{ "num_pairs": 38, "pairs": [ { "index": 1, "nt1": "///A/9", "nt2": "///A/90", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -164.297, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 52.257, "chi2": -159.034, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 55.074, "C1C1_dist": 10.759, "N1N9_dist": 9.033, "C6C8_dist": 9.943, "CNNC_torsion": -20.641, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.97],N1(imino)-N3[3.00],N2(amino)-O2(carbonyl)[2.95]", "interBase_angle": 11.090, "planarity": 0.160, "simple_Shear": -0.297, "simple_Stretch": -0.069, "simple_Buckle": 5.437, "simple_Propeller": -9.666, "bp_simpleParams": [ -0.297, -0.069, 0.307, 5.437, -9.666, -1.612 ], "bp_params": [ -0.295, -0.077, 0.307, 5.693, -9.518, -1.616 ], "frame": { "rmsd": null, "origin": [ 30.159, 36.304, 33.937 ], "x_axis": [ 0.081, -0.988, -0.133 ], "y_axis": [ 0.772, -0.022, 0.636 ], "z_axis": [ -0.631, -0.154, 0.761 ], "quaternion": [ 0.674, 0.293, -0.185, -0.652 ] } }, { "index": 2, "nt1": "///A/10", "nt2": "///A/89", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -159.428, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 52.809, "chi2": -166.722, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 53.596, "C1C1_dist": 10.697, "N1N9_dist": 8.947, "C6C8_dist": 9.855, "CNNC_torsion": -14.250, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.83],N3-N1(imino)[2.85],N4(amino)-O6(carbonyl)[2.83]", "interBase_angle": 16.293, "planarity": 0.198, "simple_Shear": 0.059, "simple_Stretch": -0.172, "simple_Buckle": 4.393, "simple_Propeller": -15.690, "bp_simpleParams": [ 0.059, -0.172, 0.042, 4.393, -15.690, -1.285 ], "bp_params": [ 0.059, -0.172, 0.042, 4.387, -15.692, -1.297 ], "frame": { "rmsd": null, "origin": [ 27.218, 35.225, 35.469 ], "x_axis": [ 0.536, -0.800, 0.268 ], "y_axis": [ 0.538, 0.569, 0.622 ], "z_axis": [ -0.650, -0.189, 0.736 ], "quaternion": [ 0.843, 0.241, -0.273, -0.397 ] } }, { "index": 3, "nt1": "///A/11", "nt2": "///A/88", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -159.222, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 53.897, "chi2": -163.628, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 55.626, "C1C1_dist": 10.596, "N1N9_dist": 8.907, "C6C8_dist": 9.877, "CNNC_torsion": -7.724, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.95],N1(imino)-N3[2.86],N2(amino)-O2(carbonyl)[2.72]", "interBase_angle": 12.718, "planarity": 0.157, "simple_Shear": -0.230, "simple_Stretch": -0.149, "simple_Buckle": -1.560, "simple_Propeller": -12.622, "bp_simpleParams": [ -0.230, -0.149, 0.052, -1.560, -12.622, 1.716 ], "bp_params": [ -0.227, -0.153, 0.052, -1.332, -12.648, 1.727 ], "frame": { "rmsd": null, "origin": [ 24.830, 32.956, 37.247 ], "x_axis": [ 0.824, -0.349, 0.446 ], "y_axis": [ 0.147, 0.892, 0.427 ], "z_axis": [ -0.547, -0.286, 0.787 ], "quaternion": [ 0.936, 0.191, -0.265, -0.133 ] } }, { "index": 4, "nt1": "///A/12", "nt2": "///A/87", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -162.976, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 57.717, "chi2": -153.635, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 52.674, "C1C1_dist": 10.675, "N1N9_dist": 9.007, "C6C8_dist": 9.968, "CNNC_torsion": -10.602, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.09],N1-N3(imino)[2.93]", "interBase_angle": 16.258, "planarity": 0.196, "simple_Shear": 0.435, "simple_Stretch": 0.033, "simple_Buckle": -2.948, "simple_Propeller": -15.989, "bp_simpleParams": [ 0.435, 0.033, 0.036, -2.948, -15.989, 0.674 ], "bp_params": [ 0.436, 0.011, 0.036, -3.737, -15.823, 0.680 ], "frame": { "rmsd": null, "origin": [ 22.825, 30.845, 39.369 ], "x_axis": [ 0.787, 0.194, 0.586 ], "y_axis": [ -0.320, 0.940, 0.118 ], "z_axis": [ -0.528, -0.280, 0.802 ], "quaternion": [ 0.939, 0.106, -0.297, 0.137 ] } }, { "index": 5, "nt1": "///A/13", "nt2": "///A/86", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -158.424, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 54.463, "chi2": -161.968, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 54.933, "C1C1_dist": 10.594, "N1N9_dist": 8.902, "C6C8_dist": 9.887, "CNNC_torsion": -15.804, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.65],N3-N1(imino)[2.83],N4(amino)-O6(carbonyl)[2.98]", "interBase_angle": 15.349, "planarity": 0.194, "simple_Shear": 0.014, "simple_Stretch": -0.141, "simple_Buckle": 1.095, "simple_Propeller": -15.310, "bp_simpleParams": [ 0.014, -0.141, 0.148, 1.095, -15.310, 2.405 ], "bp_params": [ 0.014, -0.141, 0.148, 1.149, -15.306, 2.427 ], "frame": { "rmsd": null, "origin": [ 22.039, 28.978, 41.998 ], "x_axis": [ 0.532, 0.690, 0.491 ], "y_axis": [ -0.695, 0.687, -0.211 ], "z_axis": [ -0.483, -0.229, 0.845 ], "quaternion": [ 0.875, 0.005, -0.278, 0.396 ] } }, { "index": 6, "nt1": "///A/14", "nt2": "///A/85", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -167.649, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 58.051, "chi2": -86.651, "conf2": "--", "pucker2": "~C2'-endo", "lambda2": 60.325, "C1C1_dist": 10.501, "N1N9_dist": 9.002, "C6C8_dist": 10.028, "CNNC_torsion": -9.254, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[3.04],O4(carbonyl)-N6(amino)[3.25]", "interBase_angle": 17.769, "planarity": 0.211, "simple_Shear": 0.016, "simple_Stretch": 0.144, "simple_Buckle": -13.740, "simple_Propeller": -11.268, "bp_simpleParams": [ 0.016, 0.144, 0.329, -13.740, -11.268, 3.010 ], "bp_params": [ 0.016, 0.144, 0.329, -13.783, -11.215, 3.003 ], "frame": { "rmsd": null, "origin": [ 21.298, 28.207, 45.429 ], "x_axis": [ 0.109, 0.978, 0.178 ], "y_axis": [ -0.905, 0.172, -0.389 ], "z_axis": [ -0.411, -0.119, 0.904 ], "quaternion": [ 0.739, -0.091, -0.200, 0.637 ] } }, { "index": 7, "nt1": "///A/15", "nt2": "///A/51", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -164.192, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 53.336, "chi2": -156.288, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 55.541, "C1C1_dist": 10.703, "N1N9_dist": 9.005, "C6C8_dist": 9.945, "CNNC_torsion": -14.632, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.84],N3-N1(imino)[2.94],N4(amino)-O6(carbonyl)[2.98]", "interBase_angle": 15.768, "planarity": 0.203, "simple_Shear": -0.015, "simple_Stretch": -0.075, "simple_Buckle": 6.076, "simple_Propeller": -14.551, "bp_simpleParams": [ -0.015, -0.075, 0.244, 6.076, -14.551, -0.362 ], "bp_params": [ -0.015, -0.075, 0.244, 6.183, -14.506, -0.365 ], "frame": { "rmsd": null, "origin": [ 20.522, 29.253, 48.300 ], "x_axis": [ -0.497, 0.862, -0.097 ], "y_axis": [ -0.773, -0.491, -0.402 ], "z_axis": [ -0.394, -0.124, 0.911 ], "quaternion": [ 0.480, -0.144, -0.154, 0.851 ] } }, { "index": 8, "nt1": "///A/16", "nt2": "///A/50", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -170.087, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 57.954, "chi2": -168.384, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 58.252, "C1C1_dist": 10.583, "N1N9_dist": 9.037, "C6C8_dist": 10.118, "CNNC_torsion": -12.140, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[3.31],N1(imino)-N3[3.05],N2(amino)-O2(carbonyl)[2.74]", "interBase_angle": 13.912, "planarity": 0.175, "simple_Shear": -0.191, "simple_Stretch": 0.102, "simple_Buckle": -2.287, "simple_Propeller": -13.723, "bp_simpleParams": [ -0.191, 0.102, 0.127, -2.287, -13.723, 6.179 ], "bp_params": [ -0.192, 0.099, 0.127, -2.095, -13.754, 6.223 ], "frame": { "rmsd": null, "origin": [ 19.534, 31.182, 51.664 ], "x_axis": [ -0.722, 0.498, -0.481 ], "y_axis": [ -0.426, -0.867, -0.257 ], "z_axis": [ -0.545, 0.019, 0.838 ], "quaternion": [ 0.250, -0.277, -0.064, 0.926 ] } }, { "index": 9, "nt1": "///A/16", "nt2": "///A/84", "bp": "G-A", "name": "--", "Saenger": "--", "LW": "cSS", "DSSR": "cm-m", "intra_chain": true, "chi1": -170.087, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 111.600, "chi2": -122.467, "conf2": "anti", "pucker2": "----", "lambda2": 145.252, "C1C1_dist": 5.881, "N1N9_dist": 7.651, "C6C8_dist": 10.282, "CNNC_torsion": -17.319, "hbonds_num": 2, "hbonds_desc": "O2'(hydroxyl)-O2'(hydroxyl)[2.93],N2(amino)-N3[3.13]", "interBase_angle": 18.263, "planarity": 0.241, "simple_Shear": -0.435, "simple_Stretch": 7.619, "simple_Buckle": -17.266, "simple_Propeller": 5.954, "bp_simpleParams": [ -0.435, 7.619, -1.115, -17.266, 5.954, 149.132 ], "bp_params": [ -1.879, 7.396, -1.115, -18.089, 2.517, 148.769 ], "frame": { "rmsd": null, "origin": [ 22.960, 31.294, 53.535 ], "x_axis": [ 0.135, 0.978, 0.158 ], "y_axis": [ -0.937, 0.178, -0.301 ], "z_axis": [ -0.322, -0.107, 0.941 ], "quaternion": [ 0.751, -0.064, -0.160, 0.638 ] } }, { "index": 10, "nt1": "///A/17", "nt2": "///A/49", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -163.650, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 57.081, "chi2": -163.422, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 59.402, "C1C1_dist": 10.518, "N1N9_dist": 8.982, "C6C8_dist": 10.084, "CNNC_torsion": -12.584, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[3.44],N1(imino)-N3[3.11],N2(amino)-O2(carbonyl)[2.67]", "interBase_angle": 16.766, "planarity": 0.255, "simple_Shear": -0.353, "simple_Stretch": 0.150, "simple_Buckle": -14.011, "simple_Propeller": -9.208, "bp_simpleParams": [ -0.353, 0.150, 0.367, -14.011, -9.208, 7.471 ], "bp_params": [ -0.356, 0.141, 0.367, -13.787, -9.540, 7.443 ], "frame": { "rmsd": null, "origin": [ 18.414, 32.670, 55.104 ], "x_axis": [ -0.829, -0.068, -0.555 ], "y_axis": [ 0.082, -0.997, -0.001 ], "z_axis": [ -0.553, -0.046, 0.832 ], "quaternion": [ -0.039, -0.290, -0.012, 0.956 ] } }, { "index": 11, "nt1": "///A/17", "nt2": "///A/56", "bp": "G+A", "name": "Linker", "Saenger": "--", "LW": "tSS", "DSSR": "tm+m", "intra_chain": true, "chi1": -163.650, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 89.210, "chi2": -160.028, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 60.307, "C1C1_dist": 8.062, "N1N9_dist": 7.810, "C6C8_dist": 10.105, "CNNC_torsion": 177.363, "hbonds_num": 2, "hbonds_desc": "O2'(hydroxyl)-N1[2.93],N2(amino)-N3[3.19]", "interBase_angle": 25.178, "planarity": 0.345, "simple_Shear": 7.111, "simple_Stretch": 3.943, "simple_Buckle": -24.798, "simple_Propeller": -4.358, "bp_simpleParams": [ 7.111, 3.943, -0.983, -24.798, -4.358, -150.530 ], "bp_params": [ -2.738, -7.656, -0.983, 15.798, 19.604, -150.668 ], "frame": { "rmsd": null, "origin": [ 21.767, 30.854, 57.033 ], "x_axis": [ -0.093, -0.995, -0.038 ], "y_axis": [ 0.938, -0.100, 0.331 ], "z_axis": [ -0.333, -0.004, 0.943 ], "quaternion": [ 0.661, 0.127, -0.112, -0.731 ] } }, { "index": 12, "nt1": "///A/18", "nt2": "///A/48", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -170.220, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 53.240, "chi2": -157.473, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 52.735, "C1C1_dist": 10.813, "N1N9_dist": 9.056, "C6C8_dist": 9.940, "CNNC_torsion": -15.743, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[3.03],N1(imino)-N3[3.03],N2(amino)-O2(carbonyl)[2.97]", "interBase_angle": 21.321, "planarity": 0.281, "simple_Shear": -0.146, "simple_Stretch": -0.009, "simple_Buckle": -14.813, "simple_Propeller": -15.335, "bp_simpleParams": [ -0.146, -0.009, 0.258, -14.813, -15.335, -2.448 ], "bp_params": [ -0.146, -0.009, 0.258, -14.788, -15.360, -2.450 ], "frame": { "rmsd": null, "origin": [ 16.222, 34.170, 57.541 ], "x_axis": [ -0.587, -0.595, -0.549 ], "y_axis": [ 0.458, -0.803, 0.380 ], "z_axis": [ -0.667, -0.028, 0.744 ], "quaternion": [ -0.297, -0.344, 0.099, 0.885 ] } }, { "index": 13, "nt1": "///A/19", "nt2": "///A/42", "bp": "G+G", "name": "--", "Saenger": "04-IV", "LW": "tSS", "DSSR": "tm+m", "intra_chain": true, "chi1": -138.401, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 78.598, "chi2": -148.345, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 73.550, "C1C1_dist": 8.151, "N1N9_dist": 7.964, "C6C8_dist": 10.408, "CNNC_torsion": -169.116, "hbonds_num": 2, "hbonds_desc": "N2(amino)-N3[2.83],N3-N2(amino)[2.70]", "interBase_angle": 20.145, "planarity": 0.328, "simple_Shear": 7.419, "simple_Stretch": 4.057, "simple_Buckle": 11.451, "simple_Propeller": 16.574, "bp_simpleParams": [ 7.419, 4.057, 0.633, 11.451, 16.574, -173.162 ], "bp_params": [ -3.059, -7.883, 0.633, 1.959, -20.050, -173.265 ], "frame": { "rmsd": null, "origin": [ 17.959, 37.783, 61.579 ], "x_axis": [ 0.640, -0.554, 0.533 ], "y_axis": [ 0.510, 0.825, 0.245 ], "z_axis": [ -0.575, 0.115, 0.810 ], "quaternion": [ 0.905, 0.036, -0.306, -0.294 ] } }, { "index": 14, "nt1": "///A/19", "nt2": "///A/47", "bp": "G-A", "name": "Imino", "Saenger": "08-VIII", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -138.401, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 43.415, "chi2": -159.515, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 47.473, "C1C1_dist": 12.905, "N1N9_dist": 10.861, "C6C8_dist": 11.245, "CNNC_torsion": -14.934, "hbonds_num": 2, "hbonds_desc": "O6(carbonyl)-N6(amino)[2.90],N1(imino)-N1[2.96]", "interBase_angle": 18.056, "planarity": 0.223, "simple_Shear": -0.300, "simple_Stretch": 1.517, "simple_Buckle": -3.004, "simple_Propeller": -17.804, "bp_simpleParams": [ -0.300, 1.517, -0.406, -3.004, -17.804, -17.169 ], "bp_params": [ -0.342, 1.508, -0.406, -2.481, -17.885, -17.373 ], "frame": { "rmsd": null, "origin": [ 14.135, 35.522, 59.610 ], "x_axis": [ -0.265, -0.939, -0.220 ], "y_axis": [ 0.606, -0.339, 0.719 ], "z_axis": [ -0.750, 0.057, 0.659 ], "quaternion": [ 0.514, 0.322, -0.258, -0.752 ] } }, { "index": 15, "nt1": "///A/20", "nt2": "///A/45", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -106.276, "conf1": "anti", "pucker1": "----", "lambda1": 63.436, "chi2": -73.233, "conf2": "--", "pucker2": "----", "lambda2": 54.150, "C1C1_dist": 10.410, "N1N9_dist": 8.901, "C6C8_dist": 9.952, "CNNC_torsion": 14.052, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[3.11],O4(carbonyl)-N6(amino)[3.38]", "interBase_angle": 16.550, "planarity": 0.210, "simple_Shear": 0.781, "simple_Stretch": 0.101, "simple_Buckle": 11.720, "simple_Propeller": 11.685, "bp_simpleParams": [ 0.781, 0.101, -0.292, 11.720, 11.685, 4.780 ], "bp_params": [ 0.786, 0.040, -0.292, 12.601, 10.730, 4.772 ], "frame": { "rmsd": null, "origin": [ 12.157, 35.060, 62.018 ], "x_axis": [ 0.070, -0.974, -0.216 ], "y_axis": [ 0.608, -0.129, 0.783 ], "z_axis": [ -0.791, -0.186, 0.583 ], "quaternion": [ 0.617, 0.393, -0.233, -0.641 ] } }, { "index": 16, "nt1": "///A/21", "nt2": "///A/38", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": 172.006, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 47.876, "chi2": -158.912, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 53.007, "C1C1_dist": 11.104, "N1N9_dist": 9.238, "C6C8_dist": 10.022, "CNNC_torsion": -4.362, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.98],N1(imino)-N3[3.20],N2(amino)-O2(carbonyl)[3.29]", "interBase_angle": 8.598, "planarity": 0.106, "simple_Shear": -0.479, "simple_Stretch": 0.041, "simple_Buckle": 8.522, "simple_Propeller": 1.145, "bp_simpleParams": [ -0.479, 0.041, 0.487, 8.522, 1.145, -5.981 ], "bp_params": [ -0.480, 0.020, 0.487, 8.464, 1.513, -5.965 ], "frame": { "rmsd": null, "origin": [ 14.935, 45.189, 70.860 ], "x_axis": [ -0.879, -0.059, -0.474 ], "y_axis": [ 0.097, -0.994, -0.057 ], "z_axis": [ -0.467, -0.096, 0.879 ], "quaternion": [ -0.040, -0.243, -0.039, 0.968 ] } }, { "index": 17, "nt1": "///A/21", "nt2": "///A/71", "bp": "G-U", "name": "--", "Saenger": "--", "LW": "cSS", "DSSR": "cm-m", "intra_chain": true, "chi1": 172.006, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 99.188, "chi2": -150.912, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 121.515, "C1C1_dist": 6.994, "N1N9_dist": 8.067, "C6C8_dist": 10.696, "CNNC_torsion": -40.090, "hbonds_num": 2, "hbonds_desc": "O2'(hydroxyl)-O2'(hydroxyl)[3.50],N2(amino)-O2(carbonyl)[2.57]", "interBase_angle": 40.805, "planarity": 0.460, "simple_Shear": -0.423, "simple_Stretch": 5.908, "simple_Buckle": 14.929, "simple_Propeller": -37.977, "bp_simpleParams": [ -0.423, 5.908, 1.993, 14.929, -37.977, 120.199 ], "bp_params": [ -0.963, 5.845, 1.993, 17.948, -36.646, 122.112 ], "frame": { "rmsd": null, "origin": [ 17.557, 46.867, 71.904 ], "x_axis": [ -0.245, 0.847, -0.471 ], "y_axis": [ -0.663, -0.501, -0.556 ], "z_axis": [ -0.708, 0.176, 0.684 ], "quaternion": [ 0.484, -0.378, -0.122, 0.779 ] } }, { "index": 18, "nt1": "///A/22", "nt2": "///A/37", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -165.135, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 58.840, "chi2": -171.325, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 53.043, "C1C1_dist": 10.488, "N1N9_dist": 8.852, "C6C8_dist": 9.845, "CNNC_torsion": -4.763, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.73],N3-N1(imino)[2.91],N4(amino)-O6(carbonyl)[3.00]", "interBase_angle": 11.904, "planarity": 0.133, "simple_Shear": 0.581, "simple_Stretch": -0.144, "simple_Buckle": 8.874, "simple_Propeller": -7.934, "bp_simpleParams": [ 0.581, -0.144, -0.330, 8.874, -7.934, 2.950 ], "bp_params": [ 0.573, -0.174, -0.330, 8.462, -8.372, 2.950 ], "frame": { "rmsd": null, "origin": [ 12.089, 46.422, 73.328 ], "x_axis": [ -0.586, -0.660, -0.470 ], "y_axis": [ 0.593, -0.745, 0.307 ], "z_axis": [ -0.553, -0.099, 0.827 ], "quaternion": [ -0.352, -0.288, 0.058, 0.889 ] } }, { "index": 19, "nt1": "///A/23", "nt2": "///A/36", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -160.781, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 61.106, "chi2": -172.864, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 52.028, "C1C1_dist": 10.335, "N1N9_dist": 8.729, "C6C8_dist": 9.755, "CNNC_torsion": -4.782, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.66],N3-N1(imino)[2.87],N4(amino)-O6(carbonyl)[3.04]", "interBase_angle": 10.379, "planarity": 0.167, "simple_Shear": 0.841, "simple_Stretch": -0.222, "simple_Buckle": -4.169, "simple_Propeller": -9.505, "bp_simpleParams": [ 0.841, -0.222, -0.164, -4.169, -9.505, 4.639 ], "bp_params": [ 0.820, -0.290, -0.164, -4.917, -9.141, 4.649 ], "frame": { "rmsd": null, "origin": [ 8.428, 46.315, 75.059 ], "x_axis": [ -0.037, -0.951, -0.307 ], "y_axis": [ 0.758, -0.227, 0.611 ], "z_axis": [ -0.651, -0.210, 0.729 ], "quaternion": [ 0.605, 0.339, -0.142, -0.706 ] } }, { "index": 20, "nt1": "///A/24", "nt2": "///A/35", "bp": "C-A", "name": "--", "Saenger": "--", "LW": "c.W", "DSSR": "c.-W", "intra_chain": true, "chi1": -151.163, "conf1": "anti", "pucker1": "----", "lambda1": 92.769, "chi2": -162.113, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 21.792, "C1C1_dist": 10.215, "N1N9_dist": 8.978, "C6C8_dist": 9.747, "CNNC_torsion": 3.363, "hbonds_num": 1, "hbonds_desc": "O2(carbonyl)-N6(amino)[2.19]", "interBase_angle": 3.847, "planarity": 0.066, "simple_Shear": 6.130, "simple_Stretch": 1.901, "simple_Buckle": -0.603, "simple_Propeller": -3.800, "bp_simpleParams": [ 6.130, 1.901, -0.138, -0.603, -3.800, 5.750 ], "bp_params": [ 6.014, -2.242, -0.138, -2.799, -2.639, 5.750 ], "frame": { "rmsd": null, "origin": [ 5.472, 45.697, 76.888 ], "x_axis": [ 0.569, -0.788, 0.235 ], "y_axis": [ 0.466, 0.545, 0.697 ], "z_axis": [ -0.677, -0.287, 0.678 ], "quaternion": [ 0.835, 0.295, -0.273, -0.375 ] } }, { "index": 21, "nt1": "///A/25", "nt2": "///A/36", "bp": "U-G", "name": "--", "Saenger": "--", "LW": "tHS", "DSSR": "tM-m", "intra_chain": true, "chi1": -138.444, "conf1": "anti", "pucker1": "----", "lambda1": 20.387, "chi2": -172.864, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 97.534, "C1C1_dist": 10.517, "N1N9_dist": 9.414, "C6C8_dist": 9.745, "CNNC_torsion": 78.403, "hbonds_num": 1, "hbonds_desc": "O4(carbonyl)-N2(amino)[2.78]", "interBase_angle": 63.607, "planarity": 0.634, "simple_Shear": -6.716, "simple_Stretch": 4.510, "simple_Buckle": 26.970, "simple_Propeller": -57.606, "bp_simpleParams": [ -6.716, 4.510, -0.485, 26.970, -57.606, -16.513 ], "bp_params": [ -7.577, -2.834, -0.485, 62.185, -13.376, -14.296 ], "frame": { "rmsd": null, "origin": [ 9.110, 50.654, 75.572 ], "x_axis": [ -0.202, -0.892, -0.403 ], "y_axis": [ 0.269, -0.447, 0.853 ], "z_axis": [ -0.942, 0.064, 0.330 ], "quaternion": [ -0.413, -0.478, 0.326, 0.703 ] } }, { "index": 22, "nt1": "///A/33", "nt2": "///A/34", "bp": "G-A", "name": "Platform", "Saenger": "--", "LW": "cHH", "DSSR": "cM-M", "intra_chain": true, "chi1": -6.257, "conf1": "syn", "pucker1": "----", "lambda1": 107.810, "chi2": -175.868, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 54.832, "C1C1_dist": 5.918, "N1N9_dist": 5.522, "C6C8_dist": 3.598, "CNNC_torsion": -5.549, "hbonds_num": 2, "hbonds_desc": "O2'(hydroxyl)-O5'[2.58],O2'(hydroxyl)-O4'[3.00]", "interBase_angle": 8.514, "planarity": 0.115, "simple_Shear": 5.149, "simple_Stretch": 8.269, "simple_Buckle": 4.377, "simple_Propeller": -7.303, "bp_simpleParams": [ 5.149, 8.269, -0.200, 4.377, -7.303, 90.652 ], "bp_params": [ 2.726, -9.352, -0.200, -8.360, 1.614, 90.505 ], "frame": { "rmsd": null, "origin": [ 3.493, 46.342, 80.033 ], "x_axis": [ 0.391, 0.692, 0.607 ], "y_axis": [ -0.631, 0.682, -0.370 ], "z_axis": [ -0.670, -0.238, 0.703 ], "quaternion": [ 0.833, -0.040, -0.383, 0.397 ] } }, { "index": 23, "nt1": "///A/37", "nt2": "///A/69", "bp": "G+A", "name": "--", "Saenger": "10-X", "LW": ".SW", "DSSR": ".m+W", "intra_chain": true, "chi1": -171.325, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 112.789, "chi2": -175.056, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 41.660, "C1C1_dist": 9.999, "N1N9_dist": 9.622, "C6C8_dist": 11.162, "CNNC_torsion": 98.210, "hbonds_num": 1, "hbonds_desc": "N2(amino)-N1[3.32]", "interBase_angle": 61.960, "planarity": 0.805, "simple_Shear": 2.693, "simple_Stretch": 5.176, "simple_Buckle": -30.312, "simple_Propeller": -54.039, "bp_simpleParams": [ 2.693, 5.176, -0.797, -30.312, -54.039, -85.678 ], "bp_params": [ 3.178, -4.893, -0.797, -33.393, 52.191, -89.388 ], "frame": { "rmsd": null, "origin": [ 13.762, 48.739, 74.811 ], "x_axis": [ -0.509, 0.096, -0.855 ], "y_axis": [ 0.163, 0.987, 0.014 ], "z_axis": [ 0.845, -0.133, -0.518 ], "quaternion": [ 0.490, 0.075, 0.868, -0.034 ] } }, { "index": 24, "nt1": "///A/39", "nt2": "///A/43", "bp": "U-A", "name": "rHoogsteen", "Saenger": "24-XXIV", "LW": "tWH", "DSSR": "tW-M", "intra_chain": true, "chi1": -148.050, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 32.132, "chi2": -100.631, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 17.356, "C1C1_dist": 9.597, "N1N9_dist": 7.069, "C6C8_dist": 6.117, "CNNC_torsion": -163.136, "hbonds_num": 2, "hbonds_desc": "O2(carbonyl)-N6(amino)[2.86],N3(imino)-N7[2.73]", "interBase_angle": 12.966, "planarity": 0.181, "simple_Shear": 4.448, "simple_Stretch": 1.296, "simple_Buckle": -0.136, "simple_Propeller": 12.966, "bp_simpleParams": [ 4.448, 1.296, 0.573, -0.136, 12.966, -97.242 ], "bp_params": [ 4.112, -2.134, 0.573, 8.854, 9.472, -97.267 ], "frame": { "rmsd": null, "origin": [ 17.902, 42.703, 68.768 ], "x_axis": [ -0.406, 0.904, -0.135 ], "y_axis": [ 0.872, 0.428, 0.238 ], "z_axis": [ 0.273, -0.021, -0.962 ], "quaternion": [ 0.122, 0.531, 0.836, 0.065 ] } }, { "index": 25, "nt1": "///A/41", "nt2": "///A/48", "bp": "A-C", "name": "--", "Saenger": "--", "LW": "cSS", "DSSR": "cm-m", "intra_chain": true, "chi1": -170.034, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 99.751, "chi2": -157.473, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 149.918, "C1C1_dist": 5.821, "N1N9_dist": 7.405, "C6C8_dist": 9.839, "CNNC_torsion": -27.814, "hbonds_num": 2, "hbonds_desc": "O2'(hydroxyl)-O2'(hydroxyl)[2.92],N3-O2'(hydroxyl)[2.53]", "interBase_angle": 28.669, "planarity": 0.355, "simple_Shear": -0.909, "simple_Stretch": 7.356, "simple_Buckle": -28.067, "simple_Propeller": 5.845, "bp_simpleParams": [ -0.909, 7.356, -0.729, -28.067, 5.845, 149.734 ], "bp_params": [ -2.936, 6.806, -0.729, -28.571, -2.375, 148.820 ], "frame": { "rmsd": null, "origin": [ 18.708, 36.677, 58.593 ], "x_axis": [ 0.216, -0.926, 0.309 ], "y_axis": [ 0.743, 0.361, 0.564 ], "z_axis": [ -0.634, 0.107, 0.766 ], "quaternion": [ 0.765, 0.149, -0.308, -0.545 ] } }, { "index": 26, "nt1": "///A/50", "nt2": "///A/84", "bp": "C+A", "name": "--", "Saenger": "--", "LW": "tSW", "DSSR": "tm+W", "intra_chain": true, "chi1": -168.384, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 91.646, "chi2": -122.467, "conf2": "anti", "pucker2": "----", "lambda2": 55.696, "C1C1_dist": 8.534, "N1N9_dist": 8.184, "C6C8_dist": 10.346, "CNNC_torsion": 158.255, "hbonds_num": 1, "hbonds_desc": "O2'(hydroxyl)-N1[2.56]", "interBase_angle": 31.709, "planarity": 0.374, "simple_Shear": 6.773, "simple_Stretch": 3.847, "simple_Buckle": 26.965, "simple_Propeller": -16.683, "bp_simpleParams": [ 6.773, 3.847, 0.574, 26.965, -16.683, -143.002 ], "bp_params": [ -2.117, -7.497, 0.574, -30.872, -7.239, -141.783 ], "frame": { "rmsd": null, "origin": [ 22.947, 31.384, 53.448 ], "x_axis": [ 0.208, 0.970, 0.128 ], "y_axis": [ 0.887, -0.242, 0.393 ], "z_axis": [ 0.412, 0.031, -0.910 ], "quaternion": [ 0.118, 0.768, 0.604, 0.176 ] } }, { "index": 27, "nt1": "///A/53", "nt2": "///A/84", "bp": "A+A", "name": "--", "Saenger": "02-II", "LW": "tHH", "DSSR": "tM+M", "intra_chain": true, "chi1": 62.069, "conf1": "syn", "pucker1": "----", "lambda1": 27.898, "chi2": -122.467, "conf2": "anti", "pucker2": "----", "lambda2": 15.406, "C1C1_dist": 10.744, "N1N9_dist": 8.067, "C6C8_dist": 6.056, "CNNC_torsion": 89.074, "hbonds_num": 2, "hbonds_desc": "N7-N6(amino)[2.99],N6(amino)-N7[3.70]", "interBase_angle": 31.474, "planarity": 0.456, "simple_Shear": -8.168, "simple_Stretch": 1.201, "simple_Buckle": 30.420, "simple_Propeller": -8.074, "bp_simpleParams": [ -8.168, 1.201, 0.347, 30.420, -8.074, 163.931 ], "bp_params": [ 6.284, -5.355, 0.347, -21.616, 22.876, 163.954 ], "frame": { "rmsd": null, "origin": [ 29.757, 29.133, 55.499 ], "x_axis": [ 0.251, -0.964, 0.094 ], "y_axis": [ -0.967, -0.254, -0.022 ], "z_axis": [ 0.045, -0.085, -0.995 ], "quaternion": [ 0.020, 0.791, -0.611, 0.044 ] } }, { "index": 28, "nt1": "///A/56", "nt2": "///A/83", "bp": "A-G", "name": "Sheared", "Saenger": "11-XI", "LW": "tHS", "DSSR": "tM-m", "intra_chain": true, "chi1": -160.028, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 3.721, "chi2": -152.820, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 94.988, "C1C1_dist": 9.487, "N1N9_dist": 8.274, "C6C8_dist": 8.636, "CNNC_torsion": -154.654, "hbonds_num": 3, "hbonds_desc": "N7-N2(amino)[2.84],N6(amino)-O2'(hydroxyl)[2.90],N6(amino)-N3[3.29]", "interBase_angle": 22.514, "planarity": 0.264, "simple_Shear": -7.722, "simple_Stretch": 2.633, "simple_Buckle": -7.953, "simple_Propeller": -21.063, "bp_simpleParams": [ -7.722, 2.633, 0.506, -7.953, -21.063, -9.173 ], "bp_params": [ -6.767, -4.556, 0.506, 12.024, -19.035, -9.251 ], "frame": { "rmsd": null, "origin": [ 28.994, 30.125, 58.208 ], "x_axis": [ 0.949, -0.309, 0.055 ], "y_axis": [ 0.314, 0.930, -0.193 ], "z_axis": [ 0.009, 0.200, 0.980 ], "quaternion": [ 0.982, -0.100, -0.012, -0.159 ] } }, { "index": 29, "nt1": "///A/57", "nt2": "///A/82", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -152.737, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 57.120, "chi2": 177.595, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 50.979, "C1C1_dist": 10.555, "N1N9_dist": 8.842, "C6C8_dist": 9.748, "CNNC_torsion": -8.318, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.91],N3-N1(imino)[2.93],N4(amino)-O6(carbonyl)[2.97]", "interBase_angle": 23.731, "planarity": 0.255, "simple_Shear": 0.773, "simple_Stretch": -0.168, "simple_Buckle": 16.580, "simple_Propeller": -16.979, "bp_simpleParams": [ 0.773, -0.168, -0.346, 16.580, -16.979, 0.507 ], "bp_params": [ 0.761, -0.216, -0.346, 15.483, -17.985, 0.509 ], "frame": { "rmsd": null, "origin": [ 30.607, 30.443, 61.593 ], "x_axis": [ 0.641, 0.710, -0.291 ], "y_axis": [ -0.748, 0.663, -0.029 ], "z_axis": [ 0.172, 0.236, 0.956 ], "quaternion": [ 0.903, -0.073, 0.128, 0.404 ] } }, { "index": 30, "nt1": "///A/58", "nt2": "///A/81", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -171.815, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 54.003, "chi2": -156.545, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 51.825, "C1C1_dist": 10.474, "N1N9_dist": 8.713, "C6C8_dist": 9.613, "CNNC_torsion": -16.481, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.60],N3-N1(imino)[2.64],N4(amino)-O6(carbonyl)[2.68]", "interBase_angle": 14.829, "planarity": 0.202, "simple_Shear": 0.167, "simple_Stretch": -0.421, "simple_Buckle": -1.960, "simple_Propeller": -14.699, "bp_simpleParams": [ 0.167, -0.421, 0.414, -1.960, -14.699, -1.965 ], "bp_params": [ 0.162, -0.423, 0.414, -2.141, -14.674, -1.981 ], "frame": { "rmsd": null, "origin": [ 32.716, 30.273, 65.155 ], "x_axis": [ 0.194, 0.855, -0.481 ], "y_axis": [ -0.968, 0.247, 0.048 ], "z_axis": [ 0.160, 0.456, 0.875 ], "quaternion": [ 0.761, -0.134, 0.211, 0.599 ] } }, { "index": 31, "nt1": "///A/59", "nt2": "///A/80", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -159.567, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 56.214, "chi2": -161.222, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 53.756, "C1C1_dist": 10.671, "N1N9_dist": 8.991, "C6C8_dist": 9.976, "CNNC_torsion": -18.947, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.99],O4(carbonyl)-N6(amino)[3.18]", "interBase_angle": 19.441, "planarity": 0.245, "simple_Shear": -0.014, "simple_Stretch": 0.079, "simple_Buckle": -12.255, "simple_Propeller": -15.092, "bp_simpleParams": [ -0.014, 0.079, 0.225, -12.255, -15.092, 1.880 ], "bp_params": [ -0.014, 0.079, 0.225, -12.247, -15.099, 1.885 ], "frame": { "rmsd": null, "origin": [ 34.392, 32.171, 67.680 ], "x_axis": [ -0.479, 0.755, -0.448 ], "y_axis": [ -0.866, -0.326, 0.378 ], "z_axis": [ 0.140, 0.569, 0.810 ], "quaternion": [ 0.501, -0.095, 0.293, 0.809 ] } }, { "index": 32, "nt1": "///A/60", "nt2": "///A/78", "bp": "G+G", "name": "Metal", "Saenger": "06-VI", "LW": "cWH", "DSSR": "cW+M", "intra_chain": true, "chi1": -138.276, "conf1": "anti", "pucker1": "----", "lambda1": 58.561, "chi2": -128.200, "conf2": "anti", "pucker2": "----", "lambda2": 23.982, "C1C1_dist": 11.754, "N1N9_dist": 9.678, "C6C8_dist": 9.340, "CNNC_torsion": 8.304, "hbonds_num": 2, "hbonds_desc": "N1(imino)-O6(carbonyl)[2.70],N2(amino)-N7[3.03]", "interBase_angle": 11.037, "planarity": 0.157, "simple_Shear": -2.678, "simple_Stretch": 2.365, "simple_Buckle": -9.566, "simple_Propeller": -5.505, "bp_simpleParams": [ -2.678, 2.365, 0.070, -9.566, -5.505, -97.827 ], "bp_params": [ 1.272, 3.339, 0.070, -8.512, 7.025, -97.777 ], "frame": { "rmsd": null, "origin": [ 33.225, 35.628, 68.533 ], "x_axis": [ -0.848, -0.303, 0.435 ], "y_axis": [ 0.526, -0.583, 0.620 ], "z_axis": [ 0.065, 0.754, 0.653 ], "quaternion": [ -0.236, 0.142, 0.391, 0.878 ] } }, { "index": 33, "nt1": "///A/61", "nt2": "///A/77", "bp": "A+C", "name": "--", "Saenger": "--", "LW": "tW.", "DSSR": "tW+.", "intra_chain": true, "chi1": -149.906, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 11.178, "chi2": -151.244, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 86.638, "C1C1_dist": 10.803, "N1N9_dist": 9.449, "C6C8_dist": 10.421, "CNNC_torsion": -179.944, "hbonds_num": 1, "hbonds_desc": "N6(amino)-O2(carbonyl)[2.72]", "interBase_angle": 14.902, "planarity": 0.176, "simple_Shear": 2.042, "simple_Stretch": 3.093, "simple_Buckle": -14.871, "simple_Propeller": 0.966, "bp_simpleParams": [ 2.042, 3.093, -0.291, -14.871, 0.966, 100.327 ], "bp_params": [ -2.476, 2.758, -0.291, -4.690, -14.145, 100.710 ], "frame": { "rmsd": null, "origin": [ 32.733, 37.005, 71.325 ], "x_axis": [ 0.655, 0.554, -0.513 ], "y_axis": [ 0.741, -0.340, 0.579 ], "z_axis": [ 0.146, -0.760, -0.634 ], "quaternion": [ 0.413, 0.811, 0.400, -0.113 ] } }, { "index": 34, "nt1": "///A/63", "nt2": "///A/76", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -152.595, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 54.663, "chi2": -162.050, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 55.409, "C1C1_dist": 10.433, "N1N9_dist": 8.756, "C6C8_dist": 9.745, "CNNC_torsion": -15.303, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.54],N3-N1(imino)[2.73],N4(amino)-O6(carbonyl)[2.92]", "interBase_angle": 20.252, "planarity": 0.243, "simple_Shear": 0.111, "simple_Stretch": -0.240, "simple_Buckle": 10.293, "simple_Propeller": -17.441, "bp_simpleParams": [ 0.111, -0.240, 0.124, 10.293, -17.441, 2.751 ], "bp_params": [ 0.111, -0.240, 0.124, 10.257, -17.463, 2.773 ], "frame": { "rmsd": null, "origin": [ 33.998, 39.250, 74.207 ], "x_axis": [ -0.893, 0.040, -0.449 ], "y_axis": [ -0.370, -0.633, 0.680 ], "z_axis": [ -0.257, 0.773, 0.579 ], "quaternion": [ 0.116, -0.200, 0.412, 0.881 ] } }, { "index": 35, "nt1": "///A/64", "nt2": "///A/75", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -153.885, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 56.274, "chi2": -163.235, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 61.886, "C1C1_dist": 10.390, "N1N9_dist": 8.888, "C6C8_dist": 10.018, "CNNC_torsion": -11.683, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.96],O4(carbonyl)-N6(amino)[3.43]", "interBase_angle": 18.774, "planarity": 0.220, "simple_Shear": -0.385, "simple_Stretch": 0.143, "simple_Buckle": 8.796, "simple_Propeller": -16.586, "bp_simpleParams": [ -0.385, 0.143, -0.062, 8.796, -16.586, 8.999 ], "bp_params": [ -0.392, 0.123, -0.062, 9.589, -16.140, 9.058 ], "frame": { "rmsd": null, "origin": [ 33.033, 42.639, 74.907 ], "x_axis": [ -0.950, -0.303, -0.079 ], "y_axis": [ 0.114, -0.569, 0.815 ], "z_axis": [ -0.292, 0.764, 0.575 ], "quaternion": [ -0.119, -0.106, 0.449, 0.879 ] } }, { "index": 36, "nt1": "///A/65", "nt2": "///A/74", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -163.520, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 55.606, "chi2": -166.905, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 53.419, "C1C1_dist": 10.779, "N1N9_dist": 9.081, "C6C8_dist": 10.050, "CNNC_torsion": -11.640, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[3.07],N1(imino)-N3[2.99],N2(amino)-O2(carbonyl)[2.84]", "interBase_angle": 12.329, "planarity": 0.159, "simple_Shear": 0.106, "simple_Stretch": 0.021, "simple_Buckle": 2.064, "simple_Propeller": -12.155, "bp_simpleParams": [ 0.106, 0.021, 0.064, 2.064, -12.155, 1.550 ], "bp_params": [ 0.107, 0.019, 0.064, 1.881, -12.185, 1.559 ], "frame": { "rmsd": null, "origin": [ 31.390, 45.792, 75.924 ], "x_axis": [ -0.676, -0.671, 0.305 ], "y_axis": [ 0.608, -0.274, 0.745 ], "z_axis": [ -0.417, 0.689, 0.593 ], "quaternion": [ -0.401, -0.035, 0.450, 0.797 ] } }, { "index": 37, "nt1": "///A/66", "nt2": "///A/73", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -156.040, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 55.257, "chi2": -165.601, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 53.020, "C1C1_dist": 10.570, "N1N9_dist": 8.854, "C6C8_dist": 9.793, "CNNC_torsion": -7.228, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.82],N1(imino)-N3[2.79],N2(amino)-O2(carbonyl)[2.72]", "interBase_angle": 17.736, "planarity": 0.202, "simple_Shear": 0.083, "simple_Stretch": -0.209, "simple_Buckle": -8.052, "simple_Propeller": -15.803, "bp_simpleParams": [ 0.083, -0.209, -0.279, -8.052, -15.803, 1.150 ], "bp_params": [ 0.079, -0.210, -0.279, -8.305, -15.671, 1.158 ], "frame": { "rmsd": null, "origin": [ 28.133, 47.564, 76.984 ], "x_axis": [ -0.170, -0.778, 0.605 ], "y_axis": [ 0.813, 0.236, 0.533 ], "z_axis": [ -0.557, 0.582, 0.592 ], "quaternion": [ 0.644, -0.019, -0.451, -0.618 ] } }, { "index": 38, "nt1": "///A/67", "nt2": "///A/71", "bp": "A-U", "name": "--", "Saenger": "--", "LW": "tWH", "DSSR": "tW-M", "intra_chain": true, "chi1": -171.915, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 46.481, "chi2": -150.912, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 37.918, "C1C1_dist": 11.618, "N1N9_dist": 9.647, "C6C8_dist": 8.953, "CNNC_torsion": 161.246, "hbonds_num": 1, "hbonds_desc": "N6(amino)-OP2[3.28]", "interBase_angle": 21.756, "planarity": 0.325, "simple_Shear": 5.673, "simple_Stretch": 5.409, "simple_Buckle": -21.715, "simple_Propeller": 1.335, "bp_simpleParams": [ 5.673, 5.409, -0.840, -21.715, 1.335, -96.536 ], "bp_params": [ 7.571, -2.030, -0.840, -10.175, 19.231, -97.116 ], "frame": { "rmsd": null, "origin": [ 22.545, 48.197, 75.676 ], "x_axis": [ 0.639, 0.187, 0.746 ], "y_axis": [ 0.256, 0.863, -0.435 ], "z_axis": [ -0.725, 0.469, 0.504 ], "quaternion": [ 0.867, -0.261, -0.424, -0.020 ] } } ], "num_multiplets": 7, "multiplets": [ { "index": 1, "num_nts": 3, "nts_short": "GAC", "nts_long": "///A/18,///A/41,///A/48", "planarity": 0.341 }, { "index": 2, "num_nts": 3, "nts_short": "GGA", "nts_long": "///A/19,///A/42,///A/47", "planarity": 0.397 }, { "index": 3, "num_nts": 3, "nts_short": "CGA", "nts_long": "///A/22,///A/37,///A/69", "planarity": 0.710 }, { "index": 4, "num_nts": 3, "nts_short": "CUG", "nts_long": "///A/23,///A/25,///A/36", "planarity": 0.611 }, { "index": 5, "num_nts": 4, "nts_short": "GCAA", "nts_long": "///A/16,///A/50,///A/53,///A/84", "planarity": 0.858 }, { "index": 6, "num_nts": 4, "nts_short": "GCAG", "nts_long": "///A/17,///A/49,///A/56,///A/83", "planarity": 0.807 }, { "index": 7, "num_nts": 4, "nts_short": "GCAU", "nts_long": "///A/21,///A/38,///A/67,///A/71", "planarity": 0.658 } ], "num_helices": 3, "helices": [ { "index": 1, "num_stems": 2, "strand1": "GCGACUCGGGGU", "strand2": "CGCUGAGCCCAA", "bp_type": "||||||||||.|", "helix_form": "AAAA.xA.AAx", "helical_rise": 3.048, "helical_rise_std": 0.451, "helical_radius": 9.481, "helical_radius_std": 1.526, "helical_axis": [ -0.551, -0.164, 0.818 ], "point1": [ 29.422, 34.485, 33.391 ], "point2": [ 10.888, 28.978, 60.888 ], "num_pairs": 12, "pairs": [ { "index": 1, "nt1": "///A/9", "nt2": "///A/90", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.295, -0.077, 0.307, 5.693, -9.518, -1.616 ], "step_params": [ 0.149, -1.339, 3.216, 2.316, 1.456, 37.019 ], "heli_params": [ -2.294, 0.068, 3.166, 2.290, -3.641, 37.116 ], "bp2_params": [ 0.059, -0.172, 0.042, 4.387, -15.692, -1.297 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.216, "simple_Twist": 35.077, "simple_hRise": 3.163, "simple_hTwist": 35.181 }, { "index": 2, "nt1": "///A/10", "nt2": "///A/89", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.059, -0.172, 0.042, 4.387, -15.692, -1.297 ], "step_params": [ 0.323, -1.675, 3.332, 0.511, 8.656, 31.599 ], "heli_params": [ -4.395, -0.488, 2.793, 15.532, -0.917, 32.738 ], "bp2_params": [ -0.227, -0.153, 0.052, -1.332, -12.648, 1.727 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.332, "simple_Twist": 33.029, "simple_hRise": 2.821, "simple_hTwist": 34.117 }, { "index": 3, "nt1": "///A/11", "nt2": "///A/88", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.227, -0.153, 0.052, -1.332, -12.648, 1.727 ], "step_params": [ -0.368, -1.243, 3.361, -0.476, 1.320, 32.659 ], "heli_params": [ -2.442, 0.570, 3.314, 2.347, 0.847, 32.688 ], "bp2_params": [ 0.436, 0.011, 0.036, -3.737, -15.823, 0.680 ], "groove_widths": [ 16.104, null, 18.161, null ], "simple_Rise": 3.361, "simple_Twist": 28.900, "simple_hRise": 3.307, "simple_hTwist": 28.934 }, { "index": 4, "nt1": "///A/12", "nt2": "///A/87", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.436, 0.011, 0.036, -3.737, -15.823, 0.680 ], "step_params": [ 0.083, -1.329, 3.040, -1.000, 4.535, 32.497 ], "heli_params": [ -3.055, -0.302, 2.830, 8.053, 1.775, 32.818 ], "bp2_params": [ 0.014, -0.141, 0.148, 1.149, -15.306, 2.427 ], "groove_widths": [ 16.762, 15.931, 20.261, 18.221 ], "simple_Rise": 3.040, "simple_Twist": 34.942, "simple_hRise": 2.848, "simple_hTwist": 35.240 }, { "index": 5, "nt1": "///A/13", "nt2": "///A/86", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.014, -0.141, 0.148, 1.149, -15.306, 2.427 ], "step_params": [ 0.266, -0.878, 3.475, 1.649, 8.073, 34.011 ], "heli_params": [ -2.723, -0.186, 3.198, 13.556, -2.769, 34.966 ], "bp2_params": [ 0.016, 0.144, 0.329, -13.783, -11.215, 3.003 ], "groove_widths": [ 16.987, 16.002, 12.513, 9.611 ], "simple_Rise": 3.475, "simple_Twist": 33.424, "simple_hRise": 3.191, "simple_hTwist": 34.397 }, { "index": 6, "nt1": "///A/14", "nt2": "///A/85", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.016, 0.144, 0.329, -13.783, -11.215, 3.003 ], "step_params": [ 1.297, -0.688, 2.790, 0.992, -0.473, 39.465 ], "heli_params": [ -0.971, -1.820, 2.828, -0.701, -1.468, 39.480 ], "bp2_params": [ -0.015, -0.075, 0.244, 6.183, -14.506, -0.365 ], "groove_widths": [ 15.808, 14.002, 14.163, 12.464 ], "simple_Rise": 2.790, "simple_Twist": 40.353, "simple_hRise": 2.828, "simple_hTwist": 40.367 }, { "index": 7, "nt1": "///A/15", "nt2": "///A/51", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.015, -0.075, 0.244, 6.183, -14.506, -0.365 ], "step_params": [ 0.991, -1.996, 3.324, -1.012, 12.606, 31.027 ], "heli_params": [ -5.339, -1.872, 2.327, 22.432, 1.801, 33.447 ], "bp2_params": [ -0.192, 0.099, 0.127, -2.095, -13.754, 6.223 ], "groove_widths": [ 12.994, 9.995, 15.875, 13.848 ], "simple_Rise": 3.324, "simple_Twist": 31.818, "simple_hRise": 2.355, "simple_hTwist": 34.179 }, { "index": 8, "nt1": "///A/16", "nt2": "///A/50", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.192, 0.099, 0.127, -2.095, -13.754, 6.223 ], "step_params": [ -0.586, -1.709, 3.469, -3.783, -0.246, 33.753 ], "heli_params": [ -2.884, 0.354, 3.524, -0.422, 6.490, 33.959 ], "bp2_params": [ -0.356, 0.141, 0.367, -13.787, -9.540, 7.443 ], "groove_widths": [ 13.682, 11.772, 15.867, 13.655 ], "simple_Rise": 3.469, "simple_Twist": 34.379, "simple_hRise": 3.523, "simple_hTwist": 34.582 }, { "index": 9, "nt1": "///A/17", "nt2": "///A/49", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.356, 0.141, 0.367, -13.787, -9.540, 7.443 ], "step_params": [ -0.334, -1.604, 3.211, 3.794, 7.386, 32.938 ], "heli_params": [ -3.843, 1.135, 2.743, 12.776, -6.563, 33.940 ], "bp2_params": [ -0.146, -0.009, 0.258, -14.788, -15.360, -2.450 ], "groove_widths": [ 17.095, null, 15.292, null ], "simple_Rise": 3.211, "simple_Twist": 31.517, "simple_hRise": 2.718, "simple_hTwist": 32.566 }, { "index": 10, "nt1": "///A/18", "nt2": "///A/48", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.146, -0.009, 0.258, -14.788, -15.360, -2.450 ], "step_params": [ -1.050, -0.783, 2.958, 8.369, 0.105, 33.499 ], "heli_params": [ -1.334, 2.895, 2.625, 0.178, -14.245, 34.500 ], "bp2_params": [ -0.342, 1.508, -0.406, -2.481, -17.885, -17.373 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.958, "simple_Twist": 34.490, "simple_hRise": 2.637, "simple_hTwist": 35.461 }, { "index": 11, "nt1": "///A/19", "nt2": "///A/47", "bp": "G-A", "name": "Imino", "Saenger": "08-VIII", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.342, 1.508, -0.406, -2.481, -17.885, -17.373 ], "step_params": [ 0.108, 0.677, 3.075, 1.481, 14.779, 12.627 ], "heli_params": [ -5.574, 0.440, 2.519, 49.598, -4.969, 19.472 ], "bp2_params": [ 0.786, 0.040, -0.292, 12.601, 10.730, 4.772 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.075, "simple_Twist": 6.495, "simple_hRise": 1.863, "simple_hTwist": 16.204 }, { "index": 12, "nt1": "///A/20", "nt2": "///A/45", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 2, "num_stems": 1, "strand1": "AAGGCU", "strand2": "GCCCGA", "bp_type": "..|||.", "helix_form": "x.AAx", "helical_rise": 3.052, "helical_rise_std": 0.521, "helical_radius": 7.652, "helical_radius_std": 1.810, "helical_axis": [ 0.476, 0.304, -0.825 ], "point1": [ 6.583, 41.994, 79.475 ], "point2": [ 13.856, 46.645, 66.866 ], "num_pairs": 6, "pairs": [ { "index": 1, "nt1": "///A/34", "nt2": "///A/33", "bp": "A-G", "name": "Platform", "Saenger": "--", "LW": "cHH", "DSSR": "cM-M", "bp1_params": [ -2.726, -9.352, -0.200, 8.360, 1.614, 90.505 ], "step_params": [ -0.641, 1.640, 3.336, 3.005, 1.040, 100.404 ], "heli_params": [ 1.051, 0.465, 3.334, 0.677, -1.955, 100.440 ], "bp2_params": [ -6.014, -2.242, -0.138, 2.799, -2.639, 5.750 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.336, "simple_Twist": -15.988, "simple_hRise": 3.287, "simple_hTwist": -16.300 }, { "index": 2, "nt1": "///A/35", "nt2": "///A/24", "bp": "A-C", "name": "--", "Saenger": "--", "LW": "cW.", "DSSR": "cW-.", "bp1_params": [ -6.014, -2.242, -0.138, 2.799, -2.639, 5.750 ], "step_params": [ 0.398, -0.835, 3.407, -3.912, 3.934, 48.895 ], "heli_params": [ -1.306, -0.779, 3.295, 4.735, 4.708, 49.189 ], "bp2_params": [ -0.820, -0.290, -0.164, 4.917, -9.141, 4.649 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.407, "simple_Twist": 17.406, "simple_hRise": 2.985, "simple_hTwist": 18.262 }, { "index": 3, "nt1": "///A/36", "nt2": "///A/23", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.820, -0.290, -0.164, 4.917, -9.141, 4.649 ], "step_params": [ -0.552, -1.811, 3.583, -3.488, 9.572, 36.261 ], "heli_params": [ -4.097, 0.386, 3.062, 15.018, 5.473, 37.619 ], "bp2_params": [ -0.573, -0.174, -0.330, -8.462, -8.372, 2.950 ], "groove_widths": [ 18.727, null, 14.876, null ], "simple_Rise": 3.583, "simple_Twist": 34.491, "simple_hRise": 3.029, "simple_hTwist": 35.920 }, { "index": 4, "nt1": "///A/37", "nt2": "///A/22", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.573, -0.174, -0.330, -8.462, -8.372, 2.950 ], "step_params": [ -0.484, -1.906, 3.441, -2.021, 5.351, 38.723 ], "heli_params": [ -3.500, 0.476, 3.180, 8.017, 3.028, 39.127 ], "bp2_params": [ 0.480, 0.020, 0.487, -8.464, 1.513, -5.965 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.441, "simple_Twist": 33.386, "simple_hRise": 3.129, "simple_hTwist": 33.858 }, { "index": 5, "nt1": "///A/38", "nt2": "///A/21", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.480, 0.020, 0.487, -8.464, 1.513, -5.965 ], "step_params": [ -3.017, -1.241, 2.953, 11.957, 7.025, 68.515 ], "heli_params": [ -1.292, 2.990, 2.344, 6.175, -10.511, 69.736 ], "bp2_params": [ 4.112, -2.134, 0.573, 8.854, 9.472, -97.267 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.953, "simple_Twist": 44.626, "simple_hRise": 1.921, "simple_hTwist": 46.626 }, { "index": 6, "nt1": "///A/39", "nt2": "///A/43", "bp": "U-A", "name": "rHoogsteen", "Saenger": "24-XXIV", "LW": "tWH", "DSSR": "tW-M" } ] }, { "index": 3, "num_stems": 2, "strand1": "AACCUGACUGGA", "strand2": "AGGGAGCGACCU", "bp_type": "..|||..||||.", "helix_form": "x.AAx.xAAAx", "helical_rise": 2.750, "helical_rise_std": 1.135, "helical_radius": 8.619, "helical_radius_std": 1.834, "helical_axis": [ -0.127, 0.542, 0.831 ], "point1": [ 32.183, 27.849, 55.317 ], "point2": [ 28.350, 44.244, 80.461 ], "num_pairs": 12, "pairs": [ { "index": 1, "nt1": "///A/53", "nt2": "///A/84", "bp": "A+A", "name": "--", "Saenger": "02-II", "LW": "tHH", "DSSR": "tM+M", "bp1_params": [ 6.284, -5.355, 0.347, -21.616, 22.876, 163.954 ], "step_params": [ -0.115, 0.921, 2.836, -2.766, 6.797, -122.718 ], "heli_params": [ -0.576, -0.087, 2.803, -3.871, -1.575, -122.846 ], "bp2_params": [ -6.767, -4.556, 0.506, 12.024, -19.035, -9.251 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.836, "simple_Twist": 81.829, "simple_hRise": 2.894, "simple_hTwist": 82.099 }, { "index": 2, "nt1": "///A/56", "nt2": "///A/83", "bp": "A-G", "name": "Sheared", "Saenger": "11-XI", "LW": "tHS", "DSSR": "tM-m", "bp1_params": [ -6.767, -4.556, 0.506, 12.024, -19.035, -9.251 ], "step_params": [ 1.136, -0.766, 3.505, 0.320, 9.683, 67.504 ], "heli_params": [ -1.071, -1.002, 3.387, 8.668, -0.286, 68.114 ], "bp2_params": [ 0.761, -0.216, -0.346, 15.483, -17.985, 0.509 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.505, "simple_Twist": 17.319, "simple_hRise": 2.713, "simple_hTwist": 19.827 }, { "index": 3, "nt1": "///A/57", "nt2": "///A/82", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.761, -0.216, -0.346, 15.483, -17.985, 0.509 ], "step_params": [ -0.606, -1.997, 3.579, -6.531, 11.821, 26.953 ], "heli_params": [ -6.253, -0.164, 2.572, 23.574, 13.026, 30.091 ], "bp2_params": [ 0.162, -0.423, 0.414, -2.141, -14.674, -1.981 ], "groove_widths": [ 16.180, null, 12.100, null ], "simple_Rise": 3.579, "simple_Twist": 29.546, "simple_hRise": 2.676, "simple_hTwist": 32.423 }, { "index": 4, "nt1": "///A/58", "nt2": "///A/81", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.162, -0.423, 0.414, -2.141, -14.674, -1.981 ], "step_params": [ 0.123, -1.218, 3.359, -0.050, 7.556, 39.170 ], "heli_params": [ -2.654, -0.187, 3.081, 11.144, 0.073, 39.864 ], "bp2_params": [ -0.014, 0.079, 0.225, -12.247, -15.099, 1.885 ], "groove_widths": [ 17.073, 14.705, 17.953, 17.865 ], "simple_Rise": 3.359, "simple_Twist": 39.804, "simple_hRise": 3.087, "simple_hTwist": 40.486 }, { "index": 5, "nt1": "///A/59", "nt2": "///A/80", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.014, 0.079, 0.225, -12.247, -15.099, 1.885 ], "step_params": [ 1.917, -1.562, 2.815, 12.412, 7.632, 91.424 ], "heli_params": [ -1.211, -1.121, 2.894, 5.304, -8.626, 92.323 ], "bp2_params": [ 1.272, 3.339, 0.070, -8.512, 7.025, -97.777 ], "groove_widths": [ 20.468, 18.106, 18.091, 17.874 ], "simple_Rise": 2.815, "simple_Twist": 38.680, "simple_hRise": 2.924, "simple_hTwist": 41.235 }, { "index": 6, "nt1": "///A/60", "nt2": "///A/78", "bp": "G+G", "name": "Metal", "Saenger": "06-VI", "LW": "cWH", "DSSR": "cW+M", "bp1_params": [ 1.272, 3.339, 0.070, -8.512, 7.025, -97.777 ], "step_params": [ 1.084, 0.700, 2.876, 8.672, 8.596, 16.763 ], "heli_params": [ -1.816, 0.783, 3.071, 25.534, -25.760, 20.713 ], "bp2_params": [ -2.476, 2.758, -0.291, -4.690, -14.145, 100.710 ], "groove_widths": [ 23.205, 20.653, 18.540, 16.490 ], "simple_Rise": 2.876, "simple_Twist": -26.316, "simple_hRise": 2.095, "simple_hTwist": -28.965 }, { "index": 7, "nt1": "///A/61", "nt2": "///A/77", "bp": "A+C", "name": "--", "Saenger": "--", "LW": "tW.", "DSSR": "tW+.", "bp1_params": [ -2.476, 2.758, -0.291, -4.690, -14.145, 100.710 ], "step_params": [ -1.709, 1.286, 3.220, 4.314, 5.659, -70.455 ], "heli_params": [ -1.304, -1.328, 3.209, -4.893, 3.729, -70.767 ], "bp2_params": [ 0.111, -0.240, 0.124, 10.257, -17.463, 2.773 ], "groove_widths": [ 20.247, 16.381, 20.903, 19.799 ], "simple_Rise": 3.220, "simple_Twist": 25.510, "simple_hRise": 3.102, "simple_hTwist": 26.468 }, { "index": 8, "nt1": "///A/63", "nt2": "///A/76", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.111, -0.240, 0.124, 10.257, -17.463, 2.773 ], "step_params": [ 0.268, -1.451, 3.275, -0.370, 2.052, 29.332 ], "heli_params": [ -3.292, -0.607, 3.165, 4.046, 0.729, 29.405 ], "bp2_params": [ -0.392, 0.123, -0.062, 9.589, -16.140, 9.058 ], "groove_widths": [ 16.856, 14.037, 21.029, 20.978 ], "simple_Rise": 3.275, "simple_Twist": 32.057, "simple_hRise": 3.175, "simple_hTwist": 32.123 }, { "index": 9, "nt1": "///A/64", "nt2": "///A/75", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.392, 0.123, -0.062, 9.589, -16.140, 9.058 ], "step_params": [ -0.089, -1.257, 3.476, -0.081, 8.428, 33.774 ], "heli_params": [ -3.412, 0.137, 3.083, 14.233, 0.136, 34.780 ], "bp2_params": [ 0.107, 0.019, 0.064, 1.881, -12.185, 1.559 ], "groove_widths": [ 16.425, null, 13.954, null ], "simple_Rise": 3.476, "simple_Twist": 30.883, "simple_hRise": 3.037, "simple_hTwist": 31.986 }, { "index": 10, "nt1": "///A/65", "nt2": "///A/74", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.107, 0.019, 0.064, 1.881, -12.185, 1.559 ], "step_params": [ 0.554, -1.821, 3.353, 5.928, 8.202, 33.860 ], "heli_params": [ -4.190, -0.056, 2.900, 13.707, -9.907, 35.298 ], "bp2_params": [ 0.079, -0.210, -0.279, -8.305, -15.671, 1.158 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.353, "simple_Twist": 33.638, "simple_hRise": 2.896, "simple_hTwist": 35.085 }, { "index": 11, "nt1": "///A/66", "nt2": "///A/73", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.079, -0.210, -0.279, -8.305, -15.671, 1.158 ], "step_params": [ -3.364, -3.414, 3.220, 11.688, -4.922, 78.998 ], "heli_params": [ -2.535, 2.917, 2.956, -3.846, -9.134, 79.844 ], "bp2_params": [ 7.571, -2.030, -0.840, -10.175, 19.231, -97.116 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.220, "simple_Twist": 38.919, "simple_hRise": 2.544, "simple_hTwist": 40.857 }, { "index": 12, "nt1": "///A/67", "nt2": "///A/71", "bp": "A-U", "name": "--", "Saenger": "--", "LW": "tWH", "DSSR": "tW-M" } ] } ], "num_stems": 5, "stems": [ { "index": 1, "helix_index": 1, "strand1": "GCGACU", "strand2": "CGCUGA", "bp_type": "||||||", "helix_form": "AAAA.", "helical_rise": 2.866, "helical_rise_std": 0.207, "helical_radius": 9.441, "helical_radius_std": 0.652, "helical_axis": [ -0.548, -0.103, 0.830 ], "point1": [ 30.309, 32.384, 34.033 ], "point2": [ 22.509, 30.913, 45.841 ], "num_pairs": 6, "pairs": [ { "index": 1, "nt1": "///A/9", "nt2": "///A/90", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.295, -0.077, 0.307, 5.693, -9.518, -1.616 ], "step_params": [ 0.149, -1.339, 3.216, 2.316, 1.456, 37.019 ], "heli_params": [ -2.294, 0.068, 3.166, 2.290, -3.641, 37.116 ], "bp2_params": [ 0.059, -0.172, 0.042, 4.387, -15.692, -1.297 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.216, "simple_Twist": 35.077, "simple_hRise": 3.163, "simple_hTwist": 35.181 }, { "index": 2, "nt1": "///A/10", "nt2": "///A/89", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.059, -0.172, 0.042, 4.387, -15.692, -1.297 ], "step_params": [ 0.323, -1.675, 3.332, 0.511, 8.656, 31.599 ], "heli_params": [ -4.395, -0.488, 2.793, 15.532, -0.917, 32.738 ], "bp2_params": [ -0.227, -0.153, 0.052, -1.332, -12.648, 1.727 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.332, "simple_Twist": 33.029, "simple_hRise": 2.821, "simple_hTwist": 34.117 }, { "index": 3, "nt1": "///A/11", "nt2": "///A/88", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.227, -0.153, 0.052, -1.332, -12.648, 1.727 ], "step_params": [ -0.368, -1.243, 3.361, -0.476, 1.320, 32.659 ], "heli_params": [ -2.442, 0.570, 3.314, 2.347, 0.847, 32.688 ], "bp2_params": [ 0.436, 0.011, 0.036, -3.737, -15.823, 0.680 ], "groove_widths": [ 16.104, null, 18.161, null ], "simple_Rise": 3.361, "simple_Twist": 28.900, "simple_hRise": 3.307, "simple_hTwist": 28.934 }, { "index": 4, "nt1": "///A/12", "nt2": "///A/87", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.436, 0.011, 0.036, -3.737, -15.823, 0.680 ], "step_params": [ 0.083, -1.329, 3.040, -1.000, 4.535, 32.497 ], "heli_params": [ -3.055, -0.302, 2.830, 8.053, 1.775, 32.818 ], "bp2_params": [ 0.014, -0.141, 0.148, 1.149, -15.306, 2.427 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.040, "simple_Twist": 34.942, "simple_hRise": 2.848, "simple_hTwist": 35.240 }, { "index": 5, "nt1": "///A/13", "nt2": "///A/86", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.014, -0.141, 0.148, 1.149, -15.306, 2.427 ], "step_params": [ 0.266, -0.878, 3.475, 1.649, 8.073, 34.011 ], "heli_params": [ -2.723, -0.186, 3.198, 13.556, -2.769, 34.966 ], "bp2_params": [ 0.016, 0.144, 0.329, -13.783, -11.215, 3.003 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.475, "simple_Twist": 33.424, "simple_hRise": 3.191, "simple_hTwist": 34.397 }, { "index": 6, "nt1": "///A/14", "nt2": "///A/85", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 2, "helix_index": 1, "strand1": "CGGG", "strand2": "GCCC", "bp_type": "||||", "helix_form": "A.A", "helical_rise": 2.488, "helical_rise_std": 0.249, "helical_radius": 9.381, "helical_radius_std": 0.551, "helical_axis": [ -0.542, -0.254, 0.801 ], "point1": [ 17.717, 33.380, 48.194 ], "point2": [ 13.749, 31.524, 54.063 ], "num_pairs": 4, "pairs": [ { "index": 1, "nt1": "///A/15", "nt2": "///A/51", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.015, -0.075, 0.244, 6.183, -14.506, -0.365 ], "step_params": [ 0.991, -1.996, 3.324, -1.012, 12.606, 31.027 ], "heli_params": [ -5.339, -1.872, 2.327, 22.432, 1.801, 33.447 ], "bp2_params": [ -0.192, 0.099, 0.127, -2.095, -13.754, 6.223 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.324, "simple_Twist": 31.818, "simple_hRise": 2.355, "simple_hTwist": 34.179 }, { "index": 2, "nt1": "///A/16", "nt2": "///A/50", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.192, 0.099, 0.127, -2.095, -13.754, 6.223 ], "step_params": [ -0.586, -1.709, 3.469, -3.783, -0.246, 33.753 ], "heli_params": [ -2.884, 0.354, 3.524, -0.422, 6.490, 33.959 ], "bp2_params": [ -0.356, 0.141, 0.367, -13.787, -9.540, 7.443 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.469, "simple_Twist": 34.379, "simple_hRise": 3.523, "simple_hTwist": 34.582 }, { "index": 3, "nt1": "///A/17", "nt2": "///A/49", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.356, 0.141, 0.367, -13.787, -9.540, 7.443 ], "step_params": [ -0.334, -1.604, 3.211, 3.794, 7.386, 32.938 ], "heli_params": [ -3.843, 1.135, 2.743, 12.776, -6.563, 33.940 ], "bp2_params": [ -0.146, -0.009, 0.258, -14.788, -15.360, -2.450 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.211, "simple_Twist": 31.517, "simple_hRise": 2.718, "simple_hTwist": 32.566 }, { "index": 4, "nt1": "///A/18", "nt2": "///A/48", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 3, "helix_index": 2, "strand1": "GCC", "strand2": "CGG", "bp_type": "|||", "helix_form": "A.", "helical_rise": 1.188, "helical_rise_std": 0.264, "helical_radius": 8.015, "helical_radius_std": 0.726, "helical_axis": [ -0.129, -0.521, 0.844 ], "point1": [ 9.884, 43.641, 70.205 ], "point2": [ 9.622, 42.583, 71.919 ], "num_pairs": 3, "pairs": [ { "index": 1, "nt1": "///A/21", "nt2": "///A/38", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.480, 0.020, 0.487, 8.464, 1.513, -5.965 ], "step_params": [ 0.484, -1.906, 3.441, 2.021, 5.351, 38.723 ], "heli_params": [ -3.500, -0.476, 3.180, 8.017, -3.028, 39.127 ], "bp2_params": [ 0.573, -0.174, -0.330, 8.462, -8.372, 2.950 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.441, "simple_Twist": 33.386, "simple_hRise": 3.129, "simple_hTwist": 33.858 }, { "index": 2, "nt1": "///A/22", "nt2": "///A/37", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.573, -0.174, -0.330, 8.462, -8.372, 2.950 ], "step_params": [ 0.552, -1.811, 3.583, 3.488, 9.572, 36.261 ], "heli_params": [ -4.097, -0.386, 3.062, 15.018, -5.473, 37.619 ], "bp2_params": [ 0.820, -0.290, -0.164, -4.917, -9.141, 4.649 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.583, "simple_Twist": 34.491, "simple_hRise": 3.029, "simple_hTwist": 35.920 }, { "index": 3, "nt1": "///A/23", "nt2": "///A/36", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 4, "helix_index": 3, "strand1": "CCU", "strand2": "GGA", "bp_type": "|||", "helix_form": "AA", "helical_rise": 2.274, "helical_rise_std": 0.117, "helical_radius": 8.453, "helical_radius_std": 1.005, "helical_axis": [ -0.120, 0.431, 0.894 ], "point1": [ 33.766, 32.622, 61.799 ], "point2": [ 33.234, 34.526, 65.746 ], "num_pairs": 3, "pairs": [ { "index": 1, "nt1": "///A/57", "nt2": "///A/82", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.761, -0.216, -0.346, 15.483, -17.985, 0.509 ], "step_params": [ -0.606, -1.997, 3.579, -6.531, 11.821, 26.953 ], "heli_params": [ -6.253, -0.164, 2.572, 23.574, 13.026, 30.091 ], "bp2_params": [ 0.162, -0.423, 0.414, -2.141, -14.674, -1.981 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.579, "simple_Twist": 29.546, "simple_hRise": 2.676, "simple_hTwist": 32.423 }, { "index": 2, "nt1": "///A/58", "nt2": "///A/81", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.162, -0.423, 0.414, -2.141, -14.674, -1.981 ], "step_params": [ 0.123, -1.218, 3.359, -0.050, 7.556, 39.170 ], "heli_params": [ -2.654, -0.187, 3.081, 11.144, 0.073, 39.864 ], "bp2_params": [ -0.014, 0.079, 0.225, -12.247, -15.099, 1.885 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.359, "simple_Twist": 39.804, "simple_hRise": 3.087, "simple_hTwist": 40.486 }, { "index": 3, "nt1": "///A/59", "nt2": "///A/80", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 5, "helix_index": 3, "strand1": "CUGG", "strand2": "GACC", "bp_type": "||||", "helix_form": "AAA", "helical_rise": 2.279, "helical_rise_std": 0.201, "helical_radius": 8.787, "helical_radius_std": 0.624, "helical_axis": [ -0.272, 0.507, 0.818 ], "point1": [ 30.088, 40.312, 73.140 ], "point2": [ 28.291, 43.664, 78.554 ], "num_pairs": 4, "pairs": [ { "index": 1, "nt1": "///A/63", "nt2": "///A/76", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.111, -0.240, 0.124, 10.257, -17.463, 2.773 ], "step_params": [ 0.268, -1.451, 3.275, -0.370, 2.052, 29.332 ], "heli_params": [ -3.292, -0.607, 3.165, 4.046, 0.729, 29.405 ], "bp2_params": [ -0.392, 0.123, -0.062, 9.589, -16.140, 9.058 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.275, "simple_Twist": 32.057, "simple_hRise": 3.175, "simple_hTwist": 32.123 }, { "index": 2, "nt1": "///A/64", "nt2": "///A/75", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.392, 0.123, -0.062, 9.589, -16.140, 9.058 ], "step_params": [ -0.089, -1.257, 3.476, -0.081, 8.428, 33.774 ], "heli_params": [ -3.412, 0.137, 3.083, 14.233, 0.136, 34.780 ], "bp2_params": [ 0.107, 0.019, 0.064, 1.881, -12.185, 1.559 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.476, "simple_Twist": 30.883, "simple_hRise": 3.037, "simple_hTwist": 31.986 }, { "index": 3, "nt1": "///A/65", "nt2": "///A/74", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.107, 0.019, 0.064, 1.881, -12.185, 1.559 ], "step_params": [ 0.554, -1.821, 3.353, 5.928, 8.202, 33.860 ], "heli_params": [ -4.190, -0.056, 2.900, 13.707, -9.907, 35.298 ], "bp2_params": [ 0.079, -0.210, -0.279, -8.305, -15.671, 1.158 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.353, "simple_Twist": 33.638, "simple_hRise": 2.896, "simple_hTwist": 35.085 }, { "index": 4, "nt1": "///A/66", "nt2": "///A/73", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] } ], "num_isoCanonPairs": 1, "isoCanonPairs": [ { "index": -1, "helix_index": 1, "nt1": "///A/20", "nt2": "///A/45", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W" } ], "num_coaxStacks": 2, "coaxStacks": [ { "index": 1, "helix_index": 1, "num_stems": 2, "stem_indices": [ 1, 2 ] }, { "index": 2, "helix_index": 3, "num_stems": 2, "stem_indices": [ 4, 5 ] } ], "num_stacks": 15, "stacks": [ { "index": 1, "num_nts": 2, "nts_short": "UC", "nts_long": "///A/14,///A/15" }, { "index": 2, "num_nts": 2, "nts_short": "GA", "nts_long": "///A/21,///A/43" }, { "index": 3, "num_nts": 2, "nts_short": "AG", "nts_long": "///A/41,///A/42" }, { "index": 4, "num_nts": 2, "nts_short": "GA", "nts_long": "///A/51,///A/85" }, { "index": 5, "num_nts": 3, "nts_short": "GGU", "nts_long": "///A/18,///A/19,///A/20" }, { "index": 6, "num_nts": 3, "nts_short": "AAG", "nts_long": "///A/34,///A/35,///A/36" }, { "index": 7, "num_nts": 3, "nts_short": "CUG", "nts_long": "///A/38,///A/39,///A/40" }, { "index": 8, "num_nts": 3, "nts_short": "CAA", "nts_long": "///A/57,///A/56,///A/84" }, { "index": 9, "num_nts": 3, "nts_short": "GAU", "nts_long": "///A/66,///A/67,///A/68" }, { "index": 10, "num_nts": 3, "nts_short": "GCG", "nts_long": "///A/76,///A/77,///A/78" }, { "index": 11, "num_nts": 4, "nts_short": "AAAC", "nts_long": "///A/44,///A/45,///A/47,///A/48" }, { "index": 12, "num_nts": 4, "nts_short": "UAGG", "nts_long": "///A/52,///A/53,///A/83,///A/82" }, { "index": 13, "num_nts": 4, "nts_short": "UGAC", "nts_long": "///A/59,///A/60,///A/61,///A/63" }, { "index": 14, "num_nts": 4, "nts_short": "AAUC", "nts_long": "///A/69,///A/70,///A/71,///A/73" }, { "index": 15, "num_nts": 6, "nts_short": "CCGUGC", "nts_long": "///A/23,///A/24,///A/33,///A/32,///A/31,///A/30" } ], "nonStack": { "num_nts": 4, "nts_short": "UUGa", "nts_long": "///A/25,///A/62,///A/72,///A/91" }, "num_atom2bases": 7, "atom2bases": [ { "index": 1, "type": "phosphate", "atom": "///A/42/OP2", "nt": "///A/40", "vert_dist": 3.175 }, { "index": 2, "type": "other", "atom": "///A/114/N3'", "nt": "///A/42", "vert_dist": 3.335 }, { "index": 3, "type": "other", "atom": "///A/114/N3'", "nt": "///A/43", "vert_dist": 3.422 }, { "index": 4, "type": "sugar", "atom": "///A/44/O4'", "nt": "///A/45", "vert_dist": 2.936 }, { "index": 5, "type": "sugar", "atom": "///A/52/O4'", "nt": "///A/53", "vert_dist": 3.114 }, { "index": 6, "type": "phosphate", "atom": "///A/70/OP2", "nt": "///A/68", "vert_dist": 2.934 }, { "index": 7, "type": "sugar", "atom": "///A/51/O4'", "nt": "///A/84", "vert_dist": 2.926 } ], "num_hairpins": 1, "hairpins": [ { "index": 1, "type": "hairpin loop", "bridging_nts": [ 6 ], "stem_indices": [ 5 ], "summary": "[1] 6 [A.66 A.73] 4", "num_nts": 8, "nts_short": "GAUAAUGC", "nts_long": "///A/66,///A/67,///A/68,///A/69,///A/70,///A/71,///A/72,///A/73", "num_stems": 1, "bridges": [ { "index": 1, "num_nts": 6, "nts_short": "AUAAUG", "nts_long": "///A/67,///A/68,///A/69,///A/70,///A/71,///A/72" } ] } ], "num_bulges": 1, "bulges": [ { "index": 1, "type": "bulge", "bridging_nts": [ 0, 6 ], "stem_indices": [ -1, 3 ], "summary": "[2] 0 6 [A.20 A.45 A.21 A.38] 1 3", "num_nts": 10, "nts_short": "UGCUGAGAAA", "nts_long": "///A/20,///A/21,///A/38,///A/39,///A/40,///A/41,///A/42,///A/43,///A/44,///A/45", "num_stems": 2, "bridges": [ { "index": 1, "num_nts": 0, "nts_short": "", "nts_long": "" }, { "index": 2, "num_nts": 6, "nts_short": "UGAGAA", "nts_long": "///A/39,///A/40,///A/41,///A/42,///A/43,///A/44" } ] } ], "num_iloops": 2, "iloops": [ { "index": 1, "type": "asymmetric internal loop", "bridging_nts": [ 1, 2 ], "stem_indices": [ 2, -1 ], "summary": "[2] 1 2 [A.18 A.48 A.20 A.45] 4 1", "num_nts": 7, "nts_short": "GGUAUAC", "nts_long": "///A/18,///A/19,///A/20,///A/45,///A/46,///A/47,///A/48", "num_stems": 2, "bridges": [ { "index": 1, "num_nts": 1, "nts_short": "G", "nts_long": "///A/19" }, { "index": 2, "num_nts": 2, "nts_short": "UA", "nts_long": "///A/46,///A/47" } ] }, { "index": 2, "type": "symmetric internal loop", "bridging_nts": [ 3, 3 ], "stem_indices": [ 4, 5 ], "summary": "[2] 3 3 [A.59 A.80 A.63 A.76] 3 4", "num_nts": 10, "nts_short": "UGAUCGCGUA", "nts_long": "///A/59,///A/60,///A/61,///A/62,///A/63,///A/76,///A/77,///A/78,///A/79,///A/80", "num_stems": 2, "bridges": [ { "index": 1, "num_nts": 3, "nts_short": "GAU", "nts_long": "///A/60,///A/61,///A/62" }, { "index": 2, "num_nts": 3, "nts_short": "CGU", "nts_long": "///A/77,///A/78,///A/79" } ] } ], "num_junctions": 1, "junctions": [ { "index": 1, "type": "3-way junction", "bridging_nts": [ 0, 5, 2 ], "stem_indices": [ 1, 2, 4 ], "summary": "[3] 0 5 2 [A.14 A.85 A.15 A.51 A.57 A.82] 6 4 3", "num_nts": 13, "nts_short": "UCGUAUCACGGAA", "nts_long": "///A/14,///A/15,///A/51,///A/52,///A/53,///A/54,///A/55,///A/56,///A/57,///A/82,///A/83,///A/84,///A/85", "num_stems": 3, "bridges": [ { "index": 1, "num_nts": 0, "nts_short": "", "nts_long": "" }, { "index": 2, "num_nts": 5, "nts_short": "UAUCA", "nts_long": "///A/52,///A/53,///A/54,///A/55,///A/56" }, { "index": 3, "num_nts": 2, "nts_short": "GA", "nts_long": "///A/83,///A/84" } ] } ], "num_ssSegments": 2, "ssSegments": [ { "index": 1, "is_broken": true, "num_nts": 8, "nts_short": "CUCGUGAA", "nts_long": "///A/24,///A/25,///A/30,///A/31,///A/32,///A/33,///A/34,///A/35" }, { "index": 2, "num_nts": 1, "nts_short": "a", "nts_long": "///A/91" } ], "num_Aminors": 6, "Aminors": [ { "index": 1, "type": "II", "desc_short": "A vs G-C (WC)", "desc_long": "///A/41 vs ///A/18,///A/48", "A_nt1": { "desc": "///A/41 vs ///A/18", "face_type": "+", "hbonds_num": 0, "hbonds_desc": "" }, "A_nt2": { "desc": "///A/41 vs ///A/48", "face_type": "-", "hbonds_num": 2, "hbonds_desc": "O2'(hydroxyl)-O2'(hydroxyl)[2.92],N3-O2'(hydroxyl)[2.53]" } }, { "index": 2, "type": "X", "desc_short": "A vs G-C (WC)", "desc_long": "///A/43 vs ///A/21,///A/38", "A_nt1": { "desc": "///A/43 vs ///A/21", "face_type": "+", "hbonds_num": 1, "hbonds_desc": "O2'(hydroxyl)-N7[2.63]" }, "A_nt2": { "desc": "///A/43 vs ///A/38", "face_type": "-", "hbonds_num": 0, "hbonds_desc": "" } }, { "index": 3, "type": "I", "desc_short": "A vs G-C (WC)", "desc_long": "///A/56 vs ///A/17,///A/49", "A_nt1": { "desc": "///A/56 vs ///A/17", "face_type": "+", "hbonds_num": 2, "hbonds_desc": "N1-O2'(hydroxyl)[2.93],N3-N2(amino)[3.19]" }, "A_nt2": { "desc": "///A/56 vs ///A/49", "face_type": "-", "hbonds_num": 1, "hbonds_desc": "O2'(hydroxyl)-O2'(hydroxyl)[3.06]" } }, { "index": 4, "type": "X", "desc_short": "A vs C-G (WC)", "desc_long": "///A/69 vs ///A/22,///A/37", "A_nt1": { "desc": "///A/69 vs ///A/22", "face_type": "-", "hbonds_num": 0, "hbonds_desc": "" }, "A_nt2": { "desc": "///A/69 vs ///A/37", "face_type": "+", "hbonds_num": 1, "hbonds_desc": "N1-N2(amino)[3.32]" } }, { "index": 5, "type": "II", "desc_short": "A vs C-G (WC)", "desc_long": "///A/70 vs ///A/22,///A/37", "A_nt1": { "desc": "///A/70 vs ///A/22", "face_type": "-", "hbonds_num": 3, "hbonds_desc": "O2'(hydroxyl)-O3'[3.01],O2'(hydroxyl)-O2'(hydroxyl)[2.64],N3-O2'(hydroxyl)[2.81]" }, "A_nt2": { "desc": "///A/70 vs ///A/37", "face_type": "+", "hbonds_num": 0, "hbonds_desc": "" } }, { "index": 6, "type": "I", "desc_short": "A vs G-C (WC)", "desc_long": "///A/84 vs ///A/16,///A/50", "A_nt1": { "desc": "///A/84 vs ///A/16", "face_type": "-", "hbonds_num": 2, "hbonds_desc": "O2'(hydroxyl)-O2'(hydroxyl)[2.93],N3-N2(amino)[3.13]" }, "A_nt2": { "desc": "///A/84 vs ///A/50", "face_type": "+", "hbonds_num": 1, "hbonds_desc": "N1-O2'(hydroxyl)[2.56]" } } ], "num_riboseZippers": 1, "riboseZippers": [ { "index": 1, "num_nts": 4, "nts_short": "GCAU", "nts_long": "///A/21,///A/22,///A/70,///A/71" } ], "num_splayUnits": 5, "splayUnits": [ { "index": 1, "num_nts": 2, "nts_short": "UG", "nts_long": "///A/20,///A/21" }, { "index": 2, "num_nts": 2, "nts_short": "GU", "nts_long": "///A/51,///A/52" }, { "index": 3, "num_nts": 3, "nts_short": "AUC", "nts_long": "///A/61,///A/62,///A/63" }, { "index": 4, "num_nts": 3, "nts_short": "UGC", "nts_long": "///A/71,///A/72,///A/73" }, { "index": 5, "num_nts": 2, "nts_short": "Ca", "nts_long": "///A/90,///A/91" } ], "dbn": { "all_chains": { "num_nts": 79, "num_chars": 80, "bseq": "GCGACUCGGGGUGCCCU&CGUGAAGGCUGAGAAAUACCCGUAUCACCUGAUCUGGAUAAUGCCAGCGUAGGGAAGUCGCa", "bseqUP": "GCGACUCGGGGUGCCCU&CGUGAAGGCUGAGAAAUACCCGUAUCACCUGAUCUGGAUAAUGCCAGCGUAGGGAAGUCGCA", "sstr": "((((((((((.((((..&......)))......)..)))).....(((...((((......))))...)))..)))))).", "form": "AAAAAAAAA...AA..-&A.....AAA......--AAAA..---.AA....AAAAA.AA..AAA..--AA...BAAAA.-" }, "chain_A": { "num_nts": 79, "num_chars": 80, "bseq": "GCGACUCGGGGUGCCCU&CGUGAAGGCUGAGAAAUACCCGUAUCACCUGAUCUGGAUAAUGCCAGCGUAGGGAAGUCGCa", "bseqUP": "GCGACUCGGGGUGCCCU&CGUGAAGGCUGAGAAAUACCCGUAUCACCUGAUCUGGAUAAUGCCAGCGUAGGGAAGUCGCA", "sstr": "((((((((((.((((..&......)))......)..)))).....(((...((((......))))...)))..)))))).", "form": "AAAAAAAAA...AA..-&A.....AAA......--AAAA..---.AA....AAAAA.AA..AAA..--AA...BAAAA.-" } }, "chains": { "chain_A": { "num_nts": 79, "bseq": "GCGACUCGGGGUGCCCU&CGUGAAGGCUGAGAAAUACCCGUAUCACCUGAUCUGGAUAAUGCCAGCGUAGGGAAGUCGCa", "sstr": "((((((((((.((((..&......)))......)..)))).....(((...((((......))))...)))..)))))).", "form": "AAAAAAAAA...AA..-&A.....AAA......--AAAA..---.AA....AAAAA.AA..AAA..--AA...BAAAA.-", "helical_rise": 0.133, "helical_rise_std": 3.248, "helical_axis": [ -0.544, 0.812, -0.211 ], "point1": [ 19.180, 35.574, 64.048 ], "point2": [ 13.921, 43.433, 62.006 ], "num_chars": 235, "suite": "G1aC1aG1aA1aC1aU1aC1aG1aG1cG1aG!!U5nG1aC1aC1aC!!U..C1cG1cU!!G1aA1aA1aG1aG1aC1aU1aG1gA1aG1mA!!A!!A!!U!!A1aC1aC1aC1aG3aU!!A!!U!!C7dA1aC1aC1aU1aG!!A!!U!!C1aU1aG1aG1cA1aU1gA1aA1aU1gG!!C1aC1aA1aG1aC!!G!!U!!A1aG1cG1aG7aA!!A!!G1aU1aC1aG1aC!!a" } }, "num_nts": 79, "nts": [ { "index": 1, "index_chain": 1, "chain_name": "A", "nt_resnum": 9, "nt_name": "G", "nt_code": "G", "nt_id": "///A/9", "linked_nts": [ null, "///A/10" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack", "alpha": null, "beta": null, "gamma": 61.650, "delta": 84.091, "epsilon": -150.553, "zeta": -72.121, "epsilon_zeta": -78.432, "bb_type": "BI", "chi": -164.297, "glyco_bond": "anti", "C5prime_xyz": [ -1.389, 8.685, 0.679 ], "P_xyz": [ null, null, null ], "form": "A", "ssZp": 4.343, "Dp": 4.634, "splay_angle": 21.678, "splay_distance": 3.416, "splay_ratio": 0.190, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": 4.489, "v1": -28.075, "v2": 39.580, "v3": -37.993, "v4": 21.147, "amplitude": 40.511, "phase_angle": 12.307, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.012, "frame": { "rmsd": 0.012, "origin": [ 30.020, 36.427, 34.048 ], "x_axis": [ 0.016, -0.997, -0.080 ], "y_axis": [ 0.740, -0.042, 0.672 ], "z_axis": [ -0.673, -0.070, 0.736 ], "quaternion": [ 0.654, 0.284, -0.227, -0.664 ] } }, { "index": 2, "index_chain": 2, "chain_name": "A", "nt_resnum": 10, "nt_name": "C", "nt_code": "C", "nt_id": "///A/10", "linked_nts": [ "///A/9", "///A/11" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -66.259, "beta": 172.836, "gamma": 53.278, "delta": 81.845, "epsilon": -154.411, "zeta": -68.485, "epsilon_zeta": -85.926, "bb_type": "BI", "chi": -159.428, "glyco_bond": "anti", "C5prime_xyz": [ -1.221, 8.763, 0.481 ], "P_xyz": [ 1.386, 9.116, 0.413 ], "form": "A", "ssZp": 4.481, "Dp": 4.638, "splay_angle": 23.542, "splay_distance": 3.753, "splay_ratio": 0.207, "d22": null, "d64": null, "eta": 164.196, "theta": -144.041, "eta_prime": 179.636, "theta_prime": -143.663, "eta_base": -131.362, "theta_base": -118.465, "v0": 3.217, "v1": -27.195, "v2": 39.621, "v3": -38.559, "v4": 22.347, "amplitude": 40.841, "phase_angle": 14.040, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.976, "filter_rmsd": 0.063, "frame": { "rmsd": 0.004, "origin": [ 27.174, 35.148, 35.439 ], "x_axis": [ 0.435, -0.826, 0.357 ], "y_axis": [ 0.516, 0.554, 0.653 ], "z_axis": [ -0.738, -0.100, 0.668 ], "quaternion": [ 0.815, 0.231, -0.336, -0.412 ] } }, { "index": 3, "index_chain": 3, "chain_name": "A", "nt_resnum": 11, "nt_name": "G", "nt_code": "G", "nt_id": "///A/11", "linked_nts": [ "///A/10", "///A/12" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -63.030, "beta": 178.534, "gamma": 51.554, "delta": 83.679, "epsilon": -165.098, "zeta": -68.519, "epsilon_zeta": -96.579, "bb_type": "BI", "chi": -159.222, "glyco_bond": "anti", "C5prime_xyz": [ -1.346, 8.791, 0.506 ], "P_xyz": [ 1.219, 9.277, 0.762 ], "form": "A", "ssZp": 4.436, "Dp": 4.482, "splay_angle": 22.755, "splay_distance": 3.539, "splay_ratio": 0.198, "d22": null, "d64": null, "eta": 170.149, "theta": -151.409, "eta_prime": -174.560, "theta_prime": -150.815, "eta_base": -133.611, "theta_base": -122.530, "v0": 1.915, "v1": -24.730, "v2": 36.739, "v3": -36.697, "v4": 21.932, "amplitude": 38.180, "phase_angle": 15.794, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.951, "filter_rmsd": 0.005, "frame": { "rmsd": 0.005, "origin": [ 24.710, 32.920, 37.184 ], "x_axis": [ 0.761, -0.365, 0.536 ], "y_axis": [ 0.143, 0.901, 0.410 ], "z_axis": [ -0.632, -0.236, 0.738 ], "quaternion": [ 0.922, 0.175, -0.317, -0.137 ] } }, { "index": 4, "index_chain": 4, "chain_name": "A", "nt_resnum": 12, "nt_name": "A", "nt_code": "A", "nt_id": "///A/12", "linked_nts": [ "///A/11", "///A/13" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -66.578, "beta": 174.628, "gamma": 54.485, "delta": 84.334, "epsilon": -160.212, "zeta": -68.587, "epsilon_zeta": -91.625, "bb_type": "BI", "chi": -162.976, "glyco_bond": "anti", "C5prime_xyz": [ -1.322, 8.626, 0.670 ], "P_xyz": [ 1.273, 8.923, 0.802 ], "form": "A", "ssZp": 4.487, "Dp": 4.581, "splay_angle": 21.462, "splay_distance": 3.367, "splay_ratio": 0.188, "d22": null, "d64": null, "eta": 170.364, "theta": -146.099, "eta_prime": -174.419, "theta_prime": -146.294, "eta_base": -130.936, "theta_base": -121.246, "v0": 3.443, "v1": -26.679, "v2": 38.343, "v3": -37.596, "v4": 21.571, "amplitude": 39.488, "phase_angle": 13.827, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.797, "filter_rmsd": 0.037, "frame": { "rmsd": 0.003, "origin": [ 22.985, 30.888, 39.512 ], "x_axis": [ 0.704, 0.162, 0.692 ], "y_axis": [ -0.305, 0.948, 0.089 ], "z_axis": [ -0.641, -0.274, 0.717 ], "quaternion": [ 0.918, 0.099, -0.363, 0.127 ] } }, { "index": 5, "index_chain": 5, "chain_name": "A", "nt_resnum": 13, "nt_name": "C", "nt_code": "C", "nt_id": "///A/13", "linked_nts": [ "///A/12", "///A/14" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -70.764, "beta": 177.169, "gamma": 56.328, "delta": 83.228, "epsilon": -147.935, "zeta": -74.945, "epsilon_zeta": -72.990, "bb_type": "BI", "chi": -158.424, "glyco_bond": "anti", "C5prime_xyz": [ -1.309, 8.775, 0.370 ], "P_xyz": [ 1.285, 9.083, 0.505 ], "form": "A", "ssZp": 4.320, "Dp": 4.638, "splay_angle": 23.248, "splay_distance": 3.654, "splay_ratio": 0.201, "d22": 3.914, "d64": 3.815, "eta": 170.800, "theta": -144.204, "eta_prime": -176.044, "theta_prime": -144.471, "eta_base": -136.662, "theta_base": -113.238, "v0": 3.341, "v1": -27.419, "v2": 39.742, "v3": -38.742, "v4": 22.405, "amplitude": 40.950, "phase_angle": 13.951, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.872, "filter_rmsd": 0.062, "frame": { "rmsd": 0.003, "origin": [ 22.056, 28.918, 42.079 ], "x_axis": [ 0.449, 0.667, 0.595 ], "y_axis": [ -0.710, 0.670, -0.216 ], "z_axis": [ -0.542, -0.326, 0.774 ], "quaternion": [ 0.850, 0.032, -0.334, 0.405 ] } }, { "index": 6, "index_chain": 6, "chain_name": "A", "nt_resnum": 14, "nt_name": "U", "nt_code": "U", "nt_id": "///A/14", "linked_nts": [ "///A/13", "///A/15" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop", "alpha": -65.352, "beta": 164.794, "gamma": 54.454, "delta": 81.237, "epsilon": -136.889, "zeta": -83.775, "epsilon_zeta": -53.114, "bb_type": "BI", "chi": -167.649, "glyco_bond": "anti", "C5prime_xyz": [ -1.364, 8.606, 0.959 ], "P_xyz": [ 1.238, 8.916, 0.930 ], "form": "A", "ssZp": 4.632, "Dp": 4.764, "splay_angle": 20.362, "splay_distance": 3.130, "splay_ratio": 0.177, "d22": 4.118, "d64": 4.113, "eta": 164.690, "theta": -143.659, "eta_prime": 178.674, "theta_prime": -142.380, "eta_base": -133.480, "theta_base": -102.962, "v0": 5.191, "v1": -28.984, "v2": 40.525, "v3": -38.436, "v4": 21.052, "amplitude": 41.351, "phase_angle": 11.473, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.951, "filter_rmsd": 0.105, "frame": { "rmsd": 0.002, "origin": [ 21.166, 28.208, 45.551 ], "x_axis": [ 0.041, 0.967, 0.250 ], "y_axis": [ -0.850, 0.165, -0.501 ], "z_axis": [ -0.526, -0.192, 0.829 ], "quaternion": [ 0.713, -0.108, -0.272, 0.637 ] } }, { "index": 7, "index_chain": 7, "chain_name": "A", "nt_resnum": 15, "nt_name": "C", "nt_code": "C", "nt_id": "///A/15", "linked_nts": [ "///A/14", "///A/16" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop", "alpha": -54.895, "beta": 147.800, "gamma": 61.003, "delta": 82.019, "epsilon": -143.591, "zeta": -70.825, "epsilon_zeta": -72.766, "bb_type": "BI", "chi": -164.192, "glyco_bond": "anti", "C5prime_xyz": [ -1.239, 8.710, 0.721 ], "P_xyz": [ 1.279, 8.867, -0.034 ], "form": "A", "ssZp": 4.570, "Dp": 4.735, "splay_angle": 24.059, "splay_distance": 3.920, "splay_ratio": 0.214, "d22": null, "d64": null, "eta": 164.835, "theta": -132.889, "eta_prime": -175.518, "theta_prime": -136.480, "eta_base": -115.514, "theta_base": -111.861, "v0": 3.553, "v1": -27.447, "v2": 39.776, "v3": -38.527, "v4": 22.120, "amplitude": 40.925, "phase_angle": 13.613, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.585, "filter_rmsd": 0.061, "frame": { "rmsd": 0.003, "origin": [ 20.507, 29.249, 48.427 ], "x_axis": [ -0.537, 0.843, 0.021 ], "y_axis": [ -0.793, -0.497, -0.352 ], "z_axis": [ -0.286, -0.205, 0.936 ], "quaternion": [ 0.475, -0.077, -0.162, 0.862 ] } }, { "index": 8, "index_chain": 8, "chain_name": "A", "nt_resnum": 16, "nt_name": "G", "nt_code": "G", "nt_id": "///A/16", "linked_nts": [ "///A/15", "///A/17" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,A-minor", "alpha": -59.742, "beta": 165.585, "gamma": 57.021, "delta": 80.810, "epsilon": -170.453, "zeta": -68.157, "epsilon_zeta": -102.296, "bb_type": "BI", "chi": -170.087, "glyco_bond": "anti", "C5prime_xyz": [ -1.909, 8.789, 0.934 ], "P_xyz": [ 0.602, 9.516, 1.217 ], "form": "A", "ssZp": 4.315, "Dp": 4.432, "splay_angle": 26.556, "splay_distance": 4.055, "splay_ratio": 0.232, "d22": null, "d64": null, "eta": 164.233, "theta": -155.978, "eta_prime": -173.315, "theta_prime": -156.893, "eta_base": -122.895, "theta_base": -130.102, "v0": -1.792, "v1": -24.344, "v2": 39.621, "v3": -41.525, "v4": 27.272, "amplitude": 42.374, "phase_angle": 20.769, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.937, "filter_rmsd": 0.010, "frame": { "rmsd": 0.010, "origin": [ 19.548, 31.093, 51.751 ], "x_axis": [ -0.804, 0.448, -0.392 ], "y_axis": [ -0.374, -0.892, -0.252 ], "z_axis": [ -0.462, -0.056, 0.885 ], "quaternion": [ 0.217, -0.226, -0.082, 0.946 ] } }, { "index": 9, "index_chain": 9, "chain_name": "A", "nt_resnum": 17, "nt_name": "G", "nt_code": "G", "nt_id": "///A/17", "linked_nts": [ "///A/16", "///A/18" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,A-minor", "alpha": -70.685, "beta": -164.608, "gamma": 48.996, "delta": 81.500, "epsilon": -170.958, "zeta": -61.946, "epsilon_zeta": -109.012, "bb_type": "BI", "chi": -163.650, "glyco_bond": "anti", "C5prime_xyz": [ -1.144, 8.612, 0.750 ], "P_xyz": [ 1.318, 8.773, 1.639 ], "form": "A", "ssZp": 4.374, "Dp": 4.517, "splay_angle": 21.530, "splay_distance": 3.635, "splay_ratio": 0.197, "d22": null, "d64": null, "eta": 175.027, "theta": -133.267, "eta_prime": -176.892, "theta_prime": -138.429, "eta_base": -138.870, "theta_base": -121.404, "v0": 8.358, "v1": -30.831, "v2": 40.667, "v3": -36.738, "v4": 18.011, "amplitude": 40.980, "phase_angle": 7.087, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.590, "filter_rmsd": 0.006, "frame": { "rmsd": 0.006, "origin": [ 18.466, 32.603, 55.355 ], "x_axis": [ -0.860, -0.140, -0.490 ], "y_axis": [ 0.200, -0.977, -0.071 ], "z_axis": [ -0.469, -0.159, 0.869 ], "quaternion": [ -0.088, -0.249, -0.060, 0.963 ] } }, { "index": 10, "index_chain": 10, "chain_name": "A", "nt_resnum": 18, "nt_name": "G", "nt_code": "G", "nt_id": "///A/18", "linked_nts": [ "///A/17", "///A/19" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,internal-loop,A-minor", "alpha": 173.948, "beta": -178.687, "gamma": 166.156, "delta": 89.614, "epsilon": -127.829, "zeta": -96.504, "epsilon_zeta": -31.325, "bb_type": "--", "chi": -170.220, "glyco_bond": "anti", "C5prime_xyz": [ -1.047, 8.287, 1.309 ], "P_xyz": [ 0.849, 9.768, 0.378 ], "form": ".", "ssZp": 4.426, "Dp": 4.647, "splay_angle": 19.032, "splay_distance": 3.006, "splay_ratio": 0.166, "d22": null, "d64": null, "eta": 176.399, "theta": -173.259, "eta_prime": -172.940, "theta_prime": -165.531, "eta_base": -141.510, "theta_base": -152.679, "v0": 10.193, "v1": -26.869, "v2": 32.276, "v3": -27.770, "v4": 11.163, "amplitude": 32.282, "phase_angle": 1.079, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.464, "filter_rmsd": 0.006, "frame": { "rmsd": 0.006, "origin": [ 16.177, 34.213, 57.676 ], "x_axis": [ -0.678, -0.583, -0.448 ], "y_axis": [ 0.521, -0.811, 0.268 ], "z_axis": [ -0.519, -0.052, 0.853 ], "quaternion": [ -0.302, -0.264, 0.059, 0.914 ] } }, { "index": 11, "index_chain": 11, "chain_name": "A", "nt_resnum": 19, "nt_name": "G", "nt_code": "G", "nt_id": "///A/19", "linked_nts": [ "///A/18", "///A/20" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,internal-loop", "alpha": -51.786, "beta": 154.679, "gamma": 47.792, "delta": 82.523, "epsilon": -145.226, "zeta": -77.709, "epsilon_zeta": -67.518, "bb_type": "BI", "chi": -138.401, "glyco_bond": "anti", "C5prime_xyz": [ -1.324, 8.723, -0.743 ], "P_xyz": [ 1.241, 8.764, -1.213 ], "form": ".", "ssZp": 3.455, "Dp": 4.596, "splay_angle": 19.101, "splay_distance": 3.149, "splay_ratio": 0.167, "d22": null, "d64": null, "eta": 168.177, "theta": -139.548, "eta_prime": -179.890, "theta_prime": -133.000, "eta_base": -162.692, "theta_base": -114.831, "v0": 0.809, "v1": -23.936, "v2": 36.717, "v3": -37.250, "v4": 23.036, "amplitude": 38.490, "phase_angle": 17.459, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.364, "filter_rmsd": 0.006, "frame": { "rmsd": 0.006, "origin": [ 14.789, 35.415, 60.056 ], "x_axis": [ -0.467, -0.857, -0.218 ], "y_axis": [ 0.558, -0.477, 0.679 ], "z_axis": [ -0.686, 0.195, 0.701 ], "quaternion": [ -0.435, -0.278, 0.269, 0.813 ] } }, { "index": 12, "index_chain": 12, "chain_name": "A", "nt_resnum": 20, "nt_name": "U", "nt_code": "U", "nt_id": "///A/20", "linked_nts": [ "///A/19", "///A/21" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,isolated-canonical,non-pair-contact,helix-end,bulge,internal-loop,splayed-apart", "alpha": -36.611, "beta": 175.711, "gamma": 32.795, "delta": 109.190, "epsilon": -150.819, "zeta": 103.451, "epsilon_zeta": 105.731, "bb_type": "--", "chi": -106.276, "glyco_bond": "anti", "C5prime_xyz": [ -2.059, 8.215, -1.584 ], "P_xyz": [ 0.385, 9.106, -1.437 ], "form": ".", "ssZp": 2.734, "Dp": 3.400, "splay_angle": 97.507, "splay_distance": 14.280, "splay_ratio": 0.753, "d22": null, "d64": null, "eta": 172.627, "theta": 88.725, "eta_prime": -166.455, "theta_prime": 81.382, "eta_base": -139.777, "theta_base": 109.116, "v0": -9.825, "v1": 18.660, "v2": -20.621, "v3": 15.598, "v4": -3.523, "amplitude": 20.844, "phase_angle": 171.607, "puckering": "C2'-endo", "sugar_class": "--", "bin": "33p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.104, "frame": { "rmsd": 0.011, "origin": [ 12.312, 34.701, 61.864 ], "x_axis": [ 0.168, -0.959, -0.230 ], "y_axis": [ 0.511, -0.114, 0.852 ], "z_axis": [ -0.843, -0.261, 0.471 ], "quaternion": [ 0.617, 0.450, -0.248, -0.595 ] } }, { "index": 13, "index_chain": 13, "chain_name": "A", "nt_resnum": 21, "nt_name": "G", "nt_code": "G", "nt_id": "///A/21", "linked_nts": [ "///A/20", "///A/22" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,canonical,non-canonical,non-pair-contact,helix,stem-end,multiplet,bulge,A-minor,ribose-zipper,phosphate,splayed-apart", "alpha": 86.231, "beta": -116.985, "gamma": 169.860, "delta": 83.766, "epsilon": -119.998, "zeta": -76.964, "epsilon_zeta": -43.034, "bb_type": "--", "chi": 172.006, "glyco_bond": "anti", "C5prime_xyz": [ -1.386, 7.956, 2.224 ], "P_xyz": [ 0.742, 8.876, 1.053 ], "form": "A", "ssZp": 4.723, "Dp": 4.741, "splay_angle": 23.942, "splay_distance": 3.760, "splay_ratio": 0.211, "d22": null, "d64": null, "eta": 164.887, "theta": -136.864, "eta_prime": 178.237, "theta_prime": -139.700, "eta_base": -172.393, "theta_base": -107.678, "v0": 8.312, "v1": -28.578, "v2": 37.414, "v3": -33.655, "v4": 15.927, "amplitude": 37.640, "phase_angle": 6.290, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "5n", "suiteness": 0.010, "filter_rmsd": 0.006, "frame": { "rmsd": 0.006, "origin": [ 15.033, 45.170, 71.188 ], "x_axis": [ -0.874, -0.006, -0.485 ], "y_axis": [ 0.016, -1.000, -0.017 ], "z_axis": [ -0.485, -0.023, 0.874 ], "quaternion": [ -0.006, -0.250, -0.010, 0.968 ] } }, { "index": 14, "index_chain": 14, "chain_name": "A", "nt_resnum": 22, "nt_name": "C", "nt_code": "C", "nt_id": "///A/22", "linked_nts": [ "///A/21", "///A/23" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,multiplet,A-minor,ribose-zipper", "alpha": -60.709, "beta": 166.162, "gamma": 51.894, "delta": 81.545, "epsilon": -146.221, "zeta": -68.306, "epsilon_zeta": -77.915, "bb_type": "BI", "chi": -165.135, "glyco_bond": "anti", "C5prime_xyz": [ -1.501, 8.732, 0.827 ], "P_xyz": [ 1.061, 9.145, 1.028 ], "form": "A", "ssZp": 4.516, "Dp": 4.626, "splay_angle": 24.873, "splay_distance": 4.025, "splay_ratio": 0.218, "d22": 4.195, "d64": 4.314, "eta": 162.241, "theta": -138.127, "eta_prime": -178.581, "theta_prime": -137.729, "eta_base": -125.111, "theta_base": -108.214, "v0": 0.850, "v1": -25.408, "v2": 39.007, "v3": -39.528, "v4": 24.509, "amplitude": 40.893, "phase_angle": 17.468, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.549, "filter_rmsd": 0.063, "frame": { "rmsd": 0.004, "origin": [ 11.962, 46.315, 73.030 ], "x_axis": [ -0.612, -0.682, -0.400 ], "y_axis": [ 0.568, -0.731, 0.379 ], "z_axis": [ -0.551, 0.004, 0.835 ], "quaternion": [ -0.351, -0.267, 0.107, 0.891 ] } }, { "index": 15, "index_chain": 15, "chain_name": "A", "nt_resnum": 23, "nt_name": "C", "nt_code": "C", "nt_id": "///A/23", "linked_nts": [ "///A/22", "///A/24" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,multiplet", "alpha": -65.968, "beta": 174.782, "gamma": 51.892, "delta": 80.019, "epsilon": -152.840, "zeta": -66.657, "epsilon_zeta": -86.184, "bb_type": "BI", "chi": -160.781, "glyco_bond": "anti", "C5prime_xyz": [ -1.513, 8.836, 0.497 ], "P_xyz": [ 1.003, 9.469, 0.703 ], "form": ".", "ssZp": 4.380, "Dp": 4.612, "splay_angle": 26.946, "splay_distance": 4.139, "splay_ratio": 0.233, "d22": 3.910, "d64": 3.770, "eta": 165.829, "theta": -142.397, "eta_prime": -178.981, "theta_prime": -136.901, "eta_base": -132.806, "theta_base": -85.879, "v0": -0.859, "v1": -25.103, "v2": 40.171, "v3": -41.628, "v4": 26.777, "amplitude": 42.657, "phase_angle": 19.656, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.989, "filter_rmsd": 0.062, "frame": { "rmsd": 0.004, "origin": [ 8.356, 45.976, 74.785 ], "x_axis": [ -0.056, -0.973, -0.223 ], "y_axis": [ 0.788, -0.180, 0.589 ], "z_axis": [ -0.613, -0.143, 0.777 ], "quaternion": [ 0.621, 0.295, -0.157, -0.709 ] } }, { "index": 16, "index_chain": 16, "chain_name": "A", "nt_resnum": 24, "nt_name": "C", "nt_code": "C", "nt_id": "///A/24", "linked_nts": [ "///A/23", "///A/25" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,anti,non-canonical,non-pair-contact,helix,ss-non-loop", "alpha": -61.924, "beta": 173.828, "gamma": 52.657, "delta": 78.152, "epsilon": 67.071, "zeta": -125.320, "epsilon_zeta": -167.609, "bb_type": "--", "chi": -151.163, "glyco_bond": "anti", "C5prime_xyz": [ -1.115, 8.698, 0.083 ], "P_xyz": [ 1.507, 8.744, 0.048 ], "form": ".", "ssZp": 2.716, "Dp": 2.948, "splay_angle": 80.897, "splay_distance": 12.328, "splay_ratio": 0.649, "d22": 7.186, "d64": 8.422, "eta": -162.503, "theta": 90.716, "eta_prime": -139.727, "theta_prime": 88.806, "eta_base": -80.865, "theta_base": 91.707, "v0": 5.285, "v1": -25.901, "v2": 35.944, "v3": -33.831, "v4": 18.099, "amplitude": 36.570, "phase_angle": 10.621, "puckering": "C3'-endo", "sugar_class": "--", "bin": "33p", "cluster": "1a", "suiteness": 0.953, "filter_rmsd": 0.061, "frame": { "rmsd": 0.006, "origin": [ 6.708, 42.737, 76.765 ], "x_axis": [ 0.577, -0.765, 0.284 ], "y_axis": [ 0.455, 0.590, 0.667 ], "z_axis": [ -0.678, -0.256, 0.689 ], "quaternion": [ 0.845, 0.273, -0.285, -0.361 ] } }, { "index": 17, "index_chain": 17, "chain_name": "A", "nt_resnum": 25, "nt_name": "U", "nt_code": "U", "nt_id": "///A/25", "linked_nts": [ "///A/24", null ], "nt_type": "RNA", "dbn": ".", "is_broken": true, "summary": "break,anti,non-stack,non-canonical,non-pair-contact,multiplet,ss-non-loop,phosphate", "alpha": 76.731, "beta": 107.140, "gamma": -30.716, "delta": 88.986, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": -138.444, "glyco_bond": "anti", "C5prime_xyz": [ -1.189, 8.566, -0.794 ], "P_xyz": [ 0.920, 9.081, 0.673 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": 6.083, "v1": -27.280, "v2": 37.098, "v3": -34.401, "v4": 17.891, "amplitude": 37.604, "phase_angle": 9.413, "puckering": "C3'-endo", "sugar_class": "--", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.003, "origin": [ 9.721, 54.653, 75.811 ], "x_axis": [ -0.280, -0.819, -0.501 ], "y_axis": [ -0.285, -0.427, 0.858 ], "z_axis": [ -0.917, 0.383, -0.114 ], "quaternion": [ -0.211, -0.562, 0.492, 0.631 ] } }, { "index": 18, "index_chain": 18, "chain_name": "A", "nt_resnum": 30, "nt_name": "C", "nt_code": "C", "nt_id": "///A/30", "linked_nts": [ null, "///A/31" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-pair-contact,ss-non-loop", "alpha": null, "beta": -168.878, "gamma": 53.218, "delta": 81.315, "epsilon": -165.400, "zeta": -93.532, "epsilon_zeta": -71.868, "bb_type": "BI", "chi": -159.448, "glyco_bond": "anti", "C5prime_xyz": [ -1.550, 8.888, 0.410 ], "P_xyz": [ 0.899, 9.629, 0.993 ], "form": "A", "ssZp": 4.340, "Dp": 4.445, "splay_angle": 25.947, "splay_distance": 4.138, "splay_ratio": 0.226, "d22": null, "d64": null, "eta": null, "theta": -136.828, "eta_prime": null, "theta_prime": -138.106, "eta_base": null, "theta_base": -100.530, "v0": -3.107, "v1": -21.345, "v2": 36.240, "v3": -38.988, "v4": 26.534, "amplitude": 39.362, "phase_angle": 22.975, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.062, "frame": { "rmsd": 0.001, "origin": [ -0.718, 42.823, 89.197 ], "x_axis": [ -0.428, 0.659, -0.618 ], "y_axis": [ 0.649, 0.700, 0.298 ], "z_axis": [ 0.629, -0.274, -0.727 ], "quaternion": [ 0.369, 0.387, 0.845, 0.007 ] } }, { "index": 19, "index_chain": 19, "chain_name": "A", "nt_resnum": 31, "nt_name": "G", "nt_code": "G", "nt_id": "///A/31", "linked_nts": [ "///A/30", "///A/32" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-pair-contact,ss-non-loop", "alpha": 153.740, "beta": -128.406, "gamma": 161.514, "delta": 83.057, "epsilon": -136.354, "zeta": -59.663, "epsilon_zeta": -76.691, "bb_type": "BI", "chi": 166.879, "glyco_bond": "anti", "C5prime_xyz": [ -2.037, 8.111, 2.167 ], "P_xyz": [ 0.161, 9.293, 1.350 ], "form": ".", "ssZp": 4.395, "Dp": 4.690, "splay_angle": 26.905, "splay_distance": 4.818, "splay_ratio": 0.260, "d22": null, "d64": null, "eta": 157.560, "theta": -106.933, "eta_prime": -176.831, "theta_prime": -128.597, "eta_base": -116.638, "theta_base": -101.127, "v0": 2.368, "v1": -26.066, "v2": 38.455, "v3": -38.209, "v4": 22.529, "amplitude": 39.862, "phase_angle": 15.267, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.185, "filter_rmsd": 0.008, "frame": { "rmsd": 0.008, "origin": [ 0.204, 42.815, 85.163 ], "x_axis": [ -0.060, 0.975, -0.215 ], "y_axis": [ 0.742, 0.188, 0.643 ], "z_axis": [ 0.667, -0.121, -0.735 ], "quaternion": [ 0.313, 0.610, 0.704, 0.186 ] } }, { "index": 20, "index_chain": 20, "chain_name": "A", "nt_resnum": 32, "nt_name": "U", "nt_code": "U", "nt_id": "///A/32", "linked_nts": [ "///A/31", "///A/33" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-pair-contact,ss-non-loop", "alpha": 174.825, "beta": 167.955, "gamma": 164.617, "delta": 88.376, "epsilon": -114.184, "zeta": -50.462, "epsilon_zeta": -63.722, "bb_type": "--", "chi": -177.857, "glyco_bond": "anti", "C5prime_xyz": [ -1.579, 8.360, 1.519 ], "P_xyz": [ -0.012, 10.335, 0.821 ], "form": ".", "ssZp": 4.360, "Dp": 4.602, "splay_angle": 45.568, "splay_distance": 6.558, "splay_ratio": 0.408, "d22": null, "d64": null, "eta": 156.905, "theta": -137.239, "eta_prime": 176.872, "theta_prime": -135.446, "eta_base": -129.420, "theta_base": -50.969, "v0": 5.545, "v1": -24.816, "v2": 33.418, "v3": -31.450, "v4": 16.394, "amplitude": 33.897, "phase_angle": 9.647, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.238, "filter_rmsd": 0.105, "frame": { "rmsd": 0.009, "origin": [ 0.748, 44.940, 80.874 ], "x_axis": [ 0.412, 0.822, 0.393 ], "y_axis": [ 0.582, -0.569, 0.580 ], "z_axis": [ 0.701, -0.011, -0.714 ], "quaternion": [ 0.180, 0.821, 0.428, 0.333 ] } }, { "index": 21, "index_chain": 21, "chain_name": "A", "nt_resnum": 33, "nt_name": "G", "nt_code": "G", "nt_id": "///A/33", "linked_nts": [ "///A/32", "///A/34" ], "nt_type": "RNA", "dbn": ".", "summary": "syn,BI,non-canonical,non-pair-contact,helix-end,ss-non-loop", "alpha": -107.597, "beta": 123.557, "gamma": 135.122, "delta": 87.829, "epsilon": 178.597, "zeta": -82.167, "epsilon_zeta": -99.236, "bb_type": "BI", "chi": -6.257, "glyco_bond": "syn", "C5prime_xyz": [ -5.534, 4.169, -1.225 ], "P_xyz": [ -6.541, 2.177, 0.184 ], "form": ".", "ssZp": -2.988, "Dp": 3.767, "splay_angle": 60.534, "splay_distance": 9.743, "splay_ratio": 0.504, "d22": null, "d64": null, "eta": -176.396, "theta": 147.767, "eta_prime": -154.412, "theta_prime": 151.519, "eta_base": -54.473, "theta_base": 143.949, "v0": -8.968, "v1": -12.906, "v2": 28.196, "v3": -34.456, "v4": 27.367, "amplitude": 33.893, "phase_angle": 33.705, "puckering": "C3'-endo", "sugar_class": "--", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.014, "frame": { "rmsd": 0.014, "origin": [ 7.043, 44.121, 82.522 ], "x_axis": [ -0.130, 0.984, 0.122 ], "y_axis": [ -0.693, -0.003, -0.721 ], "z_axis": [ -0.709, -0.178, 0.682 ], "quaternion": [ 0.622, -0.218, -0.334, 0.674 ] } }, { "index": 22, "index_chain": 22, "chain_name": "A", "nt_resnum": 34, "nt_name": "A", "nt_code": "A", "nt_id": "///A/34", "linked_nts": [ "///A/33", "///A/35" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,ss-non-loop", "alpha": -87.011, "beta": -171.469, "gamma": 52.477, "delta": 82.322, "epsilon": -137.849, "zeta": -58.321, "epsilon_zeta": -79.528, "bb_type": "BI", "chi": -175.868, "glyco_bond": "anti", "C5prime_xyz": [ -1.722, 8.686, 1.309 ], "P_xyz": [ 0.481, 9.154, 2.701 ], "form": ".", "ssZp": 4.331, "Dp": 4.479, "splay_angle": 27.429, "splay_distance": 4.328, "splay_ratio": 0.237, "d22": null, "d64": null, "eta": 162.595, "theta": -123.747, "eta_prime": 159.460, "theta_prime": -120.450, "eta_base": 165.348, "theta_base": -60.112, "v0": -0.984, "v1": -21.587, "v2": 34.728, "v3": -36.179, "v4": 23.481, "amplitude": 36.974, "phase_angle": 20.074, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.256, "filter_rmsd": 0.040, "frame": { "rmsd": 0.008, "origin": [ -0.058, 48.563, 77.545 ], "x_axis": [ 0.750, 0.014, 0.661 ], "y_axis": [ 0.206, -0.955, -0.214 ], "z_axis": [ 0.628, 0.297, -0.719 ], "quaternion": [ -0.138, 0.925, 0.060, 0.348 ] } }, { "index": 23, "index_chain": 23, "chain_name": "A", "nt_resnum": 35, "nt_name": "A", "nt_code": "A", "nt_id": "///A/35", "linked_nts": [ "///A/34", "///A/36" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,ss-non-loop", "alpha": -79.930, "beta": 171.154, "gamma": 55.247, "delta": 82.082, "epsilon": -141.146, "zeta": -61.301, "epsilon_zeta": -79.845, "bb_type": "BI", "chi": -162.113, "glyco_bond": "anti", "C5prime_xyz": [ -1.349, 8.700, 0.615 ], "P_xyz": [ 1.252, 9.099, 0.592 ], "form": ".", "ssZp": 4.485, "Dp": 4.708, "splay_angle": 31.636, "splay_distance": 4.999, "splay_ratio": 0.274, "d22": null, "d64": null, "eta": 149.488, "theta": -126.966, "eta_prime": 175.315, "theta_prime": -124.368, "eta_base": -103.339, "theta_base": -85.042, "v0": 2.877, "v1": -26.898, "v2": 39.415, "v3": -38.684, "v4": 22.529, "amplitude": 40.717, "phase_angle": 14.529, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.723, "filter_rmsd": 0.039, "frame": { "rmsd": 0.003, "origin": [ 4.236, 48.657, 77.010 ], "x_axis": [ 0.562, -0.807, 0.183 ], "y_axis": [ -0.479, -0.497, -0.724 ], "z_axis": [ 0.675, 0.319, -0.666 ], "quaternion": [ -0.316, 0.825, -0.389, 0.260 ] } }, { "index": 24, "index_chain": 24, "chain_name": "A", "nt_resnum": 36, "nt_name": "G", "nt_code": "G", "nt_id": "///A/36", "linked_nts": [ "///A/35", "///A/37" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,multiplet", "alpha": -64.091, "beta": 163.434, "gamma": 64.172, "delta": 78.515, "epsilon": -153.319, "zeta": -75.625, "epsilon_zeta": -77.694, "bb_type": "BI", "chi": -172.864, "glyco_bond": "anti", "C5prime_xyz": [ -1.518, 8.689, 1.223 ], "P_xyz": [ 1.023, 9.295, 1.063 ], "form": "A", "ssZp": 4.730, "Dp": 4.689, "splay_angle": 27.029, "splay_distance": 4.093, "splay_ratio": 0.235, "d22": null, "d64": null, "eta": 165.986, "theta": -152.779, "eta_prime": -166.929, "theta_prime": -152.838, "eta_base": -101.216, "theta_base": -126.524, "v0": 0.545, "v1": -26.015, "v2": 40.122, "v3": -40.686, "v4": 25.467, "amplitude": 42.134, "phase_angle": 17.778, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.741, "filter_rmsd": 0.005, "frame": { "rmsd": 0.005, "origin": [ 8.499, 46.655, 75.333 ], "x_axis": [ -0.014, -0.921, -0.389 ], "y_axis": [ -0.729, 0.275, -0.626 ], "z_axis": [ 0.684, 0.275, -0.676 ], "quaternion": [ 0.383, -0.589, 0.701, -0.125 ] } }, { "index": 25, "index_chain": 25, "chain_name": "A", "nt_resnum": 37, "nt_name": "G", "nt_code": "G", "nt_id": "///A/37", "linked_nts": [ "///A/36", "///A/38" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,multiplet,A-minor", "alpha": -65.087, "beta": -177.367, "gamma": 47.708, "delta": 81.811, "epsilon": -150.365, "zeta": -69.279, "epsilon_zeta": -81.085, "bb_type": "BI", "chi": -171.325, "glyco_bond": "anti", "C5prime_xyz": [ -1.160, 8.497, 1.177 ], "P_xyz": [ 1.363, 8.623, 1.890 ], "form": "A", "ssZp": 4.611, "Dp": 4.690, "splay_angle": 27.619, "splay_distance": 4.263, "splay_ratio": 0.243, "d22": null, "d64": null, "eta": 169.826, "theta": -144.339, "eta_prime": 178.623, "theta_prime": -139.041, "eta_base": -141.716, "theta_base": -114.772, "v0": 8.417, "v1": -31.174, "v2": 40.853, "v3": -37.014, "v4": 18.027, "amplitude": 41.161, "phase_angle": 7.005, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.896, "filter_rmsd": 0.006, "frame": { "rmsd": 0.006, "origin": [ 12.217, 46.530, 73.626 ], "x_axis": [ -0.562, -0.630, -0.537 ], "y_axis": [ -0.619, 0.750, -0.233 ], "z_axis": [ 0.549, 0.202, -0.811 ], "quaternion": [ 0.307, -0.353, 0.884, -0.009 ] } }, { "index": 26, "index_chain": 26, "chain_name": "A", "nt_resnum": 38, "nt_name": "C", "nt_code": "C", "nt_id": "///A/38", "linked_nts": [ "///A/37", "///A/39" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,multiplet,bulge,A-minor,phosphate", "alpha": -70.265, "beta": -168.041, "gamma": 52.263, "delta": 82.075, "epsilon": -148.051, "zeta": -79.485, "epsilon_zeta": -68.566, "bb_type": "BI", "chi": -158.912, "glyco_bond": "anti", "C5prime_xyz": [ -1.192, 8.737, 0.421 ], "P_xyz": [ 1.360, 9.034, 0.915 ], "form": "A", "ssZp": 4.381, "Dp": 4.672, "splay_angle": 19.407, "splay_distance": 3.123, "splay_ratio": 0.171, "d22": 4.376, "d64": 4.146, "eta": 173.896, "theta": -149.489, "eta_prime": -176.021, "theta_prime": -146.862, "eta_base": -142.671, "theta_base": -135.440, "v0": 2.337, "v1": -26.277, "v2": 39.130, "v3": -38.768, "v4": 22.866, "amplitude": 40.574, "phase_angle": 15.333, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.838, "filter_rmsd": 0.062, "frame": { "rmsd": 0.004, "origin": [ 14.837, 45.209, 70.533 ], "x_axis": [ -0.877, -0.112, -0.468 ], "y_axis": [ -0.177, 0.979, 0.098 ], "z_axis": [ 0.447, 0.168, -0.878 ], "quaternion": [ 0.237, -0.075, 0.966, 0.069 ] } }, { "index": 27, "index_chain": 27, "chain_name": "A", "nt_resnum": 39, "nt_name": "U", "nt_code": "U", "nt_id": "///A/39", "linked_nts": [ "///A/38", "///A/40" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,bulge", "alpha": -58.827, "beta": 177.445, "gamma": 42.741, "delta": 83.504, "epsilon": -145.118, "zeta": -67.440, "epsilon_zeta": -77.679, "bb_type": "BI", "chi": -148.050, "glyco_bond": "anti", "C5prime_xyz": [ -1.374, 8.766, -0.191 ], "P_xyz": [ 1.183, 9.322, -0.117 ], "form": ".", "ssZp": 4.020, "Dp": 4.649, "splay_angle": 26.956, "splay_distance": 4.328, "splay_ratio": 0.233, "d22": null, "d64": null, "eta": 168.878, "theta": -135.802, "eta_prime": 176.129, "theta_prime": -130.819, "eta_base": -164.500, "theta_base": -90.126, "v0": -0.276, "v1": -23.773, "v2": 37.280, "v3": -38.441, "v4": 24.502, "amplitude": 39.421, "phase_angle": 18.973, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.756, "filter_rmsd": 0.105, "frame": { "rmsd": 0.005, "origin": [ 16.215, 44.098, 67.960 ], "x_axis": [ -0.948, 0.276, -0.159 ], "y_axis": [ 0.269, 0.961, 0.067 ], "z_axis": [ 0.171, 0.020, -0.985 ], "quaternion": [ 0.083, 0.138, 0.987, 0.022 ] } }, { "index": 28, "index_chain": 28, "chain_name": "A", "nt_resnum": 40, "nt_name": "G", "nt_code": "G", "nt_id": "///A/40", "linked_nts": [ "///A/39", "///A/41" ], "nt_type": "RNA", "dbn": ".", "summary": "u-turn,anti,~C3'-endo,BI,non-pair-contact,bulge,cap-acceptor", "alpha": -66.766, "beta": 167.234, "gamma": 56.767, "delta": 78.804, "epsilon": -149.770, "zeta": -75.625, "epsilon_zeta": -74.145, "bb_type": "BI", "chi": -146.410, "glyco_bond": "anti", "C5prime_xyz": [ -1.514, 8.793, -0.174 ], "P_xyz": [ 0.909, 9.172, -1.039 ], "form": ".", "ssZp": 4.112, "Dp": 4.741, "splay_angle": 70.559, "splay_distance": 10.685, "splay_ratio": 0.578, "d22": null, "d64": null, "eta": 164.639, "theta": -131.373, "eta_prime": -174.695, "theta_prime": -169.888, "eta_base": -119.796, "theta_base": 130.139, "v0": -1.184, "v1": -24.319, "v2": 39.194, "v3": -40.739, "v4": 26.654, "amplitude": 41.749, "phase_angle": 20.148, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.950, "filter_rmsd": 0.014, "frame": { "rmsd": 0.014, "origin": [ 13.933, 45.496, 64.558 ], "x_axis": [ -0.557, 0.830, 0.023 ], "y_axis": [ 0.826, 0.557, -0.081 ], "z_axis": [ -0.080, -0.026, -0.996 ], "quaternion": [ -0.029, 0.470, 0.882, -0.030 ] } }, { "index": 29, "index_chain": 29, "chain_name": "A", "nt_resnum": 41, "nt_name": "A", "nt_code": "A", "nt_id": "///A/41", "linked_nts": [ "///A/40", "///A/42" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,u-turn,anti,~C3'-endo,BI,non-canonical,non-pair-contact,multiplet,bulge,A-minor", "alpha": -178.150, "beta": 174.443, "gamma": 47.218, "delta": 83.291, "epsilon": -146.358, "zeta": -72.760, "epsilon_zeta": -73.598, "bb_type": "BI", "chi": -170.034, "glyco_bond": "anti", "C5prime_xyz": [ -1.785, 8.665, 0.887 ], "P_xyz": [ 0.526, 9.121, 2.009 ], "form": ".", "ssZp": 4.103, "Dp": 4.458, "splay_angle": 22.074, "splay_distance": 3.449, "splay_ratio": 0.192, "d22": null, "d64": null, "eta": 47.554, "theta": -140.667, "eta_prime": 59.247, "theta_prime": -136.608, "eta_base": 30.558, "theta_base": -83.654, "v0": -2.045, "v1": -21.259, "v2": 34.998, "v3": -37.418, "v4": 24.896, "amplitude": 37.696, "phase_angle": 21.808, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1g", "suiteness": 0.738, "filter_rmsd": 0.039, "frame": { "rmsd": 0.013, "origin": [ 21.148, 39.228, 59.780 ], "x_axis": [ 0.899, 0.062, 0.433 ], "y_axis": [ 0.038, 0.975, -0.218 ], "z_axis": [ -0.435, 0.212, 0.875 ], "quaternion": [ 0.968, -0.111, -0.224, 0.006 ] } }, { "index": 30, "index_chain": 30, "chain_name": "A", "nt_resnum": 42, "nt_name": "G", "nt_code": "G", "nt_id": "///A/42", "linked_nts": [ "///A/41", "///A/43" ], "nt_type": "RNA", "dbn": ".", "summary": "u-turn,anti,~C3'-endo,BI,non-canonical,non-pair-contact,multiplet,bulge,cap-donor,cap-acceptor,phosphate", "alpha": -62.368, "beta": 169.040, "gamma": 51.447, "delta": 88.729, "epsilon": -151.836, "zeta": -52.975, "epsilon_zeta": -98.861, "bb_type": "BI", "chi": -148.345, "glyco_bond": "anti", "C5prime_xyz": [ -1.166, 8.678, -0.161 ], "P_xyz": [ 1.444, 8.762, -0.196 ], "form": ".", "ssZp": 3.933, "Dp": 4.525, "splay_angle": 40.260, "splay_distance": 6.755, "splay_ratio": 0.346, "d22": null, "d64": null, "eta": 167.662, "theta": -119.693, "eta_prime": -173.327, "theta_prime": -118.428, "eta_base": -106.803, "theta_base": -117.132, "v0": 6.250, "v1": -26.721, "v2": 35.737, "v3": -33.326, "v4": 17.198, "amplitude": 36.189, "phase_angle": 9.067, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.820, "filter_rmsd": 0.006, "frame": { "rmsd": 0.006, "origin": [ 21.129, 40.150, 63.103 ], "x_axis": [ 0.560, 0.789, 0.252 ], "y_axis": [ -0.698, 0.614, -0.369 ], "z_axis": [ -0.446, 0.031, 0.895 ], "quaternion": [ 0.876, -0.114, -0.199, 0.424 ] } }, { "index": 31, "index_chain": 31, "chain_name": "A", "nt_resnum": 43, "nt_name": "A", "nt_code": "A", "nt_id": "///A/43", "linked_nts": [ "///A/42", "///A/44" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,u-turn,anti,~C2'-endo,non-canonical,non-pair-contact,helix-end,bulge,A-minor,cap-acceptor,phosphate", "alpha": -85.581, "beta": -143.552, "gamma": 69.849, "delta": 101.037, "epsilon": -133.164, "zeta": 83.730, "epsilon_zeta": 143.107, "bb_type": "--", "chi": -100.631, "glyco_bond": "anti", "C5prime_xyz": [ -3.666, 7.712, -2.367 ], "P_xyz": [ -1.839, 9.387, -3.278 ], "form": ".", "ssZp": 1.466, "Dp": 2.673, "splay_angle": 79.136, "splay_distance": 11.732, "splay_ratio": 0.650, "d22": null, "d64": null, "eta": -157.831, "theta": 68.753, "eta_prime": -143.512, "theta_prime": 73.507, "eta_base": -139.820, "theta_base": 107.400, "v0": -28.240, "v1": 11.203, "v2": 8.741, "v3": -25.108, "v4": 33.158, "amplitude": 32.929, "phase_angle": 74.607, "puckering": "O4'-endo", "sugar_class": "~C2'-endo", "bin": "33p", "cluster": "1m", "suiteness": 0.279, "filter_rmsd": 0.035, "frame": { "rmsd": 0.006, "origin": [ 19.589, 41.307, 69.577 ], "x_axis": [ 0.385, 0.918, 0.092 ], "y_axis": [ -0.845, 0.391, -0.366 ], "z_axis": [ -0.372, 0.063, 0.926 ], "quaternion": [ 0.822, -0.130, -0.141, 0.536 ] } }, { "index": 32, "index_chain": 32, "chain_name": "A", "nt_resnum": 44, "nt_name": "A", "nt_code": "A", "nt_id": "///A/44", "linked_nts": [ "///A/43", "///A/45" ], "nt_type": "RNA", "dbn": ".", "summary": "syn,~C2'-endo,non-pair-contact,bulge,cap-donor", "alpha": 50.379, "beta": 151.483, "gamma": -66.577, "delta": 114.224, "epsilon": 91.860, "zeta": -36.137, "epsilon_zeta": -232.003, "bb_type": "--", "chi": 62.457, "glyco_bond": "syn", "C5prime_xyz": [ -5.089, 3.723, 1.118 ], "P_xyz": [ -7.154, 2.288, 0.393 ], "form": ".", "ssZp": -0.944, "Dp": 1.087, "splay_angle": 29.436, "splay_distance": 4.757, "splay_ratio": 0.263, "d22": null, "d64": null, "eta": -157.351, "theta": 149.306, "eta_prime": -145.640, "theta_prime": 109.459, "eta_base": -154.090, "theta_base": 99.714, "v0": -4.587, "v1": 16.301, "v2": -21.527, "v3": 19.793, "v4": -9.466, "amplitude": 21.698, "phase_angle": 187.201, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.006, "origin": [ 11.402, 33.495, 66.482 ], "x_axis": [ 0.112, -0.930, -0.349 ], "y_axis": [ -0.663, 0.192, -0.724 ], "z_axis": [ 0.740, 0.313, -0.595 ], "quaternion": [ 0.421, -0.616, 0.647, -0.159 ] } }, { "index": 33, "index_chain": 33, "chain_name": "A", "nt_resnum": 45, "nt_name": "A", "nt_code": "A", "nt_id": "///A/45", "linked_nts": [ "///A/44", "///A/46" ], "nt_type": "RNA", "dbn": ")", "summary": "isolated-canonical,non-pair-contact,helix-end,bulge,internal-loop,cap-acceptor,phosphate", "alpha": -176.558, "beta": 134.230, "gamma": 153.193, "delta": 88.409, "epsilon": -127.978, "zeta": -61.799, "epsilon_zeta": -66.179, "bb_type": "--", "chi": -73.233, "glyco_bond": "--", "C5prime_xyz": [ -2.746, 6.396, -3.440 ], "P_xyz": [ -4.014, 5.094, -5.354 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": 157.186, "theta": -165.718, "eta_prime": 127.003, "theta_prime": 168.262, "eta_base": 142.879, "theta_base": null, "v0": 6.251, "v1": -26.574, "v2": 35.529, "v3": -33.028, "v4": 16.977, "amplitude": 35.964, "phase_angle": 8.929, "puckering": "C3'-endo", "sugar_class": "--", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.006, "origin": [ 12.002, 35.418, 62.172 ], "x_axis": [ -0.029, -0.982, -0.186 ], "y_axis": [ -0.691, 0.154, -0.707 ], "z_axis": [ 0.723, 0.107, -0.683 ], "quaternion": [ 0.332, -0.612, 0.683, -0.219 ] } }, { "index": 34, "index_chain": 34, "chain_name": "A", "nt_resnum": 46, "nt_name": "U", "nt_code": "U", "nt_id": "///A/46", "linked_nts": [ "///A/45", "///A/47" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,non-stack,internal-loop", "alpha": -67.963, "beta": -113.632, "gamma": -176.213, "delta": 91.722, "epsilon": -69.094, "zeta": -70.385, "epsilon_zeta": 1.292, "bb_type": "--", "chi": null, "glyco_bond": "--", "C5prime_xyz": [ null, null, null ], "P_xyz": [ null, null, null ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": 13.079, "theta": -58.493, "eta_prime": 27.545, "theta_prime": -45.800, "eta_base": null, "theta_base": null, "v0": 7.713, "v1": -27.580, "v2": 35.717, "v3": -32.219, "v4": 15.663, "amplitude": 35.950, "phase_angle": 6.533, "puckering": "C3'-endo", "sugar_class": "--", "bin": "33t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": null }, { "index": 35, "index_chain": 35, "chain_name": "A", "nt_resnum": 47, "nt_name": "A", "nt_code": "A", "nt_id": "///A/47", "linked_nts": [ "///A/46", "///A/48" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,internal-loop", "alpha": 54.906, "beta": 120.859, "gamma": 50.307, "delta": 81.908, "epsilon": -160.243, "zeta": -66.337, "epsilon_zeta": -93.906, "bb_type": "BI", "chi": -159.515, "glyco_bond": "anti", "C5prime_xyz": [ -1.572, 8.786, 0.403 ], "P_xyz": [ 0.997, 8.533, -0.176 ], "form": "A", "ssZp": 4.351, "Dp": 4.522, "splay_angle": 23.141, "splay_distance": 3.622, "splay_ratio": 0.201, "d22": null, "d64": null, "eta": -155.972, "theta": -132.181, "eta_prime": -107.350, "theta_prime": -141.633, "eta_base": null, "theta_base": -109.887, "v0": 0.628, "v1": -24.889, "v2": 38.205, "v3": -38.781, "v4": 24.123, "amplitude": 40.090, "phase_angle": 17.639, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.004, "origin": [ 13.480, 35.629, 59.164 ], "x_axis": [ -0.054, -0.978, -0.204 ], "y_axis": [ -0.605, 0.194, -0.772 ], "z_axis": [ 0.795, 0.082, -0.602 ], "quaternion": [ 0.367, -0.582, 0.680, -0.254 ] } }, { "index": 36, "index_chain": 36, "chain_name": "A", "nt_resnum": 48, "nt_name": "C", "nt_code": "C", "nt_id": "///A/48", "linked_nts": [ "///A/47", "///A/49" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,internal-loop,A-minor", "alpha": -63.010, "beta": 178.201, "gamma": 45.948, "delta": 81.160, "epsilon": -155.393, "zeta": -69.118, "epsilon_zeta": -86.275, "bb_type": "BI", "chi": -157.473, "glyco_bond": "anti", "C5prime_xyz": [ -1.213, 8.736, 0.409 ], "P_xyz": [ 1.372, 9.007, 0.761 ], "form": "A", "ssZp": 4.370, "Dp": 4.618, "splay_angle": 23.246, "splay_distance": 3.584, "splay_ratio": 0.202, "d22": 3.917, "d64": 3.697, "eta": 167.119, "theta": -145.599, "eta_prime": -177.846, "theta_prime": -142.946, "eta_base": -122.534, "theta_base": -109.550, "v0": 2.244, "v1": -26.295, "v2": 39.352, "v3": -39.022, "v4": 23.109, "amplitude": 40.838, "phase_angle": 15.502, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.828, "filter_rmsd": 0.061, "frame": { "rmsd": 0.003, "origin": [ 16.268, 34.126, 57.407 ], "x_axis": [ -0.481, -0.610, -0.630 ], "y_axis": [ -0.374, 0.793, -0.482 ], "z_axis": [ 0.793, 0.004, -0.609 ], "quaternion": [ 0.419, -0.290, 0.849, -0.141 ] } }, { "index": 37, "index_chain": 37, "chain_name": "A", "nt_resnum": 49, "nt_name": "C", "nt_code": "C", "nt_id": "///A/49", "linked_nts": [ "///A/48", "///A/50" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,A-minor", "alpha": -71.839, "beta": 177.935, "gamma": 54.317, "delta": 83.674, "epsilon": -151.202, "zeta": -73.756, "epsilon_zeta": -77.446, "bb_type": "BI", "chi": -163.422, "glyco_bond": "anti", "C5prime_xyz": [ -1.164, 8.618, 0.722 ], "P_xyz": [ 1.435, 8.768, 0.914 ], "form": "A", "ssZp": 4.543, "Dp": 4.701, "splay_angle": 24.204, "splay_distance": 3.770, "splay_ratio": 0.211, "d22": 4.146, "d64": 4.487, "eta": 166.697, "theta": -142.654, "eta_prime": 179.751, "theta_prime": -142.141, "eta_base": -133.057, "theta_base": -115.810, "v0": 5.944, "v1": -29.348, "v2": 40.039, "v3": -37.745, "v4": 20.217, "amplitude": 40.711, "phase_angle": 10.424, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.924, "filter_rmsd": 0.063, "frame": { "rmsd": 0.003, "origin": [ 18.362, 32.736, 54.852 ], "x_axis": [ -0.779, -0.004, -0.627 ], "y_axis": [ 0.040, 0.998, -0.056 ], "z_axis": [ 0.626, -0.068, -0.777 ], "quaternion": [ 0.332, 0.009, 0.942, -0.033 ] } }, { "index": 38, "index_chain": 38, "chain_name": "A", "nt_resnum": 50, "nt_name": "C", "nt_code": "C", "nt_id": "///A/50", "linked_nts": [ "///A/49", "///A/51" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,A-minor", "alpha": -58.238, "beta": 162.505, "gamma": 54.928, "delta": 80.791, "epsilon": -159.068, "zeta": -73.912, "epsilon_zeta": -85.156, "bb_type": "BI", "chi": -168.384, "glyco_bond": "anti", "C5prime_xyz": [ -1.345, 8.677, 1.038 ], "P_xyz": [ 1.257, 9.004, 0.932 ], "form": "A", "ssZp": 4.688, "Dp": 4.655, "splay_angle": 26.255, "splay_distance": 4.085, "splay_ratio": 0.231, "d22": null, "d64": null, "eta": 167.057, "theta": -151.931, "eta_prime": -175.186, "theta_prime": -150.035, "eta_base": -128.512, "theta_base": -135.694, "v0": 2.918, "v1": -27.399, "v2": 40.074, "v3": -39.247, "v4": 23.071, "amplitude": 41.400, "phase_angle": 14.545, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.906, "filter_rmsd": 0.063, "frame": { "rmsd": 0.005, "origin": [ 19.520, 31.272, 51.577 ], "x_axis": [ -0.627, 0.537, -0.564 ], "y_axis": [ 0.472, 0.838, 0.274 ], "z_axis": [ 0.620, -0.094, -0.779 ], "quaternion": [ 0.329, 0.280, 0.901, 0.050 ] } }, { "index": 39, "index_chain": 39, "chain_name": "A", "nt_resnum": 51, "nt_name": "G", "nt_code": "G", "nt_id": "///A/51", "linked_nts": [ "///A/50", "///A/52" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop,cap-donor,splayed-apart", "alpha": -71.053, "beta": -170.225, "gamma": 55.674, "delta": 86.894, "epsilon": -142.724, "zeta": 166.341, "epsilon_zeta": 50.935, "bb_type": "--", "chi": -156.288, "glyco_bond": "anti", "C5prime_xyz": [ -1.440, 8.756, 0.285 ], "P_xyz": [ 1.108, 9.117, 0.831 ], "form": ".", "ssZp": 4.165, "Dp": 4.580, "splay_angle": 96.386, "splay_distance": 13.715, "splay_ratio": 0.745, "d22": null, "d64": null, "eta": -178.749, "theta": 100.952, "eta_prime": -172.235, "theta_prime": 108.577, "eta_base": -151.524, "theta_base": 119.135, "v0": 1.497, "v1": -23.314, "v2": 35.061, "v3": -35.204, "v4": 21.264, "amplitude": 36.538, "phase_angle": 16.350, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.783, "filter_rmsd": 0.008, "frame": { "rmsd": 0.008, "origin": [ 20.538, 29.256, 48.173 ], "x_axis": [ -0.443, 0.871, -0.212 ], "y_axis": [ 0.748, 0.489, 0.449 ], "z_axis": [ 0.495, 0.041, -0.868 ], "quaternion": [ 0.211, 0.484, 0.837, 0.146 ] } }, { "index": 40, "index_chain": 40, "chain_name": "A", "nt_resnum": 52, "nt_name": "U", "nt_code": "U", "nt_id": "///A/52", "linked_nts": [ "///A/51", "///A/53" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,anti,~C2'-endo,non-pair-contact,junction-loop,cap-donor,splayed-apart", "alpha": -72.791, "beta": 148.295, "gamma": 40.578, "delta": 85.866, "epsilon": 62.598, "zeta": -59.479, "epsilon_zeta": -237.923, "bb_type": "--", "chi": -169.846, "glyco_bond": "anti", "C5prime_xyz": [ -1.906, 8.715, 0.934 ], "P_xyz": [ 0.341, 8.799, 2.326 ], "form": ".", "ssZp": 1.045, "Dp": 1.450, "splay_angle": 30.121, "splay_distance": 4.872, "splay_ratio": 0.276, "d22": null, "d64": null, "eta": -168.229, "theta": 131.789, "eta_prime": -164.464, "theta_prime": 83.797, "eta_base": 178.370, "theta_base": 98.916, "v0": -5.938, "v1": -8.603, "v2": 18.912, "v3": -23.160, "v4": 18.246, "amplitude": 22.718, "phase_angle": 33.648, "puckering": "C3'-endo", "sugar_class": "~C2'-endo", "bin": "33p", "cluster": "3a", "suiteness": 0.843, "filter_rmsd": 0.106, "frame": { "rmsd": 0.009, "origin": [ 31.646, 22.908, 53.114 ], "x_axis": [ -0.983, -0.124, 0.135 ], "y_axis": [ -0.156, 0.954, -0.257 ], "z_axis": [ -0.097, -0.274, -0.957 ], "quaternion": [ -0.059, -0.071, 0.987, -0.135 ] } }, { "index": 41, "index_chain": 41, "chain_name": "A", "nt_resnum": 53, "nt_name": "A", "nt_code": "A", "nt_id": "///A/53", "linked_nts": [ "///A/52", "///A/54" ], "nt_type": "RNA", "dbn": ".", "summary": "syn,non-canonical,non-pair-contact,helix-end,multiplet,junction-loop,cap-acceptor,phosphate", "alpha": 140.004, "beta": -161.511, "gamma": 172.648, "delta": 87.535, "epsilon": -135.875, "zeta": -127.774, "epsilon_zeta": -8.101, "bb_type": "--", "chi": 62.069, "glyco_bond": "syn", "C5prime_xyz": [ -5.378, 4.399, 1.901 ], "P_xyz": [ -5.389, 3.835, 4.472 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": 157.372, "theta": 136.951, "eta_prime": 133.954, "theta_prime": 130.588, "eta_base": 172.127, "theta_base": null, "v0": -9.738, "v1": -12.001, "v2": 27.673, "v3": -34.261, "v4": 27.745, "amplitude": 33.802, "phase_angle": 35.049, "puckering": "C3'-endo", "sugar_class": "--", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.005, "origin": [ 33.142, 26.770, 55.680 ], "x_axis": [ -0.918, -0.342, 0.201 ], "y_axis": [ -0.387, 0.884, -0.263 ], "z_axis": [ -0.088, -0.319, -0.944 ], "quaternion": [ -0.075, -0.188, 0.968, -0.150 ] } }, { "index": 42, "index_chain": 42, "chain_name": "A", "nt_resnum": 54, "nt_name": "U", "nt_code": "U", "nt_id": "///A/54", "linked_nts": [ "///A/53", "///A/55" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,non-stack,junction-loop", "alpha": -127.353, "beta": 162.705, "gamma": -71.310, "delta": 85.695, "epsilon": -167.434, "zeta": -158.247, "epsilon_zeta": -9.186, "bb_type": "--", "chi": null, "glyco_bond": "--", "C5prime_xyz": [ null, null, null ], "P_xyz": [ null, null, null ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": 4.396, "theta": 120.199, "eta_prime": -10.954, "theta_prime": 154.413, "eta_base": null, "theta_base": null, "v0": 4.456, "v1": -26.723, "v2": 37.409, "v3": -35.858, "v4": 19.891, "amplitude": 38.251, "phase_angle": 12.046, "puckering": "C3'-endo", "sugar_class": "--", "bin": "33m", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": null }, { "index": 43, "index_chain": 43, "chain_name": "A", "nt_resnum": 55, "nt_name": "C", "nt_code": "C", "nt_id": "///A/55", "linked_nts": [ "///A/54", "///A/56" ], "nt_type": "RNA", "dbn": ".", "summary": "non-stack,junction-loop,phosphate", "alpha": 46.672, "beta": 131.968, "gamma": 62.334, "delta": 87.791, "epsilon": -146.484, "zeta": -127.801, "epsilon_zeta": -18.683, "bb_type": "--", "chi": null, "glyco_bond": "--", "C5prime_xyz": [ null, null, null ], "P_xyz": [ null, null, null ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": -99.921, "theta": -140.763, "eta_prime": -115.225, "theta_prime": -144.342, "eta_base": null, "theta_base": null, "v0": 6.137, "v1": -27.074, "v2": 36.477, "v3": -34.045, "v4": 17.638, "amplitude": 36.968, "phase_angle": 9.344, "puckering": "C3'-endo", "sugar_class": "--", "bin": "33p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": null }, { "index": 44, "index_chain": 44, "chain_name": "A", "nt_resnum": 56, "nt_name": "A", "nt_code": "A", "nt_id": "///A/56", "linked_nts": [ "///A/55", "///A/57" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-canonical,non-pair-contact,helix,multiplet,junction-loop,A-minor", "alpha": 73.583, "beta": 129.317, "gamma": 56.736, "delta": 81.475, "epsilon": -125.436, "zeta": -58.311, "epsilon_zeta": -67.125, "bb_type": "--", "chi": -160.028, "glyco_bond": "anti", "C5prime_xyz": [ -1.391, 8.776, 0.459 ], "P_xyz": [ 1.080, 8.704, -0.431 ], "form": ".", "ssZp": 4.279, "Dp": 4.738, "splay_angle": 41.965, "splay_distance": 6.563, "splay_ratio": 0.358, "d22": null, "d64": null, "eta": -87.571, "theta": -103.416, "eta_prime": -88.817, "theta_prime": -102.499, "eta_base": null, "theta_base": -55.938, "v0": 1.888, "v1": -27.340, "v2": 41.017, "v3": -40.710, "v4": 24.574, "amplitude": 42.657, "phase_angle": 15.940, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "7d", "suiteness": 0.183, "filter_rmsd": 0.039, "frame": { "rmsd": 0.003, "origin": [ 25.069, 29.105, 58.711 ], "x_axis": [ 0.907, -0.356, 0.224 ], "y_axis": [ 0.379, 0.922, -0.073 ], "z_axis": [ -0.181, 0.151, 0.972 ], "quaternion": [ 0.975, -0.057, -0.104, -0.189 ] } }, { "index": 45, "index_chain": 45, "chain_name": "A", "nt_resnum": 57, "nt_name": "C", "nt_code": "C", "nt_id": "///A/57", "linked_nts": [ "///A/56", "///A/58" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop,phosphate", "alpha": -53.673, "beta": 160.444, "gamma": 51.267, "delta": 82.245, "epsilon": -158.018, "zeta": -74.933, "epsilon_zeta": -83.085, "bb_type": "BI", "chi": -152.737, "glyco_bond": "anti", "C5prime_xyz": [ -1.280, 8.835, 0.063 ], "P_xyz": [ 1.308, 9.089, -0.301 ], "form": "A", "ssZp": 4.241, "Dp": 4.565, "splay_angle": 28.307, "splay_distance": 4.478, "splay_ratio": 0.245, "d22": 4.135, "d64": 4.528, "eta": 156.600, "theta": -149.937, "eta_prime": -166.107, "theta_prime": -151.041, "eta_base": -87.629, "theta_base": -132.771, "v0": 1.452, "v1": -25.616, "v2": 38.730, "v3": -38.811, "v4": 23.486, "amplitude": 40.386, "phase_angle": 16.465, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.598, "filter_rmsd": 0.062, "frame": { "rmsd": 0.002, "origin": [ 30.902, 30.601, 61.321 ], "x_axis": [ 0.665, 0.734, -0.137 ], "y_axis": [ -0.728, 0.678, 0.104 ], "z_axis": [ 0.169, 0.031, 0.985 ], "quaternion": [ 0.912, 0.020, 0.084, 0.401 ] } }, { "index": 46, "index_chain": 46, "chain_name": "A", "nt_resnum": 58, "nt_name": "C", "nt_code": "C", "nt_id": "///A/58", "linked_nts": [ "///A/57", "///A/59" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -64.132, "beta": 171.702, "gamma": 61.443, "delta": 83.345, "epsilon": -151.010, "zeta": -73.756, "epsilon_zeta": -77.255, "bb_type": "BI", "chi": -171.815, "glyco_bond": "anti", "C5prime_xyz": [ -1.613, 8.679, 1.074 ], "P_xyz": [ 0.923, 9.123, 1.535 ], "form": "A", "ssZp": 4.378, "Dp": 4.521, "splay_angle": 21.980, "splay_distance": 3.405, "splay_ratio": 0.191, "d22": 4.226, "d64": 3.764, "eta": 175.609, "theta": -144.217, "eta_prime": -171.571, "theta_prime": -142.683, "eta_base": -139.688, "theta_base": -105.358, "v0": -0.367, "v1": -22.468, "v2": 35.329, "v3": -36.772, "v4": 23.382, "amplitude": 37.430, "phase_angle": 19.289, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.843, "filter_rmsd": 0.064, "frame": { "rmsd": 0.007, "origin": [ 32.970, 30.385, 65.287 ], "x_axis": [ 0.229, 0.902, -0.366 ], "y_axis": [ -0.967, 0.255, 0.025 ], "z_axis": [ 0.116, 0.348, 0.930 ], "quaternion": [ 0.777, -0.104, 0.155, 0.601 ] } }, { "index": 47, "index_chain": 47, "chain_name": "A", "nt_resnum": 59, "nt_name": "U", "nt_code": "U", "nt_id": "///A/59", "linked_nts": [ "///A/58", "///A/60" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop", "alpha": -63.103, "beta": 175.565, "gamma": 52.113, "delta": 87.160, "epsilon": -136.832, "zeta": -73.494, "epsilon_zeta": -63.337, "bb_type": "BI", "chi": -159.567, "glyco_bond": "anti", "C5prime_xyz": [ -1.312, 8.677, 0.395 ], "P_xyz": [ 1.233, 8.864, 1.052 ], "form": ".", "ssZp": 3.967, "Dp": 4.525, "splay_angle": 19.741, "splay_distance": 3.183, "splay_ratio": 0.173, "d22": null, "d64": null, "eta": 175.208, "theta": -130.461, "eta_prime": -171.071, "theta_prime": -128.103, "eta_base": -122.130, "theta_base": -84.545, "v0": 4.814, "v1": -25.894, "v2": 35.983, "v3": -34.253, "v4": 18.610, "amplitude": 36.696, "phase_angle": 11.313, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.882, "filter_rmsd": 0.105, "frame": { "rmsd": 0.013, "origin": [ 34.377, 32.217, 67.789 ], "x_axis": [ -0.477, 0.814, -0.330 ], "y_axis": [ -0.872, -0.393, 0.292 ], "z_axis": [ 0.108, 0.427, 0.898 ], "quaternion": [ 0.507, -0.067, 0.216, 0.832 ] } }, { "index": 48, "index_chain": 48, "chain_name": "A", "nt_resnum": 60, "nt_name": "G", "nt_code": "G", "nt_id": "///A/60", "linked_nts": [ "///A/59", "///A/61" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,non-canonical,non-pair-contact,helix,internal-loop,phosphate", "alpha": -69.770, "beta": 169.948, "gamma": 53.353, "delta": 91.094, "epsilon": -98.968, "zeta": -36.778, "epsilon_zeta": -62.189, "bb_type": "--", "chi": -138.276, "glyco_bond": "anti", "C5prime_xyz": [ -1.248, 8.689, -0.812 ], "P_xyz": [ 1.371, 8.820, -1.085 ], "form": ".", "ssZp": 2.714, "Dp": 4.533, "splay_angle": 18.856, "splay_distance": 3.389, "splay_ratio": 0.179, "d22": null, "d64": null, "eta": 175.472, "theta": -36.403, "eta_prime": -169.685, "theta_prime": -68.493, "eta_base": -118.130, "theta_base": -119.056, "v0": 4.228, "v1": -26.266, "v2": 36.787, "v3": -35.274, "v4": 19.657, "amplitude": 37.634, "phase_angle": 12.180, "puckering": "C3'-endo", "sugar_class": "--", "bin": "33p", "cluster": "1a", "suiteness": 0.661, "filter_rmsd": 0.009, "frame": { "rmsd": 0.009, "origin": [ 33.567, 34.488, 69.867 ], "x_axis": [ -0.953, 0.251, -0.170 ], "y_axis": [ -0.298, -0.680, 0.670 ], "z_axis": [ 0.052, 0.689, 0.723 ], "quaternion": [ 0.150, -0.032, 0.371, 0.916 ] } }, { "index": 49, "index_chain": 49, "chain_name": "A", "nt_resnum": 61, "nt_name": "A", "nt_code": "A", "nt_id": "///A/61", "linked_nts": [ "///A/60", "///A/62" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C2'-endo,non-canonical,non-pair-contact,helix,internal-loop,splayed-apart", "alpha": -172.373, "beta": -172.725, "gamma": 58.238, "delta": 137.346, "epsilon": -37.701, "zeta": 64.820, "epsilon_zeta": 257.479, "bb_type": "--", "chi": -149.906, "glyco_bond": "anti", "C5prime_xyz": [ -1.781, 8.481, 0.733 ], "P_xyz": [ 0.242, 8.440, 2.455 ], "form": ".", "ssZp": 0.403, "Dp": 0.618, "splay_angle": 137.848, "splay_distance": 17.984, "splay_ratio": 0.933, "d22": null, "d64": null, "eta": 79.532, "theta": 151.162, "eta_prime": 134.551, "theta_prime": 94.077, "eta_base": 112.645, "theta_base": 72.824, "v0": -7.702, "v1": 21.213, "v2": -25.964, "v3": 22.682, "v4": -9.450, "amplitude": 25.985, "phase_angle": 182.305, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.039, "frame": { "rmsd": 0.008, "origin": [ 32.923, 35.961, 72.851 ], "x_axis": [ 0.994, 0.054, 0.090 ], "y_axis": [ -0.046, -0.547, 0.836 ], "z_axis": [ 0.095, -0.835, -0.541 ], "quaternion": [ 0.476, 0.878, 0.002, 0.053 ] } }, { "index": 50, "index_chain": 50, "chain_name": "A", "nt_resnum": 62, "nt_name": "U", "nt_code": "U", "nt_id": "///A/62", "linked_nts": [ "///A/61", "///A/63" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,anti,~C2'-endo,non-stack,internal-loop,splayed-apart", "alpha": 88.050, "beta": 157.339, "gamma": 48.261, "delta": 137.513, "epsilon": -127.680, "zeta": -49.809, "epsilon_zeta": -77.872, "bb_type": "--", "chi": -127.957, "glyco_bond": "anti", "C5prime_xyz": [ -2.143, 8.606, -0.612 ], "P_xyz": [ 0.087, 9.162, 0.654 ], "form": ".", "ssZp": 1.127, "Dp": 1.396, "splay_angle": 162.472, "splay_distance": 18.857, "splay_ratio": 0.988, "d22": 10.890, "d64": 13.845, "eta": 6.852, "theta": -16.353, "eta_prime": 13.163, "theta_prime": -53.560, "eta_base": 17.191, "theta_base": -28.923, "v0": -10.643, "v1": 23.743, "v2": -27.277, "v3": 22.527, "v4": -7.558, "amplitude": 27.313, "phase_angle": 177.067, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.104, "frame": { "rmsd": 0.005, "origin": [ 25.049, 30.120, 87.928 ], "x_axis": [ -0.407, -0.900, -0.157 ], "y_axis": [ 0.121, 0.117, -0.986 ], "z_axis": [ 0.905, -0.420, 0.061 ], "quaternion": [ 0.439, -0.322, 0.605, -0.581 ] } }, { "index": 51, "index_chain": 51, "chain_name": "A", "nt_resnum": 63, "nt_name": "C", "nt_code": "C", "nt_id": "///A/63", "linked_nts": [ "///A/62", "///A/64" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop,phosphate,splayed-apart", "alpha": 123.048, "beta": 118.272, "gamma": -52.446, "delta": 100.671, "epsilon": -169.983, "zeta": -51.273, "epsilon_zeta": -118.710, "bb_type": "BI", "chi": -152.595, "glyco_bond": "anti", "C5prime_xyz": [ -0.546, 8.228, 0.103 ], "P_xyz": [ 1.137, 8.757, 2.019 ], "form": "A", "ssZp": 4.220, "Dp": 4.452, "splay_angle": 21.561, "splay_distance": 3.445, "splay_ratio": 0.188, "d22": 4.160, "d64": 4.054, "eta": -158.685, "theta": -142.331, "eta_prime": -118.704, "theta_prime": -135.245, "eta_base": -119.111, "theta_base": -105.248, "v0": 18.646, "v1": -33.734, "v2": 34.691, "v3": -25.234, "v4": 4.289, "amplitude": 35.477, "phase_angle": 347.917, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "23m", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.002, "origin": [ 33.976, 39.376, 74.136 ], "x_axis": [ -0.928, 0.147, -0.343 ], "y_axis": [ -0.363, -0.565, 0.741 ], "z_axis": [ -0.085, 0.812, 0.578 ], "quaternion": [ 0.146, -0.122, 0.443, 0.876 ] } }, { "index": 52, "index_chain": 52, "chain_name": "A", "nt_resnum": 64, "nt_name": "U", "nt_code": "U", "nt_id": "///A/64", "linked_nts": [ "///A/63", "///A/65" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -84.861, "beta": -173.162, "gamma": 55.623, "delta": 84.978, "epsilon": -144.215, "zeta": -75.256, "epsilon_zeta": -68.959, "bb_type": "BI", "chi": -153.885, "glyco_bond": "anti", "C5prime_xyz": [ -1.396, 8.766, 0.092 ], "P_xyz": [ 1.190, 9.229, 0.308 ], "form": "A", "ssZp": 4.165, "Dp": 4.626, "splay_angle": 23.190, "splay_distance": 3.798, "splay_ratio": 0.202, "d22": null, "d64": null, "eta": 166.182, "theta": -141.757, "eta_prime": -174.692, "theta_prime": -142.581, "eta_base": -134.911, "theta_base": -118.487, "v0": 1.600, "v1": -25.242, "v2": 37.873, "v3": -37.922, "v4": 22.967, "amplitude": 39.456, "phase_angle": 16.282, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.106, "filter_rmsd": 0.105, "frame": { "rmsd": 0.004, "origin": [ 33.235, 42.639, 74.955 ], "x_axis": [ -0.971, -0.229, 0.065 ], "y_axis": [ 0.172, -0.485, 0.858 ], "z_axis": [ -0.164, 0.844, 0.510 ], "quaternion": [ -0.116, -0.029, 0.494, 0.861 ] } }, { "index": 53, "index_chain": 53, "chain_name": "A", "nt_resnum": 65, "nt_name": "G", "nt_code": "G", "nt_id": "///A/65", "linked_nts": [ "///A/64", "///A/66" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -69.586, "beta": 162.003, "gamma": 59.673, "delta": 76.341, "epsilon": -159.475, "zeta": -61.972, "epsilon_zeta": -97.503, "bb_type": "BI", "chi": -163.520, "glyco_bond": "anti", "C5prime_xyz": [ -1.535, 8.855, 0.635 ], "P_xyz": [ 0.949, 9.539, 0.239 ], "form": "A", "ssZp": 4.547, "Dp": 4.645, "splay_angle": 22.577, "splay_distance": 3.736, "splay_ratio": 0.204, "d22": null, "d64": null, "eta": 158.053, "theta": -145.875, "eta_prime": 174.548, "theta_prime": -147.231, "eta_base": -143.516, "theta_base": -120.710, "v0": -0.476, "v1": -26.483, "v2": 41.709, "v3": -42.885, "v4": 27.477, "amplitude": 44.129, "phase_angle": 19.062, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.838, "filter_rmsd": 0.003, "frame": { "rmsd": 0.003, "origin": [ 31.346, 45.775, 75.966 ], "x_axis": [ -0.709, -0.597, 0.375 ], "y_axis": [ 0.611, -0.254, 0.750 ], "z_axis": [ -0.353, 0.761, 0.545 ], "quaternion": [ -0.382, 0.007, 0.477, 0.792 ] } }, { "index": 54, "index_chain": 54, "chain_name": "A", "nt_resnum": 66, "nt_name": "G", "nt_code": "G", "nt_id": "///A/66", "linked_nts": [ "///A/65", "///A/67" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop", "alpha": -59.865, "beta": -177.785, "gamma": 47.030, "delta": 80.419, "epsilon": -166.640, "zeta": -66.368, "epsilon_zeta": -100.273, "bb_type": "BI", "chi": -156.040, "glyco_bond": "anti", "C5prime_xyz": [ -1.495, 8.877, 0.286 ], "P_xyz": [ 0.990, 9.619, 0.644 ], "form": "A", "ssZp": 4.327, "Dp": 4.467, "splay_angle": 20.755, "splay_distance": 3.648, "splay_ratio": 0.191, "d22": null, "d64": null, "eta": 172.564, "theta": -129.922, "eta_prime": -172.373, "theta_prime": -139.425, "eta_base": -129.717, "theta_base": -113.147, "v0": -0.242, "v1": -24.982, "v2": 39.317, "v3": -40.486, "v4": 25.695, "amplitude": 41.559, "phase_angle": 18.905, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.791, "filter_rmsd": 0.005, "frame": { "rmsd": 0.005, "origin": [ 28.119, 47.427, 76.869 ], "x_axis": [ -0.232, -0.688, 0.687 ], "y_axis": [ 0.852, 0.196, 0.485 ], "z_axis": [ -0.469, 0.698, 0.541 ], "quaternion": [ 0.613, -0.087, -0.471, -0.628 ] } }, { "index": 55, "index_chain": 55, "chain_name": "A", "nt_resnum": 67, "nt_name": "A", "nt_code": "A", "nt_id": "///A/67", "linked_nts": [ "///A/66", "///A/68" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,multiplet,hairpin-loop", "alpha": 153.593, "beta": -174.720, "gamma": 175.405, "delta": 87.006, "epsilon": -138.710, "zeta": -67.800, "epsilon_zeta": -70.910, "bb_type": "BI", "chi": -171.915, "glyco_bond": "anti", "C5prime_xyz": [ -0.983, 8.322, 1.226 ], "P_xyz": [ 0.430, 10.156, -0.027 ], "form": "A", "ssZp": 4.662, "Dp": 4.760, "splay_angle": 22.001, "splay_distance": 3.570, "splay_ratio": 0.198, "d22": null, "d64": null, "eta": 162.020, "theta": -158.485, "eta_prime": 176.424, "theta_prime": -151.373, "eta_base": -137.235, "theta_base": -113.851, "v0": 11.104, "v1": -32.211, "v2": 39.975, "v3": -34.599, "v4": 14.895, "amplitude": 40.025, "phase_angle": 2.875, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.927, "filter_rmsd": 0.038, "frame": { "rmsd": 0.005, "origin": [ 25.008, 47.831, 78.731 ], "x_axis": [ 0.260, -0.547, 0.796 ], "y_axis": [ 0.770, 0.615, 0.171 ], "z_axis": [ -0.583, 0.568, 0.581 ], "quaternion": [ 0.784, -0.127, -0.440, -0.420 ] } }, { "index": 56, "index_chain": 56, "chain_name": "A", "nt_resnum": 68, "nt_name": "U", "nt_code": "U", "nt_id": "///A/68", "linked_nts": [ "///A/67", "///A/69" ], "nt_type": "RNA", "dbn": ".", "summary": "u-turn,anti,~C3'-endo,BI,non-pair-contact,hairpin-loop,cap-acceptor", "alpha": -59.212, "beta": 170.692, "gamma": 53.588, "delta": 83.628, "epsilon": -146.400, "zeta": -69.051, "epsilon_zeta": -77.349, "bb_type": "BI", "chi": -149.266, "glyco_bond": "anti", "C5prime_xyz": [ -1.661, 8.830, -0.092 ], "P_xyz": [ 0.886, 9.445, -0.397 ], "form": ".", "ssZp": 4.107, "Dp": 4.570, "splay_angle": 69.383, "splay_distance": 10.365, "splay_ratio": 0.569, "d22": null, "d64": null, "eta": 169.931, "theta": -116.257, "eta_prime": -168.815, "theta_prime": -159.244, "eta_base": -118.891, "theta_base": 137.968, "v0": -2.571, "v1": -21.118, "v2": 35.389, "v3": -37.775, "v4": 25.419, "amplitude": 38.247, "phase_angle": 22.289, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.865, "filter_rmsd": 0.104, "frame": { "rmsd": 0.004, "origin": [ 23.137, 47.294, 81.723 ], "x_axis": [ 0.616, -0.019, 0.787 ], "y_axis": [ 0.278, 0.940, -0.195 ], "z_axis": [ -0.737, 0.339, 0.585 ], "quaternion": [ 0.886, -0.151, -0.430, -0.084 ] } }, { "index": 57, "index_chain": 57, "chain_name": "A", "nt_resnum": 69, "nt_name": "A", "nt_code": "A", "nt_id": "///A/69", "linked_nts": [ "///A/68", "///A/70" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,u-turn,anti,~C3'-endo,BI,non-canonical,non-pair-contact,multiplet,hairpin-loop,A-minor,phosphate", "alpha": 165.366, "beta": 169.066, "gamma": 50.703, "delta": 87.928, "epsilon": -143.157, "zeta": -66.710, "epsilon_zeta": -76.448, "bb_type": "BI", "chi": -175.056, "glyco_bond": "anti", "C5prime_xyz": [ -1.511, 8.489, 1.357 ], "P_xyz": [ 0.936, 8.554, 2.331 ], "form": "A", "ssZp": 4.269, "Dp": 4.484, "splay_angle": 20.326, "splay_distance": 3.217, "splay_ratio": 0.177, "d22": null, "d64": null, "eta": 29.442, "theta": -127.749, "eta_prime": 50.762, "theta_prime": -127.264, "eta_base": 25.773, "theta_base": -88.860, "v0": 3.303, "v1": -23.323, "v2": 33.324, "v3": -32.472, "v4": 18.484, "amplitude": 34.249, "phase_angle": 13.345, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1g", "suiteness": 0.929, "filter_rmsd": 0.040, "frame": { "rmsd": 0.009, "origin": [ 15.308, 50.947, 75.997 ], "x_axis": [ 0.226, 0.610, -0.760 ], "y_axis": [ 0.373, 0.666, 0.646 ], "z_axis": [ 0.900, -0.429, -0.077 ], "quaternion": [ 0.674, 0.399, 0.616, 0.088 ] } }, { "index": 58, "index_chain": 58, "chain_name": "A", "nt_resnum": 70, "nt_name": "A", "nt_code": "A", "nt_id": "///A/70", "linked_nts": [ "///A/69", "///A/71" ], "nt_type": "RNA", "dbn": ".", "summary": "u-turn,anti,~C3'-endo,BI,non-pair-contact,hairpin-loop,A-minor,ribose-zipper,cap-donor,phosphate", "alpha": -83.383, "beta": 178.995, "gamma": 58.450, "delta": 83.328, "epsilon": -148.736, "zeta": -83.655, "epsilon_zeta": -65.082, "bb_type": "BI", "chi": -151.648, "glyco_bond": "anti", "C5prime_xyz": [ -1.412, 8.739, -0.109 ], "P_xyz": [ 1.176, 9.132, -0.050 ], "form": "A", "ssZp": 4.010, "Dp": 4.592, "splay_angle": 19.466, "splay_distance": 3.158, "splay_ratio": 0.169, "d22": null, "d64": null, "eta": 156.499, "theta": -151.982, "eta_prime": 176.354, "theta_prime": -154.536, "eta_base": -127.128, "theta_base": -144.226, "v0": 3.220, "v1": -27.126, "v2": 39.272, "v3": -38.336, "v4": 22.208, "amplitude": 40.480, "phase_angle": 14.028, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.648, "filter_rmsd": 0.039, "frame": { "rmsd": 0.009, "origin": [ 17.974, 50.071, 74.425 ], "x_axis": [ 0.401, 0.911, -0.095 ], "y_axis": [ 0.254, -0.011, 0.967 ], "z_axis": [ 0.880, -0.412, -0.236 ], "quaternion": [ 0.537, 0.642, 0.454, 0.306 ] } }, { "index": 59, "index_chain": 59, "chain_name": "A", "nt_resnum": 71, "nt_name": "U", "nt_code": "U", "nt_id": "///A/71", "linked_nts": [ "///A/70", "///A/72" ], "nt_type": "RNA", "dbn": ".", "summary": "u-turn,anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,multiplet,hairpin-loop,ribose-zipper,phosphate,splayed-apart", "alpha": -57.862, "beta": 158.012, "gamma": 56.233, "delta": 79.954, "epsilon": -151.293, "zeta": -74.633, "epsilon_zeta": -76.660, "bb_type": "BI", "chi": -150.912, "glyco_bond": "anti", "C5prime_xyz": [ -1.605, 8.838, -0.027 ], "P_xyz": [ 0.875, 9.351, -0.648 ], "form": ".", "ssZp": 4.169, "Dp": 4.576, "splay_angle": 106.333, "splay_distance": 12.140, "splay_ratio": 0.813, "d22": null, "d64": null, "eta": 167.675, "theta": -140.724, "eta_prime": 178.579, "theta_prime": 177.738, "eta_base": -158.246, "theta_base": 100.115, "v0": -0.198, "v1": -24.830, "v2": 38.861, "v3": -40.044, "v4": 25.572, "amplitude": 41.079, "phase_angle": 18.915, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.792, "filter_rmsd": 0.105, "frame": { "rmsd": 0.005, "origin": [ 20.082, 48.563, 72.621 ], "x_axis": [ 0.475, 0.844, 0.249 ], "y_axis": [ 0.257, -0.404, 0.878 ], "z_axis": [ 0.841, -0.354, -0.409 ], "quaternion": [ 0.407, 0.756, 0.364, 0.360 ] } }, { "index": 60, "index_chain": 60, "chain_name": "A", "nt_resnum": 72, "nt_name": "G", "nt_code": "G", "nt_id": "///A/72", "linked_nts": [ "///A/71", "///A/73" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,syn,~C3'-endo,non-stack,non-pair-contact,hairpin-loop,phosphate,splayed-apart", "alpha": 176.516, "beta": 146.472, "gamma": 49.344, "delta": 74.695, "epsilon": -157.438, "zeta": 142.610, "epsilon_zeta": 59.951, "bb_type": "--", "chi": -0.055, "glyco_bond": "syn", "C5prime_xyz": [ -5.463, 4.026, -1.495 ], "P_xyz": [ -5.220, 1.424, -1.815 ], "form": ".", "ssZp": -4.611, "Dp": 4.620, "splay_angle": 93.136, "splay_distance": 12.640, "splay_ratio": 0.726, "d22": null, "d64": null, "eta": 23.233, "theta": 79.580, "eta_prime": 39.893, "theta_prime": 44.572, "eta_base": 36.458, "theta_base": -6.114, "v0": -4.992, "v1": -22.665, "v2": 40.422, "v3": -43.696, "v4": 30.771, "amplitude": 44.435, "phase_angle": 24.538, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1g", "suiteness": 0.633, "filter_rmsd": 0.011, "frame": { "rmsd": 0.011, "origin": [ 20.757, 37.454, 77.469 ], "x_axis": [ -0.814, -0.528, -0.243 ], "y_axis": [ 0.256, 0.050, -0.965 ], "z_axis": [ 0.522, -0.848, 0.094 ], "quaternion": [ -0.288, 0.102, -0.665, 0.681 ] } }, { "index": 61, "index_chain": 61, "chain_name": "A", "nt_resnum": 73, "nt_name": "C", "nt_code": "C", "nt_id": "///A/73", "linked_nts": [ "///A/72", "///A/74" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop,phosphate,splayed-apart", "alpha": 150.381, "beta": -161.884, "gamma": 50.196, "delta": 86.979, "epsilon": -157.895, "zeta": -66.346, "epsilon_zeta": -91.549, "bb_type": "BI", "chi": -165.601, "glyco_bond": "anti", "C5prime_xyz": [ -1.042, 8.539, 0.926 ], "P_xyz": [ 1.398, 8.569, 1.877 ], "form": "A", "ssZp": 4.550, "Dp": 4.566, "splay_angle": 25.743, "splay_distance": 3.982, "splay_ratio": 0.223, "d22": 4.379, "d64": 4.293, "eta": 65.840, "theta": -142.733, "eta_prime": 90.958, "theta_prime": -139.257, "eta_base": 158.882, "theta_base": -112.949, "v0": 6.539, "v1": -26.986, "v2": 35.950, "v3": -33.276, "v4": 16.961, "amplitude": 36.357, "phase_angle": 8.589, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.065, "frame": { "rmsd": 0.005, "origin": [ 28.148, 47.701, 77.098 ], "x_axis": [ -0.097, -0.852, 0.515 ], "y_axis": [ -0.769, -0.265, -0.582 ], "z_axis": [ 0.632, -0.452, -0.629 ], "quaternion": [ -0.049, 0.670, -0.604, 0.428 ] } }, { "index": 62, "index_chain": 62, "chain_name": "A", "nt_resnum": 74, "nt_name": "C", "nt_code": "C", "nt_id": "///A/74", "linked_nts": [ "///A/73", "///A/75" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -73.908, "beta": -173.150, "gamma": 51.886, "delta": 85.496, "epsilon": -151.013, "zeta": -68.037, "epsilon_zeta": -82.975, "bb_type": "BI", "chi": -166.905, "glyco_bond": "anti", "C5prime_xyz": [ -1.227, 8.631, 0.871 ], "P_xyz": [ 1.276, 8.806, 1.627 ], "form": "A", "ssZp": 4.460, "Dp": 4.614, "splay_angle": 23.077, "splay_distance": 3.612, "splay_ratio": 0.201, "d22": null, "d64": null, "eta": 169.005, "theta": -138.435, "eta_prime": -177.813, "theta_prime": -136.836, "eta_base": -138.840, "theta_base": -105.146, "v0": 5.830, "v1": -28.555, "v2": 38.905, "v3": -36.657, "v4": 19.478, "amplitude": 39.541, "phase_angle": 10.295, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.785, "filter_rmsd": 0.063, "frame": { "rmsd": 0.006, "origin": [ 31.433, 45.808, 75.881 ], "x_axis": [ -0.637, -0.736, 0.229 ], "y_axis": [ -0.607, 0.295, -0.738 ], "z_axis": [ 0.476, -0.609, -0.634 ], "quaternion": [ 0.077, -0.419, 0.801, -0.421 ] } }, { "index": 63, "index_chain": 63, "chain_name": "A", "nt_resnum": 75, "nt_name": "A", "nt_code": "A", "nt_id": "///A/75", "linked_nts": [ "///A/74", "///A/76" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -72.149, "beta": 178.421, "gamma": 52.117, "delta": 83.513, "epsilon": -157.668, "zeta": -78.277, "epsilon_zeta": -79.391, "bb_type": "BI", "chi": -163.235, "glyco_bond": "anti", "C5prime_xyz": [ -1.336, 8.667, 0.712 ], "P_xyz": [ 1.266, 9.020, 0.958 ], "form": "A", "ssZp": 4.542, "Dp": 4.611, "splay_angle": 23.697, "splay_distance": 3.755, "splay_ratio": 0.209, "d22": null, "d64": null, "eta": 161.415, "theta": -151.504, "eta_prime": 178.369, "theta_prime": -150.738, "eta_base": -131.664, "theta_base": -133.228, "v0": 2.833, "v1": -26.157, "v2": 38.317, "v3": -37.636, "v4": 21.895, "amplitude": 39.582, "phase_angle": 14.520, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.911, "filter_rmsd": 0.038, "frame": { "rmsd": 0.003, "origin": [ 32.831, 42.638, 74.859 ], "x_axis": [ -0.908, -0.353, -0.224 ], "y_axis": [ -0.072, 0.659, -0.749 ], "z_axis": [ 0.412, -0.664, -0.624 ], "quaternion": [ 0.178, -0.119, 0.893, -0.396 ] } }, { "index": 64, "index_chain": 64, "chain_name": "A", "nt_resnum": 76, "nt_name": "G", "nt_code": "G", "nt_id": "///A/76", "linked_nts": [ "///A/75", "///A/77" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop", "alpha": -51.133, "beta": 166.324, "gamma": 52.899, "delta": 83.770, "epsilon": -144.228, "zeta": -59.270, "epsilon_zeta": -84.959, "bb_type": "BI", "chi": -162.050, "glyco_bond": "anti", "C5prime_xyz": [ -1.493, 8.803, 0.600 ], "P_xyz": [ 1.080, 9.254, 0.698 ], "form": ".", "ssZp": 4.403, "Dp": 4.613, "splay_angle": 30.944, "splay_distance": 4.836, "splay_ratio": 0.267, "d22": null, "d64": null, "eta": 179.200, "theta": -124.493, "eta_prime": -169.113, "theta_prime": -121.326, "eta_base": -140.201, "theta_base": -67.272, "v0": 0.640, "v1": -25.261, "v2": 38.691, "v3": -39.475, "v4": 24.494, "amplitude": 40.620, "phase_angle": 17.728, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.777, "filter_rmsd": 0.003, "frame": { "rmsd": 0.003, "origin": [ 34.019, 39.124, 74.277 ], "x_axis": [ -0.832, -0.057, -0.551 ], "y_axis": [ 0.360, 0.701, -0.616 ], "z_axis": [ 0.421, -0.711, -0.563 ], "quaternion": [ 0.276, 0.086, 0.880, -0.377 ] } }, { "index": 65, "index_chain": 65, "chain_name": "A", "nt_resnum": 77, "nt_name": "C", "nt_code": "C", "nt_id": "///A/77", "linked_nts": [ "///A/76", "///A/78" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-canonical,non-pair-contact,helix,internal-loop,phosphate", "alpha": -68.887, "beta": 175.235, "gamma": 52.198, "delta": 86.625, "epsilon": -162.597, "zeta": 47.660, "epsilon_zeta": 149.744, "bb_type": "--", "chi": -151.244, "glyco_bond": "anti", "C5prime_xyz": [ -1.177, 8.747, 0.000 ], "P_xyz": [ 1.438, 8.962, 0.103 ], "form": ".", "ssZp": 4.089, "Dp": 4.446, "splay_angle": 18.395, "splay_distance": 2.919, "splay_ratio": 0.162, "d22": null, "d64": null, "eta": 162.171, "theta": -22.200, "eta_prime": -170.553, "theta_prime": -63.964, "eta_base": -96.125, "theta_base": -110.682, "v0": 3.866, "v1": -25.264, "v2": 35.835, "v3": -34.570, "v4": 19.498, "amplitude": 36.740, "phase_angle": 12.741, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.832, "filter_rmsd": 0.062, "frame": { "rmsd": 0.003, "origin": [ 32.543, 38.050, 69.799 ], "x_axis": [ -0.172, 0.694, -0.699 ], "y_axis": [ 0.966, 0.259, 0.020 ], "z_axis": [ 0.195, -0.671, -0.715 ], "quaternion": [ 0.305, 0.567, 0.733, -0.222 ] } }, { "index": 66, "index_chain": 66, "chain_name": "A", "nt_resnum": 78, "nt_name": "G", "nt_code": "G", "nt_id": "///A/78", "linked_nts": [ "///A/77", "///A/79" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,non-canonical,non-pair-contact,helix,internal-loop", "alpha": 164.656, "beta": 168.388, "gamma": 37.562, "delta": 112.453, "epsilon": 76.521, "zeta": -72.893, "epsilon_zeta": -210.586, "bb_type": "--", "chi": -128.200, "glyco_bond": "anti", "C5prime_xyz": [ -1.339, 8.500, -0.574 ], "P_xyz": [ 1.012, 8.708, 0.553 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": 37.653, "theta": 155.835, "eta_prime": 122.373, "theta_prime": 82.109, "eta_base": 117.900, "theta_base": null, "v0": -2.099, "v1": 14.768, "v2": -21.572, "v3": 21.076, "v4": -11.793, "amplitude": 22.190, "phase_angle": 193.551, "puckering": "C3'-exo", "sugar_class": "--", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.005, "frame": { "rmsd": 0.005, "origin": [ 32.884, 36.767, 67.200 ], "x_axis": [ -0.154, -0.563, 0.812 ], "y_axis": [ 0.985, -0.152, 0.081 ], "z_axis": [ 0.078, 0.812, 0.578 ], "quaternion": [ 0.564, -0.324, -0.326, -0.686 ] } }, { "index": 67, "index_chain": 67, "chain_name": "A", "nt_resnum": 79, "nt_name": "U", "nt_code": "U", "nt_id": "///A/79", "linked_nts": [ "///A/78", "///A/80" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,non-stack,internal-loop,phosphate", "alpha": 152.775, "beta": 162.840, "gamma": 58.566, "delta": 82.923, "epsilon": 164.953, "zeta": 30.806, "epsilon_zeta": 134.146, "bb_type": "--", "chi": null, "glyco_bond": "--", "C5prime_xyz": [ null, null, null ], "P_xyz": [ null, null, null ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": 8.563, "theta": -35.992, "eta_prime": 8.974, "theta_prime": -58.378, "eta_base": null, "theta_base": null, "v0": 7.763, "v1": -29.396, "v2": 38.516, "v3": -35.069, "v4": 17.342, "amplitude": 38.833, "phase_angle": 7.332, "puckering": "C3'-endo", "sugar_class": "--", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": null }, { "index": 68, "index_chain": 68, "chain_name": "A", "nt_resnum": 80, "nt_name": "A", "nt_code": "A", "nt_id": "///A/80", "linked_nts": [ "///A/79", "///A/81" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop,phosphate", "alpha": 66.912, "beta": 122.572, "gamma": -46.550, "delta": 97.456, "epsilon": -156.789, "zeta": -57.922, "epsilon_zeta": -98.867, "bb_type": "BI", "chi": -161.222, "glyco_bond": "anti", "C5prime_xyz": [ -0.521, 8.122, 0.653 ], "P_xyz": [ 1.141, 8.194, 2.673 ], "form": "A", "ssZp": 4.491, "Dp": 4.630, "splay_angle": 24.311, "splay_distance": 3.758, "splay_ratio": 0.211, "d22": null, "d64": null, "eta": -160.683, "theta": -138.568, "eta_prime": -120.185, "theta_prime": -130.556, "eta_base": null, "theta_base": -99.178, "v0": 20.629, "v1": -35.781, "v2": 36.512, "v3": -25.623, "v4": 3.283, "amplitude": 37.590, "phase_angle": 346.246, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "33m", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.003, "origin": [ 34.408, 32.125, 67.571 ], "x_axis": [ -0.486, 0.676, -0.555 ], "y_axis": [ 0.858, 0.247, -0.450 ], "z_axis": [ -0.167, -0.695, -0.700 ], "quaternion": [ 0.124, 0.492, 0.780, -0.367 ] } }, { "index": 69, "index_chain": 69, "chain_name": "A", "nt_resnum": 81, "nt_name": "G", "nt_code": "G", "nt_id": "///A/81", "linked_nts": [ "///A/80", "///A/82" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -81.025, "beta": -168.643, "gamma": 47.623, "delta": 81.948, "epsilon": -165.765, "zeta": -68.086, "epsilon_zeta": -97.679, "bb_type": "BI", "chi": -156.545, "glyco_bond": "anti", "C5prime_xyz": [ -0.998, 8.647, 0.371 ], "P_xyz": [ 1.581, 8.827, 0.770 ], "form": "A", "ssZp": 4.439, "Dp": 4.603, "splay_angle": 22.491, "splay_distance": 3.821, "splay_ratio": 0.206, "d22": null, "d64": null, "eta": 159.434, "theta": -126.314, "eta_prime": 177.352, "theta_prime": -134.005, "eta_base": -139.883, "theta_base": -113.917, "v0": 7.584, "v1": -30.489, "v2": 40.766, "v3": -37.409, "v4": 18.857, "amplitude": 41.192, "phase_angle": 8.251, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.295, "filter_rmsd": 0.005, "frame": { "rmsd": 0.005, "origin": [ 32.463, 30.162, 65.023 ], "x_axis": [ 0.154, 0.794, -0.588 ], "y_axis": [ 0.967, -0.243, -0.074 ], "z_axis": [ -0.202, -0.557, -0.806 ], "quaternion": [ 0.163, 0.742, 0.593, -0.266 ] } }, { "index": 70, "index_chain": 70, "chain_name": "A", "nt_resnum": 82, "nt_name": "G", "nt_code": "G", "nt_id": "///A/82", "linked_nts": [ "///A/81", "///A/83" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop", "alpha": 156.566, "beta": -166.425, "gamma": 171.890, "delta": 84.679, "epsilon": -128.135, "zeta": -61.963, "epsilon_zeta": -66.172, "bb_type": "--", "chi": 177.595, "glyco_bond": "anti", "C5prime_xyz": [ -1.106, 8.087, 1.889 ], "P_xyz": [ 0.588, 9.846, 0.981 ], "form": ".", "ssZp": 4.921, "Dp": 4.838, "splay_angle": 33.482, "splay_distance": 4.985, "splay_ratio": 0.290, "d22": null, "d64": null, "eta": 163.487, "theta": -141.706, "eta_prime": 179.038, "theta_prime": -133.509, "eta_base": -138.510, "theta_base": -78.359, "v0": 10.534, "v1": -31.040, "v2": 38.615, "v3": -33.667, "v4": 14.751, "amplitude": 38.679, "phase_angle": 3.296, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.895, "filter_rmsd": 0.006, "frame": { "rmsd": 0.006, "origin": [ 30.313, 30.285, 61.866 ], "x_axis": [ 0.618, 0.655, -0.435 ], "y_axis": [ 0.768, -0.621, 0.156 ], "z_axis": [ -0.168, -0.431, -0.887 ], "quaternion": [ 0.166, 0.884, 0.403, -0.171 ] } }, { "index": 71, "index_chain": 71, "chain_name": "A", "nt_resnum": 83, "nt_name": "G", "nt_code": "G", "nt_id": "///A/83", "linked_nts": [ "///A/82", "///A/84" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-canonical,non-pair-contact,helix,multiplet,junction-loop", "alpha": -58.028, "beta": 174.695, "gamma": 51.529, "delta": 88.715, "epsilon": -119.603, "zeta": -125.712, "epsilon_zeta": 6.108, "bb_type": "--", "chi": -152.820, "glyco_bond": "anti", "C5prime_xyz": [ -1.074, 8.678, 0.151 ], "P_xyz": [ 1.547, 8.742, 0.306 ], "form": ".", "ssZp": 3.919, "Dp": 4.660, "splay_angle": 44.223, "splay_distance": 6.977, "splay_ratio": 0.378, "d22": null, "d64": null, "eta": 177.251, "theta": -175.079, "eta_prime": -158.652, "theta_prime": -167.467, "eta_base": -90.125, "theta_base": 163.998, "v0": 3.848, "v1": -24.700, "v2": 34.815, "v3": -33.708, "v4": 18.913, "amplitude": 35.683, "phase_angle": 12.662, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.652, "filter_rmsd": 0.004, "frame": { "rmsd": 0.004, "origin": [ 32.920, 31.145, 57.705 ], "x_axis": [ 0.953, -0.272, -0.130 ], "y_axis": [ -0.227, -0.931, 0.285 ], "z_axis": [ -0.198, -0.242, -0.950 ], "quaternion": [ 0.135, 0.979, -0.127, -0.084 ] } }, { "index": 72, "index_chain": 72, "chain_name": "A", "nt_resnum": 84, "nt_name": "A", "nt_code": "A", "nt_id": "///A/84", "linked_nts": [ "///A/83", "///A/85" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,BI,non-canonical,non-pair-contact,helix-end,multiplet,junction-loop,A-minor,cap-acceptor", "alpha": -87.848, "beta": 165.328, "gamma": 47.207, "delta": 87.041, "epsilon": -145.353, "zeta": -58.875, "epsilon_zeta": -86.478, "bb_type": "BI", "chi": -122.467, "glyco_bond": "anti", "C5prime_xyz": [ -1.608, 8.357, -1.670 ], "P_xyz": [ 0.928, 8.449, -2.378 ], "form": ".", "ssZp": 2.579, "Dp": 4.546, "splay_angle": 73.620, "splay_distance": 11.640, "splay_ratio": 0.599, "d22": null, "d64": null, "eta": 156.387, "theta": -130.012, "eta_prime": 150.368, "theta_prime": -151.870, "eta_base": 126.516, "theta_base": 167.330, "v0": 2.618, "v1": -24.186, "v2": 35.244, "v3": -34.811, "v4": 20.342, "amplitude": 36.428, "phase_angle": 14.647, "puckering": "C3'-endo", "sugar_class": "--", "bin": "33p", "cluster": "7a", "suiteness": 0.236, "filter_rmsd": 0.038, "frame": { "rmsd": 0.006, "origin": [ 26.373, 31.495, 55.319 ], "x_axis": [ 0.975, 0.111, 0.192 ], "y_axis": [ 0.138, -0.982, -0.132 ], "z_axis": [ 0.174, 0.155, -0.973 ], "quaternion": [ -0.072, 0.991, 0.063, 0.092 ] } }, { "index": 73, "index_chain": 73, "chain_name": "A", "nt_resnum": 85, "nt_name": "A", "nt_code": "A", "nt_id": "///A/85", "linked_nts": [ "///A/84", "///A/86" ], "nt_type": "RNA", "dbn": ")", "summary": "~C2'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop", "alpha": -177.473, "beta": 79.827, "gamma": -178.227, "delta": 131.624, "epsilon": -175.076, "zeta": -116.562, "epsilon_zeta": -58.514, "bb_type": "BI", "chi": -86.651, "glyco_bond": "--", "C5prime_xyz": [ -2.904, 7.611, -2.251 ], "P_xyz": [ -4.214, 7.287, -4.503 ], "form": "B", "ssZp": 2.017, "Dp": 1.969, "splay_angle": 19.783, "splay_distance": 3.540, "splay_ratio": 0.175, "d22": null, "d64": null, "eta": 178.905, "theta": 137.176, "eta_prime": 165.634, "theta_prime": 140.101, "eta_base": 132.381, "theta_base": -170.585, "v0": -8.525, "v1": 21.239, "v2": -25.301, "v3": 21.675, "v4": -8.332, "amplitude": 25.301, "phase_angle": 180.178, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "32t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.035, "frame": { "rmsd": 0.009, "origin": [ 21.430, 28.206, 45.307 ], "x_axis": [ 0.168, 0.981, 0.094 ], "y_axis": [ 0.943, -0.188, 0.275 ], "z_axis": [ 0.287, 0.043, -0.957 ], "quaternion": [ 0.076, 0.760, 0.633, 0.126 ] } }, { "index": 74, "index_chain": 74, "chain_name": "A", "nt_resnum": 86, "nt_name": "G", "nt_code": "G", "nt_id": "///A/86", "linked_nts": [ "///A/85", "///A/87" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": 114.098, "beta": -154.031, "gamma": -173.306, "delta": 81.378, "epsilon": -155.201, "zeta": -69.494, "epsilon_zeta": -85.707, "bb_type": "BI", "chi": -161.968, "glyco_bond": "anti", "C5prime_xyz": [ -1.295, 8.750, 0.635 ], "P_xyz": [ -0.173, 10.402, -1.081 ], "form": "A", "ssZp": 4.404, "Dp": 4.599, "splay_angle": 20.786, "splay_distance": 3.282, "splay_ratio": 0.182, "d22": null, "d64": null, "eta": 144.865, "theta": -177.076, "eta_prime": 144.005, "theta_prime": -173.580, "eta_base": -158.411, "theta_base": -146.685, "v0": 3.080, "v1": -26.962, "v2": 39.780, "v3": -38.780, "v4": 22.415, "amplitude": 41.048, "phase_angle": 14.276, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.004, "frame": { "rmsd": 0.004, "origin": [ 22.022, 29.038, 41.917 ], "x_axis": [ 0.607, 0.699, 0.379 ], "y_axis": [ 0.678, -0.704, 0.212 ], "z_axis": [ 0.415, 0.128, -0.901 ], "quaternion": [ 0.023, 0.896, 0.384, 0.221 ] } }, { "index": 75, "index_chain": 75, "chain_name": "A", "nt_resnum": 87, "nt_name": "U", "nt_code": "U", "nt_id": "///A/87", "linked_nts": [ "///A/86", "///A/88" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -68.013, "beta": -177.159, "gamma": 47.294, "delta": 81.734, "epsilon": -156.783, "zeta": -72.608, "epsilon_zeta": -84.174, "bb_type": "BI", "chi": -153.635, "glyco_bond": "anti", "C5prime_xyz": [ -1.194, 8.698, 0.144 ], "P_xyz": [ 1.393, 9.130, 0.169 ], "form": "A", "ssZp": 4.353, "Dp": 4.658, "splay_angle": 23.969, "splay_distance": 3.699, "splay_ratio": 0.209, "d22": 3.979, "d64": 4.286, "eta": 164.180, "theta": -150.272, "eta_prime": 175.436, "theta_prime": -147.653, "eta_base": -146.759, "theta_base": -117.696, "v0": 5.592, "v1": -29.706, "v2": 41.147, "v3": -38.921, "v4": 20.945, "amplitude": 41.914, "phase_angle": 10.980, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.890, "filter_rmsd": 0.103, "frame": { "rmsd": 0.004, "origin": [ 22.664, 30.803, 39.226 ], "x_axis": [ 0.853, 0.228, 0.470 ], "y_axis": [ 0.330, -0.932, -0.148 ], "z_axis": [ 0.404, 0.281, -0.870 ], "quaternion": [ -0.112, 0.956, 0.146, 0.228 ] } }, { "index": 76, "index_chain": 76, "chain_name": "A", "nt_resnum": 88, "nt_name": "C", "nt_code": "C", "nt_id": "///A/88", "linked_nts": [ "///A/87", "///A/89" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -56.015, "beta": 164.991, "gamma": 56.862, "delta": 84.492, "epsilon": -156.184, "zeta": -72.954, "epsilon_zeta": -83.230, "bb_type": "BI", "chi": -163.628, "glyco_bond": "anti", "C5prime_xyz": [ -1.168, 8.691, 0.748 ], "P_xyz": [ 1.453, 8.913, 0.556 ], "form": "A", "ssZp": 4.554, "Dp": 4.618, "splay_angle": 23.916, "splay_distance": 3.736, "splay_ratio": 0.209, "d22": null, "d64": null, "eta": 172.643, "theta": -146.139, "eta_prime": -169.539, "theta_prime": -147.366, "eta_base": -123.450, "theta_base": -127.377, "v0": 5.164, "v1": -27.798, "v2": 38.589, "v3": -36.570, "v4": 19.814, "amplitude": 39.332, "phase_angle": 11.156, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.862, "filter_rmsd": 0.062, "frame": { "rmsd": 0.002, "origin": [ 24.949, 32.992, 37.310 ], "x_axis": [ 0.877, -0.328, 0.350 ], "y_axis": [ -0.155, -0.884, -0.442 ], "z_axis": [ 0.454, 0.334, -0.826 ], "quaternion": [ -0.205, 0.947, -0.127, 0.212 ] } }, { "index": 77, "index_chain": 77, "chain_name": "A", "nt_resnum": 89, "nt_name": "G", "nt_code": "G", "nt_id": "///A/89", "linked_nts": [ "///A/88", "///A/90" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -71.886, "beta": 173.391, "gamma": 64.328, "delta": 86.396, "epsilon": -158.567, "zeta": -66.593, "epsilon_zeta": -91.974, "bb_type": "BI", "chi": -166.722, "glyco_bond": "anti", "C5prime_xyz": [ -1.448, 8.709, 0.833 ], "P_xyz": [ 1.157, 9.063, 1.002 ], "form": "A", "ssZp": 4.330, "Dp": 4.498, "splay_angle": 22.481, "splay_distance": 3.576, "splay_ratio": 0.196, "d22": null, "d64": null, "eta": 172.143, "theta": -140.858, "eta_prime": -171.959, "theta_prime": -142.380, "eta_base": -135.420, "theta_base": -113.115, "v0": 5.410, "v1": -28.278, "v2": 38.795, "v3": -36.573, "v4": 19.821, "amplitude": 39.490, "phase_angle": 10.767, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.727, "filter_rmsd": 0.008, "frame": { "rmsd": 0.008, "origin": [ 27.262, 35.301, 35.500 ], "x_axis": [ 0.625, -0.762, 0.171 ], "y_axis": [ -0.554, -0.587, -0.591 ], "z_axis": [ 0.550, 0.275, -0.788 ], "quaternion": [ -0.250, 0.866, -0.380, 0.208 ] } }, { "index": 78, "index_chain": 78, "chain_name": "A", "nt_resnum": 90, "nt_name": "C", "nt_code": "C", "nt_id": "///A/90", "linked_nts": [ "///A/89", "///A/91" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,splayed-apart", "alpha": -67.940, "beta": 176.159, "gamma": 55.502, "delta": 86.706, "epsilon": -130.469, "zeta": 68.807, "epsilon_zeta": 160.724, "bb_type": "--", "chi": -159.034, "glyco_bond": "anti", "C5prime_xyz": [ -1.459, 8.808, 0.311 ], "P_xyz": [ 1.082, 9.227, 0.841 ], "form": ".", "ssZp": 3.876, "Dp": 4.499, "splay_angle": 140.704, "splay_distance": 17.462, "splay_ratio": 0.942, "d22": null, "d64": null, "eta": 177.864, "theta": 18.982, "eta_prime": -167.971, "theta_prime": 21.205, "eta_base": -125.639, "theta_base": 35.358, "v0": 2.201, "v1": -24.800, "v2": 36.652, "v3": -36.495, "v4": 21.646, "amplitude": 38.023, "phase_angle": 15.433, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.826, "filter_rmsd": 0.064, "frame": { "rmsd": 0.013, "origin": [ 30.297, 36.181, 33.825 ], "x_axis": [ 0.143, -0.972, -0.188 ], "y_axis": [ -0.800, -0.001, -0.600 ], "z_axis": [ 0.583, 0.236, -0.778 ], "quaternion": [ -0.302, 0.693, -0.639, 0.142 ] } }, { "index": 79, "index_chain": 79, "chain_name": "A", "nt_resnum": 91, "nt_name": "A23", "nt_code": "a", "is_modified": true, "nt_id": "///A/91", "linked_nts": [ "///A/90", null ], "nt_type": "RNA", "dbn": ".", "summary": "modified,anti,non-stack,ss-non-loop,phosphate,splayed-apart", "alpha": -143.739, "beta": -106.453, "gamma": 64.220, "delta": 127.452, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": -145.877, "glyco_bond": "anti", "C5prime_xyz": [ -1.086, 8.636, -0.309 ], "P_xyz": [ 0.756, 8.829, 1.546 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": -1.392, "v1": 7.913, "v2": -11.274, "v3": 10.722, "v4": -6.130, "amplitude": 11.537, "phase_angle": 192.272, "puckering": "C3'-exo", "sugar_class": "--", "bin": "32p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.005, "origin": [ 17.413, 40.840, 22.997 ], "x_axis": [ -0.317, 0.093, 0.944 ], "y_axis": [ 0.915, -0.233, 0.330 ], "z_axis": [ 0.251, 0.968, -0.011 ], "quaternion": [ -0.331, 0.482, 0.523, 0.620 ] } } ], "num_hbonds": 140, "hbonds": [ { "index": 1, "atom1_serNum": 15, "atom2_serNum": 1634, "donAcc_type": "standard", "distance": 2.970, "atom1_id": "///A/9/O6", "atom2_id": "///A/90/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 2, "atom1_serNum": 16, "atom2_serNum": 1632, "donAcc_type": "standard", "distance": 2.997, "atom1_id": "///A/9/N1", "atom2_id": "///A/90/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 3, "atom1_serNum": 18, "atom2_serNum": 1631, "donAcc_type": "standard", "distance": 2.954, "atom1_id": "///A/9/N2", "atom2_id": "///A/90/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 4, "atom1_serNum": 35, "atom2_serNum": 1614, "donAcc_type": "standard", "distance": 2.831, "atom1_id": "///A/10/O2", "atom2_id": "///A/89/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 5, "atom1_serNum": 36, "atom2_serNum": 1612, "donAcc_type": "standard", "distance": 2.847, "atom1_id": "///A/10/N3", "atom2_id": "///A/89/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 6, "atom1_serNum": 38, "atom2_serNum": 1611, "donAcc_type": "standard", "distance": 2.833, "atom1_id": "///A/10/N4", "atom2_id": "///A/89/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 7, "atom1_serNum": 51, "atom2_serNum": 70, "donAcc_type": "acceptable", "distance": 2.821, "atom1_id": "///A/11/O2'", "atom2_id": "///A/12/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 8, "atom1_serNum": 58, "atom2_serNum": 1591, "donAcc_type": "standard", "distance": 2.952, "atom1_id": "///A/11/O6", "atom2_id": "///A/88/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 9, "atom1_serNum": 59, "atom2_serNum": 1589, "donAcc_type": "standard", "distance": 2.856, "atom1_id": "///A/11/N1", "atom2_id": "///A/88/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 10, "atom1_serNum": 61, "atom2_serNum": 1588, "donAcc_type": "standard", "distance": 2.722, "atom1_id": "///A/11/N2", "atom2_id": "///A/88/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 11, "atom1_serNum": 74, "atom2_serNum": 92, "donAcc_type": "acceptable", "distance": 3.181, "atom1_id": "///A/12/O2'", "atom2_id": "///A/13/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 12, "atom1_serNum": 81, "atom2_serNum": 1548, "donAcc_type": "standard", "distance": 3.237, "atom1_id": "///A/12/N6", "atom2_id": "///A/86/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 13, "atom1_serNum": 81, "atom2_serNum": 1571, "donAcc_type": "standard", "distance": 3.091, "atom1_id": "///A/12/N6", "atom2_id": "///A/87/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 14, "atom1_serNum": 82, "atom2_serNum": 1569, "donAcc_type": "standard", "distance": 2.932, "atom1_id": "///A/12/N1", "atom2_id": "///A/87/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 15, "atom1_serNum": 100, "atom2_serNum": 1551, "donAcc_type": "standard", "distance": 2.654, "atom1_id": "///A/13/O2", "atom2_id": "///A/86/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 16, "atom1_serNum": 101, "atom2_serNum": 1549, "donAcc_type": "standard", "distance": 2.834, "atom1_id": "///A/13/N3", "atom2_id": "///A/86/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 17, "atom1_serNum": 103, "atom2_serNum": 1548, "donAcc_type": "standard", "distance": 2.976, "atom1_id": "///A/13/N4", "atom2_id": "///A/86/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 18, "atom1_serNum": 121, "atom2_serNum": 1527, "donAcc_type": "standard", "distance": 3.043, "atom1_id": "///A/14/N3", "atom2_id": "///A/85/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 19, "atom1_serNum": 123, "atom2_serNum": 1526, "donAcc_type": "standard", "distance": 3.254, "atom1_id": "///A/14/O4", "atom2_id": "///A/85/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 20, "atom1_serNum": 140, "atom2_serNum": 825, "donAcc_type": "standard", "distance": 2.836, "atom1_id": "///A/15/O2", "atom2_id": "///A/51/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 21, "atom1_serNum": 141, "atom2_serNum": 823, "donAcc_type": "standard", "distance": 2.938, "atom1_id": "///A/15/N3", "atom2_id": "///A/51/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 22, "atom1_serNum": 143, "atom2_serNum": 822, "donAcc_type": "standard", "distance": 2.984, "atom1_id": "///A/15/N4", "atom2_id": "///A/51/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 23, "atom1_serNum": 156, "atom2_serNum": 1497, "donAcc_type": "acceptable", "distance": 2.933, "atom1_id": "///A/16/O2'", "atom2_id": "///A/84/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 24, "atom1_serNum": 163, "atom2_serNum": 802, "donAcc_type": "standard", "distance": 3.305, "atom1_id": "///A/16/O6", "atom2_id": "///A/50/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 25, "atom1_serNum": 164, "atom2_serNum": 800, "donAcc_type": "standard", "distance": 3.048, "atom1_id": "///A/16/N1", "atom2_id": "///A/50/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 26, "atom1_serNum": 166, "atom2_serNum": 799, "donAcc_type": "standard", "distance": 2.743, "atom1_id": "///A/16/N2", "atom2_id": "///A/50/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 27, "atom1_serNum": 166, "atom2_serNum": 1507, "donAcc_type": "standard", "distance": 3.131, "atom1_id": "///A/16/N2", "atom2_id": "///A/84/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 28, "atom1_serNum": 175, "atom2_serNum": 1493, "donAcc_type": "questionable", "distance": 3.199, "atom1_id": "///A/17/O4'", "atom2_id": "///A/84/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 29, "atom1_serNum": 179, "atom2_serNum": 912, "donAcc_type": "acceptable", "distance": 2.927, "atom1_id": "///A/17/O2'", "atom2_id": "///A/56/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 30, "atom1_serNum": 186, "atom2_serNum": 782, "donAcc_type": "standard", "distance": 3.443, "atom1_id": "///A/17/O6", "atom2_id": "///A/49/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 31, "atom1_serNum": 187, "atom2_serNum": 780, "donAcc_type": "standard", "distance": 3.113, "atom1_id": "///A/17/N1", "atom2_id": "///A/49/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 32, "atom1_serNum": 189, "atom2_serNum": 779, "donAcc_type": "standard", "distance": 2.669, "atom1_id": "///A/17/N2", "atom2_id": "///A/49/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 33, "atom1_serNum": 189, "atom2_serNum": 914, "donAcc_type": "standard", "distance": 3.189, "atom1_id": "///A/17/N2", "atom2_id": "///A/56/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 34, "atom1_serNum": 202, "atom2_serNum": 221, "donAcc_type": "acceptable", "distance": 3.215, "atom1_id": "///A/18/O2'", "atom2_id": "///A/19/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 35, "atom1_serNum": 202, "atom2_serNum": 922, "donAcc_type": "acceptable", "distance": 3.078, "atom1_id": "///A/18/O2'", "atom2_id": "///A/57/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 36, "atom1_serNum": 202, "atom2_serNum": 926, "donAcc_type": "acceptable", "distance": 3.046, "atom1_id": "///A/18/O2'", "atom2_id": "///A/57/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 37, "atom1_serNum": 209, "atom2_serNum": 762, "donAcc_type": "standard", "distance": 3.034, "atom1_id": "///A/18/O6", "atom2_id": "///A/48/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 38, "atom1_serNum": 210, "atom2_serNum": 760, "donAcc_type": "standard", "distance": 3.033, "atom1_id": "///A/18/N1", "atom2_id": "///A/48/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 39, "atom1_serNum": 212, "atom2_serNum": 759, "donAcc_type": "standard", "distance": 2.969, "atom1_id": "///A/18/N2", "atom2_id": "///A/48/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 40, "atom1_serNum": 225, "atom2_serNum": 1677, "donAcc_type": "acceptable", "distance": 3.080, "atom1_id": "///A/19/O2'", "atom2_id": "///A/114/N1'", "atom_pair": "O:N", "residue_pair": "nt:ligand" }, { "index": 41, "atom1_serNum": 232, "atom2_serNum": 740, "donAcc_type": "standard", "distance": 2.904, "atom1_id": "///A/19/O6", "atom2_id": "///A/47/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 42, "atom1_serNum": 233, "atom2_serNum": 741, "donAcc_type": "standard", "distance": 2.961, "atom1_id": "///A/19/N1", "atom2_id": "///A/47/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 43, "atom1_serNum": 235, "atom2_serNum": 643, "donAcc_type": "standard", "distance": 2.832, "atom1_id": "///A/19/N2", "atom2_id": "///A/42/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 44, "atom1_serNum": 235, "atom2_serNum": 759, "donAcc_type": "standard", "distance": 3.077, "atom1_id": "///A/19/N2", "atom2_id": "///A/48/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 45, "atom1_serNum": 236, "atom2_serNum": 642, "donAcc_type": "standard", "distance": 2.702, "atom1_id": "///A/19/N3", "atom2_id": "///A/42/N2", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 46, "atom1_serNum": 248, "atom2_serNum": 259, "donAcc_type": "acceptable", "distance": 2.917, "atom1_id": "///A/20/O2'", "atom2_id": "///A/21/OP1", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 47, "atom1_serNum": 253, "atom2_serNum": 707, "donAcc_type": "standard", "distance": 3.109, "atom1_id": "///A/20/N3", "atom2_id": "///A/45/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 48, "atom1_serNum": 255, "atom2_serNum": 706, "donAcc_type": "standard", "distance": 3.375, "atom1_id": "///A/20/O4", "atom2_id": "///A/45/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 49, "atom1_serNum": 268, "atom2_serNum": 1223, "donAcc_type": "acceptable", "distance": 3.501, "atom1_id": "///A/21/O2'", "atom2_id": "///A/71/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 50, "atom1_serNum": 272, "atom2_serNum": 655, "donAcc_type": "acceptable", "distance": 2.630, "atom1_id": "///A/21/N7", "atom2_id": "///A/43/O2'", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 51, "atom1_serNum": 275, "atom2_serNum": 554, "donAcc_type": "standard", "distance": 2.980, "atom1_id": "///A/21/O6", "atom2_id": "///A/38/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 52, "atom1_serNum": 276, "atom2_serNum": 552, "donAcc_type": "standard", "distance": 3.198, "atom1_id": "///A/21/N1", "atom2_id": "///A/38/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 53, "atom1_serNum": 278, "atom2_serNum": 551, "donAcc_type": "standard", "distance": 3.290, "atom1_id": "///A/21/N2", "atom2_id": "///A/38/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 54, "atom1_serNum": 278, "atom2_serNum": 1227, "donAcc_type": "standard", "distance": 2.569, "atom1_id": "///A/21/N2", "atom2_id": "///A/71/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 55, "atom1_serNum": 287, "atom2_serNum": 1223, "donAcc_type": "acceptable", "distance": 3.556, "atom1_id": "///A/22/O4'", "atom2_id": "///A/71/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 56, "atom1_serNum": 289, "atom2_serNum": 1201, "donAcc_type": "acceptable", "distance": 3.013, "atom1_id": "///A/22/O3'", "atom2_id": "///A/70/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 57, "atom1_serNum": 291, "atom2_serNum": 1201, "donAcc_type": "acceptable", "distance": 2.635, "atom1_id": "///A/22/O2'", "atom2_id": "///A/70/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 58, "atom1_serNum": 291, "atom2_serNum": 1211, "donAcc_type": "acceptable", "distance": 2.811, "atom1_id": "///A/22/O2'", "atom2_id": "///A/70/N3", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 59, "atom1_serNum": 291, "atom2_serNum": 1219, "donAcc_type": "acceptable", "distance": 3.112, "atom1_id": "///A/22/O2'", "atom2_id": "///A/71/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 60, "atom1_serNum": 295, "atom2_serNum": 534, "donAcc_type": "standard", "distance": 2.731, "atom1_id": "///A/22/O2", "atom2_id": "///A/37/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 61, "atom1_serNum": 296, "atom2_serNum": 532, "donAcc_type": "standard", "distance": 2.908, "atom1_id": "///A/22/N3", "atom2_id": "///A/37/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 62, "atom1_serNum": 298, "atom2_serNum": 531, "donAcc_type": "standard", "distance": 3.002, "atom1_id": "///A/22/N4", "atom2_id": "///A/37/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 63, "atom1_serNum": 315, "atom2_serNum": 511, "donAcc_type": "standard", "distance": 2.656, "atom1_id": "///A/23/O2", "atom2_id": "///A/36/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 64, "atom1_serNum": 316, "atom2_serNum": 509, "donAcc_type": "standard", "distance": 2.873, "atom1_id": "///A/23/N3", "atom2_id": "///A/36/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 65, "atom1_serNum": 318, "atom2_serNum": 508, "donAcc_type": "standard", "distance": 3.040, "atom1_id": "///A/23/N4", "atom2_id": "///A/36/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 66, "atom1_serNum": 331, "atom2_serNum": 343, "donAcc_type": "acceptable", "distance": 2.319, "atom1_id": "///A/24/O2'", "atom2_id": "///A/25/OP2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 67, "atom1_serNum": 335, "atom2_serNum": 486, "donAcc_type": "standard", "distance": 2.192, "atom1_id": "///A/24/O2", "atom2_id": "///A/35/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 68, "atom1_serNum": 358, "atom2_serNum": 511, "donAcc_type": "standard", "distance": 2.775, "atom1_id": "///A/25/O4", "atom2_id": "///A/36/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 69, "atom1_serNum": 434, "atom2_serNum": 450, "donAcc_type": "acceptable", "distance": 2.581, "atom1_id": "///A/33/O2'", "atom2_id": "///A/34/O5'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 70, "atom1_serNum": 434, "atom2_serNum": 453, "donAcc_type": "acceptable", "distance": 3.000, "atom1_id": "///A/33/O2'", "atom2_id": "///A/34/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 71, "atom1_serNum": 534, "atom2_serNum": 1187, "donAcc_type": "standard", "distance": 3.316, "atom1_id": "///A/37/N2", "atom2_id": "///A/69/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 72, "atom1_serNum": 543, "atom2_serNum": 1186, "donAcc_type": "standard", "distance": 2.935, "atom1_id": "///A/38/O4'", "atom2_id": "///A/69/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 73, "atom1_serNum": 547, "atom2_serNum": 1208, "donAcc_type": "acceptable", "distance": 3.223, "atom1_id": "///A/38/O2'", "atom2_id": "///A/70/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 74, "atom1_serNum": 567, "atom2_serNum": 1264, "donAcc_type": "acceptable", "distance": 3.525, "atom1_id": "///A/39/O2'", "atom2_id": "///A/73/O3'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 75, "atom1_serNum": 571, "atom2_serNum": 662, "donAcc_type": "standard", "distance": 2.862, "atom1_id": "///A/39/O2", "atom2_id": "///A/43/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 76, "atom1_serNum": 572, "atom2_serNum": 659, "donAcc_type": "standard", "distance": 2.726, "atom1_id": "///A/39/N3", "atom2_id": "///A/43/N7", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 77, "atom1_serNum": 587, "atom2_serNum": 636, "donAcc_type": "acceptable", "distance": 2.833, "atom1_id": "///A/40/O2'", "atom2_id": "///A/42/N7", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 78, "atom1_serNum": 595, "atom2_serNum": 647, "donAcc_type": "standard", "distance": 2.743, "atom1_id": "///A/40/N1", "atom2_id": "///A/43/OP2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 79, "atom1_serNum": 597, "atom2_serNum": 648, "donAcc_type": "standard", "distance": 2.970, "atom1_id": "///A/40/N2", "atom2_id": "///A/43/O5'", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 80, "atom1_serNum": 597, "atom2_serNum": 651, "donAcc_type": "standard", "distance": 3.159, "atom1_id": "///A/40/N2", "atom2_id": "///A/43/O4'", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 81, "atom1_serNum": 597, "atom2_serNum": 1680, "donAcc_type": "unknown", "distance": 2.912, "atom1_id": "///A/40/N2", "atom2_id": "///A/114/N3'", "atom_pair": "N:N", "residue_pair": "nt:ligand" }, { "index": 82, "atom1_serNum": 598, "atom2_serNum": 1682, "donAcc_type": "standard", "distance": 2.908, "atom1_id": "///A/40/N3", "atom2_id": "///A/114/N4'", "atom_pair": "N:N", "residue_pair": "nt:ligand" }, { "index": 83, "atom1_serNum": 610, "atom2_serNum": 755, "donAcc_type": "acceptable", "distance": 2.917, "atom1_id": "///A/41/O2'", "atom2_id": "///A/48/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 84, "atom1_serNum": 617, "atom2_serNum": 902, "donAcc_type": "standard", "distance": 3.347, "atom1_id": "///A/41/N6", "atom2_id": "///A/56/O3'", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 85, "atom1_serNum": 617, "atom2_serNum": 917, "donAcc_type": "standard", "distance": 3.065, "atom1_id": "///A/41/N6", "atom2_id": "///A/57/OP1", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 86, "atom1_serNum": 620, "atom2_serNum": 755, "donAcc_type": "acceptable", "distance": 2.526, "atom1_id": "///A/41/N3", "atom2_id": "///A/48/O2'", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 87, "atom1_serNum": 628, "atom2_serNum": 755, "donAcc_type": "acceptable", "distance": 3.548, "atom1_id": "///A/42/O4'", "atom2_id": "///A/48/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 88, "atom1_serNum": 662, "atom2_serNum": 1258, "donAcc_type": "standard", "distance": 2.991, "atom1_id": "///A/43/N6", "atom2_id": "///A/73/OP2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 89, "atom1_serNum": 677, "atom2_serNum": 691, "donAcc_type": "acceptable", "distance": 2.423, "atom1_id": "///A/44/O2'", "atom2_id": "///A/45/OP2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 90, "atom1_serNum": 699, "atom2_serNum": 729, "donAcc_type": "acceptable", "distance": 2.932, "atom1_id": "///A/45/O2'", "atom2_id": "///A/47/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 91, "atom1_serNum": 775, "atom2_serNum": 904, "donAcc_type": "acceptable", "distance": 3.062, "atom1_id": "///A/49/O2'", "atom2_id": "///A/56/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 92, "atom1_serNum": 791, "atom2_serNum": 900, "donAcc_type": "questionable", "distance": 3.165, "atom1_id": "///A/50/O4'", "atom2_id": "///A/56/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 93, "atom1_serNum": 795, "atom2_serNum": 1505, "donAcc_type": "acceptable", "distance": 2.562, "atom1_id": "///A/50/O2'", "atom2_id": "///A/84/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 94, "atom1_serNum": 834, "atom2_serNum": 854, "donAcc_type": "questionable", "distance": 2.959, "atom1_id": "///A/52/O4'", "atom2_id": "///A/53/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 95, "atom1_serNum": 838, "atom2_serNum": 842, "donAcc_type": "acceptable", "distance": 3.169, "atom1_id": "///A/52/O2'", "atom2_id": "///A/52/O2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 96, "atom1_serNum": 838, "atom2_serNum": 850, "donAcc_type": "acceptable", "distance": 2.147, "atom1_id": "///A/52/O2'", "atom2_id": "///A/53/OP2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 97, "atom1_serNum": 858, "atom2_serNum": 883, "donAcc_type": "acceptable", "distance": 3.436, "atom1_id": "///A/53/O2'", "atom2_id": "///A/55/OP1", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 98, "atom1_serNum": 862, "atom2_serNum": 1504, "donAcc_type": "standard", "distance": 2.985, "atom1_id": "///A/53/N7", "atom2_id": "///A/84/N6", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 99, "atom1_serNum": 865, "atom2_serNum": 1501, "donAcc_type": "standard", "distance": 3.704, "atom1_id": "///A/53/N6", "atom2_id": "///A/84/N7", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 100, "atom1_serNum": 908, "atom2_serNum": 1484, "donAcc_type": "standard", "distance": 2.843, "atom1_id": "///A/56/N7", "atom2_id": "///A/83/N2", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 101, "atom1_serNum": 911, "atom2_serNum": 1474, "donAcc_type": "acceptable", "distance": 2.900, "atom1_id": "///A/56/N6", "atom2_id": "///A/83/O2'", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 102, "atom1_serNum": 911, "atom2_serNum": 1485, "donAcc_type": "standard", "distance": 3.293, "atom1_id": "///A/56/N6", "atom2_id": "///A/83/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 103, "atom1_serNum": 930, "atom2_serNum": 1461, "donAcc_type": "standard", "distance": 2.905, "atom1_id": "///A/57/O2", "atom2_id": "///A/82/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 104, "atom1_serNum": 931, "atom2_serNum": 1459, "donAcc_type": "standard", "distance": 2.934, "atom1_id": "///A/57/N3", "atom2_id": "///A/82/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 105, "atom1_serNum": 933, "atom2_serNum": 1458, "donAcc_type": "standard", "distance": 2.968, "atom1_id": "///A/57/N4", "atom2_id": "///A/82/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 106, "atom1_serNum": 950, "atom2_serNum": 1438, "donAcc_type": "standard", "distance": 2.603, "atom1_id": "///A/58/O2", "atom2_id": "///A/81/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 107, "atom1_serNum": 951, "atom2_serNum": 1436, "donAcc_type": "standard", "distance": 2.640, "atom1_id": "///A/58/N3", "atom2_id": "///A/81/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 108, "atom1_serNum": 953, "atom2_serNum": 1435, "donAcc_type": "standard", "distance": 2.682, "atom1_id": "///A/58/N4", "atom2_id": "///A/81/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 109, "atom1_serNum": 971, "atom2_serNum": 1414, "donAcc_type": "standard", "distance": 2.991, "atom1_id": "///A/59/N3", "atom2_id": "///A/80/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 110, "atom1_serNum": 973, "atom2_serNum": 1413, "donAcc_type": "standard", "distance": 3.182, "atom1_id": "///A/59/O4", "atom2_id": "///A/80/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 111, "atom1_serNum": 978, "atom2_serNum": 1009, "donAcc_type": "acceptable", "distance": 2.731, "atom1_id": "///A/60/OP2", "atom2_id": "///A/61/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 112, "atom1_serNum": 994, "atom2_serNum": 1378, "donAcc_type": "standard", "distance": 2.699, "atom1_id": "///A/60/N1", "atom2_id": "///A/78/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 113, "atom1_serNum": 996, "atom2_serNum": 1375, "donAcc_type": "standard", "distance": 3.025, "atom1_id": "///A/60/N2", "atom2_id": "///A/78/N7", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 114, "atom1_serNum": 1016, "atom2_serNum": 1355, "donAcc_type": "standard", "distance": 2.725, "atom1_id": "///A/61/N6", "atom2_id": "///A/77/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 115, "atom1_serNum": 1055, "atom2_serNum": 1338, "donAcc_type": "standard", "distance": 2.542, "atom1_id": "///A/63/O2", "atom2_id": "///A/76/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 116, "atom1_serNum": 1056, "atom2_serNum": 1336, "donAcc_type": "standard", "distance": 2.732, "atom1_id": "///A/63/N3", "atom2_id": "///A/76/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 117, "atom1_serNum": 1058, "atom2_serNum": 1335, "donAcc_type": "standard", "distance": 2.924, "atom1_id": "///A/63/N4", "atom2_id": "///A/76/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 118, "atom1_serNum": 1076, "atom2_serNum": 1314, "donAcc_type": "standard", "distance": 2.962, "atom1_id": "///A/64/N3", "atom2_id": "///A/75/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 119, "atom1_serNum": 1078, "atom2_serNum": 1313, "donAcc_type": "standard", "distance": 3.431, "atom1_id": "///A/64/O4", "atom2_id": "///A/75/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 120, "atom1_serNum": 1098, "atom2_serNum": 1293, "donAcc_type": "standard", "distance": 3.071, "atom1_id": "///A/65/O6", "atom2_id": "///A/74/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 121, "atom1_serNum": 1099, "atom2_serNum": 1291, "donAcc_type": "standard", "distance": 2.994, "atom1_id": "///A/65/N1", "atom2_id": "///A/74/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 122, "atom1_serNum": 1101, "atom2_serNum": 1290, "donAcc_type": "standard", "distance": 2.842, "atom1_id": "///A/65/N2", "atom2_id": "///A/74/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 123, "atom1_serNum": 1121, "atom2_serNum": 1273, "donAcc_type": "standard", "distance": 2.818, "atom1_id": "///A/66/O6", "atom2_id": "///A/73/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 124, "atom1_serNum": 1122, "atom2_serNum": 1271, "donAcc_type": "standard", "distance": 2.786, "atom1_id": "///A/66/N1", "atom2_id": "///A/73/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 125, "atom1_serNum": 1124, "atom2_serNum": 1270, "donAcc_type": "standard", "distance": 2.717, "atom1_id": "///A/66/N2", "atom2_id": "///A/73/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 126, "atom1_serNum": 1144, "atom2_serNum": 1215, "donAcc_type": "standard", "distance": 3.281, "atom1_id": "///A/67/N6", "atom2_id": "///A/71/OP2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 127, "atom1_serNum": 1159, "atom2_serNum": 1205, "donAcc_type": "acceptable", "distance": 2.793, "atom1_id": "///A/68/O2'", "atom2_id": "///A/70/N7", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 128, "atom1_serNum": 1164, "atom2_serNum": 1215, "donAcc_type": "standard", "distance": 2.581, "atom1_id": "///A/68/N3", "atom2_id": "///A/71/OP2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 129, "atom1_serNum": 1234, "atom2_serNum": 1253, "donAcc_type": "standard", "distance": 2.312, "atom1_id": "///A/72/OP1", "atom2_id": "///A/72/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 130, "atom1_serNum": 1235, "atom2_serNum": 1273, "donAcc_type": "standard", "distance": 2.918, "atom1_id": "///A/72/OP2", "atom2_id": "///A/73/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 131, "atom1_serNum": 1243, "atom2_serNum": 1696, "donAcc_type": "acceptable", "distance": 3.332, "atom1_id": "///A/72/O2'", "atom2_id": "///A/114/O1A", "atom_pair": "O:O", "residue_pair": "nt:ligand" }, { "index": 132, "atom1_serNum": 1306, "atom2_serNum": 1324, "donAcc_type": "acceptable", "distance": 2.914, "atom1_id": "///A/75/O2'", "atom2_id": "///A/76/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 133, "atom1_serNum": 1343, "atom2_serNum": 1371, "donAcc_type": "acceptable", "distance": 2.875, "atom1_id": "///A/77/OP2", "atom2_id": "///A/78/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 134, "atom1_serNum": 1358, "atom2_serNum": 1701, "donAcc_type": "standard", "distance": 3.541, "atom1_id": "///A/77/N4", "atom2_id": "///A/114/O2B", "atom_pair": "N:O", "residue_pair": "nt:ligand" }, { "index": 135, "atom1_serNum": 1371, "atom2_serNum": 1386, "donAcc_type": "acceptable", "distance": 2.353, "atom1_id": "///A/78/O2'", "atom2_id": "///A/79/OP2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 136, "atom1_serNum": 1379, "atom2_serNum": 1701, "donAcc_type": "standard", "distance": 2.646, "atom1_id": "///A/78/N1", "atom2_id": "///A/114/O2B", "atom_pair": "N:O", "residue_pair": "nt:ligand" }, { "index": 137, "atom1_serNum": 1394, "atom2_serNum": 1397, "donAcc_type": "acceptable", "distance": 2.677, "atom1_id": "///A/79/O2'", "atom2_id": "///A/80/OP1", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 138, "atom1_serNum": 1519, "atom2_serNum": 1533, "donAcc_type": "acceptable", "distance": 2.644, "atom1_id": "///A/85/O2'", "atom2_id": "///A/86/OP2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 139, "atom1_serNum": 1519, "atom2_serNum": 1534, "donAcc_type": "acceptable", "distance": 3.068, "atom1_id": "///A/85/O2'", "atom2_id": "///A/86/O5'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 140, "atom1_serNum": 1519, "atom2_serNum": 1537, "donAcc_type": "acceptable", "distance": 3.102, "atom1_id": "///A/85/O2'", "atom2_id": "///A/86/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" } ], "refCoords": { "purine": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 -0.5000 0.4000", " 3 N -2.2500 -0.5000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 1.2500 5.0000 0.4000", " 6 C 1.2500 -0.5000 0.4000", " 7 C 1.2500 -0.5000 -0.4000", " 8 C 1.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 -0.5000 0.4000", " 11 C -2.2500 -0.5000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ], "pyrimidine": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 1.0000 0.4000", " 3 N -2.2500 1.0000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 1.2500 5.0000 0.4000", " 6 C 1.2500 1.0000 0.4000", " 7 C 1.2500 1.0000 -0.4000", " 8 C 1.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 1.0000 0.4000", " 11 C -2.2500 1.0000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ], "wc_pair": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 -5.0000 0.4000", " 3 N -2.2500 -5.0000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 2.2500 5.0000 0.4000", " 6 C 2.2500 -5.0000 0.4000", " 7 C 2.2500 -5.0000 -0.4000", " 8 C 2.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 -5.0000 0.4000", " 11 C -2.2500 -5.0000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ] }, "metadata": { "license": "http://innovation.columbia.edu/technologies/CU20391", "url": "http://x3dna.org/", "url_alt": "http://home.x3dna.org/", "forum": "http://forum.x3dna.org/", "citation": "Lu et al. (2015). 'DSSR: an integrated software tool for dissecting the spatial structure of RNA.' Nucleic Acids Res., 43(21):e142 [doi:10.1093/nar/gkv716].", "str_id": "2hoj", "num_naChains": 1, "naChains": "A=79", "num_atoms": 1723, "num_waters": 22, "num_metals": 14, "metals_desc": "Mg=2,Mn=12", "num_notes": 52, "notes": [ { "Aminors": "A-minor interactions (including types I and II)" }, { "Cstem_index": "stem index of the 'Canonical' helix in k-turn" }, { "Cstem_pair": "Cstem bp delineating the k-turn internal loop" }, { "Dp": "perpendicular distance of the 3' P atom to the glycosidic bond" }, { "GA_pair": "sheared G-A pair in k-turn" }, { "HtypePknot": "H-type pseudoknot" }, { "Kturn": "kink-turn (k-turn)" }, { "LW": "Leontis-Westhof" }, { "NCstem_index": "stem index of the 'Non-Canonical' helix in k-turn" }, { "NCstem_pair": "NCstem bp delineating the k-turn internal loop" }, { "Uturn": "U-turn of the UNR- or GNRA-type" }, { "aa": "amino acid" }, { "atom_pair": "symbols of the two atoms involved in an H-bond" }, { "auxfiles": "auxiliary files" }, { "glyco_bond": "conformation of base related to sugar (syn or anti)" }, { "bb_type": "backbone conformation, BI or BII" }, { "bending_angle": "angle between two helical axes" }, { "bp": "base pair" }, { "bseq": "base sequence in one-letter code" }, { "bulge": "bulge loop" }, { "coaxStacks": "coaxial stacking of stems within a helix" }, { "dbn": "dot bracket notation" }, { "desc": "description" }, { "donAcc_type": "donor/acceptor type of the atom pair in an H-bond" }, { "epsilon_zeta": "difference between epsilon and zeta torsion angles" }, { "hairpin": "hairpin loop" }, { "hbond": "hydrogen bond (H-bond)" }, { "helix": "defined by base-stacking interactions, regardless of bp type and backbone connectivity" }, { "id": "identifier" }, { "iloop": "internal loop" }, { "index": "serial number" }, { "isoCanonPairs": "isolated canonical pairs" }, { "junction": "(multi-branched) junction loop" }, { "kissingLoop": "kissing loop" }, { "multiplet": "3+ bases in a coplanar geometry" }, { "na": "nucleic acid" }, { "nonPair": "two nts not forming a pair, but with H-bonding/stacking interactions" }, { "nonStack": "nucleotide not involved in stacking interactions" }, { "nt": "nucleotide" }, { "num": "number" }, { "oArea": "overlap areas between two bases, including exocyclic atoms" }, { "oArea_ring": "overlap areas between two bases, including only ring atoms" }, { "phosContacts": "H-bonding and atom-capping interactions involving a phosphate" }, { "residue_pair": "types of the two residues involved in an H-bond" }, { "rmsd": "root-mean-squares deviation" }, { "serNum": "serial number" }, { "ssSegments": "single-stranded segments not involved in loops" }, { "ssZp": "Z-coordinate of the 3' phosphorus atom with reference to the 5' base plane" }, { "sstr": "secondary structure in dbn" }, { "stem": "helix consisting of only canonical pairs, with a continuous backbone" }, { "str_id": "structure identifier, derived from inpfile with extension removed" }, { "vert_dist": "vertical distance from an atom to a base plane" } ], "num_auxfiles": 20, "auxfiles": [ { "index": 1, "name": "dssr-pairs.pdb", "desc": "an ensemble of base pairs" }, { "index": 2, "name": "dssr-multiplets.pdb", "desc": "an ensemble of multiplets" }, { "index": 3, "name": "dssr-stems.pdb", "desc": "an ensemble of stems" }, { "index": 4, "name": "dssr-helices.pdb", "desc": "an ensemble of helices (coaxial stacking)" }, { "index": 5, "name": "dssr-hairpins.pdb", "desc": "an ensemble of hairpin loops" }, { "index": 6, "name": "dssr-bulges.pdb", "desc": "an ensemble of bulges" }, { "index": 7, "name": "dssr-iloops.pdb", "desc": "an ensemble of internal loops" }, { "index": 8, "name": "dssr-junctions.pdb", "desc": "an ensemble of junctions (multi-branch)" }, { "index": 9, "name": "dssr-2ndstrs.bpseq", "desc": "secondary structure in bpseq format" }, { "index": 10, "name": "dssr-2ndstrs.ct", "desc": "secondary structure in connectivity table format" }, { "index": 11, "name": "dssr-2ndstrs.dbn", "desc": "secondary structure in dot-bracket notation" }, { "index": 12, "name": "dssr-torsions.txt", "desc": "backbone torsion angles and suite names" }, { "index": 13, "name": "dssr-splays.pdb", "desc": "an ensemble of splayed-apart units" }, { "index": 14, "name": "dssr-Aminors.pdb", "desc": "an ensemble of A minor motifs (types I and II)" }, { "index": 15, "name": "dssr-stacks.pdb", "desc": "an ensemble of base stacks" }, { "index": 16, "name": "dssr-atom2bases.pdb", "desc": "an ensemble of atom-base stacking interactions" }, { "index": 17, "name": "dssr-rotmat.txt", "desc": "position vector and rotation matrix" }, { "index": 18, "name": "dssr-viewV.pdb", "desc": "vertical view of the principal moment of inertia" }, { "index": 19, "name": "dssr-viewH.pdb", "desc": "horizontal view of the principal moment of inertia" }, { "index": 20, "name": "dssr-viewT.pdb", "desc": "top view of the principal moment of inertia" } ], "time_used": "999" } }