{ "num_pairs": 159, "pairs": [ { "index": 1, "nt1": "///J/2", "nt2": "///J/61", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -156.132, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 49.969, "chi2": -147.130, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.324, "C1C1_dist": 10.272, "N1N9_dist": 8.453, "C6C8_dist": 9.265, "CNNC_torsion": 10.823, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.61],N1(imino)-N3[2.79],N2(amino)-O2(carbonyl)[2.73]", "interBase_angle": 13.480, "planarity": 0.351, "simple_Shear": -0.211, "simple_Stretch": -0.815, "simple_Buckle": -10.940, "simple_Propeller": -7.875, "bp_simpleParams": [ -0.211, -0.815, -1.706, -10.940, -7.875, -1.469 ], "bp_params": [ -0.200, -0.818, -1.706, -10.842, -8.011, -1.467 ], "frame": { "rmsd": null, "origin": [ 207.885, 298.741, 287.886 ], "x_axis": [ -0.153, 0.988, 0.026 ], "y_axis": [ 0.646, 0.080, 0.759 ], "z_axis": [ 0.748, 0.133, -0.650 ], "quaternion": [ 0.263, 0.595, 0.686, 0.325 ] } }, { "index": 2, "nt1": "///J/3", "nt2": "///J/60", "bp": "U-G", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -168.656, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 60.450, "chi2": -157.444, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 48.407, "C1C1_dist": 10.442, "N1N9_dist": 8.735, "C6C8_dist": 9.752, "CNNC_torsion": -11.738, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N1(imino)[2.90],O2(carbonyl)-N2(amino)[2.94],N3(imino)-O6(carbonyl)[3.13]", "interBase_angle": 17.308, "planarity": 0.277, "simple_Shear": 1.411, "simple_Stretch": -0.102, "simple_Buckle": -6.475, "simple_Propeller": -16.052, "bp_simpleParams": [ 1.411, -0.102, -0.231, -6.475, -16.052, 5.226 ], "bp_params": [ 1.382, -0.301, -0.231, -8.660, -14.986, 5.256 ], "frame": { "rmsd": null, "origin": [ 210.434, 300.061, 285.292 ], "x_axis": [ 0.249, 0.799, 0.547 ], "y_axis": [ 0.530, -0.585, 0.614 ], "z_axis": [ 0.811, 0.137, -0.569 ], "quaternion": [ 0.154, 0.775, 0.429, 0.438 ] } }, { "index": 3, "nt1": "///J/4", "nt2": "///J/59", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -117.067, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 52.120, "chi2": -159.155, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 48.064, "C1C1_dist": 10.898, "N1N9_dist": 9.013, "C6C8_dist": 9.753, "CNNC_torsion": 15.202, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.82],N1-N3(imino)[2.93]", "interBase_angle": 8.328, "planarity": 0.164, "simple_Shear": 0.230, "simple_Stretch": -0.144, "simple_Buckle": -1.330, "simple_Propeller": 8.221, "bp_simpleParams": [ 0.230, -0.144, -0.556, -1.330, 8.221, -8.887 ], "bp_params": [ 0.226, -0.150, -0.556, -1.111, 8.254, -8.909 ], "frame": { "rmsd": null, "origin": [ 212.573, 301.101, 283.112 ], "x_axis": [ 0.171, 0.370, 0.913 ], "y_axis": [ 0.437, -0.859, 0.266 ], "z_axis": [ 0.883, 0.353, -0.309 ], "quaternion": [ -0.028, 0.765, 0.264, 0.587 ] } }, { "index": 4, "nt1": "///J/5", "nt2": "///J/58", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -112.127, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 51.923, "chi2": -158.954, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 56.559, "C1C1_dist": 10.507, "N1N9_dist": 8.795, "C6C8_dist": 9.727, "CNNC_torsion": 1.017, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.89],N1(imino)-N3[2.84],N2(amino)-O2(carbonyl)[2.66]", "interBase_angle": 3.758, "planarity": 0.106, "simple_Shear": -0.262, "simple_Stretch": -0.260, "simple_Buckle": 0.532, "simple_Propeller": -3.720, "bp_simpleParams": [ -0.262, -0.260, -0.367, 0.532, -3.720, 1.108 ], "bp_params": [ -0.256, -0.266, -0.367, 0.610, -3.708, 1.109 ], "frame": { "rmsd": null, "origin": [ 215.296, 303.914, 282.752 ], "x_axis": [ 0.260, -0.147, 0.954 ], "y_axis": [ 0.277, -0.936, -0.219 ], "z_axis": [ 0.925, 0.321, -0.202 ], "quaternion": [ -0.174, 0.774, 0.042, 0.607 ] } }, { "index": 5, "nt1": "///J/6", "nt2": "///J/57", "bp": "G-U", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -164.690, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 33.063, "chi2": -151.238, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 68.549, "C1C1_dist": 10.702, "N1N9_dist": 8.951, "C6C8_dist": 9.747, "CNNC_torsion": -15.961, "hbonds_num": 2, "hbonds_desc": "O6(carbonyl)-N3(imino)[2.92],N1(imino)-O2(carbonyl)[2.95]", "interBase_angle": 11.808, "planarity": 0.138, "simple_Shear": -2.805, "simple_Stretch": 0.187, "simple_Buckle": -8.373, "simple_Propeller": -8.326, "bp_simpleParams": [ -2.805, 0.187, -0.264, -8.373, -8.326, -2.647 ], "bp_params": [ -2.749, -0.590, -0.264, -5.766, -10.304, -2.654 ], "frame": { "rmsd": null, "origin": [ 218.035, 306.309, 281.889 ], "x_axis": [ 0.232, -0.553, 0.800 ], "y_axis": [ 0.033, -0.818, -0.575 ], "z_axis": [ 0.972, 0.160, -0.172 ], "quaternion": [ -0.247, 0.745, -0.174, 0.595 ] } }, { "index": 6, "nt1": "///J/7", "nt2": "///J/56", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -170.464, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 49.302, "chi2": -155.168, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 49.632, "C1C1_dist": 11.051, "N1N9_dist": 9.126, "C6C8_dist": 9.967, "CNNC_torsion": -11.281, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.86],N3-N1(imino)[3.01],N4(amino)-O6(carbonyl)[3.05]", "interBase_angle": 8.826, "planarity": 0.109, "simple_Shear": 0.148, "simple_Stretch": -0.012, "simple_Buckle": 2.277, "simple_Propeller": -8.528, "bp_simpleParams": [ 0.148, -0.012, -0.035, 2.277, -8.528, -0.300 ], "bp_params": [ 0.148, -0.014, -0.035, 2.202, -8.547, -0.301 ], "frame": { "rmsd": null, "origin": [ 221.249, 307.101, 282.114 ], "x_axis": [ 0.104, -0.966, 0.237 ], "y_axis": [ -0.127, -0.249, -0.960 ], "z_axis": [ 0.986, 0.070, -0.149 ], "quaternion": [ -0.420, 0.613, -0.446, 0.499 ] } }, { "index": 7, "nt1": "///J/8", "nt2": "///J/55", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -179.641, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 50.711, "chi2": -162.203, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 60.489, "C1C1_dist": 10.649, "N1N9_dist": 8.990, "C6C8_dist": 10.043, "CNNC_torsion": -17.587, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[3.45],N1(imino)-N3[3.09],N2(amino)-O2(carbonyl)[2.66]", "interBase_angle": 18.045, "planarity": 0.222, "simple_Shear": -0.686, "simple_Stretch": 0.094, "simple_Buckle": -4.722, "simple_Propeller": -17.416, "bp_simpleParams": [ -0.686, 0.094, 0.140, -4.722, -17.416, 8.062 ], "bp_params": [ -0.691, 0.053, 0.140, -3.641, -17.674, 8.154 ], "frame": { "rmsd": null, "origin": [ 225.031, 305.568, 283.968 ], "x_axis": [ -0.110, -0.982, -0.151 ], "y_axis": [ -0.090, 0.161, -0.983 ], "z_axis": [ 0.990, -0.094, -0.106 ], "quaternion": [ 0.486, -0.457, 0.587, -0.459 ] } }, { "index": 8, "nt1": "///J/8", "nt2": "///J/110", "bp": "G+A", "name": "Linker", "Saenger": "--", "LW": "tSW", "DSSR": "tm+W", "intra_chain": true, "chi1": -179.641, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 89.071, "chi2": -160.542, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 54.249, "C1C1_dist": 8.545, "N1N9_dist": 8.090, "C6C8_dist": 10.275, "CNNC_torsion": 153.987, "hbonds_num": 2, "hbonds_desc": "O2'(hydroxyl)-N1[2.49],N2(amino)-N3[3.44]", "interBase_angle": 29.215, "planarity": 0.337, "simple_Shear": 6.765, "simple_Stretch": 3.876, "simple_Buckle": 17.995, "simple_Propeller": -23.015, "bp_simpleParams": [ 6.765, 3.876, 0.901, 17.995, -23.015, -144.297 ], "bp_params": [ -2.301, -7.449, 0.901, -28.847, 4.623, -143.239 ], "frame": { "rmsd": null, "origin": [ 225.278, 309.532, 282.495 ], "x_axis": [ -0.067, -0.089, -0.994 ], "y_axis": [ 0.178, 0.979, -0.100 ], "z_axis": [ 0.982, -0.183, -0.050 ], "quaternion": [ 0.682, 0.031, 0.724, -0.098 ] } }, { "index": 9, "nt1": "///J/9", "nt2": "///J/54", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -157.524, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 54.528, "chi2": -166.410, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 56.740, "C1C1_dist": 10.632, "N1N9_dist": 8.969, "C6C8_dist": 9.934, "CNNC_torsion": -15.321, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.95],O4(carbonyl)-N6(amino)[3.10]", "interBase_angle": 12.087, "planarity": 0.156, "simple_Shear": -0.147, "simple_Stretch": 0.011, "simple_Buckle": -1.248, "simple_Propeller": -12.022, "bp_simpleParams": [ -0.147, 0.011, 0.175, -1.248, -12.022, 1.163 ], "bp_params": [ -0.147, 0.008, 0.175, -1.021, -12.044, 1.170 ], "frame": { "rmsd": null, "origin": [ 228.707, 305.112, 285.376 ], "x_axis": [ -0.109, -0.730, -0.674 ], "y_axis": [ -0.025, 0.680, -0.733 ], "z_axis": [ 0.994, -0.063, -0.092 ], "quaternion": [ 0.608, -0.275, 0.686, -0.290 ] } }, { "index": 10, "nt1": "///J/10", "nt2": "///J/44", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -162.242, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 59.656, "chi2": -168.284, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 58.440, "C1C1_dist": 10.241, "N1N9_dist": 8.720, "C6C8_dist": 9.774, "CNNC_torsion": -5.668, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.83],O4(carbonyl)-N6(amino)[3.10]", "interBase_angle": 7.481, "planarity": 0.092, "simple_Shear": -0.060, "simple_Stretch": -0.099, "simple_Buckle": -3.990, "simple_Propeller": -6.328, "bp_simpleParams": [ -0.060, -0.099, -0.003, -3.990, -6.328, 6.172 ], "bp_params": [ -0.059, -0.100, -0.003, -3.927, -6.367, 6.177 ], "frame": { "rmsd": null, "origin": [ 240.370, 318.825, 277.609 ], "x_axis": [ 0.051, -0.435, -0.899 ], "y_axis": [ -0.799, -0.558, 0.224 ], "z_axis": [ -0.599, 0.707, -0.376 ], "quaternion": [ -0.171, 0.705, -0.438, -0.531 ] } }, { "index": 11, "nt1": "///J/11", "nt2": "///J/43", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -167.876, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 46.420, "chi2": -162.549, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 52.838, "C1C1_dist": 11.008, "N1N9_dist": 9.093, "C6C8_dist": 9.884, "CNNC_torsion": -4.654, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[3.02],N1(imino)-N3[3.03],N2(amino)-O2(carbonyl)[2.94]", "interBase_angle": 13.672, "planarity": 0.154, "simple_Shear": -0.235, "simple_Stretch": -0.062, "simple_Buckle": -9.715, "simple_Propeller": -9.620, "bp_simpleParams": [ -0.235, -0.062, -0.521, -9.715, -9.620, -1.654 ], "bp_params": [ -0.234, -0.065, -0.521, -9.578, -9.756, -1.654 ], "frame": { "rmsd": null, "origin": [ 239.766, 322.337, 275.895 ], "x_axis": [ -0.267, -0.762, -0.590 ], "y_axis": [ -0.776, -0.193, 0.601 ], "z_axis": [ -0.571, 0.618, -0.540 ], "quaternion": [ 0.007, -0.605, 0.635, 0.479 ] } }, { "index": 12, "nt1": "///J/12", "nt2": "///J/42", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -157.398, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 54.167, "chi2": -155.267, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 53.688, "C1C1_dist": 10.735, "N1N9_dist": 8.998, "C6C8_dist": 9.898, "CNNC_torsion": -9.404, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.85],N3-N1(imino)[2.96],N4(amino)-O6(carbonyl)[2.96]", "interBase_angle": 11.603, "planarity": 0.140, "simple_Shear": 0.148, "simple_Stretch": -0.093, "simple_Buckle": 2.363, "simple_Propeller": -11.359, "bp_simpleParams": [ 0.148, -0.093, -0.082, 2.363, -11.359, -0.018 ], "bp_params": [ 0.147, -0.094, -0.082, 2.252, -11.382, -0.018 ], "frame": { "rmsd": null, "origin": [ 238.469, 323.997, 273.363 ], "x_axis": [ -0.555, -0.822, -0.127 ], "y_axis": [ -0.509, 0.214, 0.834 ], "z_axis": [ -0.658, 0.528, -0.537 ], "quaternion": [ -0.175, -0.438, 0.759, 0.448 ] } }, { "index": 13, "nt1": "///J/13", "nt2": "///J/41", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": 178.047, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 48.472, "chi2": -171.485, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 50.366, "C1C1_dist": 10.876, "N1N9_dist": 8.959, "C6C8_dist": 9.798, "CNNC_torsion": -18.978, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[3.00],N1(imino)-N3[2.94],N2(amino)-O2(carbonyl)[2.81]", "interBase_angle": 25.479, "planarity": 0.292, "simple_Shear": -0.191, "simple_Stretch": -0.103, "simple_Buckle": -13.164, "simple_Propeller": -21.815, "bp_simpleParams": [ -0.191, -0.103, -0.006, -13.164, -21.815, -0.280 ], "bp_params": [ -0.191, -0.104, -0.006, -13.003, -21.911, -0.283 ], "frame": { "rmsd": null, "origin": [ 236.310, 324.162, 269.831 ], "x_axis": [ -0.468, -0.743, 0.478 ], "y_axis": [ -0.236, 0.626, 0.743 ], "z_axis": [ -0.851, 0.235, -0.469 ], "quaternion": [ -0.415, -0.306, 0.801, 0.306 ] } }, { "index": 14, "nt1": "///J/14", "nt2": "///J/40", "bp": "C-A", "name": "--", "Saenger": "--", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -165.430, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 74.704, "chi2": -165.709, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 37.252, "C1C1_dist": 10.666, "N1N9_dist": 9.120, "C6C8_dist": 10.050, "CNNC_torsion": -19.800, "hbonds_num": 2, "hbonds_desc": "O2(carbonyl)-N6(amino)[3.39],O2(carbonyl)*N1[3.01]", "unusual_base2base_hbonds": 1, "interBase_angle": 32.763, "planarity": 0.382, "simple_Shear": 3.021, "simple_Stretch": 0.922, "simple_Buckle": -19.358, "simple_Propeller": -26.433, "bp_simpleParams": [ 3.021, 0.922, 0.807, -19.358, -26.433, 7.826 ], "bp_params": [ 3.157, -0.119, 0.807, -26.878, -18.736, 7.721 ], "frame": { "rmsd": null, "origin": [ 232.827, 324.199, 267.879 ], "x_axis": [ -0.459, -0.024, 0.888 ], "y_axis": [ 0.224, 0.964, 0.142 ], "z_axis": [ -0.860, 0.264, -0.437 ], "quaternion": [ 0.517, -0.059, -0.846, -0.120 ] } }, { "index": 15, "nt1": "///J/15", "nt2": "///J/328", "bp": "A+A", "name": "--", "Saenger": "01-I", "LW": "tWW", "DSSR": "tW+W", "intra_chain": true, "chi1": 170.523, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 20.923, "chi2": -73.471, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 29.696, "C1C1_dist": 13.343, "N1N9_dist": 10.764, "C6C8_dist": 10.889, "CNNC_torsion": -179.458, "hbonds_num": 2, "hbonds_desc": "N6(amino)-N1[2.53],N1-N6(amino)[2.63]", "interBase_angle": 5.645, "planarity": 0.069, "simple_Shear": -1.096, "simple_Stretch": 1.215, "simple_Buckle": 4.126, "simple_Propeller": -3.853, "bp_simpleParams": [ -1.096, 1.215, 0.035, 4.126, -3.853, 176.406 ], "bp_params": [ -1.088, -1.223, 0.035, 3.377, 4.524, 176.407 ], "frame": { "rmsd": null, "origin": [ 236.859, 325.732, 259.912 ], "x_axis": [ 0.036, -0.785, -0.618 ], "y_axis": [ 0.071, -0.615, 0.785 ], "z_axis": [ -0.997, -0.072, 0.034 ], "quaternion": [ 0.337, 0.636, -0.281, -0.635 ] } }, { "index": 16, "nt1": "///J/16", "nt2": "///J/329", "bp": "U-A", "name": "--", "Saenger": "--", "LW": "tWH", "DSSR": "tW-M", "intra_chain": true, "chi1": -117.459, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 45.315, "chi2": 77.829, "conf2": "syn", "pucker2": "----", "lambda2": 15.843, "C1C1_dist": 11.115, "N1N9_dist": 8.705, "C6C8_dist": 8.135, "CNNC_torsion": -84.604, "hbonds_num": 1, "hbonds_desc": "O2(carbonyl)-N6(amino)[2.76]", "interBase_angle": 24.336, "planarity": 0.337, "simple_Shear": 3.475, "simple_Stretch": 0.721, "simple_Buckle": 24.260, "simple_Propeller": 1.926, "bp_simpleParams": [ 3.475, 0.721, -0.380, 24.260, 1.926, -64.377 ], "bp_params": [ 3.448, -0.840, -0.380, 22.729, -8.698, -63.509 ], "frame": { "rmsd": null, "origin": [ 233.752, 323.704, 258.632 ], "x_axis": [ 0.050, 0.493, 0.869 ], "y_axis": [ -0.083, 0.869, -0.488 ], "z_axis": [ -0.995, -0.048, 0.084 ], "quaternion": [ 0.708, -0.156, -0.659, 0.203 ] } }, { "index": 17, "nt1": "///J/17", "nt2": "///J/39", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -172.289, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 46.481, "chi2": -154.790, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 55.788, "C1C1_dist": 10.844, "N1N9_dist": 8.996, "C6C8_dist": 9.881, "CNNC_torsion": -13.651, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[3.00],O4(carbonyl)-N6(amino)[3.13]", "interBase_angle": 7.676, "planarity": 0.147, "simple_Shear": -0.235, "simple_Stretch": 0.032, "simple_Buckle": 7.020, "simple_Propeller": -3.105, "bp_simpleParams": [ -0.235, 0.032, 0.308, 7.020, -3.105, 0.734 ], "bp_params": [ -0.236, 0.025, 0.308, 7.106, -2.901, 0.733 ], "frame": { "rmsd": null, "origin": [ 230.386, 322.987, 263.048 ], "x_axis": [ 0.005, 0.751, 0.660 ], "y_axis": [ -0.002, 0.660, -0.751 ], "z_axis": [ -1.000, 0.002, 0.005 ], "quaternion": [ 0.646, -0.291, -0.642, 0.291 ] } }, { "index": 18, "nt1": "///J/18", "nt2": "///J/38", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -157.624, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 53.633, "chi2": -164.980, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 55.108, "C1C1_dist": 10.743, "N1N9_dist": 9.018, "C6C8_dist": 9.966, "CNNC_torsion": -9.416, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[3.03],O4(carbonyl)-N6(amino)[3.21]", "interBase_angle": 13.484, "planarity": 0.159, "simple_Shear": -0.023, "simple_Stretch": 0.110, "simple_Buckle": 11.827, "simple_Propeller": -6.478, "bp_simpleParams": [ -0.023, 0.110, -0.114, 11.827, -6.478, 2.212 ], "bp_params": [ -0.024, 0.109, -0.114, 11.900, -6.341, 2.204 ], "frame": { "rmsd": null, "origin": [ 227.130, 322.598, 264.269 ], "x_axis": [ 0.077, 0.982, 0.174 ], "y_axis": [ -0.037, 0.177, -0.984 ], "z_axis": [ -0.996, 0.069, 0.050 ], "quaternion": [ 0.571, -0.461, -0.512, 0.446 ] } }, { "index": 19, "nt1": "///J/19", "nt2": "///J/37", "bp": "U-G", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -175.123, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 60.632, "chi2": -174.204, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 42.970, "C1C1_dist": 10.772, "N1N9_dist": 8.972, "C6C8_dist": 9.832, "CNNC_torsion": -13.360, "hbonds_num": 2, "hbonds_desc": "O2(carbonyl)-N1(imino)[2.94],N3(imino)-O6(carbonyl)[3.07]", "interBase_angle": 15.135, "planarity": 0.170, "simple_Shear": 2.112, "simple_Stretch": 0.111, "simple_Buckle": 10.359, "simple_Propeller": -11.035, "bp_simpleParams": [ 2.112, 0.111, -0.168, 10.359, -11.035, -0.628 ], "bp_params": [ 2.090, -0.321, -0.168, 7.894, -12.913, -0.630 ], "frame": { "rmsd": null, "origin": [ 223.649, 323.145, 265.973 ], "x_axis": [ 0.110, 0.871, -0.478 ], "y_axis": [ -0.099, -0.469, -0.878 ], "z_axis": [ -0.989, 0.144, 0.035 ], "quaternion": [ -0.411, 0.621, 0.311, -0.590 ] } }, { "index": 20, "nt1": "///J/20", "nt2": "///J/36", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -164.069, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 47.927, "chi2": -157.556, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 52.871, "C1C1_dist": 10.729, "N1N9_dist": 8.854, "C6C8_dist": 9.666, "CNNC_torsion": -10.824, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.82],N1(imino)-N3[2.86],N2(amino)-O2(carbonyl)[2.80]", "interBase_angle": 10.263, "planarity": 0.126, "simple_Shear": -0.247, "simple_Stretch": -0.268, "simple_Buckle": -4.823, "simple_Propeller": -9.059, "bp_simpleParams": [ -0.247, -0.268, 0.037, -4.823, -9.059, -2.906 ], "bp_params": [ -0.242, -0.273, 0.037, -4.643, -9.152, -2.913 ], "frame": { "rmsd": null, "origin": [ 219.966, 323.643, 268.326 ], "x_axis": [ 0.291, 0.527, -0.798 ], "y_axis": [ -0.101, -0.813, -0.574 ], "z_axis": [ -0.951, 0.248, -0.184 ], "quaternion": [ -0.271, 0.756, 0.141, -0.578 ] } }, { "index": 21, "nt1": "///J/21", "nt2": "///J/35", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -161.299, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 52.473, "chi2": -160.848, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 53.630, "C1C1_dist": 10.625, "N1N9_dist": 8.856, "C6C8_dist": 9.741, "CNNC_torsion": -5.745, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.84],O4(carbonyl)-N6(amino)[2.87]", "interBase_angle": 5.429, "planarity": 0.068, "simple_Shear": -0.043, "simple_Stretch": -0.165, "simple_Buckle": -0.023, "simple_Propeller": -5.429, "bp_simpleParams": [ -0.043, -0.165, -0.082, -0.023, -5.429, -2.090 ], "bp_params": [ -0.041, -0.166, -0.082, 0.022, -5.429, -2.091 ], "frame": { "rmsd": null, "origin": [ 217.165, 325.752, 267.703 ], "x_axis": [ 0.311, -0.017, -0.950 ], "y_axis": [ -0.265, -0.962, -0.070 ], "z_axis": [ -0.913, 0.274, -0.304 ], "quaternion": [ -0.107, 0.803, -0.088, -0.580 ] } }, { "index": 22, "nt1": "///J/22", "nt2": "///J/34", "bp": "U-G", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -163.133, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 62.251, "chi2": -177.797, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 44.014, "C1C1_dist": 10.933, "N1N9_dist": 9.191, "C6C8_dist": 10.077, "CNNC_torsion": -3.435, "hbonds_num": 2, "hbonds_desc": "O2(carbonyl)-N1(imino)[3.32],N3(imino)-O6(carbonyl)[3.40]", "interBase_angle": 9.987, "planarity": 0.114, "simple_Shear": 1.473, "simple_Stretch": 0.222, "simple_Buckle": 7.901, "simple_Propeller": -6.108, "bp_simpleParams": [ 1.473, 0.222, -0.404, 7.901, -6.108, -0.773 ], "bp_params": [ 1.490, 0.011, -0.404, 6.956, -7.165, -0.773 ], "frame": { "rmsd": null, "origin": [ 214.993, 327.794, 265.799 ], "x_axis": [ 0.169, -0.600, -0.782 ], "y_axis": [ -0.485, -0.741, 0.464 ], "z_axis": [ -0.858, 0.301, -0.416 ], "quaternion": [ 0.054, 0.763, -0.356, -0.538 ] } }, { "index": 23, "nt1": "///J/23", "nt2": "///J/33", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -175.547, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 50.383, "chi2": -156.042, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 54.374, "C1C1_dist": 10.805, "N1N9_dist": 9.003, "C6C8_dist": 9.931, "CNNC_torsion": -7.879, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[3.04],N1(imino)-N3[2.97],N2(amino)-O2(carbonyl)[2.82]", "interBase_angle": 7.757, "planarity": 0.097, "simple_Shear": -0.248, "simple_Stretch": -0.067, "simple_Buckle": -2.023, "simple_Propeller": -7.489, "bp_simpleParams": [ -0.248, -0.067, -0.087, -2.023, -7.489, 1.048 ], "bp_params": [ -0.247, -0.072, -0.087, -1.878, -7.526, 1.050 ], "frame": { "rmsd": null, "origin": [ 213.061, 330.336, 263.029 ], "x_axis": [ 0.175, -0.867, -0.467 ], "y_axis": [ -0.514, -0.485, 0.708 ], "z_axis": [ -0.840, 0.116, -0.530 ], "quaternion": [ 0.200, 0.740, -0.467, -0.442 ] } }, { "index": 24, "nt1": "///J/24", "nt2": "///J/32", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -164.779, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 51.698, "chi2": 170.809, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 44.353, "C1C1_dist": 10.979, "N1N9_dist": 9.007, "C6C8_dist": 9.836, "CNNC_torsion": -4.468, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.81],N3-N1(imino)[2.93],N4(amino)-O6(carbonyl)[2.93]", "interBase_angle": 4.581, "planarity": 0.062, "simple_Shear": 0.277, "simple_Stretch": -0.153, "simple_Buckle": 1.668, "simple_Propeller": -4.266, "bp_simpleParams": [ 0.277, -0.153, -0.159, 1.668, -4.266, -1.707 ], "bp_params": [ 0.273, -0.158, -0.159, 1.577, -4.301, -1.708 ], "frame": { "rmsd": null, "origin": [ 211.222, 331.036, 259.806 ], "x_axis": [ -0.145, -0.988, 0.059 ], "y_axis": [ -0.515, 0.126, 0.848 ], "z_axis": [ -0.845, 0.093, -0.527 ], "quaternion": [ -0.337, -0.560, 0.671, 0.351 ] } }, { "index": 25, "nt1": "///J/25", "nt2": "///J/31", "bp": "U-G", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -157.389, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 66.738, "chi2": -168.257, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 44.133, "C1C1_dist": 10.715, "N1N9_dist": 9.078, "C6C8_dist": 10.024, "CNNC_torsion": 10.524, "hbonds_num": 2, "hbonds_desc": "O2(carbonyl)-N1(imino)[3.06],N3(imino)-O6(carbonyl)[3.23]", "interBase_angle": 6.440, "planarity": 0.144, "simple_Shear": 2.047, "simple_Stretch": 0.216, "simple_Buckle": 2.924, "simple_Propeller": 5.738, "bp_simpleParams": [ 2.047, 0.216, -0.744, 2.924, 5.738, 0.993 ], "bp_params": [ 2.048, -0.201, -0.744, 4.018, 5.033, 0.993 ], "frame": { "rmsd": null, "origin": [ 209.131, 329.933, 256.831 ], "x_axis": [ -0.425, -0.733, 0.532 ], "y_axis": [ -0.425, 0.680, 0.598 ], "z_axis": [ -0.799, 0.028, -0.600 ], "quaternion": [ -0.405, -0.352, 0.822, 0.190 ] } }, { "index": 26, "nt1": "///J/26", "nt2": "///J/30", "bp": "C+A", "name": "--", "Saenger": "--", "LW": "cWH", "DSSR": "cW+M", "intra_chain": true, "chi1": -141.504, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 101.569, "chi2": 53.832, "conf2": "syn", "pucker2": "~C3'-endo", "lambda2": 45.979, "C1C1_dist": 7.630, "N1N9_dist": 6.913, "C6C8_dist": 6.876, "CNNC_torsion": 9.485, "hbonds_num": 2, "hbonds_desc": "O2(carbonyl)*N7[2.87],N3-N6(amino)[3.82]", "unusual_base2base_hbonds": 1, "interBase_angle": 14.073, "planarity": 0.277, "simple_Shear": -0.752, "simple_Stretch": 3.382, "simple_Buckle": 10.058, "simple_Propeller": 9.843, "bp_simpleParams": [ -0.752, 3.382, -2.095, 10.058, 9.843, -41.816 ], "bp_params": [ 3.077, 1.591, -2.095, 12.086, -7.210, -41.680 ], "frame": { "rmsd": null, "origin": [ 205.996, 325.971, 255.886 ], "x_axis": [ -0.546, 0.262, 0.796 ], "y_axis": [ -0.028, 0.944, -0.330 ], "z_axis": [ -0.837, -0.203, -0.508 ], "quaternion": [ -0.471, 0.067, 0.866, -0.154 ] } }, { "index": 27, "nt1": "///J/46", "nt2": "///J/119", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -168.615, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 54.058, "chi2": -163.903, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 51.542, "C1C1_dist": 10.632, "N1N9_dist": 8.850, "C6C8_dist": 9.757, "CNNC_torsion": -6.424, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.86],N1(imino)-N3[2.85],N2(amino)-O2(carbonyl)[2.72]", "interBase_angle": 4.613, "planarity": 0.061, "simple_Shear": -0.125, "simple_Stretch": -0.222, "simple_Buckle": -0.827, "simple_Propeller": -4.539, "bp_simpleParams": [ -0.125, -0.222, -0.006, -0.827, -4.539, -0.378 ], "bp_params": [ -0.123, -0.223, -0.006, -0.790, -4.545, -0.378 ], "frame": { "rmsd": null, "origin": [ 251.109, 307.806, 278.072 ], "x_axis": [ 0.235, -0.619, 0.750 ], "y_axis": [ -0.177, 0.731, 0.659 ], "z_axis": [ -0.956, -0.287, 0.062 ], "quaternion": [ 0.712, 0.332, -0.599, -0.155 ] } }, { "index": 28, "nt1": "///J/47", "nt2": "///J/118", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -166.547, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 52.138, "chi2": -176.655, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 49.426, "C1C1_dist": 10.846, "N1N9_dist": 8.975, "C6C8_dist": 9.865, "CNNC_torsion": -9.391, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.99],N1(imino)-N3[2.96],N2(amino)-O2(carbonyl)[2.80]", "interBase_angle": 9.319, "planarity": 0.112, "simple_Shear": -0.182, "simple_Stretch": -0.105, "simple_Buckle": -3.908, "simple_Propeller": -8.460, "bp_simpleParams": [ -0.182, -0.105, -0.140, -3.908, -8.460, 0.349 ], "bp_params": [ -0.180, -0.107, -0.140, -3.796, -8.511, 0.350 ], "frame": { "rmsd": null, "origin": [ 248.419, 304.835, 277.681 ], "x_axis": [ 0.170, -0.152, 0.974 ], "y_axis": [ -0.334, 0.921, 0.202 ], "z_axis": [ -0.927, -0.359, 0.105 ], "quaternion": [ 0.741, 0.189, -0.641, 0.061 ] } }, { "index": 29, "nt1": "///J/48", "nt2": "///J/117", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -162.073, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 54.955, "chi2": -161.320, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 51.497, "C1C1_dist": 10.735, "N1N9_dist": 8.964, "C6C8_dist": 9.885, "CNNC_torsion": -4.209, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.78],N3-N1(imino)[2.94],N4(amino)-O6(carbonyl)[3.03]", "interBase_angle": 3.455, "planarity": 0.066, "simple_Shear": 0.238, "simple_Stretch": -0.103, "simple_Buckle": -0.149, "simple_Propeller": -3.452, "bp_simpleParams": [ 0.238, -0.103, -0.182, -0.149, -3.452, 1.415 ], "bp_params": [ 0.236, -0.107, -0.182, -0.215, -3.448, 1.415 ], "frame": { "rmsd": null, "origin": [ 245.833, 302.236, 278.308 ], "x_axis": [ -0.019, 0.360, 0.933 ], "y_axis": [ -0.387, 0.857, -0.339 ], "z_axis": [ -0.922, -0.368, 0.123 ], "quaternion": [ 0.700, 0.010, -0.662, 0.267 ] } }, { "index": 30, "nt1": "///J/49", "nt2": "///J/116", "bp": "A+U", "name": "--", "Saenger": "--", "LW": "cHW", "DSSR": "cM+W", "intra_chain": true, "chi1": 19.759, "conf1": "syn", "pucker1": "~C3'-endo", "lambda1": 37.446, "chi2": -164.097, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 51.572, "C1C1_dist": 10.149, "N1N9_dist": 8.055, "C6C8_dist": 7.514, "CNNC_torsion": -7.295, "hbonds_num": 1, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.70]", "interBase_angle": 4.929, "planarity": 0.107, "simple_Shear": -3.414, "simple_Stretch": 1.204, "simple_Buckle": 0.459, "simple_Propeller": -4.908, "bp_simpleParams": [ -3.414, 1.204, -0.542, 0.459, -4.908, 93.268 ], "bp_params": [ 0.639, -3.563, -0.542, 4.041, 2.822, 93.250 ], "frame": { "rmsd": null, "origin": [ 242.731, 301.778, 279.495 ], "x_axis": [ 0.175, 0.178, 0.968 ], "y_axis": [ 0.302, -0.946, 0.120 ], "z_axis": [ 0.937, 0.271, -0.220 ], "quaternion": [ -0.049, 0.765, 0.157, 0.623 ] } }, { "index": 31, "nt1": "///J/50", "nt2": "///J/115", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -163.105, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 54.247, "chi2": -176.051, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 47.576, "C1C1_dist": 10.733, "N1N9_dist": 8.874, "C6C8_dist": 9.725, "CNNC_torsion": -8.260, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.85],N1-N3(imino)[2.83]", "interBase_angle": 4.377, "planarity": 0.124, "simple_Shear": 0.132, "simple_Stretch": -0.197, "simple_Buckle": -1.087, "simple_Propeller": -4.240, "bp_simpleParams": [ 0.132, -0.197, 0.467, -1.087, -4.240, -3.503 ], "bp_params": [ 0.128, -0.199, 0.467, -1.160, -4.221, -3.505 ], "frame": { "rmsd": null, "origin": [ 240.720, 299.162, 281.823 ], "x_axis": [ -0.095, 0.995, 0.000 ], "y_axis": [ -0.296, -0.028, -0.955 ], "z_axis": [ -0.950, -0.091, 0.297 ], "quaternion": [ 0.542, -0.399, -0.439, 0.596 ] } }, { "index": 32, "nt1": "///J/51", "nt2": "///J/114", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -165.848, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 56.006, "chi2": -160.044, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 55.653, "C1C1_dist": 10.400, "N1N9_dist": 8.741, "C6C8_dist": 9.694, "CNNC_torsion": -6.413, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.80],O4(carbonyl)-N6(amino)[2.94]", "interBase_angle": 4.647, "planarity": 0.175, "simple_Shear": -0.059, "simple_Stretch": -0.241, "simple_Buckle": 3.650, "simple_Propeller": -2.875, "bp_simpleParams": [ -0.059, -0.241, 0.663, 3.650, -2.875, 1.049 ], "bp_params": [ -0.057, -0.242, 0.663, 3.680, -2.838, 1.049 ], "frame": { "rmsd": null, "origin": [ 238.049, 299.999, 283.956 ], "x_axis": [ -0.128, 0.848, -0.515 ], "y_axis": [ -0.218, -0.530, -0.819 ], "z_axis": [ -0.967, 0.007, 0.253 ], "quaternion": [ 0.386, -0.536, -0.294, 0.691 ] } }, { "index": 33, "nt1": "///J/52", "nt2": "///J/113", "bp": "G+C", "name": "--", "Saenger": "--", "LW": "cWH", "DSSR": "cW+M", "intra_chain": true, "chi1": -163.599, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 53.708, "chi2": -27.813, "conf2": "syn", "pucker2": "~C3'-endo", "lambda2": 42.977, "C1C1_dist": 11.406, "N1N9_dist": 9.444, "C6C8_dist": 8.778, "CNNC_torsion": -5.685, "hbonds_num": 1, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.76]", "interBase_angle": 4.120, "planarity": 0.091, "simple_Shear": -3.889, "simple_Stretch": 2.800, "simple_Buckle": 2.415, "simple_Propeller": 3.339, "bp_simpleParams": [ -3.889, 2.800, 0.257, 2.415, 3.339, -90.487 ], "bp_params": [ 0.269, 4.785, 0.257, 4.113, -0.240, -90.451 ], "frame": { "rmsd": null, "origin": [ 235.355, 303.988, 284.738 ], "x_axis": [ -0.194, -0.405, -0.894 ], "y_axis": [ -0.006, -0.910, 0.414 ], "z_axis": [ -0.981, 0.086, 0.174 ], "quaternion": [ -0.132, -0.621, 0.165, 0.755 ] } }, { "index": 34, "nt1": "///J/53", "nt2": "///J/111", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -175.217, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 50.802, "chi2": -80.680, "conf2": "--", "pucker2": "~C2'-endo", "lambda2": 55.165, "C1C1_dist": 10.706, "N1N9_dist": 8.929, "C6C8_dist": 9.872, "CNNC_torsion": -3.733, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.73],N3-N1(imino)[2.93],N4(amino)-O6(carbonyl)[2.98]", "interBase_angle": 5.826, "planarity": 0.096, "simple_Shear": 0.153, "simple_Stretch": -0.110, "simple_Buckle": -3.731, "simple_Propeller": -4.475, "bp_simpleParams": [ 0.153, -0.110, -0.048, -3.731, -4.475, 1.491 ], "bp_params": [ 0.151, -0.112, -0.048, -3.788, -4.427, 1.492 ], "frame": { "rmsd": null, "origin": [ 232.011, 303.697, 286.302 ], "x_axis": [ -0.174, -0.206, -0.963 ], "y_axis": [ -0.144, -0.962, 0.232 ], "z_axis": [ -0.974, 0.179, 0.138 ], "quaternion": [ -0.021, -0.642, 0.136, 0.754 ] } }, { "index": 35, "nt1": "///J/56", "nt2": "///J/109", "bp": "G+A", "name": "--", "Saenger": "--", "LW": "cSH", "DSSR": "cm+M", "intra_chain": true, "chi1": -155.168, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 149.274, "chi2": 14.446, "conf2": "syn", "pucker2": "~C3'-endo", "lambda2": 59.032, "C1C1_dist": 6.018, "N1N9_dist": 6.550, "C6C8_dist": 6.658, "CNNC_torsion": -5.392, "hbonds_num": 1, "hbonds_desc": "N2(amino)*N6(amino)[3.78]", "interBase_angle": 29.628, "planarity": 0.371, "simple_Shear": 0.667, "simple_Stretch": 8.390, "simple_Buckle": -26.685, "simple_Propeller": -12.875, "bp_simpleParams": [ 0.667, 8.390, -0.243, -26.685, -12.875, 25.235 ], "bp_params": [ 8.306, 1.359, -0.243, -18.756, 22.936, 25.411 ], "frame": { "rmsd": null, "origin": [ 221.981, 311.231, 281.233 ], "x_axis": [ -0.201, -0.979, 0.042 ], "y_axis": [ -0.013, 0.045, 0.999 ], "z_axis": [ -0.980, 0.200, -0.021 ], "quaternion": [ -0.454, -0.440, 0.563, 0.533 ] } }, { "index": 36, "nt1": "///J/120", "nt2": "///J/259", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -175.659, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 44.999, "chi2": -133.730, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 48.839, "C1C1_dist": 10.574, "N1N9_dist": 8.567, "C6C8_dist": 9.368, "CNNC_torsion": -15.508, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.33],N3-N1(imino)[2.44],N4(amino)-O6(carbonyl)[2.36]", "interBase_angle": 6.348, "planarity": 0.095, "simple_Shear": -0.130, "simple_Stretch": -0.605, "simple_Buckle": -0.497, "simple_Propeller": -6.329, "bp_simpleParams": [ -0.130, -0.605, 0.136, -0.497, -6.329, -3.521 ], "bp_params": [ -0.120, -0.607, 0.136, -0.389, -6.336, -3.527 ], "frame": { "rmsd": null, "origin": [ 254.340, 308.807, 279.807 ], "x_axis": [ 0.200, -0.954, 0.224 ], "y_axis": [ 0.026, -0.223, -0.974 ], "z_axis": [ 0.980, 0.200, -0.020 ], "quaternion": [ -0.489, 0.601, -0.386, 0.501 ] } }, { "index": 37, "nt1": "///J/121", "nt2": "///J/258", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": 176.439, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 43.850, "chi2": -175.081, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 50.264, "C1C1_dist": 10.870, "N1N9_dist": 8.874, "C6C8_dist": 9.697, "CNNC_torsion": -26.598, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[3.07],N1(imino)-N3[2.97],N2(amino)-O2(carbonyl)[2.90]", "interBase_angle": 21.681, "planarity": 0.279, "simple_Shear": -0.762, "simple_Stretch": -0.249, "simple_Buckle": -3.469, "simple_Propeller": -21.402, "bp_simpleParams": [ -0.762, -0.249, 0.396, -3.469, -21.402, -2.635 ], "bp_params": [ -0.743, -0.302, 0.396, -1.931, -21.595, -2.682 ], "frame": { "rmsd": null, "origin": [ 257.704, 308.029, 281.410 ], "x_axis": [ 0.018, -0.953, -0.303 ], "y_axis": [ -0.037, 0.302, -0.952 ], "z_axis": [ 0.999, 0.028, -0.030 ], "quaternion": [ 0.568, -0.432, 0.573, -0.403 ] } }, { "index": 38, "nt1": "///J/121", "nt2": "///J/262", "bp": "G+A", "name": "--", "Saenger": "--", "LW": "cSH", "DSSR": "cm+M", "intra_chain": true, "chi1": 176.439, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 128.034, "chi2": 63.058, "conf2": "syn", "pucker2": "~C2'-endo", "lambda2": 60.317, "C1C1_dist": 6.738, "N1N9_dist": 6.956, "C6C8_dist": 6.993, "CNNC_torsion": -32.889, "hbonds_num": 1, "hbonds_desc": "N2(amino)*N6(amino)[3.12]", "interBase_angle": 31.770, "planarity": 0.365, "simple_Shear": 0.276, "simple_Stretch": 7.582, "simple_Buckle": 30.093, "simple_Propeller": -10.188, "bp_simpleParams": [ 0.276, 7.582, 0.955, 30.093, -10.188, 8.083 ], "bp_params": [ 7.414, 1.610, 0.955, -2.220, -31.693, 8.400 ], "frame": { "rmsd": null, "origin": [ 257.681, 311.820, 283.237 ], "x_axis": [ -0.066, -0.976, -0.209 ], "y_axis": [ -0.014, 0.211, -0.977 ], "z_axis": [ 0.998, -0.062, -0.028 ], "quaternion": [ 0.528, -0.433, 0.571, -0.455 ] } }, { "index": 39, "nt1": "///J/122", "nt2": "///J/257", "bp": "U-G", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -165.818, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 61.703, "chi2": -163.801, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 43.141, "C1C1_dist": 10.691, "N1N9_dist": 8.924, "C6C8_dist": 9.832, "CNNC_torsion": -18.073, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N1(imino)[2.94],O2(carbonyl)-N2(amino)[3.32],N3(imino)-O6(carbonyl)[3.14]", "interBase_angle": 13.730, "planarity": 0.185, "simple_Shear": 1.819, "simple_Stretch": 0.040, "simple_Buckle": -0.224, "simple_Propeller": -13.728, "bp_simpleParams": [ 1.819, 0.040, 0.272, -0.224, -13.728, 0.528 ], "bp_params": [ 1.797, -0.288, 0.272, -2.686, -13.464, 0.532 ], "frame": { "rmsd": null, "origin": [ 261.255, 307.911, 282.962 ], "x_axis": [ -0.013, -0.518, -0.855 ], "y_axis": [ -0.078, 0.853, -0.515 ], "z_axis": [ 0.997, 0.060, -0.052 ], "quaternion": [ 0.669, -0.215, 0.692, -0.165 ] } }, { "index": 40, "nt1": "///J/123", "nt2": "///J/256", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -155.994, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 53.881, "chi2": -166.679, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 53.129, "C1C1_dist": 10.501, "N1N9_dist": 8.747, "C6C8_dist": 9.690, "CNNC_torsion": -8.483, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.43],N3-N1(imino)[2.72],N4(amino)-O6(carbonyl)[2.85]", "interBase_angle": 4.458, "planarity": 0.096, "simple_Shear": 0.026, "simple_Stretch": -0.314, "simple_Buckle": -0.111, "simple_Propeller": -4.457, "bp_simpleParams": [ 0.026, -0.314, 0.374, -0.111, -4.457, 1.584 ], "bp_params": [ 0.027, -0.314, 0.374, -0.096, -4.457, 1.583 ], "frame": { "rmsd": null, "origin": [ 264.387, 306.420, 283.059 ], "x_axis": [ -0.197, -0.097, -0.976 ], "y_axis": [ -0.024, 0.995, -0.094 ], "z_axis": [ 0.980, 0.004, -0.199 ], "quaternion": [ 0.632, -0.039, 0.773, -0.029 ] } }, { "index": 41, "nt1": "///J/124", "nt2": "///J/255", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -179.937, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 46.059, "chi2": -162.220, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 51.336, "C1C1_dist": 10.910, "N1N9_dist": 8.968, "C6C8_dist": 9.775, "CNNC_torsion": -14.779, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.92],N1(imino)-N3[2.92],N2(amino)-O2(carbonyl)[2.84]", "interBase_angle": 12.586, "planarity": 0.177, "simple_Shear": -0.233, "simple_Stretch": -0.192, "simple_Buckle": -4.379, "simple_Propeller": -11.799, "bp_simpleParams": [ -0.233, -0.192, 0.328, -4.379, -11.799, -3.475 ], "bp_params": [ -0.229, -0.196, 0.328, -4.167, -11.876, -3.492 ], "frame": { "rmsd": null, "origin": [ 267.252, 304.822, 281.902 ], "x_axis": [ -0.433, 0.437, -0.788 ], "y_axis": [ 0.156, 0.898, 0.412 ], "z_axis": [ 0.888, 0.055, -0.457 ], "quaternion": [ 0.502, 0.178, 0.835, 0.140 ] } }, { "index": 42, "nt1": "///J/125", "nt2": "///J/254", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -176.785, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 45.401, "chi2": -159.984, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 50.554, "C1C1_dist": 10.951, "N1N9_dist": 8.975, "C6C8_dist": 9.759, "CNNC_torsion": -12.138, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.83],N3-N1(imino)[2.90],N4(amino)-O6(carbonyl)[2.81]", "interBase_angle": 9.523, "planarity": 0.141, "simple_Shear": 0.054, "simple_Stretch": -0.219, "simple_Buckle": -1.863, "simple_Propeller": -9.339, "bp_simpleParams": [ 0.054, -0.219, 0.409, -1.863, -9.339, -4.988 ], "bp_params": [ 0.053, -0.219, 0.409, -1.878, -9.336, -5.004 ], "frame": { "rmsd": null, "origin": [ 269.811, 304.138, 279.527 ], "x_axis": [ -0.410, 0.835, -0.366 ], "y_axis": [ 0.383, 0.522, 0.762 ], "z_axis": [ 0.828, 0.173, -0.534 ], "quaternion": [ 0.380, 0.388, 0.785, 0.298 ] } }, { "index": 43, "nt1": "///J/126", "nt2": "///J/253", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -176.387, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 50.780, "chi2": -157.305, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 54.654, "C1C1_dist": 10.663, "N1N9_dist": 8.878, "C6C8_dist": 9.779, "CNNC_torsion": -10.410, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.98],N1-N3(imino)[2.86]", "interBase_angle": 10.895, "planarity": 0.136, "simple_Shear": -0.031, "simple_Stretch": -0.124, "simple_Buckle": -5.139, "simple_Propeller": -9.607, "bp_simpleParams": [ -0.031, -0.124, 0.044, -5.139, -9.607, -0.905 ], "bp_params": [ -0.031, -0.123, 0.044, -5.170, -9.590, -0.907 ], "frame": { "rmsd": null, "origin": [ 271.402, 304.638, 276.338 ], "x_axis": [ -0.347, 0.893, 0.285 ], "y_axis": [ 0.627, -0.005, 0.779 ], "z_axis": [ 0.697, 0.449, -0.558 ], "quaternion": [ 0.149, 0.551, 0.689, 0.445 ] } }, { "index": 44, "nt1": "///J/127", "nt2": "///J/252", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -153.299, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 50.285, "chi2": -166.021, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 51.840, "C1C1_dist": 10.800, "N1N9_dist": 8.948, "C6C8_dist": 9.829, "CNNC_torsion": -17.435, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.01],N1-N3(imino)[2.92]", "interBase_angle": 16.014, "planarity": 0.193, "simple_Shear": -0.045, "simple_Stretch": -0.079, "simple_Buckle": -2.290, "simple_Propeller": -15.849, "bp_simpleParams": [ -0.045, -0.079, -0.131, -2.290, -15.849, -0.719 ], "bp_params": [ -0.045, -0.078, -0.131, -2.313, -15.846, -0.726 ], "frame": { "rmsd": null, "origin": [ 273.086, 306.163, 273.768 ], "x_axis": [ 0.008, 0.683, 0.730 ], "y_axis": [ 0.729, -0.504, 0.464 ], "z_axis": [ 0.685, 0.528, -0.502 ], "quaternion": [ -0.023, 0.709, 0.498, 0.499 ] } }, { "index": 45, "nt1": "///J/128", "nt2": "///J/251", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -168.630, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 50.527, "chi2": -151.181, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 51.441, "C1C1_dist": 10.871, "N1N9_dist": 9.018, "C6C8_dist": 9.891, "CNNC_torsion": -20.504, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.05],N1-N3(imino)[2.98]", "interBase_angle": 16.162, "planarity": 0.200, "simple_Shear": 0.081, "simple_Stretch": -0.011, "simple_Buckle": -0.686, "simple_Propeller": -16.147, "bp_simpleParams": [ 0.081, -0.011, -0.144, -0.686, -16.147, -1.460 ], "bp_params": [ 0.081, -0.012, -0.144, -0.891, -16.137, -1.475 ], "frame": { "rmsd": null, "origin": [ 274.873, 308.317, 271.779 ], "x_axis": [ 0.378, 0.284, 0.881 ], "y_axis": [ 0.601, -0.800, -0.000 ], "z_axis": [ 0.705, 0.529, -0.473 ], "quaternion": [ -0.163, 0.814, 0.272, 0.487 ] } }, { "index": 46, "nt1": "///J/129", "nt2": "///J/250", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -169.030, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 50.902, "chi2": -170.278, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 48.976, "C1C1_dist": 10.933, "N1N9_dist": 9.037, "C6C8_dist": 9.922, "CNNC_torsion": -20.126, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.90],N3-N1(imino)[3.01],N4(amino)-O6(carbonyl)[3.06]", "interBase_angle": 15.811, "planarity": 0.195, "simple_Shear": 0.260, "simple_Stretch": -0.050, "simple_Buckle": 4.308, "simple_Propeller": -15.212, "bp_simpleParams": [ 0.260, -0.050, -0.013, 4.308, -15.212, -0.008 ], "bp_params": [ 0.259, -0.055, -0.013, 3.999, -15.297, -0.008 ], "frame": { "rmsd": null, "origin": [ 276.852, 311.480, 271.336 ], "x_axis": [ 0.633, -0.181, 0.752 ], "y_axis": [ 0.323, -0.822, -0.470 ], "z_axis": [ 0.703, 0.540, -0.462 ], "quaternion": [ -0.296, 0.854, 0.041, 0.426 ] } }, { "index": 47, "nt1": "///J/130", "nt2": "///J/249", "bp": "G-A", "name": "Sheared", "Saenger": "11-XI", "LW": "tSH", "DSSR": "tm-M", "intra_chain": true, "chi1": -169.960, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 87.717, "chi2": -153.439, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 6.010, "C1C1_dist": 9.949, "N1N9_dist": 8.535, "C6C8_dist": 8.892, "CNNC_torsion": -136.981, "hbonds_num": 3, "hbonds_desc": "O2'(hydroxyl)-N6(amino)[2.91],N2(amino)-N7[2.90],N3-N6(amino)[3.15]", "interBase_angle": 22.886, "planarity": 0.265, "simple_Shear": 7.418, "simple_Stretch": 2.581, "simple_Buckle": 13.550, "simple_Propeller": -18.444, "bp_simpleParams": [ 7.418, 2.581, 0.003, 13.550, -18.444, -7.617 ], "bp_params": [ 6.745, -4.024, 0.003, -5.464, -22.224, -7.754 ], "frame": { "rmsd": null, "origin": [ 278.707, 314.884, 269.291 ], "x_axis": [ 0.555, -0.831, 0.045 ], "y_axis": [ -0.351, -0.283, -0.893 ], "z_axis": [ 0.754, 0.480, -0.448 ], "quaternion": [ -0.454, 0.756, -0.391, 0.264 ] } }, { "index": 48, "nt1": "///J/131", "nt2": "///J/140", "bp": "A-U", "name": "rHoogsteen", "Saenger": "24-XXIV", "LW": "tHW", "DSSR": "tM-W", "intra_chain": true, "chi1": -105.228, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 2.720, "chi2": -158.479, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 41.079, "C1C1_dist": 10.930, "N1N9_dist": 8.411, "C6C8_dist": 7.733, "CNNC_torsion": 160.231, "hbonds_num": 1, "hbonds_desc": "N6(amino)-O2(carbonyl)[2.67]", "interBase_angle": 8.621, "planarity": 0.114, "simple_Shear": -4.046, "simple_Stretch": 0.974, "simple_Buckle": 7.764, "simple_Propeller": -3.747, "bp_simpleParams": [ -4.046, 0.974, 0.039, 7.764, -3.747, -73.715 ], "bp_params": [ -3.954, -1.299, 0.039, 8.574, 0.899, -73.562 ], "frame": { "rmsd": null, "origin": [ 285.005, 317.438, 267.297 ], "x_axis": [ 0.132, -0.765, -0.631 ], "y_axis": [ -0.865, 0.222, -0.450 ], "z_axis": [ 0.485, 0.605, -0.632 ], "quaternion": [ 0.425, -0.621, 0.656, 0.059 ] } }, { "index": 49, "nt1": "///J/132", "nt2": "///J/248", "bp": "A-U", "name": "--", "Saenger": "--", "LW": "tHW", "DSSR": "tM-W", "intra_chain": true, "chi1": -140.490, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 9.562, "chi2": -177.550, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 76.854, "C1C1_dist": 9.735, "N1N9_dist": 8.097, "C6C8_dist": 8.301, "CNNC_torsion": -144.548, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O2'(hydroxyl)[3.39],N6(amino)-O2(carbonyl)[3.08]", "interBase_angle": 19.456, "planarity": 0.328, "simple_Shear": -7.225, "simple_Stretch": 1.876, "simple_Buckle": -8.539, "simple_Propeller": -17.482, "bp_simpleParams": [ -7.225, 1.876, 1.460, -8.539, -17.482, -29.455 ], "bp_params": [ -6.114, -4.282, 1.460, 7.810, -17.820, -29.734 ], "frame": { "rmsd": null, "origin": [ 279.184, 320.261, 269.071 ], "x_axis": [ 0.482, -0.813, -0.326 ], "y_axis": [ -0.585, -0.022, -0.811 ], "z_axis": [ 0.652, 0.582, -0.486 ], "quaternion": [ -0.493, 0.705, -0.496, 0.116 ] } }, { "index": 50, "nt1": "///J/132", "nt2": "///J/269", "bp": "A-G", "name": "--", "Saenger": "--", "LW": "cSS", "DSSR": "cm-m", "intra_chain": true, "chi1": -140.490, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 146.459, "chi2": -167.318, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 103.636, "C1C1_dist": 5.885, "N1N9_dist": 7.489, "C6C8_dist": 10.014, "CNNC_torsion": -11.456, "hbonds_num": 3, "hbonds_desc": "O2'(hydroxyl)-O2'(hydroxyl)[2.94],O2'(hydroxyl)-N3[3.24],N3-N2(amino)[3.28]", "interBase_angle": 30.334, "planarity": 0.401, "simple_Shear": 0.467, "simple_Stretch": 7.365, "simple_Buckle": 23.745, "simple_Propeller": 18.876, "bp_simpleParams": [ 0.467, 7.365, -2.293, 23.745, 18.876, 149.155 ], "bp_params": [ 2.075, 7.082, -2.293, 27.349, 13.123, 148.487 ], "frame": { "rmsd": null, "origin": [ 278.060, 326.806, 271.051 ], "x_axis": [ 0.624, 0.037, 0.781 ], "y_axis": [ 0.420, -0.858, -0.295 ], "z_axis": [ 0.659, 0.512, -0.551 ], "quaternion": [ -0.232, 0.871, 0.131, 0.413 ] } }, { "index": 51, "nt1": "///J/134", "nt2": "///J/290", "bp": "G-U", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -179.343, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 38.109, "chi2": -152.992, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 68.818, "C1C1_dist": 10.774, "N1N9_dist": 9.092, "C6C8_dist": 9.870, "CNNC_torsion": -0.451, "hbonds_num": 2, "hbonds_desc": "O6(carbonyl)-N3(imino)[3.08],N1(imino)-O2(carbonyl)[3.07]", "interBase_angle": 5.890, "planarity": 0.066, "simple_Shear": -2.349, "simple_Stretch": 0.211, "simple_Buckle": -4.918, "simple_Propeller": -3.242, "bp_simpleParams": [ -2.349, 0.211, -0.227, -4.918, -3.242, -3.656 ], "bp_params": [ -2.334, -0.340, -0.227, -4.033, -4.293, -3.656 ], "frame": { "rmsd": null, "origin": [ 287.055, 327.964, 252.807 ], "x_axis": [ 0.733, 0.261, 0.628 ], "y_axis": [ -0.674, 0.150, 0.724 ], "z_axis": [ 0.095, -0.953, 0.286 ], "quaternion": [ 0.737, 0.569, -0.181, 0.317 ] } }, { "index": 52, "nt1": "///J/135", "nt2": "///J/289", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -161.134, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 54.016, "chi2": -160.694, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 54.848, "C1C1_dist": 10.663, "N1N9_dist": 8.951, "C6C8_dist": 9.932, "CNNC_torsion": -14.539, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.98],O4(carbonyl)-N6(amino)[3.16]", "interBase_angle": 13.498, "planarity": 0.162, "simple_Shear": 0.007, "simple_Stretch": 0.025, "simple_Buckle": 1.258, "simple_Propeller": -13.439, "bp_simpleParams": [ 0.007, 0.025, -0.009, 1.258, -13.439, 2.140 ], "bp_params": [ 0.007, 0.025, -0.009, 1.300, -13.435, 2.155 ], "frame": { "rmsd": null, "origin": [ 288.290, 324.540, 252.968 ], "x_axis": [ 0.137, 0.361, 0.922 ], "y_axis": [ -0.988, -0.015, 0.153 ], "z_axis": [ 0.069, -0.932, 0.355 ], "quaternion": [ 0.608, 0.446, -0.351, 0.555 ] } }, { "index": 53, "nt1": "///J/136", "nt2": "///J/288", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -162.625, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 50.916, "chi2": -156.967, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 52.486, "C1C1_dist": 10.839, "N1N9_dist": 9.007, "C6C8_dist": 9.822, "CNNC_torsion": -11.558, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.91],N1(imino)-N3[2.97],N2(amino)-O2(carbonyl)[2.91]", "interBase_angle": 16.998, "planarity": 0.186, "simple_Shear": -0.207, "simple_Stretch": -0.110, "simple_Buckle": -10.162, "simple_Propeller": -13.626, "bp_simpleParams": [ -0.207, -0.110, -0.264, -10.162, -13.626, -1.874 ], "bp_params": [ -0.206, -0.112, -0.264, -10.004, -13.742, -1.880 ], "frame": { "rmsd": null, "origin": [ 290.073, 321.268, 254.304 ], "x_axis": [ -0.404, 0.509, 0.760 ], "y_axis": [ -0.915, -0.235, -0.329 ], "z_axis": [ 0.011, -0.828, 0.560 ], "quaternion": [ 0.480, 0.260, -0.390, 0.741 ] } }, { "index": 54, "nt1": "///J/137", "nt2": "///J/287", "bp": "U-G", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -156.848, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 68.111, "chi2": -159.187, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 43.357, "C1C1_dist": 10.790, "N1N9_dist": 9.171, "C6C8_dist": 10.124, "CNNC_torsion": -8.327, "hbonds_num": 2, "hbonds_desc": "O2(carbonyl)-N1(imino)[3.14],N3(imino)-O6(carbonyl)[3.35]", "interBase_angle": 10.982, "planarity": 0.167, "simple_Shear": 2.121, "simple_Stretch": 0.415, "simple_Buckle": -3.260, "simple_Propeller": -10.487, "bp_simpleParams": [ 2.121, 0.415, -0.133, -3.260, -10.487, 3.655 ], "bp_params": [ 2.161, -0.044, -0.133, -5.402, -9.561, 3.664 ], "frame": { "rmsd": null, "origin": [ 290.596, 319.047, 257.033 ], "x_axis": [ -0.888, 0.326, 0.323 ], "y_axis": [ -0.455, -0.525, -0.720 ], "z_axis": [ -0.065, -0.786, 0.614 ], "quaternion": [ 0.224, 0.074, -0.433, 0.870 ] } }, { "index": 55, "nt1": "///J/138", "nt2": "///J/286", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -163.574, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 51.950, "chi2": -160.206, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 53.828, "C1C1_dist": 10.790, "N1N9_dist": 9.005, "C6C8_dist": 9.913, "CNNC_torsion": -7.173, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[3.04],N1(imino)-N3[2.99],N2(amino)-O2(carbonyl)[2.87]", "interBase_angle": 8.975, "planarity": 0.104, "simple_Shear": -0.249, "simple_Stretch": -0.065, "simple_Buckle": -3.415, "simple_Propeller": -8.300, "bp_simpleParams": [ -0.249, -0.065, -0.104, -3.415, -8.300, 0.727 ], "bp_params": [ -0.248, -0.069, -0.104, -3.251, -8.365, 0.729 ], "frame": { "rmsd": null, "origin": [ 290.031, 317.608, 260.099 ], "x_axis": [ -0.942, 0.290, -0.172 ], "y_axis": [ -0.080, -0.689, -0.721 ], "z_axis": [ -0.327, -0.665, 0.672 ], "quaternion": [ 0.102, -0.137, -0.381, 0.909 ] } }, { "index": 56, "nt1": "///J/139", "nt2": "///J/246", "bp": "C+A", "name": "--", "Saenger": "--", "LW": "tSW", "DSSR": "tm+W", "intra_chain": true, "chi1": -172.442, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 82.323, "chi2": -163.913, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 58.297, "C1C1_dist": 8.958, "N1N9_dist": 8.432, "C6C8_dist": 10.565, "CNNC_torsion": 166.101, "hbonds_num": 1, "hbonds_desc": "O2'(hydroxyl)-N1[3.26]", "interBase_angle": 32.437, "planarity": 0.374, "simple_Shear": 6.729, "simple_Stretch": 3.875, "simple_Buckle": 30.426, "simple_Propeller": -11.243, "bp_simpleParams": [ 6.729, 3.875, 0.874, 30.426, -11.243, -150.176 ], "bp_params": [ -1.873, -7.535, 0.874, -29.101, -14.328, -149.450 ], "frame": { "rmsd": null, "origin": [ 290.590, 316.112, 264.364 ], "x_axis": [ 0.246, -0.709, -0.661 ], "y_axis": [ 0.810, -0.225, 0.542 ], "z_axis": [ -0.533, -0.668, 0.519 ], "quaternion": [ 0.620, 0.488, 0.052, -0.612 ] } }, { "index": 57, "nt1": "///J/139", "nt2": "///J/285", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -172.442, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 52.712, "chi2": -178.283, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 49.927, "C1C1_dist": 10.800, "N1N9_dist": 8.956, "C6C8_dist": 9.892, "CNNC_torsion": -10.380, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.74],N3-N1(imino)[2.96],N4(amino)-O6(carbonyl)[3.06]", "interBase_angle": 9.376, "planarity": 0.135, "simple_Shear": 0.190, "simple_Stretch": -0.073, "simple_Buckle": -2.510, "simple_Propeller": -9.034, "bp_simpleParams": [ 0.190, -0.073, -0.056, -2.510, -9.034, 2.638 ], "bp_params": [ 0.189, -0.076, -0.056, -2.644, -8.996, 2.645 ], "frame": { "rmsd": null, "origin": [ 287.156, 317.291, 263.224 ], "x_axis": [ -0.819, -0.083, -0.568 ], "y_axis": [ 0.398, -0.795, -0.457 ], "z_axis": [ -0.414, -0.601, 0.684 ], "quaternion": [ -0.133, -0.270, -0.291, 0.908 ] } }, { "index": 58, "nt1": "///J/141", "nt2": "///J/245", "bp": "U-U", "name": "--", "Saenger": "--", "LW": "tHS", "DSSR": "tM-m", "intra_chain": true, "chi1": 31.572, "conf1": "syn", "pucker1": "~C3'-endo", "lambda1": 29.530, "chi2": -164.762, "conf2": "anti", "pucker2": "pucker-CHK", "lambda2": 94.559, "C1C1_dist": 8.260, "N1N9_dist": 7.386, "C6C8_dist": 7.538, "CNNC_torsion": 143.543, "hbonds_num": 1, "hbonds_desc": "O4(carbonyl)-O2'(hydroxyl)[2.18]", "interBase_angle": 18.286, "planarity": 0.397, "simple_Shear": -9.051, "simple_Stretch": 4.099, "simple_Buckle": 13.373, "simple_Propeller": -12.471, "bp_simpleParams": [ -9.051, 4.099, -1.418, 13.373, -12.471, -31.285 ], "bp_params": [ -6.970, -7.081, -1.418, 16.316, 8.256, -31.062 ], "frame": { "rmsd": null, "origin": [ 296.138, 316.112, 272.571 ], "x_axis": [ 0.773, 0.622, -0.128 ], "y_axis": [ 0.609, -0.783, -0.124 ], "z_axis": [ -0.177, 0.018, -0.984 ], "quaternion": [ -0.038, 0.941, 0.327, -0.081 ] } }, { "index": 59, "nt1": "///J/142", "nt2": "///J/151", "bp": "C+G", "name": "--", "Saenger": "--", "LW": "cHW", "DSSR": "cM+W", "intra_chain": true, "chi1": 50.001, "conf1": "syn", "pucker1": "~C2'-endo", "lambda1": 49.869, "chi2": -117.326, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 61.736, "C1C1_dist": 10.841, "N1N9_dist": 9.215, "C6C8_dist": 8.576, "CNNC_torsion": -27.155, "hbonds_num": 1, "hbonds_desc": "N4(amino)-O6(carbonyl)[3.45]", "interBase_angle": 22.597, "planarity": 0.324, "simple_Shear": -3.792, "simple_Stretch": 3.505, "simple_Buckle": 10.442, "simple_Propeller": -20.040, "bp_simpleParams": [ -3.792, 3.505, -1.472, 10.442, -20.040, 78.508 ], "bp_params": [ -0.537, -5.135, -1.472, 9.863, 20.331, 79.190 ], "frame": { "rmsd": null, "origin": [ 296.667, 314.285, 276.405 ], "x_axis": [ -0.301, 0.953, -0.041 ], "y_axis": [ 0.939, 0.288, -0.187 ], "z_axis": [ -0.166, -0.095, -0.981 ], "quaternion": [ -0.039, 0.590, 0.802, -0.088 ] } }, { "index": 60, "nt1": "///J/143", "nt2": "///J/157", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": 177.989, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 48.197, "chi2": -165.858, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 51.995, "C1C1_dist": 10.959, "N1N9_dist": 9.062, "C6C8_dist": 9.930, "CNNC_torsion": -9.644, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[3.00],N1(imino)-N3[2.96],N2(amino)-O2(carbonyl)[2.84]", "interBase_angle": 9.789, "planarity": 0.122, "simple_Shear": -0.209, "simple_Stretch": -0.071, "simple_Buckle": -1.980, "simple_Propeller": -9.586, "bp_simpleParams": [ -0.209, -0.071, 0.102, -1.980, -9.586, -0.418 ], "bp_params": [ -0.208, -0.074, 0.102, -1.833, -9.616, -0.419 ], "frame": { "rmsd": null, "origin": [ 307.082, 303.067, 284.342 ], "x_axis": [ 0.780, 0.193, -0.595 ], "y_axis": [ -0.619, 0.102, -0.779 ], "z_axis": [ -0.089, 0.976, 0.199 ], "quaternion": [ 0.721, -0.608, 0.175, 0.281 ] } }, { "index": 61, "nt1": "///J/144", "nt2": "///J/156", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -171.791, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 52.252, "chi2": -161.675, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 62.119, "C1C1_dist": 10.493, "N1N9_dist": 8.900, "C6C8_dist": 9.993, "CNNC_torsion": -3.224, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[3.48],N1(imino)-N3[3.13],N2(amino)-O2(carbonyl)[2.61]", "interBase_angle": 7.738, "planarity": 0.138, "simple_Shear": -0.923, "simple_Stretch": 0.090, "simple_Buckle": -7.723, "simple_Propeller": 0.492, "bp_simpleParams": [ -0.923, 0.090, 0.187, -7.723, 0.492, 9.078 ], "bp_params": [ -0.927, 0.008, 0.187, -7.736, -0.188, 9.057 ], "frame": { "rmsd": null, "origin": [ 308.267, 306.200, 285.884 ], "x_axis": [ 0.337, 0.089, -0.937 ], "y_axis": [ -0.938, -0.057, -0.343 ], "z_axis": [ -0.084, 0.994, 0.064 ], "quaternion": [ 0.580, -0.577, 0.368, 0.443 ] } }, { "index": 62, "nt1": "///J/145", "nt2": "///J/155", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -162.045, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 53.767, "chi2": -167.021, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 54.260, "C1C1_dist": 10.590, "N1N9_dist": 8.854, "C6C8_dist": 9.793, "CNNC_torsion": -2.125, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.81],O4(carbonyl)-N6(amino)[2.92]", "interBase_angle": 2.021, "planarity": 0.054, "simple_Shear": -0.075, "simple_Stretch": -0.147, "simple_Buckle": -0.630, "simple_Propeller": 1.920, "bp_simpleParams": [ -0.075, -0.147, 0.247, -0.630, 1.920, 0.210 ], "bp_params": [ -0.073, -0.148, 0.247, -0.653, 1.912, 0.210 ], "frame": { "rmsd": null, "origin": [ 309.398, 309.413, 286.749 ], "x_axis": [ -0.266, -0.022, -0.964 ], "y_axis": [ -0.958, -0.104, 0.267 ], "z_axis": [ -0.106, 0.994, 0.007 ], "quaternion": [ 0.399, -0.456, 0.537, 0.587 ] } }, { "index": 63, "nt1": "///J/146", "nt2": "///J/154", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -165.677, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 55.881, "chi2": -168.152, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 54.110, "C1C1_dist": 10.469, "N1N9_dist": 8.774, "C6C8_dist": 9.735, "CNNC_torsion": 4.611, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.94],N1-N3(imino)[2.79]", "interBase_angle": 11.606, "planarity": 0.136, "simple_Shear": -0.025, "simple_Stretch": -0.161, "simple_Buckle": 9.391, "simple_Propeller": 6.821, "bp_simpleParams": [ -0.025, -0.161, 0.069, 9.391, 6.821, 1.281 ], "bp_params": [ -0.025, -0.161, 0.069, 9.427, 6.771, 1.279 ], "frame": { "rmsd": null, "origin": [ 310.209, 312.355, 285.768 ], "x_axis": [ -0.704, -0.163, -0.692 ], "y_axis": [ -0.692, -0.061, 0.719 ], "z_axis": [ -0.159, 0.985, -0.070 ], "quaternion": [ 0.203, -0.327, 0.654, 0.651 ] } }, { "index": 64, "nt1": "///J/147", "nt2": "///J/153", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -168.142, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 48.338, "chi2": -165.175, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 49.115, "C1C1_dist": 10.815, "N1N9_dist": 8.864, "C6C8_dist": 9.633, "CNNC_torsion": 9.437, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.80],N1(imino)-N3[2.94],N2(amino)-O2(carbonyl)[2.89]", "interBase_angle": 3.252, "planarity": 0.282, "simple_Shear": -0.115, "simple_Stretch": -0.443, "simple_Buckle": -2.324, "simple_Propeller": -2.274, "bp_simpleParams": [ -0.115, -0.443, -1.310, -2.324, -2.274, -4.541 ], "bp_params": [ -0.112, -0.444, -1.310, -2.311, -2.288, -4.541 ], "frame": { "rmsd": null, "origin": [ 310.423, 315.816, 283.778 ], "x_axis": [ -0.923, -0.357, -0.144 ], "y_axis": [ -0.233, 0.220, 0.947 ], "z_axis": [ -0.307, 0.908, -0.286 ], "quaternion": [ -0.052, -0.189, 0.779, 0.595 ] } }, { "index": 65, "nt1": "///J/148", "nt2": "///J/152", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -149.563, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 74.671, "chi2": -133.273, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 64.367, "C1C1_dist": 9.808, "N1N9_dist": 8.779, "C6C8_dist": 10.193, "CNNC_torsion": 0.329, "hbonds_num": 2, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.66],N3-N1(imino)[3.51]", "interBase_angle": 16.611, "planarity": 0.317, "simple_Shear": 1.065, "simple_Stretch": 0.434, "simple_Buckle": 15.310, "simple_Propeller": -6.444, "bp_simpleParams": [ 1.065, 0.434, -1.672, 15.310, -6.444, 27.144 ], "bp_params": [ 1.103, 0.325, -1.672, 14.604, -7.915, 26.995 ], "frame": { "rmsd": null, "origin": [ 307.871, 317.688, 282.441 ], "x_axis": [ -0.892, -0.198, 0.408 ], "y_axis": [ 0.284, 0.457, 0.843 ], "z_axis": [ -0.353, 0.867, -0.351 ], "quaternion": [ -0.231, 0.026, 0.822, 0.520 ] } }, { "index": 66, "nt1": "///J/148", "nt2": "///J/153", "bp": "C-C", "name": "--", "Saenger": "--", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -149.563, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 91.144, "chi2": -165.175, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 59.764, "C1C1_dist": 7.834, "N1N9_dist": 7.125, "C6C8_dist": 8.926, "CNNC_torsion": -9.922, "hbonds_num": 1, "hbonds_desc": "O2(carbonyl)*N3[3.15]", "interBase_angle": 11.074, "planarity": 0.274, "simple_Shear": 2.059, "simple_Stretch": -0.254, "simple_Buckle": 11.016, "simple_Propeller": 1.128, "bp_simpleParams": [ 2.059, -0.254, 1.473, 11.016, 1.128, 44.555 ], "bp_params": [ 1.952, -0.703, 1.473, 10.993, -1.338, 44.373 ], "frame": { "rmsd": null, "origin": [ 308.919, 316.683, 283.445 ], "x_axis": [ -0.937, -0.233, 0.260 ], "y_axis": [ 0.131, 0.456, 0.880 ], "z_axis": [ -0.324, 0.859, -0.397 ], "quaternion": [ -0.175, -0.031, 0.835, 0.520 ] } }, { "index": 67, "nt1": "///J/158", "nt2": "///J/184", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -163.940, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 54.689, "chi2": -149.671, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 57.924, "C1C1_dist": 11.212, "N1N9_dist": 9.575, "C6C8_dist": 10.570, "CNNC_torsion": -8.145, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[3.60],O4(carbonyl)-N6(amino)[3.81]", "interBase_angle": 9.588, "planarity": 0.118, "simple_Shear": -0.155, "simple_Stretch": 0.670, "simple_Buckle": -6.787, "simple_Propeller": -6.773, "bp_simpleParams": [ -0.155, 0.670, 0.315, -6.787, -6.773, 3.052 ], "bp_params": [ -0.168, 0.667, 0.315, -6.657, -6.901, 3.052 ], "frame": { "rmsd": null, "origin": [ 308.272, 300.442, 281.940 ], "x_axis": [ 0.981, 0.185, 0.051 ], "y_axis": [ 0.002, -0.278, 0.961 ], "z_axis": [ 0.192, -0.943, -0.273 ], "quaternion": [ 0.598, 0.796, 0.059, 0.076 ] } }, { "index": 68, "nt1": "///J/159", "nt2": "///J/183", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -165.807, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 56.126, "chi2": -153.911, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 58.958, "C1C1_dist": 10.458, "N1N9_dist": 8.876, "C6C8_dist": 9.895, "CNNC_torsion": -7.564, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[3.02],N1(imino)-N3[2.90],N2(amino)-O2(carbonyl)[2.71]", "interBase_angle": 11.361, "planarity": 0.154, "simple_Shear": -0.256, "simple_Stretch": -0.113, "simple_Buckle": -2.830, "simple_Propeller": -11.003, "bp_simpleParams": [ -0.256, -0.113, -0.321, -2.830, -11.003, 4.531 ], "bp_params": [ -0.254, -0.118, -0.321, -2.600, -11.059, 4.551 ], "frame": { "rmsd": null, "origin": [ 309.350, 297.763, 280.266 ], "x_axis": [ 0.773, 0.307, 0.555 ], "y_axis": [ -0.449, -0.354, 0.821 ], "z_axis": [ 0.448, -0.884, -0.136 ], "quaternion": [ 0.566, 0.752, -0.047, 0.333 ] } }, { "index": 69, "nt1": "///J/160", "nt2": "///J/182", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -163.077, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 55.271, "chi2": -163.718, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 58.762, "C1C1_dist": 10.433, "N1N9_dist": 8.827, "C6C8_dist": 9.862, "CNNC_torsion": -5.895, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.65],N3-N1(imino)[2.86],N4(amino)-O6(carbonyl)[2.97]", "interBase_angle": 9.294, "planarity": 0.144, "simple_Shear": 0.151, "simple_Stretch": -0.154, "simple_Buckle": 1.604, "simple_Propeller": -9.154, "bp_simpleParams": [ 0.151, -0.154, -0.367, 1.604, -9.154, 4.565 ], "bp_params": [ 0.149, -0.155, -0.367, 1.503, -9.172, 4.579 ], "frame": { "rmsd": null, "origin": [ 311.498, 295.256, 278.380 ], "x_axis": [ 0.394, 0.132, 0.910 ], "y_axis": [ -0.826, -0.384, 0.413 ], "z_axis": [ 0.404, -0.914, -0.043 ], "quaternion": [ 0.492, 0.675, -0.257, 0.487 ] } }, { "index": 70, "nt1": "///J/161", "nt2": "///J/181", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -159.751, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 55.034, "chi2": -167.415, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 55.870, "C1C1_dist": 10.480, "N1N9_dist": 8.806, "C6C8_dist": 9.781, "CNNC_torsion": 0.938, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.80],O4(carbonyl)-N6(amino)[2.97]", "interBase_angle": 1.316, "planarity": 0.073, "simple_Shear": -0.074, "simple_Stretch": -0.154, "simple_Buckle": 0.153, "simple_Propeller": -1.307, "bp_simpleParams": [ -0.074, -0.154, -0.341, 0.153, -1.307, 1.567 ], "bp_params": [ -0.072, -0.155, -0.341, 0.169, -1.305, 1.566 ], "frame": { "rmsd": null, "origin": [ 314.059, 292.478, 277.561 ], "x_axis": [ -0.125, 0.008, 0.992 ], "y_axis": [ -0.920, -0.375, -0.113 ], "z_axis": [ 0.371, -0.927, 0.055 ], "quaternion": [ 0.372, 0.547, -0.417, 0.623 ] } }, { "index": 71, "nt1": "///J/162", "nt2": "///J/180", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -166.762, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 55.455, "chi2": -157.093, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 54.446, "C1C1_dist": 10.588, "N1N9_dist": 8.893, "C6C8_dist": 9.792, "CNNC_torsion": 3.743, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.93],N1-N3(imino)[2.90]", "interBase_angle": 12.357, "planarity": 0.177, "simple_Shear": 0.112, "simple_Stretch": -0.140, "simple_Buckle": -10.864, "simple_Propeller": -5.889, "bp_simpleParams": [ 0.112, -0.140, -0.896, -10.864, -5.889, -1.136 ], "bp_params": [ 0.110, -0.142, -0.896, -10.973, -5.682, -1.132 ], "frame": { "rmsd": null, "origin": [ 316.637, 289.533, 278.508 ], "x_axis": [ -0.644, -0.014, 0.765 ], "y_axis": [ -0.690, -0.423, -0.588 ], "z_axis": [ 0.332, -0.906, 0.262 ], "quaternion": [ 0.221, 0.359, -0.490, 0.763 ] } }, { "index": 72, "nt1": "///J/163", "nt2": "///J/179", "bp": "G-A", "name": "Sheared", "Saenger": "11-XI", "LW": "tSH", "DSSR": "tm-M", "intra_chain": true, "chi1": -168.101, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 92.835, "chi2": -166.364, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 6.319, "C1C1_dist": 9.764, "N1N9_dist": 8.481, "C6C8_dist": 8.852, "CNNC_torsion": 139.659, "hbonds_num": 3, "hbonds_desc": "O2'(hydroxyl)-N6(amino)[2.71],N2(amino)-N7[2.65],N3-N6(amino)[3.00]", "interBase_angle": 1.868, "planarity": 0.117, "simple_Shear": 7.416, "simple_Stretch": 2.419, "simple_Buckle": 1.604, "simple_Propeller": -0.957, "bp_simpleParams": [ 7.416, 2.419, -0.569, 1.604, -0.957, -9.713 ], "bp_params": [ 6.682, -4.024, -0.569, 0.326, -1.839, -9.714 ], "frame": { "rmsd": null, "origin": [ 318.569, 286.907, 280.130 ], "x_axis": [ -0.959, -0.285, -0.016 ], "y_axis": [ 0.081, -0.220, -0.972 ], "z_axis": [ 0.273, -0.933, 0.234 ], "quaternion": [ -0.118, 0.083, -0.613, 0.776 ] } }, { "index": 73, "nt1": "///J/164", "nt2": "///J/178", "bp": "A+A", "name": "--", "Saenger": "--", "LW": "tHH", "DSSR": "tM+M", "intra_chain": true, "chi1": -179.160, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 6.267, "chi2": -21.477, "conf2": "syn", "pucker2": "~C3'-endo", "lambda2": 54.892, "C1C1_dist": 9.345, "N1N9_dist": 7.143, "C6C8_dist": 4.791, "CNNC_torsion": -154.338, "hbonds_num": 1, "hbonds_desc": "N6(amino)-O2'(hydroxyl)[3.42]", "interBase_angle": 7.474, "planarity": 0.193, "simple_Shear": -8.847, "simple_Stretch": 3.877, "simple_Buckle": 1.794, "simple_Propeller": 7.256, "bp_simpleParams": [ -8.847, 3.877, 0.725, 1.794, 7.256, -131.032 ], "bp_params": [ -8.419, 4.735, 0.725, 2.502, 7.043, -131.104 ], "frame": { "rmsd": null, "origin": [ 319.155, 283.731, 282.404 ], "x_axis": [ -0.740, -0.259, -0.621 ], "y_axis": [ 0.615, 0.116, -0.780 ], "z_axis": [ 0.274, -0.959, 0.074 ], "quaternion": [ 0.335, 0.133, 0.667, -0.651 ] } }, { "index": 74, "nt1": "///J/165", "nt2": "///J/177", "bp": "G-U", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": 174.456, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 39.907, "chi2": -168.122, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 77.008, "C1C1_dist": 10.069, "N1N9_dist": 8.618, "C6C8_dist": 9.774, "CNNC_torsion": 5.390, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N3(imino)[3.09],N1(imino)-O2(carbonyl)[2.37],N2(amino)-O2(carbonyl)[3.36]", "interBase_angle": 9.231, "planarity": 0.124, "simple_Shear": -3.013, "simple_Stretch": 0.344, "simple_Buckle": -0.187, "simple_Propeller": 9.229, "bp_simpleParams": [ -3.013, 0.344, -0.082, -0.187, 9.229, 15.064 ], "bp_params": [ -2.978, -0.573, -0.082, -2.937, 8.751, 15.103 ], "frame": { "rmsd": null, "origin": [ 317.997, 280.278, 282.664 ], "x_axis": [ -0.784, -0.178, -0.594 ], "y_axis": [ 0.594, 0.059, -0.802 ], "z_axis": [ 0.178, -0.982, 0.059 ], "quaternion": [ 0.289, 0.156, 0.668, -0.668 ] } }, { "index": 75, "nt1": "///J/166", "nt2": "///J/176", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -163.178, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 57.234, "chi2": -173.763, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 56.747, "C1C1_dist": 10.267, "N1N9_dist": 8.656, "C6C8_dist": 9.716, "CNNC_torsion": 3.233, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.70],O4(carbonyl)-N6(amino)[3.00]", "interBase_angle": 5.281, "planarity": 0.065, "simple_Shear": -0.023, "simple_Stretch": -0.204, "simple_Buckle": 1.543, "simple_Propeller": 5.050, "bp_simpleParams": [ -0.023, -0.204, -0.100, 1.543, 5.050, 5.825 ], "bp_params": [ -0.021, -0.204, -0.100, 1.505, 5.062, 5.830 ], "frame": { "rmsd": null, "origin": [ 317.825, 277.099, 284.265 ], "x_axis": [ -0.163, -0.012, -0.987 ], "y_axis": [ 0.977, 0.136, -0.163 ], "z_axis": [ 0.136, -0.991, -0.011 ], "quaternion": [ 0.490, 0.422, 0.572, -0.504 ] } }, { "index": 76, "nt1": "///J/167", "nt2": "///J/175", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -157.946, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 56.193, "chi2": -171.188, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 56.291, "C1C1_dist": 10.489, "N1N9_dist": 8.848, "C6C8_dist": 9.854, "CNNC_torsion": 9.311, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.63],N3-N1(imino)[2.84],N4(amino)-O6(carbonyl)[2.97]", "interBase_angle": 9.886, "planarity": 0.135, "simple_Shear": 0.119, "simple_Stretch": -0.157, "simple_Buckle": 5.858, "simple_Propeller": 7.963, "bp_simpleParams": [ 0.119, -0.157, -0.366, 5.858, 7.963, 2.949 ], "bp_params": [ 0.118, -0.159, -0.366, 5.930, 7.910, 2.952 ], "frame": { "rmsd": null, "origin": [ 316.454, 273.900, 284.024 ], "x_axis": [ 0.348, 0.194, -0.917 ], "y_axis": [ 0.933, 0.023, 0.359 ], "z_axis": [ 0.091, -0.981, -0.173 ], "quaternion": [ 0.547, 0.612, 0.461, -0.337 ] } }, { "index": 77, "nt1": "///J/168", "nt2": "///J/174", "bp": "U-G", "name": "--", "Saenger": "--", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -178.996, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 47.499, "chi2": -173.733, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 49.919, "C1C1_dist": 10.262, "N1N9_dist": 8.314, "C6C8_dist": 9.131, "CNNC_torsion": 11.003, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.29],N3(imino)*N1(imino)[2.39],O4(carbonyl)*O6(carbonyl)[2.28]", "unusual_base2base_hbonds": 2, "interBase_angle": 15.877, "planarity": 0.206, "simple_Shear": 0.198, "simple_Stretch": -0.808, "simple_Buckle": 11.771, "simple_Propeller": 10.656, "bp_simpleParams": [ 0.198, -0.808, -0.524, 11.771, 10.656, -5.587 ], "bp_params": [ 0.181, -0.812, -0.524, 11.993, 10.404, -5.580 ], "frame": { "rmsd": null, "origin": [ 315.092, 270.856, 282.634 ], "x_axis": [ 0.755, 0.291, -0.588 ], "y_axis": [ 0.638, -0.117, 0.761 ], "z_axis": [ 0.153, -0.949, -0.274 ], "quaternion": [ 0.584, 0.733, 0.317, -0.148 ] } }, { "index": 78, "nt1": "///J/169", "nt2": "///J/173", "bp": "C-A", "name": "~Sheared", "Saenger": "--", "LW": "tSH", "DSSR": "tm-M", "intra_chain": true, "chi1": -169.907, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 90.424, "chi2": -168.755, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 11.112, "C1C1_dist": 9.887, "N1N9_dist": 8.540, "C6C8_dist": 8.958, "CNNC_torsion": -52.971, "hbonds_num": 2, "hbonds_desc": "O2'(hydroxyl)-N6(amino)[3.24],O2(carbonyl)-N6(amino)[2.49]", "interBase_angle": 35.768, "planarity": 0.398, "simple_Shear": 6.841, "simple_Stretch": 2.339, "simple_Buckle": 28.138, "simple_Propeller": 22.082, "bp_simpleParams": [ 6.841, 2.339, -1.409, 28.138, 22.082, -8.051 ], "bp_params": [ 6.447, -3.270, -1.409, 35.431, -4.899, -7.678 ], "frame": { "rmsd": null, "origin": [ 314.270, 268.074, 281.121 ], "x_axis": [ 0.975, 0.115, 0.191 ], "y_axis": [ -0.138, -0.359, 0.923 ], "z_axis": [ 0.175, -0.926, -0.334 ], "quaternion": [ 0.566, 0.817, -0.007, 0.112 ] } }, { "index": 79, "nt1": "///J/185", "nt2": "///J/245", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -99.876, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 45.372, "chi2": -164.762, "conf2": "anti", "pucker2": "pucker-CHK", "lambda2": 49.350, "C1C1_dist": 10.978, "N1N9_dist": 9.001, "C6C8_dist": 9.727, "CNNC_torsion": 21.074, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.88],N1-N3(imino)[2.95]", "interBase_angle": 11.146, "planarity": 0.174, "simple_Shear": 0.018, "simple_Stretch": -0.149, "simple_Buckle": -5.692, "simple_Propeller": 9.584, "bp_simpleParams": [ 0.018, -0.149, -0.572, -5.692, 9.584, -8.674 ], "bp_params": [ 0.017, -0.149, -0.572, -5.645, 9.611, -8.694 ], "frame": { "rmsd": null, "origin": [ 300.849, 315.628, 271.264 ], "x_axis": [ 0.877, 0.467, -0.109 ], "y_axis": [ 0.477, -0.873, 0.103 ], "z_axis": [ -0.047, -0.142, -0.989 ], "quaternion": [ 0.063, 0.967, 0.244, -0.040 ] } }, { "index": 80, "nt1": "///J/186", "nt2": "///J/244", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -158.959, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 56.492, "chi2": -152.445, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 55.883, "C1C1_dist": 10.569, "N1N9_dist": 8.930, "C6C8_dist": 9.847, "CNNC_torsion": -0.657, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.99],N1-N3(imino)[2.92]", "interBase_angle": 5.972, "planarity": 0.066, "simple_Shear": 0.029, "simple_Stretch": -0.056, "simple_Buckle": -5.424, "simple_Propeller": -2.499, "bp_simpleParams": [ 0.029, -0.056, -0.280, -5.424, -2.499, -0.366 ], "bp_params": [ 0.029, -0.056, -0.280, -5.443, -2.459, -0.366 ], "frame": { "rmsd": null, "origin": [ 301.138, 316.836, 267.269 ], "x_axis": [ 0.995, 0.088, 0.055 ], "y_axis": [ 0.077, -0.980, 0.182 ], "z_axis": [ 0.070, -0.177, -0.982 ], "quaternion": [ 0.090, 0.995, 0.042, 0.031 ] } }, { "index": 81, "nt1": "///J/187", "nt2": "///J/243", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -177.523, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 47.398, "chi2": -163.823, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 50.994, "C1C1_dist": 11.051, "N1N9_dist": 9.121, "C6C8_dist": 9.914, "CNNC_torsion": -3.834, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.94],N1(imino)-N3[3.02],N2(amino)-O2(carbonyl)[2.96]", "interBase_angle": 6.005, "planarity": 0.066, "simple_Shear": -0.143, "simple_Stretch": -0.053, "simple_Buckle": -4.496, "simple_Propeller": -3.981, "bp_simpleParams": [ -0.143, -0.053, -0.142, -4.496, -3.981, -3.072 ], "bp_params": [ -0.142, -0.054, -0.142, -4.461, -4.020, -3.072 ], "frame": { "rmsd": null, "origin": [ 301.507, 318.172, 263.569 ], "x_axis": [ 0.875, -0.365, 0.319 ], "y_axis": [ -0.420, -0.899, 0.124 ], "z_axis": [ 0.241, -0.242, -0.940 ], "quaternion": [ 0.095, 0.964, -0.204, 0.145 ] } }, { "index": 82, "nt1": "///J/188", "nt2": "///J/242", "bp": "U-G", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -161.855, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 65.978, "chi2": -178.789, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 33.938, "C1C1_dist": 10.764, "N1N9_dist": 8.960, "C6C8_dist": 9.744, "CNNC_torsion": -7.851, "hbonds_num": 2, "hbonds_desc": "O2(carbonyl)-N1(imino)[2.92],N3(imino)-O6(carbonyl)[2.91]", "interBase_angle": 6.950, "planarity": 0.083, "simple_Shear": 2.784, "simple_Stretch": 0.190, "simple_Buckle": 6.339, "simple_Propeller": -2.849, "bp_simpleParams": [ 2.784, 0.190, 0.011, 6.339, -2.849, -4.301 ], "bp_params": [ 2.728, -0.583, 0.011, 5.311, -4.482, -4.300 ], "frame": { "rmsd": null, "origin": [ 303.142, 318.203, 260.537 ], "x_axis": [ 0.359, -0.837, 0.414 ], "y_axis": [ -0.877, -0.454, -0.158 ], "z_axis": [ 0.320, -0.306, -0.897 ], "quaternion": [ 0.045, 0.823, -0.520, 0.223 ] } }, { "index": 83, "nt1": "///J/189", "nt2": "///J/241", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -162.284, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 53.051, "chi2": -165.100, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 53.808, "C1C1_dist": 10.582, "N1N9_dist": 8.833, "C6C8_dist": 9.830, "CNNC_torsion": -16.625, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.48],N3-N1(imino)[2.89],N4(amino)-O6(carbonyl)[3.22]", "interBase_angle": 17.081, "planarity": 0.218, "simple_Shear": 0.185, "simple_Stretch": -0.129, "simple_Buckle": 5.008, "simple_Propeller": -16.330, "bp_simpleParams": [ 0.185, -0.129, 0.313, 5.008, -16.330, 4.390 ], "bp_params": [ 0.183, -0.131, 0.313, 4.814, -16.388, 4.432 ], "frame": { "rmsd": null, "origin": [ 306.230, 317.548, 258.570 ], "x_axis": [ -0.084, -0.875, 0.477 ], "y_axis": [ -0.928, -0.106, -0.356 ], "z_axis": [ 0.362, -0.473, -0.803 ], "quaternion": [ 0.043, 0.676, -0.667, 0.311 ] } }, { "index": 84, "nt1": "///J/190", "nt2": "///J/240", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -159.588, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 49.639, "chi2": -179.595, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 44.994, "C1C1_dist": 11.062, "N1N9_dist": 9.060, "C6C8_dist": 9.812, "CNNC_torsion": -17.496, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.91],N1-N3(imino)[2.96]", "interBase_angle": 16.377, "planarity": 0.201, "simple_Shear": 0.115, "simple_Stretch": -0.059, "simple_Buckle": -5.187, "simple_Propeller": -15.534, "bp_simpleParams": [ 0.115, -0.059, 0.023, -5.187, -15.534, -5.965 ], "bp_params": [ 0.114, -0.061, 0.023, -5.457, -15.441, -6.013 ], "frame": { "rmsd": null, "origin": [ 308.808, 315.658, 256.598 ], "x_axis": [ -0.676, -0.656, 0.336 ], "y_axis": [ -0.675, 0.368, -0.640 ], "z_axis": [ 0.296, -0.659, -0.691 ], "quaternion": [ -0.012, -0.402, 0.827, -0.393 ] } }, { "index": 85, "nt1": "///J/191", "nt2": "///J/239", "bp": "A+A", "name": "--", "Saenger": "--", "LW": "cWH", "DSSR": "cW+M", "intra_chain": true, "chi1": -156.423, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 61.197, "chi2": -3.631, "conf2": "syn", "pucker2": "~C3'-endo", "lambda2": 19.351, "C1C1_dist": 12.353, "N1N9_dist": 10.278, "C6C8_dist": 10.097, "CNNC_torsion": -7.724, "hbonds_num": 1, "hbonds_desc": "N1-N6(amino)[2.48]", "interBase_angle": 17.240, "planarity": 0.216, "simple_Shear": -1.982, "simple_Stretch": 2.657, "simple_Buckle": 0.170, "simple_Propeller": -17.240, "bp_simpleParams": [ -1.982, 2.657, 0.529, 0.170, -17.240, -105.160 ], "bp_params": [ 2.062, 2.596, 0.529, -16.623, -4.573, -104.619 ], "frame": { "rmsd": null, "origin": [ 309.506, 311.808, 256.138 ], "x_axis": [ -0.708, 0.309, -0.635 ], "y_axis": [ 0.649, 0.640, -0.411 ], "z_axis": [ 0.280, -0.703, -0.654 ], "quaternion": [ 0.264, 0.277, 0.866, -0.322 ] } }, { "index": 86, "nt1": "///J/193", "nt2": "///J/237", "bp": "G+A", "name": "--", "Saenger": "--", "LW": "cWH", "DSSR": "cW+M", "intra_chain": true, "chi1": -156.270, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 97.967, "chi2": 46.435, "conf2": "syn", "pucker2": "~C3'-endo", "lambda2": 45.365, "C1C1_dist": 9.244, "N1N9_dist": 8.432, "C6C8_dist": 8.346, "CNNC_torsion": -25.169, "hbonds_num": 1, "hbonds_desc": "N2(amino)-N7[2.46]", "interBase_angle": 20.753, "planarity": 0.341, "simple_Shear": -1.075, "simple_Stretch": 5.276, "simple_Buckle": 3.189, "simple_Propeller": -20.507, "bp_simpleParams": [ -1.075, 5.276, 1.559, 3.189, -20.507, -39.270 ], "bp_params": [ 4.618, 2.770, 1.559, -18.292, -9.804, -38.943 ], "frame": { "rmsd": null, "origin": [ 306.032, 305.952, 252.278 ], "x_axis": [ 0.022, 0.575, -0.818 ], "y_axis": [ 0.995, 0.064, 0.072 ], "z_axis": [ 0.094, -0.815, -0.571 ], "quaternion": [ 0.359, 0.618, 0.635, -0.292 ] } }, { "index": 87, "nt1": "///J/194", "nt2": "///J/236", "bp": "A+A", "name": "--", "Saenger": "02-II", "LW": "tHH", "DSSR": "tM+M", "intra_chain": true, "chi1": -148.766, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 10.760, "chi2": -172.638, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 19.645, "C1C1_dist": 10.717, "N1N9_dist": 7.941, "C6C8_dist": 5.974, "CNNC_torsion": -131.588, "hbonds_num": 2, "hbonds_desc": "N7-N6(amino)[3.27],N6(amino)-N7[2.91]", "interBase_angle": 17.860, "planarity": 0.209, "simple_Shear": -8.133, "simple_Stretch": 0.618, "simple_Buckle": -13.279, "simple_Propeller": -11.943, "bp_simpleParams": [ -8.133, 0.618, -0.357, -13.279, -11.943, -172.825 ], "bp_params": [ -6.454, 4.988, -0.357, -17.660, -2.668, -172.742 ], "frame": { "rmsd": null, "origin": [ 310.213, 303.200, 249.803 ], "x_axis": [ 0.957, -0.004, 0.289 ], "y_axis": [ 0.241, 0.560, -0.792 ], "z_axis": [ -0.159, 0.828, 0.537 ], "quaternion": [ 0.874, -0.464, -0.128, -0.070 ] } }, { "index": 88, "nt1": "///J/195", "nt2": "///J/196", "bp": "G+U", "name": "Platform", "Saenger": "--", "LW": "cSH", "DSSR": "cm+M", "intra_chain": true, "chi1": -101.405, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 145.534, "chi2": -168.809, "conf2": "anti", "pucker2": "pucker-CHK", "lambda2": 51.789, "C1C1_dist": 6.671, "N1N9_dist": 6.974, "C6C8_dist": 6.939, "CNNC_torsion": -2.494, "hbonds_num": 2, "hbonds_desc": "O2'(hydroxyl)-OP2[2.99],N2(amino)-O4(carbonyl)[3.06]", "interBase_angle": 1.534, "planarity": 0.061, "simple_Shear": 0.184, "simple_Stretch": 8.235, "simple_Buckle": 1.520, "simple_Propeller": 0.207, "bp_simpleParams": [ 0.184, 8.235, 0.250, 1.520, 0.207, 15.580 ], "bp_params": [ 8.099, 1.505, 0.250, 0.514, -1.445, 15.581 ], "frame": { "rmsd": null, "origin": [ 308.281, 302.203, 243.503 ], "x_axis": [ -0.465, 0.396, -0.792 ], "y_axis": [ 0.881, 0.295, -0.370 ], "z_axis": [ 0.087, -0.869, -0.486 ], "quaternion": [ 0.293, 0.426, 0.749, -0.414 ] } }, { "index": 89, "nt1": "///J/196", "nt2": "///J/235", "bp": "U-A", "name": "rHoogsteen", "Saenger": "24-XXIV", "LW": "tWH", "DSSR": "tW-M", "intra_chain": true, "chi1": -168.809, "conf1": "anti", "pucker1": "pucker-CHK", "lambda1": 34.255, "chi2": -169.271, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 26.642, "C1C1_dist": 9.332, "N1N9_dist": 6.955, "C6C8_dist": 6.116, "CNNC_torsion": -154.970, "hbonds_num": 2, "hbonds_desc": "O2(carbonyl)-N6(amino)[2.99],N3(imino)-N7[2.88]", "interBase_angle": 11.476, "planarity": 0.195, "simple_Shear": 4.861, "simple_Stretch": 1.545, "simple_Buckle": 11.275, "simple_Propeller": 2.137, "bp_simpleParams": [ 4.861, 1.545, 0.350, 11.275, 2.137, -95.727 ], "bp_params": [ 4.409, -2.566, 0.350, 9.149, -6.927, -95.650 ], "frame": { "rmsd": null, "origin": [ 310.252, 299.452, 249.258 ], "x_axis": [ 0.202, 0.555, -0.807 ], "y_axis": [ 0.964, 0.035, 0.265 ], "z_axis": [ 0.175, -0.831, -0.528 ], "quaternion": [ 0.421, 0.651, 0.583, -0.243 ] } }, { "index": 90, "nt1": "///J/197", "nt2": "///J/234", "bp": "A-G", "name": "Sheared", "Saenger": "11-XI", "LW": "tHS", "DSSR": "tM-m", "intra_chain": true, "chi1": -176.452, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 3.414, "chi2": -176.024, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 89.183, "C1C1_dist": 9.872, "N1N9_dist": 8.499, "C6C8_dist": 8.819, "CNNC_torsion": 162.050, "hbonds_num": 3, "hbonds_desc": "N7-N2(amino)[2.81],N6(amino)-O2'(hydroxyl)[3.11],N6(amino)-N3[3.17]", "interBase_angle": 4.677, "planarity": 0.092, "simple_Shear": -7.575, "simple_Stretch": 2.684, "simple_Buckle": -1.096, "simple_Propeller": -4.546, "bp_simpleParams": [ -7.575, 2.684, -0.322, -1.096, -4.546, -9.811 ], "bp_params": [ -6.844, -4.212, -0.322, 2.851, -3.707, -9.813 ], "frame": { "rmsd": null, "origin": [ 310.458, 298.685, 243.375 ], "x_axis": [ 0.044, 0.511, -0.858 ], "y_axis": [ 0.981, 0.140, 0.134 ], "z_axis": [ 0.189, -0.848, -0.496 ], "quaternion": [ 0.415, 0.592, 0.631, -0.283 ] } }, { "index": 91, "nt1": "///J/198", "nt2": "///J/233", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -170.715, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 52.541, "chi2": -167.718, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 52.945, "C1C1_dist": 10.626, "N1N9_dist": 8.839, "C6C8_dist": 9.794, "CNNC_torsion": -9.580, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.01],N1-N3(imino)[2.86]", "interBase_angle": 7.411, "planarity": 0.099, "simple_Shear": -0.066, "simple_Stretch": -0.118, "simple_Buckle": -1.124, "simple_Propeller": -7.326, "bp_simpleParams": [ -0.066, -0.118, -0.200, -1.124, -7.326, 1.681 ], "bp_params": [ -0.066, -0.118, -0.200, -1.111, -7.328, 1.684 ], "frame": { "rmsd": null, "origin": [ 311.155, 296.189, 240.448 ], "x_axis": [ 0.890, 0.390, -0.235 ], "y_axis": [ 0.394, -0.400, 0.827 ], "z_axis": [ 0.228, -0.829, -0.510 ], "quaternion": [ 0.495, 0.837, 0.234, -0.002 ] } }, { "index": 92, "nt1": "///J/202", "nt2": "///J/229", "bp": "A+U", "name": "--", "Saenger": "--", "LW": "tWS", "DSSR": "tW+m", "intra_chain": true, "chi1": 3.060, "conf1": "syn", "pucker1": "~C3'-endo", "lambda1": 32.780, "chi2": -157.833, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 96.421, "C1C1_dist": 9.900, "N1N9_dist": 9.088, "C6C8_dist": 10.783, "CNNC_torsion": -153.855, "hbonds_num": 1, "hbonds_desc": "N1*O2(carbonyl)[3.40]", "interBase_angle": 16.796, "planarity": 0.323, "simple_Shear": 4.921, "simple_Stretch": 3.730, "simple_Buckle": -9.878, "simple_Propeller": 13.584, "bp_simpleParams": [ 4.921, 3.730, -0.827, -9.878, 13.584, 119.334 ], "bp_params": [ -0.262, 6.170, -0.827, -16.792, -0.362, 118.794 ], "frame": { "rmsd": null, "origin": [ 317.107, 285.623, 232.730 ], "x_axis": [ 0.603, 0.547, 0.581 ], "y_axis": [ 0.571, 0.213, -0.793 ], "z_axis": [ -0.557, 0.810, -0.184 ], "quaternion": [ 0.639, -0.627, -0.445, -0.009 ] } }, { "index": 93, "nt1": "///J/203", "nt2": "///J/228", "bp": "G-U", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": 176.111, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 31.734, "chi2": -165.492, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 67.393, "C1C1_dist": 10.881, "N1N9_dist": 9.074, "C6C8_dist": 9.815, "CNNC_torsion": 4.779, "hbonds_num": 2, "hbonds_desc": "O6(carbonyl)-N3(imino)[3.04],N1(imino)-O2(carbonyl)[3.07]", "interBase_angle": 14.476, "planarity": 0.158, "simple_Shear": -3.062, "simple_Stretch": 0.356, "simple_Buckle": 12.802, "simple_Propeller": 6.757, "bp_simpleParams": [ -3.062, 0.356, 0.534, 12.802, 6.757, -3.663 ], "bp_params": [ -3.028, -0.578, 0.534, 10.203, 10.269, -3.664 ], "frame": { "rmsd": null, "origin": [ 320.375, 284.270, 233.074 ], "x_axis": [ -0.726, -0.189, 0.661 ], "y_axis": [ -0.513, -0.491, -0.704 ], "z_axis": [ 0.458, -0.850, 0.260 ], "quaternion": [ 0.103, 0.355, -0.494, 0.787 ] } }, { "index": 94, "nt1": "///J/204", "nt2": "///J/227", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -164.255, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 52.636, "chi2": -179.717, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 50.424, "C1C1_dist": 10.758, "N1N9_dist": 8.919, "C6C8_dist": 9.802, "CNNC_torsion": -1.312, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.78],N3-N1(imino)[2.93],N4(amino)-O6(carbonyl)[2.94]", "interBase_angle": 18.131, "planarity": 0.235, "simple_Shear": 0.191, "simple_Stretch": -0.078, "simple_Buckle": 18.129, "simple_Propeller": -0.279, "bp_simpleParams": [ 0.191, -0.078, -0.188, 18.129, -0.279, -0.146 ], "bp_params": [ 0.190, -0.081, -0.188, 18.124, -0.527, -0.145 ], "frame": { "rmsd": null, "origin": [ 321.718, 282.061, 235.393 ], "x_axis": [ -0.902, -0.432, -0.020 ], "y_axis": [ 0.153, -0.276, -0.949 ], "z_axis": [ 0.404, -0.858, 0.315 ], "quaternion": [ -0.185, 0.122, -0.572, 0.789 ] } }, { "index": 95, "nt1": "///J/205", "nt2": "///J/226", "bp": "U-C", "name": "--", "Saenger": "--", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -167.075, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 81.634, "chi2": -156.996, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 35.888, "C1C1_dist": 9.578, "N1N9_dist": 8.189, "C6C8_dist": 9.276, "CNNC_torsion": -19.199, "hbonds_num": 1, "hbonds_desc": "O2(carbonyl)-N4(amino)[3.26]", "interBase_angle": 33.933, "planarity": 0.431, "simple_Shear": 4.254, "simple_Stretch": 0.277, "simple_Buckle": 28.206, "simple_Propeller": -18.865, "bp_simpleParams": [ 4.254, 0.277, -0.880, 28.206, -18.865, 15.042 ], "bp_params": [ 3.990, -1.502, -0.880, 18.066, -28.724, 15.343 ], "frame": { "rmsd": null, "origin": [ 322.249, 279.100, 237.660 ], "x_axis": [ -0.656, -0.417, -0.629 ], "y_axis": [ 0.725, -0.117, -0.679 ], "z_axis": [ 0.210, -0.901, 0.379 ], "quaternion": [ -0.390, -0.143, -0.539, 0.733 ] } }, { "index": 96, "nt1": "///J/206", "nt2": "///J/225", "bp": "U-U", "name": "--", "Saenger": "16-XVI", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -153.369, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 44.233, "chi2": -171.281, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 72.454, "C1C1_dist": 8.458, "N1N9_dist": 6.961, "C6C8_dist": 8.132, "CNNC_torsion": -5.622, "hbonds_num": 2, "hbonds_desc": "N3(imino)-O2(carbonyl)[2.60],O4(carbonyl)-N3(imino)[2.41]", "interBase_angle": 19.972, "planarity": 0.220, "simple_Shear": -2.944, "simple_Stretch": -1.369, "simple_Buckle": -19.586, "simple_Propeller": -3.905, "bp_simpleParams": [ -2.944, -1.369, -0.373, -19.586, -3.905, 8.725 ], "bp_params": [ -2.418, -2.167, -0.373, -17.619, -9.405, 8.652 ], "frame": { "rmsd": null, "origin": [ 320.822, 275.047, 240.687 ], "x_axis": [ -0.535, -0.150, -0.832 ], "y_axis": [ 0.839, 0.026, -0.544 ], "z_axis": [ 0.103, -0.988, 0.112 ], "quaternion": [ -0.388, -0.286, -0.602, 0.636 ] } }, { "index": 97, "nt1": "///J/207", "nt2": "///J/224", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -175.439, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 57.106, "chi2": -154.815, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 61.368, "C1C1_dist": 10.094, "N1N9_dist": 8.583, "C6C8_dist": 9.687, "CNNC_torsion": 2.702, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.04],N1-N3(imino)[2.69]", "interBase_angle": 12.784, "planarity": 0.150, "simple_Shear": -0.048, "simple_Stretch": -0.174, "simple_Buckle": -11.530, "simple_Propeller": 5.522, "bp_simpleParams": [ -0.048, -0.174, -0.183, -11.530, 5.522, 7.883 ], "bp_params": [ -0.048, -0.174, -0.183, -11.544, 5.493, 7.852 ], "frame": { "rmsd": null, "origin": [ 320.069, 271.800, 240.708 ], "x_axis": [ 0.052, 0.072, -0.996 ], "y_axis": [ 0.994, 0.096, 0.059 ], "z_axis": [ 0.100, -0.993, -0.067 ], "quaternion": [ 0.520, 0.506, 0.527, -0.443 ] } }, { "index": 98, "nt1": "///J/208", "nt2": "///J/223", "bp": "G-U", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": 171.993, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 33.293, "chi2": -172.795, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 58.747, "C1C1_dist": 11.021, "N1N9_dist": 9.030, "C6C8_dist": 9.727, "CNNC_torsion": -6.228, "hbonds_num": 2, "hbonds_desc": "O6(carbonyl)-N3(imino)[2.88],N1(imino)-O2(carbonyl)[2.98]", "interBase_angle": 13.506, "planarity": 0.143, "simple_Shear": -2.309, "simple_Stretch": 0.065, "simple_Buckle": -12.249, "simple_Propeller": -5.690, "bp_simpleParams": [ -2.309, 0.065, -0.452, -12.249, -5.690, -6.708 ], "bp_params": [ -2.265, -0.454, -0.452, -10.674, -8.275, -6.697 ], "frame": { "rmsd": null, "origin": [ 318.381, 268.684, 239.300 ], "x_axis": [ 0.363, 0.407, -0.838 ], "y_axis": [ 0.921, -0.018, 0.390 ], "z_axis": [ 0.144, -0.913, -0.381 ], "quaternion": [ 0.491, 0.664, 0.500, -0.261 ] } }, { "index": 99, "nt1": "///J/209", "nt2": "///J/222", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -177.623, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 55.938, "chi2": -156.578, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 52.454, "C1C1_dist": 11.616, "N1N9_dist": 9.891, "C6C8_dist": 10.816, "CNNC_torsion": 5.699, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.92],N1-N3(imino)[3.86]", "interBase_angle": 5.450, "planarity": 0.119, "simple_Shear": 0.560, "simple_Stretch": 0.888, "simple_Buckle": -5.439, "simple_Propeller": -0.344, "bp_simpleParams": [ 0.560, 0.888, -0.727, -5.439, -0.344, -0.533 ], "bp_params": [ 0.614, 0.852, -0.727, -5.450, -0.008, -0.533 ], "frame": { "rmsd": null, "origin": [ 317.662, 265.760, 237.110 ], "x_axis": [ 0.864, 0.331, -0.380 ], "y_axis": [ 0.476, -0.285, 0.832 ], "z_axis": [ 0.167, -0.900, -0.404 ], "quaternion": [ 0.542, 0.799, 0.252, -0.067 ] } }, { "index": 100, "nt1": "///J/210", "nt2": "///J/221", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -166.190, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 55.332, "chi2": -175.269, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 52.821, "C1C1_dist": 10.749, "N1N9_dist": 9.008, "C6C8_dist": 9.932, "CNNC_torsion": -2.415, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.80],N3-N1(imino)[2.97],N4(amino)-O6(carbonyl)[3.03]", "interBase_angle": 8.605, "planarity": 0.110, "simple_Shear": 0.240, "simple_Stretch": -0.065, "simple_Buckle": 6.621, "simple_Propeller": -5.497, "bp_simpleParams": [ 0.240, -0.065, -0.452, 6.621, -5.497, 1.807 ], "bp_params": [ 0.239, -0.069, -0.452, 6.523, -5.612, 1.807 ], "frame": { "rmsd": null, "origin": [ 318.194, 263.831, 234.001 ], "x_axis": [ 0.986, 0.164, 0.038 ], "y_axis": [ 0.033, -0.407, 0.913 ], "z_axis": [ 0.165, -0.899, -0.406 ], "quaternion": [ 0.541, 0.836, 0.059, 0.060 ] } }, { "index": 101, "nt1": "///J/211", "nt2": "///J/220", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -168.510, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 53.202, "chi2": -170.868, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 55.163, "C1C1_dist": 10.750, "N1N9_dist": 9.011, "C6C8_dist": 9.941, "CNNC_torsion": -0.888, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.79],N3-N1(imino)[2.97],N4(amino)-O6(carbonyl)[3.02]", "interBase_angle": 1.016, "planarity": 0.052, "simple_Shear": 0.135, "simple_Stretch": -0.056, "simple_Buckle": -0.390, "simple_Propeller": 0.938, "bp_simpleParams": [ 0.135, -0.056, 0.240, -0.390, 0.938, 1.484 ], "bp_params": [ 0.135, -0.058, 0.240, -0.382, 0.942, 1.484 ], "frame": { "rmsd": null, "origin": [ 318.678, 261.291, 230.327 ], "x_axis": [ 0.883, -0.009, 0.469 ], "y_axis": [ -0.441, -0.356, 0.824 ], "z_axis": [ 0.160, -0.934, -0.318 ], "quaternion": [ 0.550, 0.800, -0.141, 0.196 ] } }, { "index": 102, "nt1": "///J/212", "nt2": "///J/219", "bp": "U-G", "name": "--", "Saenger": "--", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -173.739, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 53.406, "chi2": 174.881, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 46.722, "C1C1_dist": 11.806, "N1N9_dist": 9.905, "C6C8_dist": 10.796, "CNNC_torsion": 4.922, "hbonds_num": 1, "hbonds_desc": "O2(carbonyl)-N2(amino)[3.50]", "interBase_angle": 9.996, "planarity": 0.117, "simple_Shear": 0.237, "simple_Stretch": 0.840, "simple_Buckle": -4.593, "simple_Propeller": 8.878, "bp_simpleParams": [ 0.237, 0.840, 0.249, -4.593, 8.878, 0.939 ], "bp_params": [ 0.250, 0.836, 0.249, -4.452, 8.949, 0.941 ], "frame": { "rmsd": null, "origin": [ 320.931, 258.907, 227.845 ], "x_axis": [ 0.527, -0.144, 0.837 ], "y_axis": [ -0.822, -0.336, 0.460 ], "z_axis": [ 0.215, -0.931, -0.295 ], "quaternion": [ 0.473, 0.735, -0.329, 0.358 ] } }, { "index": 103, "nt1": "///J/213", "nt2": "///J/218", "bp": "U-G", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -159.853, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 68.003, "chi2": -174.339, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 33.952, "C1C1_dist": 10.380, "N1N9_dist": 8.628, "C6C8_dist": 9.474, "CNNC_torsion": 8.384, "hbonds_num": 2, "hbonds_desc": "O2(carbonyl)-N1(imino)[2.64],N3(imino)-O6(carbonyl)[2.83]", "interBase_angle": 20.153, "planarity": 0.297, "simple_Shear": 2.625, "simple_Stretch": -0.061, "simple_Buckle": 4.005, "simple_Propeller": 19.751, "bp_simpleParams": [ 2.625, -0.061, 0.185, 4.005, 19.751, 1.820 ], "bp_params": [ 2.513, -0.761, 0.185, 9.104, 17.980, 1.837 ], "frame": { "rmsd": null, "origin": [ 322.979, 256.412, 227.089 ], "x_axis": [ -0.196, -0.260, 0.945 ], "y_axis": [ -0.949, -0.193, -0.249 ], "z_axis": [ 0.247, -0.946, -0.210 ], "quaternion": [ -0.317, -0.549, 0.551, -0.543 ] } }, { "index": 104, "nt1": "///J/214", "nt2": "///J/216", "bp": "U-G", "name": "--", "Saenger": "--", "LW": "tSH", "DSSR": "tm-M", "intra_chain": true, "chi1": -149.753, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 78.116, "chi2": -135.512, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 39.862, "C1C1_dist": 7.717, "N1N9_dist": 6.663, "C6C8_dist": 6.511, "CNNC_torsion": -148.510, "hbonds_num": 1, "hbonds_desc": "O2(carbonyl)*N7[3.29]", "interBase_angle": 48.284, "planarity": 0.497, "simple_Shear": 7.597, "simple_Stretch": 5.812, "simple_Buckle": 33.482, "simple_Propeller": 34.789, "bp_simpleParams": [ 7.597, 5.812, -1.866, 33.482, 34.789, -72.890 ], "bp_params": [ 6.785, -6.743, -1.866, 39.026, -28.430, -71.424 ], "frame": { "rmsd": null, "origin": [ 328.241, 253.518, 223.192 ], "x_axis": [ -0.949, -0.048, 0.312 ], "y_axis": [ -0.315, 0.080, -0.946 ], "z_axis": [ 0.020, -0.996, -0.091 ], "quaternion": [ -0.100, -0.125, 0.728, -0.667 ] } }, { "index": 105, "nt1": "///J/246", "nt2": "///J/285", "bp": "A-G", "name": "--", "Saenger": "--", "LW": "cSS", "DSSR": "cm-m", "intra_chain": true, "chi1": -163.913, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 151.242, "chi2": -178.283, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 105.051, "C1C1_dist": 5.587, "N1N9_dist": 7.291, "C6C8_dist": 9.883, "CNNC_torsion": 7.991, "hbonds_num": 2, "hbonds_desc": "O2'(hydroxyl)-N3[3.13],N3-N2(amino)[3.04]", "interBase_angle": 24.578, "planarity": 0.306, "simple_Shear": 0.369, "simple_Stretch": 7.450, "simple_Buckle": 16.396, "simple_Propeller": 18.309, "bp_simpleParams": [ 0.369, 7.450, -1.506, 16.396, 18.309, 150.980 ], "bp_params": [ 1.719, 7.259, -1.506, 19.442, 15.035, 150.812 ], "frame": { "rmsd": null, "origin": [ 290.671, 316.073, 264.419 ], "x_axis": [ 0.230, -0.707, -0.669 ], "y_axis": [ 0.767, -0.291, 0.571 ], "z_axis": [ -0.599, -0.645, 0.475 ], "quaternion": [ 0.594, 0.511, 0.030, -0.620 ] } }, { "index": 106, "nt1": "///J/247", "nt2": "///J/248", "bp": "G+U", "name": "Platform", "Saenger": "--", "LW": "cSH", "DSSR": "cm+M", "intra_chain": true, "chi1": -96.524, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 142.269, "chi2": -177.550, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 55.927, "C1C1_dist": 6.532, "N1N9_dist": 6.880, "C6C8_dist": 6.851, "CNNC_torsion": 26.104, "hbonds_num": 1, "hbonds_desc": "N2(amino)-O4(carbonyl)[3.07]", "interBase_angle": 17.785, "planarity": 0.229, "simple_Shear": 0.209, "simple_Stretch": 8.150, "simple_Buckle": -17.105, "simple_Propeller": 4.871, "bp_simpleParams": [ 0.209, 8.150, -0.456, -17.105, 4.871, 15.733 ], "bp_params": [ 7.982, 1.657, -0.456, 0.804, 17.766, 15.921 ], "frame": { "rmsd": null, "origin": [ 281.228, 314.141, 265.516 ], "x_axis": [ 0.401, -0.814, -0.420 ], "y_axis": [ 0.667, -0.054, 0.743 ], "z_axis": [ -0.628, -0.578, 0.521 ], "quaternion": [ 0.683, 0.483, -0.076, -0.542 ] } }, { "index": 107, "nt1": "///J/259", "nt2": "///J/260", "bp": "G+U", "name": "Platform", "Saenger": "--", "LW": "cSH", "DSSR": "cm+M", "intra_chain": true, "chi1": -133.730, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 134.430, "chi2": -165.058, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 58.533, "C1C1_dist": 6.516, "N1N9_dist": 6.795, "C6C8_dist": 6.790, "CNNC_torsion": 21.779, "hbonds_num": 1, "hbonds_desc": "N2(amino)-O4(carbonyl)[3.01]", "interBase_angle": 19.969, "planarity": 0.293, "simple_Shear": 0.263, "simple_Stretch": 8.046, "simple_Buckle": -14.702, "simple_Propeller": 13.513, "bp_simpleParams": [ 0.263, 8.046, -1.291, -14.702, 13.513, 15.560 ], "bp_params": [ 7.801, 1.991, -1.291, 8.869, 17.891, 15.704 ], "frame": { "rmsd": null, "origin": [ 253.606, 312.505, 278.331 ], "x_axis": [ -0.007, -0.998, 0.064 ], "y_axis": [ 0.073, 0.064, 0.995 ], "z_axis": [ -0.997, 0.012, 0.072 ], "quaternion": [ 0.531, 0.463, -0.500, -0.504 ] } }, { "index": 108, "nt1": "///J/263", "nt2": "///J/275", "bp": "C+G", "name": "--", "Saenger": "--", "LW": "cHW", "DSSR": "cM+W", "intra_chain": true, "chi1": 19.178, "conf1": "syn", "pucker1": "~C3'-endo", "lambda1": 46.047, "chi2": -154.458, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 52.998, "C1C1_dist": 11.139, "N1N9_dist": 9.238, "C6C8_dist": 8.563, "CNNC_torsion": -11.297, "hbonds_num": 1, "hbonds_desc": "N4(amino)-O6(carbonyl)[2.50]", "interBase_angle": 10.741, "planarity": 0.124, "simple_Shear": -4.051, "simple_Stretch": 2.625, "simple_Buckle": 1.560, "simple_Propeller": -10.628, "bp_simpleParams": [ -4.051, 2.625, -0.474, 1.560, -10.628, 91.844 ], "bp_params": [ 0.075, -4.827, -0.474, 7.964, 7.208, 91.819 ], "frame": { "rmsd": null, "origin": [ 261.147, 326.618, 281.267 ], "x_axis": [ 0.875, 0.169, 0.453 ], "y_axis": [ -0.339, 0.883, 0.325 ], "z_axis": [ -0.345, -0.438, 0.830 ], "quaternion": [ 0.947, 0.201, -0.211, 0.134 ] } }, { "index": 109, "nt1": "///J/264", "nt2": "///J/274", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -176.055, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 44.848, "chi2": 171.086, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 40.583, "C1C1_dist": 11.126, "N1N9_dist": 8.961, "C6C8_dist": 9.695, "CNNC_torsion": -26.019, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.88],N1(imino)-N3[2.91],N2(amino)-O2(carbonyl)[2.83]", "interBase_angle": 24.576, "planarity": 0.295, "simple_Shear": -0.180, "simple_Stretch": -0.211, "simple_Buckle": -10.379, "simple_Propeller": -22.277, "bp_simpleParams": [ -0.180, -0.211, 0.152, -10.379, -22.277, -4.614 ], "bp_params": [ -0.179, -0.211, 0.152, -10.193, -22.363, -4.686 ], "frame": { "rmsd": null, "origin": [ 263.077, 330.202, 280.124 ], "x_axis": [ 0.380, -0.925, -0.008 ], "y_axis": [ -0.749, -0.303, -0.589 ], "z_axis": [ 0.542, 0.230, -0.808 ], "quaternion": [ -0.260, 0.789, -0.530, 0.169 ] } }, { "index": 110, "nt1": "///J/264", "nt2": "///J/277", "bp": "G-U", "name": "--", "Saenger": "--", "LW": "--", "DSSR": "--", "intra_chain": true, "chi1": -176.055, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 85.838, "chi2": 76.158, "conf2": "syn", "pucker2": "~C3'-endo", "lambda2": 5.275, "C1C1_dist": 11.970, "N1N9_dist": 10.476, "C6C8_dist": 11.186, "CNNC_torsion": -133.674, "hbonds_num": 1, "hbonds_desc": "N2(amino)-O4(carbonyl)[3.15]", "interBase_angle": 48.918, "planarity": 0.541, "simple_Shear": 6.492, "simple_Stretch": 3.835, "simple_Buckle": 15.326, "simple_Propeller": -46.455, "bp_simpleParams": [ 6.492, 3.835, 0.885, 15.326, -46.455, 1.192 ], "bp_params": [ 7.333, -1.752, 0.885, -21.917, -43.733, 1.264 ], "frame": { "rmsd": null, "origin": [ 261.167, 333.447, 279.269 ], "x_axis": [ 0.304, -0.939, 0.159 ], "y_axis": [ -0.661, -0.328, -0.675 ], "z_axis": [ 0.686, 0.100, -0.720 ], "quaternion": [ -0.252, 0.767, -0.522, 0.276 ] } }, { "index": 111, "nt1": "///J/265", "nt2": "///J/278", "bp": "A+A", "name": "--", "Saenger": "--", "LW": ".SH", "DSSR": ".m+M", "intra_chain": true, "chi1": 179.091, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 117.404, "chi2": -123.216, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 17.289, "C1C1_dist": 8.431, "N1N9_dist": 7.765, "C6C8_dist": 7.919, "CNNC_torsion": -48.663, "hbonds_num": 2, "hbonds_desc": "O2'(hydroxyl)-N7[3.14],N3-N6(amino)[3.16]", "interBase_angle": 52.989, "planarity": 0.755, "simple_Shear": 0.176, "simple_Stretch": 6.297, "simple_Buckle": 23.933, "simple_Propeller": -47.277, "bp_simpleParams": [ 0.176, 6.297, 2.605, 23.933, -47.277, -19.192 ], "bp_params": [ 6.229, -0.941, 2.605, -50.162, -17.076, -17.643 ], "frame": { "rmsd": null, "origin": [ 265.477, 333.547, 279.075 ], "x_axis": [ -0.308, -0.865, -0.395 ], "y_axis": [ -0.652, 0.495, -0.574 ], "z_axis": [ 0.693, 0.081, -0.717 ], "quaternion": [ 0.343, -0.478, 0.794, -0.156 ] } }, { "index": 112, "nt1": "///J/266", "nt2": "///J/271", "bp": "G-U", "name": "--", "Saenger": "--", "LW": "tWH", "DSSR": "tW-M", "intra_chain": true, "chi1": -171.300, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 71.676, "chi2": -167.788, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 24.813, "C1C1_dist": 12.211, "N1N9_dist": 10.592, "C6C8_dist": 10.391, "CNNC_torsion": 155.893, "hbonds_num": 1, "hbonds_desc": "N2(amino)-O4(carbonyl)[3.96]", "interBase_angle": 32.919, "planarity": 0.470, "simple_Shear": 7.435, "simple_Stretch": 5.907, "simple_Buckle": -32.918, "simple_Propeller": -0.343, "bp_simpleParams": [ 7.435, 5.907, 0.634, -32.918, -0.343, -55.346 ], "bp_params": [ 8.958, -3.151, 0.634, -17.801, 27.691, -56.188 ], "frame": { "rmsd": null, "origin": [ 270.275, 329.790, 274.464 ], "x_axis": [ -0.895, 0.159, -0.417 ], "y_axis": [ 0.046, 0.962, 0.268 ], "z_axis": [ 0.444, 0.220, -0.868 ], "quaternion": [ 0.223, 0.053, 0.965, 0.126 ] } }, { "index": 113, "nt1": "///J/267", "nt2": "///J/270", "bp": "U-U", "name": "--", "Saenger": "--", "LW": "tWH", "DSSR": "tW-M", "intra_chain": true, "chi1": -155.779, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 81.653, "chi2": -152.814, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 33.210, "C1C1_dist": 8.837, "N1N9_dist": 7.705, "C6C8_dist": 7.575, "CNNC_torsion": -153.719, "hbonds_num": 1, "hbonds_desc": "N3(imino)-OP2[3.22]", "interBase_angle": 32.950, "planarity": 0.406, "simple_Shear": 8.504, "simple_Stretch": 5.262, "simple_Buckle": -25.022, "simple_Propeller": 21.439, "bp_simpleParams": [ 8.504, 5.262, 1.564, -25.022, 21.439, -55.388 ], "bp_params": [ 7.192, -6.949, 1.564, 14.563, 29.557, -56.616 ], "frame": { "rmsd": null, "origin": [ 271.765, 329.154, 271.300 ], "x_axis": [ -0.776, 0.602, -0.189 ], "y_axis": [ 0.478, 0.756, 0.447 ], "z_axis": [ 0.411, 0.256, -0.875 ], "quaternion": [ 0.163, 0.292, 0.923, 0.190 ] } }, { "index": 114, "nt1": "///J/268", "nt2": "///J/284", "bp": "G+C", "name": "--", "Saenger": "--", "LW": "cHW", "DSSR": "cM+W", "intra_chain": true, "chi1": 8.341, "conf1": "syn", "pucker1": "~C3'-endo", "lambda1": 26.147, "chi2": -156.668, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 57.386, "C1C1_dist": 10.597, "N1N9_dist": 8.485, "C6C8_dist": 8.231, "CNNC_torsion": -9.065, "hbonds_num": 1, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.93]", "interBase_angle": 12.678, "planarity": 0.186, "simple_Shear": -2.282, "simple_Stretch": 1.069, "simple_Buckle": 0.031, "simple_Propeller": -12.678, "bp_simpleParams": [ -2.282, 1.069, -0.651, 0.031, -12.678, 99.367 ], "bp_params": [ -0.282, -2.504, -0.651, 12.000, 4.090, 99.093 ], "frame": { "rmsd": null, "origin": [ 277.681, 333.137, 267.926 ], "x_axis": [ 0.727, -0.162, 0.667 ], "y_axis": [ 0.087, -0.942, -0.323 ], "z_axis": [ 0.681, 0.293, -0.671 ], "quaternion": [ -0.169, 0.914, -0.021, 0.369 ] } }, { "index": 115, "nt1": "///J/269", "nt2": "///J/283", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -167.318, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 49.913, "chi2": -167.666, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 53.847, "C1C1_dist": 10.711, "N1N9_dist": 8.903, "C6C8_dist": 9.870, "CNNC_torsion": -23.454, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[3.07],N1(imino)-N3[2.96],N2(amino)-O2(carbonyl)[2.73]", "interBase_angle": 18.624, "planarity": 0.234, "simple_Shear": -0.337, "simple_Stretch": -0.092, "simple_Buckle": -3.519, "simple_Propeller": -18.289, "bp_simpleParams": [ -0.337, -0.092, 0.170, -3.519, -18.289, 3.225 ], "bp_params": [ -0.334, -0.101, 0.170, -2.989, -18.383, 3.266 ], "frame": { "rmsd": null, "origin": [ 276.709, 330.578, 270.598 ], "x_axis": [ 0.065, 0.970, 0.235 ], "y_axis": [ -0.763, 0.200, -0.614 ], "z_axis": [ -0.643, -0.139, 0.753 ], "quaternion": [ 0.710, -0.167, -0.309, 0.610 ] } }, { "index": 116, "nt1": "///J/270", "nt2": "///J/282", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -152.814, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 50.004, "chi2": -171.892, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 47.123, "C1C1_dist": 11.051, "N1N9_dist": 9.102, "C6C8_dist": 9.893, "CNNC_torsion": -18.261, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[3.03],O4(carbonyl)-N6(amino)[3.02]", "interBase_angle": 17.317, "planarity": 0.216, "simple_Shear": -0.229, "simple_Stretch": 0.039, "simple_Buckle": -7.721, "simple_Propeller": -15.500, "bp_simpleParams": [ -0.229, 0.039, -0.022, -7.721, -15.500, -4.125 ], "bp_params": [ -0.229, 0.033, -0.022, -7.328, -15.690, -4.156 ], "frame": { "rmsd": null, "origin": [ 275.864, 329.530, 274.208 ], "x_axis": [ -0.301, 0.929, -0.216 ], "y_axis": [ -0.692, -0.369, -0.621 ], "z_axis": [ -0.656, -0.038, 0.753 ], "quaternion": [ 0.520, -0.280, -0.212, 0.778 ] } }, { "index": 117, "nt1": "///J/271", "nt2": "///J/281", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -167.788, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 49.282, "chi2": -175.122, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 48.443, "C1C1_dist": 10.984, "N1N9_dist": 9.044, "C6C8_dist": 9.845, "CNNC_torsion": -14.605, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.99],O4(carbonyl)-N6(amino)[2.97]", "interBase_angle": 11.388, "planarity": 0.140, "simple_Shear": -0.011, "simple_Stretch": -0.036, "simple_Buckle": -0.592, "simple_Propeller": -11.373, "bp_simpleParams": [ -0.011, -0.036, -0.028, -0.592, -11.373, -4.120 ], "bp_params": [ -0.011, -0.036, -0.028, -0.532, -11.376, -4.140 ], "frame": { "rmsd": null, "origin": [ 274.193, 330.515, 277.030 ], "x_axis": [ -0.564, 0.600, -0.568 ], "y_axis": [ -0.455, -0.799, -0.392 ], "z_axis": [ -0.689, 0.037, 0.724 ], "quaternion": [ 0.300, -0.358, -0.101, 0.878 ] } }, { "index": 118, "nt1": "///J/272", "nt2": "///J/280", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -176.950, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 50.451, "chi2": -162.875, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 48.766, "C1C1_dist": 10.988, "N1N9_dist": 9.078, "C6C8_dist": 9.884, "CNNC_torsion": -6.149, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.93],N1-N3(imino)[2.98]", "interBase_angle": 5.503, "planarity": 0.075, "simple_Shear": 0.160, "simple_Stretch": -0.019, "simple_Buckle": 2.516, "simple_Propeller": -4.894, "bp_simpleParams": [ 0.160, -0.019, 0.149, 2.516, -4.894, -4.965 ], "bp_params": [ 0.160, -0.023, 0.149, 2.415, -4.945, -4.968 ], "frame": { "rmsd": null, "origin": [ 272.075, 332.457, 279.227 ], "x_axis": [ -0.595, 0.128, -0.793 ], "y_axis": [ -0.173, -0.985, -0.029 ], "z_axis": [ -0.785, 0.119, 0.608 ], "quaternion": [ 0.084, -0.442, 0.025, 0.893 ] } }, { "index": 119, "nt1": "///J/273", "nt2": "///J/279", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -179.574, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 51.332, "chi2": -175.117, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 48.015, "C1C1_dist": 10.649, "N1N9_dist": 8.738, "C6C8_dist": 9.610, "CNNC_torsion": -12.868, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.81],N1(imino)-N3[2.71],N2(amino)-O2(carbonyl)[2.39]", "interBase_angle": 12.362, "planarity": 0.192, "simple_Shear": -0.013, "simple_Stretch": -0.357, "simple_Buckle": -7.042, "simple_Propeller": -10.160, "bp_simpleParams": [ -0.013, -0.357, 0.413, -7.042, -10.160, -0.019 ], "bp_params": [ -0.016, -0.357, 0.413, -7.103, -10.117, -0.019 ], "frame": { "rmsd": null, "origin": [ 268.803, 334.921, 280.214 ], "x_axis": [ -0.573, -0.404, -0.713 ], "y_axis": [ 0.140, -0.906, 0.400 ], "z_axis": [ -0.807, 0.129, 0.576 ], "quaternion": [ -0.156, -0.435, 0.151, 0.874 ] } }, { "index": 120, "nt1": "///J/274", "nt2": "///J/278", "bp": "C-A", "name": "--", "Saenger": "--", "LW": "cSW", "DSSR": "cm-W", "intra_chain": true, "chi1": 171.086, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 114.976, "chi2": -123.216, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 44.217, "C1C1_dist": 9.486, "N1N9_dist": 9.065, "C6C8_dist": 10.370, "CNNC_torsion": 0.945, "hbonds_num": 2, "hbonds_desc": "O2'(hydroxyl)-N1[3.03],O2(carbonyl)-N6(amino)[3.13]", "interBase_angle": 27.436, "planarity": 0.321, "simple_Shear": 5.614, "simple_Stretch": 3.677, "simple_Buckle": -27.281, "simple_Propeller": -2.913, "bp_simpleParams": [ 5.614, 3.677, 0.619, -27.281, -2.913, 53.906 ], "bp_params": [ 6.678, -0.671, 0.619, -23.016, 14.933, 53.371 ], "frame": { "rmsd": null, "origin": [ 264.109, 333.220, 280.546 ], "x_axis": [ -0.204, -0.973, -0.105 ], "y_axis": [ 0.588, -0.208, 0.781 ], "z_axis": [ -0.783, 0.097, 0.615 ], "quaternion": [ 0.549, 0.312, -0.309, -0.712 ] } }, { "index": 121, "nt1": "///J/291", "nt2": "///J/353", "bp": "G-U", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -176.796, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 37.053, "chi2": -164.531, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 71.072, "C1C1_dist": 10.510, "N1N9_dist": 8.872, "C6C8_dist": 9.765, "CNNC_torsion": -4.112, "hbonds_num": 2, "hbonds_desc": "O6(carbonyl)-N3(imino)[2.95],N1(imino)-O2(carbonyl)[2.79]", "interBase_angle": 6.606, "planarity": 0.092, "simple_Shear": -3.031, "simple_Stretch": 0.257, "simple_Buckle": 4.218, "simple_Propeller": -5.084, "bp_simpleParams": [ -3.031, 0.257, 0.054, 4.218, -5.084, 0.780 ], "bp_params": [ -2.969, -0.662, 0.054, 5.546, -3.589, 0.780 ], "frame": { "rmsd": null, "origin": [ 296.212, 328.719, 237.519 ], "x_axis": [ -0.036, -0.997, -0.070 ], "y_axis": [ -0.393, -0.050, 0.918 ], "z_axis": [ -0.919, 0.061, -0.390 ], "quaternion": [ 0.362, 0.592, -0.587, -0.417 ] } }, { "index": 122, "nt1": "///J/292", "nt2": "///J/352", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -171.718, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 47.911, "chi2": -165.830, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 51.575, "C1C1_dist": 10.894, "N1N9_dist": 8.987, "C6C8_dist": 9.823, "CNNC_torsion": -9.683, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.92],N1(imino)-N3[2.92],N2(amino)-O2(carbonyl)[2.82]", "interBase_angle": 5.638, "planarity": 0.084, "simple_Shear": -0.201, "simple_Stretch": -0.155, "simple_Buckle": 0.278, "simple_Propeller": -5.631, "bp_simpleParams": [ -0.201, -0.155, 0.201, 0.278, -5.631, -1.944 ], "bp_params": [ -0.198, -0.158, 0.201, 0.368, -5.626, -1.946 ], "frame": { "rmsd": null, "origin": [ 293.601, 329.416, 234.868 ], "x_axis": [ -0.223, -0.741, 0.633 ], "y_axis": [ -0.159, 0.668, 0.727 ], "z_axis": [ -0.962, 0.061, -0.267 ], "quaternion": [ 0.543, 0.306, -0.735, -0.268 ] } }, { "index": 123, "nt1": "///J/293", "nt2": "///J/351", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -160.194, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 51.853, "chi2": -163.592, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 55.740, "C1C1_dist": 10.617, "N1N9_dist": 8.876, "C6C8_dist": 9.798, "CNNC_torsion": -11.232, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.84],O4(carbonyl)-N6(amino)[2.93]", "interBase_angle": 8.758, "planarity": 0.117, "simple_Shear": -0.145, "simple_Stretch": -0.130, "simple_Buckle": -0.799, "simple_Propeller": -8.722, "bp_simpleParams": [ -0.145, -0.130, 0.205, -0.799, -8.722, -1.245 ], "bp_params": [ -0.143, -0.132, 0.205, -0.635, -8.735, -1.249 ], "frame": { "rmsd": null, "origin": [ 290.538, 328.496, 233.015 ], "x_axis": [ -0.158, -0.248, 0.956 ], "y_axis": [ 0.016, 0.967, 0.254 ], "z_axis": [ -0.987, 0.055, -0.149 ], "quaternion": [ 0.644, 0.077, -0.754, -0.102 ] } }, { "index": 124, "nt1": "///J/294", "nt2": "///J/350", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -161.156, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 53.401, "chi2": -175.171, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 52.312, "C1C1_dist": 10.570, "N1N9_dist": 8.790, "C6C8_dist": 9.700, "CNNC_torsion": -11.489, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.77],O4(carbonyl)-N6(amino)[2.89]", "interBase_angle": 8.573, "planarity": 0.134, "simple_Shear": -0.017, "simple_Stretch": -0.217, "simple_Buckle": 3.156, "simple_Propeller": -7.971, "bp_simpleParams": [ -0.017, -0.217, 0.275, 3.156, -7.971, -0.724 ], "bp_params": [ -0.016, -0.217, 0.275, 3.214, -7.948, -0.726 ], "frame": { "rmsd": null, "origin": [ 287.130, 327.607, 232.802 ], "x_axis": [ -0.062, 0.325, 0.944 ], "y_axis": [ 0.121, 0.941, -0.316 ], "z_axis": [ -0.991, 0.095, -0.097 ], "quaternion": [ 0.667, -0.154, -0.725, 0.076 ] } }, { "index": 125, "nt1": "///J/295", "nt2": "///J/349", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -174.043, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 53.132, "chi2": -156.853, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 56.831, "C1C1_dist": 10.537, "N1N9_dist": 8.845, "C6C8_dist": 9.828, "CNNC_torsion": -13.415, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[3.00],N1(imino)-N3[2.87],N2(amino)-O2(carbonyl)[2.70]", "interBase_angle": 15.054, "planarity": 0.187, "simple_Shear": -0.230, "simple_Stretch": -0.156, "simple_Buckle": -1.817, "simple_Propeller": -14.944, "bp_simpleParams": [ -0.230, -0.156, -0.065, -1.817, -14.944, 3.726 ], "bp_params": [ -0.227, -0.159, -0.065, -1.551, -14.974, 3.757 ], "frame": { "rmsd": null, "origin": [ 283.648, 327.155, 234.252 ], "x_axis": [ 0.179, 0.738, 0.650 ], "y_axis": [ 0.035, 0.656, -0.754 ], "z_axis": [ -0.983, 0.158, 0.091 ], "quaternion": [ 0.694, -0.329, -0.589, 0.253 ] } }, { "index": 126, "nt1": "///J/296", "nt2": "///J/348", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -159.462, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 48.597, "chi2": -177.645, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 48.562, "C1C1_dist": 11.153, "N1N9_dist": 9.198, "C6C8_dist": 9.983, "CNNC_torsion": -13.679, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[3.13],O4(carbonyl)-N6(amino)[3.04]", "interBase_angle": 14.577, "planarity": 0.200, "simple_Shear": -0.140, "simple_Stretch": 0.099, "simple_Buckle": -7.189, "simple_Propeller": -12.680, "bp_simpleParams": [ -0.140, 0.099, -0.264, -7.189, -12.680, -4.904 ], "bp_params": [ -0.142, 0.097, -0.264, -6.982, -12.795, -4.925 ], "frame": { "rmsd": null, "origin": [ 280.093, 326.358, 235.797 ], "x_axis": [ 0.210, 0.976, 0.051 ], "y_axis": [ -0.078, 0.069, -0.995 ], "z_axis": [ -0.974, 0.205, 0.091 ], "quaternion": [ 0.585, -0.512, -0.438, 0.450 ] } }, { "index": 127, "nt1": "///J/297", "nt2": "///J/346", "bp": "U+A", "name": "Hoogsteen", "Saenger": "23-XXIII", "LW": "cWH", "DSSR": "cW+M", "intra_chain": true, "chi1": -154.251, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 61.632, "chi2": 101.408, "conf2": "--", "pucker2": "~C3'-endo", "lambda2": 54.194, "C1C1_dist": 8.893, "N1N9_dist": 7.321, "C6C8_dist": 6.776, "CNNC_torsion": -5.297, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N7[3.37],O4(carbonyl)-N6(amino)[3.03]", "interBase_angle": 12.603, "planarity": 0.169, "simple_Shear": -3.191, "simple_Stretch": 1.706, "simple_Buckle": 7.207, "simple_Propeller": -10.339, "bp_simpleParams": [ -3.191, 1.706, -0.171, 7.207, -10.339, -75.249 ], "bp_params": [ -0.340, 3.602, -0.171, -4.646, -11.715, -75.493 ], "frame": { "rmsd": null, "origin": [ 277.505, 328.376, 237.310 ], "x_axis": [ 0.056, 0.470, -0.881 ], "y_axis": [ -0.267, -0.843, -0.466 ], "z_axis": [ -0.962, 0.261, 0.078 ], "quaternion": [ 0.269, -0.675, -0.075, 0.683 ] } }, { "index": 128, "nt1": "///J/298", "nt2": "///J/315", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -164.895, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 52.808, "chi2": -135.972, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 48.379, "C1C1_dist": 11.105, "N1N9_dist": 9.235, "C6C8_dist": 10.037, "CNNC_torsion": -2.034, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.05],N1-N3(imino)[3.12]", "interBase_angle": 8.469, "planarity": 0.092, "simple_Shear": 0.298, "simple_Stretch": 0.147, "simple_Buckle": -5.336, "simple_Propeller": -6.576, "bp_simpleParams": [ 0.298, 0.147, -0.272, -5.336, -6.576, -4.597 ], "bp_params": [ 0.303, 0.136, -0.272, -5.559, -6.389, -4.599 ], "frame": { "rmsd": null, "origin": [ 273.807, 328.936, 237.746 ], "x_axis": [ 0.288, 0.471, -0.834 ], "y_axis": [ -0.310, -0.778, -0.547 ], "z_axis": [ -0.906, 0.416, -0.078 ], "quaternion": [ -0.329, 0.732, 0.055, -0.594 ] } }, { "index": 129, "nt1": "///J/299", "nt2": "///J/314", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -168.993, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 54.552, "chi2": -179.219, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 51.109, "C1C1_dist": 10.623, "N1N9_dist": 8.845, "C6C8_dist": 9.856, "CNNC_torsion": -17.009, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.38],N3-N1(imino)[2.90],N4(amino)-O6(carbonyl)[3.24]", "interBase_angle": 11.525, "planarity": 0.166, "simple_Shear": 0.206, "simple_Stretch": -0.108, "simple_Buckle": -4.285, "simple_Propeller": -10.699, "bp_simpleParams": [ 0.206, -0.108, 0.516, -4.285, -10.699, 5.829 ], "bp_params": [ 0.205, -0.112, 0.516, -4.448, -10.632, 5.850 ], "frame": { "rmsd": null, "origin": [ 271.690, 331.932, 236.551 ], "x_axis": [ 0.184, -0.086, -0.979 ], "y_axis": [ -0.393, -0.920, 0.007 ], "z_axis": [ -0.901, 0.383, -0.203 ], "quaternion": [ -0.124, 0.759, -0.157, -0.619 ] } }, { "index": 130, "nt1": "///J/300", "nt2": "///J/313", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -174.753, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 47.882, "chi2": -161.193, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 52.208, "C1C1_dist": 10.939, "N1N9_dist": 9.048, "C6C8_dist": 9.898, "CNNC_torsion": -14.310, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.99],O4(carbonyl)-N6(amino)[3.01]", "interBase_angle": 12.249, "planarity": 0.152, "simple_Shear": -0.167, "simple_Stretch": 0.009, "simple_Buckle": -6.560, "simple_Propeller": -10.344, "bp_simpleParams": [ -0.167, 0.009, 0.160, -6.560, -10.344, -2.766 ], "bp_params": [ -0.168, 0.006, 0.160, -6.362, -10.467, -2.773 ], "frame": { "rmsd": null, "origin": [ 269.730, 335.551, 236.271 ], "x_axis": [ 0.090, -0.561, -0.823 ], "y_axis": [ -0.469, -0.753, 0.461 ], "z_axis": [ -0.878, 0.345, -0.331 ], "quaternion": [ 0.040, 0.737, -0.349, -0.577 ] } }, { "index": 131, "nt1": "///J/301", "nt2": "///J/312", "bp": "U-G", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -172.765, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 58.234, "chi2": -168.856, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 36.517, "C1C1_dist": 10.922, "N1N9_dist": 8.974, "C6C8_dist": 9.688, "CNNC_torsion": -15.777, "hbonds_num": 2, "hbonds_desc": "O2(carbonyl)-N1(imino)[2.98],N3(imino)-O6(carbonyl)[2.89]", "interBase_angle": 7.504, "planarity": 0.115, "simple_Shear": 2.353, "simple_Stretch": 0.035, "simple_Buckle": -0.033, "simple_Propeller": -7.504, "bp_simpleParams": [ 2.353, 0.035, 0.282, -0.033, -7.504, -7.872 ], "bp_params": [ 2.295, -0.517, 0.282, -1.789, -7.288, -7.887 ], "frame": { "rmsd": null, "origin": [ 267.489, 337.205, 234.162 ], "x_axis": [ -0.177, -0.939, -0.295 ], "y_axis": [ -0.462, -0.186, 0.868 ], "z_axis": [ -0.869, 0.290, -0.400 ], "quaternion": [ 0.243, 0.594, -0.590, -0.490 ] } }, { "index": 132, "nt1": "///J/302", "nt2": "///J/311", "bp": "G-U", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": 178.254, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 36.098, "chi2": -163.640, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 64.777, "C1C1_dist": 10.708, "N1N9_dist": 8.905, "C6C8_dist": 9.675, "CNNC_torsion": -7.669, "hbonds_num": 2, "hbonds_desc": "O6(carbonyl)-N3(imino)[2.83],N1(imino)-O2(carbonyl)[2.90]", "interBase_angle": 8.148, "planarity": 0.093, "simple_Shear": -2.482, "simple_Stretch": 0.026, "simple_Buckle": -5.234, "simple_Propeller": -6.244, "bp_simpleParams": [ -2.482, 0.026, -0.091, -5.234, -6.244, -5.610 ], "bp_params": [ -2.413, -0.581, -0.091, -3.551, -7.333, -5.619 ], "frame": { "rmsd": null, "origin": [ 265.980, 337.123, 230.340 ], "x_axis": [ -0.116, -0.993, -0.001 ], "y_axis": [ -0.506, 0.058, 0.860 ], "z_axis": [ -0.854, 0.100, -0.510 ], "quaternion": [ -0.329, -0.578, 0.649, 0.370 ] } }, { "index": 133, "nt1": "///J/303", "nt2": "///J/310", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -167.068, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 53.202, "chi2": -163.243, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 51.651, "C1C1_dist": 10.827, "N1N9_dist": 9.032, "C6C8_dist": 9.911, "CNNC_torsion": -5.635, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.04],N1-N3(imino)[2.98]", "interBase_angle": 9.517, "planarity": 0.106, "simple_Shear": 0.084, "simple_Stretch": 0.010, "simple_Buckle": -6.869, "simple_Propeller": -6.587, "bp_simpleParams": [ 0.084, 0.010, -0.228, -6.869, -6.587, -2.202 ], "bp_params": [ 0.084, 0.009, -0.228, -6.966, -6.484, -2.201 ], "frame": { "rmsd": null, "origin": [ 263.684, 336.727, 227.204 ], "x_axis": [ -0.339, -0.720, 0.605 ], "y_axis": [ -0.324, 0.693, 0.644 ], "z_axis": [ -0.883, 0.022, -0.468 ], "quaternion": [ -0.471, -0.330, 0.791, 0.211 ] } }, { "index": 134, "nt1": "///J/304", "nt2": "///J/309", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -160.805, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 53.646, "chi2": -164.445, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 51.538, "C1C1_dist": 10.784, "N1N9_dist": 8.994, "C6C8_dist": 9.879, "CNNC_torsion": -0.942, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.98],N1-N3(imino)[2.94]", "interBase_angle": 2.262, "planarity": 0.041, "simple_Shear": 0.087, "simple_Stretch": -0.041, "simple_Buckle": -2.001, "simple_Propeller": -1.055, "bp_simpleParams": [ 0.087, -0.041, -0.220, -2.001, -1.055, -1.982 ], "bp_params": [ 0.087, -0.042, -0.220, -2.015, -1.029, -1.982 ], "frame": { "rmsd": null, "origin": [ 261.185, 335.109, 224.929 ], "x_axis": [ -0.357, -0.305, 0.883 ], "y_axis": [ -0.150, 0.952, 0.268 ], "z_axis": [ -0.922, -0.037, -0.385 ], "quaternion": [ 0.550, 0.139, -0.821, -0.070 ] } }, { "index": 135, "nt1": "///J/305", "nt2": "///J/308", "bp": "G-A", "name": "--", "Saenger": "--", "LW": "tSH", "DSSR": "tm-M", "intra_chain": true, "chi1": -158.273, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 84.852, "chi2": -165.551, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 27.509, "C1C1_dist": 10.018, "N1N9_dist": 8.829, "C6C8_dist": 8.639, "CNNC_torsion": -153.362, "hbonds_num": 3, "hbonds_desc": "N1(imino)-OP2[2.58],N2(amino)-OP2[2.70],N2(amino)-N7[3.10]", "interBase_angle": 22.933, "planarity": 0.344, "simple_Shear": 7.865, "simple_Stretch": 5.717, "simple_Buckle": 7.023, "simple_Propeller": 21.832, "bp_simpleParams": [ 7.865, 5.717, -0.212, 7.023, 21.832, -59.830 ], "bp_params": [ 8.077, -5.414, -0.212, 22.911, 1.001, -58.840 ], "frame": { "rmsd": null, "origin": [ 259.693, 332.750, 220.422 ], "x_axis": [ -0.293, 0.658, 0.694 ], "y_axis": [ 0.293, 0.753, -0.590 ], "z_axis": [ -0.910, 0.030, -0.413 ], "quaternion": [ 0.512, -0.303, -0.784, 0.178 ] } }, { "index": 136, "nt1": "///J/314", "nt2": "///J/345", "bp": "G-A", "name": "--", "Saenger": "--", "LW": "tSH", "DSSR": "tm-M", "intra_chain": true, "chi1": -179.219, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 83.690, "chi2": 42.371, "conf2": "syn", "pucker2": "~C3'-endo", "lambda2": 30.126, "C1C1_dist": 8.451, "N1N9_dist": 7.348, "C6C8_dist": 7.406, "CNNC_torsion": 179.126, "hbonds_num": 1, "hbonds_desc": "O2'(hydroxyl)-N6(amino)[3.00]", "interBase_angle": 31.829, "planarity": 0.368, "simple_Shear": 8.708, "simple_Stretch": 4.920, "simple_Buckle": 28.674, "simple_Propeller": -13.816, "bp_simpleParams": [ 8.708, 4.920, 0.807, 28.674, -13.816, -42.568 ], "bp_params": [ 6.845, -7.293, 0.807, -6.421, -31.175, -43.981 ], "frame": { "rmsd": null, "origin": [ 272.093, 333.750, 241.318 ], "x_axis": [ 0.176, 0.376, -0.910 ], "y_axis": [ 0.326, 0.850, 0.415 ], "z_axis": [ 0.929, -0.369, 0.027 ], "quaternion": [ 0.716, 0.274, 0.642, 0.018 ] } }, { "index": 137, "nt1": "///J/316", "nt2": "///J/366", "bp": "G+A", "name": "--", "Saenger": "--", "LW": "cHW", "DSSR": "cM+W", "intra_chain": true, "chi1": -163.381, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 21.760, "chi2": -56.303, "conf2": "--", "pucker2": "~C2'-endo", "lambda2": 31.031, "C1C1_dist": 13.862, "N1N9_dist": 11.247, "C6C8_dist": 10.354, "CNNC_torsion": -20.860, "hbonds_num": 1, "hbonds_desc": "O6(carbonyl)-N6(amino)[3.28]", "interBase_angle": 21.936, "planarity": 0.294, "simple_Shear": -4.817, "simple_Stretch": 2.826, "simple_Buckle": 19.202, "simple_Propeller": 10.606, "bp_simpleParams": [ -4.817, 2.826, -0.290, 19.202, 10.606, 132.864 ], "bp_params": [ 0.160, -5.583, -0.290, -19.146, 10.707, 132.454 ], "frame": { "rmsd": null, "origin": [ 277.177, 336.256, 253.409 ], "x_axis": [ -0.131, 0.639, 0.758 ], "y_axis": [ -0.484, 0.626, -0.611 ], "z_axis": [ -0.865, -0.447, 0.227 ], "quaternion": [ 0.656, -0.063, -0.618, 0.428 ] } }, { "index": 138, "nt1": "///J/316", "nt2": "///J/370", "bp": "G-U", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -163.381, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 41.951, "chi2": -168.914, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 68.851, "C1C1_dist": 10.448, "N1N9_dist": 8.836, "C6C8_dist": 9.846, "CNNC_torsion": 3.094, "hbonds_num": 2, "hbonds_desc": "O6(carbonyl)-N3(imino)[3.17],N1(imino)-O2(carbonyl)[2.77]", "interBase_angle": 3.575, "planarity": 0.054, "simple_Shear": -2.406, "simple_Stretch": 0.232, "simple_Buckle": -2.963, "simple_Propeller": 2.001, "bp_simpleParams": [ -2.406, 0.232, -0.272, -2.963, 2.001, 6.706 ], "bp_params": [ -2.392, -0.350, -0.272, -3.355, 1.234, 6.704 ], "frame": { "rmsd": null, "origin": [ 278.100, 335.629, 254.725 ], "x_axis": [ -0.327, 0.915, -0.236 ], "y_axis": [ -0.138, -0.294, -0.946 ], "z_axis": [ -0.935, -0.277, 0.222 ], "quaternion": [ 0.388, -0.431, -0.450, 0.679 ] } }, { "index": 139, "nt1": "///J/317", "nt2": "///J/369", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": 179.444, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 48.129, "chi2": -176.178, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 51.053, "C1C1_dist": 11.019, "N1N9_dist": 9.104, "C6C8_dist": 9.984, "CNNC_torsion": -2.056, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[3.13],N1(imino)-N3[3.09],N2(amino)-O2(carbonyl)[2.68]", "interBase_angle": 3.298, "planarity": 0.061, "simple_Shear": -0.198, "simple_Stretch": 0.028, "simple_Buckle": -1.802, "simple_Propeller": -2.761, "bp_simpleParams": [ -0.198, 0.028, -0.269, -1.802, -2.761, 1.533 ], "bp_params": [ -0.198, 0.026, -0.269, -1.763, -2.787, 1.533 ], "frame": { "rmsd": null, "origin": [ 274.931, 335.366, 256.748 ], "x_axis": [ -0.258, 0.581, -0.772 ], "y_axis": [ 0.071, -0.785, -0.615 ], "z_axis": [ -0.963, -0.214, 0.162 ], "quaternion": [ 0.172, -0.584, -0.279, 0.742 ] } }, { "index": 140, "nt1": "///J/318", "nt2": "///J/368", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -162.503, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 52.979, "chi2": -162.781, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 49.524, "C1C1_dist": 10.914, "N1N9_dist": 9.069, "C6C8_dist": 9.903, "CNNC_torsion": -2.417, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.02],N1-N3(imino)[3.04]", "interBase_angle": 6.111, "planarity": 0.076, "simple_Shear": 0.178, "simple_Stretch": 0.018, "simple_Buckle": -4.797, "simple_Propeller": -3.785, "bp_simpleParams": [ 0.178, 0.018, -0.351, -4.797, -3.785, -3.530 ], "bp_params": [ 0.179, 0.014, -0.351, -4.881, -3.677, -3.529 ], "frame": { "rmsd": null, "origin": [ 271.380, 336.182, 257.935 ], "x_axis": [ -0.021, 0.071, -0.997 ], "y_axis": [ 0.149, -0.986, -0.073 ], "z_axis": [ -0.989, -0.150, 0.010 ], "quaternion": [ -0.028, -0.699, -0.079, 0.710 ] } }, { "index": 141, "nt1": "///J/319", "nt2": "///J/367", "bp": "U-A", "name": "--", "Saenger": "--", "LW": "cHH", "DSSR": "cM-M", "intra_chain": true, "chi1": 5.669, "conf1": "syn", "pucker1": "~C3'-endo", "lambda1": 54.112, "chi2": 10.204, "conf2": "syn", "pucker2": "~C3'-endo", "lambda2": 27.715, "C1C1_dist": 10.747, "N1N9_dist": 8.581, "C6C8_dist": 6.094, "CNNC_torsion": 6.197, "hbonds_num": 1, "hbonds_desc": "O4(carbonyl)-N6(amino)[2.38]", "interBase_angle": 2.153, "planarity": 0.050, "simple_Shear": -0.254, "simple_Stretch": 5.921, "simple_Buckle": -1.444, "simple_Propeller": -1.597, "bp_simpleParams": [ -0.254, 5.921, 0.160, -1.444, -1.597, -177.220 ], "bp_params": [ -2.188, 5.508, 0.160, -0.838, -1.983, -177.220 ], "frame": { "rmsd": null, "origin": [ 268.249, 335.833, 254.400 ], "x_axis": [ -0.138, 0.473, 0.870 ], "y_axis": [ 0.090, -0.869, 0.486 ], "z_axis": [ 0.986, 0.145, 0.077 ], "quaternion": [ 0.133, 0.643, 0.219, 0.722 ] } }, { "index": 142, "nt1": "///J/320", "nt2": "///J/344", "bp": "A+A", "name": "--", "Saenger": "02-II", "LW": "tHH", "DSSR": "tM+M", "intra_chain": true, "chi1": -168.008, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 22.048, "chi2": -139.934, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 18.988, "C1C1_dist": 10.801, "N1N9_dist": 8.083, "C6C8_dist": 6.098, "CNNC_torsion": -102.182, "hbonds_num": 2, "hbonds_desc": "N7-N6(amino)[3.01],N6(amino)-N7[3.43]", "interBase_angle": 24.966, "planarity": 0.339, "simple_Shear": -8.138, "simple_Stretch": 0.909, "simple_Buckle": -24.900, "simple_Propeller": -1.810, "bp_simpleParams": [ -8.138, 0.909, 0.224, -24.900, -1.810, 173.226 ], "bp_params": [ 6.308, -5.222, 0.224, 21.804, -12.161, 173.139 ], "frame": { "rmsd": null, "origin": [ 264.780, 334.299, 256.089 ], "x_axis": [ 0.101, 0.511, -0.854 ], "y_axis": [ 0.296, -0.834, -0.465 ], "z_axis": [ -0.950, -0.206, -0.235 ], "quaternion": [ -0.088, 0.737, 0.274, -0.612 ] } }, { "index": 143, "nt1": "///J/321", "nt2": "///J/343", "bp": "A-G", "name": "Sheared", "Saenger": "11-XI", "LW": "tHS", "DSSR": "tM-m", "intra_chain": true, "chi1": -164.946, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 8.922, "chi2": -154.735, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 93.783, "C1C1_dist": 9.820, "N1N9_dist": 8.560, "C6C8_dist": 8.992, "CNNC_torsion": -87.742, "hbonds_num": 3, "hbonds_desc": "N7-N2(amino)[2.90],N6(amino)-O2'(hydroxyl)[3.08],N6(amino)-N3[3.03]", "interBase_angle": 8.670, "planarity": 0.114, "simple_Shear": -7.377, "simple_Stretch": 2.573, "simple_Buckle": -8.426, "simple_Propeller": -2.043, "bp_simpleParams": [ -7.377, 2.573, -0.016, -8.426, -2.043, -5.354 ], "bp_params": [ -6.787, -3.871, -0.016, -3.999, -7.693, -5.362 ], "frame": { "rmsd": null, "origin": [ 261.466, 334.304, 254.878 ], "x_axis": [ 0.229, -0.971, 0.073 ], "y_axis": [ -0.186, 0.030, 0.982 ], "z_axis": [ -0.955, -0.239, -0.174 ], "quaternion": [ 0.521, 0.586, -0.494, -0.376 ] } }, { "index": 144, "nt1": "///J/322", "nt2": "///J/342", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -171.599, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 54.254, "chi2": -175.829, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 50.450, "C1C1_dist": 10.563, "N1N9_dist": 8.761, "C6C8_dist": 9.701, "CNNC_torsion": -9.257, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.94],N1-N3(imino)[2.81]", "interBase_angle": 6.414, "planarity": 0.084, "simple_Shear": 0.088, "simple_Stretch": -0.178, "simple_Buckle": -2.606, "simple_Propeller": -5.861, "bp_simpleParams": [ 0.088, -0.178, 0.051, -2.606, -5.861, 1.496 ], "bp_params": [ 0.086, -0.179, 0.051, -2.686, -5.825, 1.497 ], "frame": { "rmsd": null, "origin": [ 258.393, 332.060, 254.297 ], "x_axis": [ 0.044, -0.453, 0.890 ], "y_axis": [ -0.299, 0.844, 0.445 ], "z_axis": [ -0.953, -0.286, -0.098 ], "quaternion": [ 0.669, 0.273, -0.689, -0.058 ] } }, { "index": 145, "nt1": "///J/323", "nt2": "///J/341", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -163.438, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 52.501, "chi2": -163.316, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 49.206, "C1C1_dist": 10.677, "N1N9_dist": 8.816, "C6C8_dist": 9.648, "CNNC_torsion": -9.231, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.80],N1-N3(imino)[2.77]", "interBase_angle": 8.691, "planarity": 0.103, "simple_Shear": 0.159, "simple_Stretch": -0.239, "simple_Buckle": -2.449, "simple_Propeller": -8.339, "bp_simpleParams": [ 0.159, -0.239, -0.029, -2.449, -8.339, -3.730 ], "bp_params": [ 0.154, -0.243, -0.029, -2.622, -8.286, -3.739 ], "frame": { "rmsd": null, "origin": [ 255.760, 329.574, 253.470 ], "x_axis": [ -0.037, 0.098, 0.994 ], "y_axis": [ -0.319, 0.942, -0.105 ], "z_axis": [ -0.947, -0.321, -0.004 ], "quaternion": [ 0.689, 0.078, -0.704, 0.151 ] } }, { "index": 146, "nt1": "///J/324", "nt2": "///J/340", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -158.462, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 50.150, "chi2": -159.625, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 52.335, "C1C1_dist": 10.765, "N1N9_dist": 8.921, "C6C8_dist": 9.783, "CNNC_torsion": -15.258, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.96],N1-N3(imino)[2.90]", "interBase_angle": 13.593, "planarity": 0.166, "simple_Shear": 0.013, "simple_Stretch": -0.106, "simple_Buckle": -5.561, "simple_Propeller": -12.404, "bp_simpleParams": [ 0.013, -0.106, -0.016, -5.561, -12.404, -2.408 ], "bp_params": [ 0.012, -0.106, -0.016, -5.656, -12.361, -2.419 ], "frame": { "rmsd": null, "origin": [ 252.917, 327.453, 254.100 ], "x_axis": [ -0.097, 0.639, 0.763 ], "y_axis": [ -0.284, 0.717, -0.637 ], "z_axis": [ -0.954, -0.279, 0.112 ], "quaternion": [ 0.658, -0.136, -0.652, 0.351 ] } }, { "index": 147, "nt1": "///J/325", "nt2": "///J/339", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -172.018, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 47.158, "chi2": -163.864, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 49.457, "C1C1_dist": 10.900, "N1N9_dist": 8.945, "C6C8_dist": 9.771, "CNNC_torsion": -19.881, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.97],N1-N3(imino)[2.90]", "interBase_angle": 10.724, "planarity": 0.147, "simple_Shear": 0.110, "simple_Stretch": -0.109, "simple_Buckle": -0.434, "simple_Propeller": -10.715, "bp_simpleParams": [ 0.110, -0.109, 0.124, -0.434, -10.715, -3.214 ], "bp_params": [ 0.108, -0.110, 0.124, -0.602, -10.707, -3.228 ], "frame": { "rmsd": null, "origin": [ 250.084, 325.872, 255.051 ], "x_axis": [ -0.204, 0.938, 0.282 ], "y_axis": [ -0.145, 0.256, -0.956 ], "z_axis": [ -0.968, -0.236, 0.084 ], "quaternion": [ 0.533, -0.338, -0.586, 0.508 ] } }, { "index": 148, "nt1": "///J/326", "nt2": "///J/338", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -176.620, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 48.900, "chi2": -165.937, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 49.798, "C1C1_dist": 10.840, "N1N9_dist": 8.917, "C6C8_dist": 9.790, "CNNC_torsion": -16.898, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.78],N3-N1(imino)[2.93],N4(amino)-O6(carbonyl)[3.01]", "interBase_angle": 10.430, "planarity": 0.140, "simple_Shear": 0.283, "simple_Stretch": -0.156, "simple_Buckle": 2.555, "simple_Propeller": -10.112, "bp_simpleParams": [ 0.283, -0.156, 0.095, 2.555, -10.112, 0.175 ], "bp_params": [ 0.279, -0.162, 0.095, 2.319, -10.169, 0.176 ], "frame": { "rmsd": null, "origin": [ 246.918, 325.555, 256.905 ], "x_axis": [ -0.226, 0.937, -0.267 ], "y_axis": [ -0.041, -0.283, -0.958 ], "z_axis": [ -0.973, -0.206, 0.102 ], "quaternion": [ 0.385, -0.488, -0.458, 0.635 ] } }, { "index": 149, "nt1": "///J/327", "nt2": "///J/337", "bp": "U-G", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -154.826, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 63.517, "chi2": 176.364, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 31.164, "C1C1_dist": 10.707, "N1N9_dist": 8.805, "C6C8_dist": 9.483, "CNNC_torsion": -10.737, "hbonds_num": 2, "hbonds_desc": "O2(carbonyl)-N1(imino)[2.89],N3(imino)-O6(carbonyl)[2.68]", "interBase_angle": 9.114, "planarity": 0.124, "simple_Shear": 2.484, "simple_Stretch": -0.131, "simple_Buckle": 1.226, "simple_Propeller": -9.031, "bp_simpleParams": [ 2.484, -0.131, -0.148, 1.226, -9.031, -8.156 ], "bp_params": [ 2.376, -0.735, -0.148, -1.026, -9.056, -8.181 ], "frame": { "rmsd": null, "origin": [ 243.594, 325.348, 258.544 ], "x_axis": [ -0.156, 0.497, -0.854 ], "y_axis": [ 0.058, -0.858, -0.510 ], "z_axis": [ -0.986, -0.129, 0.105 ], "quaternion": [ 0.151, -0.632, -0.220, 0.728 ] } }, { "index": 150, "nt1": "///J/328", "nt2": "///J/334", "bp": "A-U", "name": "rHoogsteen", "Saenger": "24-XXIV", "LW": "tHW", "DSSR": "tM-W", "intra_chain": true, "chi1": -73.471, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 17.134, "chi2": -157.434, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 37.420, "C1C1_dist": 9.627, "N1N9_dist": 7.169, "C6C8_dist": 6.389, "CNNC_torsion": 146.480, "hbonds_num": 2, "hbonds_desc": "N7-N3(imino)[2.99],N6(amino)-O2(carbonyl)[2.68]", "interBase_angle": 16.734, "planarity": 0.253, "simple_Shear": -4.868, "simple_Stretch": 1.119, "simple_Buckle": 6.879, "simple_Propeller": -15.255, "bp_simpleParams": [ -4.868, 1.119, -0.060, 6.879, -15.255, -86.627 ], "bp_params": [ -4.303, -2.536, -0.060, 15.475, -6.369, -86.192 ], "frame": { "rmsd": null, "origin": [ 237.127, 323.444, 258.057 ], "x_axis": [ -0.019, -0.115, -0.993 ], "y_axis": [ 0.202, -0.973, 0.108 ], "z_axis": [ -0.979, -0.199, 0.041 ], "quaternion": [ -0.111, -0.692, -0.032, 0.713 ] } }, { "index": 151, "nt1": "///J/329", "nt2": "///J/333", "bp": "A+A", "name": "--", "Saenger": "--", "LW": "tWW", "DSSR": "tW+W", "intra_chain": true, "chi1": 77.829, "conf1": "syn", "pucker1": "----", "lambda1": 48.959, "chi2": -115.736, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 19.253, "C1C1_dist": 12.793, "N1N9_dist": 10.556, "C6C8_dist": 11.143, "CNNC_torsion": 162.789, "hbonds_num": 1, "hbonds_desc": "N1*N1[3.03]", "interBase_angle": 30.720, "planarity": 0.352, "simple_Shear": 0.966, "simple_Stretch": 1.949, "simple_Buckle": 11.767, "simple_Propeller": -28.377, "bp_simpleParams": [ 0.966, 1.949, 0.682, 11.767, -28.377, -149.759 ], "bp_params": [ 1.842, -1.157, 0.682, -29.469, -8.678, -148.860 ], "frame": { "rmsd": null, "origin": [ 233.210, 322.824, 255.898 ], "x_axis": [ -0.061, -0.219, 0.974 ], "y_axis": [ 0.087, -0.973, -0.213 ], "z_axis": [ 0.994, 0.072, 0.078 ], "quaternion": [ -0.105, 0.677, -0.049, 0.727 ] } }, { "index": 152, "nt1": "///J/335", "nt2": "///J/336", "bp": "A+A", "name": "Platform", "Saenger": "--", "LW": "cSH", "DSSR": "cm+M", "intra_chain": true, "chi1": -131.523, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 141.512, "chi2": -171.964, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 41.299, "C1C1_dist": 6.557, "N1N9_dist": 6.602, "C6C8_dist": 6.580, "CNNC_torsion": 16.704, "hbonds_num": 1, "hbonds_desc": "N3-N6(amino)[3.29]", "interBase_angle": 15.382, "planarity": 0.184, "simple_Shear": 0.015, "simple_Stretch": 6.718, "simple_Buckle": -13.893, "simple_Propeller": -6.602, "bp_simpleParams": [ 0.015, 6.718, 0.638, -13.893, -6.602, 1.563 ], "bp_params": [ 6.714, 0.232, 0.638, -7.089, 13.651, 1.571 ], "frame": { "rmsd": null, "origin": [ 240.268, 323.774, 260.380 ], "x_axis": [ -0.057, -0.567, -0.822 ], "y_axis": [ -0.088, 0.823, -0.561 ], "z_axis": [ 0.994, 0.041, -0.097 ], "quaternion": [ 0.646, -0.233, 0.703, -0.185 ] } }, { "index": 153, "nt1": "///J/347", "nt2": "///J/371", "bp": "G+C", "name": "--", "Saenger": "--", "LW": "cHW", "DSSR": "cM+W", "intra_chain": true, "chi1": -61.723, "conf1": "--", "pucker1": "~C2'-endo", "lambda1": 20.151, "chi2": -171.093, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 57.215, "C1C1_dist": 10.681, "N1N9_dist": 8.532, "C6C8_dist": 8.322, "CNNC_torsion": -11.803, "hbonds_num": 1, "hbonds_desc": "O6(carbonyl)-N4(amino)[3.09]", "interBase_angle": 3.880, "planarity": 0.050, "simple_Shear": -2.141, "simple_Stretch": 1.330, "simple_Buckle": 3.734, "simple_Propeller": 1.056, "bp_simpleParams": [ -2.141, 1.330, 0.201, 3.734, 1.056, 95.189 ], "bp_params": [ -0.599, -2.448, 0.201, -2.165, 3.220, 95.202 ], "frame": { "rmsd": null, "origin": [ 280.999, 334.411, 250.021 ], "x_axis": [ -0.081, 0.751, 0.655 ], "y_axis": [ 0.403, -0.577, 0.711 ], "z_axis": [ 0.912, 0.322, -0.256 ], "quaternion": [ 0.147, 0.662, 0.436, 0.592 ] } }, { "index": 154, "nt1": "///J/361", "nt2": "///J/375", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -168.249, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 50.537, "chi2": -161.433, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 53.378, "C1C1_dist": 10.669, "N1N9_dist": 8.853, "C6C8_dist": 9.745, "CNNC_torsion": -13.179, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.70],N3-N1(imino)[2.84],N4(amino)-O6(carbonyl)[2.87]", "interBase_angle": 11.917, "planarity": 0.159, "simple_Shear": 0.140, "simple_Stretch": -0.238, "simple_Buckle": 4.627, "simple_Propeller": -10.982, "bp_simpleParams": [ 0.140, -0.238, 0.239, 4.627, -10.982, -1.035 ], "bp_params": [ 0.138, -0.239, 0.239, 4.530, -11.022, -1.039 ], "frame": { "rmsd": null, "origin": [ 292.873, 344.405, 253.522 ], "x_axis": [ 0.131, -0.951, 0.281 ], "y_axis": [ -0.081, 0.272, 0.959 ], "z_axis": [ -0.988, -0.148, -0.042 ], "quaternion": [ 0.583, 0.474, -0.544, -0.373 ] } }, { "index": 155, "nt1": "///J/362", "nt2": "///J/374", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -129.815, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 55.386, "chi2": -165.007, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 53.549, "C1C1_dist": 10.647, "N1N9_dist": 8.935, "C6C8_dist": 9.864, "CNNC_torsion": 7.079, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.95],N1(imino)-N3[2.94],N2(amino)-O2(carbonyl)[2.80]", "interBase_angle": 2.886, "planarity": 0.138, "simple_Shear": -0.169, "simple_Stretch": -0.142, "simple_Buckle": 2.693, "simple_Propeller": -1.039, "bp_simpleParams": [ -0.169, -0.142, -0.470, 2.693, -1.039, 0.802 ], "bp_params": [ -0.167, -0.145, -0.470, 2.706, -1.004, 0.802 ], "frame": { "rmsd": null, "origin": [ 289.859, 342.622, 252.009 ], "x_axis": [ 0.316, -0.626, 0.713 ], "y_axis": [ -0.233, 0.678, 0.697 ], "z_axis": [ -0.920, -0.387, 0.068 ], "quaternion": [ 0.718, 0.378, -0.569, -0.137 ] } }, { "index": 156, "nt1": "///J/363", "nt2": "///J/373", "bp": "U-G", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -97.455, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 57.605, "chi2": 178.349, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 39.169, "C1C1_dist": 10.715, "N1N9_dist": 8.790, "C6C8_dist": 9.449, "CNNC_torsion": 3.201, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N1(imino)[3.01],O2(carbonyl)-N2(amino)[3.34],N3(imino)-O6(carbonyl)[2.80]", "interBase_angle": 7.771, "planarity": 0.108, "simple_Shear": 1.485, "simple_Stretch": -0.328, "simple_Buckle": 4.431, "simple_Propeller": -6.384, "bp_simpleParams": [ 1.485, -0.328, -0.449, 4.431, -6.384, -7.958 ], "bp_params": [ 1.422, -0.539, -0.449, 3.457, -6.960, -7.969 ], "frame": { "rmsd": null, "origin": [ 287.015, 340.084, 251.281 ], "x_axis": [ 0.164, -0.063, 0.984 ], "y_axis": [ -0.374, 0.919, 0.121 ], "z_axis": [ -0.913, -0.388, 0.128 ], "quaternion": [ 0.744, 0.171, -0.638, 0.105 ] } }, { "index": 157, "nt1": "///J/364", "nt2": "///J/372", "bp": "G-A", "name": "Sheared", "Saenger": "11-XI", "LW": "tSH", "DSSR": "tm-M", "intra_chain": true, "chi1": -138.509, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 93.016, "chi2": -172.374, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 6.768, "C1C1_dist": 9.563, "N1N9_dist": 8.283, "C6C8_dist": 8.671, "CNNC_torsion": 140.180, "hbonds_num": 3, "hbonds_desc": "O2'(hydroxyl)-N6(amino)[3.30],N2(amino)-N7[2.92],N3-N6(amino)[3.10]", "interBase_angle": 7.939, "planarity": 0.134, "simple_Shear": 7.620, "simple_Stretch": 2.542, "simple_Buckle": 3.749, "simple_Propeller": -6.998, "bp_simpleParams": [ 7.620, 2.542, -0.333, 3.749, -6.998, -3.232 ], "bp_params": [ 6.748, -4.357, -0.333, -3.120, -7.300, -3.238 ], "frame": { "rmsd": null, "origin": [ 283.781, 338.027, 251.898 ], "x_axis": [ -0.260, 0.813, 0.522 ], "y_axis": [ -0.345, 0.427, -0.836 ], "z_axis": [ -0.902, -0.397, 0.169 ], "quaternion": [ 0.578, -0.190, -0.616, 0.501 ] } }, { "index": 158, "nt1": "///J/365", "nt2": "///J/371", "bp": "U-C", "name": "--", "Saenger": "--", "LW": "tWH", "DSSR": "tW-M", "intra_chain": true, "chi1": 40.746, "conf1": "syn", "pucker1": "~C2'-endo", "lambda1": 7.858, "chi2": -171.093, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 20.342, "C1C1_dist": 12.565, "N1N9_dist": 9.745, "C6C8_dist": 8.269, "CNNC_torsion": -152.906, "hbonds_num": 1, "hbonds_desc": "O4(carbonyl)-N4(amino)[3.29]", "interBase_angle": 9.817, "planarity": 0.115, "simple_Shear": 1.915, "simple_Stretch": 3.237, "simple_Buckle": 8.935, "simple_Propeller": -4.067, "bp_simpleParams": [ 1.915, 3.237, -0.361, 8.935, -4.067, -115.931 ], "bp_params": [ 2.937, 2.349, -0.361, 6.922, -6.962, -115.931 ], "frame": { "rmsd": null, "origin": [ 280.926, 335.678, 251.551 ], "x_axis": [ -0.033, 0.624, 0.781 ], "y_axis": [ -0.477, 0.677, -0.561 ], "z_axis": [ -0.878, -0.391, 0.275 ], "quaternion": [ 0.693, -0.061, -0.599, 0.397 ] } }, { "index": 159, "nt1": "///J/366", "nt2": "///J/370", "bp": "A-U", "name": "--", "Saenger": "--", "LW": "tH.", "DSSR": "tM-.", "intra_chain": true, "chi1": -56.303, "conf1": "--", "pucker1": "~C2'-endo", "lambda1": 16.961, "chi2": -168.914, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 13.122, "C1C1_dist": 12.542, "N1N9_dist": 9.704, "C6C8_dist": 7.954, "CNNC_torsion": 57.281, "hbonds_num": 1, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.95]", "interBase_angle": 21.087, "planarity": 0.320, "simple_Shear": -0.600, "simple_Stretch": 3.381, "simple_Buckle": 14.984, "simple_Propeller": -14.837, "bp_simpleParams": [ -0.600, 3.381, 0.342, 14.984, -14.837, -125.368 ], "bp_params": [ -1.161, 3.232, 0.342, 17.270, -12.100, -125.093 ], "frame": { "rmsd": null, "origin": [ 276.635, 337.261, 252.991 ], "x_axis": [ -0.081, 0.609, 0.789 ], "y_axis": [ -0.510, 0.654, -0.558 ], "z_axis": [ -0.856, -0.448, 0.258 ], "quaternion": [ 0.677, -0.041, -0.608, 0.414 ] } } ], "num_multiplets": 16, "multiplets": [ { "index": 1, "num_nts": 3, "nts_short": "CGA", "nts_long": "///J/7,///J/56,///J/109", "planarity": 0.394 }, { "index": 2, "num_nts": 3, "nts_short": "GCA", "nts_long": "///J/8,///J/55,///J/110", "planarity": 0.319 }, { "index": 3, "num_nts": 3, "nts_short": "AAU", "nts_long": "///J/15,///J/328,///J/334", "planarity": 0.239 }, { "index": 4, "num_nts": 3, "nts_short": "UAA", "nts_long": "///J/16,///J/329,///J/333", "planarity": 0.384 }, { "index": 5, "num_nts": 3, "nts_short": "CGU", "nts_long": "///J/120,///J/259,///J/260", "planarity": 0.305 }, { "index": 6, "num_nts": 3, "nts_short": "GCA", "nts_long": "///J/121,///J/258,///J/262", "planarity": 0.336 }, { "index": 7, "num_nts": 3, "nts_short": "CAG", "nts_long": "///J/139,///J/246,///J/285", "planarity": 0.328 }, { "index": 8, "num_nts": 3, "nts_short": "UAU", "nts_long": "///J/141,///J/185,///J/245", "planarity": 0.431 }, { "index": 9, "num_nts": 3, "nts_short": "GUA", "nts_long": "///J/195,///J/196,///J/235", "planarity": 0.159 }, { "index": 10, "num_nts": 3, "nts_short": "GCU", "nts_long": "///J/264,///J/274,///J/277", "planarity": 0.466 }, { "index": 11, "num_nts": 3, "nts_short": "ACA", "nts_long": "///J/265,///J/274,///J/278", "planarity": 0.830 }, { "index": 12, "num_nts": 3, "nts_short": "UUA", "nts_long": "///J/267,///J/270,///J/282", "planarity": 0.485 }, { "index": 13, "num_nts": 3, "nts_short": "CGA", "nts_long": "///J/299,///J/314,///J/345", "planarity": 0.317 }, { "index": 14, "num_nts": 3, "nts_short": "GAU", "nts_long": "///J/316,///J/366,///J/370", "planarity": 0.353 }, { "index": 15, "num_nts": 3, "nts_short": "GUC", "nts_long": "///J/347,///J/365,///J/371", "planarity": 0.118 }, { "index": 16, "num_nts": 5, "nts_short": "AGUGC", "nts_long": "///J/132,///J/247,///J/248,///J/269,///J/283", "planarity": 0.766 } ], "num_helices": 9, "helices": [ { "index": 1, "num_stems": 5, "strand1": "GUAGGCGUGCAUUGCCCGUCGCAAACGAAGCGCAU", "strand2": "CGUCUGCACGUAACGGGCGGCGUUUGAUUCGUGUG", "bp_type": "|||||||||.||.|||||||||||||...||||||", "helix_form": ".......xx.A..AAx...AAAAA..xxx...A.", "helical_rise": 2.672, "helical_rise_std": 1.448, "helical_radius": 11.062, "helical_radius_std": 5.218, "helical_axis": [ 0.861, 0.403, -0.311 ], "point1": [ 212.348, 288.271, 290.215 ], "point2": [ 290.425, 324.788, 261.978 ], "num_pairs": 35, "pairs": [ { "index": 1, "nt1": "///J/2", "nt2": "///J/61", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.200, -0.818, -1.706, -10.842, -8.011, -1.467 ], "step_params": [ 0.662, -0.677, 3.751, -5.573, 1.815, 40.021 ], "heli_params": [ -1.210, -1.664, 3.598, 2.635, 8.090, 40.431 ], "bp2_params": [ 1.382, -0.301, -0.231, -8.660, -14.986, 5.256 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.751, "simple_Twist": 30.843, "simple_hRise": 3.536, "simple_hTwist": 31.382 }, { "index": 2, "nt1": "///J/3", "nt2": "///J/60", "bp": "U-G", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 1.382, -0.301, -0.231, -8.660, -14.986, 5.256 ], "step_params": [ -0.559, -0.820, 3.069, 0.391, 19.953, 26.561 ], "heli_params": [ -4.343, 1.038, 1.982, 37.440, -0.734, 33.115 ], "bp2_params": [ 0.226, -0.150, -0.556, -1.111, 8.254, -8.909 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.069, "simple_Twist": 33.681, "simple_hRise": 2.251, "simple_hTwist": 39.002 }, { "index": 3, "nt1": "///J/4", "nt2": "///J/59", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.226, -0.150, -0.556, -1.111, 8.254, -8.909 ], "step_params": [ 0.606, -1.667, 3.509, -2.769, 6.226, 29.890 ], "heli_params": [ -4.401, -1.700, 3.040, 11.878, 5.282, 30.639 ], "bp2_params": [ -0.256, -0.266, -0.367, 0.610, -3.708, 1.109 ], "groove_widths": [ 16.584, null, 17.598, null ], "simple_Rise": 3.509, "simple_Twist": 32.143, "simple_hRise": 3.079, "simple_hTwist": 32.839 }, { "index": 4, "nt1": "///J/5", "nt2": "///J/58", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.256, -0.266, -0.367, 0.610, -3.708, 1.109 ], "step_params": [ -0.896, -1.404, 3.349, -8.007, 5.576, 24.564 ], "heli_params": [ -4.593, -0.219, 3.095, 12.493, 17.941, 26.403 ], "bp2_params": [ -2.749, -0.590, -0.264, -5.766, -10.304, -2.654 ], "groove_widths": [ 17.313, 15.883, 17.535, 14.594 ], "simple_Rise": 3.349, "simple_Twist": 37.530, "simple_hRise": 3.232, "simple_hTwist": 38.733 }, { "index": 5, "nt1": "///J/6", "nt2": "///J/57", "bp": "G-U", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -2.749, -0.590, -0.264, -5.766, -10.304, -2.654 ], "step_params": [ 0.080, -0.851, 3.205, -1.842, 5.080, 41.319 ], "heli_params": [ -1.714, -0.299, 3.078, 7.162, 2.597, 41.655 ], "bp2_params": [ 0.148, -0.014, -0.035, 2.202, -8.547, -0.301 ], "groove_widths": [ 17.344, 16.611, 18.263, 15.861 ], "simple_Rise": 3.205, "simple_Twist": 26.352, "simple_hRise": 2.979, "simple_hTwist": 26.891 }, { "index": 6, "nt1": "///J/7", "nt2": "///J/56", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.148, -0.014, -0.035, 2.202, -8.547, -0.301 ], "step_params": [ 1.591, -2.256, 3.532, 2.022, 9.528, 23.810 ], "heli_params": [ -7.675, -3.024, 2.575, 21.952, -4.658, 25.699 ], "bp2_params": [ -0.691, 0.053, 0.140, -3.641, -17.674, 8.154 ], "groove_widths": [ 13.987, 11.643, 19.588, 18.015 ], "simple_Rise": 3.532, "simple_Twist": 27.927, "simple_hRise": 2.736, "simple_hTwist": 29.545 }, { "index": 7, "nt1": "///J/8", "nt2": "///J/55", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.691, 0.053, 0.140, -3.641, -17.674, 8.154 ], "step_params": [ -0.619, -1.664, 3.543, -0.059, -1.977, 33.703 ], "heli_params": [ -2.514, 1.056, 3.633, -3.407, 0.102, 33.759 ], "bp2_params": [ -0.147, 0.008, 0.175, -1.021, -12.044, 1.170 ], "groove_widths": [ 14.510, 10.418, 19.807, 18.987 ], "simple_Rise": 3.543, "simple_Twist": 31.079, "simple_hRise": 3.640, "simple_hTwist": 31.141 }, { "index": 8, "nt1": "///J/9", "nt2": "///J/54", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.147, 0.008, 0.175, -1.021, -12.044, 1.170 ], "step_params": [ -0.631, -1.531, 3.322, 4.467, 5.690, 34.635 ], "heli_params": [ -3.333, 1.676, 2.940, 9.430, -7.403, 35.360 ], "bp2_params": [ -0.151, -0.112, -0.048, 3.788, -4.427, 1.492 ], "groove_widths": [ 17.421, 15.129, 19.658, 18.995 ], "simple_Rise": 3.322, "simple_Twist": 35.345, "simple_hRise": 2.950, "simple_hTwist": 36.055 }, { "index": 9, "nt1": "///J/111", "nt2": "///J/53", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.151, -0.112, -0.048, 3.788, -4.427, 1.492 ], "step_params": [ 1.035, -0.733, 3.479, 0.196, 5.733, 167.837 ], "heli_params": [ -0.378, -0.520, 3.475, 2.882, -0.098, 167.853 ], "bp2_params": [ -0.269, -4.785, -0.257, -4.113, 0.240, 90.451 ], "groove_widths": [ 16.720, 15.500, 16.349, 14.030 ], "simple_Rise": 3.479, "simple_Twist": 31.037, "simple_hRise": 3.300, "simple_hTwist": 31.549 }, { "index": 10, "nt1": "///J/113", "nt2": "///J/52", "bp": "C+G", "name": "--", "Saenger": "--", "LW": "cHW", "DSSR": "cM+W", "bp1_params": [ -0.269, -4.785, -0.257, -4.113, 0.240, 90.451 ], "step_params": [ -3.739, 0.950, 2.982, 5.705, 2.947, -98.278 ], "heli_params": [ -0.672, -2.383, 3.118, -1.947, 3.769, -98.433 ], "bp2_params": [ 0.057, -0.242, 0.663, -3.680, -2.838, 1.049 ], "groove_widths": [ 17.080, 15.461, 21.653, 21.135 ], "simple_Rise": 2.982, "simple_Twist": 36.573, "simple_hRise": 2.457, "simple_hTwist": 37.113 }, { "index": 11, "nt1": "///J/114", "nt2": "///J/51", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.057, -0.242, 0.663, -3.680, -2.838, 1.049 ], "step_params": [ -0.547, -1.537, 3.118, 0.972, 6.183, 30.528 ], "heli_params": [ -3.930, 1.187, 2.743, 11.590, -1.822, 31.148 ], "bp2_params": [ -0.128, -0.199, 0.467, 1.160, -4.221, -3.505 ], "groove_widths": [ 17.486, 15.991, 14.313, 13.682 ], "simple_Rise": 3.118, "simple_Twist": 31.391, "simple_hRise": 2.755, "simple_hTwist": 31.993 }, { "index": 12, "nt1": "///J/115", "nt2": "///J/50", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.128, -0.199, 0.467, 1.160, -4.221, -3.505 ], "step_params": [ 0.571, -2.655, 2.988, 3.385, 10.763, 80.175 ], "heli_params": [ -2.291, -0.364, 2.694, 8.319, -2.616, 80.832 ], "bp2_params": [ -0.639, 3.563, 0.542, -4.041, -2.822, -93.250 ], "groove_widths": [ 17.728, 16.527, 15.556, 11.342 ], "simple_Rise": 2.988, "simple_Twist": 34.494, "simple_hRise": 2.136, "simple_hTwist": 36.239 }, { "index": 13, "nt1": "///J/116", "nt2": "///J/49", "bp": "U+A", "name": "--", "Saenger": "--", "LW": "cWH", "DSSR": "cW+M", "bp1_params": [ -0.639, 3.563, 0.542, -4.041, -2.822, -93.250 ], "step_params": [ -0.757, 0.409, 3.240, 4.068, 6.771, -13.913 ], "heli_params": [ -6.395, 0.238, 2.841, -25.444, 15.289, -15.989 ], "bp2_params": [ -0.236, -0.107, -0.182, 0.215, -3.448, 1.415 ], "groove_widths": [ 17.563, 16.306, 15.900, 14.180 ], "simple_Rise": 3.240, "simple_Twist": 32.705, "simple_hRise": 3.145, "simple_hTwist": 33.620 }, { "index": 14, "nt1": "///J/117", "nt2": "///J/48", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.236, -0.107, -0.182, 0.215, -3.448, 1.415 ], "step_params": [ -0.133, -1.485, 3.407, -0.623, 0.965, 31.791 ], "heli_params": [ -2.893, 0.124, 3.364, 1.761, 1.137, 31.812 ], "bp2_params": [ 0.180, -0.107, -0.140, 3.796, -8.511, 0.350 ], "groove_widths": [ 16.864, 15.561, 19.104, 15.750 ], "simple_Rise": 3.407, "simple_Twist": 29.383, "simple_hRise": 3.360, "simple_hTwist": 29.405 }, { "index": 15, "nt1": "///J/118", "nt2": "///J/47", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.180, -0.107, -0.140, 3.796, -8.511, 0.350 ], "step_params": [ -0.252, -2.038, 3.464, -2.871, 4.205, 29.948 ], "heli_params": [ -4.753, -0.108, 3.164, 8.064, 5.505, 30.368 ], "bp2_params": [ 0.123, -0.223, -0.006, 0.790, -4.545, -0.378 ], "groove_widths": [ 16.595, 15.372, 16.448, 14.957 ], "simple_Rise": 3.464, "simple_Twist": 30.258, "simple_hRise": 3.168, "simple_hTwist": 30.674 }, { "index": 16, "nt1": "///J/119", "nt2": "///J/46", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.123, -0.223, -0.006, 0.790, -4.545, -0.378 ], "step_params": [ 0.804, -1.701, 3.304, -0.575, 5.670, 35.978 ], "heli_params": [ -3.486, -1.365, 2.997, 9.109, 0.924, 36.412 ], "bp2_params": [ -0.120, -0.607, 0.136, -0.389, -6.336, -3.527 ], "groove_widths": [ 16.753, 15.618, 17.043, 15.079 ], "simple_Rise": 3.304, "simple_Twist": 37.376, "simple_hRise": 3.011, "simple_hTwist": 37.792 }, { "index": 17, "nt1": "///J/120", "nt2": "///J/259", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.120, -0.607, 0.136, -0.389, -6.336, -3.527 ], "step_params": [ 1.087, -1.730, 3.211, -0.133, 9.960, 30.836 ], "heli_params": [ -4.689, -1.972, 2.539, 18.146, 0.241, 32.368 ], "bp2_params": [ -0.743, -0.302, 0.396, -1.931, -21.595, -2.682 ], "groove_widths": [ 17.614, 15.513, 16.532, 13.438 ], "simple_Rise": 3.211, "simple_Twist": 34.288, "simple_hRise": 2.619, "simple_hTwist": 35.663 }, { "index": 18, "nt1": "///J/121", "nt2": "///J/258", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.743, -0.302, 0.396, -1.931, -21.595, -2.682 ], "step_params": [ -0.835, -1.500, 3.477, -2.102, -0.642, 41.198 ], "heli_params": [ -2.054, 0.943, 3.535, -0.911, 2.984, 41.254 ], "bp2_params": [ 1.797, -0.288, 0.272, -2.686, -13.464, 0.532 ], "groove_widths": [ 17.418, 15.124, 17.688, 14.667 ], "simple_Rise": 3.477, "simple_Twist": 27.397, "simple_hRise": 3.563, "simple_hTwist": 27.483 }, { "index": 19, "nt1": "///J/122", "nt2": "///J/257", "bp": "U-G", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 1.797, -0.288, 0.272, -2.686, -13.464, 0.532 ], "step_params": [ 0.039, -1.663, 3.045, 0.305, 9.063, 25.961 ], "heli_params": [ -5.392, -0.019, 2.342, 19.434, -0.655, 27.473 ], "bp2_params": [ 0.027, -0.314, 0.374, -0.096, -4.457, 1.583 ], "groove_widths": [ 16.995, 15.736, 16.546, 13.358 ], "simple_Rise": 3.045, "simple_Twist": 35.753, "simple_hRise": 2.562, "simple_hTwist": 36.849 }, { "index": 20, "nt1": "///J/123", "nt2": "///J/256", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.027, -0.314, 0.374, -0.096, -4.457, 1.583 ], "step_params": [ -0.162, -1.689, 3.037, -0.065, 16.044, 31.980 ], "heli_params": [ -4.648, 0.257, 1.992, 27.094, 0.109, 35.685 ], "bp2_params": [ -0.229, -0.196, 0.328, -4.167, -11.876, -3.492 ], "groove_widths": [ 17.858, 16.511, 15.607, 10.769 ], "simple_Rise": 3.037, "simple_Twist": 32.550, "simple_hRise": 2.012, "simple_hTwist": 36.193 }, { "index": 21, "nt1": "///J/124", "nt2": "///J/255", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.229, -0.196, 0.328, -4.167, -11.876, -3.492 ], "step_params": [ -0.139, -1.314, 3.303, -1.327, 8.629, 32.681 ], "heli_params": [ -3.602, 0.032, 2.876, 15.004, 2.308, 33.796 ], "bp2_params": [ 0.053, -0.219, 0.409, -1.878, -9.336, -5.004 ], "groove_widths": [ 18.183, 16.558, 15.476, 10.482 ], "simple_Rise": 3.303, "simple_Twist": 31.389, "simple_hRise": 2.854, "simple_hTwist": 32.551 }, { "index": 22, "nt1": "///J/125", "nt2": "///J/254", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.053, -0.219, 0.409, -1.878, -9.336, -5.004 ], "step_params": [ -0.049, -1.744, 3.147, 0.818, 17.637, 34.196 ], "heli_params": [ -4.511, 0.161, 2.037, 27.815, -1.290, 38.364 ], "bp2_params": [ -0.031, -0.123, 0.044, -5.170, -9.590, -0.907 ], "groove_widths": [ 17.882, 16.381, 15.448, 11.276 ], "simple_Rise": 3.147, "simple_Twist": 34.662, "simple_hRise": 2.054, "simple_hTwist": 38.776 }, { "index": 23, "nt1": "///J/126", "nt2": "///J/253", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.031, -0.123, 0.044, -5.170, -9.590, -0.907 ], "step_params": [ -0.404, -0.934, 3.276, -0.404, 5.610, 34.882 ], "heli_params": [ -2.352, 0.607, 3.097, 9.283, 0.668, 35.319 ], "bp2_params": [ -0.045, -0.078, -0.131, -2.313, -15.846, -0.726 ], "groove_widths": [ 17.258, 16.132, 15.369, 12.916 ], "simple_Rise": 3.276, "simple_Twist": 35.214, "simple_hRise": 3.100, "simple_hTwist": 35.646 }, { "index": 24, "nt1": "///J/127", "nt2": "///J/252", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.045, -0.078, -0.131, -2.313, -15.846, -0.726 ], "step_params": [ -0.215, -0.721, 3.350, -1.144, 1.647, 32.808 ], "heli_params": [ -1.561, 0.181, 3.317, 2.913, 2.024, 32.867 ], "bp2_params": [ 0.081, -0.012, -0.144, -0.891, -16.137, -1.475 ], "groove_widths": [ 16.307, 15.572, 16.448, 15.582 ], "simple_Rise": 3.350, "simple_Twist": 32.284, "simple_hRise": 3.316, "simple_hTwist": 32.345 }, { "index": 25, "nt1": "///J/128", "nt2": "///J/251", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.081, -0.012, -0.144, -0.891, -16.137, -1.475 ], "step_params": [ 0.827, -1.612, 3.291, 0.707, 0.532, 31.664 ], "heli_params": [ -3.051, -1.383, 3.282, 0.975, -1.296, 31.676 ], "bp2_params": [ 0.259, -0.055, -0.013, 3.999, -15.297, -0.008 ], "groove_widths": [ 15.494, 13.178, 15.790, 14.819 ], "simple_Rise": 3.291, "simple_Twist": 31.039, "simple_hRise": 3.281, "simple_hTwist": 31.051 }, { "index": 26, "nt1": "///J/129", "nt2": "///J/250", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.259, -0.055, -0.013, 3.999, -15.297, -0.008 ], "step_params": [ -1.609, -0.669, 4.022, -1.539, 4.337, 57.468 ], "heli_params": [ -0.981, 1.568, 4.004, 4.503, 1.598, 57.636 ], "bp2_params": [ 6.745, -4.024, 0.003, -5.464, -22.224, -7.754 ], "groove_widths": [ 14.743, 12.589, 12.874, 12.652 ], "simple_Rise": 4.022, "simple_Twist": 14.353, "simple_hRise": 3.804, "simple_hTwist": 15.069 }, { "index": 27, "nt1": "///J/130", "nt2": "///J/249", "bp": "G-A", "name": "Sheared", "Saenger": "11-XI", "LW": "tSH", "DSSR": "tm-M", "bp1_params": [ 6.745, -4.024, 0.003, -5.464, -22.224, -7.754 ], "step_params": [ -4.196, -0.825, 3.301, -3.780, -7.690, 20.432 ], "heli_params": [ 1.268, 9.249, 4.041, -20.551, 10.101, 22.138 ], "bp2_params": [ -6.114, -4.282, 1.460, 7.810, -17.820, -29.734 ], "groove_widths": [ 14.934, 13.608, 13.004, 12.134 ], "simple_Rise": 3.301, "simple_Twist": 105.019, "simple_hRise": 3.444, "simple_hTwist": 105.264 }, { "index": 28, "nt1": "///J/132", "nt2": "///J/248", "bp": "A-U", "name": "--", "Saenger": "--", "LW": "tHW", "DSSR": "tM-W", "bp1_params": [ -6.114, -4.282, 1.460, 7.810, -17.820, -29.734 ], "step_params": [ 5.074, -3.503, 2.642, -12.802, -0.007, 27.170 ], "heli_params": [ -6.770, -11.045, 0.275, -0.014, 25.530, 29.984 ], "bp2_params": [ -3.954, -1.299, 0.039, 8.574, 0.899, -73.562 ], "groove_widths": [ 15.887, 13.112, 13.645, 13.645 ], "simple_Rise": 2.642, "simple_Twist": 8.745, "simple_hRise": -2.688, "simple_hTwist": 15.494 }, { "index": 29, "nt1": "///J/131", "nt2": "///J/140", "bp": "A-U", "name": "rHoogsteen", "Saenger": "24-XXIV", "LW": "tHW", "DSSR": "tM-W", "bp1_params": [ -3.954, -1.299, 0.039, 8.574, 0.899, -73.562 ], "step_params": [ 2.246, -1.876, 3.561, -3.023, 4.059, 71.621 ], "heli_params": [ -1.745, -2.024, 3.380, 3.464, 2.580, 71.775 ], "bp2_params": [ -0.189, -0.076, -0.056, 2.644, -8.996, 2.645 ], "groove_widths": [ 17.439, 13.540, 18.094, 16.527 ], "simple_Rise": 3.561, "simple_Twist": 50.501, "simple_hRise": 3.280, "simple_hTwist": 50.738 }, { "index": 30, "nt1": "///J/285", "nt2": "///J/139", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.189, -0.076, -0.056, 2.644, -8.996, 2.645 ], "step_params": [ -1.364, -2.189, 3.388, -4.084, 4.685, 32.102 ], "heli_params": [ -4.712, 1.706, 3.190, 8.374, 7.300, 32.683 ], "bp2_params": [ 0.248, -0.069, -0.104, 3.251, -8.365, 0.729 ], "groove_widths": [ 18.332, 15.208, 13.100, 13.090 ], "simple_Rise": 3.388, "simple_Twist": 30.025, "simple_hRise": 3.172, "simple_hTwist": 30.647 }, { "index": 31, "nt1": "///J/286", "nt2": "///J/138", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.248, -0.069, -0.104, 3.251, -8.365, 0.729 ], "step_params": [ -0.304, -1.307, 3.160, -2.679, 16.697, 23.687 ], "heli_params": [ -5.736, 0.103, 1.874, 35.462, 5.690, 29.034 ], "bp2_params": [ -2.161, -0.044, -0.133, 5.402, -9.561, 3.664 ], "groove_widths": [ 18.105, 16.566, 14.858, 9.732 ], "simple_Rise": 3.160, "simple_Twist": 36.662, "simple_hRise": 2.384, "simple_hTwist": 40.252 }, { "index": 32, "nt1": "///J/287", "nt2": "///J/137", "bp": "G-U", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -2.161, -0.044, -0.133, 5.402, -9.561, 3.664 ], "step_params": [ -0.233, -1.065, 3.387, 0.485, 5.878, 39.175 ], "heli_params": [ -2.269, 0.401, 3.198, 8.706, -0.718, 39.599 ], "bp2_params": [ 0.206, -0.112, -0.264, 10.004, -13.742, -1.880 ], "groove_widths": [ 18.059, null, 14.708, null ], "simple_Rise": 3.387, "simple_Twist": 26.908, "simple_hRise": 3.084, "simple_hTwist": 27.535 }, { "index": 33, "nt1": "///J/288", "nt2": "///J/136", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.206, -0.112, -0.264, 10.004, -13.742, -1.880 ], "step_params": [ 0.550, -1.580, 3.588, 1.408, 13.553, 31.195 ], "heli_params": [ -4.887, -0.714, 2.710, 23.828, -2.476, 33.974 ], "bp2_params": [ -0.007, 0.025, -0.009, -1.300, -13.435, 2.155 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.588, "simple_Twist": 31.960, "simple_hRise": 2.735, "simple_hTwist": 34.674 }, { "index": 34, "nt1": "///J/289", "nt2": "///J/135", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.007, 0.025, -0.009, -1.300, -13.435, 2.155 ], "step_params": [ 0.395, -1.292, 3.383, 3.231, 2.922, 39.175 ], "heli_params": [ -2.270, -0.194, 3.303, 4.341, -4.801, 39.407 ], "bp2_params": [ 2.334, -0.340, -0.227, 4.033, -4.293, -3.656 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.383, "simple_Twist": 27.355, "simple_hRise": 3.254, "simple_hTwist": 27.693 }, { "index": 35, "nt1": "///J/290", "nt2": "///J/134", "bp": "U-G", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 2, "num_stems": 2, "strand1": "UGCGCUUUGUUGCUC", "strand2": "ACGCAAAGCAGCGGA", "bp_type": "||||.|||||||||.", "helix_form": ".AA.xA..AA.A..", "helical_rise": 2.840, "helical_rise_std": 1.017, "helical_radius": 9.809, "helical_radius_std": 3.345, "helical_axis": [ -0.924, 0.325, -0.199 ], "point1": [ 241.481, 316.933, 269.913 ], "point2": [ 204.765, 329.851, 262.012 ], "num_pairs": 15, "pairs": [ { "index": 1, "nt1": "///J/10", "nt2": "///J/44", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.059, -0.100, -0.003, -3.927, -6.367, 6.177 ], "step_params": [ -0.818, -1.689, 3.481, 3.324, 10.282, 30.368 ], "heli_params": [ -4.828, 2.052, 2.679, 18.892, -6.107, 32.191 ], "bp2_params": [ -0.234, -0.065, -0.521, -9.578, -9.756, -1.654 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.481, "simple_Twist": 30.186, "simple_hRise": 2.673, "simple_hTwist": 32.020 }, { "index": 2, "nt1": "///J/11", "nt2": "///J/43", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.234, -0.065, -0.521, -9.578, -9.756, -1.654 ], "step_params": [ 0.156, -1.050, 3.118, -3.394, 6.319, 31.198 ], "heli_params": [ -2.956, -0.847, 2.824, 11.558, 6.208, 31.991 ], "bp2_params": [ 0.147, -0.094, -0.082, 2.252, -11.382, -0.018 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.118, "simple_Twist": 30.120, "simple_hRise": 2.811, "simple_hTwist": 30.943 }, { "index": 3, "nt1": "///J/12", "nt2": "///J/42", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.147, -0.094, -0.082, 2.252, -11.382, -0.018 ], "step_params": [ 0.377, -2.143, 3.526, -0.176, 20.567, 29.567 ], "heli_params": [ -6.086, -0.634, 1.718, 35.414, 0.303, 35.886 ], "bp2_params": [ -0.191, -0.104, -0.006, -13.003, -21.911, -0.283 ], "groove_widths": [ 19.859, null, 16.605, null ], "simple_Rise": 3.526, "simple_Twist": 30.432, "simple_hRise": 1.770, "simple_hTwist": 36.594 }, { "index": 4, "nt1": "///J/13", "nt2": "///J/41", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.191, -0.104, -0.006, -13.003, -21.911, -0.283 ], "step_params": [ 0.330, -0.907, 3.874, -2.288, 0.920, 48.940 ], "heli_params": [ -1.176, -0.602, 3.840, 1.110, 2.759, 48.999 ], "bp2_params": [ 3.157, -0.119, 0.807, -26.878, -18.736, 7.721 ], "groove_widths": [ 21.895, 16.314, 13.204, 10.045 ], "simple_Rise": 3.874, "simple_Twist": 30.369, "simple_hRise": 3.811, "simple_hTwist": 30.467 }, { "index": 5, "nt1": "///J/14", "nt2": "///J/40", "bp": "C-A", "name": "--", "Saenger": "--", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 3.157, -0.119, 0.807, -26.878, -18.736, 7.721 ], "step_params": [ -4.478, 0.053, 3.272, 24.447, 18.839, 53.835 ], "heli_params": [ -0.616, 5.247, 1.266, 19.150, -24.850, 61.476 ], "bp2_params": [ -0.236, 0.025, 0.308, 7.106, -2.901, 0.733 ], "groove_widths": [ 19.950, 16.995, 11.513, 10.175 ], "simple_Rise": 3.272, "simple_Twist": 72.821, "simple_hRise": 1.885, "simple_hTwist": 78.250 }, { "index": 6, "nt1": "///J/17", "nt2": "///J/39", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.236, 0.025, 0.308, 7.106, -2.901, 0.733 ], "step_params": [ 0.034, -1.239, 3.272, 0.688, 4.590, 31.216 ], "heli_params": [ -3.109, 0.062, 3.063, 8.470, -1.269, 31.551 ], "bp2_params": [ -0.024, 0.109, -0.114, 11.900, -6.341, 2.204 ], "groove_widths": [ 17.614, 15.552, 12.243, 12.167 ], "simple_Rise": 3.272, "simple_Twist": 30.951, "simple_hRise": 3.061, "simple_hTwist": 31.288 }, { "index": 7, "nt1": "///J/18", "nt2": "///J/38", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.024, 0.109, -0.114, 11.900, -6.341, 2.204 ], "step_params": [ -0.080, -1.561, 3.589, -0.188, 4.389, 38.409 ], "heli_params": [ -2.937, 0.097, 3.397, 6.644, 0.285, 38.650 ], "bp2_params": [ 2.090, -0.321, -0.168, 7.894, -12.913, -0.630 ], "groove_widths": [ 16.495, 14.731, 18.683, 15.147 ], "simple_Rise": 3.589, "simple_Twist": 26.927, "simple_hRise": 3.298, "simple_hTwist": 27.276 }, { "index": 8, "nt1": "///J/19", "nt2": "///J/37", "bp": "U-G", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 2.090, -0.321, -0.168, 7.894, -12.913, -0.630 ], "step_params": [ -1.923, -1.803, 3.521, -5.250, 13.037, 26.197 ], "heli_params": [ -6.290, 2.639, 2.673, 26.476, 10.662, 29.670 ], "bp2_params": [ -0.242, -0.273, 0.037, -4.643, -9.152, -2.913 ], "groove_widths": [ 17.153, 15.671, 16.280, 14.225 ], "simple_Rise": 3.521, "simple_Twist": 38.109, "simple_hRise": 3.000, "simple_hTwist": 40.528 }, { "index": 9, "nt1": "///J/20", "nt2": "///J/36", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.242, -0.273, 0.037, -4.643, -9.152, -2.913 ], "step_params": [ 0.253, -1.266, 3.319, -0.481, 7.363, 32.001 ], "heli_params": [ -3.469, -0.527, 2.959, 13.137, 0.858, 32.819 ], "bp2_params": [ -0.041, -0.166, -0.082, 0.022, -5.429, -2.091 ], "groove_widths": [ 17.891, 16.578, 16.665, 13.573 ], "simple_Rise": 3.319, "simple_Twist": 31.312, "simple_hRise": 2.949, "simple_hTwist": 32.149 }, { "index": 10, "nt1": "///J/21", "nt2": "///J/35", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.041, -0.166, -0.082, 0.022, -5.429, -2.091 ], "step_params": [ 0.490, -1.422, 3.202, 3.944, 6.188, 35.845 ], "heli_params": [ -3.078, -0.263, 2.959, 9.926, -6.327, 36.564 ], "bp2_params": [ 1.490, 0.011, -0.404, 6.956, -7.165, -0.773 ], "groove_widths": [ 17.653, 16.221, 17.129, 12.055 ], "simple_Rise": 3.202, "simple_Twist": 28.305, "simple_hRise": 2.873, "simple_hTwist": 29.221 }, { "index": 11, "nt1": "///J/22", "nt2": "///J/34", "bp": "U-G", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 1.490, 0.011, -0.404, 6.956, -7.165, -0.773 ], "step_params": [ -0.467, -2.322, 3.501, -2.204, 12.285, 20.467 ], "heli_params": [ -9.134, 0.491, 1.863, 31.116, 5.583, 23.938 ], "bp2_params": [ -0.247, -0.072, -0.087, -1.878, -7.526, 1.050 ], "groove_widths": [ 17.151, 15.586, 17.622, 15.719 ], "simple_Rise": 3.501, "simple_Twist": 29.074, "simple_hRise": 2.377, "simple_hTwist": 31.586 }, { "index": 12, "nt1": "///J/23", "nt2": "///J/33", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.247, -0.072, -0.087, -1.878, -7.526, 1.050 ], "step_params": [ -0.014, -1.788, 3.325, -0.550, 1.248, 36.527 ], "heli_params": [ -3.025, -0.054, 3.264, 1.991, 0.878, 36.552 ], "bp2_params": [ 0.273, -0.158, -0.159, 1.577, -4.301, -1.708 ], "groove_widths": [ 16.908, null, 20.066, null ], "simple_Rise": 3.325, "simple_Twist": 34.564, "simple_hRise": 3.261, "simple_hTwist": 34.590 }, { "index": 13, "nt1": "///J/24", "nt2": "///J/32", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.273, -0.158, -0.159, 1.577, -4.301, -1.708 ], "step_params": [ 0.644, -1.707, 3.334, 6.068, 1.268, 35.286 ], "heli_params": [ -2.963, -0.151, 3.334, 2.072, -9.916, 35.809 ], "bp2_params": [ 2.048, -0.201, -0.744, 4.018, 5.033, 0.993 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.334, "simple_Twist": 25.073, "simple_hRise": 3.306, "simple_hTwist": 25.817 }, { "index": 14, "nt1": "///J/25", "nt2": "///J/31", "bp": "U-G", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 2.048, -0.201, -0.744, 4.018, 5.033, 0.993 ], "step_params": [ 1.950, -3.261, 3.462, 11.270, 9.057, 62.130 ], "heli_params": [ -3.507, -1.334, 3.282, 8.652, -10.765, 63.626 ], "bp2_params": [ 3.077, 1.591, -2.095, 12.086, -7.210, -41.680 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.462, "simple_Twist": 8.283, "simple_hRise": 1.273, "simple_hTwist": 16.652 }, { "index": 15, "nt1": "///J/26", "nt2": "///J/30", "bp": "C+A", "name": "--", "Saenger": "--", "LW": "cWH", "DSSR": "cW+M" } ] }, { "index": 3, "num_stems": 3, "strand1": "UUAGGUUUUGAAUCUCAGCG", "strand2": "AAAUCAAAAAAUAGGGGUGC", "bp_type": "...||||||...|||..|||", "helix_form": "xxx.AAAA..x.A.xx..A", "helical_rise": 3.345, "helical_rise_std": 0.551, "helical_radius": 8.893, "helical_radius_std": 1.969, "helical_axis": [ 0.968, 0.234, -0.089 ], "point1": [ 232.075, 325.191, 258.152 ], "point2": [ 293.883, 340.151, 252.492 ], "num_pairs": 20, "pairs": [ { "index": 1, "nt1": "///J/16", "nt2": "///J/329", "bp": "U-A", "name": "--", "Saenger": "--", "LW": "tWH", "DSSR": "tW-M", "bp1_params": [ 3.448, -0.840, -0.380, 22.729, -8.698, -63.509 ], "step_params": [ 0.554, -0.533, 3.347, -7.539, -4.991, 22.546 ], "heli_params": [ 0.333, -3.735, 3.050, -12.156, 18.361, 24.270 ], "bp2_params": [ 4.303, -2.536, -0.060, -15.475, -6.369, -86.192 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.347, "simple_Twist": -22.414, "simple_hRise": 3.172, "simple_hTwist": -24.147 }, { "index": 2, "nt1": "///J/334", "nt2": "///J/328", "bp": "U-A", "name": "rHoogsteen", "Saenger": "24-XXIV", "LW": "tWH", "DSSR": "tW-M", "bp1_params": [ 4.303, -2.536, -0.060, -15.475, -6.369, -86.192 ], "step_params": [ -2.362, -0.923, 2.990, 7.438, 6.128, -27.463 ], "heli_params": [ 0.442, -3.010, 3.611, -12.432, 15.091, -29.074 ], "bp2_params": [ 6.714, 0.232, 0.638, -7.089, 13.651, 1.571 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.990, "simple_Twist": -88.940, "simple_hRise": 3.185, "simple_hTwist": -89.352 }, { "index": 3, "nt1": "///J/335", "nt2": "///J/336", "bp": "A+A", "name": "Platform", "Saenger": "--", "LW": "cSH", "DSSR": "cm+M", "bp1_params": [ 6.714, 0.232, 0.638, -7.089, 13.651, 1.571 ], "step_params": [ 1.439, 1.328, 3.616, -5.121, 0.354, 64.649 ], "heli_params": [ 1.222, -1.577, 3.513, 0.330, 4.781, 64.831 ], "bp2_params": [ -2.376, -0.735, -0.148, 1.026, -9.056, -8.181 ], "groove_widths": [ 17.590, null, 11.177, null ], "simple_Rise": 3.616, "simple_Twist": 165.814, "simple_hRise": 3.609, "simple_hTwist": 165.829 }, { "index": 4, "nt1": "///J/337", "nt2": "///J/327", "bp": "G-U", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -2.376, -0.735, -0.148, 1.026, -9.056, -8.181 ], "step_params": [ 0.497, -1.239, 3.464, -2.837, 3.433, 43.114 ], "heli_params": [ -2.025, -0.960, 3.323, 4.657, 3.848, 43.333 ], "bp2_params": [ -0.279, -0.162, 0.095, -2.319, -10.169, 0.176 ], "groove_widths": [ 16.415, 14.930, 10.957, 10.948 ], "simple_Rise": 3.464, "simple_Twist": 32.863, "simple_hRise": 3.268, "simple_hTwist": 33.155 }, { "index": 5, "nt1": "///J/338", "nt2": "///J/326", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.279, -0.162, 0.095, -2.319, -10.169, 0.176 ], "step_params": [ -0.405, -1.548, 3.317, -1.031, 1.731, 31.838 ], "heli_params": [ -3.133, 0.550, 3.241, 3.151, 1.877, 31.900 ], "bp2_params": [ -0.108, -0.110, 0.124, 0.602, -10.707, -3.228 ], "groove_widths": [ 16.829, 16.281, 14.262, 12.664 ], "simple_Rise": 3.317, "simple_Twist": 30.918, "simple_hRise": 3.239, "simple_hTwist": 30.982 }, { "index": 6, "nt1": "///J/339", "nt2": "///J/325", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.108, -0.110, 0.124, 0.602, -10.707, -3.228 ], "step_params": [ 0.315, -0.969, 3.224, 2.771, 1.295, 33.462 ], "heli_params": [ -1.885, -0.099, 3.200, 2.243, -4.800, 33.597 ], "bp2_params": [ -0.012, -0.106, -0.016, 5.656, -12.361, -2.419 ], "groove_widths": [ 16.566, 16.009, 14.981, 13.417 ], "simple_Rise": 3.224, "simple_Twist": 33.041, "simple_hRise": 3.200, "simple_hTwist": 33.178 }, { "index": 7, "nt1": "///J/340", "nt2": "///J/324", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.012, -0.106, -0.016, 5.656, -12.361, -2.419 ], "step_params": [ 0.042, -1.249, 3.379, -0.351, 7.086, 33.685 ], "heli_params": [ -3.211, -0.126, 3.060, 12.061, 0.597, 34.402 ], "bp2_params": [ -0.154, -0.243, -0.029, 2.622, -8.286, -3.739 ], "groove_widths": [ 16.508, 15.548, 15.750, 14.557 ], "simple_Rise": 3.379, "simple_Twist": 33.984, "simple_hRise": 3.064, "simple_hTwist": 34.695 }, { "index": 8, "nt1": "///J/341", "nt2": "///J/323", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.154, -0.243, -0.029, 2.622, -8.286, -3.739 ], "step_params": [ 0.371, -1.659, 3.302, -1.074, 5.686, 32.485 ], "heli_params": [ -3.855, -0.829, 2.964, 10.064, 1.901, 32.982 ], "bp2_params": [ -0.086, -0.179, 0.051, 2.686, -5.825, 1.497 ], "groove_widths": [ 16.486, 15.513, 15.248, 14.419 ], "simple_Rise": 3.302, "simple_Twist": 31.978, "simple_hRise": 2.957, "simple_hTwist": 32.484 }, { "index": 9, "nt1": "///J/342", "nt2": "///J/322", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.086, -0.179, 0.051, 2.686, -5.825, 1.497 ], "step_params": [ -1.069, -0.828, 3.603, 2.201, 4.607, 58.820 ], "heli_params": [ -1.097, 1.208, 3.497, 4.682, -2.237, 59.022 ], "bp2_params": [ 6.787, -3.871, -0.016, 3.999, -7.693, -5.362 ], "groove_widths": [ 17.258, 15.332, 12.979, 12.651 ], "simple_Rise": 3.603, "simple_Twist": 14.644, "simple_hRise": 3.009, "simple_hTwist": 15.505 }, { "index": 10, "nt1": "///J/343", "nt2": "///J/321", "bp": "G-A", "name": "Sheared", "Saenger": "11-XI", "LW": "tSH", "DSSR": "tm-M", "bp1_params": [ 6.787, -3.871, -0.016, 3.999, -7.693, -5.362 ], "step_params": [ 0.922, -0.029, 3.406, 2.064, 3.435, -57.523 ], "heli_params": [ -0.161, 1.072, 3.370, -3.565, 2.142, -57.651 ], "bp2_params": [ -6.308, 5.222, -0.224, -21.804, 12.161, -173.139 ], "groove_widths": [ 17.603, 15.316, 12.697, 12.615 ], "simple_Rise": 3.406, "simple_Twist": 9.995, "simple_hRise": 3.329, "simple_hTwist": 10.766 }, { "index": 11, "nt1": "///J/344", "nt2": "///J/320", "bp": "A+A", "name": "--", "Saenger": "02-II", "LW": "tHH", "DSSR": "tM+M", "bp1_params": [ -6.308, 5.222, -0.224, -21.804, 12.161, -173.139 ], "step_params": [ -0.899, 2.243, 3.377, -9.203, 3.762, 121.618 ], "heli_params": [ 1.247, 0.427, 3.454, 2.153, 5.267, 121.859 ], "bp2_params": [ 2.188, 5.508, 0.160, 0.838, -1.983, -177.220 ], "groove_widths": [ 17.025, 15.360, 11.615, 11.397 ], "simple_Rise": 3.377, "simple_Twist": 109.247, "simple_hRise": 3.474, "simple_hTwist": 109.553 }, { "index": 12, "nt1": "///J/367", "nt2": "///J/319", "bp": "A-U", "name": "--", "Saenger": "--", "LW": "cHH", "DSSR": "cM-M", "bp1_params": [ 2.188, 5.508, 0.160, 0.838, -1.983, -177.220 ], "step_params": [ -3.319, -0.858, 3.265, -1.323, 4.828, 33.397 ], "heli_params": [ -2.259, 5.501, 3.238, 8.343, 2.285, 33.760 ], "bp2_params": [ -0.179, 0.014, -0.351, 4.881, -3.677, -3.529 ], "groove_widths": [ 17.325, 15.700, 10.697, 10.151 ], "simple_Rise": 3.265, "simple_Twist": 23.160, "simple_hRise": 3.204, "simple_hTwist": 23.688 }, { "index": 13, "nt1": "///J/368", "nt2": "///J/318", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.179, 0.014, -0.351, 4.881, -3.677, -3.529 ], "step_params": [ 0.306, -1.679, 3.432, -0.416, 9.537, 34.048 ], "heli_params": [ -4.151, -0.565, 2.868, 15.902, 0.694, 35.323 ], "bp2_params": [ 0.198, 0.026, -0.269, 1.763, -2.787, 1.533 ], "groove_widths": [ 17.625, 16.126, 15.682, 15.682 ], "simple_Rise": 3.432, "simple_Twist": 32.339, "simple_hRise": 2.832, "simple_hTwist": 33.682 }, { "index": 14, "nt1": "///J/369", "nt2": "///J/317", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.198, 0.026, -0.269, 1.763, -2.787, 1.533 ], "step_params": [ 0.296, -1.455, 3.464, 0.865, 5.206, 36.638 ], "heli_params": [ -3.013, -0.346, 3.240, 8.229, -1.367, 37.003 ], "bp2_params": [ 2.392, -0.350, -0.272, 3.355, 1.234, 6.704 ], "groove_widths": [ 17.390, 15.814, 23.114, 19.196 ], "simple_Rise": 3.464, "simple_Twist": 24.138, "simple_hRise": 3.095, "simple_hTwist": 24.700 }, { "index": 15, "nt1": "///J/370", "nt2": "///J/316", "bp": "U-G", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 2.392, -0.350, -0.272, 3.355, 1.234, 6.704 ], "step_params": [ -2.977, -3.367, 3.438, 2.629, 2.284, 55.994 ], "heli_params": [ -3.712, 3.317, 3.178, 2.430, -2.798, 56.093 ], "bp2_params": [ 0.599, 2.448, -0.201, 2.165, -3.220, -95.202 ], "groove_widths": [ 17.015, 15.531, 15.099, 15.046 ], "simple_Rise": 3.438, "simple_Twist": 15.601, "simple_hRise": 2.391, "simple_hTwist": 15.983 }, { "index": 16, "nt1": "///J/371", "nt2": "///J/347", "bp": "C+G", "name": "--", "Saenger": "--", "LW": "cWH", "DSSR": "cW+M", "bp1_params": [ 0.599, 2.448, -0.201, 2.165, -3.220, -95.202 ], "step_params": [ 3.477, 0.702, 3.429, -1.471, 6.423, -11.616 ], "heli_params": [ -10.144, 13.328, 3.031, -28.885, -6.617, -13.349 ], "bp2_params": [ -6.748, -4.357, -0.333, 3.120, -7.300, -3.238 ], "groove_widths": [ 17.220, 15.438, 15.053, 14.835 ], "simple_Rise": 3.429, "simple_Twist": 87.935, "simple_hRise": 3.418, "simple_hTwist": 88.132 }, { "index": 17, "nt1": "///J/372", "nt2": "///J/364", "bp": "A-G", "name": "Sheared", "Saenger": "11-XI", "LW": "tHS", "DSSR": "tM-m", "bp1_params": [ -6.748, -4.357, -0.333, 3.120, -7.300, -3.238 ], "step_params": [ 0.218, -0.565, 3.834, -1.672, 1.883, 65.139 ], "heli_params": [ -0.615, -0.283, 3.813, 1.748, 1.553, 65.182 ], "bp2_params": [ -1.422, -0.539, -0.449, -3.457, -6.960, -7.969 ], "groove_widths": [ 20.120, null, 12.990, null ], "simple_Rise": 3.834, "simple_Twist": 26.445, "simple_hRise": 3.765, "simple_hTwist": 26.562 }, { "index": 18, "nt1": "///J/373", "nt2": "///J/363", "bp": "G-U", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -1.422, -0.539, -0.449, -3.457, -6.960, -7.969 ], "step_params": [ 0.438, -1.574, 3.519, 1.269, 3.197, 37.366 ], "heli_params": [ -2.890, -0.506, 3.390, 4.977, -1.976, 37.518 ], "bp2_params": [ 0.167, -0.145, -0.470, -2.706, -1.004, 0.802 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.519, "simple_Twist": 28.941, "simple_hRise": 3.345, "simple_hTwist": 29.140 }, { "index": 19, "nt1": "///J/374", "nt2": "///J/362", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.167, -0.145, -0.470, -2.706, -1.004, 0.802 ], "step_params": [ 0.034, -1.801, 3.363, -1.988, 15.480, 29.521 ], "heli_params": [ -5.463, -0.357, 2.169, 28.045, 3.602, 33.312 ], "bp2_params": [ -0.138, -0.239, 0.239, -4.530, -11.022, -1.039 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.363, "simple_Twist": 31.737, "simple_hRise": 2.262, "simple_hTwist": 35.278 }, { "index": 20, "nt1": "///J/375", "nt2": "///J/361", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 4, "num_stems": 1, "strand1": "CAAGUCAAGAUAA", "strand2": "GUUCGGUAAAAGU", "bp_type": ".||||||.....|", "helix_form": "x.A..A.x.x..", "helical_rise": 3.334, "helical_rise_std": 1.354, "helical_radius": 9.202, "helical_radius_std": 2.740, "helical_axis": [ 0.193, -0.486, -0.852 ], "point1": [ 302.442, 319.929, 271.972 ], "point2": [ 310.083, 300.674, 238.228 ], "num_pairs": 13, "pairs": [ { "index": 1, "nt1": "///J/142", "nt2": "///J/151", "bp": "C+G", "name": "--", "Saenger": "--", "LW": "cHW", "DSSR": "cM+W", "bp1_params": [ -0.537, -5.135, -1.472, 9.863, 20.331, 79.190 ], "step_params": [ 3.549, 3.628, 4.468, -7.385, 0.102, 79.506 ], "heli_params": [ 2.824, -3.028, 4.184, 0.080, 5.763, 79.791 ], "bp2_params": [ 0.017, -0.149, -0.572, -5.645, 9.611, -8.694 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 4.468, "simple_Twist": -59.600, "simple_hRise": 4.831, "simple_hTwist": -60.014 }, { "index": 2, "nt1": "///J/185", "nt2": "///J/245", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.017, -0.149, -0.572, -5.645, 9.611, -8.694 ], "step_params": [ 0.756, -1.685, 3.755, -3.828, 5.854, 24.094 ], "heli_params": [ -5.735, -2.953, 3.109, 13.660, 8.933, 25.074 ], "bp2_params": [ 0.029, -0.056, -0.280, -5.443, -2.459, -0.366 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.755, "simple_Twist": 24.678, "simple_hRise": 3.127, "simple_hTwist": 25.635 }, { "index": 3, "nt1": "///J/186", "nt2": "///J/244", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.029, -0.056, -0.280, -5.443, -2.459, -0.366 ], "step_params": [ -0.536, -2.030, 3.346, -2.310, 10.558, 29.404 ], "heli_params": [ -5.614, 0.589, 2.518, 19.969, 4.369, 31.286 ], "bp2_params": [ -0.142, -0.054, -0.142, -4.461, -4.020, -3.072 ], "groove_widths": [ 20.182, null, 22.193, null ], "simple_Rise": 3.346, "simple_Twist": 29.805, "simple_hRise": 2.531, "simple_hTwist": 31.662 }, { "index": 4, "nt1": "///J/187", "nt2": "///J/243", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.142, -0.054, -0.142, -4.461, -4.020, -3.072 ], "step_params": [ -0.134, -1.166, 3.240, 0.511, 6.295, 40.860 ], "heli_params": [ -2.303, 0.243, 3.033, 8.952, -0.727, 41.324 ], "bp2_params": [ 2.728, -0.583, 0.011, 5.311, -4.482, -4.300 ], "groove_widths": [ 17.693, 15.605, 18.675, 17.190 ], "simple_Rise": 3.240, "simple_Twist": 26.103, "simple_hRise": 2.881, "simple_hTwist": 26.844 }, { "index": 5, "nt1": "///J/188", "nt2": "///J/242", "bp": "U-G", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 2.728, -0.583, 0.011, 5.311, -4.482, -4.300 ], "step_params": [ 0.108, -2.203, 2.995, 0.919, 11.170, 23.432 ], "heli_params": [ -7.278, -0.045, 1.778, 25.704, -2.114, 25.940 ], "bp2_params": [ 0.183, -0.131, 0.313, 4.814, -16.388, 4.432 ], "groove_widths": [ 17.433, 15.878, 16.798, 12.485 ], "simple_Rise": 2.995, "simple_Twist": 36.848, "simple_hRise": 2.259, "simple_hTwist": 38.458 }, { "index": 6, "nt1": "///J/189", "nt2": "///J/241", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.183, -0.131, 0.313, 4.814, -16.388, 4.432 ], "step_params": [ -0.366, -1.523, 3.414, 1.642, 12.943, 35.531 ], "heli_params": [ -3.963, 0.770, 2.697, 20.381, -2.585, 37.778 ], "bp2_params": [ 0.114, -0.061, 0.023, -5.457, -15.441, -6.013 ], "groove_widths": [ 18.511, 15.577, 16.023, 12.569 ], "simple_Rise": 3.414, "simple_Twist": 35.892, "simple_hRise": 2.706, "simple_hTwist": 38.116 }, { "index": 7, "nt1": "///J/190", "nt2": "///J/240", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.114, -0.061, 0.023, -5.457, -15.441, -6.013 ], "step_params": [ 0.264, -2.373, 3.134, 3.284, 1.060, 86.501 ], "heli_params": [ -1.753, -0.123, 3.117, 0.773, -2.396, 86.556 ], "bp2_params": [ 2.062, 2.596, 0.529, -16.623, -4.573, -104.619 ], "groove_widths": [ 19.446, 12.692, 17.016, 16.451 ], "simple_Rise": 3.134, "simple_Twist": 28.226, "simple_hRise": 3.055, "simple_hTwist": 28.432 }, { "index": 8, "nt1": "///J/191", "nt2": "///J/239", "bp": "A+A", "name": "--", "Saenger": "--", "LW": "cWH", "DSSR": "cW+M", "bp1_params": [ 2.062, 2.596, 0.529, -16.623, -4.573, -104.619 ], "step_params": [ 1.219, -4.615, 6.203, 12.993, -2.906, 47.265 ], "heli_params": [ -5.127, 0.486, 6.558, -3.543, -15.842, 49.000 ], "bp2_params": [ 4.618, 2.770, 1.559, -18.292, -9.804, -38.943 ], "groove_widths": [ 22.351, 15.395, 15.306, 15.136 ], "simple_Rise": 6.203, "simple_Twist": 44.024, "simple_hRise": 6.568, "simple_hTwist": 45.898 }, { "index": 9, "nt1": "///J/193", "nt2": "///J/237", "bp": "G+A", "name": "--", "Saenger": "--", "LW": "cWH", "DSSR": "cW+M", "bp1_params": [ 4.618, 2.770, 1.559, -18.292, -9.804, -38.943 ], "step_params": [ -1.824, 3.241, 4.165, -1.723, -3.885, -77.390 ], "heli_params": [ -2.447, -1.520, 4.264, 3.105, -1.377, -77.488 ], "bp2_params": [ -6.454, 4.988, -0.357, -17.660, -2.668, -172.742 ], "groove_widths": [ 23.599, 21.000, 17.278, 14.871 ], "simple_Rise": 4.165, "simple_Twist": 7.642, "simple_hRise": 2.562, "simple_hTwist": 8.743 }, { "index": 10, "nt1": "///J/194", "nt2": "///J/236", "bp": "A+A", "name": "--", "Saenger": "02-II", "LW": "tHH", "DSSR": "tM+M", "bp1_params": [ -6.454, 4.988, -0.357, -17.660, -2.668, -172.742 ], "step_params": [ -1.044, -1.285, 3.407, -0.523, -0.935, 87.572 ], "heli_params": [ -0.907, 0.743, 3.422, -0.675, 0.378, 87.577 ], "bp2_params": [ 4.409, -2.566, 0.350, 9.149, -6.927, -95.650 ], "groove_widths": [ 19.032, null, 18.328, null ], "simple_Rise": 3.407, "simple_Twist": 36.842, "simple_hRise": 3.451, "simple_hTwist": 36.857 }, { "index": 11, "nt1": "///J/196", "nt2": "///J/235", "bp": "U-A", "name": "rHoogsteen", "Saenger": "24-XXIV", "LW": "tWH", "DSSR": "tW-M", "bp1_params": [ 4.409, -2.566, 0.350, 9.149, -6.927, -95.650 ], "step_params": [ 4.527, -1.049, 3.693, -1.068, -1.977, -9.603 ], "heli_params": [ 10.564, 23.927, 3.876, 11.600, -6.267, -9.862 ], "bp2_params": [ -6.844, -4.212, -0.322, 2.851, -3.707, -9.813 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.693, "simple_Twist": 62.690, "simple_hRise": 3.651, "simple_hTwist": 62.726 }, { "index": 12, "nt1": "///J/197", "nt2": "///J/234", "bp": "A-G", "name": "Sheared", "Saenger": "11-XI", "LW": "tHS", "DSSR": "tM-m", "bp1_params": [ -6.844, -4.212, -0.322, 2.851, -3.707, -9.813 ], "step_params": [ 0.969, -0.758, 3.711, -1.200, 2.344, 63.794 ], "heli_params": [ -0.831, -0.975, 3.668, 2.217, 1.135, 63.842 ], "bp2_params": [ -0.066, -0.118, -0.200, -1.111, -7.328, 1.684 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.711, "simple_Twist": 19.705, "simple_hRise": 3.533, "simple_hTwist": 19.878 }, { "index": 13, "nt1": "///J/198", "nt2": "///J/233", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 5, "num_stems": 3, "strand1": "GCUACCUGCUAGAGUCUC", "strand2": "CGAUGGACGAUAAUAGGA", "bp_type": "|||||||||||..|||..", "helix_form": ".AAAAx.AAA....AA.", "helical_rise": 3.032, "helical_rise_std": 0.335, "helical_radius": 9.247, "helical_radius_std": 1.323, "helical_axis": [ 0.229, -0.972, -0.050 ], "point1": [ 307.824, 318.115, 282.998 ], "point2": [ 319.630, 267.896, 280.433 ], "num_pairs": 18, "pairs": [ { "index": 1, "nt1": "///J/152", "nt2": "///J/148", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -1.103, 0.325, -1.672, -14.604, -7.915, 26.995 ], "step_params": [ -1.657, -0.678, 2.932, -4.379, 2.648, 33.327 ], "heli_params": [ -1.565, 2.202, 3.058, 4.583, 7.580, 33.707 ], "bp2_params": [ 0.112, -0.444, -1.310, 2.311, -2.288, -4.541 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.932, "simple_Twist": 26.349, "simple_hRise": 3.080, "simple_hTwist": 26.833 }, { "index": 2, "nt1": "///J/153", "nt2": "///J/147", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.112, -0.444, -1.310, 2.311, -2.288, -4.541 ], "step_params": [ 0.318, -1.682, 3.613, -7.152, 13.965, 33.551 ], "heli_params": [ -4.542, -1.469, 2.614, 22.713, 11.633, 36.942 ], "bp2_params": [ 0.025, -0.161, 0.069, -9.427, 6.771, 1.279 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.613, "simple_Twist": 34.053, "simple_hRise": 2.631, "simple_hTwist": 37.397 }, { "index": 3, "nt1": "///J/154", "nt2": "///J/146", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.025, -0.161, 0.069, -9.427, 6.771, 1.279 ], "step_params": [ -0.156, -1.482, 2.838, 0.426, 5.351, 30.541 ], "heli_params": [ -3.628, 0.360, 2.545, 10.060, -0.802, 30.998 ], "bp2_params": [ 0.073, -0.148, 0.247, 0.653, 1.912, 0.210 ], "groove_widths": [ 17.694, null, 16.516, null ], "simple_Rise": 2.838, "simple_Twist": 30.223, "simple_hRise": 2.541, "simple_hTwist": 30.685 }, { "index": 4, "nt1": "///J/155", "nt2": "///J/145", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.073, -0.148, 0.247, 0.653, 1.912, 0.210 ], "step_params": [ 0.697, -1.461, 3.119, 1.390, 3.252, 35.604 ], "heli_params": [ -2.817, -0.947, 3.003, 5.302, -2.266, 35.774 ], "bp2_params": [ 0.927, 0.008, 0.187, 7.736, -0.188, 9.057 ], "groove_widths": [ 17.422, 16.046, 17.592, 14.568 ], "simple_Rise": 3.119, "simple_Twist": 31.100, "simple_hRise": 2.983, "simple_hTwist": 31.296 }, { "index": 5, "nt1": "///J/156", "nt2": "///J/144", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.927, 0.008, 0.187, 7.736, -0.188, 9.057 ], "step_params": [ 0.047, -1.842, 3.194, 4.301, 6.533, 32.460 ], "heli_params": [ -4.210, 0.578, 2.765, 11.480, -7.559, 33.364 ], "bp2_params": [ 0.208, -0.074, 0.102, 1.833, -9.616, -0.419 ], "groove_widths": [ 16.833, 15.292, 15.001, 13.156 ], "simple_Rise": 3.194, "simple_Twist": 36.664, "simple_hRise": 2.823, "simple_hTwist": 37.461 }, { "index": 6, "nt1": "///J/157", "nt2": "///J/143", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.208, -0.074, 0.102, 1.833, -9.616, -0.419 ], "step_params": [ 1.259, -1.368, 3.260, 2.346, 7.088, 38.964 ], "heli_params": [ -2.822, -1.590, 3.042, 10.509, -3.478, 39.645 ], "bp2_params": [ -0.168, 0.667, 0.315, -6.657, -6.901, 3.052 ], "groove_widths": [ 16.760, 15.219, 16.144, 14.507 ], "simple_Rise": 3.260, "simple_Twist": 40.305, "simple_hRise": 3.052, "simple_hTwist": 40.963 }, { "index": 7, "nt1": "///J/158", "nt2": "///J/184", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.168, 0.667, 0.315, -6.657, -6.901, 3.052 ], "step_params": [ -0.212, -1.029, 3.168, -2.758, 16.841, 27.842 ], "heli_params": [ -4.453, -0.051, 2.215, 31.528, 5.163, 32.568 ], "bp2_params": [ -0.254, -0.118, -0.321, -2.600, -11.059, 4.551 ], "groove_widths": [ 17.123, 15.282, 16.446, 14.530 ], "simple_Rise": 3.168, "simple_Twist": 28.487, "simple_hRise": 2.241, "simple_hTwist": 33.117 }, { "index": 8, "nt1": "///J/159", "nt2": "///J/183", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.254, -0.118, -0.321, -2.600, -11.059, 4.551 ], "step_params": [ -0.657, -1.691, 3.341, -5.776, 2.124, 31.764 ], "heli_params": [ -3.421, 0.135, 3.289, 3.836, 10.431, 32.340 ], "bp2_params": [ 0.149, -0.155, -0.367, 1.503, -9.172, 4.579 ], "groove_widths": [ 17.216, 15.575, 16.877, 14.623 ], "simple_Rise": 3.341, "simple_Twist": 29.298, "simple_hRise": 3.280, "simple_hTwist": 29.924 }, { "index": 9, "nt1": "///J/160", "nt2": "///J/182", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.149, -0.155, -0.367, 1.503, -9.172, 4.579 ], "step_params": [ -0.628, -1.397, 3.549, -2.862, 5.197, 30.903 ], "heli_params": [ -3.608, 0.591, 3.319, 9.641, 5.310, 31.454 ], "bp2_params": [ -0.072, -0.155, -0.341, 0.169, -1.305, 1.566 ], "groove_widths": [ 17.348, 16.133, 17.179, 15.381 ], "simple_Rise": 3.549, "simple_Twist": 32.525, "simple_hRise": 3.334, "simple_hTwist": 33.048 }, { "index": 10, "nt1": "///J/161", "nt2": "///J/181", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.072, -0.155, -0.341, 0.169, -1.305, 1.566 ], "step_params": [ -0.182, -1.386, 3.777, 2.941, 11.841, 30.782 ], "heli_params": [ -4.596, 0.857, 3.023, 21.288, -5.287, 33.058 ], "bp2_params": [ 0.110, -0.142, -0.896, -10.973, -5.682, -1.132 ], "groove_widths": [ 17.432, 16.012, 15.303, 13.736 ], "simple_Rise": 3.777, "simple_Twist": 29.620, "simple_hRise": 2.986, "simple_hTwist": 31.982 }, { "index": 11, "nt1": "///J/162", "nt2": "///J/180", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.110, -0.142, -0.896, -10.973, -5.682, -1.132 ], "step_params": [ -0.565, -1.165, 3.403, -3.122, 2.557, 52.456 ], "heli_params": [ -1.487, 0.427, 3.373, 2.888, 3.527, 52.600 ], "bp2_params": [ 6.682, -4.024, -0.569, 0.326, -1.839, -9.714 ], "groove_widths": [ 17.299, 15.745, 15.018, 14.578 ], "simple_Rise": 3.403, "simple_Twist": 10.071, "simple_hRise": 3.049, "simple_hTwist": 10.848 }, { "index": 12, "nt1": "///J/163", "nt2": "///J/179", "bp": "G-A", "name": "Sheared", "Saenger": "11-XI", "LW": "tSH", "DSSR": "tm-M", "bp1_params": [ 6.682, -4.024, -0.569, 0.326, -1.839, -9.714 ], "step_params": [ -0.290, -1.757, 3.526, -8.624, 3.475, 37.535 ], "heli_params": [ -3.112, -0.694, 3.340, 5.301, 13.157, 38.629 ], "bp2_params": [ -8.419, 4.735, 0.725, 2.502, 7.043, -131.104 ], "groove_widths": [ 17.319, 15.521, 15.535, 15.230 ], "simple_Rise": 3.526, "simple_Twist": 72.045, "simple_hRise": 3.461, "simple_hTwist": 72.562 }, { "index": 13, "nt1": "///J/164", "nt2": "///J/178", "bp": "A+A", "name": "--", "Saenger": "--", "LW": "tHH", "DSSR": "tM+M", "bp1_params": [ -8.419, 4.735, 0.725, 2.502, 7.043, -131.104 ], "step_params": [ 1.482, -1.207, 3.111, 2.810, 5.009, -2.351 ], "heli_params": [ -13.686, 27.622, 1.482, -59.092, 33.155, -6.206 ], "bp2_params": [ -2.978, -0.573, -0.082, -2.937, 8.751, 15.103 ], "groove_widths": [ 17.275, 15.250, 14.485, 13.942 ], "simple_Rise": 3.111, "simple_Twist": 23.286, "simple_hRise": 2.946, "simple_hTwist": 23.975 }, { "index": 14, "nt1": "///J/165", "nt2": "///J/177", "bp": "G-U", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -2.978, -0.573, -0.082, -2.937, 8.751, 15.103 ], "step_params": [ -0.953, -1.365, 3.151, 0.005, 4.693, 44.007 ], "heli_params": [ -2.225, 1.265, 2.997, 6.241, -0.006, 44.244 ], "bp2_params": [ -0.021, -0.204, -0.100, 1.505, 5.062, 5.830 ], "groove_widths": [ 17.481, 15.680, 14.178, 13.165 ], "simple_Rise": 3.151, "simple_Twist": 27.196, "simple_hRise": 2.878, "simple_hTwist": 27.590 }, { "index": 15, "nt1": "///J/166", "nt2": "///J/176", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.021, -0.204, -0.100, 1.505, 5.062, 5.830 ], "step_params": [ -0.221, -1.715, 3.031, 3.446, 9.055, 30.990 ], "heli_params": [ -4.426, 0.911, 2.409, 16.449, -6.260, 32.434 ], "bp2_params": [ 0.118, -0.159, -0.366, 5.930, 7.910, 2.952 ], "groove_widths": [ 17.695, null, 18.932, null ], "simple_Rise": 3.031, "simple_Twist": 29.965, "simple_hRise": 2.384, "simple_hTwist": 31.458 }, { "index": 16, "nt1": "///J/167", "nt2": "///J/175", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.118, -0.159, -0.366, 5.930, 7.910, 2.952 ], "step_params": [ -0.465, -1.816, 3.088, 0.580, 6.983, 30.112 ], "heli_params": [ -4.603, 0.971, 2.602, 13.217, -1.097, 30.898 ], "bp2_params": [ 0.181, -0.812, -0.524, 11.993, 10.404, -5.580 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.088, "simple_Twist": 29.092, "simple_hRise": 2.582, "simple_hTwist": 29.906 }, { "index": 17, "nt1": "///J/168", "nt2": "///J/174", "bp": "U-G", "name": "--", "Saenger": "--", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.181, -0.812, -0.524, 11.993, 10.404, -5.580 ], "step_params": [ -1.109, -0.923, 2.936, 3.191, 2.260, 48.863 ], "heli_params": [ -1.263, 1.550, 2.820, 2.727, -3.851, 49.010 ], "bp2_params": [ 6.447, -3.270, -1.409, 35.431, -4.899, -7.678 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.936, "simple_Twist": 9.619, "simple_hRise": 2.180, "simple_hTwist": 10.382 }, { "index": 18, "nt1": "///J/169", "nt2": "///J/173", "bp": "C-A", "name": "~Sheared", "Saenger": "--", "LW": "tSH", "DSSR": "tm-M" } ] }, { "index": 6, "num_stems": 2, "strand1": "AGCUUAGACCUUU", "strand2": "UUGCUUUUGGGGG", "bp_type": ".||..|||||.|.", "helix_form": "........AA.x", "helical_rise": 2.959, "helical_rise_std": 1.149, "helical_radius": 9.845, "helical_radius_std": 1.682, "helical_axis": [ 0.248, -0.968, -0.043 ], "point1": [ 317.583, 285.439, 235.605 ], "point2": [ 326.444, 250.877, 234.077 ], "num_pairs": 13, "pairs": [ { "index": 1, "nt1": "///J/202", "nt2": "///J/229", "bp": "A+U", "name": "--", "Saenger": "--", "LW": "tWS", "DSSR": "tW+m", "bp1_params": [ -0.262, 6.170, -0.827, -16.792, -0.362, 118.794 ], "step_params": [ -2.097, 0.171, 2.864, 4.080, 6.359, -80.831 ], "heli_params": [ -0.276, -1.520, 2.932, -4.894, 3.140, -81.123 ], "bp2_params": [ -3.028, -0.578, 0.534, 10.203, 10.269, -3.664 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.864, "simple_Twist": 12.544, "simple_hRise": 1.948, "simple_hTwist": 14.636 }, { "index": 2, "nt1": "///J/203", "nt2": "///J/228", "bp": "G-U", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -3.028, -0.578, 0.534, 10.203, 10.269, -3.664 ], "step_params": [ 0.340, -1.455, 3.135, 2.049, 3.924, 43.523 ], "heli_params": [ -2.306, -0.272, 3.012, 5.275, -2.755, 43.736 ], "bp2_params": [ 0.190, -0.081, -0.188, 18.124, -0.527, -0.145 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.135, "simple_Twist": 27.048, "simple_hRise": 2.916, "simple_hTwist": 27.402 }, { "index": 3, "nt1": "///J/204", "nt2": "///J/227", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.190, -0.081, -0.188, 18.124, -0.527, -0.145 ], "step_params": [ 0.036, -1.186, 3.575, 7.860, 9.074, 37.418 ], "heli_params": [ -2.911, 0.937, 3.158, 13.718, -11.883, 39.231 ], "bp2_params": [ 3.990, -1.502, -0.880, 18.066, -28.724, 15.343 ], "groove_widths": [ 16.681, null, 17.459, null ], "simple_Rise": 3.575, "simple_Twist": 13.977, "simple_hRise": 2.153, "simple_hTwist": 18.405 }, { "index": 4, "nt1": "///J/205", "nt2": "///J/226", "bp": "U-C", "name": "--", "Saenger": "--", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 3.990, -1.502, -0.880, 18.066, -28.724, 15.343 ], "step_params": [ -0.204, -2.870, 4.398, -4.923, 16.588, 12.185 ], "heli_params": [ -14.233, -1.346, 0.348, 52.826, 15.676, 21.136 ], "bp2_params": [ -2.418, -2.167, -0.373, -17.619, -9.405, 8.652 ], "groove_widths": [ 16.770, 13.812, 17.855, 12.901 ], "simple_Rise": 4.398, "simple_Twist": 53.295, "simple_hRise": 3.439, "simple_hTwist": 55.837 }, { "index": 5, "nt1": "///J/206", "nt2": "///J/225", "bp": "U-U", "name": "--", "Saenger": "16-XVI", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -2.418, -2.167, -0.373, -17.619, -9.405, 8.652 ], "step_params": [ 0.326, -1.031, 3.154, -2.397, 9.962, 36.589 ], "heli_params": [ -2.759, -0.783, 2.763, 15.498, 3.729, 37.949 ], "bp2_params": [ -0.048, -0.174, -0.183, -11.544, 5.493, 7.852 ], "groove_widths": [ 17.404, 14.781, 19.013, 13.551 ], "simple_Rise": 3.154, "simple_Twist": 20.087, "simple_hRise": 2.330, "simple_hTwist": 22.525 }, { "index": 6, "nt1": "///J/207", "nt2": "///J/224", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.048, -0.174, -0.183, -11.544, 5.493, 7.852 ], "step_params": [ 0.195, -2.181, 3.121, 1.479, 18.763, 20.828 ], "heli_params": [ -7.657, -0.155, 0.896, 42.387, -3.342, 28.002 ], "bp2_params": [ -2.265, -0.454, -0.452, -10.674, -8.275, -6.697 ], "groove_widths": [ 17.872, 15.949, 19.223, 15.927 ], "simple_Rise": 3.121, "simple_Twist": 31.919, "simple_hRise": 1.638, "simple_hTwist": 36.930 }, { "index": 7, "nt1": "///J/208", "nt2": "///J/223", "bp": "G-U", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -2.265, -0.454, -0.452, -10.674, -8.275, -6.697 ], "step_params": [ -0.197, -1.509, 3.399, 0.015, 2.001, 39.867 ], "heli_params": [ -2.447, 0.291, 3.322, 2.932, -0.022, 39.915 ], "bp2_params": [ 0.614, 0.852, -0.727, -5.450, -0.008, -0.533 ], "groove_widths": [ 17.340, 15.843, 20.794, 20.076 ], "simple_Rise": 3.399, "simple_Twist": 25.412, "simple_hRise": 3.272, "simple_hTwist": 25.490 }, { "index": 8, "nt1": "///J/209", "nt2": "///J/222", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.614, 0.852, -0.727, -5.450, -0.008, -0.533 ], "step_params": [ 0.562, -1.963, 3.082, 0.176, -0.063, 26.959 ], "heli_params": [ -4.196, -1.164, 3.090, -0.136, -0.377, 26.960 ], "bp2_params": [ 0.239, -0.069, -0.452, 6.523, -5.612, 1.807 ], "groove_widths": [ 16.580, 15.278, 21.215, 21.043 ], "simple_Rise": 3.082, "simple_Twist": 28.930, "simple_hRise": 3.089, "simple_hTwist": 28.931 }, { "index": 9, "nt1": "///J/210", "nt2": "///J/221", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.239, -0.069, -0.452, 6.523, -5.612, 1.807 ], "step_params": [ -0.652, -2.399, 3.742, -5.380, 0.871, 27.528 ], "heli_params": [ -5.185, -0.117, 3.723, 1.807, 11.168, 28.052 ], "bp2_params": [ 0.135, -0.058, 0.240, -0.382, 0.942, 1.484 ], "groove_widths": [ 16.606, 15.239, 19.228, 19.168 ], "simple_Rise": 3.742, "simple_Twist": 27.829, "simple_hRise": 3.724, "simple_hTwist": 28.347 }, { "index": 10, "nt1": "///J/211", "nt2": "///J/220", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.135, -0.058, 0.240, -0.382, 0.942, 1.484 ], "step_params": [ 0.145, -2.298, 3.409, 1.272, 3.207, 30.574 ], "heli_params": [ -4.964, -0.023, 3.161, 6.057, -2.403, 30.763 ], "bp2_params": [ 0.250, 0.836, 0.249, -4.452, 8.949, 0.941 ], "groove_widths": [ 17.330, null, 19.060, null ], "simple_Rise": 3.409, "simple_Twist": 30.996, "simple_hRise": 3.164, "simple_hTwist": 31.183 }, { "index": 11, "nt1": "///J/212", "nt2": "///J/219", "bp": "U-G", "name": "--", "Saenger": "--", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.250, 0.836, 0.249, -4.452, 8.949, 0.941 ], "step_params": [ 0.173, -1.381, 3.009, 0.944, 5.230, 43.138 ], "heli_params": [ -2.319, -0.152, 2.834, 7.080, -1.278, 43.449 ], "bp2_params": [ 2.513, -0.761, 0.185, 9.104, 17.980, 1.837 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.009, "simple_Twist": 29.822, "simple_hRise": 2.737, "simple_hTwist": 30.281 }, { "index": 12, "nt1": "///J/213", "nt2": "///J/218", "bp": "U-G", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 2.513, -0.761, 0.185, 9.104, 17.980, 1.837 ], "step_params": [ -5.706, -1.262, 4.134, -5.031, 14.100, 59.028 ], "heli_params": [ -2.130, 5.329, 4.192, 14.066, 5.018, 60.731 ], "bp2_params": [ 6.785, -6.743, -1.866, 39.026, -28.430, -71.424 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 4.134, "simple_Twist": 17.358, "simple_hRise": 3.617, "simple_hTwist": 22.885 }, { "index": 13, "nt1": "///J/214", "nt2": "///J/216", "bp": "U-G", "name": "--", "Saenger": "--", "LW": "tSH", "DSSR": "tm-M" } ] }, { "index": 7, "num_stems": 0, "strand1": "CGA", "strand2": "GCA", "bp_type": ".|.", "helix_form": ".x", "helical_rise": 4.430, "helical_rise_std": 0.411, "helical_radius": 8.493, "helical_radius_std": 0.934, "helical_axis": [ 0.777, 0.607, -0.165 ], "point1": [ 257.980, 329.791, 281.027 ], "point2": [ 265.284, 335.498, 279.477 ], "num_pairs": 3, "pairs": [ { "index": 1, "nt1": "///J/263", "nt2": "///J/275", "bp": "C+G", "name": "--", "Saenger": "--", "LW": "cHW", "DSSR": "cM+W", "bp1_params": [ 0.075, -4.827, -0.474, 7.964, 7.208, 91.819 ], "step_params": [ -2.929, 0.410, 3.021, 15.561, 5.469, -101.128 ], "heli_params": [ -0.343, -1.657, 3.308, -3.524, 10.028, -102.100 ], "bp2_params": [ -0.179, -0.211, 0.152, -10.193, -22.363, -4.686 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.021, "simple_Twist": 36.307, "simple_hRise": 1.715, "simple_hTwist": 39.763 }, { "index": 2, "nt1": "///J/264", "nt2": "///J/274", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.179, -0.211, 0.152, -10.193, -22.363, -4.686 ], "step_params": [ -3.050, -0.891, 2.821, 10.892, 7.603, 46.309 ], "heli_params": [ -1.538, 4.380, 1.937, 9.442, -13.526, 48.075 ], "bp2_params": [ 6.229, -0.941, 2.605, -50.162, -17.076, -17.643 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.821, "simple_Twist": -44.049, "simple_hRise": 3.540, "simple_hTwist": -45.913 }, { "index": 3, "nt1": "///J/265", "nt2": "///J/278", "bp": "A+A", "name": "--", "Saenger": "--", "LW": ".SH", "DSSR": ".m+M" } ] }, { "index": 8, "num_stems": 1, "strand1": "GGUUAG", "strand2": "CCAAUC", "bp_type": ".|||||", "helix_form": "..AAA", "helical_rise": 2.650, "helical_rise_std": 0.284, "helical_radius": 9.495, "helical_radius_std": 0.899, "helical_axis": [ -0.837, -0.130, 0.532 ], "point1": [ 278.872, 334.081, 270.022 ], "point2": [ 267.953, 332.384, 276.962 ], "num_pairs": 6, "pairs": [ { "index": 1, "nt1": "///J/268", "nt2": "///J/284", "bp": "G+C", "name": "--", "Saenger": "--", "LW": "cHW", "DSSR": "cM+W", "bp1_params": [ -0.282, -2.504, -0.651, 12.000, 4.090, 99.093 ], "step_params": [ -2.218, 0.175, 3.112, 9.086, 4.721, -93.002 ], "heli_params": [ -0.205, -1.359, 3.260, -3.246, 6.248, -93.435 ], "bp2_params": [ -0.334, -0.101, 0.170, -2.989, -18.383, 3.266 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.112, "simple_Twist": 34.496, "simple_hRise": 2.469, "simple_hTwist": 35.939 }, { "index": 2, "nt1": "///J/269", "nt2": "///J/283", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.334, -0.101, 0.170, -2.989, -18.383, 3.266 ], "step_params": [ -0.898, -1.646, 3.365, -0.068, 5.877, 33.386 ], "heli_params": [ -3.756, 1.530, 3.042, 10.132, 0.117, 33.885 ], "bp2_params": [ -0.229, 0.033, -0.022, -7.328, -15.690, -4.156 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.365, "simple_Twist": 33.200, "simple_hRise": 3.039, "simple_hTwist": 33.702 }, { "index": 3, "nt1": "///J/270", "nt2": "///J/282", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.229, 0.033, -0.022, -7.328, -15.690, -4.156 ], "step_params": [ 0.380, -1.127, 3.212, 0.586, 4.973, 31.470 ], "heli_params": [ -2.921, -0.590, 3.009, 9.096, -1.072, 31.856 ], "bp2_params": [ -0.011, -0.036, -0.028, -0.532, -11.376, -4.140 ], "groove_widths": [ 17.621, null, 16.104, null ], "simple_Rise": 3.212, "simple_Twist": 30.254, "simple_hRise": 2.999, "simple_hTwist": 30.656 }, { "index": 4, "nt1": "///J/271", "nt2": "///J/281", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.011, -0.036, -0.028, -0.532, -11.376, -4.140 ], "step_params": [ 0.448, -1.650, 3.188, 1.131, 9.719, 28.782 ], "heli_params": [ -4.903, -0.651, 2.525, 18.877, -2.197, 30.366 ], "bp2_params": [ 0.160, -0.023, 0.149, 2.415, -4.945, -4.968 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.188, "simple_Twist": 27.874, "simple_hRise": 2.499, "simple_hTwist": 29.509 }, { "index": 5, "nt1": "///J/272", "nt2": "///J/280", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.160, -0.023, 0.149, 2.415, -4.945, -4.968 ], "step_params": [ 0.853, -2.191, 3.495, 0.885, 2.143, 31.160 ], "heli_params": [ -4.495, -1.409, 3.363, 3.983, -1.645, 31.244 ], "bp2_params": [ -0.016, -0.357, 0.413, -7.103, -10.117, -0.019 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.495, "simple_Twist": 32.077, "simple_hRise": 3.367, "simple_hTwist": 32.159 }, { "index": 6, "nt1": "///J/273", "nt2": "///J/279", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 9, "num_stems": 2, "strand1": "GGUUGUUACUUGAAG", "strand2": "UCAACAAUGAGUUUA", "bp_type": "||||||.|||||||.", "helix_form": ".AAA.xx.....A.", "helical_rise": 2.851, "helical_rise_std": 0.417, "helical_radius": 9.496, "helical_radius_std": 1.124, "helical_axis": [ -0.947, 0.234, -0.221 ], "point1": [ 294.638, 325.830, 237.982 ], "point2": [ 256.923, 335.135, 229.171 ], "num_pairs": 15, "pairs": [ { "index": 1, "nt1": "///J/291", "nt2": "///J/353", "bp": "G-U", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -2.969, -0.662, 0.054, 5.546, -3.589, 0.780 ], "step_params": [ -1.013, -1.381, 3.376, -7.072, 2.511, 45.387 ], "heli_params": [ -1.995, 0.661, 3.412, 3.229, 9.091, 45.970 ], "bp2_params": [ -0.198, -0.158, 0.201, 0.368, -5.626, -1.946 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.376, "simple_Twist": 29.911, "simple_hRise": 3.396, "simple_hTwist": 30.817 }, { "index": 2, "nt1": "///J/292", "nt2": "///J/352", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.198, -0.158, 0.201, 0.368, -5.626, -1.946 ], "step_params": [ -0.425, -1.561, 3.323, -3.277, 6.074, 33.968 ], "heli_params": [ -3.539, 0.220, 3.034, 10.266, 5.539, 34.642 ], "bp2_params": [ -0.143, -0.132, 0.205, -0.635, -8.735, -1.249 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.323, "simple_Twist": 33.675, "simple_hRise": 3.030, "simple_hTwist": 34.355 }, { "index": 3, "nt1": "///J/293", "nt2": "///J/351", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.143, -0.132, 0.205, -0.635, -8.735, -1.249 ], "step_params": [ 0.163, -1.150, 3.332, -2.159, 3.072, 33.668 ], "heli_params": [ -2.469, -0.628, 3.201, 5.283, 3.713, 33.870 ], "bp2_params": [ -0.016, -0.217, 0.275, 3.214, -7.948, -0.726 ], "groove_widths": [ 17.389, null, 14.394, null ], "simple_Rise": 3.332, "simple_Twist": 33.561, "simple_hRise": 3.201, "simple_hTwist": 33.764 }, { "index": 4, "nt1": "///J/294", "nt2": "///J/350", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.016, -0.217, 0.275, 3.214, -7.948, -0.726 ], "step_params": [ 0.719, -1.553, 3.392, 2.988, 11.037, 30.707 ], "heli_params": [ -4.604, -0.775, 2.742, 19.992, -5.412, 32.719 ], "bp2_params": [ -0.227, -0.159, -0.065, -1.551, -14.974, 3.757 ], "groove_widths": [ 16.813, 15.305, 14.589, 14.110 ], "simple_Rise": 3.392, "simple_Twist": 31.508, "simple_hRise": 2.762, "simple_hTwist": 33.469 }, { "index": 5, "nt1": "///J/295", "nt2": "///J/349", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.227, -0.159, -0.065, -1.551, -14.974, 3.757 ], "step_params": [ -0.870, -1.678, 3.477, -1.054, 2.543, 37.574 ], "heli_params": [ -2.944, 1.203, 3.382, 3.942, 1.634, 37.671 ], "bp2_params": [ -0.142, 0.097, -0.264, -6.982, -12.795, -4.925 ], "groove_widths": [ 16.436, 15.019, 23.538, 23.433 ], "simple_Rise": 3.477, "simple_Twist": 37.145, "simple_hRise": 3.381, "simple_hTwist": 37.243 }, { "index": 6, "nt1": "///J/296", "nt2": "///J/348", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.142, 0.097, -0.264, -6.982, -12.795, -4.925 ], "step_params": [ 0.561, -1.760, 3.106, 0.979, 3.187, 64.785 ], "heli_params": [ -1.767, -0.484, 3.033, 2.972, -0.913, 64.861 ], "bp2_params": [ -0.340, 3.602, -0.171, -4.646, -11.715, -75.493 ], "groove_widths": [ 17.300, 16.512, 16.736, 13.139 ], "simple_Rise": 3.106, "simple_Twist": 19.770, "simple_hRise": 2.813, "simple_hTwist": 20.046 }, { "index": 7, "nt1": "///J/297", "nt2": "///J/346", "bp": "U+A", "name": "Hoogsteen", "Saenger": "23-XXIII", "LW": "cWH", "DSSR": "cW+M", "bp1_params": [ -0.340, 3.602, -0.171, -4.646, -11.715, -75.493 ], "step_params": [ -0.747, 0.413, 3.668, 3.637, 12.531, -5.361 ], "heli_params": [ -14.492, 0.677, 1.223, -65.074, 18.887, -14.102 ], "bp2_params": [ 0.303, 0.136, -0.272, -5.559, -6.389, -4.599 ], "groove_widths": [ 18.730, 16.351, 16.636, 13.955 ], "simple_Rise": 3.668, "simple_Twist": 37.524, "simple_hRise": 3.538, "simple_hTwist": 39.651 }, { "index": 8, "nt1": "///J/298", "nt2": "///J/315", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.303, 0.136, -0.272, -5.559, -6.389, -4.599 ], "step_params": [ 1.243, -1.597, 3.285, -3.585, 6.495, 33.417 ], "heli_params": [ -3.678, -2.646, 2.790, 11.125, 6.140, 34.207 ], "bp2_params": [ 0.205, -0.112, 0.516, -4.448, -10.632, 5.850 ], "groove_widths": [ 15.703, 10.357, 17.519, 13.848 ], "simple_Rise": 3.285, "simple_Twist": 33.816, "simple_hRise": 2.797, "simple_hTwist": 34.597 }, { "index": 9, "nt1": "///J/299", "nt2": "///J/314", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.205, -0.112, 0.516, -4.448, -10.632, 5.850 ], "step_params": [ -1.228, -2.373, 3.143, 0.446, 7.772, 28.442 ], "heli_params": [ -6.098, 2.497, 2.405, 15.456, -0.887, 29.467 ], "bp2_params": [ -0.168, 0.006, 0.160, -6.362, -10.467, -2.773 ], "groove_widths": [ 14.520, 11.172, 16.368, 13.138 ], "simple_Rise": 3.143, "simple_Twist": 29.854, "simple_hRise": 2.444, "simple_hTwist": 30.830 }, { "index": 10, "nt1": "///J/300", "nt2": "///J/313", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.168, 0.006, 0.160, -6.362, -10.467, -2.773 ], "step_params": [ 0.024, -1.261, 3.258, 1.500, 4.876, 40.857 ], "heli_params": [ -2.308, 0.125, 3.093, 6.952, -2.138, 41.161 ], "bp2_params": [ 2.295, -0.517, 0.282, -1.789, -7.288, -7.887 ], "groove_widths": [ 17.242, 16.426, 17.047, 14.041 ], "simple_Rise": 3.258, "simple_Twist": 28.139, "simple_hRise": 2.998, "simple_hTwist": 28.589 }, { "index": 11, "nt1": "///J/301", "nt2": "///J/312", "bp": "U-G", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 2.295, -0.517, 0.282, -1.789, -7.288, -7.887 ], "step_params": [ 0.866, -2.624, 3.042, 5.203, 11.444, 13.336 ], "heli_params": [ -12.626, -0.730, 0.832, 39.590, -17.998, 18.308 ], "bp2_params": [ -2.413, -0.581, -0.091, -3.551, -7.333, -5.619 ], "groove_widths": [ 17.120, 15.706, 18.096, 15.843 ], "simple_Rise": 3.042, "simple_Twist": 38.301, "simple_hRise": 2.290, "simple_hTwist": 40.237 }, { "index": 12, "nt1": "///J/302", "nt2": "///J/311", "bp": "G-U", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -2.413, -0.581, -0.091, -3.551, -7.333, -5.619 ], "step_params": [ -0.082, -1.718, 3.509, -0.840, 5.284, 40.716 ], "heli_params": [ -3.048, 0.022, 3.271, 7.555, 1.201, 41.051 ], "bp2_params": [ 0.084, 0.009, -0.228, -6.966, -6.484, -2.201 ], "groove_widths": [ 16.993, null, 20.492, null ], "simple_Rise": 3.509, "simple_Twist": 27.488, "simple_hRise": 3.131, "simple_hTwist": 27.994 }, { "index": 13, "nt1": "///J/303", "nt2": "///J/310", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.084, 0.009, -0.228, -6.966, -6.484, -2.201 ], "step_params": [ 0.005, -1.875, 3.243, 0.091, 6.238, 28.303 ], "heli_params": [ -5.032, 0.010, 2.774, 12.565, -0.184, 28.969 ], "bp2_params": [ 0.087, -0.042, -0.220, -2.015, -1.029, -1.982 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.243, "simple_Twist": 28.549, "simple_hRise": 2.779, "simple_hTwist": 29.209 }, { "index": 14, "nt1": "///J/304", "nt2": "///J/309", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.087, -0.042, -0.220, -2.015, -1.029, -1.982 ], "step_params": [ -3.938, -1.585, 3.175, -4.128, -0.884, 58.919 ], "heli_params": [ -1.562, 3.781, 3.441, -0.898, 4.190, 59.057 ], "bp2_params": [ 8.077, -5.414, -0.212, 22.911, 1.001, -58.840 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.175, "simple_Twist": 6.137, "simple_hRise": 4.986, "simple_hTwist": 7.447 }, { "index": 15, "nt1": "///J/305", "nt2": "///J/308", "bp": "G-A", "name": "--", "Saenger": "--", "LW": "tSH", "DSSR": "tm-M" } ] } ], "num_stems": 19, "stems": [ { "index": 1, "helix_index": 1, "strand1": "GUAGGCGU", "strand2": "CGUCUGCA", "bp_type": "||||||||", "helix_form": ".......", "helical_rise": 2.989, "helical_rise_std": 0.399, "helical_radius": 9.578, "helical_radius_std": 0.957, "helical_axis": [ 0.947, 0.049, -0.316 ], "point1": [ 207.492, 302.340, 288.074 ], "point2": [ 227.266, 303.371, 281.479 ], "num_pairs": 8, "pairs": [ { "index": 1, "nt1": "///J/2", "nt2": "///J/61", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.200, -0.818, -1.706, -10.842, -8.011, -1.467 ], "step_params": [ 0.662, -0.677, 3.751, -5.573, 1.815, 40.021 ], "heli_params": [ -1.210, -1.664, 3.598, 2.635, 8.090, 40.431 ], "bp2_params": [ 1.382, -0.301, -0.231, -8.660, -14.986, 5.256 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.751, "simple_Twist": 30.843, "simple_hRise": 3.536, "simple_hTwist": 31.382 }, { "index": 2, "nt1": "///J/3", "nt2": "///J/60", "bp": "U-G", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 1.382, -0.301, -0.231, -8.660, -14.986, 5.256 ], "step_params": [ -0.559, -0.820, 3.069, 0.391, 19.953, 26.561 ], "heli_params": [ -4.343, 1.038, 1.982, 37.440, -0.734, 33.115 ], "bp2_params": [ 0.226, -0.150, -0.556, -1.111, 8.254, -8.909 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.069, "simple_Twist": 33.681, "simple_hRise": 2.251, "simple_hTwist": 39.002 }, { "index": 3, "nt1": "///J/4", "nt2": "///J/59", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.226, -0.150, -0.556, -1.111, 8.254, -8.909 ], "step_params": [ 0.606, -1.667, 3.509, -2.769, 6.226, 29.890 ], "heli_params": [ -4.401, -1.700, 3.040, 11.878, 5.282, 30.639 ], "bp2_params": [ -0.256, -0.266, -0.367, 0.610, -3.708, 1.109 ], "groove_widths": [ 16.584, null, 17.598, null ], "simple_Rise": 3.509, "simple_Twist": 32.143, "simple_hRise": 3.079, "simple_hTwist": 32.839 }, { "index": 4, "nt1": "///J/5", "nt2": "///J/58", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.256, -0.266, -0.367, 0.610, -3.708, 1.109 ], "step_params": [ -0.896, -1.404, 3.349, -8.007, 5.576, 24.564 ], "heli_params": [ -4.593, -0.219, 3.095, 12.493, 17.941, 26.403 ], "bp2_params": [ -2.749, -0.590, -0.264, -5.766, -10.304, -2.654 ], "groove_widths": [ 17.313, 15.883, 17.535, 14.594 ], "simple_Rise": 3.349, "simple_Twist": 37.530, "simple_hRise": 3.232, "simple_hTwist": 38.733 }, { "index": 5, "nt1": "///J/6", "nt2": "///J/57", "bp": "G-U", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -2.749, -0.590, -0.264, -5.766, -10.304, -2.654 ], "step_params": [ 0.080, -0.851, 3.205, -1.842, 5.080, 41.319 ], "heli_params": [ -1.714, -0.299, 3.078, 7.162, 2.597, 41.655 ], "bp2_params": [ 0.148, -0.014, -0.035, 2.202, -8.547, -0.301 ], "groove_widths": [ 17.344, null, 18.263, null ], "simple_Rise": 3.205, "simple_Twist": 26.352, "simple_hRise": 2.979, "simple_hTwist": 26.891 }, { "index": 6, "nt1": "///J/7", "nt2": "///J/56", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.148, -0.014, -0.035, 2.202, -8.547, -0.301 ], "step_params": [ 1.591, -2.256, 3.532, 2.022, 9.528, 23.810 ], "heli_params": [ -7.675, -3.024, 2.575, 21.952, -4.658, 25.699 ], "bp2_params": [ -0.691, 0.053, 0.140, -3.641, -17.674, 8.154 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.532, "simple_Twist": 27.927, "simple_hRise": 2.736, "simple_hTwist": 29.545 }, { "index": 7, "nt1": "///J/8", "nt2": "///J/55", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.691, 0.053, 0.140, -3.641, -17.674, 8.154 ], "step_params": [ -0.619, -1.664, 3.543, -0.059, -1.977, 33.703 ], "heli_params": [ -2.514, 1.056, 3.633, -3.407, 0.102, 33.759 ], "bp2_params": [ -0.147, 0.008, 0.175, -1.021, -12.044, 1.170 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.543, "simple_Twist": 31.079, "simple_hRise": 3.640, "simple_hTwist": 31.141 }, { "index": 8, "nt1": "///J/9", "nt2": "///J/54", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 2, "helix_index": 2, "strand1": "UGCG", "strand2": "ACGC", "bp_type": "||||", "helix_form": ".AA", "helical_rise": 2.802, "helical_rise_std": 0.256, "helical_radius": 10.080, "helical_radius_std": 0.772, "helical_axis": [ -0.786, 0.533, -0.312 ], "point1": [ 240.968, 317.612, 274.596 ], "point2": [ 234.324, 322.120, 271.961 ], "num_pairs": 4, "pairs": [ { "index": 1, "nt1": "///J/10", "nt2": "///J/44", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.059, -0.100, -0.003, -3.927, -6.367, 6.177 ], "step_params": [ -0.818, -1.689, 3.481, 3.324, 10.282, 30.368 ], "heli_params": [ -4.828, 2.052, 2.679, 18.892, -6.107, 32.191 ], "bp2_params": [ -0.234, -0.065, -0.521, -9.578, -9.756, -1.654 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.481, "simple_Twist": 30.186, "simple_hRise": 2.673, "simple_hTwist": 32.020 }, { "index": 2, "nt1": "///J/11", "nt2": "///J/43", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.234, -0.065, -0.521, -9.578, -9.756, -1.654 ], "step_params": [ 0.156, -1.050, 3.118, -3.394, 6.319, 31.198 ], "heli_params": [ -2.956, -0.847, 2.824, 11.558, 6.208, 31.991 ], "bp2_params": [ 0.147, -0.094, -0.082, 2.252, -11.382, -0.018 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.118, "simple_Twist": 30.120, "simple_hRise": 2.811, "simple_hTwist": 30.943 }, { "index": 3, "nt1": "///J/12", "nt2": "///J/42", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.147, -0.094, -0.082, 2.252, -11.382, -0.018 ], "step_params": [ 0.377, -2.143, 3.526, -0.176, 20.567, 29.567 ], "heli_params": [ -6.086, -0.634, 1.718, 35.414, 0.303, 35.886 ], "bp2_params": [ -0.191, -0.104, -0.006, -13.003, -21.911, -0.283 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.526, "simple_Twist": 30.432, "simple_hRise": 1.770, "simple_hTwist": 36.594 }, { "index": 4, "nt1": "///J/13", "nt2": "///J/41", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 3, "helix_index": 2, "strand1": "UUUGUUGCU", "strand2": "AAGCAGCGG", "bp_type": "|||||||||", "helix_form": "A..AA.A.", "helical_rise": 2.646, "helical_rise_std": 0.263, "helical_radius": 9.689, "helical_radius_std": 0.808, "helical_axis": [ -0.960, 0.004, -0.279 ], "point1": [ 228.692, 325.976, 266.080 ], "point2": [ 208.640, 326.061, 260.256 ], "num_pairs": 9, "pairs": [ { "index": 1, "nt1": "///J/17", "nt2": "///J/39", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.236, 0.025, 0.308, 7.106, -2.901, 0.733 ], "step_params": [ 0.034, -1.239, 3.272, 0.688, 4.590, 31.216 ], "heli_params": [ -3.109, 0.062, 3.063, 8.470, -1.269, 31.551 ], "bp2_params": [ -0.024, 0.109, -0.114, 11.900, -6.341, 2.204 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.272, "simple_Twist": 30.951, "simple_hRise": 3.061, "simple_hTwist": 31.288 }, { "index": 2, "nt1": "///J/18", "nt2": "///J/38", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.024, 0.109, -0.114, 11.900, -6.341, 2.204 ], "step_params": [ -0.080, -1.561, 3.589, -0.188, 4.389, 38.409 ], "heli_params": [ -2.937, 0.097, 3.397, 6.644, 0.285, 38.650 ], "bp2_params": [ 2.090, -0.321, -0.168, 7.894, -12.913, -0.630 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.589, "simple_Twist": 26.927, "simple_hRise": 3.298, "simple_hTwist": 27.276 }, { "index": 3, "nt1": "///J/19", "nt2": "///J/37", "bp": "U-G", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 2.090, -0.321, -0.168, 7.894, -12.913, -0.630 ], "step_params": [ -1.923, -1.803, 3.521, -5.250, 13.037, 26.197 ], "heli_params": [ -6.290, 2.639, 2.673, 26.476, 10.662, 29.670 ], "bp2_params": [ -0.242, -0.273, 0.037, -4.643, -9.152, -2.913 ], "groove_widths": [ 17.153, null, 16.280, null ], "simple_Rise": 3.521, "simple_Twist": 38.109, "simple_hRise": 3.000, "simple_hTwist": 40.528 }, { "index": 4, "nt1": "///J/20", "nt2": "///J/36", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.242, -0.273, 0.037, -4.643, -9.152, -2.913 ], "step_params": [ 0.253, -1.266, 3.319, -0.481, 7.363, 32.001 ], "heli_params": [ -3.469, -0.527, 2.959, 13.137, 0.858, 32.819 ], "bp2_params": [ -0.041, -0.166, -0.082, 0.022, -5.429, -2.091 ], "groove_widths": [ 17.891, 16.578, 16.665, 13.573 ], "simple_Rise": 3.319, "simple_Twist": 31.312, "simple_hRise": 2.949, "simple_hTwist": 32.149 }, { "index": 5, "nt1": "///J/21", "nt2": "///J/35", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.041, -0.166, -0.082, 0.022, -5.429, -2.091 ], "step_params": [ 0.490, -1.422, 3.202, 3.944, 6.188, 35.845 ], "heli_params": [ -3.078, -0.263, 2.959, 9.926, -6.327, 36.564 ], "bp2_params": [ 1.490, 0.011, -0.404, 6.956, -7.165, -0.773 ], "groove_widths": [ 17.653, 16.221, 17.129, 12.055 ], "simple_Rise": 3.202, "simple_Twist": 28.305, "simple_hRise": 2.873, "simple_hTwist": 29.221 }, { "index": 6, "nt1": "///J/22", "nt2": "///J/34", "bp": "U-G", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 1.490, 0.011, -0.404, 6.956, -7.165, -0.773 ], "step_params": [ -0.467, -2.322, 3.501, -2.204, 12.285, 20.467 ], "heli_params": [ -9.134, 0.491, 1.863, 31.116, 5.583, 23.938 ], "bp2_params": [ -0.247, -0.072, -0.087, -1.878, -7.526, 1.050 ], "groove_widths": [ 17.151, null, 17.622, null ], "simple_Rise": 3.501, "simple_Twist": 29.074, "simple_hRise": 2.377, "simple_hTwist": 31.586 }, { "index": 7, "nt1": "///J/23", "nt2": "///J/33", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.247, -0.072, -0.087, -1.878, -7.526, 1.050 ], "step_params": [ -0.014, -1.788, 3.325, -0.550, 1.248, 36.527 ], "heli_params": [ -3.025, -0.054, 3.264, 1.991, 0.878, 36.552 ], "bp2_params": [ 0.273, -0.158, -0.159, 1.577, -4.301, -1.708 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.325, "simple_Twist": 34.564, "simple_hRise": 3.261, "simple_hTwist": 34.590 }, { "index": 8, "nt1": "///J/24", "nt2": "///J/32", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.273, -0.158, -0.159, 1.577, -4.301, -1.708 ], "step_params": [ 0.644, -1.707, 3.334, 6.068, 1.268, 35.286 ], "heli_params": [ -2.963, -0.151, 3.334, 2.072, -9.916, 35.809 ], "bp2_params": [ 2.048, -0.201, -0.744, 4.018, 5.033, 0.993 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.334, "simple_Twist": 25.073, "simple_hRise": 3.306, "simple_hTwist": 25.817 }, { "index": 9, "nt1": "///J/25", "nt2": "///J/31", "bp": "U-G", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 4, "helix_index": 1, "strand1": "GGC", "strand2": "CCG", "bp_type": "|||", "helix_form": "AA", "helical_rise": 3.375, "helical_rise_std": 0.063, "helical_radius": 10.001, "helical_radius_std": 0.841, "helical_axis": [ -0.943, -0.300, 0.142 ], "point1": [ 252.484, 305.424, 280.885 ], "point2": [ 246.111, 303.400, 281.846 ], "num_pairs": 3, "pairs": [ { "index": 1, "nt1": "///J/46", "nt2": "///J/119", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.123, -0.223, -0.006, -0.790, -4.545, -0.378 ], "step_params": [ 0.252, -2.038, 3.464, 2.871, 4.205, 29.948 ], "heli_params": [ -4.753, 0.108, 3.164, 8.064, -5.505, 30.368 ], "bp2_params": [ -0.180, -0.107, -0.140, -3.796, -8.511, 0.350 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.464, "simple_Twist": 30.258, "simple_hRise": 3.168, "simple_hTwist": 30.674 }, { "index": 2, "nt1": "///J/47", "nt2": "///J/118", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.180, -0.107, -0.140, -3.796, -8.511, 0.350 ], "step_params": [ 0.133, -1.485, 3.407, 0.623, 0.965, 31.791 ], "heli_params": [ -2.893, -0.124, 3.364, 1.761, -1.137, 31.812 ], "bp2_params": [ 0.236, -0.107, -0.182, -0.215, -3.448, 1.415 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.407, "simple_Twist": 29.383, "simple_hRise": 3.360, "simple_hTwist": 29.405 }, { "index": 3, "nt1": "///J/48", "nt2": "///J/117", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 5, "helix_index": 1, "strand1": "AU", "strand2": "UA", "bp_type": "||", "helix_form": "A", "helical_rise": 2.651, "helical_rise_std": 0.010, "helical_radius": 8.907, "helical_radius_std": 0.896, "helical_axis": [ -0.992, -0.124, -0.011 ], "point1": [ 240.224, 303.252, 281.223 ], "point2": [ 237.592, 302.924, 281.194 ], "num_pairs": 2, "pairs": [ { "index": 1, "nt1": "///J/50", "nt2": "///J/115", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.128, -0.199, 0.467, -1.160, -4.221, -3.505 ], "step_params": [ 0.547, -1.537, 3.118, -0.972, 6.183, 30.528 ], "heli_params": [ -3.930, -1.187, 2.743, 11.590, 1.822, 31.148 ], "bp2_params": [ -0.057, -0.242, 0.663, 3.680, -2.838, 1.049 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.118, "simple_Twist": 31.391, "simple_hRise": 2.755, "simple_hTwist": 31.993 }, { "index": 2, "nt1": "///J/51", "nt2": "///J/114", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 6, "helix_index": 1, "strand1": "CGUCGCAAAC", "strand2": "GCGGCGUUUG", "bp_type": "||||||||||", "helix_form": "...AAAAA.", "helical_rise": 2.582, "helical_rise_std": 0.316, "helical_radius": 9.452, "helical_radius_std": 0.627, "helical_axis": [ 0.922, 0.263, -0.284 ], "point1": [ 256.380, 304.161, 281.175 ], "point2": [ 277.586, 310.200, 274.653 ], "num_pairs": 10, "pairs": [ { "index": 1, "nt1": "///J/120", "nt2": "///J/259", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.120, -0.607, 0.136, -0.389, -6.336, -3.527 ], "step_params": [ 1.087, -1.730, 3.211, -0.133, 9.960, 30.836 ], "heli_params": [ -4.689, -1.972, 2.539, 18.146, 0.241, 32.368 ], "bp2_params": [ -0.743, -0.302, 0.396, -1.931, -21.595, -2.682 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.211, "simple_Twist": 34.288, "simple_hRise": 2.619, "simple_hTwist": 35.663 }, { "index": 2, "nt1": "///J/121", "nt2": "///J/258", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.743, -0.302, 0.396, -1.931, -21.595, -2.682 ], "step_params": [ -0.835, -1.500, 3.477, -2.102, -0.642, 41.198 ], "heli_params": [ -2.054, 0.943, 3.535, -0.911, 2.984, 41.254 ], "bp2_params": [ 1.797, -0.288, 0.272, -2.686, -13.464, 0.532 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.477, "simple_Twist": 27.397, "simple_hRise": 3.563, "simple_hTwist": 27.483 }, { "index": 3, "nt1": "///J/122", "nt2": "///J/257", "bp": "U-G", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 1.797, -0.288, 0.272, -2.686, -13.464, 0.532 ], "step_params": [ 0.039, -1.663, 3.045, 0.305, 9.063, 25.961 ], "heli_params": [ -5.392, -0.019, 2.342, 19.434, -0.655, 27.473 ], "bp2_params": [ 0.027, -0.314, 0.374, -0.096, -4.457, 1.583 ], "groove_widths": [ 16.995, null, 16.546, null ], "simple_Rise": 3.045, "simple_Twist": 35.753, "simple_hRise": 2.562, "simple_hTwist": 36.849 }, { "index": 4, "nt1": "///J/123", "nt2": "///J/256", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.027, -0.314, 0.374, -0.096, -4.457, 1.583 ], "step_params": [ -0.162, -1.689, 3.037, -0.065, 16.044, 31.980 ], "heli_params": [ -4.648, 0.257, 1.992, 27.094, 0.109, 35.685 ], "bp2_params": [ -0.229, -0.196, 0.328, -4.167, -11.876, -3.492 ], "groove_widths": [ 17.858, 16.511, 15.607, 10.769 ], "simple_Rise": 3.037, "simple_Twist": 32.550, "simple_hRise": 2.012, "simple_hTwist": 36.193 }, { "index": 5, "nt1": "///J/124", "nt2": "///J/255", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.229, -0.196, 0.328, -4.167, -11.876, -3.492 ], "step_params": [ -0.139, -1.314, 3.303, -1.327, 8.629, 32.681 ], "heli_params": [ -3.602, 0.032, 2.876, 15.004, 2.308, 33.796 ], "bp2_params": [ 0.053, -0.219, 0.409, -1.878, -9.336, -5.004 ], "groove_widths": [ 18.183, 16.558, 15.476, 10.482 ], "simple_Rise": 3.303, "simple_Twist": 31.389, "simple_hRise": 2.854, "simple_hTwist": 32.551 }, { "index": 6, "nt1": "///J/125", "nt2": "///J/254", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.053, -0.219, 0.409, -1.878, -9.336, -5.004 ], "step_params": [ -0.049, -1.744, 3.147, 0.818, 17.637, 34.196 ], "heli_params": [ -4.511, 0.161, 2.037, 27.815, -1.290, 38.364 ], "bp2_params": [ -0.031, -0.123, 0.044, -5.170, -9.590, -0.907 ], "groove_widths": [ 17.882, 16.381, 15.448, 11.276 ], "simple_Rise": 3.147, "simple_Twist": 34.662, "simple_hRise": 2.054, "simple_hTwist": 38.776 }, { "index": 7, "nt1": "///J/126", "nt2": "///J/253", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.031, -0.123, 0.044, -5.170, -9.590, -0.907 ], "step_params": [ -0.404, -0.934, 3.276, -0.404, 5.610, 34.882 ], "heli_params": [ -2.352, 0.607, 3.097, 9.283, 0.668, 35.319 ], "bp2_params": [ -0.045, -0.078, -0.131, -2.313, -15.846, -0.726 ], "groove_widths": [ 17.258, null, 15.369, null ], "simple_Rise": 3.276, "simple_Twist": 35.214, "simple_hRise": 3.100, "simple_hTwist": 35.646 }, { "index": 8, "nt1": "///J/127", "nt2": "///J/252", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.045, -0.078, -0.131, -2.313, -15.846, -0.726 ], "step_params": [ -0.215, -0.721, 3.350, -1.144, 1.647, 32.808 ], "heli_params": [ -1.561, 0.181, 3.317, 2.913, 2.024, 32.867 ], "bp2_params": [ 0.081, -0.012, -0.144, -0.891, -16.137, -1.475 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.350, "simple_Twist": 32.284, "simple_hRise": 3.316, "simple_hTwist": 32.345 }, { "index": 9, "nt1": "///J/128", "nt2": "///J/251", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.081, -0.012, -0.144, -0.891, -16.137, -1.475 ], "step_params": [ 0.827, -1.612, 3.291, 0.707, 0.532, 31.664 ], "heli_params": [ -3.051, -1.383, 3.282, 0.975, -1.296, 31.676 ], "bp2_params": [ 0.259, -0.055, -0.013, 3.999, -15.297, -0.008 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.291, "simple_Twist": 31.039, "simple_hRise": 3.281, "simple_hTwist": 31.051 }, { "index": 10, "nt1": "///J/129", "nt2": "///J/250", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 7, "helix_index": 1, "strand1": "GUGUGC", "strand2": "UACGCG", "bp_type": "||||||", "helix_form": ".A...", "helical_rise": 2.315, "helical_rise_std": 0.269, "helical_radius": 8.811, "helical_radius_std": 0.316, "helical_axis": [ -0.378, -0.874, 0.306 ], "point1": [ 289.926, 327.273, 256.198 ], "point2": [ 285.662, 317.417, 259.652 ], "num_pairs": 6, "pairs": [ { "index": 1, "nt1": "///J/134", "nt2": "///J/290", "bp": "G-U", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -2.334, -0.340, -0.227, -4.033, -4.293, -3.656 ], "step_params": [ -0.395, -1.292, 3.383, -3.231, 2.922, 39.175 ], "heli_params": [ -2.270, 0.194, 3.303, 4.341, 4.801, 39.407 ], "bp2_params": [ 0.007, 0.025, -0.009, 1.300, -13.435, 2.155 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.383, "simple_Twist": 27.355, "simple_hRise": 3.254, "simple_hTwist": 27.693 }, { "index": 2, "nt1": "///J/135", "nt2": "///J/289", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.007, 0.025, -0.009, 1.300, -13.435, 2.155 ], "step_params": [ -0.550, -1.580, 3.588, -1.408, 13.553, 31.195 ], "heli_params": [ -4.887, 0.714, 2.710, 23.828, 2.476, 33.974 ], "bp2_params": [ -0.206, -0.112, -0.264, -10.004, -13.742, -1.880 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.588, "simple_Twist": 31.960, "simple_hRise": 2.735, "simple_hTwist": 34.674 }, { "index": 3, "nt1": "///J/136", "nt2": "///J/288", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.206, -0.112, -0.264, -10.004, -13.742, -1.880 ], "step_params": [ 0.233, -1.065, 3.387, -0.485, 5.878, 39.175 ], "heli_params": [ -2.269, -0.401, 3.198, 8.706, 0.718, 39.599 ], "bp2_params": [ 2.161, -0.044, -0.133, -5.402, -9.561, 3.664 ], "groove_widths": [ 18.059, null, 14.708, null ], "simple_Rise": 3.387, "simple_Twist": 26.908, "simple_hRise": 3.084, "simple_hTwist": 27.535 }, { "index": 4, "nt1": "///J/137", "nt2": "///J/287", "bp": "U-G", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 2.161, -0.044, -0.133, -5.402, -9.561, 3.664 ], "step_params": [ 0.304, -1.307, 3.160, 2.679, 16.697, 23.687 ], "heli_params": [ -5.736, -0.103, 1.874, 35.462, -5.690, 29.034 ], "bp2_params": [ -0.248, -0.069, -0.104, -3.251, -8.365, 0.729 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.160, "simple_Twist": 36.662, "simple_hRise": 2.384, "simple_hTwist": 40.252 }, { "index": 5, "nt1": "///J/138", "nt2": "///J/286", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.248, -0.069, -0.104, -3.251, -8.365, 0.729 ], "step_params": [ 1.364, -2.189, 3.388, 4.084, 4.685, 32.102 ], "heli_params": [ -4.712, -1.706, 3.190, 8.374, -7.300, 32.683 ], "bp2_params": [ 0.189, -0.076, -0.056, -2.644, -8.996, 2.645 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.388, "simple_Twist": 30.025, "simple_hRise": 3.172, "simple_hTwist": 30.647 }, { "index": 6, "nt1": "///J/139", "nt2": "///J/285", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 8, "helix_index": 5, "strand1": "GGUAGC", "strand2": "CCAUCG", "bp_type": "||||||", "helix_form": "AAAA.", "helical_rise": 2.725, "helical_rise_std": 0.174, "helical_radius": 9.485, "helical_radius_std": 1.169, "helical_axis": [ -0.299, 0.951, 0.076 ], "point1": [ 309.851, 304.226, 282.668 ], "point2": [ 305.805, 317.114, 283.695 ], "num_pairs": 6, "pairs": [ { "index": 1, "nt1": "///J/143", "nt2": "///J/157", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.208, -0.074, 0.102, -1.833, -9.616, -0.419 ], "step_params": [ -0.047, -1.842, 3.194, -4.301, 6.533, 32.460 ], "heli_params": [ -4.210, -0.578, 2.765, 11.480, 7.559, 33.364 ], "bp2_params": [ -0.927, 0.008, 0.187, -7.736, -0.188, 9.057 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.194, "simple_Twist": 36.664, "simple_hRise": 2.823, "simple_hTwist": 37.461 }, { "index": 2, "nt1": "///J/144", "nt2": "///J/156", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.927, 0.008, 0.187, -7.736, -0.188, 9.057 ], "step_params": [ -0.697, -1.461, 3.119, -1.390, 3.252, 35.604 ], "heli_params": [ -2.817, 0.947, 3.003, 5.302, 2.266, 35.774 ], "bp2_params": [ -0.073, -0.148, 0.247, -0.653, 1.912, 0.210 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.119, "simple_Twist": 31.100, "simple_hRise": 2.983, "simple_hTwist": 31.296 }, { "index": 3, "nt1": "///J/145", "nt2": "///J/155", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.073, -0.148, 0.247, -0.653, 1.912, 0.210 ], "step_params": [ 0.156, -1.482, 2.838, -0.426, 5.351, 30.541 ], "heli_params": [ -3.628, -0.360, 2.545, 10.060, 0.802, 30.998 ], "bp2_params": [ -0.025, -0.161, 0.069, 9.427, 6.771, 1.279 ], "groove_widths": [ 17.694, null, 16.516, null ], "simple_Rise": 2.838, "simple_Twist": 30.223, "simple_hRise": 2.541, "simple_hTwist": 30.685 }, { "index": 4, "nt1": "///J/146", "nt2": "///J/154", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.025, -0.161, 0.069, 9.427, 6.771, 1.279 ], "step_params": [ -0.318, -1.682, 3.613, 7.152, 13.965, 33.551 ], "heli_params": [ -4.542, 1.469, 2.614, 22.713, -11.633, 36.942 ], "bp2_params": [ -0.112, -0.444, -1.310, -2.311, -2.288, -4.541 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.613, "simple_Twist": 34.053, "simple_hRise": 2.631, "simple_hTwist": 37.397 }, { "index": 5, "nt1": "///J/147", "nt2": "///J/153", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.112, -0.444, -1.310, -2.311, -2.288, -4.541 ], "step_params": [ 1.657, -0.678, 2.932, 4.379, 2.648, 33.327 ], "heli_params": [ -1.565, -2.202, 3.058, 4.583, -7.580, 33.707 ], "bp2_params": [ 1.103, 0.325, -1.672, 14.604, -7.915, 26.995 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.932, "simple_Twist": 26.349, "simple_hRise": 3.080, "simple_hTwist": 26.833 }, { "index": 6, "nt1": "///J/148", "nt2": "///J/152", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 9, "helix_index": 5, "strand1": "UGCUA", "strand2": "ACGAU", "bp_type": "|||||", "helix_form": ".AAA", "helical_rise": 2.772, "helical_rise_std": 0.296, "helical_radius": 9.549, "helical_radius_std": 0.431, "helical_axis": [ 0.076, -0.997, 0.017 ], "point1": [ 313.028, 300.817, 282.328 ], "point2": [ 313.862, 289.832, 282.519 ], "num_pairs": 5, "pairs": [ { "index": 1, "nt1": "///J/158", "nt2": "///J/184", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.168, 0.667, 0.315, -6.657, -6.901, 3.052 ], "step_params": [ -0.212, -1.029, 3.168, -2.758, 16.841, 27.842 ], "heli_params": [ -4.453, -0.051, 2.215, 31.528, 5.163, 32.568 ], "bp2_params": [ -0.254, -0.118, -0.321, -2.600, -11.059, 4.551 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.168, "simple_Twist": 28.487, "simple_hRise": 2.241, "simple_hTwist": 33.117 }, { "index": 2, "nt1": "///J/159", "nt2": "///J/183", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.254, -0.118, -0.321, -2.600, -11.059, 4.551 ], "step_params": [ -0.657, -1.691, 3.341, -5.776, 2.124, 31.764 ], "heli_params": [ -3.421, 0.135, 3.289, 3.836, 10.431, 32.340 ], "bp2_params": [ 0.149, -0.155, -0.367, 1.503, -9.172, 4.579 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.341, "simple_Twist": 29.298, "simple_hRise": 3.280, "simple_hTwist": 29.924 }, { "index": 3, "nt1": "///J/160", "nt2": "///J/182", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.149, -0.155, -0.367, 1.503, -9.172, 4.579 ], "step_params": [ -0.628, -1.397, 3.549, -2.862, 5.197, 30.903 ], "heli_params": [ -3.608, 0.591, 3.319, 9.641, 5.310, 31.454 ], "bp2_params": [ -0.072, -0.155, -0.341, 0.169, -1.305, 1.566 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.549, "simple_Twist": 32.525, "simple_hRise": 3.334, "simple_hTwist": 33.048 }, { "index": 4, "nt1": "///J/161", "nt2": "///J/181", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.072, -0.155, -0.341, 0.169, -1.305, 1.566 ], "step_params": [ -0.182, -1.386, 3.777, 2.941, 11.841, 30.782 ], "heli_params": [ -4.596, 0.857, 3.023, 21.288, -5.287, 33.058 ], "bp2_params": [ 0.110, -0.142, -0.896, -10.973, -5.682, -1.132 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.777, "simple_Twist": 29.620, "simple_hRise": 2.986, "simple_hTwist": 31.982 }, { "index": 5, "nt1": "///J/162", "nt2": "///J/180", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 10, "helix_index": 5, "strand1": "GUC", "strand2": "UAG", "bp_type": "|||", "helix_form": ".A", "helical_rise": 2.238, "helical_rise_std": 0.101, "helical_radius": 9.109, "helical_radius_std": 1.252, "helical_axis": [ 0.470, -0.875, -0.115 ], "point1": [ 314.897, 278.608, 279.680 ], "point2": [ 316.939, 274.803, 279.180 ], "num_pairs": 3, "pairs": [ { "index": 1, "nt1": "///J/165", "nt2": "///J/177", "bp": "G-U", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -2.978, -0.573, -0.082, -2.937, 8.751, 15.103 ], "step_params": [ -0.953, -1.365, 3.151, 0.005, 4.693, 44.007 ], "heli_params": [ -2.225, 1.265, 2.997, 6.241, -0.006, 44.244 ], "bp2_params": [ -0.021, -0.204, -0.100, 1.505, 5.062, 5.830 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.151, "simple_Twist": 27.196, "simple_hRise": 2.878, "simple_hTwist": 27.590 }, { "index": 2, "nt1": "///J/166", "nt2": "///J/176", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.021, -0.204, -0.100, 1.505, 5.062, 5.830 ], "step_params": [ -0.221, -1.715, 3.031, 3.446, 9.055, 30.990 ], "heli_params": [ -4.426, 0.911, 2.409, 16.449, -6.260, 32.434 ], "bp2_params": [ 0.118, -0.159, -0.366, 5.930, 7.910, 2.952 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.031, "simple_Twist": 29.965, "simple_hRise": 2.384, "simple_hTwist": 31.458 }, { "index": 3, "nt1": "///J/167", "nt2": "///J/175", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 11, "helix_index": 4, "strand1": "AAGUCA", "strand2": "UUCGGU", "bp_type": "||||||", "helix_form": ".A..A", "helical_rise": 2.508, "helical_rise_std": 0.264, "helical_radius": 10.101, "helical_radius_std": 1.311, "helical_axis": [ 0.052, -0.532, -0.845 ], "point1": [ 305.870, 318.895, 269.469 ], "point2": [ 306.511, 312.295, 258.989 ], "num_pairs": 6, "pairs": [ { "index": 1, "nt1": "///J/185", "nt2": "///J/245", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.017, -0.149, -0.572, -5.645, 9.611, -8.694 ], "step_params": [ 0.756, -1.685, 3.755, -3.828, 5.854, 24.094 ], "heli_params": [ -5.735, -2.953, 3.109, 13.660, 8.933, 25.074 ], "bp2_params": [ 0.029, -0.056, -0.280, -5.443, -2.459, -0.366 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.755, "simple_Twist": 24.678, "simple_hRise": 3.127, "simple_hTwist": 25.635 }, { "index": 2, "nt1": "///J/186", "nt2": "///J/244", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.029, -0.056, -0.280, -5.443, -2.459, -0.366 ], "step_params": [ -0.536, -2.030, 3.346, -2.310, 10.558, 29.404 ], "heli_params": [ -5.614, 0.589, 2.518, 19.969, 4.369, 31.286 ], "bp2_params": [ -0.142, -0.054, -0.142, -4.461, -4.020, -3.072 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.346, "simple_Twist": 29.805, "simple_hRise": 2.531, "simple_hTwist": 31.662 }, { "index": 3, "nt1": "///J/187", "nt2": "///J/243", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.142, -0.054, -0.142, -4.461, -4.020, -3.072 ], "step_params": [ -0.134, -1.166, 3.240, 0.511, 6.295, 40.860 ], "heli_params": [ -2.303, 0.243, 3.033, 8.952, -0.727, 41.324 ], "bp2_params": [ 2.728, -0.583, 0.011, 5.311, -4.482, -4.300 ], "groove_widths": [ 17.693, null, 18.675, null ], "simple_Rise": 3.240, "simple_Twist": 26.103, "simple_hRise": 2.881, "simple_hTwist": 26.844 }, { "index": 4, "nt1": "///J/188", "nt2": "///J/242", "bp": "U-G", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 2.728, -0.583, 0.011, 5.311, -4.482, -4.300 ], "step_params": [ 0.108, -2.203, 2.995, 0.919, 11.170, 23.432 ], "heli_params": [ -7.278, -0.045, 1.778, 25.704, -2.114, 25.940 ], "bp2_params": [ 0.183, -0.131, 0.313, 4.814, -16.388, 4.432 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.995, "simple_Twist": 36.848, "simple_hRise": 2.259, "simple_hTwist": 38.458 }, { "index": 5, "nt1": "///J/189", "nt2": "///J/241", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.183, -0.131, 0.313, 4.814, -16.388, 4.432 ], "step_params": [ -0.366, -1.523, 3.414, 1.642, 12.943, 35.531 ], "heli_params": [ -3.963, 0.770, 2.697, 20.381, -2.585, 37.778 ], "bp2_params": [ 0.114, -0.061, 0.023, -5.457, -15.441, -6.013 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.414, "simple_Twist": 35.892, "simple_hRise": 2.706, "simple_hTwist": 38.116 }, { "index": 6, "nt1": "///J/190", "nt2": "///J/240", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 12, "helix_index": 6, "strand1": "GC", "strand2": "UG", "bp_type": "||", "helix_form": ".", "helical_rise": 3.015, "helical_rise_std": 0.016, "helical_radius": 10.309, "helical_radius_std": 2.345, "helical_axis": [ 0.538, -0.839, 0.083 ], "point1": [ 315.753, 280.431, 234.827 ], "point2": [ 317.374, 277.900, 235.077 ], "num_pairs": 2, "pairs": [ { "index": 1, "nt1": "///J/203", "nt2": "///J/228", "bp": "G-U", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -3.028, -0.578, 0.534, 10.203, 10.269, -3.664 ], "step_params": [ 0.340, -1.455, 3.135, 2.049, 3.924, 43.523 ], "heli_params": [ -2.306, -0.272, 3.012, 5.275, -2.755, 43.736 ], "bp2_params": [ 0.190, -0.081, -0.188, 18.124, -0.527, -0.145 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.135, "simple_Twist": 27.048, "simple_hRise": 2.916, "simple_hTwist": 27.402 }, { "index": 2, "nt1": "///J/204", "nt2": "///J/227", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 13, "helix_index": 6, "strand1": "AGACC", "strand2": "UUUGG", "bp_type": "|||||", "helix_form": "...A", "helical_rise": 3.295, "helical_rise_std": 0.249, "helical_radius": 10.235, "helical_radius_std": 0.569, "helical_axis": [ 0.232, -0.931, -0.282 ], "point1": [ 319.800, 274.214, 236.610 ], "point2": [ 322.882, 261.824, 232.852 ], "num_pairs": 5, "pairs": [ { "index": 1, "nt1": "///J/207", "nt2": "///J/224", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.048, -0.174, -0.183, -11.544, 5.493, 7.852 ], "step_params": [ 0.195, -2.181, 3.121, 1.479, 18.763, 20.828 ], "heli_params": [ -7.657, -0.155, 0.896, 42.387, -3.342, 28.002 ], "bp2_params": [ -2.265, -0.454, -0.452, -10.674, -8.275, -6.697 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.121, "simple_Twist": 31.919, "simple_hRise": 1.638, "simple_hTwist": 36.930 }, { "index": 2, "nt1": "///J/208", "nt2": "///J/223", "bp": "G-U", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -2.265, -0.454, -0.452, -10.674, -8.275, -6.697 ], "step_params": [ -0.197, -1.509, 3.399, 0.015, 2.001, 39.867 ], "heli_params": [ -2.447, 0.291, 3.322, 2.932, -0.022, 39.915 ], "bp2_params": [ 0.614, 0.852, -0.727, -5.450, -0.008, -0.533 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.399, "simple_Twist": 25.412, "simple_hRise": 3.272, "simple_hTwist": 25.490 }, { "index": 3, "nt1": "///J/209", "nt2": "///J/222", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.614, 0.852, -0.727, -5.450, -0.008, -0.533 ], "step_params": [ 0.562, -1.963, 3.082, 0.176, -0.063, 26.959 ], "heli_params": [ -4.196, -1.164, 3.090, -0.136, -0.377, 26.960 ], "bp2_params": [ 0.239, -0.069, -0.452, 6.523, -5.612, 1.807 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.082, "simple_Twist": 28.930, "simple_hRise": 3.089, "simple_hTwist": 28.931 }, { "index": 4, "nt1": "///J/210", "nt2": "///J/221", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.239, -0.069, -0.452, 6.523, -5.612, 1.807 ], "step_params": [ -0.652, -2.399, 3.742, -5.380, 0.871, 27.528 ], "heli_params": [ -5.185, -0.117, 3.723, 1.807, 11.168, 28.052 ], "bp2_params": [ 0.135, -0.058, 0.240, -0.382, 0.942, 1.484 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.742, "simple_Twist": 27.829, "simple_hRise": 3.724, "simple_hTwist": 28.347 }, { "index": 5, "nt1": "///J/211", "nt2": "///J/220", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 14, "helix_index": 8, "strand1": "GUUAG", "strand2": "CAAUC", "bp_type": "|||||", "helix_form": ".AAA", "helical_rise": 2.681, "helical_rise_std": 0.314, "helical_radius": 9.649, "helical_radius_std": 0.830, "helical_axis": [ -0.834, -0.120, 0.538 ], "point1": [ 276.887, 333.585, 271.483 ], "point2": [ 268.031, 332.309, 277.195 ], "num_pairs": 5, "pairs": [ { "index": 1, "nt1": "///J/269", "nt2": "///J/283", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.334, -0.101, 0.170, -2.989, -18.383, 3.266 ], "step_params": [ -0.898, -1.646, 3.365, -0.068, 5.877, 33.386 ], "heli_params": [ -3.756, 1.530, 3.042, 10.132, 0.117, 33.885 ], "bp2_params": [ -0.229, 0.033, -0.022, -7.328, -15.690, -4.156 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.365, "simple_Twist": 33.200, "simple_hRise": 3.039, "simple_hTwist": 33.702 }, { "index": 2, "nt1": "///J/270", "nt2": "///J/282", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.229, 0.033, -0.022, -7.328, -15.690, -4.156 ], "step_params": [ 0.380, -1.127, 3.212, 0.586, 4.973, 31.470 ], "heli_params": [ -2.921, -0.590, 3.009, 9.096, -1.072, 31.856 ], "bp2_params": [ -0.011, -0.036, -0.028, -0.532, -11.376, -4.140 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.212, "simple_Twist": 30.254, "simple_hRise": 2.999, "simple_hTwist": 30.656 }, { "index": 3, "nt1": "///J/271", "nt2": "///J/281", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.011, -0.036, -0.028, -0.532, -11.376, -4.140 ], "step_params": [ 0.448, -1.650, 3.188, 1.131, 9.719, 28.782 ], "heli_params": [ -4.903, -0.651, 2.525, 18.877, -2.197, 30.366 ], "bp2_params": [ 0.160, -0.023, 0.149, 2.415, -4.945, -4.968 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.188, "simple_Twist": 27.874, "simple_hRise": 2.499, "simple_hTwist": 29.509 }, { "index": 4, "nt1": "///J/272", "nt2": "///J/280", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.160, -0.023, 0.149, 2.415, -4.945, -4.968 ], "step_params": [ 0.853, -2.191, 3.495, 0.885, 2.143, 31.160 ], "heli_params": [ -4.495, -1.409, 3.363, 3.983, -1.645, 31.244 ], "bp2_params": [ -0.016, -0.357, 0.413, -7.103, -10.117, -0.019 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.495, "simple_Twist": 32.077, "simple_hRise": 3.367, "simple_hTwist": 32.159 }, { "index": 5, "nt1": "///J/273", "nt2": "///J/279", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 15, "helix_index": 9, "strand1": "GGUUGU", "strand2": "UCAACA", "bp_type": "||||||", "helix_form": ".AAA.", "helical_rise": 2.648, "helical_rise_std": 0.242, "helical_radius": 8.946, "helical_radius_std": 0.533, "helical_axis": [ -0.931, 0.328, -0.159 ], "point1": [ 294.162, 325.871, 237.636 ], "point2": [ 282.104, 330.123, 235.580 ], "num_pairs": 6, "pairs": [ { "index": 1, "nt1": "///J/291", "nt2": "///J/353", "bp": "G-U", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -2.969, -0.662, 0.054, 5.546, -3.589, 0.780 ], "step_params": [ -1.013, -1.381, 3.376, -7.072, 2.511, 45.387 ], "heli_params": [ -1.995, 0.661, 3.412, 3.229, 9.091, 45.970 ], "bp2_params": [ -0.198, -0.158, 0.201, 0.368, -5.626, -1.946 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.376, "simple_Twist": 29.911, "simple_hRise": 3.396, "simple_hTwist": 30.817 }, { "index": 2, "nt1": "///J/292", "nt2": "///J/352", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.198, -0.158, 0.201, 0.368, -5.626, -1.946 ], "step_params": [ -0.425, -1.561, 3.323, -3.277, 6.074, 33.968 ], "heli_params": [ -3.539, 0.220, 3.034, 10.266, 5.539, 34.642 ], "bp2_params": [ -0.143, -0.132, 0.205, -0.635, -8.735, -1.249 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.323, "simple_Twist": 33.675, "simple_hRise": 3.030, "simple_hTwist": 34.355 }, { "index": 3, "nt1": "///J/293", "nt2": "///J/351", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.143, -0.132, 0.205, -0.635, -8.735, -1.249 ], "step_params": [ 0.163, -1.150, 3.332, -2.159, 3.072, 33.668 ], "heli_params": [ -2.469, -0.628, 3.201, 5.283, 3.713, 33.870 ], "bp2_params": [ -0.016, -0.217, 0.275, 3.214, -7.948, -0.726 ], "groove_widths": [ 17.389, null, 14.394, null ], "simple_Rise": 3.332, "simple_Twist": 33.561, "simple_hRise": 3.201, "simple_hTwist": 33.764 }, { "index": 4, "nt1": "///J/294", "nt2": "///J/350", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.016, -0.217, 0.275, 3.214, -7.948, -0.726 ], "step_params": [ 0.719, -1.553, 3.392, 2.988, 11.037, 30.707 ], "heli_params": [ -4.604, -0.775, 2.742, 19.992, -5.412, 32.719 ], "bp2_params": [ -0.227, -0.159, -0.065, -1.551, -14.974, 3.757 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.392, "simple_Twist": 31.508, "simple_hRise": 2.762, "simple_hTwist": 33.469 }, { "index": 5, "nt1": "///J/295", "nt2": "///J/349", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.227, -0.159, -0.065, -1.551, -14.974, 3.757 ], "step_params": [ -0.870, -1.678, 3.477, -1.054, 2.543, 37.574 ], "heli_params": [ -2.944, 1.203, 3.382, 3.942, 1.634, 37.671 ], "bp2_params": [ -0.142, 0.097, -0.264, -6.982, -12.795, -4.925 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.477, "simple_Twist": 37.145, "simple_hRise": 3.381, "simple_hTwist": 37.243 }, { "index": 6, "nt1": "///J/296", "nt2": "///J/348", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 16, "helix_index": 9, "strand1": "ACUUGAA", "strand2": "UGAGUUU", "bp_type": "|||||||", "helix_form": ".....A", "helical_rise": 2.682, "helical_rise_std": 0.257, "helical_radius": 9.881, "helical_radius_std": 0.590, "helical_axis": [ -0.959, 0.159, -0.236 ], "point1": [ 275.449, 331.241, 233.709 ], "point2": [ 260.051, 333.790, 229.919 ], "num_pairs": 7, "pairs": [ { "index": 1, "nt1": "///J/298", "nt2": "///J/315", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.303, 0.136, -0.272, -5.559, -6.389, -4.599 ], "step_params": [ 1.243, -1.597, 3.285, -3.585, 6.495, 33.417 ], "heli_params": [ -3.678, -2.646, 2.790, 11.125, 6.140, 34.207 ], "bp2_params": [ 0.205, -0.112, 0.516, -4.448, -10.632, 5.850 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.285, "simple_Twist": 33.816, "simple_hRise": 2.797, "simple_hTwist": 34.597 }, { "index": 2, "nt1": "///J/299", "nt2": "///J/314", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.205, -0.112, 0.516, -4.448, -10.632, 5.850 ], "step_params": [ -1.228, -2.373, 3.143, 0.446, 7.772, 28.442 ], "heli_params": [ -6.098, 2.497, 2.405, 15.456, -0.887, 29.467 ], "bp2_params": [ -0.168, 0.006, 0.160, -6.362, -10.467, -2.773 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.143, "simple_Twist": 29.854, "simple_hRise": 2.444, "simple_hTwist": 30.830 }, { "index": 3, "nt1": "///J/300", "nt2": "///J/313", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.168, 0.006, 0.160, -6.362, -10.467, -2.773 ], "step_params": [ 0.024, -1.261, 3.258, 1.500, 4.876, 40.857 ], "heli_params": [ -2.308, 0.125, 3.093, 6.952, -2.138, 41.161 ], "bp2_params": [ 2.295, -0.517, 0.282, -1.789, -7.288, -7.887 ], "groove_widths": [ 17.242, null, 17.047, null ], "simple_Rise": 3.258, "simple_Twist": 28.139, "simple_hRise": 2.998, "simple_hTwist": 28.589 }, { "index": 4, "nt1": "///J/301", "nt2": "///J/312", "bp": "U-G", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 2.295, -0.517, 0.282, -1.789, -7.288, -7.887 ], "step_params": [ 0.866, -2.624, 3.042, 5.203, 11.444, 13.336 ], "heli_params": [ -12.626, -0.730, 0.832, 39.590, -17.998, 18.308 ], "bp2_params": [ -2.413, -0.581, -0.091, -3.551, -7.333, -5.619 ], "groove_widths": [ 17.120, null, 18.096, null ], "simple_Rise": 3.042, "simple_Twist": 38.301, "simple_hRise": 2.290, "simple_hTwist": 40.237 }, { "index": 5, "nt1": "///J/302", "nt2": "///J/311", "bp": "G-U", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -2.413, -0.581, -0.091, -3.551, -7.333, -5.619 ], "step_params": [ -0.082, -1.718, 3.509, -0.840, 5.284, 40.716 ], "heli_params": [ -3.048, 0.022, 3.271, 7.555, 1.201, 41.051 ], "bp2_params": [ 0.084, 0.009, -0.228, -6.966, -6.484, -2.201 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.509, "simple_Twist": 27.488, "simple_hRise": 3.131, "simple_hTwist": 27.994 }, { "index": 6, "nt1": "///J/303", "nt2": "///J/310", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.084, 0.009, -0.228, -6.966, -6.484, -2.201 ], "step_params": [ 0.005, -1.875, 3.243, 0.091, 6.238, 28.303 ], "heli_params": [ -5.032, 0.010, 2.774, 12.565, -0.184, 28.969 ], "bp2_params": [ 0.087, -0.042, -0.220, -2.015, -1.029, -1.982 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.243, "simple_Twist": 28.549, "simple_hRise": 2.779, "simple_hTwist": 29.209 }, { "index": 7, "nt1": "///J/304", "nt2": "///J/309", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 17, "helix_index": 3, "strand1": "GGA", "strand2": "UCU", "bp_type": "|||", "helix_form": ".A", "helical_rise": 2.850, "helical_rise_std": 0.068, "helical_radius": 9.571, "helical_radius_std": 0.683, "helical_axis": [ -0.914, -0.406, -0.000 ], "point1": [ 276.226, 339.724, 253.163 ], "point2": [ 271.050, 337.422, 253.160 ], "num_pairs": 3, "pairs": [ { "index": 1, "nt1": "///J/316", "nt2": "///J/370", "bp": "G-U", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -2.392, -0.350, -0.272, -3.355, 1.234, 6.704 ], "step_params": [ -0.296, -1.455, 3.464, -0.865, 5.206, 36.638 ], "heli_params": [ -3.013, 0.346, 3.240, 8.229, 1.367, 37.003 ], "bp2_params": [ -0.198, 0.026, -0.269, -1.763, -2.787, 1.533 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.464, "simple_Twist": 24.138, "simple_hRise": 3.095, "simple_hTwist": 24.700 }, { "index": 2, "nt1": "///J/317", "nt2": "///J/369", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.198, 0.026, -0.269, -1.763, -2.787, 1.533 ], "step_params": [ -0.306, -1.679, 3.432, 0.416, 9.537, 34.048 ], "heli_params": [ -4.151, 0.565, 2.868, 15.902, -0.694, 35.323 ], "bp2_params": [ 0.179, 0.014, -0.351, -4.881, -3.677, -3.529 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.432, "simple_Twist": 32.339, "simple_hRise": 2.832, "simple_hTwist": 33.682 }, { "index": 3, "nt1": "///J/318", "nt2": "///J/368", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 18, "helix_index": 3, "strand1": "AAAACU", "strand2": "UUUUGG", "bp_type": "||||||", "helix_form": "AAAA.", "helical_rise": 3.135, "helical_rise_std": 0.075, "helical_radius": 9.220, "helical_radius_std": 0.402, "helical_axis": [ -0.981, -0.193, -0.026 ], "point1": [ 258.797, 330.605, 256.440 ], "point2": [ 243.456, 327.589, 256.036 ], "num_pairs": 6, "pairs": [ { "index": 1, "nt1": "///J/322", "nt2": "///J/342", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.086, -0.179, 0.051, -2.686, -5.825, 1.497 ], "step_params": [ -0.371, -1.659, 3.302, 1.074, 5.686, 32.485 ], "heli_params": [ -3.855, 0.829, 2.964, 10.064, -1.901, 32.982 ], "bp2_params": [ 0.154, -0.243, -0.029, -2.622, -8.286, -3.739 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.302, "simple_Twist": 31.978, "simple_hRise": 2.957, "simple_hTwist": 32.484 }, { "index": 2, "nt1": "///J/323", "nt2": "///J/341", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.154, -0.243, -0.029, -2.622, -8.286, -3.739 ], "step_params": [ -0.042, -1.249, 3.379, 0.351, 7.086, 33.685 ], "heli_params": [ -3.211, 0.126, 3.060, 12.061, -0.597, 34.402 ], "bp2_params": [ 0.012, -0.106, -0.016, -5.656, -12.361, -2.419 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.379, "simple_Twist": 33.984, "simple_hRise": 3.064, "simple_hTwist": 34.695 }, { "index": 3, "nt1": "///J/324", "nt2": "///J/340", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.012, -0.106, -0.016, -5.656, -12.361, -2.419 ], "step_params": [ -0.315, -0.969, 3.224, -2.771, 1.295, 33.462 ], "heli_params": [ -1.885, 0.099, 3.200, 2.243, 4.800, 33.597 ], "bp2_params": [ 0.108, -0.110, 0.124, -0.602, -10.707, -3.228 ], "groove_widths": [ 16.566, null, 14.981, null ], "simple_Rise": 3.224, "simple_Twist": 33.041, "simple_hRise": 3.200, "simple_hTwist": 33.178 }, { "index": 4, "nt1": "///J/325", "nt2": "///J/339", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.108, -0.110, 0.124, -0.602, -10.707, -3.228 ], "step_params": [ 0.405, -1.548, 3.317, 1.031, 1.731, 31.838 ], "heli_params": [ -3.133, -0.550, 3.241, 3.151, -1.877, 31.900 ], "bp2_params": [ 0.279, -0.162, 0.095, 2.319, -10.169, 0.176 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.317, "simple_Twist": 30.918, "simple_hRise": 3.239, "simple_hTwist": 30.982 }, { "index": 5, "nt1": "///J/326", "nt2": "///J/338", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.279, -0.162, 0.095, 2.319, -10.169, 0.176 ], "step_params": [ -0.497, -1.239, 3.464, 2.837, 3.433, 43.114 ], "heli_params": [ -2.025, 0.960, 3.323, 4.657, -3.848, 43.333 ], "bp2_params": [ 2.376, -0.735, -0.148, -1.026, -9.056, -8.181 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.464, "simple_Twist": 32.863, "simple_hRise": 3.268, "simple_hTwist": 33.155 }, { "index": 6, "nt1": "///J/327", "nt2": "///J/337", "bp": "U-G", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 19, "helix_index": 3, "strand1": "CGU", "strand2": "GCG", "bp_type": "|||", "helix_form": "A.", "helical_rise": 3.136, "helical_rise_std": 0.184, "helical_radius": 9.893, "helical_radius_std": 1.068, "helical_axis": [ -0.968, -0.194, 0.160 ], "point1": [ 293.903, 340.432, 254.779 ], "point2": [ 287.763, 339.203, 255.797 ], "num_pairs": 3, "pairs": [ { "index": 1, "nt1": "///J/361", "nt2": "///J/375", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.138, -0.239, 0.239, 4.530, -11.022, -1.039 ], "step_params": [ -0.034, -1.801, 3.363, 1.988, 15.480, 29.521 ], "heli_params": [ -5.463, 0.357, 2.169, 28.045, -3.602, 33.312 ], "bp2_params": [ -0.167, -0.145, -0.470, 2.706, -1.004, 0.802 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.363, "simple_Twist": 31.737, "simple_hRise": 2.262, "simple_hTwist": 35.278 }, { "index": 2, "nt1": "///J/362", "nt2": "///J/374", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.167, -0.145, -0.470, 2.706, -1.004, 0.802 ], "step_params": [ -0.438, -1.574, 3.519, -1.269, 3.197, 37.366 ], "heli_params": [ -2.890, 0.506, 3.390, 4.977, 1.976, 37.518 ], "bp2_params": [ 1.422, -0.539, -0.449, 3.457, -6.960, -7.969 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.519, "simple_Twist": 28.941, "simple_hRise": 3.345, "simple_hTwist": 29.140 }, { "index": 3, "nt1": "///J/363", "nt2": "///J/373", "bp": "U-G", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W" } ] } ], "num_isoCanonPairs": 4, "isoCanonPairs": [ { "index": -1, "helix_index": 1, "nt1": "///J/53", "nt2": "///J/111", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" }, { "index": -2, "helix_index": 4, "nt1": "///J/198", "nt2": "///J/233", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W" }, { "index": -3, "helix_index": 6, "nt1": "///J/213", "nt2": "///J/218", "bp": "U-G", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W" }, { "index": -4, "helix_index": 7, "nt1": "///J/264", "nt2": "///J/274", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ], "num_coaxStacks": 6, "coaxStacks": [ { "index": 1, "helix_index": 1, "num_stems": 5, "stem_indices": [ 1, 5, 4, 6, 7 ] }, { "index": 2, "helix_index": 2, "num_stems": 2, "stem_indices": [ 2, 3 ] }, { "index": 3, "helix_index": 3, "num_stems": 3, "stem_indices": [ 18, 17, 19 ] }, { "index": 4, "helix_index": 5, "num_stems": 3, "stem_indices": [ 8, 9, 10 ] }, { "index": 5, "helix_index": 6, "num_stems": 2, "stem_indices": [ 12, 13 ] }, { "index": 6, "helix_index": 9, "num_stems": 2, "stem_indices": [ 15, 16 ] } ], "num_stacks": 57, "stacks": [ { "index": 1, "num_nts": 2, "nts_short": "AG", "nts_long": "///J/1,///J/2" }, { "index": 2, "num_nts": 2, "nts_short": "GC", "nts_long": "///J/13,///J/14" }, { "index": 3, "num_nts": 2, "nts_short": "UC", "nts_long": "///J/25,///J/26" }, { "index": 4, "num_nts": 2, "nts_short": "AA", "nts_long": "///J/44,///J/45" }, { "index": 5, "num_nts": 2, "nts_short": "GG", "nts_long": "///J/46,///J/259" }, { "index": 6, "num_nts": 2, "nts_short": "CC", "nts_long": "///J/119,///J/120" }, { "index": 7, "num_nts": 2, "nts_short": "CG", "nts_long": "///J/129,///J/130" }, { "index": 8, "num_nts": 2, "nts_short": "CA", "nts_long": "///J/148,///J/150" }, { "index": 9, "num_nts": 2, "nts_short": "GA", "nts_long": "///J/151,///J/185" }, { "index": 10, "num_nts": 2, "nts_short": "CU", "nts_long": "///J/157,///J/158" }, { "index": 11, "num_nts": 2, "nts_short": "UC", "nts_long": "///J/168,///J/169" }, { "index": 12, "num_nts": 2, "nts_short": "CU", "nts_long": "///J/204,///J/205" }, { "index": 13, "num_nts": 2, "nts_short": "UU", "nts_long": "///J/212,///J/213" }, { "index": 14, "num_nts": 2, "nts_short": "UU", "nts_long": "///J/224,///J/225" }, { "index": 15, "num_nts": 2, "nts_short": "UA", "nts_long": "///J/260,///J/262" }, { "index": 16, "num_nts": 2, "nts_short": "GC", "nts_long": "///J/273,///J/274" }, { "index": 17, "num_nts": 2, "nts_short": "CC", "nts_long": "///J/283,///J/284" }, { "index": 18, "num_nts": 2, "nts_short": "GG", "nts_long": "///J/291,///J/354" }, { "index": 19, "num_nts": 2, "nts_short": "AG", "nts_long": "///J/304,///J/305" }, { "index": 20, "num_nts": 2, "nts_short": "GC", "nts_long": "///J/316,///J/371" }, { "index": 21, "num_nts": 2, "nts_short": "AC", "nts_long": "///J/355,///J/356" }, { "index": 22, "num_nts": 2, "nts_short": "AA", "nts_long": "///J/358,///J/359" }, { "index": 23, "num_nts": 2, "nts_short": "AC", "nts_long": "///J/360,///J/361" }, { "index": 24, "num_nts": 2, "nts_short": "GU", "nts_long": "///J/375,///J/376" }, { "index": 25, "num_nts": 3, "nts_short": "AAG", "nts_long": "///J/29,///J/30,///J/31" }, { "index": 26, "num_nts": 3, "nts_short": "AAC", "nts_long": "///J/39,///J/40,///J/41" }, { "index": 27, "num_nts": 3, "nts_short": "CAA", "nts_long": "///J/48,///J/49,///J/50" }, { "index": 28, "num_nts": 3, "nts_short": "CGA", "nts_long": "///J/53,///J/52,///J/114" }, { "index": 29, "num_nts": 3, "nts_short": "AGC", "nts_long": "///J/54,///J/111,///J/113" }, { "index": 30, "num_nts": 3, "nts_short": "AAA", "nts_long": "///J/102,///J/103,///J/104" }, { "index": 31, "num_nts": 3, "nts_short": "UUG", "nts_long": "///J/115,///J/116,///J/117" }, { "index": 32, "num_nts": 3, "nts_short": "AGG", "nts_long": "///J/133,///J/268,///J/269" }, { "index": 33, "num_nts": 3, "nts_short": "CUG", "nts_long": "///J/139,///J/140,///J/247" }, { "index": 34, "num_nts": 3, "nts_short": "AGC", "nts_long": "///J/215,///J/216,///J/217" }, { "index": 35, "num_nts": 3, "nts_short": "AAU", "nts_long": "///J/238,///J/239,///J/240" }, { "index": 36, "num_nts": 3, "nts_short": "UUA", "nts_long": "///J/296,///J/297,///J/298" }, { "index": 37, "num_nts": 3, "nts_short": "GGA", "nts_long": "///J/306,///J/307,///J/308" }, { "index": 38, "num_nts": 3, "nts_short": "GAG", "nts_long": "///J/347,///J/372,///J/373" }, { "index": 39, "num_nts": 4, "nts_short": "AGAU", "nts_long": "///J/162,///J/163,///J/178,///J/177" }, { "index": 40, "num_nts": 4, "nts_short": "GAAU", "nts_long": "///J/165,///J/164,///J/179,///J/180" }, { "index": 41, "num_nts": 4, "nts_short": "AUCG", "nts_long": "///J/207,///J/206,///J/226,///J/227" }, { "index": 42, "num_nts": 4, "nts_short": "UGGG", "nts_long": "///J/214,///J/218,///J/219,///J/220" }, { "index": 43, "num_nts": 4, "nts_short": "AUAC", "nts_long": "///J/276,///J/277,///J/278,///J/279" }, { "index": 44, "num_nts": 4, "nts_short": "UAAA", "nts_long": "///J/327,///J/335,///J/328,///J/329" }, { "index": 45, "num_nts": 4, "nts_short": "AUAA", "nts_long": "///J/345,///J/315,///J/346,///J/348" }, { "index": 46, "num_nts": 4, "nts_short": "UGUA", "nts_long": "///J/363,///J/364,///J/365,///J/366" }, { "index": 47, "num_nts": 5, "nts_short": "UUAAG", "nts_long": "///J/17,///J/16,///J/15,///J/336,///J/337" }, { "index": 48, "num_nts": 5, "nts_short": "GAUAG", "nts_long": "///J/250,///J/249,///J/248,///J/131,///J/285" }, { "index": 49, "num_nts": 5, "nts_short": "AUAGU", "nts_long": "///J/318,///J/319,///J/344,///J/343,///J/342" }, { "index": 50, "num_nts": 5, "nts_short": "AAAAU", "nts_long": "///J/322,///J/321,///J/320,///J/367,///J/368" }, { "index": 51, "num_nts": 5, "nts_short": "AACAU", "nts_long": "///J/330,///J/331,///J/332,///J/333,///J/334" }, { "index": 52, "num_nts": 6, "nts_short": "GCAAAA", "nts_long": "///J/105,///J/106,///J/107,///J/108,///J/109,///J/110" }, { "index": 53, "num_nts": 6, "nts_short": "GCAAGG", "nts_long": "///J/170,///J/171,///J/172,///J/173,///J/174,///J/175" }, { "index": 54, "num_nts": 6, "nts_short": "GACAAU", "nts_long": "///J/203,///J/202,///J/201,///J/230,///J/231,///J/232" }, { "index": 55, "num_nts": 6, "nts_short": "AGGAGU", "nts_long": "///J/261,///J/275,///J/264,///J/265,///J/266,///J/267" }, { "index": 56, "num_nts": 8, "nts_short": "AAAGAUGU", "nts_long": "///J/190,///J/191,///J/192,///J/193,///J/194,///J/196,///J/234,///J/233" }, { "index": 57, "num_nts": 9, "nts_short": "UUGAAAAAA", "nts_long": "///J/228,///J/229,///J/200,///J/199,///J/198,///J/197,///J/235,///J/236,///J/237" } ], "nonStack": { "num_nts": 9, "nts_short": "UAAUUCUAU", "nts_long": "///J/10,///J/27,///J/28,///J/112,///J/141,///J/142,///J/149,///J/246,///J/357" }, "num_atom2bases": 19, "atom2bases": [ { "index": 1, "type": "sugar", "atom": "///J/29/O4'", "nt": "///J/30", "vert_dist": 3.372 }, { "index": 2, "type": "phosphate", "atom": "///J/47/OP1", "nt": "///J/45", "vert_dist": 3.212 }, { "index": 3, "type": "sugar", "atom": "///J/9/O4'", "nt": "///J/110", "vert_dist": 3.218 }, { "index": 4, "type": "sugar", "atom": "///J/284/O4'", "nt": "///J/132", "vert_dist": 3.477 }, { "index": 5, "type": "sugar", "atom": "///J/150/O2'", "nt": "///J/152", "vert_dist": 2.864 }, { "index": 6, "type": "sugar", "atom": "///J/171/O4'", "nt": "///J/170", "vert_dist": 3.471 }, { "index": 7, "type": "sugar", "atom": "///J/218/O4'", "nt": "///J/217", "vert_dist": 3.332 }, { "index": 8, "type": "sugar", "atom": "///J/140/O4'", "nt": "///J/246", "vert_dist": 3.279 }, { "index": 9, "type": "sugar", "atom": "///J/122/O4'", "nt": "///J/262", "vert_dist": 3.282 }, { "index": 10, "type": "sugar", "atom": "///J/261/O4'", "nt": "///J/263", "vert_dist": 3.360 }, { "index": 11, "type": "phosphate", "atom": "///J/269/OP2", "nt": "///J/267", "vert_dist": 3.230 }, { "index": 12, "type": "phosphate", "atom": "///J/307/OP2", "nt": "///J/305", "vert_dist": 3.211 }, { "index": 13, "type": "sugar", "atom": "///J/316/O4'", "nt": "///J/347", "vert_dist": 2.986 }, { "index": 14, "type": "sugar", "atom": "///J/355/O4'", "nt": "///J/354", "vert_dist": 3.424 }, { "index": 15, "type": "sugar", "atom": "///J/356/O2'", "nt": "///J/357", "vert_dist": 2.923 }, { "index": 16, "type": "phosphate", "atom": "///J/358/OP2", "nt": "///J/358", "vert_dist": 3.409 }, { "index": 17, "type": "sugar", "atom": "///J/358/O2'", "nt": "///J/359", "vert_dist": 2.951 }, { "index": 18, "type": "phosphate", "atom": "///J/359/OP1", "nt": "///J/360", "vert_dist": 3.145 }, { "index": 19, "type": "sugar", "atom": "///J/365/O4'", "nt": "///J/366", "vert_dist": 3.323 } ], "num_hairpins": 9, "hairpins": [ { "index": 1, "type": "hairpin loop", "bridging_nts": [ 5 ], "stem_indices": [ 3 ], "summary": "[1] 5 [J.25 J.31] 9", "num_nts": 7, "nts_short": "UCAAAAG", "nts_long": "///J/25,///J/26,///J/27,///J/28,///J/29,///J/30,///J/31", "num_stems": 1, "bridges": [ { "index": 1, "num_nts": 5, "nts_short": "CAAAA", "nts_long": "///J/26,///J/27,///J/28,///J/29,///J/30" } ] }, { "index": 2, "type": "hairpin loop", "bridging_nts": [ 3 ], "stem_indices": [ 8 ], "summary": "[1] 3 [J.148 J.152] 6", "num_nts": 5, "nts_short": "CUAGG", "nts_long": "///J/148,///J/149,///J/150,///J/151,///J/152", "num_stems": 1, "bridges": [ { "index": 1, "num_nts": 3, "nts_short": "UAG", "nts_long": "///J/149,///J/150,///J/151" } ] }, { "index": 3, "type": "hairpin loop", "bridging_nts": [ 7 ], "stem_indices": [ 10 ], "summary": "[1] 7 [J.167 J.175] 3", "num_nts": 9, "nts_short": "CUCGCAAGG", "nts_long": "///J/167,///J/168,///J/169,///J/170,///J/171,///J/172,///J/173,///J/174,///J/175", "num_stems": 1, "bridges": [ { "index": 1, "num_nts": 7, "nts_short": "UCGCAAG", "nts_long": "///J/168,///J/169,///J/170,///J/171,///J/172,///J/173,///J/174" } ] }, { "index": 4, "type": "hairpin loop", "bridging_nts": [ 4 ], "stem_indices": [ -3 ], "summary": "[1] 4 [J.213 J.218] 1", "num_nts": 6, "nts_short": "UUAGCG", "nts_long": "///J/213,///J/214,///J/215,///J/216,///J/217,///J/218", "num_stems": 1, "bridges": [ { "index": 1, "num_nts": 4, "nts_short": "UAGC", "nts_long": "///J/214,///J/215,///J/216,///J/217" } ] }, { "index": 5, "type": "hairpin loop", "bridging_nts": [ 9 ], "stem_indices": [ -4 ], "summary": "[1] 9 [J.264 J.274] 1", "num_nts": 11, "nts_short": "GAGUGGUUAGC", "nts_long": "///J/264,///J/265,///J/266,///J/267,///J/268,///J/269,///J/270,///J/271,///J/272,///J/273,///J/274", "num_stems": 1, "bridges": [ { "index": 1, "num_nts": 9, "nts_short": "AGUGGUUAG", "nts_long": "///J/265,///J/266,///J/267,///J/268,///J/269,///J/270,///J/271,///J/272,///J/273" } ] }, { "index": 6, "type": "hairpin loop", "bridging_nts": [ 5 ], "stem_indices": [ 14 ], "summary": "[1] 5 [J.273 J.279] 5", "num_nts": 7, "nts_short": "GCGAUAC", "nts_long": "///J/273,///J/274,///J/275,///J/276,///J/277,///J/278,///J/279", "num_stems": 1, "bridges": [ { "index": 1, "num_nts": 5, "nts_short": "CGAUA", "nts_long": "///J/274,///J/275,///J/276,///J/277,///J/278" } ] }, { "index": 7, "type": "hairpin loop", "bridging_nts": [ 4 ], "stem_indices": [ 16 ], "summary": "[1] 4 [J.304 J.309] 7", "num_nts": 6, "nts_short": "AGGGAU", "nts_long": "///J/304,///J/305,///J/306,///J/307,///J/308,///J/309", "num_stems": 1, "bridges": [ { "index": 1, "num_nts": 4, "nts_short": "GGGA", "nts_long": "///J/305,///J/306,///J/307,///J/308" } ] }, { "index": 8, "type": "hairpin loop", "bridging_nts": [ 9 ], "stem_indices": [ 18 ], "summary": "[1] 9 [J.327 J.337] 6", "num_nts": 11, "nts_short": "UAAAACAUAAG", "nts_long": "///J/327,///J/328,///J/329,///J/330,///J/331,///J/332,///J/333,///J/334,///J/335,///J/336,///J/337", "num_stems": 1, "bridges": [ { "index": 1, "num_nts": 9, "nts_short": "AAAACAUAA", "nts_long": "///J/328,///J/329,///J/330,///J/331,///J/332,///J/333,///J/334,///J/335,///J/336" } ] }, { "index": 9, "type": "hairpin loop", "bridging_nts": [ 9 ], "stem_indices": [ 19 ], "summary": "[1] 9 [J.363 J.373] 3", "num_nts": 11, "nts_short": "UGUAAUCUCAG", "nts_long": "///J/363,///J/364,///J/365,///J/366,///J/367,///J/368,///J/369,///J/370,///J/371,///J/372,///J/373", "num_stems": 1, "bridges": [ { "index": 1, "num_nts": 9, "nts_short": "GUAAUCUCA", "nts_long": "///J/364,///J/365,///J/366,///J/367,///J/368,///J/369,///J/370,///J/371,///J/372" } ] } ], "num_iloops": 8, "iloops": [ { "index": 1, "type": "symmetric internal loop", "bridging_nts": [ 1, 1 ], "stem_indices": [ 4, 5 ], "summary": "[2] 1 1 [J.48 J.117 J.50 J.115] 3 2", "num_nts": 6, "nts_short": "CAAUUG", "nts_long": "///J/48,///J/49,///J/50,///J/115,///J/116,///J/117", "num_stems": 2, "bridges": [ { "index": 1, "num_nts": 1, "nts_short": "A", "nts_long": "///J/49" }, { "index": 2, "num_nts": 1, "nts_short": "U", "nts_long": "///J/116" } ] }, { "index": 2, "type": "symmetric internal loop", "bridging_nts": [ 1, 1 ], "stem_indices": [ 13, -3 ], "summary": "[2] 1 1 [J.211 J.220 J.213 J.218] 5 1", "num_nts": 6, "nts_short": "CUUGGG", "nts_long": "///J/211,///J/212,///J/213,///J/218,///J/219,///J/220", "num_stems": 2, "bridges": [ { "index": 1, "num_nts": 1, "nts_short": "U", "nts_long": "///J/212" }, { "index": 2, "num_nts": 1, "nts_short": "G", "nts_long": "///J/219" } ] }, { "index": 3, "type": "asymmetric internal loop", "bridging_nts": [ 1, 2 ], "stem_indices": [ 5, -1 ], "summary": "[2] 1 2 [J.51 J.114 J.53 J.111] 2 1", "num_nts": 7, "nts_short": "UGCGUCA", "nts_long": "///J/51,///J/52,///J/53,///J/111,///J/112,///J/113,///J/114", "num_stems": 2, "bridges": [ { "index": 1, "num_nts": 1, "nts_short": "G", "nts_long": "///J/52" }, { "index": 2, "num_nts": 2, "nts_short": "UC", "nts_long": "///J/112,///J/113" } ] }, { "index": 4, "type": "asymmetric internal loop", "bridging_nts": [ 3, 1 ], "stem_indices": [ 2, 3 ], "summary": "[2] 3 1 [J.13 J.41 J.17 J.39] 4 9", "num_nts": 8, "nts_short": "GCAUUAAC", "nts_long": "///J/13,///J/14,///J/15,///J/16,///J/17,///J/39,///J/40,///J/41", "num_stems": 2, "bridges": [ { "index": 1, "num_nts": 3, "nts_short": "CAU", "nts_long": "///J/14,///J/15,///J/16" }, { "index": 2, "num_nts": 1, "nts_short": "A", "nts_long": "///J/40" } ] }, { "index": 5, "type": "symmetric internal loop", "bridging_nts": [ 2, 2 ], "stem_indices": [ 9, 10 ], "summary": "[2] 2 2 [J.162 J.180 J.165 J.177] 5 3", "num_nts": 8, "nts_short": "AGAGUAAU", "nts_long": "///J/162,///J/163,///J/164,///J/165,///J/177,///J/178,///J/179,///J/180", "num_stems": 2, "bridges": [ { "index": 1, "num_nts": 2, "nts_short": "GA", "nts_long": "///J/163,///J/164" }, { "index": 2, "num_nts": 2, "nts_short": "AA", "nts_long": "///J/178,///J/179" } ] }, { "index": 6, "type": "symmetric internal loop", "bridging_nts": [ 2, 2 ], "stem_indices": [ 12, 13 ], "summary": "[2] 2 2 [J.204 J.227 J.207 J.224] 2 5", "num_nts": 8, "nts_short": "CUUAUUCG", "nts_long": "///J/204,///J/205,///J/206,///J/207,///J/224,///J/225,///J/226,///J/227", "num_stems": 2, "bridges": [ { "index": 1, "num_nts": 2, "nts_short": "UU", "nts_long": "///J/205,///J/206" }, { "index": 2, "num_nts": 2, "nts_short": "UC", "nts_long": "///J/225,///J/226" } ] }, { "index": 7, "type": "symmetric internal loop", "bridging_nts": [ 4, 4 ], "stem_indices": [ -2, 12 ], "summary": "[2] 4 4 [J.198 J.233 J.203 J.228] 1 2", "num_nts": 12, "nts_short": "AAGCAGUUAAUU", "nts_long": "///J/198,///J/199,///J/200,///J/201,///J/202,///J/203,///J/228,///J/229,///J/230,///J/231,///J/232,///J/233", "num_stems": 2, "bridges": [ { "index": 1, "num_nts": 4, "nts_short": "AGCA", "nts_long": "///J/199,///J/200,///J/201,///J/202" }, { "index": 2, "num_nts": 4, "nts_short": "UAAU", "nts_long": "///J/229,///J/230,///J/231,///J/232" } ] }, { "index": 8, "type": "asymmetric internal loop", "bridging_nts": [ 7, 6 ], "stem_indices": [ 11, -2 ], "summary": "[2] 7 6 [J.190 J.240 J.198 J.233] 6 1", "num_nts": 17, "nts_short": "AAAGAGUAAUGAAAAAU", "nts_long": "///J/190,///J/191,///J/192,///J/193,///J/194,///J/195,///J/196,///J/197,///J/198,///J/233,///J/234,///J/235,///J/236,///J/237,///J/238,///J/239,///J/240", "num_stems": 2, "bridges": [ { "index": 1, "num_nts": 7, "nts_short": "AAGAGUA", "nts_long": "///J/191,///J/192,///J/193,///J/194,///J/195,///J/196,///J/197" }, { "index": 2, "num_nts": 6, "nts_short": "GAAAAA", "nts_long": "///J/234,///J/235,///J/236,///J/237,///J/238,///J/239" } ] } ], "num_junctions": 1, "junctions": [ { "index": 1, "type": "6-way junction", "bridging_nts": [ 1, 0, 2, 4, 3, 5 ], "stem_indices": [ 15, 16, 17, 19, 17, 18 ], "summary": "[6] 1 0 2 4 3 5 [J.296 J.348 J.298 J.315 J.316 J.370 J.373 J.363 J.368 J.318 J.322 J.342] 6 7 3 3 3 6", "is_repeated": true, "num_nts": 27, "nts_short": "UUAUGUCAGUGUAAUAUAAAUGAAAGA", "nts_long": "///J/296,///J/297,///J/298,///J/315,///J/316,///J/370,///J/371,///J/372,///J/373,///J/363,///J/364,///J/365,///J/366,///J/367,///J/368,///J/318,///J/319,///J/320,///J/321,///J/322,///J/342,///J/343,///J/344,///J/345,///J/346,///J/347,///J/348", "num_stems": 6, "bridges": [ { "index": 1, "num_nts": 1, "nts_short": "U", "nts_long": "///J/297" }, { "index": 2, "num_nts": 0, "nts_short": "", "nts_long": "" }, { "index": 3, "num_nts": 2, "nts_short": "CA", "nts_long": "///J/371,///J/372" }, { "index": 4, "num_nts": 4, "nts_short": "GUAA", "nts_long": "///J/364,///J/365,///J/366,///J/367" }, { "index": 5, "num_nts": 3, "nts_short": "UAA", "nts_long": "///J/319,///J/320,///J/321" }, { "index": 6, "num_nts": 5, "nts_short": "GAAAG", "nts_long": "///J/343,///J/344,///J/345,///J/346,///J/347" } ] } ], "num_ssSegments": 10, "ssSegments": [ { "index": 1, "num_nts": 1, "nts_short": "A", "nts_long": "///J/1" }, { "index": 2, "num_nts": 1, "nts_short": "A", "nts_long": "///J/45" }, { "index": 3, "num_nts": 9, "nts_short": "AAAGCAAAA", "nts_long": "///J/102,///J/103,///J/104,///J/105,///J/106,///J/107,///J/108,///J/109,///J/110" }, { "index": 4, "num_nts": 4, "nts_short": "GAAA", "nts_long": "///J/130,///J/131,///J/132,///J/133" }, { "index": 5, "num_nts": 3, "nts_short": "UUC", "nts_long": "///J/140,///J/141,///J/142" }, { "index": 6, "num_nts": 4, "nts_short": "AGUA", "nts_long": "///J/246,///J/247,///J/248,///J/249" }, { "index": 7, "num_nts": 4, "nts_short": "UAAC", "nts_long": "///J/260,///J/261,///J/262,///J/263" }, { "index": 8, "num_nts": 1, "nts_short": "C", "nts_long": "///J/284" }, { "index": 9, "num_nts": 7, "nts_short": "GACUAAA", "nts_long": "///J/354,///J/355,///J/356,///J/357,///J/358,///J/359,///J/360" }, { "index": 10, "num_nts": 1, "nts_short": "U", "nts_long": "///J/376" } ], "num_Aminors": 9, "Aminors": [ { "index": 1, "type": "X", "desc_short": "A vs A-U (WC)", "desc_long": "///J/103 vs ///J/4,///J/59", "A_nt1": { "desc": "///J/103 vs ///J/4", "face_type": "+", "hbonds_num": 0, "hbonds_desc": "" }, "A_nt2": { "desc": "///J/103 vs ///J/59", "face_type": "-", "hbonds_num": 1, "hbonds_desc": "N3-O2'(hydroxyl)[2.90]" } }, { "index": 2, "type": "I", "desc_short": "A vs G-C (WC)", "desc_long": "///J/104 vs ///J/5,///J/58", "A_nt1": { "desc": "///J/104 vs ///J/5", "face_type": "+", "hbonds_num": 0, "hbonds_desc": "" }, "A_nt2": { "desc": "///J/104 vs ///J/58", "face_type": "-", "hbonds_num": 2, "hbonds_desc": "O2'(hydroxyl)-O2'(hydroxyl)[2.34],O2'(hydroxyl)-O2(carbonyl)[3.35]" } }, { "index": 3, "type": "I", "desc_short": "A vs G-C (WC)", "desc_long": "///J/110 vs ///J/8,///J/55", "A_nt1": { "desc": "///J/110 vs ///J/8", "face_type": "+", "hbonds_num": 2, "hbonds_desc": "N1-O2'(hydroxyl)[2.49],N3-N2(amino)[3.44]" }, "A_nt2": { "desc": "///J/110 vs ///J/55", "face_type": "-", "hbonds_num": 1, "hbonds_desc": "O2'(hydroxyl)-O2'(hydroxyl)[2.76]" } }, { "index": 4, "type": "I", "desc_short": "A vs G-C (WC)", "desc_long": "///J/132 vs ///J/269,///J/283", "A_nt1": { "desc": "///J/132 vs ///J/269", "face_type": "-", "hbonds_num": 3, "hbonds_desc": "O2'(hydroxyl)-O2'(hydroxyl)[2.94],O2'(hydroxyl)-N3[3.24],N3-N2(amino)[3.28]" }, "A_nt2": { "desc": "///J/132 vs ///J/283", "face_type": "+", "hbonds_num": 1, "hbonds_desc": "N1-O2'(hydroxyl)[2.96]" } }, { "index": 5, "type": "I", "desc_short": "A vs G-C (WC)", "desc_long": "///J/133 vs ///J/317,///J/369", "A_nt1": { "desc": "///J/133 vs ///J/317", "face_type": "-", "hbonds_num": 0, "hbonds_desc": "" }, "A_nt2": { "desc": "///J/133 vs ///J/369", "face_type": "+", "hbonds_num": 1, "hbonds_desc": "N1-O2'(hydroxyl)[2.92]" } }, { "index": 6, "type": "I", "desc_short": "A vs C-G (WC)", "desc_long": "///J/246 vs ///J/139,///J/285", "A_nt1": { "desc": "///J/246 vs ///J/139", "face_type": "+", "hbonds_num": 1, "hbonds_desc": "N1-O2'(hydroxyl)[3.26]" }, "A_nt2": { "desc": "///J/246 vs ///J/285", "face_type": "-", "hbonds_num": 2, "hbonds_desc": "O2'(hydroxyl)-N3[3.13],N3-N2(amino)[3.04]" } }, { "index": 7, "type": "X", "desc_short": "A vs G-C (WC)", "desc_long": "///J/276 vs ///J/264,///J/274", "A_nt1": { "desc": "///J/276 vs ///J/264", "face_type": "-", "hbonds_num": 2, "hbonds_desc": "N6(amino)-O2'(hydroxyl)[2.83],N1-O2'(hydroxyl)[3.27]" }, "A_nt2": { "desc": "///J/276 vs ///J/274", "face_type": "+", "hbonds_num": 0, "hbonds_desc": "" } }, { "index": 8, "type": "X", "desc_short": "A vs G-C (WC)", "desc_long": "///J/278 vs ///J/264,///J/274", "A_nt1": { "desc": "///J/278 vs ///J/264", "face_type": "+", "hbonds_num": 0, "hbonds_desc": "" }, "A_nt2": { "desc": "///J/278 vs ///J/274", "face_type": "-", "hbonds_num": 2, "hbonds_desc": "N6(amino)-O2(carbonyl)[3.13],N1-O2'(hydroxyl)[3.03]" } }, { "index": 9, "type": "X", "desc_short": "A vs G-C (WC)", "desc_long": "///J/336 vs ///J/13,///J/41", "A_nt1": { "desc": "///J/336 vs ///J/13", "face_type": "-", "hbonds_num": 0, "hbonds_desc": "" }, "A_nt2": { "desc": "///J/336 vs ///J/41", "face_type": "+", "hbonds_num": 2, "hbonds_desc": "N6(amino)-O2'(hydroxyl)[2.96],N1-O2'(hydroxyl)[2.65]" } } ], "num_riboseZippers": 1, "riboseZippers": [ { "index": 1, "num_nts": 4, "nts_short": "CUAA", "nts_long": "///J/58,///J/59,///J/103,///J/104" } ], "num_splayUnits": 15, "splayUnits": [ { "index": 1, "num_nts": 2, "nts_short": "UU", "nts_long": "///J/9,///J/10" }, { "index": 2, "num_nts": 2, "nts_short": "AG", "nts_long": "///J/104,///J/105" }, { "index": 3, "num_nts": 3, "nts_short": "GUC", "nts_long": "///J/111,///J/112,///J/113" }, { "index": 4, "num_nts": 3, "nts_short": "AAG", "nts_long": "///J/132,///J/133,///J/134" }, { "index": 5, "num_nts": 2, "nts_short": "CG", "nts_long": "///J/142,///J/143" }, { "index": 6, "num_nts": 4, "nts_short": "CUAG", "nts_long": "///J/148,///J/149,///J/150,///J/151" }, { "index": 7, "num_nts": 2, "nts_short": "CG", "nts_long": "///J/169,///J/170" }, { "index": 8, "num_nts": 2, "nts_short": "AA", "nts_long": "///J/184,///J/185" }, { "index": 9, "num_nts": 2, "nts_short": "GC", "nts_long": "///J/200,///J/201" }, { "index": 10, "num_nts": 3, "nts_short": "UAA", "nts_long": "///J/260,///J/261,///J/262" }, { "index": 11, "num_nts": 2, "nts_short": "CG", "nts_long": "///J/284,///J/285" }, { "index": 12, "num_nts": 2, "nts_short": "UG", "nts_long": "///J/290,///J/291" }, { "index": 13, "num_nts": 2, "nts_short": "UG", "nts_long": "///J/315,///J/316" }, { "index": 14, "num_nts": 2, "nts_short": "AA", "nts_long": "///J/344,///J/345" }, { "index": 15, "num_nts": 3, "nts_short": "AGA", "nts_long": "///J/346,///J/347,///J/348" } ], "pseudoknot_order": 1, "pseudoknot_nts": [ { "index": 1, "symbols": "[]", "num_nts": 32, "nts_short": "GGCAUCGAUGCCGUGUGCGCGCGCAUGGAUCU", "nts_long": "///J/46,///J/47,///J/48,///J/50,///J/51,///J/53,///J/111,///J/114,///J/115,///J/117,///J/118,///J/119,///J/134,///J/135,///J/136,///J/137,///J/138,///J/139,///J/264,///J/274,///J/285,///J/286,///J/287,///J/288,///J/289,///J/290,///J/316,///J/317,///J/318,///J/368,///J/369,///J/370" } ], "dbn": { "all_chains": { "num_nts": 336, "num_chars": 337, "bseq": "AGUAGGCGUUGCGCAUUUUGUUGCUCAAAAGGCGACGAAACGCAAGGCAAUGCACGUCUGC&AAAGCAAAAGUCAUUGCCCGUCGCAAACGAAAGUGUGCUUCGGUAGCUAGGCUACCUGCUAGAGUCUCGCAAGGAUAAUAGCAAAGUCAAAGAGUAAAGCAGCUUAGACCUUUAGCGGGGUUUUCGUUAAUUGAAAAAUGGCUUAGUAGUUUGCGGCGUAACGAGUGGUUAGCGAUACUAACCGCGCAUGGUUGUUACUUGAAGGGAUUUGAGUGGAUAAAAAACUAAAACAUAAGGUUUUGAAAGACAACUGACUAAACGUGUAAUCUCAGCGU", "sstr": ".((((((((((((...(((((((((.....))))))))).)))).[[[.[[.[))))))))&.........]..]].]]]((((((((((....[[[[[[...((((((...))))))(((((..(((.......)))..)))))((((((.......(....((..(((((.(....).)))))..))....)......))))))....))))))))))....[....(((((]....))))).]]]]]]((((((.(((((((....)))))))[[[...((((((.........)))))).....)))))).......(((....]]]..))).", "form": ".....A.A..AA..A.AA.AA.AA......AA.AA.AA.AAA...AA..AAAAA..AAAA-&.B.A........AAAAAAAAAAAAAAA.....AAAA.A...AAAA......AAAAAAAAA...AAAB.....AAA...AAAA..AAAAA............A..A.AA.AAA....AA.AAAA..A............A.AAA...A.AAAAAAA.A.......A..AAAA......AA.AA.AAAAA.AAAAA.AAAA.AAA..A.AA.A.A.AA..A.AAAAA.......A..AAAAA......AAAA.........A......AA.A.AAA-" }, "chain_J": { "num_nts": 336, "num_chars": 337, "bseq": "AGUAGGCGUUGCGCAUUUUGUUGCUCAAAAGGCGACGAAACGCAAGGCAAUGCACGUCUGC&AAAGCAAAAGUCAUUGCCCGUCGCAAACGAAAGUGUGCUUCGGUAGCUAGGCUACCUGCUAGAGUCUCGCAAGGAUAAUAGCAAAGUCAAAGAGUAAAGCAGCUUAGACCUUUAGCGGGGUUUUCGUUAAUUGAAAAAUGGCUUAGUAGUUUGCGGCGUAACGAGUGGUUAGCGAUACUAACCGCGCAUGGUUGUUACUUGAAGGGAUUUGAGUGGAUAAAAAACUAAAACAUAAGGUUUUGAAAGACAACUGACUAAACGUGUAAUCUCAGCGU", "sstr": ".((((((((((((...(((((((((.....))))))))).)))).[[[.[[.[))))))))&.........]..]].]]]((((((((((....[[[[[[...((((((...))))))(((((..(((.......)))..)))))((((((.......(....((..(((((.(....).)))))..))....)......))))))....))))))))))....[....(((((]....))))).]]]]]]((((((.(((((((....)))))))[[[...((((((.........)))))).....)))))).......(((....]]]..))).", "form": ".....A.A..AA..A.AA.AA.AA......AA.AA.AA.AAA...AA..AAAAA..AAAA-&.B.A........AAAAAAAAAAAAAAA.....AAAA.A...AAAA......AAAAAAAAA...AAAB.....AAA...AAAA..AAAAA............A..A.AA.AAA....AA.AAAA..A............A.AAA...A.AAAAAAA.A.......A..AAAA......AA.AA.AAAAA.AAAAA.AAAA.AAA..A.AA.A.A.AA..A.AAAAA.......A..AAAAA......AAAA.........A......AA.A.AAA-" } }, "chains": { "chain_J": { "num_nts": 336, "bseq": "AGUAGGCGUUGCGCAUUUUGUUGCUCAAAAGGCGACGAAACGCAAGGCAAUGCACGUCUGC&AAAGCAAAAGUCAUUGCCCGUCGCAAACGAAAGUGUGCUUCGGUAGCUAGGCUACCUGCUAGAGUCUCGCAAGGAUAAUAGCAAAGUCAAAGAGUAAAGCAGCUUAGACCUUUAGCGGGGUUUUCGUUAAUUGAAAAAUGGCUUAGUAGUUUGCGGCGUAACGAGUGGUUAGCGAUACUAACCGCGCAUGGUUGUUACUUGAAGGGAUUUGAGUGGAUAAAAAACUAAAACAUAAGGUUUUGAAAGACAACUGACUAAACGUGUAAUCUCAGCGU", "sstr": ".((((((((((((...(((((((((.....))))))))).)))).[[[.[[.[))))))))&.........]..]].]]]((((((((((....[[[[[[...((((((...))))))(((((..(((.......)))..)))))((((((.......(....((..(((((.(....).)))))..))....)......))))))....))))))))))....[....(((((]....))))).]]]]]]((((((.(((((((....)))))))[[[...((((((.........)))))).....)))))).......(((....]]]..))).", "form": ".....A.A..AA..A.AA.AA.AA......AA.AA.AA.AAA...AA..AAAAA..AAAA-&.B.A........AAAAAAAAAAAAAAA.....AAAA.A...AAAA......AAAAAAAAA...AAAB.....AAA...AAAA..AAAAA............A..A.AA.AAA....AA.AAAA..A............A.AAA...A.AAAAAAA.A.......A..AAAA......AA.AA.AAAAA.AAAAA.AAAA.AAA..A.AA.A.A.AA..A.AAAAA.......A..AAAAA......AAAA.........A......AA.A.AAA-", "helical_rise": 0.237, "helical_rise_std": 3.186, "helical_axis": [ 0.959, -0.257, -0.124 ], "point1": [ 209.976, 325.944, 267.889 ], "point2": [ 285.740, 305.666, 258.088 ], "num_chars": 1006, "suite": "A1LG1cU!!A!!G4nG1cC!!G1aU!!U!!G1aC1cG1aC!!A!!U!!U1LU1cU1aG1aU1aU1aG1aC1aU1aC!!A1tA!!A0aA!!G1cG1aC1cG1aA1aC!!G1aA1aA!!A!!C!!G!!C!!A1cA!!G1aG1aC1aA1aA1aU!!G1cC1aA1aC1aG!!U1aC1aU1aG1tC..A1cA!!A!!G!!C1cA!!A1aA1cA!!G!!U!!C!!A1cU1aU1aG1cC1aC1cC!!G1aU1aC1cG!!C1cA1aA1cA!!C1cG7rA!!A1oA0aG1aU1aG1aU1aG1cC1aU!!U!!C!!G1aG1aU1aA1aG1aC!!U!!A!!G!!G1cC1aU1aA1aC1aC1aU1aG1aC1aU1aA1aG7aA1cG1aU1aC1cU!!C!!G1cC!!A!!A1cG1aG1aA1aU!!A1LA1aU1aA1aG1aC1aA!!A!!A1cG1LU1aC1aA1aA!!A1aG!!A!!G4bU!!A1aA1aA1cG3aC1cA1cG1LC1cU!!U1cA1eG1aA1aC1aC1aU1aU1aU!!A1aG1aC!!G!!G1aG!!G1aU1cU1aU1cU!!C!!G1aU1aU7aA!!A1aU!!U1cG!!A!!A!!A!!A!!A1cU1aG1cG1LC1aU!!U!!A7rG0aU1aA!!G1aU1cU1aU1aG1aC1aG1aG!!C1bG!!U4pA6pA2aC1cG1cA1aG1aU!!G1aG1aU1cU!!A1aG1cC!!G!!A6nU!!A1cC1aU1cA!!A1aC1aC9aG1aC1aG1aC1aA1aU!!G1aG1aU1aU!!G1aU1aU1aA1aC1cU!!U!!G1aA1aA1aG1gG1aG1aA1cU1aU1aU1aG1aA1cG1bU!!G1cG1aA1cU1aA1aA1aA1aA1aA1cA1cC1aU!!A!!A!!A!!A!!C!!A!!U1bA0aA1cG1aG1aU1aU1aU1cU1aG5zA2aA!!A!!G!!A1aC1cA1aA1aC1aU1aG!!A!!C!!U!!A&aA!!A!!C1bG!!U!!G5zU!!A2gA1aU1cC1LU1aC1aA1cG1aC1aG1aU" } }, "num_nts": 336, "nts": [ { "index": 1, "index_chain": 1, "chain_name": "J", "nt_resnum": 1, "nt_name": "A", "nt_code": "A", "nt_id": "///J/1", "linked_nts": [ null, "///J/2" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-pair-contact,ss-non-loop", "alpha": null, "beta": 104.565, "gamma": 76.781, "delta": 87.347, "epsilon": -107.027, "zeta": -111.658, "epsilon_zeta": 4.630, "bb_type": "--", "chi": -165.762, "glyco_bond": "anti", "C5prime_xyz": [ -1.305, 8.627, 0.912 ], "P_xyz": [ 0.873, 8.188, -0.504 ], "form": ".", "ssZp": 4.283, "Dp": 4.608, "splay_angle": 27.516, "splay_distance": 4.391, "splay_ratio": 0.248, "d22": null, "d64": null, "eta": null, "theta": -137.243, "eta_prime": null, "theta_prime": -142.370, "eta_base": null, "theta_base": -105.263, "v0": 2.760, "v1": -22.015, "v2": 31.804, "v3": -31.029, "v4": 17.945, "amplitude": 32.762, "phase_angle": 13.887, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.037, "frame": { "rmsd": 0.006, "origin": [ 203.819, 296.374, 290.289 ], "x_axis": [ -0.391, 0.665, -0.637 ], "y_axis": [ 0.269, 0.744, 0.612 ], "z_axis": [ 0.880, 0.068, -0.469 ], "quaternion": [ 0.470, 0.289, 0.807, 0.211 ] } }, { "index": 2, "index_chain": 2, "chain_name": "J", "nt_resnum": 2, "nt_name": "G", "nt_code": "G", "nt_id": "///J/2", "linked_nts": [ "///J/1", "///J/3" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack", "alpha": -51.898, "beta": 124.996, "gamma": 68.765, "delta": 91.233, "epsilon": -178.592, "zeta": -81.355, "epsilon_zeta": -97.237, "bb_type": "BI", "chi": -156.132, "glyco_bond": "anti", "C5prime_xyz": [ -1.039, 8.668, 0.348 ], "P_xyz": [ 1.337, 8.091, -0.669 ], "form": ".", "ssZp": 4.044, "Dp": 4.177, "splay_angle": 30.141, "splay_distance": 4.771, "splay_ratio": 0.260, "d22": null, "d64": null, "eta": 155.484, "theta": -112.021, "eta_prime": -170.102, "theta_prime": -131.400, "eta_base": -109.025, "theta_base": -103.551, "v0": 3.131, "v1": -19.808, "v2": 27.859, "v3": -26.782, "v4": 15.046, "amplitude": 28.527, "phase_angle": 12.424, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1L", "suiteness": 0.472, "filter_rmsd": 0.026, "frame": { "rmsd": 0.026, "origin": [ 206.998, 298.496, 288.127 ], "x_axis": [ -0.106, 0.994, -0.027 ], "y_axis": [ 0.570, 0.083, 0.817 ], "z_axis": [ 0.815, 0.071, -0.576 ], "quaternion": [ 0.317, 0.589, 0.664, 0.334 ] } }, { "index": 3, "index_chain": 3, "chain_name": "J", "nt_resnum": 3, "nt_name": "U", "nt_code": "U", "nt_id": "///J/3", "linked_nts": [ "///J/2", "///J/4" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": 166.018, "beta": -123.949, "gamma": 153.765, "delta": 84.492, "epsilon": -110.006, "zeta": -109.062, "epsilon_zeta": -0.944, "bb_type": "--", "chi": -168.656, "glyco_bond": "anti", "C5prime_xyz": [ -1.535, 8.798, 1.009 ], "P_xyz": [ 0.852, 9.133, -0.017 ], "form": ".", "ssZp": 4.028, "Dp": 4.309, "splay_angle": 18.045, "splay_distance": 3.049, "splay_ratio": 0.157, "d22": null, "d64": null, "eta": 178.514, "theta": -139.584, "eta_prime": -159.176, "theta_prime": -135.930, "eta_base": -107.828, "theta_base": -135.117, "v0": -5.175, "v1": -15.326, "v2": 28.747, "v3": -32.509, "v4": 23.777, "amplitude": 32.421, "phase_angle": 27.539, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.032, "filter_rmsd": 0.108, "frame": { "rmsd": 0.011, "origin": [ 210.433, 300.686, 285.643 ], "x_axis": [ 0.376, 0.780, 0.501 ], "y_axis": [ 0.452, -0.626, 0.636 ], "z_axis": [ 0.809, -0.013, -0.588 ], "quaternion": [ 0.201, 0.805, 0.383, 0.407 ] } }, { "index": 4, "index_chain": 4, "chain_name": "J", "nt_resnum": 4, "nt_name": "A", "nt_code": "A", "nt_id": "///J/4", "linked_nts": [ "///J/3", "///J/5" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,A-minor", "alpha": -19.248, "beta": 143.412, "gamma": 22.856, "delta": 145.417, "epsilon": -163.588, "zeta": -123.882, "epsilon_zeta": -39.706, "bb_type": "BI", "chi": -117.067, "glyco_bond": "anti", "C5prime_xyz": [ -2.531, 8.507, -1.313 ], "P_xyz": [ -0.293, 9.679, -0.684 ], "form": ".", "ssZp": 2.350, "Dp": 2.222, "splay_angle": 22.107, "splay_distance": 4.026, "splay_ratio": 0.204, "d22": null, "d64": null, "eta": 149.875, "theta": -133.041, "eta_prime": -170.929, "theta_prime": -151.384, "eta_base": -155.586, "theta_base": -117.465, "v0": -27.313, "v1": 41.284, "v2": -38.411, "v3": 23.598, "v4": 2.057, "amplitude": 41.342, "phase_angle": 158.295, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.015, "origin": [ 212.313, 301.109, 283.281 ], "x_axis": [ 0.073, 0.410, 0.909 ], "y_axis": [ 0.435, -0.833, 0.341 ], "z_axis": [ 0.897, 0.371, -0.239 ], "quaternion": [ -0.010, 0.732, 0.288, 0.617 ] } }, { "index": 5, "index_chain": 5, "chain_name": "J", "nt_resnum": 5, "nt_name": "G", "nt_code": "G", "nt_id": "///J/5", "linked_nts": [ "///J/4", "///J/6" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack,A-minor,phosphate", "alpha": -8.708, "beta": 177.844, "gamma": -7.178, "delta": 149.937, "epsilon": -152.722, "zeta": -144.214, "epsilon_zeta": -8.508, "bb_type": "--", "chi": -112.127, "glyco_bond": "anti", "C5prime_xyz": [ -1.997, 8.432, -1.542 ], "P_xyz": [ -0.543, 10.511, -0.906 ], "form": ".", "ssZp": 1.962, "Dp": 1.908, "splay_angle": 24.849, "splay_distance": 4.487, "splay_ratio": 0.221, "d22": null, "d64": null, "eta": 179.784, "theta": -146.356, "eta_prime": -164.241, "theta_prime": -169.405, "eta_base": -122.114, "theta_base": -145.817, "v0": -23.380, "v1": 38.670, "v2": -38.236, "v3": 25.644, "v4": -1.531, "amplitude": 39.880, "phase_angle": 163.492, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.021, "frame": { "rmsd": 0.021, "origin": [ 215.056, 303.998, 282.696 ], "x_axis": [ 0.292, -0.146, 0.945 ], "y_axis": [ 0.279, -0.933, -0.230 ], "z_axis": [ 0.915, 0.330, -0.232 ], "quaternion": [ -0.179, 0.784, 0.042, 0.593 ] } }, { "index": 6, "index_chain": 6, "chain_name": "J", "nt_resnum": 6, "nt_name": "G", "nt_code": "G", "nt_id": "///J/6", "linked_nts": [ "///J/5", "///J/7" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": 91.972, "beta": -157.886, "gamma": -153.716, "delta": 81.441, "epsilon": -155.513, "zeta": -81.163, "epsilon_zeta": -74.350, "bb_type": "BI", "chi": -164.690, "glyco_bond": "anti", "C5prime_xyz": [ -1.083, 8.691, 0.949 ], "P_xyz": [ 0.163, 10.674, -0.141 ], "form": "A", "ssZp": 4.285, "Dp": 4.457, "splay_angle": 23.784, "splay_distance": 3.850, "splay_ratio": 0.208, "d22": null, "d64": null, "eta": 150.176, "theta": -157.733, "eta_prime": 147.959, "theta_prime": -153.153, "eta_base": -174.458, "theta_base": -106.197, "v0": 1.831, "v1": -23.863, "v2": 35.889, "v3": -35.750, "v4": 21.472, "amplitude": 37.322, "phase_angle": 15.931, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23t", "cluster": "4n", "suiteness": 0.444, "filter_rmsd": 0.024, "frame": { "rmsd": 0.024, "origin": [ 217.578, 307.289, 280.981 ], "x_axis": [ 0.319, -0.519, 0.793 ], "y_axis": [ -0.008, -0.838, -0.545 ], "z_axis": [ 0.948, 0.168, -0.271 ], "quaternion": [ -0.229, 0.779, -0.169, 0.559 ] } }, { "index": 7, "index_chain": 7, "chain_name": "J", "nt_resnum": 7, "nt_name": "C", "nt_code": "C", "nt_id": "///J/7", "linked_nts": [ "///J/6", "///J/8" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet", "alpha": 164.848, "beta": -138.498, "gamma": 154.350, "delta": 75.240, "epsilon": -126.738, "zeta": -46.236, "epsilon_zeta": -80.502, "bb_type": "--", "chi": -170.464, "glyco_bond": "anti", "C5prime_xyz": [ -1.358, 8.745, 1.154 ], "P_xyz": [ 0.902, 9.478, 0.113 ], "form": ".", "ssZp": 4.399, "Dp": 4.612, "splay_angle": 24.573, "splay_distance": 4.456, "splay_ratio": 0.227, "d22": null, "d64": null, "eta": 155.145, "theta": -122.276, "eta_prime": 179.672, "theta_prime": -133.759, "eta_base": -118.595, "theta_base": -114.918, "v0": -0.169, "v1": -24.224, "v2": 38.484, "v3": -39.559, "v4": 24.933, "amplitude": 40.665, "phase_angle": 18.850, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.120, "filter_rmsd": 0.070, "frame": { "rmsd": 0.017, "origin": [ 221.240, 307.030, 282.141 ], "x_axis": [ 0.178, -0.957, 0.228 ], "y_axis": [ -0.108, -0.250, -0.962 ], "z_axis": [ 0.978, 0.147, -0.148 ], "quaternion": [ -0.442, 0.627, -0.424, 0.481 ] } }, { "index": 8, "index_chain": 8, "chain_name": "J", "nt_resnum": 8, "nt_name": "G", "nt_code": "G", "nt_id": "///J/8", "linked_nts": [ "///J/7", "///J/9" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,A-minor", "alpha": -126.944, "beta": 136.687, "gamma": 142.715, "delta": 76.806, "epsilon": -130.358, "zeta": -85.155, "epsilon_zeta": -45.203, "bb_type": "BI", "chi": -179.641, "glyco_bond": "anti", "C5prime_xyz": [ -1.577, 8.612, 1.609 ], "P_xyz": [ -0.369, 10.592, 0.424 ], "form": "A", "ssZp": 4.604, "Dp": 4.639, "splay_angle": 24.775, "splay_distance": 4.003, "splay_ratio": 0.219, "d22": null, "d64": null, "eta": 169.245, "theta": -176.882, "eta_prime": -174.032, "theta_prime": -168.479, "eta_base": -132.485, "theta_base": -142.287, "v0": -1.679, "v1": -23.040, "v2": 37.704, "v3": -39.563, "v4": 26.003, "amplitude": 40.348, "phase_angle": 20.854, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.023, "frame": { "rmsd": 0.023, "origin": [ 225.136, 305.905, 283.987 ], "x_axis": [ 0.034, -0.971, -0.237 ], "y_axis": [ -0.125, 0.231, -0.965 ], "z_axis": [ 0.992, 0.063, -0.113 ], "quaternion": [ 0.537, -0.479, 0.572, -0.394 ] } }, { "index": 9, "index_chain": 9, "chain_name": "J", "nt_resnum": 9, "nt_name": "U", "nt_code": "U", "nt_id": "///J/9", "linked_nts": [ "///J/8", "///J/10" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BII,canonical,non-pair-contact,helix,stem-end,coaxial-stack,cap-donor,splayed-apart", "alpha": -56.242, "beta": 165.768, "gamma": 56.639, "delta": 77.285, "epsilon": -129.304, "zeta": -173.759, "epsilon_zeta": 44.455, "bb_type": "BII", "chi": -157.524, "glyco_bond": "anti", "C5prime_xyz": [ -1.652, 8.832, 0.335 ], "P_xyz": [ 0.856, 9.508, 0.284 ], "form": ".", "ssZp": 4.188, "Dp": 4.650, "splay_angle": 158.833, "splay_distance": 19.573, "splay_ratio": 0.983, "d22": 11.868, "d64": 14.759, "eta": 174.346, "theta": 113.873, "eta_prime": -174.855, "theta_prime": 121.810, "eta_base": -144.321, "theta_base": -127.190, "v0": -1.306, "v1": -23.298, "v2": 37.652, "v3": -39.399, "v4": 25.676, "amplitude": 40.170, "phase_angle": 20.395, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.681, "filter_rmsd": 0.102, "frame": { "rmsd": 0.019, "origin": [ 228.802, 305.164, 285.414 ], "x_axis": [ -0.005, -0.726, -0.688 ], "y_axis": [ -0.034, 0.688, -0.725 ], "z_axis": [ 0.999, 0.020, -0.028 ], "quaternion": [ 0.643, -0.290, 0.656, -0.269 ] } }, { "index": 10, "index_chain": 10, "chain_name": "J", "nt_resnum": 10, "nt_name": "U", "nt_code": "U", "nt_id": "///J/10", "linked_nts": [ "///J/9", "///J/11" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,non-stack,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,splayed-apart", "alpha": -72.367, "beta": 177.140, "gamma": 170.160, "delta": 67.163, "epsilon": 72.061, "zeta": 67.719, "epsilon_zeta": 4.342, "bb_type": "--", "chi": -162.242, "glyco_bond": "anti", "C5prime_xyz": [ -1.517, 8.676, 0.650 ], "P_xyz": [ -0.624, 10.594, -0.883 ], "form": ".", "ssZp": 3.778, "Dp": 3.863, "splay_angle": 21.174, "splay_distance": 3.765, "splay_ratio": 0.190, "d22": null, "d64": null, "eta": 2.368, "theta": -172.277, "eta_prime": -29.409, "theta_prime": -169.893, "eta_base": -143.178, "theta_base": -151.068, "v0": 6.182, "v1": -31.088, "v2": 43.345, "v3": -40.549, "v4": 21.588, "amplitude": 44.092, "phase_angle": 10.559, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.109, "frame": { "rmsd": 0.022, "origin": [ 240.409, 318.864, 277.625 ], "x_axis": [ -0.025, -0.426, -0.904 ], "y_axis": [ -0.778, -0.560, 0.285 ], "z_axis": [ -0.628, 0.711, -0.318 ], "quaternion": [ -0.156, 0.681, -0.442, -0.563 ] } }, { "index": 11, "index_chain": 11, "chain_name": "J", "nt_resnum": 11, "nt_name": "G", "nt_code": "G", "nt_id": "///J/11", "linked_nts": [ "///J/10", "///J/12" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": 80.346, "beta": -166.183, "gamma": 177.054, "delta": 81.621, "epsilon": -131.079, "zeta": -80.762, "epsilon_zeta": -50.317, "bb_type": "BI", "chi": -167.876, "glyco_bond": "anti", "C5prime_xyz": [ -1.103, 8.742, 1.052 ], "P_xyz": [ 0.560, 10.373, -0.135 ], "form": "A", "ssZp": 4.413, "Dp": 4.587, "splay_angle": 21.587, "splay_distance": 3.528, "splay_ratio": 0.188, "d22": null, "d64": null, "eta": 149.946, "theta": -164.373, "eta_prime": 166.778, "theta_prime": -158.732, "eta_base": -162.930, "theta_base": -126.333, "v0": 0.376, "v1": -22.377, "v2": 34.779, "v3": -35.359, "v4": 22.084, "amplitude": 36.560, "phase_angle": 17.957, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.033, "frame": { "rmsd": 0.033, "origin": [ 239.972, 322.271, 276.085 ], "x_axis": [ -0.307, -0.704, -0.640 ], "y_axis": [ -0.731, -0.256, 0.632 ], "z_axis": [ -0.609, 0.662, -0.436 ], "quaternion": [ 0.013, -0.589, 0.610, 0.531 ] } }, { "index": 12, "index_chain": 12, "chain_name": "J", "nt_resnum": 12, "nt_name": "C", "nt_code": "C", "nt_id": "///J/12", "linked_nts": [ "///J/11", "///J/13" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -51.338, "beta": 158.224, "gamma": 49.186, "delta": 76.509, "epsilon": -160.264, "zeta": -84.444, "epsilon_zeta": -75.821, "bb_type": "BI", "chi": -157.398, "glyco_bond": "anti", "C5prime_xyz": [ -1.573, 8.904, 0.334 ], "P_xyz": [ 0.969, 9.501, 0.253 ], "form": "A", "ssZp": 4.321, "Dp": 4.513, "splay_angle": 24.090, "splay_distance": 4.173, "splay_ratio": 0.219, "d22": null, "d64": null, "eta": 160.062, "theta": -132.030, "eta_prime": 179.556, "theta_prime": -140.425, "eta_base": -134.408, "theta_base": -118.401, "v0": -1.365, "v1": -22.913, "v2": 37.221, "v3": -38.911, "v4": 25.396, "amplitude": 39.730, "phase_angle": 20.469, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.652, "filter_rmsd": 0.066, "frame": { "rmsd": 0.015, "origin": [ 238.479, 323.905, 273.336 ], "x_axis": [ -0.617, -0.766, -0.181 ], "y_axis": [ -0.521, 0.225, 0.823 ], "z_axis": [ -0.590, 0.602, -0.538 ], "quaternion": [ -0.132, -0.417, 0.771, 0.462 ] } }, { "index": 13, "index_chain": 13, "chain_name": "J", "nt_resnum": 13, "nt_name": "G", "nt_code": "G", "nt_id": "///J/13", "linked_nts": [ "///J/12", "///J/14" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop,A-minor", "alpha": 151.515, "beta": -149.820, "gamma": -178.742, "delta": 81.693, "epsilon": -127.951, "zeta": -69.912, "epsilon_zeta": -58.039, "bb_type": "BI", "chi": 178.047, "glyco_bond": "anti", "C5prime_xyz": [ -1.491, 8.468, 1.787 ], "P_xyz": [ 0.356, 10.126, 0.990 ], "form": ".", "ssZp": 4.492, "Dp": 4.597, "splay_angle": 29.870, "splay_distance": 4.673, "splay_ratio": 0.258, "d22": null, "d64": null, "eta": 170.781, "theta": -148.991, "eta_prime": -176.062, "theta_prime": -142.508, "eta_base": -135.725, "theta_base": -91.509, "v0": 0.763, "v1": -23.250, "v2": 35.680, "v3": -36.167, "v4": 22.341, "amplitude": 37.399, "phase_angle": 17.439, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.746, "filter_rmsd": 0.028, "frame": { "rmsd": 0.028, "origin": [ 236.369, 324.200, 269.748 ], "x_axis": [ -0.624, -0.680, 0.386 ], "y_axis": [ -0.145, 0.586, 0.797 ], "z_axis": [ -0.768, 0.441, -0.464 ], "quaternion": [ -0.353, -0.252, 0.818, 0.379 ] } }, { "index": 14, "index_chain": 14, "chain_name": "J", "nt_resnum": 14, "nt_name": "C", "nt_code": "C", "nt_id": "///J/14", "linked_nts": [ "///J/13", "///J/15" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BII,non-canonical,non-pair-contact,helix,internal-loop", "alpha": -56.404, "beta": 159.890, "gamma": 57.571, "delta": 82.397, "epsilon": -113.020, "zeta": 170.904, "epsilon_zeta": 76.076, "bb_type": "BII", "chi": -165.430, "glyco_bond": "anti", "C5prime_xyz": [ -1.362, 8.779, 0.824 ], "P_xyz": [ 1.234, 9.066, 0.991 ], "form": ".", "ssZp": 4.226, "Dp": 4.577, "splay_angle": 70.621, "splay_distance": 10.852, "splay_ratio": 0.578, "d22": null, "d64": null, "eta": 174.186, "theta": 153.186, "eta_prime": -163.214, "theta_prime": 154.107, "eta_base": -98.168, "theta_base": 146.155, "v0": -0.815, "v1": -22.066, "v2": 35.203, "v3": -36.594, "v4": 23.608, "amplitude": 37.409, "phase_angle": 19.775, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.698, "filter_rmsd": 0.073, "frame": { "rmsd": 0.023, "origin": [ 231.742, 324.210, 269.096 ], "x_axis": [ -0.559, 0.096, 0.824 ], "y_axis": [ 0.446, 0.872, 0.201 ], "z_axis": [ -0.699, 0.480, -0.530 ], "quaternion": [ -0.443, 0.158, 0.860, 0.198 ] } }, { "index": 15, "index_chain": 15, "chain_name": "J", "nt_resnum": 15, "nt_name": "A", "nt_code": "A", "nt_id": "///J/15", "linked_nts": [ "///J/14", "///J/16" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-canonical,non-pair-contact,multiplet,internal-loop", "alpha": 128.651, "beta": -134.654, "gamma": 135.287, "delta": 76.255, "epsilon": -127.315, "zeta": -113.907, "epsilon_zeta": -13.407, "bb_type": "--", "chi": 170.523, "glyco_bond": "anti", "C5prime_xyz": [ -1.985, 8.412, 2.063 ], "P_xyz": [ 0.548, 9.015, 2.119 ], "form": "A", "ssZp": 4.476, "Dp": 4.579, "splay_angle": 22.023, "splay_distance": 3.626, "splay_ratio": 0.198, "d22": null, "d64": null, "eta": 142.341, "theta": -128.902, "eta_prime": 133.201, "theta_prime": -122.068, "eta_base": 121.800, "theta_base": -95.714, "v0": -4.251, "v1": -20.351, "v2": 36.035, "v3": -39.319, "v4": 27.434, "amplitude": 39.615, "phase_angle": 24.548, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.053, "frame": { "rmsd": 0.025, "origin": [ 236.779, 326.534, 259.769 ], "x_axis": [ 0.044, -0.642, 0.766 ], "y_axis": [ -0.074, 0.762, 0.643 ], "z_axis": [ -0.996, -0.085, -0.014 ], "quaternion": [ 0.669, 0.272, -0.658, -0.212 ] } }, { "index": 16, "index_chain": 16, "chain_name": "J", "nt_resnum": 16, "nt_name": "U", "nt_code": "U", "nt_id": "///J/16", "linked_nts": [ "///J/15", "///J/17" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C2'-endo,non-canonical,non-pair-contact,helix-end,multiplet,internal-loop", "alpha": 36.335, "beta": 117.707, "gamma": -1.038, "delta": 128.295, "epsilon": 61.306, "zeta": 87.563, "epsilon_zeta": -26.257, "bb_type": "--", "chi": -117.459, "glyco_bond": "anti", "C5prime_xyz": [ -2.777, 8.533, -1.032 ], "P_xyz": [ -0.543, 9.630, -0.089 ], "form": ".", "ssZp": 2.134, "Dp": 1.833, "splay_angle": 28.856, "splay_distance": 4.829, "splay_ratio": 0.264, "d22": 4.055, "d64": 4.122, "eta": 152.258, "theta": -98.945, "eta_prime": -154.146, "theta_prime": -145.382, "eta_base": -110.305, "theta_base": -89.918, "v0": -27.867, "v1": 34.888, "v2": -27.544, "v3": 12.189, "v4": 10.181, "amplitude": 33.886, "phase_angle": 144.375, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.104, "frame": { "rmsd": 0.032, "origin": [ 234.061, 324.198, 260.319 ], "x_axis": [ 0.125, -0.032, 0.992 ], "y_axis": [ -0.249, 0.966, 0.063 ], "z_axis": [ -0.960, -0.255, 0.113 ], "quaternion": [ 0.742, 0.107, -0.657, 0.073 ] } }, { "index": 17, "index_chain": 17, "chain_name": "J", "nt_resnum": 17, "nt_name": "U", "nt_code": "U", "nt_id": "///J/17", "linked_nts": [ "///J/16", "///J/18" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop", "alpha": 148.850, "beta": 124.168, "gamma": 119.620, "delta": 75.098, "epsilon": -120.900, "zeta": -92.947, "epsilon_zeta": -27.953, "bb_type": "--", "chi": -172.289, "glyco_bond": "anti", "C5prime_xyz": [ -1.402, 8.751, 1.194 ], "P_xyz": [ 0.310, 9.965, -0.249 ], "form": "A", "ssZp": 4.297, "Dp": 4.558, "splay_angle": 20.458, "splay_distance": 3.308, "splay_ratio": 0.178, "d22": 4.203, "d64": 4.013, "eta": 143.583, "theta": -164.930, "eta_prime": 156.383, "theta_prime": -161.845, "eta_base": -128.064, "theta_base": -131.626, "v0": -3.219, "v1": -21.545, "v2": 37.094, "v3": -39.910, "v4": 27.086, "amplitude": 40.325, "phase_angle": 23.089, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.113, "frame": { "rmsd": 0.027, "origin": [ 230.231, 322.907, 262.961 ], "x_axis": [ -0.021, 0.754, 0.656 ], "y_axis": [ -0.064, 0.654, -0.754 ], "z_axis": [ -0.998, -0.057, 0.034 ], "quaternion": [ 0.646, -0.270, -0.640, 0.317 ] } }, { "index": 18, "index_chain": 18, "chain_name": "J", "nt_resnum": 18, "nt_name": "U", "nt_code": "U", "nt_id": "///J/18", "linked_nts": [ "///J/17", "///J/19" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -42.288, "beta": 148.038, "gamma": 49.553, "delta": 77.746, "epsilon": -161.171, "zeta": -92.162, "epsilon_zeta": -69.009, "bb_type": "BI", "chi": -157.624, "glyco_bond": "anti", "C5prime_xyz": [ -1.627, 8.881, 0.345 ], "P_xyz": [ 0.908, 9.331, 0.351 ], "form": "A", "ssZp": 4.155, "Dp": 4.399, "splay_angle": 23.999, "splay_distance": 3.915, "splay_ratio": 0.209, "d22": 4.039, "d64": 4.156, "eta": 164.079, "theta": -133.136, "eta_prime": -177.820, "theta_prime": -139.652, "eta_base": -134.641, "theta_base": -106.534, "v0": -2.322, "v1": -21.923, "v2": 36.469, "v3": -38.770, "v4": 26.019, "amplitude": 39.314, "phase_angle": 21.930, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1L", "suiteness": 0.503, "filter_rmsd": 0.104, "frame": { "rmsd": 0.024, "origin": [ 227.184, 322.591, 264.210 ], "x_axis": [ 0.019, 0.987, 0.160 ], "y_axis": [ -0.141, 0.161, -0.977 ], "z_axis": [ -0.990, -0.004, 0.142 ], "quaternion": [ 0.575, -0.423, -0.500, 0.490 ] } }, { "index": 19, "index_chain": 19, "chain_name": "J", "nt_resnum": 19, "nt_name": "U", "nt_code": "U", "nt_id": "///J/19", "linked_nts": [ "///J/18", "///J/20" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": 152.129, "beta": -134.768, "gamma": 170.157, "delta": 85.596, "epsilon": -127.298, "zeta": -99.333, "epsilon_zeta": -27.965, "bb_type": "--", "chi": -175.123, "glyco_bond": "anti", "C5prime_xyz": [ -1.484, 8.553, 1.453 ], "P_xyz": [ 0.642, 9.543, 0.310 ], "form": ".", "ssZp": 4.347, "Dp": 4.481, "splay_angle": 31.023, "splay_distance": 4.899, "splay_ratio": 0.268, "d22": null, "d64": null, "eta": 170.791, "theta": -167.944, "eta_prime": -171.673, "theta_prime": -166.704, "eta_base": -120.513, "theta_base": -153.440, "v0": 0.558, "v1": -21.272, "v2": 32.772, "v3": -33.272, "v4": 20.733, "amplitude": 34.399, "phase_angle": 17.693, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.398, "filter_rmsd": 0.114, "frame": { "rmsd": 0.029, "origin": [ 223.863, 324.119, 265.611 ], "x_axis": [ -0.000, 0.886, -0.463 ], "y_axis": [ -0.167, -0.456, -0.874 ], "z_axis": [ -0.986, 0.077, 0.148 ], "quaternion": [ 0.416, -0.572, -0.314, 0.633 ] } }, { "index": 20, "index_chain": 20, "chain_name": "J", "nt_resnum": 20, "nt_name": "G", "nt_code": "G", "nt_id": "///J/20", "linked_nts": [ "///J/19", "///J/21" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -65.459, "beta": 172.156, "gamma": 45.239, "delta": 83.706, "epsilon": -139.743, "zeta": -74.838, "epsilon_zeta": -64.905, "bb_type": "BI", "chi": -164.069, "glyco_bond": "anti", "C5prime_xyz": [ -1.009, 8.657, 0.810 ], "P_xyz": [ 1.544, 8.827, 1.411 ], "form": "A", "ssZp": 4.453, "Dp": 4.641, "splay_angle": 21.830, "splay_distance": 3.526, "splay_ratio": 0.191, "d22": null, "d64": null, "eta": 166.446, "theta": -136.603, "eta_prime": 170.635, "theta_prime": -133.975, "eta_base": -170.704, "theta_base": -106.765, "v0": 3.409, "v1": -25.116, "v2": 35.966, "v3": -34.826, "v4": 19.900, "amplitude": 36.960, "phase_angle": 13.317, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.381, "filter_rmsd": 0.035, "frame": { "rmsd": 0.035, "origin": [ 219.927, 323.695, 268.497 ], "x_axis": [ 0.216, 0.565, -0.797 ], "y_axis": [ -0.056, -0.807, -0.587 ], "z_axis": [ -0.975, 0.172, -0.143 ], "quaternion": [ -0.258, 0.736, 0.173, -0.602 ] } }, { "index": 21, "index_chain": 21, "chain_name": "J", "nt_resnum": 21, "nt_name": "U", "nt_code": "U", "nt_id": "///J/21", "linked_nts": [ "///J/20", "///J/22" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -60.078, "beta": 161.397, "gamma": 56.462, "delta": 79.032, "epsilon": -146.643, "zeta": -62.834, "epsilon_zeta": -83.810, "bb_type": "BI", "chi": -161.299, "glyco_bond": "anti", "C5prime_xyz": [ -1.599, 8.821, 0.507 ], "P_xyz": [ 0.960, 9.396, 0.513 ], "form": "A", "ssZp": 4.330, "Dp": 4.520, "splay_angle": 21.005, "splay_distance": 3.435, "splay_ratio": 0.184, "d22": 3.994, "d64": 3.936, "eta": 165.321, "theta": -135.707, "eta_prime": -176.141, "theta_prime": -138.822, "eta_base": -133.324, "theta_base": -103.091, "v0": -4.322, "v1": -19.251, "v2": 34.192, "v3": -37.523, "v4": 26.431, "amplitude": 37.720, "phase_angle": 24.980, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.884, "filter_rmsd": 0.101, "frame": { "rmsd": 0.020, "origin": [ 217.218, 325.821, 267.741 ], "x_axis": [ 0.272, 0.014, -0.962 ], "y_axis": [ -0.261, -0.961, -0.088 ], "z_axis": [ -0.926, 0.275, -0.258 ], "quaternion": [ -0.115, 0.789, -0.078, -0.598 ] } }, { "index": 22, "index_chain": 22, "chain_name": "J", "nt_resnum": 22, "nt_name": "U", "nt_code": "U", "nt_id": "///J/22", "linked_nts": [ "///J/21", "///J/23" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -95.009, "beta": 163.710, "gamma": 81.371, "delta": 75.765, "epsilon": -143.860, "zeta": -88.506, "epsilon_zeta": -55.354, "bb_type": "BI", "chi": -163.133, "glyco_bond": "anti", "C5prime_xyz": [ -1.618, 8.785, 0.636 ], "P_xyz": [ 0.713, 9.543, -0.214 ], "form": ".", "ssZp": 4.511, "Dp": 4.680, "splay_angle": 28.014, "splay_distance": 4.450, "splay_ratio": 0.245, "d22": null, "d64": null, "eta": 155.111, "theta": -162.825, "eta_prime": 174.867, "theta_prime": -165.428, "eta_base": -129.204, "theta_base": -152.954, "v0": -1.076, "v1": -24.454, "v2": 39.290, "v3": -40.833, "v4": 26.377, "amplitude": 41.792, "phase_angle": 19.924, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.024, "filter_rmsd": 0.103, "frame": { "rmsd": 0.018, "origin": [ 215.289, 327.283, 265.303 ], "x_axis": [ 0.120, -0.574, -0.810 ], "y_axis": [ -0.536, -0.725, 0.434 ], "z_axis": [ -0.836, 0.382, -0.394 ], "quaternion": [ 0.017, 0.748, -0.371, -0.550 ] } }, { "index": 23, "index_chain": 23, "chain_name": "J", "nt_resnum": 23, "nt_name": "G", "nt_code": "G", "nt_id": "///J/23", "linked_nts": [ "///J/22", "///J/24" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -66.195, "beta": 156.663, "gamma": 73.502, "delta": 77.577, "epsilon": -139.063, "zeta": -71.881, "epsilon_zeta": -67.182, "bb_type": "BI", "chi": -175.547, "glyco_bond": "anti", "C5prime_xyz": [ -1.513, 8.675, 1.390 ], "P_xyz": [ 1.011, 9.286, 1.310 ], "form": "A", "ssZp": 4.566, "Dp": 4.624, "splay_angle": 23.127, "splay_distance": 3.771, "splay_ratio": 0.205, "d22": null, "d64": null, "eta": 176.079, "theta": -141.919, "eta_prime": -177.071, "theta_prime": -143.250, "eta_base": -154.832, "theta_base": -116.821, "v0": -0.388, "v1": -23.582, "v2": 37.251, "v3": -38.474, "v4": 24.560, "amplitude": 39.436, "phase_angle": 19.163, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.311, "filter_rmsd": 0.015, "frame": { "rmsd": 0.015, "origin": [ 213.095, 330.455, 263.084 ], "x_axis": [ 0.114, -0.862, -0.494 ], "y_axis": [ -0.501, -0.479, 0.721 ], "z_axis": [ -0.858, 0.165, -0.486 ], "quaternion": [ 0.193, 0.721, -0.473, -0.469 ] } }, { "index": 24, "index_chain": 24, "chain_name": "J", "nt_resnum": 24, "nt_name": "C", "nt_code": "C", "nt_id": "///J/24", "linked_nts": [ "///J/23", "///J/25" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -72.697, "beta": 169.906, "gamma": 63.888, "delta": 77.655, "epsilon": -143.513, "zeta": -67.282, "epsilon_zeta": -76.231, "bb_type": "BI", "chi": -164.779, "glyco_bond": "anti", "C5prime_xyz": [ -1.489, 8.860, 0.746 ], "P_xyz": [ 1.032, 9.513, 0.793 ], "form": "A", "ssZp": 4.464, "Dp": 4.614, "splay_angle": 22.205, "splay_distance": 3.661, "splay_ratio": 0.196, "d22": 3.939, "d64": 4.083, "eta": 165.513, "theta": -138.911, "eta_prime": -179.269, "theta_prime": -137.382, "eta_base": -136.272, "theta_base": -101.605, "v0": -2.171, "v1": -22.190, "v2": 36.692, "v3": -38.818, "v4": 25.893, "amplitude": 39.461, "phase_angle": 21.592, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.750, "filter_rmsd": 0.066, "frame": { "rmsd": 0.010, "origin": [ 211.311, 330.883, 259.789 ], "x_axis": [ -0.169, -0.985, 0.026 ], "y_axis": [ -0.529, 0.113, 0.841 ], "z_axis": [ -0.832, 0.128, -0.540 ], "quaternion": [ -0.318, -0.561, 0.675, 0.359 ] } }, { "index": 25, "index_chain": 25, "chain_name": "J", "nt_resnum": 25, "nt_name": "U", "nt_code": "U", "nt_id": "///J/25", "linked_nts": [ "///J/24", "///J/26" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop", "alpha": -66.466, "beta": 165.608, "gamma": 63.950, "delta": 79.274, "epsilon": -142.989, "zeta": -69.794, "epsilon_zeta": -73.195, "bb_type": "BI", "chi": -157.389, "glyco_bond": "anti", "C5prime_xyz": [ -1.788, 8.890, 0.328 ], "P_xyz": [ 0.716, 9.659, 0.158 ], "form": ".", "ssZp": 4.215, "Dp": 4.523, "splay_angle": 21.443, "splay_distance": 3.508, "splay_ratio": 0.187, "d22": 3.976, "d64": 3.654, "eta": 169.191, "theta": -138.093, "eta_prime": -171.749, "theta_prime": -136.339, "eta_base": -120.288, "theta_base": -91.432, "v0": -3.829, "v1": -19.352, "v2": 33.893, "v3": -36.877, "v4": 25.728, "amplitude": 37.186, "phase_angle": 24.292, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.773, "filter_rmsd": 0.101, "frame": { "rmsd": 0.008, "origin": [ 209.036, 329.104, 257.538 ], "x_axis": [ -0.394, -0.727, 0.563 ], "y_axis": [ -0.449, 0.686, 0.572 ], "z_axis": [ -0.802, -0.028, -0.597 ], "quaternion": [ -0.417, -0.359, 0.818, 0.166 ] } }, { "index": 26, "index_chain": 26, "chain_name": "J", "nt_resnum": 26, "nt_name": "C", "nt_code": "C", "nt_id": "///J/26", "linked_nts": [ "///J/25", "///J/27" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-canonical,non-pair-contact,helix-end,hairpin-loop", "alpha": -62.640, "beta": 167.398, "gamma": 53.895, "delta": 81.362, "epsilon": -90.697, "zeta": -145.167, "epsilon_zeta": 54.469, "bb_type": "--", "chi": -141.504, "glyco_bond": "anti", "C5prime_xyz": [ -1.851, 8.821, -0.576 ], "P_xyz": [ 0.644, 9.456, -1.013 ], "form": ".", "ssZp": 2.869, "Dp": 4.496, "splay_angle": 27.713, "splay_distance": 4.761, "splay_ratio": 0.242, "d22": null, "d64": null, "eta": -179.202, "theta": -133.843, "eta_prime": -164.918, "theta_prime": -137.226, "eta_base": -111.773, "theta_base": -123.409, "v0": -2.125, "v1": -20.454, "v2": 33.893, "v3": -36.061, "v4": 24.117, "amplitude": 36.519, "phase_angle": 21.860, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.962, "filter_rmsd": 0.062, "frame": { "rmsd": 0.010, "origin": [ 206.010, 327.337, 257.380 ], "x_axis": [ -0.518, -0.097, 0.850 ], "y_axis": [ -0.320, 0.943, -0.088 ], "z_axis": [ -0.794, -0.317, -0.519 ], "quaternion": [ -0.476, -0.121, 0.863, -0.117 ] } }, { "index": 27, "index_chain": 27, "chain_name": "J", "nt_resnum": 27, "nt_name": "A", "nt_code": "A", "nt_id": "///J/27", "linked_nts": [ "///J/26", "///J/28" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-stack,non-pair-contact,hairpin-loop", "alpha": 85.451, "beta": -93.293, "gamma": -166.064, "delta": 77.959, "epsilon": 157.847, "zeta": -86.109, "epsilon_zeta": -116.043, "bb_type": "BI", "chi": -152.758, "glyco_bond": "anti", "C5prime_xyz": [ -1.432, 8.742, 0.030 ], "P_xyz": [ -1.269, 9.099, -2.558 ], "form": ".", "ssZp": 4.108, "Dp": 4.212, "splay_angle": 46.541, "splay_distance": 6.737, "splay_ratio": 0.399, "d22": null, "d64": null, "eta": -170.219, "theta": 156.172, "eta_prime": -165.934, "theta_prime": 178.621, "eta_base": -143.728, "theta_base": -139.209, "v0": 0.914, "v1": -24.066, "v2": 36.579, "v3": -37.081, "v4": 22.974, "amplitude": 38.313, "phase_angle": 17.305, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.040, "frame": { "rmsd": 0.010, "origin": [ 201.592, 326.490, 255.818 ], "x_axis": [ -0.560, 0.144, 0.816 ], "y_axis": [ -0.254, 0.907, -0.334 ], "z_axis": [ -0.788, -0.395, -0.472 ], "quaternion": [ -0.468, -0.032, 0.857, -0.213 ] } }, { "index": 28, "index_chain": 28, "chain_name": "J", "nt_resnum": 28, "nt_name": "A", "nt_code": "A", "nt_id": "///J/28", "linked_nts": [ "///J/27", "///J/29" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,~C2'-endo,non-stack,non-pair-contact,hairpin-loop", "alpha": 172.458, "beta": -108.713, "gamma": 161.925, "delta": 149.218, "epsilon": -27.062, "zeta": 89.898, "epsilon_zeta": 243.040, "bb_type": "--", "chi": 140.836, "glyco_bond": "--", "C5prime_xyz": [ -3.255, 7.407, 2.764 ], "P_xyz": [ -1.144, 6.684, 4.104 ], "form": ".", "ssZp": -1.191, "Dp": 1.336, "splay_angle": 43.320, "splay_distance": 7.303, "splay_ratio": 0.370, "d22": null, "d64": null, "eta": -23.268, "theta": 54.768, "eta_prime": -92.535, "theta_prime": 135.614, "eta_base": -68.541, "theta_base": 128.257, "v0": -28.435, "v1": 43.036, "v2": -40.276, "v3": 24.934, "v4": 2.002, "amplitude": 43.253, "phase_angle": 158.616, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32t", "cluster": "1t", "suiteness": 0.010, "filter_rmsd": 0.050, "frame": { "rmsd": 0.025, "origin": [ 195.437, 325.254, 253.377 ], "x_axis": [ 0.138, 0.454, 0.880 ], "y_axis": [ 0.817, 0.450, -0.361 ], "z_axis": [ -0.560, 0.769, -0.308 ], "quaternion": [ 0.566, -0.499, -0.637, -0.160 ] } }, { "index": 29, "index_chain": 29, "chain_name": "J", "nt_resnum": 29, "nt_name": "A", "nt_code": "A", "nt_id": "///J/29", "linked_nts": [ "///J/28", "///J/30" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C2'-endo,non-pair-contact,hairpin-loop,cap-donor", "alpha": 170.203, "beta": -127.177, "gamma": 68.878, "delta": 147.828, "epsilon": -126.038, "zeta": 95.721, "epsilon_zeta": 138.240, "bb_type": "--", "chi": -121.512, "glyco_bond": "anti", "C5prime_xyz": [ -3.175, 8.324, -1.194 ], "P_xyz": [ -1.715, 9.921, 0.206 ], "form": ".", "ssZp": 1.309, "Dp": 1.623, "splay_angle": 30.969, "splay_distance": 5.020, "splay_ratio": 0.335, "d22": null, "d64": null, "eta": 166.125, "theta": 98.848, "eta_prime": 171.863, "theta_prime": 77.205, "eta_base": 164.236, "theta_base": 105.177, "v0": -29.432, "v1": 42.800, "v2": -38.825, "v3": 23.068, "v4": 3.687, "amplitude": 42.453, "phase_angle": 156.140, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.035, "frame": { "rmsd": 0.027, "origin": [ 201.686, 322.732, 256.190 ], "x_axis": [ -0.958, 0.219, 0.183 ], "y_axis": [ -0.083, 0.402, -0.912 ], "z_axis": [ -0.273, -0.889, -0.367 ], "quaternion": [ -0.138, 0.041, 0.826, -0.545 ] } }, { "index": 30, "index_chain": 30, "chain_name": "J", "nt_resnum": 30, "nt_name": "A", "nt_code": "A", "nt_id": "///J/30", "linked_nts": [ "///J/29", "///J/31" ], "nt_type": "RNA", "dbn": ".", "summary": "syn,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,hairpin-loop,cap-acceptor", "alpha": -76.321, "beta": 141.612, "gamma": 26.017, "delta": 79.255, "epsilon": -141.888, "zeta": -72.113, "epsilon_zeta": -69.774, "bb_type": "BI", "chi": 53.832, "glyco_bond": "syn", "C5prime_xyz": [ -5.492, 4.241, 1.373 ], "P_xyz": [ -5.388, 1.651, 1.820 ], "form": ".", "ssZp": -2.865, "Dp": 4.534, "splay_angle": 47.505, "splay_distance": 7.171, "splay_ratio": 0.413, "d22": null, "d64": null, "eta": 144.832, "theta": -151.384, "eta_prime": 150.840, "theta_prime": -161.169, "eta_base": 167.059, "theta_base": 148.200, "v0": -3.248, "v1": -20.262, "v2": 34.734, "v3": -37.287, "v4": 25.682, "amplitude": 37.808, "phase_angle": 23.263, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "0a", "suiteness": 0.017, "filter_rmsd": 0.043, "frame": { "rmsd": 0.015, "origin": [ 205.983, 324.605, 254.393 ], "x_axis": [ -0.438, 0.594, 0.674 ], "y_axis": [ 0.233, 0.800, -0.553 ], "z_axis": [ -0.868, -0.086, -0.489 ], "quaternion": [ -0.467, 0.250, 0.826, -0.193 ] } }, { "index": 31, "index_chain": 31, "chain_name": "J", "nt_resnum": 31, "nt_name": "G", "nt_code": "G", "nt_id": "///J/31", "linked_nts": [ "///J/30", "///J/32" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop", "alpha": -110.611, "beta": 116.360, "gamma": 120.886, "delta": 87.873, "epsilon": -177.709, "zeta": -85.229, "epsilon_zeta": -92.480, "bb_type": "BI", "chi": -168.257, "glyco_bond": "anti", "C5prime_xyz": [ -1.142, 8.514, 0.967 ], "P_xyz": [ 0.005, 9.474, -1.217 ], "form": "A", "ssZp": 4.416, "Dp": 4.390, "splay_angle": 26.842, "splay_distance": 4.185, "splay_ratio": 0.235, "d22": null, "d64": null, "eta": 161.330, "theta": -156.685, "eta_prime": 176.308, "theta_prime": -167.575, "eta_base": 151.409, "theta_base": -143.000, "v0": 7.359, "v1": -26.783, "v2": 34.979, "v3": -31.550, "v4": 15.446, "amplitude": 35.227, "phase_angle": 6.810, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.013, "frame": { "rmsd": 0.013, "origin": [ 209.227, 330.762, 256.123 ], "x_axis": [ -0.457, -0.736, 0.500 ], "y_axis": [ 0.401, -0.672, -0.623 ], "z_axis": [ 0.794, -0.084, 0.602 ], "quaternion": [ -0.344, 0.392, -0.214, 0.826 ] } }, { "index": 32, "index_chain": 32, "chain_name": "J", "nt_resnum": 32, "nt_name": "G", "nt_code": "G", "nt_id": "///J/32", "linked_nts": [ "///J/31", "///J/33" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": 166.638, "beta": -135.026, "gamma": 160.150, "delta": 80.697, "epsilon": -118.504, "zeta": -82.944, "epsilon_zeta": -35.560, "bb_type": "--", "chi": 170.809, "glyco_bond": "anti", "C5prime_xyz": [ -1.367, 8.263, 2.173 ], "P_xyz": [ 1.059, 9.044, 1.615 ], "form": "A", "ssZp": 4.563, "Dp": 4.648, "splay_angle": 23.541, "splay_distance": 3.802, "splay_ratio": 0.207, "d22": null, "d64": null, "eta": 173.631, "theta": -138.458, "eta_prime": -170.390, "theta_prime": -138.956, "eta_base": -127.516, "theta_base": -112.151, "v0": 1.628, "v1": -23.447, "v2": 35.285, "v3": -35.305, "v4": 21.169, "amplitude": 36.730, "phase_angle": 16.127, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.224, "filter_rmsd": 0.026, "frame": { "rmsd": 0.026, "origin": [ 211.134, 331.188, 259.823 ], "x_axis": [ -0.121, -0.988, 0.091 ], "y_axis": [ 0.501, -0.140, -0.854 ], "z_axis": [ 0.857, -0.058, 0.512 ], "quaternion": [ 0.559, -0.356, 0.342, -0.666 ] } }, { "index": 33, "index_chain": 33, "chain_name": "J", "nt_resnum": 33, "nt_name": "C", "nt_code": "C", "nt_id": "///J/33", "linked_nts": [ "///J/32", "///J/34" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -47.778, "beta": 166.669, "gamma": 43.217, "delta": 79.929, "epsilon": -156.450, "zeta": -83.045, "epsilon_zeta": -73.405, "bb_type": "BI", "chi": -156.042, "glyco_bond": "anti", "C5prime_xyz": [ -1.448, 8.872, 0.271 ], "P_xyz": [ 1.075, 9.435, 0.626 ], "form": ".", "ssZp": 4.225, "Dp": 4.486, "splay_angle": 22.982, "splay_distance": 4.179, "splay_ratio": 0.211, "d22": null, "d64": null, "eta": 163.544, "theta": -129.006, "eta_prime": -177.494, "theta_prime": -139.980, "eta_base": -132.541, "theta_base": -130.744, "v0": -1.550, "v1": -21.269, "v2": 34.784, "v3": -36.606, "v4": 24.108, "amplitude": 37.247, "phase_angle": 20.953, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.378, "filter_rmsd": 0.062, "frame": { "rmsd": 0.008, "origin": [ 213.028, 330.217, 262.973 ], "x_axis": [ 0.234, -0.868, -0.437 ], "y_axis": [ 0.525, 0.491, -0.695 ], "z_axis": [ 0.818, -0.067, 0.571 ], "quaternion": [ 0.758, -0.207, 0.414, -0.460 ] } }, { "index": 34, "index_chain": 34, "chain_name": "J", "nt_resnum": 34, "nt_name": "G", "nt_code": "G", "nt_id": "///J/34", "linked_nts": [ "///J/33", "///J/35" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": 138.011, "beta": -156.027, "gamma": -168.216, "delta": 79.728, "epsilon": -131.523, "zeta": -79.314, "epsilon_zeta": -52.209, "bb_type": "BI", "chi": -177.797, "glyco_bond": "anti", "C5prime_xyz": [ -1.525, 8.550, 1.550 ], "P_xyz": [ -0.193, 10.579, 0.576 ], "form": "A", "ssZp": 4.597, "Dp": 4.647, "splay_angle": 23.687, "splay_distance": 3.819, "splay_ratio": 0.209, "d22": null, "d64": null, "eta": 165.382, "theta": -170.061, "eta_prime": 176.051, "theta_prime": -162.214, "eta_base": -157.338, "theta_base": -129.221, "v0": 0.382, "v1": -23.442, "v2": 36.361, "v3": -37.110, "v4": 23.119, "amplitude": 38.237, "phase_angle": 18.020, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.556, "filter_rmsd": 0.016, "frame": { "rmsd": 0.016, "origin": [ 214.696, 328.306, 266.295 ], "x_axis": [ 0.220, -0.621, -0.752 ], "y_axis": [ 0.434, 0.753, -0.495 ], "z_axis": [ 0.874, -0.217, 0.435 ], "quaternion": [ 0.776, -0.090, 0.524, -0.340 ] } }, { "index": 35, "index_chain": 35, "chain_name": "J", "nt_resnum": 35, "nt_name": "A", "nt_code": "A", "nt_id": "///J/35", "linked_nts": [ "///J/34", "///J/36" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -55.568, "beta": 169.265, "gamma": 49.437, "delta": 79.028, "epsilon": -145.109, "zeta": -80.630, "epsilon_zeta": -64.479, "bb_type": "BI", "chi": -160.848, "glyco_bond": "anti", "C5prime_xyz": [ -1.628, 8.775, 0.542 ], "P_xyz": [ 0.871, 9.421, 0.919 ], "form": "A", "ssZp": 4.332, "Dp": 4.569, "splay_angle": 22.619, "splay_distance": 3.604, "splay_ratio": 0.197, "d22": null, "d64": null, "eta": 166.863, "theta": -151.855, "eta_prime": -178.361, "theta_prime": -149.812, "eta_base": -136.681, "theta_base": -123.477, "v0": -1.185, "v1": -22.578, "v2": 36.396, "v3": -38.077, "v4": 24.750, "amplitude": 38.806, "phase_angle": 20.299, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.770, "filter_rmsd": 0.047, "frame": { "rmsd": 0.020, "origin": [ 217.112, 325.684, 267.665 ], "x_axis": [ 0.349, -0.047, -0.936 ], "y_axis": [ 0.272, 0.961, 0.053 ], "z_axis": [ 0.897, -0.273, 0.348 ], "quaternion": [ 0.815, 0.100, 0.562, -0.098 ] } }, { "index": 36, "index_chain": 36, "chain_name": "J", "nt_resnum": 36, "nt_name": "C", "nt_code": "C", "nt_id": "///J/36", "linked_nts": [ "///J/35", "///J/37" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -66.266, "beta": 166.363, "gamma": 58.753, "delta": 77.034, "epsilon": -142.339, "zeta": -56.006, "epsilon_zeta": -86.334, "bb_type": "BI", "chi": -157.556, "glyco_bond": "anti", "C5prime_xyz": [ -1.402, 8.806, 0.352 ], "P_xyz": [ 1.164, 9.235, 0.113 ], "form": ".", "ssZp": 4.302, "Dp": 4.657, "splay_angle": 23.860, "splay_distance": 4.133, "splay_ratio": 0.216, "d22": null, "d64": null, "eta": 165.053, "theta": -130.563, "eta_prime": 176.352, "theta_prime": -135.037, "eta_base": -145.699, "theta_base": -115.437, "v0": 2.544, "v1": -26.894, "v2": 39.896, "v3": -39.325, "v4": 23.171, "amplitude": 41.317, "phase_angle": 15.069, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.867, "filter_rmsd": 0.070, "frame": { "rmsd": 0.021, "origin": [ 220.005, 323.591, 268.154 ], "x_axis": [ 0.363, 0.484, -0.796 ], "y_axis": [ 0.148, 0.814, 0.562 ], "z_axis": [ 0.920, -0.322, 0.224 ], "quaternion": [ 0.775, 0.285, 0.554, 0.108 ] } }, { "index": 37, "index_chain": 37, "chain_name": "J", "nt_resnum": 37, "nt_name": "G", "nt_code": "G", "nt_id": "///J/37", "linked_nts": [ "///J/36", "///J/38" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -103.759, "beta": 156.248, "gamma": 106.297, "delta": 70.431, "epsilon": -144.579, "zeta": -69.789, "epsilon_zeta": -74.790, "bb_type": "BI", "chi": -174.204, "glyco_bond": "anti", "C5prime_xyz": [ -1.866, 8.720, 1.298 ], "P_xyz": [ 0.105, 10.165, 0.423 ], "form": "A", "ssZp": 4.569, "Dp": 4.615, "splay_angle": 26.402, "splay_distance": 4.180, "splay_ratio": 0.235, "d22": null, "d64": null, "eta": 161.703, "theta": -155.112, "eta_prime": -178.474, "theta_prime": -153.286, "eta_base": -136.532, "theta_base": -117.147, "v0": -1.431, "v1": -25.365, "v2": 41.315, "v3": -43.156, "v4": 27.912, "amplitude": 44.062, "phase_angle": 20.339, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.027, "frame": { "rmsd": 0.027, "origin": [ 223.434, 322.172, 266.335 ], "x_axis": [ 0.221, 0.849, -0.480 ], "y_axis": [ 0.032, 0.486, 0.873 ], "z_axis": [ 0.975, -0.208, 0.080 ], "quaternion": [ 0.668, 0.405, 0.544, 0.305 ] } }, { "index": 38, "index_chain": 38, "chain_name": "J", "nt_resnum": 38, "nt_name": "A", "nt_code": "A", "nt_id": "///J/38", "linked_nts": [ "///J/37", "///J/39" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -76.818, "beta": 177.727, "gamma": 75.233, "delta": 80.286, "epsilon": -147.586, "zeta": -77.211, "epsilon_zeta": -70.375, "bb_type": "BI", "chi": -164.980, "glyco_bond": "anti", "C5prime_xyz": [ -1.646, 8.747, 0.787 ], "P_xyz": [ 0.900, 9.318, 0.861 ], "form": "A", "ssZp": 4.342, "Dp": 4.498, "splay_angle": 22.878, "splay_distance": 3.693, "splay_ratio": 0.201, "d22": null, "d64": null, "eta": 174.921, "theta": -147.159, "eta_prime": -169.814, "theta_prime": -146.754, "eta_base": -120.823, "theta_base": -123.166, "v0": -1.035, "v1": -22.856, "v2": 36.772, "v3": -38.161, "v4": 24.749, "amplitude": 39.121, "phase_angle": 19.954, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.234, "filter_rmsd": 0.048, "frame": { "rmsd": 0.019, "origin": [ 227.076, 322.604, 264.327 ], "x_axis": [ 0.131, 0.973, 0.192 ], "y_axis": [ -0.068, -0.185, 0.980 ], "z_axis": [ 0.989, -0.141, 0.042 ], "quaternion": [ 0.497, 0.564, 0.401, 0.524 ] } }, { "index": 39, "index_chain": 39, "chain_name": "J", "nt_resnum": 39, "nt_name": "A", "nt_code": "A", "nt_id": "///J/39", "linked_nts": [ "///J/38", "///J/40" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop", "alpha": -59.004, "beta": 167.784, "gamma": 60.151, "delta": 80.003, "epsilon": -162.237, "zeta": -76.876, "epsilon_zeta": -85.360, "bb_type": "BI", "chi": -154.790, "glyco_bond": "anti", "C5prime_xyz": [ -1.757, 8.837, 0.234 ], "P_xyz": [ 0.759, 9.447, 0.448 ], "form": ".", "ssZp": 3.958, "Dp": 4.268, "splay_angle": 31.420, "splay_distance": 5.007, "splay_ratio": 0.271, "d22": null, "d64": null, "eta": 175.379, "theta": -118.265, "eta_prime": -169.533, "theta_prime": -121.362, "eta_base": -133.440, "theta_base": -71.311, "v0": -3.705, "v1": -18.948, "v2": 33.356, "v3": -36.203, "v4": 25.361, "amplitude": 36.594, "phase_angle": 24.286, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.885, "filter_rmsd": 0.055, "frame": { "rmsd": 0.030, "origin": [ 230.540, 323.067, 263.135 ], "x_axis": [ 0.030, 0.746, 0.666 ], "y_axis": [ -0.060, -0.663, 0.746 ], "z_axis": [ 0.998, -0.062, 0.025 ], "quaternion": [ 0.313, 0.646, 0.265, 0.644 ] } }, { "index": 40, "index_chain": 40, "chain_name": "J", "nt_resnum": 40, "nt_name": "A", "nt_code": "A", "nt_id": "///J/40", "linked_nts": [ "///J/39", "///J/41" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop", "alpha": 174.811, "beta": -125.344, "gamma": 130.112, "delta": 73.282, "epsilon": -157.666, "zeta": -85.807, "epsilon_zeta": -71.859, "bb_type": "BI", "chi": -165.709, "glyco_bond": "anti", "C5prime_xyz": [ -1.729, 8.864, 0.859 ], "P_xyz": [ 0.744, 9.149, 0.148 ], "form": "A", "ssZp": 4.398, "Dp": 4.430, "splay_angle": 25.086, "splay_distance": 4.006, "splay_ratio": 0.218, "d22": null, "d64": null, "eta": 148.039, "theta": -126.516, "eta_prime": 178.386, "theta_prime": -137.340, "eta_base": -109.891, "theta_base": -99.335, "v0": -6.853, "v1": -18.498, "v2": 35.777, "v3": -40.861, "v4": 30.108, "amplitude": 40.639, "phase_angle": 28.315, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.058, "frame": { "rmsd": 0.033, "origin": [ 233.911, 324.188, 266.662 ], "x_axis": [ -0.310, -0.115, 0.944 ], "y_axis": [ 0.011, -0.993, -0.117 ], "z_axis": [ 0.951, -0.026, 0.309 ], "quaternion": [ -0.039, 0.586, -0.044, 0.808 ] } }, { "index": 41, "index_chain": 41, "chain_name": "J", "nt_resnum": 41, "nt_name": "C", "nt_code": "C", "nt_id": "///J/41", "linked_nts": [ "///J/40", "///J/42" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop,A-minor", "alpha": 170.650, "beta": -138.207, "gamma": 144.265, "delta": 73.929, "epsilon": -113.317, "zeta": -103.956, "epsilon_zeta": -9.360, "bb_type": "--", "chi": -171.485, "glyco_bond": "anti", "C5prime_xyz": [ -1.329, 8.663, 1.256 ], "P_xyz": [ 0.914, 9.334, 0.117 ], "form": "A", "ssZp": 4.576, "Dp": 4.765, "splay_angle": 25.012, "splay_distance": 4.119, "splay_ratio": 0.220, "d22": null, "d64": null, "eta": 157.684, "theta": -145.931, "eta_prime": 175.185, "theta_prime": -145.033, "eta_base": -125.209, "theta_base": -128.117, "v0": -0.099, "v1": -25.641, "v2": 40.703, "v3": -41.787, "v4": 26.267, "amplitude": 42.983, "phase_angle": 18.745, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.074, "frame": { "rmsd": 0.027, "origin": [ 236.250, 324.125, 269.914 ], "x_axis": [ -0.302, -0.766, 0.567 ], "y_axis": [ 0.335, -0.643, -0.689 ], "z_axis": [ 0.893, -0.018, 0.450 ], "quaternion": [ -0.356, 0.472, -0.229, 0.774 ] } }, { "index": 42, "index_chain": 42, "chain_name": "J", "nt_resnum": 42, "nt_name": "G", "nt_code": "G", "nt_id": "///J/42", "linked_nts": [ "///J/41", "///J/43" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -23.252, "beta": 152.524, "gamma": 25.247, "delta": 76.726, "epsilon": -165.664, "zeta": -87.930, "epsilon_zeta": -77.734, "bb_type": "BI", "chi": -155.267, "glyco_bond": "anti", "C5prime_xyz": [ -1.747, 8.915, 0.220 ], "P_xyz": [ 0.663, 9.682, 0.793 ], "form": "A", "ssZp": 4.183, "Dp": 4.392, "splay_angle": 18.772, "splay_distance": 3.069, "splay_ratio": 0.164, "d22": null, "d64": null, "eta": 166.186, "theta": -143.236, "eta_prime": 178.433, "theta_prime": -147.381, "eta_base": -151.807, "theta_base": -120.803, "v0": -3.246, "v1": -21.073, "v2": 36.185, "v3": -39.108, "v4": 26.753, "amplitude": 39.407, "phase_angle": 23.331, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.022, "frame": { "rmsd": 0.022, "origin": [ 238.459, 324.089, 273.390 ], "x_axis": [ -0.487, -0.870, -0.074 ], "y_axis": [ 0.495, -0.205, -0.844 ], "z_axis": [ 0.720, -0.448, 0.531 ], "quaternion": [ -0.458, 0.217, -0.433, 0.745 ] } }, { "index": 43, "index_chain": 43, "chain_name": "J", "nt_resnum": 43, "nt_name": "C", "nt_code": "C", "nt_id": "///J/43", "linked_nts": [ "///J/42", "///J/44" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": 170.299, "beta": -148.538, "gamma": 145.039, "delta": 67.419, "epsilon": 81.141, "zeta": 81.713, "epsilon_zeta": -0.572, "bb_type": "--", "chi": -162.549, "glyco_bond": "anti", "C5prime_xyz": [ -1.306, 8.759, 0.715 ], "P_xyz": [ 0.706, 9.469, -0.771 ], "form": ".", "ssZp": 3.625, "Dp": 3.659, "splay_angle": 23.359, "splay_distance": 4.153, "splay_ratio": 0.208, "d22": null, "d64": null, "eta": -179.122, "theta": -120.858, "eta_prime": -168.928, "theta_prime": -136.930, "eta_base": -132.469, "theta_base": -110.263, "v0": 4.496, "v1": -28.525, "v2": 41.203, "v3": -39.457, "v4": 22.054, "amplitude": 42.231, "phase_angle": 12.662, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.070, "frame": { "rmsd": 0.016, "origin": [ 239.561, 322.403, 275.705 ], "x_axis": [ -0.232, -0.815, -0.531 ], "y_axis": [ 0.819, 0.131, -0.559 ], "z_axis": [ 0.525, -0.565, 0.636 ], "quaternion": [ 0.620, 0.002, 0.426, -0.659 ] } }, { "index": 44, "index_chain": 44, "chain_name": "J", "nt_resnum": 44, "nt_name": "A", "nt_code": "A", "nt_id": "///J/44", "linked_nts": [ "///J/43", "///J/45" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,phosphate", "alpha": 47.361, "beta": -159.563, "gamma": -166.975, "delta": 81.173, "epsilon": -144.438, "zeta": -79.139, "epsilon_zeta": -65.299, "bb_type": "BI", "chi": -168.284, "glyco_bond": "anti", "C5prime_xyz": [ -1.375, 8.508, 1.072 ], "P_xyz": [ -0.186, 10.467, -0.164 ], "form": ".", "ssZp": 4.554, "Dp": 4.662, "splay_angle": 33.934, "splay_distance": 4.846, "splay_ratio": 0.298, "d22": null, "d64": null, "eta": 132.665, "theta": -149.309, "eta_prime": 161.303, "theta_prime": -154.645, "eta_base": -147.412, "theta_base": -85.376, "v0": 5.246, "v1": -27.216, "v2": 37.793, "v3": -35.756, "v4": 19.286, "amplitude": 38.498, "phase_angle": 10.986, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.044, "frame": { "rmsd": 0.023, "origin": [ 240.330, 318.785, 277.593 ], "x_axis": [ 0.128, -0.445, -0.886 ], "y_axis": [ 0.814, 0.558, -0.163 ], "z_axis": [ 0.567, -0.700, 0.433 ], "quaternion": [ 0.728, 0.185, 0.499, -0.432 ] } }, { "index": 45, "index_chain": 45, "chain_name": "J", "nt_resnum": 45, "nt_name": "A", "nt_code": "A", "nt_id": "///J/45", "linked_nts": [ "///J/44", "///J/46" ], "nt_type": "RNA", "dbn": ".", "summary": "syn,~C3'-endo,non-pair-contact,ss-non-loop,cap-acceptor", "alpha": 153.378, "beta": -162.772, "gamma": -174.831, "delta": 81.806, "epsilon": -119.699, "zeta": 36.404, "epsilon_zeta": 203.897, "bb_type": "--", "chi": 10.730, "glyco_bond": "syn", "C5prime_xyz": [ -5.510, 4.024, -1.108 ], "P_xyz": [ -7.194, 2.508, 0.214 ], "form": ".", "ssZp": -4.502, "Dp": 4.576, "splay_angle": 68.573, "splay_distance": 11.161, "splay_ratio": 0.571, "d22": null, "d64": null, "eta": 168.874, "theta": -54.001, "eta_prime": -178.551, "theta_prime": -70.923, "eta_base": -94.480, "theta_base": -119.918, "v0": -2.845, "v1": -19.763, "v2": 33.446, "v3": -36.082, "v4": 24.536, "amplitude": 36.335, "phase_angle": 23.003, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.722, "filter_rmsd": 0.050, "frame": { "rmsd": 0.028, "origin": [ 244.271, 316.383, 276.114 ], "x_axis": [ -0.704, -0.573, -0.419 ], "y_axis": [ -0.514, 0.003, 0.858 ], "z_axis": [ -0.491, 0.819, -0.296 ], "quaternion": [ -0.025, -0.384, 0.708, 0.593 ] } }, { "index": 46, "index_chain": 46, "chain_name": "J", "nt_resnum": 46, "nt_name": "G", "nt_code": "G", "nt_id": "///J/46", "linked_nts": [ "///J/45", "///J/47" ], "nt_type": "RNA", "dbn": "[", "summary": "pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack", "alpha": -166.016, "beta": 141.867, "gamma": -89.715, "delta": 79.511, "epsilon": -148.187, "zeta": -73.440, "epsilon_zeta": -74.747, "bb_type": "BI", "chi": -168.615, "glyco_bond": "anti", "C5prime_xyz": [ -1.272, 8.557, 0.979 ], "P_xyz": [ -0.815, 10.515, 2.657 ], "form": "A", "ssZp": 4.623, "Dp": 4.690, "splay_angle": 25.159, "splay_distance": 3.962, "splay_ratio": 0.224, "d22": null, "d64": null, "eta": -83.939, "theta": 169.787, "eta_prime": -50.524, "theta_prime": -172.660, "eta_base": -35.145, "theta_base": -132.503, "v0": 5.535, "v1": -28.755, "v2": 39.741, "v3": -37.573, "v4": 20.208, "amplitude": 40.467, "phase_angle": 10.871, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33m", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.029, "frame": { "rmsd": 0.029, "origin": [ 251.117, 307.763, 277.952 ], "x_axis": [ 0.197, -0.632, 0.750 ], "y_axis": [ -0.170, 0.731, 0.661 ], "z_axis": [ -0.966, -0.257, 0.037 ], "quaternion": [ 0.701, 0.328, -0.612, -0.165 ] } }, { "index": 47, "index_chain": 47, "chain_name": "J", "nt_resnum": 47, "nt_name": "G", "nt_code": "G", "nt_id": "///J/47", "linked_nts": [ "///J/46", "///J/48" ], "nt_type": "RNA", "dbn": "[", "summary": "pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,cap-donor,phosphate", "alpha": -67.031, "beta": 167.351, "gamma": 72.303, "delta": 80.471, "epsilon": -139.735, "zeta": -76.488, "epsilon_zeta": -63.247, "bb_type": "BI", "chi": -166.547, "glyco_bond": "anti", "C5prime_xyz": [ -1.506, 8.734, 0.918 ], "P_xyz": [ 1.044, 9.225, 0.804 ], "form": "A", "ssZp": 4.467, "Dp": 4.610, "splay_angle": 22.686, "splay_distance": 3.711, "splay_ratio": 0.199, "d22": null, "d64": null, "eta": 179.103, "theta": -142.189, "eta_prime": -166.871, "theta_prime": -143.884, "eta_base": -132.148, "theta_base": -119.074, "v0": 0.091, "v1": -23.140, "v2": 36.150, "v3": -37.021, "v4": 23.334, "amplitude": 38.109, "phase_angle": 18.453, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.441, "filter_rmsd": 0.022, "frame": { "rmsd": 0.022, "origin": [ 248.486, 304.824, 277.575 ], "x_axis": [ 0.099, -0.175, 0.980 ], "y_axis": [ -0.303, 0.932, 0.197 ], "z_axis": [ -0.948, -0.316, 0.039 ], "quaternion": [ 0.720, 0.178, -0.670, 0.045 ] } }, { "index": 48, "index_chain": 48, "chain_name": "J", "nt_resnum": 48, "nt_name": "C", "nt_code": "C", "nt_id": "///J/48", "linked_nts": [ "///J/47", "///J/49" ], "nt_type": "RNA", "dbn": "[", "summary": "pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop", "alpha": -62.565, "beta": 162.347, "gamma": 60.678, "delta": 76.585, "epsilon": -150.093, "zeta": -70.520, "epsilon_zeta": -79.574, "bb_type": "BI", "chi": -162.073, "glyco_bond": "anti", "C5prime_xyz": [ -1.595, 8.896, 0.603 ], "P_xyz": [ 0.918, 9.563, 0.462 ], "form": ".", "ssZp": 4.436, "Dp": 4.598, "splay_angle": 28.085, "splay_distance": 4.291, "splay_ratio": 0.269, "d22": null, "d64": null, "eta": 165.545, "theta": -147.835, "eta_prime": -178.464, "theta_prime": -151.208, "eta_base": -135.953, "theta_base": -82.770, "v0": -1.435, "v1": -23.202, "v2": 37.665, "v3": -39.319, "v4": 25.758, "amplitude": 40.208, "phase_angle": 20.487, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.826, "filter_rmsd": 0.066, "frame": { "rmsd": 0.012, "origin": [ 245.935, 302.266, 278.425 ], "x_axis": [ -0.052, 0.360, 0.932 ], "y_axis": [ -0.385, 0.854, -0.351 ], "z_axis": [ -0.922, -0.377, 0.094 ], "quaternion": [ 0.688, 0.009, -0.673, 0.270 ] } }, { "index": 49, "index_chain": 49, "chain_name": "J", "nt_resnum": 49, "nt_name": "A", "nt_code": "A", "nt_id": "///J/49", "linked_nts": [ "///J/48", "///J/50" ], "nt_type": "RNA", "dbn": ".", "summary": "syn,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop", "alpha": -66.006, "beta": 172.752, "gamma": 63.916, "delta": 71.565, "epsilon": -145.025, "zeta": -71.842, "epsilon_zeta": -73.183, "bb_type": "BI", "chi": 19.759, "glyco_bond": "syn", "C5prime_xyz": [ -5.922, 4.309, -0.570 ], "P_xyz": [ -6.762, 1.831, -0.664 ], "form": ".", "ssZp": -4.420, "Dp": 4.489, "splay_angle": 32.781, "splay_distance": 5.060, "splay_ratio": 0.285, "d22": null, "d64": null, "eta": 174.220, "theta": -151.174, "eta_prime": -177.183, "theta_prime": -146.883, "eta_base": -97.257, "theta_base": -169.453, "v0": -9.549, "v1": -16.518, "v2": 34.789, "v3": -41.288, "v4": 32.098, "amplitude": 40.939, "phase_angle": 31.812, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.636, "filter_rmsd": 0.047, "frame": { "rmsd": 0.030, "origin": [ 241.997, 303.447, 279.651 ], "x_axis": [ 0.348, -0.562, 0.750 ], "y_axis": [ 0.119, -0.767, -0.630 ], "z_axis": [ 0.930, 0.308, -0.200 ], "quaternion": [ -0.309, 0.761, -0.146, 0.552 ] } }, { "index": 50, "index_chain": 50, "chain_name": "J", "nt_resnum": 50, "nt_name": "A", "nt_code": "A", "nt_id": "///J/50", "linked_nts": [ "///J/49", "///J/51" ], "nt_type": "RNA", "dbn": "[", "summary": "pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop", "alpha": -64.086, "beta": 165.931, "gamma": 51.727, "delta": 81.007, "epsilon": -144.541, "zeta": -74.686, "epsilon_zeta": -69.855, "bb_type": "BI", "chi": -163.105, "glyco_bond": "anti", "C5prime_xyz": [ -1.475, 8.683, 0.688 ], "P_xyz": [ 1.101, 9.134, 0.784 ], "form": "A", "ssZp": 4.501, "Dp": 4.662, "splay_angle": 22.533, "splay_distance": 3.608, "splay_ratio": 0.197, "d22": null, "d64": null, "eta": 162.050, "theta": -143.334, "eta_prime": 179.104, "theta_prime": -144.089, "eta_base": 170.137, "theta_base": -116.910, "v0": 1.524, "v1": -23.773, "v2": 35.724, "v3": -35.775, "v4": 21.629, "amplitude": 37.216, "phase_angle": 16.279, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.714, "filter_rmsd": 0.043, "frame": { "rmsd": 0.016, "origin": [ 240.521, 299.208, 281.988 ], "x_axis": [ -0.121, 0.992, 0.040 ], "y_axis": [ -0.290, 0.003, -0.957 ], "z_axis": [ -0.949, -0.128, 0.287 ], "quaternion": [ 0.541, -0.383, -0.457, 0.593 ] } }, { "index": 51, "index_chain": 51, "chain_name": "J", "nt_resnum": 51, "nt_name": "U", "nt_code": "U", "nt_id": "///J/51", "linked_nts": [ "///J/50", "///J/52" ], "nt_type": "RNA", "dbn": "[", "summary": "pseudoknotted,anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop", "alpha": -64.032, "beta": 166.279, "gamma": 49.840, "delta": 63.925, "epsilon": 99.808, "zeta": 65.950, "epsilon_zeta": 33.859, "bb_type": "--", "chi": -165.848, "glyco_bond": "anti", "C5prime_xyz": [ -1.537, 8.706, 0.890 ], "P_xyz": [ 0.991, 9.316, 0.805 ], "form": "A", "ssZp": 4.155, "Dp": 4.042, "splay_angle": 20.262, "splay_distance": 3.429, "splay_ratio": 0.182, "d22": null, "d64": null, "eta": 174.177, "theta": -133.519, "eta_prime": -167.820, "theta_prime": -139.956, "eta_base": -124.289, "theta_base": -113.288, "v0": 4.293, "v1": -30.131, "v2": 43.666, "v3": -42.096, "v4": 23.783, "amplitude": 44.846, "phase_angle": 13.173, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.325, "filter_rmsd": 0.107, "frame": { "rmsd": 0.013, "origin": [ 237.758, 300.042, 284.153 ], "x_axis": [ -0.154, 0.843, -0.515 ], "y_axis": [ -0.248, -0.538, -0.806 ], "z_axis": [ -0.956, 0.004, 0.292 ], "quaternion": [ 0.387, -0.523, -0.285, 0.704 ] } }, { "index": 52, "index_chain": 52, "chain_name": "J", "nt_resnum": 52, "nt_name": "G", "nt_code": "G", "nt_id": "///J/52", "linked_nts": [ "///J/51", "///J/53" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop,phosphate", "alpha": -140.298, "beta": 165.826, "gamma": 61.756, "delta": 77.453, "epsilon": -172.589, "zeta": -89.530, "epsilon_zeta": -83.059, "bb_type": "BI", "chi": -163.599, "glyco_bond": "anti", "C5prime_xyz": [ -1.857, 8.893, 0.637 ], "P_xyz": [ 0.558, 9.821, 0.787 ], "form": "A", "ssZp": 4.194, "Dp": 4.272, "splay_angle": 23.319, "splay_distance": 3.765, "splay_ratio": 0.204, "d22": null, "d64": null, "eta": 152.091, "theta": -148.932, "eta_prime": 175.540, "theta_prime": -153.761, "eta_base": -137.130, "theta_base": -125.031, "v0": -6.047, "v1": -17.386, "v2": 32.862, "v3": -37.394, "v4": 27.459, "amplitude": 37.178, "phase_angle": 27.884, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.017, "frame": { "rmsd": 0.017, "origin": [ 235.188, 301.766, 285.630 ], "x_axis": [ -0.109, 0.359, -0.927 ], "y_axis": [ -0.168, -0.926, -0.339 ], "z_axis": [ -0.980, 0.119, 0.161 ], "quaternion": [ 0.178, -0.644, -0.074, 0.741 ] } }, { "index": 53, "index_chain": 53, "chain_name": "J", "nt_resnum": 53, "nt_name": "C", "nt_code": "C", "nt_id": "///J/53", "linked_nts": [ "///J/52", "///J/54" ], "nt_type": "RNA", "dbn": "[", "summary": "pseudoknotted,anti,~C3'-endo,BI,isolated-canonical,non-pair-contact,helix,internal-loop", "alpha": 170.332, "beta": -144.434, "gamma": 156.475, "delta": 81.429, "epsilon": -129.552, "zeta": -77.761, "epsilon_zeta": -51.791, "bb_type": "BI", "chi": -175.217, "glyco_bond": "anti", "C5prime_xyz": [ -1.314, 8.605, 1.432 ], "P_xyz": [ 0.957, 9.433, 0.458 ], "form": "A", "ssZp": 4.488, "Dp": 4.594, "splay_angle": 23.369, "splay_distance": 3.770, "splay_ratio": 0.204, "d22": null, "d64": null, "eta": 166.216, "theta": -143.413, "eta_prime": 179.579, "theta_prime": -145.033, "eta_base": -137.415, "theta_base": -115.435, "v0": 0.762, "v1": -22.893, "v2": 35.232, "v3": -35.702, "v4": 21.968, "amplitude": 36.925, "phase_angle": 17.416, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.164, "filter_rmsd": 0.069, "frame": { "rmsd": 0.012, "origin": [ 232.029, 303.732, 286.213 ], "x_axis": [ -0.213, -0.212, -0.954 ], "y_axis": [ -0.109, -0.965, 0.239 ], "z_axis": [ -0.971, 0.155, 0.183 ], "quaternion": [ -0.033, -0.626, 0.128, 0.768 ] } }, { "index": 54, "index_chain": 54, "chain_name": "J", "nt_resnum": 54, "nt_name": "A", "nt_code": "A", "nt_id": "///J/54", "linked_nts": [ "///J/53", "///J/55" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack", "alpha": -55.421, "beta": 157.789, "gamma": 55.833, "delta": 77.025, "epsilon": -143.730, "zeta": -75.632, "epsilon_zeta": -68.097, "bb_type": "BI", "chi": -166.410, "glyco_bond": "anti", "C5prime_xyz": [ -1.864, 8.738, 0.870 ], "P_xyz": [ 0.652, 9.396, 1.014 ], "form": "A", "ssZp": 4.428, "Dp": 4.590, "splay_angle": 24.581, "splay_distance": 3.942, "splay_ratio": 0.216, "d22": null, "d64": null, "eta": 162.822, "theta": -144.994, "eta_prime": -176.945, "theta_prime": -144.697, "eta_base": -127.199, "theta_base": -111.652, "v0": -1.008, "v1": -23.844, "v2": 38.431, "v3": -39.809, "v4": 25.751, "amplitude": 40.861, "phase_angle": 19.860, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.693, "filter_rmsd": 0.044, "frame": { "rmsd": 0.014, "origin": [ 228.612, 305.061, 285.337 ], "x_axis": [ -0.213, -0.726, -0.654 ], "y_axis": [ 0.018, -0.672, 0.741 ], "z_axis": [ -0.977, 0.145, 0.156 ], "quaternion": [ -0.261, -0.571, 0.310, 0.714 ] } }, { "index": 55, "index_chain": 55, "chain_name": "J", "nt_resnum": 55, "nt_name": "C", "nt_code": "C", "nt_id": "///J/55", "linked_nts": [ "///J/54", "///J/56" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,A-minor", "alpha": -60.833, "beta": 160.721, "gamma": 65.128, "delta": 74.701, "epsilon": -146.026, "zeta": -86.360, "epsilon_zeta": -59.667, "bb_type": "BI", "chi": -162.203, "glyco_bond": "anti", "C5prime_xyz": [ -1.531, 8.834, 0.635 ], "P_xyz": [ 0.991, 9.410, 0.295 ], "form": ".", "ssZp": 4.408, "Dp": 4.636, "splay_angle": 28.095, "splay_distance": 4.549, "splay_ratio": 0.247, "d22": null, "d64": null, "eta": 169.923, "theta": -159.994, "eta_prime": -174.157, "theta_prime": -161.131, "eta_base": -124.209, "theta_base": -153.362, "v0": 1.551, "v1": -26.825, "v2": 40.786, "v3": -40.682, "v4": 24.735, "amplitude": 42.525, "phase_angle": 16.441, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.667, "filter_rmsd": 0.066, "frame": { "rmsd": 0.019, "origin": [ 224.926, 305.231, 283.950 ], "x_axis": [ -0.256, -0.964, -0.065 ], "y_axis": [ 0.078, -0.087, 0.993 ], "z_axis": [ -0.964, 0.249, 0.097 ], "quaternion": [ -0.434, -0.428, 0.518, 0.600 ] } }, { "index": 56, "index_chain": 56, "chain_name": "J", "nt_resnum": 56, "nt_name": "G", "nt_code": "G", "nt_id": "///J/56", "linked_nts": [ "///J/55", "///J/57" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,canonical,non-canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet", "alpha": -48.357, "beta": 177.935, "gamma": 35.707, "delta": 63.042, "epsilon": 109.054, "zeta": 59.751, "epsilon_zeta": 49.303, "bb_type": "--", "chi": -155.168, "glyco_bond": "anti", "C5prime_xyz": [ -1.198, 8.887, 0.303 ], "P_xyz": [ 1.265, 9.523, 0.776 ], "form": ".", "ssZp": 3.897, "Dp": 4.062, "splay_angle": 20.629, "splay_distance": 3.397, "splay_ratio": 0.180, "d22": null, "d64": null, "eta": -176.195, "theta": -131.112, "eta_prime": -170.624, "theta_prime": -131.843, "eta_base": -157.348, "theta_base": -88.297, "v0": 4.585, "v1": -32.496, "v2": 46.834, "v3": -45.001, "v4": 25.463, "amplitude": 48.074, "phase_angle": 13.040, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.117, "filter_rmsd": 0.029, "frame": { "rmsd": 0.029, "origin": [ 221.257, 307.172, 282.087 ], "x_axis": [ 0.030, -0.969, 0.245 ], "y_axis": [ 0.146, 0.247, 0.958 ], "z_axis": [ -0.989, 0.007, 0.149 ], "quaternion": [ 0.597, 0.398, -0.517, -0.467 ] } }, { "index": 57, "index_chain": 57, "chain_name": "J", "nt_resnum": 57, "nt_name": "U", "nt_code": "U", "nt_id": "///J/57", "linked_nts": [ "///J/56", "///J/58" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -134.687, "beta": 160.619, "gamma": 63.474, "delta": 76.846, "epsilon": -146.823, "zeta": -79.025, "epsilon_zeta": -67.799, "bb_type": "BI", "chi": -151.238, "glyco_bond": "anti", "C5prime_xyz": [ -1.774, 8.846, -0.050 ], "P_xyz": [ 0.685, 9.565, -0.578 ], "form": "A", "ssZp": 4.025, "Dp": 4.555, "splay_angle": 20.504, "splay_distance": 3.316, "splay_ratio": 0.178, "d22": 4.246, "d64": 4.129, "eta": 152.216, "theta": -154.950, "eta_prime": 178.498, "theta_prime": -157.361, "eta_base": -120.029, "theta_base": -136.621, "v0": -1.549, "v1": -22.702, "v2": 37.132, "v3": -38.867, "v4": 25.564, "amplitude": 39.705, "phase_angle": 20.741, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.102, "frame": { "rmsd": 0.017, "origin": [ 218.493, 305.330, 282.796 ], "x_axis": [ 0.146, -0.585, 0.797 ], "y_axis": [ -0.079, 0.797, 0.599 ], "z_axis": [ -0.986, -0.151, 0.070 ], "quaternion": [ 0.709, 0.264, -0.629, -0.178 ] } }, { "index": 58, "index_chain": 58, "chain_name": "J", "nt_resnum": 58, "nt_name": "C", "nt_code": "C", "nt_id": "///J/58", "linked_nts": [ "///J/57", "///J/59" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,A-minor,ribose-zipper", "alpha": -76.723, "beta": 158.575, "gamma": 72.361, "delta": 80.134, "epsilon": -157.381, "zeta": -74.250, "epsilon_zeta": -83.131, "bb_type": "BI", "chi": -158.954, "glyco_bond": "anti", "C5prime_xyz": [ -1.557, 8.805, 0.389 ], "P_xyz": [ 0.879, 9.341, -0.343 ], "form": "A", "ssZp": 4.346, "Dp": 4.530, "splay_angle": 23.959, "splay_distance": 3.849, "splay_ratio": 0.210, "d22": 4.688, "d64": 4.622, "eta": 161.538, "theta": -152.901, "eta_prime": 175.736, "theta_prime": -157.580, "eta_base": -148.756, "theta_base": -146.440, "v0": -0.494, "v1": -23.663, "v2": 37.255, "v3": -38.480, "v4": 24.552, "amplitude": 39.442, "phase_angle": 19.171, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.389, "filter_rmsd": 0.065, "frame": { "rmsd": 0.021, "origin": [ 215.535, 303.829, 282.808 ], "x_axis": [ 0.227, -0.148, 0.963 ], "y_axis": [ -0.274, 0.939, 0.209 ], "z_axis": [ -0.935, -0.311, 0.172 ], "quaternion": [ 0.765, 0.170, -0.620, 0.041 ] } }, { "index": 59, "index_chain": 59, "chain_name": "J", "nt_resnum": 59, "nt_name": "U", "nt_code": "U", "nt_id": "///J/59", "linked_nts": [ "///J/58", "///J/60" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,A-minor,ribose-zipper", "alpha": -84.422, "beta": 178.869, "gamma": 69.495, "delta": 80.090, "epsilon": -147.085, "zeta": -80.953, "epsilon_zeta": -66.132, "bb_type": "BI", "chi": -159.155, "glyco_bond": "anti", "C5prime_xyz": [ -1.449, 8.796, 0.433 ], "P_xyz": [ 1.089, 9.393, 0.323 ], "form": "A", "ssZp": 4.341, "Dp": 4.586, "splay_angle": 22.534, "splay_distance": 3.532, "splay_ratio": 0.195, "d22": null, "d64": null, "eta": 169.236, "theta": -153.649, "eta_prime": 177.048, "theta_prime": -152.512, "eta_base": -159.745, "theta_base": -125.582, "v0": -0.322, "v1": -22.783, "v2": 35.941, "v3": -37.069, "v4": 23.644, "amplitude": 38.029, "phase_angle": 19.076, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.437, "filter_rmsd": 0.109, "frame": { "rmsd": 0.019, "origin": [ 212.832, 301.093, 282.943 ], "x_axis": [ 0.268, 0.327, 0.906 ], "y_axis": [ -0.426, 0.884, -0.193 ], "z_axis": [ -0.864, -0.334, 0.376 ], "quaternion": [ 0.795, 0.044, -0.557, 0.237 ] } }, { "index": 60, "index_chain": 60, "chain_name": "J", "nt_resnum": 60, "nt_name": "G", "nt_code": "G", "nt_id": "///J/60", "linked_nts": [ "///J/59", "///J/61" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -69.622, "beta": 167.996, "gamma": 59.213, "delta": 84.908, "epsilon": -176.495, "zeta": -85.012, "epsilon_zeta": -91.483, "bb_type": "BI", "chi": -157.444, "glyco_bond": "anti", "C5prime_xyz": [ -1.176, 8.693, 0.385 ], "P_xyz": [ 1.436, 8.895, 0.180 ], "form": "A", "ssZp": 4.306, "Dp": 4.401, "splay_angle": 20.467, "splay_distance": 3.206, "splay_ratio": 0.178, "d22": null, "d64": null, "eta": 163.541, "theta": -138.679, "eta_prime": 179.746, "theta_prime": -140.105, "eta_base": -139.086, "theta_base": -114.015, "v0": 5.401, "v1": -25.210, "v2": 34.259, "v3": -32.054, "v4": 16.872, "amplitude": 34.772, "phase_angle": 9.854, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.863, "filter_rmsd": 0.011, "frame": { "rmsd": 0.011, "origin": [ 210.435, 299.436, 284.941 ], "x_axis": [ 0.117, 0.797, 0.592 ], "y_axis": [ -0.597, 0.533, -0.600 ], "z_axis": [ -0.794, -0.283, 0.538 ], "quaternion": [ 0.740, -0.107, -0.469, 0.471 ] } }, { "index": 61, "index_chain": 61, "chain_name": "J", "nt_resnum": 61, "nt_name": "C", "nt_code": "C", "nt_id": "///J/61", "linked_nts": [ "///J/60", null ], "nt_type": "RNA", "dbn": ")", "is_broken": true, "summary": "break,anti,~C2'-endo,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack", "alpha": 166.482, "beta": -145.515, "gamma": 175.280, "delta": 151.575, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": -147.130, "glyco_bond": "anti", "C5prime_xyz": [ -1.336, 8.602, 0.427 ], "P_xyz": [ 1.083, 9.041, -0.500 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": -16.460, "v1": 33.461, "v2": -36.734, "v3": 28.196, "v4": -7.522, "amplitude": 37.023, "phase_angle": 172.840, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32t", "cluster": "1t", "suiteness": 0.596, "filter_rmsd": 0.067, "frame": { "rmsd": 0.015, "origin": [ 208.771, 298.986, 287.644 ], "x_axis": [ -0.193, 0.978, 0.083 ], "y_axis": [ -0.715, -0.083, -0.694 ], "z_axis": [ -0.671, -0.193, 0.716 ], "quaternion": [ 0.600, -0.209, -0.314, 0.706 ] } }, { "index": 62, "index_chain": 62, "chain_name": "J", "nt_resnum": 102, "nt_name": "A", "nt_code": "A", "nt_id": "///J/102", "linked_nts": [ null, "///J/103" ], "nt_type": "RNA", "dbn": ".", "summary": "syn,~C3'-endo,BI,non-pair-contact,ss-non-loop", "alpha": null, "beta": 106.679, "gamma": 91.282, "delta": 79.164, "epsilon": -152.292, "zeta": -70.479, "epsilon_zeta": -81.812, "bb_type": "BI", "chi": -2.373, "glyco_bond": "syn", "C5prime_xyz": [ -5.530, 4.512, -1.499 ], "P_xyz": [ -5.657, 2.201, -0.274 ], "form": ".", "ssZp": -4.293, "Dp": 4.392, "splay_angle": 22.800, "splay_distance": 3.593, "splay_ratio": 0.198, "d22": null, "d64": null, "eta": null, "theta": -96.896, "eta_prime": null, "theta_prime": -109.718, "eta_base": null, "theta_base": -108.961, "v0": -6.957, "v1": -16.909, "v2": 32.769, "v3": -37.724, "v4": 28.144, "amplitude": 37.468, "phase_angle": 29.006, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.048, "frame": { "rmsd": 0.015, "origin": [ 207.149, 297.917, 276.295 ], "x_axis": [ -0.431, 0.507, 0.747 ], "y_axis": [ -0.386, 0.644, -0.660 ], "z_axis": [ -0.816, -0.573, -0.082 ], "quaternion": [ 0.532, -0.041, -0.734, 0.420 ] } }, { "index": 63, "index_chain": 63, "chain_name": "J", "nt_resnum": 103, "nt_name": "A", "nt_code": "A", "nt_id": "///J/103", "linked_nts": [ "///J/102", "///J/104" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-pair-contact,ss-non-loop,A-minor,ribose-zipper", "alpha": 161.176, "beta": -121.318, "gamma": 147.839, "delta": 88.641, "epsilon": -91.791, "zeta": -133.354, "epsilon_zeta": 41.563, "bb_type": "--", "chi": -164.200, "glyco_bond": "anti", "C5prime_xyz": [ -1.754, 8.771, 0.752 ], "P_xyz": [ 0.691, 8.904, -0.182 ], "form": "B", "ssZp": 3.503, "Dp": 3.979, "splay_angle": 21.116, "splay_distance": 3.665, "splay_ratio": 0.194, "d22": null, "d64": null, "eta": 169.832, "theta": -115.448, "eta_prime": -154.268, "theta_prime": -126.834, "eta_base": -121.575, "theta_base": -85.819, "v0": -7.071, "v1": -12.289, "v2": 25.600, "v3": -30.442, "v4": 23.693, "amplitude": 30.133, "phase_angle": 31.834, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.010, "filter_rmsd": 0.045, "frame": { "rmsd": 0.018, "origin": [ 210.286, 299.436, 277.166 ], "x_axis": [ 0.566, -0.670, -0.481 ], "y_axis": [ -0.135, 0.500, -0.856 ], "z_axis": [ 0.814, 0.549, 0.192 ], "quaternion": [ 0.751, -0.467, 0.431, -0.178 ] } }, { "index": 64, "index_chain": 64, "chain_name": "J", "nt_resnum": 104, "nt_name": "A", "nt_code": "A", "nt_id": "///J/104", "linked_nts": [ "///J/103", "///J/105" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-pair-contact,ss-non-loop,A-minor,ribose-zipper,splayed-apart", "alpha": 107.888, "beta": -105.824, "gamma": 173.458, "delta": 86.316, "epsilon": -111.914, "zeta": 73.984, "epsilon_zeta": 174.102, "bb_type": "--", "chi": -141.501, "glyco_bond": "anti", "C5prime_xyz": [ -1.505, 8.658, -0.515 ], "P_xyz": [ -0.378, 8.345, -2.831 ], "form": ".", "ssZp": 3.248, "Dp": 4.558, "splay_angle": 147.581, "splay_distance": 18.474, "splay_ratio": 0.960, "d22": null, "d64": null, "eta": 147.639, "theta": 17.044, "eta_prime": 175.454, "theta_prime": 16.439, "eta_base": -127.633, "theta_base": 36.975, "v0": -0.233, "v1": -19.970, "v2": 31.311, "v3": -32.334, "v4": 20.600, "amplitude": 33.117, "phase_angle": 19.008, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.040, "frame": { "rmsd": 0.029, "origin": [ 213.299, 300.989, 275.770 ], "x_axis": [ 0.361, -0.260, -0.896 ], "y_axis": [ -0.106, 0.943, -0.316 ], "z_axis": [ 0.927, 0.209, 0.313 ], "quaternion": [ 0.809, -0.162, 0.563, -0.048 ] } }, { "index": 65, "index_chain": 65, "chain_name": "J", "nt_resnum": 105, "nt_name": "G", "nt_code": "G", "nt_id": "///J/105", "linked_nts": [ "///J/104", "///J/106" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-pair-contact,ss-non-loop,phosphate,splayed-apart", "alpha": -127.870, "beta": -155.702, "gamma": 85.346, "delta": 77.521, "epsilon": -121.590, "zeta": -114.551, "epsilon_zeta": -7.040, "bb_type": "--", "chi": 175.632, "glyco_bond": "anti", "C5prime_xyz": [ -1.886, 8.578, 1.799 ], "P_xyz": [ 0.544, 8.893, 2.750 ], "form": "A", "ssZp": 4.585, "Dp": 4.600, "splay_angle": 24.577, "splay_distance": 3.923, "splay_ratio": 0.214, "d22": null, "d64": null, "eta": -168.641, "theta": -136.116, "eta_prime": -145.118, "theta_prime": -129.345, "eta_base": -139.992, "theta_base": -91.822, "v0": -4.328, "v1": -20.542, "v2": 36.359, "v3": -39.701, "v4": 27.786, "amplitude": 39.994, "phase_angle": 24.618, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.019, "frame": { "rmsd": 0.019, "origin": [ 210.429, 319.229, 276.373 ], "x_axis": [ -0.304, -0.238, 0.923 ], "y_axis": [ 0.183, -0.965, -0.188 ], "z_axis": [ 0.935, 0.112, 0.336 ], "quaternion": [ -0.130, 0.576, -0.024, 0.807 ] } }, { "index": 66, "index_chain": 66, "chain_name": "J", "nt_resnum": 106, "nt_name": "C", "nt_code": "C", "nt_id": "///J/106", "linked_nts": [ "///J/105", "///J/107" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-pair-contact,ss-non-loop", "alpha": 5.005, "beta": 124.537, "gamma": 20.899, "delta": 76.686, "epsilon": -163.213, "zeta": -81.765, "epsilon_zeta": -81.448, "bb_type": "BI", "chi": -154.813, "glyco_bond": "anti", "C5prime_xyz": [ -1.875, 8.960, 0.103 ], "P_xyz": [ 0.667, 9.340, 0.663 ], "form": ".", "ssZp": 4.157, "Dp": 4.355, "splay_angle": 25.433, "splay_distance": 4.121, "splay_ratio": 0.221, "d22": null, "d64": null, "eta": 165.240, "theta": -125.561, "eta_prime": -176.923, "theta_prime": -133.810, "eta_base": -125.487, "theta_base": -92.229, "v0": -7.582, "v1": -17.354, "v2": 34.285, "v3": -39.498, "v4": 29.793, "amplitude": 39.363, "phase_angle": 29.425, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.065, "frame": { "rmsd": 0.017, "origin": [ 212.981, 320.098, 279.223 ], "x_axis": [ -0.166, -0.818, 0.550 ], "y_axis": [ 0.389, -0.567, -0.726 ], "z_axis": [ 0.906, 0.093, 0.413 ], "quaternion": [ -0.412, 0.497, -0.216, 0.732 ] } }, { "index": 67, "index_chain": 67, "chain_name": "J", "nt_resnum": 107, "nt_name": "A", "nt_code": "A", "nt_id": "///J/107", "linked_nts": [ "///J/106", "///J/108" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-pair-contact,ss-non-loop,phosphate", "alpha": 156.592, "beta": -150.859, "gamma": 163.770, "delta": 84.752, "epsilon": -110.256, "zeta": -100.222, "epsilon_zeta": -10.034, "bb_type": "--", "chi": -179.771, "glyco_bond": "anti", "C5prime_xyz": [ -1.142, 8.283, 1.714 ], "P_xyz": [ 1.030, 9.393, 0.860 ], "form": ".", "ssZp": 4.559, "Dp": 4.622, "splay_angle": 32.653, "splay_distance": 4.865, "splay_ratio": 0.291, "d22": null, "d64": null, "eta": 163.730, "theta": -127.002, "eta_prime": 178.701, "theta_prime": -135.886, "eta_base": -121.062, "theta_base": -66.911, "v0": 1.388, "v1": -22.071, "v2": 33.395, "v3": -33.503, "v4": 20.257, "amplitude": 34.816, "phase_angle": 16.426, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.536, "filter_rmsd": 0.049, "frame": { "rmsd": 0.026, "origin": [ 215.553, 318.369, 281.940 ], "x_axis": [ -0.105, -0.964, -0.244 ], "y_axis": [ 0.426, 0.178, -0.887 ], "z_axis": [ 0.899, -0.197, 0.391 ], "quaternion": [ 0.605, -0.285, 0.472, -0.574 ] } }, { "index": 68, "index_chain": 68, "chain_name": "J", "nt_resnum": 108, "nt_name": "A", "nt_code": "A", "nt_id": "///J/108", "linked_nts": [ "///J/107", "///J/109" ], "nt_type": "RNA", "dbn": ".", "summary": "syn,~C3'-endo,non-pair-contact,ss-non-loop", "alpha": 95.689, "beta": -134.759, "gamma": -136.361, "delta": 85.781, "epsilon": -119.024, "zeta": -55.178, "epsilon_zeta": -63.846, "bb_type": "--", "chi": -3.212, "glyco_bond": "syn", "C5prime_xyz": [ -5.047, 4.016, -1.791 ], "P_xyz": [ -7.156, 2.695, -1.138 ], "form": ".", "ssZp": -4.580, "Dp": 4.642, "splay_angle": 23.161, "splay_distance": 3.544, "splay_ratio": 0.221, "d22": null, "d64": null, "eta": 167.066, "theta": -144.393, "eta_prime": -178.175, "theta_prime": -132.125, "eta_base": -88.296, "theta_base": -88.971, "v0": 4.457, "v1": -24.937, "v2": 34.963, "v3": -33.339, "v4": 18.196, "amplitude": 35.695, "phase_angle": 11.627, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.050, "frame": { "rmsd": 0.029, "origin": [ 219.169, 315.512, 280.383 ], "x_axis": [ -0.395, -0.681, 0.616 ], "y_axis": [ -0.016, 0.676, 0.737 ], "z_axis": [ -0.919, 0.281, -0.278 ], "quaternion": [ 0.501, 0.228, -0.766, -0.332 ] } }, { "index": 69, "index_chain": 69, "chain_name": "J", "nt_resnum": 109, "nt_name": "A", "nt_code": "A", "nt_id": "///J/109", "linked_nts": [ "///J/108", "///J/110" ], "nt_type": "RNA", "dbn": ".", "summary": "syn,~C3'-endo,BI,non-canonical,non-pair-contact,multiplet,ss-non-loop", "alpha": -65.665, "beta": 163.792, "gamma": 72.578, "delta": 76.428, "epsilon": -146.678, "zeta": -97.309, "epsilon_zeta": -49.369, "bb_type": "BI", "chi": 14.446, "glyco_bond": "syn", "C5prime_xyz": [ -5.939, 4.907, -0.273 ], "P_xyz": [ -6.818, 2.441, -0.334 ], "form": ".", "ssZp": -3.846, "Dp": 4.050, "splay_angle": 21.876, "splay_distance": 3.508, "splay_ratio": 0.191, "d22": null, "d64": null, "eta": 167.404, "theta": -125.010, "eta_prime": -160.217, "theta_prime": -126.331, "eta_base": -105.615, "theta_base": -130.814, "v0": -14.421, "v1": -10.588, "v2": 29.964, "v3": -39.183, "v4": 33.837, "amplitude": 39.005, "phase_angle": 39.807, "puckering": "C4'-exo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.240, "filter_rmsd": 0.062, "frame": { "rmsd": 0.047, "origin": [ 222.705, 315.289, 280.379 ], "x_axis": [ -0.344, -0.918, -0.196 ], "y_axis": [ -0.250, -0.112, 0.962 ], "z_axis": [ -0.905, 0.380, -0.191 ], "quaternion": [ -0.297, -0.490, 0.596, 0.562 ] } }, { "index": 70, "index_chain": 70, "chain_name": "J", "nt_resnum": 110, "nt_name": "A", "nt_code": "A", "nt_id": "///J/110", "linked_nts": [ "///J/109", "///J/111" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-canonical,non-pair-contact,multiplet,ss-non-loop,A-minor,cap-acceptor", "alpha": 148.332, "beta": -118.655, "gamma": 158.097, "delta": 83.554, "epsilon": -110.675, "zeta": -80.201, "epsilon_zeta": -30.474, "bb_type": "--", "chi": -160.542, "glyco_bond": "anti", "C5prime_xyz": [ -1.415, 8.742, 0.559 ], "P_xyz": [ 0.603, 8.904, -1.073 ], "form": ".", "ssZp": 3.994, "Dp": 4.493, "splay_angle": 83.002, "splay_distance": 12.743, "splay_ratio": 0.663, "d22": null, "d64": null, "eta": 160.780, "theta": -79.429, "eta_prime": -172.138, "theta_prime": -133.439, "eta_base": -160.612, "theta_base": 178.167, "v0": -3.163, "v1": -18.200, "v2": 31.445, "v3": -34.187, "v4": 23.615, "amplitude": 34.378, "phase_angle": 23.841, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.035, "filter_rmsd": 0.048, "frame": { "rmsd": 0.026, "origin": [ 225.421, 313.158, 281.003 ], "x_axis": [ 0.387, 0.825, -0.412 ], "y_axis": [ 0.159, 0.381, 0.911 ], "z_axis": [ 0.908, -0.418, 0.016 ], "quaternion": [ 0.668, 0.497, 0.495, 0.249 ] } }, { "index": 71, "index_chain": 71, "chain_name": "J", "nt_resnum": 111, "nt_name": "G", "nt_code": "G", "nt_id": "///J/111", "linked_nts": [ "///J/110", "///J/112" ], "nt_type": "RNA", "dbn": "]", "summary": "pseudoknotted,~C2'-endo,isolated-canonical,non-pair-contact,helix,internal-loop,splayed-apart", "alpha": 137.219, "beta": 103.936, "gamma": -179.910, "delta": 139.283, "epsilon": -85.241, "zeta": -112.479, "epsilon_zeta": 27.238, "bb_type": "--", "chi": -80.680, "glyco_bond": "--", "C5prime_xyz": [ -3.174, 7.344, -2.679 ], "P_xyz": [ -4.655, 6.905, -4.755 ], "form": ".", "ssZp": 0.430, "Dp": 0.830, "splay_angle": 130.752, "splay_distance": 18.613, "splay_ratio": 0.909, "d22": null, "d64": null, "eta": 111.628, "theta": -167.567, "eta_prime": 134.753, "theta_prime": -151.797, "eta_base": 116.140, "theta_base": -131.001, "v0": -24.501, "v1": 34.830, "v2": -31.216, "v3": 18.019, "v4": 3.905, "amplitude": 34.501, "phase_angle": 154.796, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.020, "frame": { "rmsd": 0.020, "origin": [ 231.993, 303.663, 286.391 ], "x_axis": [ -0.135, -0.201, -0.970 ], "y_axis": [ 0.178, 0.958, -0.223 ], "z_axis": [ 0.975, -0.203, -0.093 ], "quaternion": [ 0.658, -0.008, 0.739, -0.144 ] } }, { "index": 72, "index_chain": 72, "chain_name": "J", "nt_resnum": 112, "nt_name": "U", "nt_code": "U", "nt_id": "///J/112", "linked_nts": [ "///J/111", "///J/113" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,anti,~C2'-endo,non-stack,non-pair-contact,internal-loop,splayed-apart", "alpha": -58.575, "beta": 124.178, "gamma": 160.544, "delta": 152.590, "epsilon": -71.156, "zeta": -18.029, "epsilon_zeta": -53.127, "bb_type": "--", "chi": -136.684, "glyco_bond": "anti", "C5prime_xyz": [ -1.735, 8.632, -0.198 ], "P_xyz": [ -0.496, 9.963, -2.059 ], "form": ".", "ssZp": 0.013, "Dp": 0.089, "splay_angle": 131.440, "splay_distance": 14.981, "splay_ratio": 0.916, "d22": 13.226, "d64": 14.842, "eta": -34.466, "theta": -50.225, "eta_prime": -31.384, "theta_prime": -21.045, "eta_base": -32.972, "theta_base": 79.220, "v0": -19.394, "v1": 36.259, "v2": -38.282, "v3": 28.130, "v4": -5.699, "amplitude": 38.933, "phase_angle": 169.506, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.103, "frame": { "rmsd": 0.003, "origin": [ 241.270, 319.800, 286.430 ], "x_axis": [ -0.381, 0.730, 0.567 ], "y_axis": [ -0.520, -0.676, 0.522 ], "z_axis": [ 0.764, -0.096, 0.638 ], "quaternion": [ 0.381, 0.405, 0.130, 0.821 ] } }, { "index": 73, "index_chain": 73, "chain_name": "J", "nt_resnum": 113, "nt_name": "C", "nt_code": "C", "nt_id": "///J/113", "linked_nts": [ "///J/112", "///J/114" ], "nt_type": "RNA", "dbn": ".", "summary": "syn,~C3'-endo,non-canonical,non-pair-contact,helix,internal-loop,phosphate,splayed-apart", "alpha": -105.471, "beta": -156.452, "gamma": 142.407, "delta": 80.325, "epsilon": -106.559, "zeta": -92.032, "epsilon_zeta": -14.528, "bb_type": "--", "chi": -27.813, "glyco_bond": "syn", "C5prime_xyz": [ -4.454, 4.810, -2.819 ], "P_xyz": [ -5.182, 2.304, -3.030 ], "form": ".", "ssZp": -4.577, "Dp": 4.800, "splay_angle": 43.380, "splay_distance": 6.858, "splay_ratio": 0.370, "d22": null, "d64": null, "eta": -140.192, "theta": -135.141, "eta_prime": -116.224, "theta_prime": -132.600, "eta_base": 179.810, "theta_base": -149.675, "v0": 5.780, "v1": -27.988, "v2": 38.556, "v3": -36.189, "v4": 19.220, "amplitude": 39.192, "phase_angle": 10.336, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.074, "frame": { "rmsd": 0.020, "origin": [ 235.522, 306.209, 283.846 ], "x_axis": [ -0.114, -0.933, -0.341 ], "y_axis": [ 0.157, -0.355, 0.921 ], "z_axis": [ -0.981, 0.052, 0.187 ], "quaternion": [ -0.423, -0.513, 0.378, 0.644 ] } }, { "index": 74, "index_chain": 74, "chain_name": "J", "nt_resnum": 114, "nt_name": "A", "nt_code": "A", "nt_id": "///J/114", "linked_nts": [ "///J/113", "///J/115" ], "nt_type": "RNA", "dbn": "]", "summary": "pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop", "alpha": -35.016, "beta": 167.791, "gamma": 27.623, "delta": 81.358, "epsilon": -169.333, "zeta": -92.301, "epsilon_zeta": -77.033, "bb_type": "BI", "chi": -160.044, "glyco_bond": "anti", "C5prime_xyz": [ -1.455, 8.729, 0.558 ], "P_xyz": [ 0.915, 9.288, 1.500 ], "form": "A", "ssZp": 4.295, "Dp": 4.390, "splay_angle": 21.184, "splay_distance": 3.430, "splay_ratio": 0.186, "d22": null, "d64": null, "eta": 161.605, "theta": -145.199, "eta_prime": 179.453, "theta_prime": -148.677, "eta_base": 174.538, "theta_base": -128.198, "v0": -1.068, "v1": -20.950, "v2": 33.756, "v3": -35.368, "v4": 22.997, "amplitude": 35.997, "phase_angle": 20.326, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.042, "frame": { "rmsd": 0.014, "origin": [ 238.340, 299.957, 283.758 ], "x_axis": [ -0.102, 0.852, -0.513 ], "y_axis": [ 0.188, 0.523, 0.831 ], "z_axis": [ 0.977, -0.011, -0.214 ], "quaternion": [ 0.549, 0.384, 0.678, 0.302 ] } }, { "index": 75, "index_chain": 75, "chain_name": "J", "nt_resnum": 115, "nt_name": "U", "nt_code": "U", "nt_id": "///J/115", "linked_nts": [ "///J/114", "///J/116" ], "nt_type": "RNA", "dbn": "]", "summary": "pseudoknotted,anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop", "alpha": 163.814, "beta": -143.761, "gamma": 159.676, "delta": 82.109, "epsilon": -126.047, "zeta": -82.771, "epsilon_zeta": -43.276, "bb_type": "--", "chi": -176.051, "glyco_bond": "anti", "C5prime_xyz": [ -1.276, 8.507, 1.531 ], "P_xyz": [ 0.941, 9.429, 0.513 ], "form": "A", "ssZp": 4.590, "Dp": 4.631, "splay_angle": 22.204, "splay_distance": 3.585, "splay_ratio": 0.194, "d22": 4.251, "d64": 4.040, "eta": 164.654, "theta": -147.241, "eta_prime": 176.360, "theta_prime": -148.816, "eta_base": -150.463, "theta_base": -122.948, "v0": 0.678, "v1": -22.058, "v2": 33.950, "v3": -34.503, "v4": 21.284, "amplitude": 35.608, "phase_angle": 17.553, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.256, "filter_rmsd": 0.110, "frame": { "rmsd": 0.014, "origin": [ 240.918, 299.117, 281.659 ], "x_axis": [ -0.069, 0.997, -0.040 ], "y_axis": [ 0.304, 0.059, 0.951 ], "z_axis": [ 0.950, 0.054, -0.307 ], "quaternion": [ 0.413, 0.543, 0.599, 0.419 ] } }, { "index": 76, "index_chain": 76, "chain_name": "J", "nt_resnum": 116, "nt_name": "U", "nt_code": "U", "nt_id": "///J/116", "linked_nts": [ "///J/115", "///J/117" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop", "alpha": -51.147, "beta": 163.971, "gamma": 40.922, "delta": 79.093, "epsilon": -147.959, "zeta": -77.727, "epsilon_zeta": -70.232, "bb_type": "BI", "chi": -164.097, "glyco_bond": "anti", "C5prime_xyz": [ -1.448, 8.782, 0.729 ], "P_xyz": [ 1.041, 9.331, 1.223 ], "form": "A", "ssZp": 4.453, "Dp": 4.588, "splay_angle": 20.578, "splay_distance": 3.293, "splay_ratio": 0.180, "d22": null, "d64": null, "eta": 159.551, "theta": -149.950, "eta_prime": 175.438, "theta_prime": -147.453, "eta_base": -141.515, "theta_base": -117.063, "v0": -1.069, "v1": -22.366, "v2": 36.038, "v3": -37.526, "v4": 24.368, "amplitude": 38.376, "phase_angle": 20.104, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.493, "filter_rmsd": 0.096, "frame": { "rmsd": 0.016, "origin": [ 243.466, 300.109, 279.340 ], "x_axis": [ -0.059, 0.821, 0.568 ], "y_axis": [ 0.329, -0.522, 0.787 ], "z_axis": [ 0.943, 0.233, -0.239 ], "quaternion": [ 0.213, 0.652, 0.441, 0.579 ] } }, { "index": 77, "index_chain": 77, "chain_name": "J", "nt_resnum": 117, "nt_name": "G", "nt_code": "G", "nt_id": "///J/117", "linked_nts": [ "///J/116", "///J/118" ], "nt_type": "RNA", "dbn": "]", "summary": "pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop", "alpha": -56.598, "beta": 163.715, "gamma": 54.673, "delta": 79.488, "epsilon": -164.122, "zeta": -92.843, "epsilon_zeta": -71.279, "bb_type": "BI", "chi": -161.320, "glyco_bond": "anti", "C5prime_xyz": [ -1.403, 8.840, 0.636 ], "P_xyz": [ 1.167, 9.244, 0.905 ], "form": "A", "ssZp": 4.249, "Dp": 4.399, "splay_angle": 23.044, "splay_distance": 3.741, "splay_ratio": 0.201, "d22": null, "d64": null, "eta": 168.832, "theta": -138.568, "eta_prime": -175.493, "theta_prime": -145.125, "eta_base": -131.576, "theta_base": -120.249, "v0": -0.827, "v1": -21.459, "v2": 34.552, "v3": -35.959, "v4": 23.265, "amplitude": 36.757, "phase_angle": 19.946, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.886, "filter_rmsd": 0.018, "frame": { "rmsd": 0.018, "origin": [ 245.730, 302.206, 278.191 ], "x_axis": [ 0.013, 0.361, 0.933 ], "y_axis": [ 0.389, -0.861, 0.328 ], "z_axis": [ 0.921, 0.358, -0.152 ], "quaternion": [ -0.011, 0.712, 0.263, 0.651 ] } }, { "index": 78, "index_chain": 78, "chain_name": "J", "nt_resnum": 118, "nt_name": "C", "nt_code": "C", "nt_id": "///J/118", "linked_nts": [ "///J/117", "///J/119" ], "nt_type": "RNA", "dbn": "]", "summary": "pseudoknotted,anti,~C3'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": 156.674, "beta": -140.019, "gamma": 166.343, "delta": 79.630, "epsilon": -124.312, "zeta": -94.325, "epsilon_zeta": -29.986, "bb_type": "--", "chi": -176.655, "glyco_bond": "anti", "C5prime_xyz": [ -1.183, 8.495, 1.543 ], "P_xyz": [ 0.944, 9.476, 0.409 ], "form": "A", "ssZp": 4.581, "Dp": 4.697, "splay_angle": 25.346, "splay_distance": 4.092, "splay_ratio": 0.222, "d22": 4.444, "d64": 4.770, "eta": 164.608, "theta": -152.613, "eta_prime": 179.582, "theta_prime": -151.395, "eta_base": -137.451, "theta_base": -130.970, "v0": 4.160, "v1": -26.942, "v2": 38.522, "v3": -37.069, "v4": 20.667, "amplitude": 39.482, "phase_angle": 12.661, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.392, "filter_rmsd": 0.075, "frame": { "rmsd": 0.018, "origin": [ 248.351, 304.845, 277.787 ], "x_axis": [ 0.239, -0.127, 0.963 ], "y_axis": [ 0.363, -0.908, -0.210 ], "z_axis": [ 0.901, 0.400, -0.171 ], "quaternion": [ -0.200, 0.761, 0.078, 0.612 ] } }, { "index": 79, "index_chain": 79, "chain_name": "J", "nt_resnum": 119, "nt_name": "C", "nt_code": "C", "nt_id": "///J/119", "linked_nts": [ "///J/118", "///J/120" ], "nt_type": "RNA", "dbn": "]", "summary": "pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack", "alpha": -30.262, "beta": 150.125, "gamma": 46.249, "delta": 76.997, "epsilon": -153.069, "zeta": -84.837, "epsilon_zeta": -68.232, "bb_type": "BI", "chi": -163.903, "glyco_bond": "anti", "C5prime_xyz": [ -1.709, 8.946, 0.681 ], "P_xyz": [ 0.800, 9.432, 1.218 ], "form": "A", "ssZp": 4.168, "Dp": 4.358, "splay_angle": 22.372, "splay_distance": 3.950, "splay_ratio": 0.202, "d22": 4.069, "d64": 4.484, "eta": 174.521, "theta": -124.156, "eta_prime": -169.156, "theta_prime": -133.985, "eta_base": -135.635, "theta_base": -104.928, "v0": -6.301, "v1": -18.072, "v2": 34.267, "v3": -38.875, "v4": 28.519, "amplitude": 38.741, "phase_angle": 27.808, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.091, "filter_rmsd": 0.070, "frame": { "rmsd": 0.019, "origin": [ 251.100, 307.848, 278.192 ], "x_axis": [ 0.272, -0.604, 0.749 ], "y_axis": [ 0.184, -0.731, -0.657 ], "z_axis": [ 0.945, 0.317, -0.087 ], "quaternion": [ -0.337, 0.723, -0.145, 0.586 ] } }, { "index": 80, "index_chain": 80, "chain_name": "J", "nt_resnum": 120, "nt_name": "C", "nt_code": "C", "nt_id": "///J/120", "linked_nts": [ "///J/119", "///J/121" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet", "alpha": 133.279, "beta": -149.331, "gamma": -166.277, "delta": 80.284, "epsilon": -114.682, "zeta": -105.428, "epsilon_zeta": -9.254, "bb_type": "--", "chi": -175.659, "glyco_bond": "anti", "C5prime_xyz": [ -1.262, 8.566, 1.475 ], "P_xyz": [ 0.420, 10.315, 0.579 ], "form": "A", "ssZp": 4.391, "Dp": 4.595, "splay_angle": 22.572, "splay_distance": 3.896, "splay_ratio": 0.201, "d22": null, "d64": null, "eta": 167.076, "theta": -143.388, "eta_prime": -179.381, "theta_prime": -145.296, "eta_base": -131.312, "theta_base": -112.391, "v0": 0.602, "v1": -23.230, "v2": 36.028, "v3": -36.646, "v4": 22.648, "amplitude": 37.826, "phase_angle": 17.735, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.397, "filter_rmsd": 0.067, "frame": { "rmsd": 0.018, "origin": [ 254.387, 308.945, 280.088 ], "x_axis": [ 0.253, -0.934, 0.252 ], "y_axis": [ 0.030, -0.253, -0.967 ], "z_axis": [ 0.967, 0.252, -0.036 ], "quaternion": [ -0.491, 0.621, -0.364, 0.491 ] } }, { "index": 81, "index_chain": 81, "chain_name": "J", "nt_resnum": 121, "nt_name": "G", "nt_code": "G", "nt_id": "///J/121", "linked_nts": [ "///J/120", "///J/122" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,canonical,non-canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet", "alpha": 111.474, "beta": -120.077, "gamma": -159.436, "delta": 80.802, "epsilon": -122.543, "zeta": -77.855, "epsilon_zeta": -44.688, "bb_type": "--", "chi": 176.439, "glyco_bond": "anti", "C5prime_xyz": [ -1.474, 8.347, 1.895 ], "P_xyz": [ -0.063, 10.123, 0.619 ], "form": "A", "ssZp": 4.580, "Dp": 4.663, "splay_angle": 23.445, "splay_distance": 3.682, "splay_ratio": 0.205, "d22": null, "d64": null, "eta": 164.844, "theta": -161.723, "eta_prime": -175.475, "theta_prime": -157.221, "eta_base": -124.726, "theta_base": -116.685, "v0": 2.910, "v1": -25.902, "v2": 37.866, "v3": -37.136, "v4": 21.584, "amplitude": 39.093, "phase_angle": 14.393, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.029, "frame": { "rmsd": 0.029, "origin": [ 257.901, 308.343, 281.661 ], "x_axis": [ 0.206, -0.937, -0.283 ], "y_axis": [ -0.049, 0.279, -0.959 ], "z_axis": [ 0.977, 0.211, 0.012 ], "quaternion": [ 0.612, -0.478, 0.515, -0.363 ] } }, { "index": 82, "index_chain": 82, "chain_name": "J", "nt_resnum": 122, "nt_name": "U", "nt_code": "U", "nt_id": "///J/122", "linked_nts": [ "///J/121", "///J/123" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,cap-donor", "alpha": -73.417, "beta": 163.630, "gamma": 66.787, "delta": 78.413, "epsilon": -135.811, "zeta": -89.908, "epsilon_zeta": -45.903, "bb_type": "BI", "chi": -165.818, "glyco_bond": "anti", "C5prime_xyz": [ -1.381, 8.731, 0.837 ], "P_xyz": [ 1.188, 9.124, 0.711 ], "form": "A", "ssZp": 4.460, "Dp": 4.644, "splay_angle": 21.120, "splay_distance": 3.441, "splay_ratio": 0.185, "d22": 4.373, "d64": 4.356, "eta": 161.735, "theta": -148.431, "eta_prime": 179.580, "theta_prime": -148.529, "eta_base": -126.720, "theta_base": -133.625, "v0": -1.595, "v1": -22.417, "v2": 36.762, "v3": -38.518, "v4": 25.402, "amplitude": 39.339, "phase_angle": 20.853, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.472, "filter_rmsd": 0.109, "frame": { "rmsd": 0.020, "origin": [ 261.390, 307.331, 282.261 ], "x_axis": [ 0.103, -0.502, -0.859 ], "y_axis": [ -0.101, 0.853, -0.511 ], "z_axis": [ 0.989, 0.140, 0.037 ], "quaternion": [ 0.706, -0.231, 0.654, -0.142 ] } }, { "index": 83, "index_chain": 83, "chain_name": "J", "nt_resnum": 123, "nt_name": "C", "nt_code": "C", "nt_id": "///J/123", "linked_nts": [ "///J/122", "///J/124" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -42.071, "beta": 159.292, "gamma": 39.953, "delta": 77.468, "epsilon": -166.749, "zeta": -87.747, "epsilon_zeta": -79.001, "bb_type": "BI", "chi": -155.994, "glyco_bond": "anti", "C5prime_xyz": [ -1.528, 8.900, 0.269 ], "P_xyz": [ 0.993, 9.475, 0.572 ], "form": "A", "ssZp": 4.226, "Dp": 4.420, "splay_angle": 20.539, "splay_distance": 3.460, "splay_ratio": 0.183, "d22": null, "d64": null, "eta": 165.881, "theta": -138.854, "eta_prime": 178.372, "theta_prime": -146.514, "eta_base": -152.872, "theta_base": -123.847, "v0": -3.106, "v1": -20.694, "v2": 35.406, "v3": -38.107, "v4": 26.072, "amplitude": 38.507, "phase_angle": 23.150, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.346, "filter_rmsd": 0.066, "frame": { "rmsd": 0.018, "origin": [ 264.571, 306.263, 283.024 ], "x_axis": [ -0.159, -0.083, -0.984 ], "y_axis": [ -0.022, 0.997, -0.080 ], "z_axis": [ 0.987, 0.009, -0.161 ], "quaternion": [ 0.647, -0.035, 0.761, -0.023 ] } }, { "index": 84, "index_chain": 84, "chain_name": "J", "nt_resnum": 124, "nt_name": "G", "nt_code": "G", "nt_id": "///J/124", "linked_nts": [ "///J/123", "///J/125" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": 149.501, "beta": -146.316, "gamma": 175.654, "delta": 84.392, "epsilon": -100.476, "zeta": -113.709, "epsilon_zeta": 13.233, "bb_type": "--", "chi": -179.937, "glyco_bond": "anti", "C5prime_xyz": [ -1.300, 8.464, 1.690 ], "P_xyz": [ 0.772, 9.785, 0.867 ], "form": "A", "ssZp": 4.335, "Dp": 4.491, "splay_angle": 21.175, "splay_distance": 3.612, "splay_ratio": 0.186, "d22": null, "d64": null, "eta": 175.158, "theta": -136.379, "eta_prime": -176.817, "theta_prime": -143.750, "eta_base": -141.020, "theta_base": -115.772, "v0": -0.368, "v1": -20.308, "v2": 32.194, "v3": -33.278, "v4": 21.210, "amplitude": 34.095, "phase_angle": 19.222, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.652, "filter_rmsd": 0.028, "frame": { "rmsd": 0.028, "origin": [ 267.433, 304.693, 281.877 ], "x_axis": [ -0.342, 0.414, -0.843 ], "y_axis": [ 0.113, 0.909, 0.401 ], "z_axis": [ 0.933, 0.042, -0.358 ], "quaternion": [ 0.550, 0.163, 0.808, 0.137 ] } }, { "index": 85, "index_chain": 85, "chain_name": "J", "nt_resnum": 125, "nt_name": "C", "nt_code": "C", "nt_id": "///J/125", "linked_nts": [ "///J/124", "///J/126" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": 94.503, "beta": -125.574, "gamma": -154.262, "delta": 86.282, "epsilon": -142.735, "zeta": -76.212, "epsilon_zeta": -66.523, "bb_type": "BI", "chi": -176.785, "glyco_bond": "anti", "C5prime_xyz": [ -0.941, 8.334, 1.633 ], "P_xyz": [ 0.588, 9.974, 0.366 ], "form": "A", "ssZp": 4.525, "Dp": 4.576, "splay_angle": 20.629, "splay_distance": 3.418, "splay_ratio": 0.184, "d22": null, "d64": null, "eta": 154.378, "theta": -145.211, "eta_prime": 173.289, "theta_prime": -149.326, "eta_base": -139.429, "theta_base": -121.268, "v0": 5.332, "v1": -24.568, "v2": 33.655, "v3": -31.471, "v4": 16.469, "amplitude": 34.161, "phase_angle": 9.880, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.076, "frame": { "rmsd": 0.022, "origin": [ 269.927, 304.138, 279.325 ], "x_axis": [ -0.357, 0.823, -0.441 ], "y_axis": [ 0.353, 0.556, 0.752 ], "z_axis": [ 0.865, 0.113, -0.490 ], "quaternion": [ 0.421, 0.380, 0.775, 0.279 ] } }, { "index": 86, "index_chain": 86, "chain_name": "J", "nt_resnum": 126, "nt_name": "A", "nt_code": "A", "nt_id": "///J/126", "linked_nts": [ "///J/125", "///J/127" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": 178.519, "beta": -159.400, "gamma": 146.834, "delta": 83.254, "epsilon": -124.628, "zeta": -96.065, "epsilon_zeta": -28.564, "bb_type": "--", "chi": -176.387, "glyco_bond": "anti", "C5prime_xyz": [ -1.611, 8.573, 1.444 ], "P_xyz": [ 0.679, 9.624, 0.814 ], "form": "A", "ssZp": 4.329, "Dp": 4.449, "splay_angle": 20.713, "splay_distance": 3.344, "splay_ratio": 0.180, "d22": null, "d64": null, "eta": 153.996, "theta": -154.863, "eta_prime": 176.027, "theta_prime": -153.189, "eta_base": -140.127, "theta_base": -124.092, "v0": -3.622, "v1": -17.668, "v2": 31.044, "v3": -34.115, "v4": 23.859, "amplitude": 34.168, "phase_angle": 24.691, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.010, "filter_rmsd": 0.044, "frame": { "rmsd": 0.016, "origin": [ 271.384, 304.635, 276.273 ], "x_axis": [ -0.291, 0.928, 0.233 ], "y_axis": [ 0.592, -0.016, 0.806 ], "z_axis": [ 0.751, 0.372, -0.545 ], "quaternion": [ 0.192, 0.563, 0.674, 0.437 ] } }, { "index": 87, "index_chain": 87, "chain_name": "J", "nt_resnum": 127, "nt_name": "A", "nt_code": "A", "nt_id": "///J/127", "linked_nts": [ "///J/126", "///J/128" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -37.969, "beta": 150.077, "gamma": 39.403, "delta": 78.567, "epsilon": -177.677, "zeta": -89.110, "epsilon_zeta": -88.567, "bb_type": "BI", "chi": -153.299, "glyco_bond": "anti", "C5prime_xyz": [ -1.416, 8.874, 0.124 ], "P_xyz": [ 1.131, 9.273, 0.376 ], "form": "A", "ssZp": 3.988, "Dp": 4.233, "splay_angle": 21.513, "splay_distance": 3.416, "splay_ratio": 0.187, "d22": null, "d64": null, "eta": 162.222, "theta": -143.240, "eta_prime": -178.364, "theta_prime": -148.100, "eta_base": -134.385, "theta_base": -118.471, "v0": -2.818, "v1": -20.653, "v2": 34.988, "v3": -37.520, "v4": 25.523, "amplitude": 37.946, "phase_angle": 22.774, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.151, "filter_rmsd": 0.046, "frame": { "rmsd": 0.019, "origin": [ 273.013, 306.133, 273.766 ], "x_axis": [ 0.099, 0.752, 0.652 ], "y_axis": [ 0.715, -0.509, 0.479 ], "z_axis": [ 0.692, 0.419, -0.588 ], "quaternion": [ 0.020, 0.741, 0.495, 0.453 ] } }, { "index": 88, "index_chain": 88, "chain_name": "J", "nt_resnum": 128, "nt_name": "A", "nt_code": "A", "nt_id": "///J/128", "linked_nts": [ "///J/127", "///J/129" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": 168.243, "beta": -134.258, "gamma": 151.338, "delta": 81.029, "epsilon": -122.364, "zeta": -69.976, "epsilon_zeta": -52.389, "bb_type": "--", "chi": -168.630, "glyco_bond": "anti", "C5prime_xyz": [ -1.429, 8.619, 1.106 ], "P_xyz": [ 0.898, 9.108, 0.028 ], "form": "A", "ssZp": 4.328, "Dp": 4.586, "splay_angle": 22.199, "splay_distance": 3.824, "splay_ratio": 0.199, "d22": null, "d64": null, "eta": 165.279, "theta": -131.149, "eta_prime": -178.878, "theta_prime": -136.696, "eta_base": -134.017, "theta_base": -111.998, "v0": 1.623, "v1": -23.641, "v2": 35.575, "v3": -35.571, "v4": 21.417, "amplitude": 37.038, "phase_angle": 16.159, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.035, "filter_rmsd": 0.046, "frame": { "rmsd": 0.021, "origin": [ 274.834, 308.296, 271.849 ], "x_axis": [ 0.466, 0.365, 0.806 ], "y_axis": [ 0.601, -0.799, 0.014 ], "z_axis": [ 0.649, 0.478, -0.592 ], "quaternion": [ -0.137, 0.845, 0.286, 0.430 ] } }, { "index": 89, "index_chain": 89, "chain_name": "J", "nt_resnum": 129, "nt_name": "C", "nt_code": "C", "nt_id": "///J/129", "linked_nts": [ "///J/128", "///J/130" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack", "alpha": -74.722, "beta": 142.617, "gamma": 98.746, "delta": 73.996, "epsilon": -159.105, "zeta": -80.241, "epsilon_zeta": -78.864, "bb_type": "BI", "chi": -169.030, "glyco_bond": "anti", "C5prime_xyz": [ -2.033, 8.999, 0.778 ], "P_xyz": [ 0.158, 10.103, -0.090 ], "form": ".", "ssZp": 4.016, "Dp": 4.222, "splay_angle": 27.841, "splay_distance": 4.525, "splay_ratio": 0.242, "d22": null, "d64": null, "eta": 170.387, "theta": -132.264, "eta_prime": -164.245, "theta_prime": -139.674, "eta_base": -117.191, "theta_base": -86.358, "v0": -10.777, "v1": -15.465, "v2": 34.262, "v3": -41.403, "v4": 32.931, "amplitude": 41.061, "phase_angle": 33.444, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.066, "frame": { "rmsd": 0.021, "origin": [ 276.920, 311.476, 271.450 ], "x_axis": [ 0.720, -0.106, 0.685 ], "y_axis": [ 0.346, -0.802, -0.487 ], "z_axis": [ 0.601, 0.588, -0.541 ], "quaternion": [ -0.307, 0.875, 0.069, 0.368 ] } }, { "index": 90, "index_chain": 90, "chain_name": "J", "nt_resnum": 130, "nt_name": "G", "nt_code": "G", "nt_id": "///J/130", "linked_nts": [ "///J/129", "///J/131" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-canonical,non-pair-contact,helix,ss-non-loop", "alpha": 161.799, "beta": -135.565, "gamma": 157.053, "delta": 79.664, "epsilon": -123.971, "zeta": -115.668, "epsilon_zeta": -8.303, "bb_type": "--", "chi": -169.960, "glyco_bond": "anti", "C5prime_xyz": [ -1.485, 8.808, 1.067 ], "P_xyz": [ 0.779, 9.555, 0.009 ], "form": ".", "ssZp": 4.263, "Dp": 4.451, "splay_angle": 47.378, "splay_distance": 7.752, "splay_ratio": 0.402, "d22": null, "d64": null, "eta": 161.586, "theta": -154.249, "eta_prime": -174.285, "theta_prime": -153.329, "eta_base": -101.401, "theta_base": -144.310, "v0": -6.142, "v1": -17.417, "v2": 33.037, "v3": -37.453, "v4": 27.553, "amplitude": 37.367, "phase_angle": 27.854, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.195, "filter_rmsd": 0.036, "frame": { "rmsd": 0.036, "origin": [ 281.285, 312.652, 271.238 ], "x_axis": [ 0.713, -0.702, 0.013 ], "y_axis": [ -0.336, -0.357, -0.871 ], "z_axis": [ 0.616, 0.617, -0.490 ], "quaternion": [ -0.465, 0.800, -0.324, 0.196 ] } }, { "index": 91, "index_chain": 91, "chain_name": "J", "nt_resnum": 131, "nt_name": "A", "nt_code": "A", "nt_id": "///J/131", "linked_nts": [ "///J/130", "///J/132" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C2'-endo,BII,non-canonical,non-pair-contact,helix,ss-non-loop", "alpha": 66.267, "beta": -166.116, "gamma": -46.791, "delta": 158.879, "epsilon": -96.248, "zeta": 151.576, "epsilon_zeta": 112.176, "bb_type": "BII", "chi": -105.228, "glyco_bond": "anti", "C5prime_xyz": [ -1.196, 7.590, -1.677 ], "P_xyz": [ 0.370, 9.648, -1.928 ], "form": ".", "ssZp": -0.186, "Dp": 1.518, "splay_angle": 46.832, "splay_distance": 7.796, "splay_ratio": 0.403, "d22": null, "d64": null, "eta": -116.378, "theta": 150.601, "eta_prime": -112.247, "theta_prime": 149.661, "eta_base": -119.843, "theta_base": 142.207, "v0": 1.559, "v1": 19.283, "v2": -31.442, "v3": 33.136, "v4": -22.198, "amplitude": 33.734, "phase_angle": 201.238, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "32m", "cluster": "7r", "suiteness": 0.416, "filter_rmsd": 0.066, "frame": { "rmsd": 0.061, "origin": [ 285.315, 318.818, 268.825 ], "x_axis": [ 0.597, -0.776, -0.204 ], "y_axis": [ -0.585, -0.247, -0.773 ], "z_axis": [ 0.549, 0.581, -0.601 ], "quaternion": [ -0.433, 0.782, -0.435, 0.110 ] } }, { "index": 92, "index_chain": 92, "chain_name": "J", "nt_resnum": 132, "nt_name": "A", "nt_code": "A", "nt_id": "///J/132", "linked_nts": [ "///J/131", "///J/133" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-canonical,non-pair-contact,helix,multiplet,ss-non-loop,A-minor,cap-acceptor,splayed-apart", "alpha": 157.785, "beta": -144.776, "gamma": 67.873, "delta": 88.072, "epsilon": -115.356, "zeta": -64.901, "epsilon_zeta": -50.455, "bb_type": "--", "chi": -140.490, "glyco_bond": "anti", "C5prime_xyz": [ -1.340, 8.663, -0.607 ], "P_xyz": [ 1.263, 8.913, -0.267 ], "form": ".", "ssZp": 3.247, "Dp": 4.526, "splay_angle": 90.029, "splay_distance": 14.294, "splay_ratio": 0.707, "d22": null, "d64": null, "eta": 131.880, "theta": -114.076, "eta_prime": 118.822, "theta_prime": -134.581, "eta_base": 123.873, "theta_base": -173.977, "v0": 0.390, "v1": -19.896, "v2": 30.646, "v3": -31.178, "v4": 19.505, "amplitude": 32.198, "phase_angle": 17.863, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.048, "frame": { "rmsd": 0.025, "origin": [ 279.439, 323.218, 271.448 ], "x_axis": [ 0.700, -0.695, -0.164 ], "y_axis": [ -0.375, -0.162, -0.913 ], "z_axis": [ 0.608, 0.701, -0.374 ], "quaternion": [ 0.540, -0.748, 0.358, -0.148 ] } }, { "index": 93, "index_chain": 93, "chain_name": "J", "nt_resnum": 133, "nt_name": "A", "nt_code": "A", "nt_id": "///J/133", "linked_nts": [ "///J/132", "///J/134" ], "nt_type": "RNA", "dbn": ".", "summary": "~C2'-endo,BII,non-pair-contact,ss-non-loop,A-minor,splayed-apart", "alpha": -69.433, "beta": -105.886, "gamma": -76.900, "delta": 146.642, "epsilon": -124.004, "zeta": 158.001, "epsilon_zeta": 77.996, "bb_type": "BII", "chi": -66.726, "glyco_bond": "--", "C5prime_xyz": [ -3.741, 6.788, -2.778 ], "P_xyz": [ -5.834, 7.293, -4.232 ], "form": ".", "ssZp": 1.377, "Dp": 1.494, "splay_angle": 121.670, "splay_distance": 16.937, "splay_ratio": 0.873, "d22": null, "d64": null, "eta": 129.215, "theta": 72.555, "eta_prime": 129.159, "theta_prime": 108.525, "eta_base": 103.499, "theta_base": 150.872, "v0": -26.054, "v1": 39.210, "v2": -36.425, "v3": 22.444, "v4": 2.046, "amplitude": 39.234, "phase_angle": 158.188, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32m", "cluster": "1o", "suiteness": 0.349, "filter_rmsd": 0.054, "frame": { "rmsd": 0.031, "origin": [ 277.895, 335.545, 264.379 ], "x_axis": [ 0.424, 0.347, 0.837 ], "y_axis": [ 0.549, -0.833, 0.067 ], "z_axis": [ 0.720, 0.431, -0.544 ], "quaternion": [ -0.109, 0.837, 0.268, 0.465 ] } }, { "index": 94, "index_chain": 94, "chain_name": "J", "nt_resnum": 134, "nt_name": "G", "nt_code": "G", "nt_id": "///J/134", "linked_nts": [ "///J/133", "///J/135" ], "nt_type": "RNA", "dbn": "[", "summary": "pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,splayed-apart", "alpha": -72.251, "beta": -160.199, "gamma": 75.517, "delta": 79.748, "epsilon": -144.111, "zeta": -70.951, "epsilon_zeta": -73.160, "bb_type": "BI", "chi": -179.343, "glyco_bond": "anti", "C5prime_xyz": [ -1.585, 8.591, 1.575 ], "P_xyz": [ 0.850, 8.923, 2.489 ], "form": "A", "ssZp": 4.536, "Dp": 4.571, "splay_angle": 25.048, "splay_distance": 3.901, "splay_ratio": 0.219, "d22": null, "d64": null, "eta": -111.850, "theta": -139.697, "eta_prime": -135.823, "theta_prime": -135.069, "eta_base": -132.367, "theta_base": -97.615, "v0": -0.859, "v1": -22.129, "v2": 35.439, "v3": -36.750, "v4": 23.809, "amplitude": 37.668, "phase_angle": 19.810, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "0a", "suiteness": 0.019, "filter_rmsd": 0.031, "frame": { "rmsd": 0.031, "origin": [ 286.303, 327.742, 251.919 ], "x_axis": [ 0.757, 0.220, 0.616 ], "y_axis": [ -0.652, 0.191, 0.734 ], "z_axis": [ 0.043, -0.957, 0.288 ], "quaternion": [ 0.748, 0.565, -0.191, 0.292 ] } }, { "index": 95, "index_chain": 95, "chain_name": "J", "nt_resnum": 135, "nt_name": "U", "nt_code": "U", "nt_id": "///J/135", "linked_nts": [ "///J/134", "///J/136" ], "nt_type": "RNA", "dbn": "[", "summary": "pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -72.380, "beta": 173.608, "gamma": 62.463, "delta": 81.770, "epsilon": -148.998, "zeta": -71.726, "epsilon_zeta": -77.272, "bb_type": "BI", "chi": -161.134, "glyco_bond": "anti", "C5prime_xyz": [ -1.416, 8.726, 0.590 ], "P_xyz": [ 1.169, 9.067, 0.808 ], "form": "A", "ssZp": 4.289, "Dp": 4.519, "splay_angle": 23.873, "splay_distance": 3.909, "splay_ratio": 0.210, "d22": null, "d64": null, "eta": 168.214, "theta": -141.805, "eta_prime": -173.312, "theta_prime": -143.614, "eta_base": -121.054, "theta_base": -123.967, "v0": 0.570, "v1": -23.116, "v2": 35.798, "v3": -36.211, "v4": 22.499, "amplitude": 37.563, "phase_angle": 17.636, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.828, "filter_rmsd": 0.092, "frame": { "rmsd": 0.027, "origin": [ 288.277, 324.545, 252.972 ], "x_axis": [ 0.126, 0.249, 0.960 ], "y_axis": [ -0.990, -0.030, 0.138 ], "z_axis": [ 0.063, -0.968, 0.243 ], "quaternion": [ 0.579, 0.478, -0.388, 0.535 ] } }, { "index": 96, "index_chain": 96, "chain_name": "J", "nt_resnum": 136, "nt_name": "G", "nt_code": "G", "nt_id": "///J/136", "linked_nts": [ "///J/135", "///J/137" ], "nt_type": "RNA", "dbn": "[", "summary": "pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -72.618, "beta": 173.830, "gamma": 61.391, "delta": 78.182, "epsilon": -145.421, "zeta": -67.428, "epsilon_zeta": -77.993, "bb_type": "BI", "chi": -162.625, "glyco_bond": "anti", "C5prime_xyz": [ -1.616, 8.880, 0.655 ], "P_xyz": [ 0.906, 9.558, 0.974 ], "form": "A", "ssZp": 4.323, "Dp": 4.528, "splay_angle": 23.321, "splay_distance": 3.735, "splay_ratio": 0.203, "d22": null, "d64": null, "eta": 166.117, "theta": -139.325, "eta_prime": 178.731, "theta_prime": -137.967, "eta_base": -146.537, "theta_base": -95.521, "v0": -1.708, "v1": -22.671, "v2": 37.051, "v3": -38.892, "v4": 25.589, "amplitude": 39.657, "phase_angle": 20.888, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.852, "filter_rmsd": 0.028, "frame": { "rmsd": 0.028, "origin": [ 290.165, 321.339, 254.170 ], "x_axis": [ -0.389, 0.407, 0.826 ], "y_axis": [ -0.921, -0.152, -0.359 ], "z_axis": [ -0.020, -0.901, 0.434 ], "quaternion": [ 0.472, 0.287, -0.448, 0.703 ] } }, { "index": 97, "index_chain": 97, "chain_name": "J", "nt_resnum": 137, "nt_name": "U", "nt_code": "U", "nt_id": "///J/137", "linked_nts": [ "///J/136", "///J/138" ], "nt_type": "RNA", "dbn": "[", "summary": "pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -72.472, "beta": 171.676, "gamma": 61.101, "delta": 78.852, "epsilon": -136.242, "zeta": -85.074, "epsilon_zeta": -51.168, "bb_type": "BI", "chi": -156.848, "glyco_bond": "anti", "C5prime_xyz": [ -1.482, 8.788, 0.308 ], "P_xyz": [ 1.088, 9.310, 0.138 ], "form": "A", "ssZp": 4.275, "Dp": 4.676, "splay_angle": 20.607, "splay_distance": 3.346, "splay_ratio": 0.180, "d22": null, "d64": null, "eta": 164.897, "theta": -151.279, "eta_prime": -178.090, "theta_prime": -153.260, "eta_base": -120.364, "theta_base": -141.326, "v0": 1.456, "v1": -24.653, "v2": 37.259, "v3": -37.226, "v4": 22.639, "amplitude": 38.839, "phase_angle": 16.403, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.852, "filter_rmsd": 0.101, "frame": { "rmsd": 0.026, "origin": [ 289.651, 319.463, 257.358 ], "x_axis": [ -0.905, 0.243, 0.348 ], "y_axis": [ -0.424, -0.494, -0.759 ], "z_axis": [ -0.012, -0.835, 0.551 ], "quaternion": [ 0.194, 0.098, -0.464, 0.859 ] } }, { "index": 98, "index_chain": 98, "chain_name": "J", "nt_resnum": 138, "nt_name": "G", "nt_code": "G", "nt_id": "///J/138", "linked_nts": [ "///J/137", "///J/139" ], "nt_type": "RNA", "dbn": "[", "summary": "pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -76.401, "beta": 153.187, "gamma": 72.185, "delta": 77.133, "epsilon": -158.124, "zeta": -72.772, "epsilon_zeta": -85.352, "bb_type": "BI", "chi": -163.574, "glyco_bond": "anti", "C5prime_xyz": [ -1.502, 8.846, 0.701 ], "P_xyz": [ 0.952, 9.436, 0.030 ], "form": ".", "ssZp": 4.463, "Dp": 4.562, "splay_angle": 24.198, "splay_distance": 4.360, "splay_ratio": 0.227, "d22": null, "d64": null, "eta": 157.344, "theta": -122.004, "eta_prime": 170.835, "theta_prime": -133.744, "eta_base": -161.819, "theta_base": -110.484, "v0": 0.948, "v1": -25.742, "v2": 39.326, "v3": -39.605, "v4": 24.436, "amplitude": 41.156, "phase_angle": 17.151, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.346, "filter_rmsd": 0.024, "frame": { "rmsd": 0.024, "origin": [ 290.167, 317.631, 260.110 ], "x_axis": [ -0.964, 0.235, -0.128 ], "y_axis": [ -0.066, -0.671, -0.739 ], "z_axis": [ -0.259, -0.703, 0.662 ], "quaternion": [ 0.083, -0.107, -0.397, 0.908 ] } }, { "index": 99, "index_chain": 99, "chain_name": "J", "nt_resnum": 139, "nt_name": "C", "nt_code": "C", "nt_id": "///J/139", "linked_nts": [ "///J/138", "///J/140" ], "nt_type": "RNA", "dbn": "[", "summary": "pseudoknotted,anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,A-minor", "alpha": 153.583, "beta": -156.410, "gamma": -175.596, "delta": 83.729, "epsilon": -130.578, "zeta": -86.720, "epsilon_zeta": -43.858, "bb_type": "BI", "chi": -172.442, "glyco_bond": "anti", "C5prime_xyz": [ -1.490, 8.691, 1.262 ], "P_xyz": [ 0.038, 10.461, 0.058 ], "form": "A", "ssZp": 4.460, "Dp": 4.557, "splay_angle": 23.028, "splay_distance": 3.748, "splay_ratio": 0.201, "d22": 4.424, "d64": 4.351, "eta": 175.713, "theta": -167.211, "eta_prime": -167.922, "theta_prime": -160.943, "eta_base": -122.869, "theta_base": -129.894, "v0": 0.566, "v1": -22.489, "v2": 34.488, "v3": -34.951, "v4": 21.735, "amplitude": 36.178, "phase_angle": 17.581, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.902, "filter_rmsd": 0.065, "frame": { "rmsd": 0.022, "origin": [ 287.075, 317.330, 263.169 ], "x_axis": [ -0.839, -0.149, -0.524 ], "y_axis": [ 0.427, -0.778, -0.462 ], "z_axis": [ -0.339, -0.611, 0.716 ], "quaternion": [ -0.158, -0.236, -0.294, 0.913 ] } }, { "index": 100, "index_chain": 100, "chain_name": "J", "nt_resnum": 140, "nt_name": "U", "nt_code": "U", "nt_id": "///J/140", "linked_nts": [ "///J/139", "///J/141" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-canonical,non-pair-contact,helix,ss-non-loop,cap-donor", "alpha": -48.468, "beta": 157.334, "gamma": 44.824, "delta": 79.387, "epsilon": -163.519, "zeta": 135.598, "epsilon_zeta": 60.882, "bb_type": "--", "chi": -158.479, "glyco_bond": "anti", "C5prime_xyz": [ -1.769, 8.844, 0.383 ], "P_xyz": [ 0.769, 9.477, 0.601 ], "form": ".", "ssZp": 4.261, "Dp": 4.405, "splay_angle": 84.580, "splay_distance": 10.760, "splay_ratio": 0.679, "d22": 10.654, "d64": 11.704, "eta": 160.398, "theta": 95.519, "eta_prime": 179.270, "theta_prime": 95.768, "eta_base": -137.146, "theta_base": 128.839, "v0": -2.646, "v1": -21.130, "v2": 35.591, "v3": -37.883, "v4": 25.525, "amplitude": 38.468, "phase_angle": 22.300, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.528, "filter_rmsd": 0.098, "frame": { "rmsd": 0.030, "origin": [ 284.696, 316.059, 265.770 ], "x_axis": [ -0.429, -0.503, -0.750 ], "y_axis": [ 0.801, -0.596, -0.059 ], "z_axis": [ -0.418, -0.626, 0.659 ], "quaternion": [ -0.398, -0.356, -0.209, 0.819 ] } }, { "index": 101, "index_chain": 101, "chain_name": "J", "nt_resnum": 141, "nt_name": "U", "nt_code": "U", "nt_id": "///J/141", "linked_nts": [ "///J/140", "///J/142" ], "nt_type": "RNA", "dbn": ".", "summary": "syn,~C3'-endo,non-stack,non-canonical,non-pair-contact,multiplet,ss-non-loop", "alpha": 107.806, "beta": -102.540, "gamma": -179.688, "delta": 91.838, "epsilon": -126.773, "zeta": -153.072, "epsilon_zeta": 26.300, "bb_type": "--", "chi": 31.572, "glyco_bond": "syn", "C5prime_xyz": [ -5.813, 4.540, 0.401 ], "P_xyz": [ -5.543, 3.223, 2.606 ], "form": ".", "ssZp": -3.135, "Dp": 3.509, "splay_angle": 35.509, "splay_distance": 5.702, "splay_ratio": 0.359, "d22": 5.328, "d64": 4.255, "eta": -163.490, "theta": 169.938, "eta_prime": -170.639, "theta_prime": 172.575, "eta_base": 173.476, "theta_base": 177.410, "v0": -17.719, "v1": -1.391, "v2": 18.436, "v3": -29.178, "v4": 29.649, "amplitude": 30.597, "phase_angle": 52.947, "puckering": "C4'-exo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.098, "frame": { "rmsd": 0.027, "origin": [ 291.412, 316.705, 274.151 ], "x_axis": [ 0.602, 0.798, 0.015 ], "y_axis": [ 0.772, -0.577, -0.268 ], "z_axis": [ -0.206, 0.173, -0.963 ], "quaternion": [ -0.125, 0.886, 0.443, -0.054 ] } }, { "index": 102, "index_chain": 102, "chain_name": "J", "nt_resnum": 142, "nt_name": "C", "nt_code": "C", "nt_id": "///J/142", "linked_nts": [ "///J/141", "///J/143" ], "nt_type": "RNA", "dbn": ".", "summary": "syn,~C2'-endo,non-stack,non-canonical,non-pair-contact,helix-end,ss-non-loop,splayed-apart", "alpha": 110.104, "beta": -127.420, "gamma": -168.075, "delta": 150.233, "epsilon": -96.206, "zeta": -104.714, "epsilon_zeta": 8.508, "bb_type": "--", "chi": 50.001, "glyco_bond": "syn", "C5prime_xyz": [ -5.451, 4.151, 0.429 ], "P_xyz": [ -5.528, 2.223, 2.185 ], "form": ".", "ssZp": -1.060, "Dp": 0.959, "splay_angle": 114.317, "splay_distance": 17.598, "splay_ratio": 0.840, "d22": null, "d64": null, "eta": -135.991, "theta": -91.593, "eta_prime": -146.536, "theta_prime": -113.356, "eta_base": -145.002, "theta_base": -147.272, "v0": -20.829, "v1": 36.215, "v2": -36.889, "v3": 25.796, "v4": -3.300, "amplitude": 37.990, "phase_angle": 166.170, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.018, "origin": [ 294.460, 313.358, 277.619 ], "x_axis": [ 0.386, 0.920, -0.072 ], "y_axis": [ 0.874, -0.389, -0.292 ], "z_axis": [ -0.297, 0.050, -0.954 ], "quaternion": [ -0.104, 0.826, 0.543, -0.111 ] } }, { "index": 103, "index_chain": 103, "chain_name": "J", "nt_resnum": 143, "nt_name": "G", "nt_code": "G", "nt_id": "///J/143", "linked_nts": [ "///J/142", "///J/144" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,splayed-apart", "alpha": 40.819, "beta": 110.082, "gamma": 165.964, "delta": 83.973, "epsilon": -142.531, "zeta": -70.995, "epsilon_zeta": -71.535, "bb_type": "BI", "chi": 177.989, "glyco_bond": "anti", "C5prime_xyz": [ -1.028, 8.239, 1.851 ], "P_xyz": [ -0.504, 10.676, 0.935 ], "form": "A", "ssZp": 4.664, "Dp": 4.692, "splay_angle": 25.094, "splay_distance": 3.831, "splay_ratio": 0.220, "d22": null, "d64": null, "eta": -30.547, "theta": 170.799, "eta_prime": 8.834, "theta_prime": -173.063, "eta_base": 23.751, "theta_base": -138.344, "v0": 7.762, "v1": -28.140, "v2": 36.691, "v3": -33.155, "v4": 15.999, "amplitude": 36.943, "phase_angle": 6.693, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.017, "frame": { "rmsd": 0.017, "origin": [ 307.019, 303.093, 284.443 ], "x_axis": [ 0.772, 0.274, -0.574 ], "y_axis": [ -0.614, 0.088, -0.784 ], "z_axis": [ -0.164, 0.958, 0.236 ], "quaternion": [ 0.724, -0.602, 0.141, 0.307 ] } }, { "index": 104, "index_chain": 104, "chain_name": "J", "nt_resnum": 144, "nt_name": "G", "nt_code": "G", "nt_id": "///J/144", "linked_nts": [ "///J/143", "///J/145" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -85.362, "beta": -171.989, "gamma": 62.663, "delta": 83.846, "epsilon": -152.994, "zeta": -71.856, "epsilon_zeta": -81.138, "bb_type": "BI", "chi": -171.791, "glyco_bond": "anti", "C5prime_xyz": [ -1.262, 8.565, 1.253 ], "P_xyz": [ 1.270, 8.714, 1.938 ], "form": "A", "ssZp": 4.545, "Dp": 4.577, "splay_angle": 22.832, "splay_distance": 3.592, "splay_ratio": 0.201, "d22": null, "d64": null, "eta": 164.241, "theta": -144.430, "eta_prime": 178.326, "theta_prime": -142.911, "eta_base": -141.680, "theta_base": -122.781, "v0": 3.103, "v1": -23.968, "v2": 34.554, "v3": -33.657, "v4": 19.318, "amplitude": 35.564, "phase_angle": 13.689, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.568, "filter_rmsd": 0.012, "frame": { "rmsd": 0.012, "origin": [ 308.099, 306.252, 286.322 ], "x_axis": [ 0.263, 0.081, -0.962 ], "y_axis": [ -0.954, -0.131, -0.271 ], "z_axis": [ -0.148, 0.988, 0.042 ], "quaternion": [ 0.542, -0.581, 0.376, 0.477 ] } }, { "index": 105, "index_chain": 105, "chain_name": "J", "nt_resnum": 145, "nt_name": "U", "nt_code": "U", "nt_id": "///J/145", "linked_nts": [ "///J/144", "///J/146" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -70.213, "beta": 179.658, "gamma": 55.375, "delta": 82.942, "epsilon": -150.599, "zeta": -72.301, "epsilon_zeta": -78.298, "bb_type": "BI", "chi": -162.045, "glyco_bond": "anti", "C5prime_xyz": [ -1.417, 8.718, 0.680 ], "P_xyz": [ 1.144, 9.111, 1.117 ], "form": "A", "ssZp": 4.438, "Dp": 4.562, "splay_angle": 19.472, "splay_distance": 3.143, "splay_ratio": 0.171, "d22": null, "d64": null, "eta": 169.238, "theta": -144.089, "eta_prime": -178.208, "theta_prime": -144.912, "eta_base": -144.566, "theta_base": -120.608, "v0": 0.756, "v1": -22.429, "v2": 34.351, "v3": -34.783, "v4": 21.448, "amplitude": 35.990, "phase_angle": 17.359, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.946, "filter_rmsd": 0.101, "frame": { "rmsd": 0.009, "origin": [ 309.466, 309.544, 286.765 ], "x_axis": [ -0.266, -0.039, -0.963 ], "y_axis": [ -0.957, -0.109, 0.268 ], "z_axis": [ -0.116, 0.993, -0.008 ], "quaternion": [ 0.393, -0.461, 0.540, 0.585 ] } }, { "index": 106, "index_chain": 106, "chain_name": "J", "nt_resnum": 146, "nt_name": "A", "nt_code": "A", "nt_id": "///J/146", "linked_nts": [ "///J/145", "///J/147" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -68.918, "beta": 167.418, "gamma": 58.028, "delta": 80.605, "epsilon": -147.523, "zeta": -80.021, "epsilon_zeta": -67.502, "bb_type": "BI", "chi": -165.677, "glyco_bond": "anti", "C5prime_xyz": [ -1.621, 8.727, 0.791 ], "P_xyz": [ 0.924, 9.336, 0.919 ], "form": "A", "ssZp": 4.490, "Dp": 4.586, "splay_angle": 21.354, "splay_distance": 3.442, "splay_ratio": 0.188, "d22": null, "d64": null, "eta": 163.886, "theta": -151.854, "eta_prime": 177.900, "theta_prime": -152.223, "eta_base": -141.676, "theta_base": -130.725, "v0": -1.583, "v1": -20.925, "v2": 34.145, "v3": -36.004, "v4": 23.703, "amplitude": 36.577, "phase_angle": 21.012, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.943, "filter_rmsd": 0.037, "frame": { "rmsd": 0.012, "origin": [ 310.268, 312.396, 285.716 ], "x_axis": [ -0.703, -0.221, -0.677 ], "y_axis": [ -0.697, 0.022, 0.717 ], "z_axis": [ -0.143, 0.975, -0.169 ], "quaternion": [ 0.194, -0.333, 0.688, 0.615 ] } }, { "index": 107, "index_chain": 107, "chain_name": "J", "nt_resnum": 147, "nt_name": "G", "nt_code": "G", "nt_id": "///J/147", "linked_nts": [ "///J/146", "///J/148" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -69.234, "beta": 162.193, "gamma": 66.427, "delta": 81.547, "epsilon": -140.541, "zeta": -70.116, "epsilon_zeta": -70.425, "bb_type": "BI", "chi": -168.142, "glyco_bond": "anti", "C5prime_xyz": [ -1.544, 8.827, 0.978 ], "P_xyz": [ 1.017, 9.326, 1.129 ], "form": ".", "ssZp": 4.369, "Dp": 4.507, "splay_angle": 22.328, "splay_distance": 3.535, "splay_ratio": 0.194, "d22": null, "d64": null, "eta": 170.166, "theta": -134.494, "eta_prime": -178.218, "theta_prime": -133.546, "eta_base": -144.387, "theta_base": -77.558, "v0": -2.777, "v1": -19.598, "v2": 33.169, "v3": -35.636, "v4": 24.247, "amplitude": 35.999, "phase_angle": 22.872, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.669, "filter_rmsd": 0.019, "frame": { "rmsd": 0.019, "origin": [ 310.727, 315.192, 283.764 ], "x_axis": [ -0.919, -0.347, -0.187 ], "y_axis": [ -0.263, 0.188, 0.946 ], "z_axis": [ -0.293, 0.919, -0.264 ], "quaternion": [ -0.035, -0.198, 0.770, 0.606 ] } }, { "index": 108, "index_chain": 108, "chain_name": "J", "nt_resnum": 148, "nt_name": "C", "nt_code": "C", "nt_id": "///J/148", "linked_nts": [ "///J/147", "///J/149" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,canonical,non-canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,hairpin-loop,splayed-apart", "alpha": -65.861, "beta": 163.276, "gamma": 56.398, "delta": 83.487, "epsilon": -94.390, "zeta": -128.481, "epsilon_zeta": 34.091, "bb_type": "--", "chi": -149.563, "glyco_bond": "anti", "C5prime_xyz": [ -1.391, 8.789, -0.070 ], "P_xyz": [ 1.206, 9.007, -0.422 ], "form": ".", "ssZp": 3.456, "Dp": 4.624, "splay_angle": 86.838, "splay_distance": 13.061, "splay_ratio": 0.688, "d22": 8.134, "d64": 10.607, "eta": 175.383, "theta": -138.742, "eta_prime": -167.206, "theta_prime": -175.341, "eta_base": -98.591, "theta_base": 131.848, "v0": 2.668, "v1": -23.448, "v2": 34.183, "v3": -33.521, "v4": 19.524, "amplitude": 35.285, "phase_angle": 14.357, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.916, "filter_rmsd": 0.070, "frame": { "rmsd": 0.011, "origin": [ 307.720, 316.928, 283.097 ], "x_axis": [ -0.833, -0.004, 0.553 ], "y_axis": [ 0.448, 0.581, 0.680 ], "z_axis": [ -0.324, 0.814, -0.483 ], "quaternion": [ -0.257, 0.130, 0.851, 0.439 ] } }, { "index": 109, "index_chain": 109, "chain_name": "J", "nt_resnum": 149, "nt_name": "U", "nt_code": "U", "nt_id": "///J/149", "linked_nts": [ "///J/148", "///J/150" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,anti,~C2'-endo,non-stack,hairpin-loop,splayed-apart", "alpha": 51.772, "beta": -145.560, "gamma": 158.994, "delta": 148.809, "epsilon": -118.733, "zeta": 1.341, "epsilon_zeta": 239.926, "bb_type": "--", "chi": -147.208, "glyco_bond": "anti", "C5prime_xyz": [ -1.751, 8.668, 0.300 ], "P_xyz": [ 0.768, 9.048, -0.314 ], "form": ".", "ssZp": 1.275, "Dp": 1.311, "splay_angle": 92.294, "splay_distance": 13.247, "splay_ratio": 0.723, "d22": null, "d64": null, "eta": 78.116, "theta": -36.755, "eta_prime": 100.249, "theta_prime": -65.178, "eta_base": 74.621, "theta_base": -26.136, "v0": -20.172, "v1": 35.277, "v2": -36.051, "v3": 25.348, "v4": -3.458, "amplitude": 37.076, "phase_angle": 166.498, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.103, "frame": { "rmsd": 0.003, "origin": [ 318.890, 323.001, 280.109 ], "x_axis": [ 0.446, -0.498, 0.744 ], "y_axis": [ -0.758, 0.231, 0.610 ], "z_axis": [ -0.475, -0.836, -0.274 ], "quaternion": [ 0.592, 0.610, -0.515, 0.110 ] } }, { "index": 110, "index_chain": 110, "chain_name": "J", "nt_resnum": 150, "nt_name": "A", "nt_code": "A", "nt_id": "///J/150", "linked_nts": [ "///J/149", "///J/151" ], "nt_type": "RNA", "dbn": ".", "summary": "~C3'-endo,BI,non-pair-contact,hairpin-loop,cap-donor,splayed-apart", "alpha": -147.521, "beta": 109.838, "gamma": 161.291, "delta": 81.693, "epsilon": -163.354, "zeta": -114.694, "epsilon_zeta": -48.660, "bb_type": "BI", "chi": -57.279, "glyco_bond": "--", "C5prime_xyz": [ -3.394, 5.608, -3.433 ], "P_xyz": [ -5.614, 4.587, -4.365 ], "form": ".", "ssZp": -2.055, "Dp": 4.582, "splay_angle": 117.333, "splay_distance": 16.495, "splay_ratio": 0.854, "d22": null, "d64": null, "eta": 168.988, "theta": 103.221, "eta_prime": -155.580, "theta_prime": 135.492, "eta_base": -116.601, "theta_base": 169.050, "v0": 5.127, "v1": -27.119, "v2": 37.535, "v3": -35.594, "v4": 19.286, "amplitude": 38.248, "phase_angle": 11.086, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.037, "frame": { "rmsd": 0.008, "origin": [ 307.537, 322.907, 286.933 ], "x_axis": [ -0.897, -0.180, 0.403 ], "y_axis": [ -0.348, -0.276, -0.896 ], "z_axis": [ 0.273, -0.944, 0.185 ], "quaternion": [ 0.055, 0.220, -0.599, 0.768 ] } }, { "index": 111, "index_chain": 111, "chain_name": "J", "nt_resnum": 151, "nt_name": "G", "nt_code": "G", "nt_id": "///J/151", "linked_nts": [ "///J/150", "///J/152" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,anti,~C3'-endo,non-canonical,non-pair-contact,helix-end,hairpin-loop,splayed-apart", "alpha": -83.163, "beta": -174.123, "gamma": 151.000, "delta": 73.010, "epsilon": 69.969, "zeta": -14.196, "epsilon_zeta": -275.835, "bb_type": "--", "chi": -117.326, "glyco_bond": "anti", "C5prime_xyz": [ -2.295, 8.308, -1.868 ], "P_xyz": [ -1.473, 8.510, -4.334 ], "form": ".", "ssZp": 1.759, "Dp": 3.024, "splay_angle": 71.071, "splay_distance": 11.731, "splay_ratio": 0.581, "d22": null, "d64": null, "eta": -51.588, "theta": 98.848, "eta_prime": -87.141, "theta_prime": 73.207, "eta_base": -133.845, "theta_base": 44.119, "v0": -2.641, "v1": -19.195, "v2": 32.698, "v3": -35.065, "v4": 23.781, "amplitude": 35.469, "phase_angle": 22.795, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.027, "frame": { "rmsd": 0.027, "origin": [ 298.875, 315.212, 275.191 ], "x_axis": [ -0.849, 0.518, -0.100 ], "y_axis": [ 0.527, 0.822, -0.216 ], "z_axis": [ -0.030, -0.236, -0.971 ], "quaternion": [ 0.018, 0.274, 0.954, -0.119 ] } }, { "index": 112, "index_chain": 112, "chain_name": "J", "nt_resnum": 152, "nt_name": "G", "nt_code": "G", "nt_id": "///J/152", "linked_nts": [ "///J/151", "///J/153" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,hairpin-loop,cap-acceptor", "alpha": 165.104, "beta": 126.797, "gamma": 131.338, "delta": 81.117, "epsilon": 173.103, "zeta": -88.985, "epsilon_zeta": -97.912, "bb_type": "BI", "chi": -133.273, "glyco_bond": "anti", "C5prime_xyz": [ -2.324, 8.754, -1.126 ], "P_xyz": [ -1.934, 9.040, -3.702 ], "form": ".", "ssZp": 3.389, "Dp": 3.939, "splay_angle": 20.138, "splay_distance": 3.530, "splay_ratio": 0.178, "d22": null, "d64": null, "eta": 126.749, "theta": 168.765, "eta_prime": 109.167, "theta_prime": 161.309, "eta_base": 102.697, "theta_base": 172.349, "v0": -10.115, "v1": -12.530, "v2": 28.810, "v3": -35.464, "v4": 28.860, "amplitude": 35.138, "phase_angle": 34.924, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.011, "frame": { "rmsd": 0.011, "origin": [ 308.022, 318.448, 281.786 ], "x_axis": [ -0.920, -0.332, 0.210 ], "y_axis": [ -0.119, -0.274, -0.954 ], "z_axis": [ 0.374, -0.903, 0.212 ], "quaternion": [ -0.069, 0.188, -0.599, 0.776 ] } }, { "index": 113, "index_chain": 113, "chain_name": "J", "nt_resnum": 153, "nt_name": "C", "nt_code": "C", "nt_id": "///J/153", "linked_nts": [ "///J/152", "///J/154" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": 144.067, "beta": -153.001, "gamma": 178.463, "delta": 81.596, "epsilon": -141.992, "zeta": -72.301, "epsilon_zeta": -69.691, "bb_type": "BI", "chi": -165.175, "glyco_bond": "anti", "C5prime_xyz": [ -1.288, 8.792, 0.839 ], "P_xyz": [ 0.297, 10.226, -0.682 ], "form": "A", "ssZp": 4.423, "Dp": 4.564, "splay_angle": 28.834, "splay_distance": 4.596, "splay_ratio": 0.249, "d22": 4.256, "d64": 4.198, "eta": 164.421, "theta": -163.387, "eta_prime": 168.052, "theta_prime": -160.176, "eta_base": -170.028, "theta_base": -129.087, "v0": -0.967, "v1": -21.189, "v2": 34.067, "v3": -35.484, "v4": 22.997, "amplitude": 36.264, "phase_angle": 20.047, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.506, "filter_rmsd": 0.066, "frame": { "rmsd": 0.009, "origin": [ 310.118, 316.439, 283.793 ], "x_axis": [ -0.925, -0.366, -0.100 ], "y_axis": [ 0.203, -0.253, -0.946 ], "z_axis": [ 0.321, -0.896, 0.308 ], "quaternion": [ -0.180, 0.070, -0.584, 0.788 ] } }, { "index": 114, "index_chain": 114, "chain_name": "J", "nt_resnum": 154, "nt_name": "U", "nt_code": "U", "nt_id": "///J/154", "linked_nts": [ "///J/153", "///J/155" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -67.971, "beta": -179.719, "gamma": 48.277, "delta": 80.434, "epsilon": -152.695, "zeta": -75.796, "epsilon_zeta": -76.900, "bb_type": "BI", "chi": -168.152, "glyco_bond": "anti", "C5prime_xyz": [ -1.401, 8.663, 1.012 ], "P_xyz": [ 1.070, 9.091, 1.755 ], "form": "A", "ssZp": 4.569, "Dp": 4.607, "splay_angle": 20.915, "splay_distance": 3.270, "splay_ratio": 0.183, "d22": null, "d64": null, "eta": 162.561, "theta": -152.673, "eta_prime": 176.457, "theta_prime": -150.380, "eta_base": -140.216, "theta_base": -126.406, "v0": 1.518, "v1": -24.261, "v2": 36.498, "v3": -36.539, "v4": 22.080, "amplitude": 38.026, "phase_angle": 16.297, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.927, "filter_rmsd": 0.103, "frame": { "rmsd": 0.007, "origin": [ 310.149, 312.314, 285.820 ], "x_axis": [ -0.706, -0.103, -0.701 ], "y_axis": [ 0.687, 0.143, -0.713 ], "z_axis": [ 0.174, -0.984, -0.030 ], "quaternion": [ 0.319, 0.213, 0.685, -0.619 ] } }, { "index": 115, "index_chain": 115, "chain_name": "J", "nt_resnum": 155, "nt_name": "A", "nt_code": "A", "nt_id": "///J/155", "linked_nts": [ "///J/154", "///J/156" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -65.978, "beta": 166.914, "gamma": 61.008, "delta": 81.594, "epsilon": -146.118, "zeta": -71.889, "epsilon_zeta": -74.229, "bb_type": "BI", "chi": -167.021, "glyco_bond": "anti", "C5prime_xyz": [ -1.392, 8.651, 0.941 ], "P_xyz": [ 1.201, 9.012, 1.068 ], "form": "A", "ssZp": 4.512, "Dp": 4.619, "splay_angle": 22.362, "splay_distance": 3.504, "splay_ratio": 0.195, "d22": null, "d64": null, "eta": 170.245, "theta": -140.846, "eta_prime": -177.258, "theta_prime": -140.684, "eta_base": -141.027, "theta_base": -104.616, "v0": 1.721, "v1": -23.542, "v2": 35.194, "v3": -35.156, "v4": 21.128, "amplitude": 36.609, "phase_angle": 15.981, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.877, "filter_rmsd": 0.041, "frame": { "rmsd": 0.009, "origin": [ 309.331, 309.282, 286.733 ], "x_axis": [ -0.266, -0.005, -0.964 ], "y_axis": [ 0.959, 0.098, -0.265 ], "z_axis": [ 0.096, -0.995, -0.021 ], "quaternion": [ 0.450, 0.405, 0.588, -0.535 ] } }, { "index": 116, "index_chain": 116, "chain_name": "J", "nt_resnum": 156, "nt_name": "C", "nt_code": "C", "nt_id": "///J/156", "linked_nts": [ "///J/155", "///J/157" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -68.105, "beta": 168.490, "gamma": 58.167, "delta": 81.028, "epsilon": -151.336, "zeta": -76.124, "epsilon_zeta": -75.212, "bb_type": "BI", "chi": -161.675, "glyco_bond": "anti", "C5prime_xyz": [ -1.284, 8.761, 0.630 ], "P_xyz": [ 1.321, 9.041, 0.625 ], "form": "A", "ssZp": 4.452, "Dp": 4.605, "splay_angle": 22.389, "splay_distance": 3.573, "splay_ratio": 0.196, "d22": 4.369, "d64": 4.557, "eta": 163.412, "theta": -148.716, "eta_prime": -178.870, "theta_prime": -150.458, "eta_base": -124.049, "theta_base": -132.269, "v0": 2.282, "v1": -24.599, "v2": 36.418, "v3": -35.972, "v4": 21.231, "amplitude": 37.728, "phase_angle": 15.138, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.949, "filter_rmsd": 0.069, "frame": { "rmsd": 0.011, "origin": [ 308.435, 306.148, 285.445 ], "x_axis": [ 0.411, 0.086, -0.908 ], "y_axis": [ 0.912, -0.017, 0.411 ], "z_axis": [ 0.020, -0.996, -0.086 ], "quaternion": [ 0.572, 0.615, 0.406, -0.361 ] } }, { "index": 117, "index_chain": 117, "chain_name": "J", "nt_resnum": 157, "nt_name": "C", "nt_code": "C", "nt_id": "///J/157", "linked_nts": [ "///J/156", "///J/158" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack", "alpha": -65.570, "beta": 164.256, "gamma": 64.874, "delta": 78.689, "epsilon": -145.444, "zeta": -71.855, "epsilon_zeta": -73.589, "bb_type": "BI", "chi": -165.858, "glyco_bond": "anti", "C5prime_xyz": [ -1.371, 8.805, 0.862 ], "P_xyz": [ 1.205, 9.258, 0.747 ], "form": "A", "ssZp": 4.527, "Dp": 4.631, "splay_angle": 23.504, "splay_distance": 3.665, "splay_ratio": 0.204, "d22": 3.907, "d64": 3.741, "eta": 170.527, "theta": -142.183, "eta_prime": -177.066, "theta_prime": -141.439, "eta_base": -143.420, "theta_base": -103.478, "v0": 0.894, "v1": -24.174, "v2": 37.021, "v3": -37.404, "v4": 23.025, "amplitude": 38.763, "phase_angle": 17.242, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.746, "filter_rmsd": 0.068, "frame": { "rmsd": 0.009, "origin": [ 307.145, 303.041, 284.242 ], "x_axis": [ 0.782, 0.111, -0.613 ], "y_axis": [ 0.623, -0.117, 0.773 ], "z_axis": [ 0.014, -0.987, -0.161 ], "quaternion": [ 0.613, 0.718, 0.256, -0.209 ] } }, { "index": 118, "index_chain": 118, "chain_name": "J", "nt_resnum": 158, "nt_name": "U", "nt_code": "U", "nt_id": "///J/158", "linked_nts": [ "///J/157", "///J/159" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack", "alpha": -66.179, "beta": 168.015, "gamma": 59.203, "delta": 82.904, "epsilon": -143.849, "zeta": -76.368, "epsilon_zeta": -67.481, "bb_type": "BI", "chi": -163.940, "glyco_bond": "anti", "C5prime_xyz": [ -1.351, 8.676, 0.808 ], "P_xyz": [ 1.259, 8.939, 0.940 ], "form": "A", "ssZp": 4.462, "Dp": 4.605, "splay_angle": 19.894, "splay_distance": 3.230, "splay_ratio": 0.175, "d22": null, "d64": null, "eta": 167.451, "theta": -141.987, "eta_prime": -175.314, "theta_prime": -143.246, "eta_base": -120.311, "theta_base": -124.157, "v0": 2.002, "v1": -23.521, "v2": 34.937, "v3": -34.698, "v4": 20.595, "amplitude": 36.251, "phase_angle": 15.475, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.919, "filter_rmsd": 0.110, "frame": { "rmsd": 0.014, "origin": [ 308.220, 300.186, 282.213 ], "x_axis": [ 0.991, 0.121, 0.062 ], "y_axis": [ -0.034, -0.225, 0.974 ], "z_axis": [ 0.132, -0.967, -0.219 ], "quaternion": [ 0.622, 0.780, 0.028, 0.062 ] } }, { "index": 119, "index_chain": 119, "chain_name": "J", "nt_resnum": 159, "nt_name": "G", "nt_code": "G", "nt_id": "///J/159", "linked_nts": [ "///J/158", "///J/160" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -70.660, "beta": 164.900, "gamma": 63.386, "delta": 82.564, "epsilon": -155.003, "zeta": -74.812, "epsilon_zeta": -80.191, "bb_type": "BI", "chi": -165.807, "glyco_bond": "anti", "C5prime_xyz": [ -1.811, 8.786, 0.828 ], "P_xyz": [ 0.724, 9.412, 1.003 ], "form": "A", "ssZp": 4.330, "Dp": 4.430, "splay_angle": 23.212, "splay_distance": 3.776, "splay_ratio": 0.204, "d22": null, "d64": null, "eta": 163.507, "theta": -148.396, "eta_prime": 179.610, "theta_prime": -150.555, "eta_base": -144.053, "theta_base": -127.306, "v0": -3.119, "v1": -19.228, "v2": 32.811, "v3": -35.480, "v4": 24.351, "amplitude": 35.754, "phase_angle": 23.411, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.793, "filter_rmsd": 0.011, "frame": { "rmsd": 0.011, "origin": [ 309.206, 297.887, 280.169 ], "x_axis": [ 0.793, 0.206, 0.573 ], "y_axis": [ -0.490, -0.342, 0.802 ], "z_axis": [ 0.361, -0.917, -0.170 ], "quaternion": [ 0.566, 0.759, -0.093, 0.308 ] } }, { "index": 120, "index_chain": 120, "chain_name": "J", "nt_resnum": 160, "nt_name": "C", "nt_code": "C", "nt_id": "///J/160", "linked_nts": [ "///J/159", "///J/161" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -67.385, "beta": 171.949, "gamma": 60.097, "delta": 82.299, "epsilon": -149.641, "zeta": -76.126, "epsilon_zeta": -73.515, "bb_type": "BI", "chi": -163.077, "glyco_bond": "anti", "C5prime_xyz": [ -1.594, 8.890, 0.647 ], "P_xyz": [ 0.937, 9.468, 1.039 ], "form": "A", "ssZp": 4.261, "Dp": 4.407, "splay_angle": 23.930, "splay_distance": 3.893, "splay_ratio": 0.208, "d22": 4.603, "d64": 4.408, "eta": 172.357, "theta": -147.798, "eta_prime": -175.635, "theta_prime": -148.325, "eta_base": -139.209, "theta_base": -127.419, "v0": -4.656, "v1": -17.545, "v2": 31.696, "v3": -35.252, "v4": 25.153, "amplitude": 35.257, "phase_angle": 25.970, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.898, "filter_rmsd": 0.065, "frame": { "rmsd": 0.008, "origin": [ 311.517, 295.463, 278.423 ], "x_axis": [ 0.393, 0.042, 0.919 ], "y_axis": [ -0.837, -0.398, 0.376 ], "z_axis": [ 0.382, -0.916, -0.121 ], "quaternion": [ 0.467, 0.691, -0.287, 0.470 ] } }, { "index": 121, "index_chain": 121, "chain_name": "J", "nt_resnum": 161, "nt_name": "U", "nt_code": "U", "nt_id": "///J/161", "linked_nts": [ "///J/160", "///J/162" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -73.489, "beta": 175.836, "gamma": 53.750, "delta": 79.151, "epsilon": -151.858, "zeta": -75.558, "epsilon_zeta": -76.301, "bb_type": "BI", "chi": -159.751, "glyco_bond": "anti", "C5prime_xyz": [ -1.528, 8.790, 0.460 ], "P_xyz": [ 1.006, 9.415, 0.696 ], "form": "A", "ssZp": 4.380, "Dp": 4.588, "splay_angle": 23.702, "splay_distance": 3.752, "splay_ratio": 0.206, "d22": null, "d64": null, "eta": 161.099, "theta": -151.992, "eta_prime": 172.289, "theta_prime": -151.374, "eta_base": -153.599, "theta_base": -127.023, "v0": -0.183, "v1": -23.099, "v2": 36.319, "v3": -37.360, "v4": 23.681, "amplitude": 38.373, "phase_angle": 18.833, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.921, "filter_rmsd": 0.106, "frame": { "rmsd": 0.008, "origin": [ 314.071, 292.665, 277.525 ], "x_axis": [ -0.133, -0.007, 0.991 ], "y_axis": [ -0.918, -0.376, -0.126 ], "z_axis": [ 0.374, -0.926, 0.043 ], "quaternion": [ 0.365, 0.548, -0.422, 0.623 ] } }, { "index": 122, "index_chain": 122, "chain_name": "J", "nt_resnum": 162, "nt_name": "A", "nt_code": "A", "nt_id": "///J/162", "linked_nts": [ "///J/161", "///J/163" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop", "alpha": -65.605, "beta": 168.951, "gamma": 56.313, "delta": 77.430, "epsilon": -137.141, "zeta": -62.603, "epsilon_zeta": -74.538, "bb_type": "BI", "chi": -166.762, "glyco_bond": "anti", "C5prime_xyz": [ -1.497, 8.656, 0.893 ], "P_xyz": [ 1.067, 9.165, 0.984 ], "form": ".", "ssZp": 4.562, "Dp": 4.726, "splay_angle": 31.699, "splay_distance": 5.002, "splay_ratio": 0.276, "d22": null, "d64": null, "eta": 166.774, "theta": -129.117, "eta_prime": 177.121, "theta_prime": -124.501, "eta_base": -145.778, "theta_base": -84.025, "v0": 2.740, "v1": -26.795, "v2": 39.450, "v3": -38.806, "v4": 22.732, "amplitude": 40.797, "phase_angle": 14.766, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.935, "filter_rmsd": 0.038, "frame": { "rmsd": 0.008, "origin": [ 316.502, 289.969, 278.474 ], "x_axis": [ -0.621, -0.057, 0.782 ], "y_axis": [ -0.726, -0.335, -0.601 ], "z_axis": [ 0.296, -0.941, 0.167 ], "quaternion": [ 0.230, 0.370, -0.529, 0.728 ] } }, { "index": 123, "index_chain": 123, "chain_name": "J", "nt_resnum": 163, "nt_name": "G", "nt_code": "G", "nt_id": "///J/163", "linked_nts": [ "///J/162", "///J/164" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-canonical,non-pair-contact,helix,internal-loop", "alpha": -69.152, "beta": 161.852, "gamma": 78.605, "delta": 82.646, "epsilon": -136.874, "zeta": -156.225, "epsilon_zeta": 19.352, "bb_type": "--", "chi": -168.101, "glyco_bond": "anti", "C5prime_xyz": [ -1.663, 8.754, 0.965 ], "P_xyz": [ 0.855, 9.392, 0.621 ], "form": ".", "ssZp": 4.447, "Dp": 4.558, "splay_angle": 59.589, "splay_distance": 8.990, "splay_ratio": 0.497, "d22": null, "d64": null, "eta": 177.392, "theta": 151.451, "eta_prime": -157.807, "theta_prime": 155.357, "eta_base": -97.288, "theta_base": 165.532, "v0": -2.335, "v1": -19.626, "v2": 32.843, "v3": -35.080, "v4": 23.645, "amplitude": 35.495, "phase_angle": 22.289, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.172, "filter_rmsd": 0.010, "frame": { "rmsd": 0.010, "origin": [ 315.126, 286.664, 281.967 ], "x_axis": [ -0.958, -0.280, 0.070 ], "y_axis": [ 0.001, -0.247, -0.969 ], "z_axis": [ 0.288, -0.928, 0.237 ], "quaternion": [ -0.090, 0.115, -0.607, 0.781 ] } }, { "index": 124, "index_chain": 124, "chain_name": "J", "nt_resnum": 164, "nt_name": "A", "nt_code": "A", "nt_id": "///J/164", "linked_nts": [ "///J/163", "///J/165" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop", "alpha": -35.371, "beta": 130.496, "gamma": 50.343, "delta": 77.003, "epsilon": -143.390, "zeta": -56.410, "epsilon_zeta": -86.979, "bb_type": "BI", "chi": -179.160, "glyco_bond": "anti", "C5prime_xyz": [ -1.852, 8.573, 1.551 ], "P_xyz": [ 0.737, 8.756, 1.674 ], "form": ".", "ssZp": 4.586, "Dp": 4.610, "splay_angle": 39.776, "splay_distance": 6.420, "splay_ratio": 0.347, "d22": null, "d64": null, "eta": -174.326, "theta": -88.547, "eta_prime": -177.934, "theta_prime": -100.294, "eta_base": 177.728, "theta_base": -53.554, "v0": -2.129, "v1": -21.951, "v2": 36.389, "v3": -38.634, "v4": 25.671, "amplitude": 39.154, "phase_angle": 21.662, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "7a", "suiteness": 0.357, "filter_rmsd": 0.041, "frame": { "rmsd": 0.009, "origin": [ 323.823, 284.749, 283.198 ], "x_axis": [ -0.877, -0.169, 0.450 ], "y_axis": [ -0.430, -0.143, -0.891 ], "z_axis": [ 0.215, -0.975, 0.052 ], "quaternion": [ 0.091, 0.231, -0.648, 0.720 ] } }, { "index": 125, "index_chain": 125, "chain_name": "J", "nt_resnum": 165, "nt_name": "G", "nt_code": "G", "nt_id": "///J/165", "linked_nts": [ "///J/164", "///J/166" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop", "alpha": 148.014, "beta": -160.210, "gamma": 174.078, "delta": 84.276, "epsilon": -133.676, "zeta": -74.287, "epsilon_zeta": -59.389, "bb_type": "BI", "chi": 174.456, "glyco_bond": "anti", "C5prime_xyz": [ -1.256, 8.195, 2.041 ], "P_xyz": [ 0.723, 9.796, 1.441 ], "form": "A", "ssZp": 4.623, "Dp": 4.678, "splay_angle": 23.829, "splay_distance": 3.694, "splay_ratio": 0.209, "d22": null, "d64": null, "eta": 151.985, "theta": -156.315, "eta_prime": -175.180, "theta_prime": -151.704, "eta_base": -88.399, "theta_base": -119.480, "v0": 5.021, "v1": -25.198, "v2": 34.697, "v3": -32.807, "v4": 17.534, "amplitude": 35.308, "phase_angle": 10.671, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.686, "filter_rmsd": 0.014, "frame": { "rmsd": 0.014, "origin": [ 318.988, 280.566, 283.777 ], "x_axis": [ -0.712, -0.090, -0.697 ], "y_axis": [ 0.690, 0.097, -0.717 ], "z_axis": [ 0.133, -0.991, -0.007 ], "quaternion": [ 0.308, 0.222, 0.674, -0.634 ] } }, { "index": 126, "index_chain": 126, "chain_name": "J", "nt_resnum": 166, "nt_name": "U", "nt_code": "U", "nt_id": "///J/166", "linked_nts": [ "///J/165", "///J/167" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -66.861, "beta": 179.456, "gamma": 48.781, "delta": 82.391, "epsilon": -149.837, "zeta": -75.844, "epsilon_zeta": -73.993, "bb_type": "BI", "chi": -163.178, "glyco_bond": "anti", "C5prime_xyz": [ -1.348, 8.647, 0.757 ], "P_xyz": [ 1.190, 8.946, 1.346 ], "form": "A", "ssZp": 4.489, "Dp": 4.615, "splay_angle": 20.881, "splay_distance": 3.342, "splay_ratio": 0.184, "d22": 4.389, "d64": 4.320, "eta": 162.241, "theta": -147.446, "eta_prime": 178.588, "theta_prime": -145.642, "eta_base": -136.204, "theta_base": -126.667, "v0": 3.090, "v1": -24.693, "v2": 35.767, "v3": -34.921, "v4": 20.045, "amplitude": 36.841, "phase_angle": 13.871, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.844, "filter_rmsd": 0.108, "frame": { "rmsd": 0.008, "origin": [ 317.721, 277.135, 284.292 ], "x_axis": [ -0.119, 0.038, -0.992 ], "y_axis": [ 0.986, 0.121, -0.113 ], "z_axis": [ 0.116, -0.992, -0.052 ], "quaternion": [ 0.487, 0.451, 0.568, -0.486 ] } }, { "index": 127, "index_chain": 127, "chain_name": "J", "nt_resnum": 167, "nt_name": "C", "nt_code": "C", "nt_id": "///J/167", "linked_nts": [ "///J/166", "///J/168" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop", "alpha": -65.399, "beta": 175.183, "gamma": 53.532, "delta": 80.907, "epsilon": -169.536, "zeta": -92.462, "epsilon_zeta": -77.075, "bb_type": "BI", "chi": -157.946, "glyco_bond": "anti", "C5prime_xyz": [ -1.433, 8.818, 0.409 ], "P_xyz": [ 1.125, 9.283, 0.685 ], "form": "A", "ssZp": 4.296, "Dp": 4.421, "splay_angle": 22.062, "splay_distance": 3.666, "splay_ratio": 0.196, "d22": 4.350, "d64": 4.531, "eta": 165.921, "theta": -141.818, "eta_prime": 179.129, "theta_prime": -147.803, "eta_base": -148.300, "theta_base": -133.993, "v0": 0.040, "v1": -22.393, "v2": 34.980, "v3": -35.979, "v4": 22.631, "amplitude": 36.902, "phase_angle": 18.575, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.981, "filter_rmsd": 0.065, "frame": { "rmsd": 0.007, "origin": [ 316.384, 274.089, 283.973 ], "x_axis": [ 0.366, 0.261, -0.893 ], "y_axis": [ 0.928, -0.034, 0.371 ], "z_axis": [ 0.067, -0.965, -0.254 ], "quaternion": [ 0.519, 0.643, 0.462, -0.321 ] } }, { "index": 128, "index_chain": 128, "chain_name": "J", "nt_resnum": 168, "nt_name": "U", "nt_code": "U", "nt_id": "///J/168", "linked_nts": [ "///J/167", "///J/169" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-canonical,non-pair-contact,helix,hairpin-loop", "alpha": 161.125, "beta": -140.415, "gamma": 170.187, "delta": 83.700, "epsilon": -113.059, "zeta": -106.564, "epsilon_zeta": -6.495, "bb_type": "--", "chi": -178.996, "glyco_bond": "anti", "C5prime_xyz": [ -1.590, 8.603, 1.551 ], "P_xyz": [ 0.622, 9.709, 0.740 ], "form": "B", "ssZp": 4.138, "Dp": 4.334, "splay_angle": 21.753, "splay_distance": 3.579, "splay_ratio": 0.189, "d22": 3.800, "d64": 3.282, "eta": 178.697, "theta": -123.568, "eta_prime": -172.817, "theta_prime": -131.779, "eta_base": -147.251, "theta_base": -73.258, "v0": -4.590, "v1": -16.464, "v2": 30.061, "v3": -33.576, "v4": 24.036, "amplitude": 33.534, "phase_angle": 26.307, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.453, "filter_rmsd": 0.110, "frame": { "rmsd": 0.014, "origin": [ 314.862, 271.179, 282.344 ], "x_axis": [ 0.708, 0.385, -0.591 ], "y_axis": [ 0.689, -0.196, 0.698 ], "z_axis": [ 0.153, -0.902, -0.404 ], "quaternion": [ 0.526, 0.760, 0.354, -0.144 ] } }, { "index": 129, "index_chain": 129, "chain_name": "J", "nt_resnum": 169, "nt_name": "C", "nt_code": "C", "nt_id": "///J/169", "linked_nts": [ "///J/168", "///J/170" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-canonical,non-pair-contact,helix-end,hairpin-loop,splayed-apart", "alpha": 121.096, "beta": -117.602, "gamma": 173.775, "delta": 77.418, "epsilon": -113.619, "zeta": 46.878, "epsilon_zeta": 199.503, "bb_type": "--", "chi": -169.907, "glyco_bond": "anti", "C5prime_xyz": [ -1.322, 8.709, 1.140 ], "P_xyz": [ 0.424, 9.459, -0.630 ], "form": ".", "ssZp": 4.526, "Dp": 4.746, "splay_angle": 105.678, "splay_distance": 13.345, "splay_ratio": 0.800, "d22": null, "d64": null, "eta": 141.699, "theta": -27.465, "eta_prime": 171.165, "theta_prime": -62.449, "eta_base": -107.947, "theta_base": -153.628, "v0": 0.898, "v1": -24.430, "v2": 37.470, "v3": -37.949, "v4": 23.287, "amplitude": 39.245, "phase_angle": 17.295, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.072, "frame": { "rmsd": 0.014, "origin": [ 317.515, 269.686, 280.463 ], "x_axis": [ 0.986, 0.120, 0.118 ], "y_axis": [ -0.019, -0.618, 0.786 ], "z_axis": [ 0.168, -0.777, -0.607 ], "quaternion": [ 0.436, 0.896, 0.028, 0.080 ] } }, { "index": 130, "index_chain": 130, "chain_name": "J", "nt_resnum": 170, "nt_name": "G", "nt_code": "G", "nt_id": "///J/170", "linked_nts": [ "///J/169", "///J/171" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,~C3'-endo,non-pair-contact,hairpin-loop,cap-acceptor,splayed-apart", "alpha": -98.237, "beta": -110.750, "gamma": 123.050, "delta": 80.845, "epsilon": -118.818, "zeta": -56.417, "epsilon_zeta": -62.401, "bb_type": "--", "chi": 158.699, "glyco_bond": "--", "C5prime_xyz": [ -1.479, 7.674, 2.732 ], "P_xyz": [ 1.068, 6.905, 2.610 ], "form": ".", "ssZp": 4.553, "Dp": 4.777, "splay_angle": 25.538, "splay_distance": 4.922, "splay_ratio": 0.258, "d22": null, "d64": null, "eta": -86.677, "theta": -62.497, "eta_prime": -30.381, "theta_prime": -87.346, "eta_base": 44.615, "theta_base": -63.817, "v0": 6.275, "v1": -28.076, "v2": 38.014, "v3": -35.523, "v4": 18.427, "amplitude": 38.543, "phase_angle": 9.510, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.020, "frame": { "rmsd": 0.020, "origin": [ 315.823, 256.847, 277.240 ], "x_axis": [ -0.993, -0.031, 0.117 ], "y_axis": [ 0.104, 0.268, 0.958 ], "z_axis": [ -0.061, 0.963, -0.263 ], "quaternion": [ -0.056, 0.023, 0.794, 0.605 ] } }, { "index": 131, "index_chain": 131, "chain_name": "J", "nt_resnum": 171, "nt_name": "C", "nt_code": "C", "nt_id": "///J/171", "linked_nts": [ "///J/170", "///J/172" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-pair-contact,hairpin-loop,cap-donor", "alpha": 141.724, "beta": -179.487, "gamma": -172.763, "delta": 80.315, "epsilon": -110.731, "zeta": -112.897, "epsilon_zeta": 2.166, "bb_type": "--", "chi": -169.349, "glyco_bond": "anti", "C5prime_xyz": [ -1.324, 8.690, 1.109 ], "P_xyz": [ -0.187, 10.842, 0.128 ], "form": ".", "ssZp": 4.467, "Dp": 4.725, "splay_angle": 30.572, "splay_distance": 4.948, "splay_ratio": 0.264, "d22": null, "d64": null, "eta": 141.095, "theta": -147.160, "eta_prime": 168.393, "theta_prime": -142.239, "eta_base": -122.054, "theta_base": -94.251, "v0": 3.515, "v1": -25.960, "v2": 37.307, "v3": -36.136, "v4": 20.565, "amplitude": 38.342, "phase_angle": 13.339, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.126, "filter_rmsd": 0.070, "frame": { "rmsd": 0.015, "origin": [ 311.502, 258.759, 275.859 ], "x_axis": [ -0.557, 0.172, 0.813 ], "y_axis": [ 0.802, 0.367, 0.471 ], "z_axis": [ -0.217, 0.914, -0.342 ], "quaternion": [ -0.342, 0.323, 0.753, 0.460 ] } }, { "index": 132, "index_chain": 132, "chain_name": "J", "nt_resnum": 172, "nt_name": "A", "nt_code": "A", "nt_id": "///J/172", "linked_nts": [ "///J/171", "///J/173" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-pair-contact,hairpin-loop", "alpha": 113.476, "beta": -102.976, "gamma": -173.514, "delta": 78.743, "epsilon": -175.988, "zeta": 92.796, "epsilon_zeta": 91.216, "bb_type": "--", "chi": 167.489, "glyco_bond": "anti", "C5prime_xyz": [ -1.417, 8.067, 2.263 ], "P_xyz": [ 0.113, 9.496, 0.681 ], "form": ".", "ssZp": 4.232, "Dp": 4.544, "splay_angle": 32.482, "splay_distance": 5.652, "splay_ratio": 0.308, "d22": null, "d64": null, "eta": 158.154, "theta": -60.519, "eta_prime": -165.753, "theta_prime": -101.235, "eta_base": -93.247, "theta_base": -58.720, "v0": 5.188, "v1": -28.427, "v2": 39.582, "v3": -37.521, "v4": 20.454, "amplitude": 40.365, "phase_angle": 11.308, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.047, "frame": { "rmsd": 0.018, "origin": [ 309.299, 262.645, 277.985 ], "x_axis": [ 0.181, 0.317, 0.931 ], "y_axis": [ 0.950, 0.189, -0.249 ], "z_axis": [ -0.255, 0.929, -0.267 ], "quaternion": [ 0.525, -0.561, -0.565, -0.301 ] } }, { "index": 133, "index_chain": 133, "chain_name": "J", "nt_resnum": 173, "nt_name": "A", "nt_code": "A", "nt_id": "///J/173", "linked_nts": [ "///J/172", "///J/174" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,hairpin-loop", "alpha": -65.629, "beta": -71.339, "gamma": -135.629, "delta": 86.810, "epsilon": -145.294, "zeta": -53.743, "epsilon_zeta": -91.550, "bb_type": "BI", "chi": -168.755, "glyco_bond": "anti", "C5prime_xyz": [ -1.145, 8.460, 1.084 ], "P_xyz": [ -1.645, 10.249, -0.840 ], "form": ".", "ssZp": 4.559, "Dp": 4.627, "splay_angle": 34.684, "splay_distance": 6.029, "splay_ratio": 0.311, "d22": null, "d64": null, "eta": 133.848, "theta": -159.054, "eta_prime": 158.499, "theta_prime": -143.840, "eta_base": -117.848, "theta_base": -102.903, "v0": 6.296, "v1": -25.354, "v2": 33.683, "v3": -31.022, "v4": 15.686, "amplitude": 34.037, "phase_angle": 8.265, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.035, "frame": { "rmsd": 0.009, "origin": [ 311.025, 266.463, 281.780 ], "x_axis": [ 0.953, 0.152, 0.264 ], "y_axis": [ 0.256, 0.072, -0.964 ], "z_axis": [ -0.165, 0.986, 0.029 ], "quaternion": [ 0.717, -0.680, -0.150, -0.036 ] } }, { "index": 134, "index_chain": 134, "chain_name": "J", "nt_resnum": 174, "nt_name": "G", "nt_code": "G", "nt_id": "///J/174", "linked_nts": [ "///J/173", "///J/175" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,hairpin-loop", "alpha": 137.840, "beta": -159.000, "gamma": -168.903, "delta": 80.452, "epsilon": -141.531, "zeta": -79.198, "epsilon_zeta": -62.334, "bb_type": "BI", "chi": -173.733, "glyco_bond": "anti", "C5prime_xyz": [ -1.457, 8.555, 1.337 ], "P_xyz": [ -0.268, 10.589, 0.196 ], "form": "A", "ssZp": 4.667, "Dp": 4.695, "splay_angle": 22.996, "splay_distance": 3.586, "splay_ratio": 0.202, "d22": null, "d64": null, "eta": 161.514, "theta": -177.116, "eta_prime": -167.087, "theta_prime": -170.291, "eta_base": -101.645, "theta_base": -136.012, "v0": 2.985, "v1": -25.326, "v2": 36.882, "v3": -36.140, "v4": 20.915, "amplitude": 38.046, "phase_angle": 14.210, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.486, "filter_rmsd": 0.009, "frame": { "rmsd": 0.009, "origin": [ 315.322, 270.534, 282.924 ], "x_axis": [ 0.798, 0.202, -0.567 ], "y_axis": [ -0.584, 0.026, -0.812 ], "z_axis": [ -0.149, 0.979, 0.139 ], "quaternion": [ 0.701, -0.639, 0.149, 0.281 ] } }, { "index": 135, "index_chain": 135, "chain_name": "J", "nt_resnum": 175, "nt_name": "G", "nt_code": "G", "nt_id": "///J/175", "linked_nts": [ "///J/174", "///J/176" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop", "alpha": -56.619, "beta": 165.785, "gamma": 49.441, "delta": 79.141, "epsilon": -144.294, "zeta": -84.473, "epsilon_zeta": -59.821, "bb_type": "BI", "chi": -171.188, "glyco_bond": "anti", "C5prime_xyz": [ -1.488, 8.604, 1.165 ], "P_xyz": [ 1.076, 8.985, 1.493 ], "form": "A", "ssZp": 4.666, "Dp": 4.704, "splay_angle": 23.700, "splay_distance": 3.639, "splay_ratio": 0.207, "d22": null, "d64": null, "eta": 165.728, "theta": -150.854, "eta_prime": 179.069, "theta_prime": -148.885, "eta_base": -135.845, "theta_base": -122.895, "v0": 2.671, "v1": -25.669, "v2": 37.701, "v3": -37.162, "v4": 21.724, "amplitude": 38.985, "phase_angle": 14.749, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.872, "filter_rmsd": 0.009, "frame": { "rmsd": 0.009, "origin": [ 316.524, 273.711, 284.075 ], "x_axis": [ 0.331, 0.124, -0.935 ], "y_axis": [ -0.937, -0.078, -0.342 ], "z_axis": [ -0.115, 0.989, 0.091 ], "quaternion": [ 0.580, -0.574, 0.354, 0.458 ] } }, { "index": 136, "index_chain": 136, "chain_name": "J", "nt_resnum": 176, "nt_name": "A", "nt_code": "A", "nt_id": "///J/176", "linked_nts": [ "///J/175", "///J/177" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -50.182, "beta": 160.862, "gamma": 51.409, "delta": 79.467, "epsilon": -127.418, "zeta": -81.482, "epsilon_zeta": -45.936, "bb_type": "--", "chi": -173.763, "glyco_bond": "anti", "C5prime_xyz": [ -1.474, 8.533, 1.345 ], "P_xyz": [ 1.090, 8.791, 1.769 ], "form": "A", "ssZp": 4.614, "Dp": 4.713, "splay_angle": 26.477, "splay_distance": 4.078, "splay_ratio": 0.230, "d22": null, "d64": null, "eta": 175.040, "theta": -132.959, "eta_prime": -175.211, "theta_prime": -128.828, "eta_base": -137.571, "theta_base": -82.603, "v0": 2.529, "v1": -25.356, "v2": 37.426, "v3": -36.939, "v4": 21.666, "amplitude": 38.734, "phase_angle": 14.933, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.707, "filter_rmsd": 0.040, "frame": { "rmsd": 0.008, "origin": [ 317.930, 277.063, 284.237 ], "x_axis": [ -0.206, -0.063, -0.977 ], "y_axis": [ -0.966, -0.146, 0.213 ], "z_axis": [ -0.156, 0.987, -0.031 ], "quaternion": [ 0.393, -0.493, 0.522, 0.575 ] } }, { "index": 137, "index_chain": 137, "chain_name": "J", "nt_resnum": 177, "nt_name": "U", "nt_code": "U", "nt_id": "///J/177", "linked_nts": [ "///J/176", "///J/178" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop", "alpha": -47.274, "beta": 155.170, "gamma": 50.222, "delta": 80.291, "epsilon": -128.594, "zeta": -73.395, "epsilon_zeta": -55.198, "bb_type": "BI", "chi": -168.122, "glyco_bond": "anti", "C5prime_xyz": [ -1.372, 8.673, 1.001 ], "P_xyz": [ 1.233, 8.867, 1.200 ], "form": ".", "ssZp": 4.511, "Dp": 4.688, "splay_angle": 23.816, "splay_distance": 3.712, "splay_ratio": 0.226, "d22": null, "d64": null, "eta": 168.081, "theta": -142.633, "eta_prime": -173.077, "theta_prime": -148.602, "eta_base": -109.203, "theta_base": -86.426, "v0": 1.555, "v1": -24.162, "v2": 36.450, "v3": -36.429, "v4": 21.998, "amplitude": 37.967, "phase_angle": 16.256, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.530, "filter_rmsd": 0.109, "frame": { "rmsd": 0.008, "origin": [ 317.007, 279.990, 281.552 ], "x_axis": [ -0.841, -0.255, -0.477 ], "y_axis": [ -0.493, -0.001, 0.870 ], "z_axis": [ -0.222, 0.967, -0.125 ], "quaternion": [ 0.091, -0.267, 0.701, 0.655 ] } }, { "index": 138, "index_chain": 138, "chain_name": "J", "nt_resnum": 178, "nt_name": "A", "nt_code": "A", "nt_id": "///J/178", "linked_nts": [ "///J/177", "///J/179" ], "nt_type": "RNA", "dbn": ".", "summary": "syn,~C3'-endo,non-canonical,non-pair-contact,helix,internal-loop", "alpha": -96.938, "beta": 118.010, "gamma": 135.144, "delta": 81.307, "epsilon": -114.694, "zeta": -117.425, "epsilon_zeta": 2.731, "bb_type": "--", "chi": -21.477, "glyco_bond": "syn", "C5prime_xyz": [ -5.050, 4.664, -2.317 ], "P_xyz": [ -6.712, 2.843, -1.427 ], "form": ".", "ssZp": -4.273, "Dp": 4.489, "splay_angle": 61.021, "splay_distance": 9.345, "splay_ratio": 0.508, "d22": null, "d64": null, "eta": -168.144, "theta": 160.108, "eta_prime": -165.833, "theta_prime": 171.167, "eta_base": -93.165, "theta_base": 163.905, "v0": -5.177, "v1": -17.575, "v2": 32.269, "v3": -36.167, "v4": 26.112, "amplitude": 36.110, "phase_angle": 26.668, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.043, "frame": { "rmsd": 0.013, "origin": [ 314.486, 282.714, 281.610 ], "x_axis": [ 0.255, -0.007, -0.967 ], "y_axis": [ 0.908, 0.345, 0.237 ], "z_axis": [ 0.332, -0.938, 0.094 ], "quaternion": [ 0.651, 0.451, 0.499, -0.351 ] } }, { "index": 139, "index_chain": 139, "chain_name": "J", "nt_resnum": 179, "nt_name": "A", "nt_code": "A", "nt_id": "///J/179", "linked_nts": [ "///J/178", "///J/180" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-canonical,non-pair-contact,helix,internal-loop", "alpha": -64.546, "beta": 152.764, "gamma": 50.121, "delta": 81.777, "epsilon": -126.365, "zeta": -60.643, "epsilon_zeta": -65.721, "bb_type": "--", "chi": -166.364, "glyco_bond": "anti", "C5prime_xyz": [ -1.345, 8.626, 0.901 ], "P_xyz": [ 1.262, 8.774, 0.977 ], "form": ".", "ssZp": 4.472, "Dp": 4.706, "splay_angle": 35.299, "splay_distance": 5.596, "splay_ratio": 0.304, "d22": null, "d64": null, "eta": 167.036, "theta": -112.752, "eta_prime": 168.298, "theta_prime": -109.057, "eta_base": 160.984, "theta_base": -65.742, "v0": 1.827, "v1": -23.706, "v2": 35.374, "v3": -35.287, "v4": 21.115, "amplitude": 36.769, "phase_angle": 15.830, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1L", "suiteness": 0.435, "filter_rmsd": 0.037, "frame": { "rmsd": 0.008, "origin": [ 322.013, 287.151, 278.293 ], "x_axis": [ -0.953, -0.287, -0.102 ], "y_axis": [ -0.162, 0.193, 0.968 ], "z_axis": [ -0.258, 0.938, -0.230 ], "quaternion": [ -0.051, -0.146, 0.771, 0.618 ] } }, { "index": 140, "index_chain": 140, "chain_name": "J", "nt_resnum": 180, "nt_name": "U", "nt_code": "U", "nt_id": "///J/180", "linked_nts": [ "///J/179", "///J/181" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop", "alpha": -65.495, "beta": 159.487, "gamma": 69.206, "delta": 77.535, "epsilon": -136.571, "zeta": -90.282, "epsilon_zeta": -46.289, "bb_type": "BI", "chi": -157.093, "glyco_bond": "anti", "C5prime_xyz": [ -1.580, 8.814, 0.338 ], "P_xyz": [ 0.889, 9.352, -0.341 ], "form": "A", "ssZp": 4.278, "Dp": 4.678, "splay_angle": 27.319, "splay_distance": 4.304, "splay_ratio": 0.236, "d22": null, "d64": null, "eta": 164.916, "theta": -152.327, "eta_prime": -164.578, "theta_prime": -152.248, "eta_base": -96.130, "theta_base": -126.769, "v0": -0.524, "v1": -23.161, "v2": 36.841, "v3": -38.117, "v4": 24.345, "amplitude": 39.047, "phase_angle": 19.353, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.446, "filter_rmsd": 0.102, "frame": { "rmsd": 0.007, "origin": [ 316.772, 289.098, 278.541 ], "x_axis": [ -0.667, 0.025, 0.744 ], "y_axis": [ 0.650, 0.508, 0.566 ], "z_axis": [ -0.364, 0.861, -0.355 ], "quaternion": [ -0.348, 0.212, 0.795, 0.449 ] } }, { "index": 141, "index_chain": 141, "chain_name": "J", "nt_resnum": 181, "nt_name": "A", "nt_code": "A", "nt_id": "///J/181", "linked_nts": [ "///J/180", "///J/182" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -49.657, "beta": 155.417, "gamma": 52.493, "delta": 78.549, "epsilon": -138.831, "zeta": -82.297, "epsilon_zeta": -56.534, "bb_type": "BI", "chi": -167.415, "glyco_bond": "anti", "C5prime_xyz": [ -1.463, 8.635, 0.974 ], "P_xyz": [ 1.112, 8.988, 1.007 ], "form": "A", "ssZp": 4.563, "Dp": 4.697, "splay_angle": 24.613, "splay_distance": 3.839, "splay_ratio": 0.214, "d22": null, "d64": null, "eta": 170.517, "theta": -145.850, "eta_prime": -178.659, "theta_prime": -144.249, "eta_base": -140.792, "theta_base": -117.813, "v0": 1.848, "v1": -25.066, "v2": 37.582, "v3": -37.514, "v4": 22.537, "amplitude": 39.093, "phase_angle": 15.987, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.557, "filter_rmsd": 0.040, "frame": { "rmsd": 0.009, "origin": [ 314.046, 292.291, 277.597 ], "x_axis": [ -0.116, 0.024, 0.993 ], "y_axis": [ 0.922, 0.373, 0.099 ], "z_axis": [ -0.368, 0.927, -0.066 ], "quaternion": [ 0.546, -0.379, -0.624, -0.412 ] } }, { "index": 142, "index_chain": 142, "chain_name": "J", "nt_resnum": 182, "nt_name": "G", "nt_code": "G", "nt_id": "///J/182", "linked_nts": [ "///J/181", "///J/183" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -56.486, "beta": 160.168, "gamma": 56.549, "delta": 79.158, "epsilon": -142.408, "zeta": -75.604, "epsilon_zeta": -66.804, "bb_type": "BI", "chi": -163.718, "glyco_bond": "anti", "C5prime_xyz": [ -1.567, 8.655, 0.735 ], "P_xyz": [ 0.988, 9.090, 0.508 ], "form": "A", "ssZp": 4.518, "Dp": 4.711, "splay_angle": 23.523, "splay_distance": 3.842, "splay_ratio": 0.210, "d22": null, "d64": null, "eta": 168.701, "theta": -141.840, "eta_prime": -176.542, "theta_prime": -141.735, "eta_base": -134.268, "theta_base": -118.318, "v0": 4.165, "v1": -27.509, "v2": 39.186, "v3": -37.751, "v4": 21.227, "amplitude": 40.178, "phase_angle": 12.757, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.797, "filter_rmsd": 0.017, "frame": { "rmsd": 0.017, "origin": [ 311.479, 295.049, 278.336 ], "x_axis": [ 0.394, 0.219, 0.893 ], "y_axis": [ 0.816, 0.364, -0.449 ], "z_axis": [ -0.423, 0.905, -0.035 ], "quaternion": [ 0.656, -0.516, -0.501, -0.227 ] } }, { "index": 143, "index_chain": 143, "chain_name": "J", "nt_resnum": 183, "nt_name": "C", "nt_code": "C", "nt_id": "///J/183", "linked_nts": [ "///J/182", "///J/184" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -58.288, "beta": 165.178, "gamma": 63.533, "delta": 76.976, "epsilon": -123.563, "zeta": -95.117, "epsilon_zeta": -28.446, "bb_type": "--", "chi": -153.911, "glyco_bond": "anti", "C5prime_xyz": [ -1.713, 8.895, 0.133 ], "P_xyz": [ 0.758, 9.583, -0.357 ], "form": "A", "ssZp": 4.025, "Dp": 4.678, "splay_angle": 21.677, "splay_distance": 3.526, "splay_ratio": 0.188, "d22": null, "d64": null, "eta": 179.495, "theta": -149.852, "eta_prime": -168.303, "theta_prime": -148.191, "eta_base": -132.474, "theta_base": -126.176, "v0": -1.992, "v1": -22.109, "v2": 36.500, "v3": -38.671, "v4": 25.594, "amplitude": 39.218, "phase_angle": 21.455, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.769, "filter_rmsd": 0.062, "frame": { "rmsd": 0.007, "origin": [ 309.494, 297.639, 280.363 ], "x_axis": [ 0.743, 0.405, 0.534 ], "y_axis": [ 0.408, 0.358, -0.840 ], "z_axis": [ -0.531, 0.842, 0.100 ], "quaternion": [ 0.742, -0.567, -0.359, -0.001 ] } }, { "index": 144, "index_chain": 144, "chain_name": "J", "nt_resnum": 184, "nt_name": "A", "nt_code": "A", "nt_id": "///J/184", "linked_nts": [ "///J/183", "///J/185" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BII,canonical,non-pair-contact,helix,stem-end,coaxial-stack,splayed-apart", "alpha": -57.530, "beta": 150.569, "gamma": 55.864, "delta": 76.358, "epsilon": -130.019, "zeta": 166.173, "epsilon_zeta": 63.808, "bb_type": "BII", "chi": -149.671, "glyco_bond": "anti", "C5prime_xyz": [ -1.634, 8.814, -0.148 ], "P_xyz": [ 0.800, 9.245, -0.981 ], "form": ".", "ssZp": 3.925, "Dp": 4.735, "splay_angle": 154.134, "splay_distance": 19.617, "splay_ratio": 0.975, "d22": null, "d64": null, "eta": 162.902, "theta": 122.780, "eta_prime": 173.018, "theta_prime": 106.412, "eta_base": -155.677, "theta_base": -152.729, "v0": -0.344, "v1": -24.180, "v2": 38.144, "v3": -39.370, "v4": 25.038, "amplitude": 40.357, "phase_angle": 19.066, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.371, "filter_rmsd": 0.038, "frame": { "rmsd": 0.010, "origin": [ 308.323, 300.699, 281.666 ], "x_axis": [ 0.967, 0.249, 0.044 ], "y_axis": [ -0.041, 0.325, -0.945 ], "z_axis": [ -0.250, 0.912, 0.324 ], "quaternion": [ 0.809, -0.574, -0.091, 0.090 ] } }, { "index": 145, "index_chain": 145, "chain_name": "J", "nt_resnum": 185, "nt_name": "A", "nt_code": "A", "nt_id": "///J/185", "linked_nts": [ "///J/184", "///J/186" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem-end,multiplet,splayed-apart", "alpha": 77.139, "beta": -161.512, "gamma": 11.212, "delta": 144.437, "epsilon": -170.880, "zeta": -118.063, "epsilon_zeta": -52.817, "bb_type": "BI", "chi": -99.876, "glyco_bond": "anti", "C5prime_xyz": [ -2.883, 8.240, -1.861 ], "P_xyz": [ -1.582, 10.533, -1.962 ], "form": ".", "ssZp": 3.000, "Dp": 2.621, "splay_angle": 24.134, "splay_distance": 4.305, "splay_ratio": 0.218, "d22": null, "d64": null, "eta": -45.466, "theta": -165.051, "eta_prime": -39.865, "theta_prime": -175.888, "eta_base": -151.002, "theta_base": -140.450, "v0": -31.077, "v1": 44.626, "v2": -39.529, "v3": 22.469, "v4": 5.098, "amplitude": 43.838, "phase_angle": 154.384, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.053, "frame": { "rmsd": 0.035, "origin": [ 300.835, 315.738, 271.539 ], "x_axis": [ 0.839, 0.543, -0.037 ], "y_axis": [ 0.542, -0.827, 0.149 ], "z_axis": [ 0.050, -0.145, -0.988 ], "quaternion": [ 0.077, 0.956, 0.284, 0.003 ] } }, { "index": 146, "index_chain": 146, "chain_name": "J", "nt_resnum": 186, "nt_name": "A", "nt_code": "A", "nt_id": "///J/186", "linked_nts": [ "///J/185", "///J/187" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -65.070, "beta": 157.912, "gamma": 61.156, "delta": 65.531, "epsilon": 177.961, "zeta": -87.476, "epsilon_zeta": -94.563, "bb_type": "BI", "chi": -158.959, "glyco_bond": "anti", "C5prime_xyz": [ -2.488, 8.964, 0.307 ], "P_xyz": [ -0.437, 10.483, -0.089 ], "form": "A", "ssZp": 4.254, "Dp": 4.321, "splay_angle": 24.407, "splay_distance": 4.036, "splay_ratio": 0.218, "d22": null, "d64": null, "eta": 169.791, "theta": -166.359, "eta_prime": 173.233, "theta_prime": -169.332, "eta_base": -139.837, "theta_base": -146.741, "v0": -8.690, "v1": -20.253, "v2": 39.929, "v3": -46.086, "v4": 34.716, "amplitude": 45.830, "phase_angle": 29.399, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.048, "frame": { "rmsd": 0.019, "origin": [ 301.140, 316.889, 267.402 ], "x_axis": [ 0.996, 0.087, 0.033 ], "y_axis": [ 0.077, -0.970, 0.228 ], "z_axis": [ 0.052, -0.225, -0.973 ], "quaternion": [ 0.114, 0.992, 0.041, 0.022 ] } }, { "index": 147, "index_chain": 147, "chain_name": "J", "nt_resnum": 187, "nt_name": "G", "nt_code": "G", "nt_id": "///J/187", "linked_nts": [ "///J/186", "///J/188" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem", "alpha": 177.847, "beta": -143.920, "gamma": 150.569, "delta": 73.328, "epsilon": -116.561, "zeta": -89.829, "epsilon_zeta": -26.731, "bb_type": "--", "chi": -177.523, "glyco_bond": "anti", "C5prime_xyz": [ -1.551, 8.689, 1.517 ], "P_xyz": [ 0.730, 9.703, 0.802 ], "form": "A", "ssZp": 4.546, "Dp": 4.649, "splay_angle": 22.967, "splay_distance": 3.632, "splay_ratio": 0.199, "d22": null, "d64": null, "eta": 170.326, "theta": -147.321, "eta_prime": 174.875, "theta_prime": -144.245, "eta_base": -155.171, "theta_base": -103.355, "v0": -2.767, "v1": -22.678, "v2": 38.484, "v3": -41.061, "v4": 27.556, "amplitude": 41.611, "phase_angle": 22.354, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.010, "filter_rmsd": 0.031, "frame": { "rmsd": 0.031, "origin": [ 301.439, 318.240, 263.610 ], "x_axis": [ 0.894, -0.350, 0.281 ], "y_axis": [ -0.405, -0.899, 0.168 ], "z_axis": [ 0.194, -0.264, -0.945 ], "quaternion": [ 0.112, 0.967, -0.195, 0.123 ] } }, { "index": 148, "index_chain": 148, "chain_name": "J", "nt_resnum": 188, "nt_name": "U", "nt_code": "U", "nt_id": "///J/188", "linked_nts": [ "///J/187", "///J/189" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -50.502, "beta": 147.142, "gamma": 59.891, "delta": 81.024, "epsilon": -150.618, "zeta": -80.967, "epsilon_zeta": -69.651, "bb_type": "BI", "chi": -161.855, "glyco_bond": "anti", "C5prime_xyz": [ -1.577, 8.783, 0.555 ], "P_xyz": [ 0.991, 9.149, 0.230 ], "form": "A", "ssZp": 4.324, "Dp": 4.490, "splay_angle": 22.192, "splay_distance": 3.602, "splay_ratio": 0.194, "d22": 4.648, "d64": 4.599, "eta": 163.545, "theta": -150.152, "eta_prime": -175.620, "theta_prime": -155.661, "eta_base": -118.842, "theta_base": -141.537, "v0": -3.691, "v1": -19.446, "v2": 33.721, "v3": -36.727, "v4": 25.508, "amplitude": 36.949, "phase_angle": 24.126, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1L", "suiteness": 0.582, "filter_rmsd": 0.100, "frame": { "rmsd": 0.025, "origin": [ 303.890, 317.193, 261.143 ], "x_axis": [ 0.404, -0.829, 0.386 ], "y_axis": [ -0.847, -0.499, -0.185 ], "z_axis": [ 0.346, -0.252, -0.904 ], "quaternion": [ 0.020, 0.838, -0.500, 0.218 ] } }, { "index": 149, "index_chain": 149, "chain_name": "J", "nt_resnum": 189, "nt_name": "C", "nt_code": "C", "nt_id": "///J/189", "linked_nts": [ "///J/188", "///J/190" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -66.998, "beta": 164.407, "gamma": 60.126, "delta": 78.378, "epsilon": -144.825, "zeta": -73.960, "epsilon_zeta": -70.865, "bb_type": "BI", "chi": -162.284, "glyco_bond": "anti", "C5prime_xyz": [ -1.341, 8.887, 0.603 ], "P_xyz": [ 1.236, 9.417, 0.588 ], "form": "A", "ssZp": 4.367, "Dp": 4.553, "splay_angle": 21.921, "splay_distance": 3.578, "splay_ratio": 0.192, "d22": null, "d64": null, "eta": 166.973, "theta": -145.748, "eta_prime": 176.668, "theta_prime": -145.147, "eta_base": -154.343, "theta_base": -121.827, "v0": -1.884, "v1": -21.547, "v2": 35.572, "v3": -37.434, "v4": 24.800, "amplitude": 38.167, "phase_angle": 21.249, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.852, "filter_rmsd": 0.073, "frame": { "rmsd": 0.023, "origin": [ 306.340, 317.401, 258.511 ], "x_axis": [ -0.064, -0.937, 0.343 ], "y_axis": [ -0.910, -0.087, -0.405 ], "z_axis": [ 0.409, -0.338, -0.847 ], "quaternion": [ -0.024, 0.684, -0.675, 0.275 ] } }, { "index": 150, "index_chain": 150, "chain_name": "J", "nt_resnum": 190, "nt_name": "A", "nt_code": "A", "nt_id": "///J/190", "linked_nts": [ "///J/189", "///J/191" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,internal-loop", "alpha": -70.497, "beta": 167.894, "gamma": 65.981, "delta": 80.238, "epsilon": -148.133, "zeta": -70.227, "epsilon_zeta": -77.906, "bb_type": "BI", "chi": -159.588, "glyco_bond": "anti", "C5prime_xyz": [ -1.606, 8.859, 0.480 ], "P_xyz": [ 0.924, 9.508, 0.567 ], "form": "A", "ssZp": 4.171, "Dp": 4.426, "splay_angle": 21.780, "splay_distance": 3.500, "splay_ratio": 0.189, "d22": null, "d64": null, "eta": 169.026, "theta": -144.453, "eta_prime": -175.921, "theta_prime": -145.791, "eta_base": -139.601, "theta_base": -110.357, "v0": -3.111, "v1": -20.003, "v2": 34.136, "v3": -36.784, "v4": 25.190, "amplitude": 37.146, "phase_angle": 23.225, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.707, "filter_rmsd": 0.048, "frame": { "rmsd": 0.021, "origin": [ 308.794, 315.601, 256.629 ], "x_axis": [ -0.595, -0.757, 0.269 ], "y_axis": [ -0.723, 0.357, -0.592 ], "z_axis": [ 0.352, -0.547, -0.760 ], "quaternion": [ 0.025, -0.449, 0.823, -0.346 ] } }, { "index": 151, "index_chain": 151, "chain_name": "J", "nt_resnum": 191, "nt_name": "A", "nt_code": "A", "nt_id": "///J/191", "linked_nts": [ "///J/190", "///J/192" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop", "alpha": -77.871, "beta": 164.879, "gamma": 68.243, "delta": 79.304, "epsilon": -133.698, "zeta": -48.704, "epsilon_zeta": -84.994, "bb_type": "BI", "chi": -156.423, "glyco_bond": "anti", "C5prime_xyz": [ -1.446, 8.739, 0.316 ], "P_xyz": [ 1.071, 9.229, -0.155 ], "form": ".", "ssZp": 4.231, "Dp": 4.688, "splay_angle": 28.315, "splay_distance": 4.738, "splay_ratio": 0.248, "d22": null, "d64": null, "eta": 164.739, "theta": -120.525, "eta_prime": -179.759, "theta_prime": -121.028, "eta_base": -129.456, "theta_base": -86.368, "v0": 2.645, "v1": -25.890, "v2": 38.074, "v3": -37.440, "v4": 22.053, "amplitude": 39.380, "phase_angle": 14.799, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.572, "filter_rmsd": 0.043, "frame": { "rmsd": 0.020, "origin": [ 309.693, 312.772, 254.777 ], "x_axis": [ -0.899, -0.409, -0.156 ], "y_axis": [ -0.183, 0.674, -0.716 ], "z_axis": [ 0.398, -0.615, -0.681 ], "quaternion": [ 0.154, -0.164, 0.902, -0.369 ] } }, { "index": 152, "index_chain": 152, "chain_name": "J", "nt_resnum": 192, "nt_name": "A", "nt_code": "A", "nt_id": "///J/192", "linked_nts": [ "///J/191", "///J/193" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-pair-contact,internal-loop", "alpha": -100.383, "beta": 138.505, "gamma": 123.885, "delta": 81.053, "epsilon": -136.292, "zeta": -82.391, "epsilon_zeta": -53.901, "bb_type": "BI", "chi": -168.194, "glyco_bond": "anti", "C5prime_xyz": [ -1.604, 8.671, 0.951 ], "P_xyz": [ 0.074, 9.942, -0.608 ], "form": ".", "ssZp": 4.315, "Dp": 4.523, "splay_angle": 22.233, "splay_distance": 3.486, "splay_ratio": 0.193, "d22": null, "d64": null, "eta": 178.726, "theta": -165.247, "eta_prime": -154.408, "theta_prime": -163.075, "eta_base": -96.666, "theta_base": -125.139, "v0": -2.789, "v1": -20.545, "v2": 34.696, "v3": -37.173, "v4": 25.285, "amplitude": 37.614, "phase_angle": 22.715, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.041, "frame": { "rmsd": 0.022, "origin": [ 307.471, 309.513, 252.150 ], "x_axis": [ -0.786, 0.087, -0.612 ], "y_axis": [ 0.512, 0.645, -0.566 ], "z_axis": [ 0.346, -0.759, -0.552 ], "quaternion": [ 0.277, 0.173, 0.864, -0.384 ] } }, { "index": 153, "index_chain": 153, "chain_name": "J", "nt_resnum": 193, "nt_name": "G", "nt_code": "G", "nt_id": "///J/193", "linked_nts": [ "///J/192", "///J/194" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-canonical,non-pair-contact,helix,internal-loop,phosphate", "alpha": -68.656, "beta": 156.823, "gamma": 68.755, "delta": 85.059, "epsilon": -126.538, "zeta": 3.976, "epsilon_zeta": 229.485, "bb_type": "--", "chi": -156.270, "glyco_bond": "anti", "C5prime_xyz": [ -1.510, 8.713, 0.301 ], "P_xyz": [ 1.050, 8.950, -0.202 ], "form": ".", "ssZp": 4.073, "Dp": 4.596, "splay_angle": 24.285, "splay_distance": 3.969, "splay_ratio": 0.210, "d22": null, "d64": null, "eta": 171.173, "theta": -23.955, "eta_prime": -173.006, "theta_prime": -65.771, "eta_base": -125.005, "theta_base": -106.225, "v0": 0.434, "v1": -21.994, "v2": 33.883, "v3": -34.504, "v4": 21.547, "amplitude": 35.601, "phase_angle": 17.871, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.520, "filter_rmsd": 0.030, "frame": { "rmsd": 0.030, "origin": [ 307.535, 306.735, 250.045 ], "x_axis": [ -0.288, 0.410, -0.865 ], "y_axis": [ 0.925, 0.354, -0.140 ], "z_axis": [ 0.249, -0.841, -0.481 ], "quaternion": [ 0.382, 0.458, 0.728, -0.337 ] } }, { "index": 154, "index_chain": 154, "chain_name": "J", "nt_resnum": 194, "nt_name": "A", "nt_code": "A", "nt_id": "///J/194", "linked_nts": [ "///J/193", "///J/195" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C2'-endo,BII,non-canonical,non-pair-contact,helix,internal-loop", "alpha": 117.413, "beta": 161.554, "gamma": 109.388, "delta": 144.388, "epsilon": -87.988, "zeta": 130.625, "epsilon_zeta": 141.387, "bb_type": "BII", "chi": -148.766, "glyco_bond": "anti", "C5prime_xyz": [ -2.077, 8.706, 0.257 ], "P_xyz": [ 0.425, 9.430, 0.227 ], "form": ".", "ssZp": 0.345, "Dp": 0.603, "splay_angle": 39.174, "splay_distance": 6.896, "splay_ratio": 0.337, "d22": null, "d64": null, "eta": 76.543, "theta": 150.182, "eta_prime": 120.094, "theta_prime": 137.124, "eta_base": 118.086, "theta_base": 151.196, "v0": -25.017, "v1": 37.104, "v2": -34.385, "v3": 20.864, "v4": 2.276, "amplitude": 37.181, "phase_angle": 157.639, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.043, "frame": { "rmsd": 0.021, "origin": [ 307.754, 304.462, 246.798 ], "x_axis": [ -0.204, -0.424, 0.882 ], "y_axis": [ 0.969, 0.043, 0.244 ], "z_axis": [ -0.142, 0.904, 0.402 ], "quaternion": [ 0.557, -0.296, -0.460, -0.625 ] } }, { "index": 155, "index_chain": 155, "chain_name": "J", "nt_resnum": 195, "nt_name": "G", "nt_code": "G", "nt_id": "///J/195", "linked_nts": [ "///J/194", "///J/196" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,anti,~C2'-endo,non-canonical,non-pair-contact,multiplet,internal-loop", "alpha": 60.100, "beta": -103.958, "gamma": -101.228, "delta": 146.469, "epsilon": -160.705, "zeta": 134.527, "epsilon_zeta": 64.768, "bb_type": "--", "chi": -101.405, "glyco_bond": "anti", "C5prime_xyz": [ -2.935, 8.167, -1.951 ], "P_xyz": [ -4.295, 8.758, -4.109 ], "form": ".", "ssZp": 2.420, "Dp": 2.257, "splay_angle": 54.435, "splay_distance": 8.241, "splay_ratio": 0.459, "d22": null, "d64": null, "eta": -62.958, "theta": 35.701, "eta_prime": -91.562, "theta_prime": 67.263, "eta_base": -100.915, "theta_base": 93.691, "v0": -29.138, "v1": 42.544, "v2": -38.565, "v3": 22.778, "v4": 3.685, "amplitude": 42.181, "phase_angle": 156.103, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.014, "frame": { "rmsd": 0.014, "origin": [ 307.071, 303.921, 239.958 ], "x_axis": [ -0.340, 0.421, -0.841 ], "y_axis": [ 0.936, 0.236, -0.261 ], "z_axis": [ 0.089, -0.876, -0.475 ], "quaternion": [ 0.325, 0.474, 0.716, -0.397 ] } }, { "index": 156, "index_chain": 156, "chain_name": "J", "nt_resnum": 196, "nt_name": "U", "nt_code": "U", "nt_id": "///J/196", "linked_nts": [ "///J/195", "///J/197" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,BI,non-canonical,non-pair-contact,helix,multiplet,internal-loop,phosphate", "alpha": -48.032, "beta": 149.076, "gamma": 30.629, "delta": 128.404, "epsilon": -151.845, "zeta": -98.743, "epsilon_zeta": -53.102, "bb_type": "BI", "chi": -168.809, "glyco_bond": "anti", "C5prime_xyz": [ -1.474, 8.496, 1.263 ], "P_xyz": [ 0.702, 8.171, 2.680 ], "form": ".", "ssZp": 3.255, "Dp": 2.938, "splay_angle": 23.031, "splay_distance": 4.035, "splay_ratio": 0.206, "d22": null, "d64": null, "eta": 174.669, "theta": -92.778, "eta_prime": 176.216, "theta_prime": -121.328, "eta_base": 174.310, "theta_base": -101.835, "v0": -18.533, "v1": 23.661, "v2": -19.576, "v3": 9.285, "v4": 5.834, "amplitude": 23.274, "phase_angle": 147.258, "puckering": "C2'-endo", "sugar_class": "pucker-CHK", "bin": "22p", "cluster": "4b", "suiteness": 0.010, "filter_rmsd": 0.101, "frame": { "rmsd": 0.019, "origin": [ 309.491, 300.486, 247.047 ], "x_axis": [ -0.581, 0.363, -0.728 ], "y_axis": [ 0.809, 0.351, -0.471 ], "z_axis": [ 0.085, -0.863, -0.498 ], "quaternion": [ 0.261, 0.376, 0.779, -0.428 ] } }, { "index": 157, "index_chain": 157, "chain_name": "J", "nt_resnum": 197, "nt_name": "A", "nt_code": "A", "nt_id": "///J/197", "linked_nts": [ "///J/196", "///J/198" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-canonical,non-pair-contact,helix,internal-loop", "alpha": 137.830, "beta": -165.465, "gamma": 170.022, "delta": 78.799, "epsilon": -124.954, "zeta": -56.184, "epsilon_zeta": -68.769, "bb_type": "--", "chi": -176.452, "glyco_bond": "anti", "C5prime_xyz": [ -1.490, 8.517, 1.474 ], "P_xyz": [ 0.161, 10.291, 0.487 ], "form": ".", "ssZp": 4.651, "Dp": 4.707, "splay_angle": 41.871, "splay_distance": 6.357, "splay_ratio": 0.357, "d22": null, "d64": null, "eta": 134.177, "theta": -136.803, "eta_prime": 156.595, "theta_prime": -127.422, "eta_base": -156.067, "theta_base": -73.042, "v0": -0.068, "v1": -23.206, "v2": 36.486, "v3": -37.464, "v4": 23.660, "amplitude": 38.517, "phase_angle": 18.689, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.045, "frame": { "rmsd": 0.022, "origin": [ 308.210, 296.776, 246.109 ], "x_axis": [ -0.034, 0.472, -0.881 ], "y_axis": [ 0.986, 0.160, 0.047 ], "z_axis": [ 0.163, -0.867, -0.471 ], "quaternion": [ 0.405, 0.565, 0.645, -0.318 ] } }, { "index": 158, "index_chain": 158, "chain_name": "J", "nt_resnum": 198, "nt_name": "A", "nt_code": "A", "nt_id": "///J/198", "linked_nts": [ "///J/197", "///J/199" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,isolated-canonical,non-pair-contact,helix-end,internal-loop", "alpha": -70.511, "beta": 159.926, "gamma": 70.103, "delta": 80.269, "epsilon": -135.602, "zeta": -63.664, "epsilon_zeta": -71.939, "bb_type": "BI", "chi": -170.715, "glyco_bond": "anti", "C5prime_xyz": [ -1.389, 8.578, 1.160 ], "P_xyz": [ 1.208, 8.858, 1.008 ], "form": ".", "ssZp": 4.536, "Dp": 4.670, "splay_angle": 29.260, "splay_distance": 4.560, "splay_ratio": 0.254, "d22": null, "d64": null, "eta": 160.570, "theta": -125.022, "eta_prime": -164.746, "theta_prime": -124.835, "eta_base": -85.623, "theta_base": -82.766, "v0": 2.978, "v1": -26.120, "v2": 38.212, "v3": -37.360, "v4": 21.711, "amplitude": 39.433, "phase_angle": 14.298, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.382, "filter_rmsd": 0.043, "frame": { "rmsd": 0.016, "origin": [ 311.080, 296.283, 240.458 ], "x_axis": [ 0.909, 0.330, -0.255 ], "y_axis": [ 0.379, -0.397, 0.836 ], "z_axis": [ 0.175, -0.856, -0.486 ], "quaternion": [ 0.506, 0.835, 0.212, -0.024 ] } }, { "index": 159, "index_chain": 159, "chain_name": "J", "nt_resnum": 199, "nt_name": "A", "nt_code": "A", "nt_id": "///J/199", "linked_nts": [ "///J/198", "///J/200" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-pair-contact,internal-loop", "alpha": -66.257, "beta": 165.074, "gamma": 64.543, "delta": 79.471, "epsilon": -147.544, "zeta": -73.012, "epsilon_zeta": -74.532, "bb_type": "BI", "chi": -164.221, "glyco_bond": "anti", "C5prime_xyz": [ -1.496, 8.676, 0.792 ], "P_xyz": [ 1.079, 9.116, 0.750 ], "form": ".", "ssZp": 4.414, "Dp": 4.584, "splay_angle": 32.881, "splay_distance": 5.345, "splay_ratio": 0.287, "d22": null, "d64": null, "eta": 165.514, "theta": -107.414, "eta_prime": -168.927, "theta_prime": -114.755, "eta_base": -101.652, "theta_base": -71.968, "v0": 1.351, "v1": -24.501, "v2": 37.224, "v3": -37.366, "v4": 22.764, "amplitude": 38.854, "phase_angle": 16.658, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.722, "filter_rmsd": 0.044, "frame": { "rmsd": 0.020, "origin": [ 314.512, 294.364, 238.149 ], "x_axis": [ 0.875, -0.095, 0.475 ], "y_axis": [ -0.445, -0.547, 0.709 ], "z_axis": [ 0.192, -0.832, -0.521 ], "quaternion": [ 0.449, 0.858, -0.157, 0.195 ] } }, { "index": 160, "index_chain": 160, "chain_name": "J", "nt_resnum": 200, "nt_name": "G", "nt_code": "G", "nt_id": "///J/200", "linked_nts": [ "///J/199", "///J/201" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BII,non-pair-contact,internal-loop,splayed-apart", "alpha": 153.614, "beta": -146.105, "gamma": 168.774, "delta": 78.239, "epsilon": -109.663, "zeta": 176.003, "epsilon_zeta": 74.334, "bb_type": "BII", "chi": -175.409, "glyco_bond": "anti", "C5prime_xyz": [ -1.145, 8.496, 1.442 ], "P_xyz": [ 0.728, 9.753, 0.177 ], "form": ".", "ssZp": 4.693, "Dp": 4.822, "splay_angle": 96.381, "splay_distance": 13.435, "splay_ratio": 0.745, "d22": null, "d64": null, "eta": 159.442, "theta": 96.663, "eta_prime": -174.702, "theta_prime": 122.145, "eta_base": -104.974, "theta_base": 151.799, "v0": 3.057, "v1": -26.047, "v2": 38.006, "v3": -37.252, "v4": 21.594, "amplitude": 39.215, "phase_angle": 14.267, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.627, "filter_rmsd": 0.018, "frame": { "rmsd": 0.018, "origin": [ 318.532, 290.979, 239.124 ], "x_axis": [ 0.134, -0.470, 0.872 ], "y_axis": [ -0.940, -0.339, -0.039 ], "z_axis": [ 0.314, -0.815, -0.487 ], "quaternion": [ 0.277, 0.700, -0.504, 0.424 ] } }, { "index": 161, "index_chain": 161, "chain_name": "J", "nt_resnum": 201, "nt_name": "C", "nt_code": "C", "nt_id": "///J/201", "linked_nts": [ "///J/200", "///J/202" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-pair-contact,internal-loop,phosphate,splayed-apart", "alpha": -86.931, "beta": 174.394, "gamma": 58.413, "delta": 83.316, "epsilon": -148.749, "zeta": -72.416, "epsilon_zeta": -76.334, "bb_type": "BI", "chi": -155.187, "glyco_bond": "anti", "C5prime_xyz": [ -1.238, 8.763, 0.271 ], "P_xyz": [ 1.373, 9.015, 0.223 ], "form": ".", "ssZp": 4.295, "Dp": 4.595, "splay_angle": 35.524, "splay_distance": 5.336, "splay_ratio": 0.311, "d22": null, "d64": null, "eta": -157.987, "theta": -111.106, "eta_prime": -178.001, "theta_prime": -124.315, "eta_base": 147.107, "theta_base": -66.195, "v0": 2.315, "v1": -23.313, "v2": 34.279, "v3": -33.820, "v4": 19.892, "amplitude": 35.473, "phase_angle": 14.906, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "3a", "suiteness": 0.267, "filter_rmsd": 0.072, "frame": { "rmsd": 0.017, "origin": [ 316.381, 288.051, 226.190 ], "x_axis": [ 0.746, 0.345, 0.570 ], "y_axis": [ -0.504, -0.267, 0.822 ], "z_axis": [ 0.435, -0.900, -0.026 ], "quaternion": [ 0.603, 0.714, -0.056, 0.352 ] } }, { "index": 162, "index_chain": 162, "chain_name": "J", "nt_resnum": 202, "nt_name": "A", "nt_code": "A", "nt_id": "///J/202", "linked_nts": [ "///J/201", "///J/203" ], "nt_type": "RNA", "dbn": ".", "summary": "syn,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,internal-loop", "alpha": 131.704, "beta": -168.136, "gamma": -150.307, "delta": 81.796, "epsilon": -145.543, "zeta": -51.592, "epsilon_zeta": -93.951, "bb_type": "BI", "chi": 3.060, "glyco_bond": "syn", "C5prime_xyz": [ -5.311, 3.995, -1.475 ], "P_xyz": [ -7.511, 2.710, -0.927 ], "form": ".", "ssZp": -4.550, "Dp": 4.574, "splay_angle": 22.510, "splay_distance": 3.694, "splay_ratio": 0.201, "d22": null, "d64": null, "eta": 171.114, "theta": -129.923, "eta_prime": -175.766, "theta_prime": -124.027, "eta_base": -93.912, "theta_base": -115.989, "v0": 2.026, "v1": -23.748, "v2": 35.308, "v3": -35.105, "v4": 20.884, "amplitude": 36.647, "phase_angle": 15.539, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.018, "filter_rmsd": 0.049, "frame": { "rmsd": 0.018, "origin": [ 319.020, 285.873, 230.284 ], "x_axis": [ 0.862, 0.359, -0.357 ], "y_axis": [ -0.189, -0.426, -0.885 ], "z_axis": [ -0.470, 0.830, -0.299 ], "quaternion": [ 0.533, -0.804, -0.053, 0.257 ] } }, { "index": 163, "index_chain": 163, "chain_name": "J", "nt_resnum": 203, "nt_name": "G", "nt_code": "G", "nt_id": "///J/203", "linked_nts": [ "///J/202", "///J/204" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop", "alpha": 151.242, "beta": -153.357, "gamma": 161.903, "delta": 80.638, "epsilon": -114.796, "zeta": -88.428, "epsilon_zeta": -26.368, "bb_type": "--", "chi": 176.111, "glyco_bond": "anti", "C5prime_xyz": [ -1.221, 8.296, 1.916 ], "P_xyz": [ 0.943, 9.522, 1.160 ], "form": "A", "ssZp": 4.737, "Dp": 4.758, "splay_angle": 24.578, "splay_distance": 3.862, "splay_ratio": 0.215, "d22": null, "d64": null, "eta": 148.364, "theta": -144.368, "eta_prime": -174.656, "theta_prime": -139.447, "eta_base": -141.982, "theta_base": -95.598, "v0": 4.060, "v1": -25.914, "v2": 36.975, "v3": -35.619, "v4": 19.873, "amplitude": 37.894, "phase_angle": 12.639, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.397, "filter_rmsd": 0.018, "frame": { "rmsd": 0.018, "origin": [ 321.745, 284.470, 232.345 ], "x_axis": [ -0.751, -0.096, 0.654 ], "y_axis": [ -0.498, -0.569, -0.655 ], "z_axis": [ 0.435, -0.817, 0.379 ], "quaternion": [ 0.122, 0.331, -0.448, 0.821 ] } }, { "index": 164, "index_chain": 164, "chain_name": "J", "nt_resnum": 204, "nt_name": "C", "nt_code": "C", "nt_id": "///J/204", "linked_nts": [ "///J/203", "///J/205" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop", "alpha": -37.954, "beta": 147.763, "gamma": 49.242, "delta": 79.789, "epsilon": -157.985, "zeta": -80.727, "epsilon_zeta": -77.258, "bb_type": "BI", "chi": -164.255, "glyco_bond": "anti", "C5prime_xyz": [ -1.511, 8.866, 0.739 ], "P_xyz": [ 1.063, 9.141, 0.946 ], "form": ".", "ssZp": 4.306, "Dp": 4.401, "splay_angle": 23.392, "splay_distance": 3.843, "splay_ratio": 0.205, "d22": 4.024, "d64": 4.056, "eta": 165.156, "theta": -118.427, "eta_prime": -170.467, "theta_prime": -126.214, "eta_base": -108.320, "theta_base": -82.843, "v0": -4.702, "v1": -18.333, "v2": 33.110, "v3": -36.789, "v4": 26.237, "amplitude": 36.795, "phase_angle": 25.861, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1L", "suiteness": 0.546, "filter_rmsd": 0.066, "frame": { "rmsd": 0.008, "origin": [ 321.589, 282.112, 235.400 ], "x_axis": [ -0.900, -0.435, -0.017 ], "y_axis": [ 0.214, -0.408, -0.887 ], "z_axis": [ 0.379, -0.802, 0.461 ], "quaternion": [ -0.195, 0.109, -0.508, 0.832 ] } }, { "index": 165, "index_chain": 165, "chain_name": "J", "nt_resnum": 205, "nt_name": "U", "nt_code": "U", "nt_id": "///J/205", "linked_nts": [ "///J/204", "///J/206" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-canonical,non-pair-contact,helix,internal-loop", "alpha": 154.131, "beta": -140.839, "gamma": 165.314, "delta": 81.632, "epsilon": -114.987, "zeta": -110.769, "epsilon_zeta": -4.218, "bb_type": "--", "chi": -167.075, "glyco_bond": "anti", "C5prime_xyz": [ -1.401, 8.669, 0.970 ], "P_xyz": [ 0.506, 9.631, -0.532 ], "form": ".", "ssZp": 4.365, "Dp": 4.651, "splay_angle": 38.665, "splay_distance": 6.464, "splay_ratio": 0.333, "d22": 5.710, "d64": 6.352, "eta": 163.025, "theta": -162.666, "eta_prime": -174.634, "theta_prime": -160.719, "eta_base": -109.158, "theta_base": -155.951, "v0": 0.493, "v1": -22.708, "v2": 35.106, "v3": -35.798, "v4": 22.266, "amplitude": 36.889, "phase_angle": 17.884, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.518, "filter_rmsd": 0.105, "frame": { "rmsd": 0.011, "origin": [ 320.304, 278.751, 236.749 ], "x_axis": [ -0.491, -0.652, -0.578 ], "y_axis": [ 0.835, -0.161, -0.527 ], "z_axis": [ 0.250, -0.741, 0.623 ], "quaternion": [ -0.493, -0.109, -0.420, 0.754 ] } }, { "index": 166, "index_chain": 166, "chain_name": "J", "nt_resnum": 206, "nt_name": "U", "nt_code": "U", "nt_id": "///J/206", "linked_nts": [ "///J/205", "///J/207" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop", "alpha": -21.280, "beta": 166.177, "gamma": 11.129, "delta": 79.160, "epsilon": -161.326, "zeta": -88.000, "epsilon_zeta": -73.327, "bb_type": "BI", "chi": -153.369, "glyco_bond": "anti", "C5prime_xyz": [ -1.847, 8.854, 0.094 ], "P_xyz": [ 0.244, 10.041, 1.090 ], "form": "A", "ssZp": 4.163, "Dp": 4.433, "splay_angle": 23.379, "splay_distance": 3.865, "splay_ratio": 0.205, "d22": null, "d64": null, "eta": 168.021, "theta": -138.744, "eta_prime": 171.760, "theta_prime": -138.665, "eta_base": -178.951, "theta_base": -96.227, "v0": -4.050, "v1": -19.381, "v2": 34.040, "v3": -37.359, "v4": 26.118, "amplitude": 37.462, "phase_angle": 24.682, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.103, "frame": { "rmsd": 0.009, "origin": [ 320.540, 275.384, 242.261 ], "x_axis": [ -0.457, -0.216, -0.863 ], "y_axis": [ 0.846, 0.193, -0.496 ], "z_axis": [ 0.274, -0.957, 0.095 ], "quaternion": [ 0.456, 0.253, 0.624, -0.583 ] } }, { "index": 167, "index_chain": 167, "chain_name": "J", "nt_resnum": 207, "nt_name": "A", "nt_code": "A", "nt_id": "///J/207", "linked_nts": [ "///J/206", "///J/208" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop", "alpha": 153.007, "beta": -138.218, "gamma": 167.340, "delta": 80.946, "epsilon": -118.398, "zeta": -43.382, "epsilon_zeta": -75.016, "bb_type": "--", "chi": -175.439, "glyco_bond": "anti", "C5prime_xyz": [ -1.660, 8.553, 1.421 ], "P_xyz": [ 0.332, 9.713, 0.195 ], "form": ".", "ssZp": 4.488, "Dp": 4.612, "splay_angle": 22.810, "splay_distance": 4.141, "splay_ratio": 0.212, "d22": null, "d64": null, "eta": 163.817, "theta": -132.228, "eta_prime": -177.892, "theta_prime": -152.784, "eta_base": -122.439, "theta_base": -152.489, "v0": 0.169, "v1": -22.764, "v2": 35.496, "v3": -36.383, "v4": 22.820, "amplitude": 37.402, "phase_angle": 18.367, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.466, "filter_rmsd": 0.044, "frame": { "rmsd": 0.010, "origin": [ 319.972, 271.880, 240.733 ], "x_axis": [ 0.112, 0.133, -0.985 ], "y_axis": [ 0.973, 0.186, 0.136 ], "z_axis": [ 0.201, -0.974, -0.108 ], "quaternion": [ 0.545, 0.508, 0.544, -0.385 ] } }, { "index": 168, "index_chain": 168, "chain_name": "J", "nt_resnum": 208, "nt_name": "G", "nt_code": "G", "nt_id": "///J/208", "linked_nts": [ "///J/207", "///J/209" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -123.735, "beta": 94.420, "gamma": 152.954, "delta": 74.609, "epsilon": -114.332, "zeta": -82.574, "epsilon_zeta": -31.758, "bb_type": "--", "chi": 171.993, "glyco_bond": "anti", "C5prime_xyz": [ -1.323, 8.280, 2.113 ], "P_xyz": [ -0.909, 10.471, 0.763 ], "form": "A", "ssZp": 4.775, "Dp": 4.789, "splay_angle": 24.251, "splay_distance": 3.646, "splay_ratio": 0.211, "d22": null, "d64": null, "eta": 159.023, "theta": 176.834, "eta_prime": 165.248, "theta_prime": -170.854, "eta_base": -177.169, "theta_base": -122.718, "v0": 3.236, "v1": -27.996, "v2": 41.067, "v3": -40.233, "v4": 23.235, "amplitude": 42.381, "phase_angle": 14.308, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1e", "suiteness": 0.018, "filter_rmsd": 0.025, "frame": { "rmsd": 0.025, "origin": [ 317.729, 268.434, 240.247 ], "x_axis": [ 0.322, 0.335, -0.885 ], "y_axis": [ 0.925, 0.088, 0.370 ], "z_axis": [ 0.202, -0.938, -0.282 ], "quaternion": [ 0.531, 0.616, 0.512, -0.277 ] } }, { "index": 169, "index_chain": 169, "chain_name": "J", "nt_resnum": 209, "nt_name": "A", "nt_code": "A", "nt_id": "///J/209", "linked_nts": [ "///J/208", "///J/210" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -82.428, "beta": 155.426, "gamma": 78.436, "delta": 81.117, "epsilon": -129.540, "zeta": -84.112, "epsilon_zeta": -45.429, "bb_type": "BI", "chi": -177.623, "glyco_bond": "anti", "C5prime_xyz": [ -1.255, 8.332, 1.551 ], "P_xyz": [ 1.255, 8.670, 1.038 ], "form": "A", "ssZp": 4.730, "Dp": 4.764, "splay_angle": 24.309, "splay_distance": 3.974, "splay_ratio": 0.220, "d22": null, "d64": null, "eta": 159.778, "theta": -139.961, "eta_prime": 177.697, "theta_prime": -141.974, "eta_base": -123.069, "theta_base": -127.376, "v0": 6.176, "v1": -28.538, "v2": 38.967, "v3": -36.483, "v4": 19.059, "amplitude": 39.550, "phase_angle": 9.853, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.054, "filter_rmsd": 0.039, "frame": { "rmsd": 0.009, "origin": [ 318.069, 266.067, 237.494 ], "x_axis": [ 0.862, 0.332, -0.384 ], "y_axis": [ 0.471, -0.241, 0.849 ], "z_axis": [ 0.189, -0.912, -0.364 ], "quaternion": [ 0.561, 0.785, 0.256, -0.062 ] } }, { "index": 170, "index_chain": 170, "chain_name": "J", "nt_resnum": 210, "nt_name": "C", "nt_code": "C", "nt_id": "///J/210", "linked_nts": [ "///J/209", "///J/211" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -52.048, "beta": 156.447, "gamma": 62.411, "delta": 74.822, "epsilon": -153.915, "zeta": -78.175, "epsilon_zeta": -75.740, "bb_type": "BI", "chi": -166.190, "glyco_bond": "anti", "C5prime_xyz": [ -1.656, 8.878, 0.837 ], "P_xyz": [ 0.842, 9.569, 0.600 ], "form": ".", "ssZp": 4.522, "Dp": 4.592, "splay_angle": 30.353, "splay_distance": 4.768, "splay_ratio": 0.264, "d22": 4.907, "d64": 5.319, "eta": 170.428, "theta": -158.122, "eta_prime": -172.502, "theta_prime": -158.408, "eta_base": -137.444, "theta_base": -138.693, "v0": -1.065, "v1": -24.213, "v2": 38.904, "v3": -40.472, "v4": 26.155, "amplitude": 41.389, "phase_angle": 19.957, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.553, "filter_rmsd": 0.063, "frame": { "rmsd": 0.009, "origin": [ 318.274, 264.068, 234.066 ], "x_axis": [ 0.993, 0.113, 0.030 ], "y_axis": [ 0.025, -0.459, 0.888 ], "z_axis": [ 0.114, -0.881, -0.459 ], "quaternion": [ 0.518, 0.853, 0.040, 0.042 ] } }, { "index": 171, "index_chain": 171, "chain_name": "J", "nt_resnum": 211, "nt_name": "C", "nt_code": "C", "nt_id": "///J/211", "linked_nts": [ "///J/210", "///J/212" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop", "alpha": -62.812, "beta": 177.665, "gamma": 57.584, "delta": 76.469, "epsilon": -147.408, "zeta": -76.029, "epsilon_zeta": -71.379, "bb_type": "BI", "chi": -168.510, "glyco_bond": "anti", "C5prime_xyz": [ -1.333, 8.737, 1.040 ], "P_xyz": [ 1.211, 9.158, 1.427 ], "form": "A", "ssZp": 4.595, "Dp": 4.660, "splay_angle": 24.916, "splay_distance": 3.872, "splay_ratio": 0.218, "d22": 4.329, "d64": 4.541, "eta": 174.699, "theta": -151.447, "eta_prime": -178.272, "theta_prime": -148.802, "eta_base": -148.252, "theta_base": -124.765, "v0": 3.503, "v1": -28.183, "v2": 40.855, "v3": -39.779, "v4": 22.783, "amplitude": 42.068, "phase_angle": 13.796, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.814, "filter_rmsd": 0.074, "frame": { "rmsd": 0.016, "origin": [ 318.770, 261.188, 230.297 ], "x_axis": [ 0.876, -0.006, 0.482 ], "y_axis": [ -0.453, -0.353, 0.819 ], "z_axis": [ 0.165, -0.936, -0.312 ], "quaternion": [ 0.550, 0.797, -0.144, 0.203 ] } }, { "index": 172, "index_chain": 172, "chain_name": "J", "nt_resnum": 212, "nt_name": "U", "nt_code": "U", "nt_id": "///J/212", "linked_nts": [ "///J/211", "///J/213" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop", "alpha": -74.134, "beta": 168.828, "gamma": 72.388, "delta": 80.580, "epsilon": -152.746, "zeta": -63.435, "epsilon_zeta": -89.312, "bb_type": "BI", "chi": -173.739, "glyco_bond": "anti", "C5prime_xyz": [ -1.451, 8.585, 1.342 ], "P_xyz": [ 1.138, 8.996, 1.373 ], "form": "A", "ssZp": 4.577, "Dp": 4.600, "splay_angle": 22.733, "splay_distance": 3.545, "splay_ratio": 0.200, "d22": 4.293, "d64": 3.907, "eta": 169.500, "theta": -135.221, "eta_prime": -176.706, "theta_prime": -136.660, "eta_base": -138.605, "theta_base": -103.177, "v0": 3.076, "v1": -26.004, "v2": 37.674, "v3": -36.809, "v4": 21.211, "amplitude": 38.830, "phase_angle": 14.014, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.418, "filter_rmsd": 0.112, "frame": { "rmsd": 0.017, "origin": [ 320.680, 258.632, 228.105 ], "x_axis": [ 0.503, -0.073, 0.861 ], "y_axis": [ -0.835, -0.299, 0.463 ], "z_axis": [ 0.224, -0.952, -0.211 ], "quaternion": [ 0.498, 0.709, -0.320, 0.382 ] } }, { "index": 173, "index_chain": 173, "chain_name": "J", "nt_resnum": 213, "nt_name": "U", "nt_code": "U", "nt_id": "///J/213", "linked_nts": [ "///J/212", "///J/214" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,isolated-canonical,non-pair-contact,helix,hairpin-loop,internal-loop", "alpha": -92.573, "beta": -167.265, "gamma": 64.470, "delta": 84.596, "epsilon": -162.215, "zeta": -79.238, "epsilon_zeta": -82.977, "bb_type": "BI", "chi": -159.853, "glyco_bond": "anti", "C5prime_xyz": [ -1.369, 8.721, 0.510 ], "P_xyz": [ 1.228, 9.046, 0.893 ], "form": "A", "ssZp": 4.357, "Dp": 4.460, "splay_angle": 23.208, "splay_distance": 3.688, "splay_ratio": 0.202, "d22": 5.028, "d64": 4.835, "eta": 160.970, "theta": -156.588, "eta_prime": 178.072, "theta_prime": -156.610, "eta_base": -129.480, "theta_base": -154.594, "v0": 1.079, "v1": -21.672, "v2": 32.871, "v3": -33.016, "v4": 20.175, "amplitude": 34.327, "phase_angle": 16.746, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.337, "filter_rmsd": 0.104, "frame": { "rmsd": 0.012, "origin": [ 323.117, 256.070, 228.352 ], "x_axis": [ -0.252, -0.115, 0.961 ], "y_axis": [ -0.924, -0.267, -0.275 ], "z_axis": [ 0.288, -0.957, -0.039 ], "quaternion": [ 0.332, 0.513, -0.506, 0.608 ] } }, { "index": 174, "index_chain": 174, "chain_name": "J", "nt_resnum": 214, "nt_name": "U", "nt_code": "U", "nt_id": "///J/214", "linked_nts": [ "///J/213", "///J/215" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,hairpin-loop", "alpha": -73.055, "beta": -176.904, "gamma": 57.652, "delta": 81.000, "epsilon": -149.913, "zeta": -49.240, "epsilon_zeta": -100.673, "bb_type": "BI", "chi": -149.753, "glyco_bond": "anti", "C5prime_xyz": [ -1.420, 8.776, -0.095 ], "P_xyz": [ 1.150, 9.251, 0.077 ], "form": ".", "ssZp": 4.042, "Dp": 4.543, "splay_angle": 81.164, "splay_distance": 11.939, "splay_ratio": 0.651, "d22": null, "d64": null, "eta": 173.284, "theta": -94.812, "eta_prime": 177.758, "theta_prime": -142.596, "eta_base": -173.314, "theta_base": 163.911, "v0": -3.171, "v1": -19.578, "v2": 33.616, "v3": -36.358, "v4": 24.907, "amplitude": 36.640, "phase_angle": 23.440, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.796, "filter_rmsd": 0.121, "frame": { "rmsd": 0.028, "origin": [ 326.064, 254.013, 227.524 ], "x_axis": [ -0.586, -0.088, 0.805 ], "y_axis": [ -0.730, -0.373, -0.573 ], "z_axis": [ 0.351, -0.924, 0.154 ], "quaternion": [ 0.221, 0.398, -0.515, 0.727 ] } }, { "index": 175, "index_chain": 175, "chain_name": "J", "nt_resnum": 215, "nt_name": "A", "nt_code": "A", "nt_id": "///J/215", "linked_nts": [ "///J/214", "///J/216" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,anti,~C3'-endo,BI,non-pair-contact,hairpin-loop", "alpha": 109.149, "beta": 146.048, "gamma": 102.631, "delta": 91.234, "epsilon": -143.902, "zeta": -51.704, "epsilon_zeta": -92.198, "bb_type": "BI", "chi": -151.079, "glyco_bond": "anti", "C5prime_xyz": [ -1.689, 8.667, -0.037 ], "P_xyz": [ 0.563, 8.816, -1.445 ], "form": ".", "ssZp": 3.584, "Dp": 4.183, "splay_angle": 33.833, "splay_distance": 5.697, "splay_ratio": 0.291, "d22": null, "d64": null, "eta": 7.862, "theta": -116.731, "eta_prime": 46.199, "theta_prime": -125.611, "eta_base": 27.978, "theta_base": -85.235, "v0": -4.422, "v1": -15.926, "v2": 28.863, "v3": -32.156, "v4": 23.326, "amplitude": 32.206, "phase_angle": 26.339, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.055, "frame": { "rmsd": 0.039, "origin": [ 331.996, 247.576, 219.405 ], "x_axis": [ -0.249, 0.505, -0.826 ], "y_axis": [ -0.933, 0.103, 0.344 ], "z_axis": [ 0.259, 0.857, 0.446 ], "quaternion": [ 0.570, -0.225, 0.476, 0.631 ] } }, { "index": 176, "index_chain": 176, "chain_name": "J", "nt_resnum": 216, "nt_name": "G", "nt_code": "G", "nt_id": "///J/216", "linked_nts": [ "///J/215", "///J/217" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,hairpin-loop", "alpha": -73.850, "beta": 171.051, "gamma": 58.210, "delta": 74.373, "epsilon": -147.082, "zeta": -78.920, "epsilon_zeta": -68.162, "bb_type": "BI", "chi": -135.512, "glyco_bond": "anti", "C5prime_xyz": [ -2.017, 8.947, -0.962 ], "P_xyz": [ 0.332, 9.701, -1.816 ], "form": ".", "ssZp": 3.374, "Dp": 4.566, "splay_angle": 29.111, "splay_distance": 4.883, "splay_ratio": 0.252, "d22": null, "d64": null, "eta": 160.111, "theta": -153.935, "eta_prime": -172.070, "theta_prime": -153.703, "eta_base": -112.062, "theta_base": -128.684, "v0": -6.027, "v1": -19.371, "v2": 36.027, "v3": -40.405, "v4": 29.417, "amplitude": 40.431, "phase_angle": 26.993, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.537, "filter_rmsd": 0.025, "frame": { "rmsd": 0.025, "origin": [ 330.418, 253.023, 218.861 ], "x_axis": [ -0.895, 0.392, -0.215 ], "y_axis": [ -0.318, -0.220, 0.922 ], "z_axis": [ 0.314, 0.893, 0.321 ], "quaternion": [ 0.227, 0.032, 0.582, 0.780 ] } }, { "index": 177, "index_chain": 177, "chain_name": "J", "nt_resnum": 217, "nt_name": "C", "nt_code": "C", "nt_id": "///J/217", "linked_nts": [ "///J/216", "///J/218" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-pair-contact,hairpin-loop,cap-acceptor", "alpha": -56.728, "beta": 162.856, "gamma": 51.757, "delta": 77.225, "epsilon": -143.619, "zeta": -43.595, "epsilon_zeta": -100.024, "bb_type": "BI", "chi": -162.185, "glyco_bond": "anti", "C5prime_xyz": [ -1.507, 8.863, 0.617 ], "P_xyz": [ 0.994, 9.509, 0.738 ], "form": ".", "ssZp": 4.406, "Dp": 4.611, "splay_angle": 54.944, "splay_distance": 9.122, "splay_ratio": 0.466, "d22": null, "d64": null, "eta": 168.720, "theta": -85.352, "eta_prime": 178.717, "theta_prime": -83.467, "eta_base": -146.365, "theta_base": -57.937, "v0": -2.198, "v1": -21.856, "v2": 36.320, "v3": -38.570, "v4": 25.794, "amplitude": 39.117, "phase_angle": 21.799, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.778, "filter_rmsd": 0.071, "frame": { "rmsd": 0.016, "origin": [ 329.940, 257.701, 220.177 ], "x_axis": [ -0.954, -0.300, 0.010 ], "y_axis": [ 0.165, -0.496, 0.853 ], "z_axis": [ -0.251, 0.815, 0.523 ], "quaternion": [ -0.135, -0.070, 0.484, 0.862 ] } }, { "index": 178, "index_chain": 178, "chain_name": "J", "nt_resnum": 218, "nt_name": "G", "nt_code": "G", "nt_id": "///J/218", "linked_nts": [ "///J/217", "///J/219" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,isolated-canonical,non-pair-contact,helix,hairpin-loop,internal-loop,cap-donor", "alpha": 122.197, "beta": -150.060, "gamma": -140.684, "delta": 89.101, "epsilon": -160.297, "zeta": -80.546, "epsilon_zeta": -79.751, "bb_type": "BI", "chi": -174.339, "glyco_bond": "anti", "C5prime_xyz": [ -0.765, 8.316, 1.460 ], "P_xyz": [ 0.499, 10.476, 0.685 ], "form": "A", "ssZp": 4.466, "Dp": 4.481, "splay_angle": 22.514, "splay_distance": 3.426, "splay_ratio": 0.195, "d22": null, "d64": null, "eta": -168.680, "theta": -168.550, "eta_prime": -134.231, "theta_prime": -164.174, "eta_base": -69.243, "theta_base": -120.452, "v0": 6.760, "v1": -25.413, "v2": 33.274, "v3": -30.269, "v4": 14.922, "amplitude": 33.542, "phase_angle": 7.245, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.049, "frame": { "rmsd": 0.049, "origin": [ 322.841, 256.753, 225.825 ], "x_axis": [ -0.145, -0.404, 0.903 ], "y_axis": [ 0.969, 0.125, 0.212 ], "z_axis": [ -0.199, 0.906, 0.374 ], "quaternion": [ 0.582, -0.298, -0.473, -0.590 ] } }, { "index": 179, "index_chain": 179, "chain_name": "J", "nt_resnum": 219, "nt_name": "G", "nt_code": "G", "nt_id": "///J/219", "linked_nts": [ "///J/218", "///J/220" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop", "alpha": 175.284, "beta": -152.098, "gamma": 140.194, "delta": 83.253, "epsilon": -147.610, "zeta": -63.592, "epsilon_zeta": -84.019, "bb_type": "BI", "chi": 174.881, "glyco_bond": "anti", "C5prime_xyz": [ -0.775, 8.121, 1.948 ], "P_xyz": [ 1.706, 8.569, 1.212 ], "form": "A", "ssZp": 4.699, "Dp": 4.699, "splay_angle": 28.482, "splay_distance": 4.396, "splay_ratio": 0.252, "d22": null, "d64": null, "eta": 144.399, "theta": -137.484, "eta_prime": 169.502, "theta_prime": -141.926, "eta_base": -127.843, "theta_base": -128.493, "v0": 8.503, "v1": -28.771, "v2": 37.113, "v3": -33.140, "v4": 15.545, "amplitude": 37.298, "phase_angle": 5.705, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.027, "frame": { "rmsd": 0.027, "origin": [ 321.182, 259.181, 227.585 ], "x_axis": [ 0.550, -0.212, 0.807 ], "y_axis": [ 0.809, 0.373, -0.454 ], "z_axis": [ -0.205, 0.903, 0.377 ], "quaternion": [ 0.758, -0.447, -0.334, -0.337 ] } }, { "index": 180, "index_chain": 180, "chain_name": "J", "nt_resnum": 220, "nt_name": "G", "nt_code": "G", "nt_id": "///J/220", "linked_nts": [ "///J/219", "///J/221" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop", "alpha": -77.979, "beta": -167.408, "gamma": 56.978, "delta": 79.910, "epsilon": -147.581, "zeta": -66.579, "epsilon_zeta": -81.002, "bb_type": "BI", "chi": -170.868, "glyco_bond": "anti", "C5prime_xyz": [ -1.432, 8.613, 1.147 ], "P_xyz": [ 1.073, 8.966, 1.834 ], "form": ".", "ssZp": 4.675, "Dp": 4.684, "splay_angle": 25.381, "splay_distance": 4.228, "splay_ratio": 0.231, "d22": null, "d64": null, "eta": 169.233, "theta": -142.072, "eta_prime": -176.943, "theta_prime": -139.443, "eta_base": -143.977, "theta_base": -119.073, "v0": 3.203, "v1": -25.958, "v2": 37.663, "v3": -36.750, "v4": 21.062, "amplitude": 38.797, "phase_angle": 13.883, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.738, "filter_rmsd": 0.011, "frame": { "rmsd": 0.011, "origin": [ 318.587, 261.393, 230.358 ], "x_axis": [ 0.890, -0.012, 0.455 ], "y_axis": [ 0.429, 0.359, -0.829 ], "z_axis": [ -0.154, 0.933, 0.325 ], "quaternion": [ 0.802, -0.549, -0.190, -0.137 ] } }, { "index": 181, "index_chain": 181, "chain_name": "J", "nt_resnum": 221, "nt_name": "G", "nt_code": "G", "nt_id": "///J/221", "linked_nts": [ "///J/220", "///J/222" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -77.174, "beta": 159.368, "gamma": 90.570, "delta": 77.049, "epsilon": -130.905, "zeta": -103.076, "epsilon_zeta": -27.829, "bb_type": "--", "chi": -175.269, "glyco_bond": "anti", "C5prime_xyz": [ -1.843, 8.735, 1.362 ], "P_xyz": [ 0.546, 9.747, 1.060 ], "form": "A", "ssZp": 4.497, "Dp": 4.578, "splay_angle": 21.311, "splay_distance": 3.460, "splay_ratio": 0.187, "d22": null, "d64": null, "eta": -178.078, "theta": -159.202, "eta_prime": -162.475, "theta_prime": -158.015, "eta_base": -127.850, "theta_base": -142.657, "v0": -2.741, "v1": -21.159, "v2": 35.675, "v3": -38.219, "v4": 25.797, "amplitude": 38.629, "phase_angle": 22.552, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.010, "frame": { "rmsd": 0.010, "origin": [ 318.115, 263.594, 233.936 ], "x_axis": [ 0.976, 0.214, 0.041 ], "y_axis": [ -0.037, 0.352, -0.935 ], "z_axis": [ -0.214, 0.911, 0.351 ], "quaternion": [ 0.818, -0.564, -0.078, 0.077 ] } }, { "index": 182, "index_chain": 182, "chain_name": "J", "nt_resnum": 222, "nt_name": "U", "nt_code": "U", "nt_id": "///J/222", "linked_nts": [ "///J/221", "///J/223" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -28.630, "beta": 148.727, "gamma": 33.898, "delta": 78.341, "epsilon": -166.752, "zeta": -86.868, "epsilon_zeta": -79.884, "bb_type": "BI", "chi": -156.578, "glyco_bond": "anti", "C5prime_xyz": [ -1.787, 8.858, 0.272 ], "P_xyz": [ 0.730, 9.471, 0.548 ], "form": "A", "ssZp": 4.248, "Dp": 4.397, "splay_angle": 25.655, "splay_distance": 4.236, "splay_ratio": 0.226, "d22": 4.282, "d64": 4.649, "eta": 165.698, "theta": -133.373, "eta_prime": 177.828, "theta_prime": -139.034, "eta_base": -155.079, "theta_base": -107.200, "v0": -4.298, "v1": -19.578, "v2": 34.641, "v3": -38.047, "v4": 26.684, "amplitude": 38.186, "phase_angle": 24.883, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.010, "filter_rmsd": 0.102, "frame": { "rmsd": 0.012, "origin": [ 317.255, 265.453, 236.725 ], "x_axis": [ 0.866, 0.329, -0.376 ], "y_axis": [ -0.479, 0.329, -0.814 ], "z_axis": [ -0.144, 0.885, 0.443 ], "quaternion": [ 0.812, -0.523, 0.072, 0.249 ] } }, { "index": 183, "index_chain": 183, "chain_name": "J", "nt_resnum": 223, "nt_name": "U", "nt_code": "U", "nt_id": "///J/223", "linked_nts": [ "///J/222", "///J/224" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": 155.223, "beta": -142.399, "gamma": 173.610, "delta": 80.925, "epsilon": -114.436, "zeta": -98.564, "epsilon_zeta": -15.872, "bb_type": "--", "chi": -172.795, "glyco_bond": "anti", "C5prime_xyz": [ -1.244, 8.535, 1.336 ], "P_xyz": [ 0.649, 9.758, 0.029 ], "form": "A", "ssZp": 4.532, "Dp": 4.700, "splay_angle": 23.686, "splay_distance": 3.803, "splay_ratio": 0.206, "d22": 4.608, "d64": 4.293, "eta": 172.574, "theta": -160.424, "eta_prime": -173.328, "theta_prime": -157.240, "eta_base": -124.784, "theta_base": -145.757, "v0": 2.607, "v1": -24.459, "v2": 36.011, "v3": -35.438, "v4": 20.689, "amplitude": 37.229, "phase_angle": 14.693, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.614, "filter_rmsd": 0.112, "frame": { "rmsd": 0.014, "origin": [ 319.034, 268.935, 238.354 ], "x_axis": [ 0.409, 0.465, -0.785 ], "y_axis": [ -0.909, 0.128, -0.397 ], "z_axis": [ -0.084, 0.876, 0.475 ], "quaternion": [ 0.709, -0.449, 0.247, 0.484 ] } }, { "index": 184, "index_chain": 184, "chain_name": "J", "nt_resnum": 224, "nt_name": "U", "nt_code": "U", "nt_id": "///J/224", "linked_nts": [ "///J/223", "///J/225" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop", "alpha": -51.094, "beta": 164.177, "gamma": 35.055, "delta": 81.688, "epsilon": -168.648, "zeta": -86.608, "epsilon_zeta": -82.040, "bb_type": "BI", "chi": -154.815, "glyco_bond": "anti", "C5prime_xyz": [ -1.624, 8.749, 0.236 ], "P_xyz": [ 0.882, 9.328, 0.690 ], "form": "A", "ssZp": 4.231, "Dp": 4.414, "splay_angle": 21.558, "splay_distance": 3.506, "splay_ratio": 0.190, "d22": 4.060, "d64": 4.041, "eta": 155.096, "theta": -135.129, "eta_prime": 167.325, "theta_prime": -139.968, "eta_base": -170.324, "theta_base": -106.979, "v0": -0.032, "v1": -21.779, "v2": 34.124, "v3": -35.107, "v4": 22.168, "amplitude": 36.024, "phase_angle": 18.690, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.119, "filter_rmsd": 0.099, "frame": { "rmsd": 0.013, "origin": [ 320.166, 271.719, 240.684 ], "x_axis": [ -0.014, 0.025, -1.000 ], "y_axis": [ -1.000, 0.003, 0.014 ], "z_axis": [ 0.003, 1.000, 0.025 ], "quaternion": [ 0.503, -0.489, 0.498, 0.509 ] } }, { "index": 185, "index_chain": 185, "chain_name": "J", "nt_resnum": 225, "nt_name": "U", "nt_code": "U", "nt_id": "///J/225", "linked_nts": [ "///J/224", "///J/226" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-canonical,non-pair-contact,helix,internal-loop", "alpha": 163.219, "beta": -141.311, "gamma": 161.010, "delta": 82.565, "epsilon": -133.959, "zeta": -126.453, "epsilon_zeta": -7.507, "bb_type": "--", "chi": -171.281, "glyco_bond": "anti", "C5prime_xyz": [ -1.337, 8.613, 1.220 ], "P_xyz": [ 0.774, 9.509, -0.019 ], "form": ".", "ssZp": 4.516, "Dp": 4.585, "splay_angle": 35.942, "splay_distance": 5.683, "splay_ratio": 0.309, "d22": 5.669, "d64": 6.166, "eta": 164.083, "theta": -169.894, "eta_prime": -178.745, "theta_prime": -167.783, "eta_base": -128.466, "theta_base": -157.722, "v0": -0.935, "v1": -20.420, "v2": 32.922, "v3": -34.364, "v4": 22.200, "amplitude": 35.057, "phase_angle": 20.100, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.336, "filter_rmsd": 0.108, "frame": { "rmsd": 0.011, "origin": [ 321.103, 274.710, 239.113 ], "x_axis": [ -0.598, -0.059, -0.799 ], "y_axis": [ -0.798, 0.131, 0.588 ], "z_axis": [ 0.070, 0.990, -0.125 ], "quaternion": [ 0.319, -0.315, 0.681, 0.579 ] } }, { "index": 186, "index_chain": 186, "chain_name": "J", "nt_resnum": 226, "nt_name": "C", "nt_code": "C", "nt_id": "///J/226", "linked_nts": [ "///J/225", "///J/227" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop", "alpha": 10.241, "beta": 137.494, "gamma": 9.274, "delta": 77.365, "epsilon": -142.449, "zeta": -36.581, "epsilon_zeta": -105.869, "bb_type": "BI", "chi": -156.996, "glyco_bond": "anti", "C5prime_xyz": [ -1.525, 8.875, 0.313 ], "P_xyz": [ 0.918, 9.262, 1.119 ], "form": ".", "ssZp": 4.306, "Dp": 4.641, "splay_angle": 26.387, "splay_distance": 4.714, "splay_ratio": 0.240, "d22": null, "d64": null, "eta": 179.753, "theta": -113.854, "eta_prime": -178.625, "theta_prime": -120.433, "eta_base": -167.617, "theta_base": -93.573, "v0": -1.430, "v1": -22.375, "v2": 36.422, "v3": -38.226, "v4": 25.016, "amplitude": 38.928, "phase_angle": 20.673, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.066, "frame": { "rmsd": 0.008, "origin": [ 324.194, 279.448, 238.572 ], "x_axis": [ -0.788, -0.182, -0.588 ], "y_axis": [ -0.597, -0.009, 0.802 ], "z_axis": [ -0.152, 0.983, -0.102 ], "quaternion": [ 0.159, -0.284, 0.686, 0.651 ] } }, { "index": 187, "index_chain": 187, "chain_name": "J", "nt_resnum": 227, "nt_name": "G", "nt_code": "G", "nt_id": "///J/227", "linked_nts": [ "///J/226", "///J/228" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop", "alpha": -140.759, "beta": 134.606, "gamma": 148.501, "delta": 79.780, "epsilon": -129.026, "zeta": -77.161, "epsilon_zeta": -51.865, "bb_type": "BI", "chi": -179.717, "glyco_bond": "anti", "C5prime_xyz": [ -1.451, 8.497, 1.687 ], "P_xyz": [ -0.303, 10.555, 0.541 ], "form": "A", "ssZp": 4.625, "Dp": 4.665, "splay_angle": 24.411, "splay_distance": 3.851, "splay_ratio": 0.214, "d22": null, "d64": null, "eta": 169.095, "theta": -169.960, "eta_prime": -174.583, "theta_prime": -161.273, "eta_base": -127.595, "theta_base": -118.247, "v0": 1.171, "v1": -23.737, "v2": 36.182, "v3": -36.482, "v4": 22.243, "amplitude": 37.814, "phase_angle": 16.893, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.014, "frame": { "rmsd": 0.014, "origin": [ 321.848, 282.010, 235.386 ], "x_axis": [ -0.903, -0.428, -0.022 ], "y_axis": [ -0.089, 0.137, 0.987 ], "z_axis": [ -0.419, 0.893, -0.162 ], "quaternion": [ -0.134, -0.174, 0.742, 0.633 ] } }, { "index": 188, "index_chain": 188, "chain_name": "J", "nt_resnum": 228, "nt_name": "U", "nt_code": "U", "nt_id": "///J/228", "linked_nts": [ "///J/227", "///J/229" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop", "alpha": -55.299, "beta": 167.405, "gamma": 46.740, "delta": 77.492, "epsilon": -137.752, "zeta": -61.771, "epsilon_zeta": -75.981, "bb_type": "BI", "chi": -165.492, "glyco_bond": "anti", "C5prime_xyz": [ -1.422, 8.709, 0.856 ], "P_xyz": [ 1.126, 9.143, 1.235 ], "form": ".", "ssZp": 4.528, "Dp": 4.698, "splay_angle": 26.030, "splay_distance": 4.256, "splay_ratio": 0.230, "d22": 3.797, "d64": 4.139, "eta": 162.434, "theta": -128.663, "eta_prime": 179.108, "theta_prime": -124.743, "eta_base": -126.186, "theta_base": -84.524, "v0": 2.293, "v1": -26.120, "v2": 38.837, "v3": -38.413, "v4": 22.758, "amplitude": 40.269, "phase_angle": 15.327, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.703, "filter_rmsd": 0.107, "frame": { "rmsd": 0.012, "origin": [ 319.005, 284.069, 233.802 ], "x_axis": [ -0.702, -0.279, 0.656 ], "y_axis": [ 0.533, 0.406, 0.743 ], "z_axis": [ -0.473, 0.870, -0.136 ], "quaternion": [ -0.377, 0.085, 0.749, 0.538 ] } }, { "index": 189, "index_chain": 189, "chain_name": "J", "nt_resnum": 229, "nt_name": "U", "nt_code": "U", "nt_id": "///J/229", "linked_nts": [ "///J/228", "///J/230" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,internal-loop", "alpha": -69.750, "beta": 170.208, "gamma": 68.493, "delta": 78.823, "epsilon": -152.720, "zeta": -119.096, "epsilon_zeta": -33.624, "bb_type": "BI", "chi": -157.833, "glyco_bond": "anti", "C5prime_xyz": [ -1.829, 8.872, 0.351 ], "P_xyz": [ 0.649, 9.674, 0.108 ], "form": ".", "ssZp": 4.286, "Dp": 4.482, "splay_angle": 53.104, "splay_distance": 8.314, "splay_ratio": 0.447, "d22": null, "d64": null, "eta": 170.035, "theta": 169.652, "eta_prime": -167.000, "theta_prime": 174.726, "eta_base": -108.971, "theta_base": -173.399, "v0": -5.311, "v1": -18.473, "v2": 33.804, "v3": -37.875, "v4": 27.279, "amplitude": 37.790, "phase_angle": 26.554, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.576, "filter_rmsd": 0.103, "frame": { "rmsd": 0.013, "origin": [ 315.194, 285.373, 235.176 ], "x_axis": [ -0.108, -0.006, 0.994 ], "y_axis": [ 0.767, 0.636, 0.087 ], "z_axis": [ -0.633, 0.772, -0.064 ], "quaternion": [ 0.605, -0.283, -0.672, -0.319 ] } }, { "index": 190, "index_chain": 190, "chain_name": "J", "nt_resnum": 230, "nt_name": "A", "nt_code": "A", "nt_id": "///J/230", "linked_nts": [ "///J/229", "///J/231" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-pair-contact,internal-loop,phosphate", "alpha": -35.405, "beta": 167.979, "gamma": 40.089, "delta": 82.646, "epsilon": -132.132, "zeta": -95.220, "epsilon_zeta": -36.912, "bb_type": "--", "chi": -170.503, "glyco_bond": "anti", "C5prime_xyz": [ -1.692, 8.650, 1.115 ], "P_xyz": [ 0.657, 9.110, 2.157 ], "form": ".", "ssZp": 4.409, "Dp": 4.524, "splay_angle": 29.405, "splay_distance": 4.461, "splay_ratio": 0.260, "d22": null, "d64": null, "eta": -164.920, "theta": -120.441, "eta_prime": -173.628, "theta_prime": -131.295, "eta_base": -175.695, "theta_base": -60.512, "v0": -3.288, "v1": -18.686, "v2": 32.216, "v3": -35.040, "v4": 24.107, "amplitude": 35.213, "phase_angle": 23.808, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "7a", "suiteness": 0.451, "filter_rmsd": 0.042, "frame": { "rmsd": 0.013, "origin": [ 310.410, 289.576, 229.832 ], "x_axis": [ -0.055, -0.327, 0.943 ], "y_axis": [ 0.963, 0.233, 0.137 ], "z_axis": [ -0.265, 0.916, 0.302 ], "quaternion": [ 0.608, -0.320, -0.497, -0.530 ] } }, { "index": 191, "index_chain": 191, "chain_name": "J", "nt_resnum": 231, "nt_name": "A", "nt_code": "A", "nt_id": "///J/231", "linked_nts": [ "///J/230", "///J/232" ], "nt_type": "RNA", "dbn": ".", "summary": "syn,~C3'-endo,BI,non-pair-contact,internal-loop", "alpha": 108.128, "beta": -143.014, "gamma": -145.651, "delta": 79.951, "epsilon": -143.898, "zeta": -29.905, "epsilon_zeta": -113.992, "bb_type": "BI", "chi": 1.021, "glyco_bond": "syn", "C5prime_xyz": [ -5.267, 4.135, -1.619 ], "P_xyz": [ -7.427, 3.017, -0.681 ], "form": ".", "ssZp": -4.643, "Dp": 4.643, "splay_angle": 23.581, "splay_distance": 3.765, "splay_ratio": 0.209, "d22": null, "d64": null, "eta": 165.566, "theta": -140.944, "eta_prime": 175.760, "theta_prime": -128.061, "eta_base": -89.443, "theta_base": -122.083, "v0": 1.231, "v1": -24.794, "v2": 37.515, "v3": -37.861, "v4": 23.026, "amplitude": 39.188, "phase_angle": 16.801, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.044, "frame": { "rmsd": 0.016, "origin": [ 311.318, 292.131, 233.374 ], "x_axis": [ -0.860, -0.407, 0.308 ], "y_axis": [ -0.423, 0.230, -0.876 ], "z_axis": [ 0.286, -0.884, -0.370 ], "quaternion": [ -0.007, -0.264, 0.784, -0.561 ] } }, { "index": 192, "index_chain": 192, "chain_name": "J", "nt_resnum": 232, "nt_name": "U", "nt_code": "U", "nt_id": "///J/232", "linked_nts": [ "///J/231", "///J/233" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-pair-contact,internal-loop", "alpha": -97.437, "beta": -177.459, "gamma": 69.739, "delta": 79.296, "epsilon": -139.618, "zeta": -77.028, "epsilon_zeta": -62.590, "bb_type": "BI", "chi": -157.627, "glyco_bond": "anti", "C5prime_xyz": [ -1.508, 8.788, 0.381 ], "P_xyz": [ 1.046, 9.347, 0.316 ], "form": ".", "ssZp": 4.295, "Dp": 4.648, "splay_angle": 23.420, "splay_distance": 4.697, "splay_ratio": 0.230, "d22": 4.546, "d64": 5.927, "eta": 155.235, "theta": -114.408, "eta_prime": -168.133, "theta_prime": -125.565, "eta_base": -140.699, "theta_base": -118.076, "v0": 1.024, "v1": -23.919, "v2": 36.605, "v3": -36.900, "v4": 22.580, "amplitude": 38.287, "phase_angle": 17.044, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.013, "filter_rmsd": 0.108, "frame": { "rmsd": 0.010, "origin": [ 310.077, 294.018, 236.386 ], "x_axis": [ 0.935, 0.346, 0.081 ], "y_axis": [ -0.098, 0.471, -0.877 ], "z_axis": [ -0.342, 0.811, 0.474 ], "quaternion": [ 0.849, -0.497, -0.124, 0.131 ] } }, { "index": 193, "index_chain": 193, "chain_name": "J", "nt_resnum": 233, "nt_name": "U", "nt_code": "U", "nt_id": "///J/233", "linked_nts": [ "///J/232", "///J/234" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,isolated-canonical,non-pair-contact,helix-end,internal-loop", "alpha": 101.375, "beta": -143.876, "gamma": -115.953, "delta": 80.701, "epsilon": -152.795, "zeta": -75.813, "epsilon_zeta": -76.982, "bb_type": "BI", "chi": -167.718, "glyco_bond": "anti", "C5prime_xyz": [ -1.554, 8.745, 0.949 ], "P_xyz": [ -1.374, 11.247, 0.167 ], "form": ".", "ssZp": 4.256, "Dp": 4.415, "splay_angle": 30.026, "splay_distance": 4.739, "splay_ratio": 0.259, "d22": null, "d64": null, "eta": -168.699, "theta": -166.540, "eta_prime": -159.823, "theta_prime": -156.983, "eta_base": -133.299, "theta_base": -92.519, "v0": -2.238, "v1": -20.176, "v2": 33.691, "v3": -35.905, "v4": 24.079, "amplitude": 36.355, "phase_angle": 22.072, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.101, "frame": { "rmsd": 0.013, "origin": [ 311.230, 296.095, 240.438 ], "x_axis": [ 0.868, 0.448, -0.214 ], "y_axis": [ -0.409, 0.402, -0.819 ], "z_axis": [ -0.281, 0.799, 0.532 ], "quaternion": [ 0.837, -0.483, -0.020, 0.256 ] } }, { "index": 194, "index_chain": 194, "chain_name": "J", "nt_resnum": 234, "nt_name": "G", "nt_code": "G", "nt_id": "///J/234", "linked_nts": [ "///J/233", "///J/235" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-canonical,non-pair-contact,helix,internal-loop", "alpha": 159.068, "beta": -145.232, "gamma": 153.913, "delta": 78.924, "epsilon": -102.923, "zeta": -139.370, "epsilon_zeta": 36.447, "bb_type": "--", "chi": -176.024, "glyco_bond": "anti", "C5prime_xyz": [ -1.008, 8.403, 1.501 ], "P_xyz": [ 1.223, 9.181, 0.416 ], "form": ".", "ssZp": 4.586, "Dp": 4.781, "splay_angle": 67.521, "splay_distance": 11.172, "splay_ratio": 0.562, "d22": null, "d64": null, "eta": 152.974, "theta": 175.761, "eta_prime": 178.039, "theta_prime": 160.723, "eta_base": -103.886, "theta_base": 148.692, "v0": 5.312, "v1": -27.708, "v2": 38.632, "v3": -36.587, "v4": 19.748, "amplitude": 39.368, "phase_angle": 11.095, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.154, "filter_rmsd": 0.027, "frame": { "rmsd": 0.027, "origin": [ 312.707, 300.593, 240.642 ], "x_axis": [ 0.121, 0.550, -0.826 ], "y_axis": [ -0.969, -0.114, -0.218 ], "z_axis": [ -0.214, 0.827, 0.520 ], "quaternion": [ 0.618, -0.423, 0.248, 0.615 ] } }, { "index": 195, "index_chain": 195, "chain_name": "J", "nt_resnum": 235, "nt_name": "A", "nt_code": "A", "nt_id": "///J/235", "linked_nts": [ "///J/234", "///J/236" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,internal-loop,phosphate", "alpha": 38.235, "beta": -104.778, "gamma": -107.000, "delta": 82.604, "epsilon": -154.942, "zeta": -96.550, "epsilon_zeta": -58.393, "bb_type": "BI", "chi": -169.271, "glyco_bond": "anti", "C5prime_xyz": [ -1.050, 8.438, 1.144 ], "P_xyz": [ -1.314, 10.885, 0.312 ], "form": ".", "ssZp": 4.507, "Dp": 4.592, "splay_angle": 26.290, "splay_distance": 4.115, "splay_ratio": 0.231, "d22": null, "d64": null, "eta": -161.394, "theta": 172.178, "eta_prime": 177.061, "theta_prime": -162.749, "eta_base": 156.404, "theta_base": -112.943, "v0": 6.622, "v1": -27.985, "v2": 37.578, "v3": -34.730, "v4": 17.789, "amplitude": 38.026, "phase_angle": 8.804, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.043, "frame": { "rmsd": 0.021, "origin": [ 311.014, 298.418, 251.469 ], "x_axis": [ 0.828, 0.479, -0.292 ], "y_axis": [ -0.496, 0.381, -0.780 ], "z_axis": [ -0.263, 0.791, 0.553 ], "quaternion": [ 0.831, -0.473, 0.009, 0.293 ] } }, { "index": 196, "index_chain": 196, "chain_name": "J", "nt_resnum": 236, "nt_name": "A", "nt_code": "A", "nt_id": "///J/236", "linked_nts": [ "///J/235", "///J/237" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C2'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop", "alpha": 144.249, "beta": -110.934, "gamma": -173.527, "delta": 130.201, "epsilon": -146.983, "zeta": -75.679, "epsilon_zeta": -71.305, "bb_type": "BI", "chi": -172.638, "glyco_bond": "anti", "C5prime_xyz": [ -2.029, 8.515, 1.319 ], "P_xyz": [ 0.250, 9.271, 0.253 ], "form": ".", "ssZp": 2.057, "Dp": 2.514, "splay_angle": 67.302, "splay_distance": 8.925, "splay_ratio": 0.585, "d22": null, "d64": null, "eta": -160.751, "theta": -99.779, "eta_prime": -128.006, "theta_prime": -125.366, "eta_base": -74.548, "theta_base": -48.947, "v0": -23.711, "v1": 28.254, "v2": -21.988, "v3": 8.815, "v4": 9.102, "amplitude": 27.780, "phase_angle": 142.327, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "32t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.042, "frame": { "rmsd": 0.018, "origin": [ 312.672, 301.938, 252.807 ], "x_axis": [ 0.276, 0.678, -0.681 ], "y_axis": [ -0.946, 0.065, -0.319 ], "z_axis": [ -0.172, 0.732, 0.659 ], "quaternion": [ 0.707, -0.372, 0.180, 0.574 ] } }, { "index": 197, "index_chain": 197, "chain_name": "J", "nt_resnum": 237, "nt_name": "A", "nt_code": "A", "nt_id": "///J/237", "linked_nts": [ "///J/236", "///J/238" ], "nt_type": "RNA", "dbn": ".", "summary": "syn,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop", "alpha": 152.328, "beta": -159.711, "gamma": 138.687, "delta": 81.999, "epsilon": -166.115, "zeta": -102.514, "epsilon_zeta": -63.601, "bb_type": "BI", "chi": 46.435, "glyco_bond": "syn", "C5prime_xyz": [ -5.204, 3.417, 1.039 ], "P_xyz": [ -4.706, 1.811, 3.071 ], "form": ".", "ssZp": -3.522, "Dp": 4.471, "splay_angle": 50.179, "splay_distance": 6.780, "splay_ratio": 0.426, "d22": null, "d64": null, "eta": 107.333, "theta": -158.357, "eta_prime": 158.655, "theta_prime": 174.486, "eta_base": -86.735, "theta_base": 131.150, "v0": 3.486, "v1": -24.658, "v2": 35.243, "v3": -34.072, "v4": 19.357, "amplitude": 36.188, "phase_angle": 13.122, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.064, "frame": { "rmsd": 0.044, "origin": [ 304.529, 305.170, 254.511 ], "x_axis": [ 0.352, 0.586, -0.730 ], "y_axis": [ 0.934, -0.273, 0.232 ], "z_axis": [ -0.063, -0.763, -0.643 ], "quaternion": [ 0.330, 0.753, 0.504, -0.263 ] } }, { "index": 198, "index_chain": 198, "chain_name": "J", "nt_resnum": 238, "nt_name": "A", "nt_code": "A", "nt_id": "///J/238", "linked_nts": [ "///J/237", "///J/239" ], "nt_type": "RNA", "dbn": ".", "summary": "syn,~C3'-endo,BI,non-pair-contact,internal-loop", "alpha": 110.420, "beta": -142.028, "gamma": -139.151, "delta": 80.509, "epsilon": -132.460, "zeta": -72.302, "epsilon_zeta": -60.158, "bb_type": "BI", "chi": 3.488, "glyco_bond": "syn", "C5prime_xyz": [ -5.462, 4.214, -1.417 ], "P_xyz": [ -7.658, 3.216, -0.400 ], "form": ".", "ssZp": -4.522, "Dp": 4.521, "splay_angle": 23.299, "splay_distance": 3.517, "splay_ratio": 0.208, "d22": null, "d64": null, "eta": -177.434, "theta": -144.213, "eta_prime": 172.409, "theta_prime": -140.486, "eta_base": 161.749, "theta_base": -108.316, "v0": -3.924, "v1": -19.024, "v2": 33.466, "v3": -36.652, "v4": 25.619, "amplitude": 36.809, "phase_angle": 24.607, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.045, "frame": { "rmsd": 0.018, "origin": [ 310.530, 308.114, 255.642 ], "x_axis": [ 0.750, 0.463, -0.472 ], "y_axis": [ 0.651, -0.391, 0.651 ], "z_axis": [ 0.117, -0.796, -0.594 ], "quaternion": [ 0.437, 0.827, 0.337, -0.107 ] } }, { "index": 199, "index_chain": 199, "chain_name": "J", "nt_resnum": 239, "nt_name": "A", "nt_code": "A", "nt_id": "///J/239", "linked_nts": [ "///J/238", "///J/240" ], "nt_type": "RNA", "dbn": ".", "summary": "syn,~C3'-endo,non-canonical,non-pair-contact,helix,internal-loop", "alpha": 111.851, "beta": -146.318, "gamma": -141.175, "delta": 81.495, "epsilon": -126.348, "zeta": -76.438, "epsilon_zeta": -49.909, "bb_type": "--", "chi": -3.631, "glyco_bond": "syn", "C5prime_xyz": [ -5.210, 4.178, -1.795 ], "P_xyz": [ -7.397, 2.901, -1.228 ], "form": ".", "ssZp": -4.558, "Dp": 4.591, "splay_angle": 29.016, "splay_distance": 4.983, "splay_ratio": 0.261, "d22": null, "d64": null, "eta": 169.572, "theta": -136.736, "eta_prime": -168.498, "theta_prime": -135.625, "eta_base": -116.935, "theta_base": -150.784, "v0": 0.323, "v1": -22.363, "v2": 34.832, "v3": -35.650, "v4": 22.206, "amplitude": 36.658, "phase_angle": 18.164, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.044, "frame": { "rmsd": 0.017, "origin": [ 309.319, 310.844, 257.500 ], "x_axis": [ 0.101, 0.629, -0.771 ], "y_axis": [ 0.983, 0.058, 0.175 ], "z_axis": [ 0.154, -0.775, -0.612 ], "quaternion": [ 0.369, 0.643, 0.626, -0.240 ] } }, { "index": 200, "index_chain": 200, "chain_name": "J", "nt_resnum": 240, "nt_name": "U", "nt_code": "U", "nt_id": "///J/240", "linked_nts": [ "///J/239", "///J/241" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,internal-loop", "alpha": 131.172, "beta": -149.733, "gamma": -166.946, "delta": 78.649, "epsilon": -113.206, "zeta": -88.885, "epsilon_zeta": -24.321, "bb_type": "--", "chi": -179.595, "glyco_bond": "anti", "C5prime_xyz": [ -1.243, 8.381, 1.701 ], "P_xyz": [ 0.332, 10.230, 0.832 ], "form": "A", "ssZp": 4.649, "Dp": 4.736, "splay_angle": 24.968, "splay_distance": 3.934, "splay_ratio": 0.217, "d22": null, "d64": null, "eta": 154.051, "theta": -161.339, "eta_prime": -179.807, "theta_prime": -154.045, "eta_base": -177.508, "theta_base": -115.022, "v0": 3.537, "v1": -26.674, "v2": 38.718, "v3": -37.644, "v4": 21.444, "amplitude": 39.838, "phase_angle": 13.622, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.159, "filter_rmsd": 0.112, "frame": { "rmsd": 0.018, "origin": [ 308.823, 315.714, 256.568 ], "x_axis": [ -0.745, -0.542, 0.388 ], "y_axis": [ 0.624, -0.363, 0.692 ], "z_axis": [ -0.234, 0.758, 0.609 ], "quaternion": [ -0.354, 0.047, 0.440, 0.824 ] } }, { "index": 201, "index_chain": 201, "chain_name": "J", "nt_resnum": 241, "nt_name": "G", "nt_code": "G", "nt_id": "///J/241", "linked_nts": [ "///J/240", "///J/242" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -46.201, "beta": 158.433, "gamma": 43.448, "delta": 77.034, "epsilon": -152.851, "zeta": -89.114, "epsilon_zeta": -63.738, "bb_type": "BI", "chi": -165.100, "glyco_bond": "anti", "C5prime_xyz": [ -1.326, 8.748, 0.824 ], "P_xyz": [ 1.233, 9.116, 1.115 ], "form": ".", "ssZp": 4.506, "Dp": 4.610, "splay_angle": 23.745, "splay_distance": 4.228, "splay_ratio": 0.222, "d22": null, "d64": null, "eta": 159.016, "theta": -134.040, "eta_prime": 176.561, "theta_prime": -144.778, "eta_base": -132.319, "theta_base": -141.068, "v0": 1.150, "v1": -25.354, "v2": 38.641, "v3": -38.980, "v4": 23.843, "amplitude": 40.403, "phase_angle": 16.982, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.230, "filter_rmsd": 0.019, "frame": { "rmsd": 0.019, "origin": [ 306.120, 317.695, 258.628 ], "x_axis": [ -0.095, -0.794, 0.600 ], "y_axis": [ 0.947, 0.114, 0.301 ], "z_axis": [ -0.308, 0.597, 0.741 ], "quaternion": [ 0.663, -0.111, -0.342, -0.656 ] } }, { "index": 202, "index_chain": 202, "chain_name": "J", "nt_resnum": 242, "nt_name": "G", "nt_code": "G", "nt_id": "///J/242", "linked_nts": [ "///J/241", "///J/243" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem", "alpha": 144.409, "beta": -162.757, "gamma": -171.586, "delta": 83.029, "epsilon": -112.871, "zeta": -84.196, "epsilon_zeta": -28.675, "bb_type": "--", "chi": -178.789, "glyco_bond": "anti", "C5prime_xyz": [ -1.198, 8.361, 1.694 ], "P_xyz": [ 0.379, 10.280, 0.969 ], "form": "A", "ssZp": 4.663, "Dp": 4.717, "splay_angle": 23.780, "splay_distance": 3.853, "splay_ratio": 0.208, "d22": null, "d64": null, "eta": 166.961, "theta": -155.634, "eta_prime": 172.790, "theta_prime": -147.499, "eta_base": -169.697, "theta_base": -103.259, "v0": 3.884, "v1": -25.286, "v2": 36.009, "v3": -34.748, "v4": 19.496, "amplitude": 36.919, "phase_angle": 12.748, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.601, "filter_rmsd": 0.024, "frame": { "rmsd": 0.024, "origin": [ 302.395, 319.214, 259.931 ], "x_axis": [ 0.313, -0.839, 0.444 ], "y_axis": [ 0.903, 0.408, 0.133 ], "z_axis": [ -0.293, 0.360, 0.886 ], "quaternion": [ 0.807, -0.070, -0.228, -0.540 ] } }, { "index": 203, "index_chain": 203, "chain_name": "J", "nt_resnum": 243, "nt_name": "C", "nt_code": "C", "nt_id": "///J/243", "linked_nts": [ "///J/242", "///J/244" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -48.478, "beta": 148.279, "gamma": 53.754, "delta": 74.955, "epsilon": -149.013, "zeta": -65.954, "epsilon_zeta": -83.059, "bb_type": "BI", "chi": -163.823, "glyco_bond": "anti", "C5prime_xyz": [ -1.628, 8.919, 0.677 ], "P_xyz": [ 0.911, 9.484, 0.501 ], "form": "A", "ssZp": 4.465, "Dp": 4.604, "splay_angle": 22.906, "splay_distance": 3.867, "splay_ratio": 0.205, "d22": 4.257, "d64": 4.479, "eta": 157.607, "theta": -139.867, "eta_prime": -178.752, "theta_prime": -141.421, "eta_base": -119.830, "theta_base": -120.166, "v0": -2.343, "v1": -23.136, "v2": 38.359, "v3": -40.562, "v4": 27.130, "amplitude": 41.275, "phase_angle": 21.666, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1L", "suiteness": 0.794, "filter_rmsd": 0.068, "frame": { "rmsd": 0.019, "origin": [ 301.575, 318.105, 263.529 ], "x_axis": [ 0.854, -0.381, 0.354 ], "y_axis": [ 0.433, 0.898, -0.078 ], "z_axis": [ -0.288, 0.220, 0.932 ], "quaternion": [ 0.960, -0.078, -0.167, -0.212 ] } }, { "index": 204, "index_chain": 204, "chain_name": "J", "nt_resnum": 244, "nt_name": "U", "nt_code": "U", "nt_id": "///J/244", "linked_nts": [ "///J/243", "///J/245" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -67.053, "beta": 178.714, "gamma": 53.003, "delta": 75.013, "epsilon": -173.441, "zeta": -93.787, "epsilon_zeta": -79.654, "bb_type": "BI", "chi": -152.445, "glyco_bond": "anti", "C5prime_xyz": [ -1.897, 8.876, 0.037 ], "P_xyz": [ 0.497, 9.906, 0.244 ], "form": "A", "ssZp": 4.083, "Dp": 4.311, "splay_angle": 24.736, "splay_distance": 4.065, "splay_ratio": 0.217, "d22": 4.664, "d64": 4.849, "eta": 167.236, "theta": -154.899, "eta_prime": -177.190, "theta_prime": -153.977, "eta_base": -140.335, "theta_base": -141.581, "v0": -5.832, "v1": -18.852, "v2": 35.194, "v3": -39.540, "v4": 28.703, "amplitude": 39.504, "phase_angle": 27.014, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.809, "filter_rmsd": 0.099, "frame": { "rmsd": 0.023, "origin": [ 301.136, 316.782, 267.136 ], "x_axis": [ 0.993, 0.089, 0.077 ], "y_axis": [ -0.078, 0.988, -0.135 ], "z_axis": [ -0.088, 0.128, 0.988 ], "quaternion": [ 0.996, -0.066, -0.041, 0.042 ] } }, { "index": 205, "index_chain": 205, "chain_name": "J", "nt_resnum": 245, "nt_name": "U", "nt_code": "U", "nt_id": "///J/245", "linked_nts": [ "///J/244", "///J/246" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,canonical,non-canonical,non-pair-contact,helix,stem-end,multiplet", "alpha": -178.942, "beta": -137.182, "gamma": 147.491, "delta": 78.587, "epsilon": 27.134, "zeta": 39.460, "epsilon_zeta": -12.326, "bb_type": "--", "chi": -164.762, "glyco_bond": "anti", "C5prime_xyz": [ -2.089, 8.870, 0.675 ], "P_xyz": [ 0.111, 9.688, -0.389 ], "form": ".", "ssZp": 2.333, "Dp": 2.477, "splay_angle": 50.731, "splay_distance": 8.694, "splay_ratio": 0.429, "d22": null, "d64": null, "eta": -143.937, "theta": 116.407, "eta_prime": -149.663, "theta_prime": 101.052, "eta_base": -138.217, "theta_base": 89.871, "v0": -9.468, "v1": -13.793, "v2": 30.373, "v3": -36.542, "v4": 29.012, "amplitude": 36.308, "phase_angle": 33.225, "puckering": "C3'-endo", "sugar_class": "pucker-CHK", "bin": "33t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.096, "frame": { "rmsd": 0.021, "origin": [ 300.864, 315.519, 270.990 ], "x_axis": [ 0.903, 0.387, -0.187 ], "y_axis": [ -0.405, 0.912, -0.069 ], "z_axis": [ 0.144, 0.138, 0.980 ], "quaternion": [ 0.974, -0.053, 0.085, 0.204 ] } }, { "index": 206, "index_chain": 206, "chain_name": "J", "nt_resnum": 246, "nt_name": "A", "nt_code": "A", "nt_id": "///J/246", "linked_nts": [ "///J/245", "///J/247" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-stack,non-canonical,non-pair-contact,multiplet,ss-non-loop,A-minor,cap-acceptor", "alpha": 151.335, "beta": 144.574, "gamma": 134.381, "delta": 77.749, "epsilon": -102.137, "zeta": -132.280, "epsilon_zeta": 30.142, "bb_type": "--", "chi": -163.913, "glyco_bond": "anti", "C5prime_xyz": [ -1.563, 8.695, 0.687 ], "P_xyz": [ -0.589, 10.229, -1.191 ], "form": ".", "ssZp": 4.250, "Dp": 4.765, "splay_angle": 65.616, "splay_distance": 11.345, "splay_ratio": 0.549, "d22": null, "d64": null, "eta": 150.848, "theta": -171.860, "eta_prime": 135.415, "theta_prime": -172.195, "eta_base": 132.817, "theta_base": 165.424, "v0": 0.119, "v1": -24.482, "v2": 38.137, "v3": -39.074, "v4": 24.601, "amplitude": 40.195, "phase_angle": 18.412, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.051, "frame": { "rmsd": 0.028, "origin": [ 294.104, 314.893, 265.559 ], "x_axis": [ 0.716, -0.547, 0.434 ], "y_axis": [ -0.138, 0.498, 0.856 ], "z_axis": [ -0.684, -0.673, 0.281 ], "quaternion": [ 0.790, 0.484, -0.354, -0.129 ] } }, { "index": 207, "index_chain": 207, "chain_name": "J", "nt_resnum": 247, "nt_name": "G", "nt_code": "G", "nt_id": "///J/247", "linked_nts": [ "///J/246", "///J/248" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,anti,~C2'-endo,non-canonical,non-pair-contact,multiplet,ss-non-loop", "alpha": 71.425, "beta": -175.114, "gamma": -86.552, "delta": 141.298, "epsilon": -127.316, "zeta": 118.849, "epsilon_zeta": 113.835, "bb_type": "--", "chi": -96.524, "glyco_bond": "anti", "C5prime_xyz": [ -3.495, 7.949, -2.099 ], "P_xyz": [ -4.742, 9.787, -3.484 ], "form": ".", "ssZp": 2.055, "Dp": 1.876, "splay_angle": 52.372, "splay_distance": 8.165, "splay_ratio": 0.443, "d22": null, "d64": null, "eta": -159.394, "theta": 55.324, "eta_prime": -167.521, "theta_prime": 68.758, "eta_base": 157.854, "theta_base": 96.597, "v0": -35.323, "v1": 45.812, "v2": -37.829, "v3": 18.560, "v4": 10.170, "amplitude": 44.606, "phase_angle": 148.002, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32m", "cluster": "7r", "suiteness": 0.142, "filter_rmsd": 0.027, "frame": { "rmsd": 0.027, "origin": [ 283.526, 310.979, 264.338 ], "x_axis": [ 0.581, -0.716, -0.387 ], "y_axis": [ 0.588, 0.041, 0.808 ], "z_axis": [ -0.563, -0.697, 0.445 ], "quaternion": [ 0.719, 0.523, -0.061, -0.454 ] } }, { "index": 208, "index_chain": 208, "chain_name": "J", "nt_resnum": 248, "nt_name": "U", "nt_code": "U", "nt_id": "///J/248", "linked_nts": [ "///J/247", "///J/249" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,ss-non-loop,phosphate", "alpha": -94.794, "beta": 156.883, "gamma": 50.390, "delta": 85.323, "epsilon": -136.873, "zeta": -87.898, "epsilon_zeta": -48.975, "bb_type": "BI", "chi": -177.550, "glyco_bond": "anti", "C5prime_xyz": [ -1.517, 8.487, 1.565 ], "P_xyz": [ 0.954, 8.442, 2.410 ], "form": "A", "ssZp": 4.346, "Dp": 4.485, "splay_angle": 18.326, "splay_distance": 2.882, "splay_ratio": 0.159, "d22": null, "d64": null, "eta": 168.163, "theta": -143.049, "eta_prime": 166.202, "theta_prime": -143.823, "eta_base": 172.859, "theta_base": -130.574, "v0": 1.019, "v1": -22.474, "v2": 33.955, "v3": -34.207, "v4": 20.929, "amplitude": 35.478, "phase_angle": 16.846, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "0a", "suiteness": 0.474, "filter_rmsd": 0.104, "frame": { "rmsd": 0.031, "origin": [ 278.930, 317.303, 266.694 ], "x_axis": [ 0.204, -0.878, -0.433 ], "y_axis": [ 0.706, -0.174, 0.686 ], "z_axis": [ -0.678, -0.446, 0.585 ], "quaternion": [ 0.635, 0.445, -0.096, -0.623 ] } }, { "index": 209, "index_chain": 209, "chain_name": "J", "nt_resnum": 249, "nt_name": "A", "nt_code": "A", "nt_id": "///J/249", "linked_nts": [ "///J/248", "///J/250" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,ss-non-loop", "alpha": -67.512, "beta": 160.934, "gamma": 56.214, "delta": 81.883, "epsilon": -136.192, "zeta": -36.866, "epsilon_zeta": -99.326, "bb_type": "BI", "chi": -153.439, "glyco_bond": "anti", "C5prime_xyz": [ -1.396, 8.727, 0.128 ], "P_xyz": [ 1.191, 9.015, -0.228 ], "form": ".", "ssZp": 4.156, "Dp": 4.657, "splay_angle": 42.147, "splay_distance": 6.870, "splay_ratio": 0.360, "d22": null, "d64": null, "eta": 164.202, "theta": -103.453, "eta_prime": 175.445, "theta_prime": -100.393, "eta_base": -157.570, "theta_base": -64.432, "v0": 0.325, "v1": -23.021, "v2": 35.681, "v3": -36.400, "v4": 22.779, "amplitude": 37.532, "phase_angle": 18.072, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.724, "filter_rmsd": 0.050, "frame": { "rmsd": 0.028, "origin": [ 276.128, 317.116, 267.344 ], "x_axis": [ 0.375, -0.925, 0.064 ], "y_axis": [ 0.338, 0.201, 0.919 ], "z_axis": [ -0.863, -0.323, 0.388 ], "quaternion": [ 0.701, 0.443, -0.331, -0.450 ] } }, { "index": 210, "index_chain": 210, "chain_name": "J", "nt_resnum": 250, "nt_name": "G", "nt_code": "G", "nt_id": "///J/250", "linked_nts": [ "///J/249", "///J/251" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,phosphate", "alpha": -101.440, "beta": 145.810, "gamma": 115.778, "delta": 81.343, "epsilon": -150.886, "zeta": -69.670, "epsilon_zeta": -81.216, "bb_type": "BI", "chi": -170.278, "glyco_bond": "anti", "C5prime_xyz": [ -1.447, 8.707, 1.133 ], "P_xyz": [ 0.579, 9.771, -0.146 ], "form": "A", "ssZp": 4.348, "Dp": 4.491, "splay_angle": 22.695, "splay_distance": 3.692, "splay_ratio": 0.200, "d22": null, "d64": null, "eta": 171.425, "theta": -156.491, "eta_prime": -148.608, "theta_prime": -159.322, "eta_base": -81.803, "theta_base": -139.735, "v0": 0.414, "v1": -23.538, "v2": 36.331, "v3": -36.902, "v4": 23.140, "amplitude": 38.177, "phase_angle": 17.888, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.028, "frame": { "rmsd": 0.028, "origin": [ 276.783, 311.484, 271.223 ], "x_axis": [ 0.533, -0.250, 0.808 ], "y_axis": [ -0.297, 0.840, 0.455 ], "z_axis": [ -0.792, -0.482, 0.374 ], "quaternion": [ 0.829, 0.283, -0.483, 0.014 ] } }, { "index": 211, "index_chain": 211, "chain_name": "J", "nt_resnum": 251, "nt_name": "U", "nt_code": "U", "nt_id": "///J/251", "linked_nts": [ "///J/250", "///J/252" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -70.409, "beta": 178.415, "gamma": 60.912, "delta": 80.237, "epsilon": -167.425, "zeta": -91.422, "epsilon_zeta": -76.003, "bb_type": "BI", "chi": -151.181, "glyco_bond": "anti", "C5prime_xyz": [ -1.574, 8.853, -0.043 ], "P_xyz": [ 0.938, 9.519, 0.202 ], "form": "A", "ssZp": 3.871, "Dp": 4.266, "splay_angle": 21.185, "splay_distance": 3.453, "splay_ratio": 0.184, "d22": 4.241, "d64": 4.101, "eta": 171.599, "theta": -138.992, "eta_prime": -172.692, "theta_prime": -144.438, "eta_base": -140.140, "theta_base": -112.642, "v0": -2.663, "v1": -20.255, "v2": 34.354, "v3": -36.653, "v4": 24.874, "amplitude": 37.202, "phase_angle": 22.564, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.883, "filter_rmsd": 0.097, "frame": { "rmsd": 0.021, "origin": [ 274.912, 308.339, 271.709 ], "x_axis": [ 0.284, 0.196, 0.939 ], "y_axis": [ -0.603, 0.798, 0.016 ], "z_axis": [ -0.746, -0.570, 0.344 ], "quaternion": [ 0.779, 0.188, -0.541, 0.256 ] } }, { "index": 212, "index_chain": 212, "chain_name": "J", "nt_resnum": 252, "nt_name": "U", "nt_code": "U", "nt_id": "///J/252", "linked_nts": [ "///J/251", "///J/253" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": 159.138, "beta": -135.960, "gamma": 160.175, "delta": 80.104, "epsilon": -122.193, "zeta": -86.433, "epsilon_zeta": -35.760, "bb_type": "--", "chi": -166.021, "glyco_bond": "anti", "C5prime_xyz": [ -1.476, 8.695, 0.910 ], "P_xyz": [ 0.608, 9.443, -0.467 ], "form": "A", "ssZp": 4.320, "Dp": 4.615, "splay_angle": 21.736, "splay_distance": 3.517, "splay_ratio": 0.189, "d22": 4.197, "d64": 3.928, "eta": 163.829, "theta": -147.108, "eta_prime": -179.876, "theta_prime": -149.847, "eta_base": -133.064, "theta_base": -120.412, "v0": 0.181, "v1": -22.759, "v2": 35.557, "v3": -36.374, "v4": 22.837, "amplitude": 37.459, "phase_angle": 18.338, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.238, "filter_rmsd": 0.101, "frame": { "rmsd": 0.021, "origin": [ 273.160, 306.193, 273.770 ], "x_axis": [ -0.081, 0.600, 0.796 ], "y_axis": [ -0.743, 0.496, -0.450 ], "z_axis": [ -0.665, -0.628, 0.406 ], "quaternion": [ 0.675, 0.066, -0.541, 0.498 ] } }, { "index": 213, "index_chain": 213, "chain_name": "J", "nt_resnum": 253, "nt_name": "U", "nt_code": "U", "nt_id": "///J/253", "linked_nts": [ "///J/252", "///J/254" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -55.956, "beta": 152.814, "gamma": 54.621, "delta": 77.757, "epsilon": -147.134, "zeta": -71.138, "epsilon_zeta": -75.996, "bb_type": "BI", "chi": -157.305, "glyco_bond": "anti", "C5prime_xyz": [ -1.638, 8.820, 0.331 ], "P_xyz": [ 0.883, 9.353, -0.079 ], "form": "A", "ssZp": 4.351, "Dp": 4.635, "splay_angle": 22.798, "splay_distance": 3.781, "splay_ratio": 0.201, "d22": null, "d64": null, "eta": 158.980, "theta": -142.673, "eta_prime": 176.399, "theta_prime": -145.445, "eta_base": -137.046, "theta_base": -123.337, "v0": -1.044, "v1": -22.955, "v2": 36.885, "v3": -38.417, "v4": 24.959, "amplitude": 39.268, "phase_angle": 20.066, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.481, "filter_rmsd": 0.100, "frame": { "rmsd": 0.020, "origin": [ 271.419, 304.642, 276.403 ], "x_axis": [ -0.398, 0.853, 0.338 ], "y_axis": [ -0.660, -0.010, -0.751 ], "z_axis": [ -0.637, -0.522, 0.567 ], "quaternion": [ 0.538, -0.106, -0.453, 0.703 ] } }, { "index": 214, "index_chain": 214, "chain_name": "J", "nt_resnum": 254, "nt_name": "G", "nt_code": "G", "nt_id": "///J/254", "linked_nts": [ "///J/253", "///J/255" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -68.148, "beta": 173.744, "gamma": 53.949, "delta": 79.325, "epsilon": -147.402, "zeta": -74.411, "epsilon_zeta": -72.991, "bb_type": "BI", "chi": -159.984, "glyco_bond": "anti", "C5prime_xyz": [ -1.597, 8.902, 0.448 ], "P_xyz": [ 0.895, 9.698, 0.579 ], "form": "A", "ssZp": 4.414, "Dp": 4.578, "splay_angle": 21.670, "splay_distance": 3.517, "splay_ratio": 0.189, "d22": null, "d64": null, "eta": 165.340, "theta": -149.562, "eta_prime": 177.277, "theta_prime": -148.736, "eta_base": -145.887, "theta_base": -117.522, "v0": -3.909, "v1": -19.474, "v2": 34.003, "v3": -37.211, "v4": 25.948, "amplitude": 37.354, "phase_angle": 24.456, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.951, "filter_rmsd": 0.019, "frame": { "rmsd": 0.019, "origin": [ 269.695, 304.137, 279.729 ], "x_axis": [ -0.458, 0.841, -0.288 ], "y_axis": [ -0.416, -0.489, -0.766 ], "z_axis": [ -0.785, -0.231, 0.574 ], "quaternion": [ 0.396, -0.338, -0.314, 0.794 ] } }, { "index": 215, "index_chain": 215, "chain_name": "J", "nt_resnum": 255, "nt_name": "C", "nt_code": "C", "nt_id": "///J/255", "linked_nts": [ "///J/254", "///J/256" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -73.990, "beta": 163.019, "gamma": 64.984, "delta": 76.846, "epsilon": -145.143, "zeta": -70.218, "epsilon_zeta": -74.925, "bb_type": "BI", "chi": -162.220, "glyco_bond": "anti", "C5prime_xyz": [ -1.434, 8.856, 0.628 ], "P_xyz": [ 1.082, 9.422, 0.222 ], "form": "A", "ssZp": 4.514, "Dp": 4.674, "splay_angle": 21.480, "splay_distance": 3.499, "splay_ratio": 0.190, "d22": null, "d64": null, "eta": 161.963, "theta": -143.811, "eta_prime": 176.501, "theta_prime": -146.498, "eta_base": -137.886, "theta_base": -120.688, "v0": -0.017, "v1": -24.146, "v2": 37.834, "v3": -38.801, "v4": 24.442, "amplitude": 39.912, "phase_angle": 18.568, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.706, "filter_rmsd": 0.068, "frame": { "rmsd": 0.012, "origin": [ 267.072, 304.951, 281.928 ], "x_axis": [ -0.516, 0.458, -0.724 ], "y_axis": [ -0.203, -0.887, -0.416 ], "z_axis": [ -0.832, -0.068, 0.551 ], "quaternion": [ 0.192, -0.453, -0.141, 0.859 ] } }, { "index": 216, "index_chain": 216, "chain_name": "J", "nt_resnum": 256, "nt_name": "G", "nt_code": "G", "nt_id": "///J/256", "linked_nts": [ "///J/255", "///J/257" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -76.655, "beta": 172.786, "gamma": 61.034, "delta": 76.508, "epsilon": -148.579, "zeta": -81.201, "epsilon_zeta": -67.379, "bb_type": "BI", "chi": -166.679, "glyco_bond": "anti", "C5prime_xyz": [ -1.399, 8.803, 0.887 ], "P_xyz": [ 1.131, 9.430, 1.041 ], "form": "A", "ssZp": 4.547, "Dp": 4.636, "splay_angle": 23.096, "splay_distance": 3.673, "splay_ratio": 0.203, "d22": null, "d64": null, "eta": 160.193, "theta": -157.712, "eta_prime": 173.139, "theta_prime": -155.690, "eta_base": -143.795, "theta_base": -138.240, "v0": 0.891, "v1": -25.108, "v2": 38.519, "v3": -38.962, "v4": 24.029, "amplitude": 40.351, "phase_angle": 17.330, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.775, "filter_rmsd": 0.017, "frame": { "rmsd": 0.017, "origin": [ 264.203, 306.576, 283.095 ], "x_axis": [ -0.235, -0.111, -0.966 ], "y_axis": [ 0.026, -0.994, 0.108 ], "z_axis": [ -0.972, 0.000, 0.236 ], "quaternion": [ -0.044, -0.617, 0.034, 0.785 ] } }, { "index": 217, "index_chain": 217, "chain_name": "J", "nt_resnum": 257, "nt_name": "G", "nt_code": "G", "nt_id": "///J/257", "linked_nts": [ "///J/256", "///J/258" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -60.498, "beta": 164.224, "gamma": 62.848, "delta": 80.107, "epsilon": -144.121, "zeta": -38.890, "epsilon_zeta": -105.231, "bb_type": "BI", "chi": -163.801, "glyco_bond": "anti", "C5prime_xyz": [ -1.483, 8.784, 0.771 ], "P_xyz": [ 1.085, 9.255, 0.854 ], "form": ".", "ssZp": 4.362, "Dp": 4.571, "splay_angle": 25.743, "splay_distance": 4.464, "splay_ratio": 0.231, "d22": null, "d64": null, "eta": 175.112, "theta": -117.209, "eta_prime": -174.181, "theta_prime": -123.659, "eta_base": -147.375, "theta_base": -90.603, "v0": 0.950, "v1": -23.735, "v2": 36.323, "v3": -36.700, "v4": 22.622, "amplitude": 38.026, "phase_angle": 17.215, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.763, "filter_rmsd": 0.019, "frame": { "rmsd": 0.019, "origin": [ 261.120, 308.491, 283.664 ], "x_axis": [ -0.130, -0.524, -0.842 ], "y_axis": [ 0.055, -0.851, 0.522 ], "z_axis": [ -0.990, 0.022, 0.139 ], "quaternion": [ -0.199, -0.629, 0.186, 0.728 ] } }, { "index": 218, "index_chain": 218, "chain_name": "J", "nt_resnum": 258, "nt_name": "C", "nt_code": "C", "nt_id": "///J/258", "linked_nts": [ "///J/257", "///J/259" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet", "alpha": -125.363, "beta": 139.656, "gamma": 135.674, "delta": 78.336, "epsilon": -145.079, "zeta": -74.031, "epsilon_zeta": -71.048, "bb_type": "BI", "chi": -175.081, "glyco_bond": "anti", "C5prime_xyz": [ -1.317, 8.648, 1.369 ], "P_xyz": [ 0.222, 10.265, 0.009 ], "form": "A", "ssZp": 4.482, "Dp": 4.566, "splay_angle": 23.369, "splay_distance": 3.729, "splay_ratio": 0.205, "d22": null, "d64": null, "eta": 170.944, "theta": -172.887, "eta_prime": -165.864, "theta_prime": -162.385, "eta_base": -106.899, "theta_base": -143.836, "v0": -0.751, "v1": -23.200, "v2": 37.036, "v3": -38.370, "v4": 24.685, "amplitude": 39.316, "phase_angle": 19.608, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.073, "frame": { "rmsd": 0.020, "origin": [ 257.507, 307.715, 281.160 ], "x_axis": [ -0.170, -0.933, -0.316 ], "y_axis": [ 0.016, -0.323, 0.946 ], "z_axis": [ -0.985, 0.156, 0.070 ], "quaternion": [ -0.380, -0.520, 0.441, 0.625 ] } }, { "index": 219, "index_chain": 219, "chain_name": "J", "nt_resnum": 259, "nt_name": "G", "nt_code": "G", "nt_id": "///J/259", "linked_nts": [ "///J/258", "///J/260" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet", "alpha": -64.757, "beta": -174.872, "gamma": 72.924, "delta": 136.132, "epsilon": -60.215, "zeta": -148.892, "epsilon_zeta": 88.677, "bb_type": "--", "chi": -133.730, "glyco_bond": "anti", "C5prime_xyz": [ -1.472, 8.781, -0.594 ], "P_xyz": [ 0.867, 9.347, 0.397 ], "form": ".", "ssZp": -0.327, "Dp": 0.521, "splay_angle": 47.647, "splay_distance": 8.154, "splay_ratio": 0.404, "d22": null, "d64": null, "eta": -131.606, "theta": -173.562, "eta_prime": -119.585, "theta_prime": 175.525, "eta_base": -110.920, "theta_base": -171.069, "v0": -23.535, "v1": 33.485, "v2": -30.367, "v3": 17.612, "v4": 3.485, "amplitude": 33.413, "phase_angle": 155.347, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1b", "suiteness": 0.522, "filter_rmsd": 0.029, "frame": { "rmsd": 0.029, "origin": [ 254.293, 308.668, 279.526 ], "x_axis": [ 0.146, -0.970, 0.194 ], "y_axis": [ -0.024, 0.193, 0.981 ], "z_axis": [ -0.989, -0.148, 0.004 ], "quaternion": [ 0.580, 0.487, -0.510, -0.408 ] } }, { "index": 220, "index_chain": 220, "chain_name": "J", "nt_resnum": 260, "nt_name": "U", "nt_code": "U", "nt_id": "///J/260", "linked_nts": [ "///J/259", "///J/261" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C2'-endo,non-canonical,non-pair-contact,multiplet,ss-non-loop,splayed-apart", "alpha": -44.251, "beta": -88.831, "gamma": -128.607, "delta": 165.081, "epsilon": -136.485, "zeta": -174.858, "epsilon_zeta": 38.372, "bb_type": "--", "chi": -165.058, "glyco_bond": "anti", "C5prime_xyz": [ -1.562, 8.037, 1.549 ], "P_xyz": [ -0.006, 9.893, 0.568 ], "form": ".", "ssZp": 0.527, "Dp": 1.177, "splay_angle": 137.065, "splay_distance": 16.870, "splay_ratio": 0.931, "d22": null, "d64": null, "eta": -146.704, "theta": 116.746, "eta_prime": -172.267, "theta_prime": 121.504, "eta_base": -161.731, "theta_base": 171.038, "v0": -11.241, "v1": 33.562, "v2": -41.752, "v3": 36.320, "v4": -16.002, "amplitude": 41.823, "phase_angle": 183.349, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.104, "frame": { "rmsd": 0.023, "origin": [ 252.918, 316.341, 277.135 ], "x_axis": [ -0.181, -0.982, -0.055 ], "y_axis": [ 0.126, -0.078, 0.989 ], "z_axis": [ -0.975, 0.172, 0.138 ], "quaternion": [ -0.469, -0.436, 0.491, 0.591 ] } }, { "index": 221, "index_chain": 221, "chain_name": "J", "nt_resnum": 261, "nt_name": "A", "nt_code": "A", "nt_id": "///J/261", "linked_nts": [ "///J/260", "///J/262" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,~C2'-endo,non-pair-contact,ss-non-loop,cap-donor,phosphate,splayed-apart", "alpha": 77.030, "beta": -176.934, "gamma": 43.017, "delta": 142.039, "epsilon": -147.218, "zeta": 93.772, "epsilon_zeta": 119.010, "bb_type": "--", "chi": 2.965, "glyco_bond": "--", "C5prime_xyz": [ -5.716, 5.250, -1.031 ], "P_xyz": [ -6.318, 4.549, -3.475 ], "form": ".", "ssZp": 0.058, "Dp": 2.242, "splay_angle": 116.370, "splay_distance": 14.958, "splay_ratio": 0.854, "d22": null, "d64": null, "eta": -31.525, "theta": 95.222, "eta_prime": -22.058, "theta_prime": 42.132, "eta_base": -70.088, "theta_base": -22.486, "v0": -33.148, "v1": 44.250, "v2": -37.526, "v3": 19.605, "v4": 8.046, "amplitude": 43.195, "phase_angle": 150.314, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "4p", "suiteness": 0.047, "filter_rmsd": 0.050, "frame": { "rmsd": 0.031, "origin": [ 256.781, 330.195, 285.952 ], "x_axis": [ 0.659, 0.501, 0.560 ], "y_axis": [ 0.668, -0.733, -0.130 ], "z_axis": [ 0.345, 0.460, -0.818 ], "quaternion": [ -0.165, 0.896, 0.326, 0.253 ] } }, { "index": 222, "index_chain": 222, "chain_name": "J", "nt_resnum": 262, "nt_name": "A", "nt_code": "A", "nt_id": "///J/262", "linked_nts": [ "///J/261", "///J/263" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,syn,~C2'-endo,non-canonical,non-pair-contact,multiplet,ss-non-loop,cap-acceptor,phosphate,splayed-apart", "alpha": 81.497, "beta": -166.783, "gamma": 79.503, "delta": 145.110, "epsilon": -89.929, "zeta": -61.273, "epsilon_zeta": -28.656, "bb_type": "--", "chi": 63.058, "glyco_bond": "syn", "C5prime_xyz": [ -5.523, 5.294, 1.465 ], "P_xyz": [ -6.583, 2.927, 1.272 ], "form": ".", "ssZp": -0.564, "Dp": 1.108, "splay_angle": 81.529, "splay_distance": 11.321, "splay_ratio": 0.677, "d22": null, "d64": null, "eta": 42.716, "theta": -39.738, "eta_prime": 68.016, "theta_prime": -55.296, "eta_base": 104.370, "theta_base": -0.040, "v0": -30.430, "v1": 42.955, "v2": -38.354, "v3": 21.944, "v4": 4.986, "amplitude": 42.510, "phase_angle": 154.451, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "6p", "suiteness": 0.013, "filter_rmsd": 0.054, "frame": { "rmsd": 0.039, "origin": [ 257.461, 315.296, 284.813 ], "x_axis": [ -0.336, -0.934, -0.124 ], "y_axis": [ -0.020, 0.139, -0.990 ], "z_axis": [ 0.942, -0.330, -0.065 ], "quaternion": [ 0.430, -0.384, 0.620, -0.532 ] } }, { "index": 223, "index_chain": 223, "chain_name": "J", "nt_resnum": 263, "nt_name": "C", "nt_code": "C", "nt_id": "///J/263", "linked_nts": [ "///J/262", "///J/264" ], "nt_type": "RNA", "dbn": ".", "summary": "syn,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,ss-non-loop,cap-acceptor", "alpha": -65.614, "beta": 171.894, "gamma": 55.331, "delta": 78.857, "epsilon": -165.342, "zeta": -82.529, "epsilon_zeta": -82.814, "bb_type": "BI", "chi": 19.178, "glyco_bond": "syn", "C5prime_xyz": [ -5.675, 4.456, -0.379 ], "P_xyz": [ -6.079, 1.890, -0.620 ], "form": ".", "ssZp": -4.219, "Dp": 4.374, "splay_angle": 35.798, "splay_distance": 5.841, "splay_ratio": 0.315, "d22": null, "d64": null, "eta": 145.273, "theta": -130.507, "eta_prime": -164.012, "theta_prime": -136.311, "eta_base": -138.346, "theta_base": -169.070, "v0": -2.967, "v1": -21.331, "v2": 36.168, "v3": -38.771, "v4": 26.300, "amplitude": 39.223, "phase_angle": 22.763, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "2a", "suiteness": 0.719, "filter_rmsd": 0.063, "frame": { "rmsd": 0.027, "origin": [ 262.079, 324.597, 280.303 ], "x_axis": [ 0.364, 0.749, 0.554 ], "y_axis": [ -0.893, 0.450, -0.021 ], "z_axis": [ -0.265, -0.487, 0.832 ], "quaternion": [ 0.813, 0.143, -0.252, 0.505 ] } }, { "index": 224, "index_chain": 224, "chain_name": "J", "nt_resnum": 264, "nt_name": "G", "nt_code": "G", "nt_id": "///J/264", "linked_nts": [ "///J/263", "///J/265" ], "nt_type": "RNA", "dbn": "[", "summary": "pseudoknotted,anti,~C3'-endo,isolated-canonical,non-canonical,non-pair-contact,helix,multiplet,hairpin-loop,A-minor", "alpha": 157.788, "beta": -142.992, "gamma": 171.843, "delta": 82.073, "epsilon": -127.500, "zeta": -106.163, "epsilon_zeta": -21.337, "bb_type": "--", "chi": -176.055, "glyco_bond": "anti", "C5prime_xyz": [ -1.485, 8.678, 1.446 ], "P_xyz": [ 0.636, 9.902, 0.584 ], "form": ".", "ssZp": 4.267, "Dp": 4.413, "splay_angle": 24.016, "splay_distance": 3.924, "splay_ratio": 0.208, "d22": null, "d64": null, "eta": 172.350, "theta": -140.248, "eta_prime": -171.494, "theta_prime": -147.320, "eta_base": 174.117, "theta_base": -108.072, "v0": -4.626, "v1": -17.202, "v2": 31.371, "v3": -34.925, "v4": 24.882, "amplitude": 34.923, "phase_angle": 26.068, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.668, "filter_rmsd": 0.031, "frame": { "rmsd": 0.031, "origin": [ 263.163, 330.334, 280.126 ], "x_axis": [ 0.504, -0.851, -0.149 ], "y_axis": [ -0.771, -0.365, -0.522 ], "z_axis": [ 0.390, 0.377, -0.840 ], "quaternion": [ -0.273, 0.823, -0.493, 0.073 ] } }, { "index": 225, "index_chain": 225, "chain_name": "J", "nt_resnum": 265, "nt_name": "A", "nt_code": "A", "nt_id": "///J/265", "linked_nts": [ "///J/264", "///J/266" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-canonical,non-pair-contact,helix-end,multiplet,hairpin-loop", "alpha": 120.315, "beta": -131.582, "gamma": -173.890, "delta": 83.545, "epsilon": -112.248, "zeta": -68.509, "epsilon_zeta": -43.739, "bb_type": "--", "chi": 179.091, "glyco_bond": "anti", "C5prime_xyz": [ -1.008, 8.131, 1.827 ], "P_xyz": [ 0.865, 9.461, 0.658 ], "form": ".", "ssZp": 4.730, "Dp": 4.782, "splay_angle": 35.938, "splay_distance": 5.574, "splay_ratio": 0.310, "d22": null, "d64": null, "eta": 156.813, "theta": -132.453, "eta_prime": 175.577, "theta_prime": -126.787, "eta_base": -125.281, "theta_base": -85.214, "v0": 7.397, "v1": -27.597, "v2": 36.581, "v3": -33.213, "v4": 16.279, "amplitude": 36.883, "phase_angle": 7.338, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.010, "filter_rmsd": 0.052, "frame": { "rmsd": 0.028, "origin": [ 265.726, 330.725, 277.181 ], "x_axis": [ -0.087, -0.878, -0.471 ], "y_axis": [ -0.917, 0.255, -0.306 ], "z_axis": [ 0.389, 0.406, -0.827 ], "quaternion": [ 0.292, -0.609, 0.736, 0.034 ] } }, { "index": 226, "index_chain": 226, "chain_name": "J", "nt_resnum": 266, "nt_name": "G", "nt_code": "G", "nt_id": "///J/266", "linked_nts": [ "///J/265", "///J/267" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,hairpin-loop", "alpha": -57.634, "beta": 160.099, "gamma": 63.423, "delta": 81.607, "epsilon": -138.594, "zeta": -78.674, "epsilon_zeta": -59.920, "bb_type": "BI", "chi": -171.300, "glyco_bond": "anti", "C5prime_xyz": [ -1.673, 8.671, 1.166 ], "P_xyz": [ 0.878, 9.092, 1.470 ], "form": "A", "ssZp": 4.387, "Dp": 4.502, "splay_angle": 23.082, "splay_distance": 3.748, "splay_ratio": 0.202, "d22": null, "d64": null, "eta": 165.966, "theta": -141.006, "eta_prime": -163.942, "theta_prime": -142.094, "eta_base": -99.846, "theta_base": -123.951, "v0": -4.061, "v1": -18.804, "v2": 33.183, "v3": -36.427, "v4": 25.541, "amplitude": 36.559, "phase_angle": 24.817, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.312, "filter_rmsd": 0.030, "frame": { "rmsd": 0.030, "origin": [ 266.335, 329.055, 271.898 ], "x_axis": [ -0.858, -0.357, -0.370 ], "y_axis": [ -0.465, 0.846, 0.262 ], "z_axis": [ 0.220, 0.397, -0.891 ], "quaternion": [ 0.156, -0.217, 0.948, 0.174 ] } }, { "index": 227, "index_chain": 227, "chain_name": "J", "nt_resnum": 267, "nt_name": "U", "nt_code": "U", "nt_id": "///J/267", "linked_nts": [ "///J/266", "///J/268" ], "nt_type": "RNA", "dbn": ".", "summary": "u-turn,anti,~C3'-endo,BI,non-canonical,non-pair-contact,multiplet,hairpin-loop,cap-acceptor", "alpha": -78.937, "beta": 175.987, "gamma": 60.202, "delta": 77.911, "epsilon": -132.968, "zeta": -69.168, "epsilon_zeta": -63.799, "bb_type": "BI", "chi": -155.779, "glyco_bond": "anti", "C5prime_xyz": [ -1.705, 8.818, 0.214 ], "P_xyz": [ 0.805, 9.503, 0.077 ], "form": ".", "ssZp": 4.220, "Dp": 4.680, "splay_angle": 83.440, "splay_distance": 11.003, "splay_ratio": 0.673, "d22": null, "d64": null, "eta": 163.249, "theta": -128.735, "eta_prime": 173.454, "theta_prime": -162.257, "eta_base": -156.048, "theta_base": 123.516, "v0": -2.474, "v1": -21.916, "v2": 36.529, "v3": -38.894, "v4": 26.133, "amplitude": 39.418, "phase_angle": 22.071, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.755, "filter_rmsd": 0.103, "frame": { "rmsd": 0.029, "origin": [ 267.635, 328.891, 268.387 ], "x_axis": [ -0.989, 0.090, -0.115 ], "y_axis": [ 0.050, 0.948, 0.313 ], "z_axis": [ 0.137, 0.304, -0.943 ], "quaternion": [ 0.064, 0.036, 0.985, 0.157 ] } }, { "index": 228, "index_chain": 228, "chain_name": "J", "nt_resnum": 268, "nt_name": "G", "nt_code": "G", "nt_id": "///J/268", "linked_nts": [ "///J/267", "///J/269" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,u-turn,syn,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,hairpin-loop", "alpha": -146.457, "beta": 154.837, "gamma": 24.026, "delta": 74.390, "epsilon": -146.888, "zeta": -53.238, "epsilon_zeta": -93.650, "bb_type": "BI", "chi": 8.341, "glyco_bond": "syn", "C5prime_xyz": [ -5.812, 4.484, -1.034 ], "P_xyz": [ -6.320, 2.237, -2.294 ], "form": ".", "ssZp": -4.456, "Dp": 4.443, "splay_angle": 27.862, "splay_distance": 4.470, "splay_ratio": 0.243, "d22": null, "d64": null, "eta": 41.940, "theta": -131.381, "eta_prime": 53.605, "theta_prime": -126.335, "eta_base": 25.081, "theta_base": -137.548, "v0": -8.762, "v1": -17.553, "v2": 35.677, "v3": -41.519, "v4": 31.745, "amplitude": 41.372, "phase_angle": 30.421, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.054, "frame": { "rmsd": 0.054, "origin": [ 277.248, 334.244, 268.455 ], "x_axis": [ 0.577, -0.803, 0.151 ], "y_axis": [ -0.431, -0.456, -0.779 ], "z_axis": [ 0.694, 0.384, -0.609 ], "quaternion": [ -0.358, 0.813, -0.380, 0.260 ] } }, { "index": 229, "index_chain": 229, "chain_name": "J", "nt_resnum": 269, "nt_name": "G", "nt_code": "G", "nt_id": "///J/269", "linked_nts": [ "///J/268", "///J/270" ], "nt_type": "RNA", "dbn": "(", "summary": "u-turn,anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,multiplet,hairpin-loop,A-minor,cap-donor,phosphate", "alpha": -94.790, "beta": 169.274, "gamma": 82.952, "delta": 78.365, "epsilon": -151.009, "zeta": -66.742, "epsilon_zeta": -84.267, "bb_type": "BI", "chi": -167.318, "glyco_bond": "anti", "C5prime_xyz": [ -1.538, 8.812, 0.903 ], "P_xyz": [ 0.998, 9.431, 0.838 ], "form": "A", "ssZp": 4.235, "Dp": 4.443, "splay_angle": 22.681, "splay_distance": 3.774, "splay_ratio": 0.201, "d22": null, "d64": null, "eta": 159.414, "theta": -142.891, "eta_prime": -173.577, "theta_prime": -146.020, "eta_base": -169.153, "theta_base": -128.125, "v0": -2.005, "v1": -22.443, "v2": 36.987, "v3": -38.967, "v4": 25.891, "amplitude": 39.703, "phase_angle": 21.317, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.010, "filter_rmsd": 0.026, "frame": { "rmsd": 0.026, "origin": [ 276.682, 330.394, 270.654 ], "x_axis": [ -0.061, 0.941, 0.333 ], "y_axis": [ -0.745, 0.179, -0.643 ], "z_axis": [ -0.665, -0.287, 0.690 ], "quaternion": [ 0.672, -0.132, -0.371, 0.627 ] } }, { "index": 230, "index_chain": 230, "chain_name": "J", "nt_resnum": 270, "nt_name": "U", "nt_code": "U", "nt_id": "///J/270", "linked_nts": [ "///J/269", "///J/271" ], "nt_type": "RNA", "dbn": "(", "summary": "u-turn,anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,multiplet,hairpin-loop,phosphate", "alpha": -73.885, "beta": -177.458, "gamma": 55.078, "delta": 74.453, "epsilon": -164.872, "zeta": -87.411, "epsilon_zeta": -77.462, "bb_type": "BI", "chi": -152.814, "glyco_bond": "anti", "C5prime_xyz": [ -1.685, 8.894, 0.016 ], "P_xyz": [ 0.770, 9.751, 0.346 ], "form": "A", "ssZp": 4.062, "Dp": 4.397, "splay_angle": 20.777, "splay_distance": 3.462, "splay_ratio": 0.184, "d22": 4.095, "d64": 4.188, "eta": 162.981, "theta": -140.614, "eta_prime": 176.768, "theta_prime": -145.104, "eta_base": -149.674, "theta_base": -114.991, "v0": -3.304, "v1": -22.367, "v2": 38.398, "v3": -41.077, "v4": 27.998, "amplitude": 41.695, "phase_angle": 22.938, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.816, "filter_rmsd": 0.103, "frame": { "rmsd": 0.025, "origin": [ 275.894, 329.418, 274.214 ], "x_axis": [ -0.367, 0.926, -0.089 ], "y_axis": [ -0.663, -0.328, -0.672 ], "z_axis": [ -0.652, -0.188, 0.735 ], "quaternion": [ 0.510, -0.238, -0.276, 0.779 ] } }, { "index": 231, "index_chain": 231, "chain_name": "J", "nt_resnum": 271, "nt_name": "U", "nt_code": "U", "nt_id": "///J/271", "linked_nts": [ "///J/270", "///J/272" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,canonical,non-canonical,non-pair-contact,helix,stem,hairpin-loop", "alpha": 154.994, "beta": -143.735, "gamma": 171.259, "delta": 82.150, "epsilon": -112.061, "zeta": -104.817, "epsilon_zeta": -7.244, "bb_type": "--", "chi": -167.788, "glyco_bond": "anti", "C5prime_xyz": [ -1.277, 8.605, 1.039 ], "P_xyz": [ 0.620, 9.730, -0.328 ], "form": "A", "ssZp": 4.332, "Dp": 4.641, "splay_angle": 21.272, "splay_distance": 3.692, "splay_ratio": 0.190, "d22": null, "d64": null, "eta": 170.483, "theta": -131.915, "eta_prime": -177.682, "theta_prime": -144.603, "eta_base": -134.968, "theta_base": -122.059, "v0": 1.721, "v1": -23.696, "v2": 35.504, "v3": -35.389, "v4": 21.209, "amplitude": 36.921, "phase_angle": 15.927, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.581, "filter_rmsd": 0.105, "frame": { "rmsd": 0.026, "origin": [ 274.214, 330.526, 277.030 ], "x_axis": [ -0.613, 0.629, -0.479 ], "y_axis": [ -0.474, -0.777, -0.413 ], "z_axis": [ -0.632, -0.026, 0.774 ], "quaternion": [ 0.310, -0.312, -0.123, 0.889 ] } }, { "index": 232, "index_chain": 232, "chain_name": "J", "nt_resnum": 272, "nt_name": "A", "nt_code": "A", "nt_id": "///J/272", "linked_nts": [ "///J/271", "///J/273" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,hairpin-loop", "alpha": 103.804, "beta": -132.879, "gamma": -159.511, "delta": 81.673, "epsilon": -131.358, "zeta": -75.804, "epsilon_zeta": -55.554, "bb_type": "BI", "chi": -176.950, "glyco_bond": "anti", "C5prime_xyz": [ -1.014, 8.318, 1.498 ], "P_xyz": [ 0.132, 10.161, 0.050 ], "form": "A", "ssZp": 4.822, "Dp": 4.817, "splay_angle": 27.609, "splay_distance": 4.389, "splay_ratio": 0.245, "d22": null, "d64": null, "eta": 150.003, "theta": -166.299, "eta_prime": 167.038, "theta_prime": -160.256, "eta_base": -148.845, "theta_base": -131.372, "v0": 6.524, "v1": -28.437, "v2": 38.489, "v3": -35.593, "v4": 18.374, "amplitude": 38.981, "phase_angle": 9.116, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.051, "frame": { "rmsd": 0.022, "origin": [ 271.970, 332.488, 279.210 ], "x_axis": [ -0.620, 0.176, -0.765 ], "y_axis": [ -0.216, -0.975, -0.049 ], "z_axis": [ -0.754, 0.134, 0.642 ], "quaternion": [ 0.109, -0.422, 0.024, 0.900 ] } }, { "index": 233, "index_chain": 233, "chain_name": "J", "nt_resnum": 273, "nt_name": "G", "nt_code": "G", "nt_id": "///J/273", "linked_nts": [ "///J/272", "///J/274" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,hairpin-loop", "alpha": -57.517, "beta": 153.725, "gamma": 68.762, "delta": 73.800, "epsilon": -146.454, "zeta": -55.110, "epsilon_zeta": -91.344, "bb_type": "BI", "chi": -179.574, "glyco_bond": "anti", "C5prime_xyz": [ -1.548, 8.628, 1.608 ], "P_xyz": [ 0.976, 9.289, 1.556 ], "form": ".", "ssZp": 4.689, "Dp": 4.662, "splay_angle": 49.585, "splay_distance": 7.557, "splay_ratio": 0.423, "d22": null, "d64": null, "eta": 170.549, "theta": -96.554, "eta_prime": -168.862, "theta_prime": -98.636, "eta_base": -122.713, "theta_base": -51.987, "v0": -1.121, "v1": -24.214, "v2": 39.197, "v3": -40.723, "v4": 26.415, "amplitude": 41.728, "phase_angle": 20.058, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.455, "filter_rmsd": 0.023, "frame": { "rmsd": 0.023, "origin": [ 268.616, 335.113, 280.267 ], "x_axis": [ -0.642, -0.393, -0.658 ], "y_axis": [ 0.188, -0.913, 0.361 ], "z_axis": [ -0.743, 0.108, 0.660 ], "quaternion": [ -0.162, -0.391, 0.131, 0.897 ] } }, { "index": 234, "index_chain": 234, "chain_name": "J", "nt_resnum": 274, "nt_name": "C", "nt_code": "C", "nt_id": "///J/274", "linked_nts": [ "///J/273", "///J/275" ], "nt_type": "RNA", "dbn": "]", "summary": "pseudoknotted,anti,~C3'-endo,isolated-canonical,non-canonical,non-pair-contact,helix,multiplet,hairpin-loop,A-minor", "alpha": 163.555, "beta": -144.823, "gamma": 162.034, "delta": 84.676, "epsilon": -101.260, "zeta": -104.209, "epsilon_zeta": 2.949, "bb_type": "--", "chi": 171.086, "glyco_bond": "anti", "C5prime_xyz": [ -1.496, 8.370, 2.086 ], "P_xyz": [ 0.961, 9.213, 1.930 ], "form": ".", "ssZp": 4.088, "Dp": 4.319, "splay_angle": 22.187, "splay_distance": 3.768, "splay_ratio": 0.193, "d22": null, "d64": null, "eta": 171.085, "theta": -114.057, "eta_prime": -155.070, "theta_prime": -119.855, "eta_base": -77.091, "theta_base": -98.713, "v0": -1.419, "v1": -19.195, "v2": 31.291, "v3": -32.998, "v4": 21.680, "amplitude": 33.510, "phase_angle": 20.966, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.368, "filter_rmsd": 0.078, "frame": { "rmsd": 0.024, "origin": [ 262.990, 330.069, 280.122 ], "x_axis": [ 0.233, -0.965, 0.116 ], "y_axis": [ 0.705, 0.250, 0.663 ], "z_axis": [ -0.669, -0.073, 0.739 ], "quaternion": [ 0.745, 0.247, -0.263, -0.560 ] } }, { "index": 235, "index_chain": 235, "chain_name": "J", "nt_resnum": 275, "nt_name": "G", "nt_code": "G", "nt_id": "///J/275", "linked_nts": [ "///J/274", "///J/276" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C2'-endo,non-canonical,non-pair-contact,helix-end,hairpin-loop", "alpha": 118.760, "beta": -145.773, "gamma": -158.292, "delta": 147.979, "epsilon": -90.785, "zeta": 110.524, "epsilon_zeta": 158.692, "bb_type": "--", "chi": -154.458, "glyco_bond": "anti", "C5prime_xyz": [ -1.718, 8.528, 0.741 ], "P_xyz": [ 0.233, 9.930, -0.240 ], "form": ".", "ssZp": 1.030, "Dp": 0.997, "splay_angle": 48.003, "splay_distance": 7.712, "splay_ratio": 0.413, "d22": null, "d64": null, "eta": -161.489, "theta": 87.260, "eta_prime": -149.390, "theta_prime": 118.870, "eta_base": -118.989, "theta_base": 125.529, "v0": -17.357, "v1": 32.279, "v2": -34.041, "v3": 24.886, "v4": -4.949, "amplitude": 34.644, "phase_angle": 169.298, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.029, "frame": { "rmsd": 0.029, "origin": [ 260.216, 328.639, 282.232 ], "x_axis": [ 0.816, -0.555, 0.159 ], "y_axis": [ 0.394, 0.737, 0.549 ], "z_axis": [ -0.422, -0.385, 0.821 ], "quaternion": [ 0.918, 0.254, -0.158, -0.258 ] } }, { "index": 236, "index_chain": 236, "chain_name": "J", "nt_resnum": 276, "nt_name": "A", "nt_code": "A", "nt_id": "///J/276", "linked_nts": [ "///J/275", "///J/277" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,anti,~C2'-endo,non-pair-contact,hairpin-loop,A-minor", "alpha": 153.316, "beta": -134.308, "gamma": 131.355, "delta": 151.850, "epsilon": -76.967, "zeta": 94.649, "epsilon_zeta": 188.384, "bb_type": "--", "chi": -127.310, "glyco_bond": "anti", "C5prime_xyz": [ -2.001, 8.592, -0.743 ], "P_xyz": [ 0.620, 8.524, -0.789 ], "form": ".", "ssZp": 0.073, "Dp": 0.220, "splay_angle": 15.887, "splay_distance": 2.896, "splay_ratio": 0.159, "d22": null, "d64": null, "eta": -148.760, "theta": 142.572, "eta_prime": -146.678, "theta_prime": 88.072, "eta_base": -161.445, "theta_base": 106.636, "v0": -22.327, "v1": 38.419, "v2": -38.902, "v3": 27.069, "v4": -3.201, "amplitude": 40.142, "phase_angle": 165.718, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.036, "frame": { "rmsd": 0.011, "origin": [ 257.056, 334.583, 278.469 ], "x_axis": [ -0.022, -0.912, 0.410 ], "y_axis": [ 0.016, 0.410, 0.912 ], "z_axis": [ -1.000, 0.027, 0.006 ], "quaternion": [ 0.590, 0.375, -0.597, -0.393 ] } }, { "index": 237, "index_chain": 237, "chain_name": "J", "nt_resnum": 277, "nt_name": "U", "nt_code": "U", "nt_id": "///J/277", "linked_nts": [ "///J/276", "///J/278" ], "nt_type": "RNA", "dbn": ".", "summary": "syn,~C3'-endo,non-canonical,non-pair-contact,multiplet,hairpin-loop", "alpha": 68.901, "beta": -161.064, "gamma": 177.503, "delta": 84.597, "epsilon": -102.880, "zeta": -82.267, "epsilon_zeta": -20.613, "bb_type": "--", "chi": 76.158, "glyco_bond": "syn", "C5prime_xyz": [ -4.828, 4.861, 2.506 ], "P_xyz": [ -4.438, 4.898, 5.102 ], "form": ".", "ssZp": -0.477, "Dp": 4.437, "splay_angle": 44.088, "splay_distance": 6.578, "splay_ratio": 0.379, "d22": null, "d64": null, "eta": 150.059, "theta": -169.454, "eta_prime": 126.819, "theta_prime": -174.674, "eta_base": 157.546, "theta_base": 107.607, "v0": -0.754, "v1": -20.384, "v2": 32.376, "v3": -33.608, "v4": 21.786, "amplitude": 34.398, "phase_angle": 19.744, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23t", "cluster": "6n", "suiteness": 0.816, "filter_rmsd": 0.111, "frame": { "rmsd": 0.016, "origin": [ 259.171, 336.560, 278.412 ], "x_axis": [ 0.010, -0.917, 0.399 ], "y_axis": [ 0.511, 0.348, 0.786 ], "z_axis": [ -0.860, 0.196, 0.472 ], "quaternion": [ 0.676, 0.218, -0.465, -0.528 ] } }, { "index": 238, "index_chain": 238, "chain_name": "J", "nt_resnum": 278, "nt_name": "A", "nt_code": "A", "nt_id": "///J/278", "linked_nts": [ "///J/277", "///J/279" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,multiplet,hairpin-loop,A-minor", "alpha": -92.011, "beta": 84.704, "gamma": 142.982, "delta": 81.356, "epsilon": 162.758, "zeta": -86.612, "epsilon_zeta": -110.630, "bb_type": "BI", "chi": -123.216, "glyco_bond": "anti", "C5prime_xyz": [ -3.092, 8.324, -1.645 ], "P_xyz": [ -3.448, 7.433, -4.090 ], "form": ".", "ssZp": 2.919, "Dp": 3.520, "splay_angle": 23.859, "splay_distance": 4.184, "splay_ratio": 0.209, "d22": null, "d64": null, "eta": -138.278, "theta": 119.701, "eta_prime": -161.393, "theta_prime": 140.538, "eta_base": 127.765, "theta_base": 176.732, "v0": -13.491, "v1": -9.957, "v2": 27.657, "v3": -36.126, "v4": 31.469, "amplitude": 36.042, "phase_angle": 39.883, "puckering": "C4'-exo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.047, "frame": { "rmsd": 0.026, "origin": [ 265.228, 336.370, 280.970 ], "x_axis": [ -0.468, -0.772, -0.431 ], "y_axis": [ -0.239, 0.580, -0.779 ], "z_axis": [ 0.851, -0.261, -0.456 ], "quaternion": [ 0.405, -0.319, 0.791, -0.329 ] } }, { "index": 239, "index_chain": 239, "chain_name": "J", "nt_resnum": 279, "nt_name": "C", "nt_code": "C", "nt_id": "///J/279", "linked_nts": [ "///J/278", "///J/280" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,hairpin-loop", "alpha": 145.598, "beta": -150.441, "gamma": 179.738, "delta": 80.820, "epsilon": -142.890, "zeta": -76.552, "epsilon_zeta": -66.338, "bb_type": "BI", "chi": -175.117, "glyco_bond": "anti", "C5prime_xyz": [ -1.404, 8.740, 1.332 ], "P_xyz": [ 0.301, 10.317, 0.073 ], "form": "A", "ssZp": 4.443, "Dp": 4.497, "splay_angle": 24.666, "splay_distance": 4.038, "splay_ratio": 0.216, "d22": 4.597, "d64": 4.752, "eta": 171.586, "theta": -168.639, "eta_prime": 172.512, "theta_prime": -164.793, "eta_base": -146.082, "theta_base": -142.501, "v0": -2.770, "v1": -20.182, "v2": 34.275, "v3": -36.596, "v4": 24.980, "amplitude": 37.158, "phase_angle": 22.717, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.329, "filter_rmsd": 0.074, "frame": { "rmsd": 0.019, "origin": [ 268.991, 334.729, 280.161 ], "x_axis": [ -0.500, -0.416, -0.760 ], "y_axis": [ -0.089, 0.897, -0.433 ], "z_axis": [ 0.862, -0.149, -0.485 ], "quaternion": [ 0.478, -0.149, 0.849, -0.171 ] } }, { "index": 240, "index_chain": 240, "chain_name": "J", "nt_resnum": 280, "nt_name": "U", "nt_code": "U", "nt_id": "///J/280", "linked_nts": [ "///J/279", "///J/281" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -56.809, "beta": 172.323, "gamma": 48.722, "delta": 77.918, "epsilon": -166.041, "zeta": -89.203, "epsilon_zeta": -76.838, "bb_type": "BI", "chi": -162.875, "glyco_bond": "anti", "C5prime_xyz": [ -1.610, 8.860, 0.639 ], "P_xyz": [ 0.813, 9.530, 1.358 ], "form": "A", "ssZp": 4.188, "Dp": 4.322, "splay_angle": 21.291, "splay_distance": 3.546, "splay_ratio": 0.189, "d22": null, "d64": null, "eta": 168.656, "theta": -140.610, "eta_prime": -176.584, "theta_prime": -144.384, "eta_base": -143.444, "theta_base": -121.213, "v0": -4.678, "v1": -19.042, "v2": 34.407, "v3": -38.004, "v4": 26.939, "amplitude": 38.130, "phase_angle": 25.530, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.890, "filter_rmsd": 0.103, "frame": { "rmsd": 0.016, "origin": [ 272.179, 332.427, 279.245 ], "x_axis": [ -0.567, 0.080, -0.820 ], "y_axis": [ 0.131, 0.991, 0.006 ], "z_axis": [ 0.813, -0.104, -0.573 ], "quaternion": [ 0.461, 0.060, 0.885, -0.028 ] } }, { "index": 241, "index_chain": 241, "chain_name": "J", "nt_resnum": 281, "nt_name": "A", "nt_code": "A", "nt_id": "///J/281", "linked_nts": [ "///J/280", "///J/282" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem", "alpha": 163.024, "beta": -142.453, "gamma": 163.556, "delta": 81.327, "epsilon": -105.877, "zeta": -122.016, "epsilon_zeta": 16.139, "bb_type": "--", "chi": -175.122, "glyco_bond": "anti", "C5prime_xyz": [ -1.702, 8.623, 1.400 ], "P_xyz": [ 0.485, 9.735, 0.536 ], "form": ".", "ssZp": 4.179, "Dp": 4.411, "splay_angle": 20.360, "splay_distance": 3.392, "splay_ratio": 0.177, "d22": null, "d64": null, "eta": 173.664, "theta": -140.926, "eta_prime": -175.706, "theta_prime": -150.256, "eta_base": -141.769, "theta_base": -123.768, "v0": -3.902, "v1": -18.087, "v2": 32.097, "v3": -35.301, "v4": 24.711, "amplitude": 35.383, "phase_angle": 24.887, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.393, "filter_rmsd": 0.048, "frame": { "rmsd": 0.022, "origin": [ 274.172, 330.505, 277.030 ], "x_axis": [ -0.509, 0.564, -0.651 ], "y_axis": [ 0.440, 0.820, 0.366 ], "z_axis": [ 0.740, -0.100, -0.665 ], "quaternion": [ 0.402, 0.290, 0.865, 0.077 ] } }, { "index": 242, "index_chain": 242, "chain_name": "J", "nt_resnum": 282, "nt_name": "A", "nt_code": "A", "nt_id": "///J/282", "linked_nts": [ "///J/281", "///J/283" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem,multiplet", "alpha": 99.282, "beta": -121.280, "gamma": -165.343, "delta": 81.793, "epsilon": -116.014, "zeta": -78.711, "epsilon_zeta": -37.303, "bb_type": "--", "chi": -171.892, "glyco_bond": "anti", "C5prime_xyz": [ -0.931, 8.355, 1.399 ], "P_xyz": [ 0.635, 9.661, -0.185 ], "form": "A", "ssZp": 4.539, "Dp": 4.741, "splay_angle": 24.315, "splay_distance": 3.931, "splay_ratio": 0.213, "d22": null, "d64": null, "eta": 152.513, "theta": -151.338, "eta_prime": 168.209, "theta_prime": -148.340, "eta_base": -148.023, "theta_base": -114.875, "v0": 7.437, "v1": -28.420, "v2": 37.920, "v3": -34.522, "v4": 17.132, "amplitude": 38.266, "phase_angle": 7.708, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.056, "frame": { "rmsd": 0.027, "origin": [ 275.834, 329.643, 274.202 ], "x_axis": [ -0.239, 0.910, -0.340 ], "y_axis": [ 0.725, 0.400, 0.561 ], "z_axis": [ 0.646, -0.113, -0.755 ], "quaternion": [ 0.319, 0.528, 0.773, 0.145 ] } }, { "index": 243, "index_chain": 243, "chain_name": "J", "nt_resnum": 283, "nt_name": "C", "nt_code": "C", "nt_id": "///J/283", "linked_nts": [ "///J/282", "///J/284" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,multiplet,A-minor", "alpha": -54.507, "beta": 149.664, "gamma": 66.308, "delta": 74.418, "epsilon": -138.966, "zeta": -78.315, "epsilon_zeta": -60.651, "bb_type": "BI", "chi": -167.666, "glyco_bond": "anti", "C5prime_xyz": [ -1.648, 8.849, 0.878 ], "P_xyz": [ 0.852, 9.471, 0.640 ], "form": "A", "ssZp": 4.405, "Dp": 4.582, "splay_angle": 22.884, "splay_distance": 3.660, "splay_ratio": 0.199, "d22": 4.384, "d64": 4.113, "eta": 165.269, "theta": -146.487, "eta_prime": -172.014, "theta_prime": -146.375, "eta_base": -120.678, "theta_base": -118.069, "v0": -3.191, "v1": -23.144, "v2": 39.200, "v3": -42.037, "v4": 28.526, "amplitude": 42.509, "phase_angle": 22.757, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.286, "filter_rmsd": 0.069, "frame": { "rmsd": 0.023, "origin": [ 276.736, 330.762, 270.543 ], "x_axis": [ 0.188, 0.974, 0.128 ], "y_axis": [ 0.774, -0.227, 0.591 ], "z_axis": [ 0.604, -0.012, -0.797 ], "quaternion": [ 0.203, 0.743, 0.588, 0.246 ] } }, { "index": 244, "index_chain": 244, "chain_name": "J", "nt_resnum": 284, "nt_name": "C", "nt_code": "C", "nt_id": "///J/284", "linked_nts": [ "///J/283", "///J/285" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-canonical,non-pair-contact,helix-end,ss-non-loop,cap-donor,splayed-apart", "alpha": -68.855, "beta": 173.474, "gamma": 56.111, "delta": 79.853, "epsilon": -148.092, "zeta": 112.509, "epsilon_zeta": 99.399, "bb_type": "--", "chi": -156.668, "glyco_bond": "anti", "C5prime_xyz": [ -1.396, 8.824, 0.283 ], "P_xyz": [ 1.166, 9.281, 0.399 ], "form": ".", "ssZp": 4.242, "Dp": 4.550, "splay_angle": 159.850, "splay_distance": 17.849, "splay_ratio": 0.985, "d22": null, "d64": null, "eta": 165.268, "theta": 37.983, "eta_prime": 177.417, "theta_prime": 43.159, "eta_base": -141.599, "theta_base": 91.999, "v0": -2.037, "v1": -21.350, "v2": 35.320, "v3": -37.416, "v4": 24.953, "amplitude": 37.990, "phase_angle": 21.607, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.816, "filter_rmsd": 0.067, "frame": { "rmsd": 0.025, "origin": [ 278.114, 332.029, 267.397 ], "x_axis": [ 0.475, 0.637, 0.607 ], "y_axis": [ 0.582, -0.745, 0.326 ], "z_axis": [ 0.660, 0.199, -0.724 ], "quaternion": [ 0.037, 0.858, 0.355, 0.369 ] } }, { "index": 245, "index_chain": 245, "chain_name": "J", "nt_resnum": 285, "nt_name": "G", "nt_code": "G", "nt_id": "///J/285", "linked_nts": [ "///J/284", "///J/286" ], "nt_type": "RNA", "dbn": "]", "summary": "pseudoknotted,anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,A-minor,splayed-apart", "alpha": -71.252, "beta": 158.921, "gamma": 60.869, "delta": 81.435, "epsilon": -148.295, "zeta": -73.009, "epsilon_zeta": -75.286, "bb_type": "BI", "chi": -178.283, "glyco_bond": "anti", "C5prime_xyz": [ -1.340, 8.493, 1.595 ], "P_xyz": [ 1.237, 8.624, 2.036 ], "form": "A", "ssZp": 4.453, "Dp": 4.539, "splay_angle": 26.427, "splay_distance": 4.166, "splay_ratio": 0.231, "d22": null, "d64": null, "eta": -164.390, "theta": -141.189, "eta_prime": -138.351, "theta_prime": -140.671, "eta_base": -160.944, "theta_base": -124.910, "v0": 0.941, "v1": -23.630, "v2": 36.008, "v3": -36.391, "v4": 22.404, "amplitude": 37.686, "phase_angle": 17.161, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "9a", "suiteness": 0.731, "filter_rmsd": 0.035, "frame": { "rmsd": 0.035, "origin": [ 287.237, 317.252, 263.279 ], "x_axis": [ -0.792, -0.018, -0.610 ], "y_axis": [ -0.370, 0.809, 0.456 ], "z_axis": [ 0.486, 0.587, -0.648 ], "quaternion": [ 0.304, -0.108, 0.901, 0.289 ] } }, { "index": 246, "index_chain": 246, "chain_name": "J", "nt_resnum": 286, "nt_name": "C", "nt_code": "C", "nt_id": "///J/286", "linked_nts": [ "///J/285", "///J/287" ], "nt_type": "RNA", "dbn": "]", "summary": "pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -88.040, "beta": -167.416, "gamma": 63.124, "delta": 79.856, "epsilon": -149.550, "zeta": -82.954, "epsilon_zeta": -66.596, "bb_type": "BI", "chi": -160.206, "glyco_bond": "anti", "C5prime_xyz": [ -1.389, 8.812, 0.515 ], "P_xyz": [ 1.160, 9.212, 0.976 ], "form": "A", "ssZp": 4.366, "Dp": 4.560, "splay_angle": 24.751, "splay_distance": 3.901, "splay_ratio": 0.215, "d22": null, "d64": null, "eta": 166.488, "theta": -155.655, "eta_prime": 176.644, "theta_prime": -152.673, "eta_base": -154.893, "theta_base": -138.770, "v0": -0.227, "v1": -23.166, "v2": 36.485, "v3": -37.413, "v4": 23.747, "amplitude": 38.541, "phase_angle": 18.798, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.476, "filter_rmsd": 0.066, "frame": { "rmsd": 0.023, "origin": [ 289.894, 317.585, 260.088 ], "x_axis": [ -0.915, 0.341, -0.216 ], "y_axis": [ 0.097, 0.705, 0.703 ], "z_axis": [ 0.392, 0.622, -0.678 ], "quaternion": [ 0.168, 0.120, 0.908, 0.365 ] } }, { "index": 247, "index_chain": 247, "chain_name": "J", "nt_resnum": 287, "nt_name": "G", "nt_code": "G", "nt_id": "///J/287", "linked_nts": [ "///J/286", "///J/288" ], "nt_type": "RNA", "dbn": "]", "summary": "pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -84.394, "beta": 177.498, "gamma": 68.281, "delta": 82.726, "epsilon": -145.284, "zeta": -66.695, "epsilon_zeta": -78.589, "bb_type": "BI", "chi": -159.187, "glyco_bond": "anti", "C5prime_xyz": [ -1.367, 8.756, 0.532 ], "P_xyz": [ 1.226, 9.083, 0.509 ], "form": "A", "ssZp": 4.336, "Dp": 4.570, "splay_angle": 23.110, "splay_distance": 3.766, "splay_ratio": 0.202, "d22": null, "d64": null, "eta": 167.060, "theta": -134.768, "eta_prime": 173.923, "theta_prime": -136.476, "eta_base": -164.420, "theta_base": -106.873, "v0": 2.297, "v1": -24.465, "v2": 36.156, "v3": -35.653, "v4": 21.031, "amplitude": 37.441, "phase_angle": 15.050, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.464, "filter_rmsd": 0.028, "frame": { "rmsd": 0.028, "origin": [ 291.541, 318.630, 256.709 ], "x_axis": [ -0.865, 0.407, 0.292 ], "y_axis": [ 0.487, 0.548, 0.680 ], "z_axis": [ 0.118, 0.731, -0.672 ], "quaternion": [ -0.050, 0.255, 0.878, 0.402 ] } }, { "index": 248, "index_chain": 248, "chain_name": "J", "nt_resnum": 288, "nt_name": "C", "nt_code": "C", "nt_id": "///J/288", "linked_nts": [ "///J/287", "///J/289" ], "nt_type": "RNA", "dbn": "]", "summary": "pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -79.983, "beta": 170.106, "gamma": 70.703, "delta": 76.879, "epsilon": -142.856, "zeta": -72.249, "epsilon_zeta": -70.607, "bb_type": "BI", "chi": -156.967, "glyco_bond": "anti", "C5prime_xyz": [ -1.519, 8.898, 0.295 ], "P_xyz": [ 0.970, 9.524, -0.179 ], "form": "A", "ssZp": 4.291, "Dp": 4.627, "splay_angle": 24.740, "splay_distance": 4.016, "splay_ratio": 0.215, "d22": null, "d64": null, "eta": 164.261, "theta": -144.331, "eta_prime": -178.484, "theta_prime": -144.752, "eta_base": -131.025, "theta_base": -118.116, "v0": -0.801, "v1": -23.519, "v2": 37.670, "v3": -38.988, "v4": 25.108, "amplitude": 39.997, "phase_angle": 19.642, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.453, "filter_rmsd": 0.072, "frame": { "rmsd": 0.024, "origin": [ 289.982, 321.198, 254.437 ], "x_axis": [ -0.422, 0.598, 0.682 ], "y_axis": [ 0.906, 0.313, 0.286 ], "z_axis": [ -0.042, 0.738, -0.673 ], "quaternion": [ -0.233, 0.484, 0.776, 0.330 ] } }, { "index": 249, "index_chain": 249, "chain_name": "J", "nt_resnum": 289, "nt_name": "A", "nt_code": "A", "nt_id": "///J/289", "linked_nts": [ "///J/288", "///J/290" ], "nt_type": "RNA", "dbn": "]", "summary": "pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -68.954, "beta": 167.776, "gamma": 63.680, "delta": 77.307, "epsilon": -136.602, "zeta": -76.384, "epsilon_zeta": -60.219, "bb_type": "BI", "chi": -160.694, "glyco_bond": "anti", "C5prime_xyz": [ -1.596, 8.781, 0.541 ], "P_xyz": [ 0.901, 9.488, 0.379 ], "form": "A", "ssZp": 4.361, "Dp": 4.649, "splay_angle": 23.071, "splay_distance": 3.756, "splay_ratio": 0.202, "d22": null, "d64": null, "eta": 168.527, "theta": -139.813, "eta_prime": -177.805, "theta_prime": -137.882, "eta_base": -137.311, "theta_base": -101.908, "v0": -0.181, "v1": -24.297, "v2": 38.298, "v3": -39.213, "v4": 24.957, "amplitude": 40.449, "phase_angle": 18.768, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.768, "filter_rmsd": 0.047, "frame": { "rmsd": 0.026, "origin": [ 288.302, 324.535, 252.965 ], "x_axis": [ 0.148, 0.468, 0.872 ], "y_axis": [ 0.986, -0.005, -0.165 ], "z_axis": [ -0.073, 0.884, -0.462 ], "quaternion": [ -0.413, 0.635, 0.572, 0.314 ] } }, { "index": 250, "index_chain": 250, "chain_name": "J", "nt_resnum": 290, "nt_name": "U", "nt_code": "U", "nt_id": "///J/290", "linked_nts": [ "///J/289", "///J/291" ], "nt_type": "RNA", "dbn": "]", "summary": "pseudoknotted,anti,~C3'-endo,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,splayed-apart", "alpha": -52.979, "beta": 162.580, "gamma": 44.313, "delta": 63.864, "epsilon": 67.886, "zeta": -176.857, "epsilon_zeta": -115.257, "bb_type": "--", "chi": -152.992, "glyco_bond": "anti", "C5prime_xyz": [ -1.907, 8.823, 0.104 ], "P_xyz": [ 0.575, 9.549, -0.282 ], "form": ".", "ssZp": 3.598, "Dp": 3.767, "splay_angle": 151.734, "splay_distance": 18.601, "splay_ratio": 0.970, "d22": null, "d64": null, "eta": -175.717, "theta": -11.279, "eta_prime": -157.119, "theta_prime": -21.834, "eta_base": -109.491, "theta_base": -15.644, "v0": 1.826, "v1": -27.885, "v2": 42.566, "v3": -42.392, "v4": 25.420, "amplitude": 44.330, "phase_angle": 16.216, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.269, "filter_rmsd": 0.108, "frame": { "rmsd": 0.024, "origin": [ 287.807, 328.186, 253.695 ], "x_axis": [ 0.707, 0.301, 0.640 ], "y_axis": [ 0.692, -0.107, -0.714 ], "z_axis": [ -0.146, 0.948, -0.284 ], "quaternion": [ 0.573, -0.724, -0.343, -0.171 ] } }, { "index": 251, "index_chain": 251, "chain_name": "J", "nt_resnum": 291, "nt_name": "G", "nt_code": "G", "nt_id": "///J/291", "linked_nts": [ "///J/290", "///J/292" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,phosphate,splayed-apart", "alpha": -19.916, "beta": 163.293, "gamma": 34.578, "delta": 81.728, "epsilon": -155.621, "zeta": -65.509, "epsilon_zeta": -90.112, "bb_type": "BI", "chi": -176.796, "glyco_bond": "anti", "C5prime_xyz": [ -1.708, 8.662, 1.402 ], "P_xyz": [ 0.542, 9.209, 2.543 ], "form": "A", "ssZp": 4.410, "Dp": 4.454, "splay_angle": 25.218, "splay_distance": 3.913, "splay_ratio": 0.219, "d22": null, "d64": null, "eta": 177.667, "theta": -144.561, "eta_prime": -147.816, "theta_prime": -141.152, "eta_base": -123.519, "theta_base": -99.853, "v0": -3.119, "v1": -19.653, "v2": 33.340, "v3": -36.098, "v4": 24.843, "amplitude": 36.328, "phase_angle": 23.402, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.013, "frame": { "rmsd": 0.013, "origin": [ 296.372, 330.217, 237.308 ], "x_axis": [ -0.068, -0.995, -0.077 ], "y_axis": [ -0.437, -0.040, 0.899 ], "z_axis": [ -0.897, 0.095, -0.432 ], "quaternion": [ -0.339, -0.592, 0.604, 0.411 ] } }, { "index": 252, "index_chain": 252, "chain_name": "J", "nt_resnum": 292, "nt_name": "G", "nt_code": "G", "nt_id": "///J/292", "linked_nts": [ "///J/291", "///J/293" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -86.419, "beta": 179.053, "gamma": 68.146, "delta": 85.071, "epsilon": -149.297, "zeta": -67.583, "epsilon_zeta": -81.714, "bb_type": "BI", "chi": -171.718, "glyco_bond": "anti", "C5prime_xyz": [ -1.309, 8.646, 1.257 ], "P_xyz": [ 1.224, 8.827, 1.897 ], "form": "A", "ssZp": 4.317, "Dp": 4.439, "splay_angle": 23.042, "splay_distance": 3.715, "splay_ratio": 0.201, "d22": null, "d64": null, "eta": 167.262, "theta": -136.429, "eta_prime": -175.719, "theta_prime": -136.841, "eta_base": -120.568, "theta_base": -112.378, "v0": -0.121, "v1": -20.770, "v2": 32.471, "v3": -33.393, "v4": 21.174, "amplitude": 34.290, "phase_angle": 18.747, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.437, "filter_rmsd": 0.022, "frame": { "rmsd": 0.022, "origin": [ 293.539, 329.443, 234.721 ], "x_axis": [ -0.267, -0.749, 0.607 ], "y_axis": [ -0.167, 0.656, 0.736 ], "z_axis": [ -0.949, 0.095, -0.300 ], "quaternion": [ 0.522, 0.307, -0.745, -0.279 ] } }, { "index": 253, "index_chain": 253, "chain_name": "J", "nt_resnum": 293, "nt_name": "U", "nt_code": "U", "nt_id": "///J/293", "linked_nts": [ "///J/292", "///J/294" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -75.320, "beta": -179.706, "gamma": 56.325, "delta": 83.090, "epsilon": -151.996, "zeta": -69.113, "epsilon_zeta": -82.883, "bb_type": "BI", "chi": -160.194, "glyco_bond": "anti", "C5prime_xyz": [ -1.520, 8.805, 0.500 ], "P_xyz": [ 0.982, 9.347, 1.070 ], "form": "A", "ssZp": 4.220, "Dp": 4.437, "splay_angle": 22.097, "splay_distance": 3.593, "splay_ratio": 0.192, "d22": 4.219, "d64": 4.161, "eta": 165.236, "theta": -142.695, "eta_prime": -178.504, "theta_prime": -142.762, "eta_base": -138.076, "theta_base": -112.356, "v0": -2.542, "v1": -19.641, "v2": 32.973, "v3": -35.242, "v4": 23.852, "amplitude": 35.685, "phase_angle": 22.481, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.872, "filter_rmsd": 0.104, "frame": { "rmsd": 0.014, "origin": [ 290.447, 328.455, 232.914 ], "x_axis": [ -0.233, -0.254, 0.939 ], "y_axis": [ 0.019, 0.964, 0.265 ], "z_axis": [ -0.972, 0.079, -0.220 ], "quaternion": [ 0.614, 0.076, -0.777, -0.111 ] } }, { "index": 254, "index_chain": 254, "chain_name": "J", "nt_resnum": 294, "nt_name": "U", "nt_code": "U", "nt_id": "///J/294", "linked_nts": [ "///J/293", "///J/295" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -74.743, "beta": 167.489, "gamma": 64.677, "delta": 79.786, "epsilon": -146.771, "zeta": -60.187, "epsilon_zeta": -86.584, "bb_type": "BI", "chi": -161.156, "glyco_bond": "anti", "C5prime_xyz": [ -1.597, 8.816, 0.541 ], "P_xyz": [ 0.947, 9.443, 0.446 ], "form": "A", "ssZp": 4.352, "Dp": 4.561, "splay_angle": 21.807, "splay_distance": 3.650, "splay_ratio": 0.193, "d22": null, "d64": null, "eta": 164.467, "theta": -136.211, "eta_prime": -179.305, "theta_prime": -140.816, "eta_base": -133.489, "theta_base": -112.416, "v0": -1.538, "v1": -21.616, "v2": 35.189, "v3": -36.961, "v4": 24.286, "amplitude": 37.645, "phase_angle": 20.814, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.734, "filter_rmsd": 0.102, "frame": { "rmsd": 0.012, "origin": [ 286.981, 327.515, 232.815 ], "x_axis": [ -0.131, 0.324, 0.937 ], "y_axis": [ 0.093, 0.945, -0.314 ], "z_axis": [ -0.987, 0.046, -0.154 ], "quaternion": [ 0.644, -0.139, -0.747, 0.090 ] } }, { "index": 255, "index_chain": 255, "chain_name": "J", "nt_resnum": 295, "nt_name": "G", "nt_code": "G", "nt_id": "///J/295", "linked_nts": [ "///J/294", "///J/296" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -111.301, "beta": 152.837, "gamma": 110.549, "delta": 81.867, "epsilon": -147.385, "zeta": -76.842, "epsilon_zeta": -70.544, "bb_type": "BI", "chi": -174.043, "glyco_bond": "anti", "C5prime_xyz": [ -1.684, 8.669, 1.313 ], "P_xyz": [ 0.486, 9.804, 0.375 ], "form": "A", "ssZp": 4.423, "Dp": 4.481, "splay_angle": 24.079, "splay_distance": 3.838, "splay_ratio": 0.211, "d22": null, "d64": null, "eta": 164.039, "theta": -157.470, "eta_prime": -175.584, "theta_prime": -159.111, "eta_base": -127.245, "theta_base": -135.909, "v0": -1.888, "v1": -20.375, "v2": 33.549, "v3": -35.564, "v4": 23.626, "amplitude": 36.061, "phase_angle": 21.515, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.020, "frame": { "rmsd": 0.020, "origin": [ 283.657, 327.013, 234.236 ], "x_axis": [ 0.051, 0.774, 0.631 ], "y_axis": [ 0.047, 0.629, -0.776 ], "z_axis": [ -0.998, 0.069, -0.004 ], "quaternion": [ 0.647, -0.326, -0.629, 0.281 ] } }, { "index": 256, "index_chain": 256, "chain_name": "J", "nt_resnum": 296, "nt_name": "U", "nt_code": "U", "nt_id": "///J/296", "linked_nts": [ "///J/295", "///J/297" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop", "alpha": -71.687, "beta": 175.733, "gamma": 63.591, "delta": 82.963, "epsilon": -137.233, "zeta": -84.500, "epsilon_zeta": -52.733, "bb_type": "BI", "chi": -159.462, "glyco_bond": "anti", "C5prime_xyz": [ -1.456, 8.814, 0.489 ], "P_xyz": [ 1.100, 9.280, 0.840 ], "form": ".", "ssZp": 4.128, "Dp": 4.476, "splay_angle": 20.096, "splay_distance": 3.264, "splay_ratio": 0.175, "d22": 4.503, "d64": 4.133, "eta": 174.996, "theta": -145.858, "eta_prime": -173.961, "theta_prime": -146.014, "eta_base": -140.959, "theta_base": -121.762, "v0": -0.765, "v1": -21.281, "v2": 33.962, "v3": -35.260, "v4": 22.765, "amplitude": 36.083, "phase_angle": 19.741, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.792, "filter_rmsd": 0.104, "frame": { "rmsd": 0.014, "origin": [ 280.203, 326.265, 235.733 ], "x_axis": [ 0.101, 0.990, 0.101 ], "y_axis": [ -0.014, 0.103, -0.995 ], "z_axis": [ -0.995, 0.099, 0.024 ], "quaternion": [ 0.554, -0.494, -0.494, 0.453 ] } }, { "index": 257, "index_chain": 257, "chain_name": "J", "nt_resnum": 297, "nt_name": "U", "nt_code": "U", "nt_id": "///J/297", "linked_nts": [ "///J/296", "///J/298" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,junction-loop", "alpha": -64.383, "beta": 156.207, "gamma": 57.300, "delta": 78.066, "epsilon": -144.168, "zeta": -78.325, "epsilon_zeta": -65.843, "bb_type": "BI", "chi": -154.251, "glyco_bond": "anti", "C5prime_xyz": [ -1.586, 8.815, 0.136 ], "P_xyz": [ 0.941, 9.254, -0.369 ], "form": "A", "ssZp": 4.212, "Dp": 4.636, "splay_angle": 24.464, "splay_distance": 3.930, "splay_ratio": 0.213, "d22": null, "d64": null, "eta": 158.660, "theta": -146.714, "eta_prime": 173.344, "theta_prime": -148.998, "eta_base": -147.833, "theta_base": -126.265, "v0": 1.052, "v1": -25.045, "v2": 38.247, "v3": -38.487, "v4": 23.632, "amplitude": 39.997, "phase_angle": 17.015, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.744, "filter_rmsd": 0.109, "frame": { "rmsd": 0.019, "origin": [ 277.098, 326.755, 236.613 ], "x_axis": [ 0.105, 0.911, -0.399 ], "y_axis": [ -0.206, -0.373, -0.905 ], "z_axis": [ -0.973, 0.177, 0.149 ], "quaternion": [ 0.469, -0.576, -0.306, 0.595 ] } }, { "index": 258, "index_chain": 258, "chain_name": "J", "nt_resnum": 298, "nt_name": "A", "nt_code": "A", "nt_id": "///J/298", "linked_nts": [ "///J/297", "///J/299" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop", "alpha": -63.732, "beta": 164.328, "gamma": 60.167, "delta": 77.855, "epsilon": -151.563, "zeta": -64.591, "epsilon_zeta": -86.972, "bb_type": "BI", "chi": -164.895, "glyco_bond": "anti", "C5prime_xyz": [ -1.527, 8.757, 0.780 ], "P_xyz": [ 1.013, 9.345, 0.686 ], "form": "A", "ssZp": 4.538, "Dp": 4.633, "splay_angle": 26.145, "splay_distance": 4.188, "splay_ratio": 0.230, "d22": null, "d64": null, "eta": 165.936, "theta": -141.170, "eta_prime": 178.854, "theta_prime": -141.327, "eta_base": -142.252, "theta_base": -108.559, "v0": 0.899, "v1": -25.321, "v2": 38.698, "v3": -39.030, "v4": 24.145, "amplitude": 40.518, "phase_angle": 17.238, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.857, "filter_rmsd": 0.049, "frame": { "rmsd": 0.018, "origin": [ 273.953, 328.898, 237.593 ], "x_axis": [ 0.247, 0.524, -0.815 ], "y_axis": [ -0.256, -0.776, -0.577 ], "z_axis": [ -0.935, 0.351, -0.058 ], "quaternion": [ -0.321, 0.721, 0.093, -0.606 ] } }, { "index": 259, "index_chain": 259, "chain_name": "J", "nt_resnum": 299, "nt_name": "C", "nt_code": "C", "nt_id": "///J/299", "linked_nts": [ "///J/298", "///J/300" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet", "alpha": -72.274, "beta": 167.009, "gamma": 70.938, "delta": 76.260, "epsilon": -170.788, "zeta": -82.572, "epsilon_zeta": -88.216, "bb_type": "BI", "chi": -168.993, "glyco_bond": "anti", "C5prime_xyz": [ -1.473, 8.810, 1.022 ], "P_xyz": [ 1.085, 9.370, 1.044 ], "form": "A", "ssZp": 4.336, "Dp": 4.406, "splay_angle": 23.931, "splay_distance": 4.003, "splay_ratio": 0.216, "d22": 4.885, "d64": 5.128, "eta": 168.856, "theta": -143.367, "eta_prime": -169.711, "theta_prime": -150.934, "eta_base": -115.970, "theta_base": -142.405, "v0": -0.960, "v1": -23.966, "v2": 38.613, "v3": -39.951, "v4": 25.893, "amplitude": 41.045, "phase_angle": 19.823, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.478, "filter_rmsd": 0.066, "frame": { "rmsd": 0.021, "origin": [ 271.498, 332.074, 236.398 ], "x_axis": [ 0.081, -0.099, -0.992 ], "y_axis": [ -0.362, -0.930, 0.063 ], "z_axis": [ -0.929, 0.354, -0.111 ], "quaternion": [ -0.100, 0.728, -0.158, -0.659 ] } }, { "index": 260, "index_chain": 260, "chain_name": "J", "nt_resnum": 300, "nt_name": "U", "nt_code": "U", "nt_id": "///J/300", "linked_nts": [ "///J/299", "///J/301" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": 178.063, "beta": -152.997, "gamma": 155.456, "delta": 79.482, "epsilon": -119.943, "zeta": -104.358, "epsilon_zeta": -15.585, "bb_type": "--", "chi": -174.753, "glyco_bond": "anti", "C5prime_xyz": [ -1.504, 8.617, 1.441 ], "P_xyz": [ 0.724, 9.772, 0.836 ], "form": "A", "ssZp": 4.363, "Dp": 4.507, "splay_angle": 21.957, "splay_distance": 3.694, "splay_ratio": 0.194, "d22": 3.985, "d64": 4.057, "eta": 172.178, "theta": -131.812, "eta_prime": 179.731, "theta_prime": -138.106, "eta_base": -159.901, "theta_base": -99.411, "v0": -2.467, "v1": -19.927, "v2": 33.790, "v3": -36.165, "v4": 24.256, "amplitude": 36.560, "phase_angle": 22.446, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.122, "filter_rmsd": 0.105, "frame": { "rmsd": 0.021, "origin": [ 269.651, 335.623, 236.315 ], "x_axis": [ 0.019, -0.510, -0.860 ], "y_axis": [ -0.419, -0.785, 0.456 ], "z_axis": [ -0.908, 0.352, -0.229 ], "quaternion": [ 0.036, 0.713, -0.326, -0.620 ] } }, { "index": 261, "index_chain": 261, "chain_name": "J", "nt_resnum": 301, "nt_name": "U", "nt_code": "U", "nt_id": "///J/301", "linked_nts": [ "///J/300", "///J/302" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": 113.734, "beta": -130.778, "gamma": -163.334, "delta": 84.923, "epsilon": -128.025, "zeta": -47.370, "epsilon_zeta": -80.655, "bb_type": "--", "chi": -172.765, "glyco_bond": "anti", "C5prime_xyz": [ -1.100, 8.384, 1.402 ], "P_xyz": [ 0.526, 9.864, 0.048 ], "form": ".", "ssZp": 4.473, "Dp": 4.618, "splay_angle": 22.669, "splay_distance": 4.128, "splay_ratio": 0.212, "d22": null, "d64": null, "eta": 158.014, "theta": -141.478, "eta_prime": 178.654, "theta_prime": -155.664, "eta_base": -122.558, "theta_base": -156.359, "v0": 5.321, "v1": -25.397, "v2": 35.079, "v3": -32.896, "v4": 17.335, "amplitude": 35.647, "phase_angle": 10.244, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.110, "frame": { "rmsd": 0.021, "origin": [ 267.282, 336.216, 233.543 ], "x_axis": [ -0.201, -0.903, -0.379 ], "y_axis": [ -0.463, -0.253, 0.849 ], "z_axis": [ -0.863, 0.346, -0.367 ], "quaternion": [ 0.211, 0.596, -0.573, -0.521 ] } }, { "index": 262, "index_chain": 262, "chain_name": "J", "nt_resnum": 302, "nt_name": "G", "nt_code": "G", "nt_id": "///J/302", "linked_nts": [ "///J/301", "///J/303" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -140.728, "beta": 123.270, "gamma": 146.166, "delta": 77.854, "epsilon": -128.244, "zeta": -73.361, "epsilon_zeta": -54.883, "bb_type": "BI", "chi": 178.254, "glyco_bond": "anti", "C5prime_xyz": [ -1.447, 8.407, 1.770 ], "P_xyz": [ -0.526, 10.494, 0.491 ], "form": "A", "ssZp": 4.697, "Dp": 4.727, "splay_angle": 25.969, "splay_distance": 4.125, "splay_ratio": 0.230, "d22": null, "d64": null, "eta": 155.440, "theta": -168.977, "eta_prime": 167.461, "theta_prime": -160.168, "eta_base": -176.800, "theta_base": -118.643, "v0": 2.599, "v1": -26.239, "v2": 38.762, "v3": -38.258, "v4": 22.460, "amplitude": 40.122, "phase_angle": 14.962, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.020, "frame": { "rmsd": 0.020, "origin": [ 266.306, 338.300, 230.115 ], "x_axis": [ -0.147, -0.986, -0.076 ], "y_axis": [ -0.488, 0.006, 0.873 ], "z_axis": [ -0.861, 0.166, -0.482 ], "quaternion": [ -0.307, -0.576, 0.639, 0.406 ] } }, { "index": 263, "index_chain": 263, "chain_name": "J", "nt_resnum": 303, "nt_name": "A", "nt_code": "A", "nt_id": "///J/303", "linked_nts": [ "///J/302", "///J/304" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -57.208, "beta": 168.938, "gamma": 52.891, "delta": 76.878, "epsilon": -143.746, "zeta": -73.981, "epsilon_zeta": -69.764, "bb_type": "BI", "chi": -167.068, "glyco_bond": "anti", "C5prime_xyz": [ -1.532, 8.699, 0.898 ], "P_xyz": [ 0.985, 9.280, 1.279 ], "form": "A", "ssZp": 4.496, "Dp": 4.638, "splay_angle": 22.616, "splay_distance": 3.747, "splay_ratio": 0.203, "d22": null, "d64": null, "eta": 165.425, "theta": -146.107, "eta_prime": -176.286, "theta_prime": -144.489, "eta_base": -121.702, "theta_base": -123.729, "v0": 0.241, "v1": -24.614, "v2": 38.335, "v3": -39.171, "v4": 24.580, "amplitude": 40.365, "phase_angle": 18.246, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.722, "filter_rmsd": 0.044, "frame": { "rmsd": 0.017, "origin": [ 263.769, 336.697, 227.285 ], "x_axis": [ -0.383, -0.730, 0.566 ], "y_axis": [ -0.278, 0.675, 0.683 ], "z_axis": [ -0.881, 0.105, -0.462 ], "quaternion": [ -0.456, -0.317, 0.794, 0.248 ] } }, { "index": 264, "index_chain": 264, "chain_name": "J", "nt_resnum": 304, "nt_name": "A", "nt_code": "A", "nt_id": "///J/304", "linked_nts": [ "///J/303", "///J/305" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop", "alpha": -61.889, "beta": 170.545, "gamma": 58.021, "delta": 77.006, "epsilon": -142.723, "zeta": -68.246, "epsilon_zeta": -74.477, "bb_type": "BI", "chi": -160.805, "glyco_bond": "anti", "C5prime_xyz": [ -1.753, 8.854, 0.490 ], "P_xyz": [ 0.716, 9.676, 0.648 ], "form": "A", "ssZp": 4.322, "Dp": 4.565, "splay_angle": 22.972, "splay_distance": 3.863, "splay_ratio": 0.203, "d22": null, "d64": null, "eta": 171.657, "theta": -140.947, "eta_prime": -176.290, "theta_prime": -140.218, "eta_base": -144.107, "theta_base": -112.361, "v0": -4.638, "v1": -19.905, "v2": 35.434, "v3": -39.087, "v4": 27.595, "amplitude": 39.175, "phase_angle": 25.242, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.887, "filter_rmsd": 0.042, "frame": { "rmsd": 0.012, "origin": [ 261.275, 335.080, 225.004 ], "x_axis": [ -0.363, -0.322, 0.875 ], "y_axis": [ -0.140, 0.947, 0.290 ], "z_axis": [ -0.921, -0.017, -0.388 ], "quaternion": [ 0.547, 0.141, -0.821, -0.083 ] } }, { "index": 265, "index_chain": 265, "chain_name": "J", "nt_resnum": 305, "nt_name": "G", "nt_code": "G", "nt_id": "///J/305", "linked_nts": [ "///J/304", "///J/306" ], "nt_type": "RNA", "dbn": ".", "summary": "u-turn,anti,~C3'-endo,non-canonical,non-pair-contact,helix-end,hairpin-loop,cap-acceptor", "alpha": -69.447, "beta": 167.598, "gamma": 59.969, "delta": 76.646, "epsilon": -129.271, "zeta": -43.525, "epsilon_zeta": -85.746, "bb_type": "--", "chi": -158.273, "glyco_bond": "anti", "C5prime_xyz": [ -2.124, 8.829, 0.316 ], "P_xyz": [ 0.211, 9.896, -0.089 ], "form": ".", "ssZp": 4.270, "Dp": 4.699, "splay_angle": 75.678, "splay_distance": 11.063, "splay_ratio": 0.614, "d22": null, "d64": null, "eta": 165.980, "theta": -106.862, "eta_prime": -179.337, "theta_prime": -155.287, "eta_base": -138.522, "theta_base": 151.751, "v0": -4.376, "v1": -20.364, "v2": 35.790, "v3": -39.441, "v4": 27.571, "amplitude": 39.444, "phase_angle": 24.854, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.849, "filter_rmsd": 0.022, "frame": { "rmsd": 0.022, "origin": [ 257.816, 333.365, 224.866 ], "x_axis": [ -0.300, 0.208, 0.931 ], "y_axis": [ -0.048, 0.972, -0.232 ], "z_axis": [ -0.953, -0.114, -0.281 ], "quaternion": [ 0.590, -0.050, -0.799, 0.108 ] } }, { "index": 266, "index_chain": 266, "chain_name": "J", "nt_resnum": 306, "nt_name": "G", "nt_code": "G", "nt_id": "///J/306", "linked_nts": [ "///J/305", "///J/307" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,u-turn,anti,~C3'-endo,BI,non-pair-contact,hairpin-loop", "alpha": -172.424, "beta": 116.221, "gamma": 47.887, "delta": 83.752, "epsilon": -138.586, "zeta": -66.258, "epsilon_zeta": -72.327, "bb_type": "BI", "chi": -175.094, "glyco_bond": "anti", "C5prime_xyz": [ -2.092, 8.775, 1.213 ], "P_xyz": [ 0.472, 8.628, 1.726 ], "form": ".", "ssZp": 4.039, "Dp": 4.218, "splay_angle": 26.090, "splay_distance": 4.195, "splay_ratio": 0.226, "d22": null, "d64": null, "eta": 10.411, "theta": -117.158, "eta_prime": 46.840, "theta_prime": -126.324, "eta_base": 30.062, "theta_base": -83.722, "v0": -9.660, "v1": -12.385, "v2": 28.147, "v3": -34.586, "v4": 27.844, "amplitude": 34.185, "phase_angle": 34.575, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1g", "suiteness": 0.149, "filter_rmsd": 0.020, "frame": { "rmsd": 0.020, "origin": [ 254.207, 332.671, 214.431 ], "x_axis": [ 0.543, 0.528, -0.653 ], "y_axis": [ -0.200, 0.837, 0.510 ], "z_axis": [ 0.815, -0.146, 0.560 ], "quaternion": [ 0.857, 0.191, 0.428, 0.212 ] } }, { "index": 267, "index_chain": 267, "chain_name": "J", "nt_resnum": 307, "nt_name": "G", "nt_code": "G", "nt_id": "///J/307", "linked_nts": [ "///J/306", "///J/308" ], "nt_type": "RNA", "dbn": ".", "summary": "u-turn,anti,~C3'-endo,BI,non-pair-contact,hairpin-loop,cap-donor,phosphate", "alpha": -98.127, "beta": 163.183, "gamma": 81.994, "delta": 83.193, "epsilon": -150.916, "zeta": -77.338, "epsilon_zeta": -73.579, "bb_type": "BI", "chi": -164.872, "glyco_bond": "anti", "C5prime_xyz": [ -1.394, 8.747, 0.791 ], "P_xyz": [ 1.101, 9.255, 0.241 ], "form": "A", "ssZp": 4.425, "Dp": 4.527, "splay_angle": 22.086, "splay_distance": 3.516, "splay_ratio": 0.192, "d22": null, "d64": null, "eta": 152.802, "theta": -151.650, "eta_prime": 177.034, "theta_prime": -156.099, "eta_base": -113.456, "theta_base": -140.832, "v0": -1.062, "v1": -20.508, "v2": 33.001, "v3": -34.515, "v4": 22.439, "amplitude": 35.179, "phase_angle": 20.269, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.010, "filter_rmsd": 0.012, "frame": { "rmsd": 0.012, "origin": [ 258.234, 333.140, 215.507 ], "x_axis": [ 0.235, 0.972, 0.006 ], "y_axis": [ -0.553, 0.128, 0.823 ], "z_axis": [ 0.799, -0.197, 0.568 ], "quaternion": [ 0.695, 0.367, 0.285, 0.549 ] } }, { "index": 268, "index_chain": 268, "chain_name": "J", "nt_resnum": 308, "nt_name": "A", "nt_code": "A", "nt_id": "///J/308", "linked_nts": [ "///J/307", "///J/309" ], "nt_type": "RNA", "dbn": ".", "summary": "u-turn,anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,hairpin-loop,phosphate", "alpha": -70.052, "beta": 164.627, "gamma": 64.600, "delta": 82.405, "epsilon": -144.150, "zeta": -59.655, "epsilon_zeta": -84.494, "bb_type": "BI", "chi": -165.551, "glyco_bond": "anti", "C5prime_xyz": [ -1.614, 8.659, 0.836 ], "P_xyz": [ 0.916, 9.223, 0.781 ], "form": ".", "ssZp": 4.453, "Dp": 4.569, "splay_angle": 61.623, "splay_distance": 9.382, "splay_ratio": 0.513, "d22": null, "d64": null, "eta": 169.867, "theta": -84.207, "eta_prime": -177.703, "theta_prime": -80.399, "eta_base": -147.179, "theta_base": -46.945, "v0": -0.839, "v1": -20.985, "v2": 33.539, "v3": -34.955, "v4": 22.616, "amplitude": 35.676, "phase_angle": 19.929, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.751, "filter_rmsd": 0.035, "frame": { "rmsd": 0.013, "origin": [ 261.570, 332.134, 215.979 ], "x_axis": [ -0.032, 0.933, 0.358 ], "y_axis": [ -0.554, -0.314, 0.771 ], "z_axis": [ 0.832, -0.174, 0.528 ], "quaternion": [ 0.543, 0.434, 0.218, 0.684 ] } }, { "index": 269, "index_chain": 269, "chain_name": "J", "nt_resnum": 309, "nt_name": "U", "nt_code": "U", "nt_id": "///J/309", "linked_nts": [ "///J/308", "///J/310" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop", "alpha": 152.632, "beta": -123.158, "gamma": 167.624, "delta": 80.831, "epsilon": -142.895, "zeta": -75.195, "epsilon_zeta": -67.700, "bb_type": "BI", "chi": -164.445, "glyco_bond": "anti", "C5prime_xyz": [ -1.359, 8.705, 0.800 ], "P_xyz": [ 0.415, 9.299, -1.027 ], "form": "A", "ssZp": 4.440, "Dp": 4.609, "splay_angle": 22.839, "splay_distance": 3.745, "splay_ratio": 0.202, "d22": 4.384, "d64": 4.624, "eta": 162.638, "theta": -150.739, "eta_prime": -146.594, "theta_prime": -159.309, "eta_base": -76.446, "theta_base": -142.372, "v0": 1.048, "v1": -23.711, "v2": 36.192, "v3": -36.478, "v4": 22.356, "amplitude": 37.848, "phase_angle": 17.009, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.249, "filter_rmsd": 0.105, "frame": { "rmsd": 0.012, "origin": [ 261.096, 335.139, 224.854 ], "x_axis": [ -0.351, -0.288, 0.891 ], "y_axis": [ 0.160, -0.956, -0.246 ], "z_axis": [ 0.922, 0.056, 0.382 ], "quaternion": [ -0.137, 0.553, -0.058, 0.820 ] } }, { "index": 270, "index_chain": 270, "chain_name": "J", "nt_resnum": 310, "nt_name": "U", "nt_code": "U", "nt_id": "///J/310", "linked_nts": [ "///J/309", "///J/311" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -64.814, "beta": 163.269, "gamma": 64.207, "delta": 76.493, "epsilon": -142.650, "zeta": -67.692, "epsilon_zeta": -74.958, "bb_type": "BI", "chi": -163.243, "glyco_bond": "anti", "C5prime_xyz": [ -1.670, 8.850, 0.656 ], "P_xyz": [ 0.825, 9.599, 0.531 ], "form": "A", "ssZp": 4.396, "Dp": 4.589, "splay_angle": 25.158, "splay_distance": 4.091, "splay_ratio": 0.220, "d22": 3.982, "d64": 4.192, "eta": 169.125, "theta": -140.154, "eta_prime": -176.772, "theta_prime": -139.982, "eta_base": -142.472, "theta_base": -104.667, "v0": -2.926, "v1": -21.918, "v2": 37.077, "v3": -39.662, "v4": 26.865, "amplitude": 40.165, "phase_angle": 22.615, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.750, "filter_rmsd": 0.103, "frame": { "rmsd": 0.012, "origin": [ 263.599, 336.756, 227.122 ], "x_axis": [ -0.296, -0.706, 0.643 ], "y_axis": [ 0.372, -0.706, -0.603 ], "z_axis": [ 0.880, 0.061, 0.471 ], "quaternion": [ -0.343, 0.484, -0.172, 0.786 ] } }, { "index": 271, "index_chain": 271, "chain_name": "J", "nt_resnum": 311, "nt_name": "U", "nt_code": "U", "nt_id": "///J/311", "linked_nts": [ "///J/310", "///J/312" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -70.034, "beta": 166.953, "gamma": 63.870, "delta": 76.854, "epsilon": -158.789, "zeta": -87.161, "epsilon_zeta": -71.628, "bb_type": "BI", "chi": -163.640, "glyco_bond": "anti", "C5prime_xyz": [ -1.650, 8.791, 0.685 ], "P_xyz": [ 0.846, 9.543, 0.513 ], "form": ".", "ssZp": 4.476, "Dp": 4.555, "splay_angle": 32.591, "splay_distance": 5.195, "splay_ratio": 0.284, "d22": null, "d64": null, "eta": 162.614, "theta": -169.781, "eta_prime": -177.554, "theta_prime": -170.619, "eta_base": -123.136, "theta_base": -165.632, "v0": -1.287, "v1": -23.317, "v2": 37.696, "v3": -39.365, "v4": 25.637, "amplitude": 40.199, "phase_angle": 20.324, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.748, "filter_rmsd": 0.102, "frame": { "rmsd": 0.014, "origin": [ 265.654, 335.946, 230.565 ], "x_axis": [ -0.088, -0.993, 0.074 ], "y_axis": [ 0.529, -0.109, -0.842 ], "z_axis": [ 0.844, -0.035, 0.535 ], "quaternion": [ 0.578, -0.349, 0.333, -0.658 ] } }, { "index": 272, "index_chain": 272, "chain_name": "J", "nt_resnum": 312, "nt_name": "G", "nt_code": "G", "nt_id": "///J/312", "linked_nts": [ "///J/311", "///J/313" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -59.843, "beta": 173.688, "gamma": 58.100, "delta": 78.037, "epsilon": -143.402, "zeta": -66.890, "epsilon_zeta": -76.512, "bb_type": "BI", "chi": -168.856, "glyco_bond": "anti", "C5prime_xyz": [ -1.588, 8.768, 1.000 ], "P_xyz": [ 0.886, 9.407, 1.557 ], "form": "A", "ssZp": 4.438, "Dp": 4.570, "splay_angle": 23.475, "splay_distance": 3.732, "splay_ratio": 0.205, "d22": null, "d64": null, "eta": 179.550, "theta": -139.081, "eta_prime": -179.303, "theta_prime": -136.761, "eta_base": -171.119, "theta_base": -94.090, "v0": -1.795, "v1": -22.108, "v2": 36.292, "v3": -38.288, "v4": 25.291, "amplitude": 38.920, "phase_angle": 21.174, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.739, "filter_rmsd": 0.021, "frame": { "rmsd": 0.021, "origin": [ 267.695, 338.193, 234.781 ], "x_axis": [ -0.154, -0.966, -0.209 ], "y_axis": [ 0.466, 0.115, -0.877 ], "z_axis": [ 0.871, -0.232, 0.432 ], "quaternion": [ 0.590, -0.273, 0.458, -0.606 ] } }, { "index": 273, "index_chain": 273, "chain_name": "J", "nt_resnum": 313, "nt_name": "A", "nt_code": "A", "nt_id": "///J/313", "linked_nts": [ "///J/312", "///J/314" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -75.027, "beta": 171.771, "gamma": 63.111, "delta": 79.332, "epsilon": -153.357, "zeta": -78.774, "epsilon_zeta": -74.583, "bb_type": "BI", "chi": -161.193, "glyco_bond": "anti", "C5prime_xyz": [ -1.445, 8.753, 0.594 ], "P_xyz": [ 1.128, 9.248, 0.589 ], "form": ".", "ssZp": 4.403, "Dp": 4.566, "splay_angle": 24.000, "splay_distance": 4.257, "splay_ratio": 0.222, "d22": null, "d64": null, "eta": 161.517, "theta": -121.773, "eta_prime": -178.872, "theta_prime": -131.654, "eta_base": -118.789, "theta_base": -108.555, "v0": 0.682, "v1": -24.497, "v2": 37.671, "v3": -38.157, "v4": 23.674, "amplitude": 39.508, "phase_angle": 17.543, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.774, "filter_rmsd": 0.047, "frame": { "rmsd": 0.017, "origin": [ 269.810, 335.479, 236.227 ], "x_axis": [ 0.156, -0.609, -0.778 ], "y_axis": [ 0.521, 0.720, -0.459 ], "z_axis": [ 0.839, -0.333, 0.430 ], "quaternion": [ 0.759, -0.041, 0.532, -0.372 ] } }, { "index": 274, "index_chain": 274, "chain_name": "J", "nt_resnum": 314, "nt_name": "G", "nt_code": "G", "nt_id": "///J/314", "linked_nts": [ "///J/313", "///J/315" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet", "alpha": 147.593, "beta": -152.936, "gamma": -173.013, "delta": 83.706, "epsilon": -131.843, "zeta": -90.786, "epsilon_zeta": -41.058, "bb_type": "BI", "chi": -179.219, "glyco_bond": "anti", "C5prime_xyz": [ -1.425, 8.531, 1.612 ], "P_xyz": [ 0.191, 10.342, 0.587 ], "form": "A", "ssZp": 4.467, "Dp": 4.561, "splay_angle": 22.187, "splay_distance": 3.540, "splay_ratio": 0.193, "d22": null, "d64": null, "eta": 173.640, "theta": -177.285, "eta_prime": -171.441, "theta_prime": -163.060, "eta_base": -127.504, "theta_base": -146.360, "v0": 0.414, "v1": -22.292, "v2": 34.201, "v3": -34.901, "v4": 21.860, "amplitude": 35.946, "phase_angle": 17.928, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.781, "filter_rmsd": 0.029, "frame": { "rmsd": 0.029, "origin": [ 271.881, 331.791, 236.704 ], "x_axis": [ 0.287, -0.076, -0.955 ], "y_axis": [ 0.413, 0.909, 0.052 ], "z_axis": [ 0.864, -0.409, 0.293 ], "quaternion": [ 0.789, 0.146, 0.576, -0.155 ] } }, { "index": 275, "index_chain": 275, "chain_name": "J", "nt_resnum": 315, "nt_name": "U", "nt_code": "U", "nt_id": "///J/315", "linked_nts": [ "///J/314", "///J/316" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop,splayed-apart", "alpha": -55.272, "beta": 163.996, "gamma": 66.882, "delta": 145.462, "epsilon": -99.849, "zeta": -106.654, "epsilon_zeta": 6.805, "bb_type": "--", "chi": -135.972, "glyco_bond": "anti", "C5prime_xyz": [ -1.819, 8.781, -0.468 ], "P_xyz": [ 0.671, 9.298, 0.110 ], "form": ".", "ssZp": 0.831, "Dp": 0.833, "splay_angle": 167.826, "splay_distance": 18.817, "splay_ratio": 0.994, "d22": null, "d64": null, "eta": -158.930, "theta": -49.316, "eta_prime": -134.430, "theta_prime": -86.332, "eta_base": -123.400, "theta_base": -74.667, "v0": -24.991, "v1": 38.184, "v2": -36.118, "v3": 22.473, "v4": 1.439, "amplitude": 38.627, "phase_angle": 159.238, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1b", "suiteness": 0.615, "filter_rmsd": 0.101, "frame": { "rmsd": 0.020, "origin": [ 273.661, 328.974, 237.899 ], "x_axis": [ 0.323, 0.416, -0.850 ], "y_axis": [ 0.367, 0.773, 0.517 ], "z_axis": [ 0.872, -0.479, 0.098 ], "quaternion": [ 0.741, 0.336, 0.582, 0.017 ] } }, { "index": 276, "index_chain": 276, "chain_name": "J", "nt_resnum": 316, "nt_name": "G", "nt_code": "G", "nt_id": "///J/316", "linked_nts": [ "///J/315", "///J/317" ], "nt_type": "RNA", "dbn": "[", "summary": "pseudoknotted,anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,junction-loop,cap-donor,splayed-apart", "alpha": 83.729, "beta": 143.683, "gamma": -13.457, "delta": 84.011, "epsilon": -162.553, "zeta": -88.509, "epsilon_zeta": -74.044, "bb_type": "BI", "chi": -163.381, "glyco_bond": "anti", "C5prime_xyz": [ -0.903, 8.486, 0.718 ], "P_xyz": [ 1.216, 8.557, 2.254 ], "form": "A", "ssZp": 4.467, "Dp": 4.544, "splay_angle": 25.396, "splay_distance": 3.983, "splay_ratio": 0.223, "d22": null, "d64": null, "eta": -153.454, "theta": -137.844, "eta_prime": -111.900, "theta_prime": -134.640, "eta_base": -96.566, "theta_base": -104.274, "v0": 7.502, "v1": -29.101, "v2": 38.695, "v3": -35.135, "v4": 17.579, "amplitude": 39.048, "phase_angle": 7.704, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.039, "frame": { "rmsd": 0.039, "origin": [ 278.643, 334.623, 255.142 ], "x_axis": [ -0.323, 0.900, -0.294 ], "y_axis": [ -0.092, -0.339, -0.936 ], "z_axis": [ -0.942, -0.275, 0.192 ], "quaternion": [ 0.364, -0.454, -0.445, 0.681 ] } }, { "index": 277, "index_chain": 277, "chain_name": "J", "nt_resnum": 317, "nt_name": "G", "nt_code": "G", "nt_id": "///J/317", "linked_nts": [ "///J/316", "///J/318" ], "nt_type": "RNA", "dbn": "[", "summary": "pseudoknotted,anti,~C3'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack,A-minor", "alpha": 164.202, "beta": -136.293, "gamma": 161.200, "delta": 82.474, "epsilon": -122.436, "zeta": -85.164, "epsilon_zeta": -37.271, "bb_type": "--", "chi": 179.444, "glyco_bond": "anti", "C5prime_xyz": [ -1.191, 8.363, 1.777 ], "P_xyz": [ 1.128, 9.162, 0.890 ], "form": "A", "ssZp": 4.555, "Dp": 4.635, "splay_angle": 23.526, "splay_distance": 3.791, "splay_ratio": 0.206, "d22": null, "d64": null, "eta": 171.958, "theta": -143.484, "eta_prime": -170.930, "theta_prime": -143.884, "eta_base": -127.225, "theta_base": -123.601, "v0": 3.532, "v1": -25.016, "v2": 36.079, "v3": -34.853, "v4": 19.786, "amplitude": 37.061, "phase_angle": 13.223, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.282, "filter_rmsd": 0.041, "frame": { "rmsd": 0.041, "origin": [ 275.087, 335.327, 256.795 ], "x_axis": [ -0.281, 0.565, -0.776 ], "y_axis": [ 0.090, -0.789, -0.607 ], "z_axis": [ -0.956, -0.240, 0.171 ], "quaternion": [ 0.159, -0.578, -0.283, 0.748 ] } }, { "index": 278, "index_chain": 278, "chain_name": "J", "nt_resnum": 318, "nt_name": "A", "nt_code": "A", "nt_id": "///J/318", "linked_nts": [ "///J/317", "///J/319" ], "nt_type": "RNA", "dbn": "[", "summary": "pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop", "alpha": -51.458, "beta": 162.145, "gamma": 49.077, "delta": 82.091, "epsilon": -144.845, "zeta": -87.420, "epsilon_zeta": -57.425, "bb_type": "BI", "chi": -162.503, "glyco_bond": "anti", "C5prime_xyz": [ -1.741, 8.794, 0.568 ], "P_xyz": [ 0.760, 9.402, 0.990 ], "form": ".", "ssZp": 4.242, "Dp": 4.401, "splay_angle": 35.216, "splay_distance": 5.291, "splay_ratio": 0.313, "d22": null, "d64": null, "eta": 166.552, "theta": -120.177, "eta_prime": -176.542, "theta_prime": -132.248, "eta_base": -140.702, "theta_base": -61.631, "v0": -6.295, "v1": -16.801, "v2": 32.051, "v3": -36.507, "v4": 26.962, "amplitude": 36.379, "phase_angle": 28.232, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.514, "filter_rmsd": 0.055, "frame": { "rmsd": 0.033, "origin": [ 271.552, 336.208, 257.843 ], "x_axis": [ -0.058, 0.095, -0.994 ], "y_axis": [ 0.189, -0.976, -0.105 ], "z_axis": [ -0.980, -0.194, 0.039 ], "quaternion": [ -0.033, -0.685, -0.104, 0.720 ] } }, { "index": 279, "index_chain": 279, "chain_name": "J", "nt_resnum": 319, "nt_name": "U", "nt_code": "U", "nt_id": "///J/319", "linked_nts": [ "///J/318", "///J/320" ], "nt_type": "RNA", "dbn": ".", "summary": "syn,~C3'-endo,BI,non-canonical,non-pair-contact,helix,junction-loop", "alpha": 128.412, "beta": -149.597, "gamma": -164.855, "delta": 80.759, "epsilon": -141.957, "zeta": -71.158, "epsilon_zeta": -70.798, "bb_type": "BI", "chi": 5.669, "glyco_bond": "syn", "C5prime_xyz": [ -5.360, 4.205, -1.346 ], "P_xyz": [ -7.212, 2.888, -0.017 ], "form": ".", "ssZp": -4.655, "Dp": 4.642, "splay_angle": 44.665, "splay_distance": 6.835, "splay_ratio": 0.382, "d22": null, "d64": null, "eta": 163.128, "theta": -174.233, "eta_prime": 177.456, "theta_prime": -166.674, "eta_base": -86.027, "theta_base": 176.113, "v0": 1.044, "v1": -23.970, "v2": 36.445, "v3": -36.803, "v4": 22.617, "amplitude": 38.121, "phase_angle": 17.053, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.247, "filter_rmsd": 0.099, "frame": { "rmsd": 0.028, "origin": [ 268.727, 332.934, 254.794 ], "x_axis": [ -0.086, 0.881, -0.465 ], "y_axis": [ -0.119, 0.454, 0.883 ], "z_axis": [ 0.989, 0.131, 0.066 ], "quaternion": [ 0.599, 0.314, 0.607, 0.418 ] } }, { "index": 280, "index_chain": 280, "chain_name": "J", "nt_resnum": 320, "nt_name": "A", "nt_code": "A", "nt_id": "///J/320", "linked_nts": [ "///J/319", "///J/321" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,junction-loop", "alpha": -80.077, "beta": 168.656, "gamma": 74.053, "delta": 77.963, "epsilon": -134.961, "zeta": -81.406, "epsilon_zeta": -53.555, "bb_type": "BI", "chi": -168.008, "glyco_bond": "anti", "C5prime_xyz": [ -1.455, 8.626, 0.983 ], "P_xyz": [ 1.059, 9.219, 0.751 ], "form": "A", "ssZp": 4.532, "Dp": 4.689, "splay_angle": 23.750, "splay_distance": 3.703, "splay_ratio": 0.207, "d22": null, "d64": null, "eta": 169.561, "theta": -147.447, "eta_prime": -174.997, "theta_prime": -147.195, "eta_base": 177.022, "theta_base": -120.410, "v0": 2.610, "v1": -26.229, "v2": 38.720, "v3": -38.114, "v4": 22.427, "amplitude": 40.067, "phase_angle": 14.897, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.325, "filter_rmsd": 0.049, "frame": { "rmsd": 0.026, "origin": [ 264.217, 338.066, 254.584 ], "x_axis": [ 0.110, -0.832, -0.543 ], "y_axis": [ 0.009, -0.546, 0.838 ], "z_axis": [ -0.994, -0.098, -0.052 ], "quaternion": [ 0.358, 0.654, -0.315, -0.588 ] } }, { "index": 281, "index_chain": 281, "chain_name": "J", "nt_resnum": 321, "nt_name": "A", "nt_code": "A", "nt_id": "///J/321", "linked_nts": [ "///J/320", "///J/322" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,junction-loop", "alpha": -66.990, "beta": 162.849, "gamma": 63.296, "delta": 79.664, "epsilon": -128.210, "zeta": -57.577, "epsilon_zeta": -70.634, "bb_type": "BI", "chi": -164.946, "glyco_bond": "anti", "C5prime_xyz": [ -1.390, 8.613, 0.819 ], "P_xyz": [ 1.155, 9.072, 0.488 ], "form": ".", "ssZp": 4.530, "Dp": 4.761, "splay_angle": 41.378, "splay_distance": 6.378, "splay_ratio": 0.354, "d22": null, "d64": null, "eta": 168.716, "theta": -115.683, "eta_prime": -179.399, "theta_prime": -110.553, "eta_base": -139.195, "theta_base": -69.832, "v0": 3.755, "v1": -27.207, "v2": 38.952, "v3": -37.766, "v4": 21.459, "amplitude": 40.020, "phase_angle": 13.266, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.723, "filter_rmsd": 0.046, "frame": { "rmsd": 0.024, "origin": [ 261.055, 337.540, 252.729 ], "x_axis": [ 0.172, -0.985, 0.016 ], "y_axis": [ -0.145, -0.009, 0.989 ], "z_axis": [ -0.974, -0.172, -0.144 ], "quaternion": [ 0.505, 0.575, -0.491, -0.416 ] } }, { "index": 282, "index_chain": 282, "chain_name": "J", "nt_resnum": 322, "nt_name": "A", "nt_code": "A", "nt_id": "///J/322", "linked_nts": [ "///J/321", "///J/323" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop", "alpha": -69.540, "beta": 155.877, "gamma": 79.653, "delta": 79.161, "epsilon": -136.116, "zeta": -87.195, "epsilon_zeta": -48.921, "bb_type": "BI", "chi": -171.599, "glyco_bond": "anti", "C5prime_xyz": [ -1.492, 8.589, 1.210 ], "P_xyz": [ 1.031, 9.128, 0.713 ], "form": "A", "ssZp": 4.606, "Dp": 4.688, "splay_angle": 23.019, "splay_distance": 3.662, "splay_ratio": 0.202, "d22": null, "d64": null, "eta": 169.107, "theta": -148.114, "eta_prime": -157.473, "theta_prime": -149.639, "eta_base": -88.256, "theta_base": -130.223, "v0": 1.200, "v1": -24.548, "v2": 37.335, "v3": -37.453, "v4": 22.966, "amplitude": 38.998, "phase_angle": 16.791, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.110, "filter_rmsd": 0.049, "frame": { "rmsd": 0.028, "origin": [ 258.397, 331.958, 254.293 ], "x_axis": [ -0.008, -0.456, 0.890 ], "y_axis": [ -0.276, 0.857, 0.436 ], "z_axis": [ -0.961, -0.242, -0.133 ], "quaternion": [ 0.655, 0.259, -0.707, -0.069 ] } }, { "index": 283, "index_chain": 283, "chain_name": "J", "nt_resnum": 323, "nt_name": "A", "nt_code": "A", "nt_id": "///J/323", "linked_nts": [ "///J/322", "///J/324" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -49.928, "beta": 156.427, "gamma": 54.478, "delta": 78.932, "epsilon": -147.777, "zeta": -79.437, "epsilon_zeta": -68.340, "bb_type": "BI", "chi": -163.438, "glyco_bond": "anti", "C5prime_xyz": [ -1.630, 8.768, 0.719 ], "P_xyz": [ 0.925, 9.274, 0.836 ], "form": "A", "ssZp": 4.378, "Dp": 4.551, "splay_angle": 22.517, "splay_distance": 3.575, "splay_ratio": 0.196, "d22": null, "d64": null, "eta": 171.220, "theta": -148.859, "eta_prime": -174.952, "theta_prime": -148.783, "eta_base": -140.333, "theta_base": -120.162, "v0": -1.936, "v1": -21.780, "v2": 35.932, "v3": -37.885, "v4": 25.206, "amplitude": 38.582, "phase_angle": 21.359, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.618, "filter_rmsd": 0.051, "frame": { "rmsd": 0.026, "origin": [ 255.809, 329.472, 253.559 ], "x_axis": [ -0.096, 0.045, 0.994 ], "y_axis": [ -0.301, 0.951, -0.072 ], "z_axis": [ -0.949, -0.306, -0.078 ], "quaternion": [ 0.666, 0.088, -0.729, 0.130 ] } }, { "index": 284, "index_chain": 284, "chain_name": "J", "nt_resnum": 324, "nt_name": "A", "nt_code": "A", "nt_id": "///J/324", "linked_nts": [ "///J/323", "///J/325" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -55.886, "beta": 162.746, "gamma": 56.770, "delta": 80.132, "epsilon": -171.768, "zeta": -87.659, "epsilon_zeta": -84.109, "bb_type": "BI", "chi": -158.462, "glyco_bond": "anti", "C5prime_xyz": [ -1.345, 8.794, 0.492 ], "P_xyz": [ 1.225, 9.159, 0.684 ], "form": "A", "ssZp": 4.116, "Dp": 4.283, "splay_angle": 21.482, "splay_distance": 3.438, "splay_ratio": 0.187, "d22": null, "d64": null, "eta": 171.619, "theta": -139.750, "eta_prime": -171.922, "theta_prime": -146.629, "eta_base": -128.743, "theta_base": -119.758, "v0": -1.961, "v1": -20.297, "v2": 33.669, "v3": -35.690, "v4": 23.882, "amplitude": 36.237, "phase_angle": 21.700, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.856, "filter_rmsd": 0.050, "frame": { "rmsd": 0.026, "origin": [ 252.939, 327.421, 254.137 ], "x_axis": [ -0.195, 0.592, 0.782 ], "y_axis": [ -0.242, 0.744, -0.623 ], "z_axis": [ -0.951, -0.310, -0.002 ], "quaternion": [ 0.622, -0.126, -0.697, 0.335 ] } }, { "index": 285, "index_chain": 285, "chain_name": "J", "nt_resnum": 325, "nt_name": "A", "nt_code": "A", "nt_id": "///J/325", "linked_nts": [ "///J/324", "///J/326" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": 164.160, "beta": -140.757, "gamma": 158.497, "delta": 82.119, "epsilon": -131.457, "zeta": -104.470, "epsilon_zeta": -26.987, "bb_type": "--", "chi": -172.018, "glyco_bond": "anti", "C5prime_xyz": [ -1.245, 8.556, 1.334 ], "P_xyz": [ 1.072, 9.236, 0.365 ], "form": "A", "ssZp": 4.350, "Dp": 4.534, "splay_angle": 21.802, "splay_distance": 3.670, "splay_ratio": 0.193, "d22": null, "d64": null, "eta": 165.181, "theta": -129.988, "eta_prime": -178.533, "theta_prime": -140.029, "eta_base": -134.485, "theta_base": -114.050, "v0": 0.295, "v1": -21.564, "v2": 33.575, "v3": -34.308, "v4": 21.478, "amplitude": 35.338, "phase_angle": 18.177, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.244, "filter_rmsd": 0.053, "frame": { "rmsd": 0.029, "origin": [ 250.021, 325.894, 255.124 ], "x_axis": [ -0.289, 0.904, 0.315 ], "y_axis": [ -0.149, 0.283, -0.948 ], "z_axis": [ -0.946, -0.321, 0.053 ], "quaternion": [ 0.511, -0.306, -0.616, 0.515 ] } }, { "index": 286, "index_chain": 286, "chain_name": "J", "nt_resnum": 326, "nt_name": "C", "nt_code": "C", "nt_id": "///J/326", "linked_nts": [ "///J/325", "///J/327" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": 131.040, "beta": -126.356, "gamma": -172.726, "delta": 81.163, "epsilon": -124.469, "zeta": -75.420, "epsilon_zeta": -49.049, "bb_type": "--", "chi": -176.620, "glyco_bond": "anti", "C5prime_xyz": [ -1.415, 8.611, 1.493 ], "P_xyz": [ 0.460, 9.868, 0.214 ], "form": "A", "ssZp": 4.308, "Dp": 4.504, "splay_angle": 21.507, "splay_distance": 3.514, "splay_ratio": 0.187, "d22": 4.192, "d64": 3.936, "eta": 165.847, "theta": -150.779, "eta_prime": -174.536, "theta_prime": -149.033, "eta_base": -127.630, "theta_base": -111.763, "v0": -1.220, "v1": -21.263, "v2": 34.506, "v3": -36.082, "v4": 23.527, "amplitude": 36.823, "phase_angle": 20.434, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.030, "filter_rmsd": 0.073, "frame": { "rmsd": 0.026, "origin": [ 246.844, 325.699, 256.950 ], "x_axis": [ -0.312, 0.915, -0.258 ], "y_axis": [ -0.060, -0.290, -0.955 ], "z_axis": [ -0.948, -0.282, 0.145 ], "quaternion": [ 0.369, -0.456, -0.468, 0.661 ] } }, { "index": 287, "index_chain": 287, "chain_name": "J", "nt_resnum": 327, "nt_name": "U", "nt_code": "U", "nt_id": "///J/327", "linked_nts": [ "///J/326", "///J/328" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop", "alpha": -58.547, "beta": 162.296, "gamma": 51.479, "delta": 79.850, "epsilon": -117.883, "zeta": -139.613, "epsilon_zeta": 21.730, "bb_type": "--", "chi": -154.826, "glyco_bond": "anti", "C5prime_xyz": [ -1.750, 8.825, 0.167 ], "P_xyz": [ 0.769, 9.499, 0.220 ], "form": ".", "ssZp": 3.916, "Dp": 4.566, "splay_angle": 43.303, "splay_distance": 7.056, "splay_ratio": 0.369, "d22": null, "d64": null, "eta": 165.457, "theta": -153.541, "eta_prime": -176.321, "theta_prime": -136.610, "eta_base": -126.353, "theta_base": -141.370, "v0": -2.539, "v1": -20.992, "v2": 35.177, "v3": -37.548, "v4": 25.339, "amplitude": 38.025, "phase_angle": 22.314, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.648, "filter_rmsd": 0.103, "frame": { "rmsd": 0.027, "origin": [ 243.460, 326.263, 257.709 ], "x_axis": [ -0.238, 0.544, -0.804 ], "y_axis": [ 0.050, -0.820, -0.570 ], "z_axis": [ -0.970, -0.176, 0.168 ], "quaternion": [ 0.166, -0.595, -0.250, 0.746 ] } }, { "index": 288, "index_chain": 288, "chain_name": "J", "nt_resnum": 328, "nt_name": "A", "nt_code": "A", "nt_id": "///J/328", "linked_nts": [ "///J/327", "///J/329" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C2'-endo,non-canonical,non-pair-contact,helix,multiplet,hairpin-loop", "alpha": 36.803, "beta": 138.803, "gamma": 3.384, "delta": 142.460, "epsilon": -109.860, "zeta": -142.509, "epsilon_zeta": 32.649, "bb_type": "--", "chi": -73.471, "glyco_bond": "anti", "C5prime_xyz": [ -3.528, 7.040, -2.787 ], "P_xyz": [ -1.661, 8.627, -3.681 ], "form": ".", "ssZp": 1.055, "Dp": 1.212, "splay_angle": 29.126, "splay_distance": 4.987, "splay_ratio": 0.255, "d22": null, "d64": null, "eta": -149.962, "theta": -127.469, "eta_prime": -143.693, "theta_prime": -160.138, "eta_base": -157.778, "theta_base": -96.693, "v0": -26.410, "v1": 37.569, "v2": -33.619, "v3": 19.371, "v4": 4.211, "amplitude": 37.173, "phase_angle": 154.741, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.050, "frame": { "rmsd": 0.027, "origin": [ 236.940, 324.930, 260.056 ], "x_axis": [ -0.100, 0.588, -0.803 ], "y_axis": [ -0.000, -0.807, -0.591 ], "z_axis": [ -0.995, -0.059, 0.081 ], "quaternion": [ 0.209, -0.637, -0.231, 0.705 ] } }, { "index": 289, "index_chain": 289, "chain_name": "J", "nt_resnum": 329, "nt_name": "A", "nt_code": "A", "nt_id": "///J/329", "linked_nts": [ "///J/328", "///J/330" ], "nt_type": "RNA", "dbn": ".", "summary": "syn,non-canonical,non-pair-contact,helix-end,multiplet,hairpin-loop", "alpha": 40.532, "beta": -120.783, "gamma": -144.656, "delta": 110.416, "epsilon": -98.587, "zeta": -71.275, "epsilon_zeta": -27.312, "bb_type": "--", "chi": 77.829, "glyco_bond": "syn", "C5prime_xyz": [ -5.562, 5.705, 1.648 ], "P_xyz": [ -5.573, 6.257, 4.193 ], "form": ".", "ssZp": -1.998, "Dp": 2.074, "splay_angle": 76.234, "splay_distance": 12.660, "splay_ratio": 0.618, "d22": null, "d64": null, "eta": 169.698, "theta": -67.571, "eta_prime": 160.061, "theta_prime": -89.067, "eta_base": -130.998, "theta_base": -118.560, "v0": -34.431, "v1": 27.101, "v2": -10.211, "v3": -9.164, "v4": 27.471, "amplitude": 33.491, "phase_angle": 107.751, "puckering": "O4'-endo", "sugar_class": "--", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.075, "frame": { "rmsd": 0.061, "origin": [ 233.442, 323.210, 256.945 ], "x_axis": [ 0.167, 0.867, 0.470 ], "y_axis": [ -0.031, -0.472, 0.881 ], "z_axis": [ 0.986, -0.161, -0.051 ], "quaternion": [ 0.401, 0.650, 0.321, 0.560 ] } }, { "index": 290, "index_chain": 290, "chain_name": "J", "nt_resnum": 330, "nt_name": "A", "nt_code": "A", "nt_id": "///J/330", "linked_nts": [ "///J/329", "///J/331" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-pair-contact,hairpin-loop", "alpha": 89.931, "beta": 84.568, "gamma": -167.183, "delta": 93.628, "epsilon": -118.534, "zeta": -82.897, "epsilon_zeta": -35.637, "bb_type": "--", "chi": 173.136, "glyco_bond": "anti", "C5prime_xyz": [ -0.813, 7.640, 2.186 ], "P_xyz": [ -0.678, 10.270, 2.307 ], "form": ".", "ssZp": 4.712, "Dp": 4.746, "splay_angle": 32.077, "splay_distance": 4.718, "splay_ratio": 0.277, "d22": null, "d64": null, "eta": 13.710, "theta": -155.733, "eta_prime": 47.619, "theta_prime": -149.409, "eta_base": 72.873, "theta_base": -75.367, "v0": 13.783, "v1": -27.851, "v2": 30.697, "v3": -23.718, "v4": 6.394, "amplitude": 30.924, "phase_angle": 353.047, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.041, "frame": { "rmsd": 0.017, "origin": [ 225.709, 315.368, 250.702 ], "x_axis": [ -0.520, 0.816, 0.253 ], "y_axis": [ 0.212, -0.163, 0.964 ], "z_axis": [ 0.827, 0.555, -0.088 ], "quaternion": [ 0.239, 0.427, 0.601, 0.632 ] } }, { "index": 291, "index_chain": 291, "chain_name": "J", "nt_resnum": 331, "nt_name": "A", "nt_code": "A", "nt_id": "///J/331", "linked_nts": [ "///J/330", "///J/332" ], "nt_type": "RNA", "dbn": ".", "summary": "syn,~C3'-endo,non-pair-contact,hairpin-loop", "alpha": 116.323, "beta": -145.167, "gamma": -141.969, "delta": 79.227, "epsilon": -127.508, "zeta": -14.724, "epsilon_zeta": -112.784, "bb_type": "--", "chi": -16.686, "glyco_bond": "syn", "C5prime_xyz": [ -5.081, 4.543, -2.198 ], "P_xyz": [ -7.376, 3.354, -1.860 ], "form": ".", "ssZp": -4.525, "Dp": 4.647, "splay_angle": 22.856, "splay_distance": 3.565, "splay_ratio": 0.207, "d22": null, "d64": null, "eta": 169.391, "theta": -128.923, "eta_prime": -171.016, "theta_prime": -127.766, "eta_base": -84.927, "theta_base": -74.074, "v0": -2.910, "v1": -21.083, "v2": 35.567, "v3": -38.256, "v4": 25.975, "amplitude": 38.587, "phase_angle": 22.819, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.047, "frame": { "rmsd": 0.019, "origin": [ 227.299, 319.393, 252.580 ], "x_axis": [ -0.371, 0.601, -0.708 ], "y_axis": [ 0.374, -0.601, -0.706 ], "z_axis": [ -0.850, -0.527, -0.002 ], "quaternion": [ 0.081, -0.555, -0.439, 0.702 ] } }, { "index": 292, "index_chain": 292, "chain_name": "J", "nt_resnum": 332, "nt_name": "C", "nt_code": "C", "nt_id": "///J/332", "linked_nts": [ "///J/331", "///J/333" ], "nt_type": "RNA", "dbn": ".", "summary": "~C3'-endo,BI,non-pair-contact,hairpin-loop", "alpha": -141.516, "beta": 123.450, "gamma": 141.563, "delta": 76.684, "epsilon": -150.865, "zeta": -36.882, "epsilon_zeta": -113.983, "bb_type": "BI", "chi": -27.257, "glyco_bond": "--", "C5prime_xyz": [ -4.713, 5.060, -2.590 ], "P_xyz": [ -6.870, 3.695, -2.045 ], "form": ".", "ssZp": -4.022, "Dp": 4.666, "splay_angle": 21.626, "splay_distance": 3.355, "splay_ratio": 0.188, "d22": null, "d64": null, "eta": 150.339, "theta": -125.398, "eta_prime": -176.090, "theta_prime": -115.627, "eta_base": -94.974, "theta_base": -106.789, "v0": 4.348, "v1": -29.191, "v2": 41.624, "v3": -40.100, "v4": 22.549, "amplitude": 42.685, "phase_angle": 12.802, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.074, "frame": { "rmsd": 0.021, "origin": [ 230.390, 320.487, 253.980 ], "x_axis": [ -0.394, 0.911, 0.119 ], "y_axis": [ 0.015, 0.136, -0.991 ], "z_axis": [ -0.919, -0.388, -0.067 ], "quaternion": [ -0.411, 0.367, 0.632, -0.546 ] } }, { "index": 293, "index_chain": 293, "chain_name": "J", "nt_resnum": 333, "nt_name": "A", "nt_code": "A", "nt_id": "///J/333", "linked_nts": [ "///J/332", "///J/334" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C2'-endo,BI,non-canonical,non-pair-contact,multiplet,hairpin-loop", "alpha": -139.396, "beta": -124.605, "gamma": 81.015, "delta": 154.754, "epsilon": -171.312, "zeta": -104.794, "epsilon_zeta": -66.518, "bb_type": "BI", "chi": -115.736, "glyco_bond": "anti", "C5prime_xyz": [ -1.975, 8.559, -1.122 ], "P_xyz": [ 0.519, 8.835, -0.246 ], "form": ".", "ssZp": 2.809, "Dp": 2.406, "splay_angle": 26.822, "splay_distance": 4.527, "splay_ratio": 0.237, "d22": null, "d64": null, "eta": 133.386, "theta": -112.355, "eta_prime": -169.615, "theta_prime": -140.397, "eta_base": -137.212, "theta_base": -96.030, "v0": -23.888, "v1": 42.535, "v2": -42.957, "v3": 30.053, "v4": -3.690, "amplitude": 44.250, "phase_angle": 166.116, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.057, "frame": { "rmsd": 0.035, "origin": [ 232.977, 322.438, 254.851 ], "x_axis": [ 0.288, -0.954, 0.088 ], "y_axis": [ 0.220, -0.024, -0.975 ], "z_axis": [ 0.932, 0.300, 0.203 ], "quaternion": [ 0.606, -0.527, 0.348, -0.484 ] } }, { "index": 294, "index_chain": 294, "chain_name": "J", "nt_resnum": 334, "nt_name": "U", "nt_code": "U", "nt_id": "///J/334", "linked_nts": [ "///J/333", "///J/335" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,hairpin-loop,phosphate", "alpha": -79.641, "beta": 172.968, "gamma": 56.059, "delta": 74.419, "epsilon": -149.996, "zeta": -77.271, "epsilon_zeta": -72.725, "bb_type": "BI", "chi": -157.434, "glyco_bond": "anti", "C5prime_xyz": [ -1.718, 8.967, 0.181 ], "P_xyz": [ 0.663, 9.995, 0.470 ], "form": "A", "ssZp": 4.067, "Dp": 4.420, "splay_angle": 20.019, "splay_distance": 3.404, "splay_ratio": 0.178, "d22": null, "d64": null, "eta": 160.577, "theta": -156.478, "eta_prime": 169.599, "theta_prime": -148.551, "eta_base": -123.839, "theta_base": -142.886, "v0": -7.238, "v1": -18.722, "v2": 36.138, "v3": -41.186, "v4": 30.570, "amplitude": 41.104, "phase_angle": 28.454, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.115, "frame": { "rmsd": 0.034, "origin": [ 237.314, 321.957, 256.059 ], "x_axis": [ 0.252, -0.713, -0.654 ], "y_axis": [ -0.219, 0.616, -0.757 ], "z_axis": [ 0.943, 0.334, -0.000 ], "quaternion": [ 0.683, -0.399, 0.584, -0.181 ] } }, { "index": 295, "index_chain": 295, "chain_name": "J", "nt_resnum": 335, "nt_name": "A", "nt_code": "A", "nt_id": "///J/335", "linked_nts": [ "///J/334", "///J/336" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C2'-endo,BII,non-canonical,non-pair-contact,helix,hairpin-loop", "alpha": -59.031, "beta": 174.454, "gamma": 58.485, "delta": 133.792, "epsilon": -126.400, "zeta": 156.076, "epsilon_zeta": 77.523, "bb_type": "BII", "chi": -131.523, "glyco_bond": "anti", "C5prime_xyz": [ -2.486, 8.740, -0.773 ], "P_xyz": [ -0.204, 9.931, -0.306 ], "form": ".", "ssZp": 2.170, "Dp": 1.880, "splay_angle": 42.247, "splay_distance": 6.748, "splay_ratio": 0.366, "d22": null, "d64": null, "eta": -174.971, "theta": 136.592, "eta_prime": -154.337, "theta_prime": 126.866, "eta_base": -147.152, "theta_base": 137.255, "v0": -32.166, "v1": 39.237, "v2": -31.147, "v3": 13.393, "v4": 11.739, "amplitude": 38.519, "phase_angle": 143.960, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1b", "suiteness": 0.541, "filter_rmsd": 0.053, "frame": { "rmsd": 0.029, "origin": [ 240.385, 321.980, 257.525 ], "x_axis": [ -0.176, -0.559, -0.810 ], "y_axis": [ -0.147, 0.829, -0.540 ], "z_axis": [ 0.973, 0.024, -0.228 ], "quaternion": [ 0.597, -0.236, 0.747, -0.173 ] } }, { "index": 296, "index_chain": 296, "chain_name": "J", "nt_resnum": 336, "nt_name": "A", "nt_code": "A", "nt_id": "///J/336", "linked_nts": [ "///J/335", "///J/337" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,hairpin-loop,A-minor", "alpha": -84.482, "beta": 153.664, "gamma": 25.844, "delta": 84.274, "epsilon": -149.227, "zeta": -68.876, "epsilon_zeta": -80.352, "bb_type": "BI", "chi": -171.964, "glyco_bond": "anti", "C5prime_xyz": [ -1.084, 8.434, 1.314 ], "P_xyz": [ 1.301, 8.148, 2.373 ], "form": ".", "ssZp": 4.548, "Dp": 4.583, "splay_angle": 34.488, "splay_distance": 5.382, "splay_ratio": 0.298, "d22": null, "d64": null, "eta": 156.681, "theta": -99.632, "eta_prime": 146.184, "theta_prime": -102.936, "eta_base": 153.494, "theta_base": -54.633, "v0": 4.618, "v1": -24.861, "v2": 34.635, "v3": -32.793, "v4": 17.891, "amplitude": 35.314, "phase_angle": 11.250, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "0a", "suiteness": 0.124, "filter_rmsd": 0.049, "frame": { "rmsd": 0.028, "origin": [ 240.151, 325.568, 263.236 ], "x_axis": [ 0.063, -0.572, -0.818 ], "y_axis": [ -0.026, 0.818, -0.574 ], "z_axis": [ 0.998, 0.057, 0.037 ], "quaternion": [ 0.692, -0.228, 0.656, -0.197 ] } }, { "index": 297, "index_chain": 297, "chain_name": "J", "nt_resnum": 337, "nt_name": "G", "nt_code": "G", "nt_id": "///J/337", "linked_nts": [ "///J/336", "///J/338" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop", "alpha": 159.676, "beta": -141.779, "gamma": 154.616, "delta": 78.854, "epsilon": -117.930, "zeta": -83.621, "epsilon_zeta": -34.309, "bb_type": "--", "chi": 176.364, "glyco_bond": "anti", "C5prime_xyz": [ -1.263, 8.354, 1.918 ], "P_xyz": [ 1.106, 9.180, 1.164 ], "form": "A", "ssZp": 4.671, "Dp": 4.736, "splay_angle": 27.235, "splay_distance": 4.238, "splay_ratio": 0.237, "d22": null, "d64": null, "eta": 151.765, "theta": -135.830, "eta_prime": -175.350, "theta_prime": -134.512, "eta_base": -95.496, "theta_base": -92.807, "v0": 3.837, "v1": -26.894, "v2": 38.710, "v3": -37.354, "v4": 21.170, "amplitude": 39.750, "phase_angle": 13.132, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.159, "filter_rmsd": 0.035, "frame": { "rmsd": 0.035, "origin": [ 243.728, 324.433, 259.379 ], "x_axis": [ -0.074, 0.442, -0.894 ], "y_axis": [ -0.055, 0.893, 0.447 ], "z_axis": [ 0.996, 0.082, -0.042 ], "quaternion": [ 0.666, 0.137, 0.709, 0.186 ] } }, { "index": 298, "index_chain": 298, "chain_name": "J", "nt_resnum": 338, "nt_name": "G", "nt_code": "G", "nt_id": "///J/338", "linked_nts": [ "///J/337", "///J/339" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -40.807, "beta": 152.644, "gamma": 48.906, "delta": 79.511, "epsilon": -149.044, "zeta": -70.684, "epsilon_zeta": -78.360, "bb_type": "BI", "chi": -165.937, "glyco_bond": "anti", "C5prime_xyz": [ -1.462, 8.774, 0.887 ], "P_xyz": [ 1.123, 9.020, 1.259 ], "form": "A", "ssZp": 4.355, "Dp": 4.526, "splay_angle": 22.817, "splay_distance": 3.700, "splay_ratio": 0.200, "d22": null, "d64": null, "eta": 164.332, "theta": -141.730, "eta_prime": -171.752, "theta_prime": -142.768, "eta_base": -107.783, "theta_base": -121.702, "v0": -0.117, "v1": -22.984, "v2": 36.159, "v3": -37.093, "v4": 23.539, "amplitude": 38.184, "phase_angle": 18.744, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.267, "filter_rmsd": 0.032, "frame": { "rmsd": 0.032, "origin": [ 246.993, 325.411, 256.860 ], "x_axis": [ -0.139, 0.952, -0.273 ], "y_axis": [ 0.021, 0.278, 0.960 ], "z_axis": [ 0.990, 0.128, -0.059 ], "quaternion": [ 0.520, 0.400, 0.608, 0.448 ] } }, { "index": 299, "index_chain": 299, "chain_name": "J", "nt_resnum": 339, "nt_name": "U", "nt_code": "U", "nt_id": "///J/339", "linked_nts": [ "///J/338", "///J/340" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -79.215, "beta": 166.967, "gamma": 78.179, "delta": 77.900, "epsilon": -136.294, "zeta": -76.175, "epsilon_zeta": -60.119, "bb_type": "BI", "chi": -163.864, "glyco_bond": "anti", "C5prime_xyz": [ -1.642, 8.825, 0.636 ], "P_xyz": [ 0.879, 9.478, 0.503 ], "form": "A", "ssZp": 4.190, "Dp": 4.531, "splay_angle": 20.484, "splay_distance": 3.326, "splay_ratio": 0.178, "d22": 4.306, "d64": 4.162, "eta": 172.379, "theta": -143.761, "eta_prime": -173.158, "theta_prime": -145.756, "eta_base": -137.349, "theta_base": -114.604, "v0": -3.078, "v1": -21.653, "v2": 36.792, "v3": -39.396, "v4": 26.769, "amplitude": 39.909, "phase_angle": 22.796, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.181, "filter_rmsd": 0.101, "frame": { "rmsd": 0.024, "origin": [ 250.147, 325.850, 254.978 ], "x_axis": [ -0.117, 0.962, 0.245 ], "y_axis": [ 0.147, -0.228, 0.963 ], "z_axis": [ 0.982, 0.149, -0.115 ], "quaternion": [ 0.368, 0.554, 0.501, 0.554 ] } }, { "index": 300, "index_chain": 300, "chain_name": "J", "nt_resnum": 340, "nt_name": "U", "nt_code": "U", "nt_id": "///J/340", "linked_nts": [ "///J/339", "///J/341" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -75.995, "beta": 155.038, "gamma": 76.419, "delta": 78.084, "epsilon": -141.164, "zeta": -81.610, "epsilon_zeta": -59.555, "bb_type": "BI", "chi": -159.625, "glyco_bond": "anti", "C5prime_xyz": [ -1.624, 8.819, 0.457 ], "P_xyz": [ 0.808, 9.422, -0.275 ], "form": "A", "ssZp": 4.305, "Dp": 4.606, "splay_angle": 22.607, "splay_distance": 3.633, "splay_ratio": 0.197, "d22": 4.170, "d64": 4.032, "eta": 162.880, "theta": -149.326, "eta_prime": -179.813, "theta_prime": -152.373, "eta_base": -132.285, "theta_base": -126.272, "v0": -1.806, "v1": -22.709, "v2": 37.183, "v3": -39.100, "v4": 25.830, "amplitude": 39.839, "phase_angle": 21.043, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.226, "filter_rmsd": 0.096, "frame": { "rmsd": 0.025, "origin": [ 252.895, 327.485, 254.062 ], "x_axis": [ -0.002, 0.682, 0.731 ], "y_axis": [ 0.331, -0.689, 0.644 ], "z_axis": [ 0.944, 0.243, -0.225 ], "quaternion": [ 0.145, 0.691, 0.366, 0.605 ] } }, { "index": 301, "index_chain": 301, "chain_name": "J", "nt_resnum": 341, "nt_name": "U", "nt_code": "U", "nt_id": "///J/341", "linked_nts": [ "///J/340", "///J/342" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -61.606, "beta": 158.675, "gamma": 61.042, "delta": 76.974, "epsilon": -167.402, "zeta": -83.959, "epsilon_zeta": -83.442, "bb_type": "BI", "chi": -163.316, "glyco_bond": "anti", "C5prime_xyz": [ -1.461, 8.820, 0.666 ], "P_xyz": [ 1.103, 9.303, 0.548 ], "form": "A", "ssZp": 4.358, "Dp": 4.434, "splay_angle": 23.238, "splay_distance": 3.768, "splay_ratio": 0.205, "d22": 4.162, "d64": 4.241, "eta": 164.745, "theta": -135.711, "eta_prime": -179.189, "theta_prime": -141.826, "eta_base": -135.947, "theta_base": -113.923, "v0": -2.091, "v1": -21.966, "v2": 36.479, "v3": -38.512, "v4": 25.712, "amplitude": 39.222, "phase_angle": 21.555, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.764, "filter_rmsd": 0.103, "frame": { "rmsd": 0.023, "origin": [ 255.711, 329.677, 253.381 ], "x_axis": [ 0.020, 0.153, 0.988 ], "y_axis": [ 0.342, -0.930, 0.137 ], "z_axis": [ 0.940, 0.335, -0.070 ], "quaternion": [ -0.070, 0.711, 0.174, 0.678 ] } }, { "index": 302, "index_chain": 302, "chain_name": "J", "nt_resnum": 342, "nt_name": "U", "nt_code": "U", "nt_id": "///J/342", "linked_nts": [ "///J/341", "///J/343" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop", "alpha": 168.390, "beta": -141.432, "gamma": 156.577, "delta": 80.655, "epsilon": -127.504, "zeta": -62.374, "epsilon_zeta": -65.130, "bb_type": "BI", "chi": -175.829, "glyco_bond": "anti", "C5prime_xyz": [ -1.565, 8.588, 1.454 ], "P_xyz": [ 0.747, 9.494, 0.659 ], "form": ".", "ssZp": 4.399, "Dp": 4.526, "splay_angle": 28.414, "splay_distance": 4.560, "splay_ratio": 0.246, "d22": null, "d64": null, "eta": 166.261, "theta": -128.079, "eta_prime": -176.650, "theta_prime": -128.135, "eta_base": -130.863, "theta_base": -76.544, "v0": -2.286, "v1": -20.541, "v2": 34.472, "v3": -36.683, "v4": 24.457, "amplitude": 37.182, "phase_angle": 22.010, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.192, "filter_rmsd": 0.107, "frame": { "rmsd": 0.027, "origin": [ 258.389, 332.162, 254.301 ], "x_axis": [ 0.097, -0.449, 0.888 ], "y_axis": [ 0.320, -0.831, -0.455 ], "z_axis": [ 0.943, 0.328, 0.063 ], "quaternion": [ -0.286, 0.683, -0.047, 0.670 ] } }, { "index": 303, "index_chain": 303, "chain_name": "J", "nt_resnum": 343, "nt_name": "G", "nt_code": "G", "nt_id": "///J/343", "linked_nts": [ "///J/342", "///J/344" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-canonical,non-pair-contact,helix,junction-loop,phosphate", "alpha": -68.959, "beta": 163.049, "gamma": 67.293, "delta": 84.265, "epsilon": -140.942, "zeta": 40.386, "epsilon_zeta": 178.672, "bb_type": "--", "chi": -154.735, "glyco_bond": "anti", "C5prime_xyz": [ -1.554, 8.875, 0.163 ], "P_xyz": [ 1.013, 9.395, 0.051 ], "form": ".", "ssZp": 3.870, "Dp": 4.331, "splay_angle": 21.616, "splay_distance": 3.553, "splay_ratio": 0.188, "d22": null, "d64": null, "eta": 164.871, "theta": -28.604, "eta_prime": -166.962, "theta_prime": -65.765, "eta_base": -94.778, "theta_base": -97.774, "v0": -2.844, "v1": -18.151, "v2": 31.045, "v3": -33.461, "v4": 22.978, "amplitude": 33.800, "phase_angle": 23.292, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.535, "filter_rmsd": 0.031, "frame": { "rmsd": 0.031, "origin": [ 261.876, 331.067, 257.026 ], "x_axis": [ 0.282, -0.950, 0.132 ], "y_axis": [ 0.233, -0.065, -0.970 ], "z_axis": [ 0.931, 0.305, 0.203 ], "quaternion": [ 0.596, -0.535, 0.335, -0.496 ] } }, { "index": 304, "index_chain": 304, "chain_name": "J", "nt_resnum": 344, "nt_name": "A", "nt_code": "A", "nt_id": "///J/344", "linked_nts": [ "///J/343", "///J/345" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C2'-endo,non-canonical,non-pair-contact,helix,junction-loop,splayed-apart", "alpha": -176.968, "beta": 144.204, "gamma": 48.972, "delta": 140.912, "epsilon": -78.182, "zeta": -40.498, "epsilon_zeta": -37.685, "bb_type": "--", "chi": -139.934, "glyco_bond": "anti", "C5prime_xyz": [ -1.801, 8.845, -0.289 ], "P_xyz": [ 0.415, 9.228, 1.022 ], "form": ".", "ssZp": -0.347, "Dp": 0.246, "splay_angle": 115.545, "splay_distance": 14.536, "splay_ratio": 0.851, "d22": null, "d64": null, "eta": 72.056, "theta": -2.895, "eta_prime": 129.404, "theta_prime": -19.994, "eta_base": 131.660, "theta_base": 34.227, "v0": -26.290, "v1": 38.429, "v2": -35.601, "v3": 21.277, "v4": 2.768, "amplitude": 38.638, "phase_angle": 157.132, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "5z", "suiteness": 0.576, "filter_rmsd": 0.058, "frame": { "rmsd": 0.031, "origin": [ 265.342, 330.531, 257.594 ], "x_axis": [ -0.457, 0.816, 0.354 ], "y_axis": [ 0.225, 0.491, -0.842 ], "z_axis": [ -0.861, -0.305, -0.408 ], "quaternion": [ -0.396, 0.339, 0.767, -0.374 ] } }, { "index": 305, "index_chain": 305, "chain_name": "J", "nt_resnum": 345, "nt_name": "A", "nt_code": "A", "nt_id": "///J/345", "linked_nts": [ "///J/344", "///J/346" ], "nt_type": "RNA", "dbn": ".", "summary": "syn,~C3'-endo,BI,non-canonical,non-pair-contact,multiplet,junction-loop,splayed-apart", "alpha": -93.580, "beta": -135.862, "gamma": 78.666, "delta": 86.119, "epsilon": -138.527, "zeta": -68.414, "epsilon_zeta": -70.113, "bb_type": "BI", "chi": 42.371, "glyco_bond": "syn", "C5prime_xyz": [ -5.762, 4.793, 1.277 ], "P_xyz": [ -6.555, 2.341, 0.824 ], "form": ".", "ssZp": -2.596, "Dp": 3.414, "splay_angle": 70.861, "splay_distance": 11.265, "splay_ratio": 0.580, "d22": null, "d64": null, "eta": 175.006, "theta": -126.962, "eta_prime": -153.688, "theta_prime": -143.322, "eta_base": -177.707, "theta_base": -168.689, "v0": -21.186, "v1": 2.056, "v2": 16.302, "v3": -28.828, "v4": 31.424, "amplitude": 31.650, "phase_angle": 58.998, "puckering": "C4'-exo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "2a", "suiteness": 0.014, "filter_rmsd": 0.062, "frame": { "rmsd": 0.053, "origin": [ 272.305, 335.709, 245.932 ], "x_axis": [ 0.069, 0.745, -0.663 ], "y_axis": [ -0.380, -0.595, -0.708 ], "z_axis": [ -0.923, 0.301, 0.242 ], "quaternion": [ 0.423, -0.596, -0.153, 0.665 ] } }, { "index": 306, "index_chain": 306, "chain_name": "J", "nt_resnum": 346, "nt_name": "A", "nt_code": "A", "nt_id": "///J/346", "linked_nts": [ "///J/345", "///J/347" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,~C3'-endo,non-canonical,non-pair-contact,helix,junction-loop,splayed-apart", "alpha": -85.333, "beta": -116.820, "gamma": -65.625, "delta": 62.475, "epsilon": 116.183, "zeta": 71.337, "epsilon_zeta": 44.847, "bb_type": "--", "chi": 101.408, "glyco_bond": "--", "C5prime_xyz": [ -3.862, 5.776, 3.199 ], "P_xyz": [ -5.916, 6.655, 4.522 ], "form": ".", "ssZp": -0.037, "Dp": 4.029, "splay_angle": 88.946, "splay_distance": 12.284, "splay_ratio": 0.703, "d22": null, "d64": null, "eta": 101.795, "theta": -158.134, "eta_prime": 96.795, "theta_prime": -159.477, "eta_base": 91.157, "theta_base": -121.363, "v0": 4.988, "v1": -31.918, "v2": 45.802, "v3": -44.228, "v4": 24.536, "amplitude": 46.957, "phase_angle": 12.735, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33m", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.067, "frame": { "rmsd": 0.039, "origin": [ 277.913, 329.998, 238.007 ], "x_axis": [ -0.066, -0.162, -0.985 ], "y_axis": [ -0.335, -0.926, 0.175 ], "z_axis": [ -0.940, 0.341, 0.007 ], "quaternion": [ 0.061, -0.681, 0.182, 0.707 ] } }, { "index": 307, "index_chain": 307, "chain_name": "J", "nt_resnum": 347, "nt_name": "G", "nt_code": "G", "nt_id": "///J/347", "linked_nts": [ "///J/346", "///J/348" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,~C2'-endo,non-canonical,non-pair-contact,helix,multiplet,junction-loop,cap-acceptor,phosphate,splayed-apart", "alpha": 176.918, "beta": -175.326, "gamma": -140.640, "delta": 138.198, "epsilon": -147.586, "zeta": 82.641, "epsilon_zeta": 129.772, "bb_type": "--", "chi": -61.723, "glyco_bond": "--", "C5prime_xyz": [ -3.976, 6.428, -2.828 ], "P_xyz": [ -4.816, 6.233, -5.235 ], "form": ".", "ssZp": 1.106, "Dp": 2.350, "splay_angle": 108.154, "splay_distance": 15.587, "splay_ratio": 0.811, "d22": null, "d64": null, "eta": -65.992, "theta": 8.304, "eta_prime": -41.747, "theta_prime": 18.449, "eta_base": -74.172, "theta_base": 64.180, "v0": -24.157, "v1": 33.186, "v2": -29.321, "v3": 15.972, "v4": 4.851, "amplitude": 32.943, "phase_angle": 152.878, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.069, "frame": { "rmsd": 0.069, "origin": [ 280.622, 334.924, 248.929 ], "x_axis": [ 0.213, 0.070, 0.975 ], "y_axis": [ 0.339, -0.941, -0.007 ], "z_axis": [ 0.916, 0.332, -0.224 ], "quaternion": [ -0.110, 0.771, 0.133, 0.613 ] } }, { "index": 308, "index_chain": 308, "chain_name": "J", "nt_resnum": 348, "nt_name": "A", "nt_code": "A", "nt_id": "///J/348", "linked_nts": [ "///J/347", "///J/349" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop,phosphate,splayed-apart", "alpha": -103.362, "beta": 173.815, "gamma": 64.144, "delta": 82.616, "epsilon": -128.415, "zeta": -76.763, "epsilon_zeta": -51.652, "bb_type": "BI", "chi": -177.645, "glyco_bond": "anti", "C5prime_xyz": [ -1.396, 8.461, 1.578 ], "P_xyz": [ 1.133, 8.643, 2.201 ], "form": "A", "ssZp": 4.581, "Dp": 4.651, "splay_angle": 25.207, "splay_distance": 4.076, "splay_ratio": 0.222, "d22": null, "d64": null, "eta": 176.053, "theta": -128.366, "eta_prime": -163.650, "theta_prime": -125.826, "eta_base": -165.334, "theta_base": -91.913, "v0": 2.351, "v1": -24.526, "v2": 36.058, "v3": -35.588, "v4": 20.956, "amplitude": 37.324, "phase_angle": 14.967, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.050, "frame": { "rmsd": 0.023, "origin": [ 279.983, 326.451, 235.861 ], "x_axis": [ 0.311, 0.950, -0.005 ], "y_axis": [ 0.150, -0.044, 0.988 ], "z_axis": [ 0.938, -0.308, -0.156 ], "quaternion": [ 0.527, 0.615, 0.447, 0.380 ] } }, { "index": 309, "index_chain": 309, "chain_name": "J", "nt_resnum": 349, "nt_name": "C", "nt_code": "C", "nt_id": "///J/349", "linked_nts": [ "///J/348", "///J/350" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -51.228, "beta": 165.179, "gamma": 46.417, "delta": 78.953, "epsilon": -167.900, "zeta": -88.714, "epsilon_zeta": -79.186, "bb_type": "BI", "chi": -156.853, "glyco_bond": "anti", "C5prime_xyz": [ -1.615, 8.882, 0.317 ], "P_xyz": [ 0.926, 9.500, 0.568 ], "form": "A", "ssZp": 4.252, "Dp": 4.405, "splay_angle": 24.530, "splay_distance": 3.950, "splay_ratio": 0.214, "d22": null, "d64": null, "eta": 162.134, "theta": -143.772, "eta_prime": -175.437, "theta_prime": -148.846, "eta_base": -121.505, "theta_base": -129.060, "v0": -2.042, "v1": -21.422, "v2": 35.485, "v3": -37.515, "v4": 24.977, "amplitude": 38.150, "phase_angle": 21.542, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.647, "filter_rmsd": 0.065, "frame": { "rmsd": 0.018, "origin": [ 283.640, 327.296, 234.269 ], "x_axis": [ 0.305, 0.690, 0.657 ], "y_axis": [ -0.032, -0.682, 0.731 ], "z_axis": [ 0.952, -0.244, -0.186 ], "quaternion": [ 0.331, 0.737, 0.223, 0.546 ] } }, { "index": 310, "index_chain": 310, "chain_name": "J", "nt_resnum": 350, "nt_name": "A", "nt_code": "A", "nt_id": "///J/350", "linked_nts": [ "///J/349", "///J/351" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": 178.445, "beta": -149.164, "gamma": 146.537, "delta": 79.844, "epsilon": -124.793, "zeta": -92.401, "epsilon_zeta": -32.393, "bb_type": "--", "chi": -175.171, "glyco_bond": "anti", "C5prime_xyz": [ -1.447, 8.514, 1.437 ], "P_xyz": [ 0.853, 9.413, 0.584 ], "form": "A", "ssZp": 4.593, "Dp": 4.673, "splay_angle": 22.420, "splay_distance": 3.468, "splay_ratio": 0.195, "d22": null, "d64": null, "eta": 161.469, "theta": -153.988, "eta_prime": 172.263, "theta_prime": -153.851, "eta_base": -154.644, "theta_base": -126.987, "v0": 0.879, "v1": -23.299, "v2": 35.710, "v3": -36.201, "v4": 22.222, "amplitude": 37.403, "phase_angle": 17.307, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.010, "filter_rmsd": 0.046, "frame": { "rmsd": 0.018, "origin": [ 287.279, 327.699, 232.788 ], "x_axis": [ 0.008, 0.323, 0.946 ], "y_axis": [ -0.149, -0.936, 0.320 ], "z_axis": [ 0.989, -0.143, 0.041 ], "quaternion": [ 0.168, 0.690, 0.063, 0.701 ] } }, { "index": 311, "index_chain": 311, "chain_name": "J", "nt_resnum": 351, "nt_name": "A", "nt_code": "A", "nt_id": "///J/351", "linked_nts": [ "///J/350", "///J/352" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -59.664, "beta": 152.916, "gamma": 58.677, "delta": 80.575, "epsilon": -139.251, "zeta": -76.321, "epsilon_zeta": -62.930, "bb_type": "BI", "chi": -163.592, "glyco_bond": "anti", "C5prime_xyz": [ -1.429, 8.630, 0.744 ], "P_xyz": [ 1.133, 8.908, 0.344 ], "form": "A", "ssZp": 4.519, "Dp": 4.705, "splay_angle": 22.974, "splay_distance": 3.679, "splay_ratio": 0.202, "d22": null, "d64": null, "eta": 163.837, "theta": -140.441, "eta_prime": 177.930, "theta_prime": -143.371, "eta_base": -140.921, "theta_base": -118.878, "v0": 3.619, "v1": -25.827, "v2": 37.047, "v3": -35.969, "v4": 20.422, "amplitude": 38.067, "phase_angle": 13.296, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.459, "filter_rmsd": 0.043, "frame": { "rmsd": 0.017, "origin": [ 290.629, 328.536, 233.115 ], "x_axis": [ -0.083, -0.241, 0.967 ], "y_axis": [ -0.011, -0.970, -0.243 ], "z_axis": [ 0.997, -0.031, 0.078 ], "quaternion": [ -0.079, 0.673, -0.094, 0.730 ] } }, { "index": 312, "index_chain": 312, "chain_name": "J", "nt_resnum": 352, "nt_name": "C", "nt_code": "C", "nt_id": "///J/352", "linked_nts": [ "///J/351", "///J/353" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -72.404, "beta": 159.791, "gamma": 71.709, "delta": 77.794, "epsilon": -146.943, "zeta": -58.822, "epsilon_zeta": -88.121, "bb_type": "BI", "chi": -165.830, "glyco_bond": "anti", "C5prime_xyz": [ -1.378, 8.801, 0.858 ], "P_xyz": [ 1.131, 9.344, 0.396 ], "form": ".", "ssZp": 4.559, "Dp": 4.649, "splay_angle": 26.838, "splay_distance": 4.217, "splay_ratio": 0.233, "d22": 3.812, "d64": 4.005, "eta": 165.042, "theta": -132.944, "eta_prime": -179.056, "theta_prime": -133.688, "eta_base": -134.952, "theta_base": -90.455, "v0": 0.769, "v1": -24.877, "v2": 38.162, "v3": -38.658, "v4": 23.837, "amplitude": 39.996, "phase_angle": 17.418, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.439, "filter_rmsd": 0.067, "frame": { "rmsd": 0.010, "origin": [ 293.663, 329.389, 235.015 ], "x_axis": [ -0.178, -0.732, 0.658 ], "y_axis": [ 0.153, -0.681, -0.716 ], "z_axis": [ 0.972, -0.027, 0.233 ], "quaternion": [ -0.306, 0.563, -0.257, 0.723 ] } }, { "index": 313, "index_chain": 313, "chain_name": "J", "nt_resnum": 353, "nt_name": "U", "nt_code": "U", "nt_id": "///J/353", "linked_nts": [ "///J/352", "///J/354" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack", "alpha": -80.661, "beta": 168.951, "gamma": 72.821, "delta": 80.280, "epsilon": -150.484, "zeta": -87.040, "epsilon_zeta": -63.444, "bb_type": "BI", "chi": -164.531, "glyco_bond": "anti", "C5prime_xyz": [ -1.436, 8.706, 0.785 ], "P_xyz": [ 1.125, 9.189, 0.445 ], "form": ".", "ssZp": 4.513, "Dp": 4.615, "splay_angle": 26.084, "splay_distance": 4.062, "splay_ratio": 0.227, "d22": null, "d64": null, "eta": 163.503, "theta": -163.518, "eta_prime": -171.947, "theta_prime": -168.267, "eta_base": -104.682, "theta_base": -166.820, "v0": 2.248, "v1": -25.120, "v2": 37.239, "v3": -36.782, "v4": 21.764, "amplitude": 38.592, "phase_angle": 15.218, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.352, "filter_rmsd": 0.107, "frame": { "rmsd": 0.012, "origin": [ 296.053, 327.221, 237.729 ], "x_axis": [ -0.005, -0.998, -0.065 ], "y_axis": [ 0.349, 0.059, -0.935 ], "z_axis": [ 0.937, -0.027, 0.348 ], "quaternion": [ 0.592, -0.384, 0.423, -0.569 ] } }, { "index": 314, "index_chain": 314, "chain_name": "J", "nt_resnum": 354, "nt_name": "G", "nt_code": "G", "nt_id": "///J/354", "linked_nts": [ "///J/353", "///J/355" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-pair-contact,ss-non-loop,cap-acceptor", "alpha": -85.805, "beta": 157.533, "gamma": 80.011, "delta": 78.231, "epsilon": -158.208, "zeta": -0.246, "epsilon_zeta": -157.962, "bb_type": "--", "chi": -170.647, "glyco_bond": "anti", "C5prime_xyz": [ -1.265, 8.544, 1.126 ], "P_xyz": [ 1.168, 9.088, 0.335 ], "form": ".", "ssZp": 4.615, "Dp": 4.647, "splay_angle": 19.320, "splay_distance": 4.057, "splay_ratio": 0.214, "d22": null, "d64": null, "eta": 160.720, "theta": -103.790, "eta_prime": 169.898, "theta_prime": -126.574, "eta_base": -173.467, "theta_base": -108.915, "v0": 6.753, "v1": -29.888, "v2": 40.526, "v3": -37.639, "v4": 19.478, "amplitude": 41.069, "phase_angle": 9.323, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.082, "filter_rmsd": 0.017, "frame": { "rmsd": 0.017, "origin": [ 298.118, 328.813, 240.843 ], "x_axis": [ 0.089, -0.950, -0.299 ], "y_axis": [ 0.459, 0.305, -0.834 ], "z_axis": [ 0.884, -0.063, 0.463 ], "quaternion": [ 0.682, -0.283, 0.434, -0.517 ] } }, { "index": 315, "index_chain": 315, "chain_name": "J", "nt_resnum": 355, "nt_name": "A", "nt_code": "A", "nt_id": "///J/355", "linked_nts": [ "///J/354", "///J/356" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BII,non-pair-contact,ss-non-loop,cap-donor", "alpha": -155.495, "beta": 97.529, "gamma": -160.425, "delta": 85.253, "epsilon": -95.295, "zeta": -159.132, "epsilon_zeta": 63.838, "bb_type": "BII", "chi": -110.714, "glyco_bond": "anti", "C5prime_xyz": [ -1.482, 8.082, -2.152 ], "P_xyz": [ -2.727, 9.696, -3.798 ], "form": ".", "ssZp": 0.841, "Dp": 4.615, "splay_angle": 34.677, "splay_distance": 5.862, "splay_ratio": 0.310, "d22": null, "d64": null, "eta": -165.571, "theta": 135.061, "eta_prime": -158.553, "theta_prime": 147.939, "eta_base": -123.366, "theta_base": 116.197, "v0": 4.427, "v1": -23.874, "v2": 33.225, "v3": -31.508, "v4": 17.140, "amplitude": 33.876, "phase_angle": 11.253, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.044, "frame": { "rmsd": 0.014, "origin": [ 298.621, 325.424, 243.016 ], "x_axis": [ 0.619, -0.775, 0.130 ], "y_axis": [ 0.783, 0.622, -0.020 ], "z_axis": [ -0.065, 0.114, 0.991 ], "quaternion": [ 0.899, -0.037, -0.054, -0.433 ] } }, { "index": 316, "index_chain": 316, "chain_name": "J", "nt_resnum": 356, "nt_name": "C", "nt_code": "C", "nt_id": "///J/356", "linked_nts": [ "///J/355", "///J/357" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C2'-endo,non-pair-contact,ss-non-loop,cap-donor", "alpha": 80.842, "beta": -108.436, "gamma": -167.893, "delta": 141.159, "epsilon": -75.158, "zeta": -127.891, "epsilon_zeta": 52.733, "bb_type": "--", "chi": -105.502, "glyco_bond": "anti", "C5prime_xyz": [ -2.283, 8.245, -1.964 ], "P_xyz": [ -1.316, 7.380, -4.230 ], "form": ".", "ssZp": 0.382, "Dp": 0.592, "splay_angle": 64.438, "splay_distance": 10.118, "splay_ratio": 0.539, "d22": 6.906, "d64": 7.248, "eta": -129.800, "theta": 168.322, "eta_prime": -156.508, "theta_prime": -163.259, "eta_base": 162.715, "theta_base": -107.931, "v0": -23.667, "v1": 35.325, "v2": -32.910, "v3": 20.078, "v4": 1.994, "amplitude": 35.493, "phase_angle": 158.007, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.061, "frame": { "rmsd": 0.006, "origin": [ 297.853, 330.397, 246.023 ], "x_axis": [ 0.140, -0.990, -0.031 ], "y_axis": [ 0.969, 0.131, 0.208 ], "z_axis": [ -0.202, -0.059, 0.978 ], "quaternion": [ 0.750, 0.089, -0.057, -0.653 ] } }, { "index": 317, "index_chain": 317, "chain_name": "J", "nt_resnum": 357, "nt_name": "U", "nt_code": "U", "nt_id": "///J/357", "linked_nts": [ "///J/356", "///J/358" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-stack,non-pair-contact,ss-non-loop,cap-acceptor", "alpha": -90.274, "beta": 113.211, "gamma": 78.199, "delta": 81.743, "epsilon": -149.061, "zeta": -142.858, "epsilon_zeta": -6.203, "bb_type": "--", "chi": -148.642, "glyco_bond": "anti", "C5prime_xyz": [ -1.587, 8.749, -0.161 ], "P_xyz": [ 0.292, 8.316, -1.941 ], "form": ".", "ssZp": 4.083, "Dp": 4.624, "splay_angle": 27.635, "splay_distance": 4.733, "splay_ratio": 0.310, "d22": null, "d64": null, "eta": 141.593, "theta": 179.069, "eta_prime": -179.384, "theta_prime": 173.491, "eta_base": -129.552, "theta_base": -149.654, "v0": 2.154, "v1": -24.448, "v2": 36.151, "v3": -35.803, "v4": 21.256, "amplitude": 37.481, "phase_angle": 15.310, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.107, "frame": { "rmsd": 0.006, "origin": [ 304.261, 330.713, 253.847 ], "x_axis": [ 0.917, -0.304, -0.258 ], "y_axis": [ 0.162, 0.876, -0.455 ], "z_axis": [ 0.364, 0.375, 0.852 ], "quaternion": [ 0.955, -0.217, 0.163, -0.122 ] } }, { "index": 318, "index_chain": 318, "chain_name": "J", "nt_resnum": 358, "nt_name": "A", "nt_code": "A", "nt_id": "///J/358", "linked_nts": [ "///J/357", "///J/359" ], "nt_type": "RNA", "dbn": ".", "summary": "~C3'-endo,BI,non-pair-contact,ss-non-loop,cap-donor,cap-acceptor,phosphate", "alpha": -12.056, "beta": 120.655, "gamma": 64.397, "delta": 85.855, "epsilon": 179.362, "zeta": -89.762, "epsilon_zeta": -90.876, "bb_type": "BI", "chi": -68.815, "glyco_bond": "--", "C5prime_xyz": [ -2.848, 6.093, -3.467 ], "P_xyz": [ -1.551, 3.985, -4.329 ], "form": ".", "ssZp": -0.746, "Dp": 4.328, "splay_angle": 33.791, "splay_distance": 5.543, "splay_ratio": 0.308, "d22": null, "d64": null, "eta": -166.288, "theta": -166.173, "eta_prime": -151.993, "theta_prime": 169.233, "eta_base": -125.269, "theta_base": 131.663, "v0": 5.691, "v1": -25.235, "v2": 34.108, "v3": -31.697, "v4": 16.529, "amplitude": 34.568, "phase_angle": 9.358, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.036, "frame": { "rmsd": 0.009, "origin": [ 305.617, 334.285, 256.641 ], "x_axis": [ 0.839, 0.073, 0.540 ], "y_axis": [ -0.352, 0.829, 0.434 ], "z_axis": [ -0.416, -0.554, 0.721 ], "quaternion": [ 0.920, 0.268, -0.260, 0.115 ] } }, { "index": 319, "index_chain": 319, "chain_name": "J", "nt_resnum": 359, "nt_name": "A", "nt_code": "A", "nt_id": "///J/359", "linked_nts": [ "///J/358", "///J/360" ], "nt_type": "RNA", "dbn": ".", "summary": "~C3'-endo,BII,non-pair-contact,ss-non-loop,cap-donor,cap-acceptor,phosphate", "alpha": -68.067, "beta": 173.761, "gamma": 44.844, "delta": 90.355, "epsilon": -102.702, "zeta": 146.880, "epsilon_zeta": 110.418, "bb_type": "BII", "chi": -81.607, "glyco_bond": "--", "C5prime_xyz": [ -2.559, 6.757, -3.225 ], "P_xyz": [ -0.347, 6.541, -4.618 ], "form": ".", "ssZp": -1.363, "Dp": 4.526, "splay_angle": 68.456, "splay_distance": 10.529, "splay_ratio": 0.572, "d22": null, "d64": null, "eta": 176.992, "theta": 99.245, "eta_prime": 169.699, "theta_prime": 78.280, "eta_base": 151.303, "theta_base": 27.453, "v0": 2.832, "v1": -20.617, "v2": 29.458, "v3": -28.705, "v4": 16.419, "amplitude": 30.289, "phase_angle": 13.445, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "&a", "suiteness": 0.700, "filter_rmsd": 0.035, "frame": { "rmsd": 0.010, "origin": [ 300.464, 334.735, 258.632 ], "x_axis": [ 0.929, -0.148, 0.341 ], "y_axis": [ -0.110, 0.767, 0.632 ], "z_axis": [ -0.355, -0.624, 0.696 ], "quaternion": [ 0.921, 0.341, -0.189, -0.010 ] } }, { "index": 320, "index_chain": 320, "chain_name": "J", "nt_resnum": 360, "nt_name": "A", "nt_code": "A", "nt_id": "///J/360", "linked_nts": [ "///J/359", "///J/361" ], "nt_type": "RNA", "dbn": ".", "summary": "~C2'-endo,BII,non-pair-contact,ss-non-loop,cap-acceptor", "alpha": -117.341, "beta": 130.363, "gamma": -2.281, "delta": 154.428, "epsilon": -122.935, "zeta": -172.364, "epsilon_zeta": 49.429, "bb_type": "BII", "chi": -15.092, "glyco_bond": "--", "C5prime_xyz": [ -4.863, 5.152, -2.339 ], "P_xyz": [ -3.644, 5.416, -4.654 ], "form": ".", "ssZp": 0.185, "Dp": 1.418, "splay_angle": 45.859, "splay_distance": 7.638, "splay_ratio": 0.394, "d22": null, "d64": null, "eta": 91.382, "theta": -177.899, "eta_prime": 112.784, "theta_prime": 161.061, "eta_base": 119.016, "theta_base": -148.703, "v0": -23.586, "v1": 40.557, "v2": -40.996, "v3": 28.306, "v4": -3.110, "amplitude": 42.352, "phase_angle": 165.459, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.044, "frame": { "rmsd": 0.016, "origin": [ 300.042, 344.838, 255.703 ], "x_axis": [ -0.028, -0.790, -0.612 ], "y_axis": [ -0.858, -0.295, 0.420 ], "z_axis": [ -0.513, 0.537, -0.670 ], "quaternion": [ -0.042, 0.696, -0.592, -0.404 ] } }, { "index": 321, "index_chain": 321, "chain_name": "J", "nt_resnum": 361, "nt_name": "C", "nt_code": "C", "nt_id": "///J/361", "linked_nts": [ "///J/360", "///J/362" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack", "alpha": -96.430, "beta": 115.599, "gamma": 83.275, "delta": 79.861, "epsilon": -153.015, "zeta": -64.391, "epsilon_zeta": -88.624, "bb_type": "BI", "chi": -168.249, "glyco_bond": "anti", "C5prime_xyz": [ -1.431, 8.831, 0.928 ], "P_xyz": [ 0.794, 8.992, -0.444 ], "form": "A", "ssZp": 4.433, "Dp": 4.508, "splay_angle": 21.040, "splay_distance": 3.489, "splay_ratio": 0.187, "d22": null, "d64": null, "eta": 160.239, "theta": -134.544, "eta_prime": 164.564, "theta_prime": -140.653, "eta_base": -141.025, "theta_base": -128.169, "v0": -2.764, "v1": -20.715, "v2": 34.839, "v3": -37.296, "v4": 25.240, "amplitude": 37.731, "phase_angle": 22.578, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.069, "frame": { "rmsd": 0.015, "origin": [ 292.773, 344.289, 253.422 ], "x_axis": [ 0.036, -0.964, 0.265 ], "y_axis": [ -0.120, 0.259, 0.958 ], "z_axis": [ -0.992, -0.067, -0.106 ], "quaternion": [ 0.545, 0.470, -0.576, -0.387 ] } }, { "index": 322, "index_chain": 322, "chain_name": "J", "nt_resnum": 362, "nt_name": "G", "nt_code": "G", "nt_id": "///J/362", "linked_nts": [ "///J/361", "///J/363" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -77.688, "beta": -170.736, "gamma": 65.653, "delta": 148.949, "epsilon": -157.292, "zeta": -129.048, "epsilon_zeta": -28.244, "bb_type": "--", "chi": -129.815, "glyco_bond": "anti", "C5prime_xyz": [ -2.272, 8.740, -0.607 ], "P_xyz": [ 0.059, 9.710, 0.186 ], "form": ".", "ssZp": 2.356, "Dp": 2.245, "splay_angle": 21.337, "splay_distance": 3.867, "splay_ratio": 0.197, "d22": null, "d64": null, "eta": 166.532, "theta": -119.291, "eta_prime": -157.716, "theta_prime": -135.016, "eta_base": -127.998, "theta_base": -105.423, "v0": -25.119, "v1": 40.506, "v2": -39.082, "v3": 25.349, "v4": -0.138, "amplitude": 41.201, "phase_angle": 161.546, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1b", "suiteness": 0.628, "filter_rmsd": 0.015, "frame": { "rmsd": 0.015, "origin": [ 290.066, 342.716, 251.883 ], "x_axis": [ 0.306, -0.624, 0.719 ], "y_axis": [ -0.257, 0.673, 0.694 ], "z_axis": [ -0.917, -0.397, 0.045 ], "quaternion": [ 0.711, 0.383, -0.575, -0.129 ] } }, { "index": 323, "index_chain": 323, "chain_name": "J", "nt_resnum": 363, "nt_name": "U", "nt_code": "U", "nt_id": "///J/363", "linked_nts": [ "///J/362", "///J/364" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop,junction-loop,phosphate", "alpha": 4.639, "beta": 152.924, "gamma": -17.165, "delta": 155.376, "epsilon": -174.211, "zeta": -111.481, "epsilon_zeta": -62.730, "bb_type": "BI", "chi": -97.455, "glyco_bond": "anti", "C5prime_xyz": [ -2.854, 8.144, -1.804 ], "P_xyz": [ -1.376, 10.322, -1.336 ], "form": ".", "ssZp": 2.739, "Dp": 2.422, "splay_angle": 32.074, "splay_distance": 5.065, "splay_ratio": 0.277, "d22": null, "d64": null, "eta": 151.167, "theta": -145.257, "eta_prime": -179.565, "theta_prime": -155.670, "eta_base": -134.462, "theta_base": -82.635, "v0": -26.140, "v1": 45.038, "v2": -44.989, "v3": 30.546, "v4": -2.970, "amplitude": 46.623, "phase_angle": 164.783, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.124, "frame": { "rmsd": 0.037, "origin": [ 287.438, 339.879, 251.920 ], "x_axis": [ 0.137, -0.150, 0.979 ], "y_axis": [ -0.393, 0.899, 0.192 ], "z_axis": [ -0.909, -0.411, 0.064 ], "quaternion": [ 0.725, 0.208, -0.652, 0.084 ] } }, { "index": 324, "index_chain": 324, "chain_name": "J", "nt_resnum": 364, "nt_name": "G", "nt_code": "G", "nt_id": "///J/364", "linked_nts": [ "///J/363", "///J/365" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-canonical,non-pair-contact,helix,hairpin-loop,junction-loop,phosphate", "alpha": -79.675, "beta": 172.546, "gamma": 60.281, "delta": 79.965, "epsilon": -158.855, "zeta": 45.161, "epsilon_zeta": 155.984, "bb_type": "--", "chi": -138.509, "glyco_bond": "anti", "C5prime_xyz": [ -1.106, 8.808, -0.766 ], "P_xyz": [ 1.442, 9.107, -1.297 ], "form": ".", "ssZp": 3.643, "Dp": 4.472, "splay_angle": 29.773, "splay_distance": 5.392, "splay_ratio": 0.350, "d22": null, "d64": null, "eta": 166.881, "theta": -28.726, "eta_prime": 175.414, "theta_prime": -68.544, "eta_base": -99.275, "theta_base": 175.754, "v0": -0.176, "v1": -22.292, "v2": 34.871, "v3": -35.811, "v4": 22.867, "amplitude": 36.839, "phase_angle": 18.812, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.025, "frame": { "rmsd": 0.025, "origin": [ 283.807, 339.905, 255.452 ], "x_axis": [ -0.308, 0.773, 0.554 ], "y_axis": [ -0.329, 0.460, -0.825 ], "z_axis": [ -0.893, -0.436, 0.113 ], "quaternion": [ 0.563, -0.173, -0.643, 0.490 ] } }, { "index": 325, "index_chain": 325, "chain_name": "J", "nt_resnum": 365, "nt_name": "U", "nt_code": "U", "nt_id": "///J/365", "linked_nts": [ "///J/364", "///J/366" ], "nt_type": "RNA", "dbn": ".", "summary": "syn,~C2'-endo,non-canonical,non-pair-contact,multiplet,hairpin-loop,junction-loop,cap-donor", "alpha": 156.563, "beta": 161.594, "gamma": 55.870, "delta": 152.679, "epsilon": -83.545, "zeta": 119.273, "epsilon_zeta": 157.181, "bb_type": "--", "chi": 40.746, "glyco_bond": "syn", "C5prime_xyz": [ -5.579, 4.064, 0.215 ], "P_xyz": [ -5.486, 1.661, -0.862 ], "form": ".", "ssZp": -0.170, "Dp": 0.597, "splay_angle": 27.960, "splay_distance": 4.793, "splay_ratio": 0.260, "d22": null, "d64": null, "eta": 62.600, "theta": 131.534, "eta_prime": 129.391, "theta_prime": 100.756, "eta_base": 55.217, "theta_base": 88.482, "v0": -21.768, "v1": 38.056, "v2": -38.898, "v3": 27.389, "v4": -3.718, "amplitude": 40.002, "phase_angle": 166.511, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "5z", "suiteness": 0.809, "filter_rmsd": 0.097, "frame": { "rmsd": 0.032, "origin": [ 280.474, 337.460, 251.990 ], "x_axis": [ 0.403, -0.235, 0.884 ], "y_axis": [ -0.353, 0.852, 0.387 ], "z_axis": [ -0.844, -0.469, 0.260 ], "quaternion": [ 0.793, 0.270, -0.545, 0.037 ] } }, { "index": 326, "index_chain": 326, "chain_name": "J", "nt_resnum": 366, "nt_name": "A", "nt_code": "A", "nt_id": "///J/366", "linked_nts": [ "///J/365", "///J/367" ], "nt_type": "RNA", "dbn": ".", "summary": "~C2'-endo,non-canonical,non-pair-contact,multiplet,hairpin-loop,junction-loop,cap-acceptor", "alpha": -138.304, "beta": 145.596, "gamma": 77.676, "delta": 133.789, "epsilon": -130.558, "zeta": -86.084, "epsilon_zeta": -44.474, "bb_type": "--", "chi": -56.303, "glyco_bond": "--", "C5prime_xyz": [ -4.350, 6.526, -2.769 ], "P_xyz": [ -3.273, 5.744, -5.020 ], "form": ".", "ssZp": 1.142, "Dp": 1.855, "splay_angle": 53.376, "splay_distance": 8.318, "splay_ratio": 0.485, "d22": null, "d64": null, "eta": 160.452, "theta": -76.560, "eta_prime": 164.405, "theta_prime": -138.445, "eta_base": 161.377, "theta_base": -177.814, "v0": -32.299, "v1": 40.209, "v2": -32.246, "v3": 14.486, "v4": 10.985, "amplitude": 39.275, "phase_angle": 145.188, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.054, "frame": { "rmsd": 0.028, "origin": [ 275.711, 337.888, 251.675 ], "x_axis": [ 0.484, -0.255, 0.837 ], "y_axis": [ -0.439, 0.757, 0.484 ], "z_axis": [ -0.757, -0.602, 0.254 ], "quaternion": [ 0.790, 0.344, -0.505, 0.058 ] } }, { "index": 327, "index_chain": 327, "chain_name": "J", "nt_resnum": 367, "nt_name": "A", "nt_code": "A", "nt_id": "///J/367", "linked_nts": [ "///J/366", "///J/368" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,syn,~C3'-endo,BI,non-canonical,non-pair-contact,helix,hairpin-loop,junction-loop", "alpha": 160.275, "beta": 174.818, "gamma": 55.478, "delta": 71.954, "epsilon": -141.454, "zeta": -69.820, "epsilon_zeta": -71.634, "bb_type": "BI", "chi": 10.204, "glyco_bond": "syn", "C5prime_xyz": [ -5.724, 4.278, -1.092 ], "P_xyz": [ -6.327, 1.817, -1.707 ], "form": ".", "ssZp": -4.599, "Dp": 4.602, "splay_angle": 37.358, "splay_distance": 5.882, "splay_ratio": 0.326, "d22": null, "d64": null, "eta": 21.195, "theta": -145.726, "eta_prime": 65.526, "theta_prime": -140.257, "eta_base": 80.761, "theta_base": -160.734, "v0": -5.961, "v1": -20.592, "v2": 37.924, "v3": -42.286, "v4": 30.481, "amplitude": 42.368, "phase_angle": 26.478, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "2g", "suiteness": 0.244, "filter_rmsd": 0.049, "frame": { "rmsd": 0.031, "origin": [ 267.771, 338.732, 254.007 ], "x_axis": [ 0.093, -0.856, 0.508 ], "y_axis": [ -0.157, 0.491, 0.857 ], "z_axis": [ -0.983, -0.160, -0.089 ], "quaternion": [ 0.612, 0.416, -0.610, -0.286 ] } }, { "index": 328, "index_chain": 328, "chain_name": "J", "nt_resnum": 368, "nt_name": "U", "nt_code": "U", "nt_id": "///J/368", "linked_nts": [ "///J/367", "///J/369" ], "nt_type": "RNA", "dbn": "]", "summary": "pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop,junction-loop,phosphate", "alpha": -61.096, "beta": 166.591, "gamma": 61.147, "delta": 76.188, "epsilon": -161.976, "zeta": -81.054, "epsilon_zeta": -80.922, "bb_type": "BI", "chi": -162.781, "glyco_bond": "anti", "C5prime_xyz": [ -1.592, 8.855, 0.639 ], "P_xyz": [ 0.924, 9.515, 0.790 ], "form": "A", "ssZp": 4.280, "Dp": 4.439, "splay_angle": 23.779, "splay_distance": 3.880, "splay_ratio": 0.209, "d22": 4.251, "d64": 4.273, "eta": 170.444, "theta": -135.898, "eta_prime": -170.307, "theta_prime": -142.311, "eta_base": -179.600, "theta_base": -112.363, "v0": -2.374, "v1": -22.005, "v2": 36.836, "v3": -39.137, "v4": 26.277, "amplitude": 39.726, "phase_angle": 21.991, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.674, "filter_rmsd": 0.106, "frame": { "rmsd": 0.019, "origin": [ 271.207, 336.156, 258.026 ], "x_axis": [ 0.014, 0.044, -0.999 ], "y_axis": [ -0.106, 0.993, 0.042 ], "z_axis": [ 0.994, 0.106, 0.019 ], "quaternion": [ 0.712, -0.022, 0.700, 0.053 ] } }, { "index": 329, "index_chain": 329, "chain_name": "J", "nt_resnum": 369, "nt_name": "C", "nt_code": "C", "nt_id": "///J/369", "linked_nts": [ "///J/368", "///J/370" ], "nt_type": "RNA", "dbn": "]", "summary": "pseudoknotted,anti,~C3'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack,hairpin-loop,A-minor", "alpha": 175.132, "beta": -151.289, "gamma": 146.643, "delta": 78.228, "epsilon": -114.024, "zeta": -91.337, "epsilon_zeta": -22.687, "bb_type": "--", "chi": -176.178, "glyco_bond": "anti", "C5prime_xyz": [ -1.352, 8.603, 1.473 ], "P_xyz": [ 0.918, 9.547, 0.621 ], "form": "A", "ssZp": 4.581, "Dp": 4.695, "splay_angle": 24.240, "splay_distance": 3.871, "splay_ratio": 0.211, "d22": 4.021, "d64": 3.970, "eta": 160.442, "theta": -143.700, "eta_prime": 174.295, "theta_prime": -142.524, "eta_base": -140.236, "theta_base": -106.628, "v0": 0.769, "v1": -25.027, "v2": 38.553, "v3": -39.033, "v4": 24.075, "amplitude": 40.414, "phase_angle": 17.457, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.010, "filter_rmsd": 0.069, "frame": { "rmsd": 0.022, "origin": [ 274.775, 335.405, 256.701 ], "x_axis": [ -0.236, 0.597, -0.767 ], "y_axis": [ -0.053, 0.780, 0.623 ], "z_axis": [ 0.970, 0.187, -0.152 ], "quaternion": [ 0.590, 0.185, 0.736, 0.275 ] } }, { "index": 330, "index_chain": 330, "chain_name": "J", "nt_resnum": 370, "nt_name": "U", "nt_code": "U", "nt_id": "///J/370", "linked_nts": [ "///J/369", "///J/371" ], "nt_type": "RNA", "dbn": "]", "summary": "pseudoknotted,anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,hairpin-loop,junction-loop", "alpha": -47.976, "beta": 143.588, "gamma": 56.715, "delta": 75.652, "epsilon": -153.589, "zeta": -89.075, "epsilon_zeta": -64.514, "bb_type": "BI", "chi": -168.914, "glyco_bond": "anti", "C5prime_xyz": [ -1.537, 8.795, 0.940 ], "P_xyz": [ 1.029, 9.270, 0.663 ], "form": ".", "ssZp": 4.557, "Dp": 4.574, "splay_angle": 35.120, "splay_distance": 5.681, "splay_ratio": 0.307, "d22": 6.005, "d64": 6.776, "eta": 159.180, "theta": -167.692, "eta_prime": -179.394, "theta_prime": -171.779, "eta_base": -124.103, "theta_base": -174.707, "v0": -2.636, "v1": -22.850, "v2": 38.211, "v3": -40.582, "v4": 27.249, "amplitude": 41.224, "phase_angle": 22.044, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1L", "suiteness": 0.783, "filter_rmsd": 0.103, "frame": { "rmsd": 0.025, "origin": [ 277.558, 336.634, 254.307 ], "x_axis": [ -0.327, 0.928, -0.178 ], "y_axis": [ 0.185, 0.248, 0.951 ], "z_axis": [ 0.927, 0.278, -0.252 ], "quaternion": [ 0.409, 0.412, 0.676, 0.455 ] } }, { "index": 331, "index_chain": 331, "chain_name": "J", "nt_resnum": 371, "nt_name": "C", "nt_code": "C", "nt_id": "///J/371", "linked_nts": [ "///J/370", "///J/372" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,hairpin-loop,junction-loop", "alpha": -84.470, "beta": 165.828, "gamma": 80.724, "delta": 72.821, "epsilon": -151.091, "zeta": -66.134, "epsilon_zeta": -84.957, "bb_type": "BI", "chi": -171.093, "glyco_bond": "anti", "C5prime_xyz": [ -1.494, 8.821, 1.128 ], "P_xyz": [ 0.907, 9.734, 0.691 ], "form": "A", "ssZp": 4.682, "Dp": 4.670, "splay_angle": 27.114, "splay_distance": 4.289, "splay_ratio": 0.239, "d22": null, "d64": null, "eta": 171.606, "theta": -149.619, "eta_prime": 173.366, "theta_prime": -149.033, "eta_base": 177.535, "theta_base": -121.150, "v0": -1.332, "v1": -24.946, "v2": 40.321, "v3": -41.820, "v4": 27.320, "amplitude": 42.949, "phase_angle": 20.146, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.060, "filter_rmsd": 0.076, "frame": { "rmsd": 0.025, "origin": [ 281.377, 333.897, 251.112 ], "x_axis": [ -0.348, 0.934, -0.084 ], "y_axis": [ 0.242, 0.176, 0.954 ], "z_axis": [ 0.906, 0.311, -0.288 ], "quaternion": [ 0.368, 0.437, 0.673, 0.470 ] } }, { "index": 332, "index_chain": 332, "chain_name": "J", "nt_resnum": 372, "nt_name": "A", "nt_code": "A", "nt_id": "///J/372", "linked_nts": [ "///J/371", "///J/373" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,hairpin-loop,junction-loop", "alpha": -72.187, "beta": 173.163, "gamma": 66.815, "delta": 77.210, "epsilon": -155.742, "zeta": -71.900, "epsilon_zeta": -83.842, "bb_type": "BI", "chi": -172.374, "glyco_bond": "anti", "C5prime_xyz": [ -1.586, 8.625, 1.197 ], "P_xyz": [ 0.924, 9.245, 1.427 ], "form": ".", "ssZp": 4.577, "Dp": 4.567, "splay_angle": 36.214, "splay_distance": 5.521, "splay_ratio": 0.312, "d22": null, "d64": null, "eta": 173.228, "theta": -116.920, "eta_prime": -171.037, "theta_prime": -119.310, "eta_base": -127.421, "theta_base": -68.196, "v0": -1.550, "v1": -22.351, "v2": 36.492, "v3": -38.270, "v4": 25.217, "amplitude": 39.039, "phase_angle": 20.810, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.580, "filter_rmsd": 0.049, "frame": { "rmsd": 0.027, "origin": [ 283.755, 336.149, 248.344 ], "x_axis": [ -0.212, 0.848, 0.486 ], "y_axis": [ 0.364, -0.393, 0.845 ], "z_axis": [ 0.907, 0.356, -0.225 ], "quaternion": [ 0.206, 0.593, 0.511, 0.587 ] } }, { "index": 333, "index_chain": 333, "chain_name": "J", "nt_resnum": 373, "nt_name": "G", "nt_code": "G", "nt_id": "///J/373", "linked_nts": [ "///J/372", "///J/374" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop,junction-loop", "alpha": 166.057, "beta": -140.495, "gamma": 148.656, "delta": 79.571, "epsilon": -113.814, "zeta": -86.813, "epsilon_zeta": -27.001, "bb_type": "--", "chi": 178.349, "glyco_bond": "anti", "C5prime_xyz": [ -1.245, 8.284, 1.865 ], "P_xyz": [ 1.126, 8.956, 1.025 ], "form": "A", "ssZp": 4.749, "Dp": 4.781, "splay_angle": 25.794, "splay_distance": 4.074, "splay_ratio": 0.226, "d22": null, "d64": null, "eta": 157.484, "theta": -135.587, "eta_prime": -174.144, "theta_prime": -135.748, "eta_base": -96.254, "theta_base": -103.276, "v0": 5.367, "v1": -27.640, "v2": 38.421, "v3": -36.274, "v4": 19.525, "amplitude": 39.128, "phase_angle": 10.910, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.025, "filter_rmsd": 0.029, "frame": { "rmsd": 0.029, "origin": [ 286.592, 340.290, 250.643 ], "x_axis": [ 0.195, 0.025, 0.980 ], "y_axis": [ 0.361, -0.931, -0.048 ], "z_axis": [ 0.912, 0.364, -0.191 ], "quaternion": [ -0.135, 0.761, 0.127, 0.622 ] } }, { "index": 334, "index_chain": 334, "chain_name": "J", "nt_resnum": 374, "nt_name": "C", "nt_code": "C", "nt_id": "///J/374", "linked_nts": [ "///J/373", "///J/375" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -47.993, "beta": 155.151, "gamma": 53.049, "delta": 78.212, "epsilon": -146.327, "zeta": -72.561, "epsilon_zeta": -73.766, "bb_type": "BI", "chi": -165.007, "glyco_bond": "anti", "C5prime_xyz": [ -1.441, 8.827, 0.796 ], "P_xyz": [ 1.124, 9.240, 0.802 ], "form": "A", "ssZp": 4.505, "Dp": 4.605, "splay_angle": 25.303, "splay_distance": 4.148, "splay_ratio": 0.222, "d22": null, "d64": null, "eta": 164.978, "theta": -143.443, "eta_prime": -175.266, "theta_prime": -143.824, "eta_base": -122.390, "theta_base": -124.277, "v0": -1.939, "v1": -22.108, "v2": 36.398, "v3": -38.400, "v4": 25.461, "amplitude": 39.069, "phase_angle": 21.307, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.285, "filter_rmsd": 0.066, "frame": { "rmsd": 0.015, "origin": [ 289.652, 342.527, 252.135 ], "x_axis": [ 0.325, -0.627, 0.708 ], "y_axis": [ 0.209, -0.682, -0.701 ], "z_axis": [ 0.922, 0.376, -0.091 ], "quaternion": [ -0.372, 0.724, -0.144, 0.563 ] } }, { "index": 335, "index_chain": 335, "chain_name": "J", "nt_resnum": 375, "nt_name": "G", "nt_code": "G", "nt_id": "///J/375", "linked_nts": [ "///J/374", "///J/376" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack", "alpha": -65.748, "beta": 173.135, "gamma": 58.436, "delta": 78.566, "epsilon": -146.572, "zeta": -70.533, "epsilon_zeta": -76.038, "bb_type": "BI", "chi": -161.433, "glyco_bond": "anti", "C5prime_xyz": [ -1.696, 8.850, 0.569 ], "P_xyz": [ 0.791, 9.631, 0.785 ], "form": "A", "ssZp": 4.368, "Dp": 4.557, "splay_angle": 23.048, "splay_distance": 3.784, "splay_ratio": 0.202, "d22": null, "d64": null, "eta": 170.787, "theta": -145.079, "eta_prime": -176.387, "theta_prime": -144.013, "eta_base": -143.139, "theta_base": -114.344, "v0": -2.398, "v1": -21.282, "v2": 35.477, "v3": -37.822, "v4": 25.373, "amplitude": 38.287, "phase_angle": 22.089, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.929, "filter_rmsd": 0.019, "frame": { "rmsd": 0.019, "origin": [ 292.972, 344.521, 253.623 ], "x_axis": [ 0.225, -0.930, 0.290 ], "y_axis": [ 0.044, -0.288, -0.957 ], "z_axis": [ 0.973, 0.228, -0.023 ], "quaternion": [ -0.478, 0.620, -0.357, 0.510 ] } }, { "index": 336, "index_chain": 336, "chain_name": "J", "nt_resnum": 376, "nt_name": "U", "nt_code": "U", "nt_id": "///J/376", "linked_nts": [ "///J/375", null ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-pair-contact,ss-non-loop", "alpha": -69.726, "beta": 167.797, "gamma": 63.926, "delta": 77.988, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": -157.890, "glyco_bond": "anti", "C5prime_xyz": [ -1.681, 8.858, 0.349 ], "P_xyz": [ 0.801, 9.622, 0.072 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": -2.808, "v1": -21.106, "v2": 35.646, "v3": -38.204, "v4": 25.877, "amplitude": 38.625, "phase_angle": 22.652, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.780, "filter_rmsd": 0.102, "frame": { "rmsd": 0.009, "origin": [ 296.466, 344.313, 255.062 ], "x_axis": [ 0.160, -0.945, -0.284 ], "y_axis": [ 0.018, 0.291, -0.957 ], "z_axis": [ 0.987, 0.148, 0.063 ], "quaternion": [ 0.615, -0.449, 0.517, -0.391 ] } } ], "num_hbonds": 492, "hbonds": [ { "index": 1, "atom1_serNum": 33, "atom2_serNum": 49, "donAcc_type": "acceptable", "distance": 2.721, "atom1_id": "///J/2/O2'", "atom2_id": "///J/3/O5'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 2, "atom1_serNum": 40, "atom2_serNum": 1304, "donAcc_type": "standard", "distance": 2.614, "atom1_id": "///J/2/O6", "atom2_id": "///J/61/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 3, "atom1_serNum": 41, "atom2_serNum": 1302, "donAcc_type": "standard", "distance": 2.787, "atom1_id": "///J/2/N1", "atom2_id": "///J/61/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 4, "atom1_serNum": 43, "atom2_serNum": 1301, "donAcc_type": "standard", "distance": 2.734, "atom1_id": "///J/2/N2", "atom2_id": "///J/61/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 5, "atom1_serNum": 60, "atom2_serNum": 1282, "donAcc_type": "standard", "distance": 2.903, "atom1_id": "///J/3/O2", "atom2_id": "///J/60/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 6, "atom1_serNum": 60, "atom2_serNum": 1284, "donAcc_type": "standard", "distance": 2.943, "atom1_id": "///J/3/O2", "atom2_id": "///J/60/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 7, "atom1_serNum": 61, "atom2_serNum": 1281, "donAcc_type": "standard", "distance": 3.130, "atom1_id": "///J/3/N3", "atom2_id": "///J/60/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 8, "atom1_serNum": 63, "atom2_serNum": 83, "donAcc_type": "standard", "distance": 2.960, "atom1_id": "///J/3/O4", "atom2_id": "///J/4/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 9, "atom1_serNum": 76, "atom2_serNum": 90, "donAcc_type": "acceptable", "distance": 2.806, "atom1_id": "///J/4/O2'", "atom2_id": "///J/5/OP2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 10, "atom1_serNum": 83, "atom2_serNum": 1261, "donAcc_type": "standard", "distance": 2.815, "atom1_id": "///J/4/N6", "atom2_id": "///J/59/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 11, "atom1_serNum": 84, "atom2_serNum": 1259, "donAcc_type": "standard", "distance": 2.926, "atom1_id": "///J/4/N1", "atom2_id": "///J/59/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 12, "atom1_serNum": 98, "atom2_serNum": 113, "donAcc_type": "acceptable", "distance": 2.685, "atom1_id": "///J/5/O2'", "atom2_id": "///J/6/OP2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 13, "atom1_serNum": 105, "atom2_serNum": 1241, "donAcc_type": "standard", "distance": 2.890, "atom1_id": "///J/5/O6", "atom2_id": "///J/58/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 14, "atom1_serNum": 106, "atom2_serNum": 1239, "donAcc_type": "standard", "distance": 2.838, "atom1_id": "///J/5/N1", "atom2_id": "///J/58/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 15, "atom1_serNum": 108, "atom2_serNum": 1238, "donAcc_type": "standard", "distance": 2.662, "atom1_id": "///J/5/N2", "atom2_id": "///J/58/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 16, "atom1_serNum": 128, "atom2_serNum": 1219, "donAcc_type": "standard", "distance": 2.916, "atom1_id": "///J/6/O6", "atom2_id": "///J/57/N3", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 17, "atom1_serNum": 129, "atom2_serNum": 1218, "donAcc_type": "standard", "distance": 2.947, "atom1_id": "///J/6/N1", "atom2_id": "///J/57/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 18, "atom1_serNum": 131, "atom2_serNum": 1374, "donAcc_type": "standard", "distance": 3.498, "atom1_id": "///J/6/N2", "atom2_id": "///J/105/OP1", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 19, "atom1_serNum": 148, "atom2_serNum": 1201, "donAcc_type": "standard", "distance": 2.864, "atom1_id": "///J/7/O2", "atom2_id": "///J/56/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 20, "atom1_serNum": 149, "atom2_serNum": 1199, "donAcc_type": "standard", "distance": 3.015, "atom1_id": "///J/7/N3", "atom2_id": "///J/56/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 21, "atom1_serNum": 151, "atom2_serNum": 1198, "donAcc_type": "standard", "distance": 3.052, "atom1_id": "///J/7/N4", "atom2_id": "///J/56/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 22, "atom1_serNum": 164, "atom2_serNum": 1500, "donAcc_type": "acceptable", "distance": 2.486, "atom1_id": "///J/8/O2'", "atom2_id": "///J/110/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 23, "atom1_serNum": 171, "atom2_serNum": 1178, "donAcc_type": "standard", "distance": 3.447, "atom1_id": "///J/8/O6", "atom2_id": "///J/55/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 24, "atom1_serNum": 172, "atom2_serNum": 1176, "donAcc_type": "standard", "distance": 3.092, "atom1_id": "///J/8/N1", "atom2_id": "///J/55/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 25, "atom1_serNum": 174, "atom2_serNum": 1175, "donAcc_type": "standard", "distance": 2.664, "atom1_id": "///J/8/N2", "atom2_id": "///J/55/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 26, "atom1_serNum": 174, "atom2_serNum": 1502, "donAcc_type": "standard", "distance": 3.440, "atom1_id": "///J/8/N2", "atom2_id": "///J/110/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 27, "atom1_serNum": 192, "atom2_serNum": 1157, "donAcc_type": "standard", "distance": 2.951, "atom1_id": "///J/9/N3", "atom2_id": "///J/54/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 28, "atom1_serNum": 194, "atom2_serNum": 1156, "donAcc_type": "standard", "distance": 3.096, "atom1_id": "///J/9/O4", "atom2_id": "///J/54/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 29, "atom1_serNum": 207, "atom2_serNum": 220, "donAcc_type": "acceptable", "distance": 2.736, "atom1_id": "///J/10/O2'", "atom2_id": "///J/11/O5'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 30, "atom1_serNum": 212, "atom2_serNum": 940, "donAcc_type": "standard", "distance": 2.831, "atom1_id": "///J/10/N3", "atom2_id": "///J/44/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 31, "atom1_serNum": 214, "atom2_serNum": 939, "donAcc_type": "standard", "distance": 3.102, "atom1_id": "///J/10/O4", "atom2_id": "///J/44/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 32, "atom1_serNum": 234, "atom2_serNum": 919, "donAcc_type": "standard", "distance": 3.015, "atom1_id": "///J/11/O6", "atom2_id": "///J/43/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 33, "atom1_serNum": 235, "atom2_serNum": 917, "donAcc_type": "standard", "distance": 3.031, "atom1_id": "///J/11/N1", "atom2_id": "///J/43/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 34, "atom1_serNum": 237, "atom2_serNum": 916, "donAcc_type": "standard", "distance": 2.936, "atom1_id": "///J/11/N2", "atom2_id": "///J/43/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 35, "atom1_serNum": 254, "atom2_serNum": 899, "donAcc_type": "standard", "distance": 2.849, "atom1_id": "///J/12/O2", "atom2_id": "///J/42/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 36, "atom1_serNum": 255, "atom2_serNum": 897, "donAcc_type": "standard", "distance": 2.957, "atom1_id": "///J/12/N3", "atom2_id": "///J/42/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 37, "atom1_serNum": 257, "atom2_serNum": 896, "donAcc_type": "standard", "distance": 2.961, "atom1_id": "///J/12/N4", "atom2_id": "///J/42/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 38, "atom1_serNum": 277, "atom2_serNum": 876, "donAcc_type": "standard", "distance": 3.002, "atom1_id": "///J/13/O6", "atom2_id": "///J/41/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 39, "atom1_serNum": 278, "atom2_serNum": 874, "donAcc_type": "standard", "distance": 2.942, "atom1_id": "///J/13/N1", "atom2_id": "///J/41/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 40, "atom1_serNum": 280, "atom2_serNum": 873, "donAcc_type": "standard", "distance": 2.813, "atom1_id": "///J/13/N2", "atom2_id": "///J/41/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 41, "atom1_serNum": 293, "atom2_serNum": 317, "donAcc_type": "acceptable", "distance": 3.098, "atom1_id": "///J/14/O2'", "atom2_id": "///J/15/N7", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 42, "atom1_serNum": 297, "atom2_serNum": 854, "donAcc_type": "standard", "distance": 3.388, "atom1_id": "///J/14/O2", "atom2_id": "///J/40/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 43, "atom1_serNum": 297, "atom2_serNum": 855, "donAcc_type": "questionable", "distance": 3.007, "atom1_id": "///J/14/O2", "atom2_id": "///J/40/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 44, "atom1_serNum": 320, "atom2_serNum": 6166, "donAcc_type": "standard", "distance": 2.527, "atom1_id": "///J/15/N6", "atom2_id": "///J/328/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 45, "atom1_serNum": 321, "atom2_serNum": 6165, "donAcc_type": "standard", "distance": 2.626, "atom1_id": "///J/15/N1", "atom2_id": "///J/328/N6", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 46, "atom1_serNum": 335, "atom2_serNum": 348, "donAcc_type": "acceptable", "distance": 2.619, "atom1_id": "///J/16/O2'", "atom2_id": "///J/17/O5'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 47, "atom1_serNum": 339, "atom2_serNum": 6187, "donAcc_type": "standard", "distance": 2.759, "atom1_id": "///J/16/O2", "atom2_id": "///J/329/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 48, "atom1_serNum": 355, "atom2_serNum": 6253, "donAcc_type": "acceptable", "distance": 3.444, "atom1_id": "///J/17/O2'", "atom2_id": "///J/332/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 49, "atom1_serNum": 360, "atom2_serNum": 833, "donAcc_type": "standard", "distance": 3.004, "atom1_id": "///J/17/N3", "atom2_id": "///J/39/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 50, "atom1_serNum": 362, "atom2_serNum": 832, "donAcc_type": "standard", "distance": 3.125, "atom1_id": "///J/17/O4", "atom2_id": "///J/39/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 51, "atom1_serNum": 380, "atom2_serNum": 811, "donAcc_type": "standard", "distance": 3.030, "atom1_id": "///J/18/N3", "atom2_id": "///J/38/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 52, "atom1_serNum": 382, "atom2_serNum": 810, "donAcc_type": "standard", "distance": 3.210, "atom1_id": "///J/18/O4", "atom2_id": "///J/38/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 53, "atom1_serNum": 399, "atom2_serNum": 788, "donAcc_type": "standard", "distance": 2.943, "atom1_id": "///J/19/O2", "atom2_id": "///J/37/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 54, "atom1_serNum": 400, "atom2_serNum": 787, "donAcc_type": "standard", "distance": 3.066, "atom1_id": "///J/19/N3", "atom2_id": "///J/37/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 55, "atom1_serNum": 422, "atom2_serNum": 767, "donAcc_type": "standard", "distance": 2.819, "atom1_id": "///J/20/O6", "atom2_id": "///J/36/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 56, "atom1_serNum": 423, "atom2_serNum": 765, "donAcc_type": "standard", "distance": 2.864, "atom1_id": "///J/20/N1", "atom2_id": "///J/36/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 57, "atom1_serNum": 425, "atom2_serNum": 764, "donAcc_type": "standard", "distance": 2.800, "atom1_id": "///J/20/N2", "atom2_id": "///J/36/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 58, "atom1_serNum": 425, "atom2_serNum": 1406, "donAcc_type": "acceptable", "distance": 3.620, "atom1_id": "///J/20/N2", "atom2_id": "///J/106/O2'", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 59, "atom1_serNum": 438, "atom2_serNum": 1393, "donAcc_type": "acceptable", "distance": 3.333, "atom1_id": "///J/21/O2'", "atom2_id": "///J/105/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 60, "atom1_serNum": 443, "atom2_serNum": 746, "donAcc_type": "standard", "distance": 2.839, "atom1_id": "///J/21/N3", "atom2_id": "///J/35/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 61, "atom1_serNum": 445, "atom2_serNum": 745, "donAcc_type": "standard", "distance": 2.869, "atom1_id": "///J/21/O4", "atom2_id": "///J/35/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 62, "atom1_serNum": 462, "atom2_serNum": 723, "donAcc_type": "standard", "distance": 3.320, "atom1_id": "///J/22/O2", "atom2_id": "///J/34/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 63, "atom1_serNum": 463, "atom2_serNum": 722, "donAcc_type": "standard", "distance": 3.397, "atom1_id": "///J/22/N3", "atom2_id": "///J/34/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 64, "atom1_serNum": 485, "atom2_serNum": 702, "donAcc_type": "standard", "distance": 3.042, "atom1_id": "///J/23/O6", "atom2_id": "///J/33/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 65, "atom1_serNum": 486, "atom2_serNum": 700, "donAcc_type": "standard", "distance": 2.970, "atom1_id": "///J/23/N1", "atom2_id": "///J/33/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 66, "atom1_serNum": 488, "atom2_serNum": 699, "donAcc_type": "standard", "distance": 2.819, "atom1_id": "///J/23/N2", "atom2_id": "///J/33/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 67, "atom1_serNum": 505, "atom2_serNum": 682, "donAcc_type": "standard", "distance": 2.808, "atom1_id": "///J/24/O2", "atom2_id": "///J/32/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 68, "atom1_serNum": 506, "atom2_serNum": 680, "donAcc_type": "standard", "distance": 2.926, "atom1_id": "///J/24/N3", "atom2_id": "///J/32/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 69, "atom1_serNum": 508, "atom2_serNum": 679, "donAcc_type": "standard", "distance": 2.927, "atom1_id": "///J/24/N4", "atom2_id": "///J/32/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 70, "atom1_serNum": 525, "atom2_serNum": 657, "donAcc_type": "standard", "distance": 3.063, "atom1_id": "///J/25/O2", "atom2_id": "///J/31/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 71, "atom1_serNum": 526, "atom2_serNum": 656, "donAcc_type": "standard", "distance": 3.234, "atom1_id": "///J/25/N3", "atom2_id": "///J/31/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 72, "atom1_serNum": 545, "atom2_serNum": 631, "donAcc_type": "questionable", "distance": 2.868, "atom1_id": "///J/26/O2", "atom2_id": "///J/30/N7", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 73, "atom1_serNum": 546, "atom2_serNum": 634, "donAcc_type": "standard", "distance": 3.819, "atom1_id": "///J/26/N3", "atom2_id": "///J/30/N6", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 74, "atom1_serNum": 561, "atom2_serNum": 576, "donAcc_type": "acceptable", "distance": 2.607, "atom1_id": "///J/27/O2'", "atom2_id": "///J/28/O5'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 75, "atom1_serNum": 561, "atom2_serNum": 579, "donAcc_type": "acceptable", "distance": 2.947, "atom1_id": "///J/27/O2'", "atom2_id": "///J/28/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 76, "atom1_serNum": 583, "atom2_serNum": 593, "donAcc_type": "acceptable", "distance": 2.977, "atom1_id": "///J/28/O2'", "atom2_id": "///J/28/N3", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 77, "atom1_serNum": 627, "atom2_serNum": 645, "donAcc_type": "acceptable", "distance": 2.827, "atom1_id": "///J/30/O2'", "atom2_id": "///J/31/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 78, "atom1_serNum": 649, "atom2_serNum": 665, "donAcc_type": "acceptable", "distance": 2.939, "atom1_id": "///J/31/O2'", "atom2_id": "///J/32/O5'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 79, "atom1_serNum": 780, "atom2_serNum": 1417, "donAcc_type": "acceptable", "distance": 2.802, "atom1_id": "///J/37/O2'", "atom2_id": "///J/107/OP1", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 80, "atom1_serNum": 825, "atom2_serNum": 6178, "donAcc_type": "acceptable", "distance": 3.573, "atom1_id": "///J/39/O2'", "atom2_id": "///J/329/O3'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 81, "atom1_serNum": 835, "atom2_serNum": 6180, "donAcc_type": "acceptable", "distance": 3.084, "atom1_id": "///J/39/N3", "atom2_id": "///J/329/O2'", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 82, "atom1_serNum": 847, "atom2_serNum": 6168, "donAcc_type": "acceptable", "distance": 3.085, "atom1_id": "///J/40/O2'", "atom2_id": "///J/328/N3", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 83, "atom1_serNum": 847, "atom2_serNum": 6176, "donAcc_type": "acceptable", "distance": 3.619, "atom1_id": "///J/40/O2'", "atom2_id": "///J/329/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 84, "atom1_serNum": 867, "atom2_serNum": 6362, "donAcc_type": "standard", "distance": 3.389, "atom1_id": "///J/41/O3'", "atom2_id": "///J/337/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 85, "atom1_serNum": 869, "atom2_serNum": 6337, "donAcc_type": "acceptable", "distance": 2.959, "atom1_id": "///J/41/O2'", "atom2_id": "///J/336/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 86, "atom1_serNum": 869, "atom2_serNum": 6338, "donAcc_type": "acceptable", "distance": 2.648, "atom1_id": "///J/41/O2'", "atom2_id": "///J/336/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 87, "atom1_serNum": 912, "atom2_serNum": 923, "donAcc_type": "acceptable", "distance": 2.603, "atom1_id": "///J/43/O2'", "atom2_id": "///J/44/OP1", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 88, "atom1_serNum": 912, "atom2_serNum": 925, "donAcc_type": "acceptable", "distance": 3.057, "atom1_id": "///J/43/O2'", "atom2_id": "///J/44/O5'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 89, "atom1_serNum": 954, "atom2_serNum": 1541, "donAcc_type": "acceptable", "distance": 3.148, "atom1_id": "///J/45/O2'", "atom2_id": "///J/112/O2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 90, "atom1_serNum": 983, "atom2_serNum": 1689, "donAcc_type": "standard", "distance": 2.859, "atom1_id": "///J/46/O6", "atom2_id": "///J/119/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 91, "atom1_serNum": 984, "atom2_serNum": 1687, "donAcc_type": "standard", "distance": 2.848, "atom1_id": "///J/46/N1", "atom2_id": "///J/119/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 92, "atom1_serNum": 986, "atom2_serNum": 1686, "donAcc_type": "standard", "distance": 2.724, "atom1_id": "///J/46/N2", "atom2_id": "///J/119/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 93, "atom1_serNum": 1006, "atom2_serNum": 1669, "donAcc_type": "standard", "distance": 2.988, "atom1_id": "///J/47/O6", "atom2_id": "///J/118/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 94, "atom1_serNum": 1007, "atom2_serNum": 1667, "donAcc_type": "standard", "distance": 2.955, "atom1_id": "///J/47/N1", "atom2_id": "///J/118/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 95, "atom1_serNum": 1009, "atom2_serNum": 1666, "donAcc_type": "standard", "distance": 2.804, "atom1_id": "///J/47/N2", "atom2_id": "///J/118/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 96, "atom1_serNum": 1026, "atom2_serNum": 1649, "donAcc_type": "standard", "distance": 2.782, "atom1_id": "///J/48/O2", "atom2_id": "///J/117/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 97, "atom1_serNum": 1027, "atom2_serNum": 1647, "donAcc_type": "standard", "distance": 2.942, "atom1_id": "///J/48/N3", "atom2_id": "///J/117/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 98, "atom1_serNum": 1029, "atom2_serNum": 1646, "donAcc_type": "standard", "distance": 3.032, "atom1_id": "///J/48/N4", "atom2_id": "///J/117/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 99, "atom1_serNum": 1049, "atom2_serNum": 1626, "donAcc_type": "standard", "distance": 2.702, "atom1_id": "///J/49/N6", "atom2_id": "///J/116/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 100, "atom1_serNum": 1071, "atom2_serNum": 1606, "donAcc_type": "standard", "distance": 2.846, "atom1_id": "///J/50/N6", "atom2_id": "///J/115/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 101, "atom1_serNum": 1072, "atom2_serNum": 1604, "donAcc_type": "standard", "distance": 2.833, "atom1_id": "///J/50/N1", "atom2_id": "///J/115/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 102, "atom1_serNum": 1086, "atom2_serNum": 1097, "donAcc_type": "acceptable", "distance": 2.634, "atom1_id": "///J/51/O2'", "atom2_id": "///J/52/OP1", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 103, "atom1_serNum": 1091, "atom2_serNum": 1585, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///J/51/N3", "atom2_id": "///J/114/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 104, "atom1_serNum": 1093, "atom2_serNum": 1584, "donAcc_type": "standard", "distance": 2.942, "atom1_id": "///J/51/O4", "atom2_id": "///J/114/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 105, "atom1_serNum": 1106, "atom2_serNum": 1122, "donAcc_type": "acceptable", "distance": 3.021, "atom1_id": "///J/52/O2'", "atom2_id": "///J/53/O5'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 106, "atom1_serNum": 1113, "atom2_serNum": 1564, "donAcc_type": "standard", "distance": 2.763, "atom1_id": "///J/52/O6", "atom2_id": "///J/113/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 107, "atom1_serNum": 1133, "atom2_serNum": 1524, "donAcc_type": "standard", "distance": 2.731, "atom1_id": "///J/53/O2", "atom2_id": "///J/111/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 108, "atom1_serNum": 1134, "atom2_serNum": 1522, "donAcc_type": "standard", "distance": 2.927, "atom1_id": "///J/53/N3", "atom2_id": "///J/111/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 109, "atom1_serNum": 1136, "atom2_serNum": 1521, "donAcc_type": "standard", "distance": 2.976, "atom1_id": "///J/53/N4", "atom2_id": "///J/111/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 110, "atom1_serNum": 1171, "atom2_serNum": 1492, "donAcc_type": "acceptable", "distance": 2.757, "atom1_id": "///J/55/O2'", "atom2_id": "///J/110/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 111, "atom1_serNum": 1187, "atom2_serNum": 1492, "donAcc_type": "acceptable", "distance": 2.860, "atom1_id": "///J/56/O4'", "atom2_id": "///J/110/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 112, "atom1_serNum": 1191, "atom2_serNum": 1205, "donAcc_type": "acceptable", "distance": 2.662, "atom1_id": "///J/56/O2'", "atom2_id": "///J/57/OP1", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 113, "atom1_serNum": 1201, "atom2_serNum": 1477, "donAcc_type": "questionable", "distance": 3.778, "atom1_id": "///J/56/N2", "atom2_id": "///J/109/N6", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 114, "atom1_serNum": 1214, "atom2_serNum": 1455, "donAcc_type": "acceptable", "distance": 3.672, "atom1_id": "///J/57/O2'", "atom2_id": "///J/108/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 115, "atom1_serNum": 1234, "atom2_serNum": 1361, "donAcc_type": "acceptable", "distance": 2.342, "atom1_id": "///J/58/O2'", "atom2_id": "///J/104/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 116, "atom1_serNum": 1238, "atom2_serNum": 1361, "donAcc_type": "acceptable", "distance": 3.346, "atom1_id": "///J/58/O2", "atom2_id": "///J/104/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 117, "atom1_serNum": 1250, "atom2_serNum": 1361, "donAcc_type": "acceptable", "distance": 3.221, "atom1_id": "///J/59/O4'", "atom2_id": "///J/104/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 118, "atom1_serNum": 1254, "atom2_serNum": 1349, "donAcc_type": "acceptable", "distance": 2.898, "atom1_id": "///J/59/O2'", "atom2_id": "///J/103/N3", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 119, "atom1_serNum": 1270, "atom2_serNum": 1324, "donAcc_type": "standard", "distance": 3.346, "atom1_id": "///J/60/O4'", "atom2_id": "///J/102/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 120, "atom1_serNum": 1274, "atom2_serNum": 1290, "donAcc_type": "acceptable", "distance": 2.947, "atom1_id": "///J/60/O2'", "atom2_id": "///J/61/O5'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 121, "atom1_serNum": 1274, "atom2_serNum": 1324, "donAcc_type": "acceptable", "distance": 2.847, "atom1_id": "///J/60/O2'", "atom2_id": "///J/102/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 122, "atom1_serNum": 1514, "atom2_serNum": 1549, "donAcc_type": "acceptable", "distance": 3.068, "atom1_id": "///J/111/O2'", "atom2_id": "///J/113/OP2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 123, "atom1_serNum": 1514, "atom2_serNum": 1561, "donAcc_type": "acceptable", "distance": 2.826, "atom1_id": "///J/111/O2'", "atom2_id": "///J/113/O2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 124, "atom1_serNum": 1577, "atom2_serNum": 1592, "donAcc_type": "acceptable", "distance": 3.139, "atom1_id": "///J/114/O2'", "atom2_id": "///J/115/O5'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 125, "atom1_serNum": 1706, "atom2_serNum": 4686, "donAcc_type": "standard", "distance": 2.332, "atom1_id": "///J/120/O2", "atom2_id": "///J/259/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 126, "atom1_serNum": 1707, "atom2_serNum": 4684, "donAcc_type": "standard", "distance": 2.442, "atom1_id": "///J/120/N3", "atom2_id": "///J/259/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 127, "atom1_serNum": 1709, "atom2_serNum": 4683, "donAcc_type": "standard", "distance": 2.364, "atom1_id": "///J/120/N4", "atom2_id": "///J/259/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 128, "atom1_serNum": 1729, "atom2_serNum": 4663, "donAcc_type": "standard", "distance": 3.068, "atom1_id": "///J/121/O6", "atom2_id": "///J/258/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 129, "atom1_serNum": 1730, "atom2_serNum": 4661, "donAcc_type": "standard", "distance": 2.970, "atom1_id": "///J/121/N1", "atom2_id": "///J/258/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 130, "atom1_serNum": 1732, "atom2_serNum": 4660, "donAcc_type": "standard", "distance": 2.897, "atom1_id": "///J/121/N2", "atom2_id": "///J/258/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 131, "atom1_serNum": 1732, "atom2_serNum": 4748, "donAcc_type": "questionable", "distance": 3.122, "atom1_id": "///J/121/N2", "atom2_id": "///J/262/N6", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 132, "atom1_serNum": 1749, "atom2_serNum": 4641, "donAcc_type": "standard", "distance": 2.939, "atom1_id": "///J/122/O2", "atom2_id": "///J/257/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 133, "atom1_serNum": 1749, "atom2_serNum": 4643, "donAcc_type": "standard", "distance": 3.321, "atom1_id": "///J/122/O2", "atom2_id": "///J/257/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 134, "atom1_serNum": 1750, "atom2_serNum": 4640, "donAcc_type": "standard", "distance": 3.140, "atom1_id": "///J/122/N3", "atom2_id": "///J/257/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 135, "atom1_serNum": 1769, "atom2_serNum": 4620, "donAcc_type": "standard", "distance": 2.427, "atom1_id": "///J/123/O2", "atom2_id": "///J/256/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 136, "atom1_serNum": 1770, "atom2_serNum": 4618, "donAcc_type": "standard", "distance": 2.718, "atom1_id": "///J/123/N3", "atom2_id": "///J/256/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 137, "atom1_serNum": 1772, "atom2_serNum": 4617, "donAcc_type": "standard", "distance": 2.851, "atom1_id": "///J/123/N4", "atom2_id": "///J/256/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 138, "atom1_serNum": 1792, "atom2_serNum": 4597, "donAcc_type": "standard", "distance": 2.916, "atom1_id": "///J/124/O6", "atom2_id": "///J/255/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 139, "atom1_serNum": 1793, "atom2_serNum": 4595, "donAcc_type": "standard", "distance": 2.923, "atom1_id": "///J/124/N1", "atom2_id": "///J/255/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 140, "atom1_serNum": 1795, "atom2_serNum": 4594, "donAcc_type": "standard", "distance": 2.841, "atom1_id": "///J/124/N2", "atom2_id": "///J/255/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 141, "atom1_serNum": 1812, "atom2_serNum": 4577, "donAcc_type": "standard", "distance": 2.828, "atom1_id": "///J/125/O2", "atom2_id": "///J/254/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 142, "atom1_serNum": 1813, "atom2_serNum": 4575, "donAcc_type": "standard", "distance": 2.897, "atom1_id": "///J/125/N3", "atom2_id": "///J/254/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 143, "atom1_serNum": 1815, "atom2_serNum": 4574, "donAcc_type": "standard", "distance": 2.811, "atom1_id": "///J/125/N4", "atom2_id": "///J/254/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 144, "atom1_serNum": 1835, "atom2_serNum": 4554, "donAcc_type": "standard", "distance": 2.977, "atom1_id": "///J/126/N6", "atom2_id": "///J/253/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 145, "atom1_serNum": 1836, "atom2_serNum": 4552, "donAcc_type": "standard", "distance": 2.859, "atom1_id": "///J/126/N1", "atom2_id": "///J/253/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 146, "atom1_serNum": 1850, "atom2_serNum": 1865, "donAcc_type": "acceptable", "distance": 2.955, "atom1_id": "///J/127/O2'", "atom2_id": "///J/128/O5'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 147, "atom1_serNum": 1857, "atom2_serNum": 4534, "donAcc_type": "standard", "distance": 3.010, "atom1_id": "///J/127/N6", "atom2_id": "///J/252/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 148, "atom1_serNum": 1858, "atom2_serNum": 4532, "donAcc_type": "standard", "distance": 2.919, "atom1_id": "///J/127/N1", "atom2_id": "///J/252/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 149, "atom1_serNum": 1879, "atom2_serNum": 4514, "donAcc_type": "standard", "distance": 3.052, "atom1_id": "///J/128/N6", "atom2_id": "///J/251/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 150, "atom1_serNum": 1880, "atom2_serNum": 4512, "donAcc_type": "standard", "distance": 2.977, "atom1_id": "///J/128/N1", "atom2_id": "///J/251/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 151, "atom1_serNum": 1898, "atom2_serNum": 4494, "donAcc_type": "standard", "distance": 2.898, "atom1_id": "///J/129/O2", "atom2_id": "///J/250/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 152, "atom1_serNum": 1899, "atom2_serNum": 4492, "donAcc_type": "standard", "distance": 3.014, "atom1_id": "///J/129/N3", "atom2_id": "///J/250/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 153, "atom1_serNum": 1901, "atom2_serNum": 4491, "donAcc_type": "standard", "distance": 3.059, "atom1_id": "///J/129/N4", "atom2_id": "///J/250/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 154, "atom1_serNum": 1914, "atom2_serNum": 4469, "donAcc_type": "acceptable", "distance": 2.905, "atom1_id": "///J/130/O2'", "atom2_id": "///J/249/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 155, "atom1_serNum": 1921, "atom2_serNum": 4419, "donAcc_type": "acceptable", "distance": 2.964, "atom1_id": "///J/130/O6", "atom2_id": "///J/247/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 156, "atom1_serNum": 1922, "atom2_serNum": 4434, "donAcc_type": "standard", "distance": 3.342, "atom1_id": "///J/130/N1", "atom2_id": "///J/248/OP2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 157, "atom1_serNum": 1924, "atom2_serNum": 4466, "donAcc_type": "standard", "distance": 2.902, "atom1_id": "///J/130/N2", "atom2_id": "///J/249/N7", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 158, "atom1_serNum": 1925, "atom2_serNum": 4469, "donAcc_type": "standard", "distance": 3.153, "atom1_id": "///J/130/N3", "atom2_id": "///J/249/N6", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 159, "atom1_serNum": 1929, "atom2_serNum": 4429, "donAcc_type": "standard", "distance": 3.624, "atom1_id": "///J/131/OP2", "atom2_id": "///J/247/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 160, "atom1_serNum": 1933, "atom2_serNum": 4447, "donAcc_type": "standard", "distance": 3.246, "atom1_id": "///J/131/O4'", "atom2_id": "///J/248/N3", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 161, "atom1_serNum": 1944, "atom2_serNum": 2136, "donAcc_type": "standard", "distance": 2.673, "atom1_id": "///J/131/N6", "atom2_id": "///J/140/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 162, "atom1_serNum": 1959, "atom2_serNum": 4894, "donAcc_type": "acceptable", "distance": 2.936, "atom1_id": "///J/132/O2'", "atom2_id": "///J/269/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 163, "atom1_serNum": 1959, "atom2_serNum": 4905, "donAcc_type": "acceptable", "distance": 3.245, "atom1_id": "///J/132/O2'", "atom2_id": "///J/269/N3", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 164, "atom1_serNum": 1966, "atom2_serNum": 4442, "donAcc_type": "acceptable", "distance": 3.390, "atom1_id": "///J/132/N6", "atom2_id": "///J/248/O2'", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 165, "atom1_serNum": 1966, "atom2_serNum": 4446, "donAcc_type": "standard", "distance": 3.080, "atom1_id": "///J/132/N6", "atom2_id": "///J/248/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 166, "atom1_serNum": 1967, "atom2_serNum": 5193, "donAcc_type": "acceptable", "distance": 2.963, "atom1_id": "///J/132/N1", "atom2_id": "///J/283/O2'", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 167, "atom1_serNum": 1969, "atom2_serNum": 4904, "donAcc_type": "standard", "distance": 3.282, "atom1_id": "///J/132/N3", "atom2_id": "///J/269/N2", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 168, "atom1_serNum": 1989, "atom2_serNum": 7037, "donAcc_type": "acceptable", "distance": 2.917, "atom1_id": "///J/133/N1", "atom2_id": "///J/369/O2'", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 169, "atom1_serNum": 1999, "atom2_serNum": 5908, "donAcc_type": "standard", "distance": 3.439, "atom1_id": "///J/134/O4'", "atom2_id": "///J/316/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 170, "atom1_serNum": 2003, "atom2_serNum": 5898, "donAcc_type": "acceptable", "distance": 2.704, "atom1_id": "///J/134/O2'", "atom2_id": "///J/316/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 171, "atom1_serNum": 2003, "atom2_serNum": 5917, "donAcc_type": "acceptable", "distance": 3.657, "atom1_id": "///J/134/O2'", "atom2_id": "///J/317/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 172, "atom1_serNum": 2007, "atom2_serNum": 7077, "donAcc_type": "acceptable", "distance": 2.898, "atom1_id": "///J/134/N7", "atom2_id": "///J/371/O2'", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 173, "atom1_serNum": 2010, "atom2_serNum": 5346, "donAcc_type": "standard", "distance": 3.076, "atom1_id": "///J/134/O6", "atom2_id": "///J/290/N3", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 174, "atom1_serNum": 2011, "atom2_serNum": 5345, "donAcc_type": "standard", "distance": 3.067, "atom1_id": "///J/134/N1", "atom2_id": "///J/290/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 175, "atom1_serNum": 2031, "atom2_serNum": 5327, "donAcc_type": "standard", "distance": 2.983, "atom1_id": "///J/135/N3", "atom2_id": "///J/289/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 176, "atom1_serNum": 2033, "atom2_serNum": 5326, "donAcc_type": "standard", "distance": 3.161, "atom1_id": "///J/135/O4", "atom2_id": "///J/289/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 177, "atom1_serNum": 2053, "atom2_serNum": 5306, "donAcc_type": "standard", "distance": 2.908, "atom1_id": "///J/136/O6", "atom2_id": "///J/288/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 178, "atom1_serNum": 2054, "atom2_serNum": 5304, "donAcc_type": "standard", "distance": 2.972, "atom1_id": "///J/136/N1", "atom2_id": "///J/288/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 179, "atom1_serNum": 2056, "atom2_serNum": 5303, "donAcc_type": "standard", "distance": 2.912, "atom1_id": "///J/136/N2", "atom2_id": "///J/288/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 180, "atom1_serNum": 2073, "atom2_serNum": 5284, "donAcc_type": "standard", "distance": 3.140, "atom1_id": "///J/137/O2", "atom2_id": "///J/287/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 181, "atom1_serNum": 2074, "atom2_serNum": 5283, "donAcc_type": "standard", "distance": 3.346, "atom1_id": "///J/137/N3", "atom2_id": "///J/287/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 182, "atom1_serNum": 2089, "atom2_serNum": 3150, "donAcc_type": "acceptable", "distance": 2.754, "atom1_id": "///J/138/O2'", "atom2_id": "///J/188/OP1", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 183, "atom1_serNum": 2096, "atom2_serNum": 5263, "donAcc_type": "standard", "distance": 3.036, "atom1_id": "///J/138/O6", "atom2_id": "///J/286/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 184, "atom1_serNum": 2097, "atom2_serNum": 5261, "donAcc_type": "standard", "distance": 2.990, "atom1_id": "///J/138/N1", "atom2_id": "///J/286/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 185, "atom1_serNum": 2099, "atom2_serNum": 5260, "donAcc_type": "standard", "distance": 2.867, "atom1_id": "///J/138/N2", "atom2_id": "///J/286/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 186, "atom1_serNum": 2112, "atom2_serNum": 3136, "donAcc_type": "acceptable", "distance": 2.572, "atom1_id": "///J/139/O2'", "atom2_id": "///J/187/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 187, "atom1_serNum": 2112, "atom2_serNum": 4405, "donAcc_type": "acceptable", "distance": 3.256, "atom1_id": "///J/139/O2'", "atom2_id": "///J/246/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 188, "atom1_serNum": 2116, "atom2_serNum": 5243, "donAcc_type": "standard", "distance": 2.736, "atom1_id": "///J/139/O2", "atom2_id": "///J/285/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 189, "atom1_serNum": 2117, "atom2_serNum": 5241, "donAcc_type": "standard", "distance": 2.963, "atom1_id": "///J/139/N3", "atom2_id": "///J/285/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 190, "atom1_serNum": 2119, "atom2_serNum": 5240, "donAcc_type": "standard", "distance": 3.062, "atom1_id": "///J/139/N4", "atom2_id": "///J/285/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 191, "atom1_serNum": 2136, "atom2_serNum": 4397, "donAcc_type": "acceptable", "distance": 3.861, "atom1_id": "///J/140/O2", "atom2_id": "///J/246/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 192, "atom1_serNum": 2152, "atom2_serNum": 2168, "donAcc_type": "acceptable", "distance": 3.128, "atom1_id": "///J/141/O2'", "atom2_id": "///J/142/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 193, "atom1_serNum": 2157, "atom2_serNum": 4411, "donAcc_type": "standard", "distance": 3.783, "atom1_id": "///J/141/N3", "atom2_id": "///J/247/OP2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 194, "atom1_serNum": 2159, "atom2_serNum": 4377, "donAcc_type": "acceptable", "distance": 2.182, "atom1_id": "///J/141/O4", "atom2_id": "///J/245/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 195, "atom1_serNum": 2179, "atom2_serNum": 2372, "donAcc_type": "standard", "distance": 3.455, "atom1_id": "///J/142/N4", "atom2_id": "///J/151/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 196, "atom1_serNum": 2185, "atom2_serNum": 3070, "donAcc_type": "acceptable", "distance": 3.365, "atom1_id": "///J/143/O5'", "atom2_id": "///J/184/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 197, "atom1_serNum": 2199, "atom2_serNum": 2500, "donAcc_type": "standard", "distance": 3.004, "atom1_id": "///J/143/O6", "atom2_id": "///J/157/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 198, "atom1_serNum": 2200, "atom2_serNum": 2498, "donAcc_type": "standard", "distance": 2.963, "atom1_id": "///J/143/N1", "atom2_id": "///J/157/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 199, "atom1_serNum": 2202, "atom2_serNum": 2497, "donAcc_type": "standard", "distance": 2.837, "atom1_id": "///J/143/N2", "atom2_id": "///J/157/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 200, "atom1_serNum": 2222, "atom2_serNum": 2480, "donAcc_type": "standard", "distance": 3.480, "atom1_id": "///J/144/O6", "atom2_id": "///J/156/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 201, "atom1_serNum": 2223, "atom2_serNum": 2478, "donAcc_type": "standard", "distance": 3.130, "atom1_id": "///J/144/N1", "atom2_id": "///J/156/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 202, "atom1_serNum": 2225, "atom2_serNum": 2477, "donAcc_type": "standard", "distance": 2.610, "atom1_id": "///J/144/N2", "atom2_id": "///J/156/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 203, "atom1_serNum": 2243, "atom2_serNum": 2459, "donAcc_type": "standard", "distance": 2.809, "atom1_id": "///J/145/N3", "atom2_id": "///J/155/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 204, "atom1_serNum": 2245, "atom2_serNum": 2458, "donAcc_type": "standard", "distance": 2.916, "atom1_id": "///J/145/O4", "atom2_id": "///J/155/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 205, "atom1_serNum": 2258, "atom2_serNum": 2276, "donAcc_type": "acceptable", "distance": 3.140, "atom1_id": "///J/146/O2'", "atom2_id": "///J/147/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 206, "atom1_serNum": 2265, "atom2_serNum": 2438, "donAcc_type": "standard", "distance": 2.942, "atom1_id": "///J/146/N6", "atom2_id": "///J/154/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 207, "atom1_serNum": 2266, "atom2_serNum": 2436, "donAcc_type": "standard", "distance": 2.786, "atom1_id": "///J/146/N1", "atom2_id": "///J/154/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 208, "atom1_serNum": 2287, "atom2_serNum": 2418, "donAcc_type": "standard", "distance": 2.799, "atom1_id": "///J/147/O6", "atom2_id": "///J/153/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 209, "atom1_serNum": 2288, "atom2_serNum": 2416, "donAcc_type": "standard", "distance": 2.935, "atom1_id": "///J/147/N1", "atom2_id": "///J/153/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 210, "atom1_serNum": 2290, "atom2_serNum": 2415, "donAcc_type": "standard", "distance": 2.891, "atom1_id": "///J/147/N2", "atom2_id": "///J/153/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 211, "atom1_serNum": 2307, "atom2_serNum": 2398, "donAcc_type": "standard", "distance": 2.659, "atom1_id": "///J/148/O2", "atom2_id": "///J/152/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 212, "atom1_serNum": 2307, "atom2_serNum": 2416, "donAcc_type": "questionable", "distance": 3.152, "atom1_id": "///J/148/O2", "atom2_id": "///J/153/N3", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 213, "atom1_serNum": 2308, "atom2_serNum": 2396, "donAcc_type": "standard", "distance": 3.509, "atom1_id": "///J/148/N3", "atom2_id": "///J/152/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 214, "atom1_serNum": 2365, "atom2_serNum": 2381, "donAcc_type": "acceptable", "distance": 2.470, "atom1_id": "///J/151/O2'", "atom2_id": "///J/152/O5'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 215, "atom1_serNum": 2388, "atom2_serNum": 2404, "donAcc_type": "acceptable", "distance": 2.649, "atom1_id": "///J/152/O2'", "atom2_id": "///J/153/O5'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 216, "atom1_serNum": 2388, "atom2_serNum": 2407, "donAcc_type": "acceptable", "distance": 2.450, "atom1_id": "///J/152/O2'", "atom2_id": "///J/153/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 217, "atom1_serNum": 2518, "atom2_serNum": 3078, "donAcc_type": "standard", "distance": 3.597, "atom1_id": "///J/158/N3", "atom2_id": "///J/184/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 218, "atom1_serNum": 2520, "atom2_serNum": 3077, "donAcc_type": "standard", "distance": 3.808, "atom1_id": "///J/158/O4", "atom2_id": "///J/184/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 219, "atom1_serNum": 2533, "atom2_serNum": 2552, "donAcc_type": "acceptable", "distance": 3.223, "atom1_id": "///J/159/O2'", "atom2_id": "///J/160/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 220, "atom1_serNum": 2540, "atom2_serNum": 3057, "donAcc_type": "standard", "distance": 3.018, "atom1_id": "///J/159/O6", "atom2_id": "///J/183/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 221, "atom1_serNum": 2541, "atom2_serNum": 3055, "donAcc_type": "standard", "distance": 2.903, "atom1_id": "///J/159/N1", "atom2_id": "///J/183/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 222, "atom1_serNum": 2543, "atom2_serNum": 3054, "donAcc_type": "standard", "distance": 2.709, "atom1_id": "///J/159/N2", "atom2_id": "///J/183/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 223, "atom1_serNum": 2560, "atom2_serNum": 3037, "donAcc_type": "standard", "distance": 2.653, "atom1_id": "///J/160/O2", "atom2_id": "///J/182/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 224, "atom1_serNum": 2561, "atom2_serNum": 3035, "donAcc_type": "standard", "distance": 2.863, "atom1_id": "///J/160/N3", "atom2_id": "///J/182/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 225, "atom1_serNum": 2563, "atom2_serNum": 3034, "donAcc_type": "standard", "distance": 2.968, "atom1_id": "///J/160/N4", "atom2_id": "///J/182/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 226, "atom1_serNum": 2581, "atom2_serNum": 3013, "donAcc_type": "standard", "distance": 2.803, "atom1_id": "///J/161/N3", "atom2_id": "///J/181/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 227, "atom1_serNum": 2583, "atom2_serNum": 3012, "donAcc_type": "standard", "distance": 2.970, "atom1_id": "///J/161/O4", "atom2_id": "///J/181/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 228, "atom1_serNum": 2603, "atom2_serNum": 2992, "donAcc_type": "standard", "distance": 2.934, "atom1_id": "///J/162/N6", "atom2_id": "///J/180/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 229, "atom1_serNum": 2604, "atom2_serNum": 2990, "donAcc_type": "standard", "distance": 2.897, "atom1_id": "///J/162/N1", "atom2_id": "///J/180/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 230, "atom1_serNum": 2618, "atom2_serNum": 2637, "donAcc_type": "acceptable", "distance": 3.276, "atom1_id": "///J/163/O2'", "atom2_id": "///J/164/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 231, "atom1_serNum": 2618, "atom2_serNum": 2970, "donAcc_type": "acceptable", "distance": 2.714, "atom1_id": "///J/163/O2'", "atom2_id": "///J/179/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 232, "atom1_serNum": 2628, "atom2_serNum": 2967, "donAcc_type": "standard", "distance": 2.651, "atom1_id": "///J/163/N2", "atom2_id": "///J/179/N7", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 233, "atom1_serNum": 2629, "atom2_serNum": 2970, "donAcc_type": "standard", "distance": 2.999, "atom1_id": "///J/163/N3", "atom2_id": "///J/179/N6", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 234, "atom1_serNum": 2648, "atom2_serNum": 2941, "donAcc_type": "acceptable", "distance": 3.424, "atom1_id": "///J/164/N6", "atom2_id": "///J/178/O2'", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 235, "atom1_serNum": 2670, "atom2_serNum": 2926, "donAcc_type": "standard", "distance": 3.088, "atom1_id": "///J/165/O6", "atom2_id": "///J/177/N3", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 236, "atom1_serNum": 2671, "atom2_serNum": 2925, "donAcc_type": "standard", "distance": 2.371, "atom1_id": "///J/165/N1", "atom2_id": "///J/177/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 237, "atom1_serNum": 2673, "atom2_serNum": 2925, "donAcc_type": "standard", "distance": 3.365, "atom1_id": "///J/165/N2", "atom2_id": "///J/177/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 238, "atom1_serNum": 2691, "atom2_serNum": 2907, "donAcc_type": "standard", "distance": 2.698, "atom1_id": "///J/166/N3", "atom2_id": "///J/176/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 239, "atom1_serNum": 2693, "atom2_serNum": 2906, "donAcc_type": "standard", "distance": 2.996, "atom1_id": "///J/166/O4", "atom2_id": "///J/176/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 240, "atom1_serNum": 2710, "atom2_serNum": 2886, "donAcc_type": "standard", "distance": 2.634, "atom1_id": "///J/167/O2", "atom2_id": "///J/175/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 241, "atom1_serNum": 2711, "atom2_serNum": 2884, "donAcc_type": "standard", "distance": 2.837, "atom1_id": "///J/167/N3", "atom2_id": "///J/175/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 242, "atom1_serNum": 2713, "atom2_serNum": 2883, "donAcc_type": "standard", "distance": 2.967, "atom1_id": "///J/167/N4", "atom2_id": "///J/175/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 243, "atom1_serNum": 2730, "atom2_serNum": 2863, "donAcc_type": "standard", "distance": 2.295, "atom1_id": "///J/168/O2", "atom2_id": "///J/174/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 244, "atom1_serNum": 2731, "atom2_serNum": 2861, "donAcc_type": "questionable", "distance": 2.387, "atom1_id": "///J/168/N3", "atom2_id": "///J/174/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 245, "atom1_serNum": 2733, "atom2_serNum": 2860, "donAcc_type": "questionable", "distance": 2.277, "atom1_id": "///J/168/O4", "atom2_id": "///J/174/O6", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 246, "atom1_serNum": 2746, "atom2_serNum": 2838, "donAcc_type": "acceptable", "distance": 3.242, "atom1_id": "///J/169/O2'", "atom2_id": "///J/173/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 247, "atom1_serNum": 2750, "atom2_serNum": 2838, "donAcc_type": "standard", "distance": 2.487, "atom1_id": "///J/169/O2", "atom2_id": "///J/173/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 248, "atom1_serNum": 3092, "atom2_serNum": 3106, "donAcc_type": "acceptable", "distance": 2.683, "atom1_id": "///J/185/O2'", "atom2_id": "///J/186/OP2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 249, "atom1_serNum": 3092, "atom2_serNum": 3107, "donAcc_type": "acceptable", "distance": 3.119, "atom1_id": "///J/185/O2'", "atom2_id": "///J/186/O5'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 250, "atom1_serNum": 3099, "atom2_serNum": 4384, "donAcc_type": "standard", "distance": 2.884, "atom1_id": "///J/185/N6", "atom2_id": "///J/245/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 251, "atom1_serNum": 3100, "atom2_serNum": 4382, "donAcc_type": "standard", "distance": 2.953, "atom1_id": "///J/185/N1", "atom2_id": "///J/245/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 252, "atom1_serNum": 3121, "atom2_serNum": 4364, "donAcc_type": "standard", "distance": 2.991, "atom1_id": "///J/186/N6", "atom2_id": "///J/244/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 253, "atom1_serNum": 3122, "atom2_serNum": 4362, "donAcc_type": "standard", "distance": 2.919, "atom1_id": "///J/186/N1", "atom2_id": "///J/244/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 254, "atom1_serNum": 3132, "atom2_serNum": 4404, "donAcc_type": "standard", "distance": 3.759, "atom1_id": "///J/187/O4'", "atom2_id": "///J/246/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 255, "atom1_serNum": 3143, "atom2_serNum": 4344, "donAcc_type": "standard", "distance": 2.941, "atom1_id": "///J/187/O6", "atom2_id": "///J/243/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 256, "atom1_serNum": 3144, "atom2_serNum": 4342, "donAcc_type": "standard", "distance": 3.021, "atom1_id": "///J/187/N1", "atom2_id": "///J/243/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 257, "atom1_serNum": 3146, "atom2_serNum": 4341, "donAcc_type": "standard", "distance": 2.960, "atom1_id": "///J/187/N2", "atom2_id": "///J/243/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 258, "atom1_serNum": 3146, "atom2_serNum": 5272, "donAcc_type": "standard", "distance": 3.529, "atom1_id": "///J/187/N2", "atom2_id": "///J/287/O4'", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 259, "atom1_serNum": 3157, "atom2_serNum": 5286, "donAcc_type": "standard", "distance": 3.507, "atom1_id": "///J/188/O3'", "atom2_id": "///J/287/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 260, "atom1_serNum": 3159, "atom2_serNum": 3175, "donAcc_type": "acceptable", "distance": 3.184, "atom1_id": "///J/188/O2'", "atom2_id": "///J/189/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 261, "atom1_serNum": 3159, "atom2_serNum": 5276, "donAcc_type": "acceptable", "distance": 3.162, "atom1_id": "///J/188/O2'", "atom2_id": "///J/287/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 262, "atom1_serNum": 3159, "atom2_serNum": 5287, "donAcc_type": "acceptable", "distance": 3.270, "atom1_id": "///J/188/O2'", "atom2_id": "///J/287/N3", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 263, "atom1_serNum": 3163, "atom2_serNum": 4322, "donAcc_type": "standard", "distance": 2.925, "atom1_id": "///J/188/O2", "atom2_id": "///J/242/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 264, "atom1_serNum": 3164, "atom2_serNum": 4321, "donAcc_type": "standard", "distance": 2.914, "atom1_id": "///J/188/N3", "atom2_id": "///J/242/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 265, "atom1_serNum": 3183, "atom2_serNum": 4301, "donAcc_type": "standard", "distance": 2.476, "atom1_id": "///J/189/O2", "atom2_id": "///J/241/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 266, "atom1_serNum": 3184, "atom2_serNum": 4299, "donAcc_type": "standard", "distance": 2.887, "atom1_id": "///J/189/N3", "atom2_id": "///J/241/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 267, "atom1_serNum": 3186, "atom2_serNum": 4298, "donAcc_type": "standard", "distance": 3.216, "atom1_id": "///J/189/N4", "atom2_id": "///J/241/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 268, "atom1_serNum": 3206, "atom2_serNum": 4278, "donAcc_type": "standard", "distance": 2.907, "atom1_id": "///J/190/N6", "atom2_id": "///J/240/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 269, "atom1_serNum": 3207, "atom2_serNum": 4276, "donAcc_type": "standard", "distance": 2.957, "atom1_id": "///J/190/N1", "atom2_id": "///J/240/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 270, "atom1_serNum": 3229, "atom2_serNum": 4256, "donAcc_type": "standard", "distance": 2.481, "atom1_id": "///J/191/N1", "atom2_id": "///J/239/N6", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 271, "atom1_serNum": 3257, "atom2_serNum": 3288, "donAcc_type": "acceptable", "distance": 3.403, "atom1_id": "///J/193/OP2", "atom2_id": "///J/194/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 272, "atom1_serNum": 3275, "atom2_serNum": 4209, "donAcc_type": "standard", "distance": 2.457, "atom1_id": "///J/193/N2", "atom2_id": "///J/237/N7", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 273, "atom1_serNum": 3284, "atom2_serNum": 3329, "donAcc_type": "questionable", "distance": 3.219, "atom1_id": "///J/194/O4'", "atom2_id": "///J/196/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 274, "atom1_serNum": 3292, "atom2_serNum": 4190, "donAcc_type": "standard", "distance": 3.270, "atom1_id": "///J/194/N7", "atom2_id": "///J/236/N6", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 275, "atom1_serNum": 3295, "atom2_serNum": 4187, "donAcc_type": "standard", "distance": 2.908, "atom1_id": "///J/194/N6", "atom2_id": "///J/236/N7", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 276, "atom1_serNum": 3310, "atom2_serNum": 3325, "donAcc_type": "acceptable", "distance": 2.993, "atom1_id": "///J/195/O2'", "atom2_id": "///J/196/OP2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 277, "atom1_serNum": 3310, "atom2_serNum": 4145, "donAcc_type": "acceptable", "distance": 2.322, "atom1_id": "///J/195/O2'", "atom2_id": "///J/234/O6", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 278, "atom1_serNum": 3320, "atom2_serNum": 3340, "donAcc_type": "standard", "distance": 3.058, "atom1_id": "///J/195/N2", "atom2_id": "///J/196/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 279, "atom1_serNum": 3320, "atom2_serNum": 4153, "donAcc_type": "standard", "distance": 2.794, "atom1_id": "///J/195/N2", "atom2_id": "///J/235/OP2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 280, "atom1_serNum": 3325, "atom2_serNum": 4146, "donAcc_type": "standard", "distance": 2.894, "atom1_id": "///J/196/OP2", "atom2_id": "///J/234/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 281, "atom1_serNum": 3333, "atom2_serNum": 3346, "donAcc_type": "acceptable", "distance": 2.648, "atom1_id": "///J/196/O2'", "atom2_id": "///J/197/O5'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 282, "atom1_serNum": 3333, "atom2_serNum": 3349, "donAcc_type": "acceptable", "distance": 2.548, "atom1_id": "///J/196/O2'", "atom2_id": "///J/197/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 283, "atom1_serNum": 3337, "atom2_serNum": 4168, "donAcc_type": "standard", "distance": 2.991, "atom1_id": "///J/196/O2", "atom2_id": "///J/235/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 284, "atom1_serNum": 3338, "atom2_serNum": 4165, "donAcc_type": "standard", "distance": 2.881, "atom1_id": "///J/196/N3", "atom2_id": "///J/235/N7", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 285, "atom1_serNum": 3357, "atom2_serNum": 4148, "donAcc_type": "standard", "distance": 2.806, "atom1_id": "///J/197/N7", "atom2_id": "///J/234/N2", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 286, "atom1_serNum": 3360, "atom2_serNum": 4138, "donAcc_type": "acceptable", "distance": 3.111, "atom1_id": "///J/197/N6", "atom2_id": "///J/234/O2'", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 287, "atom1_serNum": 3360, "atom2_serNum": 4149, "donAcc_type": "standard", "distance": 3.173, "atom1_id": "///J/197/N6", "atom2_id": "///J/234/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 288, "atom1_serNum": 3382, "atom2_serNum": 4125, "donAcc_type": "standard", "distance": 3.006, "atom1_id": "///J/198/N6", "atom2_id": "///J/233/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 289, "atom1_serNum": 3383, "atom2_serNum": 4123, "donAcc_type": "standard", "distance": 2.859, "atom1_id": "///J/198/N1", "atom2_id": "///J/233/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 290, "atom1_serNum": 3419, "atom2_serNum": 4058, "donAcc_type": "acceptable", "distance": 3.468, "atom1_id": "///J/200/O2'", "atom2_id": "///J/230/N7", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 291, "atom1_serNum": 3419, "atom2_serNum": 4084, "donAcc_type": "acceptable", "distance": 3.085, "atom1_id": "///J/200/O2'", "atom2_id": "///J/231/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 292, "atom1_serNum": 3427, "atom2_serNum": 4026, "donAcc_type": "standard", "distance": 3.923, "atom1_id": "///J/200/N1", "atom2_id": "///J/229/OP2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 293, "atom1_serNum": 3429, "atom2_serNum": 4046, "donAcc_type": "standard", "distance": 3.320, "atom1_id": "///J/200/N2", "atom2_id": "///J/230/OP2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 294, "atom1_serNum": 3434, "atom2_serNum": 4039, "donAcc_type": "standard", "distance": 2.920, "atom1_id": "///J/201/OP2", "atom2_id": "///J/229/N3", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 295, "atom1_serNum": 3449, "atom2_serNum": 4034, "donAcc_type": "acceptable", "distance": 3.598, "atom1_id": "///J/201/N4", "atom2_id": "///J/229/O2'", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 296, "atom1_serNum": 3470, "atom2_serNum": 4038, "donAcc_type": "questionable", "distance": 3.397, "atom1_id": "///J/202/N1", "atom2_id": "///J/229/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 297, "atom1_serNum": 3491, "atom2_serNum": 4019, "donAcc_type": "standard", "distance": 3.043, "atom1_id": "///J/203/O6", "atom2_id": "///J/228/N3", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 298, "atom1_serNum": 3492, "atom2_serNum": 4018, "donAcc_type": "standard", "distance": 3.068, "atom1_id": "///J/203/N1", "atom2_id": "///J/228/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 299, "atom1_serNum": 3511, "atom2_serNum": 4001, "donAcc_type": "standard", "distance": 2.780, "atom1_id": "///J/204/O2", "atom2_id": "///J/227/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 300, "atom1_serNum": 3512, "atom2_serNum": 3999, "donAcc_type": "standard", "distance": 2.925, "atom1_id": "///J/204/N3", "atom2_id": "///J/227/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 301, "atom1_serNum": 3514, "atom2_serNum": 3998, "donAcc_type": "standard", "distance": 2.938, "atom1_id": "///J/204/N4", "atom2_id": "///J/227/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 302, "atom1_serNum": 3531, "atom2_serNum": 3978, "donAcc_type": "standard", "distance": 3.263, "atom1_id": "///J/205/O2", "atom2_id": "///J/226/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 303, "atom1_serNum": 3552, "atom2_serNum": 3955, "donAcc_type": "standard", "distance": 2.604, "atom1_id": "///J/206/N3", "atom2_id": "///J/225/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 304, "atom1_serNum": 3554, "atom2_serNum": 3956, "donAcc_type": "standard", "distance": 2.412, "atom1_id": "///J/206/O4", "atom2_id": "///J/225/N3", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 305, "atom1_serNum": 3574, "atom2_serNum": 3938, "donAcc_type": "standard", "distance": 3.044, "atom1_id": "///J/207/N6", "atom2_id": "///J/224/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 306, "atom1_serNum": 3575, "atom2_serNum": 3936, "donAcc_type": "standard", "distance": 2.691, "atom1_id": "///J/207/N1", "atom2_id": "///J/224/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 307, "atom1_serNum": 3596, "atom2_serNum": 3916, "donAcc_type": "standard", "distance": 2.880, "atom1_id": "///J/208/O6", "atom2_id": "///J/223/N3", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 308, "atom1_serNum": 3597, "atom2_serNum": 3915, "donAcc_type": "standard", "distance": 2.983, "atom1_id": "///J/208/N1", "atom2_id": "///J/223/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 309, "atom1_serNum": 3619, "atom2_serNum": 3898, "donAcc_type": "standard", "distance": 3.925, "atom1_id": "///J/209/N6", "atom2_id": "///J/222/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 310, "atom1_serNum": 3620, "atom2_serNum": 3896, "donAcc_type": "standard", "distance": 3.859, "atom1_id": "///J/209/N1", "atom2_id": "///J/222/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 311, "atom1_serNum": 3638, "atom2_serNum": 3878, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///J/210/O2", "atom2_id": "///J/221/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 312, "atom1_serNum": 3639, "atom2_serNum": 3876, "donAcc_type": "standard", "distance": 2.969, "atom1_id": "///J/210/N3", "atom2_id": "///J/221/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 313, "atom1_serNum": 3641, "atom2_serNum": 3875, "donAcc_type": "standard", "distance": 3.031, "atom1_id": "///J/210/N4", "atom2_id": "///J/221/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 314, "atom1_serNum": 3658, "atom2_serNum": 3855, "donAcc_type": "standard", "distance": 2.791, "atom1_id": "///J/211/O2", "atom2_id": "///J/220/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 315, "atom1_serNum": 3659, "atom2_serNum": 3853, "donAcc_type": "standard", "distance": 2.973, "atom1_id": "///J/211/N3", "atom2_id": "///J/220/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 316, "atom1_serNum": 3661, "atom2_serNum": 3852, "donAcc_type": "standard", "distance": 3.018, "atom1_id": "///J/211/N4", "atom2_id": "///J/220/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 317, "atom1_serNum": 3678, "atom2_serNum": 3832, "donAcc_type": "standard", "distance": 3.502, "atom1_id": "///J/212/O2", "atom2_id": "///J/219/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 318, "atom1_serNum": 3698, "atom2_serNum": 3807, "donAcc_type": "standard", "distance": 2.645, "atom1_id": "///J/213/O2", "atom2_id": "///J/218/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 319, "atom1_serNum": 3699, "atom2_serNum": 3806, "donAcc_type": "standard", "distance": 2.828, "atom1_id": "///J/213/N3", "atom2_id": "///J/218/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 320, "atom1_serNum": 3718, "atom2_serNum": 3760, "donAcc_type": "questionable", "distance": 3.295, "atom1_id": "///J/214/O2", "atom2_id": "///J/216/N7", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 321, "atom1_serNum": 4034, "atom2_serNum": 4050, "donAcc_type": "acceptable", "distance": 3.579, "atom1_id": "///J/229/O2'", "atom2_id": "///J/230/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 322, "atom1_serNum": 4138, "atom2_serNum": 4157, "donAcc_type": "acceptable", "distance": 3.498, "atom1_id": "///J/234/O2'", "atom2_id": "///J/235/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 323, "atom1_serNum": 4183, "atom2_serNum": 4193, "donAcc_type": "acceptable", "distance": 2.984, "atom1_id": "///J/236/O2'", "atom2_id": "///J/236/N3", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 324, "atom1_serNum": 4183, "atom2_serNum": 4198, "donAcc_type": "acceptable", "distance": 2.588, "atom1_id": "///J/236/O2'", "atom2_id": "///J/237/O5'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 325, "atom1_serNum": 4183, "atom2_serNum": 4201, "donAcc_type": "acceptable", "distance": 2.593, "atom1_id": "///J/236/O2'", "atom2_id": "///J/237/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 326, "atom1_serNum": 4205, "atom2_serNum": 4223, "donAcc_type": "acceptable", "distance": 2.709, "atom1_id": "///J/237/O2'", "atom2_id": "///J/238/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 327, "atom1_serNum": 4324, "atom2_serNum": 5276, "donAcc_type": "acceptable", "distance": 3.361, "atom1_id": "///J/242/N2", "atom2_id": "///J/287/O2'", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 328, "atom1_serNum": 4357, "atom2_serNum": 4370, "donAcc_type": "acceptable", "distance": 3.073, "atom1_id": "///J/244/O2'", "atom2_id": "///J/245/O5'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 329, "atom1_serNum": 4357, "atom2_serNum": 5256, "donAcc_type": "acceptable", "distance": 3.441, "atom1_id": "///J/244/O2'", "atom2_id": "///J/286/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 330, "atom1_serNum": 4377, "atom2_serNum": 4390, "donAcc_type": "acceptable", "distance": 2.594, "atom1_id": "///J/245/O2'", "atom2_id": "///J/246/O5'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 331, "atom1_serNum": 4397, "atom2_serNum": 5244, "donAcc_type": "acceptable", "distance": 3.128, "atom1_id": "///J/246/O2'", "atom2_id": "///J/285/N3", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 332, "atom1_serNum": 4407, "atom2_serNum": 5243, "donAcc_type": "standard", "distance": 3.037, "atom1_id": "///J/246/N3", "atom2_id": "///J/285/N2", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 333, "atom1_serNum": 4429, "atom2_serNum": 4449, "donAcc_type": "standard", "distance": 3.067, "atom1_id": "///J/247/N2", "atom2_id": "///J/248/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 334, "atom1_serNum": 4462, "atom2_serNum": 4917, "donAcc_type": "acceptable", "distance": 2.869, "atom1_id": "///J/249/O2'", "atom2_id": "///J/270/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 335, "atom1_serNum": 4475, "atom2_serNum": 4937, "donAcc_type": "acceptable", "distance": 3.112, "atom1_id": "///J/250/OP1", "atom2_id": "///J/271/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 336, "atom1_serNum": 4672, "atom2_serNum": 4748, "donAcc_type": "standard", "distance": 3.407, "atom1_id": "///J/259/O4'", "atom2_id": "///J/262/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 337, "atom1_serNum": 4686, "atom2_serNum": 4706, "donAcc_type": "standard", "distance": 3.013, "atom1_id": "///J/259/N2", "atom2_id": "///J/260/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 338, "atom1_serNum": 4699, "atom2_serNum": 4703, "donAcc_type": "acceptable", "distance": 2.883, "atom1_id": "///J/260/O2'", "atom2_id": "///J/260/O2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 339, "atom1_serNum": 4699, "atom2_serNum": 4711, "donAcc_type": "acceptable", "distance": 3.110, "atom1_id": "///J/260/O2'", "atom2_id": "///J/261/OP2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 340, "atom1_serNum": 4703, "atom2_serNum": 4741, "donAcc_type": "acceptable", "distance": 2.608, "atom1_id": "///J/260/O2", "atom2_id": "///J/262/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 341, "atom1_serNum": 4719, "atom2_serNum": 4732, "donAcc_type": "acceptable", "distance": 3.067, "atom1_id": "///J/261/O2'", "atom2_id": "///J/262/OP1", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 342, "atom1_serNum": 4770, "atom2_serNum": 5029, "donAcc_type": "standard", "distance": 2.499, "atom1_id": "///J/263/N4", "atom2_id": "///J/275/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 343, "atom1_serNum": 4783, "atom2_serNum": 5052, "donAcc_type": "acceptable", "distance": 2.831, "atom1_id": "///J/264/O2'", "atom2_id": "///J/276/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 344, "atom1_serNum": 4783, "atom2_serNum": 5053, "donAcc_type": "acceptable", "distance": 3.265, "atom1_id": "///J/264/O2'", "atom2_id": "///J/276/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 345, "atom1_serNum": 4790, "atom2_serNum": 5009, "donAcc_type": "standard", "distance": 2.879, "atom1_id": "///J/264/O6", "atom2_id": "///J/274/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 346, "atom1_serNum": 4791, "atom2_serNum": 5007, "donAcc_type": "standard", "distance": 2.906, "atom1_id": "///J/264/N1", "atom2_id": "///J/274/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 347, "atom1_serNum": 4793, "atom2_serNum": 5006, "donAcc_type": "standard", "distance": 2.834, "atom1_id": "///J/264/N2", "atom2_id": "///J/274/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 348, "atom1_serNum": 4793, "atom2_serNum": 5074, "donAcc_type": "standard", "distance": 3.151, "atom1_id": "///J/264/N2", "atom2_id": "///J/277/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 349, "atom1_serNum": 4806, "atom2_serNum": 5091, "donAcc_type": "acceptable", "distance": 3.139, "atom1_id": "///J/265/O2'", "atom2_id": "///J/278/N7", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 350, "atom1_serNum": 4816, "atom2_serNum": 5094, "donAcc_type": "standard", "distance": 3.158, "atom1_id": "///J/265/N3", "atom2_id": "///J/278/N6", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 351, "atom1_serNum": 4828, "atom2_serNum": 5116, "donAcc_type": "acceptable", "distance": 3.515, "atom1_id": "///J/266/O2'", "atom2_id": "///J/279/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 352, "atom1_serNum": 4838, "atom2_serNum": 4944, "donAcc_type": "standard", "distance": 3.959, "atom1_id": "///J/266/N2", "atom2_id": "///J/271/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 353, "atom1_serNum": 4851, "atom2_serNum": 4898, "donAcc_type": "acceptable", "distance": 2.781, "atom1_id": "///J/267/O2'", "atom2_id": "///J/269/N7", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 354, "atom1_serNum": 4856, "atom2_serNum": 4909, "donAcc_type": "standard", "distance": 3.217, "atom1_id": "///J/267/N3", "atom2_id": "///J/270/OP2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 355, "atom1_serNum": 4869, "atom2_serNum": 5966, "donAcc_type": "acceptable", "distance": 3.278, "atom1_id": "///J/268/O3'", "atom2_id": "///J/319/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 356, "atom1_serNum": 4871, "atom2_serNum": 5944, "donAcc_type": "acceptable", "distance": 2.519, "atom1_id": "///J/268/O2'", "atom2_id": "///J/318/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 357, "atom1_serNum": 4871, "atom2_serNum": 5954, "donAcc_type": "acceptable", "distance": 2.983, "atom1_id": "///J/268/O2'", "atom2_id": "///J/318/N3", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 358, "atom1_serNum": 4878, "atom2_serNum": 5220, "donAcc_type": "standard", "distance": 2.931, "atom1_id": "///J/268/O6", "atom2_id": "///J/284/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 359, "atom1_serNum": 4885, "atom2_serNum": 5966, "donAcc_type": "acceptable", "distance": 2.843, "atom1_id": "///J/269/OP1", "atom2_id": "///J/319/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 360, "atom1_serNum": 4890, "atom2_serNum": 5944, "donAcc_type": "acceptable", "distance": 3.642, "atom1_id": "///J/269/O4'", "atom2_id": "///J/318/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 361, "atom1_serNum": 4901, "atom2_serNum": 5200, "donAcc_type": "standard", "distance": 3.068, "atom1_id": "///J/269/O6", "atom2_id": "///J/283/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 362, "atom1_serNum": 4902, "atom2_serNum": 5198, "donAcc_type": "standard", "distance": 2.958, "atom1_id": "///J/269/N1", "atom2_id": "///J/283/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 363, "atom1_serNum": 4904, "atom2_serNum": 5197, "donAcc_type": "standard", "distance": 2.726, "atom1_id": "///J/269/N2", "atom2_id": "///J/283/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 364, "atom1_serNum": 4922, "atom2_serNum": 5179, "donAcc_type": "standard", "distance": 3.033, "atom1_id": "///J/270/N3", "atom2_id": "///J/282/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 365, "atom1_serNum": 4924, "atom2_serNum": 5178, "donAcc_type": "standard", "distance": 3.015, "atom1_id": "///J/270/O4", "atom2_id": "///J/282/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 366, "atom1_serNum": 4942, "atom2_serNum": 5157, "donAcc_type": "standard", "distance": 2.994, "atom1_id": "///J/271/N3", "atom2_id": "///J/281/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 367, "atom1_serNum": 4944, "atom2_serNum": 5156, "donAcc_type": "standard", "distance": 2.971, "atom1_id": "///J/271/O4", "atom2_id": "///J/281/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 368, "atom1_serNum": 4964, "atom2_serNum": 5136, "donAcc_type": "standard", "distance": 2.928, "atom1_id": "///J/272/N6", "atom2_id": "///J/280/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 369, "atom1_serNum": 4965, "atom2_serNum": 5134, "donAcc_type": "standard", "distance": 2.975, "atom1_id": "///J/272/N1", "atom2_id": "///J/280/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 370, "atom1_serNum": 4971, "atom2_serNum": 5009, "donAcc_type": "standard", "distance": 3.725, "atom1_id": "///J/273/OP2", "atom2_id": "///J/274/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 371, "atom1_serNum": 4986, "atom2_serNum": 5116, "donAcc_type": "standard", "distance": 2.813, "atom1_id": "///J/273/O6", "atom2_id": "///J/279/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 372, "atom1_serNum": 4987, "atom2_serNum": 5114, "donAcc_type": "standard", "distance": 2.706, "atom1_id": "///J/273/N1", "atom2_id": "///J/279/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 373, "atom1_serNum": 4989, "atom2_serNum": 5113, "donAcc_type": "standard", "distance": 2.389, "atom1_id": "///J/273/N2", "atom2_id": "///J/279/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 374, "atom1_serNum": 5002, "atom2_serNum": 5095, "donAcc_type": "acceptable", "distance": 3.031, "atom1_id": "///J/274/O2'", "atom2_id": "///J/278/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 375, "atom1_serNum": 5006, "atom2_serNum": 5094, "donAcc_type": "standard", "distance": 3.129, "atom1_id": "///J/274/O2", "atom2_id": "///J/278/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 376, "atom1_serNum": 5087, "atom2_serNum": 5102, "donAcc_type": "acceptable", "distance": 2.579, "atom1_id": "///J/278/O2'", "atom2_id": "///J/279/O5'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 377, "atom1_serNum": 5087, "atom2_serNum": 5105, "donAcc_type": "acceptable", "distance": 2.291, "atom1_id": "///J/278/O2'", "atom2_id": "///J/279/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 378, "atom1_serNum": 5341, "atom2_serNum": 5352, "donAcc_type": "acceptable", "distance": 2.804, "atom1_id": "///J/290/O2'", "atom2_id": "///J/291/OP1", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 379, "atom1_serNum": 5361, "atom2_serNum": 7133, "donAcc_type": "acceptable", "distance": 3.231, "atom1_id": "///J/291/O2'", "atom2_id": "///J/374/OP1", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 380, "atom1_serNum": 5368, "atom2_serNum": 6701, "donAcc_type": "standard", "distance": 2.948, "atom1_id": "///J/291/O6", "atom2_id": "///J/353/N3", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 381, "atom1_serNum": 5369, "atom2_serNum": 6700, "donAcc_type": "standard", "distance": 2.792, "atom1_id": "///J/291/N1", "atom2_id": "///J/353/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 382, "atom1_serNum": 5391, "atom2_serNum": 6683, "donAcc_type": "standard", "distance": 2.916, "atom1_id": "///J/292/O6", "atom2_id": "///J/352/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 383, "atom1_serNum": 5392, "atom2_serNum": 6681, "donAcc_type": "standard", "distance": 2.921, "atom1_id": "///J/292/N1", "atom2_id": "///J/352/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 384, "atom1_serNum": 5394, "atom2_serNum": 6680, "donAcc_type": "standard", "distance": 2.824, "atom1_id": "///J/292/N2", "atom2_id": "///J/352/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 385, "atom1_serNum": 5412, "atom2_serNum": 6662, "donAcc_type": "standard", "distance": 2.843, "atom1_id": "///J/293/N3", "atom2_id": "///J/351/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 386, "atom1_serNum": 5414, "atom2_serNum": 6661, "donAcc_type": "standard", "distance": 2.926, "atom1_id": "///J/293/O4", "atom2_id": "///J/351/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 387, "atom1_serNum": 5432, "atom2_serNum": 6640, "donAcc_type": "standard", "distance": 2.774, "atom1_id": "///J/294/N3", "atom2_id": "///J/350/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 388, "atom1_serNum": 5434, "atom2_serNum": 6639, "donAcc_type": "standard", "distance": 2.886, "atom1_id": "///J/294/O4", "atom2_id": "///J/350/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 389, "atom1_serNum": 5454, "atom2_serNum": 6619, "donAcc_type": "standard", "distance": 2.997, "atom1_id": "///J/295/O6", "atom2_id": "///J/349/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 390, "atom1_serNum": 5455, "atom2_serNum": 6617, "donAcc_type": "standard", "distance": 2.870, "atom1_id": "///J/295/N1", "atom2_id": "///J/349/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 391, "atom1_serNum": 5457, "atom2_serNum": 6616, "donAcc_type": "standard", "distance": 2.699, "atom1_id": "///J/295/N2", "atom2_id": "///J/349/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 392, "atom1_serNum": 5475, "atom2_serNum": 6598, "donAcc_type": "standard", "distance": 3.125, "atom1_id": "///J/296/N3", "atom2_id": "///J/348/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 393, "atom1_serNum": 5477, "atom2_serNum": 6597, "donAcc_type": "standard", "distance": 3.037, "atom1_id": "///J/296/O4", "atom2_id": "///J/348/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 394, "atom1_serNum": 5495, "atom2_serNum": 6549, "donAcc_type": "standard", "distance": 3.371, "atom1_id": "///J/297/N3", "atom2_id": "///J/346/N7", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 395, "atom1_serNum": 5497, "atom2_serNum": 6552, "donAcc_type": "standard", "distance": 3.034, "atom1_id": "///J/297/O4", "atom2_id": "///J/346/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 396, "atom1_serNum": 5517, "atom2_serNum": 5885, "donAcc_type": "standard", "distance": 3.051, "atom1_id": "///J/298/N6", "atom2_id": "///J/315/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 397, "atom1_serNum": 5518, "atom2_serNum": 5883, "donAcc_type": "standard", "distance": 3.122, "atom1_id": "///J/298/N1", "atom2_id": "///J/315/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 398, "atom1_serNum": 5532, "atom2_serNum": 6523, "donAcc_type": "acceptable", "distance": 3.180, "atom1_id": "///J/299/O2'", "atom2_id": "///J/345/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 399, "atom1_serNum": 5536, "atom2_serNum": 5865, "donAcc_type": "standard", "distance": 2.383, "atom1_id": "///J/299/O2", "atom2_id": "///J/314/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 400, "atom1_serNum": 5537, "atom2_serNum": 5863, "donAcc_type": "standard", "distance": 2.896, "atom1_id": "///J/299/N3", "atom2_id": "///J/314/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 401, "atom1_serNum": 5539, "atom2_serNum": 5862, "donAcc_type": "standard", "distance": 3.240, "atom1_id": "///J/299/N4", "atom2_id": "///J/314/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 402, "atom1_serNum": 5557, "atom2_serNum": 5841, "donAcc_type": "standard", "distance": 2.991, "atom1_id": "///J/300/N3", "atom2_id": "///J/313/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 403, "atom1_serNum": 5559, "atom2_serNum": 5840, "donAcc_type": "standard", "distance": 3.012, "atom1_id": "///J/300/O4", "atom2_id": "///J/313/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 404, "atom1_serNum": 5576, "atom2_serNum": 5818, "donAcc_type": "standard", "distance": 2.985, "atom1_id": "///J/301/O2", "atom2_id": "///J/312/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 405, "atom1_serNum": 5577, "atom2_serNum": 5817, "donAcc_type": "standard", "distance": 2.886, "atom1_id": "///J/301/N3", "atom2_id": "///J/312/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 406, "atom1_serNum": 5599, "atom2_serNum": 5795, "donAcc_type": "standard", "distance": 2.828, "atom1_id": "///J/302/O6", "atom2_id": "///J/311/N3", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 407, "atom1_serNum": 5600, "atom2_serNum": 5794, "donAcc_type": "standard", "distance": 2.895, "atom1_id": "///J/302/N1", "atom2_id": "///J/311/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 408, "atom1_serNum": 5622, "atom2_serNum": 5777, "donAcc_type": "standard", "distance": 3.044, "atom1_id": "///J/303/N6", "atom2_id": "///J/310/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 409, "atom1_serNum": 5623, "atom2_serNum": 5775, "donAcc_type": "standard", "distance": 2.982, "atom1_id": "///J/303/N1", "atom2_id": "///J/310/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 410, "atom1_serNum": 5644, "atom2_serNum": 5757, "donAcc_type": "standard", "distance": 2.984, "atom1_id": "///J/304/N6", "atom2_id": "///J/309/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 411, "atom1_serNum": 5645, "atom2_serNum": 5755, "donAcc_type": "standard", "distance": 2.938, "atom1_id": "///J/304/N1", "atom2_id": "///J/309/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 412, "atom1_serNum": 5659, "atom2_serNum": 5709, "donAcc_type": "acceptable", "distance": 3.139, "atom1_id": "///J/305/O2'", "atom2_id": "///J/307/N7", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 413, "atom1_serNum": 5667, "atom2_serNum": 5720, "donAcc_type": "standard", "distance": 2.582, "atom1_id": "///J/305/N1", "atom2_id": "///J/308/OP2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 414, "atom1_serNum": 5669, "atom2_serNum": 5720, "donAcc_type": "standard", "distance": 2.696, "atom1_id": "///J/305/N2", "atom2_id": "///J/308/OP2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 415, "atom1_serNum": 5669, "atom2_serNum": 5732, "donAcc_type": "standard", "distance": 3.101, "atom1_id": "///J/305/N2", "atom2_id": "///J/308/N7", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 416, "atom1_serNum": 5705, "atom2_serNum": 5724, "donAcc_type": "acceptable", "distance": 2.996, "atom1_id": "///J/307/O2'", "atom2_id": "///J/308/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 417, "atom1_serNum": 5790, "atom2_serNum": 5806, "donAcc_type": "acceptable", "distance": 3.303, "atom1_id": "///J/311/O2'", "atom2_id": "///J/312/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 418, "atom1_serNum": 5855, "atom2_serNum": 6530, "donAcc_type": "acceptable", "distance": 2.998, "atom1_id": "///J/314/O2'", "atom2_id": "///J/345/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 419, "atom1_serNum": 5878, "atom2_serNum": 6543, "donAcc_type": "acceptable", "distance": 3.514, "atom1_id": "///J/315/O2'", "atom2_id": "///J/346/O3'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 420, "atom1_serNum": 5878, "atom2_serNum": 6560, "donAcc_type": "acceptable", "distance": 3.593, "atom1_id": "///J/315/O2'", "atom2_id": "///J/347/O5'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 421, "atom1_serNum": 5889, "atom2_serNum": 6515, "donAcc_type": "questionable", "distance": 3.308, "atom1_id": "///J/316/OP1", "atom2_id": "///J/345/OP2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 422, "atom1_serNum": 5891, "atom2_serNum": 6559, "donAcc_type": "questionable", "distance": 3.281, "atom1_id": "///J/316/O5'", "atom2_id": "///J/347/OP2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 423, "atom1_serNum": 5905, "atom2_serNum": 6980, "donAcc_type": "standard", "distance": 3.275, "atom1_id": "///J/316/O6", "atom2_id": "///J/366/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 424, "atom1_serNum": 5905, "atom2_serNum": 7062, "donAcc_type": "standard", "distance": 3.166, "atom1_id": "///J/316/O6", "atom2_id": "///J/370/N3", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 425, "atom1_serNum": 5906, "atom2_serNum": 7061, "donAcc_type": "standard", "distance": 2.767, "atom1_id": "///J/316/N1", "atom2_id": "///J/370/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 426, "atom1_serNum": 5912, "atom2_serNum": 6514, "donAcc_type": "questionable", "distance": 3.326, "atom1_id": "///J/317/OP1", "atom2_id": "///J/345/OP1", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 427, "atom1_serNum": 5928, "atom2_serNum": 7044, "donAcc_type": "standard", "distance": 3.134, "atom1_id": "///J/317/O6", "atom2_id": "///J/369/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 428, "atom1_serNum": 5929, "atom2_serNum": 7042, "donAcc_type": "standard", "distance": 3.095, "atom1_id": "///J/317/N1", "atom2_id": "///J/369/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 429, "atom1_serNum": 5931, "atom2_serNum": 7041, "donAcc_type": "standard", "distance": 2.682, "atom1_id": "///J/317/N2", "atom2_id": "///J/369/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 430, "atom1_serNum": 5951, "atom2_serNum": 7024, "donAcc_type": "standard", "distance": 3.018, "atom1_id": "///J/318/N6", "atom2_id": "///J/368/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 431, "atom1_serNum": 5952, "atom2_serNum": 7022, "donAcc_type": "standard", "distance": 3.036, "atom1_id": "///J/318/N1", "atom2_id": "///J/368/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 432, "atom1_serNum": 5973, "atom2_serNum": 7002, "donAcc_type": "standard", "distance": 2.382, "atom1_id": "///J/319/O4", "atom2_id": "///J/367/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 433, "atom1_serNum": 5990, "atom2_serNum": 6508, "donAcc_type": "standard", "distance": 3.006, "atom1_id": "///J/320/N7", "atom2_id": "///J/344/N6", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 434, "atom1_serNum": 5993, "atom2_serNum": 6478, "donAcc_type": "acceptable", "distance": 3.879, "atom1_id": "///J/320/N6", "atom2_id": "///J/343/O2'", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 435, "atom1_serNum": 5993, "atom2_serNum": 6505, "donAcc_type": "standard", "distance": 3.433, "atom1_id": "///J/320/N6", "atom2_id": "///J/344/N7", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 436, "atom1_serNum": 6012, "atom2_serNum": 6488, "donAcc_type": "standard", "distance": 2.903, "atom1_id": "///J/321/N7", "atom2_id": "///J/343/N2", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 437, "atom1_serNum": 6015, "atom2_serNum": 6478, "donAcc_type": "acceptable", "distance": 3.075, "atom1_id": "///J/321/N6", "atom2_id": "///J/343/O2'", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 438, "atom1_serNum": 6015, "atom2_serNum": 6489, "donAcc_type": "standard", "distance": 3.030, "atom1_id": "///J/321/N6", "atom2_id": "///J/343/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 439, "atom1_serNum": 6037, "atom2_serNum": 6465, "donAcc_type": "standard", "distance": 2.945, "atom1_id": "///J/322/N6", "atom2_id": "///J/342/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 440, "atom1_serNum": 6038, "atom2_serNum": 6463, "donAcc_type": "standard", "distance": 2.807, "atom1_id": "///J/322/N1", "atom2_id": "///J/342/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 441, "atom1_serNum": 6059, "atom2_serNum": 6445, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///J/323/N6", "atom2_id": "///J/341/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 442, "atom1_serNum": 6060, "atom2_serNum": 6443, "donAcc_type": "standard", "distance": 2.771, "atom1_id": "///J/323/N1", "atom2_id": "///J/341/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 443, "atom1_serNum": 6074, "atom2_serNum": 6089, "donAcc_type": "acceptable", "distance": 3.073, "atom1_id": "///J/324/O2'", "atom2_id": "///J/325/O5'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 444, "atom1_serNum": 6081, "atom2_serNum": 6425, "donAcc_type": "standard", "distance": 2.958, "atom1_id": "///J/324/N6", "atom2_id": "///J/340/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 445, "atom1_serNum": 6082, "atom2_serNum": 6423, "donAcc_type": "standard", "distance": 2.897, "atom1_id": "///J/324/N1", "atom2_id": "///J/340/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 446, "atom1_serNum": 6103, "atom2_serNum": 6405, "donAcc_type": "standard", "distance": 2.971, "atom1_id": "///J/325/N6", "atom2_id": "///J/339/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 447, "atom1_serNum": 6104, "atom2_serNum": 6403, "donAcc_type": "standard", "distance": 2.899, "atom1_id": "///J/325/N1", "atom2_id": "///J/339/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 448, "atom1_serNum": 6122, "atom2_serNum": 6385, "donAcc_type": "standard", "distance": 2.781, "atom1_id": "///J/326/O2", "atom2_id": "///J/338/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 449, "atom1_serNum": 6123, "atom2_serNum": 6383, "donAcc_type": "standard", "distance": 2.935, "atom1_id": "///J/326/N3", "atom2_id": "///J/338/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 450, "atom1_serNum": 6125, "atom2_serNum": 6382, "donAcc_type": "standard", "distance": 3.010, "atom1_id": "///J/326/N4", "atom2_id": "///J/338/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 451, "atom1_serNum": 6142, "atom2_serNum": 6360, "donAcc_type": "standard", "distance": 2.886, "atom1_id": "///J/327/O2", "atom2_id": "///J/337/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 452, "atom1_serNum": 6143, "atom2_serNum": 6359, "donAcc_type": "standard", "distance": 2.684, "atom1_id": "///J/327/N3", "atom2_id": "///J/337/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 453, "atom1_serNum": 6145, "atom2_serNum": 6308, "donAcc_type": "acceptable", "distance": 3.020, "atom1_id": "///J/327/O4", "atom2_id": "///J/335/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 454, "atom1_serNum": 6158, "atom2_serNum": 6176, "donAcc_type": "acceptable", "distance": 3.135, "atom1_id": "///J/328/O2'", "atom2_id": "///J/329/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 455, "atom1_serNum": 6162, "atom2_serNum": 6293, "donAcc_type": "standard", "distance": 2.994, "atom1_id": "///J/328/N7", "atom2_id": "///J/334/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 456, "atom1_serNum": 6165, "atom2_serNum": 6292, "donAcc_type": "standard", "distance": 2.681, "atom1_id": "///J/328/N6", "atom2_id": "///J/334/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 457, "atom1_serNum": 6188, "atom2_serNum": 6274, "donAcc_type": "questionable", "distance": 3.026, "atom1_id": "///J/329/N1", "atom2_id": "///J/333/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 458, "atom1_serNum": 6266, "atom2_serNum": 6280, "donAcc_type": "acceptable", "distance": 2.728, "atom1_id": "///J/333/O2'", "atom2_id": "///J/334/OP2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 459, "atom1_serNum": 6266, "atom2_serNum": 6281, "donAcc_type": "acceptable", "distance": 2.858, "atom1_id": "///J/333/O2'", "atom2_id": "///J/334/O5'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 460, "atom1_serNum": 6308, "atom2_serNum": 6359, "donAcc_type": "acceptable", "distance": 3.105, "atom1_id": "///J/335/O2'", "atom2_id": "///J/337/O6", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 461, "atom1_serNum": 6318, "atom2_serNum": 6337, "donAcc_type": "standard", "distance": 3.294, "atom1_id": "///J/335/N3", "atom2_id": "///J/336/N6", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 462, "atom1_serNum": 6470, "atom2_serNum": 6501, "donAcc_type": "acceptable", "distance": 2.890, "atom1_id": "///J/343/OP2", "atom2_id": "///J/344/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 463, "atom1_serNum": 6545, "atom2_serNum": 6558, "donAcc_type": "acceptable", "distance": 2.625, "atom1_id": "///J/346/O2'", "atom2_id": "///J/347/OP1", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 464, "atom1_serNum": 6567, "atom2_serNum": 6581, "donAcc_type": "acceptable", "distance": 2.940, "atom1_id": "///J/347/O2'", "atom2_id": "///J/348/OP1", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 465, "atom1_serNum": 6574, "atom2_serNum": 7084, "donAcc_type": "standard", "distance": 3.092, "atom1_id": "///J/347/O6", "atom2_id": "///J/371/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 466, "atom1_serNum": 6696, "atom2_serNum": 6712, "donAcc_type": "acceptable", "distance": 3.192, "atom1_id": "///J/353/O2'", "atom2_id": "///J/354/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 467, "atom1_serNum": 6781, "atom2_serNum": 6797, "donAcc_type": "acceptable", "distance": 3.015, "atom1_id": "///J/357/O2'", "atom2_id": "///J/358/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 468, "atom1_serNum": 6801, "atom2_serNum": 6816, "donAcc_type": "acceptable", "distance": 2.896, "atom1_id": "///J/358/O2'", "atom2_id": "///J/359/O5'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 469, "atom1_serNum": 6801, "atom2_serNum": 6819, "donAcc_type": "acceptable", "distance": 2.726, "atom1_id": "///J/358/O2'", "atom2_id": "///J/359/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 470, "atom1_serNum": 6871, "atom2_serNum": 7172, "donAcc_type": "standard", "distance": 2.695, "atom1_id": "///J/361/O2", "atom2_id": "///J/375/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 471, "atom1_serNum": 6872, "atom2_serNum": 7170, "donAcc_type": "standard", "distance": 2.837, "atom1_id": "///J/361/N3", "atom2_id": "///J/375/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 472, "atom1_serNum": 6874, "atom2_serNum": 7169, "donAcc_type": "standard", "distance": 2.873, "atom1_id": "///J/361/N4", "atom2_id": "///J/375/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 473, "atom1_serNum": 6887, "atom2_serNum": 6902, "donAcc_type": "acceptable", "distance": 2.748, "atom1_id": "///J/362/O2'", "atom2_id": "///J/363/OP2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 474, "atom1_serNum": 6894, "atom2_serNum": 7149, "donAcc_type": "standard", "distance": 2.954, "atom1_id": "///J/362/O6", "atom2_id": "///J/374/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 475, "atom1_serNum": 6895, "atom2_serNum": 7147, "donAcc_type": "standard", "distance": 2.939, "atom1_id": "///J/362/N1", "atom2_id": "///J/374/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 476, "atom1_serNum": 6897, "atom2_serNum": 7146, "donAcc_type": "standard", "distance": 2.795, "atom1_id": "///J/362/N2", "atom2_id": "///J/374/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 477, "atom1_serNum": 6910, "atom2_serNum": 6922, "donAcc_type": "acceptable", "distance": 2.749, "atom1_id": "///J/363/O2'", "atom2_id": "///J/364/OP2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 478, "atom1_serNum": 6910, "atom2_serNum": 6923, "donAcc_type": "acceptable", "distance": 3.106, "atom1_id": "///J/363/O2'", "atom2_id": "///J/364/O5'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 479, "atom1_serNum": 6910, "atom2_serNum": 6934, "donAcc_type": "acceptable", "distance": 3.005, "atom1_id": "///J/363/O2'", "atom2_id": "///J/364/N7", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 480, "atom1_serNum": 6914, "atom2_serNum": 7127, "donAcc_type": "standard", "distance": 3.013, "atom1_id": "///J/363/O2", "atom2_id": "///J/373/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 481, "atom1_serNum": 6914, "atom2_serNum": 7129, "donAcc_type": "standard", "distance": 3.335, "atom1_id": "///J/363/O2", "atom2_id": "///J/373/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 482, "atom1_serNum": 6915, "atom2_serNum": 7126, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///J/363/N3", "atom2_id": "///J/373/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 483, "atom1_serNum": 6922, "atom2_serNum": 6953, "donAcc_type": "acceptable", "distance": 3.172, "atom1_id": "///J/364/OP2", "atom2_id": "///J/365/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 484, "atom1_serNum": 6930, "atom2_serNum": 7104, "donAcc_type": "acceptable", "distance": 3.299, "atom1_id": "///J/364/O2'", "atom2_id": "///J/372/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 485, "atom1_serNum": 6940, "atom2_serNum": 7101, "donAcc_type": "standard", "distance": 2.922, "atom1_id": "///J/364/N2", "atom2_id": "///J/372/N7", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 486, "atom1_serNum": 6941, "atom2_serNum": 7104, "donAcc_type": "standard", "distance": 3.102, "atom1_id": "///J/364/N3", "atom2_id": "///J/372/N6", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 487, "atom1_serNum": 6960, "atom2_serNum": 7084, "donAcc_type": "standard", "distance": 3.286, "atom1_id": "///J/365/O4", "atom2_id": "///J/371/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 488, "atom1_serNum": 6973, "atom2_serNum": 6988, "donAcc_type": "acceptable", "distance": 3.109, "atom1_id": "///J/366/O2'", "atom2_id": "///J/367/O5'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 489, "atom1_serNum": 6973, "atom2_serNum": 7009, "donAcc_type": "acceptable", "distance": 2.804, "atom1_id": "///J/366/O2'", "atom2_id": "///J/368/OP2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 490, "atom1_serNum": 6977, "atom2_serNum": 7044, "donAcc_type": "standard", "distance": 3.438, "atom1_id": "///J/366/N7", "atom2_id": "///J/369/N4", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 491, "atom1_serNum": 6980, "atom2_serNum": 7064, "donAcc_type": "standard", "distance": 2.946, "atom1_id": "///J/366/N6", "atom2_id": "///J/370/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 492, "atom1_serNum": 7057, "atom2_serNum": 7073, "donAcc_type": "acceptable", "distance": 3.532, "atom1_id": "///J/370/O2'", "atom2_id": "///J/371/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" } ], "refCoords": { "purine": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 -0.5000 0.4000", " 3 N -2.2500 -0.5000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 1.2500 5.0000 0.4000", " 6 C 1.2500 -0.5000 0.4000", " 7 C 1.2500 -0.5000 -0.4000", " 8 C 1.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 -0.5000 0.4000", " 11 C -2.2500 -0.5000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ], "pyrimidine": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 1.0000 0.4000", " 3 N -2.2500 1.0000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 1.2500 5.0000 0.4000", " 6 C 1.2500 1.0000 0.4000", " 7 C 1.2500 1.0000 -0.4000", " 8 C 1.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 1.0000 0.4000", " 11 C -2.2500 1.0000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ], "wc_pair": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 -5.0000 0.4000", " 3 N -2.2500 -5.0000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 2.2500 5.0000 0.4000", " 6 C 2.2500 -5.0000 0.4000", " 7 C 2.2500 -5.0000 -0.4000", " 8 C 2.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 -5.0000 0.4000", " 11 C -2.2500 -5.0000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ] }, "metadata": { "license": "http://innovation.columbia.edu/technologies/CU20391", "url": "http://x3dna.org/", "url_alt": "http://home.x3dna.org/", "forum": "http://forum.x3dna.org/", "citation": "Lu et al. (2015). 'DSSR: an integrated software tool for dissecting the spatial structure of RNA.' Nucleic Acids Res., 43(21):e142 [doi:10.1093/nar/gkv716].", "str_id": "9lec", "num_naChains": 1, "naChains": "J=336", "num_atoms": 7194, "num_waters": 0, "num_notes": 52, "notes": [ { "Aminors": "A-minor interactions (including types I and II)" }, { "Cstem_index": "stem index of the 'Canonical' helix in k-turn" }, { "Cstem_pair": "Cstem bp delineating the k-turn internal loop" }, { "Dp": "perpendicular distance of the 3' P atom to the glycosidic bond" }, { "GA_pair": "sheared G-A pair in k-turn" }, { "HtypePknot": "H-type pseudoknot" }, { "Kturn": "kink-turn (k-turn)" }, { "LW": "Leontis-Westhof" }, { "NCstem_index": "stem index of the 'Non-Canonical' helix in k-turn" }, { "NCstem_pair": "NCstem bp delineating the k-turn internal loop" }, { "Uturn": "U-turn of the UNR- or GNRA-type" }, { "aa": "amino acid" }, { "atom_pair": "symbols of the two atoms involved in an H-bond" }, { "auxfiles": "auxiliary files" }, { "glyco_bond": "conformation of base related to sugar (syn or anti)" }, { "bb_type": "backbone conformation, BI or BII" }, { "bending_angle": "angle between two helical axes" }, { "bp": "base pair" }, { "bseq": "base sequence in one-letter code" }, { "bulge": "bulge loop" }, { "coaxStacks": "coaxial stacking of stems within a helix" }, { "dbn": "dot bracket notation" }, { "desc": "description" }, { "donAcc_type": "donor/acceptor type of the atom pair in an H-bond" }, { "epsilon_zeta": "difference between epsilon and zeta torsion angles" }, { "hairpin": "hairpin loop" }, { "hbond": "hydrogen bond (H-bond)" }, { "helix": "defined by base-stacking interactions, regardless of bp type and backbone connectivity" }, { "id": "identifier" }, { "iloop": "internal loop" }, { "index": "serial number" }, { "isoCanonPairs": "isolated canonical pairs" }, { "junction": "(multi-branched) junction loop" }, { "kissingLoop": "kissing loop" }, { "multiplet": "3+ bases in a coplanar geometry" }, { "na": "nucleic acid" }, { "nonPair": "two nts not forming a pair, but with H-bonding/stacking interactions" }, { "nonStack": "nucleotide not involved in stacking interactions" }, { "nt": "nucleotide" }, { "num": "number" }, { "oArea": "overlap areas between two bases, including exocyclic atoms" }, { "oArea_ring": "overlap areas between two bases, including only ring atoms" }, { "phosContacts": "H-bonding and atom-capping interactions involving a phosphate" }, { "residue_pair": "types of the two residues involved in an H-bond" }, { "rmsd": "root-mean-squares deviation" }, { "serNum": "serial number" }, { "ssSegments": "single-stranded segments not involved in loops" }, { "ssZp": "Z-coordinate of the 3' phosphorus atom with reference to the 5' base plane" }, { "sstr": "secondary structure in dbn" }, { "stem": "helix consisting of only canonical pairs, with a continuous backbone" }, { "str_id": "structure identifier, derived from inpfile with extension removed" }, { "vert_dist": "vertical distance from an atom to a base plane" } ], "num_auxfiles": 19, "auxfiles": [ { "index": 1, "name": "dssr-pairs.pdb", "desc": "an ensemble of base pairs" }, { "index": 2, "name": "dssr-multiplets.pdb", "desc": "an ensemble of multiplets" }, { "index": 3, "name": "dssr-stems.pdb", "desc": "an ensemble of stems" }, { "index": 4, "name": "dssr-helices.pdb", "desc": "an ensemble of helices (coaxial stacking)" }, { "index": 5, "name": "dssr-hairpins.pdb", "desc": "an ensemble of hairpin loops" }, { "index": 6, "name": "dssr-iloops.pdb", "desc": "an ensemble of internal loops" }, { "index": 7, "name": "dssr-junctions.pdb", "desc": "an ensemble of junctions (multi-branch)" }, { "index": 8, "name": "dssr-2ndstrs.bpseq", "desc": "secondary structure in bpseq format" }, { "index": 9, "name": "dssr-2ndstrs.ct", "desc": "secondary structure in connectivity table format" }, { "index": 10, "name": "dssr-2ndstrs.dbn", "desc": "secondary structure in dot-bracket notation" }, { "index": 11, "name": "dssr-torsions.txt", "desc": "backbone torsion angles and suite names" }, { "index": 12, "name": "dssr-splays.pdb", "desc": "an ensemble of splayed-apart units" }, { "index": 13, "name": "dssr-Aminors.pdb", "desc": "an ensemble of A minor motifs (types I and II)" }, { "index": 14, "name": "dssr-stacks.pdb", "desc": "an ensemble of base stacks" }, { "index": 15, "name": "dssr-atom2bases.pdb", "desc": "an ensemble of atom-base stacking interactions" }, { "index": 16, "name": "dssr-rotmat.txt", "desc": "position vector and rotation matrix" }, { "index": 17, "name": "dssr-viewV.pdb", "desc": "vertical view of the principal moment of inertia" }, { "index": 18, "name": "dssr-viewH.pdb", "desc": "horizontal view of the principal moment of inertia" }, { "index": 19, "name": "dssr-viewT.pdb", "desc": "top view of the principal moment of inertia" } ], "time_used": "999" } }