**************************************************************************** File name: 8zw3.pdb no. of DNA/RNA chains: 1 [X=23] no. of nucleotides: 23 no. of atoms: 824 no. of waters: 0 no. of metals: 0 **************************************************************************** List of 12 base pairs nt1 nt2 bp name Saenger LW DSSR 1 X.DG4 X.DG8 G+G -- 06-VI cWH cW+M 2 X.DG4 X.DG18 G+G -- 06-VI cHW cM+W 3 X.DG5 X.DG9 G+G -- 06-VI cWH cW+M 4 X.DG5 X.DG19 G+G -- 06-VI cHW cM+W 5 X.DG6 X.DG10 G+G -- 06-VI cWH cW+M 6 X.DG6 X.DG20 G+G -- 06-VI cHW cM+W 7 X.DG8 X.DG14 G+G -- 06-VI cWH cW+M 8 X.DG9 X.DG15 G+G -- 06-VI cWH cW+M 9 X.DG10 X.DG16 G+G -- 06-VI cWH cW+M 10 X.DG14 X.DG18 G+G -- 06-VI cWH cW+M 11 X.DG15 X.DG19 G+G -- 06-VI cWH cW+M 12 X.DG16 X.DG20 G+G -- 06-VI cWH cW+M **************************************************************************** List of 3 multiplets 1 nts=4 GGGG X.DG4,X.DG8,X.DG14,X.DG18 2 nts=4 GGGG X.DG5,X.DG9,X.DG15,X.DG19 3 nts=4 GGGG X.DG6,X.DG10,X.DG16,X.DG20 **************************************************************************** List of 2 helices Note: A helix is defined by base-stacking interactions, regardless of pair type and backbone connectivity, and may contain more than one stem. helix#number[stems-contained] bps=number-of-base-pairs in the helix bp-type: '|' for a canonical WC/wobble pair, '.' otherwise helix-form: classification of a dinucleotide step comprising the bp above the given designation and the bp that follows it. Types include 'A', 'B' or 'Z' for the common A-, B- and Z-form helices, '.' for an unclassified step, and 'x' for a step without a continuous backbone. -------------------------------------------------------------------- helix#1[0] bps=3 parallel strand-1 5'-GGG-3' bp-type ... strand-2 5'-GGG-3' helix-form .. 1 X.DG4 X.DG8 G+G -- 06-VI cWH cW+M 2 X.DG5 X.DG9 G+G -- 06-VI cWH cW+M 3 X.DG6 X.DG10 G+G -- 06-VI cWH cW+M -------------------------------------------------------------------------- helix#2[0] bps=3 parallel strand-1 5'-GGG-3' bp-type ... strand-2 5'-GGG-3' helix-form .. 1 X.DG14 X.DG18 G+G -- 06-VI cWH cW+M 2 X.DG15 X.DG19 G+G -- 06-VI cWH cW+M 3 X.DG16 X.DG20 G+G -- 06-VI cWH cW+M **************************************************************************** List of 5 base stacks Note: A stack is an ordered list of nucleotides assembled together via base-stacking interactions, regardless of backbone connectivity. Stacking interactions within a stem are *not* included. 1 nts=2 GA X.DG12,X.DA13 2 nts=3 GGG X.DG4,X.DG5,X.DG6 3 nts=3 GGG X.DG8,X.DG9,X.DG10 4 nts=3 GGG X.DG14,X.DG15,X.DG16 5 nts=9 TCTGGGAGC X.DT1,X.DC2,X.DT3,X.DG18,X.DG19,X.DG20,X.DA21,X.DG22,X.DC23 **************************************************************************** Nucleotides not involved in stacking interactions nts=3 CCC X.DC7,X.DC11,X.DC17 **************************************************************************** List of 1 non-loop single-stranded segment 1 nts=23 TCTGGGCGGGCGAGGGCGGGAGC X.DT1,X.DC2,X.DT3,X.DG4,X.DG5,X.DG6,X.DC7,X.DG8,X.DG9,X.DG10,X.DC11,X.DG12,X.DA13,X.DG14,X.DG15,X.DG16,X.DC17,X.DG18,X.DG19,X.DG20,X.DA21,X.DG22,X.DC23 **************************************************************************** List of 3 G-tetrads 1 glyco-bond=---- sugar=---- groove=---- planarity=0.222 type=other nts=4 GGGG X.DG4,X.DG8,X.DG14,X.DG18 2 glyco-bond=---- sugar=---- groove=---- planarity=0.355 type=bowl-2 nts=4 GGGG X.DG5,X.DG9,X.DG15,X.DG19 3 glyco-bond=---- sugar=---- groove=---- planarity=0.428 type=bowl nts=4 GGGG X.DG6,X.DG10,X.DG16,X.DG20 **************************************************************************** List of 1 G4-helix Note: a G4-helix is defined by stacking interactions of G4-tetrads, regardless of backbone connectivity, and may contain more than one G4-stem. helix#1[1] stems=[#1] layers=3 INTRA-molecular 1 glyco-bond=---- sugar=---- groove=---- WC-->Major nts=4 GGGG X.DG4,X.DG8,X.DG14,X.DG18 2 glyco-bond=---- sugar=---- groove=---- WC-->Major nts=4 GGGG X.DG5,X.DG9,X.DG15,X.DG19 3 glyco-bond=---- sugar=---- groove=---- WC-->Major nts=4 GGGG X.DG6,X.DG10,X.DG16,X.DG20 step#1 pm(>>,forward) area=14.46 rise=3.40 twist=24.2 step#2 pm(>>,forward) area=12.03 rise=3.42 twist=27.6 strand#1 DNA glyco-bond=--- sugar=--- nts=3 GGG X.DG4,X.DG5,X.DG6 strand#2 DNA glyco-bond=--- sugar=--- nts=3 GGG X.DG8,X.DG9,X.DG10 strand#3 DNA glyco-bond=--- sugar=--- nts=3 GGG X.DG14,X.DG15,X.DG16 strand#4 DNA glyco-bond=--- sugar=--- nts=3 GGG X.DG18,X.DG19,X.DG20 **************************************************************************** List of 1 G4-stem Note: a G4-stem is defined as a G4-helix with backbone connectivity. Bulges are also allowed along each of the four strands. stem#1[#1] layers=3 INTRA-molecular loops=3 descriptor=3(-P-P-P) note=4+0 UUUU parallel 1 glyco-bond=---- sugar=---- groove=---- WC-->Major nts=4 GGGG X.DG4,X.DG8,X.DG14,X.DG18 2 glyco-bond=---- sugar=---- groove=---- WC-->Major nts=4 GGGG X.DG5,X.DG9,X.DG15,X.DG19 3 glyco-bond=---- sugar=---- groove=---- WC-->Major nts=4 GGGG X.DG6,X.DG10,X.DG16,X.DG20 step#1 pm(>>,forward) area=14.46 rise=3.40 twist=24.2 step#2 pm(>>,forward) area=12.03 rise=3.42 twist=27.6 strand#1 U DNA glyco-bond=--- sugar=--- nts=3 GGG X.DG4,X.DG5,X.DG6 strand#2 U DNA glyco-bond=--- sugar=--- nts=3 GGG X.DG8,X.DG9,X.DG10 strand#3 U DNA glyco-bond=--- sugar=--- nts=3 GGG X.DG14,X.DG15,X.DG16 strand#4 U DNA glyco-bond=--- sugar=--- nts=3 GGG X.DG18,X.DG19,X.DG20 loop#1 type=propeller strands=[#1,#2] nts=1 C X.DC7 loop#2 type=propeller strands=[#2,#3] nts=3 CGA X.DC11,X.DG12,X.DA13 loop#3 type=propeller strands=[#3,#4] nts=1 C X.DC17 **************************************************************************** List of 6 splayed-apart dinucleotides 1 X.DG6 X.DC7 angle=139 distance=18.0 ratio=0.94 2 X.DC7 X.DG8 angle=160 distance=18.4 ratio=0.98 3 X.DG10 X.DC11 angle=158 distance=18.5 ratio=0.98 4 X.DA13 X.DG14 angle=107 distance=15.0 ratio=0.81 5 X.DG16 X.DC17 angle=135 distance=17.3 ratio=0.92 6 X.DC17 X.DG18 angle=157 distance=18.5 ratio=0.98 ---------------------------------------------------------------- Summary of 4 splayed-apart units 1 nts=3 GCG X.DG6,X.DC7,X.DG8 2 nts=2 GC X.DG10,X.DC11 3 nts=2 AG X.DA13,X.DG14 4 nts=3 GCG X.DG16,X.DC17,X.DG18 **************************************************************************** Secondary structures in dot-bracket notation (dbn) as a whole and per chain >8zw3 nts=23 [whole] TCTGGGCGGGCGAGGGCGGGAGC ....................... >8zw3-X #1 nts=23 0.52(2.83) [chain] DNA TCTGGGCGGGCGAGGGCGGGAGC ....................... **************************************************************************** Summary of structural features of 23 nucleotides Note: the first five columns are: (1) serial number, (2) one-letter shorthand name, (3) dbn, (4) id string, (5) rmsd (~zero) of base ring atoms fitted against those in a standard base reference frame. The sixth (last) column contains a comma-separated list of features whose meanings are mostly self-explanatory, except for: turn: angle C1'(i-1)--C1'(i)--C1'(i+1) < 90 degrees break: no backbone linkage between O3'(i-1) and P(i) 1 T . X.DT1 0.030 anti,~C2'-endo,BI,non-pair-contact,ss-non-loop 2 C . X.DC2 0.016 anti,~C2'-endo,non-pair-contact,ss-non-loop 3 T . X.DT3 0.031 anti,~C2'-endo,non-pair-contact,ss-non-loop 4 G . X.DG4 0.046 anti,~C2'-endo,BI,non-canonical,non-pair-contact,helix-end,multiplet,ss-non-loop,G-tetrad 5 G . X.DG5 0.030 anti,~C2'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,ss-non-loop,G-tetrad 6 G . X.DG6 0.028 anti,~C2'-endo,non-canonical,non-pair-contact,helix-end,multiplet,ss-non-loop,G-tetrad,splayed-apart 7 C . X.DC7 0.015 turn,anti,~C2'-endo,non-stack,ss-non-loop,splayed-apart 8 G . X.DG8 0.025 anti,~C2'-endo,BI,non-canonical,non-pair-contact,helix-end,multiplet,ss-non-loop,G-tetrad,splayed-apart 9 G . X.DG9 0.021 anti,~C2'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,ss-non-loop,G-tetrad 10 G . X.DG10 0.023 anti,~C2'-endo,non-canonical,non-pair-contact,helix-end,multiplet,ss-non-loop,G-tetrad,splayed-apart 11 C . X.DC11 0.015 turn,anti,~C2'-endo,non-stack,ss-non-loop,splayed-apart 12 G . X.DG12 0.033 anti,~C2'-endo,BI,non-pair-contact,ss-non-loop 13 A . X.DA13 0.035 anti,~C2'-endo,BII,non-pair-contact,ss-non-loop,splayed-apart 14 G . X.DG14 0.023 anti,~C2'-endo,BI,non-canonical,non-pair-contact,helix-end,multiplet,ss-non-loop,G-tetrad,splayed-apart 15 G . X.DG15 0.021 anti,~C2'-endo,non-canonical,non-pair-contact,helix,multiplet,ss-non-loop,G-tetrad 16 G . X.DG16 0.029 anti,~C2'-endo,non-canonical,non-pair-contact,helix-end,multiplet,ss-non-loop,G-tetrad,splayed-apart 17 C . X.DC17 0.015 turn,anti,~C2'-endo,non-stack,ss-non-loop,splayed-apart 18 G . X.DG18 0.031 anti,~C2'-endo,BI,non-canonical,non-pair-contact,helix-end,multiplet,ss-non-loop,G-tetrad,splayed-apart 19 G . X.DG19 0.022 anti,~C2'-endo,BII,non-canonical,non-pair-contact,helix,multiplet,ss-non-loop,G-tetrad 20 G . X.DG20 0.023 anti,~C2'-endo,BI,non-canonical,non-pair-contact,helix-end,multiplet,ss-non-loop,G-tetrad 21 A . X.DA21 0.035 anti,~C2'-endo,BII,non-pair-contact,ss-non-loop 22 G . X.DG22 0.024 anti,~C2'-endo,BI,non-pair-contact,ss-non-loop 23 C . X.DC23 0.016 anti,~C2'-endo,non-pair-contact,ss-non-loop **************************************************************************** List of 13 additional files 1 dssr-pairs.pdb -- an ensemble of base pairs 2 dssr-multiplets.pdb -- an ensemble of multiplets 3 dssr-helices.pdb -- an ensemble of helices (coaxial stacking) 4 dssr-2ndstrs.bpseq -- secondary structure in bpseq format 5 dssr-2ndstrs.ct -- secondary structure in connectivity table format 6 dssr-2ndstrs.dbn -- secondary structure in dot-bracket notation 7 dssr-torsions.txt -- backbone torsion angles and suite names 8 dssr-splays.pdb -- an ensemble of splayed-apart units 9 dssr-stacks.pdb -- an ensemble of base stacks 10 dssr-rotmat.txt -- position vector and rotation matrix 11 dssr-viewV.pdb -- vertical view of the principal moment of inertia 12 dssr-viewH.pdb -- horizontal view of the principal moment of inertia 13 dssr-viewT.pdb -- top view of the principal moment of inertia