{ "num_pairs": 36, "pairs": [ { "index": 1, "nt1": "///A/2", "nt2": "///A/35", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -171.356, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 52.109, "chi2": -160.285, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 53.567, "C1C1_dist": 10.724, "N1N9_dist": 8.942, "C6C8_dist": 9.853, "CNNC_torsion": -11.382, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.93],N1(imino)-N3[2.91],N2(amino)-O2(carbonyl)[2.81]", "interBase_angle": 11.533, "planarity": 0.149, "simple_Shear": -0.365, "simple_Stretch": -0.162, "simple_Buckle": -0.595, "simple_Propeller": -11.517, "bp_simpleParams": [ -0.365, -0.162, 0.242, -0.595, -11.517, -0.924 ], "bp_params": [ -0.359, -0.174, 0.242, -0.218, -11.531, -0.926 ], "frame": { "rmsd": null, "origin": [ -36.028, -4.794, 4.877 ], "x_axis": [ -0.140, 0.990, -0.011 ], "y_axis": [ -0.990, -0.140, 0.019 ], "z_axis": [ 0.017, 0.013, 1.000 ], "quaternion": [ 0.656, 0.002, 0.011, 0.755 ] } }, { "index": 2, "nt1": "///A/3", "nt2": "///A/34", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -160.780, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 56.073, "chi2": -159.881, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 56.390, "C1C1_dist": 10.556, "N1N9_dist": 8.918, "C6C8_dist": 9.905, "CNNC_torsion": -18.187, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.07],N1-N3(imino)[2.90]", "interBase_angle": 20.088, "planarity": 0.246, "simple_Shear": -0.209, "simple_Stretch": -0.050, "simple_Buckle": -3.914, "simple_Propeller": -19.703, "bp_simpleParams": [ -0.209, -0.050, 0.114, -3.914, -19.703, 1.100 ], "bp_params": [ -0.208, -0.053, 0.114, -3.599, -19.763, 1.116 ], "frame": { "rmsd": null, "origin": [ -35.017, -3.869, 8.124 ], "x_axis": [ -0.718, 0.685, -0.121 ], "y_axis": [ -0.695, -0.715, 0.078 ], "z_axis": [ -0.033, 0.140, 0.990 ], "quaternion": [ 0.373, -0.041, 0.059, 0.925 ] } }, { "index": 3, "nt1": "///A/4", "nt2": "///A/33", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -165.210, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 56.549, "chi2": -163.147, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 54.326, "C1C1_dist": 10.533, "N1N9_dist": 8.863, "C6C8_dist": 9.836, "CNNC_torsion": -15.603, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.01],N1-N3(imino)[2.83]", "interBase_angle": 15.398, "planarity": 0.206, "simple_Shear": 0.034, "simple_Stretch": -0.125, "simple_Buckle": -2.166, "simple_Propeller": -15.244, "bp_simpleParams": [ 0.034, -0.125, 0.328, -2.166, -15.244, 0.482 ], "bp_params": [ 0.032, -0.125, 0.328, -2.295, -15.225, 0.487 ], "frame": { "rmsd": null, "origin": [ -35.175, -2.080, 10.930 ], "x_axis": [ -0.976, 0.135, -0.169 ], "y_axis": [ -0.166, -0.968, 0.186 ], "z_axis": [ -0.139, 0.210, 0.968 ], "quaternion": [ 0.076, -0.078, 0.100, 0.989 ] } }, { "index": 4, "nt1": "///A/5", "nt2": "///A/12", "bp": "G+A", "name": "--", "Saenger": "10-X", "LW": "tSW", "DSSR": "tm+W", "intra_chain": true, "chi1": -149.748, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 118.940, "chi2": -160.197, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 7.186, "C1C1_dist": 9.421, "N1N9_dist": 8.791, "C6C8_dist": 9.695, "CNNC_torsion": 155.583, "hbonds_num": 3, "hbonds_desc": "O2'(hydroxyl)-N6(amino)[2.92],N2(amino)-N1[2.98],N3-N6(amino)[3.03]", "interBase_angle": 10.866, "planarity": 0.150, "simple_Shear": 2.147, "simple_Stretch": 4.783, "simple_Buckle": 4.928, "simple_Propeller": -9.685, "bp_simpleParams": [ 2.147, 4.783, 0.063, 4.928, -9.685, -65.821 ], "bp_params": [ 3.535, -3.872, 0.063, -10.846, -0.662, -65.588 ], "frame": { "rmsd": null, "origin": [ -34.164, 0.884, 13.843 ], "x_axis": [ -0.588, -0.786, 0.189 ], "y_axis": [ 0.768, -0.471, 0.434 ], "z_axis": [ -0.252, 0.401, 0.881 ], "quaternion": [ -0.453, -0.018, 0.243, 0.857 ] } }, { "index": 5, "nt1": "///A/5", "nt2": "///A/32", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -149.748, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 54.900, "chi2": -161.145, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 55.233, "C1C1_dist": 10.563, "N1N9_dist": 8.874, "C6C8_dist": 9.829, "CNNC_torsion": -14.077, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.92],N1(imino)-N3[2.82],N2(amino)-O2(carbonyl)[2.77]", "interBase_angle": 17.459, "planarity": 0.210, "simple_Shear": -0.150, "simple_Stretch": -0.190, "simple_Buckle": -4.129, "simple_Propeller": -16.964, "bp_simpleParams": [ -0.150, -0.190, 0.004, -4.129, -16.964, 1.090 ], "bp_params": [ -0.149, -0.191, 0.004, -3.969, -17.002, 1.102 ], "frame": { "rmsd": null, "origin": [ -36.734, 0.305, 13.392 ], "x_axis": [ -0.889, -0.427, -0.164 ], "y_axis": [ 0.326, -0.842, 0.430 ], "z_axis": [ -0.321, 0.329, 0.888 ], "quaternion": [ -0.198, -0.127, 0.199, 0.951 ] } }, { "index": 6, "nt1": "///A/6", "nt2": "///A/13", "bp": "A-A", "name": "--", "Saenger": "05-V", "LW": "tHW", "DSSR": "tM-W", "intra_chain": true, "chi1": -131.488, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 22.145, "chi2": -162.919, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 22.971, "C1C1_dist": 12.273, "N1N9_dist": 9.624, "C6C8_dist": 8.125, "CNNC_torsion": -161.661, "hbonds_num": 2, "hbonds_desc": "N7-N6(amino)[3.00],N6(amino)-N1[3.07]", "interBase_angle": 7.234, "planarity": 0.104, "simple_Shear": -2.804, "simple_Stretch": 3.521, "simple_Buckle": -6.957, "simple_Propeller": -1.980, "bp_simpleParams": [ -2.804, 3.521, -0.236, -6.957, -1.980, -112.857 ], "bp_params": [ -4.228, 1.545, -0.236, -4.910, -5.312, -112.865 ], "frame": { "rmsd": null, "origin": [ -36.749, 0.974, 16.597 ], "x_axis": [ 0.923, -0.058, 0.379 ], "y_axis": [ -0.208, -0.907, 0.366 ], "z_axis": [ 0.323, -0.416, -0.850 ], "quaternion": [ 0.204, 0.959, -0.069, 0.183 ] } }, { "index": 7, "nt1": "///A/6", "nt2": "///A/31", "bp": "A+A", "name": "--", "Saenger": "01-I", "LW": "tWW", "DSSR": "tW+W", "intra_chain": true, "chi1": -131.488, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 29.384, "chi2": -171.456, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 22.811, "C1C1_dist": 13.683, "N1N9_dist": 11.118, "C6C8_dist": 11.228, "CNNC_torsion": 156.824, "hbonds_num": 2, "hbonds_desc": "N6(amino)-N1[2.98],N1-N6(amino)[2.80]", "interBase_angle": 10.797, "planarity": 0.144, "simple_Shear": -1.333, "simple_Stretch": 1.547, "simple_Buckle": -5.222, "simple_Propeller": -9.451, "bp_simpleParams": [ -1.333, 1.547, -0.055, -5.222, -9.451, -174.527 ], "bp_params": [ 1.361, 1.523, -0.055, -10.051, 3.944, -174.509 ], "frame": { "rmsd": null, "origin": [ -38.878, 1.379, 15.763 ], "x_axis": [ 0.702, -0.537, 0.468 ], "y_axis": [ -0.644, -0.759, 0.095 ], "z_axis": [ 0.304, -0.368, -0.878 ], "quaternion": [ 0.127, 0.914, -0.323, 0.211 ] } }, { "index": 8, "nt1": "///A/8", "nt2": "///A/29", "bp": "U-A", "name": "rHoogsteen", "Saenger": "24-XXIV", "LW": "tWH", "DSSR": "tW-M", "intra_chain": true, "chi1": -131.108, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 31.153, "chi2": -71.510, "conf2": "--", "pucker2": "~C2'-endo", "lambda2": 21.742, "C1C1_dist": 9.555, "N1N9_dist": 7.053, "C6C8_dist": 6.064, "CNNC_torsion": -159.413, "hbonds_num": 2, "hbonds_desc": "O2(carbonyl)-N6(amino)[3.08],N3(imino)-N7[2.83]", "interBase_angle": 24.453, "planarity": 0.251, "simple_Shear": 4.363, "simple_Stretch": 1.593, "simple_Buckle": 23.895, "simple_Propeller": -5.192, "bp_simpleParams": [ 4.363, 1.593, -1.301, 23.895, -5.192, -101.145 ], "bp_params": [ 4.227, -1.924, -1.301, 13.452, -20.420, -101.651 ], "frame": { "rmsd": null, "origin": [ -38.512, 1.579, 19.199 ], "x_axis": [ -0.422, -0.808, 0.412 ], "y_axis": [ 0.843, -0.183, 0.506 ], "z_axis": [ -0.334, 0.561, 0.758 ], "quaternion": [ 0.537, -0.025, -0.347, -0.769 ] } }, { "index": 9, "nt1": "///A/11", "nt2": "///A/33", "bp": "A-U", "name": "--", "Saenger": "--", "LW": "cWS", "DSSR": "cW-m", "intra_chain": true, "chi1": -167.429, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 33.141, "chi2": -163.147, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 127.702, "C1C1_dist": 9.202, "N1N9_dist": 8.878, "C6C8_dist": 10.220, "CNNC_torsion": -14.759, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O2(carbonyl)[2.76],N1-O2'(hydroxyl)[2.45]", "interBase_angle": 16.500, "planarity": 0.178, "simple_Shear": -5.717, "simple_Stretch": 3.524, "simple_Buckle": 9.138, "simple_Propeller": -13.739, "bp_simpleParams": [ -5.717, 3.524, 0.246, 9.138, -13.739, 53.653 ], "bp_params": [ -6.646, -0.966, 0.246, 15.818, -4.693, 53.252 ], "frame": { "rmsd": null, "origin": [ -32.179, -0.642, 11.134 ], "x_axis": [ -0.937, -0.322, -0.136 ], "y_axis": [ 0.234, -0.867, 0.441 ], "z_axis": [ -0.260, 0.382, 0.887 ], "quaternion": [ -0.145, -0.103, 0.214, 0.961 ] } }, { "index": 10, "nt1": "///A/14", "nt2": "///A/29", "bp": "C-A", "name": "--", "Saenger": "--", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -127.587, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 83.126, "chi2": -71.510, "conf2": "--", "pucker2": "~C2'-endo", "lambda2": 43.579, "C1C1_dist": 9.476, "N1N9_dist": 8.258, "C6C8_dist": 9.232, "CNNC_torsion": 19.925, "hbonds_num": 1, "hbonds_desc": "N3-N6(amino)[3.14]", "interBase_angle": 44.221, "planarity": 0.739, "simple_Shear": 3.734, "simple_Stretch": -0.101, "simple_Buckle": -25.835, "simple_Propeller": 35.890, "bp_simpleParams": [ 3.734, -0.101, 2.209, -25.835, 35.890, 31.864 ], "bp_params": [ 3.434, -1.471, 2.209, -10.438, 42.972, 33.992 ], "frame": { "rmsd": null, "origin": [ -36.246, 2.041, 20.738 ], "x_axis": [ 0.730, -0.672, 0.129 ], "y_axis": [ 0.683, 0.708, -0.177 ], "z_axis": [ 0.027, 0.217, 0.976 ], "quaternion": [ 0.924, -0.107, -0.028, -0.367 ] } }, { "index": 11, "nt1": "///A/15", "nt2": "///A/28", "bp": "A-G", "name": "Sheared", "Saenger": "11-XI", "LW": "tHS", "DSSR": "tM-m", "intra_chain": true, "chi1": -166.618, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 8.777, "chi2": -156.260, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 91.230, "C1C1_dist": 9.773, "N1N9_dist": 8.508, "C6C8_dist": 8.620, "CNNC_torsion": -158.047, "hbonds_num": 2, "hbonds_desc": "OP2-N2(amino)[3.09],N7-N2(amino)[2.94]", "interBase_angle": 8.970, "planarity": 0.135, "simple_Shear": -8.253, "simple_Stretch": 3.739, "simple_Buckle": -8.672, "simple_Propeller": 2.292, "bp_simpleParams": [ -8.253, 3.739, 0.345, -8.672, 2.292, -26.151 ], "bp_params": [ -7.410, -5.214, 0.345, -6.373, -6.312, -26.150 ], "frame": { "rmsd": null, "origin": [ -42.277, 7.164, 24.025 ], "x_axis": [ 0.246, -0.853, 0.460 ], "y_axis": [ 0.966, 0.257, -0.040 ], "z_axis": [ -0.084, 0.454, 0.887 ], "quaternion": [ 0.773, -0.160, -0.176, -0.588 ] } }, { "index": 12, "nt1": "///A/16", "nt2": "///A/27", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -160.596, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 55.718, "chi2": -166.539, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 59.388, "C1C1_dist": 10.498, "N1N9_dist": 8.913, "C6C8_dist": 9.918, "CNNC_torsion": -4.777, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.88],O4(carbonyl)-N6(amino)[3.03]", "interBase_angle": 9.719, "planarity": 0.111, "simple_Shear": -0.189, "simple_Stretch": -0.028, "simple_Buckle": 4.855, "simple_Propeller": -8.419, "bp_simpleParams": [ -0.189, -0.028, -0.065, 4.855, -8.419, 1.488 ], "bp_params": [ -0.188, -0.032, -0.065, 5.061, -8.297, 1.491 ], "frame": { "rmsd": null, "origin": [ -41.746, 6.415, 27.884 ], "x_axis": [ 0.978, -0.197, 0.065 ], "y_axis": [ 0.207, 0.904, -0.373 ], "z_axis": [ 0.015, 0.379, 0.925 ], "quaternion": [ 0.976, -0.193, -0.013, -0.104 ] } }, { "index": 13, "nt1": "///A/17", "nt2": "///A/26", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -166.865, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 54.340, "chi2": -165.967, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 56.832, "C1C1_dist": 10.577, "N1N9_dist": 8.911, "C6C8_dist": 9.881, "CNNC_torsion": -5.414, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.96],N1(imino)-N3[2.89],N2(amino)-O2(carbonyl)[2.78]", "interBase_angle": 11.959, "planarity": 0.171, "simple_Shear": -0.227, "simple_Stretch": -0.119, "simple_Buckle": 9.079, "simple_Propeller": -7.784, "bp_simpleParams": [ -0.227, -0.119, 0.059, 9.079, -7.784, 1.025 ], "bp_params": [ -0.224, -0.124, 0.059, 9.239, -7.593, 1.024 ], "frame": { "rmsd": null, "origin": [ -41.740, 6.030, 31.416 ], "x_axis": [ 0.942, 0.173, -0.288 ], "y_axis": [ -0.274, 0.892, -0.359 ], "z_axis": [ 0.195, 0.417, 0.888 ], "quaternion": [ 0.965, -0.201, 0.125, 0.116 ] } }, { "index": 14, "nt1": "///A/18", "nt2": "///A/25", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -163.564, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 60.071, "chi2": -173.960, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 55.955, "C1C1_dist": 10.522, "N1N9_dist": 8.960, "C6C8_dist": 9.971, "CNNC_torsion": -7.657, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.78],N3-N1(imino)[2.96],N4(amino)-O6(carbonyl)[3.10]", "interBase_angle": 13.597, "planarity": 0.156, "simple_Shear": 0.337, "simple_Stretch": -0.049, "simple_Buckle": 5.612, "simple_Propeller": -12.385, "bp_simpleParams": [ 0.337, -0.049, -0.127, 5.612, -12.385, 3.536 ], "bp_params": [ 0.336, -0.058, -0.127, 5.264, -12.536, 3.553 ], "frame": { "rmsd": null, "origin": [ -39.620, 5.999, 34.670 ], "x_axis": [ 0.590, 0.616, -0.523 ], "y_axis": [ -0.759, 0.644, -0.097 ], "z_axis": [ 0.277, 0.454, 0.847 ], "quaternion": [ 0.878, -0.157, 0.228, 0.392 ] } }, { "index": 15, "nt1": "///A/19", "nt2": "///A/24", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -163.840, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 55.765, "chi2": -173.479, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 49.902, "C1C1_dist": 10.731, "N1N9_dist": 8.945, "C6C8_dist": 9.822, "CNNC_torsion": 4.028, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.85],N3-N1(imino)[2.86],N4(amino)-O6(carbonyl)[2.82]", "interBase_angle": 1.571, "planarity": 0.069, "simple_Shear": 0.273, "simple_Stretch": -0.203, "simple_Buckle": -1.567, "simple_Propeller": -0.113, "bp_simpleParams": [ 0.273, -0.203, -0.229, -1.567, -0.113, -1.722 ], "bp_params": [ 0.269, -0.209, -0.229, -1.570, -0.078, -1.722 ], "frame": { "rmsd": null, "origin": [ -36.953, 6.458, 37.636 ], "x_axis": [ 0.072, 0.771, -0.633 ], "y_axis": [ -0.935, 0.274, 0.227 ], "z_axis": [ 0.348, 0.575, 0.740 ], "quaternion": [ 0.722, -0.120, 0.340, 0.590 ] } }, { "index": 16, "nt1": "///A/20", "nt2": "///A/23", "bp": "G-A", "name": "Sheared", "Saenger": "11-XI", "LW": "tSH", "DSSR": "tm-M", "intra_chain": true, "chi1": -165.641, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 98.076, "chi2": -142.249, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 10.001, "C1C1_dist": 9.449, "N1N9_dist": 8.331, "C6C8_dist": 8.554, "CNNC_torsion": -129.768, "hbonds_num": 3, "hbonds_desc": "N2(amino)-OP2[2.91],N2(amino)-N7[2.86],N3-N6(amino)[3.92]", "interBase_angle": 10.529, "planarity": 0.235, "simple_Shear": 8.089, "simple_Stretch": 3.160, "simple_Buckle": 5.647, "simple_Propeller": 8.887, "bp_simpleParams": [ 8.089, 3.160, 0.853, 5.647, 8.887, -17.542 ], "bp_params": [ 7.092, -5.012, 0.853, 10.527, 0.185, -17.470 ], "frame": { "rmsd": null, "origin": [ -34.266, 6.922, 40.294 ], "x_axis": [ -0.770, 0.554, -0.315 ], "y_axis": [ -0.587, -0.424, 0.689 ], "z_axis": [ 0.248, 0.716, 0.652 ], "quaternion": [ 0.338, -0.020, 0.417, 0.844 ] } }, { "index": 17, "nt1": "///A/29", "nt2": "///A/30", "bp": "A+C", "name": "Platform", "Saenger": "--", "LW": "cSH", "DSSR": "cm+M", "intra_chain": true, "chi1": -71.510, "conf1": "--", "pucker1": "~C2'-endo", "lambda1": 141.906, "chi2": -166.831, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 39.480, "C1C1_dist": 7.054, "N1N9_dist": 7.064, "C6C8_dist": 7.098, "CNNC_torsion": 8.676, "hbonds_num": 1, "hbonds_desc": "N3-N4(amino)[2.98]", "interBase_angle": 5.951, "planarity": 0.092, "simple_Shear": -0.167, "simple_Stretch": 7.077, "simple_Buckle": -5.581, "simple_Propeller": 2.066, "bp_simpleParams": [ -0.167, 7.077, 0.128, -5.581, 2.066, 0.312 ], "bp_params": [ 7.060, 0.519, 0.128, 1.784, 5.677, 0.312 ], "frame": { "rmsd": null, "origin": [ -38.477, 6.338, 17.814 ], "x_axis": [ 0.468, -0.765, 0.442 ], "y_axis": [ -0.843, -0.537, -0.038 ], "z_axis": [ 0.267, -0.355, -0.896 ], "quaternion": [ 0.093, 0.852, -0.472, 0.208 ] } }, { "index": 18, "nt1": "///A/36", "nt2": "///A/101", "bp": "C-g", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -156.953, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 51.208, "chi2": 171.874, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 48.524, "C1C1_dist": 11.040, "N1N9_dist": 9.134, "C6C8_dist": 9.948, "CNNC_torsion": 2.973, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.90],N3-N1(imino)[2.86],N4(amino)-O6(carbonyl)[2.93]", "interBase_angle": 2.408, "planarity": 0.037, "simple_Shear": 0.236, "simple_Stretch": -0.134, "simple_Buckle": 2.395, "simple_Propeller": -0.249, "bp_simpleParams": [ 0.236, -0.134, -0.170, 2.395, -0.249, -3.893 ], "bp_params": [ 0.234, -0.138, -0.170, 2.390, -0.289, -3.892 ], "frame": { "rmsd": null, "origin": [ -37.838, -4.005, 1.754 ], "x_axis": [ 0.382, 0.924, 0.004 ], "y_axis": [ 0.918, -0.379, -0.119 ], "z_axis": [ -0.108, 0.049, -0.993 ], "quaternion": [ -0.051, 0.830, 0.555, -0.031 ] } }, { "index": 19, "nt1": "///B/2", "nt2": "///B/35", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -168.232, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 54.341, "chi2": -155.832, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 55.452, "C1C1_dist": 10.752, "N1N9_dist": 9.055, "C6C8_dist": 10.035, "CNNC_torsion": -15.121, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[3.16],N1(imino)-N3[2.98],N2(amino)-O2(carbonyl)[2.82]", "interBase_angle": 15.959, "planarity": 0.201, "simple_Shear": -0.113, "simple_Stretch": 0.002, "simple_Buckle": -2.276, "simple_Propeller": -15.796, "bp_simpleParams": [ -0.113, 0.002, 0.185, -2.276, -15.796, 2.148 ], "bp_params": [ -0.113, 0.002, 0.185, -2.183, -15.809, 2.169 ], "frame": { "rmsd": null, "origin": [ -8.304, 5.107, 21.049 ], "x_axis": [ -0.417, -0.894, 0.166 ], "y_axis": [ -0.908, 0.417, -0.035 ], "z_axis": [ -0.037, -0.165, -0.986 ], "quaternion": [ -0.060, -0.537, 0.840, -0.060 ] } }, { "index": 20, "nt1": "///B/3", "nt2": "///B/34", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -160.085, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 54.908, "chi2": -157.724, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 53.867, "C1C1_dist": 10.463, "N1N9_dist": 8.750, "C6C8_dist": 9.702, "CNNC_torsion": -18.980, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.92],N1-N3(imino)[2.71]", "interBase_angle": 22.225, "planarity": 0.270, "simple_Shear": -0.007, "simple_Stretch": -0.235, "simple_Buckle": -5.469, "simple_Propeller": -21.542, "bp_simpleParams": [ -0.007, -0.235, 0.099, -5.469, -21.542, 0.061 ], "bp_params": [ -0.009, -0.235, 0.099, -5.592, -21.510, 0.062 ], "frame": { "rmsd": null, "origin": [ -7.181, 3.792, 17.933 ], "x_axis": [ -0.845, -0.476, 0.242 ], "y_axis": [ -0.519, 0.840, -0.158 ], "z_axis": [ -0.128, -0.259, -0.957 ], "quaternion": [ -0.097, -0.261, 0.954, -0.109 ] } }, { "index": 21, "nt1": "///B/4", "nt2": "///B/33", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -157.738, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 55.320, "chi2": -161.850, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 53.701, "C1C1_dist": 10.515, "N1N9_dist": 8.806, "C6C8_dist": 9.766, "CNNC_torsion": -21.312, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.99],N1-N3(imino)[2.75]", "interBase_angle": 19.406, "planarity": 0.266, "simple_Shear": 0.145, "simple_Stretch": -0.196, "simple_Buckle": -2.080, "simple_Propeller": -19.294, "bp_simpleParams": [ 0.145, -0.196, 0.466, -2.080, -19.294, -0.208 ], "bp_params": [ 0.141, -0.199, 0.466, -2.464, -19.249, -0.211 ], "frame": { "rmsd": null, "origin": [ -7.575, 1.886, 15.378 ], "x_axis": [ -0.974, 0.116, 0.196 ], "y_axis": [ 0.055, 0.954, -0.294 ], "z_axis": [ -0.221, -0.276, -0.935 ], "quaternion": [ -0.106, 0.044, 0.983, -0.145 ] } }, { "index": 22, "nt1": "///B/5", "nt2": "///B/12", "bp": "G+A", "name": "--", "Saenger": "10-X", "LW": "tSW", "DSSR": "tm+W", "intra_chain": true, "chi1": -145.250, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 115.491, "chi2": -156.736, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 7.289, "C1C1_dist": 9.628, "N1N9_dist": 8.929, "C6C8_dist": 9.850, "CNNC_torsion": 157.416, "hbonds_num": 3, "hbonds_desc": "O2'(hydroxyl)-N6(amino)[3.06],N2(amino)-N1[2.93],N3-N6(amino)[3.11]", "interBase_angle": 16.232, "planarity": 0.215, "simple_Shear": 2.209, "simple_Stretch": 4.716, "simple_Buckle": 10.392, "simple_Propeller": -12.469, "bp_simpleParams": [ 2.209, 4.716, 0.273, 10.392, -12.469, -69.053 ], "bp_params": [ 3.481, -3.874, 0.273, -15.538, -4.695, -68.606 ], "frame": { "rmsd": null, "origin": [ -7.380, -1.294, 12.590 ], "x_axis": [ -0.381, 0.892, -0.243 ], "y_axis": [ 0.830, 0.214, -0.516 ], "z_axis": [ -0.408, -0.398, -0.822 ], "quaternion": [ -0.053, 0.554, 0.777, -0.294 ] } }, { "index": 23, "nt1": "///B/5", "nt2": "///B/32", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -145.250, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 54.412, "chi2": -160.435, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 53.248, "C1C1_dist": 10.803, "N1N9_dist": 9.059, "C6C8_dist": 9.985, "CNNC_torsion": -19.530, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[3.08],N1(imino)-N3[2.97],N2(amino)-O2(carbonyl)[2.94]", "interBase_angle": 22.750, "planarity": 0.276, "simple_Shear": -0.096, "simple_Stretch": -0.033, "simple_Buckle": -5.936, "simple_Propeller": -21.962, "bp_simpleParams": [ -0.096, -0.033, 0.143, -5.936, -21.962, 0.136 ], "bp_params": [ -0.096, -0.033, 0.143, -5.871, -21.980, 0.139 ], "frame": { "rmsd": null, "origin": [ -9.702, -0.146, 13.112 ], "x_axis": [ -0.751, 0.641, 0.161 ], "y_axis": [ 0.481, 0.697, -0.531 ], "z_axis": [ -0.452, -0.321, -0.832 ], "quaternion": [ -0.169, 0.310, 0.906, -0.235 ] } }, { "index": 24, "nt1": "///B/6", "nt2": "///B/13", "bp": "A-A", "name": "--", "Saenger": "05-V", "LW": "tHW", "DSSR": "tM-W", "intra_chain": true, "chi1": -135.407, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 21.136, "chi2": -157.858, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 23.889, "C1C1_dist": 12.248, "N1N9_dist": 9.594, "C6C8_dist": 8.138, "CNNC_torsion": -150.323, "hbonds_num": 2, "hbonds_desc": "N7-N6(amino)[3.09],N6(amino)-N1[2.88]", "interBase_angle": 11.917, "planarity": 0.205, "simple_Shear": -2.941, "simple_Stretch": 3.260, "simple_Buckle": -11.696, "simple_Propeller": -2.283, "bp_simpleParams": [ -2.941, 3.260, -0.704, -11.696, -2.283, -108.130 ], "bp_params": [ -4.199, 1.283, -0.704, -8.861, -7.968, -108.099 ], "frame": { "rmsd": null, "origin": [ -9.694, -0.609, 9.752 ], "x_axis": [ 0.859, -0.261, -0.441 ], "y_axis": [ 0.058, 0.905, -0.421 ], "z_axis": [ 0.509, 0.336, 0.792 ], "quaternion": [ 0.943, -0.201, 0.252, -0.085 ] } }, { "index": 25, "nt1": "///B/6", "nt2": "///B/31", "bp": "A+A", "name": "--", "Saenger": "01-I", "LW": "tWW", "DSSR": "tW+W", "intra_chain": true, "chi1": -135.407, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 28.390, "chi2": -162.832, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 23.177, "C1C1_dist": 13.861, "N1N9_dist": 11.281, "C6C8_dist": 11.352, "CNNC_torsion": 149.426, "hbonds_num": 2, "hbonds_desc": "N6(amino)-N1[3.13],N1-N6(amino)[2.92]", "interBase_angle": 13.555, "planarity": 0.173, "simple_Shear": -1.485, "simple_Stretch": 1.682, "simple_Buckle": -4.836, "simple_Propeller": -12.663, "bp_simpleParams": [ -1.485, 1.682, -0.027, -4.836, -12.663, -175.681 ], "bp_params": [ 1.450, 1.712, -0.027, -13.232, 2.943, -175.654 ], "frame": { "rmsd": null, "origin": [ -11.824, -0.584, 10.632 ], "x_axis": [ 0.765, 0.302, -0.569 ], "y_axis": [ -0.424, 0.901, -0.093 ], "z_axis": [ 0.484, 0.313, 0.817 ], "quaternion": [ 0.933, -0.109, 0.282, 0.194 ] } }, { "index": 26, "nt1": "///B/8", "nt2": "///B/29", "bp": "U-A", "name": "rHoogsteen", "Saenger": "24-XXIV", "LW": "tWH", "DSSR": "tW-M", "intra_chain": true, "chi1": -134.207, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 33.092, "chi2": -78.012, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 19.995, "C1C1_dist": 9.598, "N1N9_dist": 7.106, "C6C8_dist": 6.174, "CNNC_torsion": -164.276, "hbonds_num": 2, "hbonds_desc": "O2(carbonyl)-N6(amino)[2.90],N3(imino)-N7[2.83]", "interBase_angle": 17.703, "planarity": 0.190, "simple_Shear": 4.466, "simple_Stretch": 1.412, "simple_Buckle": 17.518, "simple_Propeller": -2.553, "bp_simpleParams": [ 4.466, 1.412, -0.978, 17.518, -2.553, -97.565 ], "bp_params": [ 4.205, -2.062, -0.978, 10.924, -13.930, -97.727 ], "frame": { "rmsd": null, "origin": [ -11.585, -0.653, 6.918 ], "x_axis": [ -0.184, 0.875, -0.447 ], "y_axis": [ 0.809, -0.123, -0.575 ], "z_axis": [ -0.558, -0.468, -0.685 ], "quaternion": [ -0.042, 0.637, 0.661, -0.394 ] } }, { "index": 27, "nt1": "///B/11", "nt2": "///B/33", "bp": "A-U", "name": "--", "Saenger": "--", "LW": "cWS", "DSSR": "cW-m", "intra_chain": true, "chi1": -166.957, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 35.767, "chi2": -161.850, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 128.596, "C1C1_dist": 9.165, "N1N9_dist": 8.903, "C6C8_dist": 10.312, "CNNC_torsion": -15.950, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O2(carbonyl)[2.88],N1-O2'(hydroxyl)[2.59]", "interBase_angle": 15.640, "planarity": 0.163, "simple_Shear": -5.509, "simple_Stretch": 3.540, "simple_Buckle": 7.599, "simple_Propeller": -13.670, "bp_simpleParams": [ -5.509, 3.540, 0.496, 7.599, -13.670, 56.032 ], "bp_params": [ -6.514, -0.665, 0.496, 14.454, -5.974, 55.719 ], "frame": { "rmsd": null, "origin": [ -5.041, -0.159, 15.151 ], "x_axis": [ -0.813, 0.571, 0.116 ], "y_axis": [ 0.426, 0.719, -0.549 ], "z_axis": [ -0.397, -0.397, -0.828 ], "quaternion": [ -0.140, 0.272, 0.916, -0.258 ] } }, { "index": 28, "nt1": "///B/14", "nt2": "///B/29", "bp": "C-A", "name": "--", "Saenger": "--", "LW": "cSW", "DSSR": "cm-W", "intra_chain": true, "chi1": -133.682, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 84.029, "chi2": -78.012, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 43.243, "C1C1_dist": 9.302, "N1N9_dist": 8.107, "C6C8_dist": 9.011, "CNNC_torsion": 26.056, "hbonds_num": 1, "hbonds_desc": "N3-N6(amino)[3.16]", "interBase_angle": 52.213, "planarity": 0.825, "simple_Shear": 3.834, "simple_Stretch": -0.186, "simple_Buckle": -33.970, "simple_Propeller": 39.652, "bp_simpleParams": [ 3.834, -0.186, 2.271, -33.970, 39.652, 39.182 ], "bp_params": [ 3.478, -1.623, 2.271, -16.145, 49.654, 42.495 ], "frame": { "rmsd": null, "origin": [ -9.526, -1.875, 5.261 ], "x_axis": [ 0.892, 0.396, -0.217 ], "y_axis": [ 0.446, -0.847, 0.288 ], "z_axis": [ -0.070, -0.354, -0.933 ], "quaternion": [ 0.167, 0.958, 0.220, -0.075 ] } }, { "index": 29, "nt1": "///B/15", "nt2": "///B/28", "bp": "A-G", "name": "Sheared", "Saenger": "11-XI", "LW": "tHS", "DSSR": "tM-m", "intra_chain": true, "chi1": -170.352, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 10.487, "chi2": -155.892, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 90.066, "C1C1_dist": 9.867, "N1N9_dist": 8.594, "C6C8_dist": 8.634, "CNNC_torsion": -162.061, "hbonds_num": 2, "hbonds_desc": "OP2-N2(amino)[3.05],N7-N2(amino)[3.08]", "interBase_angle": 9.986, "planarity": 0.147, "simple_Shear": -8.381, "simple_Stretch": 4.270, "simple_Buckle": -8.932, "simple_Propeller": 4.464, "bp_simpleParams": [ -8.381, 4.270, 0.316, -8.932, 4.464, -32.900 ], "bp_params": [ -7.652, -5.471, 0.316, -8.075, -5.875, -32.864 ], "frame": { "rmsd": null, "origin": [ -17.591, -5.233, 3.178 ], "x_axis": [ 0.405, 0.740, -0.537 ], "y_axis": [ 0.859, -0.510, -0.054 ], "z_axis": [ -0.314, -0.439, -0.842 ], "quaternion": [ 0.116, 0.830, 0.481, -0.256 ] } }, { "index": 30, "nt1": "///B/16", "nt2": "///B/27", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -166.765, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 55.821, "chi2": -166.497, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 58.657, "C1C1_dist": 10.458, "N1N9_dist": 8.859, "C6C8_dist": 9.852, "CNNC_torsion": -2.647, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.79],O4(carbonyl)-N6(amino)[2.84]", "interBase_angle": 5.242, "planarity": 0.062, "simple_Shear": -0.151, "simple_Stretch": -0.118, "simple_Buckle": 1.866, "simple_Propeller": -4.899, "bp_simpleParams": [ -0.151, -0.118, 0.024, 1.866, -4.899, 0.568 ], "bp_params": [ -0.148, -0.121, 0.024, 1.962, -4.861, 0.568 ], "frame": { "rmsd": null, "origin": [ -17.156, -4.371, -1.092 ], "x_axis": [ 0.969, -0.122, -0.216 ], "y_axis": [ -0.019, -0.905, 0.426 ], "z_axis": [ -0.247, -0.409, -0.879 ], "quaternion": [ 0.215, 0.969, -0.037, -0.119 ] } }, { "index": 31, "nt1": "///B/17", "nt2": "///B/26", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -166.266, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 52.779, "chi2": -163.208, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 55.788, "C1C1_dist": 10.632, "N1N9_dist": 8.907, "C6C8_dist": 9.840, "CNNC_torsion": -7.914, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.84],N1(imino)-N3[2.84],N2(amino)-O2(carbonyl)[2.78]", "interBase_angle": 10.362, "planarity": 0.143, "simple_Shear": -0.201, "simple_Stretch": -0.186, "simple_Buckle": 3.022, "simple_Propeller": -9.912, "bp_simpleParams": [ -0.201, -0.186, -0.013, 3.022, -9.912, 0.035 ], "bp_params": [ -0.198, -0.190, -0.013, 3.180, -9.862, 0.035 ], "frame": { "rmsd": null, "origin": [ -17.684, -4.026, -4.691 ], "x_axis": [ 0.863, -0.486, 0.141 ], "y_axis": [ -0.493, -0.746, 0.448 ], "z_axis": [ -0.112, -0.456, -0.883 ], "quaternion": [ 0.242, 0.934, -0.262, 0.008 ] } }, { "index": 32, "nt1": "///B/18", "nt2": "///B/25", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -164.090, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 57.450, "chi2": -171.254, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 55.311, "C1C1_dist": 10.581, "N1N9_dist": 8.947, "C6C8_dist": 9.931, "CNNC_torsion": -9.337, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.79],N3-N1(imino)[2.94],N4(amino)-O6(carbonyl)[3.04]", "interBase_angle": 14.350, "planarity": 0.168, "simple_Shear": 0.299, "simple_Stretch": -0.072, "simple_Buckle": 5.346, "simple_Propeller": -13.317, "bp_simpleParams": [ 0.299, -0.072, -0.071, 5.346, -13.317, 2.851 ], "bp_params": [ 0.298, -0.079, -0.071, 5.029, -13.440, 2.868 ], "frame": { "rmsd": null, "origin": [ -16.427, -4.738, -8.057 ], "x_axis": [ 0.448, -0.793, 0.412 ], "y_axis": [ -0.892, -0.365, 0.267 ], "z_axis": [ -0.062, -0.487, -0.871 ], "quaternion": [ 0.230, 0.819, -0.514, 0.107 ] } }, { "index": 33, "nt1": "///B/19", "nt2": "///B/24", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -162.748, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 53.416, "chi2": -175.177, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 48.493, "C1C1_dist": 10.827, "N1N9_dist": 8.971, "C6C8_dist": 9.816, "CNNC_torsion": 3.662, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.85],N3-N1(imino)[2.89],N4(amino)-O6(carbonyl)[2.79]", "interBase_angle": 0.788, "planarity": 0.058, "simple_Shear": 0.242, "simple_Stretch": -0.195, "simple_Buckle": 0.118, "simple_Propeller": 0.779, "bp_simpleParams": [ 0.242, -0.195, -0.260, 0.118, 0.779, -3.024 ], "bp_params": [ 0.238, -0.199, -0.260, 0.133, 0.777, -3.023 ], "frame": { "rmsd": null, "origin": [ -14.875, -5.814, -11.424 ], "x_axis": [ -0.105, -0.776, 0.622 ], "y_axis": [ -0.994, 0.099, -0.044 ], "z_axis": [ -0.028, -0.623, -0.782 ], "quaternion": [ -0.231, -0.628, 0.705, -0.237 ] } }, { "index": 34, "nt1": "///B/20", "nt2": "///B/23", "bp": "G-A", "name": "Sheared", "Saenger": "11-XI", "LW": "tSH", "DSSR": "tm-M", "intra_chain": true, "chi1": -162.474, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 97.160, "chi2": -145.959, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 10.261, "C1C1_dist": 9.429, "N1N9_dist": 8.300, "C6C8_dist": 8.510, "CNNC_torsion": -136.349, "hbonds_num": 2, "hbonds_desc": "N2(amino)-OP2[2.94],N2(amino)-N7[2.90]", "interBase_angle": 15.018, "planarity": 0.259, "simple_Shear": 8.102, "simple_Stretch": 3.206, "simple_Buckle": 6.020, "simple_Propeller": 13.758, "bp_simpleParams": [ 8.102, 3.206, 0.567, 6.020, 13.758, -16.468 ], "bp_params": [ 7.103, -5.047, 0.567, 14.813, 2.470, -16.336 ], "frame": { "rmsd": null, "origin": [ -13.274, -7.220, -14.308 ], "x_axis": [ -0.862, -0.277, 0.425 ], "y_axis": [ -0.490, 0.669, -0.558 ], "z_axis": [ -0.129, -0.689, -0.713 ], "quaternion": [ -0.154, -0.213, 0.901, -0.346 ] } }, { "index": 35, "nt1": "///B/29", "nt2": "///B/30", "bp": "A+C", "name": "Platform", "Saenger": "--", "LW": "cSH", "DSSR": "cm+M", "intra_chain": true, "chi1": -78.012, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 140.946, "chi2": -171.167, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 41.461, "C1C1_dist": 6.981, "N1N9_dist": 7.014, "C6C8_dist": 7.022, "CNNC_torsion": 13.336, "hbonds_num": 1, "hbonds_desc": "N3-N4(amino)[3.06]", "interBase_angle": 10.481, "planarity": 0.151, "simple_Shear": -0.151, "simple_Stretch": 7.225, "simple_Buckle": -10.466, "simple_Propeller": -0.572, "bp_simpleParams": [ -0.151, 7.225, 0.424, -10.466, -0.572, 2.853 ], "bp_params": [ 7.199, 0.630, 0.424, -1.264, 10.405, 2.864 ], "frame": { "rmsd": null, "origin": [ -12.790, -5.167, 8.689 ], "x_axis": [ 0.628, 0.558, -0.543 ], "y_axis": [ -0.636, 0.770, 0.056 ], "z_axis": [ 0.449, 0.310, 0.838 ], "quaternion": [ 0.899, -0.071, 0.276, 0.332 ] } }, { "index": 36, "nt1": "///B/36", "nt2": "///B/101", "bp": "C-g", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -171.798, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 47.617, "chi2": -175.463, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 50.026, "C1C1_dist": 10.960, "N1N9_dist": 9.012, "C6C8_dist": 9.763, "CNNC_torsion": -5.555, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.88],N3-N1(imino)[2.68],N4(amino)-O6(carbonyl)[2.60]", "interBase_angle": 7.595, "planarity": 0.087, "simple_Shear": -0.070, "simple_Stretch": -0.308, "simple_Buckle": 2.821, "simple_Propeller": -7.052, "bp_simpleParams": [ -0.070, -0.308, -0.011, 2.821, -7.052, -7.564 ], "bp_params": [ -0.066, -0.309, -0.011, 2.918, -7.012, -7.576 ], "frame": { "rmsd": null, "origin": [ -10.146, 6.236, 24.184 ], "x_axis": [ 0.092, -0.993, 0.072 ], "y_axis": [ 0.996, 0.091, -0.008 ], "z_axis": [ 0.002, 0.073, 0.997 ], "quaternion": [ 0.738, -0.027, -0.024, -0.674 ] } } ], "num_multiplets": 8, "multiplets": [ { "index": 1, "num_nts": 3, "nts_short": "AAU", "nts_long": "///A/4,///A/11,///A/33", "planarity": 0.317 }, { "index": 2, "num_nts": 3, "nts_short": "GAC", "nts_long": "///A/5,///A/12,///A/32", "planarity": 0.200 }, { "index": 3, "num_nts": 3, "nts_short": "AAA", "nts_long": "///A/6,///A/13,///A/31", "planarity": 0.143 }, { "index": 4, "num_nts": 3, "nts_short": "AAU", "nts_long": "///B/4,///B/11,///B/33", "planarity": 0.357 }, { "index": 5, "num_nts": 3, "nts_short": "GAC", "nts_long": "///B/5,///B/12,///B/32", "planarity": 0.249 }, { "index": 6, "num_nts": 3, "nts_short": "AAA", "nts_long": "///B/6,///B/13,///B/31", "planarity": 0.222 }, { "index": 7, "num_nts": 4, "nts_short": "UCAC", "nts_long": "///A/8,///A/14,///A/29,///A/30", "planarity": 0.709 }, { "index": 8, "num_nts": 4, "nts_short": "UCAC", "nts_long": "///B/8,///B/14,///B/29,///B/30", "planarity": 0.745 } ], "num_helices": 2, "helices": [ { "index": 1, "num_stems": 2, "strand1": "AGGCAGAACUUCC", "strand2": "GCCGUAUAGAAGg", "bp_type": ".||||...|||||", "helix_form": ".AAA.xxxAAAA", "helical_rise": 3.390, "helical_rise_std": 1.335, "helical_radius": 8.992, "helical_radius_std": 2.194, "helical_axis": [ 0.073, -0.291, -0.954 ], "point1": [ -38.133, 9.942, 39.695 ], "point2": [ -35.131, -1.966, 0.650 ], "num_pairs": 13, "pairs": [ { "index": 1, "nt1": "///A/23", "nt2": "///A/20", "bp": "A-G", "name": "Sheared", "Saenger": "11-XI", "LW": "tHS", "DSSR": "tM-m", "bp1_params": [ -7.092, -5.012, 0.853, -10.527, 0.185, -17.470 ], "step_params": [ 2.112, -1.114, 2.966, 1.626, 11.037, 54.161 ], "heli_params": [ -1.779, -2.194, 2.765, 11.979, -1.765, 55.213 ], "bp2_params": [ -0.269, -0.209, -0.229, 1.570, -0.078, -1.722 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.966, "simple_Twist": 6.449, "simple_hRise": 0.799, "simple_hTwist": 12.881 }, { "index": 2, "nt1": "///A/24", "nt2": "///A/19", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.269, -0.209, -0.229, 1.570, -0.078, -1.722 ], "step_params": [ 0.538, -2.005, 3.438, -0.729, 10.081, 30.402 ], "heli_params": [ -5.374, -1.101, 2.642, 18.588, 1.344, 32.001 ], "bp2_params": [ -0.336, -0.058, -0.127, -5.264, -12.536, 3.553 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.438, "simple_Twist": 31.009, "simple_hRise": 2.660, "simple_hTwist": 32.577 }, { "index": 3, "nt1": "///A/25", "nt2": "///A/18", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.336, -0.058, -0.127, -5.264, -12.536, 3.553 ], "step_params": [ -0.305, -2.004, 3.312, -0.258, 5.658, 35.225 ], "heli_params": [ -4.064, 0.462, 2.967, 9.275, 0.423, 35.663 ], "bp2_params": [ 0.224, -0.124, 0.059, -9.239, -7.593, 1.024 ], "groove_widths": [ 17.090, null, 17.684, null ], "simple_Rise": 3.312, "simple_Twist": 32.167, "simple_hRise": 2.929, "simple_hTwist": 32.649 }, { "index": 4, "nt1": "///A/26", "nt2": "///A/17", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.224, -0.124, 0.059, -9.239, -7.593, 1.024 ], "step_params": [ 0.383, -1.759, 3.064, 2.504, 10.464, 27.832 ], "heli_params": [ -5.273, -0.301, 2.292, 20.796, -4.977, 29.801 ], "bp2_params": [ 0.188, -0.032, -0.065, -5.061, -8.297, 1.491 ], "groove_widths": [ 17.453, 16.250, 14.679, 13.134 ], "simple_Rise": 3.064, "simple_Twist": 28.266, "simple_hRise": 2.305, "simple_hTwist": 30.205 }, { "index": 5, "nt1": "///A/27", "nt2": "///A/16", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.188, -0.032, -0.065, -5.061, -8.297, 1.491 ], "step_params": [ -2.049, -1.212, 3.173, 0.427, 7.494, 63.611 ], "heli_params": [ -1.450, 1.950, 3.016, 7.083, -0.403, 64.006 ], "bp2_params": [ 7.410, -5.214, 0.345, 6.373, -6.312, -26.150 ], "groove_widths": [ 19.679, 16.601, 8.439, 5.589 ], "simple_Rise": 3.173, "simple_Twist": 15.007, "simple_hRise": 2.251, "simple_hTwist": 16.770 }, { "index": 6, "nt1": "///A/28", "nt2": "///A/15", "bp": "G-A", "name": "Sheared", "Saenger": "11-XI", "LW": "tSH", "DSSR": "tm-M", "bp1_params": [ 7.410, -5.214, 0.345, 6.373, -6.312, -26.150 ], "step_params": [ 1.983, -2.406, 7.677, 15.521, 7.569, 38.892 ], "heli_params": [ -5.180, 1.064, 7.349, 10.746, -22.037, 42.417 ], "bp2_params": [ -4.227, -1.924, -1.301, -13.452, -20.420, -101.651 ], "groove_widths": [ 20.131, 9.147, 15.356, 12.548 ], "simple_Rise": 7.677, "simple_Twist": 114.306, "simple_hRise": 7.711, "simple_hTwist": 115.142 }, { "index": 7, "nt1": "///A/29", "nt2": "///A/8", "bp": "A-U", "name": "rHoogsteen", "Saenger": "24-XXIV", "LW": "tHW", "DSSR": "tM-W", "bp1_params": [ -4.227, -1.924, -1.301, -13.452, -20.420, -101.651 ], "step_params": [ -1.107, 0.399, 2.976, -9.155, -3.622, 79.492 ], "heli_params": [ 0.399, 0.636, 3.051, -2.822, 7.134, 79.999 ], "bp2_params": [ 4.228, 1.545, -0.236, 4.910, -5.312, -112.865 ], "groove_widths": [ 17.970, 9.391, 17.075, 16.388 ], "simple_Rise": 2.976, "simple_Twist": 73.012, "simple_hRise": 3.058, "simple_hTwist": 73.581 }, { "index": 8, "nt1": "///A/13", "nt2": "///A/6", "bp": "A-A", "name": "--", "Saenger": "05-V", "LW": "tWH", "DSSR": "tW-M", "bp1_params": [ 4.228, 1.545, -0.236, 4.910, -5.312, -112.865 ], "step_params": [ 0.977, 0.713, 3.043, -5.480, -0.268, -30.939 ], "heli_params": [ -1.270, 0.820, 3.171, 0.497, -10.173, -31.410 ], "bp2_params": [ 0.149, -0.191, 0.004, 3.969, -17.002, 1.102 ], "groove_widths": [ 20.729, 20.268, 16.967, 15.317 ], "simple_Rise": 3.043, "simple_Twist": -51.017, "simple_hRise": 3.129, "simple_hTwist": -51.292 }, { "index": 9, "nt1": "///A/32", "nt2": "///A/5", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.149, -0.191, 0.004, 3.969, -17.002, 1.102 ], "step_params": [ -0.659, -1.674, 3.308, -8.815, 9.996, 31.647 ], "heli_params": [ -4.359, -0.220, 2.750, 17.395, 15.341, 34.273 ], "bp2_params": [ -0.032, -0.125, 0.328, 2.295, -15.225, 0.487 ], "groove_widths": [ 20.777, 17.837, 24.262, 24.166 ], "simple_Rise": 3.308, "simple_Twist": 32.471, "simple_hRise": 2.769, "simple_hTwist": 35.031 }, { "index": 10, "nt1": "///A/33", "nt2": "///A/4", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.032, -0.125, 0.328, 2.295, -15.225, 0.487 ], "step_params": [ -0.477, -1.179, 3.080, -0.979, 7.320, 34.798 ], "heli_params": [ -2.901, 0.651, 2.794, 12.072, 1.614, 35.549 ], "bp2_params": [ 0.208, -0.053, 0.114, 3.599, -19.763, 1.116 ], "groove_widths": [ 17.381, null, 12.945, null ], "simple_Rise": 3.080, "simple_Twist": 33.575, "simple_hRise": 2.781, "simple_hTwist": 34.355 }, { "index": 11, "nt1": "///A/34", "nt2": "///A/3", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.208, -0.053, 0.114, 3.599, -19.763, 1.116 ], "step_params": [ -0.128, -1.231, 3.300, -0.770, 7.772, 37.909 ], "heli_params": [ -2.788, 0.101, 3.001, 11.810, 1.170, 38.676 ], "bp2_params": [ 0.359, -0.174, 0.242, 0.218, -11.531, -0.926 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.300, "simple_Twist": 36.868, "simple_hRise": 2.990, "simple_hTwist": 37.658 }, { "index": 12, "nt1": "///A/35", "nt2": "///A/2", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.359, -0.174, 0.242, 0.218, -11.531, -0.926 ], "step_params": [ 0.524, -1.689, 3.244, 5.661, 2.911, 30.439 ], "heli_params": [ -3.700, 0.088, 3.117, 5.470, -10.635, 31.082 ], "bp2_params": [ 0.234, -0.138, -0.170, 2.390, -0.289, -3.892 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.244, "simple_Twist": 31.710, "simple_hRise": 3.125, "simple_hTwist": 32.327 }, { "index": 13, "nt1": "///A/36", "nt2": "///A/101", "bp": "C-g", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 2, "num_stems": 2, "strand1": "AGGCAGAACUUCC", "strand2": "GCCGUAUAGAAGg", "bp_type": ".||||...|||||", "helix_form": ".AAA.xxxAAAA", "helical_rise": 3.446, "helical_rise_std": 1.146, "helical_radius": 8.922, "helical_radius_std": 2.003, "helical_axis": [ 0.260, 0.323, 0.910 ], "point1": [ -17.125, -10.226, -13.043 ], "point2": [ -6.316, 3.226, 24.823 ], "num_pairs": 13, "pairs": [ { "index": 1, "nt1": "///B/23", "nt2": "///B/20", "bp": "A-G", "name": "Sheared", "Saenger": "11-XI", "LW": "tHS", "DSSR": "tM-m", "bp1_params": [ -7.103, -5.047, 0.567, -14.813, 2.470, -16.336 ], "step_params": [ 1.717, -1.074, 2.958, 1.889, 7.778, 54.779 ], "heli_params": [ -1.564, -1.750, 2.847, 8.403, -2.041, 55.316 ], "bp2_params": [ -0.238, -0.199, -0.260, -0.133, 0.777, -3.023 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.958, "simple_Twist": 7.100, "simple_hRise": 1.488, "simple_hTwist": 10.696 }, { "index": 2, "nt1": "///B/24", "nt2": "///B/19", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.238, -0.199, -0.260, -0.133, 0.777, -3.023 ], "step_params": [ 0.661, -1.851, 3.322, -0.221, 9.539, 33.131 ], "heli_params": [ -4.521, -1.148, 2.697, 16.312, 0.377, 34.441 ], "bp2_params": [ -0.298, -0.079, -0.071, -5.029, -13.440, 2.868 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.322, "simple_Twist": 33.586, "simple_hRise": 2.707, "simple_hTwist": 34.877 }, { "index": 3, "nt1": "///B/25", "nt2": "///B/18", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.298, -0.079, -0.071, -5.029, -13.440, 2.868 ], "step_params": [ -0.358, -1.782, 3.180, -0.849, 3.345, 33.723 ], "heli_params": [ -3.567, 0.485, 3.003, 5.747, 1.458, 33.894 ], "bp2_params": [ 0.198, -0.190, -0.013, -3.180, -9.862, 0.035 ], "groove_widths": [ 16.864, null, 16.819, null ], "simple_Rise": 3.180, "simple_Twist": 31.223, "simple_hRise": 2.986, "simple_hTwist": 31.409 }, { "index": 4, "nt1": "///B/26", "nt2": "///B/17", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.198, -0.190, -0.013, -3.180, -9.862, 0.035 ], "step_params": [ 0.470, -1.838, 3.123, 0.192, 8.207, 29.042 ], "heli_params": [ -5.005, -0.870, 2.524, 15.967, -0.374, 30.156 ], "bp2_params": [ 0.148, -0.121, 0.024, -1.962, -4.861, 0.568 ], "groove_widths": [ 17.096, 15.980, 14.870, 13.439 ], "simple_Rise": 3.123, "simple_Twist": 29.480, "simple_hRise": 2.534, "simple_hTwist": 30.577 }, { "index": 5, "nt1": "///B/27", "nt2": "///B/16", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.148, -0.121, 0.024, -1.962, -4.861, 0.568 ], "step_params": [ -2.579, -1.532, 3.188, -0.039, 4.709, 65.130 ], "heli_params": [ -1.607, 2.389, 3.085, 4.368, 0.037, 65.282 ], "bp2_params": [ 7.652, -5.471, 0.316, 8.075, -5.875, -32.864 ], "groove_widths": [ 19.606, 16.067, 7.866, 5.257 ], "simple_Rise": 3.188, "simple_Twist": 14.329, "simple_hRise": 2.562, "simple_hTwist": 15.079 }, { "index": 6, "nt1": "///B/28", "nt2": "///B/15", "bp": "G-A", "name": "Sheared", "Saenger": "11-XI", "LW": "tSH", "DSSR": "tm-M", "bp1_params": [ 7.652, -5.471, 0.316, 8.075, -5.875, -32.864 ], "step_params": [ 2.350, -2.694, 7.632, 14.858, 7.746, 35.097 ], "heli_params": [ -6.335, 0.829, 7.283, 12.035, -23.085, 38.778 ], "bp2_params": [ -4.205, -2.062, -0.978, -10.924, -13.930, -97.727 ], "groove_widths": [ 20.370, 9.096, 15.501, 12.834 ], "simple_Rise": 7.632, "simple_Twist": 112.119, "simple_hRise": 7.678, "simple_hTwist": 112.940 }, { "index": 7, "nt1": "///B/29", "nt2": "///B/8", "bp": "A-U", "name": "rHoogsteen", "Saenger": "24-XXIV", "LW": "tHW", "DSSR": "tM-W", "bp1_params": [ -4.205, -2.062, -0.978, -10.924, -13.930, -97.727 ], "step_params": [ -1.047, 0.833, 3.133, -9.425, -3.735, 79.358 ], "heli_params": [ 0.745, 0.573, 3.186, -2.914, 7.353, 79.897 ], "bp2_params": [ 4.199, 1.283, -0.704, 8.861, -7.968, -108.099 ], "groove_widths": [ 18.426, 10.021, 16.221, 15.789 ], "simple_Rise": 3.133, "simple_Twist": 73.250, "simple_hRise": 3.190, "simple_hTwist": 73.851 }, { "index": 8, "nt1": "///B/13", "nt2": "///B/6", "bp": "A-A", "name": "--", "Saenger": "05-V", "LW": "tWH", "DSSR": "tW-M", "bp1_params": [ 4.199, 1.283, -0.704, 8.861, -7.968, -108.099 ], "step_params": [ 1.248, 1.289, 2.879, -2.701, 3.021, -27.880 ], "heli_params": [ -3.268, 2.011, 2.832, -6.228, -5.569, -28.167 ], "bp2_params": [ 0.096, -0.033, 0.143, 5.871, -21.980, 0.139 ], "groove_widths": [ 21.420, 20.948, 15.092, 14.221 ], "simple_Rise": 2.879, "simple_Twist": -47.713, "simple_hRise": 2.860, "simple_hTwist": -47.874 }, { "index": 9, "nt1": "///B/32", "nt2": "///B/5", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.096, -0.033, 0.143, 5.871, -21.980, 0.139 ], "step_params": [ -0.626, -1.467, 3.353, -8.549, 12.073, 31.040 ], "heli_params": [ -4.331, -0.244, 2.691, 21.122, 14.956, 34.307 ], "bp2_params": [ -0.141, -0.199, 0.466, 2.464, -19.249, -0.211 ], "groove_widths": [ 21.137, 18.576, 24.370, 24.190 ], "simple_Rise": 3.353, "simple_Twist": 32.244, "simple_hRise": 2.724, "simple_hTwist": 35.394 }, { "index": 10, "nt1": "///B/33", "nt2": "///B/4", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.141, -0.199, 0.466, 2.464, -19.249, -0.211 ], "step_params": [ -0.150, -1.137, 3.000, 0.069, 5.588, 34.982 ], "heli_params": [ -2.601, 0.255, 2.791, 9.222, -0.114, 35.412 ], "bp2_params": [ 0.009, -0.235, 0.099, 5.592, -21.510, 0.062 ], "groove_widths": [ 17.006, null, 13.387, null ], "simple_Rise": 3.000, "simple_Twist": 34.359, "simple_hRise": 2.786, "simple_hTwist": 34.797 }, { "index": 11, "nt1": "///B/34", "nt2": "///B/3", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.009, -0.235, 0.099, 5.592, -21.510, 0.062 ], "step_params": [ 0.462, -1.454, 3.220, 0.174, 7.633, 34.275 ], "heli_params": [ -3.485, -0.741, 2.843, 12.756, -0.291, 35.091 ], "bp2_params": [ 0.113, 0.002, 0.185, 2.183, -15.809, 2.169 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.220, "simple_Twist": 33.498, "simple_hRise": 2.832, "simple_hTwist": 34.333 }, { "index": 12, "nt1": "///B/35", "nt2": "///B/2", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.113, 0.002, 0.185, 2.183, -15.809, 2.169 ], "step_params": [ -0.415, -2.005, 3.211, 1.118, 5.605, 30.020 ], "heli_params": [ -4.833, 0.994, 2.782, 10.700, -2.135, 30.547 ], "bp2_params": [ -0.066, -0.309, -0.011, 2.918, -7.012, -7.576 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.211, "simple_Twist": 30.998, "simple_hRise": 2.798, "simple_hTwist": 31.508 }, { "index": 13, "nt1": "///B/36", "nt2": "///B/101", "bp": "C-g", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] } ], "num_stems": 4, "stems": [ { "index": 1, "helix_index": 1, "strand1": "UGCC", "strand2": "ACGG", "bp_type": "||||", "helix_form": "AAA", "helical_rise": 2.407, "helical_rise_std": 0.225, "helical_radius": 9.502, "helical_radius_std": 0.269, "helical_axis": [ 0.066, 0.663, 0.746 ], "point1": [ -36.745, 5.489, 28.631 ], "point2": [ -36.271, 10.231, 33.967 ], "num_pairs": 4, "pairs": [ { "index": 1, "nt1": "///A/16", "nt2": "///A/27", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.188, -0.032, -0.065, 5.061, -8.297, 1.491 ], "step_params": [ -0.383, -1.759, 3.064, -2.504, 10.464, 27.832 ], "heli_params": [ -5.273, 0.301, 2.292, 20.796, 4.977, 29.801 ], "bp2_params": [ -0.224, -0.124, 0.059, 9.239, -7.593, 1.024 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.064, "simple_Twist": 28.266, "simple_hRise": 2.305, "simple_hTwist": 30.205 }, { "index": 2, "nt1": "///A/17", "nt2": "///A/26", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.224, -0.124, 0.059, 9.239, -7.593, 1.024 ], "step_params": [ 0.305, -2.004, 3.312, 0.258, 5.658, 35.225 ], "heli_params": [ -4.064, -0.462, 2.967, 9.275, -0.423, 35.663 ], "bp2_params": [ 0.336, -0.058, -0.127, 5.264, -12.536, 3.553 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.312, "simple_Twist": 32.167, "simple_hRise": 2.929, "simple_hTwist": 32.649 }, { "index": 3, "nt1": "///A/18", "nt2": "///A/25", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.336, -0.058, -0.127, 5.264, -12.536, 3.553 ], "step_params": [ -0.538, -2.005, 3.438, 0.729, 10.081, 30.402 ], "heli_params": [ -5.374, 1.101, 2.642, 18.588, -1.344, 32.001 ], "bp2_params": [ 0.269, -0.209, -0.229, -1.570, -0.078, -1.722 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.438, "simple_Twist": 31.009, "simple_hRise": 2.660, "simple_hTwist": 32.577 }, { "index": 4, "nt1": "///A/19", "nt2": "///A/24", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 2, "helix_index": 1, "strand1": "CUUCC", "strand2": "GAAGg", "bp_type": "|||||", "helix_form": "AAAA", "helical_rise": 2.236, "helical_rise_std": 0.093, "helical_radius": 8.444, "helical_radius_std": 0.487, "helical_axis": [ 0.328, 0.151, -0.933 ], "point1": [ -39.297, -2.063, 11.387 ], "point2": [ -36.451, -0.753, 3.290 ], "num_pairs": 5, "pairs": [ { "index": 1, "nt1": "///A/32", "nt2": "///A/5", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.149, -0.191, 0.004, 3.969, -17.002, 1.102 ], "step_params": [ -0.659, -1.674, 3.308, -8.815, 9.996, 31.647 ], "heli_params": [ -4.359, -0.220, 2.750, 17.395, 15.341, 34.273 ], "bp2_params": [ -0.032, -0.125, 0.328, 2.295, -15.225, 0.487 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.308, "simple_Twist": 32.471, "simple_hRise": 2.769, "simple_hTwist": 35.031 }, { "index": 2, "nt1": "///A/33", "nt2": "///A/4", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.032, -0.125, 0.328, 2.295, -15.225, 0.487 ], "step_params": [ -0.477, -1.179, 3.080, -0.979, 7.320, 34.798 ], "heli_params": [ -2.901, 0.651, 2.794, 12.072, 1.614, 35.549 ], "bp2_params": [ 0.208, -0.053, 0.114, 3.599, -19.763, 1.116 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.080, "simple_Twist": 33.575, "simple_hRise": 2.781, "simple_hTwist": 34.355 }, { "index": 3, "nt1": "///A/34", "nt2": "///A/3", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.208, -0.053, 0.114, 3.599, -19.763, 1.116 ], "step_params": [ -0.128, -1.231, 3.300, -0.770, 7.772, 37.909 ], "heli_params": [ -2.788, 0.101, 3.001, 11.810, 1.170, 38.676 ], "bp2_params": [ 0.359, -0.174, 0.242, 0.218, -11.531, -0.926 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.300, "simple_Twist": 36.868, "simple_hRise": 2.990, "simple_hTwist": 37.658 }, { "index": 4, "nt1": "///A/35", "nt2": "///A/2", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.359, -0.174, 0.242, 0.218, -11.531, -0.926 ], "step_params": [ 0.524, -1.689, 3.244, 5.661, 2.911, 30.439 ], "heli_params": [ -3.700, 0.088, 3.117, 5.470, -10.635, 31.082 ], "bp2_params": [ 0.234, -0.138, -0.170, 2.390, -0.289, -3.892 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.244, "simple_Twist": 31.710, "simple_hRise": 3.125, "simple_hTwist": 32.327 }, { "index": 5, "nt1": "///A/36", "nt2": "///A/101", "bp": "C-g", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 3, "helix_index": 2, "strand1": "UGCC", "strand2": "ACGG", "bp_type": "||||", "helix_form": "AAA", "helical_rise": 2.588, "helical_rise_std": 0.108, "helical_radius": 9.284, "helical_radius_std": 0.374, "helical_axis": [ -0.263, -0.616, -0.743 ], "point1": [ -12.699, -4.732, -2.566 ], "point2": [ -14.729, -9.482, -8.299 ], "num_pairs": 4, "pairs": [ { "index": 1, "nt1": "///B/16", "nt2": "///B/27", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.148, -0.121, 0.024, 1.962, -4.861, 0.568 ], "step_params": [ -0.470, -1.838, 3.123, -0.192, 8.207, 29.042 ], "heli_params": [ -5.005, 0.870, 2.524, 15.967, 0.374, 30.156 ], "bp2_params": [ -0.198, -0.190, -0.013, 3.180, -9.862, 0.035 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.123, "simple_Twist": 29.480, "simple_hRise": 2.534, "simple_hTwist": 30.577 }, { "index": 2, "nt1": "///B/17", "nt2": "///B/26", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.198, -0.190, -0.013, 3.180, -9.862, 0.035 ], "step_params": [ 0.358, -1.782, 3.180, 0.849, 3.345, 33.723 ], "heli_params": [ -3.567, -0.485, 3.003, 5.747, -1.458, 33.894 ], "bp2_params": [ 0.298, -0.079, -0.071, 5.029, -13.440, 2.868 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.180, "simple_Twist": 31.223, "simple_hRise": 2.986, "simple_hTwist": 31.409 }, { "index": 3, "nt1": "///B/18", "nt2": "///B/25", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.298, -0.079, -0.071, 5.029, -13.440, 2.868 ], "step_params": [ -0.661, -1.851, 3.322, 0.221, 9.539, 33.131 ], "heli_params": [ -4.521, 1.148, 2.697, 16.312, -0.377, 34.441 ], "bp2_params": [ 0.238, -0.199, -0.260, 0.133, 0.777, -3.023 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.322, "simple_Twist": 33.586, "simple_hRise": 2.707, "simple_hTwist": 34.877 }, { "index": 4, "nt1": "///B/19", "nt2": "///B/24", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 4, "helix_index": 2, "strand1": "CUUCC", "strand2": "GAAGg", "bp_type": "|||||", "helix_form": "AAAA", "helical_rise": 2.339, "helical_rise_std": 0.200, "helical_radius": 8.848, "helical_radius_std": 0.621, "helical_axis": [ 0.301, -0.070, 0.951 ], "point1": [ -12.206, 2.381, 14.656 ], "point2": [ -9.439, 1.734, 23.392 ], "num_pairs": 5, "pairs": [ { "index": 1, "nt1": "///B/32", "nt2": "///B/5", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.096, -0.033, 0.143, 5.871, -21.980, 0.139 ], "step_params": [ -0.626, -1.467, 3.353, -8.549, 12.073, 31.040 ], "heli_params": [ -4.331, -0.244, 2.691, 21.122, 14.956, 34.307 ], "bp2_params": [ -0.141, -0.199, 0.466, 2.464, -19.249, -0.211 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.353, "simple_Twist": 32.244, "simple_hRise": 2.724, "simple_hTwist": 35.394 }, { "index": 2, "nt1": "///B/33", "nt2": "///B/4", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.141, -0.199, 0.466, 2.464, -19.249, -0.211 ], "step_params": [ -0.150, -1.137, 3.000, 0.069, 5.588, 34.982 ], "heli_params": [ -2.601, 0.255, 2.791, 9.222, -0.114, 35.412 ], "bp2_params": [ 0.009, -0.235, 0.099, 5.592, -21.510, 0.062 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.000, "simple_Twist": 34.359, "simple_hRise": 2.786, "simple_hTwist": 34.797 }, { "index": 3, "nt1": "///B/34", "nt2": "///B/3", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.009, -0.235, 0.099, 5.592, -21.510, 0.062 ], "step_params": [ 0.462, -1.454, 3.220, 0.174, 7.633, 34.275 ], "heli_params": [ -3.485, -0.741, 2.843, 12.756, -0.291, 35.091 ], "bp2_params": [ 0.113, 0.002, 0.185, 2.183, -15.809, 2.169 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.220, "simple_Twist": 33.498, "simple_hRise": 2.832, "simple_hTwist": 34.333 }, { "index": 4, "nt1": "///B/35", "nt2": "///B/2", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.113, 0.002, 0.185, 2.183, -15.809, 2.169 ], "step_params": [ -0.415, -2.005, 3.211, 1.118, 5.605, 30.020 ], "heli_params": [ -4.833, 0.994, 2.782, 10.700, -2.135, 30.547 ], "bp2_params": [ -0.066, -0.309, -0.011, 2.918, -7.012, -7.576 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.211, "simple_Twist": 30.998, "simple_hRise": 2.798, "simple_hTwist": 31.508 }, { "index": 5, "nt1": "///B/36", "nt2": "///B/101", "bp": "C-g", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] } ], "num_coaxStacks": 2, "coaxStacks": [ { "index": 1, "helix_index": 1, "num_stems": 2, "stem_indices": [ 1, 2 ] }, { "index": 2, "helix_index": 2, "num_stems": 2, "stem_indices": [ 3, 4 ] } ], "num_stacks": 14, "stacks": [ { "index": 1, "num_nts": 2, "nts_short": "AU", "nts_long": "///A/15,///A/16" }, { "index": 2, "num_nts": 2, "nts_short": "GG", "nts_long": "///A/20,///A/24" }, { "index": 3, "num_nts": 2, "nts_short": "AG", "nts_long": "///A/27,///A/28" }, { "index": 4, "num_nts": 2, "nts_short": "AU", "nts_long": "///B/15,///B/16" }, { "index": 5, "num_nts": 2, "nts_short": "CG", "nts_long": "///B/19,///B/20" }, { "index": 6, "num_nts": 2, "nts_short": "AG", "nts_long": "///B/27,///B/28" }, { "index": 7, "num_nts": 3, "nts_short": "GAU", "nts_long": "///A/5,///A/6,///A/8" }, { "index": 8, "num_nts": 3, "nts_short": "AAA", "nts_long": "///A/21,///A/22,///A/23" }, { "index": 9, "num_nts": 3, "nts_short": "CAC", "nts_long": "///A/30,///A/31,///A/32" }, { "index": 10, "num_nts": 3, "nts_short": "GAA", "nts_long": "///B/5,///B/6,///B/29" }, { "index": 11, "num_nts": 3, "nts_short": "CAC", "nts_long": "///B/30,///B/31,///B/32" }, { "index": 12, "num_nts": 4, "nts_short": "AAAG", "nts_long": "///B/21,///B/22,///B/23,///B/24" }, { "index": 13, "num_nts": 5, "nts_short": "GCAAA", "nts_long": "///A/9,///A/14,///A/13,///A/12,///A/11" }, { "index": 14, "num_nts": 5, "nts_short": "GCAAA", "nts_long": "///B/9,///B/14,///B/13,///B/12,///B/11" } ], "nonStack": { "num_nts": 4, "nts_short": "UUUU", "nts_long": "///A/7,///A/10,///B/7,///B/10" }, "num_atom2bases": 7, "atom2bases": [ { "index": 1, "type": "phosphate", "atom": "///A/12/OP2", "nt": "///A/10", "vert_dist": 3.086 }, { "index": 2, "type": "sugar", "atom": "///A/16/O4'", "nt": "///A/15", "vert_dist": 3.428 }, { "index": 3, "type": "phosphate", "atom": "///A/22/OP2", "nt": "///A/20", "vert_dist": 3.016 }, { "index": 4, "type": "sugar", "atom": "///A/31/O4'", "nt": "///A/30", "vert_dist": 3.412 }, { "index": 5, "type": "phosphate", "atom": "///B/12/OP2", "nt": "///B/10", "vert_dist": 2.984 }, { "index": 6, "type": "sugar", "atom": "///B/16/O4'", "nt": "///B/15", "vert_dist": 3.352 }, { "index": 7, "type": "phosphate", "atom": "///B/22/OP2", "nt": "///B/20", "vert_dist": 2.973 } ], "num_hairpins": 2, "hairpins": [ { "index": 1, "type": "hairpin loop", "bridging_nts": [ 4 ], "stem_indices": [ 1 ], "summary": "[1] 4 [A.19 A.24] 4", "num_nts": 6, "nts_short": "CGAAAG", "nts_long": "///A/19,///A/20,///A/21,///A/22,///A/23,///A/24", "num_stems": 1, "bridges": [ { "index": 1, "num_nts": 4, "nts_short": "GAAA", "nts_long": "///A/20,///A/21,///A/22,///A/23" } ] }, { "index": 2, "type": "hairpin loop", "bridging_nts": [ 4 ], "stem_indices": [ 3 ], "summary": "[1] 4 [B.19 B.24] 4", "num_nts": 6, "nts_short": "CGAAAG", "nts_long": "///B/19,///B/20,///B/21,///B/22,///B/23,///B/24", "num_stems": 1, "bridges": [ { "index": 1, "num_nts": 4, "nts_short": "GAAA", "nts_long": "///B/20,///B/21,///B/22,///B/23" } ] } ], "num_iloops": 2, "iloops": [ { "index": 1, "type": "asymmetric internal loop", "bridging_nts": [ 10, 4 ], "stem_indices": [ 2, 1 ], "summary": "[2] 10 4 [A.5 A.32 A.16 A.27] 5 4 k-turn:undecided", "num_nts": 18, "nts_short": "GAUUGUAAACAUAGACAC", "nts_long": "///A/5,///A/6,///A/7,///A/8,///A/9,///A/10,///A/11,///A/12,///A/13,///A/14,///A/15,///A/16,///A/27,///A/28,///A/29,///A/30,///A/31,///A/32", "num_stems": 2, "bridges": [ { "index": 1, "num_nts": 10, "nts_short": "AUUGUAAACA", "nts_long": "///A/6,///A/7,///A/8,///A/9,///A/10,///A/11,///A/12,///A/13,///A/14,///A/15" }, { "index": 2, "num_nts": 4, "nts_short": "GACA", "nts_long": "///A/28,///A/29,///A/30,///A/31" } ] }, { "index": 2, "type": "asymmetric internal loop", "bridging_nts": [ 10, 4 ], "stem_indices": [ 4, 3 ], "summary": "[2] 10 4 [B.5 B.32 B.16 B.27] 5 4 k-turn:undecided", "num_nts": 18, "nts_short": "GAUUGUAAACAUAGACAC", "nts_long": "///B/5,///B/6,///B/7,///B/8,///B/9,///B/10,///B/11,///B/12,///B/13,///B/14,///B/15,///B/16,///B/27,///B/28,///B/29,///B/30,///B/31,///B/32", "num_stems": 2, "bridges": [ { "index": 1, "num_nts": 10, "nts_short": "AUUGUAAACA", "nts_long": "///B/6,///B/7,///B/8,///B/9,///B/10,///B/11,///B/12,///B/13,///B/14,///B/15" }, { "index": 2, "num_nts": 4, "nts_short": "GACA", "nts_long": "///B/28,///B/29,///B/30,///B/31" } ] } ], "num_Aminors": 4, "Aminors": [ { "index": 1, "type": "X", "desc_short": "A vs A-U (WC)", "desc_long": "///A/11 vs ///A/4,///A/33", "A_nt1": { "desc": "///A/11 vs ///A/4", "face_type": "+", "hbonds_num": 0, "hbonds_desc": "" }, "A_nt2": { "desc": "///A/11 vs ///A/33", "face_type": "-", "hbonds_num": 2, "hbonds_desc": "N6(amino)-O2(carbonyl)[2.76],N1-O2'(hydroxyl)[2.45]" } }, { "index": 2, "type": "X", "desc_short": "A vs G-C (WC)", "desc_long": "///A/12 vs ///A/5,///A/32", "A_nt1": { "desc": "///A/12 vs ///A/5", "face_type": "+", "hbonds_num": 3, "hbonds_desc": "N6(amino)-O2'(hydroxyl)[2.92],N6(amino)-N3[3.03],N1-N2(amino)[2.98]" }, "A_nt2": { "desc": "///A/12 vs ///A/32", "face_type": "-", "hbonds_num": 0, "hbonds_desc": "" } }, { "index": 3, "type": "X", "desc_short": "A vs A-U (WC)", "desc_long": "///B/11 vs ///B/4,///B/33", "A_nt1": { "desc": "///B/11 vs ///B/4", "face_type": "+", "hbonds_num": 0, "hbonds_desc": "" }, "A_nt2": { "desc": "///B/11 vs ///B/33", "face_type": "-", "hbonds_num": 2, "hbonds_desc": "N6(amino)-O2(carbonyl)[2.88],N1-O2'(hydroxyl)[2.59]" } }, { "index": 4, "type": "X", "desc_short": "A vs G-C (WC)", "desc_long": "///B/12 vs ///B/5,///B/32", "A_nt1": { "desc": "///B/12 vs ///B/5", "face_type": "+", "hbonds_num": 3, "hbonds_desc": "N6(amino)-O2'(hydroxyl)[3.06],N6(amino)-N3[3.11],N1-N2(amino)[2.93]" }, "A_nt2": { "desc": "///B/12 vs ///B/32", "face_type": "-", "hbonds_num": 0, "hbonds_desc": "" } } ], "num_Kturns": 2, "Kturns": [ { "index": 1, "type": "Undecided case [A-G]", "iloop_index": 1, "bounding_stems": [ 2, 1 ], "Cstem_index": 2, "NCstem_index": 1, "Cstem_pair": "G-C (///A/5,///A/32) WC", "NCstem_pair": "U-A (///A/16,///A/27) WC", "GA_pair": "A-G (///A/15,///A/28) Sheared", "bending_angle": 54.980, "strand1": { "num_nts": 19, "nts_short": "gGAAGAUUGUAAACAUGCC", "nts_long": "///A/101,///A/2,///A/3,///A/4,///A/5,///A/6,///A/7,///A/8,///A/9,///A/10,///A/11,///A/12,///A/13,///A/14,///A/15,///A/16,///A/17,///A/18,///A/19" }, "strand2": { "num_nts": 13, "nts_short": "GGCAGACACUUCC", "nts_long": "///A/24,///A/25,///A/26,///A/27,///A/28,///A/29,///A/30,///A/31,///A/32,///A/33,///A/34,///A/35,///A/36" } }, { "index": 2, "type": "Undecided case [A-G]", "iloop_index": 2, "bounding_stems": [ 4, 3 ], "Cstem_index": 4, "NCstem_index": 3, "Cstem_pair": "G-C (///B/5,///B/32) WC", "NCstem_pair": "U-A (///B/16,///B/27) WC", "GA_pair": "A-G (///B/15,///B/28) Sheared", "bending_angle": 42.072, "strand1": { "num_nts": 19, "nts_short": "gGAAGAUUGUAAACAUGCC", "nts_long": "///B/101,///B/2,///B/3,///B/4,///B/5,///B/6,///B/7,///B/8,///B/9,///B/10,///B/11,///B/12,///B/13,///B/14,///B/15,///B/16,///B/17,///B/18,///B/19" }, "strand2": { "num_nts": 13, "nts_short": "GGCAGACACUUCC", "nts_long": "///B/24,///B/25,///B/26,///B/27,///B/28,///B/29,///B/30,///B/31,///B/32,///B/33,///B/34,///B/35,///B/36" } } ], "num_splayUnits": 4, "splayUnits": [ { "index": 1, "num_nts": 2, "nts_short": "AU", "nts_long": "///A/6,///A/7" }, { "index": 2, "num_nts": 2, "nts_short": "CA", "nts_long": "///A/14,///A/15" }, { "index": 3, "num_nts": 3, "nts_short": "AUU", "nts_long": "///B/6,///B/7,///B/8" }, { "index": 4, "num_nts": 2, "nts_short": "CA", "nts_long": "///B/14,///B/15" } ], "dbn": { "all_chains": { "num_nts": 72, "num_chars": 75, "bseq": "GAAGAUUGUAAACAUGCCGAAAGGCAGACACUUCC&GAAGAUUGUAAACAUGCCGAAAGGCAGACACUUCC&g&g", "bseqUP": "GAAGAUUGUAAACAUGCCGAAAGGCAGACACUUCC&GAAGAUUGUAAACAUGCCGAAAGGCAGACACUUCC&G&G", "sstr": "((((..........((((....))))....))))(&((((..........((((....))))....))))(&)&)", "form": "AAA.......A...AAAA....AAA....AAAAA-&AAA.......A...AAA.....AAAA...AAAAA-&-&-" }, "chain_A": { "num_nts": 36, "num_chars": 37, "bseq": "GAAGAUUGUAAACAUGCCGAAAGGCAGACACUUCC&g", "bseqUP": "GAAGAUUGUAAACAUGCCGAAAGGCAGACACUUCC&G", "sstr": "((((..........((((....))))....))))(&)", "form": "AAA.......A...AAAA....AAA....AAAAA-&-" }, "chain_B": { "num_nts": 36, "num_chars": 37, "bseq": "GAAGAUUGUAAACAUGCCGAAAGGCAGACACUUCC&g", "bseqUP": "GAAGAUUGUAAACAUGCCGAAAGGCAGACACUUCC&G", "sstr": "((((..........((((....))))....))))(&)", "form": "AAA.......A...AAA.....AAAA...AAAAA-&-" } }, "chains": { "chain_A": { "num_nts": 36, "bseq": "GAAGAUUGUAAACAUGCCGAAAGGCAGACACUUCC&g", "sstr": "((((..........((((....))))....))))(&)", "form": "AAA.......A...AAAA....AAA....AAAAA-&-", "helical_rise": 0.128, "helical_rise_std": 2.871, "helical_axis": [ 0.016, 0.932, -0.361 ], "point1": [ -34.156, -0.887, 23.875 ], "point2": [ -34.081, 3.517, 22.168 ], "num_chars": 106, "suite": "G1aA1aA1aG5zA!!U!!U4bG0aU1gA1aA1aA1bC#aA1aU1aG1aC1aC1aG1gA1aA1aA1cG1aG1aC1aA1aG1[A6gC1aA1aC1aU1aU1aC1aC__g" }, "chain_B": { "num_nts": 36, "bseq": "GAAGAUUGUAAACAUGCCGAAAGGCAGACACUUCC&g", "sstr": "((((..........((((....))))....))))(&)", "form": "AAA.......A...AAA.....AAAA...AAAAA-&-", "helical_rise": 0.026, "helical_rise_std": 3.092, "helical_axis": [ 0.184, -0.981, -0.057 ], "point1": [ -11.579, 10.858, 3.190 ], "point2": [ -11.388, 9.839, 3.131 ], "num_chars": 106, "suite": "G1aA1aA1aG5zA6jU!!U4bG0aU1gA1aA1aA1bC#aA1aU1aG1aC1aC1aG1gA1aA1aA1cG1aG1aC1aA1aG1[A6gC1aA1aC1aU1aU1aC1cC__g" } }, "num_nts": 72, "nts": [ { "index": 1, "index_chain": 1, "chain_name": "A", "nt_resnum": 2, "nt_name": "G", "nt_code": "G", "nt_id": "///A/2", "linked_nts": [ "///A/101", "///A/3" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": null, "beta": 179.600, "gamma": 62.841, "delta": 82.494, "epsilon": -145.019, "zeta": -73.650, "epsilon_zeta": -71.369, "bb_type": "BI", "chi": -171.356, "glyco_bond": "anti", "C5prime_xyz": [ -1.404, 8.547, 1.209 ], "P_xyz": [ 1.174, 8.747, 1.620 ], "form": "A", "ssZp": 4.588, "Dp": 4.645, "splay_angle": 22.884, "splay_distance": 3.501, "splay_ratio": 0.199, "d22": null, "d64": null, "eta": null, "theta": -140.727, "eta_prime": null, "theta_prime": -139.178, "eta_base": null, "theta_base": -107.169, "v0": 4.203, "v1": -25.597, "v2": 36.193, "v3": -34.795, "v4": 19.274, "amplitude": 37.042, "phase_angle": 12.291, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.007, "frame": { "rmsd": 0.007, "origin": [ -35.915, -4.958, 4.998 ], "x_axis": [ -0.130, 0.987, 0.089 ], "y_axis": [ -0.991, -0.132, 0.017 ], "z_axis": [ 0.029, -0.086, 0.996 ], "quaternion": [ 0.658, 0.039, -0.023, 0.751 ] } }, { "index": 2, "index_chain": 2, "chain_name": "A", "nt_resnum": 3, "nt_name": "A", "nt_code": "A", "nt_id": "///A/3", "linked_nts": [ "///A/2", "///A/4" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -66.884, "beta": 175.881, "gamma": 53.498, "delta": 82.287, "epsilon": -138.831, "zeta": -71.275, "epsilon_zeta": -67.556, "bb_type": "BI", "chi": -160.780, "glyco_bond": "anti", "C5prime_xyz": [ -1.333, 8.571, 0.581 ], "P_xyz": [ 1.261, 8.826, 0.730 ], "form": "A", "ssZp": 4.448, "Dp": 4.739, "splay_angle": 21.771, "splay_distance": 3.482, "splay_ratio": 0.191, "d22": null, "d64": null, "eta": 167.881, "theta": -135.854, "eta_prime": -179.051, "theta_prime": -136.930, "eta_base": -131.742, "theta_base": -108.432, "v0": 7.412, "v1": -29.153, "v2": 38.554, "v3": -35.418, "v4": 17.595, "amplitude": 38.922, "phase_angle": 7.892, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.987, "filter_rmsd": 0.038, "frame": { "rmsd": 0.013, "origin": [ -34.925, -3.913, 8.190 ], "x_axis": [ -0.722, 0.690, 0.052 ], "y_axis": [ -0.689, -0.723, 0.046 ], "z_axis": [ 0.069, -0.002, 0.998 ], "quaternion": [ 0.372, 0.033, 0.012, 0.928 ] } }, { "index": 3, "index_chain": 3, "chain_name": "A", "nt_resnum": 4, "nt_name": "A", "nt_code": "A", "nt_id": "///A/4", "linked_nts": [ "///A/3", "///A/5" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,A-minor", "alpha": -71.747, "beta": 163.640, "gamma": 62.240, "delta": 74.813, "epsilon": -144.925, "zeta": -72.349, "epsilon_zeta": -72.576, "bb_type": "BI", "chi": -165.210, "glyco_bond": "anti", "C5prime_xyz": [ -1.447, 8.690, 0.748 ], "P_xyz": [ 1.028, 9.325, 0.240 ], "form": "A", "ssZp": 4.596, "Dp": 4.769, "splay_angle": 22.246, "splay_distance": 3.640, "splay_ratio": 0.202, "d22": null, "d64": null, "eta": 158.611, "theta": -147.244, "eta_prime": 174.845, "theta_prime": -145.686, "eta_base": -136.309, "theta_base": -120.893, "v0": 2.558, "v1": -27.342, "v2": 40.465, "v3": -40.082, "v4": 23.673, "amplitude": 41.934, "phase_angle": 15.208, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.757, "filter_rmsd": 0.035, "frame": { "rmsd": 0.010, "origin": [ -35.203, -1.982, 11.074 ], "x_axis": [ -0.987, 0.156, -0.038 ], "y_axis": [ -0.160, -0.973, 0.167 ], "z_axis": [ -0.011, 0.171, 0.985 ], "quaternion": [ 0.080, -0.013, 0.085, 0.993 ] } }, { "index": 4, "index_chain": 4, "chain_name": "A", "nt_resnum": 5, "nt_name": "G", "nt_code": "G", "nt_id": "///A/5", "linked_nts": [ "///A/4", "///A/6" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,internal-loop,A-minor,phosphate", "alpha": -56.137, "beta": 174.956, "gamma": 54.018, "delta": 79.688, "epsilon": -144.002, "zeta": 44.776, "epsilon_zeta": 171.222, "bb_type": "--", "chi": -149.748, "glyco_bond": "anti", "C5prime_xyz": [ -1.568, 8.844, -0.141 ], "P_xyz": [ 0.940, 9.513, -0.340 ], "form": ".", "ssZp": 4.028, "Dp": 4.647, "splay_angle": 22.354, "splay_distance": 3.572, "splay_ratio": 0.195, "d22": null, "d64": null, "eta": 178.497, "theta": -26.958, "eta_prime": -169.492, "theta_prime": -65.485, "eta_base": -134.033, "theta_base": -104.131, "v0": -0.714, "v1": -22.864, "v2": 36.367, "v3": -37.916, "v4": 24.375, "amplitude": 38.635, "phase_angle": 19.730, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.832, "filter_rmsd": 0.009, "frame": { "rmsd": 0.009, "origin": [ -36.700, 0.418, 13.365 ], "x_axis": [ -0.923, -0.385, -0.026 ], "y_axis": [ 0.343, -0.850, 0.399 ], "z_axis": [ -0.175, 0.359, 0.917 ], "quaternion": [ -0.189, -0.052, 0.197, 0.960 ] } }, { "index": 5, "index_chain": 5, "chain_name": "A", "nt_resnum": 6, "nt_name": "A", "nt_code": "A", "nt_id": "///A/6", "linked_nts": [ "///A/5", "///A/7" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C2'-endo,BII,non-canonical,non-pair-contact,helix,multiplet,internal-loop,splayed-apart", "alpha": 170.826, "beta": 146.677, "gamma": 50.008, "delta": 149.786, "epsilon": -93.989, "zeta": 126.873, "epsilon_zeta": 139.138, "bb_type": "BII", "chi": -131.488, "glyco_bond": "anti", "C5prime_xyz": [ -1.772, 8.679, -0.577 ], "P_xyz": [ 0.705, 8.910, 0.266 ], "form": ".", "ssZp": 0.480, "Dp": 0.603, "splay_angle": 113.402, "splay_distance": 14.467, "splay_ratio": 0.841, "d22": null, "d64": null, "eta": 54.558, "theta": 160.640, "eta_prime": 122.127, "theta_prime": 129.241, "eta_base": 120.590, "theta_base": -176.629, "v0": -21.182, "v1": 36.857, "v2": -37.529, "v3": 26.225, "v4": -3.362, "amplitude": 38.651, "phase_angle": 166.162, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "5z", "suiteness": 0.880, "filter_rmsd": 0.037, "frame": { "rmsd": 0.006, "origin": [ -38.899, 0.446, 16.178 ], "x_axis": [ 0.702, 0.697, -0.147 ], "y_axis": [ 0.659, -0.557, 0.506 ], "z_axis": [ 0.271, -0.452, -0.850 ], "quaternion": [ 0.272, 0.882, 0.385, 0.035 ] } }, { "index": 6, "index_chain": 6, "chain_name": "A", "nt_resnum": 7, "nt_name": "U", "nt_code": "U", "nt_id": "///A/7", "linked_nts": [ "///A/6", "///A/8" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,syn,~C2'-endo,non-stack,internal-loop,splayed-apart", "alpha": 6.925, "beta": -174.614, "gamma": 33.931, "delta": 142.536, "epsilon": -126.534, "zeta": 71.393, "epsilon_zeta": 162.072, "bb_type": "--", "chi": 64.712, "glyco_bond": "syn", "C5prime_xyz": [ -5.416, 4.594, 1.580 ], "P_xyz": [ -6.704, 2.415, 0.985 ], "form": ".", "ssZp": -1.391, "Dp": 1.450, "splay_angle": 81.606, "splay_distance": 12.849, "splay_ratio": 0.654, "d22": 7.879, "d64": 8.934, "eta": -68.081, "theta": 55.883, "eta_prime": -73.185, "theta_prime": 52.169, "eta_base": -97.746, "theta_base": 57.185, "v0": -26.180, "v1": 38.149, "v2": -34.857, "v3": 20.841, "v4": 3.145, "amplitude": 38.008, "phase_angle": 156.506, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.110, "frame": { "rmsd": 0.008, "origin": [ -43.702, -12.560, 20.311 ], "x_axis": [ -0.960, -0.265, 0.094 ], "y_axis": [ -0.125, 0.701, 0.702 ], "z_axis": [ -0.252, 0.662, -0.706 ], "quaternion": [ -0.095, -0.106, 0.917, 0.372 ] } }, { "index": 7, "index_chain": 7, "chain_name": "A", "nt_resnum": 8, "nt_name": "U", "nt_code": "U", "nt_id": "///A/8", "linked_nts": [ "///A/7", "///A/9" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C2'-endo,BII,non-canonical,non-pair-contact,helix,multiplet,internal-loop", "alpha": -133.272, "beta": -178.034, "gamma": 73.152, "delta": 147.635, "epsilon": -91.992, "zeta": 162.694, "epsilon_zeta": 105.314, "bb_type": "BII", "chi": -131.108, "glyco_bond": "anti", "C5prime_xyz": [ -2.140, 8.715, -0.678 ], "P_xyz": [ 0.252, 9.557, -0.005 ], "form": ".", "ssZp": 0.665, "Dp": 0.763, "splay_angle": 77.511, "splay_distance": 12.147, "splay_ratio": 0.626, "d22": null, "d64": null, "eta": 168.450, "theta": 166.873, "eta_prime": -163.238, "theta_prime": 167.828, "eta_base": -143.975, "theta_base": -162.548, "v0": -26.600, "v1": 40.114, "v2": -37.545, "v3": 23.166, "v4": 1.936, "amplitude": 40.349, "phase_angle": 158.514, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.098, "frame": { "rmsd": 0.008, "origin": [ -39.999, -0.317, 19.089 ], "x_axis": [ -0.928, -0.355, -0.117 ], "y_axis": [ 0.132, -0.606, 0.785 ], "z_axis": [ -0.350, 0.712, 0.609 ], "quaternion": [ -0.137, -0.132, 0.422, 0.886 ] } }, { "index": 8, "index_chain": 8, "chain_name": "A", "nt_resnum": 9, "nt_name": "G", "nt_code": "G", "nt_id": "///A/9", "linked_nts": [ "///A/8", "///A/10" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C2'-endo,BII,non-pair-contact,internal-loop", "alpha": -55.270, "beta": -174.287, "gamma": 51.455, "delta": 148.291, "epsilon": -108.048, "zeta": 139.955, "epsilon_zeta": 111.997, "bb_type": "BII", "chi": -113.564, "glyco_bond": "anti", "C5prime_xyz": [ -2.025, 8.489, -1.505 ], "P_xyz": [ 0.329, 9.479, -0.906 ], "form": ".", "ssZp": 1.134, "Dp": 1.109, "splay_angle": 34.531, "splay_distance": 5.794, "splay_ratio": 0.304, "d22": null, "d64": null, "eta": -108.797, "theta": 154.895, "eta_prime": -111.259, "theta_prime": 137.751, "eta_base": -113.137, "theta_base": 176.190, "v0": -22.696, "v1": 36.889, "v2": -36.184, "v3": 23.955, "v4": -0.980, "amplitude": 37.895, "phase_angle": 162.717, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "4b", "suiteness": 0.602, "filter_rmsd": 0.008, "frame": { "rmsd": 0.008, "origin": [ -30.711, 6.361, 23.178 ], "x_axis": [ -0.683, 0.395, 0.615 ], "y_axis": [ -0.197, -0.910, 0.365 ], "z_axis": [ 0.704, 0.128, 0.699 ], "quaternion": [ 0.163, 0.363, 0.136, 0.907 ] } }, { "index": 9, "index_chain": 9, "chain_name": "A", "nt_resnum": 10, "nt_name": "U", "nt_code": "U", "nt_id": "///A/10", "linked_nts": [ "///A/9", "///A/11" ], "nt_type": "RNA", "dbn": ".", "summary": "u-turn,anti,~C3'-endo,BI,non-stack,non-pair-contact,internal-loop,cap-acceptor,phosphate", "alpha": -69.428, "beta": 125.991, "gamma": 52.534, "delta": 77.811, "epsilon": -151.950, "zeta": -67.244, "epsilon_zeta": -84.706, "bb_type": "BI", "chi": -149.145, "glyco_bond": "anti", "C5prime_xyz": [ -1.532, 8.866, -0.183 ], "P_xyz": [ 0.950, 8.755, -1.010 ], "form": ".", "ssZp": 4.046, "Dp": 4.566, "splay_angle": 69.416, "splay_distance": 10.494, "splay_ratio": 0.569, "d22": null, "d64": null, "eta": 177.455, "theta": -116.281, "eta_prime": 178.963, "theta_prime": -164.741, "eta_base": -143.273, "theta_base": 127.566, "v0": -2.507, "v1": -21.004, "v2": 35.086, "v3": -37.559, "v4": 25.286, "amplitude": 37.930, "phase_angle": 22.328, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "0a", "suiteness": 0.334, "filter_rmsd": 0.105, "frame": { "rmsd": 0.003, "origin": [ -25.763, 4.846, 20.571 ], "x_axis": [ 0.518, 0.068, 0.853 ], "y_axis": [ -0.169, -0.969, 0.179 ], "z_axis": [ 0.839, -0.237, -0.490 ], "quaternion": [ 0.121, 0.863, -0.029, 0.490 ] } }, { "index": 10, "index_chain": 10, "chain_name": "A", "nt_resnum": 11, "nt_name": "A", "nt_code": "A", "nt_id": "///A/11", "linked_nts": [ "///A/10", "///A/12" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,u-turn,anti,~C3'-endo,BI,non-canonical,non-pair-contact,multiplet,internal-loop,A-minor", "alpha": 169.701, "beta": 169.719, "gamma": 54.006, "delta": 82.220, "epsilon": -136.201, "zeta": -68.594, "epsilon_zeta": -67.607, "bb_type": "BI", "chi": -167.429, "glyco_bond": "anti", "C5prime_xyz": [ -1.524, 8.630, 1.012 ], "P_xyz": [ 0.984, 8.886, 1.686 ], "form": ".", "ssZp": 4.374, "Dp": 4.581, "splay_angle": 23.561, "splay_distance": 3.758, "splay_ratio": 0.204, "d22": null, "d64": null, "eta": 38.569, "theta": -129.303, "eta_prime": 54.757, "theta_prime": -128.649, "eta_base": 26.613, "theta_base": -86.002, "v0": 1.722, "v1": -23.337, "v2": 34.791, "v3": -34.905, "v4": 20.972, "amplitude": 36.203, "phase_angle": 16.057, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1g", "suiteness": 0.878, "filter_rmsd": 0.037, "frame": { "rmsd": 0.006, "origin": [ -29.210, 0.893, 11.482 ], "x_axis": [ -0.758, -0.632, 0.160 ], "y_axis": [ 0.602, -0.583, 0.545 ], "z_axis": [ -0.251, 0.510, 0.823 ], "quaternion": [ -0.347, -0.026, 0.297, 0.889 ] } }, { "index": 11, "index_chain": 11, "chain_name": "A", "nt_resnum": 12, "nt_name": "A", "nt_code": "A", "nt_id": "///A/12", "linked_nts": [ "///A/11", "///A/13" ], "nt_type": "RNA", "dbn": ".", "summary": "u-turn,anti,~C3'-endo,BI,non-canonical,non-pair-contact,multiplet,internal-loop,A-minor,cap-donor,phosphate", "alpha": -63.900, "beta": 167.879, "gamma": 49.626, "delta": 79.323, "epsilon": -149.888, "zeta": -63.807, "epsilon_zeta": -86.081, "bb_type": "BI", "chi": -160.197, "glyco_bond": "anti", "C5prime_xyz": [ -1.469, 8.705, 0.519 ], "P_xyz": [ 1.087, 9.196, 0.630 ], "form": "A", "ssZp": 4.447, "Dp": 4.663, "splay_angle": 23.780, "splay_distance": 4.013, "splay_ratio": 0.214, "d22": null, "d64": null, "eta": 157.068, "theta": -139.380, "eta_prime": 177.365, "theta_prime": -140.225, "eta_base": -119.244, "theta_base": -122.010, "v0": 1.621, "v1": -24.488, "v2": 36.686, "v3": -36.798, "v4": 22.193, "amplitude": 38.210, "phase_angle": 16.237, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.893, "filter_rmsd": 0.037, "frame": { "rmsd": 0.006, "origin": [ -31.629, 1.349, 14.321 ], "x_axis": [ -0.092, -0.896, 0.434 ], "y_axis": [ 0.941, 0.065, 0.333 ], "z_axis": [ -0.327, 0.439, 0.837 ], "quaternion": [ 0.673, -0.039, -0.283, -0.683 ] } }, { "index": 12, "index_chain": 12, "chain_name": "A", "nt_resnum": 13, "nt_name": "A", "nt_code": "A", "nt_id": "///A/13", "linked_nts": [ "///A/12", "///A/14" ], "nt_type": "RNA", "dbn": ".", "summary": "u-turn,anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,internal-loop,phosphate", "alpha": -64.613, "beta": 171.395, "gamma": 58.692, "delta": 74.557, "epsilon": -133.741, "zeta": -78.208, "epsilon_zeta": -55.533, "bb_type": "BI", "chi": -162.919, "glyco_bond": "anti", "C5prime_xyz": [ -2.052, 8.784, 0.628 ], "P_xyz": [ 0.285, 9.914, 0.498 ], "form": ".", "ssZp": 4.488, "Dp": 4.726, "splay_angle": 33.060, "splay_distance": 5.300, "splay_ratio": 0.286, "d22": null, "d64": null, "eta": 172.513, "theta": -147.873, "eta_prime": -174.039, "theta_prime": -134.075, "eta_base": -141.054, "theta_base": -107.684, "v0": -4.516, "v1": -20.787, "v2": 36.703, "v3": -40.469, "v4": 28.411, "amplitude": 40.488, "phase_angle": 24.973, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.837, "filter_rmsd": 0.038, "frame": { "rmsd": 0.013, "origin": [ -34.599, 1.503, 17.016 ], "x_axis": [ 0.341, -0.792, 0.506 ], "y_axis": [ 0.863, 0.478, 0.167 ], "z_axis": [ -0.374, 0.379, 0.846 ], "quaternion": [ 0.816, -0.065, -0.269, -0.507 ] } }, { "index": 13, "index_chain": 13, "chain_name": "A", "nt_resnum": 14, "nt_name": "C", "nt_code": "C", "nt_id": "///A/14", "linked_nts": [ "///A/13", "///A/15" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C2'-endo,non-canonical,non-pair-contact,multiplet,internal-loop,phosphate,splayed-apart", "alpha": -59.752, "beta": -168.939, "gamma": 57.540, "delta": 152.616, "epsilon": -164.061, "zeta": 126.828, "epsilon_zeta": 69.110, "bb_type": "--", "chi": -127.587, "glyco_bond": "anti", "C5prime_xyz": [ -1.820, 8.665, -0.736 ], "P_xyz": [ 0.340, 9.513, 0.456 ], "form": ".", "ssZp": 1.551, "Dp": 1.829, "splay_angle": 97.114, "splay_distance": 13.733, "splay_ratio": 0.750, "d22": null, "d64": null, "eta": 175.335, "theta": 114.430, "eta_prime": -150.525, "theta_prime": 103.071, "eta_base": -122.067, "theta_base": 140.922, "v0": -20.955, "v1": 37.807, "v2": -39.362, "v3": 28.259, "v4": -4.878, "amplitude": 40.233, "phase_angle": 168.056, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1b", "suiteness": 0.612, "filter_rmsd": 0.063, "frame": { "rmsd": 0.006, "origin": [ -35.465, 0.608, 22.168 ], "x_axis": [ 0.823, -0.481, -0.301 ], "y_axis": [ 0.445, 0.876, -0.185 ], "z_axis": [ 0.353, 0.019, 0.936 ], "quaternion": [ 0.953, -0.053, 0.171, -0.243 ] } }, { "index": 14, "index_chain": 14, "chain_name": "A", "nt_resnum": 15, "nt_name": "A", "nt_code": "A", "nt_id": "///A/15", "linked_nts": [ "///A/14", "///A/16" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop,cap-acceptor,phosphate,splayed-apart", "alpha": -50.453, "beta": 159.905, "gamma": 54.807, "delta": 80.351, "epsilon": -131.648, "zeta": -42.833, "epsilon_zeta": -88.815, "bb_type": "BI", "chi": -166.618, "glyco_bond": "anti", "C5prime_xyz": [ -1.478, 8.614, 0.915 ], "P_xyz": [ 1.116, 8.952, 0.862 ], "form": ".", "ssZp": 4.575, "Dp": 4.760, "splay_angle": 48.310, "splay_distance": 7.346, "splay_ratio": 0.410, "d22": null, "d64": null, "eta": -152.487, "theta": -101.314, "eta_prime": -162.100, "theta_prime": -95.647, "eta_base": 177.268, "theta_base": -50.450, "v0": 3.554, "v1": -26.062, "v2": 37.490, "v3": -36.454, "v4": 20.749, "amplitude": 38.547, "phase_angle": 13.447, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "#a", "suiteness": 0.422, "filter_rmsd": 0.037, "frame": { "rmsd": 0.006, "origin": [ -45.719, 9.734, 22.576 ], "x_axis": [ 0.017, -0.857, 0.515 ], "y_axis": [ 0.999, 0.037, 0.029 ], "z_axis": [ -0.044, 0.514, 0.857 ], "quaternion": [ 0.691, -0.176, -0.202, -0.671 ] } }, { "index": 15, "index_chain": 15, "chain_name": "A", "nt_resnum": 16, "nt_name": "U", "nt_code": "U", "nt_id": "///A/16", "linked_nts": [ "///A/15", "///A/17" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop,cap-donor", "alpha": -70.379, "beta": 170.439, "gamma": 59.761, "delta": 77.970, "epsilon": -146.305, "zeta": -80.352, "epsilon_zeta": -65.953, "bb_type": "BI", "chi": -160.596, "glyco_bond": "anti", "C5prime_xyz": [ -1.392, 8.680, 0.553 ], "P_xyz": [ 1.191, 9.042, 0.332 ], "form": "A", "ssZp": 4.462, "Dp": 4.708, "splay_angle": 23.370, "splay_distance": 3.670, "splay_ratio": 0.205, "d22": null, "d64": null, "eta": 157.918, "theta": -151.572, "eta_prime": -164.150, "theta_prime": -151.787, "eta_base": -85.822, "theta_base": -134.404, "v0": 4.038, "v1": -27.897, "v2": 39.977, "v3": -38.712, "v4": 21.771, "amplitude": 41.039, "phase_angle": 13.063, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.425, "filter_rmsd": 0.102, "frame": { "rmsd": 0.004, "origin": [ -41.842, 6.406, 27.854 ], "x_axis": [ 0.979, -0.159, 0.128 ], "y_axis": [ 0.193, 0.923, -0.334 ], "z_axis": [ -0.065, 0.352, 0.934 ], "quaternion": [ 0.979, -0.175, -0.049, -0.090 ] } }, { "index": 16, "index_chain": 16, "chain_name": "A", "nt_resnum": 17, "nt_name": "G", "nt_code": "G", "nt_id": "///A/17", "linked_nts": [ "///A/16", "///A/18" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -66.056, "beta": 165.654, "gamma": 62.455, "delta": 79.212, "epsilon": -151.552, "zeta": -66.061, "epsilon_zeta": -85.492, "bb_type": "BI", "chi": -166.865, "glyco_bond": "anti", "C5prime_xyz": [ -1.436, 8.693, 0.899 ], "P_xyz": [ 1.142, 9.134, 0.769 ], "form": "A", "ssZp": 4.583, "Dp": 4.664, "splay_angle": 24.075, "splay_distance": 3.812, "splay_ratio": 0.212, "d22": null, "d64": null, "eta": 167.522, "theta": -141.178, "eta_prime": 178.765, "theta_prime": -142.581, "eta_base": -149.296, "theta_base": -114.417, "v0": 2.703, "v1": -25.762, "v2": 37.760, "v3": -37.225, "v4": 21.770, "amplitude": 39.042, "phase_angle": 14.719, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.803, "filter_rmsd": 0.004, "frame": { "rmsd": 0.004, "origin": [ -41.823, 5.967, 31.497 ], "x_axis": [ 0.951, 0.206, -0.230 ], "y_axis": [ -0.268, 0.921, -0.283 ], "z_axis": [ 0.154, 0.331, 0.931 ], "quaternion": [ 0.975, -0.158, 0.098, 0.122 ] } }, { "index": 17, "index_chain": 17, "chain_name": "A", "nt_resnum": 18, "nt_name": "C", "nt_code": "C", "nt_id": "///A/18", "linked_nts": [ "///A/17", "///A/19" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -69.396, "beta": 179.970, "gamma": 52.097, "delta": 75.874, "epsilon": -144.229, "zeta": -83.820, "epsilon_zeta": -60.408, "bb_type": "BI", "chi": -163.564, "glyco_bond": "anti", "C5prime_xyz": [ -1.485, 8.703, 0.734 ], "P_xyz": [ 1.058, 9.229, 0.968 ], "form": "A", "ssZp": 4.547, "Dp": 4.728, "splay_angle": 25.158, "splay_distance": 3.946, "splay_ratio": 0.221, "d22": 4.452, "d64": 4.607, "eta": 164.518, "theta": -156.358, "eta_prime": 177.629, "theta_prime": -152.874, "eta_base": -135.966, "theta_base": -133.406, "v0": 3.967, "v1": -28.359, "v2": 40.787, "v3": -39.664, "v4": 22.401, "amplitude": 41.916, "phase_angle": 13.328, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.895, "filter_rmsd": 0.061, "frame": { "rmsd": 0.007, "origin": [ -39.517, 6.055, 34.531 ], "x_axis": [ 0.595, 0.680, -0.429 ], "y_axis": [ -0.766, 0.642, -0.044 ], "z_axis": [ 0.245, 0.354, 0.902 ], "quaternion": [ 0.886, -0.112, 0.190, 0.408 ] } }, { "index": 18, "index_chain": 18, "chain_name": "A", "nt_resnum": 19, "nt_name": "C", "nt_code": "C", "nt_id": "///A/19", "linked_nts": [ "///A/18", "///A/20" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop,phosphate", "alpha": -55.738, "beta": 173.269, "gamma": 47.486, "delta": 78.537, "epsilon": -141.065, "zeta": -67.111, "epsilon_zeta": -73.954, "bb_type": "BI", "chi": -163.840, "glyco_bond": "anti", "C5prime_xyz": [ -1.359, 8.701, 0.770 ], "P_xyz": [ 1.211, 9.142, 1.002 ], "form": "A", "ssZp": 4.566, "Dp": 4.741, "splay_angle": 26.430, "splay_distance": 4.071, "splay_ratio": 0.230, "d22": null, "d64": null, "eta": 170.540, "theta": -135.627, "eta_prime": 176.218, "theta_prime": -132.385, "eta_base": -156.447, "theta_base": -90.077, "v0": 5.965, "v1": -29.270, "v2": 40.260, "v3": -37.908, "v4": 20.102, "amplitude": 40.935, "phase_angle": 10.415, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.768, "filter_rmsd": 0.067, "frame": { "rmsd": 0.009, "origin": [ -36.885, 6.467, 37.442 ], "x_axis": [ 0.087, 0.767, -0.635 ], "y_axis": [ -0.938, 0.278, 0.207 ], "z_axis": [ 0.336, 0.578, 0.744 ], "quaternion": [ 0.726, -0.128, 0.334, 0.587 ] } }, { "index": 19, "index_chain": 19, "chain_name": "A", "nt_resnum": 20, "nt_name": "G", "nt_code": "G", "nt_id": "///A/20", "linked_nts": [ "///A/19", "///A/21" ], "nt_type": "RNA", "dbn": ".", "summary": "u-turn,anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,hairpin-loop,cap-acceptor", "alpha": -68.475, "beta": -178.639, "gamma": 45.743, "delta": 81.735, "epsilon": -140.154, "zeta": -62.792, "epsilon_zeta": -77.362, "bb_type": "BI", "chi": -165.641, "glyco_bond": "anti", "C5prime_xyz": [ -1.323, 8.582, 0.708 ], "P_xyz": [ 1.287, 8.945, 0.767 ], "form": ".", "ssZp": 4.671, "Dp": 4.855, "splay_angle": 84.929, "splay_distance": 11.499, "splay_ratio": 0.675, "d22": null, "d64": null, "eta": 161.209, "theta": -117.899, "eta_prime": 176.343, "theta_prime": -162.111, "eta_base": -124.756, "theta_base": 138.304, "v0": 5.528, "v1": -27.255, "v2": 37.263, "v3": -35.222, "v4": 18.759, "amplitude": 37.894, "phase_angle": 10.472, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.854, "filter_rmsd": 0.017, "frame": { "rmsd": 0.017, "origin": [ -35.421, 10.255, 37.726 ], "x_axis": [ -0.677, 0.601, -0.426 ], "y_axis": [ -0.673, -0.269, 0.690 ], "z_axis": [ 0.300, 0.753, 0.586 ], "quaternion": [ 0.400, -0.040, 0.453, 0.795 ] } }, { "index": 20, "index_chain": 20, "chain_name": "A", "nt_resnum": 21, "nt_name": "A", "nt_code": "A", "nt_id": "///A/21", "linked_nts": [ "///A/20", "///A/22" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,u-turn,anti,~C3'-endo,BI,non-pair-contact,hairpin-loop", "alpha": 172.203, "beta": 139.187, "gamma": 56.403, "delta": 86.046, "epsilon": -137.073, "zeta": -70.979, "epsilon_zeta": -66.094, "bb_type": "BI", "chi": -170.588, "glyco_bond": "anti", "C5prime_xyz": [ -1.329, 8.534, 1.252 ], "P_xyz": [ 1.281, 8.295, 1.364 ], "form": ".", "ssZp": 4.331, "Dp": 4.546, "splay_angle": 22.107, "splay_distance": 3.453, "splay_ratio": 0.192, "d22": null, "d64": null, "eta": 21.769, "theta": -124.316, "eta_prime": 49.481, "theta_prime": -127.066, "eta_base": 25.911, "theta_base": -83.899, "v0": 2.796, "v1": -22.760, "v2": 32.889, "v3": -32.281, "v4": 18.579, "amplitude": 33.901, "phase_angle": 14.035, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1g", "suiteness": 0.779, "filter_rmsd": 0.039, "frame": { "rmsd": 0.013, "origin": [ -29.849, 7.329, 47.350 ], "x_axis": [ -0.567, -0.686, 0.456 ], "y_axis": [ -0.796, 0.599, -0.089 ], "z_axis": [ -0.212, -0.414, -0.885 ], "quaternion": [ -0.191, -0.424, 0.873, -0.144 ] } }, { "index": 21, "index_chain": 21, "chain_name": "A", "nt_resnum": 22, "nt_name": "A", "nt_code": "A", "nt_id": "///A/22", "linked_nts": [ "///A/21", "///A/23" ], "nt_type": "RNA", "dbn": ".", "summary": "u-turn,anti,~C3'-endo,BI,non-pair-contact,hairpin-loop,cap-donor,phosphate", "alpha": -67.626, "beta": 163.190, "gamma": 61.885, "delta": 85.440, "epsilon": -150.038, "zeta": -74.213, "epsilon_zeta": -75.825, "bb_type": "BI", "chi": -146.441, "glyco_bond": "anti", "C5prime_xyz": [ -1.325, 8.685, -0.192 ], "P_xyz": [ 1.249, 8.841, -0.582 ], "form": ".", "ssZp": 3.916, "Dp": 4.540, "splay_angle": 20.790, "splay_distance": 3.353, "splay_ratio": 0.184, "d22": null, "d64": null, "eta": 165.063, "theta": -140.735, "eta_prime": -170.917, "theta_prime": -142.220, "eta_base": -105.182, "theta_base": -101.286, "v0": 3.099, "v1": -24.138, "v2": 34.649, "v3": -33.850, "v4": 19.377, "amplitude": 35.663, "phase_angle": 13.697, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.775, "filter_rmsd": 0.036, "frame": { "rmsd": 0.008, "origin": [ -31.515, 4.958, 45.473 ], "x_axis": [ -0.988, -0.125, 0.092 ], "y_axis": [ -0.156, 0.815, -0.558 ], "z_axis": [ -0.006, -0.565, -0.825 ], "quaternion": [ -0.026, -0.074, 0.952, -0.295 ] } }, { "index": 22, "index_chain": 22, "chain_name": "A", "nt_resnum": 23, "nt_name": "A", "nt_code": "A", "nt_id": "///A/23", "linked_nts": [ "///A/22", "///A/24" ], "nt_type": "RNA", "dbn": ".", "summary": "u-turn,anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,hairpin-loop,phosphate", "alpha": -64.829, "beta": 165.207, "gamma": 51.913, "delta": 84.978, "epsilon": -147.048, "zeta": -69.804, "epsilon_zeta": -77.244, "bb_type": "BI", "chi": -142.249, "glyco_bond": "anti", "C5prime_xyz": [ -1.226, 8.613, -0.481 ], "P_xyz": [ 1.374, 8.599, -0.884 ], "form": ".", "ssZp": 3.776, "Dp": 4.635, "splay_angle": 43.577, "splay_distance": 6.984, "splay_ratio": 0.371, "d22": null, "d64": null, "eta": 163.510, "theta": -97.018, "eta_prime": -178.822, "theta_prime": -98.452, "eta_base": -122.200, "theta_base": -63.735, "v0": 5.599, "v1": -26.165, "v2": 35.875, "v3": -33.618, "v4": 17.660, "amplitude": 36.431, "phase_angle": 10.023, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.905, "filter_rmsd": 0.038, "frame": { "rmsd": 0.006, "origin": [ -33.112, 3.588, 42.861 ], "x_axis": [ -0.853, 0.475, -0.215 ], "y_axis": [ 0.484, 0.567, -0.667 ], "z_axis": [ -0.195, -0.673, -0.713 ], "quaternion": [ 0.006, 0.271, 0.885, -0.379 ] } }, { "index": 23, "index_chain": 23, "chain_name": "A", "nt_resnum": 24, "nt_name": "G", "nt_code": "G", "nt_id": "///A/24", "linked_nts": [ "///A/23", "///A/25" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop", "alpha": 140.513, "beta": -136.693, "gamma": -179.411, "delta": 85.905, "epsilon": -139.804, "zeta": -68.769, "epsilon_zeta": -71.035, "bb_type": "BI", "chi": -173.479, "glyco_bond": "anti", "C5prime_xyz": [ -0.771, 8.273, 1.370 ], "P_xyz": [ 0.920, 9.446, -0.243 ], "form": "A", "ssZp": 4.758, "Dp": 4.774, "splay_angle": 26.218, "splay_distance": 4.085, "splay_ratio": 0.230, "d22": null, "d64": null, "eta": 165.049, "theta": -151.646, "eta_prime": -157.194, "theta_prime": -152.404, "eta_base": -87.931, "theta_base": -128.649, "v0": 10.478, "v1": -29.316, "v2": 36.168, "v3": -31.142, "v4": 13.080, "amplitude": 36.196, "phase_angle": 2.278, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.528, "filter_rmsd": 0.007, "frame": { "rmsd": 0.007, "origin": [ -37.020, 6.449, 37.829 ], "x_axis": [ 0.058, 0.775, -0.630 ], "y_axis": [ 0.931, -0.270, -0.247 ], "z_axis": [ -0.361, -0.571, -0.737 ], "quaternion": [ 0.113, 0.719, 0.593, -0.345 ] } }, { "index": 24, "index_chain": 24, "chain_name": "A", "nt_resnum": 25, "nt_name": "G", "nt_code": "G", "nt_id": "///A/25", "linked_nts": [ "///A/24", "///A/26" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -66.790, "beta": 169.983, "gamma": 58.172, "delta": 79.303, "epsilon": -149.930, "zeta": -71.823, "epsilon_zeta": -78.108, "bb_type": "BI", "chi": -173.960, "glyco_bond": "anti", "C5prime_xyz": [ -1.579, 8.587, 1.309 ], "P_xyz": [ 0.967, 9.049, 1.531 ], "form": "A", "ssZp": 4.691, "Dp": 4.688, "splay_angle": 25.016, "splay_distance": 3.977, "splay_ratio": 0.224, "d22": null, "d64": null, "eta": 164.797, "theta": -145.084, "eta_prime": -175.592, "theta_prime": -144.696, "eta_base": -130.992, "theta_base": -121.346, "v0": 2.038, "v1": -26.466, "v2": 39.539, "v3": -39.422, "v4": 23.472, "amplitude": 41.087, "phase_angle": 15.781, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.896, "filter_rmsd": 0.007, "frame": { "rmsd": 0.007, "origin": [ -39.724, 5.943, 34.809 ], "x_axis": [ 0.582, 0.541, -0.607 ], "y_axis": [ 0.754, -0.638, 0.154 ], "z_axis": [ -0.304, -0.548, -0.779 ], "quaternion": [ 0.202, 0.866, 0.374, -0.263 ] } }, { "index": 25, "index_chain": 25, "chain_name": "A", "nt_resnum": 26, "nt_name": "C", "nt_code": "C", "nt_id": "///A/26", "linked_nts": [ "///A/25", "///A/27" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -71.002, "beta": -177.375, "gamma": 55.011, "delta": 76.905, "epsilon": -144.533, "zeta": -72.398, "epsilon_zeta": -72.134, "bb_type": "BI", "chi": -165.967, "glyco_bond": "anti", "C5prime_xyz": [ -1.429, 8.741, 0.822 ], "P_xyz": [ 1.118, 9.262, 1.152 ], "form": "A", "ssZp": 4.593, "Dp": 4.719, "splay_angle": 20.979, "splay_distance": 3.438, "splay_ratio": 0.189, "d22": null, "d64": null, "eta": 168.546, "theta": -146.029, "eta_prime": 178.249, "theta_prime": -144.294, "eta_base": -144.315, "theta_base": -120.386, "v0": 1.787, "v1": -26.158, "v2": 39.266, "v3": -39.214, "v4": 23.490, "amplitude": 40.858, "phase_angle": 16.046, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.909, "filter_rmsd": 0.061, "frame": { "rmsd": 0.007, "origin": [ -41.657, 6.092, 31.336 ], "x_axis": [ 0.930, 0.135, -0.341 ], "y_axis": [ 0.283, -0.857, 0.432 ], "z_axis": [ -0.234, -0.498, -0.835 ], "quaternion": [ 0.244, 0.952, 0.110, -0.151 ] } }, { "index": 26, "index_chain": 26, "chain_name": "A", "nt_resnum": 27, "nt_name": "A", "nt_code": "A", "nt_id": "///A/27", "linked_nts": [ "///A/26", "///A/28" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop", "alpha": -67.510, "beta": 165.496, "gamma": 63.011, "delta": 75.160, "epsilon": -141.677, "zeta": -68.513, "epsilon_zeta": -73.164, "bb_type": "BI", "chi": -166.539, "glyco_bond": "anti", "C5prime_xyz": [ -1.767, 8.701, 0.835 ], "P_xyz": [ 0.706, 9.517, 0.609 ], "form": ".", "ssZp": 4.584, "Dp": 4.721, "splay_angle": 26.707, "splay_distance": 4.150, "splay_ratio": 0.233, "d22": null, "d64": null, "eta": 166.237, "theta": -139.636, "eta_prime": 179.907, "theta_prime": -136.776, "eta_base": -141.585, "theta_base": -88.737, "v0": 0.581, "v1": -25.575, "v2": 39.459, "v3": -40.232, "v4": 24.954, "amplitude": 41.447, "phase_angle": 17.817, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.756, "filter_rmsd": 0.036, "frame": { "rmsd": 0.010, "origin": [ -41.650, 6.423, 27.914 ], "x_axis": [ 0.972, -0.237, 0.003 ], "y_axis": [ -0.217, -0.884, 0.414 ], "z_axis": [ -0.095, -0.403, -0.910 ], "quaternion": [ 0.210, 0.970, -0.117, -0.024 ] } }, { "index": 27, "index_chain": 27, "chain_name": "A", "nt_resnum": 28, "nt_name": "G", "nt_code": "G", "nt_id": "///A/28", "linked_nts": [ "///A/27", "///A/29" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop", "alpha": -63.313, "beta": 172.783, "gamma": 55.760, "delta": 82.668, "epsilon": -145.140, "zeta": -74.341, "epsilon_zeta": -70.799, "bb_type": "BI", "chi": -156.260, "glyco_bond": "anti", "C5prime_xyz": [ -1.307, 8.766, 0.288 ], "P_xyz": [ 1.292, 9.089, 0.221 ], "form": ".", "ssZp": 4.316, "Dp": 4.654, "splay_angle": 40.888, "splay_distance": 6.522, "splay_ratio": 0.350, "d22": null, "d64": null, "eta": 169.111, "theta": -150.144, "eta_prime": -172.581, "theta_prime": -137.770, "eta_base": -108.432, "theta_base": -143.630, "v0": 1.931, "v1": -23.450, "v2": 34.828, "v3": -34.656, "v4": 20.618, "amplitude": 36.157, "phase_angle": 15.583, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.868, "filter_rmsd": 0.008, "frame": { "rmsd": 0.008, "origin": [ -38.834, 4.595, 25.474 ], "x_axis": [ 0.462, -0.790, 0.403 ], "y_axis": [ -0.878, -0.471, 0.083 ], "z_axis": [ 0.124, -0.392, -0.912 ], "quaternion": [ 0.141, 0.843, -0.495, 0.156 ] } }, { "index": 28, "index_chain": 28, "chain_name": "A", "nt_resnum": 29, "nt_name": "A", "nt_code": "A", "nt_id": "///A/29", "linked_nts": [ "///A/28", "///A/30" ], "nt_type": "RNA", "dbn": ".", "summary": "~C2'-endo,non-canonical,non-pair-contact,helix,multiplet,internal-loop", "alpha": -61.561, "beta": -135.383, "gamma": 52.046, "delta": 146.937, "epsilon": -103.264, "zeta": 121.682, "epsilon_zeta": 135.055, "bb_type": "--", "chi": -71.510, "glyco_bond": "--", "C5prime_xyz": [ -3.401, 6.968, -2.884 ], "P_xyz": [ -1.577, 8.722, -3.535 ], "form": ".", "ssZp": 0.765, "Dp": 0.996, "splay_angle": 42.770, "splay_distance": 7.080, "splay_ratio": 0.369, "d22": null, "d64": null, "eta": -138.545, "theta": 127.668, "eta_prime": -131.270, "theta_prime": 111.349, "eta_base": -148.711, "theta_base": 124.428, "v0": -25.119, "v1": 38.631, "v2": -36.534, "v3": 23.020, "v4": 1.111, "amplitude": 38.982, "phase_angle": 159.589, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1[", "suiteness": 0.952, "filter_rmsd": 0.038, "frame": { "rmsd": 0.007, "origin": [ -37.026, 3.475, 19.308 ], "x_axis": [ 0.452, -0.748, 0.486 ], "y_axis": [ -0.839, -0.541, -0.053 ], "z_axis": [ 0.302, -0.384, -0.872 ], "quaternion": [ 0.098, 0.846, -0.469, 0.233 ] } }, { "index": 29, "index_chain": 29, "chain_name": "A", "nt_resnum": 30, "nt_name": "C", "nt_code": "C", "nt_id": "///A/30", "linked_nts": [ "///A/29", "///A/31" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,anti,~C3'-endo,non-canonical,non-pair-contact,multiplet,internal-loop,cap-acceptor", "alpha": -156.048, "beta": -179.964, "gamma": 48.747, "delta": 80.546, "epsilon": -126.332, "zeta": -52.590, "epsilon_zeta": -73.741, "bb_type": "--", "chi": -166.831, "glyco_bond": "anti", "C5prime_xyz": [ -1.183, 8.618, 0.928 ], "P_xyz": [ 1.394, 8.827, 1.376 ], "form": ".", "ssZp": 4.608, "Dp": 4.819, "splay_angle": 46.462, "splay_distance": 7.039, "splay_ratio": 0.395, "d22": null, "d64": null, "eta": 133.302, "theta": -109.663, "eta_prime": 121.909, "theta_prime": -99.026, "eta_base": 137.527, "theta_base": -57.959, "v0": 5.786, "v1": -28.186, "v2": 38.635, "v3": -36.304, "v4": 19.251, "amplitude": 39.267, "phase_angle": 10.287, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "6g", "suiteness": 0.115, "filter_rmsd": 0.063, "frame": { "rmsd": 0.004, "origin": [ -39.928, 9.200, 16.320 ], "x_axis": [ 0.483, -0.780, 0.397 ], "y_axis": [ -0.845, -0.534, -0.023 ], "z_axis": [ 0.230, -0.325, -0.917 ], "quaternion": [ 0.088, 0.856, -0.474, 0.183 ] } }, { "index": 30, "index_chain": 30, "chain_name": "A", "nt_resnum": 31, "nt_name": "A", "nt_code": "A", "nt_id": "///A/31", "linked_nts": [ "///A/30", "///A/32" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,multiplet,internal-loop,cap-donor", "alpha": -67.493, "beta": 154.951, "gamma": 80.535, "delta": 81.406, "epsilon": -154.884, "zeta": -70.910, "epsilon_zeta": -83.975, "bb_type": "BI", "chi": -171.456, "glyco_bond": "anti", "C5prime_xyz": [ -1.227, 8.533, 1.206 ], "P_xyz": [ 1.283, 8.910, 0.541 ], "form": "A", "ssZp": 4.593, "Dp": 4.628, "splay_angle": 22.819, "splay_distance": 3.546, "splay_ratio": 0.201, "d22": null, "d64": null, "eta": 167.348, "theta": -146.462, "eta_prime": -151.491, "theta_prime": -150.476, "eta_base": -77.167, "theta_base": -130.824, "v0": 4.556, "v1": -26.381, "v2": 36.990, "v3": -35.332, "v4": 19.461, "amplitude": 37.794, "phase_angle": 11.835, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.073, "filter_rmsd": 0.039, "frame": { "rmsd": 0.009, "origin": [ -38.857, 2.312, 15.348 ], "x_axis": [ -0.581, -0.813, 0.038 ], "y_axis": [ -0.741, 0.510, -0.436 ], "z_axis": [ 0.335, -0.282, -0.899 ], "quaternion": [ 0.086, -0.449, 0.865, -0.208 ] } }, { "index": 31, "index_chain": 31, "chain_name": "A", "nt_resnum": 32, "nt_name": "C", "nt_code": "C", "nt_id": "///A/32", "linked_nts": [ "///A/31", "///A/33" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,internal-loop,A-minor", "alpha": -63.675, "beta": 172.593, "gamma": 59.075, "delta": 82.783, "epsilon": -153.629, "zeta": -73.411, "epsilon_zeta": -80.217, "bb_type": "BI", "chi": -161.145, "glyco_bond": "anti", "C5prime_xyz": [ -1.388, 8.729, 0.615 ], "P_xyz": [ 1.208, 9.026, 0.767 ], "form": "A", "ssZp": 4.385, "Dp": 4.558, "splay_angle": 24.768, "splay_distance": 3.896, "splay_ratio": 0.215, "d22": 4.313, "d64": 4.197, "eta": 173.695, "theta": -146.280, "eta_prime": -170.630, "theta_prime": -146.596, "eta_base": -132.960, "theta_base": -124.035, "v0": 2.193, "v1": -23.839, "v2": 35.258, "v3": -34.985, "v4": 20.655, "amplitude": 36.546, "phase_angle": 15.262, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.922, "filter_rmsd": 0.063, "frame": { "rmsd": 0.006, "origin": [ -36.768, 0.193, 13.419 ], "x_axis": [ -0.834, -0.466, -0.296 ], "y_axis": [ -0.304, 0.836, -0.457 ], "z_axis": [ 0.460, -0.291, -0.839 ], "quaternion": [ 0.202, -0.205, 0.937, -0.200 ] } }, { "index": 32, "index_chain": 32, "chain_name": "A", "nt_resnum": 33, "nt_name": "U", "nt_code": "U", "nt_id": "///A/33", "linked_nts": [ "///A/32", "///A/34" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,A-minor", "alpha": -65.774, "beta": 177.635, "gamma": 53.949, "delta": 83.985, "epsilon": -150.907, "zeta": -73.570, "epsilon_zeta": -77.337, "bb_type": "BI", "chi": -163.147, "glyco_bond": "anti", "C5prime_xyz": [ -1.405, 8.674, 0.721 ], "P_xyz": [ 1.136, 9.032, 1.282 ], "form": "A", "ssZp": 4.359, "Dp": 4.557, "splay_angle": 20.301, "splay_distance": 3.188, "splay_ratio": 0.176, "d22": 4.343, "d64": 3.957, "eta": 170.844, "theta": -144.616, "eta_prime": -177.377, "theta_prime": -144.203, "eta_base": -141.302, "theta_base": -116.023, "v0": 3.480, "v1": -24.560, "v2": 34.996, "v3": -33.996, "v4": 19.236, "amplitude": 35.940, "phase_angle": 13.165, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.956, "filter_rmsd": 0.104, "frame": { "rmsd": 0.007, "origin": [ -35.147, -2.177, 10.786 ], "x_axis": [ -0.949, 0.109, -0.296 ], "y_axis": [ 0.174, 0.963, -0.204 ], "z_axis": [ 0.263, -0.245, -0.933 ], "quaternion": [ 0.143, 0.072, 0.980, -0.115 ] } }, { "index": 33, "index_chain": 33, "chain_name": "A", "nt_resnum": 34, "nt_name": "U", "nt_code": "U", "nt_id": "///A/34", "linked_nts": [ "///A/33", "///A/35" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -76.417, "beta": 171.582, "gamma": 60.261, "delta": 82.766, "epsilon": -147.626, "zeta": -74.480, "epsilon_zeta": -73.146, "bb_type": "BI", "chi": -159.881, "glyco_bond": "anti", "C5prime_xyz": [ -1.399, 8.695, 0.516 ], "P_xyz": [ 1.216, 9.017, 0.482 ], "form": "A", "ssZp": 4.405, "Dp": 4.632, "splay_angle": 22.587, "splay_distance": 3.552, "splay_ratio": 0.196, "d22": 4.327, "d64": 3.987, "eta": 161.940, "theta": -142.672, "eta_prime": 176.182, "theta_prime": -144.195, "eta_base": -140.458, "theta_base": -116.321, "v0": 2.936, "v1": -24.597, "v2": 35.689, "v3": -34.951, "v4": 20.121, "amplitude": 36.794, "phase_angle": 14.074, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.829, "filter_rmsd": 0.102, "frame": { "rmsd": 0.004, "origin": [ -35.108, -3.824, 8.057 ], "x_axis": [ -0.697, 0.656, -0.290 ], "y_axis": [ 0.705, 0.702, -0.106 ], "z_axis": [ 0.134, -0.278, -0.951 ], "quaternion": [ 0.116, 0.372, 0.915, -0.105 ] } }, { "index": 34, "index_chain": 34, "chain_name": "A", "nt_resnum": 35, "nt_name": "C", "nt_code": "C", "nt_id": "///A/35", "linked_nts": [ "///A/34", "///A/36" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -72.385, "beta": 174.039, "gamma": 56.231, "delta": 78.544, "epsilon": -142.820, "zeta": -72.816, "epsilon_zeta": -70.004, "bb_type": "BI", "chi": -160.285, "glyco_bond": "anti", "C5prime_xyz": [ -1.107, 8.750, 0.499 ], "P_xyz": [ 1.503, 9.034, 0.464 ], "form": "A", "ssZp": 4.430, "Dp": 4.706, "splay_angle": 21.000, "splay_distance": 3.455, "splay_ratio": 0.187, "d22": 4.128, "d64": 4.392, "eta": 162.480, "theta": -142.154, "eta_prime": 174.007, "theta_prime": -141.583, "eta_base": -142.261, "theta_base": -119.009, "v0": 2.584, "v1": -25.715, "v2": 37.887, "v3": -37.411, "v4": 21.912, "amplitude": 39.205, "phase_angle": 14.899, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.933, "filter_rmsd": 0.065, "frame": { "rmsd": 0.005, "origin": [ -36.142, -4.630, 4.756 ], "x_axis": [ -0.149, 0.983, -0.111 ], "y_axis": [ 0.989, 0.148, -0.021 ], "z_axis": [ -0.005, -0.113, -0.994 ], "quaternion": [ 0.035, 0.651, 0.757, -0.044 ] } }, { "index": 35, "index_chain": 35, "chain_name": "A", "nt_resnum": 36, "nt_name": "C", "nt_code": "C", "nt_id": "///A/36", "linked_nts": [ "///A/35", null ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack", "alpha": -57.108, "beta": 168.245, "gamma": 53.515, "delta": 74.673, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": -156.953, "glyco_bond": "anti", "C5prime_xyz": [ -1.424, 8.926, 0.297 ], "P_xyz": [ 1.082, 9.569, 0.083 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": -0.956, "v1": -24.760, "v2": 39.629, "v3": -41.284, "v4": 26.572, "amplitude": 42.135, "phase_angle": 19.859, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.840, "filter_rmsd": 0.067, "frame": { "rmsd": 0.008, "origin": [ -37.848, -3.876, 1.847 ], "x_axis": [ 0.350, 0.937, 0.006 ], "y_axis": [ 0.928, -0.346, -0.139 ], "z_axis": [ -0.128, 0.055, -0.990 ], "quaternion": [ -0.059, 0.820, 0.569, -0.037 ] } }, { "index": 36, "index_chain": 1, "chain_name": "B", "nt_resnum": 2, "nt_name": "G", "nt_code": "G", "nt_id": "///B/2", "linked_nts": [ "///B/101", "///B/3" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": null, "beta": 175.088, "gamma": 64.018, "delta": 79.642, "epsilon": -156.182, "zeta": -67.716, "epsilon_zeta": -88.465, "bb_type": "BI", "chi": -168.232, "glyco_bond": "anti", "C5prime_xyz": [ -1.387, 8.690, 0.992 ], "P_xyz": [ 1.201, 9.064, 1.105 ], "form": "A", "ssZp": 4.572, "Dp": 4.614, "splay_angle": 22.862, "splay_distance": 3.571, "splay_ratio": 0.201, "d22": null, "d64": null, "eta": null, "theta": -146.357, "eta_prime": null, "theta_prime": -146.745, "eta_base": null, "theta_base": -123.340, "v0": 2.954, "v1": -25.761, "v2": 37.611, "v3": -36.900, "v4": 21.395, "amplitude": 38.819, "phase_angle": 14.334, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.005, "frame": { "rmsd": 0.005, "origin": [ -8.284, 5.142, 20.948 ], "x_axis": [ -0.436, -0.899, 0.028 ], "y_axis": [ -0.900, 0.436, -0.017 ], "z_axis": [ 0.003, -0.033, -0.999 ], "quaternion": [ -0.007, -0.531, 0.847, -0.015 ] } }, { "index": 37, "index_chain": 2, "chain_name": "B", "nt_resnum": 3, "nt_name": "A", "nt_code": "A", "nt_id": "///B/3", "linked_nts": [ "///B/2", "///B/4" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -69.895, "beta": -177.248, "gamma": 54.383, "delta": 80.469, "epsilon": -149.044, "zeta": -71.283, "epsilon_zeta": -77.761, "bb_type": "BI", "chi": -160.085, "glyco_bond": "anti", "C5prime_xyz": [ -1.304, 8.658, 0.519 ], "P_xyz": [ 1.268, 9.062, 0.805 ], "form": "A", "ssZp": 4.443, "Dp": 4.681, "splay_angle": 21.487, "splay_distance": 3.379, "splay_ratio": 0.188, "d22": null, "d64": null, "eta": 170.483, "theta": -144.843, "eta_prime": -178.383, "theta_prime": -143.421, "eta_base": -140.742, "theta_base": -112.899, "v0": 4.317, "v1": -26.841, "v2": 37.915, "v3": -36.429, "v4": 20.218, "amplitude": 38.809, "phase_angle": 12.321, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.919, "filter_rmsd": 0.036, "frame": { "rmsd": 0.006, "origin": [ -7.123, 3.682, 17.903 ], "x_axis": [ -0.857, -0.512, 0.058 ], "y_axis": [ -0.515, 0.850, -0.110 ], "z_axis": [ 0.007, -0.124, -0.992 ], "quaternion": [ -0.013, -0.267, 0.962, -0.061 ] } }, { "index": 38, "index_chain": 3, "chain_name": "B", "nt_resnum": 4, "nt_name": "A", "nt_code": "A", "nt_id": "///B/4", "linked_nts": [ "///B/3", "///B/5" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,A-minor", "alpha": -61.323, "beta": 169.684, "gamma": 51.522, "delta": 77.965, "epsilon": -147.302, "zeta": -67.216, "epsilon_zeta": -80.086, "bb_type": "BI", "chi": -157.738, "glyco_bond": "anti", "C5prime_xyz": [ -1.251, 8.705, 0.346 ], "P_xyz": [ 1.327, 9.107, 0.204 ], "form": "A", "ssZp": 4.374, "Dp": 4.714, "splay_angle": 21.340, "splay_distance": 3.526, "splay_ratio": 0.191, "d22": null, "d64": null, "eta": 165.827, "theta": -141.351, "eta_prime": 179.968, "theta_prime": -139.097, "eta_base": -134.023, "theta_base": -114.047, "v0": 4.674, "v1": -27.897, "v2": 39.362, "v3": -37.700, "v4": 20.796, "amplitude": 40.253, "phase_angle": 12.079, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.959, "filter_rmsd": 0.037, "frame": { "rmsd": 0.004, "origin": [ -7.700, 1.735, 15.203 ], "x_axis": [ -0.997, 0.069, 0.037 ], "y_axis": [ 0.056, 0.960, -0.274 ], "z_axis": [ -0.054, -0.271, -0.961 ], "quaternion": [ -0.023, 0.031, 0.990, -0.138 ] } }, { "index": 39, "index_chain": 4, "chain_name": "B", "nt_resnum": 5, "nt_name": "G", "nt_code": "G", "nt_id": "///B/5", "linked_nts": [ "///B/4", "///B/6" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,internal-loop,A-minor,phosphate", "alpha": -58.994, "beta": 174.963, "gamma": 55.012, "delta": 79.215, "epsilon": -144.623, "zeta": 47.499, "epsilon_zeta": 167.878, "bb_type": "--", "chi": -145.250, "glyco_bond": "anti", "C5prime_xyz": [ -1.673, 8.883, -0.362 ], "P_xyz": [ 0.825, 9.609, -0.639 ], "form": ".", "ssZp": 3.834, "Dp": 4.594, "splay_angle": 21.731, "splay_distance": 3.558, "splay_ratio": 0.193, "d22": null, "d64": null, "eta": 177.364, "theta": -27.012, "eta_prime": -168.436, "theta_prime": -64.863, "eta_base": -132.446, "theta_base": -100.023, "v0": -2.081, "v1": -20.901, "v2": 34.781, "v3": -37.074, "v4": 24.836, "amplitude": 37.493, "phase_angle": 21.927, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.934, "filter_rmsd": 0.008, "frame": { "rmsd": 0.008, "origin": [ -9.706, -0.211, 13.054 ], "x_axis": [ -0.820, 0.572, -0.004 ], "y_axis": [ 0.501, 0.715, -0.487 ], "z_axis": [ -0.276, -0.402, -0.873 ], "quaternion": [ -0.074, 0.291, 0.923, -0.241 ] } }, { "index": 40, "index_chain": 5, "chain_name": "B", "nt_resnum": 6, "nt_name": "A", "nt_code": "A", "nt_id": "///B/6", "linked_nts": [ "///B/5", "///B/7" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C2'-endo,non-canonical,non-pair-contact,helix,multiplet,internal-loop,splayed-apart", "alpha": 172.509, "beta": 143.137, "gamma": 53.592, "delta": 148.729, "epsilon": -113.199, "zeta": 64.121, "epsilon_zeta": 182.680, "bb_type": "--", "chi": -135.407, "glyco_bond": "anti", "C5prime_xyz": [ -1.697, 8.705, -0.294 ], "P_xyz": [ 0.728, 8.740, 0.700 ], "form": ".", "ssZp": 0.543, "Dp": 0.870, "splay_angle": 148.678, "splay_distance": 20.111, "splay_ratio": 0.963, "d22": null, "d64": null, "eta": 50.717, "theta": 116.942, "eta_prime": 122.812, "theta_prime": 70.793, "eta_base": 124.761, "theta_base": 54.083, "v0": -20.014, "v1": 35.833, "v2": -37.202, "v3": 26.555, "v4": -4.503, "amplitude": 38.064, "phase_angle": 167.784, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "5z", "suiteness": 0.871, "filter_rmsd": 0.039, "frame": { "rmsd": 0.013, "origin": [ -11.639, 0.401, 10.129 ], "x_axis": [ 0.507, -0.847, 0.163 ], "y_axis": [ 0.735, 0.324, -0.596 ], "z_axis": [ 0.452, 0.422, 0.786 ], "quaternion": [ 0.809, -0.315, 0.089, -0.489 ] } }, { "index": 41, "index_chain": 6, "chain_name": "B", "nt_resnum": 7, "nt_name": "U", "nt_code": "U", "nt_id": "///B/7", "linked_nts": [ "///B/6", "///B/8" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,anti,~C3'-endo,non-stack,internal-loop,splayed-apart", "alpha": 62.327, "beta": 100.255, "gamma": 165.733, "delta": 77.978, "epsilon": -145.192, "zeta": 81.065, "epsilon_zeta": 133.743, "bb_type": "--", "chi": -155.400, "glyco_bond": "anti", "C5prime_xyz": [ -1.639, 8.861, 0.213 ], "P_xyz": [ -2.298, 10.492, -1.758 ], "form": ".", "ssZp": 4.215, "Dp": 4.602, "splay_angle": 142.013, "splay_distance": 17.523, "splay_ratio": 0.946, "d22": 8.982, "d64": 12.150, "eta": 40.873, "theta": -53.999, "eta_prime": 24.541, "theta_prime": -30.846, "eta_base": 35.131, "theta_base": -14.636, "v0": -2.348, "v1": -20.997, "v2": 35.067, "v3": -37.398, "v4": 25.006, "amplitude": 37.839, "phase_angle": 22.068, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23t", "cluster": "6j", "suiteness": 0.423, "filter_rmsd": 0.101, "frame": { "rmsd": 0.004, "origin": [ -5.012, 12.576, -4.442 ], "x_axis": [ 0.930, -0.367, -0.033 ], "y_axis": [ -0.208, -0.596, 0.776 ], "z_axis": [ -0.304, -0.714, -0.630 ], "quaternion": [ 0.419, 0.888, -0.162, -0.095 ] } }, { "index": 42, "index_chain": 7, "chain_name": "B", "nt_resnum": 8, "nt_name": "U", "nt_code": "U", "nt_id": "///B/8", "linked_nts": [ "///B/7", "///B/9" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C2'-endo,BII,non-canonical,non-pair-contact,helix,multiplet,internal-loop,splayed-apart", "alpha": -79.410, "beta": -177.155, "gamma": 58.555, "delta": 153.882, "epsilon": -90.721, "zeta": 163.294, "epsilon_zeta": 105.985, "bb_type": "BII", "chi": -134.207, "glyco_bond": "anti", "C5prime_xyz": [ -1.921, 8.678, -0.409 ], "P_xyz": [ 0.357, 9.305, 0.776 ], "form": ".", "ssZp": 0.589, "Dp": 0.580, "splay_angle": 75.987, "splay_distance": 11.913, "splay_ratio": 0.616, "d22": null, "d64": null, "eta": -151.210, "theta": 175.773, "eta_prime": -98.319, "theta_prime": 171.475, "eta_base": -86.074, "theta_base": -160.122, "v0": -23.152, "v1": 39.082, "v2": -39.215, "v3": 26.767, "v4": -2.515, "amplitude": 40.651, "phase_angle": 164.729, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.095, "frame": { "rmsd": 0.012, "origin": [ -12.534, 1.543, 6.905 ], "x_axis": [ -0.735, 0.664, 0.133 ], "y_axis": [ 0.304, 0.499, -0.812 ], "z_axis": [ -0.606, -0.556, -0.569 ], "quaternion": [ -0.221, 0.289, 0.837, -0.409 ] } }, { "index": 43, "index_chain": 8, "chain_name": "B", "nt_resnum": 9, "nt_name": "G", "nt_code": "G", "nt_id": "///B/9", "linked_nts": [ "///B/8", "///B/10" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C2'-endo,BII,non-pair-contact,internal-loop", "alpha": -60.243, "beta": -170.733, "gamma": 54.776, "delta": 149.338, "epsilon": -102.042, "zeta": 142.129, "epsilon_zeta": 115.829, "bb_type": "BII", "chi": -111.983, "glyco_bond": "anti", "C5prime_xyz": [ -1.974, 8.450, -1.632 ], "P_xyz": [ 0.412, 9.451, -1.168 ], "form": ".", "ssZp": 0.917, "Dp": 0.914, "splay_angle": 35.444, "splay_distance": 5.925, "splay_ratio": 0.311, "d22": null, "d64": null, "eta": -105.465, "theta": 156.687, "eta_prime": -106.831, "theta_prime": 140.560, "eta_base": -109.805, "theta_base": -176.887, "v0": -22.124, "v1": 37.174, "v2": -37.206, "v3": 25.226, "v4": -2.154, "amplitude": 38.625, "phase_angle": 164.424, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "4b", "suiteness": 0.481, "filter_rmsd": 0.010, "frame": { "rmsd": 0.010, "origin": [ -5.907, -7.760, 3.524 ], "x_axis": [ -0.754, -0.243, -0.610 ], "y_axis": [ 0.099, 0.877, -0.471 ], "z_axis": [ 0.649, -0.415, -0.637 ], "quaternion": [ 0.348, -0.040, 0.904, -0.245 ] } }, { "index": 44, "index_chain": 9, "chain_name": "B", "nt_resnum": 10, "nt_name": "U", "nt_code": "U", "nt_id": "///B/10", "linked_nts": [ "///B/9", "///B/11" ], "nt_type": "RNA", "dbn": ".", "summary": "u-turn,anti,~C3'-endo,BI,non-stack,non-pair-contact,internal-loop,cap-acceptor", "alpha": -76.189, "beta": 127.755, "gamma": 57.794, "delta": 76.658, "epsilon": -152.723, "zeta": -60.231, "epsilon_zeta": -92.492, "bb_type": "BI", "chi": -148.469, "glyco_bond": "anti", "C5prime_xyz": [ -1.580, 8.879, -0.235 ], "P_xyz": [ 0.825, 8.784, -1.253 ], "form": ".", "ssZp": 4.009, "Dp": 4.568, "splay_angle": 72.053, "splay_distance": 10.688, "splay_ratio": 0.588, "d22": null, "d64": null, "eta": 178.723, "theta": -112.034, "eta_prime": -179.574, "theta_prime": -163.471, "eta_base": -137.412, "theta_base": 128.444, "v0": -3.177, "v1": -21.597, "v2": 36.713, "v3": -39.679, "v4": 27.008, "amplitude": 39.922, "phase_angle": 23.131, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "0a", "suiteness": 0.226, "filter_rmsd": 0.103, "frame": { "rmsd": 0.007, "origin": [ -0.429, -7.738, 5.783 ], "x_axis": [ 0.537, -0.236, -0.810 ], "y_axis": [ 0.100, 0.971, -0.217 ], "z_axis": [ 0.838, 0.035, 0.545 ], "quaternion": [ 0.874, -0.072, 0.471, -0.096 ] } }, { "index": 45, "index_chain": 10, "chain_name": "B", "nt_resnum": 11, "nt_name": "A", "nt_code": "A", "nt_id": "///B/11", "linked_nts": [ "///B/10", "///B/12" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,u-turn,anti,~C3'-endo,BI,non-canonical,non-pair-contact,multiplet,internal-loop,A-minor", "alpha": 164.142, "beta": 160.942, "gamma": 56.175, "delta": 84.324, "epsilon": -129.706, "zeta": -73.923, "epsilon_zeta": -55.783, "bb_type": "BI", "chi": -166.957, "glyco_bond": "anti", "C5prime_xyz": [ -1.398, 8.573, 1.022 ], "P_xyz": [ 1.185, 8.693, 1.318 ], "form": ".", "ssZp": 4.391, "Dp": 4.623, "splay_angle": 22.512, "splay_distance": 3.569, "splay_ratio": 0.195, "d22": null, "d64": null, "eta": 31.986, "theta": -127.497, "eta_prime": 51.430, "theta_prime": -128.216, "eta_base": 24.573, "theta_base": -88.001, "v0": 2.804, "v1": -24.346, "v2": 35.447, "v3": -34.937, "v4": 20.248, "amplitude": 36.598, "phase_angle": 14.412, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1g", "suiteness": 0.842, "filter_rmsd": 0.037, "frame": { "rmsd": 0.008, "origin": [ -2.634, -2.355, 14.750 ], "x_axis": [ -0.562, 0.793, -0.237 ], "y_axis": [ 0.722, 0.329, -0.609 ], "z_axis": [ -0.405, -0.513, -0.757 ], "quaternion": [ -0.051, 0.465, 0.814, -0.345 ] } }, { "index": 46, "index_chain": 11, "chain_name": "B", "nt_resnum": 12, "nt_name": "A", "nt_code": "A", "nt_id": "///B/12", "linked_nts": [ "///B/11", "///B/13" ], "nt_type": "RNA", "dbn": ".", "summary": "u-turn,anti,~C3'-endo,BI,non-canonical,non-pair-contact,multiplet,internal-loop,A-minor,cap-donor,phosphate", "alpha": -64.855, "beta": 164.755, "gamma": 52.270, "delta": 80.344, "epsilon": -146.063, "zeta": -66.944, "epsilon_zeta": -79.119, "bb_type": "BI", "chi": -156.736, "glyco_bond": "anti", "C5prime_xyz": [ -1.361, 8.703, 0.315 ], "P_xyz": [ 1.198, 9.112, 0.107 ], "form": "A", "ssZp": 4.368, "Dp": 4.710, "splay_angle": 23.400, "splay_distance": 3.927, "splay_ratio": 0.208, "d22": null, "d64": null, "eta": 157.221, "theta": -137.425, "eta_prime": 176.877, "theta_prime": -138.299, "eta_base": -122.279, "theta_base": -117.179, "v0": 2.309, "v1": -25.169, "v2": 37.081, "v3": -36.799, "v4": 21.832, "amplitude": 38.437, "phase_angle": 15.269, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.777, "filter_rmsd": 0.036, "frame": { "rmsd": 0.006, "origin": [ -5.054, -2.377, 12.127 ], "x_axis": [ 0.133, 0.841, -0.525 ], "y_axis": [ 0.837, -0.379, -0.396 ], "z_axis": [ -0.531, -0.387, -0.754 ], "quaternion": [ -0.003, 0.753, 0.557, -0.351 ] } }, { "index": 47, "index_chain": 12, "chain_name": "B", "nt_resnum": 13, "nt_name": "A", "nt_code": "A", "nt_id": "///B/13", "linked_nts": [ "///B/12", "///B/14" ], "nt_type": "RNA", "dbn": ".", "summary": "u-turn,anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,internal-loop,phosphate", "alpha": -60.071, "beta": 168.597, "gamma": 53.558, "delta": 74.397, "epsilon": -139.065, "zeta": -76.205, "epsilon_zeta": -62.860, "bb_type": "BI", "chi": -157.858, "glyco_bond": "anti", "C5prime_xyz": [ -1.873, 8.884, 0.299 ], "P_xyz": [ 0.529, 9.870, 0.016 ], "form": ".", "ssZp": 4.334, "Dp": 4.718, "splay_angle": 37.066, "splay_distance": 5.865, "splay_ratio": 0.318, "d22": null, "d64": null, "eta": 168.371, "theta": -148.623, "eta_prime": -176.222, "theta_prime": -134.490, "eta_base": -138.633, "theta_base": -107.720, "v0": -4.100, "v1": -21.364, "v2": 37.301, "v3": -40.684, "v4": 28.198, "amplitude": 40.898, "phase_angle": 24.210, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.855, "filter_rmsd": 0.043, "frame": { "rmsd": 0.011, "origin": [ -7.750, -1.618, 9.374 ], "x_axis": [ 0.563, 0.586, -0.583 ], "y_axis": [ 0.606, -0.772, -0.191 ], "z_axis": [ -0.562, -0.246, -0.790 ], "quaternion": [ 0.016, 0.884, 0.337, -0.324 ] } }, { "index": 48, "index_chain": 13, "chain_name": "B", "nt_resnum": 14, "nt_name": "C", "nt_code": "C", "nt_id": "///B/14", "linked_nts": [ "///B/13", "///B/15" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C2'-endo,non-canonical,non-pair-contact,multiplet,internal-loop,phosphate,splayed-apart", "alpha": -65.146, "beta": -164.570, "gamma": 65.674, "delta": 152.908, "epsilon": -167.860, "zeta": 124.625, "epsilon_zeta": 67.515, "bb_type": "--", "chi": -133.682, "glyco_bond": "anti", "C5prime_xyz": [ -1.762, 8.711, -0.401 ], "P_xyz": [ 0.348, 9.315, 1.035 ], "form": ".", "ssZp": 1.282, "Dp": 1.793, "splay_angle": 104.152, "splay_distance": 14.460, "splay_ratio": 0.789, "d22": null, "d64": null, "eta": 177.107, "theta": 111.932, "eta_prime": -147.188, "theta_prime": 95.988, "eta_base": -119.334, "theta_base": 134.525, "v0": -21.101, "v1": 38.468, "v2": -40.171, "v3": 29.089, "v4": -5.261, "amplitude": 40.999, "phase_angle": 168.471, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1b", "suiteness": 0.565, "filter_rmsd": 0.064, "frame": { "rmsd": 0.009, "origin": [ -8.415, -0.900, 3.591 ], "x_axis": [ 0.923, 0.206, 0.324 ], "y_axis": [ 0.096, -0.941, 0.323 ], "z_axis": [ 0.371, -0.267, -0.889 ], "quaternion": [ 0.152, 0.969, 0.078, 0.179 ] } }, { "index": 49, "index_chain": 14, "chain_name": "B", "nt_resnum": 15, "nt_name": "A", "nt_code": "A", "nt_id": "///B/15", "linked_nts": [ "///B/14", "///B/16" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-canonical,non-pair-contact,helix,internal-loop,cap-acceptor,phosphate,splayed-apart", "alpha": -56.094, "beta": 159.171, "gamma": 58.225, "delta": 77.969, "epsilon": -121.007, "zeta": -51.623, "epsilon_zeta": -69.384, "bb_type": "--", "chi": -170.352, "glyco_bond": "anti", "C5prime_xyz": [ -1.644, 8.548, 1.104 ], "P_xyz": [ 0.885, 9.111, 0.844 ], "form": ".", "ssZp": 4.639, "Dp": 4.831, "splay_angle": 54.051, "splay_distance": 8.057, "splay_ratio": 0.455, "d22": null, "d64": null, "eta": -154.218, "theta": -102.156, "eta_prime": -161.967, "theta_prime": -94.168, "eta_base": 172.977, "theta_base": -52.853, "v0": 4.164, "v1": -27.965, "v2": 40.017, "v3": -38.660, "v4": 21.695, "amplitude": 41.055, "phase_angle": 12.908, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "#a", "suiteness": 0.368, "filter_rmsd": 0.036, "frame": { "rmsd": 0.015, "origin": [ -21.540, -6.738, 5.248 ], "x_axis": [ 0.126, 0.821, -0.557 ], "y_axis": [ 0.954, -0.254, -0.160 ], "z_axis": [ -0.273, -0.511, -0.815 ], "quaternion": [ 0.119, 0.741, 0.599, -0.280 ] } }, { "index": 50, "index_chain": 15, "chain_name": "B", "nt_resnum": 16, "nt_name": "U", "nt_code": "U", "nt_id": "///B/16", "linked_nts": [ "///B/15", "///B/17" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop,cap-donor", "alpha": -57.186, "beta": 162.436, "gamma": 60.016, "delta": 77.753, "epsilon": -148.153, "zeta": -85.594, "epsilon_zeta": -62.559, "bb_type": "BI", "chi": -166.765, "glyco_bond": "anti", "C5prime_xyz": [ -1.404, 8.613, 0.917 ], "P_xyz": [ 1.185, 8.948, 0.629 ], "form": "A", "ssZp": 4.626, "Dp": 4.717, "splay_angle": 24.026, "splay_distance": 3.686, "splay_ratio": 0.211, "d22": null, "d64": null, "eta": 161.073, "theta": -153.777, "eta_prime": -159.571, "theta_prime": -154.199, "eta_base": -82.537, "theta_base": -136.216, "v0": 4.512, "v1": -28.609, "v2": 40.580, "v3": -39.021, "v4": 21.699, "amplitude": 41.559, "phase_angle": 12.461, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.448, "filter_rmsd": 0.099, "frame": { "rmsd": 0.007, "origin": [ -17.229, -4.312, -1.112 ], "x_axis": [ 0.957, -0.144, -0.251 ], "y_axis": [ -0.029, -0.911, 0.412 ], "z_axis": [ -0.288, -0.387, -0.876 ], "quaternion": [ 0.207, 0.967, -0.044, -0.139 ] } }, { "index": 51, "index_chain": 16, "chain_name": "B", "nt_resnum": 17, "nt_name": "G", "nt_code": "G", "nt_id": "///B/17", "linked_nts": [ "///B/16", "///B/18" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -50.749, "beta": 163.802, "gamma": 51.497, "delta": 79.182, "epsilon": -148.126, "zeta": -69.306, "epsilon_zeta": -78.819, "bb_type": "BI", "chi": -166.266, "glyco_bond": "anti", "C5prime_xyz": [ -1.284, 8.668, 0.902 ], "P_xyz": [ 1.322, 8.888, 1.019 ], "form": "A", "ssZp": 4.588, "Dp": 4.693, "splay_angle": 23.054, "splay_distance": 3.642, "splay_ratio": 0.203, "d22": null, "d64": null, "eta": 172.810, "theta": -140.565, "eta_prime": -177.804, "theta_prime": -140.328, "eta_base": -146.452, "theta_base": -112.097, "v0": 4.207, "v1": -27.239, "v2": 38.722, "v3": -37.317, "v4": 20.804, "amplitude": 39.680, "phase_angle": 12.617, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.710, "filter_rmsd": 0.007, "frame": { "rmsd": 0.007, "origin": [ -17.722, -3.904, -4.742 ], "x_axis": [ 0.850, -0.522, 0.065 ], "y_axis": [ -0.497, -0.757, 0.423 ], "z_axis": [ -0.172, -0.392, -0.904 ], "quaternion": [ 0.218, 0.937, -0.272, -0.029 ] } }, { "index": 52, "index_chain": 17, "chain_name": "B", "nt_resnum": 18, "nt_name": "C", "nt_code": "C", "nt_id": "///B/18", "linked_nts": [ "///B/17", "///B/19" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -68.013, "beta": 170.779, "gamma": 61.138, "delta": 77.713, "epsilon": -150.888, "zeta": -75.053, "epsilon_zeta": -75.835, "bb_type": "BI", "chi": -164.090, "glyco_bond": "anti", "C5prime_xyz": [ -1.415, 8.745, 0.751 ], "P_xyz": [ 1.160, 9.202, 0.655 ], "form": "A", "ssZp": 4.552, "Dp": 4.677, "splay_angle": 23.793, "splay_distance": 3.751, "splay_ratio": 0.209, "d22": 4.477, "d64": 4.418, "eta": 167.351, "theta": -151.034, "eta_prime": -176.565, "theta_prime": -150.617, "eta_base": -129.525, "theta_base": -132.768, "v0": 3.558, "v1": -27.318, "v2": 39.481, "v3": -38.573, "v4": 22.001, "amplitude": 40.643, "phase_angle": 13.734, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.871, "filter_rmsd": 0.068, "frame": { "rmsd": 0.008, "origin": [ -16.323, -4.825, -7.976 ], "x_axis": [ 0.418, -0.853, 0.312 ], "y_axis": [ -0.905, -0.363, 0.220 ], "z_axis": [ -0.074, -0.374, -0.924 ], "quaternion": [ 0.181, 0.822, -0.535, 0.072 ] } }, { "index": 53, "index_chain": 18, "chain_name": "B", "nt_resnum": 19, "nt_name": "C", "nt_code": "C", "nt_id": "///B/19", "linked_nts": [ "///B/18", "///B/20" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop", "alpha": -74.501, "beta": -177.314, "gamma": 55.534, "delta": 79.183, "epsilon": -142.002, "zeta": -62.666, "epsilon_zeta": -79.336, "bb_type": "BI", "chi": -162.748, "glyco_bond": "anti", "C5prime_xyz": [ -1.320, 8.740, 0.688 ], "P_xyz": [ 1.254, 9.143, 1.021 ], "form": ".", "ssZp": 4.511, "Dp": 4.716, "splay_angle": 27.343, "splay_distance": 4.281, "splay_ratio": 0.237, "d22": null, "d64": null, "eta": 167.648, "theta": -131.534, "eta_prime": 174.644, "theta_prime": -128.555, "eta_base": -156.679, "theta_base": -84.288, "v0": 3.364, "v1": -26.395, "v2": 38.213, "v3": -37.273, "v4": 21.396, "amplitude": 39.351, "phase_angle": 13.810, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.875, "filter_rmsd": 0.063, "frame": { "rmsd": 0.006, "origin": [ -14.785, -5.836, -11.244 ], "x_axis": [ -0.078, -0.774, 0.628 ], "y_axis": [ -0.997, 0.078, -0.028 ], "z_axis": [ -0.027, -0.628, -0.778 ], "quaternion": [ -0.236, -0.637, 0.695, -0.236 ] } }, { "index": 54, "index_chain": 19, "chain_name": "B", "nt_resnum": 20, "nt_name": "G", "nt_code": "G", "nt_id": "///B/20", "linked_nts": [ "///B/19", "///B/21" ], "nt_type": "RNA", "dbn": ".", "summary": "u-turn,anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,hairpin-loop,cap-acceptor,phosphate", "alpha": -68.216, "beta": 179.973, "gamma": 46.526, "delta": 80.060, "epsilon": -141.690, "zeta": -56.069, "epsilon_zeta": -85.622, "bb_type": "BI", "chi": -162.474, "glyco_bond": "anti", "C5prime_xyz": [ -1.302, 8.685, 0.548 ], "P_xyz": [ 1.288, 9.105, 0.606 ], "form": ".", "ssZp": 4.556, "Dp": 4.808, "splay_angle": 83.056, "splay_distance": 11.434, "splay_ratio": 0.663, "d22": null, "d64": null, "eta": 160.285, "theta": -114.743, "eta_prime": 178.073, "theta_prime": -160.387, "eta_base": -119.459, "theta_base": 141.164, "v0": 4.114, "v1": -26.164, "v2": 37.045, "v3": -35.685, "v4": 19.926, "amplitude": 37.948, "phase_angle": 12.528, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.862, "filter_rmsd": 0.011, "frame": { "rmsd": 0.011, "origin": [ -15.135, -10.088, -11.593 ], "x_axis": [ -0.779, -0.340, 0.526 ], "y_axis": [ -0.621, 0.532, -0.576 ], "z_axis": [ -0.084, -0.776, -0.626 ], "quaternion": [ -0.178, -0.281, 0.857, -0.394 ] } }, { "index": 55, "index_chain": 20, "chain_name": "B", "nt_resnum": 21, "nt_name": "A", "nt_code": "A", "nt_id": "///B/21", "linked_nts": [ "///B/20", "///B/22" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,u-turn,anti,~C3'-endo,BI,non-pair-contact,hairpin-loop", "alpha": 170.305, "beta": 133.697, "gamma": 58.526, "delta": 84.985, "epsilon": -134.197, "zeta": -72.320, "epsilon_zeta": -61.877, "bb_type": "BI", "chi": -170.186, "glyco_bond": "anti", "C5prime_xyz": [ -1.458, 8.560, 1.233 ], "P_xyz": [ 1.142, 8.430, 1.024 ], "form": ".", "ssZp": 4.451, "Dp": 4.596, "splay_angle": 23.254, "splay_distance": 3.623, "splay_ratio": 0.202, "d22": null, "d64": null, "eta": 18.656, "theta": -124.315, "eta_prime": 48.711, "theta_prime": -128.083, "eta_base": 25.783, "theta_base": -83.317, "v0": 3.065, "v1": -23.740, "v2": 34.187, "v3": -33.417, "v4": 19.134, "amplitude": 35.196, "phase_angle": 13.750, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1g", "suiteness": 0.627, "filter_rmsd": 0.040, "frame": { "rmsd": 0.010, "origin": [ -10.298, -9.016, -21.897 ], "x_axis": [ -0.242, 0.926, -0.289 ], "y_axis": [ -0.960, -0.187, 0.207 ], "z_axis": [ 0.138, 0.328, 0.935 ], "quaternion": [ 0.614, -0.049, 0.174, 0.769 ] } }, { "index": 56, "index_chain": 21, "chain_name": "B", "nt_resnum": 22, "nt_name": "A", "nt_code": "A", "nt_id": "///B/22", "linked_nts": [ "///B/21", "///B/23" ], "nt_type": "RNA", "dbn": ".", "summary": "u-turn,anti,~C3'-endo,BI,non-pair-contact,hairpin-loop,cap-donor,phosphate", "alpha": -69.821, "beta": 157.569, "gamma": 65.670, "delta": 85.449, "epsilon": -149.392, "zeta": -70.897, "epsilon_zeta": -78.495, "bb_type": "BI", "chi": -154.958, "glyco_bond": "anti", "C5prime_xyz": [ -1.428, 8.686, 0.295 ], "P_xyz": [ 1.147, 8.872, -0.108 ], "form": ".", "ssZp": 4.173, "Dp": 4.525, "splay_angle": 20.952, "splay_distance": 3.315, "splay_ratio": 0.183, "d22": null, "d64": null, "eta": 162.194, "theta": -137.149, "eta_prime": -172.673, "theta_prime": -140.688, "eta_base": -103.052, "theta_base": -96.577, "v0": 2.921, "v1": -23.797, "v2": 34.303, "v3": -33.670, "v4": 19.426, "amplitude": 35.357, "phase_angle": 14.028, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.628, "filter_rmsd": 0.039, "frame": { "rmsd": 0.009, "origin": [ -10.640, -6.167, -19.685 ], "x_axis": [ -0.858, 0.513, 0.028 ], "y_axis": [ -0.430, -0.747, 0.508 ], "z_axis": [ 0.281, 0.423, 0.861 ], "quaternion": [ 0.253, 0.083, 0.250, 0.931 ] } }, { "index": 57, "index_chain": 22, "chain_name": "B", "nt_resnum": 23, "nt_name": "A", "nt_code": "A", "nt_id": "///B/23", "linked_nts": [ "///B/22", "///B/24" ], "nt_type": "RNA", "dbn": ".", "summary": "u-turn,anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,hairpin-loop,phosphate", "alpha": -64.490, "beta": 169.356, "gamma": 48.180, "delta": 81.886, "epsilon": -153.802, "zeta": -68.602, "epsilon_zeta": -85.200, "bb_type": "BI", "chi": -145.959, "glyco_bond": "anti", "C5prime_xyz": [ -1.028, 8.662, -0.260 ], "P_xyz": [ 1.580, 8.714, -0.411 ], "form": ".", "ssZp": 4.000, "Dp": 4.629, "splay_angle": 42.458, "splay_distance": 6.637, "splay_ratio": 0.362, "d22": null, "d64": null, "eta": 160.951, "theta": -104.186, "eta_prime": 178.717, "theta_prime": -103.239, "eta_base": -117.970, "theta_base": -64.792, "v0": 5.814, "v1": -27.731, "v2": 37.944, "v3": -35.534, "v4": 18.651, "amplitude": 38.532, "phase_angle": 10.023, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.914, "filter_rmsd": 0.043, "frame": { "rmsd": 0.010, "origin": [ -11.414, -4.351, -17.022 ], "x_axis": [ -0.923, -0.181, 0.339 ], "y_axis": [ 0.343, -0.786, 0.514 ], "z_axis": [ 0.173, 0.591, 0.788 ], "quaternion": [ -0.140, 0.137, 0.296, 0.935 ] } }, { "index": 58, "index_chain": 23, "chain_name": "B", "nt_resnum": 24, "nt_name": "G", "nt_code": "G", "nt_id": "///B/24", "linked_nts": [ "///B/23", "///B/25" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop,phosphate", "alpha": 147.208, "beta": -135.092, "gamma": 172.016, "delta": 87.342, "epsilon": -138.415, "zeta": -67.141, "epsilon_zeta": -71.274, "bb_type": "BI", "chi": -175.177, "glyco_bond": "anti", "C5prime_xyz": [ -0.752, 8.233, 1.443 ], "P_xyz": [ 1.147, 9.111, -0.143 ], "form": "A", "ssZp": 4.732, "Dp": 4.754, "splay_angle": 25.437, "splay_distance": 3.970, "splay_ratio": 0.223, "d22": null, "d64": null, "eta": 164.747, "theta": -142.717, "eta_prime": -156.312, "theta_prime": -147.044, "eta_base": -83.960, "theta_base": -122.563, "v0": 11.515, "v1": -29.863, "v2": 35.976, "v3": -30.348, "v4": 11.931, "amplitude": 35.977, "phase_angle": 0.466, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.558, "filter_rmsd": 0.011, "frame": { "rmsd": 0.011, "origin": [ -14.965, -5.793, -11.604 ], "x_axis": [ -0.131, -0.777, 0.615 ], "y_axis": [ 0.991, -0.121, 0.059 ], "z_axis": [ 0.028, 0.618, 0.786 ], "quaternion": [ 0.619, -0.225, -0.237, -0.714 ] } }, { "index": 59, "index_chain": 24, "chain_name": "B", "nt_resnum": 25, "nt_name": "G", "nt_code": "G", "nt_id": "///B/25", "linked_nts": [ "///B/24", "///B/26" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -66.601, "beta": 170.280, "gamma": 55.423, "delta": 79.038, "epsilon": -150.157, "zeta": -73.335, "epsilon_zeta": -76.821, "bb_type": "BI", "chi": -171.254, "glyco_bond": "anti", "C5prime_xyz": [ -1.432, 8.607, 1.168 ], "P_xyz": [ 1.138, 9.045, 1.408 ], "form": "A", "ssZp": 4.645, "Dp": 4.675, "splay_angle": 23.490, "splay_distance": 3.707, "splay_ratio": 0.209, "d22": null, "d64": null, "eta": 163.179, "theta": -148.161, "eta_prime": -176.323, "theta_prime": -146.489, "eta_base": -127.909, "theta_base": -122.793, "v0": 4.150, "v1": -27.594, "v2": 39.407, "v3": -38.037, "v4": 21.345, "amplitude": 40.417, "phase_angle": 12.838, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.864, "filter_rmsd": 0.007, "frame": { "rmsd": 0.007, "origin": [ -16.531, -4.652, -8.139 ], "x_axis": [ 0.477, -0.721, 0.502 ], "y_axis": [ 0.878, 0.360, -0.317 ], "z_axis": [ 0.048, 0.592, 0.805 ], "quaternion": [ 0.813, -0.279, -0.140, -0.492 ] } }, { "index": 60, "index_chain": 25, "chain_name": "B", "nt_resnum": 26, "nt_name": "C", "nt_code": "C", "nt_id": "///B/26", "linked_nts": [ "///B/25", "///B/27" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -62.379, "beta": 175.815, "gamma": 51.194, "delta": 77.537, "epsilon": -143.970, "zeta": -69.991, "epsilon_zeta": -73.978, "bb_type": "BI", "chi": -163.208, "glyco_bond": "anti", "C5prime_xyz": [ -1.386, 8.732, 0.702 ], "P_xyz": [ 1.174, 9.175, 0.941 ], "form": "A", "ssZp": 4.495, "Dp": 4.693, "splay_angle": 22.290, "splay_distance": 3.625, "splay_ratio": 0.199, "d22": null, "d64": null, "eta": 169.287, "theta": -143.627, "eta_prime": -179.707, "theta_prime": -142.244, "eta_base": -142.505, "theta_base": -117.861, "v0": 3.680, "v1": -27.980, "v2": 40.529, "v3": -39.375, "v4": 22.462, "amplitude": 41.698, "phase_angle": 13.601, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.947, "filter_rmsd": 0.062, "frame": { "rmsd": 0.006, "origin": [ -17.646, -4.147, -4.640 ], "x_axis": [ 0.870, -0.443, 0.216 ], "y_axis": [ 0.491, 0.732, -0.472 ], "z_axis": [ 0.051, 0.517, 0.854 ], "quaternion": [ 0.930, -0.266, -0.044, -0.251 ] } }, { "index": 61, "index_chain": 26, "chain_name": "B", "nt_resnum": 27, "nt_name": "A", "nt_code": "A", "nt_id": "///B/27", "linked_nts": [ "///B/26", "///B/28" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop", "alpha": -64.588, "beta": 171.560, "gamma": 57.730, "delta": 76.624, "epsilon": -150.408, "zeta": -64.844, "epsilon_zeta": -85.564, "bb_type": "BI", "chi": -166.497, "glyco_bond": "anti", "C5prime_xyz": [ -1.748, 8.691, 0.829 ], "P_xyz": [ 0.722, 9.480, 0.849 ], "form": "A", "ssZp": 4.591, "Dp": 4.682, "splay_angle": 26.787, "splay_distance": 4.133, "splay_ratio": 0.234, "d22": null, "d64": null, "eta": 166.130, "theta": -142.562, "eta_prime": -179.743, "theta_prime": -138.836, "eta_base": -139.225, "theta_base": -92.840, "v0": 1.346, "v1": -26.319, "v2": 39.845, "v3": -40.216, "v4": 24.502, "amplitude": 41.624, "phase_angle": 16.812, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.899, "filter_rmsd": 0.040, "frame": { "rmsd": 0.014, "origin": [ -17.082, -4.431, -1.071 ], "x_axis": [ 0.978, -0.100, -0.181 ], "y_axis": [ 0.011, 0.898, -0.440 ], "z_axis": [ 0.206, 0.429, 0.880 ], "quaternion": [ 0.969, -0.224, 0.100, -0.029 ] } }, { "index": 62, "index_chain": 27, "chain_name": "B", "nt_resnum": 28, "nt_name": "G", "nt_code": "G", "nt_id": "///B/28", "linked_nts": [ "///B/27", "///B/29" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop", "alpha": -65.493, "beta": 178.690, "gamma": 55.695, "delta": 82.916, "epsilon": -143.111, "zeta": -74.929, "epsilon_zeta": -68.182, "bb_type": "BI", "chi": -155.892, "glyco_bond": "anti", "C5prime_xyz": [ -1.304, 8.749, 0.297 ], "P_xyz": [ 1.300, 9.025, 0.430 ], "form": ".", "ssZp": 4.269, "Dp": 4.647, "splay_angle": 40.876, "splay_distance": 6.611, "splay_ratio": 0.350, "d22": null, "d64": null, "eta": 173.684, "theta": -146.589, "eta_prime": -169.816, "theta_prime": -134.061, "eta_base": -110.104, "theta_base": -138.985, "v0": 2.693, "v1": -23.932, "v2": 34.984, "v3": -34.393, "v4": 19.973, "amplitude": 36.127, "phase_angle": 14.448, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.907, "filter_rmsd": 0.006, "frame": { "rmsd": 0.006, "origin": [ -13.642, -3.728, 1.108 ], "x_axis": [ 0.641, 0.577, -0.506 ], "y_axis": [ -0.681, 0.731, -0.030 ], "z_axis": [ 0.352, 0.364, 0.862 ], "quaternion": [ 0.899, -0.109, 0.238, 0.350 ] } }, { "index": 63, "index_chain": 28, "chain_name": "B", "nt_resnum": 29, "nt_name": "A", "nt_code": "A", "nt_id": "///B/29", "linked_nts": [ "///B/28", "///B/30" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C2'-endo,non-canonical,non-pair-contact,helix,multiplet,internal-loop", "alpha": -62.986, "beta": -141.841, "gamma": 55.282, "delta": 146.386, "epsilon": -99.144, "zeta": 102.380, "epsilon_zeta": 158.475, "bb_type": "--", "chi": -78.012, "glyco_bond": "anti", "C5prime_xyz": [ -3.358, 7.347, -2.660 ], "P_xyz": [ -1.447, 9.052, -3.236 ], "form": ".", "ssZp": 1.048, "Dp": 1.053, "splay_angle": 44.037, "splay_distance": 7.239, "splay_ratio": 0.378, "d22": null, "d64": null, "eta": -141.514, "theta": 122.518, "eta_prime": -131.897, "theta_prime": 106.363, "eta_base": -147.107, "theta_base": 121.012, "v0": -27.884, "v1": 40.687, "v2": -37.008, "v3": 21.869, "v4": 3.521, "amplitude": 40.446, "phase_angle": 156.205, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1[", "suiteness": 0.969, "filter_rmsd": 0.035, "frame": { "rmsd": 0.009, "origin": [ -10.636, -2.849, 6.931 ], "x_axis": [ 0.568, 0.546, -0.615 ], "y_axis": [ -0.656, 0.752, 0.062 ], "z_axis": [ 0.497, 0.368, 0.786 ], "quaternion": [ 0.881, -0.087, 0.315, 0.341 ] } }, { "index": 64, "index_chain": 29, "chain_name": "B", "nt_resnum": 30, "nt_name": "C", "nt_code": "C", "nt_id": "///B/30", "linked_nts": [ "///B/29", "///B/31" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,anti,~C3'-endo,BI,non-canonical,non-pair-contact,multiplet,internal-loop,phosphate", "alpha": -173.204, "beta": -163.089, "gamma": 65.302, "delta": 80.560, "epsilon": -130.419, "zeta": -58.310, "epsilon_zeta": -72.109, "bb_type": "BI", "chi": -171.167, "glyco_bond": "anti", "C5prime_xyz": [ -1.256, 8.596, 1.158 ], "P_xyz": [ 1.301, 8.781, 1.691 ], "form": ".", "ssZp": 4.706, "Dp": 4.805, "splay_angle": 44.559, "splay_distance": 6.638, "splay_ratio": 0.379, "d22": null, "d64": null, "eta": 137.665, "theta": -112.735, "eta_prime": 127.533, "theta_prime": -102.924, "eta_base": 141.370, "theta_base": -53.639, "v0": 4.236, "v1": -27.354, "v2": 38.765, "v3": -37.366, "v4": 20.929, "amplitude": 39.725, "phase_angle": 12.617, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "6g", "suiteness": 0.500, "filter_rmsd": 0.064, "frame": { "rmsd": 0.005, "origin": [ -14.943, -7.484, 10.448 ], "x_axis": [ 0.682, 0.564, -0.466 ], "y_axis": [ -0.615, 0.787, 0.054 ], "z_axis": [ 0.397, 0.250, 0.883 ], "quaternion": [ 0.915, -0.054, 0.236, 0.322 ] } }, { "index": 65, "index_chain": 30, "chain_name": "B", "nt_resnum": 31, "nt_name": "A", "nt_code": "A", "nt_id": "///B/31", "linked_nts": [ "///B/30", "///B/32" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,multiplet,internal-loop,phosphate", "alpha": -53.451, "beta": 157.156, "gamma": 57.768, "delta": 81.362, "epsilon": -147.720, "zeta": -81.298, "epsilon_zeta": -66.423, "bb_type": "BI", "chi": -162.832, "glyco_bond": "anti", "C5prime_xyz": [ -1.091, 8.625, 0.717 ], "P_xyz": [ 1.541, 8.609, 0.460 ], "form": "A", "ssZp": 4.503, "Dp": 4.691, "splay_angle": 22.200, "splay_distance": 3.421, "splay_ratio": 0.193, "d22": null, "d64": null, "eta": 165.364, "theta": -146.396, "eta_prime": -158.368, "theta_prime": -147.277, "eta_base": -80.336, "theta_base": -124.879, "v0": 5.036, "v1": -27.094, "v2": 37.762, "v3": -35.849, "v4": 19.449, "amplitude": 38.505, "phase_angle": 11.274, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.651, "filter_rmsd": 0.040, "frame": { "rmsd": 0.008, "origin": [ -12.009, -1.570, 11.135 ], "x_axis": [ -0.337, 0.941, -0.018 ], "y_axis": [ -0.791, -0.273, 0.547 ], "z_axis": [ 0.510, 0.199, 0.837 ], "quaternion": [ 0.554, 0.157, 0.239, 0.782 ] } }, { "index": 66, "index_chain": 31, "chain_name": "B", "nt_resnum": 32, "nt_name": "C", "nt_code": "C", "nt_id": "///B/32", "linked_nts": [ "///B/31", "///B/33" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,internal-loop,A-minor", "alpha": -55.229, "beta": 155.915, "gamma": 59.645, "delta": 81.408, "epsilon": -148.855, "zeta": -75.368, "epsilon_zeta": -73.487, "bb_type": "BI", "chi": -160.435, "glyco_bond": "anti", "C5prime_xyz": [ -1.258, 8.723, 0.570 ], "P_xyz": [ 1.344, 8.833, 0.251 ], "form": "A", "ssZp": 4.406, "Dp": 4.635, "splay_angle": 24.791, "splay_distance": 3.901, "splay_ratio": 0.215, "d22": 4.201, "d64": 4.083, "eta": 171.872, "theta": -142.969, "eta_prime": -171.750, "theta_prime": -144.608, "eta_base": -131.822, "theta_base": -124.154, "v0": 4.237, "v1": -25.888, "v2": 36.662, "v3": -35.238, "v4": 19.564, "amplitude": 37.529, "phase_angle": 12.336, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.753, "filter_rmsd": 0.067, "frame": { "rmsd": 0.007, "origin": [ -9.698, -0.081, 13.171 ], "x_axis": [ -0.649, 0.693, 0.315 ], "y_axis": [ -0.453, -0.684, 0.572 ], "z_axis": [ 0.611, 0.228, 0.758 ], "quaternion": [ 0.326, 0.263, 0.228, 0.879 ] } }, { "index": 67, "index_chain": 32, "chain_name": "B", "nt_resnum": 33, "nt_name": "U", "nt_code": "U", "nt_id": "///B/33", "linked_nts": [ "///B/32", "///B/34" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,A-minor", "alpha": -62.079, "beta": 174.349, "gamma": 50.666, "delta": 82.177, "epsilon": -147.716, "zeta": -75.242, "epsilon_zeta": -72.474, "bb_type": "BI", "chi": -161.850, "glyco_bond": "anti", "C5prime_xyz": [ -1.477, 8.698, 0.648 ], "P_xyz": [ 1.076, 9.035, 1.142 ], "form": "A", "ssZp": 4.383, "Dp": 4.600, "splay_angle": 19.245, "splay_distance": 3.055, "splay_ratio": 0.168, "d22": 4.137, "d64": 3.880, "eta": 169.000, "theta": -143.502, "eta_prime": -178.714, "theta_prime": -143.167, "eta_base": -142.820, "theta_base": -112.953, "v0": 2.092, "v1": -24.386, "v2": 36.178, "v3": -35.932, "v4": 21.298, "amplitude": 37.533, "phase_angle": 15.439, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.971, "filter_rmsd": 0.100, "frame": { "rmsd": 0.007, "origin": [ -7.449, 2.037, 15.552 ], "x_axis": [ -0.923, 0.164, 0.348 ], "y_axis": [ -0.050, -0.948, 0.315 ], "z_axis": [ 0.382, 0.273, 0.883 ], "quaternion": [ 0.055, 0.188, 0.152, 0.969 ] } }, { "index": 68, "index_chain": 33, "chain_name": "B", "nt_resnum": 34, "nt_name": "U", "nt_code": "U", "nt_id": "///B/34", "linked_nts": [ "///B/33", "///B/35" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -63.971, "beta": 166.485, "gamma": 54.937, "delta": 79.799, "epsilon": -145.560, "zeta": -73.584, "epsilon_zeta": -71.976, "bb_type": "BI", "chi": -157.724, "glyco_bond": "anti", "C5prime_xyz": [ -1.441, 8.759, 0.383 ], "P_xyz": [ 1.143, 9.173, 0.305 ], "form": "A", "ssZp": 4.345, "Dp": 4.655, "splay_angle": 22.002, "splay_distance": 3.563, "splay_ratio": 0.193, "d22": 3.921, "d64": 3.964, "eta": 164.944, "theta": -141.308, "eta_prime": 178.670, "theta_prime": -140.664, "eta_base": -135.867, "theta_base": -110.130, "v0": 1.547, "v1": -24.497, "v2": 36.878, "v3": -37.015, "v4": 22.353, "amplitude": 38.435, "phase_angle": 16.363, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.964, "filter_rmsd": 0.105, "frame": { "rmsd": 0.002, "origin": [ -7.240, 3.901, 17.963 ], "x_axis": [ -0.809, -0.416, 0.415 ], "y_axis": [ 0.529, -0.824, 0.203 ], "z_axis": [ 0.258, 0.384, 0.887 ], "quaternion": [ -0.252, 0.179, 0.156, 0.938 ] } }, { "index": 69, "index_chain": 34, "chain_name": "B", "nt_resnum": 35, "nt_name": "C", "nt_code": "C", "nt_id": "///B/35", "linked_nts": [ "///B/34", "///B/36" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -54.026, "beta": 165.668, "gamma": 50.627, "delta": 79.026, "epsilon": -165.907, "zeta": -71.845, "epsilon_zeta": -94.063, "bb_type": "BI", "chi": -155.832, "glyco_bond": "anti", "C5prime_xyz": [ -1.534, 8.876, 0.254 ], "P_xyz": [ 1.021, 9.435, 0.328 ], "form": "A", "ssZp": 4.245, "Dp": 4.450, "splay_angle": 21.556, "splay_distance": 3.807, "splay_ratio": 0.197, "d22": 4.426, "d64": 4.854, "eta": 166.911, "theta": -131.906, "eta_prime": -174.948, "theta_prime": -144.323, "eta_base": -127.280, "theta_base": -131.433, "v0": -0.952, "v1": -22.095, "v2": 35.518, "v3": -37.029, "v4": 23.979, "amplitude": 37.806, "phase_angle": 20.036, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.866, "filter_rmsd": 0.059, "frame": { "rmsd": 0.006, "origin": [ -8.323, 5.072, 21.150 ], "x_axis": [ -0.392, -0.870, 0.300 ], "y_axis": [ 0.917, -0.396, 0.048 ], "z_axis": [ 0.077, 0.294, 0.953 ], "quaternion": [ 0.540, -0.114, -0.103, -0.828 ] } }, { "index": 70, "index_chain": 35, "chain_name": "B", "nt_resnum": 36, "nt_name": "C", "nt_code": "C", "nt_id": "///B/36", "linked_nts": [ "///B/35", null ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack", "alpha": 160.308, "beta": -172.706, "gamma": 170.623, "delta": 82.641, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": -171.798, "glyco_bond": "anti", "C5prime_xyz": [ -1.170, 8.542, 1.255 ], "P_xyz": [ 0.442, 10.255, 0.111 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": 4.930, "v1": -25.761, "v2": 35.751, "v3": -33.802, "v4": 18.258, "amplitude": 36.419, "phase_angle": 10.991, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.837, "filter_rmsd": 0.063, "frame": { "rmsd": 0.003, "origin": [ -10.303, 6.254, 24.178 ], "x_axis": [ 0.025, -0.991, 0.132 ], "y_axis": [ 0.999, 0.028, 0.026 ], "z_axis": [ -0.029, 0.131, 0.991 ], "quaternion": [ 0.715, -0.037, -0.056, -0.696 ] } }, { "index": 71, "index_chain": 1, "chain_name": "A", "nt_resnum": 101, "nt_name": "GTP", "nt_code": "g", "is_modified": true, "nt_id": "///A/101", "linked_nts": [ null, "///A/2" ], "nt_type": "RNA", "dbn": ")", "summary": "modified,anti,~C3'-endo,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack", "alpha": null, "beta": null, "gamma": 129.497, "delta": 86.826, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": 171.874, "glyco_bond": "anti", "C5prime_xyz": [ -1.328, 8.234, 2.168 ], "P_xyz": [ null, null, null ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": -1.528, "v1": -18.150, "v2": 29.380, "v3": -30.897, "v4": 20.684, "amplitude": 31.499, "phase_angle": 21.137, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.073, "frame": { "rmsd": 0.073, "origin": [ -37.829, -4.135, 1.660 ], "x_axis": [ 0.413, 0.911, 0.003 ], "y_axis": [ -0.906, 0.411, 0.098 ], "z_axis": [ 0.088, -0.044, 0.995 ], "quaternion": [ 0.840, 0.042, 0.025, 0.541 ] } }, { "index": 72, "index_chain": 1, "chain_name": "B", "nt_resnum": 101, "nt_name": "GTP", "nt_code": "g", "is_modified": true, "nt_id": "///B/101", "linked_nts": [ null, "///B/2" ], "nt_type": "RNA", "dbn": ")", "summary": "modified,anti,~C3'-endo,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack", "alpha": null, "beta": null, "gamma": 52.956, "delta": 88.271, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": -175.463, "glyco_bond": "anti", "C5prime_xyz": [ -1.131, 8.511, 1.349 ], "P_xyz": [ null, null, null ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": 3.477, "v1": -23.968, "v2": 34.011, "v3": -32.362, "v4": 18.526, "amplitude": 34.854, "phase_angle": 12.624, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.074, "frame": { "rmsd": 0.074, "origin": [ -9.989, 6.218, 24.191 ], "x_axis": [ 0.156, -0.988, 0.009 ], "y_axis": [ -0.987, -0.156, 0.034 ], "z_axis": [ -0.033, -0.014, -0.999 ], "quaternion": [ 0.016, 0.760, -0.650, -0.008 ] } } ], "num_hbonds": 124, "hbonds": [ { "index": 1, "atom1_serNum": 18, "atom2_serNum": 728, "donAcc_type": "standard", "distance": 2.934, "atom1_id": "///A/2/O6", "atom2_id": "///A/35/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 2, "atom1_serNum": 19, "atom2_serNum": 726, "donAcc_type": "standard", "distance": 2.915, "atom1_id": "///A/2/N1", "atom2_id": "///A/35/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 3, "atom1_serNum": 21, "atom2_serNum": 725, "donAcc_type": "standard", "distance": 2.812, "atom1_id": "///A/2/N2", "atom2_id": "///A/35/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 4, "atom1_serNum": 41, "atom2_serNum": 688, "donAcc_type": "standard", "distance": 3.802, "atom1_id": "///A/3/N6", "atom2_id": "///A/33/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 5, "atom1_serNum": 41, "atom2_serNum": 708, "donAcc_type": "standard", "distance": 3.074, "atom1_id": "///A/3/N6", "atom2_id": "///A/34/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 6, "atom1_serNum": 42, "atom2_serNum": 706, "donAcc_type": "standard", "distance": 2.905, "atom1_id": "///A/3/N1", "atom2_id": "///A/34/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 7, "atom1_serNum": 63, "atom2_serNum": 688, "donAcc_type": "standard", "distance": 3.013, "atom1_id": "///A/4/N6", "atom2_id": "///A/33/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 8, "atom1_serNum": 64, "atom2_serNum": 686, "donAcc_type": "standard", "distance": 2.830, "atom1_id": "///A/4/N1", "atom2_id": "///A/33/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 9, "atom1_serNum": 70, "atom2_serNum": 101, "donAcc_type": "acceptable", "distance": 2.701, "atom1_id": "///A/5/OP2", "atom2_id": "///A/6/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 10, "atom1_serNum": 78, "atom2_serNum": 186, "donAcc_type": "acceptable", "distance": 3.229, "atom1_id": "///A/5/O2'", "atom2_id": "///A/10/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 11, "atom1_serNum": 78, "atom2_serNum": 235, "donAcc_type": "acceptable", "distance": 2.924, "atom1_id": "///A/5/O2'", "atom2_id": "///A/12/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 12, "atom1_serNum": 85, "atom2_serNum": 668, "donAcc_type": "standard", "distance": 2.921, "atom1_id": "///A/5/O6", "atom2_id": "///A/32/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 13, "atom1_serNum": 86, "atom2_serNum": 666, "donAcc_type": "standard", "distance": 2.823, "atom1_id": "///A/5/N1", "atom2_id": "///A/32/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 14, "atom1_serNum": 88, "atom2_serNum": 236, "donAcc_type": "standard", "distance": 2.984, "atom1_id": "///A/5/N2", "atom2_id": "///A/12/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 15, "atom1_serNum": 88, "atom2_serNum": 665, "donAcc_type": "standard", "distance": 2.771, "atom1_id": "///A/5/N2", "atom2_id": "///A/32/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 16, "atom1_serNum": 89, "atom2_serNum": 235, "donAcc_type": "standard", "distance": 3.027, "atom1_id": "///A/5/N3", "atom2_id": "///A/12/N6", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 17, "atom1_serNum": 97, "atom2_serNum": 139, "donAcc_type": "questionable", "distance": 3.136, "atom1_id": "///A/6/O4'", "atom2_id": "///A/8/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 18, "atom1_serNum": 105, "atom2_serNum": 257, "donAcc_type": "standard", "distance": 3.004, "atom1_id": "///A/6/N7", "atom2_id": "///A/13/N6", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 19, "atom1_serNum": 108, "atom2_serNum": 258, "donAcc_type": "standard", "distance": 3.067, "atom1_id": "///A/6/N6", "atom2_id": "///A/13/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 20, "atom1_serNum": 108, "atom2_serNum": 647, "donAcc_type": "standard", "distance": 2.975, "atom1_id": "///A/6/N6", "atom2_id": "///A/31/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 21, "atom1_serNum": 109, "atom2_serNum": 646, "donAcc_type": "standard", "distance": 2.803, "atom1_id": "///A/6/N1", "atom2_id": "///A/31/N6", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 22, "atom1_serNum": 147, "atom2_serNum": 604, "donAcc_type": "standard", "distance": 3.083, "atom1_id": "///A/8/O2", "atom2_id": "///A/29/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 23, "atom1_serNum": 148, "atom2_serNum": 601, "donAcc_type": "standard", "distance": 2.833, "atom1_id": "///A/8/N3", "atom2_id": "///A/29/N7", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 24, "atom1_serNum": 159, "atom2_serNum": 279, "donAcc_type": "standard", "distance": 3.240, "atom1_id": "///A/9/O4'", "atom2_id": "///A/14/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 25, "atom1_serNum": 170, "atom2_serNum": 272, "donAcc_type": "acceptable", "distance": 3.067, "atom1_id": "///A/9/O6", "atom2_id": "///A/14/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 26, "atom1_serNum": 171, "atom2_serNum": 264, "donAcc_type": "standard", "distance": 2.884, "atom1_id": "///A/9/N1", "atom2_id": "///A/14/OP2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 27, "atom1_serNum": 173, "atom2_serNum": 242, "donAcc_type": "standard", "distance": 2.996, "atom1_id": "///A/9/N2", "atom2_id": "///A/13/OP2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 28, "atom1_serNum": 173, "atom2_serNum": 243, "donAcc_type": "standard", "distance": 3.159, "atom1_id": "///A/9/N2", "atom2_id": "///A/13/O5'", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 29, "atom1_serNum": 173, "atom2_serNum": 264, "donAcc_type": "standard", "distance": 2.987, "atom1_id": "///A/9/N2", "atom2_id": "///A/14/OP2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 30, "atom1_serNum": 186, "atom2_serNum": 232, "donAcc_type": "acceptable", "distance": 2.586, "atom1_id": "///A/10/O2'", "atom2_id": "///A/12/N7", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 31, "atom1_serNum": 191, "atom2_serNum": 242, "donAcc_type": "standard", "distance": 2.596, "atom1_id": "///A/10/N3", "atom2_id": "///A/13/OP2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 32, "atom1_serNum": 213, "atom2_serNum": 685, "donAcc_type": "standard", "distance": 2.760, "atom1_id": "///A/11/N6", "atom2_id": "///A/33/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 33, "atom1_serNum": 214, "atom2_serNum": 681, "donAcc_type": "acceptable", "distance": 2.449, "atom1_id": "///A/11/N1", "atom2_id": "///A/33/O2'", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 34, "atom1_serNum": 272, "atom2_serNum": 283, "donAcc_type": "acceptable", "distance": 3.155, "atom1_id": "///A/14/O2'", "atom2_id": "///A/15/OP1", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 35, "atom1_serNum": 277, "atom2_serNum": 604, "donAcc_type": "standard", "distance": 3.143, "atom1_id": "///A/14/N3", "atom2_id": "///A/29/N6", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 36, "atom1_serNum": 284, "atom2_serNum": 584, "donAcc_type": "standard", "distance": 3.093, "atom1_id": "///A/15/OP2", "atom2_id": "///A/28/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 37, "atom1_serNum": 288, "atom2_serNum": 1564, "donAcc_type": "questionable", "distance": 2.998, "atom1_id": "///A/15/O4'", "atom2_id": "///A/109/O15", "atom_pair": "O:O", "residue_pair": "nt:ligand" }, { "index": 38, "atom1_serNum": 296, "atom2_serNum": 584, "donAcc_type": "standard", "distance": 2.941, "atom1_id": "///A/15/N7", "atom2_id": "///A/28/N2", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 39, "atom1_serNum": 319, "atom2_serNum": 560, "donAcc_type": "standard", "distance": 2.880, "atom1_id": "///A/16/N3", "atom2_id": "///A/27/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 40, "atom1_serNum": 321, "atom2_serNum": 559, "donAcc_type": "standard", "distance": 3.028, "atom1_id": "///A/16/O4", "atom2_id": "///A/27/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 41, "atom1_serNum": 341, "atom2_serNum": 539, "donAcc_type": "standard", "distance": 2.959, "atom1_id": "///A/17/O6", "atom2_id": "///A/26/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 42, "atom1_serNum": 342, "atom2_serNum": 537, "donAcc_type": "standard", "distance": 2.894, "atom1_id": "///A/17/N1", "atom2_id": "///A/26/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 43, "atom1_serNum": 344, "atom2_serNum": 536, "donAcc_type": "standard", "distance": 2.778, "atom1_id": "///A/17/N2", "atom2_id": "///A/26/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 44, "atom1_serNum": 361, "atom2_serNum": 519, "donAcc_type": "standard", "distance": 2.785, "atom1_id": "///A/18/O2", "atom2_id": "///A/25/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 45, "atom1_serNum": 362, "atom2_serNum": 517, "donAcc_type": "standard", "distance": 2.956, "atom1_id": "///A/18/N3", "atom2_id": "///A/25/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 46, "atom1_serNum": 364, "atom2_serNum": 516, "donAcc_type": "standard", "distance": 3.104, "atom1_id": "///A/18/N4", "atom2_id": "///A/25/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 47, "atom1_serNum": 381, "atom2_serNum": 496, "donAcc_type": "standard", "distance": 2.847, "atom1_id": "///A/19/O2", "atom2_id": "///A/24/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 48, "atom1_serNum": 382, "atom2_serNum": 494, "donAcc_type": "standard", "distance": 2.856, "atom1_id": "///A/19/N3", "atom2_id": "///A/24/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 49, "atom1_serNum": 384, "atom2_serNum": 493, "donAcc_type": "standard", "distance": 2.818, "atom1_id": "///A/19/N4", "atom2_id": "///A/24/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 50, "atom1_serNum": 397, "atom2_serNum": 446, "donAcc_type": "acceptable", "distance": 2.846, "atom1_id": "///A/20/O2'", "atom2_id": "///A/22/N7", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 51, "atom1_serNum": 397, "atom2_serNum": 449, "donAcc_type": "acceptable", "distance": 3.291, "atom1_id": "///A/20/O2'", "atom2_id": "///A/22/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 52, "atom1_serNum": 407, "atom2_serNum": 456, "donAcc_type": "standard", "distance": 2.910, "atom1_id": "///A/20/N2", "atom2_id": "///A/23/OP2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 53, "atom1_serNum": 407, "atom2_serNum": 468, "donAcc_type": "standard", "distance": 2.863, "atom1_id": "///A/20/N2", "atom2_id": "///A/23/N7", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 54, "atom1_serNum": 408, "atom2_serNum": 471, "donAcc_type": "standard", "distance": 3.924, "atom1_id": "///A/20/N3", "atom2_id": "///A/23/N6", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 55, "atom1_serNum": 597, "atom2_serNum": 646, "donAcc_type": "acceptable", "distance": 3.467, "atom1_id": "///A/29/O2'", "atom2_id": "///A/31/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 56, "atom1_serNum": 607, "atom2_serNum": 626, "donAcc_type": "standard", "distance": 2.982, "atom1_id": "///A/29/N3", "atom2_id": "///A/30/N4", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 57, "atom1_serNum": 741, "atom2_serNum": 1543, "donAcc_type": "acceptable", "distance": 2.996, "atom1_id": "///A/36/O2'", "atom2_id": "///A/108/O3", "atom_pair": "O:O", "residue_pair": "nt:ligand" }, { "index": 58, "atom1_serNum": 741, "atom2_serNum": 1544, "donAcc_type": "acceptable", "distance": 2.085, "atom1_id": "///A/36/O2'", "atom2_id": "///A/108/O4", "atom_pair": "O:O", "residue_pair": "nt:ligand" }, { "index": 59, "atom1_serNum": 745, "atom2_serNum": 1532, "donAcc_type": "standard", "distance": 2.901, "atom1_id": "///A/36/O2", "atom2_id": "///A/101/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 60, "atom1_serNum": 746, "atom2_serNum": 1530, "donAcc_type": "standard", "distance": 2.863, "atom1_id": "///A/36/N3", "atom2_id": "///A/101/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 61, "atom1_serNum": 748, "atom2_serNum": 1529, "donAcc_type": "standard", "distance": 2.928, "atom1_id": "///A/36/N4", "atom2_id": "///A/101/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 62, "atom1_serNum": 769, "atom2_serNum": 1479, "donAcc_type": "standard", "distance": 3.156, "atom1_id": "///B/2/O6", "atom2_id": "///B/35/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 63, "atom1_serNum": 770, "atom2_serNum": 1477, "donAcc_type": "standard", "distance": 2.980, "atom1_id": "///B/2/N1", "atom2_id": "///B/35/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 64, "atom1_serNum": 772, "atom2_serNum": 1476, "donAcc_type": "standard", "distance": 2.823, "atom1_id": "///B/2/N2", "atom2_id": "///B/35/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 65, "atom1_serNum": 792, "atom2_serNum": 1439, "donAcc_type": "standard", "distance": 3.455, "atom1_id": "///B/3/N6", "atom2_id": "///B/33/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 66, "atom1_serNum": 792, "atom2_serNum": 1459, "donAcc_type": "standard", "distance": 2.919, "atom1_id": "///B/3/N6", "atom2_id": "///B/34/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 67, "atom1_serNum": 793, "atom2_serNum": 1457, "donAcc_type": "standard", "distance": 2.715, "atom1_id": "///B/3/N1", "atom2_id": "///B/34/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 68, "atom1_serNum": 814, "atom2_serNum": 1439, "donAcc_type": "standard", "distance": 2.994, "atom1_id": "///B/4/N6", "atom2_id": "///B/33/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 69, "atom1_serNum": 815, "atom2_serNum": 1437, "donAcc_type": "standard", "distance": 2.749, "atom1_id": "///B/4/N1", "atom2_id": "///B/33/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 70, "atom1_serNum": 821, "atom2_serNum": 852, "donAcc_type": "acceptable", "distance": 2.647, "atom1_id": "///B/5/OP2", "atom2_id": "///B/6/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 71, "atom1_serNum": 829, "atom2_serNum": 937, "donAcc_type": "acceptable", "distance": 3.225, "atom1_id": "///B/5/O2'", "atom2_id": "///B/10/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 72, "atom1_serNum": 829, "atom2_serNum": 986, "donAcc_type": "acceptable", "distance": 3.056, "atom1_id": "///B/5/O2'", "atom2_id": "///B/12/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 73, "atom1_serNum": 836, "atom2_serNum": 1419, "donAcc_type": "standard", "distance": 3.080, "atom1_id": "///B/5/O6", "atom2_id": "///B/32/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 74, "atom1_serNum": 837, "atom2_serNum": 1417, "donAcc_type": "standard", "distance": 2.974, "atom1_id": "///B/5/N1", "atom2_id": "///B/32/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 75, "atom1_serNum": 839, "atom2_serNum": 987, "donAcc_type": "standard", "distance": 2.928, "atom1_id": "///B/5/N2", "atom2_id": "///B/12/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 76, "atom1_serNum": 839, "atom2_serNum": 1416, "donAcc_type": "standard", "distance": 2.942, "atom1_id": "///B/5/N2", "atom2_id": "///B/32/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 77, "atom1_serNum": 840, "atom2_serNum": 986, "donAcc_type": "standard", "distance": 3.111, "atom1_id": "///B/5/N3", "atom2_id": "///B/12/N6", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 78, "atom1_serNum": 856, "atom2_serNum": 1008, "donAcc_type": "standard", "distance": 3.088, "atom1_id": "///B/6/N7", "atom2_id": "///B/13/N6", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 79, "atom1_serNum": 859, "atom2_serNum": 1009, "donAcc_type": "standard", "distance": 2.885, "atom1_id": "///B/6/N6", "atom2_id": "///B/13/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 80, "atom1_serNum": 859, "atom2_serNum": 1398, "donAcc_type": "standard", "distance": 3.126, "atom1_id": "///B/6/N6", "atom2_id": "///B/31/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 81, "atom1_serNum": 860, "atom2_serNum": 1397, "donAcc_type": "standard", "distance": 2.919, "atom1_id": "///B/6/N1", "atom2_id": "///B/31/N6", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 82, "atom1_serNum": 898, "atom2_serNum": 1355, "donAcc_type": "standard", "distance": 2.900, "atom1_id": "///B/8/O2", "atom2_id": "///B/29/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 83, "atom1_serNum": 899, "atom2_serNum": 1352, "donAcc_type": "standard", "distance": 2.825, "atom1_id": "///B/8/N3", "atom2_id": "///B/29/N7", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 84, "atom1_serNum": 910, "atom2_serNum": 1030, "donAcc_type": "standard", "distance": 3.152, "atom1_id": "///B/9/O4'", "atom2_id": "///B/14/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 85, "atom1_serNum": 921, "atom2_serNum": 1023, "donAcc_type": "acceptable", "distance": 3.296, "atom1_id": "///B/9/O6", "atom2_id": "///B/14/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 86, "atom1_serNum": 922, "atom2_serNum": 1015, "donAcc_type": "standard", "distance": 2.630, "atom1_id": "///B/9/N1", "atom2_id": "///B/14/OP2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 87, "atom1_serNum": 924, "atom2_serNum": 993, "donAcc_type": "standard", "distance": 2.919, "atom1_id": "///B/9/N2", "atom2_id": "///B/13/OP2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 88, "atom1_serNum": 924, "atom2_serNum": 994, "donAcc_type": "standard", "distance": 3.043, "atom1_id": "///B/9/N2", "atom2_id": "///B/13/O5'", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 89, "atom1_serNum": 924, "atom2_serNum": 1015, "donAcc_type": "standard", "distance": 3.044, "atom1_id": "///B/9/N2", "atom2_id": "///B/14/OP2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 90, "atom1_serNum": 937, "atom2_serNum": 983, "donAcc_type": "acceptable", "distance": 2.639, "atom1_id": "///B/10/O2'", "atom2_id": "///B/12/N7", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 91, "atom1_serNum": 942, "atom2_serNum": 993, "donAcc_type": "standard", "distance": 2.706, "atom1_id": "///B/10/N3", "atom2_id": "///B/13/OP2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 92, "atom1_serNum": 964, "atom2_serNum": 1436, "donAcc_type": "standard", "distance": 2.877, "atom1_id": "///B/11/N6", "atom2_id": "///B/33/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 93, "atom1_serNum": 965, "atom2_serNum": 1432, "donAcc_type": "acceptable", "distance": 2.588, "atom1_id": "///B/11/N1", "atom2_id": "///B/33/O2'", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 94, "atom1_serNum": 1023, "atom2_serNum": 1034, "donAcc_type": "acceptable", "distance": 3.102, "atom1_id": "///B/14/O2'", "atom2_id": "///B/15/OP1", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 95, "atom1_serNum": 1028, "atom2_serNum": 1355, "donAcc_type": "standard", "distance": 3.156, "atom1_id": "///B/14/N3", "atom2_id": "///B/29/N6", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 96, "atom1_serNum": 1035, "atom2_serNum": 1335, "donAcc_type": "standard", "distance": 3.053, "atom1_id": "///B/15/OP2", "atom2_id": "///B/28/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 97, "atom1_serNum": 1039, "atom2_serNum": 1633, "donAcc_type": "questionable", "distance": 3.133, "atom1_id": "///B/15/O4'", "atom2_id": "///B/109/O15", "atom_pair": "O:O", "residue_pair": "nt:ligand" }, { "index": 98, "atom1_serNum": 1047, "atom2_serNum": 1335, "donAcc_type": "standard", "distance": 3.077, "atom1_id": "///B/15/N7", "atom2_id": "///B/28/N2", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 99, "atom1_serNum": 1070, "atom2_serNum": 1311, "donAcc_type": "standard", "distance": 2.791, "atom1_id": "///B/16/N3", "atom2_id": "///B/27/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 100, "atom1_serNum": 1072, "atom2_serNum": 1310, "donAcc_type": "standard", "distance": 2.840, "atom1_id": "///B/16/O4", "atom2_id": "///B/27/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 101, "atom1_serNum": 1092, "atom2_serNum": 1290, "donAcc_type": "standard", "distance": 2.841, "atom1_id": "///B/17/O6", "atom2_id": "///B/26/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 102, "atom1_serNum": 1093, "atom2_serNum": 1288, "donAcc_type": "standard", "distance": 2.844, "atom1_id": "///B/17/N1", "atom2_id": "///B/26/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 103, "atom1_serNum": 1095, "atom2_serNum": 1287, "donAcc_type": "standard", "distance": 2.781, "atom1_id": "///B/17/N2", "atom2_id": "///B/26/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 104, "atom1_serNum": 1112, "atom2_serNum": 1270, "donAcc_type": "standard", "distance": 2.794, "atom1_id": "///B/18/O2", "atom2_id": "///B/25/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 105, "atom1_serNum": 1113, "atom2_serNum": 1268, "donAcc_type": "standard", "distance": 2.941, "atom1_id": "///B/18/N3", "atom2_id": "///B/25/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 106, "atom1_serNum": 1115, "atom2_serNum": 1267, "donAcc_type": "standard", "distance": 3.042, "atom1_id": "///B/18/N4", "atom2_id": "///B/25/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 107, "atom1_serNum": 1132, "atom2_serNum": 1247, "donAcc_type": "standard", "distance": 2.852, "atom1_id": "///B/19/O2", "atom2_id": "///B/24/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 108, "atom1_serNum": 1133, "atom2_serNum": 1245, "donAcc_type": "standard", "distance": 2.891, "atom1_id": "///B/19/N3", "atom2_id": "///B/24/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 109, "atom1_serNum": 1135, "atom2_serNum": 1244, "donAcc_type": "standard", "distance": 2.787, "atom1_id": "///B/19/N4", "atom2_id": "///B/24/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 110, "atom1_serNum": 1148, "atom2_serNum": 1197, "donAcc_type": "acceptable", "distance": 2.884, "atom1_id": "///B/20/O2'", "atom2_id": "///B/22/N7", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 111, "atom1_serNum": 1148, "atom2_serNum": 1200, "donAcc_type": "acceptable", "distance": 3.319, "atom1_id": "///B/20/O2'", "atom2_id": "///B/22/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 112, "atom1_serNum": 1158, "atom2_serNum": 1207, "donAcc_type": "standard", "distance": 2.935, "atom1_id": "///B/20/N2", "atom2_id": "///B/23/OP2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 113, "atom1_serNum": 1158, "atom2_serNum": 1219, "donAcc_type": "standard", "distance": 2.902, "atom1_id": "///B/20/N2", "atom2_id": "///B/23/N7", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 114, "atom1_serNum": 1348, "atom2_serNum": 1397, "donAcc_type": "acceptable", "distance": 3.498, "atom1_id": "///B/29/O2'", "atom2_id": "///B/31/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 115, "atom1_serNum": 1358, "atom2_serNum": 1377, "donAcc_type": "standard", "distance": 3.063, "atom1_id": "///B/29/N3", "atom2_id": "///B/30/N4", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 116, "atom1_serNum": 1366, "atom2_serNum": 1639, "donAcc_type": "acceptable", "distance": 3.563, "atom1_id": "///B/30/O4'", "atom2_id": "///B/109/O26", "atom_pair": "O:O", "residue_pair": "nt:ligand" }, { "index": 117, "atom1_serNum": 1490, "atom2_serNum": 1611, "donAcc_type": "acceptable", "distance": 3.041, "atom1_id": "///B/36/O3'", "atom2_id": "///B/108/O2", "atom_pair": "O:O", "residue_pair": "nt:ligand" }, { "index": 118, "atom1_serNum": 1490, "atom2_serNum": 1613, "donAcc_type": "acceptable", "distance": 2.861, "atom1_id": "///B/36/O3'", "atom2_id": "///B/108/O4", "atom_pair": "O:O", "residue_pair": "nt:ligand" }, { "index": 119, "atom1_serNum": 1492, "atom2_serNum": 1611, "donAcc_type": "acceptable", "distance": 2.487, "atom1_id": "///B/36/O2'", "atom2_id": "///B/108/O2", "atom_pair": "O:O", "residue_pair": "nt:ligand" }, { "index": 120, "atom1_serNum": 1492, "atom2_serNum": 1612, "donAcc_type": "acceptable", "distance": 2.894, "atom1_id": "///B/36/O2'", "atom2_id": "///B/108/O3", "atom_pair": "O:O", "residue_pair": "nt:ligand" }, { "index": 121, "atom1_serNum": 1496, "atom2_serNum": 1601, "donAcc_type": "standard", "distance": 2.883, "atom1_id": "///B/36/O2", "atom2_id": "///B/101/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 122, "atom1_serNum": 1497, "atom2_serNum": 1599, "donAcc_type": "standard", "distance": 2.677, "atom1_id": "///B/36/N3", "atom2_id": "///B/101/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 123, "atom1_serNum": 1499, "atom2_serNum": 1598, "donAcc_type": "standard", "distance": 2.597, "atom1_id": "///B/36/N4", "atom2_id": "///B/101/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 124, "atom1_serNum": 1510, "atom2_serNum": 1513, "donAcc_type": "acceptable", "distance": 3.080, "atom1_id": "///A/101/O2B", "atom2_id": "///A/101/O1A", "atom_pair": "O:O", "residue_pair": "nt:nt" } ], "refCoords": { "purine": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 -0.5000 0.4000", " 3 N -2.2500 -0.5000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 1.2500 5.0000 0.4000", " 6 C 1.2500 -0.5000 0.4000", " 7 C 1.2500 -0.5000 -0.4000", " 8 C 1.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 -0.5000 0.4000", " 11 C -2.2500 -0.5000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ], "pyrimidine": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 1.0000 0.4000", " 3 N -2.2500 1.0000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 1.2500 5.0000 0.4000", " 6 C 1.2500 1.0000 0.4000", " 7 C 1.2500 1.0000 -0.4000", " 8 C 1.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 1.0000 0.4000", " 11 C -2.2500 1.0000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ], "wc_pair": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 -5.0000 0.4000", " 3 N -2.2500 -5.0000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 2.2500 5.0000 0.4000", " 6 C 2.2500 -5.0000 0.4000", " 7 C 2.2500 -5.0000 -0.4000", " 8 C 2.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 -5.0000 0.4000", " 11 C -2.2500 -5.0000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ] }, "metadata": { "license": "http://innovation.columbia.edu/technologies/CU20391", "url": "http://x3dna.org/", "url_alt": "http://home.x3dna.org/", "forum": "http://forum.x3dna.org/", "citation": "Lu et al. (2015). 'DSSR: an integrated software tool for dissecting the spatial structure of RNA.' Nucleic Acids Res., 43(21):e142 [doi:10.1093/nar/gkv716].", "str_id": "8hze", "num_naChains": 2, "naChains": "A=36,B=36", "num_atoms": 1789, "num_waters": 151, "num_metals": 12, "metals_desc": "Mg=11,K=1", "num_notes": 52, "notes": [ { "Aminors": "A-minor interactions (including types I and II)" }, { "Cstem_index": "stem index of the 'Canonical' helix in k-turn" }, { "Cstem_pair": "Cstem bp delineating the k-turn internal loop" }, { "Dp": "perpendicular distance of the 3' P atom to the glycosidic bond" }, { "GA_pair": "sheared G-A pair in k-turn" }, { "HtypePknot": "H-type pseudoknot" }, { "Kturn": "kink-turn (k-turn)" }, { "LW": "Leontis-Westhof" }, { "NCstem_index": "stem index of the 'Non-Canonical' helix in k-turn" }, { "NCstem_pair": "NCstem bp delineating the k-turn internal loop" }, { "Uturn": "U-turn of the UNR- or GNRA-type" }, { "aa": "amino acid" }, { "atom_pair": "symbols of the two atoms involved in an H-bond" }, { "auxfiles": "auxiliary files" }, { "glyco_bond": "conformation of base related to sugar (syn or anti)" }, { "bb_type": "backbone conformation, BI or BII" }, { "bending_angle": "angle between two helical axes" }, { "bp": "base pair" }, { "bseq": "base sequence in one-letter code" }, { "bulge": "bulge loop" }, { "coaxStacks": "coaxial stacking of stems within a helix" }, { "dbn": "dot bracket notation" }, { "desc": "description" }, { "donAcc_type": "donor/acceptor type of the atom pair in an H-bond" }, { "epsilon_zeta": "difference between epsilon and zeta torsion angles" }, { "hairpin": "hairpin loop" }, { "hbond": "hydrogen bond (H-bond)" }, { "helix": "defined by base-stacking interactions, regardless of bp type and backbone connectivity" }, { "id": "identifier" }, { "iloop": "internal loop" }, { "index": "serial number" }, { "isoCanonPairs": "isolated canonical pairs" }, { "junction": "(multi-branched) junction loop" }, { "kissingLoop": "kissing loop" }, { "multiplet": "3+ bases in a coplanar geometry" }, { "na": "nucleic acid" }, { "nonPair": "two nts not forming a pair, but with H-bonding/stacking interactions" }, { "nonStack": "nucleotide not involved in stacking interactions" }, { "nt": "nucleotide" }, { "num": "number" }, { "oArea": "overlap areas between two bases, including exocyclic atoms" }, { "oArea_ring": "overlap areas between two bases, including only ring atoms" }, { "phosContacts": "H-bonding and atom-capping interactions involving a phosphate" }, { "residue_pair": "types of the two residues involved in an H-bond" }, { "rmsd": "root-mean-squares deviation" }, { "serNum": "serial number" }, { "ssSegments": "single-stranded segments not involved in loops" }, { "ssZp": "Z-coordinate of the 3' phosphorus atom with reference to the 5' base plane" }, { "sstr": "secondary structure in dbn" }, { "stem": "helix consisting of only canonical pairs, with a continuous backbone" }, { "str_id": "structure identifier, derived from inpfile with extension removed" }, { "vert_dist": "vertical distance from an atom to a base plane" } ], "num_auxfiles": 19, "auxfiles": [ { "index": 1, "name": "dssr-pairs.pdb", "desc": "an ensemble of base pairs" }, { "index": 2, "name": "dssr-multiplets.pdb", "desc": "an ensemble of multiplets" }, { "index": 3, "name": "dssr-stems.pdb", "desc": "an ensemble of stems" }, { "index": 4, "name": "dssr-helices.pdb", "desc": "an ensemble of helices (coaxial stacking)" }, { "index": 5, "name": "dssr-hairpins.pdb", "desc": "an ensemble of hairpin loops" }, { "index": 6, "name": "dssr-iloops.pdb", "desc": "an ensemble of internal loops" }, { "index": 7, "name": "dssr-2ndstrs.bpseq", "desc": "secondary structure in bpseq format" }, { "index": 8, "name": "dssr-2ndstrs.ct", "desc": "secondary structure in connectivity table format" }, { "index": 9, "name": "dssr-2ndstrs.dbn", "desc": "secondary structure in dot-bracket notation" }, { "index": 10, "name": "dssr-torsions.txt", "desc": "backbone torsion angles and suite names" }, { "index": 11, "name": "dssr-splays.pdb", "desc": "an ensemble of splayed-apart units" }, { "index": 12, "name": "dssr-Aminors.pdb", "desc": "an ensemble of A minor motifs (types I and II)" }, { "index": 13, "name": "dssr-Kturns.pdb", "desc": "an ensemble of kink-turn motifs" }, { "index": 14, "name": "dssr-stacks.pdb", "desc": "an ensemble of base stacks" }, { "index": 15, "name": "dssr-atom2bases.pdb", "desc": "an ensemble of atom-base stacking interactions" }, { "index": 16, "name": "dssr-rotmat.txt", "desc": "position vector and rotation matrix" }, { "index": 17, "name": "dssr-viewV.pdb", "desc": "vertical view of the principal moment of inertia" }, { "index": 18, "name": "dssr-viewH.pdb", "desc": "horizontal view of the principal moment of inertia" }, { "index": 19, "name": "dssr-viewT.pdb", "desc": "top view of the principal moment of inertia" } ], "time_used": "999" } }