{ "num_pairs": 169, "pairs": [ { "index": 1, "nt1": "///I/12", "nt2": "///J/169", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -131.600, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 54.386, "chi2": -107.908, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 52.375, "C1C1_dist": 10.634, "N1N9_dist": 8.868, "C6C8_dist": 9.805, "CNNC_torsion": -3.187, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.96],N1-N3(imino)[2.87]", "interBase_angle": 6.626, "planarity": 0.162, "simple_Shear": 0.101, "simple_Stretch": -0.150, "simple_Buckle": -6.410, "simple_Propeller": 1.679, "bp_simpleParams": [ 0.101, -0.150, 0.505, -6.410, 1.679, -0.623 ], "bp_params": [ 0.099, -0.151, 0.505, -6.386, 1.767, -0.622 ], "frame": { "rmsd": null, "origin": [ 148.119, 95.187, 96.393 ], "x_axis": [ 0.681, -0.181, -0.709 ], "y_axis": [ -0.637, 0.332, -0.696 ], "z_axis": [ 0.361, 0.926, 0.111 ], "quaternion": [ 0.729, -0.556, 0.367, 0.156 ] } }, { "index": 2, "nt1": "///I/13", "nt2": "///J/168", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -120.894, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.927, "chi2": -130.908, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.560, "C1C1_dist": 10.679, "N1N9_dist": 8.935, "C6C8_dist": 9.883, "CNNC_torsion": 5.728, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.75],N3-N1(imino)[2.89],N4(amino)-O6(carbonyl)[2.94]", "interBase_angle": 10.556, "planarity": 0.119, "simple_Shear": 0.229, "simple_Stretch": -0.130, "simple_Buckle": -6.275, "simple_Propeller": 8.489, "bp_simpleParams": [ 0.229, -0.130, 0.235, -6.275, 8.489, 1.306 ], "bp_params": [ 0.226, -0.133, 0.235, -6.135, 8.591, 1.307 ], "frame": { "rmsd": null, "origin": [ 150.543, 98.467, 97.688 ], "x_axis": [ 0.209, 0.004, -0.978 ], "y_axis": [ -0.921, 0.338, -0.195 ], "z_axis": [ 0.329, 0.941, 0.074 ], "quaternion": [ 0.637, -0.446, 0.513, 0.363 ] } }, { "index": 3, "nt1": "///I/14", "nt2": "///J/167", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -116.896, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 54.316, "chi2": -145.146, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.128, "C1C1_dist": 10.677, "N1N9_dist": 8.933, "C6C8_dist": 9.887, "CNNC_torsion": 8.870, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.78],N3-N1(imino)[2.89],N4(amino)-O6(carbonyl)[2.97]", "interBase_angle": 13.870, "planarity": 0.177, "simple_Shear": 0.245, "simple_Stretch": -0.135, "simple_Buckle": -1.958, "simple_Propeller": 13.731, "bp_simpleParams": [ 0.245, -0.135, 0.176, -1.958, 13.731, 1.914 ], "bp_params": [ 0.243, -0.139, 0.176, -1.696, 13.766, 1.928 ], "frame": { "rmsd": null, "origin": [ 152.296, 101.577, 97.300 ], "x_axis": [ -0.360, 0.105, -0.927 ], "y_axis": [ -0.895, 0.242, 0.375 ], "z_axis": [ 0.263, 0.965, 0.007 ], "quaternion": [ 0.471, -0.313, 0.631, 0.531 ] } }, { "index": 4, "nt1": "///I/15", "nt2": "///J/166", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -110.686, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 52.789, "chi2": -110.426, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.746, "C1C1_dist": 10.702, "N1N9_dist": 8.938, "C6C8_dist": 9.857, "CNNC_torsion": 4.020, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.93],N1(imino)-N3[2.91],N2(amino)-O2(carbonyl)[2.78]", "interBase_angle": 8.989, "planarity": 0.135, "simple_Shear": -0.195, "simple_Stretch": -0.166, "simple_Buckle": -8.289, "simple_Propeller": -3.478, "bp_simpleParams": [ -0.195, -0.166, -0.698, -8.289, -3.478, 0.367 ], "bp_params": [ -0.193, -0.169, -0.698, -8.243, -3.584, 0.367 ], "frame": { "rmsd": null, "origin": [ 153.656, 104.313, 96.092 ], "x_axis": [ -0.867, -0.112, -0.485 ], "y_axis": [ -0.490, 0.372, 0.789 ], "z_axis": [ 0.092, 0.921, -0.377 ], "quaternion": [ 0.178, -0.186, 0.809, 0.529 ] } }, { "index": 5, "nt1": "///I/16", "nt2": "///J/165", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -107.442, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 54.235, "chi2": -103.168, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.867, "C1C1_dist": 10.672, "N1N9_dist": 8.941, "C6C8_dist": 9.893, "CNNC_torsion": 0.012, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.73],N3-N1(imino)[2.88],N4(amino)-O6(carbonyl)[2.93]", "interBase_angle": 2.784, "planarity": 0.043, "simple_Shear": 0.200, "simple_Stretch": -0.130, "simple_Buckle": -2.668, "simple_Propeller": 0.798, "bp_simpleParams": [ 0.200, -0.130, -0.049, -2.668, 0.798, 0.994 ], "bp_params": [ 0.198, -0.133, -0.049, -2.655, 0.838, 0.993 ], "frame": { "rmsd": null, "origin": [ 153.256, 107.484, 94.837 ], "x_axis": [ -0.997, 0.067, 0.049 ], "y_axis": [ 0.070, 0.350, 0.934 ], "z_axis": [ 0.046, 0.934, -0.354 ], "quaternion": [ -0.001, 0.042, 0.822, 0.569 ] } }, { "index": 6, "nt1": "///I/17", "nt2": "///J/164", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -119.405, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.999, "chi2": -147.245, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.461, "C1C1_dist": 10.645, "N1N9_dist": 8.900, "C6C8_dist": 9.839, "CNNC_torsion": -5.040, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.75],N3-N1(imino)[2.89],N4(amino)-O6(carbonyl)[2.92]", "interBase_angle": 1.412, "planarity": 0.161, "simple_Shear": 0.201, "simple_Stretch": -0.210, "simple_Buckle": 0.600, "simple_Propeller": 1.278, "bp_simpleParams": [ 0.201, -0.210, 0.680, 0.600, 1.278, 0.754 ], "bp_params": [ 0.197, -0.213, 0.680, 0.619, 1.269, 0.754 ], "frame": { "rmsd": null, "origin": [ 152.228, 110.463, 92.915 ], "x_axis": [ -0.817, 0.198, 0.542 ], "y_axis": [ 0.577, 0.253, 0.777 ], "z_axis": [ 0.016, 0.947, -0.321 ], "quaternion": [ -0.170, 0.250, 0.773, 0.557 ] } }, { "index": 7, "nt1": "///I/18", "nt2": "///J/163", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -128.336, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 47.324, "chi2": -116.722, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 31.291, "C1C1_dist": 12.248, "N1N9_dist": 9.988, "C6C8_dist": 10.234, "CNNC_torsion": -9.472, "hbonds_num": 1, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.86]", "interBase_angle": 13.102, "planarity": 0.297, "simple_Shear": 1.603, "simple_Stretch": 0.645, "simple_Buckle": -2.044, "simple_Propeller": 12.941, "bp_simpleParams": [ 1.603, 0.645, 1.501, -2.044, 12.941, -28.377 ], "bp_params": [ 1.688, 0.370, 1.501, 0.146, 13.101, -28.556 ], "frame": { "rmsd": null, "origin": [ 153.228, 113.010, 89.631 ], "x_axis": [ -0.267, 0.130, 0.955 ], "y_axis": [ 0.963, 0.061, 0.261 ], "z_axis": [ -0.024, 0.990, -0.142 ], "quaternion": [ -0.404, 0.451, 0.606, 0.516 ] } }, { "index": 8, "nt1": "///I/19", "nt2": "///J/162", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -121.621, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 51.581, "chi2": -121.154, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 52.835, "C1C1_dist": 10.592, "N1N9_dist": 8.785, "C6C8_dist": 9.671, "CNNC_torsion": -4.827, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.92],O4(carbonyl)-N6(amino)[2.88]", "interBase_angle": 9.000, "planarity": 0.288, "simple_Shear": -0.095, "simple_Stretch": -0.351, "simple_Buckle": 3.488, "simple_Propeller": 8.296, "bp_simpleParams": [ -0.095, -0.351, 1.187, 3.488, 8.296, -1.210 ], "bp_params": [ -0.090, -0.352, 1.187, 3.377, 8.342, -1.213 ], "frame": { "rmsd": null, "origin": [ 151.968, 116.707, 91.052 ], "x_axis": [ 0.168, 0.125, 0.978 ], "y_axis": [ 0.986, 0.001, -0.169 ], "z_axis": [ -0.022, 0.992, -0.123 ], "quaternion": [ 0.511, -0.568, -0.489, -0.421 ] } }, { "index": 9, "nt1": "///I/20", "nt2": "///J/161", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -117.840, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.583, "chi2": -121.268, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 52.546, "C1C1_dist": 10.534, "N1N9_dist": 8.765, "C6C8_dist": 9.683, "CNNC_torsion": -6.664, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.83],N3-N1(imino)[2.91],N4(amino)-O6(carbonyl)[2.88]", "interBase_angle": 5.950, "planarity": 0.317, "simple_Shear": 0.209, "simple_Stretch": -0.413, "simple_Buckle": 2.560, "simple_Propeller": 5.370, "bp_simpleParams": [ 0.209, -0.413, 1.227, 2.560, 5.370, 1.226 ], "bp_params": [ 0.203, -0.417, 1.227, 2.646, 5.329, 1.227 ], "frame": { "rmsd": null, "origin": [ 152.045, 120.148, 91.423 ], "x_axis": [ 0.760, 0.039, 0.649 ], "y_axis": [ 0.648, 0.020, -0.761 ], "z_axis": [ -0.043, 0.999, -0.011 ], "quaternion": [ 0.665, -0.662, -0.260, -0.229 ] } }, { "index": 10, "nt1": "///I/21", "nt2": "///J/159", "bp": "A-T", "name": "--", "Saenger": "--", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -117.673, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 36.440, "chi2": -134.867, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 34.188, "C1C1_dist": 11.975, "N1N9_dist": 9.570, "C6C8_dist": 9.637, "CNNC_torsion": 28.923, "hbonds_num": 1, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.60]", "interBase_angle": 6.116, "planarity": 0.378, "simple_Shear": 0.068, "simple_Stretch": 0.091, "simple_Buckle": 6.040, "simple_Propeller": 0.961, "bp_simpleParams": [ 0.068, 0.091, -1.625, 6.040, 0.961, -37.919 ], "bp_params": [ 0.069, 0.090, -1.625, 6.047, 0.922, -37.871 ], "frame": { "rmsd": null, "origin": [ 152.371, 125.355, 91.417 ], "x_axis": [ 0.962, -0.029, -0.272 ], "y_axis": [ -0.271, 0.023, -0.962 ], "z_axis": [ 0.034, 0.999, 0.014 ], "quaternion": [ 0.707, -0.694, 0.108, 0.086 ] } }, { "index": 11, "nt1": "///I/21", "nt2": "///J/160", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -117.673, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 52.219, "chi2": -114.980, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 49.306, "C1C1_dist": 10.566, "N1N9_dist": 8.702, "C6C8_dist": 9.481, "CNNC_torsion": -15.697, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.82],N1-N3(imino)[2.96]", "interBase_angle": 6.311, "planarity": 0.381, "simple_Shear": 0.317, "simple_Stretch": -0.629, "simple_Buckle": 4.191, "simple_Propeller": 4.719, "bp_simpleParams": [ 0.317, -0.629, 1.858, 4.191, 4.719, -5.850 ], "bp_params": [ 0.294, -0.640, 1.858, 4.360, 4.563, -5.851 ], "frame": { "rmsd": null, "origin": [ 152.203, 123.625, 91.009 ], "x_axis": [ 1.000, -0.017, 0.005 ], "y_axis": [ 0.005, 0.024, -1.000 ], "z_axis": [ 0.017, 1.000, 0.025 ], "quaternion": [ 0.716, -0.698, 0.004, -0.008 ] } }, { "index": 12, "nt1": "///I/22", "nt2": "///J/159", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -126.955, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 54.370, "chi2": -134.867, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 51.182, "C1C1_dist": 10.500, "N1N9_dist": 8.716, "C6C8_dist": 9.584, "CNNC_torsion": -15.444, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.92],N1-N3(imino)[2.89]", "interBase_angle": 7.563, "planarity": 0.317, "simple_Shear": 0.319, "simple_Stretch": -0.479, "simple_Buckle": 7.347, "simple_Propeller": 1.794, "bp_simpleParams": [ 0.319, -0.479, 1.632, 7.347, 1.794, -2.833 ], "bp_params": [ 0.301, -0.490, 1.632, 7.408, 1.522, -2.827 ], "frame": { "rmsd": null, "origin": [ 152.685, 126.964, 91.613 ], "x_axis": [ 0.835, -0.042, -0.549 ], "y_axis": [ -0.547, 0.043, -0.836 ], "z_axis": [ 0.059, 0.998, 0.012 ], "quaternion": [ 0.687, -0.667, 0.221, 0.184 ] } }, { "index": 13, "nt1": "///I/23", "nt2": "///J/158", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -110.278, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 49.848, "chi2": -142.744, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.625, "C1C1_dist": 10.517, "N1N9_dist": 8.693, "C6C8_dist": 9.541, "CNNC_torsion": -14.452, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.90],O4(carbonyl)-N6(amino)[2.88]", "interBase_angle": 2.232, "planarity": 0.345, "simple_Shear": -0.269, "simple_Stretch": -0.528, "simple_Buckle": 2.218, "simple_Propeller": 0.248, "bp_simpleParams": [ -0.269, -0.528, 1.543, 2.218, 0.248, -4.340 ], "bp_params": [ -0.252, -0.536, 1.543, 2.210, 0.316, -4.339 ], "frame": { "rmsd": null, "origin": [ 153.717, 130.616, 93.172 ], "x_axis": [ 0.414, 0.044, -0.909 ], "y_axis": [ -0.907, 0.106, -0.407 ], "z_axis": [ 0.078, 0.993, 0.084 ], "quaternion": [ 0.633, -0.553, 0.390, 0.376 ] } }, { "index": 14, "nt1": "///I/24", "nt2": "///J/157", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -121.562, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 52.608, "chi2": -138.819, "conf2": "anti", "pucker2": "----", "lambda2": 50.201, "C1C1_dist": 10.677, "N1N9_dist": 8.840, "C6C8_dist": 9.701, "CNNC_torsion": -16.967, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.93],N1-N3(imino)[2.86]", "interBase_angle": 8.245, "planarity": 0.252, "simple_Shear": 0.167, "simple_Stretch": -0.291, "simple_Buckle": -2.797, "simple_Propeller": -7.756, "bp_simpleParams": [ 0.167, -0.291, 0.962, -2.797, -7.756, -4.595 ], "bp_params": [ 0.161, -0.294, 0.962, -2.960, -7.696, -4.604 ], "frame": { "rmsd": null, "origin": [ 154.214, 134.243, 92.676 ], "x_axis": [ -0.284, 0.042, -0.958 ], "y_axis": [ -0.952, 0.111, 0.287 ], "z_axis": [ 0.118, 0.993, 0.009 ], "quaternion": [ 0.457, -0.386, 0.589, 0.544 ] } }, { "index": 15, "nt1": "///I/25", "nt2": "///J/156", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -115.049, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 51.858, "chi2": -130.546, "conf2": "anti", "pucker2": "----", "lambda2": 53.671, "C1C1_dist": 10.690, "N1N9_dist": 8.903, "C6C8_dist": 9.816, "CNNC_torsion": -11.370, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.85],O4(carbonyl)-N6(amino)[2.96]", "interBase_angle": 8.977, "planarity": 0.136, "simple_Shear": -0.160, "simple_Stretch": -0.138, "simple_Buckle": -6.385, "simple_Propeller": -6.311, "bp_simpleParams": [ -0.160, -0.138, 0.554, -6.385, -6.311, -2.119 ], "bp_params": [ -0.158, -0.141, 0.554, -6.265, -6.429, -2.120 ], "frame": { "rmsd": null, "origin": [ 155.395, 137.833, 92.586 ], "x_axis": [ -0.718, 0.107, -0.688 ], "y_axis": [ -0.685, 0.067, 0.726 ], "z_axis": [ 0.123, 0.992, 0.025 ], "quaternion": [ 0.306, -0.218, 0.663, 0.647 ] } }, { "index": 16, "nt1": "///I/26", "nt2": "///J/155", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -122.197, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 52.901, "chi2": -113.532, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 52.996, "C1C1_dist": 10.725, "N1N9_dist": 8.946, "C6C8_dist": 9.854, "CNNC_torsion": -5.925, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.77],N3-N1(imino)[2.88],N4(amino)-O6(carbonyl)[2.89]", "interBase_angle": 7.391, "planarity": 0.103, "simple_Shear": 0.159, "simple_Stretch": -0.161, "simple_Buckle": -7.363, "simple_Propeller": -0.645, "bp_simpleParams": [ 0.159, -0.161, 0.500, -7.363, -0.645, -0.529 ], "bp_params": [ 0.157, -0.163, 0.500, -7.370, -0.560, -0.528 ], "frame": { "rmsd": null, "origin": [ 155.995, 141.321, 92.797 ], "x_axis": [ -0.987, 0.100, -0.126 ], "y_axis": [ -0.132, -0.056, 0.990 ], "z_axis": [ 0.091, 0.993, 0.069 ], "quaternion": [ 0.080, -0.012, 0.682, 0.727 ] } }, { "index": 17, "nt1": "///I/27", "nt2": "///J/154", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -121.366, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.786, "chi2": -130.252, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 52.863, "C1C1_dist": 10.674, "N1N9_dist": 8.912, "C6C8_dist": 9.838, "CNNC_torsion": -3.466, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.76],N3-N1(imino)[2.88],N4(amino)-O6(carbonyl)[2.90]", "interBase_angle": 6.138, "planarity": 0.127, "simple_Shear": 0.210, "simple_Stretch": -0.196, "simple_Buckle": -4.891, "simple_Propeller": 3.709, "bp_simpleParams": [ 0.210, -0.196, 0.630, -4.891, 3.709, 0.608 ], "bp_params": [ 0.207, -0.199, 0.630, -4.834, 3.783, 0.608 ], "frame": { "rmsd": null, "origin": [ 155.968, 144.845, 92.394 ], "x_axis": [ -0.914, -0.002, 0.405 ], "y_axis": [ 0.401, -0.141, 0.905 ], "z_axis": [ 0.055, 0.990, 0.130 ], "quaternion": [ -0.137, 0.156, 0.641, 0.739 ] } }, { "index": 18, "nt1": "///I/28", "nt2": "///J/153", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -122.358, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.912, "chi2": -109.974, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 52.148, "C1C1_dist": 10.576, "N1N9_dist": 8.800, "C6C8_dist": 9.718, "CNNC_torsion": -4.705, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.90],N1-N3(imino)[2.86]", "interBase_angle": 6.282, "planarity": 0.222, "simple_Shear": 0.123, "simple_Stretch": -0.281, "simple_Buckle": -2.165, "simple_Propeller": 5.897, "bp_simpleParams": [ 0.123, -0.281, 0.945, -2.165, 5.897, -0.646 ], "bp_params": [ 0.119, -0.283, 0.945, -2.066, 5.933, -0.647 ], "frame": { "rmsd": null, "origin": [ 156.086, 147.992, 92.627 ], "x_axis": [ -0.531, -0.150, 0.834 ], "y_axis": [ 0.847, -0.117, 0.519 ], "z_axis": [ 0.020, 0.982, 0.189 ], "quaternion": [ -0.368, 0.315, 0.554, 0.678 ] } }, { "index": 19, "nt1": "///I/29", "nt2": "///J/152", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -124.108, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 54.084, "chi2": -121.999, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.105, "C1C1_dist": 10.590, "N1N9_dist": 8.840, "C6C8_dist": 9.779, "CNNC_torsion": -3.700, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.80],N3-N1(imino)[2.90],N4(amino)-O6(carbonyl)[2.91]", "interBase_angle": 6.923, "planarity": 0.249, "simple_Shear": 0.224, "simple_Stretch": -0.290, "simple_Buckle": 0.768, "simple_Propeller": 6.880, "bp_simpleParams": [ 0.224, -0.290, 0.949, 0.768, 6.880, 1.976 ], "bp_params": [ 0.219, -0.294, 0.949, 0.887, 6.866, 1.980 ], "frame": { "rmsd": null, "origin": [ 155.596, 151.408, 93.226 ], "x_axis": [ 0.013, -0.277, 0.961 ], "y_axis": [ 1.000, -0.009, -0.017 ], "z_axis": [ 0.013, 0.961, 0.276 ], "quaternion": [ 0.566, -0.432, -0.419, -0.564 ] } }, { "index": 20, "nt1": "///I/30", "nt2": "///J/151", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -139.489, "conf1": "anti", "pucker1": "----", "lambda1": 55.185, "chi2": -126.811, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.991, "C1C1_dist": 10.493, "N1N9_dist": 8.785, "C6C8_dist": 9.752, "CNNC_torsion": -4.346, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.77],N3-N1(imino)[2.90],N4(amino)-O6(carbonyl)[2.93]", "interBase_angle": 6.677, "planarity": 0.273, "simple_Shear": 0.235, "simple_Stretch": -0.323, "simple_Buckle": 1.862, "simple_Propeller": 6.412, "bp_simpleParams": [ 0.235, -0.323, 1.027, 1.862, 6.412, 3.065 ], "bp_params": [ 0.229, -0.327, 1.027, 1.980, 6.377, 3.069 ], "frame": { "rmsd": null, "origin": [ 155.322, 154.192, 95.147 ], "x_axis": [ 0.574, -0.299, 0.763 ], "y_axis": [ 0.819, 0.200, -0.538 ], "z_axis": [ 0.008, 0.933, 0.360 ], "quaternion": [ 0.730, -0.503, -0.258, -0.383 ] } }, { "index": 21, "nt1": "///I/31", "nt2": "///J/149", "bp": "T-C", "name": "--", "Saenger": "--", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -120.282, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 32.718, "chi2": -117.329, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 34.242, "C1C1_dist": 11.309, "N1N9_dist": 8.832, "C6C8_dist": 8.958, "CNNC_torsion": 42.298, "hbonds_num": 1, "hbonds_desc": "O4(carbonyl)-N4(amino)[2.69]", "interBase_angle": 5.204, "planarity": 0.379, "simple_Shear": -0.357, "simple_Stretch": -0.720, "simple_Buckle": 3.770, "simple_Propeller": 3.586, "bp_simpleParams": [ -0.357, -0.720, -1.822, 3.770, 3.586, -41.755 ], "bp_params": [ -0.330, -0.733, -1.822, 3.634, 3.725, -41.756 ], "frame": { "rmsd": null, "origin": [ 155.028, 158.685, 97.583 ], "x_axis": [ 0.995, -0.084, 0.056 ], "y_axis": [ 0.087, 0.430, -0.898 ], "z_axis": [ 0.052, 0.899, 0.435 ], "quaternion": [ 0.846, -0.531, -0.001, -0.051 ] } }, { "index": 22, "nt1": "///I/31", "nt2": "///J/150", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -120.282, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 51.309, "chi2": -122.631, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.381, "C1C1_dist": 10.496, "N1N9_dist": 8.694, "C6C8_dist": 9.571, "CNNC_torsion": -7.494, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.91],O4(carbonyl)-N6(amino)[2.85]", "interBase_angle": 8.243, "planarity": 0.335, "simple_Shear": -0.154, "simple_Stretch": -0.479, "simple_Buckle": 3.833, "simple_Propeller": 7.297, "bp_simpleParams": [ -0.154, -0.479, 1.409, 3.833, 7.297, -1.538 ], "bp_params": [ -0.145, -0.482, 1.409, 3.692, 7.370, -1.541 ], "frame": { "rmsd": null, "origin": [ 154.927, 157.155, 97.040 ], "x_axis": [ 0.905, -0.206, 0.371 ], "y_axis": [ 0.423, 0.363, -0.830 ], "z_axis": [ 0.037, 0.909, 0.416 ], "quaternion": [ 0.819, -0.531, -0.102, -0.192 ] } }, { "index": 23, "nt1": "///I/32", "nt2": "///J/149", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -118.985, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.015, "chi2": -117.329, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 54.175, "C1C1_dist": 10.547, "N1N9_dist": 8.796, "C6C8_dist": 9.715, "CNNC_torsion": -8.001, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.90],N1(imino)-N3[2.91],N2(amino)-O2(carbonyl)[2.78]", "interBase_angle": 9.408, "planarity": 0.253, "simple_Shear": -0.181, "simple_Stretch": -0.367, "simple_Buckle": 8.361, "simple_Propeller": 4.314, "bp_simpleParams": [ -0.181, -0.367, 1.300, 8.361, 4.314, 1.021 ], "bp_params": [ -0.177, -0.369, 1.300, 8.313, 4.407, 1.019 ], "frame": { "rmsd": null, "origin": [ 155.290, 160.133, 98.137 ], "x_axis": [ 0.957, 0.061, -0.284 ], "y_axis": [ -0.279, 0.459, -0.843 ], "z_axis": [ 0.079, 0.886, 0.456 ], "quaternion": [ 0.847, -0.510, 0.107, 0.100 ] } }, { "index": 24, "nt1": "///I/33", "nt2": "///J/148", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -109.300, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.292, "chi2": -110.656, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.329, "C1C1_dist": 10.529, "N1N9_dist": 8.770, "C6C8_dist": 9.680, "CNNC_torsion": -12.688, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.80],N3-N1(imino)[2.92],N4(amino)-O6(carbonyl)[2.91]", "interBase_angle": 3.370, "planarity": 0.319, "simple_Shear": 0.159, "simple_Stretch": -0.423, "simple_Buckle": 3.356, "simple_Propeller": -0.313, "bp_simpleParams": [ 0.159, -0.423, 1.275, 3.356, -0.313, -0.283 ], "bp_params": [ 0.154, -0.425, 1.275, 3.352, -0.350, -0.283 ], "frame": { "rmsd": null, "origin": [ 155.681, 163.646, 100.058 ], "x_axis": [ 0.594, 0.311, -0.742 ], "y_axis": [ -0.791, 0.392, -0.469 ], "z_axis": [ 0.145, 0.866, 0.479 ], "quaternion": [ 0.785, -0.425, 0.282, 0.351 ] } }, { "index": 25, "nt1": "///I/34", "nt2": "///J/147", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -105.608, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 54.235, "chi2": -102.577, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 51.512, "C1C1_dist": 10.536, "N1N9_dist": 8.759, "C6C8_dist": 9.669, "CNNC_torsion": -14.212, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.94],N1-N3(imino)[2.84]", "interBase_angle": 5.078, "planarity": 0.258, "simple_Shear": 0.164, "simple_Stretch": -0.340, "simple_Buckle": -3.031, "simple_Propeller": -4.074, "bp_simpleParams": [ 0.164, -0.340, 1.077, -3.031, -4.074, -2.306 ], "bp_params": [ 0.157, -0.343, 1.077, -3.116, -4.010, -2.307 ], "frame": { "rmsd": null, "origin": [ 153.762, 167.695, 102.313 ], "x_axis": [ -0.068, 0.690, -0.720 ], "y_axis": [ -0.991, 0.039, 0.130 ], "z_axis": [ 0.118, 0.722, 0.681 ], "quaternion": [ 0.643, -0.230, 0.326, 0.654 ] } }, { "index": 26, "nt1": "///I/35", "nt2": "///J/146", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -114.091, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.229, "chi2": -112.266, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.405, "C1C1_dist": 10.697, "N1N9_dist": 8.936, "C6C8_dist": 9.859, "CNNC_torsion": -8.701, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.93],N1(imino)-N3[2.91],N2(amino)-O2(carbonyl)[2.78]", "interBase_angle": 5.385, "planarity": 0.168, "simple_Shear": -0.187, "simple_Stretch": -0.176, "simple_Buckle": -4.385, "simple_Propeller": -3.126, "bp_simpleParams": [ -0.187, -0.176, 0.563, -4.385, -3.126, -0.242 ], "bp_params": [ -0.185, -0.179, 0.563, -4.343, -3.184, -0.242 ], "frame": { "rmsd": null, "origin": [ 154.057, 170.370, 104.939 ], "x_axis": [ -0.610, 0.591, -0.528 ], "y_axis": [ -0.786, -0.366, 0.498 ], "z_axis": [ 0.101, 0.718, 0.688 ], "quaternion": [ 0.422, -0.131, 0.373, 0.816 ] } }, { "index": 27, "nt1": "///I/36", "nt2": "///J/145", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -121.570, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 54.673, "chi2": -112.626, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.196, "C1C1_dist": 10.596, "N1N9_dist": 8.858, "C6C8_dist": 9.825, "CNNC_torsion": -2.355, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.99],N1-N3(imino)[2.83]", "interBase_angle": 5.974, "planarity": 0.091, "simple_Shear": 0.088, "simple_Stretch": -0.118, "simple_Buckle": -5.798, "simple_Propeller": -1.442, "bp_simpleParams": [ 0.088, -0.118, 0.092, -5.798, -1.442, 0.563 ], "bp_params": [ 0.086, -0.119, 0.092, -5.817, -1.362, 0.562 ], "frame": { "rmsd": null, "origin": [ 154.466, 172.709, 107.533 ], "x_axis": [ -0.971, 0.220, -0.099 ], "y_axis": [ -0.224, -0.674, 0.704 ], "z_axis": [ 0.088, 0.706, 0.703 ], "quaternion": [ 0.121, -0.003, 0.385, 0.915 ] } }, { "index": 28, "nt1": "///I/37", "nt2": "///J/144", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -127.961, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 52.026, "chi2": -120.474, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.661, "C1C1_dist": 10.690, "N1N9_dist": 8.907, "C6C8_dist": 9.833, "CNNC_torsion": -1.859, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.85],O4(carbonyl)-N6(amino)[2.95]", "interBase_angle": 6.456, "planarity": 0.080, "simple_Shear": -0.095, "simple_Stretch": -0.110, "simple_Buckle": -6.226, "simple_Propeller": 1.710, "bp_simpleParams": [ -0.095, -0.110, 0.264, -6.226, 1.710, -1.072 ], "bp_params": [ -0.094, -0.111, 0.264, -6.250, 1.619, -1.071 ], "frame": { "rmsd": null, "origin": [ 154.864, 175.861, 109.459 ], "x_axis": [ -0.946, -0.185, 0.265 ], "y_axis": [ 0.315, -0.708, 0.631 ], "z_axis": [ 0.071, 0.681, 0.729 ], "quaternion": [ -0.136, 0.091, 0.357, 0.920 ] } }, { "index": 29, "nt1": "///I/38", "nt2": "///J/143", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -127.435, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 52.633, "chi2": -133.390, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 54.372, "C1C1_dist": 10.619, "N1N9_dist": 8.862, "C6C8_dist": 9.806, "CNNC_torsion": -0.169, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.84],O4(carbonyl)-N6(amino)[2.95]", "interBase_angle": 9.097, "planarity": 0.145, "simple_Shear": -0.090, "simple_Stretch": -0.155, "simple_Buckle": -5.020, "simple_Propeller": 7.586, "bp_simpleParams": [ -0.090, -0.155, 0.573, -5.020, 7.586, 0.258 ], "bp_params": [ -0.087, -0.157, 0.573, -5.130, 7.512, 0.258 ], "frame": { "rmsd": null, "origin": [ 154.401, 178.433, 112.174 ], "x_axis": [ -0.629, -0.573, 0.526 ], "y_axis": [ 0.775, -0.512, 0.371 ], "z_axis": [ 0.057, 0.641, 0.766 ], "quaternion": [ -0.395, 0.171, 0.297, 0.852 ] } }, { "index": 30, "nt1": "///I/39", "nt2": "///J/142", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -144.124, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 54.764, "chi2": -129.010, "conf2": "anti", "pucker2": "----", "lambda2": 53.621, "C1C1_dist": 10.588, "N1N9_dist": 8.864, "C6C8_dist": 9.834, "CNNC_torsion": 3.462, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.79],N3-N1(imino)[2.89],N4(amino)-O6(carbonyl)[2.94]", "interBase_angle": 11.898, "planarity": 0.231, "simple_Shear": 0.257, "simple_Stretch": -0.209, "simple_Buckle": 0.717, "simple_Propeller": 11.877, "bp_simpleParams": [ 0.257, -0.209, 0.652, 0.717, 11.877, 3.338 ], "bp_params": [ 0.253, -0.214, 0.652, 0.963, 11.859, 3.356 ], "frame": { "rmsd": null, "origin": [ 154.293, 181.167, 114.219 ], "x_axis": [ -0.087, -0.832, 0.548 ], "y_axis": [ 0.996, -0.086, 0.029 ], "z_axis": [ 0.023, 0.548, 0.836 ], "quaternion": [ 0.645, -0.201, -0.203, -0.709 ] } }, { "index": 31, "nt1": "///I/40", "nt2": "///J/141", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -118.450, "conf1": "anti", "pucker1": "----", "lambda1": 50.382, "chi2": -124.490, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 51.713, "C1C1_dist": 10.696, "N1N9_dist": 8.842, "C6C8_dist": 9.680, "CNNC_torsion": -1.710, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.95],O4(carbonyl)-N6(amino)[2.83]", "interBase_angle": 12.459, "planarity": 0.307, "simple_Shear": -0.098, "simple_Stretch": -0.330, "simple_Buckle": 5.010, "simple_Propeller": 11.407, "bp_simpleParams": [ -0.098, -0.330, 1.161, 5.010, 11.407, -2.857 ], "bp_params": [ -0.094, -0.331, 1.161, 4.861, 11.471, -2.869 ], "frame": { "rmsd": null, "origin": [ 152.863, 183.040, 117.060 ], "x_axis": [ 0.310, -0.853, 0.420 ], "y_axis": [ 0.950, 0.263, -0.168 ], "z_axis": [ 0.033, 0.451, 0.892 ], "quaternion": [ 0.785, -0.197, -0.123, -0.574 ] } }, { "index": 32, "nt1": "///I/41", "nt2": "///J/140", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -134.744, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 57.303, "chi2": -127.924, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 55.887, "C1C1_dist": 10.183, "N1N9_dist": 8.556, "C6C8_dist": 9.576, "CNNC_torsion": -7.811, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.00],N1-N3(imino)[2.82]", "interBase_angle": 11.126, "planarity": 0.312, "simple_Shear": 0.133, "simple_Stretch": -0.474, "simple_Buckle": 8.579, "simple_Propeller": 7.084, "bp_simpleParams": [ 0.133, -0.474, 1.551, 8.579, 7.084, 4.831 ], "bp_params": [ 0.124, -0.476, 1.551, 8.727, 6.901, 4.826 ], "frame": { "rmsd": null, "origin": [ 154.287, 182.567, 120.528 ], "x_axis": [ 0.801, -0.575, 0.166 ], "y_axis": [ 0.597, 0.747, -0.293 ], "z_axis": [ 0.044, 0.334, 0.942 ], "quaternion": [ 0.934, -0.168, -0.033, -0.314 ] } }, { "index": 33, "nt1": "///I/42", "nt2": "///J/139", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -139.122, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 56.026, "chi2": -131.509, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 54.839, "C1C1_dist": 10.403, "N1N9_dist": 8.729, "C6C8_dist": 9.725, "CNNC_torsion": -4.256, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.77],N3-N1(imino)[2.92],N4(amino)-O6(carbonyl)[2.97]", "interBase_angle": 9.664, "planarity": 0.341, "simple_Shear": 0.238, "simple_Stretch": -0.330, "simple_Buckle": 8.315, "simple_Propeller": 4.924, "bp_simpleParams": [ 0.238, -0.330, 1.072, 8.315, 4.924, 4.028 ], "bp_params": [ 0.232, -0.335, 1.072, 8.415, 4.750, 4.020 ], "frame": { "rmsd": null, "origin": [ 153.681, 182.868, 124.215 ], "x_axis": [ 0.993, -0.117, 0.016 ], "y_axis": [ 0.117, 0.960, -0.255 ], "z_axis": [ 0.015, 0.255, 0.967 ], "quaternion": [ 0.990, -0.129, -0.000, -0.059 ] } }, { "index": 34, "nt1": "///I/45", "nt2": "///J/136", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -116.218, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 54.725, "chi2": -102.695, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 52.531, "C1C1_dist": 10.544, "N1N9_dist": 8.795, "C6C8_dist": 9.740, "CNNC_torsion": -11.882, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.98],N1-N3(imino)[2.83]", "interBase_angle": 8.347, "planarity": 0.216, "simple_Shear": 0.094, "simple_Stretch": -0.225, "simple_Buckle": -6.258, "simple_Propeller": -5.524, "bp_simpleParams": [ 0.094, -0.225, 0.692, -6.258, -5.524, -0.704 ], "bp_params": [ 0.091, -0.226, 0.692, -6.340, -5.429, -0.703 ], "frame": { "rmsd": null, "origin": [ 154.522, 187.333, 134.046 ], "x_axis": [ -0.198, 0.973, -0.118 ], "y_axis": [ -0.940, -0.154, 0.303 ], "z_axis": [ 0.277, 0.171, 0.946 ], "quaternion": [ 0.631, 0.052, 0.156, 0.758 ] } }, { "index": 35, "nt1": "///I/46", "nt2": "///J/135", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -100.879, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.710, "chi2": -106.466, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 51.031, "C1C1_dist": 10.621, "N1N9_dist": 8.820, "C6C8_dist": 9.715, "CNNC_torsion": -11.461, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.92],N1-N3(imino)[2.85]", "interBase_angle": 7.063, "planarity": 0.227, "simple_Shear": 0.139, "simple_Stretch": -0.254, "simple_Buckle": -6.419, "simple_Propeller": -2.947, "bp_simpleParams": [ 0.139, -0.254, 0.798, -6.419, -2.947, -2.667 ], "bp_params": [ 0.134, -0.256, 0.798, -6.474, -2.824, -2.663 ], "frame": { "rmsd": null, "origin": [ 156.066, 187.164, 137.280 ], "x_axis": [ -0.741, 0.670, 0.048 ], "y_axis": [ -0.630, -0.718, 0.296 ], "z_axis": [ 0.233, 0.189, 0.954 ], "quaternion": [ 0.352, 0.076, 0.131, 0.924 ] } }, { "index": 36, "nt1": "///I/47", "nt2": "///J/134", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -102.538, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 54.696, "chi2": -120.708, "conf2": "anti", "pucker2": "----", "lambda2": 52.423, "C1C1_dist": 10.579, "N1N9_dist": 8.827, "C6C8_dist": 9.776, "CNNC_torsion": -5.934, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.95],N1-N3(imino)[2.81]", "interBase_angle": 6.406, "planarity": 0.130, "simple_Shear": 0.109, "simple_Stretch": -0.166, "simple_Buckle": -6.138, "simple_Propeller": -1.833, "bp_simpleParams": [ 0.109, -0.166, 0.307, -6.138, -1.833, -0.248 ], "bp_params": [ 0.106, -0.168, 0.307, -6.166, -1.736, -0.248 ], "frame": { "rmsd": null, "origin": [ 156.656, 187.349, 140.966 ], "x_axis": [ -0.977, 0.153, 0.151 ], "y_axis": [ -0.122, -0.973, 0.197 ], "z_axis": [ 0.177, 0.174, 0.969 ], "quaternion": [ 0.070, 0.083, 0.094, 0.990 ] } }, { "index": 37, "nt1": "///I/48", "nt2": "///J/133", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -115.829, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 52.747, "chi2": -93.435, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.587, "C1C1_dist": 10.727, "N1N9_dist": 8.957, "C6C8_dist": 9.884, "CNNC_torsion": -0.378, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.92],N1(imino)-N3[2.89],N2(amino)-O2(carbonyl)[2.77]", "interBase_angle": 5.259, "planarity": 0.104, "simple_Shear": -0.205, "simple_Stretch": -0.134, "simple_Buckle": -4.530, "simple_Propeller": 2.673, "bp_simpleParams": [ -0.205, -0.134, 0.168, -4.530, 2.673, 0.336 ], "bp_params": [ -0.203, -0.137, 0.168, -4.572, 2.599, 0.336 ], "frame": { "rmsd": null, "origin": [ 157.793, 187.440, 144.247 ], "x_axis": [ -0.904, -0.382, 0.191 ], "y_axis": [ 0.401, -0.913, 0.072 ], "z_axis": [ 0.147, 0.142, 0.979 ], "quaternion": [ -0.201, 0.087, 0.055, 0.974 ] } }, { "index": 38, "nt1": "///I/49", "nt2": "///J/132", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -121.033, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 52.786, "chi2": -116.244, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 54.283, "C1C1_dist": 10.631, "N1N9_dist": 8.877, "C6C8_dist": 9.833, "CNNC_torsion": -1.142, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.84],O4(carbonyl)-N6(amino)[2.98]", "interBase_angle": 2.486, "planarity": 0.072, "simple_Shear": -0.078, "simple_Stretch": -0.126, "simple_Buckle": 1.176, "simple_Propeller": 2.191, "bp_simpleParams": [ -0.078, -0.126, 0.280, 1.176, 2.191, 0.161 ], "bp_params": [ -0.077, -0.127, 0.280, 1.150, 2.205, 0.161 ], "frame": { "rmsd": null, "origin": [ 157.667, 187.797, 148.105 ], "x_axis": [ -0.549, -0.826, 0.125 ], "y_axis": [ 0.826, -0.559, -0.072 ], "z_axis": [ 0.129, 0.064, 0.990 ], "quaternion": [ -0.469, 0.072, -0.002, 0.880 ] } }, { "index": 39, "nt1": "///I/50", "nt2": "///J/131", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -137.073, "conf1": "anti", "pucker1": "----", "lambda1": 53.466, "chi2": -116.729, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 54.332, "C1C1_dist": 10.597, "N1N9_dist": 8.860, "C6C8_dist": 9.815, "CNNC_torsion": 1.345, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.92],N1(imino)-N3[2.89],N2(amino)-O2(carbonyl)[2.79]", "interBase_angle": 11.706, "planarity": 0.221, "simple_Shear": -0.245, "simple_Stretch": -0.235, "simple_Buckle": 3.302, "simple_Propeller": 11.230, "bp_simpleParams": [ -0.245, -0.235, 0.798, 3.302, 11.230, 2.910 ], "bp_params": [ -0.241, -0.239, 0.798, 3.092, 11.290, 2.923 ], "frame": { "rmsd": null, "origin": [ 157.513, 187.398, 151.253 ], "x_axis": [ -0.055, -0.989, -0.139 ], "y_axis": [ 0.993, -0.040, -0.108 ], "z_axis": [ 0.102, -0.144, 0.984 ], "quaternion": [ 0.687, 0.013, 0.087, -0.721 ] } }, { "index": 40, "nt1": "///I/51", "nt2": "///J/130", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -157.266, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 52.096, "chi2": -125.835, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.986, "C1C1_dist": 10.382, "N1N9_dist": 8.606, "C6C8_dist": 9.493, "CNNC_torsion": -8.232, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.94],O4(carbonyl)-N6(amino)[2.84]", "interBase_angle": 11.940, "planarity": 0.398, "simple_Shear": -0.134, "simple_Stretch": -0.585, "simple_Buckle": 5.798, "simple_Propeller": 10.437, "bp_simpleParams": [ -0.134, -0.585, 1.589, 5.798, 10.437, -0.043 ], "bp_params": [ -0.125, -0.587, 1.589, 5.625, 10.531, -0.043 ], "frame": { "rmsd": null, "origin": [ 157.268, 185.540, 154.718 ], "x_axis": [ 0.453, -0.841, -0.296 ], "y_axis": [ 0.886, 0.461, 0.048 ], "z_axis": [ 0.096, -0.284, 0.954 ], "quaternion": [ 0.847, 0.098, 0.116, -0.510 ] } }, { "index": 41, "nt1": "///I/52", "nt2": "///J/129", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -148.468, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 52.109, "chi2": -139.463, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 49.208, "C1C1_dist": 10.620, "N1N9_dist": 8.754, "C6C8_dist": 9.519, "CNNC_torsion": -15.562, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.80],N1-N3(imino)[2.92]", "interBase_angle": 12.009, "planarity": 0.339, "simple_Shear": 0.357, "simple_Stretch": -0.521, "simple_Buckle": 11.338, "simple_Propeller": 3.957, "bp_simpleParams": [ 0.357, -0.521, 1.768, 11.338, 3.957, -6.697 ], "bp_params": [ 0.335, -0.535, 1.768, 11.495, 3.476, -6.666 ], "frame": { "rmsd": null, "origin": [ 157.145, 183.979, 157.544 ], "x_axis": [ 0.892, -0.351, -0.283 ], "y_axis": [ 0.433, 0.842, 0.321 ], "z_axis": [ 0.126, -0.410, 0.904 ], "quaternion": [ 0.954, 0.192, 0.107, -0.206 ] } }, { "index": 42, "nt1": "///I/53", "nt2": "///J/128", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -144.303, "conf1": "anti", "pucker1": "----", "lambda1": 53.322, "chi2": -120.911, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 55.230, "C1C1_dist": 10.314, "N1N9_dist": 8.589, "C6C8_dist": 9.545, "CNNC_torsion": -6.947, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.89],O4(carbonyl)-N6(amino)[2.94]", "interBase_angle": 11.188, "planarity": 0.364, "simple_Shear": -0.119, "simple_Stretch": -0.469, "simple_Buckle": 10.024, "simple_Propeller": 4.969, "bp_simpleParams": [ -0.119, -0.469, 1.336, 10.024, 4.969, 1.258 ], "bp_params": [ -0.112, -0.470, 1.336, 9.954, 5.108, 1.255 ], "frame": { "rmsd": null, "origin": [ 158.024, 181.160, 160.165 ], "x_axis": [ 0.996, 0.028, -0.089 ], "y_axis": [ 0.022, 0.861, 0.509 ], "z_axis": [ 0.091, -0.508, 0.856 ], "quaternion": [ 0.963, 0.264, 0.047, 0.002 ] } }, { "index": 43, "nt1": "///I/54", "nt2": "///J/127", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -120.046, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 48.570, "chi2": -131.219, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 52.714, "C1C1_dist": 10.561, "N1N9_dist": 8.694, "C6C8_dist": 9.499, "CNNC_torsion": -16.056, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.92],O4(carbonyl)-N6(amino)[2.86]", "interBase_angle": 7.588, "planarity": 0.382, "simple_Shear": -0.260, "simple_Stretch": -0.541, "simple_Buckle": 7.408, "simple_Propeller": -1.642, "bp_simpleParams": [ -0.260, -0.541, 1.510, 7.408, -1.642, -6.335 ], "bp_params": [ -0.243, -0.549, 1.510, 7.455, -1.415, -6.322 ], "frame": { "rmsd": null, "origin": [ 158.865, 179.126, 162.982 ], "x_axis": [ 0.785, 0.553, 0.279 ], "y_axis": [ -0.603, 0.580, 0.548 ], "z_axis": [ 0.141, -0.598, 0.789 ], "quaternion": [ 0.888, 0.322, -0.039, 0.325 ] } }, { "index": 44, "nt1": "///I/55", "nt2": "///J/126", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -104.678, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 50.223, "chi2": -104.597, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.310, "C1C1_dist": 10.568, "N1N9_dist": 8.746, "C6C8_dist": 9.601, "CNNC_torsion": -17.121, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.89],O4(carbonyl)-N6(amino)[2.93]", "interBase_angle": 3.778, "planarity": 0.319, "simple_Shear": -0.260, "simple_Stretch": -0.455, "simple_Buckle": 0.683, "simple_Propeller": -3.716, "bp_simpleParams": [ -0.260, -0.455, 1.440, 0.683, -3.716, -4.681 ], "bp_params": [ -0.246, -0.463, 1.440, 0.794, -3.694, -4.683 ], "frame": { "rmsd": null, "origin": [ 159.291, 176.902, 166.399 ], "x_axis": [ 0.268, 0.763, 0.589 ], "y_axis": [ -0.942, 0.080, 0.325 ], "z_axis": [ 0.201, -0.642, 0.740 ], "quaternion": [ 0.723, 0.335, -0.134, 0.590 ] } }, { "index": 45, "nt1": "///I/56", "nt2": "///J/125", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -106.984, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 52.427, "chi2": -109.367, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 51.931, "C1C1_dist": 10.686, "N1N9_dist": 8.880, "C6C8_dist": 9.761, "CNNC_torsion": -11.767, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.87],N1(imino)-N3[2.89],N2(amino)-O2(carbonyl)[2.80]", "interBase_angle": 5.037, "planarity": 0.234, "simple_Shear": -0.151, "simple_Stretch": -0.296, "simple_Buckle": -3.936, "simple_Propeller": -3.144, "bp_simpleParams": [ -0.151, -0.296, 0.885, -3.936, -3.144, -1.861 ], "bp_params": [ -0.148, -0.297, 0.885, -3.905, -3.182, -1.861 ], "frame": { "rmsd": null, "origin": [ 158.401, 173.631, 169.249 ], "x_axis": [ -0.407, 0.636, 0.656 ], "y_axis": [ -0.892, -0.431, -0.136 ], "z_axis": [ 0.196, -0.640, 0.743 ], "quaternion": [ 0.475, 0.265, -0.242, 0.803 ] } }, { "index": 46, "nt1": "///I/57", "nt2": "///J/124", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -112.040, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.210, "chi2": -107.161, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.108, "C1C1_dist": 10.649, "N1N9_dist": 8.879, "C6C8_dist": 9.792, "CNNC_torsion": -10.104, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.91],N1(imino)-N3[2.90],N2(amino)-O2(carbonyl)[2.78]", "interBase_angle": 3.995, "planarity": 0.226, "simple_Shear": -0.168, "simple_Stretch": -0.264, "simple_Buckle": -3.816, "simple_Propeller": -1.183, "bp_simpleParams": [ -0.168, -0.264, 0.851, -3.816, -1.183, -0.374 ], "bp_params": [ -0.165, -0.266, 0.851, -3.802, -1.228, -0.374 ], "frame": { "rmsd": null, "origin": [ 158.681, 171.537, 171.711 ], "x_axis": [ -0.875, 0.265, 0.405 ], "y_axis": [ -0.458, -0.724, -0.516 ], "z_axis": [ 0.156, -0.637, 0.755 ], "quaternion": [ 0.198, 0.153, -0.315, 0.916 ] } }, { "index": 47, "nt1": "///I/58", "nt2": "///J/123", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -108.273, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.560, "chi2": -102.260, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 52.125, "C1C1_dist": 10.675, "N1N9_dist": 8.890, "C6C8_dist": 9.812, "CNNC_torsion": -5.283, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.95],N1-N3(imino)[2.86]", "interBase_angle": 3.737, "planarity": 0.128, "simple_Shear": 0.089, "simple_Stretch": -0.148, "simple_Buckle": -3.737, "simple_Propeller": -0.064, "bp_simpleParams": [ 0.089, -0.148, 0.463, -3.737, -0.064, -1.334 ], "bp_params": [ 0.087, -0.149, 0.463, -3.737, -0.015, -1.333 ], "frame": { "rmsd": null, "origin": [ 159.544, 168.657, 173.751 ], "x_axis": [ -0.968, -0.243, -0.070 ], "y_axis": [ 0.228, -0.722, -0.653 ], "z_axis": [ 0.108, -0.648, 0.754 ], "quaternion": [ -0.127, 0.010, -0.351, 0.928 ] } }, { "index": 48, "nt1": "///I/59", "nt2": "///J/122", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -108.745, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.997, "chi2": -102.144, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 52.142, "C1C1_dist": 10.656, "N1N9_dist": 8.880, "C6C8_dist": 9.810, "CNNC_torsion": -7.226, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.96],N1-N3(imino)[2.85]", "interBase_angle": 1.278, "planarity": 0.126, "simple_Shear": 0.125, "simple_Stretch": -0.161, "simple_Buckle": -0.667, "simple_Propeller": -1.089, "bp_simpleParams": [ 0.125, -0.161, 0.573, -0.667, -1.089, -1.084 ], "bp_params": [ 0.122, -0.163, 0.573, -0.686, -1.078, -1.084 ], "frame": { "rmsd": null, "origin": [ 160.308, 166.019, 176.107 ], "x_axis": [ -0.679, -0.558, -0.478 ], "y_axis": [ 0.731, -0.456, -0.507 ], "z_axis": [ 0.064, -0.693, 0.718 ], "quaternion": [ -0.382, -0.122, -0.355, 0.845 ] } }, { "index": 49, "nt1": "///I/60", "nt2": "///J/121", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -126.175, "conf1": "anti", "pucker1": "----", "lambda1": 54.968, "chi2": -103.522, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 52.757, "C1C1_dist": 10.544, "N1N9_dist": 8.802, "C6C8_dist": 9.746, "CNNC_torsion": -3.321, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.94],N1-N3(imino)[2.87]", "interBase_angle": 8.291, "planarity": 0.225, "simple_Shear": 0.149, "simple_Stretch": -0.260, "simple_Buckle": 1.302, "simple_Propeller": 8.188, "bp_simpleParams": [ 0.149, -0.260, 1.002, 1.302, 8.188, 0.806 ], "bp_params": [ 0.144, -0.263, 1.002, 1.463, 8.161, 0.808 ], "frame": { "rmsd": null, "origin": [ 160.102, 163.158, 178.135 ], "x_axis": [ -0.234, -0.553, -0.799 ], "y_axis": [ 0.972, -0.117, -0.204 ], "z_axis": [ 0.020, -0.825, 0.565 ], "quaternion": [ 0.551, 0.282, 0.372, -0.692 ] } }, { "index": 50, "nt1": "///I/61", "nt2": "///J/120", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -154.563, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 55.652, "chi2": -108.531, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 54.489, "C1C1_dist": 10.412, "N1N9_dist": 8.723, "C6C8_dist": 9.697, "CNNC_torsion": -6.229, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.76],N3-N1(imino)[2.90],N4(amino)-O6(carbonyl)[2.93]", "interBase_angle": 7.811, "planarity": 0.326, "simple_Shear": 0.232, "simple_Stretch": -0.372, "simple_Buckle": 5.687, "simple_Propeller": 5.354, "bp_simpleParams": [ 0.232, -0.372, 1.113, 5.687, 5.354, 3.478 ], "bp_params": [ 0.225, -0.377, 1.113, 5.789, 5.244, 3.477 ], "frame": { "rmsd": null, "origin": [ 159.571, 159.990, 179.560 ], "x_axis": [ 0.256, -0.475, -0.842 ], "y_axis": [ 0.967, 0.139, 0.216 ], "z_axis": [ 0.014, -0.869, 0.495 ], "quaternion": [ 0.687, 0.394, 0.311, -0.524 ] } }, { "index": 51, "nt1": "///I/62", "nt2": "///J/118", "bp": "T-C", "name": "--", "Saenger": "--", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -162.427, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 35.949, "chi2": -120.697, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 33.631, "C1C1_dist": 11.993, "N1N9_dist": 9.550, "C6C8_dist": 9.755, "CNNC_torsion": 24.482, "hbonds_num": 1, "hbonds_desc": "O4(carbonyl)-N4(amino)[3.13]", "interBase_angle": 5.359, "planarity": 0.262, "simple_Shear": 0.107, "simple_Stretch": 0.016, "simple_Buckle": 1.323, "simple_Propeller": -5.193, "bp_simpleParams": [ 0.107, 0.016, -1.672, 1.323, -5.193, -36.963 ], "bp_params": [ 0.107, 0.015, -1.672, 1.267, -5.207, -36.997 ], "frame": { "rmsd": null, "origin": [ 158.677, 154.762, 180.412 ], "x_axis": [ 0.900, -0.135, -0.413 ], "y_axis": [ 0.434, 0.352, 0.829 ], "z_axis": [ 0.033, -0.926, 0.376 ], "quaternion": [ 0.811, 0.541, 0.138, -0.175 ] } }, { "index": 52, "nt1": "///I/62", "nt2": "///J/119", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -162.427, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 51.862, "chi2": -159.696, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.706, "C1C1_dist": 10.468, "N1N9_dist": 8.684, "C6C8_dist": 9.573, "CNNC_torsion": -12.694, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.90],O4(carbonyl)-N6(amino)[2.91]", "interBase_angle": 3.418, "planarity": 0.331, "simple_Shear": -0.141, "simple_Stretch": -0.489, "simple_Buckle": 3.075, "simple_Propeller": 1.492, "bp_simpleParams": [ -0.141, -0.489, 1.453, 3.075, 1.492, -2.194 ], "bp_params": [ -0.132, -0.492, 1.453, 3.048, 1.548, -2.194 ], "frame": { "rmsd": null, "origin": [ 158.919, 156.249, 179.906 ], "x_axis": [ 0.730, -0.284, -0.622 ], "y_axis": [ 0.684, 0.298, 0.666 ], "z_axis": [ -0.004, -0.911, 0.411 ], "quaternion": [ 0.781, 0.505, 0.198, -0.310 ] } }, { "index": 53, "nt1": "///I/63", "nt2": "///J/118", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -119.531, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 51.717, "chi2": -120.697, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 52.811, "C1C1_dist": 10.642, "N1N9_dist": 8.841, "C6C8_dist": 9.694, "CNNC_torsion": -10.730, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.86],N1(imino)-N3[2.91],N2(amino)-O2(carbonyl)[2.83]", "interBase_angle": 13.820, "planarity": 0.251, "simple_Shear": -0.132, "simple_Stretch": -0.349, "simple_Buckle": 13.600, "simple_Propeller": 2.458, "bp_simpleParams": [ -0.132, -0.349, 1.346, 13.600, 2.458, -1.740 ], "bp_params": [ -0.130, -0.350, 1.346, 13.585, 2.541, -1.728 ], "frame": { "rmsd": null, "origin": [ 158.619, 153.295, 180.755 ], "x_axis": [ 0.985, 0.042, -0.167 ], "y_axis": [ 0.150, 0.262, 0.953 ], "z_axis": [ 0.084, -0.964, 0.251 ], "quaternion": [ 0.790, 0.607, 0.079, -0.034 ] } }, { "index": 54, "nt1": "///I/64", "nt2": "///J/117", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -118.195, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.085, "chi2": -132.836, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.415, "C1C1_dist": 10.581, "N1N9_dist": 8.818, "C6C8_dist": 9.737, "CNNC_torsion": -10.665, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.77],N3-N1(imino)[2.90],N4(amino)-O6(carbonyl)[2.92]", "interBase_angle": 9.471, "planarity": 0.290, "simple_Shear": 0.176, "simple_Stretch": -0.309, "simple_Buckle": 8.504, "simple_Propeller": -4.169, "bp_simpleParams": [ 0.176, -0.309, 0.936, 8.504, -4.169, -0.665 ], "bp_params": [ 0.172, -0.311, 0.936, 8.458, -4.262, -0.663 ], "frame": { "rmsd": null, "origin": [ 159.701, 149.818, 180.880 ], "x_axis": [ 0.884, 0.145, 0.445 ], "y_axis": [ -0.460, 0.091, 0.883 ], "z_axis": [ 0.088, -0.985, 0.147 ], "quaternion": [ 0.728, 0.641, -0.122, 0.208 ] } }, { "index": 55, "nt1": "///I/65", "nt2": "///J/116", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -129.737, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 47.708, "chi2": -104.683, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 51.179, "C1C1_dist": 10.779, "N1N9_dist": 8.869, "C6C8_dist": 9.651, "CNNC_torsion": -23.837, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.87],O4(carbonyl)-N6(amino)[2.92]", "interBase_angle": 13.951, "planarity": 0.325, "simple_Shear": -0.252, "simple_Stretch": -0.344, "simple_Buckle": 2.770, "simple_Propeller": -13.673, "bp_simpleParams": [ -0.252, -0.344, 1.115, 2.770, -13.673, -8.851 ], "bp_params": [ -0.241, -0.351, 1.115, 3.170, -13.586, -8.910 ], "frame": { "rmsd": null, "origin": [ 159.184, 145.698, 181.669 ], "x_axis": [ 0.439, 0.113, 0.891 ], "y_axis": [ -0.895, -0.035, 0.445 ], "z_axis": [ 0.081, -0.993, 0.086 ], "quaternion": [ 0.610, 0.589, -0.332, 0.413 ] } }, { "index": 56, "nt1": "///I/66", "nt2": "///J/115", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -95.920, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 55.027, "chi2": -114.663, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 54.041, "C1C1_dist": 10.496, "N1N9_dist": 8.788, "C6C8_dist": 9.740, "CNNC_torsion": -10.044, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.72],N3-N1(imino)[2.89],N4(amino)-O6(carbonyl)[2.93]", "interBase_angle": 5.974, "planarity": 0.241, "simple_Shear": 0.181, "simple_Stretch": -0.350, "simple_Buckle": -5.849, "simple_Propeller": 1.216, "bp_simpleParams": [ 0.181, -0.350, 1.220, -5.849, 1.216, 1.430 ], "bp_params": [ 0.177, -0.353, 1.220, -5.832, 1.292, 1.428 ], "frame": { "rmsd": null, "origin": [ 157.881, 140.845, 182.755 ], "x_axis": [ -0.300, -0.167, 0.939 ], "y_axis": [ -0.949, -0.048, -0.312 ], "z_axis": [ 0.097, -0.985, -0.144 ], "quaternion": [ -0.356, -0.472, 0.591, -0.549 ] } }, { "index": 57, "nt1": "///I/67", "nt2": "///J/114", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -117.059, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 54.630, "chi2": -119.679, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.127, "C1C1_dist": 10.521, "N1N9_dist": 8.789, "C6C8_dist": 9.714, "CNNC_torsion": -8.349, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.76],N3-N1(imino)[2.89],N4(amino)-O6(carbonyl)[2.90]", "interBase_angle": 8.711, "planarity": 0.244, "simple_Shear": 0.200, "simple_Stretch": -0.363, "simple_Buckle": -7.584, "simple_Propeller": 4.286, "bp_simpleParams": [ 0.200, -0.363, 1.233, -7.584, 4.286, 1.222 ], "bp_params": [ 0.195, -0.365, 1.233, -7.527, 4.386, 1.220 ], "frame": { "rmsd": null, "origin": [ 156.975, 136.788, 181.409 ], "x_axis": [ -0.849, -0.088, 0.520 ], "y_axis": [ -0.527, 0.106, -0.843 ], "z_axis": [ 0.019, -0.990, -0.137 ], "quaternion": [ -0.173, -0.213, 0.723, -0.634 ] } }, { "index": 58, "nt1": "///I/68", "nt2": "///J/113", "bp": "A-T", "name": "~Wobble", "Saenger": "--", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -118.298, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 45.793, "chi2": -104.626, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 69.586, "C1C1_dist": 9.590, "N1N9_dist": 8.061, "C6C8_dist": 8.516, "CNNC_torsion": 9.639, "hbonds_num": 1, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.25]", "interBase_angle": 66.328, "planarity": 0.749, "simple_Shear": -1.614, "simple_Stretch": -0.509, "simple_Buckle": -64.141, "simple_Propeller": -16.893, "bp_simpleParams": [ -1.614, -0.509, -3.321, -64.141, -16.893, -1.510 ], "bp_params": [ -1.539, -0.704, -3.321, -62.187, -23.070, -1.329 ], "frame": { "rmsd": null, "origin": [ 154.854, 131.666, 181.387 ], "x_axis": [ -0.903, 0.409, -0.132 ], "y_axis": [ -0.004, -0.316, -0.949 ], "z_axis": [ -0.429, -0.856, 0.287 ], "quaternion": [ 0.130, -0.177, -0.570, 0.792 ] } }, { "index": 59, "nt1": "///I/70", "nt2": "///J/111", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -123.364, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 54.456, "chi2": -141.051, "conf2": "anti", "pucker2": "----", "lambda2": 54.481, "C1C1_dist": 10.436, "N1N9_dist": 8.726, "C6C8_dist": 9.678, "CNNC_torsion": 10.512, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.75],N3-N1(imino)[2.90],N4(amino)-O6(carbonyl)[2.92]", "interBase_angle": 4.855, "planarity": 0.323, "simple_Shear": 0.181, "simple_Stretch": -0.414, "simple_Buckle": -4.579, "simple_Propeller": -1.614, "bp_simpleParams": [ 0.181, -0.414, -1.215, -4.579, -1.614, 1.703 ], "bp_params": [ 0.175, -0.416, -1.215, -4.601, -1.552, 1.702 ], "frame": { "rmsd": null, "origin": [ 153.705, 125.035, 180.178 ], "x_axis": [ -0.186, 0.295, -0.937 ], "y_axis": [ 0.919, -0.284, -0.272 ], "z_axis": [ -0.347, -0.912, -0.219 ], "quaternion": [ 0.279, 0.574, 0.529, -0.559 ] } }, { "index": 60, "nt1": "///I/70", "nt2": "///J/112", "bp": "C-A", "name": "~Wobble", "Saenger": "--", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -123.364, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 68.721, "chi2": -81.145, "conf2": "--", "pucker2": "~C2'-endo", "lambda2": 43.774, "C1C1_dist": 11.021, "N1N9_dist": 9.446, "C6C8_dist": 10.312, "CNNC_torsion": 21.635, "hbonds_num": 1, "hbonds_desc": "N3-N6(amino)[3.80]", "interBase_angle": 47.918, "planarity": 0.515, "simple_Shear": 2.810, "simple_Stretch": 1.112, "simple_Buckle": -39.729, "simple_Propeller": 26.790, "bp_simpleParams": [ 2.810, 1.112, 0.940, -39.729, 26.790, 7.934 ], "bp_params": [ 2.998, 0.388, 0.940, -32.330, 35.368, 8.030 ], "frame": { "rmsd": null, "origin": [ 154.309, 126.157, 181.667 ], "x_axis": [ -0.361, 0.014, -0.932 ], "y_axis": [ 0.811, -0.489, -0.322 ], "z_axis": [ -0.460, -0.872, 0.165 ], "quaternion": [ -0.281, -0.491, -0.421, 0.710 ] } }, { "index": 61, "nt1": "///I/71", "nt2": "///J/110", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -121.563, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 55.326, "chi2": -104.990, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 54.201, "C1C1_dist": 10.537, "N1N9_dist": 8.832, "C6C8_dist": 9.831, "CNNC_torsion": 0.136, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.01],N1-N3(imino)[2.82]", "interBase_angle": 2.406, "planarity": 0.033, "simple_Shear": 0.080, "simple_Stretch": -0.123, "simple_Buckle": -2.250, "simple_Propeller": 0.850, "bp_simpleParams": [ 0.080, -0.123, 0.019, -2.250, 0.850, 1.704 ], "bp_params": [ 0.078, -0.124, 0.019, -2.240, 0.878, 1.704 ], "frame": { "rmsd": null, "origin": [ 152.396, 122.057, 178.967 ], "x_axis": [ 0.406, 0.220, -0.887 ], "y_axis": [ 0.847, -0.455, 0.275 ], "z_axis": [ -0.344, -0.863, -0.371 ], "quaternion": [ 0.381, 0.747, 0.357, -0.412 ] } }, { "index": 62, "nt1": "///I/72", "nt2": "///J/109", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -123.400, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.458, "chi2": -103.787, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 51.036, "C1C1_dist": 10.740, "N1N9_dist": 8.926, "C6C8_dist": 9.800, "CNNC_torsion": 2.019, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.89],N1-N3(imino)[2.88]", "interBase_angle": 15.235, "planarity": 0.206, "simple_Shear": 0.168, "simple_Stretch": -0.135, "simple_Buckle": 9.526, "simple_Propeller": 11.889, "bp_simpleParams": [ 0.168, -0.135, 0.664, 9.526, 11.889, -2.139 ], "bp_params": [ 0.165, -0.140, 0.664, 9.821, 11.647, -2.142 ], "frame": { "rmsd": null, "origin": [ 151.226, 118.987, 178.312 ], "x_axis": [ 0.887, 0.128, -0.444 ], "y_axis": [ 0.438, -0.540, 0.719 ], "z_axis": [ -0.148, -0.832, -0.535 ], "quaternion": [ 0.450, 0.861, 0.164, -0.172 ] } }, { "index": 63, "nt1": "///I/74", "nt2": "///J/107", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -90.380, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 56.170, "chi2": -85.603, "conf2": "--", "pucker2": "~C2'-endo", "lambda2": 54.942, "C1C1_dist": 10.422, "N1N9_dist": 8.752, "C6C8_dist": 9.779, "CNNC_torsion": -7.125, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.04],N1-N3(imino)[2.79]", "interBase_angle": 3.495, "planarity": 0.134, "simple_Shear": 0.063, "simple_Stretch": -0.188, "simple_Buckle": -2.230, "simple_Propeller": -2.690, "bp_simpleParams": [ 0.063, -0.188, 0.535, -2.230, -2.690, 2.868 ], "bp_params": [ 0.061, -0.189, 0.535, -2.261, -2.665, 2.868 ], "frame": { "rmsd": null, "origin": [ 150.740, 110.748, 174.901 ], "x_axis": [ 0.671, -0.521, 0.527 ], "y_axis": [ -0.741, -0.508, 0.440 ], "z_axis": [ 0.039, -0.686, -0.727 ], "quaternion": [ 0.330, 0.852, -0.370, 0.166 ] } }, { "index": 64, "nt1": "///I/75", "nt2": "///J/106", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -106.929, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 52.068, "chi2": -118.553, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 52.329, "C1C1_dist": 10.683, "N1N9_dist": 8.880, "C6C8_dist": 9.760, "CNNC_torsion": -15.044, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.88],N1(imino)-N3[2.88],N2(amino)-O2(carbonyl)[2.77]", "interBase_angle": 6.721, "planarity": 0.221, "simple_Shear": -0.154, "simple_Stretch": -0.306, "simple_Buckle": -0.451, "simple_Propeller": -6.706, "bp_simpleParams": [ -0.154, -0.306, 0.922, -0.451, -6.706, -2.407 ], "bp_params": [ -0.151, -0.308, 0.922, -0.379, -6.710, -2.412 ], "frame": { "rmsd": null, "origin": [ 147.638, 108.243, 172.112 ], "x_axis": [ 0.004, -0.858, 0.513 ], "y_axis": [ -0.985, 0.084, 0.148 ], "z_axis": [ -0.170, -0.506, -0.846 ], "quaternion": [ -0.246, -0.664, 0.694, -0.129 ] } }, { "index": 65, "nt1": "///I/76", "nt2": "///J/105", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -137.821, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.651, "chi2": -121.939, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.871, "C1C1_dist": 10.610, "N1N9_dist": 8.866, "C6C8_dist": 9.804, "CNNC_torsion": -8.233, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.92],N1(imino)-N3[2.88],N2(amino)-O2(carbonyl)[2.74]", "interBase_angle": 0.785, "planarity": 0.192, "simple_Shear": -0.180, "simple_Stretch": -0.258, "simple_Buckle": -0.260, "simple_Propeller": -0.740, "bp_simpleParams": [ -0.180, -0.258, 0.844, -0.260, -0.740, 0.477 ], "bp_params": [ -0.177, -0.261, 0.844, -0.250, -0.744, 0.477 ], "frame": { "rmsd": null, "origin": [ 147.023, 106.243, 169.349 ], "x_axis": [ -0.623, -0.650, 0.436 ], "y_axis": [ -0.767, 0.618, -0.174 ], "z_axis": [ -0.156, -0.442, -0.883 ], "quaternion": [ -0.167, -0.401, 0.884, -0.174 ] } }, { "index": 66, "nt1": "///I/77", "nt2": "///J/104", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -108.760, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.373, "chi2": -122.518, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 52.736, "C1C1_dist": 10.665, "N1N9_dist": 8.896, "C6C8_dist": 9.809, "CNNC_torsion": -8.503, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.77],N3-N1(imino)[2.89],N4(amino)-O6(carbonyl)[2.90]", "interBase_angle": 1.799, "planarity": 0.176, "simple_Shear": 0.175, "simple_Stretch": -0.251, "simple_Buckle": -1.779, "simple_Propeller": -0.273, "bp_simpleParams": [ 0.175, -0.251, 0.839, -1.779, -0.273, -0.371 ], "bp_params": [ 0.172, -0.253, 0.839, -1.782, -0.250, -0.371 ], "frame": { "rmsd": null, "origin": [ 147.222, 104.445, 166.325 ], "x_axis": [ -0.969, -0.115, 0.220 ], "y_axis": [ -0.197, 0.893, -0.403 ], "z_axis": [ -0.150, -0.434, -0.888 ], "quaternion": [ -0.095, -0.081, 0.968, -0.216 ] } }, { "index": 67, "nt1": "///I/78", "nt2": "///J/103", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -120.266, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 54.868, "chi2": -112.151, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.557, "C1C1_dist": 10.555, "N1N9_dist": 8.830, "C6C8_dist": 9.807, "CNNC_torsion": -2.737, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.00],N1-N3(imino)[2.84]", "interBase_angle": 2.634, "planarity": 0.119, "simple_Shear": 0.069, "simple_Stretch": -0.162, "simple_Buckle": -0.414, "simple_Propeller": 2.601, "bp_simpleParams": [ 0.069, -0.162, 0.543, -0.414, 2.601, 1.207 ], "bp_params": [ 0.067, -0.163, 0.543, -0.384, 2.606, 1.207 ], "frame": { "rmsd": null, "origin": [ 146.566, 103.232, 163.139 ], "x_axis": [ -0.898, 0.437, -0.047 ], "y_axis": [ 0.408, 0.787, -0.463 ], "z_axis": [ -0.165, -0.435, -0.885 ], "quaternion": [ -0.031, 0.224, 0.945, -0.238 ] } }, { "index": 68, "nt1": "///I/79", "nt2": "///J/102", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -102.035, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.273, "chi2": -128.448, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 55.038, "C1C1_dist": 10.441, "N1N9_dist": 8.715, "C6C8_dist": 9.685, "CNNC_torsion": -6.569, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.82],O4(carbonyl)-N6(amino)[2.95]", "interBase_angle": 3.233, "planarity": 0.221, "simple_Shear": -0.103, "simple_Stretch": -0.316, "simple_Buckle": 1.953, "simple_Propeller": 2.576, "bp_simpleParams": [ -0.103, -0.316, 0.978, 1.953, 2.576, 1.090 ], "bp_params": [ -0.098, -0.318, 0.978, 1.915, 2.605, 1.090 ], "frame": { "rmsd": null, "origin": [ 145.569, 100.758, 159.932 ], "x_axis": [ -0.531, 0.802, -0.272 ], "y_axis": [ 0.830, 0.428, -0.359 ], "z_axis": [ -0.172, -0.416, -0.893 ], "quaternion": [ 0.030, 0.483, 0.844, -0.229 ] } }, { "index": 69, "nt1": "///I/80", "nt2": "///J/101", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -122.361, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.775, "chi2": -165.806, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 54.304, "C1C1_dist": 10.591, "N1N9_dist": 8.855, "C6C8_dist": 9.811, "CNNC_torsion": -3.588, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.94],N1(imino)-N3[2.91],N2(amino)-O2(carbonyl)[2.78]", "interBase_angle": 7.375, "planarity": 0.227, "simple_Shear": -0.209, "simple_Stretch": -0.251, "simple_Buckle": 0.654, "simple_Propeller": 7.346, "bp_simpleParams": [ -0.209, -0.251, 0.894, 0.654, 7.346, 2.587 ], "bp_params": [ -0.205, -0.254, 0.894, 0.538, 7.355, 2.592 ], "frame": { "rmsd": null, "origin": [ 144.395, 99.789, 156.789 ], "x_axis": [ 0.026, 0.960, -0.280 ], "y_axis": [ 0.990, -0.062, -0.123 ], "z_axis": [ -0.136, -0.275, -0.952 ], "quaternion": [ 0.053, 0.714, 0.683, -0.146 ] } }, { "index": 70, "nt1": "///I/81", "nt2": "///J/99", "bp": "T-A", "name": "--", "Saenger": "--", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -125.550, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 37.756, "chi2": -127.831, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 39.391, "C1C1_dist": 12.091, "N1N9_dist": 9.794, "C6C8_dist": 10.008, "CNNC_torsion": 34.892, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[3.90],O4(carbonyl)-N6(amino)[3.10]", "interBase_angle": 6.988, "planarity": 0.402, "simple_Shear": -0.282, "simple_Stretch": 0.225, "simple_Buckle": 5.669, "simple_Propeller": 4.086, "bp_simpleParams": [ -0.282, 0.225, -2.067, 5.669, 4.086, -32.317 ], "bp_params": [ -0.288, 0.217, -2.067, 5.552, 4.244, -32.302 ], "frame": { "rmsd": null, "origin": [ 142.716, 99.192, 152.008 ], "x_axis": [ 0.768, 0.610, -0.195 ], "y_axis": [ 0.632, -0.772, 0.076 ], "z_axis": [ -0.104, -0.181, -0.978 ], "quaternion": [ 0.068, 0.938, 0.331, -0.080 ] } }, { "index": 71, "nt1": "///I/81", "nt2": "///J/100", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -125.550, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.026, "chi2": -120.431, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 54.751, "C1C1_dist": 10.429, "N1N9_dist": 8.689, "C6C8_dist": 9.635, "CNNC_torsion": -4.195, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.88],O4(carbonyl)-N6(amino)[2.92]", "interBase_angle": 10.691, "planarity": 0.306, "simple_Shear": -0.094, "simple_Stretch": -0.382, "simple_Buckle": 5.342, "simple_Propeller": 9.261, "bp_simpleParams": [ -0.094, -0.382, 1.180, 5.342, 9.261, 1.437 ], "bp_params": [ -0.090, -0.383, 1.180, 5.222, 9.329, 1.441 ], "frame": { "rmsd": null, "origin": [ 143.032, 99.261, 153.622 ], "x_axis": [ 0.548, 0.801, -0.239 ], "y_axis": [ 0.829, -0.559, 0.026 ], "z_axis": [ -0.113, -0.212, -0.971 ], "quaternion": [ 0.068, 0.877, 0.465, -0.101 ] } }, { "index": 72, "nt1": "///I/82", "nt2": "///J/99", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -120.330, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 52.155, "chi2": -127.831, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 54.049, "C1C1_dist": 10.441, "N1N9_dist": 8.670, "C6C8_dist": 9.574, "CNNC_torsion": -5.289, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.91],O4(carbonyl)-N6(amino)[2.88]", "interBase_angle": 14.737, "planarity": 0.352, "simple_Shear": -0.072, "simple_Stretch": -0.380, "simple_Buckle": 13.061, "simple_Propeller": 6.827, "bp_simpleParams": [ -0.072, -0.380, 1.107, 13.061, 6.827, -0.617 ], "bp_params": [ -0.069, -0.381, 1.107, 13.013, 6.917, -0.615 ], "frame": { "rmsd": null, "origin": [ 142.493, 99.274, 150.405 ], "x_axis": [ 0.915, 0.382, -0.129 ], "y_axis": [ 0.393, -0.917, 0.070 ], "z_axis": [ -0.092, -0.115, -0.989 ], "quaternion": [ 0.047, 0.977, 0.198, -0.057 ] } }, { "index": 73, "nt1": "///I/83", "nt2": "///J/98", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -113.690, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.698, "chi2": -114.965, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 54.822, "C1C1_dist": 10.417, "N1N9_dist": 8.696, "C6C8_dist": 9.638, "CNNC_torsion": -11.342, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.76],N3-N1(imino)[2.90],N4(amino)-O6(carbonyl)[2.93]", "interBase_angle": 11.402, "planarity": 0.373, "simple_Shear": 0.161, "simple_Stretch": -0.407, "simple_Buckle": 11.333, "simple_Propeller": -1.258, "bp_simpleParams": [ 0.161, -0.407, 1.154, 11.333, -1.258, 0.945 ], "bp_params": [ 0.156, -0.409, 1.154, 11.319, -1.374, 0.941 ], "frame": { "rmsd": null, "origin": [ 143.097, 98.985, 146.837 ], "x_axis": [ 0.955, -0.285, -0.085 ], "y_axis": [ -0.286, -0.958, -0.001 ], "z_axis": [ -0.081, 0.025, -0.996 ], "quaternion": [ -0.006, 0.989, -0.144, -0.042 ] } }, { "index": 74, "nt1": "///I/84", "nt2": "///J/97", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -89.276, "conf1": "--", "pucker1": "~C2'-endo", "lambda1": 53.258, "chi2": -103.344, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 50.339, "C1C1_dist": 10.625, "N1N9_dist": 8.807, "C6C8_dist": 9.671, "CNNC_torsion": -21.102, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.98],N1-N3(imino)[2.84]", "interBase_angle": 12.722, "planarity": 0.280, "simple_Shear": 0.311, "simple_Stretch": -0.339, "simple_Buckle": 7.820, "simple_Propeller": -10.035, "bp_simpleParams": [ 0.311, -0.339, 1.279, 7.820, -10.035, -5.140 ], "bp_params": [ 0.300, -0.349, 1.279, 7.491, -10.283, -5.150 ], "frame": { "rmsd": null, "origin": [ 141.200, 97.713, 142.685 ], "x_axis": [ 0.533, -0.837, -0.123 ], "y_axis": [ -0.842, -0.539, 0.018 ], "z_axis": [ -0.081, 0.095, -0.992 ], "quaternion": [ -0.022, 0.875, -0.480, -0.059 ] } }, { "index": 75, "nt1": "///I/85", "nt2": "///J/96", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -106.608, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.009, "chi2": -107.471, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.831, "C1C1_dist": 10.703, "N1N9_dist": 8.946, "C6C8_dist": 9.880, "CNNC_torsion": -2.910, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.92],N1(imino)-N3[2.89],N2(amino)-O2(carbonyl)[2.76]", "interBase_angle": 8.086, "planarity": 0.094, "simple_Shear": -0.223, "simple_Stretch": -0.138, "simple_Buckle": -5.175, "simple_Propeller": -6.214, "bp_simpleParams": [ -0.223, -0.138, -0.274, -5.175, -6.214, 0.753 ], "bp_params": [ -0.221, -0.142, -0.274, -5.073, -6.297, 0.754 ], "frame": { "rmsd": null, "origin": [ 138.556, 97.769, 138.403 ], "x_axis": [ -0.148, -0.952, -0.268 ], "y_axis": [ -0.988, 0.131, 0.080 ], "z_axis": [ -0.041, 0.277, -0.960 ], "quaternion": [ 0.076, -0.648, 0.748, 0.119 ] } }, { "index": 76, "nt1": "///I/86", "nt2": "///J/95", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -118.687, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.045, "chi2": -116.246, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.017, "C1C1_dist": 10.666, "N1N9_dist": 8.891, "C6C8_dist": 9.809, "CNNC_torsion": 5.052, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.79],N3-N1(imino)[2.90],N4(amino)-O6(carbonyl)[2.90]", "interBase_angle": 6.777, "planarity": 0.219, "simple_Shear": 0.184, "simple_Stretch": -0.220, "simple_Buckle": -6.637, "simple_Propeller": -1.369, "bp_simpleParams": [ 0.184, -0.220, -0.656, -6.637, -1.369, 0.149 ], "bp_params": [ 0.181, -0.223, -0.656, -6.656, -1.276, 0.149 ], "frame": { "rmsd": null, "origin": [ 138.337, 98.928, 134.976 ], "x_axis": [ -0.727, -0.670, -0.151 ], "y_axis": [ -0.681, 0.678, 0.277 ], "z_axis": [ -0.083, 0.304, -0.949 ], "quaternion": [ 0.019, -0.369, 0.916, 0.159 ] } }, { "index": 77, "nt1": "///I/87", "nt2": "///J/94", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -114.115, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.399, "chi2": -108.913, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 55.040, "C1C1_dist": 10.553, "N1N9_dist": 8.827, "C6C8_dist": 9.795, "CNNC_torsion": -2.928, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.81],O4(carbonyl)-N6(amino)[2.97]", "interBase_angle": 7.454, "planarity": 0.106, "simple_Shear": -0.103, "simple_Stretch": -0.153, "simple_Buckle": -6.949, "simple_Propeller": 2.698, "bp_simpleParams": [ -0.103, -0.153, 0.467, -6.949, 2.698, 0.706 ], "bp_params": [ -0.101, -0.154, 0.467, -6.991, 2.587, 0.705 ], "frame": { "rmsd": null, "origin": [ 137.317, 100.040, 131.560 ], "x_axis": [ -0.982, -0.172, 0.081 ], "y_axis": [ -0.134, 0.928, 0.349 ], "z_axis": [ -0.135, 0.332, -0.934 ], "quaternion": [ -0.055, -0.078, 0.980, 0.173 ] } }, { "index": 78, "nt1": "///I/88", "nt2": "///J/93", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -124.531, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.930, "chi2": -122.899, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 54.371, "C1C1_dist": 10.594, "N1N9_dist": 8.867, "C6C8_dist": 9.818, "CNNC_torsion": -5.891, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.93],N1(imino)-N3[2.88],N2(amino)-O2(carbonyl)[2.72]", "interBase_angle": 6.090, "planarity": 0.190, "simple_Shear": -0.203, "simple_Stretch": -0.207, "simple_Buckle": -6.074, "simple_Propeller": -0.447, "bp_simpleParams": [ -0.203, -0.207, 0.571, -6.074, -0.447, 1.150 ], "bp_params": [ -0.200, -0.210, 0.571, -6.066, -0.540, 1.149 ], "frame": { "rmsd": null, "origin": [ 136.587, 101.004, 128.644 ], "x_axis": [ -0.839, 0.340, 0.425 ], "y_axis": [ 0.464, 0.855, 0.233 ], "z_axis": [ -0.284, 0.393, -0.875 ], "quaternion": [ -0.188, 0.213, 0.944, 0.166 ] } }, { "index": 79, "nt1": "///I/89", "nt2": "///J/92", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -121.501, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 54.415, "chi2": -124.156, "conf2": "anti", "pucker2": "----", "lambda2": 52.432, "C1C1_dist": 10.616, "N1N9_dist": 8.856, "C6C8_dist": 9.800, "CNNC_torsion": -2.071, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.96],N1-N3(imino)[2.86]", "interBase_angle": 6.935, "planarity": 0.159, "simple_Shear": 0.100, "simple_Stretch": -0.155, "simple_Buckle": -5.913, "simple_Propeller": 3.623, "bp_simpleParams": [ 0.100, -0.155, 0.500, -5.913, 3.623, -0.108 ], "bp_params": [ 0.098, -0.156, 0.500, -5.864, 3.702, -0.108 ], "frame": { "rmsd": null, "origin": [ 135.698, 101.564, 125.232 ], "x_axis": [ -0.433, 0.743, 0.510 ], "y_axis": [ 0.855, 0.517, -0.027 ], "z_axis": [ -0.284, 0.425, -0.860 ], "quaternion": [ -0.237, 0.477, 0.838, 0.119 ] } }, { "index": 80, "nt1": "///I/90", "nt2": "///J/91", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -121.246, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.994, "chi2": -117.071, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 51.926, "C1C1_dist": 10.639, "N1N9_dist": 8.860, "C6C8_dist": 9.786, "CNNC_torsion": -2.166, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.94],N1-N3(imino)[2.87]", "interBase_angle": 7.182, "planarity": 0.183, "simple_Shear": 0.117, "simple_Stretch": -0.190, "simple_Buckle": -3.112, "simple_Propeller": 6.473, "bp_simpleParams": [ 0.117, -0.190, 0.699, -3.112, 6.473, -0.508 ], "bp_params": [ 0.114, -0.192, 0.699, -3.010, 6.521, -0.509 ], "frame": { "rmsd": null, "origin": [ 134.603, 102.558, 121.894 ], "x_axis": [ 0.103, 0.872, 0.479 ], "y_axis": [ 0.963, 0.033, -0.268 ], "z_axis": [ -0.249, 0.488, -0.836 ], "quaternion": [ -0.274, 0.690, 0.664, 0.083 ] } }, { "index": 81, "nt1": "///I/91", "nt2": "///J/90", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -132.567, "conf1": "anti", "pucker1": "----", "lambda1": 52.795, "chi2": -122.489, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 54.618, "C1C1_dist": 10.500, "N1N9_dist": 8.753, "C6C8_dist": 9.693, "CNNC_torsion": -4.346, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.88],O4(carbonyl)-N6(amino)[2.93]", "interBase_angle": 8.715, "planarity": 0.268, "simple_Shear": -0.107, "simple_Stretch": -0.326, "simple_Buckle": 2.319, "simple_Propeller": 8.401, "bp_simpleParams": [ -0.107, -0.326, 1.112, 2.319, 8.401, 0.812 ], "bp_params": [ -0.102, -0.328, 1.112, 2.192, 8.435, 0.814 ], "frame": { "rmsd": null, "origin": [ 132.824, 104.769, 119.659 ], "x_axis": [ 0.575, 0.746, 0.336 ], "y_axis": [ 0.794, -0.410, -0.450 ], "z_axis": [ -0.198, 0.525, -0.828 ], "quaternion": [ -0.291, 0.839, 0.459, 0.041 ] } }, { "index": 82, "nt1": "///I/92", "nt2": "///J/89", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -118.443, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 52.576, "chi2": -118.398, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 54.519, "C1C1_dist": 10.382, "N1N9_dist": 8.629, "C6C8_dist": 9.555, "CNNC_torsion": -5.608, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.89],O4(carbonyl)-N6(amino)[2.88]", "interBase_angle": 11.503, "planarity": 0.348, "simple_Shear": -0.104, "simple_Stretch": -0.471, "simple_Buckle": 7.435, "simple_Propeller": 8.777, "bp_simpleParams": [ -0.104, -0.471, 1.314, 7.435, 8.777, 0.734 ], "bp_params": [ -0.098, -0.472, 1.314, 7.321, 8.872, 0.735 ], "frame": { "rmsd": null, "origin": [ 132.212, 107.235, 117.323 ], "x_axis": [ 0.920, 0.384, 0.084 ], "y_axis": [ 0.354, -0.717, -0.600 ], "z_axis": [ -0.171, 0.582, -0.795 ], "quaternion": [ -0.319, 0.926, 0.199, -0.024 ] } }, { "index": 83, "nt1": "///I/93", "nt2": "///J/88", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -101.188, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 54.650, "chi2": -122.355, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 54.133, "C1C1_dist": 10.387, "N1N9_dist": 8.673, "C6C8_dist": 9.628, "CNNC_torsion": -6.960, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.78],N3-N1(imino)[2.89],N4(amino)-O6(carbonyl)[2.90]", "interBase_angle": 12.097, "planarity": 0.379, "simple_Shear": 0.207, "simple_Stretch": -0.405, "simple_Buckle": 11.546, "simple_Propeller": 3.611, "bp_simpleParams": [ 0.207, -0.405, 1.104, 11.546, 3.611, 2.388 ], "bp_params": [ 0.200, -0.409, 1.104, 11.609, 3.403, 2.377 ], "frame": { "rmsd": null, "origin": [ 132.030, 109.181, 114.047 ], "x_axis": [ 0.937, -0.179, -0.298 ], "y_axis": [ -0.329, -0.736, -0.592 ], "z_axis": [ -0.114, 0.653, -0.749 ], "quaternion": [ -0.337, 0.925, -0.137, -0.111 ] } }, { "index": 84, "nt1": "///I/94", "nt2": "///J/87", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -87.582, "conf1": "--", "pucker1": "~C2'-endo", "lambda1": 55.399, "chi2": -76.776, "conf2": "--", "pucker2": "~C2'-endo", "lambda2": 53.918, "C1C1_dist": 10.549, "N1N9_dist": 8.841, "C6C8_dist": 9.837, "CNNC_torsion": -7.925, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.04],N1-N3(imino)[2.83]", "interBase_angle": 13.470, "planarity": 0.176, "simple_Shear": 0.056, "simple_Stretch": -0.115, "simple_Buckle": -4.116, "simple_Propeller": -12.826, "bp_simpleParams": [ 0.056, -0.115, -0.238, -4.116, -12.826, 2.284 ], "bp_params": [ 0.055, -0.116, -0.238, -4.261, -12.778, 2.297 ], "frame": { "rmsd": null, "origin": [ 130.894, 110.824, 110.020 ], "x_axis": [ 0.506, -0.661, -0.555 ], "y_axis": [ -0.849, -0.264, -0.459 ], "z_axis": [ 0.156, 0.703, -0.694 ], "quaternion": [ -0.370, 0.785, -0.481, -0.127 ] } }, { "index": 85, "nt1": "///I/95", "nt2": "///J/86", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -100.785, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 54.107, "chi2": -95.057, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 55.592, "C1C1_dist": 10.554, "N1N9_dist": 8.856, "C6C8_dist": 9.821, "CNNC_torsion": -1.005, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.96],N1(imino)-N3[2.91],N2(amino)-O2(carbonyl)[2.76]", "interBase_angle": 14.566, "planarity": 0.208, "simple_Shear": -0.267, "simple_Stretch": -0.202, "simple_Buckle": -10.672, "simple_Propeller": -9.913, "bp_simpleParams": [ -0.267, -0.202, -0.924, -10.672, -9.913, 3.422 ], "bp_params": [ -0.263, -0.207, -0.924, -10.499, -10.096, 3.421 ], "frame": { "rmsd": null, "origin": [ 128.561, 113.771, 107.200 ], "x_axis": [ -0.161, -0.654, -0.739 ], "y_axis": [ -0.980, 0.196, 0.040 ], "z_axis": [ 0.119, 0.730, -0.673 ], "quaternion": [ 0.301, -0.573, 0.712, 0.270 ] } }, { "index": 86, "nt1": "///I/96", "nt2": "///J/85", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -128.198, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 53.621, "chi2": -98.715, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.623, "C1C1_dist": 10.544, "N1N9_dist": 8.792, "C6C8_dist": 9.733, "CNNC_torsion": 1.457, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.82],N3-N1(imino)[2.91],N4(amino)-O6(carbonyl)[2.91]", "interBase_angle": 11.622, "planarity": 0.327, "simple_Shear": 0.186, "simple_Stretch": -0.289, "simple_Buckle": -10.409, "simple_Propeller": -5.169, "bp_simpleParams": [ 0.186, -0.289, -0.890, -10.409, -5.169, 1.817 ], "bp_params": [ 0.182, -0.292, -0.890, -10.491, -4.999, 1.812 ], "frame": { "rmsd": null, "origin": [ 128.621, 116.627, 105.355 ], "x_axis": [ -0.732, -0.417, -0.538 ], "y_axis": [ -0.679, 0.505, 0.533 ], "z_axis": [ 0.050, 0.756, -0.653 ], "quaternion": [ 0.173, -0.323, 0.850, 0.379 ] } }, { "index": 87, "nt1": "///I/97", "nt2": "///J/84", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -110.850, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 52.267, "chi2": -111.246, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.583, "C1C1_dist": 10.672, "N1N9_dist": 8.892, "C6C8_dist": 9.816, "CNNC_torsion": -2.564, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.85],O4(carbonyl)-N6(amino)[2.95]", "interBase_angle": 9.118, "planarity": 0.110, "simple_Shear": -0.083, "simple_Stretch": -0.105, "simple_Buckle": -9.118, "simple_Propeller": -0.003, "bp_simpleParams": [ -0.083, -0.105, 0.160, -9.118, -0.003, -1.061 ], "bp_params": [ -0.082, -0.106, 0.160, -9.117, -0.119, -1.058 ], "frame": { "rmsd": null, "origin": [ 127.504, 120.181, 103.419 ], "x_axis": [ -0.992, -0.083, -0.092 ], "y_axis": [ -0.124, 0.629, 0.768 ], "z_axis": [ -0.006, 0.773, -0.634 ], "quaternion": [ 0.024, -0.058, 0.902, 0.427 ] } }, { "index": 88, "nt1": "///I/98", "nt2": "///J/83", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -118.235, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 52.477, "chi2": -125.098, "conf2": "anti", "pucker2": "----", "lambda2": 52.741, "C1C1_dist": 10.742, "N1N9_dist": 8.948, "C6C8_dist": 9.856, "CNNC_torsion": -1.343, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.90],N1(imino)-N3[2.90],N2(amino)-O2(carbonyl)[2.80]", "interBase_angle": 7.581, "planarity": 0.157, "simple_Shear": -0.182, "simple_Stretch": -0.154, "simple_Buckle": -6.678, "simple_Propeller": 3.588, "bp_simpleParams": [ -0.182, -0.154, 0.290, -6.678, 3.588, -0.179 ], "bp_params": [ -0.180, -0.157, 0.290, -6.729, 3.491, -0.178 ], "frame": { "rmsd": null, "origin": [ 127.876, 123.047, 101.422 ], "x_axis": [ -0.909, 0.176, 0.377 ], "y_axis": [ 0.409, 0.537, 0.737 ], "z_axis": [ -0.072, 0.825, -0.561 ], "quaternion": [ -0.130, 0.169, 0.867, 0.450 ] } }, { "index": 89, "nt1": "///I/99", "nt2": "///J/82", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -123.007, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.510, "chi2": -107.896, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 51.645, "C1C1_dist": 10.645, "N1N9_dist": 8.849, "C6C8_dist": 9.750, "CNNC_torsion": -3.536, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.89],N1-N3(imino)[2.87]", "interBase_angle": 7.381, "planarity": 0.207, "simple_Shear": 0.125, "simple_Stretch": -0.229, "simple_Buckle": -4.477, "simple_Propeller": 5.868, "bp_simpleParams": [ 0.125, -0.229, 0.787, -4.477, 5.868, -1.537 ], "bp_params": [ 0.122, -0.231, 0.787, -4.382, 5.940, -1.538 ], "frame": { "rmsd": null, "origin": [ 127.444, 125.813, 99.609 ], "x_axis": [ -0.500, 0.373, 0.782 ], "y_axis": [ 0.859, 0.329, 0.392 ], "z_axis": [ -0.111, 0.867, -0.485 ], "quaternion": [ -0.294, 0.405, 0.761, 0.414 ] } }, { "index": 90, "nt1": "///I/100", "nt2": "///J/81", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -122.867, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 54.023, "chi2": -111.543, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 51.591, "C1C1_dist": 10.566, "N1N9_dist": 8.779, "C6C8_dist": 9.673, "CNNC_torsion": -6.463, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.88],N1-N3(imino)[2.89]", "interBase_angle": 7.543, "planarity": 0.272, "simple_Shear": 0.173, "simple_Stretch": -0.358, "simple_Buckle": -0.464, "simple_Propeller": 7.529, "bp_simpleParams": [ 0.173, -0.358, 1.217, -0.464, 7.529, -1.142 ], "bp_params": [ 0.165, -0.361, 1.217, -0.300, 7.537, -1.144 ], "frame": { "rmsd": null, "origin": [ 126.707, 128.946, 98.043 ], "x_axis": [ 0.039, 0.403, 0.915 ], "y_axis": [ 0.995, 0.070, -0.073 ], "z_axis": [ -0.093, 0.913, -0.398 ], "quaternion": [ -0.422, 0.585, 0.598, 0.351 ] } }, { "index": 91, "nt1": "///I/101", "nt2": "///J/79", "bp": "C-T", "name": "--", "Saenger": "--", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -121.550, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 36.164, "chi2": -120.817, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 34.567, "C1C1_dist": 11.763, "N1N9_dist": 9.343, "C6C8_dist": 9.561, "CNNC_torsion": 36.139, "hbonds_num": 1, "hbonds_desc": "N4(amino)-O4(carbonyl)[3.18]", "interBase_angle": 4.061, "planarity": 0.350, "simple_Shear": 0.154, "simple_Stretch": -0.234, "simple_Buckle": 3.533, "simple_Propeller": 2.002, "bp_simpleParams": [ 0.154, -0.234, -1.894, 3.533, 2.002, -37.706 ], "bp_params": [ 0.150, -0.237, -1.894, 3.566, 1.943, -37.694 ], "frame": { "rmsd": null, "origin": [ 125.758, 133.754, 96.665 ], "x_axis": [ 0.828, 0.197, 0.526 ], "y_axis": [ 0.560, -0.222, -0.798 ], "z_axis": [ -0.040, 0.955, -0.294 ], "quaternion": [ 0.573, -0.765, -0.247, -0.158 ] } }, { "index": 92, "nt1": "///I/101", "nt2": "///J/80", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -121.550, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 54.559, "chi2": -122.109, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.268, "C1C1_dist": 10.536, "N1N9_dist": 8.800, "C6C8_dist": 9.749, "CNNC_torsion": -4.372, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.80],N3-N1(imino)[2.91],N4(amino)-O6(carbonyl)[2.92]", "interBase_angle": 6.848, "planarity": 0.279, "simple_Shear": 0.230, "simple_Stretch": -0.329, "simple_Buckle": 1.634, "simple_Propeller": 6.651, "bp_simpleParams": [ 0.230, -0.329, 1.058, 1.634, 6.651, 2.500 ], "bp_params": [ 0.224, -0.334, 1.058, 1.753, 6.620, 2.504 ], "frame": { "rmsd": null, "origin": [ 125.896, 132.335, 97.062 ], "x_axis": [ 0.583, 0.291, 0.759 ], "y_axis": [ 0.810, -0.133, -0.571 ], "z_axis": [ -0.065, 0.947, -0.313 ], "quaternion": [ 0.533, -0.712, -0.386, -0.243 ] } }, { "index": 93, "nt1": "///I/102", "nt2": "///J/79", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -125.868, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 54.163, "chi2": -120.817, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 52.614, "C1C1_dist": 10.466, "N1N9_dist": 8.708, "C6C8_dist": 9.623, "CNNC_torsion": -8.556, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.89],N1-N3(imino)[2.85]", "interBase_angle": 7.304, "planarity": 0.267, "simple_Shear": 0.167, "simple_Stretch": -0.410, "simple_Buckle": 5.248, "simple_Propeller": 5.080, "bp_simpleParams": [ 0.167, -0.410, 1.341, 5.248, 5.080, -0.445 ], "bp_params": [ 0.158, -0.414, 1.341, 5.359, 4.962, -0.445 ], "frame": { "rmsd": null, "origin": [ 125.740, 135.323, 96.281 ], "x_axis": [ 0.964, 0.080, 0.254 ], "y_axis": [ 0.266, -0.262, -0.928 ], "z_axis": [ -0.008, 0.962, -0.274 ], "quaternion": [ 0.598, -0.790, -0.110, -0.078 ] } }, { "index": 94, "nt1": "///I/103", "nt2": "///J/77", "bp": "T-C", "name": "--", "Saenger": "--", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -109.171, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 30.154, "chi2": -120.161, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 36.264, "C1C1_dist": 11.365, "N1N9_dist": 8.884, "C6C8_dist": 8.995, "CNNC_torsion": 36.487, "hbonds_num": 1, "hbonds_desc": "O4(carbonyl)-N4(amino)[2.60]", "interBase_angle": 2.132, "planarity": 0.331, "simple_Shear": -0.776, "simple_Stretch": -0.614, "simple_Buckle": 2.122, "simple_Propeller": 0.208, "bp_simpleParams": [ -0.776, -0.614, -1.715, 2.122, 0.208, -41.908 ], "bp_params": [ -0.722, -0.676, -1.715, 2.098, 0.381, -41.902 ], "frame": { "rmsd": null, "origin": [ 125.858, 140.780, 95.510 ], "x_axis": [ 0.813, -0.155, -0.561 ], "y_axis": [ -0.581, -0.162, -0.797 ], "z_axis": [ 0.033, 0.975, -0.222 ], "quaternion": [ 0.598, -0.741, 0.248, 0.178 ] } }, { "index": 95, "nt1": "///I/103", "nt2": "///J/78", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -109.171, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 51.965, "chi2": -122.572, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 54.153, "C1C1_dist": 10.426, "N1N9_dist": 8.656, "C6C8_dist": 9.559, "CNNC_torsion": -11.164, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.89],O4(carbonyl)-N6(amino)[2.90]", "interBase_angle": 5.639, "planarity": 0.337, "simple_Shear": -0.155, "simple_Stretch": -0.495, "simple_Buckle": 4.482, "simple_Propeller": 3.423, "bp_simpleParams": [ -0.155, -0.495, 1.430, 4.482, 3.423, -1.195 ], "bp_params": [ -0.145, -0.498, 1.430, 4.415, 3.509, -1.195 ], "frame": { "rmsd": null, "origin": [ 125.733, 139.299, 96.091 ], "x_axis": [ 0.965, -0.068, -0.254 ], "y_axis": [ -0.263, -0.228, -0.938 ], "z_axis": [ 0.006, 0.971, -0.238 ], "quaternion": [ 0.612, -0.780, 0.106, 0.079 ] } }, { "index": 96, "nt1": "///I/104", "nt2": "///J/77", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -115.382, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.266, "chi2": -120.161, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.842, "C1C1_dist": 10.534, "N1N9_dist": 8.784, "C6C8_dist": 9.695, "CNNC_torsion": -12.906, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.92],N1(imino)-N3[2.91],N2(amino)-O2(carbonyl)[2.77]", "interBase_angle": 4.924, "planarity": 0.281, "simple_Shear": -0.144, "simple_Stretch": -0.420, "simple_Buckle": 4.921, "simple_Propeller": -0.171, "bp_simpleParams": [ -0.144, -0.420, 1.384, 4.921, -0.171, -0.218 ], "bp_params": [ -0.140, -0.421, 1.384, 4.923, -0.124, -0.218 ], "frame": { "rmsd": null, "origin": [ 126.157, 142.210, 94.874 ], "x_axis": [ 0.553, -0.205, -0.808 ], "y_axis": [ -0.831, -0.072, -0.551 ], "z_axis": [ 0.054, 0.976, -0.210 ], "quaternion": [ 0.564, -0.677, 0.382, 0.278 ] } }, { "index": 97, "nt1": "///I/105", "nt2": "///J/76", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -109.938, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 52.182, "chi2": -111.551, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 51.830, "C1C1_dist": 10.782, "N1N9_dist": 8.970, "C6C8_dist": 9.850, "CNNC_torsion": -18.136, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.82],N3-N1(imino)[2.89],N4(amino)-O6(carbonyl)[2.93]", "interBase_angle": 13.629, "planarity": 0.208, "simple_Shear": 0.134, "simple_Stretch": -0.192, "simple_Buckle": -2.250, "simple_Propeller": -13.442, "bp_simpleParams": [ 0.134, -0.192, 0.622, -2.250, -13.442, -2.527 ], "bp_params": [ 0.132, -0.193, 0.622, -2.376, -13.421, -2.544 ], "frame": { "rmsd": null, "origin": [ 125.307, 146.399, 94.745 ], "x_axis": [ -0.168, -0.043, -0.985 ], "y_axis": [ -0.983, 0.087, 0.163 ], "z_axis": [ 0.079, 0.995, -0.057 ], "quaternion": [ 0.464, -0.448, 0.573, 0.506 ] } }, { "index": 98, "nt1": "///I/106", "nt2": "///J/75", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -77.342, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.562, "chi2": -92.425, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.338, "C1C1_dist": 10.688, "N1N9_dist": 8.932, "C6C8_dist": 9.872, "CNNC_torsion": -9.457, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.77],N3-N1(imino)[2.88],N4(amino)-O6(carbonyl)[2.93]", "interBase_angle": 12.810, "planarity": 0.182, "simple_Shear": 0.159, "simple_Stretch": -0.134, "simple_Buckle": -6.802, "simple_Propeller": -10.855, "bp_simpleParams": [ 0.159, -0.134, 0.068, -6.802, -10.855, 0.796 ], "bp_params": [ 0.157, -0.136, 0.068, -6.943, -10.765, 0.798 ], "frame": { "rmsd": null, "origin": [ 124.748, 150.232, 95.522 ], "x_axis": [ -0.764, 0.040, -0.644 ], "y_axis": [ -0.637, 0.113, 0.762 ], "z_axis": [ 0.103, 0.993, -0.060 ], "quaternion": [ 0.269, -0.214, 0.696, 0.631 ] } }, { "index": 99, "nt1": "///I/107", "nt2": "///J/74", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -96.687, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.818, "chi2": -100.706, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 54.782, "C1C1_dist": 10.523, "N1N9_dist": 8.796, "C6C8_dist": 9.757, "CNNC_torsion": 0.505, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.88],O4(carbonyl)-N6(amino)[2.99]", "interBase_angle": 12.767, "planarity": 0.240, "simple_Shear": -0.046, "simple_Stretch": -0.162, "simple_Buckle": -12.201, "simple_Propeller": -3.759, "bp_simpleParams": [ -0.046, -0.162, -0.562, -12.201, -3.759, 0.777 ], "bp_params": [ -0.045, -0.162, -0.562, -12.176, -3.839, 0.773 ], "frame": { "rmsd": null, "origin": [ 124.281, 154.323, 97.814 ], "x_axis": [ -0.993, 0.090, -0.076 ], "y_axis": [ -0.072, 0.046, 0.996 ], "z_axis": [ 0.094, 0.995, -0.039 ], "quaternion": [ 0.059, 0.006, 0.721, 0.691 ] } }, { "index": 100, "nt1": "///I/108", "nt2": "///J/73", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -89.929, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 51.111, "chi2": -94.032, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.066, "C1C1_dist": 10.751, "N1N9_dist": 8.935, "C6C8_dist": 9.834, "CNNC_torsion": 8.791, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.88],O4(carbonyl)-N6(amino)[2.97]", "interBase_angle": 10.218, "planarity": 0.172, "simple_Shear": -0.085, "simple_Stretch": -0.111, "simple_Buckle": -6.080, "simple_Propeller": 8.212, "bp_simpleParams": [ -0.085, -0.111, -0.346, -6.080, 8.212, -2.484 ], "bp_params": [ -0.083, -0.113, -0.346, -6.195, 8.125, -2.487 ], "frame": { "rmsd": null, "origin": [ 125.195, 158.197, 98.020 ], "x_axis": [ -0.918, -0.033, 0.395 ], "y_axis": [ 0.396, -0.040, 0.918 ], "z_axis": [ -0.015, 0.999, 0.050 ], "quaternion": [ -0.151, 0.134, 0.676, 0.708 ] } }, { "index": 101, "nt1": "///I/109", "nt2": "///J/72", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -119.315, "conf1": "anti", "pucker1": "----", "lambda1": 52.411, "chi2": -108.264, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.695, "C1C1_dist": 10.669, "N1N9_dist": 8.894, "C6C8_dist": 9.832, "CNNC_torsion": 6.019, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.86],O4(carbonyl)-N6(amino)[2.96]", "interBase_angle": 11.980, "planarity": 0.164, "simple_Shear": -0.075, "simple_Stretch": -0.127, "simple_Buckle": 1.891, "simple_Propeller": 11.830, "bp_simpleParams": [ -0.075, -0.127, 0.296, 1.891, 11.830, -0.054 ], "bp_params": [ -0.074, -0.127, 0.296, 1.752, 11.852, -0.054 ], "frame": { "rmsd": null, "origin": [ 124.651, 161.492, 99.634 ], "x_axis": [ -0.619, -0.152, 0.770 ], "y_axis": [ 0.783, -0.050, 0.620 ], "z_axis": [ -0.056, 0.987, 0.150 ], "quaternion": [ -0.347, 0.265, 0.596, 0.674 ] } }, { "index": 102, "nt1": "///I/110", "nt2": "///J/71", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -114.480, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 52.338, "chi2": -115.762, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 52.631, "C1C1_dist": 10.572, "N1N9_dist": 8.779, "C6C8_dist": 9.674, "CNNC_torsion": 3.158, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.91],O4(carbonyl)-N6(amino)[2.87]", "interBase_angle": 15.279, "planarity": 0.301, "simple_Shear": -0.007, "simple_Stretch": -0.286, "simple_Buckle": 9.635, "simple_Propeller": 11.858, "bp_simpleParams": [ -0.007, -0.286, 0.887, 9.635, 11.858, -0.686 ], "bp_params": [ -0.007, -0.286, 0.887, 9.617, 11.872, -0.687 ], "frame": { "rmsd": null, "origin": [ 123.915, 164.708, 101.467 ], "x_axis": [ -0.192, -0.250, 0.949 ], "y_axis": [ 0.974, 0.074, 0.216 ], "z_axis": [ -0.124, 0.966, 0.229 ], "quaternion": [ 0.527, -0.356, -0.509, -0.580 ] } }, { "index": 103, "nt1": "///I/111", "nt2": "///J/70", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -99.208, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 52.037, "chi2": -115.037, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 52.962, "C1C1_dist": 10.753, "N1N9_dist": 8.958, "C6C8_dist": 9.857, "CNNC_torsion": 5.639, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.89],N1(imino)-N3[2.89],N2(amino)-O2(carbonyl)[2.79]", "interBase_angle": 10.698, "planarity": 0.144, "simple_Shear": -0.186, "simple_Stretch": -0.134, "simple_Buckle": -9.440, "simple_Propeller": 5.033, "bp_simpleParams": [ -0.186, -0.134, -0.203, -9.440, 5.033, -0.811 ], "bp_params": [ -0.183, -0.137, -0.203, -9.519, 4.881, -0.809 ], "frame": { "rmsd": null, "origin": [ 122.203, 167.501, 103.550 ], "x_axis": [ 0.428, -0.673, 0.603 ], "y_axis": [ 0.873, 0.480, -0.084 ], "z_axis": [ -0.233, 0.563, 0.793 ], "quaternion": [ 0.822, -0.197, -0.254, -0.470 ] } }, { "index": 104, "nt1": "///I/112", "nt2": "///J/69", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -118.187, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 52.331, "chi2": -97.679, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 50.850, "C1C1_dist": 10.794, "N1N9_dist": 8.958, "C6C8_dist": 9.832, "CNNC_torsion": 3.774, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.89],N1-N3(imino)[2.88]", "interBase_angle": 10.174, "planarity": 0.139, "simple_Shear": 0.115, "simple_Stretch": -0.112, "simple_Buckle": -4.910, "simple_Propeller": 8.911, "bp_simpleParams": [ 0.115, -0.112, 0.213, -4.910, 8.911, -3.014 ], "bp_params": [ 0.113, -0.114, 0.213, -4.778, 8.982, -3.020 ], "frame": { "rmsd": null, "origin": [ 121.833, 169.378, 106.188 ], "x_axis": [ 0.846, -0.380, 0.374 ], "y_axis": [ 0.518, 0.752, -0.407 ], "z_axis": [ -0.127, 0.538, 0.833 ], "quaternion": [ 0.926, -0.255, -0.135, -0.242 ] } }, { "index": 105, "nt1": "///I/113", "nt2": "///J/68", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -109.053, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 51.739, "chi2": -113.020, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 52.792, "C1C1_dist": 10.602, "N1N9_dist": 8.796, "C6C8_dist": 9.682, "CNNC_torsion": -1.884, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.89],O4(carbonyl)-N6(amino)[2.86]", "interBase_angle": 11.519, "planarity": 0.277, "simple_Shear": -0.072, "simple_Stretch": -0.321, "simple_Buckle": 4.048, "simple_Propeller": 10.785, "bp_simpleParams": [ -0.072, -0.321, 1.041, 4.048, 10.785, -0.992 ], "bp_params": [ -0.069, -0.322, 1.041, 3.929, 10.829, -0.996 ], "frame": { "rmsd": null, "origin": [ 121.690, 171.016, 109.337 ], "x_axis": [ 0.998, -0.055, 0.037 ], "y_axis": [ 0.066, 0.827, -0.559 ], "z_axis": [ 0.000, 0.560, 0.829 ], "quaternion": [ 0.956, -0.293, -0.010, -0.031 ] } }, { "index": 106, "nt1": "///I/114", "nt2": "///J/67", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -121.328, "conf1": "anti", "pucker1": "----", "lambda1": 52.135, "chi2": -111.028, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.113, "C1C1_dist": 10.576, "N1N9_dist": 8.786, "C6C8_dist": 9.649, "CNNC_torsion": -11.745, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.85],N1(imino)-N3[2.91],N2(amino)-O2(carbonyl)[2.83]", "interBase_angle": 12.541, "planarity": 0.281, "simple_Shear": -0.126, "simple_Stretch": -0.431, "simple_Buckle": 11.896, "simple_Propeller": 3.971, "bp_simpleParams": [ -0.126, -0.431, 1.483, 11.896, 3.971, -0.981 ], "bp_params": [ -0.124, -0.432, 1.483, 11.877, 4.028, -0.977 ], "frame": { "rmsd": null, "origin": [ 122.191, 173.733, 111.368 ], "x_axis": [ 0.801, 0.447, -0.397 ], "y_axis": [ -0.589, 0.707, -0.392 ], "z_axis": [ 0.105, 0.548, 0.830 ], "quaternion": [ 0.913, -0.257, 0.137, 0.284 ] } }, { "index": 107, "nt1": "///I/115", "nt2": "///J/66", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -87.554, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.742, "chi2": -76.644, "conf2": "--", "pucker2": "~C2'-endo", "lambda2": 53.750, "C1C1_dist": 10.653, "N1N9_dist": 8.905, "C6C8_dist": 9.840, "CNNC_torsion": -9.617, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.94],N1(imino)-N3[2.90],N2(amino)-O2(carbonyl)[2.75]", "interBase_angle": 6.037, "planarity": 0.192, "simple_Shear": -0.180, "simple_Stretch": -0.206, "simple_Buckle": -4.057, "simple_Propeller": -4.471, "bp_simpleParams": [ -0.180, -0.206, 0.689, -4.057, -4.471, 0.008 ], "bp_params": [ -0.177, -0.208, 0.689, -4.001, -4.522, 0.008 ], "frame": { "rmsd": null, "origin": [ 122.951, 177.555, 114.666 ], "x_axis": [ 0.325, 0.734, -0.597 ], "y_axis": [ -0.863, 0.488, 0.131 ], "z_axis": [ 0.387, 0.473, 0.791 ], "quaternion": [ 0.807, -0.106, 0.305, 0.495 ] } }, { "index": 108, "nt1": "///I/116", "nt2": "///J/65", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -102.928, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 55.444, "chi2": -103.542, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 54.156, "C1C1_dist": 10.497, "N1N9_dist": 8.797, "C6C8_dist": 9.794, "CNNC_torsion": -2.498, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.00],N1-N3(imino)[2.80]", "interBase_angle": 8.337, "planarity": 0.106, "simple_Shear": 0.051, "simple_Stretch": -0.141, "simple_Buckle": -7.089, "simple_Propeller": -4.388, "bp_simpleParams": [ 0.051, -0.141, -0.216, -7.089, -4.388, 1.978 ], "bp_params": [ 0.049, -0.141, -0.216, -7.138, -4.308, 1.975 ], "frame": { "rmsd": null, "origin": [ 121.835, 179.417, 118.966 ], "x_axis": [ -0.315, 0.869, -0.383 ], "y_axis": [ -0.875, -0.110, 0.472 ], "z_axis": [ 0.368, 0.483, 0.794 ], "quaternion": [ 0.585, -0.005, 0.321, 0.745 ] } }, { "index": 109, "nt1": "///I/117", "nt2": "///J/64", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -110.836, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.140, "chi2": -103.990, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.474, "C1C1_dist": 10.749, "N1N9_dist": 8.983, "C6C8_dist": 9.911, "CNNC_torsion": -0.080, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.94],N1(imino)-N3[2.91],N2(amino)-O2(carbonyl)[2.78]", "interBase_angle": 5.621, "planarity": 0.067, "simple_Shear": -0.184, "simple_Stretch": -0.109, "simple_Buckle": -5.435, "simple_Propeller": -1.435, "bp_simpleParams": [ -0.184, -0.109, -0.315, -5.435, -1.435, 0.260 ], "bp_params": [ -0.182, -0.111, -0.315, -5.415, -1.505, 0.259 ], "frame": { "rmsd": null, "origin": [ 123.104, 180.582, 121.728 ], "x_axis": [ -0.766, 0.632, -0.119 ], "y_axis": [ -0.570, -0.581, 0.581 ], "z_axis": [ 0.298, 0.513, 0.805 ], "quaternion": [ 0.339, 0.051, 0.308, 0.888 ] } }, { "index": 110, "nt1": "///I/118", "nt2": "///J/63", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -112.936, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.542, "chi2": -115.012, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.239, "C1C1_dist": 10.726, "N1N9_dist": 8.963, "C6C8_dist": 9.897, "CNNC_torsion": -2.498, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.76],N3-N1(imino)[2.90],N4(amino)-O6(carbonyl)[2.93]", "interBase_angle": 0.809, "planarity": 0.050, "simple_Shear": 0.187, "simple_Stretch": -0.129, "simple_Buckle": -0.782, "simple_Propeller": 0.208, "bp_simpleParams": [ 0.187, -0.129, 0.242, -0.782, 0.208, 0.455 ], "bp_params": [ 0.186, -0.132, 0.242, -0.779, 0.219, 0.455 ], "frame": { "rmsd": null, "origin": [ 123.631, 182.340, 124.477 ], "x_axis": [ -0.965, 0.107, 0.239 ], "y_axis": [ 0.031, -0.860, 0.509 ], "z_axis": [ 0.260, 0.499, 0.827 ], "quaternion": [ 0.020, 0.131, 0.264, 0.956 ] } }, { "index": 111, "nt1": "///I/119", "nt2": "///J/62", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -121.775, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.877, "chi2": -117.281, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 51.449, "C1C1_dist": 10.589, "N1N9_dist": 8.797, "C6C8_dist": 9.698, "CNNC_torsion": -4.628, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.89],N1-N3(imino)[2.89]", "interBase_angle": 8.026, "planarity": 0.259, "simple_Shear": 0.158, "simple_Stretch": -0.312, "simple_Buckle": -2.963, "simple_Propeller": 7.459, "bp_simpleParams": [ 0.158, -0.312, 1.077, -2.963, 7.459, -0.993 ], "bp_params": [ 0.152, -0.315, 1.077, -2.814, 7.516, -0.995 ], "frame": { "rmsd": null, "origin": [ 124.249, 184.008, 127.425 ], "x_axis": [ -0.798, -0.473, 0.374 ], "y_axis": [ 0.578, -0.775, 0.255 ], "z_axis": [ 0.169, 0.420, 0.892 ], "quaternion": [ -0.282, 0.146, 0.181, 0.931 ] } }, { "index": 112, "nt1": "///I/120", "nt2": "///J/61", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -137.522, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.710, "chi2": -136.685, "conf2": "anti", "pucker2": "----", "lambda2": 54.747, "C1C1_dist": 10.549, "N1N9_dist": 8.825, "C6C8_dist": 9.785, "CNNC_torsion": -2.382, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.93],N1(imino)-N3[2.90],N2(amino)-O2(carbonyl)[2.79]", "interBase_angle": 8.298, "planarity": 0.250, "simple_Shear": -0.232, "simple_Stretch": -0.283, "simple_Buckle": 0.108, "simple_Propeller": 8.297, "bp_simpleParams": [ -0.232, -0.283, 0.950, 0.108, 8.297, 2.924 ], "bp_params": [ -0.227, -0.287, 0.950, -0.041, 8.298, 2.931 ], "frame": { "rmsd": null, "origin": [ 124.313, 185.737, 130.490 ], "x_axis": [ -0.422, -0.829, 0.368 ], "y_axis": [ 0.896, -0.444, 0.027 ], "z_axis": [ 0.140, 0.341, 0.930 ], "quaternion": [ 0.516, -0.152, -0.110, -0.836 ] } }, { "index": 113, "nt1": "///I/121", "nt2": "///J/60", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -138.082, "conf1": "anti", "pucker1": "----", "lambda1": 51.867, "chi2": -128.651, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.296, "C1C1_dist": 10.519, "N1N9_dist": 8.725, "C6C8_dist": 9.607, "CNNC_torsion": -5.996, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.92],O4(carbonyl)-N6(amino)[2.85]", "interBase_angle": 10.666, "planarity": 0.329, "simple_Shear": -0.113, "simple_Stretch": -0.453, "simple_Buckle": 0.479, "simple_Propeller": 10.655, "bp_simpleParams": [ -0.113, -0.453, 1.425, 0.479, 10.655, -0.621 ], "bp_params": [ -0.106, -0.454, 1.425, 0.310, 10.661, -0.623 ], "frame": { "rmsd": null, "origin": [ 123.737, 187.135, 133.902 ], "x_axis": [ 0.089, -0.965, 0.246 ], "y_axis": [ 0.988, 0.054, -0.144 ], "z_axis": [ 0.126, 0.256, 0.958 ], "quaternion": [ 0.725, -0.138, -0.041, -0.674 ] } }, { "index": 114, "nt1": "///I/122", "nt2": "///J/58", "bp": "T-A", "name": "--", "Saenger": "--", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -135.155, "conf1": "anti", "pucker1": "----", "lambda1": 28.599, "chi2": -137.835, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 39.508, "C1C1_dist": 11.680, "N1N9_dist": 9.260, "C6C8_dist": 9.258, "CNNC_torsion": 42.329, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[3.30],O4(carbonyl)-N6(amino)[2.38]", "interBase_angle": 3.782, "planarity": 0.417, "simple_Shear": -1.179, "simple_Stretch": -0.194, "simple_Buckle": 2.022, "simple_Propeller": 3.196, "bp_simpleParams": [ -1.179, -0.194, -1.847, 2.022, 3.196, -41.074 ], "bp_params": [ -1.145, -0.340, -1.847, 1.607, 3.423, -41.087 ], "frame": { "rmsd": null, "origin": [ 124.519, 187.728, 139.371 ], "x_axis": [ 0.786, -0.615, -0.067 ], "y_axis": [ 0.602, 0.785, -0.143 ], "z_axis": [ 0.141, 0.072, 0.987 ], "quaternion": [ 0.943, -0.057, 0.055, -0.323 ] } }, { "index": 115, "nt1": "///I/122", "nt2": "///J/59", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -135.155, "conf1": "anti", "pucker1": "----", "lambda1": 51.316, "chi2": -150.257, "conf2": "anti", "pucker2": "pucker-CHK", "lambda2": 53.612, "C1C1_dist": 10.411, "N1N9_dist": 8.614, "C6C8_dist": 9.473, "CNNC_torsion": -8.134, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.97],O4(carbonyl)-N6(amino)[2.83]", "interBase_angle": 13.337, "planarity": 0.419, "simple_Shear": -0.116, "simple_Stretch": -0.595, "simple_Buckle": 7.881, "simple_Propeller": 10.759, "bp_simpleParams": [ -0.116, -0.595, 1.609, 7.881, 10.759, -1.038 ], "bp_params": [ -0.108, -0.596, 1.609, 7.734, 10.865, -1.040 ], "frame": { "rmsd": null, "origin": [ 123.982, 187.863, 137.675 ], "x_axis": [ 0.542, -0.839, 0.046 ], "y_axis": [ 0.825, 0.521, -0.221 ], "z_axis": [ 0.161, 0.158, 0.974 ], "quaternion": [ 0.871, -0.109, 0.033, -0.477 ] } }, { "index": 116, "nt1": "///I/123", "nt2": "///J/58", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -122.150, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 49.203, "chi2": -137.835, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 52.390, "C1C1_dist": 10.532, "N1N9_dist": 8.669, "C6C8_dist": 9.474, "CNNC_torsion": -10.625, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.97],O4(carbonyl)-N6(amino)[2.81]", "interBase_angle": 10.250, "planarity": 0.407, "simple_Shear": -0.196, "simple_Stretch": -0.580, "simple_Buckle": 8.278, "simple_Propeller": 6.045, "bp_simpleParams": [ -0.196, -0.580, 1.603, 8.278, 6.045, -4.551 ], "bp_params": [ -0.183, -0.584, 1.603, 8.146, 6.221, -4.547 ], "frame": { "rmsd": null, "origin": [ 125.142, 187.346, 141.045 ], "x_axis": [ 0.930, -0.339, -0.139 ], "y_axis": [ 0.333, 0.941, -0.067 ], "z_axis": [ 0.153, 0.016, 0.988 ], "quaternion": [ 0.982, -0.021, 0.074, -0.171 ] } }, { "index": 117, "nt1": "///I/124", "nt2": "///J/57", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -118.850, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.207, "chi2": -123.620, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 52.569, "C1C1_dist": 10.580, "N1N9_dist": 8.803, "C6C8_dist": 9.713, "CNNC_torsion": -8.795, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.82],N3-N1(imino)[2.92],N4(amino)-O6(carbonyl)[2.90]", "interBase_angle": 5.425, "planarity": 0.305, "simple_Shear": 0.189, "simple_Stretch": -0.366, "simple_Buckle": 5.080, "simple_Propeller": 1.904, "bp_simpleParams": [ 0.189, -0.366, 1.123, 5.080, 1.904, 0.222 ], "bp_params": [ 0.183, -0.368, 1.123, 5.106, 1.832, 0.222 ], "frame": { "rmsd": null, "origin": [ 126.020, 186.647, 144.179 ], "x_axis": [ 0.938, 0.299, -0.172 ], "y_axis": [ -0.279, 0.951, 0.132 ], "z_axis": [ 0.203, -0.076, 0.976 ], "quaternion": [ 0.983, 0.053, 0.095, 0.147 ] } }, { "index": 118, "nt1": "///I/125", "nt2": "///J/56", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -99.547, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 52.180, "chi2": -101.384, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 51.894, "C1C1_dist": 10.630, "N1N9_dist": 8.820, "C6C8_dist": 9.685, "CNNC_torsion": -14.010, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.84],N3-N1(imino)[2.92],N4(amino)-O6(carbonyl)[2.87]", "interBase_angle": 3.103, "planarity": 0.304, "simple_Shear": 0.151, "simple_Stretch": -0.414, "simple_Buckle": 2.852, "simple_Propeller": -1.222, "bp_simpleParams": [ 0.151, -0.414, 1.236, 2.852, -1.222, -2.145 ], "bp_params": [ 0.147, -0.416, 1.236, 2.840, -1.250, -2.144 ], "frame": { "rmsd": null, "origin": [ 126.248, 186.803, 148.045 ], "x_axis": [ 0.540, 0.839, -0.071 ], "y_axis": [ -0.794, 0.536, 0.289 ], "z_axis": [ 0.280, -0.099, 0.955 ], "quaternion": [ 0.870, 0.111, 0.101, 0.469 ] } }, { "index": 119, "nt1": "///I/126", "nt2": "///J/55", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -100.077, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 55.461, "chi2": -84.954, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.902, "C1C1_dist": 10.537, "N1N9_dist": 8.830, "C6C8_dist": 9.801, "CNNC_torsion": -1.840, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.01],N1-N3(imino)[2.84]", "interBase_angle": 14.749, "planarity": 0.187, "simple_Shear": 0.071, "simple_Stretch": -0.105, "simple_Buckle": -12.679, "simple_Propeller": -7.535, "bp_simpleParams": [ 0.071, -0.105, -0.522, -12.679, -7.535, 1.571 ], "bp_params": [ 0.069, -0.106, -0.522, -12.802, -7.325, 1.565 ], "frame": { "rmsd": null, "origin": [ 126.145, 187.092, 152.494 ], "x_axis": [ -0.134, 0.989, 0.067 ], "y_axis": [ -0.875, -0.149, 0.461 ], "z_axis": [ 0.465, 0.003, 0.885 ], "quaternion": [ 0.633, 0.181, 0.158, 0.736 ] } }, { "index": 120, "nt1": "///I/127", "nt2": "///J/54", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -101.101, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 54.967, "chi2": -90.993, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.577, "C1C1_dist": 10.561, "N1N9_dist": 8.838, "C6C8_dist": 9.800, "CNNC_torsion": 3.160, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.01],N1-N3(imino)[2.85]", "interBase_angle": 11.399, "planarity": 0.162, "simple_Shear": 0.105, "simple_Stretch": -0.137, "simple_Buckle": -11.185, "simple_Propeller": -2.198, "bp_simpleParams": [ 0.105, -0.137, -0.756, -11.185, -2.198, 0.764 ], "bp_params": [ 0.103, -0.139, -0.756, -11.219, -2.014, 0.761 ], "frame": { "rmsd": null, "origin": [ 126.910, 186.037, 155.819 ], "x_axis": [ -0.650, 0.725, 0.227 ], "y_axis": [ -0.658, -0.686, 0.310 ], "z_axis": [ 0.381, 0.052, 0.923 ], "quaternion": [ 0.383, 0.168, 0.100, 0.903 ] } }, { "index": 121, "nt1": "///I/128", "nt2": "///J/53", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -103.173, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.076, "chi2": -105.209, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 50.931, "C1C1_dist": 10.698, "N1N9_dist": 8.880, "C6C8_dist": 9.753, "CNNC_torsion": 10.073, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.93],N1-N3(imino)[2.88]", "interBase_angle": 7.780, "planarity": 0.200, "simple_Shear": 0.208, "simple_Stretch": -0.233, "simple_Buckle": -7.656, "simple_Propeller": 1.382, "bp_simpleParams": [ 0.208, -0.233, -1.067, -7.656, 1.382, -3.422 ], "bp_params": [ 0.202, -0.238, -1.067, -7.620, 1.567, -3.415 ], "frame": { "rmsd": null, "origin": [ 128.091, 184.312, 159.251 ], "x_axis": [ -0.956, 0.119, 0.268 ], "y_axis": [ -0.109, -0.993, 0.055 ], "z_axis": [ 0.273, 0.023, 0.962 ], "quaternion": [ 0.058, 0.137, 0.020, 0.989 ] } }, { "index": 122, "nt1": "///I/129", "nt2": "///J/52", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -107.005, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.652, "chi2": -107.117, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 54.611, "C1C1_dist": 10.595, "N1N9_dist": 8.864, "C6C8_dist": 9.845, "CNNC_torsion": 1.397, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.83],O4(carbonyl)-N6(amino)[3.01]", "interBase_angle": 2.098, "planarity": 0.027, "simple_Shear": -0.049, "simple_Stretch": -0.110, "simple_Buckle": 0.560, "simple_Propeller": 2.022, "bp_simpleParams": [ -0.049, -0.110, -0.063, 0.560, 2.022, 1.161 ], "bp_params": [ -0.048, -0.110, -0.063, 0.540, 2.027, 1.161 ], "frame": { "rmsd": null, "origin": [ 128.391, 184.278, 162.590 ], "x_axis": [ -0.918, -0.364, 0.161 ], "y_axis": [ 0.346, -0.929, -0.131 ], "z_axis": [ 0.197, -0.064, 0.978 ], "quaternion": [ -0.181, 0.091, -0.050, 0.978 ] } }, { "index": 123, "nt1": "///I/130", "nt2": "///J/51", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -119.883, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 51.642, "chi2": -102.481, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 49.676, "C1C1_dist": 10.847, "N1N9_dist": 8.974, "C6C8_dist": 9.800, "CNNC_torsion": -2.349, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.84],N1-N3(imino)[2.91]", "interBase_angle": 8.130, "planarity": 0.162, "simple_Shear": 0.174, "simple_Stretch": -0.164, "simple_Buckle": 3.416, "simple_Propeller": 7.377, "bp_simpleParams": [ 0.174, -0.164, 0.733, 3.416, 7.377, -4.592 ], "bp_params": [ 0.170, -0.168, 0.733, 3.579, 7.300, -4.599 ], "frame": { "rmsd": null, "origin": [ 129.617, 183.614, 165.811 ], "x_axis": [ -0.563, -0.818, -0.121 ], "y_axis": [ 0.822, -0.538, -0.185 ], "z_axis": [ 0.087, -0.203, 0.975 ], "quaternion": [ -0.468, -0.010, -0.111, 0.877 ] } }, { "index": 124, "nt1": "///I/131", "nt2": "///J/50", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -152.575, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 54.808, "chi2": -113.283, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 54.181, "C1C1_dist": 10.427, "N1N9_dist": 8.713, "C6C8_dist": 9.665, "CNNC_torsion": -11.051, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.78],N3-N1(imino)[2.92],N4(amino)-O6(carbonyl)[2.94]", "interBase_angle": 6.292, "planarity": 0.352, "simple_Shear": 0.205, "simple_Stretch": -0.430, "simple_Buckle": 5.897, "simple_Propeller": 2.192, "bp_simpleParams": [ 0.205, -0.430, 1.275, 5.897, 2.192, 2.072 ], "bp_params": [ 0.198, -0.433, 1.275, 5.932, 2.097, 2.069 ], "frame": { "rmsd": null, "origin": [ 128.773, 181.740, 169.435 ], "x_axis": [ -0.138, -0.949, -0.282 ], "y_axis": [ 0.990, -0.127, -0.056 ], "z_axis": [ 0.017, -0.287, 0.958 ], "quaternion": [ 0.650, 0.089, 0.115, -0.745 ] } }, { "index": 125, "nt1": "///I/132", "nt2": "///J/48", "bp": "A-G", "name": "--", "Saenger": "--", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -151.228, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 37.953, "chi2": -165.096, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 41.465, "C1C1_dist": 12.610, "N1N9_dist": 10.370, "C6C8_dist": 10.461, "CNNC_torsion": 27.842, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O6(carbonyl)[2.72],N1-N1(imino)[3.03]", "interBase_angle": 6.833, "planarity": 0.463, "simple_Shear": -0.522, "simple_Stretch": 0.789, "simple_Buckle": 6.789, "simple_Propeller": 0.771, "bp_simpleParams": [ -0.522, 0.789, -1.966, 6.789, 0.771, -29.829 ], "bp_params": [ -0.566, 0.759, -1.966, 6.735, 1.153, -29.781 ], "frame": { "rmsd": null, "origin": [ 127.928, 178.593, 173.475 ], "x_axis": [ 0.653, -0.601, -0.461 ], "y_axis": [ 0.755, 0.568, 0.328 ], "z_axis": [ 0.065, -0.562, 0.824 ], "quaternion": [ 0.873, 0.255, 0.151, -0.388 ] } }, { "index": 126, "nt1": "///I/132", "nt2": "///J/49", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -151.228, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 53.550, "chi2": -139.140, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 50.086, "C1C1_dist": 10.601, "N1N9_dist": 8.775, "C6C8_dist": 9.599, "CNNC_torsion": -8.431, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.83],N1-N3(imino)[2.97]", "interBase_angle": 13.110, "planarity": 0.356, "simple_Shear": 0.271, "simple_Stretch": -0.482, "simple_Buckle": 6.349, "simple_Propeller": 11.470, "bp_simpleParams": [ 0.271, -0.482, 1.702, 6.349, 11.470, -2.472 ], "bp_params": [ 0.255, -0.491, 1.702, 6.728, 11.252, -2.480 ], "frame": { "rmsd": null, "origin": [ 128.096, 180.159, 172.295 ], "x_axis": [ 0.458, -0.759, -0.463 ], "y_axis": [ 0.888, 0.411, 0.205 ], "z_axis": [ 0.035, -0.505, 0.862 ], "quaternion": [ 0.826, 0.215, 0.151, -0.498 ] } }, { "index": 127, "nt1": "///I/133", "nt2": "///J/48", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -152.677, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 55.540, "chi2": -165.096, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 54.509, "C1C1_dist": 10.347, "N1N9_dist": 8.655, "C6C8_dist": 9.624, "CNNC_torsion": -5.918, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.81],N3-N1(imino)[2.91],N4(amino)-O6(carbonyl)[2.92]", "interBase_angle": 14.192, "planarity": 0.406, "simple_Shear": 0.235, "simple_Stretch": -0.393, "simple_Buckle": 12.923, "simple_Propeller": 5.867, "bp_simpleParams": [ 0.235, -0.393, 1.101, 12.923, 5.867, 3.644 ], "bp_params": [ 0.226, -0.398, 1.101, 13.051, 5.577, 3.625 ], "frame": { "rmsd": null, "origin": [ 127.924, 177.133, 174.317 ], "x_axis": [ 0.837, -0.381, -0.393 ], "y_axis": [ 0.541, 0.684, 0.490 ], "z_axis": [ 0.083, -0.623, 0.778 ], "quaternion": [ 0.908, 0.306, 0.131, -0.254 ] } }, { "index": 128, "nt1": "///I/134", "nt2": "///J/47", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -139.232, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 50.575, "chi2": -139.640, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.275, "C1C1_dist": 10.500, "N1N9_dist": 8.682, "C6C8_dist": 9.557, "CNNC_torsion": -10.369, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.87],O4(carbonyl)-N6(amino)[2.88]", "interBase_angle": 9.231, "planarity": 0.330, "simple_Shear": -0.153, "simple_Stretch": -0.437, "simple_Buckle": 9.189, "simple_Propeller": -0.880, "bp_simpleParams": [ -0.153, -0.437, 1.211, 9.189, -0.880, -3.169 ], "bp_params": [ -0.144, -0.440, 1.211, 9.205, -0.700, -3.159 ], "frame": { "rmsd": null, "origin": [ 128.500, 174.113, 176.357 ], "x_axis": [ 0.996, 0.066, -0.063 ], "y_axis": [ 0.002, 0.681, 0.732 ], "z_axis": [ 0.091, -0.729, 0.678 ], "quaternion": [ 0.916, 0.399, 0.042, 0.017 ] } }, { "index": 129, "nt1": "///I/135", "nt2": "///J/46", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -109.607, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 47.535, "chi2": -115.731, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 51.816, "C1C1_dist": 10.745, "N1N9_dist": 8.834, "C6C8_dist": 9.603, "CNNC_torsion": -19.068, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.94],O4(carbonyl)-N6(amino)[2.90]", "interBase_angle": 8.464, "planarity": 0.353, "simple_Shear": -0.278, "simple_Stretch": -0.418, "simple_Buckle": 5.499, "simple_Propeller": -6.434, "bp_simpleParams": [ -0.278, -0.418, 1.384, 5.499, -6.434, -8.707 ], "bp_params": [ -0.264, -0.427, 1.384, 5.705, -6.253, -8.709 ], "frame": { "rmsd": null, "origin": [ 128.601, 171.185, 178.745 ], "x_axis": [ 0.798, 0.426, 0.427 ], "y_axis": [ -0.594, 0.436, 0.676 ], "z_axis": [ 0.102, -0.793, 0.601 ], "quaternion": [ 0.842, 0.436, -0.097, 0.303 ] } }, { "index": 130, "nt1": "///I/136", "nt2": "///J/45", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -154.446, "conf1": "anti", "pucker1": "----", "lambda1": 48.136, "chi2": -109.222, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 51.837, "C1C1_dist": 10.736, "N1N9_dist": 8.842, "C6C8_dist": 9.638, "CNNC_torsion": -23.316, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.85],O4(carbonyl)-N6(amino)[2.90]", "interBase_angle": 11.721, "planarity": 0.307, "simple_Shear": -0.294, "simple_Stretch": -0.363, "simple_Buckle": 1.246, "simple_Propeller": -11.655, "bp_simpleParams": [ -0.294, -0.363, 1.141, 1.246, -11.655, -8.171 ], "bp_params": [ -0.281, -0.373, 1.141, 1.632, -11.607, -8.212 ], "frame": { "rmsd": null, "origin": [ 129.384, 168.480, 180.450 ], "x_axis": [ 0.328, 0.574, 0.750 ], "y_axis": [ -0.938, 0.108, 0.328 ], "z_axis": [ 0.107, -0.812, 0.574 ], "quaternion": [ 0.709, 0.402, -0.227, 0.533 ] } }, { "index": 131, "nt1": "///I/137", "nt2": "///J/44", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -79.119, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 52.740, "chi2": -103.241, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 54.096, "C1C1_dist": 10.546, "N1N9_dist": 8.793, "C6C8_dist": 9.731, "CNNC_torsion": -16.173, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.81],O4(carbonyl)-N6(amino)[2.99]", "interBase_angle": 9.269, "planarity": 0.209, "simple_Shear": -0.160, "simple_Stretch": -0.261, "simple_Buckle": -4.214, "simple_Propeller": -8.255, "bp_simpleParams": [ -0.160, -0.261, 0.922, -4.214, -8.255, -1.505 ], "bp_params": [ -0.155, -0.264, 0.922, -4.051, -8.337, -1.508 ], "frame": { "rmsd": null, "origin": [ 128.660, 165.024, 183.174 ], "x_axis": [ -0.412, 0.475, 0.778 ], "y_axis": [ -0.896, -0.366, -0.251 ], "z_axis": [ 0.165, -0.800, 0.576 ], "quaternion": [ 0.447, 0.307, -0.343, 0.767 ] } }, { "index": 132, "nt1": "///I/138", "nt2": "///J/43", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -103.324, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 54.163, "chi2": -97.054, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 54.865, "C1C1_dist": 10.596, "N1N9_dist": 8.883, "C6C8_dist": 9.853, "CNNC_torsion": -0.981, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.95],N1(imino)-N3[2.89],N2(amino)-O2(carbonyl)[2.74]", "interBase_angle": 6.606, "planarity": 0.178, "simple_Shear": -0.221, "simple_Stretch": -0.185, "simple_Buckle": -1.567, "simple_Propeller": 6.417, "bp_simpleParams": [ -0.221, -0.185, 0.581, -1.567, 6.417, 2.558 ], "bp_params": [ -0.218, -0.189, 0.581, -1.678, 6.389, 2.561 ], "frame": { "rmsd": null, "origin": [ 127.544, 161.159, 184.035 ], "x_axis": [ -0.874, 0.084, 0.478 ], "y_axis": [ -0.447, -0.524, -0.725 ], "z_axis": [ 0.189, -0.848, 0.495 ], "quaternion": [ 0.156, 0.196, -0.462, 0.850 ] } }, { "index": 133, "nt1": "///I/139", "nt2": "///J/42", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -97.914, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 52.741, "chi2": -111.798, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.042, "C1C1_dist": 10.717, "N1N9_dist": 8.938, "C6C8_dist": 9.846, "CNNC_torsion": 7.416, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.92],N1(imino)-N3[2.89],N2(amino)-O2(carbonyl)[2.78]", "interBase_angle": 13.887, "planarity": 0.180, "simple_Shear": -0.222, "simple_Stretch": -0.140, "simple_Buckle": 10.219, "simple_Propeller": 9.404, "bp_simpleParams": [ -0.222, -0.140, -0.151, 10.219, 9.404, -0.657 ], "bp_params": [ -0.220, -0.143, -0.151, 10.091, 9.541, -0.657 ], "frame": { "rmsd": null, "origin": [ 128.643, 157.793, 184.841 ], "x_axis": [ -0.986, -0.153, -0.069 ], "y_axis": [ 0.138, -0.502, -0.854 ], "z_axis": [ 0.096, -0.851, 0.516 ], "quaternion": [ -0.084, 0.008, -0.492, 0.866 ] } }, { "index": 134, "nt1": "///I/140", "nt2": "///J/41", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -95.219, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 39.932, "chi2": -141.481, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 47.841, "C1C1_dist": 11.909, "N1N9_dist": 9.786, "C6C8_dist": 10.206, "CNNC_torsion": 13.593, "hbonds_num": 1, "hbonds_desc": "O4(carbonyl)-N6(amino)[2.93]", "interBase_angle": 25.534, "planarity": 0.309, "simple_Shear": -0.932, "simple_Stretch": 0.712, "simple_Buckle": 25.484, "simple_Propeller": 1.593, "bp_simpleParams": [ -0.932, 0.712, -0.548, 25.484, 1.593, -23.297 ], "bp_params": [ -0.995, 0.620, -0.548, 25.222, 3.981, -22.764 ], "frame": { "rmsd": null, "origin": [ 129.614, 155.550, 187.098 ], "x_axis": [ -0.808, -0.325, -0.492 ], "y_axis": [ 0.590, -0.458, -0.665 ], "z_axis": [ -0.008, -0.827, 0.561 ], "quaternion": [ -0.272, -0.149, -0.444, 0.841 ] } }, { "index": 135, "nt1": "///I/141", "nt2": "///J/40", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -159.022, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 54.677, "chi2": -150.952, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 51.298, "C1C1_dist": 10.573, "N1N9_dist": 8.794, "C6C8_dist": 9.683, "CNNC_torsion": -10.167, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.92],N1-N3(imino)[2.92]", "interBase_angle": 6.577, "planarity": 0.282, "simple_Shear": 0.255, "simple_Stretch": -0.365, "simple_Buckle": 4.033, "simple_Propeller": 5.195, "bp_simpleParams": [ 0.255, -0.365, 1.402, 4.033, 5.195, -1.644 ], "bp_params": [ 0.243, -0.373, 1.402, 4.190, 5.070, -1.644 ], "frame": { "rmsd": null, "origin": [ 127.981, 151.914, 188.530 ], "x_axis": [ -0.321, -0.227, -0.920 ], "y_axis": [ 0.947, -0.048, -0.319 ], "z_axis": [ 0.028, -0.973, 0.230 ], "quaternion": [ -0.464, -0.353, -0.510, 0.632 ] } }, { "index": 136, "nt1": "///I/142", "nt2": "///J/39", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -162.770, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 54.178, "chi2": -157.469, "conf2": "anti", "pucker2": "----", "lambda2": 54.694, "C1C1_dist": 10.516, "N1N9_dist": 8.798, "C6C8_dist": 9.740, "CNNC_torsion": -11.226, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.95],N1(imino)-N3[2.92],N2(amino)-O2(carbonyl)[2.76]", "interBase_angle": 5.123, "planarity": 0.271, "simple_Shear": -0.159, "simple_Stretch": -0.369, "simple_Buckle": 4.921, "simple_Propeller": 1.424, "bp_simpleParams": [ -0.159, -0.369, 1.330, 4.921, 1.424, 1.331 ], "bp_params": [ -0.155, -0.371, 1.330, 4.906, 1.475, 1.330 ], "frame": { "rmsd": null, "origin": [ 126.380, 148.448, 188.802 ], "x_axis": [ 0.159, -0.184, -0.970 ], "y_axis": [ 0.987, 0.014, 0.159 ], "z_axis": [ -0.015, -0.983, 0.184 ], "quaternion": [ 0.583, 0.490, 0.410, -0.503 ] } }, { "index": 137, "nt1": "///I/143", "nt2": "///J/38", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -148.726, "conf1": "anti", "pucker1": "----", "lambda1": 53.646, "chi2": -158.071, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 51.811, "C1C1_dist": 10.626, "N1N9_dist": 8.837, "C6C8_dist": 9.732, "CNNC_torsion": -9.384, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.93],N1-N3(imino)[2.88]", "interBase_angle": 5.768, "planarity": 0.216, "simple_Shear": 0.181, "simple_Stretch": -0.274, "simple_Buckle": 5.465, "simple_Propeller": 1.845, "bp_simpleParams": [ 0.181, -0.274, 1.131, 5.465, 1.845, -2.002 ], "bp_params": [ 0.175, -0.278, 1.131, 5.507, 1.718, -2.000 ], "frame": { "rmsd": null, "origin": [ 125.028, 145.236, 188.730 ], "x_axis": [ 0.664, 0.020, -0.748 ], "y_axis": [ 0.748, 0.001, 0.664 ], "z_axis": [ 0.014, -1.000, -0.014 ], "quaternion": [ 0.642, 0.647, 0.297, -0.283 ] } }, { "index": 138, "nt1": "///I/144", "nt2": "///J/37", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -129.348, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.370, "chi2": -149.389, "conf2": "anti", "pucker2": "----", "lambda2": 52.468, "C1C1_dist": 10.652, "N1N9_dist": 8.875, "C6C8_dist": 9.794, "CNNC_torsion": -8.268, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.96],N1-N3(imino)[2.86]", "interBase_angle": 6.519, "planarity": 0.149, "simple_Shear": 0.120, "simple_Stretch": -0.178, "simple_Buckle": 6.320, "simple_Propeller": -1.601, "bp_simpleParams": [ 0.120, -0.178, 0.799, 6.320, -1.601, -1.506 ], "bp_params": [ 0.117, -0.180, 0.799, 6.294, -1.701, -1.504 ], "frame": { "rmsd": null, "origin": [ 124.056, 141.981, 187.886 ], "x_axis": [ 0.958, 0.023, -0.285 ], "y_axis": [ 0.286, -0.046, 0.957 ], "z_axis": [ 0.009, -0.999, -0.050 ], "quaternion": [ 0.682, 0.717, 0.108, -0.096 ] } }, { "index": 139, "nt1": "///I/145", "nt2": "///J/36", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -135.165, "conf1": "anti", "pucker1": "----", "lambda1": 51.423, "chi2": -131.579, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 52.879, "C1C1_dist": 10.721, "N1N9_dist": 8.910, "C6C8_dist": 9.811, "CNNC_torsion": -6.060, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.87],O4(carbonyl)-N6(amino)[2.94]", "interBase_angle": 6.790, "planarity": 0.142, "simple_Shear": -0.087, "simple_Stretch": -0.137, "simple_Buckle": 5.462, "simple_Propeller": -4.033, "bp_simpleParams": [ -0.087, -0.137, 0.384, 5.462, -4.033, -2.336 ], "bp_params": [ -0.085, -0.138, 0.384, 5.518, -3.957, -2.335 ], "frame": { "rmsd": null, "origin": [ 123.844, 138.827, 186.490 ], "x_axis": [ 0.969, -0.036, 0.242 ], "y_axis": [ -0.245, -0.096, 0.965 ], "z_axis": [ -0.011, -0.995, -0.102 ], "quaternion": [ 0.665, 0.736, -0.095, 0.079 ] } }, { "index": 140, "nt1": "///I/146", "nt2": "///J/35", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -116.412, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 51.115, "chi2": -114.360, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 51.854, "C1C1_dist": 10.745, "N1N9_dist": 8.909, "C6C8_dist": 9.767, "CNNC_torsion": -15.826, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.81],N3-N1(imino)[2.89],N4(amino)-O6(carbonyl)[2.88]", "interBase_angle": 9.074, "planarity": 0.237, "simple_Shear": 0.135, "simple_Stretch": -0.286, "simple_Buckle": 3.808, "simple_Propeller": -8.237, "bp_simpleParams": [ 0.135, -0.286, 0.850, 3.808, -8.237, -3.321 ], "bp_params": [ 0.133, -0.287, 0.850, 3.740, -8.268, -3.328 ], "frame": { "rmsd": null, "origin": [ 124.117, 135.394, 186.162 ], "x_axis": [ 0.620, -0.117, 0.776 ], "y_axis": [ -0.785, -0.104, 0.611 ], "z_axis": [ 0.009, -0.988, -0.156 ], "quaternion": [ 0.583, 0.686, -0.329, 0.286 ] } }, { "index": 141, "nt1": "///I/147", "nt2": "///J/34", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -98.520, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 52.532, "chi2": -102.874, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 54.742, "C1C1_dist": 10.527, "N1N9_dist": 8.779, "C6C8_dist": 9.727, "CNNC_torsion": -12.352, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.82],O4(carbonyl)-N6(amino)[2.97]", "interBase_angle": 4.333, "planarity": 0.201, "simple_Shear": -0.153, "simple_Stretch": -0.272, "simple_Buckle": -0.457, "simple_Propeller": -4.309, "bp_simpleParams": [ -0.153, -0.272, 0.915, -0.457, -4.309, -0.745 ], "bp_params": [ -0.147, -0.274, 0.915, -0.373, -4.317, -0.745 ], "frame": { "rmsd": null, "origin": [ 123.390, 131.277, 186.174 ], "x_axis": [ 0.013, -0.250, 0.968 ], "y_axis": [ -1.000, -0.030, 0.006 ], "z_axis": [ 0.028, -0.968, -0.251 ], "quaternion": [ 0.428, 0.569, -0.549, 0.438 ] } }, { "index": 142, "nt1": "///I/148", "nt2": "///J/33", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -106.428, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 52.675, "chi2": -108.260, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.154, "C1C1_dist": 10.711, "N1N9_dist": 8.933, "C6C8_dist": 9.848, "CNNC_torsion": -8.059, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.90],N1(imino)-N3[2.88],N2(amino)-O2(carbonyl)[2.76]", "interBase_angle": 4.418, "planarity": 0.132, "simple_Shear": -0.194, "simple_Stretch": -0.185, "simple_Buckle": -2.753, "simple_Propeller": -3.455, "bp_simpleParams": [ -0.194, -0.185, 0.464, -2.753, -3.455, -0.507 ], "bp_params": [ -0.191, -0.187, 0.464, -2.704, -3.493, -0.508 ], "frame": { "rmsd": null, "origin": [ 121.637, 127.722, 184.299 ], "x_axis": [ -0.659, -0.206, 0.723 ], "y_axis": [ -0.752, 0.159, -0.640 ], "z_axis": [ 0.017, -0.966, -0.260 ], "quaternion": [ -0.245, -0.332, 0.721, -0.557 ] } }, { "index": 143, "nt1": "///I/149", "nt2": "///J/32", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -108.357, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.989, "chi2": -112.143, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 52.979, "C1C1_dist": 10.697, "N1N9_dist": 8.944, "C6C8_dist": 9.881, "CNNC_torsion": 0.944, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.75],N3-N1(imino)[2.89],N4(amino)-O6(carbonyl)[2.92]", "interBase_angle": 2.212, "planarity": 0.080, "simple_Shear": 0.212, "simple_Stretch": -0.146, "simple_Buckle": -0.921, "simple_Propeller": -2.011, "bp_simpleParams": [ 0.212, -0.146, -0.286, -0.921, -2.011, 0.670 ], "bp_params": [ 0.209, -0.150, -0.286, -0.953, -1.996, 0.670 ], "frame": { "rmsd": null, "origin": [ 121.528, 124.240, 183.495 ], "x_axis": [ -0.975, -0.048, 0.216 ], "y_axis": [ -0.221, 0.236, -0.946 ], "z_axis": [ -0.006, -0.970, -0.241 ], "quaternion": [ -0.071, -0.086, 0.783, -0.612 ] } }, { "index": 144, "nt1": "///I/150", "nt2": "///J/31", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -115.274, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.226, "chi2": -104.295, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 52.110, "C1C1_dist": 10.702, "N1N9_dist": 8.911, "C6C8_dist": 9.825, "CNNC_torsion": 0.535, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.94],N1-N3(imino)[2.86]", "interBase_angle": 7.246, "planarity": 0.106, "simple_Shear": 0.076, "simple_Stretch": -0.112, "simple_Buckle": -6.605, "simple_Propeller": 2.979, "bp_simpleParams": [ 0.076, -0.112, 0.127, -6.605, 2.979, -1.489 ], "bp_params": [ 0.075, -0.113, 0.127, -6.572, 3.051, -1.487 ], "frame": { "rmsd": null, "origin": [ 122.130, 120.939, 181.510 ], "x_axis": [ -0.885, 0.234, -0.401 ], "y_axis": [ 0.455, 0.262, -0.851 ], "z_axis": [ -0.094, -0.936, -0.338 ], "quaternion": [ 0.097, 0.219, 0.788, -0.567 ] } }, { "index": 145, "nt1": "///I/151", "nt2": "///J/30", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -141.089, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.862, "chi2": -115.375, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 54.396, "C1C1_dist": 10.629, "N1N9_dist": 8.896, "C6C8_dist": 9.858, "CNNC_torsion": -1.214, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.95],N1(imino)-N3[2.90],N2(amino)-O2(carbonyl)[2.76]", "interBase_angle": 6.697, "planarity": 0.186, "simple_Shear": -0.199, "simple_Stretch": -0.182, "simple_Buckle": -2.065, "simple_Propeller": 6.371, "bp_simpleParams": [ -0.199, -0.182, 0.613, -2.065, 6.371, 2.321 ], "bp_params": [ -0.196, -0.185, 0.613, -2.161, 6.339, 2.324 ], "frame": { "rmsd": null, "origin": [ 121.169, 117.702, 180.600 ], "x_axis": [ -0.512, 0.414, -0.752 ], "y_axis": [ 0.850, 0.122, -0.512 ], "z_axis": [ -0.121, -0.902, -0.415 ], "quaternion": [ 0.221, 0.442, 0.716, -0.494 ] } }, { "index": 146, "nt1": "///I/152", "nt2": "///J/29", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -136.602, "conf1": "anti", "pucker1": "----", "lambda1": 54.576, "chi2": -129.528, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 54.657, "C1C1_dist": 10.554, "N1N9_dist": 8.844, "C6C8_dist": 9.821, "CNNC_torsion": -1.850, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.94],N1(imino)-N3[2.89],N2(amino)-O2(carbonyl)[2.75]", "interBase_angle": 6.499, "planarity": 0.213, "simple_Shear": -0.198, "simple_Stretch": -0.231, "simple_Buckle": -0.998, "simple_Propeller": 6.422, "bp_simpleParams": [ -0.198, -0.231, 0.783, -0.998, 6.422, 2.997 ], "bp_params": [ -0.195, -0.234, 0.783, -1.094, 6.407, 3.001 ], "frame": { "rmsd": null, "origin": [ 119.744, 114.909, 179.230 ], "x_axis": [ 0.044, 0.469, -0.882 ], "y_axis": [ 0.992, -0.127, -0.019 ], "z_axis": [ -0.121, -0.874, -0.471 ], "quaternion": [ 0.334, 0.641, 0.570, -0.391 ] } }, { "index": 147, "nt1": "///I/153", "nt2": "///J/28", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -140.181, "conf1": "anti", "pucker1": "----", "lambda1": 53.035, "chi2": -127.694, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 54.517, "C1C1_dist": 10.467, "N1N9_dist": 8.722, "C6C8_dist": 9.664, "CNNC_torsion": -5.890, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.88],O4(carbonyl)-N6(amino)[2.94]", "interBase_angle": 7.178, "planarity": 0.279, "simple_Shear": -0.092, "simple_Stretch": -0.365, "simple_Buckle": 2.135, "simple_Propeller": 6.853, "bp_simpleParams": [ -0.092, -0.365, 1.202, 2.135, 6.853, 0.842 ], "bp_params": [ -0.087, -0.366, 1.202, 2.041, 6.882, 0.843 ], "frame": { "rmsd": null, "origin": [ 118.561, 112.339, 177.083 ], "x_axis": [ 0.552, 0.386, -0.739 ], "y_axis": [ 0.828, -0.360, 0.430 ], "z_axis": [ -0.100, -0.849, -0.518 ], "quaternion": [ 0.410, 0.779, 0.389, -0.269 ] } }, { "index": 148, "nt1": "///I/154", "nt2": "///J/27", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -139.081, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.697, "chi2": -135.958, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 54.315, "C1C1_dist": 10.542, "N1N9_dist": 8.808, "C6C8_dist": 9.747, "CNNC_torsion": -6.676, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.91],N1(imino)-N3[2.90],N2(amino)-O2(carbonyl)[2.77]", "interBase_angle": 5.929, "planarity": 0.244, "simple_Shear": -0.186, "simple_Stretch": -0.335, "simple_Buckle": 3.478, "simple_Propeller": 4.802, "bp_simpleParams": [ -0.186, -0.335, 1.131, 3.478, 4.802, 1.720 ], "bp_params": [ -0.182, -0.337, 1.131, 3.415, 4.847, 1.721 ], "frame": { "rmsd": null, "origin": [ 118.026, 110.336, 174.526 ], "x_axis": [ 0.920, 0.170, -0.354 ], "y_axis": [ 0.386, -0.556, 0.736 ], "z_axis": [ -0.072, -0.813, -0.577 ], "quaternion": [ 0.443, 0.874, 0.159, -0.122 ] } }, { "index": 149, "nt1": "///I/155", "nt2": "///J/26", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -141.713, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.802, "chi2": -153.159, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 54.569, "C1C1_dist": 10.530, "N1N9_dist": 8.804, "C6C8_dist": 9.735, "CNNC_torsion": -11.518, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.93],N1(imino)-N3[2.90],N2(amino)-O2(carbonyl)[2.75]", "interBase_angle": 6.401, "planarity": 0.252, "simple_Shear": -0.159, "simple_Stretch": -0.360, "simple_Buckle": 6.330, "simple_Propeller": 0.951, "bp_simpleParams": [ -0.159, -0.360, 1.281, 6.330, 0.951, 0.715 ], "bp_params": [ -0.155, -0.361, 1.281, 6.319, 1.019, 0.714 ], "frame": { "rmsd": null, "origin": [ 117.706, 107.716, 171.845 ], "x_axis": [ 0.989, -0.089, 0.120 ], "y_axis": [ -0.149, -0.584, 0.798 ], "z_axis": [ -0.002, -0.807, -0.590 ], "quaternion": [ 0.451, 0.889, -0.067, 0.033 ] } }, { "index": 150, "nt1": "///I/156", "nt2": "///J/25", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -107.717, "conf1": "anti", "pucker1": "----", "lambda1": 55.461, "chi2": -130.892, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 52.817, "C1C1_dist": 10.464, "N1N9_dist": 8.737, "C6C8_dist": 9.702, "CNNC_torsion": -10.625, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.97],N1-N3(imino)[2.80]", "interBase_angle": 4.201, "planarity": 0.205, "simple_Shear": 0.184, "simple_Stretch": -0.303, "simple_Buckle": 3.037, "simple_Propeller": -2.902, "bp_simpleParams": [ 0.184, -0.303, 1.024, 3.037, -2.902, 0.070 ], "bp_params": [ 0.177, -0.307, 1.024, 2.971, -2.969, 0.070 ], "frame": { "rmsd": null, "origin": [ 117.441, 105.705, 168.939 ], "x_axis": [ 0.640, -0.479, 0.601 ], "y_axis": [ -0.768, -0.406, 0.495 ], "z_axis": [ 0.007, -0.778, -0.628 ], "quaternion": [ 0.389, 0.818, -0.381, 0.186 ] } }, { "index": 151, "nt1": "///I/157", "nt2": "///J/24", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -137.269, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 51.245, "chi2": -133.883, "conf2": "anti", "pucker2": "----", "lambda2": 52.960, "C1C1_dist": 10.726, "N1N9_dist": 8.912, "C6C8_dist": 9.803, "CNNC_torsion": -11.636, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.86],O4(carbonyl)-N6(amino)[2.94]", "interBase_angle": 6.443, "planarity": 0.154, "simple_Shear": -0.132, "simple_Stretch": -0.168, "simple_Buckle": -0.768, "simple_Propeller": -6.397, "bp_simpleParams": [ -0.132, -0.168, 0.619, -0.768, -6.397, -3.027 ], "bp_params": [ -0.129, -0.170, 0.619, -0.658, -6.409, -3.031 ], "frame": { "rmsd": null, "origin": [ 117.903, 103.175, 166.239 ], "x_axis": [ 0.161, -0.641, 0.751 ], "y_axis": [ -0.987, -0.111, 0.117 ], "z_axis": [ 0.009, -0.760, -0.650 ], "quaternion": [ 0.316, 0.693, -0.587, 0.274 ] } }, { "index": 152, "nt1": "///I/158", "nt2": "///J/23", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -114.202, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.541, "chi2": -124.885, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 52.140, "C1C1_dist": 10.699, "N1N9_dist": 8.915, "C6C8_dist": 9.842, "CNNC_torsion": -2.157, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.96],N1-N3(imino)[2.85]", "interBase_angle": 6.823, "planarity": 0.088, "simple_Shear": 0.090, "simple_Stretch": -0.105, "simple_Buckle": -5.267, "simple_Propeller": -4.337, "bp_simpleParams": [ 0.090, -0.105, -0.221, -5.267, -4.337, -0.918 ], "bp_params": [ 0.089, -0.106, -0.221, -5.329, -4.261, -0.918 ], "frame": { "rmsd": null, "origin": [ 118.251, 101.198, 163.352 ], "x_axis": [ -0.519, -0.557, 0.648 ], "y_axis": [ -0.855, 0.343, -0.390 ], "z_axis": [ -0.005, -0.756, -0.654 ], "quaternion": [ -0.206, -0.445, 0.793, -0.361 ] } }, { "index": 153, "nt1": "///I/159", "nt2": "///J/22", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -107.075, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 50.721, "chi2": -109.240, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 52.492, "C1C1_dist": 10.794, "N1N9_dist": 8.959, "C6C8_dist": 9.835, "CNNC_torsion": -0.665, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.88],O4(carbonyl)-N6(amino)[2.90]", "interBase_angle": 5.250, "planarity": 0.093, "simple_Shear": -0.131, "simple_Stretch": -0.108, "simple_Buckle": -5.130, "simple_Propeller": -1.117, "bp_simpleParams": [ -0.131, -0.108, -0.194, -5.130, -1.117, -3.236 ], "bp_params": [ -0.129, -0.111, -0.194, -5.110, -1.204, -3.233 ], "frame": { "rmsd": null, "origin": [ 119.076, 98.494, 161.158 ], "x_axis": [ -0.883, -0.285, 0.373 ], "y_axis": [ -0.468, 0.591, -0.657 ], "z_axis": [ -0.033, -0.754, -0.656 ], "quaternion": [ -0.115, -0.213, 0.885, -0.399 ] } }, { "index": 154, "nt1": "///I/160", "nt2": "///J/21", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -92.764, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 51.000, "chi2": -102.689, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 52.424, "C1C1_dist": 10.739, "N1N9_dist": 8.909, "C6C8_dist": 9.787, "CNNC_torsion": -4.934, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.87],O4(carbonyl)-N6(amino)[2.89]", "interBase_angle": 2.545, "planarity": 0.128, "simple_Shear": -0.113, "simple_Stretch": -0.180, "simple_Buckle": -0.611, "simple_Propeller": 2.471, "bp_simpleParams": [ -0.113, -0.180, 0.617, -0.611, 2.471, -2.802 ], "bp_params": [ -0.110, -0.182, 0.617, -0.649, 2.461, -2.803 ], "frame": { "rmsd": null, "origin": [ 118.908, 96.030, 158.347 ], "x_axis": [ -0.987, 0.160, -0.028 ], "y_axis": [ 0.126, 0.648, -0.752 ], "z_axis": [ -0.102, -0.745, -0.659 ], "quaternion": [ -0.020, 0.079, 0.907, -0.412 ] } }, { "index": 155, "nt1": "///I/161", "nt2": "///J/20", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -113.528, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 52.663, "chi2": -141.581, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 52.880, "C1C1_dist": 10.738, "N1N9_dist": 8.948, "C6C8_dist": 9.856, "CNNC_torsion": -3.170, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.91],N1(imino)-N3[2.91],N2(amino)-O2(carbonyl)[2.81]", "interBase_angle": 4.691, "planarity": 0.151, "simple_Shear": -0.170, "simple_Stretch": -0.192, "simple_Buckle": 3.226, "simple_Propeller": 3.406, "bp_simpleParams": [ -0.170, -0.192, 0.732, 3.226, 3.406, 0.020 ], "bp_params": [ -0.168, -0.194, 0.732, 3.186, 3.443, 0.020 ], "frame": { "rmsd": null, "origin": [ 116.964, 94.468, 155.583 ], "x_axis": [ -0.739, 0.528, -0.419 ], "y_axis": [ 0.657, 0.426, -0.622 ], "z_axis": [ -0.150, -0.735, -0.662 ], "quaternion": [ 0.080, 0.352, 0.841, -0.404 ] } }, { "index": 156, "nt1": "///I/162", "nt2": "///J/19", "bp": "A-T", "name": "--", "Saenger": "--", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -125.412, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 42.415, "chi2": -135.408, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 25.390, "C1C1_dist": 12.946, "N1N9_dist": 10.527, "C6C8_dist": 10.523, "CNNC_torsion": -15.820, "hbonds_num": 1, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.05]", "interBase_angle": 10.495, "planarity": 0.272, "simple_Shear": 1.716, "simple_Stretch": 1.238, "simple_Buckle": 0.380, "simple_Propeller": 10.488, "bp_simpleParams": [ 1.716, 1.238, 1.557, 0.380, 10.488, -39.327 ], "bp_params": [ 1.914, 0.904, 1.557, 2.288, 10.243, -39.465 ], "frame": { "rmsd": null, "origin": [ 117.375, 90.108, 154.688 ], "x_axis": [ -0.095, 0.751, -0.654 ], "y_axis": [ 0.982, -0.036, -0.183 ], "z_axis": [ -0.161, -0.659, -0.734 ], "quaternion": [ 0.184, 0.647, 0.670, -0.315 ] } }, { "index": 157, "nt1": "///I/163", "nt2": "///J/18", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -126.825, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 52.933, "chi2": -139.386, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 54.785, "C1C1_dist": 10.495, "N1N9_dist": 8.751, "C6C8_dist": 9.691, "CNNC_torsion": -5.652, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.90],O4(carbonyl)-N6(amino)[2.95]", "interBase_angle": 7.894, "planarity": 0.279, "simple_Shear": -0.104, "simple_Stretch": -0.323, "simple_Buckle": 4.709, "simple_Propeller": 6.336, "bp_simpleParams": [ -0.104, -0.323, 1.124, 4.709, 6.336, 0.606 ], "bp_params": [ -0.100, -0.324, 1.124, 4.619, 6.402, 0.607 ], "frame": { "rmsd": null, "origin": [ 115.822, 89.824, 150.411 ], "x_axis": [ 0.214, 0.724, -0.656 ], "y_axis": [ 0.968, -0.248, 0.042 ], "z_axis": [ -0.132, -0.644, -0.753 ], "quaternion": [ 0.231, 0.744, 0.568, -0.265 ] } }, { "index": 158, "nt1": "///I/164", "nt2": "///J/17", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -116.731, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 54.328, "chi2": -103.130, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 54.839, "C1C1_dist": 10.523, "N1N9_dist": 8.814, "C6C8_dist": 9.774, "CNNC_torsion": -9.764, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.95],N1(imino)-N3[2.89],N2(amino)-O2(carbonyl)[2.72]", "interBase_angle": 2.901, "planarity": 0.244, "simple_Shear": -0.191, "simple_Stretch": -0.294, "simple_Buckle": -2.887, "simple_Propeller": -0.283, "bp_simpleParams": [ -0.191, -0.294, 0.966, -2.887, -0.283, 1.543 ], "bp_params": [ -0.187, -0.297, 0.966, -2.882, -0.324, 1.543 ], "frame": { "rmsd": null, "origin": [ 115.830, 87.818, 147.322 ], "x_axis": [ 0.808, 0.406, -0.426 ], "y_axis": [ 0.561, -0.750, 0.351 ], "z_axis": [ -0.177, -0.523, -0.834 ], "quaternion": [ 0.237, 0.921, 0.263, -0.164 ] } }, { "index": 159, "nt1": "///I/165", "nt2": "///J/16", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -108.985, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 52.449, "chi2": -104.867, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 52.890, "C1C1_dist": 10.747, "N1N9_dist": 8.957, "C6C8_dist": 9.863, "CNNC_torsion": -6.228, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.91],N1(imino)-N3[2.92],N2(amino)-O2(carbonyl)[2.81]", "interBase_angle": 1.668, "planarity": 0.151, "simple_Shear": -0.180, "simple_Stretch": -0.180, "simple_Buckle": -1.094, "simple_Propeller": 1.259, "bp_simpleParams": [ -0.180, -0.180, 0.618, -1.094, 1.259, -0.434 ], "bp_params": [ -0.178, -0.183, 0.618, -1.111, 1.244, -0.434 ], "frame": { "rmsd": null, "origin": [ 114.119, 85.515, 145.100 ], "x_axis": [ 0.991, -0.088, -0.100 ], "y_axis": [ -0.019, -0.832, 0.554 ], "z_axis": [ -0.132, -0.547, -0.827 ], "quaternion": [ 0.288, 0.955, -0.028, -0.061 ] } }, { "index": 160, "nt1": "///I/166", "nt2": "///J/15", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -109.228, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 55.254, "chi2": -117.193, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 54.990, "C1C1_dist": 10.494, "N1N9_dist": 8.804, "C6C8_dist": 9.786, "CNNC_torsion": -6.614, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.70],N3-N1(imino)[2.88],N4(amino)-O6(carbonyl)[2.95]", "interBase_angle": 2.803, "planarity": 0.230, "simple_Shear": 0.193, "simple_Stretch": -0.276, "simple_Buckle": 2.248, "simple_Propeller": 1.674, "bp_simpleParams": [ 0.193, -0.276, 0.909, 2.248, 1.674, 2.684 ], "bp_params": [ 0.189, -0.279, 0.909, 2.272, 1.641, 2.683 ], "frame": { "rmsd": null, "origin": [ 115.156, 83.006, 142.537 ], "x_axis": [ 0.774, -0.569, 0.278 ], "y_axis": [ -0.625, -0.613, 0.483 ], "z_axis": [ -0.105, -0.547, -0.830 ], "quaternion": [ 0.287, 0.897, -0.333, 0.048 ] } }, { "index": 161, "nt1": "///I/167", "nt2": "///J/14", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -126.883, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 51.868, "chi2": -114.075, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 52.938, "C1C1_dist": 10.706, "N1N9_dist": 8.908, "C6C8_dist": 9.799, "CNNC_torsion": -9.211, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.89],N1(imino)-N3[2.91],N2(amino)-O2(carbonyl)[2.80]", "interBase_angle": 1.640, "planarity": 0.194, "simple_Shear": -0.184, "simple_Stretch": -0.266, "simple_Buckle": 1.621, "simple_Propeller": -0.252, "bp_simpleParams": [ -0.184, -0.266, 0.914, 1.621, -0.252, -1.026 ], "bp_params": [ -0.181, -0.268, 0.914, 1.624, -0.230, -1.025 ], "frame": { "rmsd": null, "origin": [ 114.245, 81.743, 139.707 ], "x_axis": [ 0.243, -0.799, 0.550 ], "y_axis": [ -0.963, -0.132, 0.234 ], "z_axis": [ -0.115, -0.587, -0.801 ], "quaternion": [ 0.278, 0.738, -0.597, 0.148 ] } }, { "index": 162, "nt1": "///I/168", "nt2": "///J/13", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -114.345, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 51.248, "chi2": -125.543, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 51.866, "C1C1_dist": 10.772, "N1N9_dist": 8.939, "C6C8_dist": 9.803, "CNNC_torsion": -11.283, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.88],N1(imino)-N3[2.91],N2(amino)-O2(carbonyl)[2.83]", "interBase_angle": 2.550, "planarity": 0.189, "simple_Shear": -0.168, "simple_Stretch": -0.257, "simple_Buckle": 1.206, "simple_Propeller": -2.246, "bp_simpleParams": [ -0.168, -0.257, 0.876, 1.206, -2.246, -2.287 ], "bp_params": [ -0.165, -0.260, 0.876, 1.233, -2.232, -2.287 ], "frame": { "rmsd": null, "origin": [ 114.418, 80.116, 136.940 ], "x_axis": [ -0.382, -0.690, 0.615 ], "y_axis": [ -0.914, 0.380, -0.142 ], "z_axis": [ -0.136, -0.616, -0.776 ], "quaternion": [ -0.236, -0.503, 0.797, -0.238 ] } }, { "index": 163, "nt1": "///I/169", "nt2": "///J/12", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -111.469, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 50.257, "chi2": -123.335, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 52.234, "C1C1_dist": 10.789, "N1N9_dist": 8.941, "C6C8_dist": 9.799, "CNNC_torsion": -10.531, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.90],O4(carbonyl)-N6(amino)[2.92]", "interBase_angle": 3.668, "planarity": 0.171, "simple_Shear": -0.157, "simple_Stretch": -0.182, "simple_Buckle": -0.768, "simple_Propeller": -3.587, "bp_simpleParams": [ -0.157, -0.182, 0.792, -0.768, -3.587, -4.231 ], "bp_params": [ -0.153, -0.185, 0.792, -0.697, -3.602, -4.233 ], "frame": { "rmsd": null, "origin": [ 114.197, 77.394, 134.930 ], "x_axis": [ -0.820, -0.357, 0.447 ], "y_axis": [ -0.559, 0.669, -0.491 ], "z_axis": [ -0.124, -0.652, -0.748 ], "quaternion": [ -0.159, -0.255, 0.899, -0.318 ] } }, { "index": 164, "nt1": "///I/170", "nt2": "///J/11", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -116.377, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 51.542, "chi2": -113.248, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 49.690, "C1C1_dist": 10.891, "N1N9_dist": 9.017, "C6C8_dist": 9.857, "CNNC_torsion": -5.430, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.91],N1-N3(imino)[2.93]", "interBase_angle": 4.438, "planarity": 0.121, "simple_Shear": 0.114, "simple_Stretch": -0.092, "simple_Buckle": -3.972, "simple_Propeller": -1.979, "bp_simpleParams": [ 0.114, -0.092, 0.394, -3.972, -1.979, -4.676 ], "bp_params": [ 0.112, -0.094, 0.394, -4.003, -1.916, -4.674 ], "frame": { "rmsd": null, "origin": [ 113.933, 75.578, 131.550 ], "x_axis": [ -0.991, 0.126, 0.048 ], "y_axis": [ 0.063, 0.752, -0.656 ], "z_axis": [ -0.119, -0.647, -0.753 ], "quaternion": [ -0.045, 0.051, 0.935, -0.349 ] } }, { "index": 165, "nt1": "///I/171", "nt2": "///J/10", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -127.652, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 51.880, "chi2": -120.526, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 50.080, "C1C1_dist": 10.876, "N1N9_dist": 9.016, "C6C8_dist": 9.875, "CNNC_torsion": -2.896, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.92],N1-N3(imino)[2.92]", "interBase_angle": 3.800, "planarity": 0.062, "simple_Shear": 0.105, "simple_Stretch": -0.068, "simple_Buckle": -3.754, "simple_Propeller": -0.587, "bp_simpleParams": [ 0.105, -0.068, 0.086, -3.754, -0.587, -3.864 ], "bp_params": [ 0.104, -0.069, 0.086, -3.762, -0.531, -3.862 ], "frame": { "rmsd": null, "origin": [ 113.760, 73.046, 129.136 ], "x_axis": [ -0.809, 0.529, -0.255 ], "y_axis": [ 0.569, 0.598, -0.564 ], "z_axis": [ -0.146, -0.602, -0.785 ], "quaternion": [ 0.031, 0.307, 0.893, -0.326 ] } }, { "index": 166, "nt1": "///I/172", "nt2": "///J/9", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -118.075, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 54.091, "chi2": -110.693, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 52.533, "C1C1_dist": 10.722, "N1N9_dist": 8.962, "C6C8_dist": 9.892, "CNNC_torsion": -1.929, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.77],N3-N1(imino)[2.90],N4(amino)-O6(carbonyl)[2.93]", "interBase_angle": 2.124, "planarity": 0.073, "simple_Shear": 0.229, "simple_Stretch": -0.137, "simple_Buckle": -0.632, "simple_Propeller": 2.028, "bp_simpleParams": [ 0.229, -0.137, 0.312, -0.632, 2.028, 0.500 ], "bp_params": [ 0.226, -0.141, 0.312, -0.596, 2.039, 0.500 ], "frame": { "rmsd": null, "origin": [ 112.422, 70.999, 126.749 ], "x_axis": [ -0.394, 0.782, -0.483 ], "y_axis": [ 0.908, 0.247, -0.340 ], "z_axis": [ -0.146, -0.572, -0.807 ], "quaternion": [ 0.108, 0.540, 0.782, -0.291 ] } }, { "index": 167, "nt1": "///I/173", "nt2": "///J/8", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -110.411, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.627, "chi2": -104.409, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.274, "C1C1_dist": 10.606, "N1N9_dist": 8.848, "C6C8_dist": 9.768, "CNNC_torsion": -12.381, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.92],N1(imino)-N3[2.89],N2(amino)-O2(carbonyl)[2.75]", "interBase_angle": 3.243, "planarity": 0.233, "simple_Shear": -0.131, "simple_Stretch": -0.311, "simple_Buckle": 0.011, "simple_Propeller": -3.243, "bp_simpleParams": [ -0.131, -0.311, 1.034, 0.011, -3.243, -0.529 ], "bp_params": [ -0.128, -0.312, 1.034, 0.038, -3.242, -0.528 ], "frame": { "rmsd": null, "origin": [ 112.555, 69.415, 123.553 ], "x_axis": [ 0.255, 0.804, -0.537 ], "y_axis": [ 0.954, -0.298, 0.006 ], "z_axis": [ -0.155, -0.514, -0.843 ], "quaternion": [ 0.168, 0.774, 0.568, -0.224 ] } }, { "index": 168, "nt1": "///I/174", "nt2": "///J/7", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -117.072, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.694, "chi2": -102.679, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.077, "C1C1_dist": 10.563, "N1N9_dist": 8.808, "C6C8_dist": 9.720, "CNNC_torsion": -16.155, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.92],N1(imino)-N3[2.89],N2(amino)-O2(carbonyl)[2.75]", "interBase_angle": 6.453, "planarity": 0.282, "simple_Shear": -0.124, "simple_Stretch": -0.369, "simple_Buckle": -2.925, "simple_Propeller": -5.752, "bp_simpleParams": [ -0.124, -0.369, 1.129, -2.925, -5.752, -1.345 ], "bp_params": [ -0.121, -0.370, 1.129, -2.882, -5.774, -1.347 ], "frame": { "rmsd": null, "origin": [ 112.516, 66.985, 120.497 ], "x_axis": [ 0.799, 0.432, -0.419 ], "y_axis": [ 0.582, -0.731, 0.356 ], "z_axis": [ -0.153, -0.528, -0.835 ], "quaternion": [ 0.241, 0.917, 0.276, -0.156 ] } }, { "index": 169, "nt1": "///I/175", "nt2": "///J/6", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -121.948, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 57.934, "chi2": -128.864, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 55.094, "C1C1_dist": 9.970, "N1N9_dist": 8.347, "C6C8_dist": 9.354, "CNNC_torsion": -14.902, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.96],N1-N3(imino)[2.82]", "interBase_angle": 4.431, "planarity": 0.403, "simple_Shear": 0.237, "simple_Stretch": -0.779, "simple_Buckle": 1.258, "simple_Propeller": 4.249, "bp_simpleParams": [ 0.237, -0.779, 1.854, 1.258, 4.249, 4.011 ], "bp_params": [ 0.214, -0.786, 1.854, 1.379, 4.211, 4.013 ], "frame": { "rmsd": null, "origin": [ 112.595, 64.840, 117.531 ], "x_axis": [ 0.958, -0.249, -0.144 ], "y_axis": [ -0.091, -0.738, 0.669 ], "z_axis": [ -0.273, -0.628, -0.729 ], "quaternion": [ 0.350, 0.925, -0.092, -0.113 ] } } ], "num_helices": 2, "helices": [ { "index": 1, "num_stems": 1, "strand1": "ACCGCCATCAATATCCACCTGCAGATTCTAC", "strand2": "TGGCGGTAGTTATAGGTGGACGTCTAAGATG", "bp_type": "|||||||||||||||||||||||||||||||", "helix_form": ".B.BB..B.B.BBBBBBBBBB.BBBBB..B", "helical_rise": 3.065, "helical_rise_std": 1.219, "helical_radius": 10.768, "helical_radius_std": 4.575, "helical_axis": [ 0.097, 0.942, 0.320 ], "point1": [ 148.951, 99.218, 85.926 ], "point2": [ 157.868, 185.720, 115.314 ], "num_pairs": 31, "pairs": [ { "index": 1, "nt1": "///I/12", "nt2": "///J/169", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.099, -0.151, 0.505, -6.386, 1.767, -0.622 ], "step_params": [ -0.288, -1.438, 4.020, -2.767, 0.901, 33.354 ], "heli_params": [ -2.679, -0.060, 3.991, 1.567, 4.810, 33.477 ], "bp2_params": [ 0.226, -0.133, 0.235, -6.135, 8.591, 1.307 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 4.020, "simple_Twist": 32.802, "simple_hRise": 3.990, "simple_hTwist": 32.927 }, { "index": 2, "nt1": "///I/13", "nt2": "///J/168", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.226, -0.133, 0.235, -6.135, 8.591, 1.307 ], "step_params": [ 0.459, -0.796, 3.471, -3.629, 4.197, 33.492 ], "heli_params": [ -2.063, -1.392, 3.284, 7.222, 6.245, 33.936 ], "bp2_params": [ 0.243, -0.139, 0.176, -1.696, 13.766, 1.928 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.471, "simple_Twist": 33.403, "simple_hRise": 3.284, "simple_hTwist": 33.848 }, { "index": 3, "nt1": "///I/14", "nt2": "///J/167", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.243, -0.139, 0.176, -1.696, 13.766, 1.928 ], "step_params": [ -0.047, -1.041, 3.116, 7.325, 23.333, 34.511 ], "heli_params": [ -3.549, 0.725, 2.007, 34.492, -10.828, 42.082 ], "bp2_params": [ -0.193, -0.169, -0.698, -8.243, -3.584, 0.367 ], "groove_widths": [ 15.229, null, 17.622, null ], "simple_Rise": 3.116, "simple_Twist": 36.766, "simple_hRise": 2.087, "simple_hTwist": 43.921 }, { "index": 4, "nt1": "///I/15", "nt2": "///J/166", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.193, -0.169, -0.698, -8.243, -3.584, 0.367 ], "step_params": [ 0.619, 0.134, 3.374, -2.091, 2.256, 33.574 ], "heli_params": [ -0.146, -1.416, 3.332, 3.895, 3.610, 33.711 ], "bp2_params": [ 0.198, -0.133, -0.049, -2.655, 0.838, 0.993 ], "groove_widths": [ 14.872, 14.047, 18.549, 16.687 ], "simple_Rise": 3.374, "simple_Twist": 31.456, "simple_hRise": 3.328, "simple_hTwist": 31.602 }, { "index": 5, "nt1": "///I/16", "nt2": "///J/165", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.198, -0.133, -0.049, -2.655, 0.838, 0.993 ], "step_params": [ 0.798, -1.138, 3.420, -1.321, 2.265, 31.274 ], "heli_params": [ -2.542, -1.730, 3.296, 4.192, 2.444, 31.381 ], "bp2_params": [ 0.197, -0.213, 0.680, 0.619, 1.269, 0.754 ], "groove_widths": [ 14.504, 13.955, 19.347, 17.916 ], "simple_Rise": 3.420, "simple_Twist": 31.276, "simple_hRise": 3.296, "simple_hTwist": 31.383 }, { "index": 6, "nt1": "///I/17", "nt2": "///J/164", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.197, -0.213, 0.680, 0.619, 1.269, 0.754 ], "step_params": [ -2.710, -0.671, 3.236, -4.220, 9.970, 39.246 ], "heli_params": [ -2.083, 3.428, 3.240, 14.511, 6.142, 40.655 ], "bp2_params": [ 1.688, 0.370, 1.501, 0.146, 13.101, -28.556 ], "groove_widths": [ 14.894, 14.410, 17.979, 17.069 ], "simple_Rise": 3.236, "simple_Twist": 32.281, "simple_hRise": 3.212, "simple_hTwist": 34.002 }, { "index": 7, "nt1": "///I/18", "nt2": "///J/163", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 1.688, 0.370, 1.501, 0.146, 13.101, -28.556 ], "step_params": [ 1.955, -1.083, 3.505, -0.188, 1.082, 25.133 ], "heli_params": [ -2.824, -4.547, 3.441, 2.486, 0.432, 25.157 ], "bp2_params": [ -0.090, -0.352, 1.187, 3.377, 8.342, -1.213 ], "groove_widths": [ 15.747, 15.314, 14.797, 14.394 ], "simple_Rise": 3.505, "simple_Twist": 33.780, "simple_hRise": 3.459, "simple_hTwist": 33.797 }, { "index": 8, "nt1": "///I/19", "nt2": "///J/162", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.090, -0.352, 1.187, 3.377, 8.342, -1.213 ], "step_params": [ 0.613, -0.133, 3.404, 4.237, 4.997, 39.656 ], "heli_params": [ -0.790, -0.388, 3.408, 7.305, -6.194, 40.172 ], "bp2_params": [ 0.203, -0.417, 1.227, 2.646, 5.329, 1.227 ], "groove_widths": [ 16.010, 15.509, 14.155, 13.766 ], "simple_Rise": 3.404, "simple_Twist": 37.958, "simple_hRise": 3.406, "simple_hTwist": 38.499 }, { "index": 9, "nt1": "///I/20", "nt2": "///J/161", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.203, -0.417, 1.227, 2.646, 5.329, 1.227 ], "step_params": [ 0.038, 0.481, 3.471, 0.700, 3.900, 40.129 ], "heli_params": [ 0.228, 0.029, 3.501, 5.666, -1.017, 40.316 ], "bp2_params": [ 0.294, -0.640, 1.858, 4.360, 4.563, -5.851 ], "groove_widths": [ 15.457, 14.989, 16.298, 15.611 ], "simple_Rise": 3.471, "simple_Twist": 39.461, "simple_hRise": 3.501, "simple_hTwist": 39.651 }, { "index": 10, "nt1": "///I/21", "nt2": "///J/160", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.294, -0.640, 1.858, 4.360, 4.563, -5.851 ], "step_params": [ 0.187, -0.621, 3.366, 0.014, 2.510, 33.522 ], "heli_params": [ -1.493, -0.322, 3.312, 4.344, -0.024, 33.613 ], "bp2_params": [ 0.301, -0.490, 1.632, 7.408, 1.522, -2.827 ], "groove_widths": [ 14.646, 14.265, 15.689, 15.366 ], "simple_Rise": 3.366, "simple_Twist": 33.551, "simple_hRise": 3.312, "simple_hTwist": 33.642 }, { "index": 11, "nt1": "///I/22", "nt2": "///J/159", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.301, -0.490, 1.632, 7.408, 1.522, -2.827 ], "step_params": [ -0.544, -1.486, 3.784, 3.536, -2.393, 32.525 ], "heli_params": [ -2.153, 1.672, 3.802, -4.249, -6.279, 32.796 ], "bp2_params": [ -0.252, -0.536, 1.543, 2.210, 0.316, -4.339 ], "groove_widths": [ 14.085, 13.746, 16.267, 16.200 ], "simple_Rise": 3.784, "simple_Twist": 35.772, "simple_hRise": 3.803, "simple_hTwist": 36.018 }, { "index": 12, "nt1": "///I/23", "nt2": "///J/158", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.252, -0.536, 1.543, 2.210, 0.316, -4.339 ], "step_params": [ 0.673, -0.094, 3.632, 2.007, 4.447, 40.685 ], "heli_params": [ -0.676, -0.718, 3.630, 6.369, -2.874, 40.965 ], "bp2_params": [ 0.161, -0.294, 0.962, -2.960, -7.696, -4.604 ], "groove_widths": [ 13.489, 13.233, 17.904, 17.874 ], "simple_Rise": 3.632, "simple_Twist": 38.188, "simple_hRise": 3.628, "simple_hTwist": 38.487 }, { "index": 13, "nt1": "///I/24", "nt2": "///J/157", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.161, -0.294, 0.962, -2.960, -7.696, -4.604 ], "step_params": [ -0.256, -0.708, 3.704, -0.239, -0.930, 29.886 ], "heli_params": [ -1.154, 0.440, 3.726, -1.803, 0.463, 29.901 ], "bp2_params": [ -0.158, -0.141, 0.554, -6.265, -6.429, -2.120 ], "groove_widths": [ 13.386, 13.233, 18.202, 18.025 ], "simple_Rise": 3.704, "simple_Twist": 31.762, "simple_hRise": 3.725, "simple_hTwist": 31.776 }, { "index": 14, "nt1": "///I/25", "nt2": "///J/156", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.158, -0.141, 0.554, -6.265, -6.429, -2.120 ], "step_params": [ -0.220, -0.053, 3.539, -3.046, 0.577, 36.277 ], "heli_params": [ -0.173, -0.107, 3.544, 0.924, 4.881, 36.405 ], "bp2_params": [ 0.157, -0.163, 0.500, -7.370, -0.560, -0.528 ], "groove_widths": [ 14.448, 14.291, 18.504, 18.419 ], "simple_Rise": 3.539, "simple_Twist": 34.506, "simple_hRise": 3.543, "simple_hTwist": 34.641 }, { "index": 15, "nt1": "///I/26", "nt2": "///J/155", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.157, -0.163, 0.500, -7.370, -0.560, -0.528 ], "step_params": [ 0.173, -0.784, 3.454, -3.212, 2.558, 31.592 ], "heli_params": [ -1.917, -0.928, 3.349, 4.675, 5.869, 31.851 ], "bp2_params": [ 0.207, -0.199, 0.630, -4.834, 3.783, 0.608 ], "groove_widths": [ 14.880, 14.471, 17.821, 17.376 ], "simple_Rise": 3.454, "simple_Twist": 31.417, "simple_hRise": 3.348, "simple_hTwist": 31.677 }, { "index": 16, "nt1": "///I/27", "nt2": "///J/154", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.207, -0.199, 0.630, -4.834, 3.783, 0.608 ], "step_params": [ -0.179, -0.207, 3.146, -1.239, 3.766, 34.304 ], "heli_params": [ -0.909, 0.118, 3.111, 6.358, 2.091, 34.526 ], "bp2_params": [ 0.119, -0.283, 0.945, -2.066, 5.933, -0.647 ], "groove_widths": [ 15.210, 14.546, 17.069, 15.980 ], "simple_Rise": 3.146, "simple_Twist": 34.682, "simple_hRise": 3.111, "simple_hTwist": 34.901 }, { "index": 17, "nt1": "///I/28", "nt2": "///J/153", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.119, -0.283, 0.945, -2.066, 5.933, -0.647 ], "step_params": [ -0.057, -0.583, 3.453, -1.027, 5.059, 32.969 ], "heli_params": [ -1.892, -0.078, 3.330, 8.847, 1.797, 33.360 ], "bp2_params": [ 0.219, -0.294, 0.949, 0.887, 6.866, 1.980 ], "groove_widths": [ 16.089, 15.384, 16.717, 15.591 ], "simple_Rise": 3.453, "simple_Twist": 32.447, "simple_hRise": 3.327, "simple_hTwist": 32.844 }, { "index": 18, "nt1": "///I/29", "nt2": "///J/152", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.219, -0.294, 0.949, 0.887, 6.866, 1.980 ], "step_params": [ 0.794, -0.580, 3.248, 1.821, 4.697, 34.296 ], "heli_params": [ -1.686, -1.057, 3.180, 7.912, -3.068, 34.653 ], "bp2_params": [ 0.229, -0.327, 1.027, 1.980, 6.377, 3.069 ], "groove_widths": [ 15.900, 15.229, 16.059, 15.115 ], "simple_Rise": 3.248, "simple_Twist": 34.213, "simple_hRise": 3.179, "simple_hTwist": 34.571 }, { "index": 19, "nt1": "///I/30", "nt2": "///J/151", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.229, -0.327, 1.027, 1.980, 6.377, 3.069 ], "step_params": [ 0.021, -0.760, 3.455, 1.625, 3.513, 30.006 ], "heli_params": [ -2.198, 0.302, 3.343, 6.750, -3.123, 30.249 ], "bp2_params": [ -0.145, -0.482, 1.409, 3.692, 7.370, -1.541 ], "groove_widths": [ 15.220, 14.618, 16.617, 16.149 ], "simple_Rise": 3.455, "simple_Twist": 32.184, "simple_hRise": 3.353, "simple_hTwist": 32.410 }, { "index": 20, "nt1": "///I/31", "nt2": "///J/150", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.145, -0.482, 1.409, 3.692, 7.370, -1.541 ], "step_params": [ 0.154, 0.328, 3.174, 2.463, 2.641, 41.492 ], "heli_params": [ 0.189, 0.036, 3.192, 3.719, -3.469, 41.642 ], "bp2_params": [ -0.177, -0.369, 1.300, 8.313, 4.407, 1.019 ], "groove_widths": [ 14.947, 14.602, 15.732, 15.716 ], "simple_Rise": 3.174, "simple_Twist": 41.488, "simple_hRise": 3.192, "simple_hTwist": 41.638 }, { "index": 21, "nt1": "///I/32", "nt2": "///J/149", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.177, -0.369, 1.300, 8.313, 4.407, 1.019 ], "step_params": [ -0.072, 0.001, 4.022, 3.540, 2.152, 37.017 ], "heli_params": [ -0.350, 0.690, 3.992, 3.376, -5.554, 37.240 ], "bp2_params": [ 0.154, -0.425, 1.275, 3.352, -0.350, -0.283 ], "groove_widths": [ 14.146, 14.070, 15.727, 15.261 ], "simple_Rise": 4.022, "simple_Twist": 35.295, "simple_hRise": 3.989, "simple_hTwist": 35.530 }, { "index": 22, "nt1": "///I/33", "nt2": "///J/148", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.154, -0.425, 1.275, 3.352, -0.350, -0.283 ], "step_params": [ -0.172, 2.569, 4.305, 2.574, -14.099, 42.694 ], "heli_params": [ 4.891, 0.504, 3.323, -18.744, -3.422, 44.928 ], "bp2_params": [ 0.157, -0.343, 1.077, -3.116, -4.010, -2.307 ], "groove_widths": [ 13.112, 13.099, 16.754, 16.107 ], "simple_Rise": 4.305, "simple_Twist": 42.604, "simple_hRise": 3.321, "simple_hTwist": 44.844 }, { "index": 23, "nt1": "///I/34", "nt2": "///J/147", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.157, -0.343, 1.077, -3.116, -4.010, -2.307 ], "step_params": [ -0.015, 0.132, 3.757, -1.088, -0.070, 33.954 ], "heli_params": [ 0.238, -0.174, 3.756, -0.119, 1.863, 33.971 ], "bp2_params": [ -0.185, -0.179, 0.563, -4.343, -3.184, -0.242 ], "groove_widths": [ 12.792, 12.771, 17.390, 16.963 ], "simple_Rise": 3.757, "simple_Twist": 35.942, "simple_hRise": 3.756, "simple_hTwist": 35.958 }, { "index": 24, "nt1": "///I/35", "nt2": "///J/146", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.185, -0.179, 0.563, -4.343, -3.184, -0.242 ], "step_params": [ -0.185, 0.145, 3.509, -1.342, 0.032, 39.294 ], "heli_params": [ 0.211, 0.103, 3.514, 0.048, 1.996, 39.316 ], "bp2_params": [ 0.086, -0.119, 0.092, -5.817, -1.362, 0.562 ], "groove_widths": [ 13.228, 13.093, 16.558, 16.466 ], "simple_Rise": 3.509, "simple_Twist": 37.694, "simple_hRise": 3.514, "simple_hTwist": 37.717 }, { "index": 25, "nt1": "///I/36", "nt2": "///J/145", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.086, -0.119, 0.092, -5.817, -1.362, 0.562 ], "step_params": [ -0.157, -0.918, 3.597, -2.002, 1.095, 31.605 ], "heli_params": [ -1.903, -0.116, 3.567, 2.006, 3.670, 31.685 ], "bp2_params": [ -0.094, -0.111, 0.264, -6.250, 1.619, -1.071 ], "groove_widths": [ 13.961, 13.668, 18.069, 18.057 ], "simple_Rise": 3.597, "simple_Twist": 32.783, "simple_hRise": 3.568, "simple_hTwist": 32.860 }, { "index": 26, "nt1": "///I/37", "nt2": "///J/144", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.094, -0.111, 0.264, -6.250, 1.619, -1.071 ], "step_params": [ 0.502, -0.504, 3.700, -2.130, 2.432, 32.702 ], "heli_params": [ -1.357, -1.297, 3.615, 4.307, 3.771, 32.857 ], "bp2_params": [ -0.087, -0.157, 0.573, -5.130, 7.512, 0.258 ], "groove_widths": [ 14.732, 13.995, 19.821, 19.008 ], "simple_Rise": 3.700, "simple_Twist": 32.709, "simple_hRise": 3.615, "simple_hTwist": 32.864 }, { "index": 27, "nt1": "///I/38", "nt2": "///J/143", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.087, -0.157, 0.573, -5.130, 7.512, 0.258 ], "step_params": [ -0.816, -0.589, 3.264, -0.711, 6.897, 34.331 ], "heli_params": [ -2.000, 1.252, 3.107, 11.539, 1.190, 35.003 ], "bp2_params": [ 0.253, -0.214, 0.652, 0.963, 11.859, 3.356 ], "groove_widths": [ 16.344, 15.386, 18.553, 16.934 ], "simple_Rise": 3.264, "simple_Twist": 32.270, "simple_hRise": 3.092, "simple_hTwist": 32.987 }, { "index": 28, "nt1": "///I/39", "nt2": "///J/142", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.253, -0.214, 0.652, 0.963, 11.859, 3.356 ], "step_params": [ -0.371, -1.492, 3.356, 0.183, 6.416, 23.261 ], "heli_params": [ -5.552, 0.945, 2.844, 15.536, -0.444, 24.119 ], "bp2_params": [ -0.094, -0.331, 1.161, 4.861, 11.471, -2.869 ], "groove_widths": [ 17.547, null, 17.987, null ], "simple_Rise": 3.356, "simple_Twist": 25.222, "simple_hRise": 2.891, "simple_hTwist": 26.013 }, { "index": 29, "nt1": "///I/40", "nt2": "///J/141", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.094, -0.331, 1.161, 4.861, 11.471, -2.869 ], "step_params": [ 2.224, 0.012, 3.054, 3.734, 6.352, 35.482 ], "heli_params": [ -0.846, -3.070, 3.219, 10.286, -6.047, 36.214 ], "bp2_params": [ 0.124, -0.476, 1.551, 8.727, 6.901, 4.826 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.054, "simple_Twist": 34.034, "simple_hRise": 3.223, "simple_hTwist": 34.800 }, { "index": 30, "nt1": "///I/41", "nt2": "///J/140", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.124, -0.476, 1.551, 8.727, 6.901, 4.826 ], "step_params": [ -0.367, -1.006, 3.593, 5.017, 0.185, 30.113 ], "heli_params": [ -1.952, 1.783, 3.481, 0.353, -9.573, 30.519 ], "bp2_params": [ 0.232, -0.335, 1.072, 8.415, 4.750, 4.020 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.593, "simple_Twist": 29.659, "simple_hRise": 3.479, "simple_hTwist": 30.072 }, { "index": 31, "nt1": "///I/42", "nt2": "///J/139", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 2, "num_stems": 4, "strand1": "AAAGTGTATTTGGAAACTGCTCCACAAAGGCATGTTCAGCTGAATTCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGAATCTGCAGGTGGATATTGATGGCGGTAACGGA", "strand2": "TTTCACATAAACCTTTGACGAGGTGTTTCCGTACAAGTCGACTTAAGTCGACTTGTACGGAAAACTACCTCGTCAAAGGTTTATGTGAAAACCATCTTAGACGTCCACCTATAACTACCGCCATTGCCT", "bp_type": "|||||||||||||||||||||||.|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||.|||||||||||||", "helix_form": "BBBBBB..B..BBBBBBBB....xBBx.BBBBBBBB..BBBBBBBB..B.BBBBBBB.B.BBBBBB...BBBBBB.BB.B.BBBB.BBB..B....BBBB.BBBBBBBBBB.BB..BBBBBBBBBBBB", "helical_rise": 0.257, "helical_rise_std": 2.461, "helical_axis": [ -0.988, 0.071, 0.137 ], "point1": [ null, null, null ], "point2": [ null, null, null ], "num_pairs": 129, "pairs": [ { "index": 1, "nt1": "///I/45", "nt2": "///J/136", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.091, -0.226, 0.692, -6.340, -5.429, -0.703 ], "step_params": [ -1.013, -0.200, 3.436, -1.743, 2.115, 37.496 ], "heli_params": [ -0.602, 1.332, 3.462, 3.284, 2.707, 37.593 ], "bp2_params": [ 0.134, -0.256, 0.798, -6.474, -2.824, -2.663 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.436, "simple_Twist": 37.347, "simple_hRise": 3.462, "simple_hTwist": 37.444 }, { "index": 2, "nt1": "///I/46", "nt2": "///J/135", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.134, -0.256, 0.798, -6.474, -2.824, -2.663 ], "step_params": [ -0.044, 0.529, 3.699, -2.224, 2.613, 33.466 ], "heli_params": [ 0.429, -0.337, 3.724, 4.523, 3.850, 33.636 ], "bp2_params": [ 0.106, -0.168, 0.307, -6.166, -1.736, -0.248 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.699, "simple_Twist": 33.601, "simple_hRise": 3.724, "simple_hTwist": 33.771 }, { "index": 3, "nt1": "///I/47", "nt2": "///J/134", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.106, -0.168, 0.307, -6.166, -1.736, -0.248 ], "step_params": [ -0.524, 0.518, 3.394, -1.655, 2.010, 31.362 ], "heli_params": [ 0.562, 0.643, 3.442, 3.710, 3.054, 31.467 ], "bp2_params": [ -0.203, -0.137, 0.168, -4.572, 2.599, 0.336 ], "groove_widths": [ 15.969, null, 16.789, null ], "simple_Rise": 3.394, "simple_Twist": 33.165, "simple_hRise": 3.440, "simple_hTwist": 33.264 }, { "index": 4, "nt1": "///I/48", "nt2": "///J/133", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.203, -0.137, 0.168, -4.572, 2.599, 0.336 ], "step_params": [ 0.534, -0.391, 3.820, -2.787, 3.713, 33.090 ], "heli_params": [ -1.390, -1.462, 3.700, 6.480, 4.863, 33.405 ], "bp2_params": [ -0.077, -0.127, 0.280, 1.150, 2.205, 0.161 ], "groove_widths": [ 16.853, 15.731, 16.808, 15.989 ], "simple_Rise": 3.820, "simple_Twist": 32.455, "simple_hRise": 3.697, "simple_hTwist": 32.776 }, { "index": 5, "nt1": "///I/49", "nt2": "///J/132", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.077, -0.127, 0.280, 1.150, 2.205, 0.161 ], "step_params": [ 0.421, -0.407, 3.122, -2.257, 11.795, 31.820 ], "heli_params": [ -2.456, -1.059, 2.766, 20.618, 3.946, 33.956 ], "bp2_params": [ -0.241, -0.239, 0.798, 3.092, 11.290, 2.923 ], "groove_widths": [ 17.736, 16.138, 16.639, 15.067 ], "simple_Rise": 3.122, "simple_Twist": 32.633, "simple_hRise": 2.779, "simple_hTwist": 34.716 }, { "index": 6, "nt1": "///I/50", "nt2": "///J/131", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.241, -0.239, 0.798, 3.092, 11.290, 2.923 ], "step_params": [ 0.916, -0.826, 3.741, 2.010, 7.984, 31.079 ], "heli_params": [ -3.100, -1.251, 3.478, 14.583, -3.671, 32.125 ], "bp2_params": [ -0.125, -0.587, 1.589, 5.625, 10.531, -0.043 ], "groove_widths": [ 18.263, 16.871, 17.366, 15.177 ], "simple_Rise": 3.741, "simple_Twist": 30.498, "simple_hRise": 3.471, "simple_hTwist": 31.565 }, { "index": 7, "nt1": "///I/51", "nt2": "///J/130", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.125, -0.587, 1.589, 5.625, 10.531, -0.043 ], "step_params": [ -0.009, -0.672, 3.160, 4.352, 6.636, 37.897 ], "heli_params": [ -1.789, 0.522, 2.986, 10.083, -6.613, 38.689 ], "bp2_params": [ 0.335, -0.535, 1.768, 11.495, 3.476, -6.666 ], "groove_widths": [ 17.409, 16.451, 17.594, 16.311 ], "simple_Rise": 3.160, "simple_Twist": 35.155, "simple_hRise": 2.966, "simple_hTwist": 36.012 }, { "index": 8, "nt1": "///I/52", "nt2": "///J/129", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.335, -0.535, 1.768, 11.495, 3.476, -6.666 ], "step_params": [ 0.769, -1.138, 3.701, 6.575, -0.463, 25.337 ], "heli_params": [ -2.368, 0.381, 3.796, -1.033, -14.676, 26.167 ], "bp2_params": [ -0.112, -0.470, 1.336, 9.954, 5.108, 1.255 ], "groove_widths": [ 15.748, 15.277, 17.192, 17.189 ], "simple_Rise": 3.701, "simple_Twist": 28.028, "simple_hRise": 3.797, "simple_hTwist": 28.777 }, { "index": 9, "nt1": "///I/53", "nt2": "///J/128", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.112, -0.470, 1.336, 9.954, 5.108, 1.255 ], "step_params": [ 0.373, -0.246, 3.547, 6.994, 0.759, 39.519 ], "heli_params": [ -0.453, 0.328, 3.554, 1.112, -10.245, 40.115 ], "bp2_params": [ -0.243, -0.549, 1.510, 7.455, -1.415, -6.322 ], "groove_widths": [ 14.244, 14.077, 16.898, 16.825 ], "simple_Rise": 3.547, "simple_Twist": 40.233, "simple_hRise": 3.555, "simple_hTwist": 40.818 }, { "index": 10, "nt1": "///I/54", "nt2": "///J/127", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.243, -0.549, 1.510, 7.455, -1.415, -6.322 ], "step_params": [ 0.199, 0.465, 4.068, 4.953, -1.148, 37.233 ], "heli_params": [ 0.909, 0.496, 4.044, -1.788, -7.714, 37.566 ], "bp2_params": [ -0.246, -0.463, 1.440, 0.794, -3.694, -4.683 ], "groove_widths": [ 13.920, 13.881, 15.888, 15.747 ], "simple_Rise": 4.068, "simple_Twist": 37.294, "simple_hRise": 4.045, "simple_hTwist": 37.627 }, { "index": 11, "nt1": "///I/55", "nt2": "///J/126", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.246, -0.463, 1.440, 0.794, -3.694, -4.683 ], "step_params": [ -0.478, 1.766, 4.033, -0.240, 0.179, 40.396 ], "heli_params": [ 2.532, 0.659, 4.044, 0.259, 0.347, 40.397 ], "bp2_params": [ -0.148, -0.297, 0.885, -3.905, -3.182, -1.861 ], "groove_widths": [ 14.299, 14.284, 14.435, 14.047 ], "simple_Rise": 4.033, "simple_Twist": 39.772, "simple_hRise": 4.044, "simple_hTwist": 39.773 }, { "index": 12, "nt1": "///I/56", "nt2": "///J/125", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.148, -0.297, 0.885, -3.905, -3.182, -1.861 ], "step_params": [ 0.206, 0.210, 3.231, -1.289, 2.045, 37.707 ], "heli_params": [ 0.063, -0.483, 3.229, 3.160, 1.993, 37.782 ], "bp2_params": [ -0.165, -0.266, 0.851, -3.802, -1.228, -0.374 ], "groove_widths": [ 14.018, 13.937, 15.114, 14.897 ], "simple_Rise": 3.231, "simple_Twist": 37.783, "simple_hRise": 3.229, "simple_hTwist": 37.858 }, { "index": 13, "nt1": "///I/57", "nt2": "///J/124", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.165, -0.266, 0.851, -3.802, -1.228, -0.374 ], "step_params": [ -0.509, 0.813, 3.505, -0.842, 2.680, 40.979 ], "heli_params": [ 0.844, 0.627, 3.558, 3.822, 1.201, 41.071 ], "bp2_params": [ 0.087, -0.149, 0.463, -3.737, -0.015, -1.333 ], "groove_widths": [ 14.250, 13.916, 15.135, 15.097 ], "simple_Rise": 3.505, "simple_Twist": 39.468, "simple_hRise": 3.560, "simple_hTwist": 39.563 }, { "index": 14, "nt1": "///I/58", "nt2": "///J/123", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.087, -0.149, 0.463, -3.737, -0.015, -1.333 ], "step_params": [ -0.212, 0.542, 3.571, -1.616, 3.855, 34.157 ], "heli_params": [ 0.254, 0.081, 3.615, 6.532, 2.739, 34.404 ], "bp2_params": [ 0.122, -0.163, 0.573, -0.686, -1.078, -1.084 ], "groove_widths": [ 16.429, 15.691, 15.732, 15.559 ], "simple_Rise": 3.571, "simple_Twist": 33.999, "simple_hRise": 3.615, "simple_hTwist": 34.247 }, { "index": 15, "nt1": "///I/59", "nt2": "///J/122", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.122, -0.163, 0.573, -0.686, -1.078, -1.084 ], "step_params": [ 0.429, -0.170, 3.482, -3.192, 11.390, 29.827 ], "heli_params": [ -2.466, -1.382, 3.146, 21.113, 5.917, 32.037 ], "bp2_params": [ 0.144, -0.263, 1.002, 1.463, 8.161, 0.808 ], "groove_widths": [ 18.334, 17.336, 16.180, 14.962 ], "simple_Rise": 3.482, "simple_Twist": 29.704, "simple_hRise": 3.144, "simple_hTwist": 31.924 }, { "index": 16, "nt1": "///I/60", "nt2": "///J/121", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.144, -0.263, 1.002, 1.463, 8.161, 0.808 ], "step_params": [ 0.467, -0.595, 3.432, 0.346, 4.743, 28.450 ], "heli_params": [ -2.290, -0.857, 3.297, 9.567, -0.699, 28.837 ], "bp2_params": [ 0.225, -0.377, 1.113, 5.789, 5.244, 3.477 ], "groove_widths": [ 18.111, 17.097, 17.753, 15.568 ], "simple_Rise": 3.432, "simple_Twist": 28.055, "simple_hRise": 3.294, "simple_hTwist": 28.447 }, { "index": 17, "nt1": "///I/61", "nt2": "///J/120", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.225, -0.377, 1.113, 5.789, 5.244, 3.477 ], "step_params": [ 0.849, -1.288, 3.487, 3.667, 4.074, 32.061 ], "heli_params": [ -3.053, -0.839, 3.376, 7.309, -6.579, 32.514 ], "bp2_params": [ -0.132, -0.492, 1.453, 3.048, 1.548, -2.194 ], "groove_widths": [ 16.417, 15.515, 18.761, 17.636 ], "simple_Rise": 3.487, "simple_Twist": 34.204, "simple_hRise": 3.386, "simple_hTwist": 34.627 }, { "index": 18, "nt1": "///I/62", "nt2": "///J/119", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.132, -0.492, 1.453, 3.048, 1.548, -2.194 ], "step_params": [ -0.301, -0.349, 3.053, 6.519, 8.743, 34.835 ], "heli_params": [ -1.666, 1.308, 2.789, 14.181, -10.573, 36.452 ], "bp2_params": [ -0.130, -0.350, 1.346, 13.585, 2.541, -1.728 ], "groove_widths": [ 14.545, 14.028, 16.855, 16.817 ], "simple_Rise": 3.053, "simple_Twist": 34.648, "simple_hRise": 2.787, "simple_hTwist": 36.274 }, { "index": 19, "nt1": "///I/63", "nt2": "///J/118", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.130, -0.350, 1.346, 13.585, 2.541, -1.728 ], "step_params": [ 0.679, -0.695, 3.512, 6.052, -0.747, 36.680 ], "heli_params": [ -0.981, -0.184, 3.588, -1.177, -9.535, 37.166 ], "bp2_params": [ 0.172, -0.311, 0.936, 8.458, -4.262, -0.663 ], "groove_widths": [ 12.946, 12.827, 14.943, 14.748 ], "simple_Rise": 3.512, "simple_Twist": 35.093, "simple_hRise": 3.589, "simple_hTwist": 35.602 }, { "index": 20, "nt1": "///I/64", "nt2": "///J/117", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.172, -0.311, 0.936, 8.458, -4.262, -0.663 ], "step_params": [ -0.392, 0.833, 4.125, 2.199, -2.793, 36.682 ], "heli_params": [ 1.791, 0.993, 4.023, -4.426, -3.484, 36.848 ], "bp2_params": [ -0.241, -0.351, 1.115, 3.170, -13.586, -8.910 ], "groove_widths": [ 12.460, 12.444, 16.579, 15.744 ], "simple_Rise": 4.125, "simple_Twist": 39.062, "simple_hRise": 4.031, "simple_hTwist": 39.217 }, { "index": 21, "nt1": "///I/65", "nt2": "///J/116", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.241, -0.351, 1.115, 3.170, -13.586, -8.910 ], "step_params": [ 1.095, 1.818, 4.683, 1.904, -13.094, 44.885 ], "heli_params": [ 3.789, -1.164, 4.069, -16.724, -2.432, 46.698 ], "bp2_params": [ 0.177, -0.353, 1.220, -5.832, 1.292, 1.428 ], "groove_widths": [ 13.150, 13.113, 17.321, 16.828 ], "simple_Rise": 4.683, "simple_Twist": 42.417, "simple_hRise": 4.022, "simple_hTwist": 44.342 }, { "index": 22, "nt1": "///I/66", "nt2": "///J/115", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.177, -0.353, 1.220, -5.832, 1.292, 1.428 ], "step_params": [ 0.104, 1.375, 4.146, -3.268, 3.110, 40.591 ], "heli_params": [ 1.533, -0.610, 4.215, 4.466, 4.694, 40.830 ], "bp2_params": [ 0.195, -0.365, 1.233, -7.527, 4.386, 1.220 ], "groove_widths": [ 16.464, 14.666, 13.439, 12.525 ], "simple_Rise": 4.146, "simple_Twist": 40.561, "simple_hRise": 4.215, "simple_hTwist": 40.801 }, { "index": 23, "nt1": "///I/67", "nt2": "///J/114", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.195, -0.365, 1.233, -7.527, 4.386, 1.220 ], "step_params": [ 0.829, 0.665, 5.440, 17.815, 32.232, 37.378 ], "heli_params": [ -3.212, 1.249, 4.647, 40.343, -22.298, 52.006 ], "bp2_params": [ -1.539, -0.704, -3.321, -62.187, -23.070, -1.329 ], "groove_widths": [ 19.473, 14.654, 17.905, 15.357 ], "simple_Rise": 5.440, "simple_Twist": 44.729, "simple_hRise": 4.914, "simple_hTwist": 57.331 }, { "index": 24, "nt1": "///I/68", "nt2": "///J/113", "bp": "A-T", "name": "~Wobble", "Saenger": "--", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -1.539, -0.704, -3.321, -62.187, -23.070, -1.329 ], "step_params": [ -0.291, 2.143, 6.487, -26.006, 14.725, 66.112 ], "heli_params": [ 0.784, -1.592, 6.513, 12.846, 22.687, 71.848 ], "bp2_params": [ 0.175, -0.416, -1.215, -4.601, -1.552, 1.702 ], "groove_widths": [ 19.663, 14.169, 16.826, 16.612 ], "simple_Rise": 6.487, "simple_Twist": 58.775, "simple_hRise": 6.443, "simple_hTwist": 65.327 }, { "index": 25, "nt1": "///I/70", "nt2": "///J/111", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.175, -0.416, -1.215, -4.601, -1.552, 1.702 ], "step_params": [ 0.194, -0.143, 3.462, 0.956, 9.137, 33.635 ], "heli_params": [ -1.705, -0.171, 3.316, 15.435, -1.615, 34.832 ], "bp2_params": [ 0.078, -0.124, 0.019, -2.240, 0.878, 1.704 ], "groove_widths": [ 23.827, 16.908, 17.541, 17.430 ], "simple_Rise": 3.462, "simple_Twist": 34.099, "simple_hRise": 3.319, "simple_hTwist": 35.279 }, { "index": 26, "nt1": "///I/71", "nt2": "///J/110", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.078, -0.124, 0.019, -2.240, 0.878, 1.704 ], "step_params": [ -0.889, 0.342, 3.212, -1.763, 14.690, 35.759 ], "heli_params": [ -1.319, 1.124, 3.148, 22.760, 2.731, 38.607 ], "bp2_params": [ 0.165, -0.140, 0.664, 9.821, 11.647, -2.142 ], "groove_widths": [ 23.639, 17.544, 17.482, 16.692 ], "simple_Rise": 3.212, "simple_Twist": 35.011, "simple_hRise": 3.142, "simple_hTwist": 37.919 }, { "index": 27, "nt1": "///I/72", "nt2": "///J/109", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.165, -0.140, 0.664, 9.821, 11.647, -2.142 ], "step_params": [ 0.494, 2.600, 8.529, 15.673, 7.873, 73.340 ], "heli_params": [ 1.491, 0.873, 8.679, 6.502, -12.942, 75.121 ], "bp2_params": [ 0.061, -0.189, 0.535, -2.261, -2.665, 2.868 ], "groove_widths": [ 17.024, 14.867, 19.630, 16.786 ], "simple_Rise": 8.529, "simple_Twist": 74.198, "simple_hRise": 8.679, "simple_hTwist": 75.951 }, { "index": 28, "nt1": "///I/74", "nt2": "///J/107", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.061, -0.189, 0.535, -2.261, -2.665, 2.868 ], "step_params": [ -0.755, 2.762, 3.933, -6.681, -15.911, 41.090 ], "heli_params": [ 5.239, 0.332, 2.814, -21.559, 9.052, 44.421 ], "bp2_params": [ -0.151, -0.308, 0.922, -0.379, -6.710, -2.412 ], "groove_widths": [ 12.903, 11.451, 21.636, 16.747 ], "simple_Rise": 3.933, "simple_Twist": 42.384, "simple_hRise": 2.854, "simple_hTwist": 45.612 }, { "index": 29, "nt1": "///I/75", "nt2": "///J/106", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.151, -0.308, 0.922, -0.379, -6.710, -2.412 ], "step_params": [ 0.419, -0.091, 3.440, -0.641, -4.278, 38.612 ], "heli_params": [ 0.411, -0.712, 3.423, -6.444, 0.966, 38.844 ], "bp2_params": [ -0.177, -0.261, 0.844, -0.250, -0.744, 0.477 ], "groove_widths": [ 11.068, 10.160, 17.491, 16.324 ], "simple_Rise": 3.440, "simple_Twist": 38.783, "simple_hRise": 3.424, "simple_hTwist": 39.014 }, { "index": 30, "nt1": "///I/76", "nt2": "///J/105", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.177, -0.261, 0.844, -0.250, -0.744, 0.477 ], "step_params": [ -0.487, -0.611, 3.435, -0.265, -0.590, 39.325 ], "heli_params": [ -0.835, 0.690, 3.447, -0.877, 0.394, 39.331 ], "bp2_params": [ 0.172, -0.253, 0.839, -1.782, -0.250, -0.371 ], "groove_widths": [ 12.085, 12.023, 16.814, 16.673 ], "simple_Rise": 3.435, "simple_Twist": 37.319, "simple_hRise": 3.447, "simple_hTwist": 37.325 }, { "index": 31, "nt1": "///I/77", "nt2": "///J/104", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.172, -0.253, 0.839, -1.782, -0.250, -0.371 ], "step_params": [ 0.147, 0.299, 3.456, 0.238, 0.861, 35.952 ], "heli_params": [ 0.355, -0.202, 3.463, 1.395, -0.386, 35.963 ], "bp2_params": [ 0.067, -0.163, 0.543, -0.384, 2.606, 1.207 ], "groove_widths": [ 13.740, 13.454, 16.610, 16.546 ], "simple_Rise": 3.456, "simple_Twist": 36.500, "simple_hRise": 3.462, "simple_hTwist": 36.511 }, { "index": 32, "nt1": "///I/78", "nt2": "///J/103", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.067, -0.163, 0.543, -0.384, 2.606, 1.207 ], "step_params": [ -0.315, -0.847, 4.073, -0.647, 1.066, 32.763 ], "heli_params": [ -1.727, 0.421, 4.050, 1.888, 1.147, 32.786 ], "bp2_params": [ -0.098, -0.318, 0.978, 1.915, 2.605, 1.090 ], "groove_widths": [ 14.901, 14.258, 18.332, 18.183 ], "simple_Rise": 4.073, "simple_Twist": 33.814, "simple_hRise": 4.051, "simple_hTwist": 33.836 }, { "index": 33, "nt1": "///I/79", "nt2": "///J/102", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.098, -0.318, 0.978, 1.915, 2.605, 1.090 ], "step_params": [ 0.363, -0.577, 3.424, -4.354, 7.915, 32.734 ], "heli_params": [ -2.286, -1.335, 3.131, 13.721, 7.547, 33.924 ], "bp2_params": [ -0.205, -0.254, 0.894, 0.538, 7.355, 2.592 ], "groove_widths": [ 15.903, 14.974, 18.459, 17.578 ], "simple_Rise": 3.424, "simple_Twist": 33.252, "simple_hRise": 3.137, "simple_hTwist": 34.423 }, { "index": 34, "nt1": "///I/80", "nt2": "///J/101", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.205, -0.254, 0.894, 0.538, 7.355, 2.592 ], "step_params": [ -0.033, -0.989, 3.345, -0.127, 3.938, 31.532 ], "heli_params": [ -2.531, 0.036, 3.201, 7.211, 0.232, 31.771 ], "bp2_params": [ -0.090, -0.383, 1.180, 5.222, 9.329, 1.441 ], "groove_widths": [ 16.893, 16.018, 16.666, 15.444 ], "simple_Rise": 3.345, "simple_Twist": 30.885, "simple_hRise": 3.197, "simple_hTwist": 31.130 }, { "index": 35, "nt1": "///I/81", "nt2": "///J/100", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.090, -0.383, 1.180, 5.222, 9.329, 1.441 ], "step_params": [ 0.186, -0.551, 3.210, 3.575, 4.598, 32.701 ], "heli_params": [ -1.715, 0.257, 3.108, 8.086, -6.287, 33.202 ], "bp2_params": [ -0.069, -0.381, 1.107, 13.013, 6.917, -0.615 ], "groove_widths": [ 16.265, 15.636, 16.240, 16.145 ], "simple_Rise": 3.210, "simple_Twist": 32.496, "simple_hRise": 3.107, "simple_hTwist": 33.000 }, { "index": 36, "nt1": "///I/82", "nt2": "///J/99", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.069, -0.381, 1.107, 13.013, 6.917, -0.615 ], "step_params": [ 0.903, 0.179, 3.512, 7.970, 1.078, 39.195 ], "heli_params": [ 0.125, -0.312, 3.623, 1.587, -11.731, 39.980 ], "bp2_params": [ 0.156, -0.409, 1.154, 11.319, -1.374, 0.941 ], "groove_widths": [ 14.382, 14.113, 16.656, 16.426 ], "simple_Rise": 3.512, "simple_Twist": 38.054, "simple_hRise": 3.624, "simple_hTwist": 38.864 }, { "index": 37, "nt1": "///I/83", "nt2": "///J/98", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.156, -0.409, 1.154, 11.319, -1.374, 0.941 ], "step_params": [ -0.326, 2.152, 4.209, 3.183, -2.430, 40.673 ], "heli_params": [ 3.419, 0.909, 4.044, -3.485, -4.566, 40.861 ], "bp2_params": [ 0.300, -0.349, 1.279, 7.491, -10.283, -5.150 ], "groove_widths": [ 13.370, 13.274, 16.715, 15.602 ], "simple_Rise": 4.209, "simple_Twist": 40.050, "simple_hRise": 4.040, "simple_hTwist": 40.241 }, { "index": 38, "nt1": "///I/84", "nt2": "///J/97", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.300, -0.349, 1.279, 7.491, -10.283, -5.150 ], "step_params": [ 0.242, 2.482, 4.372, 4.436, -9.940, 40.221 ], "heli_params": [ 4.814, 0.248, 3.689, -14.143, -6.312, 41.608 ], "bp2_params": [ -0.221, -0.142, -0.274, -5.073, -6.297, 0.754 ], "groove_widths": [ 12.709, 12.585, 16.745, 15.262 ], "simple_Rise": 4.372, "simple_Twist": 42.870, "simple_hRise": 3.741, "simple_hTwist": 44.167 }, { "index": 39, "nt1": "///I/85", "nt2": "///J/96", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.221, -0.142, -0.274, -5.073, -6.297, 0.754 ], "step_params": [ -0.100, 0.046, 3.622, -2.888, -0.363, 38.223 ], "heli_params": [ 0.120, -0.248, 3.620, -0.554, 4.402, 38.329 ], "bp2_params": [ 0.181, -0.223, -0.656, -6.656, -1.276, 0.149 ], "groove_widths": [ 12.611, 12.568, 17.781, 17.174 ], "simple_Rise": 3.622, "simple_Twist": 36.032, "simple_hRise": 3.619, "simple_hTwist": 36.145 }, { "index": 40, "nt1": "///I/86", "nt2": "///J/95", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.181, -0.223, -0.656, -6.656, -1.276, 0.149 ], "step_params": [ 0.579, 0.232, 3.681, -2.881, 1.943, 35.173 ], "heli_params": [ 0.061, -1.430, 3.631, 3.206, 4.754, 35.339 ], "bp2_params": [ -0.101, -0.154, 0.467, -6.991, 2.587, 0.705 ], "groove_widths": [ 13.376, 13.242, 15.988, 15.949 ], "simple_Rise": 3.681, "simple_Twist": 36.893, "simple_hRise": 3.635, "simple_hTwist": 37.050 }, { "index": 41, "nt1": "///I/87", "nt2": "///J/94", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.101, -0.154, 0.467, -6.991, 2.587, 0.705 ], "step_params": [ 0.033, -0.198, 3.150, -2.845, 9.445, 35.751 ], "heli_params": [ -1.525, -0.418, 2.993, 15.035, 4.529, 37.043 ], "bp2_params": [ -0.200, -0.210, 0.571, -6.066, -0.540, 1.149 ], "groove_widths": [ 14.153, 13.747, 17.743, 17.618 ], "simple_Rise": 3.150, "simple_Twist": 36.181, "simple_hRise": 2.996, "simple_hTwist": 37.458 }, { "index": 42, "nt1": "///I/88", "nt2": "///J/93", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.200, -0.210, 0.571, -6.066, -0.540, 1.149 ], "step_params": [ -0.747, -0.592, 3.441, -1.440, 1.430, 33.581 ], "heli_params": [ -1.269, 1.043, 3.442, 2.472, 2.490, 33.641 ], "bp2_params": [ 0.098, -0.156, 0.500, -5.864, 3.702, -0.108 ], "groove_widths": [ 14.477, 13.874, 18.542, 18.066 ], "simple_Rise": 3.441, "simple_Twist": 31.913, "simple_hRise": 3.442, "simple_hTwist": 31.976 }, { "index": 43, "nt1": "///I/89", "nt2": "///J/92", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.098, -0.156, 0.500, -5.864, 3.702, -0.108 ], "step_params": [ -0.669, -0.272, 3.578, -2.712, 3.416, 31.925 ], "heli_params": [ -1.158, 0.675, 3.574, 6.175, 4.903, 32.214 ], "bp2_params": [ 0.114, -0.192, 0.699, -3.010, 6.521, -0.509 ], "groove_widths": [ 15.745, 15.173, 18.140, 17.487 ], "simple_Rise": 3.578, "simple_Twist": 31.845, "simple_hRise": 3.574, "simple_hTwist": 32.135 }, { "index": 44, "nt1": "///I/90", "nt2": "///J/91", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.114, -0.192, 0.699, -3.010, 6.521, -0.509 ], "step_params": [ 0.300, -1.240, 3.379, -2.065, 3.011, 29.343 ], "heli_params": [ -3.075, -1.030, 3.211, 5.915, 4.056, 29.564 ], "bp2_params": [ -0.102, -0.328, 1.112, 2.192, 8.435, 0.814 ], "groove_widths": [ 16.530, 15.903, 17.397, 16.685 ], "simple_Rise": 3.379, "simple_Twist": 30.573, "simple_hRise": 3.219, "simple_hTwist": 30.785 }, { "index": 45, "nt1": "///I/91", "nt2": "///J/90", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.102, -0.328, 1.112, 2.192, 8.435, 0.814 ], "step_params": [ 0.447, -0.565, 3.376, 1.973, 3.514, 32.307 ], "heli_params": [ -1.638, -0.444, 3.318, 6.285, -3.529, 32.551 ], "bp2_params": [ -0.098, -0.472, 1.314, 7.321, 8.872, 0.735 ], "groove_widths": [ 15.887, 15.182, 16.361, 16.203 ], "simple_Rise": 3.376, "simple_Twist": 32.213, "simple_hRise": 3.318, "simple_hTwist": 32.458 }, { "index": 46, "nt1": "///I/92", "nt2": "///J/89", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.098, -0.472, 1.314, 7.321, 8.872, 0.735 ], "step_params": [ 0.349, 0.531, 3.761, 4.831, 3.376, 39.692 ], "heli_params": [ 0.327, 0.131, 3.807, 4.940, -7.068, 40.110 ], "bp2_params": [ 0.200, -0.409, 1.104, 11.609, 3.403, 2.377 ], "groove_widths": [ 15.527, 15.124, 16.512, 16.477 ], "simple_Rise": 3.761, "simple_Twist": 37.993, "simple_hRise": 3.807, "simple_hTwist": 38.430 }, { "index": 47, "nt1": "///I/93", "nt2": "///J/88", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.200, -0.409, 1.104, 11.609, 3.403, 2.377 ], "step_params": [ 0.046, 1.983, 4.034, 13.102, 9.321, 39.964 ], "heli_params": [ 1.499, 1.637, 4.191, 13.017, -18.299, 42.955 ], "bp2_params": [ 0.055, -0.116, -0.238, -4.261, -12.778, 2.297 ], "groove_widths": [ 14.440, 14.364, 14.990, 14.624 ], "simple_Rise": 4.034, "simple_Twist": 40.635, "simple_hRise": 4.193, "simple_hTwist": 43.575 }, { "index": 48, "nt1": "///I/94", "nt2": "///J/87", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.055, -0.116, -0.238, -4.261, -12.778, 2.297 ], "step_params": [ -0.528, 2.823, 3.719, -1.758, -2.360, 40.405 ], "heli_params": [ 4.372, 0.544, 3.575, -3.411, 2.542, 40.507 ], "bp2_params": [ -0.263, -0.207, -0.924, -10.499, -10.096, 3.421 ], "groove_widths": [ 13.623, 13.611, 15.824, 15.164 ], "simple_Rise": 3.719, "simple_Twist": 42.151, "simple_hRise": 3.581, "simple_hTwist": 42.249 }, { "index": 49, "nt1": "///I/95", "nt2": "///J/86", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.263, -0.207, -0.924, -10.499, -10.096, 3.421 ], "step_params": [ -0.357, 0.446, 3.353, -4.364, 0.292, 37.954 ], "heli_params": [ 0.644, -0.021, 3.375, 0.448, 6.683, 38.196 ], "bp2_params": [ 0.182, -0.292, -0.890, -10.491, -4.999, 1.812 ], "groove_widths": [ 13.249, 13.236, 16.220, 15.358 ], "simple_Rise": 3.353, "simple_Twist": 35.593, "simple_hRise": 3.375, "simple_hTwist": 35.853 }, { "index": 50, "nt1": "///I/96", "nt2": "///J/85", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.182, -0.292, -0.890, -10.491, -4.999, 1.812 ], "step_params": [ 0.750, 1.240, 3.940, -2.677, 2.265, 35.750 ], "heli_params": [ 1.620, -1.678, 3.944, 3.679, 4.349, 35.916 ], "bp2_params": [ -0.082, -0.106, 0.160, -9.117, -0.119, -1.058 ], "groove_widths": [ 13.660, 13.629, 16.814, 16.623 ], "simple_Rise": 3.940, "simple_Twist": 37.394, "simple_hRise": 3.945, "simple_hTwist": 37.552 }, { "index": 51, "nt1": "///I/97", "nt2": "///J/84", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.082, -0.106, 0.160, -9.117, -0.119, -1.058 ], "step_params": [ -0.486, 0.191, 3.474, -4.536, 4.540, 31.178 ], "heli_params": [ -0.545, -0.007, 3.500, 8.336, 8.329, 31.815 ], "bp2_params": [ -0.180, -0.157, 0.290, -6.729, 3.491, -0.178 ], "groove_widths": [ 15.115, 14.963, 17.437, 17.433 ], "simple_Rise": 3.474, "simple_Twist": 31.723, "simple_hRise": 3.501, "simple_hTwist": 32.349 }, { "index": 52, "nt1": "///I/98", "nt2": "///J/83", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.180, -0.157, 0.290, -6.729, 3.491, -0.178 ], "step_params": [ 0.035, -0.150, 3.332, -2.198, 4.994, 35.114 ], "heli_params": [ -0.987, -0.383, 3.273, 8.216, 3.616, 35.522 ], "bp2_params": [ 0.122, -0.231, 0.787, -4.382, 5.940, -1.538 ], "groove_widths": [ 16.327, 15.923, 16.749, 16.551 ], "simple_Rise": 3.332, "simple_Twist": 33.339, "simple_hRise": 3.267, "simple_hTwist": 33.770 }, { "index": 53, "nt1": "///I/99", "nt2": "///J/82", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.122, -0.231, 0.787, -4.382, 5.940, -1.538 ], "step_params": [ 0.080, -0.365, 3.560, -2.361, 5.202, 31.836 ], "heli_params": [ -1.649, -0.594, 3.444, 9.390, 4.261, 32.331 ], "bp2_params": [ 0.165, -0.361, 1.217, -0.300, 7.537, -1.144 ], "groove_widths": [ 16.649, 15.920, 16.676, 15.908 ], "simple_Rise": 3.560, "simple_Twist": 31.551, "simple_hRise": 3.442, "simple_hTwist": 32.051 }, { "index": 54, "nt1": "///I/100", "nt2": "///J/81", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.165, -0.361, 1.217, -0.300, 7.537, -1.144 ], "step_params": [ 0.105, -0.596, 3.568, 0.172, 5.493, 33.100 ], "heli_params": [ -2.004, -0.152, 3.429, 9.559, -0.299, 33.540 ], "bp2_params": [ 0.224, -0.334, 1.058, 1.753, 6.620, 2.504 ], "groove_widths": [ 16.023, 15.143, 16.811, 16.008 ], "simple_Rise": 3.568, "simple_Twist": 32.839, "simple_hRise": 3.427, "simple_hTwist": 33.283 }, { "index": 55, "nt1": "///I/101", "nt2": "///J/80", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.224, -0.334, 1.058, 1.753, 6.620, 2.504 ], "step_params": [ 0.038, -0.133, 3.090, 0.088, 4.072, 38.719 ], "heli_params": [ -0.664, -0.048, 3.061, 6.122, -0.133, 38.925 ], "bp2_params": [ 0.158, -0.414, 1.341, 5.359, 4.962, -0.445 ], "groove_widths": [ 15.430, 14.679, 15.871, 15.349 ], "simple_Rise": 3.090, "simple_Twist": 38.903, "simple_hRise": 3.061, "simple_hTwist": 39.108 }, { "index": 56, "nt1": "///I/102", "nt2": "///J/79", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.158, -0.414, 1.341, 5.359, 4.962, -0.445 ], "step_params": [ -0.003, -0.833, 3.893, 2.130, 0.809, 30.671 ], "heli_params": [ -1.759, 0.500, 3.861, 1.527, -4.020, 30.754 ], "bp2_params": [ -0.145, -0.498, 1.430, 4.415, 3.509, -1.195 ], "groove_widths": [ 14.610, 14.232, 15.063, 15.040 ], "simple_Rise": 3.893, "simple_Twist": 32.651, "simple_hRise": 3.863, "simple_hTwist": 32.728 }, { "index": 57, "nt1": "///I/103", "nt2": "///J/78", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.145, -0.498, 1.430, 4.415, 3.509, -1.195 ], "step_params": [ 0.579, 0.239, 3.121, 2.910, 1.301, 41.197 ], "heli_params": [ 0.205, -0.520, 3.159, 1.846, -4.128, 41.315 ], "bp2_params": [ -0.140, -0.421, 1.384, 4.923, -0.124, -0.218 ], "groove_widths": [ 12.559, 12.497, 15.991, 15.836 ], "simple_Rise": 3.121, "simple_Twist": 41.094, "simple_hRise": 3.159, "simple_hTwist": 41.212 }, { "index": 58, "nt1": "///I/104", "nt2": "///J/77", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.140, -0.421, 1.384, 4.923, -0.124, -0.218 ], "step_params": [ -0.659, 1.012, 4.102, 3.206, -8.383, 43.892 ], "heli_params": [ 2.262, 1.222, 3.802, -11.078, -4.236, 44.756 ], "bp2_params": [ 0.132, -0.193, 0.622, -2.376, -13.421, -2.544 ], "groove_widths": [ 11.248, 11.218, 17.046, 16.226 ], "simple_Rise": 4.102, "simple_Twist": 42.262, "simple_hRise": 3.786, "simple_hTwist": 43.161 }, { "index": 59, "nt1": "///I/105", "nt2": "///J/76", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.132, -0.193, 0.622, -2.376, -13.421, -2.544 ], "step_params": [ -0.418, 1.280, 3.714, 1.322, -0.535, 40.464 ], "heli_params": [ 1.918, 0.771, 3.682, -0.774, -1.911, 40.488 ], "bp2_params": [ 0.157, -0.136, 0.068, -6.943, -10.765, 0.798 ], "groove_widths": [ 12.646, 12.617, 16.673, 15.317 ], "simple_Rise": 3.714, "simple_Twist": 40.226, "simple_hRise": 3.682, "simple_hTwist": 40.250 }, { "index": 60, "nt1": "///I/106", "nt2": "///J/75", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.157, -0.136, 0.068, -6.943, -10.765, 0.798 ], "step_params": [ -0.140, 2.632, 3.907, -1.350, 0.061, 35.828 ], "heli_params": [ 4.265, -0.004, 3.914, 0.098, 2.193, 35.852 ], "bp2_params": [ -0.045, -0.162, -0.562, -12.176, -3.839, 0.773 ], "groove_widths": [ 15.169, 15.040, 16.463, 16.076 ], "simple_Rise": 3.907, "simple_Twist": 37.167, "simple_hRise": 3.913, "simple_hTwist": 37.190 }, { "index": 61, "nt1": "///I/107", "nt2": "///J/74", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.045, -0.162, -0.562, -12.176, -3.839, 0.773 ], "step_params": [ -0.720, 0.308, 3.908, -3.966, 6.986, 27.654 ], "heli_params": [ -1.295, 0.362, 3.929, 14.239, 8.084, 28.775 ], "bp2_params": [ -0.083, -0.113, -0.346, -6.195, 8.125, -2.487 ], "groove_widths": [ 17.717, 17.316, 16.818, 16.817 ], "simple_Rise": 3.908, "simple_Twist": 28.039, "simple_hRise": 3.931, "simple_hTwist": 29.145 }, { "index": 62, "nt1": "///I/108", "nt2": "///J/73", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.083, -0.113, -0.346, -6.195, 8.125, -2.487 ], "step_params": [ 1.112, 0.756, 3.458, -3.198, 5.377, 28.161 ], "heli_params": [ 0.246, -2.989, 3.396, 10.881, 6.472, 28.834 ], "bp2_params": [ -0.074, -0.127, 0.296, 1.752, 11.852, -0.054 ], "groove_widths": [ 18.906, 17.855, 17.963, 17.506 ], "simple_Rise": 3.458, "simple_Twist": 27.961, "simple_hRise": 3.395, "simple_hTwist": 28.639 }, { "index": 63, "nt1": "///I/109", "nt2": "///J/72", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.074, -0.127, 0.296, 1.752, 11.852, -0.054 ], "step_params": [ 1.253, 0.117, 3.558, 1.621, 5.877, 26.763 ], "heli_params": [ -1.352, -2.201, 3.570, 12.492, -3.446, 27.436 ], "bp2_params": [ -0.007, -0.286, 0.887, 9.617, 11.872, -0.687 ], "groove_widths": [ 18.921, 17.097, 17.936, 15.985 ], "simple_Rise": 3.558, "simple_Twist": 26.171, "simple_hRise": 3.568, "simple_hTwist": 26.860 }, { "index": 64, "nt1": "///I/110", "nt2": "///J/71", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.007, -0.286, 0.887, 9.617, 11.872, -0.687 ], "step_params": [ 0.055, -1.031, 3.742, 11.331, 39.499, 29.553 ], "heli_params": [ -4.160, 0.780, 1.468, 53.604, -15.377, 50.240 ], "bp2_params": [ -0.183, -0.137, -0.203, -9.519, 4.881, -0.809 ], "groove_widths": [ 18.612, 16.767, 18.437, 16.971 ], "simple_Rise": 3.742, "simple_Twist": 30.828, "simple_hRise": 1.544, "simple_hTwist": 50.967 }, { "index": 65, "nt1": "///I/111", "nt2": "///J/70", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.183, -0.137, -0.203, -9.519, 4.881, -0.809 ], "step_params": [ 0.092, 0.213, 3.250, -2.921, 5.994, 31.941 ], "heli_params": [ -0.662, -0.670, 3.215, 10.746, 5.237, 32.612 ], "bp2_params": [ 0.113, -0.114, 0.213, -4.778, 8.982, -3.020 ], "groove_widths": [ 17.739, 16.206, 16.513, 15.317 ], "simple_Rise": 3.250, "simple_Twist": 30.182, "simple_hRise": 3.209, "simple_hTwist": 30.893 }, { "index": 66, "nt1": "///I/112", "nt2": "///J/69", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.113, -0.114, 0.213, -4.778, 8.982, -3.020 ], "step_params": [ 0.189, -0.327, 3.532, -3.346, 6.589, 27.776 ], "heli_params": [ -2.238, -1.183, 3.323, 13.426, 6.817, 28.724 ], "bp2_params": [ -0.069, -0.322, 1.041, 3.929, 10.829, -0.996 ], "groove_widths": [ 17.656, 16.488, 16.572, 16.412 ], "simple_Rise": 3.532, "simple_Twist": 28.806, "simple_hRise": 3.334, "simple_hTwist": 29.719 }, { "index": 67, "nt1": "///I/113", "nt2": "///J/68", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.069, -0.322, 1.041, 3.929, 10.829, -0.996 ], "step_params": [ 0.635, 0.992, 3.221, 2.245, 5.613, 40.118 ], "heli_params": [ 0.799, -0.663, 3.353, 8.126, -3.250, 40.552 ], "bp2_params": [ -0.124, -0.432, 1.483, 11.877, 4.028, -0.977 ], "groove_widths": [ 17.779, 17.155, 16.007, 15.971 ], "simple_Rise": 3.221, "simple_Twist": 40.256, "simple_hRise": 3.353, "simple_hTwist": 40.688 }, { "index": 68, "nt1": "///I/114", "nt2": "///J/67", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.124, -0.432, 1.483, 11.877, 4.028, -0.977 ], "step_params": [ 0.898, 1.261, 4.865, 14.881, 8.097, 33.722 ], "heli_params": [ 0.276, 1.695, 4.984, 12.990, -23.874, 37.628 ], "bp2_params": [ -0.177, -0.208, 0.689, -4.001, -4.522, 0.008 ], "groove_widths": [ 16.390, 16.174, 15.969, 15.932 ], "simple_Rise": 4.865, "simple_Twist": 34.113, "simple_hRise": 4.988, "simple_hTwist": 37.976 }, { "index": 69, "nt1": "///I/115", "nt2": "///J/66", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.177, -0.208, 0.689, -4.001, -4.522, 0.008 ], "step_params": [ -0.645, 2.782, 3.878, -1.200, 0.420, 40.245 ], "heli_params": [ 3.985, 0.775, 3.923, 0.610, 1.743, 40.264 ], "bp2_params": [ 0.049, -0.141, -0.216, -7.138, -4.308, 1.975 ], "groove_widths": [ 14.651, 14.600, 16.737, 16.512 ], "simple_Rise": 3.878, "simple_Twist": 38.874, "simple_hRise": 3.924, "simple_hTwist": 38.894 }, { "index": 70, "nt1": "///I/116", "nt2": "///J/65", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.049, -0.141, -0.216, -7.138, -4.308, 1.975 ], "step_params": [ -0.503, 0.112, 3.214, -2.731, 3.409, 33.130 ], "heli_params": [ -0.363, 0.427, 3.239, 5.946, 4.764, 33.408 ], "bp2_params": [ -0.182, -0.111, -0.315, -5.415, -1.505, 0.259 ], "groove_widths": [ 13.442, 13.338, 16.053, 15.803 ], "simple_Rise": 3.214, "simple_Twist": 34.560, "simple_hRise": 3.239, "simple_hTwist": 34.827 }, { "index": 71, "nt1": "///I/117", "nt2": "///J/64", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.182, -0.111, -0.315, -5.415, -1.505, 0.259 ], "step_params": [ 0.401, 0.078, 3.280, -1.966, 1.761, 38.895 ], "heli_params": [ -0.096, -0.838, 3.257, 2.641, 2.948, 38.981 ], "bp2_params": [ 0.186, -0.132, 0.242, -0.779, 0.219, 0.455 ], "groove_widths": [ 13.657, 13.400, 15.282, 15.281 ], "simple_Rise": 3.280, "simple_Twist": 36.886, "simple_hRise": 3.255, "simple_hTwist": 36.977 }, { "index": 72, "nt1": "///I/118", "nt2": "///J/63", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.186, -0.132, 0.242, -0.779, 0.219, 0.455 ], "step_params": [ 0.093, -0.119, 3.440, -3.725, 6.920, 35.367 ], "heli_params": [ -1.210, -0.698, 3.332, 11.219, 6.039, 36.203 ], "bp2_params": [ 0.152, -0.315, 1.077, -2.814, 7.516, -0.995 ], "groove_widths": [ 15.023, 14.464, 17.151, 16.758 ], "simple_Rise": 3.440, "simple_Twist": 35.531, "simple_hRise": 3.333, "simple_hTwist": 36.362 }, { "index": 73, "nt1": "///I/119", "nt2": "///J/62", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.152, -0.315, 1.077, -2.814, 7.516, -0.995 ], "step_params": [ -0.014, -0.633, 3.462, -1.900, 4.916, 29.657 ], "heli_params": [ -2.266, -0.378, 3.310, 9.510, 3.675, 30.112 ], "bp2_params": [ -0.227, -0.287, 0.950, -0.041, 8.298, 2.931 ], "groove_widths": [ 16.467, 15.612, 17.743, 16.757 ], "simple_Rise": 3.462, "simple_Twist": 31.780, "simple_hRise": 3.324, "simple_hTwist": 32.203 }, { "index": 74, "nt1": "///I/120", "nt2": "///J/61", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.227, -0.287, 0.950, -0.041, 8.298, 2.931 ], "step_params": [ -0.115, -1.098, 3.566, -0.073, 5.200, 31.037 ], "heli_params": [ -3.059, 0.198, 3.342, 9.632, 0.136, 31.459 ], "bp2_params": [ -0.106, -0.454, 1.425, 0.310, 10.661, -0.623 ], "groove_widths": [ 17.972, 17.033, 16.517, 14.970 ], "simple_Rise": 3.566, "simple_Twist": 30.443, "simple_hRise": 3.337, "simple_hTwist": 30.874 }, { "index": 75, "nt1": "///I/121", "nt2": "///J/60", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.106, -0.454, 1.425, 0.310, 10.661, -0.623 ], "step_params": [ -0.028, -0.319, 3.837, -0.059, 6.037, 28.996 ], "heli_params": [ -2.109, 0.041, 3.696, 11.894, 0.117, 29.605 ], "bp2_params": [ -0.108, -0.596, 1.609, 7.734, 10.865, -1.040 ], "groove_widths": [ 18.318, 17.435, 16.018, 14.909 ], "simple_Rise": 3.837, "simple_Twist": 28.800, "simple_hRise": 3.695, "simple_hTwist": 29.412 }, { "index": 76, "nt1": "///I/122", "nt2": "///J/59", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.108, -0.596, 1.609, 7.734, 10.865, -1.040 ], "step_params": [ 0.993, -0.254, 3.452, 6.708, 4.690, 38.317 ], "heli_params": [ -0.985, -0.615, 3.516, 7.047, -10.080, 39.150 ], "bp2_params": [ -0.183, -0.584, 1.603, 8.146, 6.221, -4.547 ], "groove_widths": [ 16.516, 15.803, 15.765, 15.440 ], "simple_Rise": 3.452, "simple_Twist": 38.804, "simple_hRise": 3.516, "simple_hTwist": 39.625 }, { "index": 77, "nt1": "///I/123", "nt2": "///J/58", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.183, -0.584, 1.603, 8.146, 6.221, -4.547 ], "step_params": [ 0.316, -0.594, 3.261, 5.238, 3.038, 37.202 ], "heli_params": [ -1.312, 0.187, 3.217, 4.723, -8.144, 37.675 ], "bp2_params": [ 0.183, -0.368, 1.123, 5.106, 1.832, 0.222 ], "groove_widths": [ 14.997, 14.572, 15.585, 15.584 ], "simple_Rise": 3.261, "simple_Twist": 35.198, "simple_hRise": 3.212, "simple_hTwist": 35.699 }, { "index": 78, "nt1": "///I/124", "nt2": "///J/57", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.183, -0.368, 1.123, 5.106, 1.832, 0.222 ], "step_params": [ -0.273, 0.825, 3.777, 3.841, 2.837, 39.549 ], "heli_params": [ 0.830, 0.916, 3.783, 4.174, -5.652, 39.825 ], "bp2_params": [ 0.147, -0.416, 1.236, 2.840, -1.250, -2.144 ], "groove_widths": [ 14.739, 14.550, 14.765, 14.744 ], "simple_Rise": 3.777, "simple_Twist": 39.796, "simple_hRise": 3.783, "simple_hTwist": 40.070 }, { "index": 79, "nt1": "///I/125", "nt2": "///J/56", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.147, -0.416, 1.236, 2.840, -1.250, -2.144 ], "step_params": [ 0.112, 1.829, 4.066, 9.894, 8.109, 40.621 ], "heli_params": [ 1.452, 1.152, 4.253, 11.346, -13.843, 42.506 ], "bp2_params": [ 0.069, -0.106, -0.522, -12.802, -7.325, 1.565 ], "groove_widths": [ 14.452, 14.370, 14.127, 13.906 ], "simple_Rise": 4.066, "simple_Twist": 40.728, "simple_hRise": 4.253, "simple_hTwist": 42.608 }, { "index": 80, "nt1": "///I/126", "nt2": "///J/55", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.069, -0.106, -0.522, -12.802, -7.325, 1.565 ], "step_params": [ -0.718, 1.146, 3.305, -3.553, 4.824, 34.669 ], "heli_params": [ 1.145, 0.634, 3.482, 8.021, 5.908, 35.167 ], "bp2_params": [ 0.103, -0.139, -0.756, -11.219, -2.014, 0.761 ], "groove_widths": [ 14.179, 14.098, 15.993, 15.805 ], "simple_Rise": 3.305, "simple_Twist": 34.648, "simple_hRise": 3.482, "simple_hTwist": 35.146 }, { "index": 81, "nt1": "///I/127", "nt2": "///J/54", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.103, -0.139, -0.756, -11.219, -2.014, 0.761 ], "step_params": [ -0.827, 1.665, 3.562, -4.438, 5.129, 39.487 ], "heli_params": [ 1.766, 0.632, 3.807, 7.524, 6.511, 40.042 ], "bp2_params": [ 0.202, -0.238, -1.067, -7.620, 1.567, -3.415 ], "groove_widths": [ 14.732, 14.529, 15.613, 15.577 ], "simple_Rise": 3.562, "simple_Twist": 39.004, "simple_hRise": 3.810, "simple_hTwist": 39.566 }, { "index": 82, "nt1": "///I/128", "nt2": "///J/53", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.202, -0.238, -1.067, -7.620, 1.567, -3.415 ], "step_params": [ 0.486, -0.097, 3.317, -4.397, 5.063, 28.326 ], "heli_params": [ -1.304, -1.931, 3.143, 10.167, 8.830, 29.093 ], "bp2_params": [ -0.048, -0.110, -0.063, 0.540, 2.027, 1.161 ], "groove_widths": [ 16.470, 15.828, 16.098, 15.996 ], "simple_Rise": 3.317, "simple_Twist": 29.860, "simple_hRise": 3.156, "simple_hTwist": 30.587 }, { "index": 83, "nt1": "///I/129", "nt2": "///J/52", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.048, -0.110, -0.063, 0.540, 2.027, 1.161 ], "step_params": [ -0.453, 0.634, 3.422, -2.311, 9.922, 36.120 ], "heli_params": [ -0.415, 0.378, 3.491, 15.623, 3.639, 37.483 ], "bp2_params": [ 0.170, -0.168, 0.733, 3.579, 7.300, -4.599 ], "groove_widths": [ 18.127, 16.789, 15.797, 14.514 ], "simple_Rise": 3.422, "simple_Twist": 34.664, "simple_hRise": 3.489, "simple_hTwist": 36.086 }, { "index": 84, "nt1": "///I/130", "nt2": "///J/51", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.170, -0.168, 0.733, 3.579, 7.300, -4.599 ], "step_params": [ 1.242, -0.644, 3.924, 1.932, 6.014, 26.706 ], "heli_params": [ -3.128, -2.050, 3.769, 12.793, -4.109, 27.430 ], "bp2_params": [ 0.198, -0.433, 1.275, 5.932, 2.097, 2.069 ], "groove_widths": [ 18.963, 17.279, 15.911, 13.825 ], "simple_Rise": 3.924, "simple_Twist": 26.701, "simple_hRise": 3.769, "simple_hTwist": 27.425 }, { "index": 85, "nt1": "///I/131", "nt2": "///J/50", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.198, -0.433, 1.275, 5.932, 2.097, 2.069 ], "step_params": [ 0.175, -0.803, 3.235, 1.311, 13.650, 35.564 ], "heli_params": [ -2.881, -0.110, 2.759, 21.392, -2.055, 38.036 ], "bp2_params": [ 0.255, -0.491, 1.702, 6.728, 11.252, -2.480 ], "groove_widths": [ 18.750, 17.340, 16.744, 15.177 ], "simple_Rise": 3.235, "simple_Twist": 35.091, "simple_hRise": 2.750, "simple_hTwist": 37.597 }, { "index": 86, "nt1": "///I/132", "nt2": "///J/49", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.255, -0.491, 1.702, 6.728, 11.252, -2.480 ], "step_params": [ 0.748, -1.181, 3.365, 3.520, 7.973, 30.329 ], "heli_params": [ -3.653, -0.723, 3.030, 14.858, -6.559, 31.529 ], "bp2_params": [ 0.226, -0.398, 1.101, 13.051, 5.577, 3.625 ], "groove_widths": [ 17.435, 16.549, 17.351, 16.617 ], "simple_Rise": 3.365, "simple_Twist": 30.557, "simple_hRise": 3.033, "simple_hTwist": 31.748 }, { "index": 87, "nt1": "///I/133", "nt2": "///J/48", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.226, -0.398, 1.101, 13.051, 5.577, 3.625 ], "step_params": [ 0.488, -0.717, 3.587, 7.923, 2.844, 33.520 ], "heli_params": [ -1.694, 0.535, 3.536, 4.836, -13.475, 34.531 ], "bp2_params": [ -0.144, -0.440, 1.211, 9.205, -0.700, -3.159 ], "groove_widths": [ 16.151, 15.771, 16.721, 16.520 ], "simple_Rise": 3.587, "simple_Twist": 35.773, "simple_hRise": 3.546, "simple_hTwist": 36.719 }, { "index": 88, "nt1": "///I/134", "nt2": "///J/47", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.144, -0.440, 1.211, 9.205, -0.700, -3.159 ], "step_params": [ -0.267, 0.030, 3.769, 5.591, -1.211, 37.337 ], "heli_params": [ 0.226, 1.241, 3.690, -1.878, -8.670, 37.757 ], "bp2_params": [ -0.264, -0.427, 1.384, 5.705, -6.253, -8.709 ], "groove_widths": [ 13.662, 13.560, 15.917, 15.903 ], "simple_Rise": 3.769, "simple_Twist": 38.022, "simple_hRise": 3.692, "simple_hTwist": 38.435 }, { "index": 89, "nt1": "///I/135", "nt2": "///J/46", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.264, -0.427, 1.384, 5.705, -6.253, -8.709 ], "step_params": [ 0.084, -0.492, 3.254, 1.369, -1.357, 34.219 ], "heli_params": [ -0.623, 0.072, 3.272, -2.304, -2.324, 34.272 ], "bp2_params": [ -0.281, -0.373, 1.141, 1.632, -11.607, -8.212 ], "groove_widths": [ 12.199, 12.145, 14.719, 14.263 ], "simple_Rise": 3.254, "simple_Twist": 34.290, "simple_hRise": 3.272, "simple_hTwist": 34.342 }, { "index": 90, "nt1": "///I/136", "nt2": "///J/45", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.281, -0.373, 1.141, 1.632, -11.607, -8.212 ], "step_params": [ 0.270, 1.304, 4.256, 3.387, 0.329, 43.898 ], "heli_params": [ 1.699, 0.056, 4.274, 0.440, -4.523, 44.023 ], "bp2_params": [ -0.155, -0.264, 0.922, -4.051, -8.337, -1.508 ], "groove_widths": [ 13.203, 13.187, 16.433, 15.976 ], "simple_Rise": 4.256, "simple_Twist": 43.101, "simple_hRise": 4.274, "simple_hTwist": 43.228 }, { "index": 91, "nt1": "///I/137", "nt2": "///J/44", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.155, -0.264, 0.922, -4.051, -8.337, -1.508 ], "step_params": [ 0.216, 2.226, 3.453, -2.703, -4.860, 39.185 ], "heli_params": [ 3.867, -0.641, 3.144, -7.202, 4.005, 39.563 ], "bp2_params": [ -0.218, -0.189, 0.581, -1.678, 6.389, 2.561 ], "groove_widths": [ 14.571, 14.511, 15.477, 15.409 ], "simple_Rise": 3.453, "simple_Twist": 39.566, "simple_hRise": 3.148, "simple_hTwist": 39.939 }, { "index": 92, "nt1": "///I/138", "nt2": "///J/43", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.218, -0.189, 0.581, -1.678, 6.389, 2.561 ], "step_params": [ -0.779, 0.911, 3.427, -0.029, 5.501, 34.930 ], "heli_params": [ 0.633, 1.278, 3.526, 9.095, 0.048, 35.347 ], "bp2_params": [ -0.220, -0.143, -0.151, 10.091, 9.541, -0.657 ], "groove_widths": [ 16.575, 16.203, 16.618, 16.614 ], "simple_Rise": 3.427, "simple_Twist": 34.690, "simple_hRise": 3.526, "simple_hTwist": 35.110 }, { "index": 93, "nt1": "///I/139", "nt2": "///J/42", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.220, -0.143, -0.151, 10.091, 9.541, -0.657 ], "step_params": [ -1.031, -0.324, 3.146, 4.984, 4.417, 28.060 ], "heli_params": [ -1.566, 3.104, 2.841, 8.950, -10.099, 28.824 ], "bp2_params": [ -0.995, 0.620, -0.548, 25.222, 3.981, -22.764 ], "groove_widths": [ 17.399, 16.700, 16.260, 16.136 ], "simple_Rise": 3.146, "simple_Twist": 31.690, "simple_hRise": 2.884, "simple_hTwist": 32.364 }, { "index": 94, "nt1": "///I/140", "nt2": "///J/41", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.995, 0.620, -0.548, 25.222, 3.981, -22.764 ], "step_params": [ 1.110, -1.258, 3.889, -13.990, 15.589, 35.338 ], "heli_params": [ -3.617, -3.220, 2.546, 23.327, 20.934, 40.908 ], "bp2_params": [ 0.243, -0.373, 1.402, 4.190, 5.070, -1.644 ], "groove_widths": [ 17.432, 16.734, 17.882, 16.427 ], "simple_Rise": 3.889, "simple_Twist": 29.299, "simple_hRise": 2.235, "simple_hTwist": 35.882 }, { "index": 95, "nt1": "///I/141", "nt2": "///J/40", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.243, -0.373, 1.402, 4.190, 5.070, -1.644 ], "step_params": [ 0.586, -1.579, 3.437, 2.236, 2.913, 27.908 ], "heli_params": [ -3.951, -0.663, 3.294, 6.007, -4.612, 28.144 ], "bp2_params": [ -0.155, -0.371, 1.330, 4.906, 1.475, 1.330 ], "groove_widths": [ 17.493, 16.888, 19.073, 17.264 ], "simple_Rise": 3.437, "simple_Twist": 30.197, "simple_hRise": 3.307, "simple_hTwist": 30.415 }, { "index": 96, "nt1": "///I/142", "nt2": "///J/39", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.155, -0.371, 1.330, 4.906, 1.475, 1.330 ], "step_params": [ -0.267, -1.368, 3.195, 3.355, 11.018, 32.405 ], "heli_params": [ -3.883, 0.929, 2.568, 19.010, -5.788, 34.339 ], "bp2_params": [ 0.175, -0.278, 1.131, 5.507, 1.718, -2.000 ], "groove_widths": [ 16.518, 15.829, 19.513, 17.912 ], "simple_Rise": 3.195, "simple_Twist": 30.441, "simple_hRise": 2.518, "simple_hTwist": 32.499 }, { "index": 97, "nt1": "///I/143", "nt2": "///J/38", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.175, -0.278, 1.131, 5.507, 1.718, -2.000 ], "step_params": [ -0.454, -1.166, 3.270, 1.929, 0.862, 31.858 ], "heli_params": [ -2.275, 1.173, 3.206, 1.569, -3.510, 31.926 ], "bp2_params": [ 0.117, -0.180, 0.799, 6.294, -1.701, -1.504 ], "groove_widths": [ 15.494, 14.962, 17.878, 16.842 ], "simple_Rise": 3.270, "simple_Twist": 32.224, "simple_hRise": 3.207, "simple_hTwist": 32.291 }, { "index": 98, "nt1": "///I/144", "nt2": "///J/37", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.117, -0.180, 0.799, 6.294, -1.701, -1.504 ], "step_params": [ -0.183, -1.155, 3.251, 3.012, -1.082, 30.763 ], "heli_params": [ -1.957, 0.925, 3.256, -2.032, -5.658, 30.925 ], "bp2_params": [ -0.085, -0.138, 0.384, 5.518, -3.957, -2.335 ], "groove_widths": [ 14.416, 14.242, 16.351, 16.122 ], "simple_Rise": 3.251, "simple_Twist": 32.116, "simple_hRise": 3.257, "simple_hTwist": 32.271 }, { "index": 99, "nt1": "///I/145", "nt2": "///J/36", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.085, -0.138, 0.384, 5.518, -3.957, -2.335 ], "step_params": [ 0.296, -0.051, 3.447, 3.245, -0.694, 37.508 ], "heli_params": [ 0.016, -0.013, 3.460, -1.077, -5.035, 37.649 ], "bp2_params": [ 0.133, -0.287, 0.850, 3.740, -8.268, -3.328 ], "groove_widths": [ 13.276, 13.229, 16.492, 16.475 ], "simple_Rise": 3.447, "simple_Twist": 36.181, "simple_hRise": 3.460, "simple_hTwist": 36.328 }, { "index": 100, "nt1": "///I/146", "nt2": "///J/35", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.133, -0.287, 0.850, 3.740, -8.268, -3.328 ], "step_params": [ 0.534, 1.039, 4.014, 2.843, -4.881, 37.651 ], "heli_params": [ 2.346, -0.381, 3.883, -7.511, -4.374, 38.057 ], "bp2_params": [ -0.147, -0.274, 0.915, -0.373, -4.317, -0.745 ], "groove_widths": [ 12.984, 12.974, 16.791, 16.410 ], "simple_Rise": 4.014, "simple_Twist": 39.238, "simple_hRise": 3.890, "simple_hTwist": 39.627 }, { "index": 101, "nt1": "///I/147", "nt2": "///J/34", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.147, -0.274, 0.915, -0.373, -4.317, -0.745 ], "step_params": [ -0.213, 2.039, 3.876, -0.775, -0.280, 42.013 ], "heli_params": [ 2.878, 0.202, 3.866, -0.390, 1.081, 42.021 ], "bp2_params": [ -0.191, -0.187, 0.464, -2.704, -3.493, -0.508 ], "groove_widths": [ 13.414, 13.409, 15.833, 15.287 ], "simple_Rise": 3.876, "simple_Twist": 42.161, "simple_hRise": 3.866, "simple_hTwist": 42.169 }, { "index": 102, "nt1": "///I/148", "nt2": "///J/33", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.191, -0.187, 0.464, -2.704, -3.493, -0.508 ], "step_params": [ 0.158, -0.015, 3.572, 0.299, 1.665, 35.994 ], "heli_params": [ -0.282, -0.209, 3.569, 2.693, -0.483, 36.033 ], "bp2_params": [ 0.209, -0.150, -0.286, -0.953, -1.996, 0.670 ], "groove_widths": [ 13.798, 13.723, 16.581, 16.523 ], "simple_Rise": 3.572, "simple_Twist": 33.793, "simple_hRise": 3.569, "simple_hTwist": 33.834 }, { "index": 103, "nt1": "///I/149", "nt2": "///J/32", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.209, -0.150, -0.286, -0.953, -1.996, 0.670 ], "step_params": [ -0.664, 1.031, 3.700, -5.217, 5.778, 39.669 ], "heli_params": [ 0.735, 0.277, 3.860, 8.416, 7.598, 40.395 ], "bp2_params": [ 0.075, -0.113, 0.127, -6.572, 3.051, -1.487 ], "groove_widths": [ 14.240, 13.837, 15.327, 15.306 ], "simple_Rise": 3.700, "simple_Twist": 40.344, "simple_hRise": 3.859, "simple_hTwist": 41.057 }, { "index": 104, "nt1": "///I/150", "nt2": "///J/31", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.075, -0.113, 0.127, -6.572, 3.051, -1.487 ], "step_params": [ 0.173, -0.688, 3.424, -2.468, 4.384, 31.206 ], "heli_params": [ -2.100, -0.790, 3.276, 8.084, 4.552, 31.599 ], "bp2_params": [ -0.196, -0.185, 0.613, -2.161, 6.339, 2.324 ], "groove_widths": [ 15.087, 14.391, 16.381, 16.018 ], "simple_Rise": 3.424, "simple_Twist": 32.784, "simple_hRise": 3.286, "simple_hTwist": 33.157 }, { "index": 105, "nt1": "///I/151", "nt2": "///J/30", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.196, -0.185, 0.613, -2.161, 6.339, 2.324 ], "step_params": [ 0.236, -1.012, 3.260, -0.885, 3.516, 33.153 ], "heli_params": [ -2.336, -0.556, 3.132, 6.138, 1.545, 33.346 ], "bp2_params": [ -0.195, -0.234, 0.783, -1.094, 6.407, 3.001 ], "groove_widths": [ 15.410, 14.740, 17.323, 16.009 ], "simple_Rise": 3.260, "simple_Twist": 33.205, "simple_hRise": 3.132, "simple_hTwist": 33.396 }, { "index": 106, "nt1": "///I/152", "nt2": "///J/29", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.195, -0.234, 0.783, -1.094, 6.407, 3.001 ], "step_params": [ 0.301, -0.953, 3.408, -0.193, 3.260, 30.843 ], "heli_params": [ -2.426, -0.601, 3.291, 6.108, 0.361, 31.012 ], "bp2_params": [ -0.087, -0.366, 1.202, 2.041, 6.882, 0.843 ], "groove_widths": [ 15.337, 14.826, 18.226, 16.950 ], "simple_Rise": 3.408, "simple_Twist": 30.260, "simple_hRise": 3.288, "simple_hTwist": 30.431 }, { "index": 107, "nt1": "///I/153", "nt2": "///J/28", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.087, -0.366, 1.202, 2.041, 6.882, 0.843 ], "step_params": [ 0.450, -0.967, 3.114, 2.015, 3.763, 33.209 ], "heli_params": [ -2.263, -0.470, 3.011, 6.551, -3.507, 33.474 ], "bp2_params": [ -0.182, -0.337, 1.131, 3.415, 4.847, 1.721 ], "groove_widths": [ 14.949, 14.546, 19.549, 18.980 ], "simple_Rise": 3.114, "simple_Twist": 33.646, "simple_hRise": 3.013, "simple_hTwist": 33.908 }, { "index": 108, "nt1": "///I/154", "nt2": "///J/27", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.182, -0.337, 1.131, 3.415, 4.847, 1.721 ], "step_params": [ -0.104, -0.662, 3.703, 0.336, 4.095, 31.309 ], "heli_params": [ -2.067, 0.260, 3.588, 7.546, -0.618, 31.571 ], "bp2_params": [ -0.155, -0.361, 1.281, 6.319, 1.019, 0.714 ], "groove_widths": [ 13.379, 13.023, 18.438, 18.163 ], "simple_Rise": 3.703, "simple_Twist": 31.190, "simple_hRise": 3.587, "simple_hTwist": 31.453 }, { "index": 109, "nt1": "///I/155", "nt2": "///J/26", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.155, -0.361, 1.281, 6.319, 1.019, 0.714 ], "step_params": [ -0.769, -0.806, 3.364, 2.588, -0.883, 41.635 ], "heli_params": [ -1.037, 1.358, 3.328, -1.241, -3.637, 41.721 ], "bp2_params": [ 0.177, -0.307, 1.024, 2.971, -2.969, 0.070 ], "groove_widths": [ 12.796, 12.492, 18.198, 17.999 ], "simple_Rise": 3.364, "simple_Twist": 39.776, "simple_hRise": 3.326, "simple_hTwist": 39.866 }, { "index": 110, "nt1": "///I/156", "nt2": "///J/25", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.177, -0.307, 1.024, 2.971, -2.969, 0.070 ], "step_params": [ -0.239, -0.585, 3.675, 0.790, -1.488, 30.528 ], "heli_params": [ -0.777, 0.629, 3.691, -2.823, -1.499, 30.573 ], "bp2_params": [ -0.129, -0.170, 0.619, -0.658, -6.409, -3.031 ], "groove_widths": [ 12.738, 12.492, 18.815, 18.776 ], "simple_Rise": 3.675, "simple_Twist": 32.298, "simple_hRise": 3.691, "simple_hTwist": 32.341 }, { "index": 111, "nt1": "///I/157", "nt2": "///J/24", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.129, -0.170, 0.619, -0.658, -6.409, -3.031 ], "step_params": [ -0.947, -0.164, 3.382, -0.856, -0.128, 40.532 ], "heli_params": [ -0.223, 1.268, 3.401, -0.184, 1.236, 40.541 ], "bp2_params": [ 0.089, -0.106, -0.221, -5.329, -4.261, -0.918 ], "groove_widths": [ 12.490, 12.325, 18.028, 17.936 ], "simple_Rise": 3.382, "simple_Twist": 39.116, "simple_hRise": 3.402, "simple_hTwist": 39.125 }, { "index": 112, "nt1": "///I/158", "nt2": "///J/23", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.089, -0.106, -0.221, -5.329, -4.261, -0.918 ], "step_params": [ -0.571, -0.695, 3.464, -1.203, 1.047, 30.801 ], "heli_params": [ -1.522, 0.826, 3.458, 1.970, 2.264, 30.841 ], "bp2_params": [ -0.129, -0.111, -0.194, -5.110, -1.204, -3.233 ], "groove_widths": [ 13.840, 13.656, 17.515, 17.461 ], "simple_Rise": 3.464, "simple_Twist": 32.228, "simple_hRise": 3.459, "simple_hTwist": 32.267 }, { "index": 113, "nt1": "///I/159", "nt2": "///J/22", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.129, -0.111, -0.194, -5.110, -1.204, -3.233 ], "step_params": [ -0.168, 0.466, 3.709, -1.183, 3.800, 35.170 ], "heli_params": [ 0.127, 0.078, 3.741, 6.264, 1.951, 35.388 ], "bp2_params": [ -0.110, -0.182, 0.617, -0.649, 2.461, -2.803 ], "groove_widths": [ 15.581, 15.359, 15.432, 15.183 ], "simple_Rise": 3.709, "simple_Twist": 35.116, "simple_hRise": 3.741, "simple_hTwist": 35.334 }, { "index": 114, "nt1": "///I/160", "nt2": "///J/21", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.110, -0.182, 0.617, -0.649, 2.461, -2.803 ], "step_params": [ 1.834, 0.289, 3.226, 0.688, 2.724, 34.302 ], "heli_params": [ 0.066, -2.993, 3.274, 4.608, -1.164, 34.413 ], "bp2_params": [ -0.168, -0.194, 0.732, 3.186, 3.443, 0.020 ], "groove_widths": [ 16.148, 15.903, 14.809, 14.588 ], "simple_Rise": 3.226, "simple_Twist": 34.453, "simple_hRise": 3.274, "simple_hTwist": 34.564 }, { "index": 115, "nt1": "///I/161", "nt2": "///J/20", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.168, -0.194, 0.732, 3.186, 3.443, 0.020 ], "step_params": [ -2.631, -0.235, 3.605, -2.149, 5.645, 41.919 ], "heli_params": [ -0.969, 3.398, 3.669, 7.841, 2.985, 42.332 ], "bp2_params": [ 1.914, 0.904, 1.557, 2.288, 10.243, -39.465 ], "groove_widths": [ 15.776, 15.581, 16.998, 16.960 ], "simple_Rise": 3.605, "simple_Twist": 32.364, "simple_hRise": 3.675, "simple_hTwist": 32.908 }, { "index": 116, "nt1": "///I/162", "nt2": "///J/19", "bp": "A-T", "name": "--", "Saenger": "--", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 1.914, 0.904, 1.557, 2.288, 10.243, -39.465 ], "step_params": [ 2.538, -1.193, 3.595, -1.574, 1.476, 17.739 ], "heli_params": [ -4.748, -9.136, 3.250, 4.764, 5.079, 17.869 ], "bp2_params": [ -0.100, -0.324, 1.124, 4.619, 6.402, 0.607 ], "groove_widths": [ 15.681, 15.608, 17.502, 17.400 ], "simple_Rise": 3.595, "simple_Twist": 27.019, "simple_hRise": 3.376, "simple_hTwist": 27.104 }, { "index": 117, "nt1": "///I/163", "nt2": "///J/18", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.100, -0.324, 1.124, 4.619, 6.402, 0.607 ], "step_params": [ 0.498, 0.363, 3.631, 6.812, 5.494, 41.466 ], "heli_params": [ -0.132, 0.097, 3.681, 7.657, -9.494, 42.340 ], "bp2_params": [ -0.187, -0.297, 0.966, -2.882, -0.324, 1.543 ], "groove_widths": [ 15.784, 15.636, 14.983, 14.837 ], "simple_Rise": 3.631, "simple_Twist": 41.874, "simple_hRise": 3.682, "simple_hTwist": 42.739 }, { "index": 118, "nt1": "///I/164", "nt2": "///J/17", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.187, -0.297, 0.966, -2.882, -0.324, 1.543 ], "step_params": [ -1.370, 0.350, 3.342, -2.106, 2.108, 36.074 ], "heli_params": [ 0.256, 1.899, 3.428, 3.396, 3.393, 36.193 ], "bp2_params": [ -0.178, -0.183, 0.618, -1.111, 1.244, -0.434 ], "groove_widths": [ 15.284, 14.984, 15.441, 15.327 ], "simple_Rise": 3.342, "simple_Twist": 36.037, "simple_hRise": 3.428, "simple_hTwist": 36.156 }, { "index": 119, "nt1": "///I/165", "nt2": "///J/16", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.178, -0.183, 0.618, -1.111, 1.244, -0.434 ], "step_params": [ 1.592, 0.145, 3.374, 0.635, 1.432, 37.841 ], "heli_params": [ 0.033, -2.369, 3.403, 2.207, -0.979, 37.872 ], "bp2_params": [ 0.189, -0.279, 0.909, 2.272, 1.641, 2.683 ], "groove_widths": [ 13.923, 13.666, 14.513, 14.416 ], "simple_Rise": 3.374, "simple_Twist": 35.818, "simple_hRise": 3.404, "simple_hTwist": 35.851 }, { "index": 120, "nt1": "///I/166", "nt2": "///J/15", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.189, -0.279, 0.909, 2.272, 1.641, 2.683 ], "step_params": [ -0.795, 0.170, 3.126, -2.004, 2.064, 37.234 ], "heli_params": [ 0.003, 0.987, 3.168, 3.227, 3.134, 37.341 ], "bp2_params": [ -0.181, -0.268, 0.914, 1.624, -0.230, -1.025 ], "groove_widths": [ 13.039, 12.867, 14.910, 14.485 ], "simple_Rise": 3.126, "simple_Twist": 39.266, "simple_hRise": 3.166, "simple_hTwist": 39.367 }, { "index": 121, "nt1": "///I/167", "nt2": "///J/14", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.181, -0.268, 0.914, 1.624, -0.230, -1.025 ], "step_params": [ -0.426, -0.540, 3.140, -1.041, 2.314, 37.141 ], "heli_params": [ -1.140, 0.535, 3.112, 3.628, 1.632, 37.225 ], "bp2_params": [ -0.165, -0.260, 0.876, 1.233, -2.232, -2.287 ], "groove_widths": [ 13.165, 13.041, 15.752, 15.655 ], "simple_Rise": 3.140, "simple_Twist": 37.069, "simple_hRise": 3.112, "simple_hTwist": 37.153 }, { "index": 122, "nt1": "///I/168", "nt2": "///J/13", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.165, -0.260, 0.876, 1.233, -2.232, -2.287 ], "step_params": [ 0.493, -0.669, 3.287, 2.172, 1.594, 33.359 ], "heli_params": [ -1.427, -0.496, 3.277, 2.772, -3.775, 33.465 ], "bp2_params": [ -0.153, -0.185, 0.792, -0.697, -3.602, -4.233 ], "groove_widths": [ 13.394, 13.340, 15.296, 15.239 ], "simple_Rise": 3.287, "simple_Twist": 33.333, "simple_hRise": 3.277, "simple_hTwist": 33.438 }, { "index": 123, "nt1": "///I/169", "nt2": "///J/12", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.153, -0.185, 0.792, -0.697, -3.602, -4.233 ], "step_params": [ -0.408, 0.759, 3.748, -0.315, -0.388, 37.879 ], "heli_params": [ 1.227, 0.582, 3.743, -0.598, 0.485, 37.882 ], "bp2_params": [ 0.112, -0.094, 0.394, -4.003, -1.916, -4.674 ], "groove_widths": [ 13.910, 13.876, 17.650, 17.275 ], "simple_Rise": 3.748, "simple_Twist": 36.276, "simple_hRise": 3.743, "simple_hTwist": 36.279 }, { "index": 124, "nt1": "///I/170", "nt2": "///J/11", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.112, -0.094, 0.394, -4.003, -1.916, -4.674 ], "step_params": [ -0.419, -0.322, 3.463, -2.496, 2.520, 31.014 ], "heli_params": [ -1.107, 0.276, 3.449, 4.693, 4.649, 31.211 ], "bp2_params": [ 0.104, -0.069, 0.086, -3.762, -0.531, -3.862 ], "groove_widths": [ 14.520, 14.473, 17.148, 16.984 ], "simple_Rise": 3.463, "simple_Twist": 31.101, "simple_hRise": 3.449, "simple_hTwist": 31.298 }, { "index": 125, "nt1": "///I/171", "nt2": "///J/10", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.104, -0.069, 0.086, -3.762, -0.531, -3.862 ], "step_params": [ 0.368, -0.817, 3.297, -1.298, 1.660, 31.154 ], "heli_params": [ -1.833, -0.929, 3.233, 3.087, 2.413, 31.224 ], "bp2_params": [ 0.226, -0.141, 0.312, -0.596, 2.039, 0.500 ], "groove_widths": [ 14.736, 14.612, 15.789, 15.727 ], "simple_Rise": 3.297, "simple_Twist": 30.545, "simple_hRise": 3.231, "simple_hTwist": 30.616 }, { "index": 126, "nt1": "///I/172", "nt2": "///J/9", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.226, -0.141, 0.312, -0.596, 2.039, 0.500 ], "step_params": [ 0.384, 0.696, 3.481, 0.228, 3.953, 37.796 ], "heli_params": [ 0.528, -0.558, 3.535, 6.081, -0.351, 37.996 ], "bp2_params": [ -0.128, -0.312, 1.034, 0.038, -3.242, -0.528 ], "groove_widths": [ 14.337, null, 15.586, null ], "simple_Rise": 3.481, "simple_Twist": 39.743, "simple_hRise": 3.533, "simple_hTwist": 39.931 }, { "index": 127, "nt1": "///I/173", "nt2": "///J/8", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.128, -0.312, 1.034, 0.038, -3.242, -0.528 ], "step_params": [ -0.056, 0.717, 3.837, -0.648, -0.686, 39.099 ], "heli_params": [ 1.167, -0.007, 3.825, -1.024, 0.968, 39.110 ], "bp2_params": [ -0.121, -0.370, 1.129, -2.882, -5.774, -1.347 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.837, "simple_Twist": 39.059, "simple_hRise": 3.825, "simple_hTwist": 39.070 }, { "index": 128, "nt1": "///I/174", "nt2": "///J/7", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.121, -0.370, 1.129, -2.882, -5.774, -1.347 ], "step_params": [ 0.841, 0.189, 3.559, -6.074, -8.954, 43.334 ], "heli_params": [ 1.127, -1.703, 3.318, -11.906, 8.076, 44.601 ], "bp2_params": [ 0.214, -0.786, 1.854, 1.379, 4.211, 4.013 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.559, "simple_Twist": 41.304, "simple_hRise": 3.300, "simple_hTwist": 42.637 }, { "index": 129, "nt1": "///I/175", "nt2": "///J/6", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W" } ] } ], "num_stems": 5, "stems": [ { "index": 1, "helix_index": 1, "strand1": "ACCGCCATCAATATCCACCTGCAGATTCTAC", "strand2": "TGGCGGTAGTTATAGGTGGACGTCTAAGATG", "bp_type": "|||||||||||||||||||||||||||||||", "helix_form": ".B.BB..B.B.BBBBBBBBBB.BBBBB..B", "helical_rise": 3.065, "helical_rise_std": 1.219, "helical_radius": 10.768, "helical_radius_std": 4.575, "helical_axis": [ 0.097, 0.942, 0.320 ], "point1": [ 148.951, 99.218, 85.926 ], "point2": [ 157.868, 185.720, 115.314 ], "num_pairs": 31, "pairs": [ { "index": 1, "nt1": "///I/12", "nt2": "///J/169", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.099, -0.151, 0.505, -6.386, 1.767, -0.622 ], "step_params": [ -0.288, -1.438, 4.020, -2.767, 0.901, 33.354 ], "heli_params": [ -2.679, -0.060, 3.991, 1.567, 4.810, 33.477 ], "bp2_params": [ 0.226, -0.133, 0.235, -6.135, 8.591, 1.307 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 4.020, "simple_Twist": 32.802, "simple_hRise": 3.990, "simple_hTwist": 32.927 }, { "index": 2, "nt1": "///I/13", "nt2": "///J/168", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.226, -0.133, 0.235, -6.135, 8.591, 1.307 ], "step_params": [ 0.459, -0.796, 3.471, -3.629, 4.197, 33.492 ], "heli_params": [ -2.063, -1.392, 3.284, 7.222, 6.245, 33.936 ], "bp2_params": [ 0.243, -0.139, 0.176, -1.696, 13.766, 1.928 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.471, "simple_Twist": 33.403, "simple_hRise": 3.284, "simple_hTwist": 33.848 }, { "index": 3, "nt1": "///I/14", "nt2": "///J/167", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.243, -0.139, 0.176, -1.696, 13.766, 1.928 ], "step_params": [ -0.047, -1.041, 3.116, 7.325, 23.333, 34.511 ], "heli_params": [ -3.549, 0.725, 2.007, 34.492, -10.828, 42.082 ], "bp2_params": [ -0.193, -0.169, -0.698, -8.243, -3.584, 0.367 ], "groove_widths": [ 15.229, null, 17.622, null ], "simple_Rise": 3.116, "simple_Twist": 36.766, "simple_hRise": 2.087, "simple_hTwist": 43.921 }, { "index": 4, "nt1": "///I/15", "nt2": "///J/166", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.193, -0.169, -0.698, -8.243, -3.584, 0.367 ], "step_params": [ 0.619, 0.134, 3.374, -2.091, 2.256, 33.574 ], "heli_params": [ -0.146, -1.416, 3.332, 3.895, 3.610, 33.711 ], "bp2_params": [ 0.198, -0.133, -0.049, -2.655, 0.838, 0.993 ], "groove_widths": [ 14.872, 14.047, 18.549, 16.687 ], "simple_Rise": 3.374, "simple_Twist": 31.456, "simple_hRise": 3.328, "simple_hTwist": 31.602 }, { "index": 5, "nt1": "///I/16", "nt2": "///J/165", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.198, -0.133, -0.049, -2.655, 0.838, 0.993 ], "step_params": [ 0.798, -1.138, 3.420, -1.321, 2.265, 31.274 ], "heli_params": [ -2.542, -1.730, 3.296, 4.192, 2.444, 31.381 ], "bp2_params": [ 0.197, -0.213, 0.680, 0.619, 1.269, 0.754 ], "groove_widths": [ 14.504, 13.955, 19.347, 17.916 ], "simple_Rise": 3.420, "simple_Twist": 31.276, "simple_hRise": 3.296, "simple_hTwist": 31.383 }, { "index": 6, "nt1": "///I/17", "nt2": "///J/164", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.197, -0.213, 0.680, 0.619, 1.269, 0.754 ], "step_params": [ -2.710, -0.671, 3.236, -4.220, 9.970, 39.246 ], "heli_params": [ -2.083, 3.428, 3.240, 14.511, 6.142, 40.655 ], "bp2_params": [ 1.688, 0.370, 1.501, 0.146, 13.101, -28.556 ], "groove_widths": [ 14.894, 14.410, 17.979, 17.069 ], "simple_Rise": 3.236, "simple_Twist": 32.281, "simple_hRise": 3.212, "simple_hTwist": 34.002 }, { "index": 7, "nt1": "///I/18", "nt2": "///J/163", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 1.688, 0.370, 1.501, 0.146, 13.101, -28.556 ], "step_params": [ 1.955, -1.083, 3.505, -0.188, 1.082, 25.133 ], "heli_params": [ -2.824, -4.547, 3.441, 2.486, 0.432, 25.157 ], "bp2_params": [ -0.090, -0.352, 1.187, 3.377, 8.342, -1.213 ], "groove_widths": [ 15.747, 15.314, 14.797, 14.394 ], "simple_Rise": 3.505, "simple_Twist": 33.780, "simple_hRise": 3.459, "simple_hTwist": 33.797 }, { "index": 8, "nt1": "///I/19", "nt2": "///J/162", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.090, -0.352, 1.187, 3.377, 8.342, -1.213 ], "step_params": [ 0.613, -0.133, 3.404, 4.237, 4.997, 39.656 ], "heli_params": [ -0.790, -0.388, 3.408, 7.305, -6.194, 40.172 ], "bp2_params": [ 0.203, -0.417, 1.227, 2.646, 5.329, 1.227 ], "groove_widths": [ 16.010, 15.509, 14.155, 13.766 ], "simple_Rise": 3.404, "simple_Twist": 37.958, "simple_hRise": 3.406, "simple_hTwist": 38.499 }, { "index": 9, "nt1": "///I/20", "nt2": "///J/161", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.203, -0.417, 1.227, 2.646, 5.329, 1.227 ], "step_params": [ 0.038, 0.481, 3.471, 0.700, 3.900, 40.129 ], "heli_params": [ 0.228, 0.029, 3.501, 5.666, -1.017, 40.316 ], "bp2_params": [ 0.294, -0.640, 1.858, 4.360, 4.563, -5.851 ], "groove_widths": [ 15.457, 14.989, 16.298, 15.611 ], "simple_Rise": 3.471, "simple_Twist": 39.461, "simple_hRise": 3.501, "simple_hTwist": 39.651 }, { "index": 10, "nt1": "///I/21", "nt2": "///J/160", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.294, -0.640, 1.858, 4.360, 4.563, -5.851 ], "step_params": [ 0.187, -0.621, 3.366, 0.014, 2.510, 33.522 ], "heli_params": [ -1.493, -0.322, 3.312, 4.344, -0.024, 33.613 ], "bp2_params": [ 0.301, -0.490, 1.632, 7.408, 1.522, -2.827 ], "groove_widths": [ 14.646, 14.265, 15.689, 15.366 ], "simple_Rise": 3.366, "simple_Twist": 33.551, "simple_hRise": 3.312, "simple_hTwist": 33.642 }, { "index": 11, "nt1": "///I/22", "nt2": "///J/159", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.301, -0.490, 1.632, 7.408, 1.522, -2.827 ], "step_params": [ -0.544, -1.486, 3.784, 3.536, -2.393, 32.525 ], "heli_params": [ -2.153, 1.672, 3.802, -4.249, -6.279, 32.796 ], "bp2_params": [ -0.252, -0.536, 1.543, 2.210, 0.316, -4.339 ], "groove_widths": [ 14.085, 13.746, 16.267, 16.200 ], "simple_Rise": 3.784, "simple_Twist": 35.772, "simple_hRise": 3.803, "simple_hTwist": 36.018 }, { "index": 12, "nt1": "///I/23", "nt2": "///J/158", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.252, -0.536, 1.543, 2.210, 0.316, -4.339 ], "step_params": [ 0.673, -0.094, 3.632, 2.007, 4.447, 40.685 ], "heli_params": [ -0.676, -0.718, 3.630, 6.369, -2.874, 40.965 ], "bp2_params": [ 0.161, -0.294, 0.962, -2.960, -7.696, -4.604 ], "groove_widths": [ 13.489, 13.233, 17.904, 17.874 ], "simple_Rise": 3.632, "simple_Twist": 38.188, "simple_hRise": 3.628, "simple_hTwist": 38.487 }, { "index": 13, "nt1": "///I/24", "nt2": "///J/157", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.161, -0.294, 0.962, -2.960, -7.696, -4.604 ], "step_params": [ -0.256, -0.708, 3.704, -0.239, -0.930, 29.886 ], "heli_params": [ -1.154, 0.440, 3.726, -1.803, 0.463, 29.901 ], "bp2_params": [ -0.158, -0.141, 0.554, -6.265, -6.429, -2.120 ], "groove_widths": [ 13.386, 13.233, 18.202, 18.025 ], "simple_Rise": 3.704, "simple_Twist": 31.762, "simple_hRise": 3.725, "simple_hTwist": 31.776 }, { "index": 14, "nt1": "///I/25", "nt2": "///J/156", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.158, -0.141, 0.554, -6.265, -6.429, -2.120 ], "step_params": [ -0.220, -0.053, 3.539, -3.046, 0.577, 36.277 ], "heli_params": [ -0.173, -0.107, 3.544, 0.924, 4.881, 36.405 ], "bp2_params": [ 0.157, -0.163, 0.500, -7.370, -0.560, -0.528 ], "groove_widths": [ 14.448, 14.291, 18.504, 18.419 ], "simple_Rise": 3.539, "simple_Twist": 34.506, "simple_hRise": 3.543, "simple_hTwist": 34.641 }, { "index": 15, "nt1": "///I/26", "nt2": "///J/155", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.157, -0.163, 0.500, -7.370, -0.560, -0.528 ], "step_params": [ 0.173, -0.784, 3.454, -3.212, 2.558, 31.592 ], "heli_params": [ -1.917, -0.928, 3.349, 4.675, 5.869, 31.851 ], "bp2_params": [ 0.207, -0.199, 0.630, -4.834, 3.783, 0.608 ], "groove_widths": [ 14.880, 14.471, 17.821, 17.376 ], "simple_Rise": 3.454, "simple_Twist": 31.417, "simple_hRise": 3.348, "simple_hTwist": 31.677 }, { "index": 16, "nt1": "///I/27", "nt2": "///J/154", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.207, -0.199, 0.630, -4.834, 3.783, 0.608 ], "step_params": [ -0.179, -0.207, 3.146, -1.239, 3.766, 34.304 ], "heli_params": [ -0.909, 0.118, 3.111, 6.358, 2.091, 34.526 ], "bp2_params": [ 0.119, -0.283, 0.945, -2.066, 5.933, -0.647 ], "groove_widths": [ 15.210, 14.546, 17.069, 15.980 ], "simple_Rise": 3.146, "simple_Twist": 34.682, "simple_hRise": 3.111, "simple_hTwist": 34.901 }, { "index": 17, "nt1": "///I/28", "nt2": "///J/153", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.119, -0.283, 0.945, -2.066, 5.933, -0.647 ], "step_params": [ -0.057, -0.583, 3.453, -1.027, 5.059, 32.969 ], "heli_params": [ -1.892, -0.078, 3.330, 8.847, 1.797, 33.360 ], "bp2_params": [ 0.219, -0.294, 0.949, 0.887, 6.866, 1.980 ], "groove_widths": [ 16.089, 15.384, 16.717, 15.591 ], "simple_Rise": 3.453, "simple_Twist": 32.447, "simple_hRise": 3.327, "simple_hTwist": 32.844 }, { "index": 18, "nt1": "///I/29", "nt2": "///J/152", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.219, -0.294, 0.949, 0.887, 6.866, 1.980 ], "step_params": [ 0.794, -0.580, 3.248, 1.821, 4.697, 34.296 ], "heli_params": [ -1.686, -1.057, 3.180, 7.912, -3.068, 34.653 ], "bp2_params": [ 0.229, -0.327, 1.027, 1.980, 6.377, 3.069 ], "groove_widths": [ 15.900, 15.229, 16.059, 15.115 ], "simple_Rise": 3.248, "simple_Twist": 34.213, "simple_hRise": 3.179, "simple_hTwist": 34.571 }, { "index": 19, "nt1": "///I/30", "nt2": "///J/151", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.229, -0.327, 1.027, 1.980, 6.377, 3.069 ], "step_params": [ 0.021, -0.760, 3.455, 1.625, 3.513, 30.006 ], "heli_params": [ -2.198, 0.302, 3.343, 6.750, -3.123, 30.249 ], "bp2_params": [ -0.145, -0.482, 1.409, 3.692, 7.370, -1.541 ], "groove_widths": [ 15.220, 14.618, 16.617, 16.149 ], "simple_Rise": 3.455, "simple_Twist": 32.184, "simple_hRise": 3.353, "simple_hTwist": 32.410 }, { "index": 20, "nt1": "///I/31", "nt2": "///J/150", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.145, -0.482, 1.409, 3.692, 7.370, -1.541 ], "step_params": [ 0.154, 0.328, 3.174, 2.463, 2.641, 41.492 ], "heli_params": [ 0.189, 0.036, 3.192, 3.719, -3.469, 41.642 ], "bp2_params": [ -0.177, -0.369, 1.300, 8.313, 4.407, 1.019 ], "groove_widths": [ 14.947, 14.602, 15.732, 15.716 ], "simple_Rise": 3.174, "simple_Twist": 41.488, "simple_hRise": 3.192, "simple_hTwist": 41.638 }, { "index": 21, "nt1": "///I/32", "nt2": "///J/149", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.177, -0.369, 1.300, 8.313, 4.407, 1.019 ], "step_params": [ -0.072, 0.001, 4.022, 3.540, 2.152, 37.017 ], "heli_params": [ -0.350, 0.690, 3.992, 3.376, -5.554, 37.240 ], "bp2_params": [ 0.154, -0.425, 1.275, 3.352, -0.350, -0.283 ], "groove_widths": [ 14.146, 14.070, 15.727, 15.261 ], "simple_Rise": 4.022, "simple_Twist": 35.295, "simple_hRise": 3.989, "simple_hTwist": 35.530 }, { "index": 22, "nt1": "///I/33", "nt2": "///J/148", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.154, -0.425, 1.275, 3.352, -0.350, -0.283 ], "step_params": [ -0.172, 2.569, 4.305, 2.574, -14.099, 42.694 ], "heli_params": [ 4.891, 0.504, 3.323, -18.744, -3.422, 44.928 ], "bp2_params": [ 0.157, -0.343, 1.077, -3.116, -4.010, -2.307 ], "groove_widths": [ 13.112, 13.099, 16.754, 16.107 ], "simple_Rise": 4.305, "simple_Twist": 42.604, "simple_hRise": 3.321, "simple_hTwist": 44.844 }, { "index": 23, "nt1": "///I/34", "nt2": "///J/147", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.157, -0.343, 1.077, -3.116, -4.010, -2.307 ], "step_params": [ -0.015, 0.132, 3.757, -1.088, -0.070, 33.954 ], "heli_params": [ 0.238, -0.174, 3.756, -0.119, 1.863, 33.971 ], "bp2_params": [ -0.185, -0.179, 0.563, -4.343, -3.184, -0.242 ], "groove_widths": [ 12.792, 12.771, 17.390, 16.963 ], "simple_Rise": 3.757, "simple_Twist": 35.942, "simple_hRise": 3.756, "simple_hTwist": 35.958 }, { "index": 24, "nt1": "///I/35", "nt2": "///J/146", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.185, -0.179, 0.563, -4.343, -3.184, -0.242 ], "step_params": [ -0.185, 0.145, 3.509, -1.342, 0.032, 39.294 ], "heli_params": [ 0.211, 0.103, 3.514, 0.048, 1.996, 39.316 ], "bp2_params": [ 0.086, -0.119, 0.092, -5.817, -1.362, 0.562 ], "groove_widths": [ 13.228, 13.093, 16.558, 16.466 ], "simple_Rise": 3.509, "simple_Twist": 37.694, "simple_hRise": 3.514, "simple_hTwist": 37.717 }, { "index": 25, "nt1": "///I/36", "nt2": "///J/145", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.086, -0.119, 0.092, -5.817, -1.362, 0.562 ], "step_params": [ -0.157, -0.918, 3.597, -2.002, 1.095, 31.605 ], "heli_params": [ -1.903, -0.116, 3.567, 2.006, 3.670, 31.685 ], "bp2_params": [ -0.094, -0.111, 0.264, -6.250, 1.619, -1.071 ], "groove_widths": [ 13.961, 13.668, 18.069, 18.057 ], "simple_Rise": 3.597, "simple_Twist": 32.783, "simple_hRise": 3.568, "simple_hTwist": 32.860 }, { "index": 26, "nt1": "///I/37", "nt2": "///J/144", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.094, -0.111, 0.264, -6.250, 1.619, -1.071 ], "step_params": [ 0.502, -0.504, 3.700, -2.130, 2.432, 32.702 ], "heli_params": [ -1.357, -1.297, 3.615, 4.307, 3.771, 32.857 ], "bp2_params": [ -0.087, -0.157, 0.573, -5.130, 7.512, 0.258 ], "groove_widths": [ 14.732, 13.995, 19.821, 19.008 ], "simple_Rise": 3.700, "simple_Twist": 32.709, "simple_hRise": 3.615, "simple_hTwist": 32.864 }, { "index": 27, "nt1": "///I/38", "nt2": "///J/143", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.087, -0.157, 0.573, -5.130, 7.512, 0.258 ], "step_params": [ -0.816, -0.589, 3.264, -0.711, 6.897, 34.331 ], "heli_params": [ -2.000, 1.252, 3.107, 11.539, 1.190, 35.003 ], "bp2_params": [ 0.253, -0.214, 0.652, 0.963, 11.859, 3.356 ], "groove_widths": [ 16.344, 15.386, 18.553, 16.934 ], "simple_Rise": 3.264, "simple_Twist": 32.270, "simple_hRise": 3.092, "simple_hTwist": 32.987 }, { "index": 28, "nt1": "///I/39", "nt2": "///J/142", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.253, -0.214, 0.652, 0.963, 11.859, 3.356 ], "step_params": [ -0.371, -1.492, 3.356, 0.183, 6.416, 23.261 ], "heli_params": [ -5.552, 0.945, 2.844, 15.536, -0.444, 24.119 ], "bp2_params": [ -0.094, -0.331, 1.161, 4.861, 11.471, -2.869 ], "groove_widths": [ 17.547, null, 17.987, null ], "simple_Rise": 3.356, "simple_Twist": 25.222, "simple_hRise": 2.891, "simple_hTwist": 26.013 }, { "index": 29, "nt1": "///I/40", "nt2": "///J/141", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.094, -0.331, 1.161, 4.861, 11.471, -2.869 ], "step_params": [ 2.224, 0.012, 3.054, 3.734, 6.352, 35.482 ], "heli_params": [ -0.846, -3.070, 3.219, 10.286, -6.047, 36.214 ], "bp2_params": [ 0.124, -0.476, 1.551, 8.727, 6.901, 4.826 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.054, "simple_Twist": 34.034, "simple_hRise": 3.223, "simple_hTwist": 34.800 }, { "index": 30, "nt1": "///I/41", "nt2": "///J/140", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.124, -0.476, 1.551, 8.727, 6.901, 4.826 ], "step_params": [ -0.367, -1.006, 3.593, 5.017, 0.185, 30.113 ], "heli_params": [ -1.952, 1.783, 3.481, 0.353, -9.573, 30.519 ], "bp2_params": [ 0.232, -0.335, 1.072, 8.415, 4.750, 4.020 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.593, "simple_Twist": 29.659, "simple_hRise": 3.479, "simple_hTwist": 30.072 }, { "index": 31, "nt1": "///I/42", "nt2": "///J/139", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 2, "helix_index": 2, "strand1": "AAAGTGTATTTGGAAACTGCTCC", "strand2": "TTTCACATAAACCTTTGACGAGG", "bp_type": "|||||||||||||||||||||||", "helix_form": "BBBBBB..B..BBBBBBBB...", "helical_rise": 2.954, "helical_rise_std": 1.300, "helical_radius": 11.347, "helical_radius_std": 4.699, "helical_axis": [ 0.296, -0.656, 0.694 ], "point1": [ 149.065, 189.381, 140.771 ], "point2": [ 168.135, 147.086, 185.482 ], "num_pairs": 23, "pairs": [ { "index": 1, "nt1": "///I/45", "nt2": "///J/136", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.091, -0.226, 0.692, -6.340, -5.429, -0.703 ], "step_params": [ -1.013, -0.200, 3.436, -1.743, 2.115, 37.496 ], "heli_params": [ -0.602, 1.332, 3.462, 3.284, 2.707, 37.593 ], "bp2_params": [ 0.134, -0.256, 0.798, -6.474, -2.824, -2.663 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.436, "simple_Twist": 37.347, "simple_hRise": 3.462, "simple_hTwist": 37.444 }, { "index": 2, "nt1": "///I/46", "nt2": "///J/135", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.134, -0.256, 0.798, -6.474, -2.824, -2.663 ], "step_params": [ -0.044, 0.529, 3.699, -2.224, 2.613, 33.466 ], "heli_params": [ 0.429, -0.337, 3.724, 4.523, 3.850, 33.636 ], "bp2_params": [ 0.106, -0.168, 0.307, -6.166, -1.736, -0.248 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.699, "simple_Twist": 33.601, "simple_hRise": 3.724, "simple_hTwist": 33.771 }, { "index": 3, "nt1": "///I/47", "nt2": "///J/134", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.106, -0.168, 0.307, -6.166, -1.736, -0.248 ], "step_params": [ -0.524, 0.518, 3.394, -1.655, 2.010, 31.362 ], "heli_params": [ 0.562, 0.643, 3.442, 3.710, 3.054, 31.467 ], "bp2_params": [ -0.203, -0.137, 0.168, -4.572, 2.599, 0.336 ], "groove_widths": [ 15.969, null, 16.789, null ], "simple_Rise": 3.394, "simple_Twist": 33.165, "simple_hRise": 3.440, "simple_hTwist": 33.264 }, { "index": 4, "nt1": "///I/48", "nt2": "///J/133", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.203, -0.137, 0.168, -4.572, 2.599, 0.336 ], "step_params": [ 0.534, -0.391, 3.820, -2.787, 3.713, 33.090 ], "heli_params": [ -1.390, -1.462, 3.700, 6.480, 4.863, 33.405 ], "bp2_params": [ -0.077, -0.127, 0.280, 1.150, 2.205, 0.161 ], "groove_widths": [ 16.853, 15.731, 16.808, 15.989 ], "simple_Rise": 3.820, "simple_Twist": 32.455, "simple_hRise": 3.697, "simple_hTwist": 32.776 }, { "index": 5, "nt1": "///I/49", "nt2": "///J/132", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.077, -0.127, 0.280, 1.150, 2.205, 0.161 ], "step_params": [ 0.421, -0.407, 3.122, -2.257, 11.795, 31.820 ], "heli_params": [ -2.456, -1.059, 2.766, 20.618, 3.946, 33.956 ], "bp2_params": [ -0.241, -0.239, 0.798, 3.092, 11.290, 2.923 ], "groove_widths": [ 17.736, 16.138, 16.639, 15.067 ], "simple_Rise": 3.122, "simple_Twist": 32.633, "simple_hRise": 2.779, "simple_hTwist": 34.716 }, { "index": 6, "nt1": "///I/50", "nt2": "///J/131", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.241, -0.239, 0.798, 3.092, 11.290, 2.923 ], "step_params": [ 0.916, -0.826, 3.741, 2.010, 7.984, 31.079 ], "heli_params": [ -3.100, -1.251, 3.478, 14.583, -3.671, 32.125 ], "bp2_params": [ -0.125, -0.587, 1.589, 5.625, 10.531, -0.043 ], "groove_widths": [ 18.263, 16.871, 17.366, 15.177 ], "simple_Rise": 3.741, "simple_Twist": 30.498, "simple_hRise": 3.471, "simple_hTwist": 31.565 }, { "index": 7, "nt1": "///I/51", "nt2": "///J/130", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.125, -0.587, 1.589, 5.625, 10.531, -0.043 ], "step_params": [ -0.009, -0.672, 3.160, 4.352, 6.636, 37.897 ], "heli_params": [ -1.789, 0.522, 2.986, 10.083, -6.613, 38.689 ], "bp2_params": [ 0.335, -0.535, 1.768, 11.495, 3.476, -6.666 ], "groove_widths": [ 17.409, 16.451, 17.594, 16.311 ], "simple_Rise": 3.160, "simple_Twist": 35.155, "simple_hRise": 2.966, "simple_hTwist": 36.012 }, { "index": 8, "nt1": "///I/52", "nt2": "///J/129", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.335, -0.535, 1.768, 11.495, 3.476, -6.666 ], "step_params": [ 0.769, -1.138, 3.701, 6.575, -0.463, 25.337 ], "heli_params": [ -2.368, 0.381, 3.796, -1.033, -14.676, 26.167 ], "bp2_params": [ -0.112, -0.470, 1.336, 9.954, 5.108, 1.255 ], "groove_widths": [ 15.748, 15.277, 17.192, 17.189 ], "simple_Rise": 3.701, "simple_Twist": 28.028, "simple_hRise": 3.797, "simple_hTwist": 28.777 }, { "index": 9, "nt1": "///I/53", "nt2": "///J/128", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.112, -0.470, 1.336, 9.954, 5.108, 1.255 ], "step_params": [ 0.373, -0.246, 3.547, 6.994, 0.759, 39.519 ], "heli_params": [ -0.453, 0.328, 3.554, 1.112, -10.245, 40.115 ], "bp2_params": [ -0.243, -0.549, 1.510, 7.455, -1.415, -6.322 ], "groove_widths": [ 14.244, 14.077, 16.898, 16.825 ], "simple_Rise": 3.547, "simple_Twist": 40.233, "simple_hRise": 3.555, "simple_hTwist": 40.818 }, { "index": 10, "nt1": "///I/54", "nt2": "///J/127", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.243, -0.549, 1.510, 7.455, -1.415, -6.322 ], "step_params": [ 0.199, 0.465, 4.068, 4.953, -1.148, 37.233 ], "heli_params": [ 0.909, 0.496, 4.044, -1.788, -7.714, 37.566 ], "bp2_params": [ -0.246, -0.463, 1.440, 0.794, -3.694, -4.683 ], "groove_widths": [ 13.920, 13.881, 15.888, 15.747 ], "simple_Rise": 4.068, "simple_Twist": 37.294, "simple_hRise": 4.045, "simple_hTwist": 37.627 }, { "index": 11, "nt1": "///I/55", "nt2": "///J/126", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.246, -0.463, 1.440, 0.794, -3.694, -4.683 ], "step_params": [ -0.478, 1.766, 4.033, -0.240, 0.179, 40.396 ], "heli_params": [ 2.532, 0.659, 4.044, 0.259, 0.347, 40.397 ], "bp2_params": [ -0.148, -0.297, 0.885, -3.905, -3.182, -1.861 ], "groove_widths": [ 14.299, 14.284, 14.435, 14.047 ], "simple_Rise": 4.033, "simple_Twist": 39.772, "simple_hRise": 4.044, "simple_hTwist": 39.773 }, { "index": 12, "nt1": "///I/56", "nt2": "///J/125", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.148, -0.297, 0.885, -3.905, -3.182, -1.861 ], "step_params": [ 0.206, 0.210, 3.231, -1.289, 2.045, 37.707 ], "heli_params": [ 0.063, -0.483, 3.229, 3.160, 1.993, 37.782 ], "bp2_params": [ -0.165, -0.266, 0.851, -3.802, -1.228, -0.374 ], "groove_widths": [ 14.018, 13.937, 15.114, 14.897 ], "simple_Rise": 3.231, "simple_Twist": 37.783, "simple_hRise": 3.229, "simple_hTwist": 37.858 }, { "index": 13, "nt1": "///I/57", "nt2": "///J/124", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.165, -0.266, 0.851, -3.802, -1.228, -0.374 ], "step_params": [ -0.509, 0.813, 3.505, -0.842, 2.680, 40.979 ], "heli_params": [ 0.844, 0.627, 3.558, 3.822, 1.201, 41.071 ], "bp2_params": [ 0.087, -0.149, 0.463, -3.737, -0.015, -1.333 ], "groove_widths": [ 14.250, 13.916, 15.135, 15.097 ], "simple_Rise": 3.505, "simple_Twist": 39.468, "simple_hRise": 3.560, "simple_hTwist": 39.563 }, { "index": 14, "nt1": "///I/58", "nt2": "///J/123", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.087, -0.149, 0.463, -3.737, -0.015, -1.333 ], "step_params": [ -0.212, 0.542, 3.571, -1.616, 3.855, 34.157 ], "heli_params": [ 0.254, 0.081, 3.615, 6.532, 2.739, 34.404 ], "bp2_params": [ 0.122, -0.163, 0.573, -0.686, -1.078, -1.084 ], "groove_widths": [ 16.429, 15.691, 15.732, 15.559 ], "simple_Rise": 3.571, "simple_Twist": 33.999, "simple_hRise": 3.615, "simple_hTwist": 34.247 }, { "index": 15, "nt1": "///I/59", "nt2": "///J/122", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.122, -0.163, 0.573, -0.686, -1.078, -1.084 ], "step_params": [ 0.429, -0.170, 3.482, -3.192, 11.390, 29.827 ], "heli_params": [ -2.466, -1.382, 3.146, 21.113, 5.917, 32.037 ], "bp2_params": [ 0.144, -0.263, 1.002, 1.463, 8.161, 0.808 ], "groove_widths": [ 18.334, 17.336, 16.180, 14.962 ], "simple_Rise": 3.482, "simple_Twist": 29.704, "simple_hRise": 3.144, "simple_hTwist": 31.924 }, { "index": 16, "nt1": "///I/60", "nt2": "///J/121", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.144, -0.263, 1.002, 1.463, 8.161, 0.808 ], "step_params": [ 0.467, -0.595, 3.432, 0.346, 4.743, 28.450 ], "heli_params": [ -2.290, -0.857, 3.297, 9.567, -0.699, 28.837 ], "bp2_params": [ 0.225, -0.377, 1.113, 5.789, 5.244, 3.477 ], "groove_widths": [ 18.111, 17.097, 17.753, 15.568 ], "simple_Rise": 3.432, "simple_Twist": 28.055, "simple_hRise": 3.294, "simple_hTwist": 28.447 }, { "index": 17, "nt1": "///I/61", "nt2": "///J/120", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.225, -0.377, 1.113, 5.789, 5.244, 3.477 ], "step_params": [ 0.849, -1.288, 3.487, 3.667, 4.074, 32.061 ], "heli_params": [ -3.053, -0.839, 3.376, 7.309, -6.579, 32.514 ], "bp2_params": [ -0.132, -0.492, 1.453, 3.048, 1.548, -2.194 ], "groove_widths": [ 16.417, 15.515, 18.761, 17.636 ], "simple_Rise": 3.487, "simple_Twist": 34.204, "simple_hRise": 3.386, "simple_hTwist": 34.627 }, { "index": 18, "nt1": "///I/62", "nt2": "///J/119", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.132, -0.492, 1.453, 3.048, 1.548, -2.194 ], "step_params": [ -0.301, -0.349, 3.053, 6.519, 8.743, 34.835 ], "heli_params": [ -1.666, 1.308, 2.789, 14.181, -10.573, 36.452 ], "bp2_params": [ -0.130, -0.350, 1.346, 13.585, 2.541, -1.728 ], "groove_widths": [ 14.545, 14.028, 16.855, 16.817 ], "simple_Rise": 3.053, "simple_Twist": 34.648, "simple_hRise": 2.787, "simple_hTwist": 36.274 }, { "index": 19, "nt1": "///I/63", "nt2": "///J/118", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.130, -0.350, 1.346, 13.585, 2.541, -1.728 ], "step_params": [ 0.679, -0.695, 3.512, 6.052, -0.747, 36.680 ], "heli_params": [ -0.981, -0.184, 3.588, -1.177, -9.535, 37.166 ], "bp2_params": [ 0.172, -0.311, 0.936, 8.458, -4.262, -0.663 ], "groove_widths": [ 12.946, 12.827, 14.943, 14.748 ], "simple_Rise": 3.512, "simple_Twist": 35.093, "simple_hRise": 3.589, "simple_hTwist": 35.602 }, { "index": 20, "nt1": "///I/64", "nt2": "///J/117", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.172, -0.311, 0.936, 8.458, -4.262, -0.663 ], "step_params": [ -0.392, 0.833, 4.125, 2.199, -2.793, 36.682 ], "heli_params": [ 1.791, 0.993, 4.023, -4.426, -3.484, 36.848 ], "bp2_params": [ -0.241, -0.351, 1.115, 3.170, -13.586, -8.910 ], "groove_widths": [ 12.460, null, 16.579, null ], "simple_Rise": 4.125, "simple_Twist": 39.062, "simple_hRise": 4.031, "simple_hTwist": 39.217 }, { "index": 21, "nt1": "///I/65", "nt2": "///J/116", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.241, -0.351, 1.115, 3.170, -13.586, -8.910 ], "step_params": [ 1.095, 1.818, 4.683, 1.904, -13.094, 44.885 ], "heli_params": [ 3.789, -1.164, 4.069, -16.724, -2.432, 46.698 ], "bp2_params": [ 0.177, -0.353, 1.220, -5.832, 1.292, 1.428 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 4.683, "simple_Twist": 42.417, "simple_hRise": 4.022, "simple_hTwist": 44.342 }, { "index": 22, "nt1": "///I/66", "nt2": "///J/115", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.177, -0.353, 1.220, -5.832, 1.292, 1.428 ], "step_params": [ 0.104, 1.375, 4.146, -3.268, 3.110, 40.591 ], "heli_params": [ 1.533, -0.610, 4.215, 4.466, 4.694, 40.830 ], "bp2_params": [ 0.195, -0.365, 1.233, -7.527, 4.386, 1.220 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 4.146, "simple_Twist": 40.561, "simple_hRise": 4.215, "simple_hTwist": 40.801 }, { "index": 23, "nt1": "///I/67", "nt2": "///J/114", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 3, "helix_index": 2, "strand1": "CAA", "strand2": "GTT", "bp_type": "|||", "helix_form": "BB", "helical_rise": 3.811, "helical_rise_std": 0.324, "helical_radius": 9.587, "helical_radius_std": 2.425, "helical_axis": [ -0.160, -0.843, -0.513 ], "point1": [ 151.471, 126.522, 180.133 ], "point2": [ 150.211, 119.898, 176.102 ], "num_pairs": 3, "pairs": [ { "index": 1, "nt1": "///I/70", "nt2": "///J/111", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.175, -0.416, -1.215, -4.601, -1.552, 1.702 ], "step_params": [ 0.194, -0.143, 3.462, 0.956, 9.137, 33.635 ], "heli_params": [ -1.705, -0.171, 3.316, 15.435, -1.615, 34.832 ], "bp2_params": [ 0.078, -0.124, 0.019, -2.240, 0.878, 1.704 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.462, "simple_Twist": 34.099, "simple_hRise": 3.319, "simple_hTwist": 35.279 }, { "index": 2, "nt1": "///I/71", "nt2": "///J/110", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.078, -0.124, 0.019, -2.240, 0.878, 1.704 ], "step_params": [ -0.889, 0.342, 3.212, -1.763, 14.690, 35.759 ], "heli_params": [ -1.319, 1.124, 3.148, 22.760, 2.731, 38.607 ], "bp2_params": [ 0.165, -0.140, 0.664, 9.821, 11.647, -2.142 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.212, "simple_Twist": 35.011, "simple_hRise": 3.142, "simple_hTwist": 37.919 }, { "index": 3, "nt1": "///I/72", "nt2": "///J/109", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 4, "helix_index": 2, "strand1": "AGGCATGTTCAGCTGAATTCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGAATCTGCAGGTGGATATTG", "strand2": "TCCGTACAAGTCGACTTAAGTCGACTTGTACGGAAAACTACCTCGTCAAAGGTTTATGTGAAAACCATCTTAGACGTCCACCTATAAC", "bp_type": "||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||", "helix_form": ".BBBBBBBB..BBBBBBBB..B.BBBBBBB.B.BBBBBB...BBBBBB.BB.B.BBBB.BBB..B....BBBB.BBBBBBBBBB.BB", "helical_rise": 0.330, "helical_rise_std": 2.393, "helical_axis": [ -0.990, -0.027, 0.142 ], "point1": [ null, null, null ], "point2": [ null, null, null ], "num_pairs": 88, "pairs": [ { "index": 1, "nt1": "///I/74", "nt2": "///J/107", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.061, -0.189, 0.535, -2.261, -2.665, 2.868 ], "step_params": [ -0.755, 2.762, 3.933, -6.681, -15.911, 41.090 ], "heli_params": [ 5.239, 0.332, 2.814, -21.559, 9.052, 44.421 ], "bp2_params": [ -0.151, -0.308, 0.922, -0.379, -6.710, -2.412 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.933, "simple_Twist": 42.384, "simple_hRise": 2.854, "simple_hTwist": 45.612 }, { "index": 2, "nt1": "///I/75", "nt2": "///J/106", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.151, -0.308, 0.922, -0.379, -6.710, -2.412 ], "step_params": [ 0.419, -0.091, 3.440, -0.641, -4.278, 38.612 ], "heli_params": [ 0.411, -0.712, 3.423, -6.444, 0.966, 38.844 ], "bp2_params": [ -0.177, -0.261, 0.844, -0.250, -0.744, 0.477 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.440, "simple_Twist": 38.783, "simple_hRise": 3.424, "simple_hTwist": 39.014 }, { "index": 3, "nt1": "///I/76", "nt2": "///J/105", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.177, -0.261, 0.844, -0.250, -0.744, 0.477 ], "step_params": [ -0.487, -0.611, 3.435, -0.265, -0.590, 39.325 ], "heli_params": [ -0.835, 0.690, 3.447, -0.877, 0.394, 39.331 ], "bp2_params": [ 0.172, -0.253, 0.839, -1.782, -0.250, -0.371 ], "groove_widths": [ 12.085, null, 16.814, null ], "simple_Rise": 3.435, "simple_Twist": 37.319, "simple_hRise": 3.447, "simple_hTwist": 37.325 }, { "index": 4, "nt1": "///I/77", "nt2": "///J/104", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.172, -0.253, 0.839, -1.782, -0.250, -0.371 ], "step_params": [ 0.147, 0.299, 3.456, 0.238, 0.861, 35.952 ], "heli_params": [ 0.355, -0.202, 3.463, 1.395, -0.386, 35.963 ], "bp2_params": [ 0.067, -0.163, 0.543, -0.384, 2.606, 1.207 ], "groove_widths": [ 13.740, 13.454, 16.610, 16.546 ], "simple_Rise": 3.456, "simple_Twist": 36.500, "simple_hRise": 3.462, "simple_hTwist": 36.511 }, { "index": 5, "nt1": "///I/78", "nt2": "///J/103", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.067, -0.163, 0.543, -0.384, 2.606, 1.207 ], "step_params": [ -0.315, -0.847, 4.073, -0.647, 1.066, 32.763 ], "heli_params": [ -1.727, 0.421, 4.050, 1.888, 1.147, 32.786 ], "bp2_params": [ -0.098, -0.318, 0.978, 1.915, 2.605, 1.090 ], "groove_widths": [ 14.901, 14.258, 18.332, 18.183 ], "simple_Rise": 4.073, "simple_Twist": 33.814, "simple_hRise": 4.051, "simple_hTwist": 33.836 }, { "index": 6, "nt1": "///I/79", "nt2": "///J/102", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.098, -0.318, 0.978, 1.915, 2.605, 1.090 ], "step_params": [ 0.363, -0.577, 3.424, -4.354, 7.915, 32.734 ], "heli_params": [ -2.286, -1.335, 3.131, 13.721, 7.547, 33.924 ], "bp2_params": [ -0.205, -0.254, 0.894, 0.538, 7.355, 2.592 ], "groove_widths": [ 15.903, 14.974, 18.459, 17.578 ], "simple_Rise": 3.424, "simple_Twist": 33.252, "simple_hRise": 3.137, "simple_hTwist": 34.423 }, { "index": 7, "nt1": "///I/80", "nt2": "///J/101", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.205, -0.254, 0.894, 0.538, 7.355, 2.592 ], "step_params": [ -0.033, -0.989, 3.345, -0.127, 3.938, 31.532 ], "heli_params": [ -2.531, 0.036, 3.201, 7.211, 0.232, 31.771 ], "bp2_params": [ -0.090, -0.383, 1.180, 5.222, 9.329, 1.441 ], "groove_widths": [ 16.893, 16.018, 16.666, 15.444 ], "simple_Rise": 3.345, "simple_Twist": 30.885, "simple_hRise": 3.197, "simple_hTwist": 31.130 }, { "index": 8, "nt1": "///I/81", "nt2": "///J/100", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.090, -0.383, 1.180, 5.222, 9.329, 1.441 ], "step_params": [ 0.186, -0.551, 3.210, 3.575, 4.598, 32.701 ], "heli_params": [ -1.715, 0.257, 3.108, 8.086, -6.287, 33.202 ], "bp2_params": [ -0.069, -0.381, 1.107, 13.013, 6.917, -0.615 ], "groove_widths": [ 16.265, 15.636, 16.240, 16.145 ], "simple_Rise": 3.210, "simple_Twist": 32.496, "simple_hRise": 3.107, "simple_hTwist": 33.000 }, { "index": 9, "nt1": "///I/82", "nt2": "///J/99", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.069, -0.381, 1.107, 13.013, 6.917, -0.615 ], "step_params": [ 0.903, 0.179, 3.512, 7.970, 1.078, 39.195 ], "heli_params": [ 0.125, -0.312, 3.623, 1.587, -11.731, 39.980 ], "bp2_params": [ 0.156, -0.409, 1.154, 11.319, -1.374, 0.941 ], "groove_widths": [ 14.382, 14.113, 16.656, 16.426 ], "simple_Rise": 3.512, "simple_Twist": 38.054, "simple_hRise": 3.624, "simple_hTwist": 38.864 }, { "index": 10, "nt1": "///I/83", "nt2": "///J/98", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.156, -0.409, 1.154, 11.319, -1.374, 0.941 ], "step_params": [ -0.326, 2.152, 4.209, 3.183, -2.430, 40.673 ], "heli_params": [ 3.419, 0.909, 4.044, -3.485, -4.566, 40.861 ], "bp2_params": [ 0.300, -0.349, 1.279, 7.491, -10.283, -5.150 ], "groove_widths": [ 13.370, 13.274, 16.715, 15.602 ], "simple_Rise": 4.209, "simple_Twist": 40.050, "simple_hRise": 4.040, "simple_hTwist": 40.241 }, { "index": 11, "nt1": "///I/84", "nt2": "///J/97", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.300, -0.349, 1.279, 7.491, -10.283, -5.150 ], "step_params": [ 0.242, 2.482, 4.372, 4.436, -9.940, 40.221 ], "heli_params": [ 4.814, 0.248, 3.689, -14.143, -6.312, 41.608 ], "bp2_params": [ -0.221, -0.142, -0.274, -5.073, -6.297, 0.754 ], "groove_widths": [ 12.709, 12.585, 16.745, 15.262 ], "simple_Rise": 4.372, "simple_Twist": 42.870, "simple_hRise": 3.741, "simple_hTwist": 44.167 }, { "index": 12, "nt1": "///I/85", "nt2": "///J/96", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.221, -0.142, -0.274, -5.073, -6.297, 0.754 ], "step_params": [ -0.100, 0.046, 3.622, -2.888, -0.363, 38.223 ], "heli_params": [ 0.120, -0.248, 3.620, -0.554, 4.402, 38.329 ], "bp2_params": [ 0.181, -0.223, -0.656, -6.656, -1.276, 0.149 ], "groove_widths": [ 12.611, 12.568, 17.781, 17.174 ], "simple_Rise": 3.622, "simple_Twist": 36.032, "simple_hRise": 3.619, "simple_hTwist": 36.145 }, { "index": 13, "nt1": "///I/86", "nt2": "///J/95", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.181, -0.223, -0.656, -6.656, -1.276, 0.149 ], "step_params": [ 0.579, 0.232, 3.681, -2.881, 1.943, 35.173 ], "heli_params": [ 0.061, -1.430, 3.631, 3.206, 4.754, 35.339 ], "bp2_params": [ -0.101, -0.154, 0.467, -6.991, 2.587, 0.705 ], "groove_widths": [ 13.376, 13.242, 15.988, 15.949 ], "simple_Rise": 3.681, "simple_Twist": 36.893, "simple_hRise": 3.635, "simple_hTwist": 37.050 }, { "index": 14, "nt1": "///I/87", "nt2": "///J/94", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.101, -0.154, 0.467, -6.991, 2.587, 0.705 ], "step_params": [ 0.033, -0.198, 3.150, -2.845, 9.445, 35.751 ], "heli_params": [ -1.525, -0.418, 2.993, 15.035, 4.529, 37.043 ], "bp2_params": [ -0.200, -0.210, 0.571, -6.066, -0.540, 1.149 ], "groove_widths": [ 14.153, 13.747, 17.743, 17.618 ], "simple_Rise": 3.150, "simple_Twist": 36.181, "simple_hRise": 2.996, "simple_hTwist": 37.458 }, { "index": 15, "nt1": "///I/88", "nt2": "///J/93", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.200, -0.210, 0.571, -6.066, -0.540, 1.149 ], "step_params": [ -0.747, -0.592, 3.441, -1.440, 1.430, 33.581 ], "heli_params": [ -1.269, 1.043, 3.442, 2.472, 2.490, 33.641 ], "bp2_params": [ 0.098, -0.156, 0.500, -5.864, 3.702, -0.108 ], "groove_widths": [ 14.477, 13.874, 18.542, 18.066 ], "simple_Rise": 3.441, "simple_Twist": 31.913, "simple_hRise": 3.442, "simple_hTwist": 31.976 }, { "index": 16, "nt1": "///I/89", "nt2": "///J/92", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.098, -0.156, 0.500, -5.864, 3.702, -0.108 ], "step_params": [ -0.669, -0.272, 3.578, -2.712, 3.416, 31.925 ], "heli_params": [ -1.158, 0.675, 3.574, 6.175, 4.903, 32.214 ], "bp2_params": [ 0.114, -0.192, 0.699, -3.010, 6.521, -0.509 ], "groove_widths": [ 15.745, 15.173, 18.140, 17.487 ], "simple_Rise": 3.578, "simple_Twist": 31.845, "simple_hRise": 3.574, "simple_hTwist": 32.135 }, { "index": 17, "nt1": "///I/90", "nt2": "///J/91", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.114, -0.192, 0.699, -3.010, 6.521, -0.509 ], "step_params": [ 0.300, -1.240, 3.379, -2.065, 3.011, 29.343 ], "heli_params": [ -3.075, -1.030, 3.211, 5.915, 4.056, 29.564 ], "bp2_params": [ -0.102, -0.328, 1.112, 2.192, 8.435, 0.814 ], "groove_widths": [ 16.530, 15.903, 17.397, 16.685 ], "simple_Rise": 3.379, "simple_Twist": 30.573, "simple_hRise": 3.219, "simple_hTwist": 30.785 }, { "index": 18, "nt1": "///I/91", "nt2": "///J/90", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.102, -0.328, 1.112, 2.192, 8.435, 0.814 ], "step_params": [ 0.447, -0.565, 3.376, 1.973, 3.514, 32.307 ], "heli_params": [ -1.638, -0.444, 3.318, 6.285, -3.529, 32.551 ], "bp2_params": [ -0.098, -0.472, 1.314, 7.321, 8.872, 0.735 ], "groove_widths": [ 15.887, 15.182, 16.361, 16.203 ], "simple_Rise": 3.376, "simple_Twist": 32.213, "simple_hRise": 3.318, "simple_hTwist": 32.458 }, { "index": 19, "nt1": "///I/92", "nt2": "///J/89", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.098, -0.472, 1.314, 7.321, 8.872, 0.735 ], "step_params": [ 0.349, 0.531, 3.761, 4.831, 3.376, 39.692 ], "heli_params": [ 0.327, 0.131, 3.807, 4.940, -7.068, 40.110 ], "bp2_params": [ 0.200, -0.409, 1.104, 11.609, 3.403, 2.377 ], "groove_widths": [ 15.527, 15.124, 16.512, 16.477 ], "simple_Rise": 3.761, "simple_Twist": 37.993, "simple_hRise": 3.807, "simple_hTwist": 38.430 }, { "index": 20, "nt1": "///I/93", "nt2": "///J/88", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.200, -0.409, 1.104, 11.609, 3.403, 2.377 ], "step_params": [ 0.046, 1.983, 4.034, 13.102, 9.321, 39.964 ], "heli_params": [ 1.499, 1.637, 4.191, 13.017, -18.299, 42.955 ], "bp2_params": [ 0.055, -0.116, -0.238, -4.261, -12.778, 2.297 ], "groove_widths": [ 14.440, 14.364, 14.990, 14.624 ], "simple_Rise": 4.034, "simple_Twist": 40.635, "simple_hRise": 4.193, "simple_hTwist": 43.575 }, { "index": 21, "nt1": "///I/94", "nt2": "///J/87", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.055, -0.116, -0.238, -4.261, -12.778, 2.297 ], "step_params": [ -0.528, 2.823, 3.719, -1.758, -2.360, 40.405 ], "heli_params": [ 4.372, 0.544, 3.575, -3.411, 2.542, 40.507 ], "bp2_params": [ -0.263, -0.207, -0.924, -10.499, -10.096, 3.421 ], "groove_widths": [ 13.623, 13.611, 15.824, 15.164 ], "simple_Rise": 3.719, "simple_Twist": 42.151, "simple_hRise": 3.581, "simple_hTwist": 42.249 }, { "index": 22, "nt1": "///I/95", "nt2": "///J/86", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.263, -0.207, -0.924, -10.499, -10.096, 3.421 ], "step_params": [ -0.357, 0.446, 3.353, -4.364, 0.292, 37.954 ], "heli_params": [ 0.644, -0.021, 3.375, 0.448, 6.683, 38.196 ], "bp2_params": [ 0.182, -0.292, -0.890, -10.491, -4.999, 1.812 ], "groove_widths": [ 13.249, 13.236, 16.220, 15.358 ], "simple_Rise": 3.353, "simple_Twist": 35.593, "simple_hRise": 3.375, "simple_hTwist": 35.853 }, { "index": 23, "nt1": "///I/96", "nt2": "///J/85", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.182, -0.292, -0.890, -10.491, -4.999, 1.812 ], "step_params": [ 0.750, 1.240, 3.940, -2.677, 2.265, 35.750 ], "heli_params": [ 1.620, -1.678, 3.944, 3.679, 4.349, 35.916 ], "bp2_params": [ -0.082, -0.106, 0.160, -9.117, -0.119, -1.058 ], "groove_widths": [ 13.660, 13.629, 16.814, 16.623 ], "simple_Rise": 3.940, "simple_Twist": 37.394, "simple_hRise": 3.945, "simple_hTwist": 37.552 }, { "index": 24, "nt1": "///I/97", "nt2": "///J/84", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.082, -0.106, 0.160, -9.117, -0.119, -1.058 ], "step_params": [ -0.486, 0.191, 3.474, -4.536, 4.540, 31.178 ], "heli_params": [ -0.545, -0.007, 3.500, 8.336, 8.329, 31.815 ], "bp2_params": [ -0.180, -0.157, 0.290, -6.729, 3.491, -0.178 ], "groove_widths": [ 15.115, 14.963, 17.437, 17.433 ], "simple_Rise": 3.474, "simple_Twist": 31.723, "simple_hRise": 3.501, "simple_hTwist": 32.349 }, { "index": 25, "nt1": "///I/98", "nt2": "///J/83", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.180, -0.157, 0.290, -6.729, 3.491, -0.178 ], "step_params": [ 0.035, -0.150, 3.332, -2.198, 4.994, 35.114 ], "heli_params": [ -0.987, -0.383, 3.273, 8.216, 3.616, 35.522 ], "bp2_params": [ 0.122, -0.231, 0.787, -4.382, 5.940, -1.538 ], "groove_widths": [ 16.327, 15.923, 16.749, 16.551 ], "simple_Rise": 3.332, "simple_Twist": 33.339, "simple_hRise": 3.267, "simple_hTwist": 33.770 }, { "index": 26, "nt1": "///I/99", "nt2": "///J/82", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.122, -0.231, 0.787, -4.382, 5.940, -1.538 ], "step_params": [ 0.080, -0.365, 3.560, -2.361, 5.202, 31.836 ], "heli_params": [ -1.649, -0.594, 3.444, 9.390, 4.261, 32.331 ], "bp2_params": [ 0.165, -0.361, 1.217, -0.300, 7.537, -1.144 ], "groove_widths": [ 16.649, 15.920, 16.676, 15.908 ], "simple_Rise": 3.560, "simple_Twist": 31.551, "simple_hRise": 3.442, "simple_hTwist": 32.051 }, { "index": 27, "nt1": "///I/100", "nt2": "///J/81", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.165, -0.361, 1.217, -0.300, 7.537, -1.144 ], "step_params": [ 0.105, -0.596, 3.568, 0.172, 5.493, 33.100 ], "heli_params": [ -2.004, -0.152, 3.429, 9.559, -0.299, 33.540 ], "bp2_params": [ 0.224, -0.334, 1.058, 1.753, 6.620, 2.504 ], "groove_widths": [ 16.023, 15.143, 16.811, 16.008 ], "simple_Rise": 3.568, "simple_Twist": 32.839, "simple_hRise": 3.427, "simple_hTwist": 33.283 }, { "index": 28, "nt1": "///I/101", "nt2": "///J/80", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.224, -0.334, 1.058, 1.753, 6.620, 2.504 ], "step_params": [ 0.038, -0.133, 3.090, 0.088, 4.072, 38.719 ], "heli_params": [ -0.664, -0.048, 3.061, 6.122, -0.133, 38.925 ], "bp2_params": [ 0.158, -0.414, 1.341, 5.359, 4.962, -0.445 ], "groove_widths": [ 15.430, 14.679, 15.871, 15.349 ], "simple_Rise": 3.090, "simple_Twist": 38.903, "simple_hRise": 3.061, "simple_hTwist": 39.108 }, { "index": 29, "nt1": "///I/102", "nt2": "///J/79", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.158, -0.414, 1.341, 5.359, 4.962, -0.445 ], "step_params": [ -0.003, -0.833, 3.893, 2.130, 0.809, 30.671 ], "heli_params": [ -1.759, 0.500, 3.861, 1.527, -4.020, 30.754 ], "bp2_params": [ -0.145, -0.498, 1.430, 4.415, 3.509, -1.195 ], "groove_widths": [ 14.610, 14.232, 15.063, 15.040 ], "simple_Rise": 3.893, "simple_Twist": 32.651, "simple_hRise": 3.863, "simple_hTwist": 32.728 }, { "index": 30, "nt1": "///I/103", "nt2": "///J/78", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.145, -0.498, 1.430, 4.415, 3.509, -1.195 ], "step_params": [ 0.579, 0.239, 3.121, 2.910, 1.301, 41.197 ], "heli_params": [ 0.205, -0.520, 3.159, 1.846, -4.128, 41.315 ], "bp2_params": [ -0.140, -0.421, 1.384, 4.923, -0.124, -0.218 ], "groove_widths": [ 12.559, 12.497, 15.991, 15.836 ], "simple_Rise": 3.121, "simple_Twist": 41.094, "simple_hRise": 3.159, "simple_hTwist": 41.212 }, { "index": 31, "nt1": "///I/104", "nt2": "///J/77", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.140, -0.421, 1.384, 4.923, -0.124, -0.218 ], "step_params": [ -0.659, 1.012, 4.102, 3.206, -8.383, 43.892 ], "heli_params": [ 2.262, 1.222, 3.802, -11.078, -4.236, 44.756 ], "bp2_params": [ 0.132, -0.193, 0.622, -2.376, -13.421, -2.544 ], "groove_widths": [ 11.248, 11.218, 17.046, 16.226 ], "simple_Rise": 4.102, "simple_Twist": 42.262, "simple_hRise": 3.786, "simple_hTwist": 43.161 }, { "index": 32, "nt1": "///I/105", "nt2": "///J/76", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.132, -0.193, 0.622, -2.376, -13.421, -2.544 ], "step_params": [ -0.418, 1.280, 3.714, 1.322, -0.535, 40.464 ], "heli_params": [ 1.918, 0.771, 3.682, -0.774, -1.911, 40.488 ], "bp2_params": [ 0.157, -0.136, 0.068, -6.943, -10.765, 0.798 ], "groove_widths": [ 12.646, 12.617, 16.673, 15.317 ], "simple_Rise": 3.714, "simple_Twist": 40.226, "simple_hRise": 3.682, "simple_hTwist": 40.250 }, { "index": 33, "nt1": "///I/106", "nt2": "///J/75", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.157, -0.136, 0.068, -6.943, -10.765, 0.798 ], "step_params": [ -0.140, 2.632, 3.907, -1.350, 0.061, 35.828 ], "heli_params": [ 4.265, -0.004, 3.914, 0.098, 2.193, 35.852 ], "bp2_params": [ -0.045, -0.162, -0.562, -12.176, -3.839, 0.773 ], "groove_widths": [ 15.169, 15.040, 16.463, 16.076 ], "simple_Rise": 3.907, "simple_Twist": 37.167, "simple_hRise": 3.913, "simple_hTwist": 37.190 }, { "index": 34, "nt1": "///I/107", "nt2": "///J/74", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.045, -0.162, -0.562, -12.176, -3.839, 0.773 ], "step_params": [ -0.720, 0.308, 3.908, -3.966, 6.986, 27.654 ], "heli_params": [ -1.295, 0.362, 3.929, 14.239, 8.084, 28.775 ], "bp2_params": [ -0.083, -0.113, -0.346, -6.195, 8.125, -2.487 ], "groove_widths": [ 17.717, 17.316, 16.818, 16.817 ], "simple_Rise": 3.908, "simple_Twist": 28.039, "simple_hRise": 3.931, "simple_hTwist": 29.145 }, { "index": 35, "nt1": "///I/108", "nt2": "///J/73", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.083, -0.113, -0.346, -6.195, 8.125, -2.487 ], "step_params": [ 1.112, 0.756, 3.458, -3.198, 5.377, 28.161 ], "heli_params": [ 0.246, -2.989, 3.396, 10.881, 6.472, 28.834 ], "bp2_params": [ -0.074, -0.127, 0.296, 1.752, 11.852, -0.054 ], "groove_widths": [ 18.906, 17.855, 17.963, 17.506 ], "simple_Rise": 3.458, "simple_Twist": 27.961, "simple_hRise": 3.395, "simple_hTwist": 28.639 }, { "index": 36, "nt1": "///I/109", "nt2": "///J/72", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.074, -0.127, 0.296, 1.752, 11.852, -0.054 ], "step_params": [ 1.253, 0.117, 3.558, 1.621, 5.877, 26.763 ], "heli_params": [ -1.352, -2.201, 3.570, 12.492, -3.446, 27.436 ], "bp2_params": [ -0.007, -0.286, 0.887, 9.617, 11.872, -0.687 ], "groove_widths": [ 18.921, 17.097, 17.936, 15.985 ], "simple_Rise": 3.558, "simple_Twist": 26.171, "simple_hRise": 3.568, "simple_hTwist": 26.860 }, { "index": 37, "nt1": "///I/110", "nt2": "///J/71", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.007, -0.286, 0.887, 9.617, 11.872, -0.687 ], "step_params": [ 0.055, -1.031, 3.742, 11.331, 39.499, 29.553 ], "heli_params": [ -4.160, 0.780, 1.468, 53.604, -15.377, 50.240 ], "bp2_params": [ -0.183, -0.137, -0.203, -9.519, 4.881, -0.809 ], "groove_widths": [ 18.612, 16.767, 18.437, 16.971 ], "simple_Rise": 3.742, "simple_Twist": 30.828, "simple_hRise": 1.544, "simple_hTwist": 50.967 }, { "index": 38, "nt1": "///I/111", "nt2": "///J/70", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.183, -0.137, -0.203, -9.519, 4.881, -0.809 ], "step_params": [ 0.092, 0.213, 3.250, -2.921, 5.994, 31.941 ], "heli_params": [ -0.662, -0.670, 3.215, 10.746, 5.237, 32.612 ], "bp2_params": [ 0.113, -0.114, 0.213, -4.778, 8.982, -3.020 ], "groove_widths": [ 17.739, 16.206, 16.513, 15.317 ], "simple_Rise": 3.250, "simple_Twist": 30.182, "simple_hRise": 3.209, "simple_hTwist": 30.893 }, { "index": 39, "nt1": "///I/112", "nt2": "///J/69", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.113, -0.114, 0.213, -4.778, 8.982, -3.020 ], "step_params": [ 0.189, -0.327, 3.532, -3.346, 6.589, 27.776 ], "heli_params": [ -2.238, -1.183, 3.323, 13.426, 6.817, 28.724 ], "bp2_params": [ -0.069, -0.322, 1.041, 3.929, 10.829, -0.996 ], "groove_widths": [ 17.656, 16.488, 16.572, 16.412 ], "simple_Rise": 3.532, "simple_Twist": 28.806, "simple_hRise": 3.334, "simple_hTwist": 29.719 }, { "index": 40, "nt1": "///I/113", "nt2": "///J/68", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.069, -0.322, 1.041, 3.929, 10.829, -0.996 ], "step_params": [ 0.635, 0.992, 3.221, 2.245, 5.613, 40.118 ], "heli_params": [ 0.799, -0.663, 3.353, 8.126, -3.250, 40.552 ], "bp2_params": [ -0.124, -0.432, 1.483, 11.877, 4.028, -0.977 ], "groove_widths": [ 17.779, 17.155, 16.007, 15.971 ], "simple_Rise": 3.221, "simple_Twist": 40.256, "simple_hRise": 3.353, "simple_hTwist": 40.688 }, { "index": 41, "nt1": "///I/114", "nt2": "///J/67", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.124, -0.432, 1.483, 11.877, 4.028, -0.977 ], "step_params": [ 0.898, 1.261, 4.865, 14.881, 8.097, 33.722 ], "heli_params": [ 0.276, 1.695, 4.984, 12.990, -23.874, 37.628 ], "bp2_params": [ -0.177, -0.208, 0.689, -4.001, -4.522, 0.008 ], "groove_widths": [ 16.390, 16.174, 15.969, 15.932 ], "simple_Rise": 4.865, "simple_Twist": 34.113, "simple_hRise": 4.988, "simple_hTwist": 37.976 }, { "index": 42, "nt1": "///I/115", "nt2": "///J/66", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.177, -0.208, 0.689, -4.001, -4.522, 0.008 ], "step_params": [ -0.645, 2.782, 3.878, -1.200, 0.420, 40.245 ], "heli_params": [ 3.985, 0.775, 3.923, 0.610, 1.743, 40.264 ], "bp2_params": [ 0.049, -0.141, -0.216, -7.138, -4.308, 1.975 ], "groove_widths": [ 14.651, 14.600, 16.737, 16.512 ], "simple_Rise": 3.878, "simple_Twist": 38.874, "simple_hRise": 3.924, "simple_hTwist": 38.894 }, { "index": 43, "nt1": "///I/116", "nt2": "///J/65", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.049, -0.141, -0.216, -7.138, -4.308, 1.975 ], "step_params": [ -0.503, 0.112, 3.214, -2.731, 3.409, 33.130 ], "heli_params": [ -0.363, 0.427, 3.239, 5.946, 4.764, 33.408 ], "bp2_params": [ -0.182, -0.111, -0.315, -5.415, -1.505, 0.259 ], "groove_widths": [ 13.442, 13.338, 16.053, 15.803 ], "simple_Rise": 3.214, "simple_Twist": 34.560, "simple_hRise": 3.239, "simple_hTwist": 34.827 }, { "index": 44, "nt1": "///I/117", "nt2": "///J/64", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.182, -0.111, -0.315, -5.415, -1.505, 0.259 ], "step_params": [ 0.401, 0.078, 3.280, -1.966, 1.761, 38.895 ], "heli_params": [ -0.096, -0.838, 3.257, 2.641, 2.948, 38.981 ], "bp2_params": [ 0.186, -0.132, 0.242, -0.779, 0.219, 0.455 ], "groove_widths": [ 13.657, 13.400, 15.282, 15.281 ], "simple_Rise": 3.280, "simple_Twist": 36.886, "simple_hRise": 3.255, "simple_hTwist": 36.977 }, { "index": 45, "nt1": "///I/118", "nt2": "///J/63", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.186, -0.132, 0.242, -0.779, 0.219, 0.455 ], "step_params": [ 0.093, -0.119, 3.440, -3.725, 6.920, 35.367 ], "heli_params": [ -1.210, -0.698, 3.332, 11.219, 6.039, 36.203 ], "bp2_params": [ 0.152, -0.315, 1.077, -2.814, 7.516, -0.995 ], "groove_widths": [ 15.023, 14.464, 17.151, 16.758 ], "simple_Rise": 3.440, "simple_Twist": 35.531, "simple_hRise": 3.333, "simple_hTwist": 36.362 }, { "index": 46, "nt1": "///I/119", "nt2": "///J/62", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.152, -0.315, 1.077, -2.814, 7.516, -0.995 ], "step_params": [ -0.014, -0.633, 3.462, -1.900, 4.916, 29.657 ], "heli_params": [ -2.266, -0.378, 3.310, 9.510, 3.675, 30.112 ], "bp2_params": [ -0.227, -0.287, 0.950, -0.041, 8.298, 2.931 ], "groove_widths": [ 16.467, 15.612, 17.743, 16.757 ], "simple_Rise": 3.462, "simple_Twist": 31.780, "simple_hRise": 3.324, "simple_hTwist": 32.203 }, { "index": 47, "nt1": "///I/120", "nt2": "///J/61", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.227, -0.287, 0.950, -0.041, 8.298, 2.931 ], "step_params": [ -0.115, -1.098, 3.566, -0.073, 5.200, 31.037 ], "heli_params": [ -3.059, 0.198, 3.342, 9.632, 0.136, 31.459 ], "bp2_params": [ -0.106, -0.454, 1.425, 0.310, 10.661, -0.623 ], "groove_widths": [ 17.972, 17.033, 16.517, 14.970 ], "simple_Rise": 3.566, "simple_Twist": 30.443, "simple_hRise": 3.337, "simple_hTwist": 30.874 }, { "index": 48, "nt1": "///I/121", "nt2": "///J/60", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.106, -0.454, 1.425, 0.310, 10.661, -0.623 ], "step_params": [ -0.028, -0.319, 3.837, -0.059, 6.037, 28.996 ], "heli_params": [ -2.109, 0.041, 3.696, 11.894, 0.117, 29.605 ], "bp2_params": [ -0.108, -0.596, 1.609, 7.734, 10.865, -1.040 ], "groove_widths": [ 18.318, 17.435, 16.018, 14.909 ], "simple_Rise": 3.837, "simple_Twist": 28.800, "simple_hRise": 3.695, "simple_hTwist": 29.412 }, { "index": 49, "nt1": "///I/122", "nt2": "///J/59", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.108, -0.596, 1.609, 7.734, 10.865, -1.040 ], "step_params": [ 0.993, -0.254, 3.452, 6.708, 4.690, 38.317 ], "heli_params": [ -0.985, -0.615, 3.516, 7.047, -10.080, 39.150 ], "bp2_params": [ -0.183, -0.584, 1.603, 8.146, 6.221, -4.547 ], "groove_widths": [ 16.516, 15.803, 15.765, 15.440 ], "simple_Rise": 3.452, "simple_Twist": 38.804, "simple_hRise": 3.516, "simple_hTwist": 39.625 }, { "index": 50, "nt1": "///I/123", "nt2": "///J/58", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.183, -0.584, 1.603, 8.146, 6.221, -4.547 ], "step_params": [ 0.316, -0.594, 3.261, 5.238, 3.038, 37.202 ], "heli_params": [ -1.312, 0.187, 3.217, 4.723, -8.144, 37.675 ], "bp2_params": [ 0.183, -0.368, 1.123, 5.106, 1.832, 0.222 ], "groove_widths": [ 14.997, 14.572, 15.585, 15.584 ], "simple_Rise": 3.261, "simple_Twist": 35.198, "simple_hRise": 3.212, "simple_hTwist": 35.699 }, { "index": 51, "nt1": "///I/124", "nt2": "///J/57", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.183, -0.368, 1.123, 5.106, 1.832, 0.222 ], "step_params": [ -0.273, 0.825, 3.777, 3.841, 2.837, 39.549 ], "heli_params": [ 0.830, 0.916, 3.783, 4.174, -5.652, 39.825 ], "bp2_params": [ 0.147, -0.416, 1.236, 2.840, -1.250, -2.144 ], "groove_widths": [ 14.739, 14.550, 14.765, 14.744 ], "simple_Rise": 3.777, "simple_Twist": 39.796, "simple_hRise": 3.783, "simple_hTwist": 40.070 }, { "index": 52, "nt1": "///I/125", "nt2": "///J/56", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.147, -0.416, 1.236, 2.840, -1.250, -2.144 ], "step_params": [ 0.112, 1.829, 4.066, 9.894, 8.109, 40.621 ], "heli_params": [ 1.452, 1.152, 4.253, 11.346, -13.843, 42.506 ], "bp2_params": [ 0.069, -0.106, -0.522, -12.802, -7.325, 1.565 ], "groove_widths": [ 14.452, 14.370, 14.127, 13.906 ], "simple_Rise": 4.066, "simple_Twist": 40.728, "simple_hRise": 4.253, "simple_hTwist": 42.608 }, { "index": 53, "nt1": "///I/126", "nt2": "///J/55", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.069, -0.106, -0.522, -12.802, -7.325, 1.565 ], "step_params": [ -0.718, 1.146, 3.305, -3.553, 4.824, 34.669 ], "heli_params": [ 1.145, 0.634, 3.482, 8.021, 5.908, 35.167 ], "bp2_params": [ 0.103, -0.139, -0.756, -11.219, -2.014, 0.761 ], "groove_widths": [ 14.179, 14.098, 15.993, 15.805 ], "simple_Rise": 3.305, "simple_Twist": 34.648, "simple_hRise": 3.482, "simple_hTwist": 35.146 }, { "index": 54, "nt1": "///I/127", "nt2": "///J/54", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.103, -0.139, -0.756, -11.219, -2.014, 0.761 ], "step_params": [ -0.827, 1.665, 3.562, -4.438, 5.129, 39.487 ], "heli_params": [ 1.766, 0.632, 3.807, 7.524, 6.511, 40.042 ], "bp2_params": [ 0.202, -0.238, -1.067, -7.620, 1.567, -3.415 ], "groove_widths": [ 14.732, 14.529, 15.613, 15.577 ], "simple_Rise": 3.562, "simple_Twist": 39.004, "simple_hRise": 3.810, "simple_hTwist": 39.566 }, { "index": 55, "nt1": "///I/128", "nt2": "///J/53", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.202, -0.238, -1.067, -7.620, 1.567, -3.415 ], "step_params": [ 0.486, -0.097, 3.317, -4.397, 5.063, 28.326 ], "heli_params": [ -1.304, -1.931, 3.143, 10.167, 8.830, 29.093 ], "bp2_params": [ -0.048, -0.110, -0.063, 0.540, 2.027, 1.161 ], "groove_widths": [ 16.470, 15.828, 16.098, 15.996 ], "simple_Rise": 3.317, "simple_Twist": 29.860, "simple_hRise": 3.156, "simple_hTwist": 30.587 }, { "index": 56, "nt1": "///I/129", "nt2": "///J/52", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.048, -0.110, -0.063, 0.540, 2.027, 1.161 ], "step_params": [ -0.453, 0.634, 3.422, -2.311, 9.922, 36.120 ], "heli_params": [ -0.415, 0.378, 3.491, 15.623, 3.639, 37.483 ], "bp2_params": [ 0.170, -0.168, 0.733, 3.579, 7.300, -4.599 ], "groove_widths": [ 18.127, 16.789, 15.797, 14.514 ], "simple_Rise": 3.422, "simple_Twist": 34.664, "simple_hRise": 3.489, "simple_hTwist": 36.086 }, { "index": 57, "nt1": "///I/130", "nt2": "///J/51", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.170, -0.168, 0.733, 3.579, 7.300, -4.599 ], "step_params": [ 1.242, -0.644, 3.924, 1.932, 6.014, 26.706 ], "heli_params": [ -3.128, -2.050, 3.769, 12.793, -4.109, 27.430 ], "bp2_params": [ 0.198, -0.433, 1.275, 5.932, 2.097, 2.069 ], "groove_widths": [ 18.963, 17.279, 15.911, 13.825 ], "simple_Rise": 3.924, "simple_Twist": 26.701, "simple_hRise": 3.769, "simple_hTwist": 27.425 }, { "index": 58, "nt1": "///I/131", "nt2": "///J/50", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.198, -0.433, 1.275, 5.932, 2.097, 2.069 ], "step_params": [ 0.175, -0.803, 3.235, 1.311, 13.650, 35.564 ], "heli_params": [ -2.881, -0.110, 2.759, 21.392, -2.055, 38.036 ], "bp2_params": [ 0.255, -0.491, 1.702, 6.728, 11.252, -2.480 ], "groove_widths": [ 18.750, 17.340, 16.744, 15.177 ], "simple_Rise": 3.235, "simple_Twist": 35.091, "simple_hRise": 2.750, "simple_hTwist": 37.597 }, { "index": 59, "nt1": "///I/132", "nt2": "///J/49", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.255, -0.491, 1.702, 6.728, 11.252, -2.480 ], "step_params": [ 0.748, -1.181, 3.365, 3.520, 7.973, 30.329 ], "heli_params": [ -3.653, -0.723, 3.030, 14.858, -6.559, 31.529 ], "bp2_params": [ 0.226, -0.398, 1.101, 13.051, 5.577, 3.625 ], "groove_widths": [ 17.435, 16.549, 17.351, 16.617 ], "simple_Rise": 3.365, "simple_Twist": 30.557, "simple_hRise": 3.033, "simple_hTwist": 31.748 }, { "index": 60, "nt1": "///I/133", "nt2": "///J/48", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.226, -0.398, 1.101, 13.051, 5.577, 3.625 ], "step_params": [ 0.488, -0.717, 3.587, 7.923, 2.844, 33.520 ], "heli_params": [ -1.694, 0.535, 3.536, 4.836, -13.475, 34.531 ], "bp2_params": [ -0.144, -0.440, 1.211, 9.205, -0.700, -3.159 ], "groove_widths": [ 16.151, 15.771, 16.721, 16.520 ], "simple_Rise": 3.587, "simple_Twist": 35.773, "simple_hRise": 3.546, "simple_hTwist": 36.719 }, { "index": 61, "nt1": "///I/134", "nt2": "///J/47", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.144, -0.440, 1.211, 9.205, -0.700, -3.159 ], "step_params": [ -0.267, 0.030, 3.769, 5.591, -1.211, 37.337 ], "heli_params": [ 0.226, 1.241, 3.690, -1.878, -8.670, 37.757 ], "bp2_params": [ -0.264, -0.427, 1.384, 5.705, -6.253, -8.709 ], "groove_widths": [ 13.662, 13.560, 15.917, 15.903 ], "simple_Rise": 3.769, "simple_Twist": 38.022, "simple_hRise": 3.692, "simple_hTwist": 38.435 }, { "index": 62, "nt1": "///I/135", "nt2": "///J/46", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.264, -0.427, 1.384, 5.705, -6.253, -8.709 ], "step_params": [ 0.084, -0.492, 3.254, 1.369, -1.357, 34.219 ], "heli_params": [ -0.623, 0.072, 3.272, -2.304, -2.324, 34.272 ], "bp2_params": [ -0.281, -0.373, 1.141, 1.632, -11.607, -8.212 ], "groove_widths": [ 12.199, 12.145, 14.719, 14.263 ], "simple_Rise": 3.254, "simple_Twist": 34.290, "simple_hRise": 3.272, "simple_hTwist": 34.342 }, { "index": 63, "nt1": "///I/136", "nt2": "///J/45", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.281, -0.373, 1.141, 1.632, -11.607, -8.212 ], "step_params": [ 0.270, 1.304, 4.256, 3.387, 0.329, 43.898 ], "heli_params": [ 1.699, 0.056, 4.274, 0.440, -4.523, 44.023 ], "bp2_params": [ -0.155, -0.264, 0.922, -4.051, -8.337, -1.508 ], "groove_widths": [ 13.203, 13.187, 16.433, 15.976 ], "simple_Rise": 4.256, "simple_Twist": 43.101, "simple_hRise": 4.274, "simple_hTwist": 43.228 }, { "index": 64, "nt1": "///I/137", "nt2": "///J/44", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.155, -0.264, 0.922, -4.051, -8.337, -1.508 ], "step_params": [ 0.216, 2.226, 3.453, -2.703, -4.860, 39.185 ], "heli_params": [ 3.867, -0.641, 3.144, -7.202, 4.005, 39.563 ], "bp2_params": [ -0.218, -0.189, 0.581, -1.678, 6.389, 2.561 ], "groove_widths": [ 14.571, 14.511, 15.477, 15.409 ], "simple_Rise": 3.453, "simple_Twist": 39.566, "simple_hRise": 3.148, "simple_hTwist": 39.939 }, { "index": 65, "nt1": "///I/138", "nt2": "///J/43", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.218, -0.189, 0.581, -1.678, 6.389, 2.561 ], "step_params": [ -0.779, 0.911, 3.427, -0.029, 5.501, 34.930 ], "heli_params": [ 0.633, 1.278, 3.526, 9.095, 0.048, 35.347 ], "bp2_params": [ -0.220, -0.143, -0.151, 10.091, 9.541, -0.657 ], "groove_widths": [ 16.575, 16.203, 16.618, 16.614 ], "simple_Rise": 3.427, "simple_Twist": 34.690, "simple_hRise": 3.526, "simple_hTwist": 35.110 }, { "index": 66, "nt1": "///I/139", "nt2": "///J/42", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.220, -0.143, -0.151, 10.091, 9.541, -0.657 ], "step_params": [ -1.031, -0.324, 3.146, 4.984, 4.417, 28.060 ], "heli_params": [ -1.566, 3.104, 2.841, 8.950, -10.099, 28.824 ], "bp2_params": [ -0.995, 0.620, -0.548, 25.222, 3.981, -22.764 ], "groove_widths": [ 17.399, 16.700, 16.260, 16.136 ], "simple_Rise": 3.146, "simple_Twist": 31.690, "simple_hRise": 2.884, "simple_hTwist": 32.364 }, { "index": 67, "nt1": "///I/140", "nt2": "///J/41", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.995, 0.620, -0.548, 25.222, 3.981, -22.764 ], "step_params": [ 1.110, -1.258, 3.889, -13.990, 15.589, 35.338 ], "heli_params": [ -3.617, -3.220, 2.546, 23.327, 20.934, 40.908 ], "bp2_params": [ 0.243, -0.373, 1.402, 4.190, 5.070, -1.644 ], "groove_widths": [ 17.432, 16.734, 17.882, 16.427 ], "simple_Rise": 3.889, "simple_Twist": 29.299, "simple_hRise": 2.235, "simple_hTwist": 35.882 }, { "index": 68, "nt1": "///I/141", "nt2": "///J/40", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.243, -0.373, 1.402, 4.190, 5.070, -1.644 ], "step_params": [ 0.586, -1.579, 3.437, 2.236, 2.913, 27.908 ], "heli_params": [ -3.951, -0.663, 3.294, 6.007, -4.612, 28.144 ], "bp2_params": [ -0.155, -0.371, 1.330, 4.906, 1.475, 1.330 ], "groove_widths": [ 17.493, 16.888, 19.073, 17.264 ], "simple_Rise": 3.437, "simple_Twist": 30.197, "simple_hRise": 3.307, "simple_hTwist": 30.415 }, { "index": 69, "nt1": "///I/142", "nt2": "///J/39", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.155, -0.371, 1.330, 4.906, 1.475, 1.330 ], "step_params": [ -0.267, -1.368, 3.195, 3.355, 11.018, 32.405 ], "heli_params": [ -3.883, 0.929, 2.568, 19.010, -5.788, 34.339 ], "bp2_params": [ 0.175, -0.278, 1.131, 5.507, 1.718, -2.000 ], "groove_widths": [ 16.518, 15.829, 19.513, 17.912 ], "simple_Rise": 3.195, "simple_Twist": 30.441, "simple_hRise": 2.518, "simple_hTwist": 32.499 }, { "index": 70, "nt1": "///I/143", "nt2": "///J/38", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.175, -0.278, 1.131, 5.507, 1.718, -2.000 ], "step_params": [ -0.454, -1.166, 3.270, 1.929, 0.862, 31.858 ], "heli_params": [ -2.275, 1.173, 3.206, 1.569, -3.510, 31.926 ], "bp2_params": [ 0.117, -0.180, 0.799, 6.294, -1.701, -1.504 ], "groove_widths": [ 15.494, 14.962, 17.878, 16.842 ], "simple_Rise": 3.270, "simple_Twist": 32.224, "simple_hRise": 3.207, "simple_hTwist": 32.291 }, { "index": 71, "nt1": "///I/144", "nt2": "///J/37", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.117, -0.180, 0.799, 6.294, -1.701, -1.504 ], "step_params": [ -0.183, -1.155, 3.251, 3.012, -1.082, 30.763 ], "heli_params": [ -1.957, 0.925, 3.256, -2.032, -5.658, 30.925 ], "bp2_params": [ -0.085, -0.138, 0.384, 5.518, -3.957, -2.335 ], "groove_widths": [ 14.416, 14.242, 16.351, 16.122 ], "simple_Rise": 3.251, "simple_Twist": 32.116, "simple_hRise": 3.257, "simple_hTwist": 32.271 }, { "index": 72, "nt1": "///I/145", "nt2": "///J/36", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.085, -0.138, 0.384, 5.518, -3.957, -2.335 ], "step_params": [ 0.296, -0.051, 3.447, 3.245, -0.694, 37.508 ], "heli_params": [ 0.016, -0.013, 3.460, -1.077, -5.035, 37.649 ], "bp2_params": [ 0.133, -0.287, 0.850, 3.740, -8.268, -3.328 ], "groove_widths": [ 13.276, 13.229, 16.492, 16.475 ], "simple_Rise": 3.447, "simple_Twist": 36.181, "simple_hRise": 3.460, "simple_hTwist": 36.328 }, { "index": 73, "nt1": "///I/146", "nt2": "///J/35", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.133, -0.287, 0.850, 3.740, -8.268, -3.328 ], "step_params": [ 0.534, 1.039, 4.014, 2.843, -4.881, 37.651 ], "heli_params": [ 2.346, -0.381, 3.883, -7.511, -4.374, 38.057 ], "bp2_params": [ -0.147, -0.274, 0.915, -0.373, -4.317, -0.745 ], "groove_widths": [ 12.984, 12.974, 16.791, 16.410 ], "simple_Rise": 4.014, "simple_Twist": 39.238, "simple_hRise": 3.890, "simple_hTwist": 39.627 }, { "index": 74, "nt1": "///I/147", "nt2": "///J/34", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.147, -0.274, 0.915, -0.373, -4.317, -0.745 ], "step_params": [ -0.213, 2.039, 3.876, -0.775, -0.280, 42.013 ], "heli_params": [ 2.878, 0.202, 3.866, -0.390, 1.081, 42.021 ], "bp2_params": [ -0.191, -0.187, 0.464, -2.704, -3.493, -0.508 ], "groove_widths": [ 13.414, 13.409, 15.833, 15.287 ], "simple_Rise": 3.876, "simple_Twist": 42.161, "simple_hRise": 3.866, "simple_hTwist": 42.169 }, { "index": 75, "nt1": "///I/148", "nt2": "///J/33", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.191, -0.187, 0.464, -2.704, -3.493, -0.508 ], "step_params": [ 0.158, -0.015, 3.572, 0.299, 1.665, 35.994 ], "heli_params": [ -0.282, -0.209, 3.569, 2.693, -0.483, 36.033 ], "bp2_params": [ 0.209, -0.150, -0.286, -0.953, -1.996, 0.670 ], "groove_widths": [ 13.798, 13.723, 16.581, 16.523 ], "simple_Rise": 3.572, "simple_Twist": 33.793, "simple_hRise": 3.569, "simple_hTwist": 33.834 }, { "index": 76, "nt1": "///I/149", "nt2": "///J/32", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.209, -0.150, -0.286, -0.953, -1.996, 0.670 ], "step_params": [ -0.664, 1.031, 3.700, -5.217, 5.778, 39.669 ], "heli_params": [ 0.735, 0.277, 3.860, 8.416, 7.598, 40.395 ], "bp2_params": [ 0.075, -0.113, 0.127, -6.572, 3.051, -1.487 ], "groove_widths": [ 14.240, 13.837, 15.327, 15.306 ], "simple_Rise": 3.700, "simple_Twist": 40.344, "simple_hRise": 3.859, "simple_hTwist": 41.057 }, { "index": 77, "nt1": "///I/150", "nt2": "///J/31", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.075, -0.113, 0.127, -6.572, 3.051, -1.487 ], "step_params": [ 0.173, -0.688, 3.424, -2.468, 4.384, 31.206 ], "heli_params": [ -2.100, -0.790, 3.276, 8.084, 4.552, 31.599 ], "bp2_params": [ -0.196, -0.185, 0.613, -2.161, 6.339, 2.324 ], "groove_widths": [ 15.087, 14.391, 16.381, 16.018 ], "simple_Rise": 3.424, "simple_Twist": 32.784, "simple_hRise": 3.286, "simple_hTwist": 33.157 }, { "index": 78, "nt1": "///I/151", "nt2": "///J/30", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.196, -0.185, 0.613, -2.161, 6.339, 2.324 ], "step_params": [ 0.236, -1.012, 3.260, -0.885, 3.516, 33.153 ], "heli_params": [ -2.336, -0.556, 3.132, 6.138, 1.545, 33.346 ], "bp2_params": [ -0.195, -0.234, 0.783, -1.094, 6.407, 3.001 ], "groove_widths": [ 15.410, 14.740, 17.323, 16.009 ], "simple_Rise": 3.260, "simple_Twist": 33.205, "simple_hRise": 3.132, "simple_hTwist": 33.396 }, { "index": 79, "nt1": "///I/152", "nt2": "///J/29", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.195, -0.234, 0.783, -1.094, 6.407, 3.001 ], "step_params": [ 0.301, -0.953, 3.408, -0.193, 3.260, 30.843 ], "heli_params": [ -2.426, -0.601, 3.291, 6.108, 0.361, 31.012 ], "bp2_params": [ -0.087, -0.366, 1.202, 2.041, 6.882, 0.843 ], "groove_widths": [ 15.337, 14.826, 18.226, 16.950 ], "simple_Rise": 3.408, "simple_Twist": 30.260, "simple_hRise": 3.288, "simple_hTwist": 30.431 }, { "index": 80, "nt1": "///I/153", "nt2": "///J/28", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.087, -0.366, 1.202, 2.041, 6.882, 0.843 ], "step_params": [ 0.450, -0.967, 3.114, 2.015, 3.763, 33.209 ], "heli_params": [ -2.263, -0.470, 3.011, 6.551, -3.507, 33.474 ], "bp2_params": [ -0.182, -0.337, 1.131, 3.415, 4.847, 1.721 ], "groove_widths": [ 14.949, 14.546, 19.549, 18.980 ], "simple_Rise": 3.114, "simple_Twist": 33.646, "simple_hRise": 3.013, "simple_hTwist": 33.908 }, { "index": 81, "nt1": "///I/154", "nt2": "///J/27", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.182, -0.337, 1.131, 3.415, 4.847, 1.721 ], "step_params": [ -0.104, -0.662, 3.703, 0.336, 4.095, 31.309 ], "heli_params": [ -2.067, 0.260, 3.588, 7.546, -0.618, 31.571 ], "bp2_params": [ -0.155, -0.361, 1.281, 6.319, 1.019, 0.714 ], "groove_widths": [ 13.379, 13.023, 18.438, 18.163 ], "simple_Rise": 3.703, "simple_Twist": 31.190, "simple_hRise": 3.587, "simple_hTwist": 31.453 }, { "index": 82, "nt1": "///I/155", "nt2": "///J/26", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.155, -0.361, 1.281, 6.319, 1.019, 0.714 ], "step_params": [ -0.769, -0.806, 3.364, 2.588, -0.883, 41.635 ], "heli_params": [ -1.037, 1.358, 3.328, -1.241, -3.637, 41.721 ], "bp2_params": [ 0.177, -0.307, 1.024, 2.971, -2.969, 0.070 ], "groove_widths": [ 12.796, 12.492, 18.198, 17.999 ], "simple_Rise": 3.364, "simple_Twist": 39.776, "simple_hRise": 3.326, "simple_hTwist": 39.866 }, { "index": 83, "nt1": "///I/156", "nt2": "///J/25", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.177, -0.307, 1.024, 2.971, -2.969, 0.070 ], "step_params": [ -0.239, -0.585, 3.675, 0.790, -1.488, 30.528 ], "heli_params": [ -0.777, 0.629, 3.691, -2.823, -1.499, 30.573 ], "bp2_params": [ -0.129, -0.170, 0.619, -0.658, -6.409, -3.031 ], "groove_widths": [ 12.738, 12.492, 18.815, 18.776 ], "simple_Rise": 3.675, "simple_Twist": 32.298, "simple_hRise": 3.691, "simple_hTwist": 32.341 }, { "index": 84, "nt1": "///I/157", "nt2": "///J/24", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.129, -0.170, 0.619, -0.658, -6.409, -3.031 ], "step_params": [ -0.947, -0.164, 3.382, -0.856, -0.128, 40.532 ], "heli_params": [ -0.223, 1.268, 3.401, -0.184, 1.236, 40.541 ], "bp2_params": [ 0.089, -0.106, -0.221, -5.329, -4.261, -0.918 ], "groove_widths": [ 12.490, 12.325, 18.028, 17.936 ], "simple_Rise": 3.382, "simple_Twist": 39.116, "simple_hRise": 3.402, "simple_hTwist": 39.125 }, { "index": 85, "nt1": "///I/158", "nt2": "///J/23", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.089, -0.106, -0.221, -5.329, -4.261, -0.918 ], "step_params": [ -0.571, -0.695, 3.464, -1.203, 1.047, 30.801 ], "heli_params": [ -1.522, 0.826, 3.458, 1.970, 2.264, 30.841 ], "bp2_params": [ -0.129, -0.111, -0.194, -5.110, -1.204, -3.233 ], "groove_widths": [ 13.840, null, 17.515, null ], "simple_Rise": 3.464, "simple_Twist": 32.228, "simple_hRise": 3.459, "simple_hTwist": 32.267 }, { "index": 86, "nt1": "///I/159", "nt2": "///J/22", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.129, -0.111, -0.194, -5.110, -1.204, -3.233 ], "step_params": [ -0.168, 0.466, 3.709, -1.183, 3.800, 35.170 ], "heli_params": [ 0.127, 0.078, 3.741, 6.264, 1.951, 35.388 ], "bp2_params": [ -0.110, -0.182, 0.617, -0.649, 2.461, -2.803 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.709, "simple_Twist": 35.116, "simple_hRise": 3.741, "simple_hTwist": 35.334 }, { "index": 87, "nt1": "///I/160", "nt2": "///J/21", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.110, -0.182, 0.617, -0.649, 2.461, -2.803 ], "step_params": [ 1.834, 0.289, 3.226, 0.688, 2.724, 34.302 ], "heli_params": [ 0.066, -2.993, 3.274, 4.608, -1.164, 34.413 ], "bp2_params": [ -0.168, -0.194, 0.732, 3.186, 3.443, 0.020 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.226, "simple_Twist": 34.453, "simple_hRise": 3.274, "simple_hTwist": 34.564 }, { "index": 88, "nt1": "///I/161", "nt2": "///J/20", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 5, "helix_index": 2, "strand1": "TGGCGGTAACGGA", "strand2": "ACCGCCATTGCCT", "bp_type": "|||||||||||||", "helix_form": "BBBBBBBBBBBB", "helical_rise": 3.425, "helical_rise_std": 0.303, "helical_radius": 9.369, "helical_radius_std": 0.768, "helical_axis": [ -0.120, -0.564, -0.817 ], "point1": [ 115.936, 88.776, 151.154 ], "point2": [ 111.016, 65.603, 117.621 ], "num_pairs": 13, "pairs": [ { "index": 1, "nt1": "///I/163", "nt2": "///J/18", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.100, -0.324, 1.124, 4.619, 6.402, 0.607 ], "step_params": [ 0.498, 0.363, 3.631, 6.812, 5.494, 41.466 ], "heli_params": [ -0.132, 0.097, 3.681, 7.657, -9.494, 42.340 ], "bp2_params": [ -0.187, -0.297, 0.966, -2.882, -0.324, 1.543 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.631, "simple_Twist": 41.874, "simple_hRise": 3.682, "simple_hTwist": 42.739 }, { "index": 2, "nt1": "///I/164", "nt2": "///J/17", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.187, -0.297, 0.966, -2.882, -0.324, 1.543 ], "step_params": [ -1.370, 0.350, 3.342, -2.106, 2.108, 36.074 ], "heli_params": [ 0.256, 1.899, 3.428, 3.396, 3.393, 36.193 ], "bp2_params": [ -0.178, -0.183, 0.618, -1.111, 1.244, -0.434 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.342, "simple_Twist": 36.037, "simple_hRise": 3.428, "simple_hTwist": 36.156 }, { "index": 3, "nt1": "///I/165", "nt2": "///J/16", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.178, -0.183, 0.618, -1.111, 1.244, -0.434 ], "step_params": [ 1.592, 0.145, 3.374, 0.635, 1.432, 37.841 ], "heli_params": [ 0.033, -2.369, 3.403, 2.207, -0.979, 37.872 ], "bp2_params": [ 0.189, -0.279, 0.909, 2.272, 1.641, 2.683 ], "groove_widths": [ 13.923, null, 14.513, null ], "simple_Rise": 3.374, "simple_Twist": 35.818, "simple_hRise": 3.404, "simple_hTwist": 35.851 }, { "index": 4, "nt1": "///I/166", "nt2": "///J/15", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.189, -0.279, 0.909, 2.272, 1.641, 2.683 ], "step_params": [ -0.795, 0.170, 3.126, -2.004, 2.064, 37.234 ], "heli_params": [ 0.003, 0.987, 3.168, 3.227, 3.134, 37.341 ], "bp2_params": [ -0.181, -0.268, 0.914, 1.624, -0.230, -1.025 ], "groove_widths": [ 13.039, 12.867, 14.910, 14.485 ], "simple_Rise": 3.126, "simple_Twist": 39.266, "simple_hRise": 3.166, "simple_hTwist": 39.367 }, { "index": 5, "nt1": "///I/167", "nt2": "///J/14", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.181, -0.268, 0.914, 1.624, -0.230, -1.025 ], "step_params": [ -0.426, -0.540, 3.140, -1.041, 2.314, 37.141 ], "heli_params": [ -1.140, 0.535, 3.112, 3.628, 1.632, 37.225 ], "bp2_params": [ -0.165, -0.260, 0.876, 1.233, -2.232, -2.287 ], "groove_widths": [ 13.165, 13.041, 15.752, 15.655 ], "simple_Rise": 3.140, "simple_Twist": 37.069, "simple_hRise": 3.112, "simple_hTwist": 37.153 }, { "index": 6, "nt1": "///I/168", "nt2": "///J/13", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.165, -0.260, 0.876, 1.233, -2.232, -2.287 ], "step_params": [ 0.493, -0.669, 3.287, 2.172, 1.594, 33.359 ], "heli_params": [ -1.427, -0.496, 3.277, 2.772, -3.775, 33.465 ], "bp2_params": [ -0.153, -0.185, 0.792, -0.697, -3.602, -4.233 ], "groove_widths": [ 13.394, 13.340, 15.296, 15.239 ], "simple_Rise": 3.287, "simple_Twist": 33.333, "simple_hRise": 3.277, "simple_hTwist": 33.438 }, { "index": 7, "nt1": "///I/169", "nt2": "///J/12", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.153, -0.185, 0.792, -0.697, -3.602, -4.233 ], "step_params": [ -0.408, 0.759, 3.748, -0.315, -0.388, 37.879 ], "heli_params": [ 1.227, 0.582, 3.743, -0.598, 0.485, 37.882 ], "bp2_params": [ 0.112, -0.094, 0.394, -4.003, -1.916, -4.674 ], "groove_widths": [ 13.910, 13.876, 17.650, 17.275 ], "simple_Rise": 3.748, "simple_Twist": 36.276, "simple_hRise": 3.743, "simple_hTwist": 36.279 }, { "index": 8, "nt1": "///I/170", "nt2": "///J/11", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.112, -0.094, 0.394, -4.003, -1.916, -4.674 ], "step_params": [ -0.419, -0.322, 3.463, -2.496, 2.520, 31.014 ], "heli_params": [ -1.107, 0.276, 3.449, 4.693, 4.649, 31.211 ], "bp2_params": [ 0.104, -0.069, 0.086, -3.762, -0.531, -3.862 ], "groove_widths": [ 14.520, 14.473, 17.148, 16.984 ], "simple_Rise": 3.463, "simple_Twist": 31.101, "simple_hRise": 3.449, "simple_hTwist": 31.298 }, { "index": 9, "nt1": "///I/171", "nt2": "///J/10", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.104, -0.069, 0.086, -3.762, -0.531, -3.862 ], "step_params": [ 0.368, -0.817, 3.297, -1.298, 1.660, 31.154 ], "heli_params": [ -1.833, -0.929, 3.233, 3.087, 2.413, 31.224 ], "bp2_params": [ 0.226, -0.141, 0.312, -0.596, 2.039, 0.500 ], "groove_widths": [ 14.736, 14.612, 15.789, 15.727 ], "simple_Rise": 3.297, "simple_Twist": 30.545, "simple_hRise": 3.231, "simple_hTwist": 30.616 }, { "index": 10, "nt1": "///I/172", "nt2": "///J/9", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.226, -0.141, 0.312, -0.596, 2.039, 0.500 ], "step_params": [ 0.384, 0.696, 3.481, 0.228, 3.953, 37.796 ], "heli_params": [ 0.528, -0.558, 3.535, 6.081, -0.351, 37.996 ], "bp2_params": [ -0.128, -0.312, 1.034, 0.038, -3.242, -0.528 ], "groove_widths": [ 14.337, null, 15.586, null ], "simple_Rise": 3.481, "simple_Twist": 39.743, "simple_hRise": 3.533, "simple_hTwist": 39.931 }, { "index": 11, "nt1": "///I/173", "nt2": "///J/8", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.128, -0.312, 1.034, 0.038, -3.242, -0.528 ], "step_params": [ -0.056, 0.717, 3.837, -0.648, -0.686, 39.099 ], "heli_params": [ 1.167, -0.007, 3.825, -1.024, 0.968, 39.110 ], "bp2_params": [ -0.121, -0.370, 1.129, -2.882, -5.774, -1.347 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.837, "simple_Twist": 39.059, "simple_hRise": 3.825, "simple_hTwist": 39.070 }, { "index": 12, "nt1": "///I/174", "nt2": "///J/7", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.121, -0.370, 1.129, -2.882, -5.774, -1.347 ], "step_params": [ 0.841, 0.189, 3.559, -6.074, -8.954, 43.334 ], "heli_params": [ 1.127, -1.703, 3.318, -11.906, 8.076, 44.601 ], "bp2_params": [ 0.214, -0.786, 1.854, 1.379, 4.211, 4.013 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.559, "simple_Twist": 41.304, "simple_hRise": 3.300, "simple_hTwist": 42.637 }, { "index": 13, "nt1": "///I/175", "nt2": "///J/6", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W" } ] } ], "num_coaxStacks": 1, "coaxStacks": [ { "index": 1, "helix_index": 2, "num_stems": 4, "stem_indices": [ 2, 3, 4, 5 ] } ], "num_stacks": 8, "stacks": [ { "index": 1, "num_nts": 2, "nts_short": "AA", "nts_long": "///I/44,///I/45" }, { "index": 2, "num_nts": 2, "nts_short": "AT", "nts_long": "///J/112,///J/113" }, { "index": 3, "num_nts": 3, "nts_short": "CAT", "nts_long": "///I/67,///I/68,///I/69" }, { "index": 4, "num_nts": 3, "nts_short": "AAA", "nts_long": "///I/72,///I/73,///I/74" }, { "index": 5, "num_nts": 3, "nts_short": "GAT", "nts_long": "///I/161,///I/162,///I/163" }, { "index": 6, "num_nts": 3, "nts_short": "ATC", "nts_long": "///J/18,///J/19,///J/20" }, { "index": 7, "num_nts": 3, "nts_short": "TTT", "nts_long": "///J/107,///J/108,///J/109" }, { "index": 8, "num_nts": 4, "nts_short": "TTGG", "nts_long": "///J/136,///J/137,///J/138,///J/139" } ], "nonStack": { "num_nts": 1, "nts_short": "C", "nts_long": "///I/43" }, "num_iloops": 4, "iloops": [ { "index": 1, "type": "symmetric internal loop", "bridging_nts": [ 1, 1 ], "stem_indices": [ 3, 4 ], "summary": "[2] 1 1 [I.72 J.109 I.74 J.107] 3 88", "num_nts": 6, "nts_short": "AAATTT", "nts_long": "///I/72,///I/73,///I/74,///J/107,///J/108,///J/109", "num_stems": 2, "bridges": [ { "index": 1, "num_nts": 1, "nts_short": "A", "nts_long": "///I/73" }, { "index": 2, "num_nts": 1, "nts_short": "T", "nts_long": "///J/108" } ] }, { "index": 2, "type": "symmetric internal loop", "bridging_nts": [ 1, 1 ], "stem_indices": [ 4, 5 ], "summary": "[2] 1 1 [I.161 J.20 I.163 J.18] 88 13", "num_nts": 6, "nts_short": "GATATC", "nts_long": "///I/161,///I/162,///I/163,///J/18,///J/19,///J/20", "num_stems": 2, "bridges": [ { "index": 1, "num_nts": 1, "nts_short": "A", "nts_long": "///I/162" }, { "index": 2, "num_nts": 1, "nts_short": "T", "nts_long": "///J/19" } ] }, { "index": 3, "type": "symmetric internal loop", "bridging_nts": [ 2, 2 ], "stem_indices": [ 1, 2 ], "summary": "[2] 2 2 [I.42 J.139 I.45 J.136] 31 23", "num_nts": 8, "nts_short": "CCAATTGG", "nts_long": "///I/42,///I/43,///I/44,///I/45,///J/136,///J/137,///J/138,///J/139", "num_stems": 2, "bridges": [ { "index": 1, "num_nts": 2, "nts_short": "CA", "nts_long": "///I/43,///I/44" }, { "index": 2, "num_nts": 2, "nts_short": "TG", "nts_long": "///J/137,///J/138" } ] }, { "index": 4, "type": "symmetric internal loop", "bridging_nts": [ 2, 2 ], "stem_indices": [ 2, 3 ], "summary": "[2] 2 2 [I.67 J.114 I.70 J.111] 23 3", "num_nts": 8, "nts_short": "CATCGATG", "nts_long": "///I/67,///I/68,///I/69,///I/70,///J/111,///J/112,///J/113,///J/114", "num_stems": 2, "bridges": [ { "index": 1, "num_nts": 2, "nts_short": "AT", "nts_long": "///I/68,///I/69" }, { "index": 2, "num_nts": 2, "nts_short": "AT", "nts_long": "///J/112,///J/113" } ] } ], "dbn": { "all_chains": { "num_nts": 328, "num_chars": 329, "bseq": "ACCGCCATCAATATCCACCTGCAGATTCTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGAATTCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGAATCTGCAGGTGGATATTGATGGCGGTAACGGA&TCCGTTACCGCCATCAATATCCACCTGCAGATTCTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGAATTCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGAATCTGCAGGTGGATATTGATGGCGGT", "sstr": "(((((((((((((((((((((((((((((((..(((((((((((((((((((((((..(((.((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((.(((((((((((((&))))))))))))).)))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))).)))..)))))))))))))))))))))))..)))))))))))))))))))))))))))))))", "form": ".B.B...BBB.BBB.BBBBBB.BB.BB.BB..BBBBBB.B.BB.BBBBB..B...BB.BB...BBB.B.BB..BBBBB.BB..B.BBBBBBB.B.BBB.BBB..BBBB.BBBB.B.BB.B..BB.....AAB.BB.B.....BB.BBBB..BBBBB.BB.BBB-&BBBBBBBBBBBB...BBBB.BBBBBBB..B......B..BBB..BBB.B.BBBBBBBBB...BB.BBB.B.BBBBBBB.B..BB.BBBBB..BB.BBBBB...BB.....BBB.BBBBB.BB..BBBBBB......BBBBB.BBBBBBBBBB.BBB...B.B.-" }, "chain_I": { "num_nts": 164, "num_chars": 164, "bseq": "ACCGCCATCAATATCCACCTGCAGATTCTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGAATTCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGAATCTGCAGGTGGATATTGATGGCGGTAACGGA", "sstr": "(((((((((((((((((((((((((((((((..(((((((((((((((((((((((..(((.((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((.(((((((((((((", "form": ".B.B...BBB.BBB.BBBBBB.BB.BB.BB..BBBBBB.B.BB.BBBBB..B...BB.BB...BBB.B.BB..BBBBB.BB..B.BBBBBBB.B.BBB.BBB..BBBB.BBBB.B.BB.B..BB.....AAB.BB.B.....BB.BBBB..BBBBB.BB.BBB-" }, "chain_J": { "num_nts": 164, "num_chars": 164, "bseq": "TCCGTTACCGCCATCAATATCCACCTGCAGATTCTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGAATTCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGAATCTGCAGGTGGATATTGATGGCGGT", "sstr": "))))))))))))).)))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))).)))..)))))))))))))))))))))))..)))))))))))))))))))))))))))))))", "form": "BBBBBBBBBBBB...BBBB.BBBBBBB..B......B..BBB..BBB.B.BBBBBBBBB...BB.BBB.B.BBBBBBB.B..BB.BBBBB..BB.BBBBB...BB.....BBB.BBBBB.BB..BBBBBB......BBBBB.BBBBBBBBBB.BBB...B.B.-" } }, "chains": { "chain_I": { "num_nts": 164, "bseq": "ACCGCCATCAATATCCACCTGCAGATTCTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGAATTCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGAATCTGCAGGTGGATATTGATGGCGGTAACGGA", "sstr": "(((((((((((((((((((((((((((((((..(((((((((((((((((((((((..(((.((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((.(((((((((((((", "form": ".B.B...BBB.BBB.BBBBBB.BB.BB.BB..BBBBBB.B.BB.BBBBB..B...BB.BB...BBB.B.BB..BBBBB.BB..B.BBBBBBB.B.BBB.BBB..BBBB.BBBB.B.BB.B..BB.....AAB.BB.B.....BB.BBBB..BBBBB.BB.BBB-", "helical_rise": 0.192, "helical_rise_std": 2.435, "helical_axis": [ -0.986, 0.132, 0.105 ], "point1": [ 152.673, 136.284, 135.176 ], "point2": [ 121.933, 140.394, 138.458 ], "num_chars": 490, "suite": "A!!C!!C!!G!!C!!C!!A!!T!!C!!A!!A!!T!!A!!T!!C!!C!!A!!C!!C1bT!!G!!C4bA!!G!!A!!T!!T!!C!!T!!A!!C!!C4bA!!A!!A!!A!!G!!T!!G1cT1aA1aT1bT!!T4bG!!G!!A!!A!!A1aC1aT1bG!!C!!T2[C!!C!!A!!T!!C!!A!!A2[A!!A4bG!!G!!C!!A!!T!!G!!T!!T!!C4bA4bG!!C!!T!!G!!A!!A!!T1bT!!C4bA4bG!!C1bT!!G!!A!!A!!C!!A!!T!!G!!C!!C!!T!!T!!T1bT!!G!!A!!T!!G!!G4bA!!G!!C!!A!!G!!T1aT1bT!!C!!C!!A!!A4bA!!T!!A!!C1aA1aC1bT!!T!!T!!T4bG!!G!!T!!A1aG1aA!!A!!T1bC!!T4bG!!C!!A!!G!!G1aT!!G!!G!!A!!T!!A!!T!!T!!G!!A!!T!!G!!G!!C!!G!!G!!T!!A!!A!!C!!G!!G!!A" }, "chain_J": { "num_nts": 164, "bseq": "TCCGTTACCGCCATCAATATCCACCTGCAGATTCTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGAATTCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGAATCTGCAGGTGGATATTGATGGCGGT", "sstr": "))))))))))))).)))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))).)))..)))))))))))))))))))))))..)))))))))))))))))))))))))))))))", "form": "BBBBBBBBBBBB...BBBB.BBBBBBB..B......B..BBB..BBB.B.BBBBBBBBB...BB.BBB.B.BBBBBBB.B..BB.BBBBB..BB.BBBBB...BB.....BBB.BBBBB.BB..BBBBBB......BBBBB.BBBBBBBBBB.BBB...B.B.-", "helical_rise": 0.235, "helical_rise_std": 2.416, "helical_axis": [ 0.992, -0.063, -0.106 ], "point1": [ 117.760, 141.363, 139.549 ], "point2": [ 156.070, 138.936, 135.459 ], "num_chars": 490, "suite": "T!!C!!C!!G!!T!!T!!A!!C!!C!!G!!C!!C!!A1bT!!C!!A!!A!!T!!A!!T!!C1bC!!A!!C!!C!!T!!G!!C!!A!!G!!A!!T1aT1aC1aT1bA!!C!!C4bA!!A!!A!!A!!G1bT!!G!!T!!A!!T!!T!!T4bG!!G!!A!!A!!A!!C1bT!!G!!C!!T4bC4bC!!A!!T!!C!!A!!A4bA!!A!!G!!G!!C!!A!!T!!G!!T!!T!!C1bA!!G!!C4bT4bG!!A!!A!!T!!T1bC!!A!!G!!C4bT!!G!!A!!A!!C1bA!!T!!G!!C!!C4bT4bT!!T!!T!!G!!A!!T!!G!!G!!A!!G!!C!!A!!G!!T!!T!!T!!C!!C!!A!!A!!A!!T!!A!!C!!A!!C!!T1bT!!T4bT!!G!!G!!T4bA!!G!!A!!A!!T!!C!!T4bG!!C!!A!!G!!G!!T!!G!!G!!A!!T!!A!!T!!T!!G!!A!!T!!G!!G!!C!!G!!G!!T" } }, "num_nts": 328, "nts": [ { "index": 1, "index_chain": 1, "chain_name": "I", "nt_resnum": 12, "nt_name": "DA", "nt_code": "A", "nt_id": "///I/12", "linked_nts": [ null, "///I/13" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix-end,stem-end", "alpha": null, "beta": 171.499, "gamma": 53.618, "delta": 140.192, "epsilon": -154.187, "zeta": -122.313, "epsilon_zeta": -31.874, "bb_type": "BI", "chi": -131.600, "glyco_bond": "anti", "C5prime_xyz": [ -2.051, 8.745, -0.707 ], "P_xyz": [ 0.257, 9.656, 0.133 ], "form": ".", "ssZp": 2.024, "Dp": 2.087, "splay_angle": 22.528, "splay_distance": 4.126, "splay_ratio": 0.204, "d22": null, "d64": null, "eta": null, "theta": -119.987, "eta_prime": null, "theta_prime": -142.006, "eta_base": null, "theta_base": -114.129, "v0": -27.059, "v1": 38.792, "v2": -35.145, "v3": 20.463, "v4": 3.868, "amplitude": 38.617, "phase_angle": 155.517, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.003, "origin": [ 148.292, 95.387, 96.439 ], "x_axis": [ 0.679, -0.197, -0.707 ], "y_axis": [ -0.653, 0.279, -0.705 ], "z_axis": [ 0.336, 0.940, 0.061 ], "quaternion": [ 0.710, -0.579, 0.367, 0.160 ] } }, { "index": 2, "index_chain": 2, "chain_name": "I", "nt_resnum": 13, "nt_name": "DC", "nt_code": "C", "nt_id": "///I/13", "linked_nts": [ "///I/12", "///I/14" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": 53.274, "beta": -176.831, "gamma": -85.059, "delta": 156.367, "epsilon": -174.012, "zeta": -89.849, "epsilon_zeta": -84.163, "bb_type": "BI", "chi": -120.894, "glyco_bond": "anti", "C5prime_xyz": [ -1.196, 8.340, -0.867 ], "P_xyz": [ -0.018, 10.646, -1.226 ], "form": "B", "ssZp": 1.980, "Dp": 1.921, "splay_angle": 20.338, "splay_distance": 3.551, "splay_ratio": 0.180, "d22": 3.991, "d64": 3.818, "eta": 170.606, "theta": -158.008, "eta_prime": -171.412, "theta_prime": -155.281, "eta_base": -132.625, "theta_base": -114.730, "v0": -6.089, "v1": 27.239, "v2": -36.643, "v3": 34.108, "v4": -17.804, "amplitude": 37.137, "phase_angle": 189.358, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "22m", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.003, "origin": [ 150.667, 98.555, 97.599 ], "x_axis": [ 0.175, -0.064, -0.983 ], "y_axis": [ -0.940, 0.288, -0.186 ], "z_axis": [ 0.294, 0.956, -0.010 ], "quaternion": [ 0.603, -0.474, 0.530, 0.363 ] } }, { "index": 3, "index_chain": 3, "chain_name": "I", "nt_resnum": 14, "nt_name": "DC", "nt_code": "C", "nt_id": "///I/14", "linked_nts": [ "///I/13", "///I/15" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -71.155, "beta": -176.017, "gamma": 43.972, "delta": 137.262, "epsilon": -165.294, "zeta": -128.401, "epsilon_zeta": -36.893, "bb_type": "BI", "chi": -116.896, "glyco_bond": "anti", "C5prime_xyz": [ -2.305, 8.615, -1.524 ], "P_xyz": [ -0.249, 10.161, -1.020 ], "form": ".", "ssZp": 2.194, "Dp": 2.223, "splay_angle": 15.946, "splay_distance": 2.874, "splay_ratio": 0.145, "d22": null, "d64": null, "eta": 158.036, "theta": -140.306, "eta_prime": -171.370, "theta_prime": -155.163, "eta_base": -124.610, "theta_base": -125.179, "v0": -30.524, "v1": 40.530, "v2": -34.604, "v3": 17.979, "v4": 7.558, "amplitude": 39.819, "phase_angle": 150.346, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.002, "origin": [ 152.337, 101.658, 97.162 ], "x_axis": [ -0.403, -0.007, -0.915 ], "y_axis": [ -0.892, 0.227, 0.391 ], "z_axis": [ 0.205, 0.974, -0.098 ], "quaternion": [ 0.426, -0.342, 0.657, 0.519 ] } }, { "index": 4, "index_chain": 4, "chain_name": "I", "nt_resnum": 15, "nt_name": "DG", "nt_code": "G", "nt_id": "///I/15", "linked_nts": [ "///I/14", "///I/16" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": 45.325, "beta": 178.107, "gamma": -71.500, "delta": 158.002, "epsilon": -171.252, "zeta": -87.991, "epsilon_zeta": -83.261, "bb_type": "BI", "chi": -110.686, "glyco_bond": "anti", "C5prime_xyz": [ -1.122, 8.020, -1.357 ], "P_xyz": [ 0.282, 10.215, -1.613 ], "form": "B", "ssZp": 1.707, "Dp": 1.791, "splay_angle": 21.798, "splay_distance": 3.798, "splay_ratio": 0.190, "d22": null, "d64": null, "eta": 171.019, "theta": -146.889, "eta_prime": -175.444, "theta_prime": -146.553, "eta_base": -138.793, "theta_base": -104.295, "v0": 0.650, "v1": 21.970, "v2": -34.811, "v3": 36.153, "v4": -23.366, "amplitude": 36.958, "phase_angle": 199.623, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "22m", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.006, "frame": { "rmsd": 0.006, "origin": [ 153.749, 103.971, 96.204 ], "x_axis": [ -0.866, -0.082, -0.493 ], "y_axis": [ -0.493, 0.305, 0.815 ], "z_axis": [ 0.083, 0.949, -0.304 ], "quaternion": [ 0.183, -0.183, 0.787, 0.561 ] } }, { "index": 5, "index_chain": 5, "chain_name": "I", "nt_resnum": 16, "nt_name": "DC", "nt_code": "C", "nt_id": "///I/16", "linked_nts": [ "///I/15", "///I/17" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -63.429, "beta": 176.179, "gamma": 43.342, "delta": 127.923, "epsilon": 173.797, "zeta": -93.498, "epsilon_zeta": -92.705, "bb_type": "BI", "chi": -107.442, "glyco_bond": "anti", "C5prime_xyz": [ -2.672, 8.337, -2.056 ], "P_xyz": [ -0.601, 9.911, -2.304 ], "form": ".", "ssZp": 2.405, "Dp": 2.430, "splay_angle": 22.388, "splay_distance": 4.035, "splay_ratio": 0.202, "d22": 4.230, "d64": 4.501, "eta": 155.136, "theta": -148.216, "eta_prime": -169.157, "theta_prime": -160.557, "eta_base": -121.263, "theta_base": -125.302, "v0": -33.625, "v1": 38.138, "v2": -28.175, "v3": 9.695, "v4": 14.739, "amplitude": 37.639, "phase_angle": 138.467, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.003, "origin": [ 153.152, 107.444, 94.789 ], "x_axis": [ -0.996, 0.063, 0.060 ], "y_axis": [ 0.078, 0.328, 0.942 ], "z_axis": [ 0.040, 0.943, -0.331 ], "quaternion": [ -0.006, 0.043, 0.815, 0.578 ] } }, { "index": 6, "index_chain": 6, "chain_name": "I", "nt_resnum": 17, "nt_name": "DC", "nt_code": "C", "nt_id": "///I/17", "linked_nts": [ "///I/16", "///I/18" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": -52.856, "beta": -175.303, "gamma": 44.636, "delta": 121.822, "epsilon": -153.509, "zeta": -132.403, "epsilon_zeta": -21.105, "bb_type": "--", "chi": -119.405, "glyco_bond": "anti", "C5prime_xyz": [ -2.654, 8.610, -1.637 ], "P_xyz": [ -0.772, 10.418, -1.497 ], "form": ".", "ssZp": 2.383, "Dp": 2.396, "splay_angle": 24.049, "splay_distance": 4.060, "splay_ratio": 0.210, "d22": null, "d64": null, "eta": -175.801, "theta": -176.634, "eta_prime": -163.122, "theta_prime": -173.204, "eta_base": -123.284, "theta_base": -150.885, "v0": -36.920, "v1": 37.223, "v2": -23.676, "v3": 3.224, "v4": 20.939, "amplitude": 38.097, "phase_angle": 128.423, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.003, "origin": [ 152.092, 110.778, 92.776 ], "x_axis": [ -0.813, 0.189, 0.551 ], "y_axis": [ 0.582, 0.257, 0.771 ], "z_axis": [ 0.004, 0.948, -0.319 ], "quaternion": [ -0.177, 0.249, 0.773, 0.556 ] } }, { "index": 7, "index_chain": 7, "chain_name": "I", "nt_resnum": 18, "nt_name": "DA", "nt_code": "A", "nt_id": "///I/18", "linked_nts": [ "///I/17", "///I/19" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -67.473, "beta": 161.360, "gamma": 53.409, "delta": 138.807, "epsilon": -173.269, "zeta": -90.606, "epsilon_zeta": -82.663, "bb_type": "BI", "chi": -128.336, "glyco_bond": "anti", "C5prime_xyz": [ -1.968, 8.685, -0.882 ], "P_xyz": [ 0.504, 9.351, -0.329 ], "form": ".", "ssZp": 2.220, "Dp": 2.264, "splay_angle": 20.977, "splay_distance": 3.734, "splay_ratio": 0.190, "d22": null, "d64": null, "eta": 158.338, "theta": -119.764, "eta_prime": -179.441, "theta_prime": -141.021, "eta_base": -152.418, "theta_base": -100.082, "v0": -24.711, "v1": 35.801, "v2": -32.710, "v3": 19.350, "v4": 3.132, "amplitude": 35.737, "phase_angle": 156.251, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.037, "frame": { "rmsd": 0.003, "origin": [ 153.163, 113.874, 90.379 ], "x_axis": [ -0.492, 0.001, 0.871 ], "y_axis": [ 0.869, 0.064, 0.491 ], "z_axis": [ -0.055, 0.998, -0.032 ], "quaternion": [ -0.367, 0.345, 0.630, 0.591 ] } }, { "index": 8, "index_chain": 8, "chain_name": "I", "nt_resnum": 19, "nt_name": "DT", "nt_code": "T", "nt_id": "///I/19", "linked_nts": [ "///I/18", "///I/20" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -62.074, "beta": -177.718, "gamma": 41.329, "delta": 126.876, "epsilon": -167.448, "zeta": -107.431, "epsilon_zeta": -60.017, "bb_type": "BI", "chi": -121.621, "glyco_bond": "anti", "C5prime_xyz": [ -2.449, 8.627, -1.457 ], "P_xyz": [ -0.476, 10.300, -1.045 ], "form": "B", "ssZp": 2.482, "Dp": 2.451, "splay_angle": 21.172, "splay_distance": 3.540, "splay_ratio": 0.184, "d22": 4.372, "d64": 3.689, "eta": 165.440, "theta": -152.710, "eta_prime": -169.827, "theta_prime": -155.082, "eta_base": -115.467, "theta_base": -107.331, "v0": -33.356, "v1": 37.095, "v2": -26.704, "v3": 8.265, "v4": 15.547, "amplitude": 36.756, "phase_angle": 136.595, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.105, "frame": { "rmsd": 0.003, "origin": [ 151.774, 117.290, 90.965 ], "x_axis": [ 0.160, 0.052, 0.986 ], "y_axis": [ 0.986, 0.030, -0.162 ], "z_axis": [ -0.038, 0.998, -0.046 ], "quaternion": [ 0.535, -0.542, -0.479, -0.437 ] } }, { "index": 9, "index_chain": 9, "chain_name": "I", "nt_resnum": 20, "nt_name": "DC", "nt_code": "C", "nt_id": "///I/20", "linked_nts": [ "///I/19", "///I/21" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -59.651, "beta": 170.581, "gamma": 51.216, "delta": 132.113, "epsilon": -154.748, "zeta": -119.153, "epsilon_zeta": -35.595, "bb_type": "BI", "chi": -117.840, "glyco_bond": "anti", "C5prime_xyz": [ -2.123, 8.590, -1.546 ], "P_xyz": [ 0.305, 9.570, -1.443 ], "form": "B", "ssZp": 2.279, "Dp": 2.298, "splay_angle": 22.584, "splay_distance": 3.815, "splay_ratio": 0.198, "d22": null, "d64": null, "eta": 172.153, "theta": -147.706, "eta_prime": -165.922, "theta_prime": -154.529, "eta_base": -113.333, "theta_base": -114.349, "v0": -27.661, "v1": 34.772, "v2": -28.394, "v3": 13.215, "v4": 8.895, "amplitude": 34.099, "phase_angle": 146.376, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.005, "origin": [ 151.961, 120.760, 91.640 ], "x_axis": [ 0.769, -0.007, 0.640 ], "y_axis": [ 0.639, 0.043, -0.768 ], "z_axis": [ -0.022, 0.999, 0.037 ], "quaternion": [ 0.680, -0.650, -0.244, -0.238 ] } }, { "index": 10, "index_chain": 10, "chain_name": "I", "nt_resnum": 21, "nt_name": "DA", "nt_code": "A", "nt_id": "///I/21", "linked_nts": [ "///I/20", "///I/22" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem", "alpha": -61.721, "beta": 159.011, "gamma": 56.505, "delta": 132.567, "epsilon": -168.260, "zeta": -108.860, "epsilon_zeta": -59.400, "bb_type": "BI", "chi": -117.673, "glyco_bond": "anti", "C5prime_xyz": [ -2.128, 8.510, -1.529 ], "P_xyz": [ 0.410, 9.145, -1.646 ], "form": "B", "ssZp": 2.392, "Dp": 2.384, "splay_angle": 19.601, "splay_distance": 3.303, "splay_ratio": 0.170, "d22": null, "d64": null, "eta": 163.793, "theta": -140.039, "eta_prime": -168.219, "theta_prime": -157.199, "eta_base": -121.988, "theta_base": -117.546, "v0": -25.949, "v1": 33.469, "v2": -27.947, "v3": 13.722, "v4": 7.504, "amplitude": 32.861, "phase_angle": 148.262, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.005, "origin": [ 152.364, 124.543, 91.352 ], "x_axis": [ 0.997, -0.060, 0.054 ], "y_axis": [ 0.058, 0.059, -0.997 ], "z_axis": [ 0.056, 0.996, 0.063 ], "quaternion": [ 0.728, -0.685, 0.001, -0.040 ] } }, { "index": 11, "index_chain": 11, "chain_name": "I", "nt_resnum": 22, "nt_name": "DA", "nt_code": "A", "nt_id": "///I/22", "linked_nts": [ "///I/21", "///I/23" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -61.607, "beta": 160.808, "gamma": 60.811, "delta": 130.534, "epsilon": -164.542, "zeta": -128.402, "epsilon_zeta": -36.140, "bb_type": "BI", "chi": -126.955, "glyco_bond": "anti", "C5prime_xyz": [ -2.390, 8.695, -1.154 ], "P_xyz": [ 0.023, 9.699, -1.095 ], "form": ".", "ssZp": 2.366, "Dp": 2.361, "splay_angle": 23.221, "splay_distance": 4.093, "splay_ratio": 0.207, "d22": null, "d64": null, "eta": 167.736, "theta": -140.519, "eta_prime": -165.265, "theta_prime": -159.181, "eta_base": -117.078, "theta_base": -133.698, "v0": -32.785, "v1": 38.707, "v2": -29.662, "v3": 11.665, "v4": 13.006, "amplitude": 37.946, "phase_angle": 141.417, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.004, "origin": [ 152.993, 127.762, 91.746 ], "x_axis": [ 0.847, -0.058, -0.529 ], "y_axis": [ -0.521, 0.105, -0.847 ], "z_axis": [ 0.105, 0.993, 0.059 ], "quaternion": [ 0.709, -0.649, 0.223, 0.163 ] } }, { "index": 12, "index_chain": 12, "chain_name": "I", "nt_resnum": 23, "nt_name": "DT", "nt_code": "T", "nt_id": "///I/23", "linked_nts": [ "///I/22", "///I/24" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": 44.788, "beta": -177.953, "gamma": -59.012, "delta": 157.388, "epsilon": -174.130, "zeta": -94.385, "epsilon_zeta": -79.745, "bb_type": "BI", "chi": -110.278, "glyco_bond": "anti", "C5prime_xyz": [ -1.238, 8.048, -1.398 ], "P_xyz": [ 0.134, 10.273, -1.467 ], "form": "B", "ssZp": 1.804, "Dp": 1.824, "splay_angle": 20.565, "splay_distance": 3.503, "splay_ratio": 0.179, "d22": null, "d64": null, "eta": -177.399, "theta": -151.434, "eta_prime": -164.165, "theta_prime": -152.852, "eta_base": -133.226, "theta_base": -97.867, "v0": -2.298, "v1": 24.383, "v2": -35.821, "v3": 35.425, "v4": -21.046, "amplitude": 37.105, "phase_angle": 195.121, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "22m", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.002, "origin": [ 153.968, 131.348, 93.461 ], "x_axis": [ 0.447, 0.037, -0.894 ], "y_axis": [ -0.889, 0.127, -0.440 ], "z_axis": [ 0.097, 0.991, 0.089 ], "quaternion": [ 0.645, -0.555, 0.384, 0.359 ] } }, { "index": 13, "index_chain": 13, "chain_name": "I", "nt_resnum": 24, "nt_name": "DA", "nt_code": "A", "nt_id": "///I/24", "linked_nts": [ "///I/23", "///I/25" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -63.971, "beta": 169.189, "gamma": 51.963, "delta": 117.642, "epsilon": 173.888, "zeta": -94.342, "epsilon_zeta": -91.770, "bb_type": "BI", "chi": -121.562, "glyco_bond": "anti", "C5prime_xyz": [ -2.310, 8.574, -1.596 ], "P_xyz": [ 0.016, 9.775, -1.656 ], "form": "B", "ssZp": 2.482, "Dp": 2.555, "splay_angle": 21.047, "splay_distance": 3.576, "splay_ratio": 0.184, "d22": null, "d64": null, "eta": 160.016, "theta": -155.513, "eta_prime": -168.552, "theta_prime": -164.590, "eta_base": -107.005, "theta_base": -130.972, "v0": -30.618, "v1": 28.992, "v2": -16.975, "v3": -0.091, "v4": 19.221, "amplitude": 30.753, "phase_angle": 123.504, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.004, "origin": [ 154.389, 134.707, 92.561 ], "x_axis": [ -0.237, 0.106, -0.966 ], "y_axis": [ -0.965, 0.090, 0.247 ], "z_axis": [ 0.113, 0.990, 0.081 ], "quaternion": [ 0.483, -0.385, 0.558, 0.554 ] } }, { "index": 14, "index_chain": 14, "chain_name": "I", "nt_resnum": 25, "nt_name": "DT", "nt_code": "T", "nt_id": "///I/25", "linked_nts": [ "///I/24", "///I/26" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -46.045, "beta": -177.122, "gamma": 42.249, "delta": 140.218, "epsilon": -158.502, "zeta": -122.102, "epsilon_zeta": -36.400, "bb_type": "BI", "chi": -115.049, "glyco_bond": "anti", "C5prime_xyz": [ -2.154, 8.500, -1.534 ], "P_xyz": [ -0.026, 9.889, -0.939 ], "form": "B", "ssZp": 2.003, "Dp": 2.054, "splay_angle": 20.778, "splay_distance": 3.515, "splay_ratio": 0.180, "d22": 4.410, "d64": 3.850, "eta": -178.921, "theta": -147.184, "eta_prime": -158.484, "theta_prime": -155.835, "eta_base": -120.908, "theta_base": -113.106, "v0": -25.734, "v1": 37.666, "v2": -34.735, "v3": 20.828, "v4": 2.802, "amplitude": 37.734, "phase_angle": 157.002, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.002, "origin": [ 155.533, 138.095, 92.596 ], "x_axis": [ -0.698, 0.162, -0.697 ], "y_axis": [ -0.705, 0.016, 0.709 ], "z_axis": [ 0.126, 0.987, 0.103 ], "quaternion": [ 0.324, -0.214, 0.635, 0.668 ] } }, { "index": 15, "index_chain": 15, "chain_name": "I", "nt_resnum": 26, "nt_name": "DC", "nt_code": "C", "nt_id": "///I/26", "linked_nts": [ "///I/25", "///I/27" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -51.904, "beta": 160.222, "gamma": 44.371, "delta": 126.710, "epsilon": -174.492, "zeta": -98.664, "epsilon_zeta": -75.828, "bb_type": "BI", "chi": -122.197, "glyco_bond": "anti", "C5prime_xyz": [ -2.160, 8.700, -1.424 ], "P_xyz": [ 0.219, 9.734, -1.161 ], "form": ".", "ssZp": 2.367, "Dp": 2.398, "splay_angle": 20.532, "splay_distance": 3.606, "splay_ratio": 0.181, "d22": 4.097, "d64": 4.044, "eta": 164.836, "theta": -141.257, "eta_prime": -172.081, "theta_prime": -153.605, "eta_base": -121.984, "theta_base": -118.458, "v0": -29.961, "v1": 33.917, "v2": -25.178, "v3": 8.666, "v4": 13.186, "amplitude": 33.583, "phase_angle": 138.566, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.064, "frame": { "rmsd": 0.003, "origin": [ 155.951, 141.582, 92.724 ], "x_axis": [ -0.986, 0.105, -0.130 ], "y_axis": [ -0.142, -0.119, 0.983 ], "z_axis": [ 0.088, 0.987, 0.133 ], "quaternion": [ 0.083, -0.014, 0.658, 0.748 ] } }, { "index": 16, "index_chain": 16, "chain_name": "I", "nt_resnum": 27, "nt_name": "DC", "nt_code": "C", "nt_id": "///I/27", "linked_nts": [ "///I/26", "///I/28" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -47.923, "beta": 176.436, "gamma": 37.507, "delta": 130.470, "epsilon": -159.548, "zeta": -120.143, "epsilon_zeta": -39.405, "bb_type": "BI", "chi": -121.366, "glyco_bond": "anti", "C5prime_xyz": [ -2.300, 8.689, -1.409 ], "P_xyz": [ -0.276, 10.239, -0.873 ], "form": "B", "ssZp": 2.266, "Dp": 2.275, "splay_angle": 19.592, "splay_distance": 3.308, "splay_ratio": 0.170, "d22": null, "d64": null, "eta": 173.886, "theta": -155.409, "eta_prime": -165.973, "theta_prime": -159.061, "eta_base": -122.933, "theta_base": -121.010, "v0": -32.041, "v1": 37.869, "v2": -29.227, "v3": 11.597, "v4": 12.589, "amplitude": 37.215, "phase_angle": 141.754, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.002, "origin": [ 155.851, 145.171, 92.387 ], "x_axis": [ -0.914, -0.036, 0.405 ], "y_axis": [ 0.404, -0.183, 0.896 ], "z_axis": [ 0.042, 0.982, 0.182 ], "quaternion": [ -0.146, 0.148, 0.622, 0.755 ] } }, { "index": 17, "index_chain": 17, "chain_name": "I", "nt_resnum": 28, "nt_name": "DA", "nt_code": "A", "nt_id": "///I/28", "linked_nts": [ "///I/27", "///I/29" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -53.041, "beta": 160.810, "gamma": 45.662, "delta": 132.336, "epsilon": -157.243, "zeta": -113.165, "epsilon_zeta": -44.078, "bb_type": "BI", "chi": -122.358, "glyco_bond": "anti", "C5prime_xyz": [ -2.231, 8.623, -1.321 ], "P_xyz": [ 0.140, 9.662, -0.987 ], "form": "B", "ssZp": 2.257, "Dp": 2.257, "splay_angle": 20.354, "splay_distance": 3.493, "splay_ratio": 0.177, "d22": null, "d64": null, "eta": 168.770, "theta": -140.855, "eta_prime": -170.056, "theta_prime": -152.639, "eta_base": -126.585, "theta_base": -117.494, "v0": -29.591, "v1": 36.644, "v2": -29.547, "v3": 13.311, "v4": 10.034, "amplitude": 35.938, "phase_angle": 145.304, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.003, "origin": [ 155.943, 148.463, 92.692 ], "x_axis": [ -0.537, -0.200, 0.820 ], "y_axis": [ 0.844, -0.136, 0.520 ], "z_axis": [ 0.007, 0.970, 0.241 ], "quaternion": [ -0.377, 0.299, 0.539, 0.692 ] } }, { "index": 18, "index_chain": 18, "chain_name": "I", "nt_resnum": 29, "nt_name": "DC", "nt_code": "C", "nt_id": "///I/29", "linked_nts": [ "///I/28", "///I/30" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -57.089, "beta": 164.117, "gamma": 44.028, "delta": 122.442, "epsilon": -164.125, "zeta": -98.450, "epsilon_zeta": -65.676, "bb_type": "BI", "chi": -124.108, "glyco_bond": "anti", "C5prime_xyz": [ -2.273, 8.718, -1.414 ], "P_xyz": [ 0.036, 9.926, -1.242 ], "form": "B", "ssZp": 2.509, "Dp": 2.521, "splay_angle": 19.579, "splay_distance": 3.446, "splay_ratio": 0.172, "d22": 3.918, "d64": 3.694, "eta": 165.122, "theta": -140.958, "eta_prime": -175.038, "theta_prime": -151.905, "eta_base": -131.296, "theta_base": -110.203, "v0": -32.191, "v1": 33.158, "v2": -21.830, "v3": 3.937, "v4": 17.637, "amplitude": 33.708, "phase_angle": 130.362, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.004, "origin": [ 155.457, 151.835, 93.465 ], "x_axis": [ 0.030, -0.334, 0.942 ], "y_axis": [ 1.000, 0.004, -0.030 ], "z_axis": [ 0.006, 0.943, 0.334 ], "quaternion": [ 0.585, -0.416, -0.400, -0.570 ] } }, { "index": 19, "index_chain": 19, "chain_name": "I", "nt_resnum": 30, "nt_name": "DC", "nt_code": "C", "nt_id": "///I/30", "linked_nts": [ "///I/29", "///I/31" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,BI,canonical,non-pair-contact,helix,stem", "alpha": -59.311, "beta": 160.366, "gamma": 52.727, "delta": 98.515, "epsilon": -174.178, "zeta": -87.371, "epsilon_zeta": -86.807, "bb_type": "BI", "chi": -139.489, "glyco_bond": "anti", "C5prime_xyz": [ -2.449, 8.916, -1.020 ], "P_xyz": [ -0.181, 10.212, -1.145 ], "form": "B", "ssZp": 3.044, "Dp": 3.107, "splay_angle": 21.682, "splay_distance": 3.734, "splay_ratio": 0.189, "d22": 4.436, "d64": 4.205, "eta": 166.360, "theta": -158.532, "eta_prime": -175.242, "theta_prime": -158.879, "eta_base": -123.388, "theta_base": -132.039, "v0": -34.351, "v1": 19.352, "v2": 1.383, "v3": -21.059, "v4": 35.056, "amplitude": 35.709, "phase_angle": 87.780, "puckering": "O4'-endo", "sugar_class": "--", "bin": "23p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.004, "origin": [ 155.258, 154.605, 95.507 ], "x_axis": [ 0.595, -0.344, 0.727 ], "y_axis": [ 0.804, 0.226, -0.551 ], "z_axis": [ 0.026, 0.911, 0.411 ], "quaternion": [ 0.747, -0.489, -0.235, -0.384 ] } }, { "index": 20, "index_chain": 20, "chain_name": "I", "nt_resnum": 31, "nt_name": "DT", "nt_code": "T", "nt_id": "///I/31", "linked_nts": [ "///I/30", "///I/32" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem", "alpha": -51.680, "beta": 176.479, "gamma": 46.809, "delta": 135.258, "epsilon": -158.866, "zeta": -123.725, "epsilon_zeta": -35.140, "bb_type": "BI", "chi": -120.282, "glyco_bond": "anti", "C5prime_xyz": [ -2.367, 8.621, -1.365 ], "P_xyz": [ -0.170, 9.987, -0.939 ], "form": "B", "ssZp": 2.343, "Dp": 2.294, "splay_angle": 19.152, "splay_distance": 3.145, "splay_ratio": 0.169, "d22": null, "d64": null, "eta": 175.396, "theta": -155.429, "eta_prime": -160.792, "theta_prime": -160.142, "eta_base": -128.815, "theta_base": -110.582, "v0": -31.193, "v1": 39.863, "v2": -32.818, "v3": 15.709, "v4": 9.471, "amplitude": 38.995, "phase_angle": 147.310, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1b", "suiteness": 0.198, "filter_rmsd": 0.105, "frame": { "rmsd": 0.004, "origin": [ 154.785, 157.723, 97.506 ], "x_axis": [ 0.896, -0.269, 0.354 ], "y_axis": [ 0.437, 0.388, -0.811 ], "z_axis": [ 0.081, 0.881, 0.465 ], "quaternion": [ 0.829, -0.510, -0.082, -0.213 ] } }, { "index": 21, "index_chain": 21, "chain_name": "I", "nt_resnum": 32, "nt_name": "DG", "nt_code": "G", "nt_id": "///I/32", "linked_nts": [ "///I/31", "///I/33" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -72.511, "beta": 163.577, "gamma": 62.005, "delta": 139.256, "epsilon": -163.209, "zeta": -107.051, "epsilon_zeta": -56.158, "bb_type": "BI", "chi": -118.985, "glyco_bond": "anti", "C5prime_xyz": [ -1.817, 8.536, -1.333 ], "P_xyz": [ 0.785, 8.885, -1.297 ], "form": "B", "ssZp": 2.257, "Dp": 2.231, "splay_angle": 23.938, "splay_distance": 4.007, "splay_ratio": 0.208, "d22": null, "d64": null, "eta": 162.811, "theta": -130.329, "eta_prime": -170.641, "theta_prime": -147.912, "eta_base": -115.446, "theta_base": -113.165, "v0": -19.316, "v1": 31.135, "v2": -30.423, "v3": 20.103, "v4": -0.679, "amplitude": 31.914, "phase_angle": 162.419, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.006, "frame": { "rmsd": 0.006, "origin": [ 155.308, 160.620, 98.614 ], "x_axis": [ 0.950, 0.032, -0.310 ], "y_axis": [ -0.280, 0.522, -0.806 ], "z_axis": [ 0.136, 0.852, 0.505 ], "quaternion": [ 0.863, -0.480, 0.129, 0.090 ] } }, { "index": 22, "index_chain": 22, "chain_name": "I", "nt_resnum": 33, "nt_name": "DC", "nt_code": "C", "nt_id": "///I/33", "linked_nts": [ "///I/32", "///I/34" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": -65.359, "beta": 174.672, "gamma": 54.572, "delta": 136.870, "epsilon": -129.841, "zeta": -165.248, "epsilon_zeta": 35.407, "bb_type": "--", "chi": -109.300, "glyco_bond": "anti", "C5prime_xyz": [ -2.224, 8.400, -1.851 ], "P_xyz": [ 0.208, 9.379, -1.910 ], "form": ".", "ssZp": 1.650, "Dp": 1.797, "splay_angle": 28.002, "splay_distance": 4.975, "splay_ratio": 0.275, "d22": null, "d64": null, "eta": -178.169, "theta": -178.596, "eta_prime": -157.416, "theta_prime": -177.207, "eta_base": -118.186, "theta_base": -123.720, "v0": -26.057, "v1": 35.968, "v2": -31.701, "v3": 17.601, "v4": 5.071, "amplitude": 35.546, "phase_angle": 153.102, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.003, "origin": [ 155.988, 164.139, 100.406 ], "x_axis": [ 0.596, 0.313, -0.739 ], "y_axis": [ -0.785, 0.418, -0.457 ], "z_axis": [ 0.166, 0.853, 0.495 ], "quaternion": [ 0.792, -0.414, 0.286, 0.347 ] } }, { "index": 23, "index_chain": 23, "chain_name": "I", "nt_resnum": 34, "nt_name": "DA", "nt_code": "A", "nt_id": "///I/34", "linked_nts": [ "///I/33", "///I/35" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -64.086, "beta": 134.197, "gamma": 67.581, "delta": 148.827, "epsilon": -168.262, "zeta": -117.569, "epsilon_zeta": -50.693, "bb_type": "BI", "chi": -105.608, "glyco_bond": "anti", "C5prime_xyz": [ -1.726, 8.132, -1.795 ], "P_xyz": [ 0.790, 7.480, -2.137 ], "form": "B", "ssZp": 1.848, "Dp": 1.932, "splay_angle": 21.059, "splay_distance": 3.511, "splay_ratio": 0.183, "d22": null, "d64": null, "eta": 160.067, "theta": -118.255, "eta_prime": -154.975, "theta_prime": -162.201, "eta_base": -107.973, "theta_base": -123.363, "v0": -12.721, "v1": 30.253, "v2": -35.278, "v3": 28.851, "v4": -10.375, "amplitude": 35.299, "phase_angle": 178.023, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "4b", "suiteness": 0.050, "filter_rmsd": 0.037, "frame": { "rmsd": 0.003, "origin": [ 153.991, 168.132, 102.600 ], "x_axis": [ -0.044, 0.715, -0.698 ], "y_axis": [ -0.995, 0.034, 0.097 ], "z_axis": [ 0.093, 0.699, 0.709 ], "quaternion": [ 0.652, -0.231, 0.304, 0.656 ] } }, { "index": 24, "index_chain": 24, "chain_name": "I", "nt_resnum": 35, "nt_name": "DG", "nt_code": "G", "nt_id": "///I/35", "linked_nts": [ "///I/34", "///I/36" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -59.839, "beta": 163.471, "gamma": 56.137, "delta": 139.907, "epsilon": -164.052, "zeta": -126.758, "epsilon_zeta": -37.294, "bb_type": "BI", "chi": -114.091, "glyco_bond": "anti", "C5prime_xyz": [ -2.285, 8.516, -1.581 ], "P_xyz": [ 0.176, 9.398, -1.529 ], "form": "B", "ssZp": 2.126, "Dp": 2.155, "splay_angle": 19.967, "splay_distance": 3.279, "splay_ratio": 0.174, "d22": null, "d64": null, "eta": 166.223, "theta": -148.874, "eta_prime": -165.183, "theta_prime": -165.023, "eta_base": -119.338, "theta_base": -118.030, "v0": -27.313, "v1": 38.880, "v2": -35.110, "v3": 20.316, "v4": 4.106, "amplitude": 38.684, "phase_angle": 155.176, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.005, "frame": { "rmsd": 0.005, "origin": [ 154.212, 170.550, 105.137 ], "x_axis": [ -0.606, 0.612, -0.509 ], "y_axis": [ -0.791, -0.392, 0.470 ], "z_axis": [ 0.088, 0.687, 0.721 ], "quaternion": [ 0.425, -0.128, 0.351, 0.824 ] } }, { "index": 25, "index_chain": 25, "chain_name": "I", "nt_resnum": 36, "nt_name": "DA", "nt_code": "A", "nt_id": "///I/36", "linked_nts": [ "///I/35", "///I/37" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -57.168, "beta": 160.704, "gamma": 53.738, "delta": 137.713, "epsilon": -164.470, "zeta": -104.580, "epsilon_zeta": -59.890, "bb_type": "BI", "chi": -121.570, "glyco_bond": "anti", "C5prime_xyz": [ -2.009, 8.590, -1.240 ], "P_xyz": [ 0.495, 9.276, -0.917 ], "form": ".", "ssZp": 2.160, "Dp": 2.184, "splay_angle": 21.584, "splay_distance": 3.802, "splay_ratio": 0.191, "d22": null, "d64": null, "eta": 167.788, "theta": -129.712, "eta_prime": -167.736, "theta_prime": -150.320, "eta_base": -114.554, "theta_base": -121.349, "v0": -24.481, "v1": 35.172, "v2": -32.010, "v3": 18.750, "v4": 3.361, "amplitude": 35.093, "phase_angle": 155.806, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.003, "origin": [ 154.441, 172.791, 107.519 ], "x_axis": [ -0.971, 0.224, -0.087 ], "y_axis": [ -0.224, -0.710, 0.668 ], "z_axis": [ 0.088, 0.668, 0.739 ], "quaternion": [ 0.121, 0.000, 0.361, 0.925 ] } }, { "index": 26, "index_chain": 26, "chain_name": "I", "nt_resnum": 37, "nt_name": "DT", "nt_code": "T", "nt_id": "///I/37", "linked_nts": [ "///I/36", "///I/38" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -59.451, "beta": 172.147, "gamma": 44.198, "delta": 114.124, "epsilon": -172.670, "zeta": -94.035, "epsilon_zeta": -78.635, "bb_type": "BI", "chi": -127.961, "glyco_bond": "anti", "C5prime_xyz": [ -2.477, 8.708, -1.371 ], "P_xyz": [ -0.387, 10.263, -1.158 ], "form": "B", "ssZp": 2.624, "Dp": 2.655, "splay_angle": 22.688, "splay_distance": 3.936, "splay_ratio": 0.198, "d22": 4.279, "d64": 4.111, "eta": 166.743, "theta": -152.122, "eta_prime": -175.287, "theta_prime": -155.475, "eta_base": -135.577, "theta_base": -118.758, "v0": -35.094, "v1": 30.579, "v2": -15.305, "v3": -4.297, "v4": 24.693, "amplitude": 34.355, "phase_angle": 116.455, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.002, "origin": [ 154.900, 175.999, 109.508 ], "x_axis": [ -0.950, -0.188, 0.249 ], "y_axis": [ 0.303, -0.746, 0.593 ], "z_axis": [ 0.074, 0.639, 0.766 ], "quaternion": [ -0.132, 0.087, 0.331, 0.930 ] } }, { "index": 27, "index_chain": 27, "chain_name": "I", "nt_resnum": 38, "nt_name": "DT", "nt_code": "T", "nt_id": "///I/38", "linked_nts": [ "///I/37", "///I/39" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -53.967, "beta": 172.609, "gamma": 50.153, "delta": 122.799, "epsilon": -175.603, "zeta": -98.634, "epsilon_zeta": -76.969, "bb_type": "BI", "chi": -127.435, "glyco_bond": "anti", "C5prime_xyz": [ -2.382, 8.724, -1.272 ], "P_xyz": [ -0.209, 10.130, -0.936 ], "form": "B", "ssZp": 2.428, "Dp": 2.462, "splay_angle": 20.504, "splay_distance": 3.398, "splay_ratio": 0.178, "d22": 4.902, "d64": 4.087, "eta": 172.321, "theta": -145.902, "eta_prime": -163.919, "theta_prime": -161.049, "eta_base": -120.509, "theta_base": -131.109, "v0": -33.830, "v1": 35.205, "v2": -23.550, "v3": 4.845, "v4": 18.014, "amplitude": 35.609, "phase_angle": 131.402, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.002, "origin": [ 154.384, 178.681, 112.341 ], "x_axis": [ -0.631, -0.614, 0.475 ], "y_axis": [ 0.774, -0.538, 0.334 ], "z_axis": [ 0.050, 0.578, 0.814 ], "quaternion": [ -0.402, 0.152, 0.264, 0.864 ] } }, { "index": 28, "index_chain": 28, "chain_name": "I", "nt_resnum": 39, "nt_name": "DC", "nt_code": "C", "nt_id": "///I/39", "linked_nts": [ "///I/38", "///I/40" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -173.449, "beta": 151.078, "gamma": 157.182, "delta": 148.183, "epsilon": -145.486, "zeta": -77.694, "epsilon_zeta": -67.792, "bb_type": "BI", "chi": -144.124, "glyco_bond": "anti", "C5prime_xyz": [ -1.121, 8.510, 0.261 ], "P_xyz": [ 0.885, 9.514, -1.082 ], "form": ".", "ssZp": 1.977, "Dp": 1.926, "splay_angle": 21.052, "splay_distance": 3.942, "splay_ratio": 0.189, "d22": 4.421, "d64": 4.611, "eta": -171.810, "theta": -139.779, "eta_prime": -169.326, "theta_prime": -142.774, "eta_base": -135.078, "theta_base": -128.833, "v0": -7.538, "v1": 25.081, "v2": -32.029, "v3": 28.480, "v4": -13.400, "amplitude": 32.170, "phase_angle": 185.367, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "22t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.004, "origin": [ 154.183, 181.249, 114.557 ], "x_axis": [ -0.059, -0.886, 0.459 ], "y_axis": [ 0.998, -0.055, 0.022 ], "z_axis": [ 0.006, 0.460, 0.888 ], "quaternion": [ 0.666, -0.164, -0.170, -0.708 ] } }, { "index": 29, "index_chain": 29, "chain_name": "I", "nt_resnum": 40, "nt_name": "DT", "nt_code": "T", "nt_id": "///I/40", "linked_nts": [ "///I/39", "///I/41" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,BI,canonical,non-pair-contact,helix,stem", "alpha": -56.641, "beta": 169.102, "gamma": 12.802, "delta": 103.595, "epsilon": -177.061, "zeta": -88.575, "epsilon_zeta": -88.487, "bb_type": "BI", "chi": -118.450, "glyco_bond": "anti", "C5prime_xyz": [ -3.005, 8.441, -1.842 ], "P_xyz": [ -1.594, 10.636, -2.024 ], "form": "B", "ssZp": 2.774, "Dp": 2.943, "splay_angle": 23.732, "splay_distance": 4.106, "splay_ratio": 0.206, "d22": null, "d64": null, "eta": 134.506, "theta": -163.108, "eta_prime": 166.006, "theta_prime": -158.748, "eta_base": -167.928, "theta_base": -106.867, "v0": -38.829, "v1": 27.409, "v2": -6.786, "v3": -15.206, "v4": 34.078, "amplitude": 38.144, "phase_angle": 100.247, "puckering": "O4'-endo", "sugar_class": "--", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.105, "frame": { "rmsd": 0.005, "origin": [ 152.710, 183.298, 117.586 ], "x_axis": [ 0.284, -0.900, 0.332 ], "y_axis": [ 0.959, 0.258, -0.121 ], "z_axis": [ 0.023, 0.352, 0.936 ], "quaternion": [ 0.787, -0.150, -0.098, -0.590 ] } }, { "index": 30, "index_chain": 30, "chain_name": "I", "nt_resnum": 41, "nt_name": "DA", "nt_code": "A", "nt_id": "///I/41", "linked_nts": [ "///I/40", "///I/42" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -46.974, "beta": 156.715, "gamma": 61.772, "delta": 109.773, "epsilon": -152.490, "zeta": -106.783, "epsilon_zeta": -45.707, "bb_type": "BI", "chi": -134.744, "glyco_bond": "anti", "C5prime_xyz": [ -2.667, 8.762, -1.119 ], "P_xyz": [ -0.375, 9.987, -1.399 ], "form": "B", "ssZp": 2.662, "Dp": 2.682, "splay_angle": 19.823, "splay_distance": 3.475, "splay_ratio": 0.173, "d22": null, "d64": null, "eta": -174.159, "theta": -153.509, "eta_prime": -152.142, "theta_prime": -163.759, "eta_base": -97.177, "theta_base": -134.903, "v0": -37.285, "v1": 29.734, "v2": -11.908, "v3": -9.021, "v4": 29.109, "amplitude": 36.181, "phase_angle": 109.216, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "33p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.004, "origin": [ 154.229, 182.612, 121.338 ], "x_axis": [ 0.823, -0.560, 0.099 ], "y_axis": [ 0.567, 0.793, -0.224 ], "z_axis": [ 0.047, 0.241, 0.969 ], "quaternion": [ 0.947, -0.123, -0.014, -0.297 ] } }, { "index": 31, "index_chain": 31, "chain_name": "I", "nt_resnum": 42, "nt_name": "DC", "nt_code": "C", "nt_id": "///I/42", "linked_nts": [ "///I/41", "///I/43" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix-end,stem-end,internal-loop", "alpha": -58.740, "beta": 156.491, "gamma": 41.842, "delta": 84.102, "epsilon": -114.744, "zeta": -138.596, "epsilon_zeta": 23.852, "bb_type": "--", "chi": -139.122, "glyco_bond": "anti", "C5prime_xyz": [ -2.334, 8.938, -0.966 ], "P_xyz": [ -0.038, 10.121, -1.344 ], "form": ".", "ssZp": 2.771, "Dp": 3.912, "splay_angle": 32.848, "splay_distance": 5.791, "splay_ratio": 0.319, "d22": 6.476, "d64": 5.483, "eta": 170.410, "theta": -174.581, "eta_prime": 174.616, "theta_prime": -154.586, "eta_base": -150.946, "theta_base": -106.099, "v0": -23.020, "v1": -1.185, "v2": 23.041, "v3": -37.124, "v4": 38.277, "amplitude": 39.104, "phase_angle": 53.897, "puckering": "C4'-exo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.062, "frame": { "rmsd": 0.004, "origin": [ 153.785, 182.830, 124.778 ], "x_axis": [ 0.995, -0.092, -0.031 ], "y_axis": [ 0.085, 0.980, -0.182 ], "z_axis": [ 0.047, 0.179, 0.983 ], "quaternion": [ 0.995, -0.091, 0.020, -0.044 ] } }, { "index": 32, "index_chain": 32, "chain_name": "I", "nt_resnum": 43, "nt_name": "DC", "nt_code": "C", "nt_id": "///I/43", "linked_nts": [ "///I/42", "///I/44" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,non-stack,non-pair-contact,internal-loop", "alpha": -44.088, "beta": 111.428, "gamma": 85.433, "delta": 144.962, "epsilon": -140.536, "zeta": -154.056, "epsilon_zeta": 13.520, "bb_type": "--", "chi": -96.556, "glyco_bond": "anti", "C5prime_xyz": [ -2.272, 8.048, -2.230 ], "P_xyz": [ -0.282, 6.847, -3.431 ], "form": ".", "ssZp": 1.630, "Dp": 1.809, "splay_angle": 24.115, "splay_distance": 4.151, "splay_ratio": 0.214, "d22": null, "d64": null, "eta": 176.853, "theta": -151.102, "eta_prime": -128.057, "theta_prime": 164.032, "eta_base": -97.910, "theta_base": 176.898, "v0": -21.322, "v1": 35.799, "v2": -35.841, "v3": 24.500, "v4": -2.237, "amplitude": 37.176, "phase_angle": 164.600, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.002, "origin": [ 155.514, 186.992, 128.415 ], "x_axis": [ 0.855, 0.518, -0.024 ], "y_axis": [ -0.512, 0.850, 0.123 ], "z_axis": [ 0.085, -0.093, 0.992 ], "quaternion": [ 0.961, 0.056, 0.028, 0.268 ] } }, { "index": 33, "index_chain": 33, "chain_name": "I", "nt_resnum": 44, "nt_name": "DA", "nt_code": "A", "nt_id": "///I/44", "linked_nts": [ "///I/43", "///I/45" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,BI,non-pair-contact,internal-loop", "alpha": -66.880, "beta": 153.363, "gamma": 42.639, "delta": 142.668, "epsilon": 177.990, "zeta": -97.256, "epsilon_zeta": -84.754, "bb_type": "BI", "chi": -114.761, "glyco_bond": "anti", "C5prime_xyz": [ -2.093, 8.459, -1.494 ], "P_xyz": [ 0.405, 9.160, -1.116 ], "form": "B", "ssZp": 2.220, "Dp": 2.246, "splay_angle": 23.502, "splay_distance": 3.815, "splay_ratio": 0.204, "d22": null, "d64": null, "eta": 148.494, "theta": -125.133, "eta_prime": 171.003, "theta_prime": -146.248, "eta_base": -172.118, "theta_base": -82.841, "v0": -23.874, "v1": 37.183, "v2": -35.574, "v3": 22.704, "v4": 0.488, "amplitude": 37.746, "phase_angle": 160.468, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "4b", "suiteness": 0.068, "filter_rmsd": 0.037, "frame": { "rmsd": 0.003, "origin": [ 153.542, 185.121, 131.552 ], "x_axis": [ 0.642, 0.733, -0.222 ], "y_axis": [ -0.735, 0.672, 0.091 ], "z_axis": [ 0.216, 0.105, 0.971 ], "quaternion": [ 0.906, -0.004, 0.121, 0.405 ] } }, { "index": 34, "index_chain": 34, "chain_name": "I", "nt_resnum": 45, "nt_name": "DA", "nt_code": "A", "nt_id": "///I/45", "linked_nts": [ "///I/44", "///I/46" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,internal-loop", "alpha": -67.378, "beta": 175.816, "gamma": 61.713, "delta": 142.350, "epsilon": -160.753, "zeta": -140.009, "epsilon_zeta": -20.744, "bb_type": "--", "chi": -116.218, "glyco_bond": "anti", "C5prime_xyz": [ -2.074, 8.503, -1.456 ], "P_xyz": [ 0.359, 9.425, -1.158 ], "form": "B", "ssZp": 1.894, "Dp": 1.989, "splay_angle": 21.692, "splay_distance": 3.608, "splay_ratio": 0.188, "d22": null, "d64": null, "eta": 169.930, "theta": -141.642, "eta_prime": -156.506, "theta_prime": -159.205, "eta_base": -83.592, "theta_base": -126.554, "v0": -24.789, "v1": 38.037, "v2": -36.253, "v3": 22.918, "v4": 0.857, "amplitude": 38.597, "phase_angle": 159.930, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.004, "origin": [ 154.715, 187.454, 134.334 ], "x_axis": [ -0.180, 0.981, -0.074 ], "y_axis": [ -0.956, -0.156, 0.250 ], "z_axis": [ 0.233, 0.116, 0.965 ], "quaternion": [ 0.638, 0.052, 0.121, 0.759 ] } }, { "index": 35, "index_chain": 35, "chain_name": "I", "nt_resnum": 46, "nt_name": "DA", "nt_code": "A", "nt_id": "///I/46", "linked_nts": [ "///I/45", "///I/47" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": 34.452, "beta": 176.226, "gamma": -47.748, "delta": 163.288, "epsilon": 179.804, "zeta": -101.850, "epsilon_zeta": -78.346, "bb_type": "BI", "chi": -100.879, "glyco_bond": "anti", "C5prime_xyz": [ -1.053, 7.594, -1.708 ], "P_xyz": [ 0.760, 9.466, -1.591 ], "form": "B", "ssZp": 1.447, "Dp": 1.623, "splay_angle": 21.107, "splay_distance": 3.510, "splay_ratio": 0.184, "d22": null, "d64": null, "eta": 176.636, "theta": -150.605, "eta_prime": -166.327, "theta_prime": -155.106, "eta_base": -129.697, "theta_base": -111.566, "v0": 6.499, "v1": 18.780, "v2": -35.308, "v3": 40.048, "v4": -29.560, "amplitude": 39.920, "phase_angle": 207.814, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "22m", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.003, "origin": [ 156.190, 187.376, 137.626 ], "x_axis": [ -0.720, 0.691, 0.067 ], "y_axis": [ -0.660, -0.711, 0.244 ], "z_axis": [ 0.216, 0.132, 0.968 ], "quaternion": [ 0.366, 0.076, 0.102, 0.922 ] } }, { "index": 36, "index_chain": 36, "chain_name": "I", "nt_resnum": 47, "nt_name": "DA", "nt_code": "A", "nt_id": "///I/47", "linked_nts": [ "///I/46", "///I/48" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -63.783, "beta": 178.577, "gamma": 49.958, "delta": 146.971, "epsilon": -140.871, "zeta": -142.473, "epsilon_zeta": 1.602, "bb_type": "--", "chi": -102.538, "glyco_bond": "anti", "C5prime_xyz": [ -2.144, 8.149, -2.000 ], "P_xyz": [ 0.252, 9.199, -1.865 ], "form": "B", "ssZp": 1.536, "Dp": 1.664, "splay_angle": 20.162, "splay_distance": 3.427, "splay_ratio": 0.177, "d22": null, "d64": null, "eta": 172.790, "theta": -150.709, "eta_prime": -160.053, "theta_prime": -162.910, "eta_base": -115.988, "theta_base": -126.503, "v0": -21.630, "v1": 37.277, "v2": -37.973, "v3": 26.502, "v4": -3.327, "amplitude": 39.131, "phase_angle": 166.029, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.037, "frame": { "rmsd": 0.004, "origin": [ 156.642, 187.466, 141.106 ], "x_axis": [ -0.974, 0.157, 0.165 ], "y_axis": [ -0.134, -0.980, 0.145 ], "z_axis": [ 0.185, 0.119, 0.975 ], "quaternion": [ 0.073, 0.088, 0.067, 0.991 ] } }, { "index": 37, "index_chain": 37, "chain_name": "I", "nt_resnum": 48, "nt_name": "DG", "nt_code": "G", "nt_id": "///I/48", "linked_nts": [ "///I/47", "///I/49" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -57.424, "beta": 145.552, "gamma": 46.755, "delta": 128.043, "epsilon": -167.305, "zeta": -104.304, "epsilon_zeta": -63.001, "bb_type": "BI", "chi": -115.829, "glyco_bond": "anti", "C5prime_xyz": [ -2.385, 8.530, -1.698 ], "P_xyz": [ 0.113, 9.289, -1.779 ], "form": "B", "ssZp": 2.319, "Dp": 2.374, "splay_angle": 22.786, "splay_distance": 3.958, "splay_ratio": 0.199, "d22": null, "d64": null, "eta": 160.617, "theta": -135.929, "eta_prime": -176.920, "theta_prime": -152.542, "eta_base": -135.666, "theta_base": -117.489, "v0": -30.573, "v1": 35.071, "v2": -26.346, "v3": 9.533, "v4": 13.000, "amplitude": 34.617, "phase_angle": 139.558, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.006, "frame": { "rmsd": 0.006, "origin": [ 157.870, 187.553, 144.305 ], "x_axis": [ -0.906, -0.387, 0.169 ], "y_axis": [ 0.398, -0.917, 0.032 ], "z_axis": [ 0.142, 0.097, 0.985 ], "quaternion": [ -0.201, 0.080, 0.033, 0.976 ] } }, { "index": 38, "index_chain": 38, "chain_name": "I", "nt_resnum": 49, "nt_name": "DT", "nt_code": "T", "nt_id": "///I/49", "linked_nts": [ "///I/48", "///I/50" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -52.682, "beta": 168.585, "gamma": 46.867, "delta": 120.484, "epsilon": -156.910, "zeta": -99.352, "epsilon_zeta": -57.558, "bb_type": "BI", "chi": -121.033, "glyco_bond": "anti", "C5prime_xyz": [ -2.613, 8.583, -1.578 ], "P_xyz": [ -0.448, 10.046, -1.619 ], "form": "B", "ssZp": 2.460, "Dp": 2.488, "splay_angle": 19.773, "splay_distance": 3.462, "splay_ratio": 0.172, "d22": null, "d64": null, "eta": 175.137, "theta": -142.795, "eta_prime": -166.571, "theta_prime": -152.263, "eta_base": -124.339, "theta_base": -116.527, "v0": -35.610, "v1": 35.073, "v2": -21.618, "v3": 1.859, "v4": 21.041, "amplitude": 36.331, "phase_angle": 126.515, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.002, "origin": [ 157.654, 187.873, 148.244 ], "x_axis": [ -0.550, -0.828, 0.106 ], "y_axis": [ 0.828, -0.558, -0.062 ], "z_axis": [ 0.110, 0.053, 0.992 ], "quaternion": [ -0.470, 0.061, -0.002, 0.880 ] } }, { "index": 39, "index_chain": 39, "chain_name": "I", "nt_resnum": 50, "nt_name": "DG", "nt_code": "G", "nt_id": "///I/50", "linked_nts": [ "///I/49", "///I/51" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -72.858, "beta": 161.087, "gamma": 55.039, "delta": 98.543, "epsilon": -175.269, "zeta": -84.166, "epsilon_zeta": -91.103, "bb_type": "BI", "chi": -137.073, "glyco_bond": "anti", "C5prime_xyz": [ -2.488, 8.862, -1.091 ], "P_xyz": [ -0.204, 10.108, -1.356 ], "form": ".", "ssZp": 3.069, "Dp": 3.154, "splay_angle": 24.782, "splay_distance": 4.429, "splay_ratio": 0.218, "d22": null, "d64": null, "eta": 156.800, "theta": -130.572, "eta_prime": 174.935, "theta_prime": -145.742, "eta_base": -139.571, "theta_base": -119.283, "v0": -32.822, "v1": 17.812, "v2": 2.328, "v3": -21.146, "v4": 34.187, "amplitude": 34.509, "phase_angle": 86.132, "puckering": "O4'-endo", "sugar_class": "--", "bin": "23p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.006, "frame": { "rmsd": 0.006, "origin": [ 157.442, 187.464, 151.675 ], "x_axis": [ -0.038, -0.971, -0.237 ], "y_axis": [ 0.997, -0.021, -0.076 ], "z_axis": [ 0.069, -0.239, 0.969 ], "quaternion": [ 0.691, 0.059, 0.111, -0.712 ] } }, { "index": 40, "index_chain": 40, "chain_name": "I", "nt_resnum": 51, "nt_name": "DT", "nt_code": "T", "nt_id": "///I/51", "linked_nts": [ "///I/50", "///I/52" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": 164.785, "beta": -166.245, "gamma": 169.349, "delta": 91.108, "epsilon": -150.107, "zeta": -81.383, "epsilon_zeta": -68.724, "bb_type": "BI", "chi": -157.266, "glyco_bond": "anti", "C5prime_xyz": [ -2.142, 8.996, -0.002 ], "P_xyz": [ -0.738, 10.387, -1.729 ], "form": "B", "ssZp": 3.610, "Dp": 3.719, "splay_angle": 19.615, "splay_distance": 3.333, "splay_ratio": 0.170, "d22": null, "d64": null, "eta": 171.891, "theta": -174.679, "eta_prime": -176.520, "theta_prime": -169.231, "eta_base": -139.505, "theta_base": -132.406, "v0": -23.821, "v1": 3.758, "v2": 15.951, "v3": -30.109, "v4": 34.322, "amplitude": 33.885, "phase_angle": 61.917, "puckering": "C4'-exo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.189, "filter_rmsd": 0.105, "frame": { "rmsd": 0.003, "origin": [ 157.057, 185.232, 155.481 ], "x_axis": [ 0.444, -0.810, -0.382 ], "y_axis": [ 0.891, 0.444, 0.094 ], "z_axis": [ 0.094, -0.382, 0.919 ], "quaternion": [ 0.838, 0.142, 0.142, -0.508 ] } }, { "index": 41, "index_chain": 41, "chain_name": "I", "nt_resnum": 52, "nt_name": "DA", "nt_code": "A", "nt_id": "///I/52", "linked_nts": [ "///I/51", "///I/53" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -73.362, "beta": 159.436, "gamma": 67.027, "delta": 95.466, "epsilon": -159.975, "zeta": -74.541, "epsilon_zeta": -85.434, "bb_type": "BI", "chi": -148.468, "glyco_bond": "anti", "C5prime_xyz": [ -2.027, 8.929, -0.402 ], "P_xyz": [ 0.460, 9.722, -0.683 ], "form": ".", "ssZp": 3.449, "Dp": 3.599, "splay_angle": 21.103, "splay_distance": 3.706, "splay_ratio": 0.185, "d22": null, "d64": null, "eta": 165.554, "theta": -140.786, "eta_prime": -174.035, "theta_prime": -146.101, "eta_base": -129.321, "theta_base": -119.260, "v0": -22.917, "v1": 5.800, "v2": 11.926, "v3": -25.354, "v4": 30.662, "amplitude": 30.004, "phase_angle": 66.580, "puckering": "C4'-exo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.296, "filter_rmsd": 0.038, "frame": { "rmsd": 0.004, "origin": [ 157.290, 183.333, 158.210 ], "x_axis": [ 0.862, -0.383, -0.333 ], "y_axis": [ 0.496, 0.775, 0.391 ], "z_axis": [ 0.108, -0.502, 0.858 ], "quaternion": [ 0.935, 0.239, 0.118, -0.235 ] } }, { "index": 42, "index_chain": 42, "chain_name": "I", "nt_resnum": 53, "nt_name": "DT", "nt_code": "T", "nt_id": "///I/53", "linked_nts": [ "///I/52", "///I/54" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -65.554, "beta": 165.298, "gamma": 62.530, "delta": 93.062, "epsilon": -173.965, "zeta": -85.547, "epsilon_zeta": -88.418, "bb_type": "BI", "chi": -144.303, "glyco_bond": "anti", "C5prime_xyz": [ -2.499, 8.929, -0.765 ], "P_xyz": [ -0.238, 10.226, -1.032 ], "form": "B", "ssZp": 3.305, "Dp": 3.364, "splay_angle": 21.982, "splay_distance": 3.663, "splay_ratio": 0.191, "d22": 4.710, "d64": 4.161, "eta": 170.677, "theta": -162.549, "eta_prime": -167.452, "theta_prime": -160.340, "eta_base": -128.426, "theta_base": -122.259, "v0": -31.216, "v1": 12.654, "v2": 8.965, "v3": -27.096, "v4": 36.996, "amplitude": 36.206, "phase_angle": 75.663, "puckering": "O4'-endo", "sugar_class": "--", "bin": "33p", "cluster": "1a", "suiteness": 0.325, "filter_rmsd": 0.105, "frame": { "rmsd": 0.003, "origin": [ 158.023, 180.617, 160.623 ], "x_axis": [ 0.991, 0.061, -0.120 ], "y_axis": [ 0.020, 0.813, 0.582 ], "z_axis": [ 0.133, -0.579, 0.804 ], "quaternion": [ 0.950, 0.306, 0.067, 0.011 ] } }, { "index": 43, "index_chain": 43, "chain_name": "I", "nt_resnum": 54, "nt_name": "DT", "nt_code": "T", "nt_id": "///I/54", "linked_nts": [ "///I/53", "///I/55" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -55.940, "beta": 173.114, "gamma": 59.257, "delta": 135.581, "epsilon": -157.035, "zeta": -114.196, "epsilon_zeta": -42.838, "bb_type": "BI", "chi": -120.046, "glyco_bond": "anti", "C5prime_xyz": [ -2.038, 8.585, -1.375 ], "P_xyz": [ 0.438, 9.423, -1.174 ], "form": "B", "ssZp": 2.200, "Dp": 2.211, "splay_angle": 24.223, "splay_distance": 4.040, "splay_ratio": 0.211, "d22": 5.021, "d64": 4.275, "eta": 179.591, "theta": -139.788, "eta_prime": -153.063, "theta_prime": -148.658, "eta_base": -111.906, "theta_base": -108.987, "v0": -25.524, "v1": 34.833, "v2": -30.510, "v3": 16.564, "v4": 5.412, "amplitude": 34.445, "phase_angle": 152.344, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1b", "suiteness": 0.371, "filter_rmsd": 0.105, "frame": { "rmsd": 0.003, "origin": [ 159.041, 178.447, 163.393 ], "x_axis": [ 0.819, 0.515, 0.255 ], "y_axis": [ -0.549, 0.569, 0.613 ], "z_axis": [ 0.170, -0.641, 0.748 ], "quaternion": [ 0.885, 0.354, -0.024, 0.300 ] } }, { "index": 44, "index_chain": 44, "chain_name": "I", "nt_resnum": 55, "nt_name": "DT", "nt_code": "T", "nt_id": "///I/55", "linked_nts": [ "///I/54", "///I/56" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -59.186, "beta": 165.989, "gamma": 53.972, "delta": 142.263, "epsilon": -139.241, "zeta": -151.993, "epsilon_zeta": 12.752, "bb_type": "--", "chi": -104.678, "glyco_bond": "anti", "C5prime_xyz": [ -2.417, 8.254, -1.953 ], "P_xyz": [ 0.037, 9.145, -2.158 ], "form": ".", "ssZp": 1.790, "Dp": 1.836, "splay_angle": 24.196, "splay_distance": 4.167, "splay_ratio": 0.228, "d22": null, "d64": null, "eta": 176.958, "theta": -165.259, "eta_prime": -156.323, "theta_prime": -170.938, "eta_base": -113.932, "theta_base": -121.002, "v0": -26.699, "v1": 39.453, "v2": -36.453, "v3": 22.036, "v4": 2.653, "amplitude": 39.493, "phase_angle": 157.370, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.105, "frame": { "rmsd": 0.003, "origin": [ 159.620, 176.328, 166.784 ], "x_axis": [ 0.313, 0.738, 0.598 ], "y_axis": [ -0.929, 0.106, 0.355 ], "z_axis": [ 0.198, -0.667, 0.718 ], "quaternion": [ 0.731, 0.349, -0.137, 0.570 ] } }, { "index": 45, "index_chain": 45, "chain_name": "I", "nt_resnum": 56, "nt_name": "DG", "nt_code": "G", "nt_id": "///I/56", "linked_nts": [ "///I/55", "///I/57" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -67.892, "beta": 149.785, "gamma": 61.004, "delta": 148.737, "epsilon": -176.043, "zeta": -110.279, "epsilon_zeta": -65.765, "bb_type": "BI", "chi": -106.984, "glyco_bond": "anti", "C5prime_xyz": [ -1.687, 8.225, -1.742 ], "P_xyz": [ 0.929, 8.034, -1.803 ], "form": "B", "ssZp": 1.913, "Dp": 1.965, "splay_angle": 19.574, "splay_distance": 3.239, "splay_ratio": 0.170, "d22": null, "d64": null, "eta": 157.062, "theta": -122.063, "eta_prime": -165.823, "theta_prime": -157.157, "eta_base": -116.218, "theta_base": -111.984, "v0": -12.996, "v1": 30.592, "v2": -35.580, "v3": 28.955, "v4": -10.268, "amplitude": 35.608, "phase_angle": 177.718, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "4b", "suiteness": 0.024, "filter_rmsd": 0.005, "frame": { "rmsd": 0.005, "origin": [ 158.651, 173.365, 169.549 ], "x_axis": [ -0.387, 0.624, 0.679 ], "y_axis": [ -0.905, -0.399, -0.150 ], "z_axis": [ 0.177, -0.672, 0.719 ], "quaternion": [ 0.483, 0.270, -0.260, 0.791 ] } }, { "index": 46, "index_chain": 46, "chain_name": "I", "nt_resnum": 57, "nt_name": "DG", "nt_code": "G", "nt_id": "///I/57", "linked_nts": [ "///I/56", "///I/58" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -60.511, "beta": 172.211, "gamma": 52.395, "delta": 144.750, "epsilon": -153.954, "zeta": -133.982, "epsilon_zeta": -19.973, "bb_type": "--", "chi": -112.040, "glyco_bond": "anti", "C5prime_xyz": [ -2.085, 8.459, -1.599 ], "P_xyz": [ 0.346, 9.391, -1.297 ], "form": "B", "ssZp": 1.889, "Dp": 1.933, "splay_angle": 20.644, "splay_distance": 3.436, "splay_ratio": 0.185, "d22": null, "d64": null, "eta": 169.745, "theta": -150.578, "eta_prime": -163.443, "theta_prime": -161.134, "eta_base": -110.725, "theta_base": -115.713, "v0": -23.336, "v1": 37.800, "v2": -37.117, "v3": 24.615, "v4": -1.064, "amplitude": 38.864, "phase_angle": 162.756, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.005, "frame": { "rmsd": 0.005, "origin": [ 158.881, 171.341, 172.067 ], "x_axis": [ -0.872, 0.261, 0.415 ], "y_axis": [ -0.466, -0.701, -0.539 ], "z_axis": [ 0.150, -0.664, 0.733 ], "quaternion": [ 0.200, 0.155, -0.331, 0.909 ] } }, { "index": 47, "index_chain": 47, "chain_name": "I", "nt_resnum": 58, "nt_name": "DA", "nt_code": "A", "nt_id": "///I/58", "linked_nts": [ "///I/57", "///I/59" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -59.008, "beta": 164.548, "gamma": 47.456, "delta": 145.146, "epsilon": -158.350, "zeta": -119.643, "epsilon_zeta": -38.707, "bb_type": "BI", "chi": -108.273, "glyco_bond": "anti", "C5prime_xyz": [ -1.736, 8.225, -1.739 ], "P_xyz": [ 0.824, 8.700, -1.439 ], "form": "B", "ssZp": 1.823, "Dp": 1.951, "splay_angle": 21.811, "splay_distance": 3.672, "splay_ratio": 0.191, "d22": null, "d64": null, "eta": 168.124, "theta": -134.877, "eta_prime": -168.189, "theta_prime": -151.540, "eta_base": -119.370, "theta_base": -114.946, "v0": -14.813, "v1": 30.375, "v2": -33.580, "v3": 25.872, "v4": -7.188, "amplitude": 33.811, "phase_angle": 173.307, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.004, "origin": [ 159.510, 168.550, 173.971 ], "x_axis": [ -0.970, -0.235, -0.062 ], "y_axis": [ 0.213, -0.703, -0.678 ], "z_axis": [ 0.116, -0.671, 0.732 ], "quaternion": [ -0.121, 0.015, -0.366, 0.923 ] } }, { "index": 48, "index_chain": 48, "chain_name": "I", "nt_resnum": 59, "nt_name": "DA", "nt_code": "A", "nt_id": "///I/59", "linked_nts": [ "///I/58", "///I/60" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -56.882, "beta": 163.082, "gamma": 48.054, "delta": 135.754, "epsilon": -152.963, "zeta": -101.652, "epsilon_zeta": -51.311, "bb_type": "BI", "chi": -108.745, "glyco_bond": "anti", "C5prime_xyz": [ -2.223, 8.303, -1.875 ], "P_xyz": [ 0.247, 9.166, -1.927 ], "form": "B", "ssZp": 2.006, "Dp": 2.136, "splay_angle": 21.230, "splay_distance": 3.734, "splay_ratio": 0.185, "d22": null, "d64": null, "eta": 169.591, "theta": -124.523, "eta_prime": -166.788, "theta_prime": -143.056, "eta_base": -124.993, "theta_base": -109.942, "v0": -24.776, "v1": 34.297, "v2": -30.399, "v3": 16.939, "v4": 4.682, "amplitude": 33.993, "phase_angle": 153.417, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.003, "origin": [ 160.225, 165.823, 176.325 ], "x_axis": [ -0.685, -0.560, -0.466 ], "y_axis": [ 0.725, -0.458, -0.515 ], "z_axis": [ 0.075, -0.691, 0.719 ], "quaternion": [ -0.380, -0.116, -0.357, 0.846 ] } }, { "index": 49, "index_chain": 49, "chain_name": "I", "nt_resnum": 60, "nt_name": "DA", "nt_code": "A", "nt_id": "///I/60", "linked_nts": [ "///I/59", "///I/61" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -63.716, "beta": 159.865, "gamma": 41.851, "delta": 97.073, "epsilon": -173.267, "zeta": -83.678, "epsilon_zeta": -89.589, "bb_type": "BI", "chi": -126.175, "glyco_bond": "anti", "C5prime_xyz": [ -2.762, 8.586, -1.587 ], "P_xyz": [ -0.635, 10.028, -2.077 ], "form": "B", "ssZp": 2.924, "Dp": 3.233, "splay_angle": 20.637, "splay_distance": 3.587, "splay_ratio": 0.179, "d22": null, "d64": null, "eta": 153.221, "theta": -159.676, "eta_prime": 172.548, "theta_prime": -167.849, "eta_base": -143.797, "theta_base": -133.485, "v0": -33.616, "v1": 17.451, "v2": 3.738, "v3": -23.077, "v4": 35.875, "amplitude": 35.943, "phase_angle": 84.030, "puckering": "O4'-endo", "sugar_class": "--", "bin": "23p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.004, "origin": [ 159.968, 162.721, 178.387 ], "x_axis": [ -0.227, -0.494, -0.839 ], "y_axis": [ 0.974, -0.124, -0.191 ], "z_axis": [ -0.010, -0.860, 0.509 ], "quaternion": [ 0.538, 0.311, 0.385, -0.682 ] } }, { "index": 50, "index_chain": 50, "chain_name": "I", "nt_resnum": 61, "nt_name": "DC", "nt_code": "C", "nt_id": "///I/61", "linked_nts": [ "///I/60", "///I/62" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -81.675, "beta": 158.006, "gamma": 75.535, "delta": 80.792, "epsilon": -160.225, "zeta": -69.236, "epsilon_zeta": -90.988, "bb_type": "BI", "chi": -154.563, "glyco_bond": "anti", "C5prime_xyz": [ -2.118, 9.070, -0.099 ], "P_xyz": [ 0.163, 10.057, -0.914 ], "form": ".", "ssZp": 4.003, "Dp": 4.185, "splay_angle": 23.249, "splay_distance": 3.980, "splay_ratio": 0.203, "d22": 4.217, "d64": 4.462, "eta": 165.129, "theta": -152.140, "eta_prime": 175.593, "theta_prime": -155.232, "eta_base": -139.468, "theta_base": -128.320, "v0": -18.000, "v1": -8.006, "v2": 29.081, "v3": -40.445, "v4": 37.080, "amplitude": 40.674, "phase_angle": 44.358, "puckering": "C4'-exo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.075, "filter_rmsd": 0.063, "frame": { "rmsd": 0.005, "origin": [ 159.426, 159.427, 179.700 ], "x_axis": [ 0.286, -0.432, -0.856 ], "y_axis": [ 0.958, 0.108, 0.265 ], "z_axis": [ -0.023, -0.895, 0.444 ], "quaternion": [ 0.678, 0.428, 0.307, -0.513 ] } }, { "index": 51, "index_chain": 51, "chain_name": "I", "nt_resnum": 62, "nt_name": "DT", "nt_code": "T", "nt_id": "///I/62", "linked_nts": [ "///I/61", "///I/63" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -76.542, "beta": 162.460, "gamma": 78.798, "delta": 83.700, "epsilon": -156.140, "zeta": -84.055, "epsilon_zeta": -72.084, "bb_type": "BI", "chi": -162.427, "glyco_bond": "anti", "C5prime_xyz": [ -2.140, 8.992, 0.334 ], "P_xyz": [ 0.226, 10.056, -0.057 ], "form": ".", "ssZp": 4.038, "Dp": 4.091, "splay_angle": 18.587, "splay_distance": 3.016, "splay_ratio": 0.163, "d22": null, "d64": null, "eta": 175.687, "theta": -161.181, "eta_prime": -167.811, "theta_prime": -154.637, "eta_base": -128.264, "theta_base": -125.535, "v0": -18.677, "v1": -5.593, "v2": 25.872, "v3": -37.454, "v4": 35.707, "amplitude": 38.140, "phase_angle": 47.285, "puckering": "C4'-exo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.160, "filter_rmsd": 0.105, "frame": { "rmsd": 0.004, "origin": [ 158.700, 155.532, 180.082 ], "x_axis": [ 0.717, -0.277, -0.640 ], "y_axis": [ 0.697, 0.268, 0.665 ], "z_axis": [ -0.012, -0.923, 0.385 ], "quaternion": [ 0.770, 0.516, 0.204, -0.316 ] } }, { "index": 52, "index_chain": 52, "chain_name": "I", "nt_resnum": 63, "nt_name": "DG", "nt_code": "G", "nt_id": "///I/63", "linked_nts": [ "///I/62", "///I/64" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -67.088, "beta": 176.280, "gamma": 63.683, "delta": 140.664, "epsilon": -171.565, "zeta": -95.023, "epsilon_zeta": -76.542, "bb_type": "BI", "chi": -119.531, "glyco_bond": "anti", "C5prime_xyz": [ -1.727, 8.542, -1.269 ], "P_xyz": [ 0.837, 9.013, -0.997 ], "form": "B", "ssZp": 2.261, "Dp": 2.228, "splay_angle": 20.168, "splay_distance": 3.496, "splay_ratio": 0.177, "d22": null, "d64": null, "eta": 166.610, "theta": -122.107, "eta_prime": -160.023, "theta_prime": -142.970, "eta_base": -125.462, "theta_base": -101.403, "v0": -17.982, "v1": 30.762, "v2": -31.134, "v3": 21.541, "v4": -2.428, "amplitude": 32.157, "phase_angle": 165.503, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1b", "suiteness": 0.784, "filter_rmsd": 0.008, "frame": { "rmsd": 0.008, "origin": [ 158.585, 152.597, 180.768 ], "x_axis": [ 0.981, 0.061, -0.186 ], "y_axis": [ 0.175, 0.147, 0.974 ], "z_axis": [ 0.087, -0.987, 0.133 ], "quaternion": [ 0.752, 0.652, 0.091, -0.038 ] } }, { "index": 53, "index_chain": 53, "chain_name": "I", "nt_resnum": 64, "nt_name": "DC", "nt_code": "C", "nt_id": "///I/64", "linked_nts": [ "///I/63", "///I/65" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -60.925, "beta": 172.566, "gamma": 50.157, "delta": 125.409, "epsilon": -121.299, "zeta": -164.348, "epsilon_zeta": 43.048, "bb_type": "BII", "chi": -118.195, "glyco_bond": "anti", "C5prime_xyz": [ -2.522, 8.602, -1.626 ], "P_xyz": [ -0.308, 9.995, -1.677 ], "form": ".", "ssZp": 1.804, "Dp": 1.903, "splay_angle": 24.652, "splay_distance": 4.309, "splay_ratio": 0.218, "d22": 5.427, "d64": 4.635, "eta": -176.647, "theta": -154.888, "eta_prime": -156.992, "theta_prime": -161.147, "eta_base": -107.715, "theta_base": -124.055, "v0": -34.385, "v1": 36.931, "v2": -25.525, "v3": 6.521, "v4": 17.269, "amplitude": 36.912, "phase_angle": 133.750, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.003, "origin": [ 159.890, 149.355, 180.850 ], "x_axis": [ 0.890, 0.108, 0.444 ], "y_axis": [ -0.448, 0.018, 0.894 ], "z_axis": [ 0.089, -0.994, 0.065 ], "quaternion": [ 0.702, 0.672, -0.126, 0.198 ] } }, { "index": 54, "index_chain": 54, "chain_name": "I", "nt_resnum": 65, "nt_name": "DT", "nt_code": "T", "nt_id": "///I/65", "linked_nts": [ "///I/64", "///I/66" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": 83.469, "beta": -122.320, "gamma": -154.619, "delta": 151.078, "epsilon": -135.388, "zeta": -107.890, "epsilon_zeta": -27.498, "bb_type": "--", "chi": -129.737, "glyco_bond": "anti", "C5prime_xyz": [ -1.605, 8.611, -0.539 ], "P_xyz": [ -0.025, 9.111, -2.573 ], "form": ".", "ssZp": 1.507, "Dp": 1.538, "splay_angle": 31.531, "splay_distance": 5.215, "splay_ratio": 0.274, "d22": 5.745, "d64": 5.011, "eta": -144.069, "theta": -177.938, "eta_prime": -149.639, "theta_prime": -158.493, "eta_base": -117.005, "theta_base": -104.008, "v0": -17.006, "v1": 34.965, "v2": -38.646, "v3": 29.801, "v4": -8.285, "amplitude": 38.909, "phase_angle": 173.341, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.002, "origin": [ 159.333, 145.137, 181.531 ], "x_axis": [ 0.515, -0.000, 0.857 ], "y_axis": [ -0.855, -0.063, 0.514 ], "z_axis": [ 0.054, -0.998, -0.032 ], "quaternion": [ 0.596, 0.634, -0.337, 0.359 ] } }, { "index": 55, "index_chain": 55, "chain_name": "I", "nt_resnum": 66, "nt_name": "DC", "nt_code": "C", "nt_id": "///I/66", "linked_nts": [ "///I/65", "///I/67" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -65.279, "beta": 158.722, "gamma": 54.528, "delta": 142.552, "epsilon": -155.045, "zeta": -145.332, "epsilon_zeta": -9.713, "bb_type": "--", "chi": -95.920, "glyco_bond": "anti", "C5prime_xyz": [ -2.591, 8.040, -2.288 ], "P_xyz": [ -0.127, 8.695, -2.895 ], "form": ".", "ssZp": 1.995, "Dp": 2.075, "splay_angle": 26.579, "splay_distance": 4.417, "splay_ratio": 0.239, "d22": 5.144, "d64": 4.085, "eta": 157.903, "theta": -161.179, "eta_prime": -157.107, "theta_prime": -174.196, "eta_base": -104.900, "theta_base": -125.738, "v0": -27.203, "v1": 39.978, "v2": -36.743, "v3": 22.052, "v4": 2.936, "amplitude": 39.924, "phase_angle": 156.972, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "2[", "suiteness": 0.010, "filter_rmsd": 0.062, "frame": { "rmsd": 0.004, "origin": [ 158.081, 140.238, 182.805 ], "x_axis": [ -0.313, -0.156, 0.937 ], "y_axis": [ -0.949, 0.004, -0.316 ], "z_axis": [ 0.046, -0.988, -0.149 ], "quaternion": [ -0.368, -0.456, 0.605, -0.539 ] } }, { "index": 56, "index_chain": 56, "chain_name": "I", "nt_resnum": 67, "nt_name": "DC", "nt_code": "C", "nt_id": "///I/67", "linked_nts": [ "///I/66", "///I/68" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop", "alpha": -65.187, "beta": 148.970, "gamma": 68.819, "delta": 145.782, "epsilon": -175.614, "zeta": -101.318, "epsilon_zeta": -74.295, "bb_type": "BI", "chi": -117.059, "glyco_bond": "anti", "C5prime_xyz": [ -1.785, 8.521, -1.341 ], "P_xyz": [ 0.830, 8.462, -1.558 ], "form": "B", "ssZp": 2.134, "Dp": 2.141, "splay_angle": 20.213, "splay_distance": 3.352, "splay_ratio": 0.176, "d22": null, "d64": null, "eta": 159.954, "theta": -116.904, "eta_prime": -163.155, "theta_prime": -152.064, "eta_base": -114.014, "theta_base": -108.299, "v0": -19.905, "v1": 35.010, "v2": -35.896, "v3": 25.355, "v4": -3.661, "amplitude": 36.869, "phase_angle": 166.806, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.062, "frame": { "rmsd": 0.004, "origin": [ 157.001, 136.149, 181.529 ], "x_axis": [ -0.854, -0.049, 0.517 ], "y_axis": [ -0.517, 0.172, -0.838 ], "z_axis": [ -0.048, -0.984, -0.172 ], "quaternion": [ -0.191, -0.191, 0.741, -0.615 ] } }, { "index": 57, "index_chain": 57, "chain_name": "I", "nt_resnum": 68, "nt_name": "DA", "nt_code": "A", "nt_id": "///I/68", "linked_nts": [ "///I/67", "///I/69" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop,phosphate", "alpha": -73.057, "beta": -177.787, "gamma": 53.509, "delta": 140.412, "epsilon": -169.283, "zeta": -107.503, "epsilon_zeta": -61.780, "bb_type": "BI", "chi": -118.298, "glyco_bond": "anti", "C5prime_xyz": [ -2.033, 8.531, -1.369 ], "P_xyz": [ 0.292, 9.615, -0.817 ], "form": "B", "ssZp": 2.140, "Dp": 2.179, "splay_angle": 20.138, "splay_distance": 3.432, "splay_ratio": 0.177, "d22": null, "d64": null, "eta": 160.887, "theta": -138.914, "eta_prime": -170.907, "theta_prime": -151.911, "eta_base": -115.008, "theta_base": -126.021, "v0": -24.147, "v1": 36.314, "v2": -34.051, "v3": 21.031, "v4": 1.710, "amplitude": 36.581, "phase_angle": 158.567, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.037, "frame": { "rmsd": 0.003, "origin": [ 156.263, 132.885, 181.345 ], "x_axis": [ -0.969, 0.219, -0.114 ], "y_axis": [ 0.158, 0.192, -0.969 ], "z_axis": [ -0.190, -0.957, -0.221 ], "quaternion": [ -0.025, 0.122, 0.772, -0.624 ] } }, { "index": 58, "index_chain": 58, "chain_name": "I", "nt_resnum": 69, "nt_name": "DT", "nt_code": "T", "nt_id": "///I/69", "linked_nts": [ "///I/68", "///I/70" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,BI,non-pair-contact,internal-loop", "alpha": -65.036, "beta": -177.639, "gamma": 45.409, "delta": 136.631, "epsilon": 176.930, "zeta": -90.910, "epsilon_zeta": -92.160, "bb_type": "BI", "chi": -108.524, "glyco_bond": "anti", "C5prime_xyz": [ -2.405, 8.337, -1.893 ], "P_xyz": [ -0.245, 9.807, -1.748 ], "form": ".", "ssZp": 2.254, "Dp": 2.288, "splay_angle": 26.797, "splay_distance": 4.529, "splay_ratio": 0.235, "d22": 5.130, "d64": 4.751, "eta": 161.054, "theta": -131.656, "eta_prime": -174.462, "theta_prime": -150.530, "eta_base": -139.631, "theta_base": -113.698, "v0": -28.104, "v1": 37.971, "v2": -33.005, "v3": 17.749, "v4": 6.211, "amplitude": 37.461, "phase_angle": 151.769, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.002, "origin": [ 155.697, 129.512, 181.635 ], "x_axis": [ -0.750, 0.313, -0.583 ], "y_axis": [ 0.613, -0.004, -0.790 ], "z_axis": [ -0.249, -0.950, -0.189 ], "quaternion": [ 0.120, 0.333, 0.695, -0.626 ] } }, { "index": 59, "index_chain": 59, "chain_name": "I", "nt_resnum": 70, "nt_name": "DC", "nt_code": "C", "nt_id": "///I/70", "linked_nts": [ "///I/69", "///I/71" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop", "alpha": -173.589, "beta": 146.785, "gamma": 172.929, "delta": 154.003, "epsilon": -165.879, "zeta": -83.602, "epsilon_zeta": -82.277, "bb_type": "BI", "chi": -123.364, "glyco_bond": "anti", "C5prime_xyz": [ -1.366, 8.493, -0.780 ], "P_xyz": [ 0.034, 9.657, -2.658 ], "form": "B", "ssZp": 1.771, "Dp": 1.831, "splay_angle": 23.898, "splay_distance": 4.073, "splay_ratio": 0.208, "d22": null, "d64": null, "eta": -158.334, "theta": -143.715, "eta_prime": -153.702, "theta_prime": -152.887, "eta_base": -115.423, "theta_base": -118.804, "v0": -11.302, "v1": 31.247, "v2": -38.165, "v3": 32.659, "v4": -13.660, "amplitude": 38.185, "phase_angle": 181.839, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "22t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.003, "origin": [ 153.708, 125.674, 180.285 ], "x_axis": [ -0.176, 0.279, -0.944 ], "y_axis": [ 0.935, -0.252, -0.249 ], "z_axis": [ -0.307, -0.927, -0.217 ], "quaternion": [ 0.298, 0.568, 0.534, -0.550 ] } }, { "index": 60, "index_chain": 60, "chain_name": "I", "nt_resnum": 71, "nt_name": "DA", "nt_code": "A", "nt_id": "///I/71", "linked_nts": [ "///I/70", "///I/72" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": 163.103, "beta": 163.684, "gamma": 162.970, "delta": 139.899, "epsilon": -153.727, "zeta": -100.655, "epsilon_zeta": -53.072, "bb_type": "BI", "chi": -121.563, "glyco_bond": "anti", "C5prime_xyz": [ -1.946, 8.570, -1.179 ], "P_xyz": [ -0.541, 9.461, -3.197 ], "form": "B", "ssZp": 2.053, "Dp": 2.064, "splay_angle": 21.819, "splay_distance": 3.620, "splay_ratio": 0.191, "d22": null, "d64": null, "eta": 162.521, "theta": -153.755, "eta_prime": -170.698, "theta_prime": -164.346, "eta_base": -133.585, "theta_base": -137.014, "v0": -22.573, "v1": 34.522, "v2": -32.762, "v3": 20.624, "v4": 0.970, "amplitude": 34.948, "phase_angle": 159.629, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.037, "frame": { "rmsd": 0.003, "origin": [ 152.356, 122.086, 178.911 ], "x_axis": [ 0.421, 0.220, -0.880 ], "y_axis": [ 0.847, -0.442, 0.295 ], "z_axis": [ -0.324, -0.870, -0.372 ], "quaternion": [ 0.389, 0.748, 0.357, -0.403 ] } }, { "index": 61, "index_chain": 61, "chain_name": "I", "nt_resnum": 72, "nt_name": "DA", "nt_code": "A", "nt_id": "///I/72", "linked_nts": [ "///I/71", "///I/73" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop", "alpha": 166.709, "beta": 158.315, "gamma": 153.755, "delta": 147.979, "epsilon": -145.399, "zeta": -102.230, "epsilon_zeta": -43.169, "bb_type": "BI", "chi": -123.400, "glyco_bond": "anti", "C5prime_xyz": [ -1.238, 8.337, -0.877 ], "P_xyz": [ 0.590, 8.749, -2.703 ], "form": ".", "ssZp": 1.884, "Dp": 1.966, "splay_angle": 27.307, "splay_distance": 4.634, "splay_ratio": 0.250, "d22": null, "d64": null, "eta": 157.692, "theta": -159.485, "eta_prime": -179.738, "theta_prime": -154.769, "eta_base": -149.123, "theta_base": -105.905, "v0": -6.041, "v1": 23.623, "v2": -31.111, "v3": 28.443, "v4": -14.298, "amplitude": 31.400, "phase_angle": 187.777, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "22t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.004, "origin": [ 151.219, 118.759, 178.048 ], "x_axis": [ 0.891, 0.221, -0.397 ], "y_axis": [ 0.444, -0.605, 0.661 ], "z_axis": [ -0.094, -0.765, -0.637 ], "quaternion": [ 0.403, 0.885, 0.188, -0.139 ] } }, { "index": 62, "index_chain": 62, "chain_name": "I", "nt_resnum": 73, "nt_name": "DA", "nt_code": "A", "nt_id": "///I/73", "linked_nts": [ "///I/72", "///I/74" ], "nt_type": "DNA", "dbn": ".", "summary": "~C2'-endo,non-pair-contact,internal-loop", "alpha": -74.615, "beta": 170.410, "gamma": 61.731, "delta": 147.537, "epsilon": -153.382, "zeta": -140.176, "epsilon_zeta": -13.206, "bb_type": "--", "chi": -87.034, "glyco_bond": "--", "C5prime_xyz": [ -2.264, 7.580, -2.574 ], "P_xyz": [ 0.281, 7.880, -3.125 ], "form": ".", "ssZp": 1.457, "Dp": 1.844, "splay_angle": 26.804, "splay_distance": 4.527, "splay_ratio": 0.241, "d22": null, "d64": null, "eta": 161.820, "theta": -150.000, "eta_prime": -155.541, "theta_prime": -166.149, "eta_base": -109.820, "theta_base": -131.704, "v0": -15.508, "v1": 32.078, "v2": -35.571, "v3": 27.550, "v4": -7.807, "amplitude": 35.792, "phase_angle": 173.626, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "2[", "suiteness": 0.010, "filter_rmsd": 0.037, "frame": { "rmsd": 0.003, "origin": [ 152.064, 114.351, 176.895 ], "x_axis": [ 0.951, -0.240, 0.193 ], "y_axis": [ -0.307, -0.678, 0.668 ], "z_axis": [ -0.030, -0.695, -0.719 ], "quaternion": [ 0.372, 0.915, -0.150, 0.045 ] } }, { "index": 63, "index_chain": 63, "chain_name": "I", "nt_resnum": 74, "nt_name": "DA", "nt_code": "A", "nt_id": "///I/74", "linked_nts": [ "///I/73", "///I/75" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop", "alpha": -54.634, "beta": 158.913, "gamma": 53.142, "delta": 142.149, "epsilon": -116.248, "zeta": 174.197, "epsilon_zeta": 69.555, "bb_type": "BII", "chi": -90.380, "glyco_bond": "anti", "C5prime_xyz": [ -2.476, 7.737, -2.510 ], "P_xyz": [ 0.024, 8.219, -3.107 ], "form": ".", "ssZp": 0.882, "Dp": 1.378, "splay_angle": 28.113, "splay_distance": 5.033, "splay_ratio": 0.277, "d22": null, "d64": null, "eta": -166.572, "theta": 169.431, "eta_prime": -152.340, "theta_prime": 164.039, "eta_base": -124.339, "theta_base": -141.217, "v0": -21.479, "v1": 34.739, "v2": -34.197, "v3": 22.706, "v4": -1.031, "amplitude": 35.789, "phase_angle": 162.849, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.037, "frame": { "rmsd": 0.003, "origin": [ 150.841, 110.596, 174.681 ], "x_axis": [ 0.653, -0.550, 0.522 ], "y_axis": [ -0.758, -0.481, 0.441 ], "z_axis": [ 0.009, -0.683, -0.730 ], "quaternion": [ 0.332, 0.846, -0.386, 0.157 ] } }, { "index": 64, "index_chain": 64, "chain_name": "I", "nt_resnum": 75, "nt_name": "DG", "nt_code": "G", "nt_id": "///I/75", "linked_nts": [ "///I/74", "///I/76" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -77.840, "beta": 132.226, "gamma": 66.659, "delta": 147.286, "epsilon": 174.587, "zeta": -91.494, "epsilon_zeta": -93.919, "bb_type": "BI", "chi": -106.929, "glyco_bond": "anti", "C5prime_xyz": [ -1.677, 8.216, -1.760 ], "P_xyz": [ 0.832, 7.524, -2.073 ], "form": "B", "ssZp": 1.941, "Dp": 1.990, "splay_angle": 20.691, "splay_distance": 3.431, "splay_ratio": 0.180, "d22": null, "d64": null, "eta": 147.688, "theta": -102.704, "eta_prime": -163.211, "theta_prime": -159.804, "eta_base": -115.305, "theta_base": -115.154, "v0": -12.468, "v1": 29.448, "v2": -34.341, "v3": 28.010, "v4": -10.013, "amplitude": 34.365, "phase_angle": 177.890, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "4b", "suiteness": 0.154, "filter_rmsd": 0.005, "frame": { "rmsd": 0.005, "origin": [ 147.711, 108.062, 171.661 ], "x_axis": [ 0.015, -0.888, 0.459 ], "y_axis": [ -0.985, 0.067, 0.161 ], "z_axis": [ -0.174, -0.455, -0.874 ], "quaternion": [ -0.228, -0.675, 0.694, -0.106 ] } }, { "index": 65, "index_chain": 65, "chain_name": "I", "nt_resnum": 76, "nt_name": "DG", "nt_code": "G", "nt_id": "///I/76", "linked_nts": [ "///I/75", "///I/77" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -145.274, "beta": 149.134, "gamma": 141.668, "delta": 151.225, "epsilon": -160.015, "zeta": -96.656, "epsilon_zeta": -63.359, "bb_type": "BI", "chi": -137.821, "glyco_bond": "anti", "C5prime_xyz": [ -1.629, 8.672, -0.093 ], "P_xyz": [ 0.429, 9.519, -1.474 ], "form": "B", "ssZp": 1.801, "Dp": 1.944, "splay_angle": 20.798, "splay_distance": 3.494, "splay_ratio": 0.182, "d22": null, "d64": null, "eta": -177.005, "theta": -149.893, "eta_prime": -156.055, "theta_prime": -160.514, "eta_base": -104.497, "theta_base": -120.425, "v0": -16.811, "v1": 34.871, "v2": -38.544, "v3": 29.808, "v4": -8.381, "amplitude": 38.793, "phase_angle": 173.511, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.003, "frame": { "rmsd": 0.003, "origin": [ 147.112, 106.033, 168.960 ], "x_axis": [ -0.627, -0.650, 0.429 ], "y_axis": [ -0.764, 0.622, -0.173 ], "z_axis": [ -0.154, -0.437, -0.886 ], "quaternion": [ -0.165, -0.399, 0.885, -0.172 ] } }, { "index": 66, "index_chain": 66, "chain_name": "I", "nt_resnum": 77, "nt_name": "DC", "nt_code": "C", "nt_id": "///I/77", "linked_nts": [ "///I/76", "///I/78" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -80.237, "beta": -172.071, "gamma": 45.397, "delta": 140.958, "epsilon": -162.534, "zeta": -122.789, "epsilon_zeta": -39.744, "bb_type": "BI", "chi": -108.760, "glyco_bond": "anti", "C5prime_xyz": [ -2.091, 8.389, -1.823 ], "P_xyz": [ 0.145, 9.716, -1.462 ], "form": "B", "ssZp": 2.060, "Dp": 2.108, "splay_angle": 19.958, "splay_distance": 3.332, "splay_ratio": 0.174, "d22": null, "d64": null, "eta": 154.747, "theta": -151.743, "eta_prime": -174.696, "theta_prime": -159.893, "eta_base": -127.805, "theta_base": -115.106, "v0": -24.212, "v1": 36.735, "v2": -34.638, "v3": 21.601, "v4": 1.376, "amplitude": 37.079, "phase_angle": 159.094, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.003, "origin": [ 147.100, 104.140, 166.023 ], "x_axis": [ -0.968, -0.119, 0.219 ], "y_axis": [ -0.198, 0.900, -0.389 ], "z_axis": [ -0.151, -0.420, -0.895 ], "quaternion": [ -0.095, -0.082, 0.970, -0.208 ] } }, { "index": 67, "index_chain": 67, "chain_name": "I", "nt_resnum": 78, "nt_name": "DA", "nt_code": "A", "nt_id": "///I/78", "linked_nts": [ "///I/77", "///I/79" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -64.075, "beta": 156.808, "gamma": 61.342, "delta": 136.532, "epsilon": -162.575, "zeta": -130.679, "epsilon_zeta": -31.896, "bb_type": "--", "chi": -120.266, "glyco_bond": "anti", "C5prime_xyz": [ -2.206, 8.579, -1.350 ], "P_xyz": [ 0.327, 9.239, -1.423 ], "form": ".", "ssZp": 2.251, "Dp": 2.240, "splay_angle": 25.495, "splay_distance": 4.401, "splay_ratio": 0.223, "d22": null, "d64": null, "eta": 165.009, "theta": -130.723, "eta_prime": -167.175, "theta_prime": -153.046, "eta_base": -117.208, "theta_base": -127.097, "v0": -27.739, "v1": 37.436, "v2": -32.403, "v3": 17.312, "v4": 6.293, "amplitude": 36.872, "phase_angle": 151.496, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.037, "frame": { "rmsd": 0.003, "origin": [ 146.458, 103.065, 162.935 ], "x_axis": [ -0.890, 0.455, -0.032 ], "y_axis": [ 0.418, 0.784, -0.460 ], "z_axis": [ -0.184, -0.423, -0.887 ], "quaternion": [ -0.040, 0.231, 0.944, -0.234 ] } }, { "index": 68, "index_chain": 68, "chain_name": "I", "nt_resnum": 79, "nt_name": "DT", "nt_code": "T", "nt_id": "///I/79", "linked_nts": [ "///I/78", "///I/80" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": 49.514, "beta": 174.857, "gamma": -60.415, "delta": 159.098, "epsilon": 179.726, "zeta": -94.653, "epsilon_zeta": -85.621, "bb_type": "BI", "chi": -102.035, "glyco_bond": "anti", "C5prime_xyz": [ -1.355, 7.830, -1.768 ], "P_xyz": [ 0.095, 9.985, -2.061 ], "form": "B", "ssZp": 1.801, "Dp": 1.831, "splay_angle": 20.169, "splay_distance": 3.478, "splay_ratio": 0.177, "d22": null, "d64": null, "eta": 177.538, "theta": -152.557, "eta_prime": -165.192, "theta_prime": -156.876, "eta_base": -133.027, "theta_base": -114.976, "v0": -1.314, "v1": 24.071, "v2": -36.195, "v3": 36.459, "v4": -22.291, "amplitude": 37.784, "phase_angle": 196.674, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "22m", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.003, "origin": [ 145.379, 100.447, 159.565 ], "x_axis": [ -0.519, 0.816, -0.255 ], "y_axis": [ 0.832, 0.413, -0.371 ], "z_axis": [ -0.198, -0.405, -0.893 ], "quaternion": [ 0.017, 0.490, 0.840, -0.231 ] } }, { "index": 69, "index_chain": 69, "chain_name": "I", "nt_resnum": 80, "nt_name": "DG", "nt_code": "G", "nt_id": "///I/80", "linked_nts": [ "///I/79", "///I/81" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -72.907, "beta": 177.523, "gamma": 53.016, "delta": 127.942, "epsilon": -169.382, "zeta": -99.828, "epsilon_zeta": -69.554, "bb_type": "BI", "chi": -122.361, "glyco_bond": "anti", "C5prime_xyz": [ -2.351, 8.671, -1.401 ], "P_xyz": [ -0.113, 10.016, -1.142 ], "form": ".", "ssZp": 2.431, "Dp": 2.425, "splay_angle": 20.877, "splay_distance": 3.661, "splay_ratio": 0.185, "d22": null, "d64": null, "eta": 159.760, "theta": -143.046, "eta_prime": -174.229, "theta_prime": -153.976, "eta_base": -125.898, "theta_base": -124.259, "v0": -31.226, "v1": 35.737, "v2": -26.628, "v3": 9.459, "v4": 13.450, "amplitude": 35.221, "phase_angle": 139.114, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.005, "frame": { "rmsd": 0.005, "origin": [ 144.205, 99.576, 156.408 ], "x_axis": [ 0.057, 0.973, -0.222 ], "y_axis": [ 0.989, -0.086, -0.123 ], "z_axis": [ -0.139, -0.212, -0.967 ], "quaternion": [ 0.031, 0.726, 0.675, -0.124 ] } }, { "index": 70, "index_chain": 70, "chain_name": "I", "nt_resnum": 81, "nt_name": "DT", "nt_code": "T", "nt_id": "///I/81", "linked_nts": [ "///I/80", "///I/82" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -66.934, "beta": 177.433, "gamma": 49.734, "delta": 114.402, "epsilon": -170.058, "zeta": -97.231, "epsilon_zeta": -72.827, "bb_type": "BI", "chi": -125.550, "glyco_bond": "anti", "C5prime_xyz": [ -2.477, 8.660, -1.471 ], "P_xyz": [ -0.340, 10.174, -1.388 ], "form": "B", "ssZp": 2.626, "Dp": 2.684, "splay_angle": 18.867, "splay_distance": 3.242, "splay_ratio": 0.164, "d22": 4.328, "d64": 3.777, "eta": 167.619, "theta": -153.801, "eta_prime": -176.164, "theta_prime": -157.509, "eta_base": -138.083, "theta_base": -123.723, "v0": -33.990, "v1": 29.637, "v2": -14.847, "v3": -4.142, "v4": 23.889, "amplitude": 33.277, "phase_angle": 116.497, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.105, "frame": { "rmsd": 0.002, "origin": [ 142.782, 99.207, 153.055 ], "x_axis": [ 0.567, 0.808, -0.160 ], "y_axis": [ 0.817, -0.577, -0.017 ], "z_axis": [ -0.106, -0.121, -0.987 ], "quaternion": [ 0.029, 0.885, 0.459, -0.075 ] } }, { "index": 71, "index_chain": 71, "chain_name": "I", "nt_resnum": 82, "nt_name": "DT", "nt_code": "T", "nt_id": "///I/82", "linked_nts": [ "///I/81", "///I/83" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -60.538, "beta": 171.016, "gamma": 52.053, "delta": 120.806, "epsilon": -166.789, "zeta": -106.137, "epsilon_zeta": -60.652, "bb_type": "BI", "chi": -120.330, "glyco_bond": "anti", "C5prime_xyz": [ -2.430, 8.573, -1.599 ], "P_xyz": [ -0.134, 9.826, -1.702 ], "form": "B", "ssZp": 2.524, "Dp": 2.568, "splay_angle": 22.017, "splay_distance": 3.697, "splay_ratio": 0.191, "d22": 4.588, "d64": 3.873, "eta": 169.497, "theta": -151.511, "eta_prime": -170.319, "theta_prime": -155.812, "eta_base": -130.638, "theta_base": -107.945, "v0": -32.351, "v1": 32.199, "v2": -20.215, "v3": 2.255, "v4": 18.788, "amplitude": 33.208, "phase_angle": 127.499, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.003, "origin": [ 142.336, 99.372, 149.849 ], "x_axis": [ 0.918, 0.390, -0.069 ], "y_axis": [ 0.388, -0.921, -0.043 ], "z_axis": [ -0.081, 0.013, -0.997 ], "quaternion": [ -0.014, 0.979, 0.199, -0.038 ] } }, { "index": 72, "index_chain": 72, "chain_name": "I", "nt_resnum": 83, "nt_name": "DC", "nt_code": "C", "nt_id": "///I/83", "linked_nts": [ "///I/82", "///I/84" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -56.268, "beta": 162.025, "gamma": 59.432, "delta": 132.501, "epsilon": -113.846, "zeta": -155.623, "epsilon_zeta": 41.777, "bb_type": "--", "chi": -113.690, "glyco_bond": "anti", "C5prime_xyz": [ -2.327, 8.517, -1.713 ], "P_xyz": [ 0.147, 9.300, -2.020 ], "form": ".", "ssZp": 1.467, "Dp": 1.612, "splay_angle": 27.047, "splay_distance": 4.815, "splay_ratio": 0.258, "d22": null, "d64": null, "eta": -167.596, "theta": -161.663, "eta_prime": -148.564, "theta_prime": -158.782, "eta_base": -100.924, "theta_base": -114.129, "v0": -29.342, "v1": 36.461, "v2": -29.468, "v3": 13.418, "v4": 9.771, "amplitude": 35.724, "phase_angle": 145.575, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.064, "frame": { "rmsd": 0.003, "origin": [ 143.183, 99.173, 146.256 ], "x_axis": [ 0.952, -0.292, -0.098 ], "y_axis": [ -0.301, -0.949, -0.098 ], "z_axis": [ -0.064, 0.123, -0.990 ], "quaternion": [ -0.056, 0.986, -0.150, -0.041 ] } }, { "index": 73, "index_chain": 73, "chain_name": "I", "nt_resnum": 84, "nt_name": "DA", "nt_code": "A", "nt_id": "///I/84", "linked_nts": [ "///I/83", "///I/85" ], "nt_type": "DNA", "dbn": "(", "summary": "~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -56.382, "beta": 137.843, "gamma": 50.169, "delta": 145.311, "epsilon": -136.221, "zeta": -167.648, "epsilon_zeta": 31.428, "bb_type": "--", "chi": -89.276, "glyco_bond": "--", "C5prime_xyz": [ -2.503, 7.715, -2.496 ], "P_xyz": [ 0.073, 7.741, -2.977 ], "form": ".", "ssZp": 1.388, "Dp": 1.704, "splay_angle": 24.467, "splay_distance": 4.415, "splay_ratio": 0.245, "d22": null, "d64": null, "eta": 173.354, "theta": -166.776, "eta_prime": -155.958, "theta_prime": 175.457, "eta_base": -117.188, "theta_base": -124.329, "v0": -21.227, "v1": 35.997, "v2": -36.250, "v3": 24.969, "v4": -2.587, "amplitude": 37.510, "phase_angle": 165.108, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "4b", "suiteness": 0.044, "filter_rmsd": 0.037, "frame": { "rmsd": 0.003, "origin": [ 141.375, 97.742, 142.029 ], "x_axis": [ 0.564, -0.799, -0.210 ], "y_axis": [ -0.823, -0.566, -0.056 ], "z_axis": [ -0.074, 0.204, -0.976 ], "quaternion": [ -0.074, 0.881, -0.460, -0.080 ] } }, { "index": 74, "index_chain": 74, "chain_name": "I", "nt_resnum": 85, "nt_name": "DG", "nt_code": "G", "nt_id": "///I/85", "linked_nts": [ "///I/84", "///I/86" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -67.282, "beta": 129.809, "gamma": 69.856, "delta": 149.599, "epsilon": -171.635, "zeta": -115.005, "epsilon_zeta": -56.630, "bb_type": "BI", "chi": -106.608, "glyco_bond": "anti", "C5prime_xyz": [ -1.774, 8.249, -1.742 ], "P_xyz": [ 0.720, 7.562, -2.154 ], "form": "B", "ssZp": 1.874, "Dp": 1.928, "splay_angle": 20.495, "splay_distance": 3.437, "splay_ratio": 0.178, "d22": null, "d64": null, "eta": 150.658, "theta": -112.613, "eta_prime": -159.740, "theta_prime": -163.795, "eta_base": -104.712, "theta_base": -119.847, "v0": -14.641, "v1": 32.401, "v2": -36.921, "v3": 29.380, "v4": -9.520, "amplitude": 37.016, "phase_angle": 175.901, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "4b", "suiteness": 0.024, "filter_rmsd": 0.005, "frame": { "rmsd": 0.005, "origin": [ 138.648, 97.827, 138.558 ], "x_axis": [ -0.158, -0.934, -0.320 ], "y_axis": [ -0.984, 0.124, 0.125 ], "z_axis": [ -0.077, 0.335, -0.939 ], "quaternion": [ 0.082, -0.644, 0.745, 0.154 ] } }, { "index": 75, "index_chain": 75, "chain_name": "I", "nt_resnum": 86, "nt_name": "DC", "nt_code": "C", "nt_id": "///I/86", "linked_nts": [ "///I/85", "///I/87" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -54.308, "beta": 169.488, "gamma": 45.722, "delta": 132.418, "epsilon": -163.872, "zeta": -106.543, "epsilon_zeta": -57.329, "bb_type": "BI", "chi": -118.687, "glyco_bond": "anti", "C5prime_xyz": [ -2.026, 8.618, -1.486 ], "P_xyz": [ 0.360, 9.645, -1.170 ], "form": "B", "ssZp": 2.260, "Dp": 2.295, "splay_angle": 25.325, "splay_distance": 4.286, "splay_ratio": 0.219, "d22": 4.649, "d64": 4.212, "eta": 169.611, "theta": -140.076, "eta_prime": -169.399, "theta_prime": -147.895, "eta_base": -117.174, "theta_base": -110.344, "v0": -26.187, "v1": 33.778, "v2": -28.327, "v3": 13.963, "v4": 7.488, "amplitude": 33.233, "phase_angle": 148.469, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.064, "frame": { "rmsd": 0.003, "origin": [ 138.374, 98.692, 135.243 ], "x_axis": [ -0.729, -0.665, -0.161 ], "y_axis": [ -0.675, 0.659, 0.332 ], "z_axis": [ -0.114, 0.350, -0.930 ], "quaternion": [ 0.013, -0.368, 0.911, 0.187 ] } }, { "index": 76, "index_chain": 76, "chain_name": "I", "nt_resnum": 87, "nt_name": "DT", "nt_code": "T", "nt_id": "///I/87", "linked_nts": [ "///I/86", "///I/88" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -56.856, "beta": 169.411, "gamma": 52.498, "delta": 136.465, "epsilon": -163.761, "zeta": -119.675, "epsilon_zeta": -44.086, "bb_type": "BI", "chi": -114.115, "glyco_bond": "anti", "C5prime_xyz": [ -2.403, 8.483, -1.640 ], "P_xyz": [ -0.059, 9.637, -1.567 ], "form": "B", "ssZp": 2.211, "Dp": 2.223, "splay_angle": 19.227, "splay_distance": 3.229, "splay_ratio": 0.167, "d22": null, "d64": null, "eta": 170.491, "theta": -148.195, "eta_prime": -160.837, "theta_prime": -161.156, "eta_base": -117.356, "theta_base": -119.097, "v0": -29.799, "v1": 39.291, "v2": -33.379, "v3": 17.177, "v4": 7.624, "amplitude": 38.580, "phase_angle": 149.906, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.002, "origin": [ 137.346, 100.054, 131.311 ], "x_axis": [ -0.979, -0.175, 0.104 ], "y_axis": [ -0.119, 0.907, 0.404 ], "z_axis": [ -0.165, 0.383, -0.909 ], "quaternion": [ -0.069, -0.075, 0.974, 0.202 ] } }, { "index": 77, "index_chain": 77, "chain_name": "I", "nt_resnum": 88, "nt_name": "DG", "nt_code": "G", "nt_id": "///I/88", "linked_nts": [ "///I/87", "///I/89" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -60.350, "beta": 161.376, "gamma": 53.194, "delta": 134.436, "epsilon": -161.548, "zeta": -116.327, "epsilon_zeta": -45.221, "bb_type": "BI", "chi": -124.531, "glyco_bond": "anti", "C5prime_xyz": [ -2.289, 8.709, -1.187 ], "P_xyz": [ 0.108, 9.707, -0.871 ], "form": "B", "ssZp": 2.224, "Dp": 2.248, "splay_angle": 20.754, "splay_distance": 3.499, "splay_ratio": 0.181, "d22": null, "d64": null, "eta": 165.865, "theta": -144.879, "eta_prime": -170.519, "theta_prime": -157.819, "eta_base": -121.440, "theta_base": -126.363, "v0": -29.982, "v1": 38.249, "v2": -31.603, "v3": 15.270, "v4": 8.954, "amplitude": 37.463, "phase_angle": 147.521, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.003, "frame": { "rmsd": 0.003, "origin": [ 136.541, 100.992, 128.328 ], "x_axis": [ -0.835, 0.350, 0.424 ], "y_axis": [ 0.487, 0.829, 0.275 ], "z_axis": [ -0.255, 0.436, -0.863 ], "quaternion": [ -0.181, 0.223, 0.939, 0.189 ] } }, { "index": 78, "index_chain": 78, "chain_name": "I", "nt_resnum": 89, "nt_name": "DA", "nt_code": "A", "nt_id": "///I/89", "linked_nts": [ "///I/88", "///I/90" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -62.229, "beta": 170.259, "gamma": 48.981, "delta": 133.995, "epsilon": -153.454, "zeta": -121.217, "epsilon_zeta": -32.236, "bb_type": "BI", "chi": -121.501, "glyco_bond": "anti", "C5prime_xyz": [ -2.244, 8.605, -1.336 ], "P_xyz": [ 0.062, 9.782, -0.949 ], "form": "B", "ssZp": 2.165, "Dp": 2.172, "splay_angle": 22.187, "splay_distance": 3.734, "splay_ratio": 0.192, "d22": null, "d64": null, "eta": 170.781, "theta": -148.812, "eta_prime": -170.306, "theta_prime": -156.759, "eta_base": -131.908, "theta_base": -126.306, "v0": -29.060, "v1": 37.225, "v2": -30.894, "v3": 15.026, "v4": 8.557, "amplitude": 36.499, "phase_angle": 147.826, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.003, "origin": [ 135.539, 101.666, 125.044 ], "x_axis": [ -0.425, 0.728, 0.538 ], "y_axis": [ 0.869, 0.495, 0.017 ], "z_axis": [ -0.253, 0.474, -0.843 ], "quaternion": [ -0.238, 0.480, 0.831, 0.148 ] } }, { "index": 79, "index_chain": 79, "chain_name": "I", "nt_resnum": 90, "nt_name": "DA", "nt_code": "A", "nt_id": "///I/90", "linked_nts": [ "///I/89", "///I/91" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -63.311, "beta": 163.495, "gamma": 50.579, "delta": 131.112, "epsilon": -168.711, "zeta": -97.991, "epsilon_zeta": -70.719, "bb_type": "BI", "chi": -121.246, "glyco_bond": "anti", "C5prime_xyz": [ -2.253, 8.594, -1.387 ], "P_xyz": [ 0.153, 9.611, -1.210 ], "form": ".", "ssZp": 2.387, "Dp": 2.372, "splay_angle": 21.235, "splay_distance": 3.825, "splay_ratio": 0.191, "d22": null, "d64": null, "eta": 163.015, "theta": -134.048, "eta_prime": -174.238, "theta_prime": -151.842, "eta_base": -136.577, "theta_base": -123.182, "v0": -29.205, "v1": 35.610, "v2": -28.301, "v3": 12.312, "v4": 10.397, "amplitude": 34.910, "phase_angle": 144.165, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.003, "origin": [ 134.429, 102.775, 121.655 ], "x_axis": [ 0.112, 0.843, 0.527 ], "y_axis": [ 0.970, 0.023, -0.244 ], "z_axis": [ -0.217, 0.538, -0.814 ], "quaternion": [ -0.283, 0.690, 0.657, 0.112 ] } }, { "index": 80, "index_chain": 80, "chain_name": "I", "nt_resnum": 91, "nt_name": "DT", "nt_code": "T", "nt_id": "///I/91", "linked_nts": [ "///I/90", "///I/92" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -62.320, "beta": 174.780, "gamma": 44.937, "delta": 103.362, "epsilon": -176.849, "zeta": -88.595, "epsilon_zeta": -88.254, "bb_type": "BI", "chi": -132.567, "glyco_bond": "anti", "C5prime_xyz": [ -2.597, 8.757, -1.283 ], "P_xyz": [ -0.598, 10.444, -1.193 ], "form": "B", "ssZp": 2.903, "Dp": 2.947, "splay_angle": 20.928, "splay_distance": 3.589, "splay_ratio": 0.182, "d22": 4.316, "d64": 3.972, "eta": 166.384, "theta": -160.225, "eta_prime": -178.695, "theta_prime": -158.950, "eta_base": -139.360, "theta_base": -123.464, "v0": -35.608, "v1": 23.958, "v2": -4.590, "v3": -15.600, "v4": 32.302, "amplitude": 35.219, "phase_angle": 97.488, "puckering": "O4'-endo", "sugar_class": "--", "bin": "23p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.105, "frame": { "rmsd": 0.002, "origin": [ 132.555, 105.090, 119.255 ], "x_axis": [ 0.595, 0.702, 0.392 ], "y_axis": [ 0.786, -0.404, -0.468 ], "z_axis": [ -0.170, 0.587, -0.792 ], "quaternion": [ -0.316, 0.835, 0.445, 0.066 ] } }, { "index": 81, "index_chain": 81, "chain_name": "I", "nt_resnum": 92, "nt_name": "DT", "nt_code": "T", "nt_id": "///I/92", "linked_nts": [ "///I/91", "///I/93" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -51.211, "beta": 176.741, "gamma": 46.353, "delta": 131.880, "epsilon": -155.236, "zeta": -119.351, "epsilon_zeta": -35.884, "bb_type": "BI", "chi": -118.443, "glyco_bond": "anti", "C5prime_xyz": [ -2.325, 8.569, -1.509 ], "P_xyz": [ -0.104, 9.922, -1.199 ], "form": "B", "ssZp": 2.272, "Dp": 2.268, "splay_angle": 22.432, "splay_distance": 3.740, "splay_ratio": 0.197, "d22": 4.970, "d64": 3.894, "eta": 177.941, "theta": -150.373, "eta_prime": -160.268, "theta_prime": -152.090, "eta_base": -121.163, "theta_base": -107.023, "v0": -30.028, "v1": 36.939, "v2": -29.543, "v3": 13.051, "v4": 10.443, "amplitude": 36.195, "phase_angle": 144.708, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1b", "suiteness": 0.045, "filter_rmsd": 0.105, "frame": { "rmsd": 0.003, "origin": [ 131.971, 107.767, 116.938 ], "x_axis": [ 0.933, 0.332, 0.139 ], "y_axis": [ 0.339, -0.680, -0.651 ], "z_axis": [ -0.121, 0.654, -0.747 ], "quaternion": [ -0.356, 0.916, 0.183, 0.005 ] } }, { "index": 82, "index_chain": 82, "chain_name": "I", "nt_resnum": 93, "nt_name": "DC", "nt_code": "C", "nt_id": "///I/93", "linked_nts": [ "///I/92", "///I/94" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -59.065, "beta": 165.397, "gamma": 52.068, "delta": 144.588, "epsilon": -131.030, "zeta": -150.297, "epsilon_zeta": 19.266, "bb_type": "--", "chi": -101.188, "glyco_bond": "anti", "C5prime_xyz": [ -2.198, 8.186, -2.079 ], "P_xyz": [ 0.327, 8.855, -2.265 ], "form": ".", "ssZp": 1.479, "Dp": 1.633, "splay_angle": 21.899, "splay_distance": 3.948, "splay_ratio": 0.212, "d22": null, "d64": null, "eta": 179.245, "theta": -150.802, "eta_prime": -156.717, "theta_prime": -157.915, "eta_base": -111.679, "theta_base": -107.291, "v0": -22.504, "v1": 36.881, "v2": -36.379, "v3": 24.351, "v4": -1.405, "amplitude": 37.984, "phase_angle": 163.282, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.003, "origin": [ 132.129, 109.674, 113.725 ], "x_axis": [ 0.933, -0.213, -0.291 ], "y_axis": [ -0.357, -0.662, -0.659 ], "z_axis": [ -0.052, 0.719, -0.693 ], "quaternion": [ -0.380, 0.907, -0.157, -0.094 ] } }, { "index": 83, "index_chain": 83, "chain_name": "I", "nt_resnum": 94, "nt_name": "DA", "nt_code": "A", "nt_id": "///I/94", "linked_nts": [ "///I/93", "///I/95" ], "nt_type": "DNA", "dbn": "(", "summary": "~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -51.200, "beta": 142.277, "gamma": 45.819, "delta": 147.157, "epsilon": -132.961, "zeta": -170.678, "epsilon_zeta": 37.716, "bb_type": "--", "chi": -87.582, "glyco_bond": "--", "C5prime_xyz": [ -2.477, 7.659, -2.549 ], "P_xyz": [ 0.105, 7.883, -2.945 ], "form": ".", "ssZp": 1.233, "Dp": 1.561, "splay_angle": 24.216, "splay_distance": 4.389, "splay_ratio": 0.243, "d22": null, "d64": null, "eta": 173.239, "theta": -168.526, "eta_prime": -157.639, "theta_prime": 177.050, "eta_base": -110.945, "theta_base": -127.327, "v0": -20.272, "v1": 36.204, "v2": -37.505, "v3": 26.789, "v4": -4.361, "amplitude": 38.397, "phase_angle": 167.625, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "4b", "suiteness": 0.023, "filter_rmsd": 0.037, "frame": { "rmsd": 0.003, "origin": [ 130.938, 110.737, 110.114 ], "x_axis": [ 0.501, -0.585, -0.638 ], "y_axis": [ -0.863, -0.280, -0.421 ], "z_axis": [ 0.068, 0.761, -0.645 ], "quaternion": [ -0.380, 0.779, -0.465, -0.183 ] } }, { "index": 84, "index_chain": 84, "chain_name": "I", "nt_resnum": 95, "nt_name": "DG", "nt_code": "G", "nt_id": "///I/95", "linked_nts": [ "///I/94", "///I/96" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -66.539, "beta": 137.787, "gamma": 62.139, "delta": 151.660, "epsilon": -161.916, "zeta": -122.556, "epsilon_zeta": -39.361, "bb_type": "BI", "chi": -100.785, "glyco_bond": "anti", "C5prime_xyz": [ -1.738, 8.064, -1.975 ], "P_xyz": [ 0.832, 7.558, -2.113 ], "form": "B", "ssZp": 1.575, "Dp": 1.739, "splay_angle": 19.915, "splay_distance": 3.395, "splay_ratio": 0.173, "d22": null, "d64": null, "eta": 159.890, "theta": -117.496, "eta_prime": -161.072, "theta_prime": -164.375, "eta_base": -112.026, "theta_base": -119.333, "v0": -11.790, "v1": 30.917, "v2": -37.317, "v3": 31.468, "v4": -12.609, "amplitude": 37.320, "phase_angle": 180.683, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "4b", "suiteness": 0.192, "filter_rmsd": 0.006, "frame": { "rmsd": 0.006, "origin": [ 128.629, 113.499, 107.603 ], "x_axis": [ -0.183, -0.583, -0.792 ], "y_axis": [ -0.982, 0.144, 0.122 ], "z_axis": [ 0.043, 0.800, -0.599 ], "quaternion": [ 0.301, -0.564, 0.694, 0.332 ] } }, { "index": 85, "index_chain": 85, "chain_name": "I", "nt_resnum": 96, "nt_name": "DC", "nt_code": "C", "nt_id": "///I/96", "linked_nts": [ "///I/95", "///I/97" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -51.878, "beta": 157.774, "gamma": 37.503, "delta": 98.294, "epsilon": -171.846, "zeta": -91.212, "epsilon_zeta": -80.633, "bb_type": "BI", "chi": -128.198, "glyco_bond": "anti", "C5prime_xyz": [ -1.966, 8.758, -1.420 ], "P_xyz": [ 0.485, 9.686, -1.474 ], "form": ".", "ssZp": 2.838, "Dp": 3.363, "splay_angle": 27.908, "splay_distance": 4.714, "splay_ratio": 0.247, "d22": 5.035, "d64": 4.453, "eta": 164.681, "theta": -159.029, "eta_prime": 175.522, "theta_prime": -155.016, "eta_base": -130.127, "theta_base": -117.805, "v0": -21.842, "v1": 7.322, "v2": 8.567, "v3": -21.275, "v4": 27.370, "amplitude": 26.694, "phase_angle": 71.280, "puckering": "C4'-exo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.064, "frame": { "rmsd": 0.005, "origin": [ 128.632, 116.179, 105.519 ], "x_axis": [ -0.741, -0.376, -0.556 ], "y_axis": [ -0.671, 0.439, 0.598 ], "z_axis": [ 0.019, 0.816, -0.578 ], "quaternion": [ 0.173, -0.315, 0.830, 0.426 ] } }, { "index": 86, "index_chain": 86, "chain_name": "I", "nt_resnum": 97, "nt_name": "DT", "nt_code": "T", "nt_id": "///I/97", "linked_nts": [ "///I/96", "///I/98" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -45.879, "beta": 166.563, "gamma": 60.272, "delta": 145.049, "epsilon": -153.070, "zeta": -126.648, "epsilon_zeta": -26.422, "bb_type": "--", "chi": -110.850, "glyco_bond": "anti", "C5prime_xyz": [ -1.913, 8.364, -1.646 ], "P_xyz": [ 0.656, 8.840, -1.567 ], "form": "B", "ssZp": 1.819, "Dp": 1.890, "splay_angle": 21.136, "splay_distance": 3.585, "splay_ratio": 0.184, "d22": null, "d64": null, "eta": -176.415, "theta": -137.699, "eta_prime": -142.093, "theta_prime": -157.225, "eta_base": -106.522, "theta_base": -123.681, "v0": -19.964, "v1": 34.833, "v2": -35.816, "v3": 25.185, "v4": -3.521, "amplitude": 36.806, "phase_angle": 166.684, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1b", "suiteness": 0.258, "filter_rmsd": 0.106, "frame": { "rmsd": 0.002, "origin": [ 127.551, 120.212, 103.331 ], "x_axis": [ -0.991, -0.088, -0.101 ], "y_axis": [ -0.133, 0.565, 0.815 ], "z_axis": [ -0.015, 0.821, -0.571 ], "quaternion": [ 0.024, -0.062, 0.884, 0.462 ] } }, { "index": 87, "index_chain": 87, "chain_name": "I", "nt_resnum": 98, "nt_name": "DG", "nt_code": "G", "nt_id": "///I/98", "linked_nts": [ "///I/97", "///I/99" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -53.975, "beta": 157.995, "gamma": 42.812, "delta": 131.086, "epsilon": -163.965, "zeta": -112.546, "epsilon_zeta": -51.420, "bb_type": "BI", "chi": -118.235, "glyco_bond": "anti", "C5prime_xyz": [ -2.249, 8.593, -1.530 ], "P_xyz": [ 0.147, 9.607, -1.302 ], "form": "B", "ssZp": 2.285, "Dp": 2.310, "splay_angle": 21.152, "splay_distance": 3.598, "splay_ratio": 0.184, "d22": null, "d64": null, "eta": 163.803, "theta": -143.232, "eta_prime": -173.927, "theta_prime": -154.971, "eta_base": -133.055, "theta_base": -117.028, "v0": -28.887, "v1": 35.338, "v2": -28.264, "v3": 12.413, "v4": 10.120, "amplitude": 34.695, "phase_angle": 144.550, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.007, "frame": { "rmsd": 0.007, "origin": [ 127.915, 123.108, 101.249 ], "x_axis": [ -0.908, 0.150, 0.392 ], "y_axis": [ 0.412, 0.488, 0.769 ], "z_axis": [ -0.076, 0.860, -0.505 ], "quaternion": [ -0.137, 0.165, 0.852, 0.478 ] } }, { "index": 88, "index_chain": 88, "chain_name": "I", "nt_resnum": 99, "nt_name": "DA", "nt_code": "A", "nt_id": "///I/99", "linked_nts": [ "///I/98", "///I/100" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -51.788, "beta": 164.799, "gamma": 45.234, "delta": 126.761, "epsilon": -157.844, "zeta": -109.200, "epsilon_zeta": -48.645, "bb_type": "BI", "chi": -123.007, "glyco_bond": "anti", "C5prime_xyz": [ -2.267, 8.625, -1.382 ], "P_xyz": [ 0.044, 9.808, -1.106 ], "form": "B", "ssZp": 2.326, "Dp": 2.354, "splay_angle": 22.070, "splay_distance": 3.798, "splay_ratio": 0.192, "d22": null, "d64": null, "eta": 171.798, "theta": -143.269, "eta_prime": -168.340, "theta_prime": -151.051, "eta_base": -123.411, "theta_base": -117.798, "v0": -30.508, "v1": 34.198, "v2": -25.025, "v3": 8.193, "v4": 13.840, "amplitude": 33.893, "phase_angle": 137.590, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.003, "origin": [ 127.270, 126.139, 99.421 ], "x_axis": [ -0.506, 0.323, 0.800 ], "y_axis": [ 0.856, 0.300, 0.420 ], "z_axis": [ -0.104, 0.898, -0.428 ], "quaternion": [ -0.302, 0.395, 0.747, 0.441 ] } }, { "index": 89, "index_chain": 89, "chain_name": "I", "nt_resnum": 100, "nt_name": "DA", "nt_code": "A", "nt_id": "///I/100", "linked_nts": [ "///I/99", "///I/101" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -54.152, "beta": 162.681, "gamma": 46.334, "delta": 123.897, "epsilon": -164.789, "zeta": -110.899, "epsilon_zeta": -53.890, "bb_type": "BI", "chi": -122.867, "glyco_bond": "anti", "C5prime_xyz": [ -2.497, 8.613, -1.449 ], "P_xyz": [ -0.243, 9.926, -1.350 ], "form": "B", "ssZp": 2.468, "Dp": 2.462, "splay_angle": 20.780, "splay_distance": 3.531, "splay_ratio": 0.181, "d22": null, "d64": null, "eta": 167.042, "theta": -151.582, "eta_prime": -170.182, "theta_prime": -158.541, "eta_base": -129.554, "theta_base": -121.088, "v0": -34.117, "v1": 35.850, "v2": -24.154, "v3": 5.264, "v4": 17.950, "amplitude": 36.120, "phase_angle": 131.968, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.004, "origin": [ 126.473, 129.523, 97.890 ], "x_axis": [ 0.035, 0.341, 0.939 ], "y_axis": [ 0.996, 0.071, -0.063 ], "z_axis": [ -0.088, 0.937, -0.337 ], "quaternion": [ -0.438, 0.570, 0.586, 0.373 ] } }, { "index": 90, "index_chain": 90, "chain_name": "I", "nt_resnum": 101, "nt_name": "DC", "nt_code": "C", "nt_id": "///I/101", "linked_nts": [ "///I/100", "///I/102" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -55.201, "beta": 167.008, "gamma": 47.585, "delta": 131.311, "epsilon": -161.181, "zeta": -116.878, "epsilon_zeta": -44.303, "bb_type": "BI", "chi": -121.550, "glyco_bond": "anti", "C5prime_xyz": [ -2.253, 8.681, -1.393 ], "P_xyz": [ 0.087, 9.825, -1.155 ], "form": "B", "ssZp": 2.380, "Dp": 2.350, "splay_angle": 19.341, "splay_distance": 3.230, "splay_ratio": 0.168, "d22": null, "d64": null, "eta": 169.381, "theta": -150.012, "eta_prime": -169.235, "theta_prime": -158.754, "eta_base": -125.449, "theta_base": -116.774, "v0": -31.004, "v1": 37.402, "v2": -29.317, "v3": 12.256, "v4": 11.584, "amplitude": 36.659, "phase_angle": 143.104, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.004, "origin": [ 125.792, 132.891, 97.077 ], "x_axis": [ 0.604, 0.233, 0.762 ], "y_axis": [ 0.796, -0.124, -0.592 ], "z_axis": [ -0.044, 0.965, -0.260 ], "quaternion": [ 0.552, -0.705, -0.365, -0.255 ] } }, { "index": 91, "index_chain": 91, "chain_name": "I", "nt_resnum": 102, "nt_name": "DA", "nt_code": "A", "nt_id": "///I/102", "linked_nts": [ "///I/101", "///I/103" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -64.175, "beta": 161.859, "gamma": 56.184, "delta": 129.766, "epsilon": -167.381, "zeta": -99.980, "epsilon_zeta": -67.401, "bb_type": "BI", "chi": -125.868, "glyco_bond": "anti", "C5prime_xyz": [ -2.072, 8.656, -1.181 ], "P_xyz": [ 0.430, 9.417, -1.039 ], "form": "B", "ssZp": 2.460, "Dp": 2.425, "splay_angle": 23.555, "splay_distance": 4.030, "splay_ratio": 0.205, "d22": null, "d64": null, "eta": 163.781, "theta": -135.948, "eta_prime": -172.032, "theta_prime": -148.558, "eta_base": -122.265, "theta_base": -122.103, "v0": -27.088, "v1": 32.837, "v2": -25.958, "v3": 11.100, "v4": 9.865, "amplitude": 32.209, "phase_angle": 143.698, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.004, "origin": [ 125.755, 136.028, 96.309 ], "x_axis": [ 0.963, 0.039, 0.268 ], "y_axis": [ 0.270, -0.216, -0.938 ], "z_axis": [ 0.022, 0.976, -0.219 ], "quaternion": [ 0.618, -0.774, -0.100, -0.094 ] } }, { "index": 92, "index_chain": 92, "chain_name": "I", "nt_resnum": 103, "nt_name": "DT", "nt_code": "T", "nt_id": "///I/103", "linked_nts": [ "///I/102", "///I/104" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -57.866, "beta": -178.720, "gamma": 43.928, "delta": 138.363, "epsilon": -163.798, "zeta": -131.515, "epsilon_zeta": -32.283, "bb_type": "--", "chi": -109.171, "glyco_bond": "anti", "C5prime_xyz": [ -2.503, 8.371, -1.820 ], "P_xyz": [ -0.384, 9.896, -1.660 ], "form": "B", "ssZp": 2.249, "Dp": 2.237, "splay_angle": 19.398, "splay_distance": 3.186, "splay_ratio": 0.169, "d22": null, "d64": null, "eta": 170.233, "theta": -157.960, "eta_prime": -165.333, "theta_prime": -164.325, "eta_base": -131.030, "theta_base": -109.007, "v0": -30.001, "v1": 40.512, "v2": -34.943, "v3": 18.633, "v4": 6.850, "amplitude": 39.814, "phase_angle": 151.360, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.105, "frame": { "rmsd": 0.003, "origin": [ 125.732, 140.055, 96.172 ], "x_axis": [ 0.967, -0.096, -0.237 ], "y_axis": [ -0.252, -0.191, -0.949 ], "z_axis": [ 0.046, 0.977, -0.209 ], "quaternion": [ 0.626, -0.769, 0.113, 0.062 ] } }, { "index": 93, "index_chain": 93, "chain_name": "I", "nt_resnum": 104, "nt_name": "DG", "nt_code": "G", "nt_id": "///I/104", "linked_nts": [ "///I/103", "///I/105" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -47.168, "beta": 152.126, "gamma": 50.391, "delta": 143.400, "epsilon": -151.683, "zeta": -151.768, "epsilon_zeta": 0.085, "bb_type": "--", "chi": -115.382, "glyco_bond": "anti", "C5prime_xyz": [ -2.219, 8.545, -1.457 ], "P_xyz": [ 0.312, 9.195, -1.291 ], "form": ".", "ssZp": 2.046, "Dp": 2.032, "splay_angle": 23.548, "splay_distance": 3.899, "splay_ratio": 0.216, "d22": null, "d64": null, "eta": 170.407, "theta": -161.585, "eta_prime": -162.162, "theta_prime": -173.226, "eta_base": -103.566, "theta_base": -123.035, "v0": -26.366, "v1": 39.803, "v2": -37.231, "v3": 22.956, "v4": 1.888, "amplitude": 40.011, "phase_angle": 158.515, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.004, "frame": { "rmsd": 0.004, "origin": [ 126.331, 142.915, 94.901 ], "x_axis": [ 0.555, -0.204, -0.807 ], "y_axis": [ -0.827, -0.031, -0.561 ], "z_axis": [ 0.089, 0.979, -0.186 ], "quaternion": [ 0.578, -0.665, 0.387, 0.270 ] } }, { "index": 94, "index_chain": 94, "chain_name": "I", "nt_resnum": 105, "nt_name": "DC", "nt_code": "C", "nt_id": "///I/105", "linked_nts": [ "///I/104", "///I/106" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -57.981, "beta": 146.974, "gamma": 66.223, "delta": 155.476, "epsilon": -150.532, "zeta": -150.435, "epsilon_zeta": -0.096, "bb_type": "--", "chi": -109.938, "glyco_bond": "anti", "C5prime_xyz": [ -1.654, 8.372, -1.534 ], "P_xyz": [ 0.963, 8.166, -1.508 ], "form": "B", "ssZp": 1.380, "Dp": 1.535, "splay_angle": 22.276, "splay_distance": 3.710, "splay_ratio": 0.199, "d22": 5.272, "d64": 3.993, "eta": 171.871, "theta": -121.280, "eta_prime": -150.546, "theta_prime": -153.693, "eta_base": -104.159, "theta_base": -108.030, "v0": -15.973, "v1": 36.345, "v2": -41.935, "v3": 33.735, "v4": -11.416, "amplitude": 42.000, "phase_angle": 176.822, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.005, "origin": [ 125.416, 146.697, 94.647 ], "x_axis": [ -0.136, 0.072, -0.988 ], "y_axis": [ -0.988, 0.068, 0.141 ], "z_axis": [ 0.077, 0.995, 0.062 ], "quaternion": [ 0.498, -0.428, 0.534, 0.532 ] } }, { "index": 95, "index_chain": 95, "chain_name": "I", "nt_resnum": 106, "nt_name": "DC", "nt_code": "C", "nt_id": "///I/106", "linked_nts": [ "///I/105", "///I/107" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": 15.586, "beta": 155.561, "gamma": -17.371, "delta": 162.796, "epsilon": -159.500, "zeta": -144.362, "epsilon_zeta": -15.138, "bb_type": "--", "chi": -77.342, "glyco_bond": "anti", "C5prime_xyz": [ -1.727, 7.078, -2.666 ], "P_xyz": [ 0.488, 8.477, -2.601 ], "form": ".", "ssZp": 0.930, "Dp": 1.568, "splay_angle": 25.561, "splay_distance": 4.459, "splay_ratio": 0.241, "d22": 5.332, "d64": 4.048, "eta": 175.036, "theta": -159.223, "eta_prime": -162.538, "theta_prime": -165.374, "eta_base": -115.819, "theta_base": -117.510, "v0": 0.411, "v1": 24.346, "v2": -38.398, "v3": 39.541, "v4": -25.410, "amplitude": 40.645, "phase_angle": 199.141, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.064, "frame": { "rmsd": 0.004, "origin": [ 124.735, 150.261, 95.418 ], "x_axis": [ -0.757, 0.134, -0.640 ], "y_axis": [ -0.639, 0.051, 0.767 ], "z_axis": [ 0.136, 0.990, 0.047 ], "quaternion": [ 0.292, -0.190, 0.664, 0.662 ] } }, { "index": 96, "index_chain": 96, "chain_name": "I", "nt_resnum": 107, "nt_name": "DT", "nt_code": "T", "nt_id": "///I/107", "linked_nts": [ "///I/106", "///I/108" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -56.992, "beta": 147.686, "gamma": 63.129, "delta": 147.016, "epsilon": -157.758, "zeta": -136.399, "epsilon_zeta": -21.359, "bb_type": "--", "chi": -96.687, "glyco_bond": "anti", "C5prime_xyz": [ -2.059, 7.959, -2.258 ], "P_xyz": [ 0.517, 7.884, -2.658 ], "form": "B", "ssZp": 1.511, "Dp": 1.741, "splay_angle": 23.824, "splay_distance": 4.102, "splay_ratio": 0.206, "d22": 4.833, "d64": 4.161, "eta": 168.617, "theta": -123.531, "eta_prime": -157.913, "theta_prime": -157.228, "eta_base": -115.718, "theta_base": -133.328, "v0": -17.227, "v1": 33.684, "v2": -36.724, "v3": 27.650, "v4": -6.854, "amplitude": 37.109, "phase_angle": 171.741, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.105, "frame": { "rmsd": 0.005, "origin": [ 124.283, 154.038, 97.746 ], "x_axis": [ -0.990, 0.123, -0.069 ], "y_axis": [ -0.076, -0.061, 0.995 ], "z_axis": [ 0.119, 0.990, 0.070 ], "quaternion": [ 0.069, 0.017, 0.682, 0.728 ] } }, { "index": 97, "index_chain": 97, "chain_name": "I", "nt_resnum": 108, "nt_name": "DT", "nt_code": "T", "nt_id": "///I/108", "linked_nts": [ "///I/107", "///I/109" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": 24.462, "beta": 168.316, "gamma": -42.180, "delta": 150.595, "epsilon": -157.895, "zeta": -112.622, "epsilon_zeta": -45.273, "bb_type": "BI", "chi": -89.929, "glyco_bond": "anti", "C5prime_xyz": [ -1.703, 7.534, -2.385 ], "P_xyz": [ -0.144, 9.582, -2.776 ], "form": "B", "ssZp": 1.290, "Dp": 1.906, "splay_angle": 22.912, "splay_distance": 4.021, "splay_ratio": 0.199, "d22": 4.119, "d64": 3.645, "eta": 174.468, "theta": -148.727, "eta_prime": -172.993, "theta_prime": -152.293, "eta_base": -146.022, "theta_base": -113.889, "v0": -3.441, "v1": 22.474, "v2": -31.862, "v3": 30.700, "v4": -17.413, "amplitude": 32.669, "phase_angle": 192.755, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.002, "origin": [ 125.214, 158.028, 97.943 ], "x_axis": [ -0.924, -0.102, 0.368 ], "y_axis": [ 0.378, -0.096, 0.921 ], "z_axis": [ -0.059, 0.990, 0.127 ], "quaternion": [ -0.164, 0.106, 0.652, 0.733 ] } }, { "index": 98, "index_chain": 98, "chain_name": "I", "nt_resnum": 109, "nt_name": "DT", "nt_code": "T", "nt_id": "///I/109", "linked_nts": [ "///I/108", "///I/110" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -41.776, "beta": 148.664, "gamma": 38.266, "delta": 95.826, "epsilon": -170.756, "zeta": -91.299, "epsilon_zeta": -79.457, "bb_type": "BI", "chi": -119.315, "glyco_bond": "anti", "C5prime_xyz": [ -2.856, 8.447, -1.897 ], "P_xyz": [ -0.677, 9.673, -2.619 ], "form": "B", "ssZp": 2.606, "Dp": 3.168, "splay_angle": 23.395, "splay_distance": 4.086, "splay_ratio": 0.203, "d22": 4.319, "d64": 4.084, "eta": 164.947, "theta": -156.843, "eta_prime": -176.448, "theta_prime": -156.866, "eta_base": -134.253, "theta_base": -127.326, "v0": -34.169, "v1": 17.601, "v2": 3.973, "v3": -23.658, "v4": 36.644, "amplitude": 36.630, "phase_angle": 83.774, "puckering": "O4'-endo", "sugar_class": "--", "bin": "23p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.002, "origin": [ 124.616, 161.647, 99.588 ], "x_axis": [ -0.610, -0.253, 0.751 ], "y_axis": [ 0.782, -0.035, 0.623 ], "z_axis": [ -0.131, 0.967, 0.220 ], "quaternion": [ -0.379, 0.227, 0.582, 0.683 ] } }, { "index": 99, "index_chain": 99, "chain_name": "I", "nt_resnum": 110, "nt_name": "DT", "nt_code": "T", "nt_id": "///I/110", "linked_nts": [ "///I/109", "///I/111" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -42.360, "beta": 160.578, "gamma": 51.465, "delta": 127.190, "epsilon": -162.098, "zeta": -120.963, "epsilon_zeta": -41.135, "bb_type": "BI", "chi": -114.480, "glyco_bond": "anti", "C5prime_xyz": [ -2.937, 8.466, -1.661 ], "P_xyz": [ -0.737, 9.787, -2.129 ], "form": ".", "ssZp": 2.703, "Dp": 2.554, "splay_angle": 18.885, "splay_distance": 3.406, "splay_ratio": 0.170, "d22": null, "d64": null, "eta": 176.945, "theta": -127.688, "eta_prime": -156.651, "theta_prime": -144.409, "eta_base": -123.674, "theta_base": -122.816, "v0": -38.376, "v1": 41.822, "v2": -29.029, "v3": 7.773, "v4": 18.942, "amplitude": 41.521, "phase_angle": 134.358, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1b", "suiteness": 0.096, "filter_rmsd": 0.105, "frame": { "rmsd": 0.007, "origin": [ 123.721, 165.127, 101.535 ], "x_axis": [ -0.179, -0.349, 0.920 ], "y_axis": [ 0.958, 0.151, 0.244 ], "z_axis": [ -0.224, 0.925, 0.307 ], "quaternion": [ 0.565, -0.301, -0.506, -0.578 ] } }, { "index": 100, "index_chain": 100, "chain_name": "I", "nt_resnum": 111, "nt_name": "DG", "nt_code": "G", "nt_id": "///I/111", "linked_nts": [ "///I/110", "///I/112" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": 52.919, "beta": 163.346, "gamma": -77.160, "delta": 153.842, "epsilon": -170.879, "zeta": -107.535, "epsilon_zeta": -63.344, "bb_type": "BI", "chi": -99.208, "glyco_bond": "anti", "C5prime_xyz": [ -1.468, 7.860, -1.973 ], "P_xyz": [ -0.336, 10.132, -2.633 ], "form": "B", "ssZp": 1.664, "Dp": 1.868, "splay_angle": 20.290, "splay_distance": 3.479, "splay_ratio": 0.176, "d22": null, "d64": null, "eta": 159.194, "theta": -167.004, "eta_prime": 177.019, "theta_prime": -166.102, "eta_base": -152.718, "theta_base": -125.741, "v0": -3.663, "v1": 24.119, "v2": -34.230, "v3": 32.980, "v4": -18.690, "amplitude": 35.098, "phase_angle": 192.776, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "22m", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.007, "frame": { "rmsd": 0.007, "origin": [ 122.127, 167.473, 103.420 ], "x_axis": [ 0.430, -0.700, 0.570 ], "y_axis": [ 0.892, 0.428, -0.147 ], "z_axis": [ -0.141, 0.571, 0.808 ], "quaternion": [ 0.817, -0.220, -0.218, -0.487 ] } }, { "index": 101, "index_chain": 101, "chain_name": "I", "nt_resnum": 112, "nt_name": "DA", "nt_code": "A", "nt_id": "///I/112", "linked_nts": [ "///I/111", "///I/113" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -55.755, "beta": 166.030, "gamma": 45.832, "delta": 123.853, "epsilon": -164.226, "zeta": -106.064, "epsilon_zeta": -58.162, "bb_type": "BI", "chi": -118.187, "glyco_bond": "anti", "C5prime_xyz": [ -2.331, 8.519, -1.662 ], "P_xyz": [ -0.026, 9.745, -1.656 ], "form": "B", "ssZp": 2.335, "Dp": 2.429, "splay_angle": 23.076, "splay_distance": 3.974, "splay_ratio": 0.200, "d22": null, "d64": null, "eta": 166.606, "theta": -147.190, "eta_prime": -171.741, "theta_prime": -153.245, "eta_base": -128.322, "theta_base": -125.078, "v0": -30.692, "v1": 32.750, "v2": -22.676, "v3": 5.702, "v4": 15.571, "amplitude": 32.888, "phase_angle": 133.590, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.004, "origin": [ 121.838, 169.371, 106.321 ], "x_axis": [ 0.838, -0.441, 0.320 ], "y_axis": [ 0.544, 0.719, -0.434 ], "z_axis": [ -0.038, 0.537, 0.842 ], "quaternion": [ 0.922, -0.263, -0.097, -0.267 ] } }, { "index": 102, "index_chain": 102, "chain_name": "I", "nt_resnum": 113, "nt_name": "DT", "nt_code": "T", "nt_id": "///I/113", "linked_nts": [ "///I/112", "///I/114" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -48.416, "beta": 173.169, "gamma": 36.242, "delta": 135.869, "epsilon": -134.346, "zeta": -135.450, "epsilon_zeta": 1.104, "bb_type": "--", "chi": -109.053, "glyco_bond": "anti", "C5prime_xyz": [ -2.519, 8.367, -1.838 ], "P_xyz": [ -0.388, 9.875, -1.729 ], "form": "B", "ssZp": 1.899, "Dp": 1.932, "splay_angle": 21.134, "splay_distance": 3.638, "splay_ratio": 0.189, "d22": null, "d64": null, "eta": 179.109, "theta": -152.658, "eta_prime": -162.898, "theta_prime": -157.164, "eta_base": -131.441, "theta_base": -107.079, "v0": -30.504, "v1": 39.520, "v2": -32.960, "v3": 16.260, "v4": 8.712, "amplitude": 38.709, "phase_angle": 148.371, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.105, "frame": { "rmsd": 0.003, "origin": [ 121.645, 171.176, 109.857 ], "x_axis": [ 0.993, -0.113, -0.038 ], "y_axis": [ 0.076, 0.844, -0.530 ], "z_axis": [ 0.092, 0.524, 0.847 ], "quaternion": [ 0.960, -0.274, 0.034, -0.049 ] } }, { "index": 103, "index_chain": 103, "chain_name": "I", "nt_resnum": 114, "nt_name": "DG", "nt_code": "G", "nt_id": "///I/114", "linked_nts": [ "///I/113", "///I/115" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -62.452, "beta": 139.474, "gamma": 55.634, "delta": 110.695, "epsilon": -162.174, "zeta": -93.868, "epsilon_zeta": -68.307, "bb_type": "BI", "chi": -121.328, "glyco_bond": "anti", "C5prime_xyz": [ -2.241, 8.592, -1.676 ], "P_xyz": [ 0.291, 8.919, -2.280 ], "form": ".", "ssZp": 2.521, "Dp": 2.909, "splay_angle": 27.694, "splay_distance": 4.715, "splay_ratio": 0.243, "d22": null, "d64": null, "eta": 163.666, "theta": -140.305, "eta_prime": -176.161, "theta_prime": -145.817, "eta_base": -121.724, "theta_base": -113.221, "v0": -27.310, "v1": 20.790, "v2": -7.352, "v3": -8.027, "v4": 22.275, "amplitude": 26.514, "phase_angle": 106.098, "puckering": "O4'-endo", "sugar_class": "--", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.007, "frame": { "rmsd": 0.007, "origin": [ 122.346, 173.959, 112.092 ], "x_axis": [ 0.801, 0.423, -0.424 ], "y_axis": [ -0.567, 0.764, -0.309 ], "z_axis": [ 0.193, 0.488, 0.851 ], "quaternion": [ 0.924, -0.215, 0.167, 0.268 ] } }, { "index": 104, "index_chain": 104, "chain_name": "I", "nt_resnum": 115, "nt_name": "DG", "nt_code": "G", "nt_id": "///I/115", "linked_nts": [ "///I/114", "///I/116" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -53.120, "beta": 176.161, "gamma": 53.832, "delta": 144.352, "epsilon": -128.996, "zeta": -171.930, "epsilon_zeta": 42.934, "bb_type": "BII", "chi": -87.554, "glyco_bond": "anti", "C5prime_xyz": [ -2.716, 7.726, -2.553 ], "P_xyz": [ -0.371, 8.697, -3.210 ], "form": ".", "ssZp": 1.300, "Dp": 1.569, "splay_angle": 24.108, "splay_distance": 4.448, "splay_ratio": 0.247, "d22": null, "d64": null, "eta": -170.063, "theta": 177.401, "eta_prime": -143.040, "theta_prime": 174.102, "eta_base": -112.462, "theta_base": -130.261, "v0": -24.426, "v1": 38.586, "v2": -37.271, "v3": 24.164, "v4": -0.102, "amplitude": 39.340, "phase_angle": 161.336, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.002, "frame": { "rmsd": 0.002, "origin": [ 123.145, 177.602, 114.978 ], "x_axis": [ 0.339, 0.752, -0.565 ], "y_axis": [ -0.876, 0.472, 0.103 ], "z_axis": [ 0.344, 0.460, 0.818 ], "quaternion": [ 0.811, -0.110, 0.280, 0.502 ] } }, { "index": 105, "index_chain": 105, "chain_name": "I", "nt_resnum": 116, "nt_name": "DA", "nt_code": "A", "nt_id": "///I/116", "linked_nts": [ "///I/115", "///I/117" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -74.641, "beta": 139.748, "gamma": 64.648, "delta": 151.368, "epsilon": -171.490, "zeta": -116.762, "epsilon_zeta": -54.728, "bb_type": "BI", "chi": -102.928, "glyco_bond": "anti", "C5prime_xyz": [ -1.619, 8.020, -1.882 ], "P_xyz": [ 0.935, 7.433, -2.048 ], "form": "B", "ssZp": 1.698, "Dp": 1.822, "splay_angle": 19.344, "splay_distance": 3.226, "splay_ratio": 0.168, "d22": null, "d64": null, "eta": 154.011, "theta": -118.801, "eta_prime": -164.695, "theta_prime": -162.794, "eta_base": -114.769, "theta_base": -129.228, "v0": -9.739, "v1": 29.005, "v2": -36.140, "v3": 31.452, "v4": -13.901, "amplitude": 36.203, "phase_angle": 183.400, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "4b", "suiteness": 0.184, "filter_rmsd": 0.037, "frame": { "rmsd": 0.004, "origin": [ 121.849, 179.394, 118.837 ], "x_axis": [ -0.317, 0.883, -0.345 ], "y_axis": [ -0.891, -0.154, 0.427 ], "z_axis": [ 0.324, 0.443, 0.836 ], "quaternion": [ 0.584, -0.007, 0.286, 0.759 ] } }, { "index": 106, "index_chain": 106, "chain_name": "I", "nt_resnum": 117, "nt_name": "DG", "nt_code": "G", "nt_id": "///I/117", "linked_nts": [ "///I/116", "///I/118" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -60.798, "beta": 171.049, "gamma": 48.820, "delta": 140.852, "epsilon": -166.857, "zeta": -112.898, "epsilon_zeta": -53.960, "bb_type": "BI", "chi": -110.836, "glyco_bond": "anti", "C5prime_xyz": [ -2.125, 8.423, -1.707 ], "P_xyz": [ 0.284, 9.422, -1.456 ], "form": "B", "ssZp": 2.053, "Dp": 2.112, "splay_angle": 21.501, "splay_distance": 3.612, "splay_ratio": 0.187, "d22": null, "d64": null, "eta": 163.825, "theta": -138.818, "eta_prime": -171.586, "theta_prime": -153.273, "eta_base": -130.349, "theta_base": -108.252, "v0": -23.462, "v1": 36.040, "v2": -34.339, "v3": 21.744, "v4": 0.805, "amplitude": 36.553, "phase_angle": 159.953, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.005, "frame": { "rmsd": 0.005, "origin": [ 123.158, 180.476, 121.580 ], "x_axis": [ -0.763, 0.637, -0.107 ], "y_axis": [ -0.582, -0.606, 0.543 ], "z_axis": [ 0.281, 0.476, 0.833 ], "quaternion": [ 0.341, 0.049, 0.285, 0.895 ] } }, { "index": 107, "index_chain": 107, "chain_name": "I", "nt_resnum": 118, "nt_name": "DC", "nt_code": "C", "nt_id": "///I/118", "linked_nts": [ "///I/117", "///I/119" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -57.225, "beta": 168.437, "gamma": 49.196, "delta": 134.945, "epsilon": -161.142, "zeta": -113.999, "epsilon_zeta": -47.143, "bb_type": "BI", "chi": -112.936, "glyco_bond": "anti", "C5prime_xyz": [ -2.299, 8.518, -1.701 ], "P_xyz": [ 0.079, 9.603, -1.654 ], "form": "B", "ssZp": 2.226, "Dp": 2.233, "splay_angle": 22.769, "splay_distance": 3.858, "splay_ratio": 0.197, "d22": null, "d64": null, "eta": 169.278, "theta": -143.069, "eta_prime": -166.579, "theta_prime": -154.270, "eta_base": -115.061, "theta_base": -116.833, "v0": -28.741, "v1": 37.437, "v2": -31.552, "v3": 15.890, "v4": 7.820, "amplitude": 36.770, "phase_angle": 149.104, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.064, "frame": { "rmsd": 0.003, "origin": [ 123.571, 182.467, 124.566 ], "x_axis": [ -0.965, 0.103, 0.240 ], "y_axis": [ 0.033, -0.864, 0.502 ], "z_axis": [ 0.259, 0.493, 0.831 ], "quaternion": [ 0.018, 0.130, 0.260, 0.957 ] } }, { "index": 108, "index_chain": 108, "chain_name": "I", "nt_resnum": 119, "nt_name": "DA", "nt_code": "A", "nt_id": "///I/119", "linked_nts": [ "///I/118", "///I/120" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -60.683, "beta": 166.628, "gamma": 49.361, "delta": 129.584, "epsilon": -158.710, "zeta": -112.030, "epsilon_zeta": -46.680, "bb_type": "BI", "chi": -121.775, "glyco_bond": "anti", "C5prime_xyz": [ -2.264, 8.606, -1.385 ], "P_xyz": [ 0.094, 9.716, -1.163 ], "form": "B", "ssZp": 2.344, "Dp": 2.344, "splay_angle": 20.144, "splay_distance": 3.461, "splay_ratio": 0.175, "d22": null, "d64": null, "eta": 168.081, "theta": -145.530, "eta_prime": -170.917, "theta_prime": -157.383, "eta_base": -126.671, "theta_base": -124.552, "v0": -29.787, "v1": 35.211, "v2": -27.146, "v3": 10.776, "v4": 11.753, "amplitude": 34.590, "phase_angle": 141.703, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.004, "origin": [ 124.188, 184.320, 127.893 ], "x_axis": [ -0.813, -0.492, 0.312 ], "y_axis": [ 0.568, -0.789, 0.235 ], "z_axis": [ 0.131, 0.369, 0.920 ], "quaternion": [ -0.282, 0.118, 0.161, 0.938 ] } }, { "index": 109, "index_chain": 109, "chain_name": "I", "nt_resnum": 120, "nt_name": "DG", "nt_code": "G", "nt_id": "///I/120", "linked_nts": [ "///I/119", "///I/121" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -66.826, "beta": 158.225, "gamma": 58.679, "delta": 113.354, "epsilon": -162.969, "zeta": -90.057, "epsilon_zeta": -72.913, "bb_type": "BI", "chi": -137.522, "glyco_bond": "anti", "C5prime_xyz": [ -2.418, 8.879, -0.905 ], "P_xyz": [ -0.041, 9.962, -0.882 ], "form": ".", "ssZp": 2.783, "Dp": 2.745, "splay_angle": 22.499, "splay_distance": 4.002, "splay_ratio": 0.198, "d22": null, "d64": null, "eta": 165.967, "theta": -140.411, "eta_prime": -176.163, "theta_prime": -151.341, "eta_base": -134.669, "theta_base": -125.598, "v0": -34.868, "v1": 29.442, "v2": -13.697, "v3": -5.807, "v4": 25.505, "amplitude": 33.955, "phase_angle": 113.790, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.006, "frame": { "rmsd": 0.006, "origin": [ 124.299, 186.056, 130.886 ], "x_axis": [ -0.408, -0.862, 0.300 ], "y_axis": [ 0.907, -0.422, 0.019 ], "z_axis": [ 0.110, 0.280, 0.954 ], "quaternion": [ 0.530, -0.123, -0.090, -0.834 ] } }, { "index": 110, "index_chain": 110, "chain_name": "I", "nt_resnum": 121, "nt_name": "DT", "nt_code": "T", "nt_id": "///I/121", "linked_nts": [ "///I/120", "///I/122" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -69.229, "beta": 174.177, "gamma": 51.627, "delta": 99.951, "epsilon": -155.090, "zeta": -96.263, "epsilon_zeta": -58.827, "bb_type": "BI", "chi": -138.082, "glyco_bond": "anti", "C5prime_xyz": [ -2.506, 8.846, -1.059 ], "P_xyz": [ -0.404, 10.402, -0.981 ], "form": "B", "ssZp": 2.930, "Dp": 3.089, "splay_angle": 22.842, "splay_distance": 3.960, "splay_ratio": 0.198, "d22": 4.682, "d64": 4.218, "eta": 169.102, "theta": -157.008, "eta_prime": -177.398, "theta_prime": -156.000, "eta_base": -142.396, "theta_base": -127.880, "v0": -34.422, "v1": 20.365, "v2": -0.140, "v3": -19.523, "v4": 34.116, "amplitude": 35.230, "phase_angle": 90.227, "puckering": "O4'-endo", "sugar_class": "--", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.105, "frame": { "rmsd": 0.003, "origin": [ 123.598, 187.356, 134.605 ], "x_axis": [ 0.072, -0.985, 0.157 ], "y_axis": [ 0.989, 0.049, -0.141 ], "z_axis": [ 0.131, 0.165, 0.978 ], "quaternion": [ 0.724, -0.106, -0.009, -0.681 ] } }, { "index": 111, "index_chain": 111, "chain_name": "I", "nt_resnum": 122, "nt_name": "DT", "nt_code": "T", "nt_id": "///I/122", "linked_nts": [ "///I/121", "///I/123" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,BI,canonical,non-canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -64.416, "beta": 160.717, "gamma": 60.829, "delta": 104.655, "epsilon": -170.720, "zeta": -85.522, "epsilon_zeta": -85.198, "bb_type": "BI", "chi": -135.155, "glyco_bond": "anti", "C5prime_xyz": [ -2.365, 8.816, -1.123 ], "P_xyz": [ 0.017, 9.851, -1.462 ], "form": "B", "ssZp": 2.964, "Dp": 3.032, "splay_angle": 21.408, "splay_distance": 3.652, "splay_ratio": 0.186, "d22": 4.271, "d64": 3.786, "eta": 168.350, "theta": -148.130, "eta_prime": -172.337, "theta_prime": -151.951, "eta_base": -138.246, "theta_base": -111.248, "v0": -32.505, "v1": 21.460, "v2": -3.559, "v3": -14.905, "v4": 29.942, "amplitude": 32.303, "phase_angle": 96.325, "puckering": "O4'-endo", "sugar_class": "--", "bin": "33p", "cluster": "1a", "suiteness": 0.010, "filter_rmsd": 0.105, "frame": { "rmsd": 0.004, "origin": [ 123.837, 187.881, 138.522 ], "x_axis": [ 0.519, -0.853, -0.045 ], "y_axis": [ 0.840, 0.520, -0.155 ], "z_axis": [ 0.156, 0.043, 0.987 ], "quaternion": [ 0.870, -0.057, 0.058, -0.487 ] } }, { "index": 112, "index_chain": 112, "chain_name": "I", "nt_resnum": 123, "nt_name": "DT", "nt_code": "T", "nt_id": "///I/123", "linked_nts": [ "///I/122", "///I/124" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -58.511, "beta": 170.281, "gamma": 56.343, "delta": 127.070, "epsilon": -175.868, "zeta": -104.054, "epsilon_zeta": -71.814, "bb_type": "BI", "chi": -122.150, "glyco_bond": "anti", "C5prime_xyz": [ -2.319, 8.645, -1.432 ], "P_xyz": [ 0.049, 9.767, -1.426 ], "form": "B", "ssZp": 2.524, "Dp": 2.494, "splay_angle": 18.686, "splay_distance": 3.129, "splay_ratio": 0.163, "d22": 4.128, "d64": 3.544, "eta": 168.346, "theta": -148.165, "eta_prime": -160.862, "theta_prime": -159.118, "eta_base": -111.988, "theta_base": -112.075, "v0": -31.602, "v1": 35.557, "v2": -25.991, "v3": 8.492, "v4": 14.367, "amplitude": 35.195, "phase_angle": 137.604, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1b", "suiteness": 0.022, "filter_rmsd": 0.106, "frame": { "rmsd": 0.005, "origin": [ 125.083, 187.115, 141.869 ], "x_axis": [ 0.907, -0.374, -0.192 ], "y_axis": [ 0.381, 0.925, -0.005 ], "z_axis": [ 0.180, -0.069, 0.981 ], "quaternion": [ 0.976, 0.016, 0.095, -0.193 ] } }, { "index": 113, "index_chain": 113, "chain_name": "I", "nt_resnum": 124, "nt_name": "DC", "nt_code": "C", "nt_id": "///I/124", "linked_nts": [ "///I/123", "///I/125" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -55.556, "beta": 173.550, "gamma": 48.825, "delta": 136.695, "epsilon": -151.626, "zeta": -124.197, "epsilon_zeta": -27.429, "bb_type": "--", "chi": -118.850, "glyco_bond": "anti", "C5prime_xyz": [ -2.042, 8.622, -1.427 ], "P_xyz": [ 0.328, 9.673, -1.059 ], "form": "B", "ssZp": 2.123, "Dp": 2.130, "splay_angle": 23.272, "splay_distance": 3.905, "splay_ratio": 0.207, "d22": 5.252, "d64": 4.102, "eta": 174.958, "theta": -149.043, "eta_prime": -163.344, "theta_prime": -152.475, "eta_base": -110.220, "theta_base": -112.877, "v0": -26.845, "v1": 36.745, "v2": -32.170, "v3": 17.488, "v4": 5.667, "amplitude": 36.302, "phase_angle": 152.396, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.004, "origin": [ 126.272, 186.457, 144.687 ], "x_axis": [ 0.935, 0.303, -0.187 ], "y_axis": [ -0.271, 0.946, 0.176 ], "z_axis": [ 0.230, -0.114, 0.966 ], "quaternion": [ 0.981, 0.074, 0.106, 0.146 ] } }, { "index": 114, "index_chain": 114, "chain_name": "I", "nt_resnum": 125, "nt_name": "DC", "nt_code": "C", "nt_id": "///I/125", "linked_nts": [ "///I/124", "///I/126" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -61.629, "beta": 168.285, "gamma": 51.441, "delta": 147.300, "epsilon": -156.705, "zeta": -134.908, "epsilon_zeta": -21.797, "bb_type": "--", "chi": -99.547, "glyco_bond": "anti", "C5prime_xyz": [ -1.984, 8.101, -2.129 ], "P_xyz": [ 0.578, 8.667, -2.187 ], "form": ".", "ssZp": 1.758, "Dp": 1.905, "splay_angle": 21.356, "splay_distance": 3.740, "splay_ratio": 0.205, "d22": null, "d64": null, "eta": 169.037, "theta": -149.547, "eta_prime": -163.428, "theta_prime": -162.485, "eta_base": -121.776, "theta_base": -108.777, "v0": -18.560, "v1": 34.868, "v2": -37.008, "v3": 27.155, "v4": -5.642, "amplitude": 37.610, "phase_angle": 169.733, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.004, "origin": [ 126.626, 186.692, 148.570 ], "x_axis": [ 0.558, 0.827, -0.067 ], "y_axis": [ -0.776, 0.549, 0.311 ], "z_axis": [ 0.294, -0.122, 0.948 ], "quaternion": [ 0.874, 0.124, 0.103, 0.459 ] } }, { "index": 115, "index_chain": 115, "chain_name": "I", "nt_resnum": 126, "nt_name": "DA", "nt_code": "A", "nt_id": "///I/126", "linked_nts": [ "///I/125", "///I/127" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -65.932, "beta": 154.537, "gamma": 64.953, "delta": 153.310, "epsilon": -148.205, "zeta": -140.328, "epsilon_zeta": -7.878, "bb_type": "--", "chi": -100.077, "glyco_bond": "anti", "C5prime_xyz": [ -1.853, 8.025, -2.004 ], "P_xyz": [ 0.763, 7.975, -2.189 ], "form": "B", "ssZp": 1.405, "Dp": 1.568, "splay_angle": 20.427, "splay_distance": 3.454, "splay_ratio": 0.182, "d22": null, "d64": null, "eta": 167.561, "theta": -136.410, "eta_prime": -156.942, "theta_prime": -164.515, "eta_base": -105.224, "theta_base": -124.197, "v0": -14.585, "v1": 34.112, "v2": -39.673, "v3": 32.260, "v4": -11.333, "amplitude": 39.708, "phase_angle": 177.606, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.004, "origin": [ 126.065, 187.133, 152.241 ], "x_axis": [ -0.120, 0.984, 0.129 ], "y_axis": [ -0.920, -0.159, 0.358 ], "z_axis": [ 0.373, -0.076, 0.925 ], "quaternion": [ 0.642, 0.169, 0.095, 0.742 ] } }, { "index": 116, "index_chain": 116, "chain_name": "I", "nt_resnum": 127, "nt_name": "DA", "nt_code": "A", "nt_id": "///I/127", "linked_nts": [ "///I/126", "///I/128" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -51.510, "beta": 156.404, "gamma": 38.692, "delta": 147.650, "epsilon": -145.713, "zeta": -148.619, "epsilon_zeta": 2.906, "bb_type": "--", "chi": -101.101, "glyco_bond": "anti", "C5prime_xyz": [ -2.104, 8.106, -2.042 ], "P_xyz": [ 0.403, 8.855, -1.867 ], "form": ".", "ssZp": 1.589, "Dp": 1.727, "splay_angle": 22.454, "splay_distance": 3.853, "splay_ratio": 0.209, "d22": null, "d64": null, "eta": 168.094, "theta": -156.095, "eta_prime": -167.984, "theta_prime": -166.506, "eta_base": -126.287, "theta_base": -124.614, "v0": -20.057, "v1": 36.368, "v2": -38.005, "v3": 27.369, "v4": -4.838, "amplitude": 38.811, "phase_angle": 168.302, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.004, "origin": [ 126.778, 186.102, 155.460 ], "x_axis": [ -0.648, 0.721, 0.245 ], "y_axis": [ -0.688, -0.692, 0.217 ], "z_axis": [ 0.326, -0.028, 0.945 ], "quaternion": [ 0.389, 0.158, 0.052, 0.906 ] } }, { "index": 117, "index_chain": 117, "chain_name": "I", "nt_resnum": 128, "nt_name": "DA", "nt_code": "A", "nt_id": "///I/128", "linked_nts": [ "///I/127", "///I/129" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -57.032, "beta": 159.504, "gamma": 45.154, "delta": 146.560, "epsilon": -173.589, "zeta": -98.067, "epsilon_zeta": -75.522, "bb_type": "BI", "chi": -103.173, "glyco_bond": "anti", "C5prime_xyz": [ -1.614, 8.023, -1.936 ], "P_xyz": [ 0.982, 8.250, -1.657 ], "form": "B", "ssZp": 1.792, "Dp": 1.960, "splay_angle": 22.377, "splay_distance": 3.842, "splay_ratio": 0.195, "d22": null, "d64": null, "eta": 163.223, "theta": -118.937, "eta_prime": -171.043, "theta_prime": -143.899, "eta_base": -127.439, "theta_base": -112.561, "v0": -9.624, "v1": 26.537, "v2": -32.470, "v3": 27.737, "v4": -11.636, "amplitude": 32.487, "phase_angle": 181.841, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "4b", "suiteness": 0.010, "filter_rmsd": 0.038, "frame": { "rmsd": 0.004, "origin": [ 127.862, 184.430, 158.758 ], "x_axis": [ -0.955, 0.149, 0.255 ], "y_axis": [ -0.155, -0.988, -0.002 ], "z_axis": [ 0.252, -0.041, 0.967 ], "quaternion": [ 0.077, 0.128, -0.011, 0.989 ] } }, { "index": 118, "index_chain": 118, "chain_name": "I", "nt_resnum": 129, "nt_name": "DT", "nt_code": "T", "nt_id": "///I/129", "linked_nts": [ "///I/128", "///I/130" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -59.266, "beta": 178.096, "gamma": 43.108, "delta": 131.429, "epsilon": -144.031, "zeta": -128.649, "epsilon_zeta": -15.382, "bb_type": "--", "chi": -107.005, "glyco_bond": "anti", "C5prime_xyz": [ -2.605, 8.278, -1.995 ], "P_xyz": [ -0.473, 9.782, -2.113 ], "form": "B", "ssZp": 2.004, "Dp": 2.129, "splay_angle": 22.640, "splay_distance": 3.877, "splay_ratio": 0.200, "d22": null, "d64": null, "eta": 174.083, "theta": -156.339, "eta_prime": -165.233, "theta_prime": -160.223, "eta_base": -126.959, "theta_base": -125.516, "v0": -30.876, "v1": 37.291, "v2": -29.286, "v3": 12.373, "v4": 11.363, "amplitude": 36.521, "phase_angle": 143.310, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.002, "origin": [ 128.388, 184.340, 162.563 ], "x_axis": [ -0.917, -0.372, 0.142 ], "y_axis": [ 0.356, -0.926, -0.127 ], "z_axis": [ 0.179, -0.066, 0.982 ], "quaternion": [ -0.186, 0.082, -0.050, 0.978 ] } }, { "index": 119, "index_chain": 119, "chain_name": "I", "nt_resnum": 130, "nt_name": "DA", "nt_code": "A", "nt_id": "///I/130", "linked_nts": [ "///I/129", "///I/131" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -66.352, "beta": 154.443, "gamma": 51.592, "delta": 116.288, "epsilon": -177.576, "zeta": -90.247, "epsilon_zeta": -87.329, "bb_type": "BI", "chi": -119.883, "glyco_bond": "anti", "C5prime_xyz": [ -2.096, 8.514, -1.644 ], "P_xyz": [ 0.440, 9.105, -1.957 ], "form": ".", "ssZp": 2.592, "Dp": 2.770, "splay_angle": 24.956, "splay_distance": 4.463, "splay_ratio": 0.219, "d22": null, "d64": null, "eta": 159.131, "theta": -115.397, "eta_prime": 178.816, "theta_prime": -141.072, "eta_base": -140.798, "theta_base": -113.835, "v0": -24.934, "v1": 22.348, "v2": -11.883, "v3": -2.045, "v4": 16.946, "amplitude": 24.594, "phase_angle": 118.891, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.005, "origin": [ 129.532, 183.515, 166.174 ], "x_axis": [ -0.599, -0.781, -0.176 ], "y_axis": [ 0.801, -0.577, -0.162 ], "z_axis": [ 0.025, -0.238, 0.971 ], "quaternion": [ -0.446, -0.043, -0.113, 0.887 ] } }, { "index": 120, "index_chain": 120, "chain_name": "I", "nt_resnum": 131, "nt_name": "DC", "nt_code": "C", "nt_id": "///I/131", "linked_nts": [ "///I/130", "///I/132" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": 159.305, "beta": -162.781, "gamma": 172.381, "delta": 87.991, "epsilon": -150.084, "zeta": -73.022, "epsilon_zeta": -77.062, "bb_type": "BI", "chi": -152.575, "glyco_bond": "anti", "C5prime_xyz": [ -2.099, 9.038, -0.246 ], "P_xyz": [ -0.922, 10.286, -2.231 ], "form": "B", "ssZp": 3.694, "Dp": 3.907, "splay_angle": 20.572, "splay_distance": 3.541, "splay_ratio": 0.179, "d22": null, "d64": null, "eta": 169.798, "theta": -169.399, "eta_prime": -177.786, "theta_prime": -166.570, "eta_base": -137.957, "theta_base": -134.098, "v0": -22.036, "v1": -0.076, "v2": 20.327, "v3": -33.670, "v4": 35.457, "amplitude": 35.904, "phase_angle": 55.518, "puckering": "C4'-exo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.004, "origin": [ 128.556, 181.491, 170.030 ], "x_axis": [ -0.120, -0.946, -0.300 ], "y_axis": [ 0.992, -0.125, -0.001 ], "z_axis": [ -0.037, -0.298, 0.954 ], "quaternion": [ 0.654, 0.113, 0.101, -0.741 ] } }, { "index": 121, "index_chain": 121, "chain_name": "I", "nt_resnum": 132, "nt_name": "DA", "nt_code": "A", "nt_id": "///I/132", "linked_nts": [ "///I/131", "///I/133" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -82.535, "beta": 166.749, "gamma": 62.547, "delta": 85.807, "epsilon": -159.886, "zeta": -70.888, "epsilon_zeta": -88.998, "bb_type": "BI", "chi": -151.228, "glyco_bond": "anti", "C5prime_xyz": [ -2.012, 8.964, -0.232 ], "P_xyz": [ 0.411, 9.938, -0.454 ], "form": ".", "ssZp": 3.830, "Dp": 4.062, "splay_angle": 19.728, "splay_distance": 3.371, "splay_ratio": 0.172, "d22": null, "d64": null, "eta": 156.586, "theta": -147.697, "eta_prime": 174.651, "theta_prime": -150.662, "eta_base": -142.755, "theta_base": -117.412, "v0": -16.868, "v1": -6.184, "v2": 25.115, "v3": -35.588, "v4": 33.374, "amplitude": 36.062, "phase_angle": 45.857, "puckering": "C4'-exo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.612, "filter_rmsd": 0.039, "frame": { "rmsd": 0.005, "origin": [ 127.966, 179.531, 172.920 ], "x_axis": [ 0.436, -0.712, -0.550 ], "y_axis": [ 0.900, 0.363, 0.242 ], "z_axis": [ 0.027, -0.601, 0.799 ], "quaternion": [ 0.806, 0.261, 0.179, -0.500 ] } }, { "index": 122, "index_chain": 122, "chain_name": "I", "nt_resnum": 133, "nt_name": "DC", "nt_code": "C", "nt_id": "///I/133", "linked_nts": [ "///I/132", "///I/134" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -70.478, "beta": 165.826, "gamma": 59.357, "delta": 83.721, "epsilon": -160.402, "zeta": -82.626, "epsilon_zeta": -77.776, "bb_type": "BI", "chi": -152.677, "glyco_bond": "anti", "C5prime_xyz": [ -1.888, 9.034, -0.132 ], "P_xyz": [ 0.561, 9.941, -0.327 ], "form": ".", "ssZp": 3.948, "Dp": 4.175, "splay_angle": 22.596, "splay_distance": 3.726, "splay_ratio": 0.196, "d22": 4.540, "d64": 4.259, "eta": 165.507, "theta": -158.565, "eta_prime": -177.964, "theta_prime": -154.051, "eta_base": -131.361, "theta_base": -124.917, "v0": -14.453, "v1": -9.579, "v2": 28.205, "v3": -37.424, "v4": 33.008, "amplitude": 37.339, "phase_angle": 40.942, "puckering": "C4'-exo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.828, "filter_rmsd": 0.063, "frame": { "rmsd": 0.004, "origin": [ 127.956, 176.611, 174.604 ], "x_axis": [ 0.850, -0.329, -0.411 ], "y_axis": [ 0.523, 0.618, 0.587 ], "z_axis": [ 0.061, -0.714, 0.697 ], "quaternion": [ 0.890, 0.366, 0.133, -0.239 ] } }, { "index": 123, "index_chain": 123, "chain_name": "I", "nt_resnum": 134, "nt_name": "DT", "nt_code": "T", "nt_id": "///I/134", "linked_nts": [ "///I/133", "///I/135" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -55.928, "beta": 159.372, "gamma": 72.272, "delta": 121.278, "epsilon": -154.303, "zeta": -101.358, "epsilon_zeta": -52.945, "bb_type": "BI", "chi": -139.232, "glyco_bond": "anti", "C5prime_xyz": [ -1.937, 8.846, -0.601 ], "P_xyz": [ 0.630, 9.378, -0.659 ], "form": "B", "ssZp": 2.635, "Dp": 2.613, "splay_angle": 22.776, "splay_distance": 3.839, "splay_ratio": 0.198, "d22": 5.143, "d64": 4.433, "eta": -174.878, "theta": -139.251, "eta_prime": -148.305, "theta_prime": -147.064, "eta_base": -114.514, "theta_base": -116.144, "v0": -26.343, "v1": 26.835, "v2": -17.472, "v3": 2.832, "v4": 14.696, "amplitude": 27.421, "phase_angle": 129.582, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1b", "suiteness": 0.030, "filter_rmsd": 0.106, "frame": { "rmsd": 0.003, "origin": [ 128.483, 173.516, 176.611 ], "x_axis": [ 0.996, 0.044, -0.081 ], "y_axis": [ 0.036, 0.622, 0.783 ], "z_axis": [ 0.085, -0.782, 0.617 ], "quaternion": [ 0.899, 0.435, 0.046, 0.002 ] } }, { "index": 124, "index_chain": 124, "chain_name": "I", "nt_resnum": 135, "nt_name": "DT", "nt_code": "T", "nt_id": "///I/135", "linked_nts": [ "///I/134", "///I/136" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -63.252, "beta": 170.243, "gamma": 54.490, "delta": 136.387, "epsilon": -167.011, "zeta": -108.899, "epsilon_zeta": -58.113, "bb_type": "BI", "chi": -109.607, "glyco_bond": "anti", "C5prime_xyz": [ -2.335, 8.375, -1.817 ], "P_xyz": [ 0.104, 9.329, -1.952 ], "form": "B", "ssZp": 2.298, "Dp": 2.299, "splay_angle": 18.547, "splay_distance": 3.180, "splay_ratio": 0.162, "d22": 4.050, "d64": 3.743, "eta": 164.468, "theta": -143.030, "eta_prime": -164.147, "theta_prime": -165.040, "eta_base": -125.440, "theta_base": -121.388, "v0": -26.877, "v1": 36.550, "v2": -31.801, "v3": 17.111, "v4": 5.933, "amplitude": 36.049, "phase_angle": 151.905, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.002, "origin": [ 128.693, 170.488, 178.961 ], "x_axis": [ 0.845, 0.350, 0.403 ], "y_axis": [ -0.527, 0.424, 0.737 ], "z_axis": [ 0.087, -0.835, 0.543 ], "quaternion": [ 0.838, 0.469, -0.094, 0.262 ] } }, { "index": 125, "index_chain": 125, "chain_name": "I", "nt_resnum": 136, "nt_name": "DT", "nt_code": "T", "nt_id": "///I/136", "linked_nts": [ "///I/135", "///I/137" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -80.839, "beta": 145.884, "gamma": 87.972, "delta": 93.063, "epsilon": 75.339, "zeta": 83.409, "epsilon_zeta": -8.071, "bb_type": "--", "chi": -154.446, "glyco_bond": "anti", "C5prime_xyz": [ -2.408, 9.001, -0.270 ], "P_xyz": [ -0.085, 9.923, -1.056 ], "form": ".", "ssZp": 1.153, "Dp": 1.596, "splay_angle": 28.114, "splay_distance": 4.345, "splay_ratio": 0.243, "d22": 5.571, "d64": 4.433, "eta": -145.973, "theta": -141.414, "eta_prime": -145.479, "theta_prime": -137.918, "eta_base": -100.027, "theta_base": -91.464, "v0": -31.497, "v1": 14.080, "v2": 6.898, "v3": -25.049, "v4": 35.668, "amplitude": 35.219, "phase_angle": 78.705, "puckering": "O4'-endo", "sugar_class": "--", "bin": "23p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.003, "origin": [ 129.574, 167.916, 180.611 ], "x_axis": [ 0.405, 0.481, 0.778 ], "y_axis": [ -0.910, 0.131, 0.392 ], "z_axis": [ 0.086, -0.867, 0.491 ], "quaternion": [ 0.712, 0.442, -0.243, 0.489 ] } }, { "index": 126, "index_chain": 126, "chain_name": "I", "nt_resnum": 137, "nt_name": "DT", "nt_code": "T", "nt_id": "///I/137", "linked_nts": [ "///I/136", "///I/138" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -178.603, "beta": -177.669, "gamma": 67.669, "delta": 151.270, "epsilon": -127.943, "zeta": -174.916, "epsilon_zeta": 46.972, "bb_type": "BII", "chi": -79.119, "glyco_bond": "anti", "C5prime_xyz": [ -2.758, 7.403, -2.759 ], "P_xyz": [ -0.369, 8.025, -3.642 ], "form": ".", "ssZp": 1.107, "Dp": 1.368, "splay_angle": 22.384, "splay_distance": 3.966, "splay_ratio": 0.214, "d22": null, "d64": null, "eta": 143.600, "theta": -171.853, "eta_prime": -164.232, "theta_prime": 175.430, "eta_base": -115.207, "theta_base": -124.041, "v0": -22.249, "v1": 39.921, "v2": -41.437, "v3": 29.701, "v4": -4.914, "amplitude": 42.394, "phase_angle": 167.808, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.105, "frame": { "rmsd": 0.003, "origin": [ 128.887, 164.666, 183.412 ], "x_axis": [ -0.388, 0.420, 0.821 ], "y_axis": [ -0.907, -0.331, -0.259 ], "z_axis": [ 0.163, -0.845, 0.509 ], "quaternion": [ 0.444, 0.329, -0.370, 0.746 ] } }, { "index": 127, "index_chain": 127, "chain_name": "I", "nt_resnum": 138, "nt_name": "DG", "nt_code": "G", "nt_id": "///I/138", "linked_nts": [ "///I/137", "///I/139" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -61.316, "beta": 132.171, "gamma": 54.558, "delta": 146.378, "epsilon": -144.722, "zeta": -138.389, "epsilon_zeta": -6.332, "bb_type": "--", "chi": -103.324, "glyco_bond": "anti", "C5prime_xyz": [ -2.130, 8.221, -1.969 ], "P_xyz": [ 0.488, 8.107, -2.121 ], "form": ".", "ssZp": 1.629, "Dp": 1.744, "splay_angle": 18.915, "splay_distance": 3.272, "splay_ratio": 0.174, "d22": null, "d64": null, "eta": 166.922, "theta": -137.663, "eta_prime": -162.808, "theta_prime": -163.578, "eta_base": -108.592, "theta_base": -131.410, "v0": -20.945, "v1": 36.471, "v2": -37.326, "v3": 26.202, "v4": -3.566, "amplitude": 38.392, "phase_angle": 166.468, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "4b", "suiteness": 0.267, "filter_rmsd": 0.004, "frame": { "rmsd": 0.004, "origin": [ 127.737, 160.953, 184.196 ], "x_axis": [ -0.893, 0.120, 0.434 ], "y_axis": [ -0.430, -0.514, -0.742 ], "z_axis": [ 0.134, -0.849, 0.511 ], "quaternion": [ 0.161, 0.166, -0.466, 0.854 ] } }, { "index": 128, "index_chain": 128, "chain_name": "I", "nt_resnum": 139, "nt_name": "DG", "nt_code": "G", "nt_id": "///I/139", "linked_nts": [ "///I/138", "///I/140" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -63.439, "beta": 162.900, "gamma": 42.857, "delta": 144.702, "epsilon": -151.891, "zeta": -124.970, "epsilon_zeta": -26.920, "bb_type": "--", "chi": -97.914, "glyco_bond": "anti", "C5prime_xyz": [ -2.001, 7.991, -2.206 ], "P_xyz": [ 0.553, 8.592, -2.212 ], "form": ".", "ssZp": 1.611, "Dp": 1.911, "splay_angle": 19.244, "splay_distance": 3.328, "splay_ratio": 0.169, "d22": null, "d64": null, "eta": 165.508, "theta": -139.503, "eta_prime": -173.906, "theta_prime": -157.422, "eta_base": -138.739, "theta_base": -151.283, "v0": -15.293, "v1": 30.568, "v2": -33.409, "v3": 25.463, "v4": -6.612, "amplitude": 33.707, "phase_angle": 172.364, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.004, "frame": { "rmsd": 0.004, "origin": [ 128.734, 157.910, 184.871 ], "x_axis": [ -0.991, -0.080, -0.110 ], "y_axis": [ 0.136, -0.576, -0.806 ], "z_axis": [ 0.001, -0.814, 0.581 ], "quaternion": [ -0.061, -0.031, -0.457, 0.887 ] } }, { "index": 129, "index_chain": 129, "chain_name": "I", "nt_resnum": 140, "nt_name": "DT", "nt_code": "T", "nt_id": "///I/140", "linked_nts": [ "///I/139", "///I/141" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -62.384, "beta": 161.688, "gamma": 40.776, "delta": 129.347, "epsilon": -179.299, "zeta": -94.998, "epsilon_zeta": -84.301, "bb_type": "BI", "chi": -95.219, "glyco_bond": "anti", "C5prime_xyz": [ -2.903, 7.899, -2.445 ], "P_xyz": [ -0.682, 9.062, -3.192 ], "form": ".", "ssZp": 2.268, "Dp": 2.438, "splay_angle": 31.617, "splay_distance": 5.440, "splay_ratio": 0.274, "d22": null, "d64": null, "eta": 152.596, "theta": -139.835, "eta_prime": 173.796, "theta_prime": -159.671, "eta_base": -172.668, "theta_base": -114.040, "v0": -31.353, "v1": 36.597, "v2": -27.837, "v3": 10.617, "v4": 12.771, "amplitude": 35.968, "phase_angle": 140.708, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.002, "origin": [ 130.201, 155.797, 186.982 ], "x_axis": [ -0.901, -0.169, -0.399 ], "y_axis": [ 0.401, -0.675, -0.620 ], "z_axis": [ -0.165, -0.718, 0.676 ], "quaternion": [ -0.158, -0.156, -0.371, 0.902 ] } }, { "index": 130, "index_chain": 130, "chain_name": "I", "nt_resnum": 141, "nt_name": "DA", "nt_code": "A", "nt_id": "///I/141", "linked_nts": [ "///I/140", "///I/142" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -62.689, "beta": 174.132, "gamma": 40.763, "delta": 80.956, "epsilon": -158.114, "zeta": -73.104, "epsilon_zeta": -85.010, "bb_type": "BI", "chi": -159.022, "glyco_bond": "anti", "C5prime_xyz": [ -2.007, 8.957, 0.243 ], "P_xyz": [ 0.218, 10.176, 0.863 ], "form": "A", "ssZp": 4.172, "Dp": 4.299, "splay_angle": 22.426, "splay_distance": 3.783, "splay_ratio": 0.197, "d22": null, "d64": null, "eta": 164.069, "theta": -155.506, "eta_prime": 170.731, "theta_prime": -152.269, "eta_base": -131.506, "theta_base": -122.845, "v0": -13.397, "v1": -12.241, "v2": 31.411, "v3": -40.151, "v4": 34.025, "amplitude": 39.822, "phase_angle": 37.927, "puckering": "C4'-exo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.004, "origin": [ 127.785, 151.213, 188.639 ], "x_axis": [ -0.335, -0.182, -0.925 ], "y_axis": [ 0.942, -0.087, -0.324 ], "z_axis": [ -0.021, -0.979, 0.201 ], "quaternion": [ -0.441, -0.371, -0.512, 0.637 ] } }, { "index": 131, "index_chain": 131, "chain_name": "I", "nt_resnum": 142, "nt_name": "DG", "nt_code": "G", "nt_id": "///I/142", "linked_nts": [ "///I/141", "///I/143" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -67.950, "beta": 162.625, "gamma": 68.439, "delta": 84.164, "epsilon": -150.672, "zeta": -78.309, "epsilon_zeta": -72.363, "bb_type": "BI", "chi": -162.770, "glyco_bond": "anti", "C5prime_xyz": [ -2.003, 8.978, 0.457 ], "P_xyz": [ 0.449, 9.893, 0.351 ], "form": "A", "ssZp": 4.139, "Dp": 4.225, "splay_angle": 19.890, "splay_distance": 3.375, "splay_ratio": 0.174, "d22": null, "d64": null, "eta": 175.158, "theta": -148.218, "eta_prime": -169.834, "theta_prime": -146.773, "eta_base": -131.358, "theta_base": -122.707, "v0": -14.163, "v1": -9.653, "v2": 28.038, "v3": -37.073, "v4": 32.595, "amplitude": 36.973, "phase_angle": 40.683, "puckering": "C4'-exo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.586, "filter_rmsd": 0.004, "frame": { "rmsd": 0.004, "origin": [ 126.174, 147.806, 188.970 ], "x_axis": [ 0.171, -0.172, -0.970 ], "y_axis": [ 0.984, -0.026, 0.178 ], "z_axis": [ -0.056, -0.985, 0.164 ], "quaternion": [ 0.572, 0.508, 0.400, -0.505 ] } }, { "index": 132, "index_chain": 132, "chain_name": "I", "nt_resnum": 143, "nt_name": "DA", "nt_code": "A", "nt_id": "///I/143", "linked_nts": [ "///I/142", "///I/144" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -59.847, "beta": 164.626, "gamma": 62.466, "delta": 108.067, "epsilon": -166.771, "zeta": -89.493, "epsilon_zeta": -77.278, "bb_type": "BI", "chi": -148.726, "glyco_bond": "anti", "C5prime_xyz": [ -2.163, 8.928, -0.345 ], "P_xyz": [ 0.243, 9.909, 0.014 ], "form": "B", "ssZp": 2.957, "Dp": 2.947, "splay_angle": 19.364, "splay_distance": 3.313, "splay_ratio": 0.169, "d22": null, "d64": null, "eta": 173.542, "theta": -147.432, "eta_prime": -162.819, "theta_prime": -152.370, "eta_base": -128.151, "theta_base": -124.253, "v0": -30.545, "v1": 21.949, "v2": -6.144, "v3": -11.110, "v4": 26.265, "amplitude": 29.839, "phase_angle": 101.882, "puckering": "O4'-endo", "sugar_class": "--", "bin": "33p", "cluster": "1a", "suiteness": 0.010, "filter_rmsd": 0.038, "frame": { "rmsd": 0.003, "origin": [ 124.990, 144.673, 188.564 ], "x_axis": [ 0.650, 0.036, -0.759 ], "y_axis": [ 0.760, -0.046, 0.649 ], "z_axis": [ -0.012, -0.998, -0.057 ], "quaternion": [ 0.622, 0.662, 0.300, -0.291 ] } }, { "index": 133, "index_chain": 133, "chain_name": "I", "nt_resnum": 144, "nt_name": "DA", "nt_code": "A", "nt_id": "///I/144", "linked_nts": [ "///I/143", "///I/145" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -60.581, "beta": 174.697, "gamma": 50.543, "delta": 124.247, "epsilon": -164.284, "zeta": -100.347, "epsilon_zeta": -63.938, "bb_type": "BI", "chi": -129.348, "glyco_bond": "anti", "C5prime_xyz": [ -2.153, 8.734, -1.105 ], "P_xyz": [ 0.110, 9.955, -0.604 ], "form": ".", "ssZp": 2.443, "Dp": 2.457, "splay_angle": 18.316, "splay_distance": 3.257, "splay_ratio": 0.163, "d22": null, "d64": null, "eta": 170.176, "theta": -142.345, "eta_prime": -166.823, "theta_prime": -154.055, "eta_base": -129.683, "theta_base": -123.673, "v0": -29.718, "v1": 32.078, "v2": -22.511, "v3": 6.086, "v4": 14.709, "amplitude": 32.098, "phase_angle": 134.533, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.004, "origin": [ 124.089, 141.587, 187.763 ], "x_axis": [ 0.954, 0.009, -0.298 ], "y_axis": [ 0.298, -0.100, 0.949 ], "z_axis": [ -0.021, -0.995, -0.099 ], "quaternion": [ 0.662, 0.734, 0.105, -0.109 ] } }, { "index": 134, "index_chain": 134, "chain_name": "I", "nt_resnum": 145, "nt_name": "DT", "nt_code": "T", "nt_id": "///I/145", "linked_nts": [ "///I/144", "///I/146" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -57.422, "beta": 166.127, "gamma": 43.037, "delta": 97.513, "epsilon": 179.251, "zeta": -88.367, "epsilon_zeta": -92.382, "bb_type": "BI", "chi": -135.165, "glyco_bond": "anti", "C5prime_xyz": [ -2.486, 8.807, -1.175 ], "P_xyz": [ -0.326, 10.279, -1.182 ], "form": "B", "ssZp": 3.072, "Dp": 3.179, "splay_angle": 22.264, "splay_distance": 3.707, "splay_ratio": 0.193, "d22": 4.640, "d64": 4.150, "eta": 163.462, "theta": -165.456, "eta_prime": 178.867, "theta_prime": -162.763, "eta_base": -140.126, "theta_base": -120.201, "v0": -32.058, "v1": 16.350, "v2": 3.953, "v3": -22.390, "v4": 34.479, "amplitude": 34.434, "phase_angle": 83.408, "puckering": "O4'-endo", "sugar_class": "--", "bin": "23p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.002, "origin": [ 123.817, 138.645, 186.394 ], "x_axis": [ 0.974, -0.067, 0.218 ], "y_axis": [ -0.226, -0.146, 0.963 ], "z_axis": [ -0.033, -0.987, -0.157 ], "quaternion": [ 0.646, 0.754, -0.097, 0.061 ] } }, { "index": 135, "index_chain": 135, "chain_name": "I", "nt_resnum": 146, "nt_name": "DC", "nt_code": "C", "nt_id": "///I/146", "linked_nts": [ "///I/145", "///I/147" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -49.334, "beta": 171.440, "gamma": 58.031, "delta": 140.449, "epsilon": -144.813, "zeta": -124.960, "epsilon_zeta": -19.853, "bb_type": "--", "chi": -116.412, "glyco_bond": "anti", "C5prime_xyz": [ -1.948, 8.584, -1.477 ], "P_xyz": [ 0.540, 9.357, -1.230 ], "form": "B", "ssZp": 1.804, "Dp": 1.875, "splay_angle": 24.768, "splay_distance": 4.190, "splay_ratio": 0.217, "d22": 5.096, "d64": 4.281, "eta": -172.890, "theta": -136.733, "eta_prime": -146.278, "theta_prime": -145.846, "eta_base": -103.920, "theta_base": -102.248, "v0": -24.352, "v1": 36.646, "v2": -34.522, "v3": 21.307, "v4": 1.651, "amplitude": 37.043, "phase_angle": 158.738, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1b", "suiteness": 0.190, "filter_rmsd": 0.064, "frame": { "rmsd": 0.003, "origin": [ 124.275, 134.982, 186.059 ], "x_axis": [ 0.642, -0.183, 0.744 ], "y_axis": [ -0.766, -0.141, 0.627 ], "z_axis": [ -0.010, -0.973, -0.231 ], "quaternion": [ 0.563, 0.710, -0.334, 0.259 ] } }, { "index": 136, "index_chain": 136, "chain_name": "I", "nt_resnum": 147, "nt_name": "DT", "nt_code": "T", "nt_id": "///I/147", "linked_nts": [ "///I/146", "///I/148" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -47.759, "beta": 154.715, "gamma": 43.318, "delta": 141.055, "epsilon": -137.913, "zeta": -160.044, "epsilon_zeta": 22.131, "bb_type": "--", "chi": -98.520, "glyco_bond": "anti", "C5prime_xyz": [ -2.629, 8.076, -2.205 ], "P_xyz": [ -0.201, 8.985, -2.539 ], "form": ".", "ssZp": 1.724, "Dp": 1.827, "splay_angle": 23.847, "splay_distance": 4.178, "splay_ratio": 0.230, "d22": null, "d64": null, "eta": 174.311, "theta": -170.404, "eta_prime": -157.041, "theta_prime": -176.063, "eta_base": -111.677, "theta_base": -122.524, "v0": -28.292, "v1": 40.242, "v2": -36.251, "v3": 20.904, "v4": 4.350, "amplitude": 39.992, "phase_angle": 155.019, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.002, "origin": [ 123.539, 130.857, 185.987 ], "x_axis": [ 0.021, -0.287, 0.958 ], "y_axis": [ -0.999, -0.029, 0.013 ], "z_axis": [ 0.024, -0.958, -0.287 ], "quaternion": [ 0.420, 0.578, -0.556, 0.425 ] } }, { "index": 137, "index_chain": 137, "chain_name": "I", "nt_resnum": 148, "nt_name": "DG", "nt_code": "G", "nt_id": "///I/148", "linked_nts": [ "///I/147", "///I/149" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -64.110, "beta": 142.940, "gamma": 60.705, "delta": 148.240, "epsilon": -173.077, "zeta": -108.372, "epsilon_zeta": -64.705, "bb_type": "BI", "chi": -106.428, "glyco_bond": "anti", "C5prime_xyz": [ -1.714, 8.221, -1.773 ], "P_xyz": [ 0.884, 7.905, -1.872 ], "form": "B", "ssZp": 1.867, "Dp": 1.943, "splay_angle": 19.099, "splay_distance": 3.223, "splay_ratio": 0.166, "d22": null, "d64": null, "eta": 157.965, "theta": -116.133, "eta_prime": -164.207, "theta_prime": -154.289, "eta_base": -112.794, "theta_base": -111.893, "v0": -13.377, "v1": 30.693, "v2": -35.436, "v3": 28.587, "v4": -9.794, "amplitude": 35.484, "phase_angle": 177.014, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "4b", "suiteness": 0.097, "filter_rmsd": 0.005, "frame": { "rmsd": 0.005, "origin": [ 121.774, 127.503, 184.229 ], "x_axis": [ -0.655, -0.236, 0.718 ], "y_axis": [ -0.755, 0.181, -0.630 ], "z_axis": [ 0.019, -0.955, -0.297 ], "quaternion": [ -0.239, -0.339, 0.730, -0.543 ] } }, { "index": 138, "index_chain": 138, "chain_name": "I", "nt_resnum": 149, "nt_name": "DC", "nt_code": "C", "nt_id": "///I/149", "linked_nts": [ "///I/148", "///I/150" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -54.593, "beta": 171.647, "gamma": 43.848, "delta": 140.232, "epsilon": -150.819, "zeta": -141.627, "epsilon_zeta": -9.192, "bb_type": "--", "chi": -108.357, "glyco_bond": "anti", "C5prime_xyz": [ -2.307, 8.405, -1.838 ], "P_xyz": [ 0.006, 9.626, -1.725 ], "form": ".", "ssZp": 2.000, "Dp": 2.028, "splay_angle": 24.550, "splay_distance": 4.114, "splay_ratio": 0.223, "d22": null, "d64": null, "eta": 170.703, "theta": -163.971, "eta_prime": -165.199, "theta_prime": -167.121, "eta_base": -115.014, "theta_base": -123.809, "v0": -27.833, "v1": 39.547, "v2": -35.573, "v3": 20.466, "v4": 4.347, "amplitude": 39.279, "phase_angle": 154.911, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.062, "frame": { "rmsd": 0.003, "origin": [ 121.444, 124.355, 183.623 ], "x_axis": [ -0.977, -0.063, 0.206 ], "y_axis": [ -0.215, 0.245, -0.945 ], "z_axis": [ 0.009, -0.968, -0.253 ], "quaternion": [ -0.062, -0.089, 0.786, -0.608 ] } }, { "index": 139, "index_chain": 139, "chain_name": "I", "nt_resnum": 150, "nt_name": "DA", "nt_code": "A", "nt_id": "///I/150", "linked_nts": [ "///I/149", "///I/151" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -63.130, "beta": 162.602, "gamma": 53.036, "delta": 145.086, "epsilon": 176.860, "zeta": -90.675, "epsilon_zeta": -92.466, "bb_type": "BI", "chi": -115.274, "glyco_bond": "anti", "C5prime_xyz": [ -1.476, 8.322, -1.380 ], "P_xyz": [ 1.107, 8.455, -0.965 ], "form": ".", "ssZp": 1.996, "Dp": 2.030, "splay_angle": 21.616, "splay_distance": 3.746, "splay_ratio": 0.191, "d22": null, "d64": null, "eta": 159.724, "theta": -104.522, "eta_prime": -171.094, "theta_prime": -142.383, "eta_base": -124.507, "theta_base": -114.407, "v0": -11.202, "v1": 27.211, "v2": -32.006, "v3": 26.343, "v4": -9.761, "amplitude": 32.015, "phase_angle": 178.657, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.004, "origin": [ 122.065, 120.873, 181.521 ], "x_axis": [ -0.889, 0.255, -0.381 ], "y_axis": [ 0.449, 0.318, -0.835 ], "z_axis": [ -0.092, -0.913, -0.397 ], "quaternion": [ 0.090, 0.218, 0.807, -0.542 ] } }, { "index": 140, "index_chain": 140, "chain_name": "I", "nt_resnum": 151, "nt_name": "DG", "nt_code": "G", "nt_id": "///I/151", "linked_nts": [ "///I/150", "///I/152" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -177.952, "beta": 166.751, "gamma": 159.425, "delta": 136.666, "epsilon": -153.380, "zeta": -87.900, "epsilon_zeta": -65.480, "bb_type": "BI", "chi": -141.089, "glyco_bond": "anti", "C5prime_xyz": [ -1.783, 8.815, -0.197 ], "P_xyz": [ 0.040, 10.036, -1.632 ], "form": ".", "ssZp": 2.155, "Dp": 2.171, "splay_angle": 19.531, "splay_distance": 3.538, "splay_ratio": 0.175, "d22": null, "d64": null, "eta": -179.890, "theta": -155.233, "eta_prime": -165.990, "theta_prime": -158.861, "eta_base": -127.262, "theta_base": -121.507, "v0": -22.010, "v1": 32.307, "v2": -29.812, "v3": 17.905, "v4": 2.381, "amplitude": 32.367, "phase_angle": 157.081, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.004, "frame": { "rmsd": 0.004, "origin": [ 121.103, 117.374, 180.594 ], "x_axis": [ -0.488, 0.466, -0.738 ], "y_axis": [ 0.863, 0.129, -0.489 ], "z_axis": [ -0.133, -0.875, -0.465 ], "quaternion": [ 0.210, 0.460, 0.721, -0.473 ] } }, { "index": 141, "index_chain": 141, "chain_name": "I", "nt_resnum": 152, "nt_name": "DG", "nt_code": "G", "nt_id": "///I/152", "linked_nts": [ "///I/151", "///I/153" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -72.843, "beta": 167.689, "gamma": 44.407, "delta": 100.009, "epsilon": -173.332, "zeta": -85.171, "epsilon_zeta": -88.161, "bb_type": "BI", "chi": -136.602, "glyco_bond": "anti", "C5prime_xyz": [ -2.654, 8.829, -1.125 ], "P_xyz": [ -0.615, 10.477, -1.046 ], "form": ".", "ssZp": 3.024, "Dp": 3.067, "splay_angle": 21.510, "splay_distance": 3.799, "splay_ratio": 0.189, "d22": null, "d64": null, "eta": 149.459, "theta": -156.749, "eta_prime": 174.583, "theta_prime": -159.107, "eta_base": -138.105, "theta_base": -127.430, "v0": -35.197, "v1": 21.311, "v2": -0.848, "v3": -19.212, "v4": 34.323, "amplitude": 35.765, "phase_angle": 91.359, "puckering": "O4'-endo", "sugar_class": "--", "bin": "23p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.003, "frame": { "rmsd": 0.003, "origin": [ 119.576, 114.536, 179.134 ], "x_axis": [ 0.076, 0.514, -0.854 ], "y_axis": [ 0.991, -0.132, 0.009 ], "z_axis": [ -0.109, -0.847, -0.520 ], "quaternion": [ 0.326, 0.657, 0.573, -0.366 ] } }, { "index": 142, "index_chain": 142, "chain_name": "I", "nt_resnum": 153, "nt_name": "DT", "nt_code": "T", "nt_id": "///I/153", "linked_nts": [ "///I/152", "///I/154" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -58.423, "beta": 170.644, "gamma": 55.270, "delta": 104.486, "epsilon": -173.566, "zeta": -86.384, "epsilon_zeta": -87.182, "bb_type": "BI", "chi": -140.181, "glyco_bond": "anti", "C5prime_xyz": [ -2.506, 8.876, -0.905 ], "P_xyz": [ -0.326, 10.326, -0.739 ], "form": ".", "ssZp": 2.974, "Dp": 2.955, "splay_angle": 18.759, "splay_distance": 3.284, "splay_ratio": 0.166, "d22": null, "d64": null, "eta": 174.330, "theta": -153.114, "eta_prime": -168.188, "theta_prime": -156.892, "eta_base": -129.223, "theta_base": -119.047, "v0": -35.515, "v1": 24.449, "v2": -5.400, "v3": -14.703, "v4": 31.625, "amplitude": 34.956, "phase_angle": 98.886, "puckering": "O4'-endo", "sugar_class": "--", "bin": "33p", "cluster": "1a", "suiteness": 0.010, "filter_rmsd": 0.106, "frame": { "rmsd": 0.003, "origin": [ 118.325, 111.878, 176.725 ], "x_axis": [ 0.564, 0.433, -0.703 ], "y_axis": [ 0.822, -0.378, 0.426 ], "z_axis": [ -0.081, -0.818, -0.569 ], "quaternion": [ 0.393, 0.792, 0.396, -0.248 ] } }, { "index": 143, "index_chain": 143, "chain_name": "I", "nt_resnum": 154, "nt_name": "DG", "nt_code": "G", "nt_id": "///I/154", "linked_nts": [ "///I/153", "///I/155" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -62.039, "beta": 168.675, "gamma": 58.259, "delta": 114.817, "epsilon": -140.497, "zeta": -127.192, "epsilon_zeta": -13.305, "bb_type": "--", "chi": -139.081, "glyco_bond": "anti", "C5prime_xyz": [ -2.419, 8.900, -0.827 ], "P_xyz": [ -0.165, 10.198, -0.499 ], "form": "B", "ssZp": 2.485, "Dp": 2.490, "splay_angle": 21.637, "splay_distance": 3.851, "splay_ratio": 0.188, "d22": null, "d64": null, "eta": -179.849, "theta": -135.001, "eta_prime": -162.654, "theta_prime": -146.753, "eta_base": -118.511, "theta_base": -116.892, "v0": -35.276, "v1": 31.081, "v2": -15.853, "v3": -3.822, "v4": 24.474, "amplitude": 34.600, "phase_angle": 117.269, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.005, "frame": { "rmsd": 0.005, "origin": [ 117.837, 109.954, 174.108 ], "x_axis": [ 0.928, 0.195, -0.318 ], "y_axis": [ 0.370, -0.583, 0.723 ], "z_axis": [ -0.044, -0.789, -0.613 ], "quaternion": [ 0.428, 0.884, 0.160, -0.102 ] } }, { "index": 144, "index_chain": 144, "chain_name": "I", "nt_resnum": 155, "nt_name": "DG", "nt_code": "G", "nt_id": "///I/155", "linked_nts": [ "///I/154", "///I/156" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": 92.306, "beta": -137.163, "gamma": -142.346, "delta": 145.360, "epsilon": -156.605, "zeta": -129.204, "epsilon_zeta": -27.401, "bb_type": "--", "chi": -141.713, "glyco_bond": "anti", "C5prime_xyz": [ -1.806, 8.766, -0.015 ], "P_xyz": [ -0.428, 10.244, -1.685 ], "form": "B", "ssZp": 1.898, "Dp": 2.044, "splay_angle": 20.033, "splay_distance": 3.366, "splay_ratio": 0.175, "d22": null, "d64": null, "eta": -163.709, "theta": -179.504, "eta_prime": -156.838, "theta_prime": -170.117, "eta_base": -123.003, "theta_base": -129.160, "v0": -21.281, "v1": 35.999, "v2": -36.138, "v3": 24.811, "v4": -2.459, "amplitude": 37.430, "phase_angle": 164.900, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.004, "frame": { "rmsd": 0.004, "origin": [ 117.655, 107.311, 171.313 ], "x_axis": [ 0.988, -0.086, 0.130 ], "y_axis": [ -0.155, -0.627, 0.764 ], "z_axis": [ 0.015, -0.774, -0.632 ], "quaternion": [ 0.427, 0.901, -0.067, 0.040 ] } }, { "index": 145, "index_chain": 145, "chain_name": "I", "nt_resnum": 156, "nt_name": "DA", "nt_code": "A", "nt_id": "///I/156", "linked_nts": [ "///I/155", "///I/157" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": 51.762, "beta": 157.156, "gamma": -63.882, "delta": 143.123, "epsilon": 84.234, "zeta": 67.742, "epsilon_zeta": 16.491, "bb_type": "--", "chi": -107.717, "glyco_bond": "anti", "C5prime_xyz": [ -1.010, 7.703, -1.642 ], "P_xyz": [ 0.717, 9.665, -1.527 ], "form": ".", "ssZp": 0.616, "Dp": 0.610, "splay_angle": 21.045, "splay_distance": 3.525, "splay_ratio": 0.187, "d22": null, "d64": null, "eta": 171.488, "theta": -121.583, "eta_prime": -154.480, "theta_prime": -151.876, "eta_base": -116.392, "theta_base": -114.646, "v0": 10.924, "v1": 6.431, "v2": -20.013, "v3": 26.839, "v4": -23.937, "amplitude": 26.889, "phase_angle": 221.901, "puckering": "C4'-endo", "sugar_class": "--", "bin": "22m", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.037, "frame": { "rmsd": 0.004, "origin": [ 117.619, 105.327, 168.595 ], "x_axis": [ 0.640, -0.499, 0.585 ], "y_axis": [ -0.769, -0.425, 0.478 ], "z_axis": [ 0.010, -0.755, -0.656 ], "quaternion": [ 0.374, 0.825, -0.384, 0.180 ] } }, { "index": 146, "index_chain": 146, "chain_name": "I", "nt_resnum": 157, "nt_name": "DT", "nt_code": "T", "nt_id": "///I/157", "linked_nts": [ "///I/156", "///I/158" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": 151.879, "beta": 104.459, "gamma": 139.554, "delta": 137.551, "epsilon": -157.872, "zeta": -115.561, "epsilon_zeta": -42.312, "bb_type": "BI", "chi": -137.269, "glyco_bond": "anti", "C5prime_xyz": [ -2.177, 8.849, -0.490 ], "P_xyz": [ -0.946, 9.369, -2.756 ], "form": "B", "ssZp": 1.980, "Dp": 2.186, "splay_angle": 19.025, "splay_distance": 3.072, "splay_ratio": 0.165, "d22": null, "d64": null, "eta": -170.534, "theta": 142.982, "eta_prime": -168.959, "theta_prime": 170.365, "eta_base": -131.439, "theta_base": -141.532, "v0": -30.502, "v1": 40.589, "v2": -34.712, "v3": 18.110, "v4": 7.484, "amplitude": 39.886, "phase_angle": 150.491, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.105, "frame": { "rmsd": 0.002, "origin": [ 117.980, 102.991, 165.980 ], "x_axis": [ 0.187, -0.679, 0.710 ], "y_axis": [ -0.982, -0.125, 0.139 ], "z_axis": [ -0.006, -0.723, -0.691 ], "quaternion": [ 0.305, 0.708, -0.587, 0.249 ] } }, { "index": 147, "index_chain": 147, "chain_name": "I", "nt_resnum": 158, "nt_name": "DA", "nt_code": "A", "nt_id": "///I/158", "linked_nts": [ "///I/157", "///I/159" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -74.704, "beta": -178.423, "gamma": 50.383, "delta": 144.933, "epsilon": -176.328, "zeta": -101.258, "epsilon_zeta": -75.071, "bb_type": "BI", "chi": -114.202, "glyco_bond": "anti", "C5prime_xyz": [ -1.649, 8.369, -1.459 ], "P_xyz": [ 0.780, 9.128, -0.825 ], "form": "B", "ssZp": 1.983, "Dp": 2.038, "splay_angle": 21.051, "splay_distance": 3.608, "splay_ratio": 0.185, "d22": null, "d64": null, "eta": 157.439, "theta": -132.297, "eta_prime": -175.070, "theta_prime": -149.990, "eta_base": -126.650, "theta_base": -123.737, "v0": -15.282, "v1": 30.783, "v2": -33.784, "v3": 25.769, "v4": -6.814, "amplitude": 34.067, "phase_angle": 172.612, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.004, "origin": [ 118.274, 101.238, 163.474 ], "x_axis": [ -0.513, -0.587, 0.626 ], "y_axis": [ -0.858, 0.373, -0.353 ], "z_axis": [ -0.026, -0.718, -0.695 ], "quaternion": [ -0.203, -0.450, 0.803, -0.334 ] } }, { "index": 148, "index_chain": 148, "chain_name": "I", "nt_resnum": 159, "nt_name": "DT", "nt_code": "T", "nt_id": "///I/159", "linked_nts": [ "///I/158", "///I/160" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -53.065, "beta": -170.126, "gamma": 32.474, "delta": 140.139, "epsilon": -159.460, "zeta": -132.235, "epsilon_zeta": -27.225, "bb_type": "--", "chi": -107.075, "glyco_bond": "anti", "C5prime_xyz": [ -2.108, 8.290, -1.908 ], "P_xyz": [ -0.122, 9.932, -1.467 ], "form": "B", "ssZp": 1.882, "Dp": 1.999, "splay_angle": 24.485, "splay_distance": 4.140, "splay_ratio": 0.212, "d22": 5.159, "d64": 4.310, "eta": 173.770, "theta": -146.570, "eta_prime": -167.607, "theta_prime": -153.133, "eta_base": -133.930, "theta_base": -118.373, "v0": -22.613, "v1": 35.052, "v2": -33.661, "v3": 21.450, "v4": 0.470, "amplitude": 35.709, "phase_angle": 160.501, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.003, "origin": [ 119.162, 98.553, 161.234 ], "x_axis": [ -0.870, -0.311, 0.383 ], "y_axis": [ -0.491, 0.616, -0.616 ], "z_axis": [ -0.045, -0.724, -0.688 ], "quaternion": [ -0.120, -0.225, 0.891, -0.376 ] } }, { "index": 149, "index_chain": 149, "chain_name": "I", "nt_resnum": 160, "nt_name": "DT", "nt_code": "T", "nt_id": "///I/160", "linked_nts": [ "///I/159", "///I/161" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": 30.999, "beta": 179.987, "gamma": -45.473, "delta": 158.692, "epsilon": -179.303, "zeta": -90.848, "epsilon_zeta": -88.455, "bb_type": "BI", "chi": -92.764, "glyco_bond": "anti", "C5prime_xyz": [ -1.310, 7.435, -2.145 ], "P_xyz": [ 0.432, 9.322, -2.556 ], "form": "B", "ssZp": 1.430, "Dp": 1.756, "splay_angle": 21.622, "splay_distance": 3.792, "splay_ratio": 0.189, "d22": null, "d64": null, "eta": 178.612, "theta": -140.426, "eta_prime": -163.503, "theta_prime": -146.592, "eta_base": -127.453, "theta_base": -96.120, "v0": 5.068, "v1": 18.115, "v2": -32.909, "v3": 36.759, "v4": -26.585, "amplitude": 36.744, "phase_angle": 206.409, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "22m", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.002, "origin": [ 118.920, 95.732, 158.214 ], "x_axis": [ -0.987, 0.159, 0.005 ], "y_axis": [ 0.102, 0.656, -0.748 ], "z_axis": [ -0.122, -0.738, -0.664 ], "quaternion": [ -0.035, 0.072, 0.909, -0.409 ] } }, { "index": 150, "index_chain": 150, "chain_name": "I", "nt_resnum": 161, "nt_name": "DG", "nt_code": "G", "nt_id": "///I/161", "linked_nts": [ "///I/160", "///I/162" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop", "alpha": -46.973, "beta": 164.380, "gamma": 39.563, "delta": 116.563, "epsilon": -152.130, "zeta": -146.489, "epsilon_zeta": -5.642, "bb_type": "--", "chi": -113.528, "glyco_bond": "anti", "C5prime_xyz": [ -2.853, 8.417, -1.912 ], "P_xyz": [ -0.775, 9.950, -2.355 ], "form": ".", "ssZp": 2.395, "Dp": 2.597, "splay_angle": 25.598, "splay_distance": 4.377, "splay_ratio": 0.228, "d22": null, "d64": null, "eta": 170.915, "theta": 173.980, "eta_prime": -163.591, "theta_prime": 177.203, "eta_base": -109.453, "theta_base": -158.936, "v0": -35.751, "v1": 32.850, "v2": -17.984, "v3": -1.980, "v4": 23.657, "amplitude": 35.510, "phase_angle": 120.427, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.006, "frame": { "rmsd": 0.006, "origin": [ 116.908, 94.113, 155.437 ], "x_axis": [ -0.734, 0.550, -0.399 ], "y_axis": [ 0.652, 0.406, -0.640 ], "z_axis": [ -0.190, -0.730, -0.656 ], "quaternion": [ 0.063, 0.359, 0.836, -0.410 ] } }, { "index": 151, "index_chain": 151, "chain_name": "I", "nt_resnum": 162, "nt_name": "DA", "nt_code": "A", "nt_id": "///I/162", "linked_nts": [ "///I/161", "///I/163" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop,phosphate", "alpha": -51.801, "beta": 145.098, "gamma": 53.467, "delta": 138.792, "epsilon": -174.883, "zeta": -85.715, "epsilon_zeta": -89.168, "bb_type": "BI", "chi": -125.412, "glyco_bond": "anti", "C5prime_xyz": [ -2.014, 8.653, -1.031 ], "P_xyz": [ 0.563, 9.003, -0.755 ], "form": ".", "ssZp": 2.269, "Dp": 2.286, "splay_angle": 21.667, "splay_distance": 4.038, "splay_ratio": 0.202, "d22": null, "d64": null, "eta": 160.655, "theta": -108.547, "eta_prime": -172.675, "theta_prime": -137.879, "eta_base": -146.918, "theta_base": -97.071, "v0": -25.272, "v1": 36.374, "v2": -33.068, "v3": 19.373, "v4": 3.460, "amplitude": 36.254, "phase_angle": 155.802, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.003, "origin": [ 117.603, 90.297, 153.408 ], "x_axis": [ -0.405, 0.776, -0.484 ], "y_axis": [ 0.895, 0.227, -0.384 ], "z_axis": [ -0.188, -0.589, -0.786 ], "quaternion": [ 0.095, 0.537, 0.777, -0.313 ] } }, { "index": 152, "index_chain": 152, "chain_name": "I", "nt_resnum": 163, "nt_name": "DT", "nt_code": "T", "nt_id": "///I/163", "linked_nts": [ "///I/162", "///I/164" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop", "alpha": -52.980, "beta": 179.381, "gamma": 33.796, "delta": 116.669, "epsilon": -168.649, "zeta": -110.594, "epsilon_zeta": -58.055, "bb_type": "BI", "chi": -126.825, "glyco_bond": "anti", "C5prime_xyz": [ -2.734, 8.682, -1.380 ], "P_xyz": [ -1.057, 10.653, -0.968 ], "form": "B", "ssZp": 2.671, "Dp": 2.632, "splay_angle": 21.943, "splay_distance": 3.604, "splay_ratio": 0.191, "d22": null, "d64": null, "eta": 167.001, "theta": -168.372, "eta_prime": -169.456, "theta_prime": -163.092, "eta_base": -113.416, "theta_base": -112.717, "v0": -38.166, "v1": 35.313, "v2": -19.578, "v3": -1.680, "v4": 24.866, "amplitude": 37.942, "phase_angle": 121.065, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.105, "frame": { "rmsd": 0.003, "origin": [ 115.580, 89.466, 150.013 ], "x_axis": [ 0.227, 0.757, -0.613 ], "y_axis": [ 0.961, -0.277, 0.014 ], "z_axis": [ -0.159, -0.592, -0.790 ], "quaternion": [ 0.200, 0.757, 0.567, -0.255 ] } }, { "index": 153, "index_chain": 153, "chain_name": "I", "nt_resnum": 164, "nt_name": "DG", "nt_code": "G", "nt_id": "///I/164", "linked_nts": [ "///I/163", "///I/165" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -65.429, "beta": 165.082, "gamma": 66.826, "delta": 143.972, "epsilon": -152.686, "zeta": -135.672, "epsilon_zeta": -17.014, "bb_type": "--", "chi": -116.731, "glyco_bond": "anti", "C5prime_xyz": [ -2.043, 8.543, -1.378 ], "P_xyz": [ 0.517, 9.099, -1.335 ], "form": "B", "ssZp": 1.903, "Dp": 1.936, "splay_angle": 20.734, "splay_distance": 3.442, "splay_ratio": 0.184, "d22": null, "d64": null, "eta": 173.079, "theta": -151.221, "eta_prime": -157.086, "theta_prime": -166.149, "eta_base": -106.412, "theta_base": -134.138, "v0": -22.943, "v1": 37.009, "v2": -36.208, "v3": 23.967, "v4": -0.921, "amplitude": 37.959, "phase_angle": 162.534, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.003, "frame": { "rmsd": 0.003, "origin": [ 115.586, 87.639, 146.907 ], "x_axis": [ 0.815, 0.395, -0.423 ], "y_axis": [ 0.555, -0.742, 0.377 ], "z_axis": [ -0.165, -0.542, -0.824 ], "quaternion": [ 0.250, 0.919, 0.258, -0.160 ] } }, { "index": 154, "index_chain": 154, "chain_name": "I", "nt_resnum": 165, "nt_name": "DG", "nt_code": "G", "nt_id": "///I/165", "linked_nts": [ "///I/164", "///I/166" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -61.370, "beta": 171.726, "gamma": 43.295, "delta": 145.321, "epsilon": -174.851, "zeta": -90.298, "epsilon_zeta": -84.554, "bb_type": "BI", "chi": -108.985, "glyco_bond": "anti", "C5prime_xyz": [ -1.606, 8.256, -1.673 ], "P_xyz": [ 0.898, 8.834, -1.152 ], "form": "B", "ssZp": 1.960, "Dp": 2.041, "splay_angle": 22.958, "splay_distance": 3.977, "splay_ratio": 0.200, "d22": null, "d64": null, "eta": 163.126, "theta": -116.078, "eta_prime": -175.157, "theta_prime": -134.261, "eta_base": -137.688, "theta_base": -87.300, "v0": -11.451, "v1": 27.486, "v2": -32.195, "v3": 26.412, "v4": -9.643, "amplitude": 32.209, "phase_angle": 178.334, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.007, "frame": { "rmsd": 0.007, "origin": [ 113.992, 85.430, 144.803 ], "x_axis": [ 0.993, -0.079, -0.093 ], "y_axis": [ -0.014, -0.827, 0.561 ], "z_axis": [ -0.121, -0.556, -0.822 ], "quaternion": [ 0.293, 0.954, -0.024, -0.056 ] } }, { "index": 155, "index_chain": 155, "chain_name": "I", "nt_resnum": 166, "nt_name": "DC", "nt_code": "C", "nt_id": "///I/166", "linked_nts": [ "///I/165", "///I/167" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -54.214, "beta": 171.032, "gamma": 45.333, "delta": 134.470, "epsilon": -157.433, "zeta": -150.389, "epsilon_zeta": -7.044, "bb_type": "--", "chi": -109.228, "glyco_bond": "anti", "C5prime_xyz": [ -2.778, 8.428, -1.844 ], "P_xyz": [ -0.661, 9.944, -1.973 ], "form": "B", "ssZp": 2.307, "Dp": 2.269, "splay_angle": 19.631, "splay_distance": 3.257, "splay_ratio": 0.175, "d22": null, "d64": null, "eta": 168.545, "theta": -178.155, "eta_prime": -158.674, "theta_prime": 177.479, "eta_base": -102.600, "theta_base": -141.309, "v0": -34.741, "v1": 42.565, "v2": -33.704, "v3": 14.753, "v4": 12.192, "amplitude": 41.543, "phase_angle": 144.224, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.003, "origin": [ 115.269, 82.789, 142.118 ], "x_axis": [ 0.760, -0.576, 0.301 ], "y_axis": [ -0.645, -0.611, 0.460 ], "z_axis": [ -0.081, -0.543, -0.836 ], "quaternion": [ 0.280, 0.895, -0.341, 0.061 ] } }, { "index": 156, "index_chain": 156, "chain_name": "I", "nt_resnum": 167, "nt_name": "DG", "nt_code": "G", "nt_id": "///I/167", "linked_nts": [ "///I/166", "///I/168" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -56.494, "beta": 150.011, "gamma": 54.565, "delta": 140.392, "epsilon": -167.866, "zeta": -105.628, "epsilon_zeta": -62.238, "bb_type": "BI", "chi": -126.883, "glyco_bond": "anti", "C5prime_xyz": [ -1.741, 8.691, -0.895 ], "P_xyz": [ 0.842, 8.854, -0.503 ], "form": "B", "ssZp": 2.203, "Dp": 2.191, "splay_angle": 19.042, "splay_distance": 3.196, "splay_ratio": 0.166, "d22": null, "d64": null, "eta": 164.622, "theta": -126.275, "eta_prime": -172.038, "theta_prime": -149.548, "eta_base": -128.228, "theta_base": -115.600, "v0": -20.361, "v1": 32.756, "v2": -32.078, "v3": 21.120, "v4": -0.682, "amplitude": 33.653, "phase_angle": 162.401, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.008, "frame": { "rmsd": 0.008, "origin": [ 114.300, 81.565, 139.260 ], "x_axis": [ 0.251, -0.799, 0.547 ], "y_axis": [ -0.963, -0.147, 0.228 ], "z_axis": [ -0.101, -0.583, -0.806 ], "quaternion": [ 0.273, 0.742, -0.593, 0.150 ] } }, { "index": 157, "index_chain": 157, "chain_name": "I", "nt_resnum": 168, "nt_name": "DG", "nt_code": "G", "nt_id": "///I/168", "linked_nts": [ "///I/167", "///I/169" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -53.859, "beta": -176.918, "gamma": 33.921, "delta": 138.286, "epsilon": -177.162, "zeta": -95.053, "epsilon_zeta": -82.109, "bb_type": "BI", "chi": -114.345, "glyco_bond": "anti", "C5prime_xyz": [ -1.771, 8.454, -1.553 ], "P_xyz": [ 0.423, 9.698, -0.886 ], "form": ".", "ssZp": 2.136, "Dp": 2.179, "splay_angle": 18.986, "splay_distance": 3.367, "splay_ratio": 0.169, "d22": null, "d64": null, "eta": 164.110, "theta": -134.863, "eta_prime": -171.833, "theta_prime": -145.705, "eta_base": -125.702, "theta_base": -106.674, "v0": -18.046, "v1": 29.841, "v2": -29.775, "v3": 20.112, "v4": -1.520, "amplitude": 30.973, "phase_angle": 164.012, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.009, "frame": { "rmsd": 0.009, "origin": [ 114.509, 79.854, 136.569 ], "x_axis": [ -0.367, -0.709, 0.603 ], "y_axis": [ -0.923, 0.359, -0.139 ], "z_axis": [ -0.118, -0.607, -0.786 ], "quaternion": [ -0.227, -0.515, 0.792, -0.235 ] } }, { "index": 158, "index_chain": 158, "chain_name": "I", "nt_resnum": 169, "nt_name": "DT", "nt_code": "T", "nt_id": "///I/169", "linked_nts": [ "///I/168", "///I/170" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -41.726, "beta": 176.347, "gamma": 29.085, "delta": 134.654, "epsilon": -146.180, "zeta": -149.481, "epsilon_zeta": 3.301, "bb_type": "--", "chi": -111.469, "glyco_bond": "anti", "C5prime_xyz": [ -2.552, 8.431, -1.770 ], "P_xyz": [ -0.661, 10.208, -1.486 ], "form": "B", "ssZp": 2.089, "Dp": 2.092, "splay_angle": 21.632, "splay_distance": 3.645, "splay_ratio": 0.193, "d22": null, "d64": null, "eta": 175.585, "theta": -170.663, "eta_prime": -162.332, "theta_prime": -169.050, "eta_base": -116.419, "theta_base": -122.441, "v0": -32.404, "v1": 40.570, "v2": -32.914, "v3": 15.140, "v4": 10.589, "amplitude": 39.719, "phase_angle": 145.963, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.105, "frame": { "rmsd": 0.003, "origin": [ 114.262, 77.101, 134.645 ], "x_axis": [ -0.802, -0.402, 0.441 ], "y_axis": [ -0.588, 0.658, -0.470 ], "z_axis": [ -0.101, -0.637, -0.764 ], "quaternion": [ -0.151, -0.276, 0.898, -0.308 ] } }, { "index": 159, "index_chain": 159, "chain_name": "I", "nt_resnum": 170, "nt_name": "DA", "nt_code": "A", "nt_id": "///I/170", "linked_nts": [ "///I/169", "///I/171" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -44.405, "beta": 142.586, "gamma": 46.408, "delta": 137.552, "epsilon": -154.686, "zeta": -125.771, "epsilon_zeta": -28.915, "bb_type": "--", "chi": -116.377, "glyco_bond": "anti", "C5prime_xyz": [ -2.022, 8.508, -1.512 ], "P_xyz": [ 0.552, 8.896, -1.314 ], "form": "B", "ssZp": 2.033, "Dp": 2.078, "splay_angle": 19.514, "splay_distance": 3.344, "splay_ratio": 0.170, "d22": null, "d64": null, "eta": 171.316, "theta": -136.075, "eta_prime": -164.816, "theta_prime": -157.159, "eta_base": -117.600, "theta_base": -123.429, "v0": -24.729, "v1": 35.333, "v2": -32.120, "v3": 18.635, "v4": 3.614, "amplitude": 35.297, "phase_angle": 155.505, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.039, "frame": { "rmsd": 0.006, "origin": [ 113.851, 75.423, 131.436 ], "x_axis": [ -0.995, 0.083, 0.061 ], "y_axis": [ 0.027, 0.778, -0.628 ], "z_axis": [ -0.100, -0.623, -0.776 ], "quaternion": [ -0.043, 0.029, 0.942, -0.332 ] } }, { "index": 160, "index_chain": 160, "chain_name": "I", "nt_resnum": 171, "nt_name": "DA", "nt_code": "A", "nt_id": "///I/171", "linked_nts": [ "///I/170", "///I/172" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -43.248, "beta": 151.359, "gamma": 39.031, "delta": 117.520, "epsilon": -174.591, "zeta": -95.019, "epsilon_zeta": -79.573, "bb_type": "BI", "chi": -127.652, "glyco_bond": "anti", "C5prime_xyz": [ -2.325, 8.709, -1.323 ], "P_xyz": [ -0.001, 9.863, -1.026 ], "form": ".", "ssZp": 2.509, "Dp": 2.555, "splay_angle": 20.087, "splay_distance": 3.532, "splay_ratio": 0.178, "d22": null, "d64": null, "eta": 164.903, "theta": -144.188, "eta_prime": -174.718, "theta_prime": -152.774, "eta_base": -131.386, "theta_base": -115.834, "v0": -32.987, "v1": 31.164, "v2": -18.180, "v3": -0.192, "v4": 20.745, "amplitude": 33.088, "phase_angle": 123.328, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.005, "origin": [ 113.692, 73.027, 129.108 ], "x_axis": [ -0.829, 0.505, -0.241 ], "y_axis": [ 0.546, 0.635, -0.547 ], "z_axis": [ -0.123, -0.584, -0.802 ], "quaternion": [ 0.032, 0.291, 0.904, -0.313 ] } }, { "index": 161, "index_chain": 161, "chain_name": "I", "nt_resnum": 172, "nt_name": "DC", "nt_code": "C", "nt_id": "///I/172", "linked_nts": [ "///I/171", "///I/173" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -40.620, "beta": 175.247, "gamma": 32.333, "delta": 132.916, "epsilon": -144.631, "zeta": -129.064, "epsilon_zeta": -15.566, "bb_type": "--", "chi": -118.075, "glyco_bond": "anti", "C5prime_xyz": [ -2.323, 8.612, -1.521 ], "P_xyz": [ -0.333, 10.229, -1.008 ], "form": "B", "ssZp": 2.054, "Dp": 2.078, "splay_angle": 23.016, "splay_distance": 3.902, "splay_ratio": 0.201, "d22": null, "d64": null, "eta": 179.619, "theta": -152.921, "eta_prime": -160.526, "theta_prime": -152.346, "eta_base": -117.469, "theta_base": -108.645, "v0": -31.233, "v1": 38.467, "v2": -30.818, "v3": 13.750, "v4": 10.705, "amplitude": 37.667, "phase_angle": 144.902, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.062, "frame": { "rmsd": 0.003, "origin": [ 112.291, 70.981, 126.593 ], "x_axis": [ -0.387, 0.793, -0.470 ], "y_axis": [ 0.910, 0.246, -0.333 ], "z_axis": [ -0.149, -0.557, -0.817 ], "quaternion": [ 0.103, 0.544, 0.783, -0.284 ] } }, { "index": 162, "index_chain": 162, "chain_name": "I", "nt_resnum": 173, "nt_name": "DG", "nt_code": "G", "nt_id": "///I/173", "linked_nts": [ "///I/172", "///I/174" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -50.846, "beta": 149.735, "gamma": 48.542, "delta": 136.472, "epsilon": -152.979, "zeta": -135.606, "epsilon_zeta": -17.372, "bb_type": "--", "chi": -110.411, "glyco_bond": "anti", "C5prime_xyz": [ -2.476, 8.410, -1.800 ], "P_xyz": [ 0.009, 9.219, -1.960 ], "form": "B", "ssZp": 2.113, "Dp": 2.132, "splay_angle": 23.683, "splay_distance": 3.941, "splay_ratio": 0.208, "d22": null, "d64": null, "eta": 168.249, "theta": -153.179, "eta_prime": -163.620, "theta_prime": -165.069, "eta_base": -117.341, "theta_base": -119.777, "v0": -29.065, "v1": 38.549, "v2": -32.884, "v3": 17.090, "v4": 7.242, "amplitude": 37.864, "phase_angle": 150.284, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.003, "frame": { "rmsd": 0.003, "origin": [ 112.309, 69.144, 123.150 ], "x_axis": [ 0.246, 0.791, -0.561 ], "y_axis": [ 0.955, -0.295, 0.003 ], "z_axis": [ -0.163, -0.537, -0.828 ], "quaternion": [ 0.175, 0.770, 0.567, -0.235 ] } }, { "index": 163, "index_chain": 163, "chain_name": "I", "nt_resnum": 174, "nt_name": "DG", "nt_code": "G", "nt_id": "///I/174", "linked_nts": [ "///I/173", "///I/175" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -58.006, "beta": 148.661, "gamma": 62.036, "delta": 140.229, "epsilon": -171.160, "zeta": -112.488, "epsilon_zeta": -58.672, "bb_type": "BI", "chi": -117.072, "glyco_bond": "anti", "C5prime_xyz": [ -2.241, 8.558, -1.431 ], "P_xyz": [ 0.334, 9.017, -1.590 ], "form": "B", "ssZp": 2.211, "Dp": 2.227, "splay_angle": 25.250, "splay_distance": 4.103, "splay_ratio": 0.219, "d22": null, "d64": null, "eta": 163.302, "theta": -132.819, "eta_prime": -162.697, "theta_prime": -157.526, "eta_base": -113.837, "theta_base": -105.706, "v0": -26.512, "v1": 38.287, "v2": -34.819, "v3": 20.525, "v4": 3.466, "amplitude": 38.118, "phase_angle": 155.987, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.003, "frame": { "rmsd": 0.003, "origin": [ 112.273, 66.796, 119.985 ], "x_axis": [ 0.783, 0.413, -0.465 ], "y_axis": [ 0.596, -0.712, 0.371 ], "z_axis": [ -0.178, -0.568, -0.804 ], "quaternion": [ 0.258, 0.908, 0.277, -0.177 ] } }, { "index": 164, "index_chain": 164, "chain_name": "I", "nt_resnum": 175, "nt_name": "DA", "nt_code": "A", "nt_id": "///I/175", "linked_nts": [ "///I/174", null ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack", "alpha": -62.403, "beta": 168.287, "gamma": 61.879, "delta": 139.196, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": -121.948, "glyco_bond": "anti", "C5prime_xyz": [ -2.099, 8.587, -1.202 ], "P_xyz": [ 0.389, 9.361, -0.938 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": -25.347, "v1": 36.571, "v2": -33.290, "v3": 19.643, "v4": 3.320, "amplitude": 36.438, "phase_angle": 156.010, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.006, "origin": [ 112.481, 64.521, 116.577 ], "x_axis": [ 0.963, -0.252, -0.094 ], "y_axis": [ -0.128, -0.737, 0.664 ], "z_axis": [ -0.236, -0.628, -0.742 ], "quaternion": [ 0.348, 0.928, -0.102, -0.089 ] } }, { "index": 165, "index_chain": 1, "chain_name": "J", "nt_resnum": 6, "nt_name": "DT", "nt_code": "T", "nt_id": "///J/6", "linked_nts": [ null, "///J/7" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack", "alpha": null, "beta": 161.602, "gamma": 68.913, "delta": 148.912, "epsilon": -159.553, "zeta": -121.971, "epsilon_zeta": -37.582, "bb_type": "BI", "chi": -128.864, "glyco_bond": "anti", "C5prime_xyz": [ -1.770, 8.643, -0.664 ], "P_xyz": [ 0.805, 8.873, -0.224 ], "form": "B", "ssZp": 1.787, "Dp": 1.933, "splay_angle": 20.009, "splay_distance": 3.231, "splay_ratio": 0.176, "d22": 5.536, "d64": 4.584, "eta": null, "theta": -133.784, "eta_prime": null, "theta_prime": -155.748, "eta_base": null, "theta_base": -118.879, "v0": -19.637, "v1": 36.307, "v2": -38.192, "v3": 27.940, "v4": -5.469, "amplitude": 38.887, "phase_angle": 169.147, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.105, "frame": { "rmsd": 0.005, "origin": [ 112.710, 65.158, 118.485 ], "x_axis": [ 0.950, -0.246, -0.194 ], "y_axis": [ 0.055, 0.739, -0.671 ], "z_axis": [ 0.309, 0.627, 0.715 ], "quaternion": [ 0.922, -0.352, 0.136, -0.082 ] } }, { "index": 166, "index_chain": 2, "chain_name": "J", "nt_resnum": 7, "nt_name": "DC", "nt_code": "C", "nt_id": "///J/7", "linked_nts": [ "///J/6", "///J/8" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -76.921, "beta": 175.705, "gamma": 63.501, "delta": 148.736, "epsilon": -162.413, "zeta": -124.081, "epsilon_zeta": -38.332, "bb_type": "BI", "chi": -102.679, "glyco_bond": "anti", "C5prime_xyz": [ -1.971, 8.201, -1.950 ], "P_xyz": [ 0.604, 8.716, -1.980 ], "form": "B", "ssZp": 1.852, "Dp": 1.919, "splay_angle": 23.350, "splay_distance": 3.871, "splay_ratio": 0.205, "d22": 4.901, "d64": 3.931, "eta": 166.344, "theta": -138.921, "eta_prime": -164.601, "theta_prime": -157.582, "eta_base": -121.465, "theta_base": -112.980, "v0": -18.020, "v1": 34.904, "v2": -37.531, "v3": 28.192, "v4": -6.641, "amplitude": 37.988, "phase_angle": 171.099, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.003, "origin": [ 112.758, 67.174, 121.009 ], "x_axis": [ 0.812, 0.449, -0.373 ], "y_axis": [ -0.569, 0.749, -0.339 ], "z_axis": [ 0.127, 0.487, 0.864 ], "quaternion": [ 0.925, -0.223, 0.135, 0.275 ] } }, { "index": 167, "index_chain": 3, "chain_name": "J", "nt_resnum": 8, "nt_name": "DC", "nt_code": "C", "nt_id": "///J/8", "linked_nts": [ "///J/7", "///J/9" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -65.473, "beta": 165.836, "gamma": 59.221, "delta": 146.109, "epsilon": -160.708, "zeta": -133.598, "epsilon_zeta": -27.110, "bb_type": "--", "chi": -104.409, "glyco_bond": "anti", "C5prime_xyz": [ -2.159, 8.300, -1.906 ], "P_xyz": [ 0.395, 8.874, -2.083 ], "form": "B", "ssZp": 2.010, "Dp": 2.021, "splay_angle": 19.369, "splay_distance": 3.247, "splay_ratio": 0.175, "d22": null, "d64": null, "eta": 166.943, "theta": -150.191, "eta_prime": -163.541, "theta_prime": -167.231, "eta_base": -115.562, "theta_base": -125.020, "v0": -22.322, "v1": 37.512, "v2": -37.566, "v3": 25.692, "v4": -2.375, "amplitude": 38.958, "phase_angle": 164.636, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.064, "frame": { "rmsd": 0.003, "origin": [ 112.800, 69.685, 123.955 ], "x_axis": [ 0.264, 0.817, -0.513 ], "y_axis": [ -0.953, 0.302, -0.009 ], "z_axis": [ 0.148, 0.491, 0.858 ], "quaternion": [ 0.778, -0.161, 0.212, 0.568 ] } }, { "index": 168, "index_chain": 4, "chain_name": "J", "nt_resnum": 9, "nt_name": "DG", "nt_code": "G", "nt_id": "///J/9", "linked_nts": [ "///J/8", "///J/10" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -67.634, "beta": 166.383, "gamma": 56.039, "delta": 144.057, "epsilon": -172.849, "zeta": -103.137, "epsilon_zeta": -69.711, "bb_type": "BI", "chi": -110.693, "glyco_bond": "anti", "C5prime_xyz": [ -1.704, 8.335, -1.627 ], "P_xyz": [ 0.887, 8.651, -1.417 ], "form": "B", "ssZp": 2.017, "Dp": 2.074, "splay_angle": 18.813, "splay_distance": 3.304, "splay_ratio": 0.166, "d22": null, "d64": null, "eta": 161.508, "theta": -125.358, "eta_prime": -172.616, "theta_prime": -152.878, "eta_base": -125.520, "theta_base": -126.036, "v0": -14.457, "v1": 29.490, "v2": -32.534, "v3": 25.018, "v4": -6.870, "amplitude": 32.769, "phase_angle": 173.132, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.007, "frame": { "rmsd": 0.007, "origin": [ 112.554, 71.018, 126.906 ], "x_axis": [ -0.400, 0.771, -0.496 ], "y_axis": [ -0.905, -0.247, 0.346 ], "z_axis": [ 0.144, 0.587, 0.796 ], "quaternion": [ 0.536, -0.113, 0.299, 0.782 ] } }, { "index": 169, "index_chain": 5, "chain_name": "J", "nt_resnum": 10, "nt_name": "DT", "nt_code": "T", "nt_id": "///J/10", "linked_nts": [ "///J/9", "///J/11" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -54.717, "beta": 174.948, "gamma": 39.379, "delta": 113.328, "epsilon": -172.691, "zeta": -96.730, "epsilon_zeta": -75.961, "bb_type": "BI", "chi": -120.526, "glyco_bond": "anti", "C5prime_xyz": [ -2.364, 8.558, -1.714 ], "P_xyz": [ -0.262, 10.105, -1.661 ], "form": "B", "ssZp": 2.462, "Dp": 2.660, "splay_angle": 21.085, "splay_distance": 3.663, "splay_ratio": 0.183, "d22": 4.306, "d64": 4.003, "eta": 168.773, "theta": -153.738, "eta_prime": -175.918, "theta_prime": -155.532, "eta_base": -138.749, "theta_base": -120.497, "v0": -31.713, "v1": 27.104, "v2": -13.144, "v3": -4.599, "v4": 22.840, "amplitude": 30.955, "phase_angle": 115.127, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.003, "origin": [ 113.828, 73.066, 129.163 ], "x_axis": [ -0.789, 0.551, -0.271 ], "y_axis": [ -0.591, -0.560, 0.581 ], "z_axis": [ 0.168, 0.619, 0.767 ], "quaternion": [ 0.323, -0.029, 0.340, 0.883 ] } }, { "index": 170, "index_chain": 6, "chain_name": "J", "nt_resnum": 11, "nt_name": "DT", "nt_code": "T", "nt_id": "///J/11", "linked_nts": [ "///J/10", "///J/12" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -38.958, "beta": 169.015, "gamma": 36.744, "delta": 127.217, "epsilon": -150.148, "zeta": -133.600, "epsilon_zeta": -16.548, "bb_type": "--", "chi": -113.248, "glyco_bond": "anti", "C5prime_xyz": [ -2.531, 8.450, -1.798 ], "P_xyz": [ -0.390, 9.938, -1.769 ], "form": "B", "ssZp": 2.225, "Dp": 2.306, "splay_angle": 23.897, "splay_distance": 4.054, "splay_ratio": 0.210, "d22": null, "d64": null, "eta": 179.444, "theta": -160.815, "eta_prime": -160.629, "theta_prime": -161.772, "eta_base": -122.235, "theta_base": -114.470, "v0": -32.716, "v1": 36.559, "v2": -26.527, "v3": 8.410, "v4": 15.099, "amplitude": 36.234, "phase_angle": 137.063, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.003, "origin": [ 114.015, 75.734, 131.665 ], "x_axis": [ -0.986, 0.166, 0.033 ], "y_axis": [ -0.099, -0.723, 0.684 ], "z_axis": [ 0.138, 0.671, 0.729 ], "quaternion": [ 0.072, 0.046, 0.366, 0.927 ] } }, { "index": 171, "index_chain": 7, "chain_name": "J", "nt_resnum": 12, "nt_name": "DA", "nt_code": "A", "nt_id": "///J/12", "linked_nts": [ "///J/11", "///J/13" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -47.044, "beta": 138.567, "gamma": 59.463, "delta": 128.123, "epsilon": -164.746, "zeta": -117.593, "epsilon_zeta": -47.153, "bb_type": "BI", "chi": -123.335, "glyco_bond": "anti", "C5prime_xyz": [ -2.328, 8.653, -1.350 ], "P_xyz": [ 0.224, 9.112, -1.616 ], "form": "B", "ssZp": 2.383, "Dp": 2.374, "splay_angle": 20.197, "splay_distance": 3.417, "splay_ratio": 0.176, "d22": null, "d64": null, "eta": 169.407, "theta": -144.173, "eta_prime": -160.644, "theta_prime": -164.276, "eta_base": -110.764, "theta_base": -128.920, "v0": -31.859, "v1": 36.379, "v2": -27.118, "v3": 9.490, "v4": 13.863, "amplitude": 35.944, "phase_angle": 138.976, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.005, "origin": [ 114.131, 77.687, 135.215 ], "x_axis": [ -0.836, -0.312, 0.452 ], "y_axis": [ 0.529, -0.677, 0.512 ], "z_axis": [ 0.146, 0.667, 0.730 ], "quaternion": [ -0.233, 0.166, 0.327, 0.900 ] } }, { "index": 172, "index_chain": 8, "chain_name": "J", "nt_resnum": 13, "nt_name": "DC", "nt_code": "C", "nt_id": "///J/13", "linked_nts": [ "///J/12", "///J/14" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -48.212, "beta": 165.274, "gamma": 42.338, "delta": 129.853, "epsilon": -173.948, "zeta": -97.780, "epsilon_zeta": -76.168, "bb_type": "BI", "chi": -125.543, "glyco_bond": "anti", "C5prime_xyz": [ -2.010, 8.751, -1.205 ], "P_xyz": [ 0.321, 9.815, -0.686 ], "form": "B", "ssZp": 2.365, "Dp": 2.376, "splay_angle": 18.888, "splay_distance": 3.237, "splay_ratio": 0.166, "d22": 4.042, "d64": 3.625, "eta": 167.790, "theta": -139.327, "eta_prime": -171.002, "theta_prime": -149.502, "eta_base": -126.913, "theta_base": -105.571, "v0": -28.385, "v1": 34.379, "v2": -27.225, "v3": 11.585, "v4": 10.385, "amplitude": 33.784, "phase_angle": 143.694, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.004, "origin": [ 114.327, 80.378, 137.312 ], "x_axis": [ -0.398, -0.670, 0.627 ], "y_axis": [ 0.905, -0.400, 0.146 ], "z_axis": [ 0.153, 0.626, 0.765 ], "quaternion": [ -0.492, 0.244, 0.241, 0.800 ] } }, { "index": 173, "index_chain": 9, "chain_name": "J", "nt_resnum": 14, "nt_name": "DC", "nt_code": "C", "nt_id": "///J/14", "linked_nts": [ "///J/13", "///J/15" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -49.933, "beta": 179.238, "gamma": 35.943, "delta": 138.297, "epsilon": -167.475, "zeta": -114.621, "epsilon_zeta": -52.854, "bb_type": "BI", "chi": -114.075, "glyco_bond": "anti", "C5prime_xyz": [ -2.090, 8.524, -1.618 ], "P_xyz": [ 0.056, 9.934, -1.110 ], "form": "B", "ssZp": 2.190, "Dp": 2.212, "splay_angle": 19.194, "splay_distance": 3.205, "splay_ratio": 0.167, "d22": null, "d64": null, "eta": 167.537, "theta": -147.889, "eta_prime": -166.799, "theta_prime": -154.775, "eta_base": -113.918, "theta_base": -103.712, "v0": -26.270, "v1": 37.148, "v2": -33.366, "v3": 19.028, "v4": 4.320, "amplitude": 36.930, "phase_angle": 154.623, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.003, "origin": [ 114.190, 81.922, 140.154 ], "x_axis": [ 0.234, -0.799, 0.554 ], "y_axis": [ 0.964, 0.116, -0.241 ], "z_axis": [ 0.128, 0.590, 0.797 ], "quaternion": [ 0.733, -0.284, -0.145, -0.601 ] } }, { "index": 174, "index_chain": 10, "chain_name": "J", "nt_resnum": 15, "nt_name": "DG", "nt_code": "G", "nt_id": "///J/15", "linked_nts": [ "///J/14", "///J/16" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -56.314, "beta": 160.059, "gamma": 54.680, "delta": 141.428, "epsilon": -153.340, "zeta": -140.501, "epsilon_zeta": -12.840, "bb_type": "--", "chi": -117.193, "glyco_bond": "anti", "C5prime_xyz": [ -2.343, 8.579, -1.429 ], "P_xyz": [ 0.099, 9.512, -1.280 ], "form": "B", "ssZp": 2.017, "Dp": 2.048, "splay_angle": 21.438, "splay_distance": 3.500, "splay_ratio": 0.189, "d22": null, "d64": null, "eta": 168.543, "theta": -159.445, "eta_prime": -161.689, "theta_prime": -168.969, "eta_base": -105.393, "theta_base": -137.707, "v0": -28.811, "v1": 40.978, "v2": -36.841, "v3": 21.246, "v4": 4.450, "amplitude": 40.666, "phase_angle": 154.950, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.003, "frame": { "rmsd": 0.003, "origin": [ 115.044, 83.223, 142.955 ], "x_axis": [ 0.786, -0.563, 0.254 ], "y_axis": [ 0.604, 0.616, -0.505 ], "z_axis": [ 0.128, 0.551, 0.825 ], "quaternion": [ 0.898, -0.294, -0.035, -0.325 ] } }, { "index": 175, "index_chain": 11, "chain_name": "J", "nt_resnum": 16, "nt_name": "DC", "nt_code": "C", "nt_id": "///J/16", "linked_nts": [ "///J/15", "///J/17" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -54.549, "beta": 177.928, "gamma": 36.148, "delta": 145.840, "epsilon": -177.143, "zeta": -91.879, "epsilon_zeta": -85.264, "bb_type": "BI", "chi": -104.867, "glyco_bond": "anti", "C5prime_xyz": [ -1.429, 8.077, -1.861 ], "P_xyz": [ 1.046, 8.748, -1.313 ], "form": "B", "ssZp": 1.851, "Dp": 2.015, "splay_angle": 22.280, "splay_distance": 3.816, "splay_ratio": 0.193, "d22": 4.077, "d64": 3.698, "eta": 170.062, "theta": -122.138, "eta_prime": -173.817, "theta_prime": -136.877, "eta_base": -139.305, "theta_base": -91.746, "v0": -6.689, "v1": 23.503, "v2": -30.403, "v3": 27.313, "v4": -13.220, "amplitude": 30.588, "phase_angle": 186.306, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.004, "origin": [ 114.246, 85.600, 145.397 ], "x_axis": [ 0.990, -0.097, -0.106 ], "y_axis": [ 0.024, 0.837, -0.546 ], "z_axis": [ 0.142, 0.538, 0.831 ], "quaternion": [ 0.956, -0.283, 0.065, -0.032 ] } }, { "index": 176, "index_chain": 12, "chain_name": "J", "nt_resnum": 17, "nt_name": "DC", "nt_code": "C", "nt_id": "///J/17", "linked_nts": [ "///J/16", "///J/18" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -51.496, "beta": 172.120, "gamma": 44.543, "delta": 139.548, "epsilon": -139.904, "zeta": -146.956, "epsilon_zeta": 7.052, "bb_type": "--", "chi": -103.130, "glyco_bond": "anti", "C5prime_xyz": [ -2.651, 8.272, -2.044 ], "P_xyz": [ -0.444, 9.663, -2.209 ], "form": "B", "ssZp": 1.859, "Dp": 1.896, "splay_angle": 22.215, "splay_distance": 3.769, "splay_ratio": 0.197, "d22": null, "d64": null, "eta": 176.553, "theta": -160.870, "eta_prime": -152.977, "theta_prime": -174.569, "eta_base": -102.570, "theta_base": -125.791, "v0": -30.901, "v1": 41.779, "v2": -36.049, "v3": 19.353, "v4": 6.908, "amplitude": 41.019, "phase_angle": 151.502, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.062, "frame": { "rmsd": 0.002, "origin": [ 116.075, 87.997, 147.737 ], "x_axis": [ 0.801, 0.418, -0.428 ], "y_axis": [ -0.568, 0.757, -0.324 ], "z_axis": [ 0.189, 0.502, 0.844 ], "quaternion": [ 0.922, -0.224, 0.167, 0.267 ] } }, { "index": 177, "index_chain": 13, "chain_name": "J", "nt_resnum": 18, "nt_name": "DA", "nt_code": "A", "nt_id": "///J/18", "linked_nts": [ "///J/17", "///J/19" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop", "alpha": -53.518, "beta": 150.978, "gamma": 17.868, "delta": 87.684, "epsilon": 179.185, "zeta": -88.641, "epsilon_zeta": -92.175, "bb_type": "BI", "chi": -139.386, "glyco_bond": "anti", "C5prime_xyz": [ -1.283, 8.691, -0.672 ], "P_xyz": [ 1.286, 9.098, -0.374 ], "form": ".", "ssZp": 3.710, "Dp": 4.209, "splay_angle": 32.277, "splay_distance": 5.279, "splay_ratio": 0.278, "d22": null, "d64": null, "eta": 152.914, "theta": -173.822, "eta_prime": 156.125, "theta_prime": -172.309, "eta_base": -145.270, "theta_base": -178.319, "v0": 2.133, "v1": -22.804, "v2": 33.505, "v3": -33.139, "v4": 19.746, "amplitude": 34.714, "phase_angle": 15.165, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.004, "origin": [ 116.064, 90.182, 150.808 ], "x_axis": [ 0.202, 0.688, -0.698 ], "y_axis": [ -0.974, 0.217, -0.068 ], "z_axis": [ 0.105, 0.693, 0.713 ], "quaternion": [ 0.730, -0.261, 0.275, 0.569 ] } }, { "index": 178, "index_chain": 14, "chain_name": "J", "nt_resnum": 19, "nt_name": "DT", "nt_code": "T", "nt_id": "///J/19", "linked_nts": [ "///J/18", "///J/20" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop", "alpha": -46.211, "beta": 164.441, "gamma": 65.769, "delta": 138.743, "epsilon": 173.626, "zeta": -84.885, "epsilon_zeta": -101.489, "bb_type": "BI", "chi": -135.408, "glyco_bond": "anti", "C5prime_xyz": [ -2.159, 8.820, -0.552 ], "P_xyz": [ 0.289, 9.590, -0.034 ], "form": ".", "ssZp": 2.084, "Dp": 2.387, "splay_angle": 28.211, "splay_distance": 4.910, "splay_ratio": 0.257, "d22": 3.591, "d64": 3.573, "eta": 173.611, "theta": -92.883, "eta_prime": -153.269, "theta_prime": -127.450, "eta_base": -156.230, "theta_base": -60.704, "v0": -29.672, "v1": 40.350, "v2": -35.092, "v3": 18.899, "v4": 6.493, "amplitude": 39.773, "phase_angle": 151.921, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1b", "suiteness": 0.255, "filter_rmsd": 0.106, "frame": { "rmsd": 0.002, "origin": [ 117.147, 89.920, 155.968 ], "x_axis": [ 0.231, 0.641, -0.732 ], "y_axis": [ -0.964, 0.253, -0.083 ], "z_axis": [ 0.132, 0.724, 0.677 ], "quaternion": [ 0.735, -0.275, 0.294, 0.546 ] } }, { "index": 179, "index_chain": 15, "chain_name": "J", "nt_resnum": 20, "nt_name": "DC", "nt_code": "C", "nt_id": "///J/20", "linked_nts": [ "///J/19", "///J/21" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop", "alpha": 150.382, "beta": -177.459, "gamma": -178.959, "delta": 144.742, "epsilon": -133.419, "zeta": -118.687, "epsilon_zeta": -14.732, "bb_type": "--", "chi": -141.581, "glyco_bond": "anti", "C5prime_xyz": [ -1.724, 8.839, -0.052 ], "P_xyz": [ 0.092, 10.282, -1.264 ], "form": ".", "ssZp": 1.608, "Dp": 1.692, "splay_angle": 21.740, "splay_distance": 3.653, "splay_ratio": 0.193, "d22": null, "d64": null, "eta": -173.313, "theta": -178.769, "eta_prime": -152.227, "theta_prime": -166.838, "eta_base": -71.826, "theta_base": -139.959, "v0": -23.279, "v1": 37.726, "v2": -37.123, "v3": 24.509, "v4": -0.996, "amplitude": 38.874, "phase_angle": 162.739, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.064, "frame": { "rmsd": 0.004, "origin": [ 117.021, 94.822, 155.730 ], "x_axis": [ -0.743, 0.505, -0.439 ], "y_axis": [ -0.660, -0.447, 0.604 ], "z_axis": [ 0.109, 0.738, 0.666 ], "quaternion": [ 0.345, -0.098, 0.397, 0.845 ] } }, { "index": 180, "index_chain": 16, "chain_name": "J", "nt_resnum": 21, "nt_name": "DA", "nt_code": "A", "nt_id": "///J/21", "linked_nts": [ "///J/20", "///J/22" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -76.130, "beta": 178.985, "gamma": 38.515, "delta": 145.245, "epsilon": -167.421, "zeta": -114.584, "epsilon_zeta": -52.837, "bb_type": "BI", "chi": -102.689, "glyco_bond": "anti", "C5prime_xyz": [ -1.665, 8.025, -1.996 ], "P_xyz": [ 0.790, 8.872, -1.635 ], "form": "B", "ssZp": 1.818, "Dp": 2.024, "splay_angle": 19.863, "splay_distance": 3.349, "splay_ratio": 0.174, "d22": null, "d64": null, "eta": 151.835, "theta": -140.056, "eta_prime": 179.771, "theta_prime": -153.267, "eta_base": -149.615, "theta_base": -112.355, "v0": -11.352, "v1": 27.406, "v2": -32.146, "v3": 26.366, "v4": -9.662, "amplitude": 32.158, "phase_angle": 178.419, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.005, "origin": [ 118.896, 96.327, 158.481 ], "x_axis": [ -0.985, 0.159, -0.060 ], "y_axis": [ -0.150, -0.640, 0.754 ], "z_axis": [ 0.081, 0.752, 0.654 ], "quaternion": [ 0.085, 0.006, 0.416, 0.905 ] } }, { "index": 181, "index_chain": 17, "chain_name": "J", "nt_resnum": 22, "nt_name": "DA", "nt_code": "A", "nt_id": "///J/22", "linked_nts": [ "///J/21", "///J/23" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -56.401, "beta": 163.619, "gamma": 51.351, "delta": 132.871, "epsilon": -172.467, "zeta": -104.204, "epsilon_zeta": -68.263, "bb_type": "BI", "chi": -109.240, "glyco_bond": "anti", "C5prime_xyz": [ -2.172, 8.310, -1.909 ], "P_xyz": [ 0.312, 9.102, -2.075 ], "form": "B", "ssZp": 2.194, "Dp": 2.294, "splay_angle": 20.305, "splay_distance": 3.551, "splay_ratio": 0.178, "d22": null, "d64": null, "eta": 164.381, "theta": -137.390, "eta_prime": -168.249, "theta_prime": -156.059, "eta_base": -121.440, "theta_base": -119.210, "v0": -24.786, "v1": 32.832, "v2": -28.209, "v3": 14.685, "v4": 6.140, "amplitude": 32.404, "phase_angle": 150.523, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.004, "origin": [ 118.991, 98.435, 161.082 ], "x_axis": [ -0.896, -0.261, 0.360 ], "y_axis": [ 0.444, -0.565, 0.695 ], "z_axis": [ 0.021, 0.783, 0.622 ], "quaternion": [ -0.201, 0.109, 0.421, 0.878 ] } }, { "index": 182, "index_chain": 18, "chain_name": "J", "nt_resnum": 23, "nt_name": "DT", "nt_code": "T", "nt_id": "///J/23", "linked_nts": [ "///J/22", "///J/24" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -49.145, "beta": 164.458, "gamma": 48.619, "delta": 113.922, "epsilon": -166.320, "zeta": -101.845, "epsilon_zeta": -64.475, "bb_type": "BI", "chi": -124.885, "glyco_bond": "anti", "C5prime_xyz": [ -2.637, 8.636, -1.530 ], "P_xyz": [ -0.471, 10.085, -1.651 ], "form": "B", "ssZp": 2.555, "Dp": 2.610, "splay_angle": 23.088, "splay_distance": 3.961, "splay_ratio": 0.200, "d22": null, "d64": null, "eta": 175.190, "theta": -151.655, "eta_prime": -166.745, "theta_prime": -156.708, "eta_base": -122.572, "theta_base": -109.027, "v0": -36.864, "v1": 32.223, "v2": -16.163, "v3": -4.427, "v4": 25.861, "amplitude": 36.108, "phase_angle": 116.591, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.002, "origin": [ 118.228, 101.157, 163.231 ], "x_axis": [ -0.526, -0.526, 0.669 ], "y_axis": [ 0.850, -0.311, 0.424 ], "z_axis": [ -0.015, 0.792, 0.611 ], "quaternion": [ -0.440, 0.209, 0.389, 0.782 ] } }, { "index": 183, "index_chain": 19, "chain_name": "J", "nt_resnum": 24, "nt_name": "DA", "nt_code": "A", "nt_id": "///J/24", "linked_nts": [ "///J/23", "///J/25" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -49.563, "beta": 156.520, "gamma": 55.935, "delta": 109.298, "epsilon": -168.334, "zeta": -95.972, "epsilon_zeta": -72.361, "bb_type": "BI", "chi": -133.883, "glyco_bond": "anti", "C5prime_xyz": [ -2.443, 8.777, -1.142 ], "P_xyz": [ -0.084, 9.895, -1.268 ], "form": "B", "ssZp": 2.759, "Dp": 2.795, "splay_angle": 22.766, "splay_distance": 3.936, "splay_ratio": 0.198, "d22": null, "d64": null, "eta": 175.157, "theta": -150.355, "eta_prime": -162.896, "theta_prime": -156.461, "eta_base": -108.579, "theta_base": -122.373, "v0": -34.444, "v1": 26.683, "v2": -9.881, "v3": -9.503, "v4": 27.665, "amplitude": 33.431, "phase_angle": 107.191, "puckering": "O4'-endo", "sugar_class": "--", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.003, "origin": [ 117.827, 103.360, 166.499 ], "x_axis": [ 0.134, -0.600, 0.789 ], "y_axis": [ 0.991, 0.100, -0.092 ], "z_axis": [ -0.024, 0.794, 0.608 ], "quaternion": [ 0.679, -0.326, -0.299, -0.586 ] } }, { "index": 184, "index_chain": 20, "chain_name": "J", "nt_resnum": 25, "nt_name": "DT", "nt_code": "T", "nt_id": "///J/25", "linked_nts": [ "///J/24", "///J/26" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -52.029, "beta": 165.250, "gamma": 53.074, "delta": 121.521, "epsilon": -171.412, "zeta": -93.706, "epsilon_zeta": -77.706, "bb_type": "BI", "chi": -130.892, "glyco_bond": "anti", "C5prime_xyz": [ -2.514, 8.772, -1.082 ], "P_xyz": [ -0.253, 10.075, -0.882 ], "form": ".", "ssZp": 2.676, "Dp": 2.610, "splay_angle": 21.481, "splay_distance": 3.737, "splay_ratio": 0.190, "d22": 3.958, "d64": 3.888, "eta": 171.812, "theta": -142.206, "eta_prime": -163.576, "theta_prime": -156.711, "eta_base": -121.375, "theta_base": -106.757, "v0": -35.594, "v1": 35.608, "v2": -22.327, "v3": 2.563, "v4": 20.579, "amplitude": 36.590, "phase_angle": 127.603, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.003, "origin": [ 117.263, 106.084, 169.283 ], "x_axis": [ 0.640, -0.458, 0.617 ], "y_axis": [ 0.768, 0.386, -0.511 ], "z_axis": [ -0.004, 0.801, 0.599 ], "quaternion": [ 0.810, -0.405, -0.191, -0.378 ] } }, { "index": 185, "index_chain": 21, "chain_name": "J", "nt_resnum": 26, "nt_name": "DC", "nt_code": "C", "nt_id": "///J/26", "linked_nts": [ "///J/25", "///J/27" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -72.895, "beta": 167.688, "gamma": 58.012, "delta": 87.480, "epsilon": -168.892, "zeta": -78.422, "epsilon_zeta": -90.470, "bb_type": "BI", "chi": -153.159, "glyco_bond": "anti", "C5prime_xyz": [ -2.133, 9.056, -0.234 ], "P_xyz": [ 0.228, 10.199, -0.128 ], "form": "B", "ssZp": 3.673, "Dp": 3.788, "splay_angle": 21.948, "splay_distance": 3.681, "splay_ratio": 0.190, "d22": 4.356, "d64": 4.152, "eta": 164.398, "theta": -157.987, "eta_prime": 177.722, "theta_prime": -154.287, "eta_base": -119.029, "theta_base": -122.532, "v0": -22.366, "v1": 0.243, "v2": 20.136, "v3": -33.576, "v4": 35.531, "amplitude": 35.966, "phase_angle": 55.954, "puckering": "C4'-exo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.062, "frame": { "rmsd": 0.003, "origin": [ 117.757, 108.120, 172.377 ], "x_axis": [ 0.990, -0.093, 0.109 ], "y_axis": [ 0.143, 0.539, -0.830 ], "z_axis": [ 0.019, 0.837, 0.547 ], "quaternion": [ 0.877, -0.475, -0.026, -0.067 ] } }, { "index": 186, "index_chain": 22, "chain_name": "J", "nt_resnum": 27, "nt_name": "DC", "nt_code": "C", "nt_id": "///J/27", "linked_nts": [ "///J/26", "///J/28" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -58.857, "beta": 169.089, "gamma": 64.923, "delta": 131.475, "epsilon": -159.597, "zeta": -103.967, "epsilon_zeta": -55.630, "bb_type": "BI", "chi": -135.958, "glyco_bond": "anti", "C5prime_xyz": [ -2.019, 8.889, -0.659 ], "P_xyz": [ 0.427, 9.702, -0.148 ], "form": "B", "ssZp": 2.240, "Dp": 2.287, "splay_angle": 19.071, "splay_distance": 3.303, "splay_ratio": 0.168, "d22": null, "d64": null, "eta": 178.341, "theta": -134.914, "eta_prime": -151.780, "theta_prime": -149.416, "eta_base": -114.116, "theta_base": -119.277, "v0": -29.304, "v1": 36.062, "v2": -28.907, "v3": 12.873, "v4": 10.076, "amplitude": 35.340, "phase_angle": 144.881, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1b", "suiteness": 0.392, "filter_rmsd": 0.063, "frame": { "rmsd": 0.003, "origin": [ 118.215, 110.718, 174.945 ], "x_axis": [ 0.910, 0.143, -0.389 ], "y_axis": [ -0.402, 0.530, -0.747 ], "z_axis": [ 0.099, 0.836, 0.539 ], "quaternion": [ 0.863, -0.459, 0.141, 0.158 ] } }, { "index": 187, "index_chain": 23, "chain_name": "J", "nt_resnum": 28, "nt_name": "DA", "nt_code": "A", "nt_id": "///J/28", "linked_nts": [ "///J/27", "///J/29" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -62.829, "beta": 172.402, "gamma": 41.356, "delta": 124.171, "epsilon": -166.473, "zeta": -106.117, "epsilon_zeta": -60.356, "bb_type": "BI", "chi": -127.694, "glyco_bond": "anti", "C5prime_xyz": [ -2.233, 8.710, -1.183 ], "P_xyz": [ -0.082, 10.090, -0.609 ], "form": "B", "ssZp": 2.477, "Dp": 2.487, "splay_angle": 19.185, "splay_distance": 3.310, "splay_ratio": 0.168, "d22": null, "d64": null, "eta": 160.504, "theta": -150.536, "eta_prime": -177.922, "theta_prime": -156.989, "eta_base": -136.161, "theta_base": -124.744, "v0": -30.685, "v1": 32.981, "v2": -22.956, "v3": 5.997, "v4": 15.363, "amplitude": 33.016, "phase_angle": 134.050, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.004, "origin": [ 118.796, 112.801, 177.441 ], "x_axis": [ 0.539, 0.337, -0.772 ], "y_axis": [ -0.834, 0.342, -0.433 ], "z_axis": [ 0.118, 0.877, 0.465 ], "quaternion": [ 0.766, -0.428, 0.290, 0.382 ] } }, { "index": 188, "index_chain": 24, "chain_name": "J", "nt_resnum": 29, "nt_name": "DC", "nt_code": "C", "nt_id": "///J/29", "linked_nts": [ "///J/28", "///J/30" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -58.168, "beta": 167.489, "gamma": 49.872, "delta": 120.979, "epsilon": -177.562, "zeta": -97.687, "epsilon_zeta": -79.875, "bb_type": "BI", "chi": -129.528, "glyco_bond": "anti", "C5prime_xyz": [ -2.254, 8.817, -1.167 ], "P_xyz": [ 0.041, 10.030, -0.845 ], "form": "B", "ssZp": 2.543, "Dp": 2.543, "splay_angle": 19.376, "splay_distance": 3.307, "splay_ratio": 0.170, "d22": 4.347, "d64": 3.985, "eta": 165.431, "theta": -151.164, "eta_prime": -173.126, "theta_prime": -158.572, "eta_base": -132.479, "theta_base": -126.158, "v0": -32.701, "v1": 32.791, "v2": -20.836, "v3": 2.719, "v4": 18.680, "amplitude": 33.683, "phase_angle": 128.212, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.064, "frame": { "rmsd": 0.003, "origin": [ 119.911, 115.282, 179.326 ], "x_axis": [ 0.011, 0.423, -0.906 ], "y_axis": [ -0.991, 0.124, 0.047 ], "z_axis": [ 0.132, 0.897, 0.421 ], "quaternion": [ 0.624, -0.341, 0.416, 0.567 ] } }, { "index": 189, "index_chain": 25, "chain_name": "J", "nt_resnum": 30, "nt_name": "DC", "nt_code": "C", "nt_id": "///J/30", "linked_nts": [ "///J/29", "///J/31" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -52.111, "beta": -173.617, "gamma": 37.340, "delta": 139.978, "epsilon": -165.898, "zeta": -109.768, "epsilon_zeta": -56.130, "bb_type": "BI", "chi": -115.375, "glyco_bond": "anti", "C5prime_xyz": [ -1.948, 8.548, -1.508 ], "P_xyz": [ 0.143, 9.932, -0.768 ], "form": "B", "ssZp": 2.058, "Dp": 2.109, "splay_angle": 18.905, "splay_distance": 3.250, "splay_ratio": 0.165, "d22": 4.379, "d64": 3.878, "eta": 172.328, "theta": -142.458, "eta_prime": -167.113, "theta_prime": -150.181, "eta_base": -128.170, "theta_base": -121.579, "v0": -22.931, "v1": 35.041, "v2": -33.326, "v3": 20.949, "v4": 1.010, "amplitude": 35.543, "phase_angle": 159.655, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.064, "frame": { "rmsd": 0.004, "origin": [ 121.234, 118.030, 180.606 ], "x_axis": [ -0.536, 0.361, -0.763 ], "y_axis": [ -0.837, -0.112, 0.535 ], "z_axis": [ 0.108, 0.926, 0.363 ], "quaternion": [ 0.423, -0.231, 0.515, 0.709 ] } }, { "index": 190, "index_chain": 26, "chain_name": "J", "nt_resnum": 31, "nt_name": "DT", "nt_code": "T", "nt_id": "///J/31", "linked_nts": [ "///J/30", "///J/32" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -50.411, "beta": 176.502, "gamma": 31.645, "delta": 138.765, "epsilon": -149.632, "zeta": -133.031, "epsilon_zeta": -16.600, "bb_type": "--", "chi": -104.295, "glyco_bond": "anti", "C5prime_xyz": [ -2.460, 8.239, -2.012 ], "P_xyz": [ -0.385, 9.825, -1.876 ], "form": "B", "ssZp": 1.962, "Dp": 2.047, "splay_angle": 21.777, "splay_distance": 3.682, "splay_ratio": 0.194, "d22": null, "d64": null, "eta": 170.311, "theta": -156.895, "eta_prime": -170.404, "theta_prime": -159.230, "eta_base": -136.214, "theta_base": -107.644, "v0": -27.725, "v1": 38.573, "v2": -34.219, "v3": 19.140, "v4": 5.133, "amplitude": 38.205, "phase_angle": 153.595, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.002, "origin": [ 122.194, 121.005, 181.498 ], "x_axis": [ -0.882, 0.212, -0.421 ], "y_axis": [ -0.461, -0.205, 0.863 ], "z_axis": [ 0.097, 0.956, 0.278 ], "quaternion": [ 0.219, -0.105, 0.592, 0.769 ] } }, { "index": 191, "index_chain": 27, "chain_name": "J", "nt_resnum": 32, "nt_name": "DG", "nt_code": "G", "nt_id": "///J/32", "linked_nts": [ "///J/31", "///J/33" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -60.205, "beta": 146.556, "gamma": 60.392, "delta": 136.830, "epsilon": -163.455, "zeta": -115.545, "epsilon_zeta": -47.910, "bb_type": "BI", "chi": -112.143, "glyco_bond": "anti", "C5prime_xyz": [ -2.276, 8.455, -1.717 ], "P_xyz": [ 0.287, 8.824, -2.066 ], "form": "B", "ssZp": 2.190, "Dp": 2.215, "splay_angle": 23.537, "splay_distance": 3.948, "splay_ratio": 0.204, "d22": null, "d64": null, "eta": 162.939, "theta": -136.458, "eta_prime": -165.289, "theta_prime": -157.656, "eta_base": -111.472, "theta_base": -121.903, "v0": -26.832, "v1": 36.689, "v2": -32.182, "v3": 17.587, "v4": 5.546, "amplitude": 36.269, "phase_angle": 152.536, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.005, "frame": { "rmsd": 0.005, "origin": [ 121.613, 124.124, 183.367 ], "x_axis": [ -0.974, -0.032, 0.225 ], "y_axis": [ 0.227, -0.228, 0.947 ], "z_axis": [ 0.021, 0.973, 0.229 ], "quaternion": [ -0.083, 0.079, 0.616, 0.780 ] } }, { "index": 192, "index_chain": 28, "chain_name": "J", "nt_resnum": 33, "nt_name": "DC", "nt_code": "C", "nt_id": "///J/33", "linked_nts": [ "///J/32", "///J/34" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -59.767, "beta": 170.937, "gamma": 52.173, "delta": 136.001, "epsilon": -137.541, "zeta": -141.719, "epsilon_zeta": 4.177, "bb_type": "--", "chi": -108.260, "glyco_bond": "anti", "C5prime_xyz": [ -2.353, 8.395, -1.896 ], "P_xyz": [ 0.033, 9.454, -2.046 ], "form": ".", "ssZp": 1.822, "Dp": 1.922, "splay_angle": 26.610, "splay_distance": 4.594, "splay_ratio": 0.248, "d22": null, "d64": null, "eta": -178.501, "theta": -160.924, "eta_prime": -160.599, "theta_prime": -161.577, "eta_base": -121.678, "theta_base": -111.850, "v0": -28.420, "v1": 37.705, "v2": -32.263, "v3": 16.795, "v4": 7.031, "amplitude": 37.098, "phase_angle": 150.420, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.003, "origin": [ 121.500, 127.941, 184.369 ], "x_axis": [ -0.663, -0.176, 0.728 ], "y_axis": [ 0.749, -0.137, 0.649 ], "z_axis": [ -0.014, 0.975, 0.222 ], "quaternion": [ -0.325, 0.251, 0.571, 0.711 ] } }, { "index": 193, "index_chain": 29, "chain_name": "J", "nt_resnum": 34, "nt_name": "DA", "nt_code": "A", "nt_id": "///J/34", "linked_nts": [ "///J/33", "///J/35" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -67.248, "beta": 146.334, "gamma": 65.752, "delta": 147.544, "epsilon": -148.998, "zeta": -148.144, "epsilon_zeta": -0.855, "bb_type": "--", "chi": -102.874, "glyco_bond": "anti", "C5prime_xyz": [ -2.049, 8.124, -1.954 ], "P_xyz": [ 0.530, 8.000, -2.399 ], "form": ".", "ssZp": 1.738, "Dp": 1.835, "splay_angle": 24.903, "splay_distance": 4.173, "splay_ratio": 0.223, "d22": null, "d64": null, "eta": 168.843, "theta": -149.430, "eta_prime": -156.486, "theta_prime": -174.621, "eta_base": -110.426, "theta_base": -131.078, "v0": -18.484, "v1": 34.568, "v2": -36.624, "v3": 26.925, "v4": -5.537, "amplitude": 37.230, "phase_angle": 169.648, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.037, "frame": { "rmsd": 0.003, "origin": [ 123.242, 131.697, 186.361 ], "x_axis": [ 0.006, -0.214, 0.977 ], "y_axis": [ 0.999, 0.032, 0.001 ], "z_axis": [ -0.031, 0.976, 0.214 ], "quaternion": [ 0.559, -0.436, -0.451, -0.542 ] } }, { "index": 194, "index_chain": 30, "chain_name": "J", "nt_resnum": 35, "nt_name": "DG", "nt_code": "G", "nt_id": "///J/35", "linked_nts": [ "///J/34", "///J/36" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -57.560, "beta": 145.384, "gamma": 60.179, "delta": 143.937, "epsilon": -161.037, "zeta": -122.430, "epsilon_zeta": -38.607, "bb_type": "BI", "chi": -114.360, "glyco_bond": "anti", "C5prime_xyz": [ -2.011, 8.497, -1.478 ], "P_xyz": [ 0.603, 8.634, -1.590 ], "form": "B", "ssZp": 2.085, "Dp": 2.074, "splay_angle": 19.329, "splay_distance": 3.221, "splay_ratio": 0.168, "d22": null, "d64": null, "eta": 166.759, "theta": -132.904, "eta_prime": -162.383, "theta_prime": -162.309, "eta_base": -118.181, "theta_base": -118.259, "v0": -22.048, "v1": 36.159, "v2": -35.691, "v3": 23.895, "v4": -1.386, "amplitude": 37.260, "phase_angle": 163.314, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.005, "frame": { "rmsd": 0.005, "origin": [ 123.959, 135.807, 186.264 ], "x_axis": [ 0.596, -0.047, 0.802 ], "y_axis": [ 0.803, 0.070, -0.592 ], "z_axis": [ -0.028, 0.996, 0.080 ], "quaternion": [ 0.661, -0.601, -0.314, -0.322 ] } }, { "index": 195, "index_chain": 31, "chain_name": "J", "nt_resnum": 36, "nt_name": "DA", "nt_code": "A", "nt_id": "///J/36", "linked_nts": [ "///J/35", "///J/37" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -62.420, "beta": 157.426, "gamma": 55.539, "delta": 124.313, "epsilon": -169.416, "zeta": -92.109, "epsilon_zeta": -77.307, "bb_type": "BI", "chi": -131.579, "glyco_bond": "anti", "C5prime_xyz": [ -2.063, 8.756, -0.966 ], "P_xyz": [ 0.445, 9.496, -0.790 ], "form": ".", "ssZp": 2.604, "Dp": 2.552, "splay_angle": 20.345, "splay_distance": 3.655, "splay_ratio": 0.182, "d22": null, "d64": null, "eta": 163.724, "theta": -133.305, "eta_prime": -174.172, "theta_prime": -152.220, "eta_base": -119.741, "theta_base": -119.764, "v0": -28.181, "v1": 30.563, "v2": -21.491, "v3": 5.917, "v4": 13.877, "amplitude": 30.522, "phase_angle": 134.758, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.004, "origin": [ 123.870, 139.010, 186.587 ], "x_axis": [ 0.964, -0.002, 0.265 ], "y_axis": [ 0.265, 0.048, -0.963 ], "z_axis": [ -0.010, 0.999, 0.047 ], "quaternion": [ 0.718, -0.683, -0.096, -0.093 ] } }, { "index": 196, "index_chain": 32, "chain_name": "J", "nt_resnum": 37, "nt_name": "DT", "nt_code": "T", "nt_id": "///J/37", "linked_nts": [ "///J/36", "///J/38" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -63.284, "beta": 167.451, "gamma": 51.576, "delta": 93.617, "epsilon": -171.300, "zeta": -76.957, "epsilon_zeta": -94.343, "bb_type": "BI", "chi": -149.389, "glyco_bond": "anti", "C5prime_xyz": [ -2.554, 8.962, -0.503 ], "P_xyz": [ -0.427, 10.473, -0.278 ], "form": ".", "ssZp": 3.418, "Dp": 3.376, "splay_angle": 20.730, "splay_distance": 3.690, "splay_ratio": 0.185, "d22": 3.991, "d64": 4.226, "eta": 166.421, "theta": -153.121, "eta_prime": -178.194, "theta_prime": -156.538, "eta_base": -132.011, "theta_base": -121.744, "v0": -33.195, "v1": 14.842, "v2": 7.439, "v3": -26.669, "v4": 37.912, "amplitude": 37.341, "phase_angle": 78.508, "puckering": "O4'-endo", "sugar_class": "--", "bin": "23p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.105, "frame": { "rmsd": 0.003, "origin": [ 124.022, 142.374, 188.009 ], "x_axis": [ 0.962, 0.038, -0.272 ], "y_axis": [ -0.272, -0.009, -0.962 ], "z_axis": [ -0.039, 0.999, 0.002 ], "quaternion": [ 0.699, -0.701, 0.083, 0.111 ] } }, { "index": 197, "index_chain": 33, "chain_name": "J", "nt_resnum": 38, "nt_name": "DT", "nt_code": "T", "nt_id": "///J/38", "linked_nts": [ "///J/37", "///J/39" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -62.635, "beta": 166.181, "gamma": 58.744, "delta": 89.043, "epsilon": -163.967, "zeta": -70.158, "epsilon_zeta": -93.809, "bb_type": "BI", "chi": -158.071, "glyco_bond": "anti", "C5prime_xyz": [ -2.462, 9.027, -0.049 ], "P_xyz": [ -0.246, 10.408, 0.258 ], "form": ".", "ssZp": 3.607, "Dp": 3.596, "splay_angle": 20.242, "splay_distance": 3.634, "splay_ratio": 0.181, "d22": 3.833, "d64": 4.006, "eta": 172.919, "theta": -146.063, "eta_prime": -171.573, "theta_prime": -148.236, "eta_base": -125.900, "theta_base": -112.766, "v0": -29.535, "v1": 8.563, "v2": 13.829, "v3": -31.195, "v4": 38.555, "amplitude": 37.672, "phase_angle": 68.463, "puckering": "C4'-exo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.414, "filter_rmsd": 0.105, "frame": { "rmsd": 0.002, "origin": [ 125.066, 145.800, 188.896 ], "x_axis": [ 0.677, 0.006, -0.736 ], "y_axis": [ -0.735, -0.049, -0.676 ], "z_axis": [ -0.040, 0.999, -0.029 ], "quaternion": [ 0.632, -0.662, 0.275, 0.293 ] } }, { "index": 198, "index_chain": 34, "chain_name": "J", "nt_resnum": 39, "nt_name": "DC", "nt_code": "C", "nt_id": "///J/39", "linked_nts": [ "///J/38", "///J/40" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -66.797, "beta": 170.098, "gamma": 54.439, "delta": 91.429, "epsilon": -165.307, "zeta": -79.782, "epsilon_zeta": -85.525, "bb_type": "BI", "chi": -157.469, "glyco_bond": "anti", "C5prime_xyz": [ -2.368, 9.080, -0.107 ], "P_xyz": [ -0.204, 10.464, 0.452 ], "form": ".", "ssZp": 3.449, "Dp": 3.451, "splay_angle": 21.875, "splay_distance": 3.873, "splay_ratio": 0.193, "d22": 4.497, "d64": 4.582, "eta": 167.046, "theta": -154.275, "eta_prime": -174.413, "theta_prime": -156.364, "eta_base": -126.677, "theta_base": -133.835, "v0": -30.597, "v1": 11.241, "v2": 10.605, "v3": -28.470, "v4": 37.459, "amplitude": 36.586, "phase_angle": 73.150, "puckering": "O4'-endo", "sugar_class": "--", "bin": "33p", "cluster": "1a", "suiteness": 0.579, "filter_rmsd": 0.062, "frame": { "rmsd": 0.004, "origin": [ 126.586, 149.090, 188.634 ], "x_axis": [ 0.148, -0.197, -0.969 ], "y_axis": [ -0.989, -0.054, -0.140 ], "z_axis": [ -0.025, 0.979, -0.203 ], "quaternion": [ -0.472, 0.593, -0.500, -0.419 ] } }, { "index": 199, "index_chain": 35, "chain_name": "J", "nt_resnum": 40, "nt_name": "DT", "nt_code": "T", "nt_id": "///J/40", "linked_nts": [ "///J/39", "///J/41" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -59.744, "beta": 175.687, "gamma": 42.597, "delta": 89.325, "epsilon": -167.828, "zeta": -79.144, "epsilon_zeta": -88.684, "bb_type": "BI", "chi": -150.952, "glyco_bond": "anti", "C5prime_xyz": [ -2.174, 9.001, -0.311 ], "P_xyz": [ -0.040, 10.389, 0.319 ], "form": ".", "ssZp": 3.592, "Dp": 3.705, "splay_angle": 17.748, "splay_distance": 3.068, "splay_ratio": 0.156, "d22": null, "d64": null, "eta": 168.018, "theta": -158.083, "eta_prime": -179.988, "theta_prime": -154.174, "eta_base": -148.035, "theta_base": -130.265, "v0": -23.582, "v1": 2.712, "v2": 17.463, "v3": -31.522, "v4": 34.994, "amplitude": 34.847, "phase_angle": 59.925, "puckering": "C4'-exo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.487, "filter_rmsd": 0.105, "frame": { "rmsd": 0.002, "origin": [ 128.177, 152.615, 188.421 ], "x_axis": [ -0.305, -0.270, -0.913 ], "y_axis": [ -0.949, 0.009, 0.314 ], "z_axis": [ -0.076, 0.963, -0.259 ], "quaternion": [ 0.334, -0.486, 0.627, 0.509 ] } }, { "index": 200, "index_chain": 36, "chain_name": "J", "nt_resnum": 41, "nt_name": "DA", "nt_code": "A", "nt_id": "///J/41", "linked_nts": [ "///J/40", "///J/42" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -56.855, "beta": 166.162, "gamma": 57.408, "delta": 122.436, "epsilon": -170.504, "zeta": -89.404, "epsilon_zeta": -81.100, "bb_type": "BI", "chi": -141.481, "glyco_bond": "anti", "C5prime_xyz": [ -2.342, 8.886, -0.568 ], "P_xyz": [ -0.082, 10.061, 0.061 ], "form": ".", "ssZp": 2.443, "Dp": 2.525, "splay_angle": 19.546, "splay_distance": 3.410, "splay_ratio": 0.175, "d22": null, "d64": null, "eta": 170.150, "theta": -137.230, "eta_prime": -162.681, "theta_prime": -145.518, "eta_base": -131.119, "theta_base": -104.941, "v0": -34.383, "v1": 35.433, "v2": -23.307, "v3": 4.223, "v4": 18.771, "amplitude": 35.980, "phase_angle": 130.373, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1b", "suiteness": 0.066, "filter_rmsd": 0.038, "frame": { "rmsd": 0.004, "origin": [ 129.027, 155.304, 187.213 ], "x_axis": [ -0.676, -0.401, -0.618 ], "y_axis": [ -0.722, 0.192, 0.665 ], "z_axis": [ -0.148, 0.896, -0.419 ], "quaternion": [ 0.155, -0.371, 0.756, 0.516 ] } }, { "index": 201, "index_chain": 37, "chain_name": "J", "nt_resnum": 42, "nt_name": "DC", "nt_code": "C", "nt_id": "///J/42", "linked_nts": [ "///J/41", "///J/43" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -56.445, "beta": -170.552, "gamma": 31.916, "delta": 141.375, "epsilon": -146.823, "zeta": -120.570, "epsilon_zeta": -26.253, "bb_type": "--", "chi": -111.798, "glyco_bond": "anti", "C5prime_xyz": [ -2.052, 8.476, -1.674 ], "P_xyz": [ -0.117, 10.107, -1.006 ], "form": "B", "ssZp": 1.788, "Dp": 1.868, "splay_angle": 23.501, "splay_distance": 3.990, "splay_ratio": 0.205, "d22": 4.895, "d64": 4.035, "eta": 172.398, "theta": -142.488, "eta_prime": -164.469, "theta_prime": -143.816, "eta_base": -115.773, "theta_base": -102.169, "v0": -24.313, "v1": 37.002, "v2": -35.072, "v3": 22.012, "v4": 1.162, "amplitude": 37.456, "phase_angle": 159.450, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.064, "frame": { "rmsd": 0.003, "origin": [ 128.552, 157.677, 184.811 ], "x_axis": [ -0.973, -0.227, -0.034 ], "y_axis": [ -0.131, 0.424, 0.896 ], "z_axis": [ -0.189, 0.877, -0.443 ], "quaternion": [ -0.046, -0.106, 0.843, 0.526 ] } }, { "index": 202, "index_chain": 38, "chain_name": "J", "nt_resnum": 43, "nt_name": "DC", "nt_code": "C", "nt_id": "///J/43", "linked_nts": [ "///J/42", "///J/44" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -52.835, "beta": 160.690, "gamma": 41.049, "delta": 137.216, "epsilon": -121.178, "zeta": -176.522, "epsilon_zeta": 55.344, "bb_type": "BII", "chi": -97.054, "glyco_bond": "anti", "C5prime_xyz": [ -2.640, 8.076, -2.297 ], "P_xyz": [ -0.286, 9.127, -2.730 ], "form": ".", "ssZp": 1.363, "Dp": 1.592, "splay_angle": 23.164, "splay_distance": 4.264, "splay_ratio": 0.230, "d22": null, "d64": null, "eta": 179.446, "theta": 179.267, "eta_prime": -158.337, "theta_prime": 178.260, "eta_base": -116.447, "theta_base": -129.564, "v0": -28.530, "v1": 38.450, "v2": -33.259, "v3": 17.757, "v4": 6.489, "amplitude": 37.867, "phase_angle": 151.442, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.002, "origin": [ 127.352, 161.365, 183.875 ], "x_axis": [ -0.852, 0.049, 0.522 ], "y_axis": [ 0.463, 0.535, 0.706 ], "z_axis": [ -0.244, 0.843, -0.479 ], "quaternion": [ -0.226, 0.151, 0.846, 0.458 ] } }, { "index": 203, "index_chain": 39, "chain_name": "J", "nt_resnum": 44, "nt_name": "DA", "nt_code": "A", "nt_id": "///J/44", "linked_nts": [ "///J/43", "///J/45" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -60.193, "beta": 127.530, "gamma": 56.878, "delta": 141.164, "epsilon": -154.300, "zeta": -135.511, "epsilon_zeta": -18.788, "bb_type": "--", "chi": -103.241, "glyco_bond": "anti", "C5prime_xyz": [ -2.227, 8.147, -2.023 ], "P_xyz": [ 0.352, 7.862, -2.383 ], "form": ".", "ssZp": 1.951, "Dp": 2.064, "splay_angle": 27.566, "splay_distance": 4.582, "splay_ratio": 0.248, "d22": null, "d64": null, "eta": 165.690, "theta": -140.517, "eta_prime": -162.498, "theta_prime": -165.622, "eta_base": -114.959, "theta_base": -121.306, "v0": -22.015, "v1": 34.547, "v2": -33.279, "v3": 21.482, "v4": 0.085, "amplitude": 35.186, "phase_angle": 161.050, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "4b", "suiteness": 0.188, "filter_rmsd": 0.037, "frame": { "rmsd": 0.003, "origin": [ 128.434, 165.381, 182.935 ], "x_axis": [ -0.435, 0.526, 0.730 ], "y_axis": [ 0.885, 0.400, 0.239 ], "z_axis": [ -0.166, 0.750, -0.640 ], "quaternion": [ -0.285, 0.448, 0.787, 0.314 ] } }, { "index": 204, "index_chain": 40, "chain_name": "J", "nt_resnum": 45, "nt_name": "DA", "nt_code": "A", "nt_id": "///J/45", "linked_nts": [ "///J/44", "///J/46" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -63.860, "beta": 155.340, "gamma": 66.639, "delta": 143.244, "epsilon": -176.305, "zeta": -107.821, "epsilon_zeta": -68.484, "bb_type": "BI", "chi": -109.222, "glyco_bond": "anti", "C5prime_xyz": [ -1.881, 8.270, -1.726 ], "P_xyz": [ 0.717, 8.325, -2.017 ], "form": "B", "ssZp": 2.078, "Dp": 2.102, "splay_angle": 20.043, "splay_distance": 3.410, "splay_ratio": 0.175, "d22": null, "d64": null, "eta": 164.037, "theta": -126.281, "eta_prime": -160.362, "theta_prime": -158.428, "eta_base": -114.503, "theta_base": -120.064, "v0": -17.567, "v1": 31.899, "v2": -33.359, "v3": 24.071, "v4": -4.330, "amplitude": 34.054, "phase_angle": 168.405, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.003, "origin": [ 129.195, 169.044, 180.289 ], "x_axis": [ 0.249, 0.660, 0.709 ], "y_axis": [ 0.960, -0.073, -0.269 ], "z_axis": [ -0.126, 0.748, -0.652 ], "quaternion": [ -0.362, 0.702, 0.577, 0.208 ] } }, { "index": 205, "index_chain": 41, "chain_name": "J", "nt_resnum": 46, "nt_name": "DA", "nt_code": "A", "nt_id": "///J/46", "linked_nts": [ "///J/45", "///J/47" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -48.409, "beta": 171.634, "gamma": 41.328, "delta": 137.678, "epsilon": -155.241, "zeta": -129.994, "epsilon_zeta": -25.246, "bb_type": "--", "chi": -115.731, "glyco_bond": "anti", "C5prime_xyz": [ -2.388, 8.509, -1.520 ], "P_xyz": [ -0.182, 9.866, -1.169 ], "form": "B", "ssZp": 2.245, "Dp": 2.199, "splay_angle": 22.420, "splay_distance": 3.724, "splay_ratio": 0.195, "d22": null, "d64": null, "eta": 172.814, "theta": -152.580, "eta_prime": -165.013, "theta_prime": -161.652, "eta_base": -118.358, "theta_base": -111.595, "v0": -29.721, "v1": 39.877, "v2": -34.178, "v3": 17.939, "v4": 7.177, "amplitude": 39.161, "phase_angle": 150.780, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.005, "origin": [ 128.509, 171.883, 178.530 ], "x_axis": [ 0.744, 0.503, 0.440 ], "y_axis": [ 0.658, -0.438, -0.613 ], "z_axis": [ -0.115, 0.745, -0.657 ], "quaternion": [ -0.403, 0.842, 0.345, 0.096 ] } }, { "index": 206, "index_chain": 42, "chain_name": "J", "nt_resnum": 47, "nt_name": "DA", "nt_code": "A", "nt_id": "///J/47", "linked_nts": [ "///J/46", "///J/48" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -55.017, "beta": 146.647, "gamma": 55.937, "delta": 122.182, "epsilon": -164.812, "zeta": -100.993, "epsilon_zeta": -63.820, "bb_type": "BI", "chi": -139.640, "glyco_bond": "anti", "C5prime_xyz": [ -2.177, 8.855, -0.605 ], "P_xyz": [ 0.362, 9.484, -0.434 ], "form": "B", "ssZp": 2.800, "Dp": 2.677, "splay_angle": 22.054, "splay_distance": 3.656, "splay_ratio": 0.191, "d22": null, "d64": null, "eta": 166.262, "theta": -141.294, "eta_prime": -171.267, "theta_prime": -160.990, "eta_base": -112.873, "theta_base": -124.631, "v0": -31.447, "v1": 32.107, "v2": -20.696, "v3": 3.168, "v4": 17.727, "amplitude": 32.749, "phase_angle": 129.195, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.006, "origin": [ 128.517, 174.709, 176.103 ], "x_axis": [ 0.995, 0.090, -0.049 ], "y_axis": [ 0.033, -0.735, -0.677 ], "z_axis": [ -0.097, 0.672, -0.734 ], "quaternion": [ -0.363, 0.931, 0.033, -0.039 ] } }, { "index": 207, "index_chain": 43, "chain_name": "J", "nt_resnum": 48, "nt_name": "DG", "nt_code": "G", "nt_id": "///J/48", "linked_nts": [ "///J/47", "///J/49" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -96.152, "beta": 167.568, "gamma": 71.941, "delta": 91.035, "epsilon": -160.316, "zeta": -75.277, "epsilon_zeta": -85.039, "bb_type": "BI", "chi": -165.096, "glyco_bond": "anti", "C5prime_xyz": [ -1.714, 8.894, 0.689 ], "P_xyz": [ 0.827, 9.537, 0.838 ], "form": ".", "ssZp": 3.993, "Dp": 4.014, "splay_angle": 23.599, "splay_distance": 3.935, "splay_ratio": 0.206, "d22": null, "d64": null, "eta": 158.593, "theta": -147.779, "eta_prime": 169.097, "theta_prime": -146.258, "eta_base": -139.215, "theta_base": -128.910, "v0": -11.377, "v1": -7.982, "v2": 22.809, "v3": -29.986, "v4": 26.318, "amplitude": 29.942, "phase_angle": 40.379, "puckering": "C4'-exo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.008, "frame": { "rmsd": 0.008, "origin": [ 127.891, 177.655, 174.031 ], "x_axis": [ 0.824, -0.432, -0.366 ], "y_axis": [ -0.557, -0.736, -0.386 ], "z_axis": [ -0.103, 0.522, -0.847 ], "quaternion": [ -0.246, 0.923, -0.268, -0.127 ] } }, { "index": 208, "index_chain": 44, "chain_name": "J", "nt_resnum": 49, "nt_name": "DT", "nt_code": "T", "nt_id": "///J/49", "linked_nts": [ "///J/48", "///J/50" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -61.399, "beta": -179.802, "gamma": 56.217, "delta": 131.061, "epsilon": -168.058, "zeta": -91.712, "epsilon_zeta": -76.346, "bb_type": "BI", "chi": -139.140, "glyco_bond": "anti", "C5prime_xyz": [ -1.932, 8.852, -0.434 ], "P_xyz": [ 0.325, 9.755, 0.555 ], "form": ".", "ssZp": 2.381, "Dp": 2.397, "splay_angle": 18.447, "splay_distance": 3.169, "splay_ratio": 0.163, "d22": null, "d64": null, "eta": 173.558, "theta": -131.765, "eta_prime": -158.211, "theta_prime": -141.037, "eta_base": -130.537, "theta_base": -103.986, "v0": -27.203, "v1": 33.876, "v2": -27.488, "v3": 12.501, "v4": 9.089, "amplitude": 33.267, "phase_angle": 145.721, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1b", "suiteness": 0.449, "filter_rmsd": 0.106, "frame": { "rmsd": 0.003, "origin": [ 128.226, 180.787, 171.671 ], "x_axis": [ 0.481, -0.794, -0.373 ], "y_axis": [ -0.876, -0.455, -0.161 ], "z_axis": [ -0.042, 0.404, -0.914 ], "quaternion": [ -0.167, 0.844, -0.495, -0.123 ] } }, { "index": 209, "index_chain": 45, "chain_name": "J", "nt_resnum": 50, "nt_name": "DG", "nt_code": "G", "nt_id": "///J/50", "linked_nts": [ "///J/49", "///J/51" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -53.221, "beta": -167.582, "gamma": 22.862, "delta": 144.337, "epsilon": -159.911, "zeta": -112.110, "epsilon_zeta": -47.802, "bb_type": "BI", "chi": -113.283, "glyco_bond": "anti", "C5prime_xyz": [ -1.717, 8.417, -1.501 ], "P_xyz": [ 0.155, 9.995, -0.571 ], "form": "B", "ssZp": 1.881, "Dp": 1.974, "splay_angle": 22.331, "splay_distance": 3.870, "splay_ratio": 0.194, "d22": null, "d64": null, "eta": 165.117, "theta": -143.318, "eta_prime": -170.455, "theta_prime": -147.913, "eta_base": -122.765, "theta_base": -128.558, "v0": -16.012, "v1": 31.085, "v2": -33.562, "v3": 25.124, "v4": -5.957, "amplitude": 33.963, "phase_angle": 171.186, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.006, "frame": { "rmsd": 0.006, "origin": [ 128.990, 181.990, 168.840 ], "x_axis": [ -0.155, -0.952, -0.263 ], "y_axis": [ -0.985, 0.130, 0.110 ], "z_axis": [ -0.071, 0.276, -0.959 ], "quaternion": [ 0.064, -0.647, 0.749, 0.129 ] } }, { "index": 210, "index_chain": 46, "chain_name": "J", "nt_resnum": 51, "nt_name": "DT", "nt_code": "T", "nt_id": "///J/51", "linked_nts": [ "///J/50", "///J/52" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -44.930, "beta": 179.678, "gamma": 19.652, "delta": 142.163, "epsilon": -162.129, "zeta": -129.959, "epsilon_zeta": -32.169, "bb_type": "--", "chi": -102.481, "glyco_bond": "anti", "C5prime_xyz": [ -2.267, 8.186, -2.054 ], "P_xyz": [ -0.347, 9.942, -1.788 ], "form": "B", "ssZp": 1.983, "Dp": 2.065, "splay_angle": 18.895, "splay_distance": 3.159, "splay_ratio": 0.166, "d22": null, "d64": null, "eta": 164.390, "theta": -157.512, "eta_prime": -175.613, "theta_prime": -160.713, "eta_base": -150.361, "theta_base": -109.057, "v0": -23.951, "v1": 37.104, "v2": -35.494, "v3": 22.541, "v4": 0.627, "amplitude": 37.704, "phase_angle": 160.287, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.003, "origin": [ 129.703, 183.713, 165.449 ], "x_axis": [ -0.522, -0.850, -0.067 ], "y_axis": [ -0.840, 0.499, 0.213 ], "z_axis": [ -0.148, 0.168, -0.975 ], "quaternion": [ -0.023, -0.488, 0.865, 0.110 ] } }, { "index": 211, "index_chain": 47, "chain_name": "J", "nt_resnum": 52, "nt_name": "DA", "nt_code": "A", "nt_id": "///J/52", "linked_nts": [ "///J/51", "///J/53" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -41.993, "beta": 155.931, "gamma": 40.327, "delta": 140.068, "epsilon": -149.752, "zeta": -129.258, "epsilon_zeta": -20.494, "bb_type": "--", "chi": -107.117, "glyco_bond": "anti", "C5prime_xyz": [ -2.139, 8.275, -1.891 ], "P_xyz": [ 0.335, 9.092, -1.724 ], "form": "B", "ssZp": 1.787, "Dp": 1.943, "splay_angle": 16.663, "splay_distance": 2.876, "splay_ratio": 0.145, "d22": null, "d64": null, "eta": 172.679, "theta": -138.804, "eta_prime": -164.132, "theta_prime": -155.151, "eta_base": -110.790, "theta_base": -131.573, "v0": -23.198, "v1": 35.280, "v2": -33.435, "v3": 20.880, "v4": 1.218, "amplitude": 35.734, "phase_angle": 159.333, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.004, "origin": [ 128.394, 184.216, 162.618 ], "x_axis": [ -0.917, -0.356, 0.179 ], "y_axis": [ -0.335, 0.933, 0.133 ], "z_axis": [ -0.215, 0.062, -0.975 ], "quaternion": [ -0.101, -0.177, 0.978, 0.050 ] } }, { "index": 212, "index_chain": 48, "chain_name": "J", "nt_resnum": 53, "nt_name": "DT", "nt_code": "T", "nt_id": "///J/53", "linked_nts": [ "///J/52", "///J/54" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -39.453, "beta": 152.037, "gamma": 26.801, "delta": 119.253, "epsilon": -164.297, "zeta": -125.177, "epsilon_zeta": -39.119, "bb_type": "BI", "chi": -105.209, "glyco_bond": "anti", "C5prime_xyz": [ -2.731, 8.156, -2.271 ], "P_xyz": [ -0.552, 9.554, -2.590 ], "form": ".", "ssZp": 2.091, "Dp": 2.464, "splay_angle": 24.196, "splay_distance": 4.184, "splay_ratio": 0.226, "d22": 5.238, "d64": 3.896, "eta": 163.401, "theta": -166.732, "eta_prime": 179.875, "theta_prime": -164.628, "eta_base": -150.134, "theta_base": -113.369, "v0": -32.745, "v1": 31.894, "v2": -19.555, "v3": 1.310, "v4": 19.631, "amplitude": 33.302, "phase_angle": 125.960, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.003, "origin": [ 128.320, 184.194, 159.743 ], "x_axis": [ -0.954, 0.091, 0.285 ], "y_axis": [ 0.061, 0.992, -0.110 ], "z_axis": [ -0.293, -0.087, -0.952 ], "quaternion": [ -0.146, 0.038, 0.987, -0.050 ] } }, { "index": 213, "index_chain": 49, "chain_name": "J", "nt_resnum": 54, "nt_name": "DT", "nt_code": "T", "nt_id": "///J/54", "linked_nts": [ "///J/53", "///J/55" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -41.820, "beta": 159.633, "gamma": 51.336, "delta": 149.056, "epsilon": -150.133, "zeta": -135.838, "epsilon_zeta": -14.296, "bb_type": "--", "chi": -90.993, "glyco_bond": "anti", "C5prime_xyz": [ -2.043, 7.729, -2.434 ], "P_xyz": [ 0.540, 8.004, -2.643 ], "form": "B", "ssZp": 1.291, "Dp": 1.664, "splay_angle": 21.453, "splay_distance": 3.688, "splay_ratio": 0.191, "d22": 4.494, "d64": 3.412, "eta": -179.832, "theta": -130.359, "eta_prime": -150.880, "theta_prime": -149.762, "eta_base": -105.362, "theta_base": -103.301, "v0": -13.622, "v1": 31.336, "v2": -36.284, "v3": 29.313, "v4": -10.134, "amplitude": 36.328, "phase_angle": 177.174, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.105, "frame": { "rmsd": 0.004, "origin": [ 127.041, 185.971, 156.177 ], "x_axis": [ -0.653, 0.728, 0.209 ], "y_axis": [ 0.622, 0.673, -0.400 ], "z_axis": [ -0.432, -0.132, -0.892 ], "quaternion": [ -0.179, 0.376, 0.897, -0.148 ] } }, { "index": 214, "index_chain": 50, "chain_name": "J", "nt_resnum": 55, "nt_name": "DT", "nt_code": "T", "nt_id": "///J/55", "linked_nts": [ "///J/54", "///J/56" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -27.969, "beta": 143.592, "gamma": 27.277, "delta": 141.498, "epsilon": -108.277, "zeta": -174.305, "epsilon_zeta": 66.028, "bb_type": "BII", "chi": -84.954, "glyco_bond": "anti", "C5prime_xyz": [ -3.055, 7.640, -2.586 ], "P_xyz": [ -0.731, 8.688, -3.148 ], "form": ".", "ssZp": 1.059, "Dp": 1.242, "splay_angle": 30.760, "splay_distance": 5.241, "splay_ratio": 0.275, "d22": null, "d64": null, "eta": -177.116, "theta": -161.959, "eta_prime": -152.947, "theta_prime": -164.152, "eta_base": -109.392, "theta_base": -116.177, "v0": -29.624, "v1": 41.728, "v2": -37.233, "v3": 21.120, "v4": 5.057, "amplitude": 41.340, "phase_angle": 154.243, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.003, "origin": [ 126.224, 187.050, 152.747 ], "x_axis": [ -0.155, 0.988, 0.004 ], "y_axis": [ 0.820, 0.131, -0.557 ], "z_axis": [ -0.550, -0.083, -0.831 ], "quaternion": [ -0.191, 0.621, 0.728, -0.220 ] } }, { "index": 215, "index_chain": 51, "chain_name": "J", "nt_resnum": 56, "nt_name": "DG", "nt_code": "G", "nt_id": "///J/56", "linked_nts": [ "///J/55", "///J/57" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -53.255, "beta": 135.801, "gamma": 36.291, "delta": 143.299, "epsilon": -162.215, "zeta": -133.504, "epsilon_zeta": -28.711, "bb_type": "--", "chi": -101.384, "glyco_bond": "anti", "C5prime_xyz": [ -2.251, 8.186, -2.074 ], "P_xyz": [ 0.337, 8.565, -1.959 ], "form": "B", "ssZp": 2.053, "Dp": 2.112, "splay_angle": 23.194, "splay_distance": 3.851, "splay_ratio": 0.205, "d22": null, "d64": null, "eta": 162.379, "theta": -143.393, "eta_prime": -169.966, "theta_prime": -163.282, "eta_base": -124.144, "theta_base": -114.011, "v0": -23.062, "v1": 36.776, "v2": -35.731, "v3": 23.279, "v4": -0.377, "amplitude": 37.615, "phase_angle": 161.788, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "4b", "suiteness": 0.305, "filter_rmsd": 0.009, "frame": { "rmsd": 0.009, "origin": [ 125.870, 186.914, 147.520 ], "x_axis": [ 0.522, 0.849, -0.077 ], "y_axis": [ 0.810, -0.522, -0.266 ], "z_axis": [ -0.266, 0.077, -0.961 ], "quaternion": [ -0.099, 0.867, 0.479, -0.099 ] } }, { "index": 216, "index_chain": 52, "chain_name": "J", "nt_resnum": 57, "nt_name": "DG", "nt_code": "G", "nt_id": "///J/57", "linked_nts": [ "///J/56", "///J/58" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -58.184, "beta": 152.445, "gamma": 59.967, "delta": 137.744, "epsilon": -168.033, "zeta": -106.152, "epsilon_zeta": -61.881, "bb_type": "BI", "chi": -123.620, "glyco_bond": "anti", "C5prime_xyz": [ -1.847, 8.664, -1.109 ], "P_xyz": [ 0.756, 8.912, -1.038 ], "form": "B", "ssZp": 2.319, "Dp": 2.274, "splay_angle": 20.970, "splay_distance": 3.574, "splay_ratio": 0.183, "d22": null, "d64": null, "eta": 164.789, "theta": -128.914, "eta_prime": -166.698, "theta_prime": -153.971, "eta_base": -110.931, "theta_base": -117.143, "v0": -22.107, "v1": 32.931, "v2": -30.689, "v3": 18.688, "v4": 1.964, "amplitude": 33.118, "phase_angle": 157.920, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.008, "frame": { "rmsd": 0.008, "origin": [ 125.769, 186.838, 143.671 ], "x_axis": [ 0.942, 0.297, -0.156 ], "y_axis": [ 0.286, -0.954, -0.088 ], "z_axis": [ -0.176, 0.039, -0.984 ], "quaternion": [ -0.032, 0.985, 0.148, -0.084 ] } }, { "index": 217, "index_chain": 53, "chain_name": "J", "nt_resnum": 58, "nt_name": "DA", "nt_code": "A", "nt_id": "///J/58", "linked_nts": [ "///J/57", "///J/59" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -59.458, "beta": 168.674, "gamma": 48.027, "delta": 123.578, "epsilon": -160.322, "zeta": -109.255, "epsilon_zeta": -51.067, "bb_type": "BI", "chi": -137.835, "glyco_bond": "anti", "C5prime_xyz": [ -2.128, 8.843, -0.692 ], "P_xyz": [ 0.143, 9.955, -0.014 ], "form": "B", "ssZp": 2.616, "Dp": 2.546, "splay_angle": 21.730, "splay_distance": 3.569, "splay_ratio": 0.190, "d22": null, "d64": null, "eta": 167.883, "theta": -151.940, "eta_prime": -172.104, "theta_prime": -162.825, "eta_base": -122.685, "theta_base": -125.193, "v0": -30.913, "v1": 32.637, "v2": -22.136, "v3": 4.963, "v4": 16.210, "amplitude": 32.873, "phase_angle": 132.328, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.039, "frame": { "rmsd": 0.006, "origin": [ 125.202, 187.576, 140.220 ], "x_axis": [ 0.950, -0.298, -0.091 ], "y_axis": [ -0.285, -0.949, 0.134 ], "z_axis": [ -0.126, -0.101, -0.987 ], "quaternion": [ 0.060, 0.986, -0.148, -0.055 ] } }, { "index": 218, "index_chain": 54, "chain_name": "J", "nt_resnum": 59, "nt_name": "DA", "nt_code": "A", "nt_id": "///J/59", "linked_nts": [ "///J/58", "///J/60" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -75.914, "beta": 178.973, "gamma": 32.818, "delta": 85.914, "epsilon": 77.471, "zeta": 77.212, "epsilon_zeta": 0.259, "bb_type": "--", "chi": -150.257, "glyco_bond": "anti", "C5prime_xyz": [ -0.996, 8.642, -0.009 ], "P_xyz": [ 1.533, 9.049, 0.528 ], "form": "B", "ssZp": 2.665, "Dp": 2.866, "splay_angle": 22.521, "splay_distance": 3.754, "splay_ratio": 0.195, "d22": null, "d64": null, "eta": 173.385, "theta": -130.443, "eta_prime": -177.310, "theta_prime": -130.516, "eta_base": -131.576, "theta_base": -105.631, "v0": 8.130, "v1": -28.440, "v2": 36.785, "v3": -32.949, "v4": 15.850, "amplitude": 36.999, "phase_angle": 6.165, "puckering": "C3'-endo", "sugar_class": "pucker-CHK", "bin": "23p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.039, "frame": { "rmsd": 0.006, "origin": [ 124.128, 187.846, 136.828 ], "x_axis": [ 0.565, -0.814, 0.135 ], "y_axis": [ -0.809, -0.513, 0.287 ], "z_axis": [ -0.165, -0.271, -0.948 ], "quaternion": [ 0.161, 0.870, -0.466, -0.008 ] } }, { "index": 219, "index_chain": 55, "chain_name": "J", "nt_resnum": 60, "nt_name": "DA", "nt_code": "A", "nt_id": "///J/60", "linked_nts": [ "///J/59", "///J/61" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -147.009, "beta": 161.417, "gamma": 70.415, "delta": 123.555, "epsilon": -161.980, "zeta": -103.465, "epsilon_zeta": -58.515, "bb_type": "BI", "chi": -128.651, "glyco_bond": "anti", "C5prime_xyz": [ -2.210, 8.735, -1.161 ], "P_xyz": [ 0.265, 9.534, -1.409 ], "form": "B", "ssZp": 2.432, "Dp": 2.445, "splay_angle": 19.613, "splay_distance": 3.477, "splay_ratio": 0.173, "d22": null, "d64": null, "eta": 157.406, "theta": -140.674, "eta_prime": -161.014, "theta_prime": -157.063, "eta_base": -127.927, "theta_base": -122.358, "v0": -30.880, "v1": 32.772, "v2": -22.503, "v3": 5.378, "v4": 15.920, "amplitude": 32.978, "phase_angle": 133.029, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.039, "frame": { "rmsd": 0.005, "origin": [ 123.877, 186.914, 133.200 ], "x_axis": [ 0.106, -0.937, 0.333 ], "y_axis": [ -0.987, -0.059, 0.149 ], "z_axis": [ -0.120, -0.345, -0.931 ], "quaternion": [ 0.170, 0.724, -0.665, 0.074 ] } }, { "index": 220, "index_chain": 56, "chain_name": "J", "nt_resnum": 61, "nt_name": "DC", "nt_code": "C", "nt_id": "///J/61", "linked_nts": [ "///J/60", "///J/62" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -49.210, "beta": 163.715, "gamma": 37.559, "delta": 103.053, "epsilon": -171.723, "zeta": -90.926, "epsilon_zeta": -80.796, "bb_type": "BI", "chi": -136.685, "glyco_bond": "anti", "C5prime_xyz": [ -2.293, 8.891, -1.094 ], "P_xyz": [ -0.140, 10.331, -0.753 ], "form": "B", "ssZp": 2.863, "Dp": 2.975, "splay_angle": 20.714, "splay_distance": 3.578, "splay_ratio": 0.180, "d22": 4.381, "d64": 4.051, "eta": 166.391, "theta": -157.107, "eta_prime": -177.623, "theta_prime": -155.843, "eta_base": -132.673, "theta_base": -128.041, "v0": -32.830, "v1": 20.987, "v2": -2.597, "v3": -16.075, "v4": 30.925, "amplitude": 32.860, "phase_angle": 94.533, "puckering": "O4'-endo", "sugar_class": "--", "bin": "23p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.003, "origin": [ 124.327, 185.417, 130.094 ], "x_axis": [ -0.433, -0.791, 0.433 ], "y_axis": [ -0.885, 0.464, -0.039 ], "z_axis": [ -0.170, -0.400, -0.901 ], "quaternion": [ -0.180, -0.501, 0.836, -0.131 ] } }, { "index": 221, "index_chain": 57, "chain_name": "J", "nt_resnum": 62, "nt_name": "DT", "nt_code": "T", "nt_id": "///J/62", "linked_nts": [ "///J/61", "///J/63" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -45.832, "beta": 174.578, "gamma": 40.340, "delta": 134.981, "epsilon": -158.989, "zeta": -125.451, "epsilon_zeta": -33.538, "bb_type": "BI", "chi": -117.281, "glyco_bond": "anti", "C5prime_xyz": [ -2.300, 8.560, -1.519 ], "P_xyz": [ -0.139, 9.967, -1.084 ], "form": "B", "ssZp": 2.210, "Dp": 2.218, "splay_angle": 18.121, "splay_distance": 3.030, "splay_ratio": 0.158, "d22": null, "d64": null, "eta": 174.770, "theta": -153.890, "eta_prime": -161.627, "theta_prime": -159.498, "eta_base": -129.362, "theta_base": -117.747, "v0": -29.653, "v1": 38.310, "v2": -32.048, "v3": 15.781, "v4": 8.480, "amplitude": 37.624, "phase_angle": 148.407, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1b", "suiteness": 0.047, "filter_rmsd": 0.106, "frame": { "rmsd": 0.002, "origin": [ 124.310, 183.696, 126.957 ], "x_axis": [ -0.781, -0.450, 0.434 ], "y_axis": [ -0.590, 0.760, -0.273 ], "z_axis": [ -0.207, -0.468, -0.859 ], "quaternion": [ -0.174, -0.282, 0.922, -0.201 ] } }, { "index": 222, "index_chain": 58, "chain_name": "J", "nt_resnum": 63, "nt_name": "DG", "nt_code": "G", "nt_id": "///J/63", "linked_nts": [ "///J/62", "///J/64" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -50.672, "beta": 158.468, "gamma": 45.019, "delta": 140.017, "epsilon": -162.821, "zeta": -125.437, "epsilon_zeta": -37.384, "bb_type": "BI", "chi": -115.012, "glyco_bond": "anti", "C5prime_xyz": [ -2.202, 8.529, -1.544 ], "P_xyz": [ 0.230, 9.448, -1.259 ], "form": "B", "ssZp": 2.094, "Dp": 2.127, "splay_angle": 18.264, "splay_distance": 3.008, "splay_ratio": 0.159, "d22": null, "d64": null, "eta": 164.791, "theta": -147.336, "eta_prime": -169.005, "theta_prime": -160.196, "eta_base": -121.794, "theta_base": -118.865, "v0": -26.294, "v1": 38.116, "v2": -34.834, "v3": 20.595, "v4": 3.314, "amplitude": 38.051, "phase_angle": 156.269, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.003, "frame": { "rmsd": 0.003, "origin": [ 123.691, 182.213, 124.388 ], "x_axis": [ -0.965, 0.111, 0.239 ], "y_axis": [ -0.029, 0.856, -0.516 ], "z_axis": [ -0.262, -0.504, -0.823 ], "quaternion": [ -0.131, 0.022, 0.954, -0.267 ] } }, { "index": 223, "index_chain": 59, "chain_name": "J", "nt_resnum": 64, "nt_name": "DC", "nt_code": "C", "nt_id": "///J/64", "linked_nts": [ "///J/63", "///J/65" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -50.376, "beta": 171.734, "gamma": 39.311, "delta": 143.871, "epsilon": -166.903, "zeta": -111.977, "epsilon_zeta": -54.926, "bb_type": "BI", "chi": -103.990, "glyco_bond": "anti", "C5prime_xyz": [ -1.869, 8.217, -1.968 ], "P_xyz": [ 0.569, 9.126, -1.672 ], "form": "B", "ssZp": 1.857, "Dp": 1.990, "splay_angle": 19.319, "splay_distance": 3.287, "splay_ratio": 0.168, "d22": 4.220, "d64": 3.505, "eta": 168.759, "theta": -134.742, "eta_prime": -169.049, "theta_prime": -149.354, "eta_base": -122.674, "theta_base": -108.324, "v0": -17.164, "v1": 32.043, "v2": -33.980, "v3": 24.934, "v4": -5.149, "amplitude": 34.543, "phase_angle": 169.637, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.004, "origin": [ 123.050, 180.689, 121.876 ], "x_axis": [ -0.768, 0.627, -0.131 ], "y_axis": [ 0.557, 0.554, -0.618 ], "z_axis": [ -0.315, -0.548, -0.775 ], "quaternion": [ -0.052, 0.336, 0.880, -0.331 ] } }, { "index": 224, "index_chain": 60, "chain_name": "J", "nt_resnum": 65, "nt_name": "DT", "nt_code": "T", "nt_id": "///J/65", "linked_nts": [ "///J/64", "///J/66" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -47.309, "beta": 165.883, "gamma": 38.457, "delta": 134.314, "epsilon": -99.371, "zeta": -162.987, "epsilon_zeta": 63.615, "bb_type": "BII", "chi": -103.542, "glyco_bond": "anti", "C5prime_xyz": [ -2.588, 8.186, -2.096 ], "P_xyz": [ -0.329, 9.485, -2.276 ], "form": ".", "ssZp": 0.966, "Dp": 1.226, "splay_angle": 30.041, "splay_distance": 5.203, "splay_ratio": 0.275, "d22": 5.780, "d64": 4.536, "eta": -169.043, "theta": -151.004, "eta_prime": -152.590, "theta_prime": -144.250, "eta_base": -110.450, "theta_base": -97.669, "v0": -29.193, "v1": 37.358, "v2": -30.963, "v3": 15.030, "v4": 8.619, "amplitude": 36.613, "phase_angle": 147.744, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.003, "origin": [ 121.820, 179.440, 119.094 ], "x_axis": [ -0.315, 0.851, -0.420 ], "y_axis": [ 0.856, 0.064, -0.513 ], "z_axis": [ -0.410, -0.521, -0.749 ], "quaternion": [ 0.004, 0.585, 0.729, -0.355 ] } }, { "index": 225, "index_chain": 61, "chain_name": "J", "nt_resnum": 66, "nt_name": "DC", "nt_code": "C", "nt_id": "///J/66", "linked_nts": [ "///J/65", "///J/67" ], "nt_type": "DNA", "dbn": ")", "summary": "~C2'-endo,BII,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -42.930, "beta": 124.957, "gamma": 37.812, "delta": 144.051, "epsilon": -106.643, "zeta": 173.939, "epsilon_zeta": 79.418, "bb_type": "BII", "chi": -76.644, "glyco_bond": "--", "C5prime_xyz": [ -3.293, 7.431, -2.725 ], "P_xyz": [ -0.817, 7.769, -3.496 ], "form": ".", "ssZp": 1.058, "Dp": 1.172, "splay_angle": 32.400, "splay_distance": 5.504, "splay_ratio": 0.285, "d22": 5.077, "d64": 4.164, "eta": 178.711, "theta": -166.165, "eta_prime": -148.745, "theta_prime": -179.845, "eta_base": -110.869, "theta_base": -134.294, "v0": -29.976, "v1": 43.254, "v2": -39.180, "v3": 23.034, "v4": 4.032, "amplitude": 42.960, "phase_angle": 155.786, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "4b", "suiteness": 0.025, "filter_rmsd": 0.063, "frame": { "rmsd": 0.003, "origin": [ 122.756, 177.508, 114.354 ], "x_axis": [ 0.309, 0.715, -0.628 ], "y_axis": [ 0.849, -0.505, -0.158 ], "z_axis": [ -0.430, -0.484, -0.762 ], "quaternion": [ 0.102, 0.802, 0.487, -0.329 ] } }, { "index": 226, "index_chain": 62, "chain_name": "J", "nt_resnum": 67, "nt_name": "DC", "nt_code": "C", "nt_id": "///J/67", "linked_nts": [ "///J/66", "///J/68" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -60.369, "beta": 141.549, "gamma": 35.379, "delta": 145.626, "epsilon": -160.323, "zeta": -136.253, "epsilon_zeta": -24.069, "bb_type": "--", "chi": -111.028, "glyco_bond": "anti", "C5prime_xyz": [ -2.070, 8.467, -1.648 ], "P_xyz": [ 0.474, 8.964, -1.230 ], "form": ".", "ssZp": 2.100, "Dp": 2.082, "splay_angle": 19.154, "splay_distance": 3.234, "splay_ratio": 0.178, "d22": null, "d64": null, "eta": 165.756, "theta": -149.264, "eta_prime": -172.353, "theta_prime": -163.871, "eta_base": -129.915, "theta_base": -122.788, "v0": -23.725, "v1": 38.565, "v2": -37.832, "v3": 25.092, "v4": -1.089, "amplitude": 39.610, "phase_angle": 162.770, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "4b", "suiteness": 0.512, "filter_rmsd": 0.063, "frame": { "rmsd": 0.007, "origin": [ 122.035, 173.507, 110.644 ], "x_axis": [ 0.798, 0.473, -0.373 ], "y_axis": [ 0.602, -0.643, 0.474 ], "z_axis": [ -0.015, -0.602, -0.798 ], "quaternion": [ 0.299, 0.900, 0.299, -0.108 ] } }, { "index": 227, "index_chain": 63, "chain_name": "J", "nt_resnum": 68, "nt_name": "DA", "nt_code": "A", "nt_id": "///J/68", "linked_nts": [ "///J/67", "///J/69" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -66.166, "beta": 171.156, "gamma": 52.480, "delta": 145.447, "epsilon": -172.280, "zeta": -94.869, "epsilon_zeta": -77.411, "bb_type": "BI", "chi": -113.020, "glyco_bond": "anti", "C5prime_xyz": [ -1.311, 8.204, -1.473 ], "P_xyz": [ 1.264, 8.334, -0.983 ], "form": "B", "ssZp": 1.931, "Dp": 2.056, "splay_angle": 18.304, "splay_distance": 3.131, "splay_ratio": 0.159, "d22": null, "d64": null, "eta": 164.699, "theta": -119.382, "eta_prime": -173.037, "theta_prime": -141.336, "eta_base": -126.063, "theta_base": -119.777, "v0": -6.642, "v1": 23.195, "v2": -29.947, "v3": 26.815, "v4": -12.897, "amplitude": 30.118, "phase_angle": 186.116, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.039, "frame": { "rmsd": 0.006, "origin": [ 121.735, 170.856, 108.817 ], "x_axis": [ 0.994, 0.007, 0.109 ], "y_axis": [ -0.059, -0.807, 0.588 ], "z_axis": [ 0.092, -0.590, -0.802 ], "quaternion": [ 0.310, 0.949, -0.014, 0.053 ] } }, { "index": 228, "index_chain": 64, "chain_name": "J", "nt_resnum": 69, "nt_name": "DT", "nt_code": "T", "nt_id": "///J/69", "linked_nts": [ "///J/68", "///J/70" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -57.782, "beta": -175.086, "gamma": 33.445, "delta": 142.218, "epsilon": -154.425, "zeta": -134.760, "epsilon_zeta": -19.665, "bb_type": "--", "chi": -97.679, "glyco_bond": "anti", "C5prime_xyz": [ -2.375, 8.039, -2.264 ], "P_xyz": [ -0.302, 9.636, -2.264 ], "form": "B", "ssZp": 1.796, "Dp": 1.958, "splay_angle": 17.892, "splay_distance": 3.047, "splay_ratio": 0.157, "d22": 4.308, "d64": 3.368, "eta": 166.187, "theta": -157.742, "eta_prime": -169.013, "theta_prime": -165.217, "eta_base": -138.560, "theta_base": -124.778, "v0": -24.162, "v1": 37.375, "v2": -35.751, "v3": 22.688, "v4": 0.679, "amplitude": 37.989, "phase_angle": 160.239, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.002, "origin": [ 121.828, 169.385, 106.055 ], "x_axis": [ 0.846, -0.317, 0.429 ], "y_axis": [ -0.489, -0.783, 0.384 ], "z_axis": [ 0.214, -0.534, -0.818 ], "quaternion": [ 0.247, 0.928, -0.217, 0.173 ] } }, { "index": 229, "index_chain": 65, "chain_name": "J", "nt_resnum": 70, "nt_name": "DC", "nt_code": "C", "nt_id": "///J/70", "linked_nts": [ "///J/69", "///J/71" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -52.284, "beta": 148.068, "gamma": 48.243, "delta": 126.099, "epsilon": -158.437, "zeta": -86.413, "epsilon_zeta": -72.024, "bb_type": "BI", "chi": -115.037, "glyco_bond": "anti", "C5prime_xyz": [ -2.377, 8.537, -1.768 ], "P_xyz": [ 0.102, 9.316, -2.014 ], "form": ".", "ssZp": 2.272, "Dp": 2.358, "splay_angle": 24.354, "splay_distance": 4.364, "splay_ratio": 0.213, "d22": null, "d64": null, "eta": 167.226, "theta": -119.549, "eta_prime": -173.935, "theta_prime": -134.864, "eta_base": -130.031, "theta_base": -110.370, "v0": -31.874, "v1": 35.235, "v2": -25.362, "v3": 7.739, "v4": 14.975, "amplitude": 35.025, "phase_angle": 136.395, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.064, "frame": { "rmsd": 0.003, "origin": [ 122.279, 167.530, 103.680 ], "x_axis": [ 0.423, -0.645, 0.636 ], "y_axis": [ -0.847, -0.531, 0.024 ], "z_axis": [ 0.323, -0.549, -0.771 ], "quaternion": [ 0.173, 0.825, -0.452, 0.290 ] } }, { "index": 230, "index_chain": 66, "chain_name": "J", "nt_resnum": 71, "nt_name": "DA", "nt_code": "A", "nt_id": "///J/71", "linked_nts": [ "///J/70", "///J/72" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -52.889, "beta": -173.217, "gamma": 6.675, "delta": 140.763, "epsilon": -141.602, "zeta": -142.789, "epsilon_zeta": 1.186, "bb_type": "--", "chi": -115.762, "glyco_bond": "anti", "C5prime_xyz": [ -2.031, 8.491, -1.484 ], "P_xyz": [ -0.562, 10.515, -0.708 ], "form": "B", "ssZp": 1.870, "Dp": 1.899, "splay_angle": 20.411, "splay_distance": 3.465, "splay_ratio": 0.179, "d22": null, "d64": null, "eta": 154.123, "theta": -167.572, "eta_prime": 177.889, "theta_prime": -162.533, "eta_base": -147.465, "theta_base": -136.293, "v0": -24.664, "v1": 36.828, "v2": -34.378, "v3": 21.006, "v4": 2.080, "amplitude": 37.056, "phase_angle": 158.085, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.039, "frame": { "rmsd": 0.006, "origin": [ 124.108, 164.290, 101.400 ], "x_axis": [ -0.193, -0.148, 0.970 ], "y_axis": [ -0.981, 0.008, -0.194 ], "z_axis": [ 0.021, -0.989, -0.147 ], "quaternion": [ -0.408, -0.486, 0.580, -0.510 ] } }, { "index": 231, "index_chain": 67, "chain_name": "J", "nt_resnum": 72, "nt_name": "DA", "nt_code": "A", "nt_id": "///J/72", "linked_nts": [ "///J/71", "///J/73" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -45.925, "beta": 153.588, "gamma": 31.359, "delta": 143.767, "epsilon": -118.302, "zeta": -153.020, "epsilon_zeta": 34.719, "bb_type": "--", "chi": -108.264, "glyco_bond": "anti", "C5prime_xyz": [ -2.155, 8.322, -1.789 ], "P_xyz": [ 0.243, 9.285, -1.384 ], "form": "B", "ssZp": 1.251, "Dp": 1.368, "splay_angle": 19.474, "splay_distance": 3.402, "splay_ratio": 0.176, "d22": null, "d64": null, "eta": 178.878, "theta": -147.956, "eta_prime": -164.628, "theta_prime": -155.434, "eta_base": -139.479, "theta_base": -130.682, "v0": -24.138, "v1": 37.923, "v2": -36.614, "v3": 23.586, "v4": 0.089, "amplitude": 38.699, "phase_angle": 161.108, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.004, "origin": [ 124.686, 161.337, 99.680 ], "x_axis": [ -0.621, -0.049, 0.783 ], "y_axis": [ -0.784, 0.065, -0.617 ], "z_axis": [ -0.021, -0.997, -0.079 ], "quaternion": [ -0.302, -0.314, 0.664, -0.607 ] } }, { "index": 232, "index_chain": 68, "chain_name": "J", "nt_resnum": 73, "nt_name": "DA", "nt_code": "A", "nt_id": "///J/73", "linked_nts": [ "///J/72", "///J/74" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -51.470, "beta": 144.451, "gamma": 26.461, "delta": 135.280, "epsilon": -160.728, "zeta": -121.777, "epsilon_zeta": -38.951, "bb_type": "BI", "chi": -94.032, "glyco_bond": "anti", "C5prime_xyz": [ -2.495, 7.856, -2.481 ], "P_xyz": [ -0.060, 8.782, -2.673 ], "form": "B", "ssZp": 1.800, "Dp": 2.159, "splay_angle": 22.542, "splay_distance": 3.870, "splay_ratio": 0.196, "d22": null, "d64": null, "eta": 157.214, "theta": -140.216, "eta_prime": 178.991, "theta_prime": -153.590, "eta_base": -152.071, "theta_base": -120.385, "v0": -24.524, "v1": 34.004, "v2": -30.276, "v3": 16.907, "v4": 4.568, "amplitude": 33.792, "phase_angle": 153.633, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "4b", "suiteness": 0.010, "filter_rmsd": 0.038, "frame": { "rmsd": 0.004, "origin": [ 125.177, 158.366, 98.096 ], "x_axis": [ -0.909, 0.038, 0.415 ], "y_axis": [ -0.416, -0.014, -0.909 ], "z_axis": [ -0.029, -0.999, 0.028 ], "quaternion": [ 0.162, 0.138, -0.683, 0.698 ] } }, { "index": 233, "index_chain": 69, "chain_name": "J", "nt_resnum": 74, "nt_name": "DA", "nt_code": "A", "nt_id": "///J/74", "linked_nts": [ "///J/73", "///J/75" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -37.374, "beta": 155.813, "gamma": 38.854, "delta": 119.767, "epsilon": -105.821, "zeta": -173.173, "epsilon_zeta": 67.352, "bb_type": "BII", "chi": -100.706, "glyco_bond": "anti", "C5prime_xyz": [ -3.027, 7.993, -2.345 ], "P_xyz": [ -0.881, 9.242, -3.149 ], "form": ".", "ssZp": 1.095, "Dp": 1.769, "splay_angle": 27.346, "splay_distance": 4.973, "splay_ratio": 0.264, "d22": null, "d64": null, "eta": -164.901, "theta": -179.062, "eta_prime": -154.601, "theta_prime": -169.455, "eta_base": -122.133, "theta_base": -121.630, "v0": -35.124, "v1": 34.307, "v2": -20.873, "v3": 1.334, "v4": 21.086, "amplitude": 35.713, "phase_angle": 125.766, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.003, "origin": [ 124.279, 154.608, 97.883 ], "x_axis": [ -0.995, 0.056, -0.079 ], "y_axis": [ 0.070, -0.151, -0.986 ], "z_axis": [ -0.067, -0.987, 0.147 ], "quaternion": [ -0.005, -0.048, -0.651, 0.757 ] } }, { "index": 234, "index_chain": 70, "chain_name": "J", "nt_resnum": 75, "nt_name": "DG", "nt_code": "G", "nt_id": "///J/75", "linked_nts": [ "///J/74", "///J/76" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -54.043, "beta": 121.017, "gamma": 52.811, "delta": 139.927, "epsilon": -148.322, "zeta": -152.097, "epsilon_zeta": 3.775, "bb_type": "--", "chi": -92.425, "glyco_bond": "anti", "C5prime_xyz": [ -2.729, 7.879, -2.434 ], "P_xyz": [ -0.184, 7.694, -3.016 ], "form": "B", "ssZp": 1.811, "Dp": 2.015, "splay_angle": 24.733, "splay_distance": 4.198, "splay_ratio": 0.220, "d22": null, "d64": null, "eta": 166.499, "theta": -143.815, "eta_prime": -158.646, "theta_prime": -170.144, "eta_base": -118.028, "theta_base": -119.928, "v0": -26.676, "v1": 38.088, "v2": -34.354, "v3": 19.931, "v4": 3.968, "amplitude": 37.837, "phase_angle": 155.224, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.003, "frame": { "rmsd": 0.003, "origin": [ 124.761, 150.202, 95.627 ], "x_axis": [ -0.767, -0.054, -0.639 ], "y_axis": [ 0.637, -0.172, -0.751 ], "z_axis": [ -0.070, -0.984, 0.166 ], "quaternion": [ -0.238, -0.244, -0.598, 0.726 ] } }, { "index": 235, "index_chain": 71, "chain_name": "J", "nt_resnum": 76, "nt_name": "DG", "nt_code": "G", "nt_id": "///J/76", "linked_nts": [ "///J/75", "///J/77" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -40.718, "beta": 132.268, "gamma": 54.261, "delta": 134.026, "epsilon": -157.675, "zeta": -129.863, "epsilon_zeta": -27.812, "bb_type": "--", "chi": -111.551, "glyco_bond": "anti", "C5prime_xyz": [ -2.541, 8.450, -1.759 ], "P_xyz": [ 0.023, 8.771, -2.159 ], "form": ".", "ssZp": 2.315, "Dp": 2.286, "splay_angle": 28.399, "splay_distance": 4.662, "splay_ratio": 0.248, "d22": null, "d64": null, "eta": 171.100, "theta": -144.568, "eta_prime": -160.305, "theta_prime": -162.584, "eta_base": -109.879, "theta_base": -112.272, "v0": -30.663, "v1": 38.615, "v2": -31.423, "v3": 14.643, "v4": 9.810, "amplitude": 37.761, "phase_angle": 146.322, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.004, "frame": { "rmsd": 0.004, "origin": [ 125.199, 146.101, 94.844 ], "x_axis": [ -0.198, -0.157, -0.968 ], "y_axis": [ 0.977, -0.111, -0.182 ], "z_axis": [ -0.079, -0.981, 0.175 ], "quaternion": [ -0.465, -0.429, -0.478, 0.609 ] } }, { "index": 236, "index_chain": 72, "chain_name": "J", "nt_resnum": 77, "nt_name": "DC", "nt_code": "C", "nt_id": "///J/77", "linked_nts": [ "///J/76", "///J/78" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -57.307, "beta": 150.091, "gamma": 67.389, "delta": 143.463, "epsilon": -163.261, "zeta": -126.176, "epsilon_zeta": -37.085, "bb_type": "BI", "chi": -120.161, "glyco_bond": "anti", "C5prime_xyz": [ -2.048, 8.649, -1.234 ], "P_xyz": [ 0.550, 8.928, -1.407 ], "form": "B", "ssZp": 2.154, "Dp": 2.155, "splay_angle": 19.645, "splay_distance": 3.192, "splay_ratio": 0.173, "d22": null, "d64": null, "eta": 169.063, "theta": -141.908, "eta_prime": -154.609, "theta_prime": -166.273, "eta_base": -101.115, "theta_base": -122.849, "v0": -25.539, "v1": 38.987, "v2": -36.752, "v3": 23.022, "v4": 1.326, "amplitude": 39.298, "phase_angle": 159.260, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.004, "origin": [ 125.983, 141.505, 94.847 ], "x_axis": [ 0.551, -0.206, -0.808 ], "y_axis": [ 0.834, 0.114, 0.540 ], "z_axis": [ -0.019, -0.972, 0.235 ], "quaternion": [ 0.689, 0.548, 0.286, -0.377 ] } }, { "index": 237, "index_chain": 73, "chain_name": "J", "nt_resnum": 78, "nt_name": "DA", "nt_code": "A", "nt_id": "///J/78", "linked_nts": [ "///J/77", "///J/79" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -70.456, "beta": 170.932, "gamma": 56.755, "delta": 142.139, "epsilon": -170.899, "zeta": -96.917, "epsilon_zeta": -73.982, "bb_type": "BI", "chi": -122.572, "glyco_bond": "anti", "C5prime_xyz": [ -1.598, 8.509, -1.075 ], "P_xyz": [ 0.947, 8.895, -0.559 ], "form": "B", "ssZp": 2.188, "Dp": 2.180, "splay_angle": 22.806, "splay_distance": 3.933, "splay_ratio": 0.200, "d22": null, "d64": null, "eta": 162.229, "theta": -123.009, "eta_prime": -173.176, "theta_prime": -143.251, "eta_base": -121.313, "theta_base": -115.286, "v0": -15.844, "v1": 29.634, "v2": -31.346, "v3": 22.974, "v4": -4.670, "amplitude": 31.877, "phase_angle": 169.527, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.004, "origin": [ 125.733, 138.543, 96.009 ], "x_axis": [ 0.962, -0.042, -0.271 ], "y_axis": [ 0.272, 0.265, 0.925 ], "z_axis": [ 0.033, -0.963, 0.266 ], "quaternion": [ 0.789, 0.598, 0.096, -0.099 ] } }, { "index": 238, "index_chain": 74, "chain_name": "J", "nt_resnum": 79, "nt_name": "DT", "nt_code": "T", "nt_id": "///J/79", "linked_nts": [ "///J/78", "///J/80" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -66.086, "beta": 178.600, "gamma": 51.414, "delta": 132.852, "epsilon": -166.488, "zeta": -120.487, "epsilon_zeta": -46.001, "bb_type": "BI", "chi": -120.817, "glyco_bond": "anti", "C5prime_xyz": [ -2.466, 8.622, -1.399 ], "P_xyz": [ -0.320, 10.076, -1.049 ], "form": "B", "ssZp": 2.323, "Dp": 2.326, "splay_angle": 18.068, "splay_distance": 2.961, "splay_ratio": 0.157, "d22": null, "d64": null, "eta": 166.429, "theta": -157.421, "eta_prime": -166.976, "theta_prime": -164.370, "eta_base": -127.357, "theta_base": -118.405, "v0": -32.787, "v1": 40.047, "v2": -31.734, "v3": 13.807, "v4": 11.616, "amplitude": 39.165, "phase_angle": 144.122, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.105, "frame": { "rmsd": 0.002, "origin": [ 125.724, 134.618, 96.252 ], "x_axis": [ 0.964, 0.120, 0.238 ], "y_axis": [ -0.264, 0.307, 0.914 ], "z_axis": [ 0.037, -0.944, 0.328 ], "quaternion": [ 0.806, 0.576, -0.062, 0.119 ] } }, { "index": 239, "index_chain": 75, "chain_name": "J", "nt_resnum": 80, "nt_name": "DG", "nt_code": "G", "nt_id": "///J/80", "linked_nts": [ "///J/79", "///J/81" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -62.476, "beta": 169.064, "gamma": 51.351, "delta": 136.901, "epsilon": -167.104, "zeta": -98.587, "epsilon_zeta": -68.518, "bb_type": "BI", "chi": -122.109, "glyco_bond": "anti", "C5prime_xyz": [ -1.853, 8.634, -1.212 ], "P_xyz": [ 0.619, 9.364, -0.756 ], "form": "B", "ssZp": 2.252, "Dp": 2.254, "splay_angle": 21.545, "splay_distance": 3.718, "splay_ratio": 0.188, "d22": null, "d64": null, "eta": 165.422, "theta": -129.389, "eta_prime": -172.730, "theta_prime": -144.229, "eta_base": -120.283, "theta_base": -115.631, "v0": -21.652, "v1": 32.053, "v2": -29.799, "v3": 18.037, "v4": 2.089, "amplitude": 32.226, "phase_angle": 157.624, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.007, "frame": { "rmsd": 0.007, "origin": [ 126.001, 131.779, 97.048 ], "x_axis": [ 0.561, 0.348, 0.751 ], "y_axis": [ -0.823, 0.140, 0.550 ], "z_axis": [ 0.086, -0.927, 0.365 ], "quaternion": [ 0.719, 0.514, -0.231, 0.408 ] } }, { "index": 240, "index_chain": 76, "chain_name": "J", "nt_resnum": 81, "nt_name": "DT", "nt_code": "T", "nt_id": "///J/81", "linked_nts": [ "///J/80", "///J/82" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -59.003, "beta": -177.852, "gamma": 38.486, "delta": 133.795, "epsilon": -167.825, "zeta": -114.648, "epsilon_zeta": -53.176, "bb_type": "BI", "chi": -111.543, "glyco_bond": "anti", "C5prime_xyz": [ -2.333, 8.415, -1.803 ], "P_xyz": [ -0.261, 9.984, -1.516 ], "form": "B", "ssZp": 2.212, "Dp": 2.262, "splay_angle": 19.881, "splay_distance": 3.366, "splay_ratio": 0.173, "d22": 4.415, "d64": 3.821, "eta": 165.293, "theta": -152.848, "eta_prime": -170.938, "theta_prime": -158.196, "eta_base": -132.610, "theta_base": -124.252, "v0": -28.161, "v1": 36.394, "v2": -30.514, "v3": 15.069, "v4": 7.990, "amplitude": 35.775, "phase_angle": 148.533, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.105, "frame": { "rmsd": 0.003, "origin": [ 126.940, 128.370, 98.197 ], "x_axis": [ 0.042, 0.462, 0.886 ], "y_axis": [ -0.994, -0.068, 0.083 ], "z_axis": [ 0.098, -0.884, 0.457 ], "quaternion": [ 0.598, 0.404, -0.329, 0.609 ] } }, { "index": 241, "index_chain": 77, "chain_name": "J", "nt_resnum": 82, "nt_name": "DT", "nt_code": "T", "nt_id": "///J/82", "linked_nts": [ "///J/81", "///J/83" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -50.415, "beta": 170.585, "gamma": 41.671, "delta": 139.064, "epsilon": -147.318, "zeta": -133.315, "epsilon_zeta": -14.002, "bb_type": "--", "chi": -107.896, "glyco_bond": "anti", "C5prime_xyz": [ -2.409, 8.345, -1.878 ], "P_xyz": [ -0.153, 9.655, -1.780 ], "form": "B", "ssZp": 1.912, "Dp": 1.967, "splay_angle": 18.013, "splay_distance": 3.089, "splay_ratio": 0.157, "d22": 4.271, "d64": 3.463, "eta": 175.634, "theta": -147.986, "eta_prime": -164.994, "theta_prime": -161.035, "eta_base": -128.075, "theta_base": -118.293, "v0": -28.426, "v1": 39.383, "v2": -34.863, "v3": 19.386, "v4": 5.412, "amplitude": 39.005, "phase_angle": 153.356, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.105, "frame": { "rmsd": 0.002, "origin": [ 127.617, 125.487, 99.798 ], "x_axis": [ -0.494, 0.422, 0.760 ], "y_axis": [ -0.861, -0.356, -0.362 ], "z_axis": [ 0.118, -0.834, 0.539 ], "quaternion": [ 0.415, 0.284, -0.387, 0.773 ] } }, { "index": 242, "index_chain": 78, "chain_name": "J", "nt_resnum": 83, "nt_name": "DC", "nt_code": "C", "nt_id": "///J/83", "linked_nts": [ "///J/82", "///J/84" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -45.853, "beta": 146.716, "gamma": 33.658, "delta": 100.219, "epsilon": -175.504, "zeta": -92.094, "epsilon_zeta": -83.410, "bb_type": "BI", "chi": -125.098, "glyco_bond": "anti", "C5prime_xyz": [ -2.249, 8.695, -1.618 ], "P_xyz": [ 0.171, 9.684, -1.748 ], "form": "B", "ssZp": 2.719, "Dp": 3.133, "splay_angle": 20.066, "splay_distance": 3.441, "splay_ratio": 0.176, "d22": null, "d64": null, "eta": 161.873, "theta": -156.798, "eta_prime": 174.752, "theta_prime": -157.240, "eta_base": -134.930, "theta_base": -121.462, "v0": -28.265, "v1": 14.750, "v2": 2.918, "v3": -19.160, "v4": 30.056, "amplitude": 30.109, "phase_angle": 84.438, "puckering": "O4'-endo", "sugar_class": "--", "bin": "23p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.064, "frame": { "rmsd": 0.004, "origin": [ 127.837, 122.985, 101.595 ], "x_axis": [ -0.911, 0.202, 0.360 ], "y_axis": [ -0.407, -0.584, -0.702 ], "z_axis": [ 0.069, -0.786, 0.614 ], "quaternion": [ 0.173, 0.122, -0.422, 0.882 ] } }, { "index": 243, "index_chain": 79, "chain_name": "J", "nt_resnum": 84, "nt_name": "DA", "nt_code": "A", "nt_id": "///J/84", "linked_nts": [ "///J/83", "///J/85" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -43.472, "beta": 164.943, "gamma": 49.953, "delta": 138.445, "epsilon": -140.923, "zeta": -143.160, "epsilon_zeta": 2.237, "bb_type": "--", "chi": -111.246, "glyco_bond": "anti", "C5prime_xyz": [ -2.251, 8.389, -1.736 ], "P_xyz": [ 0.193, 9.324, -1.688 ], "form": ".", "ssZp": 1.857, "Dp": 1.937, "splay_angle": 21.145, "splay_distance": 3.690, "splay_ratio": 0.200, "d22": null, "d64": null, "eta": -176.917, "theta": -160.260, "eta_prime": -150.631, "theta_prime": -164.159, "eta_base": -113.127, "theta_base": -125.572, "v0": -26.601, "v1": 37.380, "v2": -33.439, "v3": 18.967, "v4": 4.540, "amplitude": 37.114, "phase_angle": 154.289, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1b", "suiteness": 0.137, "filter_rmsd": 0.038, "frame": { "rmsd": 0.004, "origin": [ 127.457, 120.149, 103.506 ], "x_axis": [ -0.993, -0.078, -0.085 ], "y_axis": [ 0.115, -0.689, -0.716 ], "z_axis": [ -0.003, -0.721, 0.693 ], "quaternion": [ -0.053, -0.024, -0.391, 0.919 ] } }, { "index": 244, "index_chain": 80, "chain_name": "J", "nt_resnum": 85, "nt_name": "DG", "nt_code": "G", "nt_id": "///J/85", "linked_nts": [ "///J/84", "///J/86" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -63.712, "beta": 157.433, "gamma": 53.277, "delta": 146.515, "epsilon": -170.566, "zeta": -111.758, "epsilon_zeta": -58.808, "bb_type": "BI", "chi": -98.715, "glyco_bond": "anti", "C5prime_xyz": [ -1.800, 7.999, -2.160 ], "P_xyz": [ 0.813, 8.166, -2.199 ], "form": "B", "ssZp": 1.661, "Dp": 1.872, "splay_angle": 20.451, "splay_distance": 3.434, "splay_ratio": 0.178, "d22": null, "d64": null, "eta": 162.437, "theta": -127.086, "eta_prime": -167.625, "theta_prime": -152.937, "eta_base": -128.540, "theta_base": -104.866, "v0": -12.696, "v1": 29.545, "v2": -34.401, "v3": 27.887, "v4": -9.828, "amplitude": 34.432, "phase_angle": 177.552, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.007, "frame": { "rmsd": 0.007, "origin": [ 128.610, 117.075, 105.192 ], "x_axis": [ -0.724, -0.458, -0.516 ], "y_axis": [ 0.685, -0.564, -0.461 ], "z_axis": [ -0.080, -0.687, 0.722 ], "quaternion": [ -0.329, -0.172, -0.331, 0.867 ] } }, { "index": 245, "index_chain": 81, "chain_name": "J", "nt_resnum": 86, "nt_name": "DC", "nt_code": "C", "nt_id": "///J/86", "linked_nts": [ "///J/85", "///J/87" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -50.226, "beta": 168.965, "gamma": 43.287, "delta": 140.882, "epsilon": -95.344, "zeta": -172.852, "epsilon_zeta": 77.508, "bb_type": "BII", "chi": -95.057, "glyco_bond": "anti", "C5prime_xyz": [ -2.462, 8.015, -2.334 ], "P_xyz": [ -0.082, 9.050, -2.685 ], "form": ".", "ssZp": 0.661, "Dp": 0.961, "splay_angle": 28.547, "splay_distance": 5.016, "splay_ratio": 0.267, "d22": 5.792, "d64": 4.558, "eta": -165.014, "theta": -156.368, "eta_prime": -146.967, "theta_prime": -152.904, "eta_base": -100.237, "theta_base": -100.541, "v0": -24.889, "v1": 37.123, "v2": -34.614, "v3": 21.136, "v4": 2.088, "amplitude": 37.323, "phase_angle": 158.036, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.062, "frame": { "rmsd": 0.003, "origin": [ 128.494, 114.042, 106.796 ], "x_axis": [ -0.146, -0.723, -0.676 ], "y_axis": [ 0.970, -0.238, 0.045 ], "z_axis": [ -0.193, -0.649, 0.736 ], "quaternion": [ 0.581, 0.298, 0.207, -0.728 ] } }, { "index": 246, "index_chain": 82, "chain_name": "J", "nt_resnum": 87, "nt_name": "DT", "nt_code": "T", "nt_id": "///J/87", "linked_nts": [ "///J/86", "///J/88" ], "nt_type": "DNA", "dbn": ")", "summary": "~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -49.164, "beta": 124.257, "gamma": 38.981, "delta": 143.720, "epsilon": -137.381, "zeta": -164.346, "epsilon_zeta": 26.965, "bb_type": "--", "chi": -76.776, "glyco_bond": "--", "C5prime_xyz": [ -3.235, 7.337, -2.767 ], "P_xyz": [ -0.732, 7.592, -3.490 ], "form": ".", "ssZp": 1.504, "Dp": 1.796, "splay_angle": 30.102, "splay_distance": 5.084, "splay_ratio": 0.273, "d22": null, "d64": null, "eta": 167.707, "theta": -159.534, "eta_prime": -157.957, "theta_prime": -177.399, "eta_base": -113.060, "theta_base": -125.042, "v0": -28.458, "v1": 41.836, "v2": -38.432, "v3": 23.070, "v4": 3.070, "amplitude": 41.762, "phase_angle": 156.964, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "4b", "suiteness": 0.110, "filter_rmsd": 0.106, "frame": { "rmsd": 0.003, "origin": [ 130.849, 110.910, 109.926 ], "x_axis": [ 0.500, -0.730, -0.465 ], "y_axis": [ 0.831, 0.254, 0.495 ], "z_axis": [ -0.243, -0.634, 0.734 ], "quaternion": [ 0.789, 0.358, 0.070, -0.495 ] } }, { "index": 247, "index_chain": 83, "chain_name": "J", "nt_resnum": 88, "nt_name": "DG", "nt_code": "G", "nt_id": "///J/88", "linked_nts": [ "///J/87", "///J/89" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -63.046, "beta": 139.310, "gamma": 57.325, "delta": 142.503, "epsilon": -162.981, "zeta": -112.233, "epsilon_zeta": -50.748, "bb_type": "BI", "chi": -122.355, "glyco_bond": "anti", "C5prime_xyz": [ -1.738, 8.589, -1.097 ], "P_xyz": [ 0.880, 8.413, -1.010 ], "form": "B", "ssZp": 2.227, "Dp": 2.170, "splay_angle": 23.875, "splay_distance": 3.919, "splay_ratio": 0.208, "d22": null, "d64": null, "eta": 162.065, "theta": -124.955, "eta_prime": -168.965, "theta_prime": -150.706, "eta_base": -117.829, "theta_base": -114.512, "v0": -18.563, "v1": 32.210, "v2": -32.737, "v3": 22.859, "v4": -2.908, "amplitude": 33.730, "phase_angle": 166.061, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "4b", "suiteness": 0.163, "filter_rmsd": 0.007, "frame": { "rmsd": 0.007, "origin": [ 131.932, 108.688, 114.369 ], "x_axis": [ 0.940, -0.144, -0.311 ], "y_axis": [ 0.295, 0.801, 0.520 ], "z_axis": [ 0.174, -0.581, 0.795 ], "quaternion": [ 0.940, 0.293, 0.129, -0.117 ] } }, { "index": 248, "index_chain": 84, "chain_name": "J", "nt_resnum": 89, "nt_name": "DA", "nt_code": "A", "nt_id": "///J/89", "linked_nts": [ "///J/88", "///J/90" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -76.188, "beta": 175.135, "gamma": 62.692, "delta": 141.336, "epsilon": -167.346, "zeta": -112.725, "epsilon_zeta": -54.620, "bb_type": "BI", "chi": -118.398, "glyco_bond": "anti", "C5prime_xyz": [ -1.804, 8.487, -1.327 ], "P_xyz": [ 0.739, 9.057, -1.045 ], "form": "B", "ssZp": 2.142, "Dp": 2.144, "splay_angle": 19.776, "splay_distance": 3.323, "splay_ratio": 0.172, "d22": null, "d64": null, "eta": 163.316, "theta": -137.410, "eta_prime": -167.391, "theta_prime": -156.374, "eta_base": -120.947, "theta_base": -125.175, "v0": -19.546, "v1": 32.618, "v2": -32.604, "v3": 22.163, "v4": -1.873, "amplitude": 33.860, "phase_angle": 164.341, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.004, "origin": [ 132.453, 106.702, 117.707 ], "x_axis": [ 0.902, 0.431, 0.024 ], "y_axis": [ -0.372, 0.749, 0.548 ], "z_axis": [ 0.218, -0.503, 0.836 ], "quaternion": [ 0.934, 0.282, 0.052, 0.215 ] } }, { "index": 249, "index_chain": 85, "chain_name": "J", "nt_resnum": 90, "nt_name": "DA", "nt_code": "A", "nt_id": "///J/90", "linked_nts": [ "///J/89", "///J/91" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -60.679, "beta": 170.284, "gamma": 49.393, "delta": 132.535, "epsilon": -169.543, "zeta": -103.945, "epsilon_zeta": -65.598, "bb_type": "BI", "chi": -122.489, "glyco_bond": "anti", "C5prime_xyz": [ -2.123, 8.618, -1.302 ], "P_xyz": [ 0.216, 9.704, -0.878 ], "form": ".", "ssZp": 2.263, "Dp": 2.295, "splay_angle": 19.240, "splay_distance": 3.400, "splay_ratio": 0.172, "d22": null, "d64": null, "eta": 165.364, "theta": -140.502, "eta_prime": -171.657, "theta_prime": -154.513, "eta_base": -130.974, "theta_base": -129.969, "v0": -27.339, "v1": 34.914, "v2": -29.023, "v3": 14.076, "v4": 8.110, "amplitude": 34.305, "phase_angle": 147.783, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.004, "origin": [ 133.094, 104.448, 120.063 ], "x_axis": [ 0.554, 0.785, 0.277 ], "y_axis": [ -0.802, 0.414, 0.432 ], "z_axis": [ 0.224, -0.461, 0.858 ], "quaternion": [ 0.841, 0.266, -0.016, 0.472 ] } }, { "index": 250, "index_chain": 86, "chain_name": "J", "nt_resnum": 91, "nt_name": "DT", "nt_code": "T", "nt_id": "///J/91", "linked_nts": [ "///J/90", "///J/92" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -51.662, "beta": 179.532, "gamma": 33.289, "delta": 122.836, "epsilon": -162.086, "zeta": -106.869, "epsilon_zeta": -55.217, "bb_type": "BI", "chi": -117.071, "glyco_bond": "anti", "C5prime_xyz": [ -2.328, 8.509, -1.726 ], "P_xyz": [ -0.350, 10.191, -1.435 ], "form": "B", "ssZp": 2.272, "Dp": 2.423, "splay_angle": 20.424, "splay_distance": 3.569, "splay_ratio": 0.178, "d22": 4.216, "d64": 3.847, "eta": 171.334, "theta": -149.294, "eta_prime": -174.218, "theta_prime": -153.205, "eta_base": -141.891, "theta_base": -114.555, "v0": -30.228, "v1": 31.790, "v2": -21.683, "v3": 4.949, "v4": 15.745, "amplitude": 32.092, "phase_angle": 132.506, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.002, "origin": [ 134.776, 102.341, 122.134 ], "x_axis": [ 0.093, 0.899, 0.429 ], "y_axis": [ -0.956, -0.041, 0.292 ], "z_axis": [ 0.280, -0.437, 0.855 ], "quaternion": [ 0.690, 0.264, -0.054, 0.671 ] } }, { "index": 251, "index_chain": 87, "chain_name": "J", "nt_resnum": 92, "nt_name": "DT", "nt_code": "T", "nt_id": "///J/92", "linked_nts": [ "///J/91", "///J/93" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -42.490, "beta": 157.311, "gamma": 40.575, "delta": 106.016, "epsilon": 177.799, "zeta": -91.170, "epsilon_zeta": -91.031, "bb_type": "BI", "chi": -124.156, "glyco_bond": "anti", "C5prime_xyz": [ -2.639, 8.601, -1.628 ], "P_xyz": [ -0.440, 9.983, -1.852 ], "form": "B", "ssZp": 2.720, "Dp": 2.830, "splay_angle": 21.200, "splay_distance": 3.653, "splay_ratio": 0.185, "d22": 4.054, "d64": 3.959, "eta": 167.867, "theta": -156.965, "eta_prime": -171.521, "theta_prime": -160.978, "eta_base": -126.337, "theta_base": -119.283, "v0": -35.237, "v1": 25.479, "v2": -7.305, "v3": -12.602, "v4": 30.158, "amplitude": 34.406, "phase_angle": 102.258, "puckering": "O4'-endo", "sugar_class": "--", "bin": "23p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.001, "origin": [ 135.857, 101.461, 125.420 ], "x_axis": [ -0.442, 0.756, 0.482 ], "y_axis": [ -0.841, -0.537, 0.071 ], "z_axis": [ 0.313, -0.374, 0.873 ], "quaternion": [ 0.473, 0.235, -0.089, 0.844 ] } }, { "index": 252, "index_chain": 88, "chain_name": "J", "nt_resnum": 93, "nt_name": "DC", "nt_code": "C", "nt_id": "///J/93", "linked_nts": [ "///J/92", "///J/94" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -42.404, "beta": 166.632, "gamma": 49.805, "delta": 131.705, "epsilon": -152.005, "zeta": -109.113, "epsilon_zeta": -42.893, "bb_type": "BI", "chi": -122.899, "glyco_bond": "anti", "C5prime_xyz": [ -2.429, 8.719, -1.324 ], "P_xyz": [ -0.178, 10.003, -1.023 ], "form": "B", "ssZp": 2.193, "Dp": 2.201, "splay_angle": 18.292, "splay_distance": 3.086, "splay_ratio": 0.159, "d22": null, "d64": null, "eta": -177.213, "theta": -139.128, "eta_prime": -153.024, "theta_prime": -147.307, "eta_base": -107.127, "theta_base": -110.749, "v0": -34.018, "v1": 40.363, "v2": -31.176, "v3": 12.521, "v4": 13.186, "amplitude": 39.579, "phase_angle": 141.969, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1b", "suiteness": 0.010, "filter_rmsd": 0.063, "frame": { "rmsd": 0.003, "origin": [ 136.633, 101.015, 128.961 ], "x_axis": [ -0.842, 0.329, 0.427 ], "y_axis": [ -0.440, -0.878, -0.191 ], "z_axis": [ 0.312, -0.349, 0.884 ], "quaternion": [ 0.203, 0.195, -0.142, 0.949 ] } }, { "index": 253, "index_chain": 89, "chain_name": "J", "nt_resnum": 94, "nt_name": "DA", "nt_code": "A", "nt_id": "///J/94", "linked_nts": [ "///J/93", "///J/95" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -74.869, "beta": 166.368, "gamma": 53.315, "delta": 136.849, "epsilon": -152.286, "zeta": -139.973, "epsilon_zeta": -12.313, "bb_type": "--", "chi": -108.913, "glyco_bond": "anti", "C5prime_xyz": [ -2.528, 8.328, -1.873 ], "P_xyz": [ -0.177, 9.461, -2.080 ], "form": "B", "ssZp": 2.060, "Dp": 2.101, "splay_angle": 19.094, "splay_distance": 3.189, "splay_ratio": 0.169, "d22": null, "d64": null, "eta": 158.490, "theta": -163.644, "eta_prime": -174.338, "theta_prime": -172.535, "eta_base": -130.958, "theta_base": -134.731, "v0": -30.618, "v1": 40.136, "v2": -33.907, "v3": 17.248, "v4": 8.092, "amplitude": 39.374, "phase_angle": 149.448, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.037, "frame": { "rmsd": 0.003, "origin": [ 137.289, 100.025, 131.810 ], "x_axis": [ -0.984, -0.171, 0.058 ], "y_axis": [ 0.147, -0.945, -0.291 ], "z_axis": [ 0.104, -0.278, 0.955 ], "quaternion": [ -0.081, 0.041, -0.145, 0.985 ] } }, { "index": 254, "index_chain": 90, "chain_name": "J", "nt_resnum": 95, "nt_name": "DG", "nt_code": "G", "nt_id": "///J/95", "linked_nts": [ "///J/94", "///J/96" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -64.010, "beta": 153.229, "gamma": 56.795, "delta": 138.149, "epsilon": -161.682, "zeta": -112.807, "epsilon_zeta": -48.875, "bb_type": "BI", "chi": -116.246, "glyco_bond": "anti", "C5prime_xyz": [ -2.044, 8.534, -1.495 ], "P_xyz": [ 0.537, 8.970, -1.522 ], "form": "B", "ssZp": 2.162, "Dp": 2.176, "splay_angle": 22.888, "splay_distance": 3.828, "splay_ratio": 0.199, "d22": null, "d64": null, "eta": 165.066, "theta": -133.547, "eta_prime": -171.845, "theta_prime": -151.879, "eta_base": -131.056, "theta_base": -111.551, "v0": -23.616, "v1": 34.513, "v2": -31.768, "v3": 19.003, "v4": 2.661, "amplitude": 34.547, "phase_angle": 156.858, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.005, "frame": { "rmsd": 0.005, "origin": [ 138.300, 99.163, 134.709 ], "x_axis": [ -0.726, -0.674, -0.141 ], "y_axis": [ 0.686, -0.693, -0.221 ], "z_axis": [ 0.051, -0.257, 0.965 ], "quaternion": [ -0.370, -0.024, -0.130, 0.920 ] } }, { "index": 255, "index_chain": 91, "chain_name": "J", "nt_resnum": 96, "nt_name": "DC", "nt_code": "C", "nt_id": "///J/96", "linked_nts": [ "///J/95", "///J/97" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -59.010, "beta": 169.031, "gamma": 51.816, "delta": 135.914, "epsilon": -107.000, "zeta": -169.846, "epsilon_zeta": 62.846, "bb_type": "BII", "chi": -107.471, "glyco_bond": "anti", "C5prime_xyz": [ -2.303, 8.360, -1.933 ], "P_xyz": [ 0.125, 9.319, -2.116 ], "form": ".", "ssZp": 1.146, "Dp": 1.376, "splay_angle": 33.196, "splay_distance": 5.702, "splay_ratio": 0.301, "d22": 6.247, "d64": 5.476, "eta": -167.761, "theta": -169.730, "eta_prime": -150.967, "theta_prime": -165.887, "eta_base": -109.144, "theta_base": -119.998, "v0": -27.192, "v1": 36.557, "v2": -31.581, "v3": 16.774, "v4": 6.287, "amplitude": 36.012, "phase_angle": 151.278, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.003, "origin": [ 138.464, 97.711, 138.247 ], "x_axis": [ -0.141, -0.966, -0.215 ], "y_axis": [ 0.990, -0.136, -0.036 ], "z_axis": [ 0.006, -0.218, 0.976 ], "quaternion": [ 0.652, 0.070, 0.085, -0.750 ] } }, { "index": 256, "index_chain": 92, "chain_name": "J", "nt_resnum": 97, "nt_name": "DT", "nt_code": "T", "nt_id": "///J/97", "linked_nts": [ "///J/96", "///J/98" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -58.820, "beta": 130.956, "gamma": 54.446, "delta": 140.035, "epsilon": -147.507, "zeta": -140.051, "epsilon_zeta": -7.457, "bb_type": "--", "chi": -103.344, "glyco_bond": "anti", "C5prime_xyz": [ -2.383, 8.195, -2.024 ], "P_xyz": [ 0.204, 8.151, -2.429 ], "form": ".", "ssZp": 1.957, "Dp": 2.036, "splay_angle": 27.800, "splay_distance": 4.669, "splay_ratio": 0.253, "d22": null, "d64": null, "eta": 173.434, "theta": -147.242, "eta_prime": -156.039, "theta_prime": -166.876, "eta_base": -116.513, "theta_base": -115.489, "v0": -25.196, "v1": 36.772, "v2": -33.697, "v3": 20.093, "v4": 2.977, "amplitude": 36.714, "phase_angle": 156.613, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "4b", "suiteness": 0.172, "filter_rmsd": 0.106, "frame": { "rmsd": 0.002, "origin": [ 141.026, 97.685, 143.341 ], "x_axis": [ 0.503, -0.864, -0.030 ], "y_axis": [ 0.860, 0.503, -0.084 ], "z_axis": [ 0.088, 0.016, 0.996 ], "quaternion": [ 0.866, -0.029, 0.034, -0.498 ] } }, { "index": 257, "index_chain": 93, "chain_name": "J", "nt_resnum": 98, "nt_name": "DG", "nt_code": "G", "nt_id": "///J/98", "linked_nts": [ "///J/97", "///J/99" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -69.544, "beta": 142.008, "gamma": 75.448, "delta": 149.117, "epsilon": -165.740, "zeta": -128.458, "epsilon_zeta": -37.283, "bb_type": "BI", "chi": -114.965, "glyco_bond": "anti", "C5prime_xyz": [ -1.903, 8.472, -1.351 ], "P_xyz": [ 0.670, 8.262, -1.828 ], "form": "B", "ssZp": 2.029, "Dp": 2.026, "splay_angle": 22.163, "splay_distance": 3.582, "splay_ratio": 0.194, "d22": null, "d64": null, "eta": 158.124, "theta": -133.672, "eta_prime": -155.899, "theta_prime": -171.661, "eta_base": -104.736, "theta_base": -130.011, "v0": -19.224, "v1": 35.988, "v2": -38.002, "v3": 27.923, "v4": -5.711, "amplitude": 38.643, "phase_angle": 169.547, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.004, "frame": { "rmsd": 0.004, "origin": [ 143.011, 98.797, 147.418 ], "x_axis": [ 0.958, -0.277, -0.074 ], "y_axis": [ 0.269, 0.958, -0.097 ], "z_axis": [ 0.097, 0.073, 0.993 ], "quaternion": [ 0.989, -0.043, 0.043, -0.138 ] } }, { "index": 258, "index_chain": 94, "chain_name": "J", "nt_resnum": 99, "nt_name": "DA", "nt_code": "A", "nt_id": "///J/99", "linked_nts": [ "///J/98", "///J/100" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -67.240, "beta": 169.840, "gamma": 56.828, "delta": 144.143, "epsilon": -162.682, "zeta": -100.823, "epsilon_zeta": -61.859, "bb_type": "BI", "chi": -127.831, "glyco_bond": "anti", "C5prime_xyz": [ -1.585, 8.601, -0.767 ], "P_xyz": [ 0.906, 8.983, -0.035 ], "form": "B", "ssZp": 2.009, "Dp": 2.031, "splay_angle": 19.181, "splay_distance": 3.292, "splay_ratio": 0.168, "d22": null, "d64": null, "eta": 167.190, "theta": -120.754, "eta_prime": -169.822, "theta_prime": -141.553, "eta_base": -121.275, "theta_base": -110.315, "v0": -17.138, "v1": 31.960, "v2": -33.820, "v3": 24.803, "v4": -5.033, "amplitude": 34.394, "phase_angle": 169.516, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.004, "origin": [ 142.651, 99.176, 150.962 ], "x_axis": [ 0.911, 0.367, -0.187 ], "y_axis": [ -0.399, 0.899, -0.182 ], "z_axis": [ 0.102, 0.241, 0.965 ], "quaternion": [ 0.972, -0.109, 0.074, 0.197 ] } }, { "index": 259, "index_chain": 95, "chain_name": "J", "nt_resnum": 100, "nt_name": "DA", "nt_code": "A", "nt_id": "///J/100", "linked_nts": [ "///J/99", "///J/101" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -66.331, "beta": 175.260, "gamma": 42.400, "delta": 129.650, "epsilon": -169.124, "zeta": -86.228, "epsilon_zeta": -82.896, "bb_type": "BI", "chi": -120.431, "glyco_bond": "anti", "C5prime_xyz": [ -2.251, 8.581, -1.444 ], "P_xyz": [ -0.065, 9.962, -1.020 ], "form": ".", "ssZp": 2.383, "Dp": 2.389, "splay_angle": 18.989, "splay_distance": 3.325, "splay_ratio": 0.168, "d22": null, "d64": null, "eta": 157.219, "theta": -136.676, "eta_prime": -176.540, "theta_prime": -158.202, "eta_base": -131.876, "theta_base": -123.471, "v0": -29.188, "v1": 34.876, "v2": -27.225, "v3": 11.227, "v4": 11.067, "amplitude": 34.240, "phase_angle": 142.669, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.004, "origin": [ 143.283, 99.315, 154.189 ], "x_axis": [ 0.528, 0.787, -0.318 ], "y_axis": [ -0.841, 0.538, -0.065 ], "z_axis": [ 0.120, 0.302, 0.946 ], "quaternion": [ 0.868, -0.106, 0.126, 0.469 ] } }, { "index": 260, "index_chain": 96, "chain_name": "J", "nt_resnum": 101, "nt_name": "DC", "nt_code": "C", "nt_id": "///J/101", "linked_nts": [ "///J/100", "///J/102" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -133.477, "beta": 141.372, "gamma": 126.485, "delta": 94.423, "epsilon": -149.447, "zeta": -84.873, "epsilon_zeta": -64.575, "bb_type": "BI", "chi": -165.806, "glyco_bond": "anti", "C5prime_xyz": [ -1.931, 8.989, 0.549 ], "P_xyz": [ -0.124, 10.169, -0.938 ], "form": "B", "ssZp": 3.568, "Dp": 3.633, "splay_angle": 20.822, "splay_distance": 3.507, "splay_ratio": 0.181, "d22": null, "d64": null, "eta": 170.494, "theta": -170.658, "eta_prime": 176.039, "theta_prime": -162.451, "eta_base": -138.374, "theta_base": -134.030, "v0": -21.337, "v1": 3.861, "v2": 13.502, "v3": -26.119, "v4": 30.149, "amplitude": 29.715, "phase_angle": 62.974, "puckering": "C4'-exo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.064, "frame": { "rmsd": 0.003, "origin": [ 144.584, 100.002, 157.170 ], "x_axis": [ -0.005, 0.941, -0.338 ], "y_axis": [ -0.991, 0.040, 0.127 ], "z_axis": [ 0.133, 0.336, 0.933 ], "quaternion": [ 0.701, -0.075, 0.168, 0.689 ] } }, { "index": 261, "index_chain": 97, "chain_name": "J", "nt_resnum": 102, "nt_name": "DA", "nt_code": "A", "nt_id": "///J/102", "linked_nts": [ "///J/101", "///J/103" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -57.269, "beta": 169.066, "gamma": 52.442, "delta": 132.144, "epsilon": -164.809, "zeta": -95.951, "epsilon_zeta": -68.859, "bb_type": "BI", "chi": -128.448, "glyco_bond": "anti", "C5prime_xyz": [ -2.057, 8.700, -1.003 ], "P_xyz": [ 0.327, 9.637, -0.466 ], "form": "B", "ssZp": 2.337, "Dp": 2.335, "splay_angle": 22.680, "splay_distance": 3.943, "splay_ratio": 0.200, "d22": null, "d64": null, "eta": 166.057, "theta": -130.135, "eta_prime": -161.811, "theta_prime": -142.182, "eta_base": -126.497, "theta_base": -111.961, "v0": -26.946, "v1": 34.148, "v2": -28.166, "v3": 13.435, "v4": 8.279, "amplitude": 33.521, "phase_angle": 147.166, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1b", "suiteness": 0.427, "filter_rmsd": 0.037, "frame": { "rmsd": 0.003, "origin": [ 145.758, 101.068, 160.298 ], "x_axis": [ -0.543, 0.789, -0.289 ], "y_axis": [ -0.827, -0.442, 0.347 ], "z_axis": [ 0.146, 0.427, 0.892 ], "quaternion": [ 0.476, -0.042, 0.228, 0.848 ] } }, { "index": 262, "index_chain": 98, "chain_name": "J", "nt_resnum": 103, "nt_name": "DT", "nt_code": "T", "nt_id": "///J/103", "linked_nts": [ "///J/102", "///J/104" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -59.791, "beta": -179.767, "gamma": 41.708, "delta": 130.309, "epsilon": -158.298, "zeta": -132.425, "epsilon_zeta": -25.873, "bb_type": "--", "chi": -112.151, "glyco_bond": "anti", "C5prime_xyz": [ -2.585, 8.412, -1.821 ], "P_xyz": [ -0.557, 10.060, -1.730 ], "form": "B", "ssZp": 2.260, "Dp": 2.290, "splay_angle": 21.637, "splay_distance": 3.614, "splay_ratio": 0.189, "d22": null, "d64": null, "eta": 169.406, "theta": -167.253, "eta_prime": -167.433, "theta_prime": -169.135, "eta_base": -128.331, "theta_base": -127.548, "v0": -32.568, "v1": 38.284, "v2": -29.288, "v3": 11.402, "v4": 13.038, "amplitude": 37.584, "phase_angle": 141.195, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.002, "origin": [ 146.674, 103.400, 163.343 ], "x_axis": [ -0.906, 0.419, -0.063 ], "y_axis": [ -0.397, -0.790, 0.467 ], "z_axis": [ 0.146, 0.448, 0.882 ], "quaternion": [ 0.216, 0.022, 0.242, 0.946 ] } }, { "index": 263, "index_chain": 99, "chain_name": "J", "nt_resnum": 104, "nt_name": "DG", "nt_code": "G", "nt_id": "///J/104", "linked_nts": [ "///J/103", "///J/105" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -57.016, "beta": 150.260, "gamma": 60.662, "delta": 134.518, "epsilon": -172.742, "zeta": -102.894, "epsilon_zeta": -69.848, "bb_type": "BI", "chi": -122.518, "glyco_bond": "anti", "C5prime_xyz": [ -2.199, 8.673, -1.264 ], "P_xyz": [ 0.358, 9.208, -1.342 ], "form": "B", "ssZp": 2.351, "Dp": 2.343, "splay_angle": 21.008, "splay_distance": 3.568, "splay_ratio": 0.184, "d22": null, "d64": null, "eta": 164.563, "theta": -131.655, "eta_prime": -166.851, "theta_prime": -154.125, "eta_base": -121.831, "theta_base": -109.464, "v0": -28.136, "v1": 36.519, "v2": -30.675, "v3": 15.288, "v4": 7.833, "amplitude": 35.866, "phase_angle": 148.789, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.005, "frame": { "rmsd": 0.005, "origin": [ 147.343, 104.750, 166.628 ], "x_axis": [ -0.969, -0.111, 0.220 ], "y_axis": [ 0.197, -0.887, 0.418 ], "z_axis": [ 0.149, 0.448, 0.881 ], "quaternion": [ -0.080, 0.096, 0.224, 0.967 ] } }, { "index": 264, "index_chain": 100, "chain_name": "J", "nt_resnum": 105, "nt_name": "DC", "nt_code": "C", "nt_id": "///J/105", "linked_nts": [ "///J/104", "///J/106" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -62.113, "beta": 172.926, "gamma": 54.758, "delta": 134.453, "epsilon": -161.039, "zeta": -127.978, "epsilon_zeta": -33.061, "bb_type": "BI", "chi": -121.939, "glyco_bond": "anti", "C5prime_xyz": [ -2.295, 8.708, -1.316 ], "P_xyz": [ 0.012, 9.896, -1.017 ], "form": "B", "ssZp": 2.252, "Dp": 2.255, "splay_angle": 21.273, "splay_distance": 3.503, "splay_ratio": 0.185, "d22": 4.931, "d64": 4.271, "eta": 170.812, "theta": -157.581, "eta_prime": -163.779, "theta_prime": -165.090, "eta_base": -109.680, "theta_base": -124.149, "v0": -31.335, "v1": 39.529, "v2": -32.325, "v3": 15.199, "v4": 9.850, "amplitude": 38.704, "phase_angle": 146.634, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.002, "origin": [ 146.934, 106.452, 169.737 ], "x_axis": [ -0.618, -0.650, 0.442 ], "y_axis": [ 0.770, -0.614, 0.174 ], "z_axis": [ 0.159, 0.448, 0.880 ], "quaternion": [ -0.402, 0.170, 0.176, 0.882 ] } }, { "index": 265, "index_chain": 101, "chain_name": "J", "nt_resnum": 106, "nt_name": "DC", "nt_code": "C", "nt_id": "///J/106", "linked_nts": [ "///J/105", "///J/107" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -58.521, "beta": 160.536, "gamma": 57.860, "delta": 140.849, "epsilon": -102.789, "zeta": -156.565, "epsilon_zeta": 53.776, "bb_type": "BII", "chi": -118.553, "glyco_bond": "anti", "C5prime_xyz": [ -2.058, 8.622, -1.352 ], "P_xyz": [ 0.477, 9.257, -1.234 ], "form": ".", "ssZp": 1.111, "Dp": 1.140, "splay_angle": 26.918, "splay_distance": 4.702, "splay_ratio": 0.252, "d22": 6.141, "d64": 5.071, "eta": -163.323, "theta": -149.739, "eta_prime": -149.006, "theta_prime": -150.326, "eta_base": -109.939, "theta_base": -96.443, "v0": -26.234, "v1": 38.222, "v2": -35.036, "v3": 20.840, "v4": 3.113, "amplitude": 38.184, "phase_angle": 156.570, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.003, "origin": [ 147.565, 108.425, 172.563 ], "x_axis": [ -0.007, -0.825, 0.564 ], "y_axis": [ 0.986, -0.099, -0.134 ], "z_axis": [ 0.167, 0.556, 0.815 ], "quaternion": [ 0.654, -0.264, -0.152, -0.693 ] } }, { "index": 266, "index_chain": 102, "chain_name": "J", "nt_resnum": 107, "nt_name": "DT", "nt_code": "T", "nt_id": "///J/107", "linked_nts": [ "///J/106", "///J/108" ], "nt_type": "DNA", "dbn": ")", "summary": "~C2'-endo,BII,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop", "alpha": -58.011, "beta": 127.233, "gamma": 53.614, "delta": 146.470, "epsilon": -120.521, "zeta": 173.385, "epsilon_zeta": 66.094, "bb_type": "BII", "chi": -85.603, "glyco_bond": "--", "C5prime_xyz": [ -3.003, 7.676, -2.527 ], "P_xyz": [ -0.505, 7.678, -3.313 ], "form": ".", "ssZp": 1.364, "Dp": 1.428, "splay_angle": 40.491, "splay_distance": 6.737, "splay_ratio": 0.348, "d22": 6.126, "d64": 6.098, "eta": 172.821, "theta": -177.435, "eta_prime": -147.934, "theta_prime": 162.774, "eta_base": -101.319, "theta_base": -163.938, "v0": -28.497, "v1": 43.111, "v2": -40.336, "v3": 25.075, "v4": 1.824, "amplitude": 43.288, "phase_angle": 158.718, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "4b", "suiteness": 0.034, "filter_rmsd": 0.105, "frame": { "rmsd": 0.003, "origin": [ 150.639, 110.899, 175.121 ], "x_axis": [ 0.688, -0.492, 0.534 ], "y_axis": [ 0.723, 0.534, -0.439 ], "z_axis": [ -0.069, 0.687, 0.723 ], "quaternion": [ 0.858, -0.328, -0.176, -0.354 ] } }, { "index": 267, "index_chain": 103, "chain_name": "J", "nt_resnum": 108, "nt_name": "DT", "nt_code": "T", "nt_id": "///J/108", "linked_nts": [ "///J/107", "///J/109" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,BI,non-pair-contact,internal-loop", "alpha": -71.313, "beta": 151.517, "gamma": 54.114, "delta": 144.197, "epsilon": -178.732, "zeta": -81.153, "epsilon_zeta": -97.578, "bb_type": "BI", "chi": -126.401, "glyco_bond": "anti", "C5prime_xyz": [ -2.097, 8.703, -0.913 ], "P_xyz": [ 0.434, 9.254, -0.457 ], "form": ".", "ssZp": 2.134, "Dp": 2.306, "splay_angle": 24.947, "splay_distance": 4.228, "splay_ratio": 0.223, "d22": 3.754, "d64": 3.334, "eta": 168.455, "theta": -103.671, "eta_prime": -169.554, "theta_prime": -129.957, "eta_base": -139.684, "theta_base": -68.271, "v0": -26.569, "v1": 40.290, "v2": -37.695, "v3": 23.296, "v4": 1.819, "amplitude": 40.476, "phase_angle": 158.636, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "4b", "suiteness": 0.716, "filter_rmsd": 0.105, "frame": { "rmsd": 0.003, "origin": [ 148.065, 116.756, 177.234 ], "x_axis": [ 0.880, -0.276, 0.386 ], "y_axis": [ 0.460, 0.301, -0.835 ], "z_axis": [ 0.114, 0.913, 0.392 ], "quaternion": [ 0.802, -0.545, -0.085, -0.230 ] } }, { "index": 268, "index_chain": 104, "chain_name": "J", "nt_resnum": 109, "nt_name": "DT", "nt_code": "T", "nt_id": "///J/109", "linked_nts": [ "///J/108", "///J/110" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop,phosphate", "alpha": -66.808, "beta": -169.036, "gamma": 37.825, "delta": 140.927, "epsilon": -172.091, "zeta": -108.101, "epsilon_zeta": -63.990, "bb_type": "BI", "chi": -103.787, "glyco_bond": "anti", "C5prime_xyz": [ -2.270, 8.230, -2.043 ], "P_xyz": [ -0.223, 9.863, -1.760 ], "form": "B", "ssZp": 2.059, "Dp": 2.142, "splay_angle": 18.564, "splay_distance": 3.093, "splay_ratio": 0.161, "d22": 4.061, "d64": 3.158, "eta": 158.897, "theta": -145.826, "eta_prime": -165.466, "theta_prime": -153.032, "eta_base": -88.739, "theta_base": -103.776, "v0": -24.073, "v1": 36.865, "v2": -35.053, "v3": 21.945, "v4": 1.084, "amplitude": 37.394, "phase_angle": 159.620, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.107, "frame": { "rmsd": 0.003, "origin": [ 151.233, 119.214, 178.576 ], "x_axis": [ 0.878, 0.032, -0.478 ], "y_axis": [ -0.436, 0.467, -0.769 ], "z_axis": [ 0.199, 0.884, 0.424 ], "quaternion": [ 0.832, -0.497, 0.204, 0.141 ] } }, { "index": 269, "index_chain": 105, "chain_name": "J", "nt_resnum": 110, "nt_name": "DT", "nt_code": "T", "nt_id": "///J/110", "linked_nts": [ "///J/109", "///J/111" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -66.456, "beta": 170.362, "gamma": 56.260, "delta": 140.388, "epsilon": -150.978, "zeta": -122.155, "epsilon_zeta": -28.823, "bb_type": "--", "chi": -104.990, "glyco_bond": "anti", "C5prime_xyz": [ -2.544, 8.264, -1.958 ], "P_xyz": [ -0.165, 9.340, -2.200 ], "form": "B", "ssZp": 1.997, "Dp": 2.028, "splay_angle": 16.873, "splay_distance": 2.882, "splay_ratio": 0.147, "d22": null, "d64": null, "eta": 168.898, "theta": -144.970, "eta_prime": -164.982, "theta_prime": -165.581, "eta_base": -112.106, "theta_base": -127.036, "v0": -28.552, "v1": 40.237, "v2": -35.936, "v3": 20.551, "v4": 4.694, "amplitude": 39.839, "phase_angle": 154.425, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.004, "origin": [ 152.436, 122.028, 179.022 ], "x_axis": [ 0.391, 0.220, -0.894 ], "y_axis": [ -0.846, 0.469, -0.254 ], "z_axis": [ 0.363, 0.855, 0.369 ], "quaternion": [ 0.747, -0.372, 0.421, 0.357 ] } }, { "index": 270, "index_chain": 106, "chain_name": "J", "nt_resnum": 111, "nt_name": "DG", "nt_code": "G", "nt_id": "///J/111", "linked_nts": [ "///J/110", "///J/112" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop", "alpha": -79.025, "beta": 146.658, "gamma": 65.983, "delta": 103.044, "epsilon": -147.890, "zeta": -79.916, "epsilon_zeta": -67.974, "bb_type": "BI", "chi": -141.051, "glyco_bond": "anti", "C5prime_xyz": [ -2.450, 8.906, -0.864 ], "P_xyz": [ -0.017, 9.752, -1.396 ], "form": ".", "ssZp": 2.976, "Dp": 3.070, "splay_angle": 21.877, "splay_distance": 3.921, "splay_ratio": 0.214, "d22": null, "d64": null, "eta": 163.418, "theta": -102.260, "eta_prime": 173.988, "theta_prime": -131.361, "eta_base": -140.081, "theta_base": -162.323, "v0": -33.149, "v1": 20.907, "v2": -2.105, "v3": -16.718, "v4": 31.487, "amplitude": 33.293, "phase_angle": 93.625, "puckering": "O4'-endo", "sugar_class": "--", "bin": "23p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.005, "frame": { "rmsd": 0.005, "origin": [ 153.702, 124.396, 180.070 ], "x_axis": [ -0.194, 0.312, -0.930 ], "y_axis": [ -0.902, 0.316, 0.294 ], "z_axis": [ 0.386, 0.896, 0.220 ], "quaternion": [ 0.579, -0.260, 0.568, 0.524 ] } }, { "index": 271, "index_chain": 107, "chain_name": "J", "nt_resnum": 112, "nt_name": "DA", "nt_code": "A", "nt_id": "///J/112", "linked_nts": [ "///J/111", "///J/113" ], "nt_type": "DNA", "dbn": ".", "summary": "~C2'-endo,BI,non-canonical,non-pair-contact,internal-loop", "alpha": 139.844, "beta": 133.170, "gamma": -179.407, "delta": 162.267, "epsilon": 157.649, "zeta": -85.539, "epsilon_zeta": -116.812, "bb_type": "BI", "chi": -81.145, "glyco_bond": "--", "C5prime_xyz": [ -1.183, 6.831, -2.453 ], "P_xyz": [ -0.310, 6.570, -4.924 ], "form": ".", "ssZp": 0.925, "Dp": 1.378, "splay_angle": 27.220, "splay_distance": 4.390, "splay_ratio": 0.246, "d22": null, "d64": null, "eta": 141.129, "theta": 179.243, "eta_prime": 172.120, "theta_prime": 176.462, "eta_base": 153.144, "theta_base": -99.756, "v0": 12.338, "v1": 13.691, "v2": -32.832, "v3": 40.729, "v4": -33.768, "amplitude": 40.531, "phase_angle": 215.899, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "32t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.005, "origin": [ 154.910, 126.641, 183.049 ], "x_axis": [ -0.563, -0.177, -0.808 ], "y_axis": [ -0.630, 0.723, 0.281 ], "z_axis": [ 0.535, 0.667, -0.519 ], "quaternion": [ 0.401, -0.241, 0.837, 0.283 ] } }, { "index": 272, "index_chain": 108, "chain_name": "J", "nt_resnum": 113, "nt_name": "DT", "nt_code": "T", "nt_id": "///J/113", "linked_nts": [ "///J/112", "///J/114" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,non-canonical,non-pair-contact,helix,internal-loop", "alpha": -166.777, "beta": 164.918, "gamma": 151.950, "delta": 150.910, "epsilon": -117.098, "zeta": -96.722, "epsilon_zeta": -20.376, "bb_type": "--", "chi": -104.626, "glyco_bond": "anti", "C5prime_xyz": [ -1.192, 7.807, -1.757 ], "P_xyz": [ 0.496, 7.333, -3.711 ], "form": ".", "ssZp": 0.763, "Dp": 1.921, "splay_angle": 46.973, "splay_distance": 7.810, "splay_ratio": 0.414, "d22": null, "d64": null, "eta": -157.867, "theta": -109.675, "eta_prime": -148.857, "theta_prime": -126.185, "eta_base": -77.014, "theta_base": -102.330, "v0": 3.362, "v1": 16.257, "v2": -28.335, "v3": 30.993, "v4": -21.885, "amplitude": 31.171, "phase_angle": 204.631, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "22t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.002, "origin": [ 153.444, 130.448, 181.428 ], "x_axis": [ -0.807, 0.539, -0.242 ], "y_axis": [ 0.262, 0.695, 0.670 ], "z_axis": [ 0.529, 0.477, -0.702 ], "quaternion": [ 0.216, 0.224, 0.895, 0.320 ] } }, { "index": 273, "index_chain": 109, "chain_name": "J", "nt_resnum": 114, "nt_name": "DG", "nt_code": "G", "nt_id": "///J/114", "linked_nts": [ "///J/113", "///J/115" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop", "alpha": 168.303, "beta": 171.518, "gamma": 146.830, "delta": 157.362, "epsilon": -164.163, "zeta": -108.790, "epsilon_zeta": -55.373, "bb_type": "BI", "chi": -119.679, "glyco_bond": "anti", "C5prime_xyz": [ -0.928, 8.097, -0.885 ], "P_xyz": [ 1.286, 7.829, -2.267 ], "form": ".", "ssZp": 1.731, "Dp": 1.816, "splay_angle": 25.906, "splay_distance": 4.329, "splay_ratio": 0.233, "d22": null, "d64": null, "eta": 114.884, "theta": -118.067, "eta_prime": -171.647, "theta_prime": -154.396, "eta_base": -151.001, "theta_base": -114.498, "v0": 3.384, "v1": 19.252, "v2": -33.032, "v3": 35.932, "v4": -24.984, "amplitude": 36.130, "phase_angle": 203.899, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "22t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.006, "frame": { "rmsd": 0.006, "origin": [ 156.950, 137.426, 181.289 ], "x_axis": [ -0.842, -0.127, 0.525 ], "y_axis": [ 0.533, -0.040, 0.845 ], "z_axis": [ -0.086, 0.991, 0.101 ], "quaternion": [ -0.234, 0.156, 0.652, 0.704 ] } }, { "index": 274, "index_chain": 110, "chain_name": "J", "nt_resnum": 115, "nt_name": "DG", "nt_code": "G", "nt_id": "///J/115", "linked_nts": [ "///J/114", "///J/116" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": 175.355, "beta": -179.597, "gamma": 155.089, "delta": 157.941, "epsilon": -144.117, "zeta": -146.125, "epsilon_zeta": 2.009, "bb_type": "--", "chi": -114.663, "glyco_bond": "anti", "C5prime_xyz": [ -1.331, 8.223, -1.164 ], "P_xyz": [ 0.788, 8.201, -2.705 ], "form": ".", "ssZp": 1.512, "Dp": 1.579, "splay_angle": 30.202, "splay_distance": 5.075, "splay_ratio": 0.280, "d22": null, "d64": null, "eta": 167.212, "theta": -178.362, "eta_prime": -157.162, "theta_prime": 173.462, "eta_base": -117.771, "theta_base": -137.494, "v0": -4.870, "v1": 26.992, "v2": -37.432, "v3": 35.702, "v4": -19.588, "amplitude": 38.199, "phase_angle": 191.495, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "22t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.003, "frame": { "rmsd": 0.003, "origin": [ 157.680, 141.452, 182.705 ], "x_axis": [ -0.287, -0.177, 0.941 ], "y_axis": [ 0.946, 0.101, 0.307 ], "z_axis": [ -0.149, 0.979, 0.138 ], "quaternion": [ -0.488, 0.344, 0.559, 0.575 ] } }, { "index": 275, "index_chain": 111, "chain_name": "J", "nt_resnum": 116, "nt_name": "DA", "nt_code": "A", "nt_id": "///J/116", "linked_nts": [ "///J/115", "///J/117" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -62.988, "beta": 155.285, "gamma": 63.358, "delta": 146.898, "epsilon": -175.221, "zeta": -95.111, "epsilon_zeta": -80.110, "bb_type": "BI", "chi": -104.683, "glyco_bond": "anti", "C5prime_xyz": [ -1.602, 8.049, -1.864 ], "P_xyz": [ 1.002, 7.773, -2.004 ], "form": "B", "ssZp": 1.894, "Dp": 2.000, "splay_angle": 25.199, "splay_distance": 4.148, "splay_ratio": 0.220, "d22": null, "d64": null, "eta": 166.541, "theta": -117.526, "eta_prime": -157.488, "theta_prime": -154.732, "eta_base": -114.947, "theta_base": -111.911, "v0": -9.257, "v1": 26.175, "v2": -32.186, "v3": 27.653, "v4": -11.788, "amplitude": 32.212, "phase_angle": 182.318, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.003, "origin": [ 159.034, 146.259, 181.807 ], "x_axis": [ 0.357, 0.229, 0.906 ], "y_axis": [ 0.928, 0.025, -0.372 ], "z_axis": [ -0.108, 0.973, -0.203 ], "quaternion": [ 0.543, -0.619, -0.467, -0.322 ] } }, { "index": 276, "index_chain": 112, "chain_name": "J", "nt_resnum": 117, "nt_name": "DG", "nt_code": "G", "nt_id": "///J/117", "linked_nts": [ "///J/116", "///J/118" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -141.960, "beta": 143.831, "gamma": 138.036, "delta": 154.066, "epsilon": -169.163, "zeta": -96.451, "epsilon_zeta": -72.712, "bb_type": "BI", "chi": -132.836, "glyco_bond": "anti", "C5prime_xyz": [ -1.353, 8.514, -0.262 ], "P_xyz": [ 0.670, 8.976, -1.854 ], "form": "B", "ssZp": 1.969, "Dp": 1.959, "splay_angle": 22.557, "splay_distance": 3.814, "splay_ratio": 0.198, "d22": null, "d64": null, "eta": 171.407, "theta": -144.011, "eta_prime": -155.165, "theta_prime": -166.811, "eta_base": -107.538, "theta_base": -127.438, "v0": -9.534, "v1": 29.461, "v2": -36.868, "v3": 32.318, "v4": -14.497, "amplitude": 36.955, "phase_angle": 183.943, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.004, "frame": { "rmsd": 0.004, "origin": [ 159.513, 150.281, 180.910 ], "x_axis": [ 0.878, 0.183, 0.443 ], "y_axis": [ 0.471, -0.162, -0.867 ], "z_axis": [ -0.087, 0.970, -0.228 ], "quaternion": [ 0.610, -0.753, -0.217, -0.118 ] } }, { "index": 277, "index_chain": 113, "chain_name": "J", "nt_resnum": 118, "nt_name": "DC", "nt_code": "C", "nt_id": "///J/118", "linked_nts": [ "///J/117", "///J/119" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -69.474, "beta": -170.358, "gamma": 40.565, "delta": 141.621, "epsilon": -164.120, "zeta": -67.171, "epsilon_zeta": -96.950, "bb_type": "BI", "chi": -120.697, "glyco_bond": "anti", "C5prime_xyz": [ -1.853, 8.642, -1.244 ], "P_xyz": [ 0.255, 9.918, -0.337 ], "form": "B", "ssZp": 2.189, "Dp": 2.168, "splay_angle": 18.501, "splay_distance": 3.178, "splay_ratio": 0.162, "d22": null, "d64": null, "eta": 161.058, "theta": -121.657, "eta_prime": -171.623, "theta_prime": -145.029, "eta_base": -124.824, "theta_base": -101.942, "v0": -23.704, "v1": 36.663, "v2": -34.927, "v3": 22.042, "v4": 0.810, "amplitude": 37.170, "phase_angle": 159.995, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.005, "origin": [ 158.653, 153.993, 180.742 ], "x_axis": [ 0.989, 0.027, -0.146 ], "y_axis": [ -0.126, -0.373, -0.919 ], "z_axis": [ -0.079, 0.927, -0.366 ], "quaternion": [ 0.559, -0.826, 0.030, 0.068 ] } }, { "index": 278, "index_chain": 114, "chain_name": "J", "nt_resnum": 119, "nt_name": "DA", "nt_code": "A", "nt_id": "///J/119", "linked_nts": [ "///J/118", "///J/120" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -137.534, "beta": 99.237, "gamma": 150.824, "delta": 142.162, "epsilon": -148.903, "zeta": -81.845, "epsilon_zeta": -67.059, "bb_type": "BI", "chi": -159.696, "glyco_bond": "anti", "C5prime_xyz": [ -1.745, 8.616, 0.910 ], "P_xyz": [ -0.377, 9.962, -0.878 ], "form": ".", "ssZp": 1.749, "Dp": 2.008, "splay_angle": 20.919, "splay_distance": 3.647, "splay_ratio": 0.185, "d22": null, "d64": null, "eta": -148.894, "theta": 173.791, "eta_prime": -159.661, "theta_prime": -160.838, "eta_base": -109.933, "theta_base": -129.118, "v0": -20.305, "v1": 33.723, "v2": -33.582, "v3": 22.668, "v4": -1.688, "amplitude": 34.939, "phase_angle": 163.982, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.004, "origin": [ 159.138, 156.965, 179.729 ], "x_axis": [ 0.743, -0.290, -0.603 ], "y_axis": [ -0.669, -0.327, -0.667 ], "z_axis": [ -0.004, 0.899, -0.437 ], "quaternion": [ -0.494, 0.792, -0.303, -0.192 ] } }, { "index": 279, "index_chain": 115, "chain_name": "J", "nt_resnum": 120, "nt_name": "DG", "nt_code": "G", "nt_id": "///J/120", "linked_nts": [ "///J/119", "///J/121" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -53.398, "beta": -158.989, "gamma": -0.614, "delta": 150.437, "epsilon": -174.396, "zeta": -99.816, "epsilon_zeta": -74.580, "bb_type": "BI", "chi": -108.531, "glyco_bond": "anti", "C5prime_xyz": [ -1.473, 8.187, -1.604 ], "P_xyz": [ 0.071, 10.175, -0.863 ], "form": "B", "ssZp": 1.845, "Dp": 1.918, "splay_angle": 19.867, "splay_distance": 3.449, "splay_ratio": 0.174, "d22": null, "d64": null, "eta": 145.368, "theta": -147.670, "eta_prime": 179.680, "theta_prime": -151.058, "eta_base": -141.132, "theta_base": -123.181, "v0": -8.134, "v1": 26.902, "v2": -34.368, "v3": 30.519, "v4": -14.305, "amplitude": 34.515, "phase_angle": 185.287, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.006, "frame": { "rmsd": 0.006, "origin": [ 159.717, 160.553, 179.419 ], "x_axis": [ 0.228, -0.520, -0.823 ], "y_axis": [ -0.972, -0.166, -0.165 ], "z_axis": [ -0.051, 0.838, -0.543 ], "quaternion": [ -0.360, 0.696, -0.536, -0.314 ] } }, { "index": 280, "index_chain": 116, "chain_name": "J", "nt_resnum": 121, "nt_name": "DT", "nt_code": "T", "nt_id": "///J/121", "linked_nts": [ "///J/120", "///J/122" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -49.961, "beta": -172.963, "gamma": 25.229, "delta": 139.281, "epsilon": -165.889, "zeta": -120.460, "epsilon_zeta": -45.428, "bb_type": "BI", "chi": -103.522, "glyco_bond": "anti", "C5prime_xyz": [ -2.252, 8.194, -2.061 ], "P_xyz": [ -0.355, 9.975, -1.802 ], "form": "B", "ssZp": 2.010, "Dp": 2.118, "splay_angle": 19.399, "splay_distance": 3.294, "splay_ratio": 0.168, "d22": 4.416, "d64": 3.758, "eta": 166.213, "theta": -155.634, "eta_prime": -172.808, "theta_prime": -159.725, "eta_base": -139.900, "theta_base": -129.349, "v0": -23.705, "v1": 35.425, "v2": -33.202, "v3": 20.354, "v4": 1.853, "amplitude": 35.730, "phase_angle": 158.317, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.002, "origin": [ 160.237, 163.596, 177.882 ], "x_axis": [ -0.238, -0.610, -0.756 ], "y_axis": [ -0.970, 0.111, 0.217 ], "z_axis": [ -0.049, 0.785, -0.618 ], "quaternion": [ 0.252, -0.563, 0.701, 0.357 ] } }, { "index": 281, "index_chain": 117, "chain_name": "J", "nt_resnum": 122, "nt_name": "DT", "nt_code": "T", "nt_id": "///J/122", "linked_nts": [ "///J/121", "///J/123" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -42.543, "beta": 169.247, "gamma": 31.811, "delta": 137.644, "epsilon": -158.207, "zeta": -129.451, "epsilon_zeta": -28.756, "bb_type": "--", "chi": -102.144, "glyco_bond": "anti", "C5prime_xyz": [ -2.420, 8.161, -2.130 ], "P_xyz": [ -0.218, 9.564, -2.126 ], "form": "B", "ssZp": 1.970, "Dp": 2.106, "splay_angle": 21.120, "splay_distance": 3.566, "splay_ratio": 0.184, "d22": 4.537, "d64": 3.665, "eta": 171.467, "theta": -152.426, "eta_prime": -170.430, "theta_prime": -158.255, "eta_base": -137.066, "theta_base": -117.705, "v0": -26.126, "v1": 36.627, "v2": -32.759, "v3": 18.523, "v4": 4.500, "amplitude": 36.384, "phase_angle": 154.204, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.002, "origin": [ 160.390, 166.214, 175.889 ], "x_axis": [ -0.672, -0.555, -0.489 ], "y_axis": [ -0.738, 0.455, 0.498 ], "z_axis": [ -0.054, 0.696, -0.716 ], "quaternion": [ 0.129, -0.384, 0.843, 0.354 ] } }, { "index": 282, "index_chain": 118, "chain_name": "J", "nt_resnum": 123, "nt_name": "DT", "nt_code": "T", "nt_id": "///J/123", "linked_nts": [ "///J/122", "///J/124" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -41.474, "beta": 155.312, "gamma": 40.654, "delta": 138.817, "epsilon": -156.536, "zeta": -136.087, "epsilon_zeta": -20.448, "bb_type": "--", "chi": -102.260, "glyco_bond": "anti", "C5prime_xyz": [ -2.557, 8.183, -2.098 ], "P_xyz": [ -0.157, 9.191, -2.283 ], "form": "B", "ssZp": 2.045, "Dp": 2.110, "splay_angle": 23.077, "splay_distance": 3.843, "splay_ratio": 0.203, "d22": 4.706, "d64": 3.708, "eta": 170.956, "theta": -152.180, "eta_prime": -164.972, "theta_prime": -162.345, "eta_base": -122.250, "theta_base": -111.940, "v0": -28.553, "v1": 39.356, "v2": -34.655, "v3": 19.109, "v4": 5.642, "amplitude": 38.909, "phase_angle": 152.959, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.002, "origin": [ 159.578, 168.763, 173.531 ], "x_axis": [ -0.965, -0.251, -0.077 ], "y_axis": [ -0.243, 0.740, 0.627 ], "z_axis": [ -0.101, 0.624, -0.775 ], "quaternion": [ -0.006, -0.132, 0.933, 0.335 ] } }, { "index": 283, "index_chain": 119, "chain_name": "J", "nt_resnum": 124, "nt_name": "DC", "nt_code": "C", "nt_id": "///J/124", "linked_nts": [ "///J/123", "///J/125" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -47.098, "beta": 151.599, "gamma": 50.410, "delta": 142.651, "epsilon": -159.487, "zeta": -132.028, "epsilon_zeta": -27.459, "bb_type": "--", "chi": -107.161, "glyco_bond": "anti", "C5prime_xyz": [ -2.188, 8.379, -1.854 ], "P_xyz": [ 0.367, 8.909, -1.935 ], "form": "B", "ssZp": 2.012, "Dp": 2.045, "splay_angle": 19.465, "splay_distance": 3.252, "splay_ratio": 0.170, "d22": 4.565, "d64": 3.605, "eta": 169.908, "theta": -144.155, "eta_prime": -161.476, "theta_prime": -163.138, "eta_base": -109.375, "theta_base": -121.013, "v0": -25.022, "v1": 38.264, "v2": -36.284, "v3": 22.760, "v4": 1.146, "amplitude": 38.728, "phase_angle": 159.536, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.003, "origin": [ 158.481, 171.734, 171.355 ], "x_axis": [ -0.878, 0.270, 0.395 ], "y_axis": [ 0.450, 0.745, 0.492 ], "z_axis": [ -0.162, 0.610, -0.776 ], "quaternion": [ -0.151, 0.195, 0.922, 0.299 ] } }, { "index": 284, "index_chain": 120, "chain_name": "J", "nt_resnum": 125, "nt_name": "DC", "nt_code": "C", "nt_id": "///J/125", "linked_nts": [ "///J/124", "///J/126" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -48.823, "beta": 160.504, "gamma": 42.047, "delta": 139.317, "epsilon": -132.000, "zeta": -138.239, "epsilon_zeta": 6.238, "bb_type": "--", "chi": -109.367, "glyco_bond": "anti", "C5prime_xyz": [ -2.054, 8.407, -1.789 ], "P_xyz": [ 0.438, 9.188, -1.646 ], "form": ".", "ssZp": 1.661, "Dp": 1.811, "splay_angle": 27.266, "splay_distance": 4.699, "splay_ratio": 0.245, "d22": null, "d64": null, "eta": -179.726, "theta": -143.528, "eta_prime": -163.284, "theta_prime": -148.164, "eta_base": -118.772, "theta_base": -102.643, "v0": -23.496, "v1": 35.054, "v2": -32.704, "v3": 19.980, "v4": 1.981, "amplitude": 35.259, "phase_angle": 158.056, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.064, "frame": { "rmsd": 0.003, "origin": [ 158.152, 173.897, 168.948 ], "x_axis": [ -0.427, 0.645, 0.633 ], "y_axis": [ 0.878, 0.463, 0.121 ], "z_axis": [ -0.215, 0.607, -0.765 ], "quaternion": [ -0.260, 0.468, 0.815, 0.223 ] } }, { "index": 285, "index_chain": 121, "chain_name": "J", "nt_resnum": 126, "nt_name": "DA", "nt_code": "A", "nt_id": "///J/126", "linked_nts": [ "///J/125", "///J/127" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -52.045, "beta": 139.215, "gamma": 53.238, "delta": 137.405, "epsilon": -156.104, "zeta": -144.245, "epsilon_zeta": -11.859, "bb_type": "--", "chi": -104.597, "glyco_bond": "anti", "C5prime_xyz": [ -2.545, 8.212, -2.009 ], "P_xyz": [ -0.001, 8.554, -2.494 ], "form": "B", "ssZp": 2.183, "Dp": 2.214, "splay_angle": 25.151, "splay_distance": 4.165, "splay_ratio": 0.221, "d22": null, "d64": null, "eta": 164.424, "theta": -153.961, "eta_prime": -160.705, "theta_prime": -173.535, "eta_base": -114.196, "theta_base": -128.948, "v0": -28.836, "v1": 38.611, "v2": -33.131, "v3": 17.417, "v4": 6.928, "amplitude": 37.949, "phase_angle": 150.812, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.004, "origin": [ 158.962, 177.477, 166.014 ], "x_axis": [ 0.223, 0.786, 0.577 ], "y_axis": [ 0.954, -0.053, -0.297 ], "z_axis": [ -0.203, 0.616, -0.761 ], "quaternion": [ -0.320, 0.714, 0.609, 0.131 ] } }, { "index": 286, "index_chain": 122, "chain_name": "J", "nt_resnum": 127, "nt_name": "DA", "nt_code": "A", "nt_id": "///J/127", "linked_nts": [ "///J/126", "///J/128" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -50.400, "beta": 139.871, "gamma": 61.187, "delta": 135.967, "epsilon": -162.465, "zeta": -138.738, "epsilon_zeta": -23.728, "bb_type": "--", "chi": -131.219, "glyco_bond": "anti", "C5prime_xyz": [ -2.119, 8.754, -0.802 ], "P_xyz": [ 0.477, 9.045, -0.764 ], "form": "B", "ssZp": 2.351, "Dp": 2.311, "splay_angle": 21.632, "splay_distance": 3.499, "splay_ratio": 0.188, "d22": null, "d64": null, "eta": 168.595, "theta": -137.930, "eta_prime": -162.606, "theta_prime": -160.891, "eta_base": -113.858, "theta_base": -116.981, "v0": -28.538, "v1": 37.736, "v2": -32.044, "v3": 16.382, "v4": 7.442, "amplitude": 37.066, "phase_angle": 149.828, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.039, "frame": { "rmsd": 0.005, "origin": [ 158.688, 179.804, 162.570 ], "x_axis": [ 0.749, 0.593, 0.296 ], "y_axis": [ 0.654, -0.586, -0.479 ], "z_axis": [ -0.111, 0.552, -0.826 ], "quaternion": [ -0.290, 0.889, 0.351, 0.052 ] } }, { "index": 287, "index_chain": 123, "chain_name": "J", "nt_resnum": 128, "nt_name": "DA", "nt_code": "A", "nt_id": "///J/128", "linked_nts": [ "///J/127", "///J/129" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": 15.173, "beta": 165.001, "gamma": -19.558, "delta": 150.280, "epsilon": -178.014, "zeta": -90.459, "epsilon_zeta": -87.555, "bb_type": "BI", "chi": -120.911, "glyco_bond": "anti", "C5prime_xyz": [ -0.915, 8.025, -0.994 ], "P_xyz": [ 1.128, 9.124, 0.200 ], "form": ".", "ssZp": 2.158, "Dp": 2.162, "splay_angle": 23.705, "splay_distance": 4.194, "splay_ratio": 0.208, "d22": null, "d64": null, "eta": 173.241, "theta": -134.463, "eta_prime": -169.069, "theta_prime": -144.810, "eta_base": -116.147, "theta_base": -124.272, "v0": 5.411, "v1": 13.598, "v2": -26.064, "v3": 29.884, "v4": -22.405, "amplitude": 29.743, "phase_angle": 208.802, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.006, "origin": [ 158.024, 181.704, 159.708 ], "x_axis": [ 0.998, -0.003, -0.055 ], "y_axis": [ -0.026, -0.902, -0.432 ], "z_axis": [ -0.048, 0.433, -0.900 ], "quaternion": [ -0.222, 0.975, -0.008, -0.026 ] } }, { "index": 288, "index_chain": 124, "chain_name": "J", "nt_resnum": 129, "nt_name": "DT", "nt_code": "T", "nt_id": "///J/129", "linked_nts": [ "///J/128", "///J/130" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -59.015, "beta": 173.372, "gamma": 49.733, "delta": 118.302, "epsilon": -175.988, "zeta": -93.676, "epsilon_zeta": -82.313, "bb_type": "BI", "chi": -139.463, "glyco_bond": "anti", "C5prime_xyz": [ -2.511, 8.886, -0.739 ], "P_xyz": [ -0.478, 10.413, -0.105 ], "form": ".", "ssZp": 2.690, "Dp": 2.666, "splay_angle": 19.121, "splay_distance": 3.205, "splay_ratio": 0.168, "d22": null, "d64": null, "eta": 167.347, "theta": -151.192, "eta_prime": -168.550, "theta_prime": -154.507, "eta_base": -136.543, "theta_base": -108.278, "v0": -37.495, "v1": 35.596, "v2": -20.567, "v3": -0.330, "v4": 23.616, "amplitude": 37.644, "phase_angle": 123.116, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.105, "frame": { "rmsd": 0.003, "origin": [ 157.001, 184.625, 156.879 ], "x_axis": [ 0.919, -0.310, -0.241 ], "y_axis": [ -0.367, -0.898, -0.243 ], "z_axis": [ -0.141, 0.312, -0.939 ], "quaternion": [ -0.143, 0.969, -0.175, -0.099 ] } }, { "index": 289, "index_chain": 125, "chain_name": "J", "nt_resnum": 130, "nt_name": "DA", "nt_code": "A", "nt_id": "///J/130", "linked_nts": [ "///J/129", "///J/131" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -68.297, "beta": -174.359, "gamma": 48.573, "delta": 138.869, "epsilon": -159.933, "zeta": -112.369, "epsilon_zeta": -47.564, "bb_type": "BI", "chi": -125.835, "glyco_bond": "anti", "C5prime_xyz": [ -1.887, 8.667, -1.012 ], "P_xyz": [ 0.310, 9.778, -0.107 ], "form": "B", "ssZp": 2.147, "Dp": 2.154, "splay_angle": 20.598, "splay_distance": 3.460, "splay_ratio": 0.179, "d22": null, "d64": null, "eta": 167.265, "theta": -142.468, "eta_prime": -169.276, "theta_prime": -150.178, "eta_base": -114.739, "theta_base": -122.633, "v0": -23.970, "v1": 35.442, "v2": -32.847, "v3": 19.840, "v4": 2.399, "amplitude": 35.566, "phase_angle": 157.453, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.039, "frame": { "rmsd": 0.006, "origin": [ 157.480, 185.848, 153.956 ], "x_axis": [ 0.462, -0.862, -0.207 ], "y_axis": [ -0.881, -0.472, -0.000 ], "z_axis": [ -0.097, 0.183, -0.978 ], "quaternion": [ -0.054, 0.853, -0.511, -0.089 ] } }, { "index": 290, "index_chain": 126, "chain_name": "J", "nt_resnum": 131, "nt_name": "DC", "nt_code": "C", "nt_id": "///J/131", "linked_nts": [ "///J/130", "///J/132" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -64.770, "beta": 179.605, "gamma": 40.019, "delta": 138.618, "epsilon": -165.581, "zeta": -113.377, "epsilon_zeta": -52.204, "bb_type": "BI", "chi": -116.729, "glyco_bond": "anti", "C5prime_xyz": [ -1.852, 8.553, -1.475 ], "P_xyz": [ 0.424, 9.699, -0.877 ], "form": "B", "ssZp": 2.159, "Dp": 2.174, "splay_angle": 17.088, "splay_distance": 2.892, "splay_ratio": 0.149, "d22": null, "d64": null, "eta": 162.014, "theta": -145.410, "eta_prime": -176.770, "theta_prime": -154.889, "eta_base": -140.553, "theta_base": -124.401, "v0": -22.488, "v1": 33.921, "v2": -31.960, "v3": 19.782, "v4": 1.474, "amplitude": 34.274, "phase_angle": 158.826, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.003, "origin": [ 157.585, 187.331, 150.831 ], "x_axis": [ -0.069, -0.997, -0.038 ], "y_axis": [ -0.989, 0.063, 0.136 ], "z_axis": [ -0.133, 0.047, -0.990 ], "quaternion": [ -0.033, -0.682, 0.728, 0.063 ] } }, { "index": 291, "index_chain": 127, "chain_name": "J", "nt_resnum": 132, "nt_name": "DA", "nt_code": "A", "nt_id": "///J/132", "linked_nts": [ "///J/131", "///J/133" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -58.048, "beta": 168.121, "gamma": 45.016, "delta": 136.664, "epsilon": -156.922, "zeta": -132.658, "epsilon_zeta": -24.264, "bb_type": "--", "chi": -116.244, "glyco_bond": "anti", "C5prime_xyz": [ -2.206, 8.505, -1.548 ], "P_xyz": [ 0.110, 9.665, -1.214 ], "form": "B", "ssZp": 2.048, "Dp": 2.100, "splay_angle": 22.242, "splay_distance": 3.799, "splay_ratio": 0.193, "d22": null, "d64": null, "eta": 166.219, "theta": -138.371, "eta_prime": -171.376, "theta_prime": -151.765, "eta_base": -134.104, "theta_base": -124.411, "v0": -27.482, "v1": 37.380, "v2": -32.732, "v3": 17.777, "v4": 5.820, "amplitude": 36.971, "phase_angle": 152.293, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.004, "origin": [ 157.681, 187.721, 147.967 ], "x_axis": [ -0.548, -0.824, 0.144 ], "y_axis": [ -0.824, 0.561, 0.082 ], "z_axis": [ -0.148, -0.074, -0.986 ], "quaternion": [ -0.083, -0.468, 0.880, 0.002 ] } }, { "index": 292, "index_chain": 128, "chain_name": "J", "nt_resnum": 133, "nt_name": "DC", "nt_code": "C", "nt_id": "///J/133", "linked_nts": [ "///J/132", "///J/134" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": 38.838, "beta": 177.421, "gamma": -56.676, "delta": 159.199, "epsilon": -161.898, "zeta": -110.738, "epsilon_zeta": -51.160, "bb_type": "BI", "chi": -93.435, "glyco_bond": "anti", "C5prime_xyz": [ -1.312, 7.572, -2.116 ], "P_xyz": [ 0.254, 9.581, -2.692 ], "form": "B", "ssZp": 1.269, "Dp": 1.714, "splay_angle": 20.291, "splay_distance": 3.523, "splay_ratio": 0.177, "d22": 4.274, "d64": 3.589, "eta": 179.961, "theta": -154.810, "eta_prime": -166.070, "theta_prime": -159.963, "eta_base": -135.515, "theta_base": -117.278, "v0": 2.070, "v1": 21.194, "v2": -34.956, "v3": 37.073, "v4": -24.892, "amplitude": 37.626, "phase_angle": 201.713, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "22m", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.003, "origin": [ 157.717, 187.327, 144.189 ], "x_axis": [ -0.902, -0.376, 0.213 ], "y_axis": [ -0.404, 0.908, -0.112 ], "z_axis": [ -0.151, -0.187, -0.971 ], "quaternion": [ -0.094, -0.201, 0.972, -0.077 ] } }, { "index": 293, "index_chain": 129, "chain_name": "J", "nt_resnum": 134, "nt_name": "DT", "nt_code": "T", "nt_id": "///J/134", "linked_nts": [ "///J/133", "///J/135" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -57.711, "beta": 153.195, "gamma": 49.338, "delta": 98.242, "epsilon": 176.502, "zeta": -92.382, "epsilon_zeta": -91.116, "bb_type": "BI", "chi": -120.708, "glyco_bond": "anti", "C5prime_xyz": [ -2.577, 8.504, -1.841 ], "P_xyz": [ -0.258, 9.449, -2.603 ], "form": "B", "ssZp": 2.687, "Dp": 3.109, "splay_angle": 23.594, "splay_distance": 3.969, "splay_ratio": 0.208, "d22": 4.864, "d64": 4.081, "eta": 160.306, "theta": -167.639, "eta_prime": -178.914, "theta_prime": -169.297, "eta_base": -131.379, "theta_base": -134.339, "v0": -30.218, "v1": 15.279, "v2": 3.856, "v3": -21.232, "v4": 32.593, "amplitude": 32.502, "phase_angle": 83.185, "puckering": "O4'-endo", "sugar_class": "--", "bin": "23p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.002, "origin": [ 156.671, 187.233, 140.826 ], "x_axis": [ -0.979, 0.148, 0.137 ], "y_axis": [ 0.111, 0.962, -0.249 ], "z_axis": [ -0.169, -0.229, -0.959 ], "quaternion": [ -0.077, 0.065, 0.987, -0.121 ] } }, { "index": 294, "index_chain": 130, "chain_name": "J", "nt_resnum": 135, "nt_name": "DT", "nt_code": "T", "nt_id": "///J/135", "linked_nts": [ "///J/134", "///J/136" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -49.240, "beta": 175.926, "gamma": 56.053, "delta": 141.337, "epsilon": -178.494, "zeta": -98.131, "epsilon_zeta": -80.364, "bb_type": "BI", "chi": -106.466, "glyco_bond": "anti", "C5prime_xyz": [ -1.942, 8.230, -1.899 ], "P_xyz": [ 0.572, 8.944, -1.824 ], "form": "B", "ssZp": 2.029, "Dp": 2.105, "splay_angle": 21.001, "splay_distance": 3.571, "splay_ratio": 0.183, "d22": 4.013, "d64": 3.585, "eta": 175.318, "theta": -128.305, "eta_prime": -154.440, "theta_prime": -147.502, "eta_base": -118.800, "theta_base": -100.683, "v0": -18.581, "v1": 32.032, "v2": -32.670, "v3": 22.787, "v4": -2.913, "amplitude": 33.658, "phase_angle": 166.084, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1b", "suiteness": 0.124, "filter_rmsd": 0.106, "frame": { "rmsd": 0.002, "origin": [ 155.941, 186.952, 136.934 ], "x_axis": [ -0.761, 0.648, 0.033 ], "y_axis": [ 0.599, 0.721, -0.349 ], "z_axis": [ -0.250, -0.246, -0.937 ], "quaternion": [ -0.077, 0.337, 0.924, -0.161 ] } }, { "index": 295, "index_chain": 131, "chain_name": "J", "nt_resnum": 136, "nt_name": "DT", "nt_code": "T", "nt_id": "///J/136", "linked_nts": [ "///J/135", "///J/137" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,internal-loop", "alpha": -46.174, "beta": 177.826, "gamma": 35.519, "delta": 141.283, "epsilon": -129.485, "zeta": -162.234, "epsilon_zeta": 32.749, "bb_type": "--", "chi": -102.695, "glyco_bond": "anti", "C5prime_xyz": [ -2.506, 8.203, -2.024 ], "P_xyz": [ -0.389, 9.735, -1.942 ], "form": ".", "ssZp": 1.621, "Dp": 1.694, "splay_angle": 14.445, "splay_distance": 3.408, "splay_ratio": 0.194, "d22": 6.167, "d64": 4.232, "eta": -177.381, "theta": -178.680, "eta_prime": -154.822, "theta_prime": -173.605, "eta_base": -103.438, "theta_base": -132.067, "v0": -27.548, "v1": 39.736, "v2": -36.061, "v3": 21.146, "v4": 3.735, "amplitude": 39.535, "phase_angle": 155.802, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.002, "origin": [ 154.329, 187.212, 133.759 ], "x_axis": [ -0.218, 0.963, -0.160 ], "y_axis": [ 0.923, 0.149, -0.356 ], "z_axis": [ -0.319, -0.225, -0.921 ], "quaternion": [ -0.052, 0.623, 0.756, -0.192 ] } }, { "index": 296, "index_chain": 132, "chain_name": "J", "nt_resnum": 137, "nt_name": "DT", "nt_code": "T", "nt_id": "///J/137", "linked_nts": [ "///J/136", "///J/138" ], "nt_type": "DNA", "dbn": ".", "summary": "~C2'-endo,BI,non-pair-contact,internal-loop", "alpha": -70.838, "beta": 155.560, "gamma": 52.974, "delta": 149.357, "epsilon": -173.716, "zeta": -124.115, "epsilon_zeta": -49.601, "bb_type": "BI", "chi": -75.885, "glyco_bond": "--", "C5prime_xyz": [ -2.090, 7.001, -2.916 ], "P_xyz": [ 0.477, 6.693, -3.325 ], "form": ".", "ssZp": 1.121, "Dp": 1.838, "splay_angle": 28.742, "splay_distance": 4.832, "splay_ratio": 0.262, "d22": null, "d64": null, "eta": 161.776, "theta": -130.439, "eta_prime": -169.616, "theta_prime": -159.547, "eta_base": -131.253, "theta_base": -91.558, "v0": -4.368, "v1": 23.314, "v2": -32.277, "v3": 30.557, "v4": -16.769, "amplitude": 32.902, "phase_angle": 191.186, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "4b", "suiteness": 0.251, "filter_rmsd": 0.106, "frame": { "rmsd": 0.003, "origin": [ 155.740, 185.402, 131.240 ], "x_axis": [ 0.297, 0.806, -0.511 ], "y_axis": [ 0.684, -0.554, -0.475 ], "z_axis": [ -0.666, -0.208, -0.716 ], "quaternion": [ -0.083, 0.801, 0.465, -0.368 ] } }, { "index": 297, "index_chain": 133, "chain_name": "J", "nt_resnum": 138, "nt_name": "DG", "nt_code": "G", "nt_id": "///J/138", "linked_nts": [ "///J/137", "///J/139" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,BI,non-pair-contact,internal-loop", "alpha": -39.818, "beta": 144.173, "gamma": 58.862, "delta": 140.477, "epsilon": -158.498, "zeta": -94.948, "epsilon_zeta": -63.550, "bb_type": "BI", "chi": -95.971, "glyco_bond": "anti", "C5prime_xyz": [ -2.318, 7.952, -2.320 ], "P_xyz": [ 0.216, 7.891, -2.955 ], "form": ".", "ssZp": 1.870, "Dp": 2.126, "splay_angle": 25.490, "splay_distance": 4.319, "splay_ratio": 0.223, "d22": null, "d64": null, "eta": 171.921, "theta": -100.217, "eta_prime": -149.985, "theta_prime": -143.532, "eta_base": -85.605, "theta_base": -131.137, "v0": -20.076, "v1": 32.509, "v2": -31.870, "v3": 21.154, "v4": -0.901, "amplitude": 33.378, "phase_angle": 162.711, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.005, "frame": { "rmsd": 0.005, "origin": [ 156.460, 184.076, 126.649 ], "x_axis": [ 0.724, 0.089, -0.684 ], "y_axis": [ 0.124, -0.992, 0.001 ], "z_axis": [ -0.679, -0.085, -0.729 ], "quaternion": [ 0.023, 0.928, 0.057, -0.367 ] } }, { "index": 298, "index_chain": 134, "chain_name": "J", "nt_resnum": 139, "nt_name": "DG", "nt_code": "G", "nt_id": "///J/139", "linked_nts": [ "///J/138", "///J/140" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,internal-loop", "alpha": 173.117, "beta": 147.465, "gamma": 146.466, "delta": 149.037, "epsilon": -166.907, "zeta": -87.770, "epsilon_zeta": -79.137, "bb_type": "BI", "chi": -131.509, "glyco_bond": "anti", "C5prime_xyz": [ -1.329, 8.515, -0.421 ], "P_xyz": [ 0.528, 9.107, -2.159 ], "form": ".", "ssZp": 2.126, "Dp": 2.054, "splay_angle": 22.227, "splay_distance": 4.027, "splay_ratio": 0.199, "d22": null, "d64": null, "eta": 143.638, "theta": -148.786, "eta_prime": 173.178, "theta_prime": -160.100, "eta_base": -164.321, "theta_base": -124.402, "v0": -8.560, "v1": 26.270, "v2": -32.825, "v3": 28.767, "v4": -12.915, "amplitude": 32.901, "phase_angle": 183.880, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "22t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.005, "frame": { "rmsd": 0.005, "origin": [ 153.578, 182.906, 123.652 ], "x_axis": [ 0.988, -0.138, 0.067 ], "y_axis": [ -0.152, -0.934, 0.323 ], "z_axis": [ 0.018, -0.329, -0.944 ], "quaternion": [ 0.166, 0.983, -0.074, 0.021 ] } }, { "index": 299, "index_chain": 135, "chain_name": "J", "nt_resnum": 140, "nt_name": "DT", "nt_code": "T", "nt_id": "///J/140", "linked_nts": [ "///J/139", "///J/141" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": -54.127, "beta": 174.231, "gamma": 34.903, "delta": 127.516, "epsilon": -138.382, "zeta": -148.905, "epsilon_zeta": 10.523, "bb_type": "--", "chi": -127.924, "glyco_bond": "anti", "C5prime_xyz": [ -2.720, 8.716, -1.195 ], "P_xyz": [ -1.001, 10.563, -0.524 ], "form": ".", "ssZp": 2.115, "Dp": 2.099, "splay_angle": 20.616, "splay_distance": 3.459, "splay_ratio": 0.184, "d22": null, "d64": null, "eta": 170.441, "theta": 179.834, "eta_prime": -162.769, "theta_prime": -174.730, "eta_base": -120.353, "theta_base": -148.609, "v0": -38.150, "v1": 41.767, "v2": -29.330, "v3": 8.357, "v4": 18.386, "amplitude": 41.405, "phase_angle": 135.102, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.105, "frame": { "rmsd": 0.004, "origin": [ 154.346, 182.522, 119.717 ], "x_axis": [ 0.778, -0.582, 0.237 ], "y_axis": [ -0.627, -0.694, 0.353 ], "z_axis": [ -0.041, -0.423, -0.905 ], "quaternion": [ 0.211, 0.919, -0.329, 0.053 ] } }, { "index": 300, "index_chain": 136, "chain_name": "J", "nt_resnum": 141, "nt_name": "DA", "nt_code": "A", "nt_id": "///J/141", "linked_nts": [ "///J/140", "///J/142" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -63.747, "beta": 160.155, "gamma": 39.925, "delta": 141.975, "epsilon": -168.112, "zeta": -87.350, "epsilon_zeta": -80.763, "bb_type": "BI", "chi": -124.490, "glyco_bond": "anti", "C5prime_xyz": [ -1.495, 8.539, -0.979 ], "P_xyz": [ 0.966, 8.930, -0.168 ], "form": ".", "ssZp": 2.139, "Dp": 2.133, "splay_angle": 18.037, "splay_distance": 3.443, "splay_ratio": 0.168, "d22": null, "d64": null, "eta": 160.440, "theta": -111.523, "eta_prime": 178.204, "theta_prime": -135.559, "eta_base": -151.851, "theta_base": -113.030, "v0": -15.432, "v1": 29.313, "v2": -31.307, "v3": 23.165, "v4": -5.069, "amplitude": 31.763, "phase_angle": 170.276, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "4b", "suiteness": 0.010, "filter_rmsd": 0.039, "frame": { "rmsd": 0.007, "origin": [ 153.016, 182.781, 116.534 ], "x_axis": [ 0.338, -0.796, 0.502 ], "y_axis": [ -0.940, -0.262, 0.217 ], "z_axis": [ -0.042, -0.545, -0.837 ], "quaternion": [ 0.244, 0.781, -0.556, 0.147 ] } }, { "index": 301, "index_chain": 137, "chain_name": "J", "nt_resnum": 142, "nt_name": "DG", "nt_code": "G", "nt_id": "///J/142", "linked_nts": [ "///J/141", "///J/143" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,BI,canonical,non-pair-contact,helix,stem", "alpha": -54.553, "beta": 175.637, "gamma": 26.083, "delta": 103.888, "epsilon": -173.595, "zeta": -90.530, "epsilon_zeta": -83.065, "bb_type": "BI", "chi": -129.010, "glyco_bond": "anti", "C5prime_xyz": [ -2.666, 8.710, -1.471 ], "P_xyz": [ -1.053, 10.745, -1.213 ], "form": "B", "ssZp": 2.747, "Dp": 2.873, "splay_angle": 19.673, "splay_distance": 3.452, "splay_ratio": 0.172, "d22": null, "d64": null, "eta": 157.747, "theta": -161.620, "eta_prime": 177.325, "theta_prime": -159.474, "eta_base": -145.324, "theta_base": -117.387, "v0": -36.780, "v1": 25.423, "v2": -5.814, "v3": -15.024, "v4": 32.681, "amplitude": 36.182, "phase_angle": 99.247, "puckering": "O4'-endo", "sugar_class": "--", "bin": "23p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.006, "frame": { "rmsd": 0.006, "origin": [ 154.403, 181.084, 113.880 ], "x_axis": [ -0.113, -0.768, 0.630 ], "y_axis": [ -0.993, 0.113, -0.040 ], "z_axis": [ -0.040, -0.630, -0.775 ], "quaternion": [ -0.237, -0.622, 0.707, -0.237 ] } }, { "index": 302, "index_chain": 138, "chain_name": "J", "nt_resnum": 143, "nt_name": "DA", "nt_code": "A", "nt_id": "///J/143", "linked_nts": [ "///J/142", "///J/144" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -47.879, "beta": 162.683, "gamma": 50.328, "delta": 113.243, "epsilon": -159.453, "zeta": -114.518, "epsilon_zeta": -44.934, "bb_type": "BI", "chi": -133.390, "glyco_bond": "anti", "C5prime_xyz": [ -2.566, 8.765, -1.148 ], "P_xyz": [ -0.380, 10.186, -0.986 ], "form": "B", "ssZp": 2.596, "Dp": 2.615, "splay_angle": 21.392, "splay_distance": 3.600, "splay_ratio": 0.186, "d22": null, "d64": null, "eta": 177.040, "theta": -162.107, "eta_prime": -162.974, "theta_prime": -162.886, "eta_base": -116.322, "theta_base": -131.038, "v0": -37.158, "v1": 31.941, "v2": -15.486, "v3": -5.271, "v4": 26.594, "amplitude": 36.277, "phase_angle": 115.270, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.003, "origin": [ 154.418, 178.184, 112.007 ], "x_axis": [ -0.627, -0.528, 0.573 ], "y_axis": [ -0.776, 0.483, -0.405 ], "z_axis": [ -0.063, -0.699, -0.712 ], "quaternion": [ -0.189, -0.388, 0.840, -0.329 ] } }, { "index": 303, "index_chain": 139, "chain_name": "J", "nt_resnum": 144, "nt_name": "DA", "nt_code": "A", "nt_id": "///J/144", "linked_nts": [ "///J/143", "///J/145" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -53.887, "beta": 162.391, "gamma": 51.494, "delta": 132.392, "epsilon": -168.416, "zeta": -104.279, "epsilon_zeta": -64.137, "bb_type": "BI", "chi": -120.474, "glyco_bond": "anti", "C5prime_xyz": [ -2.189, 8.584, -1.406 ], "P_xyz": [ 0.238, 9.529, -1.221 ], "form": "B", "ssZp": 2.281, "Dp": 2.301, "splay_angle": 21.004, "splay_distance": 3.630, "splay_ratio": 0.185, "d22": null, "d64": null, "eta": 168.590, "theta": -137.844, "eta_prime": -167.056, "theta_prime": -152.072, "eta_base": -130.746, "theta_base": -119.700, "v0": -28.180, "v1": 35.556, "v2": -29.234, "v3": 13.803, "v4": 8.797, "amplitude": 34.911, "phase_angle": 146.865, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.037, "frame": { "rmsd": 0.003, "origin": [ 154.828, 175.724, 109.411 ], "x_axis": [ -0.942, -0.182, 0.281 ], "y_axis": [ -0.328, 0.669, -0.667 ], "z_axis": [ -0.067, -0.721, -0.690 ], "quaternion": [ -0.096, -0.140, 0.908, -0.382 ] } }, { "index": 304, "index_chain": 140, "chain_name": "J", "nt_resnum": 145, "nt_name": "DT", "nt_code": "T", "nt_id": "///J/145", "linked_nts": [ "///J/144", "///J/146" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -52.728, "beta": 175.907, "gamma": 40.415, "delta": 132.253, "epsilon": -160.602, "zeta": -124.600, "epsilon_zeta": -36.002, "bb_type": "BI", "chi": -112.626, "glyco_bond": "anti", "C5prime_xyz": [ -2.497, 8.432, -1.778 ], "P_xyz": [ -0.401, 9.986, -1.623 ], "form": "B", "ssZp": 2.227, "Dp": 2.254, "splay_angle": 22.575, "splay_distance": 3.764, "splay_ratio": 0.196, "d22": 4.725, "d64": 3.995, "eta": 171.842, "theta": -157.104, "eta_prime": -167.192, "theta_prime": -160.662, "eta_base": -127.551, "theta_base": -115.603, "v0": -31.257, "v1": 38.199, "v2": -30.392, "v3": 13.278, "v4": 11.014, "amplitude": 37.421, "phase_angle": 144.309, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.002, "origin": [ 154.490, 172.627, 107.548 ], "x_axis": [ -0.971, 0.214, -0.111 ], "y_axis": [ 0.225, 0.636, -0.738 ], "z_axis": [ -0.088, -0.742, -0.665 ], "quaternion": [ 0.006, 0.121, 0.904, -0.409 ] } }, { "index": 305, "index_chain": 141, "chain_name": "J", "nt_resnum": 146, "nt_name": "DC", "nt_code": "C", "nt_id": "///J/146", "linked_nts": [ "///J/145", "///J/147" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -49.798, "beta": 159.154, "gamma": 50.728, "delta": 135.984, "epsilon": -158.520, "zeta": -120.681, "epsilon_zeta": -37.839, "bb_type": "BI", "chi": -112.266, "glyco_bond": "anti", "C5prime_xyz": [ -2.222, 8.483, -1.733 ], "P_xyz": [ 0.262, 9.303, -1.762 ], "form": "B", "ssZp": 2.101, "Dp": 2.151, "splay_angle": 23.729, "splay_distance": 4.012, "splay_ratio": 0.206, "d22": 4.887, "d64": 4.285, "eta": 173.823, "theta": -142.135, "eta_prime": -162.290, "theta_prime": -154.414, "eta_base": -114.870, "theta_base": -120.400, "v0": -27.462, "v1": 36.876, "v2": -31.883, "v3": 16.990, "v4": 6.302, "amplitude": 36.337, "phase_angle": 151.332, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.062, "frame": { "rmsd": 0.003, "origin": [ 153.902, 170.189, 104.741 ], "x_axis": [ -0.614, 0.570, -0.545 ], "y_axis": [ 0.781, 0.340, -0.524 ], "z_axis": [ -0.114, -0.748, -0.654 ], "quaternion": [ 0.134, 0.418, 0.808, -0.394 ] } }, { "index": 306, "index_chain": 142, "chain_name": "J", "nt_resnum": 147, "nt_name": "DT", "nt_code": "T", "nt_id": "///J/147", "linked_nts": [ "///J/146", "///J/148" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem", "alpha": -45.223, "beta": 166.908, "gamma": 38.247, "delta": 138.063, "epsilon": -123.946, "zeta": -173.978, "epsilon_zeta": 50.031, "bb_type": "BII", "chi": -102.577, "glyco_bond": "anti", "C5prime_xyz": [ -2.509, 8.180, -2.077 ], "P_xyz": [ -0.216, 9.433, -2.184 ], "form": ".", "ssZp": 1.495, "Dp": 1.656, "splay_angle": 29.044, "splay_distance": 5.060, "splay_ratio": 0.278, "d22": null, "d64": null, "eta": -173.811, "theta": 179.464, "eta_prime": -156.872, "theta_prime": -178.178, "eta_base": -121.476, "theta_base": -120.063, "v0": -27.465, "v1": 37.991, "v2": -33.501, "v3": 18.582, "v4": 5.309, "amplitude": 37.547, "phase_angle": 153.156, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.002, "origin": [ 153.534, 167.259, 102.025 ], "x_axis": [ -0.092, 0.666, -0.741 ], "y_axis": [ 0.985, -0.046, -0.163 ], "z_axis": [ -0.143, -0.745, -0.652 ], "quaternion": [ 0.229, 0.634, 0.652, -0.349 ] } }, { "index": 307, "index_chain": 143, "chain_name": "J", "nt_resnum": 148, "nt_name": "DG", "nt_code": "G", "nt_id": "///J/148", "linked_nts": [ "///J/147", "///J/149" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -60.099, "beta": 128.830, "gamma": 61.588, "delta": 145.924, "epsilon": -170.401, "zeta": -109.057, "epsilon_zeta": -61.343, "bb_type": "BI", "chi": -110.656, "glyco_bond": "anti", "C5prime_xyz": [ -1.785, 8.339, -1.605 ], "P_xyz": [ 0.764, 7.757, -1.786 ], "form": "B", "ssZp": 2.046, "Dp": 2.063, "splay_angle": 24.315, "splay_distance": 4.063, "splay_ratio": 0.211, "d22": null, "d64": null, "eta": 158.233, "theta": -112.927, "eta_prime": -158.527, "theta_prime": -153.528, "eta_base": -105.154, "theta_base": -114.930, "v0": -15.615, "v1": 31.369, "v2": -34.281, "v3": 26.178, "v4": -6.859, "amplitude": 34.579, "phase_angle": 172.470, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "4b", "suiteness": 0.151, "filter_rmsd": 0.005, "frame": { "rmsd": 0.005, "origin": [ 155.375, 163.154, 99.710 ], "x_axis": [ 0.592, 0.309, -0.745 ], "y_axis": [ 0.797, -0.366, 0.481 ], "z_axis": [ -0.123, -0.878, -0.463 ], "quaternion": [ 0.437, 0.778, 0.355, -0.279 ] } }, { "index": 308, "index_chain": 144, "chain_name": "J", "nt_resnum": 149, "nt_name": "DC", "nt_code": "C", "nt_id": "///J/149", "linked_nts": [ "///J/148", "///J/150" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem", "alpha": -61.599, "beta": 173.583, "gamma": 52.329, "delta": 140.864, "epsilon": -163.665, "zeta": -124.846, "epsilon_zeta": -38.819, "bb_type": "BI", "chi": -117.329, "glyco_bond": "anti", "C5prime_xyz": [ -2.113, 8.607, -1.426 ], "P_xyz": [ 0.286, 9.598, -1.086 ], "form": "B", "ssZp": 2.204, "Dp": 2.188, "splay_angle": 19.856, "splay_distance": 3.254, "splay_ratio": 0.174, "d22": null, "d64": null, "eta": 167.438, "theta": -150.693, "eta_prime": -165.103, "theta_prime": -162.138, "eta_base": -116.398, "theta_base": -116.609, "v0": -26.478, "v1": 38.600, "v2": -35.326, "v3": 21.010, "v4": 3.173, "amplitude": 38.517, "phase_angle": 156.515, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.005, "origin": [ 155.272, 159.647, 97.660 ], "x_axis": [ 0.961, 0.092, -0.260 ], "y_axis": [ 0.275, -0.395, 0.877 ], "z_axis": [ -0.022, -0.914, -0.405 ], "quaternion": [ 0.539, 0.831, 0.110, -0.085 ] } }, { "index": 309, "index_chain": 145, "chain_name": "J", "nt_resnum": 150, "nt_name": "DA", "nt_code": "A", "nt_id": "///J/150", "linked_nts": [ "///J/149", "///J/151" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -65.913, "beta": 166.341, "gamma": 56.364, "delta": 139.632, "epsilon": -166.827, "zeta": -106.037, "epsilon_zeta": -60.790, "bb_type": "BI", "chi": -122.631, "glyco_bond": "anti", "C5prime_xyz": [ -1.734, 8.562, -1.131 ], "P_xyz": [ 0.815, 9.034, -0.751 ], "form": "B", "ssZp": 2.218, "Dp": 2.201, "splay_angle": 19.552, "splay_distance": 3.342, "splay_ratio": 0.171, "d22": null, "d64": null, "eta": 164.590, "theta": -131.426, "eta_prime": -170.744, "theta_prime": -150.722, "eta_base": -118.142, "theta_base": -118.681, "v0": -19.495, "v1": 31.671, "v2": -31.176, "v3": 20.686, "v4": -0.944, "amplitude": 32.620, "phase_angle": 162.890, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.039, "frame": { "rmsd": 0.005, "origin": [ 155.069, 156.587, 96.574 ], "x_axis": [ 0.912, -0.143, 0.385 ], "y_axis": [ -0.411, -0.335, 0.848 ], "z_axis": [ 0.008, -0.931, -0.364 ], "quaternion": [ 0.551, 0.808, -0.171, 0.122 ] } }, { "index": 310, "index_chain": 146, "chain_name": "J", "nt_resnum": 151, "nt_name": "DG", "nt_code": "G", "nt_id": "///J/151", "linked_nts": [ "///J/150", "///J/152" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -63.482, "beta": 168.712, "gamma": 51.863, "delta": 130.725, "epsilon": -161.437, "zeta": -119.723, "epsilon_zeta": -41.714, "bb_type": "BI", "chi": -126.811, "glyco_bond": "anti", "C5prime_xyz": [ -2.320, 8.753, -1.145 ], "P_xyz": [ -0.033, 9.943, -0.737 ], "form": "B", "ssZp": 2.327, "Dp": 2.320, "splay_angle": 20.048, "splay_distance": 3.346, "splay_ratio": 0.174, "d22": null, "d64": null, "eta": 165.570, "theta": -153.798, "eta_prime": -170.137, "theta_prime": -161.436, "eta_base": -127.234, "theta_base": -129.430, "v0": -31.771, "v1": 37.702, "v2": -29.136, "v3": 11.682, "v4": 12.374, "amplitude": 36.996, "phase_angle": 141.959, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.006, "frame": { "rmsd": 0.006, "origin": [ 155.386, 153.780, 94.787 ], "x_axis": [ 0.552, -0.251, 0.795 ], "y_axis": [ -0.834, -0.177, 0.522 ], "z_axis": [ 0.010, -0.952, -0.307 ], "quaternion": [ 0.516, 0.713, -0.380, 0.282 ] } }, { "index": 311, "index_chain": 147, "chain_name": "J", "nt_resnum": 152, "nt_name": "DG", "nt_code": "G", "nt_id": "///J/152", "linked_nts": [ "///J/151", "///J/153" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -58.733, "beta": 171.609, "gamma": 44.415, "delta": 137.306, "epsilon": -163.946, "zeta": -101.237, "epsilon_zeta": -62.709, "bb_type": "BI", "chi": -121.999, "glyco_bond": "anti", "C5prime_xyz": [ -1.908, 8.648, -1.215 ], "P_xyz": [ 0.432, 9.614, -0.573 ], "form": "B", "ssZp": 2.168, "Dp": 2.187, "splay_angle": 20.277, "splay_distance": 3.521, "splay_ratio": 0.178, "d22": null, "d64": null, "eta": 167.200, "theta": -131.111, "eta_prime": -173.148, "theta_prime": -143.154, "eta_base": -134.382, "theta_base": -111.802, "v0": -22.946, "v1": 33.587, "v2": -31.005, "v3": 18.561, "v4": 2.556, "amplitude": 33.686, "phase_angle": 156.988, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.007, "frame": { "rmsd": 0.007, "origin": [ 155.735, 150.981, 92.988 ], "x_axis": [ -0.003, -0.218, 0.976 ], "y_axis": [ -1.000, 0.020, 0.002 ], "z_axis": [ -0.020, -0.976, -0.218 ], "quaternion": [ -0.447, -0.547, 0.557, -0.437 ] } }, { "index": 312, "index_chain": 148, "chain_name": "J", "nt_resnum": 153, "nt_name": "DT", "nt_code": "T", "nt_id": "///J/153", "linked_nts": [ "///J/152", "///J/154" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": -55.193, "beta": 176.299, "gamma": 35.786, "delta": 134.986, "epsilon": -157.366, "zeta": -128.369, "epsilon_zeta": -28.998, "bb_type": "--", "chi": -109.974, "glyco_bond": "anti", "C5prime_xyz": [ -2.499, 8.384, -1.846 ], "P_xyz": [ -0.459, 10.004, -1.669 ], "form": "B", "ssZp": 2.154, "Dp": 2.185, "splay_angle": 17.753, "splay_distance": 3.009, "splay_ratio": 0.154, "d22": null, "d64": null, "eta": 166.045, "theta": -157.547, "eta_prime": -169.985, "theta_prime": -165.173, "eta_base": -130.054, "theta_base": -121.157, "v0": -30.767, "v1": 39.322, "v2": -32.578, "v3": 15.772, "v4": 9.152, "amplitude": 38.556, "phase_angle": 147.665, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.105, "frame": { "rmsd": 0.002, "origin": [ 156.228, 147.521, 92.561 ], "x_axis": [ -0.525, -0.099, 0.845 ], "y_axis": [ -0.850, 0.098, -0.517 ], "z_axis": [ -0.032, -0.990, -0.136 ], "quaternion": [ -0.330, -0.358, 0.663, -0.568 ] } }, { "index": 313, "index_chain": 149, "chain_name": "J", "nt_resnum": 154, "nt_name": "DG", "nt_code": "G", "nt_id": "///J/154", "linked_nts": [ "///J/153", "///J/155" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -53.611, "beta": 147.069, "gamma": 54.265, "delta": 119.356, "epsilon": -165.244, "zeta": -101.790, "epsilon_zeta": -63.453, "bb_type": "BI", "chi": -130.252, "glyco_bond": "anti", "C5prime_xyz": [ -2.401, 8.791, -1.190 ], "P_xyz": [ 0.055, 9.678, -1.216 ], "form": "B", "ssZp": 2.503, "Dp": 2.521, "splay_angle": 20.189, "splay_distance": 3.491, "splay_ratio": 0.176, "d22": null, "d64": null, "eta": 167.482, "theta": -143.437, "eta_prime": -172.633, "theta_prime": -154.563, "eta_base": -122.985, "theta_base": -125.371, "v0": -34.136, "v1": 33.003, "v2": -19.885, "v3": 0.917, "v4": 20.733, "amplitude": 34.550, "phase_angle": 125.139, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.005, "frame": { "rmsd": 0.005, "origin": [ 156.085, 144.519, 92.401 ], "x_axis": [ -0.914, 0.031, 0.404 ], "y_axis": [ -0.399, 0.099, -0.911 ], "z_axis": [ -0.068, -0.995, -0.079 ], "quaternion": [ -0.163, -0.127, 0.723, -0.659 ] } }, { "index": 314, "index_chain": 150, "chain_name": "J", "nt_resnum": 155, "nt_name": "DG", "nt_code": "G", "nt_id": "///J/155", "linked_nts": [ "///J/154", "///J/156" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -54.256, "beta": 173.769, "gamma": 42.964, "delta": 130.490, "epsilon": -151.269, "zeta": -120.416, "epsilon_zeta": -30.854, "bb_type": "BI", "chi": -113.532, "glyco_bond": "anti", "C5prime_xyz": [ -2.495, 8.469, -1.761 ], "P_xyz": [ -0.341, 9.949, -1.681 ], "form": "B", "ssZp": 2.143, "Dp": 2.202, "splay_angle": 20.886, "splay_distance": 3.588, "splay_ratio": 0.181, "d22": null, "d64": null, "eta": 174.267, "theta": -149.158, "eta_prime": -166.106, "theta_prime": -158.092, "eta_base": -130.768, "theta_base": -115.314, "v0": -30.919, "v1": 36.906, "v2": -28.741, "v3": 11.784, "v4": 11.772, "amplitude": 36.215, "phase_angle": 142.525, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.004, "frame": { "rmsd": 0.004, "origin": [ 156.039, 141.060, 92.870 ], "x_axis": [ -0.988, 0.095, -0.122 ], "y_axis": [ 0.122, -0.007, -0.993 ], "z_axis": [ -0.095, -0.995, -0.004 ], "quaternion": [ -0.009, -0.077, -0.704, 0.706 ] } }, { "index": 315, "index_chain": 151, "chain_name": "J", "nt_resnum": 156, "nt_name": "DA", "nt_code": "A", "nt_id": "///J/156", "linked_nts": [ "///J/155", "///J/157" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,BI,canonical,non-pair-contact,helix,stem", "alpha": -55.257, "beta": 148.121, "gamma": 52.333, "delta": 97.380, "epsilon": -174.882, "zeta": -87.958, "epsilon_zeta": -86.925, "bb_type": "BI", "chi": -130.546, "glyco_bond": "anti", "C5prime_xyz": [ -2.567, 8.693, -1.395 ], "P_xyz": [ -0.213, 9.672, -1.982 ], "form": "B", "ssZp": 2.964, "Dp": 3.195, "splay_angle": 22.971, "splay_distance": 3.989, "splay_ratio": 0.200, "d22": null, "d64": null, "eta": 166.187, "theta": -155.706, "eta_prime": -177.360, "theta_prime": -162.278, "eta_base": -127.518, "theta_base": -132.175, "v0": -31.953, "v1": 16.240, "v2": 4.012, "v3": -22.398, "v4": 34.395, "amplitude": 34.347, "phase_angle": 83.292, "puckering": "O4'-endo", "sugar_class": "--", "bin": "23p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.037, "frame": { "rmsd": 0.003, "origin": [ 155.256, 137.571, 92.576 ], "x_axis": [ -0.738, 0.053, -0.673 ], "y_axis": [ 0.665, -0.120, -0.738 ], "z_axis": [ -0.120, -0.991, 0.053 ], "quaternion": [ -0.221, -0.287, -0.625, 0.691 ] } }, { "index": 316, "index_chain": 152, "chain_name": "J", "nt_resnum": 157, "nt_name": "DT", "nt_code": "T", "nt_id": "///J/157", "linked_nts": [ "///J/156", "///J/158" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,BI,canonical,non-pair-contact,helix,stem", "alpha": -50.880, "beta": 162.167, "gamma": 62.701, "delta": 107.904, "epsilon": -175.856, "zeta": -96.328, "epsilon_zeta": -79.528, "bb_type": "BI", "chi": -138.819, "glyco_bond": "anti", "C5prime_xyz": [ -2.482, 8.862, -0.943 ], "P_xyz": [ -0.169, 10.087, -1.019 ], "form": "B", "ssZp": 2.802, "Dp": 2.802, "splay_angle": 24.025, "splay_distance": 3.938, "splay_ratio": 0.208, "d22": null, "d64": null, "eta": -178.983, "theta": -147.852, "eta_prime": -157.911, "theta_prime": -157.379, "eta_base": -120.852, "theta_base": -119.292, "v0": -35.990, "v1": 27.309, "v2": -9.426, "v3": -10.816, "v4": 29.424, "amplitude": 34.937, "phase_angle": 105.652, "puckering": "O4'-endo", "sugar_class": "--", "bin": "33p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.002, "origin": [ 154.040, 133.778, 92.791 ], "x_axis": [ -0.330, -0.019, -0.944 ], "y_axis": [ 0.936, -0.137, -0.324 ], "z_axis": [ -0.124, -0.990, 0.063 ], "quaternion": [ -0.386, -0.432, -0.531, 0.618 ] } }, { "index": 317, "index_chain": 153, "chain_name": "J", "nt_resnum": 158, "nt_name": "DA", "nt_code": "A", "nt_id": "///J/158", "linked_nts": [ "///J/157", "///J/159" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -174.936, "beta": 169.178, "gamma": 157.279, "delta": 150.402, "epsilon": -165.025, "zeta": -77.612, "epsilon_zeta": -87.413, "bb_type": "BI", "chi": -142.744, "glyco_bond": "anti", "C5prime_xyz": [ -1.229, 8.437, 0.209 ], "P_xyz": [ 0.989, 9.236, -0.930 ], "form": ".", "ssZp": 2.060, "Dp": 2.036, "splay_angle": 22.364, "splay_distance": 4.118, "splay_ratio": 0.204, "d22": null, "d64": null, "eta": 171.574, "theta": -129.632, "eta_prime": -163.244, "theta_prime": -147.704, "eta_base": -119.623, "theta_base": -112.720, "v0": -7.809, "v1": 26.260, "v2": -33.512, "v3": 29.869, "v4": -14.074, "amplitude": 33.665, "phase_angle": 185.468, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "32t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.004, "origin": [ 153.465, 129.883, 92.884 ], "x_axis": [ 0.379, 0.050, -0.924 ], "y_axis": [ 0.923, -0.085, 0.374 ], "z_axis": [ -0.060, -0.995, -0.079 ], "quaternion": [ 0.551, 0.621, 0.392, -0.396 ] } }, { "index": 318, "index_chain": 154, "chain_name": "J", "nt_resnum": 159, "nt_name": "DT", "nt_code": "T", "nt_id": "///J/159", "linked_nts": [ "///J/158", "///J/160" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem", "alpha": -63.512, "beta": 177.623, "gamma": 35.855, "delta": 111.084, "epsilon": -176.696, "zeta": -92.230, "epsilon_zeta": -84.467, "bb_type": "BI", "chi": -134.867, "glyco_bond": "anti", "C5prime_xyz": [ -2.574, 8.814, -1.125 ], "P_xyz": [ -0.856, 10.697, -0.514 ], "form": "B", "ssZp": 2.662, "Dp": 2.684, "splay_angle": 20.707, "splay_distance": 3.571, "splay_ratio": 0.182, "d22": 4.405, "d64": 4.170, "eta": 155.642, "theta": -160.269, "eta_prime": -173.123, "theta_prime": -158.074, "eta_base": -124.777, "theta_base": -123.836, "v0": -37.538, "v1": 31.204, "v2": -13.987, "v3": -7.032, "v4": 27.920, "amplitude": 36.480, "phase_angle": 112.545, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.002, "origin": [ 152.378, 126.167, 91.481 ], "x_axis": [ 0.822, -0.030, -0.569 ], "y_axis": [ 0.570, 0.021, 0.821 ], "z_axis": [ -0.012, -0.999, 0.034 ], "quaternion": [ 0.685, 0.664, 0.203, -0.219 ] } }, { "index": 319, "index_chain": 155, "chain_name": "J", "nt_resnum": 160, "nt_name": "DT", "nt_code": "T", "nt_id": "///J/160", "linked_nts": [ "///J/159", "///J/161" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": -54.047, "beta": -176.433, "gamma": 40.820, "delta": 140.499, "epsilon": -160.606, "zeta": -130.464, "epsilon_zeta": -30.142, "bb_type": "--", "chi": -114.980, "glyco_bond": "anti", "C5prime_xyz": [ -2.351, 8.521, -1.520 ], "P_xyz": [ -0.294, 10.047, -0.976 ], "form": "B", "ssZp": 2.229, "Dp": 2.205, "splay_angle": 19.731, "splay_distance": 3.217, "splay_ratio": 0.174, "d22": null, "d64": null, "eta": 172.179, "theta": -160.212, "eta_prime": -165.013, "theta_prime": -163.993, "eta_base": -126.218, "theta_base": -111.407, "v0": -29.060, "v1": 40.773, "v2": -36.209, "v3": 20.392, "v4": 5.176, "amplitude": 40.324, "phase_angle": 153.890, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.105, "frame": { "rmsd": 0.004, "origin": [ 152.042, 122.706, 90.666 ], "x_axis": [ 0.999, 0.022, -0.046 ], "y_axis": [ 0.046, 0.015, 0.999 ], "z_axis": [ 0.023, -1.000, 0.014 ], "quaternion": [ 0.712, 0.702, 0.024, -0.008 ] } }, { "index": 320, "index_chain": 156, "chain_name": "J", "nt_resnum": 161, "nt_name": "DG", "nt_code": "G", "nt_id": "///J/161", "linked_nts": [ "///J/160", "///J/162" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -67.869, "beta": 162.529, "gamma": 58.718, "delta": 144.186, "epsilon": -170.078, "zeta": -112.016, "epsilon_zeta": -58.062, "bb_type": "BI", "chi": -121.268, "glyco_bond": "anti", "C5prime_xyz": [ -1.665, 8.576, -1.128 ], "P_xyz": [ 0.929, 8.828, -0.833 ], "form": "B", "ssZp": 2.205, "Dp": 2.165, "splay_angle": 20.876, "splay_distance": 3.412, "splay_ratio": 0.182, "d22": null, "d64": null, "eta": 159.959, "theta": -133.375, "eta_prime": -171.479, "theta_prime": -154.567, "eta_base": -113.010, "theta_base": -117.136, "v0": -18.027, "v1": 32.672, "v2": -33.998, "v3": 24.404, "v4": -4.186, "amplitude": 34.748, "phase_angle": 168.069, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.010, "frame": { "rmsd": 0.010, "origin": [ 152.129, 119.535, 91.205 ], "x_axis": [ 0.751, 0.086, 0.655 ], "y_axis": [ -0.658, 0.002, 0.753 ], "z_axis": [ 0.063, -0.996, 0.058 ], "quaternion": [ 0.673, 0.650, -0.220, 0.276 ] } }, { "index": 321, "index_chain": 157, "chain_name": "J", "nt_resnum": 162, "nt_name": "DA", "nt_code": "A", "nt_id": "///J/162", "linked_nts": [ "///J/161", "///J/163" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -64.359, "beta": -177.563, "gamma": 46.185, "delta": 140.970, "epsilon": -156.470, "zeta": -117.689, "epsilon_zeta": -38.781, "bb_type": "BI", "chi": -121.154, "glyco_bond": "anti", "C5prime_xyz": [ -1.503, 8.475, -1.150 ], "P_xyz": [ 0.881, 9.189, -0.325 ], "form": ".", "ssZp": 2.075, "Dp": 2.122, "splay_angle": 27.163, "splay_distance": 4.711, "splay_ratio": 0.235, "d22": null, "d64": null, "eta": 170.367, "theta": -142.949, "eta_prime": -169.940, "theta_prime": -153.711, "eta_base": -123.357, "theta_base": -151.423, "v0": -14.097, "v1": 27.641, "v2": -29.933, "v3": 22.515, "v4": -5.482, "amplitude": 30.265, "phase_angle": 171.517, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.039, "frame": { "rmsd": 0.005, "origin": [ 152.162, 116.124, 91.140 ], "x_axis": [ 0.178, 0.196, 0.964 ], "y_axis": [ -0.984, 0.031, 0.175 ], "z_axis": [ 0.005, -0.980, 0.198 ], "quaternion": [ 0.593, 0.487, -0.405, 0.498 ] } }, { "index": 322, "index_chain": 158, "chain_name": "J", "nt_resnum": 163, "nt_name": "DT", "nt_code": "T", "nt_id": "///J/163", "linked_nts": [ "///J/162", "///J/164" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -62.691, "beta": 172.400, "gamma": 43.044, "delta": 133.334, "epsilon": 160.761, "zeta": -84.131, "epsilon_zeta": -115.108, "bb_type": "BI", "chi": -116.722, "glyco_bond": "anti", "C5prime_xyz": [ -2.540, 8.537, -1.579 ], "P_xyz": [ -0.436, 10.058, -1.291 ], "form": ".", "ssZp": 2.306, "Dp": 2.416, "splay_angle": 26.021, "splay_distance": 4.716, "splay_ratio": 0.243, "d22": null, "d64": null, "eta": 153.038, "theta": -115.693, "eta_prime": 179.419, "theta_prime": -140.550, "eta_base": -168.165, "theta_base": -74.518, "v0": -32.767, "v1": 40.715, "v2": -32.816, "v3": 14.884, "v4": 10.882, "amplitude": 39.832, "phase_angle": 145.475, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.105, "frame": { "rmsd": 0.002, "origin": [ 153.293, 112.146, 88.883 ], "x_axis": [ -0.022, 0.249, 0.968 ], "y_axis": [ -1.000, 0.002, -0.023 ], "z_axis": [ -0.008, -0.968, 0.249 ], "quaternion": [ 0.554, 0.426, -0.440, 0.563 ] } }, { "index": 323, "index_chain": 159, "chain_name": "J", "nt_resnum": 164, "nt_name": "DG", "nt_code": "G", "nt_id": "///J/164", "linked_nts": [ "///J/163", "///J/165" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": 161.459, "beta": -175.951, "gamma": -177.763, "delta": 136.058, "epsilon": -148.942, "zeta": -97.832, "epsilon_zeta": -51.110, "bb_type": "BI", "chi": -147.245, "glyco_bond": "anti", "C5prime_xyz": [ -2.085, 8.892, 0.018 ], "P_xyz": [ -0.477, 10.530, -1.249 ], "form": ".", "ssZp": 1.872, "Dp": 2.071, "splay_angle": 19.132, "splay_distance": 3.353, "splay_ratio": 0.170, "d22": null, "d64": null, "eta": -163.497, "theta": -169.695, "eta_prime": -150.266, "theta_prime": -161.589, "eta_base": -75.128, "theta_base": -133.846, "v0": -28.668, "v1": 37.826, "v2": -32.222, "v3": 16.616, "v4": 7.290, "amplitude": 37.193, "phase_angle": 150.038, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.004, "frame": { "rmsd": 0.004, "origin": [ 152.365, 110.149, 93.053 ], "x_axis": [ -0.820, 0.206, 0.533 ], "y_axis": [ -0.571, -0.250, -0.782 ], "z_axis": [ -0.028, -0.946, 0.323 ], "quaternion": [ 0.251, 0.163, -0.559, 0.773 ] } }, { "index": 324, "index_chain": 160, "chain_name": "J", "nt_resnum": 165, "nt_name": "DG", "nt_code": "G", "nt_id": "///J/165", "linked_nts": [ "///J/164", "///J/166" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": -62.088, "beta": -177.585, "gamma": 24.277, "delta": 142.597, "epsilon": -151.262, "zeta": -137.696, "epsilon_zeta": -13.567, "bb_type": "--", "chi": -103.168, "glyco_bond": "anti", "C5prime_xyz": [ -2.397, 8.227, -2.023 ], "P_xyz": [ -0.547, 10.057, -1.747 ], "form": "B", "ssZp": 1.842, "Dp": 1.930, "splay_angle": 18.214, "splay_distance": 3.076, "splay_ratio": 0.159, "d22": null, "d64": null, "eta": 155.224, "theta": -161.878, "eta_prime": -176.990, "theta_prime": -165.648, "eta_base": -144.357, "theta_base": -127.804, "v0": -25.546, "v1": 38.595, "v2": -36.322, "v3": 22.589, "v4": 1.569, "amplitude": 38.931, "phase_angle": 158.906, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.003, "frame": { "rmsd": 0.003, "origin": [ 153.361, 107.523, 94.886 ], "x_axis": [ -0.997, 0.071, 0.039 ], "y_axis": [ -0.062, -0.372, -0.926 ], "z_axis": [ -0.051, -0.925, 0.375 ], "quaternion": [ 0.040, -0.004, -0.559, 0.828 ] } }, { "index": 325, "index_chain": 161, "chain_name": "J", "nt_resnum": 166, "nt_name": "DC", "nt_code": "C", "nt_id": "///J/166", "linked_nts": [ "///J/165", "///J/167" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -54.619, "beta": 152.046, "gamma": 46.523, "delta": 131.062, "epsilon": -178.992, "zeta": -90.498, "epsilon_zeta": -88.495, "bb_type": "BI", "chi": -110.426, "glyco_bond": "anti", "C5prime_xyz": [ -2.400, 8.440, -1.873 ], "P_xyz": [ 0.074, 9.262, -2.100 ], "form": ".", "ssZp": 2.408, "Dp": 2.413, "splay_angle": 21.608, "splay_distance": 3.717, "splay_ratio": 0.190, "d22": null, "d64": null, "eta": 159.122, "theta": -116.672, "eta_prime": -176.935, "theta_prime": -147.729, "eta_base": -134.305, "theta_base": -119.629, "v0": -30.074, "v1": 36.497, "v2": -28.863, "v3": 12.374, "v4": 10.887, "amplitude": 35.781, "phase_angle": 143.771, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.062, "frame": { "rmsd": 0.003, "origin": [ 153.563, 104.655, 95.980 ], "x_axis": [ -0.869, -0.142, -0.475 ], "y_axis": [ 0.485, -0.437, -0.757 ], "z_axis": [ -0.100, -0.888, 0.448 ], "quaternion": [ -0.189, -0.173, -0.496, 0.830 ] } }, { "index": 326, "index_chain": 162, "chain_name": "J", "nt_resnum": 167, "nt_name": "DG", "nt_code": "G", "nt_id": "///J/167", "linked_nts": [ "///J/166", "///J/168" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": 168.486, "beta": 152.760, "gamma": 166.161, "delta": 148.491, "epsilon": -158.661, "zeta": -84.903, "epsilon_zeta": -73.758, "bb_type": "BI", "chi": -145.146, "glyco_bond": "anti", "C5prime_xyz": [ -1.422, 8.609, 0.303 ], "P_xyz": [ 0.407, 10.037, -0.908 ], "form": "B", "ssZp": 1.804, "Dp": 1.923, "splay_angle": 21.281, "splay_distance": 3.633, "splay_ratio": 0.186, "d22": null, "d64": null, "eta": 173.694, "theta": -140.683, "eta_prime": -175.637, "theta_prime": -150.872, "eta_base": -138.015, "theta_base": -123.784, "v0": -12.565, "v1": 29.849, "v2": -34.806, "v3": 28.458, "v4": -10.219, "amplitude": 34.828, "phase_angle": 178.002, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.005, "frame": { "rmsd": 0.005, "origin": [ 152.254, 101.496, 97.438 ], "x_axis": [ -0.310, 0.216, -0.926 ], "y_axis": [ 0.896, -0.259, -0.361 ], "z_axis": [ -0.318, -0.941, -0.113 ], "quaternion": [ -0.282, -0.515, -0.539, 0.603 ] } }, { "index": 327, "index_chain": 163, "chain_name": "J", "nt_resnum": 168, "nt_name": "DG", "nt_code": "G", "nt_id": "///J/168", "linked_nts": [ "///J/167", "///J/169" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": 169.925, "beta": 164.656, "gamma": 153.228, "delta": 144.699, "epsilon": -157.793, "zeta": -125.657, "epsilon_zeta": -32.135, "bb_type": "BI", "chi": -130.908, "glyco_bond": "anti", "C5prime_xyz": [ -1.922, 8.740, -0.633 ], "P_xyz": [ -0.114, 9.741, -2.239 ], "form": ".", "ssZp": 2.018, "Dp": 2.069, "splay_angle": 24.304, "splay_distance": 4.434, "splay_ratio": 0.220, "d22": null, "d64": null, "eta": 152.632, "theta": -144.372, "eta_prime": -172.045, "theta_prime": -158.022, "eta_base": -138.695, "theta_base": -126.488, "v0": -23.311, "v1": 37.554, "v2": -36.628, "v3": 24.164, "v4": -0.792, "amplitude": 38.442, "phase_angle": 162.331, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.004, "frame": { "rmsd": 0.004, "origin": [ 150.420, 98.378, 97.777 ], "x_axis": [ 0.245, 0.070, -0.967 ], "y_axis": [ 0.900, -0.388, 0.200 ], "z_axis": [ -0.362, -0.919, -0.158 ], "quaternion": [ 0.418, 0.669, 0.362, -0.496 ] } }, { "index": 328, "index_chain": 164, "chain_name": "J", "nt_resnum": 169, "nt_name": "DT", "nt_code": "T", "nt_id": "///J/169", "linked_nts": [ "///J/168", null ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix-end,stem-end", "alpha": 39.314, "beta": 129.214, "gamma": -57.523, "delta": 86.208, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": -107.908, "glyco_bond": "anti", "C5prime_xyz": [ -2.213, 8.131, -2.338 ], "P_xyz": [ -0.946, 10.424, -2.418 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": -6.865, "v1": -15.529, "v2": 30.489, "v3": -35.328, "v4": 26.834, "amplitude": 35.096, "phase_angle": 29.689, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23m", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.002, "origin": [ 147.946, 94.988, 96.348 ], "x_axis": [ 0.684, -0.165, -0.711 ], "y_axis": [ 0.620, -0.384, 0.685 ], "z_axis": [ -0.386, -0.909, -0.160 ], "quaternion": [ 0.534, 0.746, 0.152, -0.367 ] } } ], "num_hbonds": 1576, "hbonds": [ { "index": 1, "atom1_serNum": 22, "atom2_serNum": 59, "donAcc_type": "questionable", "distance": 2.948, "atom1_id": "///A/36/NZ", "atom2_id": "///A/40/NH2", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 2, "atom1_serNum": 31, "atom2_serNum": 52, "donAcc_type": "standard", "distance": 3.112, "atom1_id": "///A/37/NZ", "atom2_id": "///A/40/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 3, "atom1_serNum": 42, "atom2_serNum": 11417, "donAcc_type": "questionable", "distance": 3.318, "atom1_id": "///A/39/O", "atom2_id": "///J/101/OP1", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 4, "atom1_serNum": 48, "atom2_serNum": 9149, "donAcc_type": "standard", "distance": 3.777, "atom1_id": "///A/39/NE2", "atom2_id": "///I/160/O4'", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 5, "atom1_serNum": 56, "atom2_serNum": 11403, "donAcc_type": "standard", "distance": 3.417, "atom1_id": "///A/40/NE", "atom2_id": "///J/100/O3'", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 6, "atom1_serNum": 56, "atom2_serNum": 11417, "donAcc_type": "standard", "distance": 2.945, "atom1_id": "///A/40/NE", "atom2_id": "///J/101/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 7, "atom1_serNum": 58, "atom2_serNum": 11417, "donAcc_type": "standard", "distance": 2.430, "atom1_id": "///A/40/NH1", "atom2_id": "///J/101/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 8, "atom1_serNum": 75, "atom2_serNum": 94, "donAcc_type": "standard", "distance": 3.213, "atom1_id": "///A/42/O", "atom2_id": "///A/45/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 9, "atom1_serNum": 75, "atom2_serNum": 99, "donAcc_type": "acceptable", "distance": 2.976, "atom1_id": "///A/42/O", "atom2_id": "///A/45/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 10, "atom1_serNum": 81, "atom2_serNum": 9186, "donAcc_type": "standard", "distance": 3.455, "atom1_id": "///A/42/NH1", "atom2_id": "///I/162/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 11, "atom1_serNum": 97, "atom2_serNum": 121, "donAcc_type": "standard", "distance": 3.660, "atom1_id": "///A/45/O", "atom2_id": "///A/49/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 12, "atom1_serNum": 104, "atom2_serNum": 132, "donAcc_type": "standard", "distance": 2.911, "atom1_id": "///A/46/O", "atom2_id": "///A/50/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 13, "atom1_serNum": 111, "atom2_serNum": 140, "donAcc_type": "questionable", "distance": 3.190, "atom1_id": "///A/47/O", "atom2_id": "///A/50/OE2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 14, "atom1_serNum": 111, "atom2_serNum": 141, "donAcc_type": "standard", "distance": 2.907, "atom1_id": "///A/47/O", "atom2_id": "///A/51/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 15, "atom1_serNum": 116, "atom2_serNum": 149, "donAcc_type": "standard", "distance": 2.917, "atom1_id": "///A/48/O", "atom2_id": "///A/52/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 16, "atom1_serNum": 124, "atom2_serNum": 160, "donAcc_type": "standard", "distance": 2.914, "atom1_id": "///A/49/O", "atom2_id": "///A/53/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 17, "atom1_serNum": 135, "atom2_serNum": 171, "donAcc_type": "standard", "distance": 2.891, "atom1_id": "///A/50/O", "atom2_id": "///A/54/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 18, "atom1_serNum": 144, "atom2_serNum": 183, "donAcc_type": "standard", "distance": 2.909, "atom1_id": "///A/51/O", "atom2_id": "///A/55/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 19, "atom1_serNum": 174, "atom2_serNum": 201, "donAcc_type": "standard", "distance": 3.252, "atom1_id": "///A/54/O", "atom2_id": "///A/57/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 20, "atom1_serNum": 174, "atom2_serNum": 206, "donAcc_type": "acceptable", "distance": 2.856, "atom1_id": "///A/54/O", "atom2_id": "///A/57/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 21, "atom1_serNum": 174, "atom2_serNum": 987, "donAcc_type": "standard", "distance": 3.732, "atom1_id": "///A/54/O", "atom2_id": "///B/40/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 22, "atom1_serNum": 186, "atom2_serNum": 5070, "donAcc_type": "standard", "distance": 3.082, "atom1_id": "///A/55/O", "atom2_id": "///G/81/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 23, "atom1_serNum": 191, "atom2_serNum": 981, "donAcc_type": "standard", "distance": 3.853, "atom1_id": "///A/55/NE2", "atom2_id": "///B/40/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 24, "atom1_serNum": 204, "atom2_serNum": 206, "donAcc_type": "acceptable", "distance": 2.998, "atom1_id": "///A/57/O", "atom2_id": "///A/57/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 25, "atom1_serNum": 204, "atom2_serNum": 987, "donAcc_type": "standard", "distance": 2.922, "atom1_id": "///A/57/O", "atom2_id": "///B/40/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 26, "atom1_serNum": 214, "atom2_serNum": 221, "donAcc_type": "standard", "distance": 2.574, "atom1_id": "///A/59/N", "atom2_id": "///A/59/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 27, "atom1_serNum": 239, "atom2_serNum": 534, "donAcc_type": "standard", "distance": 3.727, "atom1_id": "///A/62/N", "atom2_id": "///A/97/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 28, "atom1_serNum": 242, "atom2_serNum": 505, "donAcc_type": "standard", "distance": 2.709, "atom1_id": "///A/62/O", "atom2_id": "///A/93/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 29, "atom1_serNum": 250, "atom2_serNum": 282, "donAcc_type": "standard", "distance": 3.582, "atom1_id": "///A/63/O", "atom2_id": "///A/67/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 30, "atom1_serNum": 256, "atom2_serNum": 11577, "donAcc_type": "standard", "distance": 3.373, "atom1_id": "///A/63/NH1", "atom2_id": "///J/109/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 31, "atom1_serNum": 261, "atom2_serNum": 293, "donAcc_type": "standard", "distance": 2.882, "atom1_id": "///A/64/O", "atom2_id": "///A/68/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 32, "atom1_serNum": 266, "atom2_serNum": 11577, "donAcc_type": "standard", "distance": 3.107, "atom1_id": "///A/64/NZ", "atom2_id": "///J/109/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 33, "atom1_serNum": 266, "atom2_serNum": 11578, "donAcc_type": "standard", "distance": 3.021, "atom1_id": "///A/64/NZ", "atom2_id": "///J/109/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 34, "atom1_serNum": 270, "atom2_serNum": 302, "donAcc_type": "standard", "distance": 2.937, "atom1_id": "///A/65/O", "atom2_id": "///A/69/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 35, "atom1_serNum": 278, "atom2_serNum": 313, "donAcc_type": "standard", "distance": 2.895, "atom1_id": "///A/66/O", "atom2_id": "///A/70/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 36, "atom1_serNum": 285, "atom2_serNum": 321, "donAcc_type": "standard", "distance": 2.898, "atom1_id": "///A/67/O", "atom2_id": "///A/71/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 37, "atom1_serNum": 296, "atom2_serNum": 328, "donAcc_type": "standard", "distance": 2.922, "atom1_id": "///A/68/O", "atom2_id": "///A/72/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 38, "atom1_serNum": 301, "atom2_serNum": 335, "donAcc_type": "questionable", "distance": 2.991, "atom1_id": "///A/68/NE2", "atom2_id": "///A/72/NE", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 39, "atom1_serNum": 305, "atom2_serNum": 339, "donAcc_type": "standard", "distance": 2.913, "atom1_id": "///A/69/O", "atom2_id": "///A/73/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 40, "atom1_serNum": 316, "atom2_serNum": 348, "donAcc_type": "standard", "distance": 2.912, "atom1_id": "///A/70/O", "atom2_id": "///A/74/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 41, "atom1_serNum": 324, "atom2_serNum": 356, "donAcc_type": "standard", "distance": 2.909, "atom1_id": "///A/71/O", "atom2_id": "///A/75/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 42, "atom1_serNum": 331, "atom2_serNum": 361, "donAcc_type": "standard", "distance": 2.919, "atom1_id": "///A/72/O", "atom2_id": "///A/76/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 43, "atom1_serNum": 337, "atom2_serNum": 7252, "donAcc_type": "standard", "distance": 3.379, "atom1_id": "///A/72/NH1", "atom2_id": "///I/68/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 44, "atom1_serNum": 359, "atom2_serNum": 389, "donAcc_type": "standard", "distance": 3.395, "atom1_id": "///A/75/O", "atom2_id": "///A/79/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 45, "atom1_serNum": 359, "atom2_serNum": 392, "donAcc_type": "questionable", "distance": 3.003, "atom1_id": "///A/75/O", "atom2_id": "///A/79/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 46, "atom1_serNum": 424, "atom2_serNum": 1309, "donAcc_type": "standard", "distance": 3.847, "atom1_id": "///A/83/O", "atom2_id": "///B/81/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 47, "atom1_serNum": 431, "atom2_serNum": 7237, "donAcc_type": "standard", "distance": 3.969, "atom1_id": "///A/83/NH2", "atom2_id": "///I/67/O4'", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 48, "atom1_serNum": 446, "atom2_serNum": 469, "donAcc_type": "standard", "distance": 3.365, "atom1_id": "///A/85/O", "atom2_id": "///A/89/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 49, "atom1_serNum": 455, "atom2_serNum": 476, "donAcc_type": "standard", "distance": 2.906, "atom1_id": "///A/86/O", "atom2_id": "///A/90/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 50, "atom1_serNum": 461, "atom2_serNum": 484, "donAcc_type": "standard", "distance": 2.913, "atom1_id": "///A/87/O", "atom2_id": "///A/91/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 51, "atom1_serNum": 467, "atom2_serNum": 489, "donAcc_type": "standard", "distance": 2.915, "atom1_id": "///A/88/O", "atom2_id": "///A/92/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 52, "atom1_serNum": 472, "atom2_serNum": 497, "donAcc_type": "standard", "distance": 2.895, "atom1_id": "///A/89/O", "atom2_id": "///A/93/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 53, "atom1_serNum": 479, "atom2_serNum": 506, "donAcc_type": "standard", "distance": 2.920, "atom1_id": "///A/90/O", "atom2_id": "///A/94/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 54, "atom1_serNum": 487, "atom2_serNum": 515, "donAcc_type": "standard", "distance": 2.914, "atom1_id": "///A/91/O", "atom2_id": "///A/95/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 55, "atom1_serNum": 492, "atom2_serNum": 520, "donAcc_type": "standard", "distance": 2.905, "atom1_id": "///A/92/O", "atom2_id": "///A/96/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 56, "atom1_serNum": 500, "atom2_serNum": 526, "donAcc_type": "standard", "distance": 2.889, "atom1_id": "///A/93/O", "atom2_id": "///A/97/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 57, "atom1_serNum": 505, "atom2_serNum": 534, "donAcc_type": "standard", "distance": 3.558, "atom1_id": "///A/93/NE2", "atom2_id": "///A/97/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 58, "atom1_serNum": 509, "atom2_serNum": 535, "donAcc_type": "standard", "distance": 2.961, "atom1_id": "///A/94/O", "atom2_id": "///A/98/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 59, "atom1_serNum": 518, "atom2_serNum": 540, "donAcc_type": "standard", "distance": 3.370, "atom1_id": "///A/95/O", "atom2_id": "///A/99/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 60, "atom1_serNum": 523, "atom2_serNum": 552, "donAcc_type": "standard", "distance": 3.506, "atom1_id": "///A/96/O", "atom2_id": "///A/100/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 61, "atom1_serNum": 529, "atom2_serNum": 560, "donAcc_type": "standard", "distance": 3.364, "atom1_id": "///A/97/O", "atom2_id": "///A/101/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 62, "atom1_serNum": 538, "atom2_serNum": 567, "donAcc_type": "standard", "distance": 2.952, "atom1_id": "///A/98/O", "atom2_id": "///A/102/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 63, "atom1_serNum": 543, "atom2_serNum": 571, "donAcc_type": "standard", "distance": 2.907, "atom1_id": "///A/99/O", "atom2_id": "///A/103/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 64, "atom1_serNum": 551, "atom2_serNum": 808, "donAcc_type": "acceptable", "distance": 3.719, "atom1_id": "///A/99/OH", "atom2_id": "///A/131/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 65, "atom1_serNum": 551, "atom2_serNum": 820, "donAcc_type": "acceptable", "distance": 2.400, "atom1_id": "///A/99/OH", "atom2_id": "///A/133/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 66, "atom1_serNum": 555, "atom2_serNum": 579, "donAcc_type": "standard", "distance": 2.898, "atom1_id": "///A/100/O", "atom2_id": "///A/104/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 67, "atom1_serNum": 563, "atom2_serNum": 590, "donAcc_type": "standard", "distance": 2.920, "atom1_id": "///A/101/O", "atom2_id": "///A/105/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 68, "atom1_serNum": 570, "atom2_serNum": 599, "donAcc_type": "standard", "distance": 2.922, "atom1_id": "///A/102/O", "atom2_id": "///A/106/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 69, "atom1_serNum": 574, "atom2_serNum": 607, "donAcc_type": "standard", "distance": 2.875, "atom1_id": "///A/103/O", "atom2_id": "///A/107/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 70, "atom1_serNum": 574, "atom2_serNum": 612, "donAcc_type": "acceptable", "distance": 2.959, "atom1_id": "///A/103/O", "atom2_id": "///A/107/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 71, "atom1_serNum": 582, "atom2_serNum": 612, "donAcc_type": "acceptable", "distance": 2.799, "atom1_id": "///A/104/O", "atom2_id": "///A/107/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 72, "atom1_serNum": 582, "atom2_serNum": 614, "donAcc_type": "standard", "distance": 2.947, "atom1_id": "///A/104/O", "atom2_id": "///A/108/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 73, "atom1_serNum": 593, "atom2_serNum": 622, "donAcc_type": "standard", "distance": 3.742, "atom1_id": "///A/105/O", "atom2_id": "///A/109/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 74, "atom1_serNum": 602, "atom2_serNum": 630, "donAcc_type": "standard", "distance": 3.621, "atom1_id": "///A/106/O", "atom2_id": "///A/110/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 75, "atom1_serNum": 606, "atom2_serNum": 805, "donAcc_type": "standard", "distance": 2.794, "atom1_id": "///A/106/OD2", "atom2_id": "///A/131/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 76, "atom1_serNum": 606, "atom2_serNum": 807, "donAcc_type": "standard", "distance": 2.688, "atom1_id": "///A/106/OD2", "atom2_id": "///A/131/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 77, "atom1_serNum": 610, "atom2_serNum": 636, "donAcc_type": "standard", "distance": 2.898, "atom1_id": "///A/107/O", "atom2_id": "///A/111/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 78, "atom1_serNum": 617, "atom2_serNum": 641, "donAcc_type": "standard", "distance": 2.934, "atom1_id": "///A/108/O", "atom2_id": "///A/112/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 79, "atom1_serNum": 625, "atom2_serNum": 649, "donAcc_type": "standard", "distance": 2.909, "atom1_id": "///A/109/O", "atom2_id": "///A/113/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 80, "atom1_serNum": 633, "atom2_serNum": 659, "donAcc_type": "standard", "distance": 3.417, "atom1_id": "///A/110/O", "atom2_id": "///A/114/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 81, "atom1_serNum": 644, "atom2_serNum": 664, "donAcc_type": "standard", "distance": 3.380, "atom1_id": "///A/112/O", "atom2_id": "///A/115/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 82, "atom1_serNum": 652, "atom2_serNum": 672, "donAcc_type": "standard", "distance": 2.693, "atom1_id": "///A/113/O", "atom2_id": "///A/115/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 83, "atom1_serNum": 658, "atom2_serNum": 3779, "donAcc_type": "standard", "distance": 2.543, "atom1_id": "///A/113/NE2", "atom2_id": "///E/123/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 84, "atom1_serNum": 672, "atom2_serNum": 3772, "donAcc_type": "questionable", "distance": 3.008, "atom1_id": "///A/115/NZ", "atom2_id": "///E/122/NZ", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 85, "atom1_serNum": 682, "atom2_serNum": 736, "donAcc_type": "standard", "distance": 3.269, "atom1_id": "///A/116/NH1", "atom2_id": "///A/123/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 86, "atom1_serNum": 683, "atom2_serNum": 694, "donAcc_type": "standard", "distance": 3.202, "atom1_id": "///A/116/NH2", "atom2_id": "///A/118/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 87, "atom1_serNum": 698, "atom2_serNum": 1016, "donAcc_type": "standard", "distance": 3.720, "atom1_id": "///A/119/N", "atom2_id": "///B/45/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 88, "atom1_serNum": 706, "atom2_serNum": 737, "donAcc_type": "standard", "distance": 3.272, "atom1_id": "///A/120/N", "atom2_id": "///A/123/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 89, "atom1_serNum": 709, "atom2_serNum": 730, "donAcc_type": "standard", "distance": 3.135, "atom1_id": "///A/120/O", "atom2_id": "///A/123/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 90, "atom1_serNum": 717, "atom2_serNum": 738, "donAcc_type": "standard", "distance": 2.748, "atom1_id": "///A/121/O", "atom2_id": "///A/124/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 91, "atom1_serNum": 717, "atom2_serNum": 746, "donAcc_type": "standard", "distance": 2.938, "atom1_id": "///A/121/O", "atom2_id": "///A/125/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 92, "atom1_serNum": 721, "atom2_serNum": 753, "donAcc_type": "standard", "distance": 3.242, "atom1_id": "///A/122/N", "atom2_id": "///A/125/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 93, "atom1_serNum": 724, "atom2_serNum": 755, "donAcc_type": "standard", "distance": 2.912, "atom1_id": "///A/122/O", "atom2_id": "///A/126/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 94, "atom1_serNum": 733, "atom2_serNum": 763, "donAcc_type": "standard", "distance": 2.889, "atom1_id": "///A/123/O", "atom2_id": "///A/127/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 95, "atom1_serNum": 736, "atom2_serNum": 3701, "donAcc_type": "standard", "distance": 2.581, "atom1_id": "///A/123/OD1", "atom2_id": "///E/113/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 96, "atom1_serNum": 741, "atom2_serNum": 768, "donAcc_type": "standard", "distance": 2.922, "atom1_id": "///A/124/O", "atom2_id": "///A/128/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 97, "atom1_serNum": 749, "atom2_serNum": 779, "donAcc_type": "standard", "distance": 2.900, "atom1_id": "///A/125/O", "atom2_id": "///A/129/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 98, "atom1_serNum": 758, "atom2_serNum": 790, "donAcc_type": "standard", "distance": 2.904, "atom1_id": "///A/126/O", "atom2_id": "///A/130/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 99, "atom1_serNum": 766, "atom2_serNum": 798, "donAcc_type": "standard", "distance": 3.301, "atom1_id": "///A/127/O", "atom2_id": "///A/131/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 100, "atom1_serNum": 771, "atom2_serNum": 813, "donAcc_type": "standard", "distance": 3.891, "atom1_id": "///A/128/O", "atom2_id": "///A/133/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 101, "atom1_serNum": 782, "atom2_serNum": 789, "donAcc_type": "standard", "distance": 3.009, "atom1_id": "///A/129/O", "atom2_id": "///A/129/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 102, "atom1_serNum": 782, "atom2_serNum": 809, "donAcc_type": "standard", "distance": 3.147, "atom1_id": "///A/129/O", "atom2_id": "///A/132/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 103, "atom1_serNum": 793, "atom2_serNum": 3848, "donAcc_type": "standard", "distance": 3.802, "atom1_id": "///A/130/O", "atom2_id": "///E/131/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 104, "atom1_serNum": 801, "atom2_serNum": 2166, "donAcc_type": "standard", "distance": 3.368, "atom1_id": "///A/131/O", "atom2_id": "///C/99/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 105, "atom1_serNum": 858, "atom2_serNum": 883, "donAcc_type": "standard", "distance": 3.107, "atom1_id": "///B/24/OD2", "atom2_id": "///B/27/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 106, "atom1_serNum": 887, "atom2_serNum": 896, "donAcc_type": "standard", "distance": 3.062, "atom1_id": "///B/28/O", "atom2_id": "///B/30/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 107, "atom1_serNum": 891, "atom2_serNum": 1104, "donAcc_type": "standard", "distance": 2.394, "atom1_id": "///B/29/O", "atom2_id": "///B/55/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 108, "atom1_serNum": 899, "atom2_serNum": 924, "donAcc_type": "standard", "distance": 3.115, "atom1_id": "///B/30/O", "atom2_id": "///B/34/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 109, "atom1_serNum": 906, "atom2_serNum": 932, "donAcc_type": "standard", "distance": 2.933, "atom1_id": "///B/31/O", "atom2_id": "///B/35/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 110, "atom1_serNum": 911, "atom2_serNum": 939, "donAcc_type": "questionable", "distance": 2.995, "atom1_id": "///B/31/NZ", "atom2_id": "///B/35/NE", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 111, "atom1_serNum": 915, "atom2_serNum": 943, "donAcc_type": "standard", "distance": 2.888, "atom1_id": "///B/32/O", "atom2_id": "///B/36/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 112, "atom1_serNum": 922, "atom2_serNum": 954, "donAcc_type": "standard", "distance": 2.912, "atom1_id": "///B/33/O", "atom2_id": "///B/37/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 113, "atom1_serNum": 927, "atom2_serNum": 962, "donAcc_type": "standard", "distance": 2.904, "atom1_id": "///B/34/O", "atom2_id": "///B/38/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 114, "atom1_serNum": 935, "atom2_serNum": 967, "donAcc_type": "standard", "distance": 2.912, "atom1_id": "///B/35/O", "atom2_id": "///B/39/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 115, "atom1_serNum": 941, "atom2_serNum": 11376, "donAcc_type": "standard", "distance": 3.237, "atom1_id": "///B/35/NH1", "atom2_id": "///J/99/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 116, "atom1_serNum": 942, "atom2_serNum": 11375, "donAcc_type": "standard", "distance": 3.279, "atom1_id": "///B/35/NH2", "atom2_id": "///J/99/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 117, "atom1_serNum": 942, "atom2_serNum": 11376, "donAcc_type": "standard", "distance": 3.178, "atom1_id": "///B/35/NH2", "atom2_id": "///J/99/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 118, "atom1_serNum": 965, "atom2_serNum": 989, "donAcc_type": "standard", "distance": 3.176, "atom1_id": "///B/38/O", "atom2_id": "///B/41/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 119, "atom1_serNum": 965, "atom2_serNum": 997, "donAcc_type": "standard", "distance": 3.921, "atom1_id": "///B/38/O", "atom2_id": "///B/43/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 120, "atom1_serNum": 970, "atom2_serNum": 993, "donAcc_type": "standard", "distance": 3.125, "atom1_id": "///B/39/O", "atom2_id": "///B/42/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 121, "atom1_serNum": 976, "atom2_serNum": 11375, "donAcc_type": "standard", "distance": 3.531, "atom1_id": "///B/39/NH1", "atom2_id": "///J/99/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 122, "atom1_serNum": 977, "atom2_serNum": 1000, "donAcc_type": "standard", "distance": 2.493, "atom1_id": "///B/39/NH2", "atom2_id": "///B/43/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 123, "atom1_serNum": 977, "atom2_serNum": 1007, "donAcc_type": "standard", "distance": 3.026, "atom1_id": "///B/39/NH2", "atom2_id": "///B/44/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 124, "atom1_serNum": 996, "atom2_serNum": 1012, "donAcc_type": "standard", "distance": 2.799, "atom1_id": "///B/42/O", "atom2_id": "///B/44/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 125, "atom1_serNum": 1035, "atom2_serNum": 1050, "donAcc_type": "standard", "distance": 3.860, "atom1_id": "///B/47/O", "atom2_id": "///B/50/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 126, "atom1_serNum": 1045, "atom2_serNum": 1086, "donAcc_type": "questionable", "distance": 2.744, "atom1_id": "///B/49/O", "atom2_id": "///B/53/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 127, "atom1_serNum": 1053, "atom2_serNum": 1088, "donAcc_type": "standard", "distance": 3.347, "atom1_id": "///B/50/O", "atom2_id": "///B/54/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 128, "atom1_serNum": 1061, "atom2_serNum": 1095, "donAcc_type": "standard", "distance": 2.902, "atom1_id": "///B/51/O", "atom2_id": "///B/55/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 129, "atom1_serNum": 1070, "atom2_serNum": 1077, "donAcc_type": "standard", "distance": 2.734, "atom1_id": "///B/52/N", "atom2_id": "///B/52/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 130, "atom1_serNum": 1073, "atom2_serNum": 1106, "donAcc_type": "standard", "distance": 2.936, "atom1_id": "///B/52/O", "atom2_id": "///B/56/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 131, "atom1_serNum": 1079, "atom2_serNum": 1086, "donAcc_type": "standard", "distance": 2.890, "atom1_id": "///B/53/N", "atom2_id": "///B/53/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 132, "atom1_serNum": 1082, "atom2_serNum": 1110, "donAcc_type": "standard", "distance": 2.885, "atom1_id": "///B/53/O", "atom2_id": "///B/57/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 133, "atom1_serNum": 1091, "atom2_serNum": 1117, "donAcc_type": "standard", "distance": 2.887, "atom1_id": "///B/54/O", "atom2_id": "///B/58/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 134, "atom1_serNum": 1098, "atom2_serNum": 1125, "donAcc_type": "standard", "distance": 2.904, "atom1_id": "///B/55/O", "atom2_id": "///B/59/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 135, "atom1_serNum": 1109, "atom2_serNum": 1134, "donAcc_type": "standard", "distance": 2.925, "atom1_id": "///B/56/O", "atom2_id": "///B/60/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 136, "atom1_serNum": 1113, "atom2_serNum": 1141, "donAcc_type": "standard", "distance": 2.899, "atom1_id": "///B/57/O", "atom2_id": "///B/61/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 137, "atom1_serNum": 1120, "atom2_serNum": 1152, "donAcc_type": "standard", "distance": 2.911, "atom1_id": "///B/58/O", "atom2_id": "///B/62/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 138, "atom1_serNum": 1128, "atom2_serNum": 1160, "donAcc_type": "standard", "distance": 2.914, "atom1_id": "///B/59/O", "atom2_id": "///B/63/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 139, "atom1_serNum": 1137, "atom2_serNum": 1176, "donAcc_type": "standard", "distance": 2.682, "atom1_id": "///B/60/O", "atom2_id": "///B/64/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 140, "atom1_serNum": 1144, "atom2_serNum": 1177, "donAcc_type": "standard", "distance": 3.640, "atom1_id": "///B/61/O", "atom2_id": "///B/65/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 141, "atom1_serNum": 1155, "atom2_serNum": 1184, "donAcc_type": "standard", "distance": 2.890, "atom1_id": "///B/62/O", "atom2_id": "///B/66/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 142, "atom1_serNum": 1163, "atom2_serNum": 1192, "donAcc_type": "standard", "distance": 2.925, "atom1_id": "///B/63/O", "atom2_id": "///B/67/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 143, "atom1_serNum": 1167, "atom2_serNum": 1201, "donAcc_type": "standard", "distance": 2.749, "atom1_id": "///B/63/OE1", "atom2_id": "///B/67/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 144, "atom1_serNum": 1168, "atom2_serNum": 1201, "donAcc_type": "standard", "distance": 3.090, "atom1_id": "///B/63/OE2", "atom2_id": "///B/67/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 145, "atom1_serNum": 1172, "atom2_serNum": 1203, "donAcc_type": "standard", "distance": 3.358, "atom1_id": "///B/64/O", "atom2_id": "///B/68/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 146, "atom1_serNum": 1175, "atom2_serNum": 1202, "donAcc_type": "standard", "distance": 3.686, "atom1_id": "///B/64/OD1", "atom2_id": "///B/67/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 147, "atom1_serNum": 1180, "atom2_serNum": 1211, "donAcc_type": "standard", "distance": 2.896, "atom1_id": "///B/65/O", "atom2_id": "///B/69/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 148, "atom1_serNum": 1187, "atom2_serNum": 1216, "donAcc_type": "standard", "distance": 2.880, "atom1_id": "///B/66/O", "atom2_id": "///B/70/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 149, "atom1_serNum": 1195, "atom2_serNum": 1223, "donAcc_type": "standard", "distance": 2.939, "atom1_id": "///B/67/O", "atom2_id": "///B/71/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 150, "atom1_serNum": 1195, "atom2_serNum": 1228, "donAcc_type": "acceptable", "distance": 2.818, "atom1_id": "///B/67/O", "atom2_id": "///B/71/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 151, "atom1_serNum": 1206, "atom2_serNum": 1230, "donAcc_type": "standard", "distance": 2.895, "atom1_id": "///B/68/O", "atom2_id": "///B/72/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 152, "atom1_serNum": 1210, "atom2_serNum": 1411, "donAcc_type": "standard", "distance": 3.139, "atom1_id": "///B/68/OD2", "atom2_id": "///B/93/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 153, "atom1_serNum": 1214, "atom2_serNum": 1242, "donAcc_type": "standard", "distance": 2.896, "atom1_id": "///B/69/O", "atom2_id": "///B/73/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 154, "atom1_serNum": 1214, "atom2_serNum": 1247, "donAcc_type": "acceptable", "distance": 2.711, "atom1_id": "///B/69/O", "atom2_id": "///B/73/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 155, "atom1_serNum": 1219, "atom2_serNum": 1249, "donAcc_type": "standard", "distance": 2.888, "atom1_id": "///B/70/O", "atom2_id": "///B/74/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 156, "atom1_serNum": 1226, "atom2_serNum": 1258, "donAcc_type": "standard", "distance": 2.932, "atom1_id": "///B/71/O", "atom2_id": "///B/75/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 157, "atom1_serNum": 1233, "atom2_serNum": 1268, "donAcc_type": "standard", "distance": 3.445, "atom1_id": "///B/72/O", "atom2_id": "///B/76/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 158, "atom1_serNum": 1241, "atom2_serNum": 2718, "donAcc_type": "acceptable", "distance": 3.152, "atom1_id": "///B/72/OH", "atom2_id": "///D/79/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 159, "atom1_serNum": 1247, "atom2_serNum": 1343, "donAcc_type": "acceptable", "distance": 3.365, "atom1_id": "///B/73/OG1", "atom2_id": "///B/85/OD2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 160, "atom1_serNum": 1252, "atom2_serNum": 1273, "donAcc_type": "standard", "distance": 3.347, "atom1_id": "///B/74/O", "atom2_id": "///B/77/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 161, "atom1_serNum": 1252, "atom2_serNum": 2827, "donAcc_type": "standard", "distance": 3.494, "atom1_id": "///B/74/O", "atom2_id": "///D/92/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 162, "atom1_serNum": 1261, "atom2_serNum": 2827, "donAcc_type": "standard", "distance": 2.298, "atom1_id": "///B/75/O", "atom2_id": "///D/92/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 163, "atom1_serNum": 1291, "atom2_serNum": 1343, "donAcc_type": "standard", "distance": 3.489, "atom1_id": "///B/78/NH1", "atom2_id": "///B/85/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 164, "atom1_serNum": 1292, "atom2_serNum": 1305, "donAcc_type": "standard", "distance": 3.392, "atom1_id": "///B/78/NH2", "atom2_id": "///B/80/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 165, "atom1_serNum": 1292, "atom2_serNum": 1321, "donAcc_type": "acceptable", "distance": 3.497, "atom1_id": "///B/78/NH2", "atom2_id": "///B/82/OG1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 166, "atom1_serNum": 1301, "atom2_serNum": 1307, "donAcc_type": "acceptable", "distance": 3.475, "atom1_id": "///B/79/NZ", "atom2_id": "///B/80/OG1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 167, "atom1_serNum": 1319, "atom2_serNum": 1344, "donAcc_type": "standard", "distance": 3.543, "atom1_id": "///B/82/O", "atom2_id": "///B/86/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 168, "atom1_serNum": 1326, "atom2_serNum": 1351, "donAcc_type": "standard", "distance": 2.881, "atom1_id": "///B/83/O", "atom2_id": "///B/87/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 169, "atom1_serNum": 1331, "atom2_serNum": 1358, "donAcc_type": "standard", "distance": 2.993, "atom1_id": "///B/84/O", "atom2_id": "///B/88/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 170, "atom1_serNum": 1339, "atom2_serNum": 1370, "donAcc_type": "standard", "distance": 2.855, "atom1_id": "///B/85/O", "atom2_id": "///B/89/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 171, "atom1_serNum": 1347, "atom2_serNum": 1375, "donAcc_type": "standard", "distance": 2.895, "atom1_id": "///B/86/O", "atom2_id": "///B/90/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 172, "atom1_serNum": 1354, "atom2_serNum": 1383, "donAcc_type": "standard", "distance": 2.940, "atom1_id": "///B/87/O", "atom2_id": "///B/91/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 173, "atom1_serNum": 1378, "atom2_serNum": 1403, "donAcc_type": "standard", "distance": 3.164, "atom1_id": "///B/90/O", "atom2_id": "///B/93/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 174, "atom1_serNum": 1378, "atom2_serNum": 1416, "donAcc_type": "standard", "distance": 3.265, "atom1_id": "///B/90/O", "atom2_id": "///B/95/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 175, "atom1_serNum": 1386, "atom2_serNum": 1412, "donAcc_type": "standard", "distance": 3.489, "atom1_id": "///B/91/O", "atom2_id": "///B/94/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 176, "atom1_serNum": 1391, "atom2_serNum": 5707, "donAcc_type": "standard", "distance": 3.704, "atom1_id": "///B/91/NZ", "atom2_id": "///H/71/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 177, "atom1_serNum": 1401, "atom2_serNum": 2697, "donAcc_type": "standard", "distance": 2.557, "atom1_id": "///B/92/NH1", "atom2_id": "///D/76/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 178, "atom1_serNum": 1406, "atom2_serNum": 5219, "donAcc_type": "standard", "distance": 2.947, "atom1_id": "///B/93/O", "atom2_id": "///G/99/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 179, "atom1_serNum": 1415, "atom2_serNum": 5217, "donAcc_type": "standard", "distance": 2.581, "atom1_id": "///B/94/O", "atom2_id": "///G/99/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 180, "atom1_serNum": 1430, "atom2_serNum": 5228, "donAcc_type": "standard", "distance": 3.725, "atom1_id": "///B/96/O", "atom2_id": "///G/101/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 181, "atom1_serNum": 1442, "atom2_serNum": 5231, "donAcc_type": "standard", "distance": 3.976, "atom1_id": "///B/98/N", "atom2_id": "///G/101/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 182, "atom1_serNum": 1453, "atom2_serNum": 5680, "donAcc_type": "acceptable", "distance": 3.137, "atom1_id": "///B/98/OH", "atom2_id": "///H/68/OD2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 183, "atom1_serNum": 1454, "atom2_serNum": 5646, "donAcc_type": "acceptable", "distance": 2.945, "atom1_id": "///B/99/N", "atom2_id": "///H/64/OG", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 184, "atom1_serNum": 1469, "atom2_serNum": 5646, "donAcc_type": "acceptable", "distance": 3.430, "atom1_id": "///B/101/N", "atom2_id": "///H/64/OG", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 185, "atom1_serNum": 1479, "atom2_serNum": 6863, "donAcc_type": "standard", "distance": 3.516, "atom1_id": "///C/12/N", "atom2_id": "///I/49/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 186, "atom1_serNum": 1492, "atom2_serNum": 12115, "donAcc_type": "standard", "distance": 3.208, "atom1_id": "///C/13/NZ", "atom2_id": "///J/135/O4'", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 187, "atom1_serNum": 1501, "atom2_serNum": 1546, "donAcc_type": "standard", "distance": 3.407, "atom1_id": "///C/15/O", "atom2_id": "///C/20/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 188, "atom1_serNum": 1510, "atom2_serNum": 1536, "donAcc_type": "acceptable", "distance": 2.973, "atom1_id": "///C/16/O", "atom2_id": "///C/19/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 189, "atom1_serNum": 1510, "atom2_serNum": 1537, "donAcc_type": "standard", "distance": 2.883, "atom1_id": "///C/16/O", "atom2_id": "///C/20/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 190, "atom1_serNum": 1512, "atom2_serNum": 1530, "donAcc_type": "acceptable", "distance": 2.945, "atom1_id": "///C/16/OG1", "atom2_id": "///C/18/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 191, "atom1_serNum": 1514, "atom2_serNum": 6841, "donAcc_type": "standard", "distance": 3.073, "atom1_id": "///C/17/N", "atom2_id": "///I/48/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 192, "atom1_serNum": 1517, "atom2_serNum": 1548, "donAcc_type": "standard", "distance": 3.134, "atom1_id": "///C/17/O", "atom2_id": "///C/21/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 193, "atom1_serNum": 1521, "atom2_serNum": 6842, "donAcc_type": "standard", "distance": 2.809, "atom1_id": "///C/17/NE", "atom2_id": "///I/48/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 194, "atom1_serNum": 1528, "atom2_serNum": 1553, "donAcc_type": "standard", "distance": 3.239, "atom1_id": "///C/18/O", "atom2_id": "///C/22/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 195, "atom1_serNum": 1528, "atom2_serNum": 1557, "donAcc_type": "standard", "distance": 3.212, "atom1_id": "///C/18/O", "atom2_id": "///C/23/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 196, "atom1_serNum": 1565, "atom2_serNum": 1819, "donAcc_type": "standard", "distance": 3.279, "atom1_id": "///C/24/N", "atom2_id": "///C/56/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 197, "atom1_serNum": 1573, "atom2_serNum": 1820, "donAcc_type": "standard", "distance": 3.115, "atom1_id": "///C/24/NE2", "atom2_id": "///C/56/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 198, "atom1_serNum": 1574, "atom2_serNum": 1819, "donAcc_type": "standard", "distance": 3.518, "atom1_id": "///C/25/N", "atom2_id": "///C/56/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 199, "atom1_serNum": 1602, "atom2_serNum": 1631, "donAcc_type": "standard", "distance": 2.894, "atom1_id": "///C/28/O", "atom2_id": "///C/32/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 200, "atom1_serNum": 1606, "atom2_serNum": 1642, "donAcc_type": "standard", "distance": 2.905, "atom1_id": "///C/29/O", "atom2_id": "///C/33/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 201, "atom1_serNum": 1612, "atom2_serNum": 2418, "donAcc_type": "acceptable", "distance": 2.377, "atom1_id": "///C/29/NH1", "atom2_id": "///D/40/OH", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 202, "atom1_serNum": 1613, "atom2_serNum": 2374, "donAcc_type": "standard", "distance": 2.715, "atom1_id": "///C/29/NH2", "atom2_id": "///D/35/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 203, "atom1_serNum": 1613, "atom2_serNum": 2378, "donAcc_type": "standard", "distance": 3.284, "atom1_id": "///C/29/NH2", "atom2_id": "///D/36/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 204, "atom1_serNum": 1617, "atom2_serNum": 1650, "donAcc_type": "standard", "distance": 2.890, "atom1_id": "///C/30/O", "atom2_id": "///C/34/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 205, "atom1_serNum": 1624, "atom2_serNum": 1658, "donAcc_type": "standard", "distance": 2.908, "atom1_id": "///C/31/O", "atom2_id": "///C/35/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 206, "atom1_serNum": 1634, "atom2_serNum": 1669, "donAcc_type": "standard", "distance": 2.896, "atom1_id": "///C/32/O", "atom2_id": "///C/36/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 207, "atom1_serNum": 1645, "atom2_serNum": 1678, "donAcc_type": "standard", "distance": 2.824, "atom1_id": "///C/33/O", "atom2_id": "///C/37/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 208, "atom1_serNum": 1661, "atom2_serNum": 1682, "donAcc_type": "standard", "distance": 3.816, "atom1_id": "///C/35/O", "atom2_id": "///C/38/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 209, "atom1_serNum": 1667, "atom2_serNum": 11991, "donAcc_type": "standard", "distance": 3.522, "atom1_id": "///C/35/NH1", "atom2_id": "///J/129/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 210, "atom1_serNum": 1689, "atom2_serNum": 4768, "donAcc_type": "standard", "distance": 2.978, "atom1_id": "///C/38/ND2", "atom2_id": "///G/41/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 211, "atom1_serNum": 1707, "atom2_serNum": 1720, "donAcc_type": "acceptable", "distance": 2.459, "atom1_id": "///C/40/OG", "atom2_id": "///C/42/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 212, "atom1_serNum": 1708, "atom2_serNum": 1715, "donAcc_type": "standard", "distance": 2.645, "atom1_id": "///C/41/N", "atom2_id": "///C/41/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 213, "atom1_serNum": 1715, "atom2_serNum": 4742, "donAcc_type": "standard", "distance": 3.160, "atom1_id": "///C/41/OE1", "atom2_id": "///G/38/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 214, "atom1_serNum": 1726, "atom2_serNum": 11969, "donAcc_type": "standard", "distance": 3.315, "atom1_id": "///C/42/NH1", "atom2_id": "///J/128/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 215, "atom1_serNum": 1727, "atom2_serNum": 11990, "donAcc_type": "standard", "distance": 3.345, "atom1_id": "///C/42/NH2", "atom2_id": "///J/129/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 216, "atom1_serNum": 1727, "atom2_serNum": 11991, "donAcc_type": "standard", "distance": 3.205, "atom1_id": "///C/42/NH2", "atom2_id": "///J/129/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 217, "atom1_serNum": 1735, "atom2_serNum": 2799, "donAcc_type": "standard", "distance": 3.263, "atom1_id": "///C/44/N", "atom2_id": "///D/89/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 218, "atom1_serNum": 1747, "atom2_serNum": 1767, "donAcc_type": "standard", "distance": 3.509, "atom1_id": "///C/46/O", "atom2_id": "///C/50/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 219, "atom1_serNum": 1751, "atom2_serNum": 1779, "donAcc_type": "standard", "distance": 2.925, "atom1_id": "///C/47/O", "atom2_id": "///C/51/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 220, "atom1_serNum": 1756, "atom2_serNum": 1787, "donAcc_type": "standard", "distance": 2.906, "atom1_id": "///C/48/O", "atom2_id": "///C/52/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 221, "atom1_serNum": 1763, "atom2_serNum": 1792, "donAcc_type": "standard", "distance": 3.517, "atom1_id": "///C/49/O", "atom2_id": "///C/53/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 222, "atom1_serNum": 1770, "atom2_serNum": 1797, "donAcc_type": "standard", "distance": 3.330, "atom1_id": "///C/50/O", "atom2_id": "///C/54/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 223, "atom1_serNum": 1778, "atom2_serNum": 2852, "donAcc_type": "acceptable", "distance": 2.647, "atom1_id": "///C/50/OH", "atom2_id": "///D/95/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 224, "atom1_serNum": 1782, "atom2_serNum": 1804, "donAcc_type": "standard", "distance": 2.961, "atom1_id": "///C/51/O", "atom2_id": "///C/55/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 225, "atom1_serNum": 1790, "atom2_serNum": 1812, "donAcc_type": "standard", "distance": 2.899, "atom1_id": "///C/52/O", "atom2_id": "///C/56/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 226, "atom1_serNum": 1795, "atom2_serNum": 1821, "donAcc_type": "standard", "distance": 2.888, "atom1_id": "///C/53/O", "atom2_id": "///C/57/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 227, "atom1_serNum": 1800, "atom2_serNum": 1833, "donAcc_type": "standard", "distance": 2.924, "atom1_id": "///C/54/O", "atom2_id": "///C/58/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 228, "atom1_serNum": 1807, "atom2_serNum": 1841, "donAcc_type": "standard", "distance": 2.943, "atom1_id": "///C/55/O", "atom2_id": "///C/59/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 229, "atom1_serNum": 1807, "atom2_serNum": 1846, "donAcc_type": "acceptable", "distance": 2.876, "atom1_id": "///C/55/O", "atom2_id": "///C/59/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 230, "atom1_serNum": 1815, "atom2_serNum": 1848, "donAcc_type": "standard", "distance": 2.870, "atom1_id": "///C/56/O", "atom2_id": "///C/60/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 231, "atom1_serNum": 1824, "atom2_serNum": 1853, "donAcc_type": "standard", "distance": 2.965, "atom1_id": "///C/57/O", "atom2_id": "///C/61/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 232, "atom1_serNum": 1832, "atom2_serNum": 2956, "donAcc_type": "acceptable", "distance": 3.249, "atom1_id": "///C/57/OH", "atom2_id": "///D/109/ND1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 233, "atom1_serNum": 1836, "atom2_serNum": 1862, "donAcc_type": "standard", "distance": 2.969, "atom1_id": "///C/58/O", "atom2_id": "///C/62/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 234, "atom1_serNum": 1844, "atom2_serNum": 1870, "donAcc_type": "standard", "distance": 2.906, "atom1_id": "///C/59/O", "atom2_id": "///C/63/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 235, "atom1_serNum": 1851, "atom2_serNum": 1878, "donAcc_type": "standard", "distance": 2.892, "atom1_id": "///C/60/O", "atom2_id": "///C/64/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 236, "atom1_serNum": 1856, "atom2_serNum": 1887, "donAcc_type": "standard", "distance": 2.911, "atom1_id": "///C/61/O", "atom2_id": "///C/65/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 237, "atom1_serNum": 1865, "atom2_serNum": 1895, "donAcc_type": "standard", "distance": 2.931, "atom1_id": "///C/62/O", "atom2_id": "///C/66/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 238, "atom1_serNum": 1873, "atom2_serNum": 1900, "donAcc_type": "standard", "distance": 2.891, "atom1_id": "///C/63/O", "atom2_id": "///C/67/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 239, "atom1_serNum": 1881, "atom2_serNum": 1904, "donAcc_type": "standard", "distance": 3.587, "atom1_id": "///C/64/O", "atom2_id": "///C/68/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 240, "atom1_serNum": 1890, "atom2_serNum": 1910, "donAcc_type": "questionable", "distance": 2.713, "atom1_id": "///C/65/O", "atom2_id": "///C/68/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 241, "atom1_serNum": 1898, "atom2_serNum": 1917, "donAcc_type": "standard", "distance": 2.918, "atom1_id": "///C/66/O", "atom2_id": "///C/70/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 242, "atom1_serNum": 1903, "atom2_serNum": 1922, "donAcc_type": "standard", "distance": 2.901, "atom1_id": "///C/67/O", "atom2_id": "///C/71/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 243, "atom1_serNum": 1907, "atom2_serNum": 1933, "donAcc_type": "standard", "distance": 3.232, "atom1_id": "///C/68/O", "atom2_id": "///C/72/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 244, "atom1_serNum": 1910, "atom2_serNum": 1912, "donAcc_type": "standard", "distance": 2.492, "atom1_id": "///C/68/OD1", "atom2_id": "///C/69/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 245, "atom1_serNum": 1915, "atom2_serNum": 1939, "donAcc_type": "questionable", "distance": 2.751, "atom1_id": "///C/69/O", "atom2_id": "///C/72/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 246, "atom1_serNum": 1925, "atom2_serNum": 1949, "donAcc_type": "standard", "distance": 3.210, "atom1_id": "///C/71/O", "atom2_id": "///C/74/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 247, "atom1_serNum": 1931, "atom2_serNum": 1961, "donAcc_type": "standard", "distance": 3.157, "atom1_id": "///C/71/NH1", "atom2_id": "///C/75/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 248, "atom1_serNum": 1939, "atom2_serNum": 1941, "donAcc_type": "standard", "distance": 2.933, "atom1_id": "///C/72/OD1", "atom2_id": "///C/73/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 249, "atom1_serNum": 1970, "atom2_serNum": 2519, "donAcc_type": "standard", "distance": 3.945, "atom1_id": "///C/76/O", "atom2_id": "///D/53/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 250, "atom1_serNum": 1977, "atom2_serNum": 2025, "donAcc_type": "acceptable", "distance": 3.961, "atom1_id": "///C/77/O", "atom2_id": "///C/82/ND1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 251, "atom1_serNum": 1996, "atom2_serNum": 2019, "donAcc_type": "standard", "distance": 3.107, "atom1_id": "///C/79/O", "atom2_id": "///C/82/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 252, "atom1_serNum": 1996, "atom2_serNum": 2029, "donAcc_type": "standard", "distance": 3.570, "atom1_id": "///C/79/O", "atom2_id": "///C/83/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 253, "atom1_serNum": 2004, "atom2_serNum": 2037, "donAcc_type": "standard", "distance": 2.927, "atom1_id": "///C/80/O", "atom2_id": "///C/84/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 254, "atom1_serNum": 2011, "atom2_serNum": 2046, "donAcc_type": "standard", "distance": 2.887, "atom1_id": "///C/81/O", "atom2_id": "///C/85/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 255, "atom1_serNum": 2017, "atom2_serNum": 2215, "donAcc_type": "standard", "distance": 3.138, "atom1_id": "///C/81/NH1", "atom2_id": "///C/107/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 256, "atom1_serNum": 2018, "atom2_serNum": 2207, "donAcc_type": "standard", "distance": 2.768, "atom1_id": "///C/81/NH2", "atom2_id": "///C/105/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 257, "atom1_serNum": 2018, "atom2_serNum": 2215, "donAcc_type": "standard", "distance": 3.325, "atom1_id": "///C/81/NH2", "atom2_id": "///C/107/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 258, "atom1_serNum": 2022, "atom2_serNum": 2054, "donAcc_type": "standard", "distance": 2.897, "atom1_id": "///C/82/O", "atom2_id": "///C/86/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 259, "atom1_serNum": 2032, "atom2_serNum": 2059, "donAcc_type": "standard", "distance": 2.916, "atom1_id": "///C/83/O", "atom2_id": "///C/87/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 260, "atom1_serNum": 2040, "atom2_serNum": 2067, "donAcc_type": "standard", "distance": 2.905, "atom1_id": "///C/84/O", "atom2_id": "///C/88/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 261, "atom1_serNum": 2045, "atom2_serNum": 2211, "donAcc_type": "standard", "distance": 2.372, "atom1_id": "///C/84/NE2", "atom2_id": "///C/106/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 262, "atom1_serNum": 2049, "atom2_serNum": 2078, "donAcc_type": "standard", "distance": 3.086, "atom1_id": "///C/85/O", "atom2_id": "///C/89/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 263, "atom1_serNum": 2062, "atom2_serNum": 2127, "donAcc_type": "standard", "distance": 3.000, "atom1_id": "///C/87/O", "atom2_id": "///C/94/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 264, "atom1_serNum": 2070, "atom2_serNum": 2127, "donAcc_type": "standard", "distance": 2.811, "atom1_id": "///C/88/O", "atom2_id": "///C/94/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 265, "atom1_serNum": 2076, "atom2_serNum": 2171, "donAcc_type": "standard", "distance": 3.616, "atom1_id": "///C/88/NH1", "atom2_id": "///C/100/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 266, "atom1_serNum": 2077, "atom2_serNum": 2126, "donAcc_type": "standard", "distance": 2.925, "atom1_id": "///C/88/NH2", "atom2_id": "///C/94/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 267, "atom1_serNum": 2084, "atom2_serNum": 2086, "donAcc_type": "standard", "distance": 3.081, "atom1_id": "///C/89/OD1", "atom2_id": "///C/90/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 268, "atom1_serNum": 2089, "atom2_serNum": 2120, "donAcc_type": "standard", "distance": 3.190, "atom1_id": "///C/90/O", "atom2_id": "///C/94/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 269, "atom1_serNum": 2089, "atom2_serNum": 2127, "donAcc_type": "standard", "distance": 2.428, "atom1_id": "///C/90/O", "atom2_id": "///C/94/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 270, "atom1_serNum": 2092, "atom2_serNum": 2094, "donAcc_type": "standard", "distance": 3.078, "atom1_id": "///C/90/OD1", "atom2_id": "///C/91/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 271, "atom1_serNum": 2106, "atom2_serNum": 2137, "donAcc_type": "standard", "distance": 2.907, "atom1_id": "///C/92/O", "atom2_id": "///C/96/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 272, "atom1_serNum": 2115, "atom2_serNum": 2145, "donAcc_type": "standard", "distance": 2.660, "atom1_id": "///C/93/O", "atom2_id": "///C/97/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 273, "atom1_serNum": 2175, "atom2_serNum": 4497, "donAcc_type": "standard", "distance": 3.413, "atom1_id": "///C/101/N", "atom2_id": "///F/96/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 274, "atom1_serNum": 2185, "atom2_serNum": 2204, "donAcc_type": "standard", "distance": 3.542, "atom1_id": "///C/102/O", "atom2_id": "///C/105/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 275, "atom1_serNum": 2240, "atom2_serNum": 2242, "donAcc_type": "standard", "distance": 3.223, "atom1_id": "///C/110/OD1", "atom2_id": "///C/111/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 276, "atom1_serNum": 2240, "atom2_serNum": 2258, "donAcc_type": "standard", "distance": 2.775, "atom1_id": "///C/110/OD1", "atom2_id": "///C/112/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 277, "atom1_serNum": 2262, "atom2_serNum": 2279, "donAcc_type": "standard", "distance": 3.198, "atom1_id": "///C/113/O", "atom2_id": "///C/116/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 278, "atom1_serNum": 2262, "atom2_serNum": 2302, "donAcc_type": "standard", "distance": 2.513, "atom1_id": "///C/113/O", "atom2_id": "///C/118/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 279, "atom1_serNum": 2282, "atom2_serNum": 2294, "donAcc_type": "standard", "distance": 2.760, "atom1_id": "///C/116/O", "atom2_id": "///C/118/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 280, "atom1_serNum": 2282, "atom2_serNum": 2302, "donAcc_type": "standard", "distance": 2.414, "atom1_id": "///C/116/O", "atom2_id": "///C/118/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 281, "atom1_serNum": 2355, "atom2_serNum": 6762, "donAcc_type": "standard", "distance": 3.592, "atom1_id": "///D/33/NH1", "atom2_id": "///I/44/O4'", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 282, "atom1_serNum": 2384, "atom2_serNum": 2419, "donAcc_type": "standard", "distance": 3.220, "atom1_id": "///D/37/O", "atom2_id": "///D/41/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 283, "atom1_serNum": 2396, "atom2_serNum": 2426, "donAcc_type": "standard", "distance": 2.900, "atom1_id": "///D/38/O", "atom2_id": "///D/42/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 284, "atom1_serNum": 2402, "atom2_serNum": 2438, "donAcc_type": "standard", "distance": 2.889, "atom1_id": "///D/39/O", "atom2_id": "///D/43/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 285, "atom1_serNum": 2410, "atom2_serNum": 2447, "donAcc_type": "standard", "distance": 2.943, "atom1_id": "///D/40/O", "atom2_id": "///D/44/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 286, "atom1_serNum": 2422, "atom2_serNum": 2454, "donAcc_type": "standard", "distance": 2.974, "atom1_id": "///D/41/O", "atom2_id": "///D/45/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 287, "atom1_serNum": 2429, "atom2_serNum": 2462, "donAcc_type": "standard", "distance": 3.486, "atom1_id": "///D/42/O", "atom2_id": "///D/46/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 288, "atom1_serNum": 2437, "atom2_serNum": 6619, "donAcc_type": "acceptable", "distance": 3.353, "atom1_id": "///D/42/OH", "atom2_id": "///I/37/OP1", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 289, "atom1_serNum": 2441, "atom2_serNum": 2462, "donAcc_type": "standard", "distance": 3.069, "atom1_id": "///D/43/O", "atom2_id": "///D/46/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 290, "atom1_serNum": 2457, "atom2_serNum": 2487, "donAcc_type": "standard", "distance": 3.164, "atom1_id": "///D/45/O", "atom2_id": "///D/49/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 291, "atom1_serNum": 2470, "atom2_serNum": 2500, "donAcc_type": "standard", "distance": 2.429, "atom1_id": "///D/46/NZ", "atom2_id": "///D/50/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 292, "atom1_serNum": 2504, "atom2_serNum": 2510, "donAcc_type": "standard", "distance": 2.607, "atom1_id": "///D/51/N", "atom2_id": "///D/51/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 293, "atom1_serNum": 2510, "atom2_serNum": 2512, "donAcc_type": "standard", "distance": 2.894, "atom1_id": "///D/51/OD1", "atom2_id": "///D/52/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 294, "atom1_serNum": 2534, "atom2_serNum": 2557, "donAcc_type": "standard", "distance": 3.961, "atom1_id": "///D/55/O", "atom2_id": "///D/59/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 295, "atom1_serNum": 2540, "atom2_serNum": 2565, "donAcc_type": "standard", "distance": 3.985, "atom1_id": "///D/56/O", "atom2_id": "///D/60/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 296, "atom1_serNum": 2555, "atom2_serNum": 2577, "donAcc_type": "standard", "distance": 2.928, "atom1_id": "///D/58/O", "atom2_id": "///D/62/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 297, "atom1_serNum": 2560, "atom2_serNum": 2585, "donAcc_type": "standard", "distance": 2.865, "atom1_id": "///D/59/O", "atom2_id": "///D/63/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 298, "atom1_serNum": 2568, "atom2_serNum": 2593, "donAcc_type": "standard", "distance": 2.923, "atom1_id": "///D/60/O", "atom2_id": "///D/64/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 299, "atom1_serNum": 2568, "atom2_serNum": 2598, "donAcc_type": "acceptable", "distance": 2.745, "atom1_id": "///D/60/O", "atom2_id": "///D/64/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 300, "atom1_serNum": 2572, "atom2_serNum": 2599, "donAcc_type": "standard", "distance": 2.899, "atom1_id": "///D/61/O", "atom2_id": "///D/65/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 301, "atom1_serNum": 2580, "atom2_serNum": 2610, "donAcc_type": "standard", "distance": 2.916, "atom1_id": "///D/62/O", "atom2_id": "///D/66/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 302, "atom1_serNum": 2588, "atom2_serNum": 2617, "donAcc_type": "standard", "distance": 2.896, "atom1_id": "///D/63/O", "atom2_id": "///D/67/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 303, "atom1_serNum": 2596, "atom2_serNum": 2625, "donAcc_type": "standard", "distance": 2.900, "atom1_id": "///D/64/O", "atom2_id": "///D/68/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 304, "atom1_serNum": 2598, "atom2_serNum": 4521, "donAcc_type": "acceptable", "distance": 3.266, "atom1_id": "///D/64/OG", "atom2_id": "///F/99/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 305, "atom1_serNum": 2598, "atom2_serNum": 4536, "donAcc_type": "acceptable", "distance": 3.173, "atom1_id": "///D/64/OG", "atom2_id": "///F/101/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 306, "atom1_serNum": 2598, "atom2_serNum": 4539, "donAcc_type": "acceptable", "distance": 2.951, "atom1_id": "///D/64/OG", "atom2_id": "///F/101/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 307, "atom1_serNum": 2602, "atom2_serNum": 2633, "donAcc_type": "standard", "distance": 2.920, "atom1_id": "///D/65/O", "atom2_id": "///D/69/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 308, "atom1_serNum": 2613, "atom2_serNum": 2641, "donAcc_type": "standard", "distance": 2.886, "atom1_id": "///D/66/O", "atom2_id": "///D/70/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 309, "atom1_serNum": 2620, "atom2_serNum": 2652, "donAcc_type": "standard", "distance": 2.898, "atom1_id": "///D/67/O", "atom2_id": "///D/71/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 310, "atom1_serNum": 2624, "atom2_serNum": 4543, "donAcc_type": "standard", "distance": 2.530, "atom1_id": "///D/67/ND2", "atom2_id": "///F/102/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 311, "atom1_serNum": 2628, "atom2_serNum": 2660, "donAcc_type": "questionable", "distance": 3.079, "atom1_id": "///D/68/O", "atom2_id": "///D/71/OE2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 312, "atom1_serNum": 2628, "atom2_serNum": 2661, "donAcc_type": "standard", "distance": 2.932, "atom1_id": "///D/68/O", "atom2_id": "///D/72/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 313, "atom1_serNum": 2632, "atom2_serNum": 2670, "donAcc_type": "standard", "distance": 2.385, "atom1_id": "///D/68/OD2", "atom2_id": "///D/72/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 314, "atom1_serNum": 2632, "atom2_serNum": 2671, "donAcc_type": "standard", "distance": 2.932, "atom1_id": "///D/68/OD2", "atom2_id": "///D/72/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 315, "atom1_serNum": 2632, "atom2_serNum": 4520, "donAcc_type": "acceptable", "distance": 2.958, "atom1_id": "///D/68/OD2", "atom2_id": "///F/98/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 316, "atom1_serNum": 2636, "atom2_serNum": 2672, "donAcc_type": "standard", "distance": 2.918, "atom1_id": "///D/69/O", "atom2_id": "///D/73/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 317, "atom1_serNum": 2644, "atom2_serNum": 2680, "donAcc_type": "standard", "distance": 2.929, "atom1_id": "///D/70/O", "atom2_id": "///D/74/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 318, "atom1_serNum": 2655, "atom2_serNum": 2685, "donAcc_type": "standard", "distance": 2.895, "atom1_id": "///D/71/O", "atom2_id": "///D/75/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 319, "atom1_serNum": 2664, "atom2_serNum": 2685, "donAcc_type": "standard", "distance": 2.745, "atom1_id": "///D/72/O", "atom2_id": "///D/75/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 320, "atom1_serNum": 2664, "atom2_serNum": 2689, "donAcc_type": "standard", "distance": 2.968, "atom1_id": "///D/72/O", "atom2_id": "///D/76/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 321, "atom1_serNum": 2675, "atom2_serNum": 2698, "donAcc_type": "standard", "distance": 2.915, "atom1_id": "///D/73/O", "atom2_id": "///D/77/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 322, "atom1_serNum": 2683, "atom2_serNum": 2703, "donAcc_type": "standard", "distance": 2.897, "atom1_id": "///D/74/O", "atom2_id": "///D/78/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 323, "atom1_serNum": 2688, "atom2_serNum": 2709, "donAcc_type": "standard", "distance": 2.901, "atom1_id": "///D/75/O", "atom2_id": "///D/79/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 324, "atom1_serNum": 2689, "atom2_serNum": 2696, "donAcc_type": "standard", "distance": 3.143, "atom1_id": "///D/76/N", "atom2_id": "///D/76/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 325, "atom1_serNum": 2692, "atom2_serNum": 2720, "donAcc_type": "standard", "distance": 2.900, "atom1_id": "///D/76/O", "atom2_id": "///D/80/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 326, "atom1_serNum": 2701, "atom2_serNum": 2728, "donAcc_type": "standard", "distance": 2.947, "atom1_id": "///D/77/O", "atom2_id": "///D/81/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 327, "atom1_serNum": 2706, "atom2_serNum": 2733, "donAcc_type": "standard", "distance": 2.878, "atom1_id": "///D/78/O", "atom2_id": "///D/82/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 328, "atom1_serNum": 2712, "atom2_serNum": 2743, "donAcc_type": "standard", "distance": 2.905, "atom1_id": "///D/79/O", "atom2_id": "///D/83/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 329, "atom1_serNum": 2716, "atom2_serNum": 2754, "donAcc_type": "acceptable", "distance": 3.293, "atom1_id": "///D/79/NE", "atom2_id": "///D/83/OH", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 330, "atom1_serNum": 2723, "atom2_serNum": 2755, "donAcc_type": "standard", "distance": 2.931, "atom1_id": "///D/80/O", "atom2_id": "///D/84/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 331, "atom1_serNum": 2731, "atom2_serNum": 2763, "donAcc_type": "standard", "distance": 2.939, "atom1_id": "///D/81/O", "atom2_id": "///D/85/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 332, "atom1_serNum": 2731, "atom2_serNum": 2772, "donAcc_type": "standard", "distance": 3.211, "atom1_id": "///D/81/O", "atom2_id": "///D/86/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 333, "atom1_serNum": 2736, "atom2_serNum": 2763, "donAcc_type": "standard", "distance": 3.015, "atom1_id": "///D/82/O", "atom2_id": "///D/85/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 334, "atom1_serNum": 2736, "atom2_serNum": 2771, "donAcc_type": "standard", "distance": 2.817, "atom1_id": "///D/82/O", "atom2_id": "///D/85/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 335, "atom1_serNum": 2746, "atom2_serNum": 2771, "donAcc_type": "standard", "distance": 2.949, "atom1_id": "///D/83/O", "atom2_id": "///D/85/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 336, "atom1_serNum": 2782, "atom2_serNum": 2788, "donAcc_type": "acceptable", "distance": 2.969, "atom1_id": "///D/86/NH2", "atom2_id": "///D/87/OG", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 337, "atom1_serNum": 2804, "atom2_serNum": 2836, "donAcc_type": "standard", "distance": 2.379, "atom1_id": "///D/90/N", "atom2_id": "///D/93/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 338, "atom1_serNum": 2814, "atom2_serNum": 2845, "donAcc_type": "standard", "distance": 2.908, "atom1_id": "///D/91/O", "atom2_id": "///D/95/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 339, "atom1_serNum": 2820, "atom2_serNum": 2854, "donAcc_type": "standard", "distance": 2.902, "atom1_id": "///D/92/O", "atom2_id": "///D/96/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 340, "atom1_serNum": 2820, "atom2_serNum": 2859, "donAcc_type": "acceptable", "distance": 3.009, "atom1_id": "///D/92/O", "atom2_id": "///D/96/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 341, "atom1_serNum": 2828, "atom2_serNum": 2835, "donAcc_type": "standard", "distance": 2.590, "atom1_id": "///D/93/N", "atom2_id": "///D/93/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 342, "atom1_serNum": 2831, "atom2_serNum": 2861, "donAcc_type": "standard", "distance": 2.846, "atom1_id": "///D/93/O", "atom2_id": "///D/97/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 343, "atom1_serNum": 2840, "atom2_serNum": 2866, "donAcc_type": "standard", "distance": 2.885, "atom1_id": "///D/94/O", "atom2_id": "///D/98/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 344, "atom1_serNum": 2848, "atom2_serNum": 2873, "donAcc_type": "standard", "distance": 2.965, "atom1_id": "///D/95/O", "atom2_id": "///D/99/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 345, "atom1_serNum": 2852, "atom2_serNum": 2882, "donAcc_type": "standard", "distance": 2.880, "atom1_id": "///D/95/OE1", "atom2_id": "///D/99/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 346, "atom1_serNum": 2853, "atom2_serNum": 2996, "donAcc_type": "acceptable", "distance": 3.789, "atom1_id": "///D/95/NE2", "atom2_id": "///D/115/OG1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 347, "atom1_serNum": 2857, "atom2_serNum": 2884, "donAcc_type": "standard", "distance": 2.860, "atom1_id": "///D/96/O", "atom2_id": "///D/100/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 348, "atom1_serNum": 2864, "atom2_serNum": 2892, "donAcc_type": "standard", "distance": 2.875, "atom1_id": "///D/97/O", "atom2_id": "///D/101/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 349, "atom1_serNum": 2895, "atom2_serNum": 2908, "donAcc_type": "standard", "distance": 3.242, "atom1_id": "///D/101/O", "atom2_id": "///D/103/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 350, "atom1_serNum": 2918, "atom2_serNum": 2936, "donAcc_type": "standard", "distance": 2.938, "atom1_id": "///D/104/O", "atom2_id": "///D/107/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 351, "atom1_serNum": 2922, "atom2_serNum": 2950, "donAcc_type": "standard", "distance": 2.789, "atom1_id": "///D/105/O", "atom2_id": "///D/109/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 352, "atom1_serNum": 2926, "atom2_serNum": 2959, "donAcc_type": "standard", "distance": 2.574, "atom1_id": "///D/105/OE1", "atom2_id": "///D/109/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 353, "atom1_serNum": 2931, "atom2_serNum": 2960, "donAcc_type": "standard", "distance": 2.954, "atom1_id": "///D/106/O", "atom2_id": "///D/110/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 354, "atom1_serNum": 2939, "atom2_serNum": 2965, "donAcc_type": "standard", "distance": 2.851, "atom1_id": "///D/107/O", "atom2_id": "///D/111/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 355, "atom1_serNum": 2944, "atom2_serNum": 2972, "donAcc_type": "standard", "distance": 2.775, "atom1_id": "///D/108/O", "atom2_id": "///D/112/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 356, "atom1_serNum": 2953, "atom2_serNum": 2978, "donAcc_type": "standard", "distance": 3.251, "atom1_id": "///D/109/O", "atom2_id": "///D/113/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 357, "atom1_serNum": 2963, "atom2_serNum": 2987, "donAcc_type": "standard", "distance": 2.617, "atom1_id": "///D/110/O", "atom2_id": "///D/114/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 358, "atom1_serNum": 2968, "atom2_serNum": 2991, "donAcc_type": "standard", "distance": 2.428, "atom1_id": "///D/111/O", "atom2_id": "///D/115/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 359, "atom1_serNum": 2975, "atom2_serNum": 2998, "donAcc_type": "standard", "distance": 2.691, "atom1_id": "///D/112/O", "atom2_id": "///D/116/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 360, "atom1_serNum": 2981, "atom2_serNum": 3007, "donAcc_type": "standard", "distance": 2.658, "atom1_id": "///D/113/O", "atom2_id": "///D/117/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 361, "atom1_serNum": 2990, "atom2_serNum": 3012, "donAcc_type": "standard", "distance": 2.946, "atom1_id": "///D/114/O", "atom2_id": "///D/118/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 362, "atom1_serNum": 2994, "atom2_serNum": 3019, "donAcc_type": "standard", "distance": 2.932, "atom1_id": "///D/115/O", "atom2_id": "///D/119/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 363, "atom1_serNum": 3001, "atom2_serNum": 3024, "donAcc_type": "acceptable", "distance": 2.319, "atom1_id": "///D/116/O", "atom2_id": "///D/119/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 364, "atom1_serNum": 3001, "atom2_serNum": 3026, "donAcc_type": "standard", "distance": 2.808, "atom1_id": "///D/116/O", "atom2_id": "///D/120/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 365, "atom1_serNum": 3010, "atom2_serNum": 3035, "donAcc_type": "standard", "distance": 2.751, "atom1_id": "///D/117/O", "atom2_id": "///D/121/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 366, "atom1_serNum": 3015, "atom2_serNum": 3047, "donAcc_type": "standard", "distance": 2.760, "atom1_id": "///D/118/O", "atom2_id": "///D/122/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 367, "atom1_serNum": 3022, "atom2_serNum": 3047, "donAcc_type": "standard", "distance": 2.951, "atom1_id": "///D/119/O", "atom2_id": "///D/122/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 368, "atom1_serNum": 3022, "atom2_serNum": 3052, "donAcc_type": "acceptable", "distance": 2.274, "atom1_id": "///D/119/O", "atom2_id": "///D/122/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 369, "atom1_serNum": 3022, "atom2_serNum": 3054, "donAcc_type": "standard", "distance": 2.806, "atom1_id": "///D/119/O", "atom2_id": "///D/123/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 370, "atom1_serNum": 3029, "atom2_serNum": 3059, "donAcc_type": "acceptable", "distance": 2.709, "atom1_id": "///D/120/O", "atom2_id": "///D/123/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 371, "atom1_serNum": 3029, "atom2_serNum": 3060, "donAcc_type": "standard", "distance": 2.852, "atom1_id": "///D/120/O", "atom2_id": "///D/124/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 372, "atom1_serNum": 3074, "atom2_serNum": 12657, "donAcc_type": "standard", "distance": 3.237, "atom1_id": "///E/37/NZ", "atom2_id": "///J/161/O3'", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 373, "atom1_serNum": 3074, "atom2_serNum": 12672, "donAcc_type": "standard", "distance": 2.359, "atom1_id": "///E/37/NZ", "atom2_id": "///J/162/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 374, "atom1_serNum": 3091, "atom2_serNum": 12637, "donAcc_type": "standard", "distance": 3.770, "atom1_id": "///E/39/NE2", "atom2_id": "///J/160/O3'", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 375, "atom1_serNum": 3101, "atom2_serNum": 7885, "donAcc_type": "questionable", "distance": 3.427, "atom1_id": "///E/40/NH1", "atom2_id": "///I/98/N2", "atom_pair": "N:N", "residue_pair": "aa:nt" }, { "index": 376, "atom1_serNum": 3118, "atom2_serNum": 3137, "donAcc_type": "standard", "distance": 3.291, "atom1_id": "///E/42/O", "atom2_id": "///E/45/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 377, "atom1_serNum": 3147, "atom2_serNum": 3164, "donAcc_type": "standard", "distance": 2.887, "atom1_id": "///E/46/O", "atom2_id": "///E/49/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 378, "atom1_serNum": 3147, "atom2_serNum": 3182, "donAcc_type": "questionable", "distance": 2.638, "atom1_id": "///E/46/O", "atom2_id": "///E/50/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 379, "atom1_serNum": 3154, "atom2_serNum": 3184, "donAcc_type": "standard", "distance": 2.964, "atom1_id": "///E/47/O", "atom2_id": "///E/51/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 380, "atom1_serNum": 3159, "atom2_serNum": 3192, "donAcc_type": "standard", "distance": 2.923, "atom1_id": "///E/48/O", "atom2_id": "///E/52/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 381, "atom1_serNum": 3167, "atom2_serNum": 3203, "donAcc_type": "standard", "distance": 2.918, "atom1_id": "///E/49/O", "atom2_id": "///E/53/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 382, "atom1_serNum": 3175, "atom2_serNum": 3182, "donAcc_type": "standard", "distance": 2.678, "atom1_id": "///E/50/N", "atom2_id": "///E/50/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 383, "atom1_serNum": 3178, "atom2_serNum": 3214, "donAcc_type": "standard", "distance": 2.873, "atom1_id": "///E/50/O", "atom2_id": "///E/54/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 384, "atom1_serNum": 3183, "atom2_serNum": 4041, "donAcc_type": "standard", "distance": 2.844, "atom1_id": "///E/50/OE2", "atom2_id": "///F/39/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 385, "atom1_serNum": 3206, "atom2_serNum": 3235, "donAcc_type": "standard", "distance": 3.195, "atom1_id": "///E/53/O", "atom2_id": "///E/56/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 386, "atom1_serNum": 3217, "atom2_serNum": 3244, "donAcc_type": "standard", "distance": 3.133, "atom1_id": "///E/54/O", "atom2_id": "///E/57/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 387, "atom1_serNum": 3217, "atom2_serNum": 3247, "donAcc_type": "questionable", "distance": 2.933, "atom1_id": "///E/54/O", "atom2_id": "///E/57/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 388, "atom1_serNum": 3217, "atom2_serNum": 3249, "donAcc_type": "acceptable", "distance": 3.180, "atom1_id": "///E/54/O", "atom2_id": "///E/57/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 389, "atom1_serNum": 3217, "atom2_serNum": 4054, "donAcc_type": "standard", "distance": 3.520, "atom1_id": "///E/54/O", "atom2_id": "///F/40/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 390, "atom1_serNum": 3234, "atom2_serNum": 4048, "donAcc_type": "standard", "distance": 3.952, "atom1_id": "///E/55/NE2", "atom2_id": "///F/40/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 391, "atom1_serNum": 3257, "atom2_serNum": 3264, "donAcc_type": "standard", "distance": 2.730, "atom1_id": "///E/59/N", "atom2_id": "///E/59/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 392, "atom1_serNum": 3277, "atom2_serNum": 4019, "donAcc_type": "standard", "distance": 3.496, "atom1_id": "///E/61/O", "atom2_id": "///F/36/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 393, "atom1_serNum": 3285, "atom2_serNum": 3309, "donAcc_type": "standard", "distance": 2.918, "atom1_id": "///E/62/O", "atom2_id": "///E/64/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 394, "atom1_serNum": 3285, "atom2_serNum": 3548, "donAcc_type": "standard", "distance": 3.189, "atom1_id": "///E/62/O", "atom2_id": "///E/93/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 395, "atom1_serNum": 3293, "atom2_serNum": 3325, "donAcc_type": "standard", "distance": 3.623, "atom1_id": "///E/63/O", "atom2_id": "///E/67/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 396, "atom1_serNum": 3304, "atom2_serNum": 3336, "donAcc_type": "standard", "distance": 2.893, "atom1_id": "///E/64/O", "atom2_id": "///E/68/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 397, "atom1_serNum": 3313, "atom2_serNum": 3345, "donAcc_type": "standard", "distance": 2.956, "atom1_id": "///E/65/O", "atom2_id": "///E/69/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 398, "atom1_serNum": 3321, "atom2_serNum": 3356, "donAcc_type": "standard", "distance": 2.876, "atom1_id": "///E/66/O", "atom2_id": "///E/70/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 399, "atom1_serNum": 3328, "atom2_serNum": 3364, "donAcc_type": "standard", "distance": 2.900, "atom1_id": "///E/67/O", "atom2_id": "///E/71/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 400, "atom1_serNum": 3339, "atom2_serNum": 3371, "donAcc_type": "standard", "distance": 2.917, "atom1_id": "///E/68/O", "atom2_id": "///E/72/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 401, "atom1_serNum": 3343, "atom2_serNum": 3378, "donAcc_type": "standard", "distance": 3.672, "atom1_id": "///E/68/OE1", "atom2_id": "///E/72/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 402, "atom1_serNum": 3348, "atom2_serNum": 3382, "donAcc_type": "standard", "distance": 2.960, "atom1_id": "///E/69/O", "atom2_id": "///E/73/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 403, "atom1_serNum": 3359, "atom2_serNum": 3391, "donAcc_type": "standard", "distance": 2.877, "atom1_id": "///E/70/O", "atom2_id": "///E/74/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 404, "atom1_serNum": 3367, "atom2_serNum": 3399, "donAcc_type": "standard", "distance": 2.894, "atom1_id": "///E/71/O", "atom2_id": "///E/75/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 405, "atom1_serNum": 3374, "atom2_serNum": 3404, "donAcc_type": "standard", "distance": 2.927, "atom1_id": "///E/72/O", "atom2_id": "///E/76/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 406, "atom1_serNum": 3440, "atom2_serNum": 3444, "donAcc_type": "standard", "distance": 3.109, "atom1_id": "///E/79/NZ", "atom2_id": "///E/80/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 407, "atom1_serNum": 3440, "atom2_serNum": 3446, "donAcc_type": "acceptable", "distance": 3.140, "atom1_id": "///E/79/NZ", "atom2_id": "///E/80/OG1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 408, "atom1_serNum": 3464, "atom2_serNum": 4363, "donAcc_type": "standard", "distance": 3.809, "atom1_id": "///E/83/N", "atom2_id": "///F/79/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 409, "atom1_serNum": 3467, "atom2_serNum": 4376, "donAcc_type": "standard", "distance": 3.294, "atom1_id": "///E/83/O", "atom2_id": "///F/81/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 410, "atom1_serNum": 3486, "atom2_serNum": 4379, "donAcc_type": "standard", "distance": 3.790, "atom1_id": "///E/85/N", "atom2_id": "///F/81/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 411, "atom1_serNum": 3489, "atom2_serNum": 3512, "donAcc_type": "standard", "distance": 3.977, "atom1_id": "///E/85/O", "atom2_id": "///E/89/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 412, "atom1_serNum": 3498, "atom2_serNum": 3519, "donAcc_type": "standard", "distance": 3.889, "atom1_id": "///E/86/O", "atom2_id": "///E/90/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 413, "atom1_serNum": 3504, "atom2_serNum": 3527, "donAcc_type": "standard", "distance": 2.915, "atom1_id": "///E/87/O", "atom2_id": "///E/91/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 414, "atom1_serNum": 3510, "atom2_serNum": 3532, "donAcc_type": "standard", "distance": 2.917, "atom1_id": "///E/88/O", "atom2_id": "///E/92/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 415, "atom1_serNum": 3515, "atom2_serNum": 3540, "donAcc_type": "standard", "distance": 2.904, "atom1_id": "///E/89/O", "atom2_id": "///E/93/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 416, "atom1_serNum": 3522, "atom2_serNum": 3549, "donAcc_type": "standard", "distance": 2.931, "atom1_id": "///E/90/O", "atom2_id": "///E/94/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 417, "atom1_serNum": 3530, "atom2_serNum": 3556, "donAcc_type": "questionable", "distance": 2.817, "atom1_id": "///E/91/O", "atom2_id": "///E/94/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 418, "atom1_serNum": 3530, "atom2_serNum": 3558, "donAcc_type": "standard", "distance": 2.905, "atom1_id": "///E/91/O", "atom2_id": "///E/95/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 419, "atom1_serNum": 3535, "atom2_serNum": 3563, "donAcc_type": "standard", "distance": 2.903, "atom1_id": "///E/92/O", "atom2_id": "///E/96/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 420, "atom1_serNum": 3543, "atom2_serNum": 3569, "donAcc_type": "standard", "distance": 2.929, "atom1_id": "///E/93/O", "atom2_id": "///E/97/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 421, "atom1_serNum": 3572, "atom2_serNum": 3603, "donAcc_type": "standard", "distance": 3.534, "atom1_id": "///E/97/O", "atom2_id": "///E/101/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 422, "atom1_serNum": 3581, "atom2_serNum": 3610, "donAcc_type": "standard", "distance": 2.897, "atom1_id": "///E/98/O", "atom2_id": "///E/102/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 423, "atom1_serNum": 3586, "atom2_serNum": 3614, "donAcc_type": "standard", "distance": 2.931, "atom1_id": "///E/99/O", "atom2_id": "///E/103/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 424, "atom1_serNum": 3594, "atom2_serNum": 3818, "donAcc_type": "acceptable", "distance": 3.623, "atom1_id": "///E/99/OH", "atom2_id": "///E/128/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 425, "atom1_serNum": 3594, "atom2_serNum": 3863, "donAcc_type": "acceptable", "distance": 2.391, "atom1_id": "///E/99/OH", "atom2_id": "///E/133/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 426, "atom1_serNum": 3594, "atom2_serNum": 3864, "donAcc_type": "acceptable", "distance": 3.075, "atom1_id": "///E/99/OH", "atom2_id": "///E/133/OE2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 427, "atom1_serNum": 3598, "atom2_serNum": 3622, "donAcc_type": "standard", "distance": 2.912, "atom1_id": "///E/100/O", "atom2_id": "///E/104/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 428, "atom1_serNum": 3606, "atom2_serNum": 3640, "donAcc_type": "questionable", "distance": 2.665, "atom1_id": "///E/101/O", "atom2_id": "///E/105/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 429, "atom1_serNum": 3617, "atom2_serNum": 3650, "donAcc_type": "standard", "distance": 2.929, "atom1_id": "///E/103/O", "atom2_id": "///E/107/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 430, "atom1_serNum": 3625, "atom2_serNum": 3655, "donAcc_type": "acceptable", "distance": 2.575, "atom1_id": "///E/104/O", "atom2_id": "///E/107/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 431, "atom1_serNum": 3625, "atom2_serNum": 3657, "donAcc_type": "standard", "distance": 2.891, "atom1_id": "///E/104/O", "atom2_id": "///E/108/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 432, "atom1_serNum": 3633, "atom2_serNum": 3640, "donAcc_type": "standard", "distance": 2.549, "atom1_id": "///E/105/N", "atom2_id": "///E/105/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 433, "atom1_serNum": 3636, "atom2_serNum": 3665, "donAcc_type": "standard", "distance": 2.895, "atom1_id": "///E/105/O", "atom2_id": "///E/109/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 434, "atom1_serNum": 3645, "atom2_serNum": 3673, "donAcc_type": "standard", "distance": 2.930, "atom1_id": "///E/106/O", "atom2_id": "///E/110/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 435, "atom1_serNum": 3649, "atom2_serNum": 3850, "donAcc_type": "standard", "distance": 3.092, "atom1_id": "///E/106/OD2", "atom2_id": "///E/131/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 436, "atom1_serNum": 3653, "atom2_serNum": 3679, "donAcc_type": "standard", "distance": 2.894, "atom1_id": "///E/107/O", "atom2_id": "///E/111/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 437, "atom1_serNum": 3660, "atom2_serNum": 3684, "donAcc_type": "standard", "distance": 2.904, "atom1_id": "///E/108/O", "atom2_id": "///E/112/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 438, "atom1_serNum": 3668, "atom2_serNum": 3692, "donAcc_type": "standard", "distance": 2.899, "atom1_id": "///E/109/O", "atom2_id": "///E/113/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 439, "atom1_serNum": 3676, "atom2_serNum": 3702, "donAcc_type": "standard", "distance": 3.539, "atom1_id": "///E/110/O", "atom2_id": "///E/114/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 440, "atom1_serNum": 3682, "atom2_serNum": 3702, "donAcc_type": "standard", "distance": 3.157, "atom1_id": "///E/111/O", "atom2_id": "///E/114/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 441, "atom1_serNum": 3687, "atom2_serNum": 3707, "donAcc_type": "standard", "distance": 2.941, "atom1_id": "///E/112/O", "atom2_id": "///E/115/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 442, "atom1_serNum": 3725, "atom2_serNum": 3779, "donAcc_type": "standard", "distance": 3.845, "atom1_id": "///E/116/NH1", "atom2_id": "///E/123/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 443, "atom1_serNum": 3726, "atom2_serNum": 3737, "donAcc_type": "standard", "distance": 2.758, "atom1_id": "///E/116/NH2", "atom2_id": "///E/118/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 444, "atom1_serNum": 3744, "atom2_serNum": 4104, "donAcc_type": "acceptable", "distance": 3.407, "atom1_id": "///E/119/O", "atom2_id": "///F/47/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 445, "atom1_serNum": 3749, "atom2_serNum": 3780, "donAcc_type": "standard", "distance": 3.175, "atom1_id": "///E/120/N", "atom2_id": "///E/123/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 446, "atom1_serNum": 3752, "atom2_serNum": 3773, "donAcc_type": "standard", "distance": 3.017, "atom1_id": "///E/120/O", "atom2_id": "///E/123/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 447, "atom1_serNum": 3760, "atom2_serNum": 3789, "donAcc_type": "standard", "distance": 2.930, "atom1_id": "///E/121/O", "atom2_id": "///E/125/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 448, "atom1_serNum": 3767, "atom2_serNum": 3798, "donAcc_type": "standard", "distance": 2.874, "atom1_id": "///E/122/O", "atom2_id": "///E/126/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 449, "atom1_serNum": 3776, "atom2_serNum": 3806, "donAcc_type": "standard", "distance": 2.918, "atom1_id": "///E/123/O", "atom2_id": "///E/127/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 450, "atom1_serNum": 3784, "atom2_serNum": 3811, "donAcc_type": "standard", "distance": 2.910, "atom1_id": "///E/124/O", "atom2_id": "///E/128/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 451, "atom1_serNum": 3792, "atom2_serNum": 3822, "donAcc_type": "standard", "distance": 2.910, "atom1_id": "///E/125/O", "atom2_id": "///E/129/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 452, "atom1_serNum": 3797, "atom2_serNum": 4153, "donAcc_type": "standard", "distance": 2.795, "atom1_id": "///E/125/NE2", "atom2_id": "///F/53/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 453, "atom1_serNum": 3801, "atom2_serNum": 3833, "donAcc_type": "standard", "distance": 2.926, "atom1_id": "///E/126/O", "atom2_id": "///E/130/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 454, "atom1_serNum": 3809, "atom2_serNum": 3841, "donAcc_type": "standard", "distance": 2.915, "atom1_id": "///E/127/O", "atom2_id": "///E/131/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 455, "atom1_serNum": 3814, "atom2_serNum": 3856, "donAcc_type": "standard", "distance": 3.259, "atom1_id": "///E/128/O", "atom2_id": "///E/133/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 456, "atom1_serNum": 3814, "atom2_serNum": 3865, "donAcc_type": "standard", "distance": 3.457, "atom1_id": "///E/128/O", "atom2_id": "///E/134/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 457, "atom1_serNum": 3820, "atom2_serNum": 3863, "donAcc_type": "standard", "distance": 3.348, "atom1_id": "///E/128/NH1", "atom2_id": "///E/133/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 458, "atom1_serNum": 3825, "atom2_serNum": 3852, "donAcc_type": "standard", "distance": 3.224, "atom1_id": "///E/129/O", "atom2_id": "///E/132/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 459, "atom1_serNum": 3825, "atom2_serNum": 3879, "donAcc_type": "questionable", "distance": 2.871, "atom1_id": "///E/129/O", "atom2_id": "///E/135/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 460, "atom1_serNum": 3851, "atom2_serNum": 3864, "donAcc_type": "standard", "distance": 3.683, "atom1_id": "///E/131/NH2", "atom2_id": "///E/133/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 461, "atom1_serNum": 3886, "atom2_serNum": 3899, "donAcc_type": "standard", "distance": 3.104, "atom1_id": "///F/20/O", "atom2_id": "///F/22/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 462, "atom1_serNum": 3895, "atom2_serNum": 3917, "donAcc_type": "standard", "distance": 3.697, "atom1_id": "///F/21/O", "atom2_id": "///F/23/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 463, "atom1_serNum": 3929, "atom2_serNum": 3951, "donAcc_type": "standard", "distance": 3.038, "atom1_id": "///F/25/O", "atom2_id": "///F/28/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 464, "atom1_serNum": 3937, "atom2_serNum": 3955, "donAcc_type": "standard", "distance": 3.393, "atom1_id": "///F/26/O", "atom2_id": "///F/29/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 465, "atom1_serNum": 3954, "atom2_serNum": 3963, "donAcc_type": "standard", "distance": 3.042, "atom1_id": "///F/28/O", "atom2_id": "///F/30/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 466, "atom1_serNum": 3958, "atom2_serNum": 4171, "donAcc_type": "standard", "distance": 3.504, "atom1_id": "///F/29/O", "atom2_id": "///F/55/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 467, "atom1_serNum": 3966, "atom2_serNum": 3991, "donAcc_type": "standard", "distance": 3.240, "atom1_id": "///F/30/O", "atom2_id": "///F/34/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 468, "atom1_serNum": 3973, "atom2_serNum": 3999, "donAcc_type": "standard", "distance": 2.912, "atom1_id": "///F/31/O", "atom2_id": "///F/35/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 469, "atom1_serNum": 3978, "atom2_serNum": 4009, "donAcc_type": "questionable", "distance": 3.215, "atom1_id": "///F/31/NZ", "atom2_id": "///F/35/NH2", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 470, "atom1_serNum": 3982, "atom2_serNum": 4010, "donAcc_type": "standard", "distance": 2.871, "atom1_id": "///F/32/O", "atom2_id": "///F/36/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 471, "atom1_serNum": 3989, "atom2_serNum": 4021, "donAcc_type": "standard", "distance": 2.926, "atom1_id": "///F/33/O", "atom2_id": "///F/37/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 472, "atom1_serNum": 3994, "atom2_serNum": 4029, "donAcc_type": "standard", "distance": 2.898, "atom1_id": "///F/34/O", "atom2_id": "///F/38/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 473, "atom1_serNum": 4002, "atom2_serNum": 4034, "donAcc_type": "standard", "distance": 2.888, "atom1_id": "///F/35/O", "atom2_id": "///F/39/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 474, "atom1_serNum": 4008, "atom2_serNum": 7867, "donAcc_type": "standard", "distance": 2.954, "atom1_id": "///F/35/NH1", "atom2_id": "///I/98/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 475, "atom1_serNum": 4008, "atom2_serNum": 7868, "donAcc_type": "standard", "distance": 3.077, "atom1_id": "///F/35/NH1", "atom2_id": "///I/98/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 476, "atom1_serNum": 4009, "atom2_serNum": 7868, "donAcc_type": "standard", "distance": 3.037, "atom1_id": "///F/35/NH2", "atom2_id": "///I/98/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 477, "atom1_serNum": 4013, "atom2_serNum": 4045, "donAcc_type": "standard", "distance": 2.908, "atom1_id": "///F/36/O", "atom2_id": "///F/40/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 478, "atom1_serNum": 4024, "atom2_serNum": 4056, "donAcc_type": "standard", "distance": 3.325, "atom1_id": "///F/37/O", "atom2_id": "///F/41/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 479, "atom1_serNum": 4032, "atom2_serNum": 4064, "donAcc_type": "standard", "distance": 3.318, "atom1_id": "///F/38/O", "atom2_id": "///F/43/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 480, "atom1_serNum": 4037, "atom2_serNum": 4060, "donAcc_type": "standard", "distance": 3.091, "atom1_id": "///F/39/O", "atom2_id": "///F/42/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 481, "atom1_serNum": 4044, "atom2_serNum": 4067, "donAcc_type": "standard", "distance": 2.763, "atom1_id": "///F/39/NH2", "atom2_id": "///F/43/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 482, "atom1_serNum": 4044, "atom2_serNum": 4074, "donAcc_type": "standard", "distance": 2.538, "atom1_id": "///F/39/NH2", "atom2_id": "///F/44/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 483, "atom1_serNum": 4120, "atom2_serNum": 4155, "donAcc_type": "standard", "distance": 2.982, "atom1_id": "///F/50/O", "atom2_id": "///F/54/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 484, "atom1_serNum": 4128, "atom2_serNum": 4160, "donAcc_type": "acceptable", "distance": 2.552, "atom1_id": "///F/51/O", "atom2_id": "///F/54/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 485, "atom1_serNum": 4128, "atom2_serNum": 4162, "donAcc_type": "standard", "distance": 2.922, "atom1_id": "///F/51/O", "atom2_id": "///F/55/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 486, "atom1_serNum": 4137, "atom2_serNum": 4145, "donAcc_type": "standard", "distance": 2.737, "atom1_id": "///F/52/N", "atom2_id": "///F/52/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 487, "atom1_serNum": 4140, "atom2_serNum": 4173, "donAcc_type": "standard", "distance": 2.908, "atom1_id": "///F/52/O", "atom2_id": "///F/56/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 488, "atom1_serNum": 4149, "atom2_serNum": 4177, "donAcc_type": "standard", "distance": 2.892, "atom1_id": "///F/53/O", "atom2_id": "///F/57/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 489, "atom1_serNum": 4158, "atom2_serNum": 4184, "donAcc_type": "standard", "distance": 2.942, "atom1_id": "///F/54/O", "atom2_id": "///F/58/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 490, "atom1_serNum": 4176, "atom2_serNum": 4192, "donAcc_type": "standard", "distance": 3.207, "atom1_id": "///F/56/O", "atom2_id": "///F/59/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 491, "atom1_serNum": 4180, "atom2_serNum": 4208, "donAcc_type": "standard", "distance": 3.980, "atom1_id": "///F/57/O", "atom2_id": "///F/61/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 492, "atom1_serNum": 4187, "atom2_serNum": 4219, "donAcc_type": "standard", "distance": 2.949, "atom1_id": "///F/58/O", "atom2_id": "///F/62/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 493, "atom1_serNum": 4195, "atom2_serNum": 4227, "donAcc_type": "standard", "distance": 2.899, "atom1_id": "///F/59/O", "atom2_id": "///F/63/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 494, "atom1_serNum": 4204, "atom2_serNum": 4236, "donAcc_type": "standard", "distance": 2.917, "atom1_id": "///F/60/O", "atom2_id": "///F/64/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 495, "atom1_serNum": 4211, "atom2_serNum": 4244, "donAcc_type": "standard", "distance": 2.954, "atom1_id": "///F/61/O", "atom2_id": "///F/65/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 496, "atom1_serNum": 4222, "atom2_serNum": 4251, "donAcc_type": "standard", "distance": 2.925, "atom1_id": "///F/62/O", "atom2_id": "///F/66/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 497, "atom1_serNum": 4230, "atom2_serNum": 4259, "donAcc_type": "standard", "distance": 2.893, "atom1_id": "///F/63/O", "atom2_id": "///F/67/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 498, "atom1_serNum": 4239, "atom2_serNum": 4270, "donAcc_type": "standard", "distance": 2.972, "atom1_id": "///F/64/O", "atom2_id": "///F/68/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 499, "atom1_serNum": 4242, "atom2_serNum": 4269, "donAcc_type": "standard", "distance": 2.996, "atom1_id": "///F/64/OD1", "atom2_id": "///F/67/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 500, "atom1_serNum": 4247, "atom2_serNum": 4278, "donAcc_type": "standard", "distance": 2.936, "atom1_id": "///F/65/O", "atom2_id": "///F/69/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 501, "atom1_serNum": 4254, "atom2_serNum": 4283, "donAcc_type": "standard", "distance": 2.843, "atom1_id": "///F/66/O", "atom2_id": "///F/70/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 502, "atom1_serNum": 4262, "atom2_serNum": 4290, "donAcc_type": "standard", "distance": 2.921, "atom1_id": "///F/67/O", "atom2_id": "///F/71/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 503, "atom1_serNum": 4262, "atom2_serNum": 4295, "donAcc_type": "acceptable", "distance": 2.705, "atom1_id": "///F/67/O", "atom2_id": "///F/71/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 504, "atom1_serNum": 4273, "atom2_serNum": 4297, "donAcc_type": "standard", "distance": 2.964, "atom1_id": "///F/68/O", "atom2_id": "///F/72/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 505, "atom1_serNum": 4281, "atom2_serNum": 4309, "donAcc_type": "standard", "distance": 2.908, "atom1_id": "///F/69/O", "atom2_id": "///F/73/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 506, "atom1_serNum": 4281, "atom2_serNum": 4314, "donAcc_type": "acceptable", "distance": 2.724, "atom1_id": "///F/69/O", "atom2_id": "///F/73/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 507, "atom1_serNum": 4286, "atom2_serNum": 4316, "donAcc_type": "standard", "distance": 2.860, "atom1_id": "///F/70/O", "atom2_id": "///F/74/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 508, "atom1_serNum": 4293, "atom2_serNum": 4325, "donAcc_type": "standard", "distance": 2.949, "atom1_id": "///F/71/O", "atom2_id": "///F/75/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 509, "atom1_serNum": 4300, "atom2_serNum": 4335, "donAcc_type": "standard", "distance": 3.438, "atom1_id": "///F/72/O", "atom2_id": "///F/76/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 510, "atom1_serNum": 4308, "atom2_serNum": 5745, "donAcc_type": "acceptable", "distance": 3.805, "atom1_id": "///F/72/OH", "atom2_id": "///H/76/OE2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 511, "atom1_serNum": 4312, "atom2_serNum": 4349, "donAcc_type": "standard", "distance": 3.545, "atom1_id": "///F/73/O", "atom2_id": "///F/78/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 512, "atom1_serNum": 4319, "atom2_serNum": 5874, "donAcc_type": "standard", "distance": 2.787, "atom1_id": "///F/74/O", "atom2_id": "///H/92/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 513, "atom1_serNum": 4328, "atom2_serNum": 5874, "donAcc_type": "standard", "distance": 3.158, "atom1_id": "///F/75/O", "atom2_id": "///H/92/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 514, "atom1_serNum": 4328, "atom2_serNum": 5875, "donAcc_type": "standard", "distance": 2.446, "atom1_id": "///F/75/O", "atom2_id": "///H/92/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 515, "atom1_serNum": 4331, "atom2_serNum": 5907, "donAcc_type": "acceptable", "distance": 2.836, "atom1_id": "///F/75/ND1", "atom2_id": "///H/96/OG1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 516, "atom1_serNum": 4358, "atom2_serNum": 4409, "donAcc_type": "standard", "distance": 3.348, "atom1_id": "///F/78/NH1", "atom2_id": "///F/85/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 517, "atom1_serNum": 4359, "atom2_serNum": 4372, "donAcc_type": "standard", "distance": 3.425, "atom1_id": "///F/78/NH2", "atom2_id": "///F/80/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 518, "atom1_serNum": 4359, "atom2_serNum": 4410, "donAcc_type": "standard", "distance": 3.703, "atom1_id": "///F/78/NH2", "atom2_id": "///F/85/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 519, "atom1_serNum": 4360, "atom2_serNum": 8281, "donAcc_type": "standard", "distance": 3.812, "atom1_id": "///F/79/N", "atom2_id": "///I/118/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 520, "atom1_serNum": 4386, "atom2_serNum": 4411, "donAcc_type": "standard", "distance": 3.654, "atom1_id": "///F/82/O", "atom2_id": "///F/86/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 521, "atom1_serNum": 4393, "atom2_serNum": 4418, "donAcc_type": "standard", "distance": 2.914, "atom1_id": "///F/83/O", "atom2_id": "///F/87/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 522, "atom1_serNum": 4398, "atom2_serNum": 4425, "donAcc_type": "standard", "distance": 2.948, "atom1_id": "///F/84/O", "atom2_id": "///F/88/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 523, "atom1_serNum": 4406, "atom2_serNum": 4437, "donAcc_type": "standard", "distance": 2.899, "atom1_id": "///F/85/O", "atom2_id": "///F/89/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 524, "atom1_serNum": 4414, "atom2_serNum": 4442, "donAcc_type": "standard", "distance": 2.905, "atom1_id": "///F/86/O", "atom2_id": "///F/90/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 525, "atom1_serNum": 4421, "atom2_serNum": 4450, "donAcc_type": "standard", "distance": 2.917, "atom1_id": "///F/87/O", "atom2_id": "///F/91/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 526, "atom1_serNum": 4436, "atom2_serNum": 4544, "donAcc_type": "acceptable", "distance": 2.812, "atom1_id": "///F/88/OH", "atom2_id": "///F/102/OXT", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 527, "atom1_serNum": 4445, "atom2_serNum": 4483, "donAcc_type": "standard", "distance": 3.141, "atom1_id": "///F/90/O", "atom2_id": "///F/95/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 528, "atom1_serNum": 4453, "atom2_serNum": 4479, "donAcc_type": "standard", "distance": 3.368, "atom1_id": "///F/91/O", "atom2_id": "///F/94/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 529, "atom1_serNum": 4458, "atom2_serNum": 5802, "donAcc_type": "acceptable", "distance": 2.570, "atom1_id": "///F/91/NZ", "atom2_id": "///H/83/OH", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 530, "atom1_serNum": 4466, "atom2_serNum": 5744, "donAcc_type": "standard", "distance": 3.307, "atom1_id": "///F/92/NE", "atom2_id": "///H/76/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 531, "atom1_serNum": 4497, "atom2_serNum": 4499, "donAcc_type": "acceptable", "distance": 2.933, "atom1_id": "///F/96/O", "atom2_id": "///F/96/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 532, "atom1_serNum": 4546, "atom2_serNum": 10332, "donAcc_type": "standard", "distance": 3.421, "atom1_id": "///G/14/N", "atom2_id": "///J/48/O4'", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 533, "atom1_serNum": 4563, "atom2_serNum": 4589, "donAcc_type": "acceptable", "distance": 2.567, "atom1_id": "///G/16/O", "atom2_id": "///G/19/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 534, "atom1_serNum": 4563, "atom2_serNum": 4590, "donAcc_type": "standard", "distance": 3.218, "atom1_id": "///G/16/O", "atom2_id": "///G/20/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 535, "atom1_serNum": 4565, "atom2_serNum": 4589, "donAcc_type": "acceptable", "distance": 3.129, "atom1_id": "///G/16/OG1", "atom2_id": "///G/19/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 536, "atom1_serNum": 4570, "atom2_serNum": 4601, "donAcc_type": "standard", "distance": 2.904, "atom1_id": "///G/17/O", "atom2_id": "///G/21/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 537, "atom1_serNum": 4577, "atom2_serNum": 4680, "donAcc_type": "acceptable", "distance": 3.518, "atom1_id": "///G/17/NH2", "atom2_id": "///G/31/ND1", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 538, "atom1_serNum": 4581, "atom2_serNum": 4606, "donAcc_type": "standard", "distance": 2.654, "atom1_id": "///G/18/O", "atom2_id": "///G/22/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 539, "atom1_serNum": 4581, "atom2_serNum": 4610, "donAcc_type": "standard", "distance": 3.182, "atom1_id": "///G/18/O", "atom2_id": "///G/23/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 540, "atom1_serNum": 4583, "atom2_serNum": 4630, "donAcc_type": "acceptable", "distance": 3.101, "atom1_id": "///G/18/OG", "atom2_id": "///G/25/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 541, "atom1_serNum": 4600, "atom2_serNum": 10327, "donAcc_type": "standard", "distance": 3.830, "atom1_id": "///G/20/NH2", "atom2_id": "///J/48/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 542, "atom1_serNum": 4604, "atom2_serNum": 6082, "donAcc_type": "standard", "distance": 2.420, "atom1_id": "///G/21/O", "atom2_id": "///H/120/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 543, "atom1_serNum": 4630, "atom2_serNum": 4645, "donAcc_type": "standard", "distance": 2.885, "atom1_id": "///G/25/O", "atom2_id": "///G/27/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 544, "atom1_serNum": 4641, "atom2_serNum": 4656, "donAcc_type": "standard", "distance": 2.835, "atom1_id": "///G/26/O", "atom2_id": "///G/29/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 545, "atom1_serNum": 4641, "atom2_serNum": 4667, "donAcc_type": "standard", "distance": 3.260, "atom1_id": "///G/26/O", "atom2_id": "///G/30/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 546, "atom1_serNum": 4648, "atom2_serNum": 4674, "donAcc_type": "standard", "distance": 3.122, "atom1_id": "///G/27/O", "atom2_id": "///G/31/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 547, "atom1_serNum": 4655, "atom2_serNum": 4684, "donAcc_type": "standard", "distance": 2.921, "atom1_id": "///G/28/O", "atom2_id": "///G/32/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 548, "atom1_serNum": 4659, "atom2_serNum": 4695, "donAcc_type": "standard", "distance": 2.869, "atom1_id": "///G/29/O", "atom2_id": "///G/33/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 549, "atom1_serNum": 4665, "atom2_serNum": 5466, "donAcc_type": "acceptable", "distance": 2.589, "atom1_id": "///G/29/NH1", "atom2_id": "///H/40/OH", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 550, "atom1_serNum": 4666, "atom2_serNum": 5426, "donAcc_type": "standard", "distance": 2.839, "atom1_id": "///G/29/NH2", "atom2_id": "///H/36/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 551, "atom1_serNum": 4670, "atom2_serNum": 4703, "donAcc_type": "standard", "distance": 2.913, "atom1_id": "///G/30/O", "atom2_id": "///G/34/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 552, "atom1_serNum": 4677, "atom2_serNum": 4711, "donAcc_type": "standard", "distance": 2.912, "atom1_id": "///G/31/O", "atom2_id": "///G/35/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 553, "atom1_serNum": 4687, "atom2_serNum": 4722, "donAcc_type": "standard", "distance": 3.193, "atom1_id": "///G/32/O", "atom2_id": "///G/36/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 554, "atom1_serNum": 4693, "atom2_serNum": 5421, "donAcc_type": "standard", "distance": 3.382, "atom1_id": "///G/32/NH1", "atom2_id": "///H/35/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 555, "atom1_serNum": 4694, "atom2_serNum": 5422, "donAcc_type": "standard", "distance": 3.134, "atom1_id": "///G/32/NH2", "atom2_id": "///H/35/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 556, "atom1_serNum": 4698, "atom2_serNum": 4731, "donAcc_type": "standard", "distance": 2.771, "atom1_id": "///G/33/O", "atom2_id": "///G/37/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 557, "atom1_serNum": 4720, "atom2_serNum": 4764, "donAcc_type": "standard", "distance": 3.027, "atom1_id": "///G/35/NH1", "atom2_id": "///G/41/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 558, "atom1_serNum": 4720, "atom2_serNum": 8504, "donAcc_type": "standard", "distance": 3.057, "atom1_id": "///G/35/NH1", "atom2_id": "///I/129/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 559, "atom1_serNum": 4721, "atom2_serNum": 8504, "donAcc_type": "standard", "distance": 2.469, "atom1_id": "///G/35/NH2", "atom2_id": "///I/129/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 560, "atom1_serNum": 4760, "atom2_serNum": 4773, "donAcc_type": "acceptable", "distance": 2.772, "atom1_id": "///G/40/OG", "atom2_id": "///G/42/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 561, "atom1_serNum": 4761, "atom2_serNum": 4768, "donAcc_type": "standard", "distance": 2.818, "atom1_id": "///G/41/N", "atom2_id": "///G/41/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 562, "atom1_serNum": 4769, "atom2_serNum": 5834, "donAcc_type": "questionable", "distance": 3.016, "atom1_id": "///G/41/OE2", "atom2_id": "///H/87/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 563, "atom1_serNum": 4773, "atom2_serNum": 5844, "donAcc_type": "standard", "distance": 3.951, "atom1_id": "///G/42/O", "atom2_id": "///H/89/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 564, "atom1_serNum": 4788, "atom2_serNum": 5847, "donAcc_type": "standard", "distance": 3.367, "atom1_id": "///G/44/N", "atom2_id": "///H/89/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 565, "atom1_serNum": 4800, "atom2_serNum": 4820, "donAcc_type": "standard", "distance": 3.099, "atom1_id": "///G/46/O", "atom2_id": "///G/50/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 566, "atom1_serNum": 4804, "atom2_serNum": 4832, "donAcc_type": "standard", "distance": 2.950, "atom1_id": "///G/47/O", "atom2_id": "///G/51/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 567, "atom1_serNum": 4809, "atom2_serNum": 4840, "donAcc_type": "standard", "distance": 2.875, "atom1_id": "///G/48/O", "atom2_id": "///G/52/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 568, "atom1_serNum": 4816, "atom2_serNum": 4845, "donAcc_type": "standard", "distance": 2.905, "atom1_id": "///G/49/O", "atom2_id": "///G/53/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 569, "atom1_serNum": 4823, "atom2_serNum": 4850, "donAcc_type": "standard", "distance": 2.934, "atom1_id": "///G/50/O", "atom2_id": "///G/54/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 570, "atom1_serNum": 4835, "atom2_serNum": 4857, "donAcc_type": "standard", "distance": 2.945, "atom1_id": "///G/51/O", "atom2_id": "///G/55/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 571, "atom1_serNum": 4843, "atom2_serNum": 4865, "donAcc_type": "standard", "distance": 2.853, "atom1_id": "///G/52/O", "atom2_id": "///G/56/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 572, "atom1_serNum": 4848, "atom2_serNum": 4874, "donAcc_type": "standard", "distance": 2.909, "atom1_id": "///G/53/O", "atom2_id": "///G/57/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 573, "atom1_serNum": 4853, "atom2_serNum": 4886, "donAcc_type": "standard", "distance": 2.957, "atom1_id": "///G/54/O", "atom2_id": "///G/58/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 574, "atom1_serNum": 4860, "atom2_serNum": 4894, "donAcc_type": "standard", "distance": 2.918, "atom1_id": "///G/55/O", "atom2_id": "///G/59/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 575, "atom1_serNum": 4868, "atom2_serNum": 4901, "donAcc_type": "standard", "distance": 2.870, "atom1_id": "///G/56/O", "atom2_id": "///G/60/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 576, "atom1_serNum": 4877, "atom2_serNum": 4906, "donAcc_type": "standard", "distance": 2.945, "atom1_id": "///G/57/O", "atom2_id": "///G/61/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 577, "atom1_serNum": 4885, "atom2_serNum": 4913, "donAcc_type": "acceptable", "distance": 2.646, "atom1_id": "///G/57/OH", "atom2_id": "///G/61/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 578, "atom1_serNum": 4889, "atom2_serNum": 4915, "donAcc_type": "standard", "distance": 2.978, "atom1_id": "///G/58/O", "atom2_id": "///G/62/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 579, "atom1_serNum": 4897, "atom2_serNum": 4923, "donAcc_type": "standard", "distance": 2.862, "atom1_id": "///G/59/O", "atom2_id": "///G/63/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 580, "atom1_serNum": 4904, "atom2_serNum": 4931, "donAcc_type": "standard", "distance": 2.920, "atom1_id": "///G/60/O", "atom2_id": "///G/64/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 581, "atom1_serNum": 4909, "atom2_serNum": 4940, "donAcc_type": "standard", "distance": 2.955, "atom1_id": "///G/61/O", "atom2_id": "///G/65/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 582, "atom1_serNum": 4914, "atom2_serNum": 4939, "donAcc_type": "questionable", "distance": 2.719, "atom1_id": "///G/61/OE2", "atom2_id": "///G/64/OE2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 583, "atom1_serNum": 4918, "atom2_serNum": 4948, "donAcc_type": "standard", "distance": 2.901, "atom1_id": "///G/62/O", "atom2_id": "///G/66/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 584, "atom1_serNum": 4926, "atom2_serNum": 4953, "donAcc_type": "standard", "distance": 2.894, "atom1_id": "///G/63/O", "atom2_id": "///G/67/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 585, "atom1_serNum": 4934, "atom2_serNum": 4957, "donAcc_type": "standard", "distance": 2.927, "atom1_id": "///G/64/O", "atom2_id": "///G/68/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 586, "atom1_serNum": 4943, "atom2_serNum": 4965, "donAcc_type": "standard", "distance": 2.908, "atom1_id": "///G/65/O", "atom2_id": "///G/69/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 587, "atom1_serNum": 4951, "atom2_serNum": 4970, "donAcc_type": "standard", "distance": 2.892, "atom1_id": "///G/66/O", "atom2_id": "///G/70/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 588, "atom1_serNum": 4956, "atom2_serNum": 4975, "donAcc_type": "standard", "distance": 2.912, "atom1_id": "///G/67/O", "atom2_id": "///G/71/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 589, "atom1_serNum": 4960, "atom2_serNum": 4986, "donAcc_type": "standard", "distance": 2.913, "atom1_id": "///G/68/O", "atom2_id": "///G/72/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 590, "atom1_serNum": 4968, "atom2_serNum": 5001, "donAcc_type": "standard", "distance": 2.973, "atom1_id": "///G/69/O", "atom2_id": "///G/73/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 591, "atom1_serNum": 4973, "atom2_serNum": 4994, "donAcc_type": "standard", "distance": 3.090, "atom1_id": "///G/70/O", "atom2_id": "///G/73/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 592, "atom1_serNum": 4978, "atom2_serNum": 5002, "donAcc_type": "standard", "distance": 3.652, "atom1_id": "///G/71/O", "atom2_id": "///G/74/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 593, "atom1_serNum": 5023, "atom2_serNum": 5567, "donAcc_type": "standard", "distance": 3.704, "atom1_id": "///G/76/O", "atom2_id": "///H/53/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 594, "atom1_serNum": 5030, "atom2_serNum": 5078, "donAcc_type": "acceptable", "distance": 3.487, "atom1_id": "///G/77/O", "atom2_id": "///G/82/ND1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 595, "atom1_serNum": 5038, "atom2_serNum": 5570, "donAcc_type": "standard", "distance": 3.013, "atom1_id": "///G/78/N", "atom2_id": "///H/53/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 596, "atom1_serNum": 5049, "atom2_serNum": 5072, "donAcc_type": "standard", "distance": 2.960, "atom1_id": "///G/79/O", "atom2_id": "///G/82/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 597, "atom1_serNum": 5049, "atom2_serNum": 5082, "donAcc_type": "standard", "distance": 3.173, "atom1_id": "///G/79/O", "atom2_id": "///G/83/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 598, "atom1_serNum": 5057, "atom2_serNum": 5090, "donAcc_type": "standard", "distance": 2.909, "atom1_id": "///G/80/O", "atom2_id": "///G/84/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 599, "atom1_serNum": 5064, "atom2_serNum": 5099, "donAcc_type": "standard", "distance": 2.903, "atom1_id": "///G/81/O", "atom2_id": "///G/85/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 600, "atom1_serNum": 5070, "atom2_serNum": 5268, "donAcc_type": "standard", "distance": 3.185, "atom1_id": "///G/81/NH1", "atom2_id": "///G/107/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 601, "atom1_serNum": 5071, "atom2_serNum": 5260, "donAcc_type": "standard", "distance": 2.608, "atom1_id": "///G/81/NH2", "atom2_id": "///G/105/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 602, "atom1_serNum": 5071, "atom2_serNum": 5268, "donAcc_type": "standard", "distance": 3.250, "atom1_id": "///G/81/NH2", "atom2_id": "///G/107/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 603, "atom1_serNum": 5075, "atom2_serNum": 5107, "donAcc_type": "standard", "distance": 2.893, "atom1_id": "///G/82/O", "atom2_id": "///G/86/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 604, "atom1_serNum": 5085, "atom2_serNum": 5112, "donAcc_type": "standard", "distance": 2.919, "atom1_id": "///G/83/O", "atom2_id": "///G/87/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 605, "atom1_serNum": 5093, "atom2_serNum": 5120, "donAcc_type": "standard", "distance": 2.882, "atom1_id": "///G/84/O", "atom2_id": "///G/88/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 606, "atom1_serNum": 5098, "atom2_serNum": 5264, "donAcc_type": "standard", "distance": 2.808, "atom1_id": "///G/84/NE2", "atom2_id": "///G/106/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 607, "atom1_serNum": 5102, "atom2_serNum": 5131, "donAcc_type": "standard", "distance": 3.080, "atom1_id": "///G/85/O", "atom2_id": "///G/89/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 608, "atom1_serNum": 5102, "atom2_serNum": 5138, "donAcc_type": "standard", "distance": 2.805, "atom1_id": "///G/85/O", "atom2_id": "///G/89/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 609, "atom1_serNum": 5115, "atom2_serNum": 5142, "donAcc_type": "questionable", "distance": 3.211, "atom1_id": "///G/87/O", "atom2_id": "///G/90/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 610, "atom1_serNum": 5115, "atom2_serNum": 5179, "donAcc_type": "questionable", "distance": 2.880, "atom1_id": "///G/87/O", "atom2_id": "///G/94/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 611, "atom1_serNum": 5123, "atom2_serNum": 5180, "donAcc_type": "standard", "distance": 3.206, "atom1_id": "///G/88/O", "atom2_id": "///G/94/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 612, "atom1_serNum": 5129, "atom2_serNum": 5224, "donAcc_type": "standard", "distance": 3.211, "atom1_id": "///G/88/NH1", "atom2_id": "///G/100/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 613, "atom1_serNum": 5130, "atom2_serNum": 5201, "donAcc_type": "standard", "distance": 3.265, "atom1_id": "///G/88/NH2", "atom2_id": "///G/97/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 614, "atom1_serNum": 5142, "atom2_serNum": 5173, "donAcc_type": "standard", "distance": 2.842, "atom1_id": "///G/90/O", "atom2_id": "///G/94/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 615, "atom1_serNum": 5145, "atom2_serNum": 5156, "donAcc_type": "standard", "distance": 3.090, "atom1_id": "///G/90/OD1", "atom2_id": "///G/92/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 616, "atom1_serNum": 5145, "atom2_serNum": 5165, "donAcc_type": "standard", "distance": 3.312, "atom1_id": "///G/90/OD1", "atom2_id": "///G/93/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 617, "atom1_serNum": 5150, "atom2_serNum": 5181, "donAcc_type": "standard", "distance": 2.919, "atom1_id": "///G/91/O", "atom2_id": "///G/95/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 618, "atom1_serNum": 5154, "atom2_serNum": 5163, "donAcc_type": "questionable", "distance": 2.874, "atom1_id": "///G/91/OE1", "atom2_id": "///G/92/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 619, "atom1_serNum": 5159, "atom2_serNum": 5190, "donAcc_type": "standard", "distance": 2.881, "atom1_id": "///G/92/O", "atom2_id": "///G/96/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 620, "atom1_serNum": 5168, "atom2_serNum": 5198, "donAcc_type": "standard", "distance": 2.909, "atom1_id": "///G/93/O", "atom2_id": "///G/97/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 621, "atom1_serNum": 5238, "atom2_serNum": 5257, "donAcc_type": "standard", "distance": 3.474, "atom1_id": "///G/102/O", "atom2_id": "///G/105/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 622, "atom1_serNum": 5315, "atom2_serNum": 5332, "donAcc_type": "standard", "distance": 3.111, "atom1_id": "///G/113/O", "atom2_id": "///G/116/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 623, "atom1_serNum": 5366, "atom2_serNum": 5376, "donAcc_type": "questionable", "distance": 3.101, "atom1_id": "///H/29/NH1", "atom2_id": "///H/30/NZ", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 624, "atom1_serNum": 5367, "atom2_serNum": 11807, "donAcc_type": "standard", "distance": 2.316, "atom1_id": "///H/29/NH2", "atom2_id": "///J/120/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 625, "atom1_serNum": 5391, "atom2_serNum": 5413, "donAcc_type": "standard", "distance": 2.857, "atom1_id": "///H/32/O", "atom2_id": "///H/34/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 626, "atom1_serNum": 5403, "atom2_serNum": 5421, "donAcc_type": "standard", "distance": 2.676, "atom1_id": "///H/33/NH1", "atom2_id": "///H/35/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 627, "atom1_serNum": 5428, "atom2_serNum": 5446, "donAcc_type": "acceptable", "distance": 2.918, "atom1_id": "///H/36/OG", "atom2_id": "///H/38/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 628, "atom1_serNum": 5432, "atom2_serNum": 5467, "donAcc_type": "standard", "distance": 3.258, "atom1_id": "///H/37/O", "atom2_id": "///H/41/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 629, "atom1_serNum": 5444, "atom2_serNum": 5474, "donAcc_type": "standard", "distance": 3.333, "atom1_id": "///H/38/O", "atom2_id": "///H/42/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 630, "atom1_serNum": 5450, "atom2_serNum": 5486, "donAcc_type": "standard", "distance": 2.915, "atom1_id": "///H/39/O", "atom2_id": "///H/43/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 631, "atom1_serNum": 5458, "atom2_serNum": 5495, "donAcc_type": "standard", "distance": 2.906, "atom1_id": "///H/40/O", "atom2_id": "///H/44/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 632, "atom1_serNum": 5470, "atom2_serNum": 5502, "donAcc_type": "standard", "distance": 2.897, "atom1_id": "///H/41/O", "atom2_id": "///H/45/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 633, "atom1_serNum": 5477, "atom2_serNum": 5510, "donAcc_type": "standard", "distance": 2.955, "atom1_id": "///H/42/O", "atom2_id": "///H/46/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 634, "atom1_serNum": 5485, "atom2_serNum": 10106, "donAcc_type": "acceptable", "distance": 3.011, "atom1_id": "///H/42/OH", "atom2_id": "///J/37/OP2", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 635, "atom1_serNum": 5489, "atom2_serNum": 5527, "donAcc_type": "standard", "distance": 3.010, "atom1_id": "///H/43/O", "atom2_id": "///H/47/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 636, "atom1_serNum": 5498, "atom2_serNum": 5526, "donAcc_type": "questionable", "distance": 2.868, "atom1_id": "///H/44/O", "atom2_id": "///H/47/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 637, "atom1_serNum": 5498, "atom2_serNum": 5528, "donAcc_type": "standard", "distance": 3.792, "atom1_id": "///H/44/O", "atom2_id": "///H/48/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 638, "atom1_serNum": 5505, "atom2_serNum": 5535, "donAcc_type": "standard", "distance": 3.076, "atom1_id": "///H/45/O", "atom2_id": "///H/49/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 639, "atom1_serNum": 5518, "atom2_serNum": 5548, "donAcc_type": "standard", "distance": 3.917, "atom1_id": "///H/46/NZ", "atom2_id": "///H/50/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 640, "atom1_serNum": 5518, "atom2_serNum": 5563, "donAcc_type": "standard", "distance": 3.971, "atom1_id": "///H/46/NZ", "atom2_id": "///H/52/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 641, "atom1_serNum": 5552, "atom2_serNum": 5558, "donAcc_type": "standard", "distance": 2.825, "atom1_id": "///H/51/N", "atom2_id": "///H/51/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 642, "atom1_serNum": 5594, "atom2_serNum": 5617, "donAcc_type": "standard", "distance": 2.959, "atom1_id": "///H/57/O", "atom2_id": "///H/61/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 643, "atom1_serNum": 5603, "atom2_serNum": 5625, "donAcc_type": "standard", "distance": 2.928, "atom1_id": "///H/58/O", "atom2_id": "///H/62/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 644, "atom1_serNum": 5608, "atom2_serNum": 5633, "donAcc_type": "standard", "distance": 2.886, "atom1_id": "///H/59/O", "atom2_id": "///H/63/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 645, "atom1_serNum": 5616, "atom2_serNum": 5641, "donAcc_type": "standard", "distance": 2.934, "atom1_id": "///H/60/O", "atom2_id": "///H/64/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 646, "atom1_serNum": 5616, "atom2_serNum": 5646, "donAcc_type": "acceptable", "distance": 2.941, "atom1_id": "///H/60/O", "atom2_id": "///H/64/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 647, "atom1_serNum": 5620, "atom2_serNum": 5647, "donAcc_type": "standard", "distance": 2.923, "atom1_id": "///H/61/O", "atom2_id": "///H/65/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 648, "atom1_serNum": 5628, "atom2_serNum": 5658, "donAcc_type": "standard", "distance": 2.886, "atom1_id": "///H/62/O", "atom2_id": "///H/66/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 649, "atom1_serNum": 5636, "atom2_serNum": 5665, "donAcc_type": "standard", "distance": 2.928, "atom1_id": "///H/63/O", "atom2_id": "///H/67/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 650, "atom1_serNum": 5644, "atom2_serNum": 5673, "donAcc_type": "standard", "distance": 2.919, "atom1_id": "///H/64/O", "atom2_id": "///H/68/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 651, "atom1_serNum": 5650, "atom2_serNum": 5681, "donAcc_type": "standard", "distance": 2.935, "atom1_id": "///H/65/O", "atom2_id": "///H/69/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 652, "atom1_serNum": 5661, "atom2_serNum": 5689, "donAcc_type": "standard", "distance": 2.887, "atom1_id": "///H/66/O", "atom2_id": "///H/70/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 653, "atom1_serNum": 5668, "atom2_serNum": 5700, "donAcc_type": "standard", "distance": 2.904, "atom1_id": "///H/67/O", "atom2_id": "///H/71/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 654, "atom1_serNum": 5676, "atom2_serNum": 5709, "donAcc_type": "standard", "distance": 2.929, "atom1_id": "///H/68/O", "atom2_id": "///H/72/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 655, "atom1_serNum": 5679, "atom2_serNum": 5716, "donAcc_type": "standard", "distance": 3.043, "atom1_id": "///H/68/OD1", "atom2_id": "///H/72/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 656, "atom1_serNum": 5684, "atom2_serNum": 5720, "donAcc_type": "standard", "distance": 2.928, "atom1_id": "///H/69/O", "atom2_id": "///H/73/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 657, "atom1_serNum": 5692, "atom2_serNum": 5728, "donAcc_type": "standard", "distance": 2.880, "atom1_id": "///H/70/O", "atom2_id": "///H/74/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 658, "atom1_serNum": 5703, "atom2_serNum": 5733, "donAcc_type": "standard", "distance": 2.916, "atom1_id": "///H/71/O", "atom2_id": "///H/75/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 659, "atom1_serNum": 5712, "atom2_serNum": 5737, "donAcc_type": "standard", "distance": 2.936, "atom1_id": "///H/72/O", "atom2_id": "///H/76/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 660, "atom1_serNum": 5723, "atom2_serNum": 5746, "donAcc_type": "standard", "distance": 2.908, "atom1_id": "///H/73/O", "atom2_id": "///H/77/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 661, "atom1_serNum": 5731, "atom2_serNum": 5751, "donAcc_type": "standard", "distance": 2.897, "atom1_id": "///H/74/O", "atom2_id": "///H/78/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 662, "atom1_serNum": 5736, "atom2_serNum": 5757, "donAcc_type": "standard", "distance": 2.955, "atom1_id": "///H/75/O", "atom2_id": "///H/79/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 663, "atom1_serNum": 5740, "atom2_serNum": 5768, "donAcc_type": "standard", "distance": 2.944, "atom1_id": "///H/76/O", "atom2_id": "///H/80/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 664, "atom1_serNum": 5744, "atom2_serNum": 5767, "donAcc_type": "standard", "distance": 2.717, "atom1_id": "///H/76/OE1", "atom2_id": "///H/79/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 665, "atom1_serNum": 5749, "atom2_serNum": 5776, "donAcc_type": "standard", "distance": 2.894, "atom1_id": "///H/77/O", "atom2_id": "///H/81/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 666, "atom1_serNum": 5754, "atom2_serNum": 5781, "donAcc_type": "standard", "distance": 2.898, "atom1_id": "///H/78/O", "atom2_id": "///H/82/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 667, "atom1_serNum": 5760, "atom2_serNum": 5791, "donAcc_type": "standard", "distance": 2.908, "atom1_id": "///H/79/O", "atom2_id": "///H/83/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 668, "atom1_serNum": 5771, "atom2_serNum": 5810, "donAcc_type": "standard", "distance": 2.884, "atom1_id": "///H/80/O", "atom2_id": "///H/84/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 669, "atom1_serNum": 5779, "atom2_serNum": 5803, "donAcc_type": "standard", "distance": 3.174, "atom1_id": "///H/81/O", "atom2_id": "///H/84/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 670, "atom1_serNum": 5779, "atom2_serNum": 5820, "donAcc_type": "standard", "distance": 3.712, "atom1_id": "///H/81/O", "atom2_id": "///H/86/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 671, "atom1_serNum": 5814, "atom2_serNum": 5827, "donAcc_type": "standard", "distance": 3.352, "atom1_id": "///H/85/O", "atom2_id": "///H/86/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 672, "atom1_serNum": 5852, "atom2_serNum": 5883, "donAcc_type": "standard", "distance": 2.781, "atom1_id": "///H/90/N", "atom2_id": "///H/93/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 673, "atom1_serNum": 5855, "atom2_serNum": 5885, "donAcc_type": "standard", "distance": 3.741, "atom1_id": "///H/90/O", "atom2_id": "///H/94/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 674, "atom1_serNum": 5857, "atom2_serNum": 5883, "donAcc_type": "acceptable", "distance": 2.676, "atom1_id": "///H/90/OG1", "atom2_id": "///H/93/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 675, "atom1_serNum": 5862, "atom2_serNum": 5893, "donAcc_type": "standard", "distance": 2.890, "atom1_id": "///H/91/O", "atom2_id": "///H/95/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 676, "atom1_serNum": 5868, "atom2_serNum": 5902, "donAcc_type": "standard", "distance": 2.880, "atom1_id": "///H/92/O", "atom2_id": "///H/96/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 677, "atom1_serNum": 5868, "atom2_serNum": 5907, "donAcc_type": "acceptable", "distance": 2.946, "atom1_id": "///H/92/O", "atom2_id": "///H/96/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 678, "atom1_serNum": 5876, "atom2_serNum": 5883, "donAcc_type": "standard", "distance": 2.604, "atom1_id": "///H/93/N", "atom2_id": "///H/93/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 679, "atom1_serNum": 5879, "atom2_serNum": 5909, "donAcc_type": "standard", "distance": 2.935, "atom1_id": "///H/93/O", "atom2_id": "///H/97/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 680, "atom1_serNum": 5888, "atom2_serNum": 5914, "donAcc_type": "standard", "distance": 2.882, "atom1_id": "///H/94/O", "atom2_id": "///H/98/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 681, "atom1_serNum": 5896, "atom2_serNum": 5921, "donAcc_type": "standard", "distance": 2.921, "atom1_id": "///H/95/O", "atom2_id": "///H/99/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 682, "atom1_serNum": 5905, "atom2_serNum": 5932, "donAcc_type": "standard", "distance": 2.869, "atom1_id": "///H/96/O", "atom2_id": "///H/100/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 683, "atom1_serNum": 5907, "atom2_serNum": 5930, "donAcc_type": "acceptable", "distance": 2.498, "atom1_id": "///H/96/OG1", "atom2_id": "///H/99/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 684, "atom1_serNum": 5912, "atom2_serNum": 5940, "donAcc_type": "standard", "distance": 2.908, "atom1_id": "///H/97/O", "atom2_id": "///H/101/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 685, "atom1_serNum": 5917, "atom2_serNum": 5948, "donAcc_type": "standard", "distance": 2.656, "atom1_id": "///H/98/O", "atom2_id": "///H/102/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 686, "atom1_serNum": 5959, "atom2_serNum": 5976, "donAcc_type": "standard", "distance": 3.251, "atom1_id": "///H/103/O", "atom2_id": "///H/106/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 687, "atom1_serNum": 5959, "atom2_serNum": 5984, "donAcc_type": "standard", "distance": 2.680, "atom1_id": "///H/103/O", "atom2_id": "///H/107/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 688, "atom1_serNum": 5966, "atom2_serNum": 5989, "donAcc_type": "standard", "distance": 2.897, "atom1_id": "///H/104/O", "atom2_id": "///H/108/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 689, "atom1_serNum": 5970, "atom2_serNum": 5997, "donAcc_type": "standard", "distance": 2.619, "atom1_id": "///H/105/O", "atom2_id": "///H/108/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 690, "atom1_serNum": 5970, "atom2_serNum": 6004, "donAcc_type": "acceptable", "distance": 2.741, "atom1_id": "///H/105/O", "atom2_id": "///H/109/ND1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 691, "atom1_serNum": 5979, "atom2_serNum": 6008, "donAcc_type": "standard", "distance": 2.915, "atom1_id": "///H/106/O", "atom2_id": "///H/110/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 692, "atom1_serNum": 5987, "atom2_serNum": 6013, "donAcc_type": "standard", "distance": 2.878, "atom1_id": "///H/107/O", "atom2_id": "///H/111/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 693, "atom1_serNum": 5992, "atom2_serNum": 6020, "donAcc_type": "standard", "distance": 2.935, "atom1_id": "///H/108/O", "atom2_id": "///H/112/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 694, "atom1_serNum": 5992, "atom2_serNum": 6025, "donAcc_type": "acceptable", "distance": 2.683, "atom1_id": "///H/108/O", "atom2_id": "///H/112/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 695, "atom1_serNum": 6001, "atom2_serNum": 6025, "donAcc_type": "acceptable", "distance": 2.722, "atom1_id": "///H/109/O", "atom2_id": "///H/112/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 696, "atom1_serNum": 6001, "atom2_serNum": 6026, "donAcc_type": "standard", "distance": 2.933, "atom1_id": "///H/109/O", "atom2_id": "///H/113/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 697, "atom1_serNum": 6011, "atom2_serNum": 6035, "donAcc_type": "standard", "distance": 2.897, "atom1_id": "///H/110/O", "atom2_id": "///H/114/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 698, "atom1_serNum": 6016, "atom2_serNum": 6039, "donAcc_type": "standard", "distance": 2.890, "atom1_id": "///H/111/O", "atom2_id": "///H/115/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 699, "atom1_serNum": 6016, "atom2_serNum": 6044, "donAcc_type": "acceptable", "distance": 2.712, "atom1_id": "///H/111/O", "atom2_id": "///H/115/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 700, "atom1_serNum": 6023, "atom2_serNum": 6044, "donAcc_type": "acceptable", "distance": 2.681, "atom1_id": "///H/112/O", "atom2_id": "///H/115/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 701, "atom1_serNum": 6023, "atom2_serNum": 6046, "donAcc_type": "standard", "distance": 2.944, "atom1_id": "///H/112/O", "atom2_id": "///H/116/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 702, "atom1_serNum": 6029, "atom2_serNum": 6055, "donAcc_type": "standard", "distance": 2.895, "atom1_id": "///H/113/O", "atom2_id": "///H/117/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 703, "atom1_serNum": 6038, "atom2_serNum": 6060, "donAcc_type": "standard", "distance": 2.900, "atom1_id": "///H/114/O", "atom2_id": "///H/118/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 704, "atom1_serNum": 6042, "atom2_serNum": 6067, "donAcc_type": "standard", "distance": 2.913, "atom1_id": "///H/115/O", "atom2_id": "///H/119/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 705, "atom1_serNum": 6042, "atom2_serNum": 6072, "donAcc_type": "acceptable", "distance": 2.628, "atom1_id": "///H/115/O", "atom2_id": "///H/119/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 706, "atom1_serNum": 6049, "atom2_serNum": 6072, "donAcc_type": "acceptable", "distance": 2.707, "atom1_id": "///H/116/O", "atom2_id": "///H/119/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 707, "atom1_serNum": 6049, "atom2_serNum": 6074, "donAcc_type": "standard", "distance": 2.928, "atom1_id": "///H/116/O", "atom2_id": "///H/120/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 708, "atom1_serNum": 6058, "atom2_serNum": 6083, "donAcc_type": "standard", "distance": 2.898, "atom1_id": "///H/117/O", "atom2_id": "///H/121/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 709, "atom1_serNum": 6063, "atom2_serNum": 6095, "donAcc_type": "standard", "distance": 2.898, "atom1_id": "///H/118/O", "atom2_id": "///H/122/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 710, "atom1_serNum": 6063, "atom2_serNum": 6100, "donAcc_type": "acceptable", "distance": 2.773, "atom1_id": "///H/118/O", "atom2_id": "///H/122/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 711, "atom1_serNum": 6070, "atom2_serNum": 6100, "donAcc_type": "acceptable", "distance": 2.910, "atom1_id": "///H/119/O", "atom2_id": "///H/122/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 712, "atom1_serNum": 6070, "atom2_serNum": 6102, "donAcc_type": "standard", "distance": 2.901, "atom1_id": "///H/119/O", "atom2_id": "///H/123/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 713, "atom1_serNum": 6070, "atom2_serNum": 6107, "donAcc_type": "acceptable", "distance": 2.792, "atom1_id": "///H/119/O", "atom2_id": "///H/123/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 714, "atom1_serNum": 6077, "atom2_serNum": 6108, "donAcc_type": "standard", "distance": 3.088, "atom1_id": "///H/120/O", "atom2_id": "///H/124/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 715, "atom1_serNum": 6130, "atom2_serNum": 12835, "donAcc_type": "standard", "distance": 2.963, "atom1_id": "///I/12/N6", "atom2_id": "///J/169/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 716, "atom1_serNum": 6131, "atom2_serNum": 12833, "donAcc_type": "standard", "distance": 2.869, "atom1_id": "///I/12/N1", "atom2_id": "///J/169/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 717, "atom1_serNum": 6148, "atom2_serNum": 12816, "donAcc_type": "standard", "distance": 2.752, "atom1_id": "///I/13/O2", "atom2_id": "///J/168/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 718, "atom1_serNum": 6149, "atom2_serNum": 12814, "donAcc_type": "standard", "distance": 2.886, "atom1_id": "///I/13/N3", "atom2_id": "///J/168/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 719, "atom1_serNum": 6151, "atom2_serNum": 12813, "donAcc_type": "standard", "distance": 2.942, "atom1_id": "///I/13/N4", "atom2_id": "///J/168/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 720, "atom1_serNum": 6167, "atom2_serNum": 12794, "donAcc_type": "standard", "distance": 2.775, "atom1_id": "///I/14/O2", "atom2_id": "///J/167/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 721, "atom1_serNum": 6168, "atom2_serNum": 12792, "donAcc_type": "standard", "distance": 2.888, "atom1_id": "///I/14/N3", "atom2_id": "///J/167/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 722, "atom1_serNum": 6170, "atom2_serNum": 12791, "donAcc_type": "standard", "distance": 2.966, "atom1_id": "///I/14/N4", "atom2_id": "///J/167/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 723, "atom1_serNum": 6189, "atom2_serNum": 12772, "donAcc_type": "standard", "distance": 2.926, "atom1_id": "///I/15/O6", "atom2_id": "///J/166/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 724, "atom1_serNum": 6190, "atom2_serNum": 12770, "donAcc_type": "standard", "distance": 2.907, "atom1_id": "///I/15/N1", "atom2_id": "///J/166/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 725, "atom1_serNum": 6192, "atom2_serNum": 12769, "donAcc_type": "standard", "distance": 2.782, "atom1_id": "///I/15/N2", "atom2_id": "///J/166/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 726, "atom1_serNum": 6208, "atom2_serNum": 12753, "donAcc_type": "standard", "distance": 2.733, "atom1_id": "///I/16/O2", "atom2_id": "///J/165/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 727, "atom1_serNum": 6209, "atom2_serNum": 12751, "donAcc_type": "standard", "distance": 2.882, "atom1_id": "///I/16/N3", "atom2_id": "///J/165/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 728, "atom1_serNum": 6211, "atom2_serNum": 12750, "donAcc_type": "standard", "distance": 2.932, "atom1_id": "///I/16/N4", "atom2_id": "///J/165/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 729, "atom1_serNum": 6227, "atom2_serNum": 12731, "donAcc_type": "standard", "distance": 2.755, "atom1_id": "///I/17/O2", "atom2_id": "///J/164/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 730, "atom1_serNum": 6228, "atom2_serNum": 12729, "donAcc_type": "standard", "distance": 2.891, "atom1_id": "///I/17/N3", "atom2_id": "///J/164/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 731, "atom1_serNum": 6230, "atom2_serNum": 12728, "donAcc_type": "standard", "distance": 2.918, "atom1_id": "///I/17/N4", "atom2_id": "///J/164/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 732, "atom1_serNum": 6249, "atom2_serNum": 12688, "donAcc_type": "standard", "distance": 3.115, "atom1_id": "///I/18/N6", "atom2_id": "///J/162/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 733, "atom1_serNum": 6249, "atom2_serNum": 12708, "donAcc_type": "standard", "distance": 2.860, "atom1_id": "///I/18/N6", "atom2_id": "///J/163/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 734, "atom1_serNum": 6268, "atom2_serNum": 12688, "donAcc_type": "standard", "distance": 2.916, "atom1_id": "///I/19/N3", "atom2_id": "///J/162/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 735, "atom1_serNum": 6270, "atom2_serNum": 12687, "donAcc_type": "standard", "distance": 2.885, "atom1_id": "///I/19/O4", "atom2_id": "///J/162/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 736, "atom1_serNum": 6287, "atom2_serNum": 12668, "donAcc_type": "standard", "distance": 2.831, "atom1_id": "///I/20/O2", "atom2_id": "///J/161/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 737, "atom1_serNum": 6288, "atom2_serNum": 12666, "donAcc_type": "standard", "distance": 2.914, "atom1_id": "///I/20/N3", "atom2_id": "///J/161/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 738, "atom1_serNum": 6290, "atom2_serNum": 12645, "donAcc_type": "standard", "distance": 2.500, "atom1_id": "///I/20/N4", "atom2_id": "///J/160/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 739, "atom1_serNum": 6290, "atom2_serNum": 12665, "donAcc_type": "standard", "distance": 2.885, "atom1_id": "///I/20/N4", "atom2_id": "///J/161/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 740, "atom1_serNum": 6309, "atom2_serNum": 12625, "donAcc_type": "standard", "distance": 2.603, "atom1_id": "///I/21/N6", "atom2_id": "///J/159/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 741, "atom1_serNum": 6309, "atom2_serNum": 12645, "donAcc_type": "standard", "distance": 2.816, "atom1_id": "///I/21/N6", "atom2_id": "///J/160/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 742, "atom1_serNum": 6310, "atom2_serNum": 12643, "donAcc_type": "standard", "distance": 2.958, "atom1_id": "///I/21/N1", "atom2_id": "///J/160/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 743, "atom1_serNum": 6330, "atom2_serNum": 12625, "donAcc_type": "standard", "distance": 2.919, "atom1_id": "///I/22/N6", "atom2_id": "///J/159/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 744, "atom1_serNum": 6331, "atom2_serNum": 12623, "donAcc_type": "standard", "distance": 2.892, "atom1_id": "///I/22/N1", "atom2_id": "///J/159/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 745, "atom1_serNum": 6349, "atom2_serNum": 12605, "donAcc_type": "standard", "distance": 2.904, "atom1_id": "///I/23/N3", "atom2_id": "///J/158/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 746, "atom1_serNum": 6351, "atom2_serNum": 12604, "donAcc_type": "standard", "distance": 2.878, "atom1_id": "///I/23/O4", "atom2_id": "///J/158/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 747, "atom1_serNum": 6371, "atom2_serNum": 12584, "donAcc_type": "standard", "distance": 2.931, "atom1_id": "///I/24/N6", "atom2_id": "///J/157/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 748, "atom1_serNum": 6372, "atom2_serNum": 12582, "donAcc_type": "standard", "distance": 2.857, "atom1_id": "///I/24/N1", "atom2_id": "///J/157/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 749, "atom1_serNum": 6390, "atom2_serNum": 12564, "donAcc_type": "standard", "distance": 2.852, "atom1_id": "///I/25/N3", "atom2_id": "///J/156/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 750, "atom1_serNum": 6392, "atom2_serNum": 12563, "donAcc_type": "standard", "distance": 2.959, "atom1_id": "///I/25/O4", "atom2_id": "///J/156/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 751, "atom1_serNum": 6409, "atom2_serNum": 12544, "donAcc_type": "standard", "distance": 2.771, "atom1_id": "///I/26/O2", "atom2_id": "///J/155/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 752, "atom1_serNum": 6410, "atom2_serNum": 12542, "donAcc_type": "standard", "distance": 2.884, "atom1_id": "///I/26/N3", "atom2_id": "///J/155/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 753, "atom1_serNum": 6412, "atom2_serNum": 12541, "donAcc_type": "standard", "distance": 2.891, "atom1_id": "///I/26/N4", "atom2_id": "///J/155/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 754, "atom1_serNum": 6428, "atom2_serNum": 12522, "donAcc_type": "standard", "distance": 2.757, "atom1_id": "///I/27/O2", "atom2_id": "///J/154/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 755, "atom1_serNum": 6429, "atom2_serNum": 12520, "donAcc_type": "standard", "distance": 2.882, "atom1_id": "///I/27/N3", "atom2_id": "///J/154/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 756, "atom1_serNum": 6431, "atom2_serNum": 12519, "donAcc_type": "standard", "distance": 2.900, "atom1_id": "///I/27/N4", "atom2_id": "///J/154/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 757, "atom1_serNum": 6450, "atom2_serNum": 12499, "donAcc_type": "standard", "distance": 2.901, "atom1_id": "///I/28/N6", "atom2_id": "///J/153/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 758, "atom1_serNum": 6451, "atom2_serNum": 12497, "donAcc_type": "standard", "distance": 2.860, "atom1_id": "///I/28/N1", "atom2_id": "///J/153/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 759, "atom1_serNum": 6468, "atom2_serNum": 12480, "donAcc_type": "standard", "distance": 2.797, "atom1_id": "///I/29/O2", "atom2_id": "///J/152/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 760, "atom1_serNum": 6469, "atom2_serNum": 12478, "donAcc_type": "standard", "distance": 2.903, "atom1_id": "///I/29/N3", "atom2_id": "///J/152/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 761, "atom1_serNum": 6471, "atom2_serNum": 12455, "donAcc_type": "standard", "distance": 3.202, "atom1_id": "///I/29/N4", "atom2_id": "///J/151/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 762, "atom1_serNum": 6471, "atom2_serNum": 12477, "donAcc_type": "standard", "distance": 2.909, "atom1_id": "///I/29/N4", "atom2_id": "///J/152/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 763, "atom1_serNum": 6487, "atom2_serNum": 12458, "donAcc_type": "standard", "distance": 2.766, "atom1_id": "///I/30/O2", "atom2_id": "///J/151/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 764, "atom1_serNum": 6488, "atom2_serNum": 12456, "donAcc_type": "standard", "distance": 2.895, "atom1_id": "///I/30/N3", "atom2_id": "///J/151/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 765, "atom1_serNum": 6490, "atom2_serNum": 12455, "donAcc_type": "standard", "distance": 2.928, "atom1_id": "///I/30/N4", "atom2_id": "///J/151/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 766, "atom1_serNum": 6507, "atom2_serNum": 12435, "donAcc_type": "standard", "distance": 2.907, "atom1_id": "///I/31/N3", "atom2_id": "///J/150/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 767, "atom1_serNum": 6509, "atom2_serNum": 12415, "donAcc_type": "standard", "distance": 2.693, "atom1_id": "///I/31/O4", "atom2_id": "///J/149/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 768, "atom1_serNum": 6509, "atom2_serNum": 12434, "donAcc_type": "standard", "distance": 2.848, "atom1_id": "///I/31/O4", "atom2_id": "///J/150/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 769, "atom1_serNum": 6529, "atom2_serNum": 12415, "donAcc_type": "standard", "distance": 2.901, "atom1_id": "///I/32/O6", "atom2_id": "///J/149/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 770, "atom1_serNum": 6530, "atom2_serNum": 12413, "donAcc_type": "standard", "distance": 2.905, "atom1_id": "///I/32/N1", "atom2_id": "///J/149/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 771, "atom1_serNum": 6532, "atom2_serNum": 12412, "donAcc_type": "standard", "distance": 2.781, "atom1_id": "///I/32/N2", "atom2_id": "///J/149/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 772, "atom1_serNum": 6548, "atom2_serNum": 12396, "donAcc_type": "standard", "distance": 2.798, "atom1_id": "///I/33/O2", "atom2_id": "///J/148/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 773, "atom1_serNum": 6549, "atom2_serNum": 12394, "donAcc_type": "standard", "distance": 2.917, "atom1_id": "///I/33/N3", "atom2_id": "///J/148/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 774, "atom1_serNum": 6551, "atom2_serNum": 12393, "donAcc_type": "standard", "distance": 2.909, "atom1_id": "///I/33/N4", "atom2_id": "///J/148/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 775, "atom1_serNum": 6570, "atom2_serNum": 12373, "donAcc_type": "standard", "distance": 2.944, "atom1_id": "///I/34/N6", "atom2_id": "///J/147/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 776, "atom1_serNum": 6571, "atom2_serNum": 12371, "donAcc_type": "standard", "distance": 2.844, "atom1_id": "///I/34/N1", "atom2_id": "///J/147/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 777, "atom1_serNum": 6591, "atom2_serNum": 12354, "donAcc_type": "standard", "distance": 2.934, "atom1_id": "///I/35/O6", "atom2_id": "///J/146/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 778, "atom1_serNum": 6592, "atom2_serNum": 12352, "donAcc_type": "standard", "distance": 2.907, "atom1_id": "///I/35/N1", "atom2_id": "///J/146/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 779, "atom1_serNum": 6594, "atom2_serNum": 12351, "donAcc_type": "standard", "distance": 2.778, "atom1_id": "///I/35/N2", "atom2_id": "///J/146/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 780, "atom1_serNum": 6613, "atom2_serNum": 12334, "donAcc_type": "standard", "distance": 2.989, "atom1_id": "///I/36/N6", "atom2_id": "///J/145/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 781, "atom1_serNum": 6614, "atom2_serNum": 12332, "donAcc_type": "standard", "distance": 2.829, "atom1_id": "///I/36/N1", "atom2_id": "///J/145/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 782, "atom1_serNum": 6632, "atom2_serNum": 12314, "donAcc_type": "standard", "distance": 2.852, "atom1_id": "///I/37/N3", "atom2_id": "///J/144/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 783, "atom1_serNum": 6634, "atom2_serNum": 12313, "donAcc_type": "standard", "distance": 2.949, "atom1_id": "///I/37/O4", "atom2_id": "///J/144/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 784, "atom1_serNum": 6652, "atom2_serNum": 12293, "donAcc_type": "standard", "distance": 2.843, "atom1_id": "///I/38/N3", "atom2_id": "///J/143/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 785, "atom1_serNum": 6654, "atom2_serNum": 12292, "donAcc_type": "standard", "distance": 2.953, "atom1_id": "///I/38/O4", "atom2_id": "///J/143/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 786, "atom1_serNum": 6671, "atom2_serNum": 12273, "donAcc_type": "standard", "distance": 2.787, "atom1_id": "///I/39/O2", "atom2_id": "///J/142/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 787, "atom1_serNum": 6672, "atom2_serNum": 12271, "donAcc_type": "standard", "distance": 2.892, "atom1_id": "///I/39/N3", "atom2_id": "///J/142/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 788, "atom1_serNum": 6674, "atom2_serNum": 12270, "donAcc_type": "standard", "distance": 2.941, "atom1_id": "///I/39/N4", "atom2_id": "///J/142/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 789, "atom1_serNum": 6691, "atom2_serNum": 12250, "donAcc_type": "standard", "distance": 2.954, "atom1_id": "///I/40/N3", "atom2_id": "///J/141/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 790, "atom1_serNum": 6693, "atom2_serNum": 12249, "donAcc_type": "standard", "distance": 2.825, "atom1_id": "///I/40/O4", "atom2_id": "///J/141/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 791, "atom1_serNum": 6713, "atom2_serNum": 12229, "donAcc_type": "standard", "distance": 2.999, "atom1_id": "///I/41/N6", "atom2_id": "///J/140/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 792, "atom1_serNum": 6714, "atom2_serNum": 12208, "donAcc_type": "standard", "distance": 3.087, "atom1_id": "///I/41/N1", "atom2_id": "///J/139/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 793, "atom1_serNum": 6714, "atom2_serNum": 12227, "donAcc_type": "standard", "distance": 2.822, "atom1_id": "///I/41/N1", "atom2_id": "///J/140/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 794, "atom1_serNum": 6731, "atom2_serNum": 12210, "donAcc_type": "standard", "distance": 2.770, "atom1_id": "///I/42/O2", "atom2_id": "///J/139/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 795, "atom1_serNum": 6732, "atom2_serNum": 12208, "donAcc_type": "standard", "distance": 2.919, "atom1_id": "///I/42/N3", "atom2_id": "///J/139/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 796, "atom1_serNum": 6734, "atom2_serNum": 12185, "donAcc_type": "standard", "distance": 2.648, "atom1_id": "///I/42/N4", "atom2_id": "///J/138/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 797, "atom1_serNum": 6734, "atom2_serNum": 12207, "donAcc_type": "standard", "distance": 2.975, "atom1_id": "///I/42/N4", "atom2_id": "///J/139/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 798, "atom1_serNum": 6793, "atom2_serNum": 12145, "donAcc_type": "standard", "distance": 2.984, "atom1_id": "///I/45/N6", "atom2_id": "///J/136/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 799, "atom1_serNum": 6794, "atom2_serNum": 12143, "donAcc_type": "standard", "distance": 2.831, "atom1_id": "///I/45/N1", "atom2_id": "///J/136/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 800, "atom1_serNum": 6814, "atom2_serNum": 12125, "donAcc_type": "standard", "distance": 2.916, "atom1_id": "///I/46/N6", "atom2_id": "///J/135/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 801, "atom1_serNum": 6815, "atom2_serNum": 12123, "donAcc_type": "standard", "distance": 2.851, "atom1_id": "///I/46/N1", "atom2_id": "///J/135/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 802, "atom1_serNum": 6835, "atom2_serNum": 12105, "donAcc_type": "standard", "distance": 2.946, "atom1_id": "///I/47/N6", "atom2_id": "///J/134/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 803, "atom1_serNum": 6836, "atom2_serNum": 12103, "donAcc_type": "standard", "distance": 2.811, "atom1_id": "///I/47/N1", "atom2_id": "///J/134/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 804, "atom1_serNum": 6856, "atom2_serNum": 12086, "donAcc_type": "standard", "distance": 2.921, "atom1_id": "///I/48/O6", "atom2_id": "///J/133/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 805, "atom1_serNum": 6857, "atom2_serNum": 12084, "donAcc_type": "standard", "distance": 2.895, "atom1_id": "///I/48/N1", "atom2_id": "///J/133/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 806, "atom1_serNum": 6859, "atom2_serNum": 12083, "donAcc_type": "standard", "distance": 2.770, "atom1_id": "///I/48/N2", "atom2_id": "///J/133/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 807, "atom1_serNum": 6876, "atom2_serNum": 12066, "donAcc_type": "standard", "distance": 2.841, "atom1_id": "///I/49/N3", "atom2_id": "///J/132/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 808, "atom1_serNum": 6878, "atom2_serNum": 12065, "donAcc_type": "standard", "distance": 2.976, "atom1_id": "///I/49/O4", "atom2_id": "///J/132/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 809, "atom1_serNum": 6898, "atom2_serNum": 12046, "donAcc_type": "standard", "distance": 2.921, "atom1_id": "///I/50/O6", "atom2_id": "///J/131/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 810, "atom1_serNum": 6899, "atom2_serNum": 12044, "donAcc_type": "standard", "distance": 2.892, "atom1_id": "///I/50/N1", "atom2_id": "///J/131/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 811, "atom1_serNum": 6901, "atom2_serNum": 12043, "donAcc_type": "standard", "distance": 2.793, "atom1_id": "///I/50/N2", "atom2_id": "///J/131/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 812, "atom1_serNum": 6918, "atom2_serNum": 12026, "donAcc_type": "standard", "distance": 2.941, "atom1_id": "///I/51/N3", "atom2_id": "///J/130/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 813, "atom1_serNum": 6920, "atom2_serNum": 12005, "donAcc_type": "questionable", "distance": 3.268, "atom1_id": "///I/51/O4", "atom2_id": "///J/129/O4", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 814, "atom1_serNum": 6920, "atom2_serNum": 12025, "donAcc_type": "standard", "distance": 2.842, "atom1_id": "///I/51/O4", "atom2_id": "///J/130/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 815, "atom1_serNum": 6940, "atom2_serNum": 11985, "donAcc_type": "standard", "distance": 3.215, "atom1_id": "///I/52/N6", "atom2_id": "///J/128/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 816, "atom1_serNum": 6940, "atom2_serNum": 12005, "donAcc_type": "standard", "distance": 2.796, "atom1_id": "///I/52/N6", "atom2_id": "///J/129/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 817, "atom1_serNum": 6941, "atom2_serNum": 12003, "donAcc_type": "standard", "distance": 2.920, "atom1_id": "///I/52/N1", "atom2_id": "///J/129/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 818, "atom1_serNum": 6959, "atom2_serNum": 11985, "donAcc_type": "standard", "distance": 2.893, "atom1_id": "///I/53/N3", "atom2_id": "///J/128/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 819, "atom1_serNum": 6961, "atom2_serNum": 11963, "donAcc_type": "standard", "distance": 2.509, "atom1_id": "///I/53/O4", "atom2_id": "///J/127/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 820, "atom1_serNum": 6961, "atom2_serNum": 11984, "donAcc_type": "standard", "distance": 2.944, "atom1_id": "///I/53/O4", "atom2_id": "///J/128/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 821, "atom1_serNum": 6979, "atom2_serNum": 11964, "donAcc_type": "standard", "distance": 2.922, "atom1_id": "///I/54/N3", "atom2_id": "///J/127/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 822, "atom1_serNum": 6981, "atom2_serNum": 11963, "donAcc_type": "standard", "distance": 2.857, "atom1_id": "///I/54/O4", "atom2_id": "///J/127/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 823, "atom1_serNum": 6999, "atom2_serNum": 11943, "donAcc_type": "standard", "distance": 2.889, "atom1_id": "///I/55/N3", "atom2_id": "///J/126/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 824, "atom1_serNum": 7001, "atom2_serNum": 11942, "donAcc_type": "standard", "distance": 2.931, "atom1_id": "///I/55/O4", "atom2_id": "///J/126/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 825, "atom1_serNum": 7021, "atom2_serNum": 11904, "donAcc_type": "standard", "distance": 2.704, "atom1_id": "///I/56/O6", "atom2_id": "///J/124/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 826, "atom1_serNum": 7021, "atom2_serNum": 11923, "donAcc_type": "standard", "distance": 2.873, "atom1_id": "///I/56/O6", "atom2_id": "///J/125/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 827, "atom1_serNum": 7022, "atom2_serNum": 11921, "donAcc_type": "standard", "distance": 2.894, "atom1_id": "///I/56/N1", "atom2_id": "///J/125/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 828, "atom1_serNum": 7024, "atom2_serNum": 11920, "donAcc_type": "standard", "distance": 2.799, "atom1_id": "///I/56/N2", "atom2_id": "///J/125/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 829, "atom1_serNum": 7043, "atom2_serNum": 11904, "donAcc_type": "standard", "distance": 2.908, "atom1_id": "///I/57/O6", "atom2_id": "///J/124/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 830, "atom1_serNum": 7044, "atom2_serNum": 11902, "donAcc_type": "standard", "distance": 2.902, "atom1_id": "///I/57/N1", "atom2_id": "///J/124/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 831, "atom1_serNum": 7046, "atom2_serNum": 11901, "donAcc_type": "standard", "distance": 2.780, "atom1_id": "///I/57/N2", "atom2_id": "///J/124/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 832, "atom1_serNum": 7065, "atom2_serNum": 11884, "donAcc_type": "standard", "distance": 2.950, "atom1_id": "///I/58/N6", "atom2_id": "///J/123/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 833, "atom1_serNum": 7066, "atom2_serNum": 11882, "donAcc_type": "standard", "distance": 2.863, "atom1_id": "///I/58/N1", "atom2_id": "///J/123/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 834, "atom1_serNum": 7086, "atom2_serNum": 11864, "donAcc_type": "standard", "distance": 2.959, "atom1_id": "///I/59/N6", "atom2_id": "///J/122/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 835, "atom1_serNum": 7087, "atom2_serNum": 11862, "donAcc_type": "standard", "distance": 2.855, "atom1_id": "///I/59/N1", "atom2_id": "///J/122/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 836, "atom1_serNum": 7107, "atom2_serNum": 11844, "donAcc_type": "standard", "distance": 2.943, "atom1_id": "///I/60/N6", "atom2_id": "///J/121/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 837, "atom1_serNum": 7108, "atom2_serNum": 11823, "donAcc_type": "standard", "distance": 2.956, "atom1_id": "///I/60/N1", "atom2_id": "///J/120/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 838, "atom1_serNum": 7108, "atom2_serNum": 11842, "donAcc_type": "standard", "distance": 2.871, "atom1_id": "///I/60/N1", "atom2_id": "///J/121/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 839, "atom1_serNum": 7125, "atom2_serNum": 11825, "donAcc_type": "standard", "distance": 2.762, "atom1_id": "///I/61/O2", "atom2_id": "///J/120/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 840, "atom1_serNum": 7126, "atom2_serNum": 11823, "donAcc_type": "standard", "distance": 2.898, "atom1_id": "///I/61/N3", "atom2_id": "///J/120/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 841, "atom1_serNum": 7128, "atom2_serNum": 11822, "donAcc_type": "standard", "distance": 2.932, "atom1_id": "///I/61/N4", "atom2_id": "///J/120/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 842, "atom1_serNum": 7145, "atom2_serNum": 11802, "donAcc_type": "standard", "distance": 2.898, "atom1_id": "///I/62/N3", "atom2_id": "///J/119/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 843, "atom1_serNum": 7147, "atom2_serNum": 11782, "donAcc_type": "standard", "distance": 3.134, "atom1_id": "///I/62/O4", "atom2_id": "///J/118/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 844, "atom1_serNum": 7147, "atom2_serNum": 11801, "donAcc_type": "standard", "distance": 2.911, "atom1_id": "///I/62/O4", "atom2_id": "///J/119/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 845, "atom1_serNum": 7167, "atom2_serNum": 11782, "donAcc_type": "standard", "distance": 2.857, "atom1_id": "///I/63/O6", "atom2_id": "///J/118/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 846, "atom1_serNum": 7168, "atom2_serNum": 11780, "donAcc_type": "standard", "distance": 2.909, "atom1_id": "///I/63/N1", "atom2_id": "///J/118/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 847, "atom1_serNum": 7170, "atom2_serNum": 11779, "donAcc_type": "standard", "distance": 2.826, "atom1_id": "///I/63/N2", "atom2_id": "///J/118/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 848, "atom1_serNum": 7186, "atom2_serNum": 11763, "donAcc_type": "standard", "distance": 2.766, "atom1_id": "///I/64/O2", "atom2_id": "///J/117/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 849, "atom1_serNum": 7187, "atom2_serNum": 11761, "donAcc_type": "standard", "distance": 2.898, "atom1_id": "///I/64/N3", "atom2_id": "///J/117/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 850, "atom1_serNum": 7189, "atom2_serNum": 11760, "donAcc_type": "standard", "distance": 2.920, "atom1_id": "///I/64/N4", "atom2_id": "///J/117/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 851, "atom1_serNum": 7206, "atom2_serNum": 11740, "donAcc_type": "standard", "distance": 2.873, "atom1_id": "///I/65/N3", "atom2_id": "///J/116/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 852, "atom1_serNum": 7208, "atom2_serNum": 11739, "donAcc_type": "standard", "distance": 2.924, "atom1_id": "///I/65/O4", "atom2_id": "///J/116/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 853, "atom1_serNum": 7225, "atom2_serNum": 11720, "donAcc_type": "standard", "distance": 2.723, "atom1_id": "///I/66/O2", "atom2_id": "///J/115/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 854, "atom1_serNum": 7226, "atom2_serNum": 11718, "donAcc_type": "standard", "distance": 2.889, "atom1_id": "///I/66/N3", "atom2_id": "///J/115/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 855, "atom1_serNum": 7228, "atom2_serNum": 11717, "donAcc_type": "standard", "distance": 2.932, "atom1_id": "///I/66/N4", "atom2_id": "///J/115/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 856, "atom1_serNum": 7244, "atom2_serNum": 11698, "donAcc_type": "standard", "distance": 2.761, "atom1_id": "///I/67/O2", "atom2_id": "///J/114/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 857, "atom1_serNum": 7245, "atom2_serNum": 11696, "donAcc_type": "standard", "distance": 2.889, "atom1_id": "///I/67/N3", "atom2_id": "///J/114/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 858, "atom1_serNum": 7247, "atom2_serNum": 11695, "donAcc_type": "standard", "distance": 2.896, "atom1_id": "///I/67/N4", "atom2_id": "///J/114/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 859, "atom1_serNum": 7266, "atom2_serNum": 11675, "donAcc_type": "standard", "distance": 3.246, "atom1_id": "///I/68/N6", "atom2_id": "///J/113/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 860, "atom1_serNum": 7304, "atom2_serNum": 11635, "donAcc_type": "standard", "distance": 2.753, "atom1_id": "///I/70/O2", "atom2_id": "///J/111/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 861, "atom1_serNum": 7305, "atom2_serNum": 11633, "donAcc_type": "standard", "distance": 2.896, "atom1_id": "///I/70/N3", "atom2_id": "///J/111/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 862, "atom1_serNum": 7307, "atom2_serNum": 11632, "donAcc_type": "standard", "distance": 2.920, "atom1_id": "///I/70/N4", "atom2_id": "///J/111/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 863, "atom1_serNum": 7326, "atom2_serNum": 11612, "donAcc_type": "standard", "distance": 3.011, "atom1_id": "///I/71/N6", "atom2_id": "///J/110/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 864, "atom1_serNum": 7327, "atom2_serNum": 11610, "donAcc_type": "standard", "distance": 2.815, "atom1_id": "///I/71/N1", "atom2_id": "///J/110/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 865, "atom1_serNum": 7347, "atom2_serNum": 11592, "donAcc_type": "standard", "distance": 2.890, "atom1_id": "///I/72/N6", "atom2_id": "///J/109/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 866, "atom1_serNum": 7348, "atom2_serNum": 11590, "donAcc_type": "standard", "distance": 2.876, "atom1_id": "///I/72/N1", "atom2_id": "///J/109/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 867, "atom1_serNum": 7369, "atom2_serNum": 11572, "donAcc_type": "questionable", "distance": 2.908, "atom1_id": "///I/73/N1", "atom2_id": "///J/108/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 868, "atom1_serNum": 7389, "atom2_serNum": 11552, "donAcc_type": "standard", "distance": 3.039, "atom1_id": "///I/74/N6", "atom2_id": "///J/107/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 869, "atom1_serNum": 7390, "atom2_serNum": 11550, "donAcc_type": "standard", "distance": 2.791, "atom1_id": "///I/74/N1", "atom2_id": "///J/107/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 870, "atom1_serNum": 7410, "atom2_serNum": 11533, "donAcc_type": "standard", "distance": 2.885, "atom1_id": "///I/75/O6", "atom2_id": "///J/106/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 871, "atom1_serNum": 7411, "atom2_serNum": 11531, "donAcc_type": "standard", "distance": 2.877, "atom1_id": "///I/75/N1", "atom2_id": "///J/106/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 872, "atom1_serNum": 7413, "atom2_serNum": 11530, "donAcc_type": "standard", "distance": 2.773, "atom1_id": "///I/75/N2", "atom2_id": "///J/106/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 873, "atom1_serNum": 7432, "atom2_serNum": 11514, "donAcc_type": "standard", "distance": 2.915, "atom1_id": "///I/76/O6", "atom2_id": "///J/105/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 874, "atom1_serNum": 7433, "atom2_serNum": 11512, "donAcc_type": "standard", "distance": 2.885, "atom1_id": "///I/76/N1", "atom2_id": "///J/105/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 875, "atom1_serNum": 7435, "atom2_serNum": 11511, "donAcc_type": "standard", "distance": 2.740, "atom1_id": "///I/76/N2", "atom2_id": "///J/105/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 876, "atom1_serNum": 7451, "atom2_serNum": 11495, "donAcc_type": "standard", "distance": 2.770, "atom1_id": "///I/77/O2", "atom2_id": "///J/104/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 877, "atom1_serNum": 7452, "atom2_serNum": 11493, "donAcc_type": "standard", "distance": 2.891, "atom1_id": "///I/77/N3", "atom2_id": "///J/104/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 878, "atom1_serNum": 7454, "atom2_serNum": 11492, "donAcc_type": "standard", "distance": 2.899, "atom1_id": "///I/77/N4", "atom2_id": "///J/104/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 879, "atom1_serNum": 7473, "atom2_serNum": 11472, "donAcc_type": "standard", "distance": 2.998, "atom1_id": "///I/78/N6", "atom2_id": "///J/103/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 880, "atom1_serNum": 7474, "atom2_serNum": 11470, "donAcc_type": "standard", "distance": 2.838, "atom1_id": "///I/78/N1", "atom2_id": "///J/103/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 881, "atom1_serNum": 7479, "atom2_serNum": 13578, "donAcc_type": "standard", "distance": 2.345, "atom1_id": "///I/79/OP1", "atom2_id": "///K/1140/NZ", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 882, "atom1_serNum": 7492, "atom2_serNum": 11452, "donAcc_type": "standard", "distance": 2.820, "atom1_id": "///I/79/N3", "atom2_id": "///J/102/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 883, "atom1_serNum": 7494, "atom2_serNum": 11451, "donAcc_type": "standard", "distance": 2.954, "atom1_id": "///I/79/O4", "atom2_id": "///J/102/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 884, "atom1_serNum": 7514, "atom2_serNum": 11432, "donAcc_type": "standard", "distance": 2.937, "atom1_id": "///I/80/O6", "atom2_id": "///J/101/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 885, "atom1_serNum": 7515, "atom2_serNum": 11412, "donAcc_type": "standard", "distance": 3.148, "atom1_id": "///I/80/N1", "atom2_id": "///J/100/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 886, "atom1_serNum": 7515, "atom2_serNum": 11430, "donAcc_type": "standard", "distance": 2.907, "atom1_id": "///I/80/N1", "atom2_id": "///J/101/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 887, "atom1_serNum": 7517, "atom2_serNum": 11429, "donAcc_type": "standard", "distance": 2.779, "atom1_id": "///I/80/N2", "atom2_id": "///J/101/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 888, "atom1_serNum": 7534, "atom2_serNum": 11391, "donAcc_type": "standard", "distance": 3.897, "atom1_id": "///I/81/N3", "atom2_id": "///J/99/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 889, "atom1_serNum": 7534, "atom2_serNum": 11412, "donAcc_type": "standard", "distance": 2.883, "atom1_id": "///I/81/N3", "atom2_id": "///J/100/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 890, "atom1_serNum": 7536, "atom2_serNum": 11390, "donAcc_type": "standard", "distance": 3.105, "atom1_id": "///I/81/O4", "atom2_id": "///J/99/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 891, "atom1_serNum": 7536, "atom2_serNum": 11411, "donAcc_type": "standard", "distance": 2.917, "atom1_id": "///I/81/O4", "atom2_id": "///J/100/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 892, "atom1_serNum": 7554, "atom2_serNum": 11391, "donAcc_type": "standard", "distance": 2.906, "atom1_id": "///I/82/N3", "atom2_id": "///J/99/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 893, "atom1_serNum": 7556, "atom2_serNum": 11390, "donAcc_type": "standard", "distance": 2.885, "atom1_id": "///I/82/O4", "atom2_id": "///J/99/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 894, "atom1_serNum": 7573, "atom2_serNum": 11371, "donAcc_type": "standard", "distance": 2.757, "atom1_id": "///I/83/O2", "atom2_id": "///J/98/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 895, "atom1_serNum": 7574, "atom2_serNum": 11369, "donAcc_type": "standard", "distance": 2.900, "atom1_id": "///I/83/N3", "atom2_id": "///J/98/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 896, "atom1_serNum": 7576, "atom2_serNum": 11368, "donAcc_type": "standard", "distance": 2.926, "atom1_id": "///I/83/N4", "atom2_id": "///J/98/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 897, "atom1_serNum": 7595, "atom2_serNum": 11348, "donAcc_type": "standard", "distance": 2.975, "atom1_id": "///I/84/N6", "atom2_id": "///J/97/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 898, "atom1_serNum": 7596, "atom2_serNum": 11346, "donAcc_type": "standard", "distance": 2.842, "atom1_id": "///I/84/N1", "atom2_id": "///J/97/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 899, "atom1_serNum": 7616, "atom2_serNum": 11329, "donAcc_type": "standard", "distance": 2.923, "atom1_id": "///I/85/O6", "atom2_id": "///J/96/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 900, "atom1_serNum": 7617, "atom2_serNum": 11327, "donAcc_type": "standard", "distance": 2.888, "atom1_id": "///I/85/N1", "atom2_id": "///J/96/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 901, "atom1_serNum": 7619, "atom2_serNum": 11326, "donAcc_type": "standard", "distance": 2.759, "atom1_id": "///I/85/N2", "atom2_id": "///J/96/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 902, "atom1_serNum": 7635, "atom2_serNum": 11310, "donAcc_type": "standard", "distance": 2.788, "atom1_id": "///I/86/O2", "atom2_id": "///J/95/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 903, "atom1_serNum": 7636, "atom2_serNum": 11308, "donAcc_type": "standard", "distance": 2.899, "atom1_id": "///I/86/N3", "atom2_id": "///J/95/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 904, "atom1_serNum": 7638, "atom2_serNum": 11307, "donAcc_type": "standard", "distance": 2.902, "atom1_id": "///I/86/N4", "atom2_id": "///J/95/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 905, "atom1_serNum": 7655, "atom2_serNum": 11287, "donAcc_type": "standard", "distance": 2.812, "atom1_id": "///I/87/N3", "atom2_id": "///J/94/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 906, "atom1_serNum": 7657, "atom2_serNum": 11286, "donAcc_type": "standard", "distance": 2.966, "atom1_id": "///I/87/O4", "atom2_id": "///J/94/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 907, "atom1_serNum": 7677, "atom2_serNum": 11267, "donAcc_type": "standard", "distance": 2.925, "atom1_id": "///I/88/O6", "atom2_id": "///J/93/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 908, "atom1_serNum": 7678, "atom2_serNum": 11265, "donAcc_type": "standard", "distance": 2.878, "atom1_id": "///I/88/N1", "atom2_id": "///J/93/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 909, "atom1_serNum": 7680, "atom2_serNum": 11264, "donAcc_type": "standard", "distance": 2.725, "atom1_id": "///I/88/N2", "atom2_id": "///J/93/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 910, "atom1_serNum": 7699, "atom2_serNum": 11247, "donAcc_type": "standard", "distance": 2.963, "atom1_id": "///I/89/N6", "atom2_id": "///J/92/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 911, "atom1_serNum": 7700, "atom2_serNum": 11245, "donAcc_type": "standard", "distance": 2.861, "atom1_id": "///I/89/N1", "atom2_id": "///J/92/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 912, "atom1_serNum": 7720, "atom2_serNum": 11227, "donAcc_type": "standard", "distance": 2.937, "atom1_id": "///I/90/N6", "atom2_id": "///J/91/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 913, "atom1_serNum": 7721, "atom2_serNum": 11225, "donAcc_type": "standard", "distance": 2.874, "atom1_id": "///I/90/N1", "atom2_id": "///J/91/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 914, "atom1_serNum": 7739, "atom2_serNum": 11207, "donAcc_type": "standard", "distance": 2.882, "atom1_id": "///I/91/N3", "atom2_id": "///J/90/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 915, "atom1_serNum": 7741, "atom2_serNum": 11185, "donAcc_type": "standard", "distance": 3.198, "atom1_id": "///I/91/O4", "atom2_id": "///J/89/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 916, "atom1_serNum": 7741, "atom2_serNum": 11206, "donAcc_type": "standard", "distance": 2.927, "atom1_id": "///I/91/O4", "atom2_id": "///J/90/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 917, "atom1_serNum": 7759, "atom2_serNum": 11186, "donAcc_type": "standard", "distance": 2.888, "atom1_id": "///I/92/N3", "atom2_id": "///J/89/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 918, "atom1_serNum": 7761, "atom2_serNum": 11185, "donAcc_type": "standard", "distance": 2.877, "atom1_id": "///I/92/O4", "atom2_id": "///J/89/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 919, "atom1_serNum": 7778, "atom2_serNum": 11166, "donAcc_type": "standard", "distance": 2.782, "atom1_id": "///I/93/O2", "atom2_id": "///J/88/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 920, "atom1_serNum": 7779, "atom2_serNum": 11164, "donAcc_type": "standard", "distance": 2.894, "atom1_id": "///I/93/N3", "atom2_id": "///J/88/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 921, "atom1_serNum": 7781, "atom2_serNum": 11163, "donAcc_type": "standard", "distance": 2.902, "atom1_id": "///I/93/N4", "atom2_id": "///J/88/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 922, "atom1_serNum": 7800, "atom2_serNum": 11143, "donAcc_type": "standard", "distance": 3.037, "atom1_id": "///I/94/N6", "atom2_id": "///J/87/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 923, "atom1_serNum": 7801, "atom2_serNum": 11141, "donAcc_type": "standard", "distance": 2.827, "atom1_id": "///I/94/N1", "atom2_id": "///J/87/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 924, "atom1_serNum": 7821, "atom2_serNum": 11124, "donAcc_type": "standard", "distance": 2.963, "atom1_id": "///I/95/O6", "atom2_id": "///J/86/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 925, "atom1_serNum": 7822, "atom2_serNum": 11122, "donAcc_type": "standard", "distance": 2.906, "atom1_id": "///I/95/N1", "atom2_id": "///J/86/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 926, "atom1_serNum": 7824, "atom2_serNum": 11121, "donAcc_type": "standard", "distance": 2.762, "atom1_id": "///I/95/N2", "atom2_id": "///J/86/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 927, "atom1_serNum": 7840, "atom2_serNum": 11105, "donAcc_type": "standard", "distance": 2.821, "atom1_id": "///I/96/O2", "atom2_id": "///J/85/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 928, "atom1_serNum": 7841, "atom2_serNum": 11103, "donAcc_type": "standard", "distance": 2.914, "atom1_id": "///I/96/N3", "atom2_id": "///J/85/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 929, "atom1_serNum": 7843, "atom2_serNum": 11102, "donAcc_type": "standard", "distance": 2.912, "atom1_id": "///I/96/N4", "atom2_id": "///J/85/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 930, "atom1_serNum": 7860, "atom2_serNum": 11082, "donAcc_type": "standard", "distance": 2.849, "atom1_id": "///I/97/N3", "atom2_id": "///J/84/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 931, "atom1_serNum": 7862, "atom2_serNum": 11081, "donAcc_type": "standard", "distance": 2.950, "atom1_id": "///I/97/O4", "atom2_id": "///J/84/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 932, "atom1_serNum": 7882, "atom2_serNum": 11062, "donAcc_type": "standard", "distance": 2.895, "atom1_id": "///I/98/O6", "atom2_id": "///J/83/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 933, "atom1_serNum": 7883, "atom2_serNum": 11060, "donAcc_type": "standard", "distance": 2.896, "atom1_id": "///I/98/N1", "atom2_id": "///J/83/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 934, "atom1_serNum": 7885, "atom2_serNum": 11059, "donAcc_type": "standard", "distance": 2.799, "atom1_id": "///I/98/N2", "atom2_id": "///J/83/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 935, "atom1_serNum": 7904, "atom2_serNum": 11042, "donAcc_type": "standard", "distance": 2.894, "atom1_id": "///I/99/N6", "atom2_id": "///J/82/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 936, "atom1_serNum": 7905, "atom2_serNum": 11040, "donAcc_type": "standard", "distance": 2.875, "atom1_id": "///I/99/N1", "atom2_id": "///J/82/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 937, "atom1_serNum": 7925, "atom2_serNum": 11022, "donAcc_type": "standard", "distance": 2.875, "atom1_id": "///I/100/N6", "atom2_id": "///J/81/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 938, "atom1_serNum": 7926, "atom2_serNum": 11020, "donAcc_type": "standard", "distance": 2.891, "atom1_id": "///I/100/N1", "atom2_id": "///J/81/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 939, "atom1_serNum": 7943, "atom2_serNum": 11003, "donAcc_type": "standard", "distance": 2.795, "atom1_id": "///I/101/O2", "atom2_id": "///J/80/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 940, "atom1_serNum": 7944, "atom2_serNum": 11001, "donAcc_type": "standard", "distance": 2.906, "atom1_id": "///I/101/N3", "atom2_id": "///J/80/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 941, "atom1_serNum": 7946, "atom2_serNum": 10980, "donAcc_type": "standard", "distance": 3.178, "atom1_id": "///I/101/N4", "atom2_id": "///J/79/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 942, "atom1_serNum": 7946, "atom2_serNum": 11000, "donAcc_type": "standard", "distance": 2.917, "atom1_id": "///I/101/N4", "atom2_id": "///J/80/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 943, "atom1_serNum": 7965, "atom2_serNum": 10980, "donAcc_type": "standard", "distance": 2.895, "atom1_id": "///I/102/N6", "atom2_id": "///J/79/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 944, "atom1_serNum": 7966, "atom2_serNum": 10978, "donAcc_type": "standard", "distance": 2.845, "atom1_id": "///I/102/N1", "atom2_id": "///J/79/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 945, "atom1_serNum": 7984, "atom2_serNum": 10960, "donAcc_type": "standard", "distance": 2.891, "atom1_id": "///I/103/N3", "atom2_id": "///J/78/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 946, "atom1_serNum": 7986, "atom2_serNum": 10940, "donAcc_type": "standard", "distance": 2.605, "atom1_id": "///I/103/O4", "atom2_id": "///J/77/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 947, "atom1_serNum": 7986, "atom2_serNum": 10959, "donAcc_type": "standard", "distance": 2.904, "atom1_id": "///I/103/O4", "atom2_id": "///J/78/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 948, "atom1_serNum": 8006, "atom2_serNum": 10940, "donAcc_type": "standard", "distance": 2.915, "atom1_id": "///I/104/O6", "atom2_id": "///J/77/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 949, "atom1_serNum": 8007, "atom2_serNum": 10938, "donAcc_type": "standard", "distance": 2.909, "atom1_id": "///I/104/N1", "atom2_id": "///J/77/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 950, "atom1_serNum": 8009, "atom2_serNum": 10937, "donAcc_type": "standard", "distance": 2.772, "atom1_id": "///I/104/N2", "atom2_id": "///J/77/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 951, "atom1_serNum": 8025, "atom2_serNum": 10921, "donAcc_type": "standard", "distance": 2.817, "atom1_id": "///I/105/O2", "atom2_id": "///J/76/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 952, "atom1_serNum": 8026, "atom2_serNum": 10919, "donAcc_type": "standard", "distance": 2.894, "atom1_id": "///I/105/N3", "atom2_id": "///J/76/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 953, "atom1_serNum": 8028, "atom2_serNum": 10918, "donAcc_type": "standard", "distance": 2.931, "atom1_id": "///I/105/N4", "atom2_id": "///J/76/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 954, "atom1_serNum": 8044, "atom2_serNum": 10899, "donAcc_type": "standard", "distance": 2.775, "atom1_id": "///I/106/O2", "atom2_id": "///J/75/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 955, "atom1_serNum": 8045, "atom2_serNum": 10897, "donAcc_type": "standard", "distance": 2.879, "atom1_id": "///I/106/N3", "atom2_id": "///J/75/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 956, "atom1_serNum": 8047, "atom2_serNum": 10896, "donAcc_type": "standard", "distance": 2.931, "atom1_id": "///I/106/N4", "atom2_id": "///J/75/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 957, "atom1_serNum": 8064, "atom2_serNum": 10876, "donAcc_type": "standard", "distance": 2.880, "atom1_id": "///I/107/N3", "atom2_id": "///J/74/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 958, "atom1_serNum": 8066, "atom2_serNum": 10875, "donAcc_type": "standard", "distance": 2.989, "atom1_id": "///I/107/O4", "atom2_id": "///J/74/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 959, "atom1_serNum": 8084, "atom2_serNum": 10855, "donAcc_type": "standard", "distance": 2.882, "atom1_id": "///I/108/N3", "atom2_id": "///J/73/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 960, "atom1_serNum": 8086, "atom2_serNum": 10854, "donAcc_type": "standard", "distance": 2.975, "atom1_id": "///I/108/O4", "atom2_id": "///J/73/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 961, "atom1_serNum": 8104, "atom2_serNum": 10834, "donAcc_type": "standard", "distance": 2.857, "atom1_id": "///I/109/N3", "atom2_id": "///J/72/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 962, "atom1_serNum": 8106, "atom2_serNum": 10833, "donAcc_type": "standard", "distance": 2.964, "atom1_id": "///I/109/O4", "atom2_id": "///J/72/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 963, "atom1_serNum": 8124, "atom2_serNum": 10813, "donAcc_type": "standard", "distance": 2.906, "atom1_id": "///I/110/N3", "atom2_id": "///J/71/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 964, "atom1_serNum": 8126, "atom2_serNum": 10812, "donAcc_type": "standard", "distance": 2.869, "atom1_id": "///I/110/O4", "atom2_id": "///J/71/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 965, "atom1_serNum": 8146, "atom2_serNum": 10793, "donAcc_type": "standard", "distance": 2.890, "atom1_id": "///I/111/O6", "atom2_id": "///J/70/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 966, "atom1_serNum": 8147, "atom2_serNum": 10791, "donAcc_type": "standard", "distance": 2.887, "atom1_id": "///I/111/N1", "atom2_id": "///J/70/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 967, "atom1_serNum": 8149, "atom2_serNum": 10790, "donAcc_type": "standard", "distance": 2.792, "atom1_id": "///I/111/N2", "atom2_id": "///J/70/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 968, "atom1_serNum": 8168, "atom2_serNum": 10773, "donAcc_type": "standard", "distance": 2.895, "atom1_id": "///I/112/N6", "atom2_id": "///J/69/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 969, "atom1_serNum": 8169, "atom2_serNum": 10771, "donAcc_type": "standard", "distance": 2.885, "atom1_id": "///I/112/N1", "atom2_id": "///J/69/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 970, "atom1_serNum": 8187, "atom2_serNum": 10753, "donAcc_type": "standard", "distance": 2.895, "atom1_id": "///I/113/N3", "atom2_id": "///J/68/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 971, "atom1_serNum": 8189, "atom2_serNum": 10752, "donAcc_type": "standard", "distance": 2.860, "atom1_id": "///I/113/O4", "atom2_id": "///J/68/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 972, "atom1_serNum": 8209, "atom2_serNum": 10733, "donAcc_type": "standard", "distance": 2.847, "atom1_id": "///I/114/O6", "atom2_id": "///J/67/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 973, "atom1_serNum": 8210, "atom2_serNum": 10731, "donAcc_type": "standard", "distance": 2.907, "atom1_id": "///I/114/N1", "atom2_id": "///J/67/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 974, "atom1_serNum": 8212, "atom2_serNum": 10730, "donAcc_type": "standard", "distance": 2.827, "atom1_id": "///I/114/N2", "atom2_id": "///J/67/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 975, "atom1_serNum": 8231, "atom2_serNum": 10714, "donAcc_type": "standard", "distance": 2.942, "atom1_id": "///I/115/O6", "atom2_id": "///J/66/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 976, "atom1_serNum": 8232, "atom2_serNum": 10712, "donAcc_type": "standard", "distance": 2.900, "atom1_id": "///I/115/N1", "atom2_id": "///J/66/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 977, "atom1_serNum": 8234, "atom2_serNum": 10711, "donAcc_type": "standard", "distance": 2.753, "atom1_id": "///I/115/N2", "atom2_id": "///J/66/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 978, "atom1_serNum": 8253, "atom2_serNum": 10694, "donAcc_type": "standard", "distance": 3.001, "atom1_id": "///I/116/N6", "atom2_id": "///J/65/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 979, "atom1_serNum": 8254, "atom2_serNum": 10692, "donAcc_type": "standard", "distance": 2.798, "atom1_id": "///I/116/N1", "atom2_id": "///J/65/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 980, "atom1_serNum": 8274, "atom2_serNum": 10675, "donAcc_type": "standard", "distance": 2.943, "atom1_id": "///I/117/O6", "atom2_id": "///J/64/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 981, "atom1_serNum": 8275, "atom2_serNum": 10673, "donAcc_type": "standard", "distance": 2.915, "atom1_id": "///I/117/N1", "atom2_id": "///J/64/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 982, "atom1_serNum": 8277, "atom2_serNum": 10672, "donAcc_type": "standard", "distance": 2.785, "atom1_id": "///I/117/N2", "atom2_id": "///J/64/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 983, "atom1_serNum": 8293, "atom2_serNum": 10656, "donAcc_type": "standard", "distance": 2.761, "atom1_id": "///I/118/O2", "atom2_id": "///J/63/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 984, "atom1_serNum": 8294, "atom2_serNum": 10654, "donAcc_type": "standard", "distance": 2.897, "atom1_id": "///I/118/N3", "atom2_id": "///J/63/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 985, "atom1_serNum": 8296, "atom2_serNum": 10653, "donAcc_type": "standard", "distance": 2.929, "atom1_id": "///I/118/N4", "atom2_id": "///J/63/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 986, "atom1_serNum": 8315, "atom2_serNum": 10633, "donAcc_type": "standard", "distance": 2.889, "atom1_id": "///I/119/N6", "atom2_id": "///J/62/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 987, "atom1_serNum": 8316, "atom2_serNum": 10631, "donAcc_type": "standard", "distance": 2.890, "atom1_id": "///I/119/N1", "atom2_id": "///J/62/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 988, "atom1_serNum": 8336, "atom2_serNum": 10614, "donAcc_type": "standard", "distance": 2.926, "atom1_id": "///I/120/O6", "atom2_id": "///J/61/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 989, "atom1_serNum": 8337, "atom2_serNum": 10594, "donAcc_type": "standard", "distance": 3.226, "atom1_id": "///I/120/N1", "atom2_id": "///J/60/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 990, "atom1_serNum": 8337, "atom2_serNum": 10612, "donAcc_type": "standard", "distance": 2.902, "atom1_id": "///I/120/N1", "atom2_id": "///J/61/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 991, "atom1_serNum": 8339, "atom2_serNum": 10611, "donAcc_type": "standard", "distance": 2.787, "atom1_id": "///I/120/N2", "atom2_id": "///J/61/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 992, "atom1_serNum": 8356, "atom2_serNum": 10594, "donAcc_type": "standard", "distance": 2.921, "atom1_id": "///I/121/N3", "atom2_id": "///J/60/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 993, "atom1_serNum": 8358, "atom2_serNum": 10572, "donAcc_type": "standard", "distance": 3.175, "atom1_id": "///I/121/O4", "atom2_id": "///J/59/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 994, "atom1_serNum": 8358, "atom2_serNum": 10593, "donAcc_type": "standard", "distance": 2.854, "atom1_id": "///I/121/O4", "atom2_id": "///J/60/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 995, "atom1_serNum": 8376, "atom2_serNum": 10552, "donAcc_type": "standard", "distance": 3.303, "atom1_id": "///I/122/N3", "atom2_id": "///J/58/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 996, "atom1_serNum": 8376, "atom2_serNum": 10573, "donAcc_type": "standard", "distance": 2.971, "atom1_id": "///I/122/N3", "atom2_id": "///J/59/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 997, "atom1_serNum": 8378, "atom2_serNum": 10551, "donAcc_type": "standard", "distance": 2.382, "atom1_id": "///I/122/O4", "atom2_id": "///J/58/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 998, "atom1_serNum": 8378, "atom2_serNum": 10572, "donAcc_type": "standard", "distance": 2.826, "atom1_id": "///I/122/O4", "atom2_id": "///J/59/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 999, "atom1_serNum": 8396, "atom2_serNum": 10552, "donAcc_type": "standard", "distance": 2.975, "atom1_id": "///I/123/N3", "atom2_id": "///J/58/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1000, "atom1_serNum": 8398, "atom2_serNum": 10551, "donAcc_type": "standard", "distance": 2.810, "atom1_id": "///I/123/O4", "atom2_id": "///J/58/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1001, "atom1_serNum": 8415, "atom2_serNum": 10532, "donAcc_type": "standard", "distance": 2.817, "atom1_id": "///I/124/O2", "atom2_id": "///J/57/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1002, "atom1_serNum": 8416, "atom2_serNum": 10530, "donAcc_type": "standard", "distance": 2.918, "atom1_id": "///I/124/N3", "atom2_id": "///J/57/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1003, "atom1_serNum": 8418, "atom2_serNum": 10529, "donAcc_type": "standard", "distance": 2.903, "atom1_id": "///I/124/N4", "atom2_id": "///J/57/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1004, "atom1_serNum": 8434, "atom2_serNum": 10510, "donAcc_type": "standard", "distance": 2.837, "atom1_id": "///I/125/O2", "atom2_id": "///J/56/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1005, "atom1_serNum": 8435, "atom2_serNum": 10508, "donAcc_type": "standard", "distance": 2.918, "atom1_id": "///I/125/N3", "atom2_id": "///J/56/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1006, "atom1_serNum": 8437, "atom2_serNum": 10507, "donAcc_type": "standard", "distance": 2.873, "atom1_id": "///I/125/N4", "atom2_id": "///J/56/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1007, "atom1_serNum": 8456, "atom2_serNum": 10487, "donAcc_type": "standard", "distance": 3.011, "atom1_id": "///I/126/N6", "atom2_id": "///J/55/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1008, "atom1_serNum": 8457, "atom2_serNum": 10485, "donAcc_type": "standard", "distance": 2.837, "atom1_id": "///I/126/N1", "atom2_id": "///J/55/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1009, "atom1_serNum": 8477, "atom2_serNum": 10467, "donAcc_type": "standard", "distance": 3.006, "atom1_id": "///I/127/N6", "atom2_id": "///J/54/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1010, "atom1_serNum": 8478, "atom2_serNum": 10465, "donAcc_type": "standard", "distance": 2.850, "atom1_id": "///I/127/N1", "atom2_id": "///J/54/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1011, "atom1_serNum": 8498, "atom2_serNum": 10447, "donAcc_type": "standard", "distance": 2.929, "atom1_id": "///I/128/N6", "atom2_id": "///J/53/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1012, "atom1_serNum": 8499, "atom2_serNum": 10445, "donAcc_type": "standard", "distance": 2.882, "atom1_id": "///I/128/N1", "atom2_id": "///J/53/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1013, "atom1_serNum": 8517, "atom2_serNum": 10427, "donAcc_type": "standard", "distance": 2.835, "atom1_id": "///I/129/N3", "atom2_id": "///J/52/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1014, "atom1_serNum": 8519, "atom2_serNum": 10426, "donAcc_type": "standard", "distance": 3.013, "atom1_id": "///I/129/O4", "atom2_id": "///J/52/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1015, "atom1_serNum": 8539, "atom2_serNum": 10406, "donAcc_type": "standard", "distance": 2.839, "atom1_id": "///I/130/N6", "atom2_id": "///J/51/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1016, "atom1_serNum": 8540, "atom2_serNum": 10404, "donAcc_type": "standard", "distance": 2.909, "atom1_id": "///I/130/N1", "atom2_id": "///J/51/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1017, "atom1_serNum": 8557, "atom2_serNum": 10387, "donAcc_type": "standard", "distance": 2.778, "atom1_id": "///I/131/O2", "atom2_id": "///J/50/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1018, "atom1_serNum": 8558, "atom2_serNum": 10385, "donAcc_type": "standard", "distance": 2.916, "atom1_id": "///I/131/N3", "atom2_id": "///J/50/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1019, "atom1_serNum": 8560, "atom2_serNum": 10364, "donAcc_type": "standard", "distance": 3.486, "atom1_id": "///I/131/N4", "atom2_id": "///J/49/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1020, "atom1_serNum": 8560, "atom2_serNum": 10384, "donAcc_type": "standard", "distance": 2.936, "atom1_id": "///I/131/N4", "atom2_id": "///J/50/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1021, "atom1_serNum": 8579, "atom2_serNum": 10342, "donAcc_type": "standard", "distance": 2.721, "atom1_id": "///I/132/N6", "atom2_id": "///J/48/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1022, "atom1_serNum": 8579, "atom2_serNum": 10364, "donAcc_type": "standard", "distance": 2.829, "atom1_id": "///I/132/N6", "atom2_id": "///J/49/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1023, "atom1_serNum": 8580, "atom2_serNum": 10343, "donAcc_type": "standard", "distance": 3.035, "atom1_id": "///I/132/N1", "atom2_id": "///J/48/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1024, "atom1_serNum": 8580, "atom2_serNum": 10362, "donAcc_type": "standard", "distance": 2.974, "atom1_id": "///I/132/N1", "atom2_id": "///J/49/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1025, "atom1_serNum": 8597, "atom2_serNum": 10345, "donAcc_type": "standard", "distance": 2.807, "atom1_id": "///I/133/O2", "atom2_id": "///J/48/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1026, "atom1_serNum": 8598, "atom2_serNum": 10343, "donAcc_type": "standard", "distance": 2.908, "atom1_id": "///I/133/N3", "atom2_id": "///J/48/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1027, "atom1_serNum": 8600, "atom2_serNum": 10342, "donAcc_type": "standard", "distance": 2.923, "atom1_id": "///I/133/N4", "atom2_id": "///J/48/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1028, "atom1_serNum": 8617, "atom2_serNum": 10322, "donAcc_type": "standard", "distance": 2.866, "atom1_id": "///I/134/N3", "atom2_id": "///J/47/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1029, "atom1_serNum": 8619, "atom2_serNum": 10300, "donAcc_type": "standard", "distance": 2.716, "atom1_id": "///I/134/O4", "atom2_id": "///J/46/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1030, "atom1_serNum": 8619, "atom2_serNum": 10321, "donAcc_type": "standard", "distance": 2.877, "atom1_id": "///I/134/O4", "atom2_id": "///J/47/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1031, "atom1_serNum": 8637, "atom2_serNum": 10301, "donAcc_type": "standard", "distance": 2.945, "atom1_id": "///I/135/N3", "atom2_id": "///J/46/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1032, "atom1_serNum": 8639, "atom2_serNum": 10279, "donAcc_type": "standard", "distance": 2.414, "atom1_id": "///I/135/O4", "atom2_id": "///J/45/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1033, "atom1_serNum": 8639, "atom2_serNum": 10300, "donAcc_type": "standard", "distance": 2.896, "atom1_id": "///I/135/O4", "atom2_id": "///J/46/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1034, "atom1_serNum": 8657, "atom2_serNum": 10280, "donAcc_type": "standard", "distance": 2.852, "atom1_id": "///I/136/N3", "atom2_id": "///J/45/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1035, "atom1_serNum": 8659, "atom2_serNum": 10279, "donAcc_type": "standard", "distance": 2.898, "atom1_id": "///I/136/O4", "atom2_id": "///J/45/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1036, "atom1_serNum": 8677, "atom2_serNum": 10259, "donAcc_type": "standard", "distance": 2.810, "atom1_id": "///I/137/N3", "atom2_id": "///J/44/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1037, "atom1_serNum": 8679, "atom2_serNum": 10258, "donAcc_type": "standard", "distance": 2.992, "atom1_id": "///I/137/O4", "atom2_id": "///J/44/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1038, "atom1_serNum": 8699, "atom2_serNum": 10239, "donAcc_type": "standard", "distance": 2.949, "atom1_id": "///I/138/O6", "atom2_id": "///J/43/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1039, "atom1_serNum": 8700, "atom2_serNum": 10237, "donAcc_type": "standard", "distance": 2.890, "atom1_id": "///I/138/N1", "atom2_id": "///J/43/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1040, "atom1_serNum": 8702, "atom2_serNum": 10236, "donAcc_type": "standard", "distance": 2.742, "atom1_id": "///I/138/N2", "atom2_id": "///J/43/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1041, "atom1_serNum": 8721, "atom2_serNum": 10220, "donAcc_type": "standard", "distance": 2.918, "atom1_id": "///I/139/O6", "atom2_id": "///J/42/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1042, "atom1_serNum": 8722, "atom2_serNum": 10218, "donAcc_type": "standard", "distance": 2.891, "atom1_id": "///I/139/N1", "atom2_id": "///J/42/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1043, "atom1_serNum": 8724, "atom2_serNum": 10217, "donAcc_type": "standard", "distance": 2.782, "atom1_id": "///I/139/N2", "atom2_id": "///J/42/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1044, "atom1_serNum": 8743, "atom2_serNum": 10199, "donAcc_type": "standard", "distance": 2.932, "atom1_id": "///I/140/O4", "atom2_id": "///J/41/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1045, "atom1_serNum": 8763, "atom2_serNum": 10179, "donAcc_type": "standard", "distance": 2.918, "atom1_id": "///I/141/N6", "atom2_id": "///J/40/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1046, "atom1_serNum": 8764, "atom2_serNum": 10177, "donAcc_type": "standard", "distance": 2.916, "atom1_id": "///I/141/N1", "atom2_id": "///J/40/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1047, "atom1_serNum": 8784, "atom2_serNum": 10160, "donAcc_type": "standard", "distance": 2.951, "atom1_id": "///I/142/O6", "atom2_id": "///J/39/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1048, "atom1_serNum": 8785, "atom2_serNum": 10158, "donAcc_type": "standard", "distance": 2.919, "atom1_id": "///I/142/N1", "atom2_id": "///J/39/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1049, "atom1_serNum": 8787, "atom2_serNum": 10157, "donAcc_type": "standard", "distance": 2.762, "atom1_id": "///I/142/N2", "atom2_id": "///J/39/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1050, "atom1_serNum": 8806, "atom2_serNum": 10140, "donAcc_type": "standard", "distance": 2.930, "atom1_id": "///I/143/N6", "atom2_id": "///J/38/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1051, "atom1_serNum": 8807, "atom2_serNum": 10138, "donAcc_type": "standard", "distance": 2.880, "atom1_id": "///I/143/N1", "atom2_id": "///J/38/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1052, "atom1_serNum": 8827, "atom2_serNum": 10120, "donAcc_type": "standard", "distance": 2.965, "atom1_id": "///I/144/N6", "atom2_id": "///J/37/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1053, "atom1_serNum": 8828, "atom2_serNum": 10118, "donAcc_type": "standard", "distance": 2.861, "atom1_id": "///I/144/N1", "atom2_id": "///J/37/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1054, "atom1_serNum": 8846, "atom2_serNum": 10100, "donAcc_type": "standard", "distance": 2.867, "atom1_id": "///I/145/N3", "atom2_id": "///J/36/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1055, "atom1_serNum": 8848, "atom2_serNum": 10099, "donAcc_type": "standard", "distance": 2.940, "atom1_id": "///I/145/O4", "atom2_id": "///J/36/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1056, "atom1_serNum": 8865, "atom2_serNum": 10080, "donAcc_type": "standard", "distance": 2.811, "atom1_id": "///I/146/O2", "atom2_id": "///J/35/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1057, "atom1_serNum": 8866, "atom2_serNum": 10078, "donAcc_type": "standard", "distance": 2.890, "atom1_id": "///I/146/N3", "atom2_id": "///J/35/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1058, "atom1_serNum": 8868, "atom2_serNum": 10077, "donAcc_type": "standard", "distance": 2.880, "atom1_id": "///I/146/N4", "atom2_id": "///J/35/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1059, "atom1_serNum": 8885, "atom2_serNum": 10057, "donAcc_type": "standard", "distance": 2.819, "atom1_id": "///I/147/N3", "atom2_id": "///J/34/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1060, "atom1_serNum": 8887, "atom2_serNum": 10056, "donAcc_type": "standard", "distance": 2.973, "atom1_id": "///I/147/O4", "atom2_id": "///J/34/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1061, "atom1_serNum": 8907, "atom2_serNum": 10037, "donAcc_type": "standard", "distance": 2.902, "atom1_id": "///I/148/O6", "atom2_id": "///J/33/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1062, "atom1_serNum": 8908, "atom2_serNum": 10035, "donAcc_type": "standard", "distance": 2.883, "atom1_id": "///I/148/N1", "atom2_id": "///J/33/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1063, "atom1_serNum": 8910, "atom2_serNum": 10034, "donAcc_type": "standard", "distance": 2.762, "atom1_id": "///I/148/N2", "atom2_id": "///J/33/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1064, "atom1_serNum": 8926, "atom2_serNum": 10018, "donAcc_type": "standard", "distance": 2.752, "atom1_id": "///I/149/O2", "atom2_id": "///J/32/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1065, "atom1_serNum": 8927, "atom2_serNum": 10016, "donAcc_type": "standard", "distance": 2.889, "atom1_id": "///I/149/N3", "atom2_id": "///J/32/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1066, "atom1_serNum": 8929, "atom2_serNum": 10015, "donAcc_type": "standard", "distance": 2.925, "atom1_id": "///I/149/N4", "atom2_id": "///J/32/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1067, "atom1_serNum": 8948, "atom2_serNum": 9995, "donAcc_type": "standard", "distance": 2.940, "atom1_id": "///I/150/N6", "atom2_id": "///J/31/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1068, "atom1_serNum": 8949, "atom2_serNum": 9993, "donAcc_type": "standard", "distance": 2.864, "atom1_id": "///I/150/N1", "atom2_id": "///J/31/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1069, "atom1_serNum": 8969, "atom2_serNum": 9976, "donAcc_type": "standard", "distance": 2.948, "atom1_id": "///I/151/O6", "atom2_id": "///J/30/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1070, "atom1_serNum": 8970, "atom2_serNum": 9974, "donAcc_type": "standard", "distance": 2.901, "atom1_id": "///I/151/N1", "atom2_id": "///J/30/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1071, "atom1_serNum": 8972, "atom2_serNum": 9973, "donAcc_type": "standard", "distance": 2.761, "atom1_id": "///I/151/N2", "atom2_id": "///J/30/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1072, "atom1_serNum": 8991, "atom2_serNum": 9957, "donAcc_type": "standard", "distance": 2.944, "atom1_id": "///I/152/O6", "atom2_id": "///J/29/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1073, "atom1_serNum": 8992, "atom2_serNum": 9937, "donAcc_type": "standard", "distance": 3.242, "atom1_id": "///I/152/N1", "atom2_id": "///J/28/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1074, "atom1_serNum": 8992, "atom2_serNum": 9955, "donAcc_type": "standard", "distance": 2.892, "atom1_id": "///I/152/N1", "atom2_id": "///J/29/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1075, "atom1_serNum": 8994, "atom2_serNum": 9954, "donAcc_type": "standard", "distance": 2.745, "atom1_id": "///I/152/N2", "atom2_id": "///J/29/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1076, "atom1_serNum": 9011, "atom2_serNum": 9937, "donAcc_type": "standard", "distance": 2.883, "atom1_id": "///I/153/N3", "atom2_id": "///J/28/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1077, "atom1_serNum": 9013, "atom2_serNum": 9936, "donAcc_type": "standard", "distance": 2.936, "atom1_id": "///I/153/O4", "atom2_id": "///J/28/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1078, "atom1_serNum": 9033, "atom2_serNum": 9917, "donAcc_type": "standard", "distance": 2.912, "atom1_id": "///I/154/O6", "atom2_id": "///J/27/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1079, "atom1_serNum": 9034, "atom2_serNum": 9915, "donAcc_type": "standard", "distance": 2.898, "atom1_id": "///I/154/N1", "atom2_id": "///J/27/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1080, "atom1_serNum": 9036, "atom2_serNum": 9914, "donAcc_type": "standard", "distance": 2.770, "atom1_id": "///I/154/N2", "atom2_id": "///J/27/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1081, "atom1_serNum": 9055, "atom2_serNum": 9898, "donAcc_type": "standard", "distance": 2.931, "atom1_id": "///I/155/O6", "atom2_id": "///J/26/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1082, "atom1_serNum": 9056, "atom2_serNum": 9896, "donAcc_type": "standard", "distance": 2.905, "atom1_id": "///I/155/N1", "atom2_id": "///J/26/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1083, "atom1_serNum": 9058, "atom2_serNum": 9895, "donAcc_type": "standard", "distance": 2.752, "atom1_id": "///I/155/N2", "atom2_id": "///J/26/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1084, "atom1_serNum": 9077, "atom2_serNum": 9878, "donAcc_type": "standard", "distance": 2.974, "atom1_id": "///I/156/N6", "atom2_id": "///J/25/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1085, "atom1_serNum": 9078, "atom2_serNum": 9876, "donAcc_type": "standard", "distance": 2.804, "atom1_id": "///I/156/N1", "atom2_id": "///J/25/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1086, "atom1_serNum": 9096, "atom2_serNum": 9858, "donAcc_type": "standard", "distance": 2.862, "atom1_id": "///I/157/N3", "atom2_id": "///J/24/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1087, "atom1_serNum": 9098, "atom2_serNum": 9857, "donAcc_type": "standard", "distance": 2.943, "atom1_id": "///I/157/O4", "atom2_id": "///J/24/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1088, "atom1_serNum": 9118, "atom2_serNum": 9837, "donAcc_type": "standard", "distance": 2.955, "atom1_id": "///I/158/N6", "atom2_id": "///J/23/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1089, "atom1_serNum": 9119, "atom2_serNum": 9835, "donAcc_type": "standard", "distance": 2.854, "atom1_id": "///I/158/N1", "atom2_id": "///J/23/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1090, "atom1_serNum": 9137, "atom2_serNum": 9817, "donAcc_type": "standard", "distance": 2.878, "atom1_id": "///I/159/N3", "atom2_id": "///J/22/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1091, "atom1_serNum": 9139, "atom2_serNum": 9816, "donAcc_type": "standard", "distance": 2.898, "atom1_id": "///I/159/O4", "atom2_id": "///J/22/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1092, "atom1_serNum": 9157, "atom2_serNum": 9796, "donAcc_type": "standard", "distance": 2.865, "atom1_id": "///I/160/N3", "atom2_id": "///J/21/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1093, "atom1_serNum": 9159, "atom2_serNum": 9795, "donAcc_type": "standard", "distance": 2.889, "atom1_id": "///I/160/O4", "atom2_id": "///J/21/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1094, "atom1_serNum": 9179, "atom2_serNum": 9776, "donAcc_type": "standard", "distance": 2.909, "atom1_id": "///I/161/O6", "atom2_id": "///J/20/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1095, "atom1_serNum": 9180, "atom2_serNum": 9774, "donAcc_type": "standard", "distance": 2.914, "atom1_id": "///I/161/N1", "atom2_id": "///J/20/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1096, "atom1_serNum": 9182, "atom2_serNum": 9773, "donAcc_type": "standard", "distance": 2.808, "atom1_id": "///I/161/N2", "atom2_id": "///J/20/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1097, "atom1_serNum": 9201, "atom2_serNum": 9736, "donAcc_type": "standard", "distance": 3.210, "atom1_id": "///I/162/N6", "atom2_id": "///J/18/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1098, "atom1_serNum": 9201, "atom2_serNum": 9756, "donAcc_type": "standard", "distance": 3.052, "atom1_id": "///I/162/N6", "atom2_id": "///J/19/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1099, "atom1_serNum": 9220, "atom2_serNum": 9736, "donAcc_type": "standard", "distance": 2.900, "atom1_id": "///I/163/N3", "atom2_id": "///J/18/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1100, "atom1_serNum": 9222, "atom2_serNum": 9735, "donAcc_type": "standard", "distance": 2.953, "atom1_id": "///I/163/O4", "atom2_id": "///J/18/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1101, "atom1_serNum": 9242, "atom2_serNum": 9716, "donAcc_type": "standard", "distance": 2.947, "atom1_id": "///I/164/O6", "atom2_id": "///J/17/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1102, "atom1_serNum": 9243, "atom2_serNum": 9714, "donAcc_type": "standard", "distance": 2.894, "atom1_id": "///I/164/N1", "atom2_id": "///J/17/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1103, "atom1_serNum": 9245, "atom2_serNum": 9713, "donAcc_type": "standard", "distance": 2.724, "atom1_id": "///I/164/N2", "atom2_id": "///J/17/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1104, "atom1_serNum": 9264, "atom2_serNum": 9697, "donAcc_type": "standard", "distance": 2.915, "atom1_id": "///I/165/O6", "atom2_id": "///J/16/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1105, "atom1_serNum": 9265, "atom2_serNum": 9695, "donAcc_type": "standard", "distance": 2.917, "atom1_id": "///I/165/N1", "atom2_id": "///J/16/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1106, "atom1_serNum": 9267, "atom2_serNum": 9694, "donAcc_type": "standard", "distance": 2.813, "atom1_id": "///I/165/N2", "atom2_id": "///J/16/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1107, "atom1_serNum": 9283, "atom2_serNum": 9678, "donAcc_type": "standard", "distance": 2.702, "atom1_id": "///I/166/O2", "atom2_id": "///J/15/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1108, "atom1_serNum": 9284, "atom2_serNum": 9676, "donAcc_type": "standard", "distance": 2.883, "atom1_id": "///I/166/N3", "atom2_id": "///J/15/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1109, "atom1_serNum": 9286, "atom2_serNum": 9675, "donAcc_type": "standard", "distance": 2.952, "atom1_id": "///I/166/N4", "atom2_id": "///J/15/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1110, "atom1_serNum": 9305, "atom2_serNum": 9637, "donAcc_type": "standard", "distance": 2.940, "atom1_id": "///I/167/O6", "atom2_id": "///J/13/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1111, "atom1_serNum": 9305, "atom2_serNum": 9656, "donAcc_type": "standard", "distance": 2.894, "atom1_id": "///I/167/O6", "atom2_id": "///J/14/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1112, "atom1_serNum": 9306, "atom2_serNum": 9654, "donAcc_type": "standard", "distance": 2.906, "atom1_id": "///I/167/N1", "atom2_id": "///J/14/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1113, "atom1_serNum": 9308, "atom2_serNum": 9653, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///I/167/N2", "atom2_id": "///J/14/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1114, "atom1_serNum": 9327, "atom2_serNum": 9616, "donAcc_type": "standard", "distance": 2.717, "atom1_id": "///I/168/O6", "atom2_id": "///J/12/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1115, "atom1_serNum": 9327, "atom2_serNum": 9637, "donAcc_type": "standard", "distance": 2.878, "atom1_id": "///I/168/O6", "atom2_id": "///J/13/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1116, "atom1_serNum": 9328, "atom2_serNum": 9635, "donAcc_type": "standard", "distance": 2.910, "atom1_id": "///I/168/N1", "atom2_id": "///J/13/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1117, "atom1_serNum": 9330, "atom2_serNum": 9634, "donAcc_type": "standard", "distance": 2.829, "atom1_id": "///I/168/N2", "atom2_id": "///J/13/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1118, "atom1_serNum": 9347, "atom2_serNum": 9617, "donAcc_type": "standard", "distance": 2.896, "atom1_id": "///I/169/N3", "atom2_id": "///J/12/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1119, "atom1_serNum": 9349, "atom2_serNum": 9616, "donAcc_type": "standard", "distance": 2.919, "atom1_id": "///I/169/O4", "atom2_id": "///J/12/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1120, "atom1_serNum": 9369, "atom2_serNum": 9596, "donAcc_type": "standard", "distance": 2.906, "atom1_id": "///I/170/N6", "atom2_id": "///J/11/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1121, "atom1_serNum": 9370, "atom2_serNum": 9594, "donAcc_type": "standard", "distance": 2.925, "atom1_id": "///I/170/N1", "atom2_id": "///J/11/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1122, "atom1_serNum": 9390, "atom2_serNum": 9576, "donAcc_type": "standard", "distance": 2.918, "atom1_id": "///I/171/N6", "atom2_id": "///J/10/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1123, "atom1_serNum": 9391, "atom2_serNum": 9574, "donAcc_type": "standard", "distance": 2.917, "atom1_id": "///I/171/N1", "atom2_id": "///J/10/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1124, "atom1_serNum": 9396, "atom2_serNum": 16230, "donAcc_type": "standard", "distance": 3.623, "atom1_id": "///I/172/OP1", "atom2_id": "///K/1488/NZ", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 1125, "atom1_serNum": 9408, "atom2_serNum": 9557, "donAcc_type": "standard", "distance": 2.767, "atom1_id": "///I/172/O2", "atom2_id": "///J/9/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1126, "atom1_serNum": 9409, "atom2_serNum": 9555, "donAcc_type": "standard", "distance": 2.900, "atom1_id": "///I/172/N3", "atom2_id": "///J/9/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1127, "atom1_serNum": 9411, "atom2_serNum": 9554, "donAcc_type": "standard", "distance": 2.935, "atom1_id": "///I/172/N4", "atom2_id": "///J/9/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1128, "atom1_serNum": 9415, "atom2_serNum": 16278, "donAcc_type": "standard", "distance": 2.591, "atom1_id": "///I/173/OP1", "atom2_id": "///K/1494/NH1", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 1129, "atom1_serNum": 9430, "atom2_serNum": 9535, "donAcc_type": "standard", "distance": 2.918, "atom1_id": "///I/173/O6", "atom2_id": "///J/8/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1130, "atom1_serNum": 9431, "atom2_serNum": 9533, "donAcc_type": "standard", "distance": 2.893, "atom1_id": "///I/173/N1", "atom2_id": "///J/8/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1131, "atom1_serNum": 9433, "atom2_serNum": 9532, "donAcc_type": "standard", "distance": 2.750, "atom1_id": "///I/173/N2", "atom2_id": "///J/8/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1132, "atom1_serNum": 9452, "atom2_serNum": 9494, "donAcc_type": "standard", "distance": 3.105, "atom1_id": "///I/174/O6", "atom2_id": "///J/6/N3", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1133, "atom1_serNum": 9452, "atom2_serNum": 9516, "donAcc_type": "standard", "distance": 2.921, "atom1_id": "///I/174/O6", "atom2_id": "///J/7/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1134, "atom1_serNum": 9453, "atom2_serNum": 9514, "donAcc_type": "standard", "distance": 2.890, "atom1_id": "///I/174/N1", "atom2_id": "///J/7/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1135, "atom1_serNum": 9455, "atom2_serNum": 9513, "donAcc_type": "standard", "distance": 2.747, "atom1_id": "///I/174/N2", "atom2_id": "///J/7/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1136, "atom1_serNum": 9474, "atom2_serNum": 9496, "donAcc_type": "standard", "distance": 2.960, "atom1_id": "///I/175/N6", "atom2_id": "///J/6/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1137, "atom1_serNum": 9475, "atom2_serNum": 9494, "donAcc_type": "standard", "distance": 2.817, "atom1_id": "///I/175/N1", "atom2_id": "///J/6/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1138, "atom1_serNum": 11314, "atom2_serNum": 15948, "donAcc_type": "standard", "distance": 2.390, "atom1_id": "///J/96/OP1", "atom2_id": "///K/1456/NZ", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 1139, "atom1_serNum": 11315, "atom2_serNum": 15999, "donAcc_type": "standard", "distance": 3.820, "atom1_id": "///J/96/OP2", "atom2_id": "///K/1462/NH2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 1140, "atom1_serNum": 11518, "atom2_serNum": 13517, "donAcc_type": "standard", "distance": 2.802, "atom1_id": "///J/106/OP1", "atom2_id": "///K/1133/NH2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 1141, "atom1_serNum": 12843, "atom2_serNum": 12873, "donAcc_type": "standard", "distance": 2.868, "atom1_id": "///K/1054/O", "atom2_id": "///K/1058/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1142, "atom1_serNum": 12851, "atom2_serNum": 12881, "donAcc_type": "standard", "distance": 3.016, "atom1_id": "///K/1055/O", "atom2_id": "///K/1059/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1143, "atom1_serNum": 12855, "atom2_serNum": 13278, "donAcc_type": "standard", "distance": 2.471, "atom1_id": "///K/1055/NE", "atom2_id": "///K/1107/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1144, "atom1_serNum": 12858, "atom2_serNum": 13278, "donAcc_type": "standard", "distance": 2.912, "atom1_id": "///K/1055/NH2", "atom2_id": "///K/1107/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1145, "atom1_serNum": 12859, "atom2_serNum": 12866, "donAcc_type": "standard", "distance": 2.653, "atom1_id": "///K/1056/N", "atom2_id": "///K/1056/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1146, "atom1_serNum": 12876, "atom2_serNum": 12901, "donAcc_type": "acceptable", "distance": 2.806, "atom1_id": "///K/1058/O", "atom2_id": "///K/1061/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1147, "atom1_serNum": 12876, "atom2_serNum": 12903, "donAcc_type": "standard", "distance": 3.430, "atom1_id": "///K/1058/O", "atom2_id": "///K/1062/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1148, "atom1_serNum": 12884, "atom2_serNum": 12911, "donAcc_type": "standard", "distance": 2.886, "atom1_id": "///K/1059/O", "atom2_id": "///K/1063/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1149, "atom1_serNum": 12892, "atom2_serNum": 12920, "donAcc_type": "standard", "distance": 2.890, "atom1_id": "///K/1060/O", "atom2_id": "///K/1064/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1150, "atom1_serNum": 12899, "atom2_serNum": 12925, "donAcc_type": "standard", "distance": 2.916, "atom1_id": "///K/1061/O", "atom2_id": "///K/1065/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1151, "atom1_serNum": 12901, "atom2_serNum": 13371, "donAcc_type": "acceptable", "distance": 2.645, "atom1_id": "///K/1061/OG1", "atom2_id": "///K/1117/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1152, "atom1_serNum": 12906, "atom2_serNum": 12933, "donAcc_type": "standard", "distance": 2.884, "atom1_id": "///K/1062/O", "atom2_id": "///K/1066/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1153, "atom1_serNum": 12914, "atom2_serNum": 12945, "donAcc_type": "standard", "distance": 2.965, "atom1_id": "///K/1063/O", "atom2_id": "///K/1067/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1154, "atom1_serNum": 12928, "atom2_serNum": 12994, "donAcc_type": "acceptable", "distance": 3.328, "atom1_id": "///K/1065/O", "atom2_id": "///K/1072/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1155, "atom1_serNum": 12936, "atom2_serNum": 12994, "donAcc_type": "acceptable", "distance": 2.824, "atom1_id": "///K/1066/O", "atom2_id": "///K/1072/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1156, "atom1_serNum": 12936, "atom2_serNum": 13031, "donAcc_type": "standard", "distance": 3.108, "atom1_id": "///K/1066/O", "atom2_id": "///K/1076/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1157, "atom1_serNum": 12948, "atom2_serNum": 12965, "donAcc_type": "standard", "distance": 2.738, "atom1_id": "///K/1067/O", "atom2_id": "///K/1069/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1158, "atom1_serNum": 12959, "atom2_serNum": 12980, "donAcc_type": "standard", "distance": 2.662, "atom1_id": "///K/1068/O", "atom2_id": "///K/1071/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1159, "atom1_serNum": 12959, "atom2_serNum": 12989, "donAcc_type": "standard", "distance": 3.043, "atom1_id": "///K/1068/O", "atom2_id": "///K/1072/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1160, "atom1_serNum": 12992, "atom2_serNum": 13010, "donAcc_type": "standard", "distance": 2.983, "atom1_id": "///K/1072/O", "atom2_id": "///K/1075/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1161, "atom1_serNum": 12992, "atom2_serNum": 13021, "donAcc_type": "standard", "distance": 2.844, "atom1_id": "///K/1072/O", "atom2_id": "///K/1076/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1162, "atom1_serNum": 12998, "atom2_serNum": 13021, "donAcc_type": "standard", "distance": 3.188, "atom1_id": "///K/1073/O", "atom2_id": "///K/1076/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1163, "atom1_serNum": 13013, "atom2_serNum": 13206, "donAcc_type": "standard", "distance": 3.493, "atom1_id": "///K/1075/O", "atom2_id": "///K/1099/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1164, "atom1_serNum": 13058, "atom2_serNum": 13087, "donAcc_type": "standard", "distance": 3.170, "atom1_id": "///K/1080/O", "atom2_id": "///K/1084/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1165, "atom1_serNum": 13061, "atom2_serNum": 13078, "donAcc_type": "standard", "distance": 3.290, "atom1_id": "///K/1080/OD1", "atom2_id": "///K/1082/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1166, "atom1_serNum": 13066, "atom2_serNum": 13099, "donAcc_type": "standard", "distance": 3.464, "atom1_id": "///K/1081/O", "atom2_id": "///K/1086/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1167, "atom1_serNum": 13102, "atom2_serNum": 13122, "donAcc_type": "standard", "distance": 3.208, "atom1_id": "///K/1086/O", "atom2_id": "///K/1089/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1168, "atom1_serNum": 13114, "atom2_serNum": 13120, "donAcc_type": "standard", "distance": 2.575, "atom1_id": "///K/1088/N", "atom2_id": "///K/1088/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1169, "atom1_serNum": 13117, "atom2_serNum": 13145, "donAcc_type": "standard", "distance": 2.916, "atom1_id": "///K/1088/O", "atom2_id": "///K/1091/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1170, "atom1_serNum": 13117, "atom2_serNum": 13153, "donAcc_type": "standard", "distance": 3.163, "atom1_id": "///K/1088/O", "atom2_id": "///K/1092/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1171, "atom1_serNum": 13120, "atom2_serNum": 13498, "donAcc_type": "acceptable", "distance": 3.003, "atom1_id": "///K/1088/OD1", "atom2_id": "///K/1131/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1172, "atom1_serNum": 13125, "atom2_serNum": 13153, "donAcc_type": "standard", "distance": 2.924, "atom1_id": "///K/1089/O", "atom2_id": "///K/1092/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1173, "atom1_serNum": 13125, "atom2_serNum": 13161, "donAcc_type": "standard", "distance": 2.715, "atom1_id": "///K/1089/O", "atom2_id": "///K/1093/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1174, "atom1_serNum": 13180, "atom2_serNum": 13190, "donAcc_type": "standard", "distance": 3.377, "atom1_id": "///K/1095/O", "atom2_id": "///K/1097/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1175, "atom1_serNum": 13180, "atom2_serNum": 13459, "donAcc_type": "standard", "distance": 3.423, "atom1_id": "///K/1095/O", "atom2_id": "///K/1127/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1176, "atom1_serNum": 13198, "atom2_serNum": 13204, "donAcc_type": "standard", "distance": 2.750, "atom1_id": "///K/1098/N", "atom2_id": "///K/1098/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1177, "atom1_serNum": 13201, "atom2_serNum": 13227, "donAcc_type": "standard", "distance": 3.485, "atom1_id": "///K/1098/O", "atom2_id": "///K/1102/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1178, "atom1_serNum": 13204, "atom2_serNum": 13225, "donAcc_type": "acceptable", "distance": 3.057, "atom1_id": "///K/1098/OD1", "atom2_id": "///K/1101/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1179, "atom1_serNum": 13205, "atom2_serNum": 13219, "donAcc_type": "acceptable", "distance": 2.343, "atom1_id": "///K/1098/OD2", "atom2_id": "///K/1100/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1180, "atom1_serNum": 13209, "atom2_serNum": 13235, "donAcc_type": "standard", "distance": 2.926, "atom1_id": "///K/1099/O", "atom2_id": "///K/1103/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1181, "atom1_serNum": 13217, "atom2_serNum": 13244, "donAcc_type": "standard", "distance": 2.896, "atom1_id": "///K/1100/O", "atom2_id": "///K/1104/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1182, "atom1_serNum": 13223, "atom2_serNum": 13255, "donAcc_type": "standard", "distance": 2.895, "atom1_id": "///K/1101/O", "atom2_id": "///K/1105/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1183, "atom1_serNum": 13230, "atom2_serNum": 13264, "donAcc_type": "standard", "distance": 2.896, "atom1_id": "///K/1102/O", "atom2_id": "///K/1106/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1184, "atom1_serNum": 13238, "atom2_serNum": 13272, "donAcc_type": "standard", "distance": 2.904, "atom1_id": "///K/1103/O", "atom2_id": "///K/1107/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1185, "atom1_serNum": 13247, "atom2_serNum": 13280, "donAcc_type": "standard", "distance": 3.076, "atom1_id": "///K/1104/O", "atom2_id": "///K/1108/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1186, "atom1_serNum": 13247, "atom2_serNum": 13285, "donAcc_type": "acceptable", "distance": 2.924, "atom1_id": "///K/1104/O", "atom2_id": "///K/1108/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1187, "atom1_serNum": 13258, "atom2_serNum": 13285, "donAcc_type": "acceptable", "distance": 3.015, "atom1_id": "///K/1105/O", "atom2_id": "///K/1108/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1188, "atom1_serNum": 13258, "atom2_serNum": 13287, "donAcc_type": "standard", "distance": 2.997, "atom1_id": "///K/1105/O", "atom2_id": "///K/1109/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1189, "atom1_serNum": 13258, "atom2_serNum": 13291, "donAcc_type": "standard", "distance": 2.823, "atom1_id": "///K/1105/O", "atom2_id": "///K/1110/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1190, "atom1_serNum": 13311, "atom2_serNum": 13394, "donAcc_type": "acceptable", "distance": 2.646, "atom1_id": "///K/1111/OH", "atom2_id": "///K/1120/OD2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1191, "atom1_serNum": 13321, "atom2_serNum": 13358, "donAcc_type": "standard", "distance": 3.282, "atom1_id": "///K/1113/N", "atom2_id": "///K/1116/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1192, "atom1_serNum": 13324, "atom2_serNum": 13351, "donAcc_type": "standard", "distance": 3.209, "atom1_id": "///K/1113/O", "atom2_id": "///K/1116/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1193, "atom1_serNum": 13328, "atom2_serNum": 13756, "donAcc_type": "acceptable", "distance": 3.043, "atom1_id": "///K/1113/OE1", "atom2_id": "///K/1162/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1194, "atom1_serNum": 13329, "atom2_serNum": 13359, "donAcc_type": "standard", "distance": 3.026, "atom1_id": "///K/1113/OE2", "atom2_id": "///K/1116/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1195, "atom1_serNum": 13333, "atom2_serNum": 13372, "donAcc_type": "standard", "distance": 2.935, "atom1_id": "///K/1114/O", "atom2_id": "///K/1118/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1196, "atom1_serNum": 13340, "atom2_serNum": 13379, "donAcc_type": "standard", "distance": 2.861, "atom1_id": "///K/1115/O", "atom2_id": "///K/1119/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1197, "atom1_serNum": 13345, "atom2_serNum": 14294, "donAcc_type": "standard", "distance": 2.696, "atom1_id": "///K/1115/NE1", "atom2_id": "///K/1253/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1198, "atom1_serNum": 13354, "atom2_serNum": 13387, "donAcc_type": "standard", "distance": 2.869, "atom1_id": "///K/1116/O", "atom2_id": "///K/1120/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1199, "atom1_serNum": 13363, "atom2_serNum": 13395, "donAcc_type": "standard", "distance": 2.981, "atom1_id": "///K/1117/O", "atom2_id": "///K/1121/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1200, "atom1_serNum": 13375, "atom2_serNum": 13403, "donAcc_type": "standard", "distance": 2.933, "atom1_id": "///K/1118/O", "atom2_id": "///K/1122/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1201, "atom1_serNum": 13382, "atom2_serNum": 13417, "donAcc_type": "standard", "distance": 2.814, "atom1_id": "///K/1119/O", "atom2_id": "///K/1123/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1202, "atom1_serNum": 13390, "atom2_serNum": 13425, "donAcc_type": "standard", "distance": 2.951, "atom1_id": "///K/1120/O", "atom2_id": "///K/1124/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1203, "atom1_serNum": 13398, "atom2_serNum": 13433, "donAcc_type": "standard", "distance": 2.994, "atom1_id": "///K/1121/O", "atom2_id": "///K/1125/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1204, "atom1_serNum": 13406, "atom2_serNum": 13444, "donAcc_type": "standard", "distance": 2.876, "atom1_id": "///K/1122/O", "atom2_id": "///K/1126/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1205, "atom1_serNum": 13411, "atom2_serNum": 13772, "donAcc_type": "standard", "distance": 3.879, "atom1_id": "///K/1122/NE1", "atom2_id": "///K/1165/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1206, "atom1_serNum": 13420, "atom2_serNum": 13452, "donAcc_type": "standard", "distance": 2.901, "atom1_id": "///K/1123/O", "atom2_id": "///K/1127/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1207, "atom1_serNum": 13428, "atom2_serNum": 13460, "donAcc_type": "standard", "distance": 2.900, "atom1_id": "///K/1124/O", "atom2_id": "///K/1128/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1208, "atom1_serNum": 13436, "atom2_serNum": 13465, "donAcc_type": "standard", "distance": 2.931, "atom1_id": "///K/1125/O", "atom2_id": "///K/1129/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1209, "atom1_serNum": 13447, "atom2_serNum": 13479, "donAcc_type": "standard", "distance": 2.873, "atom1_id": "///K/1126/O", "atom2_id": "///K/1130/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1210, "atom1_serNum": 13455, "atom2_serNum": 13487, "donAcc_type": "standard", "distance": 2.920, "atom1_id": "///K/1127/O", "atom2_id": "///K/1131/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1211, "atom1_serNum": 13463, "atom2_serNum": 13499, "donAcc_type": "standard", "distance": 3.127, "atom1_id": "///K/1128/O", "atom2_id": "///K/1132/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1212, "atom1_serNum": 13463, "atom2_serNum": 13506, "donAcc_type": "standard", "distance": 2.964, "atom1_id": "///K/1128/O", "atom2_id": "///K/1132/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1213, "atom1_serNum": 13468, "atom2_serNum": 13502, "donAcc_type": "questionable", "distance": 2.940, "atom1_id": "///K/1129/O", "atom2_id": "///K/1132/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1214, "atom1_serNum": 13473, "atom2_serNum": 13602, "donAcc_type": "acceptable", "distance": 3.124, "atom1_id": "///K/1129/NE1", "atom2_id": "///K/1143/OG", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1215, "atom1_serNum": 13510, "atom2_serNum": 13534, "donAcc_type": "standard", "distance": 3.297, "atom1_id": "///K/1133/O", "atom2_id": "///K/1136/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1216, "atom1_serNum": 13510, "atom2_serNum": 13539, "donAcc_type": "acceptable", "distance": 2.580, "atom1_id": "///K/1133/O", "atom2_id": "///K/1136/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1217, "atom1_serNum": 13516, "atom2_serNum": 13532, "donAcc_type": "acceptable", "distance": 2.365, "atom1_id": "///K/1133/NH1", "atom2_id": "///K/1135/OG1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1218, "atom1_serNum": 13537, "atom2_serNum": 13570, "donAcc_type": "standard", "distance": 3.439, "atom1_id": "///K/1136/O", "atom2_id": "///K/1140/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1219, "atom1_serNum": 13543, "atom2_serNum": 13579, "donAcc_type": "standard", "distance": 2.915, "atom1_id": "///K/1137/O", "atom2_id": "///K/1141/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1220, "atom1_serNum": 13554, "atom2_serNum": 13591, "donAcc_type": "standard", "distance": 2.907, "atom1_id": "///K/1138/O", "atom2_id": "///K/1142/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1221, "atom1_serNum": 13561, "atom2_serNum": 13597, "donAcc_type": "standard", "distance": 2.874, "atom1_id": "///K/1139/O", "atom2_id": "///K/1143/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1222, "atom1_serNum": 13561, "atom2_serNum": 13602, "donAcc_type": "acceptable", "distance": 2.700, "atom1_id": "///K/1139/O", "atom2_id": "///K/1143/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1223, "atom1_serNum": 13573, "atom2_serNum": 13603, "donAcc_type": "standard", "distance": 2.960, "atom1_id": "///K/1140/O", "atom2_id": "///K/1144/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1224, "atom1_serNum": 13582, "atom2_serNum": 13612, "donAcc_type": "standard", "distance": 2.935, "atom1_id": "///K/1141/O", "atom2_id": "///K/1145/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1225, "atom1_serNum": 13594, "atom2_serNum": 13620, "donAcc_type": "standard", "distance": 2.891, "atom1_id": "///K/1142/O", "atom2_id": "///K/1146/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1226, "atom1_serNum": 13600, "atom2_serNum": 13625, "donAcc_type": "acceptable", "distance": 2.446, "atom1_id": "///K/1143/O", "atom2_id": "///K/1146/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1227, "atom1_serNum": 13600, "atom2_serNum": 13626, "donAcc_type": "standard", "distance": 2.924, "atom1_id": "///K/1143/O", "atom2_id": "///K/1147/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1228, "atom1_serNum": 13606, "atom2_serNum": 13635, "donAcc_type": "standard", "distance": 2.934, "atom1_id": "///K/1144/O", "atom2_id": "///K/1148/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1229, "atom1_serNum": 13615, "atom2_serNum": 13642, "donAcc_type": "standard", "distance": 2.910, "atom1_id": "///K/1145/O", "atom2_id": "///K/1149/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1230, "atom1_serNum": 13623, "atom2_serNum": 13653, "donAcc_type": "standard", "distance": 2.913, "atom1_id": "///K/1146/O", "atom2_id": "///K/1150/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1231, "atom1_serNum": 13625, "atom2_serNum": 13633, "donAcc_type": "acceptable", "distance": 2.874, "atom1_id": "///K/1146/OG", "atom2_id": "///K/1147/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1232, "atom1_serNum": 13634, "atom2_serNum": 13660, "donAcc_type": "questionable", "distance": 2.833, "atom1_id": "///K/1147/OE2", "atom2_id": "///K/1150/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1233, "atom1_serNum": 13638, "atom2_serNum": 13671, "donAcc_type": "standard", "distance": 2.956, "atom1_id": "///K/1148/O", "atom2_id": "///K/1152/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1234, "atom1_serNum": 13645, "atom2_serNum": 13680, "donAcc_type": "standard", "distance": 2.892, "atom1_id": "///K/1149/O", "atom2_id": "///K/1153/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1235, "atom1_serNum": 13683, "atom2_serNum": 13710, "donAcc_type": "standard", "distance": 3.266, "atom1_id": "///K/1153/O", "atom2_id": "///K/1157/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1236, "atom1_serNum": 13691, "atom2_serNum": 13718, "donAcc_type": "standard", "distance": 2.918, "atom1_id": "///K/1154/O", "atom2_id": "///K/1158/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1237, "atom1_serNum": 13694, "atom2_serNum": 13769, "donAcc_type": "standard", "distance": 3.381, "atom1_id": "///K/1154/OD1", "atom2_id": "///K/1165/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1238, "atom1_serNum": 13699, "atom2_serNum": 13727, "donAcc_type": "standard", "distance": 2.896, "atom1_id": "///K/1155/O", "atom2_id": "///K/1159/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1239, "atom1_serNum": 13706, "atom2_serNum": 13732, "donAcc_type": "acceptable", "distance": 3.044, "atom1_id": "///K/1156/O", "atom2_id": "///K/1159/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1240, "atom1_serNum": 13706, "atom2_serNum": 13733, "donAcc_type": "standard", "distance": 2.910, "atom1_id": "///K/1156/O", "atom2_id": "///K/1160/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1241, "atom1_serNum": 13713, "atom2_serNum": 13741, "donAcc_type": "standard", "distance": 3.258, "atom1_id": "///K/1157/O", "atom2_id": "///K/1161/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1242, "atom1_serNum": 13713, "atom2_serNum": 13745, "donAcc_type": "standard", "distance": 2.757, "atom1_id": "///K/1157/O", "atom2_id": "///K/1162/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1243, "atom1_serNum": 13736, "atom2_serNum": 14290, "donAcc_type": "standard", "distance": 3.984, "atom1_id": "///K/1160/O", "atom2_id": "///K/1252/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1244, "atom1_serNum": 13776, "atom2_serNum": 13793, "donAcc_type": "standard", "distance": 3.131, "atom1_id": "///K/1166/O", "atom2_id": "///K/1168/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1245, "atom1_serNum": 13776, "atom2_serNum": 14317, "donAcc_type": "standard", "distance": 3.524, "atom1_id": "///K/1166/O", "atom2_id": "///K/1255/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1246, "atom1_serNum": 13810, "atom2_serNum": 14192, "donAcc_type": "standard", "distance": 3.363, "atom1_id": "///K/1170/N", "atom2_id": "///K/1240/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1247, "atom1_serNum": 13821, "atom2_serNum": 16909, "donAcc_type": "standard", "distance": 2.587, "atom1_id": "///K/1171/N", "atom2_id": "///K/1640/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1248, "atom1_serNum": 13824, "atom2_serNum": 13834, "donAcc_type": "standard", "distance": 3.289, "atom1_id": "///K/1171/O", "atom2_id": "///K/1173/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1249, "atom1_serNum": 13837, "atom2_serNum": 14165, "donAcc_type": "standard", "distance": 3.743, "atom1_id": "///K/1173/O", "atom2_id": "///K/1236/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1250, "atom1_serNum": 13842, "atom2_serNum": 16858, "donAcc_type": "standard", "distance": 3.139, "atom1_id": "///K/1173/NE2", "atom2_id": "///K/1635/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1251, "atom1_serNum": 13846, "atom2_serNum": 13848, "donAcc_type": "acceptable", "distance": 2.903, "atom1_id": "///K/1174/O", "atom2_id": "///K/1174/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1252, "atom1_serNum": 13850, "atom2_serNum": 13928, "donAcc_type": "standard", "distance": 3.632, "atom1_id": "///K/1175/N", "atom2_id": "///K/1185/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1253, "atom1_serNum": 13853, "atom2_serNum": 13925, "donAcc_type": "standard", "distance": 2.678, "atom1_id": "///K/1175/O", "atom2_id": "///K/1185/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1254, "atom1_serNum": 13864, "atom2_serNum": 13915, "donAcc_type": "standard", "distance": 3.138, "atom1_id": "///K/1177/N", "atom2_id": "///K/1183/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1255, "atom1_serNum": 13867, "atom2_serNum": 13895, "donAcc_type": "standard", "distance": 3.980, "atom1_id": "///K/1177/O", "atom2_id": "///K/1181/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1256, "atom1_serNum": 13881, "atom2_serNum": 14052, "donAcc_type": "acceptable", "distance": 3.293, "atom1_id": "///K/1178/OH", "atom2_id": "///K/1198/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1257, "atom1_serNum": 13936, "atom2_serNum": 14165, "donAcc_type": "standard", "distance": 3.216, "atom1_id": "///K/1186/O", "atom2_id": "///K/1236/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1258, "atom1_serNum": 13951, "atom2_serNum": 14161, "donAcc_type": "standard", "distance": 3.354, "atom1_id": "///K/1188/N", "atom2_id": "///K/1236/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1259, "atom1_serNum": 13962, "atom2_serNum": 14158, "donAcc_type": "standard", "distance": 2.937, "atom1_id": "///K/1189/O", "atom2_id": "///K/1236/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1260, "atom1_serNum": 13969, "atom2_serNum": 14087, "donAcc_type": "acceptable", "distance": 2.340, "atom1_id": "///K/1190/OG1", "atom2_id": "///K/1202/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1261, "atom1_serNum": 13971, "atom2_serNum": 14141, "donAcc_type": "standard", "distance": 2.913, "atom1_id": "///K/1191/N", "atom2_id": "///K/1234/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1262, "atom1_serNum": 13974, "atom2_serNum": 14138, "donAcc_type": "standard", "distance": 2.899, "atom1_id": "///K/1191/O", "atom2_id": "///K/1234/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1263, "atom1_serNum": 13983, "atom2_serNum": 14066, "donAcc_type": "standard", "distance": 2.900, "atom1_id": "///K/1192/N", "atom2_id": "///K/1200/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1264, "atom1_serNum": 13986, "atom2_serNum": 14063, "donAcc_type": "standard", "distance": 2.902, "atom1_id": "///K/1192/O", "atom2_id": "///K/1200/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1265, "atom1_serNum": 13995, "atom2_serNum": 14126, "donAcc_type": "standard", "distance": 2.408, "atom1_id": "///K/1193/N", "atom2_id": "///K/1232/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1266, "atom1_serNum": 14000, "atom2_serNum": 14022, "donAcc_type": "acceptable", "distance": 3.311, "atom1_id": "///K/1193/OG", "atom2_id": "///K/1196/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1267, "atom1_serNum": 14001, "atom2_serNum": 14044, "donAcc_type": "standard", "distance": 2.851, "atom1_id": "///K/1194/N", "atom2_id": "///K/1198/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1268, "atom1_serNum": 14004, "atom2_serNum": 14030, "donAcc_type": "standard", "distance": 2.794, "atom1_id": "///K/1194/O", "atom2_id": "///K/1197/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1269, "atom1_serNum": 14004, "atom2_serNum": 14041, "donAcc_type": "standard", "distance": 2.995, "atom1_id": "///K/1194/O", "atom2_id": "///K/1198/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1270, "atom1_serNum": 14028, "atom2_serNum": 14147, "donAcc_type": "standard", "distance": 3.004, "atom1_id": "///K/1196/OD1", "atom2_id": "///K/1234/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1271, "atom1_serNum": 14083, "atom2_serNum": 14104, "donAcc_type": "standard", "distance": 3.268, "atom1_id": "///K/1202/O", "atom2_id": "///K/1205/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1272, "atom1_serNum": 14166, "atom2_serNum": 14172, "donAcc_type": "standard", "distance": 2.615, "atom1_id": "///K/1237/N", "atom2_id": "///K/1237/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1273, "atom1_serNum": 14211, "atom2_serNum": 16951, "donAcc_type": "standard", "distance": 3.299, "atom1_id": "///K/1242/OE1", "atom2_id": "///K/1645/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1274, "atom1_serNum": 14212, "atom2_serNum": 16951, "donAcc_type": "standard", "distance": 2.564, "atom1_id": "///K/1242/OE2", "atom2_id": "///K/1645/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1275, "atom1_serNum": 14216, "atom2_serNum": 14314, "donAcc_type": "acceptable", "distance": 3.572, "atom1_id": "///K/1243/O", "atom2_id": "///K/1255/ND1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1276, "atom1_serNum": 14232, "atom2_serNum": 14303, "donAcc_type": "standard", "distance": 2.888, "atom1_id": "///K/1245/N", "atom2_id": "///K/1254/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1277, "atom1_serNum": 14235, "atom2_serNum": 14300, "donAcc_type": "standard", "distance": 2.924, "atom1_id": "///K/1245/O", "atom2_id": "///K/1254/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1278, "atom1_serNum": 14248, "atom2_serNum": 14283, "donAcc_type": "standard", "distance": 3.028, "atom1_id": "///K/1247/N", "atom2_id": "///K/1252/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1279, "atom1_serNum": 14254, "atom2_serNum": 14434, "donAcc_type": "standard", "distance": 3.160, "atom1_id": "///K/1248/N", "atom2_id": "///K/1270/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1280, "atom1_serNum": 14311, "atom2_serNum": 14341, "donAcc_type": "standard", "distance": 3.539, "atom1_id": "///K/1255/O", "atom2_id": "///K/1259/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1281, "atom1_serNum": 14321, "atom2_serNum": 14348, "donAcc_type": "standard", "distance": 2.826, "atom1_id": "///K/1256/O", "atom2_id": "///K/1260/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1282, "atom1_serNum": 14321, "atom2_serNum": 14356, "donAcc_type": "standard", "distance": 3.524, "atom1_id": "///K/1256/O", "atom2_id": "///K/1261/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1283, "atom1_serNum": 14326, "atom2_serNum": 14359, "donAcc_type": "standard", "distance": 3.116, "atom1_id": "///K/1256/NE2", "atom2_id": "///K/1261/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1284, "atom1_serNum": 14369, "atom2_serNum": 14401, "donAcc_type": "standard", "distance": 3.186, "atom1_id": "///K/1262/O", "atom2_id": "///K/1266/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1285, "atom1_serNum": 14372, "atom2_serNum": 14385, "donAcc_type": "acceptable", "distance": 3.037, "atom1_id": "///K/1262/ND1", "atom2_id": "///K/1264/N", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 1286, "atom1_serNum": 14376, "atom2_serNum": 14383, "donAcc_type": "standard", "distance": 2.909, "atom1_id": "///K/1263/N", "atom2_id": "///K/1263/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1287, "atom1_serNum": 14404, "atom2_serNum": 14427, "donAcc_type": "standard", "distance": 3.296, "atom1_id": "///K/1266/O", "atom2_id": "///K/1269/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1288, "atom1_serNum": 14409, "atom2_serNum": 14542, "donAcc_type": "standard", "distance": 3.490, "atom1_id": "///K/1266/NE1", "atom2_id": "///K/1284/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1289, "atom1_serNum": 14452, "atom2_serNum": 14473, "donAcc_type": "standard", "distance": 3.285, "atom1_id": "///K/1272/O", "atom2_id": "///K/1276/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1290, "atom1_serNum": 14458, "atom2_serNum": 14481, "donAcc_type": "standard", "distance": 2.901, "atom1_id": "///K/1273/O", "atom2_id": "///K/1277/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1291, "atom1_serNum": 14466, "atom2_serNum": 14490, "donAcc_type": "standard", "distance": 2.904, "atom1_id": "///K/1274/O", "atom2_id": "///K/1278/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1292, "atom1_serNum": 14470, "atom2_serNum": 14499, "donAcc_type": "standard", "distance": 3.115, "atom1_id": "///K/1275/O", "atom2_id": "///K/1279/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1293, "atom1_serNum": 14476, "atom2_serNum": 14505, "donAcc_type": "standard", "distance": 2.812, "atom1_id": "///K/1276/O", "atom2_id": "///K/1280/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1294, "atom1_serNum": 14476, "atom2_serNum": 14510, "donAcc_type": "standard", "distance": 2.728, "atom1_id": "///K/1276/O", "atom2_id": "///K/1281/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1295, "atom1_serNum": 14504, "atom2_serNum": 14520, "donAcc_type": "acceptable", "distance": 3.691, "atom1_id": "///K/1279/OG", "atom2_id": "///K/1281/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1296, "atom1_serNum": 14538, "atom2_serNum": 15221, "donAcc_type": "standard", "distance": 3.887, "atom1_id": "///K/1283/NH2", "atom2_id": "///K/1368/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1297, "atom1_serNum": 14547, "atom2_serNum": 14551, "donAcc_type": "standard", "distance": 2.680, "atom1_id": "///K/1284/NZ", "atom2_id": "///K/1285/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1298, "atom1_serNum": 14551, "atom2_serNum": 14565, "donAcc_type": "standard", "distance": 3.180, "atom1_id": "///K/1285/O", "atom2_id": "///K/1287/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1299, "atom1_serNum": 14563, "atom2_serNum": 14574, "donAcc_type": "standard", "distance": 3.076, "atom1_id": "///K/1286/OD1", "atom2_id": "///K/1288/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1300, "atom1_serNum": 14568, "atom2_serNum": 14612, "donAcc_type": "standard", "distance": 3.196, "atom1_id": "///K/1287/O", "atom2_id": "///K/1292/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1301, "atom1_serNum": 14588, "atom2_serNum": 17067, "donAcc_type": "standard", "distance": 2.964, "atom1_id": "///K/1289/O", "atom2_id": "///K/1659/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1302, "atom1_serNum": 14590, "atom2_serNum": 14604, "donAcc_type": "acceptable", "distance": 3.497, "atom1_id": "///K/1289/OG", "atom2_id": "///K/1291/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1303, "atom1_serNum": 14591, "atom2_serNum": 15236, "donAcc_type": "standard", "distance": 3.055, "atom1_id": "///K/1290/N", "atom2_id": "///K/1370/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1304, "atom1_serNum": 14594, "atom2_serNum": 14616, "donAcc_type": "standard", "distance": 3.125, "atom1_id": "///K/1290/O", "atom2_id": "///K/1293/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1305, "atom1_serNum": 14594, "atom2_serNum": 14877, "donAcc_type": "standard", "distance": 3.055, "atom1_id": "///K/1290/O", "atom2_id": "///K/1324/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1306, "atom1_serNum": 14599, "atom2_serNum": 14877, "donAcc_type": "standard", "distance": 2.753, "atom1_id": "///K/1291/O", "atom2_id": "///K/1324/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1307, "atom1_serNum": 14604, "atom2_serNum": 15235, "donAcc_type": "standard", "distance": 3.309, "atom1_id": "///K/1291/NZ", "atom2_id": "///K/1370/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1308, "atom1_serNum": 14604, "atom2_serNum": 15236, "donAcc_type": "standard", "distance": 2.859, "atom1_id": "///K/1291/NZ", "atom2_id": "///K/1370/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1309, "atom1_serNum": 14615, "atom2_serNum": 17064, "donAcc_type": "acceptable", "distance": 3.705, "atom1_id": "///K/1292/NH2", "atom2_id": "///K/1659/ND1", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 1310, "atom1_serNum": 14619, "atom2_serNum": 14877, "donAcc_type": "standard", "distance": 2.389, "atom1_id": "///K/1293/O", "atom2_id": "///K/1324/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1311, "atom1_serNum": 14636, "atom2_serNum": 14672, "donAcc_type": "acceptable", "distance": 2.975, "atom1_id": "///K/1295/OG", "atom2_id": "///K/1300/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1312, "atom1_serNum": 14640, "atom2_serNum": 14667, "donAcc_type": "standard", "distance": 2.721, "atom1_id": "///K/1296/O", "atom2_id": "///K/1300/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1313, "atom1_serNum": 14640, "atom2_serNum": 14672, "donAcc_type": "acceptable", "distance": 2.556, "atom1_id": "///K/1296/O", "atom2_id": "///K/1300/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1314, "atom1_serNum": 14642, "atom2_serNum": 14663, "donAcc_type": "acceptable", "distance": 3.276, "atom1_id": "///K/1296/OG1", "atom2_id": "///K/1299/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1315, "atom1_serNum": 14642, "atom2_serNum": 14879, "donAcc_type": "acceptable", "distance": 3.127, "atom1_id": "///K/1296/OG1", "atom2_id": "///K/1325/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1316, "atom1_serNum": 14644, "atom2_serNum": 16718, "donAcc_type": "standard", "distance": 2.792, "atom1_id": "///K/1297/N", "atom2_id": "///K/1616/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1317, "atom1_serNum": 14647, "atom2_serNum": 14674, "donAcc_type": "standard", "distance": 2.898, "atom1_id": "///K/1297/O", "atom2_id": "///K/1301/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1318, "atom1_serNum": 14655, "atom2_serNum": 16719, "donAcc_type": "standard", "distance": 3.717, "atom1_id": "///K/1298/N", "atom2_id": "///K/1616/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1319, "atom1_serNum": 14658, "atom2_serNum": 14685, "donAcc_type": "standard", "distance": 2.921, "atom1_id": "///K/1298/O", "atom2_id": "///K/1302/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1320, "atom1_serNum": 14666, "atom2_serNum": 14693, "donAcc_type": "standard", "distance": 2.900, "atom1_id": "///K/1299/O", "atom2_id": "///K/1303/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1321, "atom1_serNum": 14670, "atom2_serNum": 14702, "donAcc_type": "standard", "distance": 2.885, "atom1_id": "///K/1300/O", "atom2_id": "///K/1304/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1322, "atom1_serNum": 14677, "atom2_serNum": 14710, "donAcc_type": "standard", "distance": 2.929, "atom1_id": "///K/1301/O", "atom2_id": "///K/1305/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1323, "atom1_serNum": 14688, "atom2_serNum": 14721, "donAcc_type": "standard", "distance": 2.936, "atom1_id": "///K/1302/O", "atom2_id": "///K/1306/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1324, "atom1_serNum": 14696, "atom2_serNum": 14728, "donAcc_type": "standard", "distance": 2.872, "atom1_id": "///K/1303/O", "atom2_id": "///K/1307/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1325, "atom1_serNum": 14705, "atom2_serNum": 14736, "donAcc_type": "standard", "distance": 2.898, "atom1_id": "///K/1304/O", "atom2_id": "///K/1308/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1326, "atom1_serNum": 14713, "atom2_serNum": 14744, "donAcc_type": "standard", "distance": 2.938, "atom1_id": "///K/1305/O", "atom2_id": "///K/1309/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1327, "atom1_serNum": 14717, "atom2_serNum": 15622, "donAcc_type": "standard", "distance": 3.036, "atom1_id": "///K/1305/NE", "atom2_id": "///K/1416/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1328, "atom1_serNum": 14719, "atom2_serNum": 15679, "donAcc_type": "standard", "distance": 3.558, "atom1_id": "///K/1305/NH1", "atom2_id": "///K/1423/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1329, "atom1_serNum": 14720, "atom2_serNum": 15622, "donAcc_type": "standard", "distance": 3.273, "atom1_id": "///K/1305/NH2", "atom2_id": "///K/1416/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1330, "atom1_serNum": 14720, "atom2_serNum": 16128, "donAcc_type": "standard", "distance": 2.719, "atom1_id": "///K/1305/NH2", "atom2_id": "///K/1477/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1331, "atom1_serNum": 14724, "atom2_serNum": 14755, "donAcc_type": "standard", "distance": 2.895, "atom1_id": "///K/1306/O", "atom2_id": "///K/1310/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1332, "atom1_serNum": 14731, "atom2_serNum": 14763, "donAcc_type": "standard", "distance": 2.876, "atom1_id": "///K/1307/O", "atom2_id": "///K/1311/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1333, "atom1_serNum": 14731, "atom2_serNum": 14772, "donAcc_type": "standard", "distance": 2.924, "atom1_id": "///K/1307/O", "atom2_id": "///K/1311/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1334, "atom1_serNum": 14735, "atom2_serNum": 14850, "donAcc_type": "standard", "distance": 3.546, "atom1_id": "///K/1307/ND2", "atom2_id": "///K/1321/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1335, "atom1_serNum": 14739, "atom2_serNum": 14774, "donAcc_type": "standard", "distance": 2.923, "atom1_id": "///K/1308/O", "atom2_id": "///K/1312/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1336, "atom1_serNum": 14747, "atom2_serNum": 14785, "donAcc_type": "standard", "distance": 2.908, "atom1_id": "///K/1309/O", "atom2_id": "///K/1313/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1337, "atom1_serNum": 14758, "atom2_serNum": 14794, "donAcc_type": "standard", "distance": 2.709, "atom1_id": "///K/1310/O", "atom2_id": "///K/1314/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1338, "atom1_serNum": 14805, "atom2_serNum": 14828, "donAcc_type": "standard", "distance": 3.069, "atom1_id": "///K/1315/O", "atom2_id": "///K/1318/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1339, "atom1_serNum": 14805, "atom2_serNum": 14833, "donAcc_type": "acceptable", "distance": 2.480, "atom1_id": "///K/1315/O", "atom2_id": "///K/1318/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1340, "atom1_serNum": 14831, "atom2_serNum": 14833, "donAcc_type": "acceptable", "distance": 3.024, "atom1_id": "///K/1318/O", "atom2_id": "///K/1318/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1341, "atom1_serNum": 14834, "atom2_serNum": 15192, "donAcc_type": "standard", "distance": 3.430, "atom1_id": "///K/1319/N", "atom2_id": "///K/1364/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1342, "atom1_serNum": 14841, "atom2_serNum": 15193, "donAcc_type": "standard", "distance": 2.872, "atom1_id": "///K/1320/O", "atom2_id": "///K/1365/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1343, "atom1_serNum": 14854, "atom2_serNum": 15176, "donAcc_type": "standard", "distance": 2.545, "atom1_id": "///K/1322/N", "atom2_id": "///K/1363/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1344, "atom1_serNum": 14857, "atom2_serNum": 15173, "donAcc_type": "standard", "distance": 2.676, "atom1_id": "///K/1322/O", "atom2_id": "///K/1363/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1345, "atom1_serNum": 14868, "atom2_serNum": 15160, "donAcc_type": "standard", "distance": 3.338, "atom1_id": "///K/1324/N", "atom2_id": "///K/1361/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1346, "atom1_serNum": 14871, "atom2_serNum": 15157, "donAcc_type": "standard", "distance": 3.261, "atom1_id": "///K/1324/O", "atom2_id": "///K/1361/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1347, "atom1_serNum": 14886, "atom2_serNum": 15147, "donAcc_type": "standard", "distance": 2.889, "atom1_id": "///K/1326/N", "atom2_id": "///K/1359/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1348, "atom1_serNum": 14893, "atom2_serNum": 15147, "donAcc_type": "standard", "distance": 2.929, "atom1_id": "///K/1327/N", "atom2_id": "///K/1359/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1349, "atom1_serNum": 14896, "atom2_serNum": 15144, "donAcc_type": "standard", "distance": 2.876, "atom1_id": "///K/1327/O", "atom2_id": "///K/1359/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1350, "atom1_serNum": 14899, "atom2_serNum": 16738, "donAcc_type": "acceptable", "distance": 3.687, "atom1_id": "///K/1327/ND1", "atom2_id": "///K/1619/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1351, "atom1_serNum": 14899, "atom2_serNum": 16753, "donAcc_type": "acceptable", "distance": 3.643, "atom1_id": "///K/1327/ND1", "atom2_id": "///K/1621/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1352, "atom1_serNum": 14902, "atom2_serNum": 14913, "donAcc_type": "acceptable", "distance": 2.542, "atom1_id": "///K/1327/NE2", "atom2_id": "///K/1329/OG", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1353, "atom1_serNum": 14903, "atom2_serNum": 16738, "donAcc_type": "standard", "distance": 3.549, "atom1_id": "///K/1328/N", "atom2_id": "///K/1619/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1354, "atom1_serNum": 14906, "atom2_serNum": 16735, "donAcc_type": "standard", "distance": 3.021, "atom1_id": "///K/1328/O", "atom2_id": "///K/1619/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1355, "atom1_serNum": 14908, "atom2_serNum": 15131, "donAcc_type": "standard", "distance": 2.945, "atom1_id": "///K/1329/N", "atom2_id": "///K/1357/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1356, "atom1_serNum": 14911, "atom2_serNum": 15128, "donAcc_type": "standard", "distance": 2.871, "atom1_id": "///K/1329/O", "atom2_id": "///K/1357/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1357, "atom1_serNum": 14920, "atom2_serNum": 15124, "donAcc_type": "standard", "distance": 2.373, "atom1_id": "///K/1330/OD1", "atom2_id": "///K/1356/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1358, "atom1_serNum": 14920, "atom2_serNum": 15127, "donAcc_type": "standard", "distance": 3.042, "atom1_id": "///K/1330/OD1", "atom2_id": "///K/1356/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1359, "atom1_serNum": 14921, "atom2_serNum": 15127, "donAcc_type": "standard", "distance": 2.945, "atom1_id": "///K/1330/OD2", "atom2_id": "///K/1356/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1360, "atom1_serNum": 14922, "atom2_serNum": 15108, "donAcc_type": "standard", "distance": 2.895, "atom1_id": "///K/1331/N", "atom2_id": "///K/1355/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1361, "atom1_serNum": 14925, "atom2_serNum": 15105, "donAcc_type": "standard", "distance": 2.890, "atom1_id": "///K/1331/O", "atom2_id": "///K/1355/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1362, "atom1_serNum": 14930, "atom2_serNum": 16787, "donAcc_type": "standard", "distance": 2.897, "atom1_id": "///K/1331/NZ", "atom2_id": "///K/1625/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1363, "atom1_serNum": 14934, "atom2_serNum": 14936, "donAcc_type": "acceptable", "distance": 3.164, "atom1_id": "///K/1332/O", "atom2_id": "///K/1332/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1364, "atom1_serNum": 14938, "atom2_serNum": 15090, "donAcc_type": "standard", "distance": 2.927, "atom1_id": "///K/1333/N", "atom2_id": "///K/1353/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1365, "atom1_serNum": 14941, "atom2_serNum": 15087, "donAcc_type": "standard", "distance": 3.274, "atom1_id": "///K/1333/O", "atom2_id": "///K/1353/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1366, "atom1_serNum": 14948, "atom2_serNum": 16350, "donAcc_type": "acceptable", "distance": 3.013, "atom1_id": "///K/1334/O", "atom2_id": "///K/1503/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1367, "atom1_serNum": 14954, "atom2_serNum": 15075, "donAcc_type": "standard", "distance": 3.889, "atom1_id": "///K/1335/N", "atom2_id": "///K/1351/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1368, "atom1_serNum": 14957, "atom2_serNum": 14997, "donAcc_type": "standard", "distance": 2.892, "atom1_id": "///K/1335/O", "atom2_id": "///K/1340/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1369, "atom1_serNum": 14964, "atom2_serNum": 14981, "donAcc_type": "standard", "distance": 3.187, "atom1_id": "///K/1336/O", "atom2_id": "///K/1339/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1370, "atom1_serNum": 14964, "atom2_serNum": 14989, "donAcc_type": "standard", "distance": 3.024, "atom1_id": "///K/1336/O", "atom2_id": "///K/1340/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1371, "atom1_serNum": 14973, "atom2_serNum": 14998, "donAcc_type": "standard", "distance": 2.924, "atom1_id": "///K/1337/O", "atom2_id": "///K/1341/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1372, "atom1_serNum": 14977, "atom2_serNum": 16445, "donAcc_type": "standard", "distance": 3.317, "atom1_id": "///K/1338/N", "atom2_id": "///K/1514/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1373, "atom1_serNum": 14980, "atom2_serNum": 15003, "donAcc_type": "standard", "distance": 3.584, "atom1_id": "///K/1338/O", "atom2_id": "///K/1342/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1374, "atom1_serNum": 14981, "atom2_serNum": 16446, "donAcc_type": "standard", "distance": 3.160, "atom1_id": "///K/1339/N", "atom2_id": "///K/1514/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1375, "atom1_serNum": 14984, "atom2_serNum": 15014, "donAcc_type": "standard", "distance": 3.021, "atom1_id": "///K/1339/O", "atom2_id": "///K/1343/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1376, "atom1_serNum": 14984, "atom2_serNum": 15025, "donAcc_type": "standard", "distance": 3.459, "atom1_id": "///K/1339/O", "atom2_id": "///K/1344/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1377, "atom1_serNum": 14992, "atom2_serNum": 15032, "donAcc_type": "standard", "distance": 2.777, "atom1_id": "///K/1340/O", "atom2_id": "///K/1345/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1378, "atom1_serNum": 15017, "atom2_serNum": 15046, "donAcc_type": "standard", "distance": 2.874, "atom1_id": "///K/1343/O", "atom2_id": "///K/1347/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1379, "atom1_serNum": 15017, "atom2_serNum": 15050, "donAcc_type": "standard", "distance": 3.179, "atom1_id": "///K/1343/O", "atom2_id": "///K/1348/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1380, "atom1_serNum": 15028, "atom2_serNum": 15046, "donAcc_type": "standard", "distance": 2.982, "atom1_id": "///K/1344/O", "atom2_id": "///K/1347/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1381, "atom1_serNum": 15117, "atom2_serNum": 15314, "donAcc_type": "standard", "distance": 3.169, "atom1_id": "///K/1356/N", "atom2_id": "///K/1380/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1382, "atom1_serNum": 15120, "atom2_serNum": 15311, "donAcc_type": "standard", "distance": 3.282, "atom1_id": "///K/1356/O", "atom2_id": "///K/1380/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1383, "atom1_serNum": 15126, "atom2_serNum": 16704, "donAcc_type": "standard", "distance": 3.024, "atom1_id": "///K/1356/NH1", "atom2_id": "///K/1614/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1384, "atom1_serNum": 15133, "atom2_serNum": 15298, "donAcc_type": "acceptable", "distance": 3.318, "atom1_id": "///K/1357/OG1", "atom2_id": "///K/1378/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1385, "atom1_serNum": 15135, "atom2_serNum": 15298, "donAcc_type": "standard", "distance": 3.433, "atom1_id": "///K/1358/N", "atom2_id": "///K/1378/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1386, "atom1_serNum": 15138, "atom2_serNum": 15295, "donAcc_type": "standard", "distance": 3.343, "atom1_id": "///K/1358/O", "atom2_id": "///K/1378/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1387, "atom1_serNum": 15149, "atom2_serNum": 15280, "donAcc_type": "standard", "distance": 3.705, "atom1_id": "///K/1360/N", "atom2_id": "///K/1376/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1388, "atom1_serNum": 15152, "atom2_serNum": 15277, "donAcc_type": "standard", "distance": 3.253, "atom1_id": "///K/1360/O", "atom2_id": "///K/1376/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1389, "atom1_serNum": 15168, "atom2_serNum": 15265, "donAcc_type": "standard", "distance": 2.486, "atom1_id": "///K/1362/N", "atom2_id": "///K/1374/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1390, "atom1_serNum": 15171, "atom2_serNum": 15251, "donAcc_type": "standard", "distance": 2.922, "atom1_id": "///K/1362/O", "atom2_id": "///K/1373/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1391, "atom1_serNum": 15184, "atom2_serNum": 15240, "donAcc_type": "standard", "distance": 2.886, "atom1_id": "///K/1364/N", "atom2_id": "///K/1371/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1392, "atom1_serNum": 15187, "atom2_serNum": 15237, "donAcc_type": "standard", "distance": 2.887, "atom1_id": "///K/1364/O", "atom2_id": "///K/1371/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1393, "atom1_serNum": 15191, "atom2_serNum": 15522, "donAcc_type": "standard", "distance": 3.497, "atom1_id": "///K/1364/OE1", "atom2_id": "///K/1405/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1394, "atom1_serNum": 15192, "atom2_serNum": 15525, "donAcc_type": "questionable", "distance": 2.974, "atom1_id": "///K/1364/OE2", "atom2_id": "///K/1405/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1395, "atom1_serNum": 15202, "atom2_serNum": 15225, "donAcc_type": "standard", "distance": 2.898, "atom1_id": "///K/1366/N", "atom2_id": "///K/1369/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1396, "atom1_serNum": 15205, "atom2_serNum": 15222, "donAcc_type": "standard", "distance": 2.908, "atom1_id": "///K/1366/O", "atom2_id": "///K/1369/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1397, "atom1_serNum": 15205, "atom2_serNum": 16976, "donAcc_type": "standard", "distance": 3.627, "atom1_id": "///K/1366/O", "atom2_id": "///K/1648/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1398, "atom1_serNum": 15245, "atom2_serNum": 17002, "donAcc_type": "acceptable", "distance": 2.728, "atom1_id": "///K/1372/N", "atom2_id": "///K/1651/OG1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1399, "atom1_serNum": 15254, "atom2_serNum": 15483, "donAcc_type": "standard", "distance": 3.594, "atom1_id": "///K/1373/O", "atom2_id": "///K/1401/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1400, "atom1_serNum": 15254, "atom2_serNum": 15604, "donAcc_type": "acceptable", "distance": 2.904, "atom1_id": "///K/1373/O", "atom2_id": "///K/1414/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1401, "atom1_serNum": 15276, "atom2_serNum": 15472, "donAcc_type": "questionable", "distance": 3.210, "atom1_id": "///K/1375/O", "atom2_id": "///K/1399/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1402, "atom1_serNum": 15285, "atom2_serNum": 15452, "donAcc_type": "standard", "distance": 3.565, "atom1_id": "///K/1377/N", "atom2_id": "///K/1397/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1403, "atom1_serNum": 15288, "atom2_serNum": 15443, "donAcc_type": "standard", "distance": 2.915, "atom1_id": "///K/1377/O", "atom2_id": "///K/1396/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1404, "atom1_serNum": 15288, "atom2_serNum": 15449, "donAcc_type": "standard", "distance": 3.543, "atom1_id": "///K/1377/O", "atom2_id": "///K/1397/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1405, "atom1_serNum": 15302, "atom2_serNum": 15426, "donAcc_type": "standard", "distance": 2.899, "atom1_id": "///K/1379/N", "atom2_id": "///K/1394/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1406, "atom1_serNum": 15305, "atom2_serNum": 15423, "donAcc_type": "standard", "distance": 2.898, "atom1_id": "///K/1379/O", "atom2_id": "///K/1394/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1407, "atom1_serNum": 15309, "atom2_serNum": 15448, "donAcc_type": "acceptable", "distance": 2.902, "atom1_id": "///K/1379/OE1", "atom2_id": "///K/1396/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1408, "atom1_serNum": 15310, "atom2_serNum": 15331, "donAcc_type": "acceptable", "distance": 3.882, "atom1_id": "///K/1379/NE2", "atom2_id": "///K/1381/OH", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1409, "atom1_serNum": 15319, "atom2_serNum": 15663, "donAcc_type": "acceptable", "distance": 3.015, "atom1_id": "///K/1380/OE2", "atom2_id": "///K/1421/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1410, "atom1_serNum": 15320, "atom2_serNum": 15408, "donAcc_type": "standard", "distance": 2.924, "atom1_id": "///K/1381/N", "atom2_id": "///K/1392/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1411, "atom1_serNum": 15331, "atom2_serNum": 16342, "donAcc_type": "acceptable", "distance": 2.720, "atom1_id": "///K/1381/OH", "atom2_id": "///K/1503/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1412, "atom1_serNum": 15335, "atom2_serNum": 15350, "donAcc_type": "standard", "distance": 3.094, "atom1_id": "///K/1382/O", "atom2_id": "///K/1385/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1413, "atom1_serNum": 15341, "atom2_serNum": 16682, "donAcc_type": "acceptable", "distance": 2.903, "atom1_id": "///K/1383/OG", "atom2_id": "///K/1612/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1414, "atom1_serNum": 15342, "atom2_serNum": 15348, "donAcc_type": "standard", "distance": 2.783, "atom1_id": "///K/1384/N", "atom2_id": "///K/1384/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1415, "atom1_serNum": 15353, "atom2_serNum": 15393, "donAcc_type": "standard", "distance": 3.594, "atom1_id": "///K/1385/O", "atom2_id": "///K/1390/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1416, "atom1_serNum": 15359, "atom2_serNum": 15377, "donAcc_type": "standard", "distance": 3.387, "atom1_id": "///K/1386/O", "atom2_id": "///K/1389/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1417, "atom1_serNum": 15383, "atom2_serNum": 16339, "donAcc_type": "standard", "distance": 3.465, "atom1_id": "///K/1389/OD1", "atom2_id": "///K/1503/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1418, "atom1_serNum": 15384, "atom2_serNum": 16342, "donAcc_type": "standard", "distance": 3.095, "atom1_id": "///K/1389/ND2", "atom2_id": "///K/1503/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1419, "atom1_serNum": 15397, "atom2_serNum": 15749, "donAcc_type": "standard", "distance": 3.533, "atom1_id": "///K/1391/O", "atom2_id": "///K/1432/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1420, "atom1_serNum": 15416, "atom2_serNum": 15752, "donAcc_type": "standard", "distance": 2.889, "atom1_id": "///K/1393/N", "atom2_id": "///K/1432/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1421, "atom1_serNum": 15419, "atom2_serNum": 15760, "donAcc_type": "standard", "distance": 2.903, "atom1_id": "///K/1393/O", "atom2_id": "///K/1434/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1422, "atom1_serNum": 15435, "atom2_serNum": 15763, "donAcc_type": "standard", "distance": 2.960, "atom1_id": "///K/1395/N", "atom2_id": "///K/1434/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1423, "atom1_serNum": 15475, "atom2_serNum": 15908, "donAcc_type": "standard", "distance": 2.799, "atom1_id": "///K/1399/OD1", "atom2_id": "///K/1451/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1424, "atom1_serNum": 15476, "atom2_serNum": 15864, "donAcc_type": "standard", "distance": 2.998, "atom1_id": "///K/1399/OD2", "atom2_id": "///K/1447/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1425, "atom1_serNum": 15476, "atom2_serNum": 15872, "donAcc_type": "standard", "distance": 2.760, "atom1_id": "///K/1399/OD2", "atom2_id": "///K/1448/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1426, "atom1_serNum": 15482, "atom2_serNum": 15604, "donAcc_type": "acceptable", "distance": 3.279, "atom1_id": "///K/1400/OG", "atom2_id": "///K/1414/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1427, "atom1_serNum": 15486, "atom2_serNum": 15500, "donAcc_type": "standard", "distance": 2.917, "atom1_id": "///K/1401/O", "atom2_id": "///K/1403/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1428, "atom1_serNum": 15486, "atom2_serNum": 15604, "donAcc_type": "acceptable", "distance": 3.351, "atom1_id": "///K/1401/O", "atom2_id": "///K/1414/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1429, "atom1_serNum": 15490, "atom2_serNum": 15496, "donAcc_type": "acceptable", "distance": 3.138, "atom1_id": "///K/1402/N", "atom2_id": "///K/1402/ND1", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 1430, "atom1_serNum": 15490, "atom2_serNum": 15938, "donAcc_type": "standard", "distance": 3.556, "atom1_id": "///K/1402/N", "atom2_id": "///K/1455/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1431, "atom1_serNum": 15543, "atom2_serNum": 15563, "donAcc_type": "standard", "distance": 3.283, "atom1_id": "///K/1407/O", "atom2_id": "///K/1410/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1432, "atom1_serNum": 15558, "atom2_serNum": 15586, "donAcc_type": "standard", "distance": 2.692, "atom1_id": "///K/1409/O", "atom2_id": "///K/1413/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1433, "atom1_serNum": 15566, "atom2_serNum": 15593, "donAcc_type": "standard", "distance": 2.925, "atom1_id": "///K/1410/O", "atom2_id": "///K/1414/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1434, "atom1_serNum": 15577, "atom2_serNum": 15605, "donAcc_type": "standard", "distance": 2.906, "atom1_id": "///K/1411/O", "atom2_id": "///K/1415/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1435, "atom1_serNum": 15584, "atom2_serNum": 15615, "donAcc_type": "standard", "distance": 2.875, "atom1_id": "///K/1412/O", "atom2_id": "///K/1416/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1436, "atom1_serNum": 15589, "atom2_serNum": 15624, "donAcc_type": "standard", "distance": 2.895, "atom1_id": "///K/1413/O", "atom2_id": "///K/1417/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1437, "atom1_serNum": 15596, "atom2_serNum": 15632, "donAcc_type": "standard", "distance": 2.960, "atom1_id": "///K/1414/O", "atom2_id": "///K/1418/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1438, "atom1_serNum": 15608, "atom2_serNum": 15640, "donAcc_type": "standard", "distance": 2.879, "atom1_id": "///K/1415/O", "atom2_id": "///K/1419/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1439, "atom1_serNum": 15614, "atom2_serNum": 16029, "donAcc_type": "standard", "distance": 3.300, "atom1_id": "///K/1415/NE2", "atom2_id": "///K/1466/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1440, "atom1_serNum": 15618, "atom2_serNum": 15648, "donAcc_type": "standard", "distance": 2.856, "atom1_id": "///K/1416/O", "atom2_id": "///K/1420/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1441, "atom1_serNum": 15623, "atom2_serNum": 16102, "donAcc_type": "standard", "distance": 3.465, "atom1_id": "///K/1416/OE2", "atom2_id": "///K/1473/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1442, "atom1_serNum": 15627, "atom2_serNum": 15652, "donAcc_type": "standard", "distance": 2.936, "atom1_id": "///K/1417/O", "atom2_id": "///K/1421/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1443, "atom1_serNum": 15635, "atom2_serNum": 15664, "donAcc_type": "standard", "distance": 2.943, "atom1_id": "///K/1418/O", "atom2_id": "///K/1422/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1444, "atom1_serNum": 15643, "atom2_serNum": 15672, "donAcc_type": "standard", "distance": 2.859, "atom1_id": "///K/1419/O", "atom2_id": "///K/1423/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1445, "atom1_serNum": 15651, "atom2_serNum": 15681, "donAcc_type": "standard", "distance": 2.873, "atom1_id": "///K/1420/O", "atom2_id": "///K/1424/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1446, "atom1_serNum": 15655, "atom2_serNum": 15693, "donAcc_type": "standard", "distance": 2.955, "atom1_id": "///K/1421/O", "atom2_id": "///K/1425/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1447, "atom1_serNum": 15667, "atom2_serNum": 15700, "donAcc_type": "standard", "distance": 2.903, "atom1_id": "///K/1422/O", "atom2_id": "///K/1426/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1448, "atom1_serNum": 15675, "atom2_serNum": 15709, "donAcc_type": "standard", "distance": 2.879, "atom1_id": "///K/1423/O", "atom2_id": "///K/1427/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1449, "atom1_serNum": 15684, "atom2_serNum": 15718, "donAcc_type": "standard", "distance": 2.909, "atom1_id": "///K/1424/O", "atom2_id": "///K/1428/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1450, "atom1_serNum": 15696, "atom2_serNum": 15726, "donAcc_type": "standard", "distance": 2.927, "atom1_id": "///K/1425/O", "atom2_id": "///K/1429/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1451, "atom1_serNum": 15696, "atom2_serNum": 15730, "donAcc_type": "standard", "distance": 2.715, "atom1_id": "///K/1425/O", "atom2_id": "///K/1430/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1452, "atom1_serNum": 15708, "atom2_serNum": 16133, "donAcc_type": "standard", "distance": 3.771, "atom1_id": "///K/1426/NZ", "atom2_id": "///K/1478/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1453, "atom1_serNum": 15708, "atom2_serNum": 16144, "donAcc_type": "standard", "distance": 2.808, "atom1_id": "///K/1426/NZ", "atom2_id": "///K/1479/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1454, "atom1_serNum": 15729, "atom2_serNum": 15747, "donAcc_type": "acceptable", "distance": 3.361, "atom1_id": "///K/1429/O", "atom2_id": "///K/1431/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1455, "atom1_serNum": 15745, "atom2_serNum": 16659, "donAcc_type": "standard", "distance": 2.447, "atom1_id": "///K/1431/O", "atom2_id": "///K/1600/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1456, "atom1_serNum": 15756, "atom2_serNum": 16643, "donAcc_type": "standard", "distance": 2.902, "atom1_id": "///K/1433/N", "atom2_id": "///K/1598/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1457, "atom1_serNum": 15759, "atom2_serNum": 16640, "donAcc_type": "standard", "distance": 2.881, "atom1_id": "///K/1433/O", "atom2_id": "///K/1598/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1458, "atom1_serNum": 15770, "atom2_serNum": 16625, "donAcc_type": "standard", "distance": 2.951, "atom1_id": "///K/1435/N", "atom2_id": "///K/1596/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1459, "atom1_serNum": 15773, "atom2_serNum": 16622, "donAcc_type": "standard", "distance": 2.914, "atom1_id": "///K/1435/O", "atom2_id": "///K/1596/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1460, "atom1_serNum": 15781, "atom2_serNum": 15797, "donAcc_type": "standard", "distance": 3.069, "atom1_id": "///K/1436/O", "atom2_id": "///K/1438/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1461, "atom1_serNum": 15792, "atom2_serNum": 16607, "donAcc_type": "standard", "distance": 3.281, "atom1_id": "///K/1437/N", "atom2_id": "///K/1594/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1462, "atom1_serNum": 15800, "atom2_serNum": 15863, "donAcc_type": "acceptable", "distance": 2.485, "atom1_id": "///K/1438/O", "atom2_id": "///K/1446/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1463, "atom1_serNum": 15820, "atom2_serNum": 15836, "donAcc_type": "standard", "distance": 3.162, "atom1_id": "///K/1441/O", "atom2_id": "///K/1444/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1464, "atom1_serNum": 15847, "atom2_serNum": 16801, "donAcc_type": "standard", "distance": 3.560, "atom1_id": "///K/1445/O", "atom2_id": "///K/1627/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1465, "atom1_serNum": 15850, "atom2_serNum": 15905, "donAcc_type": "acceptable", "distance": 2.525, "atom1_id": "///K/1445/OD1", "atom2_id": "///K/1451/ND1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1466, "atom1_serNum": 15851, "atom2_serNum": 15889, "donAcc_type": "acceptable", "distance": 3.560, "atom1_id": "///K/1445/OD2", "atom2_id": "///K/1449/ND1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1467, "atom1_serNum": 15851, "atom2_serNum": 16865, "donAcc_type": "standard", "distance": 3.977, "atom1_id": "///K/1445/OD2", "atom2_id": "///K/1635/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1468, "atom1_serNum": 15855, "atom2_serNum": 16801, "donAcc_type": "standard", "distance": 3.560, "atom1_id": "///K/1446/O", "atom2_id": "///K/1627/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1469, "atom1_serNum": 15867, "atom2_serNum": 15883, "donAcc_type": "standard", "distance": 3.293, "atom1_id": "///K/1447/O", "atom2_id": "///K/1449/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1470, "atom1_serNum": 15896, "atom2_serNum": 16910, "donAcc_type": "standard", "distance": 3.457, "atom1_id": "///K/1450/O", "atom2_id": "///K/1641/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1471, "atom1_serNum": 15896, "atom2_serNum": 16921, "donAcc_type": "standard", "distance": 3.313, "atom1_id": "///K/1450/O", "atom2_id": "///K/1642/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1472, "atom1_serNum": 15912, "atom2_serNum": 15931, "donAcc_type": "standard", "distance": 3.031, "atom1_id": "///K/1452/O", "atom2_id": "///K/1455/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1473, "atom1_serNum": 15926, "atom2_serNum": 15940, "donAcc_type": "standard", "distance": 3.185, "atom1_id": "///K/1454/O", "atom2_id": "///K/1456/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1474, "atom1_serNum": 15967, "atom2_serNum": 16000, "donAcc_type": "standard", "distance": 2.937, "atom1_id": "///K/1459/O", "atom2_id": "///K/1463/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1475, "atom1_serNum": 15976, "atom2_serNum": 16008, "donAcc_type": "standard", "distance": 2.936, "atom1_id": "///K/1460/O", "atom2_id": "///K/1464/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1476, "atom1_serNum": 15983, "atom2_serNum": 16017, "donAcc_type": "standard", "distance": 2.906, "atom1_id": "///K/1461/O", "atom2_id": "///K/1465/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1477, "atom1_serNum": 15988, "atom2_serNum": 16015, "donAcc_type": "standard", "distance": 3.072, "atom1_id": "///K/1461/NZ", "atom2_id": "///K/1464/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1478, "atom1_serNum": 15992, "atom2_serNum": 16026, "donAcc_type": "standard", "distance": 2.911, "atom1_id": "///K/1462/O", "atom2_id": "///K/1466/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1479, "atom1_serNum": 16003, "atom2_serNum": 16040, "donAcc_type": "standard", "distance": 2.907, "atom1_id": "///K/1463/O", "atom2_id": "///K/1467/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1480, "atom1_serNum": 16011, "atom2_serNum": 16052, "donAcc_type": "standard", "distance": 2.887, "atom1_id": "///K/1464/O", "atom2_id": "///K/1468/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1481, "atom1_serNum": 16020, "atom2_serNum": 16061, "donAcc_type": "standard", "distance": 2.911, "atom1_id": "///K/1465/O", "atom2_id": "///K/1469/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1482, "atom1_serNum": 16029, "atom2_serNum": 16070, "donAcc_type": "standard", "distance": 2.937, "atom1_id": "///K/1466/O", "atom2_id": "///K/1470/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1483, "atom1_serNum": 16043, "atom2_serNum": 16078, "donAcc_type": "standard", "distance": 2.878, "atom1_id": "///K/1467/O", "atom2_id": "///K/1471/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1484, "atom1_serNum": 16055, "atom2_serNum": 16086, "donAcc_type": "standard", "distance": 2.887, "atom1_id": "///K/1468/O", "atom2_id": "///K/1472/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1485, "atom1_serNum": 16064, "atom2_serNum": 16094, "donAcc_type": "standard", "distance": 2.935, "atom1_id": "///K/1469/O", "atom2_id": "///K/1473/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1486, "atom1_serNum": 16073, "atom2_serNum": 16103, "donAcc_type": "standard", "distance": 2.900, "atom1_id": "///K/1470/O", "atom2_id": "///K/1474/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1487, "atom1_serNum": 16081, "atom2_serNum": 16108, "donAcc_type": "standard", "distance": 2.887, "atom1_id": "///K/1471/O", "atom2_id": "///K/1475/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1488, "atom1_serNum": 16089, "atom2_serNum": 16115, "donAcc_type": "standard", "distance": 2.924, "atom1_id": "///K/1472/O", "atom2_id": "///K/1476/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1489, "atom1_serNum": 16092, "atom2_serNum": 16185, "donAcc_type": "acceptable", "distance": 2.377, "atom1_id": "///K/1472/OD1", "atom2_id": "///K/1483/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1490, "atom1_serNum": 16097, "atom2_serNum": 16120, "donAcc_type": "acceptable", "distance": 2.665, "atom1_id": "///K/1473/O", "atom2_id": "///K/1476/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1491, "atom1_serNum": 16097, "atom2_serNum": 16121, "donAcc_type": "standard", "distance": 3.249, "atom1_id": "///K/1473/O", "atom2_id": "///K/1477/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1492, "atom1_serNum": 16106, "atom2_serNum": 16121, "donAcc_type": "standard", "distance": 3.131, "atom1_id": "///K/1474/O", "atom2_id": "///K/1477/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1493, "atom1_serNum": 16106, "atom2_serNum": 16141, "donAcc_type": "standard", "distance": 3.389, "atom1_id": "///K/1474/O", "atom2_id": "///K/1479/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1494, "atom1_serNum": 16111, "atom2_serNum": 16130, "donAcc_type": "standard", "distance": 3.013, "atom1_id": "///K/1475/O", "atom2_id": "///K/1478/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1495, "atom1_serNum": 16156, "atom2_serNum": 16651, "donAcc_type": "standard", "distance": 3.229, "atom1_id": "///K/1481/N", "atom2_id": "///K/1599/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1496, "atom1_serNum": 16166, "atom2_serNum": 16172, "donAcc_type": "standard", "distance": 2.694, "atom1_id": "///K/1482/N", "atom2_id": "///K/1482/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1497, "atom1_serNum": 16169, "atom2_serNum": 16648, "donAcc_type": "standard", "distance": 2.950, "atom1_id": "///K/1482/O", "atom2_id": "///K/1599/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1498, "atom1_serNum": 16173, "atom2_serNum": 16194, "donAcc_type": "standard", "distance": 2.527, "atom1_id": "///K/1482/OD2", "atom2_id": "///K/1484/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1499, "atom1_serNum": 16186, "atom2_serNum": 16636, "donAcc_type": "standard", "distance": 2.911, "atom1_id": "///K/1484/N", "atom2_id": "///K/1597/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1500, "atom1_serNum": 16189, "atom2_serNum": 16633, "donAcc_type": "standard", "distance": 2.926, "atom1_id": "///K/1484/O", "atom2_id": "///K/1597/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1501, "atom1_serNum": 16198, "atom2_serNum": 16231, "donAcc_type": "standard", "distance": 3.076, "atom1_id": "///K/1485/O", "atom2_id": "///K/1489/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1502, "atom1_serNum": 16206, "atom2_serNum": 16240, "donAcc_type": "standard", "distance": 2.904, "atom1_id": "///K/1486/O", "atom2_id": "///K/1490/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1503, "atom1_serNum": 16214, "atom2_serNum": 16245, "donAcc_type": "standard", "distance": 2.922, "atom1_id": "///K/1487/O", "atom2_id": "///K/1491/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1504, "atom1_serNum": 16225, "atom2_serNum": 16250, "donAcc_type": "acceptable", "distance": 2.611, "atom1_id": "///K/1488/O", "atom2_id": "///K/1491/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1505, "atom1_serNum": 16225, "atom2_serNum": 16252, "donAcc_type": "standard", "distance": 2.909, "atom1_id": "///K/1488/O", "atom2_id": "///K/1492/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1506, "atom1_serNum": 16234, "atom2_serNum": 16261, "donAcc_type": "standard", "distance": 2.895, "atom1_id": "///K/1489/O", "atom2_id": "///K/1493/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1507, "atom1_serNum": 16238, "atom2_serNum": 16268, "donAcc_type": "questionable", "distance": 3.085, "atom1_id": "///K/1489/OE1", "atom2_id": "///K/1493/OD2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1508, "atom1_serNum": 16238, "atom2_serNum": 16658, "donAcc_type": "standard", "distance": 3.056, "atom1_id": "///K/1489/OE1", "atom2_id": "///K/1599/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1509, "atom1_serNum": 16243, "atom2_serNum": 16269, "donAcc_type": "standard", "distance": 3.026, "atom1_id": "///K/1490/O", "atom2_id": "///K/1494/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1510, "atom1_serNum": 16259, "atom2_serNum": 16658, "donAcc_type": "standard", "distance": 3.562, "atom1_id": "///K/1492/OE1", "atom2_id": "///K/1599/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1511, "atom1_serNum": 16283, "atom2_serNum": 16537, "donAcc_type": "acceptable", "distance": 2.705, "atom1_id": "///K/1495/O", "atom2_id": "///K/1585/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1512, "atom1_serNum": 16288, "atom2_serNum": 16322, "donAcc_type": "standard", "distance": 3.305, "atom1_id": "///K/1496/N", "atom2_id": "///K/1500/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1513, "atom1_serNum": 16291, "atom2_serNum": 16499, "donAcc_type": "acceptable", "distance": 3.202, "atom1_id": "///K/1496/O", "atom2_id": "///K/1581/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1514, "atom1_serNum": 16304, "atom2_serNum": 16324, "donAcc_type": "standard", "distance": 3.205, "atom1_id": "///K/1498/O", "atom2_id": "///K/1501/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1515, "atom1_serNum": 16354, "atom2_serNum": 16375, "donAcc_type": "standard", "distance": 3.451, "atom1_id": "///K/1504/O", "atom2_id": "///K/1507/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1516, "atom1_serNum": 16381, "atom2_serNum": 16383, "donAcc_type": "standard", "distance": 2.632, "atom1_id": "///K/1507/OD1", "atom2_id": "///K/1508/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1517, "atom1_serNum": 16386, "atom2_serNum": 16423, "donAcc_type": "standard", "distance": 2.908, "atom1_id": "///K/1508/O", "atom2_id": "///K/1512/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1518, "atom1_serNum": 16397, "atom2_serNum": 16430, "donAcc_type": "standard", "distance": 2.903, "atom1_id": "///K/1509/O", "atom2_id": "///K/1513/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1519, "atom1_serNum": 16411, "atom2_serNum": 16438, "donAcc_type": "standard", "distance": 2.905, "atom1_id": "///K/1510/O", "atom2_id": "///K/1514/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1520, "atom1_serNum": 16418, "atom2_serNum": 16447, "donAcc_type": "standard", "distance": 2.907, "atom1_id": "///K/1511/O", "atom2_id": "///K/1515/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1521, "atom1_serNum": 16426, "atom2_serNum": 16456, "donAcc_type": "standard", "distance": 2.898, "atom1_id": "///K/1512/O", "atom2_id": "///K/1516/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1522, "atom1_serNum": 16426, "atom2_serNum": 16461, "donAcc_type": "acceptable", "distance": 2.719, "atom1_id": "///K/1512/O", "atom2_id": "///K/1516/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1523, "atom1_serNum": 16433, "atom2_serNum": 16462, "donAcc_type": "standard", "distance": 3.177, "atom1_id": "///K/1513/O", "atom2_id": "///K/1517/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1524, "atom1_serNum": 16461, "atom2_serNum": 16517, "donAcc_type": "acceptable", "distance": 3.189, "atom1_id": "///K/1516/OG", "atom2_id": "///K/1583/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1525, "atom1_serNum": 16473, "atom2_serNum": 16500, "donAcc_type": "standard", "distance": 2.925, "atom1_id": "///K/1578/O", "atom2_id": "///K/1582/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1526, "atom1_serNum": 16481, "atom2_serNum": 16509, "donAcc_type": "standard", "distance": 2.914, "atom1_id": "///K/1579/O", "atom2_id": "///K/1583/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1527, "atom1_serNum": 16489, "atom2_serNum": 16518, "donAcc_type": "standard", "distance": 2.889, "atom1_id": "///K/1580/O", "atom2_id": "///K/1584/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1528, "atom1_serNum": 16497, "atom2_serNum": 16526, "donAcc_type": "standard", "distance": 2.884, "atom1_id": "///K/1581/O", "atom2_id": "///K/1585/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1529, "atom1_serNum": 16503, "atom2_serNum": 16538, "donAcc_type": "standard", "distance": 2.928, "atom1_id": "///K/1582/O", "atom2_id": "///K/1586/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1530, "atom1_serNum": 16512, "atom2_serNum": 16543, "donAcc_type": "standard", "distance": 2.920, "atom1_id": "///K/1583/O", "atom2_id": "///K/1587/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1531, "atom1_serNum": 16512, "atom2_serNum": 16548, "donAcc_type": "acceptable", "distance": 3.002, "atom1_id": "///K/1583/O", "atom2_id": "///K/1587/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1532, "atom1_serNum": 16521, "atom2_serNum": 16550, "donAcc_type": "standard", "distance": 2.883, "atom1_id": "///K/1584/O", "atom2_id": "///K/1588/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1533, "atom1_serNum": 16529, "atom2_serNum": 16558, "donAcc_type": "standard", "distance": 2.870, "atom1_id": "///K/1585/O", "atom2_id": "///K/1589/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1534, "atom1_serNum": 16541, "atom2_serNum": 16567, "donAcc_type": "standard", "distance": 2.943, "atom1_id": "///K/1586/O", "atom2_id": "///K/1590/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1535, "atom1_serNum": 16546, "atom2_serNum": 16576, "donAcc_type": "standard", "distance": 3.186, "atom1_id": "///K/1587/O", "atom2_id": "///K/1591/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1536, "atom1_serNum": 16579, "atom2_serNum": 16611, "donAcc_type": "standard", "distance": 3.882, "atom1_id": "///K/1591/O", "atom2_id": "///K/1595/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1537, "atom1_serNum": 16589, "atom2_serNum": 16614, "donAcc_type": "questionable", "distance": 3.021, "atom1_id": "///K/1592/O", "atom2_id": "///K/1595/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1538, "atom1_serNum": 16756, "atom2_serNum": 16762, "donAcc_type": "standard", "distance": 2.740, "atom1_id": "///K/1622/N", "atom2_id": "///K/1622/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1539, "atom1_serNum": 16775, "atom2_serNum": 16788, "donAcc_type": "standard", "distance": 2.919, "atom1_id": "///K/1624/O", "atom2_id": "///K/1626/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1540, "atom1_serNum": 16791, "atom2_serNum": 16816, "donAcc_type": "standard", "distance": 3.871, "atom1_id": "///K/1626/O", "atom2_id": "///K/1630/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1541, "atom1_serNum": 16795, "atom2_serNum": 16827, "donAcc_type": "standard", "distance": 2.896, "atom1_id": "///K/1627/O", "atom2_id": "///K/1631/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1542, "atom1_serNum": 16806, "atom2_serNum": 16835, "donAcc_type": "standard", "distance": 2.907, "atom1_id": "///K/1628/O", "atom2_id": "///K/1632/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1543, "atom1_serNum": 16806, "atom2_serNum": 16840, "donAcc_type": "acceptable", "distance": 2.694, "atom1_id": "///K/1628/O", "atom2_id": "///K/1632/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1544, "atom1_serNum": 16814, "atom2_serNum": 16842, "donAcc_type": "standard", "distance": 2.911, "atom1_id": "///K/1629/O", "atom2_id": "///K/1633/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1545, "atom1_serNum": 16819, "atom2_serNum": 16850, "donAcc_type": "standard", "distance": 2.904, "atom1_id": "///K/1630/O", "atom2_id": "///K/1634/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1546, "atom1_serNum": 16830, "atom2_serNum": 16855, "donAcc_type": "standard", "distance": 2.901, "atom1_id": "///K/1631/O", "atom2_id": "///K/1635/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1547, "atom1_serNum": 16838, "atom2_serNum": 16866, "donAcc_type": "standard", "distance": 2.901, "atom1_id": "///K/1632/O", "atom2_id": "///K/1636/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1548, "atom1_serNum": 16845, "atom2_serNum": 16874, "donAcc_type": "standard", "distance": 3.065, "atom1_id": "///K/1633/O", "atom2_id": "///K/1637/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1549, "atom1_serNum": 16853, "atom2_serNum": 16883, "donAcc_type": "standard", "distance": 2.977, "atom1_id": "///K/1634/O", "atom2_id": "///K/1638/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1550, "atom1_serNum": 16853, "atom2_serNum": 16893, "donAcc_type": "standard", "distance": 2.771, "atom1_id": "///K/1634/O", "atom2_id": "///K/1639/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1551, "atom1_serNum": 16858, "atom2_serNum": 16883, "donAcc_type": "standard", "distance": 3.287, "atom1_id": "///K/1635/O", "atom2_id": "///K/1638/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1552, "atom1_serNum": 16886, "atom2_serNum": 16901, "donAcc_type": "standard", "distance": 3.139, "atom1_id": "///K/1638/O", "atom2_id": "///K/1640/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1553, "atom1_serNum": 16904, "atom2_serNum": 16996, "donAcc_type": "acceptable", "distance": 2.701, "atom1_id": "///K/1640/O", "atom2_id": "///K/1650/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1554, "atom1_serNum": 16926, "atom2_serNum": 16961, "donAcc_type": "acceptable", "distance": 3.632, "atom1_id": "///K/1642/OG", "atom2_id": "///K/1646/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1555, "atom1_serNum": 16930, "atom2_serNum": 16963, "donAcc_type": "standard", "distance": 2.751, "atom1_id": "///K/1643/O", "atom2_id": "///K/1647/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1556, "atom1_serNum": 16936, "atom2_serNum": 16968, "donAcc_type": "standard", "distance": 2.906, "atom1_id": "///K/1644/O", "atom2_id": "///K/1648/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1557, "atom1_serNum": 16944, "atom2_serNum": 16977, "donAcc_type": "standard", "distance": 2.910, "atom1_id": "///K/1645/O", "atom2_id": "///K/1649/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1558, "atom1_serNum": 16955, "atom2_serNum": 16991, "donAcc_type": "standard", "distance": 2.886, "atom1_id": "///K/1646/O", "atom2_id": "///K/1650/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1559, "atom1_serNum": 16955, "atom2_serNum": 16996, "donAcc_type": "acceptable", "distance": 3.011, "atom1_id": "///K/1646/O", "atom2_id": "///K/1650/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1560, "atom1_serNum": 16966, "atom2_serNum": 16997, "donAcc_type": "standard", "distance": 2.898, "atom1_id": "///K/1647/O", "atom2_id": "///K/1651/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1561, "atom1_serNum": 16966, "atom2_serNum": 17002, "donAcc_type": "acceptable", "distance": 3.056, "atom1_id": "///K/1647/O", "atom2_id": "///K/1651/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1562, "atom1_serNum": 16971, "atom2_serNum": 17004, "donAcc_type": "standard", "distance": 2.940, "atom1_id": "///K/1648/O", "atom2_id": "///K/1652/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1563, "atom1_serNum": 16980, "atom2_serNum": 17012, "donAcc_type": "standard", "distance": 2.927, "atom1_id": "///K/1649/O", "atom2_id": "///K/1653/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1564, "atom1_serNum": 16994, "atom2_serNum": 17018, "donAcc_type": "standard", "distance": 2.914, "atom1_id": "///K/1650/O", "atom2_id": "///K/1654/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1565, "atom1_serNum": 17000, "atom2_serNum": 17026, "donAcc_type": "standard", "distance": 2.909, "atom1_id": "///K/1651/O", "atom2_id": "///K/1655/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1566, "atom1_serNum": 17007, "atom2_serNum": 17034, "donAcc_type": "standard", "distance": 2.906, "atom1_id": "///K/1652/O", "atom2_id": "///K/1656/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1567, "atom1_serNum": 17015, "atom2_serNum": 17041, "donAcc_type": "standard", "distance": 2.898, "atom1_id": "///K/1653/O", "atom2_id": "///K/1657/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1568, "atom1_serNum": 17021, "atom2_serNum": 17050, "donAcc_type": "standard", "distance": 2.884, "atom1_id": "///K/1654/O", "atom2_id": "///K/1658/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1569, "atom1_serNum": 17029, "atom2_serNum": 17058, "donAcc_type": "standard", "distance": 2.930, "atom1_id": "///K/1655/O", "atom2_id": "///K/1659/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1570, "atom1_serNum": 17037, "atom2_serNum": 17068, "donAcc_type": "standard", "distance": 2.899, "atom1_id": "///K/1656/O", "atom2_id": "///K/1660/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1571, "atom1_serNum": 17037, "atom2_serNum": 17073, "donAcc_type": "acceptable", "distance": 2.832, "atom1_id": "///K/1656/O", "atom2_id": "///K/1660/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1572, "atom1_serNum": 17044, "atom2_serNum": 17073, "donAcc_type": "acceptable", "distance": 2.706, "atom1_id": "///K/1657/O", "atom2_id": "///K/1660/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1573, "atom1_serNum": 17044, "atom2_serNum": 17075, "donAcc_type": "standard", "distance": 2.911, "atom1_id": "///K/1657/O", "atom2_id": "///K/1661/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1574, "atom1_serNum": 17053, "atom2_serNum": 17084, "donAcc_type": "standard", "distance": 2.901, "atom1_id": "///K/1658/O", "atom2_id": "///K/1662/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1575, "atom1_serNum": 17061, "atom2_serNum": 17090, "donAcc_type": "standard", "distance": 3.209, "atom1_id": "///K/1659/O", "atom2_id": "///K/1663/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1576, "atom1_serNum": 17071, "atom2_serNum": 17105, "donAcc_type": "questionable", "distance": 2.913, "atom1_id": "///K/1660/O", "atom2_id": "///K/1664/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" } ], "refCoords": { "purine": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 -0.5000 0.4000", " 3 N -2.2500 -0.5000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 1.2500 5.0000 0.4000", " 6 C 1.2500 -0.5000 0.4000", " 7 C 1.2500 -0.5000 -0.4000", " 8 C 1.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 -0.5000 0.4000", " 11 C -2.2500 -0.5000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ], "pyrimidine": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 1.0000 0.4000", " 3 N -2.2500 1.0000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 1.2500 5.0000 0.4000", " 6 C 1.2500 1.0000 0.4000", " 7 C 1.2500 1.0000 -0.4000", " 8 C 1.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 1.0000 0.4000", " 11 C -2.2500 1.0000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ], "wc_pair": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 -5.0000 0.4000", " 3 N -2.2500 -5.0000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 2.2500 5.0000 0.4000", " 6 C 2.2500 -5.0000 0.4000", " 7 C 2.2500 -5.0000 -0.4000", " 8 C 2.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 -5.0000 0.4000", " 11 C -2.2500 -5.0000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ] }, "metadata": { "license": "http://innovation.columbia.edu/technologies/CU20391", "url": "http://x3dna.org/", "url_alt": "http://home.x3dna.org/", "forum": "http://forum.x3dna.org/", "citation": "Lu et al. (2015). 'DSSR: an integrated software tool for dissecting the spatial structure of RNA.' Nucleic Acids Res., 43(21):e142 [doi:10.1093/nar/gkv716].", "str_id": "8hah", "num_aaChains": 9, "aaChains": "A=103,B=80,C=107,D=97,E=99,F=83,G=105,H=96,K=517", "num_naChains": 2, "naChains": "I=164,J=164", "num_atoms": 17096, "num_waters": 0, "num_notes": 52, "notes": [ { "Aminors": "A-minor interactions (including types I and II)" }, { "Cstem_index": "stem index of the 'Canonical' helix in k-turn" }, { "Cstem_pair": "Cstem bp delineating the k-turn internal loop" }, { "Dp": "perpendicular distance of the 3' P atom to the glycosidic bond" }, { "GA_pair": "sheared G-A pair in k-turn" }, { "HtypePknot": "H-type pseudoknot" }, { "Kturn": "kink-turn (k-turn)" }, { "LW": "Leontis-Westhof" }, { "NCstem_index": "stem index of the 'Non-Canonical' helix in k-turn" }, { "NCstem_pair": "NCstem bp delineating the k-turn internal loop" }, { "Uturn": "U-turn of the UNR- or GNRA-type" }, { "aa": "amino acid" }, { "atom_pair": "symbols of the two atoms involved in an H-bond" }, { "auxfiles": "auxiliary files" }, { "glyco_bond": "conformation of base related to sugar (syn or anti)" }, { "bb_type": "backbone conformation, BI or BII" }, { "bending_angle": "angle between two helical axes" }, { "bp": "base pair" }, { "bseq": "base sequence in one-letter code" }, { "bulge": "bulge loop" }, { "coaxStacks": "coaxial stacking of stems within a helix" }, { "dbn": "dot bracket notation" }, { "desc": "description" }, { "donAcc_type": "donor/acceptor type of the atom pair in an H-bond" }, { "epsilon_zeta": "difference between epsilon and zeta torsion angles" }, { "hairpin": "hairpin loop" }, { "hbond": "hydrogen bond (H-bond)" }, { "helix": "defined by base-stacking interactions, regardless of bp type and backbone connectivity" }, { "id": "identifier" }, { "iloop": "internal loop" }, { "index": "serial number" }, { "isoCanonPairs": "isolated canonical pairs" }, { "junction": "(multi-branched) junction loop" }, { "kissingLoop": "kissing loop" }, { "multiplet": "3+ bases in a coplanar geometry" }, { "na": "nucleic acid" }, { "nonPair": "two nts not forming a pair, but with H-bonding/stacking interactions" }, { "nonStack": "nucleotide not involved in stacking interactions" }, { "nt": "nucleotide" }, { "num": "number" }, { "oArea": "overlap areas between two bases, including exocyclic atoms" }, { "oArea_ring": "overlap areas between two bases, including only ring atoms" }, { "phosContacts": "H-bonding and atom-capping interactions involving a phosphate" }, { "residue_pair": "types of the two residues involved in an H-bond" }, { "rmsd": "root-mean-squares deviation" }, { "serNum": "serial number" }, { "ssSegments": "single-stranded segments not involved in loops" }, { "ssZp": "Z-coordinate of the 3' phosphorus atom with reference to the 5' base plane" }, { "sstr": "secondary structure in dbn" }, { "stem": "helix consisting of only canonical pairs, with a continuous backbone" }, { "str_id": "structure identifier, derived from inpfile with extension removed" }, { "vert_dist": "vertical distance from an atom to a base plane" } ], "num_auxfiles": 13, "auxfiles": [ { "index": 1, "name": "dssr-pairs.pdb", "desc": "an ensemble of base pairs" }, { "index": 2, "name": "dssr-stems.pdb", "desc": "an ensemble of stems" }, { "index": 3, "name": "dssr-helices.pdb", "desc": "an ensemble of helices (coaxial stacking)" }, { "index": 4, "name": "dssr-iloops.pdb", "desc": "an ensemble of internal loops" }, { "index": 5, "name": "dssr-2ndstrs.bpseq", "desc": "secondary structure in bpseq format" }, { "index": 6, "name": "dssr-2ndstrs.ct", "desc": "secondary structure in connectivity table format" }, { "index": 7, "name": "dssr-2ndstrs.dbn", "desc": "secondary structure in dot-bracket notation" }, { "index": 8, "name": "dssr-torsions.txt", "desc": "backbone torsion angles and suite names" }, { "index": 9, "name": "dssr-stacks.pdb", "desc": "an ensemble of base stacks" }, { "index": 10, "name": "dssr-rotmat.txt", "desc": "position vector and rotation matrix" }, { "index": 11, "name": "dssr-viewV.pdb", "desc": "vertical view of the principal moment of inertia" }, { "index": 12, "name": "dssr-viewH.pdb", "desc": "horizontal view of the principal moment of inertia" }, { "index": 13, "name": "dssr-viewT.pdb", "desc": "top view of the principal moment of inertia" } ], "time_used": "999" } }