{ "num_pairs": 48, "pairs": [ { "index": 1, "nt1": "///A/1", "nt2": "///C/20", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -173.816, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 53.566, "chi2": -159.408, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 53.379, "C1C1_dist": 10.723, "N1N9_dist": 8.957, "C6C8_dist": 9.886, "CNNC_torsion": 0.972, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.91],N1(imino)-N3[2.90],N2(amino)-O2(carbonyl)[2.80]", "interBase_angle": 8.118, "planarity": 0.099, "simple_Shear": -0.163, "simple_Stretch": -0.138, "simple_Buckle": -7.065, "simple_Propeller": -3.998, "bp_simpleParams": [ -0.163, -0.138, -0.455, -7.065, -3.998, 0.007 ], "bp_params": [ -0.162, -0.140, -0.455, -7.025, -4.068, 0.007 ], "frame": { "rmsd": null, "origin": [ -24.094, 8.296, 77.964 ], "x_axis": [ 0.253, -0.805, 0.537 ], "y_axis": [ -0.334, -0.593, -0.733 ], "z_axis": [ 0.908, 0.006, -0.418 ], "quaternion": [ -0.245, 0.752, -0.378, 0.480 ] } }, { "index": 2, "nt1": "///A/2", "nt2": "///C/19", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -171.548, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 55.920, "chi2": -174.490, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 53.780, "C1C1_dist": 10.667, "N1N9_dist": 8.956, "C6C8_dist": 9.902, "CNNC_torsion": 1.339, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.90],N1(imino)-N3[2.90],N2(amino)-O2(carbonyl)[2.78]", "interBase_angle": 8.339, "planarity": 0.091, "simple_Shear": -0.136, "simple_Stretch": -0.118, "simple_Buckle": -7.985, "simple_Propeller": -2.405, "bp_simpleParams": [ -0.136, -0.118, -0.297, -7.985, -2.405, 0.172 ], "bp_params": [ -0.135, -0.119, -0.297, -7.965, -2.468, 0.172 ], "frame": { "rmsd": null, "origin": [ -20.135, 8.402, 78.661 ], "x_axis": [ -0.043, -0.990, 0.134 ], "y_axis": [ -0.406, -0.105, -0.908 ], "z_axis": [ 0.913, -0.094, -0.398 ], "quaternion": [ -0.337, 0.604, -0.578, 0.433 ] } }, { "index": 3, "nt1": "///A/3", "nt2": "///C/18", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -163.665, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 55.748, "chi2": -156.520, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 55.501, "C1C1_dist": 10.434, "N1N9_dist": 8.759, "C6C8_dist": 9.793, "CNNC_torsion": -2.301, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.04],N1-N3(imino)[2.79]", "interBase_angle": 6.132, "planarity": 0.094, "simple_Shear": -0.018, "simple_Stretch": -0.144, "simple_Buckle": -6.125, "simple_Propeller": -0.298, "bp_simpleParams": [ -0.018, -0.144, 0.102, -6.125, -0.298, 3.365 ], "bp_params": [ -0.018, -0.144, 0.102, -6.126, -0.276, 3.360 ], "frame": { "rmsd": null, "origin": [ -16.253, 8.438, 79.104 ], "x_axis": [ -0.341, -0.907, -0.248 ], "y_axis": [ -0.379, 0.374, -0.846 ], "z_axis": [ 0.860, -0.194, -0.472 ], "quaternion": [ 0.375, -0.435, 0.739, -0.352 ] } }, { "index": 4, "nt1": "///A/4", "nt2": "///C/17", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -163.104, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 54.830, "chi2": -150.370, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 53.855, "C1C1_dist": 10.532, "N1N9_dist": 8.797, "C6C8_dist": 9.772, "CNNC_torsion": 2.328, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.94],N1-N3(imino)[2.78]", "interBase_angle": 3.296, "planarity": 0.045, "simple_Shear": 0.038, "simple_Stretch": -0.178, "simple_Buckle": 2.336, "simple_Propeller": 2.326, "bp_simpleParams": [ 0.038, -0.178, 0.001, 2.336, 2.326, 0.771 ], "bp_params": [ 0.036, -0.178, 0.001, 2.357, 2.305, 0.771 ], "frame": { "rmsd": null, "origin": [ -12.822, 7.726, 78.956 ], "x_axis": [ -0.606, -0.592, -0.531 ], "y_axis": [ -0.187, 0.755, -0.629 ], "z_axis": [ 0.773, -0.282, -0.569 ], "quaternion": [ 0.381, -0.228, 0.856, -0.266 ] } }, { "index": 5, "nt1": "///A/5", "nt2": "///C/16", "bp": "U-G", "name": "--", "Saenger": "--", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -172.998, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 51.936, "chi2": -174.257, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 63.103, "C1C1_dist": 10.649, "N1N9_dist": 9.077, "C6C8_dist": 10.163, "CNNC_torsion": -4.520, "hbonds_num": 2, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.65],O4(carbonyl)-N1(imino)[3.29]", "interBase_angle": 3.759, "planarity": 0.074, "simple_Shear": -0.990, "simple_Stretch": 0.213, "simple_Buckle": 1.771, "simple_Propeller": -3.315, "bp_simpleParams": [ -0.990, 0.213, 0.227, 1.771, -3.315, 5.983 ], "bp_params": [ -1.007, 0.109, 0.227, 2.108, -3.112, 5.984 ], "frame": { "rmsd": null, "origin": [ -10.918, 4.848, 77.173 ], "x_axis": [ -0.759, -0.103, -0.643 ], "y_axis": [ 0.088, 0.962, -0.257 ], "z_axis": [ 0.645, -0.251, -0.722 ], "quaternion": [ 0.347, -0.004, 0.928, -0.137 ] } }, { "index": 6, "nt1": "///A/6", "nt2": "///C/15", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -156.688, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 55.347, "chi2": -172.748, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 55.503, "C1C1_dist": 10.696, "N1N9_dist": 9.024, "C6C8_dist": 10.014, "CNNC_torsion": -2.159, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.76],N3-N1(imino)[2.96],N4(amino)-O6(carbonyl)[3.07]", "interBase_angle": 1.826, "planarity": 0.042, "simple_Shear": 0.121, "simple_Stretch": -0.014, "simple_Buckle": -0.681, "simple_Propeller": -1.694, "bp_simpleParams": [ 0.121, -0.014, -0.094, -0.681, -1.694, 2.679 ], "bp_params": [ 0.121, -0.015, -0.094, -0.694, -1.689, 2.679 ], "frame": { "rmsd": null, "origin": [ -9.237, 2.219, 75.129 ], "x_axis": [ -0.652, 0.534, -0.538 ], "y_axis": [ 0.573, 0.812, 0.113 ], "z_axis": [ 0.497, -0.235, -0.835 ], "quaternion": [ 0.285, 0.305, 0.908, -0.034 ] } }, { "index": 7, "nt1": "///A/7", "nt2": "///C/14", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -153.646, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 55.738, "chi2": -106.087, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 56.366, "C1C1_dist": 10.508, "N1N9_dist": 8.866, "C6C8_dist": 9.862, "CNNC_torsion": 2.037, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.66],N3-N1(imino)[2.85],N4(amino)-O6(carbonyl)[2.95]", "interBase_angle": 3.860, "planarity": 0.115, "simple_Shear": 0.122, "simple_Stretch": -0.162, "simple_Buckle": -3.715, "simple_Propeller": -1.050, "bp_simpleParams": [ 0.122, -0.162, -0.314, -3.715, -1.050, 2.643 ], "bp_params": [ 0.121, -0.163, -0.314, -3.723, -1.020, 2.642 ], "frame": { "rmsd": null, "origin": [ -8.567, 1.601, 71.830 ], "x_axis": [ -0.240, 0.918, -0.316 ], "y_axis": [ 0.912, 0.325, 0.251 ], "z_axis": [ 0.334, -0.228, -0.915 ], "quaternion": [ 0.206, 0.581, 0.787, 0.007 ] } }, { "index": 8, "nt1": "///A/8", "nt2": "///C/13", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -174.115, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 56.059, "chi2": -89.542, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 54.305, "C1C1_dist": 10.525, "N1N9_dist": 8.848, "C6C8_dist": 9.831, "CNNC_torsion": -6.049, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.65],N3-N1(imino)[2.84],N4(amino)-O6(carbonyl)[2.95]", "interBase_angle": 5.570, "planarity": 0.079, "simple_Shear": 0.304, "simple_Stretch": -0.179, "simple_Buckle": -0.613, "simple_Propeller": -5.536, "bp_simpleParams": [ 0.304, -0.179, -0.021, -0.613, -5.536, 2.527 ], "bp_params": [ 0.299, -0.187, -0.021, -0.757, -5.518, 2.530 ], "frame": { "rmsd": null, "origin": [ -9.321, 2.174, 68.129 ], "x_axis": [ -0.091, 0.989, -0.116 ], "y_axis": [ 0.961, 0.118, 0.249 ], "z_axis": [ 0.260, -0.089, -0.961 ], "quaternion": [ 0.128, 0.662, 0.737, 0.054 ] } }, { "index": 9, "nt1": "///A/9", "nt2": "///C/12", "bp": "U-C", "name": "--", "Saenger": "18-XVIII", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -155.526, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 57.397, "chi2": -131.364, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 58.808, "C1C1_dist": 8.648, "N1N9_dist": 7.083, "C6C8_dist": 8.367, "CNNC_torsion": -12.024, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)*O2(carbonyl)[3.18],N3(imino)-N3[2.96],O4(carbonyl)-N4(amino)[2.77]", "unusual_base2base_hbonds": 1, "interBase_angle": 11.777, "planarity": 0.160, "simple_Shear": -0.309, "simple_Stretch": -1.703, "simple_Buckle": -2.967, "simple_Propeller": -11.397, "bp_simpleParams": [ -0.309, -1.703, 0.029, -2.967, -11.397, 9.889 ], "bp_params": [ -0.259, -1.712, 0.029, -2.622, -11.481, 9.936 ], "frame": { "rmsd": null, "origin": [ -8.878, 3.052, 64.797 ], "x_axis": [ 0.459, 0.867, 0.196 ], "y_axis": [ 0.847, -0.493, 0.198 ], "z_axis": [ 0.268, 0.075, -0.961 ], "quaternion": [ 0.036, 0.853, 0.502, 0.136 ] } }, { "index": 10, "nt1": "///A/10", "nt2": "///C/11", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -149.331, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 60.346, "chi2": -128.114, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 57.387, "C1C1_dist": 10.133, "N1N9_dist": 8.612, "C6C8_dist": 9.698, "CNNC_torsion": -5.618, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.74],O4(carbonyl)-N6(amino)[3.02]", "interBase_angle": 14.055, "planarity": 0.216, "simple_Shear": 0.052, "simple_Stretch": -0.190, "simple_Buckle": -11.411, "simple_Propeller": -8.206, "bp_simpleParams": [ 0.052, -0.190, -0.300, -11.411, -8.206, 6.857 ], "bp_params": [ 0.051, -0.190, -0.300, -11.445, -8.160, 6.841 ], "frame": { "rmsd": null, "origin": [ -8.618, 4.454, 61.414 ], "x_axis": [ 0.856, 0.427, 0.293 ], "y_axis": [ 0.480, -0.866, -0.142 ], "z_axis": [ 0.193, 0.262, -0.946 ], "quaternion": [ -0.105, 0.957, 0.237, 0.127 ] } }, { "index": 11, "nt1": "///A/11", "nt2": "///C/10", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -164.520, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 59.405, "chi2": -156.987, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 54.961, "C1C1_dist": 10.379, "N1N9_dist": 8.789, "C6C8_dist": 9.812, "CNNC_torsion": -6.408, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.60],N3-N1(imino)[2.81],N4(amino)-O6(carbonyl)[2.95]", "interBase_angle": 8.956, "planarity": 0.147, "simple_Shear": 0.291, "simple_Stretch": -0.188, "simple_Buckle": -6.666, "simple_Propeller": -5.981, "bp_simpleParams": [ 0.291, -0.188, -0.076, -6.666, -5.981, 4.010 ], "bp_params": [ 0.286, -0.196, -0.076, -6.818, -5.806, 4.008 ], "frame": { "rmsd": null, "origin": [ -7.497, 6.269, 58.624 ], "x_axis": [ 0.957, -0.100, 0.272 ], "y_axis": [ -0.010, -0.949, -0.314 ], "z_axis": [ 0.290, 0.298, -0.910 ], "quaternion": [ -0.156, 0.977, -0.028, 0.144 ] } }, { "index": 12, "nt1": "///A/12", "nt2": "///C/9", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -163.250, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 53.562, "chi2": -158.243, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 54.798, "C1C1_dist": 10.599, "N1N9_dist": 8.882, "C6C8_dist": 9.831, "CNNC_torsion": -6.015, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.84],O4(carbonyl)-N6(amino)[2.93]", "interBase_angle": 6.919, "planarity": 0.086, "simple_Shear": -0.117, "simple_Stretch": -0.104, "simple_Buckle": -5.207, "simple_Propeller": -4.556, "bp_simpleParams": [ -0.117, -0.104, 0.066, -5.207, -4.556, -0.046 ], "bp_params": [ -0.115, -0.106, 0.066, -5.138, -4.634, -0.046 ], "frame": { "rmsd": null, "origin": [ -6.612, 8.714, 56.063 ], "x_axis": [ 0.799, -0.582, 0.150 ], "y_axis": [ -0.482, -0.769, -0.420 ], "z_axis": [ 0.360, 0.264, -0.895 ], "quaternion": [ -0.184, 0.930, -0.286, 0.137 ] } }, { "index": 13, "nt1": "///A/13", "nt2": "///C/8", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -163.508, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 57.546, "chi2": -157.315, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 56.344, "C1C1_dist": 10.477, "N1N9_dist": 8.863, "C6C8_dist": 9.888, "CNNC_torsion": 6.221, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.99],N1(imino)-N3[2.86],N2(amino)-O2(carbonyl)[2.64]", "interBase_angle": 4.848, "planarity": 0.076, "simple_Shear": -0.208, "simple_Stretch": -0.136, "simple_Buckle": -3.944, "simple_Propeller": 2.819, "bp_simpleParams": [ -0.208, -0.136, -0.337, -3.944, 2.819, 3.335 ], "bp_params": [ -0.206, -0.140, -0.337, -3.992, 2.750, 3.334 ], "frame": { "rmsd": null, "origin": [ -4.091, 9.849, 53.666 ], "x_axis": [ 0.408, -0.913, 0.025 ], "y_axis": [ -0.794, -0.369, -0.483 ], "z_axis": [ 0.450, 0.177, -0.875 ], "quaternion": [ -0.203, 0.814, -0.524, 0.146 ] } }, { "index": 14, "nt1": "///A/14", "nt2": "///C/7", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -163.520, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 58.073, "chi2": -164.561, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 55.614, "C1C1_dist": 10.553, "N1N9_dist": 8.948, "C6C8_dist": 9.952, "CNNC_torsion": 5.776, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.70],N3-N1(imino)[2.91],N4(amino)-O6(carbonyl)[3.03]", "interBase_angle": 3.338, "planarity": 0.063, "simple_Shear": 0.221, "simple_Stretch": -0.083, "simple_Buckle": -0.082, "simple_Propeller": 3.337, "bp_simpleParams": [ 0.221, -0.083, -0.218, -0.082, 3.337, 2.864 ], "bp_params": [ 0.220, -0.087, -0.218, -0.024, 3.337, 2.864 ], "frame": { "rmsd": null, "origin": [ -0.696, 10.516, 51.651 ], "x_axis": [ -0.051, -0.995, -0.089 ], "y_axis": [ -0.890, 0.086, -0.448 ], "z_axis": [ 0.453, 0.056, -0.890 ], "quaternion": [ 0.190, -0.662, 0.712, -0.138 ] } }, { "index": 15, "nt1": "///A/15", "nt2": "///C/6", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -168.485, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 55.624, "chi2": -163.379, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 54.074, "C1C1_dist": 10.541, "N1N9_dist": 8.827, "C6C8_dist": 9.805, "CNNC_torsion": -5.815, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.97],N1-N3(imino)[2.80]", "interBase_angle": 5.396, "planarity": 0.076, "simple_Shear": 0.046, "simple_Stretch": -0.149, "simple_Buckle": -0.283, "simple_Propeller": -5.389, "bp_simpleParams": [ 0.046, -0.149, 0.117, -0.283, -5.389, 1.107 ], "bp_params": [ 0.044, -0.150, 0.117, -0.333, -5.386, 1.108 ], "frame": { "rmsd": null, "origin": [ 2.359, 10.188, 49.457 ], "x_axis": [ -0.500, -0.849, -0.171 ], "y_axis": [ -0.767, 0.526, -0.368 ], "z_axis": [ 0.402, -0.053, -0.914 ], "quaternion": [ 0.167, -0.471, 0.857, -0.123 ] } }, { "index": 16, "nt1": "///A/16", "nt2": "///C/5", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -165.831, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 53.249, "chi2": -171.629, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 54.257, "C1C1_dist": 10.706, "N1N9_dist": 8.955, "C6C8_dist": 9.885, "CNNC_torsion": 6.227, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.91],N1(imino)-N3[2.90],N2(amino)-O2(carbonyl)[2.77]", "interBase_angle": 3.564, "planarity": 0.093, "simple_Shear": -0.200, "simple_Stretch": -0.152, "simple_Buckle": -3.433, "simple_Propeller": 0.959, "bp_simpleParams": [ -0.200, -0.152, -0.484, -3.433, 0.959, 0.167 ], "bp_params": [ -0.198, -0.155, -0.484, -3.447, 0.905, 0.167 ], "frame": { "rmsd": null, "origin": [ 4.922, 8.391, 46.926 ], "x_axis": [ -0.827, -0.463, -0.318 ], "y_axis": [ -0.391, 0.881, -0.265 ], "z_axis": [ 0.403, -0.095, -0.910 ], "quaternion": [ 0.190, -0.225, 0.951, -0.095 ] } }, { "index": 17, "nt1": "///A/17", "nt2": "///C/4", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -177.519, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 54.564, "chi2": -167.580, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 55.241, "C1C1_dist": 10.694, "N1N9_dist": 9.004, "C6C8_dist": 9.947, "CNNC_torsion": 9.973, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.77],N3-N1(imino)[2.94],N4(amino)-O6(carbonyl)[3.00]", "interBase_angle": 4.873, "planarity": 0.116, "simple_Shear": 0.100, "simple_Stretch": -0.092, "simple_Buckle": 0.316, "simple_Propeller": 4.862, "bp_simpleParams": [ 0.100, -0.092, -0.467, 0.316, 4.862, 0.706 ], "bp_params": [ 0.099, -0.093, -0.467, 0.341, 4.861, 0.706 ], "frame": { "rmsd": null, "origin": [ 6.323, 5.308, 44.322 ], "x_axis": [ -0.943, -0.069, -0.327 ], "y_axis": [ -0.018, 0.987, -0.158 ], "z_axis": [ 0.334, -0.143, -0.932 ], "quaternion": [ 0.168, -0.022, 0.983, -0.077 ] } }, { "index": 18, "nt1": "///A/18", "nt2": "///C/3", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -169.008, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 54.784, "chi2": -160.889, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 55.900, "C1C1_dist": 10.388, "N1N9_dist": 8.705, "C6C8_dist": 9.737, "CNNC_torsion": -7.593, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.01],N1-N3(imino)[2.74]", "interBase_angle": 10.142, "planarity": 0.135, "simple_Shear": -0.081, "simple_Stretch": -0.200, "simple_Buckle": -5.317, "simple_Propeller": -8.636, "bp_simpleParams": [ -0.081, -0.200, -0.065, -5.317, -8.636, 3.425 ], "bp_params": [ -0.081, -0.200, -0.065, -5.308, -8.642, 3.431 ], "frame": { "rmsd": null, "origin": [ 6.985, 2.849, 41.066 ], "x_axis": [ -0.844, 0.416, -0.339 ], "y_axis": [ 0.443, 0.896, -0.003 ], "z_axis": [ 0.303, -0.153, -0.941 ], "quaternion": [ 0.167, 0.224, 0.959, -0.041 ] } }, { "index": 19, "nt1": "///A/19", "nt2": "///C/2", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -157.023, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 56.317, "chi2": -168.811, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 55.744, "C1C1_dist": 10.579, "N1N9_dist": 8.941, "C6C8_dist": 9.933, "CNNC_torsion": -0.087, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.72],N3-N1(imino)[2.91],N4(amino)-O6(carbonyl)[3.01]", "interBase_angle": 3.781, "planarity": 0.079, "simple_Shear": 0.193, "simple_Stretch": -0.095, "simple_Buckle": -0.757, "simple_Propeller": -3.705, "bp_simpleParams": [ 0.193, -0.095, -0.207, -0.757, -3.705, 2.495 ], "bp_params": [ 0.192, -0.098, -0.207, -0.812, -3.693, 2.496 ], "frame": { "rmsd": null, "origin": [ 6.726, 1.016, 37.764 ], "x_axis": [ -0.466, 0.823, -0.324 ], "y_axis": [ 0.840, 0.527, 0.129 ], "z_axis": [ 0.277, -0.212, -0.937 ], "quaternion": [ 0.176, 0.486, 0.856, -0.024 ] } }, { "index": 20, "nt1": "///A/20", "nt2": "///C/1", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -176.095, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 53.648, "chi2": -142.513, "conf2": "anti", "pucker2": "----", "lambda2": 53.784, "C1C1_dist": 10.745, "N1N9_dist": 9.003, "C6C8_dist": 9.922, "CNNC_torsion": 6.723, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.80],N3-N1(imino)[2.94],N4(amino)-O6(carbonyl)[2.96]", "interBase_angle": 2.167, "planarity": 0.100, "simple_Shear": 0.168, "simple_Stretch": -0.110, "simple_Buckle": -1.104, "simple_Propeller": 1.865, "bp_simpleParams": [ 0.168, -0.110, -0.396, -1.104, 1.865, -0.168 ], "bp_params": [ 0.167, -0.112, -0.396, -1.081, 1.878, -0.168 ], "frame": { "rmsd": null, "origin": [ 5.402, 0.191, 33.920 ], "x_axis": [ -0.086, 0.954, -0.287 ], "y_axis": [ 0.974, 0.141, 0.175 ], "z_axis": [ 0.207, -0.265, -0.942 ], "quaternion": [ 0.168, 0.655, 0.736, -0.031 ] } }, { "index": 21, "nt1": "///A/21", "nt2": "///A/50", "bp": "G-U", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -169.157, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 37.788, "chi2": -149.396, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 65.841, "C1C1_dist": 10.777, "N1N9_dist": 9.018, "C6C8_dist": 9.791, "CNNC_torsion": -4.118, "hbonds_num": 2, "hbonds_desc": "O6(carbonyl)-N3(imino)[2.87],N1(imino)-O2(carbonyl)[3.00]", "interBase_angle": 5.744, "planarity": 0.083, "simple_Shear": -2.531, "simple_Stretch": 0.136, "simple_Buckle": -5.743, "simple_Propeller": 0.112, "bp_simpleParams": [ -2.531, 0.136, 0.034, -5.743, 0.112, -6.464 ], "bp_params": [ -2.485, -0.500, 0.034, -5.589, -1.325, -6.457 ], "frame": { "rmsd": null, "origin": [ 6.661, 3.164, 30.075 ], "x_axis": [ 0.705, 0.704, 0.089 ], "y_axis": [ 0.653, -0.693, 0.307 ], "z_axis": [ 0.277, -0.159, -0.948 ], "quaternion": [ 0.127, 0.915, 0.371, 0.100 ] } }, { "index": 22, "nt1": "///A/22", "nt2": "///A/49", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -166.515, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 56.293, "chi2": -154.477, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 57.799, "C1C1_dist": 10.395, "N1N9_dist": 8.786, "C6C8_dist": 9.813, "CNNC_torsion": -9.620, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.80],O4(carbonyl)-N6(amino)[3.00]", "interBase_angle": 4.806, "planarity": 0.125, "simple_Shear": -0.087, "simple_Stretch": -0.132, "simple_Buckle": 3.429, "simple_Propeller": -3.369, "bp_simpleParams": [ -0.087, -0.132, 0.392, 3.429, -3.369, 3.450 ], "bp_params": [ -0.085, -0.133, 0.392, 3.475, -3.320, 3.450 ], "frame": { "rmsd": null, "origin": [ 7.650, 3.535, 26.920 ], "x_axis": [ 0.886, 0.178, 0.428 ], "y_axis": [ 0.078, -0.968, 0.240 ], "z_axis": [ 0.457, -0.179, -0.871 ], "quaternion": [ 0.109, 0.965, 0.066, 0.229 ] } }, { "index": 23, "nt1": "///A/23", "nt2": "///A/48", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -161.266, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 59.003, "chi2": -158.885, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 61.065, "C1C1_dist": 10.105, "N1N9_dist": 8.632, "C6C8_dist": 9.738, "CNNC_torsion": -13.270, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.73],O4(carbonyl)-N6(amino)[3.06]", "interBase_angle": 14.021, "planarity": 0.204, "simple_Shear": -0.009, "simple_Stretch": -0.166, "simple_Buckle": 8.815, "simple_Propeller": -10.903, "bp_simpleParams": [ -0.009, -0.166, 0.287, 8.815, -10.903, 6.613 ], "bp_params": [ -0.007, -0.167, 0.287, 8.909, -10.826, 6.623 ], "frame": { "rmsd": null, "origin": [ 9.634, 3.972, 24.364 ], "x_axis": [ 0.725, -0.363, 0.585 ], "y_axis": [ -0.401, -0.913, -0.071 ], "z_axis": [ 0.560, -0.183, -0.808 ], "quaternion": [ 0.030, 0.928, -0.206, 0.308 ] } }, { "index": 24, "nt1": "///A/24", "nt2": "///A/47", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -161.371, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 55.844, "chi2": -161.554, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 52.595, "C1C1_dist": 10.608, "N1N9_dist": 8.882, "C6C8_dist": 9.814, "CNNC_torsion": -11.537, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.88],O4(carbonyl)-N6(amino)[3.02]", "interBase_angle": 1.746, "planarity": 0.138, "simple_Shear": 0.026, "simple_Stretch": -0.142, "simple_Buckle": -0.742, "simple_Propeller": -1.581, "bp_simpleParams": [ 0.026, -0.142, 0.635, -0.742, -1.581, 0.096 ], "bp_params": [ 0.026, -0.142, 0.635, -0.737, -1.583, 0.096 ], "frame": { "rmsd": null, "origin": [ 12.103, 3.896, 21.370 ], "x_axis": [ 0.142, -0.712, 0.688 ], "y_axis": [ -0.682, -0.574, -0.453 ], "z_axis": [ 0.718, -0.404, -0.567 ], "quaternion": [ -0.016, 0.756, -0.461, 0.465 ] } }, { "index": 25, "nt1": "///A/25", "nt2": "///A/46", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -160.099, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 57.525, "chi2": -164.327, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 56.173, "C1C1_dist": 10.373, "N1N9_dist": 8.758, "C6C8_dist": 9.800, "CNNC_torsion": -10.757, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.79],O4(carbonyl)-N6(amino)[3.06]", "interBase_angle": 7.936, "planarity": 0.137, "simple_Shear": 0.001, "simple_Stretch": -0.143, "simple_Buckle": 3.178, "simple_Propeller": -7.272, "bp_simpleParams": [ 0.001, -0.143, 0.341, 3.178, -7.272, 3.751 ], "bp_params": [ 0.002, -0.143, 0.341, 3.223, -7.253, 3.757 ], "frame": { "rmsd": null, "origin": [ 15.121, 2.566, 20.859 ], "x_axis": [ -0.277, -0.894, 0.352 ], "y_axis": [ -0.590, -0.130, -0.797 ], "z_axis": [ 0.758, -0.429, -0.492 ], "quaternion": [ 0.159, -0.580, 0.640, -0.479 ] } }, { "index": 26, "nt1": "///A/26", "nt2": "///A/45", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -162.195, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 58.908, "chi2": -171.304, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 55.977, "C1C1_dist": 10.439, "N1N9_dist": 8.852, "C6C8_dist": 9.895, "CNNC_torsion": 6.707, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.08],N1-N3(imino)[2.85]", "interBase_angle": 7.944, "planarity": 0.099, "simple_Shear": 0.099, "simple_Stretch": -0.039, "simple_Buckle": 4.186, "simple_Propeller": 6.751, "bp_simpleParams": [ 0.099, -0.039, -0.011, 4.186, 6.751, 4.141 ], "bp_params": [ 0.098, -0.041, -0.011, 4.289, 6.686, 4.145 ], "frame": { "rmsd": null, "origin": [ 18.349, 0.934, 20.800 ], "x_axis": [ -0.668, -0.744, -0.022 ], "y_axis": [ -0.355, 0.344, -0.869 ], "z_axis": [ 0.655, -0.573, -0.494 ], "quaternion": [ 0.214, -0.347, 0.791, -0.456 ] } }, { "index": 27, "nt1": "///A/29", "nt2": "///A/40", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -173.943, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 49.463, "chi2": -171.749, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 54.624, "C1C1_dist": 10.713, "N1N9_dist": 8.899, "C6C8_dist": 9.806, "CNNC_torsion": -7.078, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.87],N1(imino)-N3[2.86],N2(amino)-O2(carbonyl)[2.75]", "interBase_angle": 11.728, "planarity": 0.132, "simple_Shear": -0.248, "simple_Stretch": -0.185, "simple_Buckle": -8.251, "simple_Propeller": -8.335, "bp_simpleParams": [ -0.248, -0.185, -0.114, -8.251, -8.335, -0.660 ], "bp_params": [ -0.245, -0.189, -0.114, -8.104, -8.477, -0.660 ], "frame": { "rmsd": null, "origin": [ 24.557, -13.478, 10.920 ], "x_axis": [ -0.949, -0.300, 0.094 ], "y_axis": [ -0.311, 0.941, -0.135 ], "z_axis": [ -0.048, -0.158, -0.986 ], "quaternion": [ -0.036, -0.155, 0.984, -0.074 ] } }, { "index": 28, "nt1": "///A/30", "nt2": "///A/39", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -164.447, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 56.729, "chi2": -152.993, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 54.096, "C1C1_dist": 10.566, "N1N9_dist": 8.889, "C6C8_dist": 9.862, "CNNC_torsion": -9.079, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.71],N3-N1(imino)[2.86],N4(amino)-O6(carbonyl)[2.94]", "interBase_angle": 11.071, "planarity": 0.162, "simple_Shear": 0.222, "simple_Stretch": -0.143, "simple_Buckle": -6.791, "simple_Propeller": -8.743, "bp_simpleParams": [ 0.222, -0.143, 0.067, -6.791, -8.743, 2.056 ], "bp_params": [ 0.219, -0.147, 0.067, -6.959, -8.610, 2.058 ], "frame": { "rmsd": null, "origin": [ 25.180, -15.530, 7.822 ], "x_axis": [ -0.974, 0.205, 0.092 ], "y_axis": [ 0.194, 0.974, -0.118 ], "z_axis": [ -0.114, -0.097, -0.989 ], "quaternion": [ -0.052, 0.100, 0.992, -0.054 ] } }, { "index": 29, "nt1": "///A/31", "nt2": "///A/38", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -162.641, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 57.647, "chi2": -165.646, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 57.069, "C1C1_dist": 10.320, "N1N9_dist": 8.728, "C6C8_dist": 9.769, "CNNC_torsion": -9.122, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.76],O4(carbonyl)-N6(amino)[2.99]", "interBase_angle": 5.618, "planarity": 0.107, "simple_Shear": 0.008, "simple_Stretch": -0.178, "simple_Buckle": -0.400, "simple_Propeller": -5.604, "bp_simpleParams": [ 0.008, -0.178, 0.364, -0.400, -5.604, 3.774 ], "bp_params": [ 0.008, -0.178, 0.364, -0.376, -5.605, 3.779 ], "frame": { "rmsd": null, "origin": [ 24.084, -16.745, 4.935 ], "x_axis": [ -0.706, 0.699, 0.115 ], "y_axis": [ 0.690, 0.716, -0.112 ], "z_axis": [ -0.161, 0.000, -0.987 ], "quaternion": [ -0.075, 0.376, 0.923, -0.030 ] } }, { "index": 30, "nt1": "///A/32", "nt2": "///A/37", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -155.109, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 56.727, "chi2": -162.949, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 58.340, "C1C1_dist": 10.254, "N1N9_dist": 8.667, "C6C8_dist": 9.730, "CNNC_torsion": 1.937, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.98],N1-N3(imino)[2.71]", "interBase_angle": 4.010, "planarity": 0.074, "simple_Shear": -0.044, "simple_Stretch": -0.200, "simple_Buckle": 3.283, "simple_Propeller": 2.303, "bp_simpleParams": [ -0.044, -0.200, -0.182, 3.283, 2.303, 5.354 ], "bp_params": [ -0.044, -0.200, -0.182, 3.286, 2.298, 5.353 ], "frame": { "rmsd": null, "origin": [ 22.221, -17.197, 2.228 ], "x_axis": [ -0.175, 0.964, 0.199 ], "y_axis": [ 0.948, 0.220, -0.231 ], "z_axis": [ -0.266, 0.149, -0.952 ], "quaternion": [ -0.152, 0.624, 0.766, -0.027 ] } }, { "index": 31, "nt1": "///A/52", "nt2": "///A/62", "bp": "A-G", "name": "Sheared", "Saenger": "11-XI", "LW": "tHS", "DSSR": "tM-m", "intra_chain": true, "chi1": -153.392, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 22.792, "chi2": -158.349, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 83.106, "C1C1_dist": 10.259, "N1N9_dist": 8.942, "C6C8_dist": 8.799, "CNNC_torsion": -152.754, "hbonds_num": 3, "hbonds_desc": "OP2-N1(imino)[2.78],OP2-N2(amino)[2.58],N7-N2(amino)[3.04]", "interBase_angle": 26.604, "planarity": 0.368, "simple_Shear": -7.944, "simple_Stretch": 5.102, "simple_Buckle": 1.770, "simple_Propeller": 26.545, "bp_simpleParams": [ -7.944, 5.102, 0.203, 1.770, 26.545, -49.869 ], "bp_params": [ -7.905, -5.162, 0.203, -23.514, 12.444, -49.209 ], "frame": { "rmsd": null, "origin": [ -7.702, 12.779, 26.767 ], "x_axis": [ 0.503, 0.274, 0.820 ], "y_axis": [ 0.856, -0.291, -0.428 ], "z_axis": [ 0.121, 0.917, -0.381 ], "quaternion": [ -0.456, 0.737, 0.383, 0.319 ] } }, { "index": 32, "nt1": "///A/53", "nt2": "///A/61", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -179.277, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 51.278, "chi2": -161.249, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 55.469, "C1C1_dist": 10.728, "N1N9_dist": 8.963, "C6C8_dist": 9.879, "CNNC_torsion": -0.954, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.96],N1(imino)-N3[2.91],N2(amino)-O2(carbonyl)[2.77]", "interBase_angle": 10.793, "planarity": 0.119, "simple_Shear": -0.265, "simple_Stretch": -0.116, "simple_Buckle": -9.523, "simple_Propeller": -5.079, "bp_simpleParams": [ -0.265, -0.116, -0.405, -9.523, -5.079, 0.692 ], "bp_params": [ -0.262, -0.121, -0.405, -9.428, -5.254, 0.690 ], "frame": { "rmsd": null, "origin": [ -4.592, 16.846, 29.486 ], "x_axis": [ 0.991, -0.069, 0.117 ], "y_axis": [ 0.086, -0.356, -0.931 ], "z_axis": [ 0.106, 0.932, -0.347 ], "quaternion": [ 0.568, -0.821, -0.005, -0.068 ] } }, { "index": 33, "nt1": "///A/54", "nt2": "///A/60", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -154.111, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 51.133, "chi2": -165.255, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 55.022, "C1C1_dist": 10.747, "N1N9_dist": 8.970, "C6C8_dist": 9.907, "CNNC_torsion": -5.220, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.95],N1(imino)-N3[2.90],N2(amino)-O2(carbonyl)[2.75]", "interBase_angle": 4.155, "planarity": 0.053, "simple_Shear": -0.236, "simple_Stretch": -0.112, "simple_Buckle": -3.813, "simple_Propeller": -1.650, "bp_simpleParams": [ -0.236, -0.112, -0.053, -3.813, -1.650, 1.066 ], "bp_params": [ -0.234, -0.117, -0.053, -3.783, -1.719, 1.066 ], "frame": { "rmsd": null, "origin": [ -4.308, 20.376, 30.000 ], "x_axis": [ 0.857, -0.302, -0.416 ], "y_axis": [ -0.496, -0.268, -0.826 ], "z_axis": [ 0.138, 0.915, -0.380 ], "quaternion": [ 0.550, -0.791, 0.252, 0.088 ] } }, { "index": 34, "nt1": "///A/55", "nt2": "///A/58", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -131.730, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 58.996, "chi2": -77.211, "conf2": "--", "pucker2": "~C3'-endo", "lambda2": 57.972, "C1C1_dist": 10.350, "N1N9_dist": 8.812, "C6C8_dist": 9.828, "CNNC_torsion": 3.138, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.71],N3-N1(imino)[2.88],N4(amino)-O6(carbonyl)[2.98]", "interBase_angle": 13.875, "planarity": 0.241, "simple_Shear": 0.240, "simple_Stretch": -0.133, "simple_Buckle": 12.665, "simple_Propeller": 5.667, "bp_simpleParams": [ 0.240, -0.133, 0.219, 12.665, 5.667, 3.795 ], "bp_params": [ 0.237, -0.138, 0.219, 12.796, 5.367, 3.776 ], "frame": { "rmsd": null, "origin": [ -4.288, 23.538, 29.916 ], "x_axis": [ 0.642, -0.459, -0.614 ], "y_axis": [ -0.734, -0.138, -0.665 ], "z_axis": [ 0.220, 0.878, -0.426 ], "quaternion": [ 0.519, -0.743, 0.402, 0.133 ] } }, { "index": 35, "nt1": "///A/68", "nt2": "///A/81", "bp": "A-G", "name": "--", "Saenger": "--", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -178.888, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 24.428, "chi2": -114.343, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 25.167, "C1C1_dist": 14.331, "N1N9_dist": 11.662, "C6C8_dist": 11.075, "CNNC_torsion": 29.268, "hbonds_num": 1, "hbonds_desc": "N6(amino)-O6(carbonyl)[2.67]", "interBase_angle": 25.320, "planarity": 0.298, "simple_Shear": 0.166, "simple_Stretch": 2.557, "simple_Buckle": -9.030, "simple_Propeller": 23.655, "bp_simpleParams": [ 0.166, 2.557, 0.192, -9.030, 23.655, -59.035 ], "bp_params": [ 0.185, 2.556, 0.192, -8.761, 23.756, -59.962 ], "frame": { "rmsd": null, "origin": [ -41.902, 3.138, 34.904 ], "x_axis": [ 0.230, 0.686, 0.690 ], "y_axis": [ 0.971, -0.114, -0.211 ], "z_axis": [ -0.066, 0.718, -0.693 ], "quaternion": [ -0.326, 0.714, 0.581, 0.219 ] } }, { "index": 36, "nt1": "///A/69", "nt2": "///A/80", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -175.548, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 51.389, "chi2": -156.326, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 54.251, "C1C1_dist": 10.784, "N1N9_dist": 8.998, "C6C8_dist": 9.883, "CNNC_torsion": -11.931, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.02],N1-N3(imino)[2.93]", "interBase_angle": 10.049, "planarity": 0.164, "simple_Shear": 0.063, "simple_Stretch": -0.065, "simple_Buckle": 8.013, "simple_Propeller": -6.064, "bp_simpleParams": [ 0.063, -0.065, 0.730, 8.013, -6.064, -2.130 ], "bp_params": [ 0.063, -0.065, 0.730, 7.956, -6.139, -2.128 ], "frame": { "rmsd": null, "origin": [ -41.046, 7.426, 35.278 ], "x_axis": [ 0.629, 0.198, 0.752 ], "y_axis": [ 0.710, -0.540, -0.452 ], "z_axis": [ 0.317, 0.818, -0.480 ], "quaternion": [ -0.390, 0.814, 0.279, 0.328 ] } }, { "index": 37, "nt1": "///A/70", "nt2": "///A/79", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -172.436, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 55.629, "chi2": -167.147, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 58.988, "C1C1_dist": 10.381, "N1N9_dist": 8.788, "C6C8_dist": 9.808, "CNNC_torsion": -15.044, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.59],N3-N1(imino)[2.81],N4(amino)-O6(carbonyl)[2.95]", "interBase_angle": 11.104, "planarity": 0.192, "simple_Shear": 0.131, "simple_Stretch": -0.237, "simple_Buckle": 1.843, "simple_Propeller": -10.950, "bp_simpleParams": [ 0.131, -0.237, 0.611, 1.843, -10.950, 2.486 ], "bp_params": [ 0.129, -0.238, 0.611, 1.742, -10.966, 2.498 ], "frame": { "rmsd": null, "origin": [ -40.605, 11.213, 34.779 ], "x_axis": [ 0.897, -0.198, 0.396 ], "y_axis": [ 0.205, -0.607, -0.768 ], "z_axis": [ 0.392, 0.770, -0.504 ], "quaternion": [ -0.443, 0.867, 0.002, 0.227 ] } }, { "index": 38, "nt1": "///A/71", "nt2": "///A/78", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -168.936, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 49.609, "chi2": -167.046, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 53.455, "C1C1_dist": 10.708, "N1N9_dist": 8.872, "C6C8_dist": 9.739, "CNNC_torsion": -13.690, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.80],O4(carbonyl)-N6(amino)[2.83]", "interBase_angle": 13.711, "planarity": 0.172, "simple_Shear": -0.169, "simple_Stretch": -0.168, "simple_Buckle": -8.450, "simple_Propeller": -10.798, "bp_simpleParams": [ -0.169, -0.168, 0.220, -8.450, -10.798, -2.794 ], "bp_params": [ -0.166, -0.171, 0.220, -8.246, -10.954, -2.800 ], "frame": { "rmsd": null, "origin": [ -39.884, 14.847, 34.314 ], "x_axis": [ 0.812, -0.582, -0.043 ], "y_axis": [ -0.319, -0.382, -0.867 ], "z_axis": [ 0.489, 0.718, -0.496 ], "quaternion": [ -0.483, 0.820, -0.275, 0.136 ] } }, { "index": 39, "nt1": "///A/72", "nt2": "///A/77", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": 179.624, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 48.894, "chi2": -160.198, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 55.609, "C1C1_dist": 10.318, "N1N9_dist": 8.518, "C6C8_dist": 9.478, "CNNC_torsion": -19.291, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.57],O4(carbonyl)-N6(amino)[2.78]", "interBase_angle": 11.653, "planarity": 0.199, "simple_Shear": -0.276, "simple_Stretch": -0.445, "simple_Buckle": -7.126, "simple_Propeller": -9.221, "bp_simpleParams": [ -0.276, -0.445, 0.757, -7.126, -9.221, 0.412 ], "bp_params": [ -0.263, -0.453, 0.757, -6.847, -9.430, 0.412 ], "frame": { "rmsd": null, "origin": [ -37.213, 16.927, 33.383 ], "x_axis": [ 0.495, -0.793, -0.355 ], "y_axis": [ -0.674, -0.092, -0.733 ], "z_axis": [ 0.548, 0.603, -0.580 ], "quaternion": [ -0.454, 0.736, -0.498, 0.066 ] } }, { "index": 40, "nt1": "///A/73", "nt2": "///A/76", "bp": "G-A", "name": "Sheared", "Saenger": "11-XI", "LW": "tSH", "DSSR": "tm-M", "intra_chain": true, "chi1": -166.092, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 89.760, "chi2": -143.411, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 11.495, "C1C1_dist": 9.104, "N1N9_dist": 7.808, "C6C8_dist": 8.003, "CNNC_torsion": -134.323, "hbonds_num": 4, "hbonds_desc": "N1(imino)-OP2[3.31],N2(amino)-OP2[2.47],N2(amino)-N7[2.45],N3-N6(amino)[3.31]", "interBase_angle": 21.342, "planarity": 0.328, "simple_Shear": 7.862, "simple_Stretch": 2.544, "simple_Buckle": 17.789, "simple_Propeller": 11.791, "bp_simpleParams": [ 7.862, 2.544, 0.086, 17.789, 11.791, -17.992 ], "bp_params": [ 6.598, -4.975, 0.086, 19.853, -7.831, -17.769 ], "frame": { "rmsd": null, "origin": [ -35.288, 19.535, 33.163 ], "x_axis": [ -0.153, -0.586, -0.796 ], "y_axis": [ -0.830, 0.513, -0.219 ], "z_axis": [ 0.537, 0.627, -0.564 ], "quaternion": [ 0.446, -0.474, 0.747, 0.137 ] } }, { "index": 41, "nt1": "c. C & i. \\-7", "nt2": "///D/7", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": 166.985, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 57.443, "chi2": -122.013, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 56.179, "C1C1_dist": 10.250, "N1N9_dist": 8.634, "C6C8_dist": 9.720, "CNNC_torsion": -14.213, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.51],N3-N1(imino)[2.72],N4(amino)-O6(carbonyl)[2.99]", "interBase_angle": 20.967, "planarity": 0.265, "simple_Shear": 0.410, "simple_Stretch": -0.271, "simple_Buckle": 4.481, "simple_Propeller": -20.482, "bp_simpleParams": [ 0.410, -0.271, -0.230, 4.481, -20.482, 7.999 ], "bp_params": [ 0.400, -0.284, -0.230, 3.758, -20.627, 8.125 ], "frame": { "rmsd": null, "origin": [ -16.119, -18.922, 10.787 ], "x_axis": [ 0.563, 0.809, -0.172 ], "y_axis": [ -0.784, 0.588, 0.200 ], "z_axis": [ 0.262, 0.022, 0.965 ], "quaternion": [ 0.883, 0.050, 0.123, 0.451 ] } }, { "index": 42, "nt1": "c. C & i. \\-6", "nt2": "///D/6", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -110.016, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 58.395, "chi2": -112.294, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 62.380, "C1C1_dist": 10.232, "N1N9_dist": 8.775, "C6C8_dist": 10.028, "CNNC_torsion": -5.057, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.66],N1-N3(imino)[2.98]", "interBase_angle": 5.978, "planarity": 0.073, "simple_Shear": -0.336, "simple_Stretch": 0.150, "simple_Buckle": 2.517, "simple_Propeller": -5.422, "bp_simpleParams": [ -0.336, 0.150, 0.076, 2.517, -5.422, 13.629 ], "bp_params": [ -0.340, 0.140, 0.076, 2.666, -5.350, 13.640 ], "frame": { "rmsd": null, "origin": [ -14.832, -19.489, 14.021 ], "x_axis": [ -0.063, 0.949, -0.308 ], "y_axis": [ -0.934, 0.053, 0.352 ], "z_axis": [ 0.351, 0.310, 0.884 ], "quaternion": [ 0.684, 0.015, 0.241, 0.688 ] } }, { "index": 43, "nt1": "c. C & i. \\-5", "nt2": "///D/5", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -129.730, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 56.226, "chi2": -104.246, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 54.486, "C1C1_dist": 10.970, "N1N9_dist": 9.292, "C6C8_dist": 10.333, "CNNC_torsion": -12.375, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.59],N1-N3(imino)[3.30]", "interBase_angle": 14.623, "planarity": 0.194, "simple_Shear": 0.132, "simple_Stretch": 0.380, "simple_Buckle": -0.968, "simple_Propeller": -14.591, "bp_simpleParams": [ 0.132, 0.380, -0.193, -0.968, -14.591, 4.359 ], "bp_params": [ 0.139, 0.378, -0.193, -1.238, -14.571, 4.394 ], "frame": { "rmsd": null, "origin": [ -13.290, -19.167, 17.197 ], "x_axis": [ -0.571, 0.814, -0.106 ], "y_axis": [ -0.744, -0.458, 0.486 ], "z_axis": [ 0.347, 0.357, 0.867 ], "quaternion": [ 0.458, 0.071, 0.248, 0.851 ] } }, { "index": 44, "nt1": "c. C & i. \\-4", "nt2": "///D/4", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -109.021, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.290, "chi2": -107.197, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 55.068, "C1C1_dist": 10.634, "N1N9_dist": 8.900, "C6C8_dist": 9.872, "CNNC_torsion": -7.613, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.86],O4(carbonyl)-N6(amino)[3.01]", "interBase_angle": 9.169, "planarity": 0.126, "simple_Shear": -0.128, "simple_Stretch": -0.086, "simple_Buckle": -3.148, "simple_Propeller": -8.612, "bp_simpleParams": [ -0.128, -0.086, -0.176, -3.148, -8.612, 0.869 ], "bp_params": [ -0.126, -0.088, -0.176, -3.003, -8.663, 0.871 ], "frame": { "rmsd": null, "origin": [ -11.948, -17.177, 19.533 ], "x_axis": [ -0.883, 0.460, 0.095 ], "y_axis": [ -0.357, -0.789, 0.500 ], "z_axis": [ 0.305, 0.408, 0.861 ], "quaternion": [ 0.217, 0.106, 0.242, 0.940 ] } }, { "index": 45, "nt1": "c. C & i. \\-3", "nt2": "///D/3", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -126.646, "conf1": "anti", "pucker1": "pucker-CHK", "lambda1": 57.994, "chi2": -122.028, "conf2": "anti", "pucker2": "----", "lambda2": 54.464, "C1C1_dist": 10.492, "N1N9_dist": 8.846, "C6C8_dist": 9.910, "CNNC_torsion": -4.194, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.15],N1-N3(imino)[2.86]", "interBase_angle": 7.871, "planarity": 0.108, "simple_Shear": 0.194, "simple_Stretch": -0.039, "simple_Buckle": -3.675, "simple_Propeller": -6.960, "bp_simpleParams": [ 0.194, -0.039, -0.264, -3.675, -6.960, 4.959 ], "bp_params": [ 0.193, -0.044, -0.264, -3.847, -6.866, 4.965 ], "frame": { "rmsd": null, "origin": [ -11.399, -15.880, 22.657 ], "x_axis": [ -0.966, -0.082, 0.244 ], "y_axis": [ 0.173, -0.908, 0.381 ], "z_axis": [ 0.190, 0.410, 0.892 ], "quaternion": [ -0.066, 0.112, 0.204, 0.970 ] } }, { "index": 46, "nt1": "c. C & i. \\-2", "nt2": "///D/2", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -155.256, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 54.066, "chi2": -112.780, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.166, "C1C1_dist": 10.628, "N1N9_dist": 8.883, "C6C8_dist": 9.831, "CNNC_torsion": -10.635, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.71],N3-N1(imino)[2.84],N4(amino)-O6(carbonyl)[2.92]", "interBase_angle": 10.197, "planarity": 0.145, "simple_Shear": 0.217, "simple_Stretch": -0.179, "simple_Buckle": -3.341, "simple_Propeller": -9.634, "bp_simpleParams": [ 0.217, -0.179, 0.012, -3.341, -9.634, 1.333 ], "bp_params": [ 0.214, -0.183, 0.012, -3.508, -9.575, 1.337 ], "frame": { "rmsd": null, "origin": [ -10.693, -13.995, 25.284 ], "x_axis": [ -0.747, -0.546, 0.378 ], "y_axis": [ 0.634, -0.757, 0.160 ], "z_axis": [ 0.199, 0.359, 0.912 ], "quaternion": [ -0.319, 0.156, 0.140, 0.924 ] } }, { "index": 47, "nt1": "c. C & i. \\-1", "nt2": "///D/1", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -138.918, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 53.798, "chi2": -129.051, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.904, "C1C1_dist": 10.693, "N1N9_dist": 8.943, "C6C8_dist": 9.890, "CNNC_torsion": -7.633, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.74],N3-N1(imino)[2.88],N4(amino)-O6(carbonyl)[2.93]", "interBase_angle": 5.048, "planarity": 0.071, "simple_Shear": 0.188, "simple_Stretch": -0.135, "simple_Buckle": -0.890, "simple_Propeller": -4.969, "bp_simpleParams": [ 0.188, -0.135, 0.073, -0.890, -4.969, 0.860 ], "bp_params": [ 0.186, -0.137, 0.073, -0.960, -4.956, 0.861 ], "frame": { "rmsd": null, "origin": [ -10.944, -12.941, 28.362 ], "x_axis": [ -0.231, -0.911, 0.341 ], "y_axis": [ 0.961, -0.268, -0.065 ], "z_axis": [ 0.150, 0.313, 0.938 ], "quaternion": [ 0.600, -0.157, -0.079, -0.781 ] } }, { "index": 48, "nt1": "///C/0", "nt2": "///D/0", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -111.047, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 55.535, "chi2": -85.750, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 57.965, "C1C1_dist": 10.270, "N1N9_dist": 8.656, "C6C8_dist": 9.717, "CNNC_torsion": 2.461, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.71],O4(carbonyl)-N6(amino)[3.01]", "interBase_angle": 9.478, "planarity": 0.113, "simple_Shear": -0.114, "simple_Stretch": -0.194, "simple_Buckle": 9.475, "simple_Propeller": -0.243, "bp_simpleParams": [ -0.114, -0.194, -0.152, 9.475, -0.243, 4.427 ], "bp_params": [ -0.111, -0.195, -0.152, 9.478, -0.087, 4.412 ], "frame": { "rmsd": null, "origin": [ -9.782, -12.862, 31.556 ], "x_axis": [ 0.291, -0.928, 0.231 ], "y_axis": [ 0.955, 0.266, -0.134 ], "z_axis": [ 0.062, 0.260, 0.964 ], "quaternion": [ 0.794, -0.124, -0.053, -0.593 ] } } ], "num_helices": 5, "helices": [ { "index": 1, "num_stems": 4, "strand1": "GGAAUCCCUUCUGCAGCACCGUUUUA", "strand2": "CCTTGGGGCAGACGTCGTGGUAAAAU", "bp_type": "||||.|||.|||||||||||||||||", "helix_form": "AAAAA.....AAAAA.AA.x...AA", "helical_rise": 2.883, "helical_rise_std": 1.008, "helical_radius": 9.828, "helical_radius_std": 2.831, "helical_axis": [ 0.560, -0.118, -0.820 ], "point1": [ -20.736, 8.733, 79.923 ], "point2": [ 19.640, 0.230, 20.729 ], "num_pairs": 26, "pairs": [ { "index": 1, "nt1": "///A/1", "nt2": "///C/20", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.162, -0.140, -0.455, -7.025, -4.068, 0.007 ], "step_params": [ 0.582, -2.194, 3.320, -0.975, 5.761, 30.396 ], "heli_params": [ -5.172, -1.270, 2.846, 10.861, 1.838, 30.939 ], "bp2_params": [ -0.135, -0.119, -0.297, -7.965, -2.468, 0.172 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.320, "simple_Twist": 30.391, "simple_hRise": 2.846, "simple_hTwist": 30.934 }, { "index": 2, "nt1": "///A/2", "nt2": "///C/19", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.135, -0.119, -0.297, -7.965, -2.468, 0.172 ], "step_params": [ -0.802, -2.013, 3.250, -4.247, 6.466, 27.729 ], "heli_params": [ -5.420, 0.716, 2.808, 13.171, 8.650, 28.768 ], "bp2_params": [ -0.018, -0.144, 0.102, -6.126, -0.276, 3.360 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.250, "simple_Twist": 26.869, "simple_hRise": 2.790, "simple_hTwist": 27.941 }, { "index": 3, "nt1": "///A/3", "nt2": "///C/18", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.018, -0.144, 0.102, -6.126, -0.276, 3.360 ], "step_params": [ -1.051, -1.360, 3.058, -2.756, 8.605, 27.652 ], "heli_params": [ -4.392, 1.556, 2.615, 17.424, 5.580, 29.064 ], "bp2_params": [ 0.036, -0.178, 0.001, 2.357, 2.305, 0.771 ], "groove_widths": [ 18.063, null, 18.074, null ], "simple_Rise": 3.058, "simple_Twist": 27.296, "simple_hRise": 2.608, "simple_hTwist": 28.726 }, { "index": 4, "nt1": "///A/4", "nt2": "///C/17", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.036, -0.178, 0.001, 2.357, 2.305, 0.771 ], "step_params": [ 0.813, -1.908, 3.284, -5.988, 9.920, 28.849 ], "heli_params": [ -5.256, -2.540, 2.307, 18.972, 11.453, 31.044 ], "bp2_params": [ -1.007, 0.109, 0.227, 2.108, -3.112, 5.984 ], "groove_widths": [ 18.049, 16.152, 17.065, 14.665 ], "simple_Rise": 3.284, "simple_Twist": 34.658, "simple_hRise": 2.492, "simple_hTwist": 36.487 }, { "index": 5, "nt1": "///A/5", "nt2": "///C/16", "bp": "U-G", "name": "--", "Saenger": "--", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -1.007, 0.109, 0.227, 2.108, -3.112, 5.984 ], "step_params": [ -0.592, -1.816, 3.205, 1.585, 10.621, 36.750 ], "heli_params": [ -3.978, 1.084, 2.575, 16.420, -2.451, 38.235 ], "bp2_params": [ 0.121, -0.015, -0.094, -0.694, -1.689, 2.679 ], "groove_widths": [ 17.974, 16.007, 17.993, 14.764 ], "simple_Rise": 3.205, "simple_Twist": 30.521, "simple_hRise": 2.421, "simple_hTwist": 32.312 }, { "index": 6, "nt1": "///A/6", "nt2": "///C/15", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.121, -0.015, -0.094, -0.694, -1.689, 2.679 ], "step_params": [ 0.624, -0.540, 3.322, 7.959, 6.748, 34.641 ], "heli_params": [ -1.845, 0.143, 3.224, 11.027, -13.006, 36.133 ], "bp2_params": [ 0.121, -0.163, -0.314, -3.723, -1.020, 2.642 ], "groove_widths": [ 18.188, 16.765, 17.786, 12.620 ], "simple_Rise": 3.322, "simple_Twist": 34.609, "simple_hRise": 3.224, "simple_hTwist": 36.102 }, { "index": 7, "nt1": "///A/7", "nt2": "///C/14", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.121, -0.163, -0.314, -3.723, -1.020, 2.642 ], "step_params": [ 1.478, -1.543, 3.167, 2.858, 8.956, 11.929 ], "heli_params": [ -12.105, -3.598, 1.862, 36.539, -11.659, 15.178 ], "bp2_params": [ 0.299, -0.187, -0.021, -0.757, -5.518, 2.530 ], "groove_widths": [ 17.262, 16.033, 18.383, 12.097 ], "simple_Rise": 3.167, "simple_Twist": 11.000, "simple_hRise": 1.751, "simple_hTwist": 14.461 }, { "index": 8, "nt1": "///A/8", "nt2": "///C/13", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.299, -0.187, -0.021, -0.757, -5.518, 2.530 ], "step_params": [ 0.794, -0.625, 3.324, 1.443, 9.300, 36.462 ], "heli_params": [ -2.178, -1.043, 3.106, 14.566, -2.260, 37.617 ], "bp2_params": [ -0.259, -1.712, 0.029, -2.622, -11.481, 9.936 ], "groove_widths": [ 15.407, 13.974, 17.874, 14.988 ], "simple_Rise": 3.324, "simple_Twist": 39.806, "simple_hRise": 3.132, "simple_hTwist": 40.860 }, { "index": 9, "nt1": "///A/9", "nt2": "///C/12", "bp": "U-C", "name": "--", "Saenger": "18-XVIII", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.259, -1.712, 0.029, -2.622, -11.481, 9.936 ], "step_params": [ 0.162, -0.966, 3.538, 10.678, 4.549, 34.797 ], "heli_params": [ -2.207, 1.317, 3.296, 7.357, -17.271, 36.625 ], "bp2_params": [ 0.051, -0.190, -0.300, -11.445, -8.160, 6.841 ], "groove_widths": [ 14.447, 13.117, 18.317, 17.992 ], "simple_Rise": 3.538, "simple_Twist": 32.889, "simple_hRise": 3.273, "simple_hTwist": 34.824 }, { "index": 10, "nt1": "///A/10", "nt2": "///C/11", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.051, -0.190, -0.300, -11.445, -8.160, 6.841 ], "step_params": [ 0.536, -0.826, 3.371, 1.048, 6.194, 30.519 ], "heli_params": [ -2.731, -0.796, 3.163, 11.613, -1.964, 31.144 ], "bp2_params": [ 0.286, -0.196, -0.076, -6.818, -5.806, 4.008 ], "groove_widths": [ 14.657, 13.722, 16.676, 16.431 ], "simple_Rise": 3.371, "simple_Twist": 29.211, "simple_hRise": 3.150, "simple_hTwist": 29.865 }, { "index": 11, "nt1": "///A/11", "nt2": "///C/10", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.286, -0.196, -0.076, -6.818, -5.806, 4.008 ], "step_params": [ -0.616, -1.462, 3.288, -0.390, 4.516, 29.942 ], "heli_params": [ -3.687, 1.102, 3.047, 8.678, 0.749, 30.275 ], "bp2_params": [ -0.115, -0.106, 0.066, -5.138, -4.634, -0.046 ], "groove_widths": [ 16.156, 15.384, 18.852, 18.455 ], "simple_Rise": 3.288, "simple_Twist": 32.135, "simple_hRise": 3.066, "simple_hTwist": 32.444 }, { "index": 12, "nt1": "///A/12", "nt2": "///C/9", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.115, -0.106, 0.066, -5.138, -4.634, -0.046 ], "step_params": [ 0.472, -1.268, 3.399, 1.004, 7.184, 29.704 ], "heli_params": [ -3.827, -0.698, 3.030, 13.756, -1.923, 30.558 ], "bp2_params": [ -0.206, -0.140, -0.337, -3.992, 2.750, 3.334 ], "groove_widths": [ 17.575, 16.589, 20.041, 19.550 ], "simple_Rise": 3.399, "simple_Twist": 30.506, "simple_hRise": 3.042, "simple_hTwist": 31.337 }, { "index": 13, "nt1": "///A/13", "nt2": "///C/8", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.206, -0.140, -0.337, -3.992, 2.750, 3.334 ], "step_params": [ 0.042, -2.122, 3.395, -1.247, 6.877, 26.945 ], "heli_params": [ -5.994, -0.375, 2.774, 14.452, 2.620, 27.820 ], "bp2_params": [ 0.220, -0.087, -0.218, -0.024, 3.337, 2.864 ], "groove_widths": [ 17.760, 16.464, 19.063, 17.993 ], "simple_Rise": 3.395, "simple_Twist": 24.412, "simple_hRise": 2.699, "simple_hTwist": 25.378 }, { "index": 14, "nt1": "///A/14", "nt2": "///C/7", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.220, -0.087, -0.218, -0.024, 3.337, 2.864 ], "step_params": [ -0.256, -1.832, 3.291, -1.099, 6.927, 26.835 ], "heli_params": [ -5.395, 0.285, 2.749, 14.611, 2.317, 27.720 ], "bp2_params": [ 0.044, -0.150, 0.117, -0.333, -5.386, 1.108 ], "groove_widths": [ 17.286, 15.884, 20.375, 19.965 ], "simple_Rise": 3.291, "simple_Twist": 27.720, "simple_hRise": 2.769, "simple_hTwist": 28.577 }, { "index": 15, "nt1": "///A/15", "nt2": "///C/6", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.044, -0.150, 0.117, -0.333, -5.386, 1.108 ], "step_params": [ 0.087, -2.031, 3.474, 1.862, 1.549, 30.513 ], "heli_params": [ -4.169, 0.222, 3.369, 2.937, -3.532, 30.607 ], "bp2_params": [ -0.198, -0.155, -0.484, -3.447, 0.905, 0.167 ], "groove_widths": [ 16.958, 15.532, 20.841, 20.644 ], "simple_Rise": 3.474, "simple_Twist": 31.897, "simple_hRise": 3.374, "simple_hTwist": 31.987 }, { "index": 16, "nt1": "///A/16", "nt2": "///C/5", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.198, -0.155, -0.484, -3.447, 0.905, 0.167 ], "step_params": [ 0.422, -2.698, 3.285, 1.529, 4.779, 23.225 ], "heli_params": [ -8.014, -0.558, 2.704, 11.697, -3.742, 23.754 ], "bp2_params": [ 0.099, -0.093, -0.467, 0.341, 4.861, 0.706 ], "groove_widths": [ 16.689, 15.305, 20.393, 20.151 ], "simple_Rise": 3.285, "simple_Twist": 21.504, "simple_hRise": 2.653, "simple_hTwist": 22.075 }, { "index": 17, "nt1": "///A/17", "nt2": "///C/4", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.099, -0.093, -0.467, 0.341, 4.861, 0.706 ], "step_params": [ 0.062, -1.989, 3.623, 0.879, 1.684, 28.644 ], "heli_params": [ -4.426, 0.090, 3.503, 3.399, -1.774, 28.705 ], "bp2_params": [ -0.081, -0.200, -0.065, -5.308, -8.642, 3.431 ], "groove_widths": [ 16.522, 15.315, 22.432, 22.354 ], "simple_Rise": 3.623, "simple_Twist": 29.368, "simple_hRise": 3.507, "simple_hTwist": 29.428 }, { "index": 18, "nt1": "///A/18", "nt2": "///C/3", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.081, -0.200, -0.065, -5.308, -8.642, 3.431 ], "step_params": [ 0.105, -1.738, 3.360, 3.494, -1.254, 32.241 ], "heli_params": [ -2.882, 0.450, 3.416, -2.249, -6.266, 32.449 ], "bp2_params": [ 0.192, -0.098, -0.207, -0.812, -3.693, 2.496 ], "groove_widths": [ 16.540, 15.431, 25.903, 25.024 ], "simple_Rise": 3.360, "simple_Twist": 30.970, "simple_hRise": 3.417, "simple_hTwist": 31.187 }, { "index": 19, "nt1": "///A/19", "nt2": "///C/2", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.192, -0.098, -0.207, -0.812, -3.693, 2.496 ], "step_params": [ 0.794, -2.096, 3.490, 4.787, -1.548, 23.247 ], "heli_params": [ -4.521, -0.174, 3.706, -3.785, -11.704, 23.778 ], "bp2_params": [ 0.167, -0.112, -0.396, -1.081, 1.878, -0.168 ], "groove_widths": [ 16.286, 14.918, 15.183, 15.047 ], "simple_Rise": 3.490, "simple_Twist": 23.380, "simple_hRise": 3.705, "simple_hTwist": 23.908 }, { "index": 20, "nt1": "///A/20", "nt2": "///C/1", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.167, -0.112, -0.396, -1.081, 1.878, -0.168 ], "step_params": [ 3.659, -0.913, 3.314, -1.674, 7.111, 53.765 ], "heli_params": [ -1.429, -4.115, 3.073, 7.822, 1.841, 54.223 ], "bp2_params": [ -2.485, -0.500, 0.034, -5.589, -1.325, -6.457 ], "groove_widths": [ 16.356, 14.016, 15.957, 15.502 ], "simple_Rise": 3.314, "simple_Twist": 67.906, "simple_hRise": 3.137, "simple_hTwist": 68.251 }, { "index": 21, "nt1": "///A/21", "nt2": "///A/50", "bp": "G-U", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -2.485, -0.500, 0.034, -5.589, -1.325, -6.457 ], "step_params": [ 0.199, -0.941, 3.185, -6.305, 9.332, 36.980 ], "heli_params": [ -2.503, -1.030, 2.805, 14.310, 9.668, 38.599 ], "bp2_params": [ -0.085, -0.133, 0.392, 3.475, -3.320, 3.450 ], "groove_widths": [ 16.545, 11.759, 15.232, 13.798 ], "simple_Rise": 3.185, "simple_Twist": 24.226, "simple_hRise": 2.526, "simple_hTwist": 26.680 }, { "index": 22, "nt1": "///A/22", "nt2": "///A/49", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.085, -0.133, 0.392, 3.475, -3.320, 3.450 ], "step_params": [ 0.271, -1.046, 3.081, 0.450, 6.933, 33.374 ], "heli_params": [ -2.790, -0.397, 2.817, 11.911, -0.774, 34.069 ], "bp2_params": [ -0.007, -0.167, 0.287, 8.909, -10.826, 6.623 ], "groove_widths": [ 17.860, 14.446, 13.040, 8.445 ], "simple_Rise": 3.081, "simple_Twist": 33.098, "simple_hRise": 2.814, "simple_hTwist": 33.799 }, { "index": 23, "nt1": "///A/23", "nt2": "///A/48", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.007, -0.167, 0.287, 8.909, -10.826, 6.623 ], "step_params": [ -0.836, -0.730, 3.720, -0.965, 20.883, 34.491 ], "heli_params": [ -3.655, 1.097, 2.863, 31.858, 1.472, 40.167 ], "bp2_params": [ 0.026, -0.142, 0.635, -0.737, -1.583, 0.096 ], "groove_widths": [ 18.822, null, 13.135, null ], "simple_Rise": 3.720, "simple_Twist": 34.513, "simple_hRise": 2.864, "simple_hTwist": 40.185 }, { "index": 24, "nt1": "///A/24", "nt2": "///A/47", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.026, -0.142, 0.635, -0.737, -1.583, 0.096 ], "step_params": [ 0.595, -1.206, 3.054, 3.826, 3.355, 32.833 ], "heli_params": [ -2.630, -0.447, 2.969, 5.891, -6.719, 33.214 ], "bp2_params": [ 0.002, -0.143, 0.341, 3.223, -7.253, 3.757 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.054, "simple_Twist": 32.851, "simple_hRise": 2.969, "simple_hTwist": 33.232 }, { "index": 25, "nt1": "///A/25", "nt2": "///A/46", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.002, -0.143, 0.341, 3.223, -7.253, 3.757 ], "step_params": [ -0.192, -1.789, 3.138, -2.092, 9.943, 31.056 ], "heli_params": [ -4.703, 0.021, 2.470, 17.977, 3.783, 32.637 ], "bp2_params": [ 0.098, -0.041, -0.011, 4.289, 6.686, 4.145 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.138, "simple_Twist": 30.401, "simple_hRise": 2.453, "simple_hTwist": 32.016 }, { "index": 26, "nt1": "///A/26", "nt2": "///A/45", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 2, "num_stems": 1, "strand1": "GCUA", "strand2": "CGAU", "bp_type": "||||", "helix_form": "AAA", "helical_rise": 2.647, "helical_rise_std": 0.090, "helical_radius": 9.432, "helical_radius_std": 0.964, "helical_axis": [ 0.040, 0.183, -0.982 ], "point1": [ 21.172, -15.207, 10.381 ], "point2": [ 21.486, -13.758, 2.618 ], "num_pairs": 4, "pairs": [ { "index": 1, "nt1": "///A/29", "nt2": "///A/40", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.245, -0.189, -0.114, -8.104, -8.477, -0.660 ], "step_params": [ -0.791, -1.689, 3.274, -3.657, 3.572, 29.084 ], "heli_params": [ -4.063, 0.787, 3.122, 7.043, 7.212, 29.521 ], "bp2_params": [ 0.219, -0.147, 0.067, -6.959, -8.610, 2.058 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.274, "simple_Twist": 26.844, "simple_hRise": 3.105, "simple_hTwist": 27.318 }, { "index": 2, "nt1": "///A/30", "nt2": "///A/39", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.219, -0.147, 0.067, -6.959, -8.610, 2.058 ], "step_params": [ 0.103, -1.266, 3.066, -3.703, 4.991, 32.299 ], "heli_params": [ -3.011, -0.757, 2.815, 8.869, 6.581, 32.876 ], "bp2_params": [ 0.008, -0.178, 0.364, -0.376, -5.605, 3.779 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.066, "simple_Twist": 33.612, "simple_hRise": 2.827, "simple_hTwist": 34.165 }, { "index": 3, "nt1": "///A/31", "nt2": "///A/38", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.008, -0.178, 0.364, -0.376, -5.605, 3.779 ], "step_params": [ 0.010, -1.411, 3.001, 1.395, 10.536, 33.334 ], "heli_params": [ -3.712, 0.164, 2.454, 17.812, -2.358, 34.942 ], "bp2_params": [ -0.044, -0.200, -0.182, 3.286, 2.298, 5.353 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.001, "simple_Twist": 33.522, "simple_hRise": 2.458, "simple_hTwist": 35.121 }, { "index": 4, "nt1": "///A/32", "nt2": "///A/37", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 3, "num_stems": 1, "strand1": "AGGC", "strand2": "GCCG", "bp_type": ".|||", "helix_form": ".Ax", "helical_rise": 3.482, "helical_rise_std": 0.336, "helical_radius": 8.408, "helical_radius_std": 1.414, "helical_axis": [ 0.166, 0.886, -0.433 ], "point1": [ -3.520, 12.801, 31.210 ], "point2": [ -1.750, 22.235, 26.597 ], "num_pairs": 4, "pairs": [ { "index": 1, "nt1": "///A/52", "nt2": "///A/62", "bp": "A-G", "name": "Sheared", "Saenger": "11-XI", "LW": "tHS", "DSSR": "tM-m", "bp1_params": [ -7.905, -5.162, 0.203, -23.514, 12.444, -49.209 ], "step_params": [ 4.490, -1.920, 3.125, 2.298, 0.390, 54.873 ], "heli_params": [ -2.105, -4.734, 3.283, 0.423, -2.493, 54.919 ], "bp2_params": [ -0.262, -0.121, -0.405, -9.428, -5.254, 0.690 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.125, "simple_Twist": 4.738, "simple_hRise": 4.615, "simple_hTwist": 5.280 }, { "index": 2, "nt1": "///A/53", "nt2": "///A/61", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.262, -0.121, -0.405, -9.428, -5.254, 0.690 ], "step_params": [ -0.478, -1.707, 3.109, -1.676, 2.279, 34.701 ], "heli_params": [ -3.179, 0.560, 3.013, 3.813, 2.804, 34.812 ], "bp2_params": [ -0.234, -0.117, -0.053, -3.783, -1.719, 1.066 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.109, "simple_Twist": 34.615, "simple_hRise": 3.013, "simple_hTwist": 34.727 }, { "index": 3, "nt1": "///A/54", "nt2": "///A/60", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.234, -0.117, -0.053, -3.783, -1.719, 1.066 ], "step_params": [ -1.163, -0.622, 2.875, 0.517, 5.782, 18.205 ], "heli_params": [ -4.374, 3.728, 2.523, 17.701, -1.584, 19.101 ], "bp2_params": [ 0.237, -0.138, 0.219, 12.796, 5.367, 3.776 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.875, "simple_Twist": 15.445, "simple_hRise": 2.440, "simple_hTwist": 16.494 }, { "index": 4, "nt1": "///A/55", "nt2": "///A/58", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 4, "num_stems": 1, "strand1": "AACUUG", "strand2": "GUGAAA", "bp_type": ".||||.", "helix_form": "..AA.", "helical_rise": 2.768, "helical_rise_std": 0.774, "helical_radius": 8.881, "helical_radius_std": 1.660, "helical_axis": [ 0.259, 0.595, -0.761 ], "point1": [ -38.639, 6.690, 39.370 ], "point2": [ -35.057, 14.935, 28.828 ], "num_pairs": 6, "pairs": [ { "index": 1, "nt1": "///A/68", "nt2": "///A/81", "bp": "A-G", "name": "--", "Saenger": "--", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.185, 2.556, 0.192, -8.761, 23.756, -59.962 ], "step_params": [ 2.765, -0.979, 3.265, -13.442, 22.179, 29.967 ], "heli_params": [ -3.437, -5.301, 1.043, 35.652, 21.607, 39.436 ], "bp2_params": [ 0.063, -0.065, 0.730, 7.956, -6.139, -2.128 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.265, "simple_Twist": 29.737, "simple_hRise": 1.028, "simple_hTwist": 39.264 }, { "index": 2, "nt1": "///A/69", "nt2": "///A/80", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.063, -0.065, 0.730, 7.956, -6.139, -2.128 ], "step_params": [ 0.094, -1.771, 3.412, -4.560, 2.635, 34.598 ], "heli_params": [ -3.352, -0.858, 3.234, 4.399, 7.612, 34.984 ], "bp2_params": [ 0.129, -0.238, 0.611, 1.742, -10.966, 2.498 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.412, "simple_Twist": 34.026, "simple_hRise": 3.230, "simple_hTwist": 34.419 }, { "index": 3, "nt1": "///A/70", "nt2": "///A/79", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.129, -0.238, 0.611, 1.742, -10.966, 2.498 ], "step_params": [ -0.917, -1.576, 3.258, -0.819, 6.257, 33.712 ], "heli_params": [ -3.615, 1.432, 2.947, 10.673, 1.397, 34.281 ], "bp2_params": [ -0.166, -0.171, 0.220, -8.246, -10.954, -2.800 ], "groove_widths": [ 16.923, null, 15.426, null ], "simple_Rise": 3.258, "simple_Twist": 35.162, "simple_hRise": 2.963, "simple_hTwist": 35.707 }, { "index": 4, "nt1": "///A/71", "nt2": "///A/78", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.166, -0.171, 0.220, -8.246, -10.954, -2.800 ], "step_params": [ 0.543, -1.161, 3.269, -3.841, 7.999, 27.386 ], "heli_params": [ -4.023, -1.902, 2.728, 16.360, 7.855, 28.762 ], "bp2_params": [ -0.263, -0.453, 0.757, -6.847, -9.430, 0.412 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.269, "simple_Twist": 27.813, "simple_hRise": 2.739, "simple_hTwist": 29.167 }, { "index": 5, "nt1": "///A/72", "nt2": "///A/77", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.263, -0.453, 0.757, -6.847, -9.430, 0.412 ], "step_params": [ -1.462, -0.850, 2.774, -0.425, -1.745, 47.783 ], "heli_params": [ -0.930, 1.775, 2.813, -2.153, 0.524, 47.815 ], "bp2_params": [ 6.598, -4.975, 0.086, 19.853, -7.831, -17.769 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.774, "simple_Twist": 1.356, "simple_hRise": 2.606, "simple_hTwist": 2.250 }, { "index": 6, "nt1": "///A/73", "nt2": "///A/76", "bp": "G-A", "name": "Sheared", "Saenger": "11-XI", "LW": "tSH", "DSSR": "tm-M" } ] }, { "index": 5, "num_stems": 1, "strand1": "CAATACCT", "strand2": "GTTATGGA", "bp_type": "||||||||", "helix_form": ".B.BBBB", "helical_rise": 3.325, "helical_rise_std": 0.331, "helical_radius": 9.849, "helical_radius_std": 0.584, "helical_axis": [ 0.250, 0.309, 0.918 ], "point1": [ -15.446, -19.834, 10.377 ], "point2": [ -9.591, -12.595, 31.891 ], "num_pairs": 8, "pairs": [ { "index": 1, "nt1": "c. C & i. \\-7", "nt2": "///D/7", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.400, -0.284, -0.230, 3.758, -20.627, 8.125 ], "step_params": [ -1.012, -0.571, 3.329, 0.365, 17.927, 33.938 ], "heli_params": [ -3.082, 1.588, 2.696, 28.389, -0.578, 38.260 ], "bp2_params": [ -0.340, 0.140, 0.076, 2.666, -5.350, 13.640 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.329, "simple_Twist": 37.842, "simple_hRise": 2.786, "simple_hTwist": 41.734 }, { "index": 2, "nt1": "c. C & i. \\-6", "nt2": "///D/6", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.340, 0.140, 0.076, 2.666, -5.350, 13.640 ], "step_params": [ -0.908, -0.052, 3.427, 0.804, 2.740, 32.599 ], "heli_params": [ -0.586, 1.756, 3.389, 4.869, -1.428, 32.721 ], "bp2_params": [ 0.139, 0.378, -0.193, -1.238, -14.571, 4.394 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.427, "simple_Twist": 29.951, "simple_hRise": 3.384, "simple_hTwist": 30.084 }, { "index": 3, "nt1": "c. C & i. \\-5", "nt2": "///D/5", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.139, 0.378, -0.193, -1.238, -14.571, 4.394 ], "step_params": [ 0.284, -0.883, 3.218, 0.687, 3.741, 29.515 ], "heli_params": [ -2.479, -0.414, 3.091, 7.304, -1.342, 29.754 ], "bp2_params": [ -0.126, -0.088, -0.176, -3.003, -8.663, 0.871 ], "groove_widths": [ 12.553, null, 17.928, null ], "simple_Rise": 3.218, "simple_Twist": 31.121, "simple_hRise": 3.099, "simple_hTwist": 31.346 }, { "index": 4, "nt1": "c. C & i. \\-4", "nt2": "///D/4", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.126, -0.088, -0.176, -3.003, -8.663, 0.871 ], "step_params": [ 0.289, 0.177, 3.411, -1.317, 6.679, 32.342 ], "heli_params": [ -0.873, -0.743, 3.365, 11.827, 2.333, 33.032 ], "bp2_params": [ 0.193, -0.044, -0.264, -3.847, -6.866, 4.965 ], "groove_widths": [ 13.145, 13.015, 19.080, 17.850 ], "simple_Rise": 3.411, "simple_Twist": 30.516, "simple_hRise": 3.358, "simple_hTwist": 31.249 }, { "index": 5, "nt1": "c. C & i. \\-3", "nt2": "///D/3", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.193, -0.044, -0.264, -3.847, -6.866, 4.965 ], "step_params": [ -0.370, -0.603, 3.232, -3.057, 0.873, 30.747 ], "heli_params": [ -1.299, 0.107, 3.235, 1.641, 5.747, 30.907 ], "bp2_params": [ 0.214, -0.183, 0.012, -3.508, -9.575, 1.337 ], "groove_widths": [ 14.326, null, 20.226, null ], "simple_Rise": 3.232, "simple_Twist": 30.579, "simple_hRise": 3.235, "simple_hTwist": 30.740 }, { "index": 6, "nt1": "c. C & i. \\-2", "nt2": "///D/2", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.214, -0.183, 0.012, -3.508, -9.575, 1.337 ], "step_params": [ 0.480, -0.662, 3.159, 0.832, 4.050, 36.703 ], "heli_params": [ -1.569, -0.651, 3.080, 6.407, -1.316, 36.927 ], "bp2_params": [ 0.186, -0.137, 0.073, -0.960, -4.956, 0.861 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.159, "simple_Twist": 36.884, "simple_hRise": 3.081, "simple_hTwist": 37.107 }, { "index": 7, "nt1": "c. C & i. \\-1", "nt2": "///D/1", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.186, -0.137, 0.073, -0.960, -4.956, 0.861 ], "step_params": [ 0.869, 0.802, 3.188, 5.169, 3.187, 30.838 ], "heli_params": [ 0.878, -0.626, 3.350, 5.920, -9.604, 31.416 ], "bp2_params": [ -0.111, -0.195, -0.152, 9.478, -0.087, 4.412 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.188, "simple_Twist": 32.545, "simple_hRise": 3.344, "simple_hTwist": 33.091 }, { "index": 8, "nt1": "///C/0", "nt2": "///D/0", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W" } ] } ], "num_stems": 8, "stems": [ { "index": 1, "helix_index": 1, "strand1": "GGAA", "strand2": "CCTT", "bp_type": "||||", "helix_form": "AAA", "helical_rise": 3.500, "helical_rise_std": 0.257, "helical_radius": 9.981, "helical_radius_std": 0.530, "helical_axis": [ 0.885, -0.071, -0.460 ], "point1": [ -23.248, 4.669, 81.027 ], "point2": [ -13.780, 3.910, 76.100 ], "num_pairs": 4, "pairs": [ { "index": 1, "nt1": "///A/1", "nt2": "///C/20", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.162, -0.140, -0.455, -7.025, -4.068, 0.007 ], "step_params": [ 0.582, -2.194, 3.320, -0.975, 5.761, 30.396 ], "heli_params": [ -5.172, -1.270, 2.846, 10.861, 1.838, 30.939 ], "bp2_params": [ -0.135, -0.119, -0.297, -7.965, -2.468, 0.172 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.320, "simple_Twist": 30.391, "simple_hRise": 2.846, "simple_hTwist": 30.934 }, { "index": 2, "nt1": "///A/2", "nt2": "///C/19", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.135, -0.119, -0.297, -7.965, -2.468, 0.172 ], "step_params": [ -0.802, -2.013, 3.250, -4.247, 6.466, 27.729 ], "heli_params": [ -5.420, 0.716, 2.808, 13.171, 8.650, 28.768 ], "bp2_params": [ -0.018, -0.144, 0.102, -6.126, -0.276, 3.360 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.250, "simple_Twist": 26.869, "simple_hRise": 2.790, "simple_hTwist": 27.941 }, { "index": 3, "nt1": "///A/3", "nt2": "///C/18", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.018, -0.144, 0.102, -6.126, -0.276, 3.360 ], "step_params": [ -1.051, -1.360, 3.058, -2.756, 8.605, 27.652 ], "heli_params": [ -4.392, 1.556, 2.615, 17.424, 5.580, 29.064 ], "bp2_params": [ 0.036, -0.178, 0.001, 2.357, 2.305, 0.771 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.058, "simple_Twist": 27.296, "simple_hRise": 2.608, "simple_hTwist": 28.726 }, { "index": 4, "nt1": "///A/4", "nt2": "///C/17", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 2, "helix_index": 1, "strand1": "CCC", "strand2": "GGG", "bp_type": "|||", "helix_form": "..", "helical_rise": 2.729, "helical_rise_std": 0.149, "helical_radius": 9.981, "helical_radius_std": 1.933, "helical_axis": [ 0.588, 0.119, -0.800 ], "point1": [ -11.256, 4.793, 74.448 ], "point2": [ -8.056, 5.442, 70.100 ], "num_pairs": 3, "pairs": [ { "index": 1, "nt1": "///A/6", "nt2": "///C/15", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.121, -0.015, -0.094, -0.694, -1.689, 2.679 ], "step_params": [ 0.624, -0.540, 3.322, 7.959, 6.748, 34.641 ], "heli_params": [ -1.845, 0.143, 3.224, 11.027, -13.006, 36.133 ], "bp2_params": [ 0.121, -0.163, -0.314, -3.723, -1.020, 2.642 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.322, "simple_Twist": 34.609, "simple_hRise": 3.224, "simple_hTwist": 36.102 }, { "index": 2, "nt1": "///A/7", "nt2": "///C/14", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.121, -0.163, -0.314, -3.723, -1.020, 2.642 ], "step_params": [ 1.478, -1.543, 3.167, 2.858, 8.956, 11.929 ], "heli_params": [ -12.105, -3.598, 1.862, 36.539, -11.659, 15.178 ], "bp2_params": [ 0.299, -0.187, -0.021, -0.757, -5.518, 2.530 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.167, "simple_Twist": 11.000, "simple_hRise": 1.751, "simple_hTwist": 14.461 }, { "index": 3, "nt1": "///A/8", "nt2": "///C/13", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 3, "helix_index": 1, "strand1": "UCUGCAGCACC", "strand2": "AGACGTCGTGG", "bp_type": "|||||||||||", "helix_form": ".AAAAA.AA.", "helical_rise": 3.017, "helical_rise_std": 0.205, "helical_radius": 10.581, "helical_radius_std": 1.096, "helical_axis": [ 0.299, 0.032, -0.954 ], "point1": [ -4.902, 5.114, 63.135 ], "point2": [ 4.079, 6.070, 34.477 ], "num_pairs": 11, "pairs": [ { "index": 1, "nt1": "///A/10", "nt2": "///C/11", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.051, -0.190, -0.300, -11.445, -8.160, 6.841 ], "step_params": [ 0.536, -0.826, 3.371, 1.048, 6.194, 30.519 ], "heli_params": [ -2.731, -0.796, 3.163, 11.613, -1.964, 31.144 ], "bp2_params": [ 0.286, -0.196, -0.076, -6.818, -5.806, 4.008 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.371, "simple_Twist": 29.211, "simple_hRise": 3.150, "simple_hTwist": 29.865 }, { "index": 2, "nt1": "///A/11", "nt2": "///C/10", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.286, -0.196, -0.076, -6.818, -5.806, 4.008 ], "step_params": [ -0.616, -1.462, 3.288, -0.390, 4.516, 29.942 ], "heli_params": [ -3.687, 1.102, 3.047, 8.678, 0.749, 30.275 ], "bp2_params": [ -0.115, -0.106, 0.066, -5.138, -4.634, -0.046 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.288, "simple_Twist": 32.135, "simple_hRise": 3.066, "simple_hTwist": 32.444 }, { "index": 3, "nt1": "///A/12", "nt2": "///C/9", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.115, -0.106, 0.066, -5.138, -4.634, -0.046 ], "step_params": [ 0.472, -1.268, 3.399, 1.004, 7.184, 29.704 ], "heli_params": [ -3.827, -0.698, 3.030, 13.756, -1.923, 30.558 ], "bp2_params": [ -0.206, -0.140, -0.337, -3.992, 2.750, 3.334 ], "groove_widths": [ 17.575, null, 20.041, null ], "simple_Rise": 3.399, "simple_Twist": 30.506, "simple_hRise": 3.042, "simple_hTwist": 31.337 }, { "index": 4, "nt1": "///A/13", "nt2": "///C/8", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.206, -0.140, -0.337, -3.992, 2.750, 3.334 ], "step_params": [ 0.042, -2.122, 3.395, -1.247, 6.877, 26.945 ], "heli_params": [ -5.994, -0.375, 2.774, 14.452, 2.620, 27.820 ], "bp2_params": [ 0.220, -0.087, -0.218, -0.024, 3.337, 2.864 ], "groove_widths": [ 17.760, 16.464, 19.063, 17.993 ], "simple_Rise": 3.395, "simple_Twist": 24.412, "simple_hRise": 2.699, "simple_hTwist": 25.378 }, { "index": 5, "nt1": "///A/14", "nt2": "///C/7", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.220, -0.087, -0.218, -0.024, 3.337, 2.864 ], "step_params": [ -0.256, -1.832, 3.291, -1.099, 6.927, 26.835 ], "heli_params": [ -5.395, 0.285, 2.749, 14.611, 2.317, 27.720 ], "bp2_params": [ 0.044, -0.150, 0.117, -0.333, -5.386, 1.108 ], "groove_widths": [ 17.286, 15.884, 20.375, 19.965 ], "simple_Rise": 3.291, "simple_Twist": 27.720, "simple_hRise": 2.769, "simple_hTwist": 28.577 }, { "index": 6, "nt1": "///A/15", "nt2": "///C/6", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.044, -0.150, 0.117, -0.333, -5.386, 1.108 ], "step_params": [ 0.087, -2.031, 3.474, 1.862, 1.549, 30.513 ], "heli_params": [ -4.169, 0.222, 3.369, 2.937, -3.532, 30.607 ], "bp2_params": [ -0.198, -0.155, -0.484, -3.447, 0.905, 0.167 ], "groove_widths": [ 16.958, 15.532, 20.841, 20.644 ], "simple_Rise": 3.474, "simple_Twist": 31.897, "simple_hRise": 3.374, "simple_hTwist": 31.987 }, { "index": 7, "nt1": "///A/16", "nt2": "///C/5", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.198, -0.155, -0.484, -3.447, 0.905, 0.167 ], "step_params": [ 0.422, -2.698, 3.285, 1.529, 4.779, 23.225 ], "heli_params": [ -8.014, -0.558, 2.704, 11.697, -3.742, 23.754 ], "bp2_params": [ 0.099, -0.093, -0.467, 0.341, 4.861, 0.706 ], "groove_widths": [ 16.689, 15.305, 20.393, 20.151 ], "simple_Rise": 3.285, "simple_Twist": 21.504, "simple_hRise": 2.653, "simple_hTwist": 22.075 }, { "index": 8, "nt1": "///A/17", "nt2": "///C/4", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.099, -0.093, -0.467, 0.341, 4.861, 0.706 ], "step_params": [ 0.062, -1.989, 3.623, 0.879, 1.684, 28.644 ], "heli_params": [ -4.426, 0.090, 3.503, 3.399, -1.774, 28.705 ], "bp2_params": [ -0.081, -0.200, -0.065, -5.308, -8.642, 3.431 ], "groove_widths": [ 16.522, null, 22.432, null ], "simple_Rise": 3.623, "simple_Twist": 29.368, "simple_hRise": 3.507, "simple_hTwist": 29.428 }, { "index": 9, "nt1": "///A/18", "nt2": "///C/3", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.081, -0.200, -0.065, -5.308, -8.642, 3.431 ], "step_params": [ 0.105, -1.738, 3.360, 3.494, -1.254, 32.241 ], "heli_params": [ -2.882, 0.450, 3.416, -2.249, -6.266, 32.449 ], "bp2_params": [ 0.192, -0.098, -0.207, -0.812, -3.693, 2.496 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.360, "simple_Twist": 30.970, "simple_hRise": 3.417, "simple_hTwist": 31.187 }, { "index": 10, "nt1": "///A/19", "nt2": "///C/2", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.192, -0.098, -0.207, -0.812, -3.693, 2.496 ], "step_params": [ 0.794, -2.096, 3.490, 4.787, -1.548, 23.247 ], "heli_params": [ -4.521, -0.174, 3.706, -3.785, -11.704, 23.778 ], "bp2_params": [ 0.167, -0.112, -0.396, -1.081, 1.878, -0.168 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.490, "simple_Twist": 23.380, "simple_hRise": 3.705, "simple_hTwist": 23.908 }, { "index": 11, "nt1": "///A/20", "nt2": "///C/1", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 4, "helix_index": 1, "strand1": "GUUUUA", "strand2": "UAAAAU", "bp_type": "||||||", "helix_form": "...AA", "helical_rise": 2.506, "helical_rise_std": 0.440, "helical_radius": 8.556, "helical_radius_std": 0.736, "helical_axis": [ 0.426, -0.572, -0.701 ], "point1": [ 10.184, 5.714, 29.942 ], "point2": [ 15.452, -1.366, 21.276 ], "num_pairs": 6, "pairs": [ { "index": 1, "nt1": "///A/21", "nt2": "///A/50", "bp": "G-U", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -2.485, -0.500, 0.034, -5.589, -1.325, -6.457 ], "step_params": [ 0.199, -0.941, 3.185, -6.305, 9.332, 36.980 ], "heli_params": [ -2.503, -1.030, 2.805, 14.310, 9.668, 38.599 ], "bp2_params": [ -0.085, -0.133, 0.392, 3.475, -3.320, 3.450 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.185, "simple_Twist": 24.226, "simple_hRise": 2.526, "simple_hTwist": 26.680 }, { "index": 2, "nt1": "///A/22", "nt2": "///A/49", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.085, -0.133, 0.392, 3.475, -3.320, 3.450 ], "step_params": [ 0.271, -1.046, 3.081, 0.450, 6.933, 33.374 ], "heli_params": [ -2.790, -0.397, 2.817, 11.911, -0.774, 34.069 ], "bp2_params": [ -0.007, -0.167, 0.287, 8.909, -10.826, 6.623 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.081, "simple_Twist": 33.098, "simple_hRise": 2.814, "simple_hTwist": 33.799 }, { "index": 3, "nt1": "///A/23", "nt2": "///A/48", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.007, -0.167, 0.287, 8.909, -10.826, 6.623 ], "step_params": [ -0.836, -0.730, 3.720, -0.965, 20.883, 34.491 ], "heli_params": [ -3.655, 1.097, 2.863, 31.858, 1.472, 40.167 ], "bp2_params": [ 0.026, -0.142, 0.635, -0.737, -1.583, 0.096 ], "groove_widths": [ 18.822, null, 13.135, null ], "simple_Rise": 3.720, "simple_Twist": 34.513, "simple_hRise": 2.864, "simple_hTwist": 40.185 }, { "index": 4, "nt1": "///A/24", "nt2": "///A/47", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.026, -0.142, 0.635, -0.737, -1.583, 0.096 ], "step_params": [ 0.595, -1.206, 3.054, 3.826, 3.355, 32.833 ], "heli_params": [ -2.630, -0.447, 2.969, 5.891, -6.719, 33.214 ], "bp2_params": [ 0.002, -0.143, 0.341, 3.223, -7.253, 3.757 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.054, "simple_Twist": 32.851, "simple_hRise": 2.969, "simple_hTwist": 33.232 }, { "index": 5, "nt1": "///A/25", "nt2": "///A/46", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.002, -0.143, 0.341, 3.223, -7.253, 3.757 ], "step_params": [ -0.192, -1.789, 3.138, -2.092, 9.943, 31.056 ], "heli_params": [ -4.703, 0.021, 2.470, 17.977, 3.783, 32.637 ], "bp2_params": [ 0.098, -0.041, -0.011, 4.289, 6.686, 4.145 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.138, "simple_Twist": 30.401, "simple_hRise": 2.453, "simple_hTwist": 32.016 }, { "index": 6, "nt1": "///A/26", "nt2": "///A/45", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 5, "helix_index": 2, "strand1": "GCUA", "strand2": "CGAU", "bp_type": "||||", "helix_form": "AAA", "helical_rise": 2.647, "helical_rise_std": 0.090, "helical_radius": 9.432, "helical_radius_std": 0.964, "helical_axis": [ 0.040, 0.183, -0.982 ], "point1": [ 21.172, -15.207, 10.381 ], "point2": [ 21.486, -13.758, 2.618 ], "num_pairs": 4, "pairs": [ { "index": 1, "nt1": "///A/29", "nt2": "///A/40", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.245, -0.189, -0.114, -8.104, -8.477, -0.660 ], "step_params": [ -0.791, -1.689, 3.274, -3.657, 3.572, 29.084 ], "heli_params": [ -4.063, 0.787, 3.122, 7.043, 7.212, 29.521 ], "bp2_params": [ 0.219, -0.147, 0.067, -6.959, -8.610, 2.058 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.274, "simple_Twist": 26.844, "simple_hRise": 3.105, "simple_hTwist": 27.318 }, { "index": 2, "nt1": "///A/30", "nt2": "///A/39", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.219, -0.147, 0.067, -6.959, -8.610, 2.058 ], "step_params": [ 0.103, -1.266, 3.066, -3.703, 4.991, 32.299 ], "heli_params": [ -3.011, -0.757, 2.815, 8.869, 6.581, 32.876 ], "bp2_params": [ 0.008, -0.178, 0.364, -0.376, -5.605, 3.779 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.066, "simple_Twist": 33.612, "simple_hRise": 2.827, "simple_hTwist": 34.165 }, { "index": 3, "nt1": "///A/31", "nt2": "///A/38", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.008, -0.178, 0.364, -0.376, -5.605, 3.779 ], "step_params": [ 0.010, -1.411, 3.001, 1.395, 10.536, 33.334 ], "heli_params": [ -3.712, 0.164, 2.454, 17.812, -2.358, 34.942 ], "bp2_params": [ -0.044, -0.200, -0.182, 3.286, 2.298, 5.353 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.001, "simple_Twist": 33.522, "simple_hRise": 2.458, "simple_hTwist": 35.121 }, { "index": 4, "nt1": "///A/32", "nt2": "///A/37", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 6, "helix_index": 3, "strand1": "GG", "strand2": "CC", "bp_type": "||", "helix_form": "A", "helical_rise": 3.041, "helical_rise_std": 0.023, "helical_radius": 9.391, "helical_radius_std": 1.284, "helical_axis": [ 0.122, 0.871, -0.476 ], "point1": [ -1.232, 16.639, 30.951 ], "point2": [ -0.861, 19.288, 29.505 ], "num_pairs": 2, "pairs": [ { "index": 1, "nt1": "///A/53", "nt2": "///A/61", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.262, -0.121, -0.405, -9.428, -5.254, 0.690 ], "step_params": [ -0.478, -1.707, 3.109, -1.676, 2.279, 34.701 ], "heli_params": [ -3.179, 0.560, 3.013, 3.813, 2.804, 34.812 ], "bp2_params": [ -0.234, -0.117, -0.053, -3.783, -1.719, 1.066 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.109, "simple_Twist": 34.615, "simple_hRise": 3.013, "simple_hTwist": 34.727 }, { "index": 2, "nt1": "///A/54", "nt2": "///A/60", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 7, "helix_index": 4, "strand1": "ACUU", "strand2": "UGAA", "bp_type": "||||", "helix_form": ".AA", "helical_rise": 2.666, "helical_rise_std": 0.274, "helical_radius": 8.909, "helical_radius_std": 0.985, "helical_axis": [ 0.296, 0.661, -0.690 ], "point1": [ -38.385, 9.272, 36.961 ], "point2": [ -36.044, 14.494, 31.512 ], "num_pairs": 4, "pairs": [ { "index": 1, "nt1": "///A/69", "nt2": "///A/80", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.063, -0.065, 0.730, 7.956, -6.139, -2.128 ], "step_params": [ 0.094, -1.771, 3.412, -4.560, 2.635, 34.598 ], "heli_params": [ -3.352, -0.858, 3.234, 4.399, 7.612, 34.984 ], "bp2_params": [ 0.129, -0.238, 0.611, 1.742, -10.966, 2.498 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.412, "simple_Twist": 34.026, "simple_hRise": 3.230, "simple_hTwist": 34.419 }, { "index": 2, "nt1": "///A/70", "nt2": "///A/79", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.129, -0.238, 0.611, 1.742, -10.966, 2.498 ], "step_params": [ -0.917, -1.576, 3.258, -0.819, 6.257, 33.712 ], "heli_params": [ -3.615, 1.432, 2.947, 10.673, 1.397, 34.281 ], "bp2_params": [ -0.166, -0.171, 0.220, -8.246, -10.954, -2.800 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.258, "simple_Twist": 35.162, "simple_hRise": 2.963, "simple_hTwist": 35.707 }, { "index": 3, "nt1": "///A/71", "nt2": "///A/78", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.166, -0.171, 0.220, -8.246, -10.954, -2.800 ], "step_params": [ 0.543, -1.161, 3.269, -3.841, 7.999, 27.386 ], "heli_params": [ -4.023, -1.902, 2.728, 16.360, 7.855, 28.762 ], "bp2_params": [ -0.263, -0.453, 0.757, -6.847, -9.430, 0.412 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.269, "simple_Twist": 27.813, "simple_hRise": 2.739, "simple_hTwist": 29.167 }, { "index": 4, "nt1": "///A/72", "nt2": "///A/77", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 8, "helix_index": 5, "strand1": "CAATACCT", "strand2": "GTTATGGA", "bp_type": "||||||||", "helix_form": ".B.BBBB", "helical_rise": 3.325, "helical_rise_std": 0.331, "helical_radius": 9.849, "helical_radius_std": 0.584, "helical_axis": [ 0.250, 0.309, 0.918 ], "point1": [ -15.446, -19.834, 10.377 ], "point2": [ -9.591, -12.595, 31.891 ], "num_pairs": 8, "pairs": [ { "index": 1, "nt1": "c. C & i. \\-7", "nt2": "///D/7", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.400, -0.284, -0.230, 3.758, -20.627, 8.125 ], "step_params": [ -1.012, -0.571, 3.329, 0.365, 17.927, 33.938 ], "heli_params": [ -3.082, 1.588, 2.696, 28.389, -0.578, 38.260 ], "bp2_params": [ -0.340, 0.140, 0.076, 2.666, -5.350, 13.640 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.329, "simple_Twist": 37.842, "simple_hRise": 2.786, "simple_hTwist": 41.734 }, { "index": 2, "nt1": "c. C & i. \\-6", "nt2": "///D/6", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.340, 0.140, 0.076, 2.666, -5.350, 13.640 ], "step_params": [ -0.908, -0.052, 3.427, 0.804, 2.740, 32.599 ], "heli_params": [ -0.586, 1.756, 3.389, 4.869, -1.428, 32.721 ], "bp2_params": [ 0.139, 0.378, -0.193, -1.238, -14.571, 4.394 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.427, "simple_Twist": 29.951, "simple_hRise": 3.384, "simple_hTwist": 30.084 }, { "index": 3, "nt1": "c. C & i. \\-5", "nt2": "///D/5", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.139, 0.378, -0.193, -1.238, -14.571, 4.394 ], "step_params": [ 0.284, -0.883, 3.218, 0.687, 3.741, 29.515 ], "heli_params": [ -2.479, -0.414, 3.091, 7.304, -1.342, 29.754 ], "bp2_params": [ -0.126, -0.088, -0.176, -3.003, -8.663, 0.871 ], "groove_widths": [ 12.553, null, 17.928, null ], "simple_Rise": 3.218, "simple_Twist": 31.121, "simple_hRise": 3.099, "simple_hTwist": 31.346 }, { "index": 4, "nt1": "c. C & i. \\-4", "nt2": "///D/4", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.126, -0.088, -0.176, -3.003, -8.663, 0.871 ], "step_params": [ 0.289, 0.177, 3.411, -1.317, 6.679, 32.342 ], "heli_params": [ -0.873, -0.743, 3.365, 11.827, 2.333, 33.032 ], "bp2_params": [ 0.193, -0.044, -0.264, -3.847, -6.866, 4.965 ], "groove_widths": [ 13.145, 13.015, 19.080, 17.850 ], "simple_Rise": 3.411, "simple_Twist": 30.516, "simple_hRise": 3.358, "simple_hTwist": 31.249 }, { "index": 5, "nt1": "c. C & i. \\-3", "nt2": "///D/3", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.193, -0.044, -0.264, -3.847, -6.866, 4.965 ], "step_params": [ -0.370, -0.603, 3.232, -3.057, 0.873, 30.747 ], "heli_params": [ -1.299, 0.107, 3.235, 1.641, 5.747, 30.907 ], "bp2_params": [ 0.214, -0.183, 0.012, -3.508, -9.575, 1.337 ], "groove_widths": [ 14.326, null, 20.226, null ], "simple_Rise": 3.232, "simple_Twist": 30.579, "simple_hRise": 3.235, "simple_hTwist": 30.740 }, { "index": 6, "nt1": "c. C & i. \\-2", "nt2": "///D/2", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.214, -0.183, 0.012, -3.508, -9.575, 1.337 ], "step_params": [ 0.480, -0.662, 3.159, 0.832, 4.050, 36.703 ], "heli_params": [ -1.569, -0.651, 3.080, 6.407, -1.316, 36.927 ], "bp2_params": [ 0.186, -0.137, 0.073, -0.960, -4.956, 0.861 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.159, "simple_Twist": 36.884, "simple_hRise": 3.081, "simple_hTwist": 37.107 }, { "index": 7, "nt1": "c. C & i. \\-1", "nt2": "///D/1", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.186, -0.137, 0.073, -0.960, -4.956, 0.861 ], "step_params": [ 0.869, 0.802, 3.188, 5.169, 3.187, 30.838 ], "heli_params": [ 0.878, -0.626, 3.350, 5.920, -9.604, 31.416 ], "bp2_params": [ -0.111, -0.195, -0.152, 9.478, -0.087, 4.412 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.188, "simple_Twist": 32.545, "simple_hRise": 3.344, "simple_hTwist": 33.091 }, { "index": 8, "nt1": "///C/0", "nt2": "///D/0", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W" } ] } ], "num_isoCanonPairs": 1, "isoCanonPairs": [ { "index": -1, "helix_index": 3, "nt1": "///A/55", "nt2": "///A/58", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ], "num_coaxStacks": 1, "coaxStacks": [ { "index": 1, "helix_index": 1, "num_stems": 4, "stem_indices": [ 1, 2, 3, 4 ] } ], "num_stacks": 23, "stacks": [ { "index": 1, "num_nts": 2, "nts_short": "GG", "nts_long": "///A/0,///A/1" }, { "index": 2, "num_nts": 2, "nts_short": "AU", "nts_long": "///A/4,///A/5" }, { "index": 3, "num_nts": 2, "nts_short": "CG", "nts_long": "///A/20,///A/21" }, { "index": 4, "num_nts": 2, "nts_short": "AG", "nts_long": "///A/26,///A/27" }, { "index": 5, "num_nts": 2, "nts_short": "AG", "nts_long": "///A/32,///A/33" }, { "index": 6, "num_nts": 2, "nts_short": "UH", "nts_long": "///A/44,///B/328" }, { "index": 7, "num_nts": 2, "nts_short": "UY", "nts_long": "///A/50,///B/72" }, { "index": 8, "num_nts": 2, "nts_short": "UN", "nts_long": "///A/56,///B/459" }, { "index": 9, "num_nts": 2, "nts_short": "GC", "nts_long": "///A/58,///A/60" }, { "index": 10, "num_nts": 2, "nts_short": "AA", "nts_long": "///A/68,///A/69" }, { "index": 11, "num_nts": 2, "nts_short": "UG", "nts_long": "///A/72,///A/73" }, { "index": 12, "num_nts": 2, "nts_short": "GY", "nts_long": "///A/81,///B/1356" }, { "index": 13, "num_nts": 3, "nts_short": "CUU", "nts_long": "///A/8,///A/9,///A/10" }, { "index": 14, "num_nts": 3, "nts_short": "GGR", "nts_long": "///A/53,///A/62,///B/69" }, { "index": 15, "num_nts": 3, "nts_short": "GCA", "nts_long": "///A/54,///A/55,///A/57" }, { "index": 16, "num_nts": 3, "nts_short": "UAF", "nts_long": "///A/63,///A/51,///B/1105" }, { "index": 17, "num_nts": 3, "nts_short": "UAU", "nts_long": "///A/64,///A/65,///A/66" }, { "index": 18, "num_nts": 3, "nts_short": "ACG", "nts_long": "///C/11,///C/12,///C/13" }, { "index": 19, "num_nts": 3, "nts_short": "GGT", "nts_long": "///C/15,///C/16,///C/17" }, { "index": 20, "num_nts": 3, "nts_short": "CCA", "nts_long": "c. D & i. \\-2,c. D & i. \\-1,///D/0" }, { "index": 21, "num_nts": 4, "nts_short": "GAAG", "nts_long": "///A/29,///A/41,///A/42,///A/43" }, { "index": 22, "num_nts": 4, "nts_short": "AAAU", "nts_long": "///A/34,///A/35,///A/36,///A/37" }, { "index": 23, "num_nts": 4, "nts_short": "AAAA", "nts_long": "///A/74,///A/75,///A/76,///A/77" } ], "nonStack": { "num_nts": 4, "nts_short": "AAUC", "nts_long": "///A/28,///A/52,///A/59,c. C & i. \\-7" }, "num_atom2bases": 3, "atom2bases": [ { "index": 1, "type": "phosphate", "atom": "///A/35/OP2", "nt": "///A/33", "vert_dist": 2.900 }, { "index": 2, "type": "sugar", "atom": "///A/57/O4'", "nt": "///A/58", "vert_dist": 2.959 }, { "index": 3, "type": "phosphate", "atom": "///A/75/OP2", "nt": "///A/73", "vert_dist": 3.078 } ], "num_hairpins": 3, "hairpins": [ { "index": 1, "type": "hairpin loop", "bridging_nts": [ 4 ], "stem_indices": [ 5 ], "summary": "[1] 4 [A.32 A.37] 4", "num_nts": 6, "nts_short": "AGAAAU", "nts_long": "///A/32,///A/33,///A/34,///A/35,///A/36,///A/37", "num_stems": 1, "bridges": [ { "index": 1, "num_nts": 4, "nts_short": "GAAA", "nts_long": "///A/33,///A/34,///A/35,///A/36" } ] }, { "index": 2, "type": "hairpin loop", "bridging_nts": [ 2 ], "stem_indices": [ -1 ], "summary": "[1] 2 [A.55 A.58] 1", "num_nts": 4, "nts_short": "CUAG", "nts_long": "///A/55,///A/56,///A/57,///A/58", "num_stems": 1, "bridges": [ { "index": 1, "num_nts": 2, "nts_short": "UA", "nts_long": "///A/56,///A/57" } ] }, { "index": 3, "type": "hairpin loop", "bridging_nts": [ 4 ], "stem_indices": [ 7 ], "summary": "[1] 4 [A.72 A.77] 4", "num_nts": 6, "nts_short": "UGAAAA", "nts_long": "///A/72,///A/73,///A/74,///A/75,///A/76,///A/77", "num_stems": 1, "bridges": [ { "index": 1, "num_nts": 4, "nts_short": "GAAA", "nts_long": "///A/73,///A/74,///A/75,///A/76" } ] } ], "num_bulges": 1, "bulges": [ { "index": 1, "type": "bulge", "bridging_nts": [ 0, 1 ], "stem_indices": [ 6, -1 ], "summary": "[2] 0 1 [A.54 A.60 A.55 A.58] 2 1", "num_nts": 5, "nts_short": "GCGUC", "nts_long": "///A/54,///A/55,///A/58,///A/59,///A/60", "num_stems": 2, "bridges": [ { "index": 1, "num_nts": 0, "nts_short": "", "nts_long": "" }, { "index": 2, "num_nts": 1, "nts_short": "U", "nts_long": "///A/59" } ] } ], "num_iloops": 3, "iloops": [ { "index": 1, "type": "symmetric internal loop", "bridging_nts": [ 1, 1 ], "stem_indices": [ 1, 2 ], "summary": "[2] 1 1 [A.4 C.17 A.6 C.15] 4 3", "num_nts": 6, "nts_short": "AUCGGT", "nts_long": "///A/4,///A/5,///A/6,///C/15,///C/16,///C/17", "num_stems": 2, "bridges": [ { "index": 1, "num_nts": 1, "nts_short": "U", "nts_long": "///A/5" }, { "index": 2, "num_nts": 1, "nts_short": "G", "nts_long": "///C/16" } ] }, { "index": 2, "type": "symmetric internal loop", "bridging_nts": [ 1, 1 ], "stem_indices": [ 2, 3 ], "summary": "[2] 1 1 [A.8 C.13 A.10 C.11] 3 11", "num_nts": 6, "nts_short": "CUUACG", "nts_long": "///A/8,///A/9,///A/10,///C/11,///C/12,///C/13", "num_stems": 2, "bridges": [ { "index": 1, "num_nts": 1, "nts_short": "U", "nts_long": "///A/9" }, { "index": 2, "num_nts": 1, "nts_short": "C", "nts_long": "///C/12" } ] }, { "index": 3, "type": "asymmetric internal loop", "bridging_nts": [ 2, 4 ], "stem_indices": [ 4, 5 ], "summary": "[2] 2 4 [A.26 A.45 A.29 A.40] 6 4", "num_nts": 10, "nts_short": "AGAGCAAGUU", "nts_long": "///A/26,///A/27,///A/28,///A/29,///A/40,///A/41,///A/42,///A/43,///A/44,///A/45", "num_stems": 2, "bridges": [ { "index": 1, "num_nts": 2, "nts_short": "GA", "nts_long": "///A/27,///A/28" }, { "index": 2, "num_nts": 4, "nts_short": "AAGU", "nts_long": "///A/41,///A/42,///A/43,///A/44" } ] } ], "num_ssSegments": 5, "ssSegments": [ { "index": 1, "num_nts": 2, "nts_short": "GG", "nts_long": "c. A & i. \\-1,///A/0" }, { "index": 2, "num_nts": 2, "nts_short": "AA", "nts_long": "///A/51,///A/52" }, { "index": 3, "num_nts": 7, "nts_short": "GUUAUCA", "nts_long": "///A/62,///A/63,///A/64,///A/65,///A/66,///A/67,///A/68" }, { "index": 4, "num_nts": 2, "nts_short": "GA", "nts_long": "///A/81,///A/82" }, { "index": 5, "num_nts": 3, "nts_short": "ACC", "nts_long": "c. D & i. \\-3,c. D & i. \\-2,c. D & i. \\-1" } ], "num_Aminors": 1, "Aminors": [ { "index": 1, "type": "X", "desc_short": "A vs U-A (WC)", "desc_long": "///A/76 vs ///A/72,///A/77", "A_nt1": { "desc": "///A/76 vs ///A/72", "face_type": "-", "hbonds_num": 0, "hbonds_desc": "" }, "A_nt2": { "desc": "///A/76 vs ///A/77", "face_type": "+", "hbonds_num": 1, "hbonds_desc": "O2'(hydroxyl)-OP1[2.78]" } } ], "num_splayUnits": 8, "splayUnits": [ { "index": 1, "num_nts": 3, "nts_short": "GAG", "nts_long": "///A/27,///A/28,///A/29" }, { "index": 2, "num_nts": 2, "nts_short": "GA", "nts_long": "///A/33,///A/34" }, { "index": 3, "num_nts": 2, "nts_short": "UU", "nts_long": "///A/44,///A/45" }, { "index": 4, "num_nts": 2, "nts_short": "UA", "nts_long": "///A/50,///A/51" }, { "index": 5, "num_nts": 3, "nts_short": "GUC", "nts_long": "///A/58,///A/59,///A/60" }, { "index": 6, "num_nts": 2, "nts_short": "UU", "nts_long": "///A/63,///A/64" }, { "index": 7, "num_nts": 2, "nts_short": "CA", "nts_long": "///A/67,///A/68" }, { "index": 8, "num_nts": 2, "nts_short": "TG", "nts_long": "///C/0,///C/1" } ], "pseudoknot_order": 1, "pseudoknot_nts": [ { "index": 1, "symbols": "[]", "num_nts": 16, "nts_short": "CAATACCTAGGTATTG", "nts_long": "c. C & i. \\-7,c. C & i. \\-6,c. C & i. \\-5,c. C & i. \\-4,c. C & i. \\-3,c. C & i. \\-2,c. C & i. \\-1,///C/0,///D/0,///D/1,///D/2,///D/3,///D/4,///D/5,///D/6,///D/7" } ], "dbn": { "all_chains": { "num_nts": 123, "num_chars": 125, "bseq": "GGGGAAUCCCUUCUGCAGCACCGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGA&CAATACCTGGTGCTGCAGACGGGGTTCC&ACCAGGTATTG", "sstr": "..((((.(((.(((((((((((((((((..((((....))))....))))))..(((..).)).......((((....))))..&[[[[[[[[))))))))))).))).))))&...]]]]]]]]", "form": "-AAAAAAA.AAAAAAAA.AA..AA.AAA..AAA...A.AAAAAB..AA.AA...A......AA.......AAA.....AAA.--&.B.BBBB..AA.AAAAA..B.BAAAAA-&-.BBBBBBB.-" }, "chain_A": { "num_nts": 84, "num_chars": 84, "bseq": "GGGGAAUCCCUUCUGCAGCACCGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGA", "sstr": "..((((.(((.(((((((((((((((((..((((....))))....))))))..(((..).)).......((((....))))..", "form": "-AAAAAAA.AAAAAAAA.AA..AA.AAA..AAA...A.AAAAAB..AA.AA...A......AA.......AAA.....AAA.--" }, "chain_C": { "num_nts": 28, "num_chars": 28, "bseq": "CAATACCTGGTGCTGCAGACGGGGTTCC", "sstr": "[[[[[[[[))))))))))).))).))))", "form": ".B.BBBB..AA.AAAAA..B.BAAAAA-" }, "chain_D": { "num_nts": 11, "num_chars": 11, "bseq": "ACCAGGTATTG", "sstr": "...]]]]]]]]", "form": "-.BBBBBBB.-" } }, "chains": { "chain_A": { "num_nts": 84, "bseq": "GGGGAAUCCCUUCUGCAGCACCGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGA", "sstr": "..((((.(((.(((((((((((((((((..((((....))))....))))))..(((..).)).......((((....))))..", "form": "-AAAAAAA.AAAAAAAA.AA..AA.AAA..AAA...A.AAAAAB..AA.AA...A......AA.......AAA.....AAA.--", "helical_rise": 0.453, "helical_rise_std": 3.124, "helical_axis": [ -0.062, 0.365, -0.929 ], "point1": [ null, null, null ], "point2": [ null, null, null ], "num_chars": 250, "suite": "G__G1aG1aG1aA1aA1aU1aC1aC1eC1aU1aU!!C1aU1aG1aC1aA1aG!!C1aA1aC!!C1aG1aU1aU1aU1aU1aA1aG!!A!!G1aC1aU1aA!!G1gA1aA1aA1LU1aA1aG!!C1aA1aA1bG2[U2aU1aA1aA1aA1aA1aU!!A1aA1cG1aG1bC!!U2[A0aG!!U3aC1aC1aG3bU2aU1aA1aU1aC!!A1aA1aC1aU!!U!!G!!A!!A1aA!!A1LA1aG1aU1bG__A" }, "chain_C": { "num_nts": 28, "bseq": "CAATACCTGGTGCTGCAGACGGGGTTCC", "sstr": "[[[[[[[[))))))))))).))).))))", "form": ".B.BBBB..AA.AAAAA..B.BAAAAA-", "helical_rise": 2.563, "helical_rise_std": 1.190, "helical_axis": [ -0.332, 0.143, 0.932 ], "point1": [ 1.595, -5.694, 18.223 ], "point2": [ -21.330, 4.214, 82.599 ], "num_chars": 82, "suite": "C!!A!!A!!T!!A!!C1aC1bT2hG!!G1aT1aG1aC1aT1aG1aC1aA1aG1bA!!C!!G!!G!!G1aG1aT1aT!!C1aC" }, "chain_D": { "num_nts": 11, "bseq": "ACCAGGTATTG", "sstr": "...]]]]]]]]", "form": "-.BBBBBBB.-", "helical_rise": 3.444, "helical_rise_std": 0.294, "helical_axis": [ -0.152, -0.354, -0.923 ], "point1": [ null, null, null ], "point2": [ -13.891, -19.630, 9.318 ], "num_chars": 31, "suite": "A__C!!C!!A!!G!!G!!T1bA!!T!!T!!G" } }, "num_nts": 123, "nts": [ { "index": 1, "index_chain": 1, "chain_name": "A", "nt_resnum": -1, "nt_name": "G", "nt_code": "G", "nt_id": "c. A & i. \\-1", "linked_nts": [ null, "///A/0" ], "nt_type": "DNA", "dbn": ".", "summary": "non-stack,ss-non-loop", "alpha": null, "beta": null, "gamma": null, "delta": null, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": null, "glyco_bond": "--", "C5prime_xyz": [ null, null, null ], "P_xyz": [ null, null, null ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": null, "v1": null, "v2": null, "v3": null, "v4": null, "amplitude": null, "phase_angle": null, "puckering": "", "sugar_class": "--", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": null }, { "index": 2, "index_chain": 2, "chain_name": "A", "nt_resnum": 0, "nt_name": "G", "nt_code": "G", "nt_id": "///A/0", "linked_nts": [ "c. A & i. \\-1", "///A/1" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-pair-contact,ss-non-loop", "alpha": -70.494, "beta": -140.667, "gamma": 78.213, "delta": 83.140, "epsilon": -143.327, "zeta": -62.025, "epsilon_zeta": -81.302, "bb_type": "BI", "chi": -165.989, "glyco_bond": "anti", "C5prime_xyz": [ -0.998, 8.556, 0.870 ], "P_xyz": [ 1.570, 8.168, 1.258 ], "form": "A", "ssZp": 4.603, "Dp": 4.736, "splay_angle": 28.066, "splay_distance": 4.340, "splay_ratio": 0.244, "d22": null, "d64": null, "eta": null, "theta": -123.658, "eta_prime": null, "theta_prime": -122.967, "eta_base": null, "theta_base": -89.375, "v0": 7.887, "v1": -28.973, "v2": 37.984, "v3": -34.409, "v4": 16.751, "amplitude": 38.267, "phase_angle": 6.974, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.004, "frame": { "rmsd": 0.004, "origin": [ -28.588, 8.055, 77.512 ], "x_axis": [ 0.533, -0.166, 0.829 ], "y_axis": [ -0.016, -0.982, -0.186 ], "z_axis": [ 0.846, 0.086, -0.526 ], "quaternion": [ -0.078, 0.872, -0.052, 0.480 ] } }, { "index": 3, "index_chain": 3, "chain_name": "A", "nt_resnum": 1, "nt_name": "G", "nt_code": "G", "nt_id": "///A/1", "linked_nts": [ "///A/0", "///A/2" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,phosphate", "alpha": -68.560, "beta": 169.660, "gamma": 59.600, "delta": 77.634, "epsilon": -138.798, "zeta": -75.252, "epsilon_zeta": -63.546, "bb_type": "BI", "chi": -173.816, "glyco_bond": "anti", "C5prime_xyz": [ -1.350, 8.563, 1.307 ], "P_xyz": [ 1.242, 8.936, 1.445 ], "form": "A", "ssZp": 4.719, "Dp": 4.751, "splay_angle": 25.361, "splay_distance": 4.115, "splay_ratio": 0.229, "d22": null, "d64": null, "eta": 164.319, "theta": -141.202, "eta_prime": -174.395, "theta_prime": -139.528, "eta_base": -114.166, "theta_base": -117.225, "v0": 4.861, "v1": -28.020, "v2": 39.417, "v3": -37.640, "v4": 20.631, "amplitude": 40.272, "phase_angle": 11.821, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.871, "filter_rmsd": 0.004, "frame": { "rmsd": 0.004, "origin": [ -24.298, 8.402, 78.067 ], "x_axis": [ 0.284, -0.805, 0.521 ], "y_axis": [ -0.388, -0.593, -0.705 ], "z_axis": [ 0.877, -0.002, -0.481 ], "quaternion": [ -0.229, 0.768, -0.388, 0.455 ] } }, { "index": 4, "index_chain": 4, "chain_name": "A", "nt_resnum": 2, "nt_name": "G", "nt_code": "G", "nt_id": "///A/2", "linked_nts": [ "///A/1", "///A/3" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -54.502, "beta": 167.080, "gamma": 56.679, "delta": 76.895, "epsilon": -156.205, "zeta": -77.804, "epsilon_zeta": -78.401, "bb_type": "BI", "chi": -171.548, "glyco_bond": "anti", "C5prime_xyz": [ -1.814, 8.710, 1.157 ], "P_xyz": [ 0.676, 9.452, 1.449 ], "form": "A", "ssZp": 4.585, "Dp": 4.591, "splay_angle": 26.183, "splay_distance": 4.082, "splay_ratio": 0.230, "d22": null, "d64": null, "eta": 170.768, "theta": -158.416, "eta_prime": -172.948, "theta_prime": -156.675, "eta_base": -132.346, "theta_base": -136.302, "v0": -0.286, "v1": -23.791, "v2": 37.562, "v3": -38.743, "v4": 24.559, "amplitude": 39.725, "phase_angle": 18.996, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.826, "filter_rmsd": 0.006, "frame": { "rmsd": 0.006, "origin": [ -20.243, 8.489, 78.765 ], "x_axis": [ -0.025, -0.992, 0.123 ], "y_axis": [ -0.469, -0.097, -0.878 ], "z_axis": [ 0.883, -0.080, -0.463 ], "quaternion": [ -0.322, 0.620, -0.589, 0.406 ] } }, { "index": 5, "index_chain": 5, "chain_name": "A", "nt_resnum": 3, "nt_name": "A", "nt_code": "A", "nt_id": "///A/3", "linked_nts": [ "///A/2", "///A/4" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -57.278, "beta": -177.870, "gamma": 48.142, "delta": 81.820, "epsilon": -148.608, "zeta": -84.829, "epsilon_zeta": -63.779, "bb_type": "BI", "chi": -163.665, "glyco_bond": "anti", "C5prime_xyz": [ -1.349, 8.663, 0.780 ], "P_xyz": [ 1.139, 9.047, 1.512 ], "form": "A", "ssZp": 4.455, "Dp": 4.599, "splay_angle": 22.049, "splay_distance": 3.451, "splay_ratio": 0.192, "d22": null, "d64": null, "eta": 178.089, "theta": -155.647, "eta_prime": -176.004, "theta_prime": -153.596, "eta_base": -148.803, "theta_base": -137.393, "v0": 2.546, "v1": -24.256, "v2": 35.603, "v3": -35.163, "v4": 20.555, "amplitude": 36.822, "phase_angle": 14.783, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.840, "filter_rmsd": 0.037, "frame": { "rmsd": 0.003, "origin": [ -16.179, 8.409, 79.143 ], "x_axis": [ -0.351, -0.896, -0.273 ], "y_axis": [ -0.415, 0.410, -0.812 ], "z_axis": [ 0.840, -0.171, -0.515 ], "quaternion": [ 0.369, -0.434, 0.754, -0.326 ] } }, { "index": 6, "index_chain": 6, "chain_name": "A", "nt_resnum": 4, "nt_name": "A", "nt_code": "A", "nt_id": "///A/4", "linked_nts": [ "///A/3", "///A/5" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop,phosphate", "alpha": -53.962, "beta": 169.116, "gamma": 41.272, "delta": 80.560, "epsilon": -149.618, "zeta": -75.298, "epsilon_zeta": -74.319, "bb_type": "BI", "chi": -163.104, "glyco_bond": "anti", "C5prime_xyz": [ -1.246, 8.646, 0.707 ], "P_xyz": [ 1.321, 8.961, 1.117 ], "form": "A", "ssZp": 4.526, "Dp": 4.669, "splay_angle": 25.310, "splay_distance": 3.943, "splay_ratio": 0.221, "d22": null, "d64": null, "eta": 165.106, "theta": -147.436, "eta_prime": 172.947, "theta_prime": -145.155, "eta_base": -160.429, "theta_base": -119.774, "v0": 3.943, "v1": -26.181, "v2": 37.279, "v3": -36.014, "v4": 20.216, "amplitude": 38.232, "phase_angle": 12.819, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.637, "filter_rmsd": 0.036, "frame": { "rmsd": 0.004, "origin": [ -12.816, 7.647, 79.002 ], "x_axis": [ -0.623, -0.581, -0.524 ], "y_axis": [ -0.167, 0.753, -0.637 ], "z_axis": [ 0.764, -0.309, -0.566 ], "quaternion": [ 0.375, -0.218, 0.858, -0.276 ] } }, { "index": 7, "index_chain": 7, "chain_name": "A", "nt_resnum": 5, "nt_name": "U", "nt_code": "U", "nt_id": "///A/5", "linked_nts": [ "///A/4", "///A/6" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop,phosphate", "alpha": -55.898, "beta": 165.471, "gamma": 54.043, "delta": 79.447, "epsilon": -146.380, "zeta": -73.419, "epsilon_zeta": -72.961, "bb_type": "BI", "chi": -172.998, "glyco_bond": "anti", "C5prime_xyz": [ -1.527, 8.579, 1.286 ], "P_xyz": [ 1.034, 8.953, 1.695 ], "form": "A", "ssZp": 4.609, "Dp": 4.640, "splay_angle": 23.043, "splay_distance": 3.686, "splay_ratio": 0.205, "d22": 4.566, "d64": 4.502, "eta": 171.043, "theta": -144.285, "eta_prime": -174.845, "theta_prime": -142.306, "eta_base": -134.442, "theta_base": -119.056, "v0": 2.542, "v1": -25.237, "v2": 37.201, "v3": -36.767, "v4": 21.544, "amplitude": 38.501, "phase_angle": 14.931, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.900, "filter_rmsd": 0.106, "frame": { "rmsd": 0.004, "origin": [ -10.458, 4.923, 77.401 ], "x_axis": [ -0.735, -0.059, -0.675 ], "y_axis": [ 0.138, 0.962, -0.235 ], "z_axis": [ 0.664, -0.266, -0.699 ], "quaternion": [ 0.363, 0.021, 0.921, -0.136 ] } }, { "index": 8, "index_chain": 8, "chain_name": "A", "nt_resnum": 6, "nt_name": "C", "nt_code": "C", "nt_id": "///A/6", "linked_nts": [ "///A/5", "///A/7" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop,phosphate", "alpha": -64.636, "beta": -176.358, "gamma": 49.604, "delta": 82.644, "epsilon": -144.653, "zeta": -75.843, "epsilon_zeta": -68.811, "bb_type": "BI", "chi": -156.688, "glyco_bond": "anti", "C5prime_xyz": [ -1.361, 8.806, 0.358 ], "P_xyz": [ 1.134, 9.292, 0.997 ], "form": "A", "ssZp": 4.206, "Dp": 4.548, "splay_angle": 20.667, "splay_distance": 3.309, "splay_ratio": 0.179, "d22": 4.246, "d64": 3.897, "eta": 172.221, "theta": -145.470, "eta_prime": -177.728, "theta_prime": -142.924, "eta_base": -143.893, "theta_base": -108.951, "v0": 1.602, "v1": -23.297, "v2": 34.938, "v3": -35.026, "v4": 21.071, "amplitude": 36.379, "phase_angle": 16.180, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.932, "filter_rmsd": 0.063, "frame": { "rmsd": 0.006, "origin": [ -9.303, 2.256, 75.135 ], "x_axis": [ -0.631, 0.550, -0.548 ], "y_axis": [ 0.585, 0.801, 0.130 ], "z_axis": [ 0.510, -0.238, -0.827 ], "quaternion": [ 0.293, 0.314, 0.902, -0.030 ] } }, { "index": 9, "index_chain": 9, "chain_name": "A", "nt_resnum": 7, "nt_name": "C", "nt_code": "C", "nt_id": "///A/7", "linked_nts": [ "///A/6", "///A/8" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -66.158, "beta": 165.457, "gamma": 57.118, "delta": 80.059, "epsilon": -109.705, "zeta": -39.717, "epsilon_zeta": -69.988, "bb_type": "--", "chi": -153.646, "glyco_bond": "anti", "C5prime_xyz": [ -1.270, 8.795, 0.153 ], "P_xyz": [ 1.304, 9.116, -0.161 ], "form": ".", "ssZp": 3.909, "Dp": 4.754, "splay_angle": 21.322, "splay_distance": 3.956, "splay_ratio": 0.195, "d22": 3.919, "d64": 5.181, "eta": 172.106, "theta": -110.005, "eta_prime": -176.714, "theta_prime": -119.051, "eta_base": -134.136, "theta_base": -113.712, "v0": 3.618, "v1": -26.233, "v2": 37.624, "v3": -36.538, "v4": 20.762, "amplitude": 38.667, "phase_angle": 13.336, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.942, "filter_rmsd": 0.064, "frame": { "rmsd": 0.003, "origin": [ -8.708, 1.665, 71.934 ], "x_axis": [ -0.216, 0.923, -0.318 ], "y_axis": [ 0.905, 0.311, 0.288 ], "z_axis": [ 0.365, -0.226, -0.903 ], "quaternion": [ 0.219, 0.586, 0.780, 0.020 ] } }, { "index": 10, "index_chain": 10, "chain_name": "A", "nt_resnum": 8, "nt_name": "C", "nt_code": "C", "nt_id": "///A/8", "linked_nts": [ "///A/7", "///A/9" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop", "alpha": -100.115, "beta": 88.150, "gamma": 166.234, "delta": 80.755, "epsilon": -135.984, "zeta": -77.867, "epsilon_zeta": -58.118, "bb_type": "BI", "chi": -174.115, "glyco_bond": "anti", "C5prime_xyz": [ -1.549, 8.618, 1.327 ], "P_xyz": [ -1.900, 10.601, -0.348 ], "form": "A", "ssZp": 4.530, "Dp": 4.615, "splay_angle": 23.009, "splay_distance": 3.671, "splay_ratio": 0.202, "d22": 4.228, "d64": 4.084, "eta": -167.567, "theta": 159.756, "eta_prime": -161.559, "theta_prime": -178.928, "eta_base": -138.230, "theta_base": -135.132, "v0": 0.722, "v1": -23.250, "v2": 35.713, "v3": -36.363, "v4": 22.406, "amplitude": 37.460, "phase_angle": 17.568, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1e", "suiteness": 0.010, "filter_rmsd": 0.065, "frame": { "rmsd": 0.005, "origin": [ -9.428, 2.312, 68.098 ], "x_axis": [ -0.057, 0.986, -0.157 ], "y_axis": [ 0.961, 0.097, 0.259 ], "z_axis": [ 0.271, -0.136, -0.953 ], "quaternion": [ 0.147, 0.671, 0.726, 0.043 ] } }, { "index": 11, "index_chain": 11, "chain_name": "A", "nt_resnum": 9, "nt_name": "U", "nt_code": "U", "nt_id": "///A/9", "linked_nts": [ "///A/8", "///A/10" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop", "alpha": -51.621, "beta": 167.899, "gamma": 48.209, "delta": 82.536, "epsilon": -142.711, "zeta": -80.041, "epsilon_zeta": -62.670, "bb_type": "BI", "chi": -155.526, "glyco_bond": "anti", "C5prime_xyz": [ -1.544, 8.802, 0.244 ], "P_xyz": [ 1.006, 9.305, 0.612 ], "form": "A", "ssZp": 4.106, "Dp": 4.504, "splay_angle": 20.870, "splay_distance": 3.369, "splay_ratio": 0.181, "d22": 4.325, "d64": 4.083, "eta": 170.018, "theta": -144.481, "eta_prime": -173.303, "theta_prime": -142.225, "eta_base": -124.488, "theta_base": -109.864, "v0": -1.106, "v1": -20.965, "v2": 33.802, "v3": -35.361, "v4": 22.967, "amplitude": 36.039, "phase_angle": 20.293, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.767, "filter_rmsd": 0.103, "frame": { "rmsd": 0.006, "origin": [ -9.658, 3.363, 64.588 ], "x_axis": [ 0.556, 0.823, 0.117 ], "y_axis": [ 0.796, -0.567, 0.211 ], "z_axis": [ 0.240, -0.024, -0.970 ], "quaternion": [ 0.067, 0.879, 0.460, 0.102 ] } }, { "index": 12, "index_chain": 12, "chain_name": "A", "nt_resnum": 10, "nt_name": "U", "nt_code": "U", "nt_id": "///A/10", "linked_nts": [ "///A/9", "///A/11" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop", "alpha": -60.258, "beta": 156.754, "gamma": 64.685, "delta": 83.738, "epsilon": -158.060, "zeta": -57.403, "epsilon_zeta": -100.657, "bb_type": "BI", "chi": -149.331, "glyco_bond": "anti", "C5prime_xyz": [ -1.693, 8.811, -0.128 ], "P_xyz": [ 0.838, 9.251, -0.668 ], "form": "A", "ssZp": 3.964, "Dp": 4.388, "splay_angle": 21.474, "splay_distance": 3.626, "splay_ratio": 0.188, "d22": 4.139, "d64": 4.348, "eta": 168.679, "theta": -135.625, "eta_prime": -171.683, "theta_prime": -144.220, "eta_base": -125.827, "theta_base": -120.466, "v0": -0.379, "v1": -20.680, "v2": 32.573, "v3": -33.718, "v4": 21.545, "amplitude": 34.497, "phase_angle": 19.226, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.688, "filter_rmsd": 0.104, "frame": { "rmsd": 0.007, "origin": [ -8.671, 4.508, 61.577 ], "x_axis": [ 0.895, 0.387, 0.221 ], "y_axis": [ 0.409, -0.911, -0.059 ], "z_axis": [ 0.178, 0.143, -0.973 ], "quaternion": [ -0.052, 0.972, 0.205, 0.103 ] } }, { "index": 13, "index_chain": 13, "chain_name": "A", "nt_resnum": 11, "nt_name": "C", "nt_code": "C", "nt_id": "///A/11", "linked_nts": [ "///A/10", "///A/12" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -110.018, "beta": 160.028, "gamma": 102.617, "delta": 80.049, "epsilon": -150.657, "zeta": -82.018, "epsilon_zeta": -68.639, "bb_type": "BI", "chi": -164.520, "glyco_bond": "anti", "C5prime_xyz": [ -1.869, 8.842, 0.686 ], "P_xyz": [ 0.280, 9.886, -0.384 ], "form": "A", "ssZp": 4.334, "Dp": 4.479, "splay_angle": 23.193, "splay_distance": 3.717, "splay_ratio": 0.202, "d22": 4.677, "d64": 4.625, "eta": 162.355, "theta": -162.731, "eta_prime": -177.147, "theta_prime": -166.915, "eta_base": -133.092, "theta_base": -147.852, "v0": -3.289, "v1": -20.296, "v2": 34.758, "v3": -37.631, "v4": 25.731, "amplitude": 37.881, "phase_angle": 23.429, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.060, "frame": { "rmsd": 0.005, "origin": [ -7.371, 6.336, 58.729 ], "x_axis": [ 0.969, -0.120, 0.216 ], "y_axis": [ -0.060, -0.962, -0.266 ], "z_axis": [ 0.240, 0.245, -0.939 ], "quaternion": [ -0.130, 0.984, -0.046, 0.116 ] } }, { "index": 14, "index_chain": 14, "chain_name": "A", "nt_resnum": 12, "nt_name": "U", "nt_code": "U", "nt_id": "///A/12", "linked_nts": [ "///A/11", "///A/13" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -69.729, "beta": 167.442, "gamma": 63.011, "delta": 80.307, "epsilon": -142.072, "zeta": -75.719, "epsilon_zeta": -66.353, "bb_type": "BI", "chi": -163.250, "glyco_bond": "anti", "C5prime_xyz": [ -1.520, 8.768, 0.684 ], "P_xyz": [ 1.039, 9.319, 0.658 ], "form": "A", "ssZp": 4.394, "Dp": 4.594, "splay_angle": 21.463, "splay_distance": 3.498, "splay_ratio": 0.189, "d22": null, "d64": null, "eta": 169.804, "theta": -143.338, "eta_prime": 178.451, "theta_prime": -144.538, "eta_base": -151.255, "theta_base": -118.320, "v0": -0.235, "v1": -22.907, "v2": 36.045, "v3": -37.180, "v4": 23.545, "amplitude": 38.106, "phase_angle": 18.933, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.783, "filter_rmsd": 0.103, "frame": { "rmsd": 0.003, "origin": [ -6.620, 8.797, 56.047 ], "x_axis": [ 0.813, -0.572, 0.113 ], "y_axis": [ -0.496, -0.781, -0.380 ], "z_axis": [ 0.305, 0.252, -0.918 ], "quaternion": [ -0.169, 0.937, -0.285, 0.112 ] } }, { "index": 15, "index_chain": 15, "chain_name": "A", "nt_resnum": 13, "nt_name": "G", "nt_code": "G", "nt_id": "///A/13", "linked_nts": [ "///A/12", "///A/14" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -62.413, "beta": 166.477, "gamma": 50.343, "delta": 75.623, "epsilon": -150.293, "zeta": -76.976, "epsilon_zeta": -73.317, "bb_type": "BI", "chi": -163.508, "glyco_bond": "anti", "C5prime_xyz": [ -1.705, 8.783, 0.666 ], "P_xyz": [ 0.807, 9.495, 0.724 ], "form": "A", "ssZp": 4.514, "Dp": 4.668, "splay_angle": 24.857, "splay_distance": 4.050, "splay_ratio": 0.221, "d22": null, "d64": null, "eta": 158.875, "theta": -153.284, "eta_prime": 173.559, "theta_prime": -152.200, "eta_base": -142.498, "theta_base": -132.574, "v0": 0.317, "v1": -24.776, "v2": 38.620, "v3": -39.485, "v4": 24.656, "amplitude": 40.651, "phase_angle": 18.186, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.884, "filter_rmsd": 0.009, "frame": { "rmsd": 0.009, "origin": [ -4.154, 9.939, 53.845 ], "x_axis": [ 0.374, -0.927, 0.033 ], "y_axis": [ -0.821, -0.347, -0.453 ], "z_axis": [ 0.432, 0.142, -0.891 ], "quaternion": [ -0.184, 0.808, -0.541, 0.144 ] } }, { "index": 16, "index_chain": 16, "chain_name": "A", "nt_resnum": 14, "nt_name": "C", "nt_code": "C", "nt_id": "///A/14", "linked_nts": [ "///A/13", "///A/15" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -52.170, "beta": 170.693, "gamma": 50.702, "delta": 75.190, "epsilon": -153.938, "zeta": -81.107, "epsilon_zeta": -72.830, "bb_type": "BI", "chi": -163.520, "glyco_bond": "anti", "C5prime_xyz": [ -1.677, 8.835, 0.692 ], "P_xyz": [ 0.819, 9.554, 0.921 ], "form": "A", "ssZp": 4.520, "Dp": 4.632, "splay_angle": 25.056, "splay_distance": 3.921, "splay_ratio": 0.219, "d22": null, "d64": null, "eta": 172.342, "theta": -160.437, "eta_prime": -177.261, "theta_prime": -158.686, "eta_base": -145.501, "theta_base": -137.564, "v0": -0.778, "v1": -24.067, "v2": 38.434, "v3": -39.941, "v4": 25.616, "amplitude": 40.814, "phase_angle": 19.664, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.749, "filter_rmsd": 0.060, "frame": { "rmsd": 0.006, "origin": [ -0.713, 10.397, 51.758 ], "x_axis": [ -0.087, -0.993, -0.074 ], "y_axis": [ -0.888, 0.111, -0.446 ], "z_axis": [ 0.451, 0.027, -0.892 ], "quaternion": [ 0.182, -0.651, 0.723, -0.145 ] } }, { "index": 17, "index_chain": 17, "chain_name": "A", "nt_resnum": 15, "nt_name": "A", "nt_code": "A", "nt_id": "///A/15", "linked_nts": [ "///A/14", "///A/16" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -53.766, "beta": 164.896, "gamma": 56.320, "delta": 79.161, "epsilon": -151.126, "zeta": -71.804, "epsilon_zeta": -79.322, "bb_type": "BI", "chi": -168.485, "glyco_bond": "anti", "C5prime_xyz": [ -1.497, 8.648, 1.017 ], "P_xyz": [ 1.072, 9.087, 1.140 ], "form": "A", "ssZp": 4.587, "Dp": 4.639, "splay_angle": 23.274, "splay_distance": 3.777, "splay_ratio": 0.208, "d22": null, "d64": null, "eta": 174.394, "theta": -145.893, "eta_prime": -175.508, "theta_prime": -146.683, "eta_base": -143.782, "theta_base": -126.383, "v0": 2.630, "v1": -25.547, "v2": 37.524, "v3": -37.019, "v4": 21.676, "amplitude": 38.812, "phase_angle": 14.803, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.768, "filter_rmsd": 0.038, "frame": { "rmsd": 0.005, "origin": [ 2.429, 10.127, 49.427 ], "x_axis": [ -0.488, -0.845, -0.217 ], "y_axis": [ -0.763, 0.534, -0.363 ], "z_axis": [ 0.423, -0.011, -0.906 ], "quaternion": [ 0.187, -0.470, 0.856, -0.110 ] } }, { "index": 18, "index_chain": 18, "chain_name": "A", "nt_resnum": 16, "nt_name": "G", "nt_code": "G", "nt_id": "///A/16", "linked_nts": [ "///A/15", "///A/17" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -59.297, "beta": 172.611, "gamma": 53.347, "delta": 77.870, "epsilon": -153.849, "zeta": -48.424, "epsilon_zeta": -105.425, "bb_type": "BI", "chi": -165.831, "glyco_bond": "anti", "C5prime_xyz": [ -1.586, 8.812, 0.822 ], "P_xyz": [ 0.917, 9.427, 1.221 ], "form": ".", "ssZp": 4.464, "Dp": 4.566, "splay_angle": 23.363, "splay_distance": 4.280, "splay_ratio": 0.221, "d22": null, "d64": null, "eta": 171.335, "theta": -128.069, "eta_prime": -175.830, "theta_prime": -137.069, "eta_base": -139.947, "theta_base": -122.934, "v0": -1.501, "v1": -22.175, "v2": 36.271, "v3": -38.213, "v4": 25.000, "amplitude": 38.815, "phase_angle": 20.860, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.942, "filter_rmsd": 0.005, "frame": { "rmsd": 0.005, "origin": [ 4.936, 8.391, 47.199 ], "x_axis": [ -0.831, -0.461, -0.311 ], "y_axis": [ -0.402, 0.884, -0.237 ], "z_axis": [ 0.385, -0.072, -0.920 ], "quaternion": [ 0.183, -0.226, 0.953, -0.081 ] } }, { "index": 19, "index_chain": 19, "chain_name": "A", "nt_resnum": 17, "nt_name": "C", "nt_code": "C", "nt_id": "///A/17", "linked_nts": [ "///A/16", "///A/18" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -148.742, "beta": 153.922, "gamma": 141.344, "delta": 75.167, "epsilon": -139.139, "zeta": -89.474, "epsilon_zeta": -49.664, "bb_type": "BI", "chi": -177.519, "glyco_bond": "anti", "C5prime_xyz": [ -1.639, 8.599, 1.558 ], "P_xyz": [ -0.255, 10.545, 0.529 ], "form": "A", "ssZp": 4.691, "Dp": 4.688, "splay_angle": 28.121, "splay_distance": 4.331, "splay_ratio": 0.245, "d22": null, "d64": null, "eta": 162.645, "theta": -179.642, "eta_prime": 176.589, "theta_prime": -172.227, "eta_base": -150.539, "theta_base": -143.998, "v0": 0.317, "v1": -24.474, "v2": 38.324, "v3": -39.214, "v4": 24.401, "amplitude": 40.347, "phase_angle": 18.220, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.065, "frame": { "rmsd": 0.008, "origin": [ 6.199, 5.293, 44.530 ], "x_axis": [ -0.956, -0.057, -0.288 ], "y_axis": [ -0.011, 0.987, -0.159 ], "z_axis": [ 0.293, -0.149, -0.944 ], "quaternion": [ 0.147, -0.017, 0.986, -0.078 ] } }, { "index": 20, "index_chain": 20, "chain_name": "A", "nt_resnum": 18, "nt_name": "A", "nt_code": "A", "nt_id": "///A/18", "linked_nts": [ "///A/17", "///A/19" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -40.777, "beta": 157.603, "gamma": 53.337, "delta": 79.065, "epsilon": -145.444, "zeta": -72.598, "epsilon_zeta": -72.846, "bb_type": "BI", "chi": -169.008, "glyco_bond": "anti", "C5prime_xyz": [ -1.413, 8.642, 1.055 ], "P_xyz": [ 1.159, 8.978, 1.211 ], "form": "A", "ssZp": 4.533, "Dp": 4.628, "splay_angle": 22.789, "splay_distance": 3.697, "splay_ratio": 0.203, "d22": null, "d64": null, "eta": 179.642, "theta": -142.654, "eta_prime": -168.057, "theta_prime": -142.805, "eta_base": -133.519, "theta_base": -120.537, "v0": 2.115, "v1": -25.165, "v2": 37.470, "v3": -37.300, "v4": 22.141, "amplitude": 38.900, "phase_angle": 15.583, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.401, "filter_rmsd": 0.038, "frame": { "rmsd": 0.006, "origin": [ 6.965, 2.747, 41.110 ], "x_axis": [ -0.804, 0.432, -0.408 ], "y_axis": [ 0.452, 0.891, 0.052 ], "z_axis": [ 0.386, -0.142, -0.912 ], "quaternion": [ 0.209, 0.233, 0.950, -0.024 ] } }, { "index": 21, "index_chain": 21, "chain_name": "A", "nt_resnum": 19, "nt_name": "C", "nt_code": "C", "nt_id": "///A/19", "linked_nts": [ "///A/18", "///A/20" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -63.101, "beta": 172.499, "gamma": 57.653, "delta": 78.599, "epsilon": -147.719, "zeta": -54.847, "epsilon_zeta": -92.872, "bb_type": "BI", "chi": -157.023, "glyco_bond": "anti", "C5prime_xyz": [ -1.479, 8.860, 0.307 ], "P_xyz": [ 1.055, 9.478, 0.232 ], "form": ".", "ssZp": 4.290, "Dp": 4.604, "splay_angle": 22.926, "splay_distance": 4.048, "splay_ratio": 0.210, "d22": 4.309, "d64": 5.214, "eta": 170.123, "theta": -136.063, "eta_prime": -175.958, "theta_prime": -141.515, "eta_base": -138.419, "theta_base": -126.273, "v0": 0.208, "v1": -24.208, "v2": 37.683, "v3": -38.570, "v4": 24.101, "amplitude": 39.680, "phase_angle": 18.255, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.949, "filter_rmsd": 0.062, "frame": { "rmsd": 0.002, "origin": [ 6.611, 1.092, 37.824 ], "x_axis": [ -0.438, 0.827, -0.351 ], "y_axis": [ 0.848, 0.510, 0.144 ], "z_axis": [ 0.298, -0.235, -0.925 ], "quaternion": [ 0.191, 0.494, 0.848, -0.027 ] } }, { "index": 22, "index_chain": 22, "chain_name": "A", "nt_resnum": 20, "nt_name": "C", "nt_code": "C", "nt_id": "///A/20", "linked_nts": [ "///A/19", "///A/21" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,phosphate", "alpha": -114.021, "beta": 146.031, "gamma": 123.641, "delta": 74.065, "epsilon": -136.685, "zeta": -69.391, "epsilon_zeta": -67.294, "bb_type": "BI", "chi": -176.095, "glyco_bond": "anti", "C5prime_xyz": [ -1.616, 8.687, 1.433 ], "P_xyz": [ -0.019, 10.311, 0.141 ], "form": ".", "ssZp": 4.679, "Dp": 4.698, "splay_angle": 30.792, "splay_distance": 4.728, "splay_ratio": 0.267, "d22": null, "d64": null, "eta": 169.472, "theta": -154.307, "eta_prime": -174.823, "theta_prime": -149.526, "eta_base": -140.438, "theta_base": -102.235, "v0": -0.436, "v1": -24.830, "v2": 39.567, "v3": -40.766, "v4": 25.858, "amplitude": 41.879, "phase_angle": 19.126, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.064, "frame": { "rmsd": 0.004, "origin": [ 5.299, 0.316, 34.073 ], "x_axis": [ -0.091, 0.958, -0.272 ], "y_axis": [ 0.972, 0.144, 0.184 ], "z_axis": [ 0.215, -0.248, -0.945 ], "quaternion": [ 0.165, 0.654, 0.738, -0.022 ] } }, { "index": 23, "index_chain": 23, "chain_name": "A", "nt_resnum": 21, "nt_name": "G", "nt_code": "G", "nt_id": "///A/21", "linked_nts": [ "///A/20", "///A/22" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack", "alpha": -55.506, "beta": 170.358, "gamma": 54.176, "delta": 83.028, "epsilon": -132.684, "zeta": -78.921, "epsilon_zeta": -53.763, "bb_type": "BI", "chi": -169.157, "glyco_bond": "anti", "C5prime_xyz": [ -1.453, 8.655, 1.077 ], "P_xyz": [ 1.099, 8.932, 1.564 ], "form": "A", "ssZp": 4.500, "Dp": 4.635, "splay_angle": 24.940, "splay_distance": 3.931, "splay_ratio": 0.216, "d22": null, "d64": null, "eta": 174.238, "theta": -134.813, "eta_prime": -166.256, "theta_prime": -131.778, "eta_base": -103.814, "theta_base": -92.728, "v0": 1.970, "v1": -23.777, "v2": 35.366, "v3": -35.238, "v4": 20.938, "amplitude": 36.722, "phase_angle": 15.618, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.769, "filter_rmsd": 0.003, "frame": { "rmsd": 0.003, "origin": [ 5.627, 2.460, 29.873 ], "x_axis": [ 0.671, 0.739, 0.058 ], "y_axis": [ 0.677, -0.643, 0.357 ], "z_axis": [ 0.301, -0.200, -0.932 ], "quaternion": [ 0.155, 0.901, 0.393, 0.099 ] } }, { "index": 24, "index_chain": 24, "chain_name": "A", "nt_resnum": 22, "nt_name": "U", "nt_code": "U", "nt_id": "///A/22", "linked_nts": [ "///A/21", "///A/23" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -57.098, "beta": 158.359, "gamma": 56.770, "delta": 81.792, "epsilon": -136.456, "zeta": -86.235, "epsilon_zeta": -50.221, "bb_type": "BI", "chi": -166.515, "glyco_bond": "anti", "C5prime_xyz": [ -1.606, 8.703, 0.903 ], "P_xyz": [ 0.978, 9.094, 1.048 ], "form": "A", "ssZp": 4.433, "Dp": 4.606, "splay_angle": 20.469, "splay_distance": 3.238, "splay_ratio": 0.178, "d22": 4.164, "d64": 3.911, "eta": 167.473, "theta": -144.668, "eta_prime": -173.695, "theta_prime": -144.100, "eta_base": -117.839, "theta_base": -113.030, "v0": 0.496, "v1": -22.524, "v2": 34.724, "v3": -35.418, "v4": 22.027, "amplitude": 36.481, "phase_angle": 17.855, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.760, "filter_rmsd": 0.104, "frame": { "rmsd": 0.007, "origin": [ 7.696, 3.556, 26.715 ], "x_axis": [ 0.901, 0.143, 0.409 ], "y_axis": [ 0.064, -0.977, 0.201 ], "z_axis": [ 0.428, -0.155, -0.890 ], "quaternion": [ 0.092, 0.971, 0.053, 0.216 ] } }, { "index": 25, "index_chain": 25, "chain_name": "A", "nt_resnum": 23, "nt_name": "U", "nt_code": "U", "nt_id": "///A/23", "linked_nts": [ "///A/22", "///A/24" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -57.008, "beta": 153.625, "gamma": 56.823, "delta": 82.643, "epsilon": -115.604, "zeta": -96.462, "epsilon_zeta": -19.142, "bb_type": "--", "chi": -161.266, "glyco_bond": "anti", "C5prime_xyz": [ -1.642, 8.742, 0.599 ], "P_xyz": [ 0.943, 9.094, 0.462 ], "form": ".", "ssZp": 4.199, "Dp": 4.640, "splay_angle": 24.979, "splay_distance": 4.016, "splay_ratio": 0.217, "d22": 4.531, "d64": 3.774, "eta": 173.236, "theta": -141.934, "eta_prime": -174.185, "theta_prime": -141.846, "eta_base": -131.209, "theta_base": -121.649, "v0": 0.516, "v1": -22.427, "v2": 34.518, "v3": -35.218, "v4": 21.872, "amplitude": 36.257, "phase_angle": 17.819, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.677, "filter_rmsd": 0.107, "frame": { "rmsd": 0.005, "origin": [ 9.745, 4.023, 24.252 ], "x_axis": [ 0.754, -0.428, 0.498 ], "y_axis": [ -0.403, -0.900, -0.164 ], "z_axis": [ 0.519, -0.077, -0.852 ], "quaternion": [ -0.023, 0.936, -0.222, 0.271 ] } }, { "index": 26, "index_chain": 26, "chain_name": "A", "nt_resnum": 24, "nt_name": "U", "nt_code": "U", "nt_id": "///A/24", "linked_nts": [ "///A/23", "///A/25" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -82.032, "beta": 153.414, "gamma": 67.181, "delta": 82.738, "epsilon": -153.548, "zeta": -70.144, "epsilon_zeta": -83.404, "bb_type": "BI", "chi": -161.371, "glyco_bond": "anti", "C5prime_xyz": [ -1.480, 8.687, 0.622 ], "P_xyz": [ 1.065, 8.961, 0.085 ], "form": "A", "ssZp": 4.405, "Dp": 4.572, "splay_angle": 20.226, "splay_distance": 3.211, "splay_ratio": 0.177, "d22": 4.102, "d64": 4.067, "eta": 150.706, "theta": -140.879, "eta_prime": 166.159, "theta_prime": -146.622, "eta_base": -158.731, "theta_base": -118.843, "v0": 3.312, "v1": -25.213, "v2": 36.289, "v3": -35.352, "v4": 20.212, "amplitude": 37.337, "phase_angle": 13.609, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.180, "filter_rmsd": 0.103, "frame": { "rmsd": 0.006, "origin": [ 12.382, 3.800, 21.232 ], "x_axis": [ 0.152, -0.718, 0.679 ], "y_axis": [ -0.686, -0.571, -0.450 ], "z_axis": [ 0.711, -0.398, -0.579 ], "quaternion": [ -0.017, 0.759, -0.463, 0.458 ] } }, { "index": 27, "index_chain": 27, "chain_name": "A", "nt_resnum": 25, "nt_name": "U", "nt_code": "U", "nt_id": "///A/25", "linked_nts": [ "///A/24", "///A/26" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -64.652, "beta": 166.959, "gamma": 57.734, "delta": 80.611, "epsilon": -151.279, "zeta": -71.030, "epsilon_zeta": -80.249, "bb_type": "BI", "chi": -160.099, "glyco_bond": "anti", "C5prime_xyz": [ -1.512, 8.735, 0.526 ], "P_xyz": [ 1.069, 9.205, 0.457 ], "form": "A", "ssZp": 4.407, "Dp": 4.600, "splay_angle": 21.168, "splay_distance": 3.428, "splay_ratio": 0.187, "d22": null, "d64": null, "eta": 166.636, "theta": -144.564, "eta_prime": -176.928, "theta_prime": -147.219, "eta_base": -128.269, "theta_base": -127.257, "v0": 2.161, "v1": -24.468, "v2": 36.275, "v3": -36.050, "v4": 21.362, "amplitude": 37.629, "phase_angle": 15.415, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.942, "filter_rmsd": 0.103, "frame": { "rmsd": 0.003, "origin": [ 15.292, 2.501, 20.832 ], "x_axis": [ -0.247, -0.923, 0.294 ], "y_axis": [ -0.561, -0.111, -0.820 ], "z_axis": [ 0.790, -0.367, -0.490 ], "quaternion": [ 0.195, -0.582, 0.638, -0.466 ] } }, { "index": 28, "index_chain": 28, "chain_name": "A", "nt_resnum": 26, "nt_name": "A", "nt_code": "A", "nt_id": "///A/26", "linked_nts": [ "///A/25", "///A/27" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,internal-loop,phosphate", "alpha": -66.838, "beta": 178.956, "gamma": 44.146, "delta": 78.473, "epsilon": -141.977, "zeta": -77.321, "epsilon_zeta": -64.656, "bb_type": "BI", "chi": -162.195, "glyco_bond": "anti", "C5prime_xyz": [ -1.540, 8.714, 0.625 ], "P_xyz": [ 0.943, 9.379, 1.128 ], "form": "A", "ssZp": 4.460, "Dp": 4.684, "splay_angle": 21.962, "splay_distance": 3.658, "splay_ratio": 0.198, "d22": null, "d64": null, "eta": 161.085, "theta": -147.251, "eta_prime": 170.618, "theta_prime": -142.861, "eta_base": -154.226, "theta_base": -120.394, "v0": 2.011, "v1": -25.613, "v2": 38.258, "v3": -38.133, "v4": 22.649, "amplitude": 39.746, "phase_angle": 15.728, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.825, "filter_rmsd": 0.038, "frame": { "rmsd": 0.008, "origin": [ 18.320, 0.893, 20.820 ], "x_axis": [ -0.716, -0.697, -0.026 ], "y_axis": [ -0.305, 0.347, -0.887 ], "z_axis": [ 0.627, -0.627, -0.461 ], "quaternion": [ 0.206, -0.315, 0.794, -0.477 ] } }, { "index": 29, "index_chain": 29, "chain_name": "A", "nt_resnum": 27, "nt_name": "G", "nt_code": "G", "nt_id": "///A/27", "linked_nts": [ "///A/26", "///A/28" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-pair-contact,internal-loop,phosphate,splayed-apart", "alpha": -55.706, "beta": 167.549, "gamma": 53.393, "delta": 79.060, "epsilon": -155.450, "zeta": 105.439, "epsilon_zeta": 99.111, "bb_type": "--", "chi": -156.926, "glyco_bond": "anti", "C5prime_xyz": [ -1.980, 8.859, 0.241 ], "P_xyz": [ 0.477, 9.740, 0.118 ], "form": ".", "ssZp": 4.323, "Dp": 4.531, "splay_angle": 157.193, "splay_distance": 18.402, "splay_ratio": 0.980, "d22": null, "d64": null, "eta": 168.809, "theta": 20.407, "eta_prime": -176.827, "theta_prime": 15.635, "eta_base": -143.409, "theta_base": 23.863, "v0": -4.703, "v1": -18.741, "v2": 33.685, "v3": -37.364, "v4": 26.461, "amplitude": 37.368, "phase_angle": 25.652, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.882, "filter_rmsd": 0.011, "frame": { "rmsd": 0.011, "origin": [ 19.817, -2.441, 20.979 ], "x_axis": [ -0.863, -0.356, -0.357 ], "y_axis": [ 0.136, 0.518, -0.844 ], "z_axis": [ 0.486, -0.778, -0.399 ], "quaternion": [ 0.253, -0.066, 0.834, -0.487 ] } }, { "index": 30, "index_chain": 30, "chain_name": "A", "nt_resnum": 28, "nt_name": "A", "nt_code": "A", "nt_id": "///A/28", "linked_nts": [ "///A/27", "///A/29" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,anti,~C2'-endo,non-stack,internal-loop,splayed-apart", "alpha": -52.248, "beta": -164.877, "gamma": 44.160, "delta": 147.665, "epsilon": -102.907, "zeta": -108.215, "epsilon_zeta": 5.308, "bb_type": "--", "chi": -89.343, "glyco_bond": "anti", "C5prime_xyz": [ -2.758, 7.691, -2.480 ], "P_xyz": [ -0.724, 9.340, -2.714 ], "form": ".", "ssZp": 0.695, "Dp": 0.855, "splay_angle": 122.678, "splay_distance": 18.486, "splay_ratio": 0.878, "d22": null, "d64": null, "eta": -123.891, "theta": -48.707, "eta_prime": -84.963, "theta_prime": -69.338, "eta_base": -89.952, "theta_base": -79.667, "v0": -22.972, "v1": 37.695, "v2": -37.335, "v3": 25.017, "v4": -1.499, "amplitude": 38.949, "phase_angle": 163.447, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.037, "frame": { "rmsd": 0.003, "origin": [ 29.356, 3.811, 6.537 ], "x_axis": [ 0.899, 0.097, 0.427 ], "y_axis": [ -0.240, -0.706, 0.666 ], "z_axis": [ 0.366, -0.702, -0.612 ], "quaternion": [ 0.381, 0.897, -0.040, 0.221 ] } }, { "index": 31, "index_chain": 31, "chain_name": "A", "nt_resnum": 29, "nt_name": "G", "nt_code": "G", "nt_id": "///A/29", "linked_nts": [ "///A/28", "///A/30" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,internal-loop,splayed-apart", "alpha": 116.613, "beta": -98.801, "gamma": -94.760, "delta": 89.965, "epsilon": -146.336, "zeta": -68.226, "epsilon_zeta": -78.110, "bb_type": "BI", "chi": -173.943, "glyco_bond": "anti", "C5prime_xyz": [ -0.860, 8.255, 1.454 ], "P_xyz": [ -1.085, 10.845, 1.249 ], "form": "A", "ssZp": 4.550, "Dp": 4.617, "splay_angle": 23.980, "splay_distance": 3.797, "splay_ratio": 0.210, "d22": null, "d64": null, "eta": -104.233, "theta": 159.969, "eta_prime": -76.355, "theta_prime": -178.462, "eta_base": -42.976, "theta_base": -144.865, "v0": 10.834, "v1": -28.052, "v2": 33.613, "v3": -28.409, "v4": 11.214, "amplitude": 33.614, "phase_angle": 0.408, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23m", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.011, "frame": { "rmsd": 0.011, "origin": [ 24.705, -13.521, 10.977 ], "x_axis": [ -0.949, -0.314, 0.021 ], "y_axis": [ -0.314, 0.947, -0.065 ], "z_axis": [ 0.000, -0.068, -0.998 ], "quaternion": [ -0.005, -0.159, 0.987, -0.034 ] } }, { "index": 32, "index_chain": 32, "chain_name": "A", "nt_resnum": 30, "nt_name": "C", "nt_code": "C", "nt_id": "///A/30", "linked_nts": [ "///A/29", "///A/31" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -68.071, "beta": 177.229, "gamma": 53.913, "delta": 82.418, "epsilon": -150.974, "zeta": -72.409, "epsilon_zeta": -78.565, "bb_type": "BI", "chi": -164.447, "glyco_bond": "anti", "C5prime_xyz": [ -1.511, 8.747, 0.782 ], "P_xyz": [ 1.006, 9.172, 1.356 ], "form": "A", "ssZp": 4.379, "Dp": 4.526, "splay_angle": 21.668, "splay_distance": 3.447, "splay_ratio": 0.189, "d22": 4.214, "d64": 4.105, "eta": 167.000, "theta": -145.094, "eta_prime": -175.358, "theta_prime": -144.397, "eta_base": -139.735, "theta_base": -116.651, "v0": 0.748, "v1": -22.895, "v2": 35.099, "v3": -35.701, "v4": 21.979, "amplitude": 36.801, "phase_angle": 17.489, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.788, "filter_rmsd": 0.063, "frame": { "rmsd": 0.004, "origin": [ 25.055, -15.582, 7.807 ], "x_axis": [ -0.976, 0.217, 0.016 ], "y_axis": [ 0.216, 0.975, -0.058 ], "z_axis": [ -0.029, -0.053, -0.998 ], "quaternion": [ -0.011, 0.109, 0.994, -0.028 ] } }, { "index": 33, "index_chain": 33, "chain_name": "A", "nt_resnum": 31, "nt_name": "U", "nt_code": "U", "nt_id": "///A/31", "linked_nts": [ "///A/30", "///A/32" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -69.747, "beta": 172.780, "gamma": 56.762, "delta": 80.815, "epsilon": -151.045, "zeta": -72.387, "epsilon_zeta": -78.658, "bb_type": "BI", "chi": -162.641, "glyco_bond": "anti", "C5prime_xyz": [ -1.528, 8.715, 0.655 ], "P_xyz": [ 1.034, 9.208, 0.846 ], "form": "A", "ssZp": 4.436, "Dp": 4.595, "splay_angle": 19.157, "splay_distance": 3.080, "splay_ratio": 0.169, "d22": null, "d64": null, "eta": 164.990, "theta": -145.872, "eta_prime": 178.939, "theta_prime": -146.574, "eta_base": -138.298, "theta_base": -121.967, "v0": 1.070, "v1": -23.596, "v2": 35.918, "v3": -36.310, "v4": 22.217, "amplitude": 37.566, "phase_angle": 17.030, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.964, "filter_rmsd": 0.104, "frame": { "rmsd": 0.002, "origin": [ 23.990, -16.806, 4.766 ], "x_axis": [ -0.690, 0.721, 0.063 ], "y_axis": [ 0.713, 0.692, -0.111 ], "z_axis": [ -0.124, -0.031, -0.992 ], "quaternion": [ -0.051, 0.390, 0.918, -0.039 ] } }, { "index": 34, "index_chain": 34, "chain_name": "A", "nt_resnum": 32, "nt_name": "A", "nt_code": "A", "nt_id": "///A/32", "linked_nts": [ "///A/31", "///A/33" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix-end,stem-end,hairpin-loop", "alpha": -59.947, "beta": 179.532, "gamma": 39.880, "delta": 80.285, "epsilon": -129.060, "zeta": -96.063, "epsilon_zeta": -32.997, "bb_type": "--", "chi": -155.109, "glyco_bond": "anti", "C5prime_xyz": [ -1.297, 8.735, 0.226 ], "P_xyz": [ 1.213, 9.276, 0.748 ], "form": ".", "ssZp": 4.152, "Dp": 4.728, "splay_angle": 32.244, "splay_distance": 4.930, "splay_ratio": 0.290, "d22": null, "d64": null, "eta": 168.048, "theta": -127.397, "eta_prime": 176.226, "theta_prime": -136.493, "eta_base": -148.098, "theta_base": -74.474, "v0": 2.143, "v1": -24.329, "v2": 36.088, "v3": -35.877, "v4": 21.269, "amplitude": 37.439, "phase_angle": 15.439, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.663, "filter_rmsd": 0.037, "frame": { "rmsd": 0.003, "origin": [ 22.155, -17.254, 2.334 ], "x_axis": [ -0.125, 0.971, 0.206 ], "y_axis": [ 0.947, 0.179, -0.268 ], "z_axis": [ -0.297, 0.162, -0.941 ], "quaternion": [ -0.168, 0.640, 0.749, -0.035 ] } }, { "index": 35, "index_chain": 35, "chain_name": "A", "nt_resnum": 33, "nt_name": "G", "nt_code": "G", "nt_id": "///A/33", "linked_nts": [ "///A/32", "///A/34" ], "nt_type": "RNA", "dbn": ".", "summary": "syn,~C3'-endo,non-pair-contact,hairpin-loop,cap-acceptor,splayed-apart", "alpha": 92.258, "beta": -133.318, "gamma": -129.388, "delta": 81.593, "epsilon": -102.958, "zeta": -41.195, "epsilon_zeta": -61.763, "bb_type": "--", "chi": 9.885, "glyco_bond": "syn", "C5prime_xyz": [ -5.193, 3.539, -1.195 ], "P_xyz": [ -7.352, 2.563, -0.104 ], "form": ".", "ssZp": -4.510, "Dp": 4.747, "splay_angle": 96.898, "splay_distance": 12.160, "splay_ratio": 0.748, "d22": null, "d64": null, "eta": 176.775, "theta": -104.591, "eta_prime": -179.195, "theta_prime": -147.579, "eta_base": -98.814, "theta_base": 145.096, "v0": 4.025, "v1": -25.704, "v2": 36.414, "v3": -35.113, "v4": 19.608, "amplitude": 37.309, "phase_angle": 12.572, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.010, "frame": { "rmsd": 0.010, "origin": [ 22.930, -13.461, -0.719 ], "x_axis": [ -0.896, 0.207, 0.393 ], "y_axis": [ -0.296, -0.938, -0.180 ], "z_axis": [ 0.332, -0.277, 0.902 ], "quaternion": [ 0.130, 0.188, -0.118, 0.966 ] } }, { "index": 36, "index_chain": 36, "chain_name": "A", "nt_resnum": 34, "nt_name": "A", "nt_code": "A", "nt_id": "///A/34", "linked_nts": [ "///A/33", "///A/35" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,anti,~C3'-endo,BI,non-pair-contact,hairpin-loop,splayed-apart", "alpha": 156.796, "beta": 138.206, "gamma": 56.957, "delta": 90.795, "epsilon": -133.951, "zeta": -60.708, "epsilon_zeta": -73.243, "bb_type": "BI", "chi": -173.953, "glyco_bond": "anti", "C5prime_xyz": [ -1.190, 8.315, 1.449 ], "P_xyz": [ 1.390, 7.830, 1.293 ], "form": ".", "ssZp": 4.530, "Dp": 4.601, "splay_angle": 25.551, "splay_distance": 3.940, "splay_ratio": 0.221, "d22": null, "d64": null, "eta": -9.534, "theta": -110.040, "eta_prime": 45.589, "theta_prime": -118.499, "eta_base": 23.602, "theta_base": -72.934, "v0": 7.640, "v1": -25.130, "v2": 32.052, "v3": -28.604, "v4": 13.307, "amplitude": 32.190, "phase_angle": 5.294, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1g", "suiteness": 0.132, "filter_rmsd": 0.039, "frame": { "rmsd": 0.007, "origin": [ 16.636, -21.323, -7.534 ], "x_axis": [ 0.567, -0.823, 0.033 ], "y_axis": [ 0.815, 0.556, -0.162 ], "z_axis": [ 0.116, 0.119, 0.986 ], "quaternion": [ 0.882, -0.080, 0.024, -0.465 ] } }, { "index": 37, "index_chain": 37, "chain_name": "A", "nt_resnum": 35, "nt_name": "A", "nt_code": "A", "nt_id": "///A/35", "linked_nts": [ "///A/34", "///A/36" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-pair-contact,hairpin-loop,cap-donor,phosphate", "alpha": -92.314, "beta": 154.098, "gamma": 83.859, "delta": 87.406, "epsilon": -151.887, "zeta": -65.934, "epsilon_zeta": -85.953, "bb_type": "BI", "chi": -174.095, "glyco_bond": "anti", "C5prime_xyz": [ -1.275, 8.459, 1.379 ], "P_xyz": [ 1.282, 8.773, 0.855 ], "form": "A", "ssZp": 4.469, "Dp": 4.510, "splay_angle": 22.663, "splay_distance": 3.518, "splay_ratio": 0.197, "d22": null, "d64": null, "eta": 153.168, "theta": -136.485, "eta_prime": -174.997, "theta_prime": -142.899, "eta_base": -93.352, "theta_base": -114.501, "v0": 3.762, "v1": -22.606, "v2": 31.737, "v3": -30.477, "v4": 16.925, "amplitude": 32.464, "phase_angle": 12.152, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.010, "filter_rmsd": 0.039, "frame": { "rmsd": 0.005, "origin": [ 18.811, -22.738, -4.568 ], "x_axis": [ 0.997, -0.048, -0.063 ], "y_axis": [ 0.045, 0.997, -0.055 ], "z_axis": [ 0.066, 0.052, 0.996 ], "quaternion": [ 0.999, -0.027, 0.032, -0.023 ] } }, { "index": 38, "index_chain": 38, "chain_name": "A", "nt_resnum": 36, "nt_name": "A", "nt_code": "A", "nt_id": "///A/36", "linked_nts": [ "///A/35", "///A/37" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-pair-contact,hairpin-loop", "alpha": -74.786, "beta": -177.148, "gamma": 49.143, "delta": 84.432, "epsilon": -110.781, "zeta": -67.203, "epsilon_zeta": -43.578, "bb_type": "--", "chi": -163.006, "glyco_bond": "anti", "C5prime_xyz": [ -1.207, 8.625, 0.705 ], "P_xyz": [ 1.340, 8.864, 1.280 ], "form": ".", "ssZp": 4.308, "Dp": 4.744, "splay_angle": 50.634, "splay_distance": 7.866, "splay_ratio": 0.428, "d22": null, "d64": null, "eta": 171.779, "theta": -106.172, "eta_prime": -175.911, "theta_prime": -91.255, "eta_base": -131.887, "theta_base": -56.860, "v0": 3.889, "v1": -24.968, "v2": 35.351, "v3": -34.079, "v4": 19.037, "amplitude": 36.219, "phase_angle": 12.569, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.809, "filter_rmsd": 0.038, "frame": { "rmsd": 0.003, "origin": [ 19.765, -23.741, -1.334 ], "x_axis": [ 0.786, 0.607, -0.115 ], "y_axis": [ -0.611, 0.791, -0.001 ], "z_axis": [ 0.091, 0.071, 0.993 ], "quaternion": [ 0.945, -0.019, 0.055, 0.322 ] } }, { "index": 39, "index_chain": 39, "chain_name": "A", "nt_resnum": 37, "nt_name": "U", "nt_code": "U", "nt_id": "///A/37", "linked_nts": [ "///A/36", "///A/38" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,hairpin-loop", "alpha": -52.943, "beta": 133.766, "gamma": 92.452, "delta": 85.743, "epsilon": -153.594, "zeta": -70.012, "epsilon_zeta": -83.582, "bb_type": "BI", "chi": -162.949, "glyco_bond": "anti", "C5prime_xyz": [ -1.434, 8.659, 0.713 ], "P_xyz": [ 0.674, 9.037, -0.815 ], "form": "A", "ssZp": 4.410, "Dp": 4.527, "splay_angle": 22.397, "splay_distance": 3.558, "splay_ratio": 0.195, "d22": null, "d64": null, "eta": 175.295, "theta": -144.397, "eta_prime": -137.003, "theta_prime": -156.295, "eta_base": -74.456, "theta_base": -136.083, "v0": 2.823, "v1": -23.067, "v2": 33.332, "v3": -32.622, "v4": 18.839, "amplitude": 34.352, "phase_angle": 13.997, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1L", "suiteness": 0.018, "filter_rmsd": 0.105, "frame": { "rmsd": 0.004, "origin": [ 22.288, -17.140, 2.123 ], "x_axis": [ -0.224, 0.956, 0.189 ], "y_axis": [ -0.946, -0.260, 0.195 ], "z_axis": [ 0.235, -0.135, 0.962 ], "quaternion": [ 0.608, 0.136, 0.019, 0.782 ] } }, { "index": 40, "index_chain": 40, "chain_name": "A", "nt_resnum": 38, "nt_name": "A", "nt_code": "A", "nt_id": "///A/38", "linked_nts": [ "///A/37", "///A/39" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -85.051, "beta": 172.739, "gamma": 69.571, "delta": 81.579, "epsilon": -139.103, "zeta": -91.843, "epsilon_zeta": -47.261, "bb_type": "BI", "chi": -165.646, "glyco_bond": "anti", "C5prime_xyz": [ -1.540, 8.682, 0.845 ], "P_xyz": [ 1.030, 9.201, 0.817 ], "form": "A", "ssZp": 4.475, "Dp": 4.634, "splay_angle": 20.043, "splay_distance": 3.193, "splay_ratio": 0.175, "d22": null, "d64": null, "eta": 165.474, "theta": -150.208, "eta_prime": 179.011, "theta_prime": -150.142, "eta_base": -141.652, "theta_base": -127.427, "v0": 1.053, "v1": -23.105, "v2": 35.181, "v3": -35.554, "v4": 21.754, "amplitude": 36.793, "phase_angle": 17.022, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.425, "filter_rmsd": 0.036, "frame": { "rmsd": 0.004, "origin": [ 24.178, -16.684, 5.104 ], "x_axis": [ -0.720, 0.674, 0.167 ], "y_axis": [ -0.666, -0.738, 0.110 ], "z_axis": [ 0.197, -0.032, 0.980 ], "quaternion": [ 0.361, 0.098, 0.021, 0.927 ] } }, { "index": 41, "index_chain": 41, "chain_name": "A", "nt_resnum": 39, "nt_name": "G", "nt_code": "G", "nt_id": "///A/39", "linked_nts": [ "///A/38", "///A/40" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -39.336, "beta": 158.063, "gamma": 36.213, "delta": 78.928, "epsilon": -147.618, "zeta": -57.633, "epsilon_zeta": -89.984, "bb_type": "BI", "chi": -152.993, "glyco_bond": "anti", "C5prime_xyz": [ -1.371, 8.827, 0.065 ], "P_xyz": [ 1.218, 9.216, 0.089 ], "form": "A", "ssZp": 4.217, "Dp": 4.666, "splay_angle": 22.347, "splay_distance": 3.760, "splay_ratio": 0.199, "d22": null, "d64": null, "eta": 165.390, "theta": -135.227, "eta_prime": 176.364, "theta_prime": -138.466, "eta_base": -147.496, "theta_base": -115.347, "v0": 2.112, "v1": -25.566, "v2": 38.017, "v3": -37.811, "v4": 22.450, "amplitude": 39.464, "phase_angle": 15.561, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.222, "filter_rmsd": 0.003, "frame": { "rmsd": 0.003, "origin": [ 25.305, -15.477, 7.836 ], "x_axis": [ -0.966, 0.197, 0.169 ], "y_axis": [ -0.167, -0.970, 0.175 ], "z_axis": [ 0.198, 0.141, 0.970 ], "quaternion": [ 0.092, 0.093, 0.080, 0.988 ] } }, { "index": 42, "index_chain": 42, "chain_name": "A", "nt_resnum": 40, "nt_name": "C", "nt_code": "C", "nt_id": "///A/40", "linked_nts": [ "///A/39", "///A/41" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,internal-loop", "alpha": -104.769, "beta": 152.497, "gamma": 106.446, "delta": 75.492, "epsilon": -146.892, "zeta": -74.930, "epsilon_zeta": -71.962, "bb_type": "BI", "chi": -171.749, "glyco_bond": "anti", "C5prime_xyz": [ -1.453, 8.678, 1.189 ], "P_xyz": [ 0.498, 9.870, -0.078 ], "form": "A", "ssZp": 4.670, "Dp": 4.691, "splay_angle": 27.281, "splay_distance": 4.070, "splay_ratio": 0.237, "d22": null, "d64": null, "eta": 162.211, "theta": -157.816, "eta_prime": -177.720, "theta_prime": -158.164, "eta_base": -132.711, "theta_base": -122.955, "v0": 1.780, "v1": -26.588, "v2": 40.035, "v3": -40.024, "v4": 23.996, "amplitude": 41.678, "phase_angle": 16.137, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.061, "frame": { "rmsd": 0.006, "origin": [ 24.408, -13.435, 10.862 ], "x_axis": [ -0.946, -0.280, 0.165 ], "y_axis": [ 0.310, -0.928, 0.205 ], "z_axis": [ 0.096, 0.245, 0.965 ], "quaternion": [ -0.151, 0.067, 0.115, 0.980 ] } }, { "index": 43, "index_chain": 43, "chain_name": "A", "nt_resnum": 41, "nt_name": "A", "nt_code": "A", "nt_id": "///A/41", "linked_nts": [ "///A/40", "///A/42" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-pair-contact,internal-loop,phosphate", "alpha": -61.255, "beta": 172.914, "gamma": 57.014, "delta": 82.265, "epsilon": -136.243, "zeta": -69.090, "epsilon_zeta": -67.154, "bb_type": "BI", "chi": -172.532, "glyco_bond": "anti", "C5prime_xyz": [ -1.187, 8.431, 1.262 ], "P_xyz": [ 1.411, 8.539, 1.551 ], "form": "A", "ssZp": 4.682, "Dp": 4.748, "splay_angle": 26.631, "splay_distance": 4.165, "splay_ratio": 0.234, "d22": null, "d64": null, "eta": 174.610, "theta": -129.071, "eta_prime": -172.791, "theta_prime": -124.820, "eta_base": -123.689, "theta_base": -87.056, "v0": 6.699, "v1": -28.261, "v2": 37.900, "v3": -35.057, "v4": 17.892, "amplitude": 38.348, "phase_angle": 8.767, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.878, "filter_rmsd": 0.037, "frame": { "rmsd": 0.005, "origin": [ 22.800, -12.017, 14.322 ], "x_axis": [ -0.524, -0.834, 0.173 ], "y_axis": [ 0.848, -0.529, 0.016 ], "z_axis": [ 0.078, 0.155, 0.985 ], "quaternion": [ -0.483, 0.072, 0.049, 0.871 ] } }, { "index": 44, "index_chain": 44, "chain_name": "A", "nt_resnum": 42, "nt_name": "A", "nt_code": "A", "nt_id": "///A/42", "linked_nts": [ "///A/41", "///A/43" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-pair-contact,internal-loop,phosphate", "alpha": -57.306, "beta": 163.067, "gamma": 65.000, "delta": 84.584, "epsilon": -141.841, "zeta": -80.317, "epsilon_zeta": -61.524, "bb_type": "BI", "chi": -162.858, "glyco_bond": "anti", "C5prime_xyz": [ -1.594, 8.762, 0.718 ], "P_xyz": [ 0.990, 9.188, 0.834 ], "form": "B", "ssZp": 4.218, "Dp": 4.423, "splay_angle": 21.241, "splay_distance": 3.368, "splay_ratio": 0.186, "d22": null, "d64": null, "eta": 176.642, "theta": -141.494, "eta_prime": -159.639, "theta_prime": -133.478, "eta_base": -102.536, "theta_base": -89.399, "v0": -1.983, "v1": -18.797, "v2": 31.211, "v3": -33.288, "v4": 22.221, "amplitude": 33.648, "phase_angle": 21.941, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.695, "filter_rmsd": 0.038, "frame": { "rmsd": 0.006, "origin": [ 21.017, -13.476, 17.792 ], "x_axis": [ 0.215, -0.969, 0.124 ], "y_axis": [ 0.977, 0.214, -0.022 ], "z_axis": [ -0.006, 0.126, 0.992 ], "quaternion": [ 0.778, -0.047, -0.042, -0.625 ] } }, { "index": 45, "index_chain": 45, "chain_name": "A", "nt_resnum": 43, "nt_name": "G", "nt_code": "G", "nt_id": "///A/43", "linked_nts": [ "///A/42", "///A/44" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C2'-endo,non-pair-contact,internal-loop", "alpha": -56.188, "beta": 162.118, "gamma": 67.734, "delta": 152.274, "epsilon": -101.408, "zeta": -73.708, "epsilon_zeta": -27.700, "bb_type": "--", "chi": -121.193, "glyco_bond": "anti", "C5prime_xyz": [ -1.861, 8.538, -1.084 ], "P_xyz": [ 0.748, 8.752, -0.947 ], "form": ".", "ssZp": 0.950, "Dp": 0.930, "splay_angle": 84.218, "splay_distance": 13.242, "splay_ratio": 0.671, "d22": null, "d64": null, "eta": -167.255, "theta": -49.871, "eta_prime": -129.808, "theta_prime": -74.924, "eta_base": -83.970, "theta_base": -50.021, "v0": -19.790, "v1": 35.604, "v2": -36.894, "v3": 26.437, "v4": -4.322, "amplitude": 37.752, "phase_angle": 167.759, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1b", "suiteness": 0.688, "filter_rmsd": 0.003, "frame": { "rmsd": 0.003, "origin": [ 21.744, -14.534, 20.906 ], "x_axis": [ 0.817, -0.576, 0.003 ], "y_axis": [ 0.569, 0.807, 0.158 ], "z_axis": [ -0.094, -0.127, 0.987 ], "quaternion": [ 0.950, 0.075, -0.025, -0.301 ] } }, { "index": 46, "index_chain": 46, "chain_name": "A", "nt_resnum": 44, "nt_name": "U", "nt_code": "U", "nt_id": "///A/44", "linked_nts": [ "///A/43", "///A/45" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C2'-endo,non-pair-contact,internal-loop,phosphate,splayed-apart", "alpha": -70.669, "beta": -178.677, "gamma": 40.792, "delta": 149.143, "epsilon": -118.878, "zeta": -47.780, "epsilon_zeta": -71.098, "bb_type": "--", "chi": -141.218, "glyco_bond": "anti", "C5prime_xyz": [ -2.023, 8.703, -0.061 ], "P_xyz": [ -0.173, 9.524, 1.596 ], "form": ".", "ssZp": 1.302, "Dp": 1.338, "splay_angle": 109.789, "splay_distance": 15.380, "splay_ratio": 0.818, "d22": 7.897, "d64": 10.192, "eta": 149.019, "theta": -41.205, "eta_prime": -154.899, "theta_prime": -54.623, "eta_base": -129.444, "theta_base": -28.792, "v0": -23.130, "v1": 37.699, "v2": -36.982, "v3": 24.606, "v4": -1.129, "amplitude": 38.700, "phase_angle": 162.864, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "2[", "suiteness": 0.473, "filter_rmsd": 0.102, "frame": { "rmsd": 0.004, "origin": [ 28.828, -6.783, 28.974 ], "x_axis": [ 0.485, -0.459, -0.745 ], "y_axis": [ -0.818, 0.062, -0.571 ], "z_axis": [ 0.308, 0.886, -0.345 ], "quaternion": [ 0.548, -0.665, 0.480, 0.164 ] } }, { "index": 47, "index_chain": 47, "chain_name": "A", "nt_resnum": 45, "nt_name": "U", "nt_code": "U", "nt_id": "///A/45", "linked_nts": [ "///A/44", "///A/46" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,internal-loop,phosphate,splayed-apart", "alpha": -83.913, "beta": -179.242, "gamma": 61.636, "delta": 78.679, "epsilon": -146.429, "zeta": -79.980, "epsilon_zeta": -66.450, "bb_type": "BI", "chi": -171.304, "glyco_bond": "anti", "C5prime_xyz": [ -1.297, 8.539, 1.178 ], "P_xyz": [ 1.290, 8.842, 1.413 ], "form": "A", "ssZp": 4.684, "Dp": 4.709, "splay_angle": 24.854, "splay_distance": 3.808, "splay_ratio": 0.219, "d22": null, "d64": null, "eta": 149.260, "theta": -150.337, "eta_prime": -161.576, "theta_prime": -146.722, "eta_base": -120.389, "theta_base": -123.712, "v0": 4.580, "v1": -27.806, "v2": 39.403, "v3": -37.777, "v4": 20.868, "amplitude": 40.316, "phase_angle": 12.218, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "2a", "suiteness": 0.442, "filter_rmsd": 0.107, "frame": { "rmsd": 0.004, "origin": [ 18.378, 0.974, 20.781 ], "x_axis": [ -0.614, -0.789, -0.021 ], "y_axis": [ 0.402, -0.336, 0.852 ], "z_axis": [ -0.679, 0.515, 0.524 ], "quaternion": [ -0.379, -0.222, 0.434, 0.786 ] } }, { "index": 48, "index_chain": 48, "chain_name": "A", "nt_resnum": 46, "nt_name": "A", "nt_code": "A", "nt_id": "///A/46", "linked_nts": [ "///A/45", "///A/47" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -53.678, "beta": 166.656, "gamma": 60.116, "delta": 83.263, "epsilon": -149.368, "zeta": -85.238, "epsilon_zeta": -64.130, "bb_type": "BI", "chi": -164.327, "glyco_bond": "anti", "C5prime_xyz": [ -1.377, 8.644, 0.829 ], "P_xyz": [ 1.219, 8.918, 0.978 ], "form": "A", "ssZp": 4.421, "Dp": 4.563, "splay_angle": 22.290, "splay_distance": 3.466, "splay_ratio": 0.193, "d22": null, "d64": null, "eta": 179.644, "theta": -151.016, "eta_prime": -166.867, "theta_prime": -151.075, "eta_base": -132.561, "theta_base": -128.982, "v0": 2.173, "v1": -23.325, "v2": 34.428, "v3": -34.182, "v4": 20.220, "amplitude": 35.686, "phase_angle": 15.258, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.803, "filter_rmsd": 0.037, "frame": { "rmsd": 0.006, "origin": [ 14.950, 2.630, 20.885 ], "x_axis": [ -0.304, -0.861, 0.408 ], "y_axis": [ 0.621, 0.146, 0.770 ], "z_axis": [ -0.722, 0.488, 0.491 ], "quaternion": [ 0.577, 0.122, -0.490, -0.642 ] } }, { "index": 49, "index_chain": 49, "chain_name": "A", "nt_resnum": 47, "nt_name": "A", "nt_code": "A", "nt_id": "///A/47", "linked_nts": [ "///A/46", "///A/48" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -50.325, "beta": 162.749, "gamma": 49.473, "delta": 84.688, "epsilon": -129.757, "zeta": -76.057, "epsilon_zeta": -53.699, "bb_type": "BI", "chi": -161.554, "glyco_bond": "anti", "C5prime_xyz": [ -1.289, 8.695, 0.701 ], "P_xyz": [ 1.288, 8.831, 1.177 ], "form": ".", "ssZp": 4.247, "Dp": 4.563, "splay_angle": 23.070, "splay_distance": 3.756, "splay_ratio": 0.200, "d22": null, "d64": null, "eta": 177.271, "theta": -127.802, "eta_prime": -172.875, "theta_prime": -127.023, "eta_base": -140.787, "theta_base": -92.656, "v0": 1.293, "v1": -21.652, "v2": 32.556, "v3": -32.742, "v4": 19.862, "amplitude": 33.953, "phase_angle": 16.489, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.699, "filter_rmsd": 0.039, "frame": { "rmsd": 0.013, "origin": [ 11.825, 3.993, 21.509 ], "x_axis": [ 0.133, -0.706, 0.696 ], "y_axis": [ 0.677, 0.578, 0.456 ], "z_axis": [ -0.724, 0.410, 0.554 ], "quaternion": [ 0.753, 0.015, -0.472, -0.459 ] } }, { "index": 50, "index_chain": 50, "chain_name": "A", "nt_resnum": 48, "nt_name": "A", "nt_code": "A", "nt_id": "///A/48", "linked_nts": [ "///A/47", "///A/49" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -58.964, "beta": 160.258, "gamma": 49.959, "delta": 80.077, "epsilon": -155.720, "zeta": -75.384, "epsilon_zeta": -80.336, "bb_type": "BI", "chi": -158.885, "glyco_bond": "anti", "C5prime_xyz": [ -1.784, 8.763, 0.461 ], "P_xyz": [ 0.756, 9.385, 0.570 ], "form": "A", "ssZp": 4.307, "Dp": 4.506, "splay_angle": 20.815, "splay_distance": 3.297, "splay_ratio": 0.181, "d22": null, "d64": null, "eta": 155.587, "theta": -151.668, "eta_prime": 177.640, "theta_prime": -151.984, "eta_base": -128.038, "theta_base": -127.319, "v0": -0.213, "v1": -22.715, "v2": 35.730, "v3": -36.869, "v4": 23.341, "amplitude": 37.772, "phase_angle": 18.927, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.740, "filter_rmsd": 0.036, "frame": { "rmsd": 0.011, "origin": [ 9.523, 3.921, 24.476 ], "x_axis": [ 0.695, -0.289, 0.658 ], "y_axis": [ 0.406, 0.913, -0.028 ], "z_axis": [ -0.593, 0.287, 0.752 ], "quaternion": [ 0.917, -0.086, -0.341, -0.190 ] } }, { "index": 51, "index_chain": 51, "chain_name": "A", "nt_resnum": 49, "nt_name": "A", "nt_code": "A", "nt_id": "///A/49", "linked_nts": [ "///A/48", "///A/50" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -69.359, "beta": 174.130, "gamma": 57.906, "delta": 82.949, "epsilon": -135.281, "zeta": -77.730, "epsilon_zeta": -57.551, "bb_type": "BI", "chi": -154.477, "glyco_bond": "anti", "C5prime_xyz": [ -1.486, 8.740, 0.250 ], "P_xyz": [ 1.091, 9.172, 0.353 ], "form": "A", "ssZp": 4.128, "Dp": 4.602, "splay_angle": 19.306, "splay_distance": 3.174, "splay_ratio": 0.168, "d22": null, "d64": null, "eta": 172.052, "theta": -136.728, "eta_prime": -178.703, "theta_prime": -135.972, "eta_base": -144.030, "theta_base": -105.012, "v0": 2.208, "v1": -24.114, "v2": 35.619, "v3": -35.364, "v4": 20.863, "amplitude": 36.920, "phase_angle": 15.259, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.922, "filter_rmsd": 0.039, "frame": { "rmsd": 0.009, "origin": [ 7.603, 3.513, 27.125 ], "x_axis": [ 0.870, 0.212, 0.445 ], "y_axis": [ -0.090, 0.956, -0.280 ], "z_axis": [ -0.484, 0.203, 0.851 ], "quaternion": [ 0.959, -0.126, -0.242, 0.079 ] } }, { "index": 52, "index_chain": 52, "chain_name": "A", "nt_resnum": 50, "nt_name": "U", "nt_code": "U", "nt_id": "///A/50", "linked_nts": [ "///A/49", "///A/51" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BII,canonical,non-pair-contact,helix,stem-end,coaxial-stack,phosphate,splayed-apart", "alpha": -58.259, "beta": 157.501, "gamma": 57.740, "delta": 81.304, "epsilon": -117.397, "zeta": 154.679, "epsilon_zeta": 87.924, "bb_type": "BII", "chi": -149.396, "glyco_bond": "anti", "C5prime_xyz": [ -1.824, 8.868, -0.200 ], "P_xyz": [ 0.645, 9.514, -0.779 ], "form": ".", "ssZp": 3.694, "Dp": 4.558, "splay_angle": 150.094, "splay_distance": 18.405, "splay_ratio": 0.966, "d22": null, "d64": null, "eta": 171.951, "theta": 108.408, "eta_prime": -173.079, "theta_prime": 105.988, "eta_base": -130.495, "theta_base": 112.418, "v0": -5.339, "v1": -18.129, "v2": 33.191, "v3": -37.189, "v4": 26.876, "amplitude": 37.138, "phase_angle": 26.654, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.789, "filter_rmsd": 0.102, "frame": { "rmsd": 0.004, "origin": [ 7.696, 3.868, 30.278 ], "x_axis": [ 0.738, 0.665, 0.114 ], "y_axis": [ -0.625, 0.738, -0.254 ], "z_axis": [ -0.253, 0.117, 0.960 ], "quaternion": [ 0.927, -0.100, -0.099, 0.348 ] } }, { "index": 53, "index_chain": 53, "chain_name": "A", "nt_resnum": 51, "nt_name": "A", "nt_code": "A", "nt_id": "///A/51", "linked_nts": [ "///A/50", "///A/52" ], "nt_type": "RNA", "dbn": ".", "summary": "syn,~C3'-endo,non-pair-contact,ss-non-loop,splayed-apart", "alpha": -65.950, "beta": 91.592, "gamma": 177.153, "delta": 85.562, "epsilon": -125.407, "zeta": -84.254, "epsilon_zeta": -41.153, "bb_type": "--", "chi": 58.524, "glyco_bond": "syn", "C5prime_xyz": [ -5.350, 4.238, 1.823 ], "P_xyz": [ -6.238, 5.672, 3.840 ], "form": ".", "ssZp": -2.013, "Dp": 4.198, "splay_angle": 47.650, "splay_distance": 7.103, "splay_ratio": 0.407, "d22": null, "d64": null, "eta": -61.553, "theta": 157.097, "eta_prime": -83.216, "theta_prime": -176.093, "eta_base": -85.082, "theta_base": -168.728, "v0": -9.886, "v1": -10.325, "v2": 25.213, "v3": -31.631, "v4": 26.190, "amplitude": 31.358, "phase_angle": 36.482, "puckering": "C4'-exo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.005, "origin": [ -9.826, 9.486, 30.666 ], "x_axis": [ -0.732, -0.626, 0.270 ], "y_axis": [ 0.585, -0.780, -0.222 ], "z_axis": [ 0.350, -0.004, 0.937 ], "quaternion": [ -0.326, 0.167, -0.061, 0.928 ] } }, { "index": 54, "index_chain": 54, "chain_name": "A", "nt_resnum": 52, "nt_name": "A", "nt_code": "A", "nt_id": "///A/52", "linked_nts": [ "///A/51", "///A/53" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-stack,non-canonical,helix-end,ss-non-loop,phosphate", "alpha": -61.145, "beta": -165.184, "gamma": 45.692, "delta": 82.865, "epsilon": -153.014, "zeta": -54.514, "epsilon_zeta": -98.501, "bb_type": "BI", "chi": -153.392, "glyco_bond": "anti", "C5prime_xyz": [ -1.102, 8.650, 0.139 ], "P_xyz": [ 1.417, 9.044, 0.737 ], "form": ".", "ssZp": 4.274, "Dp": 4.644, "splay_angle": 62.986, "splay_distance": 9.654, "splay_ratio": 0.523, "d22": null, "d64": null, "eta": 178.974, "theta": -88.337, "eta_prime": -170.577, "theta_prime": -75.307, "eta_base": -179.486, "theta_base": -53.964, "v0": 5.101, "v1": -25.853, "v2": 35.633, "v3": -33.700, "v4": 18.094, "amplitude": 36.271, "phase_angle": 10.759, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.541, "filter_rmsd": 0.038, "frame": { "rmsd": 0.004, "origin": [ -11.886, 12.540, 24.593 ], "x_axis": [ 0.098, 0.358, 0.928 ], "y_axis": [ 0.933, -0.358, 0.040 ], "z_axis": [ 0.346, 0.862, -0.369 ], "quaternion": [ -0.304, 0.675, 0.478, 0.472 ] } }, { "index": 55, "index_chain": 55, "chain_name": "A", "nt_resnum": 53, "nt_name": "G", "nt_code": "G", "nt_id": "///A/53", "linked_nts": [ "///A/52", "///A/54" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,phosphate", "alpha": 143.303, "beta": -117.831, "gamma": -179.918, "delta": 83.857, "epsilon": -147.487, "zeta": -73.655, "epsilon_zeta": -73.833, "bb_type": "BI", "chi": -179.277, "glyco_bond": "anti", "C5prime_xyz": [ -1.261, 8.348, 1.702 ], "P_xyz": [ 0.471, 9.453, 0.080 ], "form": "A", "ssZp": 4.600, "Dp": 4.646, "splay_angle": 24.277, "splay_distance": 3.767, "splay_ratio": 0.214, "d22": null, "d64": null, "eta": 178.747, "theta": -157.296, "eta_prime": -127.629, "theta_prime": -161.114, "eta_base": -64.317, "theta_base": -140.604, "v0": 6.768, "v1": -27.166, "v2": 36.137, "v3": -33.237, "v4": 16.709, "amplitude": 36.509, "phase_angle": 8.193, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.201, "filter_rmsd": 0.009, "frame": { "rmsd": 0.009, "origin": [ -4.749, 16.688, 29.597 ], "x_axis": [ 0.995, -0.029, 0.094 ], "y_axis": [ 0.072, -0.431, -0.899 ], "z_axis": [ 0.067, 0.902, -0.427 ], "quaternion": [ 0.533, -0.845, -0.013, -0.048 ] } }, { "index": 56, "index_chain": 56, "chain_name": "A", "nt_resnum": 54, "nt_name": "G", "nt_code": "G", "nt_id": "///A/54", "linked_nts": [ "///A/53", "///A/55" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,bulge", "alpha": -60.030, "beta": -174.849, "gamma": 49.736, "delta": 85.851, "epsilon": -145.829, "zeta": -90.221, "epsilon_zeta": -55.609, "bb_type": "BI", "chi": -154.111, "glyco_bond": "anti", "C5prime_xyz": [ -1.123, 8.767, 0.307 ], "P_xyz": [ 1.382, 8.990, 1.072 ], "form": ".", "ssZp": 4.110, "Dp": 4.497, "splay_angle": 19.834, "splay_distance": 3.207, "splay_ratio": 0.173, "d22": null, "d64": null, "eta": 179.315, "theta": -153.672, "eta_prime": -169.516, "theta_prime": -144.411, "eta_base": -139.151, "theta_base": -134.814, "v0": 2.797, "v1": -22.509, "v2": 32.565, "v3": -31.876, "v4": 18.360, "amplitude": 33.557, "phase_angle": 13.969, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.875, "filter_rmsd": 0.010, "frame": { "rmsd": 0.010, "origin": [ -4.383, 20.403, 30.107 ], "x_axis": [ 0.855, -0.291, -0.430 ], "y_axis": [ -0.508, -0.296, -0.809 ], "z_axis": [ 0.109, 0.910, -0.401 ], "quaternion": [ 0.538, -0.799, 0.250, 0.100 ] } }, { "index": 57, "index_chain": 57, "chain_name": "A", "nt_resnum": 55, "nt_name": "C", "nt_code": "C", "nt_id": "///A/55", "linked_nts": [ "///A/54", "///A/56" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,isolated-canonical,non-pair-contact,helix-end,hairpin-loop,bulge", "alpha": -52.771, "beta": 154.875, "gamma": 68.685, "delta": 146.160, "epsilon": -156.316, "zeta": -106.219, "epsilon_zeta": -50.097, "bb_type": "BI", "chi": -131.730, "glyco_bond": "anti", "C5prime_xyz": [ -2.066, 8.734, -0.595 ], "P_xyz": [ 0.524, 9.122, -0.461 ], "form": ".", "ssZp": 2.148, "Dp": 2.106, "splay_angle": 46.531, "splay_distance": 7.215, "splay_ratio": 0.396, "d22": 6.330, "d64": 7.262, "eta": 169.748, "theta": -126.232, "eta_prime": -149.519, "theta_prime": 172.703, "eta_base": -135.179, "theta_base": 93.808, "v0": -23.585, "v1": 37.234, "v2": -35.795, "v3": 23.072, "v4": 0.118, "amplitude": 37.851, "phase_angle": 161.032, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1b", "suiteness": 0.549, "filter_rmsd": 0.062, "frame": { "rmsd": 0.005, "origin": [ -4.137, 23.590, 29.842 ], "x_axis": [ 0.606, -0.501, -0.618 ], "y_axis": [ -0.724, -0.024, -0.690 ], "z_axis": [ 0.331, 0.865, -0.377 ], "quaternion": [ 0.549, -0.708, 0.432, 0.102 ] } }, { "index": 58, "index_chain": 58, "chain_name": "A", "nt_resnum": 56, "nt_name": "U", "nt_code": "U", "nt_id": "///A/56", "linked_nts": [ "///A/55", "///A/57" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,anti,~C2'-endo,BI,non-pair-contact,hairpin-loop", "alpha": -127.453, "beta": 141.434, "gamma": 41.842, "delta": 147.039, "epsilon": -136.864, "zeta": -77.275, "epsilon_zeta": -59.589, "bb_type": "BI", "chi": -136.205, "glyco_bond": "anti", "C5prime_xyz": [ -1.762, 8.707, -0.352 ], "P_xyz": [ 0.658, 8.794, 0.683 ], "form": ".", "ssZp": 1.702, "Dp": 1.722, "splay_angle": 73.271, "splay_distance": 11.550, "splay_ratio": 0.597, "d22": null, "d64": null, "eta": 81.131, "theta": -73.047, "eta_prime": 104.581, "theta_prime": -93.183, "eta_base": 49.801, "theta_base": -69.500, "v0": -21.198, "v1": 35.439, "v2": -35.329, "v3": 23.980, "v4": -1.921, "amplitude": 36.714, "phase_angle": 164.216, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.002, "origin": [ -10.129, 21.525, 33.291 ], "x_axis": [ -0.669, -0.523, -0.528 ], "y_axis": [ -0.223, 0.819, -0.529 ], "z_axis": [ 0.709, -0.236, -0.665 ], "quaternion": [ 0.348, -0.210, 0.888, -0.215 ] } }, { "index": 59, "index_chain": 59, "chain_name": "A", "nt_resnum": 57, "nt_name": "A", "nt_code": "A", "nt_id": "///A/57", "linked_nts": [ "///A/56", "///A/58" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,anti,~C2'-endo,non-pair-contact,hairpin-loop,cap-donor,phosphate", "alpha": -85.026, "beta": -163.314, "gamma": 61.593, "delta": 147.068, "epsilon": -116.485, "zeta": 94.696, "epsilon_zeta": 148.819, "bb_type": "--", "chi": -135.241, "glyco_bond": "anti", "C5prime_xyz": [ -1.959, 8.719, -0.390 ], "P_xyz": [ 0.110, 9.548, 0.997 ], "form": ".", "ssZp": 1.190, "Dp": 1.254, "splay_angle": 40.711, "splay_distance": 6.461, "splay_ratio": 0.380, "d22": null, "d64": null, "eta": 178.833, "theta": 93.253, "eta_prime": -137.413, "theta_prime": 78.162, "eta_base": -105.141, "theta_base": 76.471, "v0": -22.091, "v1": 36.293, "v2": -35.844, "v3": 24.007, "v4": -1.409, "amplitude": 37.410, "phase_angle": 163.361, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "2[", "suiteness": 0.268, "filter_rmsd": 0.038, "frame": { "rmsd": 0.004, "origin": [ -4.676, 24.935, 23.697 ], "x_axis": [ -0.949, 0.107, -0.298 ], "y_axis": [ -0.213, 0.481, 0.851 ], "z_axis": [ 0.234, 0.870, -0.433 ], "quaternion": [ 0.157, -0.031, 0.846, 0.509 ] } }, { "index": 60, "index_chain": 60, "chain_name": "A", "nt_resnum": 58, "nt_name": "G", "nt_code": "G", "nt_id": "///A/58", "linked_nts": [ "///A/57", "///A/59" ], "nt_type": "RNA", "dbn": ")", "summary": "~C3'-endo,isolated-canonical,non-pair-contact,helix-end,hairpin-loop,bulge,cap-acceptor,splayed-apart", "alpha": -97.897, "beta": 156.894, "gamma": 44.816, "delta": 88.318, "epsilon": -110.805, "zeta": -67.393, "epsilon_zeta": -43.412, "bb_type": "--", "chi": -77.211, "glyco_bond": "--", "C5prime_xyz": [ -2.369, 6.506, -3.346 ], "P_xyz": [ -0.265, 5.478, -4.558 ], "form": ".", "ssZp": -1.629, "Dp": 4.770, "splay_angle": 100.158, "splay_distance": 16.297, "splay_ratio": 0.768, "d22": null, "d64": null, "eta": 163.857, "theta": -97.657, "eta_prime": 170.788, "theta_prime": -108.791, "eta_base": 162.089, "theta_base": -125.197, "v0": 8.960, "v1": -26.859, "v2": 33.580, "v3": -29.356, "v4": 12.964, "amplitude": 33.646, "phase_angle": 3.599, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "0a", "suiteness": 0.038, "filter_rmsd": 0.009, "frame": { "rmsd": 0.009, "origin": [ -4.438, 23.487, 29.989 ], "x_axis": [ 0.674, -0.410, -0.614 ], "y_axis": [ 0.731, 0.250, 0.635 ], "z_axis": [ -0.107, -0.877, 0.468 ], "quaternion": [ 0.773, 0.489, 0.164, -0.369 ] } }, { "index": 61, "index_chain": 61, "chain_name": "A", "nt_resnum": 59, "nt_name": "U", "nt_code": "U", "nt_id": "///A/59", "linked_nts": [ "///A/58", "///A/60" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,anti,~C3'-endo,non-stack,non-pair-contact,bulge,phosphate,splayed-apart", "alpha": -52.998, "beta": 159.003, "gamma": -175.405, "delta": 81.582, "epsilon": 176.261, "zeta": 174.713, "epsilon_zeta": 1.548, "bb_type": "--", "chi": -165.537, "glyco_bond": "anti", "C5prime_xyz": [ -1.730, 8.751, 0.781 ], "P_xyz": [ -1.325, 11.048, -0.427 ], "form": ".", "ssZp": 4.180, "Dp": 4.215, "splay_angle": 120.635, "splay_distance": 15.733, "splay_ratio": 0.869, "d22": 9.718, "d64": 12.181, "eta": -51.357, "theta": 29.059, "eta_prime": -40.183, "theta_prime": 51.927, "eta_base": -47.905, "theta_base": 89.409, "v0": -2.694, "v1": -19.561, "v2": 32.880, "v3": -35.408, "v4": 24.078, "amplitude": 35.677, "phase_angle": 22.839, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.101, "frame": { "rmsd": 0.006, "origin": [ 9.529, 19.716, 37.492 ], "x_axis": [ 0.567, 0.454, 0.687 ], "y_axis": [ -0.626, 0.780, 0.002 ], "z_axis": [ -0.535, -0.432, 0.726 ], "quaternion": [ 0.877, 0.124, -0.349, 0.308 ] } }, { "index": 62, "index_chain": 62, "chain_name": "A", "nt_resnum": 60, "nt_name": "C", "nt_code": "C", "nt_id": "///A/60", "linked_nts": [ "///A/59", "///A/61" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,bulge,phosphate,splayed-apart", "alpha": -59.537, "beta": 159.988, "gamma": 42.231, "delta": 78.625, "epsilon": -150.750, "zeta": -70.020, "epsilon_zeta": -80.730, "bb_type": "BI", "chi": -165.255, "glyco_bond": "anti", "C5prime_xyz": [ -1.501, 8.794, 0.813 ], "P_xyz": [ 1.039, 9.219, 1.278 ], "form": "A", "ssZp": 4.471, "Dp": 4.579, "splay_angle": 21.060, "splay_distance": 3.391, "splay_ratio": 0.186, "d22": 4.208, "d64": 4.254, "eta": 172.009, "theta": -144.737, "eta_prime": 168.070, "theta_prime": -144.306, "eta_base": 144.561, "theta_base": -114.335, "v0": 0.067, "v1": -23.287, "v2": 36.413, "v3": -37.379, "v4": 23.493, "amplitude": 38.399, "phase_angle": 18.510, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "3a", "suiteness": 0.223, "filter_rmsd": 0.063, "frame": { "rmsd": 0.003, "origin": [ -4.233, 20.350, 29.893 ], "x_axis": [ 0.860, -0.314, -0.403 ], "y_axis": [ 0.483, 0.241, 0.842 ], "z_axis": [ -0.167, -0.918, 0.359 ], "quaternion": [ 0.784, 0.561, 0.075, -0.254 ] } }, { "index": 63, "index_chain": 63, "chain_name": "A", "nt_resnum": 61, "nt_name": "C", "nt_code": "C", "nt_id": "///A/61", "linked_nts": [ "///A/60", "///A/62" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,phosphate", "alpha": -65.409, "beta": 172.350, "gamma": 54.815, "delta": 78.359, "epsilon": -145.622, "zeta": -72.253, "epsilon_zeta": -73.368, "bb_type": "BI", "chi": -161.249, "glyco_bond": "anti", "C5prime_xyz": [ -1.393, 8.819, 0.558 ], "P_xyz": [ 1.176, 9.344, 0.605 ], "form": "A", "ssZp": 4.466, "Dp": 4.669, "splay_angle": 25.095, "splay_distance": 4.114, "splay_ratio": 0.221, "d22": null, "d64": null, "eta": 166.196, "theta": -144.717, "eta_prime": 179.770, "theta_prime": -142.879, "eta_base": -134.740, "theta_base": -122.133, "v0": 0.814, "v1": -24.011, "v2": 36.883, "v3": -37.369, "v4": 23.013, "amplitude": 38.651, "phase_angle": 17.393, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.960, "filter_rmsd": 0.064, "frame": { "rmsd": 0.005, "origin": [ -4.435, 17.004, 29.375 ], "x_axis": [ 0.984, -0.110, 0.137 ], "y_axis": [ -0.102, 0.279, 0.955 ], "z_axis": [ -0.144, -0.954, 0.263 ], "quaternion": [ 0.795, 0.600, -0.088, -0.003 ] } }, { "index": 64, "index_chain": 64, "chain_name": "A", "nt_resnum": 62, "nt_name": "G", "nt_code": "G", "nt_id": "///A/62", "linked_nts": [ "///A/61", "///A/63" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BII,non-canonical,non-pair-contact,helix-end,ss-non-loop,phosphate", "alpha": -62.833, "beta": 179.217, "gamma": 50.920, "delta": 80.574, "epsilon": -85.836, "zeta": -152.771, "epsilon_zeta": 66.934, "bb_type": "BII", "chi": -158.349, "glyco_bond": "anti", "C5prime_xyz": [ -1.694, 8.852, 0.372 ], "P_xyz": [ 0.787, 9.643, 0.652 ], "form": ".", "ssZp": 3.755, "Dp": 4.578, "splay_angle": 66.986, "splay_distance": 10.642, "splay_ratio": 0.552, "d22": null, "d64": null, "eta": -172.634, "theta": 172.628, "eta_prime": -165.955, "theta_prime": -152.945, "eta_base": -140.880, "theta_base": -140.773, "v0": -2.200, "v1": -20.374, "v2": 33.885, "v3": -36.064, "v4": 24.179, "amplitude": 36.538, "phase_angle": 21.969, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.957, "filter_rmsd": 0.006, "frame": { "rmsd": 0.006, "origin": [ -3.518, 13.018, 28.942 ], "x_axis": [ 0.815, 0.298, 0.498 ], "y_axis": [ -0.570, 0.248, 0.784 ], "z_axis": [ 0.110, -0.922, 0.372 ], "quaternion": [ 0.780, 0.546, -0.124, 0.278 ] } }, { "index": 65, "index_chain": 65, "chain_name": "A", "nt_resnum": 63, "nt_name": "U", "nt_code": "U", "nt_id": "///A/63", "linked_nts": [ "///A/62", "///A/64" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C2'-endo,non-pair-contact,ss-non-loop,phosphate,splayed-apart", "alpha": -60.999, "beta": 174.513, "gamma": 50.360, "delta": 149.379, "epsilon": -76.747, "zeta": -80.500, "epsilon_zeta": 3.752, "bb_type": "--", "chi": -137.601, "glyco_bond": "anti", "C5prime_xyz": [ -1.831, 8.704, -0.240 ], "P_xyz": [ 0.284, 9.341, 1.184 ], "form": ".", "ssZp": 0.030, "Dp": 0.167, "splay_angle": 133.287, "splay_distance": 17.167, "splay_ratio": 0.918, "d22": 9.065, "d64": 11.334, "eta": -130.253, "theta": -39.422, "eta_prime": -138.828, "theta_prime": -59.183, "eta_base": -156.441, "theta_base": -23.080, "v0": -21.188, "v1": 36.793, "v2": -37.433, "v3": 26.265, "v4": -3.419, "amplitude": 38.546, "phase_angle": 166.201, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "3b", "suiteness": 0.010, "filter_rmsd": 0.103, "frame": { "rmsd": 0.005, "origin": [ -5.502, 3.332, 32.878 ], "x_axis": [ 0.671, 0.617, -0.411 ], "y_axis": [ -0.586, 0.781, 0.215 ], "z_axis": [ 0.454, 0.096, 0.886 ], "quaternion": [ 0.914, 0.033, 0.237, 0.329 ] } }, { "index": 66, "index_chain": 66, "chain_name": "A", "nt_resnum": 64, "nt_name": "U", "nt_code": "U", "nt_id": "///A/64", "linked_nts": [ "///A/63", "///A/65" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-pair-contact,ss-non-loop,phosphate,splayed-apart", "alpha": -62.719, "beta": 179.522, "gamma": 60.817, "delta": 81.803, "epsilon": -135.210, "zeta": -67.134, "epsilon_zeta": -68.076, "bb_type": "BI", "chi": -175.453, "glyco_bond": "anti", "C5prime_xyz": [ -1.209, 8.368, 1.451 ], "P_xyz": [ 1.392, 8.423, 1.830 ], "form": ".", "ssZp": 4.769, "Dp": 4.783, "splay_angle": 34.169, "splay_distance": 5.062, "splay_ratio": 0.294, "d22": null, "d64": null, "eta": 162.258, "theta": -126.554, "eta_prime": -153.788, "theta_prime": -121.601, "eta_base": -139.922, "theta_base": -80.903, "v0": 7.205, "v1": -28.570, "v2": 38.005, "v3": -34.844, "v4": 17.432, "amplitude": 38.382, "phase_angle": 8.030, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "2a", "suiteness": 0.589, "filter_rmsd": 0.106, "frame": { "rmsd": 0.004, "origin": [ -16.903, 12.563, 41.795 ], "x_axis": [ -0.065, 0.397, -0.915 ], "y_axis": [ 0.517, -0.771, -0.371 ], "z_axis": [ -0.853, -0.497, -0.155 ], "quaternion": [ 0.046, 0.682, 0.335, -0.648 ] } }, { "index": 67, "index_chain": 67, "chain_name": "A", "nt_resnum": 65, "nt_name": "A", "nt_code": "A", "nt_id": "///A/65", "linked_nts": [ "///A/64", "///A/66" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-pair-contact,ss-non-loop,phosphate", "alpha": -59.467, "beta": 167.974, "gamma": 59.001, "delta": 84.429, "epsilon": -130.802, "zeta": -63.433, "epsilon_zeta": -67.370, "bb_type": "BI", "chi": -175.414, "glyco_bond": "anti", "C5prime_xyz": [ -1.298, 8.411, 1.466 ], "P_xyz": [ 1.295, 8.461, 1.872 ], "form": ".", "ssZp": 4.646, "Dp": 4.699, "splay_angle": 27.485, "splay_distance": 4.318, "splay_ratio": 0.239, "d22": null, "d64": null, "eta": 174.460, "theta": -117.787, "eta_prime": -162.991, "theta_prime": -116.880, "eta_base": -100.770, "theta_base": -72.784, "v0": 4.855, "v1": -25.249, "v2": 34.975, "v3": -33.148, "v4": 17.873, "amplitude": 35.629, "phase_angle": 10.996, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.845, "filter_rmsd": 0.040, "frame": { "rmsd": 0.005, "origin": [ -20.415, 11.813, 38.227 ], "x_axis": [ 0.442, -0.340, -0.830 ], "y_axis": [ 0.448, -0.718, 0.532 ], "z_axis": [ -0.777, -0.607, -0.166 ], "quaternion": [ 0.374, 0.763, 0.035, -0.527 ] } }, { "index": 68, "index_chain": 68, "chain_name": "A", "nt_resnum": 66, "nt_name": "U", "nt_code": "U", "nt_id": "///A/66", "linked_nts": [ "///A/65", "///A/67" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-pair-contact,ss-non-loop", "alpha": -65.579, "beta": 175.119, "gamma": 47.098, "delta": 79.561, "epsilon": -145.066, "zeta": -71.281, "epsilon_zeta": -73.785, "bb_type": "BI", "chi": -156.664, "glyco_bond": "anti", "C5prime_xyz": [ -1.375, 8.719, 0.319 ], "P_xyz": [ 1.194, 9.195, 0.477 ], "form": ".", "ssZp": 4.350, "Dp": 4.695, "splay_angle": 39.689, "splay_distance": 6.127, "splay_ratio": 0.340, "d22": 4.435, "d64": 4.867, "eta": 156.720, "theta": -142.896, "eta_prime": -179.963, "theta_prime": -136.751, "eta_base": -112.014, "theta_base": -107.477, "v0": 3.103, "v1": -25.791, "v2": 37.523, "v3": -36.749, "v4": 21.185, "amplitude": 38.691, "phase_angle": 14.115, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.767, "filter_rmsd": 0.102, "frame": { "rmsd": 0.003, "origin": [ -21.402, 8.848, 35.247 ], "x_axis": [ 0.676, -0.733, -0.070 ], "y_axis": [ -0.174, -0.252, 0.952 ], "z_axis": [ -0.716, -0.632, -0.298 ], "quaternion": [ 0.531, 0.746, -0.304, -0.263 ] } }, { "index": 69, "index_chain": 69, "chain_name": "A", "nt_resnum": 67, "nt_name": "C", "nt_code": "C", "nt_id": "///A/67", "linked_nts": [ "///A/66", "///A/68" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,ss-non-loop,phosphate,splayed-apart", "alpha": -62.198, "beta": -172.287, "gamma": 55.421, "delta": 83.672, "epsilon": -155.500, "zeta": -75.640, "epsilon_zeta": -79.860, "bb_type": "BI", "chi": -166.548, "glyco_bond": "anti", "C5prime_xyz": [ -1.294, 8.667, 0.941 ], "P_xyz": [ 1.202, 8.897, 1.709 ], "form": ".", "ssZp": 4.455, "Dp": 4.543, "splay_angle": 135.352, "splay_distance": 17.245, "splay_ratio": 0.925, "d22": null, "d64": null, "eta": -179.662, "theta": -159.778, "eta_prime": -166.861, "theta_prime": -173.709, "eta_base": -129.263, "theta_base": 179.009, "v0": 3.268, "v1": -24.628, "v2": 35.423, "v3": -34.545, "v4": 19.696, "amplitude": 36.443, "phase_angle": 13.585, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.896, "filter_rmsd": 0.066, "frame": { "rmsd": 0.005, "origin": [ -23.455, 3.412, 33.305 ], "x_axis": [ 0.701, -0.358, 0.617 ], "y_axis": [ -0.425, 0.485, 0.764 ], "z_axis": [ -0.573, -0.798, 0.188 ], "quaternion": [ 0.770, 0.507, -0.386, 0.022 ] } }, { "index": 70, "index_chain": 70, "chain_name": "A", "nt_resnum": 68, "nt_name": "A", "nt_code": "A", "nt_id": "///A/68", "linked_nts": [ "///A/67", "///A/69" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,ss-non-loop,splayed-apart", "alpha": -69.282, "beta": -129.648, "gamma": 178.865, "delta": 82.542, "epsilon": -133.576, "zeta": -69.548, "epsilon_zeta": -64.029, "bb_type": "BI", "chi": -178.888, "glyco_bond": "anti", "C5prime_xyz": [ -1.564, 8.426, 1.625 ], "P_xyz": [ 0.104, 9.803, 0.132 ], "form": ".", "ssZp": 4.705, "Dp": 4.680, "splay_angle": 30.861, "splay_distance": 4.661, "splay_ratio": 0.266, "d22": null, "d64": null, "eta": -25.404, "theta": -146.215, "eta_prime": -22.843, "theta_prime": -146.150, "eta_base": -36.106, "theta_base": -95.201, "v0": 2.106, "v1": -23.991, "v2": 35.531, "v3": -35.200, "v4": 20.894, "amplitude": 36.843, "phase_angle": 15.340, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.040, "frame": { "rmsd": 0.005, "origin": [ -40.646, 3.125, 34.632 ], "x_axis": [ -0.285, 0.541, 0.791 ], "y_axis": [ 0.957, 0.112, 0.268 ], "z_axis": [ 0.057, 0.833, -0.550 ], "quaternion": [ -0.263, 0.537, 0.698, 0.395 ] } }, { "index": 71, "index_chain": 71, "chain_name": "A", "nt_resnum": 69, "nt_name": "A", "nt_code": "A", "nt_id": "///A/69", "linked_nts": [ "///A/68", "///A/70" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end", "alpha": -58.186, "beta": 168.194, "gamma": 48.546, "delta": 83.044, "epsilon": -140.346, "zeta": -79.447, "epsilon_zeta": -60.899, "bb_type": "BI", "chi": -175.548, "glyco_bond": "anti", "C5prime_xyz": [ -1.283, 8.461, 1.478 ], "P_xyz": [ 1.239, 8.504, 2.210 ], "form": "A", "ssZp": 4.649, "Dp": 4.666, "splay_angle": 24.727, "splay_distance": 3.811, "splay_ratio": 0.215, "d22": null, "d64": null, "eta": 164.002, "theta": -140.337, "eta_prime": -174.068, "theta_prime": -137.372, "eta_base": -101.725, "theta_base": -105.871, "v0": 3.387, "v1": -24.273, "v2": 34.764, "v3": -33.730, "v4": 19.193, "amplitude": 35.720, "phase_angle": 13.285, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.831, "filter_rmsd": 0.041, "frame": { "rmsd": 0.009, "origin": [ -40.933, 7.749, 35.141 ], "x_axis": [ 0.630, 0.251, 0.735 ], "y_axis": [ 0.741, -0.478, -0.472 ], "z_axis": [ 0.233, 0.841, -0.488 ], "quaternion": [ -0.408, 0.806, 0.308, 0.300 ] } }, { "index": 72, "index_chain": 72, "chain_name": "A", "nt_resnum": 70, "nt_name": "C", "nt_code": "C", "nt_id": "///A/70", "linked_nts": [ "///A/69", "///A/71" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -52.100, "beta": 163.077, "gamma": 47.581, "delta": 81.123, "epsilon": -144.425, "zeta": -88.704, "epsilon_zeta": -55.721, "bb_type": "BI", "chi": -172.436, "glyco_bond": "anti", "C5prime_xyz": [ -1.441, 8.591, 1.296 ], "P_xyz": [ 1.102, 8.754, 1.881 ], "form": "A", "ssZp": 4.598, "Dp": 4.643, "splay_angle": 23.264, "splay_distance": 3.570, "splay_ratio": 0.202, "d22": 4.475, "d64": 4.308, "eta": 167.581, "theta": -151.402, "eta_prime": -176.050, "theta_prime": -149.403, "eta_base": -127.133, "theta_base": -127.512, "v0": 2.808, "v1": -25.013, "v2": 36.482, "v3": -35.871, "v4": 20.794, "amplitude": 37.666, "phase_angle": 14.407, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.773, "filter_rmsd": 0.066, "frame": { "rmsd": 0.008, "origin": [ -40.452, 11.508, 34.742 ], "x_axis": [ 0.934, -0.136, 0.329 ], "y_axis": [ 0.190, -0.592, -0.783 ], "z_axis": [ 0.301, 0.794, -0.527 ], "quaternion": [ -0.451, 0.874, 0.016, 0.180 ] } }, { "index": 73, "index_chain": 73, "chain_name": "A", "nt_resnum": 71, "nt_name": "U", "nt_code": "U", "nt_id": "///A/71", "linked_nts": [ "///A/70", "///A/72" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem", "alpha": -46.262, "beta": 162.177, "gamma": 47.506, "delta": 83.373, "epsilon": -107.141, "zeta": -105.529, "epsilon_zeta": -1.612, "bb_type": "--", "chi": -168.936, "glyco_bond": "anti", "C5prime_xyz": [ -1.265, 8.622, 1.080 ], "P_xyz": [ 1.282, 8.706, 1.702 ], "form": "A", "ssZp": 4.304, "Dp": 4.624, "splay_angle": 22.409, "splay_distance": 3.848, "splay_ratio": 0.197, "d22": 3.808, "d64": 4.282, "eta": -175.180, "theta": -116.465, "eta_prime": -168.917, "theta_prime": -124.532, "eta_base": -141.250, "theta_base": -100.110, "v0": 2.278, "v1": -23.150, "v2": 34.066, "v3": -33.697, "v4": 19.821, "amplitude": 35.268, "phase_angle": 14.999, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.566, "filter_rmsd": 0.112, "frame": { "rmsd": 0.010, "origin": [ -39.870, 15.007, 34.337 ], "x_axis": [ 0.862, -0.502, -0.073 ], "y_axis": [ -0.330, -0.447, -0.832 ], "z_axis": [ 0.385, 0.741, -0.550 ], "quaternion": [ -0.465, 0.845, -0.246, 0.092 ] } }, { "index": 74, "index_chain": 74, "chain_name": "A", "nt_resnum": 72, "nt_name": "U", "nt_code": "U", "nt_id": "///A/72", "linked_nts": [ "///A/71", "///A/73" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,hairpin-loop,A-minor", "alpha": 79.862, "beta": -117.647, "gamma": -136.772, "delta": 94.008, "epsilon": -96.654, "zeta": -80.014, "epsilon_zeta": -16.640, "bb_type": "--", "chi": 179.624, "glyco_bond": "anti", "C5prime_xyz": [ -0.884, 7.991, 1.840 ], "P_xyz": [ 0.353, 10.054, 0.827 ], "form": ".", "ssZp": 4.477, "Dp": 4.618, "splay_angle": 22.138, "splay_distance": 4.071, "splay_ratio": 0.204, "d22": null, "d64": null, "eta": 178.867, "theta": -128.336, "eta_prime": -172.735, "theta_prime": -128.226, "eta_base": -130.225, "theta_base": -83.610, "v0": 10.829, "v1": -25.576, "v2": 29.876, "v3": -24.556, "v4": 8.782, "amplitude": 29.893, "phase_angle": 358.090, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.117, "frame": { "rmsd": 0.018, "origin": [ -36.918, 17.281, 33.376 ], "x_axis": [ 0.535, -0.741, -0.406 ], "y_axis": [ -0.706, -0.127, -0.697 ], "z_axis": [ 0.465, 0.659, -0.591 ], "quaternion": [ -0.452, 0.751, -0.482, 0.020 ] } }, { "index": 75, "index_chain": 75, "chain_name": "A", "nt_resnum": 73, "nt_name": "G", "nt_code": "G", "nt_id": "///A/73", "linked_nts": [ "///A/72", "///A/74" ], "nt_type": "RNA", "dbn": ".", "summary": "u-turn,anti,~C3'-endo,non-canonical,non-pair-contact,helix-end,hairpin-loop,cap-acceptor", "alpha": 84.957, "beta": -131.236, "gamma": -137.353, "delta": 81.389, "epsilon": -96.769, "zeta": -42.142, "epsilon_zeta": -54.627, "bb_type": "--", "chi": -166.092, "glyco_bond": "anti", "C5prime_xyz": [ -0.981, 8.573, 0.899 ], "P_xyz": [ -0.432, 10.658, -0.569 ], "form": ".", "ssZp": 4.318, "Dp": 4.826, "splay_angle": 76.571, "splay_distance": 11.002, "splay_ratio": 0.620, "d22": null, "d64": null, "eta": 152.119, "theta": -121.472, "eta_prime": 175.895, "theta_prime": -164.203, "eta_base": -118.752, "theta_base": 143.338, "v0": 6.709, "v1": -28.045, "v2": 37.662, "v3": -34.817, "v4": 17.766, "amplitude": 38.105, "phase_angle": 8.744, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.009, "frame": { "rmsd": 0.009, "origin": [ -33.704, 16.353, 31.057 ], "x_axis": [ 0.002, -0.634, -0.774 ], "y_axis": [ -0.733, 0.526, -0.432 ], "z_axis": [ 0.681, 0.568, -0.463 ], "quaternion": [ 0.516, -0.485, 0.705, 0.048 ] } }, { "index": 76, "index_chain": 76, "chain_name": "A", "nt_resnum": 74, "nt_name": "A", "nt_code": "A", "nt_id": "///A/74", "linked_nts": [ "///A/73", "///A/75" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,u-turn,anti,~C3'-endo,BI,non-pair-contact,hairpin-loop", "alpha": -158.245, "beta": 113.546, "gamma": 30.382, "delta": 80.472, "epsilon": -170.687, "zeta": -82.224, "epsilon_zeta": -88.462, "bb_type": "BI", "chi": -165.306, "glyco_bond": "anti", "C5prime_xyz": [ -1.680, 8.754, 0.812 ], "P_xyz": [ 0.883, 8.357, 1.213 ], "form": ".", "ssZp": 4.347, "Dp": 4.387, "splay_angle": 28.084, "splay_distance": 4.270, "splay_ratio": 0.243, "d22": null, "d64": null, "eta": -10.425, "theta": -113.987, "eta_prime": 37.812, "theta_prime": -122.161, "eta_base": 25.305, "theta_base": -73.026, "v0": -1.307, "v1": -21.087, "v2": 34.144, "v3": -35.861, "v4": 23.447, "amplitude": 36.480, "phase_angle": 20.614, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.004, "origin": [ -30.734, 26.796, 32.835 ], "x_axis": [ -0.768, 0.483, 0.421 ], "y_axis": [ -0.576, -0.233, -0.784 ], "z_axis": [ -0.281, -0.844, 0.457 ], "quaternion": [ 0.338, 0.045, -0.519, 0.784 ] } }, { "index": 77, "index_chain": 77, "chain_name": "A", "nt_resnum": 75, "nt_name": "A", "nt_code": "A", "nt_id": "///A/75", "linked_nts": [ "///A/74", "///A/76" ], "nt_type": "RNA", "dbn": ".", "summary": "u-turn,anti,~C3'-endo,BI,non-pair-contact,hairpin-loop,cap-donor,phosphate", "alpha": 167.365, "beta": -127.268, "gamma": 145.059, "delta": 83.529, "epsilon": -139.055, "zeta": -72.558, "epsilon_zeta": -66.497, "bb_type": "BI", "chi": -175.158, "glyco_bond": "anti", "C5prime_xyz": [ -1.485, 8.503, 1.436 ], "P_xyz": [ 0.938, 8.797, 0.468 ], "form": ".", "ssZp": 4.531, "Dp": 4.599, "splay_angle": 24.963, "splay_distance": 3.764, "splay_ratio": 0.216, "d22": null, "d64": null, "eta": 155.651, "theta": -130.987, "eta_prime": -174.870, "theta_prime": -136.861, "eta_base": -94.549, "theta_base": -85.475, "v0": 2.191, "v1": -22.985, "v2": 33.835, "v3": -33.531, "v4": 19.775, "amplitude": 35.048, "phase_angle": 15.117, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.040, "frame": { "rmsd": 0.006, "origin": [ -34.205, 25.340, 34.852 ], "x_axis": [ -0.931, 0.045, -0.361 ], "y_axis": [ 0.266, -0.594, -0.759 ], "z_axis": [ -0.249, -0.803, 0.541 ], "quaternion": [ -0.063, -0.174, -0.446, 0.876 ] } }, { "index": 78, "index_chain": 78, "chain_name": "A", "nt_resnum": 76, "nt_name": "A", "nt_code": "A", "nt_id": "///A/76", "linked_nts": [ "///A/75", "///A/77" ], "nt_type": "RNA", "dbn": ".", "summary": "u-turn,anti,~C3'-endo,non-canonical,non-pair-contact,helix-end,hairpin-loop,A-minor,phosphate", "alpha": -55.701, "beta": 172.080, "gamma": 46.920, "delta": 86.971, "epsilon": 171.854, "zeta": 29.714, "epsilon_zeta": 142.141, "bb_type": "--", "chi": -143.411, "glyco_bond": "anti", "C5prime_xyz": [ -0.742, 8.542, -0.321 ], "P_xyz": [ 1.885, 8.387, -0.178 ], "form": ".", "ssZp": 3.807, "Dp": 4.201, "splay_angle": 39.402, "splay_distance": 6.456, "splay_ratio": 0.338, "d22": null, "d64": null, "eta": 164.768, "theta": -83.832, "eta_prime": -169.156, "theta_prime": -92.823, "eta_base": -93.905, "theta_base": -57.928, "v0": 7.735, "v1": -25.705, "v2": 32.990, "v3": -29.488, "v4": 13.811, "amplitude": 33.146, "phase_angle": 5.546, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.797, "filter_rmsd": 0.042, "frame": { "rmsd": 0.013, "origin": [ -36.872, 22.717, 35.270 ], "x_axis": [ -0.322, -0.560, -0.763 ], "y_axis": [ 0.870, -0.494, -0.005 ], "z_axis": [ -0.374, -0.665, 0.646 ], "quaternion": [ -0.456, -0.362, -0.213, 0.785 ] } }, { "index": 79, "index_chain": 79, "chain_name": "A", "nt_resnum": 77, "nt_name": "A", "nt_code": "A", "nt_id": "///A/77", "linked_nts": [ "///A/76", "///A/78" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,hairpin-loop,A-minor,phosphate", "alpha": -159.075, "beta": 120.198, "gamma": 137.950, "delta": 87.034, "epsilon": -124.585, "zeta": -91.936, "epsilon_zeta": -32.650, "bb_type": "--", "chi": -160.198, "glyco_bond": "anti", "C5prime_xyz": [ -0.890, 8.387, 0.624 ], "P_xyz": [ -0.039, 9.692, -1.468 ], "form": "A", "ssZp": 4.361, "Dp": 4.784, "splay_angle": 20.348, "splay_distance": 3.176, "splay_ratio": 0.177, "d22": null, "d64": null, "eta": 166.467, "theta": -178.569, "eta_prime": -157.025, "theta_prime": -174.995, "eta_base": -89.834, "theta_base": -154.819, "v0": 11.309, "v1": -29.587, "v2": 35.672, "v3": -30.249, "v4": 12.042, "amplitude": 35.675, "phase_angle": 0.728, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.034, "frame": { "rmsd": 0.012, "origin": [ -37.508, 16.574, 33.389 ], "x_axis": [ 0.449, -0.840, -0.306 ], "y_axis": [ 0.637, 0.061, 0.768 ], "z_axis": [ -0.626, -0.540, 0.562 ], "quaternion": [ 0.720, 0.454, -0.111, -0.513 ] } }, { "index": 80, "index_chain": 80, "chain_name": "A", "nt_resnum": 78, "nt_name": "A", "nt_code": "A", "nt_id": "///A/78", "linked_nts": [ "///A/77", "///A/79" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -63.179, "beta": 141.318, "gamma": 66.478, "delta": 79.168, "epsilon": -138.726, "zeta": -79.235, "epsilon_zeta": -59.490, "bb_type": "BI", "chi": -167.046, "glyco_bond": "anti", "C5prime_xyz": [ -1.373, 8.642, 0.928 ], "P_xyz": [ 1.114, 8.891, 0.161 ], "form": "A", "ssZp": 4.585, "Dp": 4.720, "splay_angle": 24.967, "splay_distance": 3.901, "splay_ratio": 0.218, "d22": null, "d64": null, "eta": 159.373, "theta": -138.774, "eta_prime": 175.682, "theta_prime": -141.131, "eta_base": -150.816, "theta_base": -112.771, "v0": 3.285, "v1": -25.953, "v2": 37.568, "v3": -36.695, "v4": 21.068, "amplitude": 38.695, "phase_angle": 13.859, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1L", "suiteness": 0.895, "filter_rmsd": 0.037, "frame": { "rmsd": 0.004, "origin": [ -39.897, 14.687, 34.291 ], "x_axis": [ 0.753, -0.657, -0.020 ], "y_axis": [ 0.299, 0.315, 0.901 ], "z_axis": [ -0.585, -0.685, 0.434 ], "quaternion": [ 0.791, 0.501, -0.179, -0.302 ] } }, { "index": 81, "index_chain": 81, "chain_name": "A", "nt_resnum": 79, "nt_name": "G", "nt_code": "G", "nt_id": "///A/79", "linked_nts": [ "///A/78", "///A/80" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -50.232, "beta": 160.544, "gamma": 50.457, "delta": 80.567, "epsilon": -147.785, "zeta": -77.299, "epsilon_zeta": -70.486, "bb_type": "BI", "chi": -167.147, "glyco_bond": "anti", "C5prime_xyz": [ -1.735, 8.636, 0.961 ], "P_xyz": [ 0.839, 9.082, 1.153 ], "form": "A", "ssZp": 4.559, "Dp": 4.639, "splay_angle": 24.156, "splay_distance": 3.882, "splay_ratio": 0.214, "d22": null, "d64": null, "eta": 167.525, "theta": -145.469, "eta_prime": -174.601, "theta_prime": -145.178, "eta_base": -124.723, "theta_base": -123.476, "v0": 2.524, "v1": -24.955, "v2": 36.694, "v3": -36.274, "v4": 21.239, "amplitude": 37.969, "phase_angle": 14.893, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.735, "filter_rmsd": 0.016, "frame": { "rmsd": 0.016, "origin": [ -40.758, 10.919, 34.816 ], "x_axis": [ 0.851, -0.256, 0.459 ], "y_axis": [ -0.217, 0.624, 0.751 ], "z_axis": [ -0.479, -0.738, 0.475 ], "quaternion": [ 0.859, 0.433, -0.273, -0.011 ] } }, { "index": 82, "index_chain": 82, "chain_name": "A", "nt_resnum": 80, "nt_name": "U", "nt_code": "U", "nt_id": "///A/80", "linked_nts": [ "///A/79", "///A/81" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,phosphate", "alpha": -54.408, "beta": 173.962, "gamma": 50.732, "delta": 80.442, "epsilon": -118.975, "zeta": -114.095, "epsilon_zeta": -4.880, "bb_type": "--", "chi": -156.326, "glyco_bond": "anti", "C5prime_xyz": [ -1.546, 8.804, 0.293 ], "P_xyz": [ 0.989, 9.422, 0.497 ], "form": ".", "ssZp": 4.080, "Dp": 4.678, "splay_angle": 27.347, "splay_distance": 4.436, "splay_ratio": 0.237, "d22": null, "d64": null, "eta": -177.990, "theta": -162.444, "eta_prime": -170.311, "theta_prime": -147.798, "eta_base": -139.960, "theta_base": -163.261, "v0": -0.678, "v1": -21.550, "v2": 34.360, "v3": -35.729, "v4": 22.946, "amplitude": 36.489, "phase_angle": 19.671, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.879, "filter_rmsd": 0.103, "frame": { "rmsd": 0.005, "origin": [ -41.158, 7.104, 35.415 ], "x_axis": [ 0.622, 0.144, 0.769 ], "y_axis": [ -0.674, 0.599, 0.433 ], "z_axis": [ -0.399, -0.788, 0.470 ], "quaternion": [ 0.820, 0.372, -0.356, 0.249 ] } }, { "index": 83, "index_chain": 83, "chain_name": "A", "nt_resnum": 81, "nt_name": "G", "nt_code": "G", "nt_id": "///A/81", "linked_nts": [ "///A/80", "///A/82" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C2'-endo,BII,non-canonical,helix-end,ss-non-loop", "alpha": -51.721, "beta": 161.186, "gamma": 50.589, "delta": 145.972, "epsilon": -97.149, "zeta": -170.452, "epsilon_zeta": 73.303, "bb_type": "BII", "chi": -114.343, "glyco_bond": "anti", "C5prime_xyz": [ -2.094, 8.475, -1.501 ], "P_xyz": [ 0.406, 9.205, -1.223 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": -167.143, "theta": null, "eta_prime": -152.998, "theta_prime": null, "eta_base": -174.712, "theta_base": null, "v0": -22.444, "v1": 36.090, "v2": -35.272, "v3": 23.248, "v4": -0.697, "amplitude": 37.019, "phase_angle": 162.327, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1b", "suiteness": 0.066, "filter_rmsd": 0.003, "frame": { "rmsd": 0.003, "origin": [ -43.158, 3.152, 35.176 ], "x_axis": [ 0.657, 0.678, 0.329 ], "y_axis": [ -0.731, 0.466, 0.499 ], "z_axis": [ 0.185, -0.568, 0.802 ], "quaternion": [ 0.855, 0.312, -0.042, 0.412 ] } }, { "index": 84, "index_chain": 84, "chain_name": "A", "nt_resnum": 82, "nt_name": "A", "nt_code": "A", "nt_id": "///A/82", "linked_nts": [ "///A/81", null ], "nt_type": "DNA", "dbn": ".", "summary": "non-stack,ss-non-loop", "alpha": null, "beta": null, "gamma": null, "delta": null, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": null, "glyco_bond": "--", "C5prime_xyz": [ null, null, null ], "P_xyz": [ null, null, null ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": null, "v1": null, "v2": null, "v3": null, "v4": null, "amplitude": null, "phase_angle": null, "puckering": "", "sugar_class": "--", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": null }, { "index": 85, "index_chain": 1, "chain_name": "C", "nt_resnum": -7, "nt_name": "DC", "nt_code": "C", "nt_id": "c. C & i. \\-7", "linked_nts": [ null, "c. C & i. \\-6" ], "nt_type": "DNA", "dbn": "[", "summary": "pseudoknotted,anti,~C3'-endo,non-stack,canonical,helix-end,stem-end", "alpha": null, "beta": null, "gamma": -161.346, "delta": 91.473, "epsilon": -78.263, "zeta": -139.761, "epsilon_zeta": 61.499, "bb_type": "--", "chi": 166.985, "glyco_bond": "anti", "C5prime_xyz": [ -1.442, 7.844, 2.373 ], "P_xyz": [ null, null, null ], "form": ".", "ssZp": 4.531, "Dp": 4.568, "splay_angle": 24.543, "splay_distance": 3.755, "splay_ratio": 0.217, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": 12.301, "v1": -32.039, "v2": 38.168, "v3": -32.025, "v4": 12.534, "amplitude": 38.168, "phase_angle": 0.107, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.064, "frame": { "rmsd": 0.004, "origin": [ -15.925, -18.846, 10.613 ], "x_axis": [ 0.546, 0.837, 0.019 ], "y_axis": [ -0.817, 0.528, 0.231 ], "z_axis": [ 0.183, -0.142, 0.973 ], "quaternion": [ 0.873, 0.107, 0.047, 0.474 ] } }, { "index": 86, "index_chain": 2, "chain_name": "C", "nt_resnum": -6, "nt_name": "DA", "nt_code": "A", "nt_id": "c. C & i. \\-6", "linked_nts": [ "c. C & i. \\-7", "c. C & i. \\-5" ], "nt_type": "DNA", "dbn": "[", "summary": "pseudoknotted,anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -14.914, "beta": 144.068, "gamma": 28.182, "delta": 148.159, "epsilon": -156.110, "zeta": -111.141, "epsilon_zeta": -44.969, "bb_type": "BI", "chi": -110.016, "glyco_bond": "anti", "C5prime_xyz": [ -1.387, 8.128, -1.566 ], "P_xyz": [ 1.089, 8.151, -0.749 ], "form": "B", "ssZp": 1.734, "Dp": 1.940, "splay_angle": 19.641, "splay_distance": 3.383, "splay_ratio": 0.171, "d22": null, "d64": null, "eta": 170.126, "theta": -122.666, "eta_prime": -158.185, "theta_prime": -145.818, "eta_base": -139.138, "theta_base": -117.544, "v0": -5.983, "v1": 23.926, "v2": -31.695, "v3": 29.077, "v4": -14.756, "amplitude": 32.016, "phase_angle": 188.124, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.003, "origin": [ -14.873, -19.634, 14.131 ], "x_axis": [ -0.155, 0.963, -0.221 ], "y_axis": [ -0.914, -0.055, 0.402 ], "z_axis": [ 0.375, 0.264, 0.889 ], "quaternion": [ 0.648, 0.053, 0.230, 0.724 ] } }, { "index": 87, "index_chain": 3, "chain_name": "C", "nt_resnum": -5, "nt_name": "DA", "nt_code": "A", "nt_id": "c. C & i. \\-5", "linked_nts": [ "c. C & i. \\-6", "c. C & i. \\-4" ], "nt_type": "DNA", "dbn": "[", "summary": "pseudoknotted,anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -72.303, "beta": 146.354, "gamma": 77.243, "delta": 120.986, "epsilon": -158.177, "zeta": -104.049, "epsilon_zeta": -54.128, "bb_type": "BI", "chi": -129.730, "glyco_bond": "anti", "C5prime_xyz": [ -2.582, 8.729, -1.273 ], "P_xyz": [ -0.188, 9.610, -1.801 ], "form": ".", "ssZp": 2.047, "Dp": 2.223, "splay_angle": 17.846, "splay_distance": 3.411, "splay_ratio": 0.166, "d22": null, "d64": null, "eta": 171.252, "theta": -135.045, "eta_prime": -162.418, "theta_prime": -151.529, "eta_base": -126.815, "theta_base": -120.442, "v0": -38.261, "v1": 38.408, "v2": -24.507, "v3": 3.359, "v4": 21.637, "amplitude": 39.399, "phase_angle": 128.463, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.039, "frame": { "rmsd": 0.006, "origin": [ -13.503, -19.232, 17.198 ], "x_axis": [ -0.551, 0.834, 0.023 ], "y_axis": [ -0.727, -0.494, 0.476 ], "z_axis": [ 0.409, 0.246, 0.879 ], "quaternion": [ 0.457, 0.126, 0.211, 0.855 ] } }, { "index": 88, "index_chain": 4, "chain_name": "C", "nt_resnum": -4, "nt_name": "DT", "nt_code": "T", "nt_id": "c. C & i. \\-4", "linked_nts": [ "c. C & i. \\-5", "c. C & i. \\-3" ], "nt_type": "DNA", "dbn": "[", "summary": "pseudoknotted,anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": -20.556, "beta": 160.718, "gamma": 2.091, "delta": 121.866, "epsilon": -150.706, "zeta": -134.969, "epsilon_zeta": -15.736, "bb_type": "--", "chi": -109.021, "glyco_bond": "anti", "C5prime_xyz": [ -3.056, 8.256, -2.073 ], "P_xyz": [ -1.806, 10.547, -2.026 ], "form": "B", "ssZp": 2.067, "Dp": 2.207, "splay_angle": 19.575, "splay_distance": 3.401, "splay_ratio": 0.170, "d22": null, "d64": null, "eta": 164.373, "theta": -164.929, "eta_prime": -175.897, "theta_prime": -165.960, "eta_base": -138.162, "theta_base": -118.925, "v0": -39.213, "v1": 39.435, "v2": -25.153, "v3": 3.409, "v4": 22.180, "amplitude": 40.430, "phase_angle": 128.473, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.105, "frame": { "rmsd": 0.003, "origin": [ -11.904, -17.207, 19.429 ], "x_axis": [ -0.861, 0.482, 0.164 ], "y_axis": [ -0.359, -0.803, 0.476 ], "z_axis": [ 0.361, 0.351, 0.864 ], "quaternion": [ 0.224, 0.140, 0.220, 0.939 ] } }, { "index": 89, "index_chain": 5, "chain_name": "C", "nt_resnum": -3, "nt_name": "DA", "nt_code": "A", "nt_id": "c. C & i. \\-3", "linked_nts": [ "c. C & i. \\-4", "c. C & i. \\-2" ], "nt_type": "DNA", "dbn": "[", "summary": "pseudoknotted,anti,canonical,non-pair-contact,helix,stem", "alpha": -24.725, "beta": 135.716, "gamma": 17.483, "delta": 82.805, "epsilon": 61.574, "zeta": 65.007, "epsilon_zeta": -3.433, "bb_type": "--", "chi": -126.646, "glyco_bond": "anti", "C5prime_xyz": [ -2.686, 8.632, -1.525 ], "P_xyz": [ -0.411, 9.878, -1.715 ], "form": "B", "ssZp": 1.745, "Dp": 1.820, "splay_angle": 19.467, "splay_distance": 3.444, "splay_ratio": 0.171, "d22": null, "d64": null, "eta": -174.815, "theta": -153.535, "eta_prime": -162.011, "theta_prime": -164.725, "eta_base": -114.259, "theta_base": -128.656, "v0": -24.766, "v1": 1.424, "v2": 20.683, "v3": -35.573, "v4": 38.208, "amplitude": 38.509, "phase_angle": 57.513, "puckering": "C4'-exo", "sugar_class": "pucker-CHK", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.039, "frame": { "rmsd": 0.007, "origin": [ -11.521, -15.922, 22.555 ], "x_axis": [ -0.945, -0.098, 0.312 ], "y_axis": [ 0.207, -0.918, 0.338 ], "z_axis": [ 0.254, 0.384, 0.888 ], "quaternion": [ -0.079, 0.146, 0.186, 0.968 ] } }, { "index": 90, "index_chain": 6, "chain_name": "C", "nt_resnum": -2, "nt_name": "DC", "nt_code": "C", "nt_id": "c. C & i. \\-2", "linked_nts": [ "c. C & i. \\-3", "c. C & i. \\-1" ], "nt_type": "DNA", "dbn": "[", "summary": "pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -177.613, "beta": 152.510, "gamma": 102.195, "delta": 87.666, "epsilon": -160.502, "zeta": -79.070, "epsilon_zeta": -81.433, "bb_type": "BI", "chi": -155.256, "glyco_bond": "anti", "C5prime_xyz": [ -2.386, 9.082, -0.247 ], "P_xyz": [ -0.366, 10.227, -1.428 ], "form": "B", "ssZp": 3.408, "Dp": 3.534, "splay_angle": 18.909, "splay_distance": 3.275, "splay_ratio": 0.165, "d22": 4.096, "d64": 3.752, "eta": 161.456, "theta": -160.313, "eta_prime": 175.469, "theta_prime": -161.533, "eta_base": -140.423, "theta_base": -120.676, "v0": -29.795, "v1": 8.257, "v2": 14.596, "v3": -32.189, "v4": 39.144, "amplitude": 38.422, "phase_angle": 67.673, "puckering": "C4'-exo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.065, "frame": { "rmsd": 0.005, "origin": [ -10.830, -13.982, 25.315 ], "x_axis": [ -0.720, -0.524, 0.455 ], "y_axis": [ 0.635, -0.762, 0.127 ], "z_axis": [ 0.280, 0.380, 0.881 ], "quaternion": [ -0.316, 0.200, 0.138, 0.917 ] } }, { "index": 91, "index_chain": 7, "chain_name": "C", "nt_resnum": -1, "nt_name": "DC", "nt_code": "C", "nt_id": "c. C & i. \\-1", "linked_nts": [ "c. C & i. \\-2", "///C/0" ], "nt_type": "DNA", "dbn": "[", "summary": "pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -53.908, "beta": 167.915, "gamma": 44.858, "delta": 94.407, "epsilon": -157.010, "zeta": -92.673, "epsilon_zeta": -64.338, "bb_type": "BI", "chi": -138.918, "glyco_bond": "anti", "C5prime_xyz": [ -2.043, 8.938, -0.919 ], "P_xyz": [ 0.320, 10.061, -0.672 ], "form": "B", "ssZp": 3.077, "Dp": 3.547, "splay_angle": 18.774, "splay_distance": 3.257, "splay_ratio": 0.168, "d22": 4.390, "d64": 3.472, "eta": 170.546, "theta": -153.387, "eta_prime": -172.371, "theta_prime": -146.508, "eta_base": -122.887, "theta_base": -105.146, "v0": -22.378, "v1": 4.702, "v2": 13.244, "v3": -26.374, "v4": 30.915, "amplitude": 30.445, "phase_angle": 64.213, "puckering": "C4'-exo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.434, "filter_rmsd": 0.064, "frame": { "rmsd": 0.004, "origin": [ -11.026, -12.996, 28.432 ], "x_axis": [ -0.217, -0.899, 0.381 ], "y_axis": [ 0.961, -0.264, -0.075 ], "z_axis": [ 0.168, 0.350, 0.922 ], "quaternion": [ 0.600, -0.177, -0.088, -0.775 ] } }, { "index": 92, "index_chain": 8, "chain_name": "C", "nt_resnum": 0, "nt_name": "DT", "nt_code": "T", "nt_id": "///C/0", "linked_nts": [ "c. C & i. \\-1", "///C/1" ], "nt_type": "DNA", "dbn": "[", "summary": "pseudoknotted,anti,~C2'-endo,canonical,non-pair-contact,helix-end,stem-end,splayed-apart", "alpha": -45.699, "beta": 153.623, "gamma": 56.234, "delta": 140.092, "epsilon": -79.923, "zeta": -57.575, "epsilon_zeta": -22.348, "bb_type": "--", "chi": -111.047, "glyco_bond": "anti", "C5prime_xyz": [ -2.420, 8.401, -1.704 ], "P_xyz": [ 0.095, 9.053, -1.956 ], "form": ".", "ssZp": 0.665, "Dp": 0.661, "splay_angle": 141.986, "splay_distance": 20.234, "splay_ratio": 0.946, "d22": null, "d64": null, "eta": -157.471, "theta": -32.354, "eta_prime": -132.290, "theta_prime": -62.264, "eta_base": -94.754, "theta_base": -57.412, "v0": -27.690, "v1": 38.785, "v2": -34.349, "v3": 19.426, "v4": 4.914, "amplitude": 38.274, "phase_angle": 153.825, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1b", "suiteness": 0.398, "filter_rmsd": 0.107, "frame": { "rmsd": 0.006, "origin": [ -9.896, -12.856, 31.483 ], "x_axis": [ 0.327, -0.916, 0.230 ], "y_axis": [ 0.945, 0.322, -0.062 ], "z_axis": [ -0.017, 0.238, 0.971 ], "quaternion": [ 0.809, -0.093, -0.076, -0.575 ] } }, { "index": 93, "index_chain": 9, "chain_name": "C", "nt_resnum": 1, "nt_name": "DG", "nt_code": "G", "nt_id": "///C/1", "linked_nts": [ "///C/0", "///C/2" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,phosphate,splayed-apart", "alpha": -83.278, "beta": 166.764, "gamma": -166.459, "delta": 107.765, "epsilon": -172.850, "zeta": -87.272, "epsilon_zeta": -85.578, "bb_type": "BI", "chi": -142.513, "glyco_bond": "anti", "C5prime_xyz": [ -2.676, 8.901, -0.748 ], "P_xyz": [ -2.610, 10.616, -2.700 ], "form": ".", "ssZp": 2.976, "Dp": 2.901, "splay_angle": 23.800, "splay_distance": 4.248, "splay_ratio": 0.213, "d22": null, "d64": null, "eta": -78.470, "theta": 155.691, "eta_prime": -45.855, "theta_prime": 163.710, "eta_base": -37.285, "theta_base": -166.760, "v0": -37.610, "v1": 28.218, "v2": -9.086, "v3": -12.100, "v4": 31.198, "amplitude": 36.603, "phase_angle": 104.373, "puckering": "O4'-endo", "sugar_class": "--", "bin": "23t", "cluster": "2h", "suiteness": 0.032, "filter_rmsd": 0.004, "frame": { "rmsd": 0.004, "origin": [ 5.505, 0.067, 33.768 ], "x_axis": [ -0.081, 0.950, -0.303 ], "y_axis": [ -0.976, -0.137, -0.167 ], "z_axis": [ -0.200, 0.282, 0.938 ], "quaternion": [ 0.656, -0.171, 0.039, 0.734 ] } }, { "index": 94, "index_chain": 10, "chain_name": "C", "nt_resnum": 2, "nt_name": "DG", "nt_code": "G", "nt_id": "///C/2", "linked_nts": [ "///C/1", "///C/3" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -99.054, "beta": 169.422, "gamma": 79.307, "delta": 74.365, "epsilon": -166.373, "zeta": -77.886, "epsilon_zeta": -88.487, "bb_type": "BI", "chi": -168.811, "glyco_bond": "anti", "C5prime_xyz": [ -2.515, 8.978, 0.624 ], "P_xyz": [ -0.437, 10.503, 0.337 ], "form": "A", "ssZp": 4.348, "Dp": 4.295, "splay_angle": 23.988, "splay_distance": 3.881, "splay_ratio": 0.210, "d22": null, "d64": null, "eta": 158.678, "theta": -169.114, "eta_prime": 165.944, "theta_prime": -167.891, "eta_base": -157.389, "theta_base": -135.866, "v0": -19.954, "v1": -9.641, "v2": 33.563, "v3": -46.387, "v4": 42.066, "amplitude": 46.436, "phase_angle": 43.716, "puckering": "C4'-exo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.006, "frame": { "rmsd": 0.006, "origin": [ 6.840, 0.941, 37.705 ], "x_axis": [ -0.493, 0.818, -0.296 ], "y_axis": [ -0.832, -0.543, -0.116 ], "z_axis": [ -0.256, 0.189, 0.948 ], "quaternion": [ 0.478, -0.160, 0.021, 0.864 ] } }, { "index": 95, "index_chain": 11, "chain_name": "C", "nt_resnum": 3, "nt_name": "DT", "nt_code": "T", "nt_id": "///C/3", "linked_nts": [ "///C/2", "///C/4" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -57.328, "beta": 173.384, "gamma": 50.406, "delta": 83.050, "epsilon": -152.892, "zeta": -72.232, "epsilon_zeta": -80.661, "bb_type": "BI", "chi": -160.889, "glyco_bond": "anti", "C5prime_xyz": [ -1.633, 8.822, 0.517 ], "P_xyz": [ 0.870, 9.447, 0.907 ], "form": "A", "ssZp": 4.334, "Dp": 4.490, "splay_angle": 23.585, "splay_distance": 3.938, "splay_ratio": 0.208, "d22": null, "d64": null, "eta": 175.906, "theta": -145.896, "eta_prime": -174.722, "theta_prime": -146.656, "eta_base": -134.374, "theta_base": -126.438, "v0": -3.795, "v1": -20.979, "v2": 36.174, "v3": -39.413, "v4": 27.312, "amplitude": 39.593, "phase_angle": 23.988, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.690, "filter_rmsd": 0.106, "frame": { "rmsd": 0.006, "origin": [ 7.005, 2.950, 41.021 ], "x_axis": [ -0.876, 0.401, -0.266 ], "y_axis": [ -0.429, -0.901, 0.055 ], "z_axis": [ -0.218, 0.162, 0.962 ], "quaternion": [ 0.215, -0.125, 0.056, 0.967 ] } }, { "index": 96, "index_chain": 12, "chain_name": "C", "nt_resnum": 4, "nt_name": "DG", "nt_code": "G", "nt_id": "///C/4", "linked_nts": [ "///C/3", "///C/5" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -65.552, "beta": 170.589, "gamma": 52.424, "delta": 79.425, "epsilon": -158.330, "zeta": -70.418, "epsilon_zeta": -87.912, "bb_type": "BI", "chi": -167.580, "glyco_bond": "anti", "C5prime_xyz": [ -1.862, 8.871, 0.808 ], "P_xyz": [ 0.576, 9.763, 1.096 ], "form": ".", "ssZp": 4.527, "Dp": 4.536, "splay_angle": 24.809, "splay_distance": 4.269, "splay_ratio": 0.226, "d22": null, "d64": null, "eta": 164.016, "theta": -152.495, "eta_prime": 177.396, "theta_prime": -153.651, "eta_base": -147.102, "theta_base": -138.938, "v0": -5.737, "v1": -21.315, "v2": 38.409, "v3": -42.789, "v4": 30.719, "amplitude": 42.773, "phase_angle": 26.107, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.973, "filter_rmsd": 0.006, "frame": { "rmsd": 0.006, "origin": [ 6.447, 5.324, 44.113 ], "x_axis": [ -0.927, -0.081, -0.365 ], "y_axis": [ 0.025, -0.987, 0.157 ], "z_axis": [ -0.373, 0.137, 0.918 ], "quaternion": [ -0.027, -0.189, 0.075, 0.979 ] } }, { "index": 97, "index_chain": 13, "chain_name": "C", "nt_resnum": 5, "nt_name": "DC", "nt_code": "C", "nt_id": "///C/5", "linked_nts": [ "///C/4", "///C/6" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -71.127, "beta": 172.003, "gamma": 66.505, "delta": 75.456, "epsilon": -159.084, "zeta": -76.364, "epsilon_zeta": -82.720, "bb_type": "BI", "chi": -171.629, "glyco_bond": "anti", "C5prime_xyz": [ -1.968, 8.944, 0.975 ], "P_xyz": [ 0.388, 10.048, 1.155 ], "form": "A", "ssZp": 4.530, "Dp": 4.489, "splay_angle": 26.950, "splay_distance": 4.282, "splay_ratio": 0.235, "d22": 4.719, "d64": 4.946, "eta": 173.576, "theta": -161.994, "eta_prime": -175.816, "theta_prime": -159.127, "eta_base": -148.883, "theta_base": -131.742, "v0": -10.862, "v1": -17.769, "v2": 37.752, "v3": -45.354, "v4": 35.645, "amplitude": 44.774, "phase_angle": 32.525, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.647, "filter_rmsd": 0.062, "frame": { "rmsd": 0.005, "origin": [ 4.908, 8.390, 46.654 ], "x_axis": [ -0.823, -0.465, -0.325 ], "y_axis": [ 0.380, -0.877, 0.293 ], "z_axis": [ -0.422, 0.118, 0.899 ], "quaternion": [ -0.223, -0.197, 0.108, 0.949 ] } }, { "index": 98, "index_chain": 14, "chain_name": "C", "nt_resnum": 6, "nt_name": "DT", "nt_code": "T", "nt_id": "///C/6", "linked_nts": [ "///C/5", "///C/7" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -59.954, "beta": 175.483, "gamma": 51.922, "delta": 82.280, "epsilon": -144.059, "zeta": -74.486, "epsilon_zeta": -69.572, "bb_type": "BI", "chi": -163.379, "glyco_bond": "anti", "C5prime_xyz": [ -1.454, 8.754, 0.728 ], "P_xyz": [ 1.084, 9.261, 1.133 ], "form": "A", "ssZp": 4.431, "Dp": 4.605, "splay_angle": 21.629, "splay_distance": 3.633, "splay_ratio": 0.193, "d22": null, "d64": null, "eta": 177.461, "theta": -142.524, "eta_prime": -173.487, "theta_prime": -141.193, "eta_base": -138.678, "theta_base": -120.651, "v0": 1.808, "v1": -25.991, "v2": 38.927, "v3": -39.003, "v4": 23.475, "amplitude": 40.525, "phase_angle": 16.144, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.835, "filter_rmsd": 0.105, "frame": { "rmsd": 0.003, "origin": [ 2.289, 10.249, 49.487 ], "x_axis": [ -0.511, -0.851, -0.124 ], "y_axis": [ 0.771, -0.517, 0.372 ], "z_axis": [ -0.381, 0.094, 0.920 ], "quaternion": [ -0.472, -0.147, 0.136, 0.858 ] } }, { "index": 99, "index_chain": 15, "chain_name": "C", "nt_resnum": 7, "nt_name": "DG", "nt_code": "G", "nt_id": "///C/7", "linked_nts": [ "///C/6", "///C/8" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -60.733, "beta": 165.203, "gamma": 53.853, "delta": 80.065, "epsilon": -154.732, "zeta": -72.211, "epsilon_zeta": -82.521, "bb_type": "BI", "chi": -164.561, "glyco_bond": "anti", "C5prime_xyz": [ -1.939, 8.912, 0.633 ], "P_xyz": [ 0.517, 9.798, 0.797 ], "form": "A", "ssZp": 4.400, "Dp": 4.466, "splay_angle": 23.129, "splay_distance": 3.969, "splay_ratio": 0.208, "d22": null, "d64": null, "eta": 165.942, "theta": -149.238, "eta_prime": -178.698, "theta_prime": -149.790, "eta_base": -143.740, "theta_base": -130.418, "v0": -8.181, "v1": -18.502, "v2": 36.458, "v3": -42.184, "v4": 31.861, "amplitude": 41.927, "phase_angle": 29.593, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.948, "filter_rmsd": 0.004, "frame": { "rmsd": 0.004, "origin": [ -0.680, 10.635, 51.544 ], "x_axis": [ -0.016, -0.995, -0.103 ], "y_axis": [ 0.891, -0.061, 0.451 ], "z_axis": [ -0.455, -0.085, 0.887 ], "quaternion": [ 0.673, 0.199, -0.131, -0.701 ] } }, { "index": 100, "index_chain": 16, "chain_name": "C", "nt_resnum": 8, "nt_name": "DC", "nt_code": "C", "nt_id": "///C/8", "linked_nts": [ "///C/7", "///C/9" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -63.011, "beta": 175.247, "gamma": 52.854, "delta": 79.160, "epsilon": -163.434, "zeta": -80.101, "epsilon_zeta": -83.333, "bb_type": "BI", "chi": -157.315, "glyco_bond": "anti", "C5prime_xyz": [ -1.898, 9.017, 0.187 ], "P_xyz": [ 0.469, 10.064, 0.396 ], "form": "A", "ssZp": 4.196, "Dp": 4.346, "splay_angle": 23.871, "splay_distance": 3.823, "splay_ratio": 0.207, "d22": null, "d64": null, "eta": 171.458, "theta": -165.706, "eta_prime": -177.085, "theta_prime": -162.905, "eta_base": -146.259, "theta_base": -137.865, "v0": -11.381, "v1": -15.504, "v2": 34.741, "v3": -42.475, "v4": 34.204, "amplitude": 41.985, "phase_angle": 34.160, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.960, "filter_rmsd": 0.062, "frame": { "rmsd": 0.003, "origin": [ -4.029, 9.759, 53.487 ], "x_axis": [ 0.441, -0.897, 0.019 ], "y_axis": [ 0.766, 0.388, 0.513 ], "z_axis": [ -0.467, -0.211, 0.858 ], "quaternion": [ 0.820, 0.221, -0.148, -0.507 ] } }, { "index": 101, "index_chain": 17, "chain_name": "C", "nt_resnum": 9, "nt_name": "DA", "nt_code": "A", "nt_id": "///C/9", "linked_nts": [ "///C/8", "///C/10" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -67.577, "beta": 170.580, "gamma": 60.101, "delta": 88.142, "epsilon": -158.424, "zeta": -66.078, "epsilon_zeta": -92.346, "bb_type": "BI", "chi": -158.243, "glyco_bond": "anti", "C5prime_xyz": [ -1.433, 8.745, 0.405 ], "P_xyz": [ 1.142, 9.151, 0.464 ], "form": "A", "ssZp": 4.207, "Dp": 4.373, "splay_angle": 21.594, "splay_distance": 3.592, "splay_ratio": 0.190, "d22": null, "d64": null, "eta": 173.897, "theta": -139.114, "eta_prime": -175.413, "theta_prime": -140.572, "eta_base": -143.343, "theta_base": -115.125, "v0": -1.172, "v1": -20.253, "v2": 32.550, "v3": -34.096, "v4": 22.449, "amplitude": 34.752, "phase_angle": 20.504, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.716, "filter_rmsd": 0.037, "frame": { "rmsd": 0.004, "origin": [ -6.603, 8.631, 56.079 ], "x_axis": [ 0.783, -0.594, 0.185 ], "y_axis": [ 0.465, 0.757, 0.460 ], "z_axis": [ -0.413, -0.274, 0.868 ], "quaternion": [ 0.923, 0.199, -0.162, -0.287 ] } }, { "index": 102, "index_chain": 18, "chain_name": "C", "nt_resnum": 10, "nt_name": "DG", "nt_code": "G", "nt_id": "///C/10", "linked_nts": [ "///C/9", "///C/11" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -69.564, "beta": 170.024, "gamma": 63.826, "delta": 89.419, "epsilon": -162.642, "zeta": -80.097, "epsilon_zeta": -82.545, "bb_type": "BI", "chi": -156.987, "glyco_bond": "anti", "C5prime_xyz": [ -1.890, 8.944, 0.193 ], "P_xyz": [ 0.599, 9.732, 0.366 ], "form": ".", "ssZp": 3.859, "Dp": 3.984, "splay_angle": 20.825, "splay_distance": 3.405, "splay_ratio": 0.181, "d22": null, "d64": null, "eta": 173.079, "theta": -153.705, "eta_prime": -166.497, "theta_prime": -149.433, "eta_base": -125.343, "theta_base": -122.994, "v0": -13.098, "v1": -7.792, "v2": 24.156, "v3": -32.362, "v4": 28.911, "amplitude": 32.427, "phase_angle": 41.846, "puckering": "C4'-exo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.628, "filter_rmsd": 0.004, "frame": { "rmsd": 0.004, "origin": [ -7.624, 6.202, 58.520 ], "x_axis": [ 0.940, -0.084, 0.330 ], "y_axis": [ -0.042, 0.934, 0.355 ], "z_axis": [ -0.338, -0.348, 0.874 ], "quaternion": [ 0.968, 0.182, -0.173, -0.011 ] } }, { "index": 103, "index_chain": 19, "chain_name": "C", "nt_resnum": 11, "nt_name": "DA", "nt_code": "A", "nt_id": "///C/11", "linked_nts": [ "///C/10", "///C/12" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop,phosphate", "alpha": -60.209, "beta": 173.233, "gamma": 61.133, "delta": 138.966, "epsilon": -173.024, "zeta": -89.339, "epsilon_zeta": -83.685, "bb_type": "BI", "chi": -128.114, "glyco_bond": "anti", "C5prime_xyz": [ -1.914, 8.664, -0.831 ], "P_xyz": [ 0.548, 9.326, -0.262 ], "form": ".", "ssZp": 2.238, "Dp": 2.241, "splay_angle": 23.305, "splay_distance": 4.131, "splay_ratio": 0.210, "d22": null, "d64": null, "eta": 168.888, "theta": -119.874, "eta_prime": -155.849, "theta_prime": -140.326, "eta_base": -121.348, "theta_base": -103.066, "v0": -22.729, "v1": 34.026, "v2": -31.685, "v3": 19.437, "v4": 1.869, "amplitude": 34.148, "phase_angle": 158.108, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1b", "suiteness": 0.716, "filter_rmsd": 0.037, "frame": { "rmsd": 0.004, "origin": [ -8.566, 4.400, 61.251 ], "x_axis": [ 0.810, 0.453, 0.372 ], "y_axis": [ -0.549, 0.808, 0.213 ], "z_axis": [ -0.204, -0.377, 0.904 ], "quaternion": [ 0.938, 0.157, -0.154, 0.267 ] } }, { "index": 104, "index_chain": 20, "chain_name": "C", "nt_resnum": 12, "nt_name": "DC", "nt_code": "C", "nt_id": "///C/12", "linked_nts": [ "///C/11", "///C/13" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,non-canonical,non-pair-contact,helix,internal-loop,phosphate", "alpha": -65.230, "beta": -173.887, "gamma": 39.620, "delta": 124.475, "epsilon": -154.224, "zeta": -135.165, "epsilon_zeta": -19.059, "bb_type": "--", "chi": -131.364, "glyco_bond": "anti", "C5prime_xyz": [ -2.211, 8.825, -1.056 ], "P_xyz": [ -0.352, 10.411, -0.117 ], "form": "B", "ssZp": 2.319, "Dp": 2.384, "splay_angle": 20.274, "splay_distance": 3.420, "splay_ratio": 0.177, "d22": null, "d64": null, "eta": 168.216, "theta": -147.784, "eta_prime": -170.716, "theta_prime": -143.583, "eta_base": -120.253, "theta_base": -112.586, "v0": -32.420, "v1": 34.151, "v2": -23.120, "v3": 5.148, "v4": 16.899, "amplitude": 34.382, "phase_angle": 132.255, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.003, "origin": [ -8.097, 2.741, 65.005 ], "x_axis": [ 0.355, 0.893, 0.275 ], "y_axis": [ -0.888, 0.415, -0.201 ], "z_axis": [ -0.293, -0.172, 0.940 ], "quaternion": [ 0.823, -0.009, -0.172, 0.541 ] } }, { "index": 105, "index_chain": 21, "chain_name": "C", "nt_resnum": 13, "nt_name": "DG", "nt_code": "G", "nt_id": "///C/13", "linked_nts": [ "///C/12", "///C/14" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop,phosphate", "alpha": 23.267, "beta": 148.335, "gamma": -21.269, "delta": 159.022, "epsilon": -169.920, "zeta": -115.264, "epsilon_zeta": -54.656, "bb_type": "BI", "chi": -89.542, "glyco_bond": "anti", "C5prime_xyz": [ -1.879, 7.607, -2.329 ], "P_xyz": [ 0.040, 9.297, -1.862 ], "form": ".", "ssZp": 1.578, "Dp": 1.725, "splay_angle": 20.150, "splay_distance": 3.687, "splay_ratio": 0.181, "d22": null, "d64": null, "eta": 163.337, "theta": -137.389, "eta_prime": -170.004, "theta_prime": -153.401, "eta_base": -134.568, "theta_base": -146.790, "v0": -7.584, "v1": 29.617, "v2": -39.188, "v3": 35.916, "v4": -17.985, "amplitude": 39.562, "phase_angle": 187.884, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.006, "frame": { "rmsd": 0.006, "origin": [ -9.215, 2.036, 68.159 ], "x_axis": [ -0.125, 0.989, -0.075 ], "y_axis": [ -0.960, -0.139, -0.242 ], "z_axis": [ -0.249, 0.042, 0.967 ], "quaternion": [ 0.653, -0.109, -0.067, 0.747 ] } }, { "index": 106, "index_chain": 22, "chain_name": "C", "nt_resnum": 14, "nt_name": "DG", "nt_code": "G", "nt_id": "///C/14", "linked_nts": [ "///C/13", "///C/15" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -43.728, "beta": 167.612, "gamma": 20.552, "delta": 128.041, "epsilon": -157.332, "zeta": -117.243, "epsilon_zeta": -40.089, "bb_type": "BI", "chi": -106.087, "glyco_bond": "anti", "C5prime_xyz": [ -3.309, 8.147, -2.001 ], "P_xyz": [ -1.848, 10.286, -2.134 ], "form": "B", "ssZp": 2.407, "Dp": 2.368, "splay_angle": 21.269, "splay_distance": 3.537, "splay_ratio": 0.185, "d22": null, "d64": null, "eta": 161.117, "theta": -170.103, "eta_prime": 174.460, "theta_prime": 174.981, "eta_base": -172.939, "theta_base": -142.181, "v0": -40.240, "v1": 43.595, "v2": -30.017, "v3": 8.144, "v4": 19.726, "amplitude": 43.153, "phase_angle": 134.075, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.005, "frame": { "rmsd": 0.005, "origin": [ -8.425, 1.536, 71.726 ], "x_axis": [ -0.264, 0.912, -0.313 ], "y_axis": [ -0.916, -0.339, -0.214 ], "z_axis": [ -0.302, 0.230, 0.925 ], "quaternion": [ 0.575, -0.193, 0.005, 0.795 ] } }, { "index": 107, "index_chain": 23, "chain_name": "C", "nt_resnum": 15, "nt_name": "DG", "nt_code": "G", "nt_id": "///C/15", "linked_nts": [ "///C/14", "///C/16" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop,phosphate", "alpha": -113.978, "beta": 136.198, "gamma": 87.216, "delta": 80.758, "epsilon": -135.274, "zeta": -77.212, "epsilon_zeta": -58.062, "bb_type": "BI", "chi": -172.748, "glyco_bond": "anti", "C5prime_xyz": [ -1.698, 8.714, 1.194 ], "P_xyz": [ 0.491, 9.475, 0.001 ], "form": "A", "ssZp": 4.624, "Dp": 4.669, "splay_angle": 23.938, "splay_distance": 3.862, "splay_ratio": 0.210, "d22": null, "d64": null, "eta": 145.799, "theta": -142.756, "eta_prime": 147.277, "theta_prime": -147.831, "eta_base": -158.105, "theta_base": -115.833, "v0": -1.299, "v1": -24.504, "v2": 39.419, "v3": -41.302, "v4": 26.952, "amplitude": 42.049, "phase_angle": 20.371, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.005, "frame": { "rmsd": 0.005, "origin": [ -9.170, 2.181, 75.123 ], "x_axis": [ -0.672, 0.519, -0.528 ], "y_axis": [ -0.560, -0.823, -0.095 ], "z_axis": [ -0.484, 0.232, 0.844 ], "quaternion": [ 0.295, -0.277, 0.037, 0.914 ] } }, { "index": 108, "index_chain": 24, "chain_name": "C", "nt_resnum": 16, "nt_name": "DG", "nt_code": "G", "nt_id": "///C/16", "linked_nts": [ "///C/15", "///C/17" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop", "alpha": -67.239, "beta": 158.488, "gamma": 63.312, "delta": 80.467, "epsilon": -143.822, "zeta": -85.296, "epsilon_zeta": -58.526, "bb_type": "BI", "chi": -174.257, "glyco_bond": "anti", "C5prime_xyz": [ -1.772, 8.726, 1.250 ], "P_xyz": [ 0.750, 9.387, 1.313 ], "form": "A", "ssZp": 4.578, "Dp": 4.592, "splay_angle": 24.048, "splay_distance": 3.892, "splay_ratio": 0.212, "d22": null, "d64": null, "eta": 163.987, "theta": -154.061, "eta_prime": -178.771, "theta_prime": -153.660, "eta_base": -126.208, "theta_base": -144.131, "v0": -2.879, "v1": -22.793, "v2": 38.144, "v3": -40.939, "v4": 27.714, "amplitude": 41.301, "phase_angle": 22.546, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.727, "filter_rmsd": 0.003, "frame": { "rmsd": 0.003, "origin": [ -11.378, 4.772, 76.946 ], "x_axis": [ -0.779, -0.146, -0.609 ], "y_axis": [ -0.035, -0.961, 0.276 ], "z_axis": [ -0.626, 0.236, 0.743 ], "quaternion": [ -0.030, -0.331, 0.137, 0.933 ] } }, { "index": 109, "index_chain": 25, "chain_name": "C", "nt_resnum": 17, "nt_name": "DT", "nt_code": "T", "nt_id": "///C/17", "linked_nts": [ "///C/16", "///C/18" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop", "alpha": -65.973, "beta": -176.390, "gamma": 41.963, "delta": 82.047, "epsilon": -157.173, "zeta": -62.073, "epsilon_zeta": -95.101, "bb_type": "BI", "chi": -150.370, "glyco_bond": "anti", "C5prime_xyz": [ -1.363, 8.812, -0.055 ], "P_xyz": [ 1.158, 9.477, 0.250 ], "form": "A", "ssZp": 4.149, "Dp": 4.569, "splay_angle": 21.446, "splay_distance": 3.566, "splay_ratio": 0.189, "d22": 3.979, "d64": 4.240, "eta": 165.110, "theta": -144.459, "eta_prime": 170.185, "theta_prime": -141.857, "eta_base": -171.147, "theta_base": -114.585, "v0": 3.083, "v1": -27.694, "v2": 40.340, "v3": -39.455, "v4": 23.081, "amplitude": 41.639, "phase_angle": 14.349, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.680, "filter_rmsd": 0.106, "frame": { "rmsd": 0.003, "origin": [ -12.828, 7.804, 78.910 ], "x_axis": [ -0.589, -0.603, -0.538 ], "y_axis": [ 0.207, -0.756, 0.621 ], "z_axis": [ -0.781, 0.255, 0.571 ], "quaternion": [ -0.237, -0.386, 0.256, 0.854 ] } }, { "index": 110, "index_chain": 26, "chain_name": "C", "nt_resnum": 18, "nt_name": "DT", "nt_code": "T", "nt_id": "///C/18", "linked_nts": [ "///C/17", "///C/19" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -73.784, "beta": 168.491, "gamma": 69.749, "delta": 79.757, "epsilon": -153.965, "zeta": -46.364, "epsilon_zeta": -107.601, "bb_type": "BI", "chi": -156.520, "glyco_bond": "anti", "C5prime_xyz": [ -1.727, 8.932, 0.227 ], "P_xyz": [ 0.735, 9.722, -0.200 ], "form": "A", "ssZp": 4.211, "Dp": 4.473, "splay_angle": 20.978, "splay_distance": 3.736, "splay_ratio": 0.191, "d22": 4.061, "d64": 4.702, "eta": 171.574, "theta": -132.123, "eta_prime": -170.498, "theta_prime": -143.411, "eta_base": -129.996, "theta_base": -122.667, "v0": -6.078, "v1": -19.819, "v2": 36.675, "v3": -41.234, "v4": 29.904, "amplitude": 41.145, "phase_angle": 26.953, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.525, "filter_rmsd": 0.106, "frame": { "rmsd": 0.004, "origin": [ -16.328, 8.466, 79.065 ], "x_axis": [ -0.333, -0.917, -0.222 ], "y_axis": [ 0.343, -0.336, 0.877 ], "z_axis": [ -0.878, 0.216, 0.426 ], "quaternion": [ -0.435, -0.380, 0.377, 0.724 ] } }, { "index": 111, "index_chain": 27, "chain_name": "C", "nt_resnum": 19, "nt_name": "DC", "nt_code": "C", "nt_id": "///C/19", "linked_nts": [ "///C/18", "///C/20" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -138.737, "beta": 139.148, "gamma": 136.152, "delta": 82.126, "epsilon": -141.589, "zeta": -83.913, "epsilon_zeta": -57.676, "bb_type": "BI", "chi": -174.490, "glyco_bond": "anti", "C5prime_xyz": [ -1.382, 8.597, 1.395 ], "P_xyz": [ -0.090, 10.348, -0.055 ], "form": "A", "ssZp": 4.634, "Dp": 4.653, "splay_angle": 24.811, "splay_distance": 3.929, "splay_ratio": 0.218, "d22": 4.775, "d64": 4.850, "eta": 164.856, "theta": -178.077, "eta_prime": 178.735, "theta_prime": -170.693, "eta_base": -140.717, "theta_base": -147.702, "v0": 3.991, "v1": -27.948, "v2": 40.084, "v3": -38.847, "v4": 22.026, "amplitude": 41.171, "phase_angle": 13.199, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.003, "origin": [ -20.026, 8.314, 78.557 ], "x_axis": [ -0.063, -0.988, 0.143 ], "y_axis": [ 0.342, 0.113, 0.933 ], "z_axis": [ -0.938, 0.108, 0.331 ], "quaternion": [ 0.588, 0.351, -0.460, -0.566 ] } }, { "index": 112, "index_chain": 28, "chain_name": "C", "nt_resnum": 20, "nt_name": "DC", "nt_code": "C", "nt_id": "///C/20", "linked_nts": [ "///C/19", null ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,phosphate", "alpha": -56.057, "beta": 171.520, "gamma": 55.004, "delta": 89.877, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": -159.408, "glyco_bond": "anti", "C5prime_xyz": [ -1.423, 8.848, 0.463 ], "P_xyz": [ 1.129, 9.240, 0.884 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": -4.044, "v1": -16.031, "v2": 28.656, "v3": -31.796, "v4": 22.813, "amplitude": 31.827, "phase_angle": 25.793, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.698, "filter_rmsd": 0.063, "frame": { "rmsd": 0.004, "origin": [ -23.890, 8.191, 77.861 ], "x_axis": [ 0.220, -0.805, 0.551 ], "y_axis": [ 0.277, 0.593, 0.756 ], "z_axis": [ -0.935, -0.014, 0.353 ], "quaternion": [ 0.736, 0.262, -0.505, -0.368 ] } }, { "index": 113, "index_chain": 1, "chain_name": "D", "nt_resnum": -3, "nt_name": "DA", "nt_code": "A", "nt_id": "c. D & i. \\-3", "linked_nts": [ null, "c. D & i. \\-2" ], "nt_type": "DNA", "dbn": ".", "summary": "non-stack,ss-non-loop", "alpha": null, "beta": null, "gamma": null, "delta": null, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": null, "glyco_bond": "--", "C5prime_xyz": [ null, null, null ], "P_xyz": [ null, null, null ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": null, "v1": null, "v2": null, "v3": null, "v4": null, "amplitude": null, "phase_angle": null, "puckering": "", "sugar_class": "--", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": null }, { "index": 114, "index_chain": 2, "chain_name": "D", "nt_resnum": -2, "nt_name": "DC", "nt_code": "C", "nt_id": "c. D & i. \\-2", "linked_nts": [ "c. D & i. \\-3", "c. D & i. \\-1" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,BI,non-pair-contact,ss-non-loop", "alpha": -3.488, "beta": -164.461, "gamma": -77.905, "delta": 142.667, "epsilon": -177.187, "zeta": -95.987, "epsilon_zeta": -81.200, "bb_type": "BI", "chi": -128.443, "glyco_bond": "anti", "C5prime_xyz": [ -1.784, 8.739, -0.797 ], "P_xyz": [ -1.545, 11.300, -1.309 ], "form": ".", "ssZp": 1.885, "Dp": 2.117, "splay_angle": 24.983, "splay_distance": 4.232, "splay_ratio": 0.220, "d22": 4.518, "d64": 3.808, "eta": null, "theta": -152.675, "eta_prime": null, "theta_prime": -150.521, "eta_base": null, "theta_base": -86.768, "v0": -23.031, "v1": 36.738, "v2": -35.715, "v3": 23.428, "v4": -0.552, "amplitude": 37.561, "phase_angle": 161.965, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.004, "origin": [ -9.792, -7.841, 37.790 ], "x_axis": [ 0.875, 0.174, -0.453 ], "y_axis": [ 0.300, -0.928, 0.223 ], "z_axis": [ -0.381, -0.331, -0.863 ], "quaternion": [ 0.145, 0.957, 0.124, -0.218 ] } }, { "index": 115, "index_chain": 3, "chain_name": "D", "nt_resnum": -1, "nt_name": "DC", "nt_code": "C", "nt_id": "c. D & i. \\-1", "linked_nts": [ "c. D & i. \\-2", "///D/0" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,BI,non-pair-contact,ss-non-loop", "alpha": 110.376, "beta": 166.660, "gamma": -132.174, "delta": 161.083, "epsilon": -159.949, "zeta": -90.314, "epsilon_zeta": -69.635, "bb_type": "BI", "chi": -108.871, "glyco_bond": "anti", "C5prime_xyz": [ -1.088, 7.986, -1.345 ], "P_xyz": [ 0.306, 9.609, -2.796 ], "form": "B", "ssZp": 1.352, "Dp": 1.552, "splay_angle": 24.069, "splay_distance": 4.119, "splay_ratio": 0.209, "d22": null, "d64": null, "eta": 176.673, "theta": -149.650, "eta_prime": -158.512, "theta_prime": -141.235, "eta_base": -93.392, "theta_base": -87.402, "v0": 1.284, "v1": 22.537, "v2": -36.503, "v3": 38.313, "v4": -25.204, "amplitude": 39.001, "phase_angle": 200.616, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.003, "origin": [ -9.031, -9.558, 33.998 ], "x_axis": [ 0.770, -0.636, -0.056 ], "y_axis": [ -0.568, -0.723, 0.393 ], "z_axis": [ -0.290, -0.271, -0.918 ], "quaternion": [ 0.180, 0.923, -0.326, -0.094 ] } }, { "index": 116, "index_chain": 4, "chain_name": "D", "nt_resnum": 0, "nt_name": "DA", "nt_code": "A", "nt_id": "///D/0", "linked_nts": [ "c. D & i. \\-1", "///D/1" ], "nt_type": "DNA", "dbn": "]", "summary": "pseudoknotted,anti,~C2'-endo,BII,canonical,non-pair-contact,helix-end,stem-end", "alpha": -44.653, "beta": 162.929, "gamma": 29.298, "delta": 140.892, "epsilon": -99.859, "zeta": -168.275, "epsilon_zeta": 68.416, "bb_type": "BII", "chi": -85.750, "glyco_bond": "anti", "C5prime_xyz": [ -3.286, 7.547, -2.566 ], "P_xyz": [ -1.339, 9.094, -3.329 ], "form": "B", "ssZp": 1.022, "Dp": 1.090, "splay_angle": 20.609, "splay_distance": 3.545, "splay_ratio": 0.183, "d22": null, "d64": null, "eta": 177.196, "theta": -176.177, "eta_prime": -143.775, "theta_prime": 176.704, "eta_base": -93.897, "theta_base": -145.507, "v0": -33.691, "v1": 44.102, "v2": -37.048, "v3": 18.812, "v4": 8.924, "amplitude": 43.120, "phase_angle": 149.225, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.037, "frame": { "rmsd": 0.006, "origin": [ -9.667, -12.868, 31.629 ], "x_axis": [ 0.254, -0.937, 0.239 ], "y_axis": [ -0.957, -0.208, 0.204 ], "z_axis": [ -0.141, -0.280, -0.949 ], "quaternion": [ 0.156, 0.776, -0.610, 0.031 ] } }, { "index": 117, "index_chain": 5, "chain_name": "D", "nt_resnum": 1, "nt_name": "DG", "nt_code": "G", "nt_id": "///D/1", "linked_nts": [ "///D/0", "///D/2" ], "nt_type": "DNA", "dbn": "]", "summary": "pseudoknotted,anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -94.308, "beta": 118.182, "gamma": 78.797, "delta": 114.377, "epsilon": 178.329, "zeta": -98.746, "epsilon_zeta": -82.924, "bb_type": "BI", "chi": -129.051, "glyco_bond": "anti", "C5prime_xyz": [ -2.796, 8.723, -1.372 ], "P_xyz": [ -0.396, 9.003, -2.387 ], "form": "B", "ssZp": 2.492, "Dp": 2.574, "splay_angle": 19.592, "splay_distance": 3.254, "splay_ratio": 0.171, "d22": null, "d64": null, "eta": 153.118, "theta": -148.866, "eta_prime": -178.254, "theta_prime": -174.218, "eta_base": -140.300, "theta_base": -137.133, "v0": -39.313, "v1": 35.491, "v2": -18.773, "v3": -3.125, "v4": 26.431, "amplitude": 38.759, "phase_angle": 118.971, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.004, "frame": { "rmsd": 0.004, "origin": [ -10.862, -12.886, 28.291 ], "x_axis": [ -0.245, -0.922, 0.301 ], "y_axis": [ -0.961, 0.273, 0.055 ], "z_axis": [ -0.132, -0.275, -0.952 ], "quaternion": [ -0.138, -0.599, 0.786, -0.070 ] } }, { "index": 118, "index_chain": 6, "chain_name": "D", "nt_resnum": 2, "nt_name": "DG", "nt_code": "G", "nt_id": "///D/2", "linked_nts": [ "///D/1", "///D/3" ], "nt_type": "DNA", "dbn": "]", "summary": "pseudoknotted,anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -67.901, "beta": -169.826, "gamma": 53.210, "delta": 137.114, "epsilon": -167.854, "zeta": -95.636, "epsilon_zeta": -72.218, "bb_type": "BI", "chi": -112.780, "glyco_bond": "anti", "C5prime_xyz": [ -1.944, 8.422, -1.690 ], "P_xyz": [ 0.330, 9.595, -1.224 ], "form": "B", "ssZp": 1.931, "Dp": 2.060, "splay_angle": 17.697, "splay_distance": 3.175, "splay_ratio": 0.158, "d22": null, "d64": null, "eta": 174.385, "theta": -130.229, "eta_prime": -166.849, "theta_prime": -146.696, "eta_base": -126.346, "theta_base": -107.766, "v0": -21.610, "v1": 32.366, "v2": -30.514, "v3": 18.843, "v4": 1.464, "amplitude": 32.749, "phase_angle": 158.709, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.006, "frame": { "rmsd": 0.006, "origin": [ -10.557, -14.007, 25.252 ], "x_axis": [ -0.768, -0.566, 0.299 ], "y_axis": [ -0.630, 0.753, -0.192 ], "z_axis": [ -0.117, -0.335, -0.935 ], "quaternion": [ -0.112, -0.322, 0.929, -0.142 ] } }, { "index": 119, "index_chain": 7, "chain_name": "D", "nt_resnum": 3, "nt_name": "DT", "nt_code": "T", "nt_id": "///D/3", "linked_nts": [ "///D/2", "///D/4" ], "nt_type": "DNA", "dbn": "]", "summary": "pseudoknotted,anti,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -58.214, "beta": 170.708, "gamma": 39.449, "delta": 98.528, "epsilon": -178.905, "zeta": -95.394, "epsilon_zeta": -83.511, "bb_type": "BI", "chi": -122.028, "glyco_bond": "anti", "C5prime_xyz": [ -2.707, 8.488, -1.859 ], "P_xyz": [ -0.744, 10.155, -2.205 ], "form": "B", "ssZp": 2.552, "Dp": 2.939, "splay_angle": 20.205, "splay_distance": 3.461, "splay_ratio": 0.176, "d22": null, "d64": null, "eta": 164.170, "theta": -169.746, "eta_prime": -178.667, "theta_prime": -166.977, "eta_base": -130.744, "theta_base": -131.546, "v0": -35.068, "v1": 20.028, "v2": 0.827, "v3": -20.822, "v4": 35.430, "amplitude": 36.188, "phase_angle": 88.691, "puckering": "O4'-endo", "sugar_class": "--", "bin": "23p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.004, "origin": [ -11.277, -15.838, 22.760 ], "x_axis": [ -0.983, -0.069, 0.173 ], "y_axis": [ -0.136, 0.898, -0.419 ], "z_axis": [ -0.126, -0.435, -0.892 ], "quaternion": [ -0.077, -0.053, 0.971, -0.220 ] } }, { "index": 120, "index_chain": 8, "chain_name": "D", "nt_resnum": 4, "nt_name": "DA", "nt_code": "A", "nt_id": "///D/4", "linked_nts": [ "///D/3", "///D/5" ], "nt_type": "DNA", "dbn": "]", "summary": "pseudoknotted,anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -35.533, "beta": 169.718, "gamma": 39.256, "delta": 137.615, "epsilon": -171.343, "zeta": -116.677, "epsilon_zeta": -54.667, "bb_type": "BI", "chi": -107.197, "glyco_bond": "anti", "C5prime_xyz": [ -2.202, 8.263, -1.916 ], "P_xyz": [ 0.071, 9.479, -1.700 ], "form": "B", "ssZp": 1.944, "Dp": 2.058, "splay_angle": 19.206, "splay_distance": 3.310, "splay_ratio": 0.168, "d22": null, "d64": null, "eta": 176.094, "theta": -146.297, "eta_prime": -157.318, "theta_prime": -160.132, "eta_base": -121.102, "theta_base": -125.804, "v0": -23.475, "v1": 34.489, "v2": -31.897, "v3": 19.287, "v4": 2.366, "amplitude": 34.573, "phase_angle": 157.311, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1b", "suiteness": 0.033, "filter_rmsd": 0.038, "frame": { "rmsd": 0.005, "origin": [ -11.993, -17.147, 19.637 ], "x_axis": [ -0.901, 0.433, 0.026 ], "y_axis": [ 0.357, 0.774, -0.523 ], "z_axis": [ -0.247, -0.462, -0.852 ], "quaternion": [ -0.073, 0.210, 0.939, -0.262 ] } }, { "index": 121, "index_chain": 9, "chain_name": "D", "nt_resnum": 5, "nt_name": "DT", "nt_code": "T", "nt_id": "///D/5", "linked_nts": [ "///D/4", "///D/6" ], "nt_type": "DNA", "dbn": "]", "summary": "pseudoknotted,anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -26.051, "beta": 174.707, "gamma": 14.094, "delta": 141.729, "epsilon": -172.394, "zeta": -103.175, "epsilon_zeta": -69.219, "bb_type": "BI", "chi": -104.246, "glyco_bond": "anti", "C5prime_xyz": [ -2.215, 8.193, -1.964 ], "P_xyz": [ -0.313, 9.919, -1.618 ], "form": "B", "ssZp": 2.088, "Dp": 2.135, "splay_angle": 21.256, "splay_distance": 3.715, "splay_ratio": 0.187, "d22": 3.812, "d64": 3.548, "eta": 170.663, "theta": -139.509, "eta_prime": -170.043, "theta_prime": -147.766, "eta_base": -130.117, "theta_base": -100.557, "v0": -22.276, "v1": 35.154, "v2": -33.972, "v3": 22.103, "v4": -0.164, "amplitude": 35.842, "phase_angle": 161.412, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.003, "origin": [ -13.076, -19.103, 17.196 ], "x_axis": [ -0.582, 0.779, -0.234 ], "y_axis": [ 0.763, 0.424, -0.487 ], "z_axis": [ -0.280, -0.462, -0.841 ], "quaternion": [ -0.014, 0.457, 0.844, -0.281 ] } }, { "index": 122, "index_chain": 10, "chain_name": "D", "nt_resnum": 6, "nt_name": "DT", "nt_code": "T", "nt_id": "///D/6", "linked_nts": [ "///D/5", "///D/7" ], "nt_type": "DNA", "dbn": "]", "summary": "pseudoknotted,anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -40.175, "beta": 170.485, "gamma": 31.499, "delta": 125.691, "epsilon": -167.936, "zeta": -97.366, "epsilon_zeta": -70.569, "bb_type": "BI", "chi": -112.294, "glyco_bond": "anti", "C5prime_xyz": [ -2.604, 8.371, -1.904 ], "P_xyz": [ -0.616, 10.059, -1.850 ], "form": ".", "ssZp": 2.296, "Dp": 2.378, "splay_angle": 17.697, "splay_distance": 3.337, "splay_ratio": 0.162, "d22": null, "d64": null, "eta": 170.835, "theta": -138.687, "eta_prime": -166.360, "theta_prime": -152.181, "eta_base": -112.920, "theta_base": -113.313, "v0": -32.743, "v1": 35.696, "v2": -25.329, "v3": 7.309, "v4": 15.709, "amplitude": 35.565, "phase_angle": 135.413, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.004, "origin": [ -14.790, -19.343, 13.910 ], "x_axis": [ 0.034, 0.922, -0.386 ], "y_axis": [ 0.945, -0.155, -0.288 ], "z_axis": [ -0.326, -0.355, -0.876 ], "quaternion": [ 0.023, 0.719, 0.649, -0.248 ] } }, { "index": 123, "index_chain": 11, "chain_name": "D", "nt_resnum": 7, "nt_name": "DG", "nt_code": "G", "nt_id": "///D/7", "linked_nts": [ "///D/6", null ], "nt_type": "DNA", "dbn": "]", "summary": "pseudoknotted,anti,~C3'-endo,canonical,non-pair-contact,helix-end,stem-end", "alpha": -32.301, "beta": 168.211, "gamma": 3.004, "delta": 84.334, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": -122.013, "glyco_bond": "anti", "C5prime_xyz": [ -2.628, 8.555, -1.735 ], "P_xyz": [ -0.995, 10.589, -1.964 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": -21.021, "v1": -2.612, "v2": 23.461, "v3": -36.418, "v4": 36.383, "amplitude": 37.798, "phase_angle": 51.633, "puckering": "C4'-exo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.007, "frame": { "rmsd": 0.007, "origin": [ -16.313, -18.997, 10.960 ], "x_axis": [ 0.564, 0.746, -0.353 ], "y_axis": [ 0.756, -0.639, -0.144 ], "z_axis": [ -0.333, -0.186, -0.924 ], "quaternion": [ 0.012, 0.884, 0.425, -0.194 ] } } ], "num_hbonds": 1519, "hbonds": [ { "index": 1, "atom1_serNum": 1, "atom2_serNum": 9196, "donAcc_type": "standard", "distance": 3.610, "atom1_id": "c. A & i. \\-1 & n. O3'", "atom2_id": "///B/918/NZ", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 2, "atom1_serNum": 12, "atom2_serNum": 9932, "donAcc_type": "acceptable", "distance": 3.465, "atom1_id": "///A/0/O2'", "atom2_id": "///B/1006/O", "atom_pair": "O:O", "residue_pair": "nt:aa" }, { "index": 3, "atom1_serNum": 26, "atom2_serNum": 9291, "donAcc_type": "standard", "distance": 2.423, "atom1_id": "///A/1/OP1", "atom2_id": "///B/929/NZ", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 4, "atom1_serNum": 42, "atom2_serNum": 13216, "donAcc_type": "standard", "distance": 2.908, "atom1_id": "///A/1/O6", "atom2_id": "///C/20/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 5, "atom1_serNum": 43, "atom2_serNum": 13214, "donAcc_type": "standard", "distance": 2.901, "atom1_id": "///A/1/N1", "atom2_id": "///C/20/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 6, "atom1_serNum": 45, "atom2_serNum": 13213, "donAcc_type": "standard", "distance": 2.799, "atom1_id": "///A/1/N2", "atom2_id": "///C/20/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 7, "atom1_serNum": 49, "atom2_serNum": 9267, "donAcc_type": "standard", "distance": 2.905, "atom1_id": "///A/2/OP1", "atom2_id": "///B/926/NE2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 8, "atom1_serNum": 65, "atom2_serNum": 13197, "donAcc_type": "standard", "distance": 2.901, "atom1_id": "///A/2/O6", "atom2_id": "///C/19/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 9, "atom1_serNum": 66, "atom2_serNum": 13195, "donAcc_type": "standard", "distance": 2.896, "atom1_id": "///A/2/N1", "atom2_id": "///C/19/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 10, "atom1_serNum": 68, "atom2_serNum": 13194, "donAcc_type": "standard", "distance": 2.779, "atom1_id": "///A/2/N2", "atom2_id": "///C/19/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 11, "atom1_serNum": 81, "atom2_serNum": 99, "donAcc_type": "acceptable", "distance": 3.216, "atom1_id": "///A/3/O2'", "atom2_id": "///A/4/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 12, "atom1_serNum": 88, "atom2_serNum": 13177, "donAcc_type": "standard", "distance": 3.035, "atom1_id": "///A/3/N6", "atom2_id": "///C/18/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 13, "atom1_serNum": 89, "atom2_serNum": 13175, "donAcc_type": "standard", "distance": 2.794, "atom1_id": "///A/3/N1", "atom2_id": "///C/18/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 14, "atom1_serNum": 94, "atom2_serNum": 7176, "donAcc_type": "standard", "distance": 2.223, "atom1_id": "///A/4/OP1", "atom2_id": "///B/661/NE", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 15, "atom1_serNum": 94, "atom2_serNum": 7179, "donAcc_type": "standard", "distance": 3.285, "atom1_id": "///A/4/OP1", "atom2_id": "///B/661/NH2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 16, "atom1_serNum": 110, "atom2_serNum": 13157, "donAcc_type": "standard", "distance": 2.940, "atom1_id": "///A/4/N6", "atom2_id": "///C/17/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 17, "atom1_serNum": 111, "atom2_serNum": 13155, "donAcc_type": "standard", "distance": 2.778, "atom1_id": "///A/4/N1", "atom2_id": "///C/17/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 18, "atom1_serNum": 116, "atom2_serNum": 5905, "donAcc_type": "standard", "distance": 3.066, "atom1_id": "///A/5/OP1", "atom2_id": "///B/510/NZ", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 19, "atom1_serNum": 116, "atom2_serNum": 5949, "donAcc_type": "acceptable", "distance": 2.605, "atom1_id": "///A/5/OP1", "atom2_id": "///B/515/OH", "atom_pair": "O:O", "residue_pair": "nt:aa" }, { "index": 20, "atom1_serNum": 129, "atom2_serNum": 13138, "donAcc_type": "standard", "distance": 2.647, "atom1_id": "///A/5/O2", "atom2_id": "///C/16/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 21, "atom1_serNum": 132, "atom2_serNum": 13136, "donAcc_type": "standard", "distance": 3.288, "atom1_id": "///A/5/O4", "atom2_id": "///C/16/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 22, "atom1_serNum": 137, "atom2_serNum": 5905, "donAcc_type": "standard", "distance": 3.192, "atom1_id": "///A/6/OP2", "atom2_id": "///B/510/NZ", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 23, "atom1_serNum": 149, "atom2_serNum": 13116, "donAcc_type": "standard", "distance": 2.763, "atom1_id": "///A/6/O2", "atom2_id": "///C/15/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 24, "atom1_serNum": 150, "atom2_serNum": 13114, "donAcc_type": "standard", "distance": 2.963, "atom1_id": "///A/6/N3", "atom2_id": "///C/15/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 25, "atom1_serNum": 152, "atom2_serNum": 13113, "donAcc_type": "standard", "distance": 3.067, "atom1_id": "///A/6/N4", "atom2_id": "///C/15/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 26, "atom1_serNum": 169, "atom2_serNum": 13094, "donAcc_type": "standard", "distance": 2.662, "atom1_id": "///A/7/O2", "atom2_id": "///C/14/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 27, "atom1_serNum": 170, "atom2_serNum": 13092, "donAcc_type": "standard", "distance": 2.846, "atom1_id": "///A/7/N3", "atom2_id": "///C/14/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 28, "atom1_serNum": 172, "atom2_serNum": 13091, "donAcc_type": "standard", "distance": 2.947, "atom1_id": "///A/7/N4", "atom2_id": "///C/14/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 29, "atom1_serNum": 189, "atom2_serNum": 13072, "donAcc_type": "standard", "distance": 2.652, "atom1_id": "///A/8/O2", "atom2_id": "///C/13/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 30, "atom1_serNum": 190, "atom2_serNum": 13070, "donAcc_type": "standard", "distance": 2.842, "atom1_id": "///A/8/N3", "atom2_id": "///C/13/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 31, "atom1_serNum": 192, "atom2_serNum": 13069, "donAcc_type": "standard", "distance": 2.945, "atom1_id": "///A/8/N4", "atom2_id": "///C/13/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 32, "atom1_serNum": 209, "atom2_serNum": 13047, "donAcc_type": "questionable", "distance": 3.182, "atom1_id": "///A/9/O2", "atom2_id": "///C/12/O2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 33, "atom1_serNum": 210, "atom2_serNum": 13048, "donAcc_type": "standard", "distance": 2.956, "atom1_id": "///A/9/N3", "atom2_id": "///C/12/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 34, "atom1_serNum": 212, "atom2_serNum": 13050, "donAcc_type": "standard", "distance": 2.772, "atom1_id": "///A/9/O4", "atom2_id": "///C/12/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 35, "atom1_serNum": 230, "atom2_serNum": 13030, "donAcc_type": "standard", "distance": 2.742, "atom1_id": "///A/10/N3", "atom2_id": "///C/11/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 36, "atom1_serNum": 232, "atom2_serNum": 13029, "donAcc_type": "standard", "distance": 3.020, "atom1_id": "///A/10/O4", "atom2_id": "///C/11/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 37, "atom1_serNum": 245, "atom2_serNum": 261, "donAcc_type": "acceptable", "distance": 3.230, "atom1_id": "///A/11/O2'", "atom2_id": "///A/12/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 38, "atom1_serNum": 249, "atom2_serNum": 13010, "donAcc_type": "standard", "distance": 2.597, "atom1_id": "///A/11/O2", "atom2_id": "///C/10/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 39, "atom1_serNum": 250, "atom2_serNum": 13008, "donAcc_type": "standard", "distance": 2.811, "atom1_id": "///A/11/N3", "atom2_id": "///C/10/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 40, "atom1_serNum": 252, "atom2_serNum": 13007, "donAcc_type": "standard", "distance": 2.948, "atom1_id": "///A/11/N4", "atom2_id": "///C/10/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 41, "atom1_serNum": 270, "atom2_serNum": 12987, "donAcc_type": "standard", "distance": 2.838, "atom1_id": "///A/12/N3", "atom2_id": "///C/9/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 42, "atom1_serNum": 272, "atom2_serNum": 12986, "donAcc_type": "standard", "distance": 2.926, "atom1_id": "///A/12/O4", "atom2_id": "///C/9/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 43, "atom1_serNum": 276, "atom2_serNum": 2196, "donAcc_type": "standard", "distance": 2.606, "atom1_id": "///A/13/OP1", "atom2_id": "///B/59/N", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 44, "atom1_serNum": 292, "atom2_serNum": 12967, "donAcc_type": "standard", "distance": 2.994, "atom1_id": "///A/13/O6", "atom2_id": "///C/8/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 45, "atom1_serNum": 293, "atom2_serNum": 12965, "donAcc_type": "standard", "distance": 2.862, "atom1_id": "///A/13/N1", "atom2_id": "///C/8/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 46, "atom1_serNum": 295, "atom2_serNum": 12964, "donAcc_type": "standard", "distance": 2.642, "atom1_id": "///A/13/N2", "atom2_id": "///C/8/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 47, "atom1_serNum": 299, "atom2_serNum": 2259, "donAcc_type": "standard", "distance": 3.390, "atom1_id": "///A/14/OP1", "atom2_id": "///B/66/NH1", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 48, "atom1_serNum": 300, "atom2_serNum": 2229, "donAcc_type": "standard", "distance": 3.017, "atom1_id": "///A/14/OP2", "atom2_id": "///B/63/NE", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 49, "atom1_serNum": 308, "atom2_serNum": 324, "donAcc_type": "acceptable", "distance": 3.042, "atom1_id": "///A/14/O2'", "atom2_id": "///A/15/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 50, "atom1_serNum": 312, "atom2_serNum": 12948, "donAcc_type": "standard", "distance": 2.702, "atom1_id": "///A/14/O2", "atom2_id": "///C/7/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 51, "atom1_serNum": 313, "atom2_serNum": 12946, "donAcc_type": "standard", "distance": 2.908, "atom1_id": "///A/14/N3", "atom2_id": "///C/7/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 52, "atom1_serNum": 315, "atom2_serNum": 12945, "donAcc_type": "standard", "distance": 3.032, "atom1_id": "///A/14/N4", "atom2_id": "///C/7/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 53, "atom1_serNum": 319, "atom2_serNum": 2257, "donAcc_type": "standard", "distance": 2.793, "atom1_id": "///A/15/OP1", "atom2_id": "///B/66/NE", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 54, "atom1_serNum": 319, "atom2_serNum": 2293, "donAcc_type": "standard", "distance": 3.118, "atom1_id": "///A/15/OP1", "atom2_id": "///B/70/NH1", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 55, "atom1_serNum": 319, "atom2_serNum": 2294, "donAcc_type": "standard", "distance": 2.935, "atom1_id": "///A/15/OP1", "atom2_id": "///B/70/NH2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 56, "atom1_serNum": 320, "atom2_serNum": 2259, "donAcc_type": "standard", "distance": 2.776, "atom1_id": "///A/15/OP2", "atom2_id": "///B/66/NH1", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 57, "atom1_serNum": 328, "atom2_serNum": 5409, "donAcc_type": "acceptable", "distance": 2.711, "atom1_id": "///A/15/O2'", "atom2_id": "///B/450/O", "atom_pair": "O:O", "residue_pair": "nt:aa" }, { "index": 58, "atom1_serNum": 335, "atom2_serNum": 12925, "donAcc_type": "standard", "distance": 2.972, "atom1_id": "///A/15/N6", "atom2_id": "///C/6/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 59, "atom1_serNum": 336, "atom2_serNum": 12923, "donAcc_type": "standard", "distance": 2.796, "atom1_id": "///A/15/N1", "atom2_id": "///C/6/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 60, "atom1_serNum": 341, "atom2_serNum": 2334, "donAcc_type": "standard", "distance": 2.866, "atom1_id": "///A/16/OP1", "atom2_id": "///B/74/NH1", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 61, "atom1_serNum": 341, "atom2_serNum": 2335, "donAcc_type": "standard", "distance": 2.716, "atom1_id": "///A/16/OP1", "atom2_id": "///B/74/NH2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 62, "atom1_serNum": 342, "atom2_serNum": 2293, "donAcc_type": "standard", "distance": 2.723, "atom1_id": "///A/16/OP2", "atom2_id": "///B/70/NH1", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 63, "atom1_serNum": 350, "atom2_serNum": 5390, "donAcc_type": "acceptable", "distance": 3.286, "atom1_id": "///A/16/O2'", "atom2_id": "///B/447/NH2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 64, "atom1_serNum": 350, "atom2_serNum": 5394, "donAcc_type": "acceptable", "distance": 2.722, "atom1_id": "///A/16/O2'", "atom2_id": "///B/448/O", "atom_pair": "O:O", "residue_pair": "nt:aa" }, { "index": 65, "atom1_serNum": 357, "atom2_serNum": 12906, "donAcc_type": "standard", "distance": 2.914, "atom1_id": "///A/16/O6", "atom2_id": "///C/5/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 66, "atom1_serNum": 358, "atom2_serNum": 12904, "donAcc_type": "standard", "distance": 2.896, "atom1_id": "///A/16/N1", "atom2_id": "///C/5/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 67, "atom1_serNum": 360, "atom2_serNum": 12903, "donAcc_type": "standard", "distance": 2.765, "atom1_id": "///A/16/N2", "atom2_id": "///C/5/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 68, "atom1_serNum": 364, "atom2_serNum": 5391, "donAcc_type": "standard", "distance": 3.540, "atom1_id": "///A/17/OP1", "atom2_id": "///B/448/N", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 69, "atom1_serNum": 365, "atom2_serNum": 2334, "donAcc_type": "standard", "distance": 2.618, "atom1_id": "///A/17/OP2", "atom2_id": "///B/74/NH1", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 70, "atom1_serNum": 371, "atom2_serNum": 3115, "donAcc_type": "standard", "distance": 3.445, "atom1_id": "///A/17/O3'", "atom2_id": "///B/165/NH2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 71, "atom1_serNum": 377, "atom2_serNum": 12887, "donAcc_type": "standard", "distance": 2.766, "atom1_id": "///A/17/O2", "atom2_id": "///C/4/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 72, "atom1_serNum": 378, "atom2_serNum": 12885, "donAcc_type": "standard", "distance": 2.938, "atom1_id": "///A/17/N3", "atom2_id": "///C/4/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 73, "atom1_serNum": 380, "atom2_serNum": 12884, "donAcc_type": "standard", "distance": 3.001, "atom1_id": "///A/17/N4", "atom2_id": "///C/4/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 74, "atom1_serNum": 384, "atom2_serNum": 3112, "donAcc_type": "standard", "distance": 2.772, "atom1_id": "///A/18/OP1", "atom2_id": "///B/165/NE", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 75, "atom1_serNum": 391, "atom2_serNum": 3116, "donAcc_type": "standard", "distance": 3.249, "atom1_id": "///A/18/O3'", "atom2_id": "///B/166/N", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 76, "atom1_serNum": 400, "atom2_serNum": 12864, "donAcc_type": "standard", "distance": 3.015, "atom1_id": "///A/18/N6", "atom2_id": "///C/3/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 77, "atom1_serNum": 401, "atom2_serNum": 12862, "donAcc_type": "standard", "distance": 2.742, "atom1_id": "///A/18/N1", "atom2_id": "///C/3/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 78, "atom1_serNum": 415, "atom2_serNum": 5016, "donAcc_type": "acceptable", "distance": 3.001, "atom1_id": "///A/19/O2'", "atom2_id": "///B/404/O", "atom_pair": "O:O", "residue_pair": "nt:aa" }, { "index": 79, "atom1_serNum": 419, "atom2_serNum": 12845, "donAcc_type": "standard", "distance": 2.724, "atom1_id": "///A/19/O2", "atom2_id": "///C/2/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 80, "atom1_serNum": 420, "atom2_serNum": 12843, "donAcc_type": "standard", "distance": 2.908, "atom1_id": "///A/19/N3", "atom2_id": "///C/2/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 81, "atom1_serNum": 422, "atom2_serNum": 12842, "donAcc_type": "standard", "distance": 3.011, "atom1_id": "///A/19/N4", "atom2_id": "///C/2/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 82, "atom1_serNum": 426, "atom2_serNum": 5011, "donAcc_type": "standard", "distance": 3.375, "atom1_id": "///A/20/OP1", "atom2_id": "///B/403/NH1", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 83, "atom1_serNum": 426, "atom2_serNum": 5013, "donAcc_type": "standard", "distance": 3.072, "atom1_id": "///A/20/OP1", "atom2_id": "///B/404/N", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 84, "atom1_serNum": 426, "atom2_serNum": 5046, "donAcc_type": "standard", "distance": 2.855, "atom1_id": "///A/20/OP1", "atom2_id": "///B/407/ND2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 85, "atom1_serNum": 427, "atom2_serNum": 5011, "donAcc_type": "standard", "distance": 2.483, "atom1_id": "///A/20/OP2", "atom2_id": "///B/403/NH1", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 86, "atom1_serNum": 439, "atom2_serNum": 12823, "donAcc_type": "standard", "distance": 2.800, "atom1_id": "///A/20/O2", "atom2_id": "///C/1/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 87, "atom1_serNum": 440, "atom2_serNum": 12821, "donAcc_type": "standard", "distance": 2.940, "atom1_id": "///A/20/N3", "atom2_id": "///C/1/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 88, "atom1_serNum": 442, "atom2_serNum": 12820, "donAcc_type": "standard", "distance": 2.961, "atom1_id": "///A/20/N4", "atom2_id": "///C/1/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 89, "atom1_serNum": 462, "atom2_serNum": 1084, "donAcc_type": "standard", "distance": 2.867, "atom1_id": "///A/21/O6", "atom2_id": "///A/50/N3", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 90, "atom1_serNum": 463, "atom2_serNum": 1083, "donAcc_type": "standard", "distance": 3.004, "atom1_id": "///A/21/N1", "atom2_id": "///A/50/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 91, "atom1_serNum": 478, "atom2_serNum": 10578, "donAcc_type": "acceptable", "distance": 2.557, "atom1_id": "///A/22/O2'", "atom2_id": "///B/1110/O", "atom_pair": "O:O", "residue_pair": "nt:aa" }, { "index": 92, "atom1_serNum": 483, "atom2_serNum": 1065, "donAcc_type": "standard", "distance": 2.802, "atom1_id": "///A/22/N3", "atom2_id": "///A/49/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 93, "atom1_serNum": 485, "atom2_serNum": 1064, "donAcc_type": "standard", "distance": 3.004, "atom1_id": "///A/22/O4", "atom2_id": "///A/49/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 94, "atom1_serNum": 498, "atom2_serNum": 10757, "donAcc_type": "acceptable", "distance": 2.831, "atom1_id": "///A/23/O2'", "atom2_id": "///B/1131/O", "atom_pair": "O:O", "residue_pair": "nt:aa" }, { "index": 95, "atom1_serNum": 502, "atom2_serNum": 10679, "donAcc_type": "standard", "distance": 3.443, "atom1_id": "///A/23/O2", "atom2_id": "///B/1122/NH1", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 96, "atom1_serNum": 503, "atom2_serNum": 1043, "donAcc_type": "standard", "distance": 2.726, "atom1_id": "///A/23/N3", "atom2_id": "///A/48/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 97, "atom1_serNum": 505, "atom2_serNum": 1042, "donAcc_type": "standard", "distance": 3.059, "atom1_id": "///A/23/O4", "atom2_id": "///A/48/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 98, "atom1_serNum": 509, "atom2_serNum": 10598, "donAcc_type": "standard", "distance": 2.973, "atom1_id": "///A/24/OP1", "atom2_id": "///B/1113/N", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 99, "atom1_serNum": 518, "atom2_serNum": 2598, "donAcc_type": "acceptable", "distance": 2.745, "atom1_id": "///A/24/O2'", "atom2_id": "///B/105/O", "atom_pair": "O:O", "residue_pair": "nt:aa" }, { "index": 100, "atom1_serNum": 523, "atom2_serNum": 1021, "donAcc_type": "standard", "distance": 2.875, "atom1_id": "///A/24/N3", "atom2_id": "///A/47/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 101, "atom1_serNum": 525, "atom2_serNum": 1020, "donAcc_type": "standard", "distance": 3.016, "atom1_id": "///A/24/O4", "atom2_id": "///A/47/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 102, "atom1_serNum": 538, "atom2_serNum": 2592, "donAcc_type": "acceptable", "distance": 3.373, "atom1_id": "///A/25/O2'", "atom2_id": "///B/104/O", "atom_pair": "O:O", "residue_pair": "nt:aa" }, { "index": 103, "atom1_serNum": 538, "atom2_serNum": 2655, "donAcc_type": "acceptable", "distance": 3.340, "atom1_id": "///A/25/O2'", "atom2_id": "///B/111/NZ", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 104, "atom1_serNum": 543, "atom2_serNum": 999, "donAcc_type": "standard", "distance": 2.790, "atom1_id": "///A/25/N3", "atom2_id": "///A/46/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 105, "atom1_serNum": 545, "atom2_serNum": 998, "donAcc_type": "standard", "distance": 3.060, "atom1_id": "///A/25/O4", "atom2_id": "///A/46/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 106, "atom1_serNum": 549, "atom2_serNum": 2693, "donAcc_type": "standard", "distance": 2.526, "atom1_id": "///A/26/OP1", "atom2_id": "///B/115/NH1", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 107, "atom1_serNum": 565, "atom2_serNum": 978, "donAcc_type": "standard", "distance": 3.083, "atom1_id": "///A/26/N6", "atom2_id": "///A/45/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 108, "atom1_serNum": 566, "atom2_serNum": 976, "donAcc_type": "standard", "distance": 2.850, "atom1_id": "///A/26/N1", "atom2_id": "///A/45/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 109, "atom1_serNum": 571, "atom2_serNum": 2704, "donAcc_type": "standard", "distance": 3.010, "atom1_id": "///A/27/OP1", "atom2_id": "///B/116/NE2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 110, "atom1_serNum": 572, "atom2_serNum": 2693, "donAcc_type": "standard", "distance": 3.747, "atom1_id": "///A/27/OP2", "atom2_id": "///B/115/NH1", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 111, "atom1_serNum": 588, "atom2_serNum": 943, "donAcc_type": "standard", "distance": 3.341, "atom1_id": "///A/27/N1", "atom2_id": "///A/44/OP2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 112, "atom1_serNum": 590, "atom2_serNum": 943, "donAcc_type": "standard", "distance": 2.591, "atom1_id": "///A/27/N2", "atom2_id": "///A/44/OP2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 113, "atom1_serNum": 603, "atom2_serNum": 623, "donAcc_type": "acceptable", "distance": 3.639, "atom1_id": "///A/28/O2'", "atom2_id": "///A/29/O3'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 114, "atom1_serNum": 632, "atom2_serNum": 871, "donAcc_type": "standard", "distance": 2.867, "atom1_id": "///A/29/O6", "atom2_id": "///A/40/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 115, "atom1_serNum": 633, "atom2_serNum": 869, "donAcc_type": "standard", "distance": 2.859, "atom1_id": "///A/29/N1", "atom2_id": "///A/40/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 116, "atom1_serNum": 635, "atom2_serNum": 868, "donAcc_type": "standard", "distance": 2.754, "atom1_id": "///A/29/N2", "atom2_id": "///A/40/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 117, "atom1_serNum": 652, "atom2_serNum": 851, "donAcc_type": "standard", "distance": 2.712, "atom1_id": "///A/30/O2", "atom2_id": "///A/39/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 118, "atom1_serNum": 653, "atom2_serNum": 849, "donAcc_type": "standard", "distance": 2.865, "atom1_id": "///A/30/N3", "atom2_id": "///A/39/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 119, "atom1_serNum": 655, "atom2_serNum": 848, "donAcc_type": "standard", "distance": 2.941, "atom1_id": "///A/30/N4", "atom2_id": "///A/39/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 120, "atom1_serNum": 673, "atom2_serNum": 827, "donAcc_type": "standard", "distance": 2.755, "atom1_id": "///A/31/N3", "atom2_id": "///A/38/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 121, "atom1_serNum": 675, "atom2_serNum": 826, "donAcc_type": "standard", "distance": 2.991, "atom1_id": "///A/31/O4", "atom2_id": "///A/38/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 122, "atom1_serNum": 695, "atom2_serNum": 806, "donAcc_type": "standard", "distance": 2.981, "atom1_id": "///A/32/N6", "atom2_id": "///A/37/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 123, "atom1_serNum": 696, "atom2_serNum": 804, "donAcc_type": "standard", "distance": 2.714, "atom1_id": "///A/32/N1", "atom2_id": "///A/37/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 124, "atom1_serNum": 710, "atom2_serNum": 762, "donAcc_type": "acceptable", "distance": 2.961, "atom1_id": "///A/33/O2'", "atom2_id": "///A/35/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 125, "atom1_serNum": 876, "atom2_serNum": 4484, "donAcc_type": "standard", "distance": 2.540, "atom1_id": "///A/41/OP2", "atom2_id": "///B/340/NH2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 126, "atom1_serNum": 898, "atom2_serNum": 4453, "donAcc_type": "standard", "distance": 3.499, "atom1_id": "///A/42/OP2", "atom2_id": "///B/336/NZ", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 127, "atom1_serNum": 913, "atom2_serNum": 4577, "donAcc_type": "standard", "distance": 3.033, "atom1_id": "///A/42/N6", "atom2_id": "///B/351/O", "atom_pair": "N:O", "residue_pair": "nt:aa" }, { "index": 128, "atom1_serNum": 928, "atom2_serNum": 4651, "donAcc_type": "acceptable", "distance": 2.878, "atom1_id": "///A/43/O2'", "atom2_id": "///B/359/OH", "atom_pair": "O:O", "residue_pair": "nt:aa" }, { "index": 129, "atom1_serNum": 932, "atom2_serNum": 4453, "donAcc_type": "standard", "distance": 2.927, "atom1_id": "///A/43/N7", "atom2_id": "///B/336/NZ", "atom_pair": "N:N", "residue_pair": "nt:aa" }, { "index": 130, "atom1_serNum": 936, "atom2_serNum": 4577, "donAcc_type": "standard", "distance": 3.044, "atom1_id": "///A/43/N1", "atom2_id": "///B/351/O", "atom_pair": "N:O", "residue_pair": "nt:aa" }, { "index": 131, "atom1_serNum": 938, "atom2_serNum": 4688, "donAcc_type": "standard", "distance": 3.359, "atom1_id": "///A/43/N2", "atom2_id": "///B/364/OD2", "atom_pair": "N:O", "residue_pair": "nt:aa" }, { "index": 132, "atom1_serNum": 951, "atom2_serNum": 5000, "donAcc_type": "acceptable", "distance": 2.321, "atom1_id": "///A/44/O2'", "atom2_id": "///B/402/OE1", "atom_pair": "O:O", "residue_pair": "nt:aa" }, { "index": 133, "atom1_serNum": 955, "atom2_serNum": 5001, "donAcc_type": "standard", "distance": 3.246, "atom1_id": "///A/44/O2", "atom2_id": "///B/402/NE2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 134, "atom1_serNum": 956, "atom2_serNum": 4351, "donAcc_type": "standard", "distance": 3.499, "atom1_id": "///A/44/N3", "atom2_id": "///B/325/O", "atom_pair": "N:O", "residue_pair": "nt:aa" }, { "index": 135, "atom1_serNum": 962, "atom2_serNum": 4993, "donAcc_type": "standard", "distance": 2.732, "atom1_id": "///A/45/OP1", "atom2_id": "///B/402/N", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 136, "atom1_serNum": 962, "atom2_serNum": 5002, "donAcc_type": "standard", "distance": 2.750, "atom1_id": "///A/45/OP1", "atom2_id": "///B/403/N", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 137, "atom1_serNum": 971, "atom2_serNum": 2853, "donAcc_type": "acceptable", "distance": 3.025, "atom1_id": "///A/45/O2'", "atom2_id": "///B/135/N", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 138, "atom1_serNum": 982, "atom2_serNum": 3068, "donAcc_type": "standard", "distance": 2.780, "atom1_id": "///A/46/OP1", "atom2_id": "///B/160/NE2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 139, "atom1_serNum": 982, "atom2_serNum": 5009, "donAcc_type": "standard", "distance": 2.639, "atom1_id": "///A/46/OP1", "atom2_id": "///B/403/NE", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 140, "atom1_serNum": 991, "atom2_serNum": 1009, "donAcc_type": "acceptable", "distance": 3.050, "atom1_id": "///A/46/O2'", "atom2_id": "///A/47/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 141, "atom1_serNum": 1013, "atom2_serNum": 2566, "donAcc_type": "acceptable", "distance": 2.586, "atom1_id": "///A/47/O2'", "atom2_id": "///B/101/O", "atom_pair": "O:O", "residue_pair": "nt:aa" }, { "index": 142, "atom1_serNum": 1013, "atom2_serNum": 2594, "donAcc_type": "acceptable", "distance": 2.869, "atom1_id": "///A/47/O2'", "atom2_id": "///B/104/OG", "atom_pair": "O:O", "residue_pair": "nt:aa" }, { "index": 143, "atom1_serNum": 1023, "atom2_serNum": 2594, "donAcc_type": "acceptable", "distance": 2.622, "atom1_id": "///A/47/N3", "atom2_id": "///B/104/OG", "atom_pair": "N:O", "residue_pair": "nt:aa" }, { "index": 144, "atom1_serNum": 1027, "atom2_serNum": 3093, "donAcc_type": "standard", "distance": 2.769, "atom1_id": "///A/48/OP2", "atom2_id": "///B/163/NZ", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 145, "atom1_serNum": 1035, "atom2_serNum": 1053, "donAcc_type": "acceptable", "distance": 3.247, "atom1_id": "///A/48/O2'", "atom2_id": "///A/49/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 146, "atom1_serNum": 1048, "atom2_serNum": 2355, "donAcc_type": "standard", "distance": 2.848, "atom1_id": "///A/49/OP1", "atom2_id": "///B/76/NZ", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 147, "atom1_serNum": 1067, "atom2_serNum": 10680, "donAcc_type": "standard", "distance": 2.532, "atom1_id": "///A/49/N3", "atom2_id": "///B/1122/NH2", "atom_pair": "N:N", "residue_pair": "nt:aa" }, { "index": 148, "atom1_serNum": 1070, "atom2_serNum": 10689, "donAcc_type": "standard", "distance": 3.350, "atom1_id": "///A/50/OP1", "atom2_id": "///B/1123/NZ", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 149, "atom1_serNum": 1086, "atom2_serNum": 2345, "donAcc_type": "standard", "distance": 3.320, "atom1_id": "///A/50/O4", "atom2_id": "///B/75/NH1", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 150, "atom1_serNum": 1086, "atom2_serNum": 2346, "donAcc_type": "standard", "distance": 3.297, "atom1_id": "///A/50/O4", "atom2_id": "///B/75/NH2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 151, "atom1_serNum": 1103, "atom2_serNum": 10534, "donAcc_type": "standard", "distance": 3.075, "atom1_id": "///A/51/N7", "atom2_id": "///B/1105/N", "atom_pair": "N:N", "residue_pair": "nt:aa" }, { "index": 152, "atom1_serNum": 1106, "atom2_serNum": 10529, "donAcc_type": "standard", "distance": 3.246, "atom1_id": "///A/51/N6", "atom2_id": "///B/1103/O", "atom_pair": "N:O", "residue_pair": "nt:aa" }, { "index": 153, "atom1_serNum": 1107, "atom2_serNum": 1334, "donAcc_type": "acceptable", "distance": 2.782, "atom1_id": "///A/51/N1", "atom2_id": "///A/62/O2'", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 154, "atom1_serNum": 1112, "atom2_serNum": 10689, "donAcc_type": "standard", "distance": 2.522, "atom1_id": "///A/52/OP1", "atom2_id": "///B/1123/NZ", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 155, "atom1_serNum": 1113, "atom2_serNum": 1342, "donAcc_type": "standard", "distance": 2.783, "atom1_id": "///A/52/OP2", "atom2_id": "///A/62/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 156, "atom1_serNum": 1113, "atom2_serNum": 1344, "donAcc_type": "standard", "distance": 2.578, "atom1_id": "///A/52/OP2", "atom2_id": "///A/62/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 157, "atom1_serNum": 1125, "atom2_serNum": 1344, "donAcc_type": "standard", "distance": 3.037, "atom1_id": "///A/52/N7", "atom2_id": "///A/62/N2", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 158, "atom1_serNum": 1134, "atom2_serNum": 10690, "donAcc_type": "standard", "distance": 2.759, "atom1_id": "///A/53/OP1", "atom2_id": "///B/1124/N", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 159, "atom1_serNum": 1150, "atom2_serNum": 1321, "donAcc_type": "standard", "distance": 2.962, "atom1_id": "///A/53/O6", "atom2_id": "///A/61/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 160, "atom1_serNum": 1151, "atom2_serNum": 1319, "donAcc_type": "standard", "distance": 2.913, "atom1_id": "///A/53/N1", "atom2_id": "///A/61/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 161, "atom1_serNum": 1153, "atom2_serNum": 1318, "donAcc_type": "standard", "distance": 2.773, "atom1_id": "///A/53/N2", "atom2_id": "///A/61/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 162, "atom1_serNum": 1166, "atom2_serNum": 1185, "donAcc_type": "acceptable", "distance": 2.980, "atom1_id": "///A/54/O2'", "atom2_id": "///A/55/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 163, "atom1_serNum": 1173, "atom2_serNum": 1301, "donAcc_type": "standard", "distance": 2.954, "atom1_id": "///A/54/O6", "atom2_id": "///A/60/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 164, "atom1_serNum": 1174, "atom2_serNum": 1299, "donAcc_type": "standard", "distance": 2.898, "atom1_id": "///A/54/N1", "atom2_id": "///A/60/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 165, "atom1_serNum": 1176, "atom2_serNum": 1298, "donAcc_type": "standard", "distance": 2.746, "atom1_id": "///A/54/N2", "atom2_id": "///A/60/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 166, "atom1_serNum": 1189, "atom2_serNum": 1202, "donAcc_type": "acceptable", "distance": 2.856, "atom1_id": "///A/55/O2'", "atom2_id": "///A/56/O5'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 167, "atom1_serNum": 1189, "atom2_serNum": 1233, "donAcc_type": "acceptable", "distance": 2.835, "atom1_id": "///A/55/O2'", "atom2_id": "///A/57/N7", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 168, "atom1_serNum": 1193, "atom2_serNum": 1209, "donAcc_type": "acceptable", "distance": 2.566, "atom1_id": "///A/55/O2", "atom2_id": "///A/56/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 169, "atom1_serNum": 1193, "atom2_serNum": 1261, "donAcc_type": "standard", "distance": 2.709, "atom1_id": "///A/55/O2", "atom2_id": "///A/58/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 170, "atom1_serNum": 1194, "atom2_serNum": 1259, "donAcc_type": "standard", "distance": 2.880, "atom1_id": "///A/55/N3", "atom2_id": "///A/58/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 171, "atom1_serNum": 1196, "atom2_serNum": 1258, "donAcc_type": "standard", "distance": 2.980, "atom1_id": "///A/55/N4", "atom2_id": "///A/58/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 172, "atom1_serNum": 1209, "atom2_serNum": 1222, "donAcc_type": "acceptable", "distance": 2.903, "atom1_id": "///A/56/O2'", "atom2_id": "///A/57/O5'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 173, "atom1_serNum": 1213, "atom2_serNum": 1261, "donAcc_type": "standard", "distance": 3.015, "atom1_id": "///A/56/O2", "atom2_id": "///A/58/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 174, "atom1_serNum": 1220, "atom2_serNum": 5471, "donAcc_type": "standard", "distance": 2.566, "atom1_id": "///A/57/OP1", "atom2_id": "///B/457/NH2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 175, "atom1_serNum": 1249, "atom2_serNum": 5556, "donAcc_type": "standard", "distance": 3.500, "atom1_id": "///A/58/O3'", "atom2_id": "///B/467/NH2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 176, "atom1_serNum": 1251, "atom2_serNum": 5451, "donAcc_type": "acceptable", "distance": 2.575, "atom1_id": "///A/58/O2'", "atom2_id": "///B/455/O", "atom_pair": "O:O", "residue_pair": "nt:aa" }, { "index": 177, "atom1_serNum": 1265, "atom2_serNum": 5556, "donAcc_type": "standard", "distance": 2.349, "atom1_id": "///A/59/OP1", "atom2_id": "///B/467/NH2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 178, "atom1_serNum": 1265, "atom2_serNum": 5597, "donAcc_type": "standard", "distance": 2.819, "atom1_id": "///A/59/OP1", "atom2_id": "///B/473/N", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 179, "atom1_serNum": 1266, "atom2_serNum": 5595, "donAcc_type": "acceptable", "distance": 3.244, "atom1_id": "///A/59/OP2", "atom2_id": "///B/472/OG1", "atom_pair": "O:O", "residue_pair": "nt:aa" }, { "index": 180, "atom1_serNum": 1274, "atom2_serNum": 1286, "donAcc_type": "acceptable", "distance": 2.817, "atom1_id": "///A/59/O2'", "atom2_id": "///A/60/OP2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 181, "atom1_serNum": 1274, "atom2_serNum": 2363, "donAcc_type": "acceptable", "distance": 3.193, "atom1_id": "///A/59/O2'", "atom2_id": "///B/77/ND2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 182, "atom1_serNum": 1278, "atom2_serNum": 2363, "donAcc_type": "standard", "distance": 2.656, "atom1_id": "///A/59/O2", "atom2_id": "///B/77/ND2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 183, "atom1_serNum": 1285, "atom2_serNum": 2335, "donAcc_type": "standard", "distance": 2.830, "atom1_id": "///A/60/OP1", "atom2_id": "///B/74/NH2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 184, "atom1_serNum": 1285, "atom2_serNum": 5448, "donAcc_type": "standard", "distance": 2.938, "atom1_id": "///A/60/OP1", "atom2_id": "///B/455/N", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 185, "atom1_serNum": 1286, "atom2_serNum": 2332, "donAcc_type": "standard", "distance": 3.498, "atom1_id": "///A/60/OP2", "atom2_id": "///B/74/NE", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 186, "atom1_serNum": 1305, "atom2_serNum": 2294, "donAcc_type": "standard", "distance": 2.664, "atom1_id": "///A/61/OP1", "atom2_id": "///B/70/NH2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 187, "atom1_serNum": 1305, "atom2_serNum": 5489, "donAcc_type": "acceptable", "distance": 2.665, "atom1_id": "///A/61/OP1", "atom2_id": "///B/460/OG", "atom_pair": "O:O", "residue_pair": "nt:aa" }, { "index": 188, "atom1_serNum": 1306, "atom2_serNum": 2291, "donAcc_type": "standard", "distance": 2.808, "atom1_id": "///A/61/OP2", "atom2_id": "///B/70/NE", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 189, "atom1_serNum": 1326, "atom2_serNum": 2282, "donAcc_type": "standard", "distance": 2.913, "atom1_id": "///A/62/OP2", "atom2_id": "///B/69/NH1", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 190, "atom1_serNum": 1327, "atom2_serNum": 2282, "donAcc_type": "standard", "distance": 3.210, "atom1_id": "///A/62/O5'", "atom2_id": "///B/69/NH1", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 191, "atom1_serNum": 1349, "atom2_serNum": 2282, "donAcc_type": "standard", "distance": 3.302, "atom1_id": "///A/63/OP2", "atom2_id": "///B/69/NH1", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 192, "atom1_serNum": 1357, "atom2_serNum": 2220, "donAcc_type": "acceptable", "distance": 2.795, "atom1_id": "///A/63/O2'", "atom2_id": "///B/62/OG1", "atom_pair": "O:O", "residue_pair": "nt:aa" }, { "index": 193, "atom1_serNum": 1368, "atom2_serNum": 10524, "donAcc_type": "acceptable", "distance": 2.636, "atom1_id": "///A/64/OP1", "atom2_id": "///B/1102/OG1", "atom_pair": "O:O", "residue_pair": "nt:aa" }, { "index": 194, "atom1_serNum": 1373, "atom2_serNum": 2220, "donAcc_type": "acceptable", "distance": 3.090, "atom1_id": "///A/64/O4'", "atom2_id": "///B/62/OG1", "atom_pair": "O:O", "residue_pair": "nt:aa" }, { "index": 195, "atom1_serNum": 1377, "atom2_serNum": 2183, "donAcc_type": "acceptable", "distance": 2.603, "atom1_id": "///A/64/O2'", "atom2_id": "///B/57/O", "atom_pair": "O:O", "residue_pair": "nt:aa" }, { "index": 196, "atom1_serNum": 1388, "atom2_serNum": 2180, "donAcc_type": "standard", "distance": 2.849, "atom1_id": "///A/65/OP1", "atom2_id": "///B/57/N", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 197, "atom1_serNum": 1397, "atom2_serNum": 7655, "donAcc_type": "acceptable", "distance": 2.617, "atom1_id": "///A/65/O2'", "atom2_id": "///B/721/NE2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 198, "atom1_serNum": 1430, "atom2_serNum": 7785, "donAcc_type": "standard", "distance": 2.993, "atom1_id": "///A/67/OP1", "atom2_id": "///B/739/NE2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 199, "atom1_serNum": 1430, "atom2_serNum": 7808, "donAcc_type": "standard", "distance": 2.618, "atom1_id": "///A/67/OP1", "atom2_id": "///B/742/NZ", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 200, "atom1_serNum": 1431, "atom2_serNum": 7785, "donAcc_type": "standard", "distance": 3.377, "atom1_id": "///A/67/OP2", "atom2_id": "///B/739/NE2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 201, "atom1_serNum": 1431, "atom2_serNum": 10486, "donAcc_type": "standard", "distance": 3.072, "atom1_id": "///A/67/OP2", "atom2_id": "///B/1097/NZ", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 202, "atom1_serNum": 1444, "atom2_serNum": 10503, "donAcc_type": "standard", "distance": 2.910, "atom1_id": "///A/67/N3", "atom2_id": "///B/1100/N", "atom_pair": "N:N", "residue_pair": "nt:aa" }, { "index": 203, "atom1_serNum": 1446, "atom2_serNum": 10506, "donAcc_type": "standard", "distance": 3.111, "atom1_id": "///A/67/N4", "atom2_id": "///B/1100/O", "atom_pair": "N:O", "residue_pair": "nt:aa" }, { "index": 204, "atom1_serNum": 1459, "atom2_serNum": 12506, "donAcc_type": "acceptable", "distance": 2.813, "atom1_id": "///A/68/O2'", "atom2_id": "///B/1349/ND1", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 205, "atom1_serNum": 1466, "atom2_serNum": 1746, "donAcc_type": "standard", "distance": 2.674, "atom1_id": "///A/68/N6", "atom2_id": "///A/81/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 206, "atom1_serNum": 1488, "atom2_serNum": 1726, "donAcc_type": "standard", "distance": 3.019, "atom1_id": "///A/69/N6", "atom2_id": "///A/80/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 207, "atom1_serNum": 1489, "atom2_serNum": 1724, "donAcc_type": "standard", "distance": 2.934, "atom1_id": "///A/69/N1", "atom2_id": "///A/80/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 208, "atom1_serNum": 1507, "atom2_serNum": 1706, "donAcc_type": "standard", "distance": 2.589, "atom1_id": "///A/70/O2", "atom2_id": "///A/79/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 209, "atom1_serNum": 1508, "atom2_serNum": 1704, "donAcc_type": "standard", "distance": 2.813, "atom1_id": "///A/70/N3", "atom2_id": "///A/79/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 210, "atom1_serNum": 1510, "atom2_serNum": 1703, "donAcc_type": "standard", "distance": 2.947, "atom1_id": "///A/70/N4", "atom2_id": "///A/79/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 211, "atom1_serNum": 1528, "atom2_serNum": 1682, "donAcc_type": "standard", "distance": 2.796, "atom1_id": "///A/71/N3", "atom2_id": "///A/78/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 212, "atom1_serNum": 1530, "atom2_serNum": 1681, "donAcc_type": "standard", "distance": 2.830, "atom1_id": "///A/71/O4", "atom2_id": "///A/78/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 213, "atom1_serNum": 1548, "atom2_serNum": 1660, "donAcc_type": "standard", "distance": 2.575, "atom1_id": "///A/72/N3", "atom2_id": "///A/77/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 214, "atom1_serNum": 1550, "atom2_serNum": 1659, "donAcc_type": "standard", "distance": 2.781, "atom1_id": "///A/72/O4", "atom2_id": "///A/77/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 215, "atom1_serNum": 1563, "atom2_serNum": 1615, "donAcc_type": "acceptable", "distance": 3.356, "atom1_id": "///A/73/O2'", "atom2_id": "///A/75/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 216, "atom1_serNum": 1571, "atom2_serNum": 1622, "donAcc_type": "standard", "distance": 3.308, "atom1_id": "///A/73/N1", "atom2_id": "///A/76/OP2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 217, "atom1_serNum": 1573, "atom2_serNum": 1622, "donAcc_type": "standard", "distance": 2.468, "atom1_id": "///A/73/N2", "atom2_id": "///A/76/OP2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 218, "atom1_serNum": 1573, "atom2_serNum": 1634, "donAcc_type": "standard", "distance": 2.453, "atom1_id": "///A/73/N2", "atom2_id": "///A/76/N7", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 219, "atom1_serNum": 1574, "atom2_serNum": 1637, "donAcc_type": "standard", "distance": 3.314, "atom1_id": "///A/73/N3", "atom2_id": "///A/76/N6", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 220, "atom1_serNum": 1630, "atom2_serNum": 1643, "donAcc_type": "acceptable", "distance": 2.781, "atom1_id": "///A/76/O2'", "atom2_id": "///A/77/OP1", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 221, "atom1_serNum": 1711, "atom2_serNum": 7893, "donAcc_type": "standard", "distance": 3.427, "atom1_id": "///A/80/OP2", "atom2_id": "///B/753/NH2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 222, "atom1_serNum": 1749, "atom2_serNum": 2001, "donAcc_type": "standard", "distance": 2.782, "atom1_id": "///A/81/N2", "atom2_id": "///B/33/O", "atom_pair": "N:O", "residue_pair": "nt:aa" }, { "index": 223, "atom1_serNum": 1749, "atom2_serNum": 12567, "donAcc_type": "standard", "distance": 3.088, "atom1_id": "///A/81/N2", "atom2_id": "///B/1357/O", "atom_pair": "N:O", "residue_pair": "nt:aa" }, { "index": 224, "atom1_serNum": 1786, "atom2_serNum": 7920, "donAcc_type": "standard", "distance": 2.772, "atom1_id": "///B/5/O", "atom2_id": "///B/757/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 225, "atom1_serNum": 1794, "atom2_serNum": 7897, "donAcc_type": "acceptable", "distance": 2.542, "atom1_id": "///B/5/OH", "atom2_id": "///B/754/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 226, "atom1_serNum": 1795, "atom2_serNum": 1899, "donAcc_type": "standard", "distance": 2.889, "atom1_id": "///B/6/N", "atom2_id": "///B/21/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 227, "atom1_serNum": 1798, "atom2_serNum": 1896, "donAcc_type": "standard", "distance": 2.892, "atom1_id": "///B/6/O", "atom2_id": "///B/21/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 228, "atom1_serNum": 1800, "atom2_serNum": 7929, "donAcc_type": "acceptable", "distance": 3.184, "atom1_id": "///B/6/OG", "atom2_id": "///B/758/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 229, "atom1_serNum": 1800, "atom2_serNum": 7936, "donAcc_type": "acceptable", "distance": 3.060, "atom1_id": "///B/6/OG", "atom2_id": "///B/758/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 230, "atom1_serNum": 1801, "atom2_serNum": 7932, "donAcc_type": "standard", "distance": 3.058, "atom1_id": "///B/7/N", "atom2_id": "///B/758/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 231, "atom1_serNum": 1804, "atom2_serNum": 7945, "donAcc_type": "standard", "distance": 2.874, "atom1_id": "///B/7/O", "atom2_id": "///B/760/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 232, "atom1_serNum": 1809, "atom2_serNum": 1887, "donAcc_type": "standard", "distance": 2.881, "atom1_id": "///B/8/N", "atom2_id": "///B/19/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 233, "atom1_serNum": 1812, "atom2_serNum": 1884, "donAcc_type": "standard", "distance": 2.960, "atom1_id": "///B/8/O", "atom2_id": "///B/19/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 234, "atom1_serNum": 1813, "atom2_serNum": 7948, "donAcc_type": "standard", "distance": 2.779, "atom1_id": "///B/9/N", "atom2_id": "///B/760/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 235, "atom1_serNum": 1816, "atom2_serNum": 7960, "donAcc_type": "standard", "distance": 3.100, "atom1_id": "///B/9/O", "atom2_id": "///B/762/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 236, "atom1_serNum": 1821, "atom2_serNum": 1869, "donAcc_type": "standard", "distance": 2.885, "atom1_id": "///B/10/N", "atom2_id": "///B/17/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 237, "atom1_serNum": 1824, "atom2_serNum": 1866, "donAcc_type": "standard", "distance": 2.902, "atom1_id": "///B/10/O", "atom2_id": "///B/17/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 238, "atom1_serNum": 1826, "atom2_serNum": 7963, "donAcc_type": "standard", "distance": 2.886, "atom1_id": "///B/11/N", "atom2_id": "///B/762/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 239, "atom1_serNum": 1829, "atom2_serNum": 7977, "donAcc_type": "standard", "distance": 3.041, "atom1_id": "///B/11/O", "atom2_id": "///B/764/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 240, "atom1_serNum": 1834, "atom2_serNum": 1856, "donAcc_type": "standard", "distance": 2.813, "atom1_id": "///B/12/N", "atom2_id": "///B/15/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 241, "atom1_serNum": 1843, "atom2_serNum": 1851, "donAcc_type": "acceptable", "distance": 2.951, "atom1_id": "///B/13/OG1", "atom2_id": "///B/14/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 242, "atom1_serNum": 1848, "atom2_serNum": 2151, "donAcc_type": "standard", "distance": 3.275, "atom1_id": "///B/14/O", "atom2_id": "///B/53/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 243, "atom1_serNum": 1852, "atom2_serNum": 2175, "donAcc_type": "acceptable", "distance": 2.666, "atom1_id": "///B/14/ND2", "atom2_id": "///B/55/OG", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 244, "atom1_serNum": 1859, "atom2_serNum": 2138, "donAcc_type": "standard", "distance": 2.878, "atom1_id": "///B/16/N", "atom2_id": "///B/51/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 245, "atom1_serNum": 1862, "atom2_serNum": 2135, "donAcc_type": "standard", "distance": 2.878, "atom1_id": "///B/16/O", "atom2_id": "///B/51/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 246, "atom1_serNum": 1870, "atom2_serNum": 2129, "donAcc_type": "standard", "distance": 2.861, "atom1_id": "///B/18/N", "atom2_id": "///B/49/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 247, "atom1_serNum": 1873, "atom2_serNum": 2126, "donAcc_type": "standard", "distance": 2.921, "atom1_id": "///B/18/O", "atom2_id": "///B/49/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 248, "atom1_serNum": 1889, "atom2_serNum": 2113, "donAcc_type": "standard", "distance": 2.950, "atom1_id": "///B/20/N", "atom2_id": "///B/47/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 249, "atom1_serNum": 1904, "atom2_serNum": 1943, "donAcc_type": "standard", "distance": 2.814, "atom1_id": "///B/22/N", "atom2_id": "///B/26/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 250, "atom1_serNum": 1907, "atom2_serNum": 1928, "donAcc_type": "standard", "distance": 3.152, "atom1_id": "///B/22/O", "atom2_id": "///B/25/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 251, "atom1_serNum": 1931, "atom2_serNum": 9798, "donAcc_type": "acceptable", "distance": 2.580, "atom1_id": "///B/25/O", "atom2_id": "///B/988/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 252, "atom1_serNum": 1939, "atom2_serNum": 10286, "donAcc_type": "acceptable", "distance": 2.816, "atom1_id": "///B/25/OH", "atom2_id": "///B/1073/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 253, "atom1_serNum": 1959, "atom2_serNum": 2110, "donAcc_type": "standard", "distance": 2.959, "atom1_id": "///B/28/O", "atom2_id": "///B/47/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 254, "atom1_serNum": 1966, "atom2_serNum": 1968, "donAcc_type": "acceptable", "distance": 2.769, "atom1_id": "///B/29/O", "atom2_id": "///B/29/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 255, "atom1_serNum": 1968, "atom2_serNum": 2092, "donAcc_type": "acceptable", "distance": 2.672, "atom1_id": "///B/29/OG", "atom2_id": "///B/44/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 256, "atom1_serNum": 1969, "atom2_serNum": 2096, "donAcc_type": "standard", "distance": 2.940, "atom1_id": "///B/30/N", "atom2_id": "///B/45/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 257, "atom1_serNum": 1972, "atom2_serNum": 2093, "donAcc_type": "standard", "distance": 2.899, "atom1_id": "///B/30/O", "atom2_id": "///B/45/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 258, "atom1_serNum": 1987, "atom2_serNum": 2079, "donAcc_type": "standard", "distance": 2.863, "atom1_id": "///B/32/N", "atom2_id": "///B/43/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 259, "atom1_serNum": 1990, "atom2_serNum": 2076, "donAcc_type": "standard", "distance": 2.914, "atom1_id": "///B/32/O", "atom2_id": "///B/43/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 260, "atom1_serNum": 2007, "atom2_serNum": 2063, "donAcc_type": "standard", "distance": 2.857, "atom1_id": "///B/34/N", "atom2_id": "///B/41/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 261, "atom1_serNum": 2014, "atom2_serNum": 12567, "donAcc_type": "standard", "distance": 3.107, "atom1_id": "///B/35/N", "atom2_id": "///B/1357/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 262, "atom1_serNum": 2017, "atom2_serNum": 12580, "donAcc_type": "standard", "distance": 2.768, "atom1_id": "///B/35/O", "atom2_id": "///B/1359/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 263, "atom1_serNum": 2026, "atom2_serNum": 2032, "donAcc_type": "standard", "distance": 2.876, "atom1_id": "///B/37/N", "atom2_id": "///B/37/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 264, "atom1_serNum": 2026, "atom2_serNum": 12583, "donAcc_type": "standard", "distance": 3.145, "atom1_id": "///B/37/N", "atom2_id": "///B/1359/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 265, "atom1_serNum": 2029, "atom2_serNum": 12629, "donAcc_type": "standard", "distance": 3.493, "atom1_id": "///B/37/O", "atom2_id": "///B/1364/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 266, "atom1_serNum": 2032, "atom2_serNum": 12599, "donAcc_type": "standard", "distance": 2.440, "atom1_id": "///B/37/OD1", "atom2_id": "///B/1361/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 267, "atom1_serNum": 2033, "atom2_serNum": 12602, "donAcc_type": "standard", "distance": 3.213, "atom1_id": "///B/37/ND2", "atom2_id": "///B/1361/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 268, "atom1_serNum": 2041, "atom2_serNum": 2048, "donAcc_type": "standard", "distance": 2.575, "atom1_id": "///B/39/N", "atom2_id": "///B/39/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 269, "atom1_serNum": 2048, "atom2_serNum": 2049, "donAcc_type": "standard", "distance": 3.223, "atom1_id": "///B/39/OD2", "atom2_id": "///B/40/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 270, "atom1_serNum": 2059, "atom2_serNum": 2073, "donAcc_type": "standard", "distance": 3.013, "atom1_id": "///B/40/NH2", "atom2_id": "///B/42/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 271, "atom1_serNum": 2101, "atom2_serNum": 10452, "donAcc_type": "standard", "distance": 3.496, "atom1_id": "///B/45/NZ", "atom2_id": "///B/1093/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 272, "atom1_serNum": 2101, "atom2_serNum": 12543, "donAcc_type": "standard", "distance": 3.433, "atom1_id": "///B/45/NZ", "atom2_id": "///B/1354/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 273, "atom1_serNum": 2101, "atom2_serNum": 12572, "donAcc_type": "standard", "distance": 2.571, "atom1_id": "///B/45/NZ", "atom2_id": "///B/1357/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 274, "atom1_serNum": 2102, "atom2_serNum": 10437, "donAcc_type": "standard", "distance": 2.834, "atom1_id": "///B/46/N", "atom2_id": "///B/1091/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 275, "atom1_serNum": 2105, "atom2_serNum": 2118, "donAcc_type": "standard", "distance": 2.960, "atom1_id": "///B/46/O", "atom2_id": "///B/48/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 276, "atom1_serNum": 2105, "atom2_serNum": 10453, "donAcc_type": "standard", "distance": 2.646, "atom1_id": "///B/46/O", "atom2_id": "///B/1093/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 277, "atom1_serNum": 2109, "atom2_serNum": 10433, "donAcc_type": "standard", "distance": 3.107, "atom1_id": "///B/46/ND2", "atom2_id": "///B/1091/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 278, "atom1_serNum": 2121, "atom2_serNum": 10446, "donAcc_type": "standard", "distance": 3.143, "atom1_id": "///B/48/O", "atom2_id": "///B/1093/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 279, "atom1_serNum": 2121, "atom2_serNum": 10453, "donAcc_type": "standard", "distance": 2.824, "atom1_id": "///B/48/O", "atom2_id": "///B/1093/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 280, "atom1_serNum": 2130, "atom2_serNum": 10449, "donAcc_type": "standard", "distance": 2.954, "atom1_id": "///B/50/N", "atom2_id": "///B/1093/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 281, "atom1_serNum": 2133, "atom2_serNum": 10462, "donAcc_type": "standard", "distance": 3.006, "atom1_id": "///B/50/O", "atom2_id": "///B/1095/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 282, "atom1_serNum": 2143, "atom2_serNum": 10465, "donAcc_type": "standard", "distance": 2.707, "atom1_id": "///B/52/N", "atom2_id": "///B/1095/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 283, "atom1_serNum": 2146, "atom2_serNum": 10478, "donAcc_type": "standard", "distance": 2.591, "atom1_id": "///B/52/O", "atom2_id": "///B/1097/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 284, "atom1_serNum": 2165, "atom2_serNum": 7756, "donAcc_type": "standard", "distance": 2.658, "atom1_id": "///B/54/O", "atom2_id": "///B/735/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 285, "atom1_serNum": 2168, "atom2_serNum": 10477, "donAcc_type": "standard", "distance": 3.087, "atom1_id": "///B/54/OD1", "atom2_id": "///B/1096/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 286, "atom1_serNum": 2169, "atom2_serNum": 11316, "donAcc_type": "acceptable", "distance": 2.712, "atom1_id": "///B/54/OD2", "atom2_id": "///B/1201/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 287, "atom1_serNum": 2199, "atom2_serNum": 2222, "donAcc_type": "standard", "distance": 2.986, "atom1_id": "///B/59/O", "atom2_id": "///B/63/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 288, "atom1_serNum": 2204, "atom2_serNum": 2233, "donAcc_type": "standard", "distance": 2.886, "atom1_id": "///B/60/O", "atom2_id": "///B/64/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 289, "atom1_serNum": 2213, "atom2_serNum": 2241, "donAcc_type": "standard", "distance": 2.978, "atom1_id": "///B/61/O", "atom2_id": "///B/65/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 290, "atom1_serNum": 2218, "atom2_serNum": 2250, "donAcc_type": "standard", "distance": 2.909, "atom1_id": "///B/62/O", "atom2_id": "///B/66/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 291, "atom1_serNum": 2225, "atom2_serNum": 2261, "donAcc_type": "standard", "distance": 2.915, "atom1_id": "///B/63/O", "atom2_id": "///B/67/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 292, "atom1_serNum": 2236, "atom2_serNum": 2266, "donAcc_type": "acceptable", "distance": 3.106, "atom1_id": "///B/64/O", "atom2_id": "///B/67/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 293, "atom1_serNum": 2236, "atom2_serNum": 2268, "donAcc_type": "standard", "distance": 2.968, "atom1_id": "///B/64/O", "atom2_id": "///B/68/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 294, "atom1_serNum": 2244, "atom2_serNum": 2273, "donAcc_type": "standard", "distance": 2.906, "atom1_id": "///B/65/O", "atom2_id": "///B/69/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 295, "atom1_serNum": 2253, "atom2_serNum": 2284, "donAcc_type": "standard", "distance": 3.034, "atom1_id": "///B/66/O", "atom2_id": "///B/70/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 296, "atom1_serNum": 2264, "atom2_serNum": 2295, "donAcc_type": "standard", "distance": 2.934, "atom1_id": "///B/67/O", "atom2_id": "///B/71/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 297, "atom1_serNum": 2266, "atom2_serNum": 2305, "donAcc_type": "acceptable", "distance": 2.907, "atom1_id": "///B/67/OG1", "atom2_id": "///B/71/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 298, "atom1_serNum": 2271, "atom2_serNum": 2306, "donAcc_type": "standard", "distance": 2.943, "atom1_id": "///B/68/O", "atom2_id": "///B/72/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 299, "atom1_serNum": 2276, "atom2_serNum": 2318, "donAcc_type": "standard", "distance": 2.993, "atom1_id": "///B/69/O", "atom2_id": "///B/73/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 300, "atom1_serNum": 2287, "atom2_serNum": 2325, "donAcc_type": "standard", "distance": 2.910, "atom1_id": "///B/70/O", "atom2_id": "///B/74/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 301, "atom1_serNum": 2298, "atom2_serNum": 2336, "donAcc_type": "standard", "distance": 2.930, "atom1_id": "///B/71/O", "atom2_id": "///B/75/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 302, "atom1_serNum": 2309, "atom2_serNum": 2347, "donAcc_type": "standard", "distance": 3.037, "atom1_id": "///B/72/O", "atom2_id": "///B/76/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 303, "atom1_serNum": 2321, "atom2_serNum": 2356, "donAcc_type": "standard", "distance": 2.942, "atom1_id": "///B/73/O", "atom2_id": "///B/77/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 304, "atom1_serNum": 2328, "atom2_serNum": 2364, "donAcc_type": "standard", "distance": 2.875, "atom1_id": "///B/74/O", "atom2_id": "///B/78/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 305, "atom1_serNum": 2339, "atom2_serNum": 2375, "donAcc_type": "standard", "distance": 3.130, "atom1_id": "///B/75/O", "atom2_id": "///B/79/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 306, "atom1_serNum": 2343, "atom2_serNum": 3088, "donAcc_type": "standard", "distance": 3.903, "atom1_id": "///B/75/NE", "atom2_id": "///B/163/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 307, "atom1_serNum": 2350, "atom2_serNum": 2383, "donAcc_type": "standard", "distance": 2.886, "atom1_id": "///B/76/O", "atom2_id": "///B/80/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 308, "atom1_serNum": 2359, "atom2_serNum": 2389, "donAcc_type": "standard", "distance": 2.869, "atom1_id": "///B/77/O", "atom2_id": "///B/81/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 309, "atom1_serNum": 2367, "atom2_serNum": 2401, "donAcc_type": "standard", "distance": 3.044, "atom1_id": "///B/78/O", "atom2_id": "///B/82/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 310, "atom1_serNum": 2371, "atom2_serNum": 3080, "donAcc_type": "standard", "distance": 3.130, "atom1_id": "///B/78/NE", "atom2_id": "///B/162/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 311, "atom1_serNum": 2373, "atom2_serNum": 3080, "donAcc_type": "standard", "distance": 2.999, "atom1_id": "///B/78/NH1", "atom2_id": "///B/162/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 312, "atom1_serNum": 2373, "atom2_serNum": 3088, "donAcc_type": "standard", "distance": 3.338, "atom1_id": "///B/78/NH1", "atom2_id": "///B/163/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 313, "atom1_serNum": 2378, "atom2_serNum": 2409, "donAcc_type": "standard", "distance": 2.928, "atom1_id": "///B/79/O", "atom2_id": "///B/83/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 314, "atom1_serNum": 2386, "atom2_serNum": 2418, "donAcc_type": "standard", "distance": 2.878, "atom1_id": "///B/80/O", "atom2_id": "///B/84/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 315, "atom1_serNum": 2392, "atom2_serNum": 2427, "donAcc_type": "standard", "distance": 3.018, "atom1_id": "///B/81/O", "atom2_id": "///B/85/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 316, "atom1_serNum": 2404, "atom2_serNum": 2435, "donAcc_type": "standard", "distance": 3.004, "atom1_id": "///B/82/O", "atom2_id": "///B/86/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 317, "atom1_serNum": 2412, "atom2_serNum": 2446, "donAcc_type": "standard", "distance": 2.928, "atom1_id": "///B/83/O", "atom2_id": "///B/87/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 318, "atom1_serNum": 2417, "atom2_serNum": 3032, "donAcc_type": "acceptable", "distance": 2.719, "atom1_id": "///B/83/NE2", "atom2_id": "///B/155/OH", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 319, "atom1_serNum": 2438, "atom2_serNum": 2469, "donAcc_type": "standard", "distance": 2.940, "atom1_id": "///B/86/O", "atom2_id": "///B/90/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 320, "atom1_serNum": 2449, "atom2_serNum": 2477, "donAcc_type": "standard", "distance": 2.895, "atom1_id": "///B/87/O", "atom2_id": "///B/91/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 321, "atom1_serNum": 2455, "atom2_serNum": 2482, "donAcc_type": "standard", "distance": 3.022, "atom1_id": "///B/88/O", "atom2_id": "///B/92/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 322, "atom1_serNum": 2463, "atom2_serNum": 2491, "donAcc_type": "standard", "distance": 2.979, "atom1_id": "///B/89/O", "atom2_id": "///B/93/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 323, "atom1_serNum": 2468, "atom2_serNum": 2490, "donAcc_type": "standard", "distance": 3.034, "atom1_id": "///B/89/OE2", "atom2_id": "///B/92/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 324, "atom1_serNum": 2472, "atom2_serNum": 2498, "donAcc_type": "standard", "distance": 2.552, "atom1_id": "///B/90/O", "atom2_id": "///B/94/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 325, "atom1_serNum": 2501, "atom2_serNum": 2520, "donAcc_type": "standard", "distance": 3.350, "atom1_id": "///B/94/O", "atom2_id": "///B/97/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 326, "atom1_serNum": 2504, "atom2_serNum": 2514, "donAcc_type": "standard", "distance": 3.102, "atom1_id": "///B/94/OD1", "atom2_id": "///B/96/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 327, "atom1_serNum": 2504, "atom2_serNum": 2561, "donAcc_type": "standard", "distance": 3.140, "atom1_id": "///B/94/OD1", "atom2_id": "///B/100/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 328, "atom1_serNum": 2505, "atom2_serNum": 2562, "donAcc_type": "standard", "distance": 2.659, "atom1_id": "///B/94/OD2", "atom2_id": "///B/100/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 329, "atom1_serNum": 2505, "atom2_serNum": 3003, "donAcc_type": "standard", "distance": 2.921, "atom1_id": "///B/94/OD2", "atom2_id": "///B/152/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 330, "atom1_serNum": 2506, "atom2_serNum": 2513, "donAcc_type": "standard", "distance": 2.995, "atom1_id": "///B/95/N", "atom2_id": "///B/95/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 331, "atom1_serNum": 2509, "atom2_serNum": 2548, "donAcc_type": "acceptable", "distance": 3.596, "atom1_id": "///B/95/O", "atom2_id": "///B/99/ND1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 332, "atom1_serNum": 2517, "atom2_serNum": 2552, "donAcc_type": "standard", "distance": 2.873, "atom1_id": "///B/96/O", "atom2_id": "///B/100/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 333, "atom1_serNum": 2519, "atom2_serNum": 2561, "donAcc_type": "acceptable", "distance": 2.716, "atom1_id": "///B/96/OG", "atom2_id": "///B/100/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 334, "atom1_serNum": 2523, "atom2_serNum": 2563, "donAcc_type": "standard", "distance": 2.962, "atom1_id": "///B/97/O", "atom2_id": "///B/101/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 335, "atom1_serNum": 2534, "atom2_serNum": 2571, "donAcc_type": "standard", "distance": 2.916, "atom1_id": "///B/98/O", "atom2_id": "///B/102/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 336, "atom1_serNum": 2545, "atom2_serNum": 2580, "donAcc_type": "standard", "distance": 3.237, "atom1_id": "///B/99/O", "atom2_id": "///B/103/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 337, "atom1_serNum": 2559, "atom2_serNum": 2698, "donAcc_type": "standard", "distance": 3.323, "atom1_id": "///B/100/NE", "atom2_id": "///B/116/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 338, "atom1_serNum": 2559, "atom2_serNum": 2708, "donAcc_type": "standard", "distance": 2.622, "atom1_id": "///B/100/NE", "atom2_id": "///B/117/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 339, "atom1_serNum": 2562, "atom2_serNum": 2708, "donAcc_type": "standard", "distance": 3.104, "atom1_id": "///B/100/NH2", "atom2_id": "///B/117/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 340, "atom1_serNum": 2562, "atom2_serNum": 2715, "donAcc_type": "standard", "distance": 2.818, "atom1_id": "///B/100/NH2", "atom2_id": "///B/118/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 341, "atom1_serNum": 2566, "atom2_serNum": 2589, "donAcc_type": "standard", "distance": 3.343, "atom1_id": "///B/101/O", "atom2_id": "///B/104/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 342, "atom1_serNum": 2583, "atom2_serNum": 2606, "donAcc_type": "standard", "distance": 3.075, "atom1_id": "///B/103/O", "atom2_id": "///B/106/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 343, "atom1_serNum": 2583, "atom2_serNum": 2655, "donAcc_type": "standard", "distance": 2.722, "atom1_id": "///B/103/O", "atom2_id": "///B/111/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 344, "atom1_serNum": 2587, "atom2_serNum": 2656, "donAcc_type": "standard", "distance": 2.845, "atom1_id": "///B/103/OE1", "atom2_id": "///B/112/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 345, "atom1_serNum": 2588, "atom2_serNum": 2665, "donAcc_type": "standard", "distance": 2.916, "atom1_id": "///B/103/OE2", "atom2_id": "///B/113/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 346, "atom1_serNum": 2609, "atom2_serNum": 2655, "donAcc_type": "standard", "distance": 2.759, "atom1_id": "///B/106/O", "atom2_id": "///B/111/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 347, "atom1_serNum": 2614, "atom2_serNum": 10765, "donAcc_type": "acceptable", "distance": 2.972, "atom1_id": "///B/107/N", "atom2_id": "///B/1131/OH", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 348, "atom1_serNum": 2617, "atom2_serNum": 2639, "donAcc_type": "standard", "distance": 2.858, "atom1_id": "///B/107/O", "atom2_id": "///B/110/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 349, "atom1_serNum": 2617, "atom2_serNum": 2647, "donAcc_type": "standard", "distance": 2.868, "atom1_id": "///B/107/O", "atom2_id": "///B/111/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 350, "atom1_serNum": 2646, "atom2_serNum": 10765, "donAcc_type": "acceptable", "distance": 2.906, "atom1_id": "///B/110/OD2", "atom2_id": "///B/1131/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 351, "atom1_serNum": 2683, "atom2_serNum": 2695, "donAcc_type": "standard", "distance": 2.945, "atom1_id": "///B/114/OE2", "atom2_id": "///B/116/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 352, "atom1_serNum": 2683, "atom2_serNum": 2701, "donAcc_type": "acceptable", "distance": 3.012, "atom1_id": "///B/114/OE2", "atom2_id": "///B/116/ND1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 353, "atom1_serNum": 2698, "atom2_serNum": 2731, "donAcc_type": "standard", "distance": 3.074, "atom1_id": "///B/116/O", "atom2_id": "///B/120/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 354, "atom1_serNum": 2712, "atom2_serNum": 2774, "donAcc_type": "standard", "distance": 2.852, "atom1_id": "///B/118/N", "atom2_id": "///B/125/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 355, "atom1_serNum": 2715, "atom2_serNum": 3003, "donAcc_type": "standard", "distance": 3.897, "atom1_id": "///B/118/O", "atom2_id": "///B/152/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 356, "atom1_serNum": 2720, "atom2_serNum": 2773, "donAcc_type": "standard", "distance": 2.898, "atom1_id": "///B/119/N", "atom2_id": "///B/125/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 357, "atom1_serNum": 2738, "atom2_serNum": 2766, "donAcc_type": "standard", "distance": 3.179, "atom1_id": "///B/121/O", "atom2_id": "///B/125/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 358, "atom1_serNum": 2741, "atom2_serNum": 2751, "donAcc_type": "standard", "distance": 3.275, "atom1_id": "///B/121/OD1", "atom2_id": "///B/123/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 359, "atom1_serNum": 2741, "atom2_serNum": 2758, "donAcc_type": "standard", "distance": 2.765, "atom1_id": "///B/121/OD1", "atom2_id": "///B/124/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 360, "atom1_serNum": 2742, "atom2_serNum": 2765, "donAcc_type": "standard", "distance": 2.811, "atom1_id": "///B/121/ND2", "atom2_id": "///B/124/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 361, "atom1_serNum": 2746, "atom2_serNum": 2775, "donAcc_type": "standard", "distance": 2.934, "atom1_id": "///B/122/O", "atom2_id": "///B/126/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 362, "atom1_serNum": 2754, "atom2_serNum": 2782, "donAcc_type": "standard", "distance": 2.944, "atom1_id": "///B/123/O", "atom2_id": "///B/127/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 363, "atom1_serNum": 2761, "atom2_serNum": 2787, "donAcc_type": "standard", "distance": 2.873, "atom1_id": "///B/124/O", "atom2_id": "///B/128/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 364, "atom1_serNum": 2769, "atom2_serNum": 2799, "donAcc_type": "standard", "distance": 3.012, "atom1_id": "///B/125/O", "atom2_id": "///B/129/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 365, "atom1_serNum": 2778, "atom2_serNum": 2809, "donAcc_type": "standard", "distance": 2.928, "atom1_id": "///B/126/O", "atom2_id": "///B/130/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 366, "atom1_serNum": 2785, "atom2_serNum": 2818, "donAcc_type": "standard", "distance": 2.944, "atom1_id": "///B/127/O", "atom2_id": "///B/131/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 367, "atom1_serNum": 2790, "atom2_serNum": 2827, "donAcc_type": "standard", "distance": 2.732, "atom1_id": "///B/128/O", "atom2_id": "///B/132/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 368, "atom1_serNum": 2846, "atom2_serNum": 2879, "donAcc_type": "acceptable", "distance": 3.228, "atom1_id": "///B/134/N", "atom2_id": "///B/137/ND1", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 369, "atom1_serNum": 2849, "atom2_serNum": 2873, "donAcc_type": "standard", "distance": 3.118, "atom1_id": "///B/134/O", "atom2_id": "///B/137/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 370, "atom1_serNum": 2851, "atom2_serNum": 2879, "donAcc_type": "acceptable", "distance": 2.576, "atom1_id": "///B/134/OG1", "atom2_id": "///B/137/ND1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 371, "atom1_serNum": 2856, "atom2_serNum": 2891, "donAcc_type": "standard", "distance": 2.896, "atom1_id": "///B/135/O", "atom2_id": "///B/139/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 372, "atom1_serNum": 2864, "atom2_serNum": 2902, "donAcc_type": "standard", "distance": 2.927, "atom1_id": "///B/136/O", "atom2_id": "///B/140/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 373, "atom1_serNum": 2876, "atom2_serNum": 2911, "donAcc_type": "standard", "distance": 2.960, "atom1_id": "///B/137/O", "atom2_id": "///B/141/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 374, "atom1_serNum": 2886, "atom2_serNum": 2920, "donAcc_type": "standard", "distance": 2.909, "atom1_id": "///B/138/O", "atom2_id": "///B/142/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 375, "atom1_serNum": 2894, "atom2_serNum": 2928, "donAcc_type": "standard", "distance": 2.972, "atom1_id": "///B/139/O", "atom2_id": "///B/143/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 376, "atom1_serNum": 2898, "atom2_serNum": 5128, "donAcc_type": "standard", "distance": 2.922, "atom1_id": "///B/139/NE", "atom2_id": "///B/418/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 377, "atom1_serNum": 2900, "atom2_serNum": 3065, "donAcc_type": "acceptable", "distance": 3.223, "atom1_id": "///B/139/NH1", "atom2_id": "///B/160/ND1", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 378, "atom1_serNum": 2901, "atom2_serNum": 5105, "donAcc_type": "acceptable", "distance": 2.982, "atom1_id": "///B/139/NH2", "atom2_id": "///B/415/ND1", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 379, "atom1_serNum": 2901, "atom2_serNum": 5128, "donAcc_type": "standard", "distance": 2.724, "atom1_id": "///B/139/NH2", "atom2_id": "///B/418/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 380, "atom1_serNum": 2905, "atom2_serNum": 2935, "donAcc_type": "standard", "distance": 2.907, "atom1_id": "///B/140/O", "atom2_id": "///B/144/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 381, "atom1_serNum": 2910, "atom2_serNum": 2942, "donAcc_type": "standard", "distance": 3.044, "atom1_id": "///B/140/NZ", "atom2_id": "///B/144/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 382, "atom1_serNum": 2914, "atom2_serNum": 2943, "donAcc_type": "standard", "distance": 2.799, "atom1_id": "///B/141/O", "atom2_id": "///B/145/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 383, "atom1_serNum": 2931, "atom2_serNum": 5187, "donAcc_type": "standard", "distance": 2.956, "atom1_id": "///B/143/O", "atom2_id": "///B/425/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 384, "atom1_serNum": 2938, "atom2_serNum": 5190, "donAcc_type": "standard", "distance": 2.610, "atom1_id": "///B/144/O", "atom2_id": "///B/425/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 385, "atom1_serNum": 2941, "atom2_serNum": 4264, "donAcc_type": "acceptable", "distance": 3.097, "atom1_id": "///B/144/OD1", "atom2_id": "///B/313/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 386, "atom1_serNum": 2941, "atom2_serNum": 4266, "donAcc_type": "standard", "distance": 3.419, "atom1_id": "///B/144/OD1", "atom2_id": "///B/314/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 387, "atom1_serNum": 2942, "atom2_serNum": 4264, "donAcc_type": "acceptable", "distance": 2.969, "atom1_id": "///B/144/OD2", "atom2_id": "///B/313/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 388, "atom1_serNum": 2948, "atom2_serNum": 2956, "donAcc_type": "acceptable", "distance": 3.176, "atom1_id": "///B/145/OG", "atom2_id": "///B/147/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 389, "atom1_serNum": 2959, "atom2_serNum": 5199, "donAcc_type": "standard", "distance": 3.003, "atom1_id": "///B/147/O", "atom2_id": "///B/426/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 390, "atom1_serNum": 2973, "atom2_serNum": 5198, "donAcc_type": "standard", "distance": 3.120, "atom1_id": "///B/149/N", "atom2_id": "///B/426/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 391, "atom1_serNum": 2976, "atom2_serNum": 5239, "donAcc_type": "acceptable", "distance": 2.509, "atom1_id": "///B/149/O", "atom2_id": "///B/430/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 392, "atom1_serNum": 2981, "atom2_serNum": 3013, "donAcc_type": "standard", "distance": 3.076, "atom1_id": "///B/150/O", "atom2_id": "///B/154/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 393, "atom1_serNum": 2984, "atom2_serNum": 2994, "donAcc_type": "standard", "distance": 2.756, "atom1_id": "///B/150/OD1", "atom2_id": "///B/152/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 394, "atom1_serNum": 2984, "atom2_serNum": 3001, "donAcc_type": "standard", "distance": 2.875, "atom1_id": "///B/150/OD1", "atom2_id": "///B/152/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 395, "atom1_serNum": 2985, "atom2_serNum": 3004, "donAcc_type": "standard", "distance": 2.520, "atom1_id": "///B/150/OD2", "atom2_id": "///B/152/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 396, "atom1_serNum": 2989, "atom2_serNum": 3021, "donAcc_type": "standard", "distance": 2.930, "atom1_id": "///B/151/O", "atom2_id": "///B/155/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 397, "atom1_serNum": 2997, "atom2_serNum": 3033, "donAcc_type": "standard", "distance": 2.928, "atom1_id": "///B/152/O", "atom2_id": "///B/156/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 398, "atom1_serNum": 3008, "atom2_serNum": 3041, "donAcc_type": "standard", "distance": 2.962, "atom1_id": "///B/153/O", "atom2_id": "///B/157/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 399, "atom1_serNum": 3016, "atom2_serNum": 3046, "donAcc_type": "standard", "distance": 2.992, "atom1_id": "///B/154/O", "atom2_id": "///B/158/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 400, "atom1_serNum": 3024, "atom2_serNum": 3054, "donAcc_type": "standard", "distance": 2.771, "atom1_id": "///B/155/O", "atom2_id": "///B/159/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 401, "atom1_serNum": 3036, "atom2_serNum": 3059, "donAcc_type": "standard", "distance": 2.901, "atom1_id": "///B/156/O", "atom2_id": "///B/160/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 402, "atom1_serNum": 3044, "atom2_serNum": 3069, "donAcc_type": "standard", "distance": 3.050, "atom1_id": "///B/157/O", "atom2_id": "///B/161/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 403, "atom1_serNum": 3049, "atom2_serNum": 3077, "donAcc_type": "standard", "distance": 2.926, "atom1_id": "///B/158/O", "atom2_id": "///B/162/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 404, "atom1_serNum": 3057, "atom2_serNum": 3085, "donAcc_type": "standard", "distance": 2.844, "atom1_id": "///B/159/O", "atom2_id": "///B/163/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 405, "atom1_serNum": 3062, "atom2_serNum": 3094, "donAcc_type": "standard", "distance": 3.386, "atom1_id": "///B/160/O", "atom2_id": "///B/164/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 406, "atom1_serNum": 3114, "atom2_serNum": 5357, "donAcc_type": "standard", "distance": 3.156, "atom1_id": "///B/165/NH1", "atom2_id": "///B/444/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 407, "atom1_serNum": 3114, "atom2_serNum": 5372, "donAcc_type": "standard", "distance": 2.761, "atom1_id": "///B/165/NH1", "atom2_id": "///B/446/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 408, "atom1_serNum": 3120, "atom2_serNum": 5060, "donAcc_type": "standard", "distance": 3.244, "atom1_id": "///B/167/N", "atom2_id": "///B/410/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 409, "atom1_serNum": 3123, "atom2_serNum": 5072, "donAcc_type": "standard", "distance": 2.918, "atom1_id": "///B/167/O", "atom2_id": "///B/412/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 410, "atom1_serNum": 3126, "atom2_serNum": 3141, "donAcc_type": "acceptable", "distance": 3.079, "atom1_id": "///B/167/ND1", "atom2_id": "///B/169/N", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 411, "atom1_serNum": 3129, "atom2_serNum": 5054, "donAcc_type": "standard", "distance": 2.948, "atom1_id": "///B/167/NE2", "atom2_id": "///B/409/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 412, "atom1_serNum": 3133, "atom2_serNum": 5389, "donAcc_type": "standard", "distance": 3.797, "atom1_id": "///B/168/O", "atom2_id": "///B/447/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 413, "atom1_serNum": 3152, "atom2_serNum": 5090, "donAcc_type": "standard", "distance": 2.841, "atom1_id": "///B/170/O", "atom2_id": "///B/413/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 414, "atom1_serNum": 3169, "atom2_serNum": 5090, "donAcc_type": "standard", "distance": 3.307, "atom1_id": "///B/172/O", "atom2_id": "///B/413/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 415, "atom1_serNum": 3226, "atom2_serNum": 3255, "donAcc_type": "standard", "distance": 3.444, "atom1_id": "///B/180/O", "atom2_id": "///B/184/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 416, "atom1_serNum": 3229, "atom2_serNum": 3231, "donAcc_type": "standard", "distance": 2.880, "atom1_id": "///B/180/OD1", "atom2_id": "///B/181/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 417, "atom1_serNum": 3229, "atom2_serNum": 3238, "donAcc_type": "standard", "distance": 2.665, "atom1_id": "///B/180/OD1", "atom2_id": "///B/182/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 418, "atom1_serNum": 3229, "atom2_serNum": 3246, "donAcc_type": "standard", "distance": 3.420, "atom1_id": "///B/180/OD1", "atom2_id": "///B/183/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 419, "atom1_serNum": 3230, "atom2_serNum": 3254, "donAcc_type": "standard", "distance": 2.364, "atom1_id": "///B/180/OD2", "atom2_id": "///B/183/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 420, "atom1_serNum": 3234, "atom2_serNum": 3263, "donAcc_type": "standard", "distance": 2.884, "atom1_id": "///B/181/O", "atom2_id": "///B/185/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 421, "atom1_serNum": 3241, "atom2_serNum": 3274, "donAcc_type": "standard", "distance": 2.888, "atom1_id": "///B/182/O", "atom2_id": "///B/186/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 422, "atom1_serNum": 3244, "atom2_serNum": 3454, "donAcc_type": "standard", "distance": 2.707, "atom1_id": "///B/182/OD1", "atom2_id": "///B/209/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 423, "atom1_serNum": 3249, "atom2_serNum": 3282, "donAcc_type": "standard", "distance": 2.909, "atom1_id": "///B/183/O", "atom2_id": "///B/187/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 424, "atom1_serNum": 3258, "atom2_serNum": 3291, "donAcc_type": "standard", "distance": 2.913, "atom1_id": "///B/184/O", "atom2_id": "///B/188/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 425, "atom1_serNum": 3266, "atom2_serNum": 3299, "donAcc_type": "standard", "distance": 2.972, "atom1_id": "///B/185/O", "atom2_id": "///B/189/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 426, "atom1_serNum": 3277, "atom2_serNum": 3306, "donAcc_type": "standard", "distance": 2.879, "atom1_id": "///B/186/O", "atom2_id": "///B/190/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 427, "atom1_serNum": 3285, "atom2_serNum": 3315, "donAcc_type": "standard", "distance": 2.930, "atom1_id": "///B/187/O", "atom2_id": "///B/191/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 428, "atom1_serNum": 3285, "atom2_serNum": 3320, "donAcc_type": "acceptable", "distance": 2.927, "atom1_id": "///B/187/O", "atom2_id": "///B/191/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 429, "atom1_serNum": 3294, "atom2_serNum": 3322, "donAcc_type": "standard", "distance": 2.946, "atom1_id": "///B/188/O", "atom2_id": "///B/192/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 430, "atom1_serNum": 3302, "atom2_serNum": 3334, "donAcc_type": "standard", "distance": 2.882, "atom1_id": "///B/189/O", "atom2_id": "///B/193/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 431, "atom1_serNum": 3309, "atom2_serNum": 3342, "donAcc_type": "standard", "distance": 2.940, "atom1_id": "///B/190/O", "atom2_id": "///B/194/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 432, "atom1_serNum": 3318, "atom2_serNum": 3351, "donAcc_type": "standard", "distance": 3.078, "atom1_id": "///B/191/O", "atom2_id": "///B/195/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 433, "atom1_serNum": 3325, "atom2_serNum": 3359, "donAcc_type": "standard", "distance": 2.996, "atom1_id": "///B/192/O", "atom2_id": "///B/196/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 434, "atom1_serNum": 3340, "atom2_serNum": 3403, "donAcc_type": "standard", "distance": 3.190, "atom1_id": "///B/193/OD1", "atom2_id": "///B/201/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 435, "atom1_serNum": 3341, "atom2_serNum": 3406, "donAcc_type": "standard", "distance": 3.723, "atom1_id": "///B/193/ND2", "atom2_id": "///B/201/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 436, "atom1_serNum": 3417, "atom2_serNum": 3424, "donAcc_type": "standard", "distance": 3.155, "atom1_id": "///B/202/OD1", "atom2_id": "///B/204/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 437, "atom1_serNum": 3417, "atom2_serNum": 3429, "donAcc_type": "acceptable", "distance": 2.475, "atom1_id": "///B/202/OD1", "atom2_id": "///B/204/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 438, "atom1_serNum": 3422, "atom2_serNum": 3434, "donAcc_type": "standard", "distance": 3.228, "atom1_id": "///B/203/O", "atom2_id": "///B/206/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 439, "atom1_serNum": 3427, "atom2_serNum": 3429, "donAcc_type": "acceptable", "distance": 3.022, "atom1_id": "///B/204/O", "atom2_id": "///B/204/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 440, "atom1_serNum": 3437, "atom2_serNum": 3449, "donAcc_type": "standard", "distance": 2.850, "atom1_id": "///B/206/O", "atom2_id": "///B/208/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 441, "atom1_serNum": 3444, "atom2_serNum": 3468, "donAcc_type": "standard", "distance": 3.218, "atom1_id": "///B/207/O", "atom2_id": "///B/211/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 442, "atom1_serNum": 3447, "atom2_serNum": 3463, "donAcc_type": "standard", "distance": 3.412, "atom1_id": "///B/207/OD1", "atom2_id": "///B/210/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 443, "atom1_serNum": 3452, "atom2_serNum": 3476, "donAcc_type": "standard", "distance": 2.911, "atom1_id": "///B/208/O", "atom2_id": "///B/212/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 444, "atom1_serNum": 3457, "atom2_serNum": 3484, "donAcc_type": "standard", "distance": 2.958, "atom1_id": "///B/209/O", "atom2_id": "///B/213/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 445, "atom1_serNum": 3457, "atom2_serNum": 3489, "donAcc_type": "acceptable", "distance": 3.147, "atom1_id": "///B/209/O", "atom2_id": "///B/213/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 446, "atom1_serNum": 3479, "atom2_serNum": 3555, "donAcc_type": "standard", "distance": 2.915, "atom1_id": "///B/212/O", "atom2_id": "///B/221/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 447, "atom1_serNum": 3487, "atom2_serNum": 4218, "donAcc_type": "standard", "distance": 3.142, "atom1_id": "///B/213/O", "atom2_id": "///B/307/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 448, "atom1_serNum": 3487, "atom2_serNum": 4219, "donAcc_type": "standard", "distance": 2.941, "atom1_id": "///B/213/O", "atom2_id": "///B/307/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 449, "atom1_serNum": 3493, "atom2_serNum": 3506, "donAcc_type": "standard", "distance": 2.915, "atom1_id": "///B/214/O", "atom2_id": "///B/216/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 450, "atom1_serNum": 3493, "atom2_serNum": 3555, "donAcc_type": "standard", "distance": 3.539, "atom1_id": "///B/214/O", "atom2_id": "///B/221/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 451, "atom1_serNum": 3504, "atom2_serNum": 4947, "donAcc_type": "standard", "distance": 3.908, "atom1_id": "///B/215/NH1", "atom2_id": "///B/396/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 452, "atom1_serNum": 3509, "atom2_serNum": 3556, "donAcc_type": "standard", "distance": 3.271, "atom1_id": "///B/216/O", "atom2_id": "///B/221/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 453, "atom1_serNum": 3517, "atom2_serNum": 3546, "donAcc_type": "standard", "distance": 2.976, "atom1_id": "///B/217/O", "atom2_id": "///B/221/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 454, "atom1_serNum": 3519, "atom2_serNum": 3534, "donAcc_type": "acceptable", "distance": 3.402, "atom1_id": "///B/217/OG", "atom2_id": "///B/219/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 455, "atom1_serNum": 3519, "atom2_serNum": 3535, "donAcc_type": "acceptable", "distance": 3.156, "atom1_id": "///B/217/OG", "atom2_id": "///B/220/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 456, "atom1_serNum": 3523, "atom2_serNum": 3557, "donAcc_type": "standard", "distance": 2.946, "atom1_id": "///B/218/O", "atom2_id": "///B/222/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 457, "atom1_serNum": 3532, "atom2_serNum": 3565, "donAcc_type": "standard", "distance": 2.879, "atom1_id": "///B/219/O", "atom2_id": "///B/223/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 458, "atom1_serNum": 3538, "atom2_serNum": 3574, "donAcc_type": "standard", "distance": 2.867, "atom1_id": "///B/220/O", "atom2_id": "///B/224/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 459, "atom1_serNum": 3549, "atom2_serNum": 3582, "donAcc_type": "standard", "distance": 2.932, "atom1_id": "///B/221/O", "atom2_id": "///B/225/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 460, "atom1_serNum": 3560, "atom2_serNum": 3590, "donAcc_type": "standard", "distance": 2.933, "atom1_id": "///B/222/O", "atom2_id": "///B/226/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 461, "atom1_serNum": 3568, "atom2_serNum": 3598, "donAcc_type": "standard", "distance": 2.881, "atom1_id": "///B/223/O", "atom2_id": "///B/227/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 462, "atom1_serNum": 3573, "atom2_serNum": 3657, "donAcc_type": "standard", "distance": 2.733, "atom1_id": "///B/223/OE2", "atom2_id": "///B/234/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 463, "atom1_serNum": 3577, "atom2_serNum": 3603, "donAcc_type": "standard", "distance": 3.351, "atom1_id": "///B/224/O", "atom2_id": "///B/228/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 464, "atom1_serNum": 3585, "atom2_serNum": 3603, "donAcc_type": "standard", "distance": 3.016, "atom1_id": "///B/225/O", "atom2_id": "///B/228/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 465, "atom1_serNum": 3593, "atom2_serNum": 3612, "donAcc_type": "standard", "distance": 2.919, "atom1_id": "///B/226/O", "atom2_id": "///B/229/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 466, "atom1_serNum": 3615, "atom2_serNum": 3631, "donAcc_type": "standard", "distance": 3.367, "atom1_id": "///B/229/O", "atom2_id": "///B/232/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 467, "atom1_serNum": 3643, "atom2_serNum": 3666, "donAcc_type": "standard", "distance": 2.937, "atom1_id": "///B/233/O", "atom2_id": "///B/236/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 468, "atom1_serNum": 3661, "atom2_serNum": 3811, "donAcc_type": "standard", "distance": 3.333, "atom1_id": "///B/235/O", "atom2_id": "///B/255/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 469, "atom1_serNum": 3669, "atom2_serNum": 3693, "donAcc_type": "standard", "distance": 2.808, "atom1_id": "///B/236/O", "atom2_id": "///B/240/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 470, "atom1_serNum": 3673, "atom2_serNum": 3701, "donAcc_type": "standard", "distance": 2.902, "atom1_id": "///B/237/O", "atom2_id": "///B/241/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 471, "atom1_serNum": 3681, "atom2_serNum": 3709, "donAcc_type": "standard", "distance": 2.918, "atom1_id": "///B/238/O", "atom2_id": "///B/242/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 472, "atom1_serNum": 3692, "atom2_serNum": 3717, "donAcc_type": "standard", "distance": 2.892, "atom1_id": "///B/239/O", "atom2_id": "///B/243/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 473, "atom1_serNum": 3696, "atom2_serNum": 3722, "donAcc_type": "standard", "distance": 2.866, "atom1_id": "///B/240/O", "atom2_id": "///B/244/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 474, "atom1_serNum": 3700, "atom2_serNum": 3810, "donAcc_type": "standard", "distance": 2.334, "atom1_id": "///B/240/ND2", "atom2_id": "///B/255/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 475, "atom1_serNum": 3704, "atom2_serNum": 3730, "donAcc_type": "standard", "distance": 2.907, "atom1_id": "///B/241/O", "atom2_id": "///B/245/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 476, "atom1_serNum": 3704, "atom2_serNum": 3735, "donAcc_type": "acceptable", "distance": 3.192, "atom1_id": "///B/241/O", "atom2_id": "///B/245/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 477, "atom1_serNum": 3712, "atom2_serNum": 3736, "donAcc_type": "standard", "distance": 2.866, "atom1_id": "///B/242/O", "atom2_id": "///B/246/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 478, "atom1_serNum": 3720, "atom2_serNum": 3744, "donAcc_type": "standard", "distance": 3.128, "atom1_id": "///B/243/O", "atom2_id": "///B/247/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 479, "atom1_serNum": 3720, "atom2_serNum": 3748, "donAcc_type": "standard", "distance": 2.842, "atom1_id": "///B/243/O", "atom2_id": "///B/248/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 480, "atom1_serNum": 3733, "atom2_serNum": 4141, "donAcc_type": "acceptable", "distance": 3.150, "atom1_id": "///B/245/O", "atom2_id": "///B/297/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 481, "atom1_serNum": 3735, "atom2_serNum": 4109, "donAcc_type": "acceptable", "distance": 2.709, "atom1_id": "///B/245/OG", "atom2_id": "///B/293/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 482, "atom1_serNum": 3747, "atom2_serNum": 3891, "donAcc_type": "standard", "distance": 3.859, "atom1_id": "///B/247/O", "atom2_id": "///B/265/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 483, "atom1_serNum": 3766, "atom2_serNum": 3875, "donAcc_type": "standard", "distance": 3.119, "atom1_id": "///B/250/O", "atom2_id": "///B/264/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 484, "atom1_serNum": 3776, "atom2_serNum": 3789, "donAcc_type": "standard", "distance": 3.204, "atom1_id": "///B/251/OD1", "atom2_id": "///B/253/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 485, "atom1_serNum": 3776, "atom2_serNum": 3861, "donAcc_type": "standard", "distance": 3.298, "atom1_id": "///B/251/OD1", "atom2_id": "///B/262/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 486, "atom1_serNum": 3778, "atom2_serNum": 3864, "donAcc_type": "standard", "distance": 2.747, "atom1_id": "///B/252/N", "atom2_id": "///B/262/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 487, "atom1_serNum": 3781, "atom2_serNum": 3812, "donAcc_type": "standard", "distance": 3.452, "atom1_id": "///B/252/O", "atom2_id": "///B/256/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 488, "atom1_serNum": 3792, "atom2_serNum": 3812, "donAcc_type": "standard", "distance": 3.057, "atom1_id": "///B/253/O", "atom2_id": "///B/256/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 489, "atom1_serNum": 3792, "atom2_serNum": 3823, "donAcc_type": "standard", "distance": 2.925, "atom1_id": "///B/253/O", "atom2_id": "///B/257/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 490, "atom1_serNum": 3792, "atom2_serNum": 3831, "donAcc_type": "standard", "distance": 3.060, "atom1_id": "///B/253/O", "atom2_id": "///B/258/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 491, "atom1_serNum": 3797, "atom2_serNum": 3859, "donAcc_type": "standard", "distance": 3.791, "atom1_id": "///B/253/NZ", "atom2_id": "///B/261/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 492, "atom1_serNum": 3851, "atom2_serNum": 3988, "donAcc_type": "questionable", "distance": 2.988, "atom1_id": "///B/260/OE1", "atom2_id": "///B/277/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 493, "atom1_serNum": 3874, "atom2_serNum": 8147, "donAcc_type": "standard", "distance": 2.785, "atom1_id": "///B/263/NZ", "atom2_id": "///B/790/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 494, "atom1_serNum": 3914, "atom2_serNum": 8146, "donAcc_type": "standard", "distance": 3.417, "atom1_id": "///B/268/NZ", "atom2_id": "///B/790/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 495, "atom1_serNum": 3926, "atom2_serNum": 3950, "donAcc_type": "standard", "distance": 2.924, "atom1_id": "///B/270/O", "atom2_id": "///B/273/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 496, "atom1_serNum": 3926, "atom2_serNum": 3958, "donAcc_type": "standard", "distance": 2.519, "atom1_id": "///B/270/O", "atom2_id": "///B/274/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 497, "atom1_serNum": 3928, "atom2_serNum": 3965, "donAcc_type": "acceptable", "distance": 2.686, "atom1_id": "///B/270/OG1", "atom2_id": "///B/274/OD2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 498, "atom1_serNum": 3933, "atom2_serNum": 3966, "donAcc_type": "standard", "distance": 2.689, "atom1_id": "///B/271/O", "atom2_id": "///B/275/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 499, "atom1_serNum": 3953, "atom2_serNum": 3982, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///B/273/O", "atom2_id": "///B/277/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 500, "atom1_serNum": 3961, "atom2_serNum": 3990, "donAcc_type": "standard", "distance": 2.905, "atom1_id": "///B/274/O", "atom2_id": "///B/278/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 501, "atom1_serNum": 3969, "atom2_serNum": 3998, "donAcc_type": "standard", "distance": 2.642, "atom1_id": "///B/275/O", "atom2_id": "///B/279/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 502, "atom1_serNum": 3977, "atom2_serNum": 4006, "donAcc_type": "standard", "distance": 3.119, "atom1_id": "///B/276/O", "atom2_id": "///B/280/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 503, "atom1_serNum": 3985, "atom2_serNum": 4006, "donAcc_type": "standard", "distance": 2.952, "atom1_id": "///B/277/O", "atom2_id": "///B/280/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 504, "atom1_serNum": 3993, "atom2_serNum": 4011, "donAcc_type": "standard", "distance": 2.945, "atom1_id": "///B/278/O", "atom2_id": "///B/281/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 505, "atom1_serNum": 3993, "atom2_serNum": 4020, "donAcc_type": "standard", "distance": 3.334, "atom1_id": "///B/278/O", "atom2_id": "///B/282/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 506, "atom1_serNum": 4001, "atom2_serNum": 4028, "donAcc_type": "standard", "distance": 3.018, "atom1_id": "///B/279/O", "atom2_id": "///B/283/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 507, "atom1_serNum": 4040, "atom2_serNum": 4047, "donAcc_type": "standard", "distance": 2.792, "atom1_id": "///B/285/N", "atom2_id": "///B/285/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 508, "atom1_serNum": 4052, "atom2_serNum": 4082, "donAcc_type": "standard", "distance": 3.252, "atom1_id": "///B/286/O", "atom2_id": "///B/290/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 509, "atom1_serNum": 4064, "atom2_serNum": 4093, "donAcc_type": "standard", "distance": 2.962, "atom1_id": "///B/287/O", "atom2_id": "///B/291/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 510, "atom1_serNum": 4069, "atom2_serNum": 4101, "donAcc_type": "standard", "distance": 2.938, "atom1_id": "///B/288/O", "atom2_id": "///B/292/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 511, "atom1_serNum": 4077, "atom2_serNum": 4106, "donAcc_type": "standard", "distance": 3.002, "atom1_id": "///B/289/O", "atom2_id": "///B/293/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 512, "atom1_serNum": 4085, "atom2_serNum": 4111, "donAcc_type": "standard", "distance": 2.957, "atom1_id": "///B/290/O", "atom2_id": "///B/294/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 513, "atom1_serNum": 4096, "atom2_serNum": 4120, "donAcc_type": "standard", "distance": 2.990, "atom1_id": "///B/291/O", "atom2_id": "///B/295/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 514, "atom1_serNum": 4104, "atom2_serNum": 4128, "donAcc_type": "standard", "distance": 2.990, "atom1_id": "///B/292/O", "atom2_id": "///B/296/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 515, "atom1_serNum": 4109, "atom2_serNum": 4136, "donAcc_type": "standard", "distance": 2.952, "atom1_id": "///B/293/O", "atom2_id": "///B/297/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 516, "atom1_serNum": 4114, "atom2_serNum": 4142, "donAcc_type": "standard", "distance": 3.036, "atom1_id": "///B/294/O", "atom2_id": "///B/298/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 517, "atom1_serNum": 4123, "atom2_serNum": 4150, "donAcc_type": "standard", "distance": 2.992, "atom1_id": "///B/295/O", "atom2_id": "///B/299/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 518, "atom1_serNum": 4131, "atom2_serNum": 4155, "donAcc_type": "standard", "distance": 2.967, "atom1_id": "///B/296/O", "atom2_id": "///B/300/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 519, "atom1_serNum": 4139, "atom2_serNum": 4163, "donAcc_type": "standard", "distance": 2.946, "atom1_id": "///B/297/O", "atom2_id": "///B/301/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 520, "atom1_serNum": 4145, "atom2_serNum": 4171, "donAcc_type": "standard", "distance": 3.011, "atom1_id": "///B/298/O", "atom2_id": "///B/302/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 521, "atom1_serNum": 4153, "atom2_serNum": 4179, "donAcc_type": "standard", "distance": 2.887, "atom1_id": "///B/299/O", "atom2_id": "///B/303/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 522, "atom1_serNum": 4158, "atom2_serNum": 4184, "donAcc_type": "acceptable", "distance": 2.623, "atom1_id": "///B/300/O", "atom2_id": "///B/303/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 523, "atom1_serNum": 4158, "atom2_serNum": 4185, "donAcc_type": "standard", "distance": 3.034, "atom1_id": "///B/300/O", "atom2_id": "///B/304/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 524, "atom1_serNum": 4166, "atom2_serNum": 4193, "donAcc_type": "standard", "distance": 3.773, "atom1_id": "///B/301/O", "atom2_id": "///B/305/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 525, "atom1_serNum": 4174, "atom2_serNum": 4193, "donAcc_type": "standard", "distance": 2.994, "atom1_id": "///B/302/O", "atom2_id": "///B/305/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 526, "atom1_serNum": 4174, "atom2_serNum": 4201, "donAcc_type": "standard", "distance": 2.834, "atom1_id": "///B/302/O", "atom2_id": "///B/306/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 527, "atom1_serNum": 4182, "atom2_serNum": 4219, "donAcc_type": "standard", "distance": 2.743, "atom1_id": "///B/303/O", "atom2_id": "///B/307/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 528, "atom1_serNum": 4209, "atom2_serNum": 4311, "donAcc_type": "acceptable", "distance": 3.218, "atom1_id": "///B/307/N", "atom2_id": "///B/320/OG", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 529, "atom1_serNum": 4212, "atom2_serNum": 4336, "donAcc_type": "standard", "distance": 3.568, "atom1_id": "///B/307/O", "atom2_id": "///B/323/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 530, "atom1_serNum": 4230, "atom2_serNum": 4251, "donAcc_type": "standard", "distance": 3.718, "atom1_id": "///B/309/O", "atom2_id": "///B/312/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 531, "atom1_serNum": 4264, "atom2_serNum": 4275, "donAcc_type": "acceptable", "distance": 3.017, "atom1_id": "///B/313/OG1", "atom2_id": "///B/315/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 532, "atom1_serNum": 4278, "atom2_serNum": 4301, "donAcc_type": "standard", "distance": 2.858, "atom1_id": "///B/315/O", "atom2_id": "///B/319/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 533, "atom1_serNum": 4283, "atom2_serNum": 4306, "donAcc_type": "standard", "distance": 2.882, "atom1_id": "///B/316/O", "atom2_id": "///B/320/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 534, "atom1_serNum": 4283, "atom2_serNum": 4311, "donAcc_type": "acceptable", "distance": 2.559, "atom1_id": "///B/316/O", "atom2_id": "///B/320/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 535, "atom1_serNum": 4290, "atom2_serNum": 4312, "donAcc_type": "standard", "distance": 2.922, "atom1_id": "///B/317/O", "atom2_id": "///B/321/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 536, "atom1_serNum": 4295, "atom2_serNum": 5129, "donAcc_type": "standard", "distance": 3.015, "atom1_id": "///B/318/N", "atom2_id": "///B/418/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 537, "atom1_serNum": 4298, "atom2_serNum": 4320, "donAcc_type": "standard", "distance": 2.869, "atom1_id": "///B/318/O", "atom2_id": "///B/322/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 538, "atom1_serNum": 4300, "atom2_serNum": 5128, "donAcc_type": "acceptable", "distance": 2.649, "atom1_id": "///B/318/OG", "atom2_id": "///B/418/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 539, "atom1_serNum": 4300, "atom2_serNum": 5129, "donAcc_type": "acceptable", "distance": 2.954, "atom1_id": "///B/318/OG", "atom2_id": "///B/418/OE2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 540, "atom1_serNum": 4304, "atom2_serNum": 4328, "donAcc_type": "standard", "distance": 2.838, "atom1_id": "///B/319/O", "atom2_id": "///B/323/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 541, "atom1_serNum": 4309, "atom2_serNum": 4337, "donAcc_type": "standard", "distance": 2.925, "atom1_id": "///B/320/O", "atom2_id": "///B/324/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 542, "atom1_serNum": 4315, "atom2_serNum": 4348, "donAcc_type": "standard", "distance": 2.917, "atom1_id": "///B/321/O", "atom2_id": "///B/325/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 543, "atom1_serNum": 4323, "atom2_serNum": 4360, "donAcc_type": "standard", "distance": 2.833, "atom1_id": "///B/322/O", "atom2_id": "///B/326/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 544, "atom1_serNum": 4331, "atom2_serNum": 4368, "donAcc_type": "standard", "distance": 2.948, "atom1_id": "///B/323/O", "atom2_id": "///B/327/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 545, "atom1_serNum": 4340, "atom2_serNum": 4377, "donAcc_type": "standard", "distance": 2.891, "atom1_id": "///B/324/O", "atom2_id": "///B/328/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 546, "atom1_serNum": 4346, "atom2_serNum": 4987, "donAcc_type": "standard", "distance": 2.883, "atom1_id": "///B/324/NH1", "atom2_id": "///B/401/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 547, "atom1_serNum": 4346, "atom2_serNum": 4996, "donAcc_type": "standard", "distance": 3.300, "atom1_id": "///B/324/NH1", "atom2_id": "///B/402/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 548, "atom1_serNum": 4346, "atom2_serNum": 5018, "donAcc_type": "acceptable", "distance": 3.002, "atom1_id": "///B/324/NH1", "atom2_id": "///B/404/OG1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 549, "atom1_serNum": 4347, "atom2_serNum": 5045, "donAcc_type": "standard", "distance": 3.271, "atom1_id": "///B/324/NH2", "atom2_id": "///B/407/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 550, "atom1_serNum": 4351, "atom2_serNum": 4387, "donAcc_type": "standard", "distance": 2.896, "atom1_id": "///B/325/O", "atom2_id": "///B/329/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 551, "atom1_serNum": 4363, "atom2_serNum": 4397, "donAcc_type": "standard", "distance": 2.914, "atom1_id": "///B/326/O", "atom2_id": "///B/330/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 552, "atom1_serNum": 4371, "atom2_serNum": 4406, "donAcc_type": "standard", "distance": 2.860, "atom1_id": "///B/327/O", "atom2_id": "///B/331/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 553, "atom1_serNum": 4380, "atom2_serNum": 4414, "donAcc_type": "standard", "distance": 2.852, "atom1_id": "///B/328/O", "atom2_id": "///B/332/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 554, "atom1_serNum": 4383, "atom2_serNum": 4976, "donAcc_type": "acceptable", "distance": 3.006, "atom1_id": "///B/328/ND1", "atom2_id": "///B/400/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 555, "atom1_serNum": 4386, "atom2_serNum": 4651, "donAcc_type": "acceptable", "distance": 2.815, "atom1_id": "///B/328/NE2", "atom2_id": "///B/359/OH", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 556, "atom1_serNum": 4390, "atom2_serNum": 4422, "donAcc_type": "standard", "distance": 2.986, "atom1_id": "///B/329/O", "atom2_id": "///B/333/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 557, "atom1_serNum": 4390, "atom2_serNum": 4427, "donAcc_type": "acceptable", "distance": 3.136, "atom1_id": "///B/329/O", "atom2_id": "///B/333/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 558, "atom1_serNum": 4400, "atom2_serNum": 4429, "donAcc_type": "standard", "distance": 2.971, "atom1_id": "///B/330/O", "atom2_id": "///B/334/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 559, "atom1_serNum": 4409, "atom2_serNum": 4437, "donAcc_type": "standard", "distance": 2.829, "atom1_id": "///B/331/O", "atom2_id": "///B/335/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 560, "atom1_serNum": 4412, "atom2_serNum": 4912, "donAcc_type": "standard", "distance": 3.160, "atom1_id": "///B/331/OD1", "atom2_id": "///B/392/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 561, "atom1_serNum": 4413, "atom2_serNum": 4912, "donAcc_type": "standard", "distance": 2.895, "atom1_id": "///B/331/OD2", "atom2_id": "///B/392/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 562, "atom1_serNum": 4417, "atom2_serNum": 4445, "donAcc_type": "standard", "distance": 2.885, "atom1_id": "///B/332/O", "atom2_id": "///B/336/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 563, "atom1_serNum": 4425, "atom2_serNum": 4454, "donAcc_type": "standard", "distance": 2.991, "atom1_id": "///B/333/O", "atom2_id": "///B/337/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 564, "atom1_serNum": 4432, "atom2_serNum": 4459, "donAcc_type": "standard", "distance": 2.878, "atom1_id": "///B/334/O", "atom2_id": "///B/338/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 565, "atom1_serNum": 4440, "atom2_serNum": 4467, "donAcc_type": "standard", "distance": 2.909, "atom1_id": "///B/335/O", "atom2_id": "///B/339/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 566, "atom1_serNum": 4448, "atom2_serNum": 4474, "donAcc_type": "standard", "distance": 2.884, "atom1_id": "///B/336/O", "atom2_id": "///B/340/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 567, "atom1_serNum": 4457, "atom2_serNum": 4485, "donAcc_type": "standard", "distance": 2.969, "atom1_id": "///B/337/O", "atom2_id": "///B/341/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 568, "atom1_serNum": 4462, "atom2_serNum": 4494, "donAcc_type": "standard", "distance": 2.909, "atom1_id": "///B/338/O", "atom2_id": "///B/342/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 569, "atom1_serNum": 4470, "atom2_serNum": 4503, "donAcc_type": "standard", "distance": 3.029, "atom1_id": "///B/339/O", "atom2_id": "///B/343/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 570, "atom1_serNum": 4501, "atom2_serNum": 4844, "donAcc_type": "standard", "distance": 2.940, "atom1_id": "///B/342/OE1", "atom2_id": "///B/384/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 571, "atom1_serNum": 4502, "atom2_serNum": 4847, "donAcc_type": "standard", "distance": 2.537, "atom1_id": "///B/342/NE2", "atom2_id": "///B/384/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 572, "atom1_serNum": 4530, "atom2_serNum": 4566, "donAcc_type": "standard", "distance": 3.039, "atom1_id": "///B/346/O", "atom2_id": "///B/350/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 573, "atom1_serNum": 4539, "atom2_serNum": 4574, "donAcc_type": "standard", "distance": 2.941, "atom1_id": "///B/347/O", "atom2_id": "///B/351/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 574, "atom1_serNum": 4551, "atom2_serNum": 4585, "donAcc_type": "standard", "distance": 2.902, "atom1_id": "///B/348/O", "atom2_id": "///B/352/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 575, "atom1_serNum": 4551, "atom2_serNum": 4596, "donAcc_type": "standard", "distance": 3.498, "atom1_id": "///B/348/O", "atom2_id": "///B/353/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 576, "atom1_serNum": 4569, "atom2_serNum": 4640, "donAcc_type": "standard", "distance": 2.885, "atom1_id": "///B/350/O", "atom2_id": "///B/359/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 577, "atom1_serNum": 4569, "atom2_serNum": 4652, "donAcc_type": "standard", "distance": 3.028, "atom1_id": "///B/350/O", "atom2_id": "///B/360/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 578, "atom1_serNum": 4602, "atom2_serNum": 4613, "donAcc_type": "standard", "distance": 3.046, "atom1_id": "///B/353/OD1", "atom2_id": "///B/355/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 579, "atom1_serNum": 4639, "atom2_serNum": 4661, "donAcc_type": "standard", "distance": 2.836, "atom1_id": "///B/358/O", "atom2_id": "///B/362/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 580, "atom1_serNum": 4643, "atom2_serNum": 4673, "donAcc_type": "standard", "distance": 2.916, "atom1_id": "///B/359/O", "atom2_id": "///B/363/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 581, "atom1_serNum": 4655, "atom2_serNum": 4681, "donAcc_type": "standard", "distance": 2.620, "atom1_id": "///B/360/O", "atom2_id": "///B/364/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 582, "atom1_serNum": 4655, "atom2_serNum": 4689, "donAcc_type": "standard", "distance": 3.228, "atom1_id": "///B/360/O", "atom2_id": "///B/365/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 583, "atom1_serNum": 4660, "atom2_serNum": 4697, "donAcc_type": "standard", "distance": 3.025, "atom1_id": "///B/361/O", "atom2_id": "///B/367/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 584, "atom1_serNum": 4664, "atom2_serNum": 4992, "donAcc_type": "standard", "distance": 2.863, "atom1_id": "///B/362/O", "atom2_id": "///B/401/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 585, "atom1_serNum": 4672, "atom2_serNum": 4968, "donAcc_type": "acceptable", "distance": 2.707, "atom1_id": "///B/362/OH", "atom2_id": "///B/399/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 586, "atom1_serNum": 4702, "atom2_serNum": 4733, "donAcc_type": "standard", "distance": 2.979, "atom1_id": "///B/368/N", "atom2_id": "///B/371/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 587, "atom1_serNum": 4705, "atom2_serNum": 4735, "donAcc_type": "standard", "distance": 2.780, "atom1_id": "///B/368/O", "atom2_id": "///B/372/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 588, "atom1_serNum": 4707, "atom2_serNum": 4726, "donAcc_type": "acceptable", "distance": 3.210, "atom1_id": "///B/368/OG", "atom2_id": "///B/371/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 589, "atom1_serNum": 4711, "atom2_serNum": 4746, "donAcc_type": "standard", "distance": 2.914, "atom1_id": "///B/369/O", "atom2_id": "///B/373/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 590, "atom1_serNum": 4715, "atom2_serNum": 4982, "donAcc_type": "standard", "distance": 2.885, "atom1_id": "///B/369/OE1", "atom2_id": "///B/400/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 591, "atom1_serNum": 4720, "atom2_serNum": 4758, "donAcc_type": "standard", "distance": 2.946, "atom1_id": "///B/370/O", "atom2_id": "///B/374/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 592, "atom1_serNum": 4729, "atom2_serNum": 4767, "donAcc_type": "standard", "distance": 2.903, "atom1_id": "///B/371/O", "atom2_id": "///B/375/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 593, "atom1_serNum": 4738, "atom2_serNum": 4778, "donAcc_type": "standard", "distance": 2.942, "atom1_id": "///B/372/O", "atom2_id": "///B/376/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 594, "atom1_serNum": 4749, "atom2_serNum": 4786, "donAcc_type": "standard", "distance": 2.883, "atom1_id": "///B/373/O", "atom2_id": "///B/377/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 595, "atom1_serNum": 4757, "atom2_serNum": 4957, "donAcc_type": "acceptable", "distance": 2.895, "atom1_id": "///B/373/OH", "atom2_id": "///B/398/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 596, "atom1_serNum": 4757, "atom2_serNum": 4960, "donAcc_type": "acceptable", "distance": 2.375, "atom1_id": "///B/373/OH", "atom2_id": "///B/398/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 597, "atom1_serNum": 4781, "atom2_serNum": 4810, "donAcc_type": "standard", "distance": 2.956, "atom1_id": "///B/376/O", "atom2_id": "///B/380/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 598, "atom1_serNum": 4789, "atom2_serNum": 4818, "donAcc_type": "standard", "distance": 2.979, "atom1_id": "///B/377/O", "atom2_id": "///B/381/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 599, "atom1_serNum": 4794, "atom2_serNum": 4927, "donAcc_type": "standard", "distance": 2.825, "atom1_id": "///B/377/NZ", "atom2_id": "///B/394/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 600, "atom1_serNum": 4798, "atom2_serNum": 4827, "donAcc_type": "standard", "distance": 2.868, "atom1_id": "///B/378/O", "atom2_id": "///B/382/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 601, "atom1_serNum": 4813, "atom2_serNum": 4861, "donAcc_type": "acceptable", "distance": 2.317, "atom1_id": "///B/380/O", "atom2_id": "///B/386/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 602, "atom1_serNum": 4859, "atom2_serNum": 4889, "donAcc_type": "standard", "distance": 2.865, "atom1_id": "///B/386/O", "atom2_id": "///B/390/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 603, "atom1_serNum": 4866, "atom2_serNum": 4897, "donAcc_type": "standard", "distance": 2.967, "atom1_id": "///B/387/O", "atom2_id": "///B/391/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 604, "atom1_serNum": 4875, "atom2_serNum": 4904, "donAcc_type": "standard", "distance": 2.916, "atom1_id": "///B/388/O", "atom2_id": "///B/392/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 605, "atom1_serNum": 4884, "atom2_serNum": 4913, "donAcc_type": "standard", "distance": 2.877, "atom1_id": "///B/389/O", "atom2_id": "///B/393/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 606, "atom1_serNum": 4892, "atom2_serNum": 4921, "donAcc_type": "standard", "distance": 2.947, "atom1_id": "///B/390/O", "atom2_id": "///B/394/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 607, "atom1_serNum": 4892, "atom2_serNum": 4928, "donAcc_type": "standard", "distance": 2.703, "atom1_id": "///B/390/O", "atom2_id": "///B/394/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 608, "atom1_serNum": 4900, "atom2_serNum": 4929, "donAcc_type": "standard", "distance": 3.139, "atom1_id": "///B/391/O", "atom2_id": "///B/395/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 609, "atom1_serNum": 4907, "atom2_serNum": 4940, "donAcc_type": "standard", "distance": 3.190, "atom1_id": "///B/392/O", "atom2_id": "///B/396/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 610, "atom1_serNum": 4907, "atom2_serNum": 4949, "donAcc_type": "standard", "distance": 2.751, "atom1_id": "///B/392/O", "atom2_id": "///B/397/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 611, "atom1_serNum": 4916, "atom2_serNum": 4940, "donAcc_type": "standard", "distance": 2.969, "atom1_id": "///B/393/O", "atom2_id": "///B/396/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 612, "atom1_serNum": 4939, "atom2_serNum": 4956, "donAcc_type": "standard", "distance": 3.481, "atom1_id": "///B/395/NH2", "atom2_id": "///B/397/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 613, "atom1_serNum": 4983, "atom2_serNum": 5037, "donAcc_type": "standard", "distance": 3.184, "atom1_id": "///B/400/NH2", "atom2_id": "///B/406/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 614, "atom1_serNum": 4983, "atom2_serNum": 5038, "donAcc_type": "standard", "distance": 2.489, "atom1_id": "///B/400/NH2", "atom2_id": "///B/406/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 615, "atom1_serNum": 4996, "atom2_serNum": 5046, "donAcc_type": "standard", "distance": 2.657, "atom1_id": "///B/402/O", "atom2_id": "///B/407/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 616, "atom1_serNum": 5013, "atom2_serNum": 5046, "donAcc_type": "questionable", "distance": 2.999, "atom1_id": "///B/404/N", "atom2_id": "///B/407/ND2", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 617, "atom1_serNum": 5018, "atom2_serNum": 5037, "donAcc_type": "acceptable", "distance": 2.818, "atom1_id": "///B/404/OG1", "atom2_id": "///B/406/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 618, "atom1_serNum": 5023, "atom2_serNum": 5047, "donAcc_type": "standard", "distance": 3.988, "atom1_id": "///B/405/O", "atom2_id": "///B/408/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 619, "atom1_serNum": 5034, "atom2_serNum": 5051, "donAcc_type": "standard", "distance": 3.035, "atom1_id": "///B/406/O", "atom2_id": "///B/409/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 620, "atom1_serNum": 5042, "atom2_serNum": 5057, "donAcc_type": "standard", "distance": 3.226, "atom1_id": "///B/407/O", "atom2_id": "///B/410/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 621, "atom1_serNum": 5054, "atom2_serNum": 5065, "donAcc_type": "standard", "distance": 3.254, "atom1_id": "///B/409/O", "atom2_id": "///B/411/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 622, "atom1_serNum": 5068, "atom2_serNum": 5091, "donAcc_type": "standard", "distance": 3.250, "atom1_id": "///B/411/O", "atom2_id": "///B/414/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 623, "atom1_serNum": 5075, "atom2_serNum": 5109, "donAcc_type": "standard", "distance": 2.881, "atom1_id": "///B/412/O", "atom2_id": "///B/416/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 624, "atom1_serNum": 5082, "atom2_serNum": 5089, "donAcc_type": "standard", "distance": 2.674, "atom1_id": "///B/413/N", "atom2_id": "///B/413/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 625, "atom1_serNum": 5085, "atom2_serNum": 5117, "donAcc_type": "standard", "distance": 2.841, "atom1_id": "///B/413/O", "atom2_id": "///B/417/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 626, "atom1_serNum": 5094, "atom2_serNum": 5121, "donAcc_type": "standard", "distance": 3.065, "atom1_id": "///B/414/O", "atom2_id": "///B/418/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 627, "atom1_serNum": 5102, "atom2_serNum": 5130, "donAcc_type": "standard", "distance": 2.874, "atom1_id": "///B/415/O", "atom2_id": "///B/419/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 628, "atom1_serNum": 5112, "atom2_serNum": 5138, "donAcc_type": "standard", "distance": 2.852, "atom1_id": "///B/416/O", "atom2_id": "///B/420/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 629, "atom1_serNum": 5120, "atom2_serNum": 5148, "donAcc_type": "standard", "distance": 2.919, "atom1_id": "///B/417/O", "atom2_id": "///B/421/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 630, "atom1_serNum": 5124, "atom2_serNum": 5153, "donAcc_type": "standard", "distance": 2.952, "atom1_id": "///B/418/O", "atom2_id": "///B/422/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 631, "atom1_serNum": 5133, "atom2_serNum": 5161, "donAcc_type": "standard", "distance": 2.957, "atom1_id": "///B/419/O", "atom2_id": "///B/423/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 632, "atom1_serNum": 5141, "atom2_serNum": 5169, "donAcc_type": "standard", "distance": 2.883, "atom1_id": "///B/420/O", "atom2_id": "///B/424/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 633, "atom1_serNum": 5144, "atom2_serNum": 5336, "donAcc_type": "acceptable", "distance": 2.557, "atom1_id": "///B/420/ND1", "atom2_id": "///B/441/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 634, "atom1_serNum": 5151, "atom2_serNum": 5180, "donAcc_type": "standard", "distance": 2.904, "atom1_id": "///B/421/O", "atom2_id": "///B/425/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 635, "atom1_serNum": 5156, "atom2_serNum": 5191, "donAcc_type": "standard", "distance": 2.932, "atom1_id": "///B/422/O", "atom2_id": "///B/426/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 636, "atom1_serNum": 5164, "atom2_serNum": 5200, "donAcc_type": "standard", "distance": 2.859, "atom1_id": "///B/423/O", "atom2_id": "///B/427/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 637, "atom1_serNum": 5178, "atom2_serNum": 5208, "donAcc_type": "standard", "distance": 2.867, "atom1_id": "///B/424/NH1", "atom2_id": "///B/427/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 638, "atom1_serNum": 5194, "atom2_serNum": 5217, "donAcc_type": "standard", "distance": 3.198, "atom1_id": "///B/426/O", "atom2_id": "///B/429/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 639, "atom1_serNum": 5194, "atom2_serNum": 5228, "donAcc_type": "standard", "distance": 3.064, "atom1_id": "///B/426/O", "atom2_id": "///B/430/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 640, "atom1_serNum": 5231, "atom2_serNum": 5258, "donAcc_type": "standard", "distance": 3.046, "atom1_id": "///B/430/O", "atom2_id": "///B/433/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 641, "atom1_serNum": 5231, "atom2_serNum": 5266, "donAcc_type": "standard", "distance": 3.471, "atom1_id": "///B/430/O", "atom2_id": "///B/434/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 642, "atom1_serNum": 5243, "atom2_serNum": 5275, "donAcc_type": "standard", "distance": 2.952, "atom1_id": "///B/431/O", "atom2_id": "///B/435/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 643, "atom1_serNum": 5250, "atom2_serNum": 5283, "donAcc_type": "standard", "distance": 2.996, "atom1_id": "///B/432/O", "atom2_id": "///B/436/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 644, "atom1_serNum": 5250, "atom2_serNum": 5290, "donAcc_type": "standard", "distance": 2.930, "atom1_id": "///B/432/O", "atom2_id": "///B/436/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 645, "atom1_serNum": 5282, "atom2_serNum": 5290, "donAcc_type": "standard", "distance": 3.559, "atom1_id": "///B/435/OD2", "atom2_id": "///B/436/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 646, "atom1_serNum": 5286, "atom2_serNum": 5320, "donAcc_type": "standard", "distance": 3.064, "atom1_id": "///B/436/O", "atom2_id": "///B/440/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 647, "atom1_serNum": 5294, "atom2_serNum": 5328, "donAcc_type": "standard", "distance": 2.953, "atom1_id": "///B/437/O", "atom2_id": "///B/441/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 648, "atom1_serNum": 5300, "atom2_serNum": 5336, "donAcc_type": "standard", "distance": 3.420, "atom1_id": "///B/437/NH1", "atom2_id": "///B/441/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 649, "atom1_serNum": 5305, "atom2_serNum": 5337, "donAcc_type": "standard", "distance": 2.832, "atom1_id": "///B/438/O", "atom2_id": "///B/442/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 650, "atom1_serNum": 5314, "atom2_serNum": 5346, "donAcc_type": "standard", "distance": 2.930, "atom1_id": "///B/439/O", "atom2_id": "///B/443/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 651, "atom1_serNum": 5314, "atom2_serNum": 5627, "donAcc_type": "standard", "distance": 3.016, "atom1_id": "///B/439/O", "atom2_id": "///B/476/NE1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 652, "atom1_serNum": 5323, "atom2_serNum": 5354, "donAcc_type": "standard", "distance": 3.086, "atom1_id": "///B/440/O", "atom2_id": "///B/444/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 653, "atom1_serNum": 5331, "atom2_serNum": 5362, "donAcc_type": "standard", "distance": 2.898, "atom1_id": "///B/441/O", "atom2_id": "///B/445/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 654, "atom1_serNum": 5331, "atom2_serNum": 5367, "donAcc_type": "acceptable", "distance": 3.169, "atom1_id": "///B/441/O", "atom2_id": "///B/445/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 655, "atom1_serNum": 5340, "atom2_serNum": 5369, "donAcc_type": "standard", "distance": 2.834, "atom1_id": "///B/442/O", "atom2_id": "///B/446/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 656, "atom1_serNum": 5402, "atom2_serNum": 5430, "donAcc_type": "standard", "distance": 2.903, "atom1_id": "///B/449/O", "atom2_id": "///B/452/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 657, "atom1_serNum": 5402, "atom2_serNum": 5437, "donAcc_type": "standard", "distance": 3.428, "atom1_id": "///B/449/O", "atom2_id": "///B/453/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 658, "atom1_serNum": 5417, "atom2_serNum": 6876, "donAcc_type": "acceptable", "distance": 2.699, "atom1_id": "///B/450/OH", "atom2_id": "///B/627/OE2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 659, "atom1_serNum": 5421, "atom2_serNum": 5525, "donAcc_type": "standard", "distance": 2.819, "atom1_id": "///B/451/O", "atom2_id": "///B/464/NE1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 660, "atom1_serNum": 5429, "atom2_serNum": 5700, "donAcc_type": "acceptable", "distance": 3.583, "atom1_id": "///B/451/OH", "atom2_id": "///B/484/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 661, "atom1_serNum": 5433, "atom2_serNum": 5531, "donAcc_type": "standard", "distance": 3.935, "atom1_id": "///B/452/O", "atom2_id": "///B/465/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 662, "atom1_serNum": 5444, "atom2_serNum": 5456, "donAcc_type": "standard", "distance": 2.993, "atom1_id": "///B/454/O", "atom2_id": "///B/456/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 663, "atom1_serNum": 5459, "atom2_serNum": 5555, "donAcc_type": "standard", "distance": 2.938, "atom1_id": "///B/456/O", "atom2_id": "///B/467/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 664, "atom1_serNum": 5525, "atom2_serNum": 5713, "donAcc_type": "standard", "distance": 3.212, "atom1_id": "///B/464/NE1", "atom2_id": "///B/487/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 665, "atom1_serNum": 5539, "atom2_serNum": 5715, "donAcc_type": "acceptable", "distance": 3.260, "atom1_id": "///B/466/N", "atom2_id": "///B/487/OG", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 666, "atom1_serNum": 5542, "atom2_serNum": 5684, "donAcc_type": "standard", "distance": 3.047, "atom1_id": "///B/466/O", "atom2_id": "///B/483/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 667, "atom1_serNum": 5556, "atom2_serNum": 5584, "donAcc_type": "standard", "distance": 3.243, "atom1_id": "///B/467/NH2", "atom2_id": "///B/471/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 668, "atom1_serNum": 5557, "atom2_serNum": 5673, "donAcc_type": "standard", "distance": 2.374, "atom1_id": "///B/468/N", "atom2_id": "///B/481/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 669, "atom1_serNum": 5565, "atom2_serNum": 5655, "donAcc_type": "standard", "distance": 2.876, "atom1_id": "///B/468/NZ", "atom2_id": "///B/479/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 670, "atom1_serNum": 5566, "atom2_serNum": 5673, "donAcc_type": "standard", "distance": 3.515, "atom1_id": "///B/469/N", "atom2_id": "///B/481/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 671, "atom1_serNum": 5569, "atom2_serNum": 5581, "donAcc_type": "standard", "distance": 3.122, "atom1_id": "///B/469/O", "atom2_id": "///B/471/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 672, "atom1_serNum": 5571, "atom2_serNum": 5589, "donAcc_type": "acceptable", "distance": 3.017, "atom1_id": "///B/469/OG", "atom2_id": "///B/471/OE2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 673, "atom1_serNum": 5593, "atom2_serNum": 5640, "donAcc_type": "standard", "distance": 2.863, "atom1_id": "///B/472/O", "atom2_id": "///B/477/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 674, "atom1_serNum": 5605, "atom2_serNum": 5639, "donAcc_type": "standard", "distance": 2.493, "atom1_id": "///B/474/N", "atom2_id": "///B/477/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 675, "atom1_serNum": 5610, "atom2_serNum": 5633, "donAcc_type": "acceptable", "distance": 3.144, "atom1_id": "///B/474/OG1", "atom2_id": "///B/477/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 676, "atom1_serNum": 5636, "atom2_serNum": 5670, "donAcc_type": "standard", "distance": 2.863, "atom1_id": "///B/477/O", "atom2_id": "///B/481/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 677, "atom1_serNum": 5644, "atom2_serNum": 5677, "donAcc_type": "standard", "distance": 2.874, "atom1_id": "///B/478/O", "atom2_id": "///B/482/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 678, "atom1_serNum": 5660, "atom2_serNum": 5700, "donAcc_type": "standard", "distance": 3.238, "atom1_id": "///B/479/OE2", "atom2_id": "///B/484/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 679, "atom1_serNum": 5680, "atom2_serNum": 5692, "donAcc_type": "standard", "distance": 3.071, "atom1_id": "///B/482/O", "atom2_id": "///B/484/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 680, "atom1_serNum": 5687, "atom2_serNum": 5710, "donAcc_type": "standard", "distance": 2.892, "atom1_id": "///B/483/O", "atom2_id": "///B/487/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 681, "atom1_serNum": 5687, "atom2_serNum": 5715, "donAcc_type": "acceptable", "distance": 2.847, "atom1_id": "///B/483/O", "atom2_id": "///B/487/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 682, "atom1_serNum": 5690, "atom2_serNum": 5701, "donAcc_type": "standard", "distance": 3.361, "atom1_id": "///B/483/OD1", "atom2_id": "///B/485/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 683, "atom1_serNum": 5690, "atom2_serNum": 5705, "donAcc_type": "standard", "distance": 3.071, "atom1_id": "///B/483/OD1", "atom2_id": "///B/486/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 684, "atom1_serNum": 5695, "atom2_serNum": 5716, "donAcc_type": "standard", "distance": 2.881, "atom1_id": "///B/484/O", "atom2_id": "///B/488/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 685, "atom1_serNum": 5704, "atom2_serNum": 5721, "donAcc_type": "standard", "distance": 2.935, "atom1_id": "///B/485/O", "atom2_id": "///B/489/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 686, "atom1_serNum": 5708, "atom2_serNum": 5730, "donAcc_type": "standard", "distance": 2.889, "atom1_id": "///B/486/O", "atom2_id": "///B/490/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 687, "atom1_serNum": 5708, "atom2_serNum": 5735, "donAcc_type": "acceptable", "distance": 3.134, "atom1_id": "///B/486/O", "atom2_id": "///B/490/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 688, "atom1_serNum": 5713, "atom2_serNum": 5736, "donAcc_type": "standard", "distance": 2.906, "atom1_id": "///B/487/O", "atom2_id": "///B/491/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 689, "atom1_serNum": 5724, "atom2_serNum": 5755, "donAcc_type": "standard", "distance": 2.916, "atom1_id": "///B/489/O", "atom2_id": "///B/493/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 690, "atom1_serNum": 5733, "atom2_serNum": 5764, "donAcc_type": "standard", "distance": 2.983, "atom1_id": "///B/490/O", "atom2_id": "///B/494/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 691, "atom1_serNum": 5750, "atom2_serNum": 5775, "donAcc_type": "standard", "distance": 2.925, "atom1_id": "///B/492/O", "atom2_id": "///B/495/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 692, "atom1_serNum": 5750, "atom2_serNum": 5783, "donAcc_type": "standard", "distance": 3.097, "atom1_id": "///B/492/O", "atom2_id": "///B/496/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 693, "atom1_serNum": 5763, "atom2_serNum": 5874, "donAcc_type": "standard", "distance": 3.014, "atom1_id": "///B/493/OE2", "atom2_id": "///B/506/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 694, "atom1_serNum": 5790, "atom2_serNum": 12992, "donAcc_type": "standard", "distance": 3.279, "atom1_id": "///B/497/N", "atom2_id": "///C/10/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 695, "atom1_serNum": 5797, "atom2_serNum": 12999, "donAcc_type": "standard", "distance": 3.021, "atom1_id": "///B/497/ND2", "atom2_id": "///C/10/O3'", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 696, "atom1_serNum": 5797, "atom2_serNum": 13014, "donAcc_type": "standard", "distance": 3.064, "atom1_id": "///B/497/ND2", "atom2_id": "///C/11/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 697, "atom1_serNum": 5809, "atom2_serNum": 5860, "donAcc_type": "standard", "distance": 3.070, "atom1_id": "///B/499/N", "atom2_id": "///B/505/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 698, "atom1_serNum": 5815, "atom2_serNum": 5817, "donAcc_type": "standard", "distance": 2.956, "atom1_id": "///B/499/OD1", "atom2_id": "///B/500/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 699, "atom1_serNum": 5815, "atom2_serNum": 5826, "donAcc_type": "standard", "distance": 2.858, "atom1_id": "///B/499/OD1", "atom2_id": "///B/501/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 700, "atom1_serNum": 5816, "atom2_serNum": 7188, "donAcc_type": "standard", "distance": 2.619, "atom1_id": "///B/499/OD2", "atom2_id": "///B/663/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 701, "atom1_serNum": 5816, "atom2_serNum": 7193, "donAcc_type": "acceptable", "distance": 2.814, "atom1_id": "///B/499/OD2", "atom2_id": "///B/663/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 702, "atom1_serNum": 5820, "atom2_serNum": 7593, "donAcc_type": "standard", "distance": 3.193, "atom1_id": "///B/500/O", "atom2_id": "///B/712/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 703, "atom1_serNum": 5837, "atom2_serNum": 5857, "donAcc_type": "standard", "distance": 2.927, "atom1_id": "///B/502/O", "atom2_id": "///B/505/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 704, "atom1_serNum": 5882, "atom2_serNum": 7183, "donAcc_type": "standard", "distance": 2.985, "atom1_id": "///B/508/N", "atom2_id": "///B/662/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 705, "atom1_serNum": 5885, "atom2_serNum": 7165, "donAcc_type": "standard", "distance": 2.834, "atom1_id": "///B/508/O", "atom2_id": "///B/660/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 706, "atom1_serNum": 5893, "atom2_serNum": 5916, "donAcc_type": "standard", "distance": 3.149, "atom1_id": "///B/509/O", "atom2_id": "///B/512/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 707, "atom1_serNum": 5897, "atom2_serNum": 7150, "donAcc_type": "standard", "distance": 3.244, "atom1_id": "///B/510/N", "atom2_id": "///B/658/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 708, "atom1_serNum": 5909, "atom2_serNum": 6586, "donAcc_type": "acceptable", "distance": 2.483, "atom1_id": "///B/511/O", "atom2_id": "///B/593/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 709, "atom1_serNum": 5919, "atom2_serNum": 5950, "donAcc_type": "standard", "distance": 3.042, "atom1_id": "///B/512/O", "atom2_id": "///B/516/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 710, "atom1_serNum": 5921, "atom2_serNum": 6794, "donAcc_type": "acceptable", "distance": 2.460, "atom1_id": "///B/512/OG", "atom2_id": "///B/617/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 711, "atom1_serNum": 5921, "atom2_serNum": 6795, "donAcc_type": "acceptable", "distance": 3.048, "atom1_id": "///B/512/OG", "atom2_id": "///B/617/OE2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 712, "atom1_serNum": 5922, "atom2_serNum": 6795, "donAcc_type": "standard", "distance": 3.304, "atom1_id": "///B/513/N", "atom2_id": "///B/617/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 713, "atom1_serNum": 5925, "atom2_serNum": 5959, "donAcc_type": "standard", "distance": 2.896, "atom1_id": "///B/513/O", "atom2_id": "///B/517/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 714, "atom1_serNum": 5930, "atom2_serNum": 6795, "donAcc_type": "standard", "distance": 3.139, "atom1_id": "///B/514/N", "atom2_id": "///B/617/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 715, "atom1_serNum": 5933, "atom2_serNum": 5971, "donAcc_type": "standard", "distance": 2.889, "atom1_id": "///B/514/O", "atom2_id": "///B/518/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 716, "atom1_serNum": 5941, "atom2_serNum": 5982, "donAcc_type": "standard", "distance": 2.929, "atom1_id": "///B/515/O", "atom2_id": "///B/519/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 717, "atom1_serNum": 5949, "atom2_serNum": 7169, "donAcc_type": "acceptable", "distance": 2.826, "atom1_id": "///B/515/OH", "atom2_id": "///B/661/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 718, "atom1_serNum": 5953, "atom2_serNum": 5987, "donAcc_type": "acceptable", "distance": 2.833, "atom1_id": "///B/516/O", "atom2_id": "///B/519/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 719, "atom1_serNum": 5953, "atom2_serNum": 5989, "donAcc_type": "standard", "distance": 2.895, "atom1_id": "///B/516/O", "atom2_id": "///B/520/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 720, "atom1_serNum": 5957, "atom2_serNum": 6577, "donAcc_type": "standard", "distance": 2.922, "atom1_id": "///B/516/OE1", "atom2_id": "///B/592/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 721, "atom1_serNum": 5957, "atom2_serNum": 6581, "donAcc_type": "standard", "distance": 3.053, "atom1_id": "///B/516/OE1", "atom2_id": "///B/593/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 722, "atom1_serNum": 5962, "atom2_serNum": 5996, "donAcc_type": "standard", "distance": 2.942, "atom1_id": "///B/517/O", "atom2_id": "///B/521/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 723, "atom1_serNum": 5970, "atom2_serNum": 6272, "donAcc_type": "acceptable", "distance": 3.240, "atom1_id": "///B/517/OH", "atom2_id": "///B/554/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 724, "atom1_serNum": 5974, "atom2_serNum": 6008, "donAcc_type": "standard", "distance": 2.838, "atom1_id": "///B/518/O", "atom2_id": "///B/522/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 725, "atom1_serNum": 5985, "atom2_serNum": 6016, "donAcc_type": "standard", "distance": 3.007, "atom1_id": "///B/519/O", "atom2_id": "///B/523/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 726, "atom1_serNum": 5992, "atom2_serNum": 6025, "donAcc_type": "standard", "distance": 2.868, "atom1_id": "///B/520/O", "atom2_id": "///B/524/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 727, "atom1_serNum": 5999, "atom2_serNum": 6033, "donAcc_type": "standard", "distance": 2.893, "atom1_id": "///B/521/O", "atom2_id": "///B/525/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 728, "atom1_serNum": 6014, "atom2_serNum": 7426, "donAcc_type": "standard", "distance": 3.042, "atom1_id": "///B/522/OD1", "atom2_id": "///B/693/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 729, "atom1_serNum": 6023, "atom2_serNum": 6558, "donAcc_type": "standard", "distance": 2.794, "atom1_id": "///B/523/OE1", "atom2_id": "///B/589/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 730, "atom1_serNum": 6024, "atom2_serNum": 6550, "donAcc_type": "standard", "distance": 2.963, "atom1_id": "///B/523/OE2", "atom2_id": "///B/588/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 731, "atom1_serNum": 6028, "atom2_serNum": 6049, "donAcc_type": "standard", "distance": 3.320, "atom1_id": "///B/524/O", "atom2_id": "///B/527/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 732, "atom1_serNum": 6036, "atom2_serNum": 6038, "donAcc_type": "acceptable", "distance": 2.988, "atom1_id": "///B/525/O", "atom2_id": "///B/525/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 733, "atom1_serNum": 6036, "atom2_serNum": 7406, "donAcc_type": "standard", "distance": 2.987, "atom1_id": "///B/525/O", "atom2_id": "///B/690/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 734, "atom1_serNum": 6048, "atom2_serNum": 7397, "donAcc_type": "standard", "distance": 3.528, "atom1_id": "///B/526/NZ", "atom2_id": "///B/689/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 735, "atom1_serNum": 6048, "atom2_serNum": 7402, "donAcc_type": "standard", "distance": 2.744, "atom1_id": "///B/526/NZ", "atom2_id": "///B/690/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 736, "atom1_serNum": 6048, "atom2_serNum": 7452, "donAcc_type": "standard", "distance": 2.973, "atom1_id": "///B/526/NZ", "atom2_id": "///B/695/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 737, "atom1_serNum": 6052, "atom2_serNum": 6155, "donAcc_type": "standard", "distance": 3.845, "atom1_id": "///B/527/O", "atom2_id": "///B/540/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 738, "atom1_serNum": 6056, "atom2_serNum": 6497, "donAcc_type": "standard", "distance": 2.929, "atom1_id": "///B/528/N", "atom2_id": "///B/581/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 739, "atom1_serNum": 6059, "atom2_serNum": 6494, "donAcc_type": "standard", "distance": 2.885, "atom1_id": "///B/528/O", "atom2_id": "///B/581/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 740, "atom1_serNum": 6065, "atom2_serNum": 6142, "donAcc_type": "standard", "distance": 3.170, "atom1_id": "///B/529/N", "atom2_id": "///B/538/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 741, "atom1_serNum": 6068, "atom2_serNum": 6139, "donAcc_type": "standard", "distance": 3.123, "atom1_id": "///B/529/O", "atom2_id": "///B/538/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 742, "atom1_serNum": 6076, "atom2_serNum": 6190, "donAcc_type": "acceptable", "distance": 3.135, "atom1_id": "///B/529/OH", "atom2_id": "///B/544/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 743, "atom1_serNum": 6077, "atom2_serNum": 6480, "donAcc_type": "standard", "distance": 2.926, "atom1_id": "///B/530/N", "atom2_id": "///B/579/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 744, "atom1_serNum": 6080, "atom2_serNum": 6477, "donAcc_type": "standard", "distance": 2.913, "atom1_id": "///B/530/O", "atom2_id": "///B/579/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 745, "atom1_serNum": 6158, "atom2_serNum": 7406, "donAcc_type": "standard", "distance": 3.024, "atom1_id": "///B/540/O", "atom2_id": "///B/690/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 746, "atom1_serNum": 6163, "atom2_serNum": 6189, "donAcc_type": "standard", "distance": 2.833, "atom1_id": "///B/541/N", "atom2_id": "///B/544/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 747, "atom1_serNum": 6166, "atom2_serNum": 6191, "donAcc_type": "standard", "distance": 2.887, "atom1_id": "///B/541/O", "atom2_id": "///B/545/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 748, "atom1_serNum": 6168, "atom2_serNum": 6180, "donAcc_type": "acceptable", "distance": 3.314, "atom1_id": "///B/541/OG", "atom2_id": "///B/543/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 749, "atom1_serNum": 6168, "atom2_serNum": 6182, "donAcc_type": "acceptable", "distance": 3.158, "atom1_id": "///B/541/OG", "atom2_id": "///B/544/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 750, "atom1_serNum": 6172, "atom2_serNum": 6200, "donAcc_type": "standard", "distance": 2.922, "atom1_id": "///B/542/O", "atom2_id": "///B/546/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 751, "atom1_serNum": 6173, "atom2_serNum": 6180, "donAcc_type": "standard", "distance": 2.903, "atom1_id": "///B/543/N", "atom2_id": "///B/543/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 752, "atom1_serNum": 6176, "atom2_serNum": 6209, "donAcc_type": "standard", "distance": 2.898, "atom1_id": "///B/543/O", "atom2_id": "///B/547/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 753, "atom1_serNum": 6185, "atom2_serNum": 6214, "donAcc_type": "standard", "distance": 2.885, "atom1_id": "///B/544/O", "atom2_id": "///B/548/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 754, "atom1_serNum": 6190, "atom2_serNum": 6438, "donAcc_type": "standard", "distance": 3.121, "atom1_id": "///B/544/NE2", "atom2_id": "///B/573/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 755, "atom1_serNum": 6194, "atom2_serNum": 6222, "donAcc_type": "standard", "distance": 2.924, "atom1_id": "///B/545/O", "atom2_id": "///B/549/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 756, "atom1_serNum": 6199, "atom2_serNum": 7351, "donAcc_type": "standard", "distance": 2.972, "atom1_id": "///B/545/NZ", "atom2_id": "///B/683/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 757, "atom1_serNum": 6203, "atom2_serNum": 6229, "donAcc_type": "standard", "distance": 2.953, "atom1_id": "///B/546/O", "atom2_id": "///B/550/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 758, "atom1_serNum": 6208, "atom2_serNum": 6236, "donAcc_type": "standard", "distance": 2.812, "atom1_id": "///B/546/NZ", "atom2_id": "///B/550/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 759, "atom1_serNum": 6212, "atom2_serNum": 6237, "donAcc_type": "standard", "distance": 2.887, "atom1_id": "///B/547/O", "atom2_id": "///B/551/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 760, "atom1_serNum": 6217, "atom2_serNum": 6245, "donAcc_type": "standard", "distance": 2.933, "atom1_id": "///B/548/O", "atom2_id": "///B/552/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 761, "atom1_serNum": 6217, "atom2_serNum": 6253, "donAcc_type": "standard", "distance": 3.362, "atom1_id": "///B/548/O", "atom2_id": "///B/553/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 762, "atom1_serNum": 6225, "atom2_serNum": 6264, "donAcc_type": "standard", "distance": 2.839, "atom1_id": "///B/549/O", "atom2_id": "///B/554/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 763, "atom1_serNum": 6240, "atom2_serNum": 6278, "donAcc_type": "acceptable", "distance": 2.512, "atom1_id": "///B/551/O", "atom2_id": "///B/555/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 764, "atom1_serNum": 6248, "atom2_serNum": 6273, "donAcc_type": "standard", "distance": 3.154, "atom1_id": "///B/552/O", "atom2_id": "///B/555/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 765, "atom1_serNum": 6248, "atom2_serNum": 6280, "donAcc_type": "standard", "distance": 2.827, "atom1_id": "///B/552/O", "atom2_id": "///B/556/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 766, "atom1_serNum": 6256, "atom2_serNum": 6609, "donAcc_type": "standard", "distance": 3.082, "atom1_id": "///B/553/O", "atom2_id": "///B/595/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 767, "atom1_serNum": 6272, "atom2_serNum": 6718, "donAcc_type": "standard", "distance": 2.814, "atom1_id": "///B/554/NZ", "atom2_id": "///B/608/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 768, "atom1_serNum": 6298, "atom2_serNum": 6580, "donAcc_type": "standard", "distance": 3.222, "atom1_id": "///B/557/NH2", "atom2_id": "///B/592/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 769, "atom1_serNum": 6298, "atom2_serNum": 6616, "donAcc_type": "standard", "distance": 2.285, "atom1_id": "///B/557/NH2", "atom2_id": "///B/596/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 770, "atom1_serNum": 6302, "atom2_serNum": 6345, "donAcc_type": "questionable", "distance": 3.208, "atom1_id": "///B/558/O", "atom2_id": "///B/563/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 771, "atom1_serNum": 6311, "atom2_serNum": 6539, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///B/559/O", "atom2_id": "///B/587/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 772, "atom1_serNum": 6315, "atom2_serNum": 6345, "donAcc_type": "standard", "distance": 2.847, "atom1_id": "///B/560/N", "atom2_id": "///B/563/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 773, "atom1_serNum": 6318, "atom2_serNum": 6347, "donAcc_type": "standard", "distance": 2.910, "atom1_id": "///B/560/O", "atom2_id": "///B/564/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 774, "atom1_serNum": 6320, "atom2_serNum": 6338, "donAcc_type": "acceptable", "distance": 3.128, "atom1_id": "///B/560/OG1", "atom2_id": "///B/563/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 775, "atom1_serNum": 6320, "atom2_serNum": 6345, "donAcc_type": "acceptable", "distance": 3.076, "atom1_id": "///B/560/OG1", "atom2_id": "///B/563/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 776, "atom1_serNum": 6322, "atom2_serNum": 6523, "donAcc_type": "standard", "distance": 2.792, "atom1_id": "///B/561/N", "atom2_id": "///B/585/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 777, "atom1_serNum": 6325, "atom2_serNum": 6355, "donAcc_type": "standard", "distance": 2.875, "atom1_id": "///B/561/O", "atom2_id": "///B/565/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 778, "atom1_serNum": 6332, "atom2_serNum": 6364, "donAcc_type": "standard", "distance": 2.889, "atom1_id": "///B/562/O", "atom2_id": "///B/566/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 779, "atom1_serNum": 6341, "atom2_serNum": 6373, "donAcc_type": "standard", "distance": 2.873, "atom1_id": "///B/563/O", "atom2_id": "///B/567/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 780, "atom1_serNum": 6350, "atom2_serNum": 6393, "donAcc_type": "standard", "distance": 3.118, "atom1_id": "///B/564/O", "atom2_id": "///B/569/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 781, "atom1_serNum": 6358, "atom2_serNum": 6404, "donAcc_type": "standard", "distance": 2.966, "atom1_id": "///B/565/O", "atom2_id": "///B/570/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 782, "atom1_serNum": 6367, "atom2_serNum": 6413, "donAcc_type": "standard", "distance": 3.272, "atom1_id": "///B/566/O", "atom2_id": "///B/571/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 783, "atom1_serNum": 6384, "atom2_serNum": 6422, "donAcc_type": "standard", "distance": 2.654, "atom1_id": "///B/568/O", "atom2_id": "///B/572/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 784, "atom1_serNum": 6384, "atom2_serNum": 6430, "donAcc_type": "standard", "distance": 3.393, "atom1_id": "///B/568/O", "atom2_id": "///B/573/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 785, "atom1_serNum": 6392, "atom2_serNum": 6438, "donAcc_type": "acceptable", "distance": 2.505, "atom1_id": "///B/568/OH", "atom2_id": "///B/573/OE2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 786, "atom1_serNum": 6396, "atom2_serNum": 6439, "donAcc_type": "standard", "distance": 2.992, "atom1_id": "///B/569/O", "atom2_id": "///B/574/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 787, "atom1_serNum": 6396, "atom2_serNum": 6445, "donAcc_type": "standard", "distance": 2.708, "atom1_id": "///B/569/O", "atom2_id": "///B/575/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 788, "atom1_serNum": 6412, "atom2_serNum": 6462, "donAcc_type": "standard", "distance": 2.644, "atom1_id": "///B/570/NZ", "atom2_id": "///B/576/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 789, "atom1_serNum": 6459, "atom2_serNum": 6469, "donAcc_type": "acceptable", "distance": 3.075, "atom1_id": "///B/576/O", "atom2_id": "///B/577/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 790, "atom1_serNum": 6500, "atom2_serNum": 13162, "donAcc_type": "standard", "distance": 3.665, "atom1_id": "///B/582/N", "atom2_id": "///C/18/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 791, "atom1_serNum": 6514, "atom2_serNum": 6528, "donAcc_type": "standard", "distance": 2.673, "atom1_id": "///B/584/O", "atom2_id": "///B/586/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 792, "atom1_serNum": 6572, "atom2_serNum": 6600, "donAcc_type": "standard", "distance": 3.377, "atom1_id": "///B/591/O", "atom2_id": "///B/595/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 793, "atom1_serNum": 6580, "atom2_serNum": 6610, "donAcc_type": "standard", "distance": 2.937, "atom1_id": "///B/592/O", "atom2_id": "///B/596/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 794, "atom1_serNum": 6584, "atom2_serNum": 6618, "donAcc_type": "standard", "distance": 2.899, "atom1_id": "///B/593/O", "atom2_id": "///B/597/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 795, "atom1_serNum": 6591, "atom2_serNum": 6626, "donAcc_type": "standard", "distance": 2.854, "atom1_id": "///B/594/O", "atom2_id": "///B/598/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 796, "atom1_serNum": 6599, "atom2_serNum": 6684, "donAcc_type": "acceptable", "distance": 3.204, "atom1_id": "///B/594/OH", "atom2_id": "///B/604/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 797, "atom1_serNum": 6599, "atom2_serNum": 6718, "donAcc_type": "acceptable", "distance": 2.735, "atom1_id": "///B/594/OH", "atom2_id": "///B/608/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 798, "atom1_serNum": 6603, "atom2_serNum": 6634, "donAcc_type": "standard", "distance": 2.937, "atom1_id": "///B/595/O", "atom2_id": "///B/599/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 799, "atom1_serNum": 6613, "atom2_serNum": 6643, "donAcc_type": "standard", "distance": 2.991, "atom1_id": "///B/596/O", "atom2_id": "///B/600/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 800, "atom1_serNum": 6617, "atom2_serNum": 7139, "donAcc_type": "acceptable", "distance": 2.773, "atom1_id": "///B/596/OD2", "atom2_id": "///B/656/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 801, "atom1_serNum": 6621, "atom2_serNum": 6651, "donAcc_type": "standard", "distance": 2.838, "atom1_id": "///B/597/O", "atom2_id": "///B/601/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 802, "atom1_serNum": 6629, "atom2_serNum": 6659, "donAcc_type": "standard", "distance": 2.986, "atom1_id": "///B/598/O", "atom2_id": "///B/602/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 803, "atom1_serNum": 6671, "atom2_serNum": 6704, "donAcc_type": "standard", "distance": 3.151, "atom1_id": "///B/603/O", "atom2_id": "///B/607/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 804, "atom1_serNum": 6674, "atom2_serNum": 6685, "donAcc_type": "standard", "distance": 3.361, "atom1_id": "///B/603/OD1", "atom2_id": "///B/605/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 805, "atom1_serNum": 6679, "atom2_serNum": 6712, "donAcc_type": "standard", "distance": 2.935, "atom1_id": "///B/604/O", "atom2_id": "///B/608/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 806, "atom1_serNum": 6688, "atom2_serNum": 6720, "donAcc_type": "standard", "distance": 3.043, "atom1_id": "///B/605/O", "atom2_id": "///B/609/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 807, "atom1_serNum": 6696, "atom2_serNum": 6753, "donAcc_type": "standard", "distance": 2.813, "atom1_id": "///B/606/O", "atom2_id": "///B/612/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 808, "atom1_serNum": 6723, "atom2_serNum": 6746, "donAcc_type": "standard", "distance": 3.282, "atom1_id": "///B/609/O", "atom2_id": "///B/612/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 809, "atom1_serNum": 6726, "atom2_serNum": 6728, "donAcc_type": "standard", "distance": 2.979, "atom1_id": "///B/609/OD1", "atom2_id": "///B/610/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 810, "atom1_serNum": 6726, "atom2_serNum": 6737, "donAcc_type": "standard", "distance": 3.266, "atom1_id": "///B/609/OD1", "atom2_id": "///B/611/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 811, "atom1_serNum": 6731, "atom2_serNum": 6754, "donAcc_type": "standard", "distance": 2.945, "atom1_id": "///B/610/O", "atom2_id": "///B/613/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 812, "atom1_serNum": 6749, "atom2_serNum": 6779, "donAcc_type": "standard", "distance": 2.847, "atom1_id": "///B/612/O", "atom2_id": "///B/616/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 813, "atom1_serNum": 6757, "atom2_serNum": 6787, "donAcc_type": "standard", "distance": 2.798, "atom1_id": "///B/613/O", "atom2_id": "///B/617/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 814, "atom1_serNum": 6762, "atom2_serNum": 7204, "donAcc_type": "standard", "distance": 3.316, "atom1_id": "///B/613/OE2", "atom2_id": "///B/664/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 815, "atom1_serNum": 6762, "atom2_serNum": 7237, "donAcc_type": "standard", "distance": 3.734, "atom1_id": "///B/613/OE2", "atom2_id": "///B/668/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 816, "atom1_serNum": 6766, "atom2_serNum": 6796, "donAcc_type": "standard", "distance": 2.788, "atom1_id": "///B/614/O", "atom2_id": "///B/618/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 817, "atom1_serNum": 6769, "atom2_serNum": 7204, "donAcc_type": "standard", "distance": 2.575, "atom1_id": "///B/614/OD1", "atom2_id": "///B/664/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 818, "atom1_serNum": 6774, "atom2_serNum": 6804, "donAcc_type": "standard", "distance": 2.855, "atom1_id": "///B/615/O", "atom2_id": "///B/619/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 819, "atom1_serNum": 6782, "atom2_serNum": 6812, "donAcc_type": "standard", "distance": 2.932, "atom1_id": "///B/616/O", "atom2_id": "///B/620/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 820, "atom1_serNum": 6790, "atom2_serNum": 6819, "donAcc_type": "standard", "distance": 2.811, "atom1_id": "///B/617/O", "atom2_id": "///B/621/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 821, "atom1_serNum": 6799, "atom2_serNum": 6827, "donAcc_type": "standard", "distance": 2.853, "atom1_id": "///B/618/O", "atom2_id": "///B/622/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 822, "atom1_serNum": 6803, "atom2_serNum": 6985, "donAcc_type": "acceptable", "distance": 2.462, "atom1_id": "///B/618/OD2", "atom2_id": "///B/639/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 823, "atom1_serNum": 6807, "atom2_serNum": 6834, "donAcc_type": "standard", "distance": 2.847, "atom1_id": "///B/619/O", "atom2_id": "///B/623/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 824, "atom1_serNum": 6815, "atom2_serNum": 6842, "donAcc_type": "standard", "distance": 2.803, "atom1_id": "///B/620/O", "atom2_id": "///B/624/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 825, "atom1_serNum": 6815, "atom2_serNum": 6847, "donAcc_type": "acceptable", "distance": 3.174, "atom1_id": "///B/620/O", "atom2_id": "///B/624/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 826, "atom1_serNum": 6822, "atom2_serNum": 6842, "donAcc_type": "standard", "distance": 2.954, "atom1_id": "///B/621/O", "atom2_id": "///B/624/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 827, "atom1_serNum": 6822, "atom2_serNum": 6849, "donAcc_type": "standard", "distance": 2.582, "atom1_id": "///B/621/O", "atom2_id": "///B/625/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 828, "atom1_serNum": 6830, "atom2_serNum": 6857, "donAcc_type": "standard", "distance": 3.231, "atom1_id": "///B/622/O", "atom2_id": "///B/626/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 829, "atom1_serNum": 6832, "atom2_serNum": 6948, "donAcc_type": "acceptable", "distance": 3.437, "atom1_id": "///B/622/OG1", "atom2_id": "///B/635/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 830, "atom1_serNum": 6837, "atom2_serNum": 7128, "donAcc_type": "standard", "distance": 3.211, "atom1_id": "///B/623/O", "atom2_id": "///B/656/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 831, "atom1_serNum": 6871, "atom2_serNum": 7126, "donAcc_type": "standard", "distance": 2.724, "atom1_id": "///B/627/O", "atom2_id": "///B/655/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 832, "atom1_serNum": 6875, "atom2_serNum": 7126, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///B/627/OE1", "atom2_id": "///B/655/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 833, "atom1_serNum": 6880, "atom2_serNum": 6913, "donAcc_type": "standard", "distance": 2.934, "atom1_id": "///B/628/O", "atom2_id": "///B/632/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 834, "atom1_serNum": 6883, "atom2_serNum": 6896, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///B/628/OD1", "atom2_id": "///B/630/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 835, "atom1_serNum": 6883, "atom2_serNum": 6905, "donAcc_type": "standard", "distance": 2.833, "atom1_id": "///B/628/OD1", "atom2_id": "///B/631/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 836, "atom1_serNum": 6888, "atom2_serNum": 6921, "donAcc_type": "standard", "distance": 2.916, "atom1_id": "///B/629/O", "atom2_id": "///B/633/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 837, "atom1_serNum": 6895, "atom2_serNum": 7127, "donAcc_type": "questionable", "distance": 3.079, "atom1_id": "///B/629/NH2", "atom2_id": "///B/655/NH2", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 838, "atom1_serNum": 6899, "atom2_serNum": 6930, "donAcc_type": "standard", "distance": 2.886, "atom1_id": "///B/630/O", "atom2_id": "///B/634/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 839, "atom1_serNum": 6908, "atom2_serNum": 6939, "donAcc_type": "standard", "distance": 2.943, "atom1_id": "///B/631/O", "atom2_id": "///B/635/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 840, "atom1_serNum": 6916, "atom2_serNum": 6950, "donAcc_type": "standard", "distance": 2.889, "atom1_id": "///B/632/O", "atom2_id": "///B/636/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 841, "atom1_serNum": 6924, "atom2_serNum": 6958, "donAcc_type": "standard", "distance": 2.975, "atom1_id": "///B/633/O", "atom2_id": "///B/637/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 842, "atom1_serNum": 6937, "atom2_serNum": 6966, "donAcc_type": "standard", "distance": 3.352, "atom1_id": "///B/634/OE1", "atom2_id": "///B/637/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 843, "atom1_serNum": 6942, "atom2_serNum": 6972, "donAcc_type": "acceptable", "distance": 3.461, "atom1_id": "///B/635/O", "atom2_id": "///B/638/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 844, "atom1_serNum": 6953, "atom2_serNum": 6974, "donAcc_type": "standard", "distance": 3.063, "atom1_id": "///B/636/O", "atom2_id": "///B/639/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 845, "atom1_serNum": 6961, "atom2_serNum": 6986, "donAcc_type": "standard", "distance": 3.103, "atom1_id": "///B/637/O", "atom2_id": "///B/640/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 846, "atom1_serNum": 6970, "atom2_serNum": 6997, "donAcc_type": "acceptable", "distance": 3.300, "atom1_id": "///B/638/O", "atom2_id": "///B/641/ND1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 847, "atom1_serNum": 6977, "atom2_serNum": 7001, "donAcc_type": "standard", "distance": 3.091, "atom1_id": "///B/639/O", "atom2_id": "///B/642/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 848, "atom1_serNum": 6989, "atom2_serNum": 7012, "donAcc_type": "questionable", "distance": 2.905, "atom1_id": "///B/640/O", "atom2_id": "///B/643/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 849, "atom1_serNum": 6991, "atom2_serNum": 6997, "donAcc_type": "acceptable", "distance": 2.992, "atom1_id": "///B/641/N", "atom2_id": "///B/641/ND1", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 850, "atom1_serNum": 7023, "atom2_serNum": 7052, "donAcc_type": "standard", "distance": 2.748, "atom1_id": "///B/644/O", "atom2_id": "///B/648/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 851, "atom1_serNum": 7031, "atom2_serNum": 7060, "donAcc_type": "standard", "distance": 2.901, "atom1_id": "///B/645/O", "atom2_id": "///B/649/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 852, "atom1_serNum": 7039, "atom2_serNum": 7069, "donAcc_type": "standard", "distance": 2.990, "atom1_id": "///B/646/O", "atom2_id": "///B/650/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 853, "atom1_serNum": 7044, "atom2_serNum": 7076, "donAcc_type": "standard", "distance": 3.273, "atom1_id": "///B/646/NZ", "atom2_id": "///B/650/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 854, "atom1_serNum": 7048, "atom2_serNum": 7078, "donAcc_type": "standard", "distance": 2.837, "atom1_id": "///B/647/O", "atom2_id": "///B/651/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 855, "atom1_serNum": 7055, "atom2_serNum": 7086, "donAcc_type": "standard", "distance": 2.905, "atom1_id": "///B/648/O", "atom2_id": "///B/652/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 856, "atom1_serNum": 7063, "atom2_serNum": 7095, "donAcc_type": "standard", "distance": 3.090, "atom1_id": "///B/649/O", "atom2_id": "///B/653/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 857, "atom1_serNum": 7115, "atom2_serNum": 7120, "donAcc_type": "standard", "distance": 3.755, "atom1_id": "///B/654/NH1", "atom2_id": "///B/655/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 858, "atom1_serNum": 7147, "atom2_serNum": 12971, "donAcc_type": "standard", "distance": 3.309, "atom1_id": "///B/658/N", "atom2_id": "///C/9/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 859, "atom1_serNum": 7159, "atom2_serNum": 12971, "donAcc_type": "standard", "distance": 3.182, "atom1_id": "///B/659/NE1", "atom2_id": "///C/9/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 860, "atom1_serNum": 7178, "atom2_serNum": 13015, "donAcc_type": "standard", "distance": 3.123, "atom1_id": "///B/661/NH1", "atom2_id": "///C/11/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 861, "atom1_serNum": 7191, "atom2_serNum": 7222, "donAcc_type": "standard", "distance": 3.039, "atom1_id": "///B/663/O", "atom2_id": "///B/667/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 862, "atom1_serNum": 7193, "atom2_serNum": 7214, "donAcc_type": "acceptable", "distance": 3.228, "atom1_id": "///B/663/OG", "atom2_id": "///B/666/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 863, "atom1_serNum": 7197, "atom2_serNum": 7230, "donAcc_type": "standard", "distance": 2.893, "atom1_id": "///B/664/O", "atom2_id": "///B/668/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 864, "atom1_serNum": 7197, "atom2_serNum": 7238, "donAcc_type": "standard", "distance": 3.400, "atom1_id": "///B/664/O", "atom2_id": "///B/669/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 865, "atom1_serNum": 7208, "atom2_serNum": 7238, "donAcc_type": "standard", "distance": 3.065, "atom1_id": "///B/665/O", "atom2_id": "///B/669/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 866, "atom1_serNum": 7208, "atom2_serNum": 7242, "donAcc_type": "standard", "distance": 2.802, "atom1_id": "///B/665/O", "atom2_id": "///B/670/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 867, "atom1_serNum": 7225, "atom2_serNum": 7321, "donAcc_type": "standard", "distance": 2.887, "atom1_id": "///B/667/O", "atom2_id": "///B/680/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 868, "atom1_serNum": 7236, "atom2_serNum": 7311, "donAcc_type": "acceptable", "distance": 2.807, "atom1_id": "///B/668/OD1", "atom2_id": "///B/678/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 869, "atom1_serNum": 7257, "atom2_serNum": 7296, "donAcc_type": "standard", "distance": 2.791, "atom1_id": "///B/671/NE", "atom2_id": "///B/676/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 870, "atom1_serNum": 7260, "atom2_serNum": 7336, "donAcc_type": "standard", "distance": 3.722, "atom1_id": "///B/671/NH2", "atom2_id": "///B/681/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 871, "atom1_serNum": 7261, "atom2_serNum": 7300, "donAcc_type": "standard", "distance": 2.939, "atom1_id": "///B/672/N", "atom2_id": "///B/677/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 872, "atom1_serNum": 7264, "atom2_serNum": 7293, "donAcc_type": "standard", "distance": 2.694, "atom1_id": "///B/672/O", "atom2_id": "///B/676/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 873, "atom1_serNum": 7267, "atom2_serNum": 7510, "donAcc_type": "standard", "distance": 2.745, "atom1_id": "///B/672/OD1", "atom2_id": "///B/703/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 874, "atom1_serNum": 7267, "atom2_serNum": 7515, "donAcc_type": "acceptable", "distance": 2.706, "atom1_id": "///B/672/OD1", "atom2_id": "///B/703/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 875, "atom1_serNum": 7268, "atom2_serNum": 7287, "donAcc_type": "standard", "distance": 3.012, "atom1_id": "///B/672/OD2", "atom2_id": "///B/675/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 876, "atom1_serNum": 7268, "atom2_serNum": 7292, "donAcc_type": "acceptable", "distance": 2.790, "atom1_id": "///B/672/OD2", "atom2_id": "///B/675/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 877, "atom1_serNum": 7269, "atom2_serNum": 7515, "donAcc_type": "acceptable", "distance": 2.744, "atom1_id": "///B/673/N", "atom2_id": "///B/703/OG1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 878, "atom1_serNum": 7305, "atom2_serNum": 7368, "donAcc_type": "standard", "distance": 2.907, "atom1_id": "///B/677/NZ", "atom2_id": "///B/685/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 879, "atom1_serNum": 7306, "atom2_serNum": 7336, "donAcc_type": "standard", "distance": 2.996, "atom1_id": "///B/678/N", "atom2_id": "///B/681/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 880, "atom1_serNum": 7309, "atom2_serNum": 7337, "donAcc_type": "standard", "distance": 3.137, "atom1_id": "///B/678/O", "atom2_id": "///B/682/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 881, "atom1_serNum": 7311, "atom2_serNum": 7329, "donAcc_type": "acceptable", "distance": 3.145, "atom1_id": "///B/678/OG1", "atom2_id": "///B/681/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 882, "atom1_serNum": 7316, "atom2_serNum": 7348, "donAcc_type": "standard", "distance": 2.956, "atom1_id": "///B/679/O", "atom2_id": "///B/683/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 883, "atom1_serNum": 7324, "atom2_serNum": 7356, "donAcc_type": "standard", "distance": 2.887, "atom1_id": "///B/680/O", "atom2_id": "///B/684/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 884, "atom1_serNum": 7332, "atom2_serNum": 7365, "donAcc_type": "standard", "distance": 2.987, "atom1_id": "///B/681/O", "atom2_id": "///B/685/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 885, "atom1_serNum": 7374, "atom2_serNum": 7394, "donAcc_type": "standard", "distance": 3.149, "atom1_id": "///B/686/O", "atom2_id": "///B/689/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 886, "atom1_serNum": 7374, "atom2_serNum": 7399, "donAcc_type": "standard", "distance": 3.164, "atom1_id": "///B/686/O", "atom2_id": "///B/690/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 887, "atom1_serNum": 7377, "atom2_serNum": 7417, "donAcc_type": "standard", "distance": 2.716, "atom1_id": "///B/686/OD1", "atom2_id": "///B/691/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 888, "atom1_serNum": 7378, "atom2_serNum": 7407, "donAcc_type": "standard", "distance": 3.032, "atom1_id": "///B/686/OD2", "atom2_id": "///B/691/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 889, "atom1_serNum": 7378, "atom2_serNum": 7414, "donAcc_type": "standard", "distance": 2.765, "atom1_id": "///B/686/OD2", "atom2_id": "///B/691/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 890, "atom1_serNum": 7416, "atom2_serNum": 7487, "donAcc_type": "standard", "distance": 2.797, "atom1_id": "///B/691/NH1", "atom2_id": "///B/699/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 891, "atom1_serNum": 7418, "atom2_serNum": 7452, "donAcc_type": "standard", "distance": 3.333, "atom1_id": "///B/692/N", "atom2_id": "///B/695/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 892, "atom1_serNum": 7421, "atom2_serNum": 7454, "donAcc_type": "standard", "distance": 2.756, "atom1_id": "///B/692/O", "atom2_id": "///B/696/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 893, "atom1_serNum": 7424, "atom2_serNum": 7445, "donAcc_type": "standard", "distance": 3.172, "atom1_id": "///B/692/OD1", "atom2_id": "///B/695/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 894, "atom1_serNum": 7425, "atom2_serNum": 13187, "donAcc_type": "standard", "distance": 3.207, "atom1_id": "///B/692/ND2", "atom2_id": "///C/19/O4'", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 895, "atom1_serNum": 7429, "atom2_serNum": 7462, "donAcc_type": "standard", "distance": 2.997, "atom1_id": "///B/693/O", "atom2_id": "///B/697/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 896, "atom1_serNum": 7440, "atom2_serNum": 7470, "donAcc_type": "standard", "distance": 3.238, "atom1_id": "///B/694/O", "atom2_id": "///B/698/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 897, "atom1_serNum": 7440, "atom2_serNum": 7476, "donAcc_type": "acceptable", "distance": 3.180, "atom1_id": "///B/694/O", "atom2_id": "///B/698/ND1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 898, "atom1_serNum": 7453, "atom2_serNum": 13189, "donAcc_type": "standard", "distance": 3.070, "atom1_id": "///B/695/NE2", "atom2_id": "///C/19/O3'", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 899, "atom1_serNum": 7453, "atom2_serNum": 13201, "donAcc_type": "standard", "distance": 2.850, "atom1_id": "///B/695/NE2", "atom2_id": "///C/20/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 900, "atom1_serNum": 7476, "atom2_serNum": 13206, "donAcc_type": "acceptable", "distance": 3.571, "atom1_id": "///B/698/ND1", "atom2_id": "///C/20/O4'", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 901, "atom1_serNum": 7483, "atom2_serNum": 7502, "donAcc_type": "standard", "distance": 3.129, "atom1_id": "///B/699/O", "atom2_id": "///B/702/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 902, "atom1_serNum": 7486, "atom2_serNum": 7488, "donAcc_type": "standard", "distance": 3.077, "atom1_id": "///B/699/OD1", "atom2_id": "///B/700/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 903, "atom1_serNum": 7486, "atom2_serNum": 7496, "donAcc_type": "standard", "distance": 3.010, "atom1_id": "///B/699/OD1", "atom2_id": "///B/701/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 904, "atom1_serNum": 7486, "atom2_serNum": 7501, "donAcc_type": "acceptable", "distance": 2.608, "atom1_id": "///B/699/OD1", "atom2_id": "///B/701/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 905, "atom1_serNum": 7494, "atom2_serNum": 7536, "donAcc_type": "standard", "distance": 2.959, "atom1_id": "///B/700/OD1", "atom2_id": "///B/705/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 906, "atom1_serNum": 7513, "atom2_serNum": 7546, "donAcc_type": "standard", "distance": 2.937, "atom1_id": "///B/703/O", "atom2_id": "///B/707/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 907, "atom1_serNum": 7520, "atom2_serNum": 7554, "donAcc_type": "standard", "distance": 2.870, "atom1_id": "///B/704/O", "atom2_id": "///B/708/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 908, "atom1_serNum": 7531, "atom2_serNum": 7562, "donAcc_type": "standard", "distance": 2.958, "atom1_id": "///B/705/O", "atom2_id": "///B/709/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 909, "atom1_serNum": 7540, "atom2_serNum": 7571, "donAcc_type": "standard", "distance": 2.959, "atom1_id": "///B/706/O", "atom2_id": "///B/710/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 910, "atom1_serNum": 7549, "atom2_serNum": 7580, "donAcc_type": "standard", "distance": 2.928, "atom1_id": "///B/707/O", "atom2_id": "///B/711/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 911, "atom1_serNum": 7557, "atom2_serNum": 7585, "donAcc_type": "standard", "distance": 3.377, "atom1_id": "///B/708/O", "atom2_id": "///B/712/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 912, "atom1_serNum": 7631, "atom2_serNum": 7695, "donAcc_type": "standard", "distance": 2.993, "atom1_id": "///B/718/OD2", "atom2_id": "///B/726/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 913, "atom1_serNum": 7635, "atom2_serNum": 7665, "donAcc_type": "standard", "distance": 2.772, "atom1_id": "///B/719/O", "atom2_id": "///B/723/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 914, "atom1_serNum": 7637, "atom2_serNum": 7656, "donAcc_type": "acceptable", "distance": 3.135, "atom1_id": "///B/719/OG", "atom2_id": "///B/722/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 915, "atom1_serNum": 7641, "atom2_serNum": 7675, "donAcc_type": "standard", "distance": 2.948, "atom1_id": "///B/720/O", "atom2_id": "///B/724/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 916, "atom1_serNum": 7649, "atom2_serNum": 7683, "donAcc_type": "standard", "distance": 2.862, "atom1_id": "///B/721/O", "atom2_id": "///B/725/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 917, "atom1_serNum": 7659, "atom2_serNum": 7688, "donAcc_type": "standard", "distance": 3.053, "atom1_id": "///B/722/O", "atom2_id": "///B/726/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 918, "atom1_serNum": 7678, "atom2_serNum": 7696, "donAcc_type": "standard", "distance": 3.205, "atom1_id": "///B/724/O", "atom2_id": "///B/727/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 919, "atom1_serNum": 7686, "atom2_serNum": 7747, "donAcc_type": "standard", "distance": 2.934, "atom1_id": "///B/725/O", "atom2_id": "///B/734/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 920, "atom1_serNum": 7699, "atom2_serNum": 7747, "donAcc_type": "standard", "distance": 2.775, "atom1_id": "///B/727/O", "atom2_id": "///B/734/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 921, "atom1_serNum": 7716, "atom2_serNum": 7718, "donAcc_type": "acceptable", "distance": 2.894, "atom1_id": "///B/730/O", "atom2_id": "///B/730/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 922, "atom1_serNum": 7716, "atom2_serNum": 7739, "donAcc_type": "standard", "distance": 3.081, "atom1_id": "///B/730/O", "atom2_id": "///B/734/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 923, "atom1_serNum": 7718, "atom2_serNum": 7731, "donAcc_type": "acceptable", "distance": 3.188, "atom1_id": "///B/730/OG", "atom2_id": "///B/733/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 924, "atom1_serNum": 7718, "atom2_serNum": 8000, "donAcc_type": "acceptable", "distance": 3.023, "atom1_id": "///B/730/OG", "atom2_id": "///B/766/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 925, "atom1_serNum": 7722, "atom2_serNum": 7748, "donAcc_type": "standard", "distance": 2.980, "atom1_id": "///B/731/O", "atom2_id": "///B/735/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 926, "atom1_serNum": 7729, "atom2_serNum": 7757, "donAcc_type": "standard", "distance": 3.057, "atom1_id": "///B/732/O", "atom2_id": "///B/736/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 927, "atom1_serNum": 7734, "atom2_serNum": 7761, "donAcc_type": "standard", "distance": 2.878, "atom1_id": "///B/733/O", "atom2_id": "///B/737/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 928, "atom1_serNum": 7742, "atom2_serNum": 7769, "donAcc_type": "standard", "distance": 3.014, "atom1_id": "///B/734/O", "atom2_id": "///B/738/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 929, "atom1_serNum": 7751, "atom2_serNum": 7777, "donAcc_type": "standard", "distance": 3.020, "atom1_id": "///B/735/O", "atom2_id": "///B/739/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 930, "atom1_serNum": 7756, "atom2_serNum": 10502, "donAcc_type": "standard", "distance": 2.715, "atom1_id": "///B/735/NZ", "atom2_id": "///B/1099/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 931, "atom1_serNum": 7760, "atom2_serNum": 7786, "donAcc_type": "standard", "distance": 2.873, "atom1_id": "///B/736/O", "atom2_id": "///B/740/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 932, "atom1_serNum": 7760, "atom2_serNum": 7791, "donAcc_type": "acceptable", "distance": 2.776, "atom1_id": "///B/736/O", "atom2_id": "///B/740/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 933, "atom1_serNum": 7764, "atom2_serNum": 7793, "donAcc_type": "standard", "distance": 3.010, "atom1_id": "///B/737/O", "atom2_id": "///B/741/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 934, "atom1_serNum": 7772, "atom2_serNum": 7800, "donAcc_type": "standard", "distance": 3.045, "atom1_id": "///B/738/O", "atom2_id": "///B/742/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 935, "atom1_serNum": 7780, "atom2_serNum": 7809, "donAcc_type": "standard", "distance": 2.895, "atom1_id": "///B/739/O", "atom2_id": "///B/743/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 936, "atom1_serNum": 7789, "atom2_serNum": 7816, "donAcc_type": "standard", "distance": 2.954, "atom1_id": "///B/740/O", "atom2_id": "///B/744/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 937, "atom1_serNum": 7796, "atom2_serNum": 7823, "donAcc_type": "standard", "distance": 2.991, "atom1_id": "///B/741/O", "atom2_id": "///B/745/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 938, "atom1_serNum": 7803, "atom2_serNum": 7831, "donAcc_type": "standard", "distance": 3.031, "atom1_id": "///B/742/O", "atom2_id": "///B/746/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 939, "atom1_serNum": 7812, "atom2_serNum": 7840, "donAcc_type": "standard", "distance": 2.912, "atom1_id": "///B/743/O", "atom2_id": "///B/747/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 940, "atom1_serNum": 7819, "atom2_serNum": 7848, "donAcc_type": "standard", "distance": 2.934, "atom1_id": "///B/744/O", "atom2_id": "///B/748/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 941, "atom1_serNum": 7826, "atom2_serNum": 7855, "donAcc_type": "standard", "distance": 3.008, "atom1_id": "///B/745/O", "atom2_id": "///B/749/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 942, "atom1_serNum": 7830, "atom2_serNum": 9363, "donAcc_type": "standard", "distance": 2.720, "atom1_id": "///B/745/OD2", "atom2_id": "///B/938/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 943, "atom1_serNum": 7834, "atom2_serNum": 7864, "donAcc_type": "standard", "distance": 2.882, "atom1_id": "///B/746/O", "atom2_id": "///B/750/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 944, "atom1_serNum": 7839, "atom2_serNum": 12524, "donAcc_type": "acceptable", "distance": 2.588, "atom1_id": "///B/746/OE2", "atom2_id": "///B/1351/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 945, "atom1_serNum": 7839, "atom2_serNum": 12533, "donAcc_type": "standard", "distance": 3.068, "atom1_id": "///B/746/OE2", "atom2_id": "///B/1353/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 946, "atom1_serNum": 7839, "atom2_serNum": 12538, "donAcc_type": "acceptable", "distance": 2.452, "atom1_id": "///B/746/OE2", "atom2_id": "///B/1353/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 947, "atom1_serNum": 7843, "atom2_serNum": 7871, "donAcc_type": "standard", "distance": 3.054, "atom1_id": "///B/747/O", "atom2_id": "///B/751/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 948, "atom1_serNum": 7851, "atom2_serNum": 7883, "donAcc_type": "standard", "distance": 2.938, "atom1_id": "///B/748/O", "atom2_id": "///B/753/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 949, "atom1_serNum": 7874, "atom2_serNum": 7894, "donAcc_type": "standard", "distance": 3.322, "atom1_id": "///B/751/O", "atom2_id": "///B/754/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 950, "atom1_serNum": 7912, "atom2_serNum": 9367, "donAcc_type": "standard", "distance": 2.658, "atom1_id": "///B/755/NZ", "atom2_id": "///B/939/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 951, "atom1_serNum": 7923, "atom2_serNum": 9493, "donAcc_type": "standard", "distance": 3.156, "atom1_id": "///B/757/O", "atom2_id": "///B/954/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 952, "atom1_serNum": 7937, "atom2_serNum": 9496, "donAcc_type": "standard", "distance": 2.884, "atom1_id": "///B/759/N", "atom2_id": "///B/954/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 953, "atom1_serNum": 7940, "atom2_serNum": 9509, "donAcc_type": "standard", "distance": 2.862, "atom1_id": "///B/759/O", "atom2_id": "///B/956/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 954, "atom1_serNum": 7952, "atom2_serNum": 9512, "donAcc_type": "standard", "distance": 2.832, "atom1_id": "///B/761/N", "atom2_id": "///B/956/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 955, "atom1_serNum": 7955, "atom2_serNum": 9524, "donAcc_type": "standard", "distance": 2.967, "atom1_id": "///B/761/O", "atom2_id": "///B/958/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 956, "atom1_serNum": 7967, "atom2_serNum": 9814, "donAcc_type": "standard", "distance": 2.879, "atom1_id": "///B/762/OE1", "atom2_id": "///B/990/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 957, "atom1_serNum": 7972, "atom2_serNum": 9257, "donAcc_type": "standard", "distance": 3.368, "atom1_id": "///B/763/O", "atom2_id": "///B/925/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 958, "atom1_serNum": 8010, "atom2_serNum": 8032, "donAcc_type": "acceptable", "distance": 3.495, "atom1_id": "///B/775/N", "atom2_id": "///B/777/OG", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 959, "atom1_serNum": 8013, "atom2_serNum": 8044, "donAcc_type": "standard", "distance": 3.293, "atom1_id": "///B/775/O", "atom2_id": "///B/779/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 960, "atom1_serNum": 8022, "atom2_serNum": 8053, "donAcc_type": "standard", "distance": 2.957, "atom1_id": "///B/776/O", "atom2_id": "///B/780/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 961, "atom1_serNum": 8025, "atom2_serNum": 8027, "donAcc_type": "standard", "distance": 2.506, "atom1_id": "///B/776/OD1", "atom2_id": "///B/777/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 962, "atom1_serNum": 8030, "atom2_serNum": 8064, "donAcc_type": "standard", "distance": 2.907, "atom1_id": "///B/777/O", "atom2_id": "///B/781/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 963, "atom1_serNum": 8036, "atom2_serNum": 8072, "donAcc_type": "standard", "distance": 2.916, "atom1_id": "///B/778/O", "atom2_id": "///B/782/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 964, "atom1_serNum": 8042, "atom2_serNum": 12849, "donAcc_type": "standard", "distance": 2.623, "atom1_id": "///B/778/NH1", "atom2_id": "///C/3/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 965, "atom1_serNum": 8043, "atom2_serNum": 12869, "donAcc_type": "standard", "distance": 3.247, "atom1_id": "///B/778/NH2", "atom2_id": "///C/4/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 966, "atom1_serNum": 8047, "atom2_serNum": 8081, "donAcc_type": "standard", "distance": 2.972, "atom1_id": "///B/779/O", "atom2_id": "///B/783/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 967, "atom1_serNum": 8056, "atom2_serNum": 8092, "donAcc_type": "standard", "distance": 2.992, "atom1_id": "///B/780/O", "atom2_id": "///B/784/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 968, "atom1_serNum": 8062, "atom2_serNum": 8269, "donAcc_type": "standard", "distance": 2.492, "atom1_id": "///B/780/NH1", "atom2_id": "///B/806/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 969, "atom1_serNum": 8067, "atom2_serNum": 8100, "donAcc_type": "standard", "distance": 2.864, "atom1_id": "///B/781/O", "atom2_id": "///B/785/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 970, "atom1_serNum": 8075, "atom2_serNum": 8109, "donAcc_type": "standard", "distance": 2.946, "atom1_id": "///B/782/O", "atom2_id": "///B/786/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 971, "atom1_serNum": 8080, "atom2_serNum": 12891, "donAcc_type": "standard", "distance": 3.270, "atom1_id": "///B/782/NZ", "atom2_id": "///C/5/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 972, "atom1_serNum": 8084, "atom2_serNum": 8118, "donAcc_type": "standard", "distance": 2.885, "atom1_id": "///B/783/O", "atom2_id": "///B/787/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 973, "atom1_serNum": 8090, "atom2_serNum": 8328, "donAcc_type": "acceptable", "distance": 3.654, "atom1_id": "///B/783/NH1", "atom2_id": "///B/812/OH", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 974, "atom1_serNum": 8095, "atom2_serNum": 8122, "donAcc_type": "standard", "distance": 2.914, "atom1_id": "///B/784/O", "atom2_id": "///B/788/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 975, "atom1_serNum": 8103, "atom2_serNum": 8130, "donAcc_type": "standard", "distance": 2.956, "atom1_id": "///B/785/O", "atom2_id": "///B/789/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 976, "atom1_serNum": 8112, "atom2_serNum": 8139, "donAcc_type": "standard", "distance": 2.840, "atom1_id": "///B/786/O", "atom2_id": "///B/790/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 977, "atom1_serNum": 8121, "atom2_serNum": 8148, "donAcc_type": "standard", "distance": 2.853, "atom1_id": "///B/787/O", "atom2_id": "///B/791/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 978, "atom1_serNum": 8125, "atom2_serNum": 8156, "donAcc_type": "standard", "distance": 2.714, "atom1_id": "///B/788/O", "atom2_id": "///B/792/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 979, "atom1_serNum": 8125, "atom2_serNum": 8160, "donAcc_type": "standard", "distance": 2.880, "atom1_id": "///B/788/O", "atom2_id": "///B/793/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 980, "atom1_serNum": 8165, "atom2_serNum": 8175, "donAcc_type": "acceptable", "distance": 3.288, "atom1_id": "///B/793/OG", "atom2_id": "///B/795/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 981, "atom1_serNum": 8165, "atom2_serNum": 8384, "donAcc_type": "acceptable", "distance": 2.663, "atom1_id": "///B/793/OG", "atom2_id": "///B/818/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 982, "atom1_serNum": 8169, "atom2_serNum": 8191, "donAcc_type": "standard", "distance": 3.017, "atom1_id": "///B/794/O", "atom2_id": "///B/797/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 983, "atom1_serNum": 8169, "atom2_serNum": 8200, "donAcc_type": "standard", "distance": 2.972, "atom1_id": "///B/794/O", "atom2_id": "///B/798/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 984, "atom1_serNum": 8178, "atom2_serNum": 8209, "donAcc_type": "standard", "distance": 2.926, "atom1_id": "///B/795/O", "atom2_id": "///B/799/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 985, "atom1_serNum": 8233, "atom2_serNum": 8264, "donAcc_type": "standard", "distance": 3.259, "atom1_id": "///B/802/N", "atom2_id": "///B/805/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 986, "atom1_serNum": 8236, "atom2_serNum": 8257, "donAcc_type": "standard", "distance": 3.002, "atom1_id": "///B/802/O", "atom2_id": "///B/805/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 987, "atom1_serNum": 8242, "atom2_serNum": 8248, "donAcc_type": "standard", "distance": 2.808, "atom1_id": "///B/803/N", "atom2_id": "///B/803/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 988, "atom1_serNum": 8245, "atom2_serNum": 8266, "donAcc_type": "standard", "distance": 3.081, "atom1_id": "///B/803/O", "atom2_id": "///B/806/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 989, "atom1_serNum": 8253, "atom2_serNum": 8274, "donAcc_type": "standard", "distance": 2.974, "atom1_id": "///B/804/O", "atom2_id": "///B/807/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 990, "atom1_serNum": 8260, "atom2_serNum": 8283, "donAcc_type": "standard", "distance": 2.956, "atom1_id": "///B/805/O", "atom2_id": "///B/808/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 991, "atom1_serNum": 8286, "atom2_serNum": 8317, "donAcc_type": "standard", "distance": 3.007, "atom1_id": "///B/808/O", "atom2_id": "///B/812/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 992, "atom1_serNum": 8289, "atom2_serNum": 8291, "donAcc_type": "standard", "distance": 2.863, "atom1_id": "///B/808/OD1", "atom2_id": "///B/809/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 993, "atom1_serNum": 8294, "atom2_serNum": 8329, "donAcc_type": "standard", "distance": 2.960, "atom1_id": "///B/809/O", "atom2_id": "///B/813/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 994, "atom1_serNum": 8299, "atom2_serNum": 8686, "donAcc_type": "standard", "distance": 2.673, "atom1_id": "///B/809/OE2", "atom2_id": "///B/855/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 995, "atom1_serNum": 8303, "atom2_serNum": 8337, "donAcc_type": "standard", "distance": 2.837, "atom1_id": "///B/810/O", "atom2_id": "///B/814/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 996, "atom1_serNum": 8308, "atom2_serNum": 8508, "donAcc_type": "standard", "distance": 3.394, "atom1_id": "///B/810/NZ", "atom2_id": "///B/833/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 997, "atom1_serNum": 8308, "atom2_serNum": 8530, "donAcc_type": "standard", "distance": 2.927, "atom1_id": "///B/810/NZ", "atom2_id": "///B/836/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 998, "atom1_serNum": 8312, "atom2_serNum": 8349, "donAcc_type": "standard", "distance": 3.024, "atom1_id": "///B/811/O", "atom2_id": "///B/815/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 999, "atom1_serNum": 8320, "atom2_serNum": 8361, "donAcc_type": "standard", "distance": 2.954, "atom1_id": "///B/812/O", "atom2_id": "///B/816/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1000, "atom1_serNum": 8332, "atom2_serNum": 8369, "donAcc_type": "standard", "distance": 2.920, "atom1_id": "///B/813/O", "atom2_id": "///B/817/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1001, "atom1_serNum": 8340, "atom2_serNum": 8378, "donAcc_type": "standard", "distance": 3.197, "atom1_id": "///B/814/O", "atom2_id": "///B/818/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1002, "atom1_serNum": 8340, "atom2_serNum": 8386, "donAcc_type": "standard", "distance": 2.684, "atom1_id": "///B/814/O", "atom2_id": "///B/819/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1003, "atom1_serNum": 8348, "atom2_serNum": 8465, "donAcc_type": "acceptable", "distance": 3.337, "atom1_id": "///B/814/OH", "atom2_id": "///B/828/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1004, "atom1_serNum": 8352, "atom2_serNum": 8378, "donAcc_type": "standard", "distance": 3.144, "atom1_id": "///B/815/O", "atom2_id": "///B/818/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1005, "atom1_serNum": 8372, "atom2_serNum": 8390, "donAcc_type": "standard", "distance": 3.029, "atom1_id": "///B/817/O", "atom2_id": "///B/820/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1006, "atom1_serNum": 8372, "atom2_serNum": 8903, "donAcc_type": "acceptable", "distance": 2.302, "atom1_id": "///B/817/O", "atom2_id": "///B/882/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1007, "atom1_serNum": 8376, "atom2_serNum": 8694, "donAcc_type": "standard", "distance": 2.583, "atom1_id": "///B/817/OE1", "atom2_id": "///B/857/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1008, "atom1_serNum": 8377, "atom2_serNum": 8393, "donAcc_type": "standard", "distance": 2.754, "atom1_id": "///B/817/NE2", "atom2_id": "///B/820/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1009, "atom1_serNum": 8377, "atom2_serNum": 8697, "donAcc_type": "standard", "distance": 2.704, "atom1_id": "///B/817/NE2", "atom2_id": "///B/857/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1010, "atom1_serNum": 8389, "atom2_serNum": 8462, "donAcc_type": "standard", "distance": 2.987, "atom1_id": "///B/819/O", "atom2_id": "///B/828/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1011, "atom1_serNum": 8400, "atom2_serNum": 8442, "donAcc_type": "standard", "distance": 2.811, "atom1_id": "///B/820/NH2", "atom2_id": "///B/825/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1012, "atom1_serNum": 8401, "atom2_serNum": 8447, "donAcc_type": "standard", "distance": 3.172, "atom1_id": "///B/821/N", "atom2_id": "///B/826/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1013, "atom1_serNum": 8407, "atom2_serNum": 8409, "donAcc_type": "standard", "distance": 2.613, "atom1_id": "///B/821/OD1", "atom2_id": "///B/822/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1014, "atom1_serNum": 8407, "atom2_serNum": 8417, "donAcc_type": "standard", "distance": 2.762, "atom1_id": "///B/821/OD1", "atom2_id": "///B/823/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1015, "atom1_serNum": 8407, "atom2_serNum": 8707, "donAcc_type": "acceptable", "distance": 2.624, "atom1_id": "///B/821/OD1", "atom2_id": "///B/858/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1016, "atom1_serNum": 8408, "atom2_serNum": 8452, "donAcc_type": "standard", "distance": 3.003, "atom1_id": "///B/821/OD2", "atom2_id": "///B/826/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1017, "atom1_serNum": 8408, "atom2_serNum": 8707, "donAcc_type": "acceptable", "distance": 2.927, "atom1_id": "///B/821/OD2", "atom2_id": "///B/858/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1018, "atom1_serNum": 8408, "atom2_serNum": 8709, "donAcc_type": "standard", "distance": 3.276, "atom1_id": "///B/821/OD2", "atom2_id": "///B/859/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1019, "atom1_serNum": 8409, "atom2_serNum": 8697, "donAcc_type": "standard", "distance": 3.419, "atom1_id": "///B/822/N", "atom2_id": "///B/857/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1020, "atom1_serNum": 8412, "atom2_serNum": 8912, "donAcc_type": "standard", "distance": 2.873, "atom1_id": "///B/822/O", "atom2_id": "///B/883/NE1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1021, "atom1_serNum": 8428, "atom2_serNum": 8561, "donAcc_type": "acceptable", "distance": 2.991, "atom1_id": "///B/823/OH", "atom2_id": "///B/839/OD2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1022, "atom1_serNum": 8432, "atom2_serNum": 8444, "donAcc_type": "standard", "distance": 2.773, "atom1_id": "///B/824/O", "atom2_id": "///B/826/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1023, "atom1_serNum": 8470, "atom2_serNum": 8538, "donAcc_type": "acceptable", "distance": 2.768, "atom1_id": "///B/829/N", "atom2_id": "///B/836/OH", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1024, "atom1_serNum": 8473, "atom2_serNum": 8494, "donAcc_type": "standard", "distance": 3.168, "atom1_id": "///B/829/O", "atom2_id": "///B/832/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1025, "atom1_serNum": 8476, "atom2_serNum": 8478, "donAcc_type": "standard", "distance": 2.908, "atom1_id": "///B/829/OD1", "atom2_id": "///B/830/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1026, "atom1_serNum": 8476, "atom2_serNum": 8486, "donAcc_type": "standard", "distance": 2.916, "atom1_id": "///B/829/OD1", "atom2_id": "///B/831/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1027, "atom1_serNum": 8481, "atom2_serNum": 8505, "donAcc_type": "standard", "distance": 3.583, "atom1_id": "///B/830/O", "atom2_id": "///B/833/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1028, "atom1_serNum": 8486, "atom2_serNum": 8492, "donAcc_type": "standard", "distance": 2.640, "atom1_id": "///B/831/N", "atom2_id": "///B/831/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1029, "atom1_serNum": 8497, "atom2_serNum": 8519, "donAcc_type": "standard", "distance": 2.903, "atom1_id": "///B/832/O", "atom2_id": "///B/835/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1030, "atom1_serNum": 8501, "atom2_serNum": 8526, "donAcc_type": "standard", "distance": 2.951, "atom1_id": "///B/832/NE", "atom2_id": "///B/835/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1031, "atom1_serNum": 8508, "atom2_serNum": 8527, "donAcc_type": "standard", "distance": 3.154, "atom1_id": "///B/833/O", "atom2_id": "///B/836/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1032, "atom1_serNum": 8539, "atom2_serNum": 8705, "donAcc_type": "standard", "distance": 2.872, "atom1_id": "///B/837/N", "atom2_id": "///B/858/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1033, "atom1_serNum": 8542, "atom2_serNum": 8702, "donAcc_type": "standard", "distance": 2.959, "atom1_id": "///B/837/O", "atom2_id": "///B/858/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1034, "atom1_serNum": 8546, "atom2_serNum": 8726, "donAcc_type": "standard", "distance": 2.734, "atom1_id": "///B/837/OD2", "atom2_id": "///B/861/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1035, "atom1_serNum": 8554, "atom2_serNum": 8690, "donAcc_type": "standard", "distance": 2.844, "atom1_id": "///B/839/N", "atom2_id": "///B/856/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1036, "atom1_serNum": 8557, "atom2_serNum": 8687, "donAcc_type": "standard", "distance": 2.908, "atom1_id": "///B/839/O", "atom2_id": "///B/856/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1037, "atom1_serNum": 8561, "atom2_serNum": 8758, "donAcc_type": "standard", "distance": 2.593, "atom1_id": "///B/839/OD2", "atom2_id": "///B/864/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1038, "atom1_serNum": 8565, "atom2_serNum": 8761, "donAcc_type": "standard", "distance": 3.056, "atom1_id": "///B/840/O", "atom2_id": "///B/864/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1039, "atom1_serNum": 8567, "atom2_serNum": 8673, "donAcc_type": "standard", "distance": 2.856, "atom1_id": "///B/841/N", "atom2_id": "///B/854/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1040, "atom1_serNum": 8570, "atom2_serNum": 8761, "donAcc_type": "standard", "distance": 2.630, "atom1_id": "///B/841/O", "atom2_id": "///B/864/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1041, "atom1_serNum": 8575, "atom2_serNum": 8676, "donAcc_type": "standard", "distance": 3.244, "atom1_id": "///B/842/N", "atom2_id": "///B/854/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1042, "atom1_serNum": 8578, "atom2_serNum": 8677, "donAcc_type": "standard", "distance": 3.286, "atom1_id": "///B/842/O", "atom2_id": "///B/854/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1043, "atom1_serNum": 8585, "atom2_serNum": 8604, "donAcc_type": "standard", "distance": 2.976, "atom1_id": "///B/843/O", "atom2_id": "///B/846/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1044, "atom1_serNum": 8585, "atom2_serNum": 8615, "donAcc_type": "standard", "distance": 2.997, "atom1_id": "///B/843/O", "atom2_id": "///B/847/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1045, "atom1_serNum": 8601, "atom2_serNum": 9216, "donAcc_type": "standard", "distance": 3.218, "atom1_id": "///B/845/O", "atom2_id": "///B/920/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1046, "atom1_serNum": 8607, "atom2_serNum": 9216, "donAcc_type": "standard", "distance": 2.499, "atom1_id": "///B/846/O", "atom2_id": "///B/920/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1047, "atom1_serNum": 8618, "atom2_serNum": 8632, "donAcc_type": "standard", "distance": 2.770, "atom1_id": "///B/847/O", "atom2_id": "///B/849/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1048, "atom1_serNum": 8635, "atom2_serNum": 8677, "donAcc_type": "standard", "distance": 3.272, "atom1_id": "///B/849/O", "atom2_id": "///B/854/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1049, "atom1_serNum": 8638, "atom2_serNum": 8648, "donAcc_type": "standard", "distance": 2.933, "atom1_id": "///B/849/OD1", "atom2_id": "///B/851/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1050, "atom1_serNum": 8638, "atom2_serNum": 8653, "donAcc_type": "acceptable", "distance": 2.600, "atom1_id": "///B/849/OD1", "atom2_id": "///B/851/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1051, "atom1_serNum": 8639, "atom2_serNum": 9017, "donAcc_type": "standard", "distance": 3.227, "atom1_id": "///B/849/OD2", "atom2_id": "///B/895/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1052, "atom1_serNum": 8639, "atom2_serNum": 9018, "donAcc_type": "standard", "distance": 2.550, "atom1_id": "///B/849/OD2", "atom2_id": "///B/895/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1053, "atom1_serNum": 8640, "atom2_serNum": 8646, "donAcc_type": "standard", "distance": 2.770, "atom1_id": "///B/850/N", "atom2_id": "///B/850/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1054, "atom1_serNum": 8643, "atom2_serNum": 8686, "donAcc_type": "standard", "distance": 2.869, "atom1_id": "///B/850/O", "atom2_id": "///B/855/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1055, "atom1_serNum": 8651, "atom2_serNum": 8670, "donAcc_type": "standard", "distance": 2.969, "atom1_id": "///B/851/O", "atom2_id": "///B/854/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1056, "atom1_serNum": 8651, "atom2_serNum": 8678, "donAcc_type": "standard", "distance": 3.231, "atom1_id": "///B/851/O", "atom2_id": "///B/855/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1057, "atom1_serNum": 8657, "atom2_serNum": 9027, "donAcc_type": "standard", "distance": 2.858, "atom1_id": "///B/852/O", "atom2_id": "///B/896/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1058, "atom1_serNum": 8668, "atom2_serNum": 8997, "donAcc_type": "acceptable", "distance": 2.451, "atom1_id": "///B/853/OD1", "atom2_id": "///B/893/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1059, "atom1_serNum": 8669, "atom2_serNum": 9017, "donAcc_type": "standard", "distance": 2.671, "atom1_id": "///B/853/OD2", "atom2_id": "///B/895/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1060, "atom1_serNum": 8681, "atom2_serNum": 9027, "donAcc_type": "standard", "distance": 3.002, "atom1_id": "///B/855/O", "atom2_id": "///B/896/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1061, "atom1_serNum": 8723, "atom2_serNum": 8743, "donAcc_type": "standard", "distance": 3.036, "atom1_id": "///B/860/O", "atom2_id": "///B/863/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1062, "atom1_serNum": 8729, "atom2_serNum": 8751, "donAcc_type": "standard", "distance": 2.960, "atom1_id": "///B/861/O", "atom2_id": "///B/864/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1063, "atom1_serNum": 8732, "atom2_serNum": 8734, "donAcc_type": "standard", "distance": 2.713, "atom1_id": "///B/861/OD1", "atom2_id": "///B/862/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1064, "atom1_serNum": 8737, "atom2_serNum": 8762, "donAcc_type": "standard", "distance": 3.115, "atom1_id": "///B/862/O", "atom2_id": "///B/865/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1065, "atom1_serNum": 8754, "atom2_serNum": 8811, "donAcc_type": "standard", "distance": 3.233, "atom1_id": "///B/864/O", "atom2_id": "///B/872/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1066, "atom1_serNum": 8760, "atom2_serNum": 8769, "donAcc_type": "standard", "distance": 2.957, "atom1_id": "///B/864/NH1", "atom2_id": "///B/866/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1067, "atom1_serNum": 8760, "atom2_serNum": 8792, "donAcc_type": "standard", "distance": 2.724, "atom1_id": "///B/864/NH1", "atom2_id": "///B/869/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1068, "atom1_serNum": 8781, "atom2_serNum": 8788, "donAcc_type": "standard", "distance": 2.795, "atom1_id": "///B/868/N", "atom2_id": "///B/868/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1069, "atom1_serNum": 8795, "atom2_serNum": 9112, "donAcc_type": "standard", "distance": 2.982, "atom1_id": "///B/869/OD1", "atom2_id": "///B/908/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1070, "atom1_serNum": 8814, "atom2_serNum": 8842, "donAcc_type": "standard", "distance": 3.218, "atom1_id": "///B/872/O", "atom2_id": "///B/876/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1071, "atom1_serNum": 8820, "atom2_serNum": 8849, "donAcc_type": "standard", "distance": 2.901, "atom1_id": "///B/873/O", "atom2_id": "///B/877/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1072, "atom1_serNum": 8829, "atom2_serNum": 8858, "donAcc_type": "standard", "distance": 2.952, "atom1_id": "///B/874/O", "atom2_id": "///B/878/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1073, "atom1_serNum": 8838, "atom2_serNum": 8867, "donAcc_type": "standard", "distance": 2.917, "atom1_id": "///B/875/O", "atom2_id": "///B/879/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1074, "atom1_serNum": 8845, "atom2_serNum": 8875, "donAcc_type": "standard", "distance": 2.912, "atom1_id": "///B/876/O", "atom2_id": "///B/880/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1075, "atom1_serNum": 8870, "atom2_serNum": 8904, "donAcc_type": "standard", "distance": 2.922, "atom1_id": "///B/879/O", "atom2_id": "///B/883/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1076, "atom1_serNum": 8878, "atom2_serNum": 8918, "donAcc_type": "standard", "distance": 2.867, "atom1_id": "///B/880/O", "atom2_id": "///B/884/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1077, "atom1_serNum": 8883, "atom2_serNum": 9092, "donAcc_type": "standard", "distance": 2.639, "atom1_id": "///B/880/NZ", "atom2_id": "///B/904/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1078, "atom1_serNum": 8887, "atom2_serNum": 8929, "donAcc_type": "standard", "distance": 2.968, "atom1_id": "///B/881/O", "atom2_id": "///B/885/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1079, "atom1_serNum": 8895, "atom2_serNum": 8938, "donAcc_type": "standard", "distance": 2.974, "atom1_id": "///B/882/O", "atom2_id": "///B/886/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1080, "atom1_serNum": 8907, "atom2_serNum": 8946, "donAcc_type": "standard", "distance": 2.846, "atom1_id": "///B/883/O", "atom2_id": "///B/887/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1081, "atom1_serNum": 8921, "atom2_serNum": 8954, "donAcc_type": "standard", "distance": 2.949, "atom1_id": "///B/884/O", "atom2_id": "///B/888/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1082, "atom1_serNum": 8932, "atom2_serNum": 8962, "donAcc_type": "standard", "distance": 3.180, "atom1_id": "///B/885/O", "atom2_id": "///B/889/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1083, "atom1_serNum": 8941, "atom2_serNum": 8976, "donAcc_type": "standard", "distance": 2.920, "atom1_id": "///B/886/O", "atom2_id": "///B/891/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1084, "atom1_serNum": 8941, "atom2_serNum": 8984, "donAcc_type": "standard", "distance": 3.318, "atom1_id": "///B/886/O", "atom2_id": "///B/892/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1085, "atom1_serNum": 8949, "atom2_serNum": 8967, "donAcc_type": "standard", "distance": 2.855, "atom1_id": "///B/887/O", "atom2_id": "///B/890/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1086, "atom1_serNum": 8995, "atom2_serNum": 9028, "donAcc_type": "standard", "distance": 3.028, "atom1_id": "///B/893/O", "atom2_id": "///B/897/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1087, "atom1_serNum": 8997, "atom2_serNum": 9019, "donAcc_type": "acceptable", "distance": 3.302, "atom1_id": "///B/893/OG1", "atom2_id": "///B/896/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1088, "atom1_serNum": 9002, "atom2_serNum": 9039, "donAcc_type": "standard", "distance": 2.854, "atom1_id": "///B/894/O", "atom2_id": "///B/898/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1089, "atom1_serNum": 9007, "atom2_serNum": 9045, "donAcc_type": "standard", "distance": 3.070, "atom1_id": "///B/894/NE2", "atom2_id": "///B/898/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1090, "atom1_serNum": 9007, "atom2_serNum": 9046, "donAcc_type": "standard", "distance": 3.096, "atom1_id": "///B/894/NE2", "atom2_id": "///B/898/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1091, "atom1_serNum": 9011, "atom2_serNum": 9047, "donAcc_type": "standard", "distance": 2.893, "atom1_id": "///B/895/O", "atom2_id": "///B/899/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1092, "atom1_serNum": 9022, "atom2_serNum": 9055, "donAcc_type": "standard", "distance": 2.928, "atom1_id": "///B/896/O", "atom2_id": "///B/900/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1093, "atom1_serNum": 9031, "atom2_serNum": 9063, "donAcc_type": "standard", "distance": 2.998, "atom1_id": "///B/897/O", "atom2_id": "///B/901/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1094, "atom1_serNum": 9031, "atom2_serNum": 9068, "donAcc_type": "acceptable", "distance": 2.680, "atom1_id": "///B/897/O", "atom2_id": "///B/901/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1095, "atom1_serNum": 9042, "atom2_serNum": 9070, "donAcc_type": "standard", "distance": 3.065, "atom1_id": "///B/898/O", "atom2_id": "///B/902/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1096, "atom1_serNum": 9042, "atom2_serNum": 9103, "donAcc_type": "standard", "distance": 2.363, "atom1_id": "///B/898/O", "atom2_id": "///B/905/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1097, "atom1_serNum": 9068, "atom2_serNum": 9103, "donAcc_type": "acceptable", "distance": 3.294, "atom1_id": "///B/901/OG1", "atom2_id": "///B/905/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1098, "atom1_serNum": 9073, "atom2_serNum": 9093, "donAcc_type": "standard", "distance": 2.904, "atom1_id": "///B/902/O", "atom2_id": "///B/905/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1099, "atom1_serNum": 9073, "atom2_serNum": 9108, "donAcc_type": "standard", "distance": 2.728, "atom1_id": "///B/902/O", "atom2_id": "///B/907/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1100, "atom1_serNum": 9082, "atom2_serNum": 9104, "donAcc_type": "standard", "distance": 3.112, "atom1_id": "///B/903/O", "atom2_id": "///B/906/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1101, "atom1_serNum": 9111, "atom2_serNum": 9120, "donAcc_type": "standard", "distance": 3.421, "atom1_id": "///B/907/O", "atom2_id": "///B/909/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1102, "atom1_serNum": 9120, "atom2_serNum": 9150, "donAcc_type": "standard", "distance": 2.952, "atom1_id": "///B/909/N", "atom2_id": "///B/912/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1103, "atom1_serNum": 9123, "atom2_serNum": 9151, "donAcc_type": "standard", "distance": 3.292, "atom1_id": "///B/909/O", "atom2_id": "///B/913/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1104, "atom1_serNum": 9129, "atom2_serNum": 9160, "donAcc_type": "standard", "distance": 2.970, "atom1_id": "///B/910/O", "atom2_id": "///B/914/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1105, "atom1_serNum": 9133, "atom2_serNum": 9159, "donAcc_type": "standard", "distance": 3.283, "atom1_id": "///B/910/OE1", "atom2_id": "///B/913/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1106, "atom1_serNum": 9138, "atom2_serNum": 9165, "donAcc_type": "standard", "distance": 2.903, "atom1_id": "///B/911/O", "atom2_id": "///B/915/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1107, "atom1_serNum": 9146, "atom2_serNum": 9169, "donAcc_type": "standard", "distance": 2.900, "atom1_id": "///B/912/O", "atom2_id": "///B/916/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1108, "atom1_serNum": 9154, "atom2_serNum": 9180, "donAcc_type": "standard", "distance": 3.025, "atom1_id": "///B/913/O", "atom2_id": "///B/917/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1109, "atom1_serNum": 9163, "atom2_serNum": 9188, "donAcc_type": "standard", "distance": 2.964, "atom1_id": "///B/914/O", "atom2_id": "///B/918/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1110, "atom1_serNum": 9168, "atom2_serNum": 9197, "donAcc_type": "standard", "distance": 2.838, "atom1_id": "///B/915/O", "atom2_id": "///B/919/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1111, "atom1_serNum": 9172, "atom2_serNum": 9208, "donAcc_type": "standard", "distance": 2.976, "atom1_id": "///B/916/O", "atom2_id": "///B/920/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1112, "atom1_serNum": 9183, "atom2_serNum": 9217, "donAcc_type": "standard", "distance": 3.081, "atom1_id": "///B/917/O", "atom2_id": "///B/921/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1113, "atom1_serNum": 9191, "atom2_serNum": 9217, "donAcc_type": "standard", "distance": 3.032, "atom1_id": "///B/918/O", "atom2_id": "///B/921/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1114, "atom1_serNum": 9191, "atom2_serNum": 9225, "donAcc_type": "standard", "distance": 2.652, "atom1_id": "///B/918/O", "atom2_id": "///B/922/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1115, "atom1_serNum": 9196, "atom2_serNum": 9942, "donAcc_type": "standard", "distance": 2.468, "atom1_id": "///B/918/NZ", "atom2_id": "///B/1007/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1116, "atom1_serNum": 9200, "atom2_serNum": 9540, "donAcc_type": "standard", "distance": 2.989, "atom1_id": "///B/919/O", "atom2_id": "///B/959/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1117, "atom1_serNum": 9207, "atom2_serNum": 13099, "donAcc_type": "standard", "distance": 2.543, "atom1_id": "///B/919/NH2", "atom2_id": "///C/15/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 1118, "atom1_serNum": 9239, "atom2_serNum": 9241, "donAcc_type": "standard", "distance": 3.322, "atom1_id": "///B/923/OE1", "atom2_id": "///B/924/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1119, "atom1_serNum": 9240, "atom2_serNum": 9257, "donAcc_type": "standard", "distance": 2.716, "atom1_id": "///B/923/OE2", "atom2_id": "///B/925/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1120, "atom1_serNum": 9251, "atom2_serNum": 9281, "donAcc_type": "acceptable", "distance": 2.692, "atom1_id": "///B/925/O", "atom2_id": "///B/928/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1121, "atom1_serNum": 9251, "atom2_serNum": 9283, "donAcc_type": "standard", "distance": 3.311, "atom1_id": "///B/925/O", "atom2_id": "///B/929/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1122, "atom1_serNum": 9259, "atom2_serNum": 13054, "donAcc_type": "standard", "distance": 2.627, "atom1_id": "///B/926/N", "atom2_id": "///C/13/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 1123, "atom1_serNum": 9262, "atom2_serNum": 9292, "donAcc_type": "standard", "distance": 2.936, "atom1_id": "///B/926/O", "atom2_id": "///B/930/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1124, "atom1_serNum": 9271, "atom2_serNum": 9302, "donAcc_type": "standard", "distance": 2.989, "atom1_id": "///B/927/O", "atom2_id": "///B/931/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1125, "atom1_serNum": 9279, "atom2_serNum": 9309, "donAcc_type": "standard", "distance": 2.943, "atom1_id": "///B/928/O", "atom2_id": "///B/932/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1126, "atom1_serNum": 9286, "atom2_serNum": 9314, "donAcc_type": "standard", "distance": 2.823, "atom1_id": "///B/929/O", "atom2_id": "///B/933/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1127, "atom1_serNum": 9295, "atom2_serNum": 9323, "donAcc_type": "standard", "distance": 2.912, "atom1_id": "///B/930/O", "atom2_id": "///B/934/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1128, "atom1_serNum": 9301, "atom2_serNum": 13035, "donAcc_type": "standard", "distance": 3.520, "atom1_id": "///B/930/NE2", "atom2_id": "///C/12/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 1129, "atom1_serNum": 9305, "atom2_serNum": 9331, "donAcc_type": "standard", "distance": 3.020, "atom1_id": "///B/931/O", "atom2_id": "///B/935/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1130, "atom1_serNum": 9312, "atom2_serNum": 9339, "donAcc_type": "standard", "distance": 2.859, "atom1_id": "///B/932/O", "atom2_id": "///B/936/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1131, "atom1_serNum": 9317, "atom2_serNum": 9347, "donAcc_type": "standard", "distance": 2.882, "atom1_id": "///B/933/O", "atom2_id": "///B/937/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1132, "atom1_serNum": 9317, "atom2_serNum": 9352, "donAcc_type": "acceptable", "distance": 2.891, "atom1_id": "///B/933/O", "atom2_id": "///B/937/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1133, "atom1_serNum": 9326, "atom2_serNum": 9352, "donAcc_type": "acceptable", "distance": 3.048, "atom1_id": "///B/934/O", "atom2_id": "///B/937/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1134, "atom1_serNum": 9326, "atom2_serNum": 9353, "donAcc_type": "standard", "distance": 3.003, "atom1_id": "///B/934/O", "atom2_id": "///B/938/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1135, "atom1_serNum": 9334, "atom2_serNum": 9364, "donAcc_type": "standard", "distance": 2.916, "atom1_id": "///B/935/O", "atom2_id": "///B/939/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1136, "atom1_serNum": 9342, "atom2_serNum": 9372, "donAcc_type": "standard", "distance": 2.892, "atom1_id": "///B/936/O", "atom2_id": "///B/940/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1137, "atom1_serNum": 9345, "atom2_serNum": 9379, "donAcc_type": "standard", "distance": 2.643, "atom1_id": "///B/936/OD1", "atom2_id": "///B/940/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1138, "atom1_serNum": 9345, "atom2_serNum": 9475, "donAcc_type": "standard", "distance": 2.535, "atom1_id": "///B/936/OD1", "atom2_id": "///B/951/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1139, "atom1_serNum": 9346, "atom2_serNum": 9475, "donAcc_type": "standard", "distance": 2.855, "atom1_id": "///B/936/OD2", "atom2_id": "///B/951/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1140, "atom1_serNum": 9378, "atom2_serNum": 9486, "donAcc_type": "standard", "distance": 2.809, "atom1_id": "///B/940/OD1", "atom2_id": "///B/953/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1141, "atom1_serNum": 9379, "atom2_serNum": 9489, "donAcc_type": "standard", "distance": 2.980, "atom1_id": "///B/940/ND2", "atom2_id": "///B/953/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1142, "atom1_serNum": 9390, "atom2_serNum": 9458, "donAcc_type": "standard", "distance": 2.832, "atom1_id": "///B/942/O", "atom2_id": "///B/950/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1143, "atom1_serNum": 9408, "atom2_serNum": 9444, "donAcc_type": "standard", "distance": 2.993, "atom1_id": "///B/944/N", "atom2_id": "///B/948/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1144, "atom1_serNum": 9411, "atom2_serNum": 9433, "donAcc_type": "standard", "distance": 2.961, "atom1_id": "///B/944/O", "atom2_id": "///B/947/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1145, "atom1_serNum": 9414, "atom2_serNum": 9433, "donAcc_type": "standard", "distance": 3.199, "atom1_id": "///B/944/OD1", "atom2_id": "///B/947/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1146, "atom1_serNum": 9414, "atom2_serNum": 9441, "donAcc_type": "standard", "distance": 2.818, "atom1_id": "///B/944/OD1", "atom2_id": "///B/948/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1147, "atom1_serNum": 9416, "atom2_serNum": 9423, "donAcc_type": "standard", "distance": 2.734, "atom1_id": "///B/945/N", "atom2_id": "///B/945/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1148, "atom1_serNum": 9461, "atom2_serNum": 9477, "donAcc_type": "standard", "distance": 3.196, "atom1_id": "///B/950/O", "atom2_id": "///B/952/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1149, "atom1_serNum": 9505, "atom2_serNum": 9962, "donAcc_type": "standard", "distance": 2.966, "atom1_id": "///B/955/O", "atom2_id": "///B/1010/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1150, "atom1_serNum": 9517, "atom2_serNum": 9947, "donAcc_type": "standard", "distance": 3.203, "atom1_id": "///B/957/N", "atom2_id": "///B/1008/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1151, "atom1_serNum": 9520, "atom2_serNum": 9522, "donAcc_type": "acceptable", "distance": 2.701, "atom1_id": "///B/957/O", "atom2_id": "///B/957/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1152, "atom1_serNum": 9544, "atom2_serNum": 9571, "donAcc_type": "standard", "distance": 2.961, "atom1_id": "///B/960/O", "atom2_id": "///B/964/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1153, "atom1_serNum": 9550, "atom2_serNum": 9577, "donAcc_type": "standard", "distance": 2.832, "atom1_id": "///B/961/O", "atom2_id": "///B/965/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1154, "atom1_serNum": 9555, "atom2_serNum": 9584, "donAcc_type": "standard", "distance": 2.843, "atom1_id": "///B/961/NZ", "atom2_id": "///B/965/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1155, "atom1_serNum": 9559, "atom2_serNum": 9585, "donAcc_type": "standard", "distance": 2.924, "atom1_id": "///B/962/O", "atom2_id": "///B/966/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1156, "atom1_serNum": 9567, "atom2_serNum": 9596, "donAcc_type": "standard", "distance": 2.857, "atom1_id": "///B/963/O", "atom2_id": "///B/967/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1157, "atom1_serNum": 9574, "atom2_serNum": 9607, "donAcc_type": "standard", "distance": 2.975, "atom1_id": "///B/964/O", "atom2_id": "///B/968/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1158, "atom1_serNum": 9580, "atom2_serNum": 9616, "donAcc_type": "standard", "distance": 2.807, "atom1_id": "///B/965/O", "atom2_id": "///B/969/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1159, "atom1_serNum": 9588, "atom2_serNum": 9624, "donAcc_type": "standard", "distance": 2.976, "atom1_id": "///B/966/O", "atom2_id": "///B/970/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1160, "atom1_serNum": 9599, "atom2_serNum": 9644, "donAcc_type": "standard", "distance": 2.882, "atom1_id": "///B/967/O", "atom2_id": "///B/972/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1161, "atom1_serNum": 9603, "atom2_serNum": 9647, "donAcc_type": "standard", "distance": 2.921, "atom1_id": "///B/967/NE", "atom2_id": "///B/972/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1162, "atom1_serNum": 9605, "atom2_serNum": 9780, "donAcc_type": "standard", "distance": 2.354, "atom1_id": "///B/967/NH1", "atom2_id": "///B/986/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1163, "atom1_serNum": 9615, "atom2_serNum": 11652, "donAcc_type": "standard", "distance": 3.431, "atom1_id": "///B/968/NZ", "atom2_id": "///B/1243/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1164, "atom1_serNum": 9642, "atom2_serNum": 9666, "donAcc_type": "acceptable", "distance": 3.160, "atom1_id": "///B/971/OE1", "atom2_id": "///B/973/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1165, "atom1_serNum": 9655, "atom2_serNum": 11571, "donAcc_type": "standard", "distance": 3.351, "atom1_id": "///B/973/N", "atom2_id": "///B/1234/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1166, "atom1_serNum": 9675, "atom2_serNum": 9780, "donAcc_type": "standard", "distance": 3.198, "atom1_id": "///B/974/NZ", "atom2_id": "///B/986/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1167, "atom1_serNum": 9675, "atom2_serNum": 9781, "donAcc_type": "standard", "distance": 2.760, "atom1_id": "///B/974/NZ", "atom2_id": "///B/986/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1168, "atom1_serNum": 9679, "atom2_serNum": 9703, "donAcc_type": "standard", "distance": 3.300, "atom1_id": "///B/975/O", "atom2_id": "///B/978/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1169, "atom1_serNum": 9686, "atom2_serNum": 9714, "donAcc_type": "questionable", "distance": 2.995, "atom1_id": "///B/976/O", "atom2_id": "///B/979/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1170, "atom1_serNum": 9694, "atom2_serNum": 9702, "donAcc_type": "standard", "distance": 2.490, "atom1_id": "///B/977/N", "atom2_id": "///B/977/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1171, "atom1_serNum": 9697, "atom2_serNum": 12251, "donAcc_type": "questionable", "distance": 2.955, "atom1_id": "///B/977/O", "atom2_id": "///B/1317/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1172, "atom1_serNum": 9702, "atom2_serNum": 11644, "donAcc_type": "acceptable", "distance": 2.840, "atom1_id": "///B/977/OE2", "atom2_id": "///B/1242/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1173, "atom1_serNum": 9714, "atom2_serNum": 9745, "donAcc_type": "acceptable", "distance": 3.046, "atom1_id": "///B/979/O", "atom2_id": "///B/982/ND1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1174, "atom1_serNum": 9717, "atom2_serNum": 9727, "donAcc_type": "standard", "distance": 3.170, "atom1_id": "///B/979/OD1", "atom2_id": "///B/981/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1175, "atom1_serNum": 9718, "atom2_serNum": 11506, "donAcc_type": "standard", "distance": 2.651, "atom1_id": "///B/979/ND2", "atom2_id": "///B/1226/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1176, "atom1_serNum": 9719, "atom2_serNum": 11501, "donAcc_type": "standard", "distance": 3.144, "atom1_id": "///B/980/N", "atom2_id": "///B/1225/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1177, "atom1_serNum": 9722, "atom2_serNum": 9749, "donAcc_type": "standard", "distance": 3.417, "atom1_id": "///B/980/O", "atom2_id": "///B/983/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1178, "atom1_serNum": 9726, "atom2_serNum": 11502, "donAcc_type": "standard", "distance": 2.948, "atom1_id": "///B/980/ND2", "atom2_id": "///B/1225/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1179, "atom1_serNum": 9730, "atom2_serNum": 9764, "donAcc_type": "standard", "distance": 2.899, "atom1_id": "///B/981/O", "atom2_id": "///B/985/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1180, "atom1_serNum": 9738, "atom2_serNum": 10426, "donAcc_type": "acceptable", "distance": 2.559, "atom1_id": "///B/981/OH", "atom2_id": "///B/1090/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1181, "atom1_serNum": 9742, "atom2_serNum": 9774, "donAcc_type": "standard", "distance": 2.827, "atom1_id": "///B/982/O", "atom2_id": "///B/986/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1182, "atom1_serNum": 9752, "atom2_serNum": 9782, "donAcc_type": "standard", "distance": 3.024, "atom1_id": "///B/983/O", "atom2_id": "///B/987/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1183, "atom1_serNum": 9762, "atom2_serNum": 9787, "donAcc_type": "standard", "distance": 2.938, "atom1_id": "///B/984/O", "atom2_id": "///B/988/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1184, "atom1_serNum": 9767, "atom2_serNum": 9799, "donAcc_type": "standard", "distance": 2.908, "atom1_id": "///B/985/O", "atom2_id": "///B/989/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1185, "atom1_serNum": 9777, "atom2_serNum": 9807, "donAcc_type": "standard", "distance": 2.848, "atom1_id": "///B/986/O", "atom2_id": "///B/990/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1186, "atom1_serNum": 9785, "atom2_serNum": 9815, "donAcc_type": "standard", "distance": 2.998, "atom1_id": "///B/987/O", "atom2_id": "///B/991/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1187, "atom1_serNum": 9790, "atom2_serNum": 9820, "donAcc_type": "standard", "distance": 2.949, "atom1_id": "///B/988/O", "atom2_id": "///B/992/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1188, "atom1_serNum": 9802, "atom2_serNum": 9827, "donAcc_type": "standard", "distance": 2.892, "atom1_id": "///B/989/O", "atom2_id": "///B/993/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1189, "atom1_serNum": 9810, "atom2_serNum": 9834, "donAcc_type": "standard", "distance": 2.881, "atom1_id": "///B/990/O", "atom2_id": "///B/994/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1190, "atom1_serNum": 9818, "atom2_serNum": 9838, "donAcc_type": "standard", "distance": 2.983, "atom1_id": "///B/991/O", "atom2_id": "///B/995/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1191, "atom1_serNum": 9818, "atom2_serNum": 9843, "donAcc_type": "acceptable", "distance": 2.659, "atom1_id": "///B/991/O", "atom2_id": "///B/995/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1192, "atom1_serNum": 9823, "atom2_serNum": 9843, "donAcc_type": "acceptable", "distance": 2.927, "atom1_id": "///B/992/O", "atom2_id": "///B/995/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1193, "atom1_serNum": 9823, "atom2_serNum": 9845, "donAcc_type": "standard", "distance": 2.952, "atom1_id": "///B/992/O", "atom2_id": "///B/996/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1194, "atom1_serNum": 9830, "atom2_serNum": 9850, "donAcc_type": "standard", "distance": 2.833, "atom1_id": "///B/993/O", "atom2_id": "///B/997/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1195, "atom1_serNum": 9837, "atom2_serNum": 9858, "donAcc_type": "standard", "distance": 3.032, "atom1_id": "///B/994/O", "atom2_id": "///B/998/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1196, "atom1_serNum": 9841, "atom2_serNum": 9866, "donAcc_type": "standard", "distance": 2.909, "atom1_id": "///B/995/O", "atom2_id": "///B/999/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1197, "atom1_serNum": 9848, "atom2_serNum": 9875, "donAcc_type": "standard", "distance": 2.900, "atom1_id": "///B/996/O", "atom2_id": "///B/1000/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1198, "atom1_serNum": 9853, "atom2_serNum": 9884, "donAcc_type": "standard", "distance": 3.162, "atom1_id": "///B/997/O", "atom2_id": "///B/1001/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1199, "atom1_serNum": 9869, "atom2_serNum": 10241, "donAcc_type": "standard", "distance": 2.887, "atom1_id": "///B/999/O", "atom2_id": "///B/1066/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1200, "atom1_serNum": 9878, "atom2_serNum": 10241, "donAcc_type": "standard", "distance": 3.125, "atom1_id": "///B/1000/O", "atom2_id": "///B/1066/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1201, "atom1_serNum": 9883, "atom2_serNum": 10225, "donAcc_type": "standard", "distance": 2.737, "atom1_id": "///B/1000/NZ", "atom2_id": "///B/1064/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1202, "atom1_serNum": 9883, "atom2_serNum": 10230, "donAcc_type": "standard", "distance": 2.887, "atom1_id": "///B/1000/NZ", "atom2_id": "///B/1065/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1203, "atom1_serNum": 9887, "atom2_serNum": 9912, "donAcc_type": "standard", "distance": 3.049, "atom1_id": "///B/1001/O", "atom2_id": "///B/1004/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1204, "atom1_serNum": 9899, "atom2_serNum": 9920, "donAcc_type": "standard", "distance": 2.961, "atom1_id": "///B/1002/O", "atom2_id": "///B/1005/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1205, "atom1_serNum": 9906, "atom2_serNum": 9934, "donAcc_type": "acceptable", "distance": 3.793, "atom1_id": "///B/1003/O", "atom2_id": "///B/1006/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1206, "atom1_serNum": 9915, "atom2_serNum": 9935, "donAcc_type": "standard", "distance": 2.898, "atom1_id": "///B/1004/O", "atom2_id": "///B/1007/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1207, "atom1_serNum": 9915, "atom2_serNum": 9944, "donAcc_type": "standard", "distance": 2.994, "atom1_id": "///B/1004/O", "atom2_id": "///B/1008/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1208, "atom1_serNum": 9923, "atom2_serNum": 9955, "donAcc_type": "standard", "distance": 2.608, "atom1_id": "///B/1005/O", "atom2_id": "///B/1009/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1209, "atom1_serNum": 9989, "atom2_serNum": 10012, "donAcc_type": "standard", "distance": 2.990, "atom1_id": "///B/1031/O", "atom2_id": "///B/1035/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1210, "atom1_serNum": 9998, "atom2_serNum": 10021, "donAcc_type": "standard", "distance": 2.914, "atom1_id": "///B/1032/O", "atom2_id": "///B/1036/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1211, "atom1_serNum": 10003, "atom2_serNum": 10033, "donAcc_type": "standard", "distance": 2.883, "atom1_id": "///B/1033/O", "atom2_id": "///B/1037/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1212, "atom1_serNum": 10010, "atom2_serNum": 10044, "donAcc_type": "standard", "distance": 2.826, "atom1_id": "///B/1034/O", "atom2_id": "///B/1038/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1213, "atom1_serNum": 10015, "atom2_serNum": 10055, "donAcc_type": "standard", "distance": 2.884, "atom1_id": "///B/1035/O", "atom2_id": "///B/1039/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1214, "atom1_serNum": 10024, "atom2_serNum": 10067, "donAcc_type": "standard", "distance": 2.958, "atom1_id": "///B/1036/O", "atom2_id": "///B/1040/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1215, "atom1_serNum": 10036, "atom2_serNum": 10073, "donAcc_type": "standard", "distance": 2.932, "atom1_id": "///B/1037/O", "atom2_id": "///B/1041/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1216, "atom1_serNum": 10036, "atom2_serNum": 10080, "donAcc_type": "standard", "distance": 2.799, "atom1_id": "///B/1037/O", "atom2_id": "///B/1041/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1217, "atom1_serNum": 10047, "atom2_serNum": 10081, "donAcc_type": "standard", "distance": 2.930, "atom1_id": "///B/1038/O", "atom2_id": "///B/1042/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1218, "atom1_serNum": 10070, "atom2_serNum": 10072, "donAcc_type": "acceptable", "distance": 2.974, "atom1_id": "///B/1040/O", "atom2_id": "///B/1040/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1219, "atom1_serNum": 10079, "atom2_serNum": 10104, "donAcc_type": "standard", "distance": 3.184, "atom1_id": "///B/1041/OD1", "atom2_id": "///B/1044/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1220, "atom1_serNum": 10092, "atom2_serNum": 10116, "donAcc_type": "standard", "distance": 3.539, "atom1_id": "///B/1043/O", "atom2_id": "///B/1046/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1221, "atom1_serNum": 10100, "atom2_serNum": 10127, "donAcc_type": "standard", "distance": 2.851, "atom1_id": "///B/1044/O", "atom2_id": "///B/1047/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1222, "atom1_serNum": 10130, "atom2_serNum": 10320, "donAcc_type": "standard", "distance": 2.324, "atom1_id": "///B/1047/O", "atom2_id": "///B/1076/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1223, "atom1_serNum": 10139, "atom2_serNum": 10184, "donAcc_type": "standard", "distance": 2.832, "atom1_id": "///B/1048/O", "atom2_id": "///B/1060/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1224, "atom1_serNum": 10193, "atom2_serNum": 10225, "donAcc_type": "standard", "distance": 2.889, "atom1_id": "///B/1060/NH1", "atom2_id": "///B/1064/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1225, "atom1_serNum": 10193, "atom2_serNum": 10226, "donAcc_type": "standard", "distance": 2.661, "atom1_id": "///B/1060/NH1", "atom2_id": "///B/1064/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1226, "atom1_serNum": 10198, "atom2_serNum": 10320, "donAcc_type": "standard", "distance": 2.822, "atom1_id": "///B/1061/O", "atom2_id": "///B/1076/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1227, "atom1_serNum": 10205, "atom2_serNum": 10312, "donAcc_type": "standard", "distance": 2.950, "atom1_id": "///B/1062/O", "atom2_id": "///B/1076/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1228, "atom1_serNum": 10218, "atom2_serNum": 10293, "donAcc_type": "standard", "distance": 2.834, "atom1_id": "///B/1064/N", "atom2_id": "///B/1074/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1229, "atom1_serNum": 10221, "atom2_serNum": 10283, "donAcc_type": "standard", "distance": 2.823, "atom1_id": "///B/1064/O", "atom2_id": "///B/1073/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1230, "atom1_serNum": 10221, "atom2_serNum": 10290, "donAcc_type": "standard", "distance": 2.998, "atom1_id": "///B/1064/O", "atom2_id": "///B/1074/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1231, "atom1_serNum": 10226, "atom2_serNum": 10320, "donAcc_type": "standard", "distance": 3.385, "atom1_id": "///B/1064/OE2", "atom2_id": "///B/1076/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1232, "atom1_serNum": 10234, "atom2_serNum": 10269, "donAcc_type": "standard", "distance": 2.719, "atom1_id": "///B/1066/N", "atom2_id": "///B/1071/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1233, "atom1_serNum": 10237, "atom2_serNum": 10262, "donAcc_type": "standard", "distance": 3.047, "atom1_id": "///B/1066/O", "atom2_id": "///B/1070/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1234, "atom1_serNum": 10240, "atom2_serNum": 10255, "donAcc_type": "standard", "distance": 3.012, "atom1_id": "///B/1066/OD1", "atom2_id": "///B/1069/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1235, "atom1_serNum": 10260, "atom2_serNum": 10266, "donAcc_type": "acceptable", "distance": 2.996, "atom1_id": "///B/1069/OG1", "atom2_id": "///B/1071/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1236, "atom1_serNum": 10304, "atom2_serNum": 10343, "donAcc_type": "standard", "distance": 2.647, "atom1_id": "///B/1075/N", "atom2_id": "///B/1079/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1237, "atom1_serNum": 10307, "atom2_serNum": 10325, "donAcc_type": "standard", "distance": 3.205, "atom1_id": "///B/1075/O", "atom2_id": "///B/1078/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1238, "atom1_serNum": 10307, "atom2_serNum": 10336, "donAcc_type": "standard", "distance": 2.777, "atom1_id": "///B/1075/O", "atom2_id": "///B/1079/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1239, "atom1_serNum": 10310, "atom2_serNum": 10321, "donAcc_type": "standard", "distance": 2.944, "atom1_id": "///B/1075/OD1", "atom2_id": "///B/1077/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1240, "atom1_serNum": 10328, "atom2_serNum": 10360, "donAcc_type": "standard", "distance": 3.202, "atom1_id": "///B/1078/O", "atom2_id": "///B/1082/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1241, "atom1_serNum": 10339, "atom2_serNum": 10367, "donAcc_type": "standard", "distance": 2.952, "atom1_id": "///B/1079/O", "atom2_id": "///B/1083/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1242, "atom1_serNum": 10347, "atom2_serNum": 10374, "donAcc_type": "standard", "distance": 2.935, "atom1_id": "///B/1080/O", "atom2_id": "///B/1084/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1243, "atom1_serNum": 10358, "atom2_serNum": 10385, "donAcc_type": "standard", "distance": 2.894, "atom1_id": "///B/1081/O", "atom2_id": "///B/1085/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1244, "atom1_serNum": 10363, "atom2_serNum": 10394, "donAcc_type": "standard", "distance": 2.926, "atom1_id": "///B/1082/O", "atom2_id": "///B/1086/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1245, "atom1_serNum": 10370, "atom2_serNum": 10401, "donAcc_type": "standard", "distance": 2.952, "atom1_id": "///B/1083/O", "atom2_id": "///B/1087/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1246, "atom1_serNum": 10377, "atom2_serNum": 10409, "donAcc_type": "standard", "distance": 2.952, "atom1_id": "///B/1084/O", "atom2_id": "///B/1088/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1247, "atom1_serNum": 10377, "atom2_serNum": 10414, "donAcc_type": "acceptable", "distance": 2.914, "atom1_id": "///B/1084/O", "atom2_id": "///B/1088/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1248, "atom1_serNum": 10388, "atom2_serNum": 10415, "donAcc_type": "standard", "distance": 3.286, "atom1_id": "///B/1085/O", "atom2_id": "///B/1089/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1249, "atom1_serNum": 10397, "atom2_serNum": 10415, "donAcc_type": "standard", "distance": 3.276, "atom1_id": "///B/1086/O", "atom2_id": "///B/1089/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1250, "atom1_serNum": 10414, "atom2_serNum": 11536, "donAcc_type": "acceptable", "distance": 2.995, "atom1_id": "///B/1088/OG", "atom2_id": "///B/1230/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1251, "atom1_serNum": 10426, "atom2_serNum": 10439, "donAcc_type": "standard", "distance": 3.231, "atom1_id": "///B/1090/O", "atom2_id": "///B/1092/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1252, "atom1_serNum": 10438, "atom2_serNum": 10452, "donAcc_type": "standard", "distance": 3.026, "atom1_id": "///B/1091/NE2", "atom2_id": "///B/1093/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1253, "atom1_serNum": 10442, "atom2_serNum": 10454, "donAcc_type": "standard", "distance": 2.894, "atom1_id": "///B/1092/O", "atom2_id": "///B/1094/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1254, "atom1_serNum": 10472, "atom2_serNum": 10487, "donAcc_type": "standard", "distance": 3.154, "atom1_id": "///B/1096/O", "atom2_id": "///B/1098/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1255, "atom1_serNum": 10486, "atom2_serNum": 10502, "donAcc_type": "standard", "distance": 3.013, "atom1_id": "///B/1097/NZ", "atom2_id": "///B/1099/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1256, "atom1_serNum": 10494, "atom2_serNum": 11299, "donAcc_type": "standard", "distance": 3.431, "atom1_id": "///B/1099/N", "atom2_id": "///B/1200/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1257, "atom1_serNum": 10497, "atom2_serNum": 10518, "donAcc_type": "standard", "distance": 3.272, "atom1_id": "///B/1099/O", "atom2_id": "///B/1101/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1258, "atom1_serNum": 10510, "atom2_serNum": 10823, "donAcc_type": "standard", "distance": 2.897, "atom1_id": "///B/1101/N", "atom2_id": "///B/1140/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1259, "atom1_serNum": 10537, "atom2_serNum": 10806, "donAcc_type": "standard", "distance": 2.970, "atom1_id": "///B/1105/O", "atom2_id": "///B/1138/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1260, "atom1_serNum": 10550, "atom2_serNum": 10554, "donAcc_type": "acceptable", "distance": 3.158, "atom1_id": "///B/1106/OG", "atom2_id": "///B/1107/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1261, "atom1_serNum": 10551, "atom2_serNum": 10788, "donAcc_type": "standard", "distance": 3.635, "atom1_id": "///B/1107/N", "atom2_id": "///B/1135/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1262, "atom1_serNum": 10551, "atom2_serNum": 10796, "donAcc_type": "standard", "distance": 3.212, "atom1_id": "///B/1107/N", "atom2_id": "///B/1136/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1263, "atom1_serNum": 10559, "atom2_serNum": 12778, "donAcc_type": "standard", "distance": 2.700, "atom1_id": "///B/1107/NZ", "atom2_id": "c. C & i. \\-1 & n. O2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 1264, "atom1_serNum": 10559, "atom2_serNum": 13299, "donAcc_type": "questionable", "distance": 3.373, "atom1_id": "///B/1107/NZ", "atom2_id": "///D/1/N2", "atom_pair": "N:N", "residue_pair": "aa:nt" }, { "index": 1265, "atom1_serNum": 10560, "atom2_serNum": 12805, "donAcc_type": "standard", "distance": 2.703, "atom1_id": "///B/1108/N", "atom2_id": "///C/1/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 1266, "atom1_serNum": 10569, "atom2_serNum": 12806, "donAcc_type": "standard", "distance": 3.008, "atom1_id": "///B/1109/N", "atom2_id": "///C/1/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 1267, "atom1_serNum": 10572, "atom2_serNum": 10583, "donAcc_type": "standard", "distance": 3.294, "atom1_id": "///B/1109/O", "atom2_id": "///B/1111/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1268, "atom1_serNum": 10574, "atom2_serNum": 12806, "donAcc_type": "acceptable", "distance": 2.466, "atom1_id": "///B/1109/OG", "atom2_id": "///C/1/OP2", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 1269, "atom1_serNum": 10583, "atom2_serNum": 10773, "donAcc_type": "standard", "distance": 2.781, "atom1_id": "///B/1111/N", "atom2_id": "///B/1133/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1270, "atom1_serNum": 10586, "atom2_serNum": 10770, "donAcc_type": "standard", "distance": 3.018, "atom1_id": "///B/1111/O", "atom2_id": "///B/1133/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1271, "atom1_serNum": 10607, "atom2_serNum": 10732, "donAcc_type": "standard", "distance": 3.959, "atom1_id": "///B/1114/N", "atom2_id": "///B/1128/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1272, "atom1_serNum": 10610, "atom2_serNum": 10626, "donAcc_type": "standard", "distance": 3.076, "atom1_id": "///B/1114/O", "atom2_id": "///B/1116/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1273, "atom1_serNum": 10616, "atom2_serNum": 13332, "donAcc_type": "standard", "distance": 3.458, "atom1_id": "///B/1114/NH1", "atom2_id": "///D/3/O3'", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 1274, "atom1_serNum": 10616, "atom2_serNum": 13345, "donAcc_type": "standard", "distance": 2.487, "atom1_id": "///B/1114/NH1", "atom2_id": "///D/4/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 1275, "atom1_serNum": 10617, "atom2_serNum": 10792, "donAcc_type": "standard", "distance": 3.499, "atom1_id": "///B/1114/NH2", "atom2_id": "///B/1135/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1276, "atom1_serNum": 10631, "atom2_serNum": 10640, "donAcc_type": "acceptable", "distance": 3.310, "atom1_id": "///B/1116/OG", "atom2_id": "///B/1118/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1277, "atom1_serNum": 10631, "atom2_serNum": 13345, "donAcc_type": "acceptable", "distance": 2.484, "atom1_id": "///B/1116/OG", "atom2_id": "///D/4/OP1", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 1278, "atom1_serNum": 10638, "atom2_serNum": 10640, "donAcc_type": "standard", "distance": 3.166, "atom1_id": "///B/1117/OD1", "atom2_id": "///B/1118/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1279, "atom1_serNum": 10657, "atom2_serNum": 10777, "donAcc_type": "standard", "distance": 2.635, "atom1_id": "///B/1120/N", "atom2_id": "///B/1134/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1280, "atom1_serNum": 10660, "atom2_serNum": 10774, "donAcc_type": "standard", "distance": 3.046, "atom1_id": "///B/1120/O", "atom2_id": "///B/1134/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1281, "atom1_serNum": 10684, "atom2_serNum": 10707, "donAcc_type": "standard", "distance": 3.124, "atom1_id": "///B/1123/O", "atom2_id": "///B/1126/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1282, "atom1_serNum": 10702, "atom2_serNum": 10721, "donAcc_type": "standard", "distance": 3.235, "atom1_id": "///B/1125/O", "atom2_id": "///B/1127/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1283, "atom1_serNum": 10724, "atom2_serNum": 10745, "donAcc_type": "standard", "distance": 2.829, "atom1_id": "///B/1127/O", "atom2_id": "///B/1130/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1284, "atom1_serNum": 10724, "atom2_serNum": 10754, "donAcc_type": "standard", "distance": 2.954, "atom1_id": "///B/1127/O", "atom2_id": "///B/1131/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1285, "atom1_serNum": 10727, "atom2_serNum": 10736, "donAcc_type": "standard", "distance": 3.281, "atom1_id": "///B/1127/OD1", "atom2_id": "///B/1129/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1286, "atom1_serNum": 10732, "atom2_serNum": 10766, "donAcc_type": "standard", "distance": 2.834, "atom1_id": "///B/1128/O", "atom2_id": "///B/1132/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1287, "atom1_serNum": 10793, "atom2_serNum": 13325, "donAcc_type": "standard", "distance": 3.119, "atom1_id": "///B/1136/N", "atom2_id": "///D/3/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 1288, "atom1_serNum": 10809, "atom2_serNum": 11031, "donAcc_type": "standard", "distance": 2.966, "atom1_id": "///B/1138/O", "atom2_id": "///B/1168/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1289, "atom1_serNum": 10820, "atom2_serNum": 11019, "donAcc_type": "standard", "distance": 2.861, "atom1_id": "///B/1140/N", "atom2_id": "///B/1166/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1290, "atom1_serNum": 10828, "atom2_serNum": 11016, "donAcc_type": "standard", "distance": 3.112, "atom1_id": "///B/1141/O", "atom2_id": "///B/1166/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1291, "atom1_serNum": 10836, "atom2_serNum": 11098, "donAcc_type": "acceptable", "distance": 2.870, "atom1_id": "///B/1141/OH", "atom2_id": "///B/1175/OE2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1292, "atom1_serNum": 10837, "atom2_serNum": 11284, "donAcc_type": "standard", "distance": 2.886, "atom1_id": "///B/1142/N", "atom2_id": "///B/1198/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1293, "atom1_serNum": 10840, "atom2_serNum": 11281, "donAcc_type": "standard", "distance": 2.883, "atom1_id": "///B/1142/O", "atom2_id": "///B/1198/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1294, "atom1_serNum": 10843, "atom2_serNum": 11007, "donAcc_type": "standard", "distance": 2.815, "atom1_id": "///B/1143/N", "atom2_id": "///B/1164/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1295, "atom1_serNum": 10846, "atom2_serNum": 11004, "donAcc_type": "standard", "distance": 2.952, "atom1_id": "///B/1143/O", "atom2_id": "///B/1164/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1296, "atom1_serNum": 10850, "atom2_serNum": 11267, "donAcc_type": "standard", "distance": 2.937, "atom1_id": "///B/1144/N", "atom2_id": "///B/1196/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1297, "atom1_serNum": 10853, "atom2_serNum": 11264, "donAcc_type": "standard", "distance": 3.571, "atom1_id": "///B/1144/O", "atom2_id": "///B/1196/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1298, "atom1_serNum": 10858, "atom2_serNum": 10990, "donAcc_type": "standard", "distance": 3.000, "atom1_id": "///B/1145/N", "atom2_id": "///B/1162/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1299, "atom1_serNum": 10861, "atom2_serNum": 10987, "donAcc_type": "standard", "distance": 3.160, "atom1_id": "///B/1145/O", "atom2_id": "///B/1162/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1300, "atom1_serNum": 10868, "atom2_serNum": 11222, "donAcc_type": "standard", "distance": 2.944, "atom1_id": "///B/1146/O", "atom2_id": "///B/1191/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1301, "atom1_serNum": 10872, "atom2_serNum": 10974, "donAcc_type": "standard", "distance": 3.300, "atom1_id": "///B/1147/N", "atom2_id": "///B/1160/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1302, "atom1_serNum": 10875, "atom2_serNum": 10971, "donAcc_type": "standard", "distance": 2.846, "atom1_id": "///B/1147/O", "atom2_id": "///B/1160/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1303, "atom1_serNum": 10877, "atom2_serNum": 11200, "donAcc_type": "standard", "distance": 2.786, "atom1_id": "///B/1148/N", "atom2_id": "///B/1188/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1304, "atom1_serNum": 10880, "atom2_serNum": 11197, "donAcc_type": "standard", "distance": 2.594, "atom1_id": "///B/1148/O", "atom2_id": "///B/1188/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1305, "atom1_serNum": 10885, "atom2_serNum": 11213, "donAcc_type": "standard", "distance": 2.695, "atom1_id": "///B/1148/NZ", "atom2_id": "///B/1189/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1306, "atom1_serNum": 10886, "atom2_serNum": 10959, "donAcc_type": "standard", "distance": 2.990, "atom1_id": "///B/1149/N", "atom2_id": "///B/1158/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1307, "atom1_serNum": 10889, "atom2_serNum": 10956, "donAcc_type": "standard", "distance": 2.949, "atom1_id": "///B/1149/O", "atom2_id": "///B/1158/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1308, "atom1_serNum": 10902, "atom2_serNum": 10942, "donAcc_type": "standard", "distance": 2.902, "atom1_id": "///B/1151/N", "atom2_id": "///B/1156/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1309, "atom1_serNum": 10905, "atom2_serNum": 10930, "donAcc_type": "standard", "distance": 3.169, "atom1_id": "///B/1151/O", "atom2_id": "///B/1155/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1310, "atom1_serNum": 10905, "atom2_serNum": 10939, "donAcc_type": "standard", "distance": 3.145, "atom1_id": "///B/1151/O", "atom2_id": "///B/1156/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1311, "atom1_serNum": 10910, "atom2_serNum": 10964, "donAcc_type": "questionable", "distance": 3.135, "atom1_id": "///B/1151/NZ", "atom2_id": "///B/1158/NZ", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 1312, "atom1_serNum": 10914, "atom2_serNum": 10930, "donAcc_type": "standard", "distance": 3.146, "atom1_id": "///B/1152/O", "atom2_id": "///B/1155/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1313, "atom1_serNum": 10927, "atom2_serNum": 10929, "donAcc_type": "acceptable", "distance": 2.608, "atom1_id": "///B/1154/O", "atom2_id": "///B/1154/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1314, "atom1_serNum": 10986, "atom2_serNum": 12459, "donAcc_type": "standard", "distance": 2.922, "atom1_id": "///B/1161/NZ", "atom2_id": "///B/1343/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1315, "atom1_serNum": 10986, "atom2_serNum": 12470, "donAcc_type": "standard", "distance": 2.918, "atom1_id": "///B/1161/NZ", "atom2_id": "///B/1344/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1316, "atom1_serNum": 10986, "atom2_serNum": 12610, "donAcc_type": "standard", "distance": 2.900, "atom1_id": "///B/1161/NZ", "atom2_id": "///B/1362/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1317, "atom1_serNum": 10986, "atom2_serNum": 12633, "donAcc_type": "standard", "distance": 2.611, "atom1_id": "///B/1161/NZ", "atom2_id": "///B/1365/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1318, "atom1_serNum": 10995, "atom2_serNum": 11196, "donAcc_type": "acceptable", "distance": 2.483, "atom1_id": "///B/1162/OE2", "atom2_id": "///B/1187/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1319, "atom1_serNum": 11024, "atom2_serNum": 11054, "donAcc_type": "standard", "distance": 3.252, "atom1_id": "///B/1167/N", "atom2_id": "///B/1170/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1320, "atom1_serNum": 11027, "atom2_serNum": 11056, "donAcc_type": "standard", "distance": 3.082, "atom1_id": "///B/1167/O", "atom2_id": "///B/1171/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1321, "atom1_serNum": 11029, "atom2_serNum": 11047, "donAcc_type": "acceptable", "distance": 3.127, "atom1_id": "///B/1167/OG1", "atom2_id": "///B/1170/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1322, "atom1_serNum": 11050, "atom2_serNum": 11079, "donAcc_type": "standard", "distance": 2.904, "atom1_id": "///B/1170/O", "atom2_id": "///B/1174/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1323, "atom1_serNum": 11059, "atom2_serNum": 11090, "donAcc_type": "standard", "distance": 2.888, "atom1_id": "///B/1171/O", "atom2_id": "///B/1175/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1324, "atom1_serNum": 11063, "atom2_serNum": 11098, "donAcc_type": "standard", "distance": 2.767, "atom1_id": "///B/1171/NE", "atom2_id": "///B/1175/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1325, "atom1_serNum": 11070, "atom2_serNum": 11099, "donAcc_type": "standard", "distance": 2.952, "atom1_id": "///B/1172/O", "atom2_id": "///B/1176/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1326, "atom1_serNum": 11076, "atom2_serNum": 11108, "donAcc_type": "standard", "distance": 3.511, "atom1_id": "///B/1173/O", "atom2_id": "///B/1177/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1327, "atom1_serNum": 11111, "atom2_serNum": 11139, "donAcc_type": "standard", "distance": 3.095, "atom1_id": "///B/1177/O", "atom2_id": "///B/1181/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1328, "atom1_serNum": 11114, "atom2_serNum": 11131, "donAcc_type": "standard", "distance": 2.972, "atom1_id": "///B/1177/OD1", "atom2_id": "///B/1180/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1329, "atom1_serNum": 11119, "atom2_serNum": 11150, "donAcc_type": "standard", "distance": 2.918, "atom1_id": "///B/1178/O", "atom2_id": "///B/1182/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1330, "atom1_serNum": 11126, "atom2_serNum": 11158, "donAcc_type": "standard", "distance": 2.899, "atom1_id": "///B/1179/O", "atom2_id": "///B/1183/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1331, "atom1_serNum": 11134, "atom2_serNum": 11167, "donAcc_type": "standard", "distance": 2.935, "atom1_id": "///B/1180/O", "atom2_id": "///B/1184/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1332, "atom1_serNum": 11142, "atom2_serNum": 11172, "donAcc_type": "standard", "distance": 3.210, "atom1_id": "///B/1181/O", "atom2_id": "///B/1185/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1333, "atom1_serNum": 11153, "atom2_serNum": 11181, "donAcc_type": "standard", "distance": 3.252, "atom1_id": "///B/1182/O", "atom2_id": "///B/1186/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1334, "atom1_serNum": 11153, "atom2_serNum": 11185, "donAcc_type": "standard", "distance": 3.200, "atom1_id": "///B/1182/O", "atom2_id": "///B/1187/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1335, "atom1_serNum": 11161, "atom2_serNum": 11181, "donAcc_type": "standard", "distance": 3.173, "atom1_id": "///B/1183/O", "atom2_id": "///B/1186/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1336, "atom1_serNum": 11218, "atom2_serNum": 11231, "donAcc_type": "standard", "distance": 2.883, "atom1_id": "///B/1190/O", "atom2_id": "///B/1192/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1337, "atom1_serNum": 11225, "atom2_serNum": 11248, "donAcc_type": "standard", "distance": 3.168, "atom1_id": "///B/1191/O", "atom2_id": "///B/1194/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1338, "atom1_serNum": 11234, "atom2_serNum": 11256, "donAcc_type": "standard", "distance": 3.317, "atom1_id": "///B/1192/O", "atom2_id": "///B/1195/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1339, "atom1_serNum": 11251, "atom2_serNum": 11264, "donAcc_type": "standard", "distance": 3.262, "atom1_id": "///B/1194/O", "atom2_id": "///B/1196/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1340, "atom1_serNum": 11292, "atom2_serNum": 11317, "donAcc_type": "standard", "distance": 3.257, "atom1_id": "///B/1199/O", "atom2_id": "///B/1202/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1341, "atom1_serNum": 11292, "atom2_serNum": 11322, "donAcc_type": "acceptable", "distance": 2.675, "atom1_id": "///B/1199/O", "atom2_id": "///B/1202/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1342, "atom1_serNum": 11304, "atom2_serNum": 13281, "donAcc_type": "standard", "distance": 2.587, "atom1_id": "///B/1200/NZ", "atom2_id": "///D/1/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 1343, "atom1_serNum": 11305, "atom2_serNum": 11422, "donAcc_type": "standard", "distance": 2.642, "atom1_id": "///B/1201/N", "atom2_id": "///B/1214/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1344, "atom1_serNum": 11320, "atom2_serNum": 11419, "donAcc_type": "standard", "distance": 2.925, "atom1_id": "///B/1202/O", "atom2_id": "///B/1214/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1345, "atom1_serNum": 11326, "atom2_serNum": 12492, "donAcc_type": "standard", "distance": 2.919, "atom1_id": "///B/1203/O", "atom2_id": "///B/1348/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1346, "atom1_serNum": 11331, "atom2_serNum": 11403, "donAcc_type": "standard", "distance": 2.864, "atom1_id": "///B/1204/N", "atom2_id": "///B/1212/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1347, "atom1_serNum": 11334, "atom2_serNum": 11400, "donAcc_type": "standard", "distance": 2.849, "atom1_id": "///B/1204/O", "atom2_id": "///B/1212/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1348, "atom1_serNum": 11342, "atom2_serNum": 12480, "donAcc_type": "standard", "distance": 2.836, "atom1_id": "///B/1205/N", "atom2_id": "///B/1346/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1349, "atom1_serNum": 11345, "atom2_serNum": 12477, "donAcc_type": "standard", "distance": 2.935, "atom1_id": "///B/1205/O", "atom2_id": "///B/1346/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1350, "atom1_serNum": 11349, "atom2_serNum": 12590, "donAcc_type": "standard", "distance": 2.419, "atom1_id": "///B/1205/OE1", "atom2_id": "///B/1359/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1351, "atom1_serNum": 11351, "atom2_serNum": 11383, "donAcc_type": "standard", "distance": 2.664, "atom1_id": "///B/1206/N", "atom2_id": "///B/1210/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1352, "atom1_serNum": 11359, "atom2_serNum": 11366, "donAcc_type": "standard", "distance": 2.777, "atom1_id": "///B/1207/N", "atom2_id": "///B/1207/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1353, "atom1_serNum": 11362, "atom2_serNum": 11380, "donAcc_type": "standard", "distance": 2.951, "atom1_id": "///B/1207/O", "atom2_id": "///B/1210/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1354, "atom1_serNum": 11366, "atom2_serNum": 11389, "donAcc_type": "standard", "distance": 3.079, "atom1_id": "///B/1207/OE1", "atom2_id": "///B/1210/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1355, "atom1_serNum": 11371, "atom2_serNum": 11943, "donAcc_type": "standard", "distance": 2.835, "atom1_id": "///B/1208/O", "atom2_id": "///B/1279/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1356, "atom1_serNum": 11379, "atom2_serNum": 11493, "donAcc_type": "standard", "distance": 2.692, "atom1_id": "///B/1209/O", "atom2_id": "///B/1224/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1357, "atom1_serNum": 11390, "atom2_serNum": 12447, "donAcc_type": "standard", "distance": 3.064, "atom1_id": "///B/1210/NH2", "atom2_id": "///B/1341/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1358, "atom1_serNum": 11390, "atom2_serNum": 12448, "donAcc_type": "standard", "distance": 2.597, "atom1_id": "///B/1210/NH2", "atom2_id": "///B/1341/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1359, "atom1_serNum": 11391, "atom2_serNum": 11492, "donAcc_type": "standard", "distance": 2.579, "atom1_id": "///B/1211/N", "atom2_id": "///B/1224/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1360, "atom1_serNum": 11394, "atom2_serNum": 11407, "donAcc_type": "standard", "distance": 3.162, "atom1_id": "///B/1211/O", "atom2_id": "///B/1212/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1361, "atom1_serNum": 11394, "atom2_serNum": 11482, "donAcc_type": "standard", "distance": 3.108, "atom1_id": "///B/1211/O", "atom2_id": "///B/1223/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1362, "atom1_serNum": 11410, "atom2_serNum": 11948, "donAcc_type": "standard", "distance": 2.409, "atom1_id": "///B/1212/NH2", "atom2_id": "///B/1280/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1363, "atom1_serNum": 11411, "atom2_serNum": 11467, "donAcc_type": "standard", "distance": 2.906, "atom1_id": "///B/1213/N", "atom2_id": "///B/1221/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1364, "atom1_serNum": 11414, "atom2_serNum": 11427, "donAcc_type": "standard", "distance": 3.154, "atom1_id": "///B/1213/O", "atom2_id": "///B/1215/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1365, "atom1_serNum": 11414, "atom2_serNum": 11464, "donAcc_type": "standard", "distance": 2.829, "atom1_id": "///B/1213/O", "atom2_id": "///B/1221/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1366, "atom1_serNum": 11427, "atom2_serNum": 11450, "donAcc_type": "standard", "distance": 3.092, "atom1_id": "///B/1215/N", "atom2_id": "///B/1219/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1367, "atom1_serNum": 11432, "atom2_serNum": 11450, "donAcc_type": "standard", "distance": 3.158, "atom1_id": "///B/1216/N", "atom2_id": "///B/1219/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1368, "atom1_serNum": 11437, "atom2_serNum": 11443, "donAcc_type": "acceptable", "distance": 3.238, "atom1_id": "///B/1216/OG", "atom2_id": "///B/1218/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1369, "atom1_serNum": 11437, "atom2_serNum": 13304, "donAcc_type": "acceptable", "distance": 2.883, "atom1_id": "///B/1216/OG", "atom2_id": "///D/2/OP2", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 1370, "atom1_serNum": 11441, "atom2_serNum": 12429, "donAcc_type": "acceptable", "distance": 2.705, "atom1_id": "///B/1217/O", "atom2_id": "///B/1339/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1371, "atom1_serNum": 11454, "atom2_serNum": 12397, "donAcc_type": "standard", "distance": 3.034, "atom1_id": "///B/1219/OE1", "atom2_id": "///B/1335/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1372, "atom1_serNum": 11455, "atom2_serNum": 12397, "donAcc_type": "standard", "distance": 3.249, "atom1_id": "///B/1219/OE2", "atom2_id": "///B/1335/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1373, "atom1_serNum": 11456, "atom2_serNum": 12402, "donAcc_type": "standard", "distance": 2.970, "atom1_id": "///B/1220/N", "atom2_id": "///B/1336/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1374, "atom1_serNum": 11472, "atom2_serNum": 13282, "donAcc_type": "standard", "distance": 2.443, "atom1_id": "///B/1221/NE2", "atom2_id": "///D/1/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 1375, "atom1_serNum": 11473, "atom2_serNum": 12264, "donAcc_type": "standard", "distance": 2.860, "atom1_id": "///B/1222/N", "atom2_id": "///B/1319/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1376, "atom1_serNum": 11476, "atom2_serNum": 12261, "donAcc_type": "standard", "distance": 2.897, "atom1_id": "///B/1222/O", "atom2_id": "///B/1319/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1377, "atom1_serNum": 11481, "atom2_serNum": 12226, "donAcc_type": "standard", "distance": 2.775, "atom1_id": "///B/1222/NZ", "atom2_id": "///B/1314/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1378, "atom1_serNum": 11481, "atom2_serNum": 12248, "donAcc_type": "standard", "distance": 2.868, "atom1_id": "///B/1222/NZ", "atom2_id": "///B/1317/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1379, "atom1_serNum": 11506, "atom2_serNum": 11516, "donAcc_type": "standard", "distance": 3.007, "atom1_id": "///B/1226/O", "atom2_id": "///B/1228/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1380, "atom1_serNum": 11527, "atom2_serNum": 11558, "donAcc_type": "standard", "distance": 3.107, "atom1_id": "///B/1229/O", "atom2_id": "///B/1233/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1381, "atom1_serNum": 11534, "atom2_serNum": 11565, "donAcc_type": "standard", "distance": 2.918, "atom1_id": "///B/1230/O", "atom2_id": "///B/1234/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1382, "atom1_serNum": 11540, "atom2_serNum": 11573, "donAcc_type": "standard", "distance": 2.942, "atom1_id": "///B/1231/O", "atom2_id": "///B/1235/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1383, "atom1_serNum": 11545, "atom2_serNum": 11849, "donAcc_type": "standard", "distance": 3.871, "atom1_id": "///B/1231/NZ", "atom2_id": "///B/1268/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1384, "atom1_serNum": 11549, "atom2_serNum": 11584, "donAcc_type": "standard", "distance": 2.881, "atom1_id": "///B/1232/O", "atom2_id": "///B/1236/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1385, "atom1_serNum": 11557, "atom2_serNum": 11849, "donAcc_type": "acceptable", "distance": 2.323, "atom1_id": "///B/1232/OH", "atom2_id": "///B/1268/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1386, "atom1_serNum": 11561, "atom2_serNum": 11592, "donAcc_type": "standard", "distance": 2.927, "atom1_id": "///B/1233/O", "atom2_id": "///B/1237/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1387, "atom1_serNum": 11568, "atom2_serNum": 11604, "donAcc_type": "standard", "distance": 2.963, "atom1_id": "///B/1234/O", "atom2_id": "///B/1238/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1388, "atom1_serNum": 11576, "atom2_serNum": 11612, "donAcc_type": "standard", "distance": 2.841, "atom1_id": "///B/1235/O", "atom2_id": "///B/1239/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1389, "atom1_serNum": 11587, "atom2_serNum": 11617, "donAcc_type": "standard", "distance": 3.255, "atom1_id": "///B/1236/O", "atom2_id": "///B/1240/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1390, "atom1_serNum": 11587, "atom2_serNum": 11622, "donAcc_type": "acceptable", "distance": 2.564, "atom1_id": "///B/1236/O", "atom2_id": "///B/1240/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1391, "atom1_serNum": 11595, "atom2_serNum": 11633, "donAcc_type": "standard", "distance": 3.193, "atom1_id": "///B/1237/O", "atom2_id": "///B/1242/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1392, "atom1_serNum": 11607, "atom2_serNum": 11623, "donAcc_type": "standard", "distance": 3.249, "atom1_id": "///B/1238/O", "atom2_id": "///B/1241/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1393, "atom1_serNum": 11629, "atom2_serNum": 12136, "donAcc_type": "acceptable", "distance": 3.203, "atom1_id": "///B/1241/ND1", "atom2_id": "///B/1303/NH1", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 1394, "atom1_serNum": 11670, "atom2_serNum": 11697, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///B/1248/O", "atom2_id": "///B/1252/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1395, "atom1_serNum": 11676, "atom2_serNum": 11705, "donAcc_type": "standard", "distance": 2.901, "atom1_id": "///B/1249/O", "atom2_id": "///B/1253/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1396, "atom1_serNum": 11683, "atom2_serNum": 11714, "donAcc_type": "standard", "distance": 2.909, "atom1_id": "///B/1250/O", "atom2_id": "///B/1254/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1397, "atom1_serNum": 11692, "atom2_serNum": 11723, "donAcc_type": "standard", "distance": 2.955, "atom1_id": "///B/1251/O", "atom2_id": "///B/1255/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1398, "atom1_serNum": 11700, "atom2_serNum": 11732, "donAcc_type": "standard", "distance": 2.909, "atom1_id": "///B/1252/O", "atom2_id": "///B/1256/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1399, "atom1_serNum": 11708, "atom2_serNum": 11741, "donAcc_type": "standard", "distance": 2.788, "atom1_id": "///B/1253/O", "atom2_id": "///B/1257/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1400, "atom1_serNum": 11717, "atom2_serNum": 11749, "donAcc_type": "standard", "distance": 2.920, "atom1_id": "///B/1254/O", "atom2_id": "///B/1258/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1401, "atom1_serNum": 11726, "atom2_serNum": 11760, "donAcc_type": "standard", "distance": 2.950, "atom1_id": "///B/1255/O", "atom2_id": "///B/1259/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1402, "atom1_serNum": 11735, "atom2_serNum": 11767, "donAcc_type": "standard", "distance": 2.974, "atom1_id": "///B/1256/O", "atom2_id": "///B/1260/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1403, "atom1_serNum": 11740, "atom2_serNum": 11775, "donAcc_type": "standard", "distance": 2.967, "atom1_id": "///B/1256/NE2", "atom2_id": "///B/1260/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1404, "atom1_serNum": 11744, "atom2_serNum": 11776, "donAcc_type": "standard", "distance": 2.854, "atom1_id": "///B/1257/O", "atom2_id": "///B/1261/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1405, "atom1_serNum": 11752, "atom2_serNum": 11785, "donAcc_type": "standard", "distance": 2.932, "atom1_id": "///B/1258/O", "atom2_id": "///B/1262/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1406, "atom1_serNum": 11763, "atom2_serNum": 11795, "donAcc_type": "standard", "distance": 2.970, "atom1_id": "///B/1259/O", "atom2_id": "///B/1263/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1407, "atom1_serNum": 11779, "atom2_serNum": 11810, "donAcc_type": "acceptable", "distance": 3.726, "atom1_id": "///B/1261/O", "atom2_id": "///B/1264/ND1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1408, "atom1_serNum": 11788, "atom2_serNum": 11814, "donAcc_type": "standard", "distance": 2.792, "atom1_id": "///B/1262/O", "atom2_id": "///B/1265/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1409, "atom1_serNum": 11798, "atom2_serNum": 11826, "donAcc_type": "standard", "distance": 2.981, "atom1_id": "///B/1263/O", "atom2_id": "///B/1266/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1410, "atom1_serNum": 11807, "atom2_serNum": 11842, "donAcc_type": "standard", "distance": 3.082, "atom1_id": "///B/1264/O", "atom2_id": "///B/1268/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1411, "atom1_serNum": 11817, "atom2_serNum": 11851, "donAcc_type": "standard", "distance": 2.809, "atom1_id": "///B/1265/O", "atom2_id": "///B/1269/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1412, "atom1_serNum": 11829, "atom2_serNum": 11859, "donAcc_type": "standard", "distance": 2.988, "atom1_id": "///B/1266/O", "atom2_id": "///B/1270/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1413, "atom1_serNum": 11837, "atom2_serNum": 11867, "donAcc_type": "standard", "distance": 2.933, "atom1_id": "///B/1267/O", "atom2_id": "///B/1271/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1414, "atom1_serNum": 11840, "atom2_serNum": 12056, "donAcc_type": "acceptable", "distance": 2.397, "atom1_id": "///B/1267/OD1", "atom2_id": "///B/1294/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1415, "atom1_serNum": 11840, "atom2_serNum": 12094, "donAcc_type": "standard", "distance": 2.927, "atom1_id": "///B/1267/OD1", "atom2_id": "///B/1298/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1416, "atom1_serNum": 11841, "atom2_serNum": 12094, "donAcc_type": "standard", "distance": 2.724, "atom1_id": "///B/1267/OD2", "atom2_id": "///B/1298/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1417, "atom1_serNum": 11845, "atom2_serNum": 11876, "donAcc_type": "standard", "distance": 2.957, "atom1_id": "///B/1268/O", "atom2_id": "///B/1272/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1418, "atom1_serNum": 11854, "atom2_serNum": 11885, "donAcc_type": "standard", "distance": 2.926, "atom1_id": "///B/1269/O", "atom2_id": "///B/1273/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1419, "atom1_serNum": 11862, "atom2_serNum": 11893, "donAcc_type": "standard", "distance": 2.855, "atom1_id": "///B/1270/O", "atom2_id": "///B/1274/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1420, "atom1_serNum": 11870, "atom2_serNum": 11899, "donAcc_type": "standard", "distance": 2.892, "atom1_id": "///B/1271/O", "atom2_id": "///B/1275/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1421, "atom1_serNum": 11875, "atom2_serNum": 11907, "donAcc_type": "questionable", "distance": 3.018, "atom1_id": "///B/1271/OE2", "atom2_id": "///B/1275/OE2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1422, "atom1_serNum": 11879, "atom2_serNum": 11908, "donAcc_type": "standard", "distance": 2.989, "atom1_id": "///B/1272/O", "atom2_id": "///B/1276/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1423, "atom1_serNum": 11888, "atom2_serNum": 11919, "donAcc_type": "standard", "distance": 2.864, "atom1_id": "///B/1273/O", "atom2_id": "///B/1277/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1424, "atom1_serNum": 11888, "atom2_serNum": 11924, "donAcc_type": "acceptable", "distance": 2.834, "atom1_id": "///B/1273/O", "atom2_id": "///B/1277/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1425, "atom1_serNum": 11896, "atom2_serNum": 11925, "donAcc_type": "standard", "distance": 2.925, "atom1_id": "///B/1274/O", "atom2_id": "///B/1278/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1426, "atom1_serNum": 11902, "atom2_serNum": 11934, "donAcc_type": "standard", "distance": 2.975, "atom1_id": "///B/1275/O", "atom2_id": "///B/1279/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1427, "atom1_serNum": 11911, "atom2_serNum": 11945, "donAcc_type": "standard", "distance": 2.899, "atom1_id": "///B/1276/O", "atom2_id": "///B/1280/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1428, "atom1_serNum": 11911, "atom2_serNum": 11952, "donAcc_type": "standard", "distance": 3.595, "atom1_id": "///B/1276/O", "atom2_id": "///B/1281/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1429, "atom1_serNum": 11922, "atom2_serNum": 11960, "donAcc_type": "standard", "distance": 2.743, "atom1_id": "///B/1277/O", "atom2_id": "///B/1282/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1430, "atom1_serNum": 11955, "atom2_serNum": 12410, "donAcc_type": "acceptable", "distance": 2.574, "atom1_id": "///B/1281/O", "atom2_id": "///B/1336/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1431, "atom1_serNum": 11971, "atom2_serNum": 11994, "donAcc_type": "standard", "distance": 2.847, "atom1_id": "///B/1283/O", "atom2_id": "///B/1287/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1432, "atom1_serNum": 11973, "atom2_serNum": 11979, "donAcc_type": "standard", "distance": 2.634, "atom1_id": "///B/1284/N", "atom2_id": "///B/1284/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1433, "atom1_serNum": 11976, "atom2_serNum": 12002, "donAcc_type": "standard", "distance": 2.955, "atom1_id": "///B/1284/O", "atom2_id": "///B/1288/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1434, "atom1_serNum": 11984, "atom2_serNum": 12010, "donAcc_type": "standard", "distance": 2.930, "atom1_id": "///B/1285/O", "atom2_id": "///B/1289/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1435, "atom1_serNum": 11989, "atom2_serNum": 12019, "donAcc_type": "standard", "distance": 2.890, "atom1_id": "///B/1286/O", "atom2_id": "///B/1290/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1436, "atom1_serNum": 11992, "atom2_serNum": 12018, "donAcc_type": "standard", "distance": 3.121, "atom1_id": "///B/1286/OD1", "atom2_id": "///B/1289/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1437, "atom1_serNum": 11993, "atom2_serNum": 12363, "donAcc_type": "standard", "distance": 2.663, "atom1_id": "///B/1286/ND2", "atom2_id": "///B/1332/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1438, "atom1_serNum": 11997, "atom2_serNum": 12026, "donAcc_type": "standard", "distance": 2.906, "atom1_id": "///B/1287/O", "atom2_id": "///B/1291/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1439, "atom1_serNum": 12005, "atom2_serNum": 12034, "donAcc_type": "standard", "distance": 2.965, "atom1_id": "///B/1288/O", "atom2_id": "///B/1292/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1440, "atom1_serNum": 12005, "atom2_serNum": 12039, "donAcc_type": "acceptable", "distance": 3.118, "atom1_id": "///B/1288/O", "atom2_id": "///B/1292/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1441, "atom1_serNum": 12013, "atom2_serNum": 12040, "donAcc_type": "standard", "distance": 2.930, "atom1_id": "///B/1289/O", "atom2_id": "///B/1293/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1442, "atom1_serNum": 12022, "atom2_serNum": 12045, "donAcc_type": "standard", "distance": 2.877, "atom1_id": "///B/1290/O", "atom2_id": "///B/1294/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1443, "atom1_serNum": 12029, "atom2_serNum": 12057, "donAcc_type": "standard", "distance": 2.955, "atom1_id": "///B/1291/O", "atom2_id": "///B/1295/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1444, "atom1_serNum": 12029, "atom2_serNum": 12064, "donAcc_type": "standard", "distance": 2.892, "atom1_id": "///B/1291/O", "atom2_id": "///B/1295/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1445, "atom1_serNum": 12037, "atom2_serNum": 12065, "donAcc_type": "standard", "distance": 2.923, "atom1_id": "///B/1292/O", "atom2_id": "///B/1296/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1446, "atom1_serNum": 12043, "atom2_serNum": 12074, "donAcc_type": "standard", "distance": 3.308, "atom1_id": "///B/1293/O", "atom2_id": "///B/1297/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1447, "atom1_serNum": 12063, "atom2_serNum": 12093, "donAcc_type": "standard", "distance": 2.921, "atom1_id": "///B/1295/OD1", "atom2_id": "///B/1298/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1448, "atom1_serNum": 12077, "atom2_serNum": 12103, "donAcc_type": "standard", "distance": 3.278, "atom1_id": "///B/1297/O", "atom2_id": "///B/1300/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1449, "atom1_serNum": 12106, "atom2_serNum": 12155, "donAcc_type": "standard", "distance": 2.596, "atom1_id": "///B/1300/O", "atom2_id": "///B/1305/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1450, "atom1_serNum": 12111, "atom2_serNum": 12145, "donAcc_type": "standard", "distance": 3.716, "atom1_id": "///B/1300/NZ", "atom2_id": "///B/1304/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1451, "atom1_serNum": 12115, "atom2_serNum": 12147, "donAcc_type": "standard", "distance": 2.918, "atom1_id": "///B/1301/O", "atom2_id": "///B/1305/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1452, "atom1_serNum": 12122, "atom2_serNum": 12156, "donAcc_type": "standard", "distance": 2.924, "atom1_id": "///B/1302/O", "atom2_id": "///B/1306/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1453, "atom1_serNum": 12130, "atom2_serNum": 12161, "donAcc_type": "standard", "distance": 2.902, "atom1_id": "///B/1303/O", "atom2_id": "///B/1307/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1454, "atom1_serNum": 12134, "atom2_serNum": 12169, "donAcc_type": "standard", "distance": 2.613, "atom1_id": "///B/1303/NE", "atom2_id": "///B/1307/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1455, "atom1_serNum": 12137, "atom2_serNum": 12169, "donAcc_type": "standard", "distance": 3.047, "atom1_id": "///B/1303/NH2", "atom2_id": "///B/1307/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1456, "atom1_serNum": 12141, "atom2_serNum": 12170, "donAcc_type": "standard", "distance": 2.993, "atom1_id": "///B/1304/O", "atom2_id": "///B/1308/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1457, "atom1_serNum": 12141, "atom2_serNum": 12177, "donAcc_type": "standard", "distance": 2.791, "atom1_id": "///B/1304/O", "atom2_id": "///B/1308/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1458, "atom1_serNum": 12150, "atom2_serNum": 12178, "donAcc_type": "standard", "distance": 2.884, "atom1_id": "///B/1305/O", "atom2_id": "///B/1309/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1459, "atom1_serNum": 12159, "atom2_serNum": 12186, "donAcc_type": "standard", "distance": 2.985, "atom1_id": "///B/1306/O", "atom2_id": "///B/1310/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1460, "atom1_serNum": 12164, "atom2_serNum": 12194, "donAcc_type": "standard", "distance": 3.520, "atom1_id": "///B/1307/O", "atom2_id": "///B/1311/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1461, "atom1_serNum": 12173, "atom2_serNum": 12204, "donAcc_type": "standard", "distance": 3.021, "atom1_id": "///B/1308/O", "atom2_id": "///B/1312/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1462, "atom1_serNum": 12176, "atom2_serNum": 12319, "donAcc_type": "standard", "distance": 2.639, "atom1_id": "///B/1308/OD1", "atom2_id": "///B/1327/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1463, "atom1_serNum": 12181, "atom2_serNum": 12212, "donAcc_type": "standard", "distance": 3.667, "atom1_id": "///B/1309/O", "atom2_id": "///B/1313/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1464, "atom1_serNum": 12197, "atom2_serNum": 12223, "donAcc_type": "standard", "distance": 3.226, "atom1_id": "///B/1311/O", "atom2_id": "///B/1314/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1465, "atom1_serNum": 12200, "atom2_serNum": 12301, "donAcc_type": "acceptable", "distance": 3.089, "atom1_id": "///B/1311/ND1", "atom2_id": "///B/1325/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1466, "atom1_serNum": 12207, "atom2_serNum": 12230, "donAcc_type": "standard", "distance": 2.920, "atom1_id": "///B/1312/O", "atom2_id": "///B/1315/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1467, "atom1_serNum": 12215, "atom2_serNum": 12238, "donAcc_type": "standard", "distance": 3.026, "atom1_id": "///B/1313/O", "atom2_id": "///B/1316/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1468, "atom1_serNum": 12215, "atom2_serNum": 12243, "donAcc_type": "acceptable", "distance": 3.157, "atom1_id": "///B/1313/O", "atom2_id": "///B/1316/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1469, "atom1_serNum": 12215, "atom2_serNum": 12245, "donAcc_type": "standard", "distance": 2.792, "atom1_id": "///B/1313/O", "atom2_id": "///B/1317/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1470, "atom1_serNum": 12287, "atom2_serNum": 12355, "donAcc_type": "standard", "distance": 3.003, "atom1_id": "///B/1324/N", "atom2_id": "///B/1331/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1471, "atom1_serNum": 12290, "atom2_serNum": 12352, "donAcc_type": "standard", "distance": 2.851, "atom1_id": "///B/1324/O", "atom2_id": "///B/1331/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1472, "atom1_serNum": 12306, "atom2_serNum": 12322, "donAcc_type": "standard", "distance": 3.925, "atom1_id": "///B/1325/NZ", "atom2_id": "///B/1327/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1473, "atom1_serNum": 12306, "atom2_serNum": 12336, "donAcc_type": "standard", "distance": 3.968, "atom1_id": "///B/1325/NZ", "atom2_id": "///B/1328/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1474, "atom1_serNum": 12307, "atom2_serNum": 12341, "donAcc_type": "standard", "distance": 2.911, "atom1_id": "///B/1326/N", "atom2_id": "///B/1329/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1475, "atom1_serNum": 12310, "atom2_serNum": 12338, "donAcc_type": "standard", "distance": 2.946, "atom1_id": "///B/1326/O", "atom2_id": "///B/1329/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1476, "atom1_serNum": 12377, "atom2_serNum": 13293, "donAcc_type": "standard", "distance": 3.211, "atom1_id": "///B/1333/NH1", "atom2_id": "///D/1/N7", "atom_pair": "N:N", "residue_pair": "aa:nt" }, { "index": 1477, "atom1_serNum": 12378, "atom2_serNum": 13296, "donAcc_type": "standard", "distance": 2.668, "atom1_id": "///B/1333/NH2", "atom2_id": "///D/1/O6", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 1478, "atom1_serNum": 12397, "atom2_serNum": 13315, "donAcc_type": "standard", "distance": 3.527, "atom1_id": "///B/1335/NH1", "atom2_id": "///D/2/N7", "atom_pair": "N:N", "residue_pair": "aa:nt" }, { "index": 1479, "atom1_serNum": 12398, "atom2_serNum": 12741, "donAcc_type": "questionable", "distance": 3.292, "atom1_id": "///B/1335/NH2", "atom2_id": "c. C & i. \\-3 & n. N6", "atom_pair": "N:N", "residue_pair": "aa:nt" }, { "index": 1480, "atom1_serNum": 12398, "atom2_serNum": 13318, "donAcc_type": "standard", "distance": 2.339, "atom1_id": "///B/1335/NH2", "atom2_id": "///D/2/O6", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 1481, "atom1_serNum": 12423, "atom2_serNum": 12431, "donAcc_type": "acceptable", "distance": 3.360, "atom1_id": "///B/1338/OG", "atom2_id": "///B/1340/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1482, "atom1_serNum": 12434, "atom2_serNum": 12456, "donAcc_type": "standard", "distance": 3.142, "atom1_id": "///B/1340/O", "atom2_id": "///B/1343/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1483, "atom1_serNum": 12443, "atom2_serNum": 12464, "donAcc_type": "standard", "distance": 2.987, "atom1_id": "///B/1341/O", "atom2_id": "///B/1344/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1484, "atom1_serNum": 12443, "atom2_serNum": 12472, "donAcc_type": "standard", "distance": 3.310, "atom1_id": "///B/1341/O", "atom2_id": "///B/1345/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1485, "atom1_serNum": 12475, "atom2_serNum": 12607, "donAcc_type": "standard", "distance": 2.981, "atom1_id": "///B/1345/O", "atom2_id": "///B/1362/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1486, "atom1_serNum": 12484, "atom2_serNum": 12594, "donAcc_type": "standard", "distance": 2.869, "atom1_id": "///B/1347/N", "atom2_id": "///B/1360/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1487, "atom1_serNum": 12487, "atom2_serNum": 12591, "donAcc_type": "standard", "distance": 2.848, "atom1_id": "///B/1347/O", "atom2_id": "///B/1360/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1488, "atom1_serNum": 12500, "atom2_serNum": 12576, "donAcc_type": "standard", "distance": 2.871, "atom1_id": "///B/1349/N", "atom2_id": "///B/1358/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1489, "atom1_serNum": 12503, "atom2_serNum": 12573, "donAcc_type": "standard", "distance": 2.900, "atom1_id": "///B/1349/O", "atom2_id": "///B/1358/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1490, "atom1_serNum": 12519, "atom2_serNum": 12555, "donAcc_type": "standard", "distance": 2.936, "atom1_id": "///B/1351/N", "atom2_id": "///B/1356/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1491, "atom1_serNum": 12524, "atom2_serNum": 12538, "donAcc_type": "acceptable", "distance": 3.494, "atom1_id": "///B/1351/OG", "atom2_id": "///B/1353/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1492, "atom1_serNum": 12524, "atom2_serNum": 12552, "donAcc_type": "acceptable", "distance": 3.275, "atom1_id": "///B/1351/OG", "atom2_id": "///B/1356/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1493, "atom1_serNum": 12538, "atom2_serNum": 12544, "donAcc_type": "acceptable", "distance": 3.382, "atom1_id": "///B/1353/OG1", "atom2_id": "///B/1355/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1494, "atom1_serNum": 12571, "atom2_serNum": 12589, "donAcc_type": "standard", "distance": 2.565, "atom1_id": "///B/1357/OE1", "atom2_id": "///B/1359/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1495, "atom1_serNum": 12594, "atom2_serNum": 12607, "donAcc_type": "standard", "distance": 3.098, "atom1_id": "///B/1360/O", "atom2_id": "///B/1362/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1496, "atom1_serNum": 12605, "atom2_serNum": 12620, "donAcc_type": "acceptable", "distance": 3.160, "atom1_id": "///B/1361/OD1", "atom2_id": "///B/1363/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1497, "atom1_serNum": 12605, "atom2_serNum": 12629, "donAcc_type": "standard", "distance": 3.095, "atom1_id": "///B/1361/OD1", "atom2_id": "///B/1364/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1498, "atom1_serNum": 12606, "atom2_serNum": 12615, "donAcc_type": "standard", "distance": 3.143, "atom1_id": "///B/1361/OD2", "atom2_id": "///B/1363/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1499, "atom1_serNum": 12606, "atom2_serNum": 12620, "donAcc_type": "acceptable", "distance": 2.702, "atom1_id": "///B/1361/OD2", "atom2_id": "///B/1363/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1500, "atom1_serNum": 12610, "atom2_serNum": 12630, "donAcc_type": "standard", "distance": 3.095, "atom1_id": "///B/1362/O", "atom2_id": "///B/1365/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1501, "atom1_serNum": 12657, "atom2_serNum": 13424, "donAcc_type": "standard", "distance": 2.514, "atom1_id": "c. C & i. \\-7 & n. O2", "atom2_id": "///D/7/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1502, "atom1_serNum": 12658, "atom2_serNum": 13422, "donAcc_type": "standard", "distance": 2.724, "atom1_id": "c. C & i. \\-7 & n. N3", "atom2_id": "///D/7/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1503, "atom1_serNum": 12660, "atom2_serNum": 13421, "donAcc_type": "standard", "distance": 2.993, "atom1_id": "c. C & i. \\-7 & n. N4", "atom2_id": "///D/7/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1504, "atom1_serNum": 12679, "atom2_serNum": 13401, "donAcc_type": "standard", "distance": 3.661, "atom1_id": "c. C & i. \\-6 & n. N6", "atom2_id": "///D/6/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1505, "atom1_serNum": 12680, "atom2_serNum": 13399, "donAcc_type": "standard", "distance": 2.985, "atom1_id": "c. C & i. \\-6 & n. N1", "atom2_id": "///D/6/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1506, "atom1_serNum": 12700, "atom2_serNum": 13381, "donAcc_type": "standard", "distance": 3.590, "atom1_id": "c. C & i. \\-5 & n. N6", "atom2_id": "///D/5/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1507, "atom1_serNum": 12701, "atom2_serNum": 13379, "donAcc_type": "standard", "distance": 3.296, "atom1_id": "c. C & i. \\-5 & n. N1", "atom2_id": "///D/5/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1508, "atom1_serNum": 12719, "atom2_serNum": 13361, "donAcc_type": "standard", "distance": 2.864, "atom1_id": "c. C & i. \\-4 & n. N3", "atom2_id": "///D/4/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1509, "atom1_serNum": 12721, "atom2_serNum": 13360, "donAcc_type": "standard", "distance": 3.012, "atom1_id": "c. C & i. \\-4 & n. O4", "atom2_id": "///D/4/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1510, "atom1_serNum": 12741, "atom2_serNum": 13340, "donAcc_type": "standard", "distance": 3.155, "atom1_id": "c. C & i. \\-3 & n. N6", "atom2_id": "///D/3/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1511, "atom1_serNum": 12742, "atom2_serNum": 13338, "donAcc_type": "standard", "distance": 2.855, "atom1_id": "c. C & i. \\-3 & n. N1", "atom2_id": "///D/3/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1512, "atom1_serNum": 12759, "atom2_serNum": 13321, "donAcc_type": "standard", "distance": 2.713, "atom1_id": "c. C & i. \\-2 & n. O2", "atom2_id": "///D/2/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1513, "atom1_serNum": 12760, "atom2_serNum": 13319, "donAcc_type": "standard", "distance": 2.842, "atom1_id": "c. C & i. \\-2 & n. N3", "atom2_id": "///D/2/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1514, "atom1_serNum": 12762, "atom2_serNum": 13318, "donAcc_type": "standard", "distance": 2.918, "atom1_id": "c. C & i. \\-2 & n. N4", "atom2_id": "///D/2/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1515, "atom1_serNum": 12778, "atom2_serNum": 13299, "donAcc_type": "standard", "distance": 2.737, "atom1_id": "c. C & i. \\-1 & n. O2", "atom2_id": "///D/1/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1516, "atom1_serNum": 12779, "atom2_serNum": 13297, "donAcc_type": "standard", "distance": 2.875, "atom1_id": "c. C & i. \\-1 & n. N3", "atom2_id": "///D/1/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1517, "atom1_serNum": 12781, "atom2_serNum": 13296, "donAcc_type": "standard", "distance": 2.932, "atom1_id": "c. C & i. \\-1 & n. N4", "atom2_id": "///D/1/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1518, "atom1_serNum": 12798, "atom2_serNum": 13276, "donAcc_type": "standard", "distance": 2.711, "atom1_id": "///C/0/N3", "atom2_id": "///D/0/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1519, "atom1_serNum": 12800, "atom2_serNum": 13275, "donAcc_type": "standard", "distance": 3.011, "atom1_id": "///C/0/O4", "atom2_id": "///D/0/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" } ], "refCoords": { "purine": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 -0.5000 0.4000", " 3 N -2.2500 -0.5000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 1.2500 5.0000 0.4000", " 6 C 1.2500 -0.5000 0.4000", " 7 C 1.2500 -0.5000 -0.4000", " 8 C 1.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 -0.5000 0.4000", " 11 C -2.2500 -0.5000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ], "pyrimidine": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 1.0000 0.4000", " 3 N -2.2500 1.0000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 1.2500 5.0000 0.4000", " 6 C 1.2500 1.0000 0.4000", " 7 C 1.2500 1.0000 -0.4000", " 8 C 1.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 1.0000 0.4000", " 11 C -2.2500 1.0000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ], "wc_pair": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 -5.0000 0.4000", " 3 N -2.2500 -5.0000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 2.2500 5.0000 0.4000", " 6 C 2.2500 -5.0000 0.4000", " 7 C 2.2500 -5.0000 -0.4000", " 8 C 2.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 -5.0000 0.4000", " 11 C -2.2500 -5.0000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ] }, "metadata": { "license": "http://innovation.columbia.edu/technologies/CU20391", "url": "http://x3dna.org/", "url_alt": "http://home.x3dna.org/", "forum": "http://forum.x3dna.org/", "citation": "Lu et al. (2015). 'DSSR: an integrated software tool for dissecting the spatial structure of RNA.' Nucleic Acids Res., 43(21):e142 [doi:10.1093/nar/gkv716].", "str_id": "7qqt", "num_aaChains": 1, "aaChains": "B=1333", "num_naChains": 3, "naChains": "A=84,C=28,D=11", "num_atoms": 14056, "num_waters": 621, "num_metals": 12, "metals_desc": "Mg=2,K=10", "num_notes": 52, "notes": [ { "Aminors": "A-minor interactions (including types I and II)" }, { "Cstem_index": "stem index of the 'Canonical' helix in k-turn" }, { "Cstem_pair": "Cstem bp delineating the k-turn internal loop" }, { "Dp": "perpendicular distance of the 3' P atom to the glycosidic bond" }, { "GA_pair": "sheared G-A pair in k-turn" }, { "HtypePknot": "H-type pseudoknot" }, { "Kturn": "kink-turn (k-turn)" }, { "LW": "Leontis-Westhof" }, { "NCstem_index": "stem index of the 'Non-Canonical' helix in k-turn" }, { "NCstem_pair": "NCstem bp delineating the k-turn internal loop" }, { "Uturn": "U-turn of the UNR- or GNRA-type" }, { "aa": "amino acid" }, { "atom_pair": "symbols of the two atoms involved in an H-bond" }, { "auxfiles": "auxiliary files" }, { "glyco_bond": "conformation of base related to sugar (syn or anti)" }, { "bb_type": "backbone conformation, BI or BII" }, { "bending_angle": "angle between two helical axes" }, { "bp": "base pair" }, { "bseq": "base sequence in one-letter code" }, { "bulge": "bulge loop" }, { "coaxStacks": "coaxial stacking of stems within a helix" }, { "dbn": "dot bracket notation" }, { "desc": "description" }, { "donAcc_type": "donor/acceptor type of the atom pair in an H-bond" }, { "epsilon_zeta": "difference between epsilon and zeta torsion angles" }, { "hairpin": "hairpin loop" }, { "hbond": "hydrogen bond (H-bond)" }, { "helix": "defined by base-stacking interactions, regardless of bp type and backbone connectivity" }, { "id": "identifier" }, { "iloop": "internal loop" }, { "index": "serial number" }, { "isoCanonPairs": "isolated canonical pairs" }, { "junction": "(multi-branched) junction loop" }, { "kissingLoop": "kissing loop" }, { "multiplet": "3+ bases in a coplanar geometry" }, { "na": "nucleic acid" }, { "nonPair": "two nts not forming a pair, but with H-bonding/stacking interactions" }, { "nonStack": "nucleotide not involved in stacking interactions" }, { "nt": "nucleotide" }, { "num": "number" }, { "oArea": "overlap areas between two bases, including exocyclic atoms" }, { "oArea_ring": "overlap areas between two bases, including only ring atoms" }, { "phosContacts": "H-bonding and atom-capping interactions involving a phosphate" }, { "residue_pair": "types of the two residues involved in an H-bond" }, { "rmsd": "root-mean-squares deviation" }, { "serNum": "serial number" }, { "ssSegments": "single-stranded segments not involved in loops" }, { "ssZp": "Z-coordinate of the 3' phosphorus atom with reference to the 5' base plane" }, { "sstr": "secondary structure in dbn" }, { "stem": "helix consisting of only canonical pairs, with a continuous backbone" }, { "str_id": "structure identifier, derived from inpfile with extension removed" }, { "vert_dist": "vertical distance from an atom to a base plane" } ], "num_auxfiles": 18, "auxfiles": [ { "index": 1, "name": "dssr-pairs.pdb", "desc": "an ensemble of base pairs" }, { "index": 2, "name": "dssr-stems.pdb", "desc": "an ensemble of stems" }, { "index": 3, "name": "dssr-helices.pdb", "desc": "an ensemble of helices (coaxial stacking)" }, { "index": 4, "name": "dssr-hairpins.pdb", "desc": "an ensemble of hairpin loops" }, { "index": 5, "name": "dssr-bulges.pdb", "desc": "an ensemble of bulges" }, { "index": 6, "name": "dssr-iloops.pdb", "desc": "an ensemble of internal loops" }, { "index": 7, "name": "dssr-2ndstrs.bpseq", "desc": "secondary structure in bpseq format" }, { "index": 8, "name": "dssr-2ndstrs.ct", "desc": "secondary structure in connectivity table format" }, { "index": 9, "name": "dssr-2ndstrs.dbn", "desc": "secondary structure in dot-bracket notation" }, { "index": 10, "name": "dssr-torsions.txt", "desc": "backbone torsion angles and suite names" }, { "index": 11, "name": "dssr-splays.pdb", "desc": "an ensemble of splayed-apart units" }, { "index": 12, "name": "dssr-Aminors.pdb", "desc": "an ensemble of A minor motifs (types I and II)" }, { "index": 13, "name": "dssr-stacks.pdb", "desc": "an ensemble of base stacks" }, { "index": 14, "name": "dssr-atom2bases.pdb", "desc": "an ensemble of atom-base stacking interactions" }, { "index": 15, "name": "dssr-rotmat.txt", "desc": "position vector and rotation matrix" }, { "index": 16, "name": "dssr-viewV.pdb", "desc": "vertical view of the principal moment of inertia" }, { "index": 17, "name": "dssr-viewH.pdb", "desc": "horizontal view of the principal moment of inertia" }, { "index": 18, "name": "dssr-viewT.pdb", "desc": "top view of the principal moment of inertia" } ], "time_used": "999" } }