{ "num_pairs": 34, "pairs": [ { "index": 1, "nt1": "///H/1", "nt2": "///I/68", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -99.375, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 60.147, "chi2": -120.751, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 58.774, "C1C1_dist": 10.069, "N1N9_dist": 8.569, "C6C8_dist": 9.747, "CNNC_torsion": 0.595, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.14],N1-N3(imino)[2.69]", "interBase_angle": 1.174, "planarity": 0.018, "simple_Shear": 0.033, "simple_Stretch": -0.178, "simple_Buckle": -0.851, "simple_Propeller": -0.808, "bp_simpleParams": [ 0.033, -0.178, -0.066, -0.851, -0.808, 9.189 ], "bp_params": [ 0.031, -0.178, -0.066, -0.858, -0.801, 9.189 ], "frame": { "rmsd": null, "origin": [ 159.635, 150.814, 163.763 ], "x_axis": [ -0.618, 0.068, 0.783 ], "y_axis": [ -0.195, 0.952, -0.237 ], "z_axis": [ -0.761, -0.299, -0.575 ], "quaternion": [ -0.435, -0.036, 0.887, -0.151 ] } }, { "index": 2, "nt1": "///H/2", "nt2": "///I/67", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -126.851, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 54.458, "chi2": -112.708, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 54.289, "C1C1_dist": 10.641, "N1N9_dist": 8.926, "C6C8_dist": 9.891, "CNNC_torsion": 1.233, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.94],N1(imino)-N3[2.87],N2(amino)-O2(carbonyl)[2.71]", "interBase_angle": 2.097, "planarity": 0.039, "simple_Shear": -0.185, "simple_Stretch": -0.135, "simple_Buckle": -1.820, "simple_Propeller": -1.043, "bp_simpleParams": [ -0.185, -0.135, -0.201, -1.820, -1.043, 1.449 ], "bp_params": [ -0.183, -0.138, -0.201, -1.805, -1.068, 1.448 ], "frame": { "rmsd": null, "origin": [ 157.676, 149.161, 161.145 ], "x_axis": [ -0.624, 0.575, 0.530 ], "y_axis": [ 0.194, 0.770, -0.608 ], "z_axis": [ -0.757, -0.277, -0.592 ], "quaternion": [ -0.372, 0.222, 0.864, -0.256 ] } }, { "index": 3, "nt1": "///H/3", "nt2": "///I/66", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -122.781, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 57.121, "chi2": -112.038, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 56.105, "C1C1_dist": 10.331, "N1N9_dist": 8.710, "C6C8_dist": 9.788, "CNNC_torsion": -2.747, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.08],N1-N3(imino)[2.76]", "interBase_angle": 4.673, "planarity": 0.086, "simple_Shear": 0.047, "simple_Stretch": -0.162, "simple_Buckle": 0.547, "simple_Propeller": -4.641, "bp_simpleParams": [ 0.047, -0.162, -0.275, 0.547, -4.641, 5.398 ], "bp_params": [ 0.045, -0.163, -0.275, 0.502, -4.646, 5.403 ], "frame": { "rmsd": null, "origin": [ 155.464, 148.091, 158.950 ], "x_axis": [ -0.299, 0.954, -0.009 ], "y_axis": [ 0.582, 0.175, -0.794 ], "z_axis": [ -0.756, -0.243, -0.607 ], "quaternion": [ -0.259, 0.532, 0.721, -0.360 ] } }, { "index": 4, "nt1": "///H/4", "nt2": "///I/65", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -90.432, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 52.810, "chi2": -124.054, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 54.057, "C1C1_dist": 10.616, "N1N9_dist": 8.857, "C6C8_dist": 9.805, "CNNC_torsion": -4.027, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.83],O4(carbonyl)-N6(amino)[2.94]", "interBase_angle": 8.112, "planarity": 0.119, "simple_Shear": -0.075, "simple_Stretch": -0.153, "simple_Buckle": 1.245, "simple_Propeller": -8.016, "bp_simpleParams": [ -0.075, -0.153, -0.321, 1.245, -8.016, 0.066 ], "bp_params": [ -0.074, -0.154, -0.321, 1.343, -8.001, 0.067 ], "frame": { "rmsd": null, "origin": [ 152.343, 146.526, 157.747 ], "x_axis": [ 0.037, 0.868, -0.495 ], "y_axis": [ 0.632, -0.404, -0.661 ], "z_axis": [ -0.774, -0.288, -0.563 ], "quaternion": [ -0.132, 0.708, 0.530, -0.448 ] } }, { "index": 5, "nt1": "///H/5", "nt2": "///I/64", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -133.214, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 51.431, "chi2": -100.678, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 54.190, "C1C1_dist": 10.777, "N1N9_dist": 8.990, "C6C8_dist": 9.914, "CNNC_torsion": -6.634, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.91],O4(carbonyl)-N6(amino)[3.00]", "interBase_angle": 8.331, "planarity": 0.108, "simple_Shear": -0.155, "simple_Stretch": -0.044, "simple_Buckle": -1.295, "simple_Propeller": -8.229, "bp_simpleParams": [ -0.155, -0.044, -0.092, -1.295, -8.229, -1.219 ], "bp_params": [ -0.154, -0.047, -0.092, -1.133, -8.253, -1.222 ], "frame": { "rmsd": null, "origin": [ 150.372, 145.016, 154.829 ], "x_axis": [ 0.356, 0.400, -0.845 ], "y_axis": [ 0.471, -0.857, -0.207 ], "z_axis": [ -0.807, -0.324, -0.493 ], "quaternion": [ 0.036, 0.823, 0.265, -0.502 ] } }, { "index": 6, "nt1": "///H/6", "nt2": "///I/63", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -95.561, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 54.452, "chi2": -110.335, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 56.903, "C1C1_dist": 10.394, "N1N9_dist": 8.730, "C6C8_dist": 9.772, "CNNC_torsion": -11.701, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.74],O4(carbonyl)-N6(amino)[3.02]", "interBase_angle": 11.147, "planarity": 0.149, "simple_Shear": -0.160, "simple_Stretch": -0.176, "simple_Buckle": 0.502, "simple_Propeller": -11.136, "bp_simpleParams": [ -0.160, -0.176, -0.049, 0.502, -11.136, 3.589 ], "bp_params": [ -0.156, -0.180, -0.049, 0.733, -11.123, 3.606 ], "frame": { "rmsd": null, "origin": [ 147.362, 144.780, 153.344 ], "x_axis": [ 0.545, -0.118, -0.830 ], "y_axis": [ 0.239, -0.927, 0.289 ], "z_axis": [ -0.803, -0.356, -0.477 ], "quaternion": [ 0.188, 0.859, 0.035, -0.476 ] } }, { "index": 7, "nt1": "///H/7", "nt2": "///I/62", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -104.240, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 56.746, "chi2": -116.245, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 57.041, "C1C1_dist": 10.252, "N1N9_dist": 8.652, "C6C8_dist": 9.741, "CNNC_torsion": -7.567, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.72],O4(carbonyl)-N6(amino)[3.06]", "interBase_angle": 6.522, "planarity": 0.089, "simple_Shear": -0.004, "simple_Stretch": -0.197, "simple_Buckle": 0.589, "simple_Propeller": -6.495, "bp_simpleParams": [ -0.004, -0.197, 0.049, 0.589, -6.495, 5.587 ], "bp_params": [ -0.003, -0.197, 0.049, 0.624, -6.492, 5.596 ], "frame": { "rmsd": null, "origin": [ 145.408, 143.001, 151.258 ], "x_axis": [ 0.584, -0.670, -0.458 ], "y_axis": [ -0.172, -0.654, 0.736 ], "z_axis": [ -0.793, -0.351, -0.497 ], "quaternion": [ 0.329, 0.827, -0.255, -0.378 ] } }, { "index": 8, "nt1": "///H/8", "nt2": "///I/61", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -110.424, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 56.077, "chi2": -106.951, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 55.288, "C1C1_dist": 10.449, "N1N9_dist": 8.789, "C6C8_dist": 9.829, "CNNC_torsion": -6.457, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.08],N1-N3(imino)[2.81]", "interBase_angle": 4.339, "planarity": 0.077, "simple_Shear": 0.057, "simple_Stretch": -0.120, "simple_Buckle": -1.159, "simple_Propeller": -4.182, "bp_simpleParams": [ 0.057, -0.120, 0.189, -1.159, -4.182, 3.607 ], "bp_params": [ 0.055, -0.120, 0.189, -1.202, -4.169, 3.609 ], "frame": { "rmsd": null, "origin": [ 142.513, 141.562, 150.072 ], "x_axis": [ 0.318, -0.941, 0.117 ], "y_axis": [ -0.500, -0.062, 0.864 ], "z_axis": [ -0.806, -0.333, -0.490 ], "quaternion": [ 0.438, 0.684, -0.527, -0.252 ] } }, { "index": 9, "nt1": "///H/9", "nt2": "///I/60", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -109.161, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 52.021, "chi2": -120.638, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 54.270, "C1C1_dist": 10.694, "N1N9_dist": 8.929, "C6C8_dist": 9.866, "CNNC_torsion": -6.133, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.87],O4(carbonyl)-N6(amino)[2.99]", "interBase_angle": 4.569, "planarity": 0.071, "simple_Shear": -0.147, "simple_Stretch": -0.085, "simple_Buckle": 0.984, "simple_Propeller": -4.462, "bp_simpleParams": [ -0.147, -0.085, 0.122, 0.984, -4.462, -0.729 ], "bp_params": [ -0.145, -0.088, 0.122, 1.068, -4.443, -0.729 ], "frame": { "rmsd": null, "origin": [ 140.537, 140.582, 147.305 ], "x_axis": [ 0.028, -0.860, 0.509 ], "y_axis": [ -0.588, 0.398, 0.704 ], "z_axis": [ -0.808, -0.319, -0.495 ], "quaternion": [ -0.482, -0.530, 0.683, 0.141 ] } }, { "index": 10, "nt1": "///H/10", "nt2": "///I/59", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -115.378, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 54.031, "chi2": -111.586, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.933, "C1C1_dist": 10.674, "N1N9_dist": 8.940, "C6C8_dist": 9.889, "CNNC_torsion": -8.084, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.95],N1(imino)-N3[2.89],N2(amino)-O2(carbonyl)[2.75]", "interBase_angle": 6.038, "planarity": 0.083, "simple_Shear": -0.191, "simple_Stretch": -0.129, "simple_Buckle": 0.431, "simple_Propeller": -6.023, "bp_simpleParams": [ -0.191, -0.129, 0.132, 0.431, -6.023, 0.853 ], "bp_params": [ -0.189, -0.132, 0.132, 0.521, -6.016, 0.854 ], "frame": { "rmsd": null, "origin": [ 137.772, 139.470, 145.853 ], "x_axis": [ -0.330, -0.457, 0.826 ], "y_axis": [ -0.493, 0.830, 0.262 ], "z_axis": [ -0.805, -0.321, -0.499 ], "quaternion": [ 0.500, 0.291, -0.815, 0.018 ] } }, { "index": 11, "nt1": "///H/11", "nt2": "///I/58", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -107.914, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.413, "chi2": -108.055, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 54.554, "C1C1_dist": 10.556, "N1N9_dist": 8.823, "C6C8_dist": 9.791, "CNNC_torsion": -10.191, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.80],O4(carbonyl)-N6(amino)[2.97]", "interBase_angle": 10.414, "planarity": 0.139, "simple_Shear": -0.097, "simple_Stretch": -0.158, "simple_Buckle": 2.411, "simple_Propeller": -10.131, "bp_simpleParams": [ -0.097, -0.158, -0.073, 2.411, -10.131, 0.653 ], "bp_params": [ -0.095, -0.160, -0.073, 2.560, -10.094, 0.655 ], "frame": { "rmsd": null, "origin": [ 135.442, 138.032, 144.032 ], "x_axis": [ -0.598, 0.113, 0.794 ], "y_axis": [ -0.228, 0.925, -0.303 ], "z_axis": [ -0.769, -0.362, -0.527 ], "quaternion": [ -0.447, -0.033, 0.873, -0.190 ] } }, { "index": 12, "nt1": "///H/12", "nt2": "///I/57", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -89.069, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 52.703, "chi2": -107.932, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 55.278, "C1C1_dist": 10.576, "N1N9_dist": 8.841, "C6C8_dist": 9.804, "CNNC_torsion": -8.776, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.80],O4(carbonyl)-N6(amino)[2.96]", "interBase_angle": 9.671, "planarity": 0.126, "simple_Shear": -0.145, "simple_Stretch": -0.148, "simple_Buckle": 0.619, "simple_Propeller": -9.651, "bp_simpleParams": [ -0.145, -0.148, 0.010, 0.619, -9.651, 0.168 ], "bp_params": [ -0.143, -0.151, 0.010, 0.800, -9.638, 0.169 ], "frame": { "rmsd": null, "origin": [ 132.561, 137.291, 142.422 ], "x_axis": [ -0.636, 0.668, 0.387 ], "y_axis": [ 0.170, 0.610, -0.774 ], "z_axis": [ -0.753, -0.426, -0.502 ], "quaternion": [ -0.344, 0.253, 0.829, -0.362 ] } }, { "index": 13, "nt1": "///H/13", "nt2": "///I/56", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -99.115, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 50.367, "chi2": -105.560, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 52.965, "C1C1_dist": 10.852, "N1N9_dist": 9.022, "C6C8_dist": 9.888, "CNNC_torsion": -11.506, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.92],O4(carbonyl)-N6(amino)[2.94]", "interBase_angle": 10.304, "planarity": 0.141, "simple_Shear": -0.175, "simple_Stretch": -0.057, "simple_Buckle": 1.611, "simple_Propeller": -10.178, "bp_simpleParams": [ -0.175, -0.057, 0.086, 1.611, -10.178, -3.988 ], "bp_params": [ -0.174, -0.061, 0.086, 1.830, -10.141, -4.003 ], "frame": { "rmsd": null, "origin": [ 130.257, 136.114, 140.225 ], "x_axis": [ -0.419, 0.899, -0.128 ], "y_axis": [ 0.512, 0.118, -0.851 ], "z_axis": [ -0.749, -0.423, -0.510 ], "quaternion": [ -0.217, 0.493, 0.715, -0.445 ] } }, { "index": 14, "nt1": "///H/14", "nt2": "///I/55", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -111.572, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.962, "chi2": -113.833, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 52.481, "C1C1_dist": 10.687, "N1N9_dist": 8.923, "C6C8_dist": 9.872, "CNNC_torsion": -7.268, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.02],N1-N3(imino)[2.88]", "interBase_angle": 8.826, "planarity": 0.117, "simple_Shear": 0.118, "simple_Stretch": -0.076, "simple_Buckle": -0.748, "simple_Propeller": -8.794, "bp_simpleParams": [ 0.118, -0.076, -0.139, -0.748, -8.794, 0.323 ], "bp_params": [ 0.116, -0.078, -0.139, -0.891, -8.781, 0.324 ], "frame": { "rmsd": null, "origin": [ 128.292, 134.804, 137.601 ], "x_axis": [ 0.062, 0.732, -0.679 ], "y_axis": [ 0.660, -0.540, -0.522 ], "z_axis": [ -0.748, -0.416, -0.517 ], "quaternion": [ -0.036, 0.728, 0.478, -0.490 ] } }, { "index": 15, "nt1": "///H/15", "nt2": "///I/54", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -120.115, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.434, "chi2": -120.348, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 52.986, "C1C1_dist": 10.765, "N1N9_dist": 8.994, "C6C8_dist": 9.923, "CNNC_torsion": -7.676, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.95],N1(imino)-N3[2.92],N2(amino)-O2(carbonyl)[2.82]", "interBase_angle": 10.319, "planarity": 0.138, "simple_Shear": -0.190, "simple_Stretch": -0.102, "simple_Buckle": -1.936, "simple_Propeller": -10.136, "bp_simpleParams": [ -0.190, -0.102, -0.245, -1.936, -10.136, 0.852 ], "bp_params": [ -0.189, -0.105, -0.245, -1.793, -10.162, 0.855 ], "frame": { "rmsd": null, "origin": [ 125.590, 133.550, 136.180 ], "x_axis": [ 0.397, 0.338, -0.854 ], "y_axis": [ 0.558, -0.827, -0.068 ], "z_axis": [ -0.729, -0.450, -0.517 ], "quaternion": [ 0.115, 0.828, 0.271, -0.478 ] } }, { "index": 16, "nt1": "///H/16", "nt2": "///I/53", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -121.461, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 56.078, "chi2": -96.223, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 55.729, "C1C1_dist": 10.438, "N1N9_dist": 8.787, "C6C8_dist": 9.835, "CNNC_torsion": -6.800, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.10],N1-N3(imino)[2.81]", "interBase_angle": 8.729, "planarity": 0.116, "simple_Shear": 0.024, "simple_Stretch": -0.108, "simple_Buckle": -3.724, "simple_Propeller": -7.895, "bp_simpleParams": [ 0.024, -0.108, -0.084, -3.724, -7.895, 4.238 ], "bp_params": [ 0.023, -0.109, -0.084, -3.787, -7.865, 4.246 ], "frame": { "rmsd": null, "origin": [ 123.202, 131.842, 135.072 ], "x_axis": [ 0.666, -0.298, -0.683 ], "y_axis": [ 0.205, -0.808, 0.553 ], "z_axis": [ -0.717, -0.509, -0.477 ], "quaternion": [ 0.309, 0.859, -0.027, -0.408 ] } }, { "index": 17, "nt1": "///H/17", "nt2": "///I/52", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -103.397, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 52.168, "chi2": -127.126, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 54.734, "C1C1_dist": 10.719, "N1N9_dist": 8.959, "C6C8_dist": 9.905, "CNNC_torsion": -8.865, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.90],O4(carbonyl)-N6(amino)[3.03]", "interBase_angle": 9.600, "planarity": 0.122, "simple_Shear": -0.143, "simple_Stretch": -0.051, "simple_Buckle": -1.472, "simple_Propeller": -9.486, "bp_simpleParams": [ -0.143, -0.051, -0.011, -1.472, -9.486, -0.322 ], "bp_params": [ -0.143, -0.053, -0.011, -1.297, -9.512, -0.324 ], "frame": { "rmsd": null, "origin": [ 120.475, 131.441, 132.990 ], "x_axis": [ 0.694, -0.653, -0.302 ], "y_axis": [ -0.136, -0.532, 0.836 ], "z_axis": [ -0.707, -0.539, -0.458 ], "quaternion": [ 0.420, 0.819, -0.241, -0.308 ] } }, { "index": 18, "nt1": "///H/18", "nt2": "///I/51", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -106.351, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.069, "chi2": -83.448, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.585, "C1C1_dist": 10.687, "N1N9_dist": 8.927, "C6C8_dist": 9.852, "CNNC_torsion": -3.746, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.75],N3-N1(imino)[2.86],N4(amino)-O6(carbonyl)[2.89]", "interBase_angle": 6.399, "planarity": 0.095, "simple_Shear": 0.159, "simple_Stretch": -0.160, "simple_Buckle": -2.917, "simple_Propeller": -5.695, "bp_simpleParams": [ 0.159, -0.160, -0.031, -2.917, -5.695, 0.299 ], "bp_params": [ 0.157, -0.162, -0.031, -2.983, -5.661, 0.299 ], "frame": { "rmsd": null, "origin": [ 117.965, 129.922, 131.699 ], "x_axis": [ 0.513, -0.810, 0.283 ], "y_axis": [ -0.525, -0.036, 0.850 ], "z_axis": [ -0.679, -0.585, -0.444 ], "quaternion": [ 0.508, 0.706, -0.473, -0.140 ] } }, { "index": 19, "nt1": "///H/19", "nt2": "///I/50", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -123.580, "conf1": "anti", "pucker1": "----", "lambda1": 55.030, "chi2": -98.823, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 57.519, "C1C1_dist": 10.436, "N1N9_dist": 8.794, "C6C8_dist": 9.850, "CNNC_torsion": -3.238, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.80],O4(carbonyl)-N6(amino)[3.09]", "interBase_angle": 5.609, "planarity": 0.075, "simple_Shear": -0.096, "simple_Stretch": -0.105, "simple_Buckle": 0.726, "simple_Propeller": -5.562, "bp_simpleParams": [ -0.096, -0.105, -0.084, 0.726, -5.562, 4.182 ], "bp_params": [ -0.094, -0.106, -0.084, 0.806, -5.551, 4.187 ], "frame": { "rmsd": null, "origin": [ 116.309, 127.694, 130.348 ], "x_axis": [ 0.227, -0.717, 0.659 ], "y_axis": [ -0.733, 0.319, 0.600 ], "z_axis": [ -0.641, -0.619, -0.453 ], "quaternion": [ 0.523, 0.583, -0.622, 0.008 ] } }, { "index": 20, "nt1": "///H/20", "nt2": "///I/49", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -117.871, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 49.403, "chi2": -124.225, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 52.166, "C1C1_dist": 10.908, "N1N9_dist": 9.043, "C6C8_dist": 9.885, "CNNC_torsion": -6.062, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.92],O4(carbonyl)-N6(amino)[2.90]", "interBase_angle": 6.145, "planarity": 0.084, "simple_Shear": -0.155, "simple_Stretch": -0.058, "simple_Buckle": 2.485, "simple_Propeller": -5.621, "bp_simpleParams": [ -0.155, -0.058, -0.069, 2.485, -5.621, -4.658 ], "bp_params": [ -0.154, -0.061, -0.069, 2.596, -5.570, -4.662 ], "frame": { "rmsd": null, "origin": [ 114.768, 125.744, 128.027 ], "x_axis": [ -0.094, -0.421, 0.902 ], "y_axis": [ -0.782, 0.592, 0.195 ], "z_axis": [ -0.616, -0.687, -0.385 ], "quaternion": [ 0.527, 0.418, -0.720, 0.171 ] } }, { "index": 21, "nt1": "///H/21", "nt2": "///I/48", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -97.283, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 55.225, "chi2": -102.022, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 54.670, "C1C1_dist": 10.475, "N1N9_dist": 8.781, "C6C8_dist": 9.792, "CNNC_torsion": -7.156, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.78],O4(carbonyl)-N6(amino)[3.03]", "interBase_angle": 9.360, "planarity": 0.123, "simple_Shear": 0.011, "simple_Stretch": -0.157, "simple_Buckle": 1.307, "simple_Propeller": -9.268, "bp_simpleParams": [ 0.011, -0.157, -0.092, 1.307, -9.268, 2.949 ], "bp_params": [ 0.012, -0.157, -0.092, 1.342, -9.263, 2.959 ], "frame": { "rmsd": null, "origin": [ 112.875, 123.025, 127.858 ], "x_axis": [ -0.470, 0.006, 0.882 ], "y_axis": [ -0.656, 0.667, -0.354 ], "z_axis": [ -0.591, -0.745, -0.310 ], "quaternion": [ -0.471, -0.208, 0.782, -0.351 ] } }, { "index": 22, "nt1": "///H/22", "nt2": "///I/47", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -115.640, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.820, "chi2": -107.685, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 56.278, "C1C1_dist": 10.554, "N1N9_dist": 8.854, "C6C8_dist": 9.854, "CNNC_torsion": -8.088, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.83],O4(carbonyl)-N6(amino)[3.04]", "interBase_angle": 9.901, "planarity": 0.127, "simple_Shear": -0.154, "simple_Stretch": -0.102, "simple_Buckle": -2.107, "simple_Propeller": -9.674, "bp_simpleParams": [ -0.154, -0.102, -0.033, -2.107, -9.674, 1.915 ], "bp_params": [ -0.152, -0.105, -0.033, -1.917, -9.713, 1.921 ], "frame": { "rmsd": null, "origin": [ 110.691, 120.762, 127.181 ], "x_axis": [ -0.788, 0.384, 0.482 ], "y_axis": [ -0.260, 0.502, -0.825 ], "z_axis": [ -0.559, -0.775, -0.296 ], "quaternion": [ -0.324, 0.039, 0.804, -0.497 ] } }, { "index": 23, "nt1": "///H/23", "nt2": "///I/46", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -89.236, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 52.258, "chi2": -117.249, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 50.224, "C1C1_dist": 10.930, "N1N9_dist": 9.037, "C6C8_dist": 9.911, "CNNC_torsion": -4.437, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.90],N1-N3(imino)[2.94]", "interBase_angle": 4.235, "planarity": 0.057, "simple_Shear": 0.013, "simple_Stretch": -0.045, "simple_Buckle": -2.308, "simple_Propeller": -3.551, "bp_simpleParams": [ 0.013, -0.045, -0.012, -2.308, -3.551, -3.209 ], "bp_params": [ 0.012, -0.045, -0.012, -2.329, -3.537, -3.210 ], "frame": { "rmsd": null, "origin": [ 109.466, 117.518, 126.692 ], "x_axis": [ -0.778, 0.628, -0.005 ], "y_axis": [ 0.151, 0.179, -0.972 ], "z_axis": [ -0.609, -0.758, -0.235 ], "quaternion": [ -0.204, 0.263, 0.740, -0.584 ] } }, { "index": 24, "nt1": "///H/24", "nt2": "///I/45", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -108.260, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 49.146, "chi2": -97.119, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 48.706, "C1C1_dist": 10.881, "N1N9_dist": 8.968, "C6C8_dist": 9.697, "CNNC_torsion": -15.090, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.84],O4(carbonyl)-N6(amino)[2.62]", "interBase_angle": 17.000, "planarity": 0.214, "simple_Shear": 0.117, "simple_Stretch": -0.234, "simple_Buckle": -2.580, "simple_Propeller": -16.803, "bp_simpleParams": [ 0.117, -0.234, -0.093, -2.580, -16.803, -9.235 ], "bp_params": [ 0.115, -0.235, -0.093, -2.722, -16.781, -9.332 ], "frame": { "rmsd": null, "origin": [ 108.130, 114.762, 124.819 ], "x_axis": [ -0.559, 0.503, -0.659 ], "y_axis": [ 0.627, -0.263, -0.733 ], "z_axis": [ -0.542, -0.823, -0.169 ], "quaternion": [ -0.048, -0.467, -0.605, 0.643 ] } }, { "index": 25, "nt1": "///H/25", "nt2": "///I/44", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -108.687, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 54.916, "chi2": -120.442, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 60.322, "C1C1_dist": 11.228, "N1N9_dist": 9.628, "C6C8_dist": 10.763, "CNNC_torsion": -11.394, "hbonds_num": 2, "hbonds_desc": "N1(imino)-N3[3.80],N2(amino)-O2(carbonyl)[3.28]", "interBase_angle": 12.343, "planarity": 0.168, "simple_Shear": -0.864, "simple_Stretch": 0.828, "simple_Buckle": -7.539, "simple_Propeller": -9.773, "bp_simpleParams": [ -0.864, 0.828, 0.264, -7.539, -9.773, 9.919 ], "bp_params": [ -0.926, 0.759, 0.264, -6.755, -10.330, 9.942 ], "frame": { "rmsd": null, "origin": [ 105.666, 112.994, 123.446 ], "x_axis": [ -0.143, 0.386, -0.911 ], "y_axis": [ 0.829, -0.457, -0.324 ], "z_axis": [ -0.541, -0.802, -0.255 ], "quaternion": [ 0.191, 0.626, 0.485, -0.580 ] } }, { "index": 26, "nt1": "///H/26", "nt2": "///I/43", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -103.167, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 51.194, "chi2": -90.089, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 52.649, "C1C1_dist": 10.555, "N1N9_dist": 8.775, "C6C8_dist": 9.632, "CNNC_torsion": -8.061, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.68],N3-N1(imino)[2.66],N4(amino)-O6(carbonyl)[2.58]", "interBase_angle": 10.089, "planarity": 0.139, "simple_Shear": 0.123, "simple_Stretch": -0.380, "simple_Buckle": -6.363, "simple_Propeller": -7.829, "bp_simpleParams": [ 0.123, -0.380, 0.175, -6.363, -7.829, -2.836 ], "bp_params": [ 0.119, -0.381, 0.175, -6.442, -7.764, -2.838 ], "frame": { "rmsd": null, "origin": [ 104.555, 109.787, 123.642 ], "x_axis": [ 0.488, -0.026, -0.872 ], "y_axis": [ 0.711, -0.568, 0.415 ], "z_axis": [ -0.507, -0.822, -0.259 ], "quaternion": [ 0.406, 0.761, 0.225, -0.453 ] } }, { "index": 27, "nt1": "///H/27", "nt2": "///I/42", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -126.717, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 55.156, "chi2": -107.329, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 55.433, "C1C1_dist": 10.536, "N1N9_dist": 8.852, "C6C8_dist": 9.875, "CNNC_torsion": -6.262, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.84],O4(carbonyl)-N6(amino)[3.08]", "interBase_angle": 6.801, "planarity": 0.090, "simple_Shear": -0.030, "simple_Stretch": -0.084, "simple_Buckle": 0.254, "simple_Propeller": -6.797, "bp_simpleParams": [ -0.030, -0.084, 0.010, 0.254, -6.797, 2.943 ], "bp_params": [ -0.029, -0.085, 0.010, 0.309, -6.794, 2.948 ], "frame": { "rmsd": null, "origin": [ 103.107, 107.464, 121.930 ], "x_axis": [ 0.771, -0.278, -0.572 ], "y_axis": [ 0.391, -0.502, 0.771 ], "z_axis": [ -0.502, -0.819, -0.279 ], "quaternion": [ 0.498, 0.799, 0.035, -0.336 ] } }, { "index": 28, "nt1": "///H/28", "nt2": "///I/41", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -112.468, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 51.528, "chi2": -136.159, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.210, "C1C1_dist": 10.791, "N1N9_dist": 8.989, "C6C8_dist": 9.891, "CNNC_torsion": -3.796, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.90],O4(carbonyl)-N6(amino)[2.96]", "interBase_angle": 4.528, "planarity": 0.059, "simple_Shear": -0.115, "simple_Stretch": -0.063, "simple_Buckle": -1.691, "simple_Propeller": -4.201, "bp_simpleParams": [ -0.115, -0.063, -0.022, -1.691, -4.201, -2.234 ], "bp_params": [ -0.114, -0.064, -0.022, -1.625, -4.226, -2.236 ], "frame": { "rmsd": null, "origin": [ 101.418, 105.254, 119.789 ], "x_axis": [ 0.863, -0.504, -0.022 ], "y_axis": [ -0.144, -0.286, 0.947 ], "z_axis": [ -0.484, -0.815, -0.320 ], "quaternion": [ 0.561, 0.786, -0.206, -0.161 ] } }, { "index": 29, "nt1": "///H/29", "nt2": "///I/40", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -99.268, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 52.706, "chi2": -118.479, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.603, "C1C1_dist": 10.747, "N1N9_dist": 8.975, "C6C8_dist": 9.899, "CNNC_torsion": -2.487, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.94],N1(imino)-N3[2.90],N2(amino)-O2(carbonyl)[2.77]", "interBase_angle": 0.988, "planarity": 0.032, "simple_Shear": -0.197, "simple_Stretch": -0.120, "simple_Buckle": 0.892, "simple_Propeller": -0.424, "bp_simpleParams": [ -0.197, -0.120, 0.161, 0.892, -0.424, 0.309 ], "bp_params": [ -0.195, -0.123, 0.161, 0.898, -0.411, 0.309 ], "frame": { "rmsd": null, "origin": [ 100.585, 102.326, 118.960 ], "x_axis": [ 0.650, -0.517, 0.557 ], "y_axis": [ -0.626, 0.052, 0.778 ], "z_axis": [ -0.431, -0.855, -0.290 ], "quaternion": [ 0.594, 0.687, -0.416, 0.046 ] } }, { "index": 30, "nt1": "///H/30", "nt2": "///I/39", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -147.973, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 54.392, "chi2": -108.304, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 54.692, "C1C1_dist": 10.647, "N1N9_dist": 8.935, "C6C8_dist": 9.898, "CNNC_torsion": -4.685, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.73],N3-N1(imino)[2.88],N4(amino)-O6(carbonyl)[2.95]", "interBase_angle": 4.713, "planarity": 0.068, "simple_Shear": 0.186, "simple_Stretch": -0.125, "simple_Buckle": 3.224, "simple_Propeller": -3.437, "bp_simpleParams": [ 0.186, -0.125, 0.097, 3.224, -3.437, 1.221 ], "bp_params": [ 0.185, -0.127, 0.097, 3.176, -3.481, 1.221 ], "frame": { "rmsd": null, "origin": [ 99.738, 99.105, 118.676 ], "x_axis": [ 0.146, -0.405, 0.903 ], "y_axis": [ -0.897, 0.331, 0.294 ], "z_axis": [ -0.418, -0.852, -0.315 ], "quaternion": [ 0.539, 0.532, -0.612, 0.228 ] } }, { "index": 31, "nt1": "///H/31", "nt2": "///I/38", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -89.351, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.843, "chi2": -132.642, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 55.455, "C1C1_dist": 10.492, "N1N9_dist": 8.789, "C6C8_dist": 9.782, "CNNC_torsion": -6.199, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.78],O4(carbonyl)-N6(amino)[2.97]", "interBase_angle": 7.463, "planarity": 0.099, "simple_Shear": -0.090, "simple_Stretch": -0.170, "simple_Buckle": 1.941, "simple_Propeller": -7.206, "bp_simpleParams": [ -0.090, -0.170, -0.097, 1.941, -7.206, 1.469 ], "bp_params": [ -0.088, -0.172, -0.097, 2.038, -7.179, 1.471 ], "frame": { "rmsd": null, "origin": [ 99.574, 95.648, 117.776 ], "x_axis": [ -0.425, -0.161, 0.891 ], "y_axis": [ -0.813, 0.500, -0.297 ], "z_axis": [ -0.398, -0.851, -0.343 ], "quaternion": [ -0.428, -0.323, 0.753, -0.381 ] } }, { "index": 32, "nt1": "///H/32", "nt2": "///I/37", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -97.474, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 54.007, "chi2": -107.602, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 55.546, "C1C1_dist": 10.551, "N1N9_dist": 8.839, "C6C8_dist": 9.833, "CNNC_torsion": -0.685, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.83],O4(carbonyl)-N6(amino)[3.01]", "interBase_angle": 6.285, "planarity": 0.101, "simple_Shear": -0.069, "simple_Stretch": -0.127, "simple_Buckle": 2.063, "simple_Propeller": -5.937, "bp_simpleParams": [ -0.069, -0.127, -0.355, 2.063, -5.937, 1.899 ], "bp_params": [ -0.067, -0.128, -0.355, 2.133, -5.912, 1.901 ], "frame": { "rmsd": null, "origin": [ 97.673, 93.028, 116.974 ], "x_axis": [ -0.846, 0.124, 0.518 ], "y_axis": [ -0.413, 0.460, -0.786 ], "z_axis": [ -0.336, -0.879, -0.338 ], "quaternion": [ -0.262, -0.089, 0.813, -0.512 ] } }, { "index": 33, "nt1": "///H/33", "nt2": "///I/36", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -111.809, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.168, "chi2": -84.193, "conf2": "--", "pucker2": "~C2'-endo", "lambda2": 54.702, "C1C1_dist": 10.519, "N1N9_dist": 8.785, "C6C8_dist": 9.761, "CNNC_torsion": -9.923, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.77],O4(carbonyl)-N6(amino)[2.95]", "interBase_angle": 11.114, "planarity": 0.147, "simple_Shear": -0.083, "simple_Stretch": -0.190, "simple_Buckle": 0.804, "simple_Propeller": -11.085, "bp_simpleParams": [ -0.083, -0.190, -0.096, 0.804, -11.085, 1.029 ], "bp_params": [ -0.080, -0.191, -0.096, 0.949, -11.073, 1.034 ], "frame": { "rmsd": null, "origin": [ 97.328, 89.784, 114.655 ], "x_axis": [ -0.946, 0.316, -0.065 ], "y_axis": [ 0.167, 0.306, -0.937 ], "z_axis": [ -0.277, -0.898, -0.342 ], "quaternion": [ -0.066, 0.150, 0.805, -0.570 ] } }, { "index": 34, "nt1": "///H/34", "nt2": "///I/35", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -102.639, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 54.954, "chi2": -140.681, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 56.908, "C1C1_dist": 10.356, "N1N9_dist": 8.704, "C6C8_dist": 9.749, "CNNC_torsion": -3.545, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.74],O4(carbonyl)-N6(amino)[3.00]", "interBase_angle": 6.415, "planarity": 0.097, "simple_Shear": -0.096, "simple_Stretch": -0.199, "simple_Buckle": -2.618, "simple_Propeller": -5.857, "bp_simpleParams": [ -0.096, -0.199, -0.192, -2.618, -5.857, 3.796 ], "bp_params": [ -0.094, -0.200, -0.192, -2.535, -5.893, 3.801 ], "frame": { "rmsd": null, "origin": [ 95.638, 86.451, 112.070 ], "x_axis": [ -0.554, 0.396, -0.732 ], "y_axis": [ 0.803, 0.024, -0.595 ], "z_axis": [ -0.218, -0.918, -0.331 ], "quaternion": [ 0.186, 0.434, 0.691, -0.547 ] } } ], "num_helices": 1, "helices": [ { "index": 1, "num_stems": 1, "strand1": "AGATTTTATGTTTAGATCTTTTATGCTTGCTTTT", "strand2": "TCTAAAATACAAATCTAGAAAATACGAACGAAAA", "bp_type": "||||||||||||||||||||||||||||||||||", "helix_form": "BBBB.BB.BBBBBBB.BBBBBBB.BBBBB.BB.", "helical_rise": 3.122, "helical_rise_std": 0.815, "helical_radius": 10.358, "helical_radius_std": 3.832, "helical_axis": [ -0.663, -0.636, -0.396 ], "point1": [ 158.138, 157.791, 155.549 ], "point2": [ 90.017, 92.446, 114.856 ], "num_pairs": 34, "pairs": [ { "index": 1, "nt1": "///H/1", "nt2": "///I/68", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.031, -0.178, -0.066, -0.858, -0.801, 9.189 ], "step_params": [ -1.063, -0.326, 3.491, -1.568, -0.360, 32.883 ], "heli_params": [ -0.509, 1.589, 3.539, -0.636, 2.768, 32.921 ], "bp2_params": [ -0.183, -0.138, -0.201, -1.805, -1.068, 1.448 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.491, "simple_Twist": 34.201, "simple_hRise": 3.537, "simple_hTwist": 34.237 }, { "index": 2, "nt1": "///H/2", "nt2": "///I/67", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.183, -0.138, -0.201, -1.805, -1.068, 1.448 ], "step_params": [ -0.377, 0.175, 3.269, -1.661, 1.282, 43.090 ], "heli_params": [ 0.111, 0.349, 3.284, 1.744, 2.261, 43.139 ], "bp2_params": [ 0.045, -0.163, -0.275, 0.502, -4.646, 5.403 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.269, "simple_Twist": 41.684, "simple_hRise": 3.284, "simple_hTwist": 41.734 }, { "index": 3, "nt1": "///H/3", "nt2": "///I/66", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.045, -0.163, -0.275, 0.502, -4.646, 5.403 ], "step_params": [ -0.769, -0.850, 3.510, 2.263, -2.972, 34.620 ], "heli_params": [ -0.933, 1.656, 3.513, -4.977, -3.789, 34.815 ], "bp2_params": [ -0.074, -0.154, -0.321, 1.343, -8.001, 0.067 ], "groove_widths": [ 10.473, null, 17.616, null ], "simple_Rise": 3.510, "simple_Twist": 35.497, "simple_hRise": 3.514, "simple_hTwist": 35.687 }, { "index": 4, "nt1": "///H/4", "nt2": "///I/65", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.074, -0.154, -0.321, 1.343, -8.001, 0.067 ], "step_params": [ 0.631, 1.252, 3.566, 1.574, -4.644, 38.626 ], "heli_params": [ 2.483, -0.742, 3.421, -6.986, -2.367, 38.925 ], "bp2_params": [ -0.154, -0.047, -0.092, -1.133, -8.253, -1.222 ], "groove_widths": [ 10.020, 10.006, 17.416, 17.397 ], "simple_Rise": 3.566, "simple_Twist": 38.924, "simple_hRise": 3.422, "simple_hTwist": 39.220 }, { "index": 5, "nt1": "///H/5", "nt2": "///I/64", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.154, -0.047, -0.092, -1.133, -8.253, -1.222 ], "step_params": [ -0.137, -0.949, 3.225, -1.807, -0.964, 31.992 ], "heli_params": [ -1.547, -0.074, 3.254, -1.747, 3.275, 32.056 ], "bp2_params": [ -0.156, -0.180, -0.049, 0.733, -11.123, 3.606 ], "groove_widths": [ 10.771, 10.768, 17.549, 17.545 ], "simple_Rise": 3.225, "simple_Twist": 32.203, "simple_hRise": 3.254, "simple_hTwist": 32.266 }, { "index": 6, "nt1": "///H/6", "nt2": "///I/63", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.156, -0.180, -0.049, 0.733, -11.123, 3.606 ], "step_params": [ 0.990, 0.278, 3.206, 0.851, 1.025, 38.929 ], "heli_params": [ 0.295, -1.383, 3.232, 1.538, -1.276, 38.951 ], "bp2_params": [ -0.003, -0.197, 0.049, 0.624, -6.492, 5.596 ], "groove_widths": [ 11.021, 10.963, 18.458, 18.457 ], "simple_Rise": 3.206, "simple_Twist": 37.961, "simple_hRise": 3.233, "simple_hTwist": 37.984 }, { "index": 7, "nt1": "///H/7", "nt2": "///I/62", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.003, -0.197, 0.049, 0.624, -6.492, 5.596 ], "step_params": [ 0.063, 0.589, 3.392, -0.211, -1.316, 40.309 ], "heli_params": [ 1.008, -0.116, 3.372, -1.909, 0.306, 40.330 ], "bp2_params": [ 0.055, -0.120, 0.189, -1.202, -4.169, 3.609 ], "groove_widths": [ 10.839, 10.779, 18.906, 18.847 ], "simple_Rise": 3.392, "simple_Twist": 39.767, "simple_hRise": 3.372, "simple_hTwist": 39.788 }, { "index": 8, "nt1": "///H/8", "nt2": "///I/61", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.055, -0.120, 0.189, -1.202, -4.169, 3.609 ], "step_params": [ -0.336, -1.293, 3.277, -0.001, -0.825, 28.611 ], "heli_params": [ -2.428, 0.678, 3.312, -1.669, 0.002, 28.623 ], "bp2_params": [ -0.145, -0.088, 0.122, 1.068, -4.443, -0.729 ], "groove_widths": [ 11.185, 11.174, 18.663, 18.573 ], "simple_Rise": 3.277, "simple_Twist": 29.882, "simple_hRise": 3.310, "simple_hTwist": 29.893 }, { "index": 9, "nt1": "///H/9", "nt2": "///I/60", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.145, -0.088, 0.122, 1.068, -4.443, -0.729 ], "step_params": [ 0.186, 0.119, 3.308, 0.292, -0.118, 36.458 ], "heli_params": [ 0.207, -0.257, 3.309, -0.189, -0.466, 36.459 ], "bp2_params": [ -0.189, -0.132, 0.132, 0.521, -6.016, 0.854 ], "groove_widths": [ 11.055, 11.008, 17.347, 17.294 ], "simple_Rise": 3.308, "simple_Twist": 36.750, "simple_hRise": 3.309, "simple_hTwist": 36.752 }, { "index": 10, "nt1": "///H/10", "nt2": "///I/59", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.189, -0.132, 0.132, 0.521, -6.016, 0.854 ], "step_params": [ -0.183, -0.387, 3.261, 2.894, -1.993, 36.679 ], "heli_params": [ -0.342, 0.681, 3.253, -3.158, -4.586, 36.841 ], "bp2_params": [ -0.095, -0.160, -0.073, 2.560, -10.094, 0.655 ], "groove_widths": [ 10.869, 10.827, 17.354, 17.353 ], "simple_Rise": 3.261, "simple_Twist": 36.296, "simple_hRise": 3.253, "simple_hTwist": 36.460 }, { "index": 11, "nt1": "///H/11", "nt2": "///I/58", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.095, -0.160, -0.073, 2.560, -10.094, 0.655 ], "step_params": [ 0.532, 0.418, 3.315, 3.897, -1.231, 40.339 ], "heli_params": [ 0.743, -0.324, 3.336, -1.780, -5.633, 40.537 ], "bp2_params": [ -0.143, -0.151, 0.010, 0.800, -9.638, 0.169 ], "groove_widths": [ 11.046, 11.030, 16.491, 16.471 ], "simple_Rise": 3.315, "simple_Twist": 40.505, "simple_hRise": 3.336, "simple_hTwist": 40.702 }, { "index": 12, "nt1": "///H/12", "nt2": "///I/57", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.143, -0.151, 0.010, 0.800, -9.638, 0.169 ], "step_params": [ 0.016, 0.598, 3.341, -0.529, 0.008, 35.185 ], "heli_params": [ 0.988, -0.108, 3.340, 0.014, 0.875, 35.189 ], "bp2_params": [ -0.174, -0.061, 0.086, 1.830, -10.141, -4.003 ], "groove_widths": [ 11.278, 11.252, 16.370, 16.327 ], "simple_Rise": 3.341, "simple_Twist": 35.428, "simple_hRise": 3.340, "simple_hTwist": 35.432 }, { "index": 13, "nt1": "///H/13", "nt2": "///I/56", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.174, -0.061, 0.086, 1.830, -10.141, -4.003 ], "step_params": [ 0.372, 0.992, 3.367, -0.237, 0.485, 44.059 ], "heli_params": [ 1.276, -0.519, 3.376, 0.647, 0.316, 44.062 ], "bp2_params": [ 0.116, -0.078, -0.139, -0.891, -8.781, 0.324 ], "groove_widths": [ 10.844, 10.826, 17.397, 17.249 ], "simple_Rise": 3.367, "simple_Twist": 42.163, "simple_hRise": 3.376, "simple_hTwist": 42.167 }, { "index": 14, "nt1": "///H/14", "nt2": "///I/55", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.116, -0.078, -0.139, -0.891, -8.781, 0.324 ], "step_params": [ -0.192, -0.379, 3.273, -2.078, -0.792, 31.658 ], "heli_params": [ -0.547, -0.032, 3.287, -1.449, 3.803, 31.734 ], "bp2_params": [ -0.189, -0.105, -0.245, -1.793, -10.162, 0.855 ], "groove_widths": [ 9.990, 9.984, 18.353, 18.353 ], "simple_Rise": 3.273, "simple_Twist": 33.465, "simple_hRise": 3.287, "simple_hTwist": 33.537 }, { "index": 15, "nt1": "///H/15", "nt2": "///I/54", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.189, -0.105, -0.245, -1.793, -10.162, 0.855 ], "step_params": [ -0.444, 0.247, 3.096, -3.837, -1.557, 41.684 ], "heli_params": [ 0.500, 0.241, 3.112, -2.182, 5.376, 41.880 ], "bp2_params": [ 0.023, -0.109, -0.084, -3.787, -7.865, 4.246 ], "groove_widths": [ 10.297, 10.287, 17.259, 17.237 ], "simple_Rise": 3.096, "simple_Twist": 40.268, "simple_hRise": 3.112, "simple_hTwist": 40.471 }, { "index": 16, "nt1": "///H/16", "nt2": "///I/53", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.023, -0.109, -0.084, -3.787, -7.865, 4.246 ], "step_params": [ -0.646, -1.322, 3.125, -1.992, 0.708, 30.218 ], "heli_params": [ -2.667, 0.851, 3.129, 1.355, 3.815, 30.290 ], "bp2_params": [ -0.143, -0.053, -0.011, -1.297, -9.512, -0.324 ], "groove_widths": [ 11.306, 11.212, 18.962, 18.781 ], "simple_Rise": 3.125, "simple_Twist": 31.342, "simple_hRise": 3.129, "simple_hTwist": 31.412 }, { "index": 17, "nt1": "///H/17", "nt2": "///I/52", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.143, -0.053, -0.011, -1.297, -9.512, -0.324 ], "step_params": [ -0.403, 0.155, 3.176, -0.959, 3.035, 36.737 ], "heli_params": [ -0.156, 0.511, 3.188, 4.804, 1.518, 36.870 ], "bp2_params": [ 0.157, -0.162, -0.031, -2.983, -5.661, 0.299 ], "groove_widths": [ 12.459, 12.343, 18.580, 17.106 ], "simple_Rise": 3.176, "simple_Twist": 34.965, "simple_hRise": 3.188, "simple_hTwist": 35.106 }, { "index": 18, "nt1": "///H/18", "nt2": "///I/51", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.157, -0.162, -0.031, -2.983, -5.661, 0.299 ], "step_params": [ 0.452, -0.277, 3.041, 2.100, 2.131, 27.788 ], "heli_params": [ -1.044, -0.471, 3.037, 4.421, -4.356, 27.946 ], "bp2_params": [ -0.094, -0.106, -0.084, 0.806, -5.551, 4.187 ], "groove_widths": [ 13.359, 13.313, 18.412, 17.103 ], "simple_Rise": 3.041, "simple_Twist": 29.346, "simple_hRise": 3.038, "simple_hTwist": 29.494 }, { "index": 19, "nt1": "///H/19", "nt2": "///I/50", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.094, -0.106, -0.084, 0.806, -5.551, 4.187 ], "step_params": [ -0.839, -0.703, 3.220, 1.331, 5.511, 28.455 ], "heli_params": [ -2.569, 1.956, 2.992, 11.072, -2.674, 29.003 ], "bp2_params": [ -0.154, -0.061, -0.069, 2.596, -5.570, -4.662 ], "groove_widths": [ 12.364, 12.284, 18.586, 17.768 ], "simple_Rise": 3.220, "simple_Twist": 28.794, "simple_hRise": 2.995, "simple_hTwist": 29.335 }, { "index": 20, "nt1": "///H/20", "nt2": "///I/49", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.154, -0.061, -0.069, 2.596, -5.570, -4.662 ], "step_params": [ 0.960, -0.389, 3.152, 3.657, 4.301, 32.803 ], "heli_params": [ -1.377, -1.083, 3.162, 7.547, -6.416, 33.272 ], "bp2_params": [ 0.012, -0.157, -0.092, 1.342, -9.263, 2.959 ], "groove_widths": [ 11.210, 11.108, 19.327, 18.783 ], "simple_Rise": 3.152, "simple_Twist": 32.114, "simple_hRise": 3.161, "simple_hTwist": 32.594 }, { "index": 21, "nt1": "///H/21", "nt2": "///I/48", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.012, -0.157, -0.092, 1.342, -9.263, 2.959 ], "step_params": [ 0.475, 0.090, 3.181, 2.454, -0.963, 37.058 ], "heli_params": [ 0.266, -0.425, 3.201, -1.514, -3.854, 37.148 ], "bp2_params": [ -0.152, -0.105, -0.033, -1.917, -9.713, 1.921 ], "groove_widths": [ 11.375, 11.338, 17.463, 17.321 ], "simple_Rise": 3.181, "simple_Twist": 37.797, "simple_hRise": 3.201, "simple_hTwist": 37.885 }, { "index": 22, "nt1": "///H/22", "nt2": "///I/47", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.152, -0.105, -0.033, -1.917, -9.713, 1.921 ], "step_params": [ -0.852, -0.653, 3.333, 2.749, 3.745, 31.412 ], "heli_params": [ -1.878, 2.060, 3.152, 6.870, -5.042, 31.746 ], "bp2_params": [ 0.012, -0.045, -0.012, -2.329, -3.537, -3.210 ], "groove_widths": [ 10.849, 10.795, 18.383, 18.230 ], "simple_Rise": 3.333, "simple_Twist": 30.083, "simple_hRise": 3.142, "simple_hTwist": 30.431 }, { "index": 23, "nt1": "///H/23", "nt2": "///I/46", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.012, -0.045, -0.012, -2.329, -3.537, -3.210 ], "step_params": [ -0.063, 1.339, 3.330, 1.665, -6.370, 40.552 ], "heli_params": [ 2.593, 0.269, 3.089, -9.119, -2.383, 41.060 ], "bp2_params": [ 0.115, -0.235, -0.093, -2.722, -16.781, -9.332 ], "groove_widths": [ 10.348, 10.265, 17.610, 17.551 ], "simple_Rise": 3.330, "simple_Twist": 40.584, "simple_hRise": 3.089, "simple_hTwist": 41.092 }, { "index": 24, "nt1": "///H/24", "nt2": "///I/45", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.115, -0.235, -0.093, -2.722, -16.781, -9.332 ], "step_params": [ 1.211, -0.477, 3.064, -2.260, 4.549, 28.621 ], "heli_params": [ -1.862, -2.865, 2.854, 9.111, 4.527, 29.059 ], "bp2_params": [ -0.926, 0.759, 0.264, -6.755, -10.330, 9.942 ], "groove_widths": [ 11.049, 11.016, 17.646, 17.621 ], "simple_Rise": 3.064, "simple_Twist": 33.482, "simple_hRise": 2.891, "simple_hTwist": 33.855 }, { "index": 25, "nt1": "///H/25", "nt2": "///I/44", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.926, 0.759, 0.264, -6.755, -10.330, 9.942 ], "step_params": [ -0.994, 0.857, 3.137, -2.287, 0.385, 44.368 ], "heli_params": [ 1.099, 1.110, 3.189, 0.509, 3.026, 44.426 ], "bp2_params": [ 0.119, -0.381, 0.175, -6.442, -7.764, -2.838 ], "groove_widths": [ 12.179, 12.161, 16.900, 16.683 ], "simple_Rise": 3.137, "simple_Twist": 39.180, "simple_hRise": 3.196, "simple_hTwist": 39.246 }, { "index": 26, "nt1": "///H/26", "nt2": "///I/43", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.119, -0.381, 0.175, -6.442, -7.764, -2.838 ], "step_params": [ 0.693, -0.593, 3.096, 0.646, 0.989, 27.959 ], "heli_params": [ -1.449, -1.289, 3.089, 2.045, -1.337, 27.984 ], "bp2_params": [ -0.029, -0.085, 0.010, 0.309, -6.794, 2.948 ], "groove_widths": [ 12.443, 12.344, 17.667, 16.921 ], "simple_Rise": 3.096, "simple_Twist": 28.913, "simple_hRise": 3.089, "simple_hTwist": 28.937 }, { "index": 27, "nt1": "///H/27", "nt2": "///I/42", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.029, -0.085, 0.010, 0.309, -6.794, 2.948 ], "step_params": [ 0.107, -1.248, 3.279, 2.078, 1.511, 35.048 ], "heli_params": [ -2.292, 0.132, 3.225, 2.505, -3.445, 35.139 ], "bp2_params": [ -0.114, -0.064, -0.022, -1.625, -4.226, -2.236 ], "groove_widths": [ 12.100, 11.967, 18.034, 17.647 ], "simple_Rise": 3.279, "simple_Twist": 35.432, "simple_hRise": 3.226, "simple_hTwist": 35.522 }, { "index": 28, "nt1": "///H/28", "nt2": "///I/41", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.114, -0.064, -0.022, -1.625, -4.226, -2.236 ], "step_params": [ 0.681, -0.090, 3.079, -0.625, 4.125, 35.683 ], "heli_params": [ -0.699, -1.188, 3.038, 6.703, 1.016, 35.918 ], "bp2_params": [ -0.195, -0.123, 0.161, 0.898, -0.411, 0.309 ], "groove_widths": [ 11.312, 11.203, 18.766, 18.554 ], "simple_Rise": 3.079, "simple_Twist": 36.081, "simple_hRise": 3.039, "simple_hTwist": 36.313 }, { "index": 29, "nt1": "///H/29", "nt2": "///I/40", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.195, -0.123, 0.161, 0.898, -0.411, 0.309 ], "step_params": [ 0.976, -0.122, 3.195, 1.414, -0.857, 36.187 ], "heli_params": [ -0.078, -1.375, 3.231, -1.379, -2.274, 36.223 ], "bp2_params": [ 0.185, -0.127, 0.097, 3.176, -3.481, 1.221 ], "groove_widths": [ 10.466, 10.338, 17.427, 17.297 ], "simple_Rise": 3.195, "simple_Twist": 34.072, "simple_hRise": 3.233, "simple_hTwist": 34.111 }, { "index": 30, "nt1": "///H/30", "nt2": "///I/39", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.185, -0.127, 0.097, 3.176, -3.481, 1.221 ], "step_params": [ 0.195, -1.345, 3.307, 0.986, -1.721, 36.145 ], "heli_params": [ -1.918, -0.172, 3.369, -2.771, -1.587, 36.198 ], "bp2_params": [ -0.088, -0.172, -0.097, 2.038, -7.179, 1.471 ], "groove_widths": [ 10.533, 10.434, 19.353, 19.353 ], "simple_Rise": 3.307, "simple_Twist": 37.865, "simple_hRise": 3.367, "simple_hTwist": 37.915 }, { "index": 31, "nt1": "///H/31", "nt2": "///I/38", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.088, -0.172, -0.097, 2.038, -7.179, 1.471 ], "step_params": [ 0.698, 0.380, 3.239, 3.262, -2.131, 36.736 ], "heli_params": [ 0.887, -0.664, 3.260, -3.370, -5.158, 36.935 ], "bp2_params": [ -0.067, -0.128, -0.355, 2.133, -5.912, 1.901 ], "groove_widths": [ 10.396, null, 18.161, null ], "simple_Rise": 3.239, "simple_Twist": 36.618, "simple_hRise": 3.260, "simple_hTwist": 36.818 }, { "index": 32, "nt1": "///H/32", "nt2": "///I/37", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.067, -0.128, -0.355, 2.133, -5.912, 1.901 ], "step_params": [ -0.986, 0.877, 3.779, 0.704, -3.514, 36.079 ], "heli_params": [ 1.971, 1.698, 3.661, -5.657, -1.133, 36.251 ], "bp2_params": [ -0.080, -0.191, -0.096, 0.949, -11.073, 1.034 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.779, "simple_Twist": 36.081, "simple_hRise": 3.661, "simple_hTwist": 36.253 }, { "index": 33, "nt1": "///H/33", "nt2": "///I/36", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.080, -0.191, -0.096, 0.949, -11.073, 1.034 ], "step_params": [ 1.223, 0.718, 4.317, -1.049, -3.410, 45.676 ], "heli_params": [ 1.310, -1.691, 4.228, -4.385, 1.349, 45.808 ], "bp2_params": [ -0.094, -0.200, -0.192, -2.535, -5.893, 3.801 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 4.317, "simple_Twist": 45.695, "simple_hRise": 4.228, "simple_hTwist": 45.827 }, { "index": 34, "nt1": "///H/34", "nt2": "///I/35", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W" } ] } ], "num_stems": 1, "stems": [ { "index": 1, "helix_index": 1, "strand1": "AGATTTTATGTTTAGATCTTTTATGCTTGCTTTT", "strand2": "TCTAAAATACAAATCTAGAAAATACGAACGAAAA", "bp_type": "||||||||||||||||||||||||||||||||||", "helix_form": "BBBB.BB.BBBBBBB.BBBBBBB.BBBBB.BB.", "helical_rise": 3.122, "helical_rise_std": 0.815, "helical_radius": 10.358, "helical_radius_std": 3.832, "helical_axis": [ -0.663, -0.636, -0.396 ], "point1": [ 158.138, 157.791, 155.549 ], "point2": [ 90.017, 92.446, 114.856 ], "num_pairs": 34, "pairs": [ { "index": 1, "nt1": "///H/1", "nt2": "///I/68", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.031, -0.178, -0.066, -0.858, -0.801, 9.189 ], "step_params": [ -1.063, -0.326, 3.491, -1.568, -0.360, 32.883 ], "heli_params": [ -0.509, 1.589, 3.539, -0.636, 2.768, 32.921 ], "bp2_params": [ -0.183, -0.138, -0.201, -1.805, -1.068, 1.448 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.491, "simple_Twist": 34.201, "simple_hRise": 3.537, "simple_hTwist": 34.237 }, { "index": 2, "nt1": "///H/2", "nt2": "///I/67", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.183, -0.138, -0.201, -1.805, -1.068, 1.448 ], "step_params": [ -0.377, 0.175, 3.269, -1.661, 1.282, 43.090 ], "heli_params": [ 0.111, 0.349, 3.284, 1.744, 2.261, 43.139 ], "bp2_params": [ 0.045, -0.163, -0.275, 0.502, -4.646, 5.403 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.269, "simple_Twist": 41.684, "simple_hRise": 3.284, "simple_hTwist": 41.734 }, { "index": 3, "nt1": "///H/3", "nt2": "///I/66", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.045, -0.163, -0.275, 0.502, -4.646, 5.403 ], "step_params": [ -0.769, -0.850, 3.510, 2.263, -2.972, 34.620 ], "heli_params": [ -0.933, 1.656, 3.513, -4.977, -3.789, 34.815 ], "bp2_params": [ -0.074, -0.154, -0.321, 1.343, -8.001, 0.067 ], "groove_widths": [ 10.473, null, 17.616, null ], "simple_Rise": 3.510, "simple_Twist": 35.497, "simple_hRise": 3.514, "simple_hTwist": 35.687 }, { "index": 4, "nt1": "///H/4", "nt2": "///I/65", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.074, -0.154, -0.321, 1.343, -8.001, 0.067 ], "step_params": [ 0.631, 1.252, 3.566, 1.574, -4.644, 38.626 ], "heli_params": [ 2.483, -0.742, 3.421, -6.986, -2.367, 38.925 ], "bp2_params": [ -0.154, -0.047, -0.092, -1.133, -8.253, -1.222 ], "groove_widths": [ 10.020, 10.006, 17.416, 17.397 ], "simple_Rise": 3.566, "simple_Twist": 38.924, "simple_hRise": 3.422, "simple_hTwist": 39.220 }, { "index": 5, "nt1": "///H/5", "nt2": "///I/64", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.154, -0.047, -0.092, -1.133, -8.253, -1.222 ], "step_params": [ -0.137, -0.949, 3.225, -1.807, -0.964, 31.992 ], "heli_params": [ -1.547, -0.074, 3.254, -1.747, 3.275, 32.056 ], "bp2_params": [ -0.156, -0.180, -0.049, 0.733, -11.123, 3.606 ], "groove_widths": [ 10.771, 10.768, 17.549, 17.545 ], "simple_Rise": 3.225, "simple_Twist": 32.203, "simple_hRise": 3.254, "simple_hTwist": 32.266 }, { "index": 6, "nt1": "///H/6", "nt2": "///I/63", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.156, -0.180, -0.049, 0.733, -11.123, 3.606 ], "step_params": [ 0.990, 0.278, 3.206, 0.851, 1.025, 38.929 ], "heli_params": [ 0.295, -1.383, 3.232, 1.538, -1.276, 38.951 ], "bp2_params": [ -0.003, -0.197, 0.049, 0.624, -6.492, 5.596 ], "groove_widths": [ 11.021, 10.963, 18.458, 18.457 ], "simple_Rise": 3.206, "simple_Twist": 37.961, "simple_hRise": 3.233, "simple_hTwist": 37.984 }, { "index": 7, "nt1": "///H/7", "nt2": "///I/62", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.003, -0.197, 0.049, 0.624, -6.492, 5.596 ], "step_params": [ 0.063, 0.589, 3.392, -0.211, -1.316, 40.309 ], "heli_params": [ 1.008, -0.116, 3.372, -1.909, 0.306, 40.330 ], "bp2_params": [ 0.055, -0.120, 0.189, -1.202, -4.169, 3.609 ], "groove_widths": [ 10.839, 10.779, 18.906, 18.847 ], "simple_Rise": 3.392, "simple_Twist": 39.767, "simple_hRise": 3.372, "simple_hTwist": 39.788 }, { "index": 8, "nt1": "///H/8", "nt2": "///I/61", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.055, -0.120, 0.189, -1.202, -4.169, 3.609 ], "step_params": [ -0.336, -1.293, 3.277, -0.001, -0.825, 28.611 ], "heli_params": [ -2.428, 0.678, 3.312, -1.669, 0.002, 28.623 ], "bp2_params": [ -0.145, -0.088, 0.122, 1.068, -4.443, -0.729 ], "groove_widths": [ 11.185, 11.174, 18.663, 18.573 ], "simple_Rise": 3.277, "simple_Twist": 29.882, "simple_hRise": 3.310, "simple_hTwist": 29.893 }, { "index": 9, "nt1": "///H/9", "nt2": "///I/60", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.145, -0.088, 0.122, 1.068, -4.443, -0.729 ], "step_params": [ 0.186, 0.119, 3.308, 0.292, -0.118, 36.458 ], "heli_params": [ 0.207, -0.257, 3.309, -0.189, -0.466, 36.459 ], "bp2_params": [ -0.189, -0.132, 0.132, 0.521, -6.016, 0.854 ], "groove_widths": [ 11.055, 11.008, 17.347, 17.294 ], "simple_Rise": 3.308, "simple_Twist": 36.750, "simple_hRise": 3.309, "simple_hTwist": 36.752 }, { "index": 10, "nt1": "///H/10", "nt2": "///I/59", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.189, -0.132, 0.132, 0.521, -6.016, 0.854 ], "step_params": [ -0.183, -0.387, 3.261, 2.894, -1.993, 36.679 ], "heli_params": [ -0.342, 0.681, 3.253, -3.158, -4.586, 36.841 ], "bp2_params": [ -0.095, -0.160, -0.073, 2.560, -10.094, 0.655 ], "groove_widths": [ 10.869, 10.827, 17.354, 17.353 ], "simple_Rise": 3.261, "simple_Twist": 36.296, "simple_hRise": 3.253, "simple_hTwist": 36.460 }, { "index": 11, "nt1": "///H/11", "nt2": "///I/58", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.095, -0.160, -0.073, 2.560, -10.094, 0.655 ], "step_params": [ 0.532, 0.418, 3.315, 3.897, -1.231, 40.339 ], "heli_params": [ 0.743, -0.324, 3.336, -1.780, -5.633, 40.537 ], "bp2_params": [ -0.143, -0.151, 0.010, 0.800, -9.638, 0.169 ], "groove_widths": [ 11.046, 11.030, 16.491, 16.471 ], "simple_Rise": 3.315, "simple_Twist": 40.505, "simple_hRise": 3.336, "simple_hTwist": 40.702 }, { "index": 12, "nt1": "///H/12", "nt2": "///I/57", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.143, -0.151, 0.010, 0.800, -9.638, 0.169 ], "step_params": [ 0.016, 0.598, 3.341, -0.529, 0.008, 35.185 ], "heli_params": [ 0.988, -0.108, 3.340, 0.014, 0.875, 35.189 ], "bp2_params": [ -0.174, -0.061, 0.086, 1.830, -10.141, -4.003 ], "groove_widths": [ 11.278, 11.252, 16.370, 16.327 ], "simple_Rise": 3.341, "simple_Twist": 35.428, "simple_hRise": 3.340, "simple_hTwist": 35.432 }, { "index": 13, "nt1": "///H/13", "nt2": "///I/56", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.174, -0.061, 0.086, 1.830, -10.141, -4.003 ], "step_params": [ 0.372, 0.992, 3.367, -0.237, 0.485, 44.059 ], "heli_params": [ 1.276, -0.519, 3.376, 0.647, 0.316, 44.062 ], "bp2_params": [ 0.116, -0.078, -0.139, -0.891, -8.781, 0.324 ], "groove_widths": [ 10.844, 10.826, 17.397, 17.249 ], "simple_Rise": 3.367, "simple_Twist": 42.163, "simple_hRise": 3.376, "simple_hTwist": 42.167 }, { "index": 14, "nt1": "///H/14", "nt2": "///I/55", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.116, -0.078, -0.139, -0.891, -8.781, 0.324 ], "step_params": [ -0.192, -0.379, 3.273, -2.078, -0.792, 31.658 ], "heli_params": [ -0.547, -0.032, 3.287, -1.449, 3.803, 31.734 ], "bp2_params": [ -0.189, -0.105, -0.245, -1.793, -10.162, 0.855 ], "groove_widths": [ 9.990, 9.984, 18.353, 18.353 ], "simple_Rise": 3.273, "simple_Twist": 33.465, "simple_hRise": 3.287, "simple_hTwist": 33.537 }, { "index": 15, "nt1": "///H/15", "nt2": "///I/54", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.189, -0.105, -0.245, -1.793, -10.162, 0.855 ], "step_params": [ -0.444, 0.247, 3.096, -3.837, -1.557, 41.684 ], "heli_params": [ 0.500, 0.241, 3.112, -2.182, 5.376, 41.880 ], "bp2_params": [ 0.023, -0.109, -0.084, -3.787, -7.865, 4.246 ], "groove_widths": [ 10.297, 10.287, 17.259, 17.237 ], "simple_Rise": 3.096, "simple_Twist": 40.268, "simple_hRise": 3.112, "simple_hTwist": 40.471 }, { "index": 16, "nt1": "///H/16", "nt2": "///I/53", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.023, -0.109, -0.084, -3.787, -7.865, 4.246 ], "step_params": [ -0.646, -1.322, 3.125, -1.992, 0.708, 30.218 ], "heli_params": [ -2.667, 0.851, 3.129, 1.355, 3.815, 30.290 ], "bp2_params": [ -0.143, -0.053, -0.011, -1.297, -9.512, -0.324 ], "groove_widths": [ 11.306, 11.212, 18.962, 18.781 ], "simple_Rise": 3.125, "simple_Twist": 31.342, "simple_hRise": 3.129, "simple_hTwist": 31.412 }, { "index": 17, "nt1": "///H/17", "nt2": "///I/52", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.143, -0.053, -0.011, -1.297, -9.512, -0.324 ], "step_params": [ -0.403, 0.155, 3.176, -0.959, 3.035, 36.737 ], "heli_params": [ -0.156, 0.511, 3.188, 4.804, 1.518, 36.870 ], "bp2_params": [ 0.157, -0.162, -0.031, -2.983, -5.661, 0.299 ], "groove_widths": [ 12.459, 12.343, 18.580, 17.106 ], "simple_Rise": 3.176, "simple_Twist": 34.965, "simple_hRise": 3.188, "simple_hTwist": 35.106 }, { "index": 18, "nt1": "///H/18", "nt2": "///I/51", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.157, -0.162, -0.031, -2.983, -5.661, 0.299 ], "step_params": [ 0.452, -0.277, 3.041, 2.100, 2.131, 27.788 ], "heli_params": [ -1.044, -0.471, 3.037, 4.421, -4.356, 27.946 ], "bp2_params": [ -0.094, -0.106, -0.084, 0.806, -5.551, 4.187 ], "groove_widths": [ 13.359, 13.313, 18.412, 17.103 ], "simple_Rise": 3.041, "simple_Twist": 29.346, "simple_hRise": 3.038, "simple_hTwist": 29.494 }, { "index": 19, "nt1": "///H/19", "nt2": "///I/50", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.094, -0.106, -0.084, 0.806, -5.551, 4.187 ], "step_params": [ -0.839, -0.703, 3.220, 1.331, 5.511, 28.455 ], "heli_params": [ -2.569, 1.956, 2.992, 11.072, -2.674, 29.003 ], "bp2_params": [ -0.154, -0.061, -0.069, 2.596, -5.570, -4.662 ], "groove_widths": [ 12.364, 12.284, 18.586, 17.768 ], "simple_Rise": 3.220, "simple_Twist": 28.794, "simple_hRise": 2.995, "simple_hTwist": 29.335 }, { "index": 20, "nt1": "///H/20", "nt2": "///I/49", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.154, -0.061, -0.069, 2.596, -5.570, -4.662 ], "step_params": [ 0.960, -0.389, 3.152, 3.657, 4.301, 32.803 ], "heli_params": [ -1.377, -1.083, 3.162, 7.547, -6.416, 33.272 ], "bp2_params": [ 0.012, -0.157, -0.092, 1.342, -9.263, 2.959 ], "groove_widths": [ 11.210, 11.108, 19.327, 18.783 ], "simple_Rise": 3.152, "simple_Twist": 32.114, "simple_hRise": 3.161, "simple_hTwist": 32.594 }, { "index": 21, "nt1": "///H/21", "nt2": "///I/48", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.012, -0.157, -0.092, 1.342, -9.263, 2.959 ], "step_params": [ 0.475, 0.090, 3.181, 2.454, -0.963, 37.058 ], "heli_params": [ 0.266, -0.425, 3.201, -1.514, -3.854, 37.148 ], "bp2_params": [ -0.152, -0.105, -0.033, -1.917, -9.713, 1.921 ], "groove_widths": [ 11.375, 11.338, 17.463, 17.321 ], "simple_Rise": 3.181, "simple_Twist": 37.797, "simple_hRise": 3.201, "simple_hTwist": 37.885 }, { "index": 22, "nt1": "///H/22", "nt2": "///I/47", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.152, -0.105, -0.033, -1.917, -9.713, 1.921 ], "step_params": [ -0.852, -0.653, 3.333, 2.749, 3.745, 31.412 ], "heli_params": [ -1.878, 2.060, 3.152, 6.870, -5.042, 31.746 ], "bp2_params": [ 0.012, -0.045, -0.012, -2.329, -3.537, -3.210 ], "groove_widths": [ 10.849, 10.795, 18.383, 18.230 ], "simple_Rise": 3.333, "simple_Twist": 30.083, "simple_hRise": 3.142, "simple_hTwist": 30.431 }, { "index": 23, "nt1": "///H/23", "nt2": "///I/46", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.012, -0.045, -0.012, -2.329, -3.537, -3.210 ], "step_params": [ -0.063, 1.339, 3.330, 1.665, -6.370, 40.552 ], "heli_params": [ 2.593, 0.269, 3.089, -9.119, -2.383, 41.060 ], "bp2_params": [ 0.115, -0.235, -0.093, -2.722, -16.781, -9.332 ], "groove_widths": [ 10.348, 10.265, 17.610, 17.551 ], "simple_Rise": 3.330, "simple_Twist": 40.584, "simple_hRise": 3.089, "simple_hTwist": 41.092 }, { "index": 24, "nt1": "///H/24", "nt2": "///I/45", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.115, -0.235, -0.093, -2.722, -16.781, -9.332 ], "step_params": [ 1.211, -0.477, 3.064, -2.260, 4.549, 28.621 ], "heli_params": [ -1.862, -2.865, 2.854, 9.111, 4.527, 29.059 ], "bp2_params": [ -0.926, 0.759, 0.264, -6.755, -10.330, 9.942 ], "groove_widths": [ 11.049, 11.016, 17.646, 17.621 ], "simple_Rise": 3.064, "simple_Twist": 33.482, "simple_hRise": 2.891, "simple_hTwist": 33.855 }, { "index": 25, "nt1": "///H/25", "nt2": "///I/44", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.926, 0.759, 0.264, -6.755, -10.330, 9.942 ], "step_params": [ -0.994, 0.857, 3.137, -2.287, 0.385, 44.368 ], "heli_params": [ 1.099, 1.110, 3.189, 0.509, 3.026, 44.426 ], "bp2_params": [ 0.119, -0.381, 0.175, -6.442, -7.764, -2.838 ], "groove_widths": [ 12.179, 12.161, 16.900, 16.683 ], "simple_Rise": 3.137, "simple_Twist": 39.180, "simple_hRise": 3.196, "simple_hTwist": 39.246 }, { "index": 26, "nt1": "///H/26", "nt2": "///I/43", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.119, -0.381, 0.175, -6.442, -7.764, -2.838 ], "step_params": [ 0.693, -0.593, 3.096, 0.646, 0.989, 27.959 ], "heli_params": [ -1.449, -1.289, 3.089, 2.045, -1.337, 27.984 ], "bp2_params": [ -0.029, -0.085, 0.010, 0.309, -6.794, 2.948 ], "groove_widths": [ 12.443, 12.344, 17.667, 16.921 ], "simple_Rise": 3.096, "simple_Twist": 28.913, "simple_hRise": 3.089, "simple_hTwist": 28.937 }, { "index": 27, "nt1": "///H/27", "nt2": "///I/42", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.029, -0.085, 0.010, 0.309, -6.794, 2.948 ], "step_params": [ 0.107, -1.248, 3.279, 2.078, 1.511, 35.048 ], "heli_params": [ -2.292, 0.132, 3.225, 2.505, -3.445, 35.139 ], "bp2_params": [ -0.114, -0.064, -0.022, -1.625, -4.226, -2.236 ], "groove_widths": [ 12.100, 11.967, 18.034, 17.647 ], "simple_Rise": 3.279, "simple_Twist": 35.432, "simple_hRise": 3.226, "simple_hTwist": 35.522 }, { "index": 28, "nt1": "///H/28", "nt2": "///I/41", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.114, -0.064, -0.022, -1.625, -4.226, -2.236 ], "step_params": [ 0.681, -0.090, 3.079, -0.625, 4.125, 35.683 ], "heli_params": [ -0.699, -1.188, 3.038, 6.703, 1.016, 35.918 ], "bp2_params": [ -0.195, -0.123, 0.161, 0.898, -0.411, 0.309 ], "groove_widths": [ 11.312, 11.203, 18.766, 18.554 ], "simple_Rise": 3.079, "simple_Twist": 36.081, "simple_hRise": 3.039, "simple_hTwist": 36.313 }, { "index": 29, "nt1": "///H/29", "nt2": "///I/40", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.195, -0.123, 0.161, 0.898, -0.411, 0.309 ], "step_params": [ 0.976, -0.122, 3.195, 1.414, -0.857, 36.187 ], "heli_params": [ -0.078, -1.375, 3.231, -1.379, -2.274, 36.223 ], "bp2_params": [ 0.185, -0.127, 0.097, 3.176, -3.481, 1.221 ], "groove_widths": [ 10.466, 10.338, 17.427, 17.297 ], "simple_Rise": 3.195, "simple_Twist": 34.072, "simple_hRise": 3.233, "simple_hTwist": 34.111 }, { "index": 30, "nt1": "///H/30", "nt2": "///I/39", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.185, -0.127, 0.097, 3.176, -3.481, 1.221 ], "step_params": [ 0.195, -1.345, 3.307, 0.986, -1.721, 36.145 ], "heli_params": [ -1.918, -0.172, 3.369, -2.771, -1.587, 36.198 ], "bp2_params": [ -0.088, -0.172, -0.097, 2.038, -7.179, 1.471 ], "groove_widths": [ 10.533, 10.434, 19.353, 19.353 ], "simple_Rise": 3.307, "simple_Twist": 37.865, "simple_hRise": 3.367, "simple_hTwist": 37.915 }, { "index": 31, "nt1": "///H/31", "nt2": "///I/38", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.088, -0.172, -0.097, 2.038, -7.179, 1.471 ], "step_params": [ 0.698, 0.380, 3.239, 3.262, -2.131, 36.736 ], "heli_params": [ 0.887, -0.664, 3.260, -3.370, -5.158, 36.935 ], "bp2_params": [ -0.067, -0.128, -0.355, 2.133, -5.912, 1.901 ], "groove_widths": [ 10.396, null, 18.161, null ], "simple_Rise": 3.239, "simple_Twist": 36.618, "simple_hRise": 3.260, "simple_hTwist": 36.818 }, { "index": 32, "nt1": "///H/32", "nt2": "///I/37", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.067, -0.128, -0.355, 2.133, -5.912, 1.901 ], "step_params": [ -0.986, 0.877, 3.779, 0.704, -3.514, 36.079 ], "heli_params": [ 1.971, 1.698, 3.661, -5.657, -1.133, 36.251 ], "bp2_params": [ -0.080, -0.191, -0.096, 0.949, -11.073, 1.034 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.779, "simple_Twist": 36.081, "simple_hRise": 3.661, "simple_hTwist": 36.253 }, { "index": 33, "nt1": "///H/33", "nt2": "///I/36", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.080, -0.191, -0.096, 0.949, -11.073, 1.034 ], "step_params": [ 1.223, 0.718, 4.317, -1.049, -3.410, 45.676 ], "heli_params": [ 1.310, -1.691, 4.228, -4.385, 1.349, 45.808 ], "bp2_params": [ -0.094, -0.200, -0.192, -2.535, -5.893, 3.801 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 4.317, "simple_Twist": 45.695, "simple_hRise": 4.228, "simple_hTwist": 45.827 }, { "index": 34, "nt1": "///H/34", "nt2": "///I/35", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W" } ] } ], "num_stacks": 1, "stacks": [ { "index": 1, "num_nts": 2, "nts_short": "Ea", "nts_long": "///D/298,///D/901" } ], "nonStack": { "num_nts": 4, "nts_short": "Aaaa", "nts_long": "///I/35,///E/901,///A/1001,///G/901" }, "num_ssSegments": 4, "ssSegments": [ { "index": 1, "num_nts": 1, "nts_short": "a", "nts_long": "///D/901" }, { "index": 2, "num_nts": 1, "nts_short": "a", "nts_long": "///E/901" }, { "index": 3, "num_nts": 1, "nts_short": "a", "nts_long": "///A/1001" }, { "index": 4, "num_nts": 1, "nts_short": "a", "nts_long": "///G/901" } ], "dbn": { "all_chains": { "num_nts": 72, "num_chars": 77, "bseq": "AGATTTTATGTTTAGATCTTTTATGCTTGCTTTT&AAAAGCAAGCATAAAAGATCTAAACATAAAATCT&a&a&a&a", "bseqUP": "AGATTTTATGTTTAGATCTTTTATGCTTGCTTTT&AAAAGCAAGCATAAAAGATCTAAACATAAAATCT&A&A&A&A", "sstr": "((((((((((((((((((((((((((((((((((&))))))))))))))))))))))))))))))))))&.&.&.&.", "form": "BBBB.BB.BBBBBBB.BBBBBBBBB..BB.B..-&.BB.BB.B.BB.BB.BB.BBBBBBB.BB...BB-&-&-&-&-" }, "chain_H": { "num_nts": 34, "num_chars": 34, "bseq": "AGATTTTATGTTTAGATCTTTTATGCTTGCTTTT", "bseqUP": "AGATTTTATGTTTAGATCTTTTATGCTTGCTTTT", "sstr": "((((((((((((((((((((((((((((((((((", "form": "BBBB.BB.BBBBBBB.BBBBBBBBB..BB.B..-" }, "chain_I": { "num_nts": 34, "num_chars": 34, "bseq": "AAAAGCAAGCATAAAAGATCTAAACATAAAATCT", "bseqUP": "AAAAGCAAGCATAAAAGATCTAAACATAAAATCT", "sstr": "))))))))))))))))))))))))))))))))))", "form": ".BB.BB.B.BB.BB.BB.BBBBBBB.BB...BB-" } }, "chains": { "chain_H": { "num_nts": 34, "bseq": "AGATTTTATGTTTAGATCTTTTATGCTTGCTTTT", "sstr": "((((((((((((((((((((((((((((((((((", "form": "BBBB.BB.BBBBBBB.BBBBBBBBB..BB.B..-", "helical_rise": 3.124, "helical_rise_std": 0.770, "helical_axis": [ -0.672, -0.621, -0.404 ], "point1": [ 160.112, 158.318, 156.560 ], "point2": [ 91.045, 94.457, 115.025 ], "num_chars": 100, "suite": "A!!G!!A!!T!!T!!T!!T!!A!!T!!G!!T!!T!!T4bA!!G!!A!!T!!C!!T1bT!!T!!T!!A4bT!!G!!C!!T!!T!!G!!C!!T!!T4bT!!T" }, "chain_I": { "num_nts": 34, "bseq": "AAAAGCAAGCATAAAAGATCTAAACATAAAATCT", "sstr": "))))))))))))))))))))))))))))))))))", "form": ".BB.BB.B.BB.BB.BB.BBBBBBB.BB...BB-", "helical_rise": 3.114, "helical_rise_std": 0.862, "helical_axis": [ 0.651, 0.650, 0.392 ], "point1": [ 89.276, 90.409, 114.411 ], "point2": [ 156.059, 157.018, 154.656 ], "num_chars": 100, "suite": "A!!A!!A!!A!!G!!C!!A!!A!!G!!C!!A!!T!!A!!A!!A!!A!!G!!A!!T!!C!!T!!A!!A!!A!!C!!A!!T4bA!!A!!A!!A!!T!!C!!T" } }, "num_nts": 72, "nts": [ { "index": 1, "index_chain": 1, "chain_name": "H", "nt_resnum": 1, "nt_name": "DA", "nt_code": "A", "nt_id": "///H/1", "linked_nts": [ null, "///H/2" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix-end,stem-end", "alpha": null, "beta": 123.047, "gamma": -45.913, "delta": 147.721, "epsilon": -151.780, "zeta": -147.618, "epsilon_zeta": -4.162, "bb_type": "--", "chi": -99.375, "glyco_bond": "anti", "C5prime_xyz": [ -2.574, 8.058, -2.051 ], "P_xyz": [ -1.819, 10.417, -1.211 ], "form": "B", "ssZp": 1.982, "Dp": 1.974, "splay_angle": 21.794, "splay_distance": 3.619, "splay_ratio": 0.189, "d22": null, "d64": null, "eta": null, "theta": 179.277, "eta_prime": null, "theta_prime": -176.510, "eta_base": null, "theta_base": -143.636, "v0": -25.112, "v1": 40.481, "v2": -39.415, "v3": 26.107, "v4": -0.948, "amplitude": 41.356, "phase_angle": 162.375, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.036, "frame": { "rmsd": 0.009, "origin": [ 159.668, 150.740, 163.815 ], "x_axis": [ -0.637, 0.143, 0.758 ], "y_axis": [ -0.138, 0.946, -0.294 ], "z_axis": [ -0.758, -0.292, -0.582 ], "quaternion": [ -0.426, 0.001, 0.890, -0.165 ] } }, { "index": 2, "index_chain": 2, "chain_name": "H", "nt_resnum": 2, "nt_name": "DG", "nt_code": "G", "nt_id": "///H/2", "linked_nts": [ "///H/1", "///H/3" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -66.516, "beta": 144.773, "gamma": 66.355, "delta": 137.948, "epsilon": -163.000, "zeta": -120.411, "epsilon_zeta": -42.589, "bb_type": "BI", "chi": -126.851, "glyco_bond": "anti", "C5prime_xyz": [ -2.447, 8.736, -1.042 ], "P_xyz": [ 0.091, 9.401, -1.130 ], "form": "B", "ssZp": 2.147, "Dp": 2.269, "splay_angle": 20.455, "splay_distance": 3.244, "splay_ratio": 0.179, "d22": null, "d64": null, "eta": 165.118, "theta": -143.431, "eta_prime": -168.985, "theta_prime": -163.248, "eta_base": -135.041, "theta_base": -116.258, "v0": -32.576, "v1": 42.541, "v2": -35.631, "v3": 17.957, "v4": 8.765, "amplitude": 41.574, "phase_angle": 148.987, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.003, "frame": { "rmsd": 0.003, "origin": [ 157.796, 149.083, 161.198 ], "x_axis": [ -0.628, 0.582, 0.517 ], "y_axis": [ 0.213, 0.767, -0.605 ], "z_axis": [ -0.748, -0.270, -0.606 ], "quaternion": [ -0.365, 0.230, 0.866, -0.252 ] } }, { "index": 3, "index_chain": 3, "chain_name": "H", "nt_resnum": 3, "nt_name": "DA", "nt_code": "A", "nt_id": "///H/3", "linked_nts": [ "///H/2", "///H/4" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": -106.513, "beta": 170.086, "gamma": 91.338, "delta": 149.838, "epsilon": -157.023, "zeta": -130.209, "epsilon_zeta": -26.814, "bb_type": "--", "chi": -122.781, "glyco_bond": "anti", "C5prime_xyz": [ -1.783, 8.552, -0.951 ], "P_xyz": [ 0.828, 8.791, -1.126 ], "form": "B", "ssZp": 1.782, "Dp": 1.870, "splay_angle": 21.295, "splay_distance": 3.666, "splay_ratio": 0.187, "d22": null, "d64": null, "eta": 160.298, "theta": -122.203, "eta_prime": -165.634, "theta_prime": -153.155, "eta_base": -113.447, "theta_base": -127.058, "v0": -19.101, "v1": 36.417, "v2": -38.877, "v3": 28.838, "v4": -6.381, "amplitude": 39.433, "phase_angle": 170.372, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.036, "frame": { "rmsd": 0.005, "origin": [ 155.514, 148.132, 159.098 ], "x_axis": [ -0.302, 0.951, -0.072 ], "y_axis": [ 0.593, 0.129, -0.795 ], "z_axis": [ -0.746, -0.283, -0.603 ], "quaternion": [ -0.236, 0.541, 0.713, -0.378 ] } }, { "index": 4, "index_chain": 4, "chain_name": "H", "nt_resnum": 4, "nt_name": "DT", "nt_code": "T", "nt_id": "///H/4", "linked_nts": [ "///H/3", "///H/5" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": 16.207, "beta": 171.684, "gamma": -31.331, "delta": 162.142, "epsilon": -145.030, "zeta": -96.652, "epsilon_zeta": -48.378, "bb_type": "BI", "chi": -90.432, "glyco_bond": "anti", "C5prime_xyz": [ -1.843, 7.704, -2.223 ], "P_xyz": [ -0.319, 9.845, -2.195 ], "form": "B", "ssZp": 1.230, "Dp": 1.412, "splay_angle": 23.218, "splay_distance": 3.938, "splay_ratio": 0.204, "d22": 4.747, "d64": 3.970, "eta": 178.088, "theta": -147.693, "eta_prime": -162.373, "theta_prime": -158.273, "eta_base": -131.355, "theta_base": -106.266, "v0": -9.633, "v1": 33.463, "v2": -43.274, "v3": 38.660, "v4": -18.428, "amplitude": 43.513, "phase_angle": 185.997, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.105, "frame": { "rmsd": 0.003, "origin": [ 152.418, 146.571, 157.906 ], "x_axis": [ -0.017, 0.846, -0.533 ], "y_axis": [ 0.623, -0.408, -0.667 ], "z_axis": [ -0.782, -0.343, -0.520 ], "quaternion": [ -0.117, 0.691, 0.531, -0.476 ] } }, { "index": 5, "index_chain": 5, "chain_name": "H", "nt_resnum": 5, "nt_name": "DT", "nt_code": "T", "nt_id": "///H/5", "linked_nts": [ "///H/4", "///H/6" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": -115.133, "beta": 87.156, "gamma": 143.221, "delta": 154.224, "epsilon": -161.041, "zeta": -130.995, "epsilon_zeta": -30.046, "bb_type": "--", "chi": -133.214, "glyco_bond": "anti", "C5prime_xyz": [ -1.702, 8.674, -0.310 ], "P_xyz": [ -0.524, 8.935, -2.639 ], "form": ".", "ssZp": 1.489, "Dp": 1.865, "splay_angle": 19.035, "splay_distance": 3.416, "splay_ratio": 0.174, "d22": 4.369, "d64": 4.193, "eta": -107.006, "theta": 136.590, "eta_prime": -144.456, "theta_prime": -175.516, "eta_base": -99.378, "theta_base": -130.605, "v0": -19.201, "v1": 38.653, "v2": -42.261, "v3": 32.127, "v4": -8.395, "amplitude": 42.635, "phase_angle": 172.410, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.004, "origin": [ 150.371, 145.020, 154.921 ], "x_axis": [ 0.292, 0.384, -0.876 ], "y_axis": [ 0.482, -0.850, -0.212 ], "z_axis": [ -0.826, -0.361, -0.433 ], "quaternion": [ 0.046, 0.802, 0.270, -0.530 ] } }, { "index": 6, "index_chain": 6, "chain_name": "H", "nt_resnum": 6, "nt_name": "DT", "nt_code": "T", "nt_id": "///H/6", "linked_nts": [ "///H/5", "///H/7" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": 31.569, "beta": 137.107, "gamma": -33.471, "delta": 142.521, "epsilon": 179.677, "zeta": -104.758, "epsilon_zeta": -75.565, "bb_type": "BI", "chi": -95.561, "glyco_bond": "anti", "C5prime_xyz": [ -2.289, 7.932, -2.328 ], "P_xyz": [ -0.975, 10.145, -1.866 ], "form": "B", "ssZp": 1.857, "Dp": 2.001, "splay_angle": 20.457, "splay_distance": 3.452, "splay_ratio": 0.178, "d22": 3.929, "d64": 3.379, "eta": 154.371, "theta": -154.993, "eta_prime": -176.798, "theta_prime": -157.381, "eta_base": -130.612, "theta_base": -102.027, "v0": -20.052, "v1": 34.147, "v2": -34.841, "v3": 24.007, "v4": -2.868, "amplitude": 35.955, "phase_angle": 165.705, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22m", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.006, "origin": [ 147.318, 144.882, 153.395 ], "x_axis": [ 0.472, -0.181, -0.863 ], "y_axis": [ 0.219, -0.924, 0.313 ], "z_axis": [ -0.854, -0.337, -0.396 ], "quaternion": [ 0.195, 0.835, 0.012, -0.514 ] } }, { "index": 7, "index_chain": 7, "chain_name": "H", "nt_resnum": 7, "nt_name": "DT", "nt_code": "T", "nt_id": "///H/7", "linked_nts": [ "///H/6", "///H/8" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": -47.280, "beta": 171.358, "gamma": 44.531, "delta": 141.726, "epsilon": -145.250, "zeta": -151.102, "epsilon_zeta": 5.852, "bb_type": "--", "chi": -104.240, "glyco_bond": "anti", "C5prime_xyz": [ -2.545, 8.216, -2.020 ], "P_xyz": [ -0.336, 9.598, -2.085 ], "form": "B", "ssZp": 1.784, "Dp": 1.857, "splay_angle": 21.099, "splay_distance": 3.523, "splay_ratio": 0.185, "d22": null, "d64": null, "eta": 179.694, "theta": -158.232, "eta_prime": -156.245, "theta_prime": -165.863, "eta_base": -100.215, "theta_base": -115.558, "v0": -29.444, "v1": 41.778, "v2": -37.598, "v3": 21.737, "v4": 4.481, "amplitude": 41.486, "phase_angle": 154.997, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.105, "frame": { "rmsd": 0.006, "origin": [ 145.404, 143.058, 151.174 ], "x_axis": [ 0.529, -0.720, -0.450 ], "y_axis": [ -0.203, -0.622, 0.757 ], "z_axis": [ -0.824, -0.309, -0.475 ], "quaternion": [ 0.329, 0.810, -0.285, -0.393 ] } }, { "index": 8, "index_chain": 8, "chain_name": "H", "nt_resnum": 8, "nt_name": "DA", "nt_code": "A", "nt_id": "///H/8", "linked_nts": [ "///H/7", "///H/9" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -35.414, "beta": 140.053, "gamma": 38.114, "delta": 131.751, "epsilon": -177.451, "zeta": -108.921, "epsilon_zeta": -68.530, "bb_type": "BI", "chi": -110.424, "glyco_bond": "anti", "C5prime_xyz": [ -2.353, 8.350, -1.894 ], "P_xyz": [ 0.123, 9.132, -1.773 ], "form": ".", "ssZp": 2.109, "Dp": 2.209, "splay_angle": 19.519, "splay_distance": 3.514, "splay_ratio": 0.176, "d22": null, "d64": null, "eta": 165.062, "theta": -139.323, "eta_prime": -167.594, "theta_prime": -161.297, "eta_base": -114.402, "theta_base": -135.868, "v0": -28.809, "v1": 36.409, "v2": -30.135, "v3": 14.298, "v4": 8.797, "amplitude": 35.842, "phase_angle": 147.224, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.006, "origin": [ 142.476, 141.508, 149.978 ], "x_axis": [ 0.272, -0.954, 0.126 ], "y_axis": [ -0.500, -0.028, 0.865 ], "z_axis": [ -0.822, -0.299, -0.485 ], "quaternion": [ 0.436, 0.668, -0.544, -0.260 ] } }, { "index": 9, "index_chain": 9, "chain_name": "H", "nt_resnum": 9, "nt_name": "DT", "nt_code": "T", "nt_id": "///H/9", "linked_nts": [ "///H/8", "///H/10" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": -28.316, "beta": 178.562, "gamma": 17.752, "delta": 140.319, "epsilon": -155.920, "zeta": -135.085, "epsilon_zeta": -20.835, "bb_type": "--", "chi": -109.161, "glyco_bond": "anti", "C5prime_xyz": [ -2.442, 8.372, -1.820 ], "P_xyz": [ -0.769, 10.328, -1.435 ], "form": "B", "ssZp": 2.027, "Dp": 2.055, "splay_angle": 19.883, "splay_distance": 3.318, "splay_ratio": 0.173, "d22": null, "d64": null, "eta": 179.320, "theta": -162.712, "eta_prime": -165.440, "theta_prime": -163.964, "eta_base": -134.279, "theta_base": -115.765, "v0": -30.082, "v1": 41.560, "v2": -36.678, "v3": 20.245, "v4": 5.853, "amplitude": 41.125, "phase_angle": 153.107, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.105, "frame": { "rmsd": 0.002, "origin": [ 140.512, 140.607, 147.207 ], "x_axis": [ 0.001, -0.874, 0.485 ], "y_axis": [ -0.596, 0.389, 0.702 ], "z_axis": [ -0.803, -0.289, -0.521 ], "quaternion": [ -0.466, -0.532, 0.691, 0.149 ] } }, { "index": 10, "index_chain": 10, "chain_name": "H", "nt_resnum": 10, "nt_name": "DG", "nt_code": "G", "nt_id": "///H/10", "linked_nts": [ "///H/9", "///H/11" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -46.038, "beta": 149.041, "gamma": 49.281, "delta": 137.860, "epsilon": -164.020, "zeta": -121.203, "epsilon_zeta": -42.817, "bb_type": "BI", "chi": -115.378, "glyco_bond": "anti", "C5prime_xyz": [ -2.465, 8.520, -1.605 ], "P_xyz": [ -0.042, 9.462, -1.503 ], "form": "B", "ssZp": 2.018, "Dp": 2.149, "splay_angle": 18.958, "splay_distance": 3.186, "splay_ratio": 0.166, "d22": null, "d64": null, "eta": 168.349, "theta": -143.315, "eta_prime": -163.096, "theta_prime": -161.107, "eta_base": -112.376, "theta_base": -121.184, "v0": -31.504, "v1": 41.680, "v2": -35.552, "v3": 18.307, "v4": 7.897, "amplitude": 40.988, "phase_angle": 150.157, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.006, "frame": { "rmsd": 0.006, "origin": [ 137.783, 139.437, 145.725 ], "x_axis": [ -0.375, -0.467, 0.801 ], "y_axis": [ -0.494, 0.832, 0.253 ], "z_axis": [ -0.784, -0.301, -0.543 ], "quaternion": [ -0.478, -0.290, 0.829, -0.014 ] } }, { "index": 11, "index_chain": 11, "chain_name": "H", "nt_resnum": 11, "nt_name": "DT", "nt_code": "T", "nt_id": "///H/11", "linked_nts": [ "///H/10", "///H/12" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -54.522, "beta": 166.809, "gamma": 49.440, "delta": 140.210, "epsilon": -156.772, "zeta": -146.399, "epsilon_zeta": -10.374, "bb_type": "--", "chi": -107.914, "glyco_bond": "anti", "C5prime_xyz": [ -2.519, 8.322, -1.927 ], "P_xyz": [ -0.247, 9.598, -1.939 ], "form": "B", "ssZp": 1.838, "Dp": 1.981, "splay_angle": 20.540, "splay_distance": 3.418, "splay_ratio": 0.178, "d22": 4.525, "d64": 3.745, "eta": 174.215, "theta": -146.465, "eta_prime": -162.680, "theta_prime": -156.814, "eta_base": -118.981, "theta_base": -106.498, "v0": -30.398, "v1": 41.940, "v2": -37.097, "v3": 20.528, "v4": 5.775, "amplitude": 41.549, "phase_angle": 153.235, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.105, "frame": { "rmsd": 0.007, "origin": [ 135.517, 137.966, 144.038 ], "x_axis": [ -0.664, 0.085, 0.743 ], "y_axis": [ -0.240, 0.917, -0.320 ], "z_axis": [ -0.708, -0.391, -0.588 ], "quaternion": [ -0.407, -0.044, 0.890, -0.199 ] } }, { "index": 12, "index_chain": 12, "chain_name": "H", "nt_resnum": 12, "nt_name": "DT", "nt_code": "T", "nt_id": "///H/12", "linked_nts": [ "///H/11", "///H/13" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": -0.562, "beta": 141.785, "gamma": 6.632, "delta": 148.088, "epsilon": -155.592, "zeta": -170.159, "epsilon_zeta": 14.567, "bb_type": "--", "chi": -89.069, "glyco_bond": "anti", "C5prime_xyz": [ -2.674, 7.791, -2.483 ], "P_xyz": [ -0.514, 9.260, -2.416 ], "form": "B", "ssZp": 1.811, "Dp": 1.928, "splay_angle": 20.586, "splay_distance": 3.431, "splay_ratio": 0.180, "d22": 4.404, "d64": 3.635, "eta": 171.365, "theta": -158.580, "eta_prime": -163.917, "theta_prime": -166.363, "eta_base": -111.116, "theta_base": -122.046, "v0": -25.160, "v1": 41.143, "v2": -40.559, "v3": 26.846, "v4": -1.310, "amplitude": 42.410, "phase_angle": 163.007, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.105, "frame": { "rmsd": 0.004, "origin": [ 132.589, 137.195, 142.450 ], "x_axis": [ -0.697, 0.630, 0.342 ], "y_axis": [ 0.166, 0.606, -0.778 ], "z_axis": [ -0.698, -0.485, -0.527 ], "quaternion": [ -0.309, 0.237, 0.841, -0.375 ] } }, { "index": 13, "index_chain": 13, "chain_name": "H", "nt_resnum": 13, "nt_name": "DT", "nt_code": "T", "nt_id": "///H/13", "linked_nts": [ "///H/12", "///H/14" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": -6.063, "beta": 121.660, "gamma": 27.454, "delta": 141.727, "epsilon": -147.975, "zeta": -155.761, "epsilon_zeta": 7.786, "bb_type": "--", "chi": -99.115, "glyco_bond": "anti", "C5prime_xyz": [ -2.917, 8.133, -2.162 ], "P_xyz": [ -0.478, 9.046, -2.015 ], "form": "B", "ssZp": 1.985, "Dp": 2.009, "splay_angle": 20.799, "splay_distance": 3.439, "splay_ratio": 0.185, "d22": null, "d64": null, "eta": 174.851, "theta": -152.976, "eta_prime": -161.481, "theta_prime": -168.530, "eta_base": -117.097, "theta_base": -107.464, "v0": -33.199, "v1": 45.416, "v2": -39.659, "v3": 21.561, "v4": 6.936, "amplitude": 44.779, "phase_angle": 152.334, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.105, "frame": { "rmsd": 0.003, "origin": [ 130.245, 136.015, 140.240 ], "x_axis": [ -0.502, 0.853, -0.142 ], "y_axis": [ 0.483, 0.140, -0.864 ], "z_axis": [ -0.717, -0.502, -0.483 ], "quaternion": [ -0.197, 0.459, 0.729, -0.469 ] } }, { "index": 14, "index_chain": 14, "chain_name": "H", "nt_resnum": 14, "nt_name": "DA", "nt_code": "A", "nt_id": "///H/14", "linked_nts": [ "///H/13", "///H/15" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -44.043, "beta": 141.640, "gamma": 47.151, "delta": 140.340, "epsilon": -165.149, "zeta": -119.364, "epsilon_zeta": -45.785, "bb_type": "BI", "chi": -111.572, "glyco_bond": "anti", "C5prime_xyz": [ -1.971, 8.387, -1.716 ], "P_xyz": [ 0.624, 8.709, -1.582 ], "form": "B", "ssZp": 1.940, "Dp": 2.033, "splay_angle": 19.147, "splay_distance": 3.263, "splay_ratio": 0.167, "d22": null, "d64": null, "eta": 167.458, "theta": -134.682, "eta_prime": -164.311, "theta_prime": -159.027, "eta_base": -100.889, "theta_base": -122.319, "v0": -22.325, "v1": 35.188, "v2": -34.083, "v3": 21.979, "v4": -0.051, "amplitude": 35.980, "phase_angle": 161.311, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "4b", "suiteness": 0.019, "filter_rmsd": 0.039, "frame": { "rmsd": 0.005, "origin": [ 128.322, 134.896, 137.618 ], "x_axis": [ 0.007, 0.696, -0.718 ], "y_axis": [ 0.666, -0.539, -0.516 ], "z_axis": [ -0.746, -0.475, -0.467 ], "quaternion": [ -0.014, 0.709, 0.480, -0.516 ] } }, { "index": 15, "index_chain": 15, "chain_name": "H", "nt_resnum": 15, "nt_name": "DG", "nt_code": "G", "nt_id": "///H/15", "linked_nts": [ "///H/14", "///H/16" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": -52.665, "beta": 155.723, "gamma": 53.436, "delta": 139.612, "epsilon": -148.953, "zeta": -134.422, "epsilon_zeta": -14.531, "bb_type": "--", "chi": -120.115, "glyco_bond": "anti", "C5prime_xyz": [ -2.589, 8.652, -1.385 ], "P_xyz": [ -0.267, 9.835, -1.209 ], "form": "B", "ssZp": 1.884, "Dp": 2.039, "splay_angle": 19.675, "splay_distance": 3.199, "splay_ratio": 0.172, "d22": null, "d64": null, "eta": 172.230, "theta": -154.596, "eta_prime": -160.880, "theta_prime": -166.344, "eta_base": -118.159, "theta_base": -114.916, "v0": -34.554, "v1": 45.534, "v2": -38.581, "v3": 19.781, "v4": 8.880, "amplitude": 44.653, "phase_angle": 149.772, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.005, "frame": { "rmsd": 0.005, "origin": [ 125.612, 133.616, 136.327 ], "x_axis": [ 0.335, 0.290, -0.896 ], "y_axis": [ 0.567, -0.822, -0.054 ], "z_axis": [ -0.752, -0.491, -0.440 ], "quaternion": [ 0.136, 0.806, 0.266, -0.511 ] } }, { "index": 16, "index_chain": 16, "chain_name": "H", "nt_resnum": 16, "nt_name": "DA", "nt_code": "A", "nt_id": "///H/16", "linked_nts": [ "///H/15", "///H/17" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -73.201, "beta": 156.999, "gamma": 61.764, "delta": 141.063, "epsilon": -164.649, "zeta": -114.618, "epsilon_zeta": -50.031, "bb_type": "BI", "chi": -121.461, "glyco_bond": "anti", "C5prime_xyz": [ -1.930, 8.595, -1.199 ], "P_xyz": [ 0.637, 9.103, -0.998 ], "form": ".", "ssZp": 1.918, "Dp": 2.022, "splay_angle": 19.355, "splay_distance": 3.497, "splay_ratio": 0.175, "d22": null, "d64": null, "eta": 161.769, "theta": -127.925, "eta_prime": -169.461, "theta_prime": -152.905, "eta_base": -113.159, "theta_base": -128.778, "v0": -23.622, "v1": 36.394, "v2": -34.834, "v3": 22.116, "v4": 0.609, "amplitude": 37.013, "phase_angle": 160.242, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.037, "frame": { "rmsd": 0.007, "origin": [ 123.229, 131.904, 135.055 ], "x_axis": [ 0.624, -0.363, -0.692 ], "y_axis": [ 0.207, -0.778, 0.594 ], "z_axis": [ -0.754, -0.513, -0.410 ], "quaternion": [ 0.330, 0.838, -0.047, -0.431 ] } }, { "index": 17, "index_chain": 17, "chain_name": "H", "nt_resnum": 17, "nt_name": "DT", "nt_code": "T", "nt_id": "///H/17", "linked_nts": [ "///H/16", "///H/18" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": -16.818, "beta": 177.067, "gamma": -2.956, "delta": 149.373, "epsilon": -154.341, "zeta": -139.503, "epsilon_zeta": -14.837, "bb_type": "--", "chi": -103.397, "glyco_bond": "anti", "C5prime_xyz": [ -2.224, 8.240, -1.910 ], "P_xyz": [ -0.749, 10.350, -1.449 ], "form": "B", "ssZp": 1.804, "Dp": 1.869, "splay_angle": 18.978, "splay_distance": 3.176, "splay_ratio": 0.165, "d22": 4.409, "d64": 3.551, "eta": 171.606, "theta": -161.608, "eta_prime": -168.624, "theta_prime": -162.750, "eta_base": -136.576, "theta_base": -117.914, "v0": -23.772, "v1": 40.345, "v2": -40.781, "v3": 28.020, "v4": -2.960, "amplitude": 42.178, "phase_angle": 165.210, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.105, "frame": { "rmsd": 0.004, "origin": [ 120.434, 131.505, 132.991 ], "x_axis": [ 0.633, -0.695, -0.341 ], "y_axis": [ -0.126, -0.528, 0.840 ], "z_axis": [ -0.763, -0.489, -0.422 ], "quaternion": [ 0.413, 0.804, -0.255, -0.344 ] } }, { "index": 18, "index_chain": 18, "chain_name": "H", "nt_resnum": 18, "nt_name": "DC", "nt_code": "C", "nt_id": "///H/18", "linked_nts": [ "///H/17", "///H/19" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -34.745, "beta": 157.516, "gamma": 25.815, "delta": 137.647, "epsilon": -161.920, "zeta": -114.578, "epsilon_zeta": -47.343, "bb_type": "BI", "chi": -106.351, "glyco_bond": "anti", "C5prime_xyz": [ -2.058, 8.321, -1.971 ], "P_xyz": [ 0.273, 9.452, -1.676 ], "form": "B", "ssZp": 1.919, "Dp": 2.045, "splay_angle": 17.125, "splay_distance": 3.042, "splay_ratio": 0.150, "d22": 3.880, "d64": 3.587, "eta": 169.830, "theta": -136.238, "eta_prime": -171.095, "theta_prime": -152.398, "eta_base": -123.591, "theta_base": -113.822, "v0": -23.222, "v1": 34.269, "v2": -31.912, "v3": 19.319, "v4": 2.180, "amplitude": 34.500, "phase_angle": 157.664, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.065, "frame": { "rmsd": 0.009, "origin": [ 118.058, 129.870, 131.659 ], "x_axis": [ 0.477, -0.838, 0.263 ], "y_axis": [ -0.508, -0.019, 0.861 ], "z_axis": [ -0.717, -0.545, -0.435 ], "quaternion": [ 0.506, 0.695, -0.484, -0.163 ] } }, { "index": 19, "index_chain": 19, "chain_name": "H", "nt_resnum": 19, "nt_name": "DT", "nt_code": "T", "nt_id": "///H/19", "linked_nts": [ "///H/18", "///H/20" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,BI,canonical,non-pair-contact,helix,stem", "alpha": -37.915, "beta": 151.682, "gamma": 31.989, "delta": 98.181, "epsilon": 175.631, "zeta": -93.521, "epsilon_zeta": -90.848, "bb_type": "BI", "chi": -123.580, "glyco_bond": "anti", "C5prime_xyz": [ -2.880, 8.541, -1.708 ], "P_xyz": [ -0.818, 10.094, -2.049 ], "form": "B", "ssZp": 2.817, "Dp": 3.002, "splay_angle": 19.830, "splay_distance": 3.417, "splay_ratio": 0.172, "d22": 4.412, "d64": 4.118, "eta": 164.182, "theta": -170.685, "eta_prime": -178.858, "theta_prime": -172.603, "eta_base": -131.670, "theta_base": -150.245, "v0": -36.421, "v1": 21.633, "v2": -0.171, "v3": -20.674, "v4": 36.119, "amplitude": 37.317, "phase_angle": 90.263, "puckering": "O4'-endo", "sugar_class": "--", "bin": "23p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.003, "origin": [ 116.364, 127.737, 130.304 ], "x_axis": [ 0.169, -0.734, 0.657 ], "y_axis": [ -0.744, 0.342, 0.574 ], "z_axis": [ -0.646, -0.586, -0.489 ], "quaternion": [ 0.506, 0.573, -0.645, 0.005 ] } }, { "index": 20, "index_chain": 20, "chain_name": "H", "nt_resnum": 20, "nt_name": "DT", "nt_code": "T", "nt_id": "///H/20", "linked_nts": [ "///H/19", "///H/21" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -46.924, "beta": 172.404, "gamma": 50.693, "delta": 134.912, "epsilon": -164.644, "zeta": -112.879, "epsilon_zeta": -51.765, "bb_type": "BI", "chi": -117.871, "glyco_bond": "anti", "C5prime_xyz": [ -2.318, 8.582, -1.558 ], "P_xyz": [ -0.100, 9.920, -1.299 ], "form": "B", "ssZp": 2.020, "Dp": 2.138, "splay_angle": 18.820, "splay_distance": 3.346, "splay_ratio": 0.168, "d22": 3.822, "d64": 3.584, "eta": 179.473, "theta": -134.856, "eta_prime": -159.235, "theta_prime": -145.431, "eta_base": -135.316, "theta_base": -97.231, "v0": -31.646, "v1": 40.567, "v2": -33.816, "v3": 16.500, "v4": 9.216, "amplitude": 39.857, "phase_angle": 148.042, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1b", "suiteness": 0.081, "filter_rmsd": 0.106, "frame": { "rmsd": 0.005, "origin": [ 114.820, 125.782, 127.965 ], "x_axis": [ -0.091, -0.477, 0.874 ], "y_axis": [ -0.800, 0.558, 0.221 ], "z_axis": [ -0.593, -0.679, -0.433 ], "quaternion": [ 0.508, 0.443, -0.722, 0.159 ] } }, { "index": 21, "index_chain": 21, "chain_name": "H", "nt_resnum": 21, "nt_name": "DT", "nt_code": "T", "nt_id": "///H/21", "linked_nts": [ "///H/20", "///H/22" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -18.094, "beta": 160.303, "gamma": 9.000, "delta": 148.398, "epsilon": -130.279, "zeta": -162.284, "epsilon_zeta": 32.005, "bb_type": "--", "chi": -97.283, "glyco_bond": "anti", "C5prime_xyz": [ -2.894, 8.077, -2.161 ], "P_xyz": [ -1.201, 10.062, -2.061 ], "form": "B", "ssZp": 1.614, "Dp": 1.662, "splay_angle": 18.934, "splay_distance": 3.238, "splay_ratio": 0.165, "d22": 4.142, "d64": 3.611, "eta": 175.025, "theta": -158.065, "eta_prime": -157.249, "theta_prime": -164.514, "eta_base": -104.888, "theta_base": -112.818, "v0": -32.125, "v1": 46.997, "v2": -43.053, "v3": 25.689, "v4": 3.671, "amplitude": 46.881, "phase_angle": 156.686, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.104, "frame": { "rmsd": 0.004, "origin": [ 112.951, 123.007, 127.905 ], "x_axis": [ -0.533, -0.038, 0.845 ], "y_axis": [ -0.649, 0.659, -0.380 ], "z_axis": [ -0.543, -0.751, -0.376 ], "quaternion": [ -0.433, -0.214, 0.801, -0.353 ] } }, { "index": 22, "index_chain": 22, "chain_name": "H", "nt_resnum": 22, "nt_name": "DT", "nt_code": "T", "nt_id": "///H/22", "linked_nts": [ "///H/21", "///H/23" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": -36.736, "beta": 128.170, "gamma": 38.083, "delta": 119.026, "epsilon": -165.230, "zeta": -136.811, "epsilon_zeta": -28.419, "bb_type": "--", "chi": -115.640, "glyco_bond": "anti", "C5prime_xyz": [ -3.167, 8.387, -1.915 ], "P_xyz": [ -0.926, 9.680, -2.072 ], "form": "B", "ssZp": 2.240, "Dp": 2.342, "splay_angle": 20.216, "splay_distance": 3.488, "splay_ratio": 0.177, "d22": null, "d64": null, "eta": 170.504, "theta": -155.135, "eta_prime": -168.639, "theta_prime": -165.341, "eta_base": -114.807, "theta_base": -139.406, "v0": -42.336, "v1": 41.676, "v2": -25.581, "v3": 2.046, "v4": 24.892, "amplitude": 43.126, "phase_angle": 126.382, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.105, "frame": { "rmsd": 0.004, "origin": [ 110.773, 120.719, 127.193 ], "x_axis": [ -0.836, 0.326, 0.441 ], "y_axis": [ -0.237, 0.510, -0.827 ], "z_axis": [ -0.494, -0.796, -0.349 ], "quaternion": [ -0.285, 0.027, 0.821, -0.494 ] } }, { "index": 23, "index_chain": 23, "chain_name": "H", "nt_resnum": 23, "nt_name": "DA", "nt_code": "A", "nt_id": "///H/23", "linked_nts": [ "///H/22", "///H/24" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": 14.597, "beta": 162.435, "gamma": -21.229, "delta": 158.155, "epsilon": -144.792, "zeta": -172.298, "epsilon_zeta": 27.506, "bb_type": "--", "chi": -89.236, "glyco_bond": "anti", "C5prime_xyz": [ -2.148, 7.770, -2.323 ], "P_xyz": [ -0.541, 9.835, -2.161 ], "form": "B", "ssZp": 1.436, "Dp": 1.594, "splay_angle": 20.834, "splay_distance": 3.531, "splay_ratio": 0.188, "d22": null, "d64": null, "eta": 179.731, "theta": -175.682, "eta_prime": -166.233, "theta_prime": -176.163, "eta_base": -138.828, "theta_base": -121.711, "v0": -17.640, "v1": 39.083, "v2": -44.534, "v3": 34.953, "v4": -11.128, "amplitude": 44.668, "phase_angle": 175.560, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.009, "origin": [ 109.461, 117.523, 126.715 ], "x_axis": [ -0.801, 0.598, 0.014 ], "y_axis": [ 0.141, 0.212, -0.967 ], "z_axis": [ -0.582, -0.773, -0.254 ], "quaternion": [ -0.198, 0.245, 0.753, -0.578 ] } }, { "index": 24, "index_chain": 24, "chain_name": "H", "nt_resnum": 24, "nt_name": "DT", "nt_code": "T", "nt_id": "///H/24", "linked_nts": [ "///H/23", "///H/25" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -36.466, "beta": 121.518, "gamma": 55.100, "delta": 138.642, "epsilon": -158.833, "zeta": -126.255, "epsilon_zeta": -32.578, "bb_type": "BI", "chi": -108.260, "glyco_bond": "anti", "C5prime_xyz": [ -2.641, 8.360, -1.924 ], "P_xyz": [ -0.052, 8.596, -2.144 ], "form": "B", "ssZp": 1.919, "Dp": 2.062, "splay_angle": 19.275, "splay_distance": 3.325, "splay_ratio": 0.169, "d22": null, "d64": null, "eta": 168.683, "theta": -125.488, "eta_prime": -157.166, "theta_prime": -156.653, "eta_base": -105.808, "theta_base": -105.131, "v0": -32.078, "v1": 42.850, "v2": -36.994, "v3": 19.466, "v4": 7.549, "amplitude": 42.281, "phase_angle": 151.038, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "4b", "suiteness": 0.010, "filter_rmsd": 0.105, "frame": { "rmsd": 0.005, "origin": [ 108.049, 114.861, 124.875 ], "x_axis": [ -0.681, 0.396, -0.616 ], "y_axis": [ 0.586, -0.211, -0.783 ], "z_axis": [ -0.440, -0.894, -0.088 ], "quaternion": [ -0.071, -0.393, -0.624, 0.672 ] } }, { "index": 25, "index_chain": 25, "chain_name": "H", "nt_resnum": 25, "nt_name": "DG", "nt_code": "G", "nt_id": "///H/25", "linked_nts": [ "///H/24", "///H/26" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem", "alpha": -35.403, "beta": 151.485, "gamma": 31.366, "delta": 144.578, "epsilon": -119.576, "zeta": -166.604, "epsilon_zeta": 47.028, "bb_type": "BII", "chi": -108.687, "glyco_bond": "anti", "C5prime_xyz": [ -2.794, 8.439, -1.760 ], "P_xyz": [ -0.669, 9.939, -1.495 ], "form": "B", "ssZp": 1.426, "Dp": 1.552, "splay_angle": 18.695, "splay_distance": 3.145, "splay_ratio": 0.162, "d22": null, "d64": null, "eta": 178.364, "theta": -158.034, "eta_prime": -156.973, "theta_prime": -165.946, "eta_base": -102.400, "theta_base": -121.489, "v0": -34.448, "v1": 47.433, "v2": -41.387, "v3": 22.749, "v4": 6.967, "amplitude": 46.628, "phase_angle": 152.573, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.007, "frame": { "rmsd": 0.007, "origin": [ 105.975, 112.536, 123.711 ], "x_axis": [ -0.114, 0.275, -0.955 ], "y_axis": [ 0.872, -0.433, -0.229 ], "z_axis": [ -0.476, -0.858, -0.190 ], "quaternion": [ 0.256, 0.614, 0.467, -0.582 ] } }, { "index": 26, "index_chain": 26, "chain_name": "H", "nt_resnum": 26, "nt_name": "DC", "nt_code": "C", "nt_id": "///H/26", "linked_nts": [ "///H/25", "///H/27" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -39.542, "beta": 145.900, "gamma": 15.023, "delta": 136.885, "epsilon": -176.632, "zeta": -101.583, "epsilon_zeta": -75.049, "bb_type": "BI", "chi": -103.167, "glyco_bond": "anti", "C5prime_xyz": [ -2.207, 8.254, -2.125 ], "P_xyz": [ 0.088, 9.470, -1.842 ], "form": ".", "ssZp": 2.101, "Dp": 2.178, "splay_angle": 17.476, "splay_distance": 3.119, "splay_ratio": 0.156, "d22": 3.768, "d64": 3.689, "eta": 159.794, "theta": -137.596, "eta_prime": -179.858, "theta_prime": -154.250, "eta_base": -130.638, "theta_base": -112.982, "v0": -24.803, "v1": 35.559, "v2": -32.441, "v3": 18.898, "v4": 3.433, "amplitude": 35.570, "phase_angle": 155.788, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.064, "frame": { "rmsd": 0.007, "origin": [ 104.404, 109.821, 123.488 ], "x_axis": [ 0.436, -0.070, -0.897 ], "y_axis": [ 0.750, -0.523, 0.405 ], "z_axis": [ -0.498, -0.849, -0.176 ], "quaternion": [ 0.429, 0.731, 0.233, -0.477 ] } }, { "index": 27, "index_chain": 27, "chain_name": "H", "nt_resnum": 27, "nt_name": "DT", "nt_code": "T", "nt_id": "///H/27", "linked_nts": [ "///H/26", "///H/28" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -56.760, "beta": 161.706, "gamma": 59.077, "delta": 114.018, "epsilon": 178.579, "zeta": -95.363, "epsilon_zeta": -86.058, "bb_type": "BI", "chi": -126.717, "glyco_bond": "anti", "C5prime_xyz": [ -2.965, 8.624, -1.449 ], "P_xyz": [ -0.899, 10.157, -1.821 ], "form": ".", "ssZp": 2.636, "Dp": 2.627, "splay_angle": 19.597, "splay_distance": 3.498, "splay_ratio": 0.178, "d22": 4.299, "d64": 4.236, "eta": 171.498, "theta": -157.375, "eta_prime": -165.751, "theta_prime": -165.838, "eta_base": -117.094, "theta_base": -131.153, "v0": -41.480, "v1": 37.206, "v2": -19.408, "v3": -3.706, "v4": 28.139, "amplitude": 40.822, "phase_angle": 118.387, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.104, "frame": { "rmsd": 0.004, "origin": [ 103.076, 107.485, 121.904 ], "x_axis": [ 0.750, -0.339, -0.568 ], "y_axis": [ 0.371, -0.496, 0.785 ], "z_axis": [ -0.548, -0.800, -0.247 ], "quaternion": [ 0.502, 0.789, 0.010, -0.353 ] } }, { "index": 28, "index_chain": 28, "chain_name": "H", "nt_resnum": 28, "nt_name": "DT", "nt_code": "T", "nt_id": "///H/28", "linked_nts": [ "///H/27", "///H/29" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -47.120, "beta": -175.141, "gamma": 35.822, "delta": 141.053, "epsilon": -159.550, "zeta": -152.741, "epsilon_zeta": -6.809, "bb_type": "--", "chi": -112.468, "glyco_bond": "anti", "C5prime_xyz": [ -2.439, 8.479, -1.685 ], "P_xyz": [ -0.590, 10.265, -1.199 ], "form": "B", "ssZp": 2.033, "Dp": 2.108, "splay_angle": 19.266, "splay_distance": 3.251, "splay_ratio": 0.168, "d22": null, "d64": null, "eta": 177.550, "theta": -148.169, "eta_prime": -162.677, "theta_prime": -151.311, "eta_base": -123.770, "theta_base": -103.859, "v0": -30.660, "v1": 42.927, "v2": -38.119, "v3": 21.345, "v4": 5.504, "amplitude": 42.486, "phase_angle": 153.793, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.105, "frame": { "rmsd": 0.002, "origin": [ 101.379, 105.301, 119.763 ], "x_axis": [ 0.847, -0.529, -0.052 ], "y_axis": [ -0.120, -0.285, 0.951 ], "z_axis": [ -0.517, -0.799, -0.305 ], "quaternion": [ 0.561, 0.781, -0.208, -0.182 ] } }, { "index": 29, "index_chain": 29, "chain_name": "H", "nt_resnum": 29, "nt_name": "DG", "nt_code": "G", "nt_id": "///H/29", "linked_nts": [ "///H/28", "///H/30" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": 17.279, "beta": 122.347, "gamma": -3.338, "delta": 134.441, "epsilon": -172.083, "zeta": -97.048, "epsilon_zeta": -75.035, "bb_type": "BI", "chi": -99.268, "glyco_bond": "anti", "C5prime_xyz": [ -2.716, 8.110, -2.247 ], "P_xyz": [ -0.695, 9.669, -1.669 ], "form": "B", "ssZp": 2.292, "Dp": 2.384, "splay_angle": 19.870, "splay_distance": 3.382, "splay_ratio": 0.173, "d22": null, "d64": null, "eta": 161.491, "theta": -148.450, "eta_prime": -176.736, "theta_prime": -161.955, "eta_base": -122.326, "theta_base": -110.326, "v0": -30.188, "v1": 38.578, "v2": -31.901, "v3": 15.322, "v4": 9.098, "amplitude": 37.823, "phase_angle": 147.503, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.006, "frame": { "rmsd": 0.006, "origin": [ 100.526, 102.305, 118.834 ], "x_axis": [ 0.647, -0.520, 0.558 ], "y_axis": [ -0.631, 0.047, 0.775 ], "z_axis": [ -0.428, -0.853, -0.298 ], "quaternion": [ 0.591, 0.689, -0.417, 0.047 ] } }, { "index": 30, "index_chain": 30, "chain_name": "H", "nt_resnum": 30, "nt_name": "DC", "nt_code": "C", "nt_id": "///H/30", "linked_nts": [ "///H/29", "///H/31" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": -101.173, "beta": 114.200, "gamma": 135.412, "delta": 149.950, "epsilon": -159.111, "zeta": -127.485, "epsilon_zeta": -31.626, "bb_type": "--", "chi": -147.973, "glyco_bond": "anti", "C5prime_xyz": [ -2.043, 8.829, 0.321 ], "P_xyz": [ -0.220, 9.813, -1.274 ], "form": ".", "ssZp": 1.381, "Dp": 2.133, "splay_angle": 19.124, "splay_distance": 3.484, "splay_ratio": 0.179, "d22": 4.419, "d64": 4.250, "eta": -136.862, "theta": -167.642, "eta_prime": -139.295, "theta_prime": -157.824, "eta_base": -87.987, "theta_base": -116.645, "v0": -27.387, "v1": 44.068, "v2": -42.714, "v3": 28.034, "v4": -0.725, "amplitude": 44.911, "phase_angle": 162.007, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.003, "origin": [ 99.788, 99.005, 118.725 ], "x_axis": [ 0.124, -0.428, 0.895 ], "y_axis": [ -0.909, 0.312, 0.275 ], "z_axis": [ -0.397, -0.848, -0.350 ], "quaternion": [ 0.521, 0.539, -0.620, 0.231 ] } }, { "index": 31, "index_chain": 31, "chain_name": "H", "nt_resnum": 31, "nt_name": "DT", "nt_code": "T", "nt_id": "///H/31", "linked_nts": [ "///H/30", "///H/32" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": 42.486, "beta": 132.804, "gamma": -45.923, "delta": 158.324, "epsilon": -158.297, "zeta": -155.793, "epsilon_zeta": -2.505, "bb_type": "--", "chi": -89.351, "glyco_bond": "anti", "C5prime_xyz": [ -2.293, 7.771, -2.363 ], "P_xyz": [ -1.189, 10.123, -1.972 ], "form": "B", "ssZp": 1.640, "Dp": 1.727, "splay_angle": 19.288, "splay_distance": 3.219, "splay_ratio": 0.168, "d22": 4.099, "d64": 3.458, "eta": 150.557, "theta": -162.183, "eta_prime": -176.893, "theta_prime": -162.492, "eta_base": -129.726, "theta_base": -108.451, "v0": -18.398, "v1": 39.314, "v2": -44.279, "v3": 34.679, "v4": -10.458, "amplitude": 44.467, "phase_angle": 174.728, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22m", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.105, "frame": { "rmsd": 0.004, "origin": [ 99.682, 95.654, 117.779 ], "x_axis": [ -0.459, -0.208, 0.864 ], "y_axis": [ -0.814, 0.488, -0.315 ], "z_axis": [ -0.356, -0.848, -0.393 ], "quaternion": [ -0.399, -0.334, 0.765, -0.380 ] } }, { "index": 32, "index_chain": 32, "chain_name": "H", "nt_resnum": 32, "nt_name": "DT", "nt_code": "T", "nt_id": "///H/32", "linked_nts": [ "///H/31", "///H/33" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": -10.591, "beta": 132.110, "gamma": 20.872, "delta": 139.553, "epsilon": -149.111, "zeta": -160.058, "epsilon_zeta": 10.948, "bb_type": "--", "chi": -97.474, "glyco_bond": "anti", "C5prime_xyz": [ -3.018, 8.078, -2.197 ], "P_xyz": [ -0.726, 9.331, -2.190 ], "form": ".", "ssZp": 2.133, "Dp": 2.132, "splay_angle": 24.818, "splay_distance": 4.100, "splay_ratio": 0.222, "d22": 5.616, "d64": 4.644, "eta": 172.417, "theta": -172.348, "eta_prime": -165.158, "theta_prime": -178.829, "eta_base": -109.980, "theta_base": -139.407, "v0": -33.714, "v1": 44.762, "v2": -37.951, "v3": 19.403, "v4": 8.642, "amplitude": 43.867, "phase_angle": 149.896, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.105, "frame": { "rmsd": 0.004, "origin": [ 97.787, 93.151, 117.067 ], "x_axis": [ -0.869, 0.086, 0.487 ], "y_axis": [ -0.405, 0.443, -0.800 ], "z_axis": [ -0.284, -0.893, -0.350 ], "quaternion": [ -0.236, -0.098, 0.816, -0.519 ] } }, { "index": 33, "index_chain": 33, "chain_name": "H", "nt_resnum": 33, "nt_name": "DT", "nt_code": "T", "nt_id": "///H/33", "linked_nts": [ "///H/32", "///H/34" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -61.713, "beta": 146.953, "gamma": 66.033, "delta": 140.968, "epsilon": -174.345, "zeta": -98.950, "epsilon_zeta": -75.395, "bb_type": "BI", "chi": -111.809, "glyco_bond": "anti", "C5prime_xyz": [ -1.976, 8.383, -1.677 ], "P_xyz": [ 0.623, 8.459, -2.005 ], "form": ".", "ssZp": 2.049, "Dp": 2.123, "splay_angle": 27.551, "splay_distance": 4.513, "splay_ratio": 0.238, "d22": 4.839, "d64": 4.258, "eta": 168.958, "theta": -120.149, "eta_prime": -162.142, "theta_prime": -149.165, "eta_base": -124.596, "theta_base": -99.832, "v0": -20.770, "v1": 33.821, "v2": -33.368, "v3": 22.182, "v4": -1.172, "amplitude": 34.877, "phase_angle": 163.082, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "4b", "suiteness": 0.024, "filter_rmsd": 0.106, "frame": { "rmsd": 0.003, "origin": [ 97.364, 89.786, 114.764 ], "x_axis": [ -0.967, 0.231, -0.106 ], "y_axis": [ 0.174, 0.296, -0.939 ], "z_axis": [ -0.185, -0.927, -0.326 ], "quaternion": [ -0.025, 0.126, 0.805, -0.580 ] } }, { "index": 34, "index_chain": 34, "chain_name": "H", "nt_resnum": 34, "nt_name": "DT", "nt_code": "T", "nt_id": "///H/34", "linked_nts": [ "///H/33", null ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix-end,stem-end", "alpha": -60.477, "beta": -177.909, "gamma": 52.778, "delta": 138.515, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": -102.639, "glyco_bond": "anti", "C5prime_xyz": [ -2.212, 8.138, -2.113 ], "P_xyz": [ 0.191, 9.197, -2.153 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": -21.496, "v1": 32.967, "v2": -31.462, "v3": 19.915, "v4": 0.717, "amplitude": 33.484, "phase_angle": 159.989, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.004, "origin": [ 95.604, 86.518, 112.196 ], "x_axis": [ -0.537, 0.350, -0.768 ], "y_axis": [ 0.826, 0.032, -0.563 ], "z_axis": [ -0.172, -0.936, -0.306 ], "quaternion": [ 0.218, 0.429, 0.685, -0.547 ] } }, { "index": 35, "index_chain": 1, "chain_name": "I", "nt_resnum": 35, "nt_name": "DA", "nt_code": "A", "nt_id": "///I/35", "linked_nts": [ null, "///I/36" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,non-stack,canonical,non-pair-contact,helix-end,stem-end", "alpha": null, "beta": 154.280, "gamma": 174.978, "delta": 140.285, "epsilon": -164.800, "zeta": -110.029, "epsilon_zeta": -54.771, "bb_type": "BI", "chi": -140.681, "glyco_bond": "anti", "C5prime_xyz": [ -2.109, 8.788, -0.242 ], "P_xyz": [ -0.992, 10.548, -1.834 ], "form": ".", "ssZp": 1.973, "Dp": 2.233, "splay_angle": 30.049, "splay_distance": 4.577, "splay_ratio": 0.264, "d22": null, "d64": null, "eta": null, "theta": 163.150, "eta_prime": null, "theta_prime": -169.486, "eta_base": null, "theta_base": -129.159, "v0": -28.059, "v1": 39.547, "v2": -35.303, "v3": 20.136, "v4": 4.669, "amplitude": 39.158, "phase_angle": 154.366, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.036, "frame": { "rmsd": 0.005, "origin": [ 95.672, 86.384, 111.945 ], "x_axis": [ -0.568, 0.442, -0.694 ], "y_axis": [ -0.780, -0.018, 0.626 ], "z_axis": [ 0.264, 0.897, 0.355 ], "quaternion": [ 0.439, -0.154, 0.546, 0.697 ] } }, { "index": 36, "index_chain": 2, "chain_name": "I", "nt_resnum": 36, "nt_name": "DA", "nt_code": "A", "nt_id": "///I/36", "linked_nts": [ "///I/35", "///I/37" ], "nt_type": "DNA", "dbn": ")", "summary": "~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -99.744, "beta": -138.906, "gamma": 70.407, "delta": 141.131, "epsilon": 169.617, "zeta": -96.171, "epsilon_zeta": -94.211, "bb_type": "BI", "chi": -84.193, "glyco_bond": "--", "C5prime_xyz": [ -1.893, 7.261, -2.761 ], "P_xyz": [ 0.655, 7.809, -2.558 ], "form": "B", "ssZp": 1.419, "Dp": 1.973, "splay_angle": 23.201, "splay_distance": 3.909, "splay_ratio": 0.202, "d22": null, "d64": null, "eta": 172.234, "theta": -133.101, "eta_prime": -166.452, "theta_prime": -154.689, "eta_base": -129.386, "theta_base": -107.250, "v0": -3.980, "v1": 19.492, "v2": -26.623, "v3": 24.935, "v4": -13.490, "amplitude": 27.062, "phase_angle": 190.343, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.037, "frame": { "rmsd": 0.004, "origin": [ 97.293, 89.783, 114.546 ], "x_axis": [ -0.917, 0.398, -0.023 ], "y_axis": [ -0.161, -0.316, 0.935 ], "z_axis": [ 0.365, 0.861, 0.354 ], "quaternion": [ 0.174, 0.106, 0.558, 0.804 ] } }, { "index": 37, "index_chain": 3, "chain_name": "I", "nt_resnum": 37, "nt_name": "DA", "nt_code": "A", "nt_id": "///I/37", "linked_nts": [ "///I/36", "///I/38" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": -54.796, "beta": 164.935, "gamma": 62.511, "delta": 139.405, "epsilon": -154.229, "zeta": -138.579, "epsilon_zeta": -15.650, "bb_type": "--", "chi": -107.602, "glyco_bond": "anti", "C5prime_xyz": [ -2.583, 8.304, -1.870 ], "P_xyz": [ -0.196, 9.253, -2.316 ], "form": "B", "ssZp": 2.116, "Dp": 2.111, "splay_angle": 20.979, "splay_distance": 3.453, "splay_ratio": 0.185, "d22": null, "d64": null, "eta": 177.812, "theta": -165.269, "eta_prime": -152.359, "theta_prime": -179.185, "eta_base": -102.841, "theta_base": -134.646, "v0": -30.486, "v1": 41.513, "v2": -36.063, "v3": 19.475, "v4": 6.606, "amplitude": 40.862, "phase_angle": 151.953, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.036, "frame": { "rmsd": 0.004, "origin": [ 97.558, 92.906, 116.881 ], "x_axis": [ -0.821, 0.161, 0.548 ], "y_axis": [ 0.420, -0.479, 0.771 ], "z_axis": [ 0.387, 0.863, 0.326 ], "quaternion": [ -0.080, 0.288, 0.504, 0.810 ] } }, { "index": 38, "index_chain": 4, "chain_name": "I", "nt_resnum": 38, "nt_name": "DA", "nt_code": "A", "nt_id": "///I/38", "linked_nts": [ "///I/37", "///I/39" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -81.879, "beta": 139.800, "gamma": 85.327, "delta": 146.593, "epsilon": -178.352, "zeta": -96.272, "epsilon_zeta": -82.080, "bb_type": "BI", "chi": -132.642, "glyco_bond": "anti", "C5prime_xyz": [ -2.027, 8.723, -0.560 ], "P_xyz": [ 0.560, 8.930, -0.960 ], "form": ".", "ssZp": 1.831, "Dp": 2.222, "splay_angle": 21.346, "splay_distance": 3.669, "splay_ratio": 0.195, "d22": null, "d64": null, "eta": 146.992, "theta": -104.675, "eta_prime": -163.118, "theta_prime": -151.013, "eta_base": -115.768, "theta_base": -120.793, "v0": -26.322, "v1": 41.266, "v2": -39.671, "v3": 25.602, "v4": 0.105, "amplitude": 41.962, "phase_angle": 160.979, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.036, "frame": { "rmsd": 0.005, "origin": [ 99.466, 95.643, 117.773 ], "x_axis": [ -0.388, -0.114, 0.914 ], "y_axis": [ 0.811, -0.514, 0.280 ], "z_axis": [ 0.438, 0.850, 0.292 ], "quaternion": [ -0.312, 0.456, 0.382, 0.741 ] } }, { "index": 39, "index_chain": 5, "chain_name": "I", "nt_resnum": 39, "nt_name": "DG", "nt_code": "G", "nt_id": "///I/39", "linked_nts": [ "///I/38", "///I/40" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -102.928, "beta": -156.252, "gamma": 65.930, "delta": 141.334, "epsilon": -156.420, "zeta": -138.603, "epsilon_zeta": -17.816, "bb_type": "--", "chi": -108.304, "glyco_bond": "anti", "C5prime_xyz": [ -2.591, 8.363, -1.839 ], "P_xyz": [ -0.465, 9.860, -1.516 ], "form": "B", "ssZp": 2.003, "Dp": 2.063, "splay_angle": 20.159, "splay_distance": 3.317, "splay_ratio": 0.175, "d22": null, "d64": null, "eta": 161.458, "theta": -162.435, "eta_prime": -173.276, "theta_prime": -170.414, "eta_base": -131.806, "theta_base": -132.925, "v0": -30.360, "v1": 42.281, "v2": -37.508, "v3": 21.144, "v4": 5.389, "amplitude": 41.815, "phase_angle": 153.767, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.004, "frame": { "rmsd": 0.004, "origin": [ 99.687, 99.205, 118.627 ], "x_axis": [ 0.169, -0.383, 0.908 ], "y_axis": [ 0.883, -0.350, -0.312 ], "z_axis": [ 0.438, 0.855, 0.279 ], "quaternion": [ 0.524, -0.557, -0.225, -0.604 ] } }, { "index": 40, "index_chain": 6, "chain_name": "I", "nt_resnum": 40, "nt_name": "DC", "nt_code": "C", "nt_id": "///I/40", "linked_nts": [ "///I/39", "///I/41" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -66.339, "beta": 159.333, "gamma": 58.803, "delta": 139.915, "epsilon": -158.540, "zeta": -106.129, "epsilon_zeta": -52.411, "bb_type": "BI", "chi": -118.479, "glyco_bond": "anti", "C5prime_xyz": [ -2.035, 8.631, -1.394 ], "P_xyz": [ 0.500, 9.285, -1.272 ], "form": "B", "ssZp": 1.975, "Dp": 2.041, "splay_angle": 18.364, "splay_distance": 3.061, "splay_ratio": 0.160, "d22": null, "d64": null, "eta": 170.062, "theta": -136.693, "eta_prime": -169.321, "theta_prime": -159.397, "eta_base": -129.199, "theta_base": -125.820, "v0": -26.061, "v1": 37.888, "v2": -34.793, "v3": 20.754, "v4": 3.060, "amplitude": 37.900, "phase_angle": 156.638, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.004, "origin": [ 100.644, 102.348, 119.085 ], "x_axis": [ 0.653, -0.514, 0.556 ], "y_axis": [ 0.620, -0.057, -0.782 ], "z_axis": [ 0.434, 0.856, 0.281 ], "quaternion": [ 0.685, -0.598, -0.045, -0.414 ] } }, { "index": 41, "index_chain": 7, "chain_name": "I", "nt_resnum": 41, "nt_name": "DA", "nt_code": "A", "nt_id": "///I/41", "linked_nts": [ "///I/40", "///I/42" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": -128.642, "beta": 142.750, "gamma": 117.664, "delta": 146.705, "epsilon": -156.695, "zeta": -129.384, "epsilon_zeta": -27.311, "bb_type": "--", "chi": -136.159, "glyco_bond": "anti", "C5prime_xyz": [ -1.932, 8.754, -0.337 ], "P_xyz": [ 0.326, 9.297, -1.531 ], "form": ".", "ssZp": 1.795, "Dp": 2.010, "splay_angle": 19.754, "splay_distance": 3.522, "splay_ratio": 0.179, "d22": null, "d64": null, "eta": 163.217, "theta": -134.277, "eta_prime": -165.304, "theta_prime": -160.199, "eta_base": -126.943, "theta_base": -120.371, "v0": -24.923, "v1": 40.223, "v2": -39.356, "v3": 25.951, "v4": -0.933, "amplitude": 41.273, "phase_angle": 162.469, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.037, "frame": { "rmsd": 0.005, "origin": [ 101.457, 105.207, 119.815 ], "x_axis": [ 0.877, -0.480, 0.009 ], "y_axis": [ 0.168, 0.289, -0.943 ], "z_axis": [ 0.450, 0.829, 0.334 ], "quaternion": [ 0.791, -0.560, 0.139, -0.205 ] } }, { "index": 42, "index_chain": 8, "chain_name": "I", "nt_resnum": 42, "nt_name": "DA", "nt_code": "A", "nt_id": "///I/42", "linked_nts": [ "///I/41", "///I/43" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": 27.596, "beta": 150.704, "gamma": -37.745, "delta": 132.455, "epsilon": 148.965, "zeta": -63.033, "epsilon_zeta": -148.002, "bb_type": "BI", "chi": -107.329, "glyco_bond": "anti", "C5prime_xyz": [ -1.679, 8.142, -1.870 ], "P_xyz": [ -0.232, 10.253, -1.333 ], "form": "B", "ssZp": 1.804, "Dp": 1.881, "splay_angle": 19.362, "splay_distance": 3.343, "splay_ratio": 0.170, "d22": null, "d64": null, "eta": 161.887, "theta": -152.710, "eta_prime": -171.904, "theta_prime": -154.291, "eta_base": -125.224, "theta_base": -129.867, "v0": -10.067, "v1": 21.872, "v2": -24.850, "v3": 19.665, "v4": -6.314, "amplitude": 24.925, "phase_angle": 175.544, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22m", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.007, "origin": [ 103.137, 107.443, 121.956 ], "x_axis": [ 0.789, -0.216, -0.575 ], "y_axis": [ -0.413, 0.506, -0.757 ], "z_axis": [ 0.454, 0.835, 0.310 ], "quaternion": [ 0.807, -0.493, 0.319, 0.061 ] } }, { "index": 43, "index_chain": 9, "chain_name": "I", "nt_resnum": 43, "nt_name": "DG", "nt_code": "G", "nt_id": "///I/43", "linked_nts": [ "///I/42", "///I/44" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": -94.021, "beta": -147.027, "gamma": 42.405, "delta": 142.469, "epsilon": -150.649, "zeta": -153.626, "epsilon_zeta": 2.976, "bb_type": "--", "chi": -90.089, "glyco_bond": "anti", "C5prime_xyz": [ -2.978, 7.818, -2.387 ], "P_xyz": [ -1.094, 9.776, -2.195 ], "form": ".", "ssZp": 2.055, "Dp": 2.122, "splay_angle": 22.723, "splay_distance": 3.807, "splay_ratio": 0.208, "d22": null, "d64": null, "eta": 164.934, "theta": -169.444, "eta_prime": -174.728, "theta_prime": -172.341, "eta_base": -146.057, "theta_base": -98.279, "v0": -30.152, "v1": 42.447, "v2": -37.724, "v3": 21.215, "v4": 5.338, "amplitude": 41.986, "phase_angle": 153.963, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.008, "frame": { "rmsd": 0.008, "origin": [ 104.705, 109.752, 123.795 ], "x_axis": [ 0.539, 0.014, -0.842 ], "y_axis": [ -0.669, 0.614, -0.419 ], "z_axis": [ 0.512, 0.789, 0.340 ], "quaternion": [ 0.790, -0.382, 0.428, 0.216 ] } }, { "index": 44, "index_chain": 10, "chain_name": "I", "nt_resnum": 44, "nt_name": "DC", "nt_code": "C", "nt_id": "///I/44", "linked_nts": [ "///I/43", "///I/45" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": -55.090, "beta": 130.548, "gamma": 67.089, "delta": 132.312, "epsilon": -162.077, "zeta": -130.895, "epsilon_zeta": -31.182, "bb_type": "--", "chi": -120.442, "glyco_bond": "anti", "C5prime_xyz": [ -1.784, 8.643, -1.427 ], "P_xyz": [ 0.778, 8.299, -1.877 ], "form": "B", "ssZp": 2.140, "Dp": 2.236, "splay_angle": 19.954, "splay_distance": 3.481, "splay_ratio": 0.173, "d22": null, "d64": null, "eta": 167.360, "theta": -131.024, "eta_prime": -161.657, "theta_prime": -158.763, "eta_base": -87.612, "theta_base": -149.552, "v0": -23.653, "v1": 31.493, "v2": -27.055, "v3": 14.003, "v4": 5.875, "amplitude": 31.070, "phase_angle": 150.548, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.067, "frame": { "rmsd": 0.010, "origin": [ 105.357, 113.452, 123.181 ], "x_axis": [ -0.160, 0.497, -0.853 ], "y_axis": [ -0.784, 0.461, 0.416 ], "z_axis": [ 0.600, 0.735, 0.316 ], "quaternion": [ 0.636, -0.126, 0.571, 0.504 ] } }, { "index": 45, "index_chain": 11, "chain_name": "I", "nt_resnum": 45, "nt_name": "DA", "nt_code": "A", "nt_id": "///I/45", "linked_nts": [ "///I/44", "///I/46" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": 3.273, "beta": 151.813, "gamma": -6.676, "delta": 148.979, "epsilon": -136.824, "zeta": -147.363, "epsilon_zeta": 10.539, "bb_type": "--", "chi": -97.119, "glyco_bond": "anti", "C5prime_xyz": [ -2.508, 8.030, -2.128 ], "P_xyz": [ -0.799, 9.942, -1.688 ], "form": "B", "ssZp": 1.655, "Dp": 1.708, "splay_angle": 21.610, "splay_distance": 3.652, "splay_ratio": 0.198, "d22": null, "d64": null, "eta": 175.162, "theta": -167.575, "eta_prime": -165.444, "theta_prime": -167.534, "eta_base": -149.909, "theta_base": -109.313, "v0": -26.089, "v1": 42.345, "v2": -41.556, "v3": 27.471, "v4": -1.129, "amplitude": 43.525, "phase_angle": 162.700, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.042, "frame": { "rmsd": 0.012, "origin": [ 108.211, 114.664, 124.763 ], "x_axis": [ -0.422, 0.592, -0.687 ], "y_axis": [ -0.650, 0.331, 0.684 ], "z_axis": [ 0.632, 0.735, 0.246 ], "quaternion": [ 0.537, -0.023, 0.614, 0.578 ] } }, { "index": 46, "index_chain": 12, "chain_name": "I", "nt_resnum": 46, "nt_name": "DT", "nt_code": "T", "nt_id": "///I/46", "linked_nts": [ "///I/45", "///I/47" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -84.817, "beta": 138.301, "gamma": 77.928, "delta": 144.279, "epsilon": -164.951, "zeta": -107.241, "epsilon_zeta": -57.710, "bb_type": "BI", "chi": -117.249, "glyco_bond": "anti", "C5prime_xyz": [ -1.902, 8.572, -1.392 ], "P_xyz": [ 0.617, 8.367, -1.967 ], "form": ".", "ssZp": 1.795, "Dp": 1.878, "splay_angle": 19.591, "splay_distance": 3.518, "splay_ratio": 0.175, "d22": null, "d64": null, "eta": 154.783, "theta": -109.714, "eta_prime": -164.031, "theta_prime": -149.518, "eta_base": -106.681, "theta_base": -104.478, "v0": -20.802, "v1": 35.670, "v2": -36.302, "v3": 25.079, "v4": -2.886, "amplitude": 37.465, "phase_angle": 165.686, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.107, "frame": { "rmsd": 0.007, "origin": [ 109.470, 117.514, 126.669 ], "x_axis": [ -0.755, 0.655, -0.026 ], "y_axis": [ -0.160, -0.146, 0.976 ], "z_axis": [ 0.636, 0.741, 0.215 ], "quaternion": [ 0.280, 0.210, 0.590, 0.727 ] } }, { "index": 47, "index_chain": 13, "chain_name": "I", "nt_resnum": 47, "nt_name": "DA", "nt_code": "A", "nt_id": "///I/47", "linked_nts": [ "///I/46", "///I/48" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem", "alpha": -28.385, "beta": 161.648, "gamma": 16.444, "delta": 144.853, "epsilon": -97.265, "zeta": 179.935, "epsilon_zeta": 82.800, "bb_type": "BII", "chi": -107.685, "glyco_bond": "anti", "C5prime_xyz": [ -2.955, 8.327, -1.753 ], "P_xyz": [ -1.278, 10.290, -1.384 ], "form": "B", "ssZp": 1.168, "Dp": 1.245, "splay_angle": 19.081, "splay_distance": 3.197, "splay_ratio": 0.166, "d22": null, "d64": null, "eta": -176.006, "theta": -163.538, "eta_prime": -148.789, "theta_prime": -164.194, "eta_base": -99.328, "theta_base": -116.776, "v0": -35.860, "v1": 48.479, "v2": -41.535, "v3": 22.199, "v4": 8.116, "amplitude": 47.395, "phase_angle": 151.207, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.007, "origin": [ 110.608, 120.805, 127.170 ], "x_axis": [ -0.733, 0.440, 0.519 ], "y_axis": [ 0.282, -0.497, 0.821 ], "z_axis": [ 0.619, 0.748, 0.240 ], "quaternion": [ 0.050, 0.362, 0.499, 0.786 ] } }, { "index": 48, "index_chain": 14, "chain_name": "I", "nt_resnum": 48, "nt_name": "DA", "nt_code": "A", "nt_id": "///I/48", "linked_nts": [ "///I/47", "///I/49" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": -47.612, "beta": 137.048, "gamma": 13.418, "delta": 138.382, "epsilon": -162.716, "zeta": -133.592, "epsilon_zeta": -29.124, "bb_type": "--", "chi": -102.022, "glyco_bond": "anti", "C5prime_xyz": [ -2.482, 8.164, -2.141 ], "P_xyz": [ -0.218, 9.431, -1.826 ], "form": "B", "ssZp": 2.087, "Dp": 2.153, "splay_angle": 19.554, "splay_distance": 3.293, "splay_ratio": 0.170, "d22": null, "d64": null, "eta": 158.464, "theta": -155.610, "eta_prime": 179.273, "theta_prime": -167.528, "eta_base": -129.232, "theta_base": -135.539, "v0": -28.630, "v1": 39.467, "v2": -34.793, "v3": 19.086, "v4": 5.690, "amplitude": 39.070, "phase_angle": 152.940, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.037, "frame": { "rmsd": 0.007, "origin": [ 112.799, 123.043, 127.811 ], "x_axis": [ -0.404, 0.048, 0.914 ], "y_axis": [ 0.659, -0.677, 0.327 ], "z_axis": [ 0.634, 0.734, 0.242 ], "quaternion": [ -0.201, 0.508, 0.348, 0.762 ] } }, { "index": 49, "index_chain": 15, "chain_name": "I", "nt_resnum": 49, "nt_name": "DA", "nt_code": "A", "nt_id": "///I/49", "linked_nts": [ "///I/48", "///I/50" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -51.548, "beta": 152.831, "gamma": 51.876, "delta": 133.891, "epsilon": -162.325, "zeta": -126.443, "epsilon_zeta": -35.882, "bb_type": "BI", "chi": -124.225, "glyco_bond": "anti", "C5prime_xyz": [ -2.336, 8.673, -1.260 ], "P_xyz": [ 0.065, 9.652, -1.027 ], "form": ".", "ssZp": 2.098, "Dp": 2.192, "splay_angle": 18.857, "splay_distance": 3.385, "splay_ratio": 0.171, "d22": null, "d64": null, "eta": 170.079, "theta": -127.701, "eta_prime": -168.893, "theta_prime": -142.021, "eta_base": -132.248, "theta_base": -101.059, "v0": -32.674, "v1": 40.794, "v2": -33.058, "v3": 15.151, "v4": 10.660, "amplitude": 39.939, "phase_angle": 145.865, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.007, "origin": [ 114.715, 125.706, 128.089 ], "x_axis": [ -0.095, -0.363, 0.927 ], "y_axis": [ 0.764, -0.623, -0.165 ], "z_axis": [ 0.638, 0.693, 0.336 ], "quaternion": [ -0.393, 0.546, 0.184, 0.717 ] } }, { "index": 50, "index_chain": 16, "chain_name": "I", "nt_resnum": 50, "nt_name": "DA", "nt_code": "A", "nt_id": "///I/50", "linked_nts": [ "///I/49", "///I/51" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem", "alpha": 7.322, "beta": 138.249, "gamma": -7.917, "delta": 144.873, "epsilon": -93.739, "zeta": 163.959, "epsilon_zeta": 102.302, "bb_type": "BII", "chi": -98.823, "glyco_bond": "anti", "C5prime_xyz": [ -3.097, 8.073, -2.058 ], "P_xyz": [ -1.596, 10.156, -1.550 ], "form": "B", "ssZp": 1.093, "Dp": 1.127, "splay_angle": 18.179, "splay_distance": 3.134, "splay_ratio": 0.159, "d22": null, "d64": null, "eta": -178.694, "theta": -155.697, "eta_prime": -152.938, "theta_prime": -156.372, "eta_base": -106.883, "theta_base": -124.140, "v0": -34.982, "v1": 47.786, "v2": -41.236, "v3": 22.440, "v4": 7.417, "amplitude": 46.743, "phase_angle": 151.907, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.037, "frame": { "rmsd": 0.007, "origin": [ 116.254, 127.652, 130.392 ], "x_axis": [ 0.285, -0.698, 0.657 ], "y_axis": [ 0.719, -0.299, -0.628 ], "z_axis": [ 0.634, 0.651, 0.417 ], "quaternion": [ 0.592, -0.540, -0.010, -0.598 ] } }, { "index": 51, "index_chain": 17, "chain_name": "I", "nt_resnum": 51, "nt_name": "DG", "nt_code": "G", "nt_id": "///I/51", "linked_nts": [ "///I/50", "///I/52" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": -21.998, "beta": 115.526, "gamma": -9.928, "delta": 142.729, "epsilon": -162.202, "zeta": -164.996, "epsilon_zeta": 2.794, "bb_type": "--", "chi": -83.448, "glyco_bond": "anti", "C5prime_xyz": [ -3.528, 7.621, -2.470 ], "P_xyz": [ -1.801, 9.572, -2.342 ], "form": "B", "ssZp": 2.379, "Dp": 2.377, "splay_angle": 19.860, "splay_distance": 3.245, "splay_ratio": 0.173, "d22": null, "d64": null, "eta": 149.575, "theta": -172.854, "eta_prime": 169.749, "theta_prime": -179.581, "eta_base": -152.779, "theta_base": -126.583, "v0": -35.830, "v1": 47.927, "v2": -40.634, "v3": 21.177, "v4": 8.736, "amplitude": 46.777, "phase_angle": 150.306, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.007, "frame": { "rmsd": 0.007, "origin": [ 117.871, 129.973, 131.739 ], "x_axis": [ 0.547, -0.780, 0.303 ], "y_axis": [ 0.541, 0.054, -0.839 ], "z_axis": [ 0.639, 0.623, 0.451 ], "quaternion": [ 0.716, -0.510, 0.117, -0.461 ] } }, { "index": 52, "index_chain": 18, "chain_name": "I", "nt_resnum": 52, "nt_name": "DA", "nt_code": "A", "nt_id": "///I/52", "linked_nts": [ "///I/51", "///I/53" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -33.180, "beta": 122.525, "gamma": 62.106, "delta": 134.365, "epsilon": -160.408, "zeta": -127.170, "epsilon_zeta": -33.238, "bb_type": "BI", "chi": -127.126, "glyco_bond": "anti", "C5prime_xyz": [ -2.655, 8.716, -1.119 ], "P_xyz": [ -0.104, 9.182, -1.234 ], "form": ".", "ssZp": 2.052, "Dp": 2.252, "splay_angle": 17.898, "splay_distance": 3.413, "splay_ratio": 0.172, "d22": null, "d64": null, "eta": 173.754, "theta": -116.782, "eta_prime": -155.259, "theta_prime": -147.582, "eta_base": -102.322, "theta_base": -112.169, "v0": -36.891, "v1": 44.925, "v2": -35.532, "v3": 15.296, "v4": 13.108, "amplitude": 43.954, "phase_angle": 143.939, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.037, "frame": { "rmsd": 0.006, "origin": [ 120.517, 131.377, 132.988 ], "x_axis": [ 0.750, -0.608, -0.261 ], "y_axis": [ 0.146, 0.536, -0.831 ], "z_axis": [ 0.645, 0.585, 0.491 ], "quaternion": [ 0.833, -0.425, 0.272, -0.226 ] } }, { "index": 53, "index_chain": 19, "chain_name": "I", "nt_resnum": 53, "nt_name": "DT", "nt_code": "T", "nt_id": "///I/53", "linked_nts": [ "///I/52", "///I/54" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": 10.569, "beta": 147.390, "gamma": -19.333, "delta": 142.433, "epsilon": -149.271, "zeta": -162.491, "epsilon_zeta": 13.220, "bb_type": "--", "chi": -96.223, "glyco_bond": "anti", "C5prime_xyz": [ -2.977, 8.006, -2.235 ], "P_xyz": [ -1.789, 10.327, -2.009 ], "form": "B", "ssZp": 1.990, "Dp": 2.019, "splay_angle": 18.434, "splay_distance": 3.083, "splay_ratio": 0.160, "d22": 4.232, "d64": 3.493, "eta": 165.173, "theta": -173.083, "eta_prime": -172.843, "theta_prime": -173.742, "eta_base": -128.489, "theta_base": -116.138, "v0": -32.994, "v1": 44.880, "v2": -39.146, "v3": 21.261, "v4": 6.952, "amplitude": 44.261, "phase_angle": 152.184, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.104, "frame": { "rmsd": 0.005, "origin": [ 123.175, 131.781, 135.090 ], "x_axis": [ 0.707, -0.233, -0.668 ], "y_axis": [ -0.209, 0.833, -0.512 ], "z_axis": [ 0.676, 0.501, 0.541 ], "quaternion": [ 0.878, -0.288, 0.383, -0.007 ] } }, { "index": 54, "index_chain": 20, "chain_name": "I", "nt_resnum": 54, "nt_name": "DC", "nt_code": "C", "nt_id": "///I/54", "linked_nts": [ "///I/53", "///I/55" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -23.744, "beta": 126.154, "gamma": 37.682, "delta": 111.843, "epsilon": -179.928, "zeta": -97.594, "epsilon_zeta": -82.334, "bb_type": "BI", "chi": -120.348, "glyco_bond": "anti", "C5prime_xyz": [ -2.581, 8.611, -1.778 ], "P_xyz": [ -0.104, 9.393, -1.828 ], "form": "B", "ssZp": 2.469, "Dp": 2.587, "splay_angle": 19.426, "splay_distance": 3.344, "splay_ratio": 0.169, "d22": 4.230, "d64": 3.898, "eta": 171.545, "theta": -147.591, "eta_prime": -170.420, "theta_prime": -160.297, "eta_base": -110.294, "theta_base": -124.509, "v0": -36.603, "v1": 31.313, "v2": -15.138, "v3": -5.406, "v4": 26.407, "amplitude": 35.765, "phase_angle": 115.041, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.064, "frame": { "rmsd": 0.004, "origin": [ 125.567, 133.483, 136.032 ], "x_axis": [ 0.456, 0.382, -0.804 ], "y_axis": [ -0.550, 0.831, 0.082 ], "z_axis": [ 0.699, 0.405, 0.589 ], "quaternion": [ 0.848, -0.095, 0.443, 0.275 ] } }, { "index": 55, "index_chain": 21, "chain_name": "I", "nt_resnum": 55, "nt_name": "DT", "nt_code": "T", "nt_id": "///I/55", "linked_nts": [ "///I/54", "///I/56" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -46.407, "beta": 170.386, "gamma": 47.388, "delta": 137.715, "epsilon": -140.588, "zeta": -142.334, "epsilon_zeta": 1.746, "bb_type": "--", "chi": -113.833, "glyco_bond": "anti", "C5prime_xyz": [ -2.521, 8.484, -1.669 ], "P_xyz": [ -0.333, 9.881, -1.536 ], "form": "B", "ssZp": 1.868, "Dp": 1.905, "splay_angle": 21.671, "splay_distance": 3.630, "splay_ratio": 0.194, "d22": null, "d64": null, "eta": -175.606, "theta": -160.120, "eta_prime": -154.419, "theta_prime": -163.087, "eta_base": -114.984, "theta_base": -113.776, "v0": -32.934, "v1": 42.766, "v2": -35.837, "v3": 17.790, "v4": 9.183, "amplitude": 41.947, "phase_angle": 148.688, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.105, "frame": { "rmsd": 0.004, "origin": [ 128.262, 134.711, 137.584 ], "x_axis": [ 0.117, 0.763, -0.636 ], "y_axis": [ -0.655, 0.541, 0.528 ], "z_axis": [ 0.747, 0.355, 0.563 ], "quaternion": [ 0.745, 0.058, 0.464, 0.476 ] } }, { "index": 56, "index_chain": 22, "chain_name": "I", "nt_resnum": 56, "nt_name": "DA", "nt_code": "A", "nt_id": "///I/56", "linked_nts": [ "///I/55", "///I/57" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -57.907, "beta": 150.124, "gamma": 53.063, "delta": 143.672, "epsilon": -157.412, "zeta": -121.643, "epsilon_zeta": -35.770, "bb_type": "BI", "chi": -105.560, "glyco_bond": "anti", "C5prime_xyz": [ -2.054, 8.221, -1.948 ], "P_xyz": [ 0.527, 8.664, -1.995 ], "form": "B", "ssZp": 1.677, "Dp": 1.843, "splay_angle": 20.148, "splay_distance": 3.357, "splay_ratio": 0.176, "d22": null, "d64": null, "eta": 167.641, "theta": -136.520, "eta_prime": -162.501, "theta_prime": -158.174, "eta_base": -113.045, "theta_base": -113.557, "v0": -22.093, "v1": 36.496, "v2": -36.480, "v3": 24.678, "v4": -1.930, "amplitude": 37.932, "phase_angle": 164.100, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.037, "frame": { "rmsd": 0.006, "origin": [ 130.268, 136.214, 140.210 ], "x_axis": [ -0.333, 0.936, -0.112 ], "y_axis": [ -0.537, -0.091, 0.839 ], "z_axis": [ 0.775, 0.340, 0.533 ], "quaternion": [ 0.526, 0.237, 0.421, 0.699 ] } }, { "index": 57, "index_chain": 23, "chain_name": "I", "nt_resnum": 57, "nt_name": "DA", "nt_code": "A", "nt_id": "///I/57", "linked_nts": [ "///I/56", "///I/58" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": -68.049, "beta": 156.223, "gamma": 62.607, "delta": 143.010, "epsilon": -156.476, "zeta": -168.049, "epsilon_zeta": 11.573, "bb_type": "--", "chi": -107.932, "glyco_bond": "anti", "C5prime_xyz": [ -2.538, 8.312, -1.835 ], "P_xyz": [ -0.071, 9.093, -2.241 ], "form": "B", "ssZp": 2.040, "Dp": 2.075, "splay_angle": 20.670, "splay_distance": 3.348, "splay_ratio": 0.183, "d22": null, "d64": null, "eta": 163.259, "theta": -160.522, "eta_prime": -164.145, "theta_prime": -176.946, "eta_base": -116.223, "theta_base": -127.356, "v0": -30.090, "v1": 42.987, "v2": -38.713, "v3": 22.481, "v4": 4.415, "amplitude": 42.641, "phase_angle": 155.217, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.036, "frame": { "rmsd": 0.005, "origin": [ 132.532, 137.386, 142.394 ], "x_axis": [ -0.571, 0.700, 0.429 ], "y_axis": [ -0.175, -0.614, 0.770 ], "z_axis": [ 0.802, 0.364, 0.473 ], "quaternion": [ 0.268, 0.377, 0.348, 0.815 ] } }, { "index": 58, "index_chain": 24, "chain_name": "I", "nt_resnum": 58, "nt_name": "DA", "nt_code": "A", "nt_id": "///I/58", "linked_nts": [ "///I/57", "///I/59" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -5.845, "beta": 136.814, "gamma": 19.598, "delta": 143.458, "epsilon": 178.063, "zeta": -98.921, "epsilon_zeta": -83.016, "bb_type": "BI", "chi": -108.055, "glyco_bond": "anti", "C5prime_xyz": [ -1.743, 8.216, -1.789 ], "P_xyz": [ 0.688, 8.761, -0.988 ], "form": "B", "ssZp": 1.940, "Dp": 2.007, "splay_angle": 20.041, "splay_distance": 3.395, "splay_ratio": 0.175, "d22": null, "d64": null, "eta": 168.357, "theta": -127.463, "eta_prime": -167.962, "theta_prime": -148.661, "eta_base": -116.054, "theta_base": -107.456, "v0": -14.713, "v1": 30.038, "v2": -33.120, "v3": 25.410, "v4": -7.027, "amplitude": 33.360, "phase_angle": 173.111, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.037, "frame": { "rmsd": 0.005, "origin": [ 135.367, 138.098, 144.026 ], "x_axis": [ -0.526, 0.138, 0.839 ], "y_axis": [ 0.213, -0.934, 0.287 ], "z_axis": [ 0.823, 0.330, 0.462 ], "quaternion": [ -0.022, 0.486, 0.180, 0.855 ] } }, { "index": 59, "index_chain": 25, "chain_name": "I", "nt_resnum": 59, "nt_name": "DC", "nt_code": "C", "nt_id": "///I/59", "linked_nts": [ "///I/58", "///I/60" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": -59.937, "beta": -179.652, "gamma": 48.266, "delta": 139.463, "epsilon": -156.594, "zeta": -126.775, "epsilon_zeta": -29.819, "bb_type": "--", "chi": -111.586, "glyco_bond": "anti", "C5prime_xyz": [ -2.218, 8.483, -1.724 ], "P_xyz": [ 0.039, 9.785, -1.467 ], "form": "B", "ssZp": 2.023, "Dp": 2.063, "splay_angle": 19.749, "splay_distance": 3.314, "splay_ratio": 0.172, "d22": null, "d64": null, "eta": 173.220, "theta": -152.450, "eta_prime": -163.229, "theta_prime": -161.305, "eta_base": -113.810, "theta_base": -118.662, "v0": -27.067, "v1": 38.621, "v2": -34.891, "v3": 20.238, "v4": 4.002, "amplitude": 38.413, "phase_angle": 155.273, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.004, "origin": [ 137.761, 139.503, 145.981 ], "x_axis": [ -0.283, -0.445, 0.849 ], "y_axis": [ 0.492, -0.828, -0.270 ], "z_axis": [ 0.823, 0.341, 0.454 ], "quaternion": [ -0.293, 0.522, 0.022, 0.801 ] } }, { "index": 60, "index_chain": 26, "chain_name": "I", "nt_resnum": 60, "nt_name": "DA", "nt_code": "A", "nt_id": "///I/60", "linked_nts": [ "///I/59", "///I/61" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -61.425, "beta": 152.131, "gamma": 61.077, "delta": 134.206, "epsilon": -169.879, "zeta": -106.609, "epsilon_zeta": -63.269, "bb_type": "BI", "chi": -120.638, "glyco_bond": "anti", "C5prime_xyz": [ -2.329, 8.603, -1.408 ], "P_xyz": [ 0.160, 9.389, -1.476 ], "form": ".", "ssZp": 2.106, "Dp": 2.214, "splay_angle": 19.392, "splay_distance": 3.565, "splay_ratio": 0.179, "d22": null, "d64": null, "eta": 163.912, "theta": -131.340, "eta_prime": -166.032, "theta_prime": -153.926, "eta_base": -118.639, "theta_base": -120.996, "v0": -31.092, "v1": 39.601, "v2": -32.849, "v3": 15.886, "v4": 9.222, "amplitude": 38.883, "phase_angle": 147.653, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.005, "origin": [ 140.563, 140.556, 147.403 ], "x_axis": [ 0.056, -0.845, 0.532 ], "y_axis": [ 0.581, -0.406, -0.705 ], "z_axis": [ 0.812, 0.349, 0.468 ], "quaternion": [ 0.529, -0.498, 0.132, -0.674 ] } }, { "index": 61, "index_chain": 27, "chain_name": "I", "nt_resnum": 61, "nt_name": "DT", "nt_code": "T", "nt_id": "///I/61", "linked_nts": [ "///I/60", "///I/62" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": -29.347, "beta": 175.702, "gamma": 13.504, "delta": 141.645, "epsilon": -149.152, "zeta": -150.849, "epsilon_zeta": 1.697, "bb_type": "--", "chi": -106.951, "glyco_bond": "anti", "C5prime_xyz": [ -2.687, 8.321, -1.866 ], "P_xyz": [ -1.153, 10.407, -1.490 ], "form": "B", "ssZp": 2.025, "Dp": 2.039, "splay_angle": 20.465, "splay_distance": 3.367, "splay_ratio": 0.180, "d22": null, "d64": null, "eta": 173.980, "theta": -172.981, "eta_prime": -165.893, "theta_prime": -171.492, "eta_base": -125.751, "theta_base": -117.916, "v0": -32.132, "v1": 43.987, "v2": -38.472, "v3": 21.013, "v4": 6.572, "amplitude": 43.379, "phase_angle": 152.485, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.105, "frame": { "rmsd": 0.004, "origin": [ 142.550, 141.616, 150.167 ], "x_axis": [ 0.362, -0.926, 0.108 ], "y_axis": [ 0.497, 0.094, -0.862 ], "z_axis": [ 0.788, 0.366, 0.495 ], "quaternion": [ 0.698, -0.440, 0.244, -0.509 ] } }, { "index": 62, "index_chain": 28, "chain_name": "I", "nt_resnum": 62, "nt_name": "DA", "nt_code": "A", "nt_id": "///I/62", "linked_nts": [ "///I/61", "///I/63" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": -48.001, "beta": 142.733, "gamma": 51.952, "delta": 140.459, "epsilon": -157.080, "zeta": -128.732, "epsilon_zeta": -28.348, "bb_type": "--", "chi": -116.245, "glyco_bond": "anti", "C5prime_xyz": [ -2.126, 8.483, -1.500 ], "P_xyz": [ 0.447, 8.928, -1.350 ], "form": "B", "ssZp": 1.899, "Dp": 1.989, "splay_angle": 20.012, "splay_distance": 3.286, "splay_ratio": 0.176, "d22": null, "d64": null, "eta": 170.273, "theta": -144.560, "eta_prime": -162.774, "theta_prime": -163.472, "eta_base": -108.910, "theta_base": -125.114, "v0": -25.776, "v1": 37.878, "v2": -35.087, "v3": 21.212, "v4": 2.501, "amplitude": 38.004, "phase_angle": 157.404, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "4b", "suiteness": 0.010, "filter_rmsd": 0.036, "frame": { "rmsd": 0.007, "origin": [ 145.412, 142.945, 151.342 ], "x_axis": [ 0.635, -0.616, -0.465 ], "y_axis": [ 0.137, 0.683, -0.717 ], "z_axis": [ 0.760, 0.392, 0.519 ], "quaternion": [ 0.842, -0.329, 0.364, -0.224 ] } }, { "index": 63, "index_chain": 29, "chain_name": "I", "nt_resnum": 63, "nt_name": "DA", "nt_code": "A", "nt_id": "///I/63", "linked_nts": [ "///I/62", "///I/64" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -66.521, "beta": 165.249, "gamma": 57.371, "delta": 142.875, "epsilon": -172.532, "zeta": -99.446, "epsilon_zeta": -73.087, "bb_type": "BI", "chi": -110.335, "glyco_bond": "anti", "C5prime_xyz": [ -1.892, 8.305, -1.703 ], "P_xyz": [ 0.655, 8.894, -1.550 ], "form": ".", "ssZp": 1.835, "Dp": 1.961, "splay_angle": 18.263, "splay_distance": 3.316, "splay_ratio": 0.166, "d22": null, "d64": null, "eta": 163.300, "theta": -121.830, "eta_prime": -167.906, "theta_prime": -147.347, "eta_base": -124.636, "theta_base": -115.740, "v0": -18.811, "v1": 33.157, "v2": -34.315, "v3": 24.415, "v4": -3.826, "amplitude": 35.170, "phase_angle": 167.338, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.036, "frame": { "rmsd": 0.008, "origin": [ 147.406, 144.679, 153.294 ], "x_axis": [ 0.612, -0.053, -0.789 ], "y_axis": [ -0.264, 0.927, -0.267 ], "z_axis": [ 0.745, 0.372, 0.554 ], "quaternion": [ 0.879, -0.182, 0.436, 0.060 ] } }, { "index": 64, "index_chain": 30, "chain_name": "I", "nt_resnum": 64, "nt_name": "DA", "nt_code": "A", "nt_id": "///I/64", "linked_nts": [ "///I/63", "///I/65" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -40.770, "beta": 177.440, "gamma": 20.352, "delta": 137.314, "epsilon": -148.050, "zeta": -158.887, "epsilon_zeta": 10.838, "bb_type": "--", "chi": -100.678, "glyco_bond": "anti", "C5prime_xyz": [ -2.886, 8.107, -2.144 ], "P_xyz": [ -1.260, 10.162, -2.225 ], "form": ".", "ssZp": 2.079, "Dp": 2.102, "splay_angle": 21.911, "splay_distance": 3.726, "splay_ratio": 0.205, "d22": null, "d64": null, "eta": 170.236, "theta": 169.243, "eta_prime": -168.622, "theta_prime": 172.783, "eta_base": -129.663, "theta_base": -135.676, "v0": -33.486, "v1": 43.178, "v2": -35.877, "v3": 17.576, "v4": 9.642, "amplitude": 42.259, "phase_angle": 148.100, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.005, "origin": [ 150.373, 145.011, 154.736 ], "x_axis": [ 0.418, 0.412, -0.809 ], "y_axis": [ -0.459, 0.865, 0.204 ], "z_axis": [ 0.784, 0.286, 0.551 ], "quaternion": [ 0.842, -0.024, 0.473, 0.259 ] } }, { "index": 65, "index_chain": 31, "chain_name": "I", "nt_resnum": 65, "nt_name": "DA", "nt_code": "A", "nt_id": "///I/65", "linked_nts": [ "///I/64", "///I/66" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -70.073, "beta": 136.659, "gamma": 72.811, "delta": 145.529, "epsilon": -174.136, "zeta": -91.195, "epsilon_zeta": -82.942, "bb_type": "BI", "chi": -124.054, "glyco_bond": "anti", "C5prime_xyz": [ -1.681, 8.558, -0.963 ], "P_xyz": [ 0.909, 8.229, -1.246 ], "form": ".", "ssZp": 2.049, "Dp": 2.089, "splay_angle": 20.956, "splay_distance": 3.719, "splay_ratio": 0.189, "d22": null, "d64": null, "eta": 153.216, "theta": -100.029, "eta_prime": -164.993, "theta_prime": -144.834, "eta_base": -114.684, "theta_base": -105.475, "v0": -18.009, "v1": 33.293, "v2": -35.075, "v3": 25.614, "v4": -4.989, "amplitude": 35.714, "phase_angle": 169.146, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.037, "frame": { "rmsd": 0.004, "origin": [ 152.269, 146.481, 157.588 ], "x_axis": [ 0.090, 0.886, -0.454 ], "y_axis": [ -0.641, 0.401, 0.655 ], "z_axis": [ 0.762, 0.232, 0.604 ], "quaternion": [ 0.724, 0.146, 0.420, 0.528 ] } }, { "index": 66, "index_chain": 32, "chain_name": "I", "nt_resnum": 66, "nt_name": "DT", "nt_code": "T", "nt_id": "///I/66", "linked_nts": [ "///I/65", "///I/67" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -53.003, "beta": -178.177, "gamma": 33.965, "delta": 138.026, "epsilon": -157.527, "zeta": -120.785, "epsilon_zeta": -36.742, "bb_type": "BI", "chi": -112.038, "glyco_bond": "anti", "C5prime_xyz": [ -2.506, 8.433, -1.749 ], "P_xyz": [ -0.657, 10.242, -1.332 ], "form": "B", "ssZp": 2.049, "Dp": 2.111, "splay_angle": 20.163, "splay_distance": 3.354, "splay_ratio": 0.175, "d22": 4.506, "d64": 3.640, "eta": 168.688, "theta": -153.078, "eta_prime": -163.167, "theta_prime": -156.973, "eta_base": -111.413, "theta_base": -107.426, "v0": -31.215, "v1": 41.591, "v2": -35.640, "v3": 18.661, "v4": 7.519, "amplitude": 40.886, "phase_angle": 150.657, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.105, "frame": { "rmsd": 0.003, "origin": [ 155.414, 148.050, 158.802 ], "x_axis": [ -0.296, 0.954, 0.053 ], "y_axis": [ -0.572, -0.221, 0.790 ], "z_axis": [ 0.765, 0.204, 0.611 ], "quaternion": [ 0.523, 0.280, 0.341, 0.729 ] } }, { "index": 67, "index_chain": 33, "chain_name": "I", "nt_resnum": 67, "nt_name": "DC", "nt_code": "C", "nt_id": "///I/67", "linked_nts": [ "///I/66", "///I/68" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -65.638, "beta": 161.523, "gamma": 55.960, "delta": 133.256, "epsilon": -173.370, "zeta": -105.935, "epsilon_zeta": -67.435, "bb_type": "BI", "chi": -112.708, "glyco_bond": "anti", "C5prime_xyz": [ -2.346, 8.499, -1.749 ], "P_xyz": [ 0.112, 9.364, -2.004 ], "form": "B", "ssZp": 2.354, "Dp": 2.346, "splay_angle": 21.707, "splay_distance": 3.709, "splay_ratio": 0.190, "d22": 4.122, "d64": 3.887, "eta": 161.007, "theta": -139.069, "eta_prime": -171.211, "theta_prime": -156.351, "eta_base": -116.282, "theta_base": -111.990, "v0": -29.419, "v1": 37.331, "v2": -30.697, "v3": 14.596, "v4": 9.003, "amplitude": 36.567, "phase_angle": 147.084, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.003, "origin": [ 157.556, 149.239, 161.092 ], "x_axis": [ -0.619, 0.568, 0.543 ], "y_axis": [ -0.174, -0.773, 0.610 ], "z_axis": [ 0.766, 0.283, 0.577 ], "quaternion": [ 0.215, 0.380, 0.259, 0.862 ] } }, { "index": 68, "index_chain": 34, "chain_name": "I", "nt_resnum": 68, "nt_name": "DT", "nt_code": "T", "nt_id": "///I/68", "linked_nts": [ "///I/67", null ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix-end,stem-end", "alpha": -54.006, "beta": 166.180, "gamma": 54.601, "delta": 129.187, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": -120.751, "glyco_bond": "anti", "C5prime_xyz": [ -2.655, 8.582, -1.445 ], "P_xyz": [ -0.399, 9.894, -1.419 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": -34.331, "v1": 39.149, "v2": -28.895, "v3": 10.119, "v4": 14.846, "amplitude": 38.479, "phase_angle": 138.671, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.005, "origin": [ 159.602, 150.887, 163.711 ], "x_axis": [ -0.595, -0.006, 0.804 ], "y_axis": [ 0.249, -0.952, 0.178 ], "z_axis": [ 0.764, 0.306, 0.568 ], "quaternion": [ -0.072, 0.444, 0.137, 0.882 ] } }, { "index": 69, "index_chain": 1, "chain_name": "D", "nt_resnum": 901, "nt_name": "ATP", "nt_code": "a", "is_modified": true, "nt_id": "///D/901", "linked_nts": [ null, null ], "nt_type": "RNA", "dbn": ".", "summary": "modified,anti,~C2'-endo,ss-non-loop", "alpha": null, "beta": null, "gamma": 67.376, "delta": 127.480, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": 172.594, "glyco_bond": "anti", "C5prime_xyz": [ -2.074, 8.228, 2.081 ], "P_xyz": [ null, null, null ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": -21.596, "v1": 21.850, "v2": -14.660, "v3": 2.349, "v4": 12.151, "amplitude": 22.677, "phase_angle": 130.275, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.072, "frame": { "rmsd": 0.059, "origin": [ 131.044, 165.940, 104.216 ], "x_axis": [ -0.993, -0.032, 0.110 ], "y_axis": [ 0.042, -0.995, 0.092 ], "z_axis": [ 0.107, 0.096, 0.990 ], "quaternion": [ -0.019, 0.054, 0.047, 0.997 ] } }, { "index": 70, "index_chain": 1, "chain_name": "E", "nt_resnum": 901, "nt_name": "ATP", "nt_code": "a", "is_modified": true, "nt_id": "///E/901", "linked_nts": [ null, null ], "nt_type": "RNA", "dbn": ".", "summary": "modified,anti,non-stack,ss-non-loop", "alpha": null, "beta": null, "gamma": 105.289, "delta": 107.577, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": -174.261, "glyco_bond": "anti", "C5prime_xyz": [ -2.544, 8.860, 1.105 ], "P_xyz": [ null, null, null ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": -32.259, "v1": 23.470, "v2": -6.896, "v3": -11.991, "v4": 27.809, "amplitude": 31.796, "phase_angle": 102.526, "puckering": "O4'-endo", "sugar_class": "--", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.070, "frame": { "rmsd": 0.058, "origin": [ 156.003, 131.122, 94.727 ], "x_axis": [ -0.817, 0.447, -0.365 ], "y_axis": [ -0.537, -0.356, 0.765 ], "z_axis": [ 0.212, 0.821, 0.530 ], "quaternion": [ 0.299, -0.047, 0.482, 0.822 ] } }, { "index": 71, "index_chain": 1, "chain_name": "A", "nt_resnum": 1001, "nt_name": "ATP", "nt_code": "a", "is_modified": true, "nt_id": "///A/1001", "linked_nts": [ null, null ], "nt_type": "RNA", "dbn": ".", "summary": "modified,anti,~C3'-endo,non-stack,ss-non-loop", "alpha": null, "beta": null, "gamma": -53.431, "delta": 120.477, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": -167.513, "glyco_bond": "anti", "C5prime_xyz": [ -0.818, 8.111, 1.212 ], "P_xyz": [ null, null, null ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": 3.621, "v1": -5.820, "v2": 5.763, "v3": -3.752, "v4": 0.089, "amplitude": 6.043, "phase_angle": 342.476, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.065, "frame": { "rmsd": 0.054, "origin": [ 103.372, 172.266, 137.477 ], "x_axis": [ -0.689, -0.680, 0.250 ], "y_axis": [ 0.623, -0.732, -0.275 ], "z_axis": [ 0.370, -0.034, 0.928 ], "quaternion": [ -0.356, 0.169, -0.084, 0.915 ] } }, { "index": 72, "index_chain": 1, "chain_name": "G", "nt_resnum": 901, "nt_name": "ATP", "nt_code": "a", "is_modified": true, "nt_id": "///G/901", "linked_nts": [ null, null ], "nt_type": "RNA", "dbn": ".", "summary": "modified,anti,~C3'-endo,non-stack,ss-non-loop", "alpha": null, "beta": null, "gamma": 58.858, "delta": 99.964, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": -155.491, "glyco_bond": "anti", "C5prime_xyz": [ -1.442, 8.870, 0.304 ], "P_xyz": [ null, null, null ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": -13.959, "v1": 0.328, "v2": 12.192, "v3": -20.565, "v4": 21.798, "amplitude": 22.078, "phase_angle": 56.481, "puckering": "C4'-exo", "sugar_class": "~C3'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.069, "frame": { "rmsd": 0.056, "origin": [ 97.036, 141.272, 169.556 ], "x_axis": [ -0.025, -0.994, -0.106 ], "y_axis": [ 0.650, 0.064, -0.757 ], "z_axis": [ 0.759, -0.088, 0.645 ], "quaternion": [ 0.649, -0.258, 0.333, -0.634 ] } } ], "num_hbonds": 2401, "hbonds": [ { "index": 1, "atom1_serNum": 4, "atom2_serNum": 13505, "donAcc_type": "standard", "distance": 3.495, "atom1_id": "///B/276/O", "atom2_id": "///E/399/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2, "atom1_serNum": 38, "atom2_serNum": 53, "donAcc_type": "standard", "distance": 3.017, "atom1_id": "///B/280/O", "atom2_id": "///B/283/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 3, "atom1_serNum": 38, "atom2_serNum": 65, "donAcc_type": "standard", "distance": 2.968, "atom1_id": "///B/280/O", "atom2_id": "///B/284/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 4, "atom1_serNum": 44, "atom2_serNum": 76, "donAcc_type": "standard", "distance": 2.908, "atom1_id": "///B/281/O", "atom2_id": "///B/285/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 5, "atom1_serNum": 52, "atom2_serNum": 91, "donAcc_type": "acceptable", "distance": 3.473, "atom1_id": "///B/282/O", "atom2_id": "///B/286/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 6, "atom1_serNum": 56, "atom2_serNum": 86, "donAcc_type": "standard", "distance": 3.296, "atom1_id": "///B/283/O", "atom2_id": "///B/286/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 7, "atom1_serNum": 56, "atom2_serNum": 91, "donAcc_type": "acceptable", "distance": 2.486, "atom1_id": "///B/283/O", "atom2_id": "///B/286/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 8, "atom1_serNum": 100, "atom2_serNum": 129, "donAcc_type": "standard", "distance": 2.982, "atom1_id": "///B/324/O", "atom2_id": "///B/328/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 9, "atom1_serNum": 109, "atom2_serNum": 134, "donAcc_type": "acceptable", "distance": 2.767, "atom1_id": "///B/325/O", "atom2_id": "///B/328/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 10, "atom1_serNum": 109, "atom2_serNum": 135, "donAcc_type": "standard", "distance": 2.907, "atom1_id": "///B/325/O", "atom2_id": "///B/329/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 11, "atom1_serNum": 115, "atom2_serNum": 6686, "donAcc_type": "standard", "distance": 3.873, "atom1_id": "///B/325/NE2", "atom2_id": "///C/641/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 12, "atom1_serNum": 119, "atom2_serNum": 143, "donAcc_type": "standard", "distance": 2.930, "atom1_id": "///B/326/O", "atom2_id": "///B/330/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 13, "atom1_serNum": 128, "atom2_serNum": 151, "donAcc_type": "standard", "distance": 2.964, "atom1_id": "///B/327/O", "atom2_id": "///B/331/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 14, "atom1_serNum": 132, "atom2_serNum": 156, "donAcc_type": "standard", "distance": 2.972, "atom1_id": "///B/328/O", "atom2_id": "///B/332/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 15, "atom1_serNum": 138, "atom2_serNum": 164, "donAcc_type": "standard", "distance": 2.877, "atom1_id": "///B/329/O", "atom2_id": "///B/333/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 16, "atom1_serNum": 146, "atom2_serNum": 172, "donAcc_type": "standard", "distance": 2.916, "atom1_id": "///B/330/O", "atom2_id": "///B/334/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 17, "atom1_serNum": 154, "atom2_serNum": 181, "donAcc_type": "standard", "distance": 3.001, "atom1_id": "///B/331/O", "atom2_id": "///B/335/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 18, "atom1_serNum": 159, "atom2_serNum": 190, "donAcc_type": "standard", "distance": 3.020, "atom1_id": "///B/332/O", "atom2_id": "///B/336/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 19, "atom1_serNum": 167, "atom2_serNum": 202, "donAcc_type": "standard", "distance": 2.885, "atom1_id": "///B/333/O", "atom2_id": "///B/337/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 20, "atom1_serNum": 175, "atom2_serNum": 213, "donAcc_type": "standard", "distance": 2.921, "atom1_id": "///B/334/O", "atom2_id": "///B/338/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 21, "atom1_serNum": 184, "atom2_serNum": 218, "donAcc_type": "acceptable", "distance": 2.675, "atom1_id": "///B/335/O", "atom2_id": "///B/338/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 22, "atom1_serNum": 184, "atom2_serNum": 219, "donAcc_type": "standard", "distance": 3.088, "atom1_id": "///B/335/O", "atom2_id": "///B/339/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 23, "atom1_serNum": 189, "atom2_serNum": 218, "donAcc_type": "acceptable", "distance": 2.658, "atom1_id": "///B/335/OE2", "atom2_id": "///B/338/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 24, "atom1_serNum": 201, "atom2_serNum": 1440, "donAcc_type": "acceptable", "distance": 2.853, "atom1_id": "///B/336/OH", "atom2_id": "///B/491/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 25, "atom1_serNum": 209, "atom2_serNum": 499, "donAcc_type": "standard", "distance": 3.157, "atom1_id": "///B/337/NE", "atom2_id": "///B/371/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 26, "atom1_serNum": 212, "atom2_serNum": 458, "donAcc_type": "acceptable", "distance": 2.882, "atom1_id": "///B/337/NH2", "atom2_id": "///B/367/OG", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 27, "atom1_serNum": 222, "atom2_serNum": 249, "donAcc_type": "standard", "distance": 3.269, "atom1_id": "///B/339/O", "atom2_id": "///B/342/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 28, "atom1_serNum": 222, "atom2_serNum": 258, "donAcc_type": "standard", "distance": 3.388, "atom1_id": "///B/339/O", "atom2_id": "///B/343/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 29, "atom1_serNum": 234, "atom2_serNum": 272, "donAcc_type": "standard", "distance": 2.986, "atom1_id": "///B/340/O", "atom2_id": "///B/344/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 30, "atom1_serNum": 245, "atom2_serNum": 280, "donAcc_type": "standard", "distance": 3.020, "atom1_id": "///B/341/O", "atom2_id": "///B/345/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 31, "atom1_serNum": 252, "atom2_serNum": 286, "donAcc_type": "standard", "distance": 2.910, "atom1_id": "///B/342/O", "atom2_id": "///B/346/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 32, "atom1_serNum": 257, "atom2_serNum": 4585, "donAcc_type": "standard", "distance": 3.055, "atom1_id": "///B/342/NZ", "atom2_id": "///C/324/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 33, "atom1_serNum": 257, "atom2_serNum": 4586, "donAcc_type": "standard", "distance": 3.124, "atom1_id": "///B/342/NZ", "atom2_id": "///C/324/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 34, "atom1_serNum": 261, "atom2_serNum": 294, "donAcc_type": "standard", "distance": 2.877, "atom1_id": "///B/343/O", "atom2_id": "///B/347/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 35, "atom1_serNum": 275, "atom2_serNum": 302, "donAcc_type": "standard", "distance": 2.923, "atom1_id": "///B/344/O", "atom2_id": "///B/348/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 36, "atom1_serNum": 283, "atom2_serNum": 310, "donAcc_type": "standard", "distance": 3.008, "atom1_id": "///B/345/O", "atom2_id": "///B/349/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 37, "atom1_serNum": 289, "atom2_serNum": 323, "donAcc_type": "standard", "distance": 3.298, "atom1_id": "///B/346/O", "atom2_id": "///B/351/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 38, "atom1_serNum": 297, "atom2_serNum": 1195, "donAcc_type": "acceptable", "distance": 3.080, "atom1_id": "///B/347/O", "atom2_id": "///B/461/ND1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 39, "atom1_serNum": 308, "atom2_serNum": 2578, "donAcc_type": "acceptable", "distance": 2.462, "atom1_id": "///B/348/OD1", "atom2_id": "///C/50/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 40, "atom1_serNum": 309, "atom2_serNum": 2473, "donAcc_type": "questionable", "distance": 3.091, "atom1_id": "///B/348/ND2", "atom2_id": "///C/38/N", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 41, "atom1_serNum": 313, "atom2_serNum": 4543, "donAcc_type": "standard", "distance": 2.930, "atom1_id": "///B/349/O", "atom2_id": "///C/319/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 42, "atom1_serNum": 317, "atom2_serNum": 2608, "donAcc_type": "acceptable", "distance": 3.368, "atom1_id": "///B/349/OE1", "atom2_id": "///C/53/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 43, "atom1_serNum": 317, "atom2_serNum": 2619, "donAcc_type": "standard", "distance": 2.490, "atom1_id": "///B/349/OE1", "atom2_id": "///C/54/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 44, "atom1_serNum": 318, "atom2_serNum": 2578, "donAcc_type": "acceptable", "distance": 2.646, "atom1_id": "///B/349/OE2", "atom2_id": "///C/50/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 45, "atom1_serNum": 318, "atom2_serNum": 2619, "donAcc_type": "standard", "distance": 3.244, "atom1_id": "///B/349/OE2", "atom2_id": "///C/54/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 46, "atom1_serNum": 334, "atom2_serNum": 1376, "donAcc_type": "standard", "distance": 2.796, "atom1_id": "///B/352/N", "atom2_id": "///B/484/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 47, "atom1_serNum": 337, "atom2_serNum": 1392, "donAcc_type": "standard", "distance": 2.593, "atom1_id": "///B/352/O", "atom2_id": "///B/486/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 48, "atom1_serNum": 340, "atom2_serNum": 1199, "donAcc_type": "standard", "distance": 3.725, "atom1_id": "///B/352/OD1", "atom2_id": "///B/462/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 49, "atom1_serNum": 342, "atom2_serNum": 1202, "donAcc_type": "standard", "distance": 2.935, "atom1_id": "///B/353/N", "atom2_id": "///B/462/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 50, "atom1_serNum": 345, "atom2_serNum": 1215, "donAcc_type": "standard", "distance": 2.938, "atom1_id": "///B/353/O", "atom2_id": "///B/464/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 51, "atom1_serNum": 350, "atom2_serNum": 1395, "donAcc_type": "standard", "distance": 3.287, "atom1_id": "///B/354/N", "atom2_id": "///B/486/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 52, "atom1_serNum": 353, "atom2_serNum": 1412, "donAcc_type": "standard", "distance": 2.837, "atom1_id": "///B/354/O", "atom2_id": "///B/488/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 53, "atom1_serNum": 358, "atom2_serNum": 1218, "donAcc_type": "standard", "distance": 2.949, "atom1_id": "///B/355/N", "atom2_id": "///B/464/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 54, "atom1_serNum": 361, "atom2_serNum": 1226, "donAcc_type": "standard", "distance": 2.952, "atom1_id": "///B/355/O", "atom2_id": "///B/466/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 55, "atom1_serNum": 366, "atom2_serNum": 1415, "donAcc_type": "standard", "distance": 3.366, "atom1_id": "///B/356/N", "atom2_id": "///B/488/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 56, "atom1_serNum": 385, "atom2_serNum": 1488, "donAcc_type": "acceptable", "distance": 2.316, "atom1_id": "///B/358/O", "atom2_id": "///B/496/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 57, "atom1_serNum": 390, "atom2_serNum": 1450, "donAcc_type": "standard", "distance": 2.887, "atom1_id": "///B/359/N", "atom2_id": "///B/492/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 58, "atom1_serNum": 393, "atom2_serNum": 408, "donAcc_type": "standard", "distance": 2.894, "atom1_id": "///B/359/O", "atom2_id": "///B/361/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 59, "atom1_serNum": 394, "atom2_serNum": 1465, "donAcc_type": "standard", "distance": 3.097, "atom1_id": "///B/360/N", "atom2_id": "///B/494/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 60, "atom1_serNum": 397, "atom2_serNum": 1452, "donAcc_type": "acceptable", "distance": 2.643, "atom1_id": "///B/360/O", "atom2_id": "///B/492/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 61, "atom1_serNum": 399, "atom2_serNum": 409, "donAcc_type": "acceptable", "distance": 3.536, "atom1_id": "///B/360/OG", "atom2_id": "///B/362/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 62, "atom1_serNum": 399, "atom2_serNum": 1511, "donAcc_type": "acceptable", "distance": 3.004, "atom1_id": "///B/360/OG", "atom2_id": "///B/499/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 63, "atom1_serNum": 399, "atom2_serNum": 1512, "donAcc_type": "acceptable", "distance": 3.102, "atom1_id": "///B/360/OG", "atom2_id": "///B/499/OE2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 64, "atom1_serNum": 403, "atom2_serNum": 436, "donAcc_type": "standard", "distance": 3.254, "atom1_id": "///B/361/O", "atom2_id": "///B/365/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 65, "atom1_serNum": 408, "atom2_serNum": 1240, "donAcc_type": "standard", "distance": 2.812, "atom1_id": "///B/361/NZ", "atom2_id": "///B/467/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 66, "atom1_serNum": 412, "atom2_serNum": 444, "donAcc_type": "standard", "distance": 2.946, "atom1_id": "///B/362/O", "atom2_id": "///B/366/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 67, "atom1_serNum": 412, "atom2_serNum": 997, "donAcc_type": "standard", "distance": 3.935, "atom1_id": "///B/362/O", "atom2_id": "///B/435/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 68, "atom1_serNum": 422, "atom2_serNum": 453, "donAcc_type": "standard", "distance": 2.874, "atom1_id": "///B/363/O", "atom2_id": "///B/367/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 69, "atom1_serNum": 422, "atom2_serNum": 458, "donAcc_type": "acceptable", "distance": 2.684, "atom1_id": "///B/363/O", "atom2_id": "///B/367/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 70, "atom1_serNum": 431, "atom2_serNum": 459, "donAcc_type": "standard", "distance": 2.933, "atom1_id": "///B/364/O", "atom2_id": "///B/368/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 71, "atom1_serNum": 439, "atom2_serNum": 470, "donAcc_type": "standard", "distance": 2.944, "atom1_id": "///B/365/O", "atom2_id": "///B/369/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 72, "atom1_serNum": 447, "atom2_serNum": 480, "donAcc_type": "standard", "distance": 2.878, "atom1_id": "///B/366/O", "atom2_id": "///B/370/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 73, "atom1_serNum": 452, "atom2_serNum": 2337, "donAcc_type": "standard", "distance": 3.023, "atom1_id": "///B/366/NE2", "atom2_id": "///C/2/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 74, "atom1_serNum": 452, "atom2_serNum": 2338, "donAcc_type": "standard", "distance": 3.116, "atom1_id": "///B/366/NE2", "atom2_id": "///C/2/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 75, "atom1_serNum": 452, "atom2_serNum": 2351, "donAcc_type": "acceptable", "distance": 2.930, "atom1_id": "///B/366/NE2", "atom2_id": "///C/4/OG1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 76, "atom1_serNum": 456, "atom2_serNum": 491, "donAcc_type": "standard", "distance": 2.918, "atom1_id": "///B/367/O", "atom2_id": "///B/371/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 77, "atom1_serNum": 462, "atom2_serNum": 500, "donAcc_type": "standard", "distance": 3.290, "atom1_id": "///B/368/O", "atom2_id": "///B/372/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 78, "atom1_serNum": 462, "atom2_serNum": 507, "donAcc_type": "standard", "distance": 3.258, "atom1_id": "///B/368/O", "atom2_id": "///B/373/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 79, "atom1_serNum": 494, "atom2_serNum": 521, "donAcc_type": "acceptable", "distance": 3.195, "atom1_id": "///B/371/O", "atom2_id": "///B/374/ND1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 80, "atom1_serNum": 546, "atom2_serNum": 954, "donAcc_type": "standard", "distance": 2.967, "atom1_id": "///B/377/O", "atom2_id": "///B/431/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 81, "atom1_serNum": 548, "atom2_serNum": 2438, "donAcc_type": "acceptable", "distance": 3.870, "atom1_id": "///B/377/OG1", "atom2_id": "///C/16/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 82, "atom1_serNum": 553, "atom2_serNum": 2417, "donAcc_type": "standard", "distance": 2.765, "atom1_id": "///B/378/O", "atom2_id": "///C/14/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 83, "atom1_serNum": 557, "atom2_serNum": 957, "donAcc_type": "standard", "distance": 3.026, "atom1_id": "///B/379/N", "atom2_id": "///B/431/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 84, "atom1_serNum": 560, "atom2_serNum": 973, "donAcc_type": "standard", "distance": 3.352, "atom1_id": "///B/379/O", "atom2_id": "///B/433/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 85, "atom1_serNum": 565, "atom2_serNum": 2402, "donAcc_type": "standard", "distance": 3.177, "atom1_id": "///B/380/N", "atom2_id": "///C/12/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 86, "atom1_serNum": 568, "atom2_serNum": 2399, "donAcc_type": "standard", "distance": 2.874, "atom1_id": "///B/380/O", "atom2_id": "///C/12/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 87, "atom1_serNum": 572, "atom2_serNum": 976, "donAcc_type": "standard", "distance": 2.760, "atom1_id": "///B/381/N", "atom2_id": "///B/433/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 88, "atom1_serNum": 575, "atom2_serNum": 988, "donAcc_type": "standard", "distance": 3.236, "atom1_id": "///B/381/O", "atom2_id": "///B/435/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 89, "atom1_serNum": 579, "atom2_serNum": 2392, "donAcc_type": "standard", "distance": 2.941, "atom1_id": "///B/382/N", "atom2_id": "///C/10/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 90, "atom1_serNum": 582, "atom2_serNum": 602, "donAcc_type": "standard", "distance": 3.358, "atom1_id": "///B/382/O", "atom2_id": "///B/385/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 91, "atom1_serNum": 585, "atom2_serNum": 994, "donAcc_type": "acceptable", "distance": 3.330, "atom1_id": "///B/382/OD1", "atom2_id": "///B/435/ND1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 92, "atom1_serNum": 586, "atom2_serNum": 2349, "donAcc_type": "standard", "distance": 3.092, "atom1_id": "///B/382/ND2", "atom2_id": "///C/4/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 93, "atom1_serNum": 587, "atom2_serNum": 991, "donAcc_type": "standard", "distance": 2.861, "atom1_id": "///B/383/N", "atom2_id": "///B/435/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 94, "atom1_serNum": 590, "atom2_serNum": 1026, "donAcc_type": "standard", "distance": 3.372, "atom1_id": "///B/383/O", "atom2_id": "///B/440/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 95, "atom1_serNum": 623, "atom2_serNum": 625, "donAcc_type": "acceptable", "distance": 2.830, "atom1_id": "///B/387/O", "atom2_id": "///B/387/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 96, "atom1_serNum": 637, "atom2_serNum": 666, "donAcc_type": "standard", "distance": 3.323, "atom1_id": "///B/389/O", "atom2_id": "///B/393/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 97, "atom1_serNum": 639, "atom2_serNum": 658, "donAcc_type": "acceptable", "distance": 3.075, "atom1_id": "///B/389/OG1", "atom2_id": "///B/392/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 98, "atom1_serNum": 644, "atom2_serNum": 674, "donAcc_type": "standard", "distance": 2.988, "atom1_id": "///B/390/O", "atom2_id": "///B/394/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 99, "atom1_serNum": 652, "atom2_serNum": 682, "donAcc_type": "standard", "distance": 2.847, "atom1_id": "///B/391/O", "atom2_id": "///B/395/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 100, "atom1_serNum": 657, "atom2_serNum": 689, "donAcc_type": "standard", "distance": 2.937, "atom1_id": "///B/391/NZ", "atom2_id": "///B/395/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 101, "atom1_serNum": 657, "atom2_serNum": 21375, "donAcc_type": "standard", "distance": 3.473, "atom1_id": "///B/391/NZ", "atom2_id": "///I/58/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 102, "atom1_serNum": 661, "atom2_serNum": 690, "donAcc_type": "standard", "distance": 2.887, "atom1_id": "///B/392/O", "atom2_id": "///B/396/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 103, "atom1_serNum": 669, "atom2_serNum": 696, "donAcc_type": "standard", "distance": 2.978, "atom1_id": "///B/393/O", "atom2_id": "///B/397/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 104, "atom1_serNum": 677, "atom2_serNum": 704, "donAcc_type": "standard", "distance": 2.924, "atom1_id": "///B/394/O", "atom2_id": "///B/398/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 105, "atom1_serNum": 677, "atom2_serNum": 709, "donAcc_type": "acceptable", "distance": 2.738, "atom1_id": "///B/394/O", "atom2_id": "///B/398/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 106, "atom1_serNum": 685, "atom2_serNum": 711, "donAcc_type": "standard", "distance": 2.877, "atom1_id": "///B/395/O", "atom2_id": "///B/399/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 107, "atom1_serNum": 685, "atom2_serNum": 716, "donAcc_type": "acceptable", "distance": 2.879, "atom1_id": "///B/395/O", "atom2_id": "///B/399/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 108, "atom1_serNum": 688, "atom2_serNum": 766, "donAcc_type": "standard", "distance": 2.769, "atom1_id": "///B/395/OD1", "atom2_id": "///B/407/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 109, "atom1_serNum": 693, "atom2_serNum": 717, "donAcc_type": "standard", "distance": 2.930, "atom1_id": "///B/396/O", "atom2_id": "///B/400/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 110, "atom1_serNum": 695, "atom2_serNum": 724, "donAcc_type": "acceptable", "distance": 3.840, "atom1_id": "///B/396/OG", "atom2_id": "///B/400/OD2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 111, "atom1_serNum": 699, "atom2_serNum": 725, "donAcc_type": "standard", "distance": 2.970, "atom1_id": "///B/397/O", "atom2_id": "///B/401/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 112, "atom1_serNum": 699, "atom2_serNum": 733, "donAcc_type": "standard", "distance": 3.383, "atom1_id": "///B/397/O", "atom2_id": "///B/402/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 113, "atom1_serNum": 707, "atom2_serNum": 749, "donAcc_type": "standard", "distance": 2.919, "atom1_id": "///B/398/O", "atom2_id": "///B/404/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 114, "atom1_serNum": 714, "atom2_serNum": 741, "donAcc_type": "standard", "distance": 3.399, "atom1_id": "///B/399/O", "atom2_id": "///B/403/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 115, "atom1_serNum": 720, "atom2_serNum": 2437, "donAcc_type": "standard", "distance": 3.335, "atom1_id": "///B/400/O", "atom2_id": "///C/15/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 116, "atom1_serNum": 728, "atom2_serNum": 2458, "donAcc_type": "questionable", "distance": 3.345, "atom1_id": "///B/401/O", "atom2_id": "///C/19/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 117, "atom1_serNum": 747, "atom2_serNum": 2437, "donAcc_type": "standard", "distance": 2.957, "atom1_id": "///B/403/OD1", "atom2_id": "///C/15/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 118, "atom1_serNum": 748, "atom2_serNum": 2437, "donAcc_type": "standard", "distance": 3.380, "atom1_id": "///B/403/OD2", "atom2_id": "///C/15/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 119, "atom1_serNum": 787, "atom2_serNum": 818, "donAcc_type": "standard", "distance": 3.086, "atom1_id": "///B/410/O", "atom2_id": "///B/414/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 120, "atom1_serNum": 795, "atom2_serNum": 823, "donAcc_type": "standard", "distance": 2.935, "atom1_id": "///B/411/O", "atom2_id": "///B/415/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 121, "atom1_serNum": 802, "atom2_serNum": 830, "donAcc_type": "standard", "distance": 2.932, "atom1_id": "///B/412/O", "atom2_id": "///B/416/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 122, "atom1_serNum": 805, "atom2_serNum": 1132, "donAcc_type": "acceptable", "distance": 3.439, "atom1_id": "///B/412/ND1", "atom2_id": "///B/453/NH1", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 123, "atom1_serNum": 812, "atom2_serNum": 838, "donAcc_type": "standard", "distance": 2.938, "atom1_id": "///B/413/O", "atom2_id": "///B/417/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 124, "atom1_serNum": 821, "atom2_serNum": 846, "donAcc_type": "standard", "distance": 2.891, "atom1_id": "///B/414/O", "atom2_id": "///B/418/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 125, "atom1_serNum": 826, "atom2_serNum": 854, "donAcc_type": "standard", "distance": 2.881, "atom1_id": "///B/415/O", "atom2_id": "///B/419/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 126, "atom1_serNum": 833, "atom2_serNum": 863, "donAcc_type": "standard", "distance": 3.005, "atom1_id": "///B/416/O", "atom2_id": "///B/420/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 127, "atom1_serNum": 836, "atom2_serNum": 1133, "donAcc_type": "standard", "distance": 2.385, "atom1_id": "///B/416/OD1", "atom2_id": "///B/453/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 128, "atom1_serNum": 841, "atom2_serNum": 872, "donAcc_type": "standard", "distance": 2.946, "atom1_id": "///B/417/O", "atom2_id": "///B/421/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 129, "atom1_serNum": 849, "atom2_serNum": 881, "donAcc_type": "standard", "distance": 2.872, "atom1_id": "///B/418/O", "atom2_id": "///B/422/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 130, "atom1_serNum": 857, "atom2_serNum": 892, "donAcc_type": "standard", "distance": 2.899, "atom1_id": "///B/419/O", "atom2_id": "///B/423/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 131, "atom1_serNum": 866, "atom2_serNum": 897, "donAcc_type": "standard", "distance": 3.034, "atom1_id": "///B/420/O", "atom2_id": "///B/424/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 132, "atom1_serNum": 879, "atom2_serNum": 2472, "donAcc_type": "standard", "distance": 2.578, "atom1_id": "///B/421/OE1", "atom2_id": "///C/20/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 133, "atom1_serNum": 884, "atom2_serNum": 1180, "donAcc_type": "standard", "distance": 2.640, "atom1_id": "///B/422/O", "atom2_id": "///B/459/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 134, "atom1_serNum": 908, "atom2_serNum": 1180, "donAcc_type": "standard", "distance": 2.913, "atom1_id": "///B/425/O", "atom2_id": "///B/459/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 135, "atom1_serNum": 942, "atom2_serNum": 1176, "donAcc_type": "acceptable", "distance": 3.608, "atom1_id": "///B/429/ND1", "atom2_id": "///B/459/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 136, "atom1_serNum": 942, "atom2_serNum": 1198, "donAcc_type": "acceptable", "distance": 3.304, "atom1_id": "///B/429/ND1", "atom2_id": "///B/461/NE2", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 137, "atom1_serNum": 945, "atom2_serNum": 2478, "donAcc_type": "acceptable", "distance": 3.066, "atom1_id": "///B/429/NE2", "atom2_id": "///C/38/OG", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 138, "atom1_serNum": 949, "atom2_serNum": 1189, "donAcc_type": "standard", "distance": 3.166, "atom1_id": "///B/430/O", "atom2_id": "///B/461/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 139, "atom1_serNum": 965, "atom2_serNum": 1192, "donAcc_type": "standard", "distance": 2.890, "atom1_id": "///B/432/N", "atom2_id": "///B/461/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 140, "atom1_serNum": 968, "atom2_serNum": 1207, "donAcc_type": "standard", "distance": 2.922, "atom1_id": "///B/432/O", "atom2_id": "///B/463/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 141, "atom1_serNum": 981, "atom2_serNum": 1210, "donAcc_type": "standard", "distance": 2.901, "atom1_id": "///B/434/N", "atom2_id": "///B/463/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 142, "atom1_serNum": 984, "atom2_serNum": 1220, "donAcc_type": "standard", "distance": 2.992, "atom1_id": "///B/434/O", "atom2_id": "///B/465/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 143, "atom1_serNum": 1005, "atom2_serNum": 1020, "donAcc_type": "standard", "distance": 3.508, "atom1_id": "///B/436/ND2", "atom2_id": "///B/438/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 144, "atom1_serNum": 1005, "atom2_serNum": 1241, "donAcc_type": "standard", "distance": 2.465, "atom1_id": "///B/436/ND2", "atom2_id": "///B/467/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 145, "atom1_serNum": 1006, "atom2_serNum": 1223, "donAcc_type": "standard", "distance": 2.687, "atom1_id": "///B/437/N", "atom2_id": "///B/465/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 146, "atom1_serNum": 1009, "atom2_serNum": 1095, "donAcc_type": "standard", "distance": 2.799, "atom1_id": "///B/437/O", "atom2_id": "///B/448/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 147, "atom1_serNum": 1014, "atom2_serNum": 1020, "donAcc_type": "standard", "distance": 2.571, "atom1_id": "///B/438/N", "atom2_id": "///B/438/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 148, "atom1_serNum": 1017, "atom2_serNum": 1054, "donAcc_type": "standard", "distance": 3.269, "atom1_id": "///B/438/O", "atom2_id": "///B/443/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 149, "atom1_serNum": 1021, "atom2_serNum": 1234, "donAcc_type": "standard", "distance": 2.712, "atom1_id": "///B/438/OD2", "atom2_id": "///B/467/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 150, "atom1_serNum": 1021, "atom2_serNum": 1242, "donAcc_type": "standard", "distance": 2.489, "atom1_id": "///B/438/OD2", "atom2_id": "///B/468/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 151, "atom1_serNum": 1021, "atom2_serNum": 1273, "donAcc_type": "acceptable", "distance": 3.242, "atom1_id": "///B/438/OD2", "atom2_id": "///B/471/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 152, "atom1_serNum": 1042, "atom2_serNum": 1095, "donAcc_type": "standard", "distance": 2.583, "atom1_id": "///B/442/O", "atom2_id": "///B/448/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 153, "atom1_serNum": 1056, "atom2_serNum": 13727, "donAcc_type": "standard", "distance": 2.759, "atom1_id": "///B/443/NH1", "atom2_id": "///E/427/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 154, "atom1_serNum": 1058, "atom2_serNum": 1064, "donAcc_type": "standard", "distance": 2.618, "atom1_id": "///B/444/N", "atom2_id": "///B/444/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 155, "atom1_serNum": 1061, "atom2_serNum": 1087, "donAcc_type": "standard", "distance": 3.601, "atom1_id": "///B/444/O", "atom2_id": "///B/448/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 156, "atom1_serNum": 1069, "atom2_serNum": 1096, "donAcc_type": "standard", "distance": 2.922, "atom1_id": "///B/445/O", "atom2_id": "///B/449/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 157, "atom1_serNum": 1076, "atom2_serNum": 1101, "donAcc_type": "standard", "distance": 2.953, "atom1_id": "///B/446/O", "atom2_id": "///B/450/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 158, "atom1_serNum": 1085, "atom2_serNum": 1109, "donAcc_type": "standard", "distance": 2.913, "atom1_id": "///B/447/O", "atom2_id": "///B/451/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 159, "atom1_serNum": 1090, "atom2_serNum": 1117, "donAcc_type": "standard", "distance": 2.890, "atom1_id": "///B/448/O", "atom2_id": "///B/452/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 160, "atom1_serNum": 1094, "atom2_serNum": 1306, "donAcc_type": "standard", "distance": 2.959, "atom1_id": "///B/448/OE1", "atom2_id": "///B/475/NE1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 161, "atom1_serNum": 1099, "atom2_serNum": 1122, "donAcc_type": "acceptable", "distance": 2.792, "atom1_id": "///B/449/O", "atom2_id": "///B/452/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 162, "atom1_serNum": 1099, "atom2_serNum": 1123, "donAcc_type": "standard", "distance": 2.953, "atom1_id": "///B/449/O", "atom2_id": "///B/453/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 163, "atom1_serNum": 1104, "atom2_serNum": 1134, "donAcc_type": "standard", "distance": 2.925, "atom1_id": "///B/450/O", "atom2_id": "///B/454/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 164, "atom1_serNum": 1112, "atom2_serNum": 1142, "donAcc_type": "standard", "distance": 2.912, "atom1_id": "///B/451/O", "atom2_id": "///B/455/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 165, "atom1_serNum": 1120, "atom2_serNum": 1147, "donAcc_type": "standard", "distance": 2.962, "atom1_id": "///B/452/O", "atom2_id": "///B/456/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 166, "atom1_serNum": 1156, "atom2_serNum": 1361, "donAcc_type": "acceptable", "distance": 3.332, "atom1_id": "///B/456/NH1", "atom2_id": "///B/482/OG", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 167, "atom1_serNum": 1161, "atom2_serNum": 1184, "donAcc_type": "questionable", "distance": 3.018, "atom1_id": "///B/457/O", "atom2_id": "///B/460/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 168, "atom1_serNum": 1240, "atom2_serNum": 1488, "donAcc_type": "acceptable", "distance": 2.447, "atom1_id": "///B/467/OD1", "atom2_id": "///B/496/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 169, "atom1_serNum": 1245, "atom2_serNum": 1273, "donAcc_type": "acceptable", "distance": 2.688, "atom1_id": "///B/468/O", "atom2_id": "///B/471/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 170, "atom1_serNum": 1248, "atom2_serNum": 1260, "donAcc_type": "acceptable", "distance": 3.094, "atom1_id": "///B/468/ND1", "atom2_id": "///B/470/N", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 171, "atom1_serNum": 1252, "atom2_serNum": 7082, "donAcc_type": "standard", "distance": 3.282, "atom1_id": "///B/469/N", "atom2_id": "///C/703/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 172, "atom1_serNum": 1263, "atom2_serNum": 1282, "donAcc_type": "standard", "distance": 3.456, "atom1_id": "///B/470/O", "atom2_id": "///B/473/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 173, "atom1_serNum": 1267, "atom2_serNum": 13714, "donAcc_type": "standard", "distance": 3.434, "atom1_id": "///B/470/ND2", "atom2_id": "///E/426/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 174, "atom1_serNum": 1271, "atom2_serNum": 1290, "donAcc_type": "standard", "distance": 3.397, "atom1_id": "///B/471/O", "atom2_id": "///B/474/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 175, "atom1_serNum": 1285, "atom2_serNum": 13578, "donAcc_type": "acceptable", "distance": 3.347, "atom1_id": "///B/473/O", "atom2_id": "///E/408/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 176, "atom1_serNum": 1301, "atom2_serNum": 13555, "donAcc_type": "acceptable", "distance": 3.268, "atom1_id": "///B/475/O", "atom2_id": "///E/405/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 177, "atom1_serNum": 1315, "atom2_serNum": 1342, "donAcc_type": "standard", "distance": 2.815, "atom1_id": "///B/476/O", "atom2_id": "///B/480/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 178, "atom1_serNum": 1318, "atom2_serNum": 1341, "donAcc_type": "standard", "distance": 2.571, "atom1_id": "///B/476/OD1", "atom2_id": "///B/479/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 179, "atom1_serNum": 1319, "atom2_serNum": 1329, "donAcc_type": "standard", "distance": 2.978, "atom1_id": "///B/476/OD2", "atom2_id": "///B/478/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 180, "atom1_serNum": 1323, "atom2_serNum": 1350, "donAcc_type": "standard", "distance": 2.892, "atom1_id": "///B/477/O", "atom2_id": "///B/481/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 181, "atom1_serNum": 1327, "atom2_serNum": 13564, "donAcc_type": "standard", "distance": 3.254, "atom1_id": "///B/477/OE1", "atom2_id": "///E/406/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 182, "atom1_serNum": 1332, "atom2_serNum": 1356, "donAcc_type": "standard", "distance": 2.954, "atom1_id": "///B/478/O", "atom2_id": "///B/482/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 183, "atom1_serNum": 1336, "atom2_serNum": 1362, "donAcc_type": "standard", "distance": 2.665, "atom1_id": "///B/479/O", "atom2_id": "///B/483/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 184, "atom1_serNum": 1359, "atom2_serNum": 1373, "donAcc_type": "standard", "distance": 3.026, "atom1_id": "///B/482/O", "atom2_id": "///B/484/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 185, "atom1_serNum": 1365, "atom2_serNum": 1381, "donAcc_type": "standard", "distance": 2.706, "atom1_id": "///B/483/O", "atom2_id": "///B/485/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 186, "atom1_serNum": 1380, "atom2_serNum": 4518, "donAcc_type": "standard", "distance": 2.880, "atom1_id": "///B/484/ND2", "atom2_id": "///C/316/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 187, "atom1_serNum": 1397, "atom2_serNum": 1420, "donAcc_type": "acceptable", "distance": 3.164, "atom1_id": "///B/486/OG", "atom2_id": "///B/488/NE1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 188, "atom1_serNum": 1398, "atom2_serNum": 6411, "donAcc_type": "standard", "distance": 3.164, "atom1_id": "///B/487/N", "atom2_id": "///C/605/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 189, "atom1_serNum": 1401, "atom2_serNum": 6414, "donAcc_type": "questionable", "distance": 3.145, "atom1_id": "///B/487/O", "atom2_id": "///C/605/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 190, "atom1_serNum": 1415, "atom2_serNum": 1434, "donAcc_type": "standard", "distance": 3.032, "atom1_id": "///B/488/O", "atom2_id": "///B/490/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 191, "atom1_serNum": 1432, "atom2_serNum": 1445, "donAcc_type": "acceptable", "distance": 2.360, "atom1_id": "///B/489/OD1", "atom2_id": "///B/491/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 192, "atom1_serNum": 1433, "atom2_serNum": 6562, "donAcc_type": "acceptable", "distance": 3.074, "atom1_id": "///B/489/OD2", "atom2_id": "///C/624/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 193, "atom1_serNum": 1437, "atom2_serNum": 1447, "donAcc_type": "standard", "distance": 3.124, "atom1_id": "///B/490/O", "atom2_id": "///B/492/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 194, "atom1_serNum": 1473, "atom2_serNum": 1489, "donAcc_type": "standard", "distance": 2.956, "atom1_id": "///B/495/O", "atom2_id": "///B/497/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 195, "atom1_serNum": 1477, "atom2_serNum": 7049, "donAcc_type": "standard", "distance": 2.884, "atom1_id": "///B/496/N", "atom2_id": "///C/699/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 196, "atom1_serNum": 1480, "atom2_serNum": 1518, "donAcc_type": "acceptable", "distance": 2.733, "atom1_id": "///B/496/O", "atom2_id": "///B/500/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 197, "atom1_serNum": 1492, "atom2_serNum": 1520, "donAcc_type": "standard", "distance": 2.930, "atom1_id": "///B/497/O", "atom2_id": "///B/501/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 198, "atom1_serNum": 1504, "atom2_serNum": 1511, "donAcc_type": "standard", "distance": 2.843, "atom1_id": "///B/499/N", "atom2_id": "///B/499/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 199, "atom1_serNum": 1516, "atom2_serNum": 1558, "donAcc_type": "acceptable", "distance": 3.633, "atom1_id": "///B/500/O", "atom2_id": "///B/505/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 200, "atom1_serNum": 1528, "atom2_serNum": 1553, "donAcc_type": "standard", "distance": 3.397, "atom1_id": "///B/502/O", "atom2_id": "///B/505/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 201, "atom1_serNum": 1543, "atom2_serNum": 18601, "donAcc_type": "standard", "distance": 2.906, "atom1_id": "///B/503/OE1", "atom2_id": "///G/421/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 202, "atom1_serNum": 1551, "atom2_serNum": 1553, "donAcc_type": "standard", "distance": 2.887, "atom1_id": "///B/504/OD1", "atom2_id": "///B/505/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 203, "atom1_serNum": 1562, "atom2_serNum": 1584, "donAcc_type": "standard", "distance": 3.076, "atom1_id": "///B/515/O", "atom2_id": "///B/519/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 204, "atom1_serNum": 1567, "atom2_serNum": 1592, "donAcc_type": "standard", "distance": 2.925, "atom1_id": "///B/516/O", "atom2_id": "///B/520/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 205, "atom1_serNum": 1575, "atom2_serNum": 1603, "donAcc_type": "standard", "distance": 2.945, "atom1_id": "///B/517/O", "atom2_id": "///B/521/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 206, "atom1_serNum": 1581, "atom2_serNum": 1608, "donAcc_type": "acceptable", "distance": 2.706, "atom1_id": "///B/518/O", "atom2_id": "///B/521/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 207, "atom1_serNum": 1581, "atom2_serNum": 1609, "donAcc_type": "standard", "distance": 2.963, "atom1_id": "///B/518/O", "atom2_id": "///B/522/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 208, "atom1_serNum": 1587, "atom2_serNum": 1616, "donAcc_type": "standard", "distance": 2.868, "atom1_id": "///B/519/O", "atom2_id": "///B/523/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 209, "atom1_serNum": 1595, "atom2_serNum": 1627, "donAcc_type": "standard", "distance": 2.949, "atom1_id": "///B/520/O", "atom2_id": "///B/524/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 210, "atom1_serNum": 1601, "atom2_serNum": 2303, "donAcc_type": "standard", "distance": 3.174, "atom1_id": "///B/520/NH1", "atom2_id": "///B/614/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 211, "atom1_serNum": 1606, "atom2_serNum": 1632, "donAcc_type": "acceptable", "distance": 2.931, "atom1_id": "///B/521/O", "atom2_id": "///B/524/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 212, "atom1_serNum": 1612, "atom2_serNum": 1638, "donAcc_type": "acceptable", "distance": 2.943, "atom1_id": "///B/522/O", "atom2_id": "///B/525/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 213, "atom1_serNum": 1630, "atom2_serNum": 1685, "donAcc_type": "standard", "distance": 2.835, "atom1_id": "///B/524/O", "atom2_id": "///B/531/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 214, "atom1_serNum": 1650, "atom2_serNum": 1675, "donAcc_type": "standard", "distance": 3.013, "atom1_id": "///B/527/O", "atom2_id": "///B/531/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 215, "atom1_serNum": 1652, "atom2_serNum": 19019, "donAcc_type": "acceptable", "distance": 3.237, "atom1_id": "///B/527/OG1", "atom2_id": "///G/473/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 216, "atom1_serNum": 1657, "atom2_serNum": 1686, "donAcc_type": "standard", "distance": 2.936, "atom1_id": "///B/528/O", "atom2_id": "///B/532/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 217, "atom1_serNum": 1664, "atom2_serNum": 1690, "donAcc_type": "standard", "distance": 2.943, "atom1_id": "///B/529/O", "atom2_id": "///B/533/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 218, "atom1_serNum": 1672, "atom2_serNum": 1698, "donAcc_type": "standard", "distance": 2.989, "atom1_id": "///B/530/O", "atom2_id": "///B/534/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 219, "atom1_serNum": 1674, "atom2_serNum": 2008, "donAcc_type": "acceptable", "distance": 2.353, "atom1_id": "///B/530/OG", "atom2_id": "///B/577/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 220, "atom1_serNum": 1678, "atom2_serNum": 1710, "donAcc_type": "standard", "distance": 2.891, "atom1_id": "///B/531/O", "atom2_id": "///B/535/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 221, "atom1_serNum": 1689, "atom2_serNum": 1718, "donAcc_type": "standard", "distance": 2.911, "atom1_id": "///B/532/O", "atom2_id": "///B/536/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 222, "atom1_serNum": 1693, "atom2_serNum": 1726, "donAcc_type": "standard", "distance": 3.055, "atom1_id": "///B/533/O", "atom2_id": "///B/537/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 223, "atom1_serNum": 1701, "atom2_serNum": 1734, "donAcc_type": "standard", "distance": 2.900, "atom1_id": "///B/534/O", "atom2_id": "///B/538/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 224, "atom1_serNum": 1709, "atom2_serNum": 2082, "donAcc_type": "acceptable", "distance": 3.310, "atom1_id": "///B/534/OH", "atom2_id": "///B/586/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 225, "atom1_serNum": 1713, "atom2_serNum": 1741, "donAcc_type": "standard", "distance": 2.875, "atom1_id": "///B/535/O", "atom2_id": "///B/539/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 226, "atom1_serNum": 1721, "atom2_serNum": 1750, "donAcc_type": "standard", "distance": 2.981, "atom1_id": "///B/536/O", "atom2_id": "///B/540/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 227, "atom1_serNum": 1729, "atom2_serNum": 1762, "donAcc_type": "standard", "distance": 2.924, "atom1_id": "///B/537/O", "atom2_id": "///B/541/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 228, "atom1_serNum": 1737, "atom2_serNum": 1771, "donAcc_type": "standard", "distance": 2.929, "atom1_id": "///B/538/O", "atom2_id": "///B/542/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 229, "atom1_serNum": 1744, "atom2_serNum": 1779, "donAcc_type": "standard", "distance": 2.882, "atom1_id": "///B/539/O", "atom2_id": "///B/543/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 230, "atom1_serNum": 1753, "atom2_serNum": 1788, "donAcc_type": "standard", "distance": 2.934, "atom1_id": "///B/540/O", "atom2_id": "///B/544/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 231, "atom1_serNum": 1765, "atom2_serNum": 1796, "donAcc_type": "standard", "distance": 2.857, "atom1_id": "///B/541/O", "atom2_id": "///B/545/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 232, "atom1_serNum": 1788, "atom2_serNum": 1794, "donAcc_type": "standard", "distance": 2.940, "atom1_id": "///B/544/N", "atom2_id": "///B/544/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 233, "atom1_serNum": 1812, "atom2_serNum": 2178, "donAcc_type": "standard", "distance": 2.900, "atom1_id": "///B/553/O", "atom2_id": "///B/599/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 234, "atom1_serNum": 1820, "atom2_serNum": 1854, "donAcc_type": "standard", "distance": 3.675, "atom1_id": "///B/554/O", "atom2_id": "///B/558/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 235, "atom1_serNum": 1824, "atom2_serNum": 2163, "donAcc_type": "standard", "distance": 2.926, "atom1_id": "///B/555/N", "atom2_id": "///B/597/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 236, "atom1_serNum": 1827, "atom2_serNum": 1862, "donAcc_type": "standard", "distance": 2.952, "atom1_id": "///B/555/O", "atom2_id": "///B/559/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 237, "atom1_serNum": 1838, "atom2_serNum": 1874, "donAcc_type": "standard", "distance": 2.941, "atom1_id": "///B/556/O", "atom2_id": "///B/560/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 238, "atom1_serNum": 1844, "atom2_serNum": 20032, "donAcc_type": "standard", "distance": 3.298, "atom1_id": "///B/556/NH1", "atom2_id": "///G/637/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 239, "atom1_serNum": 1845, "atom2_serNum": 20032, "donAcc_type": "standard", "distance": 2.807, "atom1_id": "///B/556/NH2", "atom2_id": "///G/637/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 240, "atom1_serNum": 1849, "atom2_serNum": 1880, "donAcc_type": "standard", "distance": 2.911, "atom1_id": "///B/557/O", "atom2_id": "///B/561/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 241, "atom1_serNum": 1849, "atom2_serNum": 1885, "donAcc_type": "acceptable", "distance": 2.514, "atom1_id": "///B/557/O", "atom2_id": "///B/561/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 242, "atom1_serNum": 1857, "atom2_serNum": 1886, "donAcc_type": "standard", "distance": 2.913, "atom1_id": "///B/558/O", "atom2_id": "///B/562/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 243, "atom1_serNum": 1865, "atom2_serNum": 1892, "donAcc_type": "standard", "distance": 2.965, "atom1_id": "///B/559/O", "atom2_id": "///B/563/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 244, "atom1_serNum": 1873, "atom2_serNum": 20050, "donAcc_type": "acceptable", "distance": 2.799, "atom1_id": "///B/559/OH", "atom2_id": "///G/639/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 245, "atom1_serNum": 1877, "atom2_serNum": 1903, "donAcc_type": "standard", "distance": 2.926, "atom1_id": "///B/560/O", "atom2_id": "///B/564/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 246, "atom1_serNum": 1883, "atom2_serNum": 1912, "donAcc_type": "standard", "distance": 2.938, "atom1_id": "///B/561/O", "atom2_id": "///B/565/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 247, "atom1_serNum": 1889, "atom2_serNum": 1917, "donAcc_type": "standard", "distance": 2.877, "atom1_id": "///B/562/O", "atom2_id": "///B/566/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 248, "atom1_serNum": 1889, "atom2_serNum": 1928, "donAcc_type": "standard", "distance": 2.884, "atom1_id": "///B/562/O", "atom2_id": "///B/567/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 249, "atom1_serNum": 1899, "atom2_serNum": 20024, "donAcc_type": "standard", "distance": 3.346, "atom1_id": "///B/563/NE", "atom2_id": "///G/636/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 250, "atom1_serNum": 1902, "atom2_serNum": 20024, "donAcc_type": "standard", "distance": 2.561, "atom1_id": "///B/563/NH2", "atom2_id": "///G/636/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 251, "atom1_serNum": 1952, "atom2_serNum": 1976, "donAcc_type": "standard", "distance": 3.661, "atom1_id": "///B/570/O", "atom2_id": "///B/574/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 252, "atom1_serNum": 1958, "atom2_serNum": 1984, "donAcc_type": "standard", "distance": 2.946, "atom1_id": "///B/571/O", "atom2_id": "///B/575/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 253, "atom1_serNum": 1962, "atom2_serNum": 1991, "donAcc_type": "standard", "distance": 3.062, "atom1_id": "///B/571/OD2", "atom2_id": "///B/575/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 254, "atom1_serNum": 1962, "atom2_serNum": 1994, "donAcc_type": "standard", "distance": 2.639, "atom1_id": "///B/571/OD2", "atom2_id": "///B/575/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 255, "atom1_serNum": 1962, "atom2_serNum": 19997, "donAcc_type": "questionable", "distance": 2.852, "atom1_id": "///B/571/OD2", "atom2_id": "///G/634/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 256, "atom1_serNum": 1966, "atom2_serNum": 1995, "donAcc_type": "standard", "distance": 2.930, "atom1_id": "///B/572/O", "atom2_id": "///B/576/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 257, "atom1_serNum": 1974, "atom2_serNum": 2000, "donAcc_type": "standard", "distance": 2.941, "atom1_id": "///B/573/O", "atom2_id": "///B/577/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 258, "atom1_serNum": 1979, "atom2_serNum": 2009, "donAcc_type": "standard", "distance": 2.950, "atom1_id": "///B/574/O", "atom2_id": "///B/578/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 259, "atom1_serNum": 1987, "atom2_serNum": 2017, "donAcc_type": "standard", "distance": 2.888, "atom1_id": "///B/575/O", "atom2_id": "///B/579/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 260, "atom1_serNum": 1987, "atom2_serNum": 2022, "donAcc_type": "acceptable", "distance": 2.587, "atom1_id": "///B/575/O", "atom2_id": "///B/579/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 261, "atom1_serNum": 1998, "atom2_serNum": 2024, "donAcc_type": "standard", "distance": 2.952, "atom1_id": "///B/576/O", "atom2_id": "///B/580/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 262, "atom1_serNum": 2003, "atom2_serNum": 2033, "donAcc_type": "standard", "distance": 2.938, "atom1_id": "///B/577/O", "atom2_id": "///B/581/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 263, "atom1_serNum": 2008, "atom2_serNum": 2031, "donAcc_type": "standard", "distance": 3.415, "atom1_id": "///B/577/NE2", "atom2_id": "///B/580/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 264, "atom1_serNum": 2012, "atom2_serNum": 2044, "donAcc_type": "standard", "distance": 2.887, "atom1_id": "///B/578/O", "atom2_id": "///B/582/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 265, "atom1_serNum": 2020, "atom2_serNum": 2052, "donAcc_type": "standard", "distance": 2.923, "atom1_id": "///B/579/O", "atom2_id": "///B/583/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 266, "atom1_serNum": 2027, "atom2_serNum": 2060, "donAcc_type": "standard", "distance": 2.938, "atom1_id": "///B/580/O", "atom2_id": "///B/584/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 267, "atom1_serNum": 2027, "atom2_serNum": 2066, "donAcc_type": "acceptable", "distance": 3.228, "atom1_id": "///B/580/O", "atom2_id": "///B/584/ND1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 268, "atom1_serNum": 2036, "atom2_serNum": 2070, "donAcc_type": "standard", "distance": 2.756, "atom1_id": "///B/581/O", "atom2_id": "///B/585/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 269, "atom1_serNum": 2036, "atom2_serNum": 2079, "donAcc_type": "standard", "distance": 3.038, "atom1_id": "///B/581/O", "atom2_id": "///B/586/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 270, "atom1_serNum": 2094, "atom2_serNum": 2189, "donAcc_type": "standard", "distance": 2.878, "atom1_id": "///B/588/N", "atom2_id": "///B/600/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 271, "atom1_serNum": 2097, "atom2_serNum": 2186, "donAcc_type": "standard", "distance": 2.932, "atom1_id": "///B/588/O", "atom2_id": "///B/600/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 272, "atom1_serNum": 2109, "atom2_serNum": 2172, "donAcc_type": "standard", "distance": 2.895, "atom1_id": "///B/590/N", "atom2_id": "///B/598/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 273, "atom1_serNum": 2112, "atom2_serNum": 2169, "donAcc_type": "standard", "distance": 2.909, "atom1_id": "///B/590/O", "atom2_id": "///B/598/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 274, "atom1_serNum": 2129, "atom2_serNum": 2157, "donAcc_type": "standard", "distance": 2.905, "atom1_id": "///B/592/N", "atom2_id": "///B/596/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 275, "atom1_serNum": 2132, "atom2_serNum": 2150, "donAcc_type": "standard", "distance": 3.215, "atom1_id": "///B/592/O", "atom2_id": "///B/595/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 276, "atom1_serNum": 2196, "atom2_serNum": 2208, "donAcc_type": "standard", "distance": 2.883, "atom1_id": "///B/601/O", "atom2_id": "///B/603/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 277, "atom1_serNum": 2216, "atom2_serNum": 2222, "donAcc_type": "standard", "distance": 2.728, "atom1_id": "///B/604/N", "atom2_id": "///B/604/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 278, "atom1_serNum": 2219, "atom2_serNum": 2241, "donAcc_type": "standard", "distance": 3.055, "atom1_id": "///B/604/O", "atom2_id": "///B/608/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 279, "atom1_serNum": 2227, "atom2_serNum": 2249, "donAcc_type": "standard", "distance": 2.893, "atom1_id": "///B/605/O", "atom2_id": "///B/609/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 280, "atom1_serNum": 2231, "atom2_serNum": 2258, "donAcc_type": "standard", "distance": 2.949, "atom1_id": "///B/606/O", "atom2_id": "///B/610/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 281, "atom1_serNum": 2236, "atom2_serNum": 2267, "donAcc_type": "standard", "distance": 2.856, "atom1_id": "///B/607/O", "atom2_id": "///B/611/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 282, "atom1_serNum": 2244, "atom2_serNum": 2278, "donAcc_type": "standard", "distance": 2.918, "atom1_id": "///B/608/O", "atom2_id": "///B/612/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 283, "atom1_serNum": 2252, "atom2_serNum": 2257, "donAcc_type": "standard", "distance": 3.160, "atom1_id": "///B/609/O", "atom2_id": "///B/609/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 284, "atom1_serNum": 2252, "atom2_serNum": 2286, "donAcc_type": "standard", "distance": 2.948, "atom1_id": "///B/609/O", "atom2_id": "///B/613/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 285, "atom1_serNum": 2252, "atom2_serNum": 2294, "donAcc_type": "questionable", "distance": 2.947, "atom1_id": "///B/609/O", "atom2_id": "///B/613/OE2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 286, "atom1_serNum": 2261, "atom2_serNum": 2295, "donAcc_type": "standard", "distance": 2.848, "atom1_id": "///B/610/O", "atom2_id": "///B/614/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 287, "atom1_serNum": 2270, "atom2_serNum": 2304, "donAcc_type": "standard", "distance": 2.980, "atom1_id": "///B/611/O", "atom2_id": "///B/615/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 288, "atom1_serNum": 2323, "atom2_serNum": 18651, "donAcc_type": "standard", "distance": 3.727, "atom1_id": "///C/1/N", "atom2_id": "///G/427/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 289, "atom1_serNum": 2334, "atom2_serNum": 2353, "donAcc_type": "standard", "distance": 3.010, "atom1_id": "///C/2/O", "atom2_id": "///C/5/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 290, "atom1_serNum": 2337, "atom2_serNum": 2346, "donAcc_type": "standard", "distance": 2.768, "atom1_id": "///C/2/OD1", "atom2_id": "///C/4/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 291, "atom1_serNum": 2337, "atom2_serNum": 2351, "donAcc_type": "acceptable", "distance": 3.073, "atom1_id": "///C/2/OD1", "atom2_id": "///C/4/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 292, "atom1_serNum": 2349, "atom2_serNum": 2361, "donAcc_type": "standard", "distance": 3.107, "atom1_id": "///C/4/O", "atom2_id": "///C/6/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 293, "atom1_serNum": 2351, "atom2_serNum": 2428, "donAcc_type": "acceptable", "distance": 3.475, "atom1_id": "///C/4/OG1", "atom2_id": "///C/14/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 294, "atom1_serNum": 2366, "atom2_serNum": 2380, "donAcc_type": "acceptable", "distance": 2.938, "atom1_id": "///C/6/OG", "atom2_id": "///C/9/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 295, "atom1_serNum": 2366, "atom2_serNum": 2383, "donAcc_type": "acceptable", "distance": 3.025, "atom1_id": "///C/6/OG", "atom2_id": "///C/9/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 296, "atom1_serNum": 2370, "atom2_serNum": 18603, "donAcc_type": "standard", "distance": 2.431, "atom1_id": "///C/7/O", "atom2_id": "///G/421/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 297, "atom1_serNum": 2379, "atom2_serNum": 18397, "donAcc_type": "acceptable", "distance": 3.187, "atom1_id": "///C/8/OG", "atom2_id": "///G/394/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 298, "atom1_serNum": 2420, "atom2_serNum": 2445, "donAcc_type": "standard", "distance": 2.947, "atom1_id": "///C/14/O", "atom2_id": "///C/16/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 299, "atom1_serNum": 2498, "atom2_serNum": 2524, "donAcc_type": "standard", "distance": 3.525, "atom1_id": "///C/41/O", "atom2_id": "///C/45/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 300, "atom1_serNum": 2502, "atom2_serNum": 2531, "donAcc_type": "standard", "distance": 3.263, "atom1_id": "///C/42/O", "atom2_id": "///C/46/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 301, "atom1_serNum": 2520, "atom2_serNum": 2540, "donAcc_type": "standard", "distance": 3.120, "atom1_id": "///C/44/O", "atom2_id": "///C/47/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 302, "atom1_serNum": 2543, "atom2_serNum": 2579, "donAcc_type": "standard", "distance": 3.418, "atom1_id": "///C/47/O", "atom2_id": "///C/51/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 303, "atom1_serNum": 2547, "atom2_serNum": 4634, "donAcc_type": "standard", "distance": 3.117, "atom1_id": "///C/47/OE1", "atom2_id": "///C/330/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 304, "atom1_serNum": 2552, "atom2_serNum": 2588, "donAcc_type": "standard", "distance": 2.948, "atom1_id": "///C/48/O", "atom2_id": "///C/52/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 305, "atom1_serNum": 2559, "atom2_serNum": 2597, "donAcc_type": "standard", "distance": 2.917, "atom1_id": "///C/49/O", "atom2_id": "///C/53/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 306, "atom1_serNum": 2570, "atom2_serNum": 2609, "donAcc_type": "standard", "distance": 2.932, "atom1_id": "///C/50/O", "atom2_id": "///C/54/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 307, "atom1_serNum": 2578, "atom2_serNum": 2619, "donAcc_type": "acceptable", "distance": 2.560, "atom1_id": "///C/50/OH", "atom2_id": "///C/54/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 308, "atom1_serNum": 2582, "atom2_serNum": 2620, "donAcc_type": "standard", "distance": 2.942, "atom1_id": "///C/51/O", "atom2_id": "///C/55/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 309, "atom1_serNum": 2586, "atom2_serNum": 4739, "donAcc_type": "standard", "distance": 3.203, "atom1_id": "///C/51/OE1", "atom2_id": "///C/344/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 310, "atom1_serNum": 2591, "atom2_serNum": 2629, "donAcc_type": "standard", "distance": 2.966, "atom1_id": "///C/52/O", "atom2_id": "///C/56/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 311, "atom1_serNum": 2595, "atom2_serNum": 4675, "donAcc_type": "acceptable", "distance": 2.945, "atom1_id": "///C/52/OE1", "atom2_id": "///C/336/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 312, "atom1_serNum": 2596, "atom2_serNum": 4739, "donAcc_type": "standard", "distance": 2.670, "atom1_id": "///C/52/OE2", "atom2_id": "///C/344/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 313, "atom1_serNum": 2600, "atom2_serNum": 2634, "donAcc_type": "standard", "distance": 2.925, "atom1_id": "///C/53/O", "atom2_id": "///C/57/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 314, "atom1_serNum": 2612, "atom2_serNum": 2648, "donAcc_type": "standard", "distance": 2.939, "atom1_id": "///C/54/O", "atom2_id": "///C/58/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 315, "atom1_serNum": 2623, "atom2_serNum": 2656, "donAcc_type": "standard", "distance": 3.026, "atom1_id": "///C/55/O", "atom2_id": "///C/59/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 316, "atom1_serNum": 2632, "atom2_serNum": 2665, "donAcc_type": "standard", "distance": 2.986, "atom1_id": "///C/56/O", "atom2_id": "///C/60/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 317, "atom1_serNum": 2637, "atom2_serNum": 2673, "donAcc_type": "standard", "distance": 2.900, "atom1_id": "///C/57/O", "atom2_id": "///C/61/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 318, "atom1_serNum": 2651, "atom2_serNum": 2681, "donAcc_type": "standard", "distance": 2.980, "atom1_id": "///C/58/O", "atom2_id": "///C/62/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 319, "atom1_serNum": 2659, "atom2_serNum": 2689, "donAcc_type": "standard", "distance": 3.011, "atom1_id": "///C/59/O", "atom2_id": "///C/63/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 320, "atom1_serNum": 2668, "atom2_serNum": 2699, "donAcc_type": "standard", "distance": 2.987, "atom1_id": "///C/60/O", "atom2_id": "///C/64/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 321, "atom1_serNum": 2676, "atom2_serNum": 2707, "donAcc_type": "standard", "distance": 2.957, "atom1_id": "///C/61/O", "atom2_id": "///C/65/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 322, "atom1_serNum": 2684, "atom2_serNum": 2712, "donAcc_type": "standard", "distance": 2.945, "atom1_id": "///C/62/O", "atom2_id": "///C/66/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 323, "atom1_serNum": 2692, "atom2_serNum": 2720, "donAcc_type": "standard", "distance": 2.979, "atom1_id": "///C/63/O", "atom2_id": "///C/67/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 324, "atom1_serNum": 2695, "atom2_serNum": 4277, "donAcc_type": "acceptable", "distance": 2.890, "atom1_id": "///C/63/ND1", "atom2_id": "///C/288/OH", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 325, "atom1_serNum": 2702, "atom2_serNum": 2728, "donAcc_type": "standard", "distance": 2.954, "atom1_id": "///C/64/O", "atom2_id": "///C/68/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 326, "atom1_serNum": 2710, "atom2_serNum": 2737, "donAcc_type": "standard", "distance": 2.982, "atom1_id": "///C/65/O", "atom2_id": "///C/69/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 327, "atom1_serNum": 2715, "atom2_serNum": 2747, "donAcc_type": "standard", "distance": 2.965, "atom1_id": "///C/66/O", "atom2_id": "///C/70/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 328, "atom1_serNum": 2723, "atom2_serNum": 2758, "donAcc_type": "standard", "distance": 2.955, "atom1_id": "///C/67/O", "atom2_id": "///C/71/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 329, "atom1_serNum": 2723, "atom2_serNum": 2763, "donAcc_type": "acceptable", "distance": 2.913, "atom1_id": "///C/67/O", "atom2_id": "///C/71/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 330, "atom1_serNum": 2731, "atom2_serNum": 2763, "donAcc_type": "acceptable", "distance": 2.785, "atom1_id": "///C/68/O", "atom2_id": "///C/71/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 331, "atom1_serNum": 2731, "atom2_serNum": 2764, "donAcc_type": "standard", "distance": 2.987, "atom1_id": "///C/68/O", "atom2_id": "///C/72/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 332, "atom1_serNum": 2740, "atom2_serNum": 2776, "donAcc_type": "standard", "distance": 2.998, "atom1_id": "///C/69/O", "atom2_id": "///C/73/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 333, "atom1_serNum": 2767, "atom2_serNum": 2799, "donAcc_type": "standard", "distance": 2.996, "atom1_id": "///C/72/O", "atom2_id": "///C/76/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 334, "atom1_serNum": 2779, "atom2_serNum": 2807, "donAcc_type": "standard", "distance": 2.947, "atom1_id": "///C/73/O", "atom2_id": "///C/77/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 335, "atom1_serNum": 2784, "atom2_serNum": 2816, "donAcc_type": "standard", "distance": 3.012, "atom1_id": "///C/74/O", "atom2_id": "///C/78/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 336, "atom1_serNum": 2795, "atom2_serNum": 2825, "donAcc_type": "standard", "distance": 2.936, "atom1_id": "///C/75/O", "atom2_id": "///C/79/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 337, "atom1_serNum": 2802, "atom2_serNum": 2833, "donAcc_type": "standard", "distance": 2.961, "atom1_id": "///C/76/O", "atom2_id": "///C/80/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 338, "atom1_serNum": 2810, "atom2_serNum": 2840, "donAcc_type": "standard", "distance": 2.933, "atom1_id": "///C/77/O", "atom2_id": "///C/81/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 339, "atom1_serNum": 2814, "atom2_serNum": 3115, "donAcc_type": "standard", "distance": 2.592, "atom1_id": "///C/77/OE1", "atom2_id": "///C/120/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 340, "atom1_serNum": 2815, "atom2_serNum": 3115, "donAcc_type": "standard", "distance": 3.156, "atom1_id": "///C/77/OE2", "atom2_id": "///C/120/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 341, "atom1_serNum": 2815, "atom2_serNum": 3116, "donAcc_type": "standard", "distance": 2.831, "atom1_id": "///C/77/OE2", "atom2_id": "///C/120/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 342, "atom1_serNum": 2819, "atom2_serNum": 2848, "donAcc_type": "standard", "distance": 2.953, "atom1_id": "///C/78/O", "atom2_id": "///C/82/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 343, "atom1_serNum": 2828, "atom2_serNum": 2859, "donAcc_type": "standard", "distance": 2.992, "atom1_id": "///C/79/O", "atom2_id": "///C/83/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 344, "atom1_serNum": 2836, "atom2_serNum": 2866, "donAcc_type": "standard", "distance": 2.942, "atom1_id": "///C/80/O", "atom2_id": "///C/84/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 345, "atom1_serNum": 2843, "atom2_serNum": 2873, "donAcc_type": "standard", "distance": 2.884, "atom1_id": "///C/81/O", "atom2_id": "///C/85/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 346, "atom1_serNum": 2851, "atom2_serNum": 2877, "donAcc_type": "standard", "distance": 2.986, "atom1_id": "///C/82/O", "atom2_id": "///C/86/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 347, "atom1_serNum": 2862, "atom2_serNum": 2886, "donAcc_type": "standard", "distance": 2.929, "atom1_id": "///C/83/O", "atom2_id": "///C/87/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 348, "atom1_serNum": 2869, "atom2_serNum": 2891, "donAcc_type": "standard", "distance": 2.927, "atom1_id": "///C/84/O", "atom2_id": "///C/88/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 349, "atom1_serNum": 2885, "atom2_serNum": 4073, "donAcc_type": "questionable", "distance": 3.145, "atom1_id": "///C/86/NE2", "atom2_id": "///C/262/NH2", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 350, "atom1_serNum": 2927, "atom2_serNum": 4049, "donAcc_type": "standard", "distance": 3.578, "atom1_id": "///C/96/N", "atom2_id": "///C/260/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 351, "atom1_serNum": 2930, "atom2_serNum": 4063, "donAcc_type": "standard", "distance": 3.652, "atom1_id": "///C/96/O", "atom2_id": "///C/262/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 352, "atom1_serNum": 2938, "atom2_serNum": 3891, "donAcc_type": "standard", "distance": 3.163, "atom1_id": "///C/97/O", "atom2_id": "///C/238/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 353, "atom1_serNum": 2945, "atom2_serNum": 4082, "donAcc_type": "standard", "distance": 2.900, "atom1_id": "///C/98/O", "atom2_id": "///C/264/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 354, "atom1_serNum": 2947, "atom2_serNum": 3894, "donAcc_type": "acceptable", "distance": 2.499, "atom1_id": "///C/98/OG1", "atom2_id": "///C/238/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 355, "atom1_serNum": 2949, "atom2_serNum": 3894, "donAcc_type": "standard", "distance": 3.194, "atom1_id": "///C/99/N", "atom2_id": "///C/238/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 356, "atom1_serNum": 2952, "atom2_serNum": 3906, "donAcc_type": "standard", "distance": 3.079, "atom1_id": "///C/99/O", "atom2_id": "///C/240/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 357, "atom1_serNum": 2954, "atom2_serNum": 4085, "donAcc_type": "standard", "distance": 2.879, "atom1_id": "///C/100/N", "atom2_id": "///C/264/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 358, "atom1_serNum": 2957, "atom2_serNum": 4100, "donAcc_type": "standard", "distance": 2.913, "atom1_id": "///C/100/O", "atom2_id": "///C/266/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 359, "atom1_serNum": 2962, "atom2_serNum": 2975, "donAcc_type": "standard", "distance": 2.699, "atom1_id": "///C/101/O", "atom2_id": "///C/103/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 360, "atom1_serNum": 2967, "atom2_serNum": 4103, "donAcc_type": "standard", "distance": 2.848, "atom1_id": "///C/102/N", "atom2_id": "///C/266/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 361, "atom1_serNum": 2975, "atom2_serNum": 3921, "donAcc_type": "standard", "distance": 3.157, "atom1_id": "///C/103/N", "atom2_id": "///C/242/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 362, "atom1_serNum": 2978, "atom2_serNum": 3921, "donAcc_type": "questionable", "distance": 3.063, "atom1_id": "///C/103/O", "atom2_id": "///C/242/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 363, "atom1_serNum": 2989, "atom2_serNum": 3002, "donAcc_type": "standard", "distance": 2.732, "atom1_id": "///C/105/O", "atom2_id": "///C/107/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 364, "atom1_serNum": 2994, "atom2_serNum": 3000, "donAcc_type": "standard", "distance": 2.581, "atom1_id": "///C/106/N", "atom2_id": "///C/106/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 365, "atom1_serNum": 3000, "atom2_serNum": 3035, "donAcc_type": "standard", "distance": 3.142, "atom1_id": "///C/106/OD1", "atom2_id": "///C/110/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 366, "atom1_serNum": 3001, "atom2_serNum": 3025, "donAcc_type": "standard", "distance": 3.297, "atom1_id": "///C/106/ND2", "atom2_id": "///C/109/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 367, "atom1_serNum": 3001, "atom2_serNum": 4456, "donAcc_type": "standard", "distance": 2.758, "atom1_id": "///C/106/ND2", "atom2_id": "///C/309/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 368, "atom1_serNum": 3005, "atom2_serNum": 3010, "donAcc_type": "standard", "distance": 3.169, "atom1_id": "///C/107/O", "atom2_id": "///C/107/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 369, "atom1_serNum": 3005, "atom2_serNum": 3026, "donAcc_type": "standard", "distance": 3.326, "atom1_id": "///C/107/O", "atom2_id": "///C/110/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 370, "atom1_serNum": 3014, "atom2_serNum": 3036, "donAcc_type": "standard", "distance": 3.572, "atom1_id": "///C/108/O", "atom2_id": "///C/111/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 371, "atom1_serNum": 3024, "atom2_serNum": 4478, "donAcc_type": "standard", "distance": 3.649, "atom1_id": "///C/109/OD1", "atom2_id": "///C/312/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 372, "atom1_serNum": 3025, "atom2_serNum": 4470, "donAcc_type": "standard", "distance": 3.150, "atom1_id": "///C/109/OD2", "atom2_id": "///C/311/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 373, "atom1_serNum": 3029, "atom2_serNum": 3059, "donAcc_type": "standard", "distance": 3.006, "atom1_id": "///C/110/O", "atom2_id": "///C/114/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 374, "atom1_serNum": 3039, "atom2_serNum": 3070, "donAcc_type": "standard", "distance": 2.882, "atom1_id": "///C/111/O", "atom2_id": "///C/115/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 375, "atom1_serNum": 3039, "atom2_serNum": 3075, "donAcc_type": "acceptable", "distance": 2.465, "atom1_id": "///C/111/O", "atom2_id": "///C/115/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 376, "atom1_serNum": 3047, "atom2_serNum": 3077, "donAcc_type": "standard", "distance": 2.929, "atom1_id": "///C/112/O", "atom2_id": "///C/116/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 377, "atom1_serNum": 3053, "atom2_serNum": 3082, "donAcc_type": "standard", "distance": 2.983, "atom1_id": "///C/113/O", "atom2_id": "///C/117/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 378, "atom1_serNum": 3062, "atom2_serNum": 3090, "donAcc_type": "standard", "distance": 2.967, "atom1_id": "///C/114/O", "atom2_id": "///C/118/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 379, "atom1_serNum": 3073, "atom2_serNum": 3095, "donAcc_type": "acceptable", "distance": 2.696, "atom1_id": "///C/115/O", "atom2_id": "///C/118/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 380, "atom1_serNum": 3073, "atom2_serNum": 3097, "donAcc_type": "standard", "distance": 2.924, "atom1_id": "///C/115/O", "atom2_id": "///C/119/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 381, "atom1_serNum": 3080, "atom2_serNum": 3106, "donAcc_type": "standard", "distance": 2.970, "atom1_id": "///C/116/O", "atom2_id": "///C/120/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 382, "atom1_serNum": 3085, "atom2_serNum": 3117, "donAcc_type": "standard", "distance": 2.967, "atom1_id": "///C/117/O", "atom2_id": "///C/121/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 383, "atom1_serNum": 3093, "atom2_serNum": 3125, "donAcc_type": "standard", "distance": 2.928, "atom1_id": "///C/118/O", "atom2_id": "///C/122/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 384, "atom1_serNum": 3100, "atom2_serNum": 3135, "donAcc_type": "standard", "distance": 2.917, "atom1_id": "///C/119/O", "atom2_id": "///C/123/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 385, "atom1_serNum": 3109, "atom2_serNum": 3140, "donAcc_type": "standard", "distance": 2.980, "atom1_id": "///C/120/O", "atom2_id": "///C/124/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 386, "atom1_serNum": 3120, "atom2_serNum": 3160, "donAcc_type": "standard", "distance": 3.243, "atom1_id": "///C/121/O", "atom2_id": "///C/126/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 387, "atom1_serNum": 3134, "atom2_serNum": 3369, "donAcc_type": "standard", "distance": 2.863, "atom1_id": "///C/122/NE2", "atom2_id": "///C/154/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 388, "atom1_serNum": 3163, "atom2_serNum": 3631, "donAcc_type": "standard", "distance": 3.185, "atom1_id": "///C/126/O", "atom2_id": "///C/204/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 389, "atom1_serNum": 3170, "atom2_serNum": 3634, "donAcc_type": "standard", "distance": 2.886, "atom1_id": "///C/128/N", "atom2_id": "///C/204/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 390, "atom1_serNum": 3173, "atom2_serNum": 3648, "donAcc_type": "standard", "distance": 2.946, "atom1_id": "///C/128/O", "atom2_id": "///C/206/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 391, "atom1_serNum": 3185, "atom2_serNum": 3651, "donAcc_type": "standard", "distance": 2.905, "atom1_id": "///C/130/N", "atom2_id": "///C/206/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 392, "atom1_serNum": 3188, "atom2_serNum": 3662, "donAcc_type": "standard", "distance": 2.868, "atom1_id": "///C/130/O", "atom2_id": "///C/208/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 393, "atom1_serNum": 3198, "atom2_serNum": 3665, "donAcc_type": "standard", "distance": 2.813, "atom1_id": "///C/132/N", "atom2_id": "///C/208/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 394, "atom1_serNum": 3209, "atom2_serNum": 3232, "donAcc_type": "standard", "distance": 3.258, "atom1_id": "///C/133/O", "atom2_id": "///C/136/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 395, "atom1_serNum": 3215, "atom2_serNum": 3692, "donAcc_type": "standard", "distance": 3.278, "atom1_id": "///C/134/N", "atom2_id": "///C/211/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 396, "atom1_serNum": 3254, "atom2_serNum": 3280, "donAcc_type": "standard", "distance": 2.928, "atom1_id": "///C/139/O", "atom2_id": "///C/143/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 397, "atom1_serNum": 3261, "atom2_serNum": 3285, "donAcc_type": "standard", "distance": 2.978, "atom1_id": "///C/140/O", "atom2_id": "///C/144/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 398, "atom1_serNum": 3269, "atom2_serNum": 3292, "donAcc_type": "standard", "distance": 2.933, "atom1_id": "///C/141/O", "atom2_id": "///C/145/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 399, "atom1_serNum": 3278, "atom2_serNum": 3301, "donAcc_type": "standard", "distance": 2.933, "atom1_id": "///C/142/O", "atom2_id": "///C/146/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 400, "atom1_serNum": 3278, "atom2_serNum": 3306, "donAcc_type": "acceptable", "distance": 3.073, "atom1_id": "///C/142/O", "atom2_id": "///C/146/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 401, "atom1_serNum": 3283, "atom2_serNum": 3306, "donAcc_type": "acceptable", "distance": 3.181, "atom1_id": "///C/143/O", "atom2_id": "///C/146/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 402, "atom1_serNum": 3283, "atom2_serNum": 3308, "donAcc_type": "standard", "distance": 2.929, "atom1_id": "///C/143/O", "atom2_id": "///C/147/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 403, "atom1_serNum": 3288, "atom2_serNum": 3316, "donAcc_type": "standard", "distance": 2.975, "atom1_id": "///C/144/O", "atom2_id": "///C/148/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 404, "atom1_serNum": 3295, "atom2_serNum": 3323, "donAcc_type": "standard", "distance": 2.914, "atom1_id": "///C/145/O", "atom2_id": "///C/149/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 405, "atom1_serNum": 3304, "atom2_serNum": 3334, "donAcc_type": "standard", "distance": 2.872, "atom1_id": "///C/146/O", "atom2_id": "///C/150/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 406, "atom1_serNum": 3311, "atom2_serNum": 3338, "donAcc_type": "standard", "distance": 3.016, "atom1_id": "///C/147/O", "atom2_id": "///C/151/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 407, "atom1_serNum": 3319, "atom2_serNum": 3346, "donAcc_type": "standard", "distance": 2.984, "atom1_id": "///C/148/O", "atom2_id": "///C/152/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 408, "atom1_serNum": 3326, "atom2_serNum": 3353, "donAcc_type": "standard", "distance": 2.939, "atom1_id": "///C/149/O", "atom2_id": "///C/153/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 409, "atom1_serNum": 3337, "atom2_serNum": 3362, "donAcc_type": "standard", "distance": 2.872, "atom1_id": "///C/150/O", "atom2_id": "///C/154/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 410, "atom1_serNum": 3341, "atom2_serNum": 3370, "donAcc_type": "standard", "distance": 3.028, "atom1_id": "///C/151/O", "atom2_id": "///C/155/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 411, "atom1_serNum": 3349, "atom2_serNum": 3378, "donAcc_type": "standard", "distance": 2.925, "atom1_id": "///C/152/O", "atom2_id": "///C/156/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 412, "atom1_serNum": 3356, "atom2_serNum": 3383, "donAcc_type": "standard", "distance": 2.888, "atom1_id": "///C/153/O", "atom2_id": "///C/157/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 413, "atom1_serNum": 3365, "atom2_serNum": 3392, "donAcc_type": "standard", "distance": 2.954, "atom1_id": "///C/154/O", "atom2_id": "///C/158/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 414, "atom1_serNum": 3373, "atom2_serNum": 3399, "donAcc_type": "standard", "distance": 3.495, "atom1_id": "///C/155/O", "atom2_id": "///C/159/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 415, "atom1_serNum": 3436, "atom2_serNum": 3462, "donAcc_type": "standard", "distance": 2.853, "atom1_id": "///C/179/NH1", "atom2_id": "///C/182/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 416, "atom1_serNum": 3437, "atom2_serNum": 21415, "donAcc_type": "standard", "distance": 2.976, "atom1_id": "///C/179/NH2", "atom2_id": "///I/60/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 417, "atom1_serNum": 3452, "atom2_serNum": 3454, "donAcc_type": "acceptable", "distance": 2.884, "atom1_id": "///C/181/O", "atom2_id": "///C/181/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 418, "atom1_serNum": 3454, "atom2_serNum": 21415, "donAcc_type": "acceptable", "distance": 3.662, "atom1_id": "///C/181/OG", "atom2_id": "///I/60/OP1", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 419, "atom1_serNum": 3458, "atom2_serNum": 3470, "donAcc_type": "standard", "distance": 2.993, "atom1_id": "///C/182/O", "atom2_id": "///C/184/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 420, "atom1_serNum": 3473, "atom2_serNum": 3503, "donAcc_type": "standard", "distance": 3.126, "atom1_id": "///C/184/O", "atom2_id": "///C/188/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 421, "atom1_serNum": 3480, "atom2_serNum": 3511, "donAcc_type": "standard", "distance": 2.963, "atom1_id": "///C/185/O", "atom2_id": "///C/189/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 422, "atom1_serNum": 3488, "atom2_serNum": 3520, "donAcc_type": "standard", "distance": 2.941, "atom1_id": "///C/186/O", "atom2_id": "///C/190/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 423, "atom1_serNum": 3488, "atom2_serNum": 3525, "donAcc_type": "acceptable", "distance": 2.789, "atom1_id": "///C/186/O", "atom2_id": "///C/190/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 424, "atom1_serNum": 3497, "atom2_serNum": 3526, "donAcc_type": "standard", "distance": 2.883, "atom1_id": "///C/187/O", "atom2_id": "///C/191/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 425, "atom1_serNum": 3506, "atom2_serNum": 3540, "donAcc_type": "standard", "distance": 2.939, "atom1_id": "///C/188/O", "atom2_id": "///C/192/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 426, "atom1_serNum": 3514, "atom2_serNum": 3552, "donAcc_type": "standard", "distance": 2.952, "atom1_id": "///C/189/O", "atom2_id": "///C/193/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 427, "atom1_serNum": 3514, "atom2_serNum": 3557, "donAcc_type": "acceptable", "distance": 2.932, "atom1_id": "///C/189/O", "atom2_id": "///C/193/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 428, "atom1_serNum": 3523, "atom2_serNum": 3559, "donAcc_type": "standard", "distance": 2.916, "atom1_id": "///C/190/O", "atom2_id": "///C/194/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 429, "atom1_serNum": 3529, "atom2_serNum": 3567, "donAcc_type": "standard", "distance": 2.968, "atom1_id": "///C/191/O", "atom2_id": "///C/195/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 430, "atom1_serNum": 3529, "atom2_serNum": 3573, "donAcc_type": "questionable", "distance": 2.906, "atom1_id": "///C/191/O", "atom2_id": "///C/195/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 431, "atom1_serNum": 3543, "atom2_serNum": 3575, "donAcc_type": "standard", "distance": 2.951, "atom1_id": "///C/192/O", "atom2_id": "///C/196/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 432, "atom1_serNum": 3543, "atom2_serNum": 3586, "donAcc_type": "standard", "distance": 3.257, "atom1_id": "///C/192/O", "atom2_id": "///C/197/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 433, "atom1_serNum": 3551, "atom2_serNum": 3623, "donAcc_type": "acceptable", "distance": 3.285, "atom1_id": "///C/192/OH", "atom2_id": "///C/203/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 434, "atom1_serNum": 3557, "atom2_serNum": 3593, "donAcc_type": "acceptable", "distance": 3.822, "atom1_id": "///C/193/OG1", "atom2_id": "///C/197/OD2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 435, "atom1_serNum": 3640, "atom2_serNum": 3869, "donAcc_type": "standard", "distance": 2.899, "atom1_id": "///C/205/N", "atom2_id": "///C/235/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 436, "atom1_serNum": 3643, "atom2_serNum": 3884, "donAcc_type": "standard", "distance": 3.451, "atom1_id": "///C/205/O", "atom2_id": "///C/237/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 437, "atom1_serNum": 3655, "atom2_serNum": 3887, "donAcc_type": "standard", "distance": 2.912, "atom1_id": "///C/207/N", "atom2_id": "///C/237/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 438, "atom1_serNum": 3658, "atom2_serNum": 3902, "donAcc_type": "questionable", "distance": 3.318, "atom1_id": "///C/207/O", "atom2_id": "///C/239/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 439, "atom1_serNum": 3670, "atom2_serNum": 3902, "donAcc_type": "standard", "distance": 3.299, "atom1_id": "///C/209/N", "atom2_id": "///C/239/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 440, "atom1_serNum": 3673, "atom2_serNum": 3914, "donAcc_type": "standard", "distance": 3.075, "atom1_id": "///C/209/O", "atom2_id": "///C/241/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 441, "atom1_serNum": 3681, "atom2_serNum": 3917, "donAcc_type": "questionable", "distance": 2.973, "atom1_id": "///C/210/O", "atom2_id": "///C/241/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 442, "atom1_serNum": 3685, "atom2_serNum": 3691, "donAcc_type": "standard", "distance": 2.640, "atom1_id": "///C/211/N", "atom2_id": "///C/211/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 443, "atom1_serNum": 3688, "atom2_serNum": 3713, "donAcc_type": "standard", "distance": 3.263, "atom1_id": "///C/211/O", "atom2_id": "///C/214/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 444, "atom1_serNum": 3693, "atom2_serNum": 3917, "donAcc_type": "standard", "distance": 3.492, "atom1_id": "///C/212/N", "atom2_id": "///C/241/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 445, "atom1_serNum": 3707, "atom2_serNum": 13625, "donAcc_type": "questionable", "distance": 2.883, "atom1_id": "///C/213/O", "atom2_id": "///E/414/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 446, "atom1_serNum": 3733, "atom2_serNum": 3756, "donAcc_type": "standard", "distance": 3.202, "atom1_id": "///C/216/O", "atom2_id": "///C/220/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 447, "atom1_serNum": 3736, "atom2_serNum": 3738, "donAcc_type": "standard", "distance": 2.926, "atom1_id": "///C/216/OD1", "atom2_id": "///C/217/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 448, "atom1_serNum": 3741, "atom2_serNum": 3764, "donAcc_type": "standard", "distance": 2.942, "atom1_id": "///C/217/O", "atom2_id": "///C/221/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 449, "atom1_serNum": 3746, "atom2_serNum": 3773, "donAcc_type": "standard", "distance": 2.943, "atom1_id": "///C/218/O", "atom2_id": "///C/222/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 450, "atom1_serNum": 3752, "atom2_serNum": 3781, "donAcc_type": "standard", "distance": 2.907, "atom1_id": "///C/219/O", "atom2_id": "///C/223/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 451, "atom1_serNum": 3759, "atom2_serNum": 3789, "donAcc_type": "standard", "distance": 2.929, "atom1_id": "///C/220/O", "atom2_id": "///C/224/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 452, "atom1_serNum": 3767, "atom2_serNum": 3797, "donAcc_type": "standard", "distance": 2.979, "atom1_id": "///C/221/O", "atom2_id": "///C/225/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 453, "atom1_serNum": 3772, "atom2_serNum": 3986, "donAcc_type": "standard", "distance": 2.927, "atom1_id": "///C/221/NE2", "atom2_id": "///C/252/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 454, "atom1_serNum": 3776, "atom2_serNum": 3805, "donAcc_type": "standard", "distance": 2.919, "atom1_id": "///C/222/O", "atom2_id": "///C/226/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 455, "atom1_serNum": 3779, "atom2_serNum": 11794, "donAcc_type": "standard", "distance": 2.645, "atom1_id": "///C/222/OD1", "atom2_id": "///E/130/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 456, "atom1_serNum": 3780, "atom2_serNum": 11793, "donAcc_type": "standard", "distance": 2.653, "atom1_id": "///C/222/OD2", "atom2_id": "///E/130/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 457, "atom1_serNum": 3784, "atom2_serNum": 3813, "donAcc_type": "standard", "distance": 2.922, "atom1_id": "///C/223/O", "atom2_id": "///C/227/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 458, "atom1_serNum": 3792, "atom2_serNum": 3821, "donAcc_type": "standard", "distance": 2.884, "atom1_id": "///C/224/O", "atom2_id": "///C/228/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 459, "atom1_serNum": 3800, "atom2_serNum": 3827, "donAcc_type": "standard", "distance": 2.967, "atom1_id": "///C/225/O", "atom2_id": "///C/229/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 460, "atom1_serNum": 3808, "atom2_serNum": 3832, "donAcc_type": "standard", "distance": 3.424, "atom1_id": "///C/226/O", "atom2_id": "///C/230/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 461, "atom1_serNum": 3824, "atom2_serNum": 3826, "donAcc_type": "acceptable", "distance": 2.898, "atom1_id": "///C/228/O", "atom2_id": "///C/228/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 462, "atom1_serNum": 3830, "atom2_serNum": 11177, "donAcc_type": "standard", "distance": 3.178, "atom1_id": "///C/229/O", "atom2_id": "///E/52/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 463, "atom1_serNum": 3835, "atom2_serNum": 3858, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///C/230/O", "atom2_id": "///C/234/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 464, "atom1_serNum": 3841, "atom2_serNum": 11344, "donAcc_type": "standard", "distance": 2.681, "atom1_id": "///C/230/NE2", "atom2_id": "///E/73/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 465, "atom1_serNum": 3861, "atom2_serNum": 3873, "donAcc_type": "standard", "distance": 3.102, "atom1_id": "///C/234/O", "atom2_id": "///C/236/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 466, "atom1_serNum": 3940, "atom2_serNum": 3957, "donAcc_type": "standard", "distance": 3.200, "atom1_id": "///C/245/O", "atom2_id": "///C/248/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 467, "atom1_serNum": 3945, "atom2_serNum": 3969, "donAcc_type": "standard", "distance": 2.959, "atom1_id": "///C/246/O", "atom2_id": "///C/250/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 468, "atom1_serNum": 3953, "atom2_serNum": 3979, "donAcc_type": "standard", "distance": 2.869, "atom1_id": "///C/247/O", "atom2_id": "///C/251/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 469, "atom1_serNum": 3960, "atom2_serNum": 3983, "donAcc_type": "standard", "distance": 2.957, "atom1_id": "///C/248/O", "atom2_id": "///C/252/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 470, "atom1_serNum": 3965, "atom2_serNum": 3990, "donAcc_type": "standard", "distance": 3.266, "atom1_id": "///C/249/O", "atom2_id": "///C/253/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 471, "atom1_serNum": 3972, "atom2_serNum": 10358, "donAcc_type": "standard", "distance": 3.776, "atom1_id": "///C/250/O", "atom2_id": "///D/395/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 472, "atom1_serNum": 3993, "atom2_serNum": 10358, "donAcc_type": "standard", "distance": 3.174, "atom1_id": "///C/253/O", "atom2_id": "///D/395/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 473, "atom1_serNum": 4001, "atom2_serNum": 4034, "donAcc_type": "standard", "distance": 2.874, "atom1_id": "///C/254/O", "atom2_id": "///C/258/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 474, "atom1_serNum": 4001, "atom2_serNum": 4039, "donAcc_type": "acceptable", "distance": 3.078, "atom1_id": "///C/254/O", "atom2_id": "///C/258/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 475, "atom1_serNum": 4008, "atom2_serNum": 4040, "donAcc_type": "standard", "distance": 3.086, "atom1_id": "///C/255/O", "atom2_id": "///C/259/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 476, "atom1_serNum": 4008, "atom2_serNum": 4045, "donAcc_type": "acceptable", "distance": 2.414, "atom1_id": "///C/255/O", "atom2_id": "///C/259/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 477, "atom1_serNum": 4016, "atom2_serNum": 12695, "donAcc_type": "acceptable", "distance": 2.482, "atom1_id": "///C/255/OH", "atom2_id": "///E/243/OD2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 478, "atom1_serNum": 4020, "atom2_serNum": 4054, "donAcc_type": "standard", "distance": 3.526, "atom1_id": "///C/256/O", "atom2_id": "///C/260/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 479, "atom1_serNum": 4030, "atom2_serNum": 4046, "donAcc_type": "standard", "distance": 3.227, "atom1_id": "///C/257/O", "atom2_id": "///C/260/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 480, "atom1_serNum": 4039, "atom2_serNum": 10358, "donAcc_type": "acceptable", "distance": 3.319, "atom1_id": "///C/258/OG", "atom2_id": "///D/395/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 481, "atom1_serNum": 4054, "atom2_serNum": 21633, "donAcc_type": "acceptable", "distance": 3.165, "atom1_id": "///C/260/NZ", "atom2_id": "///E/901/O2G", "atom_pair": "N:O", "residue_pair": "aa:ligand" }, { "index": 482, "atom1_serNum": 4072, "atom2_serNum": 13058, "donAcc_type": "standard", "distance": 3.025, "atom1_id": "///C/262/NH1", "atom2_id": "///E/295/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 483, "atom1_serNum": 4072, "atom2_serNum": 13059, "donAcc_type": "standard", "distance": 3.087, "atom1_id": "///C/262/NH1", "atom2_id": "///E/295/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 484, "atom1_serNum": 4077, "atom2_serNum": 13051, "donAcc_type": "standard", "distance": 3.213, "atom1_id": "///C/263/O", "atom2_id": "///E/295/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 485, "atom1_serNum": 4092, "atom2_serNum": 13058, "donAcc_type": "standard", "distance": 3.758, "atom1_id": "///C/264/NH2", "atom2_id": "///E/295/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 486, "atom1_serNum": 4135, "atom2_serNum": 4187, "donAcc_type": "standard", "distance": 3.735, "atom1_id": "///C/269/NE2", "atom2_id": "///C/277/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 487, "atom1_serNum": 4139, "atom2_serNum": 4160, "donAcc_type": "standard", "distance": 3.155, "atom1_id": "///C/270/O", "atom2_id": "///C/274/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 488, "atom1_serNum": 4144, "atom2_serNum": 4164, "donAcc_type": "standard", "distance": 2.915, "atom1_id": "///C/271/O", "atom2_id": "///C/275/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 489, "atom1_serNum": 4149, "atom2_serNum": 4172, "donAcc_type": "standard", "distance": 2.910, "atom1_id": "///C/272/O", "atom2_id": "///C/276/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 490, "atom1_serNum": 4156, "atom2_serNum": 4180, "donAcc_type": "standard", "distance": 2.969, "atom1_id": "///C/273/O", "atom2_id": "///C/277/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 491, "atom1_serNum": 4163, "atom2_serNum": 4189, "donAcc_type": "standard", "distance": 2.976, "atom1_id": "///C/274/O", "atom2_id": "///C/278/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 492, "atom1_serNum": 4167, "atom2_serNum": 4196, "donAcc_type": "standard", "distance": 2.868, "atom1_id": "///C/275/O", "atom2_id": "///C/279/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 493, "atom1_serNum": 4175, "atom2_serNum": 4204, "donAcc_type": "standard", "distance": 2.954, "atom1_id": "///C/276/O", "atom2_id": "///C/280/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 494, "atom1_serNum": 4178, "atom2_serNum": 5414, "donAcc_type": "standard", "distance": 2.762, "atom1_id": "///C/276/OD1", "atom2_id": "///C/427/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 495, "atom1_serNum": 4178, "atom2_serNum": 5417, "donAcc_type": "standard", "distance": 3.152, "atom1_id": "///C/276/OD1", "atom2_id": "///C/427/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 496, "atom1_serNum": 4183, "atom2_serNum": 4212, "donAcc_type": "standard", "distance": 2.952, "atom1_id": "///C/277/O", "atom2_id": "///C/281/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 497, "atom1_serNum": 4192, "atom2_serNum": 4221, "donAcc_type": "standard", "distance": 2.905, "atom1_id": "///C/278/O", "atom2_id": "///C/282/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 498, "atom1_serNum": 4192, "atom2_serNum": 4228, "donAcc_type": "standard", "distance": 3.513, "atom1_id": "///C/278/O", "atom2_id": "///C/283/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 499, "atom1_serNum": 4204, "atom2_serNum": 4210, "donAcc_type": "standard", "distance": 2.759, "atom1_id": "///C/280/N", "atom2_id": "///C/280/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 500, "atom1_serNum": 4207, "atom2_serNum": 5236, "donAcc_type": "standard", "distance": 3.898, "atom1_id": "///C/280/O", "atom2_id": "///C/404/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 501, "atom1_serNum": 4224, "atom2_serNum": 4244, "donAcc_type": "standard", "distance": 3.279, "atom1_id": "///C/282/O", "atom2_id": "///C/285/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 502, "atom1_serNum": 4239, "atom2_serNum": 5233, "donAcc_type": "standard", "distance": 2.688, "atom1_id": "///C/284/O", "atom2_id": "///C/404/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 503, "atom1_serNum": 4294, "atom2_serNum": 6319, "donAcc_type": "standard", "distance": 3.060, "atom1_id": "///C/291/N", "atom2_id": "///C/594/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 504, "atom1_serNum": 4297, "atom2_serNum": 6334, "donAcc_type": "standard", "distance": 3.169, "atom1_id": "///C/291/O", "atom2_id": "///C/596/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 505, "atom1_serNum": 4307, "atom2_serNum": 5446, "donAcc_type": "acceptable", "distance": 3.535, "atom1_id": "///C/292/O", "atom2_id": "///C/430/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 506, "atom1_serNum": 4312, "atom2_serNum": 6337, "donAcc_type": "standard", "distance": 3.236, "atom1_id": "///C/293/N", "atom2_id": "///C/596/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 507, "atom1_serNum": 4315, "atom2_serNum": 4338, "donAcc_type": "standard", "distance": 2.972, "atom1_id": "///C/293/O", "atom2_id": "///C/297/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 508, "atom1_serNum": 4321, "atom2_serNum": 4349, "donAcc_type": "standard", "distance": 2.963, "atom1_id": "///C/294/O", "atom2_id": "///C/298/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 509, "atom1_serNum": 4325, "atom2_serNum": 4358, "donAcc_type": "standard", "distance": 2.900, "atom1_id": "///C/295/O", "atom2_id": "///C/299/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 510, "atom1_serNum": 4334, "atom2_serNum": 4369, "donAcc_type": "standard", "distance": 2.970, "atom1_id": "///C/296/O", "atom2_id": "///C/300/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 511, "atom1_serNum": 4336, "atom2_serNum": 6337, "donAcc_type": "acceptable", "distance": 3.324, "atom1_id": "///C/296/OG1", "atom2_id": "///C/596/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 512, "atom1_serNum": 4341, "atom2_serNum": 4377, "donAcc_type": "standard", "distance": 3.040, "atom1_id": "///C/297/O", "atom2_id": "///C/301/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 513, "atom1_serNum": 4352, "atom2_serNum": 4382, "donAcc_type": "acceptable", "distance": 3.120, "atom1_id": "///C/298/O", "atom2_id": "///C/301/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 514, "atom1_serNum": 4352, "atom2_serNum": 4384, "donAcc_type": "standard", "distance": 2.841, "atom1_id": "///C/298/O", "atom2_id": "///C/302/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 515, "atom1_serNum": 4361, "atom2_serNum": 4394, "donAcc_type": "standard", "distance": 2.987, "atom1_id": "///C/299/O", "atom2_id": "///C/303/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 516, "atom1_serNum": 4372, "atom2_serNum": 4402, "donAcc_type": "standard", "distance": 3.042, "atom1_id": "///C/300/O", "atom2_id": "///C/304/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 517, "atom1_serNum": 4380, "atom2_serNum": 4413, "donAcc_type": "standard", "distance": 2.870, "atom1_id": "///C/301/O", "atom2_id": "///C/305/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 518, "atom1_serNum": 4387, "atom2_serNum": 4421, "donAcc_type": "standard", "distance": 2.932, "atom1_id": "///C/302/O", "atom2_id": "///C/306/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 519, "atom1_serNum": 4397, "atom2_serNum": 4445, "donAcc_type": "standard", "distance": 3.295, "atom1_id": "///C/303/O", "atom2_id": "///C/308/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 520, "atom1_serNum": 4405, "atom2_serNum": 4448, "donAcc_type": "questionable", "distance": 2.824, "atom1_id": "///C/304/O", "atom2_id": "///C/308/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 521, "atom1_serNum": 4416, "atom2_serNum": 13098, "donAcc_type": "standard", "distance": 3.438, "atom1_id": "///C/305/O", "atom2_id": "///E/323/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 522, "atom1_serNum": 4424, "atom2_serNum": 13110, "donAcc_type": "standard", "distance": 3.529, "atom1_id": "///C/306/O", "atom2_id": "///E/324/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 523, "atom1_serNum": 4451, "atom2_serNum": 4469, "donAcc_type": "acceptable", "distance": 2.854, "atom1_id": "///C/308/OD1", "atom2_id": "///C/310/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 524, "atom1_serNum": 4452, "atom2_serNum": 13533, "donAcc_type": "standard", "distance": 3.150, "atom1_id": "///C/308/OD2", "atom2_id": "///E/402/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 525, "atom1_serNum": 4467, "atom2_serNum": 4492, "donAcc_type": "standard", "distance": 3.690, "atom1_id": "///C/310/O", "atom2_id": "///C/314/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 526, "atom1_serNum": 4473, "atom2_serNum": 4503, "donAcc_type": "standard", "distance": 2.912, "atom1_id": "///C/311/O", "atom2_id": "///C/315/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 527, "atom1_serNum": 4481, "atom2_serNum": 4511, "donAcc_type": "standard", "distance": 2.932, "atom1_id": "///C/312/O", "atom2_id": "///C/316/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 528, "atom1_serNum": 4491, "atom2_serNum": 4520, "donAcc_type": "standard", "distance": 2.932, "atom1_id": "///C/313/O", "atom2_id": "///C/317/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 529, "atom1_serNum": 4495, "atom2_serNum": 4524, "donAcc_type": "standard", "distance": 2.927, "atom1_id": "///C/314/O", "atom2_id": "///C/318/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 530, "atom1_serNum": 4506, "atom2_serNum": 4535, "donAcc_type": "standard", "distance": 2.861, "atom1_id": "///C/315/O", "atom2_id": "///C/319/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 531, "atom1_serNum": 4514, "atom2_serNum": 4544, "donAcc_type": "standard", "distance": 2.935, "atom1_id": "///C/316/O", "atom2_id": "///C/320/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 532, "atom1_serNum": 4523, "atom2_serNum": 4556, "donAcc_type": "standard", "distance": 2.969, "atom1_id": "///C/317/O", "atom2_id": "///C/321/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 533, "atom1_serNum": 4527, "atom2_serNum": 4562, "donAcc_type": "standard", "distance": 2.900, "atom1_id": "///C/318/O", "atom2_id": "///C/322/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 534, "atom1_serNum": 4538, "atom2_serNum": 4570, "donAcc_type": "standard", "distance": 2.903, "atom1_id": "///C/319/O", "atom2_id": "///C/323/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 535, "atom1_serNum": 4547, "atom2_serNum": 4578, "donAcc_type": "standard", "distance": 2.911, "atom1_id": "///C/320/O", "atom2_id": "///C/324/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 536, "atom1_serNum": 4555, "atom2_serNum": 6415, "donAcc_type": "acceptable", "distance": 2.582, "atom1_id": "///C/320/OH", "atom2_id": "///C/605/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 537, "atom1_serNum": 4559, "atom2_serNum": 4587, "donAcc_type": "standard", "distance": 2.947, "atom1_id": "///C/321/O", "atom2_id": "///C/325/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 538, "atom1_serNum": 4565, "atom2_serNum": 4597, "donAcc_type": "standard", "distance": 2.931, "atom1_id": "///C/322/O", "atom2_id": "///C/326/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 539, "atom1_serNum": 4573, "atom2_serNum": 4608, "donAcc_type": "standard", "distance": 2.968, "atom1_id": "///C/323/O", "atom2_id": "///C/327/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 540, "atom1_serNum": 4590, "atom2_serNum": 4619, "donAcc_type": "standard", "distance": 3.568, "atom1_id": "///C/325/O", "atom2_id": "///C/328/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 541, "atom1_serNum": 4596, "atom2_serNum": 6311, "donAcc_type": "standard", "distance": 2.925, "atom1_id": "///C/325/NE2", "atom2_id": "///C/593/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 542, "atom1_serNum": 4626, "atom2_serNum": 4640, "donAcc_type": "standard", "distance": 3.091, "atom1_id": "///C/329/O", "atom2_id": "///C/332/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 543, "atom1_serNum": 4626, "atom2_serNum": 4651, "donAcc_type": "standard", "distance": 3.372, "atom1_id": "///C/329/O", "atom2_id": "///C/333/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 544, "atom1_serNum": 4630, "atom2_serNum": 4651, "donAcc_type": "standard", "distance": 2.861, "atom1_id": "///C/330/O", "atom2_id": "///C/333/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 545, "atom1_serNum": 4630, "atom2_serNum": 4656, "donAcc_type": "standard", "distance": 3.095, "atom1_id": "///C/330/O", "atom2_id": "///C/334/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 546, "atom1_serNum": 4659, "atom2_serNum": 4670, "donAcc_type": "standard", "distance": 2.840, "atom1_id": "///C/334/O", "atom2_id": "///C/336/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 547, "atom1_serNum": 4680, "atom2_serNum": 4712, "donAcc_type": "standard", "distance": 2.858, "atom1_id": "///C/337/O", "atom2_id": "///C/341/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 548, "atom1_serNum": 4683, "atom2_serNum": 4702, "donAcc_type": "acceptable", "distance": 3.928, "atom1_id": "///C/337/OD1", "atom2_id": "///C/339/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 549, "atom1_serNum": 4688, "atom2_serNum": 4717, "donAcc_type": "standard", "distance": 2.952, "atom1_id": "///C/338/O", "atom2_id": "///C/342/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 550, "atom1_serNum": 4697, "atom2_serNum": 5866, "donAcc_type": "standard", "distance": 3.981, "atom1_id": "///C/339/N", "atom2_id": "///C/482/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 551, "atom1_serNum": 4700, "atom2_serNum": 4725, "donAcc_type": "standard", "distance": 3.038, "atom1_id": "///C/339/O", "atom2_id": "///C/343/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 552, "atom1_serNum": 4706, "atom2_serNum": 4729, "donAcc_type": "standard", "distance": 2.874, "atom1_id": "///C/340/O", "atom2_id": "///C/344/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 553, "atom1_serNum": 4715, "atom2_serNum": 4740, "donAcc_type": "standard", "distance": 2.926, "atom1_id": "///C/341/O", "atom2_id": "///C/345/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 554, "atom1_serNum": 4720, "atom2_serNum": 4748, "donAcc_type": "standard", "distance": 3.049, "atom1_id": "///C/342/O", "atom2_id": "///C/346/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 555, "atom1_serNum": 4728, "atom2_serNum": 4757, "donAcc_type": "standard", "distance": 2.977, "atom1_id": "///C/343/O", "atom2_id": "///C/347/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 556, "atom1_serNum": 4732, "atom2_serNum": 4766, "donAcc_type": "standard", "distance": 3.335, "atom1_id": "///C/344/O", "atom2_id": "///C/348/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 557, "atom1_serNum": 4769, "atom2_serNum": 5078, "donAcc_type": "standard", "distance": 3.219, "atom1_id": "///C/348/O", "atom2_id": "///C/386/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 558, "atom1_serNum": 4774, "atom2_serNum": 4807, "donAcc_type": "standard", "distance": 2.735, "atom1_id": "///C/349/N", "atom2_id": "///C/352/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 559, "atom1_serNum": 4779, "atom2_serNum": 4807, "donAcc_type": "acceptable", "distance": 2.493, "atom1_id": "///C/349/OG1", "atom2_id": "///C/352/OD2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 560, "atom1_serNum": 4784, "atom2_serNum": 4816, "donAcc_type": "standard", "distance": 2.931, "atom1_id": "///C/350/O", "atom2_id": "///C/354/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 561, "atom1_serNum": 4787, "atom2_serNum": 5041, "donAcc_type": "acceptable", "distance": 3.149, "atom1_id": "///C/350/ND1", "atom2_id": "///C/382/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 562, "atom1_serNum": 4794, "atom2_serNum": 4825, "donAcc_type": "standard", "distance": 2.921, "atom1_id": "///C/351/O", "atom2_id": "///C/355/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 563, "atom1_serNum": 4803, "atom2_serNum": 4832, "donAcc_type": "standard", "distance": 2.935, "atom1_id": "///C/352/O", "atom2_id": "///C/356/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 564, "atom1_serNum": 4806, "atom2_serNum": 4808, "donAcc_type": "standard", "distance": 2.793, "atom1_id": "///C/352/OD1", "atom2_id": "///C/353/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 565, "atom1_serNum": 4811, "atom2_serNum": 4840, "donAcc_type": "standard", "distance": 3.012, "atom1_id": "///C/353/O", "atom2_id": "///C/357/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 566, "atom1_serNum": 4819, "atom2_serNum": 4851, "donAcc_type": "standard", "distance": 2.905, "atom1_id": "///C/354/O", "atom2_id": "///C/358/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 567, "atom1_serNum": 4823, "atom2_serNum": 4849, "donAcc_type": "standard", "distance": 2.922, "atom1_id": "///C/354/OE1", "atom2_id": "///C/357/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 568, "atom1_serNum": 4824, "atom2_serNum": 13982, "donAcc_type": "acceptable", "distance": 2.966, "atom1_id": "///C/354/OE2", "atom2_id": "///F/225/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 569, "atom1_serNum": 4847, "atom2_serNum": 5007, "donAcc_type": "standard", "distance": 3.282, "atom1_id": "///C/357/NE", "atom2_id": "///C/378/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 570, "atom1_serNum": 4850, "atom2_serNum": 5007, "donAcc_type": "standard", "distance": 3.050, "atom1_id": "///C/357/NH2", "atom2_id": "///C/378/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 571, "atom1_serNum": 4854, "atom2_serNum": 4904, "donAcc_type": "standard", "distance": 3.236, "atom1_id": "///C/358/O", "atom2_id": "///C/363/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 572, "atom1_serNum": 4865, "atom2_serNum": 4883, "donAcc_type": "standard", "distance": 3.169, "atom1_id": "///C/359/O", "atom2_id": "///C/362/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 573, "atom1_serNum": 4877, "atom2_serNum": 6306, "donAcc_type": "standard", "distance": 3.732, "atom1_id": "///C/361/N", "atom2_id": "///C/592/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 574, "atom1_serNum": 4880, "atom2_serNum": 4912, "donAcc_type": "standard", "distance": 3.457, "atom1_id": "///C/361/O", "atom2_id": "///C/365/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 575, "atom1_serNum": 4882, "atom2_serNum": 6281, "donAcc_type": "acceptable", "distance": 3.055, "atom1_id": "///C/361/OG", "atom2_id": "///C/590/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 576, "atom1_serNum": 4886, "atom2_serNum": 4924, "donAcc_type": "standard", "distance": 2.841, "atom1_id": "///C/362/O", "atom2_id": "///C/366/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 577, "atom1_serNum": 4897, "atom2_serNum": 4931, "donAcc_type": "standard", "distance": 2.981, "atom1_id": "///C/363/O", "atom2_id": "///C/367/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 578, "atom1_serNum": 4903, "atom2_serNum": 13957, "donAcc_type": "standard", "distance": 3.863, "atom1_id": "///C/363/NH1", "atom2_id": "///F/223/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 579, "atom1_serNum": 4908, "atom2_serNum": 4940, "donAcc_type": "standard", "distance": 2.933, "atom1_id": "///C/364/O", "atom2_id": "///C/368/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 580, "atom1_serNum": 4923, "atom2_serNum": 5096, "donAcc_type": "acceptable", "distance": 2.891, "atom1_id": "///C/365/OH", "atom2_id": "///C/388/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 581, "atom1_serNum": 4927, "atom2_serNum": 4949, "donAcc_type": "standard", "distance": 3.145, "atom1_id": "///C/366/O", "atom2_id": "///C/369/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 582, "atom1_serNum": 4960, "atom2_serNum": 4991, "donAcc_type": "standard", "distance": 2.975, "atom1_id": "///C/372/O", "atom2_id": "///C/376/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 583, "atom1_serNum": 4966, "atom2_serNum": 4999, "donAcc_type": "standard", "distance": 2.910, "atom1_id": "///C/373/O", "atom2_id": "///C/377/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 584, "atom1_serNum": 4975, "atom2_serNum": 5004, "donAcc_type": "standard", "distance": 2.895, "atom1_id": "///C/374/O", "atom2_id": "///C/378/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 585, "atom1_serNum": 4982, "atom2_serNum": 5096, "donAcc_type": "questionable", "distance": 3.160, "atom1_id": "///C/374/NH2", "atom2_id": "///C/388/NZ", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 586, "atom1_serNum": 4986, "atom2_serNum": 5011, "donAcc_type": "standard", "distance": 2.901, "atom1_id": "///C/375/O", "atom2_id": "///C/379/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 587, "atom1_serNum": 4994, "atom2_serNum": 5019, "donAcc_type": "standard", "distance": 3.065, "atom1_id": "///C/376/O", "atom2_id": "///C/380/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 588, "atom1_serNum": 5029, "atom2_serNum": 5042, "donAcc_type": "standard", "distance": 2.579, "atom1_id": "///C/381/O", "atom2_id": "///C/383/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 589, "atom1_serNum": 5037, "atom2_serNum": 5070, "donAcc_type": "standard", "distance": 2.937, "atom1_id": "///C/382/O", "atom2_id": "///C/386/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 590, "atom1_serNum": 5045, "atom2_serNum": 5079, "donAcc_type": "standard", "distance": 2.929, "atom1_id": "///C/383/O", "atom2_id": "///C/387/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 591, "atom1_serNum": 5053, "atom2_serNum": 5088, "donAcc_type": "standard", "distance": 2.932, "atom1_id": "///C/384/O", "atom2_id": "///C/388/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 592, "atom1_serNum": 5065, "atom2_serNum": 5097, "donAcc_type": "standard", "distance": 2.956, "atom1_id": "///C/385/O", "atom2_id": "///C/389/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 593, "atom1_serNum": 5091, "atom2_serNum": 5121, "donAcc_type": "standard", "distance": 3.778, "atom1_id": "///C/388/O", "atom2_id": "///C/392/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 594, "atom1_serNum": 5100, "atom2_serNum": 5129, "donAcc_type": "standard", "distance": 2.972, "atom1_id": "///C/389/O", "atom2_id": "///C/393/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 595, "atom1_serNum": 5108, "atom2_serNum": 5137, "donAcc_type": "standard", "distance": 2.930, "atom1_id": "///C/390/O", "atom2_id": "///C/394/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 596, "atom1_serNum": 5115, "atom2_serNum": 5148, "donAcc_type": "standard", "distance": 2.917, "atom1_id": "///C/391/O", "atom2_id": "///C/395/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 597, "atom1_serNum": 5124, "atom2_serNum": 5156, "donAcc_type": "standard", "distance": 2.966, "atom1_id": "///C/392/O", "atom2_id": "///C/396/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 598, "atom1_serNum": 5132, "atom2_serNum": 5162, "donAcc_type": "standard", "distance": 2.973, "atom1_id": "///C/393/O", "atom2_id": "///C/397/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 599, "atom1_serNum": 5140, "atom2_serNum": 5170, "donAcc_type": "standard", "distance": 2.913, "atom1_id": "///C/394/O", "atom2_id": "///C/398/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 600, "atom1_serNum": 5151, "atom2_serNum": 5178, "donAcc_type": "standard", "distance": 2.945, "atom1_id": "///C/395/O", "atom2_id": "///C/399/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 601, "atom1_serNum": 5159, "atom2_serNum": 5188, "donAcc_type": "standard", "distance": 3.001, "atom1_id": "///C/396/O", "atom2_id": "///C/400/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 602, "atom1_serNum": 5165, "atom2_serNum": 5199, "donAcc_type": "standard", "distance": 3.001, "atom1_id": "///C/397/O", "atom2_id": "///C/401/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 603, "atom1_serNum": 5173, "atom2_serNum": 5207, "donAcc_type": "standard", "distance": 2.952, "atom1_id": "///C/398/O", "atom2_id": "///C/402/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 604, "atom1_serNum": 5181, "atom2_serNum": 5215, "donAcc_type": "standard", "distance": 2.885, "atom1_id": "///C/399/O", "atom2_id": "///C/403/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 605, "atom1_serNum": 5191, "atom2_serNum": 5226, "donAcc_type": "standard", "distance": 3.027, "atom1_id": "///C/400/O", "atom2_id": "///C/404/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 606, "atom1_serNum": 5202, "atom2_serNum": 5237, "donAcc_type": "standard", "distance": 3.016, "atom1_id": "///C/401/O", "atom2_id": "///C/405/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 607, "atom1_serNum": 5210, "atom2_serNum": 5243, "donAcc_type": "standard", "distance": 2.924, "atom1_id": "///C/402/O", "atom2_id": "///C/406/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 608, "atom1_serNum": 5210, "atom2_serNum": 5248, "donAcc_type": "acceptable", "distance": 2.981, "atom1_id": "///C/402/O", "atom2_id": "///C/406/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 609, "atom1_serNum": 5218, "atom2_serNum": 5248, "donAcc_type": "acceptable", "distance": 3.075, "atom1_id": "///C/403/O", "atom2_id": "///C/406/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 610, "atom1_serNum": 5218, "atom2_serNum": 5249, "donAcc_type": "standard", "distance": 2.935, "atom1_id": "///C/403/O", "atom2_id": "///C/407/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 611, "atom1_serNum": 5229, "atom2_serNum": 5257, "donAcc_type": "standard", "distance": 2.946, "atom1_id": "///C/404/O", "atom2_id": "///C/408/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 612, "atom1_serNum": 5235, "atom2_serNum": 5264, "donAcc_type": "standard", "distance": 2.553, "atom1_id": "///C/404/NH1", "atom2_id": "///C/408/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 613, "atom1_serNum": 5240, "atom2_serNum": 5266, "donAcc_type": "standard", "distance": 2.991, "atom1_id": "///C/405/O", "atom2_id": "///C/409/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 614, "atom1_serNum": 5246, "atom2_serNum": 5277, "donAcc_type": "standard", "distance": 2.919, "atom1_id": "///C/406/O", "atom2_id": "///C/410/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 615, "atom1_serNum": 5248, "atom2_serNum": 6206, "donAcc_type": "acceptable", "distance": 2.714, "atom1_id": "///C/406/OG", "atom2_id": "///C/580/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 616, "atom1_serNum": 5252, "atom2_serNum": 5285, "donAcc_type": "standard", "distance": 2.975, "atom1_id": "///C/407/O", "atom2_id": "///C/411/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 617, "atom1_serNum": 5252, "atom2_serNum": 5290, "donAcc_type": "acceptable", "distance": 3.076, "atom1_id": "///C/407/O", "atom2_id": "///C/411/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 618, "atom1_serNum": 5260, "atom2_serNum": 5758, "donAcc_type": "standard", "distance": 3.312, "atom1_id": "///C/408/O", "atom2_id": "///C/469/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 619, "atom1_serNum": 5264, "atom2_serNum": 5405, "donAcc_type": "standard", "distance": 3.015, "atom1_id": "///C/408/OE1", "atom2_id": "///C/426/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 620, "atom1_serNum": 5265, "atom2_serNum": 5405, "donAcc_type": "standard", "distance": 3.256, "atom1_id": "///C/408/OE2", "atom2_id": "///C/426/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 621, "atom1_serNum": 5269, "atom2_serNum": 5301, "donAcc_type": "standard", "distance": 3.974, "atom1_id": "///C/409/O", "atom2_id": "///C/413/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 622, "atom1_serNum": 5280, "atom2_serNum": 5309, "donAcc_type": "standard", "distance": 2.952, "atom1_id": "///C/410/O", "atom2_id": "///C/414/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 623, "atom1_serNum": 5288, "atom2_serNum": 5316, "donAcc_type": "standard", "distance": 2.863, "atom1_id": "///C/411/O", "atom2_id": "///C/415/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 624, "atom1_serNum": 5290, "atom2_serNum": 5760, "donAcc_type": "acceptable", "distance": 2.889, "atom1_id": "///C/411/OG1", "atom2_id": "///C/469/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 625, "atom1_serNum": 5295, "atom2_serNum": 5320, "donAcc_type": "standard", "distance": 2.998, "atom1_id": "///C/412/O", "atom2_id": "///C/416/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 626, "atom1_serNum": 5299, "atom2_serNum": 5761, "donAcc_type": "standard", "distance": 2.538, "atom1_id": "///C/412/OE1", "atom2_id": "///C/469/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 627, "atom1_serNum": 5312, "atom2_serNum": 5328, "donAcc_type": "standard", "distance": 3.276, "atom1_id": "///C/414/O", "atom2_id": "///C/417/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 628, "atom1_serNum": 5370, "atom2_serNum": 5461, "donAcc_type": "standard", "distance": 3.376, "atom1_id": "///C/422/O", "atom2_id": "///C/432/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 629, "atom1_serNum": 5388, "atom2_serNum": 5426, "donAcc_type": "standard", "distance": 2.961, "atom1_id": "///C/425/N", "atom2_id": "///C/428/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 630, "atom1_serNum": 5391, "atom2_serNum": 5427, "donAcc_type": "standard", "distance": 3.801, "atom1_id": "///C/425/O", "atom2_id": "///C/429/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 631, "atom1_serNum": 5399, "atom2_serNum": 5435, "donAcc_type": "standard", "distance": 2.913, "atom1_id": "///C/426/O", "atom2_id": "///C/430/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 632, "atom1_serNum": 5410, "atom2_serNum": 5447, "donAcc_type": "standard", "distance": 2.968, "atom1_id": "///C/427/O", "atom2_id": "///C/431/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 633, "atom1_serNum": 5418, "atom2_serNum": 5426, "donAcc_type": "standard", "distance": 3.149, "atom1_id": "///C/428/N", "atom2_id": "///C/428/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 634, "atom1_serNum": 5421, "atom2_serNum": 5454, "donAcc_type": "standard", "distance": 2.907, "atom1_id": "///C/428/O", "atom2_id": "///C/432/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 635, "atom1_serNum": 5430, "atom2_serNum": 5462, "donAcc_type": "standard", "distance": 2.895, "atom1_id": "///C/429/O", "atom2_id": "///C/433/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 636, "atom1_serNum": 5438, "atom2_serNum": 5468, "donAcc_type": "standard", "distance": 3.009, "atom1_id": "///C/430/O", "atom2_id": "///C/434/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 637, "atom1_serNum": 5450, "atom2_serNum": 5476, "donAcc_type": "standard", "distance": 2.925, "atom1_id": "///C/431/O", "atom2_id": "///C/435/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 638, "atom1_serNum": 5457, "atom2_serNum": 5487, "donAcc_type": "questionable", "distance": 3.202, "atom1_id": "///C/432/O", "atom2_id": "///C/436/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 639, "atom1_serNum": 5471, "atom2_serNum": 6237, "donAcc_type": "standard", "distance": 3.379, "atom1_id": "///C/434/O", "atom2_id": "///C/584/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 640, "atom1_serNum": 5503, "atom2_serNum": 5522, "donAcc_type": "standard", "distance": 3.134, "atom1_id": "///C/438/O", "atom2_id": "///C/441/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 641, "atom1_serNum": 5503, "atom2_serNum": 5527, "donAcc_type": "acceptable", "distance": 2.305, "atom1_id": "///C/438/O", "atom2_id": "///C/441/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 642, "atom1_serNum": 5525, "atom2_serNum": 5557, "donAcc_type": "standard", "distance": 3.631, "atom1_id": "///C/441/O", "atom2_id": "///C/445/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 643, "atom1_serNum": 5532, "atom2_serNum": 5566, "donAcc_type": "standard", "distance": 2.941, "atom1_id": "///C/442/O", "atom2_id": "///C/446/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 644, "atom1_serNum": 5539, "atom2_serNum": 5575, "donAcc_type": "standard", "distance": 2.901, "atom1_id": "///C/443/O", "atom2_id": "///C/447/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 645, "atom1_serNum": 5548, "atom2_serNum": 5581, "donAcc_type": "standard", "distance": 2.930, "atom1_id": "///C/444/O", "atom2_id": "///C/448/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 646, "atom1_serNum": 5560, "atom2_serNum": 5589, "donAcc_type": "standard", "distance": 2.939, "atom1_id": "///C/445/O", "atom2_id": "///C/449/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 647, "atom1_serNum": 5569, "atom2_serNum": 5598, "donAcc_type": "standard", "distance": 2.928, "atom1_id": "///C/446/O", "atom2_id": "///C/450/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 648, "atom1_serNum": 5578, "atom2_serNum": 5606, "donAcc_type": "standard", "distance": 2.926, "atom1_id": "///C/447/O", "atom2_id": "///C/451/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 649, "atom1_serNum": 5584, "atom2_serNum": 5614, "donAcc_type": "standard", "distance": 2.880, "atom1_id": "///C/448/O", "atom2_id": "///C/452/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 650, "atom1_serNum": 5584, "atom2_serNum": 5619, "donAcc_type": "acceptable", "distance": 2.853, "atom1_id": "///C/448/O", "atom2_id": "///C/452/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 651, "atom1_serNum": 5592, "atom2_serNum": 5620, "donAcc_type": "standard", "distance": 2.998, "atom1_id": "///C/449/O", "atom2_id": "///C/453/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 652, "atom1_serNum": 5619, "atom2_serNum": 6095, "donAcc_type": "acceptable", "distance": 2.795, "atom1_id": "///C/452/OG", "atom2_id": "///C/566/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 653, "atom1_serNum": 5639, "atom2_serNum": 5670, "donAcc_type": "standard", "distance": 3.111, "atom1_id": "///C/455/N", "atom2_id": "///C/458/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 654, "atom1_serNum": 5642, "atom2_serNum": 5671, "donAcc_type": "standard", "distance": 3.133, "atom1_id": "///C/455/O", "atom2_id": "///C/459/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 655, "atom1_serNum": 5644, "atom2_serNum": 5670, "donAcc_type": "acceptable", "distance": 2.802, "atom1_id": "///C/455/OG", "atom2_id": "///C/458/OE2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 656, "atom1_serNum": 5648, "atom2_serNum": 5682, "donAcc_type": "standard", "distance": 2.939, "atom1_id": "///C/456/O", "atom2_id": "///C/460/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 657, "atom1_serNum": 5657, "atom2_serNum": 5689, "donAcc_type": "standard", "distance": 2.932, "atom1_id": "///C/457/O", "atom2_id": "///C/461/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 658, "atom1_serNum": 5665, "atom2_serNum": 5694, "donAcc_type": "standard", "distance": 2.893, "atom1_id": "///C/458/O", "atom2_id": "///C/462/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 659, "atom1_serNum": 5674, "atom2_serNum": 5703, "donAcc_type": "standard", "distance": 2.970, "atom1_id": "///C/459/O", "atom2_id": "///C/463/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 660, "atom1_serNum": 5685, "atom2_serNum": 5710, "donAcc_type": "standard", "distance": 2.918, "atom1_id": "///C/460/O", "atom2_id": "///C/464/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 661, "atom1_serNum": 5692, "atom2_serNum": 5718, "donAcc_type": "standard", "distance": 2.916, "atom1_id": "///C/461/O", "atom2_id": "///C/465/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 662, "atom1_serNum": 5697, "atom2_serNum": 5729, "donAcc_type": "standard", "distance": 2.971, "atom1_id": "///C/462/O", "atom2_id": "///C/466/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 663, "atom1_serNum": 5706, "atom2_serNum": 5734, "donAcc_type": "standard", "distance": 2.888, "atom1_id": "///C/463/O", "atom2_id": "///C/467/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 664, "atom1_serNum": 5713, "atom2_serNum": 5742, "donAcc_type": "standard", "distance": 2.936, "atom1_id": "///C/464/O", "atom2_id": "///C/468/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 665, "atom1_serNum": 5721, "atom2_serNum": 5751, "donAcc_type": "standard", "distance": 2.944, "atom1_id": "///C/465/O", "atom2_id": "///C/469/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 666, "atom1_serNum": 5727, "atom2_serNum": 5749, "donAcc_type": "standard", "distance": 2.509, "atom1_id": "///C/465/NH1", "atom2_id": "///C/468/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 667, "atom1_serNum": 5732, "atom2_serNum": 5762, "donAcc_type": "standard", "distance": 2.924, "atom1_id": "///C/466/O", "atom2_id": "///C/470/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 668, "atom1_serNum": 5732, "atom2_serNum": 5767, "donAcc_type": "acceptable", "distance": 2.537, "atom1_id": "///C/466/O", "atom2_id": "///C/470/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 669, "atom1_serNum": 5737, "atom2_serNum": 5769, "donAcc_type": "standard", "distance": 2.929, "atom1_id": "///C/467/O", "atom2_id": "///C/471/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 670, "atom1_serNum": 5745, "atom2_serNum": 5778, "donAcc_type": "standard", "distance": 2.940, "atom1_id": "///C/468/O", "atom2_id": "///C/472/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 671, "atom1_serNum": 5754, "atom2_serNum": 5787, "donAcc_type": "standard", "distance": 2.967, "atom1_id": "///C/469/O", "atom2_id": "///C/473/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 672, "atom1_serNum": 5765, "atom2_serNum": 5798, "donAcc_type": "standard", "distance": 2.893, "atom1_id": "///C/470/O", "atom2_id": "///C/474/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 673, "atom1_serNum": 5772, "atom2_serNum": 5806, "donAcc_type": "standard", "distance": 2.958, "atom1_id": "///C/471/O", "atom2_id": "///C/475/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 674, "atom1_serNum": 5776, "atom2_serNum": 5936, "donAcc_type": "standard", "distance": 2.414, "atom1_id": "///C/471/OE1", "atom2_id": "///C/492/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 675, "atom1_serNum": 5781, "atom2_serNum": 5813, "donAcc_type": "standard", "distance": 2.907, "atom1_id": "///C/472/O", "atom2_id": "///C/476/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 676, "atom1_serNum": 5790, "atom2_serNum": 5822, "donAcc_type": "standard", "distance": 2.941, "atom1_id": "///C/473/O", "atom2_id": "///C/477/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 677, "atom1_serNum": 5801, "atom2_serNum": 5839, "donAcc_type": "standard", "distance": 3.490, "atom1_id": "///C/474/O", "atom2_id": "///C/479/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 678, "atom1_serNum": 5854, "atom2_serNum": 5876, "donAcc_type": "standard", "distance": 3.194, "atom1_id": "///C/481/O", "atom2_id": "///C/484/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 679, "atom1_serNum": 5879, "atom2_serNum": 5900, "donAcc_type": "standard", "distance": 2.924, "atom1_id": "///C/484/O", "atom2_id": "///C/488/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 680, "atom1_serNum": 5879, "atom2_serNum": 5905, "donAcc_type": "acceptable", "distance": 2.843, "atom1_id": "///C/484/O", "atom2_id": "///C/488/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 681, "atom1_serNum": 5883, "atom2_serNum": 5907, "donAcc_type": "standard", "distance": 2.925, "atom1_id": "///C/485/O", "atom2_id": "///C/489/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 682, "atom1_serNum": 5892, "atom2_serNum": 5912, "donAcc_type": "standard", "distance": 2.931, "atom1_id": "///C/486/O", "atom2_id": "///C/490/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 683, "atom1_serNum": 5897, "atom2_serNum": 5919, "donAcc_type": "standard", "distance": 2.957, "atom1_id": "///C/487/O", "atom2_id": "///C/491/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 684, "atom1_serNum": 5903, "atom2_serNum": 5927, "donAcc_type": "standard", "distance": 2.912, "atom1_id": "///C/488/O", "atom2_id": "///C/492/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 685, "atom1_serNum": 5922, "atom2_serNum": 5945, "donAcc_type": "standard", "distance": 3.099, "atom1_id": "///C/491/O", "atom2_id": "///C/494/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 686, "atom1_serNum": 5922, "atom2_serNum": 5954, "donAcc_type": "standard", "distance": 3.229, "atom1_id": "///C/491/O", "atom2_id": "///C/495/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 687, "atom1_serNum": 5930, "atom2_serNum": 5962, "donAcc_type": "standard", "distance": 2.971, "atom1_id": "///C/492/O", "atom2_id": "///C/496/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 688, "atom1_serNum": 5941, "atom2_serNum": 5971, "donAcc_type": "standard", "distance": 2.909, "atom1_id": "///C/493/O", "atom2_id": "///C/497/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 689, "atom1_serNum": 5948, "atom2_serNum": 5976, "donAcc_type": "standard", "distance": 2.978, "atom1_id": "///C/494/O", "atom2_id": "///C/498/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 690, "atom1_serNum": 5953, "atom2_serNum": 6165, "donAcc_type": "standard", "distance": 3.725, "atom1_id": "///C/494/NZ", "atom2_id": "///C/575/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 691, "atom1_serNum": 5953, "atom2_serNum": 6202, "donAcc_type": "standard", "distance": 3.710, "atom1_id": "///C/494/NZ", "atom2_id": "///C/579/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 692, "atom1_serNum": 5957, "atom2_serNum": 5984, "donAcc_type": "standard", "distance": 2.915, "atom1_id": "///C/495/O", "atom2_id": "///C/499/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 693, "atom1_serNum": 5965, "atom2_serNum": 5995, "donAcc_type": "standard", "distance": 2.917, "atom1_id": "///C/496/O", "atom2_id": "///C/500/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 694, "atom1_serNum": 5969, "atom2_serNum": 5994, "donAcc_type": "standard", "distance": 2.669, "atom1_id": "///C/496/OE1", "atom2_id": "///C/499/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 695, "atom1_serNum": 5970, "atom2_serNum": 5991, "donAcc_type": "standard", "distance": 3.395, "atom1_id": "///C/496/OE2", "atom2_id": "///C/499/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 696, "atom1_serNum": 5970, "atom2_serNum": 5994, "donAcc_type": "standard", "distance": 3.034, "atom1_id": "///C/496/OE2", "atom2_id": "///C/499/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 697, "atom1_serNum": 5974, "atom2_serNum": 6003, "donAcc_type": "standard", "distance": 2.968, "atom1_id": "///C/497/O", "atom2_id": "///C/501/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 698, "atom1_serNum": 5979, "atom2_serNum": 6008, "donAcc_type": "standard", "distance": 2.912, "atom1_id": "///C/498/O", "atom2_id": "///C/502/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 699, "atom1_serNum": 5987, "atom2_serNum": 6015, "donAcc_type": "standard", "distance": 2.920, "atom1_id": "///C/499/O", "atom2_id": "///C/503/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 700, "atom1_serNum": 5998, "atom2_serNum": 6023, "donAcc_type": "standard", "distance": 2.901, "atom1_id": "///C/500/O", "atom2_id": "///C/504/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 701, "atom1_serNum": 6006, "atom2_serNum": 6032, "donAcc_type": "standard", "distance": 2.948, "atom1_id": "///C/501/O", "atom2_id": "///C/505/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 702, "atom1_serNum": 6011, "atom2_serNum": 6039, "donAcc_type": "standard", "distance": 2.892, "atom1_id": "///C/502/O", "atom2_id": "///C/506/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 703, "atom1_serNum": 6015, "atom2_serNum": 6021, "donAcc_type": "standard", "distance": 2.776, "atom1_id": "///C/503/N", "atom2_id": "///C/503/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 704, "atom1_serNum": 6018, "atom2_serNum": 6046, "donAcc_type": "standard", "distance": 2.969, "atom1_id": "///C/503/O", "atom2_id": "///C/507/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 705, "atom1_serNum": 6078, "atom2_serNum": 6106, "donAcc_type": "standard", "distance": 2.951, "atom1_id": "///C/564/O", "atom2_id": "///C/568/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 706, "atom1_serNum": 6083, "atom2_serNum": 6113, "donAcc_type": "standard", "distance": 2.930, "atom1_id": "///C/565/O", "atom2_id": "///C/569/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 707, "atom1_serNum": 6091, "atom2_serNum": 6121, "donAcc_type": "standard", "distance": 2.896, "atom1_id": "///C/566/O", "atom2_id": "///C/570/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 708, "atom1_serNum": 6100, "atom2_serNum": 6130, "donAcc_type": "standard", "distance": 2.918, "atom1_id": "///C/567/O", "atom2_id": "///C/571/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 709, "atom1_serNum": 6109, "atom2_serNum": 6138, "donAcc_type": "standard", "distance": 2.958, "atom1_id": "///C/568/O", "atom2_id": "///C/572/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 710, "atom1_serNum": 6116, "atom2_serNum": 6146, "donAcc_type": "standard", "distance": 2.908, "atom1_id": "///C/569/O", "atom2_id": "///C/573/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 711, "atom1_serNum": 6124, "atom2_serNum": 6155, "donAcc_type": "standard", "distance": 2.934, "atom1_id": "///C/570/O", "atom2_id": "///C/574/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 712, "atom1_serNum": 6129, "atom2_serNum": 6153, "donAcc_type": "standard", "distance": 2.741, "atom1_id": "///C/570/NE2", "atom2_id": "///C/573/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 713, "atom1_serNum": 6133, "atom2_serNum": 6162, "donAcc_type": "standard", "distance": 3.010, "atom1_id": "///C/571/O", "atom2_id": "///C/575/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 714, "atom1_serNum": 6133, "atom2_serNum": 6169, "donAcc_type": "questionable", "distance": 2.919, "atom1_id": "///C/571/O", "atom2_id": "///C/575/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 715, "atom1_serNum": 6141, "atom2_serNum": 6179, "donAcc_type": "standard", "distance": 3.460, "atom1_id": "///C/572/O", "atom2_id": "///C/577/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 716, "atom1_serNum": 6149, "atom2_serNum": 6186, "donAcc_type": "standard", "distance": 2.751, "atom1_id": "///C/573/O", "atom2_id": "///C/578/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 717, "atom1_serNum": 6158, "atom2_serNum": 6202, "donAcc_type": "questionable", "distance": 3.021, "atom1_id": "///C/574/O", "atom2_id": "///C/579/OD2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 718, "atom1_serNum": 6160, "atom2_serNum": 6193, "donAcc_type": "acceptable", "distance": 2.567, "atom1_id": "///C/574/OG1", "atom2_id": "///C/578/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 719, "atom1_serNum": 6174, "atom2_serNum": 6203, "donAcc_type": "standard", "distance": 3.275, "atom1_id": "///C/576/O", "atom2_id": "///C/580/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 720, "atom1_serNum": 6198, "atom2_serNum": 6228, "donAcc_type": "standard", "distance": 3.524, "atom1_id": "///C/579/O", "atom2_id": "///C/582/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 721, "atom1_serNum": 6230, "atom2_serNum": 6257, "donAcc_type": "standard", "distance": 3.567, "atom1_id": "///C/582/NH1", "atom2_id": "///C/586/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 722, "atom1_serNum": 6235, "atom2_serNum": 6254, "donAcc_type": "standard", "distance": 2.836, "atom1_id": "///C/583/O", "atom2_id": "///C/586/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 723, "atom1_serNum": 6235, "atom2_serNum": 6262, "donAcc_type": "standard", "distance": 3.198, "atom1_id": "///C/583/O", "atom2_id": "///C/587/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 724, "atom1_serNum": 6240, "atom2_serNum": 6262, "donAcc_type": "standard", "distance": 3.407, "atom1_id": "///C/584/O", "atom2_id": "///C/587/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 725, "atom1_serNum": 6240, "atom2_serNum": 6298, "donAcc_type": "standard", "distance": 3.132, "atom1_id": "///C/584/O", "atom2_id": "///C/591/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 726, "atom1_serNum": 6270, "atom2_serNum": 6289, "donAcc_type": "standard", "distance": 3.353, "atom1_id": "///C/588/O", "atom2_id": "///C/591/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 727, "atom1_serNum": 6270, "atom2_serNum": 6295, "donAcc_type": "acceptable", "distance": 3.188, "atom1_id": "///C/588/O", "atom2_id": "///C/591/ND1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 728, "atom1_serNum": 6292, "atom2_serNum": 6316, "donAcc_type": "standard", "distance": 3.069, "atom1_id": "///C/591/O", "atom2_id": "///C/594/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 729, "atom1_serNum": 6292, "atom2_serNum": 6327, "donAcc_type": "standard", "distance": 3.118, "atom1_id": "///C/591/O", "atom2_id": "///C/595/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 730, "atom1_serNum": 6348, "atom2_serNum": 6359, "donAcc_type": "standard", "distance": 2.949, "atom1_id": "///C/597/O", "atom2_id": "///C/599/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 731, "atom1_serNum": 6358, "atom2_serNum": 6377, "donAcc_type": "acceptable", "distance": 3.003, "atom1_id": "///C/598/OD2", "atom2_id": "///C/601/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 732, "atom1_serNum": 6362, "atom2_serNum": 6386, "donAcc_type": "standard", "distance": 2.887, "atom1_id": "///C/599/O", "atom2_id": "///C/603/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 733, "atom1_serNum": 6370, "atom2_serNum": 6397, "donAcc_type": "standard", "distance": 2.952, "atom1_id": "///C/600/O", "atom2_id": "///C/604/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 734, "atom1_serNum": 6375, "atom2_serNum": 6408, "donAcc_type": "standard", "distance": 2.935, "atom1_id": "///C/601/O", "atom2_id": "///C/605/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 735, "atom1_serNum": 6382, "atom2_serNum": 6416, "donAcc_type": "standard", "distance": 2.909, "atom1_id": "///C/602/O", "atom2_id": "///C/606/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 736, "atom1_serNum": 6389, "atom2_serNum": 6424, "donAcc_type": "standard", "distance": 2.962, "atom1_id": "///C/603/O", "atom2_id": "///C/607/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 737, "atom1_serNum": 6435, "atom2_serNum": 13520, "donAcc_type": "standard", "distance": 2.681, "atom1_id": "///C/608/O", "atom2_id": "///E/401/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 738, "atom1_serNum": 6439, "atom2_serNum": 6464, "donAcc_type": "standard", "distance": 3.535, "atom1_id": "///C/609/O", "atom2_id": "///C/613/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 739, "atom1_serNum": 6444, "atom2_serNum": 6469, "donAcc_type": "standard", "distance": 2.946, "atom1_id": "///C/610/O", "atom2_id": "///C/614/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 740, "atom1_serNum": 6451, "atom2_serNum": 6477, "donAcc_type": "standard", "distance": 2.869, "atom1_id": "///C/611/O", "atom2_id": "///C/615/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 741, "atom1_serNum": 6462, "atom2_serNum": 6487, "donAcc_type": "standard", "distance": 2.954, "atom1_id": "///C/612/O", "atom2_id": "///C/616/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 742, "atom1_serNum": 6467, "atom2_serNum": 6494, "donAcc_type": "standard", "distance": 2.919, "atom1_id": "///C/613/O", "atom2_id": "///C/617/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 743, "atom1_serNum": 6467, "atom2_serNum": 6562, "donAcc_type": "acceptable", "distance": 3.992, "atom1_id": "///C/613/O", "atom2_id": "///C/624/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 744, "atom1_serNum": 6472, "atom2_serNum": 6499, "donAcc_type": "standard", "distance": 2.914, "atom1_id": "///C/614/O", "atom2_id": "///C/618/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 745, "atom1_serNum": 6480, "atom2_serNum": 6507, "donAcc_type": "standard", "distance": 2.936, "atom1_id": "///C/615/O", "atom2_id": "///C/619/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 746, "atom1_serNum": 6486, "atom2_serNum": 6513, "donAcc_type": "standard", "distance": 2.881, "atom1_id": "///C/615/NE2", "atom2_id": "///C/619/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 747, "atom1_serNum": 6490, "atom2_serNum": 6518, "donAcc_type": "questionable", "distance": 2.856, "atom1_id": "///C/616/O", "atom2_id": "///C/620/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 748, "atom1_serNum": 6492, "atom2_serNum": 6562, "donAcc_type": "acceptable", "distance": 3.529, "atom1_id": "///C/616/OG1", "atom2_id": "///C/624/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 749, "atom1_serNum": 6497, "atom2_serNum": 6726, "donAcc_type": "acceptable", "distance": 3.924, "atom1_id": "///C/617/O", "atom2_id": "///C/646/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 750, "atom1_serNum": 6510, "atom2_serNum": 6761, "donAcc_type": "standard", "distance": 3.386, "atom1_id": "///C/619/O", "atom2_id": "///C/650/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 751, "atom1_serNum": 6518, "atom2_serNum": 6540, "donAcc_type": "standard", "distance": 3.366, "atom1_id": "///C/620/O", "atom2_id": "///C/623/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 752, "atom1_serNum": 6526, "atom2_serNum": 6551, "donAcc_type": "standard", "distance": 2.946, "atom1_id": "///C/621/O", "atom2_id": "///C/624/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 753, "atom1_serNum": 6526, "atom2_serNum": 6563, "donAcc_type": "standard", "distance": 2.805, "atom1_id": "///C/621/O", "atom2_id": "///C/625/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 754, "atom1_serNum": 6533, "atom2_serNum": 6571, "donAcc_type": "standard", "distance": 3.126, "atom1_id": "///C/622/O", "atom2_id": "///C/626/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 755, "atom1_serNum": 6536, "atom2_serNum": 6583, "donAcc_type": "acceptable", "distance": 3.047, "atom1_id": "///C/622/ND1", "atom2_id": "///C/627/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 756, "atom1_serNum": 6636, "atom2_serNum": 6656, "donAcc_type": "standard", "distance": 3.387, "atom1_id": "///C/634/O", "atom2_id": "///C/637/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 757, "atom1_serNum": 6644, "atom2_serNum": 6761, "donAcc_type": "standard", "distance": 2.532, "atom1_id": "///C/635/O", "atom2_id": "///C/650/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 758, "atom1_serNum": 6675, "atom2_serNum": 6690, "donAcc_type": "standard", "distance": 3.661, "atom1_id": "///C/639/O", "atom2_id": "///C/642/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 759, "atom1_serNum": 6701, "atom2_serNum": 6721, "donAcc_type": "standard", "distance": 2.948, "atom1_id": "///C/643/O", "atom2_id": "///C/646/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 760, "atom1_serNum": 6701, "atom2_serNum": 6727, "donAcc_type": "standard", "distance": 3.544, "atom1_id": "///C/643/O", "atom2_id": "///C/647/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 761, "atom1_serNum": 6708, "atom2_serNum": 6734, "donAcc_type": "standard", "distance": 3.522, "atom1_id": "///C/644/O", "atom2_id": "///C/648/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 762, "atom1_serNum": 6716, "atom2_serNum": 6741, "donAcc_type": "standard", "distance": 2.926, "atom1_id": "///C/645/O", "atom2_id": "///C/649/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 763, "atom1_serNum": 6724, "atom2_serNum": 6753, "donAcc_type": "standard", "distance": 2.887, "atom1_id": "///C/646/O", "atom2_id": "///C/650/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 764, "atom1_serNum": 6730, "atom2_serNum": 6762, "donAcc_type": "standard", "distance": 2.982, "atom1_id": "///C/647/O", "atom2_id": "///C/651/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 765, "atom1_serNum": 6737, "atom2_serNum": 6770, "donAcc_type": "standard", "distance": 2.929, "atom1_id": "///C/648/O", "atom2_id": "///C/652/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 766, "atom1_serNum": 6737, "atom2_serNum": 6877, "donAcc_type": "standard", "distance": 3.426, "atom1_id": "///C/648/O", "atom2_id": "///C/664/NE1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 767, "atom1_serNum": 6744, "atom2_serNum": 6780, "donAcc_type": "standard", "distance": 2.841, "atom1_id": "///C/649/O", "atom2_id": "///C/653/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 768, "atom1_serNum": 6756, "atom2_serNum": 6788, "donAcc_type": "standard", "distance": 2.982, "atom1_id": "///C/650/O", "atom2_id": "///C/654/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 769, "atom1_serNum": 6773, "atom2_serNum": 6797, "donAcc_type": "standard", "distance": 3.703, "atom1_id": "///C/652/O", "atom2_id": "///C/655/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 770, "atom1_serNum": 6816, "atom2_serNum": 20737, "donAcc_type": "standard", "distance": 3.876, "atom1_id": "///C/657/NH1", "atom2_id": "///H/27/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 771, "atom1_serNum": 6826, "atom2_serNum": 7191, "donAcc_type": "standard", "distance": 2.878, "atom1_id": "///C/659/N", "atom2_id": "///C/716/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 772, "atom1_serNum": 6829, "atom2_serNum": 7188, "donAcc_type": "standard", "distance": 2.916, "atom1_id": "///C/659/O", "atom2_id": "///C/716/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 773, "atom1_serNum": 6840, "atom2_serNum": 7173, "donAcc_type": "questionable", "distance": 3.031, "atom1_id": "///C/660/OD1", "atom2_id": "///C/714/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 774, "atom1_serNum": 6842, "atom2_serNum": 7173, "donAcc_type": "standard", "distance": 3.368, "atom1_id": "///C/661/N", "atom2_id": "///C/714/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 775, "atom1_serNum": 6845, "atom2_serNum": 6883, "donAcc_type": "standard", "distance": 2.923, "atom1_id": "///C/661/O", "atom2_id": "///C/665/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 776, "atom1_serNum": 6853, "atom2_serNum": 6891, "donAcc_type": "standard", "distance": 2.923, "atom1_id": "///C/662/O", "atom2_id": "///C/666/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 777, "atom1_serNum": 6861, "atom2_serNum": 6867, "donAcc_type": "standard", "distance": 2.535, "atom1_id": "///C/663/N", "atom2_id": "///C/663/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 778, "atom1_serNum": 6864, "atom2_serNum": 6900, "donAcc_type": "standard", "distance": 2.907, "atom1_id": "///C/663/O", "atom2_id": "///C/667/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 779, "atom1_serNum": 6872, "atom2_serNum": 6905, "donAcc_type": "standard", "distance": 2.978, "atom1_id": "///C/664/O", "atom2_id": "///C/668/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 780, "atom1_serNum": 6886, "atom2_serNum": 6916, "donAcc_type": "standard", "distance": 2.860, "atom1_id": "///C/665/O", "atom2_id": "///C/669/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 781, "atom1_serNum": 6894, "atom2_serNum": 6927, "donAcc_type": "standard", "distance": 2.891, "atom1_id": "///C/666/O", "atom2_id": "///C/670/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 782, "atom1_serNum": 6903, "atom2_serNum": 6933, "donAcc_type": "standard", "distance": 2.977, "atom1_id": "///C/667/O", "atom2_id": "///C/671/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 783, "atom1_serNum": 6908, "atom2_serNum": 6940, "donAcc_type": "standard", "distance": 3.128, "atom1_id": "///C/668/O", "atom2_id": "///C/672/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 784, "atom1_serNum": 6950, "atom2_serNum": 6980, "donAcc_type": "standard", "distance": 3.906, "atom1_id": "///C/687/O", "atom2_id": "///C/691/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 785, "atom1_serNum": 6957, "atom2_serNum": 6985, "donAcc_type": "standard", "distance": 2.903, "atom1_id": "///C/688/O", "atom2_id": "///C/692/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 786, "atom1_serNum": 6966, "atom2_serNum": 6996, "donAcc_type": "standard", "distance": 2.928, "atom1_id": "///C/689/O", "atom2_id": "///C/693/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 787, "atom1_serNum": 6974, "atom2_serNum": 7007, "donAcc_type": "standard", "distance": 2.907, "atom1_id": "///C/690/O", "atom2_id": "///C/694/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 788, "atom1_serNum": 6974, "atom2_serNum": 7012, "donAcc_type": "acceptable", "distance": 2.953, "atom1_id": "///C/690/O", "atom2_id": "///C/694/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 789, "atom1_serNum": 6983, "atom2_serNum": 7014, "donAcc_type": "standard", "distance": 2.904, "atom1_id": "///C/691/O", "atom2_id": "///C/695/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 790, "atom1_serNum": 6988, "atom2_serNum": 7025, "donAcc_type": "standard", "distance": 2.949, "atom1_id": "///C/692/O", "atom2_id": "///C/696/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 791, "atom1_serNum": 6999, "atom2_serNum": 7030, "donAcc_type": "standard", "distance": 2.927, "atom1_id": "///C/693/O", "atom2_id": "///C/697/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 792, "atom1_serNum": 7010, "atom2_serNum": 7037, "donAcc_type": "standard", "distance": 2.906, "atom1_id": "///C/694/O", "atom2_id": "///C/698/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 793, "atom1_serNum": 7017, "atom2_serNum": 7042, "donAcc_type": "standard", "distance": 2.951, "atom1_id": "///C/695/O", "atom2_id": "///C/699/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 794, "atom1_serNum": 7028, "atom2_serNum": 7051, "donAcc_type": "standard", "distance": 2.902, "atom1_id": "///C/696/O", "atom2_id": "///C/700/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 795, "atom1_serNum": 7033, "atom2_serNum": 7059, "donAcc_type": "standard", "distance": 2.895, "atom1_id": "///C/697/O", "atom2_id": "///C/701/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 796, "atom1_serNum": 7040, "atom2_serNum": 7068, "donAcc_type": "standard", "distance": 2.915, "atom1_id": "///C/698/O", "atom2_id": "///C/702/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 797, "atom1_serNum": 7045, "atom2_serNum": 7079, "donAcc_type": "standard", "distance": 2.975, "atom1_id": "///C/699/O", "atom2_id": "///C/703/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 798, "atom1_serNum": 7054, "atom2_serNum": 7091, "donAcc_type": "standard", "distance": 3.157, "atom1_id": "///C/700/O", "atom2_id": "///C/705/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 799, "atom1_serNum": 7054, "atom2_serNum": 7103, "donAcc_type": "standard", "distance": 3.562, "atom1_id": "///C/700/O", "atom2_id": "///C/706/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 800, "atom1_serNum": 7062, "atom2_serNum": 7087, "donAcc_type": "standard", "distance": 2.963, "atom1_id": "///C/701/O", "atom2_id": "///C/704/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 801, "atom1_serNum": 7094, "atom2_serNum": 7211, "donAcc_type": "standard", "distance": 2.986, "atom1_id": "///C/705/O", "atom2_id": "///C/719/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 802, "atom1_serNum": 7111, "atom2_serNum": 7196, "donAcc_type": "standard", "distance": 2.914, "atom1_id": "///C/707/N", "atom2_id": "///C/717/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 803, "atom1_serNum": 7114, "atom2_serNum": 7193, "donAcc_type": "standard", "distance": 2.934, "atom1_id": "///C/707/O", "atom2_id": "///C/717/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 804, "atom1_serNum": 7119, "atom2_serNum": 7123, "donAcc_type": "standard", "distance": 3.320, "atom1_id": "///C/707/NZ", "atom2_id": "///C/708/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 805, "atom1_serNum": 7128, "atom2_serNum": 7181, "donAcc_type": "standard", "distance": 3.185, "atom1_id": "///C/709/N", "atom2_id": "///C/715/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 806, "atom1_serNum": 7133, "atom2_serNum": 20736, "donAcc_type": "acceptable", "distance": 3.057, "atom1_id": "///C/709/OG", "atom2_id": "///H/27/OP1", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 807, "atom1_serNum": 7150, "atom2_serNum": 20713, "donAcc_type": "questionable", "distance": 3.390, "atom1_id": "///C/711/NE", "atom2_id": "///H/25/N2", "atom_pair": "N:N", "residue_pair": "aa:nt" }, { "index": 808, "atom1_serNum": 7150, "atom2_serNum": 20722, "donAcc_type": "standard", "distance": 3.036, "atom1_id": "///C/711/NE", "atom2_id": "///H/26/O4'", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 809, "atom1_serNum": 7152, "atom2_serNum": 21132, "donAcc_type": "standard", "distance": 2.567, "atom1_id": "///C/711/NH1", "atom2_id": "///I/46/O4'", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 810, "atom1_serNum": 7162, "atom2_serNum": 20757, "donAcc_type": "standard", "distance": 3.550, "atom1_id": "///C/712/NZ", "atom2_id": "///H/28/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 811, "atom1_serNum": 7196, "atom2_serNum": 7198, "donAcc_type": "acceptable", "distance": 2.759, "atom1_id": "///C/717/O", "atom2_id": "///C/717/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 812, "atom1_serNum": 7252, "atom2_serNum": 7271, "donAcc_type": "standard", "distance": 3.136, "atom1_id": "///D/3/O", "atom2_id": "///D/6/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 813, "atom1_serNum": 7252, "atom2_serNum": 7282, "donAcc_type": "standard", "distance": 3.152, "atom1_id": "///D/3/O", "atom2_id": "///D/7/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 814, "atom1_serNum": 7263, "atom2_serNum": 7269, "donAcc_type": "standard", "distance": 2.727, "atom1_id": "///D/5/N", "atom2_id": "///D/5/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 815, "atom1_serNum": 7274, "atom2_serNum": 7306, "donAcc_type": "standard", "distance": 2.958, "atom1_id": "///D/6/O", "atom2_id": "///D/10/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 816, "atom1_serNum": 7285, "atom2_serNum": 7311, "donAcc_type": "acceptable", "distance": 2.576, "atom1_id": "///D/7/O", "atom2_id": "///D/10/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 817, "atom1_serNum": 7285, "atom2_serNum": 7312, "donAcc_type": "standard", "distance": 2.913, "atom1_id": "///D/7/O", "atom2_id": "///D/11/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 818, "atom1_serNum": 7294, "atom2_serNum": 7320, "donAcc_type": "standard", "distance": 2.830, "atom1_id": "///D/8/O", "atom2_id": "///D/12/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 819, "atom1_serNum": 7302, "atom2_serNum": 7331, "donAcc_type": "standard", "distance": 2.928, "atom1_id": "///D/9/O", "atom2_id": "///D/13/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 820, "atom1_serNum": 7309, "atom2_serNum": 7342, "donAcc_type": "standard", "distance": 2.930, "atom1_id": "///D/10/O", "atom2_id": "///D/14/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 821, "atom1_serNum": 7315, "atom2_serNum": 7353, "donAcc_type": "standard", "distance": 2.920, "atom1_id": "///D/11/O", "atom2_id": "///D/15/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 822, "atom1_serNum": 7323, "atom2_serNum": 7361, "donAcc_type": "standard", "distance": 2.942, "atom1_id": "///D/12/O", "atom2_id": "///D/16/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 823, "atom1_serNum": 7327, "atom2_serNum": 9696, "donAcc_type": "standard", "distance": 3.042, "atom1_id": "///D/12/NE", "atom2_id": "///D/312/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 824, "atom1_serNum": 7329, "atom2_serNum": 11019, "donAcc_type": "standard", "distance": 2.411, "atom1_id": "///D/12/NH1", "atom2_id": "///E/31/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 825, "atom1_serNum": 7330, "atom2_serNum": 9696, "donAcc_type": "standard", "distance": 3.382, "atom1_id": "///D/12/NH2", "atom2_id": "///D/312/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 826, "atom1_serNum": 7334, "atom2_serNum": 7370, "donAcc_type": "standard", "distance": 2.953, "atom1_id": "///D/13/O", "atom2_id": "///D/17/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 827, "atom1_serNum": 7338, "atom2_serNum": 9281, "donAcc_type": "acceptable", "distance": 3.196, "atom1_id": "///D/13/NE", "atom2_id": "///D/261/OH", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 828, "atom1_serNum": 7341, "atom2_serNum": 9281, "donAcc_type": "acceptable", "distance": 3.140, "atom1_id": "///D/13/NH2", "atom2_id": "///D/261/OH", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 829, "atom1_serNum": 7345, "atom2_serNum": 7379, "donAcc_type": "standard", "distance": 2.913, "atom1_id": "///D/14/O", "atom2_id": "///D/18/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 830, "atom1_serNum": 7356, "atom2_serNum": 7390, "donAcc_type": "standard", "distance": 2.955, "atom1_id": "///D/15/O", "atom2_id": "///D/19/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 831, "atom1_serNum": 7364, "atom2_serNum": 7398, "donAcc_type": "standard", "distance": 2.963, "atom1_id": "///D/16/O", "atom2_id": "///D/20/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 832, "atom1_serNum": 7369, "atom2_serNum": 10965, "donAcc_type": "standard", "distance": 3.622, "atom1_id": "///D/16/NZ", "atom2_id": "///E/24/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 833, "atom1_serNum": 7369, "atom2_serNum": 11018, "donAcc_type": "standard", "distance": 2.636, "atom1_id": "///D/16/NZ", "atom2_id": "///E/31/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 834, "atom1_serNum": 7373, "atom2_serNum": 7407, "donAcc_type": "standard", "distance": 2.860, "atom1_id": "///D/17/O", "atom2_id": "///D/21/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 835, "atom1_serNum": 7377, "atom2_serNum": 9281, "donAcc_type": "acceptable", "distance": 3.940, "atom1_id": "///D/17/OE1", "atom2_id": "///D/261/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 836, "atom1_serNum": 7378, "atom2_serNum": 7416, "donAcc_type": "standard", "distance": 3.399, "atom1_id": "///D/17/OE2", "atom2_id": "///D/21/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 837, "atom1_serNum": 7378, "atom2_serNum": 11676, "donAcc_type": "standard", "distance": 2.381, "atom1_id": "///D/17/OE2", "atom2_id": "///E/115/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 838, "atom1_serNum": 7378, "atom2_serNum": 11677, "donAcc_type": "standard", "distance": 3.273, "atom1_id": "///D/17/OE2", "atom2_id": "///E/115/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 839, "atom1_serNum": 7382, "atom2_serNum": 9613, "donAcc_type": "standard", "distance": 3.922, "atom1_id": "///D/18/O", "atom2_id": "///D/302/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 840, "atom1_serNum": 7389, "atom2_serNum": 9017, "donAcc_type": "standard", "distance": 2.409, "atom1_id": "///D/18/NH2", "atom2_id": "///D/224/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 841, "atom1_serNum": 7406, "atom2_serNum": 11030, "donAcc_type": "standard", "distance": 3.290, "atom1_id": "///D/20/NE2", "atom2_id": "///E/33/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 842, "atom1_serNum": 7414, "atom2_serNum": 9219, "donAcc_type": "standard", "distance": 2.780, "atom1_id": "///D/21/NE", "atom2_id": "///D/254/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 843, "atom1_serNum": 7424, "atom2_serNum": 7450, "donAcc_type": "acceptable", "distance": 2.637, "atom1_id": "///D/22/OD1", "atom2_id": "///D/25/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 844, "atom1_serNum": 7425, "atom2_serNum": 7450, "donAcc_type": "acceptable", "distance": 3.042, "atom1_id": "///D/22/OD2", "atom2_id": "///D/25/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 845, "atom1_serNum": 7429, "atom2_serNum": 7773, "donAcc_type": "standard", "distance": 3.509, "atom1_id": "///D/23/O", "atom2_id": "///D/67/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 846, "atom1_serNum": 7441, "atom2_serNum": 7779, "donAcc_type": "acceptable", "distance": 3.159, "atom1_id": "///D/24/O", "atom2_id": "///D/68/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 847, "atom1_serNum": 7443, "atom2_serNum": 9111, "donAcc_type": "acceptable", "distance": 2.574, "atom1_id": "///D/24/OG1", "atom2_id": "///D/237/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 848, "atom1_serNum": 7460, "atom2_serNum": 21626, "donAcc_type": "standard", "distance": 2.908, "atom1_id": "///D/27/N", "atom2_id": "///D/901/N1", "atom_pair": "N:N", "residue_pair": "aa:ligand" }, { "index": 849, "atom1_serNum": 7463, "atom2_serNum": 21625, "donAcc_type": "standard", "distance": 2.728, "atom1_id": "///D/27/O", "atom2_id": "///D/901/N6", "atom_pair": "O:N", "residue_pair": "aa:ligand" }, { "index": 850, "atom1_serNum": 7467, "atom2_serNum": 9578, "donAcc_type": "standard", "distance": 3.065, "atom1_id": "///D/27/NE", "atom2_id": "///D/298/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 851, "atom1_serNum": 7469, "atom2_serNum": 9578, "donAcc_type": "standard", "distance": 3.007, "atom1_id": "///D/27/NH1", "atom2_id": "///D/298/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 852, "atom1_serNum": 7469, "atom2_serNum": 21628, "donAcc_type": "standard", "distance": 3.210, "atom1_id": "///D/27/NH1", "atom2_id": "///D/901/N3", "atom_pair": "N:N", "residue_pair": "aa:ligand" }, { "index": 853, "atom1_serNum": 7486, "atom2_serNum": 8859, "donAcc_type": "acceptable", "distance": 3.671, "atom1_id": "///D/29/OH", "atom2_id": "///D/206/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 854, "atom1_serNum": 7490, "atom2_serNum": 7521, "donAcc_type": "standard", "distance": 2.928, "atom1_id": "///D/30/O", "atom2_id": "///D/34/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 855, "atom1_serNum": 7490, "atom2_serNum": 7526, "donAcc_type": "acceptable", "distance": 3.075, "atom1_id": "///D/30/O", "atom2_id": "///D/34/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 856, "atom1_serNum": 7495, "atom2_serNum": 7527, "donAcc_type": "standard", "distance": 2.914, "atom1_id": "///D/31/O", "atom2_id": "///D/35/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 857, "atom1_serNum": 7500, "atom2_serNum": 7509, "donAcc_type": "standard", "distance": 2.718, "atom1_id": "///D/31/NZ", "atom2_id": "///D/32/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 858, "atom1_serNum": 7504, "atom2_serNum": 7535, "donAcc_type": "standard", "distance": 3.040, "atom1_id": "///D/32/O", "atom2_id": "///D/36/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 859, "atom1_serNum": 7513, "atom2_serNum": 7542, "donAcc_type": "standard", "distance": 2.891, "atom1_id": "///D/33/O", "atom2_id": "///D/37/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 860, "atom1_serNum": 7517, "atom2_serNum": 7779, "donAcc_type": "acceptable", "distance": 3.315, "atom1_id": "///D/33/NE", "atom2_id": "///D/68/OG", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 861, "atom1_serNum": 7519, "atom2_serNum": 7807, "donAcc_type": "standard", "distance": 2.353, "atom1_id": "///D/33/NH1", "atom2_id": "///D/72/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 862, "atom1_serNum": 7524, "atom2_serNum": 7553, "donAcc_type": "standard", "distance": 2.931, "atom1_id": "///D/34/O", "atom2_id": "///D/38/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 863, "atom1_serNum": 7530, "atom2_serNum": 7561, "donAcc_type": "standard", "distance": 2.979, "atom1_id": "///D/35/O", "atom2_id": "///D/39/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 864, "atom1_serNum": 7538, "atom2_serNum": 7569, "donAcc_type": "standard", "distance": 3.014, "atom1_id": "///D/36/O", "atom2_id": "///D/40/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 865, "atom1_serNum": 7545, "atom2_serNum": 7577, "donAcc_type": "standard", "distance": 2.903, "atom1_id": "///D/37/O", "atom2_id": "///D/41/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 866, "atom1_serNum": 7556, "atom2_serNum": 7586, "donAcc_type": "standard", "distance": 2.914, "atom1_id": "///D/38/O", "atom2_id": "///D/42/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 867, "atom1_serNum": 7564, "atom2_serNum": 7597, "donAcc_type": "standard", "distance": 3.020, "atom1_id": "///D/39/O", "atom2_id": "///D/43/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 868, "atom1_serNum": 7564, "atom2_serNum": 7602, "donAcc_type": "acceptable", "distance": 3.169, "atom1_id": "///D/39/O", "atom2_id": "///D/43/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 869, "atom1_serNum": 7564, "atom2_serNum": 7652, "donAcc_type": "standard", "distance": 3.710, "atom1_id": "///D/39/O", "atom2_id": "///D/50/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 870, "atom1_serNum": 7572, "atom2_serNum": 7604, "donAcc_type": "standard", "distance": 2.962, "atom1_id": "///D/40/O", "atom2_id": "///D/44/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 871, "atom1_serNum": 7580, "atom2_serNum": 7609, "donAcc_type": "standard", "distance": 2.934, "atom1_id": "///D/41/O", "atom2_id": "///D/45/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 872, "atom1_serNum": 7585, "atom2_serNum": 7616, "donAcc_type": "standard", "distance": 3.592, "atom1_id": "///D/41/NE2", "atom2_id": "///D/45/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 873, "atom1_serNum": 7589, "atom2_serNum": 7618, "donAcc_type": "standard", "distance": 2.937, "atom1_id": "///D/42/O", "atom2_id": "///D/46/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 874, "atom1_serNum": 7589, "atom2_serNum": 7626, "donAcc_type": "standard", "distance": 3.405, "atom1_id": "///D/42/O", "atom2_id": "///D/47/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 875, "atom1_serNum": 7595, "atom2_serNum": 7637, "donAcc_type": "standard", "distance": 3.624, "atom1_id": "///D/42/NH1", "atom2_id": "///D/48/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 876, "atom1_serNum": 7596, "atom2_serNum": 16271, "donAcc_type": "standard", "distance": 2.513, "atom1_id": "///D/42/NH2", "atom2_id": "///A/795/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 877, "atom1_serNum": 7600, "atom2_serNum": 8330, "donAcc_type": "acceptable", "distance": 2.906, "atom1_id": "///D/43/O", "atom2_id": "///D/141/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 878, "atom1_serNum": 7602, "atom2_serNum": 7652, "donAcc_type": "acceptable", "distance": 3.324, "atom1_id": "///D/43/OG1", "atom2_id": "///D/50/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 879, "atom1_serNum": 7607, "atom2_serNum": 14261, "donAcc_type": "standard", "distance": 2.888, "atom1_id": "///D/44/O", "atom2_id": "///A/539/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 880, "atom1_serNum": 7629, "atom2_serNum": 8299, "donAcc_type": "standard", "distance": 2.936, "atom1_id": "///D/47/O", "atom2_id": "///D/137/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 881, "atom1_serNum": 7637, "atom2_serNum": 16240, "donAcc_type": "standard", "distance": 3.105, "atom1_id": "///D/48/OE1", "atom2_id": "///A/791/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 882, "atom1_serNum": 7638, "atom2_serNum": 14367, "donAcc_type": "standard", "distance": 3.211, "atom1_id": "///D/48/OE2", "atom2_id": "///A/553/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 883, "atom1_serNum": 7642, "atom2_serNum": 14427, "donAcc_type": "standard", "distance": 3.146, "atom1_id": "///D/49/O", "atom2_id": "///A/560/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 884, "atom1_serNum": 7645, "atom2_serNum": 8604, "donAcc_type": "standard", "distance": 3.447, "atom1_id": "///D/50/N", "atom2_id": "///D/175/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 885, "atom1_serNum": 7648, "atom2_serNum": 8615, "donAcc_type": "standard", "distance": 3.427, "atom1_id": "///D/50/O", "atom2_id": "///D/177/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 886, "atom1_serNum": 7651, "atom2_serNum": 16240, "donAcc_type": "standard", "distance": 2.438, "atom1_id": "///D/50/OD1", "atom2_id": "///A/791/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 887, "atom1_serNum": 7656, "atom2_serNum": 8799, "donAcc_type": "acceptable", "distance": 3.102, "atom1_id": "///D/51/O", "atom2_id": "///D/199/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 888, "atom1_serNum": 7658, "atom2_serNum": 8799, "donAcc_type": "acceptable", "distance": 2.442, "atom1_id": "///D/51/OG", "atom2_id": "///D/199/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 889, "atom1_serNum": 7659, "atom2_serNum": 8618, "donAcc_type": "standard", "distance": 2.920, "atom1_id": "///D/52/N", "atom2_id": "///D/177/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 890, "atom1_serNum": 7662, "atom2_serNum": 8630, "donAcc_type": "standard", "distance": 2.902, "atom1_id": "///D/52/O", "atom2_id": "///D/179/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 891, "atom1_serNum": 7670, "atom2_serNum": 8830, "donAcc_type": "standard", "distance": 3.275, "atom1_id": "///D/53/O", "atom2_id": "///D/203/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 892, "atom1_serNum": 7675, "atom2_serNum": 8633, "donAcc_type": "standard", "distance": 2.863, "atom1_id": "///D/54/N", "atom2_id": "///D/179/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 893, "atom1_serNum": 7678, "atom2_serNum": 8641, "donAcc_type": "standard", "distance": 2.973, "atom1_id": "///D/54/O", "atom2_id": "///D/181/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 894, "atom1_serNum": 7683, "atom2_serNum": 8833, "donAcc_type": "standard", "distance": 2.855, "atom1_id": "///D/55/N", "atom2_id": "///D/203/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 895, "atom1_serNum": 7686, "atom2_serNum": 8848, "donAcc_type": "standard", "distance": 2.700, "atom1_id": "///D/55/O", "atom2_id": "///D/205/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 896, "atom1_serNum": 7691, "atom2_serNum": 8644, "donAcc_type": "standard", "distance": 3.774, "atom1_id": "///D/56/N", "atom2_id": "///D/181/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 897, "atom1_serNum": 7698, "atom2_serNum": 7717, "donAcc_type": "standard", "distance": 3.312, "atom1_id": "///D/57/O", "atom2_id": "///D/60/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 898, "atom1_serNum": 7698, "atom2_serNum": 7722, "donAcc_type": "acceptable", "distance": 2.462, "atom1_id": "///D/57/O", "atom2_id": "///D/60/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 899, "atom1_serNum": 7712, "atom2_serNum": 12119, "donAcc_type": "standard", "distance": 3.191, "atom1_id": "///D/58/NH2", "atom2_id": "///E/170/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 900, "atom1_serNum": 7713, "atom2_serNum": 21606, "donAcc_type": "standard", "distance": 3.662, "atom1_id": "///D/59/N", "atom2_id": "///D/901/O3B", "atom_pair": "N:O", "residue_pair": "aa:ligand" }, { "index": 901, "atom1_serNum": 7720, "atom2_serNum": 7727, "donAcc_type": "standard", "distance": 2.870, "atom1_id": "///D/60/O", "atom2_id": "///D/62/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 902, "atom1_serNum": 7720, "atom2_serNum": 21604, "donAcc_type": "acceptable", "distance": 2.952, "atom1_id": "///D/60/O", "atom2_id": "///D/901/O1B", "atom_pair": "O:O", "residue_pair": "aa:ligand" }, { "index": 903, "atom1_serNum": 7722, "atom2_serNum": 8851, "donAcc_type": "acceptable", "distance": 3.348, "atom1_id": "///D/60/OG", "atom2_id": "///D/205/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 904, "atom1_serNum": 7727, "atom2_serNum": 21604, "donAcc_type": "acceptable", "distance": 3.041, "atom1_id": "///D/62/N", "atom2_id": "///D/901/O1B", "atom_pair": "N:O", "residue_pair": "aa:ligand" }, { "index": 905, "atom1_serNum": 7730, "atom2_serNum": 7758, "donAcc_type": "standard", "distance": 2.970, "atom1_id": "///D/62/O", "atom2_id": "///D/66/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 906, "atom1_serNum": 7735, "atom2_serNum": 21601, "donAcc_type": "acceptable", "distance": 2.855, "atom1_id": "///D/62/NZ", "atom2_id": "///D/901/O2G", "atom_pair": "N:O", "residue_pair": "aa:ligand" }, { "index": 907, "atom1_serNum": 7736, "atom2_serNum": 21604, "donAcc_type": "acceptable", "distance": 3.096, "atom1_id": "///D/63/N", "atom2_id": "///D/901/O1B", "atom_pair": "N:O", "residue_pair": "aa:ligand" }, { "index": 908, "atom1_serNum": 7739, "atom2_serNum": 7766, "donAcc_type": "standard", "distance": 2.909, "atom1_id": "///D/63/O", "atom2_id": "///D/67/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 909, "atom1_serNum": 7746, "atom2_serNum": 7774, "donAcc_type": "standard", "distance": 2.911, "atom1_id": "///D/64/O", "atom2_id": "///D/68/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 910, "atom1_serNum": 7748, "atom2_serNum": 21608, "donAcc_type": "acceptable", "distance": 2.566, "atom1_id": "///D/64/OG1", "atom2_id": "///D/901/O1A", "atom_pair": "O:O", "residue_pair": "aa:ligand" }, { "index": 911, "atom1_serNum": 7753, "atom2_serNum": 7780, "donAcc_type": "standard", "distance": 2.990, "atom1_id": "///D/65/O", "atom2_id": "///D/69/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 912, "atom1_serNum": 7761, "atom2_serNum": 7787, "donAcc_type": "standard", "distance": 2.946, "atom1_id": "///D/66/O", "atom2_id": "///D/70/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 913, "atom1_serNum": 7769, "atom2_serNum": 7795, "donAcc_type": "standard", "distance": 2.871, "atom1_id": "///D/67/O", "atom2_id": "///D/71/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 914, "atom1_serNum": 7777, "atom2_serNum": 7800, "donAcc_type": "standard", "distance": 2.988, "atom1_id": "///D/68/O", "atom2_id": "///D/72/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 915, "atom1_serNum": 7783, "atom2_serNum": 7808, "donAcc_type": "standard", "distance": 2.944, "atom1_id": "///D/69/O", "atom2_id": "///D/73/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 916, "atom1_serNum": 7790, "atom2_serNum": 7816, "donAcc_type": "standard", "distance": 2.876, "atom1_id": "///D/70/O", "atom2_id": "///D/74/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 917, "atom1_serNum": 7803, "atom2_serNum": 7838, "donAcc_type": "standard", "distance": 3.548, "atom1_id": "///D/72/O", "atom2_id": "///D/76/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 918, "atom1_serNum": 7811, "atom2_serNum": 7831, "donAcc_type": "standard", "distance": 3.365, "atom1_id": "///D/73/O", "atom2_id": "///D/76/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 919, "atom1_serNum": 7811, "atom2_serNum": 7838, "donAcc_type": "standard", "distance": 2.980, "atom1_id": "///D/73/O", "atom2_id": "///D/76/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 920, "atom1_serNum": 7819, "atom2_serNum": 7839, "donAcc_type": "standard", "distance": 3.974, "atom1_id": "///D/74/O", "atom2_id": "///D/77/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 921, "atom1_serNum": 7842, "atom2_serNum": 7853, "donAcc_type": "acceptable", "distance": 3.006, "atom1_id": "///D/77/O", "atom2_id": "///D/78/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 922, "atom1_serNum": 7851, "atom2_serNum": 7878, "donAcc_type": "standard", "distance": 2.918, "atom1_id": "///D/78/O", "atom2_id": "///D/82/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 923, "atom1_serNum": 7851, "atom2_serNum": 7885, "donAcc_type": "standard", "distance": 3.106, "atom1_id": "///D/78/O", "atom2_id": "///D/82/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 924, "atom1_serNum": 7881, "atom2_serNum": 7891, "donAcc_type": "acceptable", "distance": 2.875, "atom1_id": "///D/82/O", "atom2_id": "///D/83/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 925, "atom1_serNum": 7881, "atom2_serNum": 8325, "donAcc_type": "standard", "distance": 3.092, "atom1_id": "///D/82/O", "atom2_id": "///D/141/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 926, "atom1_serNum": 7884, "atom2_serNum": 14263, "donAcc_type": "standard", "distance": 3.305, "atom1_id": "///D/82/OD1", "atom2_id": "///A/540/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 927, "atom1_serNum": 7884, "atom2_serNum": 14270, "donAcc_type": "standard", "distance": 3.306, "atom1_id": "///D/82/OD1", "atom2_id": "///A/541/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 928, "atom1_serNum": 7885, "atom2_serNum": 14277, "donAcc_type": "standard", "distance": 2.618, "atom1_id": "///D/82/ND2", "atom2_id": "///A/541/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 929, "atom1_serNum": 7893, "atom2_serNum": 8328, "donAcc_type": "standard", "distance": 2.910, "atom1_id": "///D/84/N", "atom2_id": "///D/141/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 930, "atom1_serNum": 7896, "atom2_serNum": 8338, "donAcc_type": "standard", "distance": 2.931, "atom1_id": "///D/84/O", "atom2_id": "///D/143/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 931, "atom1_serNum": 7909, "atom2_serNum": 8341, "donAcc_type": "standard", "distance": 2.885, "atom1_id": "///D/86/N", "atom2_id": "///D/143/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 932, "atom1_serNum": 7912, "atom2_serNum": 8357, "donAcc_type": "standard", "distance": 2.937, "atom1_id": "///D/86/O", "atom2_id": "///D/145/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 933, "atom1_serNum": 7919, "atom2_serNum": 8071, "donAcc_type": "standard", "distance": 2.620, "atom1_id": "///D/87/O", "atom2_id": "///D/106/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 934, "atom1_serNum": 7926, "atom2_serNum": 8360, "donAcc_type": "standard", "distance": 2.884, "atom1_id": "///D/88/N", "atom2_id": "///D/145/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 935, "atom1_serNum": 7929, "atom2_serNum": 8373, "donAcc_type": "standard", "distance": 2.913, "atom1_id": "///D/88/O", "atom2_id": "///D/147/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 936, "atom1_serNum": 7934, "atom2_serNum": 7968, "donAcc_type": "acceptable", "distance": 3.098, "atom1_id": "///D/89/N", "atom2_id": "///D/93/ND1", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 937, "atom1_serNum": 7937, "atom2_serNum": 7962, "donAcc_type": "standard", "distance": 3.003, "atom1_id": "///D/89/O", "atom2_id": "///D/93/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 938, "atom1_serNum": 7937, "atom2_serNum": 7968, "donAcc_type": "acceptable", "distance": 2.761, "atom1_id": "///D/89/O", "atom2_id": "///D/93/ND1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 939, "atom1_serNum": 7940, "atom2_serNum": 7946, "donAcc_type": "standard", "distance": 3.059, "atom1_id": "///D/89/OD1", "atom2_id": "///D/91/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 940, "atom1_serNum": 7942, "atom2_serNum": 8376, "donAcc_type": "standard", "distance": 2.834, "atom1_id": "///D/90/N", "atom2_id": "///D/147/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 941, "atom1_serNum": 7949, "atom2_serNum": 11850, "donAcc_type": "standard", "distance": 2.863, "atom1_id": "///D/91/O", "atom2_id": "///E/137/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 942, "atom1_serNum": 7957, "atom2_serNum": 7972, "donAcc_type": "standard", "distance": 3.230, "atom1_id": "///D/92/O", "atom2_id": "///D/94/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 943, "atom1_serNum": 7965, "atom2_serNum": 8449, "donAcc_type": "standard", "distance": 3.508, "atom1_id": "///D/93/O", "atom2_id": "///D/155/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 944, "atom1_serNum": 7982, "atom2_serNum": 8013, "donAcc_type": "standard", "distance": 3.307, "atom1_id": "///D/95/O", "atom2_id": "///D/99/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 945, "atom1_serNum": 7990, "atom2_serNum": 8018, "donAcc_type": "standard", "distance": 2.902, "atom1_id": "///D/96/O", "atom2_id": "///D/100/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 946, "atom1_serNum": 7993, "atom2_serNum": 8446, "donAcc_type": "acceptable", "distance": 2.909, "atom1_id": "///D/96/OD1", "atom2_id": "///D/155/ND1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 947, "atom1_serNum": 7998, "atom2_serNum": 8026, "donAcc_type": "standard", "distance": 2.927, "atom1_id": "///D/97/O", "atom2_id": "///D/101/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 948, "atom1_serNum": 8004, "atom2_serNum": 20413, "donAcc_type": "standard", "distance": 2.720, "atom1_id": "///D/97/NH1", "atom2_id": "///H/11/O5'", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 949, "atom1_serNum": 8009, "atom2_serNum": 8035, "donAcc_type": "standard", "distance": 2.985, "atom1_id": "///D/98/O", "atom2_id": "///D/102/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 950, "atom1_serNum": 8016, "atom2_serNum": 8041, "donAcc_type": "standard", "distance": 2.901, "atom1_id": "///D/99/O", "atom2_id": "///D/103/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 951, "atom1_serNum": 8021, "atom2_serNum": 8049, "donAcc_type": "standard", "distance": 2.941, "atom1_id": "///D/100/O", "atom2_id": "///D/104/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 952, "atom1_serNum": 8021, "atom2_serNum": 8054, "donAcc_type": "acceptable", "distance": 2.852, "atom1_id": "///D/100/O", "atom2_id": "///D/104/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 953, "atom1_serNum": 8029, "atom2_serNum": 8056, "donAcc_type": "standard", "distance": 2.939, "atom1_id": "///D/101/O", "atom2_id": "///D/105/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 954, "atom1_serNum": 8034, "atom2_serNum": 8166, "donAcc_type": "standard", "distance": 3.719, "atom1_id": "///D/101/NZ", "atom2_id": "///D/119/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 955, "atom1_serNum": 8034, "atom2_serNum": 8205, "donAcc_type": "questionable", "distance": 3.172, "atom1_id": "///D/101/NZ", "atom2_id": "///D/124/ND2", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 956, "atom1_serNum": 8038, "atom2_serNum": 8063, "donAcc_type": "standard", "distance": 2.932, "atom1_id": "///D/102/O", "atom2_id": "///D/106/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 957, "atom1_serNum": 8040, "atom2_serNum": 8071, "donAcc_type": "acceptable", "distance": 3.194, "atom1_id": "///D/102/OG", "atom2_id": "///D/106/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 958, "atom1_serNum": 8044, "atom2_serNum": 8072, "donAcc_type": "standard", "distance": 2.978, "atom1_id": "///D/103/O", "atom2_id": "///D/107/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 959, "atom1_serNum": 8052, "atom2_serNum": 8089, "donAcc_type": "standard", "distance": 3.340, "atom1_id": "///D/104/O", "atom2_id": "///D/109/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 960, "atom1_serNum": 8059, "atom2_serNum": 8080, "donAcc_type": "standard", "distance": 2.993, "atom1_id": "///D/105/O", "atom2_id": "///D/108/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 961, "atom1_serNum": 8075, "atom2_serNum": 14242, "donAcc_type": "standard", "distance": 2.972, "atom1_id": "///D/107/O", "atom2_id": "///A/537/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 962, "atom1_serNum": 8092, "atom2_serNum": 8114, "donAcc_type": "standard", "distance": 3.059, "atom1_id": "///D/109/O", "atom2_id": "///D/112/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 963, "atom1_serNum": 8100, "atom2_serNum": 14135, "donAcc_type": "standard", "distance": 2.444, "atom1_id": "///D/110/O", "atom2_id": "///A/523/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 964, "atom1_serNum": 8106, "atom2_serNum": 8112, "donAcc_type": "standard", "distance": 2.752, "atom1_id": "///D/111/N", "atom2_id": "///D/111/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 965, "atom1_serNum": 8109, "atom2_serNum": 8152, "donAcc_type": "standard", "distance": 3.559, "atom1_id": "///D/111/O", "atom2_id": "///D/118/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 966, "atom1_serNum": 8113, "atom2_serNum": 8204, "donAcc_type": "standard", "distance": 3.332, "atom1_id": "///D/111/ND2", "atom2_id": "///D/124/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 967, "atom1_serNum": 8122, "atom2_serNum": 8136, "donAcc_type": "standard", "distance": 3.733, "atom1_id": "///D/113/O", "atom2_id": "///D/116/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 968, "atom1_serNum": 8155, "atom2_serNum": 8204, "donAcc_type": "questionable", "distance": 3.107, "atom1_id": "///D/118/O", "atom2_id": "///D/124/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 969, "atom1_serNum": 8167, "atom2_serNum": 8196, "donAcc_type": "standard", "distance": 3.239, "atom1_id": "///D/120/N", "atom2_id": "///D/123/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 970, "atom1_serNum": 8170, "atom2_serNum": 8198, "donAcc_type": "standard", "distance": 2.846, "atom1_id": "///D/120/O", "atom2_id": "///D/124/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 971, "atom1_serNum": 8172, "atom2_serNum": 8189, "donAcc_type": "acceptable", "distance": 3.072, "atom1_id": "///D/120/OG", "atom2_id": "///D/123/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 972, "atom1_serNum": 8173, "atom2_serNum": 20411, "donAcc_type": "standard", "distance": 3.000, "atom1_id": "///D/121/N", "atom2_id": "///H/11/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 973, "atom1_serNum": 8176, "atom2_serNum": 8206, "donAcc_type": "standard", "distance": 2.971, "atom1_id": "///D/121/O", "atom2_id": "///D/125/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 974, "atom1_serNum": 8187, "atom2_serNum": 8214, "donAcc_type": "standard", "distance": 2.922, "atom1_id": "///D/122/O", "atom2_id": "///D/126/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 975, "atom1_serNum": 8192, "atom2_serNum": 8219, "donAcc_type": "standard", "distance": 2.921, "atom1_id": "///D/123/O", "atom2_id": "///D/127/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 976, "atom1_serNum": 8196, "atom2_serNum": 14180, "donAcc_type": "standard", "distance": 3.044, "atom1_id": "///D/123/OE1", "atom2_id": "///A/528/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 977, "atom1_serNum": 8197, "atom2_serNum": 14177, "donAcc_type": "standard", "distance": 2.709, "atom1_id": "///D/123/OE2", "atom2_id": "///A/528/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 978, "atom1_serNum": 8201, "atom2_serNum": 8230, "donAcc_type": "standard", "distance": 2.954, "atom1_id": "///D/124/O", "atom2_id": "///D/128/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 979, "atom1_serNum": 8209, "atom2_serNum": 8238, "donAcc_type": "standard", "distance": 2.962, "atom1_id": "///D/125/O", "atom2_id": "///D/129/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 980, "atom1_serNum": 8217, "atom2_serNum": 8246, "donAcc_type": "standard", "distance": 2.911, "atom1_id": "///D/126/O", "atom2_id": "///D/130/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 981, "atom1_serNum": 8222, "atom2_serNum": 8255, "donAcc_type": "standard", "distance": 2.935, "atom1_id": "///D/127/O", "atom2_id": "///D/131/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 982, "atom1_serNum": 8233, "atom2_serNum": 8261, "donAcc_type": "standard", "distance": 2.955, "atom1_id": "///D/128/O", "atom2_id": "///D/132/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 983, "atom1_serNum": 8241, "atom2_serNum": 8269, "donAcc_type": "standard", "distance": 2.900, "atom1_id": "///D/129/O", "atom2_id": "///D/133/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 984, "atom1_serNum": 8249, "atom2_serNum": 8278, "donAcc_type": "standard", "distance": 2.940, "atom1_id": "///D/130/O", "atom2_id": "///D/134/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 985, "atom1_serNum": 8253, "atom2_serNum": 15127, "donAcc_type": "standard", "distance": 3.003, "atom1_id": "///D/130/OE1", "atom2_id": "///A/649/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 986, "atom1_serNum": 8264, "atom2_serNum": 8589, "donAcc_type": "standard", "distance": 3.305, "atom1_id": "///D/132/O", "atom2_id": "///D/173/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 987, "atom1_serNum": 8287, "atom2_serNum": 8315, "donAcc_type": "acceptable", "distance": 2.717, "atom1_id": "///D/136/N", "atom2_id": "///D/139/OG", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 988, "atom1_serNum": 8290, "atom2_serNum": 8310, "donAcc_type": "standard", "distance": 3.095, "atom1_id": "///D/136/O", "atom2_id": "///D/139/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 989, "atom1_serNum": 8290, "atom2_serNum": 8315, "donAcc_type": "acceptable", "distance": 2.317, "atom1_id": "///D/136/O", "atom2_id": "///D/139/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 990, "atom1_serNum": 8303, "atom2_serNum": 14252, "donAcc_type": "standard", "distance": 2.913, "atom1_id": "///D/138/O", "atom2_id": "///A/539/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 991, "atom1_serNum": 8316, "atom2_serNum": 14237, "donAcc_type": "standard", "distance": 3.070, "atom1_id": "///D/140/N", "atom2_id": "///A/537/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 992, "atom1_serNum": 8324, "atom2_serNum": 14241, "donAcc_type": "standard", "distance": 3.634, "atom1_id": "///D/140/NZ", "atom2_id": "///A/537/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 993, "atom1_serNum": 8330, "atom2_serNum": 8597, "donAcc_type": "acceptable", "distance": 3.137, "atom1_id": "///D/141/OG", "atom2_id": "///D/174/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 994, "atom1_serNum": 8334, "atom2_serNum": 8609, "donAcc_type": "standard", "distance": 3.140, "atom1_id": "///D/142/O", "atom2_id": "///D/176/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 995, "atom1_serNum": 8346, "atom2_serNum": 8612, "donAcc_type": "standard", "distance": 3.151, "atom1_id": "///D/144/N", "atom2_id": "///D/176/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 996, "atom1_serNum": 8349, "atom2_serNum": 8612, "donAcc_type": "questionable", "distance": 3.035, "atom1_id": "///D/144/O", "atom2_id": "///D/176/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 997, "atom1_serNum": 8349, "atom2_serNum": 8622, "donAcc_type": "standard", "distance": 3.195, "atom1_id": "///D/144/O", "atom2_id": "///D/178/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 998, "atom1_serNum": 8365, "atom2_serNum": 8625, "donAcc_type": "standard", "distance": 2.934, "atom1_id": "///D/146/N", "atom2_id": "///D/178/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 999, "atom1_serNum": 8368, "atom2_serNum": 8634, "donAcc_type": "standard", "distance": 2.952, "atom1_id": "///D/146/O", "atom2_id": "///D/180/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1000, "atom1_serNum": 8382, "atom2_serNum": 8637, "donAcc_type": "standard", "distance": 2.994, "atom1_id": "///D/148/N", "atom2_id": "///D/180/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1001, "atom1_serNum": 8385, "atom2_serNum": 8418, "donAcc_type": "standard", "distance": 3.569, "atom1_id": "///D/148/O", "atom2_id": "///D/152/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1002, "atom1_serNum": 8390, "atom2_serNum": 11906, "donAcc_type": "standard", "distance": 3.262, "atom1_id": "///D/148/OE2", "atom2_id": "///E/144/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1003, "atom1_serNum": 8394, "atom2_serNum": 8429, "donAcc_type": "standard", "distance": 2.997, "atom1_id": "///D/149/O", "atom2_id": "///D/153/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1004, "atom1_serNum": 8402, "atom2_serNum": 8408, "donAcc_type": "standard", "distance": 2.603, "atom1_id": "///D/150/N", "atom2_id": "///D/150/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1005, "atom1_serNum": 8408, "atom2_serNum": 8410, "donAcc_type": "standard", "distance": 2.848, "atom1_id": "///D/150/OD1", "atom2_id": "///D/151/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1006, "atom1_serNum": 8413, "atom2_serNum": 8435, "donAcc_type": "standard", "distance": 3.204, "atom1_id": "///D/151/O", "atom2_id": "///D/154/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1007, "atom1_serNum": 8432, "atom2_serNum": 8476, "donAcc_type": "standard", "distance": 3.086, "atom1_id": "///D/153/O", "atom2_id": "///D/158/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1008, "atom1_serNum": 8443, "atom2_serNum": 8468, "donAcc_type": "standard", "distance": 3.201, "atom1_id": "///D/155/O", "atom2_id": "///D/158/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1009, "atom1_serNum": 8453, "atom2_serNum": 8477, "donAcc_type": "standard", "distance": 2.996, "atom1_id": "///D/156/O", "atom2_id": "///D/159/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1010, "atom1_serNum": 8471, "atom2_serNum": 8492, "donAcc_type": "standard", "distance": 2.997, "atom1_id": "///D/158/O", "atom2_id": "///D/161/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1011, "atom1_serNum": 8471, "atom2_serNum": 8500, "donAcc_type": "standard", "distance": 2.969, "atom1_id": "///D/158/O", "atom2_id": "///D/162/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1012, "atom1_serNum": 8475, "atom2_serNum": 8721, "donAcc_type": "standard", "distance": 2.722, "atom1_id": "///D/158/OE1", "atom2_id": "///D/191/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1013, "atom1_serNum": 8476, "atom2_serNum": 8708, "donAcc_type": "standard", "distance": 2.763, "atom1_id": "///D/158/NE2", "atom2_id": "///D/189/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1014, "atom1_serNum": 8480, "atom2_serNum": 8512, "donAcc_type": "standard", "distance": 3.043, "atom1_id": "///D/159/O", "atom2_id": "///D/163/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1015, "atom1_serNum": 8482, "atom2_serNum": 14999, "donAcc_type": "acceptable", "distance": 2.990, "atom1_id": "///D/159/OG1", "atom2_id": "///A/635/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1016, "atom1_serNum": 8487, "atom2_serNum": 8520, "donAcc_type": "standard", "distance": 2.872, "atom1_id": "///D/160/O", "atom2_id": "///D/164/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1017, "atom1_serNum": 8495, "atom2_serNum": 8528, "donAcc_type": "standard", "distance": 2.922, "atom1_id": "///D/161/O", "atom2_id": "///D/165/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1018, "atom1_serNum": 8511, "atom2_serNum": 8782, "donAcc_type": "acceptable", "distance": 2.840, "atom1_id": "///D/162/OH", "atom2_id": "///D/197/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1019, "atom1_serNum": 8511, "atom2_serNum": 14991, "donAcc_type": "acceptable", "distance": 3.993, "atom1_id": "///D/162/OH", "atom2_id": "///A/633/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1020, "atom1_serNum": 8515, "atom2_serNum": 8547, "donAcc_type": "standard", "distance": 3.198, "atom1_id": "///D/163/O", "atom2_id": "///D/167/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1021, "atom1_serNum": 8523, "atom2_serNum": 8559, "donAcc_type": "acceptable", "distance": 3.070, "atom1_id": "///D/164/O", "atom2_id": "///D/168/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1022, "atom1_serNum": 8531, "atom2_serNum": 8554, "donAcc_type": "standard", "distance": 2.957, "atom1_id": "///D/165/O", "atom2_id": "///D/168/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1023, "atom1_serNum": 8531, "atom2_serNum": 8560, "donAcc_type": "standard", "distance": 3.021, "atom1_id": "///D/165/O", "atom2_id": "///D/169/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1024, "atom1_serNum": 8542, "atom2_serNum": 8560, "donAcc_type": "standard", "distance": 2.979, "atom1_id": "///D/166/O", "atom2_id": "///D/169/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1025, "atom1_serNum": 8542, "atom2_serNum": 8569, "donAcc_type": "standard", "distance": 3.058, "atom1_id": "///D/166/O", "atom2_id": "///D/170/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1026, "atom1_serNum": 8542, "atom2_serNum": 8574, "donAcc_type": "acceptable", "distance": 2.636, "atom1_id": "///D/166/O", "atom2_id": "///D/170/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1027, "atom1_serNum": 8546, "atom2_serNum": 15014, "donAcc_type": "standard", "distance": 3.638, "atom1_id": "///D/166/OD2", "atom2_id": "///A/636/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1028, "atom1_serNum": 8550, "atom2_serNum": 8569, "donAcc_type": "standard", "distance": 3.004, "atom1_id": "///D/167/O", "atom2_id": "///D/170/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1029, "atom1_serNum": 8550, "atom2_serNum": 8572, "donAcc_type": "questionable", "distance": 2.999, "atom1_id": "///D/167/O", "atom2_id": "///D/170/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1030, "atom1_serNum": 8568, "atom2_serNum": 8775, "donAcc_type": "standard", "distance": 2.584, "atom1_id": "///D/169/NE2", "atom2_id": "///D/197/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1031, "atom1_serNum": 8572, "atom2_serNum": 8580, "donAcc_type": "standard", "distance": 2.935, "atom1_id": "///D/170/O", "atom2_id": "///D/172/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1032, "atom1_serNum": 8592, "atom2_serNum": 8601, "donAcc_type": "standard", "distance": 2.900, "atom1_id": "///D/173/O", "atom2_id": "///D/175/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1033, "atom1_serNum": 8646, "atom2_serNum": 8654, "donAcc_type": "acceptable", "distance": 3.591, "atom1_id": "///D/181/OG1", "atom2_id": "///D/183/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1034, "atom1_serNum": 8664, "atom2_serNum": 8679, "donAcc_type": "standard", "distance": 2.693, "atom1_id": "///D/183/NH2", "atom2_id": "///D/185/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1035, "atom1_serNum": 8680, "atom2_serNum": 16465, "donAcc_type": "standard", "distance": 3.780, "atom1_id": "///D/185/OD2", "atom2_id": "///A/822/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1036, "atom1_serNum": 8680, "atom2_serNum": 17131, "donAcc_type": "standard", "distance": 3.342, "atom1_id": "///D/185/OD2", "atom2_id": "///A/907/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1037, "atom1_serNum": 8684, "atom2_serNum": 8705, "donAcc_type": "standard", "distance": 3.117, "atom1_id": "///D/186/O", "atom2_id": "///D/189/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1038, "atom1_serNum": 8703, "atom2_serNum": 19771, "donAcc_type": "acceptable", "distance": 2.611, "atom1_id": "///D/188/OE1", "atom2_id": "///G/606/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1039, "atom1_serNum": 8724, "atom2_serNum": 8757, "donAcc_type": "standard", "distance": 2.545, "atom1_id": "///D/191/O", "atom2_id": "///D/195/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1040, "atom1_serNum": 8728, "atom2_serNum": 8738, "donAcc_type": "standard", "distance": 3.998, "atom1_id": "///D/191/OE1", "atom2_id": "///D/192/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1041, "atom1_serNum": 8728, "atom2_serNum": 8748, "donAcc_type": "standard", "distance": 3.184, "atom1_id": "///D/191/OE1", "atom2_id": "///D/193/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1042, "atom1_serNum": 8733, "atom2_serNum": 8766, "donAcc_type": "standard", "distance": 2.934, "atom1_id": "///D/192/O", "atom2_id": "///D/196/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1043, "atom1_serNum": 8742, "atom2_serNum": 8772, "donAcc_type": "standard", "distance": 3.154, "atom1_id": "///D/193/O", "atom2_id": "///D/197/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1044, "atom1_serNum": 8746, "atom2_serNum": 15676, "donAcc_type": "standard", "distance": 2.579, "atom1_id": "///D/193/NE", "atom2_id": "///A/718/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1045, "atom1_serNum": 8748, "atom2_serNum": 15430, "donAcc_type": "standard", "distance": 2.905, "atom1_id": "///D/193/NH1", "atom2_id": "///A/687/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1046, "atom1_serNum": 8748, "atom2_serNum": 15431, "donAcc_type": "standard", "distance": 2.744, "atom1_id": "///D/193/NH1", "atom2_id": "///A/687/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1047, "atom1_serNum": 8749, "atom2_serNum": 15430, "donAcc_type": "standard", "distance": 2.857, "atom1_id": "///D/193/NH2", "atom2_id": "///A/687/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1048, "atom1_serNum": 8749, "atom2_serNum": 15431, "donAcc_type": "standard", "distance": 3.028, "atom1_id": "///D/193/NH2", "atom2_id": "///A/687/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1049, "atom1_serNum": 8753, "atom2_serNum": 8783, "donAcc_type": "standard", "distance": 3.157, "atom1_id": "///D/194/O", "atom2_id": "///D/198/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1050, "atom1_serNum": 8771, "atom2_serNum": 16167, "donAcc_type": "acceptable", "distance": 2.402, "atom1_id": "///D/196/OG", "atom2_id": "///A/782/OD2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1051, "atom1_serNum": 8771, "atom2_serNum": 16182, "donAcc_type": "acceptable", "distance": 2.799, "atom1_id": "///D/196/OG", "atom2_id": "///A/784/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1052, "atom1_serNum": 8781, "atom2_serNum": 21665, "donAcc_type": "acceptable", "distance": 2.463, "atom1_id": "///D/197/NH1", "atom2_id": "///A/1001/O2G", "atom_pair": "N:O", "residue_pair": "aa:ligand" }, { "index": 1053, "atom1_serNum": 8782, "atom2_serNum": 21666, "donAcc_type": "standard", "distance": 2.861, "atom1_id": "///D/197/NH2", "atom2_id": "///A/1001/O3G", "atom_pair": "N:O", "residue_pair": "aa:ligand" }, { "index": 1054, "atom1_serNum": 8786, "atom2_serNum": 8806, "donAcc_type": "acceptable", "distance": 3.167, "atom1_id": "///D/198/O", "atom2_id": "///D/200/ND1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1055, "atom1_serNum": 8797, "atom2_serNum": 8810, "donAcc_type": "standard", "distance": 2.919, "atom1_id": "///D/199/O", "atom2_id": "///D/201/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1056, "atom1_serNum": 8800, "atom2_serNum": 8806, "donAcc_type": "acceptable", "distance": 3.140, "atom1_id": "///D/200/N", "atom2_id": "///D/200/ND1", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 1057, "atom1_serNum": 8819, "atom2_serNum": 16271, "donAcc_type": "standard", "distance": 3.048, "atom1_id": "///D/201/NH1", "atom2_id": "///A/795/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1058, "atom1_serNum": 8819, "atom2_serNum": 16272, "donAcc_type": "standard", "distance": 2.997, "atom1_id": "///D/201/NH1", "atom2_id": "///A/795/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1059, "atom1_serNum": 8820, "atom2_serNum": 16272, "donAcc_type": "standard", "distance": 2.827, "atom1_id": "///D/201/NH2", "atom2_id": "///A/795/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1060, "atom1_serNum": 8870, "atom2_serNum": 16512, "donAcc_type": "questionable", "distance": 3.111, "atom1_id": "///D/207/O", "atom2_id": "///A/828/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1061, "atom1_serNum": 8877, "atom2_serNum": 8937, "donAcc_type": "questionable", "distance": 3.131, "atom1_id": "///D/208/O", "atom2_id": "///D/214/OD2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1062, "atom1_serNum": 8891, "atom2_serNum": 9529, "donAcc_type": "standard", "distance": 2.960, "atom1_id": "///D/210/O", "atom2_id": "///D/292/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1063, "atom1_serNum": 8895, "atom2_serNum": 16517, "donAcc_type": "standard", "distance": 2.671, "atom1_id": "///D/210/NE", "atom2_id": "///A/829/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1064, "atom1_serNum": 8898, "atom2_serNum": 16561, "donAcc_type": "standard", "distance": 2.958, "atom1_id": "///D/210/NH2", "atom2_id": "///A/834/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1065, "atom1_serNum": 8902, "atom2_serNum": 8938, "donAcc_type": "standard", "distance": 3.381, "atom1_id": "///D/211/O", "atom2_id": "///D/215/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1066, "atom1_serNum": 8913, "atom2_serNum": 8950, "donAcc_type": "standard", "distance": 2.927, "atom1_id": "///D/212/O", "atom2_id": "///D/216/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1067, "atom1_serNum": 8924, "atom2_serNum": 8957, "donAcc_type": "standard", "distance": 2.931, "atom1_id": "///D/213/O", "atom2_id": "///D/217/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1068, "atom1_serNum": 8928, "atom2_serNum": 9475, "donAcc_type": "standard", "distance": 3.165, "atom1_id": "///D/213/OE1", "atom2_id": "///D/285/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1069, "atom1_serNum": 8928, "atom2_serNum": 9476, "donAcc_type": "standard", "distance": 2.594, "atom1_id": "///D/213/OE1", "atom2_id": "///D/285/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1070, "atom1_serNum": 8930, "atom2_serNum": 8936, "donAcc_type": "standard", "distance": 2.738, "atom1_id": "///D/214/N", "atom2_id": "///D/214/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1071, "atom1_serNum": 8933, "atom2_serNum": 8965, "donAcc_type": "standard", "distance": 2.890, "atom1_id": "///D/214/O", "atom2_id": "///D/218/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1072, "atom1_serNum": 8941, "atom2_serNum": 8973, "donAcc_type": "standard", "distance": 2.958, "atom1_id": "///D/215/O", "atom2_id": "///D/219/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1073, "atom1_serNum": 8949, "atom2_serNum": 9552, "donAcc_type": "acceptable", "distance": 3.972, "atom1_id": "///D/215/OH", "atom2_id": "///D/295/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1074, "atom1_serNum": 8953, "atom2_serNum": 8979, "donAcc_type": "standard", "distance": 2.909, "atom1_id": "///D/216/O", "atom2_id": "///D/220/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1075, "atom1_serNum": 8957, "atom2_serNum": 8963, "donAcc_type": "standard", "distance": 2.820, "atom1_id": "///D/217/N", "atom2_id": "///D/217/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1076, "atom1_serNum": 8960, "atom2_serNum": 8990, "donAcc_type": "standard", "distance": 2.920, "atom1_id": "///D/217/O", "atom2_id": "///D/221/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1077, "atom1_serNum": 8968, "atom2_serNum": 8998, "donAcc_type": "standard", "distance": 2.925, "atom1_id": "///D/218/O", "atom2_id": "///D/222/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1078, "atom1_serNum": 8982, "atom2_serNum": 9014, "donAcc_type": "standard", "distance": 3.136, "atom1_id": "///D/220/O", "atom2_id": "///D/224/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1079, "atom1_serNum": 8982, "atom2_serNum": 9019, "donAcc_type": "acceptable", "distance": 3.176, "atom1_id": "///D/220/O", "atom2_id": "///D/224/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1080, "atom1_serNum": 9009, "atom2_serNum": 9361, "donAcc_type": "standard", "distance": 2.960, "atom1_id": "///D/223/O", "atom2_id": "///D/271/NE1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1081, "atom1_serNum": 9020, "atom2_serNum": 9373, "donAcc_type": "standard", "distance": 3.188, "atom1_id": "///D/225/N", "atom2_id": "///D/272/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1082, "atom1_serNum": 9023, "atom2_serNum": 9336, "donAcc_type": "standard", "distance": 3.129, "atom1_id": "///D/225/O", "atom2_id": "///D/268/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1083, "atom1_serNum": 9023, "atom2_serNum": 9374, "donAcc_type": "standard", "distance": 3.390, "atom1_id": "///D/225/O", "atom2_id": "///D/272/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1084, "atom1_serNum": 9038, "atom2_serNum": 9054, "donAcc_type": "standard", "distance": 3.015, "atom1_id": "///D/227/O", "atom2_id": "///D/230/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1085, "atom1_serNum": 9038, "atom2_serNum": 9060, "donAcc_type": "standard", "distance": 3.175, "atom1_id": "///D/227/O", "atom2_id": "///D/231/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1086, "atom1_serNum": 9045, "atom2_serNum": 9068, "donAcc_type": "standard", "distance": 2.939, "atom1_id": "///D/228/O", "atom2_id": "///D/232/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1087, "atom1_serNum": 9046, "atom2_serNum": 9052, "donAcc_type": "standard", "distance": 2.883, "atom1_id": "///D/229/N", "atom2_id": "///D/229/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1088, "atom1_serNum": 9049, "atom2_serNum": 9076, "donAcc_type": "standard", "distance": 2.952, "atom1_id": "///D/229/O", "atom2_id": "///D/233/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1089, "atom1_serNum": 9057, "atom2_serNum": 9084, "donAcc_type": "standard", "distance": 2.871, "atom1_id": "///D/230/O", "atom2_id": "///D/234/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1090, "atom1_serNum": 9063, "atom2_serNum": 9089, "donAcc_type": "standard", "distance": 2.906, "atom1_id": "///D/231/O", "atom2_id": "///D/235/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1091, "atom1_serNum": 9071, "atom2_serNum": 9094, "donAcc_type": "standard", "distance": 2.893, "atom1_id": "///D/232/O", "atom2_id": "///D/236/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1092, "atom1_serNum": 9079, "atom2_serNum": 9103, "donAcc_type": "standard", "distance": 2.992, "atom1_id": "///D/233/O", "atom2_id": "///D/237/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1093, "atom1_serNum": 9087, "atom2_serNum": 9112, "donAcc_type": "standard", "distance": 2.943, "atom1_id": "///D/234/O", "atom2_id": "///D/238/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1094, "atom1_serNum": 9092, "atom2_serNum": 9120, "donAcc_type": "standard", "distance": 2.893, "atom1_id": "///D/235/O", "atom2_id": "///D/239/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1095, "atom1_serNum": 9097, "atom2_serNum": 9132, "donAcc_type": "standard", "distance": 2.959, "atom1_id": "///D/236/O", "atom2_id": "///D/240/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1096, "atom1_serNum": 9106, "atom2_serNum": 9140, "donAcc_type": "standard", "distance": 2.982, "atom1_id": "///D/237/O", "atom2_id": "///D/241/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1097, "atom1_serNum": 9115, "atom2_serNum": 9148, "donAcc_type": "standard", "distance": 2.866, "atom1_id": "///D/238/O", "atom2_id": "///D/242/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1098, "atom1_serNum": 9123, "atom2_serNum": 9157, "donAcc_type": "standard", "distance": 2.980, "atom1_id": "///D/239/O", "atom2_id": "///D/243/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1099, "atom1_serNum": 9156, "atom2_serNum": 9199, "donAcc_type": "standard", "distance": 2.887, "atom1_id": "///D/242/NE2", "atom2_id": "///D/252/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1100, "atom1_serNum": 9176, "atom2_serNum": 11955, "donAcc_type": "standard", "distance": 3.296, "atom1_id": "///D/250/O", "atom2_id": "///E/150/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1101, "atom1_serNum": 9188, "atom2_serNum": 9213, "donAcc_type": "standard", "distance": 2.981, "atom1_id": "///D/251/O", "atom2_id": "///D/254/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1102, "atom1_serNum": 9188, "atom2_serNum": 11955, "donAcc_type": "standard", "distance": 2.901, "atom1_id": "///D/251/O", "atom2_id": "///E/150/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1103, "atom1_serNum": 9213, "atom2_serNum": 11955, "donAcc_type": "questionable", "distance": 3.184, "atom1_id": "///D/254/N", "atom2_id": "///E/150/ND2", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 1104, "atom1_serNum": 9216, "atom2_serNum": 11954, "donAcc_type": "questionable", "distance": 2.914, "atom1_id": "///D/254/O", "atom2_id": "///E/150/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1105, "atom1_serNum": 9224, "atom2_serNum": 11677, "donAcc_type": "standard", "distance": 3.630, "atom1_id": "///D/255/O", "atom2_id": "///E/115/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1106, "atom1_serNum": 9227, "atom2_serNum": 9231, "donAcc_type": "acceptable", "distance": 3.023, "atom1_id": "///D/255/ND1", "atom2_id": "///D/256/N", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 1107, "atom1_serNum": 9245, "atom2_serNum": 9261, "donAcc_type": "standard", "distance": 3.638, "atom1_id": "///D/257/O", "atom2_id": "///D/260/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1108, "atom1_serNum": 9249, "atom2_serNum": 9269, "donAcc_type": "questionable", "distance": 3.307, "atom1_id": "///D/257/OD2", "atom2_id": "///D/260/OE2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1109, "atom1_serNum": 9253, "atom2_serNum": 9273, "donAcc_type": "questionable", "distance": 3.309, "atom1_id": "///D/258/O", "atom2_id": "///D/261/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1110, "atom1_serNum": 9269, "atom2_serNum": 11674, "donAcc_type": "standard", "distance": 2.719, "atom1_id": "///D/260/OE2", "atom2_id": "///E/115/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1111, "atom1_serNum": 9269, "atom2_serNum": 11676, "donAcc_type": "standard", "distance": 2.991, "atom1_id": "///D/260/OE2", "atom2_id": "///E/115/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1112, "atom1_serNum": 9300, "atom2_serNum": 9329, "donAcc_type": "standard", "distance": 3.053, "atom1_id": "///D/264/O", "atom2_id": "///D/268/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1113, "atom1_serNum": 9306, "atom2_serNum": 9340, "donAcc_type": "standard", "distance": 2.936, "atom1_id": "///D/265/O", "atom2_id": "///D/269/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1114, "atom1_serNum": 9313, "atom2_serNum": 9348, "donAcc_type": "standard", "distance": 2.935, "atom1_id": "///D/266/O", "atom2_id": "///D/270/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1115, "atom1_serNum": 9324, "atom2_serNum": 9353, "donAcc_type": "standard", "distance": 2.934, "atom1_id": "///D/267/O", "atom2_id": "///D/271/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1116, "atom1_serNum": 9332, "atom2_serNum": 9367, "donAcc_type": "standard", "distance": 2.962, "atom1_id": "///D/268/O", "atom2_id": "///D/272/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1117, "atom1_serNum": 9338, "atom2_serNum": 9346, "donAcc_type": "standard", "distance": 3.627, "atom1_id": "///D/268/NH1", "atom2_id": "///D/269/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1118, "atom1_serNum": 9343, "atom2_serNum": 9375, "donAcc_type": "standard", "distance": 2.936, "atom1_id": "///D/269/O", "atom2_id": "///D/273/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1119, "atom1_serNum": 9351, "atom2_serNum": 9384, "donAcc_type": "standard", "distance": 2.980, "atom1_id": "///D/270/O", "atom2_id": "///D/274/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1120, "atom1_serNum": 9356, "atom2_serNum": 9393, "donAcc_type": "standard", "distance": 2.926, "atom1_id": "///D/271/O", "atom2_id": "///D/275/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1121, "atom1_serNum": 9367, "atom2_serNum": 9373, "donAcc_type": "standard", "distance": 2.761, "atom1_id": "///D/272/N", "atom2_id": "///D/272/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1122, "atom1_serNum": 9370, "atom2_serNum": 9401, "donAcc_type": "standard", "distance": 2.984, "atom1_id": "///D/272/O", "atom2_id": "///D/276/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1123, "atom1_serNum": 9378, "atom2_serNum": 9407, "donAcc_type": "standard", "distance": 2.943, "atom1_id": "///D/273/O", "atom2_id": "///D/277/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1124, "atom1_serNum": 9387, "atom2_serNum": 9416, "donAcc_type": "standard", "distance": 2.917, "atom1_id": "///D/274/O", "atom2_id": "///D/278/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1125, "atom1_serNum": 9392, "atom2_serNum": 9754, "donAcc_type": "standard", "distance": 3.491, "atom1_id": "///D/274/NE2", "atom2_id": "///D/319/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1126, "atom1_serNum": 9396, "atom2_serNum": 9423, "donAcc_type": "standard", "distance": 2.949, "atom1_id": "///D/275/O", "atom2_id": "///D/279/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1127, "atom1_serNum": 9404, "atom2_serNum": 9431, "donAcc_type": "standard", "distance": 2.967, "atom1_id": "///D/276/O", "atom2_id": "///D/280/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1128, "atom1_serNum": 9419, "atom2_serNum": 9436, "donAcc_type": "standard", "distance": 3.152, "atom1_id": "///D/278/O", "atom2_id": "///D/281/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1129, "atom1_serNum": 9419, "atom2_serNum": 9441, "donAcc_type": "acceptable", "distance": 2.324, "atom1_id": "///D/278/O", "atom2_id": "///D/281/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1130, "atom1_serNum": 9439, "atom2_serNum": 9466, "donAcc_type": "standard", "distance": 3.227, "atom1_id": "///D/281/O", "atom2_id": "///D/285/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1131, "atom1_serNum": 9441, "atom2_serNum": 9461, "donAcc_type": "acceptable", "distance": 3.669, "atom1_id": "///D/281/OG1", "atom2_id": "///D/284/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1132, "atom1_serNum": 9446, "atom2_serNum": 9477, "donAcc_type": "standard", "distance": 2.892, "atom1_id": "///D/282/O", "atom2_id": "///D/286/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1133, "atom1_serNum": 9455, "atom2_serNum": 9482, "donAcc_type": "acceptable", "distance": 2.627, "atom1_id": "///D/283/O", "atom2_id": "///D/286/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1134, "atom1_serNum": 9455, "atom2_serNum": 9483, "donAcc_type": "standard", "distance": 2.986, "atom1_id": "///D/283/O", "atom2_id": "///D/287/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1135, "atom1_serNum": 9455, "atom2_serNum": 9488, "donAcc_type": "acceptable", "distance": 2.991, "atom1_id": "///D/283/O", "atom2_id": "///D/287/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1136, "atom1_serNum": 9464, "atom2_serNum": 9490, "donAcc_type": "standard", "distance": 2.937, "atom1_id": "///D/284/O", "atom2_id": "///D/288/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1137, "atom1_serNum": 9469, "atom2_serNum": 9498, "donAcc_type": "standard", "distance": 2.830, "atom1_id": "///D/285/O", "atom2_id": "///D/289/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1138, "atom1_serNum": 9480, "atom2_serNum": 9507, "donAcc_type": "standard", "distance": 2.981, "atom1_id": "///D/286/O", "atom2_id": "///D/290/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1139, "atom1_serNum": 9486, "atom2_serNum": 9512, "donAcc_type": "standard", "distance": 2.968, "atom1_id": "///D/287/O", "atom2_id": "///D/291/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1140, "atom1_serNum": 9493, "atom2_serNum": 9520, "donAcc_type": "standard", "distance": 2.833, "atom1_id": "///D/288/O", "atom2_id": "///D/292/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1141, "atom1_serNum": 9501, "atom2_serNum": 9530, "donAcc_type": "standard", "distance": 2.876, "atom1_id": "///D/289/O", "atom2_id": "///D/293/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1142, "atom1_serNum": 9506, "atom2_serNum": 9536, "donAcc_type": "standard", "distance": 3.340, "atom1_id": "///D/289/NE2", "atom2_id": "///D/293/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1143, "atom1_serNum": 9510, "atom2_serNum": 9538, "donAcc_type": "standard", "distance": 3.057, "atom1_id": "///D/290/O", "atom2_id": "///D/294/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1144, "atom1_serNum": 9515, "atom2_serNum": 9549, "donAcc_type": "standard", "distance": 3.299, "atom1_id": "///D/291/O", "atom2_id": "///D/295/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1145, "atom1_serNum": 9533, "atom2_serNum": 16537, "donAcc_type": "standard", "distance": 3.374, "atom1_id": "///D/293/O", "atom2_id": "///A/832/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1146, "atom1_serNum": 9541, "atom2_serNum": 16525, "donAcc_type": "acceptable", "distance": 2.792, "atom1_id": "///D/294/O", "atom2_id": "///A/830/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1147, "atom1_serNum": 9555, "atom2_serNum": 9557, "donAcc_type": "standard", "distance": 3.229, "atom1_id": "///D/295/OD1", "atom2_id": "///D/296/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1148, "atom1_serNum": 9556, "atom2_serNum": 16914, "donAcc_type": "standard", "distance": 2.776, "atom1_id": "///D/295/OD2", "atom2_id": "///A/880/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1149, "atom1_serNum": 9568, "atom2_serNum": 9585, "donAcc_type": "standard", "distance": 3.149, "atom1_id": "///D/297/O", "atom2_id": "///D/300/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1150, "atom1_serNum": 9568, "atom2_serNum": 9597, "donAcc_type": "standard", "distance": 3.514, "atom1_id": "///D/297/O", "atom2_id": "///D/301/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1151, "atom1_serNum": 9574, "atom2_serNum": 9605, "donAcc_type": "standard", "distance": 2.899, "atom1_id": "///D/298/O", "atom2_id": "///D/302/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1152, "atom1_serNum": 9583, "atom2_serNum": 9614, "donAcc_type": "standard", "distance": 2.938, "atom1_id": "///D/299/O", "atom2_id": "///D/303/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1153, "atom1_serNum": 9588, "atom2_serNum": 9622, "donAcc_type": "standard", "distance": 3.005, "atom1_id": "///D/300/O", "atom2_id": "///D/304/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1154, "atom1_serNum": 9600, "atom2_serNum": 9633, "donAcc_type": "standard", "distance": 2.858, "atom1_id": "///D/301/O", "atom2_id": "///D/305/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1155, "atom1_serNum": 9608, "atom2_serNum": 9641, "donAcc_type": "standard", "distance": 2.888, "atom1_id": "///D/302/O", "atom2_id": "///D/306/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1156, "atom1_serNum": 9613, "atom2_serNum": 21618, "donAcc_type": "acceptable", "distance": 2.673, "atom1_id": "///D/302/NZ", "atom2_id": "///D/901/O2'", "atom_pair": "N:O", "residue_pair": "aa:ligand" }, { "index": 1157, "atom1_serNum": 9617, "atom2_serNum": 9652, "donAcc_type": "standard", "distance": 3.047, "atom1_id": "///D/303/O", "atom2_id": "///D/307/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1158, "atom1_serNum": 9620, "atom2_serNum": 9659, "donAcc_type": "standard", "distance": 3.535, "atom1_id": "///D/303/OD1", "atom2_id": "///D/307/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1159, "atom1_serNum": 9621, "atom2_serNum": 12148, "donAcc_type": "standard", "distance": 3.550, "atom1_id": "///D/303/ND2", "atom2_id": "///E/174/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1160, "atom1_serNum": 9625, "atom2_serNum": 9663, "donAcc_type": "standard", "distance": 2.951, "atom1_id": "///D/304/O", "atom2_id": "///D/308/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1161, "atom1_serNum": 9636, "atom2_serNum": 9671, "donAcc_type": "standard", "distance": 2.847, "atom1_id": "///D/305/O", "atom2_id": "///D/309/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1162, "atom1_serNum": 9644, "atom2_serNum": 9678, "donAcc_type": "standard", "distance": 2.972, "atom1_id": "///D/306/O", "atom2_id": "///D/310/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1163, "atom1_serNum": 9655, "atom2_serNum": 9692, "donAcc_type": "standard", "distance": 3.296, "atom1_id": "///D/307/O", "atom2_id": "///D/311/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1164, "atom1_serNum": 9662, "atom2_serNum": 12153, "donAcc_type": "standard", "distance": 3.247, "atom1_id": "///D/307/NH2", "atom2_id": "///E/175/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1165, "atom1_serNum": 9662, "atom2_serNum": 12165, "donAcc_type": "questionable", "distance": 3.187, "atom1_id": "///D/307/NH2", "atom2_id": "///E/177/N", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 1166, "atom1_serNum": 9674, "atom2_serNum": 9693, "donAcc_type": "standard", "distance": 3.359, "atom1_id": "///D/309/O", "atom2_id": "///D/312/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1167, "atom1_serNum": 9681, "atom2_serNum": 9710, "donAcc_type": "standard", "distance": 2.896, "atom1_id": "///D/310/O", "atom2_id": "///D/313/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1168, "atom1_serNum": 9686, "atom2_serNum": 9701, "donAcc_type": "standard", "distance": 3.015, "atom1_id": "///D/311/O", "atom2_id": "///D/313/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1169, "atom1_serNum": 9704, "atom2_serNum": 9728, "donAcc_type": "standard", "distance": 3.024, "atom1_id": "///D/313/O", "atom2_id": "///D/316/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1170, "atom1_serNum": 9733, "atom2_serNum": 9788, "donAcc_type": "acceptable", "distance": 3.044, "atom1_id": "///D/316/OG", "atom2_id": "///D/323/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1171, "atom1_serNum": 9744, "atom2_serNum": 9788, "donAcc_type": "standard", "distance": 2.573, "atom1_id": "///D/318/O", "atom2_id": "///D/323/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1172, "atom1_serNum": 9762, "atom2_serNum": 9789, "donAcc_type": "standard", "distance": 3.335, "atom1_id": "///D/320/O", "atom2_id": "///D/324/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1173, "atom1_serNum": 9769, "atom2_serNum": 9797, "donAcc_type": "standard", "distance": 2.922, "atom1_id": "///D/321/O", "atom2_id": "///D/325/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1174, "atom1_serNum": 9771, "atom2_serNum": 9778, "donAcc_type": "standard", "distance": 3.079, "atom1_id": "///D/322/N", "atom2_id": "///D/322/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1175, "atom1_serNum": 9774, "atom2_serNum": 9802, "donAcc_type": "standard", "distance": 2.882, "atom1_id": "///D/322/O", "atom2_id": "///D/326/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1176, "atom1_serNum": 9783, "atom2_serNum": 9807, "donAcc_type": "standard", "distance": 2.998, "atom1_id": "///D/323/O", "atom2_id": "///D/327/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1177, "atom1_serNum": 9792, "atom2_serNum": 9814, "donAcc_type": "standard", "distance": 2.901, "atom1_id": "///D/324/O", "atom2_id": "///D/328/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1178, "atom1_serNum": 9800, "atom2_serNum": 9818, "donAcc_type": "standard", "distance": 2.886, "atom1_id": "///D/325/O", "atom2_id": "///D/329/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1179, "atom1_serNum": 9805, "atom2_serNum": 9823, "donAcc_type": "acceptable", "distance": 2.863, "atom1_id": "///D/326/O", "atom2_id": "///D/329/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1180, "atom1_serNum": 9805, "atom2_serNum": 9824, "donAcc_type": "standard", "distance": 2.950, "atom1_id": "///D/326/O", "atom2_id": "///D/330/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1181, "atom1_serNum": 9810, "atom2_serNum": 9833, "donAcc_type": "standard", "distance": 2.955, "atom1_id": "///D/327/O", "atom2_id": "///D/331/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1182, "atom1_serNum": 9817, "atom2_serNum": 9844, "donAcc_type": "standard", "distance": 3.151, "atom1_id": "///D/328/O", "atom2_id": "///D/332/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1183, "atom1_serNum": 9832, "atom2_serNum": 12168, "donAcc_type": "standard", "distance": 3.908, "atom1_id": "///D/330/NE2", "atom2_id": "///E/177/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1184, "atom1_serNum": 9836, "atom2_serNum": 16887, "donAcc_type": "standard", "distance": 3.393, "atom1_id": "///D/331/O", "atom2_id": "///A/877/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1185, "atom1_serNum": 9863, "atom2_serNum": 9865, "donAcc_type": "standard", "distance": 2.955, "atom1_id": "///D/334/OD1", "atom2_id": "///D/335/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1186, "atom1_serNum": 9864, "atom2_serNum": 10616, "donAcc_type": "standard", "distance": 2.441, "atom1_id": "///D/334/OD2", "atom2_id": "///D/435/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1187, "atom1_serNum": 9871, "atom2_serNum": 12066, "donAcc_type": "questionable", "distance": 2.843, "atom1_id": "///D/335/OD1", "atom2_id": "///E/164/OE2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1188, "atom1_serNum": 9876, "atom2_serNum": 9907, "donAcc_type": "standard", "distance": 2.901, "atom1_id": "///D/336/O", "atom2_id": "///D/340/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1189, "atom1_serNum": 9885, "atom2_serNum": 9915, "donAcc_type": "standard", "distance": 2.924, "atom1_id": "///D/337/O", "atom2_id": "///D/341/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1190, "atom1_serNum": 9902, "atom2_serNum": 11109, "donAcc_type": "standard", "distance": 2.722, "atom1_id": "///D/339/O", "atom2_id": "///E/42/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1191, "atom1_serNum": 9918, "atom2_serNum": 12686, "donAcc_type": "standard", "distance": 2.974, "atom1_id": "///D/341/O", "atom2_id": "///E/242/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1192, "atom1_serNum": 9924, "atom2_serNum": 12209, "donAcc_type": "questionable", "distance": 2.890, "atom1_id": "///D/342/O", "atom2_id": "///E/182/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1193, "atom1_serNum": 9928, "atom2_serNum": 10690, "donAcc_type": "acceptable", "distance": 2.288, "atom1_id": "///D/343/O", "atom2_id": "///D/443/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1194, "atom1_serNum": 9928, "atom2_serNum": 12686, "donAcc_type": "standard", "distance": 3.391, "atom1_id": "///D/343/O", "atom2_id": "///E/242/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1195, "atom1_serNum": 9933, "atom2_serNum": 9961, "donAcc_type": "standard", "distance": 2.944, "atom1_id": "///D/344/N", "atom2_id": "///D/347/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1196, "atom1_serNum": 9936, "atom2_serNum": 9963, "donAcc_type": "standard", "distance": 3.076, "atom1_id": "///D/344/O", "atom2_id": "///D/348/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1197, "atom1_serNum": 9938, "atom2_serNum": 9961, "donAcc_type": "acceptable", "distance": 2.425, "atom1_id": "///D/344/OG", "atom2_id": "///D/347/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1198, "atom1_serNum": 9938, "atom2_serNum": 9962, "donAcc_type": "acceptable", "distance": 3.192, "atom1_id": "///D/344/OG", "atom2_id": "///D/347/OE2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1199, "atom1_serNum": 9942, "atom2_serNum": 9971, "donAcc_type": "standard", "distance": 2.904, "atom1_id": "///D/345/O", "atom2_id": "///D/349/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1200, "atom1_serNum": 9946, "atom2_serNum": 12660, "donAcc_type": "standard", "distance": 3.585, "atom1_id": "///D/346/N", "atom2_id": "///E/239/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1201, "atom1_serNum": 9949, "atom2_serNum": 9977, "donAcc_type": "standard", "distance": 2.951, "atom1_id": "///D/346/O", "atom2_id": "///D/350/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1202, "atom1_serNum": 9957, "atom2_serNum": 9985, "donAcc_type": "standard", "distance": 2.937, "atom1_id": "///D/347/O", "atom2_id": "///D/351/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1203, "atom1_serNum": 9966, "atom2_serNum": 9993, "donAcc_type": "standard", "distance": 2.923, "atom1_id": "///D/348/O", "atom2_id": "///D/352/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1204, "atom1_serNum": 9974, "atom2_serNum": 10001, "donAcc_type": "standard", "distance": 2.950, "atom1_id": "///D/349/O", "atom2_id": "///D/353/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1205, "atom1_serNum": 9980, "atom2_serNum": 10006, "donAcc_type": "standard", "distance": 2.912, "atom1_id": "///D/350/O", "atom2_id": "///D/354/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1206, "atom1_serNum": 9988, "atom2_serNum": 10014, "donAcc_type": "standard", "distance": 2.856, "atom1_id": "///D/351/O", "atom2_id": "///D/355/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1207, "atom1_serNum": 9996, "atom2_serNum": 10023, "donAcc_type": "standard", "distance": 2.942, "atom1_id": "///D/352/O", "atom2_id": "///D/356/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1208, "atom1_serNum": 10004, "atom2_serNum": 10033, "donAcc_type": "standard", "distance": 2.967, "atom1_id": "///D/353/O", "atom2_id": "///D/357/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1209, "atom1_serNum": 10009, "atom2_serNum": 10043, "donAcc_type": "standard", "distance": 2.881, "atom1_id": "///D/354/O", "atom2_id": "///D/358/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1210, "atom1_serNum": 10017, "atom2_serNum": 10049, "donAcc_type": "standard", "distance": 2.894, "atom1_id": "///D/355/O", "atom2_id": "///D/359/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1211, "atom1_serNum": 10026, "atom2_serNum": 10058, "donAcc_type": "standard", "distance": 2.973, "atom1_id": "///D/356/O", "atom2_id": "///D/360/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1212, "atom1_serNum": 10032, "atom2_serNum": 10760, "donAcc_type": "standard", "distance": 3.043, "atom1_id": "///D/356/NE2", "atom2_id": "///D/453/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1213, "atom1_serNum": 10036, "atom2_serNum": 10066, "donAcc_type": "standard", "distance": 3.175, "atom1_id": "///D/357/O", "atom2_id": "///D/361/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1214, "atom1_serNum": 10046, "atom2_serNum": 10086, "donAcc_type": "standard", "distance": 2.976, "atom1_id": "///D/358/O", "atom2_id": "///D/363/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1215, "atom1_serNum": 10095, "atom2_serNum": 10565, "donAcc_type": "standard", "distance": 2.996, "atom1_id": "///D/363/NH1", "atom2_id": "///D/429/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1216, "atom1_serNum": 10096, "atom2_serNum": 10578, "donAcc_type": "standard", "distance": 2.480, "atom1_id": "///D/363/NH2", "atom2_id": "///D/431/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1217, "atom1_serNum": 10111, "atom2_serNum": 10546, "donAcc_type": "standard", "distance": 3.324, "atom1_id": "///D/366/N", "atom2_id": "///D/427/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1218, "atom1_serNum": 10114, "atom2_serNum": 10543, "donAcc_type": "standard", "distance": 3.280, "atom1_id": "///D/366/O", "atom2_id": "///D/427/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1219, "atom1_serNum": 10125, "atom2_serNum": 10158, "donAcc_type": "standard", "distance": 3.300, "atom1_id": "///D/367/O", "atom2_id": "///D/371/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1220, "atom1_serNum": 10128, "atom2_serNum": 10130, "donAcc_type": "standard", "distance": 2.738, "atom1_id": "///D/367/OD1", "atom2_id": "///D/368/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1221, "atom1_serNum": 10128, "atom2_serNum": 10141, "donAcc_type": "standard", "distance": 3.136, "atom1_id": "///D/367/OD1", "atom2_id": "///D/369/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1222, "atom1_serNum": 10128, "atom2_serNum": 10509, "donAcc_type": "questionable", "distance": 2.871, "atom1_id": "///D/367/OD1", "atom2_id": "///D/423/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1223, "atom1_serNum": 10133, "atom2_serNum": 10166, "donAcc_type": "standard", "distance": 2.874, "atom1_id": "///D/368/O", "atom2_id": "///D/372/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1224, "atom1_serNum": 10144, "atom2_serNum": 10178, "donAcc_type": "standard", "distance": 2.933, "atom1_id": "///D/369/O", "atom2_id": "///D/373/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1225, "atom1_serNum": 10148, "atom2_serNum": 10319, "donAcc_type": "standard", "distance": 2.995, "atom1_id": "///D/369/OE1", "atom2_id": "///D/390/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1226, "atom1_serNum": 10149, "atom2_serNum": 10319, "donAcc_type": "standard", "distance": 3.288, "atom1_id": "///D/369/OE2", "atom2_id": "///D/390/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1227, "atom1_serNum": 10149, "atom2_serNum": 10320, "donAcc_type": "standard", "distance": 2.437, "atom1_id": "///D/369/OE2", "atom2_id": "///D/390/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1228, "atom1_serNum": 10153, "atom2_serNum": 10183, "donAcc_type": "standard", "distance": 2.956, "atom1_id": "///D/370/O", "atom2_id": "///D/374/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1229, "atom1_serNum": 10161, "atom2_serNum": 10194, "donAcc_type": "standard", "distance": 2.869, "atom1_id": "///D/371/O", "atom2_id": "///D/375/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1230, "atom1_serNum": 10169, "atom2_serNum": 10205, "donAcc_type": "standard", "distance": 2.873, "atom1_id": "///D/372/O", "atom2_id": "///D/376/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1231, "atom1_serNum": 10169, "atom2_serNum": 10210, "donAcc_type": "acceptable", "distance": 2.990, "atom1_id": "///D/372/O", "atom2_id": "///D/376/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1232, "atom1_serNum": 10181, "atom2_serNum": 10210, "donAcc_type": "acceptable", "distance": 2.837, "atom1_id": "///D/373/O", "atom2_id": "///D/376/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1233, "atom1_serNum": 10181, "atom2_serNum": 10211, "donAcc_type": "standard", "distance": 3.001, "atom1_id": "///D/373/O", "atom2_id": "///D/377/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1234, "atom1_serNum": 10197, "atom2_serNum": 10220, "donAcc_type": "standard", "distance": 3.112, "atom1_id": "///D/375/O", "atom2_id": "///D/378/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1235, "atom1_serNum": 10197, "atom2_serNum": 10231, "donAcc_type": "standard", "distance": 2.836, "atom1_id": "///D/375/O", "atom2_id": "///D/379/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1236, "atom1_serNum": 10208, "atom2_serNum": 10236, "donAcc_type": "standard", "distance": 2.953, "atom1_id": "///D/376/O", "atom2_id": "///D/380/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1237, "atom1_serNum": 10223, "atom2_serNum": 10245, "donAcc_type": "standard", "distance": 3.168, "atom1_id": "///D/378/O", "atom2_id": "///D/381/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1238, "atom1_serNum": 10223, "atom2_serNum": 10252, "donAcc_type": "standard", "distance": 2.884, "atom1_id": "///D/378/O", "atom2_id": "///D/382/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1239, "atom1_serNum": 10234, "atom2_serNum": 10257, "donAcc_type": "acceptable", "distance": 2.827, "atom1_id": "///D/379/O", "atom2_id": "///D/382/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1240, "atom1_serNum": 10255, "atom2_serNum": 10263, "donAcc_type": "acceptable", "distance": 2.663, "atom1_id": "///D/382/O", "atom2_id": "///D/383/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1241, "atom1_serNum": 10257, "atom2_serNum": 10272, "donAcc_type": "acceptable", "distance": 3.182, "atom1_id": "///D/382/OG", "atom2_id": "///D/385/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1242, "atom1_serNum": 10261, "atom2_serNum": 10263, "donAcc_type": "acceptable", "distance": 2.768, "atom1_id": "///D/383/O", "atom2_id": "///D/383/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1243, "atom1_serNum": 10268, "atom2_serNum": 10270, "donAcc_type": "acceptable", "distance": 3.055, "atom1_id": "///D/384/O", "atom2_id": "///D/384/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1244, "atom1_serNum": 10268, "atom2_serNum": 12665, "donAcc_type": "standard", "distance": 2.871, "atom1_id": "///D/384/O", "atom2_id": "///E/239/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1245, "atom1_serNum": 10304, "atom2_serNum": 10335, "donAcc_type": "standard", "distance": 3.394, "atom1_id": "///D/389/O", "atom2_id": "///D/393/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1246, "atom1_serNum": 10308, "atom2_serNum": 12991, "donAcc_type": "questionable", "distance": 2.901, "atom1_id": "///D/389/OE1", "atom2_id": "///E/288/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1247, "atom1_serNum": 10313, "atom2_serNum": 10342, "donAcc_type": "standard", "distance": 2.912, "atom1_id": "///D/390/O", "atom2_id": "///D/394/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1248, "atom1_serNum": 10320, "atom2_serNum": 10513, "donAcc_type": "standard", "distance": 2.849, "atom1_id": "///D/390/NH2", "atom2_id": "///D/423/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1249, "atom1_serNum": 10324, "atom2_serNum": 10350, "donAcc_type": "standard", "distance": 2.928, "atom1_id": "///D/391/O", "atom2_id": "///D/395/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1250, "atom1_serNum": 10330, "atom2_serNum": 10359, "donAcc_type": "standard", "distance": 2.914, "atom1_id": "///D/392/O", "atom2_id": "///D/396/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1251, "atom1_serNum": 10338, "atom2_serNum": 10364, "donAcc_type": "standard", "distance": 2.904, "atom1_id": "///D/393/O", "atom2_id": "///D/397/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1252, "atom1_serNum": 10345, "atom2_serNum": 10375, "donAcc_type": "standard", "distance": 2.963, "atom1_id": "///D/394/O", "atom2_id": "///D/398/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1253, "atom1_serNum": 10353, "atom2_serNum": 10384, "donAcc_type": "standard", "distance": 2.908, "atom1_id": "///D/395/O", "atom2_id": "///D/399/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1254, "atom1_serNum": 10362, "atom2_serNum": 10394, "donAcc_type": "standard", "distance": 2.942, "atom1_id": "///D/396/O", "atom2_id": "///D/400/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1255, "atom1_serNum": 10367, "atom2_serNum": 10402, "donAcc_type": "standard", "distance": 2.949, "atom1_id": "///D/397/O", "atom2_id": "///D/401/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1256, "atom1_serNum": 10378, "atom2_serNum": 10413, "donAcc_type": "standard", "distance": 2.952, "atom1_id": "///D/398/O", "atom2_id": "///D/402/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1257, "atom1_serNum": 10397, "atom2_serNum": 10435, "donAcc_type": "standard", "distance": 3.428, "atom1_id": "///D/400/O", "atom2_id": "///D/405/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1258, "atom1_serNum": 10405, "atom2_serNum": 10426, "donAcc_type": "standard", "distance": 3.287, "atom1_id": "///D/401/O", "atom2_id": "///D/404/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1259, "atom1_serNum": 10429, "atom2_serNum": 12075, "donAcc_type": "standard", "distance": 3.155, "atom1_id": "///D/404/O", "atom2_id": "///E/165/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1260, "atom1_serNum": 10433, "atom2_serNum": 11813, "donAcc_type": "standard", "distance": 2.424, "atom1_id": "///D/404/OE1", "atom2_id": "///E/132/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1261, "atom1_serNum": 10434, "atom2_serNum": 17039, "donAcc_type": "questionable", "distance": 3.224, "atom1_id": "///D/404/OE2", "atom2_id": "///A/897/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1262, "atom1_serNum": 10438, "atom2_serNum": 10570, "donAcc_type": "standard", "distance": 3.170, "atom1_id": "///D/405/O", "atom2_id": "///D/430/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1263, "atom1_serNum": 10451, "atom2_serNum": 10556, "donAcc_type": "standard", "distance": 2.909, "atom1_id": "///D/407/N", "atom2_id": "///D/428/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1264, "atom1_serNum": 10454, "atom2_serNum": 10553, "donAcc_type": "standard", "distance": 2.877, "atom1_id": "///D/407/O", "atom2_id": "///D/428/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1265, "atom1_serNum": 10462, "atom2_serNum": 10474, "donAcc_type": "standard", "distance": 3.100, "atom1_id": "///D/408/O", "atom2_id": "///D/410/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1266, "atom1_serNum": 10491, "atom2_serNum": 10515, "donAcc_type": "standard", "distance": 3.118, "atom1_id": "///D/421/O", "atom2_id": "///D/424/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1267, "atom1_serNum": 10491, "atom2_serNum": 10526, "donAcc_type": "standard", "distance": 3.019, "atom1_id": "///D/421/O", "atom2_id": "///D/425/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1268, "atom1_serNum": 10496, "atom2_serNum": 13774, "donAcc_type": "standard", "distance": 3.405, "atom1_id": "///D/421/NE2", "atom2_id": "///E/434/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1269, "atom1_serNum": 10586, "atom2_serNum": 10617, "donAcc_type": "standard", "distance": 3.583, "atom1_id": "///D/432/O", "atom2_id": "///D/436/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1270, "atom1_serNum": 10593, "atom2_serNum": 10625, "donAcc_type": "standard", "distance": 2.932, "atom1_id": "///D/433/O", "atom2_id": "///D/437/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1271, "atom1_serNum": 10605, "atom2_serNum": 10635, "donAcc_type": "standard", "distance": 2.919, "atom1_id": "///D/434/O", "atom2_id": "///D/438/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1272, "atom1_serNum": 10611, "atom2_serNum": 10645, "donAcc_type": "standard", "distance": 2.930, "atom1_id": "///D/435/O", "atom2_id": "///D/439/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1273, "atom1_serNum": 10620, "atom2_serNum": 10651, "donAcc_type": "standard", "distance": 2.957, "atom1_id": "///D/436/O", "atom2_id": "///D/440/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1274, "atom1_serNum": 10638, "atom2_serNum": 10668, "donAcc_type": "standard", "distance": 2.956, "atom1_id": "///D/438/O", "atom2_id": "///D/442/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1275, "atom1_serNum": 10641, "atom2_serNum": 10666, "donAcc_type": "acceptable", "distance": 3.834, "atom1_id": "///D/438/ND1", "atom2_id": "///D/441/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1276, "atom1_serNum": 10648, "atom2_serNum": 10679, "donAcc_type": "standard", "distance": 3.020, "atom1_id": "///D/439/O", "atom2_id": "///D/443/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1277, "atom1_serNum": 10716, "atom2_serNum": 10743, "donAcc_type": "standard", "distance": 3.219, "atom1_id": "///D/447/O", "atom2_id": "///D/451/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1278, "atom1_serNum": 10723, "atom2_serNum": 10748, "donAcc_type": "standard", "distance": 2.910, "atom1_id": "///D/448/O", "atom2_id": "///D/452/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1279, "atom1_serNum": 10730, "atom2_serNum": 10757, "donAcc_type": "standard", "distance": 2.922, "atom1_id": "///D/449/O", "atom2_id": "///D/453/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1280, "atom1_serNum": 10739, "atom2_serNum": 10771, "donAcc_type": "standard", "distance": 2.908, "atom1_id": "///D/450/O", "atom2_id": "///D/454/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1281, "atom1_serNum": 10751, "atom2_serNum": 10785, "donAcc_type": "standard", "distance": 3.680, "atom1_id": "///D/452/O", "atom2_id": "///D/456/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1282, "atom1_serNum": 10788, "atom2_serNum": 10790, "donAcc_type": "acceptable", "distance": 2.394, "atom1_id": "///D/456/O", "atom2_id": "///D/456/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1283, "atom1_serNum": 10795, "atom2_serNum": 10822, "donAcc_type": "standard", "distance": 3.685, "atom1_id": "///E/1/O", "atom2_id": "///E/5/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1284, "atom1_serNum": 10803, "atom2_serNum": 10828, "donAcc_type": "standard", "distance": 2.918, "atom1_id": "///E/2/O", "atom2_id": "///E/6/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1285, "atom1_serNum": 10812, "atom2_serNum": 10834, "donAcc_type": "standard", "distance": 2.898, "atom1_id": "///E/3/O", "atom2_id": "///E/7/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1286, "atom1_serNum": 10817, "atom2_serNum": 10840, "donAcc_type": "standard", "distance": 2.944, "atom1_id": "///E/4/O", "atom2_id": "///E/8/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1287, "atom1_serNum": 10825, "atom2_serNum": 10848, "donAcc_type": "standard", "distance": 3.168, "atom1_id": "///E/5/O", "atom2_id": "///E/9/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1288, "atom1_serNum": 10837, "atom2_serNum": 10839, "donAcc_type": "acceptable", "distance": 2.651, "atom1_id": "///E/7/O", "atom2_id": "///E/7/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1289, "atom1_serNum": 10843, "atom2_serNum": 10872, "donAcc_type": "standard", "distance": 3.124, "atom1_id": "///E/8/O", "atom2_id": "///E/12/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1290, "atom1_serNum": 10875, "atom2_serNum": 10896, "donAcc_type": "standard", "distance": 3.619, "atom1_id": "///E/12/O", "atom2_id": "///E/15/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1291, "atom1_serNum": 10886, "atom2_serNum": 21657, "donAcc_type": "standard", "distance": 2.870, "atom1_id": "///E/13/O", "atom2_id": "///E/901/N6", "atom_pair": "O:N", "residue_pair": "aa:ligand" }, { "index": 1292, "atom1_serNum": 10899, "atom2_serNum": 10926, "donAcc_type": "standard", "distance": 2.962, "atom1_id": "///E/15/O", "atom2_id": "///E/19/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1293, "atom1_serNum": 10903, "atom2_serNum": 12222, "donAcc_type": "acceptable", "distance": 3.109, "atom1_id": "///E/15/NE", "atom2_id": "///E/183/OH", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1294, "atom1_serNum": 10905, "atom2_serNum": 12200, "donAcc_type": "standard", "distance": 3.285, "atom1_id": "///E/15/NH1", "atom2_id": "///E/181/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1295, "atom1_serNum": 10906, "atom2_serNum": 11123, "donAcc_type": "standard", "distance": 3.746, "atom1_id": "///E/15/NH2", "atom2_id": "///E/45/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1296, "atom1_serNum": 10906, "atom2_serNum": 12200, "donAcc_type": "standard", "distance": 2.382, "atom1_id": "///E/15/NH2", "atom2_id": "///E/181/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1297, "atom1_serNum": 10907, "atom2_serNum": 10914, "donAcc_type": "standard", "distance": 2.892, "atom1_id": "///E/16/N", "atom2_id": "///E/16/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1298, "atom1_serNum": 10910, "atom2_serNum": 10934, "donAcc_type": "standard", "distance": 2.923, "atom1_id": "///E/16/O", "atom2_id": "///E/20/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1299, "atom1_serNum": 10915, "atom2_serNum": 12280, "donAcc_type": "standard", "distance": 3.611, "atom1_id": "///E/16/OE2", "atom2_id": "///E/190/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1300, "atom1_serNum": 10919, "atom2_serNum": 10943, "donAcc_type": "standard", "distance": 2.930, "atom1_id": "///E/17/O", "atom2_id": "///E/21/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1301, "atom1_serNum": 10919, "atom2_serNum": 10948, "donAcc_type": "acceptable", "distance": 2.876, "atom1_id": "///E/17/O", "atom2_id": "///E/21/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1302, "atom1_serNum": 10924, "atom2_serNum": 10950, "donAcc_type": "standard", "distance": 2.931, "atom1_id": "///E/18/O", "atom2_id": "///E/22/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1303, "atom1_serNum": 10929, "atom2_serNum": 10958, "donAcc_type": "standard", "distance": 2.869, "atom1_id": "///E/19/O", "atom2_id": "///E/23/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1304, "atom1_serNum": 10937, "atom2_serNum": 10962, "donAcc_type": "standard", "distance": 2.927, "atom1_id": "///E/20/O", "atom2_id": "///E/24/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1305, "atom1_serNum": 10946, "atom2_serNum": 10971, "donAcc_type": "standard", "distance": 2.960, "atom1_id": "///E/21/O", "atom2_id": "///E/25/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1306, "atom1_serNum": 10953, "atom2_serNum": 10979, "donAcc_type": "standard", "distance": 2.928, "atom1_id": "///E/22/O", "atom2_id": "///E/26/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1307, "atom1_serNum": 10990, "atom2_serNum": 11257, "donAcc_type": "questionable", "distance": 3.088, "atom1_id": "///E/27/O", "atom2_id": "///E/62/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1308, "atom1_serNum": 10994, "atom2_serNum": 11038, "donAcc_type": "acceptable", "distance": 3.950, "atom1_id": "///E/28/O", "atom2_id": "///E/33/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1309, "atom1_serNum": 10997, "atom2_serNum": 10999, "donAcc_type": "standard", "distance": 2.940, "atom1_id": "///E/28/OD1", "atom2_id": "///E/29/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1310, "atom1_serNum": 10997, "atom2_serNum": 11005, "donAcc_type": "standard", "distance": 3.397, "atom1_id": "///E/28/OD1", "atom2_id": "///E/30/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1311, "atom1_serNum": 11002, "atom2_serNum": 11971, "donAcc_type": "standard", "distance": 3.217, "atom1_id": "///E/29/O", "atom2_id": "///E/152/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1312, "atom1_serNum": 11004, "atom2_serNum": 11697, "donAcc_type": "acceptable", "distance": 3.039, "atom1_id": "///E/29/OG", "atom2_id": "///E/118/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1313, "atom1_serNum": 11014, "atom2_serNum": 11971, "donAcc_type": "standard", "distance": 3.554, "atom1_id": "///E/31/O", "atom2_id": "///E/152/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1314, "atom1_serNum": 11025, "atom2_serNum": 11923, "donAcc_type": "acceptable", "distance": 3.526, "atom1_id": "///E/32/OG1", "atom2_id": "///E/146/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1315, "atom1_serNum": 11027, "atom2_serNum": 11970, "donAcc_type": "standard", "distance": 3.179, "atom1_id": "///E/33/N", "atom2_id": "///E/152/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1316, "atom1_serNum": 11051, "atom2_serNum": 11891, "donAcc_type": "acceptable", "distance": 3.119, "atom1_id": "///E/35/OG", "atom2_id": "///E/143/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1317, "atom1_serNum": 11055, "atom2_serNum": 12158, "donAcc_type": "standard", "distance": 2.935, "atom1_id": "///E/36/O", "atom2_id": "///E/176/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1318, "atom1_serNum": 11057, "atom2_serNum": 11989, "donAcc_type": "standard", "distance": 3.390, "atom1_id": "///E/37/N", "atom2_id": "///E/155/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1319, "atom1_serNum": 11060, "atom2_serNum": 12001, "donAcc_type": "standard", "distance": 2.888, "atom1_id": "///E/37/O", "atom2_id": "///E/157/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1320, "atom1_serNum": 11065, "atom2_serNum": 12161, "donAcc_type": "standard", "distance": 2.903, "atom1_id": "///E/38/N", "atom2_id": "///E/176/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1321, "atom1_serNum": 11068, "atom2_serNum": 12171, "donAcc_type": "standard", "distance": 2.853, "atom1_id": "///E/38/O", "atom2_id": "///E/178/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1322, "atom1_serNum": 11076, "atom2_serNum": 12035, "donAcc_type": "acceptable", "distance": 2.326, "atom1_id": "///E/38/OH", "atom2_id": "///E/161/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1323, "atom1_serNum": 11077, "atom2_serNum": 12004, "donAcc_type": "standard", "distance": 3.365, "atom1_id": "///E/39/N", "atom2_id": "///E/157/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1324, "atom1_serNum": 11080, "atom2_serNum": 12004, "donAcc_type": "questionable", "distance": 3.358, "atom1_id": "///E/39/O", "atom2_id": "///E/157/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1325, "atom1_serNum": 11080, "atom2_serNum": 12017, "donAcc_type": "standard", "distance": 3.863, "atom1_id": "///E/39/O", "atom2_id": "///E/159/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1326, "atom1_serNum": 11085, "atom2_serNum": 12174, "donAcc_type": "standard", "distance": 2.926, "atom1_id": "///E/40/N", "atom2_id": "///E/178/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1327, "atom1_serNum": 11088, "atom2_serNum": 12189, "donAcc_type": "standard", "distance": 2.782, "atom1_id": "///E/40/O", "atom2_id": "///E/180/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1328, "atom1_serNum": 11096, "atom2_serNum": 12020, "donAcc_type": "standard", "distance": 3.549, "atom1_id": "///E/41/N", "atom2_id": "///E/159/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1329, "atom1_serNum": 11103, "atom2_serNum": 11125, "donAcc_type": "acceptable", "distance": 2.516, "atom1_id": "///E/42/O", "atom2_id": "///E/45/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1330, "atom1_serNum": 11103, "atom2_serNum": 11139, "donAcc_type": "standard", "distance": 2.857, "atom1_id": "///E/42/O", "atom2_id": "///E/47/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1331, "atom1_serNum": 11113, "atom2_serNum": 12210, "donAcc_type": "standard", "distance": 3.053, "atom1_id": "///E/43/O", "atom2_id": "///E/182/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1332, "atom1_serNum": 11115, "atom2_serNum": 12030, "donAcc_type": "acceptable", "distance": 3.102, "atom1_id": "///E/43/OG", "atom2_id": "///E/160/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1333, "atom1_serNum": 11116, "atom2_serNum": 21638, "donAcc_type": "standard", "distance": 3.531, "atom1_id": "///E/44/N", "atom2_id": "///E/901/O3B", "atom_pair": "N:O", "residue_pair": "aa:ligand" }, { "index": 1334, "atom1_serNum": 11127, "atom2_serNum": 21642, "donAcc_type": "standard", "distance": 3.486, "atom1_id": "///E/46/N", "atom2_id": "///E/901/O3A", "atom_pair": "N:O", "residue_pair": "aa:ligand" }, { "index": 1335, "atom1_serNum": 11134, "atom2_serNum": 11160, "donAcc_type": "standard", "distance": 2.944, "atom1_id": "///E/47/O", "atom2_id": "///E/51/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1336, "atom1_serNum": 11134, "atom2_serNum": 11165, "donAcc_type": "acceptable", "distance": 3.106, "atom1_id": "///E/47/O", "atom2_id": "///E/51/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1337, "atom1_serNum": 11139, "atom2_serNum": 21636, "donAcc_type": "acceptable", "distance": 2.636, "atom1_id": "///E/47/NZ", "atom2_id": "///E/901/O1B", "atom_pair": "N:O", "residue_pair": "aa:ligand" }, { "index": 1338, "atom1_serNum": 11143, "atom2_serNum": 11165, "donAcc_type": "acceptable", "distance": 3.173, "atom1_id": "///E/48/O", "atom2_id": "///E/51/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1339, "atom1_serNum": 11143, "atom2_serNum": 11167, "donAcc_type": "standard", "distance": 2.914, "atom1_id": "///E/48/O", "atom2_id": "///E/52/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1340, "atom1_serNum": 11145, "atom2_serNum": 11761, "donAcc_type": "acceptable", "distance": 2.332, "atom1_id": "///E/48/OG1", "atom2_id": "///E/126/OD2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1341, "atom1_serNum": 11147, "atom2_serNum": 21641, "donAcc_type": "acceptable", "distance": 3.209, "atom1_id": "///E/49/N", "atom2_id": "///E/901/O2A", "atom_pair": "N:O", "residue_pair": "aa:ligand" }, { "index": 1342, "atom1_serNum": 11150, "atom2_serNum": 11178, "donAcc_type": "standard", "distance": 2.945, "atom1_id": "///E/49/O", "atom2_id": "///E/53/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1343, "atom1_serNum": 11155, "atom2_serNum": 11183, "donAcc_type": "standard", "distance": 2.888, "atom1_id": "///E/50/O", "atom2_id": "///E/54/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1344, "atom1_serNum": 11163, "atom2_serNum": 11194, "donAcc_type": "standard", "distance": 2.884, "atom1_id": "///E/51/O", "atom2_id": "///E/55/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1345, "atom1_serNum": 11170, "atom2_serNum": 11202, "donAcc_type": "standard", "distance": 2.923, "atom1_id": "///E/52/O", "atom2_id": "///E/56/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1346, "atom1_serNum": 11181, "atom2_serNum": 11211, "donAcc_type": "standard", "distance": 2.952, "atom1_id": "///E/53/O", "atom2_id": "///E/57/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1347, "atom1_serNum": 11186, "atom2_serNum": 11220, "donAcc_type": "standard", "distance": 2.913, "atom1_id": "///E/54/O", "atom2_id": "///E/58/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1348, "atom1_serNum": 11197, "atom2_serNum": 11226, "donAcc_type": "standard", "distance": 2.910, "atom1_id": "///E/55/O", "atom2_id": "///E/59/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1349, "atom1_serNum": 11205, "atom2_serNum": 11230, "donAcc_type": "standard", "distance": 2.937, "atom1_id": "///E/56/O", "atom2_id": "///E/60/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1350, "atom1_serNum": 11214, "atom2_serNum": 11239, "donAcc_type": "standard", "distance": 2.909, "atom1_id": "///E/57/O", "atom2_id": "///E/61/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1351, "atom1_serNum": 11223, "atom2_serNum": 11250, "donAcc_type": "standard", "distance": 3.024, "atom1_id": "///E/58/O", "atom2_id": "///E/62/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1352, "atom1_serNum": 11266, "atom2_serNum": 11688, "donAcc_type": "standard", "distance": 3.386, "atom1_id": "///E/63/ND2", "atom2_id": "///E/117/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1353, "atom1_serNum": 11274, "atom2_serNum": 11714, "donAcc_type": "standard", "distance": 2.902, "atom1_id": "///E/65/N", "atom2_id": "///E/120/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1354, "atom1_serNum": 11277, "atom2_serNum": 11726, "donAcc_type": "standard", "distance": 2.889, "atom1_id": "///E/65/O", "atom2_id": "///E/122/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1355, "atom1_serNum": 11283, "atom2_serNum": 11460, "donAcc_type": "standard", "distance": 2.980, "atom1_id": "///E/65/NH1", "atom2_id": "///E/88/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1356, "atom1_serNum": 11283, "atom2_serNum": 11648, "donAcc_type": "standard", "distance": 2.873, "atom1_id": "///E/65/NH1", "atom2_id": "///E/111/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1357, "atom1_serNum": 11292, "atom2_serNum": 11729, "donAcc_type": "standard", "distance": 2.917, "atom1_id": "///E/67/N", "atom2_id": "///E/122/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1358, "atom1_serNum": 11295, "atom2_serNum": 11742, "donAcc_type": "standard", "distance": 2.901, "atom1_id": "///E/67/O", "atom2_id": "///E/124/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1359, "atom1_serNum": 11307, "atom2_serNum": 11745, "donAcc_type": "standard", "distance": 2.871, "atom1_id": "///E/69/N", "atom2_id": "///E/124/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1360, "atom1_serNum": 11310, "atom2_serNum": 11754, "donAcc_type": "standard", "distance": 2.866, "atom1_id": "///E/69/O", "atom2_id": "///E/126/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1361, "atom1_serNum": 11318, "atom2_serNum": 11336, "donAcc_type": "standard", "distance": 3.094, "atom1_id": "///E/70/O", "atom2_id": "///E/73/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1362, "atom1_serNum": 11321, "atom2_serNum": 11769, "donAcc_type": "standard", "distance": 3.290, "atom1_id": "///E/70/OD1", "atom2_id": "///E/127/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1363, "atom1_serNum": 11323, "atom2_serNum": 11757, "donAcc_type": "standard", "distance": 2.982, "atom1_id": "///E/71/N", "atom2_id": "///E/126/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1364, "atom1_serNum": 11339, "atom2_serNum": 11351, "donAcc_type": "standard", "distance": 3.131, "atom1_id": "///E/73/O", "atom2_id": "///E/75/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1365, "atom1_serNum": 11366, "atom2_serNum": 11394, "donAcc_type": "standard", "distance": 3.837, "atom1_id": "///E/76/O", "atom2_id": "///E/80/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1366, "atom1_serNum": 11373, "atom2_serNum": 11375, "donAcc_type": "acceptable", "distance": 2.956, "atom1_id": "///E/77/O", "atom2_id": "///E/77/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1367, "atom1_serNum": 11373, "atom2_serNum": 11402, "donAcc_type": "standard", "distance": 2.978, "atom1_id": "///E/77/O", "atom2_id": "///E/81/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1368, "atom1_serNum": 11380, "atom2_serNum": 11410, "donAcc_type": "standard", "distance": 2.934, "atom1_id": "///E/78/O", "atom2_id": "///E/82/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1369, "atom1_serNum": 11385, "atom2_serNum": 11418, "donAcc_type": "standard", "distance": 2.511, "atom1_id": "///E/78/NZ", "atom2_id": "///E/82/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1370, "atom1_serNum": 11389, "atom2_serNum": 11419, "donAcc_type": "standard", "distance": 3.003, "atom1_id": "///E/79/O", "atom2_id": "///E/83/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1371, "atom1_serNum": 11397, "atom2_serNum": 11427, "donAcc_type": "standard", "distance": 2.893, "atom1_id": "///E/80/O", "atom2_id": "///E/84/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1372, "atom1_serNum": 11405, "atom2_serNum": 11435, "donAcc_type": "standard", "distance": 2.944, "atom1_id": "///E/81/O", "atom2_id": "///E/85/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1373, "atom1_serNum": 11413, "atom2_serNum": 11443, "donAcc_type": "standard", "distance": 2.882, "atom1_id": "///E/82/O", "atom2_id": "///E/86/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1374, "atom1_serNum": 11422, "atom2_serNum": 11451, "donAcc_type": "standard", "distance": 3.029, "atom1_id": "///E/83/O", "atom2_id": "///E/87/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1375, "atom1_serNum": 11422, "atom2_serNum": 11456, "donAcc_type": "acceptable", "distance": 3.095, "atom1_id": "///E/83/O", "atom2_id": "///E/87/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1376, "atom1_serNum": 11430, "atom2_serNum": 11457, "donAcc_type": "standard", "distance": 2.991, "atom1_id": "///E/84/O", "atom2_id": "///E/88/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1377, "atom1_serNum": 11438, "atom2_serNum": 11465, "donAcc_type": "standard", "distance": 3.081, "atom1_id": "///E/85/O", "atom2_id": "///E/89/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1378, "atom1_serNum": 11468, "atom2_serNum": 11485, "donAcc_type": "standard", "distance": 3.807, "atom1_id": "///E/89/O", "atom2_id": "///E/92/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1379, "atom1_serNum": 11488, "atom2_serNum": 11506, "donAcc_type": "standard", "distance": 3.600, "atom1_id": "///E/92/O", "atom2_id": "///E/95/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1380, "atom1_serNum": 11493, "atom2_serNum": 11609, "donAcc_type": "standard", "distance": 3.601, "atom1_id": "///E/92/NE2", "atom2_id": "///E/107/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1381, "atom1_serNum": 11497, "atom2_serNum": 11511, "donAcc_type": "standard", "distance": 3.746, "atom1_id": "///E/93/O", "atom2_id": "///E/96/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1382, "atom1_serNum": 11522, "atom2_serNum": 11610, "donAcc_type": "standard", "distance": 3.149, "atom1_id": "///E/97/O", "atom2_id": "///E/107/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1383, "atom1_serNum": 11543, "atom2_serNum": 11549, "donAcc_type": "standard", "distance": 2.691, "atom1_id": "///E/100/N", "atom2_id": "///E/100/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1384, "atom1_serNum": 11546, "atom2_serNum": 11575, "donAcc_type": "standard", "distance": 3.445, "atom1_id": "///E/100/O", "atom2_id": "///E/104/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1385, "atom1_serNum": 11549, "atom2_serNum": 11567, "donAcc_type": "standard", "distance": 3.323, "atom1_id": "///E/100/OD1", "atom2_id": "///E/103/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1386, "atom1_serNum": 11554, "atom2_serNum": 11586, "donAcc_type": "standard", "distance": 3.207, "atom1_id": "///E/101/O", "atom2_id": "///E/105/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1387, "atom1_serNum": 11562, "atom2_serNum": 11593, "donAcc_type": "standard", "distance": 2.953, "atom1_id": "///E/102/O", "atom2_id": "///E/106/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1388, "atom1_serNum": 11570, "atom2_serNum": 11602, "donAcc_type": "standard", "distance": 2.925, "atom1_id": "///E/103/O", "atom2_id": "///E/107/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1389, "atom1_serNum": 11573, "atom2_serNum": 11610, "donAcc_type": "standard", "distance": 2.629, "atom1_id": "///E/103/OD1", "atom2_id": "///E/107/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1390, "atom1_serNum": 11578, "atom2_serNum": 11611, "donAcc_type": "standard", "distance": 2.935, "atom1_id": "///E/104/O", "atom2_id": "///E/108/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1391, "atom1_serNum": 11589, "atom2_serNum": 11619, "donAcc_type": "standard", "distance": 2.883, "atom1_id": "///E/105/O", "atom2_id": "///E/109/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1392, "atom1_serNum": 11596, "atom2_serNum": 11630, "donAcc_type": "standard", "distance": 3.009, "atom1_id": "///E/106/O", "atom2_id": "///E/110/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1393, "atom1_serNum": 11601, "atom2_serNum": 11628, "donAcc_type": "standard", "distance": 2.758, "atom1_id": "///E/106/OE2", "atom2_id": "///E/109/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1394, "atom1_serNum": 11605, "atom2_serNum": 11649, "donAcc_type": "standard", "distance": 3.697, "atom1_id": "///E/107/O", "atom2_id": "///E/111/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1395, "atom1_serNum": 11622, "atom2_serNum": 11650, "donAcc_type": "standard", "distance": 3.575, "atom1_id": "///E/109/O", "atom2_id": "///E/112/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1396, "atom1_serNum": 11626, "atom2_serNum": 11936, "donAcc_type": "standard", "distance": 2.944, "atom1_id": "///E/109/NE", "atom2_id": "///E/148/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1397, "atom1_serNum": 11629, "atom2_serNum": 11936, "donAcc_type": "standard", "distance": 3.166, "atom1_id": "///E/109/NH2", "atom2_id": "///E/148/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1398, "atom1_serNum": 11644, "atom2_serNum": 11710, "donAcc_type": "standard", "distance": 3.030, "atom1_id": "///E/111/O", "atom2_id": "///E/119/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1399, "atom1_serNum": 11670, "atom2_serNum": 11700, "donAcc_type": "questionable", "distance": 2.914, "atom1_id": "///E/115/O", "atom2_id": "///E/118/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1400, "atom1_serNum": 11705, "atom2_serNum": 11971, "donAcc_type": "standard", "distance": 3.828, "atom1_id": "///E/119/O", "atom2_id": "///E/152/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1401, "atom1_serNum": 11715, "atom2_serNum": 11967, "donAcc_type": "standard", "distance": 2.891, "atom1_id": "///E/121/N", "atom2_id": "///E/152/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1402, "atom1_serNum": 11718, "atom2_serNum": 11980, "donAcc_type": "standard", "distance": 3.418, "atom1_id": "///E/121/O", "atom2_id": "///E/154/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1403, "atom1_serNum": 11734, "atom2_serNum": 11983, "donAcc_type": "standard", "distance": 3.079, "atom1_id": "///E/123/N", "atom2_id": "///E/154/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1404, "atom1_serNum": 11737, "atom2_serNum": 11993, "donAcc_type": "standard", "distance": 2.547, "atom1_id": "///E/123/O", "atom2_id": "///E/156/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1405, "atom1_serNum": 11747, "atom2_serNum": 11996, "donAcc_type": "standard", "distance": 3.068, "atom1_id": "///E/125/N", "atom2_id": "///E/156/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1406, "atom1_serNum": 11750, "atom2_serNum": 12009, "donAcc_type": "standard", "distance": 3.036, "atom1_id": "///E/125/O", "atom2_id": "///E/158/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1407, "atom1_serNum": 11760, "atom2_serNum": 11762, "donAcc_type": "standard", "distance": 2.771, "atom1_id": "///E/126/OD1", "atom2_id": "///E/127/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1408, "atom1_serNum": 11762, "atom2_serNum": 12012, "donAcc_type": "standard", "distance": 3.101, "atom1_id": "///E/127/N", "atom2_id": "///E/158/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1409, "atom1_serNum": 11765, "atom2_serNum": 11784, "donAcc_type": "standard", "distance": 3.304, "atom1_id": "///E/127/O", "atom2_id": "///E/130/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1410, "atom1_serNum": 11770, "atom2_serNum": 12012, "donAcc_type": "standard", "distance": 2.713, "atom1_id": "///E/128/N", "atom2_id": "///E/158/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1411, "atom1_serNum": 11773, "atom2_serNum": 11795, "donAcc_type": "standard", "distance": 3.091, "atom1_id": "///E/128/O", "atom2_id": "///E/131/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1412, "atom1_serNum": 11778, "atom2_serNum": 11812, "donAcc_type": "standard", "distance": 3.092, "atom1_id": "///E/129/O", "atom2_id": "///E/132/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1413, "atom1_serNum": 11782, "atom2_serNum": 12022, "donAcc_type": "acceptable", "distance": 3.155, "atom1_id": "///E/129/OE1", "atom2_id": "///E/159/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1414, "atom1_serNum": 11787, "atom2_serNum": 11814, "donAcc_type": "standard", "distance": 3.179, "atom1_id": "///E/130/O", "atom2_id": "///E/133/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1415, "atom1_serNum": 11806, "atom2_serNum": 17046, "donAcc_type": "standard", "distance": 3.156, "atom1_id": "///E/132/O", "atom2_id": "///A/897/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1416, "atom1_serNum": 11820, "atom2_serNum": 17045, "donAcc_type": "standard", "distance": 2.960, "atom1_id": "///E/133/OD1", "atom2_id": "///A/897/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1417, "atom1_serNum": 11820, "atom2_serNum": 17046, "donAcc_type": "standard", "distance": 2.427, "atom1_id": "///E/133/OD1", "atom2_id": "///A/897/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1418, "atom1_serNum": 11854, "atom2_serNum": 11880, "donAcc_type": "standard", "distance": 2.918, "atom1_id": "///E/138/O", "atom2_id": "///E/142/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1419, "atom1_serNum": 11861, "atom2_serNum": 11888, "donAcc_type": "standard", "distance": 3.017, "atom1_id": "///E/139/O", "atom2_id": "///E/143/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1420, "atom1_serNum": 11876, "atom2_serNum": 11896, "donAcc_type": "standard", "distance": 3.097, "atom1_id": "///E/141/O", "atom2_id": "///E/144/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1421, "atom1_serNum": 11876, "atom2_serNum": 11907, "donAcc_type": "standard", "distance": 2.947, "atom1_id": "///E/141/O", "atom2_id": "///E/145/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1422, "atom1_serNum": 11899, "atom2_serNum": 11933, "donAcc_type": "standard", "distance": 3.150, "atom1_id": "///E/144/O", "atom2_id": "///E/148/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1423, "atom1_serNum": 11905, "atom2_serNum": 21602, "donAcc_type": "acceptable", "distance": 2.415, "atom1_id": "///E/144/NH1", "atom2_id": "///D/901/O3G", "atom_pair": "N:O", "residue_pair": "aa:ligand" }, { "index": 1424, "atom1_serNum": 11906, "atom2_serNum": 21602, "donAcc_type": "acceptable", "distance": 3.178, "atom1_id": "///E/144/NH2", "atom2_id": "///D/901/O3G", "atom_pair": "N:O", "residue_pair": "aa:ligand" }, { "index": 1425, "atom1_serNum": 11910, "atom2_serNum": 11941, "donAcc_type": "standard", "distance": 2.927, "atom1_id": "///E/145/O", "atom2_id": "///E/149/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1426, "atom1_serNum": 11910, "atom2_serNum": 11946, "donAcc_type": "acceptable", "distance": 2.585, "atom1_id": "///E/145/O", "atom2_id": "///E/149/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1427, "atom1_serNum": 11918, "atom2_serNum": 11948, "donAcc_type": "standard", "distance": 3.104, "atom1_id": "///E/146/O", "atom2_id": "///E/150/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1428, "atom1_serNum": 11918, "atom2_serNum": 11956, "donAcc_type": "standard", "distance": 3.344, "atom1_id": "///E/146/O", "atom2_id": "///E/151/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1429, "atom1_serNum": 11931, "atom2_serNum": 21609, "donAcc_type": "acceptable", "distance": 3.555, "atom1_id": "///E/147/OE1", "atom2_id": "///D/901/O2A", "atom_pair": "O:O", "residue_pair": "aa:ligand" }, { "index": 1430, "atom1_serNum": 11959, "atom2_serNum": 11972, "donAcc_type": "standard", "distance": 2.817, "atom1_id": "///E/151/O", "atom2_id": "///E/153/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1431, "atom1_serNum": 12043, "atom2_serNum": 12067, "donAcc_type": "standard", "distance": 3.298, "atom1_id": "///E/162/O", "atom2_id": "///E/165/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1432, "atom1_serNum": 12050, "atom2_serNum": 12076, "donAcc_type": "standard", "distance": 3.043, "atom1_id": "///E/163/O", "atom2_id": "///E/166/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1433, "atom1_serNum": 12061, "atom2_serNum": 17035, "donAcc_type": "acceptable", "distance": 2.358, "atom1_id": "///E/164/O", "atom2_id": "///A/896/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1434, "atom1_serNum": 12065, "atom2_serNum": 17062, "donAcc_type": "questionable", "distance": 3.150, "atom1_id": "///E/164/OE1", "atom2_id": "///A/899/OD2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1435, "atom1_serNum": 12075, "atom2_serNum": 17061, "donAcc_type": "standard", "distance": 3.115, "atom1_id": "///E/165/NZ", "atom2_id": "///A/899/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1436, "atom1_serNum": 12075, "atom2_serNum": 17062, "donAcc_type": "standard", "distance": 2.784, "atom1_id": "///E/165/NZ", "atom2_id": "///A/899/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1437, "atom1_serNum": 12090, "atom2_serNum": 17030, "donAcc_type": "standard", "distance": 2.981, "atom1_id": "///E/167/O", "atom2_id": "///A/896/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1438, "atom1_serNum": 12099, "atom2_serNum": 12105, "donAcc_type": "standard", "distance": 2.631, "atom1_id": "///E/168/N", "atom2_id": "///E/168/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1439, "atom1_serNum": 12102, "atom2_serNum": 16934, "donAcc_type": "acceptable", "distance": 3.909, "atom1_id": "///E/168/O", "atom2_id": "///A/883/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1440, "atom1_serNum": 12105, "atom2_serNum": 12126, "donAcc_type": "questionable", "distance": 2.963, "atom1_id": "///E/168/OD1", "atom2_id": "///E/171/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1441, "atom1_serNum": 12110, "atom2_serNum": 16956, "donAcc_type": "standard", "distance": 3.661, "atom1_id": "///E/169/O", "atom2_id": "///A/887/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1442, "atom1_serNum": 12115, "atom2_serNum": 19925, "donAcc_type": "standard", "distance": 3.949, "atom1_id": "///E/169/NZ", "atom2_id": "///G/625/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1443, "atom1_serNum": 12148, "atom2_serNum": 16913, "donAcc_type": "standard", "distance": 3.398, "atom1_id": "///E/174/OE1", "atom2_id": "///A/880/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1444, "atom1_serNum": 12149, "atom2_serNum": 16913, "donAcc_type": "standard", "distance": 2.362, "atom1_id": "///E/174/OE2", "atom2_id": "///A/880/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1445, "atom1_serNum": 12214, "atom2_serNum": 12656, "donAcc_type": "acceptable", "distance": 2.485, "atom1_id": "///E/183/O", "atom2_id": "///E/238/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1446, "atom1_serNum": 12214, "atom2_serNum": 12684, "donAcc_type": "standard", "distance": 3.123, "atom1_id": "///E/183/O", "atom2_id": "///E/242/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1447, "atom1_serNum": 12214, "atom2_serNum": 12687, "donAcc_type": "standard", "distance": 2.567, "atom1_id": "///E/183/O", "atom2_id": "///E/242/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1448, "atom1_serNum": 12222, "atom2_serNum": 21654, "donAcc_type": "acceptable", "distance": 2.841, "atom1_id": "///E/183/OH", "atom2_id": "///E/901/N7", "atom_pair": "O:N", "residue_pair": "aa:ligand" }, { "index": 1449, "atom1_serNum": 12222, "atom2_serNum": 21657, "donAcc_type": "acceptable", "distance": 2.493, "atom1_id": "///E/183/OH", "atom2_id": "///E/901/N6", "atom_pair": "O:N", "residue_pair": "aa:ligand" }, { "index": 1450, "atom1_serNum": 12223, "atom2_serNum": 12229, "donAcc_type": "standard", "distance": 2.624, "atom1_id": "///E/184/N", "atom2_id": "///E/184/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1451, "atom1_serNum": 12226, "atom2_serNum": 12254, "donAcc_type": "standard", "distance": 2.974, "atom1_id": "///E/184/O", "atom2_id": "///E/188/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1452, "atom1_serNum": 12226, "atom2_serNum": 12259, "donAcc_type": "acceptable", "distance": 2.430, "atom1_id": "///E/184/O", "atom2_id": "///E/188/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1453, "atom1_serNum": 12229, "atom2_serNum": 12245, "donAcc_type": "standard", "distance": 3.393, "atom1_id": "///E/184/OD1", "atom2_id": "///E/187/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1454, "atom1_serNum": 12234, "atom2_serNum": 12261, "donAcc_type": "standard", "distance": 2.940, "atom1_id": "///E/185/O", "atom2_id": "///E/189/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1455, "atom1_serNum": 12243, "atom2_serNum": 12270, "donAcc_type": "standard", "distance": 2.935, "atom1_id": "///E/186/O", "atom2_id": "///E/190/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1456, "atom1_serNum": 12248, "atom2_serNum": 12281, "donAcc_type": "standard", "distance": 2.910, "atom1_id": "///E/187/O", "atom2_id": "///E/191/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1457, "atom1_serNum": 12257, "atom2_serNum": 12289, "donAcc_type": "standard", "distance": 2.906, "atom1_id": "///E/188/O", "atom2_id": "///E/192/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1458, "atom1_serNum": 12259, "atom2_serNum": 12656, "donAcc_type": "acceptable", "distance": 3.348, "atom1_id": "///E/188/OG1", "atom2_id": "///E/238/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1459, "atom1_serNum": 12264, "atom2_serNum": 12297, "donAcc_type": "standard", "distance": 2.919, "atom1_id": "///E/189/O", "atom2_id": "///E/193/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1460, "atom1_serNum": 12269, "atom2_serNum": 12553, "donAcc_type": "standard", "distance": 3.174, "atom1_id": "///E/189/NE2", "atom2_id": "///E/227/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1461, "atom1_serNum": 12284, "atom2_serNum": 12301, "donAcc_type": "standard", "distance": 3.252, "atom1_id": "///E/191/O", "atom2_id": "///E/194/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1462, "atom1_serNum": 12292, "atom2_serNum": 12549, "donAcc_type": "acceptable", "distance": 3.792, "atom1_id": "///E/192/O", "atom2_id": "///E/226/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1463, "atom1_serNum": 12304, "atom2_serNum": 12306, "donAcc_type": "acceptable", "distance": 2.978, "atom1_id": "///E/194/O", "atom2_id": "///E/194/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1464, "atom1_serNum": 12310, "atom2_serNum": 12344, "donAcc_type": "standard", "distance": 3.451, "atom1_id": "///E/195/O", "atom2_id": "///E/199/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1465, "atom1_serNum": 12313, "atom2_serNum": 12549, "donAcc_type": "acceptable", "distance": 3.468, "atom1_id": "///E/195/OD1", "atom2_id": "///E/226/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1466, "atom1_serNum": 12318, "atom2_serNum": 12351, "donAcc_type": "standard", "distance": 2.944, "atom1_id": "///E/196/O", "atom2_id": "///E/200/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1467, "atom1_serNum": 12329, "atom2_serNum": 12362, "donAcc_type": "standard", "distance": 2.910, "atom1_id": "///E/197/O", "atom2_id": "///E/201/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1468, "atom1_serNum": 12334, "atom2_serNum": 12517, "donAcc_type": "standard", "distance": 3.404, "atom1_id": "///E/197/NE2", "atom2_id": "///E/223/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1469, "atom1_serNum": 12338, "atom2_serNum": 12370, "donAcc_type": "standard", "distance": 2.901, "atom1_id": "///E/198/O", "atom2_id": "///E/202/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1470, "atom1_serNum": 12347, "atom2_serNum": 12379, "donAcc_type": "standard", "distance": 2.940, "atom1_id": "///E/199/O", "atom2_id": "///E/203/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1471, "atom1_serNum": 12354, "atom2_serNum": 12387, "donAcc_type": "standard", "distance": 2.921, "atom1_id": "///E/200/O", "atom2_id": "///E/204/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1472, "atom1_serNum": 12361, "atom2_serNum": 12476, "donAcc_type": "standard", "distance": 3.831, "atom1_id": "///E/200/NH2", "atom2_id": "///E/218/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1473, "atom1_serNum": 12365, "atom2_serNum": 12395, "donAcc_type": "standard", "distance": 2.939, "atom1_id": "///E/201/O", "atom2_id": "///E/205/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1474, "atom1_serNum": 12377, "atom2_serNum": 12766, "donAcc_type": "standard", "distance": 2.415, "atom1_id": "///E/202/OE1", "atom2_id": "///E/252/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1475, "atom1_serNum": 12382, "atom2_serNum": 12404, "donAcc_type": "standard", "distance": 2.957, "atom1_id": "///E/203/O", "atom2_id": "///E/206/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1476, "atom1_serNum": 12416, "atom2_serNum": 12450, "donAcc_type": "standard", "distance": 3.895, "atom1_id": "///E/211/O", "atom2_id": "///E/215/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1477, "atom1_serNum": 12425, "atom2_serNum": 12458, "donAcc_type": "questionable", "distance": 3.082, "atom1_id": "///E/212/O", "atom2_id": "///E/215/OE2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1478, "atom1_serNum": 12425, "atom2_serNum": 12459, "donAcc_type": "standard", "distance": 2.976, "atom1_id": "///E/212/O", "atom2_id": "///E/216/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1479, "atom1_serNum": 12434, "atom2_serNum": 12467, "donAcc_type": "standard", "distance": 2.873, "atom1_id": "///E/213/O", "atom2_id": "///E/217/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1480, "atom1_serNum": 12445, "atom2_serNum": 12473, "donAcc_type": "standard", "distance": 2.931, "atom1_id": "///E/214/O", "atom2_id": "///E/218/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1481, "atom1_serNum": 12453, "atom2_serNum": 12482, "donAcc_type": "standard", "distance": 2.966, "atom1_id": "///E/215/O", "atom2_id": "///E/219/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1482, "atom1_serNum": 12457, "atom2_serNum": 12489, "donAcc_type": "questionable", "distance": 2.934, "atom1_id": "///E/215/OE1", "atom2_id": "///E/219/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1483, "atom1_serNum": 12470, "atom2_serNum": 12491, "donAcc_type": "standard", "distance": 2.908, "atom1_id": "///E/217/O", "atom2_id": "///E/220/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1484, "atom1_serNum": 12470, "atom2_serNum": 12496, "donAcc_type": "standard", "distance": 3.095, "atom1_id": "///E/217/O", "atom2_id": "///E/221/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1485, "atom1_serNum": 12506, "atom2_serNum": 12527, "donAcc_type": "standard", "distance": 2.894, "atom1_id": "///E/222/O", "atom2_id": "///E/225/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1486, "atom1_serNum": 12506, "atom2_serNum": 12538, "donAcc_type": "standard", "distance": 3.425, "atom1_id": "///E/222/O", "atom2_id": "///E/226/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1487, "atom1_serNum": 12510, "atom2_serNum": 12518, "donAcc_type": "standard", "distance": 3.143, "atom1_id": "///E/223/N", "atom2_id": "///E/223/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1488, "atom1_serNum": 12513, "atom2_serNum": 12550, "donAcc_type": "standard", "distance": 3.130, "atom1_id": "///E/223/O", "atom2_id": "///E/227/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1489, "atom1_serNum": 12522, "atom2_serNum": 12558, "donAcc_type": "standard", "distance": 2.924, "atom1_id": "///E/224/O", "atom2_id": "///E/228/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1490, "atom1_serNum": 12530, "atom2_serNum": 12566, "donAcc_type": "standard", "distance": 2.938, "atom1_id": "///E/225/O", "atom2_id": "///E/229/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1491, "atom1_serNum": 12541, "atom2_serNum": 12578, "donAcc_type": "standard", "distance": 2.910, "atom1_id": "///E/226/O", "atom2_id": "///E/230/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1492, "atom1_serNum": 12553, "atom2_serNum": 12586, "donAcc_type": "standard", "distance": 2.920, "atom1_id": "///E/227/O", "atom2_id": "///E/231/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1493, "atom1_serNum": 12561, "atom2_serNum": 12594, "donAcc_type": "standard", "distance": 2.980, "atom1_id": "///E/228/O", "atom2_id": "///E/232/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1494, "atom1_serNum": 12569, "atom2_serNum": 12602, "donAcc_type": "standard", "distance": 2.872, "atom1_id": "///E/229/O", "atom2_id": "///E/233/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1495, "atom1_serNum": 12577, "atom2_serNum": 12754, "donAcc_type": "acceptable", "distance": 2.309, "atom1_id": "///E/229/OH", "atom2_id": "///E/251/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1496, "atom1_serNum": 12581, "atom2_serNum": 12613, "donAcc_type": "standard", "distance": 2.887, "atom1_id": "///E/230/O", "atom2_id": "///E/234/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1497, "atom1_serNum": 12589, "atom2_serNum": 12621, "donAcc_type": "standard", "distance": 2.950, "atom1_id": "///E/231/O", "atom2_id": "///E/235/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1498, "atom1_serNum": 12589, "atom2_serNum": 12626, "donAcc_type": "acceptable", "distance": 2.994, "atom1_id": "///E/231/O", "atom2_id": "///E/235/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1499, "atom1_serNum": 12597, "atom2_serNum": 12626, "donAcc_type": "acceptable", "distance": 2.723, "atom1_id": "///E/232/O", "atom2_id": "///E/235/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1500, "atom1_serNum": 12605, "atom2_serNum": 12634, "donAcc_type": "standard", "distance": 2.950, "atom1_id": "///E/233/O", "atom2_id": "///E/237/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1501, "atom1_serNum": 12616, "atom2_serNum": 12645, "donAcc_type": "standard", "distance": 3.392, "atom1_id": "///E/234/O", "atom2_id": "///E/238/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1502, "atom1_serNum": 12637, "atom2_serNum": 12671, "donAcc_type": "standard", "distance": 3.419, "atom1_id": "///E/237/O", "atom2_id": "///E/241/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1503, "atom1_serNum": 12656, "atom2_serNum": 12684, "donAcc_type": "acceptable", "distance": 2.972, "atom1_id": "///E/238/OH", "atom2_id": "///E/242/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1504, "atom1_serNum": 12669, "atom2_serNum": 13023, "donAcc_type": "acceptable", "distance": 3.369, "atom1_id": "///E/240/O", "atom2_id": "///E/291/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1505, "atom1_serNum": 12680, "atom2_serNum": 12696, "donAcc_type": "standard", "distance": 3.222, "atom1_id": "///E/242/O", "atom2_id": "///E/244/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1506, "atom1_serNum": 12691, "atom2_serNum": 12719, "donAcc_type": "standard", "distance": 3.022, "atom1_id": "///E/243/O", "atom2_id": "///E/247/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1507, "atom1_serNum": 12699, "atom2_serNum": 12727, "donAcc_type": "standard", "distance": 2.935, "atom1_id": "///E/244/O", "atom2_id": "///E/248/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1508, "atom1_serNum": 12706, "atom2_serNum": 12736, "donAcc_type": "standard", "distance": 2.971, "atom1_id": "///E/245/O", "atom2_id": "///E/249/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1509, "atom1_serNum": 12713, "atom2_serNum": 12744, "donAcc_type": "standard", "distance": 2.959, "atom1_id": "///E/246/O", "atom2_id": "///E/250/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1510, "atom1_serNum": 12713, "atom2_serNum": 12749, "donAcc_type": "acceptable", "distance": 2.852, "atom1_id": "///E/246/O", "atom2_id": "///E/250/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1511, "atom1_serNum": 12717, "atom2_serNum": 13039, "donAcc_type": "standard", "distance": 3.288, "atom1_id": "///E/246/OE1", "atom2_id": "///E/293/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1512, "atom1_serNum": 12722, "atom2_serNum": 12751, "donAcc_type": "standard", "distance": 2.859, "atom1_id": "///E/247/O", "atom2_id": "///E/251/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1513, "atom1_serNum": 12730, "atom2_serNum": 12756, "donAcc_type": "standard", "distance": 3.041, "atom1_id": "///E/248/O", "atom2_id": "///E/252/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1514, "atom1_serNum": 12747, "atom2_serNum": 12776, "donAcc_type": "standard", "distance": 2.938, "atom1_id": "///E/250/O", "atom2_id": "///E/254/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1515, "atom1_serNum": 12754, "atom2_serNum": 12782, "donAcc_type": "standard", "distance": 2.896, "atom1_id": "///E/251/O", "atom2_id": "///E/255/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1516, "atom1_serNum": 12759, "atom2_serNum": 12790, "donAcc_type": "standard", "distance": 2.982, "atom1_id": "///E/252/O", "atom2_id": "///E/256/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1517, "atom1_serNum": 12770, "atom2_serNum": 12796, "donAcc_type": "standard", "distance": 3.012, "atom1_id": "///E/253/O", "atom2_id": "///E/257/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1518, "atom1_serNum": 12779, "atom2_serNum": 12803, "donAcc_type": "standard", "distance": 2.830, "atom1_id": "///E/254/O", "atom2_id": "///E/258/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1519, "atom1_serNum": 12785, "atom2_serNum": 12815, "donAcc_type": "standard", "distance": 2.958, "atom1_id": "///E/255/O", "atom2_id": "///E/259/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1520, "atom1_serNum": 12799, "atom2_serNum": 12823, "donAcc_type": "standard", "distance": 3.745, "atom1_id": "///E/257/O", "atom2_id": "///E/260/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1521, "atom1_serNum": 12799, "atom2_serNum": 12925, "donAcc_type": "standard", "distance": 3.389, "atom1_id": "///E/257/O", "atom2_id": "///E/278/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1522, "atom1_serNum": 12818, "atom2_serNum": 12839, "donAcc_type": "standard", "distance": 3.280, "atom1_id": "///E/259/O", "atom2_id": "///E/262/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1523, "atom1_serNum": 12818, "atom2_serNum": 12846, "donAcc_type": "standard", "distance": 3.322, "atom1_id": "///E/259/O", "atom2_id": "///E/263/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1524, "atom1_serNum": 12826, "atom2_serNum": 12854, "donAcc_type": "standard", "distance": 2.921, "atom1_id": "///E/260/O", "atom2_id": "///E/264/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1525, "atom1_serNum": 12865, "atom2_serNum": 12881, "donAcc_type": "standard", "distance": 3.480, "atom1_id": "///E/265/O", "atom2_id": "///E/274/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1526, "atom1_serNum": 12886, "atom2_serNum": 12926, "donAcc_type": "standard", "distance": 3.229, "atom1_id": "///E/275/O", "atom2_id": "///E/279/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1527, "atom1_serNum": 12894, "atom2_serNum": 12934, "donAcc_type": "standard", "distance": 2.842, "atom1_id": "///E/276/O", "atom2_id": "///E/280/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1528, "atom1_serNum": 12908, "atom2_serNum": 12939, "donAcc_type": "standard", "distance": 3.054, "atom1_id": "///E/277/O", "atom2_id": "///E/281/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1529, "atom1_serNum": 12929, "atom2_serNum": 12950, "donAcc_type": "standard", "distance": 2.578, "atom1_id": "///E/279/O", "atom2_id": "///E/283/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1530, "atom1_serNum": 12942, "atom2_serNum": 12969, "donAcc_type": "standard", "distance": 3.584, "atom1_id": "///E/281/O", "atom2_id": "///E/285/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1531, "atom1_serNum": 12946, "atom2_serNum": 12969, "donAcc_type": "standard", "distance": 2.945, "atom1_id": "///E/282/O", "atom2_id": "///E/285/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1532, "atom1_serNum": 12946, "atom2_serNum": 12975, "donAcc_type": "standard", "distance": 2.865, "atom1_id": "///E/282/O", "atom2_id": "///E/286/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1533, "atom1_serNum": 12953, "atom2_serNum": 12980, "donAcc_type": "standard", "distance": 3.261, "atom1_id": "///E/283/O", "atom2_id": "///E/287/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1534, "atom1_serNum": 12972, "atom2_serNum": 12993, "donAcc_type": "acceptable", "distance": 2.893, "atom1_id": "///E/285/O", "atom2_id": "///E/288/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1535, "atom1_serNum": 12978, "atom2_serNum": 12995, "donAcc_type": "standard", "distance": 3.179, "atom1_id": "///E/286/O", "atom2_id": "///E/289/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1536, "atom1_serNum": 12983, "atom2_serNum": 13004, "donAcc_type": "standard", "distance": 3.608, "atom1_id": "///E/287/O", "atom2_id": "///E/290/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1537, "atom1_serNum": 12998, "atom2_serNum": 13027, "donAcc_type": "questionable", "distance": 3.226, "atom1_id": "///E/289/O", "atom2_id": "///E/292/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1538, "atom1_serNum": 13007, "atom2_serNum": 13024, "donAcc_type": "standard", "distance": 2.871, "atom1_id": "///E/290/O", "atom2_id": "///E/292/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1539, "atom1_serNum": 13086, "atom2_serNum": 13135, "donAcc_type": "standard", "distance": 3.042, "atom1_id": "///E/321/O", "atom2_id": "///E/326/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1540, "atom1_serNum": 13094, "atom2_serNum": 13127, "donAcc_type": "standard", "distance": 2.890, "atom1_id": "///E/322/O", "atom2_id": "///E/326/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1541, "atom1_serNum": 13101, "atom2_serNum": 13136, "donAcc_type": "standard", "distance": 3.058, "atom1_id": "///E/323/O", "atom2_id": "///E/327/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1542, "atom1_serNum": 13113, "atom2_serNum": 13147, "donAcc_type": "standard", "distance": 2.900, "atom1_id": "///E/324/O", "atom2_id": "///E/328/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1543, "atom1_serNum": 13125, "atom2_serNum": 13155, "donAcc_type": "standard", "distance": 2.917, "atom1_id": "///E/325/O", "atom2_id": "///E/329/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1544, "atom1_serNum": 13130, "atom2_serNum": 13163, "donAcc_type": "standard", "distance": 2.994, "atom1_id": "///E/326/O", "atom2_id": "///E/330/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1545, "atom1_serNum": 13139, "atom2_serNum": 13171, "donAcc_type": "standard", "distance": 2.923, "atom1_id": "///E/327/O", "atom2_id": "///E/331/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1546, "atom1_serNum": 13150, "atom2_serNum": 13176, "donAcc_type": "standard", "distance": 2.924, "atom1_id": "///E/328/O", "atom2_id": "///E/332/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1547, "atom1_serNum": 13158, "atom2_serNum": 13181, "donAcc_type": "standard", "distance": 2.961, "atom1_id": "///E/329/O", "atom2_id": "///E/333/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1548, "atom1_serNum": 13166, "atom2_serNum": 13192, "donAcc_type": "standard", "distance": 2.951, "atom1_id": "///E/330/O", "atom2_id": "///E/334/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1549, "atom1_serNum": 13174, "atom2_serNum": 13200, "donAcc_type": "standard", "distance": 2.906, "atom1_id": "///E/331/O", "atom2_id": "///E/335/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1550, "atom1_serNum": 13179, "atom2_serNum": 13205, "donAcc_type": "standard", "distance": 2.957, "atom1_id": "///E/332/O", "atom2_id": "///E/336/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1551, "atom1_serNum": 13184, "atom2_serNum": 13211, "donAcc_type": "standard", "distance": 2.905, "atom1_id": "///E/333/O", "atom2_id": "///E/337/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1552, "atom1_serNum": 13195, "atom2_serNum": 13221, "donAcc_type": "standard", "distance": 2.935, "atom1_id": "///E/334/O", "atom2_id": "///E/338/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1553, "atom1_serNum": 13203, "atom2_serNum": 13392, "donAcc_type": "standard", "distance": 2.631, "atom1_id": "///E/335/O", "atom2_id": "///E/384/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1554, "atom1_serNum": 13208, "atom2_serNum": 13335, "donAcc_type": "standard", "distance": 2.906, "atom1_id": "///E/336/O", "atom2_id": "///E/378/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1555, "atom1_serNum": 13210, "atom2_serNum": 13338, "donAcc_type": "acceptable", "distance": 2.913, "atom1_id": "///E/336/OG", "atom2_id": "///E/378/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1556, "atom1_serNum": 13210, "atom2_serNum": 13771, "donAcc_type": "acceptable", "distance": 3.076, "atom1_id": "///E/336/OG", "atom2_id": "///E/434/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1557, "atom1_serNum": 13214, "atom2_serNum": 13217, "donAcc_type": "acceptable", "distance": 3.015, "atom1_id": "///E/337/O", "atom2_id": "///E/337/ND1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1558, "atom1_serNum": 13224, "atom2_serNum": 13255, "donAcc_type": "questionable", "distance": 2.988, "atom1_id": "///E/338/O", "atom2_id": "///E/342/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1559, "atom1_serNum": 13228, "atom2_serNum": 13936, "donAcc_type": "standard", "distance": 2.424, "atom1_id": "///E/338/ND2", "atom2_id": "///E/455/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1560, "atom1_serNum": 13232, "atom2_serNum": 13393, "donAcc_type": "standard", "distance": 2.750, "atom1_id": "///E/339/O", "atom2_id": "///E/384/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1561, "atom1_serNum": 13247, "atom2_serNum": 20983, "donAcc_type": "standard", "distance": 2.945, "atom1_id": "///E/341/NZ", "atom2_id": "///I/39/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 1562, "atom1_serNum": 13251, "atom2_serNum": 13285, "donAcc_type": "standard", "distance": 2.946, "atom1_id": "///E/342/O", "atom2_id": "///E/346/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1563, "atom1_serNum": 13260, "atom2_serNum": 13293, "donAcc_type": "standard", "distance": 2.924, "atom1_id": "///E/343/O", "atom2_id": "///E/347/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1564, "atom1_serNum": 13264, "atom2_serNum": 13390, "donAcc_type": "standard", "distance": 2.739, "atom1_id": "///E/343/OD2", "atom2_id": "///E/384/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1565, "atom1_serNum": 13264, "atom2_serNum": 13393, "donAcc_type": "standard", "distance": 2.786, "atom1_id": "///E/343/OD2", "atom2_id": "///E/384/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1566, "atom1_serNum": 13331, "atom2_serNum": 13770, "donAcc_type": "standard", "distance": 3.884, "atom1_id": "///E/377/O", "atom2_id": "///E/433/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1567, "atom1_serNum": 13350, "atom2_serNum": 13757, "donAcc_type": "standard", "distance": 2.929, "atom1_id": "///E/380/N", "atom2_id": "///E/432/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1568, "atom1_serNum": 13353, "atom2_serNum": 13754, "donAcc_type": "standard", "distance": 2.863, "atom1_id": "///E/380/O", "atom2_id": "///E/432/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1569, "atom1_serNum": 13364, "atom2_serNum": 13394, "donAcc_type": "standard", "distance": 3.153, "atom1_id": "///E/381/O", "atom2_id": "///E/385/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1570, "atom1_serNum": 13366, "atom2_serNum": 13381, "donAcc_type": "acceptable", "distance": 2.425, "atom1_id": "///E/381/OG", "atom2_id": "///E/383/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1571, "atom1_serNum": 13370, "atom2_serNum": 13402, "donAcc_type": "standard", "distance": 2.920, "atom1_id": "///E/382/O", "atom2_id": "///E/386/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1572, "atom1_serNum": 13375, "atom2_serNum": 13381, "donAcc_type": "standard", "distance": 2.725, "atom1_id": "///E/383/N", "atom2_id": "///E/383/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1573, "atom1_serNum": 13378, "atom2_serNum": 13410, "donAcc_type": "standard", "distance": 2.917, "atom1_id": "///E/383/O", "atom2_id": "///E/387/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1574, "atom1_serNum": 13381, "atom2_serNum": 13383, "donAcc_type": "standard", "distance": 2.737, "atom1_id": "///E/383/OD1", "atom2_id": "///E/384/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1575, "atom1_serNum": 13386, "atom2_serNum": 13415, "donAcc_type": "standard", "distance": 2.972, "atom1_id": "///E/384/O", "atom2_id": "///E/388/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1576, "atom1_serNum": 13397, "atom2_serNum": 13423, "donAcc_type": "standard", "distance": 2.890, "atom1_id": "///E/385/O", "atom2_id": "///E/389/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1577, "atom1_serNum": 13405, "atom2_serNum": 13434, "donAcc_type": "standard", "distance": 2.908, "atom1_id": "///E/386/O", "atom2_id": "///E/390/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1578, "atom1_serNum": 13413, "atom2_serNum": 13446, "donAcc_type": "standard", "distance": 2.916, "atom1_id": "///E/387/O", "atom2_id": "///E/391/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1579, "atom1_serNum": 13418, "atom2_serNum": 13451, "donAcc_type": "standard", "distance": 2.917, "atom1_id": "///E/388/O", "atom2_id": "///E/392/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1580, "atom1_serNum": 13426, "atom2_serNum": 13459, "donAcc_type": "standard", "distance": 2.934, "atom1_id": "///E/389/O", "atom2_id": "///E/393/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1581, "atom1_serNum": 13437, "atom2_serNum": 13493, "donAcc_type": "standard", "distance": 3.167, "atom1_id": "///E/390/O", "atom2_id": "///E/396/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1582, "atom1_serNum": 13445, "atom2_serNum": 13497, "donAcc_type": "acceptable", "distance": 2.675, "atom1_id": "///E/390/OH", "atom2_id": "///E/397/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1583, "atom1_serNum": 13475, "atom2_serNum": 13944, "donAcc_type": "acceptable", "distance": 3.835, "atom1_id": "///E/394/OE2", "atom2_id": "///E/455/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1584, "atom1_serNum": 13504, "atom2_serNum": 13513, "donAcc_type": "standard", "distance": 3.079, "atom1_id": "///E/398/O", "atom2_id": "///E/400/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1585, "atom1_serNum": 13518, "atom2_serNum": 13526, "donAcc_type": "acceptable", "distance": 3.159, "atom1_id": "///E/400/OG1", "atom2_id": "///E/402/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1586, "atom1_serNum": 13523, "atom2_serNum": 13550, "donAcc_type": "standard", "distance": 2.955, "atom1_id": "///E/401/O", "atom2_id": "///E/405/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1587, "atom1_serNum": 13523, "atom2_serNum": 13555, "donAcc_type": "acceptable", "distance": 2.561, "atom1_id": "///E/401/O", "atom2_id": "///E/405/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1588, "atom1_serNum": 13529, "atom2_serNum": 13556, "donAcc_type": "standard", "distance": 2.891, "atom1_id": "///E/402/O", "atom2_id": "///E/406/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1589, "atom1_serNum": 13537, "atom2_serNum": 13565, "donAcc_type": "standard", "distance": 3.024, "atom1_id": "///E/403/O", "atom2_id": "///E/407/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1590, "atom1_serNum": 13545, "atom2_serNum": 13573, "donAcc_type": "standard", "distance": 3.019, "atom1_id": "///E/404/O", "atom2_id": "///E/408/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1591, "atom1_serNum": 13553, "atom2_serNum": 13579, "donAcc_type": "standard", "distance": 2.922, "atom1_id": "///E/405/O", "atom2_id": "///E/409/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1592, "atom1_serNum": 13559, "atom2_serNum": 13586, "donAcc_type": "standard", "distance": 2.906, "atom1_id": "///E/406/O", "atom2_id": "///E/410/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1593, "atom1_serNum": 13568, "atom2_serNum": 13594, "donAcc_type": "standard", "distance": 3.037, "atom1_id": "///E/407/O", "atom2_id": "///E/411/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1594, "atom1_serNum": 13576, "atom2_serNum": 13601, "donAcc_type": "standard", "distance": 2.975, "atom1_id": "///E/408/O", "atom2_id": "///E/412/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1595, "atom1_serNum": 13589, "atom2_serNum": 13627, "donAcc_type": "standard", "distance": 3.258, "atom1_id": "///E/410/O", "atom2_id": "///E/415/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1596, "atom1_serNum": 13589, "atom2_serNum": 13635, "donAcc_type": "standard", "distance": 3.246, "atom1_id": "///E/410/O", "atom2_id": "///E/416/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1597, "atom1_serNum": 13597, "atom2_serNum": 13619, "donAcc_type": "standard", "distance": 3.297, "atom1_id": "///E/411/O", "atom2_id": "///E/414/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1598, "atom1_serNum": 13630, "atom2_serNum": 13777, "donAcc_type": "standard", "distance": 3.389, "atom1_id": "///E/415/O", "atom2_id": "///E/435/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1599, "atom1_serNum": 13643, "atom2_serNum": 13765, "donAcc_type": "standard", "distance": 3.109, "atom1_id": "///E/417/N", "atom2_id": "///E/433/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1600, "atom1_serNum": 13646, "atom2_serNum": 13762, "donAcc_type": "standard", "distance": 3.241, "atom1_id": "///E/417/O", "atom2_id": "///E/433/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1601, "atom1_serNum": 13648, "atom2_serNum": 13765, "donAcc_type": "acceptable", "distance": 2.919, "atom1_id": "///E/417/OG", "atom2_id": "///E/433/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1602, "atom1_serNum": 13648, "atom2_serNum": 13769, "donAcc_type": "acceptable", "distance": 3.179, "atom1_id": "///E/417/OG", "atom2_id": "///E/433/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1603, "atom1_serNum": 13652, "atom2_serNum": 13685, "donAcc_type": "questionable", "distance": 3.140, "atom1_id": "///E/418/O", "atom2_id": "///E/422/OE2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1604, "atom1_serNum": 13663, "atom2_serNum": 13672, "donAcc_type": "acceptable", "distance": 2.829, "atom1_id": "///E/419/O", "atom2_id": "///E/420/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1605, "atom1_serNum": 13667, "atom2_serNum": 13746, "donAcc_type": "standard", "distance": 3.402, "atom1_id": "///E/420/N", "atom2_id": "///E/431/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1606, "atom1_serNum": 13670, "atom2_serNum": 13677, "donAcc_type": "standard", "distance": 2.961, "atom1_id": "///E/420/O", "atom2_id": "///E/422/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1607, "atom1_serNum": 13676, "atom2_serNum": 13686, "donAcc_type": "standard", "distance": 2.556, "atom1_id": "///E/421/O", "atom2_id": "///E/423/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1608, "atom1_serNum": 13684, "atom2_serNum": 13694, "donAcc_type": "standard", "distance": 3.348, "atom1_id": "///E/422/OE1", "atom2_id": "///E/423/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1609, "atom1_serNum": 13695, "atom2_serNum": 13701, "donAcc_type": "standard", "distance": 2.725, "atom1_id": "///E/424/N", "atom2_id": "///E/424/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1610, "atom1_serNum": 13780, "atom2_serNum": 13782, "donAcc_type": "acceptable", "distance": 2.419, "atom1_id": "///E/435/O", "atom2_id": "///E/435/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1611, "atom1_serNum": 13795, "atom2_serNum": 13824, "donAcc_type": "standard", "distance": 3.659, "atom1_id": "///E/437/O", "atom2_id": "///E/441/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1612, "atom1_serNum": 13799, "atom2_serNum": 13831, "donAcc_type": "standard", "distance": 2.930, "atom1_id": "///E/438/O", "atom2_id": "///E/442/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1613, "atom1_serNum": 13807, "atom2_serNum": 13839, "donAcc_type": "standard", "distance": 2.947, "atom1_id": "///E/439/O", "atom2_id": "///E/443/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1614, "atom1_serNum": 13816, "atom2_serNum": 13848, "donAcc_type": "standard", "distance": 2.934, "atom1_id": "///E/440/O", "atom2_id": "///E/444/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1615, "atom1_serNum": 13827, "atom2_serNum": 13856, "donAcc_type": "standard", "distance": 2.871, "atom1_id": "///E/441/O", "atom2_id": "///E/445/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1616, "atom1_serNum": 13834, "atom2_serNum": 13860, "donAcc_type": "standard", "distance": 2.931, "atom1_id": "///E/442/O", "atom2_id": "///E/446/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1617, "atom1_serNum": 13842, "atom2_serNum": 13869, "donAcc_type": "standard", "distance": 3.024, "atom1_id": "///E/443/O", "atom2_id": "///E/447/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1618, "atom1_serNum": 13851, "atom2_serNum": 13876, "donAcc_type": "standard", "distance": 2.858, "atom1_id": "///E/444/O", "atom2_id": "///E/448/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1619, "atom1_serNum": 13859, "atom2_serNum": 13883, "donAcc_type": "standard", "distance": 2.919, "atom1_id": "///E/445/O", "atom2_id": "///E/449/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1620, "atom1_serNum": 13859, "atom2_serNum": 13887, "donAcc_type": "standard", "distance": 3.260, "atom1_id": "///E/445/O", "atom2_id": "///E/450/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1621, "atom1_serNum": 13890, "atom2_serNum": 13906, "donAcc_type": "standard", "distance": 3.152, "atom1_id": "///E/450/O", "atom2_id": "///E/452/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1622, "atom1_serNum": 13901, "atom2_serNum": 13924, "donAcc_type": "standard", "distance": 3.571, "atom1_id": "///E/451/O", "atom2_id": "///E/454/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1623, "atom1_serNum": 13909, "atom2_serNum": 13933, "donAcc_type": "standard", "distance": 3.099, "atom1_id": "///E/452/O", "atom2_id": "///E/455/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1624, "atom1_serNum": 13954, "atom2_serNum": 13961, "donAcc_type": "standard", "distance": 2.845, "atom1_id": "///F/223/N", "atom2_id": "///F/223/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1625, "atom1_serNum": 13966, "atom2_serNum": 14000, "donAcc_type": "standard", "distance": 3.026, "atom1_id": "///F/224/O", "atom2_id": "///F/228/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1626, "atom1_serNum": 13969, "atom2_serNum": 13971, "donAcc_type": "standard", "distance": 2.723, "atom1_id": "///F/224/OD1", "atom2_id": "///F/225/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1627, "atom1_serNum": 13974, "atom2_serNum": 14014, "donAcc_type": "standard", "distance": 2.887, "atom1_id": "///F/225/O", "atom2_id": "///F/229/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1628, "atom1_serNum": 13986, "atom2_serNum": 14023, "donAcc_type": "standard", "distance": 2.921, "atom1_id": "///F/226/O", "atom2_id": "///F/230/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1629, "atom1_serNum": 13995, "atom2_serNum": 14028, "donAcc_type": "standard", "distance": 2.909, "atom1_id": "///F/227/O", "atom2_id": "///F/231/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1630, "atom1_serNum": 14003, "atom2_serNum": 14039, "donAcc_type": "standard", "distance": 2.880, "atom1_id": "///F/228/O", "atom2_id": "///F/232/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1631, "atom1_serNum": 14017, "atom2_serNum": 14047, "donAcc_type": "standard", "distance": 2.943, "atom1_id": "///F/229/O", "atom2_id": "///F/233/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1632, "atom1_serNum": 14026, "atom2_serNum": 14055, "donAcc_type": "standard", "distance": 2.903, "atom1_id": "///F/230/O", "atom2_id": "///F/234/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1633, "atom1_serNum": 14031, "atom2_serNum": 14060, "donAcc_type": "standard", "distance": 2.891, "atom1_id": "///F/231/O", "atom2_id": "///F/235/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1634, "atom1_serNum": 14037, "atom2_serNum": 14068, "donAcc_type": "questionable", "distance": 3.093, "atom1_id": "///F/231/NH1", "atom2_id": "///F/235/NZ", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 1635, "atom1_serNum": 14042, "atom2_serNum": 14069, "donAcc_type": "standard", "distance": 2.925, "atom1_id": "///F/232/O", "atom2_id": "///F/236/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1636, "atom1_serNum": 14050, "atom2_serNum": 14074, "donAcc_type": "standard", "distance": 2.892, "atom1_id": "///F/233/O", "atom2_id": "///F/237/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1637, "atom1_serNum": 14058, "atom2_serNum": 14083, "donAcc_type": "standard", "distance": 2.878, "atom1_id": "///F/234/O", "atom2_id": "///F/238/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1638, "atom1_serNum": 14072, "atom2_serNum": 14088, "donAcc_type": "standard", "distance": 3.140, "atom1_id": "///F/236/O", "atom2_id": "///F/239/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1639, "atom1_serNum": 14101, "atom2_serNum": 14127, "donAcc_type": "standard", "distance": 3.928, "atom1_id": "///A/519/O", "atom2_id": "///A/523/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1640, "atom1_serNum": 14108, "atom2_serNum": 14136, "donAcc_type": "standard", "distance": 2.947, "atom1_id": "///A/520/O", "atom2_id": "///A/524/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1641, "atom1_serNum": 14115, "atom2_serNum": 14144, "donAcc_type": "standard", "distance": 2.892, "atom1_id": "///A/521/O", "atom2_id": "///A/525/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1642, "atom1_serNum": 14121, "atom2_serNum": 14153, "donAcc_type": "standard", "distance": 2.949, "atom1_id": "///A/522/O", "atom2_id": "///A/526/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1643, "atom1_serNum": 14130, "atom2_serNum": 14162, "donAcc_type": "standard", "distance": 2.919, "atom1_id": "///A/523/O", "atom2_id": "///A/527/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1644, "atom1_serNum": 14139, "atom2_serNum": 14170, "donAcc_type": "standard", "distance": 2.890, "atom1_id": "///A/524/O", "atom2_id": "///A/528/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1645, "atom1_serNum": 14147, "atom2_serNum": 14181, "donAcc_type": "standard", "distance": 2.913, "atom1_id": "///A/525/O", "atom2_id": "///A/529/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1646, "atom1_serNum": 14152, "atom2_serNum": 21499, "donAcc_type": "standard", "distance": 2.445, "atom1_id": "///A/525/NZ", "atom2_id": "///I/64/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 1647, "atom1_serNum": 14156, "atom2_serNum": 14190, "donAcc_type": "standard", "distance": 2.946, "atom1_id": "///A/526/O", "atom2_id": "///A/531/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1648, "atom1_serNum": 14156, "atom2_serNum": 14199, "donAcc_type": "standard", "distance": 3.366, "atom1_id": "///A/526/O", "atom2_id": "///A/532/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1649, "atom1_serNum": 14165, "atom2_serNum": 14186, "donAcc_type": "standard", "distance": 2.997, "atom1_id": "///A/527/O", "atom2_id": "///A/530/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1650, "atom1_serNum": 14173, "atom2_serNum": 15165, "donAcc_type": "standard", "distance": 2.777, "atom1_id": "///A/528/O", "atom2_id": "///A/655/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1651, "atom1_serNum": 14179, "atom2_serNum": 21477, "donAcc_type": "standard", "distance": 3.787, "atom1_id": "///A/528/NH1", "atom2_id": "///I/63/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 1652, "atom1_serNum": 14184, "atom2_serNum": 15164, "donAcc_type": "standard", "distance": 2.881, "atom1_id": "///A/529/O", "atom2_id": "///A/654/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1653, "atom1_serNum": 14210, "atom2_serNum": 14220, "donAcc_type": "standard", "distance": 2.918, "atom1_id": "///A/533/O", "atom2_id": "///A/535/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1654, "atom1_serNum": 14259, "atom2_serNum": 14273, "donAcc_type": "standard", "distance": 3.441, "atom1_id": "///A/539/NE", "atom2_id": "///A/541/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1655, "atom1_serNum": 14310, "atom2_serNum": 14327, "donAcc_type": "standard", "distance": 3.274, "atom1_id": "///A/546/O", "atom2_id": "///A/549/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1656, "atom1_serNum": 14318, "atom2_serNum": 14320, "donAcc_type": "acceptable", "distance": 2.987, "atom1_id": "///A/547/O", "atom2_id": "///A/547/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1657, "atom1_serNum": 14324, "atom2_serNum": 14326, "donAcc_type": "acceptable", "distance": 2.590, "atom1_id": "///A/548/O", "atom2_id": "///A/548/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1658, "atom1_serNum": 14335, "atom2_serNum": 14400, "donAcc_type": "standard", "distance": 2.921, "atom1_id": "///A/549/NZ", "atom2_id": "///A/557/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1659, "atom1_serNum": 14339, "atom2_serNum": 14368, "donAcc_type": "standard", "distance": 2.887, "atom1_id": "///A/550/O", "atom2_id": "///A/554/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1660, "atom1_serNum": 14345, "atom2_serNum": 14376, "donAcc_type": "standard", "distance": 2.960, "atom1_id": "///A/551/O", "atom2_id": "///A/555/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1661, "atom1_serNum": 14354, "atom2_serNum": 14381, "donAcc_type": "standard", "distance": 2.903, "atom1_id": "///A/552/O", "atom2_id": "///A/556/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1662, "atom1_serNum": 14362, "atom2_serNum": 14392, "donAcc_type": "standard", "distance": 2.938, "atom1_id": "///A/553/O", "atom2_id": "///A/557/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1663, "atom1_serNum": 14371, "atom2_serNum": 14401, "donAcc_type": "standard", "distance": 2.926, "atom1_id": "///A/554/O", "atom2_id": "///A/558/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1664, "atom1_serNum": 14379, "atom2_serNum": 14410, "donAcc_type": "standard", "distance": 2.934, "atom1_id": "///A/555/O", "atom2_id": "///A/559/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1665, "atom1_serNum": 14391, "atom2_serNum": 16293, "donAcc_type": "standard", "distance": 2.486, "atom1_id": "///A/556/NH2", "atom2_id": "///A/798/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1666, "atom1_serNum": 14404, "atom2_serNum": 15992, "donAcc_type": "standard", "distance": 3.178, "atom1_id": "///A/558/O", "atom2_id": "///A/757/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1667, "atom1_serNum": 14408, "atom2_serNum": 15986, "donAcc_type": "questionable", "distance": 2.936, "atom1_id": "///A/558/OE1", "atom2_id": "///A/757/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1668, "atom1_serNum": 14421, "atom2_serNum": 15992, "donAcc_type": "standard", "distance": 2.865, "atom1_id": "///A/560/O", "atom2_id": "///A/757/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1669, "atom1_serNum": 14424, "atom2_serNum": 14435, "donAcc_type": "acceptable", "distance": 3.250, "atom1_id": "///A/560/ND1", "atom2_id": "///A/562/N", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 1670, "atom1_serNum": 14431, "atom2_serNum": 21682, "donAcc_type": "acceptable", "distance": 2.985, "atom1_id": "///A/561/O", "atom2_id": "///A/1001/O2'", "atom_pair": "O:O", "residue_pair": "aa:ligand" }, { "index": 1671, "atom1_serNum": 14438, "atom2_serNum": 14448, "donAcc_type": "standard", "distance": 3.011, "atom1_id": "///A/562/O", "atom2_id": "///A/564/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1672, "atom1_serNum": 14444, "atom2_serNum": 15992, "donAcc_type": "standard", "distance": 3.208, "atom1_id": "///A/563/O", "atom2_id": "///A/757/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1673, "atom1_serNum": 14480, "atom2_serNum": 14498, "donAcc_type": "standard", "distance": 3.974, "atom1_id": "///A/568/O", "atom2_id": "///A/571/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1674, "atom1_serNum": 14488, "atom2_serNum": 21689, "donAcc_type": "standard", "distance": 2.702, "atom1_id": "///A/569/O", "atom2_id": "///A/1001/N6", "atom_pair": "O:N", "residue_pair": "aa:ligand" }, { "index": 1675, "atom1_serNum": 14495, "atom2_serNum": 15929, "donAcc_type": "standard", "distance": 3.376, "atom1_id": "///A/570/O", "atom2_id": "///A/749/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1676, "atom1_serNum": 14505, "atom2_serNum": 14744, "donAcc_type": "standard", "distance": 3.116, "atom1_id": "///A/571/NE", "atom2_id": "///A/602/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1677, "atom1_serNum": 14508, "atom2_serNum": 14744, "donAcc_type": "standard", "distance": 3.019, "atom1_id": "///A/571/NH2", "atom2_id": "///A/602/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1678, "atom1_serNum": 14508, "atom2_serNum": 15871, "donAcc_type": "standard", "distance": 2.573, "atom1_id": "///A/571/NH2", "atom2_id": "///A/743/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1679, "atom1_serNum": 14512, "atom2_serNum": 14549, "donAcc_type": "standard", "distance": 2.934, "atom1_id": "///A/572/O", "atom2_id": "///A/576/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1680, "atom1_serNum": 14516, "atom2_serNum": 14557, "donAcc_type": "questionable", "distance": 3.237, "atom1_id": "///A/572/OE1", "atom2_id": "///A/576/OE2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1681, "atom1_serNum": 14521, "atom2_serNum": 14558, "donAcc_type": "standard", "distance": 2.974, "atom1_id": "///A/573/O", "atom2_id": "///A/577/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1682, "atom1_serNum": 14527, "atom2_serNum": 14556, "donAcc_type": "standard", "distance": 2.858, "atom1_id": "///A/573/NH1", "atom2_id": "///A/576/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1683, "atom1_serNum": 14527, "atom2_serNum": 14557, "donAcc_type": "standard", "distance": 3.308, "atom1_id": "///A/573/NH1", "atom2_id": "///A/576/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1684, "atom1_serNum": 14529, "atom2_serNum": 14536, "donAcc_type": "standard", "distance": 2.836, "atom1_id": "///A/574/N", "atom2_id": "///A/574/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1685, "atom1_serNum": 14532, "atom2_serNum": 14566, "donAcc_type": "standard", "distance": 2.969, "atom1_id": "///A/574/O", "atom2_id": "///A/578/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1686, "atom1_serNum": 14541, "atom2_serNum": 14574, "donAcc_type": "standard", "distance": 2.899, "atom1_id": "///A/575/O", "atom2_id": "///A/579/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1687, "atom1_serNum": 14552, "atom2_serNum": 14586, "donAcc_type": "standard", "distance": 2.904, "atom1_id": "///A/576/O", "atom2_id": "///A/580/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1688, "atom1_serNum": 14561, "atom2_serNum": 14591, "donAcc_type": "standard", "distance": 3.039, "atom1_id": "///A/577/O", "atom2_id": "///A/581/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1689, "atom1_serNum": 14569, "atom2_serNum": 14602, "donAcc_type": "standard", "distance": 2.926, "atom1_id": "///A/578/O", "atom2_id": "///A/582/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1690, "atom1_serNum": 14577, "atom2_serNum": 14610, "donAcc_type": "standard", "distance": 2.884, "atom1_id": "///A/579/O", "atom2_id": "///A/583/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1691, "atom1_serNum": 14589, "atom2_serNum": 14619, "donAcc_type": "standard", "distance": 2.999, "atom1_id": "///A/580/O", "atom2_id": "///A/584/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1692, "atom1_serNum": 14594, "atom2_serNum": 14623, "donAcc_type": "standard", "distance": 2.950, "atom1_id": "///A/581/O", "atom2_id": "///A/585/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1693, "atom1_serNum": 14605, "atom2_serNum": 14632, "donAcc_type": "standard", "distance": 2.912, "atom1_id": "///A/582/O", "atom2_id": "///A/586/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1694, "atom1_serNum": 14613, "atom2_serNum": 14640, "donAcc_type": "standard", "distance": 2.942, "atom1_id": "///A/583/O", "atom2_id": "///A/587/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1695, "atom1_serNum": 14622, "atom2_serNum": 14649, "donAcc_type": "standard", "distance": 2.945, "atom1_id": "///A/584/O", "atom2_id": "///A/588/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1696, "atom1_serNum": 14626, "atom2_serNum": 14666, "donAcc_type": "standard", "distance": 3.786, "atom1_id": "///A/585/O", "atom2_id": "///A/590/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1697, "atom1_serNum": 14635, "atom2_serNum": 14665, "donAcc_type": "standard", "distance": 3.351, "atom1_id": "///A/586/O", "atom2_id": "///A/589/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1698, "atom1_serNum": 14656, "atom2_serNum": 17297, "donAcc_type": "standard", "distance": 2.915, "atom1_id": "///A/588/OD2", "atom2_id": "///G/256/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1699, "atom1_serNum": 14656, "atom2_serNum": 17300, "donAcc_type": "standard", "distance": 2.964, "atom1_id": "///A/588/OD2", "atom2_id": "///G/256/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1700, "atom1_serNum": 14664, "atom2_serNum": 15620, "donAcc_type": "standard", "distance": 2.483, "atom1_id": "///A/589/OE1", "atom2_id": "///A/710/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1701, "atom1_serNum": 14665, "atom2_serNum": 15360, "donAcc_type": "acceptable", "distance": 2.541, "atom1_id": "///A/589/NE2", "atom2_id": "///A/678/OG1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1702, "atom1_serNum": 14676, "atom2_serNum": 15624, "donAcc_type": "standard", "distance": 2.931, "atom1_id": "///A/592/N", "atom2_id": "///A/711/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1703, "atom1_serNum": 14679, "atom2_serNum": 15636, "donAcc_type": "standard", "distance": 2.945, "atom1_id": "///A/592/O", "atom2_id": "///A/713/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1704, "atom1_serNum": 14686, "atom2_serNum": 15639, "donAcc_type": "standard", "distance": 2.944, "atom1_id": "///A/594/N", "atom2_id": "///A/713/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1705, "atom1_serNum": 14689, "atom2_serNum": 15650, "donAcc_type": "standard", "distance": 2.900, "atom1_id": "///A/594/O", "atom2_id": "///A/715/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1706, "atom1_serNum": 14689, "atom2_serNum": 15655, "donAcc_type": "acceptable", "distance": 2.760, "atom1_id": "///A/594/O", "atom2_id": "///A/715/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1707, "atom1_serNum": 14694, "atom2_serNum": 15827, "donAcc_type": "standard", "distance": 3.722, "atom1_id": "///A/595/N", "atom2_id": "///A/738/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1708, "atom1_serNum": 14697, "atom2_serNum": 15842, "donAcc_type": "standard", "distance": 3.270, "atom1_id": "///A/595/O", "atom2_id": "///A/740/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1709, "atom1_serNum": 14705, "atom2_serNum": 15681, "donAcc_type": "acceptable", "distance": 2.577, "atom1_id": "///A/595/OH", "atom2_id": "///A/719/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1710, "atom1_serNum": 14706, "atom2_serNum": 15653, "donAcc_type": "standard", "distance": 2.915, "atom1_id": "///A/596/N", "atom2_id": "///A/715/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1711, "atom1_serNum": 14709, "atom2_serNum": 15665, "donAcc_type": "standard", "distance": 2.956, "atom1_id": "///A/596/O", "atom2_id": "///A/717/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1712, "atom1_serNum": 14713, "atom2_serNum": 15845, "donAcc_type": "standard", "distance": 3.053, "atom1_id": "///A/597/N", "atom2_id": "///A/740/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1713, "atom1_serNum": 14716, "atom2_serNum": 15857, "donAcc_type": "standard", "distance": 2.867, "atom1_id": "///A/597/O", "atom2_id": "///A/742/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1714, "atom1_serNum": 14719, "atom2_serNum": 15668, "donAcc_type": "standard", "distance": 2.960, "atom1_id": "///A/598/N", "atom2_id": "///A/717/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1715, "atom1_serNum": 14722, "atom2_serNum": 15677, "donAcc_type": "standard", "distance": 2.639, "atom1_id": "///A/598/O", "atom2_id": "///A/718/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1716, "atom1_serNum": 14726, "atom2_serNum": 14746, "donAcc_type": "acceptable", "distance": 2.350, "atom1_id": "///A/599/O", "atom2_id": "///A/602/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1717, "atom1_serNum": 14737, "atom2_serNum": 21670, "donAcc_type": "standard", "distance": 3.456, "atom1_id": "///A/601/N", "atom2_id": "///A/1001/O3B", "atom_pair": "N:O", "residue_pair": "aa:ligand" }, { "index": 1718, "atom1_serNum": 14740, "atom2_serNum": 16168, "donAcc_type": "standard", "distance": 3.247, "atom1_id": "///A/601/O", "atom2_id": "///A/783/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1719, "atom1_serNum": 14746, "atom2_serNum": 14760, "donAcc_type": "acceptable", "distance": 3.338, "atom1_id": "///A/602/OG1", "atom2_id": "///A/604/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1720, "atom1_serNum": 14751, "atom2_serNum": 14778, "donAcc_type": "acceptable", "distance": 2.547, "atom1_id": "///A/603/O", "atom2_id": "///A/607/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1721, "atom1_serNum": 14755, "atom2_serNum": 14780, "donAcc_type": "standard", "distance": 2.985, "atom1_id": "///A/604/O", "atom2_id": "///A/608/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1722, "atom1_serNum": 14760, "atom2_serNum": 21664, "donAcc_type": "acceptable", "distance": 3.081, "atom1_id": "///A/604/NZ", "atom2_id": "///A/1001/O1G", "atom_pair": "N:O", "residue_pair": "aa:ligand" }, { "index": 1723, "atom1_serNum": 14760, "atom2_serNum": 21668, "donAcc_type": "acceptable", "distance": 3.060, "atom1_id": "///A/604/NZ", "atom2_id": "///A/1001/O1B", "atom_pair": "N:O", "residue_pair": "aa:ligand" }, { "index": 1724, "atom1_serNum": 14761, "atom2_serNum": 21669, "donAcc_type": "standard", "distance": 3.395, "atom1_id": "///A/605/N", "atom2_id": "///A/1001/O2B", "atom_pair": "N:O", "residue_pair": "aa:ligand" }, { "index": 1725, "atom1_serNum": 14764, "atom2_serNum": 14787, "donAcc_type": "standard", "distance": 2.921, "atom1_id": "///A/605/O", "atom2_id": "///A/609/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1726, "atom1_serNum": 14764, "atom2_serNum": 14792, "donAcc_type": "acceptable", "distance": 2.916, "atom1_id": "///A/605/O", "atom2_id": "///A/609/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1727, "atom1_serNum": 14768, "atom2_serNum": 21673, "donAcc_type": "acceptable", "distance": 3.475, "atom1_id": "///A/606/N", "atom2_id": "///A/1001/O2A", "atom_pair": "N:O", "residue_pair": "aa:ligand" }, { "index": 1728, "atom1_serNum": 14771, "atom2_serNum": 14792, "donAcc_type": "acceptable", "distance": 3.167, "atom1_id": "///A/606/O", "atom2_id": "///A/609/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1729, "atom1_serNum": 14771, "atom2_serNum": 14794, "donAcc_type": "standard", "distance": 2.910, "atom1_id": "///A/606/O", "atom2_id": "///A/610/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1730, "atom1_serNum": 14776, "atom2_serNum": 14798, "donAcc_type": "standard", "distance": 2.908, "atom1_id": "///A/607/O", "atom2_id": "///A/611/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1731, "atom1_serNum": 14783, "atom2_serNum": 14805, "donAcc_type": "standard", "distance": 2.976, "atom1_id": "///A/608/O", "atom2_id": "///A/612/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1732, "atom1_serNum": 14790, "atom2_serNum": 14813, "donAcc_type": "standard", "distance": 2.879, "atom1_id": "///A/609/O", "atom2_id": "///A/613/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1733, "atom1_serNum": 14797, "atom2_serNum": 14824, "donAcc_type": "standard", "distance": 2.961, "atom1_id": "///A/610/O", "atom2_id": "///A/614/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1734, "atom1_serNum": 14797, "atom2_serNum": 14829, "donAcc_type": "acceptable", "distance": 2.925, "atom1_id": "///A/610/O", "atom2_id": "///A/614/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1735, "atom1_serNum": 14801, "atom2_serNum": 14831, "donAcc_type": "standard", "distance": 2.910, "atom1_id": "///A/611/O", "atom2_id": "///A/615/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1736, "atom1_serNum": 14808, "atom2_serNum": 14839, "donAcc_type": "standard", "distance": 2.904, "atom1_id": "///A/612/O", "atom2_id": "///A/616/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1737, "atom1_serNum": 14816, "atom2_serNum": 14848, "donAcc_type": "standard", "distance": 2.934, "atom1_id": "///A/613/O", "atom2_id": "///A/617/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1738, "atom1_serNum": 14827, "atom2_serNum": 14859, "donAcc_type": "standard", "distance": 2.937, "atom1_id": "///A/614/O", "atom2_id": "///A/618/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1739, "atom1_serNum": 14834, "atom2_serNum": 14867, "donAcc_type": "standard", "distance": 2.864, "atom1_id": "///A/615/O", "atom2_id": "///A/619/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1740, "atom1_serNum": 14842, "atom2_serNum": 14872, "donAcc_type": "standard", "distance": 2.945, "atom1_id": "///A/616/O", "atom2_id": "///A/620/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1741, "atom1_serNum": 14862, "atom2_serNum": 14898, "donAcc_type": "standard", "distance": 3.159, "atom1_id": "///A/618/O", "atom2_id": "///A/623/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1742, "atom1_serNum": 14888, "atom2_serNum": 14906, "donAcc_type": "questionable", "distance": 2.937, "atom1_id": "///A/621/OE1", "atom2_id": "///A/623/OE2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1743, "atom1_serNum": 14938, "atom2_serNum": 15358, "donAcc_type": "standard", "distance": 2.826, "atom1_id": "///A/628/N", "atom2_id": "///A/678/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1744, "atom1_serNum": 14941, "atom2_serNum": 15369, "donAcc_type": "standard", "distance": 2.938, "atom1_id": "///A/628/O", "atom2_id": "///A/680/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1745, "atom1_serNum": 14959, "atom2_serNum": 15372, "donAcc_type": "standard", "distance": 3.113, "atom1_id": "///A/630/N", "atom2_id": "///A/680/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1746, "atom1_serNum": 14962, "atom2_serNum": 15372, "donAcc_type": "questionable", "distance": 2.955, "atom1_id": "///A/630/O", "atom2_id": "///A/680/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1747, "atom1_serNum": 14962, "atom2_serNum": 15384, "donAcc_type": "standard", "distance": 3.262, "atom1_id": "///A/630/O", "atom2_id": "///A/682/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1748, "atom1_serNum": 14970, "atom2_serNum": 15136, "donAcc_type": "standard", "distance": 3.335, "atom1_id": "///A/631/O", "atom2_id": "///A/650/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1749, "atom1_serNum": 14976, "atom2_serNum": 15387, "donAcc_type": "standard", "distance": 3.154, "atom1_id": "///A/632/N", "atom2_id": "///A/682/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1750, "atom1_serNum": 14979, "atom2_serNum": 15399, "donAcc_type": "standard", "distance": 3.385, "atom1_id": "///A/632/O", "atom2_id": "///A/684/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1751, "atom1_serNum": 14990, "atom2_serNum": 14996, "donAcc_type": "standard", "distance": 2.915, "atom1_id": "///A/633/OD1", "atom2_id": "///A/635/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1752, "atom1_serNum": 14991, "atom2_serNum": 15406, "donAcc_type": "standard", "distance": 3.719, "atom1_id": "///A/633/ND2", "atom2_id": "///A/684/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1753, "atom1_serNum": 14992, "atom2_serNum": 15402, "donAcc_type": "standard", "distance": 3.126, "atom1_id": "///A/634/N", "atom2_id": "///A/684/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1754, "atom1_serNum": 15033, "atom2_serNum": 15057, "donAcc_type": "standard", "distance": 3.288, "atom1_id": "///A/639/O", "atom2_id": "///A/642/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1755, "atom1_serNum": 15038, "atom2_serNum": 15065, "donAcc_type": "standard", "distance": 3.305, "atom1_id": "///A/639/OE2", "atom2_id": "///A/642/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1756, "atom1_serNum": 15042, "atom2_serNum": 15066, "donAcc_type": "standard", "distance": 3.525, "atom1_id": "///A/640/O", "atom2_id": "///A/643/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1757, "atom1_serNum": 15049, "atom2_serNum": 15071, "donAcc_type": "standard", "distance": 3.000, "atom1_id": "///A/641/O", "atom2_id": "///A/644/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1758, "atom1_serNum": 15055, "atom2_serNum": 15500, "donAcc_type": "standard", "distance": 3.016, "atom1_id": "///A/641/NH1", "atom2_id": "///A/695/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1759, "atom1_serNum": 15060, "atom2_serNum": 15090, "donAcc_type": "standard", "distance": 3.106, "atom1_id": "///A/642/O", "atom2_id": "///A/646/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1760, "atom1_serNum": 15069, "atom2_serNum": 15099, "donAcc_type": "standard", "distance": 2.945, "atom1_id": "///A/643/O", "atom2_id": "///A/647/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1761, "atom1_serNum": 15074, "atom2_serNum": 15107, "donAcc_type": "standard", "distance": 3.614, "atom1_id": "///A/644/O", "atom2_id": "///A/648/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1762, "atom1_serNum": 15082, "atom2_serNum": 15534, "donAcc_type": "acceptable", "distance": 2.596, "atom1_id": "///A/644/OH", "atom2_id": "///A/699/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1763, "atom1_serNum": 15086, "atom2_serNum": 15119, "donAcc_type": "standard", "distance": 3.236, "atom1_id": "///A/645/O", "atom2_id": "///A/649/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1764, "atom1_serNum": 15093, "atom2_serNum": 15128, "donAcc_type": "standard", "distance": 2.868, "atom1_id": "///A/646/O", "atom2_id": "///A/650/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1765, "atom1_serNum": 15102, "atom2_serNum": 15128, "donAcc_type": "standard", "distance": 2.983, "atom1_id": "///A/647/O", "atom2_id": "///A/650/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1766, "atom1_serNum": 15102, "atom2_serNum": 15137, "donAcc_type": "standard", "distance": 3.183, "atom1_id": "///A/647/O", "atom2_id": "///A/651/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1767, "atom1_serNum": 15110, "atom2_serNum": 15137, "donAcc_type": "standard", "distance": 2.947, "atom1_id": "///A/648/O", "atom2_id": "///A/651/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1768, "atom1_serNum": 15110, "atom2_serNum": 15145, "donAcc_type": "standard", "distance": 2.975, "atom1_id": "///A/648/O", "atom2_id": "///A/652/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1769, "atom1_serNum": 15150, "atom2_serNum": 15156, "donAcc_type": "acceptable", "distance": 3.155, "atom1_id": "///A/652/OG1", "atom2_id": "///A/654/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1770, "atom1_serNum": 15182, "atom2_serNum": 15217, "donAcc_type": "standard", "distance": 2.891, "atom1_id": "///A/657/O", "atom2_id": "///A/661/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1771, "atom1_serNum": 15188, "atom2_serNum": 15222, "donAcc_type": "standard", "distance": 2.895, "atom1_id": "///A/658/O", "atom2_id": "///A/662/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1772, "atom1_serNum": 15202, "atom2_serNum": 15232, "donAcc_type": "standard", "distance": 2.966, "atom1_id": "///A/659/O", "atom2_id": "///A/663/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1773, "atom1_serNum": 15211, "atom2_serNum": 15237, "donAcc_type": "standard", "distance": 2.917, "atom1_id": "///A/660/O", "atom2_id": "///A/664/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1774, "atom1_serNum": 15220, "atom2_serNum": 15245, "donAcc_type": "standard", "distance": 2.891, "atom1_id": "///A/661/O", "atom2_id": "///A/665/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1775, "atom1_serNum": 15225, "atom2_serNum": 15253, "donAcc_type": "standard", "distance": 2.953, "atom1_id": "///A/662/O", "atom2_id": "///A/666/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1776, "atom1_serNum": 15231, "atom2_serNum": 17871, "donAcc_type": "standard", "distance": 3.246, "atom1_id": "///A/662/NE2", "atom2_id": "///G/329/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1777, "atom1_serNum": 15235, "atom2_serNum": 15262, "donAcc_type": "standard", "distance": 2.930, "atom1_id": "///A/663/O", "atom2_id": "///A/667/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1778, "atom1_serNum": 15240, "atom2_serNum": 15271, "donAcc_type": "standard", "distance": 2.912, "atom1_id": "///A/664/O", "atom2_id": "///A/668/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1779, "atom1_serNum": 15248, "atom2_serNum": 15282, "donAcc_type": "standard", "distance": 2.931, "atom1_id": "///A/665/O", "atom2_id": "///A/669/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1780, "atom1_serNum": 15256, "atom2_serNum": 15293, "donAcc_type": "standard", "distance": 2.918, "atom1_id": "///A/666/O", "atom2_id": "///A/670/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1781, "atom1_serNum": 15256, "atom2_serNum": 15298, "donAcc_type": "acceptable", "distance": 2.493, "atom1_id": "///A/666/O", "atom2_id": "///A/670/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1782, "atom1_serNum": 15265, "atom2_serNum": 15305, "donAcc_type": "acceptable", "distance": 2.601, "atom1_id": "///A/667/O", "atom2_id": "///A/671/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1783, "atom1_serNum": 15274, "atom2_serNum": 15346, "donAcc_type": "standard", "distance": 2.831, "atom1_id": "///A/668/O", "atom2_id": "///A/676/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1784, "atom1_serNum": 15274, "atom2_serNum": 15347, "donAcc_type": "standard", "distance": 2.918, "atom1_id": "///A/668/O", "atom2_id": "///A/676/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1785, "atom1_serNum": 15303, "atom2_serNum": 15314, "donAcc_type": "standard", "distance": 3.212, "atom1_id": "///A/671/O", "atom2_id": "///A/673/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1786, "atom1_serNum": 15303, "atom2_serNum": 15346, "donAcc_type": "standard", "distance": 3.475, "atom1_id": "///A/671/O", "atom2_id": "///A/676/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1787, "atom1_serNum": 15317, "atom2_serNum": 15337, "donAcc_type": "standard", "distance": 3.027, "atom1_id": "///A/673/O", "atom2_id": "///A/676/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1788, "atom1_serNum": 15347, "atom2_serNum": 15605, "donAcc_type": "standard", "distance": 3.261, "atom1_id": "///A/676/NH2", "atom2_id": "///A/708/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1789, "atom1_serNum": 15365, "atom2_serNum": 15629, "donAcc_type": "standard", "distance": 2.958, "atom1_id": "///A/679/O", "atom2_id": "///A/712/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1790, "atom1_serNum": 15376, "atom2_serNum": 15632, "donAcc_type": "standard", "distance": 3.212, "atom1_id": "///A/681/N", "atom2_id": "///A/712/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1791, "atom1_serNum": 15379, "atom2_serNum": 15643, "donAcc_type": "standard", "distance": 3.157, "atom1_id": "///A/681/O", "atom2_id": "///A/714/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1792, "atom1_serNum": 15392, "atom2_serNum": 15646, "donAcc_type": "standard", "distance": 2.717, "atom1_id": "///A/683/N", "atom2_id": "///A/714/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1793, "atom1_serNum": 15395, "atom2_serNum": 15657, "donAcc_type": "standard", "distance": 2.851, "atom1_id": "///A/683/O", "atom2_id": "///A/716/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1794, "atom1_serNum": 15399, "atom2_serNum": 15405, "donAcc_type": "standard", "distance": 2.683, "atom1_id": "///A/684/N", "atom2_id": "///A/684/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1795, "atom1_serNum": 15407, "atom2_serNum": 15660, "donAcc_type": "standard", "distance": 3.174, "atom1_id": "///A/685/N", "atom2_id": "///A/716/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1796, "atom1_serNum": 15410, "atom2_serNum": 15432, "donAcc_type": "standard", "distance": 3.326, "atom1_id": "///A/685/O", "atom2_id": "///A/688/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1797, "atom1_serNum": 15416, "atom2_serNum": 15660, "donAcc_type": "standard", "distance": 3.371, "atom1_id": "///A/686/N", "atom2_id": "///A/716/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1798, "atom1_serNum": 15419, "atom2_serNum": 15440, "donAcc_type": "standard", "distance": 3.213, "atom1_id": "///A/686/O", "atom2_id": "///A/689/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1799, "atom1_serNum": 15424, "atom2_serNum": 15430, "donAcc_type": "standard", "distance": 2.673, "atom1_id": "///A/687/N", "atom2_id": "///A/687/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1800, "atom1_serNum": 15430, "atom2_serNum": 15432, "donAcc_type": "standard", "distance": 2.931, "atom1_id": "///A/687/OD1", "atom2_id": "///A/688/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1801, "atom1_serNum": 15457, "atom2_serNum": 15492, "donAcc_type": "standard", "distance": 3.994, "atom1_id": "///A/691/O", "atom2_id": "///A/694/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1802, "atom1_serNum": 15460, "atom2_serNum": 15473, "donAcc_type": "standard", "distance": 3.030, "atom1_id": "///A/691/OD1", "atom2_id": "///A/693/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1803, "atom1_serNum": 15460, "atom2_serNum": 15484, "donAcc_type": "standard", "distance": 2.818, "atom1_id": "///A/691/OD1", "atom2_id": "///A/694/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1804, "atom1_serNum": 15462, "atom2_serNum": 21313, "donAcc_type": "standard", "distance": 3.275, "atom1_id": "///A/692/N", "atom2_id": "///I/55/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 1805, "atom1_serNum": 15476, "atom2_serNum": 18280, "donAcc_type": "standard", "distance": 3.577, "atom1_id": "///A/693/O", "atom2_id": "///G/380/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1806, "atom1_serNum": 15480, "atom2_serNum": 18279, "donAcc_type": "standard", "distance": 3.170, "atom1_id": "///A/693/NE", "atom2_id": "///G/380/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1807, "atom1_serNum": 15491, "atom2_serNum": 15752, "donAcc_type": "standard", "distance": 2.953, "atom1_id": "///A/694/OE1", "atom2_id": "///A/728/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1808, "atom1_serNum": 15492, "atom2_serNum": 15739, "donAcc_type": "standard", "distance": 2.581, "atom1_id": "///A/694/NE2", "atom2_id": "///A/726/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1809, "atom1_serNum": 15496, "atom2_serNum": 15527, "donAcc_type": "standard", "distance": 2.957, "atom1_id": "///A/695/O", "atom2_id": "///A/699/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1810, "atom1_serNum": 15504, "atom2_serNum": 15535, "donAcc_type": "standard", "distance": 2.952, "atom1_id": "///A/696/O", "atom2_id": "///A/700/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1811, "atom1_serNum": 15511, "atom2_serNum": 15543, "donAcc_type": "standard", "distance": 2.951, "atom1_id": "///A/697/O", "atom2_id": "///A/701/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1812, "atom1_serNum": 15518, "atom2_serNum": 15551, "donAcc_type": "standard", "distance": 2.854, "atom1_id": "///A/698/O", "atom2_id": "///A/702/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1813, "atom1_serNum": 15530, "atom2_serNum": 15559, "donAcc_type": "standard", "distance": 2.978, "atom1_id": "///A/699/O", "atom2_id": "///A/703/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1814, "atom1_serNum": 15554, "atom2_serNum": 15585, "donAcc_type": "acceptable", "distance": 2.526, "atom1_id": "///A/702/O", "atom2_id": "///A/705/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1815, "atom1_serNum": 15557, "atom2_serNum": 15800, "donAcc_type": "standard", "distance": 3.624, "atom1_id": "///A/702/OD1", "atom2_id": "///A/734/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1816, "atom1_serNum": 15558, "atom2_serNum": 15595, "donAcc_type": "standard", "distance": 2.720, "atom1_id": "///A/702/OD2", "atom2_id": "///A/706/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1817, "atom1_serNum": 15583, "atom2_serNum": 17346, "donAcc_type": "standard", "distance": 3.990, "atom1_id": "///A/705/O", "atom2_id": "///G/263/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1818, "atom1_serNum": 15590, "atom2_serNum": 15610, "donAcc_type": "questionable", "distance": 3.113, "atom1_id": "///A/706/O", "atom2_id": "///A/709/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1819, "atom1_serNum": 15596, "atom2_serNum": 17353, "donAcc_type": "standard", "distance": 3.335, "atom1_id": "///A/707/N", "atom2_id": "///G/263/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1820, "atom1_serNum": 15601, "atom2_serNum": 17353, "donAcc_type": "acceptable", "distance": 2.453, "atom1_id": "///A/707/OG", "atom2_id": "///G/263/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1821, "atom1_serNum": 15653, "atom2_serNum": 15655, "donAcc_type": "acceptable", "distance": 2.884, "atom1_id": "///A/715/O", "atom2_id": "///A/715/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1822, "atom1_serNum": 15677, "atom2_serNum": 21664, "donAcc_type": "acceptable", "distance": 3.365, "atom1_id": "///A/718/ND2", "atom2_id": "///A/1001/O1G", "atom_pair": "N:O", "residue_pair": "aa:ligand" }, { "index": 1823, "atom1_serNum": 15681, "atom2_serNum": 15683, "donAcc_type": "acceptable", "distance": 2.961, "atom1_id": "///A/719/O", "atom2_id": "///A/719/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1824, "atom1_serNum": 15685, "atom2_serNum": 19826, "donAcc_type": "standard", "distance": 3.170, "atom1_id": "///A/720/N", "atom2_id": "///G/614/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1825, "atom1_serNum": 15693, "atom2_serNum": 15699, "donAcc_type": "standard", "distance": 2.762, "atom1_id": "///A/721/N", "atom2_id": "///A/721/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1826, "atom1_serNum": 15696, "atom2_serNum": 15716, "donAcc_type": "standard", "distance": 3.268, "atom1_id": "///A/721/O", "atom2_id": "///A/724/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1827, "atom1_serNum": 15696, "atom2_serNum": 15725, "donAcc_type": "standard", "distance": 2.786, "atom1_id": "///A/721/O", "atom2_id": "///A/725/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1828, "atom1_serNum": 15700, "atom2_serNum": 15732, "donAcc_type": "standard", "distance": 3.174, "atom1_id": "///A/721/OD2", "atom2_id": "///A/725/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1829, "atom1_serNum": 15704, "atom2_serNum": 15736, "donAcc_type": "standard", "distance": 3.040, "atom1_id": "///A/722/O", "atom2_id": "///A/726/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1830, "atom1_serNum": 15704, "atom2_serNum": 15744, "donAcc_type": "standard", "distance": 3.444, "atom1_id": "///A/722/O", "atom2_id": "///A/727/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1831, "atom1_serNum": 15712, "atom2_serNum": 15785, "donAcc_type": "acceptable", "distance": 2.368, "atom1_id": "///A/723/O", "atom2_id": "///A/732/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1832, "atom1_serNum": 15723, "atom2_serNum": 15840, "donAcc_type": "standard", "distance": 3.663, "atom1_id": "///A/724/OE1", "atom2_id": "///A/739/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1833, "atom1_serNum": 15734, "atom2_serNum": 20001, "donAcc_type": "standard", "distance": 3.012, "atom1_id": "///A/725/NH1", "atom2_id": "///G/634/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1834, "atom1_serNum": 15755, "atom2_serNum": 15780, "donAcc_type": "standard", "distance": 2.805, "atom1_id": "///A/728/O", "atom2_id": "///A/732/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1835, "atom1_serNum": 15755, "atom2_serNum": 15785, "donAcc_type": "acceptable", "distance": 2.893, "atom1_id": "///A/728/O", "atom2_id": "///A/732/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1836, "atom1_serNum": 15763, "atom2_serNum": 15787, "donAcc_type": "standard", "distance": 2.928, "atom1_id": "///A/729/O", "atom2_id": "///A/733/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1837, "atom1_serNum": 15767, "atom2_serNum": 15793, "donAcc_type": "standard", "distance": 2.911, "atom1_id": "///A/730/O", "atom2_id": "///A/734/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1838, "atom1_serNum": 15776, "atom2_serNum": 15804, "donAcc_type": "standard", "distance": 2.919, "atom1_id": "///A/731/O", "atom2_id": "///A/735/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1839, "atom1_serNum": 15783, "atom2_serNum": 15812, "donAcc_type": "standard", "distance": 3.394, "atom1_id": "///A/732/O", "atom2_id": "///A/736/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1840, "atom1_serNum": 15792, "atom2_serNum": 19069, "donAcc_type": "acceptable", "distance": 3.422, "atom1_id": "///A/733/OG", "atom2_id": "///G/480/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1841, "atom1_serNum": 15802, "atom2_serNum": 21697, "donAcc_type": "acceptable", "distance": 2.446, "atom1_id": "///A/734/NH1", "atom2_id": "///G/901/O2G", "atom_pair": "N:O", "residue_pair": "aa:ligand" }, { "index": 1842, "atom1_serNum": 15803, "atom2_serNum": 21698, "donAcc_type": "standard", "distance": 3.060, "atom1_id": "///A/734/NH2", "atom2_id": "///G/901/O3G", "atom_pair": "N:O", "residue_pair": "aa:ligand" }, { "index": 1843, "atom1_serNum": 15815, "atom2_serNum": 15841, "donAcc_type": "standard", "distance": 3.199, "atom1_id": "///A/736/O", "atom2_id": "///A/739/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1844, "atom1_serNum": 15816, "atom2_serNum": 19102, "donAcc_type": "standard", "distance": 2.466, "atom1_id": "///A/737/N", "atom2_id": "///G/484/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1845, "atom1_serNum": 15819, "atom2_serNum": 19135, "donAcc_type": "standard", "distance": 2.509, "atom1_id": "///A/737/O", "atom2_id": "///G/488/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1846, "atom1_serNum": 15834, "atom2_serNum": 19136, "donAcc_type": "standard", "distance": 3.510, "atom1_id": "///A/739/O", "atom2_id": "///G/488/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1847, "atom1_serNum": 15875, "atom2_serNum": 19840, "donAcc_type": "standard", "distance": 3.238, "atom1_id": "///A/743/OE1", "atom2_id": "///G/615/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1848, "atom1_serNum": 15884, "atom2_serNum": 16159, "donAcc_type": "standard", "distance": 3.487, "atom1_id": "///A/745/N", "atom2_id": "///A/781/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1849, "atom1_serNum": 15895, "atom2_serNum": 21686, "donAcc_type": "acceptable", "distance": 2.787, "atom1_id": "///A/745/OH", "atom2_id": "///A/1001/N7", "atom_pair": "O:N", "residue_pair": "aa:ligand" }, { "index": 1850, "atom1_serNum": 15895, "atom2_serNum": 21689, "donAcc_type": "acceptable", "distance": 2.462, "atom1_id": "///A/745/OH", "atom2_id": "///A/1001/N6", "atom_pair": "O:N", "residue_pair": "aa:ligand" }, { "index": 1851, "atom1_serNum": 15899, "atom2_serNum": 15930, "donAcc_type": "standard", "distance": 3.621, "atom1_id": "///A/746/O", "atom2_id": "///A/750/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1852, "atom1_serNum": 15901, "atom2_serNum": 15928, "donAcc_type": "acceptable", "distance": 2.872, "atom1_id": "///A/746/OG", "atom2_id": "///A/749/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1853, "atom1_serNum": 15915, "atom2_serNum": 15947, "donAcc_type": "standard", "distance": 2.966, "atom1_id": "///A/748/O", "atom2_id": "///A/752/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1854, "atom1_serNum": 15924, "atom2_serNum": 15956, "donAcc_type": "standard", "distance": 2.948, "atom1_id": "///A/749/O", "atom2_id": "///A/753/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1855, "atom1_serNum": 15933, "atom2_serNum": 15964, "donAcc_type": "standard", "distance": 3.351, "atom1_id": "///A/750/O", "atom2_id": "///A/754/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1856, "atom1_serNum": 15941, "atom2_serNum": 15971, "donAcc_type": "standard", "distance": 2.963, "atom1_id": "///A/751/O", "atom2_id": "///A/755/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1857, "atom1_serNum": 15941, "atom2_serNum": 15976, "donAcc_type": "acceptable", "distance": 2.944, "atom1_id": "///A/751/O", "atom2_id": "///A/755/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1858, "atom1_serNum": 15950, "atom2_serNum": 15978, "donAcc_type": "standard", "distance": 2.929, "atom1_id": "///A/752/O", "atom2_id": "///A/756/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1859, "atom1_serNum": 15959, "atom2_serNum": 15983, "donAcc_type": "standard", "distance": 2.936, "atom1_id": "///A/753/O", "atom2_id": "///A/757/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1860, "atom1_serNum": 15967, "atom2_serNum": 15994, "donAcc_type": "standard", "distance": 2.944, "atom1_id": "///A/754/O", "atom2_id": "///A/758/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1861, "atom1_serNum": 15993, "atom2_serNum": 21682, "donAcc_type": "acceptable", "distance": 2.579, "atom1_id": "///A/757/NH2", "atom2_id": "///A/1001/O2'", "atom_pair": "N:O", "residue_pair": "aa:ligand" }, { "index": 1862, "atom1_serNum": 15997, "atom2_serNum": 16015, "donAcc_type": "acceptable", "distance": 3.183, "atom1_id": "///A/758/O", "atom2_id": "///A/761/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1863, "atom1_serNum": 16016, "atom2_serNum": 16024, "donAcc_type": "standard", "distance": 2.696, "atom1_id": "///A/762/N", "atom2_id": "///A/762/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1864, "atom1_serNum": 16028, "atom2_serNum": 16333, "donAcc_type": "standard", "distance": 2.655, "atom1_id": "///A/763/O", "atom2_id": "///A/805/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1865, "atom1_serNum": 16043, "atom2_serNum": 16336, "donAcc_type": "standard", "distance": 3.608, "atom1_id": "///A/765/N", "atom2_id": "///A/805/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1866, "atom1_serNum": 16046, "atom2_serNum": 16070, "donAcc_type": "standard", "distance": 3.186, "atom1_id": "///A/765/O", "atom2_id": "///A/769/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1867, "atom1_serNum": 16055, "atom2_serNum": 16077, "donAcc_type": "standard", "distance": 2.933, "atom1_id": "///A/766/O", "atom2_id": "///A/770/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1868, "atom1_serNum": 16056, "atom2_serNum": 16064, "donAcc_type": "standard", "distance": 2.718, "atom1_id": "///A/767/N", "atom2_id": "///A/767/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1869, "atom1_serNum": 16059, "atom2_serNum": 16086, "donAcc_type": "standard", "distance": 2.888, "atom1_id": "///A/767/O", "atom2_id": "///A/771/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1870, "atom1_serNum": 16068, "atom2_serNum": 16094, "donAcc_type": "standard", "distance": 2.967, "atom1_id": "///A/768/O", "atom2_id": "///A/772/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1871, "atom1_serNum": 16073, "atom2_serNum": 16101, "donAcc_type": "standard", "distance": 2.922, "atom1_id": "///A/769/O", "atom2_id": "///A/773/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1872, "atom1_serNum": 16080, "atom2_serNum": 16106, "donAcc_type": "standard", "distance": 2.885, "atom1_id": "///A/770/O", "atom2_id": "///A/774/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1873, "atom1_serNum": 16089, "atom2_serNum": 16117, "donAcc_type": "standard", "distance": 2.966, "atom1_id": "///A/771/O", "atom2_id": "///A/775/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1874, "atom1_serNum": 16097, "atom2_serNum": 16126, "donAcc_type": "standard", "distance": 2.918, "atom1_id": "///A/772/O", "atom2_id": "///A/776/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1875, "atom1_serNum": 16104, "atom2_serNum": 16133, "donAcc_type": "standard", "distance": 2.928, "atom1_id": "///A/773/O", "atom2_id": "///A/777/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1876, "atom1_serNum": 16129, "atom2_serNum": 16143, "donAcc_type": "standard", "distance": 3.092, "atom1_id": "///A/776/O", "atom2_id": "///A/779/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1877, "atom1_serNum": 16129, "atom2_serNum": 16150, "donAcc_type": "standard", "distance": 3.268, "atom1_id": "///A/776/O", "atom2_id": "///A/780/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1878, "atom1_serNum": 16129, "atom2_serNum": 16156, "donAcc_type": "standard", "distance": 3.581, "atom1_id": "///A/776/O", "atom2_id": "///A/781/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1879, "atom1_serNum": 16141, "atom2_serNum": 19377, "donAcc_type": "standard", "distance": 2.977, "atom1_id": "///A/778/O", "atom2_id": "///G/559/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1880, "atom1_serNum": 16146, "atom2_serNum": 19394, "donAcc_type": "standard", "distance": 3.682, "atom1_id": "///A/779/O", "atom2_id": "///G/560/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1881, "atom1_serNum": 16155, "atom2_serNum": 16160, "donAcc_type": "acceptable", "distance": 3.114, "atom1_id": "///A/780/OG", "atom2_id": "///A/782/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1882, "atom1_serNum": 16166, "atom2_serNum": 16168, "donAcc_type": "standard", "distance": 2.863, "atom1_id": "///A/782/OD1", "atom2_id": "///A/783/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1883, "atom1_serNum": 16166, "atom2_serNum": 16173, "donAcc_type": "standard", "distance": 2.809, "atom1_id": "///A/782/OD1", "atom2_id": "///A/784/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1884, "atom1_serNum": 16171, "atom2_serNum": 16200, "donAcc_type": "standard", "distance": 2.999, "atom1_id": "///A/783/O", "atom2_id": "///A/787/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1885, "atom1_serNum": 16176, "atom2_serNum": 16208, "donAcc_type": "standard", "distance": 2.898, "atom1_id": "///A/784/O", "atom2_id": "///A/788/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1886, "atom1_serNum": 16183, "atom2_serNum": 21670, "donAcc_type": "standard", "distance": 3.092, "atom1_id": "///A/784/NH2", "atom2_id": "///A/1001/O3B", "atom_pair": "N:O", "residue_pair": "aa:ligand" }, { "index": 1887, "atom1_serNum": 16187, "atom2_serNum": 16216, "donAcc_type": "standard", "distance": 2.917, "atom1_id": "///A/785/O", "atom2_id": "///A/789/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1888, "atom1_serNum": 16198, "atom2_serNum": 16224, "donAcc_type": "standard", "distance": 2.959, "atom1_id": "///A/786/O", "atom2_id": "///A/790/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1889, "atom1_serNum": 16211, "atom2_serNum": 16241, "donAcc_type": "standard", "distance": 2.951, "atom1_id": "///A/788/O", "atom2_id": "///A/792/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1890, "atom1_serNum": 16214, "atom2_serNum": 16239, "donAcc_type": "standard", "distance": 3.636, "atom1_id": "///A/788/OD1", "atom2_id": "///A/791/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1891, "atom1_serNum": 16219, "atom2_serNum": 16252, "donAcc_type": "standard", "distance": 2.878, "atom1_id": "///A/789/O", "atom2_id": "///A/793/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1892, "atom1_serNum": 16227, "atom2_serNum": 16257, "donAcc_type": "standard", "distance": 2.943, "atom1_id": "///A/790/O", "atom2_id": "///A/794/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1893, "atom1_serNum": 16233, "atom2_serNum": 16264, "donAcc_type": "standard", "distance": 2.952, "atom1_id": "///A/791/O", "atom2_id": "///A/795/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1894, "atom1_serNum": 16244, "atom2_serNum": 16273, "donAcc_type": "standard", "distance": 2.889, "atom1_id": "///A/792/O", "atom2_id": "///A/796/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1895, "atom1_serNum": 16248, "atom2_serNum": 16423, "donAcc_type": "standard", "distance": 2.844, "atom1_id": "///A/792/NE", "atom2_id": "///A/816/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1896, "atom1_serNum": 16251, "atom2_serNum": 16423, "donAcc_type": "standard", "distance": 2.975, "atom1_id": "///A/792/NH2", "atom2_id": "///A/816/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1897, "atom1_serNum": 16255, "atom2_serNum": 16281, "donAcc_type": "standard", "distance": 2.926, "atom1_id": "///A/793/O", "atom2_id": "///A/797/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1898, "atom1_serNum": 16260, "atom2_serNum": 16286, "donAcc_type": "standard", "distance": 2.913, "atom1_id": "///A/794/O", "atom2_id": "///A/798/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1899, "atom1_serNum": 16276, "atom2_serNum": 16301, "donAcc_type": "standard", "distance": 3.514, "atom1_id": "///A/796/O", "atom2_id": "///A/800/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1900, "atom1_serNum": 16289, "atom2_serNum": 16306, "donAcc_type": "standard", "distance": 3.380, "atom1_id": "///A/798/O", "atom2_id": "///A/801/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1901, "atom1_serNum": 16330, "atom2_serNum": 16340, "donAcc_type": "standard", "distance": 2.980, "atom1_id": "///A/804/O", "atom2_id": "///A/806/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1902, "atom1_serNum": 16343, "atom2_serNum": 16363, "donAcc_type": "standard", "distance": 2.970, "atom1_id": "///A/806/O", "atom2_id": "///A/809/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1903, "atom1_serNum": 16343, "atom2_serNum": 16373, "donAcc_type": "standard", "distance": 3.499, "atom1_id": "///A/806/O", "atom2_id": "///A/810/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1904, "atom1_serNum": 16350, "atom2_serNum": 16380, "donAcc_type": "standard", "distance": 2.927, "atom1_id": "///A/807/O", "atom2_id": "///A/811/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1905, "atom1_serNum": 16358, "atom2_serNum": 16389, "donAcc_type": "standard", "distance": 2.928, "atom1_id": "///A/808/O", "atom2_id": "///A/812/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1906, "atom1_serNum": 16366, "atom2_serNum": 16398, "donAcc_type": "standard", "distance": 2.945, "atom1_id": "///A/809/O", "atom2_id": "///A/813/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1907, "atom1_serNum": 16376, "atom2_serNum": 16403, "donAcc_type": "standard", "distance": 2.855, "atom1_id": "///A/810/O", "atom2_id": "///A/814/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1908, "atom1_serNum": 16383, "atom2_serNum": 16411, "donAcc_type": "standard", "distance": 2.959, "atom1_id": "///A/811/O", "atom2_id": "///A/815/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1909, "atom1_serNum": 16392, "atom2_serNum": 16416, "donAcc_type": "standard", "distance": 2.935, "atom1_id": "///A/812/O", "atom2_id": "///A/816/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1910, "atom1_serNum": 16397, "atom2_serNum": 16424, "donAcc_type": "standard", "distance": 3.541, "atom1_id": "///A/812/NE2", "atom2_id": "///A/816/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1911, "atom1_serNum": 16401, "atom2_serNum": 16425, "donAcc_type": "standard", "distance": 2.927, "atom1_id": "///A/813/O", "atom2_id": "///A/817/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1912, "atom1_serNum": 16406, "atom2_serNum": 16433, "donAcc_type": "standard", "distance": 2.918, "atom1_id": "///A/814/O", "atom2_id": "///A/818/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1913, "atom1_serNum": 16449, "atom2_serNum": 16451, "donAcc_type": "acceptable", "distance": 2.365, "atom1_id": "///A/820/O", "atom2_id": "///A/820/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1914, "atom1_serNum": 16460, "atom2_serNum": 16487, "donAcc_type": "standard", "distance": 2.945, "atom1_id": "///A/822/O", "atom2_id": "///A/826/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1915, "atom1_serNum": 16465, "atom2_serNum": 16973, "donAcc_type": "standard", "distance": 3.169, "atom1_id": "///A/822/NZ", "atom2_id": "///A/889/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1916, "atom1_serNum": 16469, "atom2_serNum": 16495, "donAcc_type": "standard", "distance": 2.921, "atom1_id": "///A/823/O", "atom2_id": "///A/827/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1917, "atom1_serNum": 16476, "atom2_serNum": 16506, "donAcc_type": "standard", "distance": 2.944, "atom1_id": "///A/824/O", "atom2_id": "///A/828/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1918, "atom1_serNum": 16485, "atom2_serNum": 16514, "donAcc_type": "standard", "distance": 3.176, "atom1_id": "///A/825/O", "atom2_id": "///A/829/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1919, "atom1_serNum": 16490, "atom2_serNum": 16562, "donAcc_type": "standard", "distance": 3.247, "atom1_id": "///A/826/O", "atom2_id": "///A/834/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1920, "atom1_serNum": 16498, "atom2_serNum": 16562, "donAcc_type": "standard", "distance": 3.583, "atom1_id": "///A/827/O", "atom2_id": "///A/834/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1921, "atom1_serNum": 16509, "atom2_serNum": 16513, "donAcc_type": "standard", "distance": 2.851, "atom1_id": "///A/828/O", "atom2_id": "///A/828/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1922, "atom1_serNum": 16523, "atom2_serNum": 16545, "donAcc_type": "standard", "distance": 2.922, "atom1_id": "///A/830/O", "atom2_id": "///A/833/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1923, "atom1_serNum": 16523, "atom2_serNum": 16554, "donAcc_type": "standard", "distance": 2.904, "atom1_id": "///A/830/O", "atom2_id": "///A/834/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1924, "atom1_serNum": 16529, "atom2_serNum": 16563, "donAcc_type": "standard", "distance": 2.968, "atom1_id": "///A/831/O", "atom2_id": "///A/835/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1925, "atom1_serNum": 16540, "atom2_serNum": 16571, "donAcc_type": "standard", "distance": 2.930, "atom1_id": "///A/832/O", "atom2_id": "///A/836/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1926, "atom1_serNum": 16548, "atom2_serNum": 16582, "donAcc_type": "standard", "distance": 2.898, "atom1_id": "///A/833/O", "atom2_id": "///A/837/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1927, "atom1_serNum": 16552, "atom2_serNum": 16943, "donAcc_type": "standard", "distance": 3.281, "atom1_id": "///A/833/OE1", "atom2_id": "///A/884/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1928, "atom1_serNum": 16557, "atom2_serNum": 16590, "donAcc_type": "standard", "distance": 2.939, "atom1_id": "///A/834/O", "atom2_id": "///A/838/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1929, "atom1_serNum": 16566, "atom2_serNum": 16599, "donAcc_type": "standard", "distance": 2.957, "atom1_id": "///A/835/O", "atom2_id": "///A/839/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1930, "atom1_serNum": 16574, "atom2_serNum": 16604, "donAcc_type": "standard", "distance": 2.991, "atom1_id": "///A/836/O", "atom2_id": "///A/840/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1931, "atom1_serNum": 16585, "atom2_serNum": 16612, "donAcc_type": "standard", "distance": 3.652, "atom1_id": "///A/837/O", "atom2_id": "///A/841/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1932, "atom1_serNum": 16593, "atom2_serNum": 16617, "donAcc_type": "standard", "distance": 2.918, "atom1_id": "///A/838/O", "atom2_id": "///A/842/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1933, "atom1_serNum": 16602, "atom2_serNum": 16622, "donAcc_type": "standard", "distance": 2.926, "atom1_id": "///A/839/O", "atom2_id": "///A/843/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1934, "atom1_serNum": 16607, "atom2_serNum": 16631, "donAcc_type": "standard", "distance": 2.941, "atom1_id": "///A/840/O", "atom2_id": "///A/844/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1935, "atom1_serNum": 16615, "atom2_serNum": 16638, "donAcc_type": "standard", "distance": 2.943, "atom1_id": "///A/841/O", "atom2_id": "///A/845/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1936, "atom1_serNum": 16615, "atom2_serNum": 16643, "donAcc_type": "acceptable", "distance": 2.970, "atom1_id": "///A/841/O", "atom2_id": "///A/845/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1937, "atom1_serNum": 16620, "atom2_serNum": 16645, "donAcc_type": "standard", "distance": 2.909, "atom1_id": "///A/842/O", "atom2_id": "///A/846/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1938, "atom1_serNum": 16625, "atom2_serNum": 16656, "donAcc_type": "standard", "distance": 2.909, "atom1_id": "///A/843/O", "atom2_id": "///A/847/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1939, "atom1_serNum": 16625, "atom2_serNum": 16661, "donAcc_type": "acceptable", "distance": 3.063, "atom1_id": "///A/843/O", "atom2_id": "///A/847/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1940, "atom1_serNum": 16629, "atom2_serNum": 16652, "donAcc_type": "standard", "distance": 2.720, "atom1_id": "///A/843/OE1", "atom2_id": "///A/846/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1941, "atom1_serNum": 16629, "atom2_serNum": 16765, "donAcc_type": "standard", "distance": 3.949, "atom1_id": "///A/843/OE1", "atom2_id": "///A/860/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1942, "atom1_serNum": 16630, "atom2_serNum": 16655, "donAcc_type": "standard", "distance": 2.763, "atom1_id": "///A/843/OE2", "atom2_id": "///A/846/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1943, "atom1_serNum": 16634, "atom2_serNum": 16663, "donAcc_type": "standard", "distance": 3.014, "atom1_id": "///A/844/O", "atom2_id": "///A/848/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1944, "atom1_serNum": 16659, "atom2_serNum": 16667, "donAcc_type": "standard", "distance": 3.037, "atom1_id": "///A/847/O", "atom2_id": "///A/849/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1945, "atom1_serNum": 16661, "atom2_serNum": 16670, "donAcc_type": "acceptable", "distance": 3.616, "atom1_id": "///A/847/OG1", "atom2_id": "///A/849/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1946, "atom1_serNum": 16674, "atom2_serNum": 16681, "donAcc_type": "standard", "distance": 2.707, "atom1_id": "///A/850/N", "atom2_id": "///A/850/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1947, "atom1_serNum": 16695, "atom2_serNum": 16697, "donAcc_type": "acceptable", "distance": 2.902, "atom1_id": "///A/852/O", "atom2_id": "///A/852/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1948, "atom1_serNum": 16695, "atom2_serNum": 17100, "donAcc_type": "standard", "distance": 2.630, "atom1_id": "///A/852/O", "atom2_id": "///A/904/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1949, "atom1_serNum": 16697, "atom2_serNum": 17103, "donAcc_type": "acceptable", "distance": 3.113, "atom1_id": "///A/852/OG1", "atom2_id": "///A/904/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1950, "atom1_serNum": 16702, "atom2_serNum": 16729, "donAcc_type": "standard", "distance": 3.463, "atom1_id": "///A/853/O", "atom2_id": "///A/857/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1951, "atom1_serNum": 16706, "atom2_serNum": 17085, "donAcc_type": "standard", "distance": 2.967, "atom1_id": "///A/854/N", "atom2_id": "///A/902/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1952, "atom1_serNum": 16709, "atom2_serNum": 16736, "donAcc_type": "standard", "distance": 2.880, "atom1_id": "///A/854/O", "atom2_id": "///A/858/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1953, "atom1_serNum": 16720, "atom2_serNum": 16748, "donAcc_type": "standard", "distance": 3.000, "atom1_id": "///A/855/O", "atom2_id": "///A/859/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1954, "atom1_serNum": 16728, "atom2_serNum": 16757, "donAcc_type": "standard", "distance": 2.978, "atom1_id": "///A/856/O", "atom2_id": "///A/860/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1955, "atom1_serNum": 16732, "atom2_serNum": 16766, "donAcc_type": "standard", "distance": 2.850, "atom1_id": "///A/857/O", "atom2_id": "///A/861/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1956, "atom1_serNum": 16739, "atom2_serNum": 16773, "donAcc_type": "standard", "distance": 2.931, "atom1_id": "///A/858/O", "atom2_id": "///A/862/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1957, "atom1_serNum": 16747, "atom2_serNum": 16781, "donAcc_type": "acceptable", "distance": 2.731, "atom1_id": "///A/858/OH", "atom2_id": "///A/862/OE2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1958, "atom1_serNum": 16747, "atom2_serNum": 16858, "donAcc_type": "acceptable", "distance": 3.191, "atom1_id": "///A/858/OH", "atom2_id": "///A/873/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1959, "atom1_serNum": 16751, "atom2_serNum": 16782, "donAcc_type": "standard", "distance": 3.019, "atom1_id": "///A/859/O", "atom2_id": "///A/863/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1960, "atom1_serNum": 16760, "atom2_serNum": 16789, "donAcc_type": "standard", "distance": 2.946, "atom1_id": "///A/860/O", "atom2_id": "///A/864/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1961, "atom1_serNum": 16769, "atom2_serNum": 16797, "donAcc_type": "standard", "distance": 2.866, "atom1_id": "///A/861/O", "atom2_id": "///A/865/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1962, "atom1_serNum": 16776, "atom2_serNum": 16802, "donAcc_type": "standard", "distance": 2.909, "atom1_id": "///A/862/O", "atom2_id": "///A/866/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1963, "atom1_serNum": 16785, "atom2_serNum": 16807, "donAcc_type": "standard", "distance": 2.982, "atom1_id": "///A/863/O", "atom2_id": "///A/867/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1964, "atom1_serNum": 16792, "atom2_serNum": 16818, "donAcc_type": "standard", "distance": 2.907, "atom1_id": "///A/864/O", "atom2_id": "///A/868/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1965, "atom1_serNum": 16800, "atom2_serNum": 16826, "donAcc_type": "standard", "distance": 3.012, "atom1_id": "///A/865/O", "atom2_id": "///A/869/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1966, "atom1_serNum": 16800, "atom2_serNum": 16833, "donAcc_type": "questionable", "distance": 2.883, "atom1_id": "///A/865/O", "atom2_id": "///A/870/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1967, "atom1_serNum": 16865, "atom2_serNum": 16880, "donAcc_type": "standard", "distance": 2.828, "atom1_id": "///A/874/O", "atom2_id": "///A/877/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1968, "atom1_serNum": 16865, "atom2_serNum": 16891, "donAcc_type": "standard", "distance": 3.232, "atom1_id": "///A/874/O", "atom2_id": "///A/878/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1969, "atom1_serNum": 16872, "atom2_serNum": 16896, "donAcc_type": "standard", "distance": 2.908, "atom1_id": "///A/875/O", "atom2_id": "///A/879/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1970, "atom1_serNum": 16883, "atom2_serNum": 16915, "donAcc_type": "standard", "distance": 3.020, "atom1_id": "///A/877/O", "atom2_id": "///A/881/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1971, "atom1_serNum": 16894, "atom2_serNum": 16923, "donAcc_type": "standard", "distance": 2.910, "atom1_id": "///A/878/O", "atom2_id": "///A/882/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1972, "atom1_serNum": 16899, "atom2_serNum": 16929, "donAcc_type": "standard", "distance": 2.880, "atom1_id": "///A/879/O", "atom2_id": "///A/883/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1973, "atom1_serNum": 16907, "atom2_serNum": 16935, "donAcc_type": "standard", "distance": 2.955, "atom1_id": "///A/880/O", "atom2_id": "///A/884/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1974, "atom1_serNum": 16918, "atom2_serNum": 16944, "donAcc_type": "standard", "distance": 2.989, "atom1_id": "///A/881/O", "atom2_id": "///A/885/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1975, "atom1_serNum": 16926, "atom2_serNum": 16952, "donAcc_type": "standard", "distance": 2.901, "atom1_id": "///A/882/O", "atom2_id": "///A/886/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1976, "atom1_serNum": 16932, "atom2_serNum": 16956, "donAcc_type": "standard", "distance": 2.894, "atom1_id": "///A/883/O", "atom2_id": "///A/887/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1977, "atom1_serNum": 16938, "atom2_serNum": 16961, "donAcc_type": "standard", "distance": 2.971, "atom1_id": "///A/884/O", "atom2_id": "///A/888/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1978, "atom1_serNum": 16943, "atom2_serNum": 16968, "donAcc_type": "standard", "distance": 2.599, "atom1_id": "///A/884/NZ", "atom2_id": "///A/888/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1979, "atom1_serNum": 16947, "atom2_serNum": 16981, "donAcc_type": "standard", "distance": 2.958, "atom1_id": "///A/885/O", "atom2_id": "///A/890/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1980, "atom1_serNum": 16947, "atom2_serNum": 16989, "donAcc_type": "standard", "distance": 3.335, "atom1_id": "///A/885/O", "atom2_id": "///A/891/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1981, "atom1_serNum": 16955, "atom2_serNum": 16979, "donAcc_type": "standard", "distance": 2.472, "atom1_id": "///A/886/O", "atom2_id": "///A/889/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1982, "atom1_serNum": 16973, "atom2_serNum": 17131, "donAcc_type": "standard", "distance": 2.868, "atom1_id": "///A/889/O", "atom2_id": "///A/907/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1983, "atom1_serNum": 16980, "atom2_serNum": 19925, "donAcc_type": "standard", "distance": 3.098, "atom1_id": "///A/889/NH2", "atom2_id": "///G/625/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1984, "atom1_serNum": 16984, "atom2_serNum": 17124, "donAcc_type": "standard", "distance": 3.326, "atom1_id": "///A/890/O", "atom2_id": "///A/907/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1985, "atom1_serNum": 16984, "atom2_serNum": 17132, "donAcc_type": "standard", "distance": 3.296, "atom1_id": "///A/890/O", "atom2_id": "///A/908/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1986, "atom1_serNum": 16997, "atom2_serNum": 17111, "donAcc_type": "standard", "distance": 2.903, "atom1_id": "///A/892/N", "atom2_id": "///A/905/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1987, "atom1_serNum": 17000, "atom2_serNum": 17108, "donAcc_type": "standard", "distance": 2.885, "atom1_id": "///A/892/O", "atom2_id": "///A/905/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1988, "atom1_serNum": 17011, "atom2_serNum": 17094, "donAcc_type": "standard", "distance": 3.688, "atom1_id": "///A/894/N", "atom2_id": "///A/903/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1989, "atom1_serNum": 17019, "atom2_serNum": 17091, "donAcc_type": "standard", "distance": 3.612, "atom1_id": "///A/894/OE2", "atom2_id": "///A/903/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1990, "atom1_serNum": 17023, "atom2_serNum": 17053, "donAcc_type": "questionable", "distance": 2.826, "atom1_id": "///A/895/O", "atom2_id": "///A/898/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1991, "atom1_serNum": 17026, "atom2_serNum": 17036, "donAcc_type": "acceptable", "distance": 3.141, "atom1_id": "///A/895/ND1", "atom2_id": "///A/897/N", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 1992, "atom1_serNum": 17050, "atom2_serNum": 17082, "donAcc_type": "standard", "distance": 3.043, "atom1_id": "///A/898/O", "atom2_id": "///A/902/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1993, "atom1_serNum": 17119, "atom2_serNum": 19940, "donAcc_type": "standard", "distance": 3.312, "atom1_id": "///A/906/O", "atom2_id": "///G/627/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1994, "atom1_serNum": 17142, "atom2_serNum": 17166, "donAcc_type": "standard", "distance": 3.672, "atom1_id": "///A/909/O", "atom2_id": "///A/913/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1995, "atom1_serNum": 17144, "atom2_serNum": 17156, "donAcc_type": "acceptable", "distance": 2.659, "atom1_id": "///A/909/OG", "atom2_id": "///A/911/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1996, "atom1_serNum": 17150, "atom2_serNum": 17156, "donAcc_type": "standard", "distance": 2.598, "atom1_id": "///A/911/N", "atom2_id": "///A/911/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1997, "atom1_serNum": 17153, "atom2_serNum": 17184, "donAcc_type": "standard", "distance": 2.949, "atom1_id": "///A/911/O", "atom2_id": "///A/915/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1998, "atom1_serNum": 17156, "atom2_serNum": 17158, "donAcc_type": "standard", "distance": 2.919, "atom1_id": "///A/911/OD1", "atom2_id": "///A/912/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1999, "atom1_serNum": 17157, "atom2_serNum": 19637, "donAcc_type": "standard", "distance": 3.548, "atom1_id": "///A/911/OD2", "atom2_id": "///G/589/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2000, "atom1_serNum": 17161, "atom2_serNum": 17196, "donAcc_type": "standard", "distance": 2.912, "atom1_id": "///A/912/O", "atom2_id": "///A/916/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2001, "atom1_serNum": 17169, "atom2_serNum": 17201, "donAcc_type": "standard", "distance": 2.916, "atom1_id": "///A/913/O", "atom2_id": "///A/917/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2002, "atom1_serNum": 17177, "atom2_serNum": 17209, "donAcc_type": "standard", "distance": 2.923, "atom1_id": "///A/914/O", "atom2_id": "///A/918/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2003, "atom1_serNum": 17239, "atom2_serNum": 17245, "donAcc_type": "standard", "distance": 2.708, "atom1_id": "///G/250/N", "atom2_id": "///G/250/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2004, "atom1_serNum": 17242, "atom2_serNum": 17277, "donAcc_type": "standard", "distance": 2.946, "atom1_id": "///G/250/O", "atom2_id": "///G/254/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2005, "atom1_serNum": 17246, "atom2_serNum": 19180, "donAcc_type": "standard", "distance": 3.958, "atom1_id": "///G/250/ND2", "atom2_id": "///G/494/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2006, "atom1_serNum": 17250, "atom2_serNum": 17285, "donAcc_type": "standard", "distance": 2.889, "atom1_id": "///G/251/O", "atom2_id": "///G/255/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2007, "atom1_serNum": 17259, "atom2_serNum": 17290, "donAcc_type": "standard", "distance": 2.949, "atom1_id": "///G/252/O", "atom2_id": "///G/256/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2008, "atom1_serNum": 17267, "atom2_serNum": 19231, "donAcc_type": "acceptable", "distance": 2.856, "atom1_id": "///G/252/OH", "atom2_id": "///G/527/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 2009, "atom1_serNum": 17271, "atom2_serNum": 17301, "donAcc_type": "standard", "distance": 2.916, "atom1_id": "///G/253/O", "atom2_id": "///G/257/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2010, "atom1_serNum": 17276, "atom2_serNum": 19181, "donAcc_type": "standard", "distance": 3.185, "atom1_id": "///G/253/NE2", "atom2_id": "///G/494/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2011, "atom1_serNum": 17280, "atom2_serNum": 17312, "donAcc_type": "standard", "distance": 2.935, "atom1_id": "///G/254/O", "atom2_id": "///G/258/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2012, "atom1_serNum": 17288, "atom2_serNum": 17319, "donAcc_type": "standard", "distance": 2.973, "atom1_id": "///G/255/O", "atom2_id": "///G/259/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2013, "atom1_serNum": 17315, "atom2_serNum": 18850, "donAcc_type": "standard", "distance": 3.912, "atom1_id": "///G/258/O", "atom2_id": "///G/450/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2014, "atom1_serNum": 17322, "atom2_serNum": 17335, "donAcc_type": "standard", "distance": 2.518, "atom1_id": "///G/259/O", "atom2_id": "///G/261/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2015, "atom1_serNum": 17338, "atom2_serNum": 17340, "donAcc_type": "acceptable", "distance": 2.289, "atom1_id": "///G/261/O", "atom2_id": "///G/261/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 2016, "atom1_serNum": 17344, "atom2_serNum": 21714, "donAcc_type": "acceptable", "distance": 2.421, "atom1_id": "///G/262/O", "atom2_id": "///G/901/O2'", "atom_pair": "O:O", "residue_pair": "aa:ligand" }, { "index": 2017, "atom1_serNum": 17360, "atom2_serNum": 21714, "donAcc_type": "acceptable", "distance": 3.431, "atom1_id": "///G/264/OG1", "atom2_id": "///G/901/O2'", "atom_pair": "O:O", "residue_pair": "aa:ligand" }, { "index": 2018, "atom1_serNum": 17371, "atom2_serNum": 17377, "donAcc_type": "standard", "distance": 2.579, "atom1_id": "///G/266/N", "atom2_id": "///G/266/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2019, "atom1_serNum": 17378, "atom2_serNum": 18873, "donAcc_type": "standard", "distance": 2.980, "atom1_id": "///G/266/ND2", "atom2_id": "///G/453/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2020, "atom1_serNum": 17405, "atom2_serNum": 17648, "donAcc_type": "standard", "distance": 3.171, "atom1_id": "///G/270/NE", "atom2_id": "///G/301/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2021, "atom1_serNum": 17407, "atom2_serNum": 17432, "donAcc_type": "questionable", "distance": 3.364, "atom1_id": "///G/270/NH1", "atom2_id": "///G/273/NE2", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 2022, "atom1_serNum": 17407, "atom2_serNum": 18727, "donAcc_type": "standard", "distance": 3.393, "atom1_id": "///G/270/NH1", "atom2_id": "///G/436/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2023, "atom1_serNum": 17408, "atom2_serNum": 17648, "donAcc_type": "standard", "distance": 3.262, "atom1_id": "///G/270/NH2", "atom2_id": "///G/301/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2024, "atom1_serNum": 17408, "atom2_serNum": 18727, "donAcc_type": "standard", "distance": 2.392, "atom1_id": "///G/270/NH2", "atom2_id": "///G/436/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2025, "atom1_serNum": 17412, "atom2_serNum": 17441, "donAcc_type": "standard", "distance": 2.928, "atom1_id": "///G/271/O", "atom2_id": "///G/275/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2026, "atom1_serNum": 17421, "atom2_serNum": 17450, "donAcc_type": "standard", "distance": 2.927, "atom1_id": "///G/272/O", "atom2_id": "///G/276/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2027, "atom1_serNum": 17427, "atom2_serNum": 17459, "donAcc_type": "standard", "distance": 2.963, "atom1_id": "///G/273/O", "atom2_id": "///G/277/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2028, "atom1_serNum": 17436, "atom2_serNum": 17467, "donAcc_type": "standard", "distance": 2.911, "atom1_id": "///G/274/O", "atom2_id": "///G/278/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2029, "atom1_serNum": 17444, "atom2_serNum": 17478, "donAcc_type": "standard", "distance": 2.917, "atom1_id": "///G/275/O", "atom2_id": "///G/279/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2030, "atom1_serNum": 17453, "atom2_serNum": 17487, "donAcc_type": "standard", "distance": 2.957, "atom1_id": "///G/276/O", "atom2_id": "///G/280/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2031, "atom1_serNum": 17458, "atom2_serNum": 18686, "donAcc_type": "standard", "distance": 3.089, "atom1_id": "///G/276/OE2", "atom2_id": "///G/431/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2032, "atom1_serNum": 17462, "atom2_serNum": 17498, "donAcc_type": "standard", "distance": 2.994, "atom1_id": "///G/277/O", "atom2_id": "///G/281/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2033, "atom1_serNum": 17470, "atom2_serNum": 17509, "donAcc_type": "standard", "distance": 2.877, "atom1_id": "///G/278/O", "atom2_id": "///G/282/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2034, "atom1_serNum": 17470, "atom2_serNum": 17514, "donAcc_type": "acceptable", "distance": 2.374, "atom1_id": "///G/278/O", "atom2_id": "///G/282/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 2035, "atom1_serNum": 17476, "atom2_serNum": 17739, "donAcc_type": "standard", "distance": 2.855, "atom1_id": "///G/278/NH1", "atom2_id": "///G/313/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2036, "atom1_serNum": 17481, "atom2_serNum": 17515, "donAcc_type": "standard", "distance": 2.939, "atom1_id": "///G/279/O", "atom2_id": "///G/283/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2037, "atom1_serNum": 17490, "atom2_serNum": 17523, "donAcc_type": "standard", "distance": 3.015, "atom1_id": "///G/280/O", "atom2_id": "///G/284/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2038, "atom1_serNum": 17501, "atom2_serNum": 17533, "donAcc_type": "standard", "distance": 2.917, "atom1_id": "///G/281/O", "atom2_id": "///G/285/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2039, "atom1_serNum": 17512, "atom2_serNum": 17541, "donAcc_type": "standard", "distance": 2.892, "atom1_id": "///G/282/O", "atom2_id": "///G/286/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2040, "atom1_serNum": 17515, "atom2_serNum": 17521, "donAcc_type": "standard", "distance": 2.742, "atom1_id": "///G/283/N", "atom2_id": "///G/283/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2041, "atom1_serNum": 17518, "atom2_serNum": 17550, "donAcc_type": "standard", "distance": 2.949, "atom1_id": "///G/283/O", "atom2_id": "///G/287/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2042, "atom1_serNum": 17518, "atom2_serNum": 17555, "donAcc_type": "acceptable", "distance": 3.010, "atom1_id": "///G/283/O", "atom2_id": "///G/287/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 2043, "atom1_serNum": 17536, "atom2_serNum": 17564, "donAcc_type": "standard", "distance": 3.273, "atom1_id": "///G/285/O", "atom2_id": "///G/288/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2044, "atom1_serNum": 17563, "atom2_serNum": 18459, "donAcc_type": "standard", "distance": 2.925, "atom1_id": "///G/288/OE1", "atom2_id": "///G/402/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2045, "atom1_serNum": 17577, "atom2_serNum": 18447, "donAcc_type": "acceptable", "distance": 2.523, "atom1_id": "///G/290/OG", "atom2_id": "///G/401/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 2046, "atom1_serNum": 17577, "atom2_serNum": 18464, "donAcc_type": "acceptable", "distance": 3.310, "atom1_id": "///G/290/OG", "atom2_id": "///G/403/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 2047, "atom1_serNum": 17578, "atom2_serNum": 18464, "donAcc_type": "standard", "distance": 3.714, "atom1_id": "///G/291/N", "atom2_id": "///G/403/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2048, "atom1_serNum": 17585, "atom2_serNum": 18676, "donAcc_type": "standard", "distance": 3.373, "atom1_id": "///G/292/O", "atom2_id": "///G/431/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2049, "atom1_serNum": 17588, "atom2_serNum": 18480, "donAcc_type": "standard", "distance": 2.864, "atom1_id": "///G/293/N", "atom2_id": "///G/405/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2050, "atom1_serNum": 17591, "atom2_serNum": 18492, "donAcc_type": "standard", "distance": 2.933, "atom1_id": "///G/293/O", "atom2_id": "///G/407/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2051, "atom1_serNum": 17596, "atom2_serNum": 18679, "donAcc_type": "standard", "distance": 2.882, "atom1_id": "///G/294/N", "atom2_id": "///G/431/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2052, "atom1_serNum": 17599, "atom2_serNum": 18695, "donAcc_type": "standard", "distance": 2.937, "atom1_id": "///G/294/O", "atom2_id": "///G/433/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2053, "atom1_serNum": 17607, "atom2_serNum": 18520, "donAcc_type": "acceptable", "distance": 2.379, "atom1_id": "///G/294/OH", "atom2_id": "///G/411/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 2054, "atom1_serNum": 17607, "atom2_serNum": 18539, "donAcc_type": "acceptable", "distance": 3.934, "atom1_id": "///G/294/OH", "atom2_id": "///G/414/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2055, "atom1_serNum": 17608, "atom2_serNum": 18495, "donAcc_type": "standard", "distance": 2.898, "atom1_id": "///G/295/N", "atom2_id": "///G/407/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2056, "atom1_serNum": 17611, "atom2_serNum": 18504, "donAcc_type": "standard", "distance": 2.950, "atom1_id": "///G/295/O", "atom2_id": "///G/409/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2057, "atom1_serNum": 17615, "atom2_serNum": 18698, "donAcc_type": "standard", "distance": 2.931, "atom1_id": "///G/296/N", "atom2_id": "///G/433/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2058, "atom1_serNum": 17618, "atom2_serNum": 18713, "donAcc_type": "standard", "distance": 2.866, "atom1_id": "///G/296/O", "atom2_id": "///G/435/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2059, "atom1_serNum": 17620, "atom2_serNum": 18709, "donAcc_type": "acceptable", "distance": 3.230, "atom1_id": "///G/296/OG", "atom2_id": "///G/434/ND1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2060, "atom1_serNum": 17621, "atom2_serNum": 18507, "donAcc_type": "standard", "distance": 3.001, "atom1_id": "///G/297/N", "atom2_id": "///G/409/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2061, "atom1_serNum": 17624, "atom2_serNum": 18516, "donAcc_type": "standard", "distance": 3.032, "atom1_id": "///G/297/O", "atom2_id": "///G/410/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2062, "atom1_serNum": 17628, "atom2_serNum": 17645, "donAcc_type": "standard", "distance": 3.393, "atom1_id": "///G/298/O", "atom2_id": "///G/301/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2063, "atom1_serNum": 17628, "atom2_serNum": 17650, "donAcc_type": "acceptable", "distance": 2.749, "atom1_id": "///G/298/O", "atom2_id": "///G/301/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 2064, "atom1_serNum": 17641, "atom2_serNum": 21702, "donAcc_type": "standard", "distance": 3.200, "atom1_id": "///G/300/N", "atom2_id": "///G/901/O3B", "atom_pair": "N:O", "residue_pair": "aa:ligand" }, { "index": 2065, "atom1_serNum": 17644, "atom2_serNum": 19053, "donAcc_type": "standard", "distance": 3.303, "atom1_id": "///G/300/O", "atom2_id": "///G/479/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2066, "atom1_serNum": 17650, "atom2_serNum": 17664, "donAcc_type": "acceptable", "distance": 3.656, "atom1_id": "///G/301/OG1", "atom2_id": "///G/303/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2067, "atom1_serNum": 17652, "atom2_serNum": 21706, "donAcc_type": "standard", "distance": 3.384, "atom1_id": "///G/302/N", "atom2_id": "///G/901/O3A", "atom_pair": "N:O", "residue_pair": "aa:ligand" }, { "index": 2068, "atom1_serNum": 17659, "atom2_serNum": 17683, "donAcc_type": "standard", "distance": 3.015, "atom1_id": "///G/303/O", "atom2_id": "///G/307/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2069, "atom1_serNum": 17664, "atom2_serNum": 21696, "donAcc_type": "acceptable", "distance": 3.119, "atom1_id": "///G/303/NZ", "atom2_id": "///G/901/O1G", "atom_pair": "N:O", "residue_pair": "aa:ligand" }, { "index": 2070, "atom1_serNum": 17664, "atom2_serNum": 21700, "donAcc_type": "acceptable", "distance": 2.771, "atom1_id": "///G/303/NZ", "atom2_id": "///G/901/O1B", "atom_pair": "N:O", "residue_pair": "aa:ligand" }, { "index": 2071, "atom1_serNum": 17668, "atom2_serNum": 17691, "donAcc_type": "standard", "distance": 2.821, "atom1_id": "///G/304/O", "atom2_id": "///G/308/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2072, "atom1_serNum": 17670, "atom2_serNum": 18246, "donAcc_type": "acceptable", "distance": 3.266, "atom1_id": "///G/304/OG1", "atom2_id": "///G/376/OD2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 2073, "atom1_serNum": 17672, "atom2_serNum": 21705, "donAcc_type": "acceptable", "distance": 2.783, "atom1_id": "///G/305/N", "atom2_id": "///G/901/O2A", "atom_pair": "N:O", "residue_pair": "aa:ligand" }, { "index": 2074, "atom1_serNum": 17675, "atom2_serNum": 17697, "donAcc_type": "standard", "distance": 2.924, "atom1_id": "///G/305/O", "atom2_id": "///G/309/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2075, "atom1_serNum": 17680, "atom2_serNum": 17705, "donAcc_type": "standard", "distance": 2.943, "atom1_id": "///G/306/O", "atom2_id": "///G/310/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2076, "atom1_serNum": 17686, "atom2_serNum": 17713, "donAcc_type": "standard", "distance": 2.920, "atom1_id": "///G/307/O", "atom2_id": "///G/311/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2077, "atom1_serNum": 17700, "atom2_serNum": 17721, "donAcc_type": "standard", "distance": 3.506, "atom1_id": "///G/309/O", "atom2_id": "///G/312/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2078, "atom1_serNum": 17735, "atom2_serNum": 17766, "donAcc_type": "standard", "distance": 2.882, "atom1_id": "///G/313/O", "atom2_id": "///G/317/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2079, "atom1_serNum": 17735, "atom2_serNum": 17818, "donAcc_type": "standard", "distance": 3.224, "atom1_id": "///G/313/O", "atom2_id": "///G/322/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2080, "atom1_serNum": 17743, "atom2_serNum": 17771, "donAcc_type": "acceptable", "distance": 2.421, "atom1_id": "///G/314/O", "atom2_id": "///G/317/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 2081, "atom1_serNum": 17743, "atom2_serNum": 17772, "donAcc_type": "standard", "distance": 2.942, "atom1_id": "///G/314/O", "atom2_id": "///G/318/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2082, "atom1_serNum": 17747, "atom2_serNum": 17753, "donAcc_type": "standard", "distance": 2.643, "atom1_id": "///G/315/N", "atom2_id": "///G/315/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2083, "atom1_serNum": 17750, "atom2_serNum": 17781, "donAcc_type": "standard", "distance": 2.953, "atom1_id": "///G/315/O", "atom2_id": "///G/319/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2084, "atom1_serNum": 17753, "atom2_serNum": 17755, "donAcc_type": "standard", "distance": 2.694, "atom1_id": "///G/315/OD1", "atom2_id": "///G/316/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2085, "atom1_serNum": 17758, "atom2_serNum": 17792, "donAcc_type": "standard", "distance": 2.997, "atom1_id": "///G/316/O", "atom2_id": "///G/320/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2086, "atom1_serNum": 17758, "atom2_serNum": 17795, "donAcc_type": "questionable", "distance": 2.929, "atom1_id": "///G/316/O", "atom2_id": "///G/320/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 2087, "atom1_serNum": 17769, "atom2_serNum": 18190, "donAcc_type": "standard", "distance": 3.734, "atom1_id": "///G/317/O", "atom2_id": "///G/369/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2088, "atom1_serNum": 17800, "atom2_serNum": 18195, "donAcc_type": "standard", "distance": 2.660, "atom1_id": "///G/321/N", "atom2_id": "///G/370/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2089, "atom1_serNum": 17803, "atom2_serNum": 18208, "donAcc_type": "standard", "distance": 3.074, "atom1_id": "///G/321/O", "atom2_id": "///G/372/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2090, "atom1_serNum": 17807, "atom2_serNum": 18142, "donAcc_type": "standard", "distance": 3.988, "atom1_id": "///G/321/OE1", "atom2_id": "///G/363/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2091, "atom1_serNum": 17820, "atom2_serNum": 18211, "donAcc_type": "standard", "distance": 2.829, "atom1_id": "///G/323/N", "atom2_id": "///G/372/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2092, "atom1_serNum": 17823, "atom2_serNum": 18224, "donAcc_type": "standard", "distance": 2.946, "atom1_id": "///G/323/O", "atom2_id": "///G/374/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2093, "atom1_serNum": 17838, "atom2_serNum": 17854, "donAcc_type": "acceptable", "distance": 3.772, "atom1_id": "///G/324/OH", "atom2_id": "///G/326/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2094, "atom1_serNum": 17838, "atom2_serNum": 18246, "donAcc_type": "acceptable", "distance": 2.456, "atom1_id": "///G/324/OH", "atom2_id": "///G/376/OD2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 2095, "atom1_serNum": 17839, "atom2_serNum": 18227, "donAcc_type": "standard", "distance": 2.909, "atom1_id": "///G/325/N", "atom2_id": "///G/374/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2096, "atom1_serNum": 17842, "atom2_serNum": 18239, "donAcc_type": "standard", "distance": 2.923, "atom1_id": "///G/325/O", "atom2_id": "///G/376/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2097, "atom1_serNum": 17850, "atom2_serNum": 17868, "donAcc_type": "standard", "distance": 3.148, "atom1_id": "///G/326/O", "atom2_id": "///G/329/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2098, "atom1_serNum": 17850, "atom2_serNum": 17873, "donAcc_type": "acceptable", "distance": 2.994, "atom1_id": "///G/326/O", "atom2_id": "///G/329/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 2099, "atom1_serNum": 17855, "atom2_serNum": 18242, "donAcc_type": "standard", "distance": 2.937, "atom1_id": "///G/327/N", "atom2_id": "///G/376/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2100, "atom1_serNum": 17890, "atom2_serNum": 17904, "donAcc_type": "standard", "distance": 3.139, "atom1_id": "///G/332/O", "atom2_id": "///G/335/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2101, "atom1_serNum": 17903, "atom2_serNum": 18052, "donAcc_type": "questionable", "distance": 2.935, "atom1_id": "///G/334/O", "atom2_id": "///G/353/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 2102, "atom1_serNum": 17907, "atom2_serNum": 17928, "donAcc_type": "standard", "distance": 2.972, "atom1_id": "///G/335/O", "atom2_id": "///G/338/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2103, "atom1_serNum": 17907, "atom2_serNum": 17937, "donAcc_type": "standard", "distance": 3.307, "atom1_id": "///G/335/O", "atom2_id": "///G/339/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2104, "atom1_serNum": 17912, "atom2_serNum": 17946, "donAcc_type": "standard", "distance": 2.835, "atom1_id": "///G/336/O", "atom2_id": "///G/340/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2105, "atom1_serNum": 17919, "atom2_serNum": 17954, "donAcc_type": "standard", "distance": 2.893, "atom1_id": "///G/337/O", "atom2_id": "///G/341/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2106, "atom1_serNum": 17927, "atom2_serNum": 18340, "donAcc_type": "acceptable", "distance": 3.774, "atom1_id": "///G/337/OH", "atom2_id": "///G/388/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 2107, "atom1_serNum": 17931, "atom2_serNum": 17960, "donAcc_type": "standard", "distance": 3.102, "atom1_id": "///G/338/O", "atom2_id": "///G/342/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2108, "atom1_serNum": 17940, "atom2_serNum": 17965, "donAcc_type": "acceptable", "distance": 2.574, "atom1_id": "///G/339/O", "atom2_id": "///G/342/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 2109, "atom1_serNum": 17940, "atom2_serNum": 17967, "donAcc_type": "standard", "distance": 2.948, "atom1_id": "///G/339/O", "atom2_id": "///G/343/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2110, "atom1_serNum": 17945, "atom2_serNum": 17974, "donAcc_type": "standard", "distance": 3.637, "atom1_id": "///G/339/NZ", "atom2_id": "///G/343/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2111, "atom1_serNum": 17949, "atom2_serNum": 17976, "donAcc_type": "standard", "distance": 3.091, "atom1_id": "///G/340/O", "atom2_id": "///G/344/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2112, "atom1_serNum": 17957, "atom2_serNum": 17976, "donAcc_type": "standard", "distance": 3.006, "atom1_id": "///G/341/O", "atom2_id": "///G/344/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2113, "atom1_serNum": 17957, "atom2_serNum": 17984, "donAcc_type": "standard", "distance": 2.809, "atom1_id": "///G/341/O", "atom2_id": "///G/345/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2114, "atom1_serNum": 17957, "atom2_serNum": 17993, "donAcc_type": "standard", "distance": 3.382, "atom1_id": "///G/341/O", "atom2_id": "///G/346/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2115, "atom1_serNum": 18017, "atom2_serNum": 18072, "donAcc_type": "standard", "distance": 3.089, "atom1_id": "///G/349/N", "atom2_id": "///G/355/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2116, "atom1_serNum": 18020, "atom2_serNum": 18036, "donAcc_type": "standard", "distance": 3.999, "atom1_id": "///G/349/O", "atom2_id": "///G/351/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2117, "atom1_serNum": 18023, "atom2_serNum": 18072, "donAcc_type": "standard", "distance": 3.560, "atom1_id": "///G/350/N", "atom2_id": "///G/355/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2118, "atom1_serNum": 18041, "atom2_serNum": 18073, "donAcc_type": "standard", "distance": 3.417, "atom1_id": "///G/352/O", "atom2_id": "///G/356/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2119, "atom1_serNum": 18048, "atom2_serNum": 18083, "donAcc_type": "standard", "distance": 2.965, "atom1_id": "///G/353/O", "atom2_id": "///G/357/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2120, "atom1_serNum": 18057, "atom2_serNum": 18091, "donAcc_type": "standard", "distance": 2.921, "atom1_id": "///G/354/O", "atom2_id": "///G/358/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2121, "atom1_serNum": 18068, "atom2_serNum": 18100, "donAcc_type": "standard", "distance": 2.900, "atom1_id": "///G/355/O", "atom2_id": "///G/359/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2122, "atom1_serNum": 18076, "atom2_serNum": 18105, "donAcc_type": "standard", "distance": 2.976, "atom1_id": "///G/356/O", "atom2_id": "///G/360/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2123, "atom1_serNum": 18086, "atom2_serNum": 18113, "donAcc_type": "standard", "distance": 2.954, "atom1_id": "///G/357/O", "atom2_id": "///G/361/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2124, "atom1_serNum": 18094, "atom2_serNum": 18122, "donAcc_type": "standard", "distance": 2.892, "atom1_id": "///G/358/O", "atom2_id": "///G/362/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2125, "atom1_serNum": 18103, "atom2_serNum": 18133, "donAcc_type": "standard", "distance": 2.937, "atom1_id": "///G/359/O", "atom2_id": "///G/363/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2126, "atom1_serNum": 18108, "atom2_serNum": 18143, "donAcc_type": "standard", "distance": 2.902, "atom1_id": "///G/360/O", "atom2_id": "///G/364/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2127, "atom1_serNum": 18116, "atom2_serNum": 18151, "donAcc_type": "standard", "distance": 2.966, "atom1_id": "///G/361/O", "atom2_id": "///G/365/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2128, "atom1_serNum": 18136, "atom2_serNum": 18167, "donAcc_type": "standard", "distance": 3.025, "atom1_id": "///G/363/O", "atom2_id": "///G/367/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2129, "atom1_serNum": 18163, "atom2_serNum": 18165, "donAcc_type": "acceptable", "distance": 2.609, "atom1_id": "///G/366/O", "atom2_id": "///G/366/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 2130, "atom1_serNum": 18170, "atom2_serNum": 18460, "donAcc_type": "standard", "distance": 2.629, "atom1_id": "///G/367/O", "atom2_id": "///G/402/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2131, "atom1_serNum": 18200, "atom2_serNum": 18453, "donAcc_type": "standard", "distance": 3.693, "atom1_id": "///G/371/N", "atom2_id": "///G/402/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2132, "atom1_serNum": 18203, "atom2_serNum": 18469, "donAcc_type": "standard", "distance": 2.815, "atom1_id": "///G/371/O", "atom2_id": "///G/404/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2133, "atom1_serNum": 18216, "atom2_serNum": 18472, "donAcc_type": "standard", "distance": 3.354, "atom1_id": "///G/373/N", "atom2_id": "///G/404/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2134, "atom1_serNum": 18219, "atom2_serNum": 18485, "donAcc_type": "standard", "distance": 2.981, "atom1_id": "///G/373/O", "atom2_id": "///G/406/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2135, "atom1_serNum": 18231, "atom2_serNum": 18488, "donAcc_type": "standard", "distance": 2.888, "atom1_id": "///G/375/N", "atom2_id": "///G/406/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2136, "atom1_serNum": 18234, "atom2_serNum": 18496, "donAcc_type": "standard", "distance": 3.288, "atom1_id": "///G/375/O", "atom2_id": "///G/408/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2137, "atom1_serNum": 18245, "atom2_serNum": 18247, "donAcc_type": "standard", "distance": 2.790, "atom1_id": "///G/376/OD1", "atom2_id": "///G/377/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2138, "atom1_serNum": 18247, "atom2_serNum": 18499, "donAcc_type": "standard", "distance": 3.258, "atom1_id": "///G/377/N", "atom2_id": "///G/408/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2139, "atom1_serNum": 18250, "atom2_serNum": 18272, "donAcc_type": "standard", "distance": 3.534, "atom1_id": "///G/377/O", "atom2_id": "///G/380/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2140, "atom1_serNum": 18256, "atom2_serNum": 18499, "donAcc_type": "standard", "distance": 2.957, "atom1_id": "///G/378/N", "atom2_id": "///G/408/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2141, "atom1_serNum": 18259, "atom2_serNum": 18281, "donAcc_type": "standard", "distance": 3.106, "atom1_id": "///G/378/O", "atom2_id": "///G/381/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2142, "atom1_serNum": 18300, "atom2_serNum": 18319, "donAcc_type": "acceptable", "distance": 3.172, "atom1_id": "///G/383/OG1", "atom2_id": "///G/386/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2143, "atom1_serNum": 18311, "atom2_serNum": 18604, "donAcc_type": "standard", "distance": 3.682, "atom1_id": "///G/385/O", "atom2_id": "///G/421/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2144, "atom1_serNum": 18322, "atom2_serNum": 18352, "donAcc_type": "standard", "distance": 3.346, "atom1_id": "///G/386/O", "atom2_id": "///G/390/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2145, "atom1_serNum": 18327, "atom2_serNum": 18576, "donAcc_type": "standard", "distance": 2.708, "atom1_id": "///G/386/NE2", "atom2_id": "///G/418/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2146, "atom1_serNum": 18331, "atom2_serNum": 18364, "donAcc_type": "standard", "distance": 2.951, "atom1_id": "///G/387/O", "atom2_id": "///G/391/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2147, "atom1_serNum": 18331, "atom2_serNum": 18369, "donAcc_type": "acceptable", "distance": 2.313, "atom1_id": "///G/387/O", "atom2_id": "///G/391/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 2148, "atom1_serNum": 18340, "atom2_serNum": 18371, "donAcc_type": "standard", "distance": 2.915, "atom1_id": "///G/388/O", "atom2_id": "///G/392/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2149, "atom1_serNum": 18347, "atom2_serNum": 18379, "donAcc_type": "standard", "distance": 2.955, "atom1_id": "///G/389/O", "atom2_id": "///G/393/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2150, "atom1_serNum": 18355, "atom2_serNum": 18390, "donAcc_type": "standard", "distance": 2.911, "atom1_id": "///G/390/O", "atom2_id": "///G/394/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2151, "atom1_serNum": 18363, "atom2_serNum": 18594, "donAcc_type": "acceptable", "distance": 3.505, "atom1_id": "///G/390/OH", "atom2_id": "///G/421/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2152, "atom1_serNum": 18374, "atom2_serNum": 18399, "donAcc_type": "standard", "distance": 3.210, "atom1_id": "///G/392/O", "atom2_id": "///G/395/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2153, "atom1_serNum": 18393, "atom2_serNum": 18425, "donAcc_type": "standard", "distance": 3.378, "atom1_id": "///G/394/O", "atom2_id": "///G/398/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2154, "atom1_serNum": 18402, "atom2_serNum": 18425, "donAcc_type": "standard", "distance": 3.193, "atom1_id": "///G/395/O", "atom2_id": "///G/398/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2155, "atom1_serNum": 18402, "atom2_serNum": 18449, "donAcc_type": "acceptable", "distance": 2.492, "atom1_id": "///G/395/O", "atom2_id": "///G/401/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 2156, "atom1_serNum": 18428, "atom2_serNum": 18440, "donAcc_type": "standard", "distance": 3.167, "atom1_id": "///G/398/O", "atom2_id": "///G/400/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2157, "atom1_serNum": 18428, "atom2_serNum": 18444, "donAcc_type": "standard", "distance": 3.339, "atom1_id": "///G/398/O", "atom2_id": "///G/401/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2158, "atom1_serNum": 18428, "atom2_serNum": 18449, "donAcc_type": "acceptable", "distance": 3.255, "atom1_id": "///G/398/O", "atom2_id": "///G/401/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 2159, "atom1_serNum": 18516, "atom2_serNum": 21696, "donAcc_type": "acceptable", "distance": 3.023, "atom1_id": "///G/410/ND2", "atom2_id": "///G/901/O1G", "atom_pair": "N:O", "residue_pair": "aa:ligand" }, { "index": 2160, "atom1_serNum": 18531, "atom2_serNum": 18537, "donAcc_type": "standard", "distance": 2.740, "atom1_id": "///G/413/N", "atom2_id": "///G/413/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2161, "atom1_serNum": 18534, "atom2_serNum": 18562, "donAcc_type": "standard", "distance": 3.047, "atom1_id": "///G/413/O", "atom2_id": "///G/417/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2162, "atom1_serNum": 18542, "atom2_serNum": 18573, "donAcc_type": "standard", "distance": 2.904, "atom1_id": "///G/414/O", "atom2_id": "///G/418/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2163, "atom1_serNum": 18550, "atom2_serNum": 18578, "donAcc_type": "standard", "distance": 2.858, "atom1_id": "///G/415/O", "atom2_id": "///G/419/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2164, "atom1_serNum": 18589, "atom2_serNum": 18613, "donAcc_type": "standard", "distance": 3.186, "atom1_id": "///G/420/O", "atom2_id": "///G/423/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2165, "atom1_serNum": 18608, "atom2_serNum": 18629, "donAcc_type": "questionable", "distance": 2.975, "atom1_id": "///G/422/O", "atom2_id": "///G/425/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 2166, "atom1_serNum": 18629, "atom2_serNum": 18652, "donAcc_type": "standard", "distance": 2.963, "atom1_id": "///G/425/O", "atom2_id": "///G/428/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2167, "atom1_serNum": 18629, "atom2_serNum": 18660, "donAcc_type": "standard", "distance": 3.479, "atom1_id": "///G/425/O", "atom2_id": "///G/429/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2168, "atom1_serNum": 18636, "atom2_serNum": 18651, "donAcc_type": "standard", "distance": 2.581, "atom1_id": "///G/425/NH2", "atom2_id": "///G/427/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2169, "atom1_serNum": 18738, "atom2_serNum": 19044, "donAcc_type": "standard", "distance": 3.252, "atom1_id": "///G/438/N", "atom2_id": "///G/477/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2170, "atom1_serNum": 18749, "atom2_serNum": 21718, "donAcc_type": "acceptable", "distance": 2.845, "atom1_id": "///G/438/OH", "atom2_id": "///G/901/N7", "atom_pair": "O:N", "residue_pair": "aa:ligand" }, { "index": 2171, "atom1_serNum": 18749, "atom2_serNum": 21721, "donAcc_type": "acceptable", "distance": 2.557, "atom1_id": "///G/438/OH", "atom2_id": "///G/901/N6", "atom_pair": "O:N", "residue_pair": "aa:ligand" }, { "index": 2172, "atom1_serNum": 18750, "atom2_serNum": 18781, "donAcc_type": "standard", "distance": 3.155, "atom1_id": "///G/439/N", "atom2_id": "///G/442/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2173, "atom1_serNum": 18753, "atom2_serNum": 18783, "donAcc_type": "standard", "distance": 3.350, "atom1_id": "///G/439/O", "atom2_id": "///G/443/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2174, "atom1_serNum": 18759, "atom2_serNum": 18791, "donAcc_type": "standard", "distance": 3.010, "atom1_id": "///G/440/O", "atom2_id": "///G/444/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2175, "atom1_serNum": 18768, "atom2_serNum": 18798, "donAcc_type": "standard", "distance": 2.881, "atom1_id": "///G/441/O", "atom2_id": "///G/445/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2176, "atom1_serNum": 18773, "atom2_serNum": 18806, "donAcc_type": "standard", "distance": 3.933, "atom1_id": "///G/441/NE2", "atom2_id": "///G/445/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2177, "atom1_serNum": 18777, "atom2_serNum": 18807, "donAcc_type": "standard", "distance": 2.925, "atom1_id": "///G/442/O", "atom2_id": "///G/446/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2178, "atom1_serNum": 18786, "atom2_serNum": 18815, "donAcc_type": "standard", "distance": 2.954, "atom1_id": "///G/443/O", "atom2_id": "///G/447/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2179, "atom1_serNum": 18794, "atom2_serNum": 18826, "donAcc_type": "standard", "distance": 2.871, "atom1_id": "///G/444/O", "atom2_id": "///G/448/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2180, "atom1_serNum": 18801, "atom2_serNum": 18835, "donAcc_type": "standard", "distance": 2.901, "atom1_id": "///G/445/O", "atom2_id": "///G/449/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2181, "atom1_serNum": 18810, "atom2_serNum": 18841, "donAcc_type": "standard", "distance": 2.961, "atom1_id": "///G/446/O", "atom2_id": "///G/450/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2182, "atom1_serNum": 18818, "atom2_serNum": 18852, "donAcc_type": "standard", "distance": 2.922, "atom1_id": "///G/447/O", "atom2_id": "///G/451/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2183, "atom1_serNum": 18838, "atom2_serNum": 18865, "donAcc_type": "standard", "distance": 2.958, "atom1_id": "///G/449/O", "atom2_id": "///G/453/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2184, "atom1_serNum": 18851, "atom2_serNum": 21714, "donAcc_type": "acceptable", "distance": 2.529, "atom1_id": "///G/450/NH2", "atom2_id": "///G/901/O2'", "atom_pair": "N:O", "residue_pair": "aa:ligand" }, { "index": 2185, "atom1_serNum": 18855, "atom2_serNum": 18888, "donAcc_type": "standard", "distance": 2.667, "atom1_id": "///G/451/O", "atom2_id": "///G/456/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2186, "atom1_serNum": 18898, "atom2_serNum": 18921, "donAcc_type": "questionable", "distance": 3.168, "atom1_id": "///G/457/O", "atom2_id": "///G/460/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 2187, "atom1_serNum": 18914, "atom2_serNum": 19244, "donAcc_type": "standard", "distance": 3.103, "atom1_id": "///G/459/O", "atom2_id": "///G/529/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2188, "atom1_serNum": 18932, "atom2_serNum": 18957, "donAcc_type": "standard", "distance": 3.309, "atom1_id": "///G/461/O", "atom2_id": "///G/465/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2189, "atom1_serNum": 18939, "atom2_serNum": 18965, "donAcc_type": "standard", "distance": 2.932, "atom1_id": "///G/462/O", "atom2_id": "///G/466/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2190, "atom1_serNum": 18946, "atom2_serNum": 18974, "donAcc_type": "standard", "distance": 2.953, "atom1_id": "///G/463/O", "atom2_id": "///G/467/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2191, "atom1_serNum": 18953, "atom2_serNum": 18955, "donAcc_type": "acceptable", "distance": 3.033, "atom1_id": "///G/464/O", "atom2_id": "///G/464/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 2192, "atom1_serNum": 18953, "atom2_serNum": 18982, "donAcc_type": "standard", "distance": 2.951, "atom1_id": "///G/464/O", "atom2_id": "///G/468/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2193, "atom1_serNum": 18960, "atom2_serNum": 18990, "donAcc_type": "standard", "distance": 2.917, "atom1_id": "///G/465/O", "atom2_id": "///G/469/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2194, "atom1_serNum": 18977, "atom2_serNum": 19000, "donAcc_type": "standard", "distance": 3.025, "atom1_id": "///G/467/O", "atom2_id": "///G/471/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2195, "atom1_serNum": 18985, "atom2_serNum": 19009, "donAcc_type": "standard", "distance": 2.965, "atom1_id": "///G/468/O", "atom2_id": "///G/472/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2196, "atom1_serNum": 18993, "atom2_serNum": 19016, "donAcc_type": "standard", "distance": 2.899, "atom1_id": "///G/469/O", "atom2_id": "///G/473/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2197, "atom1_serNum": 19003, "atom2_serNum": 19027, "donAcc_type": "standard", "distance": 2.968, "atom1_id": "///G/471/O", "atom2_id": "///G/475/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2198, "atom1_serNum": 19012, "atom2_serNum": 19035, "donAcc_type": "standard", "distance": 2.931, "atom1_id": "///G/472/O", "atom2_id": "///G/476/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2199, "atom1_serNum": 19012, "atom2_serNum": 19041, "donAcc_type": "standard", "distance": 2.914, "atom1_id": "///G/472/O", "atom2_id": "///G/477/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2200, "atom1_serNum": 19040, "atom2_serNum": 19051, "donAcc_type": "acceptable", "distance": 2.374, "atom1_id": "///G/476/OG", "atom2_id": "///G/478/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 2201, "atom1_serNum": 19045, "atom2_serNum": 19051, "donAcc_type": "standard", "distance": 2.511, "atom1_id": "///G/478/N", "atom2_id": "///G/478/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2202, "atom1_serNum": 19048, "atom2_serNum": 19082, "donAcc_type": "standard", "distance": 3.703, "atom1_id": "///G/478/O", "atom2_id": "///G/482/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2203, "atom1_serNum": 19056, "atom2_serNum": 19087, "donAcc_type": "standard", "distance": 2.896, "atom1_id": "///G/479/O", "atom2_id": "///G/483/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2204, "atom1_serNum": 19063, "atom2_serNum": 19095, "donAcc_type": "standard", "distance": 2.889, "atom1_id": "///G/480/O", "atom2_id": "///G/484/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2205, "atom1_serNum": 19069, "atom2_serNum": 21697, "donAcc_type": "acceptable", "distance": 3.089, "atom1_id": "///G/480/NH1", "atom2_id": "///G/901/O2G", "atom_pair": "N:O", "residue_pair": "aa:ligand" }, { "index": 2206, "atom1_serNum": 19074, "atom2_serNum": 19103, "donAcc_type": "standard", "distance": 2.937, "atom1_id": "///G/481/O", "atom2_id": "///G/485/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2207, "atom1_serNum": 19080, "atom2_serNum": 19350, "donAcc_type": "acceptable", "distance": 3.886, "atom1_id": "///G/481/NH1", "atom2_id": "///G/542/OH", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2208, "atom1_serNum": 19085, "atom2_serNum": 19111, "donAcc_type": "standard", "distance": 2.930, "atom1_id": "///G/482/O", "atom2_id": "///G/486/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2209, "atom1_serNum": 19090, "atom2_serNum": 19115, "donAcc_type": "standard", "distance": 2.885, "atom1_id": "///G/483/O", "atom2_id": "///G/487/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2210, "atom1_serNum": 19098, "atom2_serNum": 19126, "donAcc_type": "standard", "distance": 2.853, "atom1_id": "///G/484/O", "atom2_id": "///G/488/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2211, "atom1_serNum": 19106, "atom2_serNum": 19137, "donAcc_type": "standard", "distance": 2.932, "atom1_id": "///G/485/O", "atom2_id": "///G/489/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2212, "atom1_serNum": 19118, "atom2_serNum": 19151, "donAcc_type": "standard", "distance": 2.932, "atom1_id": "///G/487/O", "atom2_id": "///G/491/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2213, "atom1_serNum": 19129, "atom2_serNum": 19160, "donAcc_type": "standard", "distance": 2.889, "atom1_id": "///G/488/O", "atom2_id": "///G/492/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2214, "atom1_serNum": 19140, "atom2_serNum": 19168, "donAcc_type": "standard", "distance": 2.910, "atom1_id": "///G/489/O", "atom2_id": "///G/493/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2215, "atom1_serNum": 19147, "atom2_serNum": 19173, "donAcc_type": "standard", "distance": 2.903, "atom1_id": "///G/490/O", "atom2_id": "///G/494/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2216, "atom1_serNum": 19163, "atom2_serNum": 19191, "donAcc_type": "standard", "distance": 2.856, "atom1_id": "///G/492/O", "atom2_id": "///G/496/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2217, "atom1_serNum": 19171, "atom2_serNum": 19200, "donAcc_type": "standard", "distance": 2.888, "atom1_id": "///G/493/O", "atom2_id": "///G/497/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2218, "atom1_serNum": 19176, "atom2_serNum": 19209, "donAcc_type": "standard", "distance": 3.298, "atom1_id": "///G/494/O", "atom2_id": "///G/498/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2219, "atom1_serNum": 19254, "atom2_serNum": 19283, "donAcc_type": "standard", "distance": 3.741, "atom1_id": "///G/530/O", "atom2_id": "///G/534/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2220, "atom1_serNum": 19258, "atom2_serNum": 19282, "donAcc_type": "standard", "distance": 3.104, "atom1_id": "///G/530/OE1", "atom2_id": "///G/533/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2221, "atom1_serNum": 19263, "atom2_serNum": 19290, "donAcc_type": "standard", "distance": 2.891, "atom1_id": "///G/531/O", "atom2_id": "///G/535/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2222, "atom1_serNum": 19270, "atom2_serNum": 19295, "donAcc_type": "standard", "distance": 2.892, "atom1_id": "///G/532/O", "atom2_id": "///G/536/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2223, "atom1_serNum": 19277, "atom2_serNum": 19300, "donAcc_type": "standard", "distance": 2.958, "atom1_id": "///G/533/O", "atom2_id": "///G/537/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2224, "atom1_serNum": 19286, "atom2_serNum": 19307, "donAcc_type": "standard", "distance": 2.889, "atom1_id": "///G/534/O", "atom2_id": "///G/538/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2225, "atom1_serNum": 19293, "atom2_serNum": 19315, "donAcc_type": "standard", "distance": 2.923, "atom1_id": "///G/535/O", "atom2_id": "///G/539/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2226, "atom1_serNum": 19293, "atom2_serNum": 19321, "donAcc_type": "questionable", "distance": 2.896, "atom1_id": "///G/535/O", "atom2_id": "///G/539/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 2227, "atom1_serNum": 19298, "atom2_serNum": 19323, "donAcc_type": "standard", "distance": 2.918, "atom1_id": "///G/536/O", "atom2_id": "///G/540/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2228, "atom1_serNum": 19303, "atom2_serNum": 19332, "donAcc_type": "standard", "distance": 2.925, "atom1_id": "///G/537/O", "atom2_id": "///G/541/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2229, "atom1_serNum": 19310, "atom2_serNum": 19339, "donAcc_type": "standard", "distance": 2.663, "atom1_id": "///G/538/O", "atom2_id": "///G/542/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2230, "atom1_serNum": 19315, "atom2_serNum": 19321, "donAcc_type": "standard", "distance": 2.820, "atom1_id": "///G/539/N", "atom2_id": "///G/539/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2231, "atom1_serNum": 19365, "atom2_serNum": 19395, "donAcc_type": "standard", "distance": 3.030, "atom1_id": "///G/557/O", "atom2_id": "///G/561/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2232, "atom1_serNum": 19372, "atom2_serNum": 19404, "donAcc_type": "standard", "distance": 2.940, "atom1_id": "///G/558/O", "atom2_id": "///G/562/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2233, "atom1_serNum": 19380, "atom2_serNum": 19412, "donAcc_type": "standard", "distance": 2.945, "atom1_id": "///G/559/O", "atom2_id": "///G/563/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2234, "atom1_serNum": 19384, "atom2_serNum": 19626, "donAcc_type": "acceptable", "distance": 2.308, "atom1_id": "///G/559/OE1", "atom2_id": "///G/588/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 2235, "atom1_serNum": 19385, "atom2_serNum": 19706, "donAcc_type": "standard", "distance": 3.580, "atom1_id": "///G/559/NE2", "atom2_id": "///G/598/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2236, "atom1_serNum": 19389, "atom2_serNum": 19420, "donAcc_type": "standard", "distance": 2.960, "atom1_id": "///G/560/O", "atom2_id": "///G/564/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2237, "atom1_serNum": 19393, "atom2_serNum": 19839, "donAcc_type": "standard", "distance": 3.844, "atom1_id": "///G/560/OE1", "atom2_id": "///G/615/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2238, "atom1_serNum": 19398, "atom2_serNum": 19428, "donAcc_type": "standard", "distance": 2.941, "atom1_id": "///G/561/O", "atom2_id": "///G/565/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2239, "atom1_serNum": 19407, "atom2_serNum": 19434, "donAcc_type": "standard", "distance": 2.961, "atom1_id": "///G/562/O", "atom2_id": "///G/566/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2240, "atom1_serNum": 19415, "atom2_serNum": 19439, "donAcc_type": "acceptable", "distance": 2.973, "atom1_id": "///G/563/O", "atom2_id": "///G/566/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 2241, "atom1_serNum": 19415, "atom2_serNum": 19441, "donAcc_type": "standard", "distance": 2.951, "atom1_id": "///G/563/O", "atom2_id": "///G/567/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2242, "atom1_serNum": 19423, "atom2_serNum": 19449, "donAcc_type": "standard", "distance": 2.949, "atom1_id": "///G/564/O", "atom2_id": "///G/568/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2243, "atom1_serNum": 19431, "atom2_serNum": 19456, "donAcc_type": "standard", "distance": 2.924, "atom1_id": "///G/565/O", "atom2_id": "///G/569/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2244, "atom1_serNum": 19437, "atom2_serNum": 19464, "donAcc_type": "standard", "distance": 2.933, "atom1_id": "///G/566/O", "atom2_id": "///G/570/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2245, "atom1_serNum": 19444, "atom2_serNum": 19472, "donAcc_type": "standard", "distance": 2.928, "atom1_id": "///G/567/O", "atom2_id": "///G/571/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2246, "atom1_serNum": 19452, "atom2_serNum": 19480, "donAcc_type": "standard", "distance": 2.916, "atom1_id": "///G/568/O", "atom2_id": "///G/572/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2247, "atom1_serNum": 19459, "atom2_serNum": 19491, "donAcc_type": "standard", "distance": 2.934, "atom1_id": "///G/569/O", "atom2_id": "///G/573/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2248, "atom1_serNum": 19498, "atom2_serNum": 20181, "donAcc_type": "acceptable", "distance": 3.865, "atom1_id": "///G/573/ND2", "atom2_id": "///G/657/OG1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2249, "atom1_serNum": 19519, "atom2_serNum": 19525, "donAcc_type": "standard", "distance": 2.605, "atom1_id": "///G/576/N", "atom2_id": "///G/576/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2250, "atom1_serNum": 19530, "atom2_serNum": 19544, "donAcc_type": "standard", "distance": 3.034, "atom1_id": "///G/577/O", "atom2_id": "///G/579/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2251, "atom1_serNum": 19547, "atom2_serNum": 19971, "donAcc_type": "standard", "distance": 3.096, "atom1_id": "///G/579/O", "atom2_id": "///G/631/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2252, "atom1_serNum": 19555, "atom2_serNum": 19581, "donAcc_type": "standard", "distance": 3.030, "atom1_id": "///G/580/O", "atom2_id": "///G/584/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2253, "atom1_serNum": 19558, "atom2_serNum": 19955, "donAcc_type": "standard", "distance": 2.898, "atom1_id": "///G/581/N", "atom2_id": "///G/629/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2254, "atom1_serNum": 19561, "atom2_serNum": 19589, "donAcc_type": "standard", "distance": 2.910, "atom1_id": "///G/581/O", "atom2_id": "///G/585/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2255, "atom1_serNum": 19566, "atom2_serNum": 19936, "donAcc_type": "standard", "distance": 3.304, "atom1_id": "///G/582/N", "atom2_id": "///G/627/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2256, "atom1_serNum": 19569, "atom2_serNum": 19599, "donAcc_type": "standard", "distance": 2.944, "atom1_id": "///G/582/O", "atom2_id": "///G/586/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2257, "atom1_serNum": 19584, "atom2_serNum": 19615, "donAcc_type": "standard", "distance": 2.925, "atom1_id": "///G/584/O", "atom2_id": "///G/588/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2258, "atom1_serNum": 19592, "atom2_serNum": 19627, "donAcc_type": "standard", "distance": 2.922, "atom1_id": "///G/585/O", "atom2_id": "///G/589/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2259, "atom1_serNum": 19607, "atom2_serNum": 19943, "donAcc_type": "standard", "distance": 2.697, "atom1_id": "///G/586/OE2", "atom2_id": "///G/627/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2260, "atom1_serNum": 19611, "atom2_serNum": 19649, "donAcc_type": "standard", "distance": 2.943, "atom1_id": "///G/587/O", "atom2_id": "///G/591/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2261, "atom1_serNum": 19618, "atom2_serNum": 19656, "donAcc_type": "standard", "distance": 2.937, "atom1_id": "///G/588/O", "atom2_id": "///G/592/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2262, "atom1_serNum": 19626, "atom2_serNum": 19716, "donAcc_type": "acceptable", "distance": 3.611, "atom1_id": "///G/588/OH", "atom2_id": "///G/600/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2263, "atom1_serNum": 19630, "atom2_serNum": 19662, "donAcc_type": "standard", "distance": 2.891, "atom1_id": "///G/589/O", "atom2_id": "///G/593/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2264, "atom1_serNum": 19641, "atom2_serNum": 19667, "donAcc_type": "standard", "distance": 2.948, "atom1_id": "///G/590/O", "atom2_id": "///G/594/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2265, "atom1_serNum": 19647, "atom2_serNum": 20191, "donAcc_type": "standard", "distance": 3.806, "atom1_id": "///G/590/NH1", "atom2_id": "///G/659/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2266, "atom1_serNum": 19647, "atom2_serNum": 20197, "donAcc_type": "standard", "distance": 3.377, "atom1_id": "///G/590/NH1", "atom2_id": "///G/660/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2267, "atom1_serNum": 19652, "atom2_serNum": 19676, "donAcc_type": "standard", "distance": 2.937, "atom1_id": "///G/591/O", "atom2_id": "///G/595/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2268, "atom1_serNum": 19659, "atom2_serNum": 19695, "donAcc_type": "standard", "distance": 3.165, "atom1_id": "///G/592/O", "atom2_id": "///G/597/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2269, "atom1_serNum": 19659, "atom2_serNum": 19698, "donAcc_type": "questionable", "distance": 2.899, "atom1_id": "///G/592/O", "atom2_id": "///G/597/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 2270, "atom1_serNum": 19665, "atom2_serNum": 19687, "donAcc_type": "standard", "distance": 3.257, "atom1_id": "///G/593/O", "atom2_id": "///G/596/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2271, "atom1_serNum": 19675, "atom2_serNum": 20174, "donAcc_type": "standard", "distance": 2.786, "atom1_id": "///G/594/NZ", "atom2_id": "///G/656/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2272, "atom1_serNum": 19685, "atom2_serNum": 20175, "donAcc_type": "standard", "distance": 3.292, "atom1_id": "///G/595/NH1", "atom2_id": "///G/656/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2273, "atom1_serNum": 19686, "atom2_serNum": 20175, "donAcc_type": "standard", "distance": 2.982, "atom1_id": "///G/595/NH2", "atom2_id": "///G/656/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2274, "atom1_serNum": 19727, "atom2_serNum": 19746, "donAcc_type": "standard", "distance": 3.133, "atom1_id": "///G/601/O", "atom2_id": "///G/604/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2275, "atom1_serNum": 19727, "atom2_serNum": 19755, "donAcc_type": "standard", "distance": 2.742, "atom1_id": "///G/601/O", "atom2_id": "///G/605/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2276, "atom1_serNum": 19730, "atom2_serNum": 19732, "donAcc_type": "standard", "distance": 2.581, "atom1_id": "///G/601/OD1", "atom2_id": "///G/602/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2277, "atom1_serNum": 19735, "atom2_serNum": 19766, "donAcc_type": "standard", "distance": 2.948, "atom1_id": "///G/602/O", "atom2_id": "///G/606/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2278, "atom1_serNum": 19735, "atom2_serNum": 19771, "donAcc_type": "acceptable", "distance": 2.855, "atom1_id": "///G/602/O", "atom2_id": "///G/606/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 2279, "atom1_serNum": 19739, "atom2_serNum": 19942, "donAcc_type": "standard", "distance": 2.820, "atom1_id": "///G/602/OE1", "atom2_id": "///G/627/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2280, "atom1_serNum": 19749, "atom2_serNum": 19777, "donAcc_type": "standard", "distance": 2.967, "atom1_id": "///G/604/O", "atom2_id": "///G/608/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2281, "atom1_serNum": 19749, "atom2_serNum": 19782, "donAcc_type": "acceptable", "distance": 3.069, "atom1_id": "///G/604/O", "atom2_id": "///G/608/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 2282, "atom1_serNum": 19758, "atom2_serNum": 19784, "donAcc_type": "standard", "distance": 2.958, "atom1_id": "///G/605/O", "atom2_id": "///G/609/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2283, "atom1_serNum": 19769, "atom2_serNum": 19791, "donAcc_type": "standard", "distance": 2.948, "atom1_id": "///G/606/O", "atom2_id": "///G/610/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2284, "atom1_serNum": 19776, "atom2_serNum": 19799, "donAcc_type": "standard", "distance": 2.926, "atom1_id": "///G/607/O", "atom2_id": "///G/611/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2285, "atom1_serNum": 19780, "atom2_serNum": 19807, "donAcc_type": "standard", "distance": 2.996, "atom1_id": "///G/608/O", "atom2_id": "///G/612/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2286, "atom1_serNum": 19787, "atom2_serNum": 19814, "donAcc_type": "standard", "distance": 2.944, "atom1_id": "///G/609/O", "atom2_id": "///G/613/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2287, "atom1_serNum": 19802, "atom2_serNum": 19828, "donAcc_type": "acceptable", "distance": 3.041, "atom1_id": "///G/611/O", "atom2_id": "///G/614/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 2288, "atom1_serNum": 19810, "atom2_serNum": 19830, "donAcc_type": "standard", "distance": 3.265, "atom1_id": "///G/612/O", "atom2_id": "///G/615/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2289, "atom1_serNum": 19817, "atom2_serNum": 19841, "donAcc_type": "standard", "distance": 3.212, "atom1_id": "///G/613/O", "atom2_id": "///G/616/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2290, "atom1_serNum": 19822, "atom2_serNum": 19872, "donAcc_type": "standard", "distance": 3.721, "atom1_id": "///G/613/OE2", "atom2_id": "///G/620/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2291, "atom1_serNum": 19848, "atom2_serNum": 19994, "donAcc_type": "standard", "distance": 2.977, "atom1_id": "///G/617/O", "atom2_id": "///G/634/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2292, "atom1_serNum": 19861, "atom2_serNum": 19981, "donAcc_type": "standard", "distance": 2.887, "atom1_id": "///G/619/N", "atom2_id": "///G/632/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2293, "atom1_serNum": 19864, "atom2_serNum": 19978, "donAcc_type": "standard", "distance": 2.892, "atom1_id": "///G/619/O", "atom2_id": "///G/632/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2294, "atom1_serNum": 19880, "atom2_serNum": 19965, "donAcc_type": "standard", "distance": 2.902, "atom1_id": "///G/621/N", "atom2_id": "///G/630/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2295, "atom1_serNum": 19883, "atom2_serNum": 19962, "donAcc_type": "standard", "distance": 2.965, "atom1_id": "///G/621/O", "atom2_id": "///G/630/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2296, "atom1_serNum": 19899, "atom2_serNum": 19958, "donAcc_type": "acceptable", "distance": 3.035, "atom1_id": "///G/623/N", "atom2_id": "///G/629/ND1", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 2297, "atom1_serNum": 19907, "atom2_serNum": 20601, "donAcc_type": "standard", "distance": 3.452, "atom1_id": "///G/623/NZ", "atom2_id": "///H/20/O3'", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 2298, "atom1_serNum": 19920, "atom2_serNum": 19944, "donAcc_type": "standard", "distance": 2.985, "atom1_id": "///G/625/O", "atom2_id": "///G/628/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2299, "atom1_serNum": 19970, "atom2_serNum": 20614, "donAcc_type": "standard", "distance": 2.425, "atom1_id": "///G/630/NZ", "atom2_id": "///H/21/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 2300, "atom1_serNum": 20017, "atom2_serNum": 20023, "donAcc_type": "standard", "distance": 2.574, "atom1_id": "///G/636/N", "atom2_id": "///G/636/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2301, "atom1_serNum": 20020, "atom2_serNum": 20043, "donAcc_type": "standard", "distance": 2.968, "atom1_id": "///G/636/O", "atom2_id": "///G/639/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2302, "atom1_serNum": 20020, "atom2_serNum": 20052, "donAcc_type": "standard", "distance": 3.005, "atom1_id": "///G/636/O", "atom2_id": "///G/640/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2303, "atom1_serNum": 20023, "atom2_serNum": 20050, "donAcc_type": "questionable", "distance": 2.993, "atom1_id": "///G/636/OD1", "atom2_id": "///G/639/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 2304, "atom1_serNum": 20025, "atom2_serNum": 20032, "donAcc_type": "standard", "distance": 2.835, "atom1_id": "///G/637/N", "atom2_id": "///G/637/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2305, "atom1_serNum": 20028, "atom2_serNum": 20059, "donAcc_type": "standard", "distance": 2.888, "atom1_id": "///G/637/O", "atom2_id": "///G/641/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2306, "atom1_serNum": 20028, "atom2_serNum": 20065, "donAcc_type": "acceptable", "distance": 2.350, "atom1_id": "///G/637/O", "atom2_id": "///G/641/ND1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2307, "atom1_serNum": 20046, "atom2_serNum": 20074, "donAcc_type": "standard", "distance": 2.915, "atom1_id": "///G/639/O", "atom2_id": "///G/643/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2308, "atom1_serNum": 20055, "atom2_serNum": 20079, "donAcc_type": "standard", "distance": 2.954, "atom1_id": "///G/640/O", "atom2_id": "///G/644/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2309, "atom1_serNum": 20059, "atom2_serNum": 20065, "donAcc_type": "acceptable", "distance": 3.103, "atom1_id": "///G/641/N", "atom2_id": "///G/641/ND1", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 2310, "atom1_serNum": 20062, "atom2_serNum": 20087, "donAcc_type": "standard", "distance": 3.633, "atom1_id": "///G/641/O", "atom2_id": "///G/645/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2311, "atom1_serNum": 20082, "atom2_serNum": 20092, "donAcc_type": "acceptable", "distance": 2.667, "atom1_id": "///G/644/O", "atom2_id": "///G/645/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 2312, "atom1_serNum": 20096, "atom2_serNum": 20119, "donAcc_type": "standard", "distance": 3.014, "atom1_id": "///G/646/O", "atom2_id": "///G/649/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2313, "atom1_serNum": 20096, "atom2_serNum": 20127, "donAcc_type": "standard", "distance": 3.182, "atom1_id": "///G/646/O", "atom2_id": "///G/650/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2314, "atom1_serNum": 20099, "atom2_serNum": 20118, "donAcc_type": "standard", "distance": 2.498, "atom1_id": "///G/646/OD1", "atom2_id": "///G/648/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2315, "atom1_serNum": 20100, "atom2_serNum": 20118, "donAcc_type": "standard", "distance": 3.344, "atom1_id": "///G/646/OD2", "atom2_id": "///G/648/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2316, "atom1_serNum": 20104, "atom2_serNum": 20135, "donAcc_type": "standard", "distance": 2.929, "atom1_id": "///G/647/O", "atom2_id": "///G/651/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2317, "atom1_serNum": 20122, "atom2_serNum": 20140, "donAcc_type": "standard", "distance": 2.994, "atom1_id": "///G/649/O", "atom2_id": "///G/652/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2318, "atom1_serNum": 20122, "atom2_serNum": 20146, "donAcc_type": "standard", "distance": 2.931, "atom1_id": "///G/649/O", "atom2_id": "///G/653/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2319, "atom1_serNum": 20130, "atom2_serNum": 20154, "donAcc_type": "standard", "distance": 2.925, "atom1_id": "///G/650/O", "atom2_id": "///G/654/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2320, "atom1_serNum": 20138, "atom2_serNum": 20167, "donAcc_type": "acceptable", "distance": 2.838, "atom1_id": "///G/651/O", "atom2_id": "///G/655/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 2321, "atom1_serNum": 20149, "atom2_serNum": 20168, "donAcc_type": "standard", "distance": 3.058, "atom1_id": "///G/653/O", "atom2_id": "///G/656/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2322, "atom1_serNum": 20179, "atom2_serNum": 20194, "donAcc_type": "standard", "distance": 3.153, "atom1_id": "///G/657/O", "atom2_id": "///G/660/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2323, "atom1_serNum": 20219, "atom2_serNum": 21594, "donAcc_type": "standard", "distance": 3.143, "atom1_id": "///H/1/N6", "atom2_id": "///I/68/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 2324, "atom1_serNum": 20220, "atom2_serNum": 21592, "donAcc_type": "standard", "distance": 2.688, "atom1_id": "///H/1/N1", "atom2_id": "///I/68/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 2325, "atom1_serNum": 20240, "atom2_serNum": 21575, "donAcc_type": "standard", "distance": 2.942, "atom1_id": "///H/2/O6", "atom2_id": "///I/67/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 2326, "atom1_serNum": 20241, "atom2_serNum": 21573, "donAcc_type": "standard", "distance": 2.875, "atom1_id": "///H/2/N1", "atom2_id": "///I/67/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 2327, "atom1_serNum": 20243, "atom2_serNum": 21572, "donAcc_type": "standard", "distance": 2.713, "atom1_id": "///H/2/N2", "atom2_id": "///I/67/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 2328, "atom1_serNum": 20262, "atom2_serNum": 21555, "donAcc_type": "standard", "distance": 3.076, "atom1_id": "///H/3/N6", "atom2_id": "///I/66/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 2329, "atom1_serNum": 20263, "atom2_serNum": 21553, "donAcc_type": "standard", "distance": 2.759, "atom1_id": "///H/3/N1", "atom2_id": "///I/66/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 2330, "atom1_serNum": 20281, "atom2_serNum": 21535, "donAcc_type": "standard", "distance": 2.826, "atom1_id": "///H/4/N3", "atom2_id": "///I/65/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 2331, "atom1_serNum": 20283, "atom2_serNum": 21534, "donAcc_type": "standard", "distance": 2.945, "atom1_id": "///H/4/O4", "atom2_id": "///I/65/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 2332, "atom1_serNum": 20300, "atom2_serNum": 20313, "donAcc_type": "questionable", "distance": 3.121, "atom1_id": "///H/5/O2", "atom2_id": "///H/6/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 2333, "atom1_serNum": 20301, "atom2_serNum": 21514, "donAcc_type": "standard", "distance": 2.909, "atom1_id": "///H/5/N3", "atom2_id": "///I/64/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 2334, "atom1_serNum": 20303, "atom2_serNum": 21513, "donAcc_type": "standard", "distance": 3.000, "atom1_id": "///H/5/O4", "atom2_id": "///I/64/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 2335, "atom1_serNum": 20321, "atom2_serNum": 21493, "donAcc_type": "standard", "distance": 2.744, "atom1_id": "///H/6/N3", "atom2_id": "///I/63/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 2336, "atom1_serNum": 20323, "atom2_serNum": 21492, "donAcc_type": "standard", "distance": 3.020, "atom1_id": "///H/6/O4", "atom2_id": "///I/63/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 2337, "atom1_serNum": 20341, "atom2_serNum": 21472, "donAcc_type": "standard", "distance": 2.717, "atom1_id": "///H/7/N3", "atom2_id": "///I/62/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 2338, "atom1_serNum": 20343, "atom2_serNum": 21471, "donAcc_type": "standard", "distance": 3.058, "atom1_id": "///H/7/O4", "atom2_id": "///I/62/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 2339, "atom1_serNum": 20363, "atom2_serNum": 21451, "donAcc_type": "standard", "distance": 3.079, "atom1_id": "///H/8/N6", "atom2_id": "///I/61/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 2340, "atom1_serNum": 20364, "atom2_serNum": 21449, "donAcc_type": "standard", "distance": 2.806, "atom1_id": "///H/8/N1", "atom2_id": "///I/61/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 2341, "atom1_serNum": 20382, "atom2_serNum": 21431, "donAcc_type": "standard", "distance": 2.869, "atom1_id": "///H/9/N3", "atom2_id": "///I/60/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 2342, "atom1_serNum": 20384, "atom2_serNum": 21430, "donAcc_type": "standard", "distance": 2.990, "atom1_id": "///H/9/O4", "atom2_id": "///I/60/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 2343, "atom1_serNum": 20404, "atom2_serNum": 21411, "donAcc_type": "standard", "distance": 2.946, "atom1_id": "///H/10/O6", "atom2_id": "///I/59/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 2344, "atom1_serNum": 20405, "atom2_serNum": 21409, "donAcc_type": "standard", "distance": 2.891, "atom1_id": "///H/10/N1", "atom2_id": "///I/59/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 2345, "atom1_serNum": 20407, "atom2_serNum": 21408, "donAcc_type": "standard", "distance": 2.747, "atom1_id": "///H/10/N2", "atom2_id": "///I/59/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 2346, "atom1_serNum": 20424, "atom2_serNum": 21391, "donAcc_type": "standard", "distance": 2.797, "atom1_id": "///H/11/N3", "atom2_id": "///I/58/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 2347, "atom1_serNum": 20426, "atom2_serNum": 21390, "donAcc_type": "standard", "distance": 2.968, "atom1_id": "///H/11/O4", "atom2_id": "///I/58/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 2348, "atom1_serNum": 20444, "atom2_serNum": 21370, "donAcc_type": "standard", "distance": 2.803, "atom1_id": "///H/12/N3", "atom2_id": "///I/57/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 2349, "atom1_serNum": 20446, "atom2_serNum": 21369, "donAcc_type": "standard", "distance": 2.961, "atom1_id": "///H/12/O4", "atom2_id": "///I/57/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 2350, "atom1_serNum": 20464, "atom2_serNum": 21349, "donAcc_type": "standard", "distance": 2.923, "atom1_id": "///H/13/N3", "atom2_id": "///I/56/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 2351, "atom1_serNum": 20466, "atom2_serNum": 21348, "donAcc_type": "standard", "distance": 2.945, "atom1_id": "///H/13/O4", "atom2_id": "///I/56/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 2352, "atom1_serNum": 20486, "atom2_serNum": 21328, "donAcc_type": "standard", "distance": 3.024, "atom1_id": "///H/14/N6", "atom2_id": "///I/55/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 2353, "atom1_serNum": 20487, "atom2_serNum": 21326, "donAcc_type": "standard", "distance": 2.878, "atom1_id": "///H/14/N1", "atom2_id": "///I/55/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 2354, "atom1_serNum": 20507, "atom2_serNum": 21309, "donAcc_type": "standard", "distance": 2.954, "atom1_id": "///H/15/O6", "atom2_id": "///I/54/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 2355, "atom1_serNum": 20508, "atom2_serNum": 21307, "donAcc_type": "standard", "distance": 2.925, "atom1_id": "///H/15/N1", "atom2_id": "///I/54/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 2356, "atom1_serNum": 20510, "atom2_serNum": 21306, "donAcc_type": "standard", "distance": 2.824, "atom1_id": "///H/15/N2", "atom2_id": "///I/54/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 2357, "atom1_serNum": 20529, "atom2_serNum": 21289, "donAcc_type": "standard", "distance": 3.100, "atom1_id": "///H/16/N6", "atom2_id": "///I/53/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 2358, "atom1_serNum": 20530, "atom2_serNum": 21287, "donAcc_type": "standard", "distance": 2.808, "atom1_id": "///H/16/N1", "atom2_id": "///I/53/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 2359, "atom1_serNum": 20548, "atom2_serNum": 21269, "donAcc_type": "standard", "distance": 2.896, "atom1_id": "///H/17/N3", "atom2_id": "///I/52/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 2360, "atom1_serNum": 20550, "atom2_serNum": 21268, "donAcc_type": "standard", "distance": 3.031, "atom1_id": "///H/17/O4", "atom2_id": "///I/52/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 2361, "atom1_serNum": 20567, "atom2_serNum": 21249, "donAcc_type": "standard", "distance": 2.750, "atom1_id": "///H/18/O2", "atom2_id": "///I/51/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 2362, "atom1_serNum": 20568, "atom2_serNum": 21247, "donAcc_type": "standard", "distance": 2.864, "atom1_id": "///H/18/N3", "atom2_id": "///I/51/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 2363, "atom1_serNum": 20570, "atom2_serNum": 21246, "donAcc_type": "standard", "distance": 2.891, "atom1_id": "///H/18/N4", "atom2_id": "///I/51/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 2364, "atom1_serNum": 20587, "atom2_serNum": 21226, "donAcc_type": "standard", "distance": 2.802, "atom1_id": "///H/19/N3", "atom2_id": "///I/50/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 2365, "atom1_serNum": 20589, "atom2_serNum": 21225, "donAcc_type": "standard", "distance": 3.086, "atom1_id": "///H/19/O4", "atom2_id": "///I/50/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 2366, "atom1_serNum": 20607, "atom2_serNum": 21205, "donAcc_type": "standard", "distance": 2.924, "atom1_id": "///H/20/N3", "atom2_id": "///I/49/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 2367, "atom1_serNum": 20609, "atom2_serNum": 21204, "donAcc_type": "standard", "distance": 2.896, "atom1_id": "///H/20/O4", "atom2_id": "///I/49/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 2368, "atom1_serNum": 20627, "atom2_serNum": 21184, "donAcc_type": "standard", "distance": 2.782, "atom1_id": "///H/21/N3", "atom2_id": "///I/48/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 2369, "atom1_serNum": 20629, "atom2_serNum": 21183, "donAcc_type": "standard", "distance": 3.031, "atom1_id": "///H/21/O4", "atom2_id": "///I/48/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 2370, "atom1_serNum": 20647, "atom2_serNum": 21163, "donAcc_type": "standard", "distance": 2.827, "atom1_id": "///H/22/N3", "atom2_id": "///I/47/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 2371, "atom1_serNum": 20649, "atom2_serNum": 21162, "donAcc_type": "standard", "distance": 3.038, "atom1_id": "///H/22/O4", "atom2_id": "///I/47/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 2372, "atom1_serNum": 20669, "atom2_serNum": 21142, "donAcc_type": "standard", "distance": 2.902, "atom1_id": "///H/23/N6", "atom2_id": "///I/46/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 2373, "atom1_serNum": 20670, "atom2_serNum": 21140, "donAcc_type": "standard", "distance": 2.944, "atom1_id": "///H/23/N1", "atom2_id": "///I/46/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 2374, "atom1_serNum": 20688, "atom2_serNum": 21122, "donAcc_type": "standard", "distance": 2.839, "atom1_id": "///H/24/N3", "atom2_id": "///I/45/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 2375, "atom1_serNum": 20690, "atom2_serNum": 21121, "donAcc_type": "standard", "distance": 2.624, "atom1_id": "///H/24/O4", "atom2_id": "///I/45/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 2376, "atom1_serNum": 20711, "atom2_serNum": 21100, "donAcc_type": "standard", "distance": 3.799, "atom1_id": "///H/25/N1", "atom2_id": "///I/44/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 2377, "atom1_serNum": 20713, "atom2_serNum": 21099, "donAcc_type": "standard", "distance": 3.278, "atom1_id": "///H/25/N2", "atom2_id": "///I/44/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 2378, "atom1_serNum": 20729, "atom2_serNum": 21083, "donAcc_type": "standard", "distance": 2.682, "atom1_id": "///H/26/O2", "atom2_id": "///I/43/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 2379, "atom1_serNum": 20730, "atom2_serNum": 21081, "donAcc_type": "standard", "distance": 2.665, "atom1_id": "///H/26/N3", "atom2_id": "///I/43/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 2380, "atom1_serNum": 20732, "atom2_serNum": 21080, "donAcc_type": "standard", "distance": 2.580, "atom1_id": "///H/26/N4", "atom2_id": "///I/43/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 2381, "atom1_serNum": 20749, "atom2_serNum": 21060, "donAcc_type": "standard", "distance": 2.838, "atom1_id": "///H/27/N3", "atom2_id": "///I/42/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 2382, "atom1_serNum": 20751, "atom2_serNum": 21059, "donAcc_type": "standard", "distance": 3.084, "atom1_id": "///H/27/O4", "atom2_id": "///I/42/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 2383, "atom1_serNum": 20769, "atom2_serNum": 21039, "donAcc_type": "standard", "distance": 2.904, "atom1_id": "///H/28/N3", "atom2_id": "///I/41/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 2384, "atom1_serNum": 20771, "atom2_serNum": 21038, "donAcc_type": "standard", "distance": 2.963, "atom1_id": "///H/28/O4", "atom2_id": "///I/41/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 2385, "atom1_serNum": 20791, "atom2_serNum": 21019, "donAcc_type": "standard", "distance": 2.939, "atom1_id": "///H/29/O6", "atom2_id": "///I/40/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 2386, "atom1_serNum": 20792, "atom2_serNum": 21017, "donAcc_type": "standard", "distance": 2.904, "atom1_id": "///H/29/N1", "atom2_id": "///I/40/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 2387, "atom1_serNum": 20794, "atom2_serNum": 21016, "donAcc_type": "standard", "distance": 2.770, "atom1_id": "///H/29/N2", "atom2_id": "///I/40/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 2388, "atom1_serNum": 20810, "atom2_serNum": 20822, "donAcc_type": "questionable", "distance": 3.135, "atom1_id": "///H/30/O2", "atom2_id": "///H/31/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 2389, "atom1_serNum": 20810, "atom2_serNum": 21000, "donAcc_type": "standard", "distance": 2.728, "atom1_id": "///H/30/O2", "atom2_id": "///I/39/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 2390, "atom1_serNum": 20811, "atom2_serNum": 20998, "donAcc_type": "standard", "distance": 2.882, "atom1_id": "///H/30/N3", "atom2_id": "///I/39/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 2391, "atom1_serNum": 20813, "atom2_serNum": 20997, "donAcc_type": "standard", "distance": 2.946, "atom1_id": "///H/30/N4", "atom2_id": "///I/39/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 2392, "atom1_serNum": 20822, "atom2_serNum": 21000, "donAcc_type": "standard", "distance": 3.022, "atom1_id": "///H/31/O4'", "atom2_id": "///I/39/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 2393, "atom1_serNum": 20830, "atom2_serNum": 20977, "donAcc_type": "standard", "distance": 2.775, "atom1_id": "///H/31/N3", "atom2_id": "///I/38/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 2394, "atom1_serNum": 20832, "atom2_serNum": 20976, "donAcc_type": "standard", "distance": 2.966, "atom1_id": "///H/31/O4", "atom2_id": "///I/38/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 2395, "atom1_serNum": 20850, "atom2_serNum": 20956, "donAcc_type": "standard", "distance": 2.831, "atom1_id": "///H/32/N3", "atom2_id": "///I/37/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 2396, "atom1_serNum": 20852, "atom2_serNum": 20955, "donAcc_type": "standard", "distance": 3.015, "atom1_id": "///H/32/O4", "atom2_id": "///I/37/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 2397, "atom1_serNum": 20870, "atom2_serNum": 20935, "donAcc_type": "standard", "distance": 2.765, "atom1_id": "///H/33/N3", "atom2_id": "///I/36/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 2398, "atom1_serNum": 20872, "atom2_serNum": 20934, "donAcc_type": "standard", "distance": 2.946, "atom1_id": "///H/33/O4", "atom2_id": "///I/36/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 2399, "atom1_serNum": 20890, "atom2_serNum": 20914, "donAcc_type": "standard", "distance": 2.735, "atom1_id": "///H/34/N3", "atom2_id": "///I/35/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 2400, "atom1_serNum": 20892, "atom2_serNum": 20913, "donAcc_type": "standard", "distance": 2.997, "atom1_id": "///H/34/O4", "atom2_id": "///I/35/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 2401, "atom1_serNum": 21650, "atom2_serNum": 21660, "donAcc_type": "acceptable", "distance": 3.182, "atom1_id": "///E/901/O2'", "atom2_id": "///E/901/N3", "atom_pair": "O:N", "residue_pair": "ligand:ligand" } ], "refCoords": { "purine": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 -0.5000 0.4000", " 3 N -2.2500 -0.5000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 1.2500 5.0000 0.4000", " 6 C 1.2500 -0.5000 0.4000", " 7 C 1.2500 -0.5000 -0.4000", " 8 C 1.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 -0.5000 0.4000", " 11 C -2.2500 -0.5000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ], "pyrimidine": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 1.0000 0.4000", " 3 N -2.2500 1.0000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 1.2500 5.0000 0.4000", " 6 C 1.2500 1.0000 0.4000", " 7 C 1.2500 1.0000 -0.4000", " 8 C 1.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 1.0000 0.4000", " 11 C -2.2500 1.0000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ], "wc_pair": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 -5.0000 0.4000", " 3 N -2.2500 -5.0000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 2.2500 5.0000 0.4000", " 6 C 2.2500 -5.0000 0.4000", " 7 C 2.2500 -5.0000 -0.4000", " 8 C 2.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 -5.0000 0.4000", " 11 C -2.2500 -5.0000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ] }, "metadata": { "license": "http://innovation.columbia.edu/technologies/CU20391", "url": "http://x3dna.org/", "url_alt": "http://home.x3dna.org/", "forum": "http://forum.x3dna.org/", "citation": "Lu et al. (2015). 'DSSR: an integrated software tool for dissecting the spatial structure of RNA.' Nucleic Acids Res., 43(21):e142 [doi:10.1093/nar/gkv716].", "str_id": "7jk4", "num_aaChains": 7, "aaChains": "A=402,B=290,C=612,D=442,E=399,F=17,G=373", "num_naChains": 2, "naChains": "H=34,I=34", "num_atoms": 21717, "num_waters": 0, "num_metals": 4, "metals_desc": "Mg=4", "num_notes": 52, "notes": [ { "Aminors": "A-minor interactions (including types I and II)" }, { "Cstem_index": "stem index of the 'Canonical' helix in k-turn" }, { "Cstem_pair": "Cstem bp delineating the k-turn internal loop" }, { "Dp": "perpendicular distance of the 3' P atom to the glycosidic bond" }, { "GA_pair": "sheared G-A pair in k-turn" }, { "HtypePknot": "H-type pseudoknot" }, { "Kturn": "kink-turn (k-turn)" }, { "LW": "Leontis-Westhof" }, { "NCstem_index": "stem index of the 'Non-Canonical' helix in k-turn" }, { "NCstem_pair": "NCstem bp delineating the k-turn internal loop" }, { "Uturn": "U-turn of the UNR- or GNRA-type" }, { "aa": "amino acid" }, { "atom_pair": "symbols of the two atoms involved in an H-bond" }, { "auxfiles": "auxiliary files" }, { "glyco_bond": "conformation of base related to sugar (syn or anti)" }, { "bb_type": "backbone conformation, BI or BII" }, { "bending_angle": "angle between two helical axes" }, { "bp": "base pair" }, { "bseq": "base sequence in one-letter code" }, { "bulge": "bulge loop" }, { "coaxStacks": "coaxial stacking of stems within a helix" }, { "dbn": "dot bracket notation" }, { "desc": "description" }, { "donAcc_type": "donor/acceptor type of the atom pair in an H-bond" }, { "epsilon_zeta": "difference between epsilon and zeta torsion angles" }, { "hairpin": "hairpin loop" }, { "hbond": "hydrogen bond (H-bond)" }, { "helix": "defined by base-stacking interactions, regardless of bp type and backbone connectivity" }, { "id": "identifier" }, { "iloop": "internal loop" }, { "index": "serial number" }, { "isoCanonPairs": "isolated canonical pairs" }, { "junction": "(multi-branched) junction loop" }, { "kissingLoop": "kissing loop" }, { "multiplet": "3+ bases in a coplanar geometry" }, { "na": "nucleic acid" }, { "nonPair": "two nts not forming a pair, but with H-bonding/stacking interactions" }, { "nonStack": "nucleotide not involved in stacking interactions" }, { "nt": "nucleotide" }, { "num": "number" }, { "oArea": "overlap areas between two bases, including exocyclic atoms" }, { "oArea_ring": "overlap areas between two bases, including only ring atoms" }, { "phosContacts": "H-bonding and atom-capping interactions involving a phosphate" }, { "residue_pair": "types of the two residues involved in an H-bond" }, { "rmsd": "root-mean-squares deviation" }, { "serNum": "serial number" }, { "ssSegments": "single-stranded segments not involved in loops" }, { "ssZp": "Z-coordinate of the 3' phosphorus atom with reference to the 5' base plane" }, { "sstr": "secondary structure in dbn" }, { "stem": "helix consisting of only canonical pairs, with a continuous backbone" }, { "str_id": "structure identifier, derived from inpfile with extension removed" }, { "vert_dist": "vertical distance from an atom to a base plane" } ], "num_auxfiles": 12, "auxfiles": [ { "index": 1, "name": "dssr-pairs.pdb", "desc": "an ensemble of base pairs" }, { "index": 2, "name": "dssr-stems.pdb", "desc": "an ensemble of stems" }, { "index": 3, "name": "dssr-helices.pdb", "desc": "an ensemble of helices (coaxial stacking)" }, { "index": 4, "name": "dssr-2ndstrs.bpseq", "desc": "secondary structure in bpseq format" }, { "index": 5, "name": "dssr-2ndstrs.ct", "desc": "secondary structure in connectivity table format" }, { "index": 6, "name": "dssr-2ndstrs.dbn", "desc": "secondary structure in dot-bracket notation" }, { "index": 7, "name": "dssr-torsions.txt", "desc": "backbone torsion angles and suite names" }, { "index": 8, "name": "dssr-stacks.pdb", "desc": "an ensemble of base stacks" }, { "index": 9, "name": "dssr-rotmat.txt", "desc": "position vector and rotation matrix" }, { "index": 10, "name": "dssr-viewV.pdb", "desc": "vertical view of the principal moment of inertia" }, { "index": 11, "name": "dssr-viewH.pdb", "desc": "horizontal view of the principal moment of inertia" }, { "index": 12, "name": "dssr-viewT.pdb", "desc": "top view of the principal moment of inertia" } ], "time_used": "999" } }