{ "num_pairs": 21, "pairs": [ { "index": 1, "nt1": "///M/9", "nt2": "///N/34", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -95.770, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 59.357, "chi2": -152.629, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 42.060, "C1C1_dist": 11.059, "N1N9_dist": 9.262, "C6C8_dist": 9.973, "CNNC_torsion": 44.403, "hbonds_num": 2, "hbonds_desc": "N1-N3(imino)[3.33],N1*O4(carbonyl)[2.86]", "unusual_base2base_hbonds": 1, "interBase_angle": 40.868, "planarity": 0.509, "simple_Shear": 1.903, "simple_Stretch": 0.296, "simple_Buckle": -15.474, "simple_Propeller": 37.825, "bp_simpleParams": [ 1.903, 0.296, -0.675, -15.474, 37.825, -12.432 ], "bp_params": [ 1.925, -0.060, -0.675, -7.805, 40.116, -13.201 ], "frame": { "rmsd": null, "origin": [ 11.190, 2.889, 16.399 ], "x_axis": [ -0.793, -0.607, -0.053 ], "y_axis": [ -0.535, 0.734, -0.418 ], "z_axis": [ 0.293, -0.303, -0.907 ], "quaternion": [ 0.094, -0.308, 0.927, -0.194 ] } }, { "index": 2, "nt1": "///M/10", "nt2": "///N/33", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -159.306, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 55.929, "chi2": -149.291, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 54.876, "C1C1_dist": 10.389, "N1N9_dist": 8.729, "C6C8_dist": 9.674, "CNNC_torsion": -22.181, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.83],O4(carbonyl)-N6(amino)[3.05]", "interBase_angle": 22.081, "planarity": 0.267, "simple_Shear": 0.171, "simple_Stretch": -0.188, "simple_Buckle": 3.797, "simple_Propeller": -21.752, "bp_simpleParams": [ 0.171, -0.188, -0.070, 3.797, -21.752, 1.656 ], "bp_params": [ 0.170, -0.190, -0.070, 3.559, -21.792, 1.686 ], "frame": { "rmsd": null, "origin": [ 13.269, 2.107, 13.448 ], "x_axis": [ -0.925, -0.367, -0.098 ], "y_axis": [ -0.325, 0.898, -0.296 ], "z_axis": [ 0.197, -0.242, -0.950 ], "quaternion": [ 0.076, -0.178, 0.971, -0.139 ] } }, { "index": 3, "nt1": "///M/11", "nt2": "///N/32", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -157.057, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 54.293, "chi2": -167.974, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 53.395, "C1C1_dist": 10.302, "N1N9_dist": 8.592, "C6C8_dist": 9.566, "CNNC_torsion": -18.791, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.90],N1-N3(imino)[2.70]", "interBase_angle": 13.211, "planarity": 0.198, "simple_Shear": 0.104, "simple_Stretch": -0.316, "simple_Buckle": -2.183, "simple_Propeller": -13.029, "bp_simpleParams": [ 0.104, -0.316, 0.419, -2.183, -13.029, 1.014 ], "bp_params": [ 0.100, -0.318, 0.419, -2.351, -13.000, 1.021 ], "frame": { "rmsd": null, "origin": [ 14.617, 0.407, 10.371 ], "x_axis": [ -0.952, 0.259, 0.165 ], "y_axis": [ 0.251, 0.966, -0.064 ], "z_axis": [ -0.176, -0.019, -0.984 ], "quaternion": [ -0.086, 0.129, 0.988, -0.021 ] } }, { "index": 4, "nt1": "///M/12", "nt2": "///N/31", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -154.558, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 55.565, "chi2": -159.249, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 45.907, "C1C1_dist": 10.558, "N1N9_dist": 8.733, "C6C8_dist": 9.488, "CNNC_torsion": 6.718, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.65],N1-N3(imino)[2.78]", "interBase_angle": 7.074, "planarity": 0.185, "simple_Shear": 0.239, "simple_Stretch": -0.386, "simple_Buckle": 1.053, "simple_Propeller": 6.995, "bp_simpleParams": [ 0.239, -0.386, -0.717, 1.053, 6.995, -11.299 ], "bp_params": [ 0.229, -0.392, -0.717, 1.231, 6.966, -11.319 ], "frame": { "rmsd": null, "origin": [ 14.889, -1.735, 6.611 ], "x_axis": [ -0.760, 0.575, 0.303 ], "y_axis": [ 0.567, 0.814, -0.122 ], "z_axis": [ -0.317, 0.079, -0.945 ], "quaternion": [ -0.165, 0.305, 0.938, -0.011 ] } }, { "index": 5, "nt1": "///M/13", "nt2": "///N/30", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -136.109, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 52.464, "chi2": -152.381, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 55.419, "C1C1_dist": 10.608, "N1N9_dist": 8.897, "C6C8_dist": 9.824, "CNNC_torsion": 11.509, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[3.01],N1(imino)-N3[2.94],N2(amino)-O2(carbonyl)[2.81]", "interBase_angle": 14.075, "planarity": 0.232, "simple_Shear": -0.172, "simple_Stretch": -0.106, "simple_Buckle": 13.366, "simple_Propeller": 4.413, "bp_simpleParams": [ -0.172, -0.106, -0.297, 13.366, 4.413, 0.534 ], "bp_params": [ -0.171, -0.108, -0.297, 13.319, 4.551, 0.531 ], "frame": { "rmsd": null, "origin": [ 11.728, -1.652, 4.170 ], "x_axis": [ -0.396, 0.802, 0.448 ], "y_axis": [ 0.810, 0.535, -0.241 ], "z_axis": [ -0.433, 0.268, -0.861 ], "quaternion": [ -0.264, 0.482, 0.835, 0.008 ] } }, { "index": 6, "nt1": "///M/15", "nt2": "///N/28", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -88.547, "conf1": "--", "pucker1": "~C2'-endo", "lambda1": 51.446, "chi2": -143.784, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 57.197, "C1C1_dist": 10.486, "N1N9_dist": 8.808, "C6C8_dist": 9.570, "CNNC_torsion": 38.642, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.90],N3-N1(imino)[2.93],N4(amino)-O6(carbonyl)[2.88]", "interBase_angle": 18.409, "planarity": 0.385, "simple_Shear": -0.151, "simple_Stretch": -0.491, "simple_Buckle": 2.863, "simple_Propeller": 18.185, "bp_simpleParams": [ -0.151, -0.491, -1.426, 2.863, 18.185, -9.493 ], "bp_params": [ -0.144, -0.493, -1.426, 2.548, 18.232, -9.611 ], "frame": { "rmsd": null, "origin": [ 7.119, -6.974, -6.309 ], "x_axis": [ -0.977, -0.067, -0.202 ], "y_axis": [ 0.026, 0.904, -0.426 ], "z_axis": [ 0.211, -0.421, -0.882 ], "quaternion": [ 0.106, -0.011, 0.970, -0.218 ] } }, { "index": 7, "nt1": "///M/16", "nt2": "///N/27", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -165.594, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 50.884, "chi2": -145.870, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 54.462, "C1C1_dist": 10.098, "N1N9_dist": 8.337, "C6C8_dist": 9.168, "CNNC_torsion": 6.119, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.31],N1(imino)-N3[2.35],N2(amino)-O2(carbonyl)[2.35]", "interBase_angle": 5.251, "planarity": 0.094, "simple_Shear": -0.158, "simple_Stretch": -0.799, "simple_Buckle": 1.416, "simple_Propeller": 5.056, "bp_simpleParams": [ -0.158, -0.799, -0.282, 1.416, 5.056, -5.490 ], "bp_params": [ -0.148, -0.801, -0.282, 1.354, 5.073, -5.495 ], "frame": { "rmsd": null, "origin": [ 8.897, -9.427, -9.455 ], "x_axis": [ -0.918, 0.318, -0.237 ], "y_axis": [ 0.355, 0.925, -0.134 ], "z_axis": [ 0.177, -0.207, -0.962 ], "quaternion": [ 0.106, 0.172, 0.975, -0.087 ] } }, { "index": 8, "nt1": "///M/17", "nt2": "///N/26", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -153.586, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 54.606, "chi2": -179.180, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 51.236, "C1C1_dist": 10.588, "N1N9_dist": 8.820, "C6C8_dist": 9.695, "CNNC_torsion": 1.781, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.69],N3-N1(imino)[2.82],N4(amino)-O6(carbonyl)[2.85]", "interBase_angle": 9.100, "planarity": 0.128, "simple_Shear": 0.075, "simple_Stretch": -0.244, "simple_Buckle": 6.440, "simple_Propeller": 6.430, "bp_simpleParams": [ 0.075, -0.244, -0.137, 6.440, 6.430, -0.366 ], "bp_params": [ 0.074, -0.244, -0.137, 6.468, 6.402, -0.366 ], "frame": { "rmsd": null, "origin": [ 8.560, -11.364, -13.162 ], "x_axis": [ -0.584, 0.790, -0.188 ], "y_axis": [ 0.798, 0.601, 0.047 ], "z_axis": [ 0.150, -0.122, -0.981 ], "quaternion": [ 0.095, 0.446, 0.890, -0.021 ] } }, { "index": 9, "nt1": "///M/18", "nt2": "///N/25", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -154.069, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 49.397, "chi2": -168.180, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 45.467, "C1C1_dist": 10.917, "N1N9_dist": 8.935, "C6C8_dist": 9.600, "CNNC_torsion": 3.630, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[3.03],N3-N1(imino)[2.87],N4(amino)-O6(carbonyl)[2.69]", "interBase_angle": 14.580, "planarity": 0.192, "simple_Shear": -0.109, "simple_Stretch": -0.250, "simple_Buckle": 14.088, "simple_Propeller": 3.753, "bp_simpleParams": [ -0.109, -0.250, -0.506, 14.088, 3.753, -9.082 ], "bp_params": [ -0.106, -0.251, -0.506, 14.044, 3.915, -9.020 ], "frame": { "rmsd": null, "origin": [ 7.235, -12.378, -16.398 ], "x_axis": [ -0.241, 0.967, 0.089 ], "y_axis": [ 0.969, 0.244, -0.028 ], "z_axis": [ -0.048, 0.080, -0.996 ], "quaternion": [ -0.044, 0.615, 0.787, 0.017 ] } }, { "index": 10, "nt1": "///M/19", "nt2": "///N/24", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -112.327, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.698, "chi2": -159.188, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 54.641, "C1C1_dist": 10.584, "N1N9_dist": 8.877, "C6C8_dist": 9.756, "CNNC_torsion": 19.377, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.84],N3-N1(imino)[2.97],N4(amino)-O6(carbonyl)[3.03]", "interBase_angle": 27.970, "planarity": 0.364, "simple_Shear": -0.088, "simple_Stretch": -0.000, "simple_Buckle": 25.520, "simple_Propeller": 11.449, "bp_simpleParams": [ -0.088, -0.000, -0.700, 25.520, 11.449, -0.423 ], "bp_params": [ -0.088, -0.001, -0.700, 25.552, 11.378, -0.415 ], "frame": { "rmsd": null, "origin": [ 5.819, -10.327, -19.092 ], "x_axis": [ 0.232, 0.895, 0.382 ], "y_axis": [ 0.958, -0.141, -0.251 ], "z_axis": [ -0.171, 0.424, -0.889 ], "quaternion": [ -0.224, 0.752, 0.616, 0.070 ] } }, { "index": 11, "nt1": "///M/21", "nt2": "///N/22", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -81.437, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 46.961, "chi2": -144.681, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 58.882, "C1C1_dist": 10.508, "N1N9_dist": 8.796, "C6C8_dist": 9.899, "CNNC_torsion": 44.763, "hbonds_num": 3, "hbonds_desc": "N1(imino)-N3[2.88],N2(amino)-O2(carbonyl)[2.43],N2(amino)-N3[3.14]", "interBase_angle": 38.555, "planarity": 0.498, "simple_Shear": -0.278, "simple_Stretch": -0.100, "simple_Buckle": -6.165, "simple_Propeller": 38.059, "bp_simpleParams": [ -0.278, -0.100, -1.081, -6.165, 38.059, 7.365 ], "bp_params": [ -0.275, -0.108, -1.081, -7.070, 37.901, 7.773 ], "frame": { "rmsd": null, "origin": [ -1.294, -9.764, -30.494 ], "x_axis": [ -0.747, 0.635, -0.197 ], "y_axis": [ 0.665, 0.717, -0.209 ], "z_axis": [ 0.009, -0.287, -0.958 ], "quaternion": [ 0.056, 0.351, 0.925, -0.134 ] } }, { "index": 12, "nt1": "///M/22", "nt2": "///N/21", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -163.460, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 55.481, "chi2": -159.842, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 51.443, "C1C1_dist": 10.595, "N1N9_dist": 8.857, "C6C8_dist": 9.752, "CNNC_torsion": -8.676, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.82],N1(imino)-N3[2.86],N2(amino)-O2(carbonyl)[2.82]", "interBase_angle": 7.243, "planarity": 0.086, "simple_Shear": -0.076, "simple_Stretch": -0.232, "simple_Buckle": -3.101, "simple_Propeller": -6.546, "bp_simpleParams": [ -0.076, -0.232, -0.013, -3.101, -6.546, -2.612 ], "bp_params": [ -0.075, -0.233, -0.013, -3.084, -6.554, -2.615 ], "frame": { "rmsd": null, "origin": [ -1.342, -12.695, -33.900 ], "x_axis": [ -0.436, 0.880, -0.188 ], "y_axis": [ 0.899, 0.436, -0.045 ], "z_axis": [ 0.042, -0.188, -0.981 ], "quaternion": [ 0.068, 0.527, 0.844, -0.069 ] } }, { "index": 13, "nt1": "///M/23", "nt2": "///N/20", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -162.252, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 47.203, "chi2": -152.275, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 52.964, "C1C1_dist": 10.646, "N1N9_dist": 8.774, "C6C8_dist": 9.542, "CNNC_torsion": -3.895, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.77],N1(imino)-N3[2.98],N2(amino)-O2(carbonyl)[3.32]", "interBase_angle": 23.556, "planarity": 0.334, "simple_Shear": -0.369, "simple_Stretch": -0.451, "simple_Buckle": -15.275, "simple_Propeller": -17.932, "bp_simpleParams": [ -0.369, -0.451, -1.440, -15.275, -17.932, -3.168 ], "bp_params": [ -0.359, -0.459, -1.440, -14.844, -18.291, -3.182 ], "frame": { "rmsd": null, "origin": [ -2.675, -13.484, -37.610 ], "x_axis": [ 0.075, 0.977, 0.199 ], "y_axis": [ 0.994, -0.058, -0.089 ], "z_axis": [ -0.075, 0.205, -0.976 ], "quaternion": [ -0.101, 0.726, 0.679, 0.043 ] } }, { "index": 14, "nt1": "///M/24", "nt2": "///N/19", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -161.492, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 53.571, "chi2": -161.986, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 55.045, "C1C1_dist": 10.529, "N1N9_dist": 8.826, "C6C8_dist": 9.671, "CNNC_torsion": -12.341, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.99],N1-N3(imino)[2.95]", "interBase_angle": 10.408, "planarity": 0.183, "simple_Shear": -0.128, "simple_Stretch": -0.206, "simple_Buckle": 9.119, "simple_Propeller": -5.017, "bp_simpleParams": [ -0.128, -0.206, 0.925, 9.119, -5.017, -4.082 ], "bp_params": [ -0.126, -0.208, 0.925, 9.177, -4.910, -4.073 ], "frame": { "rmsd": null, "origin": [ -4.246, -13.116, -40.574 ], "x_axis": [ 0.429, 0.842, 0.327 ], "y_axis": [ 0.868, -0.485, 0.111 ], "z_axis": [ 0.252, 0.236, -0.938 ], "quaternion": [ -0.037, 0.844, 0.506, 0.171 ] } }, { "index": 15, "nt1": "///M/25", "nt2": "///N/18", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -129.340, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 57.781, "chi2": -173.187, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 55.656, "C1C1_dist": 9.970, "N1N9_dist": 8.366, "C6C8_dist": 9.428, "CNNC_torsion": 7.515, "hbonds_num": 2, "hbonds_desc": "N3-N1(imino)[2.93],N4(amino)-O6(carbonyl)[2.94]", "interBase_angle": 25.437, "planarity": 0.570, "simple_Shear": 0.412, "simple_Stretch": -0.572, "simple_Buckle": 11.566, "simple_Propeller": 22.655, "bp_simpleParams": [ 0.412, -0.572, 1.312, 11.566, 22.655, 11.604 ], "bp_params": [ 0.385, -0.591, 1.312, 12.517, 22.144, 11.755 ], "frame": { "rmsd": null, "origin": [ -3.047, -9.941, -42.669 ], "x_axis": [ 0.722, 0.264, 0.640 ], "y_axis": [ 0.456, -0.877, -0.152 ], "z_axis": [ 0.521, 0.401, -0.753 ], "quaternion": [ -0.151, 0.915, 0.197, 0.317 ] } }, { "index": 16, "nt1": "///M/27", "nt2": "///N/16", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -79.394, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 56.283, "chi2": -148.417, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 64.130, "C1C1_dist": 10.219, "N1N9_dist": 8.843, "C6C8_dist": 10.062, "CNNC_torsion": 55.030, "hbonds_num": 2, "hbonds_desc": "N1*O2(carbonyl)[3.08],N1-N3(imino)[3.41]", "unusual_base2base_hbonds": 1, "interBase_angle": 57.650, "planarity": 0.713, "simple_Shear": -1.456, "simple_Stretch": 0.274, "simple_Buckle": 16.000, "simple_Propeller": 55.386, "bp_simpleParams": [ -1.456, 0.274, -1.071, 16.000, 55.386, 9.044 ], "bp_params": [ -1.479, 0.088, -1.071, 7.727, 57.130, 10.273 ], "frame": { "rmsd": null, "origin": [ -8.073, -4.239, -54.016 ], "x_axis": [ -0.293, 0.936, -0.198 ], "y_axis": [ 0.953, 0.269, -0.138 ], "z_axis": [ -0.076, -0.229, -0.970 ], "quaternion": [ 0.038, 0.593, 0.796, -0.115 ] } }, { "index": 17, "nt1": "///M/28", "nt2": "///N/15", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -173.333, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 51.084, "chi2": -165.312, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 60.462, "C1C1_dist": 10.588, "N1N9_dist": 8.933, "C6C8_dist": 9.939, "CNNC_torsion": -3.984, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.69],N3-N1(imino)[2.96],N4(amino)-O6(carbonyl)[3.21]", "interBase_angle": 6.444, "planarity": 0.121, "simple_Shear": -0.027, "simple_Stretch": -0.029, "simple_Buckle": -1.890, "simple_Propeller": -6.161, "bp_simpleParams": [ -0.027, -0.029, -0.254, -1.890, -6.161, 4.791 ], "bp_params": [ -0.027, -0.029, -0.254, -1.855, -6.171, 4.797 ], "frame": { "rmsd": null, "origin": [ -9.421, -6.105, -57.906 ], "x_axis": [ 0.332, 0.943, -0.030 ], "y_axis": [ 0.943, -0.332, 0.004 ], "z_axis": [ -0.006, -0.030, -1.000 ], "quaternion": [ 0.010, 0.816, 0.578, -0.011 ] } }, { "index": 18, "nt1": "///M/29", "nt2": "///N/14", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -164.174, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 52.851, "chi2": -167.324, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 54.214, "C1C1_dist": 10.721, "N1N9_dist": 8.978, "C6C8_dist": 9.894, "CNNC_torsion": -11.249, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.91],N3-N1(imino)[2.97],N4(amino)-O6(carbonyl)[2.98]", "interBase_angle": 8.236, "planarity": 0.135, "simple_Shear": 0.133, "simple_Stretch": -0.100, "simple_Buckle": 3.992, "simple_Propeller": -7.204, "bp_simpleParams": [ 0.133, -0.100, 0.319, 3.992, -7.204, -1.543 ], "bp_params": [ 0.132, -0.101, 0.319, 3.923, -7.241, -1.545 ], "frame": { "rmsd": null, "origin": [ -11.527, -6.050, -61.171 ], "x_axis": [ 0.726, 0.684, 0.069 ], "y_axis": [ 0.680, -0.730, 0.070 ], "z_axis": [ 0.098, -0.003, -0.995 ], "quaternion": [ 0.020, 0.929, 0.367, 0.045 ] } }, { "index": 19, "nt1": "///M/30", "nt2": "///N/13", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -104.615, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 58.407, "chi2": -152.397, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 58.931, "C1C1_dist": 9.838, "N1N9_dist": 8.312, "C6C8_dist": 9.180, "CNNC_torsion": -11.461, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.88],N1-N3(imino)[2.99]", "interBase_angle": 42.869, "planarity": 0.589, "simple_Shear": 0.053, "simple_Stretch": -0.212, "simple_Buckle": 36.792, "simple_Propeller": -22.002, "bp_simpleParams": [ 0.053, -0.212, -0.691, 36.792, -22.002, 0.963 ], "bp_params": [ 0.058, -0.211, -0.691, 37.490, -20.790, 0.929 ], "frame": { "rmsd": null, "origin": [ -12.046, -5.073, -63.872 ], "x_axis": [ 0.853, 0.243, 0.462 ], "y_axis": [ 0.388, -0.887, -0.249 ], "z_axis": [ 0.349, 0.392, -0.851 ], "quaternion": [ -0.169, 0.948, 0.166, 0.214 ] } }, { "index": 20, "nt1": "///M/32", "nt2": "///N/11", "bp": "G-C", "name": "--", "Saenger": "--", "LW": "tWW", "DSSR": "tW-W", "intra_chain": false, "chi1": -144.717, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 28.342, "chi2": -154.192, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 44.683, "C1C1_dist": 10.271, "N1N9_dist": 8.015, "C6C8_dist": 8.419, "CNNC_torsion": -105.430, "hbonds_num": 2, "hbonds_desc": "N1(imino)-O2(carbonyl)[2.61],N1(imino)-N3[2.77]", "interBase_angle": 68.155, "planarity": 0.987, "simple_Shear": -0.864, "simple_Stretch": -1.661, "simple_Buckle": 4.344, "simple_Propeller": -68.017, "bp_simpleParams": [ -0.864, -1.661, 1.808, 4.344, -68.017, -39.662 ], "bp_params": [ -0.649, -1.757, 1.808, 12.338, -67.029, -46.602 ], "frame": { "rmsd": null, "origin": [ -11.584, 1.411, -71.996 ], "x_axis": [ 0.523, 0.015, -0.852 ], "y_axis": [ -0.063, -0.996, -0.056 ], "z_axis": [ -0.850, 0.083, -0.520 ], "quaternion": [ -0.040, 0.872, -0.014, -0.488 ] } }, { "index": 21, "nt1": "///M/32", "nt2": "///N/12", "bp": "G+G", "name": "--", "Saenger": "--", "LW": "tWS", "DSSR": "tW+m", "intra_chain": false, "chi1": -144.717, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 59.795, "chi2": -175.339, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 96.110, "C1C1_dist": 8.963, "N1N9_dist": 8.772, "C6C8_dist": 10.894, "CNNC_torsion": -144.921, "hbonds_num": 2, "hbonds_desc": "N2(amino)-O2'(hydroxyl)[3.29],N2(amino)-N3[3.29]", "interBase_angle": 48.017, "planarity": 0.594, "simple_Shear": 7.198, "simple_Stretch": 5.038, "simple_Buckle": -42.934, "simple_Propeller": 21.501, "bp_simpleParams": [ 7.198, 5.038, 0.636, -42.934, 21.501, 143.890 ], "bp_params": [ 2.280, 8.485, 0.636, -46.543, -11.809, 141.092 ], "frame": { "rmsd": null, "origin": [ -10.780, 0.249, -68.660 ], "x_axis": [ 0.264, 0.957, 0.124 ], "y_axis": [ -0.403, 0.226, -0.887 ], "z_axis": [ -0.876, 0.184, 0.445 ], "quaternion": [ 0.695, -0.385, -0.360, 0.489 ] } } ], "num_multiplets": 1, "multiplets": [ { "index": 1, "num_nts": 3, "nts_short": "GCG", "nts_long": "///M/32,///N/11,///N/12", "planarity": 1.052 } ], "num_helices": 4, "helices": [ { "index": 1, "num_stems": 1, "strand1": "AUAAG", "strand2": "UAUUC", "bp_type": "|||||", "helix_form": "...A", "helical_rise": 2.240, "helical_rise_std": 0.484, "helical_radius": 9.888, "helical_radius_std": 2.132, "helical_axis": [ 0.127, 0.476, -0.870 ], "point1": [ 9.554, -1.380, 13.413 ], "point2": [ 10.680, 2.852, 5.676 ], "num_pairs": 5, "pairs": [ { "index": 1, "nt1": "///M/9", "nt2": "///N/34", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 1.925, -0.060, -0.675, -7.805, 40.116, -13.201 ], "step_params": [ -1.167, -0.498, 3.469, -6.158, 3.282, 15.696 ], "heli_params": [ -3.984, -0.432, 3.495, 11.318, 21.233, 17.169 ], "bp2_params": [ 0.170, -0.190, -0.070, 3.559, -21.792, 1.686 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.469, "simple_Twist": 24.145, "simple_hRise": 3.554, "simple_hTwist": 25.119 }, { "index": 2, "nt1": "///M/10", "nt2": "///N/33", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.170, -0.190, -0.070, 3.559, -21.792, 1.686 ], "step_params": [ -1.248, -1.337, 3.290, -14.078, 20.855, 34.266 ], "heli_params": [ -3.949, 0.316, 2.450, 30.789, 20.784, 42.288 ], "bp2_params": [ 0.100, -0.318, 0.419, -2.351, -13.000, 1.021 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.290, "simple_Twist": 34.541, "simple_hRise": 2.459, "simple_hTwist": 42.507 }, { "index": 3, "nt1": "///M/11", "nt2": "///N/32", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.100, -0.318, 0.419, -2.351, -13.000, 1.021 ], "step_params": [ -2.039, -1.524, 3.510, -1.542, 10.013, 20.492 ], "heli_params": [ -7.393, 4.604, 2.629, 26.180, 4.032, 22.835 ], "bp2_params": [ 0.229, -0.392, -0.717, 1.231, 6.966, -11.319 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.510, "simple_Twist": 20.551, "simple_hRise": 2.632, "simple_hTwist": 22.889 }, { "index": 4, "nt1": "///M/12", "nt2": "///N/31", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.229, -0.392, -0.717, 1.231, 6.966, -11.319 ], "step_params": [ 1.001, -1.790, 3.427, -1.909, 13.440, 22.495 ], "heli_params": [ -7.178, -2.666, 1.969, 31.080, 4.415, 26.228 ], "bp2_params": [ -0.171, -0.108, -0.297, 13.319, 4.551, 0.531 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.427, "simple_Twist": 23.864, "simple_hRise": 2.057, "simple_hTwist": 27.406 }, { "index": 5, "nt1": "///M/13", "nt2": "///N/30", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 2, "num_stems": 1, "strand1": "CGCCC", "strand2": "GCGGG", "bp_type": "|||||", "helix_form": "..AA", "helical_rise": 2.263, "helical_rise_std": 0.318, "helical_radius": 9.793, "helical_radius_std": 2.112, "helical_axis": [ 0.486, 0.295, -0.823 ], "point1": [ 3.335, -8.823, -10.185 ], "point2": [ 7.661, -6.196, -17.508 ], "num_pairs": 5, "pairs": [ { "index": 1, "nt1": "///M/15", "nt2": "///N/28", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.144, -0.493, -1.426, 2.548, 18.232, -9.611 ], "step_params": [ -1.242, -1.086, 4.044, -12.480, 4.514, 22.216 ], "heli_params": [ -4.073, -1.768, 3.890, 10.587, 29.269, 25.836 ], "bp2_params": [ -0.148, -0.801, -0.282, 1.354, 5.073, -5.495 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 4.044, "simple_Twist": 22.953, "simple_hRise": 3.910, "simple_hTwist": 26.469 }, { "index": 2, "nt1": "///M/16", "nt2": "///N/27", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.148, -0.801, -0.282, 1.354, 5.073, -5.495 ], "step_params": [ -0.004, -1.621, 3.870, -2.986, 4.287, 33.481 ], "heli_params": [ -3.578, -0.548, 3.627, 7.385, 5.145, 33.874 ], "bp2_params": [ 0.074, -0.244, -0.137, 6.468, 6.402, -0.366 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.870, "simple_Twist": 32.727, "simple_hRise": 3.620, "simple_hTwist": 33.130 }, { "index": 3, "nt1": "///M/17", "nt2": "///N/26", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.074, -0.244, -0.137, 6.468, 6.402, -0.366 ], "step_params": [ -0.215, -1.751, 3.185, 5.330, 15.399, 22.871 ], "heli_params": [ -6.575, 1.468, 1.619, 33.863, -11.720, 28.019 ], "bp2_params": [ -0.106, -0.251, -0.506, 14.044, 3.915, -9.020 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.185, "simple_Twist": 23.811, "simple_hRise": 1.681, "simple_hTwist": 28.787 }, { "index": 4, "nt1": "///M/18", "nt2": "///N/25", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.106, -0.251, -0.506, 14.044, 3.915, -9.020 ], "step_params": [ 1.296, -1.047, 3.271, 6.923, 20.812, 25.208 ], "heli_params": [ -5.106, -1.171, 2.113, 39.479, -13.132, 33.297 ], "bp2_params": [ -0.088, -0.001, -0.700, 25.552, 11.378, -0.415 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.271, "simple_Twist": 23.677, "simple_hRise": 2.029, "simple_hTwist": 32.168 }, { "index": 5, "nt1": "///M/19", "nt2": "///N/24", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 3, "num_stems": 1, "strand1": "GGGAC", "strand2": "CCCUG", "bp_type": "|||||", "helix_form": "....", "helical_rise": 2.187, "helical_rise_std": 0.392, "helical_radius": 9.715, "helical_radius_std": 2.281, "helical_axis": [ 0.608, -0.061, -0.791 ], "point1": [ -4.734, -8.911, -34.066 ], "point2": [ 0.537, -9.444, -40.926 ], "num_pairs": 5, "pairs": [ { "index": 1, "nt1": "///M/21", "nt2": "///N/22", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.275, -0.108, -1.081, -7.070, 37.901, 7.773 ], "step_params": [ -1.533, -1.347, 4.003, -5.051, 3.500, 22.621 ], "heli_params": [ -4.795, 1.644, 3.994, 8.719, 12.580, 23.430 ], "bp2_params": [ -0.075, -0.233, -0.013, -3.084, -6.554, -2.615 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 4.003, "simple_Twist": 21.898, "simple_hRise": 3.990, "simple_hTwist": 22.734 }, { "index": 2, "nt1": "///M/22", "nt2": "///N/21", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.075, -0.233, -0.013, -3.084, -6.554, -2.615 ], "step_params": [ -0.561, -1.405, 3.726, 2.270, 23.569, 29.797 ], "heli_params": [ -5.188, 1.155, 2.064, 39.010, -3.757, 37.892 ], "bp2_params": [ -0.359, -0.459, -1.440, -14.844, -18.291, -3.182 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.726, "simple_Twist": 30.417, "simple_hRise": 2.099, "simple_hTwist": 38.374 }, { "index": 3, "nt1": "///M/23", "nt2": "///N/20", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.359, -0.459, -1.440, -14.844, -18.291, -3.182 ], "step_params": [ -0.782, -1.684, 2.817, -17.633, 7.176, 22.174 ], "heli_params": [ -4.723, -1.829, 2.211, 15.488, 38.055, 29.147 ], "bp2_params": [ -0.126, -0.208, 0.925, 9.177, -4.910, -4.073 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.817, "simple_Twist": 21.783, "simple_hRise": 2.195, "simple_hTwist": 28.854 }, { "index": 4, "nt1": "///M/24", "nt2": "///N/19", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.126, -0.208, 0.925, 9.177, -4.910, -4.073 ], "step_params": [ 1.569, -1.593, 3.304, -3.811, 20.741, 36.959 ], "heli_params": [ -4.053, -2.511, 2.009, 29.923, 5.498, 42.369 ], "bp2_params": [ 0.385, -0.591, 1.312, 12.517, 22.144, 11.755 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.304, "simple_Twist": 32.762, "simple_hRise": 1.827, "simple_hTwist": 38.806 }, { "index": 5, "nt1": "///M/25", "nt2": "///N/18", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 4, "num_stems": 1, "strand1": "ACCA", "strand2": "UGGU", "bp_type": "||||", "helix_form": ".A.", "helical_rise": 2.351, "helical_rise_std": 0.661, "helical_radius": 9.827, "helical_radius_std": 1.968, "helical_axis": [ 0.432, -0.383, -0.816 ], "point1": [ -9.501, -0.634, -57.767 ], "point2": [ -6.473, -3.316, -63.487 ], "num_pairs": 4, "pairs": [ { "index": 1, "nt1": "///M/27", "nt2": "///N/16", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -1.479, 0.088, -1.071, 7.727, 57.130, 10.273 ], "step_params": [ -1.369, -1.148, 4.152, -3.752, 11.666, 35.967 ], "heli_params": [ -3.616, 1.511, 3.734, 18.252, 5.870, 37.932 ], "bp2_params": [ -0.027, -0.029, -0.254, -1.855, -6.171, 4.797 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 4.152, "simple_Twist": 27.577, "simple_hRise": 3.539, "simple_hTwist": 30.129 }, { "index": 2, "nt1": "///M/28", "nt2": "///N/15", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.027, -0.029, -0.254, -1.855, -6.171, 4.797 ], "step_params": [ -1.141, -1.946, 3.163, -4.197, 4.526, 27.572 ], "heli_params": [ -4.984, 1.414, 2.950, 9.348, 8.669, 28.242 ], "bp2_params": [ 0.132, -0.101, 0.319, 3.923, -7.241, -1.545 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.163, "simple_Twist": 27.441, "simple_hRise": 2.949, "simple_hTwist": 28.114 }, { "index": 3, "nt1": "///M/29", "nt2": "///N/14", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.132, -0.101, 0.319, 3.923, -7.241, -1.545 ], "step_params": [ -0.758, -0.967, 2.648, 12.122, 25.629, 24.426 ], "heli_params": [ -3.748, 2.243, 0.856, 45.248, -21.401, 37.258 ], "bp2_params": [ 0.058, -0.211, -0.691, 37.490, -20.790, 0.929 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.648, "simple_Twist": 26.876, "simple_hRise": 0.992, "simple_hTwist": 38.875 }, { "index": 4, "nt1": "///M/30", "nt2": "///N/13", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W" } ] } ], "num_stems": 4, "stems": [ { "index": 1, "helix_index": 1, "strand1": "AUAAG", "strand2": "UAUUC", "bp_type": "|||||", "helix_form": "...A", "helical_rise": 2.240, "helical_rise_std": 0.484, "helical_radius": 9.888, "helical_radius_std": 2.132, "helical_axis": [ 0.127, 0.476, -0.870 ], "point1": [ 9.554, -1.380, 13.413 ], "point2": [ 10.680, 2.852, 5.676 ], "num_pairs": 5, "pairs": [ { "index": 1, "nt1": "///M/9", "nt2": "///N/34", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 1.925, -0.060, -0.675, -7.805, 40.116, -13.201 ], "step_params": [ -1.167, -0.498, 3.469, -6.158, 3.282, 15.696 ], "heli_params": [ -3.984, -0.432, 3.495, 11.318, 21.233, 17.169 ], "bp2_params": [ 0.170, -0.190, -0.070, 3.559, -21.792, 1.686 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.469, "simple_Twist": 24.145, "simple_hRise": 3.554, "simple_hTwist": 25.119 }, { "index": 2, "nt1": "///M/10", "nt2": "///N/33", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.170, -0.190, -0.070, 3.559, -21.792, 1.686 ], "step_params": [ -1.248, -1.337, 3.290, -14.078, 20.855, 34.266 ], "heli_params": [ -3.949, 0.316, 2.450, 30.789, 20.784, 42.288 ], "bp2_params": [ 0.100, -0.318, 0.419, -2.351, -13.000, 1.021 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.290, "simple_Twist": 34.541, "simple_hRise": 2.459, "simple_hTwist": 42.507 }, { "index": 3, "nt1": "///M/11", "nt2": "///N/32", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.100, -0.318, 0.419, -2.351, -13.000, 1.021 ], "step_params": [ -2.039, -1.524, 3.510, -1.542, 10.013, 20.492 ], "heli_params": [ -7.393, 4.604, 2.629, 26.180, 4.032, 22.835 ], "bp2_params": [ 0.229, -0.392, -0.717, 1.231, 6.966, -11.319 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.510, "simple_Twist": 20.551, "simple_hRise": 2.632, "simple_hTwist": 22.889 }, { "index": 4, "nt1": "///M/12", "nt2": "///N/31", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.229, -0.392, -0.717, 1.231, 6.966, -11.319 ], "step_params": [ 1.001, -1.790, 3.427, -1.909, 13.440, 22.495 ], "heli_params": [ -7.178, -2.666, 1.969, 31.080, 4.415, 26.228 ], "bp2_params": [ -0.171, -0.108, -0.297, 13.319, 4.551, 0.531 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.427, "simple_Twist": 23.864, "simple_hRise": 2.057, "simple_hTwist": 27.406 }, { "index": 5, "nt1": "///M/13", "nt2": "///N/30", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 2, "helix_index": 2, "strand1": "CGCCC", "strand2": "GCGGG", "bp_type": "|||||", "helix_form": "..AA", "helical_rise": 2.263, "helical_rise_std": 0.318, "helical_radius": 9.793, "helical_radius_std": 2.112, "helical_axis": [ 0.486, 0.295, -0.823 ], "point1": [ 3.335, -8.823, -10.185 ], "point2": [ 7.661, -6.196, -17.508 ], "num_pairs": 5, "pairs": [ { "index": 1, "nt1": "///M/15", "nt2": "///N/28", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.144, -0.493, -1.426, 2.548, 18.232, -9.611 ], "step_params": [ -1.242, -1.086, 4.044, -12.480, 4.514, 22.216 ], "heli_params": [ -4.073, -1.768, 3.890, 10.587, 29.269, 25.836 ], "bp2_params": [ -0.148, -0.801, -0.282, 1.354, 5.073, -5.495 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 4.044, "simple_Twist": 22.953, "simple_hRise": 3.910, "simple_hTwist": 26.469 }, { "index": 2, "nt1": "///M/16", "nt2": "///N/27", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.148, -0.801, -0.282, 1.354, 5.073, -5.495 ], "step_params": [ -0.004, -1.621, 3.870, -2.986, 4.287, 33.481 ], "heli_params": [ -3.578, -0.548, 3.627, 7.385, 5.145, 33.874 ], "bp2_params": [ 0.074, -0.244, -0.137, 6.468, 6.402, -0.366 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.870, "simple_Twist": 32.727, "simple_hRise": 3.620, "simple_hTwist": 33.130 }, { "index": 3, "nt1": "///M/17", "nt2": "///N/26", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.074, -0.244, -0.137, 6.468, 6.402, -0.366 ], "step_params": [ -0.215, -1.751, 3.185, 5.330, 15.399, 22.871 ], "heli_params": [ -6.575, 1.468, 1.619, 33.863, -11.720, 28.019 ], "bp2_params": [ -0.106, -0.251, -0.506, 14.044, 3.915, -9.020 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.185, "simple_Twist": 23.811, "simple_hRise": 1.681, "simple_hTwist": 28.787 }, { "index": 4, "nt1": "///M/18", "nt2": "///N/25", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.106, -0.251, -0.506, 14.044, 3.915, -9.020 ], "step_params": [ 1.296, -1.047, 3.271, 6.923, 20.812, 25.208 ], "heli_params": [ -5.106, -1.171, 2.113, 39.479, -13.132, 33.297 ], "bp2_params": [ -0.088, -0.001, -0.700, 25.552, 11.378, -0.415 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.271, "simple_Twist": 23.677, "simple_hRise": 2.029, "simple_hTwist": 32.168 }, { "index": 5, "nt1": "///M/19", "nt2": "///N/24", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 3, "helix_index": 3, "strand1": "GGGAC", "strand2": "CCCUG", "bp_type": "|||||", "helix_form": "....", "helical_rise": 2.187, "helical_rise_std": 0.392, "helical_radius": 9.715, "helical_radius_std": 2.281, "helical_axis": [ 0.608, -0.061, -0.791 ], "point1": [ -4.734, -8.911, -34.066 ], "point2": [ 0.537, -9.444, -40.926 ], "num_pairs": 5, "pairs": [ { "index": 1, "nt1": "///M/21", "nt2": "///N/22", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.275, -0.108, -1.081, -7.070, 37.901, 7.773 ], "step_params": [ -1.533, -1.347, 4.003, -5.051, 3.500, 22.621 ], "heli_params": [ -4.795, 1.644, 3.994, 8.719, 12.580, 23.430 ], "bp2_params": [ -0.075, -0.233, -0.013, -3.084, -6.554, -2.615 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 4.003, "simple_Twist": 21.898, "simple_hRise": 3.990, "simple_hTwist": 22.734 }, { "index": 2, "nt1": "///M/22", "nt2": "///N/21", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.075, -0.233, -0.013, -3.084, -6.554, -2.615 ], "step_params": [ -0.561, -1.405, 3.726, 2.270, 23.569, 29.797 ], "heli_params": [ -5.188, 1.155, 2.064, 39.010, -3.757, 37.892 ], "bp2_params": [ -0.359, -0.459, -1.440, -14.844, -18.291, -3.182 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.726, "simple_Twist": 30.417, "simple_hRise": 2.099, "simple_hTwist": 38.374 }, { "index": 3, "nt1": "///M/23", "nt2": "///N/20", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.359, -0.459, -1.440, -14.844, -18.291, -3.182 ], "step_params": [ -0.782, -1.684, 2.817, -17.633, 7.176, 22.174 ], "heli_params": [ -4.723, -1.829, 2.211, 15.488, 38.055, 29.147 ], "bp2_params": [ -0.126, -0.208, 0.925, 9.177, -4.910, -4.073 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.817, "simple_Twist": 21.783, "simple_hRise": 2.195, "simple_hTwist": 28.854 }, { "index": 4, "nt1": "///M/24", "nt2": "///N/19", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.126, -0.208, 0.925, 9.177, -4.910, -4.073 ], "step_params": [ 1.569, -1.593, 3.304, -3.811, 20.741, 36.959 ], "heli_params": [ -4.053, -2.511, 2.009, 29.923, 5.498, 42.369 ], "bp2_params": [ 0.385, -0.591, 1.312, 12.517, 22.144, 11.755 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.304, "simple_Twist": 32.762, "simple_hRise": 1.827, "simple_hTwist": 38.806 }, { "index": 5, "nt1": "///M/25", "nt2": "///N/18", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 4, "helix_index": 4, "strand1": "ACCA", "strand2": "UGGU", "bp_type": "||||", "helix_form": ".A.", "helical_rise": 2.351, "helical_rise_std": 0.661, "helical_radius": 9.827, "helical_radius_std": 1.968, "helical_axis": [ 0.432, -0.383, -0.816 ], "point1": [ -9.501, -0.634, -57.767 ], "point2": [ -6.473, -3.316, -63.487 ], "num_pairs": 4, "pairs": [ { "index": 1, "nt1": "///M/27", "nt2": "///N/16", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -1.479, 0.088, -1.071, 7.727, 57.130, 10.273 ], "step_params": [ -1.369, -1.148, 4.152, -3.752, 11.666, 35.967 ], "heli_params": [ -3.616, 1.511, 3.734, 18.252, 5.870, 37.932 ], "bp2_params": [ -0.027, -0.029, -0.254, -1.855, -6.171, 4.797 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 4.152, "simple_Twist": 27.577, "simple_hRise": 3.539, "simple_hTwist": 30.129 }, { "index": 2, "nt1": "///M/28", "nt2": "///N/15", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.027, -0.029, -0.254, -1.855, -6.171, 4.797 ], "step_params": [ -1.141, -1.946, 3.163, -4.197, 4.526, 27.572 ], "heli_params": [ -4.984, 1.414, 2.950, 9.348, 8.669, 28.242 ], "bp2_params": [ 0.132, -0.101, 0.319, 3.923, -7.241, -1.545 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.163, "simple_Twist": 27.441, "simple_hRise": 2.949, "simple_hTwist": 28.114 }, { "index": 3, "nt1": "///M/29", "nt2": "///N/14", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.132, -0.101, 0.319, 3.923, -7.241, -1.545 ], "step_params": [ -0.758, -0.967, 2.648, 12.122, 25.629, 24.426 ], "heli_params": [ -3.748, 2.243, 0.856, 45.248, -21.401, 37.258 ], "bp2_params": [ 0.058, -0.211, -0.691, 37.490, -20.790, 0.929 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.648, "simple_Twist": 26.876, "simple_hRise": 0.992, "simple_hTwist": 38.875 }, { "index": 4, "nt1": "///M/30", "nt2": "///N/13", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W" } ] } ], "num_stacks": 11, "stacks": [ { "index": 1, "num_nts": 2, "nts_short": "UG", "nts_long": "///M/-3,///M/-2" }, { "index": 2, "num_nts": 2, "nts_short": "CG", "nts_long": "///M/-1,///M/0" }, { "index": 3, "num_nts": 2, "nts_short": "AC", "nts_long": "///M/30,///M/31" }, { "index": 4, "num_nts": 2, "nts_short": "UG", "nts_long": "///N/8,///N/9" }, { "index": 5, "num_nts": 2, "nts_short": "GU", "nts_long": "///N/12,///N/13" }, { "index": 6, "num_nts": 2, "nts_short": "UC", "nts_long": "///N/16,///N/17" }, { "index": 7, "num_nts": 2, "nts_short": "CC", "nts_long": "///N/22,///N/23" }, { "index": 8, "num_nts": 2, "nts_short": "GC", "nts_long": "///N/28,///N/29" }, { "index": 9, "num_nts": 2, "nts_short": "UC", "nts_long": "///N/34,///N/35" }, { "index": 10, "num_nts": 2, "nts_short": "UA", "nts_long": "///N/36,///N/37" }, { "index": 11, "num_nts": 4, "nts_short": "CGUA", "nts_long": "///M/4,///M/5,///M/6,///M/7" } ], "nonStack": { "num_nts": 7, "nts_short": "CGGGACC", "nts_long": "///M/3,///M/20,///M/26,///M/32,///N/10,///N/11,///N/30" }, "num_atom2bases": 1, "atom2bases": [ { "index": 1, "type": "other", "atom": "///G/164/N", "nt": "///M/31", "vert_dist": 2.930 } ], "num_iloops": 3, "iloops": [ { "index": 1, "type": "symmetric internal loop", "bridging_nts": [ 1, 1 ], "stem_indices": [ 1, 2 ], "summary": "[2] 1 1 [M.13 N.30 M.15 N.28] 5 5", "num_nts": 6, "nts_short": "GGCGCC", "nts_long": "///M/13,///M/14,///M/15,///N/28,///N/29,///N/30", "num_stems": 2, "bridges": [ { "index": 1, "num_nts": 1, "nts_short": "G", "nts_long": "///M/14" }, { "index": 2, "num_nts": 1, "nts_short": "C", "nts_long": "///N/29" } ] }, { "index": 2, "type": "symmetric internal loop", "bridging_nts": [ 1, 1 ], "stem_indices": [ 2, 3 ], "summary": "[2] 1 1 [M.19 N.24 M.21 N.22] 5 5", "num_nts": 6, "nts_short": "CGGCCG", "nts_long": "///M/19,///M/20,///M/21,///N/22,///N/23,///N/24", "num_stems": 2, "bridges": [ { "index": 1, "num_nts": 1, "nts_short": "G", "nts_long": "///M/20" }, { "index": 2, "num_nts": 1, "nts_short": "C", "nts_long": "///N/23" } ] }, { "index": 3, "type": "symmetric internal loop", "bridging_nts": [ 1, 1 ], "stem_indices": [ 3, 4 ], "summary": "[2] 1 1 [M.25 N.18 M.27 N.16] 5 4", "num_nts": 6, "nts_short": "CGAUCG", "nts_long": "///M/25,///M/26,///M/27,///N/16,///N/17,///N/18", "num_stems": 2, "bridges": [ { "index": 1, "num_nts": 1, "nts_short": "G", "nts_long": "///M/26" }, { "index": 2, "num_nts": 1, "nts_short": "C", "nts_long": "///N/17" } ] } ], "num_ssSegments": 4, "ssSegments": [ { "index": 1, "num_nts": 12, "nts_short": "UGCGACCCGUAG", "nts_long": "///M/-3,///M/-2,///M/-1,///M/0,///M/1,///M/2,///M/3,///M/4,///M/5,///M/6,///M/7,///M/8" }, { "index": 2, "num_nts": 2, "nts_short": "CG", "nts_long": "///M/31,///M/32" }, { "index": 3, "num_nts": 5, "nts_short": "UGACG", "nts_long": "///N/8,///N/9,///N/10,///N/11,///N/12" }, { "index": 4, "num_nts": 3, "nts_short": "CUA", "nts_long": "///N/35,///N/36,///N/37" } ], "num_splayUnits": 8, "splayUnits": [ { "index": 1, "num_nts": 3, "nts_short": "ACC", "nts_long": "///M/1,///M/2,///M/3" }, { "index": 2, "num_nts": 3, "nts_short": "AGA", "nts_long": "///M/7,///M/8,///M/9" }, { "index": 3, "num_nts": 3, "nts_short": "GGC", "nts_long": "///M/13,///M/14,///M/15" }, { "index": 4, "num_nts": 3, "nts_short": "CGG", "nts_long": "///M/19,///M/20,///M/21" }, { "index": 5, "num_nts": 3, "nts_short": "CGA", "nts_long": "///M/25,///M/26,///M/27" }, { "index": 6, "num_nts": 2, "nts_short": "CG", "nts_long": "///N/17,///N/18" }, { "index": 7, "num_nts": 2, "nts_short": "CG", "nts_long": "///N/23,///N/24" }, { "index": 8, "num_nts": 2, "nts_short": "CU", "nts_long": "///N/35,///N/36" } ], "dbn": { "all_chains": { "num_nts": 66, "num_chars": 67, "bseq": "UGCGACCCGUAGAUAAGGCGCCCGGGGACGACCACG&UGACGUGGUCGUCCCCGGGCGCCUUAUCUA", "sstr": "............(((((.(((((.(((((.((((..&.....)))).))))).))))).)))))...", "form": ".............A.A...AA....AAA...A...-&.....A.AA.A..A..A..A.....A...-" }, "chain_M": { "num_nts": 36, "num_chars": 36, "bseq": "UGCGACCCGUAGAUAAGGCGCCCGGGGACGACCACG", "sstr": "............(((((.(((((.(((((.((((..", "form": ".............A.A...AA....AAA...A...-" }, "chain_N": { "num_nts": 30, "num_chars": 30, "bseq": "UGACGUGGUCGUCCCCGGGCGCCUUAUCUA", "sstr": ".....)))).))))).))))).)))))...", "form": ".....A.AA.A..A..A..A.....A...-" } }, "chains": { "chain_M": { "num_nts": 36, "bseq": "UGCGACCCGUAGAUAAGGCGCCCGGGGACGACCACG", "sstr": "............(((((.(((((.(((((.((((..", "form": ".............A.A...AA....AAA...A...-", "helical_rise": 3.509, "helical_rise_std": 2.563, "helical_axis": [ -0.389, -0.098, -0.916 ], "point1": [ 26.990, 6.920, 42.758 ], "point2": [ -20.619, -5.014, -69.329 ], "num_chars": 106, "suite": "U1aG!!C!!G!!A!!C!!C!!C1aG1eU!!A!!G2uA0aU1aA1aA1bG!!G!!C#aG1aC1aC!!C2uG!!G#aG1aG1aA1bC!!G!!A#aC1aC1aA1bC!!G" }, "chain_N": { "num_nts": 30, "bseq": "UGACGUGGUCGUCCCCGGGCGCCUUAUCUA", "sstr": ".....)))).))))).))))).)))))...", "form": ".....A.AA.A..A..A..A.....A...-", "helical_rise": 3.679, "helical_rise_std": 1.021, "helical_axis": [ -0.221, -0.181, 0.958 ], "point1": [ 14.919, 9.295, -80.701 ], "point2": [ -8.689, -10.060, 21.774 ], "num_chars": 88, "suite": "U!!G!!A!!C!!G1aU1cG1aG1aU!!C!!G1aU!!C!!C1aC1bC!!G1aG!!G1aC1aG1[C!!C1cU!!U!!A!!U1aC!!U!!A" } }, "num_nts": 66, "nts": [ { "index": 1, "index_chain": 1, "chain_name": "M", "nt_resnum": -3, "nt_name": "U", "nt_code": "U", "nt_id": "///M/-3", "linked_nts": [ null, "///M/-2" ], "nt_type": "RNA", "dbn": ".", "summary": "~C3'-endo,BI,non-pair-contact,ss-non-loop", "alpha": null, "beta": -177.721, "gamma": 54.449, "delta": 96.404, "epsilon": -160.315, "zeta": -86.933, "epsilon_zeta": -73.382, "bb_type": "BI", "chi": -76.971, "glyco_bond": "--", "C5prime_xyz": [ -2.276, 6.362, -3.352 ], "P_xyz": [ 0.105, 6.093, -4.407 ], "form": ".", "ssZp": -0.492, "Dp": 4.209, "splay_angle": 36.712, "splay_distance": 6.232, "splay_ratio": 0.360, "d22": null, "d64": null, "eta": null, "theta": -156.491, "eta_prime": null, "theta_prime": -165.006, "eta_base": null, "theta_base": -120.349, "v0": 8.407, "v1": -21.180, "v2": 25.387, "v3": -21.256, "v4": 8.249, "amplitude": 25.387, "phase_angle": 359.940, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.103, "frame": { "rmsd": 0.020, "origin": [ -5.398, 20.647, 60.221 ], "x_axis": [ 0.551, -0.797, -0.249 ], "y_axis": [ -0.220, 0.149, -0.964 ], "z_axis": [ 0.805, 0.586, -0.093 ], "quaternion": [ 0.634, -0.611, 0.416, -0.228 ] } }, { "index": 2, "index_chain": 2, "chain_name": "M", "nt_resnum": -2, "nt_name": "G", "nt_code": "G", "nt_id": "///M/-2", "linked_nts": [ "///M/-3", "///M/-1" ], "nt_type": "RNA", "dbn": ".", "summary": "~C3'-endo,non-pair-contact,ss-non-loop", "alpha": -83.052, "beta": 166.252, "gamma": 56.465, "delta": 91.515, "epsilon": -98.965, "zeta": -60.009, "epsilon_zeta": -38.956, "bb_type": "--", "chi": 92.280, "glyco_bond": "--", "C5prime_xyz": [ -4.124, 5.810, 3.035 ], "P_xyz": [ -3.622, 3.885, 4.686 ], "form": ".", "ssZp": 0.916, "Dp": 3.868, "splay_angle": 43.640, "splay_distance": 6.621, "splay_ratio": 0.372, "d22": null, "d64": null, "eta": 170.154, "theta": -108.428, "eta_prime": 170.380, "theta_prime": -116.672, "eta_base": -149.969, "theta_base": -107.784, "v0": -9.720, "v1": -9.581, "v2": 23.779, "v3": -30.090, "v4": 25.173, "amplitude": 29.824, "phase_angle": 37.127, "puckering": "C4'-exo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.262, "filter_rmsd": 0.041, "frame": { "rmsd": 0.041, "origin": [ -3.299, 22.165, 54.553 ], "x_axis": [ 0.034, -0.141, 0.989 ], "y_axis": [ -0.468, 0.873, 0.140 ], "z_axis": [ -0.883, -0.468, -0.037 ], "quaternion": [ 0.684, 0.222, -0.685, 0.120 ] } }, { "index": 3, "index_chain": 3, "chain_name": "M", "nt_resnum": -1, "nt_name": "C", "nt_code": "C", "nt_id": "///M/-1", "linked_nts": [ "///M/-2", "///M/0" ], "nt_type": "RNA", "dbn": ".", "summary": "syn,~C3'-endo,non-pair-contact,ss-non-loop", "alpha": -106.421, "beta": 94.543, "gamma": 161.663, "delta": 84.602, "epsilon": -101.035, "zeta": -11.947, "epsilon_zeta": -89.088, "bb_type": "--", "chi": 47.899, "glyco_bond": "syn", "C5prime_xyz": [ -5.518, 4.302, 1.130 ], "P_xyz": [ -6.228, 5.127, 3.458 ], "form": ".", "ssZp": -2.251, "Dp": 4.164, "splay_angle": 19.009, "splay_distance": 3.128, "splay_ratio": 0.173, "d22": null, "d64": null, "eta": -167.519, "theta": -131.904, "eta_prime": -160.471, "theta_prime": -142.184, "eta_base": -135.877, "theta_base": 135.547, "v0": -6.968, "v1": -13.478, "v2": 27.562, "v3": -32.445, "v4": 24.843, "amplitude": 32.123, "phase_angle": 30.904, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.074, "frame": { "rmsd": 0.019, "origin": [ -1.782, 20.266, 48.394 ], "x_axis": [ 0.525, -0.473, 0.708 ], "y_axis": [ 0.205, 0.877, 0.434 ], "z_axis": [ -0.826, -0.083, 0.557 ], "quaternion": [ 0.860, 0.150, -0.446, -0.197 ] } }, { "index": 4, "index_chain": 4, "chain_name": "M", "nt_resnum": 0, "nt_name": "G", "nt_code": "G", "nt_id": "///M/0", "linked_nts": [ "///M/-1", "///M/1" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C2'-endo,BII,non-pair-contact,ss-non-loop", "alpha": -134.842, "beta": 62.902, "gamma": -172.125, "delta": 124.190, "epsilon": -82.726, "zeta": -158.929, "epsilon_zeta": 76.202, "bb_type": "BII", "chi": -100.965, "glyco_bond": "anti", "C5prime_xyz": [ -1.441, 7.743, -2.397 ], "P_xyz": [ -3.096, 7.803, -4.469 ], "form": ".", "ssZp": -0.161, "Dp": 2.644, "splay_angle": 47.873, "splay_distance": 7.970, "splay_ratio": 0.420, "d22": null, "d64": null, "eta": -178.965, "theta": 95.889, "eta_prime": -171.451, "theta_prime": 108.667, "eta_base": 114.311, "theta_base": 104.062, "v0": -12.713, "v1": 17.303, "v2": -15.136, "v3": 8.257, "v4": 2.789, "amplitude": 17.109, "phase_angle": 152.212, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.041, "frame": { "rmsd": 0.041, "origin": [ 1.292, 20.354, 48.968 ], "x_axis": [ -0.632, -0.773, -0.066 ], "y_axis": [ -0.332, 0.346, -0.877 ], "z_axis": [ 0.701, -0.532, -0.475 ], "quaternion": [ 0.245, -0.353, 0.783, -0.450 ] } }, { "index": 5, "index_chain": 5, "chain_name": "M", "nt_resnum": 1, "nt_name": "A", "nt_code": "A", "nt_id": "///M/1", "linked_nts": [ "///M/0", "///M/2" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,anti,~C3'-endo,ss-non-loop,splayed-apart", "alpha": -105.476, "beta": 131.706, "gamma": -13.421, "delta": 69.898, "epsilon": -134.835, "zeta": 100.745, "epsilon_zeta": 124.419, "bb_type": "--", "chi": -173.777, "glyco_bond": "anti", "C5prime_xyz": [ -0.958, 8.363, 1.270 ], "P_xyz": [ 1.250, 7.890, 2.531 ], "form": ".", "ssZp": 4.659, "Dp": 4.750, "splay_angle": 158.037, "splay_distance": 15.711, "splay_ratio": 0.982, "d22": null, "d64": null, "eta": 92.181, "theta": 33.198, "eta_prime": 82.927, "theta_prime": 51.864, "eta_base": 104.312, "theta_base": 111.453, "v0": 11.236, "v1": -35.901, "v2": 46.244, "v3": -40.667, "v4": 18.573, "amplitude": 46.411, "phase_angle": 4.861, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.057, "frame": { "rmsd": 0.032, "origin": [ 6.248, 25.953, 46.211 ], "x_axis": [ -0.771, -0.280, 0.573 ], "y_axis": [ -0.635, 0.414, -0.652 ], "z_axis": [ -0.054, -0.866, -0.496 ], "quaternion": [ -0.192, -0.279, 0.819, -0.464 ] } }, { "index": 6, "index_chain": 6, "chain_name": "M", "nt_resnum": 2, "nt_name": "C", "nt_code": "C", "nt_id": "///M/2", "linked_nts": [ "///M/1", "///M/3" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C2'-endo,non-pair-contact,ss-non-loop,phosphate,splayed-apart", "alpha": 174.703, "beta": -150.906, "gamma": 137.092, "delta": 150.884, "epsilon": -119.797, "zeta": -104.168, "epsilon_zeta": -15.629, "bb_type": "--", "chi": -144.324, "glyco_bond": "anti", "C5prime_xyz": [ -0.985, 8.515, 0.222 ], "P_xyz": [ 1.599, 8.101, 0.337 ], "form": ".", "ssZp": 1.062, "Dp": 1.296, "splay_angle": 92.882, "splay_distance": 15.331, "splay_ratio": 0.725, "d22": 12.290, "d64": 14.530, "eta": -161.427, "theta": -54.264, "eta_prime": -131.633, "theta_prime": -93.136, "eta_base": 172.970, "theta_base": -82.382, "v0": -13.634, "v1": 30.201, "v2": -34.232, "v3": 27.219, "v4": -8.801, "amplitude": 34.326, "phase_angle": 175.757, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.089, "frame": { "rmsd": 0.033, "origin": [ 2.415, 25.647, 30.978 ], "x_axis": [ 0.751, 0.636, 0.181 ], "y_axis": [ -0.068, -0.198, 0.978 ], "z_axis": [ 0.657, -0.746, -0.106 ], "quaternion": [ 0.601, 0.717, 0.198, 0.292 ] } }, { "index": 7, "index_chain": 7, "chain_name": "M", "nt_resnum": 3, "nt_name": "C", "nt_code": "C", "nt_id": "///M/3", "linked_nts": [ "///M/2", "///M/4" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,anti,~C2'-endo,non-stack,non-pair-contact,ss-non-loop,splayed-apart", "alpha": 129.324, "beta": -102.953, "gamma": -91.917, "delta": 142.343, "epsilon": -151.328, "zeta": 142.590, "epsilon_zeta": 66.082, "bb_type": "--", "chi": -111.130, "glyco_bond": "anti", "C5prime_xyz": [ -2.830, 8.408, -1.746 ], "P_xyz": [ -4.348, 9.265, -3.729 ], "form": ".", "ssZp": 2.105, "Dp": 2.095, "splay_angle": 23.345, "splay_distance": 3.704, "splay_ratio": 0.203, "d22": 5.802, "d64": 5.959, "eta": -66.242, "theta": 82.967, "eta_prime": -47.536, "theta_prime": 102.053, "eta_base": -43.696, "theta_base": 138.668, "v0": -32.385, "v1": 43.321, "v2": -36.994, "v3": 19.291, "v4": 7.952, "amplitude": 42.496, "phase_angle": 150.519, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22m", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.056, "frame": { "rmsd": 0.021, "origin": [ 6.724, 12.686, 37.941 ], "x_axis": [ -0.190, -0.877, 0.440 ], "y_axis": [ -0.980, 0.147, -0.130 ], "z_axis": [ 0.050, -0.457, -0.888 ], "quaternion": [ -0.131, -0.623, 0.746, -0.197 ] } }, { "index": 8, "index_chain": 8, "chain_name": "M", "nt_resnum": 4, "nt_name": "C", "nt_code": "C", "nt_id": "///M/4", "linked_nts": [ "///M/3", "///M/5" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-pair-contact,ss-non-loop,phosphate", "alpha": 105.788, "beta": -104.727, "gamma": 162.355, "delta": 76.735, "epsilon": -128.857, "zeta": -90.173, "epsilon_zeta": -38.684, "bb_type": "--", "chi": -168.000, "glyco_bond": "anti", "C5prime_xyz": [ -1.222, 8.612, 1.045 ], "P_xyz": [ 0.456, 8.854, -0.896 ], "form": ".", "ssZp": 4.530, "Dp": 4.718, "splay_angle": 10.853, "splay_distance": 1.801, "splay_ratio": 0.101, "d22": null, "d64": null, "eta": 161.610, "theta": -144.254, "eta_prime": 159.594, "theta_prime": -153.566, "eta_base": -165.157, "theta_base": -152.083, "v0": 2.619, "v1": -27.150, "v2": 40.581, "v3": -40.096, "v4": 23.402, "amplitude": 42.035, "phase_angle": 15.112, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.076, "frame": { "rmsd": 0.017, "origin": [ 8.705, 14.200, 35.201 ], "x_axis": [ -0.300, -0.853, -0.427 ], "y_axis": [ -0.817, 0.461, -0.347 ], "z_axis": [ 0.493, 0.245, -0.835 ], "quaternion": [ 0.286, -0.518, 0.806, -0.032 ] } }, { "index": 9, "index_chain": 9, "chain_name": "M", "nt_resnum": 5, "nt_name": "G", "nt_code": "G", "nt_id": "///M/5", "linked_nts": [ "///M/4", "///M/6" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-pair-contact,ss-non-loop", "alpha": -38.409, "beta": 166.735, "gamma": 42.262, "delta": 77.109, "epsilon": -113.172, "zeta": -51.111, "epsilon_zeta": -62.061, "bb_type": "--", "chi": -104.804, "glyco_bond": "anti", "C5prime_xyz": [ -2.231, 8.113, -2.403 ], "P_xyz": [ -0.074, 8.458, -3.786 ], "form": ".", "ssZp": 0.583, "Dp": 4.583, "splay_angle": 35.755, "splay_distance": 6.274, "splay_ratio": 0.307, "d22": null, "d64": null, "eta": -176.443, "theta": -122.627, "eta_prime": -171.752, "theta_prime": -131.142, "eta_base": -160.803, "theta_base": -123.914, "v0": -4.784, "v1": -19.923, "v2": 35.738, "v3": -39.587, "v4": 28.089, "amplitude": 39.605, "phase_angle": 25.532, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.283, "filter_rmsd": 0.022, "frame": { "rmsd": 0.022, "origin": [ 10.263, 13.671, 34.467 ], "x_axis": [ -0.412, -0.686, -0.599 ], "y_axis": [ -0.122, 0.694, -0.710 ], "z_axis": [ 0.903, -0.219, -0.370 ], "quaternion": [ 0.477, -0.257, 0.787, -0.295 ] } }, { "index": 10, "index_chain": 10, "chain_name": "M", "nt_resnum": 6, "nt_name": "U", "nt_code": "U", "nt_id": "///M/6", "linked_nts": [ "///M/5", "///M/7" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-pair-contact,ss-non-loop", "alpha": -114.727, "beta": 99.243, "gamma": 143.754, "delta": 79.835, "epsilon": -91.818, "zeta": -131.216, "epsilon_zeta": 39.398, "bb_type": "--", "chi": -170.190, "glyco_bond": "anti", "C5prime_xyz": [ -1.093, 8.474, 1.192 ], "P_xyz": [ -0.661, 10.088, -0.765 ], "form": ".", "ssZp": 4.336, "Dp": 4.728, "splay_angle": 12.013, "splay_distance": 1.967, "splay_ratio": 0.111, "d22": null, "d64": null, "eta": 168.975, "theta": -167.136, "eta_prime": 176.348, "theta_prime": -145.332, "eta_base": -169.815, "theta_base": -131.231, "v0": 5.963, "v1": -29.457, "v2": 40.708, "v3": -38.118, "v4": 20.386, "amplitude": 41.393, "phase_angle": 10.440, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1e", "suiteness": 0.010, "filter_rmsd": 0.122, "frame": { "rmsd": 0.030, "origin": [ 12.360, 11.659, 28.906 ], "x_axis": [ -0.953, -0.298, -0.049 ], "y_axis": [ -0.284, 0.939, -0.193 ], "z_axis": [ 0.103, -0.170, -0.980 ], "quaternion": [ 0.039, -0.148, 0.984, -0.092 ] } }, { "index": 11, "index_chain": 11, "chain_name": "M", "nt_resnum": 7, "nt_name": "A", "nt_code": "A", "nt_id": "///M/7", "linked_nts": [ "///M/6", "///M/8" ], "nt_type": "RNA", "dbn": ".", "summary": "~C2'-endo,BI,non-pair-contact,ss-non-loop,splayed-apart", "alpha": 15.003, "beta": 113.748, "gamma": 32.205, "delta": 144.137, "epsilon": -154.902, "zeta": -55.656, "epsilon_zeta": -99.246, "bb_type": "BI", "chi": -55.589, "glyco_bond": "--", "C5prime_xyz": [ -4.852, 6.266, -2.259 ], "P_xyz": [ -3.116, 6.889, -4.014 ], "form": ".", "ssZp": 2.353, "Dp": 2.550, "splay_angle": 150.570, "splay_distance": 15.141, "splay_ratio": 0.969, "d22": null, "d64": null, "eta": 159.415, "theta": -40.807, "eta_prime": -155.536, "theta_prime": -94.924, "eta_base": -141.201, "theta_base": 160.882, "v0": -38.249, "v1": 48.893, "v2": -39.367, "v3": 18.685, "v4": 11.655, "amplitude": 47.195, "phase_angle": 146.527, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.066, "frame": { "rmsd": 0.058, "origin": [ 11.831, 11.318, 27.043 ], "x_axis": [ -0.970, -0.234, 0.059 ], "y_axis": [ -0.176, 0.519, -0.836 ], "z_axis": [ 0.165, -0.822, -0.545 ], "quaternion": [ 0.031, -0.118, 0.871, -0.476 ] } }, { "index": 12, "index_chain": 12, "chain_name": "M", "nt_resnum": 8, "nt_name": "G", "nt_code": "G", "nt_id": "///M/8", "linked_nts": [ "///M/7", "///M/9" ], "nt_type": "RNA", "dbn": ".", "summary": "syn,~C2'-endo,non-pair-contact,ss-non-loop,phosphate,splayed-apart", "alpha": -130.086, "beta": -145.506, "gamma": -171.205, "delta": 147.504, "epsilon": -94.130, "zeta": -68.836, "epsilon_zeta": -25.294, "bb_type": "--", "chi": 57.085, "glyco_bond": "syn", "C5prime_xyz": [ -5.202, 3.841, 1.263 ], "P_xyz": [ -5.067, 1.916, 3.077 ], "form": ".", "ssZp": -0.383, "Dp": 0.674, "splay_angle": 87.486, "splay_distance": 14.188, "splay_ratio": 0.692, "d22": null, "d64": null, "eta": -45.630, "theta": -111.531, "eta_prime": -15.032, "theta_prime": -112.405, "eta_base": 93.988, "theta_base": -103.461, "v0": -20.445, "v1": 35.004, "v2": -35.659, "v3": 24.709, "v4": -3.036, "amplitude": 36.778, "phase_angle": 165.833, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.020, "frame": { "rmsd": 0.020, "origin": [ 18.236, 13.754, 13.542 ], "x_axis": [ 0.355, 0.459, -0.814 ], "y_axis": [ -0.928, 0.276, -0.249 ], "z_axis": [ 0.110, 0.844, 0.524 ], "quaternion": [ 0.734, -0.373, 0.315, 0.473 ] } }, { "index": 13, "index_chain": 13, "chain_name": "M", "nt_resnum": 9, "nt_name": "A", "nt_code": "A", "nt_id": "///M/9", "linked_nts": [ "///M/8", "///M/10" ], "nt_type": "RNA", "dbn": "(", "summary": "turn,anti,~C2'-endo,canonical,non-pair-contact,helix-end,stem-end,phosphate,splayed-apart", "alpha": -77.935, "beta": 119.530, "gamma": -159.000, "delta": 145.149, "epsilon": -145.945, "zeta": -178.086, "epsilon_zeta": 32.141, "bb_type": "--", "chi": -95.770, "glyco_bond": "anti", "C5prime_xyz": [ -3.162, 7.733, -2.253 ], "P_xyz": [ -4.587, 8.371, -4.338 ], "form": ".", "ssZp": 1.962, "Dp": 1.894, "splay_angle": 26.842, "splay_distance": 4.290, "splay_ratio": 0.234, "d22": null, "d64": null, "eta": -65.827, "theta": 86.512, "eta_prime": -42.630, "theta_prime": 103.778, "eta_base": -67.168, "theta_base": 142.868, "v0": -30.323, "v1": 42.266, "v2": -37.378, "v3": 20.982, "v4": 5.661, "amplitude": 41.754, "phase_angle": 153.535, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22t", "cluster": "2u", "suiteness": 0.010, "filter_rmsd": 0.047, "frame": { "rmsd": 0.035, "origin": [ 10.344, 2.385, 16.666 ], "x_axis": [ -0.771, -0.560, 0.305 ], "y_axis": [ -0.636, 0.700, -0.323 ], "z_axis": [ -0.033, -0.443, -0.896 ], "quaternion": [ -0.092, -0.326, 0.917, -0.209 ] } }, { "index": 14, "index_chain": 14, "chain_name": "M", "nt_resnum": 10, "nt_name": "U", "nt_code": "U", "nt_id": "///M/10", "linked_nts": [ "///M/9", "///M/11" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -77.885, "beta": 126.904, "gamma": 65.467, "delta": 77.348, "epsilon": -153.098, "zeta": -78.272, "epsilon_zeta": -74.826, "bb_type": "BI", "chi": -159.306, "glyco_bond": "anti", "C5prime_xyz": [ -1.700, 8.762, 0.466 ], "P_xyz": [ 0.693, 8.888, -0.428 ], "form": "A", "ssZp": 4.243, "Dp": 4.511, "splay_angle": 25.875, "splay_distance": 3.957, "splay_ratio": 0.224, "d22": null, "d64": null, "eta": 163.627, "theta": -148.547, "eta_prime": 161.603, "theta_prime": -154.232, "eta_base": -161.133, "theta_base": -133.035, "v0": -1.087, "v1": -24.518, "v2": 39.523, "v3": -41.028, "v4": 26.571, "amplitude": 42.048, "phase_angle": 19.957, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "0a", "suiteness": 0.031, "filter_rmsd": 0.101, "frame": { "rmsd": 0.024, "origin": [ 13.214, 1.999, 13.501 ], "x_axis": [ -0.875, -0.395, -0.280 ], "y_axis": [ -0.303, 0.897, -0.321 ], "z_axis": [ 0.378, -0.196, -0.905 ], "quaternion": [ 0.171, -0.182, 0.959, -0.135 ] } }, { "index": 15, "index_chain": 15, "chain_name": "M", "nt_resnum": 11, "nt_name": "A", "nt_code": "A", "nt_id": "///M/11", "linked_nts": [ "///M/10", "///M/12" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -63.776, "beta": -170.417, "gamma": 42.659, "delta": 85.676, "epsilon": -141.411, "zeta": -82.101, "epsilon_zeta": -59.310, "bb_type": "BI", "chi": -157.057, "glyco_bond": "anti", "C5prime_xyz": [ -1.061, 8.463, 0.551 ], "P_xyz": [ 1.288, 8.554, 1.628 ], "form": ".", "ssZp": 4.187, "Dp": 4.582, "splay_angle": 23.625, "splay_distance": 3.830, "splay_ratio": 0.206, "d22": null, "d64": null, "eta": 174.716, "theta": -145.113, "eta_prime": 178.176, "theta_prime": -140.998, "eta_base": -150.930, "theta_base": -140.406, "v0": 5.165, "v1": -26.457, "v2": 36.516, "v3": -34.507, "v4": 18.576, "amplitude": 37.176, "phase_angle": 10.811, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.694, "filter_rmsd": 0.061, "frame": { "rmsd": 0.045, "origin": [ 14.493, 0.262, 10.183 ], "x_axis": [ -0.963, 0.265, 0.052 ], "y_axis": [ 0.262, 0.964, -0.044 ], "z_axis": [ -0.062, -0.029, -0.998 ], "quaternion": [ -0.029, 0.133, 0.991, -0.018 ] } }, { "index": 16, "index_chain": 16, "chain_name": "M", "nt_resnum": 12, "nt_name": "A", "nt_code": "A", "nt_id": "///M/12", "linked_nts": [ "///M/11", "///M/13" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -57.199, "beta": 173.027, "gamma": 41.717, "delta": 84.422, "epsilon": -139.176, "zeta": -86.620, "epsilon_zeta": -52.556, "bb_type": "BI", "chi": -154.558, "glyco_bond": "anti", "C5prime_xyz": [ -2.075, 8.616, 0.118 ], "P_xyz": [ 0.247, 9.496, 0.716 ], "form": "A", "ssZp": 3.964, "Dp": 4.428, "splay_angle": 23.939, "splay_distance": 4.076, "splay_ratio": 0.211, "d22": null, "d64": null, "eta": 168.281, "theta": -143.804, "eta_prime": 176.807, "theta_prime": -136.938, "eta_base": -175.393, "theta_base": -115.155, "v0": -9.111, "v1": -13.989, "v2": 30.283, "v3": -36.244, "v4": 28.673, "amplitude": 36.022, "phase_angle": 32.789, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.678, "filter_rmsd": 0.060, "frame": { "rmsd": 0.047, "origin": [ 14.804, -1.857, 7.008 ], "x_axis": [ -0.791, 0.486, 0.371 ], "y_axis": [ 0.488, 0.867, -0.096 ], "z_axis": [ -0.369, 0.105, -0.923 ], "quaternion": [ -0.196, 0.257, 0.946, 0.002 ] } }, { "index": 17, "index_chain": 17, "chain_name": "M", "nt_resnum": 13, "nt_name": "G", "nt_code": "G", "nt_id": "///M/13", "linked_nts": [ "///M/12", "///M/14" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix-end,stem-end,internal-loop,splayed-apart", "alpha": -44.742, "beta": 156.421, "gamma": 60.887, "delta": 128.381, "epsilon": -128.003, "zeta": -48.434, "epsilon_zeta": -79.570, "bb_type": "--", "chi": -136.109, "glyco_bond": "anti", "C5prime_xyz": [ -2.438, 8.933, -0.627 ], "P_xyz": [ -0.106, 10.019, -0.674 ], "form": ".", "ssZp": 2.528, "Dp": 2.217, "splay_angle": 147.671, "splay_distance": 15.879, "splay_ratio": 0.962, "d22": null, "d64": null, "eta": -171.172, "theta": -59.921, "eta_prime": -148.024, "theta_prime": -100.066, "eta_base": -121.881, "theta_base": -176.576, "v0": -34.658, "v1": 40.489, "v2": -30.384, "v3": 10.921, "v4": 14.785, "amplitude": 39.778, "phase_angle": 139.805, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1b", "suiteness": 0.268, "filter_rmsd": 0.030, "frame": { "rmsd": 0.030, "origin": [ 11.783, -1.789, 4.273 ], "x_axis": [ -0.373, 0.794, 0.480 ], "y_axis": [ 0.755, 0.560, -0.340 ], "z_axis": [ -0.539, 0.235, -0.809 ], "quaternion": [ -0.308, 0.468, 0.828, -0.032 ] } }, { "index": 18, "index_chain": 18, "chain_name": "M", "nt_resnum": 14, "nt_name": "G", "nt_code": "G", "nt_id": "///M/14", "linked_nts": [ "///M/13", "///M/15" ], "nt_type": "RNA", "dbn": ".", "summary": "syn,~C2'-endo,non-pair-contact,internal-loop,phosphate,splayed-apart", "alpha": -96.769, "beta": -147.839, "gamma": 172.148, "delta": 169.972, "epsilon": -90.246, "zeta": -71.195, "epsilon_zeta": -19.051, "bb_type": "--", "chi": 64.409, "glyco_bond": "syn", "C5prime_xyz": [ -5.467, 4.648, 0.912 ], "P_xyz": [ -5.731, 2.495, 2.385 ], "form": ".", "ssZp": -0.404, "Dp": 1.567, "splay_angle": 87.133, "splay_distance": 14.218, "splay_ratio": 0.690, "d22": null, "d64": null, "eta": -24.817, "theta": -112.879, "eta_prime": 7.664, "theta_prime": -113.623, "eta_base": 72.210, "theta_base": -93.985, "v0": -26.077, "v1": 47.840, "v2": -49.577, "v3": 35.712, "v4": -6.219, "amplitude": 50.655, "phase_angle": 168.161, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.038, "origin": [ 20.388, -3.410, -8.973 ], "x_axis": [ 0.344, 0.196, -0.918 ], "y_axis": [ -0.669, 0.737, -0.093 ], "z_axis": [ 0.659, 0.647, 0.385 ], "quaternion": [ 0.785, -0.236, 0.502, 0.276 ] } }, { "index": 19, "index_chain": 19, "chain_name": "M", "nt_resnum": 15, "nt_name": "C", "nt_code": "C", "nt_id": "///M/15", "linked_nts": [ "///M/14", "///M/16" ], "nt_type": "RNA", "dbn": "(", "summary": "turn,~C2'-endo,canonical,non-pair-contact,helix-end,stem-end,internal-loop,phosphate,splayed-apart", "alpha": -89.456, "beta": 102.022, "gamma": -155.275, "delta": 134.919, "epsilon": -162.263, "zeta": -164.378, "epsilon_zeta": 2.115, "bb_type": "--", "chi": -88.547, "glyco_bond": "--", "C5prime_xyz": [ -3.896, 7.713, -2.110 ], "P_xyz": [ -6.208, 7.959, -3.314 ], "form": ".", "ssZp": 2.779, "Dp": 2.524, "splay_angle": 30.676, "splay_distance": 5.012, "splay_ratio": 0.265, "d22": null, "d64": null, "eta": -79.484, "theta": 86.457, "eta_prime": -56.202, "theta_prime": 107.861, "eta_base": -67.141, "theta_base": 146.942, "v0": -35.631, "v1": 42.956, "v2": -33.234, "v3": 13.520, "v4": 13.404, "amplitude": 41.888, "phase_angle": 142.504, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.075, "frame": { "rmsd": 0.037, "origin": [ 7.033, -6.892, -5.561 ], "x_axis": [ -0.997, -0.073, -0.023 ], "y_axis": [ -0.055, 0.892, -0.449 ], "z_axis": [ 0.053, -0.447, -0.893 ], "quaternion": [ 0.020, -0.033, 0.972, -0.230 ] } }, { "index": 20, "index_chain": 20, "chain_name": "M", "nt_resnum": 16, "nt_name": "G", "nt_code": "G", "nt_id": "///M/16", "linked_nts": [ "///M/15", "///M/17" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -54.305, "beta": 140.248, "gamma": 53.336, "delta": 75.492, "epsilon": -154.196, "zeta": -78.476, "epsilon_zeta": -75.721, "bb_type": "BI", "chi": -165.594, "glyco_bond": "anti", "C5prime_xyz": [ -1.976, 8.838, 0.702 ], "P_xyz": [ 0.495, 9.478, 0.626 ], "form": "A", "ssZp": 4.302, "Dp": 4.426, "splay_angle": 26.945, "splay_distance": 4.197, "splay_ratio": 0.233, "d22": null, "d64": null, "eta": 175.885, "theta": -154.704, "eta_prime": 169.786, "theta_prime": -153.606, "eta_base": -155.184, "theta_base": -124.553, "v0": -9.287, "v1": -17.418, "v2": 35.934, "v3": -42.269, "v4": 32.681, "amplitude": 41.984, "phase_angle": 31.139, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "#a", "suiteness": 0.010, "filter_rmsd": 0.042, "frame": { "rmsd": 0.042, "origin": [ 8.797, -9.792, -9.248 ], "x_axis": [ -0.941, 0.282, -0.187 ], "y_axis": [ 0.312, 0.937, -0.155 ], "z_axis": [ 0.132, -0.204, -0.970 ], "quaternion": [ 0.081, 0.151, 0.981, -0.091 ] } }, { "index": 21, "index_chain": 21, "chain_name": "M", "nt_resnum": 17, "nt_name": "C", "nt_code": "C", "nt_id": "///M/17", "linked_nts": [ "///M/16", "///M/18" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -68.406, "beta": -176.301, "gamma": 49.856, "delta": 79.461, "epsilon": -130.437, "zeta": -83.400, "epsilon_zeta": -47.038, "bb_type": "BI", "chi": -153.586, "glyco_bond": "anti", "C5prime_xyz": [ -1.267, 8.679, 0.180 ], "P_xyz": [ 1.263, 8.951, 0.484 ], "form": "A", "ssZp": 4.100, "Dp": 4.719, "splay_angle": 20.571, "splay_distance": 3.476, "splay_ratio": 0.183, "d22": 4.200, "d64": 4.424, "eta": 173.500, "theta": -142.854, "eta_prime": 178.646, "theta_prime": -142.440, "eta_base": -145.487, "theta_base": -136.023, "v0": 2.453, "v1": -25.674, "v2": 38.059, "v3": -37.555, "v4": 22.214, "amplitude": 39.423, "phase_angle": 15.117, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.841, "filter_rmsd": 0.077, "frame": { "rmsd": 0.028, "origin": [ 8.431, -11.400, -13.107 ], "x_axis": [ -0.593, 0.794, -0.133 ], "y_axis": [ 0.802, 0.597, -0.009 ], "z_axis": [ 0.072, -0.112, -0.991 ], "quaternion": [ 0.057, 0.448, 0.892, -0.034 ] } }, { "index": 22, "index_chain": 22, "chain_name": "M", "nt_resnum": 18, "nt_name": "C", "nt_code": "C", "nt_id": "///M/18", "linked_nts": [ "///M/17", "///M/19" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem", "alpha": -52.462, "beta": 158.198, "gamma": 55.751, "delta": 74.202, "epsilon": -124.915, "zeta": -103.327, "epsilon_zeta": -21.588, "bb_type": "--", "chi": -154.069, "glyco_bond": "anti", "C5prime_xyz": [ -1.732, 8.940, 0.050 ], "P_xyz": [ 0.595, 9.856, -0.465 ], "form": ".", "ssZp": 3.960, "Dp": 4.609, "splay_angle": 21.508, "splay_distance": 3.536, "splay_ratio": 0.187, "d22": 4.041, "d64": 3.611, "eta": 170.964, "theta": -150.514, "eta_prime": 179.098, "theta_prime": -138.584, "eta_base": -165.010, "theta_base": -113.261, "v0": -7.813, "v1": -17.355, "v2": 34.534, "v3": -39.987, "v4": 30.341, "amplitude": 39.784, "phase_angle": 29.766, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.614, "filter_rmsd": 0.071, "frame": { "rmsd": 0.026, "origin": [ 7.139, -12.480, -16.148 ], "x_axis": [ -0.311, 0.941, 0.134 ], "y_axis": [ 0.934, 0.329, -0.139 ], "z_axis": [ -0.175, 0.082, -0.981 ], "quaternion": [ -0.095, 0.579, 0.810, -0.017 ] } }, { "index": 23, "index_chain": 23, "chain_name": "M", "nt_resnum": 19, "nt_name": "C", "nt_code": "C", "nt_id": "///M/19", "linked_nts": [ "///M/18", "///M/20" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,internal-loop,splayed-apart", "alpha": -17.900, "beta": 149.712, "gamma": 37.864, "delta": 140.838, "epsilon": -131.306, "zeta": -51.119, "epsilon_zeta": -80.186, "bb_type": "BI", "chi": -112.327, "glyco_bond": "anti", "C5prime_xyz": [ -2.295, 8.518, -1.592 ], "P_xyz": [ 0.180, 9.330, -1.673 ], "form": ".", "ssZp": 2.242, "Dp": 2.003, "splay_angle": 149.860, "splay_distance": 18.000, "splay_ratio": 0.966, "d22": null, "d64": null, "eta": -177.887, "theta": -46.058, "eta_prime": -149.223, "theta_prime": -93.808, "eta_base": -123.027, "theta_base": -148.552, "v0": -28.598, "v1": 39.934, "v2": -34.799, "v3": 19.118, "v4": 5.871, "amplitude": 39.162, "phase_angle": 152.698, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.073, "frame": { "rmsd": 0.026, "origin": [ 5.868, -10.515, -18.797 ], "x_axis": [ 0.255, 0.847, 0.466 ], "y_axis": [ 0.900, -0.031, -0.435 ], "z_axis": [ -0.355, 0.530, -0.770 ], "quaternion": [ -0.337, 0.717, 0.609, 0.039 ] } }, { "index": 24, "index_chain": 24, "chain_name": "M", "nt_resnum": 20, "nt_name": "G", "nt_code": "G", "nt_id": "///M/20", "linked_nts": [ "///M/19", "///M/21" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C2'-endo,non-stack,non-pair-contact,internal-loop,splayed-apart", "alpha": -103.526, "beta": -151.591, "gamma": -175.792, "delta": 150.118, "epsilon": -106.691, "zeta": -43.643, "epsilon_zeta": -63.048, "bb_type": "--", "chi": -123.637, "glyco_bond": "anti", "C5prime_xyz": [ -0.598, 8.198, -1.047 ], "P_xyz": [ 1.173, 8.002, -2.985 ], "form": ".", "ssZp": 1.228, "Dp": 1.753, "splay_angle": 89.967, "splay_distance": 15.306, "splay_ratio": 0.707, "d22": null, "d64": null, "eta": -39.918, "theta": -100.247, "eta_prime": 0.507, "theta_prime": -110.170, "eta_base": 50.545, "theta_base": -94.085, "v0": -11.193, "v1": 27.092, "v2": -31.652, "v3": 25.818, "v4": -9.397, "amplitude": 31.667, "phase_angle": 178.195, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22t", "cluster": "2u", "suiteness": 0.271, "filter_rmsd": 0.048, "frame": { "rmsd": 0.048, "origin": [ 12.119, -15.252, -34.998 ], "x_axis": [ -0.423, -0.875, 0.235 ], "y_axis": [ -0.356, 0.399, 0.845 ], "z_axis": [ -0.833, 0.274, -0.480 ], "quaternion": [ -0.352, -0.406, 0.759, 0.369 ] } }, { "index": 25, "index_chain": 25, "chain_name": "M", "nt_resnum": 21, "nt_name": "G", "nt_code": "G", "nt_id": "///M/21", "linked_nts": [ "///M/20", "///M/22" ], "nt_type": "RNA", "dbn": "(", "summary": "turn,anti,~C2'-endo,canonical,non-pair-contact,helix-end,stem-end,internal-loop,phosphate,splayed-apart", "alpha": -108.422, "beta": 116.835, "gamma": -139.974, "delta": 150.917, "epsilon": -172.579, "zeta": -171.362, "epsilon_zeta": -1.217, "bb_type": "--", "chi": -81.437, "glyco_bond": "anti", "C5prime_xyz": [ -3.389, 7.970, -2.206 ], "P_xyz": [ -5.324, 9.227, -3.396 ], "form": ".", "ssZp": 2.784, "Dp": 2.526, "splay_angle": 31.927, "splay_distance": 4.985, "splay_ratio": 0.275, "d22": null, "d64": null, "eta": -76.922, "theta": 89.837, "eta_prime": -50.213, "theta_prime": 107.565, "eta_base": -53.938, "theta_base": 141.512, "v0": -32.655, "v1": 48.493, "v2": -44.415, "v3": 26.762, "v4": 3.360, "amplitude": 48.216, "phase_angle": 157.099, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.051, "frame": { "rmsd": 0.051, "origin": [ -1.232, -9.734, -29.938 ], "x_axis": [ -0.669, 0.734, 0.116 ], "y_axis": [ 0.718, 0.679, -0.157 ], "z_axis": [ -0.194, -0.022, -0.981 ], "quaternion": [ -0.085, 0.398, 0.912, -0.049 ] } }, { "index": 26, "index_chain": 26, "chain_name": "M", "nt_resnum": 22, "nt_name": "G", "nt_code": "G", "nt_id": "///M/22", "linked_nts": [ "///M/21", "///M/23" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -64.070, "beta": 148.928, "gamma": 65.312, "delta": 79.952, "epsilon": -145.786, "zeta": -83.453, "epsilon_zeta": -62.333, "bb_type": "BI", "chi": -163.460, "glyco_bond": "anti", "C5prime_xyz": [ -1.653, 8.667, 0.659 ], "P_xyz": [ 0.771, 9.143, 0.025 ], "form": "A", "ssZp": 4.420, "Dp": 4.603, "splay_angle": 21.896, "splay_distance": 3.513, "splay_ratio": 0.193, "d22": null, "d64": null, "eta": -177.116, "theta": -150.273, "eta_prime": 174.300, "theta_prime": -154.964, "eta_base": -159.510, "theta_base": -136.893, "v0": -2.175, "v1": -22.216, "v2": 36.687, "v3": -38.955, "v4": 25.999, "amplitude": 39.483, "phase_angle": 21.691, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "#a", "suiteness": 0.021, "filter_rmsd": 0.032, "frame": { "rmsd": 0.032, "origin": [ -1.431, -12.777, -33.881 ], "x_axis": [ -0.452, 0.858, -0.243 ], "y_axis": [ 0.887, 0.461, -0.024 ], "z_axis": [ 0.091, -0.226, -0.970 ], "quaternion": [ 0.098, 0.514, 0.849, -0.074 ] } }, { "index": 27, "index_chain": 27, "chain_name": "M", "nt_resnum": 23, "nt_name": "G", "nt_code": "G", "nt_id": "///M/23", "linked_nts": [ "///M/22", "///M/24" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -52.416, "beta": 167.581, "gamma": 45.629, "delta": 78.439, "epsilon": -131.365, "zeta": -78.447, "epsilon_zeta": -52.918, "bb_type": "BI", "chi": -162.252, "glyco_bond": "anti", "C5prime_xyz": [ -1.305, 8.783, 0.647 ], "P_xyz": [ 1.165, 9.277, 1.140 ], "form": "A", "ssZp": 4.269, "Dp": 4.612, "splay_angle": 26.624, "splay_distance": 4.413, "splay_ratio": 0.232, "d22": null, "d64": null, "eta": 173.179, "theta": -142.935, "eta_prime": 179.665, "theta_prime": -140.789, "eta_base": -150.425, "theta_base": -124.438, "v0": -1.746, "v1": -22.367, "v2": 36.702, "v3": -38.788, "v4": 25.588, "amplitude": 39.359, "phase_angle": 21.175, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.736, "filter_rmsd": 0.031, "frame": { "rmsd": 0.031, "origin": [ -2.863, -13.793, -36.923 ], "x_axis": [ 0.045, 0.998, 0.040 ], "y_axis": [ 0.998, -0.046, 0.041 ], "z_axis": [ 0.043, 0.038, -0.998 ], "quaternion": [ 0.001, 0.723, 0.691, 0.029 ] } }, { "index": 28, "index_chain": 28, "chain_name": "M", "nt_resnum": 24, "nt_name": "A", "nt_code": "A", "nt_id": "///M/24", "linked_nts": [ "///M/23", "///M/25" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -59.470, "beta": 167.003, "gamma": 52.701, "delta": 74.435, "epsilon": -145.015, "zeta": -55.564, "epsilon_zeta": -89.451, "bb_type": "BI", "chi": -161.492, "glyco_bond": "anti", "C5prime_xyz": [ -1.824, 8.751, 0.508 ], "P_xyz": [ 0.492, 9.778, 0.549 ], "form": "A", "ssZp": 4.365, "Dp": 4.631, "splay_angle": 26.673, "splay_distance": 4.413, "splay_ratio": 0.235, "d22": null, "d64": null, "eta": 167.299, "theta": -134.895, "eta_prime": 179.067, "theta_prime": -125.961, "eta_base": -154.280, "theta_base": -92.464, "v0": -3.780, "v1": -22.086, "v2": 38.003, "v3": -41.372, "v4": 28.738, "amplitude": 41.564, "phase_angle": 23.889, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.740, "filter_rmsd": 0.047, "frame": { "rmsd": 0.036, "origin": [ -4.247, -13.010, -41.040 ], "x_axis": [ 0.406, 0.868, 0.285 ], "y_axis": [ 0.899, -0.435, 0.045 ], "z_axis": [ 0.163, 0.238, -0.957 ], "quaternion": [ -0.058, 0.836, 0.528, 0.134 ] } }, { "index": 29, "index_chain": 29, "chain_name": "M", "nt_resnum": 25, "nt_name": "C", "nt_code": "C", "nt_id": "///M/25", "linked_nts": [ "///M/24", "///M/26" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix-end,stem-end,internal-loop,splayed-apart", "alpha": -76.009, "beta": -162.756, "gamma": 53.686, "delta": 133.848, "epsilon": -95.879, "zeta": -120.707, "epsilon_zeta": 24.828, "bb_type": "--", "chi": -129.340, "glyco_bond": "anti", "C5prime_xyz": [ -1.927, 8.742, -0.904 ], "P_xyz": [ 0.275, 9.817, -0.107 ], "form": ".", "ssZp": 1.649, "Dp": 1.520, "splay_angle": 140.542, "splay_distance": 16.343, "splay_ratio": 0.944, "d22": null, "d64": null, "eta": -169.046, "theta": -84.906, "eta_prime": -145.670, "theta_prime": -114.744, "eta_base": -108.405, "theta_base": -172.752, "v0": -27.865, "v1": 35.068, "v2": -28.398, "v3": 13.071, "v4": 9.219, "amplitude": 34.278, "phase_angle": 145.942, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1b", "suiteness": 0.388, "filter_rmsd": 0.059, "frame": { "rmsd": 0.026, "origin": [ -2.701, -9.367, -42.995 ], "x_axis": [ 0.663, 0.088, 0.744 ], "y_axis": [ 0.452, -0.839, -0.304 ], "z_axis": [ 0.597, 0.537, -0.596 ], "quaternion": [ -0.239, 0.880, 0.153, 0.381 ] } }, { "index": 30, "index_chain": 30, "chain_name": "M", "nt_resnum": 26, "nt_name": "G", "nt_code": "G", "nt_id": "///M/26", "linked_nts": [ "///M/25", "///M/27" ], "nt_type": "RNA", "dbn": ".", "summary": "syn,~C2'-endo,non-stack,non-pair-contact,internal-loop,splayed-apart", "alpha": 0.613, "beta": 139.602, "gamma": 151.043, "delta": 145.982, "epsilon": -167.432, "zeta": 14.338, "epsilon_zeta": 178.230, "bb_type": "--", "chi": 35.993, "glyco_bond": "syn", "C5prime_xyz": [ -5.558, 4.144, 0.043 ], "P_xyz": [ -6.402, 2.270, 1.712 ], "form": ".", "ssZp": -1.557, "Dp": 2.108, "splay_angle": 85.821, "splay_distance": 13.991, "splay_ratio": 0.681, "d22": null, "d64": null, "eta": -15.725, "theta": -99.127, "eta_prime": 6.814, "theta_prime": -108.874, "eta_base": 54.823, "theta_base": -99.336, "v0": -25.595, "v1": 39.296, "v2": -36.825, "v3": 23.086, "v4": 1.164, "amplitude": 39.383, "phase_angle": 159.236, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.026, "frame": { "rmsd": 0.026, "origin": [ -2.841, -17.284, -57.292 ], "x_axis": [ 0.189, -0.106, -0.976 ], "y_axis": [ 0.719, 0.692, 0.064 ], "z_axis": [ 0.669, -0.714, 0.207 ], "quaternion": [ 0.723, 0.269, 0.569, -0.286 ] } }, { "index": 31, "index_chain": 31, "chain_name": "M", "nt_resnum": 27, "nt_name": "A", "nt_code": "A", "nt_id": "///M/27", "linked_nts": [ "///M/26", "///M/28" ], "nt_type": "RNA", "dbn": "(", "summary": "turn,anti,~C2'-endo,canonical,non-pair-contact,helix-end,stem-end,internal-loop,phosphate,splayed-apart", "alpha": -154.297, "beta": 116.133, "gamma": -130.739, "delta": 148.015, "epsilon": -157.888, "zeta": -173.898, "epsilon_zeta": 16.010, "bb_type": "--", "chi": -79.394, "glyco_bond": "anti", "C5prime_xyz": [ -3.707, 7.010, -2.660 ], "P_xyz": [ -5.613, 8.058, -4.027 ], "form": ".", "ssZp": 2.065, "Dp": 2.090, "splay_angle": 31.320, "splay_distance": 4.905, "splay_ratio": 0.270, "d22": null, "d64": null, "eta": -88.373, "theta": 93.374, "eta_prime": -53.816, "theta_prime": 104.078, "eta_base": -66.039, "theta_base": 153.358, "v0": -29.604, "v1": 43.133, "v2": -39.062, "v3": 23.106, "v4": 3.628, "amplitude": 42.724, "phase_angle": 156.106, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.048, "frame": { "rmsd": 0.034, "origin": [ -7.774, -4.797, -53.356 ], "x_axis": [ -0.120, 0.956, 0.268 ], "y_axis": [ 0.956, 0.184, -0.229 ], "z_axis": [ -0.268, 0.229, -0.936 ], "quaternion": [ -0.179, 0.639, 0.748, 0.000 ] } }, { "index": 32, "index_chain": 32, "chain_name": "M", "nt_resnum": 28, "nt_name": "C", "nt_code": "C", "nt_id": "///M/28", "linked_nts": [ "///M/27", "///M/29" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -80.605, "beta": 135.021, "gamma": 68.240, "delta": 76.199, "epsilon": -135.972, "zeta": -89.930, "epsilon_zeta": -46.042, "bb_type": "BI", "chi": -173.333, "glyco_bond": "anti", "C5prime_xyz": [ -1.105, 8.598, 1.328 ], "P_xyz": [ 1.379, 8.769, 0.696 ], "form": "A", "ssZp": 4.601, "Dp": 4.690, "splay_angle": 26.505, "splay_distance": 4.106, "splay_ratio": 0.231, "d22": 4.835, "d64": 5.047, "eta": 166.538, "theta": -150.923, "eta_prime": 159.018, "theta_prime": -152.755, "eta_base": -152.168, "theta_base": -142.022, "v0": 3.912, "v1": -28.346, "v2": 40.900, "v3": -39.602, "v4": 22.504, "amplitude": 42.035, "phase_angle": 13.340, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "#a", "suiteness": 0.010, "filter_rmsd": 0.075, "frame": { "rmsd": 0.021, "origin": [ -9.439, -6.109, -57.779 ], "x_axis": [ 0.371, 0.925, -0.083 ], "y_axis": [ 0.929, -0.370, 0.024 ], "z_axis": [ -0.009, -0.086, -0.996 ], "quaternion": [ 0.033, 0.827, 0.560, -0.028 ] } }, { "index": 33, "index_chain": 33, "chain_name": "M", "nt_resnum": 29, "nt_name": "C", "nt_code": "C", "nt_id": "///M/29", "linked_nts": [ "///M/28", "///M/30" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -48.802, "beta": 164.848, "gamma": 48.632, "delta": 76.050, "epsilon": -133.823, "zeta": -82.261, "epsilon_zeta": -51.562, "bb_type": "BI", "chi": -164.174, "glyco_bond": "anti", "C5prime_xyz": [ -1.292, 8.711, 0.788 ], "P_xyz": [ 1.268, 9.013, 0.969 ], "form": ".", "ssZp": 4.413, "Dp": 4.670, "splay_angle": 16.069, "splay_distance": 2.469, "splay_ratio": 0.140, "d22": null, "d64": null, "eta": 172.635, "theta": -146.315, "eta_prime": -179.738, "theta_prime": -138.413, "eta_base": -156.347, "theta_base": -136.620, "v0": 2.729, "v1": -27.770, "v2": 41.376, "v3": -40.646, "v4": 23.779, "amplitude": 42.820, "phase_angle": 14.918, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.559, "filter_rmsd": 0.066, "frame": { "rmsd": 0.019, "origin": [ -11.497, -5.968, -61.328 ], "x_axis": [ 0.721, 0.693, 0.006 ], "y_axis": [ 0.692, -0.721, 0.035 ], "z_axis": [ 0.029, -0.022, -0.999 ], "quaternion": [ 0.015, 0.928, 0.373, 0.009 ] } }, { "index": 34, "index_chain": 34, "chain_name": "M", "nt_resnum": 30, "nt_name": "A", "nt_code": "A", "nt_id": "///M/30", "linked_nts": [ "///M/29", "///M/31" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end", "alpha": -57.264, "beta": -161.438, "gamma": 34.314, "delta": 86.969, "epsilon": -151.822, "zeta": -81.931, "epsilon_zeta": -69.891, "bb_type": "BI", "chi": -104.615, "glyco_bond": "anti", "C5prime_xyz": [ -1.911, 7.652, -2.415 ], "P_xyz": [ 0.560, 8.415, -2.870 ], "form": ".", "ssZp": 1.561, "Dp": 4.562, "splay_angle": 8.768, "splay_distance": 2.248, "splay_ratio": 0.127, "d22": null, "d64": null, "eta": 170.946, "theta": -155.114, "eta_prime": 174.260, "theta_prime": -144.286, "eta_base": 179.647, "theta_base": -147.352, "v0": 4.388, "v1": -23.817, "v2": 33.129, "v3": -31.390, "v4": 17.011, "amplitude": 33.773, "phase_angle": 11.205, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.301, "filter_rmsd": 0.050, "frame": { "rmsd": 0.039, "origin": [ -12.183, -5.108, -63.538 ], "x_axis": [ 0.893, 0.329, 0.306 ], "y_axis": [ 0.446, -0.725, -0.524 ], "z_axis": [ 0.050, 0.605, -0.794 ], "quaternion": [ -0.306, 0.924, 0.210, 0.096 ] } }, { "index": 35, "index_chain": 35, "chain_name": "M", "nt_resnum": 31, "nt_name": "C", "nt_code": "C", "nt_id": "///M/31", "linked_nts": [ "///M/30", "///M/32" ], "nt_type": "RNA", "dbn": ".", "summary": "~C2'-endo,non-pair-contact,ss-non-loop,cap-acceptor", "alpha": -64.117, "beta": 158.189, "gamma": 81.777, "delta": 147.030, "epsilon": -153.544, "zeta": -149.479, "epsilon_zeta": -4.065, "bb_type": "--", "chi": -60.969, "glyco_bond": "--", "C5prime_xyz": [ -3.767, 6.630, -2.890 ], "P_xyz": [ -2.079, 6.012, -4.754 ], "form": ".", "ssZp": 1.517, "Dp": 1.964, "splay_angle": 61.486, "splay_distance": 10.228, "splay_ratio": 0.511, "d22": null, "d64": null, "eta": 173.102, "theta": -160.161, "eta_prime": -143.888, "theta_prime": 163.483, "eta_base": -153.190, "theta_base": -165.153, "v0": -25.653, "v1": 38.162, "v2": -35.521, "v3": 21.640, "v4": 2.242, "amplitude": 38.341, "phase_angle": 157.889, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1b", "suiteness": 0.215, "filter_rmsd": 0.069, "frame": { "rmsd": 0.017, "origin": [ -11.415, -5.454, -65.622 ], "x_axis": [ 0.839, 0.324, 0.437 ], "y_axis": [ 0.505, -0.162, -0.848 ], "z_axis": [ -0.204, 0.932, -0.299 ], "quaternion": [ 0.587, -0.758, -0.273, -0.077 ] } }, { "index": 36, "index_chain": 36, "chain_name": "M", "nt_resnum": 32, "nt_name": "G", "nt_code": "G", "nt_id": "///M/32", "linked_nts": [ "///M/31", null ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-stack,non-canonical,non-pair-contact,multiplet,ss-non-loop,phosphate", "alpha": -57.558, "beta": 93.196, "gamma": 150.540, "delta": 85.827, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": -144.717, "glyco_bond": "anti", "C5prime_xyz": [ -0.972, 8.645, -0.378 ], "P_xyz": [ -1.364, 9.482, -2.849 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": 4.946, "v1": -24.491, "v2": 33.564, "v3": -31.779, "v4": 16.988, "amplitude": 34.147, "phase_angle": 10.599, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.019, "frame": { "rmsd": 0.019, "origin": [ -12.466, 2.357, -72.140 ], "x_axis": [ 0.038, 0.470, -0.882 ], "y_axis": [ -0.163, -0.867, -0.470 ], "z_axis": [ -0.986, 0.162, 0.044 ], "quaternion": [ 0.232, -0.682, -0.113, 0.684 ] } }, { "index": 37, "index_chain": 1, "chain_name": "N", "nt_resnum": 8, "nt_name": "U", "nt_code": "U", "nt_id": "///N/8", "linked_nts": [ null, "///N/9" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-pair-contact,ss-non-loop", "alpha": null, "beta": 142.700, "gamma": -60.075, "delta": 81.448, "epsilon": -143.467, "zeta": -130.831, "epsilon_zeta": -12.636, "bb_type": "--", "chi": -92.988, "glyco_bond": "anti", "C5prime_xyz": [ -3.022, 7.469, -2.794 ], "P_xyz": [ -2.395, 9.784, -3.810 ], "form": ".", "ssZp": 0.435, "Dp": 4.412, "splay_angle": 23.534, "splay_distance": 4.146, "splay_ratio": 0.217, "d22": null, "d64": null, "eta": null, "theta": 175.114, "eta_prime": null, "theta_prime": -170.755, "eta_base": null, "theta_base": -152.675, "v0": -9.241, "v1": -13.285, "v2": 29.250, "v3": -35.399, "v4": 28.210, "amplitude": 35.073, "phase_angle": 33.492, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.105, "frame": { "rmsd": 0.009, "origin": [ -17.004, -1.667, -88.170 ], "x_axis": [ 0.715, -0.698, 0.046 ], "y_axis": [ 0.699, 0.711, -0.071 ], "z_axis": [ 0.017, 0.083, 0.996 ], "quaternion": [ 0.925, -0.042, -0.008, -0.378 ] } }, { "index": 38, "index_chain": 2, "chain_name": "N", "nt_resnum": 9, "nt_name": "G", "nt_code": "G", "nt_id": "///N/9", "linked_nts": [ "///N/8", "///N/10" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C2'-endo,BI,non-pair-contact,ss-non-loop", "alpha": 113.505, "beta": -105.633, "gamma": -154.430, "delta": 146.014, "epsilon": -143.696, "zeta": -66.442, "epsilon_zeta": -77.254, "bb_type": "BI", "chi": -101.408, "glyco_bond": "anti", "C5prime_xyz": [ -2.366, 8.087, -2.090 ], "P_xyz": [ -2.092, 7.243, -4.558 ], "form": ".", "ssZp": 1.969, "Dp": 1.950, "splay_angle": 58.902, "splay_distance": 9.332, "splay_ratio": 0.494, "d22": null, "d64": null, "eta": -117.876, "theta": -131.677, "eta_prime": -132.010, "theta_prime": -174.881, "eta_base": -132.062, "theta_base": 173.865, "v0": -24.578, "v1": 37.271, "v2": -34.799, "v3": 21.673, "v4": 1.668, "amplitude": 37.361, "phase_angle": 158.660, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.014, "frame": { "rmsd": 0.014, "origin": [ -14.131, -0.825, -85.302 ], "x_axis": [ 0.751, -0.631, -0.192 ], "y_axis": [ 0.656, 0.747, 0.111 ], "z_axis": [ 0.073, -0.209, 0.975 ], "quaternion": [ 0.932, 0.086, 0.071, -0.345 ] } }, { "index": 39, "index_chain": 3, "chain_name": "N", "nt_resnum": 10, "nt_name": "A", "nt_code": "A", "nt_id": "///N/10", "linked_nts": [ "///N/9", "///N/11" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-stack,non-pair-contact,ss-non-loop", "alpha": 154.736, "beta": 89.608, "gamma": 146.441, "delta": 86.360, "epsilon": -158.249, "zeta": -116.472, "epsilon_zeta": -41.777, "bb_type": "BI", "chi": -103.646, "glyco_bond": "anti", "C5prime_xyz": [ -2.120, 7.831, -2.501 ], "P_xyz": [ -3.430, 6.919, -4.580 ], "form": ".", "ssZp": 1.627, "Dp": 4.408, "splay_angle": 43.952, "splay_distance": 7.249, "splay_ratio": 0.377, "d22": null, "d64": null, "eta": 76.106, "theta": 163.701, "eta_prime": 122.223, "theta_prime": -177.076, "eta_base": 135.619, "theta_base": -153.016, "v0": -0.054, "v1": -19.777, "v2": 30.770, "v3": -31.688, "v4": 20.151, "amplitude": 32.491, "phase_angle": 18.733, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.009, "origin": [ -16.103, 1.676, -76.531 ], "x_axis": [ 0.547, -0.837, 0.008 ], "y_axis": [ 0.836, 0.546, -0.051 ], "z_axis": [ 0.039, 0.034, 0.999 ], "quaternion": [ 0.879, -0.024, 0.009, -0.476 ] } }, { "index": 40, "index_chain": 4, "chain_name": "N", "nt_resnum": 11, "nt_name": "C", "nt_code": "C", "nt_id": "///N/11", "linked_nts": [ "///N/10", "///N/12" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-stack,non-canonical,non-pair-contact,multiplet,ss-non-loop", "alpha": 152.330, "beta": -107.136, "gamma": 169.328, "delta": 82.768, "epsilon": -174.858, "zeta": -90.326, "epsilon_zeta": -84.532, "bb_type": "BI", "chi": -154.192, "glyco_bond": "anti", "C5prime_xyz": [ -1.548, 8.822, 0.117 ], "P_xyz": [ -0.386, 8.818, -2.275 ], "form": ".", "ssZp": 4.286, "Dp": 4.426, "splay_angle": 42.701, "splay_distance": 7.246, "splay_ratio": 0.373, "d22": null, "d64": null, "eta": 162.782, "theta": -127.441, "eta_prime": -159.142, "theta_prime": -151.771, "eta_base": -127.494, "theta_base": -162.900, "v0": 3.046, "v1": -25.783, "v2": 37.207, "v3": -36.309, "v4": 21.012, "amplitude": 38.341, "phase_angle": 13.972, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.068, "frame": { "rmsd": 0.016, "origin": [ -10.701, 0.465, -71.851 ], "x_axis": [ 0.836, -0.398, -0.379 ], "y_axis": [ 0.352, 0.917, -0.188 ], "z_axis": [ 0.422, 0.024, 0.906 ], "quaternion": [ 0.956, -0.055, 0.209, -0.196 ] } }, { "index": 41, "index_chain": 5, "chain_name": "N", "nt_resnum": 12, "nt_name": "G", "nt_code": "G", "nt_id": "///N/12", "linked_nts": [ "///N/11", "///N/13" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,multiplet,ss-non-loop", "alpha": 147.150, "beta": -109.302, "gamma": -148.317, "delta": 76.513, "epsilon": -160.197, "zeta": -79.896, "epsilon_zeta": -80.301, "bb_type": "BI", "chi": -175.339, "glyco_bond": "anti", "C5prime_xyz": [ -1.480, 8.583, 1.306 ], "P_xyz": [ -1.455, 10.453, -0.539 ], "form": ".", "ssZp": 4.683, "Dp": 4.629, "splay_angle": 26.000, "splay_distance": 4.357, "splay_ratio": 0.247, "d22": null, "d64": null, "eta": -130.666, "theta": 153.610, "eta_prime": -119.277, "theta_prime": 163.230, "eta_base": -105.407, "theta_base": 160.805, "v0": 2.985, "v1": -27.746, "v2": 40.661, "v3": -39.749, "v4": 23.147, "amplitude": 41.983, "phase_angle": 14.415, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.019, "frame": { "rmsd": 0.019, "origin": [ -9.094, -1.859, -65.179 ], "x_axis": [ 0.784, 0.029, 0.621 ], "y_axis": [ 0.086, 0.984, -0.155 ], "z_axis": [ -0.615, 0.175, 0.769 ], "quaternion": [ 0.940, -0.088, -0.329, -0.015 ] } }, { "index": 42, "index_chain": 6, "chain_name": "N", "nt_resnum": 13, "nt_name": "U", "nt_code": "U", "nt_id": "///N/13", "linked_nts": [ "///N/12", "///N/14" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end", "alpha": -59.432, "beta": -178.946, "gamma": 58.071, "delta": 76.600, "epsilon": -148.361, "zeta": -82.084, "epsilon_zeta": -66.277, "bb_type": "BI", "chi": -152.397, "glyco_bond": "anti", "C5prime_xyz": [ -1.765, 8.835, -0.012 ], "P_xyz": [ 0.695, 9.722, -0.138 ], "form": "A", "ssZp": 4.119, "Dp": 4.580, "splay_angle": 19.577, "splay_distance": 3.393, "splay_ratio": 0.178, "d22": null, "d64": null, "eta": -179.093, "theta": -129.205, "eta_prime": -176.676, "theta_prime": -138.414, "eta_base": 178.697, "theta_base": -113.113, "v0": -2.421, "v1": -21.673, "v2": 36.289, "v3": -38.705, "v4": 25.809, "amplitude": 39.155, "phase_angle": 22.061, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.793, "filter_rmsd": 0.102, "frame": { "rmsd": 0.016, "origin": [ -11.909, -5.038, -64.205 ], "x_axis": [ 0.764, 0.203, 0.612 ], "y_axis": [ -0.237, 0.971, -0.027 ], "z_axis": [ -0.600, -0.124, 0.790 ], "quaternion": [ 0.939, 0.026, -0.323, 0.117 ] } }, { "index": 43, "index_chain": 7, "chain_name": "N", "nt_resnum": 14, "nt_name": "G", "nt_code": "G", "nt_id": "///N/14", "linked_nts": [ "///N/13", "///N/15" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": 159.971, "beta": -164.633, "gamma": 168.465, "delta": 87.167, "epsilon": -135.500, "zeta": -60.431, "epsilon_zeta": -75.069, "bb_type": "BI", "chi": -167.324, "glyco_bond": "anti", "C5prime_xyz": [ -1.344, 8.537, 0.954 ], "P_xyz": [ 0.187, 10.016, -0.599 ], "form": ".", "ssZp": 4.456, "Dp": 4.615, "splay_angle": 20.673, "splay_distance": 3.676, "splay_ratio": 0.194, "d22": null, "d64": null, "eta": 154.854, "theta": -147.277, "eta_prime": 171.127, "theta_prime": -149.577, "eta_base": -146.641, "theta_base": -122.042, "v0": 4.760, "v1": -25.602, "v2": 35.455, "v3": -33.707, "v4": 18.280, "amplitude": 36.144, "phase_angle": 11.210, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.652, "filter_rmsd": 0.023, "frame": { "rmsd": 0.023, "origin": [ -11.556, -6.132, -61.013 ], "x_axis": [ 0.727, 0.673, 0.133 ], "y_axis": [ -0.666, 0.739, -0.102 ], "z_axis": [ -0.167, -0.015, 0.986 ], "quaternion": [ 0.929, -0.023, -0.081, 0.360 ] } }, { "index": 44, "index_chain": 8, "chain_name": "N", "nt_resnum": 15, "nt_name": "G", "nt_code": "G", "nt_id": "///N/15", "linked_nts": [ "///N/14", "///N/16" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem", "alpha": -80.135, "beta": 161.260, "gamma": 75.057, "delta": 69.065, "epsilon": -113.860, "zeta": -92.232, "epsilon_zeta": -21.628, "bb_type": "--", "chi": -165.312, "glyco_bond": "anti", "C5prime_xyz": [ -2.203, 8.845, 0.743 ], "P_xyz": [ -0.083, 10.194, 0.180 ], "form": "A", "ssZp": 4.304, "Dp": 4.713, "splay_angle": 26.194, "splay_distance": 4.265, "splay_ratio": 0.228, "d22": null, "d64": null, "eta": 162.718, "theta": -147.044, "eta_prime": -179.075, "theta_prime": -141.090, "eta_base": -135.053, "theta_base": -107.764, "v0": -4.040, "v1": -23.150, "v2": 40.266, "v3": -43.780, "v4": 30.143, "amplitude": 44.029, "phase_angle": 23.860, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.185, "filter_rmsd": 0.021, "frame": { "rmsd": 0.021, "origin": [ -9.404, -6.101, -58.033 ], "x_axis": [ 0.292, 0.956, 0.024 ], "y_axis": [ -0.956, 0.292, 0.011 ], "z_axis": [ 0.004, -0.027, 1.000 ], "quaternion": [ 0.804, 0.012, -0.006, 0.595 ] } }, { "index": 45, "index_chain": 9, "chain_name": "N", "nt_resnum": 16, "nt_name": "U", "nt_code": "U", "nt_id": "///N/16", "linked_nts": [ "///N/15", "///N/17" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,internal-loop", "alpha": -48.796, "beta": 168.277, "gamma": 34.021, "delta": 84.939, "epsilon": -162.578, "zeta": -86.782, "epsilon_zeta": -75.796, "bb_type": "BI", "chi": -148.417, "glyco_bond": "anti", "C5prime_xyz": [ -1.715, 8.760, -0.189 ], "P_xyz": [ 0.749, 9.543, 0.192 ], "form": "A", "ssZp": 3.999, "Dp": 4.348, "splay_angle": 28.255, "splay_distance": 4.509, "splay_ratio": 0.244, "d22": 4.412, "d64": 3.876, "eta": 156.641, "theta": -144.331, "eta_prime": 170.328, "theta_prime": -138.218, "eta_base": -146.935, "theta_base": -117.348, "v0": -4.881, "v1": -16.732, "v2": 30.590, "v3": -34.243, "v4": 24.591, "amplitude": 34.188, "phase_angle": 26.521, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.085, "filter_rmsd": 0.097, "frame": { "rmsd": 0.020, "origin": [ -8.372, -3.682, -54.676 ], "x_axis": [ -0.362, 0.687, -0.630 ], "y_axis": [ -0.923, -0.361, 0.135 ], "z_axis": [ -0.135, 0.630, 0.764 ], "quaternion": [ 0.510, -0.243, 0.243, 0.789 ] } }, { "index": 46, "index_chain": 10, "chain_name": "N", "nt_resnum": 17, "nt_name": "C", "nt_code": "C", "nt_id": "///N/17", "linked_nts": [ "///N/16", "///N/18" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C2'-endo,non-pair-contact,internal-loop,splayed-apart", "alpha": -158.258, "beta": -160.443, "gamma": 143.069, "delta": 141.306, "epsilon": -149.991, "zeta": 130.537, "epsilon_zeta": 79.472, "bb_type": "--", "chi": -153.822, "glyco_bond": "anti", "C5prime_xyz": [ -1.601, 8.723, 0.477 ], "P_xyz": [ 0.929, 9.230, 0.253 ], "form": ".", "ssZp": 1.955, "Dp": 2.129, "splay_angle": 97.026, "splay_distance": 15.540, "splay_ratio": 0.751, "d22": null, "d64": null, "eta": 172.527, "theta": 133.188, "eta_prime": -158.673, "theta_prime": 94.684, "eta_base": -134.059, "theta_base": 91.446, "v0": -24.066, "v1": 34.661, "v2": -31.478, "v3": 18.383, "v4": 3.321, "amplitude": 34.528, "phase_angle": 155.738, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.056, "frame": { "rmsd": 0.020, "origin": [ -8.933, 0.086, -52.264 ], "x_axis": [ -0.526, -0.132, -0.840 ], "y_axis": [ -0.578, -0.669, 0.467 ], "z_axis": [ -0.624, 0.731, 0.276 ], "quaternion": [ 0.142, -0.466, 0.381, 0.786 ] } }, { "index": 47, "index_chain": 11, "chain_name": "N", "nt_resnum": 18, "nt_name": "G", "nt_code": "G", "nt_id": "///N/18", "linked_nts": [ "///N/17", "///N/19" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,internal-loop,phosphate,splayed-apart", "alpha": 62.932, "beta": -89.640, "gamma": -97.549, "delta": 79.632, "epsilon": -158.998, "zeta": -78.433, "epsilon_zeta": -80.565, "bb_type": "BI", "chi": -173.187, "glyco_bond": "anti", "C5prime_xyz": [ -1.805, 8.701, 1.203 ], "P_xyz": [ -3.089, 10.795, 0.313 ], "form": "A", "ssZp": 4.321, "Dp": 4.382, "splay_angle": 23.311, "splay_distance": 3.614, "splay_ratio": 0.203, "d22": null, "d64": null, "eta": -94.204, "theta": 127.731, "eta_prime": -129.719, "theta_prime": 155.951, "eta_base": -145.328, "theta_base": -174.958, "v0": -4.079, "v1": -19.419, "v2": 33.926, "v3": -37.517, "v4": 26.287, "amplitude": 37.402, "phase_angle": 24.899, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23m", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.024, "frame": { "rmsd": 0.024, "origin": [ -3.393, -10.514, -42.343 ], "x_axis": [ 0.767, 0.419, 0.486 ], "y_axis": [ -0.485, 0.874, 0.013 ], "z_axis": [ -0.419, -0.246, 0.874 ], "quaternion": [ 0.937, 0.069, -0.241, 0.241 ] } }, { "index": 48, "index_chain": 12, "chain_name": "N", "nt_resnum": 19, "nt_name": "U", "nt_code": "U", "nt_id": "///N/19", "linked_nts": [ "///N/18", "///N/20" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -94.177, "beta": -169.099, "gamma": 64.397, "delta": 83.242, "epsilon": -144.010, "zeta": -44.362, "epsilon_zeta": -99.648, "bb_type": "BI", "chi": -161.986, "glyco_bond": "anti", "C5prime_xyz": [ -1.381, 8.641, 0.623 ], "P_xyz": [ 1.198, 8.963, 0.828 ], "form": ".", "ssZp": 4.478, "Dp": 4.646, "splay_angle": 12.026, "splay_distance": 2.524, "splay_ratio": 0.132, "d22": 4.314, "d64": 4.637, "eta": 163.052, "theta": -120.301, "eta_prime": 169.277, "theta_prime": -128.694, "eta_base": -164.733, "theta_base": -106.613, "v0": 2.108, "v1": -24.817, "v2": 36.700, "v3": -36.435, "v4": 21.564, "amplitude": 38.064, "phase_angle": 15.382, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.300, "filter_rmsd": 0.109, "frame": { "rmsd": 0.021, "origin": [ -4.246, -13.223, -40.108 ], "x_axis": [ 0.446, 0.814, 0.373 ], "y_axis": [ -0.829, 0.533, -0.172 ], "z_axis": [ -0.339, -0.232, 0.912 ], "quaternion": [ 0.850, 0.018, -0.209, 0.483 ] } }, { "index": 49, "index_chain": 13, "chain_name": "N", "nt_resnum": 20, "nt_name": "C", "nt_code": "C", "nt_id": "///N/20", "linked_nts": [ "///N/19", "///N/21" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem", "alpha": -129.499, "beta": 135.864, "gamma": 142.077, "delta": 86.410, "epsilon": -114.500, "zeta": -100.082, "epsilon_zeta": -14.418, "bb_type": "--", "chi": -152.275, "glyco_bond": "anti", "C5prime_xyz": [ -1.585, 8.842, 0.046 ], "P_xyz": [ -0.748, 10.081, -2.080 ], "form": ".", "ssZp": 3.601, "Dp": 4.321, "splay_angle": 26.050, "splay_distance": 4.585, "splay_ratio": 0.226, "d22": 3.986, "d64": 3.970, "eta": -177.658, "theta": -145.014, "eta_prime": -166.931, "theta_prime": -151.787, "eta_base": -129.669, "theta_base": -127.866, "v0": -6.413, "v1": -15.163, "v2": 29.540, "v3": -34.147, "v4": 25.636, "amplitude": 33.876, "phase_angle": 29.306, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.055, "frame": { "rmsd": 0.026, "origin": [ -2.488, -13.174, -38.298 ], "x_axis": [ 0.123, 0.931, 0.345 ], "y_axis": [ -0.974, 0.047, 0.221 ], "z_axis": [ 0.189, -0.363, 0.912 ], "quaternion": [ 0.722, 0.202, -0.054, 0.660 ] } }, { "index": 50, "index_chain": 14, "chain_name": "N", "nt_resnum": 21, "nt_name": "C", "nt_code": "C", "nt_id": "///N/21", "linked_nts": [ "///N/20", "///N/22" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem", "alpha": 105.275, "beta": -146.954, "gamma": -158.900, "delta": 81.277, "epsilon": -111.621, "zeta": -78.220, "epsilon_zeta": -33.401, "bb_type": "--", "chi": -159.842, "glyco_bond": "anti", "C5prime_xyz": [ -1.136, 8.644, 0.617 ], "P_xyz": [ 0.020, 10.306, -0.962 ], "form": "A", "ssZp": 4.118, "Dp": 4.715, "splay_angle": 23.665, "splay_distance": 4.023, "splay_ratio": 0.208, "d22": 4.076, "d64": 4.160, "eta": 143.229, "theta": -154.279, "eta_prime": 161.276, "theta_prime": -147.942, "eta_base": -161.482, "theta_base": -123.008, "v0": 5.278, "v1": -27.933, "v2": 39.032, "v3": -36.910, "v4": 19.980, "amplitude": 39.783, "phase_angle": 11.151, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.075, "frame": { "rmsd": 0.023, "origin": [ -1.254, -12.612, -33.918 ], "x_axis": [ -0.416, 0.900, -0.133 ], "y_axis": [ -0.909, -0.411, 0.068 ], "z_axis": [ 0.007, 0.149, 0.989 ], "quaternion": [ 0.539, -0.038, 0.065, 0.839 ] } }, { "index": 51, "index_chain": 15, "chain_name": "N", "nt_resnum": 22, "nt_name": "C", "nt_code": "C", "nt_id": "///N/22", "linked_nts": [ "///N/21", "///N/23" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,internal-loop", "alpha": -58.057, "beta": 165.802, "gamma": 53.234, "delta": 78.092, "epsilon": -130.472, "zeta": -74.132, "epsilon_zeta": -56.340, "bb_type": "BI", "chi": -144.681, "glyco_bond": "anti", "C5prime_xyz": [ -2.091, 8.927, -0.509 ], "P_xyz": [ 0.212, 9.969, -0.967 ], "form": ".", "ssZp": 3.541, "Dp": 4.405, "splay_angle": 27.112, "splay_distance": 4.621, "splay_ratio": 0.234, "d22": 3.966, "d64": 3.682, "eta": 163.254, "theta": -135.038, "eta_prime": -179.555, "theta_prime": -125.303, "eta_base": -147.639, "theta_base": -105.517, "v0": -14.046, "v1": -10.566, "v2": 29.650, "v3": -38.540, "v4": 33.310, "amplitude": 38.447, "phase_angle": 39.540, "puckering": "C4'-exo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.332, "filter_rmsd": 0.049, "frame": { "rmsd": 0.034, "origin": [ -1.355, -9.793, -31.050 ], "x_axis": [ -0.754, 0.452, -0.476 ], "y_axis": [ -0.622, -0.724, 0.298 ], "z_axis": [ -0.210, 0.521, 0.827 ], "quaternion": [ 0.295, -0.189, 0.225, 0.909 ] } }, { "index": 52, "index_chain": 16, "chain_name": "N", "nt_resnum": 23, "nt_name": "C", "nt_code": "C", "nt_id": "///N/23", "linked_nts": [ "///N/22", "///N/24" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C2'-endo,non-pair-contact,internal-loop,splayed-apart", "alpha": -57.356, "beta": -179.403, "gamma": 53.436, "delta": 142.742, "epsilon": -157.127, "zeta": 119.956, "epsilon_zeta": 82.917, "bb_type": "--", "chi": -104.311, "glyco_bond": "anti", "C5prime_xyz": [ -2.724, 8.229, -1.955 ], "P_xyz": [ -0.553, 9.628, -2.182 ], "form": ".", "ssZp": 2.205, "Dp": 2.150, "splay_angle": 88.864, "splay_distance": 14.659, "splay_ratio": 0.703, "d22": null, "d64": null, "eta": 168.683, "theta": 119.638, "eta_prime": -156.326, "theta_prime": 86.396, "eta_base": -132.631, "theta_base": 93.612, "v0": -28.817, "v1": 40.415, "v2": -35.892, "v3": 20.141, "v4": 5.161, "amplitude": 39.987, "phase_angle": 153.843, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1b", "suiteness": 0.789, "filter_rmsd": 0.057, "frame": { "rmsd": 0.015, "origin": [ -4.590, -7.011, -29.275 ], "x_axis": [ -0.583, -0.307, -0.752 ], "y_axis": [ -0.312, -0.771, 0.556 ], "z_axis": [ -0.750, 0.559, 0.354 ], "quaternion": [ 0.002, -0.457, 0.339, 0.823 ] } }, { "index": 53, "index_chain": 17, "chain_name": "N", "nt_resnum": 24, "nt_name": "G", "nt_code": "G", "nt_id": "///N/24", "linked_nts": [ "///N/23", "///N/25" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,internal-loop,phosphate,splayed-apart", "alpha": 51.576, "beta": -104.739, "gamma": -99.266, "delta": 80.243, "epsilon": -158.469, "zeta": -82.488, "epsilon_zeta": -75.981, "bb_type": "BI", "chi": -159.188, "glyco_bond": "anti", "C5prime_xyz": [ -1.671, 8.853, 0.442 ], "P_xyz": [ -2.709, 10.978, -0.627 ], "form": "A", "ssZp": 4.262, "Dp": 4.435, "splay_angle": 23.660, "splay_distance": 3.809, "splay_ratio": 0.206, "d22": null, "d64": null, "eta": -123.872, "theta": 130.258, "eta_prime": -150.330, "theta_prime": 152.541, "eta_base": -163.632, "theta_base": 176.143, "v0": -2.504, "v1": -21.443, "v2": 35.636, "v3": -38.114, "v4": 25.595, "amplitude": 38.490, "phase_angle": 22.206, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23m", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.016, "frame": { "rmsd": 0.016, "origin": [ 5.769, -10.139, -19.386 ], "x_axis": [ 0.228, 0.930, 0.290 ], "y_axis": [ -0.973, 0.224, 0.045 ], "z_axis": [ -0.023, -0.292, 0.956 ], "quaternion": [ 0.776, 0.109, -0.101, 0.613 ] } }, { "index": 54, "index_chain": 18, "chain_name": "N", "nt_resnum": 25, "nt_name": "G", "nt_code": "G", "nt_id": "///N/25", "linked_nts": [ "///N/24", "///N/26" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -68.040, "beta": 165.396, "gamma": 68.299, "delta": 83.033, "epsilon": -143.661, "zeta": -51.107, "epsilon_zeta": -92.554, "bb_type": "BI", "chi": -168.180, "glyco_bond": "anti", "C5prime_xyz": [ -1.520, 8.833, 0.983 ], "P_xyz": [ 1.010, 9.283, 1.482 ], "form": ".", "ssZp": 4.025, "Dp": 4.283, "splay_angle": 21.347, "splay_distance": 3.811, "splay_ratio": 0.194, "d22": null, "d64": null, "eta": 176.229, "theta": -118.730, "eta_prime": -175.779, "theta_prime": -129.487, "eta_base": -154.860, "theta_base": -110.881, "v0": -4.722, "v1": -18.100, "v2": 32.747, "v3": -36.256, "v4": 25.890, "amplitude": 36.379, "phase_angle": 25.822, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.577, "filter_rmsd": 0.034, "frame": { "rmsd": 0.034, "origin": [ 7.332, -12.276, -16.648 ], "x_axis": [ -0.163, 0.985, 0.062 ], "y_axis": [ -0.983, -0.157, -0.090 ], "z_axis": [ -0.079, -0.076, 0.994 ], "quaternion": [ 0.647, -0.005, -0.054, 0.761 ] } }, { "index": 55, "index_chain": 19, "chain_name": "N", "nt_resnum": 26, "nt_name": "G", "nt_code": "G", "nt_id": "///N/26", "linked_nts": [ "///N/25", "///N/27" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -136.398, "beta": 157.001, "gamma": 123.602, "delta": 76.802, "epsilon": -132.012, "zeta": -72.674, "epsilon_zeta": -59.339, "bb_type": "BI", "chi": -179.180, "glyco_bond": "anti", "C5prime_xyz": [ -2.230, 8.762, 1.332 ], "P_xyz": [ -0.322, 10.381, 0.668 ], "form": ".", "ssZp": 4.130, "Dp": 4.316, "splay_angle": 24.359, "splay_distance": 4.226, "splay_ratio": 0.218, "d22": null, "d64": null, "eta": 155.217, "theta": -152.078, "eta_prime": 175.275, "theta_prime": -151.878, "eta_base": -146.621, "theta_base": -128.408, "v0": -11.467, "v1": -14.653, "v2": 33.685, "v3": -41.271, "v4": 33.269, "amplitude": 40.892, "phase_angle": 34.539, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.030, "frame": { "rmsd": 0.030, "origin": [ 8.690, -11.328, -13.216 ], "x_axis": [ -0.571, 0.785, -0.242 ], "y_axis": [ -0.789, -0.606, -0.103 ], "z_axis": [ -0.227, 0.132, 0.965 ], "quaternion": [ 0.444, -0.132, 0.008, 0.886 ] } }, { "index": 56, "index_chain": 20, "chain_name": "N", "nt_resnum": 27, "nt_name": "C", "nt_code": "C", "nt_id": "///N/27", "linked_nts": [ "///N/26", "///N/28" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -61.311, "beta": -179.732, "gamma": 38.199, "delta": 75.232, "epsilon": -145.698, "zeta": -76.836, "epsilon_zeta": -68.862, "bb_type": "BI", "chi": -145.870, "glyco_bond": "anti", "C5prime_xyz": [ -2.081, 8.870, -0.410 ], "P_xyz": [ 0.089, 10.231, -0.291 ], "form": "A", "ssZp": 3.845, "Dp": 4.559, "splay_angle": 22.073, "splay_distance": 3.743, "splay_ratio": 0.193, "d22": null, "d64": null, "eta": 157.288, "theta": -154.802, "eta_prime": 169.622, "theta_prime": -150.091, "eta_base": -155.962, "theta_base": -125.647, "v0": -8.792, "v1": -17.311, "v2": 35.197, "v3": -41.111, "v4": 31.705, "amplitude": 40.930, "phase_angle": 30.691, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.517, "filter_rmsd": 0.056, "frame": { "rmsd": 0.027, "origin": [ 8.996, -9.063, -9.662 ], "x_axis": [ -0.891, 0.353, -0.285 ], "y_axis": [ -0.396, -0.912, 0.109 ], "z_axis": [ -0.222, 0.210, 0.952 ], "quaternion": [ 0.193, -0.131, 0.082, 0.969 ] } }, { "index": 57, "index_chain": 21, "chain_name": "N", "nt_resnum": 28, "nt_name": "G", "nt_code": "G", "nt_id": "///N/28", "linked_nts": [ "///N/27", "///N/29" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,internal-loop", "alpha": -56.717, "beta": 163.460, "gamma": 51.125, "delta": 73.880, "epsilon": -139.728, "zeta": -57.852, "epsilon_zeta": -81.876, "bb_type": "BI", "chi": -143.784, "glyco_bond": "anti", "C5prime_xyz": [ -2.460, 8.763, -0.512 ], "P_xyz": [ -0.286, 9.845, -1.380 ], "form": ".", "ssZp": 3.649, "Dp": 4.677, "splay_angle": 28.148, "splay_distance": 4.734, "splay_ratio": 0.245, "d22": null, "d64": null, "eta": 166.354, "theta": -129.351, "eta_prime": 178.203, "theta_prime": -120.865, "eta_base": -150.499, "theta_base": -105.150, "v0": -4.835, "v1": -22.002, "v2": 38.996, "v3": -42.725, "v4": 30.086, "amplitude": 42.984, "phase_angle": 24.874, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.749, "filter_rmsd": 0.032, "frame": { "rmsd": 0.032, "origin": [ 7.206, -7.056, -7.058 ], "x_axis": [ -0.926, -0.054, -0.373 ], "y_axis": [ -0.098, -0.921, 0.377 ], "z_axis": [ -0.364, 0.385, 0.848 ], "quaternion": [ 0.011, -0.192, 0.198, 0.961 ] } }, { "index": 58, "index_chain": 22, "chain_name": "N", "nt_resnum": 29, "nt_name": "C", "nt_code": "C", "nt_id": "///N/29", "linked_nts": [ "///N/28", "///N/30" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C2'-endo,non-pair-contact,internal-loop", "alpha": -79.454, "beta": -152.863, "gamma": 55.795, "delta": 141.035, "epsilon": -138.851, "zeta": 110.794, "epsilon_zeta": 110.355, "bb_type": "--", "chi": -92.657, "glyco_bond": "anti", "C5prime_xyz": [ -3.130, 7.817, -2.314 ], "P_xyz": [ -1.198, 9.519, -2.665 ], "form": ".", "ssZp": 1.981, "Dp": 1.937, "splay_angle": 83.363, "splay_distance": 14.349, "splay_ratio": 0.667, "d22": 11.712, "d64": 14.522, "eta": 175.915, "theta": 117.641, "eta_prime": -156.900, "theta_prime": 87.923, "eta_base": -136.731, "theta_base": 93.698, "v0": -29.169, "v1": 39.911, "v2": -34.539, "v3": 18.731, "v4": 6.288, "amplitude": 39.135, "phase_angle": 151.951, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1[", "suiteness": 0.577, "filter_rmsd": 0.062, "frame": { "rmsd": 0.013, "origin": [ 2.647, -6.465, -5.928 ], "x_axis": [ -0.249, -0.623, -0.742 ], "y_axis": [ 0.152, -0.782, 0.605 ], "z_axis": [ -0.957, 0.038, 0.289 ], "quaternion": [ -0.254, -0.558, 0.211, 0.761 ] } }, { "index": 59, "index_chain": 23, "chain_name": "N", "nt_resnum": 30, "nt_name": "C", "nt_code": "C", "nt_id": "///N/30", "linked_nts": [ "///N/29", "///N/31" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,non-stack,canonical,non-pair-contact,helix-end,stem-end,internal-loop,phosphate", "alpha": 49.712, "beta": -116.854, "gamma": -85.508, "delta": 78.855, "epsilon": -172.128, "zeta": -85.501, "epsilon_zeta": -86.627, "bb_type": "BI", "chi": -152.381, "glyco_bond": "anti", "C5prime_xyz": [ -1.945, 8.946, -0.041 ], "P_xyz": [ -3.204, 11.071, -0.802 ], "form": ".", "ssZp": 4.013, "Dp": 4.186, "splay_angle": 21.884, "splay_distance": 3.936, "splay_ratio": 0.200, "d22": 4.766, "d64": 5.050, "eta": -117.673, "theta": 151.007, "eta_prime": -143.625, "theta_prime": 161.235, "eta_base": -154.502, "theta_base": 173.598, "v0": -10.820, "v1": -13.314, "v2": 30.950, "v3": -38.000, "v4": 30.941, "amplitude": 37.737, "phase_angle": 34.898, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23m", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.055, "frame": { "rmsd": 0.026, "origin": [ 11.674, -1.515, 4.068 ], "x_axis": [ -0.415, 0.811, 0.414 ], "y_axis": [ -0.852, -0.506, 0.137 ], "z_axis": [ 0.320, -0.296, 0.900 ], "quaternion": [ 0.495, 0.218, -0.047, 0.840 ] } }, { "index": 60, "index_chain": 24, "chain_name": "N", "nt_resnum": 31, "nt_name": "U", "nt_code": "U", "nt_id": "///N/31", "linked_nts": [ "///N/30", "///N/32" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem", "alpha": 132.540, "beta": -172.028, "gamma": -160.295, "delta": 86.953, "epsilon": -117.892, "zeta": -39.872, "epsilon_zeta": -78.020, "bb_type": "--", "chi": -159.249, "glyco_bond": "anti", "C5prime_xyz": [ -1.123, 8.560, 0.599 ], "P_xyz": [ 0.205, 10.466, -0.423 ], "form": ".", "ssZp": 3.982, "Dp": 4.548, "splay_angle": 27.511, "splay_distance": 4.860, "splay_ratio": 0.243, "d22": 4.504, "d64": 5.361, "eta": 166.131, "theta": -139.035, "eta_prime": 168.845, "theta_prime": -138.916, "eta_base": -177.944, "theta_base": -114.046, "v0": 1.456, "v1": -21.400, "v2": 32.233, "v3": -32.249, "v4": 19.446, "amplitude": 33.567, "phase_angle": 16.210, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.238, "filter_rmsd": 0.105, "frame": { "rmsd": 0.026, "origin": [ 14.973, -1.612, 6.213 ], "x_axis": [ -0.717, 0.656, 0.233 ], "y_axis": [ -0.644, -0.752, 0.136 ], "z_axis": [ 0.264, -0.053, 0.963 ], "quaternion": [ 0.351, 0.134, 0.022, 0.926 ] } }, { "index": 61, "index_chain": 25, "chain_name": "N", "nt_resnum": 32, "nt_name": "U", "nt_code": "U", "nt_id": "///N/32", "linked_nts": [ "///N/31", "///N/33" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem", "alpha": -118.056, "beta": 118.865, "gamma": 147.271, "delta": 79.371, "epsilon": -118.071, "zeta": -89.700, "epsilon_zeta": -28.371, "bb_type": "--", "chi": -167.974, "glyco_bond": "anti", "C5prime_xyz": [ -1.477, 8.630, 1.000 ], "P_xyz": [ -0.940, 10.452, -0.718 ], "form": ".", "ssZp": 4.392, "Dp": 4.639, "splay_angle": 20.161, "splay_distance": 3.580, "splay_ratio": 0.184, "d22": null, "d64": null, "eta": 173.519, "theta": -149.737, "eta_prime": -168.964, "theta_prime": -154.619, "eta_base": -131.921, "theta_base": -118.669, "v0": -2.489, "v1": -20.268, "v2": 34.251, "v3": -36.620, "v4": 24.642, "amplitude": 37.050, "phase_angle": 22.416, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.020, "origin": [ 14.742, 0.551, 10.559 ], "x_axis": [ -0.928, 0.252, 0.276 ], "y_axis": [ -0.238, -0.968, 0.082 ], "z_axis": [ 0.288, 0.010, 0.958 ], "quaternion": [ 0.125, 0.144, 0.023, 0.981 ] } }, { "index": 62, "index_chain": 26, "chain_name": "N", "nt_resnum": 33, "nt_name": "A", "nt_code": "A", "nt_id": "///N/33", "linked_nts": [ "///N/32", "///N/34" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem", "alpha": 102.124, "beta": -158.384, "gamma": -141.813, "delta": 88.352, "epsilon": -88.210, "zeta": -119.933, "epsilon_zeta": 31.723, "bb_type": "--", "chi": -149.291, "glyco_bond": "anti", "C5prime_xyz": [ -0.850, 8.287, -0.012 ], "P_xyz": [ -0.053, 10.159, -1.554 ], "form": "A", "ssZp": 3.445, "Dp": 4.805, "splay_angle": 19.214, "splay_distance": 3.246, "splay_ratio": 0.168, "d22": null, "d64": null, "eta": 157.687, "theta": -145.771, "eta_prime": 170.394, "theta_prime": -150.120, "eta_base": -141.877, "theta_base": -143.681, "v0": 14.925, "v1": -34.594, "v2": 39.901, "v3": -32.349, "v4": 11.138, "amplitude": 39.949, "phase_angle": 357.188, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.051, "frame": { "rmsd": 0.038, "origin": [ 13.324, 2.215, 13.395 ], "x_axis": [ -0.940, -0.330, 0.088 ], "y_axis": [ 0.342, -0.902, 0.265 ], "z_axis": [ -0.008, 0.279, 0.960 ], "quaternion": [ -0.172, 0.020, 0.140, 0.975 ] } }, { "index": 63, "index_chain": 27, "chain_name": "N", "nt_resnum": 34, "nt_name": "U", "nt_code": "U", "nt_id": "///N/34", "linked_nts": [ "///N/33", "///N/35" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix-end,stem-end", "alpha": 100.418, "beta": -125.311, "gamma": -165.051, "delta": 82.847, "epsilon": -113.576, "zeta": -54.332, "epsilon_zeta": -59.244, "bb_type": "--", "chi": -152.629, "glyco_bond": "anti", "C5prime_xyz": [ -1.410, 8.616, 0.137 ], "P_xyz": [ -0.664, 9.596, -2.117 ], "form": ".", "ssZp": 3.898, "Dp": 4.743, "splay_angle": 39.019, "splay_distance": 6.323, "splay_ratio": 0.334, "d22": 3.653, "d64": 3.596, "eta": 143.416, "theta": -122.153, "eta_prime": 163.421, "theta_prime": -119.306, "eta_base": 178.476, "theta_base": -81.949, "v0": 5.213, "v1": -26.619, "v2": 36.639, "v3": -34.651, "v4": 18.587, "amplitude": 37.293, "phase_angle": 10.748, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.104, "frame": { "rmsd": 0.026, "origin": [ 12.036, 3.394, 16.132 ], "x_axis": [ -0.692, -0.596, -0.409 ], "y_axis": [ 0.428, -0.794, 0.433 ], "z_axis": [ -0.582, 0.124, 0.804 ], "quaternion": [ -0.282, -0.273, 0.154, 0.907 ] } }, { "index": 64, "index_chain": 28, "chain_name": "N", "nt_resnum": 35, "nt_name": "C", "nt_code": "C", "nt_id": "///N/35", "linked_nts": [ "///N/34", "///N/36" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,anti,~C3'-endo,non-pair-contact,ss-non-loop,splayed-apart", "alpha": -87.818, "beta": -161.667, "gamma": 55.536, "delta": 77.637, "epsilon": 65.108, "zeta": -67.688, "epsilon_zeta": -227.204, "bb_type": "--", "chi": -129.887, "glyco_bond": "anti", "C5prime_xyz": [ -2.062, 8.615, -1.210 ], "P_xyz": [ 0.395, 9.462, -1.393 ], "form": ".", "ssZp": 2.239, "Dp": 2.848, "splay_angle": 86.747, "splay_distance": 14.144, "splay_ratio": 0.687, "d22": 8.322, "d64": 9.753, "eta": 173.249, "theta": 113.632, "eta_prime": -153.788, "theta_prime": 76.968, "eta_base": -106.277, "theta_base": 50.913, "v0": -4.590, "v1": -16.281, "v2": 29.838, "v3": -33.285, "v4": 23.882, "amplitude": 33.296, "phase_angle": 26.345, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.198, "filter_rmsd": 0.067, "frame": { "rmsd": 0.014, "origin": [ 8.526, -1.853, 16.504 ], "x_axis": [ 0.551, -0.748, -0.370 ], "y_axis": [ 0.547, -0.011, 0.837 ], "z_axis": [ -0.630, -0.663, 0.403 ], "quaternion": [ 0.697, 0.538, -0.093, -0.465 ] } }, { "index": 65, "index_chain": 29, "chain_name": "N", "nt_resnum": 36, "nt_name": "U", "nt_code": "U", "nt_id": "///N/36", "linked_nts": [ "///N/35", "///N/37" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C2'-endo,non-pair-contact,ss-non-loop,phosphate,splayed-apart", "alpha": 128.681, "beta": 150.799, "gamma": 162.113, "delta": 147.741, "epsilon": -152.586, "zeta": 178.426, "epsilon_zeta": 28.989, "bb_type": "--", "chi": -175.538, "glyco_bond": "anti", "C5prime_xyz": [ -2.267, 8.438, 1.556 ], "P_xyz": [ -0.437, 10.263, 1.827 ], "form": ".", "ssZp": 0.217, "Dp": 1.968, "splay_angle": 28.881, "splay_distance": 4.560, "splay_ratio": 0.249, "d22": null, "d64": null, "eta": 119.355, "theta": 146.426, "eta_prime": 109.804, "theta_prime": 140.131, "eta_base": 114.147, "theta_base": 82.320, "v0": -25.456, "v1": 39.400, "v2": -37.346, "v3": 23.732, "v4": 0.802, "amplitude": 39.753, "phase_angle": 159.959, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.110, "frame": { "rmsd": 0.012, "origin": [ 16.969, 6.725, 23.933 ], "x_axis": [ 0.647, -0.733, -0.208 ], "y_axis": [ -0.630, -0.668, 0.396 ], "z_axis": [ -0.430, -0.126, -0.894 ], "quaternion": [ 0.146, 0.896, -0.380, -0.178 ] } }, { "index": 66, "index_chain": 30, "chain_name": "N", "nt_resnum": 37, "nt_name": "A", "nt_code": "A", "nt_id": "///N/37", "linked_nts": [ "///N/36", null ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-pair-contact,ss-non-loop,phosphate", "alpha": 16.577, "beta": 111.982, "gamma": -59.833, "delta": 92.921, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": -177.833, "glyco_bond": "anti", "C5prime_xyz": [ -0.984, 7.931, 1.782 ], "P_xyz": [ -0.670, 7.979, 4.398 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": 12.728, "v1": -26.817, "v2": 30.183, "v3": -23.909, "v4": 7.137, "amplitude": 30.309, "phase_angle": 354.773, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.055, "frame": { "rmsd": 0.042, "origin": [ 17.604, 5.757, 28.343 ], "x_axis": [ -0.097, -0.989, 0.108 ], "y_axis": [ -0.899, 0.134, 0.417 ], "z_axis": [ -0.427, -0.057, -0.902 ], "quaternion": [ -0.183, -0.646, 0.730, 0.123 ] } } ], "num_hbonds": 1499, "hbonds": [ { "index": 1, "atom1_serNum": 4, "atom2_serNum": 11, "donAcc_type": "standard", "distance": 2.856, "atom1_id": "///A/7/O", "atom2_id": "///A/9/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2, "atom1_serNum": 19, "atom2_serNum": 31, "donAcc_type": "standard", "distance": 2.975, "atom1_id": "///A/10/O", "atom2_id": "///A/13/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 3, "atom1_serNum": 29, "atom2_serNum": 36, "donAcc_type": "standard", "distance": 2.708, "atom1_id": "///A/12/O", "atom2_id": "///A/14/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 4, "atom1_serNum": 64, "atom2_serNum": 71, "donAcc_type": "standard", "distance": 2.875, "atom1_id": "///A/19/O", "atom2_id": "///A/21/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 5, "atom1_serNum": 64, "atom2_serNum": 76, "donAcc_type": "standard", "distance": 3.011, "atom1_id": "///A/19/O", "atom2_id": "///A/22/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 6, "atom1_serNum": 74, "atom2_serNum": 86, "donAcc_type": "standard", "distance": 2.955, "atom1_id": "///A/21/O", "atom2_id": "///A/24/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 7, "atom1_serNum": 79, "atom2_serNum": 91, "donAcc_type": "standard", "distance": 2.896, "atom1_id": "///A/22/O", "atom2_id": "///A/25/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 8, "atom1_serNum": 79, "atom2_serNum": 96, "donAcc_type": "standard", "distance": 2.743, "atom1_id": "///A/22/O", "atom2_id": "///A/26/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 9, "atom1_serNum": 84, "atom2_serNum": 96, "donAcc_type": "standard", "distance": 2.831, "atom1_id": "///A/23/O", "atom2_id": "///A/26/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 10, "atom1_serNum": 109, "atom2_serNum": 451, "donAcc_type": "standard", "distance": 3.520, "atom1_id": "///A/28/O", "atom2_id": "///A/115/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 11, "atom1_serNum": 139, "atom2_serNum": 156, "donAcc_type": "standard", "distance": 2.928, "atom1_id": "///A/34/O", "atom2_id": "///A/38/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 12, "atom1_serNum": 169, "atom2_serNum": 186, "donAcc_type": "standard", "distance": 2.449, "atom1_id": "///A/40/O", "atom2_id": "///A/44/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 13, "atom1_serNum": 174, "atom2_serNum": 191, "donAcc_type": "standard", "distance": 2.783, "atom1_id": "///A/41/O", "atom2_id": "///A/45/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 14, "atom1_serNum": 179, "atom2_serNum": 196, "donAcc_type": "standard", "distance": 2.767, "atom1_id": "///A/42/O", "atom2_id": "///A/46/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 15, "atom1_serNum": 184, "atom2_serNum": 201, "donAcc_type": "standard", "distance": 3.249, "atom1_id": "///A/43/O", "atom2_id": "///A/47/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 16, "atom1_serNum": 194, "atom2_serNum": 211, "donAcc_type": "standard", "distance": 2.806, "atom1_id": "///A/45/O", "atom2_id": "///A/49/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 17, "atom1_serNum": 199, "atom2_serNum": 216, "donAcc_type": "standard", "distance": 2.811, "atom1_id": "///A/46/O", "atom2_id": "///A/50/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 18, "atom1_serNum": 204, "atom2_serNum": 221, "donAcc_type": "standard", "distance": 2.834, "atom1_id": "///A/47/O", "atom2_id": "///A/51/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 19, "atom1_serNum": 209, "atom2_serNum": 226, "donAcc_type": "standard", "distance": 2.790, "atom1_id": "///A/48/O", "atom2_id": "///A/52/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 20, "atom1_serNum": 214, "atom2_serNum": 231, "donAcc_type": "standard", "distance": 2.784, "atom1_id": "///A/49/O", "atom2_id": "///A/53/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 21, "atom1_serNum": 219, "atom2_serNum": 236, "donAcc_type": "standard", "distance": 2.821, "atom1_id": "///A/50/O", "atom2_id": "///A/54/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 22, "atom1_serNum": 224, "atom2_serNum": 241, "donAcc_type": "standard", "distance": 2.814, "atom1_id": "///A/51/O", "atom2_id": "///A/55/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 23, "atom1_serNum": 229, "atom2_serNum": 246, "donAcc_type": "standard", "distance": 2.922, "atom1_id": "///A/52/O", "atom2_id": "///A/56/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 24, "atom1_serNum": 249, "atom2_serNum": 271, "donAcc_type": "standard", "distance": 3.892, "atom1_id": "///A/56/O", "atom2_id": "///A/61/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 25, "atom1_serNum": 254, "atom2_serNum": 271, "donAcc_type": "standard", "distance": 2.779, "atom1_id": "///A/57/O", "atom2_id": "///A/61/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 26, "atom1_serNum": 254, "atom2_serNum": 276, "donAcc_type": "standard", "distance": 2.539, "atom1_id": "///A/57/O", "atom2_id": "///A/62/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 27, "atom1_serNum": 259, "atom2_serNum": 266, "donAcc_type": "standard", "distance": 2.878, "atom1_id": "///A/58/O", "atom2_id": "///A/60/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 28, "atom1_serNum": 279, "atom2_serNum": 291, "donAcc_type": "standard", "distance": 3.294, "atom1_id": "///A/62/O", "atom2_id": "///A/65/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 29, "atom1_serNum": 289, "atom2_serNum": 306, "donAcc_type": "standard", "distance": 2.410, "atom1_id": "///A/64/O", "atom2_id": "///A/68/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 30, "atom1_serNum": 304, "atom2_serNum": 316, "donAcc_type": "standard", "distance": 3.237, "atom1_id": "///A/67/O", "atom2_id": "///A/70/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 31, "atom1_serNum": 314, "atom2_serNum": 326, "donAcc_type": "standard", "distance": 3.770, "atom1_id": "///A/69/O", "atom2_id": "///A/72/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 32, "atom1_serNum": 319, "atom2_serNum": 331, "donAcc_type": "standard", "distance": 3.363, "atom1_id": "///A/70/O", "atom2_id": "///A/73/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 33, "atom1_serNum": 349, "atom2_serNum": 356, "donAcc_type": "standard", "distance": 2.932, "atom1_id": "///A/86/O", "atom2_id": "///A/88/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 34, "atom1_serNum": 369, "atom2_serNum": 386, "donAcc_type": "standard", "distance": 2.910, "atom1_id": "///A/90/O", "atom2_id": "///A/94/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 35, "atom1_serNum": 384, "atom2_serNum": 396, "donAcc_type": "standard", "distance": 3.009, "atom1_id": "///A/93/O", "atom2_id": "///A/96/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 36, "atom1_serNum": 389, "atom2_serNum": 406, "donAcc_type": "standard", "distance": 3.176, "atom1_id": "///A/94/O", "atom2_id": "///A/98/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 37, "atom1_serNum": 394, "atom2_serNum": 411, "donAcc_type": "standard", "distance": 2.949, "atom1_id": "///A/95/O", "atom2_id": "///A/99/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 38, "atom1_serNum": 399, "atom2_serNum": 416, "donAcc_type": "standard", "distance": 2.945, "atom1_id": "///A/96/O", "atom2_id": "///A/100/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 39, "atom1_serNum": 409, "atom2_serNum": 426, "donAcc_type": "standard", "distance": 2.911, "atom1_id": "///A/98/O", "atom2_id": "///A/102/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 40, "atom1_serNum": 414, "atom2_serNum": 431, "donAcc_type": "standard", "distance": 2.945, "atom1_id": "///A/99/O", "atom2_id": "///A/103/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 41, "atom1_serNum": 419, "atom2_serNum": 436, "donAcc_type": "standard", "distance": 3.088, "atom1_id": "///A/100/O", "atom2_id": "///A/104/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 42, "atom1_serNum": 424, "atom2_serNum": 439, "donAcc_type": "questionable", "distance": 3.041, "atom1_id": "///A/101/O", "atom2_id": "///A/104/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 43, "atom1_serNum": 454, "atom2_serNum": 461, "donAcc_type": "standard", "distance": 2.628, "atom1_id": "///A/115/O", "atom2_id": "///A/117/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 44, "atom1_serNum": 469, "atom2_serNum": 699, "donAcc_type": "questionable", "distance": 3.182, "atom1_id": "///A/118/O", "atom2_id": "///A/164/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 45, "atom1_serNum": 479, "atom2_serNum": 486, "donAcc_type": "standard", "distance": 3.139, "atom1_id": "///A/120/O", "atom2_id": "///A/122/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 46, "atom1_serNum": 484, "atom2_serNum": 584, "donAcc_type": "questionable", "distance": 3.132, "atom1_id": "///A/121/O", "atom2_id": "///A/141/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 47, "atom1_serNum": 486, "atom2_serNum": 959, "donAcc_type": "standard", "distance": 2.483, "atom1_id": "///A/122/N", "atom2_id": "///A/216/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 48, "atom1_serNum": 499, "atom2_serNum": 506, "donAcc_type": "standard", "distance": 2.617, "atom1_id": "///A/124/O", "atom2_id": "///A/126/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 49, "atom1_serNum": 504, "atom2_serNum": 2871, "donAcc_type": "standard", "distance": 3.976, "atom1_id": "///A/125/O", "atom2_id": "///A/659/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 50, "atom1_serNum": 511, "atom2_serNum": 554, "donAcc_type": "standard", "distance": 2.315, "atom1_id": "///A/127/N", "atom2_id": "///A/135/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 51, "atom1_serNum": 516, "atom2_serNum": 554, "donAcc_type": "standard", "distance": 3.412, "atom1_id": "///A/128/N", "atom2_id": "///A/135/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 52, "atom1_serNum": 526, "atom2_serNum": 2884, "donAcc_type": "standard", "distance": 2.439, "atom1_id": "///A/130/N", "atom2_id": "///A/661/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 53, "atom1_serNum": 554, "atom2_serNum": 561, "donAcc_type": "standard", "distance": 3.027, "atom1_id": "///A/135/O", "atom2_id": "///A/137/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 54, "atom1_serNum": 579, "atom2_serNum": 681, "donAcc_type": "standard", "distance": 3.724, "atom1_id": "///A/140/O", "atom2_id": "///A/161/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 55, "atom1_serNum": 589, "atom2_serNum": 689, "donAcc_type": "questionable", "distance": 3.202, "atom1_id": "///A/142/O", "atom2_id": "///A/162/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 56, "atom1_serNum": 604, "atom2_serNum": 616, "donAcc_type": "standard", "distance": 2.702, "atom1_id": "///A/145/O", "atom2_id": "///A/148/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 57, "atom1_serNum": 604, "atom2_serNum": 621, "donAcc_type": "standard", "distance": 2.336, "atom1_id": "///A/145/O", "atom2_id": "///A/149/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 58, "atom1_serNum": 654, "atom2_serNum": 661, "donAcc_type": "standard", "distance": 2.560, "atom1_id": "///A/155/O", "atom2_id": "///A/157/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 59, "atom1_serNum": 684, "atom2_serNum": 691, "donAcc_type": "standard", "distance": 2.706, "atom1_id": "///A/161/O", "atom2_id": "///A/163/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 60, "atom1_serNum": 694, "atom2_serNum": 701, "donAcc_type": "standard", "distance": 2.756, "atom1_id": "///A/163/O", "atom2_id": "///A/165/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 61, "atom1_serNum": 704, "atom2_serNum": 721, "donAcc_type": "standard", "distance": 2.692, "atom1_id": "///A/165/O", "atom2_id": "///A/169/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 62, "atom1_serNum": 709, "atom2_serNum": 726, "donAcc_type": "standard", "distance": 2.824, "atom1_id": "///A/166/O", "atom2_id": "///A/170/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 63, "atom1_serNum": 714, "atom2_serNum": 731, "donAcc_type": "standard", "distance": 2.902, "atom1_id": "///A/167/O", "atom2_id": "///A/171/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 64, "atom1_serNum": 719, "atom2_serNum": 736, "donAcc_type": "standard", "distance": 2.846, "atom1_id": "///A/168/O", "atom2_id": "///A/172/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 65, "atom1_serNum": 724, "atom2_serNum": 741, "donAcc_type": "standard", "distance": 2.895, "atom1_id": "///A/169/O", "atom2_id": "///A/173/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 66, "atom1_serNum": 729, "atom2_serNum": 746, "donAcc_type": "standard", "distance": 2.887, "atom1_id": "///A/170/O", "atom2_id": "///A/174/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 67, "atom1_serNum": 734, "atom2_serNum": 751, "donAcc_type": "standard", "distance": 2.933, "atom1_id": "///A/171/O", "atom2_id": "///A/175/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 68, "atom1_serNum": 739, "atom2_serNum": 756, "donAcc_type": "standard", "distance": 2.787, "atom1_id": "///A/172/O", "atom2_id": "///A/176/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 69, "atom1_serNum": 744, "atom2_serNum": 761, "donAcc_type": "standard", "distance": 2.902, "atom1_id": "///A/173/O", "atom2_id": "///A/177/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 70, "atom1_serNum": 749, "atom2_serNum": 766, "donAcc_type": "standard", "distance": 2.896, "atom1_id": "///A/174/O", "atom2_id": "///A/178/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 71, "atom1_serNum": 754, "atom2_serNum": 771, "donAcc_type": "standard", "distance": 3.733, "atom1_id": "///A/175/O", "atom2_id": "///A/179/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 72, "atom1_serNum": 759, "atom2_serNum": 776, "donAcc_type": "standard", "distance": 2.864, "atom1_id": "///A/176/O", "atom2_id": "///A/180/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 73, "atom1_serNum": 764, "atom2_serNum": 781, "donAcc_type": "standard", "distance": 2.765, "atom1_id": "///A/177/O", "atom2_id": "///A/181/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 74, "atom1_serNum": 764, "atom2_serNum": 786, "donAcc_type": "standard", "distance": 2.827, "atom1_id": "///A/177/O", "atom2_id": "///A/182/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 75, "atom1_serNum": 769, "atom2_serNum": 789, "donAcc_type": "questionable", "distance": 2.803, "atom1_id": "///A/178/O", "atom2_id": "///A/182/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 76, "atom1_serNum": 794, "atom2_serNum": 811, "donAcc_type": "standard", "distance": 2.371, "atom1_id": "///A/183/O", "atom2_id": "///A/187/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 77, "atom1_serNum": 799, "atom2_serNum": 816, "donAcc_type": "standard", "distance": 2.516, "atom1_id": "///A/184/O", "atom2_id": "///A/188/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 78, "atom1_serNum": 799, "atom2_serNum": 821, "donAcc_type": "standard", "distance": 3.605, "atom1_id": "///A/184/O", "atom2_id": "///A/189/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 79, "atom1_serNum": 804, "atom2_serNum": 821, "donAcc_type": "standard", "distance": 2.563, "atom1_id": "///A/185/O", "atom2_id": "///A/189/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 80, "atom1_serNum": 819, "atom2_serNum": 826, "donAcc_type": "standard", "distance": 3.162, "atom1_id": "///A/188/O", "atom2_id": "///A/190/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 81, "atom1_serNum": 839, "atom2_serNum": 846, "donAcc_type": "standard", "distance": 2.952, "atom1_id": "///A/192/O", "atom2_id": "///A/194/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 82, "atom1_serNum": 839, "atom2_serNum": 2154, "donAcc_type": "questionable", "distance": 2.938, "atom1_id": "///A/192/O", "atom2_id": "///A/500/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 83, "atom1_serNum": 844, "atom2_serNum": 861, "donAcc_type": "standard", "distance": 3.161, "atom1_id": "///A/193/O", "atom2_id": "///A/197/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 84, "atom1_serNum": 849, "atom2_serNum": 866, "donAcc_type": "standard", "distance": 2.893, "atom1_id": "///A/194/O", "atom2_id": "///A/198/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 85, "atom1_serNum": 854, "atom2_serNum": 871, "donAcc_type": "standard", "distance": 2.870, "atom1_id": "///A/195/O", "atom2_id": "///A/199/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 86, "atom1_serNum": 864, "atom2_serNum": 881, "donAcc_type": "standard", "distance": 2.939, "atom1_id": "///A/197/O", "atom2_id": "///A/201/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 87, "atom1_serNum": 869, "atom2_serNum": 886, "donAcc_type": "standard", "distance": 2.912, "atom1_id": "///A/198/O", "atom2_id": "///A/202/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 88, "atom1_serNum": 879, "atom2_serNum": 896, "donAcc_type": "standard", "distance": 2.937, "atom1_id": "///A/200/O", "atom2_id": "///A/204/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 89, "atom1_serNum": 884, "atom2_serNum": 901, "donAcc_type": "standard", "distance": 2.895, "atom1_id": "///A/201/O", "atom2_id": "///A/205/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 90, "atom1_serNum": 889, "atom2_serNum": 906, "donAcc_type": "standard", "distance": 2.711, "atom1_id": "///A/202/O", "atom2_id": "///A/206/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 91, "atom1_serNum": 904, "atom2_serNum": 916, "donAcc_type": "standard", "distance": 3.758, "atom1_id": "///A/205/O", "atom2_id": "///A/208/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 92, "atom1_serNum": 909, "atom2_serNum": 916, "donAcc_type": "standard", "distance": 2.906, "atom1_id": "///A/206/O", "atom2_id": "///A/208/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 93, "atom1_serNum": 926, "atom2_serNum": 969, "donAcc_type": "standard", "distance": 3.322, "atom1_id": "///A/210/N", "atom2_id": "///A/218/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 94, "atom1_serNum": 954, "atom2_serNum": 961, "donAcc_type": "standard", "distance": 3.096, "atom1_id": "///A/215/O", "atom2_id": "///A/217/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 95, "atom1_serNum": 974, "atom2_serNum": 986, "donAcc_type": "standard", "distance": 2.916, "atom1_id": "///A/219/O", "atom2_id": "///A/222/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 96, "atom1_serNum": 974, "atom2_serNum": 991, "donAcc_type": "standard", "distance": 3.609, "atom1_id": "///A/219/O", "atom2_id": "///A/223/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 97, "atom1_serNum": 984, "atom2_serNum": 996, "donAcc_type": "standard", "distance": 3.424, "atom1_id": "///A/221/O", "atom2_id": "///A/224/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 98, "atom1_serNum": 984, "atom2_serNum": 1001, "donAcc_type": "standard", "distance": 2.873, "atom1_id": "///A/221/O", "atom2_id": "///A/225/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 99, "atom1_serNum": 989, "atom2_serNum": 1001, "donAcc_type": "standard", "distance": 2.655, "atom1_id": "///A/222/O", "atom2_id": "///A/225/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 100, "atom1_serNum": 989, "atom2_serNum": 1006, "donAcc_type": "standard", "distance": 2.779, "atom1_id": "///A/222/O", "atom2_id": "///A/226/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 101, "atom1_serNum": 999, "atom2_serNum": 1016, "donAcc_type": "standard", "distance": 2.819, "atom1_id": "///A/224/O", "atom2_id": "///A/228/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 102, "atom1_serNum": 1004, "atom2_serNum": 1021, "donAcc_type": "standard", "distance": 3.517, "atom1_id": "///A/225/O", "atom2_id": "///A/229/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 103, "atom1_serNum": 1009, "atom2_serNum": 1026, "donAcc_type": "standard", "distance": 2.927, "atom1_id": "///A/226/O", "atom2_id": "///A/230/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 104, "atom1_serNum": 1019, "atom2_serNum": 1031, "donAcc_type": "standard", "distance": 2.903, "atom1_id": "///A/228/O", "atom2_id": "///A/231/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 105, "atom1_serNum": 1019, "atom2_serNum": 1036, "donAcc_type": "standard", "distance": 2.912, "atom1_id": "///A/228/O", "atom2_id": "///A/232/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 106, "atom1_serNum": 1024, "atom2_serNum": 1041, "donAcc_type": "standard", "distance": 2.973, "atom1_id": "///A/229/O", "atom2_id": "///A/233/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 107, "atom1_serNum": 1034, "atom2_serNum": 1051, "donAcc_type": "standard", "distance": 2.941, "atom1_id": "///A/231/O", "atom2_id": "///A/235/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 108, "atom1_serNum": 1039, "atom2_serNum": 1056, "donAcc_type": "standard", "distance": 2.919, "atom1_id": "///A/232/O", "atom2_id": "///A/236/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 109, "atom1_serNum": 1044, "atom2_serNum": 1061, "donAcc_type": "standard", "distance": 2.942, "atom1_id": "///A/233/O", "atom2_id": "///A/237/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 110, "atom1_serNum": 1054, "atom2_serNum": 1066, "donAcc_type": "standard", "distance": 2.925, "atom1_id": "///A/235/O", "atom2_id": "///A/238/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 111, "atom1_serNum": 1064, "atom2_serNum": 1071, "donAcc_type": "standard", "distance": 2.774, "atom1_id": "///A/237/O", "atom2_id": "///A/239/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 112, "atom1_serNum": 1069, "atom2_serNum": 1076, "donAcc_type": "standard", "distance": 2.687, "atom1_id": "///A/238/O", "atom2_id": "///A/240/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 113, "atom1_serNum": 1084, "atom2_serNum": 1096, "donAcc_type": "standard", "distance": 3.009, "atom1_id": "///A/241/O", "atom2_id": "///A/244/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 114, "atom1_serNum": 1084, "atom2_serNum": 1101, "donAcc_type": "standard", "distance": 2.396, "atom1_id": "///A/241/O", "atom2_id": "///A/245/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 115, "atom1_serNum": 1089, "atom2_serNum": 1109, "donAcc_type": "questionable", "distance": 2.825, "atom1_id": "///A/242/O", "atom2_id": "///A/246/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 116, "atom1_serNum": 1109, "atom2_serNum": 1121, "donAcc_type": "standard", "distance": 3.222, "atom1_id": "///A/246/O", "atom2_id": "///A/249/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 117, "atom1_serNum": 1124, "atom2_serNum": 1131, "donAcc_type": "standard", "distance": 2.575, "atom1_id": "///A/249/O", "atom2_id": "///A/251/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 118, "atom1_serNum": 1144, "atom2_serNum": 1516, "donAcc_type": "standard", "distance": 2.619, "atom1_id": "///A/253/O", "atom2_id": "///A/328/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 119, "atom1_serNum": 1149, "atom2_serNum": 1691, "donAcc_type": "standard", "distance": 2.853, "atom1_id": "///A/254/O", "atom2_id": "///A/363/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 120, "atom1_serNum": 1151, "atom2_serNum": 1509, "donAcc_type": "standard", "distance": 2.890, "atom1_id": "///A/255/N", "atom2_id": "///A/326/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 121, "atom1_serNum": 1159, "atom2_serNum": 1674, "donAcc_type": "questionable", "distance": 3.320, "atom1_id": "///A/256/O", "atom2_id": "///A/359/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 122, "atom1_serNum": 1159, "atom2_serNum": 1681, "donAcc_type": "standard", "distance": 3.015, "atom1_id": "///A/256/O", "atom2_id": "///A/361/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 123, "atom1_serNum": 1161, "atom2_serNum": 1499, "donAcc_type": "standard", "distance": 2.930, "atom1_id": "///A/257/N", "atom2_id": "///A/324/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 124, "atom1_serNum": 1164, "atom2_serNum": 1489, "donAcc_type": "questionable", "distance": 3.138, "atom1_id": "///A/257/O", "atom2_id": "///A/322/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 125, "atom1_serNum": 1166, "atom2_serNum": 1674, "donAcc_type": "standard", "distance": 3.682, "atom1_id": "///A/258/N", "atom2_id": "///A/359/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 126, "atom1_serNum": 1169, "atom2_serNum": 1671, "donAcc_type": "standard", "distance": 2.932, "atom1_id": "///A/258/O", "atom2_id": "///A/359/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 127, "atom1_serNum": 1174, "atom2_serNum": 1486, "donAcc_type": "standard", "distance": 3.162, "atom1_id": "///A/259/O", "atom2_id": "///A/322/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 128, "atom1_serNum": 1179, "atom2_serNum": 1661, "donAcc_type": "standard", "distance": 2.951, "atom1_id": "///A/260/O", "atom2_id": "///A/357/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 129, "atom1_serNum": 1184, "atom2_serNum": 1196, "donAcc_type": "standard", "distance": 3.522, "atom1_id": "///A/261/O", "atom2_id": "///A/264/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 130, "atom1_serNum": 1189, "atom2_serNum": 1651, "donAcc_type": "standard", "distance": 2.822, "atom1_id": "///A/262/O", "atom2_id": "///A/355/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 131, "atom1_serNum": 1194, "atom2_serNum": 1211, "donAcc_type": "standard", "distance": 2.862, "atom1_id": "///A/263/O", "atom2_id": "///A/267/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 132, "atom1_serNum": 1199, "atom2_serNum": 1216, "donAcc_type": "standard", "distance": 2.951, "atom1_id": "///A/264/O", "atom2_id": "///A/268/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 133, "atom1_serNum": 1204, "atom2_serNum": 1221, "donAcc_type": "standard", "distance": 2.902, "atom1_id": "///A/265/O", "atom2_id": "///A/269/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 134, "atom1_serNum": 1209, "atom2_serNum": 1226, "donAcc_type": "standard", "distance": 2.858, "atom1_id": "///A/266/O", "atom2_id": "///A/270/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 135, "atom1_serNum": 1214, "atom2_serNum": 1231, "donAcc_type": "standard", "distance": 2.943, "atom1_id": "///A/267/O", "atom2_id": "///A/271/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 136, "atom1_serNum": 1219, "atom2_serNum": 1236, "donAcc_type": "standard", "distance": 2.840, "atom1_id": "///A/268/O", "atom2_id": "///A/272/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 137, "atom1_serNum": 1224, "atom2_serNum": 1241, "donAcc_type": "standard", "distance": 2.734, "atom1_id": "///A/269/O", "atom2_id": "///A/273/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 138, "atom1_serNum": 1249, "atom2_serNum": 1256, "donAcc_type": "standard", "distance": 2.746, "atom1_id": "///A/274/O", "atom2_id": "///A/276/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 139, "atom1_serNum": 1279, "atom2_serNum": 1286, "donAcc_type": "standard", "distance": 2.629, "atom1_id": "///A/280/O", "atom2_id": "///A/282/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 140, "atom1_serNum": 1279, "atom2_serNum": 1291, "donAcc_type": "standard", "distance": 3.273, "atom1_id": "///A/280/O", "atom2_id": "///A/283/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 141, "atom1_serNum": 1284, "atom2_serNum": 1301, "donAcc_type": "standard", "distance": 2.873, "atom1_id": "///A/281/O", "atom2_id": "///A/285/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 142, "atom1_serNum": 1289, "atom2_serNum": 1306, "donAcc_type": "standard", "distance": 2.957, "atom1_id": "///A/282/O", "atom2_id": "///A/286/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 143, "atom1_serNum": 1294, "atom2_serNum": 1311, "donAcc_type": "standard", "distance": 2.894, "atom1_id": "///A/283/O", "atom2_id": "///A/287/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 144, "atom1_serNum": 1299, "atom2_serNum": 1316, "donAcc_type": "standard", "distance": 2.828, "atom1_id": "///A/284/O", "atom2_id": "///A/288/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 145, "atom1_serNum": 1304, "atom2_serNum": 1321, "donAcc_type": "standard", "distance": 2.891, "atom1_id": "///A/285/O", "atom2_id": "///A/289/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 146, "atom1_serNum": 1314, "atom2_serNum": 1331, "donAcc_type": "standard", "distance": 2.882, "atom1_id": "///A/287/O", "atom2_id": "///A/291/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 147, "atom1_serNum": 1319, "atom2_serNum": 1336, "donAcc_type": "standard", "distance": 2.888, "atom1_id": "///A/288/O", "atom2_id": "///A/292/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 148, "atom1_serNum": 1324, "atom2_serNum": 1341, "donAcc_type": "standard", "distance": 2.834, "atom1_id": "///A/289/O", "atom2_id": "///A/293/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 149, "atom1_serNum": 1329, "atom2_serNum": 1346, "donAcc_type": "standard", "distance": 2.900, "atom1_id": "///A/290/O", "atom2_id": "///A/294/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 150, "atom1_serNum": 1334, "atom2_serNum": 1351, "donAcc_type": "standard", "distance": 2.868, "atom1_id": "///A/291/O", "atom2_id": "///A/295/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 151, "atom1_serNum": 1339, "atom2_serNum": 1356, "donAcc_type": "standard", "distance": 3.795, "atom1_id": "///A/292/O", "atom2_id": "///A/296/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 152, "atom1_serNum": 1344, "atom2_serNum": 1361, "donAcc_type": "standard", "distance": 3.848, "atom1_id": "///A/293/O", "atom2_id": "///A/297/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 153, "atom1_serNum": 1349, "atom2_serNum": 1366, "donAcc_type": "standard", "distance": 2.726, "atom1_id": "///A/294/O", "atom2_id": "///A/298/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 154, "atom1_serNum": 1354, "atom2_serNum": 1371, "donAcc_type": "standard", "distance": 2.913, "atom1_id": "///A/295/O", "atom2_id": "///A/299/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 155, "atom1_serNum": 1359, "atom2_serNum": 1376, "donAcc_type": "standard", "distance": 2.812, "atom1_id": "///A/296/O", "atom2_id": "///A/300/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 156, "atom1_serNum": 1364, "atom2_serNum": 1381, "donAcc_type": "standard", "distance": 2.901, "atom1_id": "///A/297/O", "atom2_id": "///A/301/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 157, "atom1_serNum": 1369, "atom2_serNum": 1386, "donAcc_type": "standard", "distance": 2.825, "atom1_id": "///A/298/O", "atom2_id": "///A/302/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 158, "atom1_serNum": 1374, "atom2_serNum": 1391, "donAcc_type": "standard", "distance": 2.854, "atom1_id": "///A/299/O", "atom2_id": "///A/303/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 159, "atom1_serNum": 1379, "atom2_serNum": 1396, "donAcc_type": "standard", "distance": 2.915, "atom1_id": "///A/300/O", "atom2_id": "///A/304/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 160, "atom1_serNum": 1384, "atom2_serNum": 1401, "donAcc_type": "standard", "distance": 2.822, "atom1_id": "///A/301/O", "atom2_id": "///A/305/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 161, "atom1_serNum": 1394, "atom2_serNum": 1411, "donAcc_type": "standard", "distance": 2.467, "atom1_id": "///A/303/O", "atom2_id": "///A/307/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 162, "atom1_serNum": 1399, "atom2_serNum": 1421, "donAcc_type": "standard", "distance": 2.589, "atom1_id": "///A/304/O", "atom2_id": "///A/309/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 163, "atom1_serNum": 1404, "atom2_serNum": 1416, "donAcc_type": "standard", "distance": 2.773, "atom1_id": "///A/305/O", "atom2_id": "///A/308/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 164, "atom1_serNum": 1444, "atom2_serNum": 1451, "donAcc_type": "standard", "distance": 2.721, "atom1_id": "///A/313/O", "atom2_id": "///A/315/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 165, "atom1_serNum": 1464, "atom2_serNum": 1476, "donAcc_type": "standard", "distance": 3.038, "atom1_id": "///A/317/O", "atom2_id": "///A/320/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 166, "atom1_serNum": 1469, "atom2_serNum": 1481, "donAcc_type": "standard", "distance": 2.982, "atom1_id": "///A/318/O", "atom2_id": "///A/321/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 167, "atom1_serNum": 1479, "atom2_serNum": 1486, "donAcc_type": "standard", "distance": 3.063, "atom1_id": "///A/320/O", "atom2_id": "///A/322/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 168, "atom1_serNum": 1484, "atom2_serNum": 1491, "donAcc_type": "standard", "distance": 2.618, "atom1_id": "///A/321/O", "atom2_id": "///A/323/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 169, "atom1_serNum": 1489, "atom2_serNum": 1496, "donAcc_type": "standard", "distance": 2.509, "atom1_id": "///A/322/O", "atom2_id": "///A/324/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 170, "atom1_serNum": 1514, "atom2_serNum": 1521, "donAcc_type": "standard", "distance": 2.649, "atom1_id": "///A/327/O", "atom2_id": "///A/329/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 171, "atom1_serNum": 1524, "atom2_serNum": 1541, "donAcc_type": "standard", "distance": 2.440, "atom1_id": "///A/329/O", "atom2_id": "///A/333/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 172, "atom1_serNum": 1529, "atom2_serNum": 1546, "donAcc_type": "standard", "distance": 2.876, "atom1_id": "///A/330/O", "atom2_id": "///A/334/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 173, "atom1_serNum": 1534, "atom2_serNum": 1551, "donAcc_type": "standard", "distance": 2.851, "atom1_id": "///A/331/O", "atom2_id": "///A/335/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 174, "atom1_serNum": 1539, "atom2_serNum": 1556, "donAcc_type": "standard", "distance": 2.866, "atom1_id": "///A/332/O", "atom2_id": "///A/336/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 175, "atom1_serNum": 1549, "atom2_serNum": 1566, "donAcc_type": "standard", "distance": 2.912, "atom1_id": "///A/334/O", "atom2_id": "///A/338/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 176, "atom1_serNum": 1554, "atom2_serNum": 1571, "donAcc_type": "standard", "distance": 2.839, "atom1_id": "///A/335/O", "atom2_id": "///A/339/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 177, "atom1_serNum": 1559, "atom2_serNum": 1576, "donAcc_type": "standard", "distance": 2.860, "atom1_id": "///A/336/O", "atom2_id": "///A/340/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 178, "atom1_serNum": 1564, "atom2_serNum": 1581, "donAcc_type": "standard", "distance": 2.934, "atom1_id": "///A/337/O", "atom2_id": "///A/341/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 179, "atom1_serNum": 1569, "atom2_serNum": 1586, "donAcc_type": "standard", "distance": 2.855, "atom1_id": "///A/338/O", "atom2_id": "///A/342/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 180, "atom1_serNum": 1574, "atom2_serNum": 1591, "donAcc_type": "standard", "distance": 2.911, "atom1_id": "///A/339/O", "atom2_id": "///A/343/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 181, "atom1_serNum": 1579, "atom2_serNum": 1596, "donAcc_type": "standard", "distance": 2.840, "atom1_id": "///A/340/O", "atom2_id": "///A/344/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 182, "atom1_serNum": 1584, "atom2_serNum": 1601, "donAcc_type": "standard", "distance": 2.887, "atom1_id": "///A/341/O", "atom2_id": "///A/345/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 183, "atom1_serNum": 1589, "atom2_serNum": 1606, "donAcc_type": "standard", "distance": 2.921, "atom1_id": "///A/342/O", "atom2_id": "///A/346/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 184, "atom1_serNum": 1594, "atom2_serNum": 1611, "donAcc_type": "standard", "distance": 2.884, "atom1_id": "///A/343/O", "atom2_id": "///A/347/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 185, "atom1_serNum": 1599, "atom2_serNum": 1611, "donAcc_type": "standard", "distance": 3.044, "atom1_id": "///A/344/O", "atom2_id": "///A/347/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 186, "atom1_serNum": 1599, "atom2_serNum": 1616, "donAcc_type": "standard", "distance": 2.893, "atom1_id": "///A/344/O", "atom2_id": "///A/348/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 187, "atom1_serNum": 1604, "atom2_serNum": 1621, "donAcc_type": "standard", "distance": 3.507, "atom1_id": "///A/345/O", "atom2_id": "///A/349/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 188, "atom1_serNum": 1614, "atom2_serNum": 1634, "donAcc_type": "questionable", "distance": 2.834, "atom1_id": "///A/347/O", "atom2_id": "///A/351/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 189, "atom1_serNum": 1644, "atom2_serNum": 1651, "donAcc_type": "standard", "distance": 3.201, "atom1_id": "///A/353/O", "atom2_id": "///A/355/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 190, "atom1_serNum": 1669, "atom2_serNum": 1676, "donAcc_type": "standard", "distance": 3.295, "atom1_id": "///A/358/O", "atom2_id": "///A/360/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 191, "atom1_serNum": 1674, "atom2_serNum": 1681, "donAcc_type": "standard", "distance": 2.698, "atom1_id": "///A/359/O", "atom2_id": "///A/361/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 192, "atom1_serNum": 1709, "atom2_serNum": 1721, "donAcc_type": "standard", "distance": 2.871, "atom1_id": "///A/366/O", "atom2_id": "///A/369/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 193, "atom1_serNum": 1729, "atom2_serNum": 1736, "donAcc_type": "standard", "distance": 2.731, "atom1_id": "///A/370/O", "atom2_id": "///A/372/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 194, "atom1_serNum": 1729, "atom2_serNum": 1741, "donAcc_type": "standard", "distance": 2.842, "atom1_id": "///A/370/O", "atom2_id": "///A/373/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 195, "atom1_serNum": 1739, "atom2_serNum": 1756, "donAcc_type": "standard", "distance": 2.816, "atom1_id": "///A/372/O", "atom2_id": "///A/376/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 196, "atom1_serNum": 1744, "atom2_serNum": 1761, "donAcc_type": "standard", "distance": 2.954, "atom1_id": "///A/373/O", "atom2_id": "///A/377/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 197, "atom1_serNum": 1749, "atom2_serNum": 1766, "donAcc_type": "standard", "distance": 2.838, "atom1_id": "///A/374/O", "atom2_id": "///A/378/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 198, "atom1_serNum": 1754, "atom2_serNum": 1771, "donAcc_type": "standard", "distance": 2.828, "atom1_id": "///A/375/O", "atom2_id": "///A/379/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 199, "atom1_serNum": 1759, "atom2_serNum": 1776, "donAcc_type": "standard", "distance": 2.860, "atom1_id": "///A/376/O", "atom2_id": "///A/380/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 200, "atom1_serNum": 1764, "atom2_serNum": 1781, "donAcc_type": "standard", "distance": 2.900, "atom1_id": "///A/377/O", "atom2_id": "///A/381/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 201, "atom1_serNum": 1769, "atom2_serNum": 1786, "donAcc_type": "standard", "distance": 2.862, "atom1_id": "///A/378/O", "atom2_id": "///A/382/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 202, "atom1_serNum": 1774, "atom2_serNum": 1791, "donAcc_type": "standard", "distance": 3.442, "atom1_id": "///A/379/O", "atom2_id": "///A/383/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 203, "atom1_serNum": 1779, "atom2_serNum": 1796, "donAcc_type": "standard", "distance": 2.921, "atom1_id": "///A/380/O", "atom2_id": "///A/384/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 204, "atom1_serNum": 1784, "atom2_serNum": 1801, "donAcc_type": "standard", "distance": 2.858, "atom1_id": "///A/381/O", "atom2_id": "///A/385/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 205, "atom1_serNum": 1794, "atom2_serNum": 1806, "donAcc_type": "standard", "distance": 2.750, "atom1_id": "///A/383/O", "atom2_id": "///A/386/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 206, "atom1_serNum": 1824, "atom2_serNum": 1831, "donAcc_type": "standard", "distance": 2.548, "atom1_id": "///A/389/O", "atom2_id": "///A/391/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 207, "atom1_serNum": 1839, "atom2_serNum": 1849, "donAcc_type": "questionable", "distance": 3.044, "atom1_id": "///A/422/O", "atom2_id": "///A/424/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 208, "atom1_serNum": 1859, "atom2_serNum": 1866, "donAcc_type": "standard", "distance": 3.183, "atom1_id": "///A/426/O", "atom2_id": "///A/428/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 209, "atom1_serNum": 1869, "atom2_serNum": 1876, "donAcc_type": "standard", "distance": 2.928, "atom1_id": "///A/428/O", "atom2_id": "///A/430/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 210, "atom1_serNum": 1919, "atom2_serNum": 2071, "donAcc_type": "standard", "distance": 3.601, "atom1_id": "///A/438/O", "atom2_id": "///A/484/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 211, "atom1_serNum": 1924, "atom2_serNum": 2024, "donAcc_type": "questionable", "distance": 2.846, "atom1_id": "///A/439/O", "atom2_id": "///A/459/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 212, "atom1_serNum": 1926, "atom2_serNum": 2064, "donAcc_type": "standard", "distance": 2.904, "atom1_id": "///A/440/N", "atom2_id": "///A/482/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 213, "atom1_serNum": 1929, "atom2_serNum": 2061, "donAcc_type": "standard", "distance": 2.887, "atom1_id": "///A/440/O", "atom2_id": "///A/482/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 214, "atom1_serNum": 1931, "atom2_serNum": 2014, "donAcc_type": "standard", "distance": 2.482, "atom1_id": "///A/441/N", "atom2_id": "///A/457/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 215, "atom1_serNum": 1934, "atom2_serNum": 1941, "donAcc_type": "standard", "distance": 2.775, "atom1_id": "///A/441/O", "atom2_id": "///A/443/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 216, "atom1_serNum": 1934, "atom2_serNum": 2011, "donAcc_type": "standard", "distance": 3.066, "atom1_id": "///A/441/O", "atom2_id": "///A/457/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 217, "atom1_serNum": 1936, "atom2_serNum": 2054, "donAcc_type": "standard", "distance": 3.946, "atom1_id": "///A/442/N", "atom2_id": "///A/480/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 218, "atom1_serNum": 1976, "atom2_serNum": 2009, "donAcc_type": "standard", "distance": 2.898, "atom1_id": "///A/450/N", "atom2_id": "///A/456/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 219, "atom1_serNum": 2056, "atom2_serNum": 2164, "donAcc_type": "standard", "distance": 2.570, "atom1_id": "///A/481/N", "atom2_id": "///A/502/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 220, "atom1_serNum": 2059, "atom2_serNum": 2066, "donAcc_type": "standard", "distance": 3.196, "atom1_id": "///A/481/O", "atom2_id": "///A/483/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 221, "atom1_serNum": 2074, "atom2_serNum": 2081, "donAcc_type": "standard", "distance": 2.763, "atom1_id": "///A/484/O", "atom2_id": "///A/486/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 222, "atom1_serNum": 2099, "atom2_serNum": 2116, "donAcc_type": "standard", "distance": 3.806, "atom1_id": "///A/489/O", "atom2_id": "///A/493/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 223, "atom1_serNum": 2104, "atom2_serNum": 2121, "donAcc_type": "standard", "distance": 2.957, "atom1_id": "///A/490/O", "atom2_id": "///A/494/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 224, "atom1_serNum": 2109, "atom2_serNum": 2126, "donAcc_type": "standard", "distance": 2.901, "atom1_id": "///A/491/O", "atom2_id": "///A/495/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 225, "atom1_serNum": 2114, "atom2_serNum": 2131, "donAcc_type": "standard", "distance": 2.861, "atom1_id": "///A/492/O", "atom2_id": "///A/496/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 226, "atom1_serNum": 2119, "atom2_serNum": 2136, "donAcc_type": "standard", "distance": 2.546, "atom1_id": "///A/493/O", "atom2_id": "///A/497/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 227, "atom1_serNum": 2134, "atom2_serNum": 2141, "donAcc_type": "standard", "distance": 3.270, "atom1_id": "///A/496/O", "atom2_id": "///A/498/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 228, "atom1_serNum": 2259, "atom2_serNum": 2266, "donAcc_type": "standard", "distance": 2.970, "atom1_id": "///A/521/O", "atom2_id": "///A/523/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 229, "atom1_serNum": 2299, "atom2_serNum": 2306, "donAcc_type": "standard", "distance": 2.922, "atom1_id": "///A/529/O", "atom2_id": "///A/531/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 230, "atom1_serNum": 2329, "atom2_serNum": 2341, "donAcc_type": "standard", "distance": 2.825, "atom1_id": "///A/535/O", "atom2_id": "///A/538/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 231, "atom1_serNum": 2329, "atom2_serNum": 2346, "donAcc_type": "standard", "distance": 2.947, "atom1_id": "///A/535/O", "atom2_id": "///A/539/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 232, "atom1_serNum": 2334, "atom2_serNum": 2351, "donAcc_type": "standard", "distance": 3.226, "atom1_id": "///A/536/O", "atom2_id": "///A/540/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 233, "atom1_serNum": 2374, "atom2_serNum": 2381, "donAcc_type": "standard", "distance": 2.690, "atom1_id": "///A/544/O", "atom2_id": "///A/546/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 234, "atom1_serNum": 2384, "atom2_serNum": 2776, "donAcc_type": "standard", "distance": 3.797, "atom1_id": "///A/546/O", "atom2_id": "///A/640/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 235, "atom1_serNum": 2386, "atom2_serNum": 2939, "donAcc_type": "standard", "distance": 2.982, "atom1_id": "///A/547/N", "atom2_id": "///A/672/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 236, "atom1_serNum": 2389, "atom2_serNum": 2936, "donAcc_type": "standard", "distance": 2.925, "atom1_id": "///A/547/O", "atom2_id": "///A/672/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 237, "atom1_serNum": 2389, "atom2_serNum": 2939, "donAcc_type": "questionable", "distance": 2.899, "atom1_id": "///A/547/O", "atom2_id": "///A/672/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 238, "atom1_serNum": 2391, "atom2_serNum": 2769, "donAcc_type": "standard", "distance": 2.946, "atom1_id": "///A/548/N", "atom2_id": "///A/638/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 239, "atom1_serNum": 2396, "atom2_serNum": 2929, "donAcc_type": "standard", "distance": 2.958, "atom1_id": "///A/549/N", "atom2_id": "///A/670/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 240, "atom1_serNum": 2399, "atom2_serNum": 2926, "donAcc_type": "standard", "distance": 2.958, "atom1_id": "///A/549/O", "atom2_id": "///A/670/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 241, "atom1_serNum": 2401, "atom2_serNum": 2759, "donAcc_type": "standard", "distance": 2.946, "atom1_id": "///A/550/N", "atom2_id": "///A/636/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 242, "atom1_serNum": 2404, "atom2_serNum": 2756, "donAcc_type": "standard", "distance": 2.957, "atom1_id": "///A/550/O", "atom2_id": "///A/636/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 243, "atom1_serNum": 2406, "atom2_serNum": 2919, "donAcc_type": "standard", "distance": 2.910, "atom1_id": "///A/551/N", "atom2_id": "///A/668/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 244, "atom1_serNum": 2409, "atom2_serNum": 2916, "donAcc_type": "standard", "distance": 2.964, "atom1_id": "///A/551/O", "atom2_id": "///A/668/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 245, "atom1_serNum": 2411, "atom2_serNum": 2749, "donAcc_type": "standard", "distance": 3.570, "atom1_id": "///A/552/N", "atom2_id": "///A/634/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 246, "atom1_serNum": 2414, "atom2_serNum": 2746, "donAcc_type": "standard", "distance": 3.708, "atom1_id": "///A/552/O", "atom2_id": "///A/634/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 247, "atom1_serNum": 2416, "atom2_serNum": 2909, "donAcc_type": "standard", "distance": 3.064, "atom1_id": "///A/553/N", "atom2_id": "///A/666/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 248, "atom1_serNum": 2419, "atom2_serNum": 2906, "donAcc_type": "standard", "distance": 3.257, "atom1_id": "///A/553/O", "atom2_id": "///A/666/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 249, "atom1_serNum": 2419, "atom2_serNum": 2909, "donAcc_type": "questionable", "distance": 2.933, "atom1_id": "///A/553/O", "atom2_id": "///A/666/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 250, "atom1_serNum": 2434, "atom2_serNum": 2451, "donAcc_type": "standard", "distance": 2.454, "atom1_id": "///A/556/O", "atom2_id": "///A/560/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 251, "atom1_serNum": 2439, "atom2_serNum": 2456, "donAcc_type": "standard", "distance": 2.865, "atom1_id": "///A/557/O", "atom2_id": "///A/561/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 252, "atom1_serNum": 2444, "atom2_serNum": 2461, "donAcc_type": "standard", "distance": 2.902, "atom1_id": "///A/558/O", "atom2_id": "///A/562/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 253, "atom1_serNum": 2449, "atom2_serNum": 2466, "donAcc_type": "standard", "distance": 3.309, "atom1_id": "///A/559/O", "atom2_id": "///A/563/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 254, "atom1_serNum": 2474, "atom2_serNum": 2481, "donAcc_type": "standard", "distance": 3.049, "atom1_id": "///A/564/O", "atom2_id": "///A/566/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 255, "atom1_serNum": 2499, "atom2_serNum": 2511, "donAcc_type": "standard", "distance": 2.928, "atom1_id": "///A/574/O", "atom2_id": "///A/577/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 256, "atom1_serNum": 2499, "atom2_serNum": 2516, "donAcc_type": "standard", "distance": 3.393, "atom1_id": "///A/574/O", "atom2_id": "///A/578/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 257, "atom1_serNum": 2504, "atom2_serNum": 2521, "donAcc_type": "standard", "distance": 3.233, "atom1_id": "///A/575/O", "atom2_id": "///A/579/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 258, "atom1_serNum": 2509, "atom2_serNum": 2526, "donAcc_type": "standard", "distance": 2.894, "atom1_id": "///A/576/O", "atom2_id": "///A/580/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 259, "atom1_serNum": 2514, "atom2_serNum": 2531, "donAcc_type": "standard", "distance": 2.986, "atom1_id": "///A/577/O", "atom2_id": "///A/581/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 260, "atom1_serNum": 2524, "atom2_serNum": 2541, "donAcc_type": "standard", "distance": 3.363, "atom1_id": "///A/579/O", "atom2_id": "///A/583/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 261, "atom1_serNum": 2529, "atom2_serNum": 2546, "donAcc_type": "standard", "distance": 2.979, "atom1_id": "///A/580/O", "atom2_id": "///A/584/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 262, "atom1_serNum": 2534, "atom2_serNum": 2551, "donAcc_type": "standard", "distance": 2.958, "atom1_id": "///A/581/O", "atom2_id": "///A/585/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 263, "atom1_serNum": 2539, "atom2_serNum": 2556, "donAcc_type": "standard", "distance": 2.901, "atom1_id": "///A/582/O", "atom2_id": "///A/586/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 264, "atom1_serNum": 2544, "atom2_serNum": 2561, "donAcc_type": "standard", "distance": 2.860, "atom1_id": "///A/583/O", "atom2_id": "///A/587/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 265, "atom1_serNum": 2549, "atom2_serNum": 2566, "donAcc_type": "standard", "distance": 2.925, "atom1_id": "///A/584/O", "atom2_id": "///A/588/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 266, "atom1_serNum": 2554, "atom2_serNum": 2571, "donAcc_type": "standard", "distance": 2.870, "atom1_id": "///A/585/O", "atom2_id": "///A/589/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 267, "atom1_serNum": 2559, "atom2_serNum": 2576, "donAcc_type": "standard", "distance": 2.919, "atom1_id": "///A/586/O", "atom2_id": "///A/590/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 268, "atom1_serNum": 2564, "atom2_serNum": 2581, "donAcc_type": "standard", "distance": 2.873, "atom1_id": "///A/587/O", "atom2_id": "///A/591/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 269, "atom1_serNum": 2579, "atom2_serNum": 2591, "donAcc_type": "standard", "distance": 3.070, "atom1_id": "///A/590/O", "atom2_id": "///A/593/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 270, "atom1_serNum": 2579, "atom2_serNum": 2596, "donAcc_type": "standard", "distance": 3.560, "atom1_id": "///A/590/O", "atom2_id": "///A/594/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 271, "atom1_serNum": 2584, "atom2_serNum": 2601, "donAcc_type": "standard", "distance": 2.930, "atom1_id": "///A/591/O", "atom2_id": "///A/595/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 272, "atom1_serNum": 2589, "atom2_serNum": 2606, "donAcc_type": "standard", "distance": 2.807, "atom1_id": "///A/592/O", "atom2_id": "///A/596/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 273, "atom1_serNum": 2594, "atom2_serNum": 2611, "donAcc_type": "standard", "distance": 2.914, "atom1_id": "///A/593/O", "atom2_id": "///A/597/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 274, "atom1_serNum": 2599, "atom2_serNum": 2616, "donAcc_type": "standard", "distance": 2.885, "atom1_id": "///A/594/O", "atom2_id": "///A/598/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 275, "atom1_serNum": 2609, "atom2_serNum": 2684, "donAcc_type": "questionable", "distance": 2.882, "atom1_id": "///A/596/O", "atom2_id": "///A/621/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 276, "atom1_serNum": 2614, "atom2_serNum": 2621, "donAcc_type": "standard", "distance": 2.993, "atom1_id": "///A/597/O", "atom2_id": "///A/599/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 277, "atom1_serNum": 2624, "atom2_serNum": 2631, "donAcc_type": "standard", "distance": 3.210, "atom1_id": "///A/599/O", "atom2_id": "///A/601/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 278, "atom1_serNum": 2704, "atom2_serNum": 2711, "donAcc_type": "standard", "distance": 2.849, "atom1_id": "///A/625/O", "atom2_id": "///A/627/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 279, "atom1_serNum": 2711, "atom2_serNum": 2754, "donAcc_type": "standard", "distance": 3.502, "atom1_id": "///A/627/N", "atom2_id": "///A/635/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 280, "atom1_serNum": 2774, "atom2_serNum": 2786, "donAcc_type": "standard", "distance": 2.792, "atom1_id": "///A/639/O", "atom2_id": "///A/642/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 281, "atom1_serNum": 2774, "atom2_serNum": 2791, "donAcc_type": "standard", "distance": 3.209, "atom1_id": "///A/639/O", "atom2_id": "///A/643/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 282, "atom1_serNum": 2784, "atom2_serNum": 2801, "donAcc_type": "standard", "distance": 2.982, "atom1_id": "///A/641/O", "atom2_id": "///A/645/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 283, "atom1_serNum": 2789, "atom2_serNum": 2806, "donAcc_type": "standard", "distance": 2.795, "atom1_id": "///A/642/O", "atom2_id": "///A/646/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 284, "atom1_serNum": 2794, "atom2_serNum": 2811, "donAcc_type": "standard", "distance": 2.950, "atom1_id": "///A/643/O", "atom2_id": "///A/647/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 285, "atom1_serNum": 2804, "atom2_serNum": 2821, "donAcc_type": "standard", "distance": 3.463, "atom1_id": "///A/645/O", "atom2_id": "///A/649/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 286, "atom1_serNum": 2809, "atom2_serNum": 2826, "donAcc_type": "standard", "distance": 2.904, "atom1_id": "///A/646/O", "atom2_id": "///A/650/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 287, "atom1_serNum": 2814, "atom2_serNum": 2831, "donAcc_type": "standard", "distance": 2.968, "atom1_id": "///A/647/O", "atom2_id": "///A/651/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 288, "atom1_serNum": 2819, "atom2_serNum": 2836, "donAcc_type": "standard", "distance": 2.926, "atom1_id": "///A/648/O", "atom2_id": "///A/652/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 289, "atom1_serNum": 2824, "atom2_serNum": 2841, "donAcc_type": "standard", "distance": 2.889, "atom1_id": "///A/649/O", "atom2_id": "///A/653/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 290, "atom1_serNum": 2829, "atom2_serNum": 2846, "donAcc_type": "standard", "distance": 2.868, "atom1_id": "///A/650/O", "atom2_id": "///A/654/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 291, "atom1_serNum": 2834, "atom2_serNum": 2851, "donAcc_type": "standard", "distance": 2.933, "atom1_id": "///A/651/O", "atom2_id": "///A/655/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 292, "atom1_serNum": 2839, "atom2_serNum": 2856, "donAcc_type": "standard", "distance": 2.902, "atom1_id": "///A/652/O", "atom2_id": "///A/656/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 293, "atom1_serNum": 2844, "atom2_serNum": 2861, "donAcc_type": "standard", "distance": 2.800, "atom1_id": "///A/653/O", "atom2_id": "///A/657/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 294, "atom1_serNum": 2849, "atom2_serNum": 2866, "donAcc_type": "standard", "distance": 2.983, "atom1_id": "///A/654/O", "atom2_id": "///A/658/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 295, "atom1_serNum": 2874, "atom2_serNum": 2881, "donAcc_type": "standard", "distance": 2.911, "atom1_id": "///A/659/O", "atom2_id": "///A/661/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 296, "atom1_serNum": 2911, "atom2_serNum": 3074, "donAcc_type": "standard", "distance": 3.044, "atom1_id": "///A/667/N", "atom2_id": "///A/699/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 297, "atom1_serNum": 2914, "atom2_serNum": 3081, "donAcc_type": "standard", "distance": 3.828, "atom1_id": "///A/667/O", "atom2_id": "///A/701/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 298, "atom1_serNum": 2964, "atom2_serNum": 2971, "donAcc_type": "standard", "distance": 2.783, "atom1_id": "///A/677/O", "atom2_id": "///A/679/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 299, "atom1_serNum": 2964, "atom2_serNum": 2976, "donAcc_type": "standard", "distance": 2.726, "atom1_id": "///A/677/O", "atom2_id": "///A/680/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 300, "atom1_serNum": 2964, "atom2_serNum": 2981, "donAcc_type": "standard", "distance": 3.373, "atom1_id": "///A/677/O", "atom2_id": "///A/681/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 301, "atom1_serNum": 2974, "atom2_serNum": 2986, "donAcc_type": "standard", "distance": 3.329, "atom1_id": "///A/679/O", "atom2_id": "///A/682/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 302, "atom1_serNum": 2974, "atom2_serNum": 2991, "donAcc_type": "standard", "distance": 2.900, "atom1_id": "///A/679/O", "atom2_id": "///A/683/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 303, "atom1_serNum": 2979, "atom2_serNum": 2991, "donAcc_type": "standard", "distance": 3.123, "atom1_id": "///A/680/O", "atom2_id": "///A/683/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 304, "atom1_serNum": 2979, "atom2_serNum": 2996, "donAcc_type": "standard", "distance": 3.000, "atom1_id": "///A/680/O", "atom2_id": "///A/684/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 305, "atom1_serNum": 2994, "atom2_serNum": 3011, "donAcc_type": "standard", "distance": 2.944, "atom1_id": "///A/683/O", "atom2_id": "///A/687/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 306, "atom1_serNum": 2999, "atom2_serNum": 3016, "donAcc_type": "standard", "distance": 2.973, "atom1_id": "///A/684/O", "atom2_id": "///A/688/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 307, "atom1_serNum": 3004, "atom2_serNum": 3021, "donAcc_type": "standard", "distance": 2.922, "atom1_id": "///A/685/O", "atom2_id": "///A/689/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 308, "atom1_serNum": 3014, "atom2_serNum": 3031, "donAcc_type": "standard", "distance": 2.942, "atom1_id": "///A/687/O", "atom2_id": "///A/691/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 309, "atom1_serNum": 3019, "atom2_serNum": 3036, "donAcc_type": "standard", "distance": 2.926, "atom1_id": "///A/688/O", "atom2_id": "///A/692/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 310, "atom1_serNum": 3024, "atom2_serNum": 3041, "donAcc_type": "standard", "distance": 2.843, "atom1_id": "///A/689/O", "atom2_id": "///A/693/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 311, "atom1_serNum": 3029, "atom2_serNum": 3046, "donAcc_type": "standard", "distance": 2.964, "atom1_id": "///A/690/O", "atom2_id": "///A/694/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 312, "atom1_serNum": 3034, "atom2_serNum": 3051, "donAcc_type": "standard", "distance": 2.996, "atom1_id": "///A/691/O", "atom2_id": "///A/695/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 313, "atom1_serNum": 3039, "atom2_serNum": 3061, "donAcc_type": "standard", "distance": 3.179, "atom1_id": "///A/692/O", "atom2_id": "///A/697/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 314, "atom1_serNum": 3069, "atom2_serNum": 3121, "donAcc_type": "standard", "distance": 3.467, "atom1_id": "///A/698/O", "atom2_id": "///A/709/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 315, "atom1_serNum": 3076, "atom2_serNum": 3114, "donAcc_type": "standard", "distance": 3.484, "atom1_id": "///A/700/N", "atom2_id": "///A/707/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 316, "atom1_serNum": 3079, "atom2_serNum": 3086, "donAcc_type": "standard", "distance": 2.448, "atom1_id": "///A/700/O", "atom2_id": "///A/702/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 317, "atom1_serNum": 3084, "atom2_serNum": 3096, "donAcc_type": "standard", "distance": 3.295, "atom1_id": "///A/701/O", "atom2_id": "///A/704/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 318, "atom1_serNum": 3104, "atom2_serNum": 3111, "donAcc_type": "standard", "distance": 2.553, "atom1_id": "///A/705/O", "atom2_id": "///A/707/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 319, "atom1_serNum": 3119, "atom2_serNum": 3136, "donAcc_type": "standard", "distance": 2.857, "atom1_id": "///A/708/O", "atom2_id": "///A/712/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 320, "atom1_serNum": 3129, "atom2_serNum": 3141, "donAcc_type": "standard", "distance": 2.829, "atom1_id": "///A/710/O", "atom2_id": "///A/713/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 321, "atom1_serNum": 3134, "atom2_serNum": 3151, "donAcc_type": "standard", "distance": 2.943, "atom1_id": "///A/711/O", "atom2_id": "///A/715/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 322, "atom1_serNum": 3139, "atom2_serNum": 3156, "donAcc_type": "standard", "distance": 2.863, "atom1_id": "///A/712/O", "atom2_id": "///A/716/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 323, "atom1_serNum": 3144, "atom2_serNum": 3161, "donAcc_type": "standard", "distance": 2.974, "atom1_id": "///A/713/O", "atom2_id": "///A/717/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 324, "atom1_serNum": 3149, "atom2_serNum": 3166, "donAcc_type": "standard", "distance": 3.559, "atom1_id": "///A/714/O", "atom2_id": "///A/718/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 325, "atom1_serNum": 3154, "atom2_serNum": 3171, "donAcc_type": "standard", "distance": 2.923, "atom1_id": "///A/715/O", "atom2_id": "///A/719/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 326, "atom1_serNum": 3159, "atom2_serNum": 3176, "donAcc_type": "standard", "distance": 2.871, "atom1_id": "///A/716/O", "atom2_id": "///A/720/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 327, "atom1_serNum": 3174, "atom2_serNum": 3186, "donAcc_type": "standard", "distance": 3.006, "atom1_id": "///A/719/O", "atom2_id": "///A/722/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 328, "atom1_serNum": 3184, "atom2_serNum": 3191, "donAcc_type": "standard", "distance": 2.706, "atom1_id": "///A/721/O", "atom2_id": "///A/723/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 329, "atom1_serNum": 3189, "atom2_serNum": 3206, "donAcc_type": "standard", "distance": 2.351, "atom1_id": "///A/722/O", "atom2_id": "///A/726/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 330, "atom1_serNum": 3194, "atom2_serNum": 3211, "donAcc_type": "standard", "distance": 2.973, "atom1_id": "///A/723/O", "atom2_id": "///A/727/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 331, "atom1_serNum": 3194, "atom2_serNum": 3216, "donAcc_type": "standard", "distance": 3.183, "atom1_id": "///A/723/O", "atom2_id": "///A/728/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 332, "atom1_serNum": 3234, "atom2_serNum": 3241, "donAcc_type": "standard", "distance": 3.018, "atom1_id": "///A/731/O", "atom2_id": "///A/733/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 333, "atom1_serNum": 3254, "atom2_serNum": 3271, "donAcc_type": "standard", "distance": 2.866, "atom1_id": "///A/735/O", "atom2_id": "///A/739/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 334, "atom1_serNum": 3259, "atom2_serNum": 3276, "donAcc_type": "standard", "distance": 2.955, "atom1_id": "///A/736/O", "atom2_id": "///A/740/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 335, "atom1_serNum": 3264, "atom2_serNum": 3281, "donAcc_type": "standard", "distance": 2.945, "atom1_id": "///A/737/O", "atom2_id": "///A/741/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 336, "atom1_serNum": 3269, "atom2_serNum": 3286, "donAcc_type": "standard", "distance": 3.078, "atom1_id": "///A/738/O", "atom2_id": "///A/742/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 337, "atom1_serNum": 3274, "atom2_serNum": 3291, "donAcc_type": "standard", "distance": 3.462, "atom1_id": "///A/739/O", "atom2_id": "///A/743/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 338, "atom1_serNum": 3279, "atom2_serNum": 3296, "donAcc_type": "standard", "distance": 2.954, "atom1_id": "///A/740/O", "atom2_id": "///A/744/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 339, "atom1_serNum": 3284, "atom2_serNum": 3301, "donAcc_type": "standard", "distance": 2.919, "atom1_id": "///A/741/O", "atom2_id": "///A/745/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 340, "atom1_serNum": 3289, "atom2_serNum": 3306, "donAcc_type": "standard", "distance": 2.818, "atom1_id": "///A/742/O", "atom2_id": "///A/746/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 341, "atom1_serNum": 3299, "atom2_serNum": 3316, "donAcc_type": "standard", "distance": 3.905, "atom1_id": "///A/744/O", "atom2_id": "///A/748/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 342, "atom1_serNum": 3309, "atom2_serNum": 3344, "donAcc_type": "questionable", "distance": 3.249, "atom1_id": "///A/746/O", "atom2_id": "///A/753/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 343, "atom1_serNum": 3314, "atom2_serNum": 3321, "donAcc_type": "standard", "distance": 2.843, "atom1_id": "///A/747/O", "atom2_id": "///A/749/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 344, "atom1_serNum": 3339, "atom2_serNum": 3351, "donAcc_type": "standard", "distance": 3.155, "atom1_id": "///A/752/O", "atom2_id": "///A/755/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 345, "atom1_serNum": 3349, "atom2_serNum": 3356, "donAcc_type": "standard", "distance": 2.878, "atom1_id": "///A/754/O", "atom2_id": "///A/756/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 346, "atom1_serNum": 3364, "atom2_serNum": 3371, "donAcc_type": "standard", "distance": 2.762, "atom1_id": "///A/757/O", "atom2_id": "///A/759/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 347, "atom1_serNum": 3364, "atom2_serNum": 3381, "donAcc_type": "standard", "distance": 3.240, "atom1_id": "///A/757/O", "atom2_id": "///A/761/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 348, "atom1_serNum": 3379, "atom2_serNum": 3391, "donAcc_type": "standard", "distance": 3.289, "atom1_id": "///A/760/O", "atom2_id": "///A/763/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 349, "atom1_serNum": 3389, "atom2_serNum": 3401, "donAcc_type": "standard", "distance": 3.825, "atom1_id": "///A/762/O", "atom2_id": "///A/765/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 350, "atom1_serNum": 3399, "atom2_serNum": 3411, "donAcc_type": "standard", "distance": 2.959, "atom1_id": "///A/764/O", "atom2_id": "///A/767/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 351, "atom1_serNum": 3404, "atom2_serNum": 3421, "donAcc_type": "standard", "distance": 2.663, "atom1_id": "///A/765/O", "atom2_id": "///A/769/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 352, "atom1_serNum": 3424, "atom2_serNum": 3436, "donAcc_type": "standard", "distance": 2.730, "atom1_id": "///A/769/O", "atom2_id": "///A/772/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 353, "atom1_serNum": 3424, "atom2_serNum": 3441, "donAcc_type": "standard", "distance": 2.453, "atom1_id": "///A/769/O", "atom2_id": "///A/773/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 354, "atom1_serNum": 3454, "atom2_serNum": 3466, "donAcc_type": "standard", "distance": 3.295, "atom1_id": "///A/775/O", "atom2_id": "///A/778/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 355, "atom1_serNum": 3464, "atom2_serNum": 3471, "donAcc_type": "standard", "distance": 2.751, "atom1_id": "///A/777/O", "atom2_id": "///A/779/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 356, "atom1_serNum": 3489, "atom2_serNum": 3496, "donAcc_type": "standard", "distance": 3.094, "atom1_id": "///A/782/O", "atom2_id": "///A/784/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 357, "atom1_serNum": 3519, "atom2_serNum": 3526, "donAcc_type": "standard", "distance": 2.874, "atom1_id": "///A/788/O", "atom2_id": "///A/790/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 358, "atom1_serNum": 3519, "atom2_serNum": 3531, "donAcc_type": "standard", "distance": 3.192, "atom1_id": "///A/788/O", "atom2_id": "///A/791/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 359, "atom1_serNum": 3529, "atom2_serNum": 3546, "donAcc_type": "standard", "distance": 2.859, "atom1_id": "///A/790/O", "atom2_id": "///A/794/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 360, "atom1_serNum": 3534, "atom2_serNum": 3551, "donAcc_type": "standard", "distance": 2.936, "atom1_id": "///A/791/O", "atom2_id": "///A/795/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 361, "atom1_serNum": 3544, "atom2_serNum": 3556, "donAcc_type": "standard", "distance": 3.268, "atom1_id": "///A/793/O", "atom2_id": "///A/796/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 362, "atom1_serNum": 3544, "atom2_serNum": 3561, "donAcc_type": "standard", "distance": 2.899, "atom1_id": "///A/793/O", "atom2_id": "///A/797/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 363, "atom1_serNum": 3549, "atom2_serNum": 3566, "donAcc_type": "standard", "distance": 2.923, "atom1_id": "///A/794/O", "atom2_id": "///A/798/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 364, "atom1_serNum": 3585, "atom2_serNum": 3592, "donAcc_type": "standard", "distance": 2.676, "atom1_id": "///B/4/O", "atom2_id": "///B/6/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 365, "atom1_serNum": 3590, "atom2_serNum": 3597, "donAcc_type": "standard", "distance": 2.709, "atom1_id": "///B/5/O", "atom2_id": "///B/7/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 366, "atom1_serNum": 3592, "atom2_serNum": 4310, "donAcc_type": "standard", "distance": 3.458, "atom1_id": "///B/6/N", "atom2_id": "///B/157/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 367, "atom1_serNum": 3595, "atom2_serNum": 4307, "donAcc_type": "standard", "distance": 3.694, "atom1_id": "///B/6/O", "atom2_id": "///B/157/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 368, "atom1_serNum": 3600, "atom2_serNum": 4492, "donAcc_type": "standard", "distance": 2.927, "atom1_id": "///B/7/O", "atom2_id": "///B/194/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 369, "atom1_serNum": 3605, "atom2_serNum": 4292, "donAcc_type": "standard", "distance": 3.944, "atom1_id": "///B/8/O", "atom2_id": "///B/154/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 370, "atom1_serNum": 3607, "atom2_serNum": 4485, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///B/9/N", "atom2_id": "///B/192/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 371, "atom1_serNum": 3610, "atom2_serNum": 4482, "donAcc_type": "standard", "distance": 2.850, "atom1_id": "///B/9/O", "atom2_id": "///B/192/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 372, "atom1_serNum": 3635, "atom2_serNum": 4262, "donAcc_type": "standard", "distance": 2.542, "atom1_id": "///B/14/O", "atom2_id": "///B/148/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 373, "atom1_serNum": 3650, "atom2_serNum": 3657, "donAcc_type": "standard", "distance": 2.789, "atom1_id": "///B/17/O", "atom2_id": "///B/19/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 374, "atom1_serNum": 3655, "atom2_serNum": 3852, "donAcc_type": "standard", "distance": 2.964, "atom1_id": "///B/18/O", "atom2_id": "///B/58/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 375, "atom1_serNum": 3660, "atom2_serNum": 3672, "donAcc_type": "standard", "distance": 3.057, "atom1_id": "///B/19/O", "atom2_id": "///B/22/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 376, "atom1_serNum": 3660, "atom2_serNum": 3677, "donAcc_type": "standard", "distance": 2.620, "atom1_id": "///B/19/O", "atom2_id": "///B/23/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 377, "atom1_serNum": 3665, "atom2_serNum": 3677, "donAcc_type": "standard", "distance": 2.459, "atom1_id": "///B/20/O", "atom2_id": "///B/23/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 378, "atom1_serNum": 3665, "atom2_serNum": 3682, "donAcc_type": "standard", "distance": 2.928, "atom1_id": "///B/20/O", "atom2_id": "///B/24/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 379, "atom1_serNum": 3675, "atom2_serNum": 3692, "donAcc_type": "standard", "distance": 2.841, "atom1_id": "///B/22/O", "atom2_id": "///B/26/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 380, "atom1_serNum": 3680, "atom2_serNum": 3697, "donAcc_type": "standard", "distance": 2.908, "atom1_id": "///B/23/O", "atom2_id": "///B/27/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 381, "atom1_serNum": 3685, "atom2_serNum": 3702, "donAcc_type": "standard", "distance": 2.872, "atom1_id": "///B/24/O", "atom2_id": "///B/28/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 382, "atom1_serNum": 3690, "atom2_serNum": 3707, "donAcc_type": "standard", "distance": 2.921, "atom1_id": "///B/25/O", "atom2_id": "///B/29/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 383, "atom1_serNum": 3700, "atom2_serNum": 3712, "donAcc_type": "standard", "distance": 2.568, "atom1_id": "///B/27/O", "atom2_id": "///B/30/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 384, "atom1_serNum": 3700, "atom2_serNum": 3717, "donAcc_type": "standard", "distance": 3.520, "atom1_id": "///B/27/O", "atom2_id": "///B/31/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 385, "atom1_serNum": 3710, "atom2_serNum": 3722, "donAcc_type": "standard", "distance": 3.255, "atom1_id": "///B/29/O", "atom2_id": "///B/32/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 386, "atom1_serNum": 3710, "atom2_serNum": 3727, "donAcc_type": "standard", "distance": 2.970, "atom1_id": "///B/29/O", "atom2_id": "///B/33/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 387, "atom1_serNum": 3715, "atom2_serNum": 3732, "donAcc_type": "standard", "distance": 2.819, "atom1_id": "///B/30/O", "atom2_id": "///B/34/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 388, "atom1_serNum": 3745, "atom2_serNum": 3762, "donAcc_type": "standard", "distance": 2.959, "atom1_id": "///B/36/O", "atom2_id": "///B/40/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 389, "atom1_serNum": 3750, "atom2_serNum": 3767, "donAcc_type": "standard", "distance": 2.916, "atom1_id": "///B/37/O", "atom2_id": "///B/41/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 390, "atom1_serNum": 3755, "atom2_serNum": 3772, "donAcc_type": "standard", "distance": 2.834, "atom1_id": "///B/38/O", "atom2_id": "///B/42/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 391, "atom1_serNum": 3760, "atom2_serNum": 3777, "donAcc_type": "standard", "distance": 2.884, "atom1_id": "///B/39/O", "atom2_id": "///B/43/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 392, "atom1_serNum": 3765, "atom2_serNum": 3782, "donAcc_type": "standard", "distance": 2.855, "atom1_id": "///B/40/O", "atom2_id": "///B/44/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 393, "atom1_serNum": 3770, "atom2_serNum": 3787, "donAcc_type": "standard", "distance": 2.924, "atom1_id": "///B/41/O", "atom2_id": "///B/45/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 394, "atom1_serNum": 3775, "atom2_serNum": 3792, "donAcc_type": "standard", "distance": 2.895, "atom1_id": "///B/42/O", "atom2_id": "///B/46/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 395, "atom1_serNum": 3780, "atom2_serNum": 3797, "donAcc_type": "standard", "distance": 2.890, "atom1_id": "///B/43/O", "atom2_id": "///B/47/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 396, "atom1_serNum": 3785, "atom2_serNum": 3802, "donAcc_type": "standard", "distance": 2.946, "atom1_id": "///B/44/O", "atom2_id": "///B/48/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 397, "atom1_serNum": 3790, "atom2_serNum": 3807, "donAcc_type": "standard", "distance": 3.457, "atom1_id": "///B/45/O", "atom2_id": "///B/49/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 398, "atom1_serNum": 3795, "atom2_serNum": 3812, "donAcc_type": "standard", "distance": 2.941, "atom1_id": "///B/46/O", "atom2_id": "///B/50/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 399, "atom1_serNum": 3850, "atom2_serNum": 3857, "donAcc_type": "standard", "distance": 2.585, "atom1_id": "///B/57/O", "atom2_id": "///B/59/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 400, "atom1_serNum": 3850, "atom2_serNum": 4305, "donAcc_type": "questionable", "distance": 2.979, "atom1_id": "///B/57/O", "atom2_id": "///B/156/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 401, "atom1_serNum": 3860, "atom2_serNum": 4300, "donAcc_type": "questionable", "distance": 2.862, "atom1_id": "///B/59/O", "atom2_id": "///B/155/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 402, "atom1_serNum": 3865, "atom2_serNum": 3880, "donAcc_type": "questionable", "distance": 3.019, "atom1_id": "///B/60/O", "atom2_id": "///B/63/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 403, "atom1_serNum": 3882, "atom2_serNum": 4010, "donAcc_type": "standard", "distance": 2.776, "atom1_id": "///B/64/N", "atom2_id": "///B/89/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 404, "atom1_serNum": 3885, "atom2_serNum": 4002, "donAcc_type": "standard", "distance": 3.237, "atom1_id": "///B/64/O", "atom2_id": "///B/88/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 405, "atom1_serNum": 3905, "atom2_serNum": 3912, "donAcc_type": "standard", "distance": 2.992, "atom1_id": "///B/68/O", "atom2_id": "///B/70/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 406, "atom1_serNum": 3910, "atom2_serNum": 3922, "donAcc_type": "standard", "distance": 3.154, "atom1_id": "///B/69/O", "atom2_id": "///B/72/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 407, "atom1_serNum": 3910, "atom2_serNum": 3927, "donAcc_type": "standard", "distance": 3.015, "atom1_id": "///B/69/O", "atom2_id": "///B/73/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 408, "atom1_serNum": 3940, "atom2_serNum": 3952, "donAcc_type": "standard", "distance": 3.744, "atom1_id": "///B/75/O", "atom2_id": "///B/78/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 409, "atom1_serNum": 3950, "atom2_serNum": 3957, "donAcc_type": "standard", "distance": 3.220, "atom1_id": "///B/77/O", "atom2_id": "///B/79/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 410, "atom1_serNum": 3965, "atom2_serNum": 3972, "donAcc_type": "standard", "distance": 2.591, "atom1_id": "///B/80/O", "atom2_id": "///B/82/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 411, "atom1_serNum": 3970, "atom2_serNum": 3982, "donAcc_type": "standard", "distance": 3.940, "atom1_id": "///B/81/O", "atom2_id": "///B/84/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 412, "atom1_serNum": 3995, "atom2_serNum": 4007, "donAcc_type": "standard", "distance": 3.954, "atom1_id": "///B/86/O", "atom2_id": "///B/89/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 413, "atom1_serNum": 4015, "atom2_serNum": 4032, "donAcc_type": "standard", "distance": 2.637, "atom1_id": "///B/90/O", "atom2_id": "///B/94/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 414, "atom1_serNum": 4025, "atom2_serNum": 4042, "donAcc_type": "standard", "distance": 2.891, "atom1_id": "///B/92/O", "atom2_id": "///B/96/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 415, "atom1_serNum": 4030, "atom2_serNum": 4047, "donAcc_type": "standard", "distance": 2.865, "atom1_id": "///B/93/O", "atom2_id": "///B/97/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 416, "atom1_serNum": 4035, "atom2_serNum": 4052, "donAcc_type": "standard", "distance": 2.865, "atom1_id": "///B/94/O", "atom2_id": "///B/98/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 417, "atom1_serNum": 4045, "atom2_serNum": 4067, "donAcc_type": "standard", "distance": 2.770, "atom1_id": "///B/96/O", "atom2_id": "///B/101/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 418, "atom1_serNum": 4045, "atom2_serNum": 4072, "donAcc_type": "standard", "distance": 2.896, "atom1_id": "///B/96/O", "atom2_id": "///B/102/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 419, "atom1_serNum": 4050, "atom2_serNum": 4062, "donAcc_type": "standard", "distance": 2.924, "atom1_id": "///B/97/O", "atom2_id": "///B/100/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 420, "atom1_serNum": 4055, "atom2_serNum": 4972, "donAcc_type": "standard", "distance": 2.815, "atom1_id": "///B/98/O", "atom2_id": "///B/290/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 421, "atom1_serNum": 4070, "atom2_serNum": 4087, "donAcc_type": "standard", "distance": 2.924, "atom1_id": "///B/101/O", "atom2_id": "///B/105/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 422, "atom1_serNum": 4105, "atom2_serNum": 4117, "donAcc_type": "standard", "distance": 2.726, "atom1_id": "///B/108/O", "atom2_id": "///B/111/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 423, "atom1_serNum": 4105, "atom2_serNum": 4122, "donAcc_type": "standard", "distance": 2.430, "atom1_id": "///B/108/O", "atom2_id": "///B/112/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 424, "atom1_serNum": 4110, "atom2_serNum": 4132, "donAcc_type": "standard", "distance": 2.478, "atom1_id": "///B/109/O", "atom2_id": "///B/114/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 425, "atom1_serNum": 4115, "atom2_serNum": 4137, "donAcc_type": "standard", "distance": 2.484, "atom1_id": "///B/110/O", "atom2_id": "///B/115/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 426, "atom1_serNum": 4120, "atom2_serNum": 4140, "donAcc_type": "questionable", "distance": 2.937, "atom1_id": "///B/111/O", "atom2_id": "///B/115/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 427, "atom1_serNum": 4150, "atom2_serNum": 4157, "donAcc_type": "standard", "distance": 3.130, "atom1_id": "///B/117/O", "atom2_id": "///B/119/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 428, "atom1_serNum": 4177, "atom2_serNum": 4260, "donAcc_type": "standard", "distance": 3.208, "atom1_id": "///B/123/N", "atom2_id": "///B/147/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 429, "atom1_serNum": 4180, "atom2_serNum": 4257, "donAcc_type": "standard", "distance": 3.191, "atom1_id": "///B/123/O", "atom2_id": "///B/147/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 430, "atom1_serNum": 4205, "atom2_serNum": 13871, "donAcc_type": "acceptable", "distance": 2.728, "atom1_id": "///B/128/O", "atom2_id": "///M/0/O2'", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 431, "atom1_serNum": 4295, "atom2_serNum": 4302, "donAcc_type": "standard", "distance": 2.997, "atom1_id": "///B/154/O", "atom2_id": "///B/156/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 432, "atom1_serNum": 4305, "atom2_serNum": 4312, "donAcc_type": "standard", "distance": 3.092, "atom1_id": "///B/156/O", "atom2_id": "///B/158/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 433, "atom1_serNum": 4335, "atom2_serNum": 4342, "donAcc_type": "standard", "distance": 2.542, "atom1_id": "///B/162/O", "atom2_id": "///B/164/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 434, "atom1_serNum": 4350, "atom2_serNum": 4362, "donAcc_type": "standard", "distance": 3.776, "atom1_id": "///B/165/O", "atom2_id": "///B/168/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 435, "atom1_serNum": 4355, "atom2_serNum": 4372, "donAcc_type": "standard", "distance": 3.397, "atom1_id": "///B/166/O", "atom2_id": "///B/170/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 436, "atom1_serNum": 4360, "atom2_serNum": 4382, "donAcc_type": "standard", "distance": 2.693, "atom1_id": "///B/167/O", "atom2_id": "///B/172/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 437, "atom1_serNum": 4375, "atom2_serNum": 4392, "donAcc_type": "standard", "distance": 2.861, "atom1_id": "///B/170/O", "atom2_id": "///B/174/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 438, "atom1_serNum": 4380, "atom2_serNum": 4397, "donAcc_type": "standard", "distance": 2.780, "atom1_id": "///B/171/O", "atom2_id": "///B/175/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 439, "atom1_serNum": 4385, "atom2_serNum": 4402, "donAcc_type": "standard", "distance": 2.908, "atom1_id": "///B/172/O", "atom2_id": "///B/176/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 440, "atom1_serNum": 4390, "atom2_serNum": 4407, "donAcc_type": "standard", "distance": 2.784, "atom1_id": "///B/173/O", "atom2_id": "///B/177/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 441, "atom1_serNum": 4395, "atom2_serNum": 4412, "donAcc_type": "standard", "distance": 3.037, "atom1_id": "///B/174/O", "atom2_id": "///B/178/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 442, "atom1_serNum": 4400, "atom2_serNum": 4420, "donAcc_type": "questionable", "distance": 2.996, "atom1_id": "///B/175/O", "atom2_id": "///B/179/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 443, "atom1_serNum": 4405, "atom2_serNum": 4477, "donAcc_type": "standard", "distance": 3.183, "atom1_id": "///B/176/O", "atom2_id": "///B/191/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 444, "atom1_serNum": 4415, "atom2_serNum": 4470, "donAcc_type": "questionable", "distance": 3.120, "atom1_id": "///B/178/O", "atom2_id": "///B/189/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 445, "atom1_serNum": 4435, "atom2_serNum": 4442, "donAcc_type": "standard", "distance": 2.666, "atom1_id": "///B/182/O", "atom2_id": "///B/184/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 446, "atom1_serNum": 4457, "atom2_serNum": 5476, "donAcc_type": "standard", "distance": 3.733, "atom1_id": "///B/187/N", "atom2_id": "///C/117/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 447, "atom1_serNum": 4520, "atom2_serNum": 4527, "donAcc_type": "standard", "distance": 3.102, "atom1_id": "///B/199/O", "atom2_id": "///B/201/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 448, "atom1_serNum": 4540, "atom2_serNum": 4965, "donAcc_type": "questionable", "distance": 2.830, "atom1_id": "///B/203/O", "atom2_id": "///B/288/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 449, "atom1_serNum": 4562, "atom2_serNum": 4970, "donAcc_type": "standard", "distance": 3.226, "atom1_id": "///B/208/N", "atom2_id": "///B/289/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 450, "atom1_serNum": 4567, "atom2_serNum": 4970, "donAcc_type": "standard", "distance": 2.870, "atom1_id": "///B/209/N", "atom2_id": "///B/289/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 451, "atom1_serNum": 4570, "atom2_serNum": 4967, "donAcc_type": "standard", "distance": 2.879, "atom1_id": "///B/209/O", "atom2_id": "///B/289/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 452, "atom1_serNum": 4570, "atom2_serNum": 4970, "donAcc_type": "questionable", "distance": 2.801, "atom1_id": "///B/209/O", "atom2_id": "///B/289/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 453, "atom1_serNum": 4575, "atom2_serNum": 4805, "donAcc_type": "questionable", "distance": 2.868, "atom1_id": "///B/210/O", "atom2_id": "///B/256/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 454, "atom1_serNum": 4577, "atom2_serNum": 4960, "donAcc_type": "standard", "distance": 2.748, "atom1_id": "///B/211/N", "atom2_id": "///B/287/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 455, "atom1_serNum": 4580, "atom2_serNum": 4957, "donAcc_type": "standard", "distance": 2.869, "atom1_id": "///B/211/O", "atom2_id": "///B/287/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 456, "atom1_serNum": 4585, "atom2_serNum": 4787, "donAcc_type": "standard", "distance": 3.974, "atom1_id": "///B/212/O", "atom2_id": "///B/253/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 457, "atom1_serNum": 4587, "atom2_serNum": 4950, "donAcc_type": "standard", "distance": 2.771, "atom1_id": "///B/213/N", "atom2_id": "///B/285/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 458, "atom1_serNum": 4605, "atom2_serNum": 4612, "donAcc_type": "standard", "distance": 2.462, "atom1_id": "///B/216/O", "atom2_id": "///B/218/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 459, "atom1_serNum": 4605, "atom2_serNum": 4775, "donAcc_type": "questionable", "distance": 3.318, "atom1_id": "///B/216/O", "atom2_id": "///B/250/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 460, "atom1_serNum": 4610, "atom2_serNum": 4617, "donAcc_type": "standard", "distance": 2.900, "atom1_id": "///B/217/O", "atom2_id": "///B/219/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 461, "atom1_serNum": 4632, "atom2_serNum": 4800, "donAcc_type": "standard", "distance": 2.815, "atom1_id": "///B/222/N", "atom2_id": "///B/255/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 462, "atom1_serNum": 4650, "atom2_serNum": 4777, "donAcc_type": "standard", "distance": 3.103, "atom1_id": "///B/225/O", "atom2_id": "///B/251/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 463, "atom1_serNum": 4667, "atom2_serNum": 4760, "donAcc_type": "standard", "distance": 2.957, "atom1_id": "///B/229/N", "atom2_id": "///B/247/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 464, "atom1_serNum": 4685, "atom2_serNum": 4692, "donAcc_type": "standard", "distance": 3.289, "atom1_id": "///B/232/O", "atom2_id": "///B/234/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 465, "atom1_serNum": 4685, "atom2_serNum": 13812, "donAcc_type": "questionable", "distance": 3.178, "atom1_id": "///B/232/O", "atom2_id": "///M/-3/O2", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 466, "atom1_serNum": 4710, "atom2_serNum": 4727, "donAcc_type": "standard", "distance": 2.425, "atom1_id": "///B/237/O", "atom2_id": "///B/241/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 467, "atom1_serNum": 4740, "atom2_serNum": 4747, "donAcc_type": "standard", "distance": 3.007, "atom1_id": "///B/243/O", "atom2_id": "///B/245/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 468, "atom1_serNum": 4745, "atom2_serNum": 4850, "donAcc_type": "questionable", "distance": 3.004, "atom1_id": "///B/244/O", "atom2_id": "///B/265/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 469, "atom1_serNum": 4750, "atom2_serNum": 4757, "donAcc_type": "standard", "distance": 2.706, "atom1_id": "///B/245/O", "atom2_id": "///B/247/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 470, "atom1_serNum": 4760, "atom2_serNum": 4767, "donAcc_type": "standard", "distance": 3.281, "atom1_id": "///B/247/O", "atom2_id": "///B/249/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 471, "atom1_serNum": 4780, "atom2_serNum": 4792, "donAcc_type": "standard", "distance": 3.884, "atom1_id": "///B/251/O", "atom2_id": "///B/254/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 472, "atom1_serNum": 4790, "atom2_serNum": 4797, "donAcc_type": "standard", "distance": 3.114, "atom1_id": "///B/253/O", "atom2_id": "///B/255/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 473, "atom1_serNum": 4795, "atom2_serNum": 4802, "donAcc_type": "standard", "distance": 3.003, "atom1_id": "///B/254/O", "atom2_id": "///B/256/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 474, "atom1_serNum": 4820, "atom2_serNum": 4942, "donAcc_type": "standard", "distance": 3.659, "atom1_id": "///B/259/O", "atom2_id": "///B/284/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 475, "atom1_serNum": 4945, "atom2_serNum": 4952, "donAcc_type": "standard", "distance": 2.702, "atom1_id": "///B/284/O", "atom2_id": "///B/286/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 476, "atom1_serNum": 4950, "atom2_serNum": 4957, "donAcc_type": "standard", "distance": 2.702, "atom1_id": "///B/285/O", "atom2_id": "///B/287/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 477, "atom1_serNum": 4960, "atom2_serNum": 4967, "donAcc_type": "standard", "distance": 3.243, "atom1_id": "///B/287/O", "atom2_id": "///B/289/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 478, "atom1_serNum": 4981, "atom2_serNum": 4988, "donAcc_type": "standard", "distance": 3.081, "atom1_id": "///C/2/O", "atom2_id": "///C/4/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 479, "atom1_serNum": 4981, "atom2_serNum": 5781, "donAcc_type": "questionable", "distance": 2.870, "atom1_id": "///C/2/O", "atom2_id": "///C/186/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 480, "atom1_serNum": 4988, "atom2_serNum": 5776, "donAcc_type": "standard", "distance": 2.717, "atom1_id": "///C/4/N", "atom2_id": "///C/185/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 481, "atom1_serNum": 4988, "atom2_serNum": 5781, "donAcc_type": "standard", "distance": 3.580, "atom1_id": "///C/4/N", "atom2_id": "///C/186/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 482, "atom1_serNum": 4993, "atom2_serNum": 5776, "donAcc_type": "standard", "distance": 2.970, "atom1_id": "///C/5/N", "atom2_id": "///C/185/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 483, "atom1_serNum": 4996, "atom2_serNum": 5773, "donAcc_type": "standard", "distance": 2.894, "atom1_id": "///C/5/O", "atom2_id": "///C/185/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 484, "atom1_serNum": 4998, "atom2_serNum": 6061, "donAcc_type": "standard", "distance": 2.928, "atom1_id": "///C/6/N", "atom2_id": "///C/242/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 485, "atom1_serNum": 5001, "atom2_serNum": 5008, "donAcc_type": "standard", "distance": 2.843, "atom1_id": "///C/6/O", "atom2_id": "///C/8/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 486, "atom1_serNum": 5003, "atom2_serNum": 5766, "donAcc_type": "standard", "distance": 3.492, "atom1_id": "///C/7/N", "atom2_id": "///C/183/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 487, "atom1_serNum": 5006, "atom2_serNum": 5013, "donAcc_type": "standard", "distance": 3.131, "atom1_id": "///C/7/O", "atom2_id": "///C/9/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 488, "atom1_serNum": 5008, "atom2_serNum": 6051, "donAcc_type": "standard", "distance": 2.924, "atom1_id": "///C/8/N", "atom2_id": "///C/240/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 489, "atom1_serNum": 5011, "atom2_serNum": 6048, "donAcc_type": "standard", "distance": 2.874, "atom1_id": "///C/8/O", "atom2_id": "///C/240/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 490, "atom1_serNum": 5013, "atom2_serNum": 5756, "donAcc_type": "standard", "distance": 2.819, "atom1_id": "///C/9/N", "atom2_id": "///C/181/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 491, "atom1_serNum": 5016, "atom2_serNum": 5753, "donAcc_type": "standard", "distance": 2.889, "atom1_id": "///C/9/O", "atom2_id": "///C/181/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 492, "atom1_serNum": 5018, "atom2_serNum": 6041, "donAcc_type": "standard", "distance": 2.686, "atom1_id": "///C/10/N", "atom2_id": "///C/238/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 493, "atom1_serNum": 5021, "atom2_serNum": 6038, "donAcc_type": "standard", "distance": 2.526, "atom1_id": "///C/10/O", "atom2_id": "///C/238/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 494, "atom1_serNum": 5023, "atom2_serNum": 5746, "donAcc_type": "standard", "distance": 2.953, "atom1_id": "///C/11/N", "atom2_id": "///C/179/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 495, "atom1_serNum": 5026, "atom2_serNum": 5743, "donAcc_type": "standard", "distance": 2.866, "atom1_id": "///C/11/O", "atom2_id": "///C/179/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 496, "atom1_serNum": 5028, "atom2_serNum": 5971, "donAcc_type": "standard", "distance": 2.947, "atom1_id": "///C/12/N", "atom2_id": "///C/224/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 497, "atom1_serNum": 5031, "atom2_serNum": 5968, "donAcc_type": "standard", "distance": 2.805, "atom1_id": "///C/12/O", "atom2_id": "///C/224/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 498, "atom1_serNum": 5033, "atom2_serNum": 5736, "donAcc_type": "standard", "distance": 2.878, "atom1_id": "///C/13/N", "atom2_id": "///C/177/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 499, "atom1_serNum": 5036, "atom2_serNum": 5733, "donAcc_type": "standard", "distance": 2.888, "atom1_id": "///C/13/O", "atom2_id": "///C/177/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 500, "atom1_serNum": 5036, "atom2_serNum": 5736, "donAcc_type": "questionable", "distance": 2.861, "atom1_id": "///C/13/O", "atom2_id": "///C/177/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 501, "atom1_serNum": 5043, "atom2_serNum": 5726, "donAcc_type": "standard", "distance": 3.287, "atom1_id": "///C/15/N", "atom2_id": "///C/175/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 502, "atom1_serNum": 5046, "atom2_serNum": 5718, "donAcc_type": "standard", "distance": 2.901, "atom1_id": "///C/15/O", "atom2_id": "///C/174/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 503, "atom1_serNum": 5053, "atom2_serNum": 5946, "donAcc_type": "standard", "distance": 2.900, "atom1_id": "///C/17/N", "atom2_id": "///C/219/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 504, "atom1_serNum": 5058, "atom2_serNum": 5931, "donAcc_type": "standard", "distance": 3.840, "atom1_id": "///C/18/N", "atom2_id": "///C/216/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 505, "atom1_serNum": 5061, "atom2_serNum": 5068, "donAcc_type": "standard", "distance": 3.157, "atom1_id": "///C/18/O", "atom2_id": "///C/20/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 506, "atom1_serNum": 5068, "atom2_serNum": 5706, "donAcc_type": "standard", "distance": 3.449, "atom1_id": "///C/20/N", "atom2_id": "///C/171/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 507, "atom1_serNum": 5091, "atom2_serNum": 15186, "donAcc_type": "questionable", "distance": 3.029, "atom1_id": "///C/24/O", "atom2_id": "///N/37/OP1", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 508, "atom1_serNum": 5146, "atom2_serNum": 13947, "donAcc_type": "questionable", "distance": 3.273, "atom1_id": "///C/35/O", "atom2_id": "///M/4/OP1", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 509, "atom1_serNum": 5156, "atom2_serNum": 5168, "donAcc_type": "standard", "distance": 3.873, "atom1_id": "///C/53/O", "atom2_id": "///C/56/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 510, "atom1_serNum": 5161, "atom2_serNum": 5173, "donAcc_type": "standard", "distance": 3.269, "atom1_id": "///C/54/O", "atom2_id": "///C/57/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 511, "atom1_serNum": 5166, "atom2_serNum": 5183, "donAcc_type": "standard", "distance": 2.960, "atom1_id": "///C/55/O", "atom2_id": "///C/59/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 512, "atom1_serNum": 5171, "atom2_serNum": 5188, "donAcc_type": "standard", "distance": 2.827, "atom1_id": "///C/56/O", "atom2_id": "///C/60/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 513, "atom1_serNum": 5176, "atom2_serNum": 5193, "donAcc_type": "standard", "distance": 2.815, "atom1_id": "///C/57/O", "atom2_id": "///C/61/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 514, "atom1_serNum": 5181, "atom2_serNum": 5198, "donAcc_type": "standard", "distance": 2.876, "atom1_id": "///C/58/O", "atom2_id": "///C/62/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 515, "atom1_serNum": 5186, "atom2_serNum": 5203, "donAcc_type": "standard", "distance": 2.896, "atom1_id": "///C/59/O", "atom2_id": "///C/63/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 516, "atom1_serNum": 5191, "atom2_serNum": 5208, "donAcc_type": "standard", "distance": 2.808, "atom1_id": "///C/60/O", "atom2_id": "///C/64/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 517, "atom1_serNum": 5196, "atom2_serNum": 5213, "donAcc_type": "standard", "distance": 2.920, "atom1_id": "///C/61/O", "atom2_id": "///C/65/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 518, "atom1_serNum": 5201, "atom2_serNum": 5213, "donAcc_type": "standard", "distance": 2.842, "atom1_id": "///C/62/O", "atom2_id": "///C/65/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 519, "atom1_serNum": 5206, "atom2_serNum": 6069, "donAcc_type": "standard", "distance": 3.519, "atom1_id": "///C/63/O", "atom2_id": "///D/2/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 520, "atom1_serNum": 5206, "atom2_serNum": 6074, "donAcc_type": "standard", "distance": 3.545, "atom1_id": "///C/63/O", "atom2_id": "///D/3/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 521, "atom1_serNum": 5211, "atom2_serNum": 5218, "donAcc_type": "standard", "distance": 2.600, "atom1_id": "///C/64/O", "atom2_id": "///C/66/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 522, "atom1_serNum": 5226, "atom2_serNum": 5238, "donAcc_type": "standard", "distance": 3.140, "atom1_id": "///C/67/O", "atom2_id": "///C/70/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 523, "atom1_serNum": 5226, "atom2_serNum": 5243, "donAcc_type": "standard", "distance": 3.445, "atom1_id": "///C/67/O", "atom2_id": "///C/71/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 524, "atom1_serNum": 5246, "atom2_serNum": 5253, "donAcc_type": "standard", "distance": 2.931, "atom1_id": "///C/71/O", "atom2_id": "///C/73/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 525, "atom1_serNum": 5261, "atom2_serNum": 5268, "donAcc_type": "standard", "distance": 3.192, "atom1_id": "///C/74/O", "atom2_id": "///C/76/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 526, "atom1_serNum": 5261, "atom2_serNum": 5273, "donAcc_type": "standard", "distance": 2.782, "atom1_id": "///C/74/O", "atom2_id": "///C/77/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 527, "atom1_serNum": 5261, "atom2_serNum": 5278, "donAcc_type": "standard", "distance": 2.789, "atom1_id": "///C/74/O", "atom2_id": "///C/78/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 528, "atom1_serNum": 5301, "atom2_serNum": 5308, "donAcc_type": "standard", "distance": 2.679, "atom1_id": "///C/82/O", "atom2_id": "///C/84/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 529, "atom1_serNum": 5316, "atom2_serNum": 5431, "donAcc_type": "questionable", "distance": 2.846, "atom1_id": "///C/85/O", "atom2_id": "///C/108/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 530, "atom1_serNum": 5326, "atom2_serNum": 5343, "donAcc_type": "standard", "distance": 3.197, "atom1_id": "///C/87/O", "atom2_id": "///C/91/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 531, "atom1_serNum": 5331, "atom2_serNum": 5348, "donAcc_type": "standard", "distance": 2.861, "atom1_id": "///C/88/O", "atom2_id": "///C/92/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 532, "atom1_serNum": 5336, "atom2_serNum": 5358, "donAcc_type": "standard", "distance": 3.607, "atom1_id": "///C/89/O", "atom2_id": "///C/94/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 533, "atom1_serNum": 5346, "atom2_serNum": 5451, "donAcc_type": "questionable", "distance": 2.919, "atom1_id": "///C/91/O", "atom2_id": "///C/112/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 534, "atom1_serNum": 5351, "atom2_serNum": 5463, "donAcc_type": "standard", "distance": 3.372, "atom1_id": "///C/92/O", "atom2_id": "///C/115/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 535, "atom1_serNum": 5366, "atom2_serNum": 13851, "donAcc_type": "acceptable", "distance": 3.341, "atom1_id": "///C/95/O", "atom2_id": "///M/-1/O2'", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 536, "atom1_serNum": 5371, "atom2_serNum": 13828, "donAcc_type": "acceptable", "distance": 2.474, "atom1_id": "///C/96/O", "atom2_id": "///M/-2/O2'", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 537, "atom1_serNum": 5396, "atom2_serNum": 5408, "donAcc_type": "standard", "distance": 2.871, "atom1_id": "///C/101/O", "atom2_id": "///C/104/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 538, "atom1_serNum": 5401, "atom2_serNum": 5413, "donAcc_type": "standard", "distance": 2.937, "atom1_id": "///C/102/O", "atom2_id": "///C/105/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 539, "atom1_serNum": 5401, "atom2_serNum": 5418, "donAcc_type": "standard", "distance": 2.917, "atom1_id": "///C/102/O", "atom2_id": "///C/106/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 540, "atom1_serNum": 5406, "atom2_serNum": 5423, "donAcc_type": "standard", "distance": 2.882, "atom1_id": "///C/103/O", "atom2_id": "///C/107/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 541, "atom1_serNum": 5426, "atom2_serNum": 5438, "donAcc_type": "standard", "distance": 3.999, "atom1_id": "///C/107/O", "atom2_id": "///C/110/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 542, "atom1_serNum": 5431, "atom2_serNum": 5438, "donAcc_type": "standard", "distance": 2.762, "atom1_id": "///C/108/O", "atom2_id": "///C/110/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 543, "atom1_serNum": 5446, "atom2_serNum": 5453, "donAcc_type": "standard", "distance": 2.743, "atom1_id": "///C/111/O", "atom2_id": "///C/113/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 544, "atom1_serNum": 5451, "atom2_serNum": 5458, "donAcc_type": "standard", "distance": 2.582, "atom1_id": "///C/112/O", "atom2_id": "///C/114/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 545, "atom1_serNum": 5461, "atom2_serNum": 5468, "donAcc_type": "standard", "distance": 2.481, "atom1_id": "///C/114/O", "atom2_id": "///C/116/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 546, "atom1_serNum": 5466, "atom2_serNum": 5473, "donAcc_type": "standard", "distance": 2.752, "atom1_id": "///C/115/O", "atom2_id": "///C/117/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 547, "atom1_serNum": 5496, "atom2_serNum": 5738, "donAcc_type": "standard", "distance": 2.883, "atom1_id": "///C/121/O", "atom2_id": "///C/178/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 548, "atom1_serNum": 5503, "atom2_serNum": 5731, "donAcc_type": "standard", "distance": 3.146, "atom1_id": "///C/123/N", "atom2_id": "///C/176/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 549, "atom1_serNum": 5506, "atom2_serNum": 5513, "donAcc_type": "standard", "distance": 2.831, "atom1_id": "///C/123/O", "atom2_id": "///C/125/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 550, "atom1_serNum": 5511, "atom2_serNum": 5518, "donAcc_type": "standard", "distance": 2.990, "atom1_id": "///C/124/O", "atom2_id": "///C/126/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 551, "atom1_serNum": 5551, "atom2_serNum": 5568, "donAcc_type": "standard", "distance": 2.557, "atom1_id": "///C/132/O", "atom2_id": "///C/142/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 552, "atom1_serNum": 5576, "atom2_serNum": 5588, "donAcc_type": "standard", "distance": 3.609, "atom1_id": "///C/143/O", "atom2_id": "///C/146/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 553, "atom1_serNum": 5581, "atom2_serNum": 6579, "donAcc_type": "standard", "distance": 3.356, "atom1_id": "///C/144/O", "atom2_id": "///D/120/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 554, "atom1_serNum": 5593, "atom2_serNum": 5701, "donAcc_type": "standard", "distance": 2.819, "atom1_id": "///C/149/N", "atom2_id": "///C/170/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 555, "atom1_serNum": 5606, "atom2_serNum": 5691, "donAcc_type": "questionable", "distance": 2.831, "atom1_id": "///C/151/O", "atom2_id": "///C/168/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 556, "atom1_serNum": 5613, "atom2_serNum": 5681, "donAcc_type": "standard", "distance": 2.554, "atom1_id": "///C/153/N", "atom2_id": "///C/166/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 557, "atom1_serNum": 5616, "atom2_serNum": 5678, "donAcc_type": "standard", "distance": 2.600, "atom1_id": "///C/153/O", "atom2_id": "///C/166/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 558, "atom1_serNum": 5618, "atom2_serNum": 14057, "donAcc_type": "standard", "distance": 3.122, "atom1_id": "///C/154/N", "atom2_id": "///M/9/O5'", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 559, "atom1_serNum": 5621, "atom2_serNum": 5668, "donAcc_type": "standard", "distance": 3.194, "atom1_id": "///C/154/O", "atom2_id": "///C/164/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 560, "atom1_serNum": 5628, "atom2_serNum": 14032, "donAcc_type": "standard", "distance": 2.666, "atom1_id": "///C/156/N", "atom2_id": "///M/8/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 561, "atom1_serNum": 5636, "atom2_serNum": 14051, "donAcc_type": "standard", "distance": 3.360, "atom1_id": "///C/157/O", "atom2_id": "///M/8/N2", "atom_pair": "O:N", "residue_pair": "aa:nt" }, { "index": 562, "atom1_serNum": 5663, "atom2_serNum": 15139, "donAcc_type": "standard", "distance": 3.233, "atom1_id": "///C/163/N", "atom2_id": "///N/34/O2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 563, "atom1_serNum": 5666, "atom2_serNum": 15135, "donAcc_type": "acceptable", "distance": 2.720, "atom1_id": "///C/163/O", "atom2_id": "///N/34/O2'", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 564, "atom1_serNum": 5671, "atom2_serNum": 5678, "donAcc_type": "standard", "distance": 3.133, "atom1_id": "///C/164/O", "atom2_id": "///C/166/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 565, "atom1_serNum": 5766, "atom2_serNum": 5773, "donAcc_type": "standard", "distance": 2.680, "atom1_id": "///C/183/O", "atom2_id": "///C/185/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 566, "atom1_serNum": 5771, "atom2_serNum": 5778, "donAcc_type": "standard", "distance": 2.809, "atom1_id": "///C/184/O", "atom2_id": "///C/186/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 567, "atom1_serNum": 5786, "atom2_serNum": 5798, "donAcc_type": "standard", "distance": 2.853, "atom1_id": "///C/187/O", "atom2_id": "///C/190/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 568, "atom1_serNum": 5796, "atom2_serNum": 5803, "donAcc_type": "standard", "distance": 2.726, "atom1_id": "///C/189/O", "atom2_id": "///C/191/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 569, "atom1_serNum": 5796, "atom2_serNum": 5813, "donAcc_type": "standard", "distance": 3.778, "atom1_id": "///C/189/O", "atom2_id": "///C/193/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 570, "atom1_serNum": 5811, "atom2_serNum": 5823, "donAcc_type": "standard", "distance": 3.361, "atom1_id": "///C/192/O", "atom2_id": "///C/195/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 571, "atom1_serNum": 5811, "atom2_serNum": 5828, "donAcc_type": "standard", "distance": 2.766, "atom1_id": "///C/192/O", "atom2_id": "///C/196/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 572, "atom1_serNum": 5816, "atom2_serNum": 5838, "donAcc_type": "standard", "distance": 3.632, "atom1_id": "///C/193/O", "atom2_id": "///C/198/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 573, "atom1_serNum": 5836, "atom2_serNum": 5843, "donAcc_type": "standard", "distance": 2.873, "atom1_id": "///C/197/O", "atom2_id": "///C/199/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 574, "atom1_serNum": 5836, "atom2_serNum": 5848, "donAcc_type": "standard", "distance": 2.712, "atom1_id": "///C/197/O", "atom2_id": "///C/200/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 575, "atom1_serNum": 5836, "atom2_serNum": 5853, "donAcc_type": "standard", "distance": 2.971, "atom1_id": "///C/197/O", "atom2_id": "///C/201/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 576, "atom1_serNum": 5846, "atom2_serNum": 5863, "donAcc_type": "standard", "distance": 2.876, "atom1_id": "///C/199/O", "atom2_id": "///C/203/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 577, "atom1_serNum": 5851, "atom2_serNum": 5868, "donAcc_type": "standard", "distance": 2.904, "atom1_id": "///C/200/O", "atom2_id": "///C/204/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 578, "atom1_serNum": 5856, "atom2_serNum": 5873, "donAcc_type": "standard", "distance": 2.883, "atom1_id": "///C/201/O", "atom2_id": "///C/205/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 579, "atom1_serNum": 5871, "atom2_serNum": 5883, "donAcc_type": "standard", "distance": 3.013, "atom1_id": "///C/204/O", "atom2_id": "///C/207/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 580, "atom1_serNum": 5881, "atom2_serNum": 5888, "donAcc_type": "standard", "distance": 2.780, "atom1_id": "///C/206/O", "atom2_id": "///C/208/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 581, "atom1_serNum": 5916, "atom2_serNum": 5933, "donAcc_type": "standard", "distance": 3.100, "atom1_id": "///C/213/O", "atom2_id": "///C/217/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 582, "atom1_serNum": 5918, "atom2_serNum": 13967, "donAcc_type": "standard", "distance": 3.721, "atom1_id": "///C/214/N", "atom2_id": "///M/5/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 583, "atom1_serNum": 5928, "atom2_serNum": 6567, "donAcc_type": "standard", "distance": 3.169, "atom1_id": "///C/216/N", "atom2_id": "///D/117/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 584, "atom1_serNum": 5931, "atom2_serNum": 5938, "donAcc_type": "standard", "distance": 2.724, "atom1_id": "///C/216/O", "atom2_id": "///C/218/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 585, "atom1_serNum": 5951, "atom2_serNum": 5958, "donAcc_type": "standard", "distance": 2.732, "atom1_id": "///C/220/O", "atom2_id": "///C/222/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 586, "atom1_serNum": 6011, "atom2_serNum": 6018, "donAcc_type": "standard", "distance": 2.781, "atom1_id": "///C/232/O", "atom2_id": "///C/234/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 587, "atom1_serNum": 6036, "atom2_serNum": 6043, "donAcc_type": "standard", "distance": 3.064, "atom1_id": "///C/237/O", "atom2_id": "///C/239/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 588, "atom1_serNum": 6046, "atom2_serNum": 6053, "donAcc_type": "standard", "distance": 3.027, "atom1_id": "///C/239/O", "atom2_id": "///C/241/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 589, "atom1_serNum": 6051, "atom2_serNum": 6058, "donAcc_type": "standard", "distance": 3.132, "atom1_id": "///C/240/O", "atom2_id": "///C/242/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 590, "atom1_serNum": 6072, "atom2_serNum": 6079, "donAcc_type": "standard", "distance": 2.520, "atom1_id": "///D/2/O", "atom2_id": "///D/4/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 591, "atom1_serNum": 6087, "atom2_serNum": 6094, "donAcc_type": "standard", "distance": 2.913, "atom1_id": "///D/5/O", "atom2_id": "///D/7/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 592, "atom1_serNum": 6087, "atom2_serNum": 6864, "donAcc_type": "standard", "distance": 3.555, "atom1_id": "///D/5/O", "atom2_id": "///D/185/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 593, "atom1_serNum": 6092, "atom2_serNum": 7149, "donAcc_type": "standard", "distance": 2.928, "atom1_id": "///D/6/O", "atom2_id": "///D/242/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 594, "atom1_serNum": 6094, "atom2_serNum": 6857, "donAcc_type": "standard", "distance": 3.841, "atom1_id": "///D/7/N", "atom2_id": "///D/183/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 595, "atom1_serNum": 6097, "atom2_serNum": 6854, "donAcc_type": "standard", "distance": 2.904, "atom1_id": "///D/7/O", "atom2_id": "///D/183/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 596, "atom1_serNum": 6099, "atom2_serNum": 7142, "donAcc_type": "standard", "distance": 2.823, "atom1_id": "///D/8/N", "atom2_id": "///D/240/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 597, "atom1_serNum": 6102, "atom2_serNum": 7139, "donAcc_type": "standard", "distance": 2.865, "atom1_id": "///D/8/O", "atom2_id": "///D/240/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 598, "atom1_serNum": 6104, "atom2_serNum": 6847, "donAcc_type": "standard", "distance": 2.871, "atom1_id": "///D/9/N", "atom2_id": "///D/181/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 599, "atom1_serNum": 6107, "atom2_serNum": 6844, "donAcc_type": "standard", "distance": 2.847, "atom1_id": "///D/9/O", "atom2_id": "///D/181/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 600, "atom1_serNum": 6109, "atom2_serNum": 7132, "donAcc_type": "standard", "distance": 2.676, "atom1_id": "///D/10/N", "atom2_id": "///D/238/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 601, "atom1_serNum": 6112, "atom2_serNum": 7129, "donAcc_type": "standard", "distance": 3.019, "atom1_id": "///D/10/O", "atom2_id": "///D/238/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 602, "atom1_serNum": 6114, "atom2_serNum": 6837, "donAcc_type": "standard", "distance": 2.941, "atom1_id": "///D/11/N", "atom2_id": "///D/179/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 603, "atom1_serNum": 6117, "atom2_serNum": 6834, "donAcc_type": "standard", "distance": 2.867, "atom1_id": "///D/11/O", "atom2_id": "///D/179/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 604, "atom1_serNum": 6117, "atom2_serNum": 6837, "donAcc_type": "questionable", "distance": 2.859, "atom1_id": "///D/11/O", "atom2_id": "///D/179/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 605, "atom1_serNum": 6119, "atom2_serNum": 7062, "donAcc_type": "standard", "distance": 3.432, "atom1_id": "///D/12/N", "atom2_id": "///D/224/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 606, "atom1_serNum": 6122, "atom2_serNum": 6129, "donAcc_type": "standard", "distance": 3.287, "atom1_id": "///D/12/O", "atom2_id": "///D/14/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 607, "atom1_serNum": 6122, "atom2_serNum": 7059, "donAcc_type": "standard", "distance": 3.346, "atom1_id": "///D/12/O", "atom2_id": "///D/224/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 608, "atom1_serNum": 6124, "atom2_serNum": 6827, "donAcc_type": "standard", "distance": 2.857, "atom1_id": "///D/13/N", "atom2_id": "///D/177/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 609, "atom1_serNum": 6127, "atom2_serNum": 6824, "donAcc_type": "standard", "distance": 2.901, "atom1_id": "///D/13/O", "atom2_id": "///D/177/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 610, "atom1_serNum": 6132, "atom2_serNum": 6139, "donAcc_type": "standard", "distance": 2.785, "atom1_id": "///D/14/O", "atom2_id": "///D/16/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 611, "atom1_serNum": 6134, "atom2_serNum": 6817, "donAcc_type": "standard", "distance": 3.489, "atom1_id": "///D/15/N", "atom2_id": "///D/175/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 612, "atom1_serNum": 6137, "atom2_serNum": 6809, "donAcc_type": "standard", "distance": 2.915, "atom1_id": "///D/15/O", "atom2_id": "///D/174/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 613, "atom1_serNum": 6139, "atom2_serNum": 7037, "donAcc_type": "standard", "distance": 3.727, "atom1_id": "///D/16/N", "atom2_id": "///D/219/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 614, "atom1_serNum": 6152, "atom2_serNum": 6159, "donAcc_type": "standard", "distance": 2.820, "atom1_id": "///D/18/O", "atom2_id": "///D/20/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 615, "atom1_serNum": 6157, "atom2_serNum": 6164, "donAcc_type": "standard", "distance": 3.110, "atom1_id": "///D/19/O", "atom2_id": "///D/21/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 616, "atom1_serNum": 6159, "atom2_serNum": 6797, "donAcc_type": "standard", "distance": 3.121, "atom1_id": "///D/20/N", "atom2_id": "///D/171/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 617, "atom1_serNum": 6199, "atom2_serNum": 15045, "donAcc_type": "standard", "distance": 3.553, "atom1_id": "///D/28/N", "atom2_id": "///N/30/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 618, "atom1_serNum": 6222, "atom2_serNum": 6229, "donAcc_type": "standard", "distance": 3.197, "atom1_id": "///D/32/O", "atom2_id": "///D/34/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 619, "atom1_serNum": 6239, "atom2_serNum": 14039, "donAcc_type": "standard", "distance": 2.894, "atom1_id": "///D/52/N", "atom2_id": "///M/8/O3'", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 620, "atom1_serNum": 6239, "atom2_serNum": 14055, "donAcc_type": "standard", "distance": 2.986, "atom1_id": "///D/52/N", "atom2_id": "///M/9/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 621, "atom1_serNum": 6252, "atom2_serNum": 6269, "donAcc_type": "standard", "distance": 2.995, "atom1_id": "///D/54/O", "atom2_id": "///D/58/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 622, "atom1_serNum": 6257, "atom2_serNum": 6274, "donAcc_type": "standard", "distance": 2.837, "atom1_id": "///D/55/O", "atom2_id": "///D/59/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 623, "atom1_serNum": 6262, "atom2_serNum": 6279, "donAcc_type": "standard", "distance": 2.898, "atom1_id": "///D/56/O", "atom2_id": "///D/60/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 624, "atom1_serNum": 6267, "atom2_serNum": 6284, "donAcc_type": "standard", "distance": 2.888, "atom1_id": "///D/57/O", "atom2_id": "///D/61/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 625, "atom1_serNum": 6272, "atom2_serNum": 6289, "donAcc_type": "standard", "distance": 2.903, "atom1_id": "///D/58/O", "atom2_id": "///D/62/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 626, "atom1_serNum": 6282, "atom2_serNum": 6299, "donAcc_type": "standard", "distance": 2.838, "atom1_id": "///D/60/O", "atom2_id": "///D/64/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 627, "atom1_serNum": 6287, "atom2_serNum": 6304, "donAcc_type": "standard", "distance": 2.970, "atom1_id": "///D/61/O", "atom2_id": "///D/65/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 628, "atom1_serNum": 6292, "atom2_serNum": 6307, "donAcc_type": "questionable", "distance": 2.916, "atom1_id": "///D/62/O", "atom2_id": "///D/65/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 629, "atom1_serNum": 6297, "atom2_serNum": 7165, "donAcc_type": "standard", "distance": 2.754, "atom1_id": "///D/63/O", "atom2_id": "///E/3/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 630, "atom1_serNum": 6307, "atom2_serNum": 6314, "donAcc_type": "standard", "distance": 3.179, "atom1_id": "///D/65/O", "atom2_id": "///D/67/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 631, "atom1_serNum": 6312, "atom2_serNum": 6319, "donAcc_type": "standard", "distance": 2.617, "atom1_id": "///D/66/O", "atom2_id": "///D/68/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 632, "atom1_serNum": 6422, "atom2_serNum": 6439, "donAcc_type": "standard", "distance": 2.894, "atom1_id": "///D/88/O", "atom2_id": "///D/92/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 633, "atom1_serNum": 6437, "atom2_serNum": 6452, "donAcc_type": "questionable", "distance": 2.998, "atom1_id": "///D/91/O", "atom2_id": "///D/94/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 634, "atom1_serNum": 6437, "atom2_serNum": 6549, "donAcc_type": "standard", "distance": 3.676, "atom1_id": "///D/91/O", "atom2_id": "///D/114/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 635, "atom1_serNum": 6442, "atom2_serNum": 6449, "donAcc_type": "standard", "distance": 2.839, "atom1_id": "///D/92/O", "atom2_id": "///D/94/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 636, "atom1_serNum": 6462, "atom2_serNum": 13976, "donAcc_type": "acceptable", "distance": 2.457, "atom1_id": "///D/96/O", "atom2_id": "///M/5/O2'", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 637, "atom1_serNum": 6497, "atom2_serNum": 6509, "donAcc_type": "standard", "distance": 3.396, "atom1_id": "///D/103/O", "atom2_id": "///D/106/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 638, "atom1_serNum": 6507, "atom2_serNum": 6517, "donAcc_type": "questionable", "distance": 2.974, "atom1_id": "///D/105/O", "atom2_id": "///D/107/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 639, "atom1_serNum": 6517, "atom2_serNum": 6529, "donAcc_type": "standard", "distance": 3.759, "atom1_id": "///D/107/O", "atom2_id": "///D/110/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 640, "atom1_serNum": 6522, "atom2_serNum": 6529, "donAcc_type": "standard", "distance": 2.924, "atom1_id": "///D/108/O", "atom2_id": "///D/110/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 641, "atom1_serNum": 6527, "atom2_serNum": 6539, "donAcc_type": "standard", "distance": 2.788, "atom1_id": "///D/109/O", "atom2_id": "///D/112/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 642, "atom1_serNum": 6542, "atom2_serNum": 6549, "donAcc_type": "standard", "distance": 3.093, "atom1_id": "///D/112/O", "atom2_id": "///D/114/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 643, "atom1_serNum": 6547, "atom2_serNum": 6554, "donAcc_type": "standard", "distance": 2.858, "atom1_id": "///D/113/O", "atom2_id": "///D/115/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 644, "atom1_serNum": 6559, "atom2_serNum": 6852, "donAcc_type": "standard", "distance": 2.940, "atom1_id": "///D/116/N", "atom2_id": "///D/182/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 645, "atom1_serNum": 6562, "atom2_serNum": 6849, "donAcc_type": "standard", "distance": 3.849, "atom1_id": "///D/116/O", "atom2_id": "///D/182/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 646, "atom1_serNum": 6569, "atom2_serNum": 6842, "donAcc_type": "standard", "distance": 3.227, "atom1_id": "///D/118/N", "atom2_id": "///D/180/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 647, "atom1_serNum": 6584, "atom2_serNum": 6832, "donAcc_type": "standard", "distance": 3.842, "atom1_id": "///D/121/N", "atom2_id": "///D/178/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 648, "atom1_serNum": 6587, "atom2_serNum": 6829, "donAcc_type": "standard", "distance": 2.947, "atom1_id": "///D/121/O", "atom2_id": "///D/178/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 649, "atom1_serNum": 6617, "atom2_serNum": 6624, "donAcc_type": "standard", "distance": 3.184, "atom1_id": "///D/127/O", "atom2_id": "///D/129/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 650, "atom1_serNum": 6662, "atom2_serNum": 6669, "donAcc_type": "standard", "distance": 2.527, "atom1_id": "///D/142/O", "atom2_id": "///D/144/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 651, "atom1_serNum": 6667, "atom2_serNum": 6674, "donAcc_type": "standard", "distance": 3.380, "atom1_id": "///D/143/O", "atom2_id": "///D/145/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 652, "atom1_serNum": 6694, "atom2_serNum": 6782, "donAcc_type": "standard", "distance": 2.559, "atom1_id": "///D/151/N", "atom2_id": "///D/168/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 653, "atom1_serNum": 6697, "atom2_serNum": 6779, "donAcc_type": "standard", "distance": 2.742, "atom1_id": "///D/151/O", "atom2_id": "///D/168/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 654, "atom1_serNum": 6712, "atom2_serNum": 6764, "donAcc_type": "standard", "distance": 3.280, "atom1_id": "///D/154/O", "atom2_id": "///D/165/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 655, "atom1_serNum": 6722, "atom2_serNum": 6729, "donAcc_type": "standard", "distance": 3.209, "atom1_id": "///D/156/O", "atom2_id": "///D/158/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 656, "atom1_serNum": 6722, "atom2_serNum": 14183, "donAcc_type": "standard", "distance": 2.713, "atom1_id": "///D/156/O", "atom2_id": "///M/14/N2", "atom_pair": "O:N", "residue_pair": "aa:nt" }, { "index": 657, "atom1_serNum": 6727, "atom2_serNum": 6734, "donAcc_type": "standard", "distance": 2.731, "atom1_id": "///D/157/O", "atom2_id": "///D/159/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 658, "atom1_serNum": 6727, "atom2_serNum": 6739, "donAcc_type": "standard", "distance": 3.076, "atom1_id": "///D/157/O", "atom2_id": "///D/160/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 659, "atom1_serNum": 6757, "atom2_serNum": 15010, "donAcc_type": "acceptable", "distance": 2.365, "atom1_id": "///D/163/O", "atom2_id": "///N/28/O2'", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 660, "atom1_serNum": 6762, "atom2_serNum": 15010, "donAcc_type": "acceptable", "distance": 2.719, "atom1_id": "///D/164/O", "atom2_id": "///N/28/O2'", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 661, "atom1_serNum": 6802, "atom2_serNum": 6814, "donAcc_type": "standard", "distance": 3.491, "atom1_id": "///D/172/O", "atom2_id": "///D/175/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 662, "atom1_serNum": 6857, "atom2_serNum": 6864, "donAcc_type": "standard", "distance": 2.600, "atom1_id": "///D/183/O", "atom2_id": "///D/185/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 663, "atom1_serNum": 6862, "atom2_serNum": 6869, "donAcc_type": "standard", "distance": 2.558, "atom1_id": "///D/184/O", "atom2_id": "///D/186/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 664, "atom1_serNum": 6867, "atom2_serNum": 6874, "donAcc_type": "standard", "distance": 3.011, "atom1_id": "///D/185/O", "atom2_id": "///D/187/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 665, "atom1_serNum": 6882, "atom2_serNum": 6894, "donAcc_type": "standard", "distance": 3.675, "atom1_id": "///D/188/O", "atom2_id": "///D/191/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 666, "atom1_serNum": 6887, "atom2_serNum": 6904, "donAcc_type": "standard", "distance": 2.901, "atom1_id": "///D/189/O", "atom2_id": "///D/193/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 667, "atom1_serNum": 6897, "atom2_serNum": 6914, "donAcc_type": "standard", "distance": 2.899, "atom1_id": "///D/191/O", "atom2_id": "///D/195/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 668, "atom1_serNum": 6902, "atom2_serNum": 6919, "donAcc_type": "standard", "distance": 2.902, "atom1_id": "///D/192/O", "atom2_id": "///D/196/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 669, "atom1_serNum": 6907, "atom2_serNum": 6924, "donAcc_type": "standard", "distance": 2.882, "atom1_id": "///D/193/O", "atom2_id": "///D/197/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 670, "atom1_serNum": 6907, "atom2_serNum": 6929, "donAcc_type": "standard", "distance": 3.496, "atom1_id": "///D/193/O", "atom2_id": "///D/198/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 671, "atom1_serNum": 6917, "atom2_serNum": 6924, "donAcc_type": "standard", "distance": 2.807, "atom1_id": "///D/195/O", "atom2_id": "///D/197/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 672, "atom1_serNum": 6917, "atom2_serNum": 6929, "donAcc_type": "standard", "distance": 2.917, "atom1_id": "///D/195/O", "atom2_id": "///D/198/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 673, "atom1_serNum": 6917, "atom2_serNum": 6934, "donAcc_type": "standard", "distance": 2.971, "atom1_id": "///D/195/O", "atom2_id": "///D/199/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 674, "atom1_serNum": 6927, "atom2_serNum": 6944, "donAcc_type": "standard", "distance": 2.804, "atom1_id": "///D/197/O", "atom2_id": "///D/201/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 675, "atom1_serNum": 6932, "atom2_serNum": 6949, "donAcc_type": "standard", "distance": 2.992, "atom1_id": "///D/198/O", "atom2_id": "///D/202/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 676, "atom1_serNum": 6937, "atom2_serNum": 6954, "donAcc_type": "standard", "distance": 2.848, "atom1_id": "///D/199/O", "atom2_id": "///D/203/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 677, "atom1_serNum": 6942, "atom2_serNum": 6959, "donAcc_type": "standard", "distance": 2.906, "atom1_id": "///D/200/O", "atom2_id": "///D/204/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 678, "atom1_serNum": 6952, "atom2_serNum": 6964, "donAcc_type": "standard", "distance": 2.488, "atom1_id": "///D/202/O", "atom2_id": "///D/205/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 679, "atom1_serNum": 6952, "atom2_serNum": 6969, "donAcc_type": "standard", "distance": 3.037, "atom1_id": "///D/202/O", "atom2_id": "///D/206/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 680, "atom1_serNum": 6957, "atom2_serNum": 6969, "donAcc_type": "standard", "distance": 3.298, "atom1_id": "///D/203/O", "atom2_id": "///D/206/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 681, "atom1_serNum": 6957, "atom2_serNum": 6974, "donAcc_type": "standard", "distance": 3.500, "atom1_id": "///D/203/O", "atom2_id": "///D/207/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 682, "atom1_serNum": 6962, "atom2_serNum": 6979, "donAcc_type": "standard", "distance": 3.441, "atom1_id": "///D/204/O", "atom2_id": "///D/208/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 683, "atom1_serNum": 6987, "atom2_serNum": 6994, "donAcc_type": "standard", "distance": 2.575, "atom1_id": "///D/209/O", "atom2_id": "///D/211/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 684, "atom1_serNum": 7002, "atom2_serNum": 14079, "donAcc_type": "questionable", "distance": 3.135, "atom1_id": "///D/212/O", "atom2_id": "///M/10/O5'", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 685, "atom1_serNum": 7002, "atom2_serNum": 14098, "donAcc_type": "questionable", "distance": 2.823, "atom1_id": "///D/212/O", "atom2_id": "///M/11/OP2", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 686, "atom1_serNum": 7007, "atom2_serNum": 7014, "donAcc_type": "standard", "distance": 2.897, "atom1_id": "///D/213/O", "atom2_id": "///D/215/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 687, "atom1_serNum": 7007, "atom2_serNum": 7024, "donAcc_type": "standard", "distance": 2.969, "atom1_id": "///D/213/O", "atom2_id": "///D/217/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 688, "atom1_serNum": 7009, "atom2_serNum": 14097, "donAcc_type": "standard", "distance": 3.847, "atom1_id": "///D/214/N", "atom2_id": "///M/11/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 689, "atom1_serNum": 7012, "atom2_serNum": 7655, "donAcc_type": "standard", "distance": 3.961, "atom1_id": "///D/214/O", "atom2_id": "///E/117/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 690, "atom1_serNum": 7022, "atom2_serNum": 7029, "donAcc_type": "standard", "distance": 2.590, "atom1_id": "///D/216/O", "atom2_id": "///D/218/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 691, "atom1_serNum": 7037, "atom2_serNum": 7044, "donAcc_type": "standard", "distance": 2.694, "atom1_id": "///D/219/O", "atom2_id": "///D/221/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 692, "atom1_serNum": 7102, "atom2_serNum": 7109, "donAcc_type": "standard", "distance": 3.101, "atom1_id": "///D/232/O", "atom2_id": "///D/234/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 693, "atom1_serNum": 7117, "atom2_serNum": 7124, "donAcc_type": "standard", "distance": 2.731, "atom1_id": "///D/235/O", "atom2_id": "///D/237/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 694, "atom1_serNum": 7147, "atom2_serNum": 7154, "donAcc_type": "standard", "distance": 2.606, "atom1_id": "///D/241/O", "atom2_id": "///D/243/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 695, "atom1_serNum": 7163, "atom2_serNum": 7170, "donAcc_type": "standard", "distance": 2.761, "atom1_id": "///E/2/O", "atom2_id": "///E/4/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 696, "atom1_serNum": 7173, "atom2_serNum": 8248, "donAcc_type": "questionable", "distance": 3.215, "atom1_id": "///E/4/O", "atom2_id": "///E/243/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 697, "atom1_serNum": 7178, "atom2_serNum": 7955, "donAcc_type": "standard", "distance": 2.841, "atom1_id": "///E/5/O", "atom2_id": "///E/185/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 698, "atom1_serNum": 7180, "atom2_serNum": 8243, "donAcc_type": "standard", "distance": 2.846, "atom1_id": "///E/6/N", "atom2_id": "///E/242/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 699, "atom1_serNum": 7183, "atom2_serNum": 8240, "donAcc_type": "standard", "distance": 2.874, "atom1_id": "///E/6/O", "atom2_id": "///E/242/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 700, "atom1_serNum": 7185, "atom2_serNum": 7948, "donAcc_type": "standard", "distance": 2.945, "atom1_id": "///E/7/N", "atom2_id": "///E/183/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 701, "atom1_serNum": 7188, "atom2_serNum": 7945, "donAcc_type": "standard", "distance": 2.834, "atom1_id": "///E/7/O", "atom2_id": "///E/183/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 702, "atom1_serNum": 7190, "atom2_serNum": 8233, "donAcc_type": "standard", "distance": 2.816, "atom1_id": "///E/8/N", "atom2_id": "///E/240/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 703, "atom1_serNum": 7193, "atom2_serNum": 8230, "donAcc_type": "standard", "distance": 2.901, "atom1_id": "///E/8/O", "atom2_id": "///E/240/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 704, "atom1_serNum": 7195, "atom2_serNum": 7938, "donAcc_type": "standard", "distance": 2.885, "atom1_id": "///E/9/N", "atom2_id": "///E/181/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 705, "atom1_serNum": 7198, "atom2_serNum": 7935, "donAcc_type": "standard", "distance": 2.912, "atom1_id": "///E/9/O", "atom2_id": "///E/181/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 706, "atom1_serNum": 7200, "atom2_serNum": 8223, "donAcc_type": "standard", "distance": 2.838, "atom1_id": "///E/10/N", "atom2_id": "///E/238/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 707, "atom1_serNum": 7205, "atom2_serNum": 7928, "donAcc_type": "standard", "distance": 2.871, "atom1_id": "///E/11/N", "atom2_id": "///E/179/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 708, "atom1_serNum": 7208, "atom2_serNum": 7925, "donAcc_type": "standard", "distance": 2.940, "atom1_id": "///E/11/O", "atom2_id": "///E/179/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 709, "atom1_serNum": 7213, "atom2_serNum": 8150, "donAcc_type": "standard", "distance": 2.703, "atom1_id": "///E/12/O", "atom2_id": "///E/224/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 710, "atom1_serNum": 7215, "atom2_serNum": 7918, "donAcc_type": "standard", "distance": 2.832, "atom1_id": "///E/13/N", "atom2_id": "///E/177/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 711, "atom1_serNum": 7218, "atom2_serNum": 7915, "donAcc_type": "standard", "distance": 2.930, "atom1_id": "///E/13/O", "atom2_id": "///E/177/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 712, "atom1_serNum": 7228, "atom2_serNum": 7238, "donAcc_type": "questionable", "distance": 2.763, "atom1_id": "///E/15/O", "atom2_id": "///E/17/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 713, "atom1_serNum": 7228, "atom2_serNum": 7900, "donAcc_type": "standard", "distance": 3.108, "atom1_id": "///E/15/O", "atom2_id": "///E/174/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 714, "atom1_serNum": 7240, "atom2_serNum": 8123, "donAcc_type": "standard", "distance": 3.363, "atom1_id": "///E/18/N", "atom2_id": "///E/218/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 715, "atom1_serNum": 7248, "atom2_serNum": 8120, "donAcc_type": "standard", "distance": 3.111, "atom1_id": "///E/19/O", "atom2_id": "///E/218/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 716, "atom1_serNum": 7250, "atom2_serNum": 7888, "donAcc_type": "standard", "distance": 3.890, "atom1_id": "///E/20/N", "atom2_id": "///E/171/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 717, "atom1_serNum": 7263, "atom2_serNum": 7878, "donAcc_type": "questionable", "distance": 2.812, "atom1_id": "///E/22/O", "atom2_id": "///E/169/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 718, "atom1_serNum": 7273, "atom2_serNum": 7875, "donAcc_type": "standard", "distance": 3.386, "atom1_id": "///E/24/O", "atom2_id": "///E/169/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 719, "atom1_serNum": 7330, "atom2_serNum": 14188, "donAcc_type": "standard", "distance": 2.847, "atom1_id": "///E/52/N", "atom2_id": "///M/15/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 720, "atom1_serNum": 7333, "atom2_serNum": 14187, "donAcc_type": "questionable", "distance": 2.982, "atom1_id": "///E/52/O", "atom2_id": "///M/15/OP1", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 721, "atom1_serNum": 7343, "atom2_serNum": 7355, "donAcc_type": "standard", "distance": 2.805, "atom1_id": "///E/54/O", "atom2_id": "///E/57/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 722, "atom1_serNum": 7343, "atom2_serNum": 7360, "donAcc_type": "standard", "distance": 2.838, "atom1_id": "///E/54/O", "atom2_id": "///E/58/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 723, "atom1_serNum": 7348, "atom2_serNum": 7365, "donAcc_type": "standard", "distance": 2.902, "atom1_id": "///E/55/O", "atom2_id": "///E/59/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 724, "atom1_serNum": 7358, "atom2_serNum": 7375, "donAcc_type": "standard", "distance": 2.847, "atom1_id": "///E/57/O", "atom2_id": "///E/61/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 725, "atom1_serNum": 7363, "atom2_serNum": 7380, "donAcc_type": "standard", "distance": 2.827, "atom1_id": "///E/58/O", "atom2_id": "///E/62/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 726, "atom1_serNum": 7388, "atom2_serNum": 8256, "donAcc_type": "standard", "distance": 3.096, "atom1_id": "///E/63/O", "atom2_id": "///F/3/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 727, "atom1_serNum": 7403, "atom2_serNum": 7410, "donAcc_type": "standard", "distance": 3.115, "atom1_id": "///E/66/O", "atom2_id": "///E/68/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 728, "atom1_serNum": 7418, "atom2_serNum": 7430, "donAcc_type": "standard", "distance": 3.445, "atom1_id": "///E/69/O", "atom2_id": "///E/72/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 729, "atom1_serNum": 7453, "atom2_serNum": 15073, "donAcc_type": "acceptable", "distance": 3.050, "atom1_id": "///E/76/O", "atom2_id": "///N/31/O2'", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 730, "atom1_serNum": 7468, "atom2_serNum": 7475, "donAcc_type": "standard", "distance": 2.516, "atom1_id": "///E/79/O", "atom2_id": "///E/81/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 731, "atom1_serNum": 7478, "atom2_serNum": 7485, "donAcc_type": "standard", "distance": 3.055, "atom1_id": "///E/81/O", "atom2_id": "///E/83/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 732, "atom1_serNum": 7483, "atom2_serNum": 7490, "donAcc_type": "standard", "distance": 2.779, "atom1_id": "///E/82/O", "atom2_id": "///E/84/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 733, "atom1_serNum": 7503, "atom2_serNum": 7510, "donAcc_type": "standard", "distance": 3.041, "atom1_id": "///E/86/O", "atom2_id": "///E/88/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 734, "atom1_serNum": 7508, "atom2_serNum": 7520, "donAcc_type": "standard", "distance": 2.715, "atom1_id": "///E/87/O", "atom2_id": "///E/90/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 735, "atom1_serNum": 7508, "atom2_serNum": 7525, "donAcc_type": "standard", "distance": 2.943, "atom1_id": "///E/87/O", "atom2_id": "///E/91/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 736, "atom1_serNum": 7513, "atom2_serNum": 7530, "donAcc_type": "standard", "distance": 2.944, "atom1_id": "///E/88/O", "atom2_id": "///E/92/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 737, "atom1_serNum": 7513, "atom2_serNum": 7535, "donAcc_type": "standard", "distance": 3.800, "atom1_id": "///E/88/O", "atom2_id": "///E/93/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 738, "atom1_serNum": 7528, "atom2_serNum": 7543, "donAcc_type": "questionable", "distance": 2.946, "atom1_id": "///E/91/O", "atom2_id": "///E/94/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 739, "atom1_serNum": 7528, "atom2_serNum": 7640, "donAcc_type": "standard", "distance": 3.543, "atom1_id": "///E/91/O", "atom2_id": "///E/114/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 740, "atom1_serNum": 7533, "atom2_serNum": 7540, "donAcc_type": "standard", "distance": 2.789, "atom1_id": "///E/92/O", "atom2_id": "///E/94/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 741, "atom1_serNum": 7550, "atom2_serNum": 7623, "donAcc_type": "standard", "distance": 3.140, "atom1_id": "///E/96/N", "atom2_id": "///E/110/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 742, "atom1_serNum": 7553, "atom2_serNum": 14106, "donAcc_type": "acceptable", "distance": 2.929, "atom1_id": "///E/96/O", "atom2_id": "///M/11/O2'", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 743, "atom1_serNum": 7568, "atom2_serNum": 15113, "donAcc_type": "acceptable", "distance": 3.183, "atom1_id": "///E/99/O", "atom2_id": "///N/33/O2'", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 744, "atom1_serNum": 7583, "atom2_serNum": 7590, "donAcc_type": "standard", "distance": 2.729, "atom1_id": "///E/102/O", "atom2_id": "///E/104/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 745, "atom1_serNum": 7583, "atom2_serNum": 7595, "donAcc_type": "standard", "distance": 3.273, "atom1_id": "///E/102/O", "atom2_id": "///E/105/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 746, "atom1_serNum": 7588, "atom2_serNum": 7605, "donAcc_type": "standard", "distance": 2.919, "atom1_id": "///E/103/O", "atom2_id": "///E/107/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 747, "atom1_serNum": 7598, "atom2_serNum": 7615, "donAcc_type": "standard", "distance": 2.827, "atom1_id": "///E/105/O", "atom2_id": "///E/109/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 748, "atom1_serNum": 7598, "atom2_serNum": 7620, "donAcc_type": "standard", "distance": 3.153, "atom1_id": "///E/105/O", "atom2_id": "///E/110/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 749, "atom1_serNum": 7603, "atom2_serNum": 7610, "donAcc_type": "standard", "distance": 2.585, "atom1_id": "///E/106/O", "atom2_id": "///E/108/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 750, "atom1_serNum": 7633, "atom2_serNum": 7640, "donAcc_type": "standard", "distance": 2.924, "atom1_id": "///E/112/O", "atom2_id": "///E/114/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 751, "atom1_serNum": 7638, "atom2_serNum": 7645, "donAcc_type": "standard", "distance": 2.944, "atom1_id": "///E/113/O", "atom2_id": "///E/115/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 752, "atom1_serNum": 7643, "atom2_serNum": 7950, "donAcc_type": "standard", "distance": 2.758, "atom1_id": "///E/114/O", "atom2_id": "///E/184/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 753, "atom1_serNum": 7650, "atom2_serNum": 7943, "donAcc_type": "standard", "distance": 2.858, "atom1_id": "///E/116/N", "atom2_id": "///E/182/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 754, "atom1_serNum": 7653, "atom2_serNum": 7940, "donAcc_type": "standard", "distance": 2.900, "atom1_id": "///E/116/O", "atom2_id": "///E/182/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 755, "atom1_serNum": 7660, "atom2_serNum": 7933, "donAcc_type": "standard", "distance": 3.074, "atom1_id": "///E/118/N", "atom2_id": "///E/180/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 756, "atom1_serNum": 7675, "atom2_serNum": 7923, "donAcc_type": "standard", "distance": 3.542, "atom1_id": "///E/121/N", "atom2_id": "///E/178/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 757, "atom1_serNum": 7678, "atom2_serNum": 7920, "donAcc_type": "standard", "distance": 2.890, "atom1_id": "///E/121/O", "atom2_id": "///E/178/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 758, "atom1_serNum": 7685, "atom2_serNum": 7913, "donAcc_type": "standard", "distance": 3.314, "atom1_id": "///E/123/N", "atom2_id": "///E/176/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 759, "atom1_serNum": 7693, "atom2_serNum": 7700, "donAcc_type": "standard", "distance": 2.618, "atom1_id": "///E/124/O", "atom2_id": "///E/126/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 760, "atom1_serNum": 7718, "atom2_serNum": 7725, "donAcc_type": "standard", "distance": 2.697, "atom1_id": "///E/129/O", "atom2_id": "///E/131/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 761, "atom1_serNum": 7733, "atom2_serNum": 7760, "donAcc_type": "standard", "distance": 2.985, "atom1_id": "///E/132/O", "atom2_id": "///E/144/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 762, "atom1_serNum": 7753, "atom2_serNum": 7760, "donAcc_type": "standard", "distance": 2.933, "atom1_id": "///E/142/O", "atom2_id": "///E/144/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 763, "atom1_serNum": 7785, "atom2_serNum": 7873, "donAcc_type": "standard", "distance": 3.419, "atom1_id": "///E/151/N", "atom2_id": "///E/168/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 764, "atom1_serNum": 7788, "atom2_serNum": 7865, "donAcc_type": "standard", "distance": 3.553, "atom1_id": "///E/151/O", "atom2_id": "///E/167/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 765, "atom1_serNum": 7788, "atom2_serNum": 7870, "donAcc_type": "standard", "distance": 3.475, "atom1_id": "///E/151/O", "atom2_id": "///E/168/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 766, "atom1_serNum": 7813, "atom2_serNum": 14290, "donAcc_type": "questionable", "distance": 2.964, "atom1_id": "///E/156/O", "atom2_id": "///M/20/OP1", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 767, "atom1_serNum": 7833, "atom2_serNum": 7840, "donAcc_type": "standard", "distance": 3.348, "atom1_id": "///E/160/O", "atom2_id": "///E/162/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 768, "atom1_serNum": 7853, "atom2_serNum": 14881, "donAcc_type": "acceptable", "distance": 2.927, "atom1_id": "///E/164/O", "atom2_id": "///N/22/O2'", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 769, "atom1_serNum": 7873, "atom2_serNum": 7880, "donAcc_type": "standard", "distance": 3.114, "atom1_id": "///E/168/O", "atom2_id": "///E/170/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 770, "atom1_serNum": 7893, "atom2_serNum": 7905, "donAcc_type": "standard", "distance": 3.963, "atom1_id": "///E/172/O", "atom2_id": "///E/175/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 771, "atom1_serNum": 7908, "atom2_serNum": 7915, "donAcc_type": "standard", "distance": 3.184, "atom1_id": "///E/175/O", "atom2_id": "///E/177/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 772, "atom1_serNum": 7953, "atom2_serNum": 7960, "donAcc_type": "standard", "distance": 2.862, "atom1_id": "///E/184/O", "atom2_id": "///E/186/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 773, "atom1_serNum": 7968, "atom2_serNum": 7985, "donAcc_type": "standard", "distance": 2.908, "atom1_id": "///E/187/O", "atom2_id": "///E/191/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 774, "atom1_serNum": 7973, "atom2_serNum": 7985, "donAcc_type": "standard", "distance": 2.944, "atom1_id": "///E/188/O", "atom2_id": "///E/191/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 775, "atom1_serNum": 7973, "atom2_serNum": 7990, "donAcc_type": "standard", "distance": 2.973, "atom1_id": "///E/188/O", "atom2_id": "///E/192/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 776, "atom1_serNum": 7978, "atom2_serNum": 7995, "donAcc_type": "standard", "distance": 2.890, "atom1_id": "///E/189/O", "atom2_id": "///E/193/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 777, "atom1_serNum": 7988, "atom2_serNum": 8000, "donAcc_type": "standard", "distance": 3.382, "atom1_id": "///E/191/O", "atom2_id": "///E/194/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 778, "atom1_serNum": 7988, "atom2_serNum": 8005, "donAcc_type": "standard", "distance": 2.900, "atom1_id": "///E/191/O", "atom2_id": "///E/195/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 779, "atom1_serNum": 7993, "atom2_serNum": 8005, "donAcc_type": "standard", "distance": 3.139, "atom1_id": "///E/192/O", "atom2_id": "///E/195/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 780, "atom1_serNum": 7993, "atom2_serNum": 8010, "donAcc_type": "standard", "distance": 3.053, "atom1_id": "///E/192/O", "atom2_id": "///E/196/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 781, "atom1_serNum": 8013, "atom2_serNum": 8030, "donAcc_type": "standard", "distance": 3.817, "atom1_id": "///E/196/O", "atom2_id": "///E/200/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 782, "atom1_serNum": 8018, "atom2_serNum": 8035, "donAcc_type": "standard", "distance": 2.808, "atom1_id": "///E/197/O", "atom2_id": "///E/201/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 783, "atom1_serNum": 8023, "atom2_serNum": 8040, "donAcc_type": "standard", "distance": 2.911, "atom1_id": "///E/198/O", "atom2_id": "///E/202/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 784, "atom1_serNum": 8028, "atom2_serNum": 8045, "donAcc_type": "standard", "distance": 2.967, "atom1_id": "///E/199/O", "atom2_id": "///E/203/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 785, "atom1_serNum": 8033, "atom2_serNum": 8050, "donAcc_type": "standard", "distance": 2.877, "atom1_id": "///E/200/O", "atom2_id": "///E/204/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 786, "atom1_serNum": 8043, "atom2_serNum": 8055, "donAcc_type": "standard", "distance": 2.814, "atom1_id": "///E/202/O", "atom2_id": "///E/205/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 787, "atom1_serNum": 8043, "atom2_serNum": 8060, "donAcc_type": "standard", "distance": 3.013, "atom1_id": "///E/202/O", "atom2_id": "///E/206/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 788, "atom1_serNum": 8090, "atom2_serNum": 14207, "donAcc_type": "standard", "distance": 3.278, "atom1_id": "///E/212/N", "atom2_id": "///M/16/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 789, "atom1_serNum": 8093, "atom2_serNum": 8100, "donAcc_type": "standard", "distance": 3.164, "atom1_id": "///E/212/O", "atom2_id": "///E/214/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 790, "atom1_serNum": 8093, "atom2_serNum": 14230, "donAcc_type": "questionable", "distance": 2.786, "atom1_id": "///E/212/O", "atom2_id": "///M/17/OP1", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 791, "atom1_serNum": 8098, "atom2_serNum": 8115, "donAcc_type": "standard", "distance": 3.274, "atom1_id": "///E/213/O", "atom2_id": "///E/217/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 792, "atom1_serNum": 8098, "atom2_serNum": 8118, "donAcc_type": "questionable", "distance": 3.008, "atom1_id": "///E/213/O", "atom2_id": "///E/217/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 793, "atom1_serNum": 8110, "atom2_serNum": 8749, "donAcc_type": "standard", "distance": 3.309, "atom1_id": "///E/216/N", "atom2_id": "///F/117/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 794, "atom1_serNum": 8128, "atom2_serNum": 8135, "donAcc_type": "standard", "distance": 2.555, "atom1_id": "///E/219/O", "atom2_id": "///E/221/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 795, "atom1_serNum": 8158, "atom2_serNum": 8213, "donAcc_type": "questionable", "distance": 2.876, "atom1_id": "///E/225/O", "atom2_id": "///E/236/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 796, "atom1_serNum": 8208, "atom2_serNum": 8215, "donAcc_type": "standard", "distance": 3.047, "atom1_id": "///E/235/O", "atom2_id": "///E/237/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 797, "atom1_serNum": 8218, "atom2_serNum": 8225, "donAcc_type": "standard", "distance": 3.198, "atom1_id": "///E/237/O", "atom2_id": "///E/239/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 798, "atom1_serNum": 8254, "atom2_serNum": 8261, "donAcc_type": "standard", "distance": 2.696, "atom1_id": "///F/2/O", "atom2_id": "///F/4/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 799, "atom1_serNum": 8254, "atom2_serNum": 9044, "donAcc_type": "questionable", "distance": 3.255, "atom1_id": "///F/2/O", "atom2_id": "///F/186/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 800, "atom1_serNum": 8261, "atom2_serNum": 9039, "donAcc_type": "standard", "distance": 3.218, "atom1_id": "///F/4/N", "atom2_id": "///F/185/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 801, "atom1_serNum": 8266, "atom2_serNum": 9039, "donAcc_type": "standard", "distance": 3.044, "atom1_id": "///F/5/N", "atom2_id": "///F/185/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 802, "atom1_serNum": 8269, "atom2_serNum": 9036, "donAcc_type": "standard", "distance": 2.725, "atom1_id": "///F/5/O", "atom2_id": "///F/185/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 803, "atom1_serNum": 8271, "atom2_serNum": 9324, "donAcc_type": "standard", "distance": 2.944, "atom1_id": "///F/6/N", "atom2_id": "///F/242/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 804, "atom1_serNum": 8274, "atom2_serNum": 9321, "donAcc_type": "standard", "distance": 2.866, "atom1_id": "///F/6/O", "atom2_id": "///F/242/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 805, "atom1_serNum": 8276, "atom2_serNum": 9029, "donAcc_type": "standard", "distance": 2.902, "atom1_id": "///F/7/N", "atom2_id": "///F/183/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 806, "atom1_serNum": 8279, "atom2_serNum": 9026, "donAcc_type": "standard", "distance": 2.811, "atom1_id": "///F/7/O", "atom2_id": "///F/183/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 807, "atom1_serNum": 8281, "atom2_serNum": 9314, "donAcc_type": "standard", "distance": 2.787, "atom1_id": "///F/8/N", "atom2_id": "///F/240/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 808, "atom1_serNum": 8284, "atom2_serNum": 9304, "donAcc_type": "questionable", "distance": 2.906, "atom1_id": "///F/8/O", "atom2_id": "///F/238/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 809, "atom1_serNum": 8284, "atom2_serNum": 9311, "donAcc_type": "standard", "distance": 2.926, "atom1_id": "///F/8/O", "atom2_id": "///F/240/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 810, "atom1_serNum": 8286, "atom2_serNum": 9019, "donAcc_type": "standard", "distance": 2.834, "atom1_id": "///F/9/N", "atom2_id": "///F/181/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 811, "atom1_serNum": 8289, "atom2_serNum": 9016, "donAcc_type": "standard", "distance": 2.909, "atom1_id": "///F/9/O", "atom2_id": "///F/181/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 812, "atom1_serNum": 8296, "atom2_serNum": 9009, "donAcc_type": "standard", "distance": 2.960, "atom1_id": "///F/11/N", "atom2_id": "///F/179/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 813, "atom1_serNum": 8299, "atom2_serNum": 9006, "donAcc_type": "standard", "distance": 2.904, "atom1_id": "///F/11/O", "atom2_id": "///F/179/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 814, "atom1_serNum": 8299, "atom2_serNum": 9009, "donAcc_type": "questionable", "distance": 2.812, "atom1_id": "///F/11/O", "atom2_id": "///F/179/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 815, "atom1_serNum": 8304, "atom2_serNum": 8311, "donAcc_type": "standard", "distance": 3.267, "atom1_id": "///F/12/O", "atom2_id": "///F/14/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 816, "atom1_serNum": 8306, "atom2_serNum": 8999, "donAcc_type": "standard", "distance": 2.882, "atom1_id": "///F/13/N", "atom2_id": "///F/177/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 817, "atom1_serNum": 8309, "atom2_serNum": 8996, "donAcc_type": "standard", "distance": 2.917, "atom1_id": "///F/13/O", "atom2_id": "///F/177/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 818, "atom1_serNum": 8314, "atom2_serNum": 8321, "donAcc_type": "standard", "distance": 3.024, "atom1_id": "///F/14/O", "atom2_id": "///F/16/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 819, "atom1_serNum": 8314, "atom2_serNum": 9214, "donAcc_type": "questionable", "distance": 2.841, "atom1_id": "///F/14/O", "atom2_id": "///F/220/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 820, "atom1_serNum": 8316, "atom2_serNum": 8989, "donAcc_type": "standard", "distance": 2.733, "atom1_id": "///F/15/N", "atom2_id": "///F/175/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 821, "atom1_serNum": 8319, "atom2_serNum": 8329, "donAcc_type": "questionable", "distance": 2.959, "atom1_id": "///F/15/O", "atom2_id": "///F/17/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 822, "atom1_serNum": 8319, "atom2_serNum": 8981, "donAcc_type": "standard", "distance": 2.592, "atom1_id": "///F/15/O", "atom2_id": "///F/174/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 823, "atom1_serNum": 8334, "atom2_serNum": 9204, "donAcc_type": "questionable", "distance": 2.752, "atom1_id": "///F/18/O", "atom2_id": "///F/218/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 824, "atom1_serNum": 8336, "atom2_serNum": 8969, "donAcc_type": "standard", "distance": 3.399, "atom1_id": "///F/19/N", "atom2_id": "///F/171/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 825, "atom1_serNum": 8344, "atom2_serNum": 8966, "donAcc_type": "standard", "distance": 3.499, "atom1_id": "///F/20/O", "atom2_id": "///F/171/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 826, "atom1_serNum": 8351, "atom2_serNum": 8959, "donAcc_type": "standard", "distance": 3.272, "atom1_id": "///F/22/N", "atom2_id": "///F/169/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 827, "atom1_serNum": 8354, "atom2_serNum": 8956, "donAcc_type": "standard", "distance": 2.634, "atom1_id": "///F/22/O", "atom2_id": "///F/169/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 828, "atom1_serNum": 8359, "atom2_serNum": 14802, "donAcc_type": "questionable", "distance": 3.220, "atom1_id": "///F/23/O", "atom2_id": "///N/18/N7", "atom_pair": "O:N", "residue_pair": "aa:nt" }, { "index": 829, "atom1_serNum": 8414, "atom2_serNum": 14322, "donAcc_type": "acceptable", "distance": 2.433, "atom1_id": "///F/34/O", "atom2_id": "///M/21/O2'", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 830, "atom1_serNum": 8421, "atom2_serNum": 14314, "donAcc_type": "standard", "distance": 3.196, "atom1_id": "///F/52/N", "atom2_id": "///M/21/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 831, "atom1_serNum": 8429, "atom2_serNum": 8441, "donAcc_type": "standard", "distance": 2.835, "atom1_id": "///F/53/O", "atom2_id": "///F/56/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 832, "atom1_serNum": 8429, "atom2_serNum": 8446, "donAcc_type": "standard", "distance": 3.019, "atom1_id": "///F/53/O", "atom2_id": "///F/57/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 833, "atom1_serNum": 8439, "atom2_serNum": 14291, "donAcc_type": "questionable", "distance": 2.996, "atom1_id": "///F/55/O", "atom2_id": "///M/20/OP2", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 834, "atom1_serNum": 8444, "atom2_serNum": 8456, "donAcc_type": "standard", "distance": 3.118, "atom1_id": "///F/56/O", "atom2_id": "///F/59/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 835, "atom1_serNum": 8444, "atom2_serNum": 8461, "donAcc_type": "standard", "distance": 2.978, "atom1_id": "///F/56/O", "atom2_id": "///F/60/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 836, "atom1_serNum": 8449, "atom2_serNum": 8461, "donAcc_type": "standard", "distance": 3.145, "atom1_id": "///F/57/O", "atom2_id": "///F/60/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 837, "atom1_serNum": 8449, "atom2_serNum": 8466, "donAcc_type": "standard", "distance": 2.880, "atom1_id": "///F/57/O", "atom2_id": "///F/61/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 838, "atom1_serNum": 8464, "atom2_serNum": 8476, "donAcc_type": "standard", "distance": 3.106, "atom1_id": "///F/60/O", "atom2_id": "///F/63/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 839, "atom1_serNum": 8464, "atom2_serNum": 8481, "donAcc_type": "standard", "distance": 2.862, "atom1_id": "///F/60/O", "atom2_id": "///F/64/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 840, "atom1_serNum": 8484, "atom2_serNum": 8491, "donAcc_type": "standard", "distance": 2.676, "atom1_id": "///F/64/O", "atom2_id": "///F/66/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 841, "atom1_serNum": 8494, "atom2_serNum": 8501, "donAcc_type": "standard", "distance": 2.755, "atom1_id": "///F/66/O", "atom2_id": "///F/68/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 842, "atom1_serNum": 8559, "atom2_serNum": 8566, "donAcc_type": "standard", "distance": 2.629, "atom1_id": "///F/79/O", "atom2_id": "///F/81/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 843, "atom1_serNum": 8569, "atom2_serNum": 8576, "donAcc_type": "standard", "distance": 3.223, "atom1_id": "///F/81/O", "atom2_id": "///F/83/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 844, "atom1_serNum": 8574, "atom2_serNum": 8581, "donAcc_type": "standard", "distance": 2.688, "atom1_id": "///F/82/O", "atom2_id": "///F/84/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 845, "atom1_serNum": 8584, "atom2_serNum": 8591, "donAcc_type": "standard", "distance": 2.832, "atom1_id": "///F/84/O", "atom2_id": "///F/86/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 846, "atom1_serNum": 8584, "atom2_serNum": 8596, "donAcc_type": "standard", "distance": 3.086, "atom1_id": "///F/84/O", "atom2_id": "///F/87/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 847, "atom1_serNum": 8604, "atom2_serNum": 8621, "donAcc_type": "standard", "distance": 2.969, "atom1_id": "///F/88/O", "atom2_id": "///F/92/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 848, "atom1_serNum": 8609, "atom2_serNum": 8626, "donAcc_type": "standard", "distance": 3.305, "atom1_id": "///F/89/O", "atom2_id": "///F/93/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 849, "atom1_serNum": 8624, "atom2_serNum": 8736, "donAcc_type": "standard", "distance": 3.493, "atom1_id": "///F/92/O", "atom2_id": "///F/115/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 850, "atom1_serNum": 8644, "atom2_serNum": 14239, "donAcc_type": "acceptable", "distance": 2.847, "atom1_id": "///F/96/O", "atom2_id": "///M/17/O2'", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 851, "atom1_serNum": 8674, "atom2_serNum": 8691, "donAcc_type": "standard", "distance": 2.956, "atom1_id": "///F/102/O", "atom2_id": "///F/106/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 852, "atom1_serNum": 8679, "atom2_serNum": 8696, "donAcc_type": "standard", "distance": 2.837, "atom1_id": "///F/103/O", "atom2_id": "///F/107/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 853, "atom1_serNum": 8684, "atom2_serNum": 8701, "donAcc_type": "standard", "distance": 2.494, "atom1_id": "///F/104/O", "atom2_id": "///F/108/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 854, "atom1_serNum": 8689, "atom2_serNum": 8711, "donAcc_type": "standard", "distance": 3.868, "atom1_id": "///F/105/O", "atom2_id": "///F/110/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 855, "atom1_serNum": 8694, "atom2_serNum": 8711, "donAcc_type": "standard", "distance": 3.501, "atom1_id": "///F/106/O", "atom2_id": "///F/110/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 856, "atom1_serNum": 8724, "atom2_serNum": 8731, "donAcc_type": "standard", "distance": 2.763, "atom1_id": "///F/112/O", "atom2_id": "///F/114/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 857, "atom1_serNum": 8734, "atom2_serNum": 8741, "donAcc_type": "standard", "distance": 2.817, "atom1_id": "///F/114/O", "atom2_id": "///F/116/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 858, "atom1_serNum": 8734, "atom2_serNum": 9024, "donAcc_type": "questionable", "distance": 2.775, "atom1_id": "///F/114/O", "atom2_id": "///F/182/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 859, "atom1_serNum": 8734, "atom2_serNum": 9031, "donAcc_type": "standard", "distance": 3.377, "atom1_id": "///F/114/O", "atom2_id": "///F/184/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 860, "atom1_serNum": 8741, "atom2_serNum": 9024, "donAcc_type": "standard", "distance": 2.930, "atom1_id": "///F/116/N", "atom2_id": "///F/182/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 861, "atom1_serNum": 8744, "atom2_serNum": 9021, "donAcc_type": "standard", "distance": 2.841, "atom1_id": "///F/116/O", "atom2_id": "///F/182/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 862, "atom1_serNum": 8751, "atom2_serNum": 9014, "donAcc_type": "standard", "distance": 2.963, "atom1_id": "///F/118/N", "atom2_id": "///F/180/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 863, "atom1_serNum": 8769, "atom2_serNum": 9001, "donAcc_type": "standard", "distance": 3.001, "atom1_id": "///F/121/O", "atom2_id": "///F/178/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 864, "atom1_serNum": 8776, "atom2_serNum": 8994, "donAcc_type": "standard", "distance": 2.736, "atom1_id": "///F/123/N", "atom2_id": "///F/176/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 865, "atom1_serNum": 8809, "atom2_serNum": 8816, "donAcc_type": "standard", "distance": 2.786, "atom1_id": "///F/129/O", "atom2_id": "///F/131/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 866, "atom1_serNum": 8819, "atom2_serNum": 8834, "donAcc_type": "questionable", "distance": 2.923, "atom1_id": "///F/131/O", "atom2_id": "///F/142/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 867, "atom1_serNum": 8844, "atom2_serNum": 9845, "donAcc_type": "questionable", "distance": 2.825, "atom1_id": "///F/144/O", "atom2_id": "///G/120/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 868, "atom1_serNum": 8854, "atom2_serNum": 9502, "donAcc_type": "standard", "distance": 2.758, "atom1_id": "///F/146/O", "atom2_id": "///G/52/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 869, "atom1_serNum": 8856, "atom2_serNum": 8964, "donAcc_type": "standard", "distance": 2.789, "atom1_id": "///F/149/N", "atom2_id": "///F/170/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 870, "atom1_serNum": 8859, "atom2_serNum": 8961, "donAcc_type": "standard", "distance": 3.005, "atom1_id": "///F/149/O", "atom2_id": "///F/170/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 871, "atom1_serNum": 8866, "atom2_serNum": 8954, "donAcc_type": "standard", "distance": 2.891, "atom1_id": "///F/151/N", "atom2_id": "///F/168/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 872, "atom1_serNum": 8869, "atom2_serNum": 8951, "donAcc_type": "standard", "distance": 2.649, "atom1_id": "///F/151/O", "atom2_id": "///F/168/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 873, "atom1_serNum": 8884, "atom2_serNum": 8936, "donAcc_type": "standard", "distance": 3.073, "atom1_id": "///F/154/O", "atom2_id": "///F/165/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 874, "atom1_serNum": 8886, "atom2_serNum": 14413, "donAcc_type": "acceptable", "distance": 3.602, "atom1_id": "///F/155/N", "atom2_id": "///M/25/O2'", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 875, "atom1_serNum": 8894, "atom2_serNum": 8924, "donAcc_type": "questionable", "distance": 3.054, "atom1_id": "///F/156/O", "atom2_id": "///F/162/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 876, "atom1_serNum": 8899, "atom2_serNum": 14443, "donAcc_type": "standard", "distance": 3.246, "atom1_id": "///F/157/O", "atom2_id": "///M/26/N2", "atom_pair": "O:N", "residue_pair": "aa:nt" }, { "index": 877, "atom1_serNum": 8909, "atom2_serNum": 8916, "donAcc_type": "standard", "distance": 2.795, "atom1_id": "///F/159/O", "atom2_id": "///F/161/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 878, "atom1_serNum": 8929, "atom2_serNum": 8936, "donAcc_type": "standard", "distance": 3.160, "atom1_id": "///F/163/O", "atom2_id": "///F/165/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 879, "atom1_serNum": 8934, "atom2_serNum": 14758, "donAcc_type": "acceptable", "distance": 3.085, "atom1_id": "///F/164/O", "atom2_id": "///N/16/O2'", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 880, "atom1_serNum": 8999, "atom2_serNum": 9006, "donAcc_type": "standard", "distance": 3.456, "atom1_id": "///F/177/O", "atom2_id": "///F/179/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 881, "atom1_serNum": 9034, "atom2_serNum": 9041, "donAcc_type": "standard", "distance": 2.886, "atom1_id": "///F/184/O", "atom2_id": "///F/186/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 882, "atom1_serNum": 9059, "atom2_serNum": 9071, "donAcc_type": "standard", "distance": 3.122, "atom1_id": "///F/189/O", "atom2_id": "///F/192/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 883, "atom1_serNum": 9059, "atom2_serNum": 9076, "donAcc_type": "standard", "distance": 2.844, "atom1_id": "///F/189/O", "atom2_id": "///F/193/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 884, "atom1_serNum": 9064, "atom2_serNum": 9081, "donAcc_type": "standard", "distance": 2.868, "atom1_id": "///F/190/O", "atom2_id": "///F/194/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 885, "atom1_serNum": 9079, "atom2_serNum": 9096, "donAcc_type": "standard", "distance": 2.864, "atom1_id": "///F/193/O", "atom2_id": "///F/197/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 886, "atom1_serNum": 9084, "atom2_serNum": 9101, "donAcc_type": "standard", "distance": 2.884, "atom1_id": "///F/194/O", "atom2_id": "///F/198/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 887, "atom1_serNum": 9084, "atom2_serNum": 9106, "donAcc_type": "standard", "distance": 3.296, "atom1_id": "///F/194/O", "atom2_id": "///F/199/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 888, "atom1_serNum": 9104, "atom2_serNum": 9121, "donAcc_type": "standard", "distance": 2.821, "atom1_id": "///F/198/O", "atom2_id": "///F/202/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 889, "atom1_serNum": 9124, "atom2_serNum": 9141, "donAcc_type": "standard", "distance": 2.907, "atom1_id": "///F/202/O", "atom2_id": "///F/206/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 890, "atom1_serNum": 9134, "atom2_serNum": 9146, "donAcc_type": "standard", "distance": 2.726, "atom1_id": "///F/204/O", "atom2_id": "///F/207/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 891, "atom1_serNum": 9159, "atom2_serNum": 14309, "donAcc_type": "standard", "distance": 2.577, "atom1_id": "///F/209/O", "atom2_id": "///M/20/N2", "atom_pair": "O:N", "residue_pair": "aa:nt" }, { "index": 892, "atom1_serNum": 9184, "atom2_serNum": 9827, "donAcc_type": "standard", "distance": 3.377, "atom1_id": "///F/214/O", "atom2_id": "///G/117/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 893, "atom1_serNum": 9194, "atom2_serNum": 9201, "donAcc_type": "standard", "distance": 2.844, "atom1_id": "///F/216/O", "atom2_id": "///F/218/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 894, "atom1_serNum": 9274, "atom2_serNum": 9281, "donAcc_type": "standard", "distance": 2.674, "atom1_id": "///F/232/O", "atom2_id": "///F/234/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 895, "atom1_serNum": 9304, "atom2_serNum": 9311, "donAcc_type": "standard", "distance": 2.872, "atom1_id": "///F/238/O", "atom2_id": "///F/240/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 896, "atom1_serNum": 9335, "atom2_serNum": 9342, "donAcc_type": "standard", "distance": 2.773, "atom1_id": "///G/2/O", "atom2_id": "///G/4/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 897, "atom1_serNum": 9335, "atom2_serNum": 10095, "donAcc_type": "questionable", "distance": 3.238, "atom1_id": "///G/2/O", "atom2_id": "///G/186/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 898, "atom1_serNum": 9342, "atom2_serNum": 10090, "donAcc_type": "standard", "distance": 3.204, "atom1_id": "///G/4/N", "atom2_id": "///G/185/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 899, "atom1_serNum": 9347, "atom2_serNum": 10090, "donAcc_type": "standard", "distance": 3.551, "atom1_id": "///G/5/N", "atom2_id": "///G/185/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 900, "atom1_serNum": 9350, "atom2_serNum": 10087, "donAcc_type": "standard", "distance": 2.948, "atom1_id": "///G/5/O", "atom2_id": "///G/185/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 901, "atom1_serNum": 9352, "atom2_serNum": 10375, "donAcc_type": "standard", "distance": 2.882, "atom1_id": "///G/6/N", "atom2_id": "///G/242/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 902, "atom1_serNum": 9355, "atom2_serNum": 9362, "donAcc_type": "standard", "distance": 2.828, "atom1_id": "///G/6/O", "atom2_id": "///G/8/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 903, "atom1_serNum": 9357, "atom2_serNum": 10080, "donAcc_type": "standard", "distance": 3.560, "atom1_id": "///G/7/N", "atom2_id": "///G/183/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 904, "atom1_serNum": 9360, "atom2_serNum": 9367, "donAcc_type": "standard", "distance": 2.692, "atom1_id": "///G/7/O", "atom2_id": "///G/9/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 905, "atom1_serNum": 9362, "atom2_serNum": 10365, "donAcc_type": "standard", "distance": 2.889, "atom1_id": "///G/8/N", "atom2_id": "///G/240/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 906, "atom1_serNum": 9365, "atom2_serNum": 9372, "donAcc_type": "standard", "distance": 2.648, "atom1_id": "///G/8/O", "atom2_id": "///G/10/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 907, "atom1_serNum": 9372, "atom2_serNum": 10355, "donAcc_type": "standard", "distance": 3.150, "atom1_id": "///G/10/N", "atom2_id": "///G/238/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 908, "atom1_serNum": 9375, "atom2_serNum": 10352, "donAcc_type": "standard", "distance": 3.246, "atom1_id": "///G/10/O", "atom2_id": "///G/238/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 909, "atom1_serNum": 9375, "atom2_serNum": 10355, "donAcc_type": "questionable", "distance": 2.879, "atom1_id": "///G/10/O", "atom2_id": "///G/238/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 910, "atom1_serNum": 9377, "atom2_serNum": 10060, "donAcc_type": "standard", "distance": 2.953, "atom1_id": "///G/11/N", "atom2_id": "///G/179/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 911, "atom1_serNum": 9380, "atom2_serNum": 10057, "donAcc_type": "standard", "distance": 2.864, "atom1_id": "///G/11/O", "atom2_id": "///G/179/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 912, "atom1_serNum": 9380, "atom2_serNum": 10060, "donAcc_type": "questionable", "distance": 2.844, "atom1_id": "///G/11/O", "atom2_id": "///G/179/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 913, "atom1_serNum": 9387, "atom2_serNum": 10050, "donAcc_type": "standard", "distance": 2.911, "atom1_id": "///G/13/N", "atom2_id": "///G/177/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 914, "atom1_serNum": 9390, "atom2_serNum": 10047, "donAcc_type": "standard", "distance": 2.941, "atom1_id": "///G/13/O", "atom2_id": "///G/177/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 915, "atom1_serNum": 9395, "atom2_serNum": 10265, "donAcc_type": "questionable", "distance": 2.775, "atom1_id": "///G/14/O", "atom2_id": "///G/220/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 916, "atom1_serNum": 9395, "atom2_serNum": 10272, "donAcc_type": "standard", "distance": 3.243, "atom1_id": "///G/14/O", "atom2_id": "///G/222/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 917, "atom1_serNum": 9397, "atom2_serNum": 10040, "donAcc_type": "standard", "distance": 2.732, "atom1_id": "///G/15/N", "atom2_id": "///G/175/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 918, "atom1_serNum": 9400, "atom2_serNum": 10032, "donAcc_type": "standard", "distance": 2.897, "atom1_id": "///G/15/O", "atom2_id": "///G/174/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 919, "atom1_serNum": 9402, "atom2_serNum": 10265, "donAcc_type": "standard", "distance": 3.685, "atom1_id": "///G/16/N", "atom2_id": "///G/220/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 920, "atom1_serNum": 9417, "atom2_serNum": 10020, "donAcc_type": "standard", "distance": 3.835, "atom1_id": "///G/19/N", "atom2_id": "///G/171/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 921, "atom1_serNum": 9430, "atom2_serNum": 9437, "donAcc_type": "standard", "distance": 2.965, "atom1_id": "///G/21/O", "atom2_id": "///G/23/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 922, "atom1_serNum": 9430, "atom2_serNum": 9497, "donAcc_type": "standard", "distance": 3.241, "atom1_id": "///G/21/O", "atom2_id": "///G/35/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 923, "atom1_serNum": 9495, "atom2_serNum": 14456, "donAcc_type": "acceptable", "distance": 3.265, "atom1_id": "///G/34/O", "atom2_id": "///M/27/O2'", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 924, "atom1_serNum": 9500, "atom2_serNum": 14470, "donAcc_type": "questionable", "distance": 2.920, "atom1_id": "///G/35/O", "atom2_id": "///M/28/OP2", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 925, "atom1_serNum": 9505, "atom2_serNum": 9522, "donAcc_type": "standard", "distance": 3.011, "atom1_id": "///G/52/O", "atom2_id": "///G/56/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 926, "atom1_serNum": 9520, "atom2_serNum": 9537, "donAcc_type": "standard", "distance": 2.858, "atom1_id": "///G/55/O", "atom2_id": "///G/59/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 927, "atom1_serNum": 9525, "atom2_serNum": 9542, "donAcc_type": "standard", "distance": 2.930, "atom1_id": "///G/56/O", "atom2_id": "///G/60/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 928, "atom1_serNum": 9530, "atom2_serNum": 9547, "donAcc_type": "standard", "distance": 2.870, "atom1_id": "///G/57/O", "atom2_id": "///G/61/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 929, "atom1_serNum": 9540, "atom2_serNum": 9557, "donAcc_type": "standard", "distance": 2.917, "atom1_id": "///G/59/O", "atom2_id": "///G/63/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 930, "atom1_serNum": 9545, "atom2_serNum": 9562, "donAcc_type": "standard", "distance": 2.869, "atom1_id": "///G/60/O", "atom2_id": "///G/64/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 931, "atom1_serNum": 9550, "atom2_serNum": 9567, "donAcc_type": "standard", "distance": 2.910, "atom1_id": "///G/61/O", "atom2_id": "///G/65/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 932, "atom1_serNum": 9555, "atom2_serNum": 9572, "donAcc_type": "standard", "distance": 2.808, "atom1_id": "///G/62/O", "atom2_id": "///G/66/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 933, "atom1_serNum": 9580, "atom2_serNum": 9597, "donAcc_type": "standard", "distance": 2.657, "atom1_id": "///G/67/O", "atom2_id": "///G/71/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 934, "atom1_serNum": 9580, "atom2_serNum": 9602, "donAcc_type": "standard", "distance": 3.397, "atom1_id": "///G/67/O", "atom2_id": "///G/72/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 935, "atom1_serNum": 9585, "atom2_serNum": 9607, "donAcc_type": "standard", "distance": 2.890, "atom1_id": "///G/68/O", "atom2_id": "///G/73/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 936, "atom1_serNum": 9640, "atom2_serNum": 9647, "donAcc_type": "standard", "distance": 2.566, "atom1_id": "///G/79/O", "atom2_id": "///G/81/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 937, "atom1_serNum": 9650, "atom2_serNum": 9657, "donAcc_type": "standard", "distance": 2.746, "atom1_id": "///G/81/O", "atom2_id": "///G/83/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 938, "atom1_serNum": 9655, "atom2_serNum": 9662, "donAcc_type": "standard", "distance": 2.751, "atom1_id": "///G/82/O", "atom2_id": "///G/84/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 939, "atom1_serNum": 9680, "atom2_serNum": 9692, "donAcc_type": "standard", "distance": 2.770, "atom1_id": "///G/87/O", "atom2_id": "///G/90/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 940, "atom1_serNum": 9680, "atom2_serNum": 9697, "donAcc_type": "standard", "distance": 3.355, "atom1_id": "///G/87/O", "atom2_id": "///G/91/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 941, "atom1_serNum": 9685, "atom2_serNum": 9702, "donAcc_type": "standard", "distance": 2.872, "atom1_id": "///G/88/O", "atom2_id": "///G/92/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 942, "atom1_serNum": 9740, "atom2_serNum": 14861, "donAcc_type": "acceptable", "distance": 3.456, "atom1_id": "///G/99/O", "atom2_id": "///N/21/O2'", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 943, "atom1_serNum": 9750, "atom2_serNum": 9762, "donAcc_type": "standard", "distance": 3.758, "atom1_id": "///G/101/O", "atom2_id": "///G/104/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 944, "atom1_serNum": 9755, "atom2_serNum": 9767, "donAcc_type": "standard", "distance": 2.736, "atom1_id": "///G/102/O", "atom2_id": "///G/105/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 945, "atom1_serNum": 9755, "atom2_serNum": 9772, "donAcc_type": "standard", "distance": 2.949, "atom1_id": "///G/102/O", "atom2_id": "///G/106/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 946, "atom1_serNum": 9770, "atom2_serNum": 9795, "donAcc_type": "questionable", "distance": 3.331, "atom1_id": "///G/105/O", "atom2_id": "///G/110/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 947, "atom1_serNum": 9780, "atom2_serNum": 9792, "donAcc_type": "standard", "distance": 3.050, "atom1_id": "///G/107/O", "atom2_id": "///G/110/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 948, "atom1_serNum": 9805, "atom2_serNum": 9812, "donAcc_type": "standard", "distance": 2.877, "atom1_id": "///G/112/O", "atom2_id": "///G/114/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 949, "atom1_serNum": 9810, "atom2_serNum": 9817, "donAcc_type": "standard", "distance": 2.857, "atom1_id": "///G/113/O", "atom2_id": "///G/115/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 950, "atom1_serNum": 9815, "atom2_serNum": 10082, "donAcc_type": "standard", "distance": 3.178, "atom1_id": "///G/114/O", "atom2_id": "///G/184/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 951, "atom1_serNum": 9822, "atom2_serNum": 10075, "donAcc_type": "standard", "distance": 3.587, "atom1_id": "///G/116/N", "atom2_id": "///G/182/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 952, "atom1_serNum": 9825, "atom2_serNum": 10072, "donAcc_type": "standard", "distance": 2.904, "atom1_id": "///G/116/O", "atom2_id": "///G/182/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 953, "atom1_serNum": 9835, "atom2_serNum": 9842, "donAcc_type": "standard", "distance": 2.947, "atom1_id": "///G/118/O", "atom2_id": "///G/120/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 954, "atom1_serNum": 9840, "atom2_serNum": 9847, "donAcc_type": "standard", "distance": 2.865, "atom1_id": "///G/119/O", "atom2_id": "///G/121/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 955, "atom1_serNum": 9850, "atom2_serNum": 10052, "donAcc_type": "standard", "distance": 3.554, "atom1_id": "///G/121/O", "atom2_id": "///G/178/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 956, "atom1_serNum": 9857, "atom2_serNum": 10045, "donAcc_type": "standard", "distance": 3.577, "atom1_id": "///G/123/N", "atom2_id": "///G/176/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 957, "atom1_serNum": 9895, "atom2_serNum": 9907, "donAcc_type": "standard", "distance": 2.791, "atom1_id": "///G/130/O", "atom2_id": "///G/139/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 958, "atom1_serNum": 9905, "atom2_serNum": 9915, "donAcc_type": "questionable", "distance": 3.192, "atom1_id": "///G/132/O", "atom2_id": "///G/140/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 959, "atom1_serNum": 9920, "atom2_serNum": 10483, "donAcc_type": "standard", "distance": 2.508, "atom1_id": "///G/141/O", "atom2_id": "///H/22/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 960, "atom1_serNum": 9930, "atom2_serNum": 9937, "donAcc_type": "standard", "distance": 2.951, "atom1_id": "///G/143/O", "atom2_id": "///G/145/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 961, "atom1_serNum": 9935, "atom2_serNum": 10896, "donAcc_type": "questionable", "distance": 2.939, "atom1_id": "///G/144/O", "atom2_id": "///H/120/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 962, "atom1_serNum": 9940, "atom2_serNum": 10893, "donAcc_type": "standard", "distance": 3.665, "atom1_id": "///G/145/O", "atom2_id": "///H/120/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 963, "atom1_serNum": 9945, "atom2_serNum": 10553, "donAcc_type": "standard", "distance": 3.297, "atom1_id": "///G/146/O", "atom2_id": "///H/52/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 964, "atom1_serNum": 9960, "atom2_serNum": 10002, "donAcc_type": "standard", "distance": 2.891, "atom1_id": "///G/151/O", "atom2_id": "///G/168/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 965, "atom1_serNum": 9965, "atom2_serNum": 9972, "donAcc_type": "standard", "distance": 3.009, "atom1_id": "///G/152/O", "atom2_id": "///G/154/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 966, "atom1_serNum": 9965, "atom2_serNum": 10543, "donAcc_type": "standard", "distance": 3.581, "atom1_id": "///G/152/O", "atom2_id": "///H/34/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 967, "atom1_serNum": 9967, "atom2_serNum": 9990, "donAcc_type": "standard", "distance": 3.006, "atom1_id": "///G/153/N", "atom2_id": "///G/165/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 968, "atom1_serNum": 9970, "atom2_serNum": 14656, "donAcc_type": "standard", "distance": 3.081, "atom1_id": "///G/153/O", "atom2_id": "///N/11/N4", "atom_pair": "O:N", "residue_pair": "aa:nt" }, { "index": 969, "atom1_serNum": 9975, "atom2_serNum": 14656, "donAcc_type": "standard", "distance": 2.950, "atom1_id": "///G/154/O", "atom2_id": "///N/11/N4", "atom_pair": "O:N", "residue_pair": "aa:nt" }, { "index": 970, "atom1_serNum": 9980, "atom2_serNum": 14553, "donAcc_type": "questionable", "distance": 3.061, "atom1_id": "///G/155/O", "atom2_id": "///M/32/O5'", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 971, "atom1_serNum": 9985, "atom2_serNum": 9992, "donAcc_type": "standard", "distance": 2.824, "atom1_id": "///G/164/O", "atom2_id": "///G/166/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 972, "atom1_serNum": 9990, "atom2_serNum": 9997, "donAcc_type": "standard", "distance": 3.286, "atom1_id": "///G/165/O", "atom2_id": "///G/167/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 973, "atom1_serNum": 10015, "atom2_serNum": 10022, "donAcc_type": "standard", "distance": 3.291, "atom1_id": "///G/170/O", "atom2_id": "///G/172/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 974, "atom1_serNum": 10050, "atom2_serNum": 10057, "donAcc_type": "standard", "distance": 2.793, "atom1_id": "///G/177/O", "atom2_id": "///G/179/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 975, "atom1_serNum": 10055, "atom2_serNum": 10062, "donAcc_type": "standard", "distance": 3.049, "atom1_id": "///G/178/O", "atom2_id": "///G/180/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 976, "atom1_serNum": 10080, "atom2_serNum": 10087, "donAcc_type": "standard", "distance": 2.908, "atom1_id": "///G/183/O", "atom2_id": "///G/185/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 977, "atom1_serNum": 10085, "atom2_serNum": 10092, "donAcc_type": "standard", "distance": 2.734, "atom1_id": "///G/184/O", "atom2_id": "///G/186/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 978, "atom1_serNum": 10105, "atom2_serNum": 10117, "donAcc_type": "standard", "distance": 2.762, "atom1_id": "///G/188/O", "atom2_id": "///G/191/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 979, "atom1_serNum": 10105, "atom2_serNum": 10122, "donAcc_type": "standard", "distance": 2.905, "atom1_id": "///G/188/O", "atom2_id": "///G/192/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 980, "atom1_serNum": 10110, "atom2_serNum": 10127, "donAcc_type": "standard", "distance": 2.926, "atom1_id": "///G/189/O", "atom2_id": "///G/193/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 981, "atom1_serNum": 10125, "atom2_serNum": 10142, "donAcc_type": "standard", "distance": 2.953, "atom1_id": "///G/192/O", "atom2_id": "///G/196/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 982, "atom1_serNum": 10130, "atom2_serNum": 10147, "donAcc_type": "standard", "distance": 2.939, "atom1_id": "///G/193/O", "atom2_id": "///G/197/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 983, "atom1_serNum": 10130, "atom2_serNum": 10152, "donAcc_type": "standard", "distance": 3.463, "atom1_id": "///G/193/O", "atom2_id": "///G/198/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 984, "atom1_serNum": 10150, "atom2_serNum": 10157, "donAcc_type": "standard", "distance": 2.928, "atom1_id": "///G/197/O", "atom2_id": "///G/199/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 985, "atom1_serNum": 10150, "atom2_serNum": 10162, "donAcc_type": "standard", "distance": 2.724, "atom1_id": "///G/197/O", "atom2_id": "///G/200/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 986, "atom1_serNum": 10150, "atom2_serNum": 10167, "donAcc_type": "standard", "distance": 2.915, "atom1_id": "///G/197/O", "atom2_id": "///G/201/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 987, "atom1_serNum": 10160, "atom2_serNum": 10177, "donAcc_type": "standard", "distance": 2.962, "atom1_id": "///G/199/O", "atom2_id": "///G/203/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 988, "atom1_serNum": 10165, "atom2_serNum": 10182, "donAcc_type": "standard", "distance": 2.863, "atom1_id": "///G/200/O", "atom2_id": "///G/204/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 989, "atom1_serNum": 10170, "atom2_serNum": 10187, "donAcc_type": "standard", "distance": 2.853, "atom1_id": "///G/201/O", "atom2_id": "///G/205/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 990, "atom1_serNum": 10175, "atom2_serNum": 10192, "donAcc_type": "standard", "distance": 2.930, "atom1_id": "///G/202/O", "atom2_id": "///G/206/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 991, "atom1_serNum": 10185, "atom2_serNum": 10200, "donAcc_type": "questionable", "distance": 2.947, "atom1_id": "///G/204/O", "atom2_id": "///G/207/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 992, "atom1_serNum": 10190, "atom2_serNum": 10207, "donAcc_type": "standard", "distance": 3.816, "atom1_id": "///G/205/O", "atom2_id": "///G/209/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 993, "atom1_serNum": 10200, "atom2_serNum": 10207, "donAcc_type": "standard", "distance": 3.228, "atom1_id": "///G/207/O", "atom2_id": "///G/209/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 994, "atom1_serNum": 10225, "atom2_serNum": 14490, "donAcc_type": "questionable", "distance": 2.807, "atom1_id": "///G/212/O", "atom2_id": "///M/29/OP2", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 995, "atom1_serNum": 10227, "atom2_serNum": 10250, "donAcc_type": "standard", "distance": 3.319, "atom1_id": "///G/213/N", "atom2_id": "///G/217/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 996, "atom1_serNum": 10230, "atom2_serNum": 10237, "donAcc_type": "standard", "distance": 2.643, "atom1_id": "///G/213/O", "atom2_id": "///G/215/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 997, "atom1_serNum": 10232, "atom2_serNum": 14489, "donAcc_type": "standard", "distance": 3.025, "atom1_id": "///G/214/N", "atom2_id": "///M/29/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 998, "atom1_serNum": 10242, "atom2_serNum": 10881, "donAcc_type": "standard", "distance": 3.346, "atom1_id": "///G/216/N", "atom2_id": "///H/117/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 999, "atom1_serNum": 10265, "atom2_serNum": 10272, "donAcc_type": "standard", "distance": 3.265, "atom1_id": "///G/220/O", "atom2_id": "///G/222/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1000, "atom1_serNum": 10330, "atom2_serNum": 10337, "donAcc_type": "standard", "distance": 2.953, "atom1_id": "///G/233/O", "atom2_id": "///G/235/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1001, "atom1_serNum": 10398, "atom2_serNum": 11141, "donAcc_type": "standard", "distance": 2.929, "atom1_id": "///H/5/N", "atom2_id": "///H/185/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1002, "atom1_serNum": 10403, "atom2_serNum": 11426, "donAcc_type": "standard", "distance": 2.885, "atom1_id": "///H/6/N", "atom2_id": "///H/242/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1003, "atom1_serNum": 10406, "atom2_serNum": 10413, "donAcc_type": "standard", "distance": 3.088, "atom1_id": "///H/6/O", "atom2_id": "///H/8/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1004, "atom1_serNum": 10406, "atom2_serNum": 11423, "donAcc_type": "standard", "distance": 2.859, "atom1_id": "///H/6/O", "atom2_id": "///H/242/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1005, "atom1_serNum": 10411, "atom2_serNum": 11128, "donAcc_type": "standard", "distance": 2.934, "atom1_id": "///H/7/O", "atom2_id": "///H/183/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1006, "atom1_serNum": 10416, "atom2_serNum": 11413, "donAcc_type": "standard", "distance": 2.956, "atom1_id": "///H/8/O", "atom2_id": "///H/240/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1007, "atom1_serNum": 10416, "atom2_serNum": 11416, "donAcc_type": "questionable", "distance": 2.859, "atom1_id": "///H/8/O", "atom2_id": "///H/240/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1008, "atom1_serNum": 10418, "atom2_serNum": 11121, "donAcc_type": "standard", "distance": 2.844, "atom1_id": "///H/9/N", "atom2_id": "///H/181/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1009, "atom1_serNum": 10421, "atom2_serNum": 11118, "donAcc_type": "standard", "distance": 2.906, "atom1_id": "///H/9/O", "atom2_id": "///H/181/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1010, "atom1_serNum": 10426, "atom2_serNum": 11403, "donAcc_type": "standard", "distance": 3.056, "atom1_id": "///H/10/O", "atom2_id": "///H/238/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1011, "atom1_serNum": 10428, "atom2_serNum": 11111, "donAcc_type": "standard", "distance": 2.909, "atom1_id": "///H/11/N", "atom2_id": "///H/179/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1012, "atom1_serNum": 10431, "atom2_serNum": 11108, "donAcc_type": "standard", "distance": 2.868, "atom1_id": "///H/11/O", "atom2_id": "///H/179/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1013, "atom1_serNum": 10433, "atom2_serNum": 11336, "donAcc_type": "standard", "distance": 2.396, "atom1_id": "///H/12/N", "atom2_id": "///H/224/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1014, "atom1_serNum": 10436, "atom2_serNum": 11333, "donAcc_type": "standard", "distance": 2.967, "atom1_id": "///H/12/O", "atom2_id": "///H/224/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1015, "atom1_serNum": 10438, "atom2_serNum": 11101, "donAcc_type": "standard", "distance": 2.955, "atom1_id": "///H/13/N", "atom2_id": "///H/177/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1016, "atom1_serNum": 10441, "atom2_serNum": 11098, "donAcc_type": "standard", "distance": 2.925, "atom1_id": "///H/13/O", "atom2_id": "///H/177/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1017, "atom1_serNum": 10446, "atom2_serNum": 11316, "donAcc_type": "questionable", "distance": 2.990, "atom1_id": "///H/14/O", "atom2_id": "///H/220/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1018, "atom1_serNum": 10446, "atom2_serNum": 11323, "donAcc_type": "standard", "distance": 2.830, "atom1_id": "///H/14/O", "atom2_id": "///H/222/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1019, "atom1_serNum": 10451, "atom2_serNum": 11083, "donAcc_type": "standard", "distance": 2.407, "atom1_id": "///H/15/O", "atom2_id": "///H/174/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1020, "atom1_serNum": 10471, "atom2_serNum": 11068, "donAcc_type": "standard", "distance": 3.714, "atom1_id": "///H/19/O", "atom2_id": "///H/171/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1021, "atom1_serNum": 10478, "atom2_serNum": 11061, "donAcc_type": "standard", "distance": 3.585, "atom1_id": "///H/21/N", "atom2_id": "///H/169/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1022, "atom1_serNum": 10481, "atom2_serNum": 10488, "donAcc_type": "standard", "distance": 2.911, "atom1_id": "///H/21/O", "atom2_id": "///H/23/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1023, "atom1_serNum": 10496, "atom2_serNum": 11048, "donAcc_type": "standard", "distance": 3.489, "atom1_id": "///H/24/O", "atom2_id": "///H/167/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1024, "atom1_serNum": 10551, "atom2_serNum": 11268, "donAcc_type": "standard", "distance": 3.669, "atom1_id": "///H/35/O", "atom2_id": "///H/211/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1025, "atom1_serNum": 10551, "atom2_serNum": 11273, "donAcc_type": "standard", "distance": 2.799, "atom1_id": "///H/35/O", "atom2_id": "///H/212/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1026, "atom1_serNum": 10551, "atom2_serNum": 11278, "donAcc_type": "standard", "distance": 3.291, "atom1_id": "///H/35/O", "atom2_id": "///H/213/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1027, "atom1_serNum": 10556, "atom2_serNum": 10573, "donAcc_type": "standard", "distance": 3.859, "atom1_id": "///H/52/O", "atom2_id": "///H/56/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1028, "atom1_serNum": 10556, "atom2_serNum": 11263, "donAcc_type": "standard", "distance": 3.574, "atom1_id": "///H/52/O", "atom2_id": "///H/210/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1029, "atom1_serNum": 10561, "atom2_serNum": 10578, "donAcc_type": "standard", "distance": 3.271, "atom1_id": "///H/53/O", "atom2_id": "///H/57/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1030, "atom1_serNum": 10566, "atom2_serNum": 10583, "donAcc_type": "standard", "distance": 2.882, "atom1_id": "///H/54/O", "atom2_id": "///H/58/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1031, "atom1_serNum": 10571, "atom2_serNum": 10588, "donAcc_type": "standard", "distance": 2.881, "atom1_id": "///H/55/O", "atom2_id": "///H/59/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1032, "atom1_serNum": 10576, "atom2_serNum": 10593, "donAcc_type": "standard", "distance": 2.869, "atom1_id": "///H/56/O", "atom2_id": "///H/60/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1033, "atom1_serNum": 10586, "atom2_serNum": 10603, "donAcc_type": "standard", "distance": 2.913, "atom1_id": "///H/58/O", "atom2_id": "///H/62/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1034, "atom1_serNum": 10591, "atom2_serNum": 10608, "donAcc_type": "standard", "distance": 3.612, "atom1_id": "///H/59/O", "atom2_id": "///H/63/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1035, "atom1_serNum": 10596, "atom2_serNum": 10613, "donAcc_type": "standard", "distance": 2.838, "atom1_id": "///H/60/O", "atom2_id": "///H/64/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1036, "atom1_serNum": 10601, "atom2_serNum": 10618, "donAcc_type": "standard", "distance": 2.873, "atom1_id": "///H/61/O", "atom2_id": "///H/65/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1037, "atom1_serNum": 10606, "atom2_serNum": 10623, "donAcc_type": "standard", "distance": 3.097, "atom1_id": "///H/62/O", "atom2_id": "///H/66/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1038, "atom1_serNum": 10606, "atom2_serNum": 10628, "donAcc_type": "standard", "distance": 2.897, "atom1_id": "///H/62/O", "atom2_id": "///H/67/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1039, "atom1_serNum": 10626, "atom2_serNum": 10633, "donAcc_type": "standard", "distance": 3.348, "atom1_id": "///H/66/O", "atom2_id": "///H/68/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1040, "atom1_serNum": 10631, "atom2_serNum": 10643, "donAcc_type": "standard", "distance": 3.036, "atom1_id": "///H/67/O", "atom2_id": "///H/70/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1041, "atom1_serNum": 10631, "atom2_serNum": 10646, "donAcc_type": "questionable", "distance": 2.840, "atom1_id": "///H/67/O", "atom2_id": "///H/70/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1042, "atom1_serNum": 10641, "atom2_serNum": 10693, "donAcc_type": "standard", "distance": 2.453, "atom1_id": "///H/69/O", "atom2_id": "///H/80/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1043, "atom1_serNum": 10641, "atom2_serNum": 10698, "donAcc_type": "standard", "distance": 2.578, "atom1_id": "///H/69/O", "atom2_id": "///H/81/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1044, "atom1_serNum": 10661, "atom2_serNum": 10668, "donAcc_type": "standard", "distance": 2.952, "atom1_id": "///H/73/O", "atom2_id": "///H/75/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1045, "atom1_serNum": 10681, "atom2_serNum": 10688, "donAcc_type": "standard", "distance": 2.572, "atom1_id": "///H/77/O", "atom2_id": "///H/79/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1046, "atom1_serNum": 10726, "atom2_serNum": 10733, "donAcc_type": "standard", "distance": 2.742, "atom1_id": "///H/86/O", "atom2_id": "///H/88/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1047, "atom1_serNum": 10731, "atom2_serNum": 10743, "donAcc_type": "standard", "distance": 3.257, "atom1_id": "///H/87/O", "atom2_id": "///H/90/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1048, "atom1_serNum": 10731, "atom2_serNum": 10748, "donAcc_type": "standard", "distance": 2.407, "atom1_id": "///H/87/O", "atom2_id": "///H/91/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1049, "atom1_serNum": 10736, "atom2_serNum": 10753, "donAcc_type": "standard", "distance": 2.856, "atom1_id": "///H/88/O", "atom2_id": "///H/92/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1050, "atom1_serNum": 10751, "atom2_serNum": 10768, "donAcc_type": "standard", "distance": 2.726, "atom1_id": "///H/91/O", "atom2_id": "///H/95/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1051, "atom1_serNum": 10751, "atom2_serNum": 10863, "donAcc_type": "standard", "distance": 3.840, "atom1_id": "///H/91/O", "atom2_id": "///H/114/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1052, "atom1_serNum": 10781, "atom2_serNum": 10788, "donAcc_type": "standard", "distance": 2.927, "atom1_id": "///H/97/O", "atom2_id": "///H/99/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1053, "atom1_serNum": 10786, "atom2_serNum": 14735, "donAcc_type": "acceptable", "distance": 3.810, "atom1_id": "///H/98/O", "atom2_id": "///N/15/O2'", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 1054, "atom1_serNum": 10801, "atom2_serNum": 10818, "donAcc_type": "standard", "distance": 2.930, "atom1_id": "///H/101/O", "atom2_id": "///H/105/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1055, "atom1_serNum": 10811, "atom2_serNum": 10828, "donAcc_type": "standard", "distance": 2.831, "atom1_id": "///H/103/O", "atom2_id": "///H/107/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1056, "atom1_serNum": 10816, "atom2_serNum": 10828, "donAcc_type": "standard", "distance": 3.025, "atom1_id": "///H/104/O", "atom2_id": "///H/107/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1057, "atom1_serNum": 10826, "atom2_serNum": 10838, "donAcc_type": "standard", "distance": 3.864, "atom1_id": "///H/106/O", "atom2_id": "///H/109/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1058, "atom1_serNum": 10826, "atom2_serNum": 10843, "donAcc_type": "standard", "distance": 2.691, "atom1_id": "///H/106/O", "atom2_id": "///H/110/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1059, "atom1_serNum": 10826, "atom2_serNum": 10848, "donAcc_type": "standard", "distance": 3.267, "atom1_id": "///H/106/O", "atom2_id": "///H/111/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1060, "atom1_serNum": 10836, "atom2_serNum": 11143, "donAcc_type": "standard", "distance": 2.598, "atom1_id": "///H/108/O", "atom2_id": "///H/186/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1061, "atom1_serNum": 10836, "atom2_serNum": 11148, "donAcc_type": "standard", "distance": 3.568, "atom1_id": "///H/108/O", "atom2_id": "///H/187/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1062, "atom1_serNum": 10841, "atom2_serNum": 11136, "donAcc_type": "questionable", "distance": 2.854, "atom1_id": "///H/109/O", "atom2_id": "///H/184/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1063, "atom1_serNum": 10871, "atom2_serNum": 10878, "donAcc_type": "standard", "distance": 2.920, "atom1_id": "///H/115/O", "atom2_id": "///H/117/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1064, "atom1_serNum": 10873, "atom2_serNum": 11126, "donAcc_type": "standard", "distance": 3.777, "atom1_id": "///H/116/N", "atom2_id": "///H/182/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1065, "atom1_serNum": 10883, "atom2_serNum": 11116, "donAcc_type": "standard", "distance": 3.441, "atom1_id": "///H/118/N", "atom2_id": "///H/180/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1066, "atom1_serNum": 10886, "atom2_serNum": 10893, "donAcc_type": "standard", "distance": 3.200, "atom1_id": "///H/118/O", "atom2_id": "///H/120/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1067, "atom1_serNum": 10898, "atom2_serNum": 11106, "donAcc_type": "standard", "distance": 2.916, "atom1_id": "///H/121/N", "atom2_id": "///H/178/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1068, "atom1_serNum": 10901, "atom2_serNum": 10908, "donAcc_type": "standard", "distance": 2.835, "atom1_id": "///H/121/O", "atom2_id": "///H/123/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1069, "atom1_serNum": 10916, "atom2_serNum": 10923, "donAcc_type": "standard", "distance": 2.796, "atom1_id": "///H/124/O", "atom2_id": "///H/126/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1070, "atom1_serNum": 10921, "atom2_serNum": 10928, "donAcc_type": "standard", "distance": 2.827, "atom1_id": "///H/125/O", "atom2_id": "///H/127/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1071, "atom1_serNum": 10931, "atom2_serNum": 11063, "donAcc_type": "standard", "distance": 3.265, "atom1_id": "///H/127/O", "atom2_id": "///H/170/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1072, "atom1_serNum": 10976, "atom2_serNum": 10983, "donAcc_type": "standard", "distance": 2.806, "atom1_id": "///H/142/O", "atom2_id": "///H/144/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1073, "atom1_serNum": 10978, "atom2_serNum": 11296, "donAcc_type": "standard", "distance": 3.629, "atom1_id": "///H/143/N", "atom2_id": "///H/216/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1074, "atom1_serNum": 10981, "atom2_serNum": 10988, "donAcc_type": "standard", "distance": 2.903, "atom1_id": "///H/143/O", "atom2_id": "///H/145/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1075, "atom1_serNum": 11036, "atom2_serNum": 11043, "donAcc_type": "standard", "distance": 2.922, "atom1_id": "///H/164/O", "atom2_id": "///H/166/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1076, "atom1_serNum": 11076, "atom2_serNum": 11088, "donAcc_type": "standard", "distance": 3.834, "atom1_id": "///H/172/O", "atom2_id": "///H/175/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1077, "atom1_serNum": 11086, "atom2_serNum": 11093, "donAcc_type": "standard", "distance": 2.876, "atom1_id": "///H/174/O", "atom2_id": "///H/176/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1078, "atom1_serNum": 11126, "atom2_serNum": 11133, "donAcc_type": "standard", "distance": 2.723, "atom1_id": "///H/182/O", "atom2_id": "///H/184/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1079, "atom1_serNum": 11131, "atom2_serNum": 11138, "donAcc_type": "standard", "distance": 2.636, "atom1_id": "///H/183/O", "atom2_id": "///H/185/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1080, "atom1_serNum": 11151, "atom2_serNum": 11163, "donAcc_type": "standard", "distance": 3.001, "atom1_id": "///H/187/O", "atom2_id": "///H/190/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1081, "atom1_serNum": 11151, "atom2_serNum": 11168, "donAcc_type": "standard", "distance": 3.296, "atom1_id": "///H/187/O", "atom2_id": "///H/191/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1082, "atom1_serNum": 11156, "atom2_serNum": 11173, "donAcc_type": "standard", "distance": 2.875, "atom1_id": "///H/188/O", "atom2_id": "///H/192/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1083, "atom1_serNum": 11171, "atom2_serNum": 11188, "donAcc_type": "standard", "distance": 2.909, "atom1_id": "///H/191/O", "atom2_id": "///H/195/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1084, "atom1_serNum": 11176, "atom2_serNum": 11193, "donAcc_type": "standard", "distance": 2.834, "atom1_id": "///H/192/O", "atom2_id": "///H/196/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1085, "atom1_serNum": 11181, "atom2_serNum": 11198, "donAcc_type": "standard", "distance": 2.850, "atom1_id": "///H/193/O", "atom2_id": "///H/197/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1086, "atom1_serNum": 11186, "atom2_serNum": 11203, "donAcc_type": "standard", "distance": 2.833, "atom1_id": "///H/194/O", "atom2_id": "///H/198/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1087, "atom1_serNum": 11196, "atom2_serNum": 11213, "donAcc_type": "standard", "distance": 2.814, "atom1_id": "///H/196/O", "atom2_id": "///H/200/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1088, "atom1_serNum": 11201, "atom2_serNum": 11218, "donAcc_type": "standard", "distance": 2.878, "atom1_id": "///H/197/O", "atom2_id": "///H/201/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1089, "atom1_serNum": 11216, "atom2_serNum": 11228, "donAcc_type": "standard", "distance": 3.232, "atom1_id": "///H/200/O", "atom2_id": "///H/203/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1090, "atom1_serNum": 11221, "atom2_serNum": 11233, "donAcc_type": "standard", "distance": 2.983, "atom1_id": "///H/201/O", "atom2_id": "///H/204/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1091, "atom1_serNum": 11221, "atom2_serNum": 11238, "donAcc_type": "standard", "distance": 2.927, "atom1_id": "///H/201/O", "atom2_id": "///H/205/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1092, "atom1_serNum": 11276, "atom2_serNum": 14611, "donAcc_type": "questionable", "distance": 2.804, "atom1_id": "///H/212/O", "atom2_id": "///N/9/O6", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 1093, "atom1_serNum": 11286, "atom2_serNum": 11293, "donAcc_type": "standard", "distance": 2.631, "atom1_id": "///H/214/O", "atom2_id": "///H/216/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1094, "atom1_serNum": 11442, "atom2_serNum": 11449, "donAcc_type": "standard", "distance": 2.935, "atom1_id": "///I/8/O", "atom2_id": "///I/10/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1095, "atom1_serNum": 11447, "atom2_serNum": 11454, "donAcc_type": "standard", "distance": 3.000, "atom1_id": "///I/9/O", "atom2_id": "///I/11/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1096, "atom1_serNum": 11472, "atom2_serNum": 11479, "donAcc_type": "standard", "distance": 2.895, "atom1_id": "///I/14/O", "atom2_id": "///I/16/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1097, "atom1_serNum": 11487, "atom2_serNum": 11494, "donAcc_type": "standard", "distance": 2.553, "atom1_id": "///I/17/O", "atom2_id": "///I/19/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1098, "atom1_serNum": 11492, "atom2_serNum": 11499, "donAcc_type": "standard", "distance": 2.875, "atom1_id": "///I/18/O", "atom2_id": "///I/20/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1099, "atom1_serNum": 11502, "atom2_serNum": 11509, "donAcc_type": "standard", "distance": 2.784, "atom1_id": "///I/20/O", "atom2_id": "///I/22/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1100, "atom1_serNum": 11502, "atom2_serNum": 11514, "donAcc_type": "standard", "distance": 2.498, "atom1_id": "///I/20/O", "atom2_id": "///I/23/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1101, "atom1_serNum": 11507, "atom2_serNum": 11524, "donAcc_type": "standard", "distance": 2.736, "atom1_id": "///I/21/O", "atom2_id": "///I/25/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1102, "atom1_serNum": 11512, "atom2_serNum": 11529, "donAcc_type": "standard", "distance": 2.905, "atom1_id": "///I/22/O", "atom2_id": "///I/26/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1103, "atom1_serNum": 11517, "atom2_serNum": 11534, "donAcc_type": "standard", "distance": 2.913, "atom1_id": "///I/23/O", "atom2_id": "///I/27/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1104, "atom1_serNum": 11522, "atom2_serNum": 11539, "donAcc_type": "standard", "distance": 2.814, "atom1_id": "///I/24/O", "atom2_id": "///I/28/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1105, "atom1_serNum": 11527, "atom2_serNum": 11544, "donAcc_type": "standard", "distance": 2.876, "atom1_id": "///I/25/O", "atom2_id": "///I/29/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1106, "atom1_serNum": 11532, "atom2_serNum": 11549, "donAcc_type": "standard", "distance": 2.895, "atom1_id": "///I/26/O", "atom2_id": "///I/30/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1107, "atom1_serNum": 11537, "atom2_serNum": 11554, "donAcc_type": "standard", "distance": 2.881, "atom1_id": "///I/27/O", "atom2_id": "///I/31/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1108, "atom1_serNum": 11542, "atom2_serNum": 11559, "donAcc_type": "standard", "distance": 2.879, "atom1_id": "///I/28/O", "atom2_id": "///I/32/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1109, "atom1_serNum": 11547, "atom2_serNum": 11559, "donAcc_type": "standard", "distance": 2.936, "atom1_id": "///I/29/O", "atom2_id": "///I/32/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1110, "atom1_serNum": 11547, "atom2_serNum": 11564, "donAcc_type": "standard", "distance": 3.421, "atom1_id": "///I/29/O", "atom2_id": "///I/33/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1111, "atom1_serNum": 11557, "atom2_serNum": 11567, "donAcc_type": "questionable", "distance": 2.959, "atom1_id": "///I/31/O", "atom2_id": "///I/33/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1112, "atom1_serNum": 11572, "atom2_serNum": 11579, "donAcc_type": "standard", "distance": 2.902, "atom1_id": "///I/34/O", "atom2_id": "///I/36/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1113, "atom1_serNum": 11582, "atom2_serNum": 11589, "donAcc_type": "standard", "distance": 2.611, "atom1_id": "///I/36/O", "atom2_id": "///I/38/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1114, "atom1_serNum": 11597, "atom2_serNum": 11614, "donAcc_type": "standard", "distance": 2.891, "atom1_id": "///I/39/O", "atom2_id": "///I/43/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1115, "atom1_serNum": 11602, "atom2_serNum": 11619, "donAcc_type": "standard", "distance": 2.850, "atom1_id": "///I/40/O", "atom2_id": "///I/44/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1116, "atom1_serNum": 11607, "atom2_serNum": 11624, "donAcc_type": "standard", "distance": 2.921, "atom1_id": "///I/41/O", "atom2_id": "///I/45/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1117, "atom1_serNum": 11617, "atom2_serNum": 11634, "donAcc_type": "standard", "distance": 2.916, "atom1_id": "///I/43/O", "atom2_id": "///I/47/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1118, "atom1_serNum": 11622, "atom2_serNum": 11639, "donAcc_type": "standard", "distance": 2.880, "atom1_id": "///I/44/O", "atom2_id": "///I/48/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1119, "atom1_serNum": 11627, "atom2_serNum": 11644, "donAcc_type": "standard", "distance": 2.893, "atom1_id": "///I/45/O", "atom2_id": "///I/49/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1120, "atom1_serNum": 11632, "atom2_serNum": 11649, "donAcc_type": "standard", "distance": 2.933, "atom1_id": "///I/46/O", "atom2_id": "///I/50/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1121, "atom1_serNum": 11637, "atom2_serNum": 11654, "donAcc_type": "standard", "distance": 2.891, "atom1_id": "///I/47/O", "atom2_id": "///I/51/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1122, "atom1_serNum": 11642, "atom2_serNum": 11659, "donAcc_type": "standard", "distance": 2.866, "atom1_id": "///I/48/O", "atom2_id": "///I/52/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1123, "atom1_serNum": 11652, "atom2_serNum": 11667, "donAcc_type": "questionable", "distance": 2.882, "atom1_id": "///I/50/O", "atom2_id": "///I/53/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1124, "atom1_serNum": 11657, "atom2_serNum": 11679, "donAcc_type": "standard", "distance": 3.241, "atom1_id": "///I/51/O", "atom2_id": "///I/56/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1125, "atom1_serNum": 11662, "atom2_serNum": 11684, "donAcc_type": "standard", "distance": 3.541, "atom1_id": "///I/52/O", "atom2_id": "///I/57/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1126, "atom1_serNum": 11667, "atom2_serNum": 11674, "donAcc_type": "standard", "distance": 2.770, "atom1_id": "///I/53/O", "atom2_id": "///I/55/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1127, "atom1_serNum": 11677, "atom2_serNum": 11694, "donAcc_type": "standard", "distance": 2.500, "atom1_id": "///I/55/O", "atom2_id": "///I/59/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1128, "atom1_serNum": 11687, "atom2_serNum": 11699, "donAcc_type": "standard", "distance": 3.787, "atom1_id": "///I/57/O", "atom2_id": "///I/60/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1129, "atom1_serNum": 11692, "atom2_serNum": 11704, "donAcc_type": "standard", "distance": 2.720, "atom1_id": "///I/58/O", "atom2_id": "///I/61/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1130, "atom1_serNum": 11707, "atom2_serNum": 11714, "donAcc_type": "standard", "distance": 2.515, "atom1_id": "///I/61/O", "atom2_id": "///I/63/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1131, "atom1_serNum": 11717, "atom2_serNum": 11734, "donAcc_type": "standard", "distance": 3.766, "atom1_id": "///I/63/O", "atom2_id": "///I/67/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1132, "atom1_serNum": 11722, "atom2_serNum": 11739, "donAcc_type": "standard", "distance": 2.849, "atom1_id": "///I/64/O", "atom2_id": "///I/68/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1133, "atom1_serNum": 11727, "atom2_serNum": 11744, "donAcc_type": "standard", "distance": 2.943, "atom1_id": "///I/65/O", "atom2_id": "///I/69/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1134, "atom1_serNum": 11732, "atom2_serNum": 11749, "donAcc_type": "standard", "distance": 2.910, "atom1_id": "///I/66/O", "atom2_id": "///I/70/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1135, "atom1_serNum": 11737, "atom2_serNum": 11754, "donAcc_type": "standard", "distance": 2.871, "atom1_id": "///I/67/O", "atom2_id": "///I/71/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1136, "atom1_serNum": 11742, "atom2_serNum": 11759, "donAcc_type": "standard", "distance": 2.995, "atom1_id": "///I/68/O", "atom2_id": "///I/72/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1137, "atom1_serNum": 11752, "atom2_serNum": 11769, "donAcc_type": "standard", "distance": 2.871, "atom1_id": "///I/70/O", "atom2_id": "///I/74/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1138, "atom1_serNum": 11757, "atom2_serNum": 11774, "donAcc_type": "standard", "distance": 2.946, "atom1_id": "///I/71/O", "atom2_id": "///I/75/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1139, "atom1_serNum": 11762, "atom2_serNum": 11779, "donAcc_type": "standard", "distance": 3.443, "atom1_id": "///I/72/O", "atom2_id": "///I/76/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1140, "atom1_serNum": 11767, "atom2_serNum": 11784, "donAcc_type": "standard", "distance": 2.981, "atom1_id": "///I/73/O", "atom2_id": "///I/77/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1141, "atom1_serNum": 11777, "atom2_serNum": 11789, "donAcc_type": "standard", "distance": 3.110, "atom1_id": "///I/75/O", "atom2_id": "///I/78/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1142, "atom1_serNum": 11777, "atom2_serNum": 11794, "donAcc_type": "standard", "distance": 3.465, "atom1_id": "///I/75/O", "atom2_id": "///I/79/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1143, "atom1_serNum": 11782, "atom2_serNum": 11799, "donAcc_type": "standard", "distance": 2.927, "atom1_id": "///I/76/O", "atom2_id": "///I/80/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1144, "atom1_serNum": 11787, "atom2_serNum": 11804, "donAcc_type": "standard", "distance": 2.895, "atom1_id": "///I/77/O", "atom2_id": "///I/81/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1145, "atom1_serNum": 11792, "atom2_serNum": 11809, "donAcc_type": "standard", "distance": 2.928, "atom1_id": "///I/78/O", "atom2_id": "///I/82/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1146, "atom1_serNum": 11797, "atom2_serNum": 11814, "donAcc_type": "standard", "distance": 2.866, "atom1_id": "///I/79/O", "atom2_id": "///I/83/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1147, "atom1_serNum": 11812, "atom2_serNum": 11824, "donAcc_type": "standard", "distance": 2.966, "atom1_id": "///I/82/O", "atom2_id": "///I/85/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1148, "atom1_serNum": 11817, "atom2_serNum": 11829, "donAcc_type": "standard", "distance": 3.798, "atom1_id": "///I/83/O", "atom2_id": "///I/86/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1149, "atom1_serNum": 11822, "atom2_serNum": 11844, "donAcc_type": "standard", "distance": 2.584, "atom1_id": "///I/84/O", "atom2_id": "///I/89/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1150, "atom1_serNum": 11857, "atom2_serNum": 11874, "donAcc_type": "standard", "distance": 3.051, "atom1_id": "///I/96/O", "atom2_id": "///I/100/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1151, "atom1_serNum": 11862, "atom2_serNum": 11879, "donAcc_type": "standard", "distance": 2.918, "atom1_id": "///I/97/O", "atom2_id": "///I/101/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1152, "atom1_serNum": 11867, "atom2_serNum": 11884, "donAcc_type": "standard", "distance": 2.883, "atom1_id": "///I/98/O", "atom2_id": "///I/102/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1153, "atom1_serNum": 11872, "atom2_serNum": 11889, "donAcc_type": "standard", "distance": 2.945, "atom1_id": "///I/99/O", "atom2_id": "///I/103/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1154, "atom1_serNum": 11877, "atom2_serNum": 11894, "donAcc_type": "standard", "distance": 2.926, "atom1_id": "///I/100/O", "atom2_id": "///I/104/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1155, "atom1_serNum": 11882, "atom2_serNum": 11899, "donAcc_type": "standard", "distance": 2.876, "atom1_id": "///I/101/O", "atom2_id": "///I/105/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1156, "atom1_serNum": 11887, "atom2_serNum": 11904, "donAcc_type": "standard", "distance": 2.921, "atom1_id": "///I/102/O", "atom2_id": "///I/106/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1157, "atom1_serNum": 11897, "atom2_serNum": 11909, "donAcc_type": "standard", "distance": 2.800, "atom1_id": "///I/104/O", "atom2_id": "///I/107/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1158, "atom1_serNum": 11927, "atom2_serNum": 11934, "donAcc_type": "standard", "distance": 2.966, "atom1_id": "///I/110/O", "atom2_id": "///I/112/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1159, "atom1_serNum": 11942, "atom2_serNum": 11954, "donAcc_type": "standard", "distance": 3.067, "atom1_id": "///I/113/O", "atom2_id": "///I/116/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1160, "atom1_serNum": 11947, "atom2_serNum": 11959, "donAcc_type": "standard", "distance": 2.897, "atom1_id": "///I/114/O", "atom2_id": "///I/117/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1161, "atom1_serNum": 11947, "atom2_serNum": 11964, "donAcc_type": "standard", "distance": 2.858, "atom1_id": "///I/114/O", "atom2_id": "///I/118/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1162, "atom1_serNum": 11952, "atom2_serNum": 11969, "donAcc_type": "standard", "distance": 2.812, "atom1_id": "///I/115/O", "atom2_id": "///I/119/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1163, "atom1_serNum": 11962, "atom2_serNum": 11974, "donAcc_type": "standard", "distance": 2.934, "atom1_id": "///I/117/O", "atom2_id": "///I/120/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1164, "atom1_serNum": 11962, "atom2_serNum": 11979, "donAcc_type": "standard", "distance": 3.182, "atom1_id": "///I/117/O", "atom2_id": "///I/121/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1165, "atom1_serNum": 11967, "atom2_serNum": 11984, "donAcc_type": "standard", "distance": 2.977, "atom1_id": "///I/118/O", "atom2_id": "///I/122/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1166, "atom1_serNum": 11972, "atom2_serNum": 11989, "donAcc_type": "standard", "distance": 2.439, "atom1_id": "///I/119/O", "atom2_id": "///I/123/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1167, "atom1_serNum": 11977, "atom2_serNum": 11994, "donAcc_type": "standard", "distance": 3.018, "atom1_id": "///I/120/O", "atom2_id": "///I/124/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1168, "atom1_serNum": 11982, "atom2_serNum": 11994, "donAcc_type": "standard", "distance": 2.976, "atom1_id": "///I/121/O", "atom2_id": "///I/124/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1169, "atom1_serNum": 11982, "atom2_serNum": 11999, "donAcc_type": "standard", "distance": 2.663, "atom1_id": "///I/121/O", "atom2_id": "///I/125/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1170, "atom1_serNum": 11997, "atom2_serNum": 12009, "donAcc_type": "standard", "distance": 2.885, "atom1_id": "///I/124/O", "atom2_id": "///I/127/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1171, "atom1_serNum": 11997, "atom2_serNum": 12014, "donAcc_type": "standard", "distance": 2.453, "atom1_id": "///I/124/O", "atom2_id": "///I/128/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1172, "atom1_serNum": 12033, "atom2_serNum": 12040, "donAcc_type": "standard", "distance": 2.936, "atom1_id": "///J/8/O", "atom2_id": "///J/10/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1173, "atom1_serNum": 12038, "atom2_serNum": 12045, "donAcc_type": "standard", "distance": 3.000, "atom1_id": "///J/9/O", "atom2_id": "///J/11/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1174, "atom1_serNum": 12063, "atom2_serNum": 12070, "donAcc_type": "standard", "distance": 2.895, "atom1_id": "///J/14/O", "atom2_id": "///J/16/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1175, "atom1_serNum": 12078, "atom2_serNum": 12085, "donAcc_type": "standard", "distance": 2.553, "atom1_id": "///J/17/O", "atom2_id": "///J/19/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1176, "atom1_serNum": 12083, "atom2_serNum": 12090, "donAcc_type": "standard", "distance": 2.876, "atom1_id": "///J/18/O", "atom2_id": "///J/20/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1177, "atom1_serNum": 12093, "atom2_serNum": 12100, "donAcc_type": "standard", "distance": 2.783, "atom1_id": "///J/20/O", "atom2_id": "///J/22/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1178, "atom1_serNum": 12093, "atom2_serNum": 12105, "donAcc_type": "standard", "distance": 2.498, "atom1_id": "///J/20/O", "atom2_id": "///J/23/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1179, "atom1_serNum": 12098, "atom2_serNum": 12115, "donAcc_type": "standard", "distance": 2.736, "atom1_id": "///J/21/O", "atom2_id": "///J/25/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1180, "atom1_serNum": 12103, "atom2_serNum": 12120, "donAcc_type": "standard", "distance": 2.905, "atom1_id": "///J/22/O", "atom2_id": "///J/26/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1181, "atom1_serNum": 12108, "atom2_serNum": 12125, "donAcc_type": "standard", "distance": 2.913, "atom1_id": "///J/23/O", "atom2_id": "///J/27/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1182, "atom1_serNum": 12113, "atom2_serNum": 12130, "donAcc_type": "standard", "distance": 2.814, "atom1_id": "///J/24/O", "atom2_id": "///J/28/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1183, "atom1_serNum": 12118, "atom2_serNum": 12135, "donAcc_type": "standard", "distance": 2.876, "atom1_id": "///J/25/O", "atom2_id": "///J/29/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1184, "atom1_serNum": 12123, "atom2_serNum": 12140, "donAcc_type": "standard", "distance": 2.895, "atom1_id": "///J/26/O", "atom2_id": "///J/30/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1185, "atom1_serNum": 12128, "atom2_serNum": 12145, "donAcc_type": "standard", "distance": 2.881, "atom1_id": "///J/27/O", "atom2_id": "///J/31/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1186, "atom1_serNum": 12133, "atom2_serNum": 12150, "donAcc_type": "standard", "distance": 2.879, "atom1_id": "///J/28/O", "atom2_id": "///J/32/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1187, "atom1_serNum": 12138, "atom2_serNum": 12150, "donAcc_type": "standard", "distance": 2.936, "atom1_id": "///J/29/O", "atom2_id": "///J/32/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1188, "atom1_serNum": 12138, "atom2_serNum": 12155, "donAcc_type": "standard", "distance": 3.422, "atom1_id": "///J/29/O", "atom2_id": "///J/33/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1189, "atom1_serNum": 12148, "atom2_serNum": 12158, "donAcc_type": "questionable", "distance": 2.958, "atom1_id": "///J/31/O", "atom2_id": "///J/33/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1190, "atom1_serNum": 12163, "atom2_serNum": 12170, "donAcc_type": "standard", "distance": 2.901, "atom1_id": "///J/34/O", "atom2_id": "///J/36/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1191, "atom1_serNum": 12173, "atom2_serNum": 12180, "donAcc_type": "standard", "distance": 2.611, "atom1_id": "///J/36/O", "atom2_id": "///J/38/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1192, "atom1_serNum": 12188, "atom2_serNum": 12205, "donAcc_type": "standard", "distance": 2.891, "atom1_id": "///J/39/O", "atom2_id": "///J/43/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1193, "atom1_serNum": 12193, "atom2_serNum": 12210, "donAcc_type": "standard", "distance": 2.850, "atom1_id": "///J/40/O", "atom2_id": "///J/44/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1194, "atom1_serNum": 12198, "atom2_serNum": 12215, "donAcc_type": "standard", "distance": 2.921, "atom1_id": "///J/41/O", "atom2_id": "///J/45/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1195, "atom1_serNum": 12208, "atom2_serNum": 12225, "donAcc_type": "standard", "distance": 2.917, "atom1_id": "///J/43/O", "atom2_id": "///J/47/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1196, "atom1_serNum": 12213, "atom2_serNum": 12230, "donAcc_type": "standard", "distance": 2.880, "atom1_id": "///J/44/O", "atom2_id": "///J/48/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1197, "atom1_serNum": 12218, "atom2_serNum": 12235, "donAcc_type": "standard", "distance": 2.893, "atom1_id": "///J/45/O", "atom2_id": "///J/49/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1198, "atom1_serNum": 12223, "atom2_serNum": 12240, "donAcc_type": "standard", "distance": 2.933, "atom1_id": "///J/46/O", "atom2_id": "///J/50/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1199, "atom1_serNum": 12228, "atom2_serNum": 12245, "donAcc_type": "standard", "distance": 2.891, "atom1_id": "///J/47/O", "atom2_id": "///J/51/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1200, "atom1_serNum": 12233, "atom2_serNum": 12250, "donAcc_type": "standard", "distance": 2.867, "atom1_id": "///J/48/O", "atom2_id": "///J/52/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1201, "atom1_serNum": 12243, "atom2_serNum": 12258, "donAcc_type": "questionable", "distance": 2.882, "atom1_id": "///J/50/O", "atom2_id": "///J/53/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1202, "atom1_serNum": 12248, "atom2_serNum": 12270, "donAcc_type": "standard", "distance": 3.242, "atom1_id": "///J/51/O", "atom2_id": "///J/56/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1203, "atom1_serNum": 12253, "atom2_serNum": 12275, "donAcc_type": "standard", "distance": 3.542, "atom1_id": "///J/52/O", "atom2_id": "///J/57/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1204, "atom1_serNum": 12258, "atom2_serNum": 12265, "donAcc_type": "standard", "distance": 2.771, "atom1_id": "///J/53/O", "atom2_id": "///J/55/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1205, "atom1_serNum": 12268, "atom2_serNum": 12285, "donAcc_type": "standard", "distance": 2.501, "atom1_id": "///J/55/O", "atom2_id": "///J/59/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1206, "atom1_serNum": 12278, "atom2_serNum": 12290, "donAcc_type": "standard", "distance": 3.787, "atom1_id": "///J/57/O", "atom2_id": "///J/60/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1207, "atom1_serNum": 12283, "atom2_serNum": 12295, "donAcc_type": "standard", "distance": 2.721, "atom1_id": "///J/58/O", "atom2_id": "///J/61/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1208, "atom1_serNum": 12298, "atom2_serNum": 12305, "donAcc_type": "standard", "distance": 2.515, "atom1_id": "///J/61/O", "atom2_id": "///J/63/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1209, "atom1_serNum": 12308, "atom2_serNum": 12325, "donAcc_type": "standard", "distance": 3.766, "atom1_id": "///J/63/O", "atom2_id": "///J/67/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1210, "atom1_serNum": 12313, "atom2_serNum": 12330, "donAcc_type": "standard", "distance": 2.849, "atom1_id": "///J/64/O", "atom2_id": "///J/68/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1211, "atom1_serNum": 12318, "atom2_serNum": 12335, "donAcc_type": "standard", "distance": 2.943, "atom1_id": "///J/65/O", "atom2_id": "///J/69/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1212, "atom1_serNum": 12323, "atom2_serNum": 12340, "donAcc_type": "standard", "distance": 2.909, "atom1_id": "///J/66/O", "atom2_id": "///J/70/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1213, "atom1_serNum": 12328, "atom2_serNum": 12345, "donAcc_type": "standard", "distance": 2.872, "atom1_id": "///J/67/O", "atom2_id": "///J/71/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1214, "atom1_serNum": 12333, "atom2_serNum": 12350, "donAcc_type": "standard", "distance": 2.995, "atom1_id": "///J/68/O", "atom2_id": "///J/72/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1215, "atom1_serNum": 12343, "atom2_serNum": 12360, "donAcc_type": "standard", "distance": 2.872, "atom1_id": "///J/70/O", "atom2_id": "///J/74/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1216, "atom1_serNum": 12348, "atom2_serNum": 12365, "donAcc_type": "standard", "distance": 2.945, "atom1_id": "///J/71/O", "atom2_id": "///J/75/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1217, "atom1_serNum": 12353, "atom2_serNum": 12370, "donAcc_type": "standard", "distance": 3.442, "atom1_id": "///J/72/O", "atom2_id": "///J/76/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1218, "atom1_serNum": 12358, "atom2_serNum": 12375, "donAcc_type": "standard", "distance": 2.980, "atom1_id": "///J/73/O", "atom2_id": "///J/77/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1219, "atom1_serNum": 12368, "atom2_serNum": 12380, "donAcc_type": "standard", "distance": 3.109, "atom1_id": "///J/75/O", "atom2_id": "///J/78/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1220, "atom1_serNum": 12368, "atom2_serNum": 12385, "donAcc_type": "standard", "distance": 3.465, "atom1_id": "///J/75/O", "atom2_id": "///J/79/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1221, "atom1_serNum": 12373, "atom2_serNum": 12390, "donAcc_type": "standard", "distance": 2.927, "atom1_id": "///J/76/O", "atom2_id": "///J/80/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1222, "atom1_serNum": 12378, "atom2_serNum": 12395, "donAcc_type": "standard", "distance": 2.896, "atom1_id": "///J/77/O", "atom2_id": "///J/81/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1223, "atom1_serNum": 12383, "atom2_serNum": 12400, "donAcc_type": "standard", "distance": 2.927, "atom1_id": "///J/78/O", "atom2_id": "///J/82/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1224, "atom1_serNum": 12388, "atom2_serNum": 12405, "donAcc_type": "standard", "distance": 2.867, "atom1_id": "///J/79/O", "atom2_id": "///J/83/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1225, "atom1_serNum": 12403, "atom2_serNum": 12415, "donAcc_type": "standard", "distance": 2.966, "atom1_id": "///J/82/O", "atom2_id": "///J/85/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1226, "atom1_serNum": 12408, "atom2_serNum": 12420, "donAcc_type": "standard", "distance": 3.798, "atom1_id": "///J/83/O", "atom2_id": "///J/86/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1227, "atom1_serNum": 12413, "atom2_serNum": 12435, "donAcc_type": "standard", "distance": 2.583, "atom1_id": "///J/84/O", "atom2_id": "///J/89/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1228, "atom1_serNum": 12448, "atom2_serNum": 12465, "donAcc_type": "standard", "distance": 3.051, "atom1_id": "///J/96/O", "atom2_id": "///J/100/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1229, "atom1_serNum": 12453, "atom2_serNum": 12470, "donAcc_type": "standard", "distance": 2.917, "atom1_id": "///J/97/O", "atom2_id": "///J/101/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1230, "atom1_serNum": 12458, "atom2_serNum": 12475, "donAcc_type": "standard", "distance": 2.883, "atom1_id": "///J/98/O", "atom2_id": "///J/102/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1231, "atom1_serNum": 12463, "atom2_serNum": 12480, "donAcc_type": "standard", "distance": 2.944, "atom1_id": "///J/99/O", "atom2_id": "///J/103/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1232, "atom1_serNum": 12468, "atom2_serNum": 12485, "donAcc_type": "standard", "distance": 2.925, "atom1_id": "///J/100/O", "atom2_id": "///J/104/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1233, "atom1_serNum": 12473, "atom2_serNum": 12490, "donAcc_type": "standard", "distance": 2.876, "atom1_id": "///J/101/O", "atom2_id": "///J/105/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1234, "atom1_serNum": 12478, "atom2_serNum": 12495, "donAcc_type": "standard", "distance": 2.920, "atom1_id": "///J/102/O", "atom2_id": "///J/106/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1235, "atom1_serNum": 12488, "atom2_serNum": 12500, "donAcc_type": "standard", "distance": 2.800, "atom1_id": "///J/104/O", "atom2_id": "///J/107/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1236, "atom1_serNum": 12518, "atom2_serNum": 12525, "donAcc_type": "standard", "distance": 2.966, "atom1_id": "///J/110/O", "atom2_id": "///J/112/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1237, "atom1_serNum": 12533, "atom2_serNum": 12545, "donAcc_type": "standard", "distance": 3.067, "atom1_id": "///J/113/O", "atom2_id": "///J/116/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1238, "atom1_serNum": 12538, "atom2_serNum": 12550, "donAcc_type": "standard", "distance": 2.897, "atom1_id": "///J/114/O", "atom2_id": "///J/117/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1239, "atom1_serNum": 12538, "atom2_serNum": 12555, "donAcc_type": "standard", "distance": 2.857, "atom1_id": "///J/114/O", "atom2_id": "///J/118/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1240, "atom1_serNum": 12543, "atom2_serNum": 12560, "donAcc_type": "standard", "distance": 2.812, "atom1_id": "///J/115/O", "atom2_id": "///J/119/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1241, "atom1_serNum": 12553, "atom2_serNum": 12565, "donAcc_type": "standard", "distance": 2.934, "atom1_id": "///J/117/O", "atom2_id": "///J/120/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1242, "atom1_serNum": 12553, "atom2_serNum": 12570, "donAcc_type": "standard", "distance": 3.182, "atom1_id": "///J/117/O", "atom2_id": "///J/121/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1243, "atom1_serNum": 12558, "atom2_serNum": 12575, "donAcc_type": "standard", "distance": 2.978, "atom1_id": "///J/118/O", "atom2_id": "///J/122/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1244, "atom1_serNum": 12563, "atom2_serNum": 12580, "donAcc_type": "standard", "distance": 2.438, "atom1_id": "///J/119/O", "atom2_id": "///J/123/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1245, "atom1_serNum": 12568, "atom2_serNum": 12585, "donAcc_type": "standard", "distance": 3.018, "atom1_id": "///J/120/O", "atom2_id": "///J/124/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1246, "atom1_serNum": 12573, "atom2_serNum": 12585, "donAcc_type": "standard", "distance": 2.977, "atom1_id": "///J/121/O", "atom2_id": "///J/124/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1247, "atom1_serNum": 12573, "atom2_serNum": 12590, "donAcc_type": "standard", "distance": 2.664, "atom1_id": "///J/121/O", "atom2_id": "///J/125/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1248, "atom1_serNum": 12588, "atom2_serNum": 12600, "donAcc_type": "standard", "distance": 2.886, "atom1_id": "///J/124/O", "atom2_id": "///J/127/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1249, "atom1_serNum": 12588, "atom2_serNum": 12605, "donAcc_type": "standard", "distance": 2.453, "atom1_id": "///J/124/O", "atom2_id": "///J/128/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1250, "atom1_serNum": 12624, "atom2_serNum": 12631, "donAcc_type": "standard", "distance": 2.935, "atom1_id": "///K/8/O", "atom2_id": "///K/10/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1251, "atom1_serNum": 12629, "atom2_serNum": 12636, "donAcc_type": "standard", "distance": 3.000, "atom1_id": "///K/9/O", "atom2_id": "///K/11/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1252, "atom1_serNum": 12654, "atom2_serNum": 12661, "donAcc_type": "standard", "distance": 2.896, "atom1_id": "///K/14/O", "atom2_id": "///K/16/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1253, "atom1_serNum": 12669, "atom2_serNum": 12676, "donAcc_type": "standard", "distance": 2.552, "atom1_id": "///K/17/O", "atom2_id": "///K/19/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1254, "atom1_serNum": 12674, "atom2_serNum": 12681, "donAcc_type": "standard", "distance": 2.876, "atom1_id": "///K/18/O", "atom2_id": "///K/20/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1255, "atom1_serNum": 12684, "atom2_serNum": 12691, "donAcc_type": "standard", "distance": 2.783, "atom1_id": "///K/20/O", "atom2_id": "///K/22/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1256, "atom1_serNum": 12684, "atom2_serNum": 12696, "donAcc_type": "standard", "distance": 2.498, "atom1_id": "///K/20/O", "atom2_id": "///K/23/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1257, "atom1_serNum": 12689, "atom2_serNum": 12706, "donAcc_type": "standard", "distance": 2.736, "atom1_id": "///K/21/O", "atom2_id": "///K/25/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1258, "atom1_serNum": 12694, "atom2_serNum": 12711, "donAcc_type": "standard", "distance": 2.905, "atom1_id": "///K/22/O", "atom2_id": "///K/26/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1259, "atom1_serNum": 12699, "atom2_serNum": 12716, "donAcc_type": "standard", "distance": 2.913, "atom1_id": "///K/23/O", "atom2_id": "///K/27/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1260, "atom1_serNum": 12704, "atom2_serNum": 12721, "donAcc_type": "standard", "distance": 2.813, "atom1_id": "///K/24/O", "atom2_id": "///K/28/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1261, "atom1_serNum": 12709, "atom2_serNum": 12726, "donAcc_type": "standard", "distance": 2.875, "atom1_id": "///K/25/O", "atom2_id": "///K/29/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1262, "atom1_serNum": 12714, "atom2_serNum": 12731, "donAcc_type": "standard", "distance": 2.895, "atom1_id": "///K/26/O", "atom2_id": "///K/30/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1263, "atom1_serNum": 12719, "atom2_serNum": 12736, "donAcc_type": "standard", "distance": 2.880, "atom1_id": "///K/27/O", "atom2_id": "///K/31/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1264, "atom1_serNum": 12724, "atom2_serNum": 12741, "donAcc_type": "standard", "distance": 2.879, "atom1_id": "///K/28/O", "atom2_id": "///K/32/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1265, "atom1_serNum": 12729, "atom2_serNum": 12741, "donAcc_type": "standard", "distance": 2.936, "atom1_id": "///K/29/O", "atom2_id": "///K/32/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1266, "atom1_serNum": 12729, "atom2_serNum": 12746, "donAcc_type": "standard", "distance": 3.422, "atom1_id": "///K/29/O", "atom2_id": "///K/33/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1267, "atom1_serNum": 12739, "atom2_serNum": 12749, "donAcc_type": "questionable", "distance": 2.959, "atom1_id": "///K/31/O", "atom2_id": "///K/33/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1268, "atom1_serNum": 12754, "atom2_serNum": 12761, "donAcc_type": "standard", "distance": 2.901, "atom1_id": "///K/34/O", "atom2_id": "///K/36/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1269, "atom1_serNum": 12764, "atom2_serNum": 12771, "donAcc_type": "standard", "distance": 2.611, "atom1_id": "///K/36/O", "atom2_id": "///K/38/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1270, "atom1_serNum": 12779, "atom2_serNum": 12796, "donAcc_type": "standard", "distance": 2.891, "atom1_id": "///K/39/O", "atom2_id": "///K/43/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1271, "atom1_serNum": 12784, "atom2_serNum": 12801, "donAcc_type": "standard", "distance": 2.850, "atom1_id": "///K/40/O", "atom2_id": "///K/44/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1272, "atom1_serNum": 12789, "atom2_serNum": 12806, "donAcc_type": "standard", "distance": 2.921, "atom1_id": "///K/41/O", "atom2_id": "///K/45/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1273, "atom1_serNum": 12799, "atom2_serNum": 12816, "donAcc_type": "standard", "distance": 2.917, "atom1_id": "///K/43/O", "atom2_id": "///K/47/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1274, "atom1_serNum": 12804, "atom2_serNum": 12821, "donAcc_type": "standard", "distance": 2.881, "atom1_id": "///K/44/O", "atom2_id": "///K/48/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1275, "atom1_serNum": 12809, "atom2_serNum": 12826, "donAcc_type": "standard", "distance": 2.892, "atom1_id": "///K/45/O", "atom2_id": "///K/49/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1276, "atom1_serNum": 12814, "atom2_serNum": 12831, "donAcc_type": "standard", "distance": 2.933, "atom1_id": "///K/46/O", "atom2_id": "///K/50/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1277, "atom1_serNum": 12819, "atom2_serNum": 12836, "donAcc_type": "standard", "distance": 2.891, "atom1_id": "///K/47/O", "atom2_id": "///K/51/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1278, "atom1_serNum": 12824, "atom2_serNum": 12841, "donAcc_type": "standard", "distance": 2.868, "atom1_id": "///K/48/O", "atom2_id": "///K/52/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1279, "atom1_serNum": 12834, "atom2_serNum": 12849, "donAcc_type": "questionable", "distance": 2.883, "atom1_id": "///K/50/O", "atom2_id": "///K/53/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1280, "atom1_serNum": 12839, "atom2_serNum": 12861, "donAcc_type": "standard", "distance": 3.242, "atom1_id": "///K/51/O", "atom2_id": "///K/56/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1281, "atom1_serNum": 12844, "atom2_serNum": 12866, "donAcc_type": "standard", "distance": 3.541, "atom1_id": "///K/52/O", "atom2_id": "///K/57/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1282, "atom1_serNum": 12849, "atom2_serNum": 12856, "donAcc_type": "standard", "distance": 2.771, "atom1_id": "///K/53/O", "atom2_id": "///K/55/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1283, "atom1_serNum": 12859, "atom2_serNum": 12876, "donAcc_type": "standard", "distance": 2.500, "atom1_id": "///K/55/O", "atom2_id": "///K/59/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1284, "atom1_serNum": 12869, "atom2_serNum": 12881, "donAcc_type": "standard", "distance": 3.787, "atom1_id": "///K/57/O", "atom2_id": "///K/60/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1285, "atom1_serNum": 12874, "atom2_serNum": 12886, "donAcc_type": "standard", "distance": 2.721, "atom1_id": "///K/58/O", "atom2_id": "///K/61/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1286, "atom1_serNum": 12889, "atom2_serNum": 12896, "donAcc_type": "standard", "distance": 2.516, "atom1_id": "///K/61/O", "atom2_id": "///K/63/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1287, "atom1_serNum": 12899, "atom2_serNum": 12916, "donAcc_type": "standard", "distance": 3.765, "atom1_id": "///K/63/O", "atom2_id": "///K/67/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1288, "atom1_serNum": 12904, "atom2_serNum": 12921, "donAcc_type": "standard", "distance": 2.848, "atom1_id": "///K/64/O", "atom2_id": "///K/68/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1289, "atom1_serNum": 12909, "atom2_serNum": 12926, "donAcc_type": "standard", "distance": 2.943, "atom1_id": "///K/65/O", "atom2_id": "///K/69/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1290, "atom1_serNum": 12914, "atom2_serNum": 12931, "donAcc_type": "standard", "distance": 2.909, "atom1_id": "///K/66/O", "atom2_id": "///K/70/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1291, "atom1_serNum": 12919, "atom2_serNum": 12936, "donAcc_type": "standard", "distance": 2.872, "atom1_id": "///K/67/O", "atom2_id": "///K/71/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1292, "atom1_serNum": 12924, "atom2_serNum": 12941, "donAcc_type": "standard", "distance": 2.995, "atom1_id": "///K/68/O", "atom2_id": "///K/72/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1293, "atom1_serNum": 12934, "atom2_serNum": 12951, "donAcc_type": "standard", "distance": 2.872, "atom1_id": "///K/70/O", "atom2_id": "///K/74/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1294, "atom1_serNum": 12939, "atom2_serNum": 12956, "donAcc_type": "standard", "distance": 2.946, "atom1_id": "///K/71/O", "atom2_id": "///K/75/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1295, "atom1_serNum": 12944, "atom2_serNum": 12961, "donAcc_type": "standard", "distance": 3.442, "atom1_id": "///K/72/O", "atom2_id": "///K/76/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1296, "atom1_serNum": 12949, "atom2_serNum": 12966, "donAcc_type": "standard", "distance": 2.981, "atom1_id": "///K/73/O", "atom2_id": "///K/77/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1297, "atom1_serNum": 12959, "atom2_serNum": 12971, "donAcc_type": "standard", "distance": 3.109, "atom1_id": "///K/75/O", "atom2_id": "///K/78/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1298, "atom1_serNum": 12959, "atom2_serNum": 12976, "donAcc_type": "standard", "distance": 3.466, "atom1_id": "///K/75/O", "atom2_id": "///K/79/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1299, "atom1_serNum": 12964, "atom2_serNum": 12981, "donAcc_type": "standard", "distance": 2.928, "atom1_id": "///K/76/O", "atom2_id": "///K/80/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1300, "atom1_serNum": 12969, "atom2_serNum": 12986, "donAcc_type": "standard", "distance": 2.895, "atom1_id": "///K/77/O", "atom2_id": "///K/81/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1301, "atom1_serNum": 12974, "atom2_serNum": 12991, "donAcc_type": "standard", "distance": 2.927, "atom1_id": "///K/78/O", "atom2_id": "///K/82/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1302, "atom1_serNum": 12979, "atom2_serNum": 12996, "donAcc_type": "standard", "distance": 2.866, "atom1_id": "///K/79/O", "atom2_id": "///K/83/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1303, "atom1_serNum": 12994, "atom2_serNum": 13006, "donAcc_type": "standard", "distance": 2.965, "atom1_id": "///K/82/O", "atom2_id": "///K/85/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1304, "atom1_serNum": 12999, "atom2_serNum": 13011, "donAcc_type": "standard", "distance": 3.798, "atom1_id": "///K/83/O", "atom2_id": "///K/86/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1305, "atom1_serNum": 13004, "atom2_serNum": 13026, "donAcc_type": "standard", "distance": 2.583, "atom1_id": "///K/84/O", "atom2_id": "///K/89/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1306, "atom1_serNum": 13039, "atom2_serNum": 13056, "donAcc_type": "standard", "distance": 3.052, "atom1_id": "///K/96/O", "atom2_id": "///K/100/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1307, "atom1_serNum": 13044, "atom2_serNum": 13061, "donAcc_type": "standard", "distance": 2.917, "atom1_id": "///K/97/O", "atom2_id": "///K/101/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1308, "atom1_serNum": 13049, "atom2_serNum": 13066, "donAcc_type": "standard", "distance": 2.883, "atom1_id": "///K/98/O", "atom2_id": "///K/102/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1309, "atom1_serNum": 13054, "atom2_serNum": 13071, "donAcc_type": "standard", "distance": 2.945, "atom1_id": "///K/99/O", "atom2_id": "///K/103/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1310, "atom1_serNum": 13059, "atom2_serNum": 13076, "donAcc_type": "standard", "distance": 2.926, "atom1_id": "///K/100/O", "atom2_id": "///K/104/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1311, "atom1_serNum": 13064, "atom2_serNum": 13081, "donAcc_type": "standard", "distance": 2.876, "atom1_id": "///K/101/O", "atom2_id": "///K/105/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1312, "atom1_serNum": 13069, "atom2_serNum": 13086, "donAcc_type": "standard", "distance": 2.920, "atom1_id": "///K/102/O", "atom2_id": "///K/106/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1313, "atom1_serNum": 13079, "atom2_serNum": 13091, "donAcc_type": "standard", "distance": 2.800, "atom1_id": "///K/104/O", "atom2_id": "///K/107/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1314, "atom1_serNum": 13109, "atom2_serNum": 13116, "donAcc_type": "standard", "distance": 2.966, "atom1_id": "///K/110/O", "atom2_id": "///K/112/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1315, "atom1_serNum": 13124, "atom2_serNum": 13136, "donAcc_type": "standard", "distance": 3.067, "atom1_id": "///K/113/O", "atom2_id": "///K/116/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1316, "atom1_serNum": 13129, "atom2_serNum": 13141, "donAcc_type": "standard", "distance": 2.898, "atom1_id": "///K/114/O", "atom2_id": "///K/117/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1317, "atom1_serNum": 13129, "atom2_serNum": 13146, "donAcc_type": "standard", "distance": 2.857, "atom1_id": "///K/114/O", "atom2_id": "///K/118/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1318, "atom1_serNum": 13134, "atom2_serNum": 13151, "donAcc_type": "standard", "distance": 2.813, "atom1_id": "///K/115/O", "atom2_id": "///K/119/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1319, "atom1_serNum": 13144, "atom2_serNum": 13156, "donAcc_type": "standard", "distance": 2.934, "atom1_id": "///K/117/O", "atom2_id": "///K/120/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1320, "atom1_serNum": 13144, "atom2_serNum": 13161, "donAcc_type": "standard", "distance": 3.181, "atom1_id": "///K/117/O", "atom2_id": "///K/121/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1321, "atom1_serNum": 13149, "atom2_serNum": 13166, "donAcc_type": "standard", "distance": 2.976, "atom1_id": "///K/118/O", "atom2_id": "///K/122/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1322, "atom1_serNum": 13154, "atom2_serNum": 13171, "donAcc_type": "standard", "distance": 2.438, "atom1_id": "///K/119/O", "atom2_id": "///K/123/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1323, "atom1_serNum": 13159, "atom2_serNum": 13176, "donAcc_type": "standard", "distance": 3.019, "atom1_id": "///K/120/O", "atom2_id": "///K/124/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1324, "atom1_serNum": 13164, "atom2_serNum": 13176, "donAcc_type": "standard", "distance": 2.977, "atom1_id": "///K/121/O", "atom2_id": "///K/124/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1325, "atom1_serNum": 13164, "atom2_serNum": 13181, "donAcc_type": "standard", "distance": 2.663, "atom1_id": "///K/121/O", "atom2_id": "///K/125/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1326, "atom1_serNum": 13179, "atom2_serNum": 13191, "donAcc_type": "standard", "distance": 2.886, "atom1_id": "///K/124/O", "atom2_id": "///K/127/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1327, "atom1_serNum": 13179, "atom2_serNum": 13196, "donAcc_type": "standard", "distance": 2.452, "atom1_id": "///K/124/O", "atom2_id": "///K/128/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1328, "atom1_serNum": 13215, "atom2_serNum": 13222, "donAcc_type": "standard", "distance": 2.935, "atom1_id": "///L/8/O", "atom2_id": "///L/10/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1329, "atom1_serNum": 13220, "atom2_serNum": 13227, "donAcc_type": "standard", "distance": 3.000, "atom1_id": "///L/9/O", "atom2_id": "///L/11/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1330, "atom1_serNum": 13245, "atom2_serNum": 13252, "donAcc_type": "standard", "distance": 2.895, "atom1_id": "///L/14/O", "atom2_id": "///L/16/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1331, "atom1_serNum": 13260, "atom2_serNum": 13267, "donAcc_type": "standard", "distance": 2.552, "atom1_id": "///L/17/O", "atom2_id": "///L/19/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1332, "atom1_serNum": 13265, "atom2_serNum": 13272, "donAcc_type": "standard", "distance": 2.876, "atom1_id": "///L/18/O", "atom2_id": "///L/20/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1333, "atom1_serNum": 13275, "atom2_serNum": 13282, "donAcc_type": "standard", "distance": 2.784, "atom1_id": "///L/20/O", "atom2_id": "///L/22/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1334, "atom1_serNum": 13275, "atom2_serNum": 13287, "donAcc_type": "standard", "distance": 2.498, "atom1_id": "///L/20/O", "atom2_id": "///L/23/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1335, "atom1_serNum": 13280, "atom2_serNum": 13297, "donAcc_type": "standard", "distance": 2.736, "atom1_id": "///L/21/O", "atom2_id": "///L/25/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1336, "atom1_serNum": 13285, "atom2_serNum": 13302, "donAcc_type": "standard", "distance": 2.905, "atom1_id": "///L/22/O", "atom2_id": "///L/26/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1337, "atom1_serNum": 13290, "atom2_serNum": 13307, "donAcc_type": "standard", "distance": 2.912, "atom1_id": "///L/23/O", "atom2_id": "///L/27/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1338, "atom1_serNum": 13295, "atom2_serNum": 13312, "donAcc_type": "standard", "distance": 2.814, "atom1_id": "///L/24/O", "atom2_id": "///L/28/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1339, "atom1_serNum": 13300, "atom2_serNum": 13317, "donAcc_type": "standard", "distance": 2.875, "atom1_id": "///L/25/O", "atom2_id": "///L/29/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1340, "atom1_serNum": 13305, "atom2_serNum": 13322, "donAcc_type": "standard", "distance": 2.895, "atom1_id": "///L/26/O", "atom2_id": "///L/30/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1341, "atom1_serNum": 13310, "atom2_serNum": 13327, "donAcc_type": "standard", "distance": 2.881, "atom1_id": "///L/27/O", "atom2_id": "///L/31/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1342, "atom1_serNum": 13315, "atom2_serNum": 13332, "donAcc_type": "standard", "distance": 2.879, "atom1_id": "///L/28/O", "atom2_id": "///L/32/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1343, "atom1_serNum": 13320, "atom2_serNum": 13332, "donAcc_type": "standard", "distance": 2.936, "atom1_id": "///L/29/O", "atom2_id": "///L/32/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1344, "atom1_serNum": 13320, "atom2_serNum": 13337, "donAcc_type": "standard", "distance": 3.421, "atom1_id": "///L/29/O", "atom2_id": "///L/33/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1345, "atom1_serNum": 13330, "atom2_serNum": 13340, "donAcc_type": "questionable", "distance": 2.958, "atom1_id": "///L/31/O", "atom2_id": "///L/33/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1346, "atom1_serNum": 13345, "atom2_serNum": 13352, "donAcc_type": "standard", "distance": 2.901, "atom1_id": "///L/34/O", "atom2_id": "///L/36/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1347, "atom1_serNum": 13355, "atom2_serNum": 13362, "donAcc_type": "standard", "distance": 2.610, "atom1_id": "///L/36/O", "atom2_id": "///L/38/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1348, "atom1_serNum": 13370, "atom2_serNum": 13387, "donAcc_type": "standard", "distance": 2.892, "atom1_id": "///L/39/O", "atom2_id": "///L/43/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1349, "atom1_serNum": 13375, "atom2_serNum": 13392, "donAcc_type": "standard", "distance": 2.851, "atom1_id": "///L/40/O", "atom2_id": "///L/44/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1350, "atom1_serNum": 13380, "atom2_serNum": 13397, "donAcc_type": "standard", "distance": 2.921, "atom1_id": "///L/41/O", "atom2_id": "///L/45/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1351, "atom1_serNum": 13390, "atom2_serNum": 13407, "donAcc_type": "standard", "distance": 2.917, "atom1_id": "///L/43/O", "atom2_id": "///L/47/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1352, "atom1_serNum": 13395, "atom2_serNum": 13412, "donAcc_type": "standard", "distance": 2.881, "atom1_id": "///L/44/O", "atom2_id": "///L/48/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1353, "atom1_serNum": 13400, "atom2_serNum": 13417, "donAcc_type": "standard", "distance": 2.892, "atom1_id": "///L/45/O", "atom2_id": "///L/49/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1354, "atom1_serNum": 13405, "atom2_serNum": 13422, "donAcc_type": "standard", "distance": 2.933, "atom1_id": "///L/46/O", "atom2_id": "///L/50/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1355, "atom1_serNum": 13410, "atom2_serNum": 13427, "donAcc_type": "standard", "distance": 2.891, "atom1_id": "///L/47/O", "atom2_id": "///L/51/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1356, "atom1_serNum": 13415, "atom2_serNum": 13432, "donAcc_type": "standard", "distance": 2.866, "atom1_id": "///L/48/O", "atom2_id": "///L/52/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1357, "atom1_serNum": 13425, "atom2_serNum": 13440, "donAcc_type": "questionable", "distance": 2.882, "atom1_id": "///L/50/O", "atom2_id": "///L/53/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1358, "atom1_serNum": 13430, "atom2_serNum": 13452, "donAcc_type": "standard", "distance": 3.242, "atom1_id": "///L/51/O", "atom2_id": "///L/56/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1359, "atom1_serNum": 13435, "atom2_serNum": 13457, "donAcc_type": "standard", "distance": 3.541, "atom1_id": "///L/52/O", "atom2_id": "///L/57/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1360, "atom1_serNum": 13440, "atom2_serNum": 13447, "donAcc_type": "standard", "distance": 2.771, "atom1_id": "///L/53/O", "atom2_id": "///L/55/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1361, "atom1_serNum": 13450, "atom2_serNum": 13467, "donAcc_type": "standard", "distance": 2.500, "atom1_id": "///L/55/O", "atom2_id": "///L/59/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1362, "atom1_serNum": 13460, "atom2_serNum": 13472, "donAcc_type": "standard", "distance": 3.788, "atom1_id": "///L/57/O", "atom2_id": "///L/60/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1363, "atom1_serNum": 13465, "atom2_serNum": 13477, "donAcc_type": "standard", "distance": 2.722, "atom1_id": "///L/58/O", "atom2_id": "///L/61/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1364, "atom1_serNum": 13480, "atom2_serNum": 13487, "donAcc_type": "standard", "distance": 2.515, "atom1_id": "///L/61/O", "atom2_id": "///L/63/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1365, "atom1_serNum": 13490, "atom2_serNum": 13507, "donAcc_type": "standard", "distance": 3.767, "atom1_id": "///L/63/O", "atom2_id": "///L/67/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1366, "atom1_serNum": 13495, "atom2_serNum": 13512, "donAcc_type": "standard", "distance": 2.849, "atom1_id": "///L/64/O", "atom2_id": "///L/68/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1367, "atom1_serNum": 13500, "atom2_serNum": 13517, "donAcc_type": "standard", "distance": 2.944, "atom1_id": "///L/65/O", "atom2_id": "///L/69/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1368, "atom1_serNum": 13505, "atom2_serNum": 13522, "donAcc_type": "standard", "distance": 2.909, "atom1_id": "///L/66/O", "atom2_id": "///L/70/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1369, "atom1_serNum": 13510, "atom2_serNum": 13527, "donAcc_type": "standard", "distance": 2.872, "atom1_id": "///L/67/O", "atom2_id": "///L/71/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1370, "atom1_serNum": 13515, "atom2_serNum": 13532, "donAcc_type": "standard", "distance": 2.995, "atom1_id": "///L/68/O", "atom2_id": "///L/72/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1371, "atom1_serNum": 13525, "atom2_serNum": 13542, "donAcc_type": "standard", "distance": 2.872, "atom1_id": "///L/70/O", "atom2_id": "///L/74/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1372, "atom1_serNum": 13530, "atom2_serNum": 13547, "donAcc_type": "standard", "distance": 2.945, "atom1_id": "///L/71/O", "atom2_id": "///L/75/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1373, "atom1_serNum": 13535, "atom2_serNum": 13552, "donAcc_type": "standard", "distance": 3.441, "atom1_id": "///L/72/O", "atom2_id": "///L/76/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1374, "atom1_serNum": 13540, "atom2_serNum": 13557, "donAcc_type": "standard", "distance": 2.981, "atom1_id": "///L/73/O", "atom2_id": "///L/77/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1375, "atom1_serNum": 13550, "atom2_serNum": 13562, "donAcc_type": "standard", "distance": 3.109, "atom1_id": "///L/75/O", "atom2_id": "///L/78/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1376, "atom1_serNum": 13550, "atom2_serNum": 13567, "donAcc_type": "standard", "distance": 3.465, "atom1_id": "///L/75/O", "atom2_id": "///L/79/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1377, "atom1_serNum": 13555, "atom2_serNum": 13572, "donAcc_type": "standard", "distance": 2.928, "atom1_id": "///L/76/O", "atom2_id": "///L/80/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1378, "atom1_serNum": 13560, "atom2_serNum": 13577, "donAcc_type": "standard", "distance": 2.896, "atom1_id": "///L/77/O", "atom2_id": "///L/81/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1379, "atom1_serNum": 13565, "atom2_serNum": 13582, "donAcc_type": "standard", "distance": 2.927, "atom1_id": "///L/78/O", "atom2_id": "///L/82/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1380, "atom1_serNum": 13570, "atom2_serNum": 13587, "donAcc_type": "standard", "distance": 2.867, "atom1_id": "///L/79/O", "atom2_id": "///L/83/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1381, "atom1_serNum": 13585, "atom2_serNum": 13597, "donAcc_type": "standard", "distance": 2.966, "atom1_id": "///L/82/O", "atom2_id": "///L/85/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1382, "atom1_serNum": 13590, "atom2_serNum": 13602, "donAcc_type": "standard", "distance": 3.798, "atom1_id": "///L/83/O", "atom2_id": "///L/86/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1383, "atom1_serNum": 13595, "atom2_serNum": 13617, "donAcc_type": "standard", "distance": 2.583, "atom1_id": "///L/84/O", "atom2_id": "///L/89/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1384, "atom1_serNum": 13630, "atom2_serNum": 13647, "donAcc_type": "standard", "distance": 3.051, "atom1_id": "///L/96/O", "atom2_id": "///L/100/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1385, "atom1_serNum": 13635, "atom2_serNum": 13652, "donAcc_type": "standard", "distance": 2.917, "atom1_id": "///L/97/O", "atom2_id": "///L/101/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1386, "atom1_serNum": 13640, "atom2_serNum": 13657, "donAcc_type": "standard", "distance": 2.883, "atom1_id": "///L/98/O", "atom2_id": "///L/102/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1387, "atom1_serNum": 13645, "atom2_serNum": 13662, "donAcc_type": "standard", "distance": 2.945, "atom1_id": "///L/99/O", "atom2_id": "///L/103/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1388, "atom1_serNum": 13650, "atom2_serNum": 13667, "donAcc_type": "standard", "distance": 2.925, "atom1_id": "///L/100/O", "atom2_id": "///L/104/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1389, "atom1_serNum": 13655, "atom2_serNum": 13672, "donAcc_type": "standard", "distance": 2.876, "atom1_id": "///L/101/O", "atom2_id": "///L/105/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1390, "atom1_serNum": 13660, "atom2_serNum": 13677, "donAcc_type": "standard", "distance": 2.920, "atom1_id": "///L/102/O", "atom2_id": "///L/106/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1391, "atom1_serNum": 13670, "atom2_serNum": 13682, "donAcc_type": "standard", "distance": 2.800, "atom1_id": "///L/104/O", "atom2_id": "///L/107/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1392, "atom1_serNum": 13700, "atom2_serNum": 13707, "donAcc_type": "standard", "distance": 2.965, "atom1_id": "///L/110/O", "atom2_id": "///L/112/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1393, "atom1_serNum": 13715, "atom2_serNum": 13727, "donAcc_type": "standard", "distance": 3.067, "atom1_id": "///L/113/O", "atom2_id": "///L/116/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1394, "atom1_serNum": 13720, "atom2_serNum": 13732, "donAcc_type": "standard", "distance": 2.898, "atom1_id": "///L/114/O", "atom2_id": "///L/117/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1395, "atom1_serNum": 13720, "atom2_serNum": 13737, "donAcc_type": "standard", "distance": 2.857, "atom1_id": "///L/114/O", "atom2_id": "///L/118/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1396, "atom1_serNum": 13725, "atom2_serNum": 13742, "donAcc_type": "standard", "distance": 2.812, "atom1_id": "///L/115/O", "atom2_id": "///L/119/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1397, "atom1_serNum": 13735, "atom2_serNum": 13747, "donAcc_type": "standard", "distance": 2.934, "atom1_id": "///L/117/O", "atom2_id": "///L/120/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1398, "atom1_serNum": 13735, "atom2_serNum": 13752, "donAcc_type": "standard", "distance": 3.181, "atom1_id": "///L/117/O", "atom2_id": "///L/121/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1399, "atom1_serNum": 13740, "atom2_serNum": 13757, "donAcc_type": "standard", "distance": 2.978, "atom1_id": "///L/118/O", "atom2_id": "///L/122/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1400, "atom1_serNum": 13745, "atom2_serNum": 13762, "donAcc_type": "standard", "distance": 2.439, "atom1_id": "///L/119/O", "atom2_id": "///L/123/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1401, "atom1_serNum": 13750, "atom2_serNum": 13767, "donAcc_type": "standard", "distance": 3.018, "atom1_id": "///L/120/O", "atom2_id": "///L/124/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1402, "atom1_serNum": 13755, "atom2_serNum": 13767, "donAcc_type": "standard", "distance": 2.976, "atom1_id": "///L/121/O", "atom2_id": "///L/124/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1403, "atom1_serNum": 13755, "atom2_serNum": 13772, "donAcc_type": "standard", "distance": 2.663, "atom1_id": "///L/121/O", "atom2_id": "///L/125/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1404, "atom1_serNum": 13770, "atom2_serNum": 13782, "donAcc_type": "standard", "distance": 2.886, "atom1_id": "///L/124/O", "atom2_id": "///L/127/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1405, "atom1_serNum": 13770, "atom2_serNum": 13787, "donAcc_type": "standard", "distance": 2.453, "atom1_id": "///L/124/O", "atom2_id": "///L/128/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1406, "atom1_serNum": 13808, "atom2_serNum": 13821, "donAcc_type": "acceptable", "distance": 3.048, "atom1_id": "///M/-3/O2'", "atom2_id": "///M/-2/O5'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 1407, "atom1_serNum": 13808, "atom2_serNum": 13824, "donAcc_type": "acceptable", "distance": 2.547, "atom1_id": "///M/-3/O2'", "atom2_id": "///M/-2/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 1408, "atom1_serNum": 13858, "atom2_serNum": 13878, "donAcc_type": "standard", "distance": 3.169, "atom1_id": "///M/-1/N4", "atom2_id": "///M/0/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1409, "atom1_serNum": 13871, "atom2_serNum": 13907, "donAcc_type": "acceptable", "distance": 2.368, "atom1_id": "///M/0/O2'", "atom2_id": "///M/2/OP1", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 1410, "atom1_serNum": 13882, "atom2_serNum": 13901, "donAcc_type": "standard", "distance": 3.821, "atom1_id": "///M/0/N3", "atom2_id": "///M/1/N6", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1411, "atom1_serNum": 13916, "atom2_serNum": 13934, "donAcc_type": "acceptable", "distance": 3.543, "atom1_id": "///M/2/O2'", "atom2_id": "///M/3/O3'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 1412, "atom1_serNum": 13916, "atom2_serNum": 13949, "donAcc_type": "acceptable", "distance": 3.341, "atom1_id": "///M/2/O2'", "atom2_id": "///M/4/O5'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 1413, "atom1_serNum": 13936, "atom2_serNum": 13948, "donAcc_type": "acceptable", "distance": 2.804, "atom1_id": "///M/3/O2'", "atom2_id": "///M/4/OP2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 1414, "atom1_serNum": 14004, "atom2_serNum": 15195, "donAcc_type": "acceptable", "distance": 3.214, "atom1_id": "///M/6/N3", "atom2_id": "///N/37/O2'", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1415, "atom1_serNum": 14006, "atom2_serNum": 15193, "donAcc_type": "questionable", "distance": 2.862, "atom1_id": "///M/6/O4", "atom2_id": "///N/37/O3'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 1416, "atom1_serNum": 14019, "atom2_serNum": 14034, "donAcc_type": "acceptable", "distance": 2.413, "atom1_id": "///M/7/O2'", "atom2_id": "///M/8/O5'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 1417, "atom1_serNum": 14026, "atom2_serNum": 15193, "donAcc_type": "standard", "distance": 2.295, "atom1_id": "///M/7/N6", "atom2_id": "///N/37/O3'", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1418, "atom1_serNum": 14032, "atom2_serNum": 14051, "donAcc_type": "standard", "distance": 3.256, "atom1_id": "///M/8/OP1", "atom2_id": "///M/8/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1419, "atom1_serNum": 14041, "atom2_serNum": 14062, "donAcc_type": "acceptable", "distance": 3.408, "atom1_id": "///M/8/O2'", "atom2_id": "///M/9/O3'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 1420, "atom1_serNum": 14041, "atom2_serNum": 14077, "donAcc_type": "acceptable", "distance": 3.179, "atom1_id": "///M/8/O2'", "atom2_id": "///M/10/OP1", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 1421, "atom1_serNum": 14064, "atom2_serNum": 14078, "donAcc_type": "acceptable", "distance": 2.567, "atom1_id": "///M/9/O2'", "atom2_id": "///M/10/OP2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 1422, "atom1_serNum": 14072, "atom2_serNum": 15140, "donAcc_type": "standard", "distance": 3.326, "atom1_id": "///M/9/N1", "atom2_id": "///N/34/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1423, "atom1_serNum": 14072, "atom2_serNum": 15142, "donAcc_type": "questionable", "distance": 2.862, "atom1_id": "///M/9/N1", "atom2_id": "///N/34/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1424, "atom1_serNum": 14091, "atom2_serNum": 15121, "donAcc_type": "standard", "distance": 2.832, "atom1_id": "///M/10/N3", "atom2_id": "///N/33/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1425, "atom1_serNum": 14093, "atom2_serNum": 15120, "donAcc_type": "standard", "distance": 3.047, "atom1_id": "///M/10/O4", "atom2_id": "///N/33/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1426, "atom1_serNum": 14113, "atom2_serNum": 15100, "donAcc_type": "standard", "distance": 2.896, "atom1_id": "///M/11/N6", "atom2_id": "///N/32/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1427, "atom1_serNum": 14114, "atom2_serNum": 15098, "donAcc_type": "standard", "distance": 2.702, "atom1_id": "///M/11/N1", "atom2_id": "///N/32/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1428, "atom1_serNum": 14135, "atom2_serNum": 15080, "donAcc_type": "standard", "distance": 2.651, "atom1_id": "///M/12/N6", "atom2_id": "///N/31/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1429, "atom1_serNum": 14136, "atom2_serNum": 15078, "donAcc_type": "standard", "distance": 2.782, "atom1_id": "///M/12/N1", "atom2_id": "///N/31/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1430, "atom1_serNum": 14150, "atom2_serNum": 14166, "donAcc_type": "acceptable", "distance": 3.161, "atom1_id": "///M/13/O2'", "atom2_id": "///M/14/O5'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 1431, "atom1_serNum": 14157, "atom2_serNum": 15060, "donAcc_type": "standard", "distance": 3.011, "atom1_id": "///M/13/O6", "atom2_id": "///N/30/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1432, "atom1_serNum": 14158, "atom2_serNum": 15058, "donAcc_type": "standard", "distance": 2.938, "atom1_id": "///M/13/N1", "atom2_id": "///N/30/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1433, "atom1_serNum": 14160, "atom2_serNum": 15057, "donAcc_type": "standard", "distance": 2.810, "atom1_id": "///M/13/N2", "atom2_id": "///N/30/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1434, "atom1_serNum": 14164, "atom2_serNum": 14183, "donAcc_type": "standard", "distance": 3.214, "atom1_id": "///M/14/OP1", "atom2_id": "///M/14/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1435, "atom1_serNum": 14173, "atom2_serNum": 14194, "donAcc_type": "acceptable", "distance": 3.575, "atom1_id": "///M/14/O2'", "atom2_id": "///M/15/O3'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 1436, "atom1_serNum": 14173, "atom2_serNum": 14212, "donAcc_type": "acceptable", "distance": 3.476, "atom1_id": "///M/14/O2'", "atom2_id": "///M/16/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 1437, "atom1_serNum": 14196, "atom2_serNum": 14208, "donAcc_type": "acceptable", "distance": 2.378, "atom1_id": "///M/15/O2'", "atom2_id": "///M/16/OP2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 1438, "atom1_serNum": 14200, "atom2_serNum": 15020, "donAcc_type": "standard", "distance": 2.896, "atom1_id": "///M/15/O2", "atom2_id": "///N/28/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1439, "atom1_serNum": 14201, "atom2_serNum": 15018, "donAcc_type": "standard", "distance": 2.930, "atom1_id": "///M/15/N3", "atom2_id": "///N/28/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1440, "atom1_serNum": 14203, "atom2_serNum": 15017, "donAcc_type": "standard", "distance": 2.880, "atom1_id": "///M/15/N4", "atom2_id": "///N/28/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1441, "atom1_serNum": 14223, "atom2_serNum": 14997, "donAcc_type": "standard", "distance": 2.307, "atom1_id": "///M/16/O6", "atom2_id": "///N/27/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1442, "atom1_serNum": 14224, "atom2_serNum": 14995, "donAcc_type": "standard", "distance": 2.350, "atom1_id": "///M/16/N1", "atom2_id": "///N/27/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1443, "atom1_serNum": 14226, "atom2_serNum": 14994, "donAcc_type": "standard", "distance": 2.351, "atom1_id": "///M/16/N2", "atom2_id": "///N/27/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1444, "atom1_serNum": 14243, "atom2_serNum": 14977, "donAcc_type": "standard", "distance": 2.689, "atom1_id": "///M/17/O2", "atom2_id": "///N/26/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1445, "atom1_serNum": 14244, "atom2_serNum": 14975, "donAcc_type": "standard", "distance": 2.815, "atom1_id": "///M/17/N3", "atom2_id": "///N/26/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1446, "atom1_serNum": 14246, "atom2_serNum": 14974, "donAcc_type": "standard", "distance": 2.855, "atom1_id": "///M/17/N4", "atom2_id": "///N/26/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1447, "atom1_serNum": 14263, "atom2_serNum": 14954, "donAcc_type": "standard", "distance": 3.033, "atom1_id": "///M/18/O2", "atom2_id": "///N/25/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1448, "atom1_serNum": 14264, "atom2_serNum": 14952, "donAcc_type": "standard", "distance": 2.875, "atom1_id": "///M/18/N3", "atom2_id": "///N/25/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1449, "atom1_serNum": 14266, "atom2_serNum": 14951, "donAcc_type": "standard", "distance": 2.688, "atom1_id": "///M/18/N4", "atom2_id": "///N/25/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1450, "atom1_serNum": 14279, "atom2_serNum": 14292, "donAcc_type": "acceptable", "distance": 3.134, "atom1_id": "///M/19/O2'", "atom2_id": "///M/20/O5'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 1451, "atom1_serNum": 14283, "atom2_serNum": 14931, "donAcc_type": "standard", "distance": 2.845, "atom1_id": "///M/19/O2", "atom2_id": "///N/24/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1452, "atom1_serNum": 14284, "atom2_serNum": 14929, "donAcc_type": "standard", "distance": 2.969, "atom1_id": "///M/19/N3", "atom2_id": "///N/24/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1453, "atom1_serNum": 14286, "atom2_serNum": 14928, "donAcc_type": "standard", "distance": 3.033, "atom1_id": "///M/19/N4", "atom2_id": "///N/24/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1454, "atom1_serNum": 14299, "atom2_serNum": 14320, "donAcc_type": "acceptable", "distance": 3.600, "atom1_id": "///M/20/O2'", "atom2_id": "///M/21/O3'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 1455, "atom1_serNum": 14322, "atom2_serNum": 14337, "donAcc_type": "acceptable", "distance": 2.426, "atom1_id": "///M/21/O2'", "atom2_id": "///M/22/OP2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 1456, "atom1_serNum": 14330, "atom2_serNum": 14886, "donAcc_type": "standard", "distance": 2.883, "atom1_id": "///M/21/N1", "atom2_id": "///N/22/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1457, "atom1_serNum": 14332, "atom2_serNum": 14885, "donAcc_type": "standard", "distance": 2.431, "atom1_id": "///M/21/N2", "atom2_id": "///N/22/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1458, "atom1_serNum": 14332, "atom2_serNum": 14886, "donAcc_type": "standard", "distance": 3.138, "atom1_id": "///M/21/N2", "atom2_id": "///N/22/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1459, "atom1_serNum": 14352, "atom2_serNum": 14868, "donAcc_type": "standard", "distance": 2.817, "atom1_id": "///M/22/O6", "atom2_id": "///N/21/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1460, "atom1_serNum": 14353, "atom2_serNum": 14866, "donAcc_type": "standard", "distance": 2.857, "atom1_id": "///M/22/N1", "atom2_id": "///N/21/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1461, "atom1_serNum": 14355, "atom2_serNum": 14865, "donAcc_type": "standard", "distance": 2.819, "atom1_id": "///M/22/N2", "atom2_id": "///N/21/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1462, "atom1_serNum": 14375, "atom2_serNum": 14848, "donAcc_type": "standard", "distance": 2.773, "atom1_id": "///M/23/O6", "atom2_id": "///N/20/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1463, "atom1_serNum": 14376, "atom2_serNum": 14846, "donAcc_type": "standard", "distance": 2.978, "atom1_id": "///M/23/N1", "atom2_id": "///N/20/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1464, "atom1_serNum": 14378, "atom2_serNum": 14845, "donAcc_type": "standard", "distance": 3.325, "atom1_id": "///M/23/N2", "atom2_id": "///N/20/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1465, "atom1_serNum": 14398, "atom2_serNum": 14805, "donAcc_type": "standard", "distance": 3.224, "atom1_id": "///M/24/N6", "atom2_id": "///N/18/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1466, "atom1_serNum": 14398, "atom2_serNum": 14828, "donAcc_type": "standard", "distance": 2.989, "atom1_id": "///M/24/N6", "atom2_id": "///N/19/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1467, "atom1_serNum": 14399, "atom2_serNum": 14826, "donAcc_type": "standard", "distance": 2.952, "atom1_id": "///M/24/N1", "atom2_id": "///N/19/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1468, "atom1_serNum": 14418, "atom2_serNum": 14806, "donAcc_type": "standard", "distance": 2.933, "atom1_id": "///M/25/N3", "atom2_id": "///N/18/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1469, "atom1_serNum": 14420, "atom2_serNum": 14805, "donAcc_type": "standard", "distance": 2.945, "atom1_id": "///M/25/N4", "atom2_id": "///N/18/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1470, "atom1_serNum": 14433, "atom2_serNum": 14447, "donAcc_type": "acceptable", "distance": 2.701, "atom1_id": "///M/26/O2'", "atom2_id": "///M/27/OP1", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 1471, "atom1_serNum": 14433, "atom2_serNum": 14449, "donAcc_type": "acceptable", "distance": 3.155, "atom1_id": "///M/26/O2'", "atom2_id": "///M/27/O5'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 1472, "atom1_serNum": 14456, "atom2_serNum": 14470, "donAcc_type": "acceptable", "distance": 2.482, "atom1_id": "///M/27/O2'", "atom2_id": "///M/28/OP2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 1473, "atom1_serNum": 14464, "atom2_serNum": 14762, "donAcc_type": "questionable", "distance": 3.080, "atom1_id": "///M/27/N1", "atom2_id": "///N/16/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1474, "atom1_serNum": 14464, "atom2_serNum": 14763, "donAcc_type": "standard", "distance": 3.406, "atom1_id": "///M/27/N1", "atom2_id": "///N/16/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1475, "atom1_serNum": 14482, "atom2_serNum": 14745, "donAcc_type": "standard", "distance": 2.695, "atom1_id": "///M/28/O2", "atom2_id": "///N/15/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1476, "atom1_serNum": 14483, "atom2_serNum": 14743, "donAcc_type": "standard", "distance": 2.962, "atom1_id": "///M/28/N3", "atom2_id": "///N/15/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1477, "atom1_serNum": 14485, "atom2_serNum": 14742, "donAcc_type": "standard", "distance": 3.213, "atom1_id": "///M/28/N4", "atom2_id": "///N/15/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1478, "atom1_serNum": 14502, "atom2_serNum": 14722, "donAcc_type": "standard", "distance": 2.907, "atom1_id": "///M/29/O2", "atom2_id": "///N/14/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1479, "atom1_serNum": 14503, "atom2_serNum": 14720, "donAcc_type": "standard", "distance": 2.974, "atom1_id": "///M/29/N3", "atom2_id": "///N/14/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1480, "atom1_serNum": 14505, "atom2_serNum": 14719, "donAcc_type": "standard", "distance": 2.983, "atom1_id": "///M/29/N4", "atom2_id": "///N/14/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1481, "atom1_serNum": 14518, "atom2_serNum": 14536, "donAcc_type": "acceptable", "distance": 2.873, "atom1_id": "///M/30/O2'", "atom2_id": "///M/31/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 1482, "atom1_serNum": 14525, "atom2_serNum": 14699, "donAcc_type": "standard", "distance": 2.877, "atom1_id": "///M/30/N6", "atom2_id": "///N/13/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1483, "atom1_serNum": 14526, "atom2_serNum": 14697, "donAcc_type": "standard", "distance": 2.994, "atom1_id": "///M/30/N1", "atom2_id": "///N/13/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1484, "atom1_serNum": 14540, "atom2_serNum": 14552, "donAcc_type": "acceptable", "distance": 2.690, "atom1_id": "///M/31/O2'", "atom2_id": "///M/32/OP2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 1485, "atom1_serNum": 14564, "atom2_serNum": 14634, "donAcc_type": "standard", "distance": 2.722, "atom1_id": "///M/32/N7", "atom2_id": "///N/10/N6", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1486, "atom1_serNum": 14568, "atom2_serNum": 14653, "donAcc_type": "standard", "distance": 2.610, "atom1_id": "///M/32/N1", "atom2_id": "///N/11/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1487, "atom1_serNum": 14568, "atom2_serNum": 14654, "donAcc_type": "standard", "distance": 2.773, "atom1_id": "///M/32/N1", "atom2_id": "///N/11/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1488, "atom1_serNum": 14570, "atom2_serNum": 14669, "donAcc_type": "acceptable", "distance": 3.286, "atom1_id": "///M/32/N2", "atom2_id": "///N/12/O2'", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1489, "atom1_serNum": 14570, "atom2_serNum": 14680, "donAcc_type": "standard", "distance": 3.292, "atom1_id": "///M/32/N2", "atom2_id": "///N/12/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1490, "atom1_serNum": 14584, "atom2_serNum": 14600, "donAcc_type": "acceptable", "distance": 2.950, "atom1_id": "///N/8/O2'", "atom2_id": "///N/9/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 1491, "atom1_serNum": 14604, "atom2_serNum": 14620, "donAcc_type": "acceptable", "distance": 2.636, "atom1_id": "///N/9/O2'", "atom2_id": "///N/10/O5'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 1492, "atom1_serNum": 14778, "atom2_serNum": 14782, "donAcc_type": "acceptable", "distance": 3.010, "atom1_id": "///N/17/O2'", "atom2_id": "///N/17/O2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 1493, "atom1_serNum": 14778, "atom2_serNum": 14790, "donAcc_type": "acceptable", "distance": 3.024, "atom1_id": "///N/17/O2'", "atom2_id": "///N/18/OP2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 1494, "atom1_serNum": 14901, "atom2_serNum": 14912, "donAcc_type": "acceptable", "distance": 3.104, "atom1_id": "///N/23/O2'", "atom2_id": "///N/24/OP1", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 1495, "atom1_serNum": 14921, "atom2_serNum": 14940, "donAcc_type": "acceptable", "distance": 3.000, "atom1_id": "///N/24/O2'", "atom2_id": "///N/25/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 1496, "atom1_serNum": 15053, "atom2_serNum": 15066, "donAcc_type": "acceptable", "distance": 2.939, "atom1_id": "///N/30/O2'", "atom2_id": "///N/31/O5'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 1497, "atom1_serNum": 15155, "atom2_serNum": 15167, "donAcc_type": "acceptable", "distance": 2.324, "atom1_id": "///N/35/O2'", "atom2_id": "///N/36/OP2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 1498, "atom1_serNum": 15175, "atom2_serNum": 15179, "donAcc_type": "acceptable", "distance": 2.670, "atom1_id": "///N/36/O2'", "atom2_id": "///N/36/O2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 1499, "atom1_serNum": 15175, "atom2_serNum": 15187, "donAcc_type": "acceptable", "distance": 2.495, "atom1_id": "///N/36/O2'", "atom2_id": "///N/37/OP2", "atom_pair": "O:O", "residue_pair": "nt:nt" } ], "refCoords": { "purine": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 -0.5000 0.4000", " 3 N -2.2500 -0.5000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 1.2500 5.0000 0.4000", " 6 C 1.2500 -0.5000 0.4000", " 7 C 1.2500 -0.5000 -0.4000", " 8 C 1.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 -0.5000 0.4000", " 11 C -2.2500 -0.5000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ], "pyrimidine": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 1.0000 0.4000", " 3 N -2.2500 1.0000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 1.2500 5.0000 0.4000", " 6 C 1.2500 1.0000 0.4000", " 7 C 1.2500 1.0000 -0.4000", " 8 C 1.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 1.0000 0.4000", " 11 C -2.2500 1.0000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ], "wc_pair": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 -5.0000 0.4000", " 3 N -2.2500 -5.0000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 2.2500 5.0000 0.4000", " 6 C 2.2500 -5.0000 0.4000", " 7 C 2.2500 -5.0000 -0.4000", " 8 C 2.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 -5.0000 0.4000", " 11 C -2.2500 -5.0000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ] }, "metadata": { "license": "http://innovation.columbia.edu/technologies/CU20391", "url": "http://x3dna.org/", "url_alt": "http://home.x3dna.org/", "forum": "http://forum.x3dna.org/", "citation": "Lu et al. (2015). 'DSSR: an integrated software tool for dissecting the spatial structure of RNA.' Nucleic Acids Res., 43(21):e142 [doi:10.1093/nar/gkv716].", "str_id": "6o1o", "num_aaChains": 12, "aaChains": "A=716,B=279,C=218,D=218,E=218,F=216,G=210,H=210,I=118,J=118,K=118,L=118", "num_naChains": 2, "naChains": "M=36,N=30", "num_atoms": 15193, "num_waters": 0, "num_notes": 52, "notes": [ { "Aminors": "A-minor interactions (including types I and II)" }, { "Cstem_index": "stem index of the 'Canonical' helix in k-turn" }, { "Cstem_pair": "Cstem bp delineating the k-turn internal loop" }, { "Dp": "perpendicular distance of the 3' P atom to the glycosidic bond" }, { "GA_pair": "sheared G-A pair in k-turn" }, { "HtypePknot": "H-type pseudoknot" }, { "Kturn": "kink-turn (k-turn)" }, { "LW": "Leontis-Westhof" }, { "NCstem_index": "stem index of the 'Non-Canonical' helix in k-turn" }, { "NCstem_pair": "NCstem bp delineating the k-turn internal loop" }, { "Uturn": "U-turn of the UNR- or GNRA-type" }, { "aa": "amino acid" }, { "atom_pair": "symbols of the two atoms involved in an H-bond" }, { "auxfiles": "auxiliary files" }, { "glyco_bond": "conformation of base related to sugar (syn or anti)" }, { "bb_type": "backbone conformation, BI or BII" }, { "bending_angle": "angle between two helical axes" }, { "bp": "base pair" }, { "bseq": "base sequence in one-letter code" }, { "bulge": "bulge loop" }, { "coaxStacks": "coaxial stacking of stems within a helix" }, { "dbn": "dot bracket notation" }, { "desc": "description" }, { "donAcc_type": "donor/acceptor type of the atom pair in an H-bond" }, { "epsilon_zeta": "difference between epsilon and zeta torsion angles" }, { "hairpin": "hairpin loop" }, { "hbond": "hydrogen bond (H-bond)" }, { "helix": "defined by base-stacking interactions, regardless of bp type and backbone connectivity" }, { "id": "identifier" }, { "iloop": "internal loop" }, { "index": "serial number" }, { "isoCanonPairs": "isolated canonical pairs" }, { "junction": "(multi-branched) junction loop" }, { "kissingLoop": "kissing loop" }, { "multiplet": "3+ bases in a coplanar geometry" }, { "na": "nucleic acid" }, { "nonPair": "two nts not forming a pair, but with H-bonding/stacking interactions" }, { "nonStack": "nucleotide not involved in stacking interactions" }, { "nt": "nucleotide" }, { "num": "number" }, { "oArea": "overlap areas between two bases, including exocyclic atoms" }, { "oArea_ring": "overlap areas between two bases, including only ring atoms" }, { "phosContacts": "H-bonding and atom-capping interactions involving a phosphate" }, { "residue_pair": "types of the two residues involved in an H-bond" }, { "rmsd": "root-mean-squares deviation" }, { "serNum": "serial number" }, { "ssSegments": "single-stranded segments not involved in loops" }, { "ssZp": "Z-coordinate of the 3' phosphorus atom with reference to the 5' base plane" }, { "sstr": "secondary structure in dbn" }, { "stem": "helix consisting of only canonical pairs, with a continuous backbone" }, { "str_id": "structure identifier, derived from inpfile with extension removed" }, { "vert_dist": "vertical distance from an atom to a base plane" } ], "num_auxfiles": 12, "auxfiles": [ { "index": 1, "name": "dssr-pairs.pdb", "desc": "an ensemble of base pairs" }, { "index": 2, "name": "dssr-multiplets.pdb", "desc": "an ensemble of multiplets" }, { "index": 3, "name": "dssr-stems.pdb", "desc": "an ensemble of stems" }, { "index": 4, "name": "dssr-helices.pdb", "desc": "an ensemble of helices (coaxial stacking)" }, { "index": 5, "name": "dssr-iloops.pdb", "desc": "an ensemble of internal loops" }, { "index": 6, "name": "dssr-2ndstrs.bpseq", "desc": "secondary structure in bpseq format" }, { "index": 7, "name": "dssr-2ndstrs.ct", "desc": "secondary structure in connectivity table format" }, { "index": 8, "name": "dssr-2ndstrs.dbn", "desc": "secondary structure in dot-bracket notation" }, { "index": 9, "name": "dssr-torsions.txt", "desc": "backbone torsion angles and suite names" }, { "index": 10, "name": "dssr-splays.pdb", "desc": "an ensemble of splayed-apart units" }, { "index": 11, "name": "dssr-stacks.pdb", "desc": "an ensemble of base stacks" }, { "index": 12, "name": "dssr-atom2bases.pdb", "desc": "an ensemble of atom-base stacking interactions" } ], "time_used": "999" } }