{ "num_pairs": 165, "pairs": [ { "index": 1, "nt1": "///A/103", "nt2": "///A/217", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": 176.073, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 54.974, "chi2": -166.070, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 63.044, "C1C1_dist": 10.561, "N1N9_dist": 9.051, "C6C8_dist": 10.165, "CNNC_torsion": 1.178, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[3.52],N1(imino)-N3[3.19],N2(amino)-O2(carbonyl)[2.73]", "interBase_angle": 3.002, "planarity": 0.121, "simple_Shear": -0.748, "simple_Stretch": 0.180, "simple_Buckle": 0.784, "simple_Propeller": -2.898, "bp_simpleParams": [ -0.748, 0.180, -0.463, 0.784, -2.898, 9.053 ], "bp_params": [ -0.759, 0.128, -0.463, 0.982, -2.837, 9.056 ], "frame": { "rmsd": null, "origin": [ 51.318, 55.915, 90.924 ], "x_axis": [ -0.299, 0.743, -0.598 ], "y_axis": [ 0.674, -0.280, -0.684 ], "z_axis": [ -0.676, -0.607, -0.417 ], "quaternion": [ -0.032, 0.591, 0.599, -0.539 ] } }, { "index": 2, "nt1": "///A/103", "nt2": "///A/256", "bp": "G+A", "name": "--", "Saenger": "--", "LW": "cHW", "DSSR": "cM+W", "intra_chain": true, "chi1": 176.073, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 66.054, "chi2": -175.370, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 38.144, "C1C1_dist": 10.784, "N1N9_dist": 9.039, "C6C8_dist": 7.768, "CNNC_torsion": 4.358, "hbonds_num": 1, "hbonds_desc": "N7-N6(amino)[3.23]", "interBase_angle": 20.570, "planarity": 0.306, "simple_Shear": -5.493, "simple_Stretch": 5.043, "simple_Buckle": 18.419, "simple_Propeller": 9.157, "bp_simpleParams": [ -5.493, 5.043, 0.237, 18.419, 9.157, 77.230 ], "bp_params": [ 2.677, -6.959, 0.237, -20.570, 0.043, 76.326 ], "frame": { "rmsd": null, "origin": [ 53.452, 54.991, 88.039 ], "x_axis": [ -0.633, 0.764, -0.126 ], "y_axis": [ 0.255, 0.052, -0.966 ], "z_axis": [ -0.731, -0.643, -0.228 ], "quaternion": [ -0.219, 0.368, 0.691, -0.582 ] } }, { "index": 3, "nt1": "///A/104", "nt2": "///A/216", "bp": "A-C", "name": "--", "Saenger": "--", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -172.335, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 48.434, "chi2": -172.827, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 56.534, "C1C1_dist": 10.536, "N1N9_dist": 8.745, "C6C8_dist": 9.532, "CNNC_torsion": -19.234, "hbonds_num": 1, "hbonds_desc": "N6(amino)-N3[3.13]", "interBase_angle": 38.133, "planarity": 0.429, "simple_Shear": -1.292, "simple_Stretch": -0.056, "simple_Buckle": -30.214, "simple_Propeller": -23.265, "bp_simpleParams": [ -1.292, -0.056, -0.417, -30.214, -23.265, -1.737 ], "bp_params": [ -1.279, -0.186, -0.417, -27.835, -26.064, -1.733 ], "frame": { "rmsd": null, "origin": [ 46.866, 54.195, 90.259 ], "x_axis": [ 0.151, 0.540, -0.828 ], "y_axis": [ 0.699, -0.651, -0.296 ], "z_axis": [ -0.699, -0.534, -0.476 ], "quaternion": [ 0.079, 0.755, 0.410, -0.506 ] } }, { "index": 4, "nt1": "///A/104", "nt2": "///A/257", "bp": "A+G", "name": "--", "Saenger": "09-IX", "LW": "cHW", "DSSR": "cM+W", "intra_chain": true, "chi1": -172.335, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 56.211, "chi2": -174.637, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 71.343, "C1C1_dist": 10.295, "N1N9_dist": 9.011, "C6C8_dist": 8.471, "CNNC_torsion": 17.811, "hbonds_num": 2, "hbonds_desc": "OP2-N2(amino)[2.54],N7-N2(amino)[3.18]", "interBase_angle": 24.884, "planarity": 0.396, "simple_Shear": -2.886, "simple_Stretch": 4.999, "simple_Buckle": 14.043, "simple_Propeller": 20.543, "bp_simpleParams": [ -2.886, 4.999, 1.797, 14.043, 20.543, 55.646 ], "bp_params": [ -1.933, -5.439, 1.797, -24.736, -2.709, 54.556 ], "frame": { "rmsd": null, "origin": [ 48.795, 54.107, 88.603 ], "x_axis": [ -0.377, 0.591, -0.713 ], "y_axis": [ 0.622, -0.408, -0.668 ], "z_axis": [ -0.686, -0.696, -0.214 ], "quaternion": [ -0.013, -0.558, -0.544, 0.627 ] } }, { "index": 5, "nt1": "///A/104", "nt2": "///A/258", "bp": "A+U", "name": "--", "Saenger": "--", "LW": "cHW", "DSSR": "cM+W", "intra_chain": true, "chi1": -172.335, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 67.402, "chi2": -164.270, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 67.731, "C1C1_dist": 6.981, "N1N9_dist": 5.853, "C6C8_dist": 5.628, "CNNC_torsion": 5.456, "hbonds_num": 1, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.51]", "interBase_angle": 37.988, "planarity": 0.791, "simple_Shear": -1.937, "simple_Stretch": 2.217, "simple_Buckle": 17.539, "simple_Propeller": 33.697, "bp_simpleParams": [ -1.937, 2.217, -0.810, 17.539, 33.697, 34.603 ], "bp_params": [ -0.043, -2.944, -0.810, -35.458, -13.630, 33.292 ], "frame": { "rmsd": null, "origin": [ 47.430, 52.977, 89.965 ], "x_axis": [ -0.167, 0.599, -0.783 ], "y_axis": [ 0.610, -0.561, -0.560 ], "z_axis": [ -0.775, -0.571, -0.271 ], "quaternion": [ 0.005, 0.645, 0.468, -0.604 ] } }, { "index": 6, "nt1": "///A/105", "nt2": "///A/215", "bp": "A-G", "name": "Imino", "Saenger": "08-VIII", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -155.292, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 49.462, "chi2": -165.939, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 49.577, "C1C1_dist": 12.411, "N1N9_dist": 10.503, "C6C8_dist": 11.010, "CNNC_torsion": -0.004, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O6(carbonyl)[2.80],N1-N1(imino)[2.65]", "interBase_angle": 17.817, "planarity": 0.270, "simple_Shear": 0.140, "simple_Stretch": 1.338, "simple_Buckle": -17.817, "simple_Propeller": 0.076, "bp_simpleParams": [ 0.140, 1.338, -0.062, -17.817, 0.076, -13.342 ], "bp_params": [ 0.158, 1.336, -0.062, -17.815, 0.313, -13.182 ], "frame": { "rmsd": null, "origin": [ 43.733, 53.625, 89.103 ], "x_axis": [ 0.606, 0.092, -0.790 ], "y_axis": [ 0.445, -0.863, 0.240 ], "z_axis": [ -0.660, -0.497, -0.564 ], "quaternion": [ 0.212, 0.871, 0.154, -0.416 ] } }, { "index": 7, "nt1": "///A/105", "nt2": "///A/258", "bp": "A+U", "name": "Hoogsteen", "Saenger": "23-XXIII", "LW": "cHW", "DSSR": "cM+W", "intra_chain": true, "chi1": -155.292, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 51.389, "chi2": -164.270, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 71.547, "C1C1_dist": 7.757, "N1N9_dist": 6.384, "C6C8_dist": 6.001, "CNNC_torsion": 14.649, "hbonds_num": 2, "hbonds_desc": "N7-N3(imino)[2.88],N6(amino)-O4(carbonyl)[3.40]", "interBase_angle": 34.428, "planarity": 0.408, "simple_Shear": -2.709, "simple_Stretch": 1.771, "simple_Buckle": 26.344, "simple_Propeller": 22.165, "bp_simpleParams": [ -2.709, 1.771, 2.484, 26.344, 22.165, 63.336 ], "bp_params": [ 0.015, -3.236, 2.484, -32.989, 9.850, 61.399 ], "frame": { "rmsd": null, "origin": [ 46.055, 52.503, 89.117 ], "x_axis": [ 0.095, 0.496, -0.863 ], "y_axis": [ 0.599, -0.721, -0.348 ], "z_axis": [ -0.795, -0.484, -0.366 ], "quaternion": [ 0.046, 0.739, 0.371, -0.561 ] } }, { "index": 8, "nt1": "///A/107", "nt2": "///A/214", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -165.986, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 55.069, "chi2": -164.913, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 60.552, "C1C1_dist": 10.242, "N1N9_dist": 8.671, "C6C8_dist": 9.755, "CNNC_torsion": 4.846, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.70],O4(carbonyl)-N6(amino)[3.02]", "interBase_angle": 4.971, "planarity": 0.097, "simple_Shear": -0.306, "simple_Stretch": -0.183, "simple_Buckle": -1.466, "simple_Propeller": 4.750, "bp_simpleParams": [ -0.306, -0.183, -0.315, -1.466, 4.750, 5.790 ], "bp_params": [ -0.300, -0.194, -0.315, -1.638, 4.694, 5.794 ], "frame": { "rmsd": null, "origin": [ 40.497, 54.721, 86.582 ], "x_axis": [ 0.708, -0.530, -0.467 ], "y_axis": [ -0.145, -0.756, 0.638 ], "z_axis": [ -0.691, -0.384, -0.612 ], "quaternion": [ 0.291, 0.877, -0.192, -0.330 ] } }, { "index": 9, "nt1": "///A/107", "nt2": "///A/259", "bp": "U+U", "name": "--", "Saenger": "--", "LW": "cHW", "DSSR": "cM+W", "intra_chain": true, "chi1": -165.986, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 40.407, "chi2": -158.461, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 75.989, "C1C1_dist": 8.775, "N1N9_dist": 7.306, "C6C8_dist": 7.167, "CNNC_torsion": 3.120, "hbonds_num": 1, "hbonds_desc": "O4(carbonyl)-N3(imino)[2.73]", "interBase_angle": 14.572, "planarity": 0.230, "simple_Shear": -1.969, "simple_Stretch": 2.034, "simple_Buckle": 14.370, "simple_Propeller": -2.418, "bp_simpleParams": [ -1.969, 2.034, 1.153, 14.370, -2.418, 65.333 ], "bp_params": [ -1.174, -2.576, 1.153, -3.010, 14.257, 65.720 ], "frame": { "rmsd": null, "origin": [ 41.608, 53.902, 86.958 ], "x_axis": [ 0.617, -0.120, -0.778 ], "y_axis": [ 0.231, -0.917, 0.324 ], "z_axis": [ -0.752, -0.380, -0.538 ], "quaternion": [ 0.201, 0.876, 0.032, -0.437 ] } }, { "index": 10, "nt1": "///A/108", "nt2": "///A/213", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -159.360, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 55.314, "chi2": -159.469, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 54.359, "C1C1_dist": 10.460, "N1N9_dist": 8.760, "C6C8_dist": 9.708, "CNNC_torsion": -5.629, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.70],N1(imino)-N3[2.70],N2(amino)-O2(carbonyl)[2.62]", "interBase_angle": 10.832, "planarity": 0.155, "simple_Shear": 0.052, "simple_Stretch": -0.324, "simple_Buckle": -0.923, "simple_Propeller": -10.792, "bp_simpleParams": [ 0.052, -0.324, -0.305, -0.923, -10.792, 0.938 ], "bp_params": [ 0.048, -0.324, -0.305, -1.030, -10.783, 0.942 ], "frame": { "rmsd": null, "origin": [ 38.422, 54.936, 83.333 ], "x_axis": [ 0.610, -0.792, -0.035 ], "y_axis": [ -0.517, -0.431, 0.740 ], "z_axis": [ -0.601, -0.433, -0.672 ], "quaternion": [ 0.356, 0.824, -0.397, -0.193 ] } }, { "index": 11, "nt1": "///A/108", "nt2": "///A/260", "bp": "G+C", "name": "~Hoogsteen", "Saenger": "--", "LW": "cHW", "DSSR": "cM+W", "intra_chain": true, "chi1": -159.360, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 44.269, "chi2": -162.915, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 73.227, "C1C1_dist": 8.190, "N1N9_dist": 6.718, "C6C8_dist": 6.471, "CNNC_torsion": 0.091, "hbonds_num": 3, "hbonds_desc": "OP2-O2'(hydroxyl)[2.61],N7*O2(carbonyl)[2.79],O6(carbonyl)-N4(amino)[3.16]", "unusual_base2base_hbonds": 1, "interBase_angle": 6.725, "planarity": 0.128, "simple_Shear": -2.074, "simple_Stretch": 1.838, "simple_Buckle": 0.326, "simple_Propeller": -6.717, "bp_simpleParams": [ -2.074, 1.838, 0.082, 0.326, -6.717, 61.140 ], "bp_params": [ -0.776, -2.661, 0.082, 5.933, 3.165, 61.092 ], "frame": { "rmsd": null, "origin": [ 38.743, 53.851, 83.993 ], "x_axis": [ 0.714, -0.513, -0.476 ], "y_axis": [ -0.131, -0.766, 0.629 ], "z_axis": [ -0.688, -0.387, -0.614 ], "quaternion": [ 0.289, 0.880, -0.183, -0.331 ] } }, { "index": 12, "nt1": "///A/109", "nt2": "///A/212", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -172.692, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 49.481, "chi2": -176.778, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 54.425, "C1C1_dist": 10.893, "N1N9_dist": 9.074, "C6C8_dist": 9.932, "CNNC_torsion": -3.178, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.97],N3-N1(imino)[2.98],N4(amino)-O6(carbonyl)[2.87]", "interBase_angle": 17.651, "planarity": 0.191, "simple_Shear": -0.185, "simple_Stretch": -0.040, "simple_Buckle": 13.053, "simple_Propeller": -11.883, "bp_simpleParams": [ -0.185, -0.040, -0.578, 13.053, -11.883, -2.062 ], "bp_params": [ -0.184, -0.045, -0.578, 13.397, -11.493, -2.059 ], "frame": { "rmsd": null, "origin": [ 38.378, 53.453, 80.017 ], "x_axis": [ 0.275, -0.917, 0.290 ], "y_axis": [ -0.774, -0.032, 0.632 ], "z_axis": [ -0.570, -0.398, -0.719 ], "quaternion": [ 0.362, 0.712, -0.594, -0.099 ] } }, { "index": 13, "nt1": "///A/110", "nt2": "///A/183", "bp": "G-A", "name": "--", "Saenger": "--", "LW": "cSW", "DSSR": "cm-W", "intra_chain": true, "chi1": -167.958, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 150.280, "chi2": -158.094, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 91.124, "C1C1_dist": 5.869, "N1N9_dist": 7.257, "C6C8_dist": 9.736, "CNNC_torsion": -30.367, "hbonds_num": 3, "hbonds_desc": "O2'(hydroxyl)-O2'(hydroxyl)[2.93],O2'(hydroxyl)-N3[2.65],N2(amino)-N1[3.72]", "interBase_angle": 28.923, "planarity": 0.387, "simple_Shear": 0.948, "simple_Stretch": 6.519, "simple_Buckle": -22.164, "simple_Propeller": -18.583, "bp_simpleParams": [ 0.948, 6.519, -0.691, -22.164, -18.583, 142.034 ], "bp_params": [ 2.778, 5.973, -0.691, -26.585, -11.393, 141.236 ], "frame": { "rmsd": null, "origin": [ 38.098, 54.512, 73.991 ], "x_axis": [ 0.745, -0.647, -0.160 ], "y_axis": [ -0.480, -0.687, 0.545 ], "z_axis": [ -0.463, -0.330, -0.823 ], "quaternion": [ 0.242, 0.902, -0.312, -0.173 ] } }, { "index": 14, "nt1": "///A/110", "nt2": "///A/211", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -167.958, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 50.360, "chi2": -166.588, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 55.091, "C1C1_dist": 10.645, "N1N9_dist": 8.857, "C6C8_dist": 9.718, "CNNC_torsion": -1.784, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.74],N1(imino)-N3[2.85],N2(amino)-O2(carbonyl)[2.84]", "interBase_angle": 7.512, "planarity": 0.080, "simple_Shear": -0.577, "simple_Stretch": -0.278, "simple_Buckle": -6.377, "simple_Propeller": -3.971, "bp_simpleParams": [ -0.577, -0.278, -0.189, -6.377, -3.971, -2.827 ], "bp_params": [ -0.561, -0.308, -0.189, -6.162, -4.297, -2.825 ], "frame": { "rmsd": null, "origin": [ 37.654, 51.483, 75.861 ], "x_axis": [ -0.099, -0.766, 0.635 ], "y_axis": [ -0.798, 0.442, 0.409 ], "z_axis": [ -0.594, -0.467, -0.655 ], "quaternion": [ -0.415, -0.528, 0.741, -0.019 ] } }, { "index": 15, "nt1": "///A/111", "nt2": "///A/209", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -164.880, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 53.655, "chi2": -149.871, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 54.059, "C1C1_dist": 10.891, "N1N9_dist": 9.146, "C6C8_dist": 10.041, "CNNC_torsion": -4.155, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.96],N1(imino)-N3[3.05],N2(amino)-O2(carbonyl)[2.99]", "interBase_angle": 3.805, "planarity": 0.048, "simple_Shear": -0.110, "simple_Stretch": 0.012, "simple_Buckle": -1.230, "simple_Propeller": -3.601, "bp_simpleParams": [ -0.110, 0.012, 0.024, -1.230, -3.601, -1.770 ], "bp_params": [ -0.110, 0.011, 0.024, -1.207, -3.609, -1.770 ], "frame": { "rmsd": null, "origin": [ 36.521, 48.551, 74.322 ], "x_axis": [ -0.517, -0.286, 0.807 ], "y_axis": [ -0.575, 0.814, -0.080 ], "z_axis": [ -0.634, -0.505, -0.585 ], "quaternion": [ -0.422, -0.252, 0.854, -0.171 ] } }, { "index": 16, "nt1": "///A/112", "nt2": "///A/208", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -166.481, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 57.135, "chi2": -165.611, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 54.768, "C1C1_dist": 10.522, "N1N9_dist": 8.869, "C6C8_dist": 9.874, "CNNC_torsion": -11.404, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[3.01],N1(imino)-N3[2.85],N2(amino)-O2(carbonyl)[2.59]", "interBase_angle": 11.281, "planarity": 0.155, "simple_Shear": -0.116, "simple_Stretch": -0.141, "simple_Buckle": 6.616, "simple_Propeller": -9.138, "bp_simpleParams": [ -0.116, -0.141, 0.391, 6.616, -9.138, 2.991 ], "bp_params": [ -0.114, -0.142, 0.391, 6.697, -9.078, 2.995 ], "frame": { "rmsd": null, "origin": [ 34.701, 45.729, 73.339 ], "x_axis": [ -0.628, 0.235, 0.741 ], "y_axis": [ -0.216, 0.863, -0.457 ], "z_axis": [ -0.747, -0.447, -0.491 ], "quaternion": [ -0.431, 0.005, 0.864, -0.262 ] } }, { "index": 17, "nt1": "///A/113", "nt2": "///A/207", "bp": "A-A", "name": "~Sheared", "Saenger": "--", "LW": "tSH", "DSSR": "tm-M", "intra_chain": true, "chi1": -160.913, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 86.575, "chi2": -175.259, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 7.099, "C1C1_dist": 9.612, "N1N9_dist": 8.174, "C6C8_dist": 8.421, "CNNC_torsion": -127.057, "hbonds_num": 2, "hbonds_desc": "O2'(hydroxyl)-N6(amino)[3.13],N3-N6(amino)[2.73]", "interBase_angle": 16.160, "planarity": 0.182, "simple_Shear": 7.166, "simple_Stretch": 1.948, "simple_Buckle": 14.643, "simple_Propeller": -6.836, "bp_simpleParams": [ 7.166, 1.948, 0.073, 14.643, -6.836, -18.268 ], "bp_params": [ 6.260, -3.996, 0.073, 4.809, -15.428, -18.417 ], "frame": { "rmsd": null, "origin": [ 32.484, 42.804, 72.261 ], "x_axis": [ -0.471, 0.882, -0.025 ], "y_axis": [ 0.378, 0.176, -0.909 ], "z_axis": [ -0.797, -0.438, -0.416 ], "quaternion": [ -0.269, 0.438, 0.718, -0.469 ] } }, { "index": 18, "nt1": "///A/114", "nt2": "///A/206", "bp": "A-A", "name": "~Sheared", "Saenger": "--", "LW": "tHS", "DSSR": "tM-m", "intra_chain": true, "chi1": -170.751, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 10.846, "chi2": -105.899, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 88.892, "C1C1_dist": 9.243, "N1N9_dist": 7.881, "C6C8_dist": 8.138, "CNNC_torsion": -110.140, "hbonds_num": 1, "hbonds_desc": "N6(amino)-N3[2.95]", "interBase_angle": 31.340, "planarity": 0.458, "simple_Shear": -7.246, "simple_Stretch": 2.090, "simple_Buckle": -5.308, "simple_Propeller": 30.888, "bp_simpleParams": [ -7.246, 2.090, 0.451, -5.308, 30.888, -14.204 ], "bp_params": [ -6.176, -4.328, 0.451, -27.314, 15.367, -13.938 ], "frame": { "rmsd": null, "origin": [ 28.760, 41.002, 71.801 ], "x_axis": [ -0.553, 0.831, 0.061 ], "y_axis": [ 0.222, 0.218, -0.950 ], "z_axis": [ -0.803, -0.512, -0.305 ], "quaternion": [ -0.300, 0.366, 0.720, -0.507 ] } }, { "index": 19, "nt1": "///A/116", "nt2": "///A/205", "bp": "G-U", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -156.042, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 49.972, "chi2": -150.667, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 69.399, "C1C1_dist": 10.487, "N1N9_dist": 9.023, "C6C8_dist": 10.165, "CNNC_torsion": -8.282, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N3(imino)[3.55],N1(imino)-O2(carbonyl)[3.06],N2(amino)-O2(carbonyl)[3.00]", "interBase_angle": 9.230, "planarity": 0.128, "simple_Shear": -1.662, "simple_Stretch": 0.334, "simple_Buckle": -5.895, "simple_Propeller": -7.103, "bp_simpleParams": [ -1.662, 0.334, 0.228, -5.895, -7.103, 9.439 ], "bp_params": [ -1.694, 0.064, 0.228, -4.684, -7.954, 9.454 ], "frame": { "rmsd": null, "origin": [ 23.911, 39.334, 70.700 ], "x_axis": [ 0.356, 0.668, -0.653 ], "y_axis": [ 0.223, -0.739, -0.635 ], "z_axis": [ -0.907, 0.080, -0.413 ], "quaternion": [ -0.226, 0.792, 0.282, -0.493 ] } }, { "index": 20, "nt1": "///A/117", "nt2": "///A/204", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -154.660, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 51.556, "chi2": -159.126, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 54.940, "C1C1_dist": 10.633, "N1N9_dist": 8.867, "C6C8_dist": 9.745, "CNNC_torsion": -11.133, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.77],N1(imino)-N3[2.84],N2(amino)-O2(carbonyl)[2.88]", "interBase_angle": 15.954, "planarity": 0.227, "simple_Shear": -0.363, "simple_Stretch": -0.237, "simple_Buckle": 9.975, "simple_Propeller": -12.450, "bp_simpleParams": [ -0.363, -0.237, 0.112, 9.975, -12.450, -2.239 ], "bp_params": [ -0.354, -0.251, 0.112, 10.419, -12.082, -2.243 ], "frame": { "rmsd": null, "origin": [ 20.861, 40.089, 70.324 ], "x_axis": [ 0.570, 0.158, -0.806 ], "y_axis": [ -0.005, -0.981, -0.196 ], "z_axis": [ -0.821, 0.116, -0.558 ], "quaternion": [ -0.088, 0.882, 0.043, -0.461 ] } }, { "index": 21, "nt1": "///A/118", "nt2": "///A/203", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -163.403, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 55.748, "chi2": -158.268, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 55.772, "C1C1_dist": 10.409, "N1N9_dist": 8.746, "C6C8_dist": 9.681, "CNNC_torsion": -4.655, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.67],N1(imino)-N3[2.73],N2(amino)-O2(carbonyl)[2.70]", "interBase_angle": 9.150, "planarity": 0.151, "simple_Shear": -0.353, "simple_Stretch": -0.354, "simple_Buckle": 2.074, "simple_Propeller": -8.911, "bp_simpleParams": [ -0.353, -0.354, -0.259, 2.074, -8.911, -0.327 ], "bp_params": [ -0.342, -0.365, -0.259, 2.356, -8.841, -0.328 ], "frame": { "rmsd": null, "origin": [ 18.862, 41.958, 67.621 ], "x_axis": [ 0.692, -0.374, -0.618 ], "y_axis": [ -0.342, -0.923, 0.176 ], "z_axis": [ -0.636, 0.090, -0.766 ], "quaternion": [ 0.023, 0.919, -0.195, -0.341 ] } }, { "index": 22, "nt1": "///A/119", "nt2": "///A/202", "bp": "G-U", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -174.171, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 45.703, "chi2": -160.708, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 66.048, "C1C1_dist": 10.239, "N1N9_dist": 8.612, "C6C8_dist": 9.552, "CNNC_torsion": -9.395, "hbonds_num": 2, "hbonds_desc": "O6(carbonyl)-N3(imino)[2.71],N1(imino)-O2(carbonyl)[2.60]", "interBase_angle": 14.683, "planarity": 0.165, "simple_Shear": -2.089, "simple_Stretch": -0.222, "simple_Buckle": -10.550, "simple_Propeller": -10.213, "bp_simpleParams": [ -2.089, -0.222, -0.171, -10.550, -10.213, 1.081 ], "bp_params": [ -2.002, -0.637, -0.171, -8.284, -12.123, 1.084 ], "frame": { "rmsd": null, "origin": [ 17.984, 43.306, 64.168 ], "x_axis": [ 0.597, -0.753, -0.277 ], "y_axis": [ -0.600, -0.649, 0.469 ], "z_axis": [ -0.533, -0.113, -0.839 ], "quaternion": [ 0.166, 0.878, -0.385, -0.231 ] } }, { "index": 23, "nt1": "///A/120", "nt2": "///A/201", "bp": "U-G", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -162.183, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 69.346, "chi2": -170.296, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 43.040, "C1C1_dist": 10.321, "N1N9_dist": 8.728, "C6C8_dist": 9.719, "CNNC_torsion": -8.943, "hbonds_num": 2, "hbonds_desc": "O2(carbonyl)-N1(imino)[2.65],N3(imino)-O6(carbonyl)[2.89]", "interBase_angle": 12.250, "planarity": 0.148, "simple_Shear": 2.271, "simple_Stretch": -0.023, "simple_Buckle": 6.597, "simple_Propeller": -10.322, "bp_simpleParams": [ 2.271, -0.023, -0.159, 6.597, -10.322, 4.142 ], "bp_params": [ 2.210, -0.522, -0.159, 4.155, -11.524, 4.160 ], "frame": { "rmsd": null, "origin": [ 17.256, 43.082, 61.134 ], "x_axis": [ -0.013, -0.986, 0.168 ], "y_axis": [ -0.861, 0.097, 0.500 ], "z_axis": [ -0.509, -0.138, -0.850 ], "quaternion": [ -0.242, -0.659, 0.700, 0.129 ] } }, { "index": 24, "nt1": "///A/121", "nt2": "///A/200", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -158.944, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 54.124, "chi2": 168.282, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 45.423, "C1C1_dist": 10.767, "N1N9_dist": 8.866, "C6C8_dist": 9.700, "CNNC_torsion": 8.082, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.86],N3-N1(imino)[2.86],N4(amino)-O6(carbonyl)[2.78]", "interBase_angle": 7.059, "planarity": 0.099, "simple_Shear": 0.626, "simple_Stretch": -0.295, "simple_Buckle": 0.082, "simple_Propeller": 7.058, "bp_simpleParams": [ 0.626, -0.295, -0.232, 0.082, 7.058, -3.501 ], "bp_params": [ 0.608, -0.331, -0.232, 0.489, 7.042, -3.508 ], "frame": { "rmsd": null, "origin": [ 17.396, 42.066, 57.324 ], "x_axis": [ -0.415, -0.779, 0.470 ], "y_axis": [ -0.766, 0.578, 0.281 ], "z_axis": [ -0.490, -0.244, -0.837 ], "quaternion": [ -0.286, -0.459, 0.841, 0.011 ] } }, { "index": 25, "nt1": "///A/123", "nt2": "///A/198", "bp": "A-A", "name": "--", "Saenger": "--", "LW": "tWH", "DSSR": "tW-M", "intra_chain": true, "chi1": -99.825, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 45.831, "chi2": -138.625, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 15.114, "C1C1_dist": 11.615, "N1N9_dist": 9.273, "C6C8_dist": 8.496, "CNNC_torsion": 152.805, "hbonds_num": 1, "hbonds_desc": "N1*N7[3.12]", "interBase_angle": 13.440, "planarity": 0.193, "simple_Shear": 4.970, "simple_Stretch": 2.757, "simple_Buckle": -13.089, "simple_Propeller": -3.052, "bp_simpleParams": [ 4.970, 2.757, -0.346, -13.089, -3.052, -77.872 ], "bp_params": [ 5.562, -1.168, -0.346, -11.889, 6.269, -77.654 ], "frame": { "rmsd": null, "origin": [ 16.306, 43.372, 53.518 ], "x_axis": [ 0.366, 0.799, -0.477 ], "y_axis": [ -0.782, 0.542, 0.308 ], "z_axis": [ 0.505, 0.260, 0.823 ], "quaternion": [ 0.826, 0.015, 0.297, 0.478 ] } }, { "index": 26, "nt1": "///A/124", "nt2": "///A/197", "bp": "C-C", "name": "~rHoogsteen", "Saenger": "--", "LW": "tHW", "DSSR": "tM-W", "intra_chain": true, "chi1": -166.921, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 16.690, "chi2": -164.318, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 36.731, "C1C1_dist": 11.128, "N1N9_dist": 8.607, "C6C8_dist": 7.902, "CNNC_torsion": -143.859, "hbonds_num": 1, "hbonds_desc": "N4(amino)-N3[3.41]", "interBase_angle": 18.686, "planarity": 0.294, "simple_Shear": -4.494, "simple_Stretch": 1.541, "simple_Buckle": -2.903, "simple_Propeller": 18.460, "bp_simpleParams": [ -4.494, 1.541, 1.434, -2.903, 18.460, -79.475 ], "bp_params": [ -4.547, -1.375, 1.434, -13.123, 13.303, -79.486 ], "frame": { "rmsd": null, "origin": [ 17.398, 48.788, 57.167 ], "x_axis": [ 0.253, 0.374, -0.892 ], "y_axis": [ -0.790, 0.613, 0.033 ], "z_axis": [ 0.559, 0.696, 0.450 ], "quaternion": [ 0.761, -0.218, 0.477, 0.382 ] } }, { "index": 27, "nt1": "///A/124", "nt2": "///A/201", "bp": "C+G", "name": "--", "Saenger": "29-XXIX", "LW": "tWS", "DSSR": "tW+m", "intra_chain": true, "chi1": -166.921, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 10.156, "chi2": -170.296, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 90.059, "C1C1_dist": 9.794, "N1N9_dist": 8.513, "C6C8_dist": 9.616, "CNNC_torsion": -169.116, "hbonds_num": 2, "hbonds_desc": "N3-N2(amino)[3.15],N4(amino)-N3[3.63]", "interBase_angle": 43.152, "planarity": 0.463, "simple_Shear": 2.689, "simple_Stretch": 2.781, "simple_Buckle": -32.067, "simple_Propeller": 28.876, "bp_simpleParams": [ 2.689, 2.781, 1.607, -32.067, 28.876, 97.696 ], "bp_params": [ -1.672, 3.488, 1.607, -38.173, -20.123, 95.349 ], "frame": { "rmsd": null, "origin": [ 17.386, 46.101, 60.254 ], "x_axis": [ 0.765, -0.634, -0.115 ], "y_axis": [ 0.330, 0.539, -0.775 ], "z_axis": [ 0.554, 0.555, 0.621 ], "quaternion": [ 0.855, -0.389, 0.196, -0.282 ] } }, { "index": 28, "nt1": "///A/126", "nt2": "///A/196", "bp": "G-A", "name": "Imino", "Saenger": "08-VIII", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -172.949, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 44.529, "chi2": -168.817, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 46.728, "C1C1_dist": 12.735, "N1N9_dist": 10.671, "C6C8_dist": 11.000, "CNNC_torsion": -11.320, "hbonds_num": 2, "hbonds_desc": "O6(carbonyl)-N6(amino)[2.91],N1(imino)-N1[2.96]", "interBase_angle": 30.494, "planarity": 0.461, "simple_Shear": -0.195, "simple_Stretch": 1.606, "simple_Buckle": 28.750, "simple_Propeller": -10.165, "bp_simpleParams": [ -0.195, 1.606, 0.157, 28.750, -10.165, -20.074 ], "bp_params": [ -0.243, 1.599, 0.157, 29.098, -9.122, -19.508 ], "frame": { "rmsd": null, "origin": [ 18.948, 52.250, 56.068 ], "x_axis": [ -0.545, 0.696, -0.467 ], "y_axis": [ -0.524, 0.151, 0.838 ], "z_axis": [ 0.654, 0.702, 0.283 ], "quaternion": [ 0.471, 0.072, 0.595, 0.647 ] } }, { "index": 29, "nt1": "///A/127", "nt2": "///A/195", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -156.859, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 50.380, "chi2": -171.449, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 51.852, "C1C1_dist": 10.991, "N1N9_dist": 9.137, "C6C8_dist": 9.851, "CNNC_torsion": -15.792, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[3.43],N3-N1(imino)[3.13],N4(amino)-O6(carbonyl)[2.90]", "interBase_angle": 38.870, "planarity": 0.411, "simple_Shear": 0.228, "simple_Stretch": 0.116, "simple_Buckle": 27.548, "simple_Propeller": -27.422, "bp_simpleParams": [ 0.228, 0.116, -0.572, 27.548, -27.422, -6.294 ], "bp_params": [ 0.227, 0.118, -0.572, 27.822, -27.144, -6.296 ], "frame": { "rmsd": null, "origin": [ 20.480, 55.157, 55.277 ], "x_axis": [ -0.773, 0.615, 0.156 ], "y_axis": [ 0.006, -0.238, 0.971 ], "z_axis": [ 0.634, 0.752, 0.180 ], "quaternion": [ 0.206, 0.267, 0.582, 0.740 ] } }, { "index": 30, "nt1": "///A/128", "nt2": "///A/194", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -164.692, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 56.423, "chi2": -178.688, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 53.781, "C1C1_dist": 10.578, "N1N9_dist": 8.888, "C6C8_dist": 9.842, "CNNC_torsion": -12.796, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.76],N3-N1(imino)[2.93],N4(amino)-O6(carbonyl)[3.04]", "interBase_angle": 16.059, "planarity": 0.208, "simple_Shear": 0.593, "simple_Stretch": -0.151, "simple_Buckle": 8.708, "simple_Propeller": -13.493, "bp_simpleParams": [ 0.593, -0.151, 0.257, 8.708, -13.493, 1.076 ], "bp_params": [ 0.585, -0.181, 0.257, 7.996, -13.926, 1.082 ], "frame": { "rmsd": null, "origin": [ 21.939, 58.884, 54.824 ], "x_axis": [ -0.715, 0.144, 0.684 ], "y_axis": [ 0.481, -0.608, 0.632 ], "z_axis": [ 0.507, 0.781, 0.366 ], "quaternion": [ -0.103, 0.363, 0.431, 0.820 ] } }, { "index": 31, "nt1": "///A/129", "nt2": "///A/193", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -170.866, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 58.658, "chi2": -159.662, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 51.763, "C1C1_dist": 10.617, "N1N9_dist": 8.937, "C6C8_dist": 9.890, "CNNC_torsion": -11.489, "hbonds_num": 4, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.94],N1(imino)-N3[2.88],N2(amino)-O2(carbonyl)[2.80],N2(amino)-N3[2.94]", "interBase_angle": 20.977, "planarity": 0.232, "simple_Shear": 0.727, "simple_Stretch": -0.063, "simple_Buckle": -10.483, "simple_Propeller": -18.169, "bp_simpleParams": [ 0.727, -0.063, -0.298, -10.483, -18.169, 1.803 ], "bp_params": [ 0.719, -0.124, -0.298, -11.953, -17.238, 1.814 ], "frame": { "rmsd": null, "origin": [ 22.418, 62.577, 55.512 ], "x_axis": [ -0.401, -0.362, 0.842 ], "y_axis": [ 0.854, -0.481, 0.200 ], "z_axis": [ 0.332, 0.799, 0.502 ], "quaternion": [ -0.394, 0.380, 0.323, 0.772 ] } }, { "index": 32, "nt1": "///A/130", "nt2": "///A/192", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -172.013, "conf1": "anti", "pucker1": "----", "lambda1": 47.587, "chi2": -168.458, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 39.047, "C1C1_dist": 11.228, "N1N9_dist": 9.090, "C6C8_dist": 9.461, "CNNC_torsion": -15.584, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[3.23],O4(carbonyl)-N6(amino)[2.57]", "interBase_angle": 22.389, "planarity": 0.299, "simple_Shear": 0.747, "simple_Stretch": -0.145, "simple_Buckle": -16.344, "simple_Propeller": -15.301, "bp_simpleParams": [ 0.747, -0.145, 0.735, -16.344, -15.301, -26.044 ], "bp_params": [ 0.731, -0.210, 0.735, -17.631, -13.799, -25.932 ], "frame": { "rmsd": null, "origin": [ 22.403, 66.885, 56.174 ], "x_axis": [ 0.022, -0.783, 0.621 ], "y_axis": [ 0.908, -0.244, -0.340 ], "z_axis": [ 0.417, 0.572, 0.706 ], "quaternion": [ 0.609, -0.374, -0.084, -0.694 ] } }, { "index": 33, "nt1": "///A/132", "nt2": "///A/191", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -173.804, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 52.839, "chi2": -165.260, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 51.608, "C1C1_dist": 11.113, "N1N9_dist": 9.295, "C6C8_dist": 10.042, "CNNC_torsion": -2.940, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[3.32],N3-N1(imino)[3.17],N4(amino)-O6(carbonyl)[2.82]", "interBase_angle": 7.370, "planarity": 0.085, "simple_Shear": 0.277, "simple_Stretch": 0.037, "simple_Buckle": 5.327, "simple_Propeller": -5.093, "bp_simpleParams": [ 0.277, 0.037, -0.301, 5.327, -5.093, -7.700 ], "bp_params": [ 0.278, 0.030, -0.301, 5.210, -5.213, -7.701 ], "frame": { "rmsd": null, "origin": [ 21.695, 68.725, 58.482 ], "x_axis": [ 0.660, -0.666, 0.349 ], "y_axis": [ 0.709, 0.398, -0.582 ], "z_axis": [ 0.248, 0.631, 0.735 ], "quaternion": [ 0.836, -0.363, -0.030, -0.411 ] } }, { "index": 34, "nt1": "///A/133", "nt2": "///A/190", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -167.815, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 57.930, "chi2": -161.820, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 54.991, "C1C1_dist": 10.359, "N1N9_dist": 8.728, "C6C8_dist": 9.754, "CNNC_torsion": -10.918, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.97],N1-N3(imino)[2.71]", "interBase_angle": 11.066, "planarity": 0.148, "simple_Shear": 0.282, "simple_Stretch": -0.184, "simple_Buckle": -2.459, "simple_Propeller": -10.790, "bp_simpleParams": [ 0.282, -0.184, 0.202, -2.459, -10.790, 3.333 ], "bp_params": [ 0.276, -0.194, 0.202, -2.827, -10.699, 3.347 ], "frame": { "rmsd": null, "origin": [ 21.487, 70.029, 62.009 ], "x_axis": [ 0.879, -0.458, -0.132 ], "y_axis": [ 0.226, 0.645, -0.730 ], "z_axis": [ 0.419, 0.612, 0.671 ], "quaternion": [ 0.894, -0.375, 0.154, -0.191 ] } }, { "index": 35, "nt1": "///A/134", "nt2": "///A/189", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -172.139, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 53.624, "chi2": -157.624, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 57.695, "C1C1_dist": 10.461, "N1N9_dist": 8.793, "C6C8_dist": 9.764, "CNNC_torsion": -10.307, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[3.03],N1(imino)-N3[2.90],N2(amino)-O2(carbonyl)[2.76]", "interBase_angle": 23.084, "planarity": 0.251, "simple_Shear": -0.721, "simple_Stretch": -0.152, "simple_Buckle": -16.176, "simple_Propeller": -16.468, "bp_simpleParams": [ -0.721, -0.152, -0.348, -16.176, -16.468, 3.758 ], "bp_params": [ -0.711, -0.194, -0.348, -15.193, -17.380, 3.769 ], "frame": { "rmsd": null, "origin": [ 23.100, 70.831, 65.392 ], "x_axis": [ 0.823, -0.146, -0.548 ], "y_axis": [ -0.203, 0.827, -0.525 ], "z_axis": [ 0.530, 0.543, 0.651 ], "quaternion": [ 0.908, -0.294, 0.297, 0.016 ] } }, { "index": 36, "nt1": "///A/135", "nt2": "///A/187", "bp": "U+A", "name": "Hoogsteen", "Saenger": "23-XXIII", "LW": "cWH", "DSSR": "cW+M", "intra_chain": true, "chi1": -165.890, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 60.261, "chi2": 60.837, "conf2": "syn", "pucker2": "~C3'-endo", "lambda2": 59.091, "C1C1_dist": 8.157, "N1N9_dist": 6.667, "C6C8_dist": 6.076, "CNNC_torsion": -12.399, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N7[2.86],O4(carbonyl)-N6(amino)[3.36]", "interBase_angle": 14.792, "planarity": 0.208, "simple_Shear": -3.272, "simple_Stretch": 2.148, "simple_Buckle": 5.351, "simple_Propeller": -13.790, "bp_simpleParams": [ -3.272, 2.148, 0.407, 5.351, -13.790, -62.692 ], "bp_params": [ -0.559, 3.873, 0.407, -6.803, -13.135, -62.938 ], "frame": { "rmsd": null, "origin": [ 25.994, 70.501, 67.851 ], "x_axis": [ 0.115, 0.559, -0.821 ], "y_axis": [ -0.856, 0.476, 0.204 ], "z_axis": [ 0.505, 0.679, 0.533 ], "quaternion": [ 0.729, -0.163, 0.455, 0.485 ] } }, { "index": 37, "nt1": "///A/136", "nt2": "///A/182", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -171.225, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 54.694, "chi2": -122.884, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 50.638, "C1C1_dist": 10.979, "N1N9_dist": 9.195, "C6C8_dist": 10.028, "CNNC_torsion": -5.835, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.97],N1-N3(imino)[3.10]", "interBase_angle": 17.548, "planarity": 0.198, "simple_Shear": 0.215, "simple_Stretch": 0.107, "simple_Buckle": -9.024, "simple_Propeller": -15.050, "bp_simpleParams": [ 0.215, 0.107, -0.549, -9.024, -15.050, -3.937 ], "bp_params": [ 0.219, 0.100, -0.549, -9.464, -14.778, -3.957 ], "frame": { "rmsd": null, "origin": [ 27.332, 72.958, 70.370 ], "x_axis": [ -0.025, 0.446, -0.895 ], "y_axis": [ -0.819, 0.504, 0.274 ], "z_axis": [ 0.573, 0.740, 0.352 ], "quaternion": [ 0.677, -0.172, 0.542, 0.467 ] } }, { "index": 38, "nt1": "///A/137", "nt2": "///A/181", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -164.959, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 55.396, "chi2": 178.930, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 51.071, "C1C1_dist": 10.655, "N1N9_dist": 8.894, "C6C8_dist": 9.824, "CNNC_torsion": -22.521, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.94],N3-N1(imino)[2.86],N4(amino)-O6(carbonyl)[3.02]", "interBase_angle": 27.464, "planarity": 0.342, "simple_Shear": 0.432, "simple_Stretch": -0.196, "simple_Buckle": 2.802, "simple_Propeller": -27.321, "bp_simpleParams": [ 0.432, -0.196, 0.027, 2.802, -27.321, 1.158 ], "bp_params": [ 0.425, -0.211, 0.027, 1.756, -27.408, 1.191 ], "frame": { "rmsd": null, "origin": [ 29.775, 75.151, 70.068 ], "x_axis": [ -0.549, 0.600, -0.582 ], "y_axis": [ -0.667, 0.105, 0.738 ], "z_axis": [ 0.504, 0.793, 0.343 ], "quaternion": [ 0.474, -0.029, 0.573, 0.668 ] } }, { "index": 39, "nt1": "///A/138", "nt2": "///A/180", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -128.661, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 52.613, "chi2": -160.873, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 50.037, "C1C1_dist": 10.697, "N1N9_dist": 8.856, "C6C8_dist": 9.675, "CNNC_torsion": -4.519, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.84],N3-N1(imino)[2.76],N4(amino)-O6(carbonyl)[2.57]", "interBase_angle": 5.411, "planarity": 0.067, "simple_Shear": 0.278, "simple_Stretch": -0.340, "simple_Buckle": 0.621, "simple_Propeller": -5.375, "bp_simpleParams": [ 0.278, -0.340, 0.031, 0.621, -5.375, -5.026 ], "bp_params": [ 0.270, -0.347, 0.031, 0.494, -5.388, -5.031 ], "frame": { "rmsd": null, "origin": [ 32.926, 77.510, 69.717 ], "x_axis": [ -0.906, 0.343, -0.249 ], "y_axis": [ -0.314, -0.147, 0.938 ], "z_axis": [ 0.285, 0.928, 0.241 ], "quaternion": [ 0.217, 0.012, 0.616, 0.757 ] } }, { "index": 40, "nt1": "///A/139", "nt2": "///A/164", "bp": "A-G", "name": "Sheared", "Saenger": "11-XI", "LW": "tHS", "DSSR": "tM-m", "intra_chain": true, "chi1": 176.907, "conf1": "--", "pucker1": "~C3'-endo", "lambda1": 7.771, "chi2": -100.526, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 94.746, "C1C1_dist": 9.164, "N1N9_dist": 7.936, "C6C8_dist": 8.304, "CNNC_torsion": -121.013, "hbonds_num": 3, "hbonds_desc": "N7-N2(amino)[2.91],N6(amino)-O4'[3.03],N6(amino)-N3[3.19]", "interBase_angle": 30.735, "planarity": 0.455, "simple_Shear": -7.586, "simple_Stretch": 2.093, "simple_Buckle": 12.828, "simple_Propeller": 27.930, "bp_simpleParams": [ -7.586, 2.093, 0.898, 12.828, 27.930, -0.597 ], "bp_params": [ -6.340, -4.662, 0.898, -14.158, 27.280, -0.609 ], "frame": { "rmsd": null, "origin": [ 38.897, 73.438, 74.600 ], "x_axis": [ 0.269, 0.786, -0.557 ], "y_axis": [ -0.692, 0.560, 0.456 ], "z_axis": [ 0.670, 0.263, 0.694 ], "quaternion": [ 0.794, 0.061, 0.386, 0.465 ] } }, { "index": 41, "nt1": "///A/140", "nt2": "///A/163", "bp": "A-G", "name": "Sheared", "Saenger": "11-XI", "LW": "tHS", "DSSR": "tM-m", "intra_chain": true, "chi1": -172.727, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 11.612, "chi2": -154.542, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 96.500, "C1C1_dist": 9.656, "N1N9_dist": 8.457, "C6C8_dist": 8.959, "CNNC_torsion": 13.364, "hbonds_num": 3, "hbonds_desc": "N7-N2(amino)[2.73],N6(amino)-O2'(hydroxyl)[2.92],N6(amino)-N3[2.71]", "interBase_angle": 14.803, "planarity": 0.201, "simple_Shear": -7.194, "simple_Stretch": 2.268, "simple_Buckle": -1.457, "simple_Propeller": -14.731, "bp_simpleParams": [ -7.194, 2.268, -0.169, -1.457, -14.731, -1.025 ], "bp_params": [ -6.543, -3.754, -0.169, 9.852, -11.048, -1.026 ], "frame": { "rmsd": null, "origin": [ 41.162, 73.887, 76.586 ], "x_axis": [ -0.320, 0.879, -0.353 ], "y_axis": [ -0.779, -0.032, 0.626 ], "z_axis": [ 0.539, 0.476, 0.695 ], "quaternion": [ 0.579, 0.065, 0.385, 0.715 ] } }, { "index": 42, "nt1": "///A/141", "nt2": "///A/162", "bp": "G-U", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -171.841, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 41.329, "chi2": -166.870, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 67.511, "C1C1_dist": 10.259, "N1N9_dist": 8.596, "C6C8_dist": 9.497, "CNNC_torsion": -11.718, "hbonds_num": 2, "hbonds_desc": "O6(carbonyl)-N3(imino)[2.62],N1(imino)-O2(carbonyl)[2.62]", "interBase_angle": 20.653, "planarity": 0.301, "simple_Shear": -2.299, "simple_Stretch": -0.214, "simple_Buckle": 4.859, "simple_Propeller": -20.074, "bp_simpleParams": [ -2.299, -0.214, -0.105, 4.859, -20.074, 0.148 ], "bp_params": [ -2.187, -0.742, -0.105, 9.346, -18.418, 0.149 ], "frame": { "rmsd": null, "origin": [ 43.525, 75.756, 78.450 ], "x_axis": [ -0.876, 0.439, 0.200 ], "y_axis": [ -0.253, -0.771, 0.585 ], "z_axis": [ 0.411, 0.462, 0.786 ], "quaternion": [ 0.187, 0.165, 0.282, 0.926 ] } }, { "index": 43, "nt1": "///A/142", "nt2": "///A/161", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -162.050, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 53.346, "chi2": -168.566, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 54.885, "C1C1_dist": 10.432, "N1N9_dist": 8.702, "C6C8_dist": 9.613, "CNNC_torsion": -13.247, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.65],O4(carbonyl)-N6(amino)[2.69]", "interBase_angle": 18.497, "planarity": 0.216, "simple_Shear": 0.041, "simple_Stretch": -0.331, "simple_Buckle": 4.035, "simple_Propeller": -18.051, "bp_simpleParams": [ 0.041, -0.331, -0.180, 4.035, -18.051, -1.034 ], "bp_params": [ 0.042, -0.330, -0.180, 4.055, -18.047, -1.046 ], "frame": { "rmsd": null, "origin": [ 44.877, 78.498, 80.450 ], "x_axis": [ -0.824, -0.234, 0.517 ], "y_axis": [ 0.427, -0.855, 0.294 ], "z_axis": [ 0.373, 0.463, 0.804 ], "quaternion": [ -0.177, 0.238, 0.203, 0.933 ] } }, { "index": 44, "nt1": "///A/143", "nt2": "///A/160", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -164.161, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 55.117, "chi2": -165.707, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 52.773, "C1C1_dist": 10.733, "N1N9_dist": 8.994, "C6C8_dist": 9.900, "CNNC_torsion": -7.716, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.89],N3-N1(imino)[2.94],N4(amino)-O6(carbonyl)[2.90]", "interBase_angle": 9.722, "planarity": 0.126, "simple_Shear": 0.352, "simple_Stretch": -0.125, "simple_Buckle": -0.256, "simple_Propeller": -9.718, "bp_simpleParams": [ 0.352, -0.125, -0.013, -0.256, -9.718, -1.171 ], "bp_params": [ 0.348, -0.136, -0.013, -0.555, -9.706, -1.175 ], "frame": { "rmsd": null, "origin": [ 45.221, 81.295, 82.920 ], "x_axis": [ -0.501, -0.696, 0.514 ], "y_axis": [ 0.804, -0.594, -0.021 ], "z_axis": [ 0.320, 0.403, 0.857 ], "quaternion": [ -0.436, 0.243, 0.111, 0.859 ] } }, { "index": 45, "nt1": "///A/144", "nt2": "///A/159", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -160.675, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 56.493, "chi2": -162.929, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 55.492, "C1C1_dist": 10.577, "N1N9_dist": 8.925, "C6C8_dist": 9.939, "CNNC_torsion": -11.935, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.93],O4(carbonyl)-N6(amino)[3.17]", "interBase_angle": 13.638, "planarity": 0.170, "simple_Shear": 0.081, "simple_Stretch": 0.000, "simple_Buckle": 2.195, "simple_Propeller": -13.460, "bp_simpleParams": [ 0.081, 0.000, 0.120, 2.195, -13.460, 3.257 ], "bp_params": [ 0.081, -0.000, 0.120, 2.161, -13.466, 3.279 ], "frame": { "rmsd": null, "origin": [ 44.963, 82.826, 85.990 ], "x_axis": [ -0.067, -0.940, 0.334 ], "y_axis": [ 0.957, -0.155, -0.245 ], "z_axis": [ 0.282, 0.303, 0.910 ], "quaternion": [ 0.650, -0.211, -0.020, -0.730 ] } }, { "index": 46, "nt1": "///A/145", "nt2": "///A/158", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -159.130, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 58.308, "chi2": -167.845, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 53.617, "C1C1_dist": 10.630, "N1N9_dist": 8.975, "C6C8_dist": 9.953, "CNNC_torsion": -4.338, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.77],N3-N1(imino)[3.00],N4(amino)-O6(carbonyl)[3.09]", "interBase_angle": 6.913, "planarity": 0.115, "simple_Shear": 0.535, "simple_Stretch": -0.051, "simple_Buckle": 6.066, "simple_Propeller": -3.317, "bp_simpleParams": [ 0.535, -0.051, 0.206, 6.066, -3.317, 2.411 ], "bp_params": [ 0.532, -0.076, 0.206, 5.901, -3.601, 2.409 ], "frame": { "rmsd": null, "origin": [ 44.971, 83.164, 89.320 ], "x_axis": [ 0.462, -0.886, 0.023 ], "y_axis": [ 0.837, 0.428, -0.341 ], "z_axis": [ 0.292, 0.177, 0.940 ], "quaternion": [ 0.841, -0.154, 0.080, -0.512 ] } }, { "index": 47, "nt1": "///A/146", "nt2": "///A/157", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -163.815, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 56.625, "chi2": -157.653, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 55.247, "C1C1_dist": 10.269, "N1N9_dist": 8.614, "C6C8_dist": 9.596, "CNNC_torsion": -7.731, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.72],N1-N3(imino)[2.57]", "interBase_angle": 9.938, "planarity": 0.121, "simple_Shear": 0.184, "simple_Stretch": -0.347, "simple_Buckle": 2.926, "simple_Propeller": -9.497, "bp_simpleParams": [ 0.184, -0.347, 0.045, 2.926, -9.497, 1.485 ], "bp_params": [ 0.176, -0.351, 0.045, 2.706, -9.562, 1.490 ], "frame": { "rmsd": null, "origin": [ 44.909, 82.779, 92.682 ], "x_axis": [ 0.746, -0.568, -0.348 ], "y_axis": [ 0.521, 0.823, -0.226 ], "z_axis": [ 0.415, -0.013, 0.910 ], "quaternion": [ 0.932, -0.057, 0.205, -0.292 ] } }, { "index": 48, "nt1": "///A/147", "nt2": "///A/156", "bp": "G-U", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -171.170, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 43.677, "chi2": -156.363, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 68.114, "C1C1_dist": 10.206, "N1N9_dist": 8.595, "C6C8_dist": 9.558, "CNNC_torsion": -2.773, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N3(imino)[2.71],N1(imino)-O2(carbonyl)[2.56],N2(amino)-O2(carbonyl)[3.25]", "interBase_angle": 8.533, "planarity": 0.140, "simple_Shear": -2.264, "simple_Stretch": -0.199, "simple_Buckle": -2.279, "simple_Propeller": -8.223, "bp_simpleParams": [ -2.264, -0.199, -0.363, -2.279, -8.223, 2.595 ], "bp_params": [ -2.164, -0.695, -0.363, -0.398, -8.523, 2.603 ], "frame": { "rmsd": null, "origin": [ 45.871, 81.281, 95.544 ], "x_axis": [ 0.741, -0.152, -0.654 ], "y_axis": [ 0.155, 0.986, -0.053 ], "z_axis": [ 0.654, -0.063, 0.754 ], "quaternion": [ 0.933, 0.003, 0.350, -0.082 ] } }, { "index": 49, "nt1": "///A/148", "nt2": "///A/155", "bp": "G-U", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -177.394, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 44.355, "chi2": -165.186, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 69.556, "C1C1_dist": 10.397, "N1N9_dist": 8.833, "C6C8_dist": 9.824, "CNNC_torsion": -1.490, "hbonds_num": 2, "hbonds_desc": "O6(carbonyl)-N3(imino)[2.99],N1(imino)-O2(carbonyl)[2.74]", "interBase_angle": 9.512, "planarity": 0.101, "simple_Shear": -2.411, "simple_Stretch": 0.134, "simple_Buckle": -9.199, "simple_Propeller": -2.420, "bp_simpleParams": [ -2.411, 0.134, -0.285, -9.199, -2.420, 3.788 ], "bp_params": [ -2.375, -0.438, -0.285, -8.373, -4.512, 3.781 ], "frame": { "rmsd": null, "origin": [ 48.565, 79.735, 97.627 ], "x_axis": [ 0.555, 0.407, -0.726 ], "y_axis": [ -0.331, 0.908, 0.256 ], "z_axis": [ 0.763, 0.098, 0.639 ], "quaternion": [ 0.881, 0.045, 0.423, 0.210 ] } }, { "index": 50, "nt1": "///A/149", "nt2": "///A/154", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -167.140, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 55.079, "chi2": -165.124, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 57.530, "C1C1_dist": 10.613, "N1N9_dist": 8.974, "C6C8_dist": 9.996, "CNNC_torsion": 7.842, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[3.18],N1(imino)-N3[2.99],N2(amino)-O2(carbonyl)[2.69]", "interBase_angle": 9.316, "planarity": 0.125, "simple_Shear": -0.397, "simple_Stretch": -0.008, "simple_Buckle": -5.500, "simple_Propeller": 7.519, "bp_simpleParams": [ -0.397, -0.008, -0.237, -5.500, 7.519, 4.160 ], "bp_params": [ -0.397, -0.022, -0.237, -5.768, 7.315, 4.164 ], "frame": { "rmsd": null, "origin": [ 51.863, 78.610, 99.071 ], "x_axis": [ 0.205, 0.858, -0.471 ], "y_axis": [ -0.609, 0.489, 0.625 ], "z_axis": [ 0.766, 0.158, 0.623 ], "quaternion": [ 0.761, 0.153, 0.407, 0.482 ] } }, { "index": 51, "nt1": "///A/150", "nt2": "///A/153", "bp": "G-A", "name": "Sheared", "Saenger": "11-XI", "LW": "tSH", "DSSR": "tm-M", "intra_chain": true, "chi1": -161.789, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 93.723, "chi2": -146.824, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 14.158, "C1C1_dist": 9.304, "N1N9_dist": 8.114, "C6C8_dist": 8.325, "CNNC_torsion": -122.320, "hbonds_num": 2, "hbonds_desc": "N2(amino)-OP2[2.86],N2(amino)-N7[2.74]", "interBase_angle": 14.694, "planarity": 0.328, "simple_Shear": 8.035, "simple_Stretch": 2.867, "simple_Buckle": 9.887, "simple_Propeller": 10.869, "bp_simpleParams": [ 8.035, 2.867, 1.311, 9.887, 10.869, -18.205 ], "bp_params": [ 6.839, -5.100, 1.311, 14.527, -2.204, -18.065 ], "frame": { "rmsd": null, "origin": [ 54.790, 76.748, 100.551 ], "x_axis": [ -0.509, 0.853, 0.115 ], "y_axis": [ -0.508, -0.406, 0.760 ], "z_axis": [ 0.695, 0.328, 0.640 ], "quaternion": [ 0.426, 0.253, 0.340, 0.799 ] } }, { "index": 52, "nt1": "///A/151", "nt2": "///A/248", "bp": "A+A", "name": "--", "Saenger": "01-I", "LW": "tWW", "DSSR": "tW+W", "intra_chain": true, "chi1": -176.096, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 29.310, "chi2": -115.973, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 31.662, "C1C1_dist": 13.576, "N1N9_dist": 11.125, "C6C8_dist": 11.338, "CNNC_torsion": 139.300, "hbonds_num": 2, "hbonds_desc": "N6(amino)-N1[3.05],N1-N6(amino)[2.92]", "interBase_angle": 27.093, "planarity": 0.318, "simple_Shear": -1.122, "simple_Stretch": 1.600, "simple_Buckle": -4.232, "simple_Propeller": -26.761, "bp_simpleParams": [ -1.122, 1.600, 0.271, -4.232, -26.761, -179.637 ], "bp_params": [ 1.468, 1.290, 0.271, -27.066, 1.214, -179.626 ], "frame": { "rmsd": null, "origin": [ 60.816, 71.721, 105.251 ], "x_axis": [ -0.425, 0.798, 0.427 ], "y_axis": [ 0.522, 0.602, -0.605 ], "z_axis": [ -0.740, -0.034, -0.672 ], "quaternion": [ -0.355, 0.402, 0.821, -0.194 ] } }, { "index": 53, "nt1": "///A/152", "nt2": "///A/224", "bp": "A-U", "name": "--", "Saenger": "--", "LW": "cSS", "DSSR": "cm-m", "intra_chain": true, "chi1": -156.935, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 95.967, "chi2": -159.214, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 146.430, "C1C1_dist": 5.562, "N1N9_dist": 7.082, "C6C8_dist": 9.623, "CNNC_torsion": -48.684, "hbonds_num": 3, "hbonds_desc": "O2'(hydroxyl)-O3'[3.05],O2'(hydroxyl)-O2'(hydroxyl)[2.62],N3-O2'(hydroxyl)[2.69]", "interBase_angle": 30.899, "planarity": 0.373, "simple_Shear": -0.799, "simple_Stretch": 6.891, "simple_Buckle": 4.252, "simple_Propeller": -30.605, "bp_simpleParams": [ -0.799, 6.891, 1.112, 4.252, -30.605, 146.706 ], "bp_params": [ -2.464, 6.484, 1.112, 11.536, -28.665, 147.523 ], "frame": { "rmsd": null, "origin": [ 60.500, 69.892, 102.686 ], "x_axis": [ -0.167, -0.869, 0.465 ], "y_axis": [ -0.775, 0.407, 0.484 ], "z_axis": [ -0.610, -0.279, -0.742 ], "quaternion": [ -0.353, -0.540, 0.761, 0.067 ] } }, { "index": 54, "nt1": "///A/153", "nt2": "///A/250", "bp": "A+G", "name": "Linker", "Saenger": "--", "LW": "tSS", "DSSR": "tm+m", "intra_chain": true, "chi1": -146.824, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 65.852, "chi2": -171.628, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 80.638, "C1C1_dist": 8.016, "N1N9_dist": 7.689, "C6C8_dist": 10.049, "CNNC_torsion": 163.753, "hbonds_num": 2, "hbonds_desc": "N1-O2'(hydroxyl)[3.21],N3-N2(amino)[2.79]", "interBase_angle": 22.026, "planarity": 0.379, "simple_Shear": 7.119, "simple_Stretch": 3.650, "simple_Buckle": -13.835, "simple_Propeller": -17.138, "bp_simpleParams": [ 7.119, 3.650, 1.150, -13.835, -17.138, 159.784 ], "bp_params": [ 2.930, 7.444, 1.150, 0.972, -22.004, 160.147 ], "frame": { "rmsd": null, "origin": [ 57.769, 70.140, 100.478 ], "x_axis": [ -0.471, -0.369, 0.801 ], "y_axis": [ -0.507, 0.857, 0.097 ], "z_axis": [ -0.722, -0.360, -0.590 ], "quaternion": [ -0.446, -0.256, 0.854, -0.077 ] } }, { "index": 55, "nt1": "///A/164", "nt2": "///A/178", "bp": "G-A", "name": "--", "Saenger": "--", "LW": "cWH", "DSSR": "cW-M", "intra_chain": true, "chi1": -100.526, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 35.070, "chi2": -141.207, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 37.158, "C1C1_dist": 11.520, "N1N9_dist": 9.168, "C6C8_dist": 7.677, "CNNC_torsion": -43.951, "hbonds_num": 1, "hbonds_desc": "O6(carbonyl)-N6(amino)[3.16]", "interBase_angle": 68.461, "planarity": 0.827, "simple_Shear": 1.387, "simple_Stretch": 3.833, "simple_Buckle": 68.274, "simple_Propeller": 5.053, "bp_simpleParams": [ 1.387, 3.833, -1.074, 68.274, 5.053, -128.085 ], "bp_params": [ 2.493, 3.226, -1.074, 66.403, -16.658, -120.040 ], "frame": { "rmsd": null, "origin": [ 36.091, 78.212, 73.143 ], "x_axis": [ 0.828, -0.044, -0.558 ], "y_axis": [ 0.281, -0.831, 0.481 ], "z_axis": [ -0.485, -0.555, -0.676 ], "quaternion": [ 0.284, 0.913, 0.065, -0.286 ] } }, { "index": 56, "nt1": "///A/165", "nt2": "///A/175", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -166.732, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 52.755, "chi2": -170.586, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 56.784, "C1C1_dist": 10.558, "N1N9_dist": 8.854, "C6C8_dist": 9.814, "CNNC_torsion": -4.416, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.84],N3-N1(imino)[2.86],N4(amino)-O6(carbonyl)[2.85]", "interBase_angle": 13.157, "planarity": 0.256, "simple_Shear": -0.043, "simple_Stretch": -0.224, "simple_Buckle": -4.046, "simple_Propeller": -12.520, "bp_simpleParams": [ -0.043, -0.224, -0.593, -4.046, -12.520, 2.172 ], "bp_params": [ -0.042, -0.225, -0.593, -3.948, -12.551, 2.184 ], "frame": { "rmsd": null, "origin": [ 45.775, 72.087, 64.154 ], "x_axis": [ 0.627, 0.023, 0.779 ], "y_axis": [ -0.704, -0.411, 0.579 ], "z_axis": [ 0.333, -0.911, -0.242 ], "quaternion": [ 0.494, 0.755, -0.226, 0.368 ] } }, { "index": 57, "nt1": "///A/166", "nt2": "///A/174", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -158.013, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 55.302, "chi2": -167.431, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 52.153, "C1C1_dist": 10.793, "N1N9_dist": 9.044, "C6C8_dist": 9.947, "CNNC_torsion": -7.600, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.89],N3-N1(imino)[2.95],N4(amino)-O6(carbonyl)[2.92]", "interBase_angle": 8.649, "planarity": 0.118, "simple_Shear": 0.178, "simple_Stretch": -0.081, "simple_Buckle": -1.471, "simple_Propeller": -8.523, "bp_simpleParams": [ 0.178, -0.081, -0.033, -1.471, -8.523, -0.986 ], "bp_params": [ 0.177, -0.084, -0.033, -1.581, -8.503, -0.988 ], "frame": { "rmsd": null, "origin": [ 47.909, 69.531, 63.231 ], "x_axis": [ 0.084, -0.019, 0.996 ], "y_axis": [ -0.903, -0.424, 0.068 ], "z_axis": [ 0.421, -0.905, -0.052 ], "quaternion": [ 0.390, 0.625, -0.369, 0.567 ] } }, { "index": 58, "nt1": "///A/167", "nt2": "///A/173", "bp": "U+A", "name": "--", "Saenger": "--", "LW": "tW.", "DSSR": "tW+.", "intra_chain": true, "chi1": -133.298, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 24.837, "chi2": -173.926, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 6.436, "C1C1_dist": 13.391, "N1N9_dist": 10.610, "C6C8_dist": 10.124, "CNNC_torsion": 120.816, "hbonds_num": 1, "hbonds_desc": "O4(carbonyl)-N6(amino)[2.67]", "interBase_angle": 16.320, "planarity": 0.224, "simple_Shear": -3.939, "simple_Stretch": 1.153, "simple_Buckle": -9.621, "simple_Propeller": -13.183, "bp_simpleParams": [ -3.939, 1.153, 0.614, -9.621, -13.183, -160.447 ], "bp_params": [ -0.532, 4.070, 0.614, -15.945, 3.481, -160.268 ], "frame": { "rmsd": null, "origin": [ 50.047, 67.105, 63.499 ], "x_axis": [ -0.676, -0.411, -0.612 ], "y_axis": [ -0.532, -0.303, 0.791 ], "z_axis": [ -0.510, 0.860, -0.013 ], "quaternion": [ 0.043, -0.400, 0.589, 0.701 ] } }, { "index": 59, "nt1": "///A/168", "nt2": "///A/188", "bp": "U-G", "name": "--", "Saenger": "--", "LW": "tHW", "DSSR": "tM-W", "intra_chain": true, "chi1": -137.211, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 19.211, "chi2": 104.627, "conf2": "--", "pucker2": "~C2'-endo", "lambda2": 31.585, "C1C1_dist": 12.898, "N1N9_dist": 10.312, "C6C8_dist": 9.320, "CNNC_torsion": 133.277, "hbonds_num": 2, "hbonds_desc": "O4(carbonyl)-N1(imino)[3.05],O4(carbonyl)-N2(amino)[2.98]", "interBase_angle": 22.068, "planarity": 0.317, "simple_Shear": -4.058, "simple_Stretch": 3.653, "simple_Buckle": 20.605, "simple_Propeller": -7.902, "bp_simpleParams": [ -4.058, 3.653, 0.041, 20.605, -7.902, -90.682 ], "bp_params": [ -5.422, 0.645, 0.041, 21.375, 5.490, -89.746 ], "frame": { "rmsd": null, "origin": [ 34.496, 58.570, 69.645 ], "x_axis": [ 0.120, 0.978, -0.170 ], "y_axis": [ 0.969, -0.153, -0.193 ], "z_axis": [ -0.214, -0.141, -0.966 ], "quaternion": [ -0.017, 0.748, 0.651, -0.128 ] } }, { "index": 60, "nt1": "///A/169", "nt2": "///B/255", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": 177.446, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 54.055, "chi2": -166.379, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 56.808, "C1C1_dist": 10.494, "N1N9_dist": 8.816, "C6C8_dist": 9.798, "CNNC_torsion": -1.679, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.92],N1(imino)-N3[2.85],N2(amino)-O2(carbonyl)[2.70]", "interBase_angle": 10.175, "planarity": 0.170, "simple_Shear": -0.372, "simple_Stretch": -0.235, "simple_Buckle": -4.512, "simple_Propeller": -9.120, "bp_simpleParams": [ -0.372, -0.235, -0.635, -4.512, -9.120, 3.274 ], "bp_params": [ -0.364, -0.247, -0.635, -4.222, -9.258, 3.282 ], "frame": { "rmsd": null, "origin": [ 52.060, 57.324, 67.017 ], "x_axis": [ 0.149, -0.090, -0.985 ], "y_axis": [ -0.897, -0.431, -0.096 ], "z_axis": [ -0.416, 0.898, -0.145 ], "quaternion": [ -0.378, 0.657, -0.376, -0.533 ] } }, { "index": 61, "nt1": "///A/170", "nt2": "///B/254", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -169.321, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 55.445, "chi2": -174.850, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 51.361, "C1C1_dist": 10.591, "N1N9_dist": 8.829, "C6C8_dist": 9.748, "CNNC_torsion": -1.354, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.73],N3-N1(imino)[2.88],N4(amino)-O6(carbonyl)[2.89]", "interBase_angle": 15.223, "planarity": 0.190, "simple_Shear": 0.526, "simple_Stretch": -0.174, "simple_Buckle": -15.201, "simple_Propeller": 0.807, "bp_simpleParams": [ 0.526, -0.174, 0.188, -15.201, 0.807, 0.321 ], "bp_params": [ 0.517, -0.198, 0.188, -15.147, 1.520, 0.318 ], "frame": { "rmsd": null, "origin": [ 52.331, 61.339, 66.594 ], "x_axis": [ -0.445, -0.401, -0.801 ], "y_axis": [ -0.739, -0.341, 0.582 ], "z_axis": [ -0.506, 0.850, -0.144 ], "quaternion": [ 0.132, -0.510, 0.559, 0.641 ] } }, { "index": 62, "nt1": "///A/171", "nt2": "///A/172", "bp": "A+A", "name": "Platform", "Saenger": "--", "LW": "cSH", "DSSR": "cm+M", "intra_chain": true, "chi1": -164.853, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 139.824, "chi2": -178.475, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 35.170, "C1C1_dist": 7.101, "N1N9_dist": 7.021, "C6C8_dist": 6.980, "CNNC_torsion": 15.189, "hbonds_num": 1, "hbonds_desc": "N3-N6(amino)[3.41]", "interBase_angle": 11.968, "planarity": 0.208, "simple_Shear": -0.007, "simple_Stretch": 6.993, "simple_Buckle": -11.902, "simple_Propeller": 1.249, "bp_simpleParams": [ -0.007, 6.993, 0.696, -11.902, 1.249, 0.754 ], "bp_params": [ 6.992, -0.120, 0.696, 1.460, 11.878, 0.758 ], "frame": { "rmsd": null, "origin": [ 51.370, 63.492, 63.861 ], "x_axis": [ -0.819, -0.572, 0.053 ], "y_axis": [ -0.060, 0.177, 0.982 ], "z_axis": [ -0.571, 0.801, -0.179 ], "quaternion": [ -0.212, -0.214, 0.737, 0.605 ] } }, { "index": 63, "nt1": "///A/181", "nt2": "///A/186", "bp": "G+A", "name": "Linker", "Saenger": "--", "LW": "tSS", "DSSR": "tm+m", "intra_chain": true, "chi1": 178.930, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 83.799, "chi2": -130.331, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 57.699, "C1C1_dist": 8.133, "N1N9_dist": 7.663, "C6C8_dist": 9.789, "CNNC_torsion": 159.640, "hbonds_num": 2, "hbonds_desc": "O2'(hydroxyl)-N1[2.48],N2(amino)-N3[2.92]", "interBase_angle": 40.762, "planarity": 0.471, "simple_Shear": 6.944, "simple_Stretch": 3.266, "simple_Buckle": 37.491, "simple_Propeller": -15.999, "bp_simpleParams": [ 6.944, 3.266, 1.575, 37.491, -15.999, -153.792 ], "bp_params": [ -2.711, -7.179, 1.575, -37.890, -15.031, -152.553 ], "frame": { "rmsd": null, "origin": [ 33.295, 73.304, 70.783 ], "x_axis": [ 0.565, 0.109, -0.818 ], "y_axis": [ 0.643, -0.680, 0.354 ], "z_axis": [ -0.517, -0.725, -0.454 ], "quaternion": [ 0.328, 0.821, 0.229, -0.406 ] } }, { "index": 64, "nt1": "///A/184", "nt2": "///A/212", "bp": "A+G", "name": "Linker", "Saenger": "--", "LW": "tSS", "DSSR": "tm+m", "intra_chain": true, "chi1": -121.844, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 59.361, "chi2": -176.778, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 86.697, "C1C1_dist": 8.205, "N1N9_dist": 7.843, "C6C8_dist": 10.091, "CNNC_torsion": 158.563, "hbonds_num": 2, "hbonds_desc": "N1-O2'(hydroxyl)[2.56],N3-N2(amino)[3.05]", "interBase_angle": 28.854, "planarity": 0.355, "simple_Shear": 6.986, "simple_Stretch": 3.455, "simple_Buckle": 20.843, "simple_Propeller": -19.954, "bp_simpleParams": [ 6.986, 3.455, -1.386, 20.843, -19.954, 154.990 ], "bp_params": [ 2.732, 7.299, -1.386, 28.853, -0.278, 154.202 ], "frame": { "rmsd": null, "origin": [ 38.840, 56.179, 77.258 ], "x_axis": [ 0.766, -0.228, -0.602 ], "y_axis": [ 0.005, 0.937, -0.349 ], "z_axis": [ 0.643, 0.264, 0.719 ], "quaternion": [ 0.925, -0.166, 0.336, -0.063 ] } }, { "index": 65, "nt1": "///A/197", "nt2": "///A/200", "bp": "C-G", "name": "--", "Saenger": "--", "LW": "cSS", "DSSR": "cm-m", "intra_chain": true, "chi1": -164.318, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 147.632, "chi2": 168.282, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 101.963, "C1C1_dist": 5.708, "N1N9_dist": 7.298, "C6C8_dist": 9.813, "CNNC_torsion": -8.893, "hbonds_num": 3, "hbonds_desc": "O2'(hydroxyl)-O2'(hydroxyl)[2.81],O2'(hydroxyl)-N3[2.68],O2(carbonyl)-N2(amino)[2.67]", "interBase_angle": 29.994, "planarity": 0.346, "simple_Shear": 0.629, "simple_Stretch": 7.457, "simple_Buckle": 27.529, "simple_Propeller": 11.907, "bp_simpleParams": [ 0.629, 7.457, -1.015, 27.529, 11.907, 152.045 ], "bp_params": [ 2.230, 7.144, -1.015, 29.488, 5.485, 151.163 ], "frame": { "rmsd": null, "origin": [ 17.184, 45.965, 55.984 ], "x_axis": [ -0.818, 0.405, 0.408 ], "y_axis": [ 0.133, 0.824, -0.551 ], "z_axis": [ -0.559, -0.397, -0.728 ], "quaternion": [ -0.263, 0.147, 0.918, -0.258 ] } }, { "index": 66, "nt1": "///A/218", "nt2": "///A/219", "bp": "A+A", "name": "Platform", "Saenger": "--", "LW": "cSH", "DSSR": "cm+M", "intra_chain": true, "chi1": -122.114, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 142.213, "chi2": 178.015, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 35.868, "C1C1_dist": 6.458, "N1N9_dist": 6.431, "C6C8_dist": 6.386, "CNNC_torsion": 27.457, "hbonds_num": 1, "hbonds_desc": "N3-N6(amino)[2.97]", "interBase_angle": 16.022, "planarity": 0.217, "simple_Shear": -0.006, "simple_Stretch": 6.660, "simple_Buckle": -14.414, "simple_Propeller": 6.996, "bp_simpleParams": [ -0.006, 6.660, -0.305, -14.414, 6.996, 3.300 ], "bp_params": [ 6.660, -0.056, -0.305, 7.108, 14.359, 3.319 ], "frame": { "rmsd": null, "origin": [ 54.951, 57.515, 90.615 ], "x_axis": [ -0.770, 0.637, 0.036 ], "y_axis": [ -0.142, -0.225, 0.964 ], "z_axis": [ 0.622, 0.737, 0.264 ], "quaternion": [ 0.259, 0.219, 0.566, 0.752 ] } }, { "index": 67, "nt1": "///A/220", "nt2": "///A/253", "bp": "G-U", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -166.179, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 40.672, "chi2": -162.221, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 67.601, "C1C1_dist": 10.397, "N1N9_dist": 8.724, "C6C8_dist": 9.628, "CNNC_torsion": -12.273, "hbonds_num": 2, "hbonds_desc": "O6(carbonyl)-N3(imino)[2.81],N1(imino)-O2(carbonyl)[2.67]", "interBase_angle": 10.339, "planarity": 0.155, "simple_Shear": -2.230, "simple_Stretch": -0.128, "simple_Buckle": 6.066, "simple_Propeller": -8.372, "bp_simpleParams": [ -2.230, -0.128, 0.652, 6.066, -8.372, -0.649 ], "bp_params": [ -2.147, -0.617, 0.652, 7.759, -6.833, -0.648 ], "frame": { "rmsd": null, "origin": [ 57.069, 59.237, 93.332 ], "x_axis": [ -0.550, 0.119, 0.827 ], "y_axis": [ 0.467, -0.777, 0.422 ], "z_axis": [ 0.693, 0.618, 0.371 ], "quaternion": [ -0.106, 0.463, 0.317, 0.821 ] } }, { "index": 68, "nt1": "///A/221", "nt2": "///A/252", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -164.175, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 53.354, "chi2": -167.465, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 55.441, "C1C1_dist": 10.622, "N1N9_dist": 8.902, "C6C8_dist": 9.822, "CNNC_torsion": -12.924, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.88],O4(carbonyl)-N6(amino)[2.98]", "interBase_angle": 14.636, "planarity": 0.223, "simple_Shear": -0.063, "simple_Stretch": -0.101, "simple_Buckle": 9.086, "simple_Propeller": -11.474, "bp_simpleParams": [ -0.063, -0.101, 0.385, 9.086, -11.474, -1.447 ], "bp_params": [ -0.062, -0.102, 0.385, 9.247, -11.345, -1.450 ], "frame": { "rmsd": null, "origin": [ 58.650, 62.368, 94.170 ], "x_axis": [ -0.188, -0.428, 0.884 ], "y_axis": [ 0.697, -0.692, -0.187 ], "z_axis": [ 0.692, 0.581, 0.429 ], "quaternion": [ -0.370, 0.518, 0.130, 0.760 ] } }, { "index": 69, "nt1": "///A/222", "nt2": "///A/251", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -159.894, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 55.770, "chi2": 177.834, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 51.434, "C1C1_dist": 10.628, "N1N9_dist": 8.882, "C6C8_dist": 9.824, "CNNC_torsion": -16.082, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.79],N3-N1(imino)[2.91],N4(amino)-O6(carbonyl)[3.05]", "interBase_angle": 24.046, "planarity": 0.275, "simple_Shear": 0.469, "simple_Stretch": -0.118, "simple_Buckle": 14.447, "simple_Propeller": -19.222, "bp_simpleParams": [ 0.469, -0.118, -0.055, 14.447, -19.222, 1.636 ], "bp_params": [ 0.465, -0.132, -0.055, 13.792, -19.698, 1.648 ], "frame": { "rmsd": null, "origin": [ 59.886, 64.630, 96.414 ], "x_axis": [ 0.259, -0.753, 0.605 ], "y_axis": [ 0.708, -0.278, -0.649 ], "z_axis": [ 0.657, 0.597, 0.461 ], "quaternion": [ 0.600, -0.519, 0.021, -0.608 ] } }, { "index": 70, "nt1": "///A/223", "nt2": "///A/250", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -162.083, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 53.664, "chi2": -171.628, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 48.848, "C1C1_dist": 10.853, "N1N9_dist": 9.005, "C6C8_dist": 9.859, "CNNC_torsion": -7.130, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.94],N3-N1(imino)[2.94],N4(amino)-O6(carbonyl)[2.85]", "interBase_angle": 11.200, "planarity": 0.129, "simple_Shear": 0.372, "simple_Stretch": -0.148, "simple_Buckle": 4.715, "simple_Propeller": -10.159, "bp_simpleParams": [ 0.372, -0.148, -0.129, 4.715, -10.159, -2.757 ], "bp_params": [ 0.368, -0.159, -0.129, 4.392, -10.303, -2.766 ], "frame": { "rmsd": null, "origin": [ 60.767, 67.499, 99.344 ], "x_axis": [ 0.496, -0.860, 0.116 ], "y_axis": [ 0.445, 0.137, -0.885 ], "z_axis": [ 0.745, 0.491, 0.451 ], "quaternion": [ 0.722, -0.476, 0.218, -0.452 ] } }, { "index": 71, "nt1": "///A/224", "nt2": "///A/248", "bp": "U-A", "name": "rHoogsteen", "Saenger": "24-XXIV", "LW": "tWH", "DSSR": "tW-M", "intra_chain": true, "chi1": -159.214, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 40.542, "chi2": -115.973, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 15.488, "C1C1_dist": 9.674, "N1N9_dist": 7.244, "C6C8_dist": 6.501, "CNNC_torsion": 143.249, "hbonds_num": 2, "hbonds_desc": "O2(carbonyl)-N6(amino)[2.82],N3(imino)-N7[3.01]", "interBase_angle": 16.908, "planarity": 0.296, "simple_Shear": 4.865, "simple_Stretch": 0.978, "simple_Buckle": -6.319, "simple_Propeller": -15.683, "bp_simpleParams": [ 4.865, 0.978, -1.012, -6.319, -15.683, -84.408 ], "bp_params": [ 4.256, -2.552, -1.012, -15.216, -7.373, -84.022 ], "frame": { "rmsd": null, "origin": [ 62.018, 69.203, 103.761 ], "x_axis": [ 0.590, -0.086, -0.802 ], "y_axis": [ -0.208, 0.945, -0.254 ], "z_axis": [ 0.780, 0.316, 0.540 ], "quaternion": [ 0.877, -0.163, 0.451, 0.035 ] } }, { "index": 72, "nt1": "///A/225", "nt2": "///A/226", "bp": "A+A", "name": "Platform", "Saenger": "--", "LW": "cSH", "DSSR": "cm+M", "intra_chain": true, "chi1": -113.358, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 141.235, "chi2": -174.652, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 36.896, "C1C1_dist": 6.560, "N1N9_dist": 6.539, "C6C8_dist": 6.527, "CNNC_torsion": 28.387, "hbonds_num": 1, "hbonds_desc": "N3-N6(amino)[3.09]", "interBase_angle": 23.833, "planarity": 0.263, "simple_Shear": 0.007, "simple_Stretch": 6.579, "simple_Buckle": -23.578, "simple_Propeller": -3.473, "bp_simpleParams": [ 0.007, 6.579, 0.140, -23.578, -3.473, 0.633 ], "bp_params": [ 6.579, 0.075, 0.140, -3.718, 23.541, 0.646 ], "frame": { "rmsd": null, "origin": [ 64.385, 68.318, 106.539 ], "x_axis": [ 0.473, -0.400, -0.785 ], "y_axis": [ 0.136, 0.913, -0.384 ], "z_axis": [ 0.870, 0.075, 0.487 ], "quaternion": [ 0.848, -0.136, 0.488, -0.158 ] } }, { "index": 73, "nt1": "///A/226", "nt2": "///A/249", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -174.652, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 44.761, "chi2": -168.381, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 51.380, "C1C1_dist": 10.798, "N1N9_dist": 8.834, "C6C8_dist": 9.485, "CNNC_torsion": 25.696, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.65],N1-N3(imino)[2.87]", "interBase_angle": 39.274, "planarity": 0.475, "simple_Shear": -0.100, "simple_Stretch": -0.197, "simple_Buckle": -23.577, "simple_Propeller": 31.409, "bp_simpleParams": [ -0.100, -0.197, -0.329, -23.577, 31.409, -12.756 ], "bp_params": [ -0.092, -0.200, -0.329, -24.519, 30.679, -12.946 ], "frame": { "rmsd": null, "origin": [ 62.908, 69.679, 109.205 ], "x_axis": [ 0.825, -0.263, -0.500 ], "y_axis": [ 0.229, 0.965, -0.129 ], "z_axis": [ 0.516, -0.008, 0.857 ], "quaternion": [ 0.955, -0.032, 0.266, -0.129 ] } }, { "index": 74, "nt1": "///A/227", "nt2": "///A/247", "bp": "G-U", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -171.867, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 41.954, "chi2": -153.646, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 67.781, "C1C1_dist": 10.376, "N1N9_dist": 8.729, "C6C8_dist": 9.631, "CNNC_torsion": -9.223, "hbonds_num": 2, "hbonds_desc": "O6(carbonyl)-N3(imino)[2.78],N1(imino)-O2(carbonyl)[2.68]", "interBase_angle": 11.680, "planarity": 0.143, "simple_Shear": -2.294, "simple_Stretch": -0.099, "simple_Buckle": -8.695, "simple_Propeller": -7.798, "bp_simpleParams": [ -2.294, -0.099, 0.082, -8.695, -7.798, -0.543 ], "bp_params": [ -2.214, -0.606, 0.082, -6.747, -9.534, -0.544 ], "frame": { "rmsd": null, "origin": [ 67.983, 70.769, 107.191 ], "x_axis": [ 0.229, 0.615, -0.754 ], "y_axis": [ -0.415, 0.763, 0.496 ], "z_axis": [ 0.880, 0.200, 0.430 ], "quaternion": [ 0.778, 0.095, 0.525, 0.331 ] } }, { "index": 75, "nt1": "///A/228", "nt2": "///A/246", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -160.624, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 54.438, "chi2": -164.519, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 56.107, "C1C1_dist": 10.703, "N1N9_dist": 9.022, "C6C8_dist": 9.963, "CNNC_torsion": -8.904, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.97],O4(carbonyl)-N6(amino)[3.04]", "interBase_angle": 12.721, "planarity": 0.152, "simple_Shear": -0.024, "simple_Stretch": 0.024, "simple_Buckle": 5.724, "simple_Propeller": -11.361, "bp_simpleParams": [ -0.024, 0.024, -0.007, 5.724, -11.361, -0.484 ], "bp_params": [ -0.024, 0.024, -0.007, 5.817, -11.313, -0.486 ], "frame": { "rmsd": null, "origin": [ 71.237, 70.690, 107.640 ], "x_axis": [ -0.187, 0.929, -0.319 ], "y_axis": [ -0.463, 0.203, 0.863 ], "z_axis": [ 0.866, 0.309, 0.393 ], "quaternion": [ 0.594, 0.233, 0.499, 0.587 ] } }, { "index": 76, "nt1": "///A/229", "nt2": "///A/245", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -161.452, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 54.947, "chi2": -165.659, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 53.983, "C1C1_dist": 10.615, "N1N9_dist": 8.897, "C6C8_dist": 9.800, "CNNC_torsion": -1.361, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.73],N3-N1(imino)[2.81],N4(amino)-O6(carbonyl)[2.82]", "interBase_angle": 7.423, "planarity": 0.092, "simple_Shear": 0.311, "simple_Stretch": -0.217, "simple_Buckle": 5.599, "simple_Propeller": -4.875, "bp_simpleParams": [ 0.311, -0.217, 0.072, 5.599, -4.875, -0.479 ], "bp_params": [ 0.306, -0.225, 0.072, 5.472, -5.017, -0.479 ], "frame": { "rmsd": null, "origin": [ 74.478, 71.972, 107.741 ], "x_axis": [ -0.563, 0.810, 0.167 ], "y_axis": [ -0.243, -0.355, 0.903 ], "z_axis": [ 0.790, 0.468, 0.396 ], "quaternion": [ 0.346, 0.314, 0.451, 0.761 ] } }, { "index": 77, "nt1": "///A/230", "nt2": "///A/244", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -166.175, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 54.514, "chi2": -175.841, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 51.354, "C1C1_dist": 10.679, "N1N9_dist": 8.859, "C6C8_dist": 9.763, "CNNC_torsion": -4.719, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.81],N1-N3(imino)[2.80]", "interBase_angle": 6.276, "planarity": 0.106, "simple_Shear": -0.069, "simple_Stretch": -0.198, "simple_Buckle": 5.305, "simple_Propeller": -3.354, "bp_simpleParams": [ -0.069, -0.198, 0.512, 5.305, -3.354, -2.068 ], "bp_params": [ -0.068, -0.198, 0.512, 5.319, -3.332, -2.067 ], "frame": { "rmsd": null, "origin": [ 76.882, 74.581, 107.546 ], "x_axis": [ -0.731, 0.457, 0.507 ], "y_axis": [ 0.059, -0.698, 0.714 ], "z_axis": [ 0.680, 0.551, 0.483 ], "quaternion": [ 0.117, 0.348, 0.371, 0.853 ] } }, { "index": 78, "nt1": "///A/231", "nt2": "///A/243", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -163.851, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 55.607, "chi2": -160.915, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 52.242, "C1C1_dist": 10.508, "N1N9_dist": 8.767, "C6C8_dist": 9.669, "CNNC_torsion": -10.950, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.73],N1-N3(imino)[2.69]", "interBase_angle": 11.635, "planarity": 0.161, "simple_Shear": 0.158, "simple_Stretch": -0.272, "simple_Buckle": -3.833, "simple_Propeller": -10.986, "bp_simpleParams": [ 0.158, -0.272, 0.237, -3.833, -10.986, -1.897 ], "bp_params": [ 0.152, -0.275, 0.237, -4.064, -10.903, -1.905 ], "frame": { "rmsd": null, "origin": [ 78.946, 77.736, 108.115 ], "x_axis": [ -0.657, -0.068, 0.751 ], "y_axis": [ 0.495, -0.791, 0.361 ], "z_axis": [ 0.569, 0.609, 0.553 ], "quaternion": [ -0.162, 0.381, 0.280, 0.866 ] } }, { "index": 79, "nt1": "///A/232", "nt2": "///A/242", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -163.419, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 56.465, "chi2": -167.672, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 54.369, "C1C1_dist": 10.463, "N1N9_dist": 8.786, "C6C8_dist": 9.759, "CNNC_torsion": -9.286, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.53],N3-N1(imino)[2.75],N4(amino)-O6(carbonyl)[2.85]", "interBase_angle": 8.498, "planarity": 0.128, "simple_Shear": 0.202, "simple_Stretch": -0.273, "simple_Buckle": 2.357, "simple_Propeller": -8.165, "bp_simpleParams": [ 0.202, -0.273, 0.315, 2.357, -8.165, 1.644 ], "bp_params": [ 0.198, -0.276, 0.315, 2.233, -8.200, 1.648 ], "frame": { "rmsd": null, "origin": [ 79.415, 80.255, 110.176 ], "x_axis": [ -0.311, -0.544, 0.779 ], "y_axis": [ 0.796, -0.597, -0.099 ], "z_axis": [ 0.519, 0.589, 0.619 ], "quaternion": [ -0.422, 0.408, 0.154, 0.795 ] } }, { "index": 80, "nt1": "///A/233", "nt2": "///A/241", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -173.814, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 55.055, "chi2": -160.562, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 57.001, "C1C1_dist": 10.411, "N1N9_dist": 8.761, "C6C8_dist": 9.698, "CNNC_torsion": -7.513, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.81],N1-N3(imino)[2.76]", "interBase_angle": 9.758, "planarity": 0.140, "simple_Shear": -0.243, "simple_Stretch": -0.245, "simple_Buckle": -5.960, "simple_Propeller": -7.726, "bp_simpleParams": [ -0.243, -0.245, 0.199, -5.960, -7.726, -1.006 ], "bp_params": [ -0.239, -0.249, 0.199, -5.815, -7.836, -1.007 ], "frame": { "rmsd": null, "origin": [ 79.499, 82.664, 112.875 ], "x_axis": [ 0.029, -0.854, 0.519 ], "y_axis": [ 0.877, -0.227, -0.423 ], "z_axis": [ 0.479, 0.467, 0.743 ], "quaternion": [ 0.622, -0.358, -0.016, -0.697 ] } }, { "index": 81, "nt1": "///A/234", "nt2": "///A/240", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -164.090, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 45.453, "chi2": -170.802, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 52.851, "C1C1_dist": 11.099, "N1N9_dist": 9.175, "C6C8_dist": 9.929, "CNNC_torsion": -21.118, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[3.10],N1(imino)-N3[3.25],N2(amino)-O2(carbonyl)[3.45]", "interBase_angle": 21.432, "planarity": 0.262, "simple_Shear": -1.000, "simple_Stretch": -0.024, "simple_Buckle": -6.033, "simple_Propeller": -20.565, "bp_simpleParams": [ -1.000, -0.024, 0.102, -6.033, -20.565, -7.066 ], "bp_params": [ -0.993, -0.116, 0.102, -4.067, -21.043, -7.182 ], "frame": { "rmsd": null, "origin": [ 79.495, 84.279, 116.095 ], "x_axis": [ 0.421, -0.890, 0.173 ], "y_axis": [ 0.767, 0.248, -0.591 ], "z_axis": [ 0.483, 0.382, 0.788 ], "quaternion": [ 0.784, -0.310, 0.099, -0.529 ] } }, { "index": 82, "nt1": "///A/235", "nt2": "///A/239", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -179.351, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 43.632, "chi2": -164.959, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 45.247, "C1C1_dist": 10.830, "N1N9_dist": 8.733, "C6C8_dist": 9.322, "CNNC_torsion": -25.711, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.33],N1-N3(imino)[2.64]", "interBase_angle": 25.942, "planarity": 0.312, "simple_Shear": -0.215, "simple_Stretch": -0.525, "simple_Buckle": -1.969, "simple_Propeller": -25.867, "bp_simpleParams": [ -0.215, -0.525, 0.138, -1.969, -25.867, -15.990 ], "bp_params": [ -0.205, -0.529, 0.138, -1.470, -25.900, -16.400 ], "frame": { "rmsd": null, "origin": [ 80.210, 85.069, 119.547 ], "x_axis": [ 0.765, -0.599, -0.238 ], "y_axis": [ 0.367, 0.709, -0.603 ], "z_axis": [ 0.529, 0.374, 0.762 ], "quaternion": [ 0.899, -0.271, 0.213, -0.268 ] } }, { "index": 83, "nt1": "///A/254", "nt2": "///B/170", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -178.939, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 50.574, "chi2": -169.520, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 55.375, "C1C1_dist": 10.940, "N1N9_dist": 9.156, "C6C8_dist": 10.033, "CNNC_torsion": -1.779, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[3.10],N1(imino)-N3[3.16],N2(amino)-O2(carbonyl)[3.08]", "interBase_angle": 11.687, "planarity": 0.160, "simple_Shear": -0.516, "simple_Stretch": 0.075, "simple_Buckle": 11.628, "simple_Propeller": -1.166, "bp_simpleParams": [ -0.516, 0.075, 0.083, 11.628, -1.166, -1.616 ], "bp_params": [ -0.519, 0.051, 0.083, 11.671, -0.610, -1.608 ], "frame": { "rmsd": null, "origin": [ 58.857, 60.676, 81.836 ], "x_axis": [ 0.365, -0.438, 0.821 ], "y_axis": [ -0.643, 0.519, 0.563 ], "z_axis": [ -0.673, -0.734, -0.092 ], "quaternion": [ 0.669, 0.484, -0.558, 0.076 ] } }, { "index": 84, "nt1": "///A/255", "nt2": "///B/169", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -165.026, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 58.360, "chi2": 178.684, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 51.610, "C1C1_dist": 10.608, "N1N9_dist": 8.915, "C6C8_dist": 9.879, "CNNC_torsion": 1.250, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.79],N3-N1(imino)[2.98],N4(amino)-O6(carbonyl)[3.05]", "interBase_angle": 5.545, "planarity": 0.108, "simple_Shear": 0.660, "simple_Stretch": -0.134, "simple_Buckle": 3.852, "simple_Propeller": -3.988, "bp_simpleParams": [ 0.660, -0.134, -0.511, 3.852, -3.988, 2.128 ], "bp_params": [ 0.651, -0.173, -0.511, 3.604, -4.214, 2.128 ], "frame": { "rmsd": null, "origin": [ 58.243, 56.682, 81.624 ], "x_axis": [ -0.157, 0.021, 0.987 ], "y_axis": [ -0.767, 0.627, -0.135 ], "z_axis": [ -0.622, -0.779, -0.083 ], "quaternion": [ 0.589, 0.273, -0.683, 0.334 ] } }, { "index": 85, "nt1": "///B/103", "nt2": "///B/217", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -175.670, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 55.807, "chi2": -170.674, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 56.682, "C1C1_dist": 10.549, "N1N9_dist": 8.913, "C6C8_dist": 9.941, "CNNC_torsion": 1.359, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[3.09],N1(imino)-N3[2.93],N2(amino)-O2(carbonyl)[2.62]", "interBase_angle": 4.646, "planarity": 0.153, "simple_Shear": -0.203, "simple_Stretch": -0.085, "simple_Buckle": 3.572, "simple_Propeller": -2.970, "bp_simpleParams": [ -0.203, -0.085, -0.467, 3.572, -2.970, 4.876 ], "bp_params": [ -0.202, -0.088, -0.467, 3.618, -2.914, 4.875 ], "frame": { "rmsd": null, "origin": [ 58.404, 54.656, 57.548 ], "x_axis": [ 0.428, 0.695, 0.577 ], "y_axis": [ -0.735, -0.104, 0.671 ], "z_axis": [ 0.526, -0.711, 0.466 ], "quaternion": [ 0.669, 0.516, -0.019, 0.534 ] } }, { "index": 86, "nt1": "///B/103", "nt2": "///B/256", "bp": "G+A", "name": "--", "Saenger": "--", "LW": "cHW", "DSSR": "cM+W", "intra_chain": true, "chi1": -175.670, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 67.283, "chi2": -173.527, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 39.258, "C1C1_dist": 10.664, "N1N9_dist": 8.968, "C6C8_dist": 7.725, "CNNC_torsion": -1.349, "hbonds_num": 1, "hbonds_desc": "N7-N6(amino)[3.22]", "interBase_angle": 18.465, "planarity": 0.300, "simple_Shear": -5.428, "simple_Stretch": 5.032, "simple_Buckle": 17.430, "simple_Propeller": 6.097, "bp_simpleParams": [ -5.428, 5.032, -0.156, 17.430, 6.097, 75.706 ], "bp_params": [ 2.660, -6.907, -0.156, -18.329, 2.236, 75.004 ], "frame": { "rmsd": null, "origin": [ 56.426, 54.450, 60.547 ], "x_axis": [ 0.785, 0.612, 0.096 ], "y_axis": [ -0.245, 0.165, 0.955 ], "z_axis": [ 0.569, -0.773, 0.279 ], "quaternion": [ 0.746, 0.579, 0.159, 0.287 ] } }, { "index": 87, "nt1": "///B/104", "nt2": "///B/216", "bp": "A-C", "name": "--", "Saenger": "--", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -179.620, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 45.196, "chi2": -165.513, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 56.768, "C1C1_dist": 10.625, "N1N9_dist": 8.777, "C6C8_dist": 9.534, "CNNC_torsion": -16.987, "hbonds_num": 1, "hbonds_desc": "N6(amino)-N3[2.97]", "interBase_angle": 24.973, "planarity": 0.324, "simple_Shear": -1.324, "simple_Stretch": -0.190, "simple_Buckle": -20.771, "simple_Propeller": -13.865, "bp_simpleParams": [ -1.324, -0.190, 0.128, -20.771, -13.865, -5.467 ], "bp_params": [ -1.292, -0.346, 0.128, -19.021, -16.182, -5.447 ], "frame": { "rmsd": null, "origin": [ 62.284, 52.181, 57.768 ], "x_axis": [ 0.017, 0.613, 0.790 ], "y_axis": [ -0.871, -0.380, 0.313 ], "z_axis": [ 0.492, -0.693, 0.527 ], "quaternion": [ 0.540, 0.466, -0.138, 0.687 ] } }, { "index": 88, "nt1": "///B/104", "nt2": "///B/257", "bp": "A+G", "name": "--", "Saenger": "--", "LW": "cHW", "DSSR": "cM+W", "intra_chain": true, "chi1": -179.620, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 60.715, "chi2": -167.614, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 69.762, "C1C1_dist": 10.340, "N1N9_dist": 9.110, "C6C8_dist": 8.588, "CNNC_torsion": 11.873, "hbonds_num": 2, "hbonds_desc": "OP2-N2(amino)[2.41],N7-N2(amino)[3.32]", "interBase_angle": 26.340, "planarity": 0.355, "simple_Shear": -2.818, "simple_Stretch": 5.439, "simple_Buckle": 16.745, "simple_Propeller": 20.333, "bp_simpleParams": [ -2.818, 5.439, 1.010, 16.745, 20.333, 51.372 ], "bp_params": [ -2.052, -5.772, 1.010, -26.287, -1.683, 50.198 ], "frame": { "rmsd": null, "origin": [ 60.694, 52.296, 59.746 ], "x_axis": [ 0.499, 0.577, 0.647 ], "y_axis": [ -0.698, -0.175, 0.695 ], "z_axis": [ 0.514, -0.798, 0.315 ], "quaternion": [ 0.640, 0.583, -0.052, 0.498 ] } }, { "index": 89, "nt1": "///B/105", "nt2": "///B/215", "bp": "A-G", "name": "Imino", "Saenger": "08-VIII", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -120.898, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 48.088, "chi2": -171.403, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 47.837, "C1C1_dist": 12.800, "N1N9_dist": 10.835, "C6C8_dist": 11.284, "CNNC_torsion": 3.213, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O6(carbonyl)[2.96],N1-N1(imino)[2.92]", "interBase_angle": 10.346, "planarity": 0.180, "simple_Shear": 0.132, "simple_Stretch": 1.555, "simple_Buckle": -10.186, "simple_Propeller": -1.815, "bp_simpleParams": [ 0.132, 1.555, -0.335, -10.186, -1.815, -16.038 ], "bp_params": [ 0.153, 1.553, -0.335, -10.210, -1.673, -15.977 ], "frame": { "rmsd": null, "origin": [ 65.295, 50.838, 58.929 ], "x_axis": [ -0.567, 0.250, 0.785 ], "y_axis": [ -0.603, -0.776, -0.188 ], "z_axis": [ 0.562, -0.580, 0.591 ], "quaternion": [ 0.249, 0.393, -0.224, 0.856 ] } }, { "index": 90, "nt1": "///B/105", "nt2": "///B/258", "bp": "A+U", "name": "Hoogsteen", "Saenger": "23-XXIII", "LW": "cHW", "DSSR": "cM+W", "intra_chain": true, "chi1": -120.898, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 50.564, "chi2": -174.027, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 64.195, "C1C1_dist": 8.117, "N1N9_dist": 6.547, "C6C8_dist": 6.075, "CNNC_torsion": 4.078, "hbonds_num": 3, "hbonds_desc": "OP2*O2(carbonyl)[2.92],N7-N3(imino)[2.86],N6(amino)-O4(carbonyl)[3.02]", "interBase_angle": 29.294, "planarity": 0.313, "simple_Shear": -3.038, "simple_Stretch": 1.640, "simple_Buckle": 27.165, "simple_Propeller": 10.964, "bp_simpleParams": [ -3.038, 1.640, 1.808, 27.165, 10.964, 67.333 ], "bp_params": [ 0.389, -3.431, 1.808, -24.428, 16.168, 66.662 ], "frame": { "rmsd": null, "origin": [ 62.807, 49.928, 59.015 ], "x_axis": [ 0.094, 0.566, 0.819 ], "y_axis": [ -0.730, -0.520, 0.443 ], "z_axis": [ 0.677, -0.640, 0.364 ], "quaternion": [ 0.484, 0.559, -0.074, 0.669 ] } }, { "index": 91, "nt1": "///B/107", "nt2": "///B/214", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -168.838, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 53.440, "chi2": -168.382, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 60.052, "C1C1_dist": 10.563, "N1N9_dist": 8.944, "C6C8_dist": 9.988, "CNNC_torsion": 3.460, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.93],O4(carbonyl)-N6(amino)[3.16]", "interBase_angle": 4.127, "planarity": 0.061, "simple_Shear": -0.437, "simple_Stretch": 0.051, "simple_Buckle": 3.772, "simple_Propeller": 1.674, "bp_simpleParams": [ -0.437, 0.051, -0.291, 3.772, 1.674, 3.887 ], "bp_params": [ -0.439, 0.030, -0.291, 3.686, 1.856, 3.885 ], "frame": { "rmsd": null, "origin": [ 68.616, 51.377, 61.660 ], "x_axis": [ -0.795, -0.317, 0.516 ], "y_axis": [ -0.077, -0.792, -0.605 ], "z_axis": [ 0.601, -0.521, 0.606 ], "quaternion": [ -0.067, 0.313, -0.315, 0.894 ] } }, { "index": 92, "nt1": "///B/107", "nt2": "///B/259", "bp": "U+U", "name": "--", "Saenger": "--", "LW": "cHW", "DSSR": "cM+W", "intra_chain": true, "chi1": -168.838, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 42.209, "chi2": -164.372, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 74.537, "C1C1_dist": 9.106, "N1N9_dist": 7.625, "C6C8_dist": 7.422, "CNNC_torsion": 1.942, "hbonds_num": 1, "hbonds_desc": "O4(carbonyl)-N3(imino)[3.14]", "interBase_angle": 15.764, "planarity": 0.244, "simple_Shear": -2.167, "simple_Stretch": 2.425, "simple_Buckle": 15.264, "simple_Propeller": -3.936, "bp_simpleParams": [ -2.167, 2.425, 1.237, 15.264, -3.936, 64.548 ], "bp_params": [ -1.335, -2.965, 1.237, -2.625, 15.543, 65.013 ], "frame": { "rmsd": null, "origin": [ 67.234, 50.586, 61.317 ], "x_axis": [ -0.577, 0.078, 0.813 ], "y_axis": [ -0.444, -0.865, -0.233 ], "z_axis": [ 0.685, -0.495, 0.534 ], "quaternion": [ 0.151, 0.434, -0.211, 0.863 ] } }, { "index": 93, "nt1": "///B/108", "nt2": "///B/213", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -159.397, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 56.175, "chi2": -163.933, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 54.879, "C1C1_dist": 10.514, "N1N9_dist": 8.843, "C6C8_dist": 9.837, "CNNC_torsion": -6.157, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.90],N1(imino)-N3[2.77],N2(amino)-O2(carbonyl)[2.54]", "interBase_angle": 9.060, "planarity": 0.113, "simple_Shear": 0.122, "simple_Stretch": -0.189, "simple_Buckle": -0.740, "simple_Propeller": -9.030, "bp_simpleParams": [ 0.122, -0.189, -0.027, -0.740, -9.030, 2.869 ], "bp_params": [ 0.119, -0.191, -0.027, -0.900, -9.015, 2.878 ], "frame": { "rmsd": null, "origin": [ 70.740, 51.139, 65.054 ], "x_axis": [ -0.799, -0.601, 0.025 ], "y_axis": [ 0.370, -0.523, -0.768 ], "z_axis": [ 0.475, -0.604, 0.640 ], "quaternion": [ -0.282, 0.145, -0.398, 0.861 ] } }, { "index": 94, "nt1": "///B/108", "nt2": "///B/260", "bp": "G+C", "name": "~Hoogsteen", "Saenger": "--", "LW": "cHW", "DSSR": "cM+W", "intra_chain": true, "chi1": -159.397, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 44.592, "chi2": -155.492, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 69.649, "C1C1_dist": 8.259, "N1N9_dist": 6.703, "C6C8_dist": 6.376, "CNNC_torsion": 2.831, "hbonds_num": 3, "hbonds_desc": "OP2-O2'(hydroxyl)[2.63],N7*O2(carbonyl)[2.93],O6(carbonyl)-N4(amino)[2.85]", "unusual_base2base_hbonds": 1, "interBase_angle": 10.127, "planarity": 0.123, "simple_Shear": -2.396, "simple_Stretch": 1.502, "simple_Buckle": 9.528, "simple_Propeller": 3.433, "bp_simpleParams": [ -2.396, 1.502, 0.784, 9.528, 3.433, 66.238 ], "bp_params": [ -0.251, -2.817, 0.784, -7.380, 6.935, 66.225 ], "frame": { "rmsd": null, "origin": [ 70.247, 50.167, 64.120 ], "x_axis": [ -0.804, -0.310, 0.508 ], "y_axis": [ -0.050, -0.815, -0.577 ], "z_axis": [ 0.593, -0.490, 0.639 ], "quaternion": [ -0.072, 0.305, -0.296, 0.902 ] } }, { "index": 95, "nt1": "///B/109", "nt2": "///B/212", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -171.667, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 52.982, "chi2": 179.738, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 54.395, "C1C1_dist": 10.784, "N1N9_dist": 9.035, "C6C8_dist": 9.935, "CNNC_torsion": -3.474, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.87],N3-N1(imino)[2.96],N4(amino)-O6(carbonyl)[2.91]", "interBase_angle": 14.382, "planarity": 0.154, "simple_Shear": -0.007, "simple_Stretch": -0.057, "simple_Buckle": 10.708, "simple_Propeller": -9.601, "bp_simpleParams": [ -0.007, -0.057, -0.383, 10.708, -9.601, -0.631 ], "bp_params": [ -0.007, -0.057, -0.383, 10.801, -9.497, -0.631 ], "frame": { "rmsd": null, "origin": [ 70.361, 49.691, 68.464 ], "x_axis": [ -0.505, -0.800, -0.324 ], "y_axis": [ 0.740, -0.207, -0.640 ], "z_axis": [ 0.445, -0.563, 0.696 ], "quaternion": [ -0.496, 0.039, -0.388, 0.776 ] } }, { "index": 96, "nt1": "///B/110", "nt2": "///B/183", "bp": "G-A", "name": "--", "Saenger": "--", "LW": "cSW", "DSSR": "cm-W", "intra_chain": true, "chi1": -168.567, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 148.285, "chi2": -157.891, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 90.592, "C1C1_dist": 5.963, "N1N9_dist": 7.308, "C6C8_dist": 9.776, "CNNC_torsion": -30.237, "hbonds_num": 3, "hbonds_desc": "O2'(hydroxyl)-O2'(hydroxyl)[2.96],O2'(hydroxyl)-N3[2.73],N2(amino)-N1[3.64]", "interBase_angle": 29.708, "planarity": 0.398, "simple_Shear": 0.966, "simple_Stretch": 6.416, "simple_Buckle": -23.045, "simple_Propeller": -18.748, "bp_simpleParams": [ 0.966, 6.416, -0.777, -23.045, -18.748, 140.426 ], "bp_params": [ 2.740, 5.882, -0.777, -27.431, -11.407, 139.535 ], "frame": { "rmsd": null, "origin": [ 70.877, 50.820, 74.507 ], "x_axis": [ -0.896, -0.410, 0.169 ], "y_axis": [ 0.273, -0.810, -0.520 ], "z_axis": [ 0.350, -0.420, 0.837 ], "quaternion": [ -0.182, 0.138, -0.250, 0.941 ] } }, { "index": 97, "nt1": "///B/110", "nt2": "///B/211", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -168.567, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 50.467, "chi2": -169.269, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 55.607, "C1C1_dist": 10.805, "N1N9_dist": 9.030, "C6C8_dist": 9.933, "CNNC_torsion": 2.169, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[3.03],N1(imino)-N3[3.05],N2(amino)-O2(carbonyl)[2.94]", "interBase_angle": 4.213, "planarity": 0.055, "simple_Shear": -0.645, "simple_Stretch": -0.066, "simple_Buckle": -4.196, "simple_Propeller": -0.378, "bp_simpleParams": [ -0.645, -0.066, -0.265, -4.196, -0.378, -0.697 ], "bp_params": [ -0.640, -0.104, -0.265, -4.166, -0.627, -0.696 ], "frame": { "rmsd": null, "origin": [ 70.381, 47.717, 72.765 ], "x_axis": [ -0.132, -0.804, -0.580 ], "y_axis": [ 0.879, 0.176, -0.443 ], "z_axis": [ 0.459, -0.568, 0.683 ], "quaternion": [ 0.657, 0.047, 0.395, -0.640 ] } }, { "index": 98, "nt1": "///B/111", "nt2": "///B/209", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -164.720, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 55.380, "chi2": -122.253, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 47.478, "C1C1_dist": 10.930, "N1N9_dist": 9.095, "C6C8_dist": 9.933, "CNNC_torsion": 3.932, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.79],N1(imino)-N3[2.95],N2(amino)-O2(carbonyl)[2.95]", "interBase_angle": 7.478, "planarity": 0.090, "simple_Shear": 0.369, "simple_Stretch": -0.064, "simple_Buckle": -7.214, "simple_Propeller": -1.969, "bp_simpleParams": [ 0.369, -0.064, -0.396, -7.214, -1.969, -3.508 ], "bp_params": [ 0.366, -0.079, -0.396, -7.291, -1.664, -3.501 ], "frame": { "rmsd": null, "origin": [ 70.840, 44.744, 74.674 ], "x_axis": [ 0.412, -0.416, -0.811 ], "y_axis": [ 0.796, 0.597, 0.098 ], "z_axis": [ 0.443, -0.686, 0.577 ], "quaternion": [ 0.804, 0.243, 0.390, -0.377 ] } }, { "index": 99, "nt1": "///B/112", "nt2": "///B/208", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -171.513, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 55.271, "chi2": -166.122, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 54.565, "C1C1_dist": 10.768, "N1N9_dist": 9.069, "C6C8_dist": 10.014, "CNNC_torsion": -10.380, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[3.07],N1(imino)-N3[3.01],N2(amino)-O2(carbonyl)[2.87]", "interBase_angle": 12.880, "planarity": 0.161, "simple_Shear": -0.232, "simple_Stretch": -0.012, "simple_Buckle": -2.879, "simple_Propeller": -12.554, "bp_simpleParams": [ -0.232, -0.012, 0.175, -2.879, -12.554, 0.602 ], "bp_params": [ -0.231, -0.016, 0.175, -2.651, -12.604, 0.606 ], "frame": { "rmsd": null, "origin": [ 71.812, 41.379, 75.361 ], "x_axis": [ 0.575, 0.130, -0.808 ], "y_axis": [ 0.474, 0.752, 0.458 ], "z_axis": [ 0.667, -0.646, 0.371 ], "quaternion": [ 0.821, 0.336, 0.449, -0.105 ] } }, { "index": 100, "nt1": "///B/113", "nt2": "///B/207", "bp": "A-A", "name": "~Sheared", "Saenger": "--", "LW": "tSH", "DSSR": "tm-M", "intra_chain": true, "chi1": -161.248, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 86.005, "chi2": -166.903, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 5.122, "C1C1_dist": 9.640, "N1N9_dist": 8.188, "C6C8_dist": 8.397, "CNNC_torsion": -144.193, "hbonds_num": 2, "hbonds_desc": "O2'(hydroxyl)-N6(amino)[3.17],N3-N6(amino)[2.87]", "interBase_angle": 13.657, "planarity": 0.162, "simple_Shear": 7.237, "simple_Stretch": 2.046, "simple_Buckle": 7.945, "simple_Propeller": -11.109, "bp_simpleParams": [ 7.237, 2.046, 0.374, 7.945, -11.109, -21.419 ], "bp_params": [ 6.299, -4.109, 0.374, -3.160, -13.287, -21.553 ], "frame": { "rmsd": null, "origin": [ 73.043, 37.798, 76.454 ], "x_axis": [ 0.625, 0.780, -0.029 ], "y_axis": [ -0.232, 0.221, 0.947 ], "z_axis": [ 0.746, -0.585, 0.319 ], "quaternion": [ 0.736, 0.521, 0.263, 0.344 ] } }, { "index": 101, "nt1": "///B/114", "nt2": "///B/206", "bp": "A-A", "name": "~Sheared", "Saenger": "--", "LW": "tHS", "DSSR": "tM-m", "intra_chain": true, "chi1": -163.014, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 4.155, "chi2": -151.253, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 90.358, "C1C1_dist": 9.592, "N1N9_dist": 8.242, "C6C8_dist": 8.552, "CNNC_torsion": 168.525, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O2'(hydroxyl)[3.08],N6(amino)-N3[2.94]", "interBase_angle": 5.511, "planarity": 0.128, "simple_Shear": -7.395, "simple_Stretch": 2.224, "simple_Buckle": -4.892, "simple_Propeller": 2.539, "bp_simpleParams": [ -7.395, 2.224, -0.627, -4.892, 2.539, -12.409 ], "bp_params": [ -6.492, -4.181, -0.627, -5.106, -2.074, -12.399 ], "frame": { "rmsd": null, "origin": [ 75.748, 35.515, 76.607 ], "x_axis": [ 0.622, 0.720, -0.307 ], "y_axis": [ -0.022, 0.408, 0.913 ], "z_axis": [ 0.783, -0.561, 0.270 ], "quaternion": [ 0.758, 0.486, 0.359, 0.245 ] } }, { "index": 102, "nt1": "///B/115", "nt2": "///B/206", "bp": "A-A", "name": "--", "Saenger": "--", "LW": ".WS", "DSSR": ".W-m", "intra_chain": true, "chi1": -161.035, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 24.705, "chi2": -151.253, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 108.276, "C1C1_dist": 9.957, "N1N9_dist": 9.116, "C6C8_dist": 9.953, "CNNC_torsion": -15.724, "hbonds_num": 1, "hbonds_desc": "N6(amino)-N3[3.34]", "interBase_angle": 10.747, "planarity": 0.397, "simple_Shear": -6.594, "simple_Stretch": 2.765, "simple_Buckle": 6.790, "simple_Propeller": 8.330, "bp_simpleParams": [ -6.594, 2.765, 1.961, 6.790, 8.330, 24.035 ], "bp_params": [ -6.686, -2.535, 1.961, -0.814, 10.716, 24.136 ], "frame": { "rmsd": null, "origin": [ 77.340, 34.993, 76.684 ], "x_axis": [ 0.505, 0.863, -0.028 ], "y_axis": [ -0.184, 0.139, 0.973 ], "z_axis": [ 0.844, -0.486, 0.228 ], "quaternion": [ 0.684, 0.533, 0.318, 0.382 ] } }, { "index": 103, "nt1": "///B/116", "nt2": "///B/205", "bp": "G-U", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -165.132, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 40.801, "chi2": -159.030, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 66.859, "C1C1_dist": 10.388, "N1N9_dist": 8.699, "C6C8_dist": 9.555, "CNNC_torsion": -9.633, "hbonds_num": 2, "hbonds_desc": "O6(carbonyl)-N3(imino)[2.66],N1(imino)-O2(carbonyl)[2.65]", "interBase_angle": 9.628, "planarity": 0.135, "simple_Shear": -2.309, "simple_Stretch": -0.193, "simple_Buckle": 1.194, "simple_Propeller": -9.553, "bp_simpleParams": [ -2.309, -0.193, 0.369, 1.194, -9.553, -3.107 ], "bp_params": [ -2.205, -0.712, 0.369, 3.330, -9.034, -3.115 ], "frame": { "rmsd": null, "origin": [ 80.145, 32.500, 76.469 ], "x_axis": [ -0.025, 0.783, 0.621 ], "y_axis": [ -0.375, -0.583, 0.720 ], "z_axis": [ 0.927, -0.215, 0.308 ], "quaternion": [ 0.418, 0.559, 0.183, 0.692 ] } }, { "index": 104, "nt1": "///B/117", "nt2": "///B/204", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -167.688, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 50.875, "chi2": -162.247, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 54.458, "C1C1_dist": 10.813, "N1N9_dist": 9.023, "C6C8_dist": 9.881, "CNNC_torsion": -7.330, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.83],N1(imino)-N3[2.95],N2(amino)-O2(carbonyl)[2.99]", "interBase_angle": 10.197, "planarity": 0.138, "simple_Shear": -0.343, "simple_Stretch": -0.135, "simple_Buckle": 3.557, "simple_Propeller": -9.557, "bp_simpleParams": [ -0.343, -0.135, 0.076, 3.557, -9.557, -3.157 ], "bp_params": [ -0.339, -0.145, 0.076, 3.849, -9.443, -3.166 ], "frame": { "rmsd": null, "origin": [ 83.624, 32.710, 76.766 ], "x_axis": [ -0.404, 0.278, 0.871 ], "y_axis": [ -0.271, -0.946, 0.176 ], "z_axis": [ 0.873, -0.165, 0.458 ], "quaternion": [ 0.164, 0.521, 0.003, 0.838 ] } }, { "index": 105, "nt1": "///B/118", "nt2": "///B/203", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -162.227, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 53.940, "chi2": -156.827, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 55.285, "C1C1_dist": 10.498, "N1N9_dist": 8.791, "C6C8_dist": 9.747, "CNNC_torsion": -13.118, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.83],N1(imino)-N3[2.75],N2(amino)-O2(carbonyl)[2.74]", "interBase_angle": 19.434, "planarity": 0.238, "simple_Shear": -0.250, "simple_Stretch": -0.276, "simple_Buckle": -4.179, "simple_Propeller": -18.980, "bp_simpleParams": [ -0.250, -0.276, -0.178, -4.179, -18.980, 1.666 ], "bp_params": [ -0.246, -0.280, -0.178, -3.806, -19.058, 1.689 ], "frame": { "rmsd": null, "origin": [ 86.561, 33.833, 79.020 ], "x_axis": [ -0.607, -0.255, 0.753 ], "y_axis": [ 0.070, -0.961, -0.269 ], "z_axis": [ 0.791, -0.110, 0.601 ], "quaternion": [ -0.091, 0.434, -0.107, 0.890 ] } }, { "index": 106, "nt1": "///B/119", "nt2": "///B/202", "bp": "G-U", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": 176.624, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 40.581, "chi2": -161.840, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 66.207, "C1C1_dist": 10.378, "N1N9_dist": 8.673, "C6C8_dist": 9.579, "CNNC_torsion": -16.331, "hbonds_num": 2, "hbonds_desc": "O6(carbonyl)-N3(imino)[2.77],N1(imino)-O2(carbonyl)[2.65]", "interBase_angle": 20.442, "planarity": 0.240, "simple_Shear": -2.436, "simple_Stretch": -0.095, "simple_Buckle": -13.394, "simple_Propeller": -15.442, "bp_simpleParams": [ -2.436, -0.095, 0.006, -13.394, -15.442, 0.342 ], "bp_params": [ -2.347, -0.660, 0.006, -9.414, -18.145, 0.345 ], "frame": { "rmsd": null, "origin": [ 88.153, 34.864, 82.202 ], "x_axis": [ -0.707, -0.590, 0.390 ], "y_axis": [ 0.316, -0.757, -0.571 ], "z_axis": [ 0.633, -0.280, 0.722 ], "quaternion": [ -0.254, 0.287, -0.238, 0.893 ] } }, { "index": 107, "nt1": "///B/120", "nt2": "///B/201", "bp": "U-G", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -163.853, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 72.520, "chi2": -169.895, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 40.857, "C1C1_dist": 10.475, "N1N9_dist": 8.928, "C6C8_dist": 9.887, "CNNC_torsion": -7.355, "hbonds_num": 2, "hbonds_desc": "O2(carbonyl)-N1(imino)[2.79],N3(imino)-O6(carbonyl)[3.01]", "interBase_angle": 7.582, "planarity": 0.102, "simple_Shear": 2.744, "simple_Stretch": 0.259, "simple_Buckle": -1.751, "simple_Propeller": -7.377, "bp_simpleParams": [ 2.744, 0.259, 0.193, -1.751, -7.377, 2.457 ], "bp_params": [ 2.712, -0.492, 0.193, -3.677, -6.631, 2.460 ], "frame": { "rmsd": null, "origin": [ 89.240, 33.953, 85.229 ], "x_axis": [ -0.247, -0.939, -0.240 ], "y_axis": [ 0.771, -0.040, -0.635 ], "z_axis": [ 0.587, -0.342, 0.734 ], "quaternion": [ 0.601, -0.122, 0.344, -0.711 ] } }, { "index": 108, "nt1": "///B/121", "nt2": "///B/200", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -146.432, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 52.446, "chi2": 179.586, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 50.103, "C1C1_dist": 10.984, "N1N9_dist": 9.135, "C6C8_dist": 9.940, "CNNC_torsion": -1.109, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[3.16],N3-N1(imino)[3.05],N4(amino)-O6(carbonyl)[2.83]", "interBase_angle": 8.002, "planarity": 0.129, "simple_Shear": 0.179, "simple_Stretch": -0.081, "simple_Buckle": 4.056, "simple_Propeller": -6.898, "bp_simpleParams": [ 0.179, -0.081, -0.553, 4.056, -6.898, -4.916 ], "bp_params": [ 0.178, -0.083, -0.553, 3.965, -6.950, -4.922 ], "frame": { "rmsd": null, "origin": [ 89.169, 32.783, 88.652 ], "x_axis": [ 0.151, -0.875, -0.460 ], "y_axis": [ 0.892, 0.321, -0.318 ], "z_axis": [ 0.426, -0.363, 0.829 ], "quaternion": [ 0.758, 0.015, 0.292, -0.583 ] } }, { "index": 109, "nt1": "///B/123", "nt2": "///B/198", "bp": "A-A", "name": "--", "Saenger": "05-V", "LW": "tWH", "DSSR": "tW-M", "intra_chain": true, "chi1": -79.474, "conf1": "--", "pucker1": "~C2'-endo", "lambda1": 20.572, "chi2": -131.571, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 18.992, "C1C1_dist": 12.273, "N1N9_dist": 9.561, "C6C8_dist": 8.122, "CNNC_torsion": -157.863, "hbonds_num": 2, "hbonds_desc": "N6(amino)-N7[3.04],N1-N6(amino)[3.37]", "interBase_angle": 41.121, "planarity": 0.503, "simple_Shear": 2.915, "simple_Stretch": 3.345, "simple_Buckle": -15.095, "simple_Propeller": 38.250, "bp_simpleParams": [ 2.915, 3.345, 1.921, -15.095, 38.250, -106.984 ], "bp_params": [ 4.251, 1.271, 1.921, 8.115, 40.313, -110.273 ], "frame": { "rmsd": null, "origin": [ 91.131, 33.409, 91.594 ], "x_axis": [ -0.023, 0.567, 0.824 ], "y_axis": [ 0.694, 0.602, -0.395 ], "z_axis": [ -0.720, 0.562, -0.407 ], "quaternion": [ 0.541, -0.442, -0.713, -0.059 ] } }, { "index": 110, "nt1": "///B/123", "nt2": "///B/200", "bp": "A+G", "name": "--", "Saenger": "--", "LW": "tWW", "DSSR": "tW+W", "intra_chain": true, "chi1": -79.474, "conf1": "--", "pucker1": "~C2'-endo", "lambda1": 32.476, "chi2": 179.586, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 77.361, "C1C1_dist": 12.794, "N1N9_dist": 11.386, "C6C8_dist": 12.513, "CNNC_torsion": -119.383, "hbonds_num": 1, "hbonds_desc": "N1-N2(amino)[3.41]", "interBase_angle": 48.021, "planarity": 0.662, "simple_Shear": 2.598, "simple_Stretch": 4.037, "simple_Buckle": -16.581, "simple_Propeller": 45.068, "bp_simpleParams": [ 2.598, 4.037, -1.137, -16.581, 45.068, 123.021 ], "bp_params": [ -3.056, 3.703, -1.137, -48.002, -1.361, 118.576 ], "frame": { "rmsd": null, "origin": [ 90.071, 34.155, 90.805 ], "x_axis": [ -0.673, -0.739, 0.003 ], "y_axis": [ -0.345, 0.318, 0.883 ], "z_axis": [ -0.654, 0.593, -0.470 ], "quaternion": [ -0.209, -0.346, 0.784, 0.470 ] } }, { "index": 111, "nt1": "///B/124", "nt2": "///B/197", "bp": "C-C", "name": "--", "Saenger": "--", "LW": "tHW", "DSSR": "tM-W", "intra_chain": true, "chi1": -168.829, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 12.239, "chi2": -156.704, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 44.973, "C1C1_dist": 10.648, "N1N9_dist": 8.245, "C6C8_dist": 7.776, "CNNC_torsion": -142.965, "hbonds_num": 2, "hbonds_desc": "N4(amino)-O2(carbonyl)[2.87],N4(amino)-N3[3.22]", "interBase_angle": 5.125, "planarity": 0.287, "simple_Shear": -4.939, "simple_Stretch": 0.866, "simple_Buckle": -2.048, "simple_Propeller": 4.698, "bp_simpleParams": [ -4.939, 0.866, 1.435, -2.048, 4.698, -68.313 ], "bp_params": [ -4.504, -2.204, 1.435, -4.419, 2.595, -68.287 ], "frame": { "rmsd": null, "origin": [ 90.984, 39.273, 89.714 ], "x_axis": [ -0.083, 0.388, 0.918 ], "y_axis": [ 0.899, 0.427, -0.099 ], "z_axis": [ -0.431, 0.817, -0.384 ], "quaternion": [ -0.490, 0.467, 0.688, 0.261 ] } }, { "index": 112, "nt1": "///B/124", "nt2": "///B/201", "bp": "C+G", "name": "--", "Saenger": "29-XXIX", "LW": "tWS", "DSSR": "tW+m", "intra_chain": true, "chi1": -168.829, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 14.732, "chi2": -169.895, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 89.075, "C1C1_dist": 9.665, "N1N9_dist": 8.402, "C6C8_dist": 9.633, "CNNC_torsion": -159.598, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[3.36],N3-N2(amino)[2.99],N4(amino)-N3[3.71]", "interBase_angle": 34.952, "planarity": 0.417, "simple_Shear": 2.966, "simple_Stretch": 2.432, "simple_Buckle": -25.293, "simple_Propeller": 24.123, "bp_simpleParams": [ 2.966, 2.432, 0.787, -25.293, 24.123, 103.474 ], "bp_params": [ -1.146, 3.660, 0.787, -31.818, -14.466, 101.730 ], "frame": { "rmsd": null, "origin": [ 89.790, 36.882, 86.404 ], "x_axis": [ -0.861, -0.456, 0.225 ], "y_axis": [ -0.119, 0.610, 0.783 ], "z_axis": [ -0.495, 0.648, -0.580 ], "quaternion": [ -0.206, -0.165, 0.873, 0.410 ] } }, { "index": 113, "nt1": "///B/126", "nt2": "///B/196", "bp": "G-A", "name": "Imino", "Saenger": "08-VIII", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -172.157, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 44.877, "chi2": -161.219, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 46.586, "C1C1_dist": 12.725, "N1N9_dist": 10.667, "C6C8_dist": 10.956, "CNNC_torsion": -12.241, "hbonds_num": 2, "hbonds_desc": "O6(carbonyl)-N6(amino)[2.87],N1(imino)-N1[2.99]", "interBase_angle": 32.973, "planarity": 0.496, "simple_Shear": 0.087, "simple_Stretch": 1.630, "simple_Buckle": 30.870, "simple_Propeller": -11.586, "bp_simpleParams": [ 0.087, 1.630, 0.093, 30.870, -11.586, -22.224 ], "bp_params": [ 0.082, 1.630, 0.093, 30.987, -11.270, -21.545 ], "frame": { "rmsd": null, "origin": [ 90.120, 42.716, 90.330 ], "x_axis": [ 0.775, 0.486, 0.405 ], "y_axis": [ 0.409, 0.104, -0.907 ], "z_axis": [ -0.482, 0.868, -0.118 ], "quaternion": [ 0.663, -0.669, -0.334, 0.029 ] } }, { "index": 114, "nt1": "///B/127", "nt2": "///B/195", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -162.955, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 53.208, "chi2": -172.549, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 51.495, "C1C1_dist": 10.601, "N1N9_dist": 8.802, "C6C8_dist": 9.594, "CNNC_torsion": -20.910, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[3.07],N3-N1(imino)[2.89],N4(amino)-O6(carbonyl)[2.87]", "interBase_angle": 35.277, "planarity": 0.400, "simple_Shear": 0.723, "simple_Stretch": -0.218, "simple_Buckle": 23.780, "simple_Propeller": -26.056, "bp_simpleParams": [ 0.723, -0.218, -0.077, 23.780, -26.056, -4.744 ], "bp_params": [ 0.712, -0.251, -0.077, 22.515, -27.157, -4.792 ], "frame": { "rmsd": null, "origin": [ 89.448, 46.209, 91.729 ], "x_axis": [ 0.888, 0.385, -0.253 ], "y_axis": [ -0.175, -0.225, -0.959 ], "z_axis": [ -0.425, 0.895, -0.132 ], "quaternion": [ 0.619, -0.749, -0.070, 0.226 ] } }, { "index": 115, "nt1": "///B/128", "nt2": "///B/194", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -162.890, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 60.275, "chi2": -172.397, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 54.412, "C1C1_dist": 10.384, "N1N9_dist": 8.790, "C6C8_dist": 9.826, "CNNC_torsion": -3.430, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.61],N3-N1(imino)[2.88],N4(amino)-O6(carbonyl)[3.05]", "interBase_angle": 9.392, "planarity": 0.144, "simple_Shear": 0.629, "simple_Stretch": -0.175, "simple_Buckle": -1.137, "simple_Propeller": -9.323, "bp_simpleParams": [ 0.629, -0.175, -0.214, -1.137, -9.323, 5.332 ], "bp_params": [ 0.618, -0.211, -0.214, -1.675, -9.241, 5.348 ], "frame": { "rmsd": null, "origin": [ 88.917, 50.535, 92.684 ], "x_axis": [ 0.697, 0.022, -0.716 ], "y_axis": [ -0.652, -0.394, -0.647 ], "z_axis": [ -0.297, 0.919, -0.261 ], "quaternion": [ 0.510, -0.767, 0.206, 0.330 ] } }, { "index": 116, "nt1": "///B/129", "nt2": "///B/193", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -171.383, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 58.899, "chi2": -163.412, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 55.318, "C1C1_dist": 10.382, "N1N9_dist": 8.780, "C6C8_dist": 9.786, "CNNC_torsion": 5.200, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.88],N1(imino)-N3[2.79],N2(amino)-O2(carbonyl)[2.61]", "interBase_angle": 12.495, "planarity": 0.223, "simple_Shear": 0.096, "simple_Stretch": -0.196, "simple_Buckle": -11.463, "simple_Propeller": 4.971, "bp_simpleParams": [ 0.096, -0.196, 0.260, -11.463, 4.971, 3.083 ], "bp_params": [ 0.094, -0.197, 0.260, -11.408, 5.096, 3.071 ], "frame": { "rmsd": null, "origin": [ 89.526, 54.098, 92.432 ], "x_axis": [ 0.378, -0.451, -0.808 ], "y_axis": [ -0.909, -0.345, -0.233 ], "z_axis": [ -0.174, 0.823, -0.541 ], "quaternion": [ -0.351, 0.752, -0.452, -0.326 ] } }, { "index": 117, "nt1": "///B/130", "nt2": "///B/192", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -134.370, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 52.311, "chi2": -170.558, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 46.194, "C1C1_dist": 10.767, "N1N9_dist": 8.816, "C6C8_dist": 9.541, "CNNC_torsion": -14.125, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.90],O4(carbonyl)-N6(amino)[2.75]", "interBase_angle": 13.992, "planarity": 0.199, "simple_Shear": 0.854, "simple_Stretch": -0.307, "simple_Buckle": 11.056, "simple_Propeller": -8.576, "bp_simpleParams": [ 0.854, -0.307, 0.132, 11.056, -8.576, -8.369 ], "bp_params": [ 0.826, -0.375, 0.132, 10.331, -9.436, -8.364 ], "frame": { "rmsd": null, "origin": [ 89.837, 57.142, 91.750 ], "x_axis": [ -0.318, -0.529, -0.787 ], "y_axis": [ -0.945, 0.113, 0.306 ], "z_axis": [ -0.073, 0.841, -0.536 ], "quaternion": [ 0.254, -0.526, 0.701, 0.409 ] } }, { "index": 118, "nt1": "///B/132", "nt2": "///B/191", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -162.619, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 59.923, "chi2": -168.790, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 53.591, "C1C1_dist": 10.855, "N1N9_dist": 9.237, "C6C8_dist": 10.228, "CNNC_torsion": -3.464, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[3.09],N3-N1(imino)[3.32],N4(amino)-O6(carbonyl)[3.43]", "interBase_angle": 11.039, "planarity": 0.119, "simple_Shear": 0.787, "simple_Stretch": 0.254, "simple_Buckle": 9.577, "simple_Propeller": -5.490, "bp_simpleParams": [ 0.787, 0.254, -0.308, 9.577, -5.490, 3.175 ], "bp_params": [ 0.803, 0.196, -0.308, 9.162, -6.158, 3.170 ], "frame": { "rmsd": null, "origin": [ 90.894, 59.711, 89.737 ], "x_axis": [ -0.848, -0.407, -0.338 ], "y_axis": [ -0.520, 0.523, 0.675 ], "z_axis": [ -0.098, 0.749, -0.655 ], "quaternion": [ 0.069, -0.266, 0.870, 0.409 ] } }, { "index": 119, "nt1": "///B/133", "nt2": "///B/190", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -168.979, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 58.238, "chi2": -162.549, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 56.054, "C1C1_dist": 10.352, "N1N9_dist": 8.752, "C6C8_dist": 9.792, "CNNC_torsion": -9.263, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.00],N1-N3(imino)[2.75]", "interBase_angle": 11.967, "planarity": 0.146, "simple_Shear": 0.142, "simple_Stretch": -0.145, "simple_Buckle": -3.227, "simple_Propeller": -11.524, "bp_simpleParams": [ 0.142, -0.145, 0.048, -3.227, -11.524, 4.129 ], "bp_params": [ 0.139, -0.148, 0.048, -3.460, -11.456, 4.148 ], "frame": { "rmsd": null, "origin": [ 91.056, 61.365, 86.197 ], "x_axis": [ -0.960, -0.245, 0.136 ], "y_axis": [ -0.060, 0.654, 0.755 ], "z_axis": [ -0.274, 0.716, -0.642 ], "quaternion": [ -0.114, -0.085, 0.902, 0.408 ] } }, { "index": 120, "nt1": "///B/134", "nt2": "///B/189", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -171.882, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 51.914, "chi2": -163.397, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 54.188, "C1C1_dist": 10.639, "N1N9_dist": 8.862, "C6C8_dist": 9.784, "CNNC_torsion": -9.586, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.93],N1(imino)-N3[2.88],N2(amino)-O2(carbonyl)[2.76]", "interBase_angle": 18.229, "planarity": 0.203, "simple_Shear": -0.521, "simple_Stretch": -0.179, "simple_Buckle": -12.124, "simple_Propeller": -13.612, "bp_simpleParams": [ -0.521, -0.179, -0.153, -12.124, -13.612, 0.891 ], "bp_params": [ -0.513, -0.200, -0.153, -11.544, -14.107, 0.893 ], "frame": { "rmsd": null, "origin": [ 89.858, 62.646, 82.952 ], "x_axis": [ -0.813, 0.042, 0.581 ], "y_axis": [ 0.432, 0.712, 0.553 ], "z_axis": [ -0.390, 0.701, -0.597 ], "quaternion": [ -0.275, 0.134, 0.883, 0.355 ] } }, { "index": 121, "nt1": "///B/135", "nt2": "///B/187", "bp": "U+A", "name": "Hoogsteen", "Saenger": "23-XXIII", "LW": "cWH", "DSSR": "cW+M", "intra_chain": true, "chi1": -163.734, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 64.034, "chi2": 48.739, "conf2": "syn", "pucker2": "~C3'-endo", "lambda2": 55.832, "C1C1_dist": 8.143, "N1N9_dist": 6.672, "C6C8_dist": 6.170, "CNNC_torsion": -14.151, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N7[2.90],O4(carbonyl)-N6(amino)[3.25]", "interBase_angle": 18.174, "planarity": 0.243, "simple_Shear": -2.908, "simple_Stretch": 2.027, "simple_Buckle": 10.826, "simple_Propeller": -14.598, "bp_simpleParams": [ -2.908, 2.027, 0.273, 10.826, -14.598, -62.149 ], "bp_params": [ -0.115, 3.543, 0.273, -5.240, -17.402, -62.684 ], "frame": { "rmsd": null, "origin": [ 86.779, 63.155, 80.412 ], "x_axis": [ 0.031, 0.563, 0.826 ], "y_axis": [ 0.945, 0.254, -0.209 ], "z_axis": [ -0.327, 0.787, -0.524 ], "quaternion": [ -0.436, 0.570, 0.661, 0.219 ] } }, { "index": 122, "nt1": "///B/136", "nt2": "///B/182", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -171.807, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 53.637, "chi2": -123.155, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 49.902, "C1C1_dist": 10.914, "N1N9_dist": 9.094, "C6C8_dist": 9.915, "CNNC_torsion": -5.714, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.84],N1-N3(imino)[2.99]", "interBase_angle": 15.663, "planarity": 0.177, "simple_Shear": 0.190, "simple_Stretch": -0.010, "simple_Buckle": -7.608, "simple_Propeller": -13.691, "bp_simpleParams": [ 0.190, -0.010, -0.477, -7.608, -13.691, -4.725 ], "bp_params": [ 0.190, -0.015, -0.477, -7.959, -13.490, -4.747 ], "frame": { "rmsd": null, "origin": [ 86.027, 65.990, 77.805 ], "x_axis": [ 0.093, 0.464, 0.881 ], "y_axis": [ 0.924, 0.290, -0.250 ], "z_axis": [ -0.371, 0.837, -0.402 ], "quaternion": [ -0.495, 0.549, 0.632, 0.232 ] } }, { "index": 123, "nt1": "///B/137", "nt2": "///B/181", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -165.869, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 55.818, "chi2": 178.079, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 51.996, "C1C1_dist": 10.668, "N1N9_dist": 8.934, "C6C8_dist": 9.890, "CNNC_torsion": -19.958, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.88],N3-N1(imino)[2.90],N4(amino)-O6(carbonyl)[3.09]", "interBase_angle": 24.033, "planarity": 0.302, "simple_Shear": 0.419, "simple_Stretch": -0.131, "simple_Buckle": 1.663, "simple_Propeller": -23.975, "bp_simpleParams": [ 0.419, -0.131, 0.079, 1.663, -23.975, 2.099 ], "bp_params": [ 0.414, -0.146, 0.079, 0.773, -24.020, 2.146 ], "frame": { "rmsd": null, "origin": [ 84.293, 68.807, 77.982 ], "x_axis": [ 0.675, 0.476, 0.565 ], "y_axis": [ 0.678, -0.095, -0.729 ], "z_axis": [ -0.293, 0.874, -0.386 ], "quaternion": [ 0.546, -0.734, -0.393, -0.092 ] } }, { "index": 124, "nt1": "///B/138", "nt2": "///B/180", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -120.973, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.195, "chi2": -164.485, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 50.327, "C1C1_dist": 10.799, "N1N9_dist": 8.975, "C6C8_dist": 9.814, "CNNC_torsion": -5.227, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.96],N3-N1(imino)[2.90],N4(amino)-O6(carbonyl)[2.73]", "interBase_angle": 10.475, "planarity": 0.118, "simple_Shear": 0.287, "simple_Stretch": -0.196, "simple_Buckle": 5.552, "simple_Propeller": -8.883, "bp_simpleParams": [ 0.287, -0.196, -0.217, 5.552, -8.883, -3.837 ], "bp_params": [ 0.283, -0.202, -0.217, 5.346, -9.009, -3.845 ], "frame": { "rmsd": null, "origin": [ 81.852, 71.724, 78.339 ], "x_axis": [ 0.955, 0.179, 0.238 ], "y_axis": [ 0.273, -0.206, -0.940 ], "z_axis": [ -0.119, 0.962, -0.245 ], "quaternion": [ 0.613, -0.776, -0.146, -0.039 ] } }, { "index": 125, "nt1": "///B/139", "nt2": "///B/164", "bp": "A-G", "name": "Sheared", "Saenger": "11-XI", "LW": "tHS", "DSSR": "tM-m", "intra_chain": true, "chi1": 177.027, "conf1": "--", "pucker1": "~C3'-endo", "lambda1": 7.928, "chi2": -101.151, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 93.624, "C1C1_dist": 9.253, "N1N9_dist": 7.994, "C6C8_dist": 8.353, "CNNC_torsion": -118.742, "hbonds_num": 3, "hbonds_desc": "N7-N2(amino)[2.80],N6(amino)-O4'[3.21],N6(amino)-N3[3.14]", "interBase_angle": 27.589, "planarity": 0.419, "simple_Shear": -7.555, "simple_Stretch": 2.106, "simple_Buckle": 10.221, "simple_Propeller": 25.626, "bp_simpleParams": [ -7.555, 2.106, 0.898, 10.221, 25.626, -2.513 ], "bp_params": [ -6.364, -4.583, 0.898, -13.739, 23.925, -2.551 ], "frame": { "rmsd": null, "origin": [ 75.012, 69.089, 73.483 ], "x_axis": [ -0.091, 0.837, 0.540 ], "y_axis": [ 0.788, 0.392, -0.475 ], "z_axis": [ -0.609, 0.382, -0.695 ], "quaternion": [ -0.389, 0.550, 0.738, -0.032 ] } }, { "index": 126, "nt1": "///B/140", "nt2": "///B/163", "bp": "A-G", "name": "Sheared", "Saenger": "11-XI", "LW": "tHS", "DSSR": "tM-m", "intra_chain": true, "chi1": -171.599, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 10.528, "chi2": -155.000, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 97.803, "C1C1_dist": 9.660, "N1N9_dist": 8.494, "C6C8_dist": 8.993, "CNNC_torsion": 26.618, "hbonds_num": 3, "hbonds_desc": "N7-N2(amino)[2.81],N6(amino)-O2'(hydroxyl)[2.91],N6(amino)-N3[2.78]", "interBase_angle": 16.436, "planarity": 0.221, "simple_Shear": -7.230, "simple_Stretch": 2.368, "simple_Buckle": -0.612, "simple_Propeller": -16.425, "bp_simpleParams": [ -7.230, 2.368, -0.139, -0.612, -16.425, -0.680 ], "bp_params": [ -6.611, -3.766, -0.139, 11.759, -11.483, -0.680 ], "frame": { "rmsd": null, "origin": [ 72.895, 70.044, 71.526 ], "x_axis": [ 0.505, 0.798, 0.328 ], "y_axis": [ 0.749, -0.218, -0.625 ], "z_axis": [ -0.428, 0.562, -0.708 ], "quaternion": [ -0.381, 0.780, 0.496, -0.032 ] } }, { "index": 127, "nt1": "///B/141", "nt2": "///B/162", "bp": "G-U", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -169.637, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 41.346, "chi2": -165.939, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 69.433, "C1C1_dist": 10.170, "N1N9_dist": 8.555, "C6C8_dist": 9.474, "CNNC_torsion": -11.969, "hbonds_num": 2, "hbonds_desc": "O6(carbonyl)-N3(imino)[2.58],N1(imino)-O2(carbonyl)[2.55]", "interBase_angle": 20.519, "planarity": 0.296, "simple_Shear": -2.462, "simple_Stretch": -0.200, "simple_Buckle": 4.589, "simple_Propeller": -19.999, "bp_simpleParams": [ -2.462, -0.200, -0.077, 4.589, -19.999, 0.790 ], "bp_params": [ -2.335, -0.806, -0.077, 9.376, -18.252, 0.798 ], "frame": { "rmsd": null, "origin": [ 71.126, 72.598, 69.595 ], "x_axis": [ 0.950, 0.230, -0.210 ], "y_axis": [ 0.070, -0.813, -0.578 ], "z_axis": [ -0.304, 0.534, -0.789 ], "quaternion": [ -0.295, 0.942, 0.080, -0.136 ] } }, { "index": 128, "nt1": "///B/142", "nt2": "///B/161", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -165.699, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 52.687, "chi2": -169.830, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 54.941, "C1C1_dist": 10.561, "N1N9_dist": 8.819, "C6C8_dist": 9.718, "CNNC_torsion": -14.658, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.74],O4(carbonyl)-N6(amino)[2.78]", "interBase_angle": 17.378, "planarity": 0.209, "simple_Shear": -0.047, "simple_Stretch": -0.229, "simple_Buckle": 2.315, "simple_Propeller": -17.223, "bp_simpleParams": [ -0.047, -0.229, 0.053, 2.315, -17.223, -2.042 ], "bp_params": [ -0.044, -0.230, 0.053, 2.479, -17.200, -2.065 ], "frame": { "rmsd": null, "origin": [ 70.287, 75.603, 67.541 ], "x_axis": [ 0.756, -0.420, -0.501 ], "y_axis": [ -0.594, -0.762, -0.257 ], "z_axis": [ -0.274, 0.492, -0.826 ], "quaternion": [ -0.205, 0.914, -0.277, -0.212 ] } }, { "index": 129, "nt1": "///B/143", "nt2": "///B/160", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -161.732, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 54.083, "chi2": -166.548, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 52.816, "C1C1_dist": 10.729, "N1N9_dist": 8.971, "C6C8_dist": 9.864, "CNNC_torsion": -9.557, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.90],N3-N1(imino)[2.91],N4(amino)-O6(carbonyl)[2.85]", "interBase_angle": 12.456, "planarity": 0.152, "simple_Shear": 0.301, "simple_Stretch": -0.161, "simple_Buckle": 2.487, "simple_Propeller": -12.205, "bp_simpleParams": [ 0.301, -0.161, -0.009, 2.487, -12.205, -1.965 ], "bp_params": [ 0.297, -0.168, -0.009, 2.175, -12.265, -1.976 ], "frame": { "rmsd": null, "origin": [ 70.648, 78.260, 65.126 ], "x_axis": [ 0.340, -0.795, -0.502 ], "y_axis": [ -0.914, -0.404, 0.021 ], "z_axis": [ -0.220, 0.452, -0.865 ], "quaternion": [ -0.133, 0.808, -0.529, -0.223 ] } }, { "index": 130, "nt1": "///B/144", "nt2": "///B/159", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -156.882, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 56.432, "chi2": -163.017, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 55.942, "C1C1_dist": 10.564, "N1N9_dist": 8.921, "C6C8_dist": 9.942, "CNNC_torsion": -10.296, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.92],O4(carbonyl)-N6(amino)[3.16]", "interBase_angle": 12.746, "planarity": 0.156, "simple_Shear": 0.041, "simple_Stretch": 0.006, "simple_Buckle": 3.681, "simple_Propeller": -12.203, "bp_simpleParams": [ 0.041, 0.006, 0.055, 3.681, -12.203, 3.494 ], "bp_params": [ 0.041, 0.006, 0.055, 3.703, -12.197, 3.512 ], "frame": { "rmsd": null, "origin": [ 71.241, 79.625, 61.990 ], "x_axis": [ -0.151, -0.941, -0.303 ], "y_axis": [ -0.968, 0.079, 0.239 ], "z_axis": [ -0.201, 0.329, -0.923 ], "quaternion": [ 0.035, -0.651, 0.734, 0.193 ] } }, { "index": 131, "nt1": "///B/145", "nt2": "///B/158", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -158.880, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 56.977, "chi2": -166.372, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 54.199, "C1C1_dist": 10.515, "N1N9_dist": 8.844, "C6C8_dist": 9.820, "CNNC_torsion": -8.089, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.63],N3-N1(imino)[2.85],N4(amino)-O6(carbonyl)[2.95]", "interBase_angle": 10.031, "planarity": 0.130, "simple_Shear": 0.429, "simple_Stretch": -0.187, "simple_Buckle": 6.297, "simple_Propeller": -7.808, "bp_simpleParams": [ 0.429, -0.187, 0.127, 6.297, -7.808, 2.129 ], "bp_params": [ 0.422, -0.203, 0.127, 6.007, -8.033, 2.131 ], "frame": { "rmsd": null, "origin": [ 71.341, 79.863, 58.645 ], "x_axis": [ -0.649, -0.760, -0.001 ], "y_axis": [ -0.718, 0.613, 0.328 ], "z_axis": [ -0.249, 0.213, -0.945 ], "quaternion": [ -0.069, -0.413, 0.895, 0.151 ] } }, { "index": 132, "nt1": "///B/146", "nt2": "///B/157", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -162.064, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 56.447, "chi2": -157.724, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 55.885, "C1C1_dist": 10.211, "N1N9_dist": 8.567, "C6C8_dist": 9.555, "CNNC_torsion": -8.275, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.68],N1-N3(imino)[2.54]", "interBase_angle": 10.713, "planarity": 0.132, "simple_Shear": 0.092, "simple_Stretch": -0.389, "simple_Buckle": 4.559, "simple_Propeller": -9.694, "bp_simpleParams": [ 0.092, -0.389, 0.048, 4.559, -9.694, 1.536 ], "bp_params": [ 0.087, -0.390, 0.048, 4.430, -9.754, 1.541 ], "frame": { "rmsd": null, "origin": [ 71.174, 79.354, 55.318 ], "x_axis": [ -0.850, -0.388, 0.356 ], "y_axis": [ -0.333, 0.920, 0.209 ], "z_axis": [ -0.408, 0.060, -0.911 ], "quaternion": [ -0.199, -0.188, 0.959, 0.070 ] } }, { "index": 133, "nt1": "///B/147", "nt2": "///B/156", "bp": "G-U", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -167.097, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 45.387, "chi2": -156.413, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 68.852, "C1C1_dist": 10.177, "N1N9_dist": 8.613, "C6C8_dist": 9.613, "CNNC_torsion": -3.484, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N3(imino)[2.78],N1(imino)-O2(carbonyl)[2.59],N2(amino)-O2(carbonyl)[3.21]", "interBase_angle": 8.350, "planarity": 0.152, "simple_Shear": -2.212, "simple_Stretch": -0.152, "simple_Buckle": -0.331, "simple_Propeller": -8.344, "bp_simpleParams": [ -2.212, -0.152, -0.367, -0.331, -8.344, 4.085 ], "bp_params": [ -2.126, -0.629, -0.367, 1.487, -8.217, 4.095 ], "frame": { "rmsd": null, "origin": [ 69.950, 78.041, 52.466 ], "x_axis": [ -0.754, 0.034, 0.656 ], "y_axis": [ 0.064, 0.998, 0.022 ], "z_axis": [ -0.653, 0.058, -0.755 ], "quaternion": [ -0.349, 0.026, 0.936, 0.021 ] } }, { "index": 134, "nt1": "///B/148", "nt2": "///B/155", "bp": "G-U", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -174.086, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 44.285, "chi2": -164.340, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 68.350, "C1C1_dist": 10.463, "N1N9_dist": 8.868, "C6C8_dist": 9.836, "CNNC_torsion": -1.461, "hbonds_num": 2, "hbonds_desc": "O6(carbonyl)-N3(imino)[2.99],N1(imino)-O2(carbonyl)[2.81]", "interBase_angle": 8.457, "planarity": 0.102, "simple_Shear": -2.329, "simple_Stretch": 0.105, "simple_Buckle": -7.575, "simple_Propeller": -3.761, "bp_simpleParams": [ -2.329, 0.105, -0.440, -7.575, -3.761, 2.584 ], "bp_params": [ -2.292, -0.426, -0.440, -6.526, -5.379, 2.582 ], "frame": { "rmsd": null, "origin": [ 67.029, 77.012, 50.330 ], "x_axis": [ -0.460, 0.552, 0.695 ], "y_axis": [ 0.513, 0.804, -0.299 ], "z_axis": [ -0.724, 0.219, -0.654 ], "quaternion": [ -0.415, 0.312, 0.854, -0.023 ] } }, { "index": 135, "nt1": "///B/149", "nt2": "///B/154", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -166.348, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 56.455, "chi2": -163.839, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 57.634, "C1C1_dist": 10.551, "N1N9_dist": 8.942, "C6C8_dist": 9.965, "CNNC_torsion": 7.134, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[3.11],N1(imino)-N3[2.95],N2(amino)-O2(carbonyl)[2.67]", "interBase_angle": 8.147, "planarity": 0.110, "simple_Shear": -0.339, "simple_Stretch": -0.050, "simple_Buckle": -5.783, "simple_Propeller": 5.738, "bp_simpleParams": [ -0.339, -0.050, -0.363, -5.783, 5.738, 3.732 ], "bp_params": [ -0.337, -0.060, -0.363, -5.957, 5.558, 3.731 ], "frame": { "rmsd": null, "origin": [ 63.399, 76.782, 49.049 ], "x_axis": [ -0.027, 0.901, 0.433 ], "y_axis": [ 0.691, 0.330, -0.643 ], "z_axis": [ -0.722, 0.282, -0.632 ], "quaternion": [ -0.410, 0.565, 0.705, -0.128 ] } }, { "index": 136, "nt1": "///B/150", "nt2": "///B/153", "bp": "G-A", "name": "Sheared", "Saenger": "11-XI", "LW": "tSH", "DSSR": "tm-M", "intra_chain": true, "chi1": -160.871, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 94.246, "chi2": -147.508, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 14.471, "C1C1_dist": 9.185, "N1N9_dist": 8.016, "C6C8_dist": 8.215, "CNNC_torsion": -124.183, "hbonds_num": 2, "hbonds_desc": "N2(amino)-OP2[2.67],N2(amino)-N7[2.74]", "interBase_angle": 14.381, "planarity": 0.331, "simple_Shear": 8.076, "simple_Stretch": 2.816, "simple_Buckle": 8.273, "simple_Propeller": 11.762, "bp_simpleParams": [ 8.076, 2.816, 1.325, 8.273, 11.762, -18.128 ], "bp_params": [ 6.777, -5.219, 1.325, 14.373, -0.476, -17.988 ], "frame": { "rmsd": null, "origin": [ 60.160, 75.591, 47.587 ], "x_axis": [ 0.700, 0.701, -0.137 ], "y_axis": [ 0.397, -0.541, -0.742 ], "z_axis": [ -0.594, 0.465, -0.657 ], "quaternion": [ -0.355, 0.851, 0.322, -0.215 ] } }, { "index": 137, "nt1": "///B/151", "nt2": "///B/248", "bp": "A+A", "name": "--", "Saenger": "01-I", "LW": "tWW", "DSSR": "tW+W", "intra_chain": true, "chi1": -174.128, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 26.984, "chi2": -103.732, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 32.076, "C1C1_dist": 13.650, "N1N9_dist": 11.178, "C6C8_dist": 11.343, "CNNC_torsion": 144.678, "hbonds_num": 2, "hbonds_desc": "N6(amino)-N1[2.97],N1-N6(amino)[2.99]", "interBase_angle": 23.843, "planarity": 0.273, "simple_Shear": -1.263, "simple_Stretch": 1.624, "simple_Buckle": -2.133, "simple_Propeller": -23.747, "bp_simpleParams": [ -1.263, 1.624, 0.204, -2.133, -23.747, 177.662 ], "bp_params": [ -1.452, -1.457, 0.204, 23.826, 0.897, 177.611 ], "frame": { "rmsd": null, "origin": [ 53.280, 71.935, 42.948 ], "x_axis": [ -0.605, -0.665, 0.438 ], "y_axis": [ 0.405, -0.731, -0.549 ], "z_axis": [ 0.685, -0.155, 0.712 ], "quaternion": [ -0.307, 0.322, -0.202, 0.873 ] } }, { "index": 138, "nt1": "///B/152", "nt2": "///B/224", "bp": "A-U", "name": "--", "Saenger": "--", "LW": "cSS", "DSSR": "cm-m", "intra_chain": true, "chi1": -158.513, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 94.102, "chi2": -160.968, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 147.503, "C1C1_dist": 5.612, "N1N9_dist": 7.102, "C6C8_dist": 9.628, "CNNC_torsion": -49.069, "hbonds_num": 3, "hbonds_desc": "O2'(hydroxyl)-O3'[3.11],O2'(hydroxyl)-O2'(hydroxyl)[2.77],N3-O2'(hydroxyl)[2.57]", "interBase_angle": 32.943, "planarity": 0.385, "simple_Shear": -0.843, "simple_Stretch": 6.839, "simple_Buckle": 5.717, "simple_Propeller": -32.443, "bp_simpleParams": [ -0.843, 6.839, 1.255, 5.717, -32.443, 145.695 ], "bp_params": [ -2.576, 6.392, 1.255, 13.742, -29.940, 146.554 ], "frame": { "rmsd": null, "origin": [ 53.118, 70.059, 45.516 ], "x_axis": [ -0.023, -0.895, -0.446 ], "y_axis": [ 0.838, 0.226, -0.496 ], "z_axis": [ 0.545, -0.386, 0.745 ], "quaternion": [ 0.698, -0.040, 0.355, -0.621 ] } }, { "index": 139, "nt1": "///B/153", "nt2": "///B/250", "bp": "A+G", "name": "Linker", "Saenger": "--", "LW": "tSS", "DSSR": "tm+m", "intra_chain": true, "chi1": -147.508, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 63.634, "chi2": -167.547, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 81.502, "C1C1_dist": 8.143, "N1N9_dist": 7.771, "C6C8_dist": 10.108, "CNNC_torsion": 162.266, "hbonds_num": 2, "hbonds_desc": "N1-O2'(hydroxyl)[3.16],N3-N2(amino)[2.78]", "interBase_angle": 19.276, "planarity": 0.356, "simple_Shear": 7.036, "simple_Stretch": 3.596, "simple_Buckle": -10.454, "simple_Propeller": -16.194, "bp_simpleParams": [ 7.036, 3.596, 1.151, -10.454, -16.194, 157.751 ], "bp_params": [ 2.809, 7.386, 1.151, 3.137, -19.019, 158.041 ], "frame": { "rmsd": null, "origin": [ 55.825, 69.766, 47.754 ], "x_axis": [ 0.395, -0.499, -0.772 ], "y_axis": [ 0.670, 0.731, -0.130 ], "z_axis": [ 0.629, -0.466, 0.623 ], "quaternion": [ 0.829, 0.101, 0.422, -0.352 ] } }, { "index": 140, "nt1": "///B/164", "nt2": "///B/178", "bp": "G-A", "name": "--", "Saenger": "--", "LW": "cWH", "DSSR": "cW-M", "intra_chain": true, "chi1": -101.151, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 35.405, "chi2": -159.922, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 35.819, "C1C1_dist": 11.602, "N1N9_dist": 9.229, "C6C8_dist": 7.658, "CNNC_torsion": -37.884, "hbonds_num": 1, "hbonds_desc": "O6(carbonyl)-N6(amino)[3.11]", "interBase_angle": 66.873, "planarity": 0.808, "simple_Shear": 1.166, "simple_Stretch": 4.008, "simple_Buckle": 66.143, "simple_Propeller": 9.857, "bp_simpleParams": [ 1.166, 4.008, -1.031, 66.143, 9.857, -132.025 ], "bp_params": [ 2.270, 3.504, -1.031, 66.016, -10.673, -124.259 ], "frame": { "rmsd": null, "origin": [ 78.721, 73.331, 74.880 ], "x_axis": [ -0.782, 0.103, 0.614 ], "y_axis": [ -0.469, -0.747, -0.472 ], "z_axis": [ 0.410, -0.657, 0.633 ], "quaternion": [ 0.161, 0.288, -0.317, 0.889 ] } }, { "index": 141, "nt1": "///B/165", "nt2": "///B/175", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -168.693, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 51.808, "chi2": -170.281, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 57.394, "C1C1_dist": 10.601, "N1N9_dist": 8.891, "C6C8_dist": 9.835, "CNNC_torsion": -4.888, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.78],N3-N1(imino)[2.84],N4(amino)-O6(carbonyl)[2.82]", "interBase_angle": 11.297, "planarity": 0.209, "simple_Shear": -0.199, "simple_Stretch": -0.182, "simple_Buckle": -6.381, "simple_Propeller": -9.322, "bp_simpleParams": [ -0.199, -0.182, -0.343, -6.381, -9.322, 0.873 ], "bp_params": [ -0.195, -0.186, -0.343, -6.169, -9.464, 0.875 ], "frame": { "rmsd": null, "origin": [ 68.047, 69.637, 84.030 ], "x_axis": [ -0.604, 0.168, -0.779 ], "y_axis": [ 0.594, -0.556, -0.581 ], "z_axis": [ -0.531, -0.814, 0.236 ], "quaternion": [ -0.137, -0.423, -0.451, 0.774 ] } }, { "index": 142, "nt1": "///B/166", "nt2": "///B/174", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -153.053, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 54.008, "chi2": -169.143, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 52.108, "C1C1_dist": 10.836, "N1N9_dist": 9.060, "C6C8_dist": 9.936, "CNNC_torsion": -6.907, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.96],N3-N1(imino)[2.96],N4(amino)-O6(carbonyl)[2.86]", "interBase_angle": 10.348, "planarity": 0.132, "simple_Shear": 0.137, "simple_Stretch": -0.093, "simple_Buckle": 2.861, "simple_Propeller": -9.944, "bp_simpleParams": [ 0.137, -0.093, -0.258, 2.861, -9.944, -1.961 ], "bp_params": [ 0.136, -0.094, -0.258, 2.777, -9.968, -1.968 ], "frame": { "rmsd": null, "origin": [ 65.460, 67.894, 85.006 ], "x_axis": [ -0.095, -0.037, -0.995 ], "y_axis": [ 0.765, -0.642, -0.049 ], "z_axis": [ -0.637, -0.766, 0.089 ], "quaternion": [ -0.297, -0.604, -0.302, 0.675 ] } }, { "index": 143, "nt1": "///B/167", "nt2": "///B/173", "bp": "U+A", "name": "--", "Saenger": "--", "LW": "tW.", "DSSR": "tW+.", "intra_chain": true, "chi1": -135.217, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 25.199, "chi2": 178.618, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 5.376, "C1C1_dist": 13.436, "N1N9_dist": 10.654, "C6C8_dist": 10.164, "CNNC_torsion": 117.330, "hbonds_num": 1, "hbonds_desc": "O4(carbonyl)-N6(amino)[2.74]", "interBase_angle": 15.405, "planarity": 0.214, "simple_Shear": -3.920, "simple_Stretch": 1.213, "simple_Buckle": -11.100, "simple_Propeller": -10.683, "bp_simpleParams": [ -3.920, 1.213, 0.670, -11.100, -10.683, -159.414 ], "bp_params": [ -0.461, 4.077, 0.670, -14.238, 5.882, -159.284 ], "frame": { "rmsd": null, "origin": [ 62.726, 65.932, 84.721 ], "x_axis": [ 0.582, -0.520, 0.625 ], "y_axis": [ 0.419, -0.467, -0.779 ], "z_axis": [ 0.697, 0.715, -0.054 ], "quaternion": [ 0.515, -0.725, 0.035, -0.456 ] } }, { "index": 144, "nt1": "///B/168", "nt2": "///B/188", "bp": "U-G", "name": "--", "Saenger": "--", "LW": "tHW", "DSSR": "tM-W", "intra_chain": true, "chi1": -131.476, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 21.168, "chi2": 108.211, "conf2": "--", "pucker2": "~C2'-endo", "lambda2": 32.834, "C1C1_dist": 12.741, "N1N9_dist": 10.189, "C6C8_dist": 9.176, "CNNC_torsion": 133.803, "hbonds_num": 2, "hbonds_desc": "O4(carbonyl)-N1(imino)[3.10],O4(carbonyl)-N2(amino)[2.74]", "interBase_angle": 23.458, "planarity": 0.332, "simple_Shear": -4.236, "simple_Stretch": 3.764, "simple_Buckle": 20.158, "simple_Propeller": -11.997, "bp_simpleParams": [ -4.236, 3.764, 0.035, 20.158, -11.997, -92.086 ], "bp_params": [ -5.653, 0.383, 0.035, 23.275, 2.921, -90.915 ], "frame": { "rmsd": null, "origin": [ 75.581, 53.619, 78.885 ], "x_axis": [ 0.132, 0.982, 0.134 ], "y_axis": [ -0.972, 0.101, 0.213 ], "z_axis": [ 0.195, -0.158, 0.968 ], "quaternion": [ 0.742, 0.125, 0.021, 0.659 ] } }, { "index": 145, "nt1": "///B/171", "nt2": "///B/172", "bp": "A+A", "name": "Platform", "Saenger": "--", "LW": "cSH", "DSSR": "cm+M", "intra_chain": true, "chi1": -153.009, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 141.282, "chi2": -178.354, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 34.039, "C1C1_dist": 7.050, "N1N9_dist": 6.981, "C6C8_dist": 6.927, "CNNC_torsion": 15.335, "hbonds_num": 1, "hbonds_desc": "N3-N6(amino)[3.32]", "interBase_angle": 11.359, "planarity": 0.222, "simple_Shear": -0.007, "simple_Stretch": 7.042, "simple_Buckle": -11.184, "simple_Propeller": 1.984, "bp_simpleParams": [ -0.007, 7.042, 0.751, -11.184, 1.984, 2.204 ], "bp_params": [ 7.031, -0.394, 0.751, 2.612, 11.054, 2.213 ], "frame": { "rmsd": null, "origin": [ 60.517, 62.595, 84.496 ], "x_axis": [ 0.666, -0.744, -0.062 ], "y_axis": [ 0.080, 0.154, -0.985 ], "z_axis": [ 0.742, 0.651, 0.162 ], "quaternion": [ 0.704, -0.581, 0.286, -0.293 ] } }, { "index": 146, "nt1": "///B/181", "nt2": "///B/186", "bp": "G+A", "name": "Linker", "Saenger": "--", "LW": "tSS", "DSSR": "tm+m", "intra_chain": true, "chi1": 178.079, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 83.651, "chi2": -124.080, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 54.369, "C1C1_dist": 8.127, "N1N9_dist": 7.575, "C6C8_dist": 9.619, "CNNC_torsion": 162.166, "hbonds_num": 2, "hbonds_desc": "O2'(hydroxyl)-N1[2.63],N2(amino)-N3[2.82]", "interBase_angle": 43.634, "planarity": 0.525, "simple_Shear": 6.755, "simple_Stretch": 2.989, "simple_Buckle": 40.742, "simple_Propeller": -15.619, "bp_simpleParams": [ 6.755, 2.989, 2.036, 40.742, -15.619, -151.569 ], "bp_params": [ -2.595, -6.916, 2.036, -39.447, -18.650, -150.216 ], "frame": { "rmsd": null, "origin": [ 80.494, 67.947, 77.268 ], "x_axis": [ -0.527, 0.308, 0.792 ], "y_axis": [ -0.777, -0.552, -0.302 ], "z_axis": [ 0.344, -0.775, 0.531 ], "quaternion": [ 0.336, 0.351, -0.333, 0.808 ] } }, { "index": 147, "nt1": "///B/184", "nt2": "///B/212", "bp": "A+G", "name": "Linker", "Saenger": "--", "LW": "tSS", "DSSR": "tm+m", "intra_chain": true, "chi1": -111.509, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 59.450, "chi2": 179.738, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 84.910, "C1C1_dist": 8.265, "N1N9_dist": 7.856, "C6C8_dist": 10.067, "CNNC_torsion": 157.231, "hbonds_num": 2, "hbonds_desc": "N1-O2'(hydroxyl)[2.62],N3-N2(amino)[2.94]", "interBase_angle": 32.400, "planarity": 0.393, "simple_Shear": 6.907, "simple_Stretch": 3.307, "simple_Buckle": 25.298, "simple_Propeller": -20.243, "bp_simpleParams": [ 6.907, 3.307, -1.547, 25.298, -20.243, 156.427 ], "bp_params": [ 2.639, 7.189, -1.547, 32.236, 3.252, 155.500 ], "frame": { "rmsd": null, "origin": [ 70.707, 52.501, 71.153 ], "x_axis": [ -0.783, -0.031, 0.621 ], "y_axis": [ 0.230, 0.913, 0.336 ], "z_axis": [ -0.578, 0.406, -0.708 ], "quaternion": [ -0.325, 0.054, 0.923, 0.201 ] } }, { "index": 148, "nt1": "///B/197", "nt2": "///B/200", "bp": "C-G", "name": "--", "Saenger": "--", "LW": "cSS", "DSSR": "cm-m", "intra_chain": true, "chi1": -156.704, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 152.967, "chi2": 179.586, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 104.908, "C1C1_dist": 5.789, "N1N9_dist": 7.546, "C6C8_dist": 9.972, "CNNC_torsion": -21.701, "hbonds_num": 4, "hbonds_desc": "O2'(hydroxyl)-O2'(hydroxyl)[2.93],O2'(hydroxyl)-N2(amino)[3.35],O2'(hydroxyl)-N3[2.59],O2(carbonyl)-N2(amino)[3.16]", "interBase_angle": 31.776, "planarity": 0.384, "simple_Shear": 0.574, "simple_Stretch": 8.227, "simple_Buckle": 28.957, "simple_Propeller": 13.084, "bp_simpleParams": [ 0.574, 8.227, -1.287, 28.957, 13.084, 159.314 ], "bp_params": [ 2.726, 7.784, -1.287, 31.416, 4.770, 158.547 ], "frame": { "rmsd": null, "origin": [ 90.703, 36.403, 90.428 ], "x_axis": [ 0.866, 0.229, -0.445 ], "y_axis": [ 0.134, 0.749, 0.648 ], "z_axis": [ 0.482, -0.621, 0.618 ], "quaternion": [ 0.899, 0.353, 0.258, 0.026 ] } }, { "index": 149, "nt1": "///B/218", "nt2": "///B/219", "bp": "A+A", "name": "Platform", "Saenger": "--", "LW": "cSH", "DSSR": "cm+M", "intra_chain": true, "chi1": -125.154, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 142.323, "chi2": -179.396, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 34.877, "C1C1_dist": 6.462, "N1N9_dist": 6.423, "C6C8_dist": 6.394, "CNNC_torsion": 26.988, "hbonds_num": 1, "hbonds_desc": "N3-N6(amino)[2.91]", "interBase_angle": 15.341, "planarity": 0.204, "simple_Shear": -0.011, "simple_Stretch": 6.613, "simple_Buckle": -14.118, "simple_Propeller": 6.002, "bp_simpleParams": [ -0.011, 6.613, -0.440, -14.118, 6.002, 2.552 ], "bp_params": [ 6.611, -0.172, -0.440, 6.369, 13.956, 2.567 ], "frame": { "rmsd": null, "origin": [ 55.679, 57.079, 57.882 ], "x_axis": [ 0.881, 0.465, -0.089 ], "y_axis": [ 0.062, -0.301, -0.952 ], "z_axis": [ -0.469, 0.833, -0.294 ], "quaternion": [ 0.567, -0.787, -0.167, 0.178 ] } }, { "index": 150, "nt1": "///B/220", "nt2": "///B/253", "bp": "G-U", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -170.954, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 41.010, "chi2": -160.941, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 68.022, "C1C1_dist": 10.444, "N1N9_dist": 8.785, "C6C8_dist": 9.701, "CNNC_torsion": -10.211, "hbonds_num": 2, "hbonds_desc": "O6(carbonyl)-N3(imino)[2.86],N1(imino)-O2(carbonyl)[2.71]", "interBase_angle": 8.990, "planarity": 0.132, "simple_Shear": -2.217, "simple_Stretch": -0.062, "simple_Buckle": 2.999, "simple_Propeller": -8.475, "bp_simpleParams": [ -2.217, -0.062, 0.460, 2.999, -8.475, 0.136 ], "bp_params": [ -2.150, -0.544, 0.460, 4.769, -7.620, 0.137 ], "frame": { "rmsd": null, "origin": [ 53.971, 59.145, 55.116 ], "x_axis": [ 0.584, -0.062, -0.809 ], "y_axis": [ -0.631, -0.662, -0.405 ], "z_axis": [ -0.510, 0.747, -0.426 ], "quaternion": [ -0.353, 0.817, -0.212, -0.404 ] } }, { "index": 151, "nt1": "///B/221", "nt2": "///B/252", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -167.088, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 54.087, "chi2": -165.944, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 56.652, "C1C1_dist": 10.536, "N1N9_dist": 8.860, "C6C8_dist": 9.840, "CNNC_torsion": -14.801, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.85],O4(carbonyl)-N6(amino)[3.06]", "interBase_angle": 15.688, "planarity": 0.224, "simple_Shear": -0.108, "simple_Stretch": -0.096, "simple_Buckle": 6.579, "simple_Propeller": -14.242, "bp_simpleParams": [ -0.108, -0.096, 0.373, 6.579, -14.242, 1.143 ], "bp_params": [ -0.106, -0.098, 0.373, 6.829, -14.124, 1.150 ], "frame": { "rmsd": null, "origin": [ 53.229, 62.514, 54.088 ], "x_axis": [ 0.111, -0.490, -0.865 ], "y_axis": [ -0.835, -0.517, 0.186 ], "z_axis": [ -0.538, 0.702, -0.466 ], "quaternion": [ -0.178, 0.724, -0.458, -0.485 ] } }, { "index": 152, "nt1": "///B/222", "nt2": "///B/251", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -160.280, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 56.318, "chi2": 176.304, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 51.097, "C1C1_dist": 10.713, "N1N9_dist": 8.970, "C6C8_dist": 9.939, "CNNC_torsion": -13.974, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.81],N3-N1(imino)[3.01],N4(amino)-O6(carbonyl)[3.21]", "interBase_angle": 23.355, "planarity": 0.265, "simple_Shear": 0.473, "simple_Stretch": 0.017, "simple_Buckle": 15.630, "simple_Propeller": -17.355, "bp_simpleParams": [ 0.473, 0.017, -0.105, 15.630, -17.355, 3.282 ], "bp_params": [ 0.473, 0.002, -0.105, 15.058, -17.853, 3.294 ], "frame": { "rmsd": null, "origin": [ 52.559, 64.891, 51.908 ], "x_axis": [ -0.405, -0.698, -0.590 ], "y_axis": [ -0.761, -0.100, 0.641 ], "z_axis": [ -0.507, 0.709, -0.491 ], "quaternion": [ 0.031, -0.544, 0.670, 0.504 ] } }, { "index": 153, "nt1": "///B/223", "nt2": "///B/250", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -163.505, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 53.720, "chi2": -167.547, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 49.212, "C1C1_dist": 10.803, "N1N9_dist": 8.966, "C6C8_dist": 9.844, "CNNC_torsion": -10.601, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.93],N3-N1(imino)[2.92],N4(amino)-O6(carbonyl)[2.87]", "interBase_angle": 13.519, "planarity": 0.168, "simple_Shear": 0.388, "simple_Stretch": -0.169, "simple_Buckle": 2.055, "simple_Propeller": -13.362, "bp_simpleParams": [ 0.388, -0.169, -0.072, 2.055, -13.362, -1.878 ], "bp_params": [ 0.382, -0.182, -0.072, 1.601, -13.424, -1.891 ], "frame": { "rmsd": null, "origin": [ 52.370, 67.846, 48.879 ], "x_axis": [ -0.657, -0.748, -0.094 ], "y_axis": [ -0.422, 0.262, 0.868 ], "z_axis": [ -0.625, 0.610, -0.487 ], "quaternion": [ -0.171, -0.377, 0.776, 0.476 ] } }, { "index": 154, "nt1": "///B/224", "nt2": "///B/248", "bp": "U-A", "name": "rHoogsteen", "Saenger": "24-XXIV", "LW": "tWH", "DSSR": "tW-M", "intra_chain": true, "chi1": -160.968, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 41.805, "chi2": -103.732, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 16.922, "C1C1_dist": 9.564, "N1N9_dist": 7.171, "C6C8_dist": 6.465, "CNNC_torsion": 137.035, "hbonds_num": 2, "hbonds_desc": "O2(carbonyl)-N6(amino)[2.79],N3(imino)-N7[2.99]", "interBase_angle": 18.085, "planarity": 0.316, "simple_Shear": 4.928, "simple_Stretch": 0.954, "simple_Buckle": -11.594, "simple_Propeller": -13.880, "bp_simpleParams": [ 4.928, 0.954, -0.870, -11.594, -13.880, -83.943 ], "bp_params": [ 4.271, -2.637, -0.870, -17.930, -2.367, -83.255 ], "frame": { "rmsd": null, "origin": [ 51.566, 69.682, 44.426 ], "x_axis": [ -0.609, 0.056, 0.791 ], "y_axis": [ 0.380, 0.896, 0.230 ], "z_axis": [ -0.696, 0.441, -0.567 ], "quaternion": [ -0.424, 0.124, 0.876, 0.191 ] } }, { "index": 155, "nt1": "///B/225", "nt2": "///B/226", "bp": "A+A", "name": "Platform", "Saenger": "--", "LW": "cSH", "DSSR": "cm+M", "intra_chain": true, "chi1": -110.549, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 141.510, "chi2": -172.938, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 37.813, "C1C1_dist": 6.486, "N1N9_dist": 6.483, "C6C8_dist": 6.474, "CNNC_torsion": 27.772, "hbonds_num": 1, "hbonds_desc": "N3-N6(amino)[3.11]", "interBase_angle": 23.377, "planarity": 0.256, "simple_Shear": 0.014, "simple_Stretch": 6.596, "simple_Buckle": -23.165, "simple_Propeller": -3.140, "bp_simpleParams": [ 0.014, 6.596, 0.019, -23.165, -3.140, 1.505 ], "bp_params": [ 6.594, 0.172, 0.019, -3.748, 23.074, 1.535 ], "frame": { "rmsd": null, "origin": [ 49.228, 69.168, 41.672 ], "x_axis": [ -0.575, -0.287, 0.766 ], "y_axis": [ 0.014, 0.933, 0.360 ], "z_axis": [ -0.818, 0.218, -0.533 ], "quaternion": [ -0.454, -0.078, 0.872, 0.166 ] } }, { "index": 156, "nt1": "///B/226", "nt2": "///B/249", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -172.938, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 43.176, "chi2": -170.602, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 50.290, "C1C1_dist": 10.851, "N1N9_dist": 8.839, "C6C8_dist": 9.452, "CNNC_torsion": 28.217, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.61],N1-N3(imino)[2.87]", "interBase_angle": 39.216, "planarity": 0.474, "simple_Shear": -0.210, "simple_Stretch": -0.257, "simple_Buckle": -20.462, "simple_Propeller": 33.455, "bp_simpleParams": [ -0.210, -0.257, -0.316, -20.462, 33.455, -14.707 ], "bp_params": [ -0.198, -0.267, -0.316, -21.703, 32.663, -15.069 ], "frame": { "rmsd": null, "origin": [ 50.967, 70.170, 39.041 ], "x_axis": [ -0.888, -0.082, 0.452 ], "y_axis": [ -0.035, 0.993, 0.112 ], "z_axis": [ -0.458, 0.083, -0.885 ], "quaternion": [ -0.234, -0.030, 0.970, 0.050 ] } }, { "index": 157, "nt1": "///B/227", "nt2": "///B/247", "bp": "G-U", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -167.537, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 41.644, "chi2": -153.780, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 67.632, "C1C1_dist": 10.294, "N1N9_dist": 8.637, "C6C8_dist": 9.540, "CNNC_torsion": -7.373, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N3(imino)[2.67],N1(imino)-O2(carbonyl)[2.58],N2(amino)-O2(carbonyl)[3.32]", "interBase_angle": 8.168, "planarity": 0.099, "simple_Shear": -2.297, "simple_Stretch": -0.198, "simple_Buckle": -5.908, "simple_Propeller": -5.640, "bp_simpleParams": [ -2.297, -0.198, 0.039, -5.908, -5.640, -0.640 ], "bp_params": [ -2.195, -0.707, 0.039, -4.497, -6.819, -0.641 ], "frame": { "rmsd": null, "origin": [ 46.178, 72.238, 40.884 ], "x_axis": [ -0.133, 0.657, 0.742 ], "y_axis": [ 0.551, 0.671, -0.495 ], "z_axis": [ -0.824, 0.343, -0.452 ], "quaternion": [ 0.521, -0.402, -0.751, 0.051 ] } }, { "index": 158, "nt1": "///B/228", "nt2": "///B/246", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -158.958, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 52.757, "chi2": -166.171, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 54.361, "C1C1_dist": 10.743, "N1N9_dist": 8.990, "C6C8_dist": 9.879, "CNNC_torsion": -8.432, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.92],O4(carbonyl)-N6(amino)[2.91]", "interBase_angle": 12.665, "planarity": 0.145, "simple_Shear": -0.009, "simple_Stretch": -0.052, "simple_Buckle": 6.739, "simple_Propeller": -10.723, "bp_simpleParams": [ -0.009, -0.052, -0.134, 6.739, -10.723, -2.419 ], "bp_params": [ -0.009, -0.052, -0.134, 6.816, -10.675, -2.425 ], "frame": { "rmsd": null, "origin": [ 42.983, 72.833, 40.349 ], "x_axis": [ 0.367, 0.878, 0.308 ], "y_axis": [ 0.487, 0.101, -0.867 ], "z_axis": [ -0.792, 0.468, -0.391 ], "quaternion": [ 0.519, -0.643, -0.530, 0.188 ] } }, { "index": 159, "nt1": "///B/229", "nt2": "///B/245", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -160.438, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 53.863, "chi2": -168.786, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 50.515, "C1C1_dist": 10.761, "N1N9_dist": 8.945, "C6C8_dist": 9.794, "CNNC_torsion": -4.766, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.82],N3-N1(imino)[2.85],N4(amino)-O6(carbonyl)[2.79]", "interBase_angle": 7.780, "planarity": 0.094, "simple_Shear": 0.362, "simple_Stretch": -0.210, "simple_Buckle": 6.360, "simple_Propeller": -4.481, "bp_simpleParams": [ 0.362, -0.210, -0.038, 6.360, -4.481, -2.181 ], "bp_params": [ 0.355, -0.221, -0.038, 6.225, -4.668, -2.180 ], "frame": { "rmsd": null, "origin": [ 40.008, 74.691, 40.201 ], "x_axis": [ 0.688, 0.704, -0.177 ], "y_axis": [ 0.164, -0.388, -0.907 ], "z_axis": [ -0.707, 0.595, -0.382 ], "quaternion": [ -0.479, 0.784, 0.277, -0.282 ] } }, { "index": 160, "nt1": "///B/230", "nt2": "///B/244", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -161.959, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 54.076, "chi2": -176.202, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 53.638, "C1C1_dist": 10.559, "N1N9_dist": 8.775, "C6C8_dist": 9.673, "CNNC_torsion": -8.154, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.74],N1-N3(imino)[2.73]", "interBase_angle": 12.861, "planarity": 0.154, "simple_Shear": -0.074, "simple_Stretch": -0.248, "simple_Buckle": 10.481, "simple_Propeller": -7.453, "bp_simpleParams": [ -0.074, -0.248, 0.428, 10.481, -7.453, -2.227 ], "bp_params": [ -0.072, -0.249, 0.428, 10.532, -7.381, -2.222 ], "frame": { "rmsd": null, "origin": [ 38.140, 77.666, 40.425 ], "x_axis": [ 0.786, 0.346, -0.513 ], "y_axis": [ -0.177, -0.669, -0.722 ], "z_axis": [ -0.593, 0.658, -0.464 ], "quaternion": [ -0.404, 0.854, 0.049, -0.324 ] } }, { "index": 161, "nt1": "///B/231", "nt2": "///B/243", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -161.148, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 54.160, "chi2": -161.858, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 53.549, "C1C1_dist": 10.555, "N1N9_dist": 8.811, "C6C8_dist": 9.707, "CNNC_torsion": -11.967, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.77],N1-N3(imino)[2.73]", "interBase_angle": 13.818, "planarity": 0.172, "simple_Shear": 0.026, "simple_Stretch": -0.238, "simple_Buckle": -2.378, "simple_Propeller": -13.612, "bp_simpleParams": [ 0.026, -0.238, 0.123, -2.378, -13.612, -1.983 ], "bp_params": [ 0.024, -0.239, 0.123, -2.482, -13.593, -1.997 ], "frame": { "rmsd": null, "origin": [ 36.626, 81.122, 39.729 ], "x_axis": [ 0.634, -0.188, -0.750 ], "y_axis": [ -0.632, -0.685, -0.363 ], "z_axis": [ -0.446, 0.704, -0.553 ], "quaternion": [ -0.315, 0.847, -0.242, -0.353 ] } }, { "index": 162, "nt1": "///B/232", "nt2": "///B/242", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -160.567, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 56.695, "chi2": -169.275, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 55.044, "C1C1_dist": 10.506, "N1N9_dist": 8.849, "C6C8_dist": 9.830, "CNNC_torsion": -10.371, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.59],N3-N1(imino)[2.82],N4(amino)-O6(carbonyl)[2.96]", "interBase_angle": 11.391, "planarity": 0.165, "simple_Shear": 0.204, "simple_Stretch": -0.191, "simple_Buckle": 5.697, "simple_Propeller": -9.865, "bp_simpleParams": [ 0.204, -0.191, 0.320, 5.697, -9.865, 2.068 ], "bp_params": [ 0.201, -0.194, 0.320, 5.555, -9.945, 2.073 ], "frame": { "rmsd": null, "origin": [ 36.695, 83.591, 37.641 ], "x_axis": [ 0.227, -0.608, -0.761 ], "y_axis": [ -0.891, -0.445, 0.090 ], "z_axis": [ -0.393, 0.658, -0.643 ], "quaternion": [ -0.187, 0.761, -0.493, -0.379 ] } }, { "index": 163, "nt1": "///B/233", "nt2": "///B/241", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -176.122, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 55.583, "chi2": -164.521, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 56.693, "C1C1_dist": 10.355, "N1N9_dist": 8.709, "C6C8_dist": 9.676, "CNNC_torsion": -10.511, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.87],N1-N3(imino)[2.74]", "interBase_angle": 9.395, "planarity": 0.171, "simple_Shear": -0.239, "simple_Stretch": -0.284, "simple_Buckle": -3.699, "simple_Propeller": -8.637, "bp_simpleParams": [ -0.239, -0.284, 0.476, -3.699, -8.637, 0.287 ], "bp_params": [ -0.234, -0.288, 0.476, -3.534, -8.705, 0.288 ], "frame": { "rmsd": null, "origin": [ 37.049, 85.840, 34.900 ], "x_axis": [ -0.167, -0.861, -0.480 ], "y_axis": [ -0.899, -0.067, 0.433 ], "z_axis": [ -0.404, 0.504, -0.763 ], "quaternion": [ 0.028, -0.645, 0.683, 0.343 ] } }, { "index": 164, "nt1": "///B/234", "nt2": "///B/240", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -162.201, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 48.261, "chi2": -165.226, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 53.006, "C1C1_dist": 11.027, "N1N9_dist": 9.156, "C6C8_dist": 9.906, "CNNC_torsion": -18.910, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.99],N1(imino)-N3[3.20],N2(amino)-O2(carbonyl)[3.48]", "interBase_angle": 25.508, "planarity": 0.289, "simple_Shear": -0.854, "simple_Stretch": -0.020, "simple_Buckle": -13.163, "simple_Propeller": -21.850, "bp_simpleParams": [ -0.854, -0.020, -0.159, -13.163, -21.850, -6.955 ], "bp_params": [ -0.851, -0.081, -0.159, -11.472, -22.783, -7.061 ], "frame": { "rmsd": null, "origin": [ 37.314, 87.291, 31.296 ], "x_axis": [ -0.590, -0.801, -0.100 ], "y_axis": [ -0.718, 0.463, 0.520 ], "z_axis": [ -0.370, 0.378, -0.848 ], "quaternion": [ -0.079, -0.446, 0.852, 0.264 ] } }, { "index": 165, "nt1": "///B/235", "nt2": "///B/239", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -178.847, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 44.069, "chi2": -165.112, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 46.588, "C1C1_dist": 10.932, "N1N9_dist": 8.865, "C6C8_dist": 9.435, "CNNC_torsion": -23.165, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.37],N1-N3(imino)[2.76]", "interBase_angle": 24.822, "planarity": 0.297, "simple_Shear": -0.214, "simple_Stretch": -0.408, "simple_Buckle": -3.181, "simple_Propeller": -24.618, "bp_simpleParams": [ -0.214, -0.408, 0.117, -3.181, -24.618, -16.727 ], "bp_params": [ -0.207, -0.412, 0.117, -2.724, -24.672, -17.112 ], "frame": { "rmsd": null, "origin": [ 36.871, 87.734, 27.818 ], "x_axis": [ -0.861, -0.439, 0.257 ], "y_axis": [ -0.250, 0.806, 0.537 ], "z_axis": [ -0.443, 0.398, -0.803 ], "quaternion": [ -0.188, -0.185, 0.931, 0.251 ] } } ], "num_multiplets": 28, "multiplets": [ { "index": 1, "num_nts": 3, "nts_short": "GCA", "nts_long": "///A/103,///A/217,///A/256", "planarity": 0.451 }, { "index": 2, "num_nts": 3, "nts_short": "ACG", "nts_long": "///A/104,///A/216,///A/257", "planarity": 0.473 }, { "index": 3, "num_nts": 3, "nts_short": "AGU", "nts_long": "///A/105,///A/215,///A/258", "planarity": 0.371 }, { "index": 4, "num_nts": 3, "nts_short": "UAU", "nts_long": "///A/107,///A/214,///A/259", "planarity": 0.224 }, { "index": 5, "num_nts": 3, "nts_short": "GCC", "nts_long": "///A/108,///A/213,///A/260", "planarity": 0.147 }, { "index": 6, "num_nts": 3, "nts_short": "CAG", "nts_long": "///A/109,///A/184,///A/212", "planarity": 0.331 }, { "index": 7, "num_nts": 3, "nts_short": "GAC", "nts_long": "///A/110,///A/183,///A/211", "planarity": 0.353 }, { "index": 8, "num_nts": 3, "nts_short": "CCG", "nts_long": "///A/121,///A/197,///A/200", "planarity": 0.296 }, { "index": 9, "num_nts": 3, "nts_short": "CGA", "nts_long": "///A/137,///A/181,///A/186", "planarity": 0.448 }, { "index": 10, "num_nts": 3, "nts_short": "AGA", "nts_long": "///A/139,///A/164,///A/178", "planarity": 0.705 }, { "index": 11, "num_nts": 3, "nts_short": "AUA", "nts_long": "///A/151,///A/224,///A/248", "planarity": 0.532 }, { "index": 12, "num_nts": 3, "nts_short": "AAU", "nts_long": "///A/225,///A/226,///A/249", "planarity": 0.649 }, { "index": 13, "num_nts": 3, "nts_short": "GCA", "nts_long": "///B/103,///B/217,///B/256", "planarity": 0.497 }, { "index": 14, "num_nts": 3, "nts_short": "ACG", "nts_long": "///B/104,///B/216,///B/257", "planarity": 0.415 }, { "index": 15, "num_nts": 3, "nts_short": "AGU", "nts_long": "///B/105,///B/215,///B/258", "planarity": 0.313 }, { "index": 16, "num_nts": 3, "nts_short": "UAU", "nts_long": "///B/107,///B/214,///B/259", "planarity": 0.202 }, { "index": 17, "num_nts": 3, "nts_short": "GCC", "nts_long": "///B/108,///B/213,///B/260", "planarity": 0.167 }, { "index": 18, "num_nts": 3, "nts_short": "CAG", "nts_long": "///B/109,///B/184,///B/212", "planarity": 0.346 }, { "index": 19, "num_nts": 3, "nts_short": "GAC", "nts_long": "///B/110,///B/183,///B/211", "planarity": 0.368 }, { "index": 20, "num_nts": 3, "nts_short": "CCG", "nts_long": "///B/121,///B/197,///B/200", "planarity": 0.395 }, { "index": 21, "num_nts": 3, "nts_short": "CGA", "nts_long": "///B/137,///B/181,///B/186", "planarity": 0.483 }, { "index": 22, "num_nts": 3, "nts_short": "AGA", "nts_long": "///B/139,///B/164,///B/178", "planarity": 0.717 }, { "index": 23, "num_nts": 3, "nts_short": "AUA", "nts_long": "///B/151,///B/224,///B/248", "planarity": 0.527 }, { "index": 24, "num_nts": 3, "nts_short": "AAU", "nts_long": "///B/225,///B/226,///B/249", "planarity": 0.654 }, { "index": 25, "num_nts": 4, "nts_short": "UCCG", "nts_long": "///A/120,///A/124,///A/197,///A/201", "planarity": 0.926 }, { "index": 26, "num_nts": 4, "nts_short": "GACG", "nts_long": "///A/150,///A/153,///A/223,///A/250", "planarity": 0.521 }, { "index": 27, "num_nts": 4, "nts_short": "UCCG", "nts_long": "///B/120,///B/124,///B/197,///B/201", "planarity": 0.998 }, { "index": 28, "num_nts": 4, "nts_short": "GACG", "nts_long": "///B/150,///B/153,///B/223,///B/250", "planarity": 0.484 } ], "num_helices": 8, "helices": [ { "index": 1, "num_stems": 5, "strand1": "ACUGGGGAAGGGCGUAAGAGUCCUAGUCAACAGA", "strand2": "AGGUCCUAACCCGCAGCCAUAGGAUUAGUUGUCU", "bp_type": ".||||||..||||||..|.||||.||||||||||", "helix_form": "x.....x...x...x..xx...xxx........", "helical_rise": 3.050, "helical_rise_std": 1.120, "helical_radius": 9.244, "helical_radius_std": 2.356, "helical_axis": [ 0.671, 0.402, 0.623 ], "point1": [ 15.042, 38.036, 58.020 ], "point2": [ 82.651, 78.504, 120.719 ], "num_pairs": 34, "pairs": [ { "index": 1, "nt1": "///A/123", "nt2": "///A/198", "bp": "A-A", "name": "--", "Saenger": "--", "LW": "tWH", "DSSR": "tW-M", "bp1_params": [ 5.562, -1.168, -0.346, -11.889, 6.269, -77.654 ], "step_params": [ -2.409, -0.454, 3.372, -0.348, -1.412, -2.712 ], "heli_params": [ 35.087, -51.425, 2.491, 27.388, -6.752, -3.077 ], "bp2_params": [ 0.608, -0.331, -0.232, 0.489, 7.042, -3.508 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.372, "simple_Twist": 28.483, "simple_hRise": 3.418, "simple_hTwist": 28.520 }, { "index": 2, "nt1": "///A/121", "nt2": "///A/200", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.608, -0.331, -0.232, 0.489, 7.042, -3.508 ], "step_params": [ -0.384, 2.064, 3.341, 2.744, -5.600, 31.054 ], "heli_params": [ 4.777, 1.191, 2.890, -10.329, -5.062, 31.659 ], "bp2_params": [ 2.210, -0.522, -0.159, 4.155, -11.524, 4.160 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.341, "simple_Twist": 40.179, "simple_hRise": 3.007, "simple_hTwist": 40.641 }, { "index": 3, "nt1": "///A/120", "nt2": "///A/201", "bp": "U-G", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 2.210, -0.522, -0.159, 4.155, -11.524, 4.160 ], "step_params": [ 0.151, 0.973, 2.969, 0.971, -1.779, 46.551 ], "heli_params": [ 1.364, -0.117, 2.935, -2.250, -1.228, 46.592 ], "bp2_params": [ -2.002, -0.637, -0.171, -8.284, -12.123, 1.084 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.969, "simple_Twist": 23.206, "simple_hRise": 2.891, "simple_hTwist": 23.293 }, { "index": 4, "nt1": "///A/119", "nt2": "///A/202", "bp": "G-U", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -2.002, -0.637, -0.171, -8.284, -12.123, 1.084 ], "step_params": [ 0.260, 1.899, 3.293, -5.213, -12.709, 27.263 ], "heli_params": [ 5.841, -1.409, 2.132, -25.046, 10.274, 30.469 ], "bp2_params": [ -0.342, -0.365, -0.259, 2.356, -8.841, -0.328 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.293, "simple_Twist": 36.199, "simple_hRise": 2.454, "simple_hTwist": 38.636 }, { "index": 5, "nt1": "///A/118", "nt2": "///A/203", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.342, -0.365, -0.259, 2.356, -8.841, -0.328 ], "step_params": [ 0.479, 1.581, 3.474, 0.324, -16.081, 29.537 ], "heli_params": [ 5.242, -0.780, 2.332, -28.991, -0.583, 33.547 ], "bp2_params": [ -0.354, -0.251, 0.112, 10.419, -12.082, -2.243 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.474, "simple_Twist": 29.550, "simple_hRise": 2.333, "simple_hTwist": 33.558 }, { "index": 6, "nt1": "///A/117", "nt2": "///A/204", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.354, -0.251, 0.112, 10.419, -12.082, -2.243 ], "step_params": [ -0.848, 0.930, 2.904, -2.359, -9.648, 32.018 ], "heli_params": [ 2.978, 1.138, 2.577, -16.987, 4.154, 33.484 ], "bp2_params": [ -1.694, 0.064, 0.228, -4.684, -7.954, 9.454 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.904, "simple_Twist": 25.217, "simple_hRise": 2.455, "simple_hTwist": 27.073 }, { "index": 7, "nt1": "///A/116", "nt2": "///A/205", "bp": "G-U", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -1.694, 0.064, 0.228, -4.684, -7.954, 9.454 ], "step_params": [ -0.736, 0.680, 5.148, 6.635, -34.920, 63.438 ], "heli_params": [ 2.420, 0.977, 4.259, -30.817, -5.855, 71.800 ], "bp2_params": [ -6.176, -4.328, 0.451, -27.314, 15.367, -13.938 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 5.148, "simple_Twist": 28.761, "simple_hRise": 2.694, "simple_hTwist": 45.429 }, { "index": 8, "nt1": "///A/114", "nt2": "///A/206", "bp": "A-A", "name": "~Sheared", "Saenger": "--", "LW": "tHS", "DSSR": "tM-m", "bp1_params": [ -6.176, -4.328, 0.451, -27.314, 15.367, -13.938 ], "step_params": [ 0.368, 1.055, 4.010, 6.880, 3.351, -6.618 ], "heli_params": [ -12.829, 16.148, 2.027, -21.544, 44.235, -10.114 ], "bp2_params": [ 6.260, -3.996, 0.073, 4.809, -15.428, -18.417 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 4.010, "simple_Twist": 77.383, "simple_hRise": 4.062, "simple_hTwist": 77.701 }, { "index": 9, "nt1": "///A/113", "nt2": "///A/207", "bp": "A-A", "name": "~Sheared", "Saenger": "--", "LW": "tSH", "DSSR": "tm-M", "bp1_params": [ 6.260, -3.996, 0.073, 4.809, -15.428, -18.417 ], "step_params": [ -0.990, 1.187, 3.499, 3.362, -3.997, 60.913 ], "heli_params": [ 1.367, 1.142, 3.369, -3.935, -3.310, 61.115 ], "bp2_params": [ -0.114, -0.142, 0.391, 6.697, -9.078, 2.995 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.499, "simple_Twist": 19.547, "simple_hRise": 2.988, "simple_hTwist": 20.226 }, { "index": 10, "nt1": "///A/112", "nt2": "///A/208", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.114, -0.142, 0.391, 6.697, -9.078, 2.995 ], "step_params": [ 0.394, 1.491, 3.140, -4.059, -8.078, 30.129 ], "heli_params": [ 4.108, -1.408, 2.589, -15.117, 7.596, 31.426 ], "bp2_params": [ -0.110, 0.011, 0.024, -1.207, -3.609, -1.770 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.140, "simple_Twist": 30.656, "simple_hRise": 2.601, "simple_hTwist": 31.930 }, { "index": 11, "nt1": "///A/111", "nt2": "///A/209", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.110, 0.011, 0.024, -1.207, -3.609, -1.770 ], "step_params": [ 0.836, 1.440, 3.079, -0.909, -5.065, 38.180 ], "heli_params": [ 2.755, -1.370, 2.852, -7.701, 1.382, 38.513 ], "bp2_params": [ -0.561, -0.308, -0.189, -6.162, -4.297, -2.825 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.079, "simple_Twist": 35.738, "simple_hRise": 2.834, "simple_hTwist": 36.095 }, { "index": 12, "nt1": "///A/110", "nt2": "///A/211", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.561, -0.308, -0.189, -6.162, -4.297, -2.825 ], "step_params": [ -0.319, 2.120, 4.133, -2.247, -5.065, 30.369 ], "heli_params": [ 5.180, 0.069, 3.752, -9.568, 4.244, 30.859 ], "bp2_params": [ -0.184, -0.045, -0.578, 13.397, -11.493, -2.059 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 4.133, "simple_Twist": 32.325, "simple_hRise": 3.779, "simple_hTwist": 32.784 }, { "index": 13, "nt1": "///A/109", "nt2": "///A/212", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.184, -0.045, -0.578, 13.397, -11.493, -2.059 ], "step_params": [ 0.828, 1.953, 2.950, 3.556, 1.339, 27.946 ], "heli_params": [ 3.717, -0.926, 3.117, 2.756, -7.319, 28.198 ], "bp2_params": [ 0.048, -0.324, -0.305, -1.030, -10.783, 0.942 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.950, "simple_Twist": 29.301, "simple_hRise": 3.110, "simple_hTwist": 29.541 }, { "index": 14, "nt1": "///A/108", "nt2": "///A/213", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.048, -0.324, -0.305, -1.030, -10.783, 0.942 ], "step_params": [ -0.736, 1.783, 3.344, 2.467, -6.373, 29.145 ], "heli_params": [ 4.715, 1.914, 2.829, -12.450, -4.819, 29.918 ], "bp2_params": [ -0.300, -0.194, -0.315, -1.638, 4.694, 5.794 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.344, "simple_Twist": 27.387, "simple_hRise": 2.790, "simple_hTwist": 28.211 }, { "index": 15, "nt1": "///A/107", "nt2": "///A/214", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.300, -0.194, -0.315, -1.638, 4.694, 5.794 ], "step_params": [ -0.911, 2.648, 3.192, 7.246, 0.918, 41.583 ], "heli_params": [ 3.587, 1.982, 3.054, 1.282, -10.112, 42.191 ], "bp2_params": [ 0.158, 1.336, -0.062, -17.815, 0.313, -13.182 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.192, "simple_Twist": 43.903, "simple_hRise": 3.064, "simple_hTwist": 44.477 }, { "index": 16, "nt1": "///A/105", "nt2": "///A/215", "bp": "A-G", "name": "Imino", "Saenger": "08-VIII", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.158, 1.336, -0.062, -17.815, 0.313, -13.182 ], "step_params": [ -0.456, 1.452, 3.026, 0.198, -5.913, 36.785 ], "heli_params": [ 2.974, 0.737, 2.765, -9.296, -0.311, 37.242 ], "bp2_params": [ -1.279, -0.186, -0.417, -27.835, -26.064, -1.733 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.026, "simple_Twist": 30.412, "simple_hRise": 2.699, "simple_hTwist": 30.969 }, { "index": 17, "nt1": "///A/104", "nt2": "///A/216", "bp": "A-C", "name": "--", "Saenger": "--", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -1.279, -0.186, -0.417, -27.835, -26.064, -1.733 ], "step_params": [ -0.325, 2.060, 4.345, 1.257, -5.380, 31.185 ], "heli_params": [ 5.042, 0.892, 3.927, -9.910, -2.316, 31.659 ], "bp2_params": [ -0.759, 0.128, -0.463, 0.982, -2.837, 9.056 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 4.345, "simple_Twist": 32.766, "simple_hRise": 3.951, "simple_hTwist": 33.216 }, { "index": 18, "nt1": "///A/103", "nt2": "///A/217", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.759, 0.128, -0.463, 0.982, -2.837, 9.056 ], "step_params": [ -1.965, 0.891, 3.346, 10.098, -6.326, -134.011 ], "heli_params": [ -0.441, -0.997, 3.437, 3.434, 5.481, -134.274 ], "bp2_params": [ -6.660, 0.056, 0.305, -7.108, -14.359, -3.319 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.346, "simple_Twist": -41.781, "simple_hRise": 3.790, "simple_hTwist": -43.374 }, { "index": 19, "nt1": "///A/219", "nt2": "///A/218", "bp": "A+A", "name": "Platform", "Saenger": "--", "LW": "cHS", "DSSR": "cM+m", "bp1_params": [ -6.660, 0.056, 0.305, -7.108, -14.359, -3.319 ], "step_params": [ 0.646, 1.616, 3.436, -9.582, -2.953, 58.273 ], "heli_params": [ 1.795, -1.159, 3.225, -3.008, 9.760, 59.055 ], "bp2_params": [ -2.147, -0.617, 0.652, 7.759, -6.833, -0.648 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.436, "simple_Twist": -18.237, "simple_hRise": 3.541, "simple_hTwist": -20.791 }, { "index": 20, "nt1": "///A/220", "nt2": "///A/253", "bp": "G-U", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -2.147, -0.617, 0.652, 7.759, -6.833, -0.648 ], "step_params": [ -0.352, -1.389, 3.309, -2.027, 3.346, 38.272 ], "heli_params": [ -2.523, 0.283, 3.195, 5.087, 3.082, 38.464 ], "bp2_params": [ -0.062, -0.102, 0.385, 9.247, -11.345, -1.450 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.309, "simple_Twist": 27.054, "simple_hRise": 3.135, "simple_hTwist": 27.330 }, { "index": 21, "nt1": "///A/221", "nt2": "///A/252", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.062, -0.102, 0.385, 9.247, -11.345, -1.450 ], "step_params": [ 0.375, -1.234, 3.165, 2.740, 0.805, 36.064 ], "heli_params": [ -2.098, -0.231, 3.156, 1.298, -4.418, 36.173 ], "bp2_params": [ 0.465, -0.132, -0.055, 13.792, -19.698, 1.648 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.165, "simple_Twist": 33.724, "simple_hRise": 3.155, "simple_hTwist": 33.842 }, { "index": 22, "nt1": "///A/222", "nt2": "///A/251", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.465, -0.132, -0.055, 13.792, -19.698, 1.648 ], "step_params": [ -0.929, -2.078, 3.523, -3.932, 6.881, 31.459 ], "heli_params": [ -4.968, 0.953, 3.101, 12.445, 7.111, 32.417 ], "bp2_params": [ 0.368, -0.159, -0.129, 4.392, -10.303, -2.766 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.523, "simple_Twist": 31.579, "simple_hRise": 3.103, "simple_hTwist": 32.534 }, { "index": 23, "nt1": "///A/223", "nt2": "///A/250", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.368, -0.159, -0.129, 4.392, -10.303, -2.766 ], "step_params": [ -2.317, -1.945, 3.850, 10.203, 5.139, 74.308 ], "heli_params": [ -1.772, 2.251, 3.434, 4.230, -8.398, 75.056 ], "bp2_params": [ 4.256, -2.552, -1.012, -15.216, -7.373, -84.022 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.850, "simple_Twist": 49.069, "simple_hRise": 3.135, "simple_hTwist": 50.301 }, { "index": 24, "nt1": "///A/224", "nt2": "///A/248", "bp": "U-A", "name": "rHoogsteen", "Saenger": "24-XXIV", "LW": "tWH", "DSSR": "tW-M", "bp1_params": [ 4.256, -2.552, -1.012, -15.216, -7.373, -84.022 ], "step_params": [ -2.970, -0.749, 4.613, 22.580, -20.356, -13.971 ], "heli_params": [ 7.320, 1.504, 3.497, 44.116, 48.937, -33.389 ], "bp2_params": [ -0.092, -0.200, -0.329, -24.519, 30.679, -12.946 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 4.613, "simple_Twist": 14.959, "simple_hRise": 0.542, "simple_hTwist": 33.804 }, { "index": 25, "nt1": "///A/226", "nt2": "///A/249", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.092, -0.200, -0.329, -24.519, 30.679, -12.946 ], "step_params": [ 4.987, -0.254, 2.464, -4.680, 34.467, 57.418 ], "heli_params": [ -1.199, -4.688, 1.721, 32.806, 4.454, 66.356 ], "bp2_params": [ -2.214, -0.606, 0.082, -6.747, -9.534, -0.544 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.464, "simple_Twist": 67.392, "simple_hRise": 1.871, "simple_hTwist": 74.887 }, { "index": 26, "nt1": "///A/227", "nt2": "///A/247", "bp": "G-U", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -2.214, -0.606, 0.082, -6.747, -9.534, -0.544 ], "step_params": [ -0.229, -1.294, 3.011, -2.031, 6.350, 39.227 ], "heli_params": [ -2.560, 0.126, 2.785, 9.377, 2.999, 39.768 ], "bp2_params": [ -0.024, 0.024, -0.007, 5.817, -11.313, -0.486 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.011, "simple_Twist": 27.417, "simple_hRise": 2.659, "simple_hTwist": 28.201 }, { "index": 27, "nt1": "///A/228", "nt2": "///A/246", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.024, 0.024, -0.007, 5.817, -11.313, -0.486 ], "step_params": [ -0.105, -1.299, 3.235, -1.088, 10.052, 35.098 ], "heli_params": [ -3.379, 0.026, 2.773, 16.256, 1.759, 36.481 ], "bp2_params": [ 0.306, -0.225, 0.072, 5.472, -5.017, -0.479 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.235, "simple_Twist": 33.044, "simple_hRise": 2.737, "simple_hTwist": 34.515 }, { "index": 28, "nt1": "///A/229", "nt2": "///A/245", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.306, -0.225, 0.072, 5.472, -5.017, -0.479 ], "step_params": [ 0.046, -1.871, 3.021, -2.150, 9.104, 28.652 ], "heli_params": [ -5.160, -0.457, 2.321, 17.805, 4.206, 30.110 ], "bp2_params": [ -0.068, -0.198, 0.512, 5.319, -3.332, -2.067 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.021, "simple_Twist": 30.985, "simple_hRise": 2.381, "simple_hTwist": 32.333 }, { "index": 29, "nt1": "///A/230", "nt2": "///A/244", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.068, -0.198, 0.512, 5.319, -3.332, -2.067 ], "step_params": [ -0.499, -1.604, 3.422, 2.139, 7.938, 33.027 ], "heli_params": [ -3.993, 1.190, 2.932, 13.700, -3.692, 34.007 ], "bp2_params": [ 0.152, -0.275, 0.237, -4.064, -10.903, -1.905 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.422, "simple_Twist": 31.780, "simple_hRise": 2.909, "simple_hTwist": 32.799 }, { "index": 30, "nt1": "///A/231", "nt2": "///A/243", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.152, -0.275, 0.237, -4.064, -10.903, -1.905 ], "step_params": [ 0.600, -1.267, 2.974, 0.610, 4.816, 33.945 ], "heli_params": [ -2.818, -0.933, 2.783, 8.196, -1.038, 34.280 ], "bp2_params": [ 0.198, -0.276, 0.315, 2.233, -8.200, 1.648 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.974, "simple_Twist": 33.733, "simple_hRise": 2.782, "simple_hTwist": 34.070 }, { "index": 31, "nt1": "///A/232", "nt2": "///A/242", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.198, -0.276, 0.315, 2.233, -8.200, 1.648 ], "step_params": [ 0.050, -1.753, 3.165, 0.946, 10.203, 28.961 ], "heli_params": [ -5.080, 0.069, 2.423, 19.642, -1.822, 30.684 ], "bp2_params": [ -0.239, -0.249, 0.199, -5.815, -7.836, -1.007 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.165, "simple_Twist": 31.206, "simple_hRise": 2.485, "simple_hTwist": 32.805 }, { "index": 32, "nt1": "///A/233", "nt2": "///A/241", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.239, -0.249, 0.199, -5.815, -7.836, -1.007 ], "step_params": [ -0.315, -1.715, 3.152, 1.187, 5.420, 29.892 ], "heli_params": [ -4.267, 0.819, 2.791, 10.395, -2.277, 30.391 ], "bp2_params": [ -0.993, -0.116, 0.102, -4.067, -21.043, -7.182 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.152, "simple_Twist": 33.694, "simple_hRise": 2.838, "simple_hTwist": 34.135 }, { "index": 33, "nt1": "///A/234", "nt2": "///A/240", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.993, -0.116, 0.102, -4.067, -21.043, -7.182 ], "step_params": [ -0.269, -1.359, 3.337, -2.270, 2.049, 35.459 ], "heli_params": [ -2.526, 0.107, 3.266, 3.357, 3.718, 35.586 ], "bp2_params": [ -0.205, -0.529, 0.138, -1.470, -25.900, -16.400 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.337, "simple_Twist": 31.437, "simple_hRise": 3.255, "simple_hTwist": 31.582 }, { "index": 34, "nt1": "///A/235", "nt2": "///A/239", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 2, "num_stems": 3, "strand1": "CGCCGUCAGUACC", "strand2": "CAGGCAGUCAUGG", "bp_type": "..|||||||.|||", "helix_form": "x.AA.xAAxxA.", "helical_rise": 2.970, "helical_rise_std": 0.857, "helical_radius": 8.965, "helical_radius_std": 1.768, "helical_axis": [ 0.458, 0.730, 0.508 ], "point1": [ 14.579, 52.872, 52.344 ], "point2": [ 31.021, 79.057, 70.560 ], "num_pairs": 13, "pairs": [ { "index": 1, "nt1": "///A/124", "nt2": "///A/197", "bp": "C-C", "name": "~rHoogsteen", "Saenger": "--", "LW": "tHW", "DSSR": "tM-W", "bp1_params": [ -4.547, -1.375, 1.434, -13.123, 13.303, -79.486 ], "step_params": [ 2.585, -0.300, 2.971, 8.753, 6.751, 57.208 ], "heli_params": [ -0.651, -2.215, 3.250, 6.979, -9.048, 58.178 ], "bp2_params": [ -0.243, 1.599, 0.157, 29.098, -9.122, -19.508 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.971, "simple_Twist": 34.373, "simple_hRise": 3.391, "simple_hTwist": 36.056 }, { "index": 2, "nt1": "///A/126", "nt2": "///A/196", "bp": "G-A", "name": "Imino", "Saenger": "08-VIII", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.243, 1.599, 0.157, 29.098, -9.122, -19.508 ], "step_params": [ 1.033, -1.349, 2.922, 5.485, 3.779, 38.891 ], "heli_params": [ -2.399, -0.950, 2.897, 5.625, -8.164, 39.436 ], "bp2_params": [ 0.227, 0.118, -0.572, 27.822, -27.144, -6.296 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.922, "simple_Twist": 37.538, "simple_hRise": 2.894, "simple_hTwist": 38.103 }, { "index": 3, "nt1": "///A/127", "nt2": "///A/195", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.227, 0.118, -0.572, 27.822, -27.144, -6.296 ], "step_params": [ 0.219, -1.817, 3.588, -6.513, 11.303, 40.127 ], "heli_params": [ -3.722, -0.992, 2.926, 15.971, 9.202, 42.111 ], "bp2_params": [ 0.585, -0.181, 0.257, 7.996, -13.926, 1.082 ], "groove_widths": [ 15.698, null, 13.107, null ], "simple_Rise": 3.588, "simple_Twist": 36.519, "simple_hRise": 2.845, "simple_hTwist": 38.705 }, { "index": 4, "nt1": "///A/128", "nt2": "///A/194", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.585, -0.181, 0.257, 7.996, -13.926, 1.082 ], "step_params": [ -0.187, -1.580, 3.436, 4.209, 12.032, 33.929 ], "heli_params": [ -4.189, 0.877, 2.697, 19.773, -6.917, 36.178 ], "bp2_params": [ 0.719, -0.124, -0.298, -11.953, -17.238, 1.814 ], "groove_widths": [ 16.686, 14.964, 13.766, 6.772 ], "simple_Rise": 3.436, "simple_Twist": 32.576, "simple_hRise": 2.660, "simple_hTwist": 34.918 }, { "index": 5, "nt1": "///A/129", "nt2": "///A/193", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.719, -0.124, -0.298, -11.953, -17.238, 1.814 ], "step_params": [ -2.020, -1.851, 3.390, -8.686, 16.021, 33.694 ], "heli_params": [ -4.839, 1.999, 2.696, 25.460, 13.804, 38.180 ], "bp2_params": [ 0.731, -0.210, 0.735, -17.631, -13.799, -25.932 ], "groove_widths": [ 17.585, 15.690, 14.309, 9.682 ], "simple_Rise": 3.390, "simple_Twist": 33.876, "simple_hRise": 2.701, "simple_hTwist": 38.340 }, { "index": 6, "nt1": "///A/130", "nt2": "///A/192", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.731, -0.210, 0.735, -17.631, -13.799, -25.932 ], "step_params": [ -0.564, -1.556, 2.544, 8.942, -5.323, 40.982 ], "heli_params": [ -1.727, 1.508, 2.546, -7.459, -12.530, 42.228 ], "bp2_params": [ 0.278, 0.030, -0.301, 5.210, -5.213, -7.701 ], "groove_widths": [ 16.721, 15.384, 14.438, 11.124 ], "simple_Rise": 2.544, "simple_Twist": 43.922, "simple_hRise": 2.550, "simple_hTwist": 45.078 }, { "index": 7, "nt1": "///A/132", "nt2": "///A/191", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.278, 0.030, -0.301, 5.210, -5.213, -7.701 ], "step_params": [ -0.481, -1.871, 3.233, -6.718, 8.083, 32.046 ], "heli_params": [ -4.461, -0.194, 2.737, 14.173, 11.779, 33.683 ], "bp2_params": [ 0.276, -0.194, 0.202, -2.827, -10.699, 3.347 ], "groove_widths": [ 16.234, 15.031, 13.952, 13.933 ], "simple_Rise": 3.233, "simple_Twist": 31.789, "simple_hRise": 2.732, "simple_hTwist": 33.439 }, { "index": 8, "nt1": "///A/133", "nt2": "///A/190", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.276, -0.194, 0.202, -2.827, -10.699, 3.347 ], "step_params": [ -0.036, -1.623, 3.473, 2.202, 7.245, 29.489 ], "heli_params": [ -4.548, 0.511, 2.988, 13.945, -4.239, 30.425 ], "bp2_params": [ -0.711, -0.194, -0.348, -15.193, -17.380, 3.769 ], "groove_widths": [ 16.466, 15.277, 23.401, 23.019 ], "simple_Rise": 3.473, "simple_Twist": 34.727, "simple_hRise": 3.075, "simple_hTwist": 35.518 }, { "index": 9, "nt1": "///A/134", "nt2": "///A/189", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.711, -0.194, -0.348, -15.193, -17.380, 3.769 ], "step_params": [ -0.347, -2.604, 2.762, -8.113, 6.512, 62.262 ], "heli_params": [ -2.727, 0.038, 2.530, 6.251, 7.788, 63.039 ], "bp2_params": [ -0.559, 3.873, 0.407, -6.803, -13.135, -62.938 ], "groove_widths": [ 17.009, 16.003, 16.271, 10.771 ], "simple_Rise": 2.762, "simple_Twist": 20.568, "simple_hRise": 1.864, "simple_hTwist": 23.024 }, { "index": 10, "nt1": "///A/135", "nt2": "///A/187", "bp": "U+A", "name": "Hoogsteen", "Saenger": "23-XXIII", "LW": "cWH", "DSSR": "cW+M", "bp1_params": [ -0.559, 3.873, 0.407, -6.803, -13.135, -62.938 ], "step_params": [ -0.874, 0.680, 3.598, 4.113, 10.887, 2.581 ], "heli_params": [ -13.700, 10.621, 1.100, 72.535, -27.402, 11.920 ], "bp2_params": [ 0.219, 0.100, -0.549, -9.464, -14.778, -3.957 ], "groove_widths": [ 17.687, null, 16.130, null ], "simple_Rise": 3.598, "simple_Twist": 39.469, "simple_hRise": 3.551, "simple_hTwist": 41.084 }, { "index": 11, "nt1": "///A/136", "nt2": "///A/182", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.219, 0.100, -0.549, -9.464, -14.778, -3.957 ], "step_params": [ 0.735, -1.397, 2.895, -3.797, 3.334, 36.553 ], "heli_params": [ -2.594, -1.602, 2.674, 5.285, 6.018, 36.889 ], "bp2_params": [ 0.425, -0.211, 0.027, 1.756, -27.408, 1.191 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.895, "simple_Twist": 35.664, "simple_hRise": 2.668, "simple_hTwist": 36.008 }, { "index": 12, "nt1": "///A/137", "nt2": "///A/181", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.425, -0.211, 0.027, 1.756, -27.408, 1.191 ], "step_params": [ -1.070, -2.056, 3.201, -1.139, 15.868, 27.903 ], "heli_params": [ -6.089, 1.769, 1.836, 30.018, 2.154, 32.041 ], "bp2_params": [ 0.270, -0.347, 0.031, 0.494, -5.388, -5.031 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.201, "simple_Twist": 28.531, "simple_hRise": 1.868, "simple_hTwist": 32.586 }, { "index": 13, "nt1": "///A/138", "nt2": "///A/180", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 3, "num_stems": 1, "strand1": "AAGUCUCAGGGG", "strand2": "GGUAGAGUUUCA", "bp_type": "..|||||||||.", "helix_form": "...AAAA....", "helical_rise": 2.850, "helical_rise_std": 0.552, "helical_radius": 8.458, "helical_radius_std": 1.202, "helical_axis": [ 0.495, 0.202, 0.845 ], "point1": [ 37.752, 76.548, 74.258 ], "point2": [ 53.283, 82.891, 100.758 ], "num_pairs": 12, "pairs": [ { "index": 1, "nt1": "///A/139", "nt2": "///A/164", "bp": "A-G", "name": "Sheared", "Saenger": "11-XI", "LW": "tHS", "DSSR": "tM-m", "bp1_params": [ -6.340, -4.662, 0.898, -14.158, 27.280, -0.609 ], "step_params": [ -0.546, -0.588, 2.937, -9.281, 10.964, 35.252 ], "heli_params": [ -2.157, -0.222, 2.698, 17.246, 14.599, 37.980 ], "bp2_params": [ -6.543, -3.754, -0.169, 9.852, -11.048, -1.026 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.937, "simple_Twist": 31.965, "simple_hRise": 2.654, "simple_hTwist": 34.968 }, { "index": 2, "nt1": "///A/140", "nt2": "///A/163", "bp": "A-G", "name": "Sheared", "Saenger": "11-XI", "LW": "tHS", "DSSR": "tM-m", "bp1_params": [ -6.543, -3.754, -0.169, 9.852, -11.048, -1.026 ], "step_params": [ -0.243, -1.002, 3.390, -8.184, 3.903, 53.445 ], "heli_params": [ -1.348, -0.251, 3.316, 4.304, 9.027, 54.153 ], "bp2_params": [ -2.187, -0.742, -0.105, 9.346, -18.418, 0.149 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.390, "simple_Twist": 22.764, "simple_hRise": 3.078, "simple_hTwist": 24.481 }, { "index": 3, "nt1": "///A/141", "nt2": "///A/162", "bp": "G-U", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -2.187, -0.742, -0.105, 9.346, -18.418, 0.149 ], "step_params": [ -0.160, -1.355, 3.389, -0.202, 2.397, 43.690 ], "heli_params": [ -2.053, 0.195, 3.314, 3.218, 0.272, 43.753 ], "bp2_params": [ 0.042, -0.330, -0.180, 4.055, -18.047, -1.046 ], "groove_widths": [ 15.877, null, 12.935, null ], "simple_Rise": 3.389, "simple_Twist": 30.794, "simple_hRise": 3.277, "simple_hTwist": 30.886 }, { "index": 4, "nt1": "///A/142", "nt2": "///A/161", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.042, -0.330, -0.180, 4.055, -18.047, -1.046 ], "step_params": [ -0.257, -1.585, 3.385, -1.124, 5.411, 32.311 ], "heli_params": [ -3.739, 0.262, 3.093, 9.636, 2.001, 32.768 ], "bp2_params": [ 0.348, -0.136, -0.013, -0.555, -9.706, -1.175 ], "groove_widths": [ 16.316, 15.186, 14.467, 11.465 ], "simple_Rise": 3.385, "simple_Twist": 30.600, "simple_hRise": 3.074, "simple_hTwist": 31.083 }, { "index": 5, "nt1": "///A/143", "nt2": "///A/160", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.348, -0.136, -0.013, -0.555, -9.706, -1.175 ], "step_params": [ 0.125, -1.302, 3.183, 0.216, 6.844, 29.960 ], "heli_params": [ -3.708, -0.196, 2.823, 13.026, -0.411, 30.715 ], "bp2_params": [ 0.081, -0.000, 0.120, 2.161, -13.466, 3.279 ], "groove_widths": [ 17.268, 16.090, 15.189, 12.329 ], "simple_Rise": 3.183, "simple_Twist": 31.564, "simple_hRise": 2.845, "simple_hTwist": 32.280 }, { "index": 6, "nt1": "///A/144", "nt2": "///A/159", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.081, -0.000, 0.120, 2.161, -13.466, 3.279 ], "step_params": [ 0.293, -1.031, 3.170, 0.985, 7.368, 35.159 ], "heli_params": [ -2.662, -0.343, 2.909, 12.031, -1.608, 35.912 ], "bp2_params": [ 0.532, -0.076, 0.206, 5.901, -3.601, 2.409 ], "groove_widths": [ 17.767, 16.420, 15.206, 12.331 ], "simple_Rise": 3.170, "simple_Twist": 32.609, "simple_hRise": 2.883, "simple_hTwist": 33.423 }, { "index": 7, "nt1": "///A/145", "nt2": "///A/158", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.532, -0.076, 0.206, 5.901, -3.601, 2.409 ], "step_params": [ -0.327, -1.375, 3.076, 1.596, 12.993, 30.207 ], "heli_params": [ -4.336, 0.812, 2.287, 23.589, -2.897, 32.861 ], "bp2_params": [ 0.176, -0.351, 0.045, 2.706, -9.562, 1.490 ], "groove_widths": [ 17.658, 16.068, 15.184, 11.150 ], "simple_Rise": 3.076, "simple_Twist": 32.123, "simple_hRise": 2.343, "simple_hTwist": 34.623 }, { "index": 8, "nt1": "///A/146", "nt2": "///A/157", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.176, -0.351, 0.045, 2.706, -9.562, 1.490 ], "step_params": [ -0.170, -1.560, 2.983, -3.414, 16.263, 25.266 ], "heli_params": [ -5.589, -0.218, 1.698, 33.014, 6.931, 30.166 ], "bp2_params": [ -2.164, -0.695, -0.363, -0.398, -8.523, 2.603 ], "groove_widths": [ 17.494, 15.667, 15.163, 11.984 ], "simple_Rise": 2.983, "simple_Twist": 38.530, "simple_hRise": 2.186, "simple_hTwist": 41.836 }, { "index": 9, "nt1": "///A/147", "nt2": "///A/156", "bp": "G-U", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -2.164, -0.695, -0.363, -0.398, -8.523, 2.603 ], "step_params": [ 0.180, -1.647, 3.353, -7.907, 10.318, 33.034 ], "heli_params": [ -4.143, -1.397, 2.627, 17.333, 13.283, 35.433 ], "bp2_params": [ -2.375, -0.438, -0.285, -8.373, -4.512, 3.781 ], "groove_widths": [ 17.285, null, 16.349, null ], "simple_Rise": 3.353, "simple_Twist": 33.946, "simple_hRise": 2.651, "simple_hTwist": 36.281 }, { "index": 10, "nt1": "///A/148", "nt2": "///A/155", "bp": "G-U", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -2.375, -0.438, -0.285, -8.373, -4.512, 3.781 ], "step_params": [ -0.321, -1.818, 3.290, -2.001, 2.953, 36.293 ], "heli_params": [ -3.308, 0.239, 3.150, 4.726, 3.203, 36.462 ], "bp2_params": [ -0.397, -0.022, -0.237, -5.768, 7.315, 4.164 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.290, "simple_Twist": 25.529, "simple_hRise": 3.079, "simple_hTwist": 25.773 }, { "index": 11, "nt1": "///A/149", "nt2": "///A/154", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.397, -0.022, -0.237, -5.768, 7.315, 4.164 ], "step_params": [ -2.550, -0.893, 2.631, -3.831, 9.891, 54.250 ], "heli_params": [ -1.435, 2.569, 2.605, 10.731, 4.156, 55.200 ], "bp2_params": [ 6.839, -5.100, 1.311, 14.527, -2.204, -18.065 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.631, "simple_Twist": 4.043, "simple_hRise": 1.021, "simple_hTwist": 11.349 }, { "index": 12, "nt1": "///A/150", "nt2": "///A/153", "bp": "G-A", "name": "Sheared", "Saenger": "11-XI", "LW": "tSH", "DSSR": "tm-M" } ] }, { "index": 4, "num_stems": 2, "strand1": "GCAUCC", "strand2": "CGAAGG", "bp_type": "||..||", "helix_form": ".xx..", "helical_rise": 3.462, "helical_rise_std": 0.613, "helical_radius": 8.658, "helical_radius_std": 0.737, "helical_axis": [ -0.476, 0.868, -0.145 ], "point1": [ 53.171, 57.607, 66.334 ], "point2": [ 44.808, 72.858, 63.790 ], "num_pairs": 6, "pairs": [ { "index": 1, "nt1": "///A/169", "nt2": "///B/255", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.364, -0.247, -0.635, -4.222, -9.258, 3.282 ], "step_params": [ -0.630, -2.018, 3.450, -5.674, 1.522, 40.713 ], "heli_params": [ -3.048, 0.247, 3.430, 2.175, 8.104, 41.117 ], "bp2_params": [ 0.517, -0.198, 0.188, -15.147, 1.520, 0.318 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.450, "simple_Twist": 35.849, "simple_hRise": 3.421, "simple_hTwist": 36.312 }, { "index": 2, "nt1": "///A/170", "nt2": "///B/254", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.517, -0.198, 0.188, -15.147, 1.520, 0.318 ], "step_params": [ 0.662, -2.255, 2.740, -0.205, 5.051, 56.336 ], "heli_params": [ -2.609, -0.708, 2.544, 5.337, 0.217, 56.544 ], "bp2_params": [ 6.992, -0.120, 0.696, 1.460, 11.878, 0.758 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.740, "simple_Twist": -31.617, "simple_hRise": 3.058, "simple_hTwist": -32.009 }, { "index": 3, "nt1": "///A/171", "nt2": "///A/172", "bp": "A+A", "name": "Platform", "Saenger": "--", "LW": "cSH", "DSSR": "cm+M", "bp1_params": [ 6.992, -0.120, 0.696, 1.460, 11.878, 0.758 ], "step_params": [ -0.823, -0.257, 3.766, -7.662, -7.402, -40.373 ], "heli_params": [ 1.238, -2.064, 3.463, 10.506, -10.874, -41.698 ], "bp2_params": [ -0.532, 4.070, 0.614, -15.945, 3.481, -160.268 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.766, "simple_Twist": 2.167, "simple_hRise": 1.507, "simple_hTwist": 10.871 }, { "index": 4, "nt1": "///A/167", "nt2": "///A/173", "bp": "U+A", "name": "--", "Saenger": "--", "LW": "tW.", "DSSR": "tW+.", "bp1_params": [ -0.532, 4.070, 0.614, -15.945, 3.481, -160.268 ], "step_params": [ 0.647, 0.515, 3.138, 3.294, -6.028, -48.473 ], "heli_params": [ -0.181, 1.022, 3.129, 7.299, 3.989, -48.929 ], "bp2_params": [ 0.177, -0.084, -0.033, -1.581, -8.503, -0.988 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.138, "simple_Twist": 0.594, "simple_hRise": 0.130, "simple_hTwist": 6.895 }, { "index": 5, "nt1": "///A/166", "nt2": "///A/174", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.177, -0.084, -0.033, -1.581, -8.503, -0.988 ], "step_params": [ -0.074, 1.083, 3.280, 0.727, -11.972, 32.013 ], "heli_params": [ 3.643, 0.236, 2.711, -20.817, -1.264, 34.131 ], "bp2_params": [ -0.042, -0.225, -0.593, -3.948, -12.551, 2.184 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.280, "simple_Twist": 31.383, "simple_hRise": 2.696, "simple_hTwist": 33.543 }, { "index": 6, "nt1": "///A/165", "nt2": "///A/175", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 5, "num_stems": 2, "strand1": "CGAAGG", "strand2": "GCAUCC", "bp_type": "||..||", "helix_form": ".xx..", "helical_rise": 3.480, "helical_rise_std": 0.651, "helical_radius": 8.655, "helical_radius_std": 0.838, "helical_axis": [ 0.685, 0.723, 0.091 ], "point1": [ 57.276, 57.260, 82.490 ], "point2": [ 69.373, 70.026, 84.101 ], "num_pairs": 6, "pairs": [ { "index": 1, "nt1": "///A/255", "nt2": "///B/169", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.651, -0.173, -0.511, 3.604, -4.214, 2.128 ], "step_params": [ 0.578, 2.054, 3.438, 3.686, -1.429, 41.873 ], "heli_params": [ 3.018, -0.406, 3.406, -1.994, -5.144, 42.051 ], "bp2_params": [ -0.519, 0.051, 0.083, 11.671, -0.610, -1.608 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.438, "simple_Twist": 35.615, "simple_hRise": 3.397, "simple_hTwist": 35.827 }, { "index": 2, "nt1": "///A/254", "nt2": "///B/170", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.519, 0.051, 0.083, 11.671, -0.610, -1.608 ], "step_params": [ -2.174, -0.827, 2.847, 7.293, -0.908, -121.598 ], "heli_params": [ 0.481, -1.186, 2.919, 0.520, 4.176, -121.730 ], "bp2_params": [ -7.031, 0.394, -0.751, -2.612, -11.054, -2.213 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.847, "simple_Twist": -32.257, "simple_hRise": 3.224, "simple_hTwist": -33.062 }, { "index": 3, "nt1": "///B/172", "nt2": "///B/171", "bp": "A+A", "name": "Platform", "Saenger": "--", "LW": "cHS", "DSSR": "cM+m", "bp1_params": [ -7.031, 0.394, -0.751, -2.612, -11.054, -2.213 ], "step_params": [ -0.853, -0.285, 3.905, -10.463, -8.027, -42.085 ], "heli_params": [ 1.259, -2.283, 3.499, 10.862, -14.158, -44.013 ], "bp2_params": [ 0.461, -4.077, -0.670, 14.238, -5.882, 159.284 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.905, "simple_Twist": 2.734, "simple_hRise": 1.627, "simple_hTwist": 13.467 }, { "index": 4, "nt1": "///B/173", "nt2": "///B/167", "bp": "A+U", "name": "--", "Saenger": "--", "LW": "t.W", "DSSR": "t.+W", "bp1_params": [ 0.461, -4.077, -0.670, 14.238, -5.882, 159.284 ], "step_params": [ 0.404, -0.790, 3.259, -3.842, -3.118, 131.231 ], "heli_params": [ -0.411, -0.249, 3.262, -1.712, 2.109, 131.280 ], "bp2_params": [ -0.136, -0.094, -0.258, -2.777, -9.968, -1.968 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.259, "simple_Twist": 0.367, "simple_hRise": 0.424, "simple_hTwist": 4.962 }, { "index": 5, "nt1": "///B/174", "nt2": "///B/166", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.136, -0.094, -0.258, -2.777, -9.968, -1.968 ], "step_params": [ 0.104, -1.147, 3.059, -3.259, 10.252, 32.837 ], "heli_params": [ -3.339, -0.621, 2.574, 17.558, 5.581, 34.508 ], "bp2_params": [ 0.195, -0.186, -0.343, 6.169, -9.464, 0.875 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.059, "simple_Twist": 31.624, "simple_hRise": 2.551, "simple_hTwist": 33.359 }, { "index": 6, "nt1": "///B/175", "nt2": "///B/165", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 6, "num_stems": 3, "strand1": "CGCCGUCAGUACC", "strand2": "CAGGCAGUCAUGG", "bp_type": "..|||||||.|||", "helix_form": "x..A.xAAxxA.", "helical_rise": 3.006, "helical_rise_std": 0.867, "helical_radius": 8.958, "helical_radius_std": 1.474, "helical_axis": [ -0.277, 0.848, -0.451 ], "point1": [ 94.256, 42.578, 94.569 ], "point2": [ 84.231, 73.323, 78.213 ], "num_pairs": 13, "pairs": [ { "index": 1, "nt1": "///B/124", "nt2": "///B/197", "bp": "C-C", "name": "--", "Saenger": "--", "LW": "tHW", "DSSR": "tM-W", "bp1_params": [ -4.504, -2.204, 1.435, -4.419, 2.595, -68.287 ], "step_params": [ 1.705, -0.153, 3.170, 10.298, 12.039, 59.466 ], "heli_params": [ -0.724, -1.180, 3.314, 11.909, -10.186, 61.353 ], "bp2_params": [ 0.082, 1.630, 0.093, 30.987, -11.270, -21.545 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.170, "simple_Twist": 34.420, "simple_hRise": 3.299, "simple_hTwist": 37.791 }, { "index": 2, "nt1": "///B/126", "nt2": "///B/196", "bp": "G-A", "name": "Imino", "Saenger": "08-VIII", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.082, 1.630, 0.093, 30.987, -11.270, -21.545 ], "step_params": [ 1.145, -1.728, 3.212, -1.096, 3.553, 39.265 ], "heli_params": [ -2.962, -1.820, 3.018, 5.273, 1.626, 39.434 ], "bp2_params": [ 0.712, -0.251, -0.077, 22.515, -27.157, -4.792 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.212, "simple_Twist": 36.290, "simple_hRise": 3.000, "simple_hTwist": 36.473 }, { "index": 3, "nt1": "///B/127", "nt2": "///B/195", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.712, -0.251, -0.077, 22.515, -27.157, -4.792 ], "step_params": [ 0.021, -2.086, 3.944, -2.580, 10.205, 34.631 ], "heli_params": [ -4.972, -0.441, 3.211, 16.673, 4.214, 36.148 ], "bp2_params": [ 0.618, -0.211, -0.214, -1.675, -9.241, 5.348 ], "groove_widths": [ 16.017, null, 14.112, null ], "simple_Rise": 3.944, "simple_Twist": 33.908, "simple_hRise": 3.192, "simple_hTwist": 35.458 }, { "index": 4, "nt1": "///B/128", "nt2": "///B/194", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.618, -0.211, -0.214, -1.675, -9.241, 5.348 ], "step_params": [ -0.234, -1.860, 3.101, -3.761, 18.042, 28.469 ], "heli_params": [ -5.523, -0.082, 1.676, 32.712, 6.819, 33.810 ], "bp2_params": [ 0.094, -0.197, 0.260, -11.408, 5.096, 3.071 ], "groove_widths": [ 17.463, 15.518, 14.524, 6.944 ], "simple_Rise": 3.101, "simple_Twist": 31.709, "simple_hRise": 1.830, "simple_hTwist": 36.557 }, { "index": 5, "nt1": "///B/129", "nt2": "///B/193", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.094, -0.197, 0.260, -11.408, 5.096, 3.071 ], "step_params": [ -1.058, -0.706, 2.866, 5.853, -0.546, 41.085 ], "heli_params": [ -0.947, 2.027, 2.705, -0.773, -8.288, 41.485 ], "bp2_params": [ 0.826, -0.375, 0.132, 10.331, -9.436, -8.364 ], "groove_widths": [ 18.195, 16.235, 14.457, 9.756 ], "simple_Rise": 2.866, "simple_Twist": 36.868, "simple_hRise": 2.682, "simple_hTwist": 37.317 }, { "index": 6, "nt1": "///B/130", "nt2": "///B/192", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.826, -0.375, 0.132, 10.331, -9.436, -8.364 ], "step_params": [ -0.776, -1.086, 3.161, 4.227, 7.629, 40.643 ], "heli_params": [ -2.283, 1.511, 2.829, 10.833, -6.002, 41.529 ], "bp2_params": [ 0.803, 0.196, -0.308, 9.162, -6.158, 3.170 ], "groove_widths": [ 16.939, 15.594, 13.683, 10.805 ], "simple_Rise": 3.161, "simple_Twist": 40.771, "simple_hRise": 2.831, "simple_hTwist": 41.654 }, { "index": 7, "nt1": "///B/132", "nt2": "///B/191", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.803, 0.196, -0.308, 9.162, -6.158, 3.170 ], "step_params": [ -0.322, -1.731, 3.492, -2.430, 9.996, 28.066 ], "heli_params": [ -5.406, 0.127, 2.744, 19.790, 4.810, 29.857 ], "bp2_params": [ 0.139, -0.148, 0.048, -3.460, -11.456, 4.148 ], "groove_widths": [ 16.433, 15.183, 13.633, 13.633 ], "simple_Rise": 3.492, "simple_Twist": 31.557, "simple_hRise": 2.842, "simple_hTwist": 33.151 }, { "index": 8, "nt1": "///B/133", "nt2": "///B/190", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.139, -0.148, 0.048, -3.460, -11.456, 4.148 ], "step_params": [ -0.241, -1.585, 3.322, 0.157, 7.204, 31.088 ], "heli_params": [ -4.145, 0.466, 2.890, 13.220, -0.288, 31.892 ], "bp2_params": [ -0.513, -0.200, -0.153, -11.544, -14.107, 0.893 ], "groove_widths": [ 16.441, 15.296, 22.954, 22.575 ], "simple_Rise": 3.322, "simple_Twist": 34.517, "simple_hRise": 2.941, "simple_hTwist": 35.239 }, { "index": 9, "nt1": "///B/134", "nt2": "///B/189", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.513, -0.200, -0.153, -11.544, -14.107, 0.893 ], "step_params": [ -0.403, -2.748, 2.913, -6.524, 3.518, 61.462 ], "heli_params": [ -2.815, 0.127, 2.793, 3.429, 6.358, 61.864 ], "bp2_params": [ -0.115, 3.543, 0.273, -5.240, -17.402, -62.684 ], "groove_widths": [ 16.891, 15.975, 16.551, 12.617 ], "simple_Rise": 2.913, "simple_Twist": 16.943, "simple_hRise": 2.294, "simple_hTwist": 18.483 }, { "index": 10, "nt1": "///B/135", "nt2": "///B/187", "bp": "U+A", "name": "Hoogsteen", "Saenger": "23-XXIII", "LW": "cWH", "DSSR": "cW+M", "bp1_params": [ -0.115, 3.543, 0.273, -5.240, -17.402, -62.684 ], "step_params": [ -0.818, 0.664, 3.779, 3.195, 7.309, 1.046 ], "heli_params": [ -21.335, 17.225, 0.770, 75.629, -33.058, 8.045 ], "bp2_params": [ 0.190, -0.015, -0.477, -7.959, -13.490, -4.747 ], "groove_widths": [ 17.702, null, 16.075, null ], "simple_Rise": 3.779, "simple_Twist": 41.905, "simple_hRise": 3.768, "simple_hTwist": 42.623 }, { "index": 11, "nt1": "///B/136", "nt2": "///B/182", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.190, -0.015, -0.477, -7.959, -13.490, -4.747 ], "step_params": [ 0.864, -1.305, 2.920, -3.547, 3.571, 38.534 ], "heli_params": [ -2.337, -1.672, 2.706, 5.383, 5.347, 38.849 ], "bp2_params": [ 0.414, -0.146, 0.079, 0.773, -24.020, 2.146 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.920, "simple_Twist": 37.370, "simple_hRise": 2.698, "simple_hTwist": 37.695 }, { "index": 12, "nt1": "///B/137", "nt2": "///B/181", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.414, -0.146, 0.079, 0.773, -24.020, 2.146 ], "step_params": [ -0.939, -2.040, 3.091, 2.862, 13.532, 27.168 ], "heli_params": [ -6.028, 2.242, 1.790, 26.721, -5.651, 30.427 ], "bp2_params": [ 0.283, -0.202, -0.217, 5.346, -9.009, -3.845 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.091, "simple_Twist": 27.956, "simple_hRise": 1.829, "simple_hTwist": 31.129 }, { "index": 13, "nt1": "///B/138", "nt2": "///B/180", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 7, "num_stems": 1, "strand1": "AAGUCUCAGGGG", "strand2": "GGUAGAGUUUCA", "bp_type": "..|||||||||.", "helix_form": "...AAAA....", "helical_rise": 2.848, "helical_rise_std": 0.554, "helical_radius": 8.483, "helical_radius_std": 1.201, "helical_axis": [ -0.443, 0.289, -0.849 ], "point1": [ 76.940, 72.103, 73.775 ], "point2": [ 63.059, 81.167, 47.173 ], "num_pairs": 12, "pairs": [ { "index": 1, "nt1": "///B/139", "nt2": "///B/164", "bp": "A-G", "name": "Sheared", "Saenger": "11-XI", "LW": "tHS", "DSSR": "tM-m", "bp1_params": [ -6.364, -4.583, 0.898, -13.739, 23.925, -2.551 ], "step_params": [ -0.454, -0.584, 2.946, -9.856, 10.881, 35.531 ], "heli_params": [ -2.110, -0.415, 2.689, 16.964, 15.367, 38.354 ], "bp2_params": [ -6.611, -3.766, -0.139, 11.759, -11.483, -0.680 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.946, "simple_Twist": 33.260, "simple_hRise": 2.658, "simple_hTwist": 36.272 }, { "index": 2, "nt1": "///B/140", "nt2": "///B/163", "bp": "A-G", "name": "Sheared", "Saenger": "11-XI", "LW": "tHS", "DSSR": "tM-m", "bp1_params": [ -6.611, -3.766, -0.139, 11.759, -11.483, -0.680 ], "step_params": [ 0.012, -1.057, 3.502, -7.299, 4.616, 53.401 ], "heli_params": [ -1.465, -0.490, 3.379, 5.099, 8.062, 54.045 ], "bp2_params": [ -2.335, -0.806, -0.077, 9.376, -18.252, 0.798 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.502, "simple_Twist": 23.337, "simple_hRise": 3.093, "simple_hTwist": 24.863 }, { "index": 3, "nt1": "///B/141", "nt2": "///B/162", "bp": "G-U", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -2.335, -0.806, -0.077, 9.376, -18.252, 0.798 ], "step_params": [ -0.261, -1.419, 3.446, -2.520, 2.609, 43.284 ], "heli_params": [ -2.182, 0.098, 3.368, 3.530, 3.410, 43.429 ], "bp2_params": [ -0.044, -0.230, 0.053, 2.479, -17.200, -2.065 ], "groove_widths": [ 15.876, null, 13.042, null ], "simple_Rise": 3.446, "simple_Twist": 29.840, "simple_hRise": 3.323, "simple_hTwist": 30.055 }, { "index": 4, "nt1": "///B/142", "nt2": "///B/161", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.044, -0.230, 0.053, 2.479, -17.200, -2.065 ], "step_params": [ -0.220, -1.636, 3.208, 0.762, 4.428, 32.281 ], "heli_params": [ -3.646, 0.518, 2.958, 7.916, -1.363, 32.584 ], "bp2_params": [ 0.297, -0.168, -0.009, 2.175, -12.265, -1.976 ], "groove_widths": [ 16.311, 15.142, 14.680, 11.871 ], "simple_Rise": 3.208, "simple_Twist": 30.450, "simple_hRise": 2.941, "simple_hTwist": 30.772 }, { "index": 5, "nt1": "///B/143", "nt2": "///B/160", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.297, -0.168, -0.009, 2.175, -12.265, -1.976 ], "step_params": [ 0.136, -1.293, 3.218, 0.316, 7.844, 30.925 ], "heli_params": [ -3.691, -0.194, 2.815, 14.421, -0.581, 31.883 ], "bp2_params": [ 0.041, 0.006, 0.055, 3.703, -12.197, 3.512 ], "groove_widths": [ 17.181, 16.055, 15.021, 12.116 ], "simple_Rise": 3.218, "simple_Twist": 32.471, "simple_hRise": 2.839, "simple_hTwist": 33.382 }, { "index": 6, "nt1": "///B/144", "nt2": "///B/159", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.041, 0.006, 0.055, 3.703, -12.197, 3.512 ], "step_params": [ 0.274, -1.059, 3.172, 0.327, 7.285, 34.796 ], "heli_params": [ -2.734, -0.405, 2.900, 12.018, -0.539, 35.529 ], "bp2_params": [ 0.422, -0.203, 0.127, 6.007, -8.033, 2.131 ], "groove_widths": [ 17.659, 16.324, 15.189, 12.095 ], "simple_Rise": 3.172, "simple_Twist": 32.582, "simple_hRise": 2.877, "simple_hTwist": 33.367 }, { "index": 7, "nt1": "///B/145", "nt2": "///B/158", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.422, -0.203, 0.127, 6.007, -8.033, 2.131 ], "step_params": [ -0.189, -1.328, 3.092, 1.496, 12.763, 29.502 ], "heli_params": [ -4.379, 0.574, 2.321, 23.696, -2.778, 32.122 ], "bp2_params": [ 0.087, -0.390, 0.048, 4.430, -9.754, 1.541 ], "groove_widths": [ 17.624, 15.997, 15.242, 11.167 ], "simple_Rise": 3.092, "simple_Twist": 31.393, "simple_hRise": 2.376, "simple_hTwist": 33.860 }, { "index": 8, "nt1": "///B/146", "nt2": "///B/157", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.087, -0.390, 0.048, 4.430, -9.754, 1.541 ], "step_params": [ -0.221, -1.560, 2.979, -2.945, 16.442, 25.839 ], "heli_params": [ -5.479, -0.037, 1.716, 32.767, 5.870, 30.691 ], "bp2_params": [ -2.126, -0.629, -0.367, 1.487, -8.217, 4.095 ], "groove_widths": [ 17.413, 15.622, 15.023, 11.755 ], "simple_Rise": 2.979, "simple_Twist": 38.442, "simple_hRise": 2.174, "simple_hTwist": 41.788 }, { "index": 9, "nt1": "///B/147", "nt2": "///B/156", "bp": "G-U", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -2.126, -0.629, -0.367, 1.487, -8.217, 4.095 ], "step_params": [ 0.088, -1.626, 3.392, -6.656, 9.545, 33.511 ], "heli_params": [ -4.034, -1.093, 2.773, 15.967, 11.135, 35.419 ], "bp2_params": [ -2.292, -0.426, -0.440, -6.526, -5.379, 2.582 ], "groove_widths": [ 17.166, null, 16.550, null ], "simple_Rise": 3.392, "simple_Twist": 34.006, "simple_hRise": 2.784, "simple_hTwist": 35.886 }, { "index": 10, "nt1": "///B/148", "nt2": "///B/155", "bp": "G-U", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -2.292, -0.426, -0.440, -6.526, -5.379, 2.582 ], "step_params": [ 0.009, -1.833, 3.393, -1.581, 3.470, 35.667 ], "heli_params": [ -3.479, -0.244, 3.203, 5.645, 2.573, 35.863 ], "bp2_params": [ -0.337, -0.060, -0.363, -5.957, 5.558, 3.731 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.393, "simple_Twist": 25.175, "simple_hRise": 3.109, "simple_hTwist": 25.458 }, { "index": 11, "nt1": "///B/149", "nt2": "///B/154", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.337, -0.060, -0.363, -5.957, 5.558, 3.731 ], "step_params": [ -2.514, -0.856, 2.646, -4.424, 12.171, 55.218 ], "heli_params": [ -1.457, 2.450, 2.598, 12.933, 4.701, 56.599 ], "bp2_params": [ 6.777, -5.219, 1.325, 14.373, -0.476, -17.988 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.646, "simple_Twist": 5.069, "simple_hRise": 1.017, "simple_hTwist": 13.902 }, { "index": 12, "nt1": "///B/150", "nt2": "///B/153", "bp": "G-A", "name": "Sheared", "Saenger": "11-XI", "LW": "tSH", "DSSR": "tm-M" } ] }, { "index": 8, "num_stems": 5, "strand1": "AGGUCCUAACCCGCAGCCAGUCCUUGUCAACAGA", "strand2": "ACUGGGGAAGGGCGUAAGAUAGGAAUAGUUGUCU", "bp_type": ".||||||..||||||..|.||||.||||||||||", "helix_form": "x...A.x..Ax.AAx..xx.A.xxx.AAAAAAA", "helical_rise": 2.999, "helical_rise_std": 1.108, "helical_radius": 9.598, "helical_radius_std": 3.545, "helical_axis": [ -0.639, 0.454, -0.621 ], "point1": [ 93.734, 33.952, 89.804 ], "point2": [ 30.609, 78.806, 28.429 ], "num_pairs": 34, "pairs": [ { "index": 1, "nt1": "///B/198", "nt2": "///B/123", "bp": "A-A", "name": "--", "Saenger": "05-V", "LW": "tHW", "DSSR": "tM-W", "bp1_params": [ -4.251, 1.271, 1.921, -8.115, 40.313, -110.273 ], "step_params": [ 2.186, 0.710, 2.759, 17.709, 26.700, 10.628 ], "heli_params": [ -4.294, -0.111, 2.587, 60.103, -39.864, 33.712 ], "bp2_params": [ -0.178, -0.083, -0.553, -3.965, -6.950, -4.922 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.759, "simple_Twist": 32.662, "simple_hRise": 3.243, "simple_hTwist": 45.445 }, { "index": 2, "nt1": "///B/200", "nt2": "///B/121", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.178, -0.083, -0.553, -3.965, -6.950, -4.922 ], "step_params": [ 0.206, -1.912, 3.065, -10.795, -0.380, 26.642 ], "heli_params": [ -3.775, -2.678, 2.797, -0.785, 22.296, 28.711 ], "bp2_params": [ -2.712, -0.492, 0.193, 3.677, -6.631, 2.460 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.065, "simple_Twist": 40.677, "simple_hRise": 2.936, "simple_hTwist": 42.028 }, { "index": 3, "nt1": "///B/201", "nt2": "///B/120", "bp": "G-U", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -2.712, -0.492, 0.193, 3.677, -6.631, 2.460 ], "step_params": [ -0.442, -1.020, 3.152, -0.476, 4.427, 50.445 ], "heli_params": [ -1.490, 0.485, 3.062, 5.182, 0.557, 50.628 ], "bp2_params": [ 2.347, -0.660, 0.006, 9.414, -18.145, 0.345 ], "groove_widths": [ 18.541, null, 15.090, null ], "simple_Rise": 3.152, "simple_Twist": 22.976, "simple_hRise": 2.915, "simple_hTwist": 23.398 }, { "index": 4, "nt1": "///B/202", "nt2": "///B/119", "bp": "U-G", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 2.347, -0.660, 0.006, 9.414, -18.145, 0.345 ], "step_params": [ -0.367, -2.050, 3.064, 3.824, 14.570, 25.310 ], "heli_params": [ -6.445, 1.355, 1.600, 30.092, -7.897, 29.390 ], "bp2_params": [ 0.246, -0.280, -0.178, 3.806, -19.058, 1.689 ], "groove_widths": [ 16.986, 15.238, 14.411, 9.079 ], "simple_Rise": 3.064, "simple_Twist": 36.639, "simple_hRise": 2.085, "simple_hTwist": 39.516 }, { "index": 5, "nt1": "///B/203", "nt2": "///B/118", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.246, -0.280, -0.178, 3.806, -19.058, 1.689 ], "step_params": [ -0.348, -1.618, 3.497, -3.042, 9.493, 32.550 ], "heli_params": [ -4.294, 0.105, 2.943, 16.461, 5.275, 34.003 ], "bp2_params": [ 0.339, -0.145, 0.076, -3.849, -9.443, -3.166 ], "groove_widths": [ 17.225, 15.304, 14.554, 9.575 ], "simple_Rise": 3.497, "simple_Twist": 31.942, "simple_hRise": 2.929, "simple_hTwist": 33.422 }, { "index": 6, "nt1": "///B/204", "nt2": "///B/117", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.339, -0.145, 0.076, -3.849, -9.443, -3.166 ], "step_params": [ 0.413, -1.312, 3.216, 2.821, 9.126, 38.731 ], "heli_params": [ -2.921, -0.298, 2.869, 13.511, -4.177, 39.847 ], "bp2_params": [ 2.205, -0.712, 0.369, -3.330, -9.034, -3.115 ], "groove_widths": [ 18.468, 16.313, 10.796, 9.514 ], "simple_Rise": 3.216, "simple_Twist": 28.473, "simple_hRise": 2.703, "simple_hTwist": 30.002 }, { "index": 7, "nt1": "///B/205", "nt2": "///B/116", "bp": "U-G", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 2.205, -0.712, 0.369, -3.330, -9.034, -3.115 ], "step_params": [ 1.236, -1.464, 4.977, -1.898, 21.624, 65.992 ], "heli_params": [ -2.454, -1.192, 4.344, 19.322, 1.696, 69.085 ], "bp2_params": [ 6.492, -4.181, -0.627, 5.106, -2.074, -12.399 ], "groove_widths": [ 20.229, 17.602, 11.527, 9.943 ], "simple_Rise": 4.977, "simple_Twist": 35.561, "simple_hRise": 3.499, "simple_hTwist": 41.479 }, { "index": 8, "nt1": "///B/206", "nt2": "///B/114", "bp": "A-A", "name": "~Sheared", "Saenger": "--", "LW": "tSH", "DSSR": "tm-M", "bp1_params": [ 6.492, -4.181, -0.627, 5.106, -2.074, -12.399 ], "step_params": [ 0.042, -0.917, 3.422, -2.497, 2.873, -16.103 ], "heli_params": [ 1.085, -1.680, 3.496, -10.075, -8.755, -16.544 ], "bp2_params": [ -6.299, -4.109, 0.374, 3.160, -13.287, -21.553 ], "groove_widths": [ 20.914, 16.858, 12.834, 10.781 ], "simple_Rise": 3.422, "simple_Twist": 67.293, "simple_hRise": 3.382, "simple_hTwist": 67.388 }, { "index": 9, "nt1": "///B/207", "nt2": "///B/113", "bp": "A-A", "name": "~Sheared", "Saenger": "--", "LW": "tHS", "DSSR": "tM-m", "bp1_params": [ -6.299, -4.109, 0.374, 3.160, -13.287, -21.553 ], "step_params": [ 1.561, -1.070, 3.457, 0.199, 6.451, 60.713 ], "heli_params": [ -1.375, -1.528, 3.344, 6.363, -0.196, 61.022 ], "bp2_params": [ 0.231, -0.016, 0.175, 2.651, -12.604, 0.606 ], "groove_widths": [ 19.789, 15.703, 13.922, 12.374 ], "simple_Rise": 3.457, "simple_Twist": 18.498, "simple_hRise": 2.934, "simple_hTwist": 19.582 }, { "index": 10, "nt1": "///B/208", "nt2": "///B/112", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.231, -0.016, 0.175, 2.651, -12.604, 0.606 ], "step_params": [ -0.464, -1.626, 3.143, 6.658, 16.334, 28.971 ], "heli_params": [ -4.973, 1.686, 1.845, 29.457, -12.007, 33.820 ], "bp2_params": [ -0.366, -0.079, -0.396, 7.291, -1.664, -3.501 ], "groove_widths": [ 18.200, 16.117, 12.954, 11.615 ], "simple_Rise": 3.143, "simple_Twist": 31.921, "simple_hRise": 1.976, "simple_hTwist": 36.359 }, { "index": 11, "nt1": "///B/209", "nt2": "///B/111", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.366, -0.079, -0.396, 7.291, -1.664, -3.501 ], "step_params": [ -0.564, -1.260, 3.284, -2.436, 8.772, 40.451 ], "heli_params": [ -2.691, 0.545, 2.987, 12.496, 3.470, 41.421 ], "bp2_params": [ 0.640, -0.104, -0.265, 4.166, -0.627, -0.696 ], "groove_widths": [ 17.082, 15.879, 17.258, 15.781 ], "simple_Rise": 3.284, "simple_Twist": 35.356, "simple_hRise": 2.930, "simple_hTwist": 36.473 }, { "index": 12, "nt1": "///B/211", "nt2": "///B/110", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.640, -0.104, -0.265, 4.166, -0.627, -0.696 ], "step_params": [ 0.370, -2.348, 4.093, 1.075, 0.322, 26.165 ], "heli_params": [ -5.290, -0.453, 4.076, 0.711, -2.374, 26.189 ], "bp2_params": [ 0.007, -0.057, -0.383, -10.801, -9.497, -0.631 ], "groove_widths": [ 16.160, 14.764, 18.711, 18.433 ], "simple_Rise": 4.093, "simple_Twist": 29.463, "simple_hRise": 4.079, "simple_hTwist": 29.484 }, { "index": 13, "nt1": "///B/212", "nt2": "///B/109", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.007, -0.057, -0.383, -10.801, -9.497, -0.631 ], "step_params": [ -0.748, -2.143, 2.952, -4.187, -1.029, 28.815 ], "heli_params": [ -4.052, 0.636, 3.100, -2.054, 8.355, 29.130 ], "bp2_params": [ -0.119, -0.191, -0.027, 0.900, -9.015, 2.878 ], "groove_widths": [ 16.370, 14.967, 20.793, 19.543 ], "simple_Rise": 2.952, "simple_Twist": 29.741, "simple_hRise": 3.096, "simple_hTwist": 30.045 }, { "index": 14, "nt1": "///B/213", "nt2": "///B/108", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.119, -0.191, -0.027, 0.900, -9.015, 2.878 ], "step_params": [ 0.688, -2.010, 3.402, 0.748, 8.880, 31.786 ], "heli_params": [ -4.993, -1.090, 2.770, 15.828, -1.333, 32.981 ], "bp2_params": [ 0.439, 0.030, -0.291, -3.686, 1.856, 3.885 ], "groove_widths": [ 16.765, 15.368, 18.711, 17.491 ], "simple_Rise": 3.402, "simple_Twist": 28.927, "simple_hRise": 2.696, "simple_hTwist": 30.240 }, { "index": 15, "nt1": "///B/214", "nt2": "///B/107", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.439, 0.030, -0.291, -3.686, 1.856, 3.885 ], "step_params": [ 0.574, -2.784, 3.271, -4.003, -1.154, 39.039 ], "heli_params": [ -4.006, -1.334, 3.276, -1.721, 5.969, 39.252 ], "bp2_params": [ -0.153, 1.553, -0.335, 10.210, -1.673, -15.977 ], "groove_widths": [ 16.617, 14.877, 17.276, 15.658 ], "simple_Rise": 3.271, "simple_Twist": 41.985, "simple_hRise": 3.277, "simple_hTwist": 42.182 }, { "index": 16, "nt1": "///B/215", "nt2": "///B/105", "bp": "G-A", "name": "Imino", "Saenger": "08-VIII", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.153, 1.553, -0.335, 10.210, -1.673, -15.977 ], "step_params": [ 0.591, -1.508, 3.097, -6.924, 4.888, 39.993 ], "heli_params": [ -2.648, -1.537, 2.766, 7.051, 9.987, 40.845 ], "bp2_params": [ 1.292, -0.346, 0.128, 19.021, -16.182, -5.447 ], "groove_widths": [ 18.302, 14.061, 20.389, 19.484 ], "simple_Rise": 3.097, "simple_Twist": 32.937, "simple_hRise": 2.676, "simple_hTwist": 33.981 }, { "index": 17, "nt1": "///B/216", "nt2": "///B/104", "bp": "C-A", "name": "--", "Saenger": "--", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 1.292, -0.346, 0.128, 19.021, -16.182, -5.447 ], "step_params": [ 0.597, -2.499, 3.824, 3.151, 2.713, 27.084 ], "heli_params": [ -6.043, -0.370, 3.606, 5.751, -6.679, 27.395 ], "bp2_params": [ 0.202, -0.088, -0.467, -3.618, -2.914, 4.875 ], "groove_widths": [ 17.881, 13.344, 16.080, 15.041 ], "simple_Rise": 3.824, "simple_Twist": 32.278, "simple_hRise": 3.648, "simple_hTwist": 32.538 }, { "index": 18, "nt1": "///B/217", "nt2": "///B/103", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.202, -0.088, -0.467, -3.618, -2.914, 4.875 ], "step_params": [ -0.423, -1.871, 3.120, 8.166, 9.485, 48.820 ], "heli_params": [ -2.809, 1.021, 2.638, 11.262, -9.696, 50.303 ], "bp2_params": [ -6.611, 0.172, 0.440, -6.369, -13.956, -2.567 ], "groove_widths": [ 16.020, 13.588, 9.689, 8.259 ], "simple_Rise": 3.120, "simple_Twist": 137.714, "simple_hRise": 3.045, "simple_hTwist": 137.978 }, { "index": 19, "nt1": "///B/219", "nt2": "///B/218", "bp": "A+A", "name": "Platform", "Saenger": "--", "LW": "cHS", "DSSR": "cM+m", "bp1_params": [ -6.611, 0.172, 0.440, -6.369, -13.956, -2.567 ], "step_params": [ 0.613, 1.544, 3.476, -9.283, 0.771, 56.248 ], "heli_params": [ 1.575, -1.183, 3.364, 0.811, 9.772, 56.952 ], "bp2_params": [ -2.150, -0.544, 0.460, 4.769, -7.620, 0.137 ], "groove_widths": [ 16.232, 12.038, 10.174, 10.110 ], "simple_Rise": 3.476, "simple_Twist": -19.928, "simple_hRise": 3.358, "simple_hTwist": -21.977 }, { "index": 20, "nt1": "///B/220", "nt2": "///B/253", "bp": "G-U", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -2.150, -0.544, 0.460, 4.769, -7.620, 0.137 ], "step_params": [ -0.315, -1.425, 3.290, -3.124, 2.234, 37.339 ], "heli_params": [ -2.506, 0.083, 3.217, 3.478, 4.864, 37.529 ], "bp2_params": [ -0.106, -0.098, 0.373, 6.829, -14.124, 1.150 ], "groove_widths": [ 18.409, 15.184, 13.768, 12.532 ], "simple_Rise": 3.290, "simple_Twist": 26.435, "simple_hRise": 3.176, "simple_hTwist": 26.707 }, { "index": 21, "nt1": "///B/221", "nt2": "///B/252", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.106, -0.098, 0.373, 6.829, -14.124, 1.150 ], "step_params": [ 0.266, -1.164, 3.071, 2.250, 0.547, 36.167 ], "heli_params": [ -1.943, -0.132, 3.064, 0.880, -3.619, 36.239 ], "bp2_params": [ 0.473, 0.002, -0.105, 15.058, -17.853, 3.294 ], "groove_widths": [ 18.386, 18.174, 14.365, 11.579 ], "simple_Rise": 3.071, "simple_Twist": 33.702, "simple_hRise": 3.063, "simple_hTwist": 33.779 }, { "index": 22, "nt1": "///B/222", "nt2": "///B/251", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.473, 0.002, -0.105, 15.058, -17.853, 3.294 ], "step_params": [ -1.012, -2.083, 3.547, -3.854, 7.957, 31.485 ], "heli_params": [ -5.118, 1.113, 3.043, 14.314, 6.933, 32.673 ], "bp2_params": [ 0.382, -0.182, -0.072, 1.601, -13.424, -1.891 ], "groove_widths": [ 15.134, 13.814, 10.678, 10.365 ], "simple_Rise": 3.547, "simple_Twist": 31.338, "simple_hRise": 3.040, "simple_hTwist": 32.532 }, { "index": 23, "nt1": "///B/223", "nt2": "///B/250", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.382, -0.182, -0.072, 1.601, -13.424, -1.891 ], "step_params": [ -2.351, -1.845, 3.862, 10.091, 5.432, 73.636 ], "heli_params": [ -1.716, 2.297, 3.439, 4.505, -8.370, 74.397 ], "bp2_params": [ 4.271, -2.637, -0.870, -17.930, -2.367, -83.255 ], "groove_widths": [ 16.150, 10.242, 20.545, 19.633 ], "simple_Rise": 3.862, "simple_Twist": 48.406, "simple_hRise": 3.132, "simple_hTwist": 49.665 }, { "index": 24, "nt1": "///B/224", "nt2": "///B/248", "bp": "U-A", "name": "rHoogsteen", "Saenger": "24-XXIV", "LW": "tWH", "DSSR": "tW-M", "bp1_params": [ 4.271, -2.637, -0.870, -17.930, -2.367, -83.255 ], "step_params": [ -0.746, 2.890, 4.549, -22.512, -21.286, 165.281 ], "heli_params": [ 1.510, 0.319, 4.496, -10.727, 11.345, 165.819 ], "bp2_params": [ 0.198, -0.267, -0.316, 21.703, 32.663, -15.069 ], "groove_widths": [ 17.973, 12.613, 10.825, 10.589 ], "simple_Rise": 4.549, "simple_Twist": -165.040, "simple_hRise": 4.597, "simple_hTwist": -165.587 }, { "index": 25, "nt1": "///B/249", "nt2": "///B/226", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.198, -0.267, -0.316, 21.703, 32.663, -15.069 ], "step_params": [ -0.236, -4.980, 2.397, 36.225, 2.681, -123.340 ], "heli_params": [ 2.773, 0.095, 2.464, -1.509, 20.384, -126.397 ], "bp2_params": [ -2.195, -0.707, 0.039, -4.497, -6.819, -0.641 ], "groove_widths": [ 17.213, 15.519, 10.617, 10.538 ], "simple_Rise": 2.397, "simple_Twist": -113.840, "simple_hRise": 2.469, "simple_hTwist": -117.521 }, { "index": 26, "nt1": "///B/227", "nt2": "///B/247", "bp": "G-U", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -2.195, -0.707, 0.039, -4.497, -6.819, -0.641 ], "step_params": [ -0.197, -1.213, 3.056, -1.401, 8.068, 40.055 ], "heli_params": [ -2.537, 0.144, 2.776, 11.632, 2.020, 40.850 ], "bp2_params": [ -0.009, -0.052, -0.134, 6.816, -10.675, -2.425 ], "groove_widths": [ 16.663, 14.983, 22.166, 21.321 ], "simple_Rise": 3.056, "simple_Twist": 28.088, "simple_hRise": 2.620, "simple_hTwist": 29.234 }, { "index": 27, "nt1": "///B/228", "nt2": "///B/246", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.009, -0.052, -0.134, 6.816, -10.675, -2.425 ], "step_params": [ -0.113, -1.233, 3.285, -0.133, 8.745, 34.288 ], "heli_params": [ -3.268, 0.167, 2.894, 14.541, 0.221, 35.354 ], "bp2_params": [ 0.355, -0.221, -0.038, 6.225, -4.668, -2.180 ], "groove_widths": [ 17.121, 16.331, 14.926, 14.545 ], "simple_Rise": 3.285, "simple_Twist": 32.298, "simple_hRise": 2.863, "simple_hTwist": 33.431 }, { "index": 28, "nt1": "///B/229", "nt2": "///B/245", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.355, -0.221, -0.038, 6.225, -4.668, -2.180 ], "step_params": [ 0.124, -1.850, 2.992, -1.935, 8.651, 27.711 ], "heli_params": [ -5.262, -0.599, 2.307, 17.504, 3.914, 29.068 ], "bp2_params": [ -0.072, -0.249, 0.428, 10.532, -7.381, -2.222 ], "groove_widths": [ 17.455, 16.703, 15.230, 11.158 ], "simple_Rise": 2.992, "simple_Twist": 29.870, "simple_hRise": 2.364, "simple_hTwist": 31.129 }, { "index": 29, "nt1": "///B/230", "nt2": "///B/244", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.072, -0.249, 0.428, 10.532, -7.381, -2.222 ], "step_params": [ -0.402, -1.503, 3.508, 2.538, 9.854, 33.744 ], "heli_params": [ -3.961, 1.045, 2.930, 16.514, -4.253, 35.202 ], "bp2_params": [ 0.024, -0.239, 0.123, -2.482, -13.593, -1.997 ], "groove_widths": [ 17.444, 16.121, 15.026, 11.055 ], "simple_Rise": 3.508, "simple_Twist": 33.290, "simple_hRise": 2.920, "simple_hTwist": 34.768 }, { "index": 30, "nt1": "///B/231", "nt2": "///B/243", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.024, -0.239, 0.123, -2.482, -13.593, -1.997 ], "step_params": [ 0.652, -1.264, 2.904, 0.145, 6.541, 33.430 ], "heli_params": [ -3.047, -1.095, 2.620, 11.238, -0.250, 34.046 ], "bp2_params": [ 0.201, -0.194, 0.320, 5.555, -9.945, 2.073 ], "groove_widths": [ 17.338, 16.032, 14.891, 11.072 ], "simple_Rise": 2.904, "simple_Twist": 32.612, "simple_hRise": 2.612, "simple_hTwist": 33.245 }, { "index": 31, "nt1": "///B/232", "nt2": "///B/242", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.201, -0.194, 0.320, 5.555, -9.945, 2.073 ], "step_params": [ 0.069, -1.742, 3.108, -1.099, 11.155, 29.706 ], "heli_params": [ -4.950, -0.300, 2.315, 20.846, 2.053, 31.706 ], "bp2_params": [ -0.234, -0.288, 0.476, -3.534, -8.705, 0.288 ], "groove_widths": [ 16.901, null, 15.808, null ], "simple_Rise": 3.108, "simple_Twist": 32.052, "simple_hRise": 2.382, "simple_hTwist": 33.907 }, { "index": 32, "nt1": "///B/233", "nt2": "///B/241", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.234, -0.288, 0.476, -3.534, -8.705, 0.288 ], "step_params": [ -0.318, -1.775, 3.451, 5.581, 6.973, 32.504 ], "heli_params": [ -4.192, 1.452, 2.926, 12.172, -9.743, 33.677 ], "bp2_params": [ -0.851, -0.081, -0.159, -11.472, -22.783, -7.061 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.451, "simple_Twist": 35.266, "simple_hRise": 2.975, "simple_hTwist": 36.344 }, { "index": 33, "nt1": "///B/234", "nt2": "///B/240", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.851, -0.081, -0.159, -11.472, -22.783, -7.061 ], "step_params": [ -0.201, -1.425, 3.228, -4.270, 2.668, 33.444 ], "heli_params": [ -2.870, -0.327, 3.109, 4.603, 7.368, 33.810 ], "bp2_params": [ -0.207, -0.412, 0.117, -2.724, -24.672, -17.112 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.228, "simple_Twist": 30.142, "simple_hRise": 3.091, "simple_hTwist": 30.550 }, { "index": 34, "nt1": "///B/235", "nt2": "///B/239", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W" } ] } ], "num_stems": 22, "stems": [ { "index": 1, "helix_index": 1, "strand1": "UGCG", "strand2": "ACGC", "bp_type": "||||", "helix_form": "AAA", "helical_rise": 3.293, "helical_rise_std": 0.159, "helical_radius": 10.013, "helical_radius_std": 1.032, "helical_axis": [ -0.626, -0.477, -0.617 ], "point1": [ 43.553, 53.504, 84.980 ], "point2": [ 37.355, 48.779, 78.875 ], "num_pairs": 4, "pairs": [ { "index": 1, "nt1": "///A/107", "nt2": "///A/214", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.300, -0.194, -0.315, -1.638, 4.694, 5.794 ], "step_params": [ -0.736, -1.783, 3.344, 2.467, 6.373, 29.145 ], "heli_params": [ -4.715, 1.914, 2.829, 12.450, -4.819, 29.918 ], "bp2_params": [ 0.048, -0.324, -0.305, -1.030, -10.783, 0.942 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.344, "simple_Twist": 27.387, "simple_hRise": 2.790, "simple_hTwist": 28.211 }, { "index": 2, "nt1": "///A/108", "nt2": "///A/213", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.048, -0.324, -0.305, -1.030, -10.783, 0.942 ], "step_params": [ 0.828, -1.953, 2.950, 3.556, -1.339, 27.946 ], "heli_params": [ -3.717, -0.926, 3.117, -2.756, -7.319, 28.198 ], "bp2_params": [ -0.184, -0.045, -0.578, 13.397, -11.493, -2.059 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.950, "simple_Twist": 29.301, "simple_hRise": 3.110, "simple_hTwist": 29.541 }, { "index": 3, "nt1": "///A/109", "nt2": "///A/212", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.184, -0.045, -0.578, 13.397, -11.493, -2.059 ], "step_params": [ -0.319, -2.120, 4.133, -2.247, 5.065, 30.369 ], "heli_params": [ -5.180, 0.069, 3.752, 9.568, 4.244, 30.859 ], "bp2_params": [ -0.561, -0.308, -0.189, -6.162, -4.297, -2.825 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 4.133, "simple_Twist": 32.325, "simple_hRise": 3.779, "simple_hTwist": 32.784 }, { "index": 4, "nt1": "///A/110", "nt2": "///A/211", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 2, "helix_index": 1, "strand1": "GG", "strand2": "CC", "bp_type": "||", "helix_form": "A", "helical_rise": 2.675, "helical_rise_std": 0.040, "helical_radius": 9.108, "helical_radius_std": 1.546, "helical_axis": [ -0.710, -0.160, -0.686 ], "point1": [ 33.167, 48.129, 77.467 ], "point2": [ 31.268, 47.702, 75.633 ], "num_pairs": 2, "pairs": [ { "index": 1, "nt1": "///A/111", "nt2": "///A/209", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.110, 0.011, 0.024, -1.207, -3.609, -1.770 ], "step_params": [ 0.394, -1.491, 3.140, -4.059, 8.078, 30.129 ], "heli_params": [ -4.108, -1.408, 2.589, 15.117, 7.596, 31.426 ], "bp2_params": [ -0.114, -0.142, 0.391, 6.697, -9.078, 2.995 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.140, "simple_Twist": 30.656, "simple_hRise": 2.601, "simple_hTwist": 31.930 }, { "index": 2, "nt1": "///A/112", "nt2": "///A/208", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 3, "helix_index": 1, "strand1": "GGGGUC", "strand2": "UCCUGG", "bp_type": "||||||", "helix_form": ".A...", "helical_rise": 2.460, "helical_rise_std": 0.303, "helical_radius": 8.957, "helical_radius_std": 0.506, "helical_axis": [ -0.739, -0.248, -0.627 ], "point1": [ 25.605, 41.670, 67.975 ], "point2": [ 16.606, 38.648, 60.344 ], "num_pairs": 6, "pairs": [ { "index": 1, "nt1": "///A/116", "nt2": "///A/205", "bp": "G-U", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -1.694, 0.064, 0.228, -4.684, -7.954, 9.454 ], "step_params": [ -0.848, -0.930, 2.904, -2.359, 9.648, 32.018 ], "heli_params": [ -2.978, 1.138, 2.577, 16.987, 4.154, 33.484 ], "bp2_params": [ -0.354, -0.251, 0.112, 10.419, -12.082, -2.243 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.904, "simple_Twist": 25.217, "simple_hRise": 2.455, "simple_hTwist": 27.073 }, { "index": 2, "nt1": "///A/117", "nt2": "///A/204", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.354, -0.251, 0.112, 10.419, -12.082, -2.243 ], "step_params": [ 0.479, -1.581, 3.474, 0.324, 16.081, 29.537 ], "heli_params": [ -5.242, -0.780, 2.332, 28.991, -0.583, 33.547 ], "bp2_params": [ -0.342, -0.365, -0.259, 2.356, -8.841, -0.328 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.474, "simple_Twist": 29.550, "simple_hRise": 2.333, "simple_hTwist": 33.558 }, { "index": 3, "nt1": "///A/118", "nt2": "///A/203", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.342, -0.365, -0.259, 2.356, -8.841, -0.328 ], "step_params": [ 0.260, -1.899, 3.293, -5.213, 12.709, 27.263 ], "heli_params": [ -5.841, -1.409, 2.132, 25.046, 10.274, 30.469 ], "bp2_params": [ -2.002, -0.637, -0.171, -8.284, -12.123, 1.084 ], "groove_widths": [ 17.063, null, 15.156, null ], "simple_Rise": 3.293, "simple_Twist": 36.199, "simple_hRise": 2.454, "simple_hTwist": 38.636 }, { "index": 4, "nt1": "///A/119", "nt2": "///A/202", "bp": "G-U", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -2.002, -0.637, -0.171, -8.284, -12.123, 1.084 ], "step_params": [ 0.151, -0.973, 2.969, 0.971, 1.779, 46.551 ], "heli_params": [ -1.364, -0.117, 2.935, 2.250, -1.228, 46.592 ], "bp2_params": [ 2.210, -0.522, -0.159, 4.155, -11.524, 4.160 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.969, "simple_Twist": 23.206, "simple_hRise": 2.891, "simple_hTwist": 23.293 }, { "index": 5, "nt1": "///A/120", "nt2": "///A/201", "bp": "U-G", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 2.210, -0.522, -0.159, 4.155, -11.524, 4.160 ], "step_params": [ -0.384, -2.064, 3.341, 2.744, 5.600, 31.054 ], "heli_params": [ -4.777, 1.191, 2.890, 10.329, -5.062, 31.659 ], "bp2_params": [ 0.608, -0.331, -0.232, 0.489, 7.042, -3.508 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.341, "simple_Twist": 40.179, "simple_hRise": 3.007, "simple_hTwist": 40.641 }, { "index": 6, "nt1": "///A/121", "nt2": "///A/200", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 4, "helix_index": 2, "strand1": "CCGU", "strand2": "GGCA", "bp_type": "||||", "helix_form": "AA.", "helical_rise": 2.053, "helical_rise_std": 0.310, "helical_radius": 8.789, "helical_radius_std": 0.697, "helical_axis": [ 0.652, 0.547, 0.525 ], "point1": [ 17.829, 59.313, 56.948 ], "point2": [ 21.705, 62.565, 60.066 ], "num_pairs": 4, "pairs": [ { "index": 1, "nt1": "///A/127", "nt2": "///A/195", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.227, 0.118, -0.572, 27.822, -27.144, -6.296 ], "step_params": [ 0.219, -1.817, 3.588, -6.513, 11.303, 40.127 ], "heli_params": [ -3.722, -0.992, 2.926, 15.971, 9.202, 42.111 ], "bp2_params": [ 0.585, -0.181, 0.257, 7.996, -13.926, 1.082 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.588, "simple_Twist": 36.519, "simple_hRise": 2.845, "simple_hTwist": 38.705 }, { "index": 2, "nt1": "///A/128", "nt2": "///A/194", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.585, -0.181, 0.257, 7.996, -13.926, 1.082 ], "step_params": [ -0.187, -1.580, 3.436, 4.209, 12.032, 33.929 ], "heli_params": [ -4.189, 0.877, 2.697, 19.773, -6.917, 36.178 ], "bp2_params": [ 0.719, -0.124, -0.298, -11.953, -17.238, 1.814 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.436, "simple_Twist": 32.576, "simple_hRise": 2.660, "simple_hTwist": 34.918 }, { "index": 3, "nt1": "///A/129", "nt2": "///A/193", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.719, -0.124, -0.298, -11.953, -17.238, 1.814 ], "step_params": [ -2.020, -1.851, 3.390, -8.686, 16.021, 33.694 ], "heli_params": [ -4.839, 1.999, 2.696, 25.460, 13.804, 38.180 ], "bp2_params": [ 0.731, -0.210, 0.735, -17.631, -13.799, -25.932 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.390, "simple_Twist": 33.876, "simple_hRise": 2.701, "simple_hTwist": 38.340 }, { "index": 4, "nt1": "///A/130", "nt2": "///A/192", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 5, "helix_index": 2, "strand1": "CAG", "strand2": "GUC", "bp_type": "|||", "helix_form": "AA", "helical_rise": 1.790, "helical_rise_std": 0.134, "helical_radius": 8.766, "helical_radius_std": 0.875, "helical_axis": [ 0.363, 0.867, 0.341 ], "point1": [ 24.780, 67.093, 61.425 ], "point2": [ 26.007, 70.023, 62.578 ], "num_pairs": 3, "pairs": [ { "index": 1, "nt1": "///A/132", "nt2": "///A/191", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.278, 0.030, -0.301, 5.210, -5.213, -7.701 ], "step_params": [ -0.481, -1.871, 3.233, -6.718, 8.083, 32.046 ], "heli_params": [ -4.461, -0.194, 2.737, 14.173, 11.779, 33.683 ], "bp2_params": [ 0.276, -0.194, 0.202, -2.827, -10.699, 3.347 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.233, "simple_Twist": 31.789, "simple_hRise": 2.732, "simple_hTwist": 33.439 }, { "index": 2, "nt1": "///A/133", "nt2": "///A/190", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.276, -0.194, 0.202, -2.827, -10.699, 3.347 ], "step_params": [ -0.036, -1.623, 3.473, 2.202, 7.245, 29.489 ], "heli_params": [ -4.548, 0.511, 2.988, 13.945, -4.239, 30.425 ], "bp2_params": [ -0.711, -0.194, -0.348, -15.193, -17.380, 3.769 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.473, "simple_Twist": 34.727, "simple_hRise": 3.075, "simple_hTwist": 35.518 }, { "index": 3, "nt1": "///A/134", "nt2": "///A/189", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 6, "helix_index": 2, "strand1": "ACC", "strand2": "UGG", "bp_type": "|||", "helix_form": "A.", "helical_rise": 1.284, "helical_rise_std": 0.176, "helical_radius": 8.558, "helical_radius_std": 0.640, "helical_axis": [ -0.021, 0.746, 0.665 ], "point1": [ 27.616, 76.735, 66.492 ], "point2": [ 27.566, 78.524, 68.087 ], "num_pairs": 3, "pairs": [ { "index": 1, "nt1": "///A/136", "nt2": "///A/182", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.219, 0.100, -0.549, -9.464, -14.778, -3.957 ], "step_params": [ 0.735, -1.397, 2.895, -3.797, 3.334, 36.553 ], "heli_params": [ -2.594, -1.602, 2.674, 5.285, 6.018, 36.889 ], "bp2_params": [ 0.425, -0.211, 0.027, 1.756, -27.408, 1.191 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.895, "simple_Twist": 35.664, "simple_hRise": 2.668, "simple_hTwist": 36.008 }, { "index": 2, "nt1": "///A/137", "nt2": "///A/181", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.425, -0.211, 0.027, 1.756, -27.408, 1.191 ], "step_params": [ -1.070, -2.056, 3.201, -1.139, 15.868, 27.903 ], "heli_params": [ -6.089, 1.769, 1.836, 30.018, 2.154, 32.041 ], "bp2_params": [ 0.270, -0.347, 0.031, 0.494, -5.388, -5.031 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.201, "simple_Twist": 28.531, "simple_hRise": 1.868, "simple_hTwist": 32.586 }, { "index": 3, "nt1": "///A/138", "nt2": "///A/180", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 7, "helix_index": 3, "strand1": "GUCUCAGGG", "strand2": "UAGAGUUUC", "bp_type": "|||||||||", "helix_form": ".AAAA...", "helical_rise": 2.623, "helical_rise_std": 0.258, "helical_radius": 8.916, "helical_radius_std": 0.575, "helical_axis": [ 0.536, 0.237, 0.810 ], "point1": [ 40.690, 77.605, 80.940 ], "point2": [ 51.865, 82.551, 97.824 ], "num_pairs": 9, "pairs": [ { "index": 1, "nt1": "///A/141", "nt2": "///A/162", "bp": "G-U", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -2.187, -0.742, -0.105, 9.346, -18.418, 0.149 ], "step_params": [ -0.160, -1.355, 3.389, -0.202, 2.397, 43.690 ], "heli_params": [ -2.053, 0.195, 3.314, 3.218, 0.272, 43.753 ], "bp2_params": [ 0.042, -0.330, -0.180, 4.055, -18.047, -1.046 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.389, "simple_Twist": 30.794, "simple_hRise": 3.277, "simple_hTwist": 30.886 }, { "index": 2, "nt1": "///A/142", "nt2": "///A/161", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.042, -0.330, -0.180, 4.055, -18.047, -1.046 ], "step_params": [ -0.257, -1.585, 3.385, -1.124, 5.411, 32.311 ], "heli_params": [ -3.739, 0.262, 3.093, 9.636, 2.001, 32.768 ], "bp2_params": [ 0.348, -0.136, -0.013, -0.555, -9.706, -1.175 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.385, "simple_Twist": 30.600, "simple_hRise": 3.074, "simple_hTwist": 31.083 }, { "index": 3, "nt1": "///A/143", "nt2": "///A/160", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.348, -0.136, -0.013, -0.555, -9.706, -1.175 ], "step_params": [ 0.125, -1.302, 3.183, 0.216, 6.844, 29.960 ], "heli_params": [ -3.708, -0.196, 2.823, 13.026, -0.411, 30.715 ], "bp2_params": [ 0.081, -0.000, 0.120, 2.161, -13.466, 3.279 ], "groove_widths": [ 17.268, null, 15.189, null ], "simple_Rise": 3.183, "simple_Twist": 31.564, "simple_hRise": 2.845, "simple_hTwist": 32.280 }, { "index": 4, "nt1": "///A/144", "nt2": "///A/159", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.081, -0.000, 0.120, 2.161, -13.466, 3.279 ], "step_params": [ 0.293, -1.031, 3.170, 0.985, 7.368, 35.159 ], "heli_params": [ -2.662, -0.343, 2.909, 12.031, -1.608, 35.912 ], "bp2_params": [ 0.532, -0.076, 0.206, 5.901, -3.601, 2.409 ], "groove_widths": [ 17.767, 16.420, 15.206, 12.331 ], "simple_Rise": 3.170, "simple_Twist": 32.609, "simple_hRise": 2.883, "simple_hTwist": 33.423 }, { "index": 5, "nt1": "///A/145", "nt2": "///A/158", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.532, -0.076, 0.206, 5.901, -3.601, 2.409 ], "step_params": [ -0.327, -1.375, 3.076, 1.596, 12.993, 30.207 ], "heli_params": [ -4.336, 0.812, 2.287, 23.589, -2.897, 32.861 ], "bp2_params": [ 0.176, -0.351, 0.045, 2.706, -9.562, 1.490 ], "groove_widths": [ 17.658, 16.068, 15.184, 11.150 ], "simple_Rise": 3.076, "simple_Twist": 32.123, "simple_hRise": 2.343, "simple_hTwist": 34.623 }, { "index": 6, "nt1": "///A/146", "nt2": "///A/157", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.176, -0.351, 0.045, 2.706, -9.562, 1.490 ], "step_params": [ -0.170, -1.560, 2.983, -3.414, 16.263, 25.266 ], "heli_params": [ -5.589, -0.218, 1.698, 33.014, 6.931, 30.166 ], "bp2_params": [ -2.164, -0.695, -0.363, -0.398, -8.523, 2.603 ], "groove_widths": [ 17.494, null, 15.163, null ], "simple_Rise": 2.983, "simple_Twist": 38.530, "simple_hRise": 2.186, "simple_hTwist": 41.836 }, { "index": 7, "nt1": "///A/147", "nt2": "///A/156", "bp": "G-U", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -2.164, -0.695, -0.363, -0.398, -8.523, 2.603 ], "step_params": [ 0.180, -1.647, 3.353, -7.907, 10.318, 33.034 ], "heli_params": [ -4.143, -1.397, 2.627, 17.333, 13.283, 35.433 ], "bp2_params": [ -2.375, -0.438, -0.285, -8.373, -4.512, 3.781 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.353, "simple_Twist": 33.946, "simple_hRise": 2.651, "simple_hTwist": 36.281 }, { "index": 8, "nt1": "///A/148", "nt2": "///A/155", "bp": "G-U", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -2.375, -0.438, -0.285, -8.373, -4.512, 3.781 ], "step_params": [ -0.321, -1.818, 3.290, -2.001, 2.953, 36.293 ], "heli_params": [ -3.308, 0.239, 3.150, 4.726, 3.203, 36.462 ], "bp2_params": [ -0.397, -0.022, -0.237, -5.768, 7.315, 4.164 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.290, "simple_Twist": 25.529, "simple_hRise": 3.079, "simple_hTwist": 25.773 }, { "index": 9, "nt1": "///A/149", "nt2": "///A/154", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 8, "helix_index": 4, "strand1": "CC", "strand2": "GG", "bp_type": "||", "helix_form": "A", "helical_rise": 2.691, "helical_rise_std": 0.021, "helical_radius": 8.511, "helical_radius_std": 1.602, "helical_axis": [ 0.105, -0.985, 0.136 ], "point1": [ 48.720, 73.293, 66.617 ], "point2": [ 49.003, 70.642, 66.983 ], "num_pairs": 2, "pairs": [ { "index": 1, "nt1": "///A/165", "nt2": "///A/175", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.042, -0.225, -0.593, -3.948, -12.551, 2.184 ], "step_params": [ -0.074, -1.083, 3.280, 0.727, 11.972, 32.013 ], "heli_params": [ -3.643, 0.236, 2.711, 20.817, -1.264, 34.131 ], "bp2_params": [ 0.177, -0.084, -0.033, -1.581, -8.503, -0.988 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.280, "simple_Twist": 31.383, "simple_hRise": 2.696, "simple_hTwist": 33.543 }, { "index": 2, "nt1": "///A/166", "nt2": "///A/174", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 9, "helix_index": 4, "strand1": "GC", "strand2": "CG", "bp_type": "||", "helix_form": "A", "helical_rise": 3.210, "helical_rise_std": 0.003, "helical_radius": 9.097, "helical_radius_std": 1.454, "helical_axis": [ -0.411, 0.888, -0.205 ], "point1": [ 53.583, 56.928, 64.001 ], "point2": [ 52.265, 59.780, 63.344 ], "num_pairs": 2, "pairs": [ { "index": 1, "nt1": "///A/169", "nt2": "///B/255", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.364, -0.247, -0.635, -4.222, -9.258, 3.282 ], "step_params": [ -0.630, -2.018, 3.450, -5.674, 1.522, 40.713 ], "heli_params": [ -3.048, 0.247, 3.430, 2.175, 8.104, 41.117 ], "bp2_params": [ 0.517, -0.198, 0.188, -15.147, 1.520, 0.318 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.450, "simple_Twist": 35.849, "simple_hRise": 3.421, "simple_hTwist": 36.312 }, { "index": 2, "nt1": "///A/170", "nt2": "///B/254", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 10, "helix_index": 1, "strand1": "GUCC", "strand2": "UAGG", "bp_type": "||||", "helix_form": ".AA", "helical_rise": 3.151, "helical_rise_std": 0.203, "helical_radius": 9.137, "helical_radius_std": 0.788, "helical_axis": [ 0.744, 0.567, 0.354 ], "point1": [ 56.004, 59.313, 96.827 ], "point2": [ 63.040, 64.668, 100.170 ], "num_pairs": 4, "pairs": [ { "index": 1, "nt1": "///A/220", "nt2": "///A/253", "bp": "G-U", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -2.147, -0.617, 0.652, 7.759, -6.833, -0.648 ], "step_params": [ -0.352, -1.389, 3.309, -2.027, 3.346, 38.272 ], "heli_params": [ -2.523, 0.283, 3.195, 5.087, 3.082, 38.464 ], "bp2_params": [ -0.062, -0.102, 0.385, 9.247, -11.345, -1.450 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.309, "simple_Twist": 27.054, "simple_hRise": 3.135, "simple_hTwist": 27.330 }, { "index": 2, "nt1": "///A/221", "nt2": "///A/252", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.062, -0.102, 0.385, 9.247, -11.345, -1.450 ], "step_params": [ 0.375, -1.234, 3.165, 2.740, 0.805, 36.064 ], "heli_params": [ -2.098, -0.231, 3.156, 1.298, -4.418, 36.173 ], "bp2_params": [ 0.465, -0.132, -0.055, 13.792, -19.698, 1.648 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.165, "simple_Twist": 33.724, "simple_hRise": 3.155, "simple_hTwist": 33.842 }, { "index": 3, "nt1": "///A/222", "nt2": "///A/251", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.465, -0.132, -0.055, 13.792, -19.698, 1.648 ], "step_params": [ -0.929, -2.078, 3.523, -3.932, 6.881, 31.459 ], "heli_params": [ -4.968, 0.953, 3.101, 12.445, 7.111, 32.417 ], "bp2_params": [ 0.368, -0.159, -0.129, 4.392, -10.303, -2.766 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.523, "simple_Twist": 31.579, "simple_hRise": 3.103, "simple_hTwist": 32.534 }, { "index": 4, "nt1": "///A/223", "nt2": "///A/250", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 11, "helix_index": 1, "strand1": "GUCAACAGA", "strand2": "UAGUUGUCU", "bp_type": "|||||||||", "helix_form": ".AAAAAAA", "helical_rise": 2.724, "helical_rise_std": 0.223, "helical_radius": 9.164, "helical_radius_std": 0.849, "helical_axis": [ 0.662, 0.426, 0.617 ], "point1": [ 68.980, 72.900, 104.401 ], "point2": [ 83.361, 82.146, 117.797 ], "num_pairs": 9, "pairs": [ { "index": 1, "nt1": "///A/227", "nt2": "///A/247", "bp": "G-U", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -2.214, -0.606, 0.082, -6.747, -9.534, -0.544 ], "step_params": [ -0.229, -1.294, 3.011, -2.031, 6.350, 39.227 ], "heli_params": [ -2.560, 0.126, 2.785, 9.377, 2.999, 39.768 ], "bp2_params": [ -0.024, 0.024, -0.007, 5.817, -11.313, -0.486 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.011, "simple_Twist": 27.417, "simple_hRise": 2.659, "simple_hTwist": 28.201 }, { "index": 2, "nt1": "///A/228", "nt2": "///A/246", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.024, 0.024, -0.007, 5.817, -11.313, -0.486 ], "step_params": [ -0.105, -1.299, 3.235, -1.088, 10.052, 35.098 ], "heli_params": [ -3.379, 0.026, 2.773, 16.256, 1.759, 36.481 ], "bp2_params": [ 0.306, -0.225, 0.072, 5.472, -5.017, -0.479 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.235, "simple_Twist": 33.044, "simple_hRise": 2.737, "simple_hTwist": 34.515 }, { "index": 3, "nt1": "///A/229", "nt2": "///A/245", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.306, -0.225, 0.072, 5.472, -5.017, -0.479 ], "step_params": [ 0.046, -1.871, 3.021, -2.150, 9.104, 28.652 ], "heli_params": [ -5.160, -0.457, 2.321, 17.805, 4.206, 30.110 ], "bp2_params": [ -0.068, -0.198, 0.512, 5.319, -3.332, -2.067 ], "groove_widths": [ 17.444, null, 15.215, null ], "simple_Rise": 3.021, "simple_Twist": 30.985, "simple_hRise": 2.381, "simple_hTwist": 32.333 }, { "index": 4, "nt1": "///A/230", "nt2": "///A/244", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.068, -0.198, 0.512, 5.319, -3.332, -2.067 ], "step_params": [ -0.499, -1.604, 3.422, 2.139, 7.938, 33.027 ], "heli_params": [ -3.993, 1.190, 2.932, 13.700, -3.692, 34.007 ], "bp2_params": [ 0.152, -0.275, 0.237, -4.064, -10.903, -1.905 ], "groove_widths": [ 17.363, 16.011, 15.097, 11.533 ], "simple_Rise": 3.422, "simple_Twist": 31.780, "simple_hRise": 2.909, "simple_hTwist": 32.799 }, { "index": 5, "nt1": "///A/231", "nt2": "///A/243", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.152, -0.275, 0.237, -4.064, -10.903, -1.905 ], "step_params": [ 0.600, -1.267, 2.974, 0.610, 4.816, 33.945 ], "heli_params": [ -2.818, -0.933, 2.783, 8.196, -1.038, 34.280 ], "bp2_params": [ 0.198, -0.276, 0.315, 2.233, -8.200, 1.648 ], "groove_widths": [ 17.316, 16.139, 15.448, 12.521 ], "simple_Rise": 2.974, "simple_Twist": 33.733, "simple_hRise": 2.782, "simple_hTwist": 34.070 }, { "index": 6, "nt1": "///A/232", "nt2": "///A/242", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.198, -0.276, 0.315, 2.233, -8.200, 1.648 ], "step_params": [ 0.050, -1.753, 3.165, 0.946, 10.203, 28.961 ], "heli_params": [ -5.080, 0.069, 2.423, 19.642, -1.822, 30.684 ], "bp2_params": [ -0.239, -0.249, 0.199, -5.815, -7.836, -1.007 ], "groove_widths": [ 16.878, null, 16.077, null ], "simple_Rise": 3.165, "simple_Twist": 31.206, "simple_hRise": 2.485, "simple_hTwist": 32.805 }, { "index": 7, "nt1": "///A/233", "nt2": "///A/241", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.239, -0.249, 0.199, -5.815, -7.836, -1.007 ], "step_params": [ -0.315, -1.715, 3.152, 1.187, 5.420, 29.892 ], "heli_params": [ -4.267, 0.819, 2.791, 10.395, -2.277, 30.391 ], "bp2_params": [ -0.993, -0.116, 0.102, -4.067, -21.043, -7.182 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.152, "simple_Twist": 33.694, "simple_hRise": 2.838, "simple_hTwist": 34.135 }, { "index": 8, "nt1": "///A/234", "nt2": "///A/240", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.993, -0.116, 0.102, -4.067, -21.043, -7.182 ], "step_params": [ -0.269, -1.359, 3.337, -2.270, 2.049, 35.459 ], "heli_params": [ -2.526, 0.107, 3.266, 3.357, 3.718, 35.586 ], "bp2_params": [ -0.205, -0.529, 0.138, -1.470, -25.900, -16.400 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.337, "simple_Twist": 31.437, "simple_hRise": 3.255, "simple_hTwist": 31.582 }, { "index": 9, "nt1": "///A/235", "nt2": "///A/239", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 12, "helix_index": 5, "strand1": "GC", "strand2": "CG", "bp_type": "||", "helix_form": "A", "helical_rise": 3.279, "helical_rise_std": 0.021, "helical_radius": 9.158, "helical_radius_std": 1.325, "helical_axis": [ -0.612, -0.783, -0.112 ], "point1": [ 58.942, 59.475, 85.322 ], "point2": [ 56.935, 56.909, 84.956 ], "num_pairs": 2, "pairs": [ { "index": 1, "nt1": "///A/254", "nt2": "///B/170", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.519, 0.051, 0.083, 11.671, -0.610, -1.608 ], "step_params": [ 0.578, -2.054, 3.438, 3.686, 1.429, 41.873 ], "heli_params": [ -3.018, -0.406, 3.406, 1.994, -5.144, 42.051 ], "bp2_params": [ 0.651, -0.173, -0.511, 3.604, -4.214, 2.128 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.438, "simple_Twist": 35.615, "simple_hRise": 3.397, "simple_hTwist": 35.827 }, { "index": 2, "nt1": "///A/255", "nt2": "///B/169", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 13, "helix_index": 8, "strand1": "UGCG", "strand2": "ACGC", "bp_type": "||||", "helix_form": "AA.", "helical_rise": 3.121, "helical_rise_std": 0.211, "helical_radius": 10.142, "helical_radius_std": 1.120, "helical_axis": [ 0.507, -0.635, 0.583 ], "point1": [ 65.023, 50.634, 63.807 ], "point2": [ 69.757, 44.710, 69.243 ], "num_pairs": 4, "pairs": [ { "index": 1, "nt1": "///B/107", "nt2": "///B/214", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.439, 0.030, -0.291, 3.686, 1.856, 3.885 ], "step_params": [ -0.688, -2.010, 3.402, -0.748, 8.880, 31.786 ], "heli_params": [ -4.993, 1.090, 2.770, 15.828, 1.333, 32.981 ], "bp2_params": [ 0.119, -0.191, -0.027, -0.900, -9.015, 2.878 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.402, "simple_Twist": 28.927, "simple_hRise": 2.696, "simple_hTwist": 30.240 }, { "index": 2, "nt1": "///B/108", "nt2": "///B/213", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.119, -0.191, -0.027, -0.900, -9.015, 2.878 ], "step_params": [ 0.748, -2.143, 2.952, 4.187, -1.029, 28.815 ], "heli_params": [ -4.052, -0.636, 3.100, -2.054, -8.355, 29.130 ], "bp2_params": [ -0.007, -0.057, -0.383, 10.801, -9.497, -0.631 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.952, "simple_Twist": 29.741, "simple_hRise": 3.096, "simple_hTwist": 30.045 }, { "index": 3, "nt1": "///B/109", "nt2": "///B/212", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.007, -0.057, -0.383, 10.801, -9.497, -0.631 ], "step_params": [ -0.370, -2.348, 4.093, -1.075, 0.322, 26.165 ], "heli_params": [ -5.290, 0.453, 4.076, 0.711, 2.374, 26.189 ], "bp2_params": [ -0.640, -0.104, -0.265, -4.166, -0.627, -0.696 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 4.093, "simple_Twist": 29.463, "simple_hRise": 4.079, "simple_hTwist": 29.484 }, { "index": 4, "nt1": "///B/110", "nt2": "///B/211", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 14, "helix_index": 8, "strand1": "GG", "strand2": "CC", "bp_type": "||", "helix_form": "A", "helical_rise": 1.768, "helical_rise_std": 0.090, "helical_radius": 8.014, "helical_radius_std": 1.466, "helical_axis": [ 0.733, -0.144, 0.664 ], "point1": [ 73.705, 43.224, 71.329 ], "point2": [ 75.002, 42.969, 72.504 ], "num_pairs": 2, "pairs": [ { "index": 1, "nt1": "///B/111", "nt2": "///B/209", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.366, -0.079, -0.396, -7.291, -1.664, -3.501 ], "step_params": [ 0.464, -1.626, 3.143, -6.658, 16.334, 28.971 ], "heli_params": [ -4.973, -1.686, 1.845, 29.457, 12.007, 33.820 ], "bp2_params": [ -0.231, -0.016, 0.175, -2.651, -12.604, 0.606 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.143, "simple_Twist": 31.921, "simple_hRise": 1.976, "simple_hTwist": 36.359 }, { "index": 2, "nt1": "///B/112", "nt2": "///B/208", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 15, "helix_index": 8, "strand1": "GGGGUC", "strand2": "UCCUGG", "bp_type": "||||||", "helix_form": ".A...", "helical_rise": 2.307, "helical_rise_std": 0.235, "helical_radius": 8.884, "helical_radius_std": 0.501, "helical_axis": [ 0.741, -0.482, 0.467 ], "point1": [ 80.270, 35.238, 79.965 ], "point2": [ 88.643, 29.791, 85.246 ], "num_pairs": 6, "pairs": [ { "index": 1, "nt1": "///B/116", "nt2": "///B/205", "bp": "G-U", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -2.205, -0.712, 0.369, 3.330, -9.034, -3.115 ], "step_params": [ -0.413, -1.312, 3.216, -2.821, 9.126, 38.731 ], "heli_params": [ -2.921, 0.298, 2.869, 13.511, 4.177, 39.847 ], "bp2_params": [ -0.339, -0.145, 0.076, 3.849, -9.443, -3.166 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.216, "simple_Twist": 28.473, "simple_hRise": 2.703, "simple_hTwist": 30.002 }, { "index": 2, "nt1": "///B/117", "nt2": "///B/204", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.339, -0.145, 0.076, 3.849, -9.443, -3.166 ], "step_params": [ 0.348, -1.618, 3.497, 3.042, 9.493, 32.550 ], "heli_params": [ -4.294, -0.105, 2.943, 16.461, -5.275, 34.003 ], "bp2_params": [ -0.246, -0.280, -0.178, -3.806, -19.058, 1.689 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.497, "simple_Twist": 31.942, "simple_hRise": 2.929, "simple_hTwist": 33.422 }, { "index": 3, "nt1": "///B/118", "nt2": "///B/203", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.246, -0.280, -0.178, -3.806, -19.058, 1.689 ], "step_params": [ 0.367, -2.050, 3.064, -3.824, 14.570, 25.310 ], "heli_params": [ -6.445, -1.355, 1.600, 30.092, 7.897, 29.390 ], "bp2_params": [ -2.347, -0.660, 0.006, -9.414, -18.145, 0.345 ], "groove_widths": [ 16.986, null, 14.411, null ], "simple_Rise": 3.064, "simple_Twist": 36.639, "simple_hRise": 2.085, "simple_hTwist": 39.516 }, { "index": 4, "nt1": "///B/119", "nt2": "///B/202", "bp": "G-U", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -2.347, -0.660, 0.006, -9.414, -18.145, 0.345 ], "step_params": [ 0.442, -1.020, 3.152, 0.476, 4.427, 50.445 ], "heli_params": [ -1.490, -0.485, 3.062, 5.182, -0.557, 50.628 ], "bp2_params": [ 2.712, -0.492, 0.193, -3.677, -6.631, 2.460 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.152, "simple_Twist": 22.976, "simple_hRise": 2.915, "simple_hTwist": 23.398 }, { "index": 5, "nt1": "///B/120", "nt2": "///B/201", "bp": "U-G", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 2.712, -0.492, 0.193, -3.677, -6.631, 2.460 ], "step_params": [ -0.206, -1.912, 3.065, 10.795, -0.380, 26.642 ], "heli_params": [ -3.775, 2.678, 2.797, -0.785, -22.296, 28.711 ], "bp2_params": [ 0.178, -0.083, -0.553, 3.965, -6.950, -4.922 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.065, "simple_Twist": 40.677, "simple_hRise": 2.936, "simple_hTwist": 42.028 }, { "index": 6, "nt1": "///B/121", "nt2": "///B/200", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 16, "helix_index": 6, "strand1": "CCGU", "strand2": "GGCA", "bp_type": "||||", "helix_form": ".A.", "helical_rise": 2.133, "helical_rise_std": 0.453, "helical_radius": 8.724, "helical_radius_std": 0.631, "helical_axis": [ -0.540, 0.692, -0.479 ], "point1": [ 93.036, 50.005, 90.660 ], "point2": [ 89.696, 54.289, 87.696 ], "num_pairs": 4, "pairs": [ { "index": 1, "nt1": "///B/127", "nt2": "///B/195", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.712, -0.251, -0.077, 22.515, -27.157, -4.792 ], "step_params": [ 0.021, -2.086, 3.944, -2.580, 10.205, 34.631 ], "heli_params": [ -4.972, -0.441, 3.211, 16.673, 4.214, 36.148 ], "bp2_params": [ 0.618, -0.211, -0.214, -1.675, -9.241, 5.348 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.944, "simple_Twist": 33.908, "simple_hRise": 3.192, "simple_hTwist": 35.458 }, { "index": 2, "nt1": "///B/128", "nt2": "///B/194", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.618, -0.211, -0.214, -1.675, -9.241, 5.348 ], "step_params": [ -0.234, -1.860, 3.101, -3.761, 18.042, 28.469 ], "heli_params": [ -5.523, -0.082, 1.676, 32.712, 6.819, 33.810 ], "bp2_params": [ 0.094, -0.197, 0.260, -11.408, 5.096, 3.071 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.101, "simple_Twist": 31.709, "simple_hRise": 1.830, "simple_hTwist": 36.557 }, { "index": 3, "nt1": "///B/129", "nt2": "///B/193", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.094, -0.197, 0.260, -11.408, 5.096, 3.071 ], "step_params": [ -1.058, -0.706, 2.866, 5.853, -0.546, 41.085 ], "heli_params": [ -0.947, 2.027, 2.705, -0.773, -8.288, 41.485 ], "bp2_params": [ 0.826, -0.375, 0.132, 10.331, -9.436, -8.364 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.866, "simple_Twist": 36.868, "simple_hRise": 2.682, "simple_hTwist": 37.317 }, { "index": 4, "nt1": "///B/130", "nt2": "///B/192", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 17, "helix_index": 6, "strand1": "CAG", "strand2": "GUC", "bp_type": "|||", "helix_form": "AA", "helical_rise": 2.222, "helical_rise_std": 0.101, "helical_radius": 8.874, "helical_radius_std": 0.509, "helical_axis": [ -0.221, 0.901, -0.373 ], "point1": [ 87.621, 58.563, 87.417 ], "point2": [ 86.666, 62.457, 85.803 ], "num_pairs": 3, "pairs": [ { "index": 1, "nt1": "///B/132", "nt2": "///B/191", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.803, 0.196, -0.308, 9.162, -6.158, 3.170 ], "step_params": [ -0.322, -1.731, 3.492, -2.430, 9.996, 28.066 ], "heli_params": [ -5.406, 0.127, 2.744, 19.790, 4.810, 29.857 ], "bp2_params": [ 0.139, -0.148, 0.048, -3.460, -11.456, 4.148 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.492, "simple_Twist": 31.557, "simple_hRise": 2.842, "simple_hTwist": 33.151 }, { "index": 2, "nt1": "///B/133", "nt2": "///B/190", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.139, -0.148, 0.048, -3.460, -11.456, 4.148 ], "step_params": [ -0.241, -1.585, 3.322, 0.157, 7.204, 31.088 ], "heli_params": [ -4.145, 0.466, 2.890, 13.220, -0.288, 31.892 ], "bp2_params": [ -0.513, -0.200, -0.153, -11.544, -14.107, 0.893 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.322, "simple_Twist": 34.517, "simple_hRise": 2.941, "simple_hTwist": 35.239 }, { "index": 3, "nt1": "///B/134", "nt2": "///B/189", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 18, "helix_index": 6, "strand1": "ACC", "strand2": "UGG", "bp_type": "|||", "helix_form": "A.", "helical_rise": 1.299, "helical_rise_std": 0.175, "helical_radius": 8.420, "helical_radius_std": 0.567, "helical_axis": [ 0.213, 0.709, -0.673 ], "point1": [ 86.516, 69.718, 81.542 ], "point2": [ 87.030, 71.428, 79.919 ], "num_pairs": 3, "pairs": [ { "index": 1, "nt1": "///B/136", "nt2": "///B/182", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.190, -0.015, -0.477, -7.959, -13.490, -4.747 ], "step_params": [ 0.864, -1.305, 2.920, -3.547, 3.571, 38.534 ], "heli_params": [ -2.337, -1.672, 2.706, 5.383, 5.347, 38.849 ], "bp2_params": [ 0.414, -0.146, 0.079, 0.773, -24.020, 2.146 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.920, "simple_Twist": 37.370, "simple_hRise": 2.698, "simple_hTwist": 37.695 }, { "index": 2, "nt1": "///B/137", "nt2": "///B/181", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.414, -0.146, 0.079, 0.773, -24.020, 2.146 ], "step_params": [ -0.939, -2.040, 3.091, 2.862, 13.532, 27.168 ], "heli_params": [ -6.028, 2.242, 1.790, 26.721, -5.651, 30.427 ], "bp2_params": [ 0.283, -0.202, -0.217, 5.346, -9.009, -3.845 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.091, "simple_Twist": 27.956, "simple_hRise": 1.829, "simple_hTwist": 31.129 }, { "index": 3, "nt1": "///B/138", "nt2": "///B/180", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 19, "helix_index": 7, "strand1": "GUCUCAGGG", "strand2": "UAGAGUUUC", "bp_type": "|||||||||", "helix_form": ".AAAA...", "helical_rise": 2.603, "helical_rise_std": 0.218, "helical_radius": 8.943, "helical_radius_std": 0.554, "helical_axis": [ -0.480, 0.332, -0.812 ], "point1": [ 74.285, 73.724, 67.009 ], "point2": [ 64.366, 80.588, 50.237 ], "num_pairs": 9, "pairs": [ { "index": 1, "nt1": "///B/141", "nt2": "///B/162", "bp": "G-U", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -2.335, -0.806, -0.077, 9.376, -18.252, 0.798 ], "step_params": [ -0.261, -1.419, 3.446, -2.520, 2.609, 43.284 ], "heli_params": [ -2.182, 0.098, 3.368, 3.530, 3.410, 43.429 ], "bp2_params": [ -0.044, -0.230, 0.053, 2.479, -17.200, -2.065 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.446, "simple_Twist": 29.840, "simple_hRise": 3.323, "simple_hTwist": 30.055 }, { "index": 2, "nt1": "///B/142", "nt2": "///B/161", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.044, -0.230, 0.053, 2.479, -17.200, -2.065 ], "step_params": [ -0.220, -1.636, 3.208, 0.762, 4.428, 32.281 ], "heli_params": [ -3.646, 0.518, 2.958, 7.916, -1.363, 32.584 ], "bp2_params": [ 0.297, -0.168, -0.009, 2.175, -12.265, -1.976 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.208, "simple_Twist": 30.450, "simple_hRise": 2.941, "simple_hTwist": 30.772 }, { "index": 3, "nt1": "///B/143", "nt2": "///B/160", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.297, -0.168, -0.009, 2.175, -12.265, -1.976 ], "step_params": [ 0.136, -1.293, 3.218, 0.316, 7.844, 30.925 ], "heli_params": [ -3.691, -0.194, 2.815, 14.421, -0.581, 31.883 ], "bp2_params": [ 0.041, 0.006, 0.055, 3.703, -12.197, 3.512 ], "groove_widths": [ 17.181, null, 15.021, null ], "simple_Rise": 3.218, "simple_Twist": 32.471, "simple_hRise": 2.839, "simple_hTwist": 33.382 }, { "index": 4, "nt1": "///B/144", "nt2": "///B/159", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.041, 0.006, 0.055, 3.703, -12.197, 3.512 ], "step_params": [ 0.274, -1.059, 3.172, 0.327, 7.285, 34.796 ], "heli_params": [ -2.734, -0.405, 2.900, 12.018, -0.539, 35.529 ], "bp2_params": [ 0.422, -0.203, 0.127, 6.007, -8.033, 2.131 ], "groove_widths": [ 17.659, 16.324, 15.189, 12.095 ], "simple_Rise": 3.172, "simple_Twist": 32.582, "simple_hRise": 2.877, "simple_hTwist": 33.367 }, { "index": 5, "nt1": "///B/145", "nt2": "///B/158", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.422, -0.203, 0.127, 6.007, -8.033, 2.131 ], "step_params": [ -0.189, -1.328, 3.092, 1.496, 12.763, 29.502 ], "heli_params": [ -4.379, 0.574, 2.321, 23.696, -2.778, 32.122 ], "bp2_params": [ 0.087, -0.390, 0.048, 4.430, -9.754, 1.541 ], "groove_widths": [ 17.624, 15.997, 15.242, 11.167 ], "simple_Rise": 3.092, "simple_Twist": 31.393, "simple_hRise": 2.376, "simple_hTwist": 33.860 }, { "index": 6, "nt1": "///B/146", "nt2": "///B/157", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.087, -0.390, 0.048, 4.430, -9.754, 1.541 ], "step_params": [ -0.221, -1.560, 2.979, -2.945, 16.442, 25.839 ], "heli_params": [ -5.479, -0.037, 1.716, 32.767, 5.870, 30.691 ], "bp2_params": [ -2.126, -0.629, -0.367, 1.487, -8.217, 4.095 ], "groove_widths": [ 17.413, null, 15.023, null ], "simple_Rise": 2.979, "simple_Twist": 38.442, "simple_hRise": 2.174, "simple_hTwist": 41.788 }, { "index": 7, "nt1": "///B/147", "nt2": "///B/156", "bp": "G-U", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -2.126, -0.629, -0.367, 1.487, -8.217, 4.095 ], "step_params": [ 0.088, -1.626, 3.392, -6.656, 9.545, 33.511 ], "heli_params": [ -4.034, -1.093, 2.773, 15.967, 11.135, 35.419 ], "bp2_params": [ -2.292, -0.426, -0.440, -6.526, -5.379, 2.582 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.392, "simple_Twist": 34.006, "simple_hRise": 2.784, "simple_hTwist": 35.886 }, { "index": 8, "nt1": "///B/148", "nt2": "///B/155", "bp": "G-U", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -2.292, -0.426, -0.440, -6.526, -5.379, 2.582 ], "step_params": [ 0.009, -1.833, 3.393, -1.581, 3.470, 35.667 ], "heli_params": [ -3.479, -0.244, 3.203, 5.645, 2.573, 35.863 ], "bp2_params": [ -0.337, -0.060, -0.363, -5.957, 5.558, 3.731 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.393, "simple_Twist": 25.175, "simple_hRise": 3.109, "simple_hTwist": 25.458 }, { "index": 9, "nt1": "///B/149", "nt2": "///B/154", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 20, "helix_index": 5, "strand1": "CC", "strand2": "GG", "bp_type": "||", "helix_form": "A", "helical_rise": 2.654, "helical_rise_std": 0.012, "helical_radius": 8.581, "helical_radius_std": 1.352, "helical_axis": [ -0.318, -0.944, -0.086 ], "point1": [ 65.452, 71.306, 81.258 ], "point2": [ 64.609, 68.799, 81.030 ], "num_pairs": 2, "pairs": [ { "index": 1, "nt1": "///B/165", "nt2": "///B/175", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.195, -0.186, -0.343, -6.169, -9.464, 0.875 ], "step_params": [ -0.104, -1.147, 3.059, 3.259, 10.252, 32.837 ], "heli_params": [ -3.339, 0.621, 2.574, 17.558, -5.581, 34.508 ], "bp2_params": [ 0.136, -0.094, -0.258, 2.777, -9.968, -1.968 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.059, "simple_Twist": 31.624, "simple_hRise": 2.551, "simple_hTwist": 33.359 }, { "index": 2, "nt1": "///B/166", "nt2": "///B/174", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 21, "helix_index": 8, "strand1": "GUCC", "strand2": "UAGG", "bp_type": "||||", "helix_form": ".A.", "helical_rise": 3.107, "helical_rise_std": 0.223, "helical_radius": 9.212, "helical_radius_std": 0.797, "helical_axis": [ -0.602, 0.699, -0.386 ], "point1": [ 55.204, 58.882, 51.591 ], "point2": [ 49.600, 65.391, 47.997 ], "num_pairs": 4, "pairs": [ { "index": 1, "nt1": "///B/220", "nt2": "///B/253", "bp": "G-U", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -2.150, -0.544, 0.460, 4.769, -7.620, 0.137 ], "step_params": [ -0.315, -1.425, 3.290, -3.124, 2.234, 37.339 ], "heli_params": [ -2.506, 0.083, 3.217, 3.478, 4.864, 37.529 ], "bp2_params": [ -0.106, -0.098, 0.373, 6.829, -14.124, 1.150 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.290, "simple_Twist": 26.435, "simple_hRise": 3.176, "simple_hTwist": 26.707 }, { "index": 2, "nt1": "///B/221", "nt2": "///B/252", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.106, -0.098, 0.373, 6.829, -14.124, 1.150 ], "step_params": [ 0.266, -1.164, 3.071, 2.250, 0.547, 36.167 ], "heli_params": [ -1.943, -0.132, 3.064, 0.880, -3.619, 36.239 ], "bp2_params": [ 0.473, 0.002, -0.105, 15.058, -17.853, 3.294 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.071, "simple_Twist": 33.702, "simple_hRise": 3.063, "simple_hTwist": 33.779 }, { "index": 3, "nt1": "///B/222", "nt2": "///B/251", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.473, 0.002, -0.105, 15.058, -17.853, 3.294 ], "step_params": [ -1.012, -2.083, 3.547, -3.854, 7.957, 31.485 ], "heli_params": [ -5.118, 1.113, 3.043, 14.314, 6.933, 32.673 ], "bp2_params": [ 0.382, -0.182, -0.072, 1.601, -13.424, -1.891 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.547, "simple_Twist": 31.338, "simple_hRise": 3.040, "simple_hTwist": 32.532 }, { "index": 4, "nt1": "///B/223", "nt2": "///B/250", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 22, "helix_index": 8, "strand1": "GUCAACAGA", "strand2": "UAGUUGUCU", "bp_type": "|||||||||", "helix_form": ".AAAAAAA", "helical_rise": 2.684, "helical_rise_std": 0.234, "helical_radius": 9.159, "helical_radius_std": 0.943, "helical_axis": [ -0.569, 0.513, -0.642 ], "point1": [ 45.438, 74.809, 43.637 ], "point2": [ 33.264, 85.786, 29.902 ], "num_pairs": 9, "pairs": [ { "index": 1, "nt1": "///B/227", "nt2": "///B/247", "bp": "G-U", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -2.195, -0.707, 0.039, -4.497, -6.819, -0.641 ], "step_params": [ -0.197, -1.213, 3.056, -1.401, 8.068, 40.055 ], "heli_params": [ -2.537, 0.144, 2.776, 11.632, 2.020, 40.850 ], "bp2_params": [ -0.009, -0.052, -0.134, 6.816, -10.675, -2.425 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.056, "simple_Twist": 28.088, "simple_hRise": 2.620, "simple_hTwist": 29.234 }, { "index": 2, "nt1": "///B/228", "nt2": "///B/246", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.009, -0.052, -0.134, 6.816, -10.675, -2.425 ], "step_params": [ -0.113, -1.233, 3.285, -0.133, 8.745, 34.288 ], "heli_params": [ -3.268, 0.167, 2.894, 14.541, 0.221, 35.354 ], "bp2_params": [ 0.355, -0.221, -0.038, 6.225, -4.668, -2.180 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.285, "simple_Twist": 32.298, "simple_hRise": 2.863, "simple_hTwist": 33.431 }, { "index": 3, "nt1": "///B/229", "nt2": "///B/245", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.355, -0.221, -0.038, 6.225, -4.668, -2.180 ], "step_params": [ 0.124, -1.850, 2.992, -1.935, 8.651, 27.711 ], "heli_params": [ -5.262, -0.599, 2.307, 17.504, 3.914, 29.068 ], "bp2_params": [ -0.072, -0.249, 0.428, 10.532, -7.381, -2.222 ], "groove_widths": [ 17.455, null, 15.230, null ], "simple_Rise": 2.992, "simple_Twist": 29.870, "simple_hRise": 2.364, "simple_hTwist": 31.129 }, { "index": 4, "nt1": "///B/230", "nt2": "///B/244", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.072, -0.249, 0.428, 10.532, -7.381, -2.222 ], "step_params": [ -0.402, -1.503, 3.508, 2.538, 9.854, 33.744 ], "heli_params": [ -3.961, 1.045, 2.930, 16.514, -4.253, 35.202 ], "bp2_params": [ 0.024, -0.239, 0.123, -2.482, -13.593, -1.997 ], "groove_widths": [ 17.444, 16.121, 15.026, 11.055 ], "simple_Rise": 3.508, "simple_Twist": 33.290, "simple_hRise": 2.920, "simple_hTwist": 34.768 }, { "index": 5, "nt1": "///B/231", "nt2": "///B/243", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.024, -0.239, 0.123, -2.482, -13.593, -1.997 ], "step_params": [ 0.652, -1.264, 2.904, 0.145, 6.541, 33.430 ], "heli_params": [ -3.047, -1.095, 2.620, 11.238, -0.250, 34.046 ], "bp2_params": [ 0.201, -0.194, 0.320, 5.555, -9.945, 2.073 ], "groove_widths": [ 17.338, 16.032, 14.891, 11.072 ], "simple_Rise": 2.904, "simple_Twist": 32.612, "simple_hRise": 2.612, "simple_hTwist": 33.245 }, { "index": 6, "nt1": "///B/232", "nt2": "///B/242", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.201, -0.194, 0.320, 5.555, -9.945, 2.073 ], "step_params": [ 0.069, -1.742, 3.108, -1.099, 11.155, 29.706 ], "heli_params": [ -4.950, -0.300, 2.315, 20.846, 2.053, 31.706 ], "bp2_params": [ -0.234, -0.288, 0.476, -3.534, -8.705, 0.288 ], "groove_widths": [ 16.901, null, 15.808, null ], "simple_Rise": 3.108, "simple_Twist": 32.052, "simple_hRise": 2.382, "simple_hTwist": 33.907 }, { "index": 7, "nt1": "///B/233", "nt2": "///B/241", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.234, -0.288, 0.476, -3.534, -8.705, 0.288 ], "step_params": [ -0.318, -1.775, 3.451, 5.581, 6.973, 32.504 ], "heli_params": [ -4.192, 1.452, 2.926, 12.172, -9.743, 33.677 ], "bp2_params": [ -0.851, -0.081, -0.159, -11.472, -22.783, -7.061 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.451, "simple_Twist": 35.266, "simple_hRise": 2.975, "simple_hTwist": 36.344 }, { "index": 8, "nt1": "///B/234", "nt2": "///B/240", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.851, -0.081, -0.159, -11.472, -22.783, -7.061 ], "step_params": [ -0.201, -1.425, 3.228, -4.270, 2.668, 33.444 ], "heli_params": [ -2.870, -0.327, 3.109, 4.603, 7.368, 33.810 ], "bp2_params": [ -0.207, -0.412, 0.117, -2.724, -24.672, -17.112 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.228, "simple_Twist": 30.142, "simple_hRise": 3.091, "simple_hTwist": 30.550 }, { "index": 9, "nt1": "///B/235", "nt2": "///B/239", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W" } ] } ], "num_isoCanonPairs": 4, "isoCanonPairs": [ { "index": -1, "helix_index": 1, "nt1": "///A/103", "nt2": "///A/217", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" }, { "index": -2, "helix_index": 1, "nt1": "///A/226", "nt2": "///A/249", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W" }, { "index": -3, "helix_index": 8, "nt1": "///B/103", "nt2": "///B/217", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" }, { "index": -4, "helix_index": 8, "nt1": "///B/226", "nt2": "///B/249", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W" } ], "num_coaxStacks": 6, "coaxStacks": [ { "index": 1, "helix_index": 1, "num_stems": 5, "stem_indices": [ 3, 2, 1, 10, 11 ] }, { "index": 2, "helix_index": 2, "num_stems": 3, "stem_indices": [ 4, 5, 6 ] }, { "index": 3, "helix_index": 4, "num_stems": 2, "stem_indices": [ 9, 8 ] }, { "index": 4, "helix_index": 5, "num_stems": 2, "stem_indices": [ 12, 20 ] }, { "index": 5, "helix_index": 6, "num_stems": 3, "stem_indices": [ 16, 17, 18 ] }, { "index": 6, "helix_index": 8, "num_stems": 5, "stem_indices": [ 15, 14, 13, 21, 22 ] } ], "num_stacks": 51, "stacks": [ { "index": 1, "num_nts": 2, "nts_short": "GG", "nts_long": "///A/110,///A/111" }, { "index": 2, "num_nts": 2, "nts_short": "GU", "nts_long": "///A/134,///A/135" }, { "index": 3, "num_nts": 2, "nts_short": "GG", "nts_long": "///A/149,///A/150" }, { "index": 4, "num_nts": 2, "nts_short": "AG", "nts_long": "///A/178,///A/180" }, { "index": 5, "num_nts": 2, "nts_short": "GA", "nts_long": "///A/191,///A/192" }, { "index": 6, "num_nts": 2, "nts_short": "AA", "nts_long": "///A/210,///B/210" }, { "index": 7, "num_nts": 2, "nts_short": "AG", "nts_long": "///A/248,///A/250" }, { "index": 8, "num_nts": 2, "nts_short": "UC", "nts_long": "///B/107,///B/260" }, { "index": 9, "num_nts": 2, "nts_short": "GG", "nts_long": "///B/110,///B/111" }, { "index": 10, "num_nts": 2, "nts_short": "UC", "nts_long": "///B/130,///B/132" }, { "index": 11, "num_nts": 2, "nts_short": "GU", "nts_long": "///B/134,///B/135" }, { "index": 12, "num_nts": 2, "nts_short": "GG", "nts_long": "///B/149,///B/150" }, { "index": 13, "num_nts": 2, "nts_short": "AG", "nts_long": "///B/178,///B/180" }, { "index": 14, "num_nts": 2, "nts_short": "GA", "nts_long": "///B/191,///B/192" }, { "index": 15, "num_nts": 2, "nts_short": "AG", "nts_long": "///B/198,///B/200" }, { "index": 16, "num_nts": 2, "nts_short": "CC", "nts_long": "///B/209,///B/211" }, { "index": 17, "num_nts": 3, "nts_short": "AAG", "nts_long": "///A/122,///A/198,///A/200" }, { "index": 18, "num_nts": 3, "nts_short": "CGC", "nts_long": "///A/124,///A/126,///A/127" }, { "index": 19, "num_nts": 3, "nts_short": "AAC", "nts_long": "///A/136,///A/187,///A/189" }, { "index": 20, "num_nts": 3, "nts_short": "UGG", "nts_long": "///A/162,///A/163,///A/164" }, { "index": 21, "num_nts": 3, "nts_short": "UAA", "nts_long": "///A/168,///A/183,///A/184" }, { "index": 22, "num_nts": 3, "nts_short": "GGU", "nts_long": "///A/175,///A/176,///A/177" }, { "index": 23, "num_nts": 3, "nts_short": "CGC", "nts_long": "///B/124,///B/126,///B/127" }, { "index": 24, "num_nts": 3, "nts_short": "AAC", "nts_long": "///B/136,///B/187,///B/189" }, { "index": 25, "num_nts": 3, "nts_short": "UGG", "nts_long": "///B/162,///B/163,///B/164" }, { "index": 26, "num_nts": 3, "nts_short": "UAA", "nts_long": "///B/168,///B/183,///B/184" }, { "index": 27, "num_nts": 3, "nts_short": "GGU", "nts_long": "///B/175,///B/176,///B/177" }, { "index": 28, "num_nts": 3, "nts_short": "AGC", "nts_long": "///B/214,///B/215,///B/216" }, { "index": 29, "num_nts": 3, "nts_short": "CAU", "nts_long": "///B/217,///B/218,///B/253" }, { "index": 30, "num_nts": 4, "nts_short": "GAAU", "nts_long": "///A/112,///A/113,///A/206,///A/205" }, { "index": 31, "num_nts": 4, "nts_short": "ACAG", "nts_long": "///A/123,///A/197,///A/196,///A/195" }, { "index": 32, "num_nts": 4, "nts_short": "GAAA", "nts_long": "///A/141,///A/140,///A/139,///A/186" }, { "index": 33, "num_nts": 4, "nts_short": "CUAC", "nts_long": "///A/166,///A/167,///A/171,///A/170" }, { "index": 34, "num_nts": 4, "nts_short": "GAAG", "nts_long": "///A/174,///A/173,///A/172,///B/254" }, { "index": 35, "num_nts": 4, "nts_short": "CUAU", "nts_long": "///A/223,///A/224,///A/225,///A/247" }, { "index": 36, "num_nts": 4, "nts_short": "GAAG", "nts_long": "///A/254,///B/172,///B/173,///B/174" }, { "index": 37, "num_nts": 4, "nts_short": "CAGU", "nts_long": "///A/255,///A/256,///A/257,///A/258" }, { "index": 38, "num_nts": 4, "nts_short": "GAAU", "nts_long": "///B/112,///B/113,///B/206,///B/205" }, { "index": 39, "num_nts": 4, "nts_short": "ACAG", "nts_long": "///B/123,///B/197,///B/196,///B/195" }, { "index": 40, "num_nts": 4, "nts_short": "AAAC", "nts_long": "///B/151,///B/152,///B/153,///B/154" }, { "index": 41, "num_nts": 4, "nts_short": "CUAC", "nts_long": "///B/166,///B/167,///B/171,///B/170" }, { "index": 42, "num_nts": 4, "nts_short": "CUAU", "nts_long": "///B/223,///B/224,///B/225,///B/247" }, { "index": 43, "num_nts": 4, "nts_short": "GAAG", "nts_long": "///B/227,///B/226,///B/248,///B/250" }, { "index": 44, "num_nts": 5, "nts_short": "GAAAC", "nts_long": "///A/116,///A/115,///A/114,///A/207,///A/208" }, { "index": 45, "num_nts": 5, "nts_short": "AAGAG", "nts_long": "///B/105,///B/104,///B/103,///B/219,///B/220" }, { "index": 46, "num_nts": 5, "nts_short": "GAAAC", "nts_long": "///B/116,///B/115,///B/114,///B/207,///B/208" }, { "index": 47, "num_nts": 5, "nts_short": "GAAAU", "nts_long": "///B/141,///B/140,///B/139,///B/186,///B/182" }, { "index": 48, "num_nts": 5, "nts_short": "CAGUU", "nts_long": "///B/255,///B/256,///B/257,///B/258,///B/259" }, { "index": 49, "num_nts": 6, "nts_short": "CAAAAG", "nts_long": "///A/154,///A/153,///A/152,///A/151,///A/226,///A/227" }, { "index": 50, "num_nts": 6, "nts_short": "AGCCAU", "nts_long": "///A/214,///A/215,///A/216,///A/217,///A/218,///A/253" }, { "index": 51, "num_nts": 7, "nts_short": "GAGAAUC", "nts_long": "///A/220,///A/219,///A/103,///A/104,///A/105,///A/259,///A/260" } ], "nonStack": { "num_nts": 25, "nts_short": "UAACUUGUCUCUUUAAAUUGUUCUU", "nts_long": "///A/106,///A/125,///A/131,///A/132,///A/179,///A/185,///A/188,///A/199,///A/211,///A/236,///A/237,///A/238,///A/249,///B/106,///B/122,///B/125,///B/131,///B/179,///B/185,///B/188,///B/199,///B/236,///B/237,///B/238,///B/249" }, "num_atom2bases": 14, "atom2bases": [ { "index": 1, "type": "sugar", "atom": "///A/121/O2'", "nt": "///A/124", "vert_dist": 3.039 }, { "index": 2, "type": "phosphate", "atom": "///A/152/OP2", "nt": "///A/150", "vert_dist": 3.146 }, { "index": 3, "type": "sugar", "atom": "///A/178/O4'", "nt": "///A/180", "vert_dist": 3.029 }, { "index": 4, "type": "sugar", "atom": "///A/213/O4'", "nt": "///A/184", "vert_dist": 3.013 }, { "index": 5, "type": "sugar", "atom": "///A/182/O4'", "nt": "///A/186", "vert_dist": 3.259 }, { "index": 6, "type": "sugar", "atom": "///A/183/O4'", "nt": "///A/188", "vert_dist": 2.976 }, { "index": 7, "type": "sugar", "atom": "///A/208/O4'", "nt": "///A/207", "vert_dist": 3.235 }, { "index": 8, "type": "sugar", "atom": "///A/235/O2'", "nt": "///A/236", "vert_dist": 3.428 }, { "index": 9, "type": "sugar", "atom": "///B/122/O4'", "nt": "///B/123", "vert_dist": 3.314 }, { "index": 10, "type": "sugar", "atom": "///B/121/O2'", "nt": "///B/124", "vert_dist": 3.205 }, { "index": 11, "type": "phosphate", "atom": "///B/152/OP2", "nt": "///B/150", "vert_dist": 3.084 }, { "index": 12, "type": "sugar", "atom": "///B/213/O4'", "nt": "///B/184", "vert_dist": 2.927 }, { "index": 13, "type": "sugar", "atom": "///B/182/O4'", "nt": "///B/186", "vert_dist": 3.127 }, { "index": 14, "type": "sugar", "atom": "///B/183/O4'", "nt": "///B/188", "vert_dist": 3.047 } ], "num_hairpins": 6, "hairpins": [ { "index": 1, "type": "hairpin loop", "bridging_nts": [ 4 ], "stem_indices": [ 7 ], "summary": "[1] 4 [A.149 A.154] 9", "num_nts": 6, "nts_short": "GGAAAC", "nts_long": "///A/149,///A/150,///A/151,///A/152,///A/153,///A/154", "num_stems": 1, "bridges": [ { "index": 1, "num_nts": 4, "nts_short": "GAAA", "nts_long": "///A/150,///A/151,///A/152,///A/153" } ] }, { "index": 2, "type": "hairpin loop", "bridging_nts": [ 7 ], "stem_indices": [ 8 ], "summary": "[1] 7 [A.166 A.174] 2", "num_nts": 9, "nts_short": "CUUGCAAAG", "nts_long": "///A/166,///A/167,///A/168,///A/169,///A/170,///A/171,///A/172,///A/173,///A/174", "num_stems": 1, "bridges": [ { "index": 1, "num_nts": 7, "nts_short": "UUGCAAA", "nts_long": "///A/167,///A/168,///A/169,///A/170,///A/171,///A/172,///A/173" } ] }, { "index": 3, "type": "hairpin loop", "bridging_nts": [ 3 ], "stem_indices": [ 11 ], "summary": "[1] 3 [A.235 A.239] 9", "num_nts": 5, "nts_short": "AUCUU", "nts_long": "///A/235,///A/236,///A/237,///A/238,///A/239", "num_stems": 1, "bridges": [ { "index": 1, "num_nts": 3, "nts_short": "UCU", "nts_long": "///A/236,///A/237,///A/238" } ] }, { "index": 4, "type": "hairpin loop", "bridging_nts": [ 4 ], "stem_indices": [ 19 ], "summary": "[1] 4 [B.149 B.154] 9", "num_nts": 6, "nts_short": "GGAAAC", "nts_long": "///B/149,///B/150,///B/151,///B/152,///B/153,///B/154", "num_stems": 1, "bridges": [ { "index": 1, "num_nts": 4, "nts_short": "GAAA", "nts_long": "///B/150,///B/151,///B/152,///B/153" } ] }, { "index": 5, "type": "hairpin loop", "bridging_nts": [ 7 ], "stem_indices": [ 20 ], "summary": "[1] 7 [B.166 B.174] 2", "num_nts": 9, "nts_short": "CUUGCAAAG", "nts_long": "///B/166,///B/167,///B/168,///B/169,///B/170,///B/171,///B/172,///B/173,///B/174", "num_stems": 1, "bridges": [ { "index": 1, "num_nts": 7, "nts_short": "UUGCAAA", "nts_long": "///B/167,///B/168,///B/169,///B/170,///B/171,///B/172,///B/173" } ] }, { "index": 6, "type": "hairpin loop", "bridging_nts": [ 3 ], "stem_indices": [ 22 ], "summary": "[1] 3 [B.235 B.239] 9", "num_nts": 5, "nts_short": "AUCUU", "nts_long": "///B/235,///B/236,///B/237,///B/238,///B/239", "num_stems": 1, "bridges": [ { "index": 1, "num_nts": 3, "nts_short": "UCU", "nts_long": "///B/236,///B/237,///B/238" } ] } ], "num_bulges": 8, "bulges": [ { "index": 1, "type": "bulge", "bridging_nts": [ 0, 1 ], "stem_indices": [ 1, 2 ], "summary": "[2] 0 1 [A.110 A.211 A.111 A.209] 4 2", "num_nts": 5, "nts_short": "GGCAC", "nts_long": "///A/110,///A/111,///A/209,///A/210,///A/211", "num_stems": 2, "bridges": [ { "index": 1, "num_nts": 0, "nts_short": "", "nts_long": "" }, { "index": 2, "num_nts": 1, "nts_short": "A", "nts_long": "///A/210" } ] }, { "index": 2, "type": "bulge", "bridging_nts": [ 1, 0 ], "stem_indices": [ 4, 5 ], "summary": "[2] 1 0 [A.130 A.192 A.132 A.191] 4 3", "num_nts": 5, "nts_short": "UACGA", "nts_long": "///A/130,///A/131,///A/132,///A/191,///A/192", "num_stems": 2, "bridges": [ { "index": 1, "num_nts": 1, "nts_short": "A", "nts_long": "///A/131" }, { "index": 2, "num_nts": 0, "nts_short": "", "nts_long": "" } ] }, { "index": 3, "type": "bulge", "bridging_nts": [ 0, 1 ], "stem_indices": [ -2, 11 ], "summary": "[2] 0 1 [A.226 A.249 A.227 A.247] 1 9", "num_nts": 5, "nts_short": "AGUAU", "nts_long": "///A/226,///A/227,///A/247,///A/248,///A/249", "num_stems": 2, "bridges": [ { "index": 1, "num_nts": 0, "nts_short": "", "nts_long": "" }, { "index": 2, "num_nts": 1, "nts_short": "A", "nts_long": "///A/248" } ] }, { "index": 4, "type": "bulge", "bridging_nts": [ 0, 1 ], "stem_indices": [ 13, 14 ], "summary": "[2] 0 1 [B.110 B.211 B.111 B.209] 4 2", "num_nts": 5, "nts_short": "GGCAC", "nts_long": "///B/110,///B/111,///B/209,///B/210,///B/211", "num_stems": 2, "bridges": [ { "index": 1, "num_nts": 0, "nts_short": "", "nts_long": "" }, { "index": 2, "num_nts": 1, "nts_short": "A", "nts_long": "///B/210" } ] }, { "index": 5, "type": "bulge", "bridging_nts": [ 1, 0 ], "stem_indices": [ 16, 17 ], "summary": "[2] 1 0 [B.130 B.192 B.132 B.191] 4 3", "num_nts": 5, "nts_short": "UACGA", "nts_long": "///B/130,///B/131,///B/132,///B/191,///B/192", "num_stems": 2, "bridges": [ { "index": 1, "num_nts": 1, "nts_short": "A", "nts_long": "///B/131" }, { "index": 2, "num_nts": 0, "nts_short": "", "nts_long": "" } ] }, { "index": 6, "type": "bulge", "bridging_nts": [ 0, 1 ], "stem_indices": [ -4, 22 ], "summary": "[2] 0 1 [B.226 B.249 B.227 B.247] 1 9", "num_nts": 5, "nts_short": "AGUAU", "nts_long": "///B/226,///B/227,///B/247,///B/248,///B/249", "num_stems": 2, "bridges": [ { "index": 1, "num_nts": 0, "nts_short": "", "nts_long": "" }, { "index": 2, "num_nts": 1, "nts_short": "A", "nts_long": "///B/248" } ] }, { "index": 7, "type": "bulge", "bridging_nts": [ 2, 0 ], "stem_indices": [ 10, -2 ], "summary": "[2] 2 0 [A.223 A.250 A.226 A.249] 4 1", "num_nts": 6, "nts_short": "CUAAUG", "nts_long": "///A/223,///A/224,///A/225,///A/226,///A/249,///A/250", "num_stems": 2, "bridges": [ { "index": 1, "num_nts": 2, "nts_short": "UA", "nts_long": "///A/224,///A/225" }, { "index": 2, "num_nts": 0, "nts_short": "", "nts_long": "" } ] }, { "index": 8, "type": "bulge", "bridging_nts": [ 2, 0 ], "stem_indices": [ 21, -4 ], "summary": "[2] 2 0 [B.223 B.250 B.226 B.249] 4 1", "num_nts": 6, "nts_short": "CUAAUG", "nts_long": "///B/223,///B/224,///B/225,///B/226,///B/249,///B/250", "num_stems": 2, "bridges": [ { "index": 1, "num_nts": 2, "nts_short": "UA", "nts_long": "///B/224,///B/225" }, { "index": 2, "num_nts": 0, "nts_short": "", "nts_long": "" } ] } ], "num_iloops": 8, "iloops": [ { "index": 1, "type": "asymmetric internal loop", "bridging_nts": [ 3, 2 ], "stem_indices": [ -1, 1 ], "summary": "[2] 3 2 [A.103 A.217 A.107 A.214] 1 4", "num_nts": 9, "nts_short": "GAAUUAGCC", "nts_long": "///A/103,///A/104,///A/105,///A/106,///A/107,///A/214,///A/215,///A/216,///A/217", "num_stems": 2, "bridges": [ { "index": 1, "num_nts": 3, "nts_short": "AAU", "nts_long": "///A/104,///A/105,///A/106" }, { "index": 2, "num_nts": 2, "nts_short": "GC", "nts_long": "///A/215,///A/216" } ] }, { "index": 2, "type": "asymmetric internal loop", "bridging_nts": [ 3, 2 ], "stem_indices": [ 2, 3 ], "summary": "[2] 3 2 [A.112 A.208 A.116 A.205] 2 6", "num_nts": 9, "nts_short": "GAAAGUAAC", "nts_long": "///A/112,///A/113,///A/114,///A/115,///A/116,///A/205,///A/206,///A/207,///A/208", "num_stems": 2, "bridges": [ { "index": 1, "num_nts": 3, "nts_short": "AAA", "nts_long": "///A/113,///A/114,///A/115" }, { "index": 2, "num_nts": 2, "nts_short": "AA", "nts_long": "///A/206,///A/207" } ] }, { "index": 3, "type": "asymmetric internal loop", "bridging_nts": [ 3, 2 ], "stem_indices": [ -3, 13 ], "summary": "[2] 3 2 [B.103 B.217 B.107 B.214] 1 4", "num_nts": 9, "nts_short": "GAAUUAGCC", "nts_long": "///B/103,///B/104,///B/105,///B/106,///B/107,///B/214,///B/215,///B/216,///B/217", "num_stems": 2, "bridges": [ { "index": 1, "num_nts": 3, "nts_short": "AAU", "nts_long": "///B/104,///B/105,///B/106" }, { "index": 2, "num_nts": 2, "nts_short": "GC", "nts_long": "///B/215,///B/216" } ] }, { "index": 4, "type": "asymmetric internal loop", "bridging_nts": [ 3, 2 ], "stem_indices": [ 14, 15 ], "summary": "[2] 3 2 [B.112 B.208 B.116 B.205] 2 6", "num_nts": 9, "nts_short": "GAAAGUAAC", "nts_long": "///B/112,///B/113,///B/114,///B/115,///B/116,///B/205,///B/206,///B/207,///B/208", "num_stems": 2, "bridges": [ { "index": 1, "num_nts": 3, "nts_short": "AAA", "nts_long": "///B/113,///B/114,///B/115" }, { "index": 2, "num_nts": 2, "nts_short": "AA", "nts_long": "///B/206,///B/207" } ] }, { "index": 5, "type": "asymmetric internal loop", "bridging_nts": [ 1, 6 ], "stem_indices": [ 5, 6 ], "summary": "[2] 1 6 [A.134 A.189 A.136 A.182] 3 3", "num_nts": 11, "nts_short": "GUAUAAUAAGC", "nts_long": "///A/134,///A/135,///A/136,///A/182,///A/183,///A/184,///A/185,///A/186,///A/187,///A/188,///A/189", "num_stems": 2, "bridges": [ { "index": 1, "num_nts": 1, "nts_short": "U", "nts_long": "///A/135" }, { "index": 2, "num_nts": 6, "nts_short": "AAUAAG", "nts_long": "///A/183,///A/184,///A/185,///A/186,///A/187,///A/188" } ] }, { "index": 6, "type": "asymmetric internal loop", "bridging_nts": [ 1, 6 ], "stem_indices": [ 17, 18 ], "summary": "[2] 1 6 [B.134 B.189 B.136 B.182] 3 3", "num_nts": 11, "nts_short": "GUAUAAUAAGC", "nts_long": "///B/134,///B/135,///B/136,///B/182,///B/183,///B/184,///B/185,///B/186,///B/187,///B/188,///B/189", "num_stems": 2, "bridges": [ { "index": 1, "num_nts": 1, "nts_short": "U", "nts_long": "///B/135" }, { "index": 2, "num_nts": 6, "nts_short": "AAUAAG", "nts_long": "///B/183,///B/184,///B/185,///B/186,///B/187,///B/188" } ] }, { "index": 7, "type": "asymmetric internal loop", "bridging_nts": [ 5, 4 ], "stem_indices": [ 3, 4 ], "summary": "[2] 5 4 [A.121 A.200 A.127 A.195] 6 4", "num_nts": 13, "nts_short": "CAACAGCGACAUG", "nts_long": "///A/121,///A/122,///A/123,///A/124,///A/125,///A/126,///A/127,///A/195,///A/196,///A/197,///A/198,///A/199,///A/200", "num_stems": 2, "bridges": [ { "index": 1, "num_nts": 5, "nts_short": "AACAG", "nts_long": "///A/122,///A/123,///A/124,///A/125,///A/126" }, { "index": 2, "num_nts": 4, "nts_short": "ACAU", "nts_long": "///A/196,///A/197,///A/198,///A/199" } ] }, { "index": 8, "type": "asymmetric internal loop", "bridging_nts": [ 5, 4 ], "stem_indices": [ 15, 16 ], "summary": "[2] 5 4 [B.121 B.200 B.127 B.195] 6 4", "num_nts": 13, "nts_short": "CAACAGCGACAUG", "nts_long": "///B/121,///B/122,///B/123,///B/124,///B/125,///B/126,///B/127,///B/195,///B/196,///B/197,///B/198,///B/199,///B/200", "num_stems": 2, "bridges": [ { "index": 1, "num_nts": 5, "nts_short": "AACAG", "nts_long": "///B/122,///B/123,///B/124,///B/125,///B/126" }, { "index": 2, "num_nts": 4, "nts_short": "ACAU", "nts_long": "///B/196,///B/197,///B/198,///B/199" } ] } ], "num_junctions": 2, "junctions": [ { "index": 1, "type": "3-way junction", "bridging_nts": [ 2, 2, 4 ], "stem_indices": [ 6, 7, 8 ], "summary": "[3] 2 2 4 [A.138 A.180 A.141 A.162 A.165 A.175] 3 9 2", "num_nts": 14, "nts_short": "CAAGUGGCGGUAUG", "nts_long": "///A/138,///A/139,///A/140,///A/141,///A/162,///A/163,///A/164,///A/165,///A/175,///A/176,///A/177,///A/178,///A/179,///A/180", "num_stems": 3, "bridges": [ { "index": 1, "num_nts": 2, "nts_short": "AA", "nts_long": "///A/139,///A/140" }, { "index": 2, "num_nts": 2, "nts_short": "GG", "nts_long": "///A/163,///A/164" }, { "index": 3, "num_nts": 4, "nts_short": "GUAU", "nts_long": "///A/176,///A/177,///A/178,///A/179" } ] }, { "index": 2, "type": "3-way junction", "bridging_nts": [ 2, 2, 4 ], "stem_indices": [ 18, 19, 20 ], "summary": "[3] 2 2 4 [B.138 B.180 B.141 B.162 B.165 B.175] 3 9 2", "num_nts": 14, "nts_short": "CAAGUGGCGGUAUG", "nts_long": "///B/138,///B/139,///B/140,///B/141,///B/162,///B/163,///B/164,///B/165,///B/175,///B/176,///B/177,///B/178,///B/179,///B/180", "num_stems": 3, "bridges": [ { "index": 1, "num_nts": 2, "nts_short": "AA", "nts_long": "///B/139,///B/140" }, { "index": 2, "num_nts": 2, "nts_short": "GG", "nts_long": "///B/163,///B/164" }, { "index": 3, "num_nts": 4, "nts_short": "GUAU", "nts_long": "///B/176,///B/177,///B/178,///B/179" } ] } ], "num_ssSegments": 4, "ssSegments": [ { "index": 1, "num_nts": 2, "nts_short": "AA", "nts_long": "///A/218,///A/219" }, { "index": 2, "num_nts": 5, "nts_short": "AGUUC", "nts_long": "///A/256,///A/257,///A/258,///A/259,///A/260" }, { "index": 3, "num_nts": 2, "nts_short": "AA", "nts_long": "///B/218,///B/219" }, { "index": 4, "num_nts": 5, "nts_short": "AGUUC", "nts_long": "///B/256,///B/257,///B/258,///B/259,///B/260" } ], "num_Aminors": 12, "Aminors": [ { "index": 1, "type": "X", "desc_short": "A vs A-U (WC)", "desc_long": "///A/131 vs ///B/230,///B/244", "A_nt1": { "desc": "///A/131 vs ///B/230", "face_type": "+", "hbonds_num": 0, "hbonds_desc": "" }, "A_nt2": { "desc": "///A/131 vs ///B/244", "face_type": "-", "hbonds_num": 2, "hbonds_desc": "N6(amino)-O2'(hydroxyl)[3.38],N1-O2'(hydroxyl)[3.33]" } }, { "index": 2, "type": "X", "desc_short": "A vs C-G (WC)", "desc_long": "///A/152 vs ///A/223,///A/250", "A_nt1": { "desc": "///A/152 vs ///A/223", "face_type": "-", "hbonds_num": 0, "hbonds_desc": "" }, "A_nt2": { "desc": "///A/152 vs ///A/250", "face_type": "+", "hbonds_num": 1, "hbonds_desc": "N6(amino)-O2'(hydroxyl)[2.89]" } }, { "index": 3, "type": "I", "desc_short": "A vs C-G (WC)", "desc_long": "///A/153 vs ///A/223,///A/250", "A_nt1": { "desc": "///A/153 vs ///A/223", "face_type": "-", "hbonds_num": 2, "hbonds_desc": "O2'(hydroxyl)-O2'(hydroxyl)[2.88],O2'(hydroxyl)-O2(carbonyl)[2.77]" }, "A_nt2": { "desc": "///A/153 vs ///A/250", "face_type": "+", "hbonds_num": 2, "hbonds_desc": "N1-O2'(hydroxyl)[3.21],N3-N2(amino)[2.79]" } }, { "index": 4, "type": "II", "desc_short": "A vs G-C (WC)", "desc_long": "///A/183 vs ///A/110,///A/211", "A_nt1": { "desc": "///A/183 vs ///A/110", "face_type": "-", "hbonds_num": 2, "hbonds_desc": "O2'(hydroxyl)-O2'(hydroxyl)[2.93],N3-O2'(hydroxyl)[2.65]" }, "A_nt2": { "desc": "///A/183 vs ///A/211", "face_type": "+", "hbonds_num": 0, "hbonds_desc": "" } }, { "index": 5, "type": "I", "desc_short": "A vs C-G (WC)", "desc_long": "///A/184 vs ///A/109,///A/212", "A_nt1": { "desc": "///A/184 vs ///A/109", "face_type": "-", "hbonds_num": 2, "hbonds_desc": "O2'(hydroxyl)-O2'(hydroxyl)[2.75],O2'(hydroxyl)-O2(carbonyl)[2.79]" }, "A_nt2": { "desc": "///A/184 vs ///A/212", "face_type": "+", "hbonds_num": 2, "hbonds_desc": "N1-O2'(hydroxyl)[2.56],N3-N2(amino)[3.05]" } }, { "index": 6, "type": "I", "desc_short": "A vs C-G (WC)", "desc_long": "///A/186 vs ///A/137,///A/181", "A_nt1": { "desc": "///A/186 vs ///A/137", "face_type": "-", "hbonds_num": 2, "hbonds_desc": "O2'(hydroxyl)-O2'(hydroxyl)[2.61],O2'(hydroxyl)-O2(carbonyl)[2.72]" }, "A_nt2": { "desc": "///A/186 vs ///A/181", "face_type": "+", "hbonds_num": 2, "hbonds_desc": "N1-O2'(hydroxyl)[2.48],N3-N2(amino)[2.92]" } }, { "index": 7, "type": "X", "desc_short": "A vs U-G (Wobble)", "desc_long": "///B/125 vs ///B/120,///B/201", "A_nt1": { "desc": "///B/125 vs ///B/120", "face_type": "+", "hbonds_num": 1, "hbonds_desc": "N6(amino)-O2'(hydroxyl)[2.30]" }, "A_nt2": { "desc": "///B/125 vs ///B/201", "face_type": "-", "hbonds_num": 0, "hbonds_desc": "" } }, { "index": 8, "type": "X", "desc_short": "A vs C-G (WC)", "desc_long": "///B/152 vs ///B/223,///B/250", "A_nt1": { "desc": "///B/152 vs ///B/223", "face_type": "-", "hbonds_num": 0, "hbonds_desc": "" }, "A_nt2": { "desc": "///B/152 vs ///B/250", "face_type": "+", "hbonds_num": 1, "hbonds_desc": "N6(amino)-O2'(hydroxyl)[2.91]" } }, { "index": 9, "type": "I", "desc_short": "A vs C-G (WC)", "desc_long": "///B/153 vs ///B/223,///B/250", "A_nt1": { "desc": "///B/153 vs ///B/223", "face_type": "-", "hbonds_num": 2, "hbonds_desc": "O2'(hydroxyl)-O2'(hydroxyl)[2.71],O2'(hydroxyl)-O2(carbonyl)[2.90]" }, "A_nt2": { "desc": "///B/153 vs ///B/250", "face_type": "+", "hbonds_num": 2, "hbonds_desc": "N1-O2'(hydroxyl)[3.16],N3-N2(amino)[2.78]" } }, { "index": 10, "type": "II", "desc_short": "A vs G-C (WC)", "desc_long": "///B/183 vs ///B/110,///B/211", "A_nt1": { "desc": "///B/183 vs ///B/110", "face_type": "-", "hbonds_num": 2, "hbonds_desc": "O2'(hydroxyl)-O2'(hydroxyl)[2.96],N3-O2'(hydroxyl)[2.73]" }, "A_nt2": { "desc": "///B/183 vs ///B/211", "face_type": "+", "hbonds_num": 0, "hbonds_desc": "" } }, { "index": 11, "type": "I", "desc_short": "A vs C-G (WC)", "desc_long": "///B/184 vs ///B/109,///B/212", "A_nt1": { "desc": "///B/184 vs ///B/109", "face_type": "-", "hbonds_num": 2, "hbonds_desc": "O2'(hydroxyl)-O2'(hydroxyl)[2.63],O2'(hydroxyl)-O2(carbonyl)[2.88]" }, "A_nt2": { "desc": "///B/184 vs ///B/212", "face_type": "+", "hbonds_num": 2, "hbonds_desc": "N1-O2'(hydroxyl)[2.62],N3-N2(amino)[2.94]" } }, { "index": 12, "type": "I", "desc_short": "A vs C-G (WC)", "desc_long": "///B/186 vs ///B/137,///B/181", "A_nt1": { "desc": "///B/186 vs ///B/137", "face_type": "-", "hbonds_num": 2, "hbonds_desc": "O2'(hydroxyl)-O2'(hydroxyl)[2.64],O2'(hydroxyl)-O2(carbonyl)[2.70]" }, "A_nt2": { "desc": "///B/186 vs ///B/181", "face_type": "+", "hbonds_num": 2, "hbonds_desc": "N1-O2'(hydroxyl)[2.63],N3-N2(amino)[2.82]" } } ], "num_riboseZippers": 4, "riboseZippers": [ { "index": 1, "num_nts": 4, "nts_short": "CGAA", "nts_long": "///A/109,///A/110,///A/183,///A/184" }, { "index": 2, "num_nts": 4, "nts_short": "AACU", "nts_long": "///A/152,///A/153,///A/223,///A/224" }, { "index": 3, "num_nts": 4, "nts_short": "CGAA", "nts_long": "///B/109,///B/110,///B/183,///B/184" }, { "index": 4, "num_nts": 4, "nts_short": "AACU", "nts_long": "///B/152,///B/153,///B/223,///B/224" } ], "num_splayUnits": 26, "splayUnits": [ { "index": 1, "num_nts": 3, "nts_short": "AUU", "nts_long": "///A/105,///A/106,///A/107" }, { "index": 2, "num_nts": 2, "nts_short": "CA", "nts_long": "///A/124,///A/125" }, { "index": 3, "num_nts": 3, "nts_short": "UAC", "nts_long": "///A/130,///A/131,///A/132" }, { "index": 4, "num_nts": 3, "nts_short": "UUG", "nts_long": "///A/167,///A/168,///A/169" }, { "index": 5, "num_nts": 4, "nts_short": "UAUG", "nts_long": "///A/177,///A/178,///A/179,///A/180" }, { "index": 6, "num_nts": 2, "nts_short": "UA", "nts_long": "///A/182,///A/183" }, { "index": 7, "num_nts": 3, "nts_short": "AUA", "nts_long": "///A/184,///A/185,///A/186" }, { "index": 8, "num_nts": 2, "nts_short": "GC", "nts_long": "///A/188,///A/189" }, { "index": 9, "num_nts": 3, "nts_short": "AUG", "nts_long": "///A/198,///A/199,///A/200" }, { "index": 10, "num_nts": 3, "nts_short": "CAC", "nts_long": "///A/209,///A/210,///A/211" }, { "index": 11, "num_nts": 2, "nts_short": "UC", "nts_long": "///A/236,///A/237" }, { "index": 12, "num_nts": 2, "nts_short": "UU", "nts_long": "///A/238,///A/239" }, { "index": 13, "num_nts": 2, "nts_short": "UG", "nts_long": "///A/253,///A/254" }, { "index": 14, "num_nts": 3, "nts_short": "AUU", "nts_long": "///B/105,///B/106,///B/107" }, { "index": 15, "num_nts": 3, "nts_short": "UAC", "nts_long": "///B/130,///B/131,///B/132" }, { "index": 16, "num_nts": 2, "nts_short": "GC", "nts_long": "///B/164,///B/165" }, { "index": 17, "num_nts": 3, "nts_short": "UUG", "nts_long": "///B/167,///B/168,///B/169" }, { "index": 18, "num_nts": 4, "nts_short": "UAUG", "nts_long": "///B/177,///B/178,///B/179,///B/180" }, { "index": 19, "num_nts": 2, "nts_short": "UA", "nts_long": "///B/182,///B/183" }, { "index": 20, "num_nts": 3, "nts_short": "AUA", "nts_long": "///B/184,///B/185,///B/186" }, { "index": 21, "num_nts": 2, "nts_short": "GC", "nts_long": "///B/188,///B/189" }, { "index": 22, "num_nts": 3, "nts_short": "AUG", "nts_long": "///B/198,///B/199,///B/200" }, { "index": 23, "num_nts": 3, "nts_short": "CAC", "nts_long": "///B/209,///B/210,///B/211" }, { "index": 24, "num_nts": 2, "nts_short": "UC", "nts_long": "///B/236,///B/237" }, { "index": 25, "num_nts": 2, "nts_short": "UU", "nts_long": "///B/238,///B/239" }, { "index": 26, "num_nts": 2, "nts_short": "UG", "nts_long": "///B/253,///B/254" } ], "pseudoknot_order": 1, "pseudoknot_nts": [ { "index": 1, "symbols": "[]", "num_nts": 8, "nts_short": "GCGCGCGC", "nts_long": "///A/169,///A/170,///A/254,///A/255,///B/169,///B/170,///B/254,///B/255" } ], "dbn": { "all_chains": { "num_nts": 316, "num_chars": 317, "bseq": "GAAUUGCGGGAAAGGGGUCAACAGCCGUACAGUACCAAGUCUCAGGGGAAACUUUGAGAUGGCCUUGCAAAGGGUAUGGUAAUAAGCUGACGGACAUGGUCCUAACCACGCAGCCAAGUCCUAAGUCAACAGAUCUUCUGUUGAUAUGGAUGCAGUUC&GAAUUGCGGGAAAGGGGUCAACAGCCGUACAGUACCAAGUCUCAGGGGAAACUUUGAGAUGGCCUUGCAAAGGGUAUGGUAAUAAGCUGACGGACAUGGUCCUAACCACGCAGCCAAGUCCUAAGUCAACAGAUCUUCUGUUGAUAUGGAUGCAGUUC", "sstr": "(...((((((...((((((.....((((.(((.(((..(((((((((....)))))))))..((..[[...))....)))......)))))))....))))))..)).))))..)..((((..((((((((((...))))))))).)))))[[.....&(...((((((...((((((.....((((.(((.(((..(((((((((....)))))))))..((..]]...))....)))......)))))))....))))))..)).))))..)..((((..((((((((((...))))))))).)))))]].....", "form": "....AA.AA...AAAA.A.....AAA...AAAAAA.A.AAAAAAAAA....AAAAAAAA...A...A..A.A.A....A.......AAA.AAAA...AAAAA...A..AAAAAA...AAAAA..AAAAAAAA....AAAAAAAA....AA.A....A-&.A..AA.AA..AAAA..A.....AAA...AAAAAA.A.AAAAAAAAA....AAAAAAAA...A...A...AA.A....A.......AAA.A.AA...A.AAA...A...AAAAA...AAAAA..AAAAAAAA....AAAAAAAA....AA.A....A-" }, "chain_A": { "num_nts": 158, "num_chars": 158, "bseq": "GAAUUGCGGGAAAGGGGUCAACAGCCGUACAGUACCAAGUCUCAGGGGAAACUUUGAGAUGGCCUUGCAAAGGGUAUGGUAAUAAGCUGACGGACAUGGUCCUAACCACGCAGCCAAGUCCUAAGUCAACAGAUCUUCUGUUGAUAUGGAUGCAGUUC", "sstr": "(...((((((...((((((.....((((.(((.(((..(((((((((....)))))))))..((..[[...))....)))......)))))))....))))))..)).))))..)..((((..((((((((((...))))))))).)))))[[.....", "form": "....AA.AA...AAAA.A.....AAA...AAAAAA.A.AAAAAAAAA....AAAAAAAA...A...A..A.A.A....A.......AAA.AAAA...AAAAA...A..AAAAAA...AAAAA..AAAAAAAA....AAAAAAAA....AA.A....A-" }, "chain_B": { "num_nts": 158, "num_chars": 158, "bseq": "GAAUUGCGGGAAAGGGGUCAACAGCCGUACAGUACCAAGUCUCAGGGGAAACUUUGAGAUGGCCUUGCAAAGGGUAUGGUAAUAAGCUGACGGACAUGGUCCUAACCACGCAGCCAAGUCCUAAGUCAACAGAUCUUCUGUUGAUAUGGAUGCAGUUC", "sstr": "(...((((((...((((((.....((((.(((.(((..(((((((((....)))))))))..((..]]...))....)))......)))))))....))))))..)).))))..)..((((..((((((((((...))))))))).)))))]].....", "form": ".A..AA.AA..AAAA..A.....AAA...AAAAAA.A.AAAAAAAAA....AAAAAAAA...A...A...AA.A....A.......AAA.A.AA...A.AAA...A...AAAAA...AAAAA..AAAAAAAA....AAAAAAAA....AA.A....A-" } }, "chains": { "chain_A": { "num_nts": 158, "bseq": "GAAUUGCGGGAAAGGGGUCAACAGCCGUACAGUACCAAGUCUCAGGGGAAACUUUGAGAUGGCCUUGCAAAGGGUAUGGUAAUAAGCUGACGGACAUGGUCCUAACCACGCAGCCAAGUCCUAAGUCAACAGAUCUUCUGUUGAUAUGGAUGCAGUUC", "sstr": "(...((((((...((((((.....((((.(((.(((..(((((((((....)))))))))..((..[[...))....)))......)))))))....))))))..)).))))..)..((((..((((((((((...))))))))).)))))[[.....", "form": "....AA.AA...AAAA.A.....AAA...AAAAAA.A.AAAAAAAAA....AAAAAAAA...A...A..A.A.A....A.......AAA.AAAA...AAAAA...A..AAAAAA...AAAAA..AAAAAAAA....AAAAAAAA....AA.A....A-", "helical_rise": 0.082, "helical_rise_std": 3.228, "helical_axis": [ -0.563, -0.594, -0.576 ], "point1": [ 46.949, 67.074, 82.880 ], "point2": [ 39.707, 59.433, 75.470 ], "num_chars": 472, "suite": "G!!A!!A2uU!!U1aG1cC1aG1aG1aG1aA&aA1aA1aG1aG1aG1aG1aU1aC!!A!!A1cC!!A2aG1aC1aC1aG!!U!!A!!C1aA1aG1aU1aA1aC1bC0aA1aA1aG1aU1aC1aU1aC1aA1aG1aG1aG1aG1gA1LA1aA!!C1aU1aU1aU1aG1aA1aG1aA1aU1aG1bG2aC1aC!!U6pU6dG1aC1tA!!A1aA1aG1aG1aG1aU3bA6pU2aG1cG1bU2aA1LA5pU!!A1fA!!G0aC1aU1aG1aA1aC1aG1aG1aA1aC3bA!!U!!G1aG1aU1aC1aC1aU1bA0aA1aC1aC7pA6jC1aG1aC1aA1aG1cC!!C1bA4gA1aG1aU1aC1aC1aU1bA4gA1aG1aU1aC1aA1aA1aC1aA!!G!!A!!U!!C!!U!!U1cC1aU1aG1aU1aU1aG1aA1aU!!A!!U1mG1cG1aA1aU3aG1aC1aA1LG1aU1aU1aC" }, "chain_B": { "num_nts": 158, "bseq": "GAAUUGCGGGAAAGGGGUCAACAGCCGUACAGUACCAAGUCUCAGGGGAAACUUUGAGAUGGCCUUGCAAAGGGUAUGGUAAUAAGCUGACGGACAUGGUCCUAACCACGCAGCCAAGUCCUAAGUCAACAGAUCUUCUGUUGAUAUGGAUGCAGUUC", "sstr": "(...((((((...((((((.....((((.(((.(((..(((((((((....)))))))))..((..]]...))....)))......)))))))....))))))..)).))))..)..((((..((((((((((...))))))))).)))))]].....", "form": ".A..AA.AA..AAAA..A.....AAA...AAAAAA.A.AAAAAAAAA....AAAAAAAA...A...A...AA.A....A.......AAA.A.AA...A.AAA...A...AAAAA...AAAAA..AAAAAAAA....AAAAAAAA....AA.A....A-", "helical_rise": 0.088, "helical_rise_std": 3.246, "helical_axis": [ 0.471, -0.724, 0.504 ], "point1": [ 64.698, 63.720, 65.200 ], "point2": [ 71.298, 53.559, 72.267 ], "num_chars": 472, "suite": "G1aA1bA!!U!!U1aG1cC1aG1aG1aG1aA7aA1aA1aG1aG1aG1cG1LU1aC!!A0bA0iC!!A1aG1aC1aC1aG!!U!!A!!C1aA1aG1aU1aA1aC1bC0aA1aA1aG1aU1aC1aU1aC1aA1aG1aG1aG1aG1gA1aA1aA!!C1aU1aU1aU1aG1aA1aG1aA1aU1aG1bG2aC1aC!!U6pU6dG1aC!!A!!A1aA1aG1aG1aG1aU!!A6pU2aG1cG1bU2aA1LA5pU!!A1fA!!G0aC1aU1aG1aA1aC1aG1aG1aA1aC3bA!!U!!G1aG1aU1aC1aC1aU1aA7aA1aC1bC!!A2aC1aG1aC1aA1aG1aC1aC1bA4gA1aG1aU1aC1aC1aU1bA4gA1aG1aU1aC1aA1aA1aC1aA!!G!!A!!U!!C!!U!!U1cC1aU1aG1aU1aU1aG1aA1aU1bA!!U1mG1cG1aA1aU3aG1aC1aA1aG1cU1aU1aC" } }, "num_nts": 316, "nts": [ { "index": 1, "index_chain": 1, "chain_name": "A", "nt_resnum": 103, "nt_name": "G", "nt_code": "G", "nt_id": "///A/103", "linked_nts": [ null, "///A/104" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,isolated-canonical,non-canonical,non-pair-contact,helix,multiplet,internal-loop", "alpha": null, "beta": -82.516, "gamma": -105.742, "delta": 93.040, "epsilon": -137.661, "zeta": -104.983, "epsilon_zeta": -32.678, "bb_type": "BI", "chi": 176.073, "glyco_bond": "anti", "C5prime_xyz": [ -1.046, 7.937, 1.941 ], "P_xyz": [ -1.620, 10.502, 1.701 ], "form": ".", "ssZp": 4.713, "Dp": 4.721, "splay_angle": 33.268, "splay_distance": 5.094, "splay_ratio": 0.290, "d22": null, "d64": null, "eta": null, "theta": 153.988, "eta_prime": null, "theta_prime": -178.117, "eta_base": null, "theta_base": -147.798, "v0": 17.145, "v1": -33.557, "v2": 36.251, "v3": -27.397, "v4": 6.629, "amplitude": 36.654, "phase_angle": 351.499, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.002, "frame": { "rmsd": 0.002, "origin": [ 51.631, 55.756, 91.204 ], "x_axis": [ -0.262, 0.703, -0.661 ], "y_axis": [ 0.691, -0.342, -0.637 ], "z_axis": [ -0.674, -0.623, -0.396 ], "quaternion": [ -0.006, 0.607, 0.574, -0.549 ] } }, { "index": 2, "index_chain": 2, "chain_name": "A", "nt_resnum": 104, "nt_name": "A", "nt_code": "A", "nt_id": "///A/104", "linked_nts": [ "///A/103", "///A/105" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,internal-loop,phosphate", "alpha": 8.617, "beta": 129.823, "gamma": 35.631, "delta": 80.883, "epsilon": -148.049, "zeta": -32.552, "epsilon_zeta": -115.497, "bb_type": "BI", "chi": -172.335, "glyco_bond": "anti", "C5prime_xyz": [ -2.067, 8.781, 1.063 ], "P_xyz": [ 0.378, 8.991, 1.987 ], "form": ".", "ssZp": 4.107, "Dp": 4.206, "splay_angle": 18.829, "splay_distance": 3.369, "splay_ratio": 0.172, "d22": null, "d64": null, "eta": -168.368, "theta": -112.305, "eta_prime": -148.102, "theta_prime": -123.203, "eta_base": -121.206, "theta_base": -102.751, "v0": -8.712, "v1": -13.315, "v2": 28.804, "v3": -34.833, "v4": 27.578, "amplitude": 34.387, "phase_angle": 33.108, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.039, "frame": { "rmsd": 0.006, "origin": [ 46.850, 54.021, 90.915 ], "x_axis": [ -0.002, 0.396, -0.918 ], "y_axis": [ 0.850, -0.484, -0.211 ], "z_axis": [ -0.528, -0.781, -0.335 ], "quaternion": [ 0.211, 0.674, 0.462, -0.536 ] } }, { "index": 3, "index_chain": 3, "chain_name": "A", "nt_resnum": 105, "nt_name": "A", "nt_code": "A", "nt_id": "///A/105", "linked_nts": [ "///A/104", "///A/106" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C2'-endo,non-canonical,non-pair-contact,helix,multiplet,internal-loop,splayed-apart", "alpha": -147.932, "beta": 113.112, "gamma": 165.180, "delta": 148.553, "epsilon": -110.920, "zeta": -64.644, "epsilon_zeta": -46.276, "bb_type": "--", "chi": -155.292, "glyco_bond": "anti", "C5prime_xyz": [ -1.649, 8.541, 0.763 ], "P_xyz": [ -0.361, 10.290, -0.733 ], "form": ".", "ssZp": 1.049, "Dp": 1.118, "splay_angle": 103.173, "splay_distance": 16.338, "splay_ratio": 0.784, "d22": null, "d64": null, "eta": -138.572, "theta": -138.370, "eta_prime": -140.368, "theta_prime": -127.513, "eta_base": -111.219, "theta_base": -119.324, "v0": -15.915, "v1": 31.632, "v2": -34.302, "v3": 26.087, "v4": -6.604, "amplitude": 34.640, "phase_angle": 171.989, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.036, "frame": { "rmsd": 0.005, "origin": [ 44.099, 53.072, 89.219 ], "x_axis": [ 0.541, 0.182, -0.821 ], "y_axis": [ 0.608, -0.759, 0.232 ], "z_axis": [ -0.581, -0.624, -0.522 ], "quaternion": [ 0.255, 0.840, 0.235, -0.417 ] } }, { "index": 4, "index_chain": 4, "chain_name": "A", "nt_resnum": 106, "nt_name": "U", "nt_code": "U", "nt_id": "///A/106", "linked_nts": [ "///A/105", "///A/107" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,anti,~C2'-endo,non-stack,internal-loop,splayed-apart", "alpha": -77.716, "beta": 138.102, "gamma": -179.193, "delta": 146.639, "epsilon": -105.025, "zeta": -133.589, "epsilon_zeta": 28.563, "bb_type": "--", "chi": -130.214, "glyco_bond": "anti", "C5prime_xyz": [ -2.105, 8.663, -0.626 ], "P_xyz": [ -1.568, 10.425, -2.486 ], "form": ".", "ssZp": 1.405, "Dp": 1.250, "splay_angle": 136.969, "splay_distance": 17.521, "splay_ratio": 0.931, "d22": 11.361, "d64": 14.312, "eta": -61.037, "theta": -128.422, "eta_prime": -35.857, "theta_prime": -163.712, "eta_base": -24.568, "theta_base": 134.197, "v0": -21.206, "v1": 35.300, "v2": -35.364, "v3": 23.861, "v4": -1.813, "amplitude": 36.756, "phase_angle": 164.183, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22t", "cluster": "2u", "suiteness": 0.262, "filter_rmsd": 0.105, "frame": { "rmsd": 0.009, "origin": [ 36.815, 38.812, 92.463 ], "x_axis": [ 0.048, -0.655, 0.754 ], "y_axis": [ 0.583, 0.631, 0.512 ], "z_axis": [ -0.811, 0.415, 0.412 ], "quaternion": [ 0.723, 0.033, -0.541, -0.428 ] } }, { "index": 5, "index_chain": 5, "chain_name": "A", "nt_resnum": 107, "nt_name": "U", "nt_code": "U", "nt_id": "///A/107", "linked_nts": [ "///A/106", "///A/108" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,internal-loop,phosphate,splayed-apart", "alpha": 86.996, "beta": 121.766, "gamma": 79.267, "delta": 79.570, "epsilon": -156.599, "zeta": -72.691, "epsilon_zeta": -83.908, "bb_type": "BI", "chi": -165.986, "glyco_bond": "anti", "C5prime_xyz": [ -1.375, 8.680, 0.873 ], "P_xyz": [ 0.874, 8.766, -0.483 ], "form": "A", "ssZp": 4.509, "Dp": 4.587, "splay_angle": 24.320, "splay_distance": 3.873, "splay_ratio": 0.214, "d22": null, "d64": null, "eta": -85.417, "theta": -144.364, "eta_prime": -15.755, "theta_prime": -157.129, "eta_base": 57.426, "theta_base": -147.257, "v0": 1.638, "v1": -24.250, "v2": 36.246, "v3": -36.385, "v4": 21.975, "amplitude": 37.750, "phase_angle": 16.229, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.105, "frame": { "rmsd": 0.004, "origin": [ 40.514, 54.934, 86.686 ], "x_axis": [ 0.728, -0.551, -0.409 ], "y_axis": [ -0.173, -0.724, 0.668 ], "z_axis": [ -0.664, -0.416, -0.622 ], "quaternion": [ 0.309, 0.877, -0.206, -0.306 ] } }, { "index": 6, "index_chain": 6, "chain_name": "A", "nt_resnum": 108, "nt_name": "G", "nt_code": "G", "nt_id": "///A/108", "linked_nts": [ "///A/107", "///A/109" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,phosphate", "alpha": -61.354, "beta": 174.960, "gamma": 53.564, "delta": 78.854, "epsilon": -150.585, "zeta": -100.968, "epsilon_zeta": -49.617, "bb_type": "BI", "chi": -159.360, "glyco_bond": "anti", "C5prime_xyz": [ -1.413, 8.786, 0.497 ], "P_xyz": [ 1.156, 9.300, 0.663 ], "form": "A", "ssZp": 4.438, "Dp": 4.649, "splay_angle": 19.921, "splay_distance": 3.431, "splay_ratio": 0.182, "d22": null, "d64": null, "eta": 171.786, "theta": -133.439, "eta_prime": -177.298, "theta_prime": -139.324, "eta_base": -148.127, "theta_base": -117.326, "v0": 1.221, "v1": -24.094, "v2": 36.458, "v3": -36.763, "v4": 22.383, "amplitude": 38.079, "phase_angle": 16.778, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.935, "filter_rmsd": 0.004, "frame": { "rmsd": 0.004, "origin": [ 38.612, 55.053, 83.315 ], "x_axis": [ 0.547, -0.832, -0.092 ], "y_axis": [ -0.515, -0.421, 0.747 ], "z_axis": [ -0.660, -0.361, -0.659 ], "quaternion": [ 0.342, 0.810, -0.416, -0.232 ] } }, { "index": 7, "index_chain": 7, "chain_name": "A", "nt_resnum": 109, "nt_name": "C", "nt_code": "C", "nt_id": "///A/109", "linked_nts": [ "///A/108", "///A/110" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,A-minor,ribose-zipper", "alpha": 133.565, "beta": -126.882, "gamma": -172.140, "delta": 81.043, "epsilon": -128.790, "zeta": -86.281, "epsilon_zeta": -42.509, "bb_type": "--", "chi": -172.692, "glyco_bond": "anti", "C5prime_xyz": [ -1.225, 8.588, 1.291 ], "P_xyz": [ 0.237, 9.950, -0.419 ], "form": ".", "ssZp": 4.653, "Dp": 4.734, "splay_angle": 31.163, "splay_distance": 4.963, "splay_ratio": 0.270, "d22": null, "d64": null, "eta": 171.068, "theta": -165.177, "eta_prime": -174.060, "theta_prime": -162.279, "eta_base": -133.765, "theta_base": -140.103, "v0": 2.964, "v1": -24.874, "v2": 36.115, "v3": -35.403, "v4": 20.428, "amplitude": 37.243, "phase_angle": 14.136, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.125, "filter_rmsd": 0.066, "frame": { "rmsd": 0.004, "origin": [ 38.535, 53.653, 80.183 ], "x_axis": [ 0.236, -0.950, 0.203 ], "y_axis": [ -0.833, -0.090, 0.546 ], "z_axis": [ -0.501, -0.298, -0.813 ], "quaternion": [ 0.288, 0.731, -0.610, -0.102 ] } }, { "index": 8, "index_chain": 8, "chain_name": "A", "nt_resnum": 110, "nt_name": "G", "nt_code": "G", "nt_id": "///A/110", "linked_nts": [ "///A/109", "///A/111" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,bulge,A-minor,ribose-zipper", "alpha": -48.628, "beta": 166.718, "gamma": 46.418, "delta": 79.848, "epsilon": -144.124, "zeta": -73.132, "epsilon_zeta": -70.992, "bb_type": "BI", "chi": -167.958, "glyco_bond": "anti", "C5prime_xyz": [ -1.550, 8.735, 0.981 ], "P_xyz": [ 0.955, 9.314, 1.429 ], "form": "A", "ssZp": 4.581, "Dp": 4.659, "splay_angle": 22.999, "splay_distance": 3.662, "splay_ratio": 0.202, "d22": null, "d64": null, "eta": 171.462, "theta": -143.187, "eta_prime": -175.906, "theta_prime": -140.670, "eta_base": -143.171, "theta_base": -103.489, "v0": 1.298, "v1": -24.315, "v2": 36.802, "v3": -37.048, "v4": 22.505, "amplitude": 38.419, "phase_angle": 16.680, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.563, "filter_rmsd": 0.002, "frame": { "rmsd": 0.002, "origin": [ 37.861, 51.674, 75.682 ], "x_axis": [ -0.103, -0.794, 0.599 ], "y_axis": [ -0.768, 0.446, 0.459 ], "z_axis": [ -0.632, -0.413, -0.656 ], "quaternion": [ -0.415, -0.526, 0.742, 0.015 ] } }, { "index": 9, "index_chain": 9, "chain_name": "A", "nt_resnum": 111, "nt_name": "G", "nt_code": "G", "nt_id": "///A/111", "linked_nts": [ "///A/110", "///A/112" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge", "alpha": -59.011, "beta": 167.448, "gamma": 52.659, "delta": 79.631, "epsilon": -144.415, "zeta": -76.796, "epsilon_zeta": -67.619, "bb_type": "BI", "chi": -164.880, "glyco_bond": "anti", "C5prime_xyz": [ -1.518, 8.764, 0.769 ], "P_xyz": [ 1.052, 9.254, 0.967 ], "form": "A", "ssZp": 4.516, "Dp": 4.656, "splay_angle": 23.287, "splay_distance": 3.714, "splay_ratio": 0.203, "d22": null, "d64": null, "eta": 167.641, "theta": -145.728, "eta_prime": -176.110, "theta_prime": -144.812, "eta_base": -123.156, "theta_base": -117.370, "v0": 1.046, "v1": -23.963, "v2": 36.505, "v3": -36.940, "v4": 22.644, "amplitude": 38.195, "phase_angle": 17.105, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.948, "filter_rmsd": 0.003, "frame": { "rmsd": 0.003, "origin": [ 36.538, 48.565, 74.270 ], "x_axis": [ -0.528, -0.314, 0.789 ], "y_axis": [ -0.577, 0.815, -0.061 ], "z_axis": [ -0.624, -0.488, -0.611 ], "quaternion": [ -0.411, -0.259, 0.859, -0.160 ] } }, { "index": 10, "index_chain": 10, "chain_name": "A", "nt_resnum": 112, "nt_name": "G", "nt_code": "G", "nt_id": "///A/112", "linked_nts": [ "///A/111", "///A/113" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop,phosphate", "alpha": -64.223, "beta": 164.375, "gamma": 57.533, "delta": 78.578, "epsilon": -135.527, "zeta": -71.217, "epsilon_zeta": -64.310, "bb_type": "BI", "chi": -166.481, "glyco_bond": "anti", "C5prime_xyz": [ -1.623, 8.729, 0.883 ], "P_xyz": [ 0.937, 9.284, 0.811 ], "form": ".", "ssZp": 4.583, "Dp": 4.736, "splay_angle": 28.580, "splay_distance": 4.459, "splay_ratio": 0.248, "d22": null, "d64": null, "eta": 166.545, "theta": -132.576, "eta_prime": 179.737, "theta_prime": -128.715, "eta_base": -137.936, "theta_base": -81.298, "v0": 2.426, "v1": -25.769, "v2": 38.105, "v3": -37.668, "v4": 22.213, "amplitude": 39.471, "phase_angle": 15.119, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.918, "filter_rmsd": 0.005, "frame": { "rmsd": 0.005, "origin": [ 34.606, 45.567, 73.233 ], "x_axis": [ -0.692, 0.219, 0.688 ], "y_axis": [ -0.240, 0.829, -0.505 ], "z_axis": [ -0.681, -0.514, -0.521 ], "quaternion": [ -0.393, -0.006, 0.872, -0.292 ] } }, { "index": 11, "index_chain": 11, "chain_name": "A", "nt_resnum": 113, "nt_name": "A", "nt_code": "A", "nt_id": "///A/113", "linked_nts": [ "///A/112", "///A/114" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop", "alpha": -56.107, "beta": 158.435, "gamma": 62.350, "delta": 82.689, "epsilon": -167.796, "zeta": -107.208, "epsilon_zeta": -60.588, "bb_type": "BI", "chi": -160.913, "glyco_bond": "anti", "C5prime_xyz": [ -1.550, 8.730, 0.594 ], "P_xyz": [ 1.019, 9.147, 0.287 ], "form": ".", "ssZp": 4.348, "Dp": 4.425, "splay_angle": 49.037, "splay_distance": 7.370, "splay_ratio": 0.415, "d22": null, "d64": null, "eta": 167.093, "theta": 169.963, "eta_prime": -165.030, "theta_prime": 170.659, "eta_base": -94.730, "theta_base": 176.800, "v0": 3.821, "v1": -24.862, "v2": 35.313, "v3": -34.094, "v4": 19.129, "amplitude": 36.202, "phase_angle": 12.724, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.729, "filter_rmsd": 0.038, "frame": { "rmsd": 0.004, "origin": [ 30.226, 45.197, 73.983 ], "x_axis": [ -0.623, 0.779, 0.071 ], "y_axis": [ 0.249, 0.283, -0.926 ], "z_axis": [ -0.742, -0.559, -0.370 ], "quaternion": [ -0.269, 0.341, 0.754, -0.492 ] } }, { "index": 12, "index_chain": 12, "chain_name": "A", "nt_resnum": 114, "nt_name": "A", "nt_code": "A", "nt_id": "///A/114", "linked_nts": [ "///A/113", "///A/115" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-canonical,non-pair-contact,helix,internal-loop", "alpha": -64.890, "beta": 178.864, "gamma": 62.003, "delta": 84.580, "epsilon": -125.220, "zeta": -85.435, "epsilon_zeta": -39.784, "bb_type": "--", "chi": -170.751, "glyco_bond": "anti", "C5prime_xyz": [ -1.303, 8.529, 1.210 ], "P_xyz": [ 1.257, 8.656, 1.761 ], "form": ".", "ssZp": 4.530, "Dp": 4.664, "splay_angle": 26.455, "splay_distance": 4.051, "splay_ratio": 0.232, "d22": null, "d64": null, "eta": -166.797, "theta": -132.096, "eta_prime": -176.991, "theta_prime": -127.690, "eta_base": 176.687, "theta_base": -72.749, "v0": 2.457, "v1": -23.147, "v2": 33.844, "v3": -33.416, "v4": 19.587, "amplitude": 34.996, "phase_angle": 14.737, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "&a", "suiteness": 0.740, "filter_rmsd": 0.039, "frame": { "rmsd": 0.005, "origin": [ 29.804, 37.849, 73.600 ], "x_axis": [ -0.492, 0.843, 0.219 ], "y_axis": [ 0.357, 0.424, -0.832 ], "z_axis": [ -0.794, -0.331, -0.509 ], "quaternion": [ -0.325, 0.385, 0.779, -0.374 ] } }, { "index": 13, "index_chain": 13, "chain_name": "A", "nt_resnum": 115, "nt_name": "A", "nt_code": "A", "nt_id": "///A/115", "linked_nts": [ "///A/114", "///A/116" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-pair-contact,internal-loop", "alpha": -51.951, "beta": 154.419, "gamma": 47.159, "delta": 84.092, "epsilon": -136.873, "zeta": -92.121, "epsilon_zeta": -44.752, "bb_type": "BI", "chi": -157.121, "glyco_bond": "anti", "C5prime_xyz": [ -0.782, 8.519, 0.419 ], "P_xyz": [ 1.823, 8.170, 0.257 ], "form": "A", "ssZp": 4.358, "Dp": 4.755, "splay_angle": 19.745, "splay_distance": 3.049, "splay_ratio": 0.172, "d22": null, "d64": null, "eta": 160.503, "theta": -147.193, "eta_prime": -179.312, "theta_prime": -148.569, "eta_base": -107.292, "theta_base": -139.937, "v0": 8.309, "v1": -28.129, "v2": 36.201, "v3": -32.438, "v4": 15.280, "amplitude": 36.386, "phase_angle": 5.781, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.513, "filter_rmsd": 0.039, "frame": { "rmsd": 0.008, "origin": [ 26.505, 39.137, 71.633 ], "x_axis": [ 0.054, 0.847, -0.529 ], "y_axis": [ 0.486, -0.485, -0.727 ], "z_axis": [ -0.872, -0.218, -0.438 ], "quaternion": [ -0.181, 0.703, 0.474, -0.498 ] } }, { "index": 14, "index_chain": 14, "chain_name": "A", "nt_resnum": 116, "nt_name": "G", "nt_code": "G", "nt_id": "///A/116", "linked_nts": [ "///A/115", "///A/117" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop", "alpha": -57.281, "beta": 153.377, "gamma": 54.482, "delta": 81.210, "epsilon": -148.605, "zeta": -77.346, "epsilon_zeta": -71.259, "bb_type": "BI", "chi": -156.042, "glyco_bond": "anti", "C5prime_xyz": [ -1.095, 8.684, 0.305 ], "P_xyz": [ 1.458, 8.679, -0.262 ], "form": "A", "ssZp": 4.377, "Dp": 4.704, "splay_angle": 20.317, "splay_distance": 3.228, "splay_ratio": 0.178, "d22": null, "d64": null, "eta": 162.232, "theta": -144.962, "eta_prime": 174.994, "theta_prime": -148.491, "eta_base": -158.713, "theta_base": -134.762, "v0": 6.689, "v1": -28.306, "v2": 38.071, "v3": -35.191, "v4": 17.931, "amplitude": 38.524, "phase_angle": 8.794, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.578, "filter_rmsd": 0.004, "frame": { "rmsd": 0.004, "origin": [ 23.513, 38.753, 71.185 ], "x_axis": [ 0.313, 0.608, -0.730 ], "y_axis": [ 0.236, -0.794, -0.560 ], "z_axis": [ -0.920, 0.003, -0.392 ], "quaternion": [ -0.178, 0.790, 0.267, -0.522 ] } }, { "index": 15, "index_chain": 15, "chain_name": "A", "nt_resnum": 117, "nt_name": "G", "nt_code": "G", "nt_id": "///A/117", "linked_nts": [ "///A/116", "///A/118" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -56.409, "beta": 166.826, "gamma": 51.185, "delta": 78.917, "epsilon": -137.517, "zeta": -75.926, "epsilon_zeta": -61.591, "bb_type": "BI", "chi": -154.660, "glyco_bond": "anti", "C5prime_xyz": [ -1.363, 8.794, 0.263 ], "P_xyz": [ 1.221, 9.209, 0.127 ], "form": "A", "ssZp": 4.263, "Dp": 4.724, "splay_angle": 23.077, "splay_distance": 3.794, "splay_ratio": 0.203, "d22": null, "d64": null, "eta": 170.176, "theta": -139.727, "eta_prime": -178.550, "theta_prime": -138.866, "eta_base": -148.534, "theta_base": -114.596, "v0": 3.486, "v1": -26.335, "v2": 38.012, "v3": -37.003, "v4": 21.049, "amplitude": 39.103, "phase_angle": 13.567, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.902, "filter_rmsd": 0.004, "frame": { "rmsd": 0.004, "origin": [ 20.715, 40.190, 70.460 ], "x_axis": [ 0.482, 0.193, -0.855 ], "y_axis": [ -0.073, -0.963, -0.258 ], "z_axis": [ -0.873, 0.187, -0.451 ], "quaternion": [ -0.131, 0.851, 0.035, -0.508 ] } }, { "index": 16, "index_chain": 16, "chain_name": "A", "nt_resnum": 118, "nt_name": "G", "nt_code": "G", "nt_id": "///A/118", "linked_nts": [ "///A/117", "///A/119" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -59.833, "beta": 161.804, "gamma": 55.942, "delta": 76.450, "epsilon": -154.240, "zeta": -76.895, "epsilon_zeta": -77.345, "bb_type": "BI", "chi": -163.403, "glyco_bond": "anti", "C5prime_xyz": [ -1.923, 8.809, 0.753 ], "P_xyz": [ 0.567, 9.633, 0.691 ], "form": "A", "ssZp": 4.537, "Dp": 4.616, "splay_angle": 26.111, "splay_distance": 4.212, "splay_ratio": 0.231, "d22": null, "d64": null, "eta": 161.067, "theta": -153.898, "eta_prime": 178.084, "theta_prime": -154.887, "eta_base": -139.940, "theta_base": -133.228, "v0": -0.188, "v1": -24.094, "v2": 37.821, "v3": -38.988, "v4": 24.663, "amplitude": 39.965, "phase_angle": 18.853, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.843, "filter_rmsd": 0.008, "frame": { "rmsd": 0.008, "origin": [ 18.889, 42.178, 67.794 ], "x_axis": [ 0.642, -0.363, -0.676 ], "y_axis": [ -0.354, -0.922, 0.159 ], "z_axis": [ -0.680, 0.137, -0.720 ], "quaternion": [ 0.006, 0.906, -0.198, -0.374 ] } }, { "index": 17, "index_chain": 17, "chain_name": "A", "nt_resnum": 119, "nt_name": "G", "nt_code": "G", "nt_id": "///A/119", "linked_nts": [ "///A/118", "///A/120" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -57.631, "beta": 170.765, "gamma": 52.446, "delta": 78.495, "epsilon": -129.993, "zeta": -76.578, "epsilon_zeta": -53.416, "bb_type": "BI", "chi": -174.171, "glyco_bond": "anti", "C5prime_xyz": [ -1.830, 8.669, 1.313 ], "P_xyz": [ 0.635, 9.355, 1.908 ], "form": ".", "ssZp": 4.670, "Dp": 4.713, "splay_angle": 24.501, "splay_distance": 3.869, "splay_ratio": 0.214, "d22": null, "d64": null, "eta": 174.281, "theta": -136.540, "eta_prime": -178.186, "theta_prime": -132.057, "eta_base": -145.258, "theta_base": -80.277, "v0": 0.797, "v1": -24.039, "v2": 36.885, "v3": -37.337, "v4": 22.993, "amplitude": 38.646, "phase_angle": 17.363, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.874, "filter_rmsd": 0.004, "frame": { "rmsd": 0.004, "origin": [ 17.623, 44.275, 64.368 ], "x_axis": [ 0.530, -0.769, -0.358 ], "y_axis": [ -0.563, -0.634, 0.530 ], "z_axis": [ -0.634, -0.080, -0.769 ], "quaternion": [ 0.178, 0.856, -0.389, -0.290 ] } }, { "index": 18, "index_chain": 18, "chain_name": "A", "nt_resnum": 120, "nt_name": "U", "nt_code": "U", "nt_id": "///A/120", "linked_nts": [ "///A/119", "///A/121" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet", "alpha": -59.232, "beta": 155.327, "gamma": 62.719, "delta": 80.560, "epsilon": -147.360, "zeta": -83.123, "epsilon_zeta": -64.237, "bb_type": "BI", "chi": -162.183, "glyco_bond": "anti", "C5prime_xyz": [ -1.571, 8.762, 0.630 ], "P_xyz": [ 0.972, 9.254, 0.231 ], "form": "A", "ssZp": 4.458, "Dp": 4.615, "splay_angle": 23.453, "splay_distance": 3.746, "splay_ratio": 0.205, "d22": 4.735, "d64": 4.572, "eta": 164.118, "theta": -153.255, "eta_prime": -173.050, "theta_prime": -155.518, "eta_base": -102.392, "theta_base": -142.936, "v0": 0.633, "v1": -22.771, "v2": 35.013, "v3": -35.574, "v4": 22.002, "amplitude": 36.732, "phase_angle": 17.595, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.647, "filter_rmsd": 0.105, "frame": { "rmsd": 0.003, "origin": [ 17.506, 41.978, 61.256 ], "x_axis": [ -0.095, -0.991, 0.098 ], "y_axis": [ -0.876, 0.130, 0.465 ], "z_axis": [ -0.474, -0.041, -0.880 ], "quaternion": [ -0.197, -0.643, 0.725, 0.146 ] } }, { "index": 19, "index_chain": 19, "chain_name": "A", "nt_resnum": 121, "nt_name": "C", "nt_code": "C", "nt_id": "///A/121", "linked_nts": [ "///A/120", "///A/122" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,internal-loop,cap-donor", "alpha": -68.261, "beta": 174.218, "gamma": 55.683, "delta": 82.634, "epsilon": -122.770, "zeta": -54.990, "epsilon_zeta": -67.780, "bb_type": "--", "chi": -158.944, "glyco_bond": "anti", "C5prime_xyz": [ -1.342, 8.816, 0.428 ], "P_xyz": [ 1.237, 9.269, 0.641 ], "form": ".", "ssZp": 4.193, "Dp": 4.646, "splay_angle": 43.049, "splay_distance": 7.586, "splay_ratio": 0.372, "d22": null, "d64": null, "eta": 175.171, "theta": -129.280, "eta_prime": 179.786, "theta_prime": -137.305, "eta_base": -160.038, "theta_base": -151.831, "v0": -0.085, "v1": -21.426, "v2": 33.451, "v3": -34.479, "v4": 21.828, "amplitude": 35.328, "phase_angle": 18.759, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.883, "filter_rmsd": 0.064, "frame": { "rmsd": 0.002, "origin": [ 17.453, 41.762, 57.517 ], "x_axis": [ -0.360, -0.780, 0.512 ], "y_axis": [ -0.780, 0.553, 0.293 ], "z_axis": [ -0.512, -0.294, -0.807 ], "quaternion": [ -0.310, -0.473, 0.825, -0.000 ] } }, { "index": 20, "index_chain": 20, "chain_name": "A", "nt_resnum": 122, "nt_name": "A", "nt_code": "A", "nt_id": "///A/122", "linked_nts": [ "///A/121", "///A/123" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,anti,~C2'-endo,BII,non-pair-contact,internal-loop", "alpha": -136.797, "beta": 94.019, "gamma": -166.040, "delta": 147.357, "epsilon": -119.696, "zeta": 159.064, "epsilon_zeta": 81.241, "bb_type": "BII", "chi": -128.692, "glyco_bond": "anti", "C5prime_xyz": [ -1.957, 8.628, -0.750 ], "P_xyz": [ -2.525, 10.215, -2.773 ], "form": ".", "ssZp": 1.394, "Dp": 1.375, "splay_angle": 32.190, "splay_distance": 5.309, "splay_ratio": 0.295, "d22": null, "d64": null, "eta": -125.012, "theta": 49.047, "eta_prime": -135.019, "theta_prime": 57.472, "eta_base": -156.107, "theta_base": 70.945, "v0": -20.638, "v1": 35.114, "v2": -35.404, "v3": 24.374, "v4": -2.518, "amplitude": 36.624, "phase_angle": 165.165, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.037, "frame": { "rmsd": 0.003, "origin": [ 16.853, 40.300, 50.097 ], "x_axis": [ -0.169, -0.874, 0.457 ], "y_axis": [ -0.848, 0.365, 0.384 ], "z_axis": [ -0.502, -0.322, -0.803 ], "quaternion": [ -0.314, -0.563, 0.764, 0.020 ] } }, { "index": 21, "index_chain": 21, "chain_name": "A", "nt_resnum": 123, "nt_name": "A", "nt_code": "A", "nt_id": "///A/123", "linked_nts": [ "///A/122", "///A/124" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,internal-loop", "alpha": -113.146, "beta": 75.540, "gamma": 128.786, "delta": 80.212, "epsilon": 162.010, "zeta": -88.275, "epsilon_zeta": -109.714, "bb_type": "BI", "chi": -99.825, "glyco_bond": "anti", "C5prime_xyz": [ -2.278, 7.681, -2.693 ], "P_xyz": [ -3.312, 5.928, -4.350 ], "form": ".", "ssZp": 1.708, "Dp": 4.107, "splay_angle": 47.862, "splay_distance": 8.120, "splay_ratio": 0.406, "d22": null, "d64": null, "eta": -156.645, "theta": 133.332, "eta_prime": -173.479, "theta_prime": 138.206, "eta_base": -171.184, "theta_base": 137.143, "v0": -0.102, "v1": -21.631, "v2": 33.837, "v3": -34.931, "v4": 22.179, "amplitude": 35.758, "phase_angle": 18.864, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.039, "frame": { "rmsd": 0.006, "origin": [ 17.693, 45.233, 51.869 ], "x_axis": [ 0.786, 0.290, -0.546 ], "y_axis": [ -0.434, 0.888, -0.154 ], "z_axis": [ 0.440, 0.358, 0.823 ], "quaternion": [ 0.935, -0.137, 0.264, 0.194 ] } }, { "index": 22, "index_chain": 22, "chain_name": "A", "nt_resnum": 124, "nt_name": "C", "nt_code": "C", "nt_id": "///A/124", "linked_nts": [ "///A/123", "///A/125" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BII,non-canonical,non-pair-contact,helix-end,multiplet,internal-loop,cap-acceptor,splayed-apart", "alpha": -173.379, "beta": -164.918, "gamma": 153.524, "delta": 86.539, "epsilon": -105.397, "zeta": -154.491, "epsilon_zeta": 49.093, "bb_type": "BII", "chi": -166.921, "glyco_bond": "anti", "C5prime_xyz": [ -1.625, 8.835, 0.868 ], "P_xyz": [ 0.418, 10.060, -0.230 ], "form": ".", "ssZp": 3.966, "Dp": 4.275, "splay_angle": 89.120, "splay_distance": 11.671, "splay_ratio": 0.718, "d22": null, "d64": null, "eta": -175.647, "theta": 178.548, "eta_prime": 174.889, "theta_prime": 161.924, "eta_base": 175.924, "theta_base": 95.892, "v0": -6.440, "v1": -13.617, "v2": 27.089, "v3": -31.600, "v4": 24.078, "amplitude": 31.339, "phase_angle": 30.188, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.010, "filter_rmsd": 0.065, "frame": { "rmsd": 0.007, "origin": [ 17.766, 48.016, 59.497 ], "x_axis": [ 0.691, -0.116, -0.713 ], "y_axis": [ -0.531, 0.588, -0.610 ], "z_axis": [ 0.491, 0.800, 0.345 ], "quaternion": [ 0.810, -0.435, 0.372, 0.128 ] } }, { "index": 23, "index_chain": 23, "chain_name": "A", "nt_resnum": 125, "nt_name": "A", "nt_code": "A", "nt_id": "///A/125", "linked_nts": [ "///A/124", "///A/126" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,syn,~C2'-endo,non-stack,non-pair-contact,internal-loop,splayed-apart", "alpha": 160.983, "beta": -143.752, "gamma": 57.399, "delta": 142.942, "epsilon": -105.012, "zeta": -74.611, "epsilon_zeta": -30.400, "bb_type": "--", "chi": 79.202, "glyco_bond": "syn", "C5prime_xyz": [ -5.131, 4.461, 1.984 ], "P_xyz": [ -5.882, 1.997, 1.415 ], "form": ".", "ssZp": -1.027, "Dp": 1.117, "splay_angle": 76.283, "splay_distance": 11.863, "splay_ratio": 0.618, "d22": null, "d64": null, "eta": 85.981, "theta": -58.357, "eta_prime": 101.183, "theta_prime": -69.783, "eta_base": 82.631, "theta_base": -46.859, "v0": -22.359, "v1": 34.649, "v2": -33.057, "v3": 21.065, "v4": 0.629, "amplitude": 35.128, "phase_angle": 160.228, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.040, "frame": { "rmsd": 0.008, "origin": [ 7.541, 53.483, 60.829 ], "x_axis": [ -0.859, -0.108, 0.501 ], "y_axis": [ 0.336, 0.619, 0.710 ], "z_axis": [ -0.387, 0.778, -0.495 ], "quaternion": [ -0.257, 0.066, 0.862, 0.432 ] } }, { "index": 24, "index_chain": 24, "chain_name": "A", "nt_resnum": 126, "nt_name": "G", "nt_code": "G", "nt_id": "///A/126", "linked_nts": [ "///A/125", "///A/127" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop", "alpha": -73.233, "beta": 177.535, "gamma": 56.916, "delta": 80.131, "epsilon": -133.945, "zeta": -77.437, "epsilon_zeta": -56.508, "bb_type": "BI", "chi": -172.949, "glyco_bond": "anti", "C5prime_xyz": [ -1.485, 8.599, 1.295 ], "P_xyz": [ 1.050, 8.979, 1.845 ], "form": "A", "ssZp": 4.674, "Dp": 4.727, "splay_angle": 21.914, "splay_distance": 3.436, "splay_ratio": 0.192, "d22": null, "d64": null, "eta": 156.816, "theta": -138.403, "eta_prime": -162.485, "theta_prime": -134.433, "eta_base": -143.606, "theta_base": -91.496, "v0": 2.725, "v1": -25.091, "v2": 36.772, "v3": -36.157, "v4": 21.055, "amplitude": 37.993, "phase_angle": 14.560, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "2a", "suiteness": 0.852, "filter_rmsd": 0.002, "frame": { "rmsd": 0.002, "origin": [ 18.647, 52.342, 56.817 ], "x_axis": [ -0.422, 0.684, -0.595 ], "y_axis": [ -0.416, 0.438, 0.797 ], "z_axis": [ 0.806, 0.584, 0.099 ], "quaternion": [ 0.528, 0.101, 0.663, 0.521 ] } }, { "index": 25, "index_chain": 25, "chain_name": "A", "nt_resnum": 127, "nt_name": "C", "nt_code": "C", "nt_id": "///A/127", "linked_nts": [ "///A/126", "///A/128" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop", "alpha": -60.381, "beta": 165.545, "gamma": 55.483, "delta": 82.632, "epsilon": -141.790, "zeta": -71.148, "epsilon_zeta": -70.642, "bb_type": "BI", "chi": -156.859, "glyco_bond": "anti", "C5prime_xyz": [ -1.317, 8.781, 0.355 ], "P_xyz": [ 1.281, 9.101, 0.228 ], "form": "A", "ssZp": 4.319, "Dp": 4.646, "splay_angle": 27.588, "splay_distance": 4.374, "splay_ratio": 0.238, "d22": 3.881, "d64": 3.611, "eta": 166.834, "theta": -136.072, "eta_prime": -176.132, "theta_prime": -136.261, "eta_base": -118.238, "theta_base": -102.646, "v0": 3.196, "v1": -24.247, "v2": 34.887, "v3": -33.995, "v4": 19.470, "amplitude": 35.897, "phase_angle": 13.623, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.847, "filter_rmsd": 0.063, "frame": { "rmsd": 0.002, "origin": [ 20.212, 54.998, 55.300 ], "x_axis": [ -0.613, 0.782, 0.111 ], "y_axis": [ 0.146, -0.026, 0.989 ], "z_axis": [ 0.776, 0.623, -0.098 ], "quaternion": [ 0.256, 0.357, 0.649, 0.621 ] } }, { "index": 26, "index_chain": 26, "chain_name": "A", "nt_resnum": 128, "nt_name": "C", "nt_code": "C", "nt_id": "///A/128", "linked_nts": [ "///A/127", "///A/129" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -68.165, "beta": 179.316, "gamma": 47.407, "delta": 80.279, "epsilon": -146.463, "zeta": -75.463, "epsilon_zeta": -71.000, "bb_type": "BI", "chi": -164.692, "glyco_bond": "anti", "C5prime_xyz": [ -1.170, 8.680, 0.790 ], "P_xyz": [ 1.385, 8.996, 1.285 ], "form": "A", "ssZp": 4.571, "Dp": 4.698, "splay_angle": 21.845, "splay_distance": 3.379, "splay_ratio": 0.190, "d22": null, "d64": null, "eta": 160.756, "theta": -147.897, "eta_prime": 175.270, "theta_prime": -145.196, "eta_base": -134.317, "theta_base": -114.681, "v0": 5.135, "v1": -27.102, "v2": 37.574, "v3": -35.597, "v4": 19.195, "amplitude": 38.282, "phase_angle": 11.037, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.911, "filter_rmsd": 0.065, "frame": { "rmsd": 0.003, "origin": [ 21.752, 59.082, 55.014 ], "x_axis": [ -0.646, 0.235, 0.726 ], "y_axis": [ 0.524, -0.555, 0.646 ], "z_axis": [ 0.555, 0.798, 0.235 ], "quaternion": [ -0.093, 0.410, 0.462, 0.780 ] } }, { "index": 27, "index_chain": 27, "chain_name": "A", "nt_resnum": 129, "nt_name": "G", "nt_code": "G", "nt_id": "///A/129", "linked_nts": [ "///A/128", "///A/130" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -63.780, "beta": 166.142, "gamma": 58.421, "delta": 82.731, "epsilon": -138.752, "zeta": -85.937, "epsilon_zeta": -52.815, "bb_type": "BI", "chi": -170.866, "glyco_bond": "anti", "C5prime_xyz": [ -1.360, 8.594, 1.184 ], "P_xyz": [ 1.248, 8.826, 1.441 ], "form": ".", "ssZp": 4.604, "Dp": 4.687, "splay_angle": 28.807, "splay_distance": 4.590, "splay_ratio": 0.251, "d22": null, "d64": null, "eta": 170.207, "theta": -148.972, "eta_prime": -175.952, "theta_prime": -145.048, "eta_base": -131.853, "theta_base": -133.348, "v0": 3.183, "v1": -24.894, "v2": 35.790, "v3": -35.032, "v4": 20.088, "amplitude": 36.852, "phase_angle": 13.794, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.930, "filter_rmsd": 0.006, "frame": { "rmsd": 0.006, "origin": [ 22.171, 62.358, 55.727 ], "x_axis": [ -0.327, -0.251, 0.911 ], "y_axis": [ 0.817, -0.560, 0.139 ], "z_axis": [ 0.475, 0.789, 0.388 ], "quaternion": [ -0.354, 0.460, 0.308, 0.754 ] } }, { "index": 28, "index_chain": 28, "chain_name": "A", "nt_resnum": 130, "nt_name": "U", "nt_code": "U", "nt_id": "///A/130", "linked_nts": [ "///A/129", "///A/131" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,BII,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge,splayed-apart", "alpha": -68.489, "beta": 155.423, "gamma": 88.196, "delta": 108.663, "epsilon": -97.307, "zeta": -175.263, "epsilon_zeta": 77.956, "bb_type": "BII", "chi": -172.013, "glyco_bond": "anti", "C5prime_xyz": [ -2.081, 8.697, 1.185 ], "P_xyz": [ 0.458, 9.300, 1.586 ], "form": ".", "ssZp": 2.512, "Dp": 2.560, "splay_angle": 122.407, "splay_distance": 18.156, "splay_ratio": 0.876, "d22": null, "d64": null, "eta": -149.720, "theta": -145.661, "eta_prime": -141.505, "theta_prime": -157.227, "eta_base": -127.700, "theta_base": -155.908, "v0": -16.172, "v1": 10.996, "v2": -2.119, "v3": -7.048, "v4": 14.404, "amplitude": 15.939, "phase_angle": 97.641, "puckering": "O4'-endo", "sugar_class": "--", "bin": "33p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.101, "frame": { "rmsd": 0.018, "origin": [ 22.470, 66.835, 56.697 ], "x_axis": [ -0.109, -0.618, 0.779 ], "y_axis": [ 0.831, -0.486, -0.270 ], "z_axis": [ 0.546, 0.618, 0.566 ], "quaternion": [ -0.493, 0.450, 0.118, 0.735 ] } }, { "index": 29, "index_chain": 29, "chain_name": "A", "nt_resnum": 131, "nt_name": "A", "nt_code": "A", "nt_id": "///A/131", "linked_nts": [ "///A/130", "///A/132" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,anti,~C2'-endo,non-stack,non-pair-contact,bulge,A-minor,splayed-apart", "alpha": 47.149, "beta": 73.372, "gamma": -157.238, "delta": 117.763, "epsilon": 53.367, "zeta": 162.446, "epsilon_zeta": -109.079, "bb_type": "--", "chi": -107.520, "glyco_bond": "anti", "C5prime_xyz": [ -2.994, 8.271, -1.886 ], "P_xyz": [ -5.085, 8.482, -3.547 ], "form": ".", "ssZp": 1.171, "Dp": 1.451, "splay_angle": 164.378, "splay_distance": 18.645, "splay_ratio": 0.991, "d22": null, "d64": null, "eta": 74.211, "theta": -118.423, "eta_prime": 52.278, "theta_prime": -103.559, "eta_base": 20.168, "theta_base": -122.544, "v0": -27.304, "v1": 32.262, "v2": -24.390, "v3": 9.577, "v4": 10.925, "amplitude": 31.410, "phase_angle": 140.941, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.034, "frame": { "rmsd": 0.014, "origin": [ 34.152, 77.370, 47.630 ], "x_axis": [ -0.088, 0.172, -0.981 ], "y_axis": [ -0.703, -0.709, -0.062 ], "z_axis": [ -0.706, 0.684, 0.184 ], "quaternion": [ 0.311, -0.599, 0.221, 0.704 ] } }, { "index": 30, "index_chain": 30, "chain_name": "A", "nt_resnum": 132, "nt_name": "C", "nt_code": "C", "nt_id": "///A/132", "linked_nts": [ "///A/131", "///A/133" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,non-stack,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge,phosphate,splayed-apart", "alpha": -75.170, "beta": 126.521, "gamma": 101.271, "delta": 78.392, "epsilon": -156.218, "zeta": -75.564, "epsilon_zeta": -80.655, "bb_type": "BI", "chi": -173.804, "glyco_bond": "anti", "C5prime_xyz": [ -2.079, 8.771, 1.355 ], "P_xyz": [ -0.201, 10.106, 0.163 ], "form": "A", "ssZp": 4.414, "Dp": 4.424, "splay_angle": 25.685, "splay_distance": 3.983, "splay_ratio": 0.223, "d22": null, "d64": null, "eta": -165.451, "theta": -163.715, "eta_prime": -110.557, "theta_prime": -165.541, "eta_base": -56.202, "theta_base": -133.812, "v0": 0.572, "v1": -23.162, "v2": 35.841, "v3": -36.482, "v4": 22.797, "amplitude": 37.656, "phase_angle": 17.861, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.065, "frame": { "rmsd": 0.013, "origin": [ 21.760, 68.543, 58.410 ], "x_axis": [ 0.620, -0.664, 0.418 ], "y_axis": [ 0.762, 0.384, -0.521 ], "z_axis": [ 0.186, 0.642, 0.744 ], "quaternion": [ 0.829, -0.351, -0.070, -0.430 ] } }, { "index": 31, "index_chain": 31, "chain_name": "A", "nt_resnum": 133, "nt_name": "A", "nt_code": "A", "nt_id": "///A/133", "linked_nts": [ "///A/132", "///A/134" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -66.943, "beta": 175.855, "gamma": 52.240, "delta": 79.506, "epsilon": -148.742, "zeta": -76.134, "epsilon_zeta": -72.608, "bb_type": "BI", "chi": -167.815, "glyco_bond": "anti", "C5prime_xyz": [ -1.479, 8.588, 1.126 ], "P_xyz": [ 1.020, 8.857, 1.882 ], "form": "A", "ssZp": 4.536, "Dp": 4.614, "splay_angle": 22.944, "splay_distance": 3.648, "splay_ratio": 0.202, "d22": null, "d64": null, "eta": 167.994, "theta": -146.737, "eta_prime": 176.796, "theta_prime": -145.397, "eta_base": -140.036, "theta_base": -122.336, "v0": 4.084, "v1": -26.129, "v2": 36.867, "v3": -35.738, "v4": 19.990, "amplitude": 37.787, "phase_angle": 12.673, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.930, "filter_rmsd": 0.037, "frame": { "rmsd": 0.004, "origin": [ 21.628, 69.965, 62.129 ], "x_axis": [ 0.921, -0.379, -0.091 ], "y_axis": [ 0.190, 0.640, -0.744 ], "z_axis": [ 0.340, 0.668, 0.662 ], "quaternion": [ 0.898, -0.393, 0.120, -0.159 ] } }, { "index": 32, "index_chain": 32, "chain_name": "A", "nt_resnum": 134, "nt_name": "G", "nt_code": "G", "nt_id": "///A/134", "linked_nts": [ "///A/133", "///A/135" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop", "alpha": -58.297, "beta": 166.589, "gamma": 53.224, "delta": 79.576, "epsilon": -144.824, "zeta": -86.184, "epsilon_zeta": -58.639, "bb_type": "BI", "chi": -172.139, "glyco_bond": "anti", "C5prime_xyz": [ -1.573, 8.675, 1.124 ], "P_xyz": [ 0.972, 9.201, 1.394 ], "form": "A", "ssZp": 4.652, "Dp": 4.676, "splay_angle": 22.919, "splay_distance": 3.555, "splay_ratio": 0.200, "d22": null, "d64": null, "eta": 168.120, "theta": -155.667, "eta_prime": -179.324, "theta_prime": -154.698, "eta_base": -141.333, "theta_base": -134.473, "v0": 3.409, "v1": -25.803, "v2": 37.117, "v3": -36.152, "v4": 20.667, "amplitude": 38.186, "phase_angle": 13.586, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.931, "filter_rmsd": 0.006, "frame": { "rmsd": 0.006, "origin": [ 22.735, 70.709, 65.525 ], "x_axis": [ 0.883, -0.030, -0.469 ], "y_axis": [ -0.292, 0.748, -0.596 ], "z_axis": [ 0.368, 0.663, 0.651 ], "quaternion": [ 0.906, -0.348, 0.231, 0.072 ] } }, { "index": 33, "index_chain": 33, "chain_name": "A", "nt_resnum": 135, "nt_name": "U", "nt_code": "U", "nt_id": "///A/135", "linked_nts": [ "///A/134", "///A/136" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop", "alpha": -53.240, "beta": 166.131, "gamma": 48.543, "delta": 80.381, "epsilon": -139.303, "zeta": -81.057, "epsilon_zeta": -58.246, "bb_type": "BI", "chi": -165.890, "glyco_bond": "anti", "C5prime_xyz": [ -1.286, 8.634, 0.869 ], "P_xyz": [ 1.300, 8.938, 1.114 ], "form": "A", "ssZp": 4.573, "Dp": 4.725, "splay_angle": 22.278, "splay_distance": 3.467, "splay_ratio": 0.194, "d22": null, "d64": null, "eta": 171.964, "theta": -145.811, "eta_prime": -179.751, "theta_prime": -144.598, "eta_base": -148.924, "theta_base": -118.128, "v0": 4.857, "v1": -27.056, "v2": 37.752, "v3": -35.977, "v4": 19.648, "amplitude": 38.530, "phase_angle": 11.535, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.745, "filter_rmsd": 0.106, "frame": { "rmsd": 0.003, "origin": [ 24.407, 71.404, 68.584 ], "x_axis": [ 0.606, 0.314, -0.731 ], "y_axis": [ -0.665, 0.704, -0.249 ], "z_axis": [ 0.436, 0.638, 0.635 ], "quaternion": [ 0.858, -0.258, 0.340, 0.285 ] } }, { "index": 34, "index_chain": 34, "chain_name": "A", "nt_resnum": 136, "nt_name": "A", "nt_code": "A", "nt_id": "///A/136", "linked_nts": [ "///A/135", "///A/137" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop", "alpha": -63.553, "beta": 160.948, "gamma": 57.018, "delta": 80.056, "epsilon": -142.338, "zeta": -76.730, "epsilon_zeta": -65.609, "bb_type": "BI", "chi": -171.225, "glyco_bond": "anti", "C5prime_xyz": [ -1.520, 8.569, 1.169 ], "P_xyz": [ 1.079, 8.950, 1.192 ], "form": "A", "ssZp": 4.666, "Dp": 4.708, "splay_angle": 23.007, "splay_distance": 3.590, "splay_ratio": 0.203, "d22": null, "d64": null, "eta": 162.900, "theta": -141.639, "eta_prime": 177.164, "theta_prime": -141.036, "eta_base": -139.747, "theta_base": -106.238, "v0": 4.061, "v1": -26.624, "v2": 37.853, "v3": -36.499, "v4": 20.427, "amplitude": 38.802, "phase_angle": 12.694, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.850, "filter_rmsd": 0.037, "frame": { "rmsd": 0.003, "origin": [ 27.130, 72.829, 70.189 ], "x_axis": [ 0.074, 0.524, -0.848 ], "y_axis": [ -0.861, 0.462, 0.211 ], "z_axis": [ 0.503, 0.715, 0.486 ], "quaternion": [ 0.711, -0.177, 0.475, 0.487 ] } }, { "index": 35, "index_chain": 35, "chain_name": "A", "nt_resnum": 137, "nt_name": "C", "nt_code": "C", "nt_id": "///A/137", "linked_nts": [ "///A/136", "///A/138" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,A-minor", "alpha": -55.526, "beta": 159.445, "gamma": 60.187, "delta": 81.734, "epsilon": -147.907, "zeta": -69.450, "epsilon_zeta": -78.457, "bb_type": "BI", "chi": -164.959, "glyco_bond": "anti", "C5prime_xyz": [ -1.379, 8.730, 0.810 ], "P_xyz": [ 1.209, 9.083, 0.614 ], "form": "A", "ssZp": 4.517, "Dp": 4.629, "splay_angle": 23.423, "splay_distance": 3.908, "splay_ratio": 0.209, "d22": 4.467, "d64": 4.605, "eta": 171.142, "theta": -141.278, "eta_prime": -170.271, "theta_prime": -136.866, "eta_base": -115.851, "theta_base": -129.872, "v0": 3.114, "v1": -24.833, "v2": 35.953, "v3": -35.055, "v4": 20.154, "amplitude": 37.028, "phase_angle": 13.840, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.805, "filter_rmsd": 0.064, "frame": { "rmsd": 0.004, "origin": [ 29.735, 75.278, 69.871 ], "x_axis": [ -0.420, 0.772, -0.478 ], "y_axis": [ -0.654, 0.108, 0.749 ], "z_axis": [ 0.630, 0.626, 0.459 ], "quaternion": [ 0.536, 0.057, 0.517, 0.665 ] } }, { "index": 36, "index_chain": 36, "chain_name": "A", "nt_resnum": 138, "nt_name": "C", "nt_code": "C", "nt_id": "///A/138", "linked_nts": [ "///A/137", "///A/139" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,junction-loop", "alpha": -61.738, "beta": -168.351, "gamma": 57.178, "delta": 142.678, "epsilon": -129.862, "zeta": 104.934, "epsilon_zeta": 125.204, "bb_type": "--", "chi": -128.661, "glyco_bond": "anti", "C5prime_xyz": [ -1.983, 8.744, -0.839 ], "P_xyz": [ 0.202, 9.818, 0.115 ], "form": ".", "ssZp": 1.754, "Dp": 1.692, "splay_angle": 84.346, "splay_distance": 12.200, "splay_ratio": 0.676, "d22": null, "d64": null, "eta": -169.417, "theta": 95.819, "eta_prime": -146.714, "theta_prime": 90.418, "eta_base": -134.437, "theta_base": 130.016, "v0": -23.463, "v1": 35.792, "v2": -33.762, "v3": 21.111, "v4": 1.274, "amplitude": 36.110, "phase_angle": 159.226, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1b", "suiteness": 0.892, "filter_rmsd": 0.063, "frame": { "rmsd": 0.004, "origin": [ 32.863, 77.596, 69.525 ], "x_axis": [ -0.877, 0.392, -0.279 ], "y_axis": [ -0.351, -0.126, 0.928 ], "z_axis": [ 0.328, 0.911, 0.248 ], "quaternion": [ 0.248, 0.017, 0.613, 0.750 ] } }, { "index": 37, "index_chain": 37, "chain_name": "A", "nt_resnum": 139, "nt_name": "A", "nt_code": "A", "nt_id": "///A/139", "linked_nts": [ "///A/138", "///A/140" ], "nt_type": "RNA", "dbn": ".", "summary": "~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,multiplet,junction-loop,phosphate", "alpha": -74.339, "beta": 159.283, "gamma": 43.995, "delta": 85.677, "epsilon": -137.402, "zeta": -76.683, "epsilon_zeta": -60.719, "bb_type": "BI", "chi": 176.907, "glyco_bond": "--", "C5prime_xyz": [ -1.076, 8.080, 1.860 ], "P_xyz": [ 1.436, 7.588, 2.464 ], "form": "A", "ssZp": 4.736, "Dp": 4.739, "splay_angle": 26.367, "splay_distance": 3.983, "splay_ratio": 0.230, "d22": null, "d64": null, "eta": -177.508, "theta": -132.101, "eta_prime": -173.651, "theta_prime": -130.345, "eta_base": -171.529, "theta_base": -109.161, "v0": 8.645, "v1": -28.106, "v2": 35.893, "v3": -31.934, "v4": 14.749, "amplitude": 36.038, "phase_angle": 5.137, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "0a", "suiteness": 0.286, "filter_rmsd": 0.038, "frame": { "rmsd": 0.005, "origin": [ 39.958, 69.760, 75.614 ], "x_axis": [ 0.118, 0.691, -0.713 ], "y_axis": [ -0.772, 0.516, 0.372 ], "z_axis": [ 0.625, 0.506, 0.594 ], "quaternion": [ 0.746, -0.045, 0.448, 0.490 ] } }, { "index": 38, "index_chain": 38, "chain_name": "A", "nt_resnum": 140, "nt_name": "A", "nt_code": "A", "nt_id": "///A/140", "linked_nts": [ "///A/139", "///A/141" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,junction-loop", "alpha": -55.618, "beta": 168.026, "gamma": 52.800, "delta": 83.130, "epsilon": -133.096, "zeta": -64.765, "epsilon_zeta": -68.331, "bb_type": "BI", "chi": -172.727, "glyco_bond": "anti", "C5prime_xyz": [ -1.361, 8.487, 1.220 ], "P_xyz": [ 1.227, 8.716, 1.510 ], "form": ".", "ssZp": 4.683, "Dp": 4.747, "splay_angle": 31.267, "splay_distance": 4.829, "splay_ratio": 0.271, "d22": null, "d64": null, "eta": 174.172, "theta": -123.355, "eta_prime": -169.617, "theta_prime": -120.681, "eta_base": -128.529, "theta_base": -75.755, "v0": 6.108, "v1": -27.050, "v2": 36.638, "v3": -34.096, "v4": 17.709, "amplitude": 37.135, "phase_angle": 9.390, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.844, "filter_rmsd": 0.038, "frame": { "rmsd": 0.004, "origin": [ 43.626, 71.032, 76.506 ], "x_axis": [ -0.257, 0.921, -0.293 ], "y_axis": [ -0.731, 0.013, 0.683 ], "z_axis": [ 0.632, 0.390, 0.669 ], "quaternion": [ 0.597, 0.123, 0.388, 0.692 ] } }, { "index": 39, "index_chain": 39, "chain_name": "A", "nt_resnum": 141, "nt_name": "G", "nt_code": "G", "nt_id": "///A/141", "linked_nts": [ "///A/140", "///A/142" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,junction-loop", "alpha": -60.551, "beta": 166.049, "gamma": 54.077, "delta": 80.429, "epsilon": -139.125, "zeta": -72.707, "epsilon_zeta": -66.418, "bb_type": "BI", "chi": -171.841, "glyco_bond": "anti", "C5prime_xyz": [ -1.374, 8.624, 1.145 ], "P_xyz": [ 1.213, 8.962, 1.370 ], "form": "A", "ssZp": 4.668, "Dp": 4.717, "splay_angle": 24.777, "splay_distance": 3.869, "splay_ratio": 0.216, "d22": null, "d64": null, "eta": 163.632, "theta": -136.504, "eta_prime": -172.154, "theta_prime": -134.417, "eta_base": -102.489, "theta_base": -96.697, "v0": 3.367, "v1": -25.550, "v2": 36.800, "v3": -35.903, "v4": 20.542, "amplitude": 37.871, "phase_angle": 13.661, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.837, "filter_rmsd": 0.004, "frame": { "rmsd": 0.004, "origin": [ 44.556, 75.538, 77.973 ], "x_axis": [ -0.798, 0.511, 0.320 ], "y_axis": [ -0.212, -0.734, 0.645 ], "z_axis": [ 0.565, 0.447, 0.694 ], "quaternion": [ 0.201, 0.246, 0.304, 0.898 ] } }, { "index": 40, "index_chain": 40, "chain_name": "A", "nt_resnum": 142, "nt_name": "U", "nt_code": "U", "nt_id": "///A/142", "linked_nts": [ "///A/141", "///A/143" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -59.282, "beta": 168.431, "gamma": 53.563, "delta": 78.948, "epsilon": -140.568, "zeta": -81.929, "epsilon_zeta": -58.639, "bb_type": "BI", "chi": -162.050, "glyco_bond": "anti", "C5prime_xyz": [ -1.346, 8.706, 0.642 ], "P_xyz": [ 1.252, 9.078, 0.732 ], "form": "A", "ssZp": 4.482, "Dp": 4.714, "splay_angle": 23.787, "splay_distance": 3.750, "splay_ratio": 0.207, "d22": 4.214, "d64": 4.273, "eta": 167.713, "theta": -147.385, "eta_prime": -175.067, "theta_prime": -145.723, "eta_base": -119.762, "theta_base": -119.851, "v0": 2.486, "v1": -25.349, "v2": 37.306, "v3": -36.921, "v4": 21.662, "amplitude": 38.621, "phase_angle": 14.993, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.925, "filter_rmsd": 0.105, "frame": { "rmsd": 0.003, "origin": [ 44.756, 78.592, 80.340 ], "x_axis": [ -0.760, -0.148, 0.633 ], "y_axis": [ 0.435, -0.839, 0.327 ], "z_axis": [ 0.482, 0.524, 0.702 ], "quaternion": [ -0.161, 0.307, 0.234, 0.908 ] } }, { "index": 41, "index_chain": 41, "chain_name": "A", "nt_resnum": 143, "nt_name": "C", "nt_code": "C", "nt_id": "///A/143", "linked_nts": [ "///A/142", "///A/144" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -55.878, "beta": 162.566, "gamma": 53.512, "delta": 80.267, "epsilon": -142.378, "zeta": -85.885, "epsilon_zeta": -56.493, "bb_type": "BI", "chi": -164.161, "glyco_bond": "anti", "C5prime_xyz": [ -1.381, 8.752, 0.764 ], "P_xyz": [ 1.214, 9.119, 0.793 ], "form": "A", "ssZp": 4.520, "Dp": 4.674, "splay_angle": 22.071, "splay_distance": 3.446, "splay_ratio": 0.192, "d22": 4.278, "d64": 4.161, "eta": 168.961, "theta": -149.269, "eta_prime": -178.073, "theta_prime": -147.966, "eta_base": -138.534, "theta_base": -121.696, "v0": 2.924, "v1": -25.143, "v2": 36.586, "v3": -35.883, "v4": 20.794, "amplitude": 37.748, "phase_angle": 14.257, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.826, "filter_rmsd": 0.064, "frame": { "rmsd": 0.003, "origin": [ 45.077, 81.211, 83.005 ], "x_axis": [ -0.480, -0.654, 0.585 ], "y_axis": [ 0.797, -0.603, -0.019 ], "z_axis": [ 0.365, 0.457, 0.811 ], "quaternion": [ -0.426, 0.279, 0.129, 0.851 ] } }, { "index": 42, "index_chain": 42, "chain_name": "A", "nt_resnum": 144, "nt_name": "U", "nt_code": "U", "nt_id": "///A/144", "linked_nts": [ "///A/143", "///A/145" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -49.941, "beta": 158.421, "gamma": 51.720, "delta": 81.862, "epsilon": -132.414, "zeta": -84.119, "epsilon_zeta": -48.295, "bb_type": "BI", "chi": -160.675, "glyco_bond": "anti", "C5prime_xyz": [ -1.374, 8.711, 0.578 ], "P_xyz": [ 1.237, 8.983, 0.528 ], "form": "A", "ssZp": 4.390, "Dp": 4.697, "splay_angle": 21.199, "splay_distance": 3.382, "splay_ratio": 0.184, "d22": 4.096, "d64": 3.828, "eta": 173.163, "theta": -140.589, "eta_prime": -174.974, "theta_prime": -140.471, "eta_base": -136.700, "theta_base": -111.275, "v0": 3.181, "v1": -24.394, "v2": 35.142, "v3": -34.269, "v4": 19.619, "amplitude": 36.167, "phase_angle": 13.674, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.672, "filter_rmsd": 0.106, "frame": { "rmsd": 0.003, "origin": [ 44.977, 82.806, 86.058 ], "x_axis": [ -0.007, -0.902, 0.432 ], "y_axis": [ 0.963, -0.123, -0.240 ], "z_axis": [ 0.270, 0.414, 0.870 ], "quaternion": [ 0.659, -0.248, -0.061, -0.707 ] } }, { "index": 43, "index_chain": 43, "chain_name": "A", "nt_resnum": 145, "nt_name": "C", "nt_code": "C", "nt_id": "///A/145", "linked_nts": [ "///A/144", "///A/146" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -61.398, "beta": 157.011, "gamma": 57.328, "delta": 79.359, "epsilon": -153.043, "zeta": -75.904, "epsilon_zeta": -77.140, "bb_type": "BI", "chi": -159.130, "glyco_bond": "anti", "C5prime_xyz": [ -1.422, 8.821, 0.456 ], "P_xyz": [ 1.150, 9.189, 0.118 ], "form": "A", "ssZp": 4.413, "Dp": 4.608, "splay_angle": 20.854, "splay_distance": 3.300, "splay_ratio": 0.182, "d22": null, "d64": null, "eta": 160.387, "theta": -149.744, "eta_prime": 177.199, "theta_prime": -153.431, "eta_base": -136.195, "theta_base": -134.309, "v0": 1.674, "v1": -24.247, "v2": 36.357, "v3": -36.398, "v4": 21.910, "amplitude": 37.849, "phase_angle": 16.143, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.716, "filter_rmsd": 0.063, "frame": { "rmsd": 0.003, "origin": [ 45.092, 82.930, 89.436 ], "x_axis": [ 0.489, -0.871, 0.047 ], "y_axis": [ 0.841, 0.456, -0.293 ], "z_axis": [ 0.234, 0.182, 0.955 ], "quaternion": [ 0.851, -0.140, 0.055, -0.503 ] } }, { "index": 44, "index_chain": 44, "chain_name": "A", "nt_resnum": 146, "nt_name": "A", "nt_code": "A", "nt_id": "///A/146", "linked_nts": [ "///A/145", "///A/147" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -63.366, "beta": 170.374, "gamma": 50.034, "delta": 78.709, "epsilon": -145.559, "zeta": -84.076, "epsilon_zeta": -61.482, "bb_type": "BI", "chi": -163.815, "glyco_bond": "anti", "C5prime_xyz": [ -1.355, 8.669, 0.719 ], "P_xyz": [ 1.231, 9.096, 0.894 ], "form": "A", "ssZp": 4.554, "Dp": 4.710, "splay_angle": 23.708, "splay_distance": 3.724, "splay_ratio": 0.208, "d22": null, "d64": null, "eta": 163.547, "theta": -155.359, "eta_prime": 173.599, "theta_prime": -154.970, "eta_base": -151.001, "theta_base": -140.705, "v0": 4.217, "v1": -27.168, "v2": 38.470, "v3": -37.119, "v4": 20.725, "amplitude": 39.419, "phase_angle": 12.597, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.944, "filter_rmsd": 0.036, "frame": { "rmsd": 0.003, "origin": [ 44.893, 82.584, 92.711 ], "x_axis": [ 0.784, -0.557, -0.274 ], "y_axis": [ 0.520, 0.830, -0.201 ], "z_axis": [ 0.339, 0.015, 0.941 ], "quaternion": [ 0.943, -0.057, 0.162, -0.286 ] } }, { "index": 45, "index_chain": 45, "chain_name": "A", "nt_resnum": 147, "nt_name": "G", "nt_code": "G", "nt_id": "///A/147", "linked_nts": [ "///A/146", "///A/148" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -59.223, "beta": 171.030, "gamma": 46.464, "delta": 78.824, "epsilon": -145.534, "zeta": -71.893, "epsilon_zeta": -73.642, "bb_type": "BI", "chi": -171.170, "glyco_bond": "anti", "C5prime_xyz": [ -1.381, 8.631, 1.120 ], "P_xyz": [ 1.169, 9.039, 1.579 ], "form": "A", "ssZp": 4.675, "Dp": 4.711, "splay_angle": 27.057, "splay_distance": 4.245, "splay_ratio": 0.238, "d22": null, "d64": null, "eta": 165.087, "theta": -144.367, "eta_prime": 172.076, "theta_prime": -142.329, "eta_base": -161.930, "theta_base": -115.503, "v0": 3.706, "v1": -26.435, "v2": 37.951, "v3": -36.791, "v4": 20.818, "amplitude": 38.986, "phase_angle": 13.234, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.806, "filter_rmsd": 0.002, "frame": { "rmsd": 0.002, "origin": [ 44.897, 81.113, 96.133 ], "x_axis": [ 0.791, -0.133, -0.598 ], "y_axis": [ 0.135, 0.990, -0.042 ], "z_axis": [ 0.597, -0.048, 0.801 ], "quaternion": [ 0.946, 0.002, 0.316, -0.071 ] } }, { "index": 46, "index_chain": 46, "chain_name": "A", "nt_resnum": 148, "nt_name": "G", "nt_code": "G", "nt_id": "///A/148", "linked_nts": [ "///A/147", "///A/149" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -61.545, "beta": 175.232, "gamma": 50.593, "delta": 78.079, "epsilon": -143.350, "zeta": -76.242, "epsilon_zeta": -67.108, "bb_type": "BI", "chi": -177.394, "glyco_bond": "anti", "C5prime_xyz": [ -1.595, 8.543, 1.488 ], "P_xyz": [ 0.886, 9.009, 2.207 ], "form": "A", "ssZp": 4.723, "Dp": 4.703, "splay_angle": 25.123, "splay_distance": 3.988, "splay_ratio": 0.225, "d22": null, "d64": null, "eta": 167.407, "theta": -145.664, "eta_prime": 179.431, "theta_prime": -141.537, "eta_base": -138.265, "theta_base": -111.593, "v0": 2.942, "v1": -26.120, "v2": 38.081, "v3": -37.448, "v4": 21.787, "amplitude": 39.323, "phase_angle": 14.437, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.949, "filter_rmsd": 0.004, "frame": { "rmsd": 0.004, "origin": [ 47.870, 79.040, 98.341 ], "x_axis": [ 0.571, 0.441, -0.692 ], "y_axis": [ -0.404, 0.885, 0.230 ], "z_axis": [ 0.714, 0.148, 0.684 ], "quaternion": [ 0.886, 0.023, 0.397, 0.239 ] } }, { "index": 47, "index_chain": 47, "chain_name": "A", "nt_resnum": 149, "nt_name": "G", "nt_code": "G", "nt_id": "///A/149", "linked_nts": [ "///A/148", "///A/150" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,hairpin-loop", "alpha": -56.943, "beta": 176.572, "gamma": 48.082, "delta": 79.286, "epsilon": -137.660, "zeta": -71.977, "epsilon_zeta": -65.682, "bb_type": "BI", "chi": -167.140, "glyco_bond": "anti", "C5prime_xyz": [ -1.502, 8.715, 0.937 ], "P_xyz": [ 1.020, 9.210, 1.493 ], "form": "A", "ssZp": 4.596, "Dp": 4.721, "splay_angle": 24.966, "splay_distance": 3.969, "splay_ratio": 0.218, "d22": null, "d64": null, "eta": 172.098, "theta": -137.660, "eta_prime": -177.173, "theta_prime": -134.392, "eta_base": -136.219, "theta_base": -94.141, "v0": 3.686, "v1": -26.254, "v2": 37.627, "v3": -36.497, "v4": 20.679, "amplitude": 38.653, "phase_angle": 13.235, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.881, "filter_rmsd": 0.002, "frame": { "rmsd": 0.002, "origin": [ 51.738, 78.415, 99.084 ], "x_axis": [ 0.133, 0.862, -0.489 ], "y_axis": [ -0.652, 0.448, 0.612 ], "z_axis": [ 0.746, 0.237, 0.622 ], "quaternion": [ 0.742, 0.126, 0.416, 0.510 ] } }, { "index": 48, "index_chain": 48, "chain_name": "A", "nt_resnum": 150, "nt_name": "G", "nt_code": "G", "nt_id": "///A/150", "linked_nts": [ "///A/149", "///A/151" ], "nt_type": "RNA", "dbn": ".", "summary": "u-turn,anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,multiplet,hairpin-loop,cap-acceptor", "alpha": -56.121, "beta": 169.110, "gamma": 46.987, "delta": 78.495, "epsilon": -138.708, "zeta": -57.954, "epsilon_zeta": -80.755, "bb_type": "BI", "chi": -161.789, "glyco_bond": "anti", "C5prime_xyz": [ -1.343, 8.750, 0.576 ], "P_xyz": [ 1.215, 9.272, 0.641 ], "form": ".", "ssZp": 4.484, "Dp": 4.754, "splay_angle": 84.246, "splay_distance": 11.615, "splay_ratio": 0.671, "d22": null, "d64": null, "eta": 165.036, "theta": -115.454, "eta_prime": -178.924, "theta_prime": -161.947, "eta_base": -122.726, "theta_base": 140.729, "v0": 5.217, "v1": -28.040, "v2": 39.002, "v3": -37.052, "v4": 20.054, "amplitude": 39.764, "phase_angle": 11.237, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.837, "filter_rmsd": 0.004, "frame": { "rmsd": 0.004, "origin": [ 54.802, 80.915, 99.427 ], "x_axis": [ -0.423, 0.906, -0.006 ], "y_axis": [ -0.488, -0.223, 0.844 ], "z_axis": [ 0.763, 0.360, 0.537 ], "quaternion": [ 0.472, 0.256, 0.408, 0.739 ] } }, { "index": 49, "index_chain": 49, "chain_name": "A", "nt_resnum": 151, "nt_name": "A", "nt_code": "A", "nt_id": "///A/151", "linked_nts": [ "///A/150", "///A/152" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,u-turn,anti,~C3'-endo,non-canonical,non-pair-contact,multiplet,hairpin-loop", "alpha": 170.063, "beta": 134.273, "gamma": 55.035, "delta": 85.690, "epsilon": -118.177, "zeta": -93.458, "epsilon_zeta": -24.718, "bb_type": "--", "chi": -176.096, "glyco_bond": "anti", "C5prime_xyz": [ -1.542, 8.450, 1.516 ], "P_xyz": [ 1.083, 8.289, 1.501 ], "form": ".", "ssZp": 4.549, "Dp": 4.636, "splay_angle": 22.221, "splay_distance": 3.454, "splay_ratio": 0.193, "d22": null, "d64": null, "eta": 18.785, "theta": -130.011, "eta_prime": 47.814, "theta_prime": -130.634, "eta_base": 26.082, "theta_base": -90.171, "v0": 1.342, "v1": -21.277, "v2": 31.920, "v3": -32.017, "v4": 19.370, "amplitude": 33.261, "phase_angle": 16.321, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1g", "suiteness": 0.674, "filter_rmsd": 0.038, "frame": { "rmsd": 0.006, "origin": [ 60.740, 72.690, 105.083 ], "x_axis": [ -0.682, -0.590, 0.433 ], "y_axis": [ -0.416, 0.799, 0.434 ], "z_axis": [ -0.602, 0.116, -0.790 ], "quaternion": [ -0.286, -0.278, 0.904, 0.152 ] } }, { "index": 50, "index_chain": 50, "chain_name": "A", "nt_resnum": 152, "nt_name": "A", "nt_code": "A", "nt_id": "///A/152", "linked_nts": [ "///A/151", "///A/153" ], "nt_type": "RNA", "dbn": ".", "summary": "u-turn,anti,~C3'-endo,BI,non-canonical,non-pair-contact,hairpin-loop,A-minor,ribose-zipper,cap-donor,phosphate", "alpha": -56.719, "beta": 137.931, "gamma": 66.399, "delta": 85.353, "epsilon": -141.846, "zeta": -71.577, "epsilon_zeta": -70.269, "bb_type": "BI", "chi": -156.935, "glyco_bond": "anti", "C5prime_xyz": [ -1.459, 8.729, 0.415 ], "P_xyz": [ 1.030, 8.739, -0.403 ], "form": ".", "ssZp": 4.262, "Dp": 4.563, "splay_angle": 22.093, "splay_distance": 3.494, "splay_ratio": 0.193, "d22": null, "d64": null, "eta": 163.147, "theta": -131.451, "eta_prime": -172.633, "theta_prime": -137.956, "eta_base": -109.581, "theta_base": -94.388, "v0": 2.470, "v1": -22.467, "v2": 32.794, "v3": -32.256, "v4": 18.808, "amplitude": 33.875, "phase_angle": 14.513, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1L", "suiteness": 0.879, "filter_rmsd": 0.038, "frame": { "rmsd": 0.005, "origin": [ 57.855, 72.129, 103.268 ], "x_axis": [ -0.881, 0.117, 0.458 ], "y_axis": [ 0.059, 0.989, -0.138 ], "z_axis": [ -0.469, -0.095, -0.878 ], "quaternion": [ -0.240, 0.045, 0.968, -0.060 ] } }, { "index": 51, "index_chain": 51, "chain_name": "A", "nt_resnum": 153, "nt_name": "A", "nt_code": "A", "nt_id": "///A/153", "linked_nts": [ "///A/152", "///A/154" ], "nt_type": "RNA", "dbn": ".", "summary": "u-turn,anti,~C3'-endo,non-canonical,non-pair-contact,helix-end,multiplet,hairpin-loop,A-minor,ribose-zipper,phosphate", "alpha": -76.133, "beta": 162.339, "gamma": 67.089, "delta": 83.410, "epsilon": -126.867, "zeta": -43.023, "epsilon_zeta": -83.844, "bb_type": "--", "chi": -146.824, "glyco_bond": "anti", "C5prime_xyz": [ -1.207, 8.668, -0.227 ], "P_xyz": [ 1.280, 8.741, -1.061 ], "form": ".", "ssZp": 3.830, "Dp": 4.746, "splay_angle": 45.771, "splay_distance": 7.304, "splay_ratio": 0.389, "d22": null, "d64": null, "eta": 165.883, "theta": -101.788, "eta_prime": -175.844, "theta_prime": -96.557, "eta_base": -113.061, "theta_base": -58.887, "v0": 5.108, "v1": -25.953, "v2": 35.751, "v3": -33.805, "v4": 18.147, "amplitude": 36.390, "phase_angle": 10.750, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.614, "filter_rmsd": 0.038, "frame": { "rmsd": 0.003, "origin": [ 54.779, 72.581, 101.674 ], "x_axis": [ -0.608, 0.767, 0.206 ], "y_axis": [ 0.502, 0.572, -0.648 ], "z_axis": [ -0.615, -0.290, -0.733 ], "quaternion": [ -0.241, 0.372, 0.853, -0.275 ] } }, { "index": 52, "index_chain": 52, "chain_name": "A", "nt_resnum": 154, "nt_name": "C", "nt_code": "C", "nt_id": "///A/154", "linked_nts": [ "///A/153", "///A/155" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,hairpin-loop", "alpha": -83.189, "beta": 147.943, "gamma": 94.419, "delta": 80.074, "epsilon": -148.024, "zeta": -70.125, "epsilon_zeta": -77.900, "bb_type": "BI", "chi": -165.124, "glyco_bond": "anti", "C5prime_xyz": [ -1.244, 8.702, 0.825 ], "P_xyz": [ 0.937, 9.278, -0.516 ], "form": "A", "ssZp": 4.562, "Dp": 4.676, "splay_angle": 24.507, "splay_distance": 3.833, "splay_ratio": 0.213, "d22": 4.077, "d64": 4.345, "eta": 161.998, "theta": -145.309, "eta_prime": -153.408, "theta_prime": -149.675, "eta_base": -82.462, "theta_base": -120.487, "v0": 3.325, "v1": -25.828, "v2": 37.271, "v3": -36.316, "v4": 20.783, "amplitude": 38.361, "phase_angle": 13.692, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.065, "frame": { "rmsd": 0.003, "origin": [ 51.988, 78.804, 99.059 ], "x_axis": [ 0.275, 0.847, -0.455 ], "y_axis": [ 0.560, -0.526, -0.640 ], "z_axis": [ -0.781, -0.079, -0.619 ], "quaternion": [ -0.180, 0.778, 0.452, -0.397 ] } }, { "index": 53, "index_chain": 53, "chain_name": "A", "nt_resnum": 155, "nt_name": "U", "nt_code": "U", "nt_id": "///A/155", "linked_nts": [ "///A/154", "///A/156" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -59.425, "beta": 163.635, "gamma": 62.248, "delta": 82.950, "epsilon": -132.776, "zeta": -88.730, "epsilon_zeta": -44.047, "bb_type": "BI", "chi": -165.186, "glyco_bond": "anti", "C5prime_xyz": [ -1.454, 8.689, 0.839 ], "P_xyz": [ 1.136, 9.079, 0.811 ], "form": "A", "ssZp": 4.453, "Dp": 4.650, "splay_angle": 20.482, "splay_distance": 3.271, "splay_ratio": 0.178, "d22": 4.383, "d64": 4.014, "eta": 177.589, "theta": -145.276, "eta_prime": -165.125, "theta_prime": -145.227, "eta_base": -117.948, "theta_base": -121.907, "v0": 2.189, "v1": -23.326, "v2": 34.428, "v3": -34.113, "v4": 20.162, "amplitude": 35.674, "phase_angle": 15.186, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.827, "filter_rmsd": 0.106, "frame": { "rmsd": 0.004, "origin": [ 49.260, 80.431, 96.912 ], "x_axis": [ 0.533, 0.374, -0.759 ], "y_axis": [ 0.257, -0.926, -0.276 ], "z_axis": [ -0.806, -0.048, -0.589 ], "quaternion": [ -0.065, 0.873, 0.180, -0.448 ] } }, { "index": 54, "index_chain": 54, "chain_name": "A", "nt_resnum": 156, "nt_name": "U", "nt_code": "U", "nt_id": "///A/156", "linked_nts": [ "///A/155", "///A/157" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -55.084, "beta": 157.314, "gamma": 48.994, "delta": 79.204, "epsilon": -146.969, "zeta": -83.466, "epsilon_zeta": -63.503, "bb_type": "BI", "chi": -156.363, "glyco_bond": "anti", "C5prime_xyz": [ -1.482, 8.794, 0.296 ], "P_xyz": [ 1.102, 9.184, 0.189 ], "form": "A", "ssZp": 4.299, "Dp": 4.626, "splay_angle": 21.023, "splay_distance": 3.363, "splay_ratio": 0.183, "d22": 4.299, "d64": 4.108, "eta": 162.242, "theta": -152.238, "eta_prime": 175.728, "theta_prime": -152.971, "eta_base": -146.228, "theta_base": -139.485, "v0": -0.291, "v1": -22.561, "v2": 35.597, "v3": -36.785, "v4": 23.366, "amplitude": 37.664, "phase_angle": 19.073, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.630, "filter_rmsd": 0.105, "frame": { "rmsd": 0.002, "origin": [ 46.845, 81.448, 94.954 ], "x_axis": [ 0.686, -0.169, -0.707 ], "y_axis": [ -0.173, -0.983, 0.066 ], "z_axis": [ -0.706, 0.077, -0.704 ], "quaternion": [ -0.003, 0.918, -0.093, -0.385 ] } }, { "index": 55, "index_chain": 55, "chain_name": "A", "nt_resnum": 157, "nt_name": "U", "nt_code": "U", "nt_id": "///A/157", "linked_nts": [ "///A/156", "///A/158" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -64.549, "beta": 166.431, "gamma": 54.578, "delta": 79.594, "epsilon": -147.189, "zeta": -74.458, "epsilon_zeta": -72.731, "bb_type": "BI", "chi": -157.653, "glyco_bond": "anti", "C5prime_xyz": [ -1.530, 8.780, 0.374 ], "P_xyz": [ 1.049, 9.257, 0.305 ], "form": "A", "ssZp": 4.350, "Dp": 4.628, "splay_angle": 21.482, "splay_distance": 3.476, "splay_ratio": 0.188, "d22": null, "d64": null, "eta": 164.310, "theta": -145.628, "eta_prime": 173.722, "theta_prime": -146.697, "eta_base": -160.412, "theta_base": -120.943, "v0": 1.087, "v1": -23.611, "v2": 35.963, "v3": -36.309, "v4": 22.177, "amplitude": 37.601, "phase_angle": 16.976, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.869, "filter_rmsd": 0.105, "frame": { "rmsd": 0.003, "origin": [ 44.926, 82.973, 92.653 ], "x_axis": [ 0.701, -0.577, -0.419 ], "y_axis": [ -0.520, -0.816, 0.253 ], "z_axis": [ -0.488, 0.041, -0.872 ], "quaternion": [ 0.058, 0.920, -0.298, -0.246 ] } }, { "index": 56, "index_chain": 56, "chain_name": "A", "nt_resnum": 158, "nt_name": "G", "nt_code": "G", "nt_id": "///A/158", "linked_nts": [ "///A/157", "///A/159" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -66.380, "beta": 164.492, "gamma": 59.949, "delta": 79.427, "epsilon": -153.582, "zeta": -77.463, "epsilon_zeta": -76.120, "bb_type": "BI", "chi": -167.845, "glyco_bond": "anti", "C5prime_xyz": [ -1.670, 8.778, 0.951 ], "P_xyz": [ 0.870, 9.379, 1.077 ], "form": "A", "ssZp": 4.509, "Dp": 4.550, "splay_angle": 21.596, "splay_distance": 3.329, "splay_ratio": 0.187, "d22": null, "d64": null, "eta": 164.441, "theta": -153.231, "eta_prime": 179.175, "theta_prime": -153.469, "eta_base": -138.192, "theta_base": -123.071, "v0": 0.276, "v1": -22.889, "v2": 35.563, "v3": -36.436, "v4": 22.848, "amplitude": 37.449, "phase_angle": 18.263, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.894, "filter_rmsd": 0.004, "frame": { "rmsd": 0.004, "origin": [ 44.850, 83.398, 89.204 ], "x_axis": [ 0.435, -0.900, 0.002 ], "y_axis": [ -0.830, -0.400, 0.389 ], "z_axis": [ -0.349, -0.171, -0.921 ], "quaternion": [ 0.169, 0.830, -0.521, -0.105 ] } }, { "index": 57, "index_chain": 57, "chain_name": "A", "nt_resnum": 159, "nt_name": "A", "nt_code": "A", "nt_id": "///A/159", "linked_nts": [ "///A/158", "///A/160" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -63.698, "beta": 171.372, "gamma": 52.325, "delta": 81.462, "epsilon": -138.978, "zeta": -81.241, "epsilon_zeta": -57.738, "bb_type": "BI", "chi": -162.929, "glyco_bond": "anti", "C5prime_xyz": [ -1.185, 8.597, 0.714 ], "P_xyz": [ 1.420, 8.787, 0.872 ], "form": "A", "ssZp": 4.507, "Dp": 4.730, "splay_angle": 21.721, "splay_distance": 3.444, "splay_ratio": 0.190, "d22": null, "d64": null, "eta": 169.337, "theta": -145.274, "eta_prime": 179.207, "theta_prime": -144.582, "eta_base": -137.821, "theta_base": -125.167, "v0": 6.622, "v1": -27.724, "v2": 37.201, "v3": -34.411, "v4": 17.544, "amplitude": 37.639, "phase_angle": 8.744, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.950, "filter_rmsd": 0.037, "frame": { "rmsd": 0.002, "origin": [ 44.949, 82.846, 85.922 ], "x_axis": [ -0.128, -0.964, 0.232 ], "y_axis": [ -0.948, 0.187, 0.255 ], "z_axis": [ -0.290, -0.187, -0.939 ], "quaternion": [ -0.174, -0.637, 0.751, 0.023 ] } }, { "index": 58, "index_chain": 58, "chain_name": "A", "nt_resnum": 160, "nt_name": "G", "nt_code": "G", "nt_id": "///A/160", "linked_nts": [ "///A/159", "///A/161" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -61.171, "beta": 158.731, "gamma": 59.756, "delta": 79.769, "epsilon": -148.057, "zeta": -70.467, "epsilon_zeta": -77.590, "bb_type": "BI", "chi": -165.707, "glyco_bond": "anti", "C5prime_xyz": [ -1.504, 8.730, 0.852 ], "P_xyz": [ 1.051, 9.210, 0.625 ], "form": "A", "ssZp": 4.567, "Dp": 4.665, "splay_angle": 23.365, "splay_distance": 3.762, "splay_ratio": 0.207, "d22": null, "d64": null, "eta": 165.167, "theta": -142.161, "eta_prime": 179.930, "theta_prime": -143.800, "eta_base": -144.110, "theta_base": -118.201, "v0": 2.439, "v1": -25.269, "v2": 37.224, "v3": -36.792, "v4": 21.654, "amplitude": 38.541, "phase_angle": 15.019, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.800, "filter_rmsd": 0.002, "frame": { "rmsd": 0.002, "origin": [ 45.365, 81.378, 82.834 ], "x_axis": [ -0.518, -0.734, 0.439 ], "y_axis": [ -0.811, 0.585, 0.021 ], "z_axis": [ -0.273, -0.345, -0.898 ], "quaternion": [ -0.206, -0.446, 0.866, -0.093 ] } }, { "index": 59, "index_chain": 59, "chain_name": "A", "nt_resnum": 161, "nt_name": "A", "nt_code": "A", "nt_id": "///A/161", "linked_nts": [ "///A/160", "///A/162" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -66.386, "beta": 164.418, "gamma": 66.138, "delta": 78.261, "epsilon": -148.044, "zeta": -66.940, "epsilon_zeta": -81.104, "bb_type": "BI", "chi": -168.566, "glyco_bond": "anti", "C5prime_xyz": [ -1.770, 8.704, 1.001 ], "P_xyz": [ 0.757, 9.411, 0.925 ], "form": "A", "ssZp": 4.580, "Dp": 4.632, "splay_angle": 24.455, "splay_distance": 3.852, "splay_ratio": 0.214, "d22": null, "d64": null, "eta": 169.983, "theta": -139.929, "eta_prime": -172.690, "theta_prime": -140.349, "eta_base": -127.635, "theta_base": -97.976, "v0": -1.062, "v1": -22.690, "v2": 36.441, "v3": -38.071, "v4": 24.656, "amplitude": 38.810, "phase_angle": 20.125, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.700, "filter_rmsd": 0.037, "frame": { "rmsd": 0.004, "origin": [ 44.999, 78.403, 80.560 ], "x_axis": [ -0.869, -0.309, 0.386 ], "y_axis": [ -0.424, 0.867, -0.261 ], "z_axis": [ -0.254, -0.390, -0.885 ], "quaternion": [ -0.168, -0.193, 0.952, -0.171 ] } }, { "index": 60, "index_chain": 60, "chain_name": "A", "nt_resnum": 162, "nt_name": "U", "nt_code": "U", "nt_id": "///A/162", "linked_nts": [ "///A/161", "///A/163" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,junction-loop", "alpha": -67.043, "beta": 166.103, "gamma": 60.288, "delta": 78.848, "epsilon": -132.349, "zeta": -70.681, "epsilon_zeta": -61.668, "bb_type": "BI", "chi": -166.870, "glyco_bond": "anti", "C5prime_xyz": [ -1.511, 8.687, 0.908 ], "P_xyz": [ 1.070, 9.182, 0.861 ], "form": ".", "ssZp": 4.574, "Dp": 4.740, "splay_angle": 28.700, "splay_distance": 4.487, "splay_ratio": 0.249, "d22": null, "d64": null, "eta": 167.578, "theta": -129.794, "eta_prime": -174.725, "theta_prime": -124.724, "eta_base": -113.065, "theta_base": -72.984, "v0": 3.004, "v1": -25.881, "v2": 37.710, "v3": -36.911, "v4": 21.356, "amplitude": 38.900, "phase_angle": 14.207, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.882, "filter_rmsd": 0.104, "frame": { "rmsd": 0.003, "origin": [ 42.495, 75.974, 78.927 ], "x_axis": [ -0.928, 0.366, 0.067 ], "y_axis": [ 0.281, 0.808, -0.518 ], "z_axis": [ -0.244, -0.462, -0.853 ], "quaternion": [ -0.082, 0.171, 0.947, -0.259 ] } }, { "index": 61, "index_chain": 61, "chain_name": "A", "nt_resnum": 163, "nt_name": "G", "nt_code": "G", "nt_id": "///A/163", "linked_nts": [ "///A/162", "///A/164" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-canonical,non-pair-contact,helix,junction-loop,phosphate", "alpha": -54.311, "beta": 153.396, "gamma": 66.720, "delta": 85.112, "epsilon": -125.898, "zeta": -83.273, "epsilon_zeta": -42.625, "bb_type": "--", "chi": -154.542, "glyco_bond": "anti", "C5prime_xyz": [ -1.481, 8.846, 0.247 ], "P_xyz": [ 1.077, 9.146, -0.269 ], "form": ".", "ssZp": 4.016, "Dp": 4.534, "splay_angle": 19.407, "splay_distance": 3.219, "splay_ratio": 0.174, "d22": null, "d64": null, "eta": 177.490, "theta": -131.073, "eta_prime": -157.533, "theta_prime": -123.706, "eta_base": -88.174, "theta_base": -83.886, "v0": -0.228, "v1": -20.006, "v2": 31.397, "v3": -32.418, "v4": 20.656, "amplitude": 33.208, "phase_angle": 19.012, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.534, "filter_rmsd": 0.005, "frame": { "rmsd": 0.005, "origin": [ 38.697, 76.743, 76.665 ], "x_axis": [ -0.375, 0.829, -0.416 ], "y_axis": [ 0.818, 0.084, -0.570 ], "z_axis": [ -0.437, -0.553, -0.709 ], "quaternion": [ -0.007, 0.559, 0.736, -0.381 ] } }, { "index": 62, "index_chain": 62, "chain_name": "A", "nt_resnum": 164, "nt_name": "G", "nt_code": "G", "nt_id": "///A/164", "linked_nts": [ "///A/163", "///A/165" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C2'-endo,non-canonical,non-pair-contact,helix-end,multiplet,junction-loop,phosphate", "alpha": -48.372, "beta": 167.288, "gamma": 52.442, "delta": 144.575, "epsilon": -118.094, "zeta": -64.719, "epsilon_zeta": -53.374, "bb_type": "--", "chi": -100.526, "glyco_bond": "anti", "C5prime_xyz": [ -2.003, 8.072, -2.122 ], "P_xyz": [ 0.576, 8.546, -2.272 ], "form": ".", "ssZp": 1.092, "Dp": 1.527, "splay_angle": 84.229, "splay_distance": 13.186, "splay_ratio": 0.672, "d22": null, "d64": null, "eta": -177.306, "theta": -59.208, "eta_prime": -143.781, "theta_prime": -75.153, "eta_base": -100.016, "theta_base": -36.656, "v0": -18.573, "v1": 31.931, "v2": -32.351, "v3": 22.490, "v4": -2.652, "amplitude": 33.384, "phase_angle": 165.709, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1b", "suiteness": 0.662, "filter_rmsd": 0.005, "frame": { "rmsd": 0.005, "origin": [ 37.836, 77.117, 73.586 ], "x_axis": [ 0.426, 0.820, -0.382 ], "y_axis": [ 0.611, -0.572, -0.547 ], "z_axis": [ -0.667, 0.000, -0.745 ], "quaternion": [ -0.165, 0.828, 0.432, -0.317 ] } }, { "index": 63, "index_chain": 63, "chain_name": "A", "nt_resnum": 165, "nt_name": "C", "nt_code": "C", "nt_id": "///A/165", "linked_nts": [ "///A/164", "///A/166" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,junction-loop", "alpha": -74.297, "beta": 166.857, "gamma": 52.456, "delta": 81.911, "epsilon": -122.369, "zeta": -86.817, "epsilon_zeta": -35.552, "bb_type": "--", "chi": -166.732, "glyco_bond": "anti", "C5prime_xyz": [ -1.314, 8.730, 0.915 ], "P_xyz": [ 1.273, 9.004, 1.303 ], "form": "A", "ssZp": 4.451, "Dp": 4.682, "splay_angle": 22.686, "splay_distance": 3.690, "splay_ratio": 0.197, "d22": 4.402, "d64": 4.239, "eta": 149.748, "theta": -137.573, "eta_prime": -166.922, "theta_prime": -135.205, "eta_base": -132.573, "theta_base": -111.591, "v0": 0.342, "v1": -22.144, "v2": 34.211, "v3": -34.970, "v4": 21.825, "amplitude": 35.981, "phase_angle": 18.048, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "2a", "suiteness": 0.603, "filter_rmsd": 0.065, "frame": { "rmsd": 0.004, "origin": [ 45.743, 72.403, 64.144 ], "x_axis": [ 0.645, -0.085, 0.760 ], "y_axis": [ -0.726, -0.378, 0.574 ], "z_axis": [ 0.238, -0.922, -0.305 ], "quaternion": [ 0.490, 0.763, -0.266, 0.327 ] } }, { "index": 64, "index_chain": 64, "chain_name": "A", "nt_resnum": 166, "nt_name": "C", "nt_code": "C", "nt_id": "///A/166", "linked_nts": [ "///A/165", "///A/167" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop,phosphate", "alpha": -67.120, "beta": 154.976, "gamma": 64.142, "delta": 80.641, "epsilon": -99.601, "zeta": -26.266, "epsilon_zeta": -73.334, "bb_type": "--", "chi": -158.013, "glyco_bond": "anti", "C5prime_xyz": [ -1.678, 8.884, 0.382 ], "P_xyz": [ 0.829, 9.447, -0.110 ], "form": ".", "ssZp": 3.881, "Dp": 4.575, "splay_angle": 20.623, "splay_distance": 3.490, "splay_ratio": 0.179, "d22": 3.861, "d64": 4.617, "eta": 173.927, "theta": -40.029, "eta_prime": -174.430, "theta_prime": -67.419, "eta_base": -142.259, "theta_base": -92.344, "v0": -1.343, "v1": -21.277, "v2": 34.486, "v3": -36.258, "v4": 23.743, "amplitude": 36.862, "phase_angle": 20.682, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.457, "filter_rmsd": 0.062, "frame": { "rmsd": 0.004, "origin": [ 47.947, 69.562, 63.317 ], "x_axis": [ 0.122, -0.082, 0.989 ], "y_axis": [ -0.908, -0.412, 0.078 ], "z_axis": [ 0.401, -0.907, -0.125 ], "quaternion": [ 0.382, 0.644, -0.384, 0.540 ] } }, { "index": 65, "index_chain": 65, "chain_name": "A", "nt_resnum": 167, "nt_name": "U", "nt_code": "U", "nt_id": "///A/167", "linked_nts": [ "///A/166", "///A/168" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C2'-endo,non-canonical,non-pair-contact,helix,hairpin-loop,splayed-apart", "alpha": -167.080, "beta": -166.772, "gamma": 48.215, "delta": 147.233, "epsilon": -94.806, "zeta": 78.649, "epsilon_zeta": 186.545, "bb_type": "--", "chi": -133.298, "glyco_bond": "anti", "C5prime_xyz": [ -1.883, 8.684, -0.523 ], "P_xyz": [ 0.066, 9.682, 0.910 ], "form": ".", "ssZp": 0.747, "Dp": 0.758, "splay_angle": 167.018, "splay_distance": 18.816, "splay_ratio": 0.994, "d22": 11.527, "d64": 14.896, "eta": 72.257, "theta": 123.378, "eta_prime": 124.621, "theta_prime": 88.989, "eta_base": 131.390, "theta_base": 150.308, "v0": -21.679, "v1": 36.099, "v2": -35.965, "v3": 24.363, "v4": -1.900, "amplitude": 37.394, "phase_angle": 164.108, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.104, "frame": { "rmsd": 0.002, "origin": [ 48.988, 66.861, 65.267 ], "x_axis": [ 0.335, 0.338, -0.880 ], "y_axis": [ -0.727, -0.501, -0.469 ], "z_axis": [ -0.599, 0.797, 0.078 ], "quaternion": [ -0.477, 0.663, -0.147, -0.558 ] } }, { "index": 66, "index_chain": 66, "chain_name": "A", "nt_resnum": 168, "nt_name": "U", "nt_code": "U", "nt_id": "///A/168", "linked_nts": [ "///A/167", "///A/169" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,anti,~C2'-endo,non-canonical,non-pair-contact,hairpin-loop,splayed-apart", "alpha": 59.939, "beta": 139.269, "gamma": 65.133, "delta": 146.621, "epsilon": -79.016, "zeta": 91.553, "epsilon_zeta": 189.430, "bb_type": "--", "chi": -137.211, "glyco_bond": "anti", "C5prime_xyz": [ -2.015, 8.734, -0.261 ], "P_xyz": [ 0.583, 8.854, 0.056 ], "form": ".", "ssZp": 0.509, "Dp": 0.468, "splay_angle": 141.965, "splay_distance": 18.055, "splay_ratio": 0.946, "d22": null, "d64": null, "eta": -13.348, "theta": 138.279, "eta_prime": -0.729, "theta_prime": 92.166, "eta_base": -67.027, "theta_base": 66.625, "v0": -21.929, "v1": 36.347, "v2": -36.099, "v3": 24.330, "v4": -1.707, "amplitude": 37.588, "phase_angle": 163.818, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "6p", "suiteness": 0.456, "filter_rmsd": 0.106, "frame": { "rmsd": 0.005, "origin": [ 34.478, 55.866, 70.023 ], "x_axis": [ -0.549, 0.818, 0.172 ], "y_axis": [ 0.742, 0.572, -0.349 ], "z_axis": [ -0.384, -0.064, -0.921 ], "quaternion": [ -0.160, 0.447, 0.872, -0.118 ] } }, { "index": 67, "index_chain": 67, "chain_name": "A", "nt_resnum": 169, "nt_name": "G", "nt_code": "G", "nt_id": "///A/169", "linked_nts": [ "///A/168", "///A/170" ], "nt_type": "RNA", "dbn": "[", "summary": "pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,hairpin-loop,splayed-apart", "alpha": 47.181, "beta": 165.843, "gamma": 56.700, "delta": 81.877, "epsilon": -143.682, "zeta": -77.544, "epsilon_zeta": -66.138, "bb_type": "BI", "chi": 177.446, "glyco_bond": "anti", "C5prime_xyz": [ -1.734, 8.411, 1.809 ], "P_xyz": [ 0.778, 8.724, 2.495 ], "form": "A", "ssZp": 4.612, "Dp": 4.633, "splay_angle": 28.310, "splay_distance": 4.344, "splay_ratio": 0.247, "d22": null, "d64": null, "eta": -26.941, "theta": -142.982, "eta_prime": -34.820, "theta_prime": -140.637, "eta_base": -11.378, "theta_base": -111.694, "v0": 1.327, "v1": -23.154, "v2": 34.944, "v3": -35.111, "v4": 21.336, "amplitude": 36.455, "phase_angle": 16.553, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "6d", "suiteness": 0.238, "filter_rmsd": 0.003, "frame": { "rmsd": 0.003, "origin": [ 52.276, 57.108, 67.254 ], "x_axis": [ 0.088, -0.031, -0.996 ], "y_axis": [ -0.884, -0.463, -0.064 ], "z_axis": [ -0.459, 0.886, -0.068 ], "quaternion": [ -0.373, 0.636, -0.360, -0.572 ] } }, { "index": 68, "index_chain": 68, "chain_name": "A", "nt_resnum": 170, "nt_name": "C", "nt_code": "C", "nt_id": "///A/170", "linked_nts": [ "///A/169", "///A/171" ], "nt_type": "RNA", "dbn": "[", "summary": "pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop", "alpha": -57.080, "beta": -176.834, "gamma": 43.452, "delta": 81.914, "epsilon": -161.568, "zeta": -78.619, "epsilon_zeta": -82.949, "bb_type": "BI", "chi": -169.321, "glyco_bond": "anti", "C5prime_xyz": [ -1.207, 8.615, 1.101 ], "P_xyz": [ 1.209, 8.785, 2.113 ], "form": ".", "ssZp": 4.517, "Dp": 4.544, "splay_angle": 30.003, "splay_distance": 4.617, "splay_ratio": 0.259, "d22": null, "d64": null, "eta": 172.087, "theta": -120.880, "eta_prime": -176.493, "theta_prime": -114.333, "eta_base": -133.951, "theta_base": -59.564, "v0": 3.508, "v1": -24.972, "v2": 35.705, "v3": -34.749, "v4": 19.684, "amplitude": 36.688, "phase_angle": 13.289, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.770, "filter_rmsd": 0.067, "frame": { "rmsd": 0.005, "origin": [ 52.242, 61.349, 66.316 ], "x_axis": [ -0.440, -0.413, -0.797 ], "y_axis": [ -0.664, -0.449, 0.599 ], "z_axis": [ -0.605, 0.792, -0.077 ], "quaternion": [ 0.093, -0.521, 0.517, 0.673 ] } }, { "index": 69, "index_chain": 69, "chain_name": "A", "nt_resnum": 171, "nt_name": "A", "nt_code": "A", "nt_id": "///A/171", "linked_nts": [ "///A/170", "///A/172" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C2'-endo,BII,non-canonical,non-pair-contact,helix,hairpin-loop,phosphate", "alpha": 149.567, "beta": -131.722, "gamma": -178.623, "delta": 147.993, "epsilon": -79.078, "zeta": -176.953, "epsilon_zeta": 97.876, "bb_type": "BII", "chi": -164.853, "glyco_bond": "anti", "C5prime_xyz": [ -1.579, 8.450, 1.276 ], "P_xyz": [ 0.923, 8.990, 0.674 ], "form": ".", "ssZp": 0.437, "Dp": 0.516, "splay_angle": 43.186, "splay_distance": 7.028, "splay_ratio": 0.378, "d22": null, "d64": null, "eta": -114.824, "theta": 143.310, "eta_prime": -112.441, "theta_prime": 157.740, "eta_base": -50.528, "theta_base": 167.722, "v0": -17.583, "v1": 33.195, "v2": -35.336, "v3": 26.075, "v4": -5.533, "amplitude": 35.880, "phase_angle": 170.003, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32t", "cluster": "1t", "suiteness": 0.204, "filter_rmsd": 0.038, "frame": { "rmsd": 0.006, "origin": [ 48.312, 61.762, 63.926 ], "x_axis": [ -0.756, -0.650, 0.079 ], "y_axis": [ -0.062, 0.191, 0.980 ], "z_axis": [ -0.652, 0.735, -0.185 ], "quaternion": [ -0.250, -0.244, 0.730, 0.587 ] } }, { "index": 70, "index_chain": 70, "chain_name": "A", "nt_resnum": 172, "nt_name": "A", "nt_code": "A", "nt_id": "///A/172", "linked_nts": [ "///A/171", "///A/173" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,hairpin-loop", "alpha": 152.749, "beta": -158.405, "gamma": 82.093, "delta": 84.435, "epsilon": -145.052, "zeta": -65.039, "epsilon_zeta": -80.013, "bb_type": "BI", "chi": -178.475, "glyco_bond": "anti", "C5prime_xyz": [ -1.269, 8.286, 1.576 ], "P_xyz": [ 1.367, 8.148, 1.808 ], "form": "A", "ssZp": 4.720, "Dp": 4.714, "splay_angle": 29.205, "splay_distance": 4.451, "splay_ratio": 0.256, "d22": null, "d64": null, "eta": 113.940, "theta": -128.051, "eta_prime": 121.182, "theta_prime": -128.629, "eta_base": 142.972, "theta_base": -101.913, "v0": 8.278, "v1": -28.952, "v2": 37.543, "v3": -33.759, "v4": 16.121, "amplitude": 37.767, "phase_angle": 6.249, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.037, "frame": { "rmsd": 0.002, "origin": [ 54.427, 65.223, 63.796 ], "x_axis": [ -0.873, -0.487, 0.029 ], "y_axis": [ -0.059, 0.163, 0.985 ], "z_axis": [ -0.484, 0.858, -0.171 ], "quaternion": [ -0.173, -0.184, 0.743, 0.620 ] } }, { "index": 71, "index_chain": 71, "chain_name": "A", "nt_resnum": 173, "nt_name": "A", "nt_code": "A", "nt_id": "///A/173", "linked_nts": [ "///A/172", "///A/174" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,hairpin-loop,phosphate", "alpha": -67.554, "beta": 175.415, "gamma": 59.835, "delta": 80.841, "epsilon": -132.246, "zeta": -79.681, "epsilon_zeta": -52.565, "bb_type": "BI", "chi": -173.926, "glyco_bond": "anti", "C5prime_xyz": [ -1.500, 8.489, 1.398 ], "P_xyz": [ 1.063, 8.833, 1.878 ], "form": ".", "ssZp": 4.688, "Dp": 4.736, "splay_angle": 27.173, "splay_distance": 4.134, "splay_ratio": 0.236, "d22": null, "d64": null, "eta": 173.460, "theta": -134.142, "eta_prime": -168.934, "theta_prime": -130.055, "eta_base": -119.490, "theta_base": -81.517, "v0": 4.813, "v1": -26.985, "v2": 37.667, "v3": -35.947, "v4": 19.619, "amplitude": 38.451, "phase_angle": 11.586, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.900, "filter_rmsd": 0.037, "frame": { "rmsd": 0.004, "origin": [ 51.106, 67.349, 61.731 ], "x_axis": [ -0.705, -0.243, 0.666 ], "y_axis": [ 0.578, 0.347, 0.739 ], "z_axis": [ -0.411, 0.906, -0.104 ], "quaternion": [ -0.367, 0.114, 0.734, 0.560 ] } }, { "index": 72, "index_chain": 72, "chain_name": "A", "nt_resnum": 174, "nt_name": "G", "nt_code": "G", "nt_id": "///A/174", "linked_nts": [ "///A/173", "///A/175" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop", "alpha": -46.123, "beta": 158.318, "gamma": 45.299, "delta": 81.213, "epsilon": -122.985, "zeta": -92.233, "epsilon_zeta": -30.752, "bb_type": "--", "chi": -167.431, "glyco_bond": "anti", "C5prime_xyz": [ -1.264, 8.631, 1.050 ], "P_xyz": [ 1.345, 8.726, 1.386 ], "form": "A", "ssZp": 4.561, "Dp": 4.762, "splay_angle": 20.590, "splay_distance": 3.233, "splay_ratio": 0.179, "d22": null, "d64": null, "eta": 169.174, "theta": -140.178, "eta_prime": -172.964, "theta_prime": -139.343, "eta_base": -107.417, "theta_base": -110.613, "v0": 5.429, "v1": -26.767, "v2": 36.794, "v3": -34.672, "v4": 18.416, "amplitude": 37.415, "phase_angle": 10.453, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.558, "filter_rmsd": 0.005, "frame": { "rmsd": 0.005, "origin": [ 47.871, 69.500, 63.145 ], "x_axis": [ 0.044, 0.045, 0.998 ], "y_axis": [ 0.898, 0.437, -0.059 ], "z_axis": [ -0.439, 0.898, -0.021 ], "quaternion": [ 0.604, -0.396, -0.594, -0.353 ] } }, { "index": 73, "index_chain": 73, "chain_name": "A", "nt_resnum": 175, "nt_name": "G", "nt_code": "G", "nt_id": "///A/175", "linked_nts": [ "///A/174", "///A/176" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,junction-loop", "alpha": -53.088, "beta": 147.975, "gamma": 50.929, "delta": 77.850, "epsilon": -133.907, "zeta": -73.120, "epsilon_zeta": -60.786, "bb_type": "BI", "chi": -170.586, "glyco_bond": "anti", "C5prime_xyz": [ -1.469, 8.642, 1.099 ], "P_xyz": [ 1.105, 9.000, 0.854 ], "form": ".", "ssZp": 4.692, "Dp": 4.782, "splay_angle": 29.282, "splay_distance": 4.638, "splay_ratio": 0.257, "d22": null, "d64": null, "eta": 158.257, "theta": -132.602, "eta_prime": 172.676, "theta_prime": -131.958, "eta_base": -140.647, "theta_base": -99.130, "v0": 4.067, "v1": -27.259, "v2": 38.874, "v3": -37.556, "v4": 21.056, "amplitude": 39.872, "phase_angle": 12.847, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.378, "filter_rmsd": 0.005, "frame": { "rmsd": 0.005, "origin": [ 45.808, 71.771, 64.163 ], "x_axis": [ 0.599, 0.130, 0.790 ], "y_axis": [ 0.680, 0.439, -0.587 ], "z_axis": [ -0.423, 0.889, 0.175 ], "quaternion": [ 0.744, -0.496, -0.408, -0.185 ] } }, { "index": 74, "index_chain": 74, "chain_name": "A", "nt_resnum": 176, "nt_name": "G", "nt_code": "G", "nt_id": "///A/176", "linked_nts": [ "///A/175", "///A/177" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-pair-contact,junction-loop", "alpha": -55.381, "beta": 166.363, "gamma": 55.512, "delta": 78.230, "epsilon": -141.653, "zeta": -69.235, "epsilon_zeta": -72.419, "bb_type": "BI", "chi": -170.879, "glyco_bond": "anti", "C5prime_xyz": [ -1.600, 8.714, 1.145 ], "P_xyz": [ 0.937, 9.304, 1.428 ], "form": "A", "ssZp": 4.639, "Dp": 4.685, "splay_angle": 24.616, "splay_distance": 3.852, "splay_ratio": 0.215, "d22": null, "d64": null, "eta": 170.436, "theta": -138.064, "eta_prime": -171.565, "theta_prime": -135.208, "eta_base": -118.021, "theta_base": -89.175, "v0": 0.691, "v1": -23.998, "v2": 36.929, "v3": -37.564, "v4": 23.213, "amplitude": 38.746, "phase_angle": 17.615, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.807, "filter_rmsd": 0.004, "frame": { "rmsd": 0.004, "origin": [ 45.489, 74.846, 67.620 ], "x_axis": [ 0.962, 0.234, 0.142 ], "y_axis": [ 0.087, 0.229, -0.969 ], "z_axis": [ -0.259, 0.945, 0.200 ], "quaternion": [ 0.773, -0.619, -0.130, 0.047 ] } }, { "index": 75, "index_chain": 75, "chain_name": "A", "nt_resnum": 177, "nt_name": "U", "nt_code": "U", "nt_id": "///A/177", "linked_nts": [ "///A/176", "///A/178" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BII,non-pair-contact,junction-loop,splayed-apart", "alpha": -62.500, "beta": 168.109, "gamma": 55.509, "delta": 81.254, "epsilon": -124.237, "zeta": 152.430, "epsilon_zeta": 83.334, "bb_type": "BII", "chi": -162.559, "glyco_bond": "anti", "C5prime_xyz": [ -1.417, 8.702, 0.673 ], "P_xyz": [ 1.171, 9.107, 0.730 ], "form": ".", "ssZp": 4.396, "Dp": 4.733, "splay_angle": 95.912, "splay_distance": 13.403, "splay_ratio": 0.743, "d22": null, "d64": null, "eta": 170.937, "theta": 103.025, "eta_prime": -172.094, "theta_prime": 119.741, "eta_base": -110.675, "theta_base": 136.886, "v0": 2.616, "v1": -24.577, "v2": 36.036, "v3": -35.501, "v4": 20.734, "amplitude": 37.251, "phase_angle": 14.674, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.943, "filter_rmsd": 0.104, "frame": { "rmsd": 0.002, "origin": [ 47.148, 78.066, 68.931 ], "x_axis": [ 0.736, 0.301, -0.606 ], "y_axis": [ -0.657, 0.103, -0.747 ], "z_axis": [ -0.163, 0.948, 0.274 ], "quaternion": [ 0.727, -0.583, 0.152, 0.330 ] } }, { "index": 76, "index_chain": 76, "chain_name": "A", "nt_resnum": 178, "nt_name": "A", "nt_code": "A", "nt_id": "///A/178", "linked_nts": [ "///A/177", "///A/179" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C2'-endo,non-canonical,non-pair-contact,multiplet,junction-loop,cap-donor,splayed-apart", "alpha": -51.681, "beta": 140.966, "gamma": 51.507, "delta": 146.596, "epsilon": -108.872, "zeta": 92.593, "epsilon_zeta": 158.535, "bb_type": "--", "chi": -141.207, "glyco_bond": "anti", "C5prime_xyz": [ -1.944, 8.737, -0.049 ], "P_xyz": [ 0.501, 8.855, 0.901 ], "form": ".", "ssZp": 0.984, "Dp": 1.083, "splay_angle": 140.779, "splay_distance": 17.460, "splay_ratio": 0.942, "d22": null, "d64": null, "eta": -152.466, "theta": 127.008, "eta_prime": -139.457, "theta_prime": 60.459, "eta_base": -170.483, "theta_base": 1.268, "v0": -22.484, "v1": 36.804, "v2": -36.196, "v3": 24.187, "v4": -1.295, "amplitude": 37.826, "phase_angle": 163.119, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "3b", "suiteness": 0.362, "filter_rmsd": 0.038, "frame": { "rmsd": 0.005, "origin": [ 34.346, 79.308, 72.700 ], "x_axis": [ 0.840, -0.305, 0.448 ], "y_axis": [ 0.525, 0.253, -0.813 ], "z_axis": [ 0.134, 0.918, 0.373 ], "quaternion": [ 0.785, -0.551, -0.100, -0.264 ] } }, { "index": 77, "index_chain": 77, "chain_name": "A", "nt_resnum": 179, "nt_name": "U", "nt_code": "U", "nt_id": "///A/179", "linked_nts": [ "///A/178", "///A/180" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,anti,~C2'-endo,non-stack,junction-loop,splayed-apart", "alpha": 72.378, "beta": -177.685, "gamma": 67.012, "delta": 149.988, "epsilon": -96.263, "zeta": -51.221, "epsilon_zeta": -45.041, "bb_type": "--", "chi": -170.544, "glyco_bond": "anti", "C5prime_xyz": [ -1.860, 8.362, 1.557 ], "P_xyz": [ -0.139, 7.875, 3.493 ], "form": ".", "ssZp": 0.437, "Dp": 0.644, "splay_angle": 116.320, "splay_distance": 16.451, "splay_ratio": 0.850, "d22": null, "d64": null, "eta": 20.866, "theta": -27.021, "eta_prime": 39.041, "theta_prime": -48.140, "eta_base": 78.878, "theta_base": -27.998, "v0": -19.199, "v1": 35.002, "v2": -36.547, "v3": 26.461, "v4": -4.803, "amplitude": 37.299, "phase_angle": 168.475, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "6p", "suiteness": 0.736, "filter_rmsd": 0.110, "frame": { "rmsd": 0.009, "origin": [ 37.811, 86.926, 57.376 ], "x_axis": [ -0.378, 0.919, 0.114 ], "y_axis": [ -0.799, -0.386, 0.462 ], "z_axis": [ 0.468, 0.083, 0.880 ], "quaternion": [ 0.528, 0.179, 0.168, 0.813 ] } }, { "index": 78, "index_chain": 78, "chain_name": "A", "nt_resnum": 180, "nt_name": "G", "nt_code": "G", "nt_id": "///A/180", "linked_nts": [ "///A/179", "///A/181" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,junction-loop,cap-acceptor,splayed-apart", "alpha": -64.555, "beta": -169.880, "gamma": 55.722, "delta": 82.022, "epsilon": -150.408, "zeta": -82.486, "epsilon_zeta": -67.922, "bb_type": "BI", "chi": -160.873, "glyco_bond": "anti", "C5prime_xyz": [ -1.273, 8.734, 0.594 ], "P_xyz": [ 1.263, 9.144, 1.143 ], "form": ".", "ssZp": 4.452, "Dp": 4.622, "splay_angle": 22.711, "splay_distance": 3.996, "splay_ratio": 0.208, "d22": null, "d64": null, "eta": 161.732, "theta": -120.886, "eta_prime": -152.855, "theta_prime": -127.606, "eta_base": -126.404, "theta_base": -101.970, "v0": 3.756, "v1": -24.679, "v2": 34.970, "v3": -33.788, "v4": 18.935, "amplitude": 35.850, "phase_angle": 12.717, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "2a", "suiteness": 0.679, "filter_rmsd": 0.003, "frame": { "rmsd": 0.003, "origin": [ 32.990, 77.424, 69.910 ], "x_axis": [ -0.931, 0.292, -0.219 ], "y_axis": [ 0.274, 0.164, -0.948 ], "z_axis": [ -0.241, -0.942, -0.233 ], "quaternion": [ -0.007, 0.185, 0.763, -0.619 ] } }, { "index": 79, "index_chain": 79, "chain_name": "A", "nt_resnum": 181, "nt_name": "G", "nt_code": "G", "nt_id": "///A/181", "linked_nts": [ "///A/180", "///A/182" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,canonical,non-canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,A-minor", "alpha": 140.772, "beta": -144.213, "gamma": -175.344, "delta": 81.573, "epsilon": -129.159, "zeta": -95.998, "epsilon_zeta": -33.161, "bb_type": "--", "chi": 178.930, "glyco_bond": "anti", "C5prime_xyz": [ -1.549, 8.439, 1.724 ], "P_xyz": [ -0.023, 10.245, 0.529 ], "form": "A", "ssZp": 4.714, "Dp": 4.721, "splay_angle": 19.196, "splay_distance": 3.007, "splay_ratio": 0.169, "d22": null, "d64": null, "eta": 166.150, "theta": -173.327, "eta_prime": -174.647, "theta_prime": -160.415, "eta_base": -126.614, "theta_base": -137.654, "v0": 3.193, "v1": -24.801, "v2": 35.715, "v3": -34.857, "v4": 19.969, "amplitude": 36.764, "phase_angle": 13.718, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.624, "filter_rmsd": 0.004, "frame": { "rmsd": 0.004, "origin": [ 29.814, 75.024, 70.264 ], "x_axis": [ -0.645, 0.394, -0.655 ], "y_axis": [ 0.680, -0.096, -0.727 ], "z_axis": [ -0.349, -0.914, -0.206 ], "quaternion": [ 0.115, 0.405, 0.662, -0.619 ] } }, { "index": 80, "index_chain": 80, "chain_name": "A", "nt_resnum": 182, "nt_name": "U", "nt_code": "U", "nt_id": "///A/182", "linked_nts": [ "///A/181", "///A/183" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop,cap-donor,splayed-apart", "alpha": -34.447, "beta": 163.999, "gamma": 51.842, "delta": 145.232, "epsilon": -90.580, "zeta": -81.533, "epsilon_zeta": -9.047, "bb_type": "--", "chi": -122.884, "glyco_bond": "anti", "C5prime_xyz": [ -1.811, 8.548, -1.080 ], "P_xyz": [ 0.691, 9.102, -0.541 ], "form": ".", "ssZp": 0.733, "Dp": 0.851, "splay_angle": 155.728, "splay_distance": 19.167, "splay_ratio": 0.978, "d22": null, "d64": null, "eta": -152.096, "theta": -61.851, "eta_prime": -129.561, "theta_prime": -89.016, "eta_base": -113.228, "theta_base": -67.218, "v0": -19.786, "v1": 33.565, "v2": -33.739, "v3": 23.203, "v4": -2.364, "amplitude": 34.926, "phase_angle": 165.021, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1b", "suiteness": 0.302, "filter_rmsd": 0.105, "frame": { "rmsd": 0.002, "origin": [ 27.533, 73.087, 70.551 ], "x_axis": [ -0.130, 0.369, -0.920 ], "y_axis": [ 0.765, -0.553, -0.330 ], "z_axis": [ -0.631, -0.747, -0.211 ], "quaternion": [ 0.163, 0.639, 0.444, -0.607 ] } }, { "index": 81, "index_chain": 81, "chain_name": "A", "nt_resnum": 183, "nt_name": "A", "nt_code": "A", "nt_id": "///A/183", "linked_nts": [ "///A/182", "///A/184" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-canonical,non-pair-contact,multiplet,internal-loop,A-minor,ribose-zipper,cap-donor,phosphate,splayed-apart", "alpha": -53.285, "beta": -139.315, "gamma": 64.304, "delta": 81.520, "epsilon": -123.730, "zeta": -111.109, "epsilon_zeta": -12.621, "bb_type": "--", "chi": -158.094, "glyco_bond": "anti", "C5prime_xyz": [ -1.623, 8.804, 0.404 ], "P_xyz": [ 0.751, 9.236, 1.448 ], "form": ".", "ssZp": 4.159, "Dp": 4.612, "splay_angle": 19.049, "splay_distance": 3.151, "splay_ratio": 0.177, "d22": null, "d64": null, "eta": -141.483, "theta": -150.273, "eta_prime": -109.182, "theta_prime": -139.538, "eta_base": -107.344, "theta_base": -96.443, "v0": -1.801, "v1": -20.305, "v2": 33.377, "v3": -35.357, "v4": 23.457, "amplitude": 35.855, "phase_angle": 21.426, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "2a", "suiteness": 0.440, "filter_rmsd": 0.037, "frame": { "rmsd": 0.004, "origin": [ 38.335, 57.350, 72.301 ], "x_axis": [ 0.792, 0.504, -0.345 ], "y_axis": [ -0.550, 0.834, -0.045 ], "z_axis": [ 0.265, 0.225, 0.938 ], "quaternion": [ 0.944, -0.071, 0.162, 0.279 ] } }, { "index": 82, "index_chain": 82, "chain_name": "A", "nt_resnum": 184, "nt_name": "A", "nt_code": "A", "nt_id": "///A/184", "linked_nts": [ "///A/183", "///A/185" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-canonical,non-pair-contact,multiplet,internal-loop,A-minor,ribose-zipper,cap-acceptor,phosphate,splayed-apart", "alpha": -33.443, "beta": 143.430, "gamma": 40.838, "delta": 84.824, "epsilon": -141.750, "zeta": 49.070, "epsilon_zeta": 169.180, "bb_type": "--", "chi": -121.844, "glyco_bond": "anti", "C5prime_xyz": [ -1.445, 8.315, -1.632 ], "P_xyz": [ 1.047, 7.898, -2.353 ], "form": ".", "ssZp": 2.558, "Dp": 4.651, "splay_angle": 109.249, "splay_distance": 15.029, "splay_ratio": 0.816, "d22": null, "d64": null, "eta": 171.842, "theta": 20.288, "eta_prime": -176.086, "theta_prime": -36.006, "eta_base": -130.839, "theta_base": -107.357, "v0": 6.157, "v1": -25.849, "v2": 34.617, "v3": -32.124, "v4": 16.418, "amplitude": 35.032, "phase_angle": 8.822, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1L", "suiteness": 0.184, "filter_rmsd": 0.038, "frame": { "rmsd": 0.003, "origin": [ 39.458, 59.105, 74.665 ], "x_axis": [ 0.332, 0.898, -0.288 ], "y_axis": [ -0.711, 0.439, 0.549 ], "z_axis": [ 0.620, 0.023, 0.784 ], "quaternion": [ 0.799, 0.165, 0.284, 0.503 ] } }, { "index": 83, "index_chain": 83, "chain_name": "A", "nt_resnum": 185, "nt_name": "U", "nt_code": "U", "nt_id": "///A/185", "linked_nts": [ "///A/184", "///A/186" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C2'-endo,BII,non-stack,non-pair-contact,internal-loop,splayed-apart", "alpha": 74.506, "beta": 140.829, "gamma": 51.311, "delta": 148.655, "epsilon": -100.022, "zeta": -164.047, "epsilon_zeta": 64.024, "bb_type": "BII", "chi": -158.359, "glyco_bond": "anti", "C5prime_xyz": [ -1.949, 8.610, 0.803 ], "P_xyz": [ 0.456, 8.382, 1.826 ], "form": ".", "ssZp": 1.288, "Dp": 1.111, "splay_angle": 116.335, "splay_distance": 16.020, "splay_ratio": 0.850, "d22": null, "d64": null, "eta": -47.758, "theta": 176.357, "eta_prime": 32.097, "theta_prime": -176.395, "eta_base": 77.815, "theta_base": -133.649, "v0": -21.126, "v1": 36.150, "v2": -36.652, "v3": 25.248, "v4": -2.731, "amplitude": 37.868, "phase_angle": 165.441, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "5p", "suiteness": 0.649, "filter_rmsd": 0.108, "frame": { "rmsd": 0.014, "origin": [ 38.107, 67.839, 86.821 ], "x_axis": [ 0.163, -0.717, 0.678 ], "y_axis": [ -0.670, -0.585, -0.457 ], "z_axis": [ 0.724, -0.380, -0.575 ], "quaternion": [ -0.025, 0.762, -0.455, 0.460 ] } }, { "index": 84, "index_chain": 84, "chain_name": "A", "nt_resnum": 186, "nt_name": "A", "nt_code": "A", "nt_id": "///A/186", "linked_nts": [ "///A/185", "///A/187" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,multiplet,internal-loop,A-minor,cap-acceptor,phosphate,splayed-apart", "alpha": -78.753, "beta": -123.686, "gamma": 59.536, "delta": 86.940, "epsilon": -145.518, "zeta": -109.952, "epsilon_zeta": -35.566, "bb_type": "BI", "chi": -130.331, "glyco_bond": "anti", "C5prime_xyz": [ -1.552, 8.548, -1.167 ], "P_xyz": [ 0.962, 8.920, -0.422 ], "form": ".", "ssZp": 3.131, "Dp": 4.521, "splay_angle": 65.308, "splay_distance": 10.295, "splay_ratio": 0.540, "d22": null, "d64": null, "eta": -87.322, "theta": -151.885, "eta_prime": -122.756, "theta_prime": -162.040, "eta_base": -152.402, "theta_base": -156.538, "v0": 4.224, "v1": -23.116, "v2": 32.210, "v3": -30.660, "v4": 16.766, "amplitude": 32.865, "phase_angle": 11.454, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.039, "frame": { "rmsd": 0.006, "origin": [ 36.775, 71.584, 71.302 ], "x_axis": [ 0.592, -0.806, -0.012 ], "y_axis": [ -0.515, -0.389, 0.764 ], "z_axis": [ -0.620, -0.446, -0.645 ], "quaternion": [ 0.373, 0.810, -0.408, -0.195 ] } }, { "index": 85, "index_chain": 85, "chain_name": "A", "nt_resnum": 187, "nt_name": "A", "nt_code": "A", "nt_id": "///A/187", "linked_nts": [ "///A/186", "///A/188" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,syn,~C3'-endo,non-canonical,non-pair-contact,helix,internal-loop,phosphate", "alpha": 145.745, "beta": 129.823, "gamma": -165.231, "delta": 86.888, "epsilon": -71.867, "zeta": -44.233, "epsilon_zeta": -27.634, "bb_type": "--", "chi": 60.837, "glyco_bond": "syn", "C5prime_xyz": [ -5.251, 4.209, 1.853 ], "P_xyz": [ -6.911, 4.825, 3.780 ], "form": ".", "ssZp": -0.998, "Dp": 4.021, "splay_angle": 73.499, "splay_distance": 11.044, "splay_ratio": 0.601, "d22": null, "d64": null, "eta": 152.537, "theta": -118.568, "eta_prime": 135.037, "theta_prime": -108.445, "eta_base": 132.619, "theta_base": -99.573, "v0": -5.502, "v1": -14.902, "v2": 28.244, "v3": -32.131, "v4": 23.838, "amplitude": 32.042, "phase_angle": 28.179, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1f", "suiteness": 0.010, "filter_rmsd": 0.040, "frame": { "rmsd": 0.008, "origin": [ 27.581, 69.598, 67.118 ], "x_axis": [ -0.384, 0.679, -0.626 ], "y_axis": [ -0.731, 0.190, 0.655 ], "z_axis": [ 0.564, 0.709, 0.423 ], "quaternion": [ 0.554, -0.024, 0.537, 0.636 ] } }, { "index": 86, "index_chain": 86, "chain_name": "A", "nt_resnum": 188, "nt_name": "G", "nt_code": "G", "nt_id": "///A/188", "linked_nts": [ "///A/187", "///A/189" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,~C2'-endo,non-stack,non-canonical,non-pair-contact,internal-loop,cap-acceptor,splayed-apart", "alpha": -98.746, "beta": 123.147, "gamma": -159.694, "delta": 143.312, "epsilon": -145.130, "zeta": 122.124, "epsilon_zeta": 92.747, "bb_type": "--", "chi": 104.627, "glyco_bond": "--", "C5prime_xyz": [ -4.235, 5.690, 2.907 ], "P_xyz": [ -4.801, 6.935, 5.144 ], "form": ".", "ssZp": -1.236, "Dp": 1.890, "splay_angle": 110.333, "splay_distance": 15.226, "splay_ratio": 0.821, "d22": null, "d64": null, "eta": -100.894, "theta": 33.379, "eta_prime": -79.038, "theta_prime": 57.391, "eta_base": -61.283, "theta_base": 84.562, "v0": -21.582, "v1": 34.238, "v2": -33.079, "v3": 21.538, "v4": -0.135, "amplitude": 34.890, "phase_angle": 161.458, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.018, "frame": { "rmsd": 0.018, "origin": [ 34.514, 61.274, 69.267 ], "x_axis": [ 0.781, 0.603, -0.161 ], "y_axis": [ -0.623, 0.769, -0.145 ], "z_axis": [ 0.036, 0.214, 0.976 ], "quaternion": [ 0.939, -0.095, 0.053, 0.326 ] } }, { "index": 87, "index_chain": 87, "chain_name": "A", "nt_resnum": 189, "nt_name": "C", "nt_code": "C", "nt_id": "///A/189", "linked_nts": [ "///A/188", "///A/190" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop,splayed-apart", "alpha": -78.208, "beta": 161.024, "gamma": 46.145, "delta": 81.751, "epsilon": -141.415, "zeta": -80.894, "epsilon_zeta": -60.521, "bb_type": "BI", "chi": -157.624, "glyco_bond": "anti", "C5prime_xyz": [ -1.140, 8.721, 0.413 ], "P_xyz": [ 1.470, 8.786, 0.523 ], "form": "A", "ssZp": 4.318, "Dp": 4.679, "splay_angle": 25.546, "splay_distance": 4.074, "splay_ratio": 0.221, "d22": 4.215, "d64": 4.245, "eta": -179.077, "theta": -142.559, "eta_prime": 177.974, "theta_prime": -142.169, "eta_base": -177.744, "theta_base": -122.183, "v0": 3.249, "v1": -24.853, "v2": 35.881, "v3": -35.031, "v4": 20.025, "amplitude": 36.934, "phase_angle": 13.717, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "0a", "suiteness": 0.720, "filter_rmsd": 0.066, "frame": { "rmsd": 0.005, "origin": [ 23.465, 70.954, 65.259 ], "x_axis": [ 0.736, -0.247, -0.631 ], "y_axis": [ 0.099, -0.882, 0.461 ], "z_axis": [ -0.670, -0.402, -0.624 ], "quaternion": [ 0.240, 0.900, -0.041, -0.361 ] } }, { "index": 88, "index_chain": 88, "chain_name": "A", "nt_resnum": 190, "nt_name": "U", "nt_code": "U", "nt_id": "///A/190", "linked_nts": [ "///A/189", "///A/191" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -49.317, "beta": 165.795, "gamma": 42.067, "delta": 78.385, "epsilon": -137.304, "zeta": -75.060, "epsilon_zeta": -62.244, "bb_type": "BI", "chi": -161.820, "glyco_bond": "anti", "C5prime_xyz": [ -1.387, 8.707, 0.636 ], "P_xyz": [ 1.172, 9.160, 0.882 ], "form": "A", "ssZp": 4.474, "Dp": 4.733, "splay_angle": 20.991, "splay_distance": 3.552, "splay_ratio": 0.190, "d22": null, "d64": null, "eta": 167.485, "theta": -141.518, "eta_prime": 178.756, "theta_prime": -139.128, "eta_base": -147.066, "theta_base": -117.263, "v0": 3.873, "v1": -26.684, "v2": 38.230, "v3": -36.994, "v4": 20.842, "amplitude": 39.244, "phase_angle": 13.053, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.620, "filter_rmsd": 0.105, "frame": { "rmsd": 0.002, "origin": [ 21.345, 70.092, 61.888 ], "x_axis": [ 0.830, -0.531, -0.173 ], "y_axis": [ -0.262, -0.644, 0.719 ], "z_axis": [ -0.493, -0.551, -0.673 ], "quaternion": [ 0.358, 0.887, -0.223, -0.188 ] } }, { "index": 89, "index_chain": 89, "chain_name": "A", "nt_resnum": 191, "nt_name": "G", "nt_code": "G", "nt_id": "///A/191", "linked_nts": [ "///A/190", "///A/192" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge", "alpha": -59.683, "beta": 156.165, "gamma": 69.308, "delta": 76.982, "epsilon": -151.417, "zeta": -71.973, "epsilon_zeta": -79.444, "bb_type": "BI", "chi": -165.260, "glyco_bond": "anti", "C5prime_xyz": [ -2.097, 8.865, 0.803 ], "P_xyz": [ 0.312, 9.835, 0.566 ], "form": "A", "ssZp": 4.410, "Dp": 4.500, "splay_angle": 21.677, "splay_distance": 3.577, "splay_ratio": 0.192, "d22": null, "d64": null, "eta": 170.958, "theta": -149.435, "eta_prime": -170.830, "theta_prime": -152.971, "eta_base": -133.349, "theta_base": -123.848, "v0": -5.602, "v1": -18.674, "v2": 34.373, "v3": -38.640, "v4": 27.837, "amplitude": 38.505, "phase_angle": 26.786, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.513, "filter_rmsd": 0.008, "frame": { "rmsd": 0.008, "origin": [ 21.630, 68.906, 58.553 ], "x_axis": [ 0.692, -0.668, 0.273 ], "y_axis": [ -0.651, -0.416, 0.635 ], "z_axis": [ -0.310, -0.618, -0.723 ], "quaternion": [ 0.372, 0.841, -0.392, -0.011 ] } }, { "index": 90, "index_chain": 90, "chain_name": "A", "nt_resnum": 192, "nt_name": "A", "nt_code": "A", "nt_id": "///A/192", "linked_nts": [ "///A/191", "///A/193" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge", "alpha": -67.411, "beta": 162.830, "gamma": 57.028, "delta": 71.859, "epsilon": -127.087, "zeta": -85.367, "epsilon_zeta": -41.720, "bb_type": "--", "chi": -168.458, "glyco_bond": "anti", "C5prime_xyz": [ -1.810, 8.797, 0.899 ], "P_xyz": [ 0.631, 9.648, 0.554 ], "form": ".", "ssZp": 4.605, "Dp": 4.802, "splay_angle": 26.022, "splay_distance": 4.168, "splay_ratio": 0.229, "d22": null, "d64": null, "eta": 163.359, "theta": -140.825, "eta_prime": 175.116, "theta_prime": -136.895, "eta_base": -139.615, "theta_base": -92.115, "v0": -3.298, "v1": -25.307, "v2": 42.556, "v3": -45.599, "v4": 30.736, "amplitude": 46.072, "phase_angle": 22.528, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.720, "filter_rmsd": 0.042, "frame": { "rmsd": 0.013, "origin": [ 22.337, 66.936, 55.652 ], "x_axis": [ 0.197, -0.863, 0.466 ], "y_axis": [ -0.942, -0.034, 0.335 ], "z_axis": [ -0.273, -0.505, -0.819 ], "quaternion": [ 0.293, 0.716, -0.630, 0.067 ] } }, { "index": 91, "index_chain": 91, "chain_name": "A", "nt_resnum": 193, "nt_name": "C", "nt_code": "C", "nt_id": "///A/193", "linked_nts": [ "///A/192", "///A/194" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -43.173, "beta": 151.677, "gamma": 52.124, "delta": 78.544, "epsilon": -142.352, "zeta": -77.804, "epsilon_zeta": -64.548, "bb_type": "BI", "chi": -159.662, "glyco_bond": "anti", "C5prime_xyz": [ -1.641, 8.868, 0.493 ], "P_xyz": [ 0.914, 9.444, 0.155 ], "form": "A", "ssZp": 4.446, "Dp": 4.674, "splay_angle": 26.289, "splay_distance": 4.197, "splay_ratio": 0.229, "d22": null, "d64": null, "eta": 166.587, "theta": -144.887, "eta_prime": -176.221, "theta_prime": -146.523, "eta_base": -115.581, "theta_base": -117.862, "v0": 2.367, "v1": -25.544, "v2": 37.634, "v3": -37.236, "v4": 21.951, "amplitude": 38.982, "phase_angle": 15.111, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.346, "filter_rmsd": 0.061, "frame": { "rmsd": 0.004, "origin": [ 22.664, 62.796, 55.296 ], "x_axis": [ -0.453, -0.475, 0.754 ], "y_axis": [ -0.873, 0.406, -0.269 ], "z_axis": [ -0.178, -0.781, -0.599 ], "quaternion": [ -0.297, -0.430, 0.784, -0.335 ] } }, { "index": 92, "index_chain": 92, "chain_name": "A", "nt_resnum": 194, "nt_name": "G", "nt_code": "G", "nt_id": "///A/194", "linked_nts": [ "///A/193", "///A/195" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -63.605, "beta": 161.173, "gamma": 59.581, "delta": 77.970, "epsilon": -144.016, "zeta": -73.743, "epsilon_zeta": -70.273, "bb_type": "BI", "chi": -178.688, "glyco_bond": "anti", "C5prime_xyz": [ -1.775, 8.564, 1.516 ], "P_xyz": [ 0.760, 9.218, 1.715 ], "form": "A", "ssZp": 4.697, "Dp": 4.691, "splay_angle": 22.917, "splay_distance": 3.693, "splay_ratio": 0.208, "d22": null, "d64": null, "eta": 163.406, "theta": -145.315, "eta_prime": 178.422, "theta_prime": -145.657, "eta_base": -133.615, "theta_base": -117.243, "v0": 3.107, "v1": -26.527, "v2": 38.576, "v3": -37.772, "v4": 21.810, "amplitude": 39.785, "phase_angle": 14.157, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.850, "filter_rmsd": 0.005, "frame": { "rmsd": 0.005, "origin": [ 22.127, 58.687, 54.634 ], "x_axis": [ -0.778, 0.058, 0.626 ], "y_axis": [ -0.440, 0.661, -0.608 ], "z_axis": [ -0.449, -0.748, -0.489 ], "quaternion": [ -0.314, -0.112, 0.856, -0.396 ] } }, { "index": 93, "index_chain": 93, "chain_name": "A", "nt_resnum": 195, "nt_name": "G", "nt_code": "G", "nt_id": "///A/195", "linked_nts": [ "///A/194", "///A/196" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop", "alpha": -69.610, "beta": 169.924, "gamma": 66.120, "delta": 80.313, "epsilon": -156.073, "zeta": -77.247, "epsilon_zeta": -78.826, "bb_type": "BI", "chi": -171.449, "glyco_bond": "anti", "C5prime_xyz": [ -1.555, 8.704, 1.126 ], "P_xyz": [ 0.997, 9.309, 1.217 ], "form": "A", "ssZp": 4.569, "Dp": 4.575, "splay_angle": 22.931, "splay_distance": 3.496, "splay_ratio": 0.199, "d22": null, "d64": null, "eta": 169.146, "theta": -155.857, "eta_prime": -175.364, "theta_prime": -156.154, "eta_base": -128.936, "theta_base": -131.404, "v0": 2.457, "v1": -24.693, "v2": 36.182, "v3": -35.779, "v4": 21.073, "amplitude": 37.447, "phase_angle": 14.935, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.702, "filter_rmsd": 0.004, "frame": { "rmsd": 0.004, "origin": [ 20.749, 55.316, 55.253 ], "x_axis": [ -0.905, 0.406, 0.131 ], "y_axis": [ 0.073, 0.450, -0.890 ], "z_axis": [ -0.420, -0.795, -0.437 ], "quaternion": [ -0.165, 0.143, 0.835, -0.504 ] } }, { "index": 94, "index_chain": 94, "chain_name": "A", "nt_resnum": 196, "nt_name": "A", "nt_code": "A", "nt_id": "///A/196", "linked_nts": [ "///A/195", "///A/197" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-canonical,non-pair-contact,helix,internal-loop", "alpha": -69.522, "beta": 174.786, "gamma": 59.843, "delta": 83.806, "epsilon": -121.607, "zeta": -95.236, "epsilon_zeta": -26.371, "bb_type": "--", "chi": -168.817, "glyco_bond": "anti", "C5prime_xyz": [ -1.172, 8.558, 1.065 ], "P_xyz": [ 1.429, 8.672, 1.443 ], "form": "A", "ssZp": 4.515, "Dp": 4.716, "splay_angle": 21.710, "splay_distance": 3.452, "splay_ratio": 0.188, "d22": null, "d64": null, "eta": 178.539, "theta": -143.805, "eta_prime": -174.352, "theta_prime": -141.348, "eta_base": -141.387, "theta_base": -124.385, "v0": 4.589, "v1": -25.103, "v2": 34.855, "v3": -33.219, "v4": 18.111, "amplitude": 35.557, "phase_angle": 11.404, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.879, "filter_rmsd": 0.039, "frame": { "rmsd": 0.005, "origin": [ 19.250, 52.159, 55.319 ], "x_axis": [ -0.694, 0.622, -0.363 ], "y_axis": [ 0.557, 0.144, -0.818 ], "z_axis": [ -0.457, -0.770, -0.446 ], "quaternion": [ -0.031, 0.390, 0.756, -0.525 ] } }, { "index": 95, "index_chain": 95, "chain_name": "A", "nt_resnum": 197, "nt_name": "C", "nt_code": "C", "nt_id": "///A/197", "linked_nts": [ "///A/196", "///A/198" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BII,non-canonical,non-pair-contact,helix-end,multiplet,internal-loop", "alpha": -61.071, "beta": 149.335, "gamma": 61.493, "delta": 83.642, "epsilon": -97.297, "zeta": -159.412, "epsilon_zeta": 62.115, "bb_type": "BII", "chi": -164.318, "glyco_bond": "anti", "C5prime_xyz": [ -1.483, 8.821, 0.749 ], "P_xyz": [ 1.118, 9.109, 0.605 ], "form": ".", "ssZp": 3.981, "Dp": 4.449, "splay_angle": 52.565, "splay_distance": 8.328, "splay_ratio": 0.445, "d22": null, "d64": null, "eta": 178.064, "theta": 164.554, "eta_prime": -173.151, "theta_prime": -175.267, "eta_base": -149.423, "theta_base": -174.451, "v0": -2.010, "v1": -19.058, "v2": 31.478, "v3": -33.580, "v4": 22.509, "amplitude": 33.938, "phase_angle": 21.949, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.335, "filter_rmsd": 0.065, "frame": { "rmsd": 0.005, "origin": [ 17.030, 49.559, 54.838 ], "x_axis": [ -0.215, 0.783, -0.584 ], "y_axis": [ 0.761, -0.241, -0.603 ], "z_axis": [ -0.612, -0.574, -0.544 ], "quaternion": [ -0.011, 0.626, 0.616, -0.478 ] } }, { "index": 96, "index_chain": 96, "chain_name": "A", "nt_resnum": 198, "nt_name": "A", "nt_code": "A", "nt_id": "///A/198", "linked_nts": [ "///A/197", "///A/199" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C2'-endo,non-canonical,non-pair-contact,helix-end,internal-loop,splayed-apart", "alpha": -60.363, "beta": 146.460, "gamma": 54.979, "delta": 148.240, "epsilon": -80.055, "zeta": 109.249, "epsilon_zeta": 170.696, "bb_type": "--", "chi": -138.625, "glyco_bond": "anti", "C5prime_xyz": [ -1.816, 8.703, -0.152 ], "P_xyz": [ 0.692, 8.828, 0.596 ], "form": ".", "ssZp": 0.393, "Dp": 0.455, "splay_angle": 155.158, "splay_distance": 16.061, "splay_ratio": 0.978, "d22": null, "d64": null, "eta": -144.847, "theta": 139.467, "eta_prime": -141.156, "theta_prime": 92.746, "eta_base": -161.167, "theta_base": 4.348, "v0": -21.671, "v1": 36.334, "v2": -36.498, "v3": 24.822, "v4": -2.194, "amplitude": 37.861, "phase_angle": 164.577, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "3b", "suiteness": 0.092, "filter_rmsd": 0.039, "frame": { "rmsd": 0.008, "origin": [ 14.919, 41.510, 55.166 ], "x_axis": [ -0.148, 0.985, -0.090 ], "y_axis": [ 0.814, 0.069, -0.577 ], "z_axis": [ -0.562, -0.159, -0.812 ], "quaternion": [ -0.166, 0.631, 0.712, -0.258 ] } }, { "index": 97, "index_chain": 97, "chain_name": "A", "nt_resnum": 199, "nt_name": "U", "nt_code": "U", "nt_id": "///A/199", "linked_nts": [ "///A/198", "///A/200" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,syn,~C2'-endo,non-stack,internal-loop,splayed-apart", "alpha": 101.029, "beta": 162.471, "gamma": 32.961, "delta": 124.495, "epsilon": -82.766, "zeta": -72.778, "epsilon_zeta": -9.988, "bb_type": "--", "chi": 64.517, "glyco_bond": "syn", "C5prime_xyz": [ -5.422, 4.381, 1.437 ], "P_xyz": [ -6.000, 1.811, 1.178 ], "form": ".", "ssZp": -1.002, "Dp": 1.555, "splay_angle": 113.225, "splay_distance": 15.847, "splay_ratio": 0.836, "d22": null, "d64": null, "eta": 29.230, "theta": -53.243, "eta_prime": 26.994, "theta_prime": -50.253, "eta_base": 94.725, "theta_base": -38.308, "v0": -6.944, "v1": 10.575, "v2": -9.940, "v3": 6.289, "v4": 0.333, "amplitude": 10.626, "phase_angle": 159.292, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.113, "frame": { "rmsd": 0.013, "origin": [ 27.270, 35.076, 47.165 ], "x_axis": [ 0.840, -0.414, -0.351 ], "y_axis": [ 0.244, -0.288, 0.926 ], "z_axis": [ -0.484, -0.864, -0.141 ], "quaternion": [ 0.594, 0.753, -0.056, -0.277 ] } }, { "index": 98, "index_chain": 98, "chain_name": "A", "nt_resnum": 200, "nt_name": "G", "nt_code": "G", "nt_id": "///A/200", "linked_nts": [ "///A/199", "///A/201" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,internal-loop,splayed-apart", "alpha": -40.618, "beta": 150.134, "gamma": 99.018, "delta": 81.197, "epsilon": -134.387, "zeta": -78.565, "epsilon_zeta": -55.822, "bb_type": "BI", "chi": 168.282, "glyco_bond": "anti", "C5prime_xyz": [ -1.319, 8.081, 2.196 ], "P_xyz": [ 1.178, 8.672, 1.523 ], "form": "A", "ssZp": 4.709, "Dp": 4.745, "splay_angle": 28.048, "splay_distance": 4.298, "splay_ratio": 0.247, "d22": null, "d64": null, "eta": -161.531, "theta": -140.770, "eta_prime": -113.020, "theta_prime": -144.985, "eta_base": -96.189, "theta_base": -126.759, "v0": 3.167, "v1": -24.924, "v2": 35.941, "v3": -35.187, "v4": 20.146, "amplitude": 37.015, "phase_angle": 13.835, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.009, "frame": { "rmsd": 0.009, "origin": [ 17.338, 42.370, 57.130 ], "x_axis": [ -0.467, -0.774, 0.427 ], "y_axis": [ 0.750, -0.603, -0.272 ], "z_axis": [ 0.467, 0.193, 0.863 ], "quaternion": [ -0.445, 0.261, -0.023, 0.856 ] } }, { "index": 99, "index_chain": 99, "chain_name": "A", "nt_resnum": 201, "nt_name": "G", "nt_code": "G", "nt_id": "///A/201", "linked_nts": [ "///A/200", "///A/202" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet", "alpha": -52.294, "beta": 179.722, "gamma": 43.384, "delta": 81.737, "epsilon": -136.424, "zeta": -69.189, "epsilon_zeta": -67.235, "bb_type": "BI", "chi": -170.296, "glyco_bond": "anti", "C5prime_xyz": [ -1.208, 8.596, 1.108 ], "P_xyz": [ 1.292, 8.842, 1.875 ], "form": "A", "ssZp": 4.656, "Dp": 4.742, "splay_angle": 23.906, "splay_distance": 3.736, "splay_ratio": 0.209, "d22": null, "d64": null, "eta": 174.611, "theta": -133.505, "eta_prime": -173.762, "theta_prime": -128.132, "eta_base": -138.292, "theta_base": -81.534, "v0": 5.203, "v1": -26.642, "v2": 36.869, "v3": -34.790, "v4": 18.655, "amplitude": 37.532, "phase_angle": 10.778, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.683, "filter_rmsd": 0.004, "frame": { "rmsd": 0.004, "origin": [ 17.005, 44.185, 61.011 ], "x_axis": [ 0.070, -0.970, 0.232 ], "y_axis": [ 0.840, -0.068, -0.539 ], "z_axis": [ 0.539, 0.232, 0.810 ], "quaternion": [ 0.673, -0.287, 0.114, -0.672 ] } }, { "index": 100, "index_chain": 100, "chain_name": "A", "nt_resnum": 202, "nt_name": "U", "nt_code": "U", "nt_id": "///A/202", "linked_nts": [ "///A/201", "///A/203" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -59.586, "beta": 163.401, "gamma": 57.722, "delta": 80.790, "epsilon": -139.261, "zeta": -88.122, "epsilon_zeta": -51.138, "bb_type": "BI", "chi": -160.708, "glyco_bond": "anti", "C5prime_xyz": [ -1.374, 8.723, 0.573 ], "P_xyz": [ 1.218, 9.091, 0.433 ], "form": "A", "ssZp": 4.419, "Dp": 4.686, "splay_angle": 22.185, "splay_distance": 3.566, "splay_ratio": 0.193, "d22": 4.440, "d64": 4.361, "eta": 167.860, "theta": -150.279, "eta_prime": -170.466, "theta_prime": -150.563, "eta_base": -106.057, "theta_base": -136.744, "v0": 2.673, "v1": -24.645, "v2": 36.032, "v3": -35.498, "v4": 20.693, "amplitude": 37.233, "phase_angle": 14.594, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.868, "filter_rmsd": 0.105, "frame": { "rmsd": 0.002, "origin": [ 18.346, 42.336, 63.967 ], "x_axis": [ 0.654, -0.733, -0.189 ], "y_axis": [ 0.628, 0.665, -0.404 ], "z_axis": [ 0.422, 0.145, 0.895 ], "quaternion": [ 0.896, -0.153, 0.171, -0.380 ] } }, { "index": 101, "index_chain": 101, "chain_name": "A", "nt_resnum": 203, "nt_name": "C", "nt_code": "C", "nt_id": "///A/203", "linked_nts": [ "///A/202", "///A/204" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -53.540, "beta": 162.254, "gamma": 46.583, "delta": 78.960, "epsilon": -151.683, "zeta": -75.342, "epsilon_zeta": -76.341, "bb_type": "BI", "chi": -158.268, "glyco_bond": "anti", "C5prime_xyz": [ -1.458, 8.847, 0.414 ], "P_xyz": [ 1.119, 9.322, 0.535 ], "form": "A", "ssZp": 4.368, "Dp": 4.596, "splay_angle": 24.201, "splay_distance": 3.910, "splay_ratio": 0.211, "d22": 4.311, "d64": 4.423, "eta": 164.641, "theta": -148.849, "eta_prime": 174.872, "theta_prime": -148.102, "eta_base": -158.365, "theta_base": -126.717, "v0": -0.141, "v1": -22.893, "v2": 35.941, "v3": -37.028, "v4": 23.458, "amplitude": 37.975, "phase_angle": 18.836, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.676, "filter_rmsd": 0.062, "frame": { "rmsd": 0.002, "origin": [ 18.835, 41.737, 67.449 ], "x_axis": [ 0.738, -0.382, -0.556 ], "y_axis": [ 0.332, 0.923, -0.194 ], "z_axis": [ 0.588, -0.042, 0.808 ], "quaternion": [ 0.931, -0.041, 0.307, -0.192 ] } }, { "index": 102, "index_chain": 102, "chain_name": "A", "nt_resnum": 204, "nt_name": "C", "nt_code": "C", "nt_id": "///A/204", "linked_nts": [ "///A/203", "///A/205" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -58.515, "beta": 174.691, "gamma": 48.693, "delta": 78.530, "epsilon": -138.143, "zeta": -72.974, "epsilon_zeta": -65.169, "bb_type": "BI", "chi": -159.126, "glyco_bond": "anti", "C5prime_xyz": [ -1.457, 8.846, 0.443 ], "P_xyz": [ 1.082, 9.407, 0.794 ], "form": "A", "ssZp": 4.342, "Dp": 4.665, "splay_angle": 20.516, "splay_distance": 3.303, "splay_ratio": 0.178, "d22": 3.883, "d64": 3.608, "eta": 171.639, "theta": -139.369, "eta_prime": -179.187, "theta_prime": -135.884, "eta_base": -147.482, "theta_base": -93.290, "v0": -0.526, "v1": -22.538, "v2": 35.746, "v3": -37.048, "v4": 23.686, "amplitude": 37.896, "phase_angle": 19.390, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.912, "filter_rmsd": 0.063, "frame": { "rmsd": 0.002, "origin": [ 21.007, 39.987, 70.189 ], "x_axis": [ 0.655, 0.130, -0.745 ], "y_axis": [ -0.054, 0.991, 0.126 ], "z_axis": [ 0.754, -0.042, 0.656 ], "quaternion": [ 0.908, 0.046, 0.412, 0.051 ] } }, { "index": 103, "index_chain": 103, "chain_name": "A", "nt_resnum": 205, "nt_name": "U", "nt_code": "U", "nt_id": "///A/205", "linked_nts": [ "///A/204", "///A/206" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop", "alpha": -60.630, "beta": 162.803, "gamma": 55.878, "delta": 78.790, "epsilon": -123.287, "zeta": -58.515, "epsilon_zeta": -64.772, "bb_type": "--", "chi": -150.667, "glyco_bond": "anti", "C5prime_xyz": [ -1.533, 8.800, -0.072 ], "P_xyz": [ 0.986, 9.295, -0.554 ], "form": ".", "ssZp": 3.906, "Dp": 4.732, "splay_angle": 33.690, "splay_distance": 5.443, "splay_ratio": 0.290, "d22": null, "d64": null, "eta": 168.408, "theta": -112.990, "eta_prime": -175.766, "theta_prime": -104.125, "eta_base": -121.195, "theta_base": -71.510, "v0": 0.421, "v1": -23.405, "v2": 36.195, "v3": -36.991, "v4": 23.075, "amplitude": 38.062, "phase_angle": 18.020, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.884, "filter_rmsd": 0.105, "frame": { "rmsd": 0.003, "origin": [ 24.309, 39.915, 70.214 ], "x_axis": [ 0.402, 0.718, -0.568 ], "y_axis": [ -0.220, 0.678, 0.702 ], "z_axis": [ 0.889, -0.157, 0.431 ], "quaternion": [ 0.792, 0.271, 0.460, 0.296 ] } }, { "index": 104, "index_chain": 104, "chain_name": "A", "nt_resnum": 206, "nt_name": "A", "nt_code": "A", "nt_id": "///A/206", "linked_nts": [ "///A/205", "///A/207" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C2'-endo,non-canonical,non-pair-contact,helix,internal-loop", "alpha": -70.042, "beta": -162.609, "gamma": 59.039, "delta": 146.529, "epsilon": -147.627, "zeta": 175.669, "epsilon_zeta": 36.705, "bb_type": "--", "chi": -105.899, "glyco_bond": "anti", "C5prime_xyz": [ -2.025, 8.168, -1.945 ], "P_xyz": [ 0.385, 9.168, -1.746 ], "form": ".", "ssZp": 1.824, "Dp": 1.876, "splay_angle": 49.613, "splay_distance": 7.979, "splay_ratio": 0.422, "d22": null, "d64": null, "eta": 171.321, "theta": 156.136, "eta_prime": -149.194, "theta_prime": 141.948, "eta_base": -109.187, "theta_base": 167.750, "v0": -20.457, "v1": 34.658, "v2": -34.873, "v3": 23.921, "v4": -2.354, "amplitude": 36.110, "phase_angle": 164.959, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1b", "suiteness": 0.557, "filter_rmsd": 0.039, "frame": { "rmsd": 0.004, "origin": [ 27.715, 44.155, 70.002 ], "x_axis": [ -0.648, 0.756, -0.086 ], "y_axis": [ -0.115, 0.014, 0.993 ], "z_axis": [ 0.753, 0.654, 0.078 ], "quaternion": [ 0.333, 0.255, 0.629, 0.654 ] } }, { "index": 105, "index_chain": 105, "chain_name": "A", "nt_resnum": 207, "nt_name": "A", "nt_code": "A", "nt_id": "///A/207", "linked_nts": [ "///A/206", "///A/208" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop,cap-acceptor,phosphate", "alpha": -77.094, "beta": 147.817, "gamma": 50.891, "delta": 79.142, "epsilon": -136.221, "zeta": -48.775, "epsilon_zeta": -87.447, "bb_type": "BI", "chi": -175.259, "glyco_bond": "anti", "C5prime_xyz": [ -1.523, 8.524, 1.351 ], "P_xyz": [ 1.076, 8.767, 1.393 ], "form": ".", "ssZp": 4.710, "Dp": 4.735, "splay_angle": 41.004, "splay_distance": 6.203, "splay_ratio": 0.351, "d22": null, "d64": null, "eta": 170.557, "theta": -109.488, "eta_prime": 159.247, "theta_prime": -106.734, "eta_base": -178.364, "theta_base": -56.954, "v0": 1.842, "v1": -24.869, "v2": 37.116, "v3": -37.056, "v4": 22.216, "amplitude": 38.595, "phase_angle": 15.910, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "0a", "suiteness": 0.243, "filter_rmsd": 0.037, "frame": { "rmsd": 0.002, "origin": [ 34.742, 40.412, 70.538 ], "x_axis": [ -0.290, 0.951, -0.109 ], "y_axis": [ -0.464, -0.040, 0.885 ], "z_axis": [ 0.837, 0.308, 0.453 ], "quaternion": [ 0.530, 0.272, 0.446, 0.668 ] } }, { "index": 106, "index_chain": 106, "chain_name": "A", "nt_resnum": 208, "nt_name": "C", "nt_code": "C", "nt_id": "///A/208", "linked_nts": [ "///A/207", "///A/209" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop,cap-donor", "alpha": -71.750, "beta": 172.648, "gamma": 62.125, "delta": 81.611, "epsilon": -142.983, "zeta": -74.283, "epsilon_zeta": -68.700, "bb_type": "BI", "chi": -165.611, "glyco_bond": "anti", "C5prime_xyz": [ -1.245, 8.709, 0.890 ], "P_xyz": [ 1.376, 8.927, 1.131 ], "form": "A", "ssZp": 4.493, "Dp": 4.636, "splay_angle": 19.853, "splay_distance": 3.282, "splay_ratio": 0.176, "d22": 4.530, "d64": 4.439, "eta": 163.608, "theta": -139.863, "eta_prime": -164.030, "theta_prime": -140.017, "eta_base": -83.729, "theta_base": -125.302, "v0": 2.234, "v1": -23.839, "v2": 35.118, "v3": -34.851, "v4": 20.593, "amplitude": 36.392, "phase_angle": 15.202, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.575, "filter_rmsd": 0.065, "frame": { "rmsd": 0.006, "origin": [ 34.796, 45.891, 73.445 ], "x_axis": [ -0.562, 0.245, 0.790 ], "y_axis": [ 0.186, -0.894, 0.409 ], "z_axis": [ 0.806, 0.376, 0.457 ], "quaternion": [ 0.017, 0.468, 0.230, 0.853 ] } }, { "index": 107, "index_chain": 107, "chain_name": "A", "nt_resnum": 209, "nt_name": "C", "nt_code": "C", "nt_id": "///A/209", "linked_nts": [ "///A/208", "///A/210" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BII,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge,splayed-apart", "alpha": -65.228, "beta": 173.126, "gamma": 53.411, "delta": 80.735, "epsilon": -93.170, "zeta": -156.419, "epsilon_zeta": 63.249, "bb_type": "BII", "chi": -149.871, "glyco_bond": "anti", "C5prime_xyz": [ -1.647, 8.908, -0.128 ], "P_xyz": [ 0.882, 9.621, -0.136 ], "form": ".", "ssZp": 3.387, "Dp": 4.509, "splay_angle": 156.325, "splay_distance": 19.088, "splay_ratio": 0.979, "d22": null, "d64": null, "eta": -179.253, "theta": -173.194, "eta_prime": -170.766, "theta_prime": 157.964, "eta_base": -148.340, "theta_base": 170.913, "v0": -3.173, "v1": -19.695, "v2": 33.583, "v3": -36.388, "v4": 24.980, "amplitude": 36.608, "phase_angle": 23.455, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.981, "filter_rmsd": 0.064, "frame": { "rmsd": 0.006, "origin": [ 36.503, 48.536, 74.374 ], "x_axis": [ -0.505, -0.257, 0.824 ], "y_axis": [ 0.574, -0.813, 0.098 ], "z_axis": [ 0.644, 0.523, 0.558 ], "quaternion": [ -0.245, 0.433, 0.183, 0.848 ] } }, { "index": 108, "index_chain": 108, "chain_name": "A", "nt_resnum": 210, "nt_name": "A", "nt_code": "A", "nt_id": "///A/210", "linked_nts": [ "///A/209", "///A/211" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,anti,~C2'-endo,non-pair-contact,bulge,splayed-apart", "alpha": 53.038, "beta": -135.352, "gamma": 55.910, "delta": 144.323, "epsilon": -124.393, "zeta": 53.886, "epsilon_zeta": 181.722, "bb_type": "--", "chi": -116.876, "glyco_bond": "anti", "C5prime_xyz": [ -1.598, 8.432, -1.376 ], "P_xyz": [ 0.407, 9.446, 0.009 ], "form": ".", "ssZp": 1.366, "Dp": 1.594, "splay_angle": 130.219, "splay_distance": 19.404, "splay_ratio": 0.907, "d22": null, "d64": null, "eta": -9.474, "theta": 92.810, "eta_prime": 7.685, "theta_prime": 53.146, "eta_base": -23.708, "theta_base": 34.944, "v0": -18.329, "v1": 31.799, "v2": -32.418, "v3": 22.690, "v4": -2.937, "amplitude": 33.381, "phase_angle": 166.203, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "7p", "suiteness": 0.326, "filter_rmsd": 0.039, "frame": { "rmsd": 0.006, "origin": [ 54.558, 42.349, 74.106 ], "x_axis": [ -0.104, -0.837, 0.537 ], "y_axis": [ -0.983, 0.168, 0.072 ], "z_axis": [ -0.151, -0.521, -0.840 ], "quaternion": [ -0.237, -0.626, 0.727, -0.154 ] } }, { "index": 109, "index_chain": 109, "chain_name": "A", "nt_resnum": 211, "nt_name": "C", "nt_code": "C", "nt_id": "///A/211", "linked_nts": [ "///A/210", "///A/212" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,non-stack,canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,bulge,A-minor,splayed-apart", "alpha": 61.434, "beta": 109.037, "gamma": 177.398, "delta": 80.003, "epsilon": -147.823, "zeta": -73.723, "epsilon_zeta": -74.099, "bb_type": "BI", "chi": -166.588, "glyco_bond": "anti", "C5prime_xyz": [ -1.305, 8.711, 0.860 ], "P_xyz": [ -1.789, 10.962, -0.414 ], "form": "A", "ssZp": 4.584, "Dp": 4.672, "splay_angle": 27.722, "splay_distance": 4.354, "splay_ratio": 0.242, "d22": null, "d64": null, "eta": 57.807, "theta": 153.337, "eta_prime": 56.352, "theta_prime": 173.179, "eta_base": 76.658, "theta_base": -152.485, "v0": 2.717, "v1": -25.422, "v2": 37.145, "v3": -36.563, "v4": 21.327, "amplitude": 38.383, "phase_angle": 14.587, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23t", "cluster": "6j", "suiteness": 0.761, "filter_rmsd": 0.064, "frame": { "rmsd": 0.003, "origin": [ 37.447, 51.292, 76.040 ], "x_axis": [ -0.098, -0.737, 0.669 ], "y_axis": [ 0.827, -0.434, -0.357 ], "z_axis": [ 0.554, 0.518, 0.652 ], "quaternion": [ 0.529, -0.414, -0.054, -0.739 ] } }, { "index": 110, "index_chain": 110, "chain_name": "A", "nt_resnum": 212, "nt_name": "G", "nt_code": "G", "nt_id": "///A/212", "linked_nts": [ "///A/211", "///A/213" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,A-minor,phosphate", "alpha": -65.145, "beta": 161.086, "gamma": 70.164, "delta": 80.479, "epsilon": -151.811, "zeta": -75.767, "epsilon_zeta": -76.044, "bb_type": "BI", "chi": -176.778, "glyco_bond": "anti", "C5prime_xyz": [ -1.608, 8.578, 1.475 ], "P_xyz": [ 0.976, 9.133, 1.458 ], "form": "A", "ssZp": 4.613, "Dp": 4.618, "splay_angle": 23.883, "splay_distance": 3.836, "splay_ratio": 0.214, "d22": null, "d64": null, "eta": 171.504, "theta": -149.400, "eta_prime": -170.631, "theta_prime": -151.589, "eta_base": -128.164, "theta_base": -137.318, "v0": 0.878, "v1": -23.413, "v2": 35.628, "v3": -36.095, "v4": 22.174, "amplitude": 37.300, "phase_angle": 17.217, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.525, "filter_rmsd": 0.004, "frame": { "rmsd": 0.004, "origin": [ 38.221, 53.253, 79.850 ], "x_axis": [ 0.322, -0.872, 0.369 ], "y_axis": [ 0.710, -0.035, -0.703 ], "z_axis": [ 0.626, 0.489, 0.608 ], "quaternion": [ 0.688, -0.433, 0.093, -0.575 ] } }, { "index": 111, "index_chain": 111, "chain_name": "A", "nt_resnum": 213, "nt_name": "C", "nt_code": "C", "nt_id": "///A/213", "linked_nts": [ "///A/212", "///A/214" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,cap-donor", "alpha": -63.781, "beta": -178.873, "gamma": 50.822, "delta": 80.073, "epsilon": -143.251, "zeta": -70.549, "epsilon_zeta": -72.702, "bb_type": "BI", "chi": -159.469, "glyco_bond": "anti", "C5prime_xyz": [ -1.376, 8.796, 0.463 ], "P_xyz": [ 1.172, 9.358, 0.770 ], "form": "A", "ssZp": 4.427, "Dp": 4.688, "splay_angle": 23.373, "splay_distance": 3.862, "splay_ratio": 0.207, "d22": null, "d64": null, "eta": 172.641, "theta": -140.543, "eta_prime": -179.158, "theta_prime": -138.274, "eta_base": -152.549, "theta_base": -110.805, "v0": 2.439, "v1": -24.967, "v2": 36.737, "v3": -36.286, "v4": 21.343, "amplitude": 38.027, "phase_angle": 14.965, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.955, "filter_rmsd": 0.062, "frame": { "rmsd": 0.002, "origin": [ 38.232, 54.819, 83.352 ], "x_axis": [ 0.668, -0.744, 0.023 ], "y_axis": [ 0.516, 0.441, -0.734 ], "z_axis": [ 0.536, 0.502, 0.679 ], "quaternion": [ 0.835, -0.370, 0.154, -0.377 ] } }, { "index": 112, "index_chain": 112, "chain_name": "A", "nt_resnum": 214, "nt_name": "A", "nt_code": "A", "nt_id": "///A/214", "linked_nts": [ "///A/213", "///A/215" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,internal-loop", "alpha": -59.652, "beta": 165.716, "gamma": 56.792, "delta": 76.750, "epsilon": -148.305, "zeta": -81.789, "epsilon_zeta": -66.517, "bb_type": "BI", "chi": -164.913, "glyco_bond": "anti", "C5prime_xyz": [ -1.880, 8.808, 0.766 ], "P_xyz": [ 0.585, 9.672, 0.938 ], "form": "A", "ssZp": 4.477, "Dp": 4.586, "splay_angle": 24.034, "splay_distance": 3.840, "splay_ratio": 0.210, "d22": null, "d64": null, "eta": 167.654, "theta": -154.596, "eta_prime": -175.503, "theta_prime": -153.254, "eta_base": -132.771, "theta_base": -124.280, "v0": -2.502, "v1": -21.589, "v2": 36.082, "v3": -38.564, "v4": 25.879, "amplitude": 38.976, "phase_angle": 22.217, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.906, "filter_rmsd": 0.037, "frame": { "rmsd": 0.004, "origin": [ 40.480, 54.508, 86.477 ], "x_axis": [ 0.686, -0.506, -0.523 ], "y_axis": [ 0.121, 0.788, -0.604 ], "z_axis": [ 0.718, 0.351, 0.602 ], "quaternion": [ 0.877, -0.272, 0.354, -0.179 ] } }, { "index": 113, "index_chain": 113, "chain_name": "A", "nt_resnum": 215, "nt_name": "G", "nt_code": "G", "nt_id": "///A/215", "linked_nts": [ "///A/214", "///A/216" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,internal-loop", "alpha": -49.316, "beta": 160.744, "gamma": 49.131, "delta": 79.946, "epsilon": -167.139, "zeta": -92.825, "epsilon_zeta": -74.314, "bb_type": "BI", "chi": -165.939, "glyco_bond": "anti", "C5prime_xyz": [ -1.652, 8.754, 0.882 ], "P_xyz": [ 0.899, 9.290, 1.090 ], "form": "A", "ssZp": 4.460, "Dp": 4.476, "splay_angle": 23.092, "splay_distance": 3.573, "splay_ratio": 0.203, "d22": null, "d64": null, "eta": 167.190, "theta": -138.325, "eta_prime": -176.907, "theta_prime": -141.676, "eta_base": -131.896, "theta_base": -103.014, "v0": 1.262, "v1": -23.889, "v2": 36.241, "v3": -36.469, "v4": 22.226, "amplitude": 37.845, "phase_angle": 16.738, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.694, "filter_rmsd": 0.003, "frame": { "rmsd": 0.003, "origin": [ 43.368, 54.179, 88.988 ], "x_axis": [ 0.638, -0.016, -0.769 ], "y_axis": [ -0.266, 0.934, -0.240 ], "z_axis": [ 0.722, 0.358, 0.592 ], "quaternion": [ 0.889, -0.168, 0.419, 0.070 ] } }, { "index": 114, "index_chain": 114, "chain_name": "A", "nt_resnum": 216, "nt_name": "C", "nt_code": "C", "nt_id": "///A/216", "linked_nts": [ "///A/215", "///A/217" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-canonical,non-pair-contact,helix,multiplet,internal-loop", "alpha": 174.074, "beta": -134.985, "gamma": 148.265, "delta": 80.511, "epsilon": -107.141, "zeta": -122.668, "epsilon_zeta": 15.527, "bb_type": "--", "chi": -172.827, "glyco_bond": "anti", "C5prime_xyz": [ -1.224, 8.563, 1.312 ], "P_xyz": [ 1.050, 9.038, 0.146 ], "form": "A", "ssZp": 4.542, "Dp": 4.745, "splay_angle": 29.435, "splay_distance": 4.583, "splay_ratio": 0.254, "d22": 4.114, "d64": 4.049, "eta": 168.530, "theta": -147.218, "eta_prime": -177.993, "theta_prime": -142.972, "eta_base": -124.416, "theta_base": -115.182, "v0": 3.110, "v1": -24.883, "v2": 36.241, "v3": -35.453, "v4": 20.363, "amplitude": 37.352, "phase_angle": 14.006, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.010, "filter_rmsd": 0.066, "frame": { "rmsd": 0.005, "origin": [ 46.882, 54.368, 89.602 ], "x_axis": [ 0.330, 0.616, -0.715 ], "y_axis": [ -0.511, 0.754, 0.413 ], "z_axis": [ 0.793, 0.229, 0.564 ], "quaternion": [ 0.814, 0.056, 0.464, 0.346 ] } }, { "index": 115, "index_chain": 115, "chain_name": "A", "nt_resnum": 217, "nt_name": "C", "nt_code": "C", "nt_id": "///A/217", "linked_nts": [ "///A/216", "///A/218" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,isolated-canonical,non-pair-contact,helix,multiplet,internal-loop", "alpha": -13.737, "beta": 127.636, "gamma": 33.232, "delta": 79.843, "epsilon": -143.466, "zeta": -67.351, "epsilon_zeta": -76.115, "bb_type": "BI", "chi": -166.070, "glyco_bond": "anti", "C5prime_xyz": [ -1.731, 8.840, 0.871 ], "P_xyz": [ 0.841, 8.803, 1.265 ], "form": ".", "ssZp": 4.458, "Dp": 4.558, "splay_angle": 23.262, "splay_distance": 3.690, "splay_ratio": 0.202, "d22": null, "d64": null, "eta": 168.944, "theta": -128.862, "eta_prime": -176.613, "theta_prime": -123.656, "eta_base": -136.604, "theta_base": -87.390, "v0": -0.795, "v1": -21.546, "v2": 34.563, "v3": -35.884, "v4": 23.202, "amplitude": 36.739, "phase_angle": 19.818, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.064, "frame": { "rmsd": 0.008, "origin": [ 51.006, 56.075, 90.644 ], "x_axis": [ -0.335, 0.778, -0.532 ], "y_axis": [ -0.655, 0.214, 0.725 ], "z_axis": [ 0.677, 0.591, 0.438 ], "quaternion": [ 0.574, 0.058, 0.527, 0.624 ] } }, { "index": 116, "index_chain": 116, "chain_name": "A", "nt_resnum": 218, "nt_name": "A", "nt_code": "A", "nt_id": "///A/218", "linked_nts": [ "///A/217", "///A/219" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C2'-endo,BII,non-canonical,non-pair-contact,helix,ss-non-loop", "alpha": -60.986, "beta": -175.164, "gamma": 63.509, "delta": 143.399, "epsilon": -92.702, "zeta": 177.774, "epsilon_zeta": 89.524, "bb_type": "BII", "chi": -122.114, "glyco_bond": "anti", "C5prime_xyz": [ -1.645, 8.509, -1.204 ], "P_xyz": [ 0.813, 9.180, -0.696 ], "form": ".", "ssZp": 0.635, "Dp": 0.978, "splay_angle": 39.950, "splay_distance": 6.667, "splay_ratio": 0.352, "d22": null, "d64": null, "eta": -152.454, "theta": 154.098, "eta_prime": -127.953, "theta_prime": 142.436, "eta_base": -87.939, "theta_base": 160.553, "v0": -18.926, "v1": 32.165, "v2": -32.468, "v3": 22.410, "v4": -2.376, "amplitude": 33.574, "phase_angle": 165.252, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1b", "suiteness": 0.898, "filter_rmsd": 0.039, "frame": { "rmsd": 0.004, "origin": [ 52.297, 59.532, 90.666 ], "x_axis": [ -0.845, 0.534, 0.034 ], "y_axis": [ -0.082, -0.192, 0.978 ], "z_axis": [ 0.529, 0.823, 0.206 ], "quaternion": [ 0.206, 0.188, 0.601, 0.749 ] } }, { "index": 117, "index_chain": 117, "chain_name": "A", "nt_resnum": 219, "nt_name": "A", "nt_code": "A", "nt_id": "///A/219", "linked_nts": [ "///A/218", "///A/220" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,ss-non-loop", "alpha": -141.261, "beta": 141.058, "gamma": 53.522, "delta": 82.015, "epsilon": -128.920, "zeta": -70.779, "epsilon_zeta": -58.141, "bb_type": "BI", "chi": 178.015, "glyco_bond": "anti", "C5prime_xyz": [ -1.591, 8.339, 1.788 ], "P_xyz": [ 0.999, 8.312, 1.951 ], "form": ".", "ssZp": 4.671, "Dp": 4.685, "splay_angle": 29.730, "splay_distance": 4.466, "splay_ratio": 0.257, "d22": null, "d64": null, "eta": 141.268, "theta": -120.771, "eta_prime": 131.418, "theta_prime": -120.574, "eta_base": 155.126, "theta_base": -68.911, "v0": 3.078, "v1": -24.485, "v2": 35.523, "v3": -34.725, "v4": 19.971, "amplitude": 36.601, "phase_angle": 13.938, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "4g", "suiteness": 0.593, "filter_rmsd": 0.040, "frame": { "rmsd": 0.005, "origin": [ 57.605, 55.499, 90.563 ], "x_axis": [ -0.681, 0.731, 0.045 ], "y_axis": [ -0.203, -0.247, 0.948 ], "z_axis": [ 0.704, 0.636, 0.317 ], "quaternion": [ 0.312, 0.250, 0.529, 0.749 ] } }, { "index": 118, "index_chain": 118, "chain_name": "A", "nt_resnum": 220, "nt_name": "G", "nt_code": "G", "nt_id": "///A/220", "linked_nts": [ "///A/219", "///A/221" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack", "alpha": -63.400, "beta": 163.684, "gamma": 56.984, "delta": 84.175, "epsilon": -147.320, "zeta": -66.540, "epsilon_zeta": -80.780, "bb_type": "BI", "chi": -166.179, "glyco_bond": "anti", "C5prime_xyz": [ -1.123, 8.595, 0.944 ], "P_xyz": [ 1.498, 8.549, 1.085 ], "form": "A", "ssZp": 4.516, "Dp": 4.622, "splay_angle": 22.977, "splay_distance": 3.624, "splay_ratio": 0.200, "d22": null, "d64": null, "eta": 161.037, "theta": -132.452, "eta_prime": -174.001, "theta_prime": -133.611, "eta_base": -95.387, "theta_base": -103.115, "v0": 5.985, "v1": -25.956, "v2": 34.881, "v3": -32.520, "v4": 16.851, "amplitude": 35.337, "phase_angle": 9.222, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.752, "filter_rmsd": 0.004, "frame": { "rmsd": 0.004, "origin": [ 57.740, 59.551, 92.436 ], "x_axis": [ -0.511, 0.161, 0.844 ], "y_axis": [ 0.511, -0.733, 0.449 ], "z_axis": [ 0.691, 0.661, 0.292 ], "quaternion": [ -0.110, 0.482, 0.349, 0.796 ] } }, { "index": 119, "index_chain": 119, "chain_name": "A", "nt_resnum": 221, "nt_name": "U", "nt_code": "U", "nt_id": "///A/221", "linked_nts": [ "///A/220", "///A/222" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -68.655, "beta": 169.383, "gamma": 58.429, "delta": 80.276, "epsilon": -142.297, "zeta": -79.069, "epsilon_zeta": -63.228, "bb_type": "BI", "chi": -164.175, "glyco_bond": "anti", "C5prime_xyz": [ -1.473, 8.698, 0.794 ], "P_xyz": [ 1.110, 9.102, 0.941 ], "form": "A", "ssZp": 4.488, "Dp": 4.654, "splay_angle": 20.718, "splay_distance": 3.243, "splay_ratio": 0.180, "d22": 4.208, "d64": 4.059, "eta": 165.837, "theta": -145.106, "eta_prime": -175.598, "theta_prime": -144.091, "eta_base": -124.169, "theta_base": -107.942, "v0": 2.778, "v1": -25.011, "v2": 36.561, "v3": -35.970, "v4": 20.918, "amplitude": 37.764, "phase_angle": 14.499, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.931, "filter_rmsd": 0.106, "frame": { "rmsd": 0.004, "origin": [ 58.754, 62.529, 94.235 ], "x_axis": [ -0.131, -0.358, 0.925 ], "y_axis": [ 0.750, -0.646, -0.143 ], "z_axis": [ 0.648, 0.674, 0.353 ], "quaternion": [ -0.379, 0.539, 0.182, 0.730 ] } }, { "index": 120, "index_chain": 120, "chain_name": "A", "nt_resnum": 222, "nt_name": "C", "nt_code": "C", "nt_id": "///A/222", "linked_nts": [ "///A/221", "///A/223" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -60.025, "beta": 156.788, "gamma": 61.517, "delta": 81.426, "epsilon": -154.107, "zeta": -73.950, "epsilon_zeta": -80.157, "bb_type": "BI", "chi": -159.894, "glyco_bond": "anti", "C5prime_xyz": [ -1.314, 8.765, 0.519 ], "P_xyz": [ 1.267, 9.005, 0.117 ], "form": "A", "ssZp": 4.413, "Dp": 4.588, "splay_angle": 25.796, "splay_distance": 4.103, "splay_ratio": 0.224, "d22": 4.497, "d64": 4.564, "eta": 165.568, "theta": -146.397, "eta_prime": -176.103, "theta_prime": -149.419, "eta_base": -122.133, "theta_base": -132.919, "v0": 2.557, "v1": -24.508, "v2": 35.900, "v3": -35.446, "v4": 20.783, "amplitude": 37.129, "phase_angle": 14.786, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.774, "filter_rmsd": 0.063, "frame": { "rmsd": 0.001, "origin": [ 59.881, 64.457, 96.586 ], "x_axis": [ 0.371, -0.640, 0.673 ], "y_axis": [ 0.774, -0.188, -0.605 ], "z_axis": [ 0.514, 0.745, 0.425 ], "quaternion": [ 0.634, -0.533, -0.063, -0.557 ] } }, { "index": 121, "index_chain": 121, "chain_name": "A", "nt_resnum": 223, "nt_name": "C", "nt_code": "C", "nt_id": "///A/223", "linked_nts": [ "///A/222", "///A/224" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,bulge,A-minor,ribose-zipper", "alpha": -68.607, "beta": -179.222, "gamma": 53.003, "delta": 79.955, "epsilon": -144.275, "zeta": -71.088, "epsilon_zeta": -73.187, "bb_type": "BI", "chi": -162.083, "glyco_bond": "anti", "C5prime_xyz": [ -1.370, 8.778, 0.655 ], "P_xyz": [ 1.185, 9.221, 1.103 ], "form": "A", "ssZp": 4.467, "Dp": 4.660, "splay_angle": 22.269, "splay_distance": 3.608, "splay_ratio": 0.195, "d22": 4.130, "d64": 4.245, "eta": 170.114, "theta": -141.453, "eta_prime": 179.005, "theta_prime": -138.914, "eta_base": -151.085, "theta_base": -109.293, "v0": 1.811, "v1": -24.447, "v2": 36.519, "v3": -36.472, "v4": 21.822, "amplitude": 37.974, "phase_angle": 15.910, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.953, "filter_rmsd": 0.063, "frame": { "rmsd": 0.003, "origin": [ 60.775, 67.298, 99.407 ], "x_axis": [ 0.549, -0.816, 0.179 ], "y_axis": [ 0.486, 0.138, -0.863 ], "z_axis": [ 0.680, 0.561, 0.472 ], "quaternion": [ 0.735, -0.484, 0.171, -0.443 ] } }, { "index": 122, "index_chain": 122, "chain_name": "A", "nt_resnum": 224, "nt_name": "U", "nt_code": "U", "nt_id": "///A/224", "linked_nts": [ "///A/223", "///A/225" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,bulge,ribose-zipper", "alpha": -62.564, "beta": 165.868, "gamma": 58.937, "delta": 79.415, "epsilon": -142.207, "zeta": -66.873, "epsilon_zeta": -75.334, "bb_type": "BI", "chi": -159.214, "glyco_bond": "anti", "C5prime_xyz": [ -1.633, 8.805, 0.420 ], "P_xyz": [ 0.888, 9.466, 0.229 ], "form": "A", "ssZp": 4.369, "Dp": 4.646, "splay_angle": 20.520, "splay_distance": 3.476, "splay_ratio": 0.183, "d22": null, "d64": null, "eta": 169.215, "theta": -136.615, "eta_prime": -174.671, "theta_prime": -130.442, "eta_base": -130.890, "theta_base": -114.036, "v0": -1.130, "v1": -21.714, "v2": 35.009, "v3": -36.593, "v4": 23.773, "amplitude": 37.319, "phase_angle": 20.265, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.922, "filter_rmsd": 0.103, "frame": { "rmsd": 0.002, "origin": [ 63.145, 67.655, 102.103 ], "x_axis": [ 0.679, -0.644, -0.352 ], "y_axis": [ 0.200, 0.623, -0.756 ], "z_axis": [ 0.706, 0.443, 0.552 ], "quaternion": [ 0.845, -0.355, 0.313, -0.250 ] } }, { "index": 123, "index_chain": 123, "chain_name": "A", "nt_resnum": 225, "nt_name": "A", "nt_code": "A", "nt_id": "///A/225", "linked_nts": [ "///A/224", "///A/226" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C2'-endo,BII,non-canonical,non-pair-contact,multiplet,bulge", "alpha": -55.908, "beta": -171.668, "gamma": 49.689, "delta": 141.020, "epsilon": -103.811, "zeta": 150.554, "epsilon_zeta": 105.635, "bb_type": "BII", "chi": -113.358, "glyco_bond": "anti", "C5prime_xyz": [ -2.313, 8.407, -1.622 ], "P_xyz": [ -0.126, 9.824, -1.238 ], "form": ".", "ssZp": 1.132, "Dp": 1.187, "splay_angle": 39.873, "splay_distance": 6.581, "splay_ratio": 0.349, "d22": null, "d64": null, "eta": -163.742, "theta": 135.977, "eta_prime": -140.115, "theta_prime": 124.333, "eta_base": -120.903, "theta_base": 139.375, "v0": -25.031, "v1": 36.350, "v2": -33.172, "v3": 19.598, "v4": 3.226, "amplitude": 36.253, "phase_angle": 156.209, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1b", "suiteness": 0.793, "filter_rmsd": 0.037, "frame": { "rmsd": 0.003, "origin": [ 66.007, 67.041, 103.977 ], "x_axis": [ 0.286, -0.405, -0.868 ], "y_axis": [ 0.104, 0.914, -0.392 ], "z_axis": [ 0.953, 0.021, 0.304 ], "quaternion": [ 0.791, -0.131, 0.575, -0.161 ] } }, { "index": 124, "index_chain": 124, "chain_name": "A", "nt_resnum": 226, "nt_name": "A", "nt_code": "A", "nt_id": "///A/226", "linked_nts": [ "///A/225", "///A/227" ], "nt_type": "RNA", "dbn": "(", "summary": "turn,anti,~C3'-endo,isolated-canonical,non-canonical,non-pair-contact,helix,multiplet,bulge", "alpha": -129.524, "beta": 154.810, "gamma": 47.025, "delta": 84.046, "epsilon": -125.804, "zeta": -63.469, "epsilon_zeta": -62.335, "bb_type": "--", "chi": -174.652, "glyco_bond": "anti", "C5prime_xyz": [ -1.275, 8.434, 1.364 ], "P_xyz": [ 1.338, 8.398, 1.674 ], "form": ".", "ssZp": 4.688, "Dp": 4.750, "splay_angle": 34.626, "splay_distance": 5.276, "splay_ratio": 0.298, "d22": null, "d64": null, "eta": 148.039, "theta": -111.917, "eta_prime": 137.284, "theta_prime": -110.035, "eta_base": 152.803, "theta_base": -59.545, "v0": 5.435, "v1": -25.773, "v2": 35.184, "v3": -32.996, "v4": 17.399, "amplitude": 35.733, "phase_angle": 10.048, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "4g", "suiteness": 0.414, "filter_rmsd": 0.038, "frame": { "rmsd": 0.003, "origin": [ 62.762, 69.596, 109.101 ], "x_axis": [ 0.639, -0.385, -0.666 ], "y_axis": [ 0.166, 0.914, -0.369 ], "z_axis": [ 0.751, 0.126, 0.648 ], "quaternion": [ 0.895, -0.138, 0.396, -0.154 ] } }, { "index": 125, "index_chain": 125, "chain_name": "A", "nt_resnum": 227, "nt_name": "G", "nt_code": "G", "nt_id": "///A/227", "linked_nts": [ "///A/226", "///A/228" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge", "alpha": -63.771, "beta": 163.818, "gamma": 52.153, "delta": 82.103, "epsilon": -138.456, "zeta": -74.688, "epsilon_zeta": -63.768, "bb_type": "BI", "chi": -171.867, "glyco_bond": "anti", "C5prime_xyz": [ -1.263, 8.559, 1.196 ], "P_xyz": [ 1.353, 8.717, 1.408 ], "form": "A", "ssZp": 4.689, "Dp": 4.737, "splay_angle": 21.994, "splay_distance": 3.446, "splay_ratio": 0.193, "d22": null, "d64": null, "eta": 155.452, "theta": -136.123, "eta_prime": -176.070, "theta_prime": -135.010, "eta_base": -96.509, "theta_base": -101.755, "v0": 5.184, "v1": -26.737, "v2": 36.934, "v3": -34.928, "v4": 18.771, "amplitude": 37.606, "phase_angle": 10.845, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.681, "filter_rmsd": 0.002, "frame": { "rmsd": 0.002, "origin": [ 67.891, 69.865, 107.894 ], "x_axis": [ 0.303, 0.628, -0.717 ], "y_axis": [ -0.464, 0.754, 0.464 ], "z_axis": [ 0.832, 0.192, 0.520 ], "quaternion": [ 0.803, 0.085, 0.483, 0.340 ] } }, { "index": 126, "index_chain": 126, "chain_name": "A", "nt_resnum": 228, "nt_name": "U", "nt_code": "U", "nt_id": "///A/228", "linked_nts": [ "///A/227", "///A/229" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -61.347, "beta": 168.153, "gamma": 53.757, "delta": 81.319, "epsilon": -140.774, "zeta": -82.309, "epsilon_zeta": -58.465, "bb_type": "BI", "chi": -160.624, "glyco_bond": "anti", "C5prime_xyz": [ -1.367, 8.708, 0.557 ], "P_xyz": [ 1.228, 9.093, 0.561 ], "form": "A", "ssZp": 4.448, "Dp": 4.691, "splay_angle": 22.533, "splay_distance": 3.539, "splay_ratio": 0.196, "d22": 4.188, "d64": 3.943, "eta": 166.352, "theta": -146.726, "eta_prime": -177.012, "theta_prime": -145.987, "eta_base": -125.623, "theta_base": -118.797, "v0": 3.843, "v1": -25.503, "v2": 36.320, "v3": -35.040, "v4": 19.660, "amplitude": 37.243, "phase_angle": 12.779, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.930, "filter_rmsd": 0.104, "frame": { "rmsd": 0.001, "origin": [ 71.230, 70.680, 107.653 ], "x_axis": [ -0.097, 0.954, -0.285 ], "y_axis": [ -0.419, 0.220, 0.881 ], "z_axis": [ 0.903, 0.205, 0.378 ], "quaternion": [ 0.613, 0.276, 0.485, 0.560 ] } }, { "index": 127, "index_chain": 127, "chain_name": "A", "nt_resnum": 229, "nt_name": "C", "nt_code": "C", "nt_id": "///A/229", "linked_nts": [ "///A/228", "///A/230" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -59.118, "beta": 168.938, "gamma": 48.431, "delta": 80.494, "epsilon": -146.963, "zeta": -77.332, "epsilon_zeta": -69.630, "bb_type": "BI", "chi": -161.452, "glyco_bond": "anti", "C5prime_xyz": [ -1.213, 8.736, 0.582 ], "P_xyz": [ 1.392, 9.016, 0.736 ], "form": "A", "ssZp": 4.481, "Dp": 4.679, "splay_angle": 23.259, "splay_distance": 3.714, "splay_ratio": 0.204, "d22": null, "d64": null, "eta": 164.765, "theta": -146.187, "eta_prime": 176.453, "theta_prime": -144.793, "eta_base": -142.319, "theta_base": -124.928, "v0": 3.304, "v1": -25.487, "v2": 36.808, "v3": -35.869, "v4": 20.554, "amplitude": 37.887, "phase_angle": 13.708, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.857, "filter_rmsd": 0.064, "frame": { "rmsd": 0.003, "origin": [ 74.448, 72.152, 107.680 ], "x_axis": [ -0.527, 0.831, 0.179 ], "y_axis": [ -0.207, -0.329, 0.921 ], "z_axis": [ 0.825, 0.448, 0.345 ], "quaternion": [ 0.350, 0.338, 0.462, 0.742 ] } }, { "index": 128, "index_chain": 128, "chain_name": "A", "nt_resnum": 230, "nt_name": "A", "nt_code": "A", "nt_id": "///A/230", "linked_nts": [ "///A/229", "///A/231" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -56.126, "beta": 164.609, "gamma": 54.575, "delta": 80.205, "epsilon": -151.919, "zeta": -76.579, "epsilon_zeta": -75.340, "bb_type": "BI", "chi": -166.175, "glyco_bond": "anti", "C5prime_xyz": [ -1.699, 8.724, 0.883 ], "P_xyz": [ 0.853, 9.279, 1.138 ], "form": "A", "ssZp": 4.492, "Dp": 4.562, "splay_angle": 23.358, "splay_distance": 3.676, "splay_ratio": 0.204, "d22": null, "d64": null, "eta": 169.992, "theta": -150.143, "eta_prime": -175.543, "theta_prime": -150.412, "eta_base": -140.850, "theta_base": -124.874, "v0": 0.751, "v1": -23.068, "v2": 35.360, "v3": -35.922, "v4": 22.195, "amplitude": 37.074, "phase_angle": 17.493, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.893, "filter_rmsd": 0.038, "frame": { "rmsd": 0.004, "origin": [ 77.075, 74.776, 107.581 ], "x_axis": [ -0.712, 0.485, 0.507 ], "y_axis": [ 0.078, -0.663, 0.744 ], "z_axis": [ 0.698, 0.570, 0.435 ], "quaternion": [ 0.122, 0.359, 0.392, 0.838 ] } }, { "index": 129, "index_chain": 129, "chain_name": "A", "nt_resnum": 231, "nt_name": "A", "nt_code": "A", "nt_id": "///A/231", "linked_nts": [ "///A/230", "///A/232" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -60.786, "beta": 174.379, "gamma": 47.812, "delta": 80.454, "epsilon": -141.262, "zeta": -77.228, "epsilon_zeta": -64.034, "bb_type": "BI", "chi": -163.851, "glyco_bond": "anti", "C5prime_xyz": [ -1.422, 8.658, 0.743 ], "P_xyz": [ 1.130, 9.093, 1.125 ], "form": "A", "ssZp": 4.528, "Dp": 4.709, "splay_angle": 20.968, "splay_distance": 3.320, "splay_ratio": 0.184, "d22": null, "d64": null, "eta": 169.326, "theta": -144.275, "eta_prime": 179.033, "theta_prime": -142.495, "eta_base": -142.720, "theta_base": -108.769, "v0": 5.047, "v1": -26.837, "v2": 37.249, "v3": -35.368, "v4": 19.126, "amplitude": 37.967, "phase_angle": 11.157, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.917, "filter_rmsd": 0.038, "frame": { "rmsd": 0.004, "origin": [ 78.896, 77.912, 108.188 ], "x_axis": [ -0.607, 0.002, 0.795 ], "y_axis": [ 0.463, -0.812, 0.356 ], "z_axis": [ 0.646, 0.584, 0.492 ], "quaternion": [ -0.135, 0.422, 0.275, 0.853 ] } }, { "index": 130, "index_chain": 130, "chain_name": "A", "nt_resnum": 232, "nt_name": "C", "nt_code": "C", "nt_id": "///A/232", "linked_nts": [ "///A/231", "///A/233" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -56.085, "beta": 161.801, "gamma": 50.286, "delta": 77.276, "epsilon": -146.125, "zeta": -79.191, "epsilon_zeta": -66.933, "bb_type": "BI", "chi": -163.419, "glyco_bond": "anti", "C5prime_xyz": [ -1.368, 8.753, 0.673 ], "P_xyz": [ 1.204, 9.169, 0.548 ], "form": "A", "ssZp": 4.539, "Dp": 4.707, "splay_angle": 22.568, "splay_distance": 3.565, "splay_ratio": 0.199, "d22": null, "d64": null, "eta": 162.397, "theta": -149.222, "eta_prime": 177.834, "theta_prime": -149.763, "eta_base": -131.171, "theta_base": -128.969, "v0": 4.623, "v1": -28.280, "v2": 39.944, "v3": -38.339, "v4": 21.205, "amplitude": 40.871, "phase_angle": 12.227, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.846, "filter_rmsd": 0.062, "frame": { "rmsd": 0.006, "origin": [ 79.357, 80.376, 110.364 ], "x_axis": [ -0.262, -0.509, 0.820 ], "y_axis": [ 0.810, -0.578, -0.100 ], "z_axis": [ 0.525, 0.638, 0.563 ], "quaternion": [ -0.425, 0.434, 0.174, 0.775 ] } }, { "index": 131, "index_chain": 131, "chain_name": "A", "nt_resnum": 233, "nt_name": "A", "nt_code": "A", "nt_id": "///A/233", "linked_nts": [ "///A/232", "///A/234" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -53.985, "beta": 160.693, "gamma": 54.546, "delta": 77.724, "epsilon": -137.974, "zeta": -106.456, "epsilon_zeta": -31.518, "bb_type": "BI", "chi": -173.814, "glyco_bond": "anti", "C5prime_xyz": [ -1.678, 8.574, 1.264 ], "P_xyz": [ 0.891, 9.137, 1.410 ], "form": "A", "ssZp": 4.718, "Dp": 4.752, "splay_angle": 23.433, "splay_distance": 3.670, "splay_ratio": 0.207, "d22": null, "d64": null, "eta": 169.321, "theta": -156.660, "eta_prime": -178.599, "theta_prime": -153.283, "eta_base": -141.882, "theta_base": -134.219, "v0": 3.942, "v1": -27.302, "v2": 38.855, "v3": -37.594, "v4": 21.223, "amplitude": 39.875, "phase_angle": 12.984, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.799, "filter_rmsd": 0.036, "frame": { "rmsd": 0.005, "origin": [ 79.434, 82.841, 112.939 ], "x_axis": [ 0.056, -0.819, 0.571 ], "y_axis": [ 0.853, -0.259, -0.454 ], "z_axis": [ 0.520, 0.513, 0.684 ], "quaternion": [ 0.608, -0.397, -0.021, -0.687 ] } }, { "index": 132, "index_chain": 132, "chain_name": "A", "nt_resnum": 234, "nt_name": "G", "nt_code": "G", "nt_id": "///A/234", "linked_nts": [ "///A/233", "///A/235" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -20.978, "beta": 136.737, "gamma": 47.744, "delta": 81.016, "epsilon": -147.320, "zeta": -41.580, "epsilon_zeta": -105.740, "bb_type": "BI", "chi": -164.090, "glyco_bond": "anti", "C5prime_xyz": [ -1.754, 8.869, 0.763 ], "P_xyz": [ 0.857, 9.152, 0.816 ], "form": "A", "ssZp": 4.383, "Dp": 4.495, "splay_angle": 22.050, "splay_distance": 3.794, "splay_ratio": 0.198, "d22": null, "d64": null, "eta": 179.269, "theta": -117.915, "eta_prime": -167.085, "theta_prime": -135.172, "eta_base": -137.560, "theta_base": -112.377, "v0": -2.186, "v1": -19.835, "v2": 32.858, "v3": -35.091, "v4": 23.446, "amplitude": 35.442, "phase_angle": 22.015, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.012, "frame": { "rmsd": 0.012, "origin": [ 79.266, 84.726, 116.084 ], "x_axis": [ 0.457, -0.818, 0.350 ], "y_axis": [ 0.781, 0.181, -0.597 ], "z_axis": [ 0.425, 0.546, 0.722 ], "quaternion": [ 0.768, -0.372, 0.024, -0.521 ] } }, { "index": 133, "index_chain": 133, "chain_name": "A", "nt_resnum": 235, "nt_name": "A", "nt_code": "A", "nt_id": "///A/235", "linked_nts": [ "///A/234", "///A/236" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,hairpin-loop,cap-donor", "alpha": -140.789, "beta": 126.722, "gamma": 138.320, "delta": 81.534, "epsilon": -115.788, "zeta": -97.884, "epsilon_zeta": -17.904, "bb_type": "--", "chi": -179.351, "glyco_bond": "anti", "C5prime_xyz": [ -1.127, 8.208, 1.674 ], "P_xyz": [ 0.009, 10.080, 0.213 ], "form": ".", "ssZp": 4.824, "Dp": 4.866, "splay_angle": 78.311, "splay_distance": 10.351, "splay_ratio": 0.632, "d22": null, "d64": null, "eta": 159.117, "theta": -145.994, "eta_prime": 173.171, "theta_prime": 177.370, "eta_base": -139.163, "theta_base": 100.958, "v0": 9.109, "v1": -30.505, "v2": 38.995, "v3": -34.849, "v4": 16.297, "amplitude": 39.175, "phase_angle": 5.488, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.036, "frame": { "rmsd": 0.007, "origin": [ 80.071, 84.969, 119.784 ], "x_axis": [ 0.804, -0.594, 0.026 ], "y_axis": [ 0.481, 0.625, -0.615 ], "z_axis": [ 0.349, 0.507, 0.788 ], "quaternion": [ 0.897, -0.313, 0.090, -0.300 ] } }, { "index": 134, "index_chain": 134, "chain_name": "A", "nt_resnum": 236, "nt_name": "U", "nt_code": "U", "nt_id": "///A/236", "linked_nts": [ "///A/235", "///A/237" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,~C3'-endo,non-stack,hairpin-loop,cap-acceptor,splayed-apart", "alpha": 91.027, "beta": -165.594, "gamma": 144.952, "delta": 84.071, "epsilon": -145.762, "zeta": -136.839, "epsilon_zeta": -8.923, "bb_type": "--", "chi": -85.787, "glyco_bond": "--", "C5prime_xyz": [ -2.431, 7.005, -3.145 ], "P_xyz": [ -2.172, 5.505, -5.301 ], "form": ".", "ssZp": -0.113, "Dp": 4.670, "splay_angle": 142.955, "splay_distance": 18.441, "splay_ratio": 0.948, "d22": 9.874, "d64": 12.893, "eta": 50.169, "theta": 123.652, "eta_prime": 73.874, "theta_prime": 107.867, "eta_base": 29.452, "theta_base": 87.523, "v0": 4.889, "v1": -25.477, "v2": 35.228, "v3": -33.277, "v4": 17.927, "amplitude": 35.873, "phase_angle": 10.879, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.109, "frame": { "rmsd": 0.007, "origin": [ 74.893, 93.682, 117.683 ], "x_axis": [ -0.150, -0.647, -0.748 ], "y_axis": [ 0.535, -0.689, 0.488 ], "z_axis": [ -0.831, -0.327, 0.450 ], "quaternion": [ -0.391, -0.522, 0.053, 0.756 ] } }, { "index": 135, "index_chain": 135, "chain_name": "A", "nt_resnum": 237, "nt_name": "C", "nt_code": "C", "nt_id": "///A/237", "linked_nts": [ "///A/236", "///A/238" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-stack,non-pair-contact,hairpin-loop,splayed-apart", "alpha": 162.620, "beta": 95.191, "gamma": 126.169, "delta": 83.655, "epsilon": -160.673, "zeta": -156.794, "epsilon_zeta": -3.879, "bb_type": "--", "chi": 178.170, "glyco_bond": "anti", "C5prime_xyz": [ -1.122, 8.211, 1.911 ], "P_xyz": [ 0.311, 9.528, 0.128 ], "form": ".", "ssZp": 4.385, "Dp": 4.561, "splay_angle": 76.055, "splay_distance": 10.652, "splay_ratio": 0.616, "d22": 8.594, "d64": 9.823, "eta": 98.391, "theta": 137.591, "eta_prime": 102.011, "theta_prime": 164.037, "eta_base": 122.653, "theta_base": -168.383, "v0": 9.386, "v1": -29.275, "v2": 36.791, "v3": -32.461, "v4": 14.585, "amplitude": 36.892, "phase_angle": 4.235, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.072, "frame": { "rmsd": 0.014, "origin": [ 83.950, 86.114, 131.853 ], "x_axis": [ -0.247, 0.946, 0.212 ], "y_axis": [ -0.352, 0.116, -0.929 ], "z_axis": [ -0.903, -0.304, 0.304 ], "quaternion": [ 0.542, -0.288, -0.515, 0.599 ] } }, { "index": 136, "index_chain": 136, "chain_name": "A", "nt_resnum": 238, "nt_name": "U", "nt_code": "U", "nt_id": "///A/238", "linked_nts": [ "///A/237", "///A/239" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,anti,~C3'-endo,non-stack,non-pair-contact,hairpin-loop,splayed-apart", "alpha": 75.558, "beta": 121.704, "gamma": 14.218, "delta": 83.197, "epsilon": -150.654, "zeta": 128.369, "epsilon_zeta": 80.978, "bb_type": "--", "chi": -165.649, "glyco_bond": "anti", "C5prime_xyz": [ -1.501, 8.747, 0.853 ], "P_xyz": [ 0.864, 8.534, 2.050 ], "form": ".", "ssZp": 4.357, "Dp": 4.469, "splay_angle": 115.694, "splay_distance": 17.264, "splay_ratio": 0.849, "d22": 9.221, "d64": 11.997, "eta": -126.081, "theta": 39.560, "eta_prime": -156.012, "theta_prime": 16.016, "eta_base": 179.753, "theta_base": 4.669, "v0": -1.033, "v1": -20.247, "v2": 32.351, "v3": -33.976, "v4": 22.125, "amplitude": 34.500, "phase_angle": 20.328, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.008, "origin": [ 78.425, 77.439, 134.627 ], "x_axis": [ 0.156, 0.914, 0.375 ], "y_axis": [ 0.274, 0.325, -0.905 ], "z_axis": [ -0.949, 0.244, -0.200 ], "quaternion": [ 0.566, -0.508, -0.585, 0.283 ] } }, { "index": 137, "index_chain": 137, "chain_name": "A", "nt_resnum": 239, "nt_name": "U", "nt_code": "U", "nt_id": "///A/239", "linked_nts": [ "///A/238", "///A/240" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,hairpin-loop,splayed-apart", "alpha": -35.775, "beta": -100.956, "gamma": -91.926, "delta": 83.623, "epsilon": -144.513, "zeta": -102.497, "epsilon_zeta": -42.016, "bb_type": "BI", "chi": -164.959, "glyco_bond": "anti", "C5prime_xyz": [ -1.305, 8.649, 0.843 ], "P_xyz": [ -2.078, 11.075, 0.273 ], "form": "A", "ssZp": 4.437, "Dp": 4.582, "splay_angle": 22.152, "splay_distance": 3.529, "splay_ratio": 0.193, "d22": 4.200, "d64": 3.986, "eta": 159.255, "theta": 167.034, "eta_prime": 173.702, "theta_prime": -177.589, "eta_base": -145.261, "theta_base": -126.899, "v0": 0.885, "v1": -21.636, "v2": 32.973, "v3": -33.412, "v4": 20.575, "amplitude": 34.522, "phase_angle": 17.227, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33m", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.006, "origin": [ 80.350, 85.170, 119.311 ], "x_axis": [ 0.674, -0.558, -0.484 ], "y_axis": [ -0.282, -0.800, 0.530 ], "z_axis": [ -0.682, -0.221, -0.697 ], "quaternion": [ 0.211, 0.890, -0.236, -0.327 ] } }, { "index": 138, "index_chain": 138, "chain_name": "A", "nt_resnum": 240, "nt_name": "C", "nt_code": "C", "nt_id": "///A/240", "linked_nts": [ "///A/239", "///A/241" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": 150.075, "beta": -129.940, "gamma": 162.407, "delta": 81.058, "epsilon": -126.239, "zeta": -81.376, "epsilon_zeta": -44.863, "bb_type": "--", "chi": -170.802, "glyco_bond": "anti", "C5prime_xyz": [ -1.236, 8.590, 1.203 ], "P_xyz": [ 0.764, 9.253, -0.331 ], "form": "A", "ssZp": 4.588, "Dp": 4.725, "splay_angle": 21.994, "splay_distance": 3.564, "splay_ratio": 0.193, "d22": 4.127, "d64": 4.083, "eta": 154.420, "theta": -144.237, "eta_prime": 176.902, "theta_prime": -148.927, "eta_base": -125.264, "theta_base": -126.873, "v0": 3.969, "v1": -25.523, "v2": 36.341, "v3": -35.075, "v4": 19.612, "amplitude": 37.252, "phase_angle": 12.695, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.098, "filter_rmsd": 0.066, "frame": { "rmsd": 0.005, "origin": [ 79.724, 83.831, 116.107 ], "x_axis": [ 0.377, -0.926, -0.011 ], "y_axis": [ -0.763, -0.317, 0.563 ], "z_axis": [ -0.525, -0.204, -0.827 ], "quaternion": [ 0.241, 0.794, -0.532, -0.169 ] } }, { "index": 139, "index_chain": 139, "chain_name": "A", "nt_resnum": 241, "nt_name": "U", "nt_code": "U", "nt_id": "///A/241", "linked_nts": [ "///A/240", "///A/242" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -54.122, "beta": 163.019, "gamma": 46.855, "delta": 77.955, "epsilon": -151.030, "zeta": -77.199, "epsilon_zeta": -73.831, "bb_type": "BI", "chi": -160.562, "glyco_bond": "anti", "C5prime_xyz": [ -1.655, 8.782, 0.533 ], "P_xyz": [ 0.855, 9.447, 0.641 ], "form": "A", "ssZp": 4.441, "Dp": 4.620, "splay_angle": 22.951, "splay_distance": 3.677, "splay_ratio": 0.201, "d22": null, "d64": null, "eta": 160.412, "theta": -152.846, "eta_prime": 176.535, "theta_prime": -152.552, "eta_base": -142.227, "theta_base": -127.725, "v0": 0.729, "v1": -24.005, "v2": 36.853, "v3": -37.507, "v4": 23.214, "amplitude": 38.664, "phase_angle": 17.604, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.622, "filter_rmsd": 0.103, "frame": { "rmsd": 0.003, "origin": [ 79.564, 82.487, 112.810 ], "x_axis": [ 0.006, -0.887, 0.463 ], "y_axis": [ -0.901, 0.196, 0.388 ], "z_axis": [ -0.435, -0.419, -0.797 ], "quaternion": [ -0.318, -0.634, 0.705, -0.011 ] } }, { "index": 140, "index_chain": 140, "chain_name": "A", "nt_resnum": 242, "nt_name": "G", "nt_code": "G", "nt_id": "///A/242", "linked_nts": [ "///A/241", "///A/243" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -56.829, "beta": 165.517, "gamma": 53.362, "delta": 80.148, "epsilon": -145.915, "zeta": -82.394, "epsilon_zeta": -63.522, "bb_type": "BI", "chi": -167.672, "glyco_bond": "anti", "C5prime_xyz": [ -1.577, 8.742, 1.012 ], "P_xyz": [ 0.955, 9.266, 1.364 ], "form": "A", "ssZp": 4.539, "Dp": 4.617, "splay_angle": 20.824, "splay_distance": 3.260, "splay_ratio": 0.181, "d22": null, "d64": null, "eta": 170.514, "theta": -152.981, "eta_prime": -177.878, "theta_prime": -151.891, "eta_base": -139.942, "theta_base": -127.677, "v0": 1.053, "v1": -23.423, "v2": 35.647, "v3": -36.016, "v4": 22.040, "amplitude": 37.279, "phase_angle": 17.019, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.892, "filter_rmsd": 0.005, "frame": { "rmsd": 0.005, "origin": [ 79.474, 80.133, 109.988 ], "x_axis": [ -0.359, -0.576, 0.734 ], "y_axis": [ -0.781, 0.616, 0.101 ], "z_axis": [ -0.511, -0.537, -0.671 ], "quaternion": [ -0.383, -0.417, 0.813, -0.134 ] } }, { "index": 141, "index_chain": 141, "chain_name": "A", "nt_resnum": 243, "nt_name": "U", "nt_code": "U", "nt_id": "///A/243", "linked_nts": [ "///A/242", "///A/244" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -62.213, "beta": 170.211, "gamma": 51.110, "delta": 81.704, "epsilon": -140.718, "zeta": -77.233, "epsilon_zeta": -63.485, "bb_type": "BI", "chi": -160.915, "glyco_bond": "anti", "C5prime_xyz": [ -1.303, 8.696, 0.558 ], "P_xyz": [ 1.290, 9.004, 0.718 ], "form": "A", "ssZp": 4.429, "Dp": 4.696, "splay_angle": 24.419, "splay_distance": 3.960, "splay_ratio": 0.213, "d22": 3.683, "d64": 4.044, "eta": 169.439, "theta": -139.470, "eta_prime": 179.123, "theta_prime": -137.641, "eta_base": -145.718, "theta_base": -109.444, "v0": 3.073, "v1": -25.189, "v2": 36.545, "v3": -35.728, "v4": 20.592, "amplitude": 37.665, "phase_angle": 14.007, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.895, "filter_rmsd": 0.108, "frame": { "rmsd": 0.005, "origin": [ 78.997, 77.560, 108.043 ], "x_axis": [ -0.699, -0.140, 0.702 ], "y_axis": [ -0.525, 0.766, -0.370 ], "z_axis": [ -0.486, -0.627, -0.609 ], "quaternion": [ -0.339, -0.190, 0.877, -0.284 ] } }, { "index": 142, "index_chain": 142, "chain_name": "A", "nt_resnum": 244, "nt_name": "U", "nt_code": "U", "nt_id": "///A/244", "linked_nts": [ "///A/243", "///A/245" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -60.080, "beta": 154.437, "gamma": 63.448, "delta": 78.973, "epsilon": -144.544, "zeta": -81.386, "epsilon_zeta": -63.159, "bb_type": "BI", "chi": -175.841, "glyco_bond": "anti", "C5prime_xyz": [ -1.898, 8.839, 1.321 ], "P_xyz": [ 0.718, 9.412, 1.397 ], "form": "A", "ssZp": 4.630, "Dp": 4.484, "splay_angle": 20.073, "splay_distance": 3.402, "splay_ratio": 0.182, "d22": null, "d64": null, "eta": 165.906, "theta": -144.165, "eta_prime": -174.644, "theta_prime": -146.706, "eta_base": -127.968, "theta_base": -126.194, "v0": -7.075, "v1": -18.503, "v2": 35.841, "v3": -39.980, "v4": 29.768, "amplitude": 40.542, "phase_angle": 27.865, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.705, "filter_rmsd": 0.103, "frame": { "rmsd": 0.012, "origin": [ 76.689, 74.387, 107.510 ], "x_axis": [ -0.750, 0.428, 0.505 ], "y_axis": [ -0.041, 0.731, -0.681 ], "z_axis": [ -0.661, -0.531, -0.530 ], "quaternion": [ -0.336, 0.112, 0.868, -0.349 ] } }, { "index": 143, "index_chain": 143, "chain_name": "A", "nt_resnum": 245, "nt_name": "G", "nt_code": "G", "nt_id": "///A/245", "linked_nts": [ "///A/244", "///A/246" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -58.595, "beta": 165.910, "gamma": 48.980, "delta": 78.733, "epsilon": -152.409, "zeta": -79.500, "epsilon_zeta": -72.909, "bb_type": "BI", "chi": -165.659, "glyco_bond": "anti", "C5prime_xyz": [ -2.108, 8.920, 0.829 ], "P_xyz": [ 0.411, 9.765, 1.216 ], "form": "A", "ssZp": 4.538, "Dp": 4.535, "splay_angle": 21.708, "splay_distance": 3.448, "splay_ratio": 0.190, "d22": null, "d64": null, "eta": 162.937, "theta": -153.030, "eta_prime": 175.375, "theta_prime": -152.214, "eta_base": -147.445, "theta_base": -118.671, "v0": -2.894, "v1": -21.147, "v2": 35.609, "v3": -38.182, "v4": 25.858, "amplitude": 38.592, "phase_angle": 22.674, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.865, "filter_rmsd": 0.018, "frame": { "rmsd": 0.018, "origin": [ 74.509, 71.792, 107.803 ], "x_axis": [ -0.598, 0.787, 0.152 ], "y_axis": [ 0.277, 0.381, -0.882 ], "z_axis": [ -0.752, -0.485, -0.446 ], "quaternion": [ -0.290, 0.342, 0.779, -0.439 ] } }, { "index": 144, "index_chain": 144, "chain_name": "A", "nt_resnum": 246, "nt_name": "A", "nt_code": "A", "nt_id": "///A/246", "linked_nts": [ "///A/245", "///A/247" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -63.862, "beta": 165.190, "gamma": 56.416, "delta": 80.244, "epsilon": -140.346, "zeta": -71.714, "epsilon_zeta": -68.631, "bb_type": "BI", "chi": -164.519, "glyco_bond": "anti", "C5prime_xyz": [ -1.546, 8.685, 0.787 ], "P_xyz": [ 1.030, 9.204, 0.778 ], "form": "A", "ssZp": 4.547, "Dp": 4.700, "splay_angle": 21.753, "splay_distance": 3.504, "splay_ratio": 0.192, "d22": null, "d64": null, "eta": 168.367, "theta": -137.408, "eta_prime": 178.454, "theta_prime": -136.620, "eta_base": -135.635, "theta_base": -100.048, "v0": 2.545, "v1": -24.992, "v2": 36.657, "v3": -36.175, "v4": 21.208, "amplitude": 37.918, "phase_angle": 14.818, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.909, "filter_rmsd": 0.036, "frame": { "rmsd": 0.005, "origin": [ 71.243, 70.700, 107.627 ], "x_axis": [ -0.272, 0.895, -0.355 ], "y_axis": [ 0.505, -0.181, -0.844 ], "z_axis": [ -0.819, -0.409, -0.403 ], "quaternion": [ -0.190, 0.573, 0.611, -0.512 ] } }, { "index": 145, "index_chain": 145, "chain_name": "A", "nt_resnum": 247, "nt_name": "U", "nt_code": "U", "nt_id": "///A/247", "linked_nts": [ "///A/246", "///A/248" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge", "alpha": -65.453, "beta": 167.264, "gamma": 58.615, "delta": 79.453, "epsilon": -138.174, "zeta": -97.637, "epsilon_zeta": -40.537, "bb_type": "BI", "chi": -153.646, "glyco_bond": "anti", "C5prime_xyz": [ -1.594, 8.810, 0.141 ], "P_xyz": [ 0.940, 9.406, -0.210 ], "form": ".", "ssZp": 4.224, "Dp": 4.695, "splay_angle": 45.413, "splay_distance": 7.321, "splay_ratio": 0.387, "d22": null, "d64": null, "eta": 166.713, "theta": -164.016, "eta_prime": -176.341, "theta_prime": -150.852, "eta_base": -123.629, "theta_base": -147.992, "v0": 1.288, "v1": -24.363, "v2": 36.842, "v3": -37.046, "v4": 22.535, "amplitude": 38.456, "phase_angle": 16.659, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.920, "filter_rmsd": 0.105, "frame": { "rmsd": 0.005, "origin": [ 68.075, 71.673, 106.488 ], "x_axis": [ 0.153, 0.602, -0.784 ], "y_axis": [ 0.363, -0.772, -0.522 ], "z_axis": [ -0.919, -0.205, -0.336 ], "quaternion": [ -0.105, 0.752, 0.321, -0.566 ] } }, { "index": 146, "index_chain": 146, "chain_name": "A", "nt_resnum": 248, "nt_name": "A", "nt_code": "A", "nt_id": "///A/248", "linked_nts": [ "///A/247", "///A/249" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C2'-endo,non-canonical,non-pair-contact,helix,multiplet,bulge,phosphate", "alpha": -70.719, "beta": 176.819, "gamma": 98.778, "delta": 143.816, "epsilon": -124.834, "zeta": -143.951, "epsilon_zeta": 19.117, "bb_type": "--", "chi": -115.973, "glyco_bond": "anti", "C5prime_xyz": [ -2.831, 8.456, -1.407 ], "P_xyz": [ -0.541, 9.465, -2.173 ], "form": ".", "ssZp": 1.613, "Dp": 1.629, "splay_angle": 27.681, "splay_distance": 4.561, "splay_ratio": 0.239, "d22": null, "d64": null, "eta": -138.467, "theta": -171.542, "eta_prime": -126.031, "theta_prime": 145.528, "eta_base": -139.163, "theta_base": 87.069, "v0": -28.235, "v1": 40.440, "v2": -36.405, "v3": 21.157, "v4": 4.195, "amplitude": 40.096, "phase_angle": 155.225, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.036, "frame": { "rmsd": 0.008, "origin": [ 60.892, 70.751, 105.418 ], "x_axis": [ 0.333, 0.579, -0.744 ], "y_axis": [ 0.435, -0.795, -0.423 ], "z_axis": [ -0.837, -0.182, -0.516 ], "quaternion": [ -0.074, 0.813, 0.312, -0.486 ] } }, { "index": 147, "index_chain": 147, "chain_name": "A", "nt_resnum": 249, "nt_name": "U", "nt_code": "U", "nt_id": "///A/249", "linked_nts": [ "///A/248", "///A/250" ], "nt_type": "RNA", "dbn": ")", "summary": "turn,anti,~C3'-endo,BI,non-stack,isolated-canonical,helix,multiplet,bulge", "alpha": -96.269, "beta": 120.732, "gamma": 14.660, "delta": 81.080, "epsilon": -149.182, "zeta": -58.655, "epsilon_zeta": -90.527, "bb_type": "BI", "chi": -168.381, "glyco_bond": "anti", "C5prime_xyz": [ -2.237, 8.874, 0.834 ], "P_xyz": [ -0.111, 9.158, 2.350 ], "form": ".", "ssZp": 4.066, "Dp": 4.186, "splay_angle": 71.746, "splay_distance": 10.492, "splay_ratio": 0.587, "d22": null, "d64": null, "eta": 98.399, "theta": -124.893, "eta_prime": 90.441, "theta_prime": -117.840, "eta_base": 47.336, "theta_base": -87.122, "v0": -10.058, "v1": -12.177, "v2": 28.180, "v3": -34.890, "v4": 28.359, "amplitude": 34.476, "phase_angle": 35.178, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.010, "origin": [ 63.054, 69.762, 109.310 ], "x_axis": [ 0.954, -0.175, -0.244 ], "y_axis": [ -0.203, -0.975, -0.096 ], "z_axis": [ -0.221, 0.141, -0.965 ], "quaternion": [ -0.060, 0.987, -0.096, -0.118 ] } }, { "index": 148, "index_chain": 148, "chain_name": "A", "nt_resnum": 250, "nt_name": "G", "nt_code": "G", "nt_id": "///A/250", "linked_nts": [ "///A/249", "///A/251" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,bulge,A-minor,phosphate", "alpha": -75.777, "beta": -148.251, "gamma": 61.740, "delta": 84.467, "epsilon": -153.093, "zeta": -74.764, "epsilon_zeta": -78.329, "bb_type": "BI", "chi": -171.628, "glyco_bond": "anti", "C5prime_xyz": [ -0.970, 8.469, 1.175 ], "P_xyz": [ 1.456, 8.186, 2.147 ], "form": ".", "ssZp": 4.634, "Dp": 4.648, "splay_angle": 25.069, "splay_distance": 4.287, "splay_ratio": 0.230, "d22": null, "d64": null, "eta": -167.661, "theta": -113.768, "eta_prime": -152.609, "theta_prime": -119.759, "eta_base": -114.932, "theta_base": -97.343, "v0": 7.525, "v1": -27.462, "v2": 35.890, "v3": -32.566, "v4": 15.841, "amplitude": 36.154, "phase_angle": 6.927, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1m", "suiteness": 0.846, "filter_rmsd": 0.006, "frame": { "rmsd": 0.006, "origin": [ 60.759, 67.699, 99.282 ], "x_axis": [ 0.437, -0.898, 0.055 ], "y_axis": [ -0.405, -0.142, 0.903 ], "z_axis": [ -0.803, -0.417, -0.426 ], "quaternion": [ 0.466, 0.708, -0.460, -0.264 ] } }, { "index": 149, "index_chain": 149, "chain_name": "A", "nt_resnum": 251, "nt_name": "G", "nt_code": "G", "nt_id": "///A/251", "linked_nts": [ "///A/250", "///A/252" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": 156.655, "beta": -154.316, "gamma": 173.748, "delta": 80.697, "epsilon": -121.302, "zeta": -94.198, "epsilon_zeta": -27.103, "bb_type": "--", "chi": 177.834, "glyco_bond": "anti", "C5prime_xyz": [ -1.384, 8.339, 1.811 ], "P_xyz": [ 0.412, 9.998, 0.856 ], "form": "A", "ssZp": 4.763, "Dp": 4.779, "splay_angle": 23.353, "splay_distance": 3.621, "splay_ratio": 0.204, "d22": null, "d64": null, "eta": 165.133, "theta": -164.318, "eta_prime": -174.497, "theta_prime": -159.385, "eta_base": -127.267, "theta_base": -128.928, "v0": 3.843, "v1": -26.002, "v2": 37.076, "v3": -35.900, "v4": 20.177, "amplitude": 38.043, "phase_angle": 12.947, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.834, "filter_rmsd": 0.006, "frame": { "rmsd": 0.006, "origin": [ 59.890, 64.803, 96.243 ], "x_axis": [ 0.127, -0.836, 0.535 ], "y_axis": [ -0.624, 0.352, 0.698 ], "z_axis": [ -0.771, -0.422, -0.476 ], "quaternion": [ 0.501, 0.559, -0.652, -0.106 ] } }, { "index": 150, "index_chain": 150, "chain_name": "A", "nt_resnum": 252, "nt_name": "A", "nt_code": "A", "nt_id": "///A/252", "linked_nts": [ "///A/251", "///A/253" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -46.874, "beta": 152.576, "gamma": 49.397, "delta": 79.121, "epsilon": -141.478, "zeta": -70.860, "epsilon_zeta": -70.618, "bb_type": "BI", "chi": -167.465, "glyco_bond": "anti", "C5prime_xyz": [ -1.502, 8.661, 0.935 ], "P_xyz": [ 1.091, 8.999, 0.923 ], "form": "A", "ssZp": 4.603, "Dp": 4.710, "splay_angle": 24.469, "splay_distance": 3.926, "splay_ratio": 0.216, "d22": null, "d64": null, "eta": 166.209, "theta": -135.418, "eta_prime": -178.929, "theta_prime": -134.726, "eta_base": -136.809, "theta_base": -101.321, "v0": 2.000, "v1": -24.891, "v2": 37.080, "v3": -36.935, "v4": 22.049, "amplitude": 38.519, "phase_angle": 15.707, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.317, "filter_rmsd": 0.037, "frame": { "rmsd": 0.002, "origin": [ 58.546, 62.208, 94.105 ], "x_axis": [ -0.250, -0.490, 0.835 ], "y_axis": [ -0.643, 0.729, 0.235 ], "z_axis": [ -0.724, -0.479, -0.498 ], "quaternion": [ -0.495, -0.360, 0.787, -0.077 ] } }, { "index": 151, "index_chain": 151, "chain_name": "A", "nt_resnum": 253, "nt_name": "U", "nt_code": "U", "nt_id": "///A/253", "linked_nts": [ "///A/252", "///A/254" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BII,canonical,non-pair-contact,helix,stem-end,coaxial-stack,splayed-apart", "alpha": -58.299, "beta": 163.751, "gamma": 59.481, "delta": 79.707, "epsilon": -130.229, "zeta": 169.619, "epsilon_zeta": 60.152, "bb_type": "BII", "chi": -162.221, "glyco_bond": "anti", "C5prime_xyz": [ -1.665, 8.788, 0.624 ], "P_xyz": [ 0.875, 9.421, 0.524 ], "form": ".", "ssZp": 4.389, "Dp": 4.672, "splay_angle": 91.924, "splay_distance": 12.941, "splay_ratio": 0.719, "d22": null, "d64": null, "eta": 174.294, "theta": 102.976, "eta_prime": -168.215, "theta_prime": 108.388, "eta_base": -117.435, "theta_base": 128.045, "v0": 0.046, "v1": -22.814, "v2": 35.621, "v3": -36.568, "v4": 23.023, "amplitude": 37.567, "phase_angle": 18.523, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.874, "filter_rmsd": 0.104, "frame": { "rmsd": 0.003, "origin": [ 56.398, 58.924, 94.229 ], "x_axis": [ -0.588, 0.079, 0.805 ], "y_axis": [ -0.424, 0.818, -0.390 ], "z_axis": [ -0.689, -0.570, -0.448 ], "quaternion": [ -0.442, -0.102, 0.845, -0.284 ] } }, { "index": 152, "index_chain": 152, "chain_name": "A", "nt_resnum": 254, "nt_name": "G", "nt_code": "G", "nt_id": "///A/254", "linked_nts": [ "///A/253", "///A/255" ], "nt_type": "RNA", "dbn": "[", "summary": "pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,splayed-apart", "alpha": -77.061, "beta": 147.072, "gamma": 37.936, "delta": 80.259, "epsilon": -143.266, "zeta": -66.567, "epsilon_zeta": -76.699, "bb_type": "BI", "chi": -178.939, "glyco_bond": "anti", "C5prime_xyz": [ -1.444, 8.481, 1.551 ], "P_xyz": [ 1.121, 8.492, 2.088 ], "form": "A", "ssZp": 4.702, "Dp": 4.696, "splay_angle": 25.218, "splay_distance": 3.966, "splay_ratio": 0.223, "d22": null, "d64": null, "eta": 164.777, "theta": -130.871, "eta_prime": 160.547, "theta_prime": -130.622, "eta_base": 150.259, "theta_base": -96.920, "v0": 2.978, "v1": -25.232, "v2": 36.587, "v3": -35.945, "v4": 20.804, "amplitude": 37.744, "phase_angle": 14.222, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "3a", "suiteness": 0.695, "filter_rmsd": 0.003, "frame": { "rmsd": 0.003, "origin": [ 58.718, 60.773, 81.633 ], "x_axis": [ 0.371, -0.448, 0.813 ], "y_axis": [ -0.703, 0.436, 0.562 ], "z_axis": [ -0.606, -0.780, -0.153 ], "quaternion": [ 0.643, 0.522, -0.552, 0.099 ] } }, { "index": 153, "index_chain": 153, "chain_name": "A", "nt_resnum": 255, "nt_name": "C", "nt_code": "C", "nt_id": "///A/255", "linked_nts": [ "///A/254", "///A/256" ], "nt_type": "RNA", "dbn": "[", "summary": "pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack", "alpha": -65.600, "beta": 179.488, "gamma": 49.245, "delta": 78.619, "epsilon": -136.031, "zeta": -71.270, "epsilon_zeta": -64.760, "bb_type": "BI", "chi": -165.026, "glyco_bond": "anti", "C5prime_xyz": [ -1.296, 8.719, 0.816 ], "P_xyz": [ 1.259, 9.133, 1.283 ], "form": ".", "ssZp": 4.575, "Dp": 4.758, "splay_angle": 32.799, "splay_distance": 5.007, "splay_ratio": 0.282, "d22": null, "d64": null, "eta": 166.210, "theta": -133.629, "eta_prime": -178.851, "theta_prime": -127.188, "eta_base": -125.886, "theta_base": -82.833, "v0": 3.057, "v1": -26.248, "v2": 38.166, "v3": -37.430, "v4": 21.663, "amplitude": 39.374, "phase_angle": 14.229, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.938, "filter_rmsd": 0.063, "frame": { "rmsd": 0.002, "origin": [ 58.418, 56.833, 81.979 ], "x_axis": [ -0.194, 0.003, 0.981 ], "y_axis": [ -0.783, 0.602, -0.157 ], "z_axis": [ -0.591, -0.798, -0.115 ], "quaternion": [ 0.569, 0.282, -0.691, 0.345 ] } }, { "index": 154, "index_chain": 154, "chain_name": "A", "nt_resnum": 256, "nt_name": "A", "nt_code": "A", "nt_id": "///A/256", "linked_nts": [ "///A/255", "///A/257" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-canonical,non-pair-contact,multiplet,ss-non-loop", "alpha": -52.148, "beta": 162.718, "gamma": 51.114, "delta": 80.535, "epsilon": -116.076, "zeta": -82.468, "epsilon_zeta": -33.609, "bb_type": "--", "chi": -175.370, "glyco_bond": "anti", "C5prime_xyz": [ -1.436, 8.462, 1.449 ], "P_xyz": [ 1.157, 8.673, 1.833 ], "form": ".", "ssZp": 4.697, "Dp": 4.786, "splay_angle": 30.495, "splay_distance": 4.749, "splay_ratio": 0.264, "d22": null, "d64": null, "eta": 173.101, "theta": -124.851, "eta_prime": -167.308, "theta_prime": -120.306, "eta_base": -106.641, "theta_base": -77.671, "v0": 5.182, "v1": -26.828, "v2": 37.203, "v3": -35.163, "v4": 18.842, "amplitude": 37.883, "phase_angle": 10.874, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.779, "filter_rmsd": 0.039, "frame": { "rmsd": 0.004, "origin": [ 55.272, 54.226, 84.874 ], "x_axis": [ -0.572, 0.640, 0.513 ], "y_axis": [ -0.297, 0.422, -0.857 ], "z_axis": [ -0.765, -0.642, -0.051 ], "quaternion": [ -0.447, 0.120, 0.715, -0.524 ] } }, { "index": 155, "index_chain": 155, "chain_name": "A", "nt_resnum": 257, "nt_name": "G", "nt_code": "G", "nt_id": "///A/257", "linked_nts": [ "///A/256", "///A/258" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-canonical,non-pair-contact,multiplet,ss-non-loop", "alpha": -42.490, "beta": 147.681, "gamma": 51.308, "delta": 78.271, "epsilon": -126.328, "zeta": -99.056, "epsilon_zeta": -27.272, "bb_type": "--", "chi": -174.637, "glyco_bond": "anti", "C5prime_xyz": [ -1.678, 8.586, 1.382 ], "P_xyz": [ 0.879, 9.069, 1.405 ], "form": ".", "ssZp": 4.706, "Dp": 4.760, "splay_angle": 27.626, "splay_distance": 4.469, "splay_ratio": 0.245, "d22": null, "d64": null, "eta": 164.594, "theta": -156.279, "eta_prime": -172.137, "theta_prime": -155.284, "eta_base": -106.248, "theta_base": -154.121, "v0": 3.833, "v1": -26.593, "v2": 38.046, "v3": -36.833, "v4": 20.763, "amplitude": 39.057, "phase_angle": 13.064, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1L", "suiteness": 0.661, "filter_rmsd": 0.004, "frame": { "rmsd": 0.004, "origin": [ 50.739, 54.192, 86.290 ], "x_axis": [ -0.530, 0.789, -0.310 ], "y_axis": [ 0.244, -0.208, -0.947 ], "z_axis": [ -0.812, -0.578, -0.083 ], "quaternion": [ 0.212, -0.436, -0.593, 0.643 ] } }, { "index": 156, "index_chain": 156, "chain_name": "A", "nt_resnum": 258, "nt_name": "U", "nt_code": "U", "nt_id": "///A/258", "linked_nts": [ "///A/257", "///A/259" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,multiplet,ss-non-loop", "alpha": -65.575, "beta": 165.284, "gamma": 55.237, "delta": 78.122, "epsilon": -147.312, "zeta": -64.015, "epsilon_zeta": -83.298, "bb_type": "BI", "chi": -164.270, "glyco_bond": "anti", "C5prime_xyz": [ -1.720, 8.781, 0.729 ], "P_xyz": [ 0.756, 9.573, 0.772 ], "form": ".", "ssZp": 4.507, "Dp": 4.628, "splay_angle": 35.753, "splay_distance": 5.679, "splay_ratio": 0.309, "d22": 4.603, "d64": 4.992, "eta": 166.626, "theta": -139.574, "eta_prime": 170.322, "theta_prime": -136.462, "eta_base": 179.058, "theta_base": -106.442, "v0": 0.354, "v1": -23.598, "v2": 36.537, "v3": -37.355, "v4": 23.359, "amplitude": 38.440, "phase_angle": 18.104, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.398, "filter_rmsd": 0.102, "frame": { "rmsd": 0.004, "origin": [ 48.011, 51.933, 89.014 ], "x_axis": [ -0.160, 0.824, -0.544 ], "y_axis": [ 0.310, -0.481, -0.820 ], "z_axis": [ -0.937, -0.300, -0.178 ], "quaternion": [ -0.212, 0.612, 0.463, -0.605 ] } }, { "index": 157, "index_chain": 157, "chain_name": "A", "nt_resnum": 259, "nt_name": "U", "nt_code": "U", "nt_id": "///A/259", "linked_nts": [ "///A/258", "///A/260" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,multiplet,ss-non-loop", "alpha": -64.891, "beta": -169.909, "gamma": 47.577, "delta": 77.862, "epsilon": -147.061, "zeta": -86.402, "epsilon_zeta": -60.659, "bb_type": "BI", "chi": -158.461, "glyco_bond": "anti", "C5prime_xyz": [ -1.513, 8.752, 0.422 ], "P_xyz": [ 0.944, 9.410, 1.047 ], "form": "A", "ssZp": 4.387, "Dp": 4.670, "splay_angle": 29.723, "splay_distance": 4.610, "splay_ratio": 0.257, "d22": 4.586, "d64": 4.798, "eta": 172.903, "theta": -158.355, "eta_prime": -174.128, "theta_prime": -151.420, "eta_base": -132.562, "theta_base": -123.303, "v0": -0.329, "v1": -22.930, "v2": 36.279, "v3": -37.486, "v4": 23.767, "amplitude": 38.391, "phase_angle": 19.094, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.816, "filter_rmsd": 0.103, "frame": { "rmsd": 0.002, "origin": [ 42.702, 52.869, 87.229 ], "x_axis": [ 0.321, 0.365, -0.874 ], "y_axis": [ 0.458, -0.868, -0.194 ], "z_axis": [ -0.829, -0.338, -0.446 ], "quaternion": [ 0.044, 0.812, 0.253, -0.525 ] } }, { "index": 158, "index_chain": 158, "chain_name": "A", "nt_resnum": 260, "nt_name": "C", "nt_code": "C", "nt_id": "///A/260", "linked_nts": [ "///A/259", null ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-canonical,non-pair-contact,multiplet,ss-non-loop", "alpha": -47.687, "beta": 165.261, "gamma": 51.533, "delta": 81.084, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": -162.915, "glyco_bond": "anti", "C5prime_xyz": [ -1.277, 8.712, 0.669 ], "P_xyz": [ 1.338, 8.932, 0.775 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": 2.443, "v1": -24.595, "v2": 36.208, "v3": -35.750, "v4": 21.012, "amplitude": 37.474, "phase_angle": 14.935, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.644, "filter_rmsd": 0.064, "frame": { "rmsd": 0.003, "origin": [ 38.873, 52.649, 84.671 ], "x_axis": [ 0.647, -0.073, -0.759 ], "y_axis": [ 0.271, -0.908, 0.318 ], "z_axis": [ -0.713, -0.412, -0.567 ], "quaternion": [ 0.207, 0.884, 0.056, -0.417 ] } }, { "index": 159, "index_chain": 1, "chain_name": "B", "nt_resnum": 103, "nt_name": "G", "nt_code": "G", "nt_id": "///B/103", "linked_nts": [ null, "///B/104" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,isolated-canonical,non-canonical,non-pair-contact,helix,multiplet,internal-loop", "alpha": null, "beta": -84.353, "gamma": -100.781, "delta": 92.560, "epsilon": -150.924, "zeta": -70.446, "epsilon_zeta": -80.478, "bb_type": "BI", "chi": -175.670, "glyco_bond": "anti", "C5prime_xyz": [ -0.961, 8.180, 1.509 ], "P_xyz": [ -1.632, 10.714, 1.198 ], "form": ".", "ssZp": 4.626, "Dp": 4.627, "splay_angle": 32.662, "splay_distance": 5.121, "splay_ratio": 0.286, "d22": null, "d64": null, "eta": null, "theta": 150.098, "eta_prime": null, "theta_prime": 175.234, "eta_base": null, "theta_base": -158.004, "v0": 15.754, "v1": -32.588, "v2": 36.037, "v3": -28.012, "v4": 7.884, "amplitude": 36.263, "phase_angle": 353.597, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.003, "frame": { "rmsd": 0.003, "origin": [ 58.271, 54.756, 57.352 ], "x_axis": [ 0.411, 0.671, 0.617 ], "y_axis": [ -0.736, -0.156, 0.659 ], "z_axis": [ 0.538, -0.725, 0.430 ], "quaternion": [ 0.649, 0.533, -0.031, 0.542 ] } }, { "index": 160, "index_chain": 2, "chain_name": "B", "nt_resnum": 104, "nt_name": "A", "nt_code": "A", "nt_id": "///B/104", "linked_nts": [ "///B/103", "///B/105" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,internal-loop,phosphate", "alpha": -59.743, "beta": 171.080, "gamma": 67.121, "delta": 80.767, "epsilon": -140.558, "zeta": -77.341, "epsilon_zeta": -63.217, "bb_type": "BI", "chi": -179.620, "glyco_bond": "anti", "C5prime_xyz": [ -1.897, 8.588, 1.558 ], "P_xyz": [ 0.562, 9.129, 2.326 ], "form": "A", "ssZp": 4.402, "Dp": 4.463, "splay_angle": 18.830, "splay_distance": 3.062, "splay_ratio": 0.166, "d22": null, "d64": null, "eta": -174.255, "theta": -140.508, "eta_prime": -157.604, "theta_prime": -132.147, "eta_base": -131.922, "theta_base": -107.523, "v0": -4.950, "v1": -17.225, "v2": 31.422, "v3": -35.252, "v4": 25.357, "amplitude": 35.128, "phase_angle": 26.556, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.508, "filter_rmsd": 0.040, "frame": { "rmsd": 0.006, "origin": [ 62.455, 51.806, 57.237 ], "x_axis": [ 0.120, 0.516, 0.848 ], "y_axis": [ -0.935, -0.229, 0.272 ], "z_axis": [ 0.334, -0.825, 0.455 ], "quaternion": [ 0.580, 0.473, -0.221, 0.625 ] } }, { "index": 161, "index_chain": 3, "chain_name": "B", "nt_resnum": 105, "nt_name": "A", "nt_code": "A", "nt_id": "///B/105", "linked_nts": [ "///B/104", "///B/106" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C2'-endo,non-canonical,non-pair-contact,helix,multiplet,internal-loop,splayed-apart", "alpha": -52.180, "beta": 174.653, "gamma": 56.273, "delta": 146.329, "epsilon": -124.396, "zeta": -89.211, "epsilon_zeta": -35.185, "bb_type": "--", "chi": -120.898, "glyco_bond": "anti", "C5prime_xyz": [ -2.140, 8.525, -1.237 ], "P_xyz": [ 0.276, 9.454, -0.719 ], "form": ".", "ssZp": 1.491, "Dp": 1.457, "splay_angle": 120.755, "splay_distance": 17.457, "splay_ratio": 0.869, "d22": null, "d64": null, "eta": -173.860, "theta": -86.731, "eta_prime": -142.764, "theta_prime": -111.191, "eta_base": -113.792, "theta_base": -121.767, "v0": -24.546, "v1": 38.167, "v2": -36.282, "v3": 23.140, "v4": 0.696, "amplitude": 38.569, "phase_angle": 160.169, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1b", "suiteness": 0.911, "filter_rmsd": 0.037, "frame": { "rmsd": 0.004, "origin": [ 64.690, 50.352, 58.743 ], "x_axis": [ -0.463, 0.339, 0.819 ], "y_axis": [ -0.722, -0.680, -0.127 ], "z_axis": [ 0.514, -0.650, 0.560 ], "quaternion": [ 0.323, 0.405, -0.236, 0.822 ] } }, { "index": 162, "index_chain": 4, "chain_name": "B", "nt_resnum": 106, "nt_name": "U", "nt_code": "U", "nt_id": "///B/106", "linked_nts": [ "///B/105", "///B/107" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,anti,~C3'-endo,BII,non-stack,internal-loop,splayed-apart", "alpha": -66.088, "beta": 174.898, "gamma": 141.831, "delta": 84.323, "epsilon": -109.521, "zeta": 165.731, "epsilon_zeta": 84.747, "bb_type": "BII", "chi": -161.371, "glyco_bond": "anti", "C5prime_xyz": [ -1.626, 8.793, 0.512 ], "P_xyz": [ 0.051, 10.128, -0.999 ], "form": ".", "ssZp": 4.103, "Dp": 4.580, "splay_angle": 136.263, "splay_distance": 18.994, "splay_ratio": 0.928, "d22": 11.536, "d64": 14.506, "eta": -93.658, "theta": 118.343, "eta_prime": -68.517, "theta_prime": 103.321, "eta_base": -38.652, "theta_base": 93.804, "v0": -3.523, "v1": -17.512, "v2": 30.538, "v3": -33.260, "v4": 23.152, "amplitude": 33.505, "phase_angle": 24.293, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.102, "frame": { "rmsd": 0.007, "origin": [ 68.018, 33.584, 55.209 ], "x_axis": [ -0.319, -0.352, -0.880 ], "y_axis": [ -0.449, 0.874, -0.187 ], "z_axis": [ 0.835, 0.335, -0.437 ], "quaternion": [ 0.529, -0.247, 0.811, 0.046 ] } }, { "index": 163, "index_chain": 5, "chain_name": "B", "nt_resnum": 107, "nt_name": "U", "nt_code": "U", "nt_id": "///B/107", "linked_nts": [ "///B/106", "///B/108" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,internal-loop,splayed-apart", "alpha": 59.071, "beta": 152.602, "gamma": 169.212, "delta": 81.775, "epsilon": -155.339, "zeta": -70.469, "epsilon_zeta": -84.870, "bb_type": "BI", "chi": -168.838, "glyco_bond": "anti", "C5prime_xyz": [ -1.396, 8.624, 1.065 ], "P_xyz": [ -0.581, 10.817, -0.173 ], "form": "A", "ssZp": 4.510, "Dp": 4.556, "splay_angle": 26.325, "splay_distance": 4.171, "splay_ratio": 0.231, "d22": null, "d64": null, "eta": 82.260, "theta": 172.398, "eta_prime": 74.642, "theta_prime": -176.463, "eta_base": 75.893, "theta_base": -148.603, "v0": 2.627, "v1": -24.675, "v2": 36.243, "v3": -35.605, "v4": 20.758, "amplitude": 37.453, "phase_angle": 14.603, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.104, "frame": { "rmsd": 0.005, "origin": [ 68.701, 51.511, 61.450 ], "x_axis": [ -0.806, -0.336, 0.486 ], "y_axis": [ -0.030, -0.798, -0.602 ], "z_axis": [ 0.590, -0.500, 0.633 ], "quaternion": [ -0.085, 0.299, -0.306, 0.900 ] } }, { "index": 164, "index_chain": 6, "chain_name": "B", "nt_resnum": 108, "nt_name": "G", "nt_code": "G", "nt_id": "///B/108", "linked_nts": [ "///B/107", "///B/109" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,phosphate", "alpha": -64.459, "beta": -176.927, "gamma": 49.898, "delta": 80.021, "epsilon": -163.162, "zeta": -78.138, "epsilon_zeta": -85.024, "bb_type": "BI", "chi": -159.397, "glyco_bond": "anti", "C5prime_xyz": [ -1.347, 8.779, 0.535 ], "P_xyz": [ 1.190, 9.251, 1.065 ], "form": "A", "ssZp": 4.414, "Dp": 4.541, "splay_angle": 19.744, "splay_distance": 3.524, "splay_ratio": 0.185, "d22": null, "d64": null, "eta": 170.903, "theta": -128.819, "eta_prime": -177.867, "theta_prime": -136.146, "eta_base": -144.839, "theta_base": -115.154, "v0": 2.339, "v1": -24.462, "v2": 35.967, "v3": -35.729, "v4": 21.015, "amplitude": 37.259, "phase_angle": 15.136, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.926, "filter_rmsd": 0.004, "frame": { "rmsd": 0.004, "origin": [ 70.651, 51.161, 65.120 ], "x_axis": [ -0.749, -0.660, 0.056 ], "y_axis": [ 0.385, -0.502, -0.774 ], "z_axis": [ 0.539, -0.559, 0.630 ], "quaternion": [ -0.308, 0.175, -0.393, 0.849 ] } }, { "index": 165, "index_chain": 7, "chain_name": "B", "nt_resnum": 109, "nt_name": "C", "nt_code": "C", "nt_id": "///B/109", "linked_nts": [ "///B/108", "///B/110" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,A-minor,ribose-zipper", "alpha": 150.756, "beta": -151.622, "gamma": 176.631, "delta": 79.796, "epsilon": -135.099, "zeta": -89.690, "epsilon_zeta": -45.409, "bb_type": "BI", "chi": -171.667, "glyco_bond": "anti", "C5prime_xyz": [ -1.342, 8.618, 1.201 ], "P_xyz": [ 0.177, 10.189, -0.260 ], "form": ".", "ssZp": 4.670, "Dp": 4.736, "splay_angle": 30.877, "splay_distance": 4.867, "splay_ratio": 0.269, "d22": null, "d64": null, "eta": 163.756, "theta": -172.428, "eta_prime": -179.321, "theta_prime": -168.330, "eta_base": -138.216, "theta_base": -148.066, "v0": 4.924, "v1": -27.124, "v2": 37.914, "v3": -36.054, "v4": 19.602, "amplitude": 38.683, "phase_angle": 11.437, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.851, "filter_rmsd": 0.064, "frame": { "rmsd": 0.004, "origin": [ 70.257, 49.807, 68.350 ], "x_axis": [ -0.474, -0.841, -0.260 ], "y_axis": [ 0.778, -0.261, -0.572 ], "z_axis": [ 0.414, -0.473, 0.778 ], "quaternion": [ 0.511, -0.048, 0.330, -0.793 ] } }, { "index": 166, "index_chain": 8, "chain_name": "B", "nt_resnum": 110, "nt_name": "G", "nt_code": "G", "nt_id": "///B/110", "linked_nts": [ "///B/109", "///B/111" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,bulge,A-minor,ribose-zipper", "alpha": -44.920, "beta": 164.418, "gamma": 50.683, "delta": 79.895, "epsilon": -143.215, "zeta": -73.586, "epsilon_zeta": -69.630, "bb_type": "BI", "chi": -168.567, "glyco_bond": "anti", "C5prime_xyz": [ -1.546, 8.738, 0.999 ], "P_xyz": [ 0.989, 9.249, 1.356 ], "form": "A", "ssZp": 4.567, "Dp": 4.643, "splay_angle": 22.817, "splay_distance": 3.631, "splay_ratio": 0.199, "d22": null, "d64": null, "eta": 178.886, "theta": -141.481, "eta_prime": -171.114, "theta_prime": -140.071, "eta_base": -144.396, "theta_base": -103.224, "v0": -0.355, "v1": -22.496, "v2": 35.467, "v3": -36.682, "v4": 23.376, "amplitude": 37.545, "phase_angle": 19.156, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.519, "filter_rmsd": 0.002, "frame": { "rmsd": 0.002, "origin": [ 70.316, 48.040, 72.884 ], "x_axis": [ -0.134, -0.808, -0.574 ], "y_axis": [ 0.861, 0.192, -0.471 ], "z_axis": [ 0.491, -0.557, 0.670 ], "quaternion": [ 0.657, 0.033, 0.405, -0.635 ] } }, { "index": 167, "index_chain": 9, "chain_name": "B", "nt_resnum": 111, "nt_name": "G", "nt_code": "G", "nt_id": "///B/111", "linked_nts": [ "///B/110", "///B/112" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge", "alpha": -59.431, "beta": 168.719, "gamma": 48.626, "delta": 78.522, "epsilon": -142.209, "zeta": -81.450, "epsilon_zeta": -60.759, "bb_type": "BI", "chi": -164.720, "glyco_bond": "anti", "C5prime_xyz": [ -1.499, 8.744, 0.787 ], "P_xyz": [ 1.065, 9.218, 1.073 ], "form": "A", "ssZp": 4.543, "Dp": 4.698, "splay_angle": 23.860, "splay_distance": 3.777, "splay_ratio": 0.208, "d22": null, "d64": null, "eta": 164.295, "theta": -148.082, "eta_prime": 179.721, "theta_prime": -146.276, "eta_base": -126.697, "theta_base": -119.516, "v0": 2.664, "v1": -25.687, "v2": 37.732, "v3": -37.228, "v4": 21.778, "amplitude": 39.024, "phase_angle": 14.787, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.920, "filter_rmsd": 0.003, "frame": { "rmsd": 0.003, "origin": [ 70.796, 44.780, 74.408 ], "x_axis": [ 0.395, -0.445, -0.804 ], "y_axis": [ 0.779, 0.626, 0.036 ], "z_axis": [ 0.487, -0.640, 0.594 ], "quaternion": [ 0.809, 0.209, 0.399, -0.379 ] } }, { "index": 168, "index_chain": 10, "chain_name": "B", "nt_resnum": 112, "nt_name": "G", "nt_code": "G", "nt_id": "///B/112", "linked_nts": [ "///B/111", "///B/113" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop,phosphate", "alpha": -52.837, "beta": 161.276, "gamma": 50.501, "delta": 79.826, "epsilon": -135.575, "zeta": -71.856, "epsilon_zeta": -63.719, "bb_type": "BI", "chi": -171.513, "glyco_bond": "anti", "C5prime_xyz": [ -1.622, 8.660, 1.145 ], "P_xyz": [ 0.939, 9.155, 1.371 ], "form": ".", "ssZp": 4.674, "Dp": 4.727, "splay_angle": 27.338, "splay_distance": 4.272, "splay_ratio": 0.238, "d22": null, "d64": null, "eta": 169.298, "theta": -132.052, "eta_prime": -178.875, "theta_prime": -128.395, "eta_base": -138.568, "theta_base": -81.338, "v0": 2.395, "v1": -25.000, "v2": 36.825, "v3": -36.419, "v4": 21.498, "amplitude": 38.137, "phase_angle": 15.073, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.781, "filter_rmsd": 0.005, "frame": { "rmsd": 0.005, "origin": [ 71.800, 41.302, 75.483 ], "x_axis": [ 0.648, 0.063, -0.759 ], "y_axis": [ 0.456, 0.766, 0.453 ], "z_axis": [ 0.610, -0.639, 0.468 ], "quaternion": [ 0.849, 0.322, 0.403, -0.116 ] } }, { "index": 169, "index_chain": 11, "chain_name": "B", "nt_resnum": 113, "nt_name": "A", "nt_code": "A", "nt_id": "///B/113", "linked_nts": [ "///B/112", "///B/114" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-canonical,non-pair-contact,helix,internal-loop", "alpha": -54.219, "beta": 162.641, "gamma": 52.876, "delta": 83.031, "epsilon": -157.501, "zeta": -129.693, "epsilon_zeta": -27.809, "bb_type": "--", "chi": -161.248, "glyco_bond": "anti", "C5prime_xyz": [ -1.537, 8.714, 0.627 ], "P_xyz": [ 1.044, 9.152, 0.663 ], "form": ".", "ssZp": 4.422, "Dp": 4.532, "splay_angle": 50.352, "splay_distance": 7.577, "splay_ratio": 0.425, "d22": null, "d64": null, "eta": 165.836, "theta": 161.120, "eta_prime": -170.111, "theta_prime": 164.284, "eta_base": -101.747, "theta_base": 166.894, "v0": 2.808, "v1": -23.971, "v2": 34.889, "v3": -34.211, "v4": 19.827, "amplitude": 35.995, "phase_angle": 14.244, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.812, "filter_rmsd": 0.038, "frame": { "rmsd": 0.004, "origin": [ 75.626, 39.691, 74.475 ], "x_axis": [ 0.741, 0.651, -0.166 ], "y_axis": [ -0.115, 0.367, 0.923 ], "z_axis": [ 0.662, -0.665, 0.346 ], "quaternion": [ 0.783, 0.507, 0.264, 0.244 ] } }, { "index": 170, "index_chain": 12, "chain_name": "B", "nt_resnum": 114, "nt_name": "A", "nt_code": "A", "nt_id": "///B/114", "linked_nts": [ "///B/113", "///B/115" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop", "alpha": -39.896, "beta": 157.470, "gamma": 43.736, "delta": 83.273, "epsilon": -131.512, "zeta": -82.957, "epsilon_zeta": -48.555, "bb_type": "BI", "chi": -163.014, "glyco_bond": "anti", "C5prime_xyz": [ -1.263, 8.676, 0.727 ], "P_xyz": [ 1.328, 8.765, 1.119 ], "form": "A", "ssZp": 4.369, "Dp": 4.642, "splay_angle": 21.073, "splay_distance": 3.354, "splay_ratio": 0.183, "d22": null, "d64": null, "eta": -171.169, "theta": -135.914, "eta_prime": 178.955, "theta_prime": -135.539, "eta_base": 167.262, "theta_base": -101.883, "v0": 2.130, "v1": -23.190, "v2": 34.222, "v3": -34.013, "v4": 20.149, "amplitude": 35.482, "phase_angle": 15.314, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "7a", "suiteness": 0.656, "filter_rmsd": 0.040, "frame": { "rmsd": 0.005, "origin": [ 73.529, 32.499, 75.613 ], "x_axis": [ 0.638, 0.659, -0.398 ], "y_axis": [ 0.013, 0.507, 0.862 ], "z_axis": [ 0.770, -0.555, 0.315 ], "quaternion": [ 0.784, 0.452, 0.372, 0.206 ] } }, { "index": 171, "index_chain": 13, "chain_name": "B", "nt_resnum": 115, "nt_name": "A", "nt_code": "A", "nt_id": "///B/115", "linked_nts": [ "///B/114", "///B/116" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,internal-loop", "alpha": -55.570, "beta": 157.501, "gamma": 45.649, "delta": 78.762, "epsilon": -141.962, "zeta": -75.437, "epsilon_zeta": -66.525, "bb_type": "BI", "chi": -161.035, "glyco_bond": "anti", "C5prime_xyz": [ -1.347, 8.686, 0.534 ], "P_xyz": [ 1.250, 8.991, 0.434 ], "form": "A", "ssZp": 4.469, "Dp": 4.733, "splay_angle": 23.599, "splay_distance": 3.784, "splay_ratio": 0.207, "d22": null, "d64": null, "eta": 156.953, "theta": -141.569, "eta_prime": 173.148, "theta_prime": -141.030, "eta_base": -135.019, "theta_base": -114.286, "v0": 3.894, "v1": -26.817, "v2": 38.275, "v3": -37.114, "v4": 20.942, "amplitude": 39.293, "phase_angle": 13.069, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.661, "filter_rmsd": 0.037, "frame": { "rmsd": 0.004, "origin": [ 76.713, 31.456, 75.768 ], "x_axis": [ 0.375, 0.914, 0.155 ], "y_axis": [ -0.274, -0.050, 0.960 ], "z_axis": [ 0.886, -0.402, 0.232 ], "quaternion": [ 0.624, 0.546, 0.293, 0.476 ] } }, { "index": 172, "index_chain": 14, "chain_name": "B", "nt_resnum": 116, "nt_name": "G", "nt_code": "G", "nt_id": "///B/116", "linked_nts": [ "///B/115", "///B/117" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop", "alpha": -57.569, "beta": 159.808, "gamma": 60.625, "delta": 77.984, "epsilon": -145.073, "zeta": -73.865, "epsilon_zeta": -71.209, "bb_type": "BI", "chi": -165.132, "glyco_bond": "anti", "C5prime_xyz": [ -1.512, 8.806, 0.780 ], "P_xyz": [ 1.037, 9.373, 0.558 ], "form": "A", "ssZp": 4.543, "Dp": 4.668, "splay_angle": 22.564, "splay_distance": 3.551, "splay_ratio": 0.196, "d22": null, "d64": null, "eta": 169.846, "theta": -145.350, "eta_prime": -173.903, "theta_prime": -146.458, "eta_base": -129.854, "theta_base": -111.823, "v0": 0.641, "v1": -24.075, "v2": 37.046, "v3": -37.669, "v4": 23.339, "amplitude": 38.877, "phase_angle": 17.657, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.811, "filter_rmsd": 0.003, "frame": { "rmsd": 0.003, "origin": [ 80.477, 31.804, 75.585 ], "x_axis": [ 0.058, 0.780, 0.623 ], "y_axis": [ -0.347, -0.569, 0.746 ], "z_axis": [ 0.936, -0.259, 0.237 ], "quaternion": [ 0.426, 0.589, 0.184, 0.661 ] } }, { "index": 173, "index_chain": 15, "chain_name": "B", "nt_resnum": 117, "nt_name": "G", "nt_code": "G", "nt_id": "///B/117", "linked_nts": [ "///B/116", "///B/118" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -62.272, "beta": 168.717, "gamma": 49.999, "delta": 78.672, "epsilon": -141.621, "zeta": -75.467, "epsilon_zeta": -66.154, "bb_type": "BI", "chi": -167.688, "glyco_bond": "anti", "C5prime_xyz": [ -1.298, 8.663, 0.941 ], "P_xyz": [ 1.279, 9.042, 1.151 ], "form": "A", "ssZp": 4.629, "Dp": 4.741, "splay_angle": 24.320, "splay_distance": 3.845, "splay_ratio": 0.214, "d22": null, "d64": null, "eta": 163.301, "theta": -143.873, "eta_prime": 176.849, "theta_prime": -141.187, "eta_base": -130.990, "theta_base": -112.881, "v0": 5.053, "v1": -27.844, "v2": 38.892, "v3": -37.003, "v4": 20.128, "amplitude": 39.681, "phase_angle": 11.445, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.935, "filter_rmsd": 0.002, "frame": { "rmsd": 0.002, "origin": [ 83.745, 32.725, 76.623 ], "x_axis": [ -0.324, 0.291, 0.900 ], "y_axis": [ -0.250, -0.944, 0.215 ], "z_axis": [ 0.912, -0.156, 0.379 ], "quaternion": [ 0.166, 0.557, 0.018, 0.813 ] } }, { "index": 174, "index_chain": 16, "chain_name": "B", "nt_resnum": 118, "nt_name": "G", "nt_code": "G", "nt_id": "///B/118", "linked_nts": [ "///B/117", "///B/119" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -53.288, "beta": 169.901, "gamma": 50.145, "delta": 78.711, "epsilon": -163.073, "zeta": -75.967, "epsilon_zeta": -87.106, "bb_type": "BI", "chi": -162.227, "glyco_bond": "anti", "C5prime_xyz": [ -1.396, 8.759, 0.602 ], "P_xyz": [ 1.171, 9.225, 0.739 ], "form": ".", "ssZp": 4.469, "Dp": 4.566, "splay_angle": 24.203, "splay_distance": 4.215, "splay_ratio": 0.224, "d22": null, "d64": null, "eta": 169.112, "theta": -131.193, "eta_prime": -174.444, "theta_prime": -142.077, "eta_base": -129.556, "theta_base": -128.748, "v0": 1.804, "v1": -24.872, "v2": 37.312, "v3": -37.322, "v4": 22.392, "amplitude": 38.826, "phase_angle": 16.050, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.844, "filter_rmsd": 0.003, "frame": { "rmsd": 0.003, "origin": [ 86.555, 34.009, 78.912 ], "x_axis": [ -0.467, -0.287, 0.837 ], "y_axis": [ 0.049, -0.953, -0.299 ], "z_axis": [ 0.883, -0.098, 0.459 ], "quaternion": [ -0.099, 0.507, -0.117, 0.848 ] } }, { "index": 175, "index_chain": 17, "chain_name": "B", "nt_resnum": 119, "nt_name": "G", "nt_code": "G", "nt_id": "///B/119", "linked_nts": [ "///B/118", "///B/120" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": 157.226, "beta": -167.827, "gamma": 174.780, "delta": 81.105, "epsilon": -108.368, "zeta": -81.975, "epsilon_zeta": -26.392, "bb_type": "--", "chi": 176.624, "glyco_bond": "anti", "C5prime_xyz": [ -1.276, 8.245, 1.853 ], "P_xyz": [ 0.420, 10.096, 1.191 ], "form": ".", "ssZp": 4.806, "Dp": 4.829, "splay_angle": 28.499, "splay_distance": 4.487, "splay_ratio": 0.249, "d22": null, "d64": null, "eta": 163.866, "theta": -144.161, "eta_prime": 173.117, "theta_prime": -135.163, "eta_base": -156.258, "theta_base": -81.480, "v0": 6.731, "v1": -27.979, "v2": 37.554, "v3": -34.720, "v4": 17.689, "amplitude": 37.992, "phase_angle": 8.706, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.924, "filter_rmsd": 0.006, "frame": { "rmsd": 0.006, "origin": [ 88.880, 35.805, 81.935 ], "x_axis": [ -0.596, -0.634, 0.494 ], "y_axis": [ 0.261, -0.734, -0.627 ], "z_axis": [ 0.760, -0.245, 0.602 ], "quaternion": [ -0.261, 0.366, -0.255, 0.856 ] } }, { "index": 176, "index_chain": 18, "chain_name": "B", "nt_resnum": 120, "nt_name": "U", "nt_code": "U", "nt_id": "///B/120", "linked_nts": [ "///B/119", "///B/121" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,A-minor", "alpha": -42.798, "beta": 147.707, "gamma": 52.637, "delta": 79.476, "epsilon": -151.743, "zeta": -87.498, "epsilon_zeta": -64.245, "bb_type": "BI", "chi": -163.853, "glyco_bond": "anti", "C5prime_xyz": [ -1.800, 8.793, 0.705 ], "P_xyz": [ 0.755, 9.316, 0.531 ], "form": "A", "ssZp": 4.477, "Dp": 4.564, "splay_angle": 20.438, "splay_distance": 3.277, "splay_ratio": 0.180, "d22": 5.160, "d64": 4.993, "eta": 158.164, "theta": -159.078, "eta_prime": -172.433, "theta_prime": -162.286, "eta_base": -99.361, "theta_base": -157.566, "v0": -1.349, "v1": -21.585, "v2": 35.006, "v3": -36.684, "v4": 23.918, "amplitude": 37.382, "phase_angle": 20.540, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1L", "suiteness": 0.695, "filter_rmsd": 0.104, "frame": { "rmsd": 0.003, "origin": [ 88.772, 32.657, 85.130 ], "x_axis": [ -0.196, -0.958, -0.212 ], "y_axis": [ 0.756, -0.010, -0.654 ], "z_axis": [ 0.624, -0.288, 0.726 ], "quaternion": [ 0.617, -0.148, 0.339, -0.695 ] } }, { "index": 177, "index_chain": 19, "chain_name": "B", "nt_resnum": 121, "nt_name": "C", "nt_code": "C", "nt_id": "///B/121", "linked_nts": [ "///B/120", "///B/122" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,internal-loop,cap-donor", "alpha": -59.867, "beta": 171.185, "gamma": 50.183, "delta": 80.319, "epsilon": -150.541, "zeta": -75.303, "epsilon_zeta": -75.237, "bb_type": "BI", "chi": -146.432, "glyco_bond": "anti", "C5prime_xyz": [ -1.364, 8.806, -0.301 ], "P_xyz": [ 1.184, 9.287, -0.619 ], "form": ".", "ssZp": 4.014, "Dp": 4.629, "splay_angle": 66.332, "splay_distance": 11.384, "splay_ratio": 0.554, "d22": null, "d64": null, "eta": 169.256, "theta": -155.153, "eta_prime": 174.775, "theta_prime": -155.682, "eta_base": -170.110, "theta_base": -158.513, "v0": 0.349, "v1": -22.945, "v2": 35.550, "v3": -36.293, "v4": 22.545, "amplitude": 37.379, "phase_angle": 17.998, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.785, "filter_rmsd": 0.063, "frame": { "rmsd": 0.003, "origin": [ 89.027, 32.793, 88.395 ], "x_axis": [ 0.136, -0.908, -0.396 ], "y_axis": [ 0.913, 0.270, -0.306 ], "z_axis": [ 0.385, -0.320, 0.866 ], "quaternion": [ 0.754, 0.005, 0.259, -0.604 ] } }, { "index": 178, "index_chain": 20, "chain_name": "B", "nt_resnum": 122, "nt_name": "A", "nt_code": "A", "nt_id": "///B/122", "linked_nts": [ "///B/121", "///B/123" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,anti,~C2'-endo,non-stack,internal-loop,cap-donor", "alpha": -160.589, "beta": 131.517, "gamma": -157.678, "delta": 150.121, "epsilon": -95.301, "zeta": 112.900, "epsilon_zeta": 151.799, "bb_type": "--", "chi": -168.628, "glyco_bond": "anti", "C5prime_xyz": [ -2.506, 8.404, 1.468 ], "P_xyz": [ -2.309, 10.996, 1.618 ], "form": ".", "ssZp": 0.224, "Dp": 0.926, "splay_angle": 49.685, "splay_distance": 7.748, "splay_ratio": 0.423, "d22": null, "d64": null, "eta": -110.733, "theta": 60.790, "eta_prime": -128.642, "theta_prime": 70.544, "eta_base": -146.860, "theta_base": 42.869, "v0": -21.669, "v1": 37.200, "v2": -37.673, "v3": 26.105, "v4": -2.966, "amplitude": 38.897, "phase_angle": 165.587, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.041, "frame": { "rmsd": 0.010, "origin": [ 91.988, 31.697, 99.332 ], "x_axis": [ -0.680, -0.601, -0.421 ], "y_axis": [ 0.267, 0.332, -0.905 ], "z_axis": [ 0.683, -0.727, -0.066 ], "quaternion": [ 0.383, -0.116, 0.721, -0.566 ] } }, { "index": 179, "index_chain": 21, "chain_name": "B", "nt_resnum": 123, "nt_name": "A", "nt_code": "A", "nt_id": "///B/123", "linked_nts": [ "///B/122", "///B/124" ], "nt_type": "RNA", "dbn": ".", "summary": "~C2'-endo,BII,non-canonical,non-pair-contact,helix-end,internal-loop,cap-acceptor", "alpha": -113.321, "beta": 147.901, "gamma": 62.296, "delta": 139.247, "epsilon": -96.977, "zeta": 125.179, "epsilon_zeta": 137.844, "bb_type": "BII", "chi": -79.474, "glyco_bond": "--", "C5prime_xyz": [ -3.289, 7.323, -2.758 ], "P_xyz": [ -1.164, 7.405, -4.259 ], "form": ".", "ssZp": 0.737, "Dp": 1.045, "splay_angle": 34.687, "splay_distance": 6.088, "splay_ratio": 0.298, "d22": null, "d64": null, "eta": 178.744, "theta": 153.018, "eta_prime": -173.799, "theta_prime": 125.643, "eta_base": 154.394, "theta_base": 154.165, "v0": -25.901, "v1": 36.585, "v2": -32.791, "v3": 18.758, "v4": 4.213, "amplitude": 36.303, "phase_angle": 154.590, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "0b", "suiteness": 0.320, "filter_rmsd": 0.040, "frame": { "rmsd": 0.007, "origin": [ 90.832, 35.537, 92.702 ], "x_axis": [ -0.392, -0.333, 0.858 ], "y_axis": [ 0.560, 0.653, 0.510 ], "z_axis": [ -0.730, 0.680, -0.070 ], "quaternion": [ 0.546, -0.078, -0.727, -0.409 ] } }, { "index": 180, "index_chain": 22, "chain_name": "B", "nt_resnum": 124, "nt_name": "C", "nt_code": "C", "nt_id": "///B/124", "linked_nts": [ "///B/123", "///B/125" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-canonical,non-pair-contact,helix-end,multiplet,internal-loop,cap-acceptor", "alpha": 84.970, "beta": -141.097, "gamma": 177.565, "delta": 84.274, "epsilon": -89.470, "zeta": -140.235, "epsilon_zeta": 50.764, "bb_type": "--", "chi": -168.829, "glyco_bond": "anti", "C5prime_xyz": [ -1.780, 8.796, 0.985 ], "P_xyz": [ -0.035, 10.108, -0.464 ], "form": ".", "ssZp": 3.859, "Dp": 4.250, "splay_angle": 36.214, "splay_distance": 5.868, "splay_ratio": 0.330, "d22": null, "d64": null, "eta": 178.082, "theta": 157.577, "eta_prime": 160.685, "theta_prime": 157.110, "eta_base": -173.811, "theta_base": 131.726, "v0": -4.481, "v1": -16.577, "v2": 29.984, "v3": -33.498, "v4": 23.957, "amplitude": 33.410, "phase_angle": 26.175, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23t", "cluster": "0i", "suiteness": 0.348, "filter_rmsd": 0.066, "frame": { "rmsd": 0.009, "origin": [ 89.871, 38.516, 87.480 ], "x_axis": [ -0.574, 0.084, 0.814 ], "y_axis": [ 0.716, 0.534, 0.450 ], "z_axis": [ -0.397, 0.841, -0.367 ], "quaternion": [ -0.385, 0.254, 0.787, 0.410 ] } }, { "index": 181, "index_chain": 23, "chain_name": "B", "nt_resnum": 125, "nt_name": "A", "nt_code": "A", "nt_id": "///B/125", "linked_nts": [ "///B/124", "///B/126" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,~C3'-endo,non-stack,non-pair-contact,internal-loop,A-minor", "alpha": -84.835, "beta": 146.327, "gamma": 13.718, "delta": 82.515, "epsilon": -119.341, "zeta": -52.220, "epsilon_zeta": -67.121, "bb_type": "--", "chi": 94.496, "glyco_bond": "--", "C5prime_xyz": [ -4.441, 5.968, 2.958 ], "P_xyz": [ -4.846, 4.026, 4.676 ], "form": ".", "ssZp": 0.489, "Dp": 4.030, "splay_angle": 53.802, "splay_distance": 7.991, "splay_ratio": 0.453, "d22": null, "d64": null, "eta": 131.751, "theta": -98.570, "eta_prime": 124.768, "theta_prime": -85.925, "eta_base": 107.629, "theta_base": -63.353, "v0": -14.283, "v1": -7.966, "v2": 25.469, "v3": -34.520, "v4": 30.904, "amplitude": 34.526, "phase_angle": 42.466, "puckering": "C4'-exo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.045, "frame": { "rmsd": 0.014, "origin": [ 93.567, 39.529, 83.036 ], "x_axis": [ 0.459, -0.866, -0.197 ], "y_axis": [ 0.773, 0.499, -0.391 ], "z_axis": [ 0.437, 0.027, 0.899 ], "quaternion": [ 0.845, -0.123, 0.188, -0.485 ] } }, { "index": 182, "index_chain": 24, "chain_name": "B", "nt_resnum": 126, "nt_name": "G", "nt_code": "G", "nt_id": "///B/126", "linked_nts": [ "///B/125", "///B/127" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop", "alpha": -63.791, "beta": 170.202, "gamma": 73.085, "delta": 83.279, "epsilon": -139.430, "zeta": -69.767, "epsilon_zeta": -69.663, "bb_type": "BI", "chi": -172.157, "glyco_bond": "anti", "C5prime_xyz": [ -1.367, 8.569, 1.231 ], "P_xyz": [ 1.247, 8.881, 1.141 ], "form": "A", "ssZp": 4.648, "Dp": 4.685, "splay_angle": 26.454, "splay_distance": 4.149, "splay_ratio": 0.231, "d22": null, "d64": null, "eta": 175.466, "theta": -130.483, "eta_prime": -146.353, "theta_prime": -130.855, "eta_base": -98.136, "theta_base": -92.023, "v0": 3.587, "v1": -24.982, "v2": 35.564, "v3": -34.487, "v4": 19.581, "amplitude": 36.517, "phase_angle": 13.113, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.225, "filter_rmsd": 0.004, "frame": { "rmsd": 0.004, "origin": [ 90.463, 42.861, 89.602 ], "x_axis": [ 0.659, 0.496, 0.566 ], "y_axis": [ 0.385, 0.425, -0.819 ], "z_axis": [ -0.647, 0.757, 0.089 ], "quaternion": [ 0.737, -0.535, -0.411, 0.038 ] } }, { "index": 183, "index_chain": 25, "chain_name": "B", "nt_resnum": 127, "nt_name": "C", "nt_code": "C", "nt_id": "///B/127", "linked_nts": [ "///B/126", "///B/128" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop", "alpha": -58.880, "beta": 171.673, "gamma": 50.083, "delta": 81.383, "epsilon": -137.111, "zeta": -76.623, "epsilon_zeta": -60.488, "bb_type": "BI", "chi": -162.955, "glyco_bond": "anti", "C5prime_xyz": [ -1.338, 8.745, 0.723 ], "P_xyz": [ 1.238, 9.124, 1.069 ], "form": "A", "ssZp": 4.463, "Dp": 4.671, "splay_angle": 26.873, "splay_distance": 4.259, "splay_ratio": 0.233, "d22": 4.057, "d64": 3.915, "eta": 167.607, "theta": -139.560, "eta_prime": -173.563, "theta_prime": -136.253, "eta_base": -114.143, "theta_base": -105.046, "v0": 3.012, "v1": -24.666, "v2": 35.802, "v3": -35.034, "v4": 20.137, "amplitude": 36.900, "phase_angle": 14.010, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.922, "filter_rmsd": 0.064, "frame": { "rmsd": 0.003, "origin": [ 89.803, 46.340, 91.764 ], "x_axis": [ 0.779, 0.590, -0.214 ], "y_axis": [ -0.242, -0.032, -0.970 ], "z_axis": [ -0.579, 0.807, 0.118 ], "quaternion": [ 0.683, -0.650, -0.134, 0.305 ] } }, { "index": 184, "index_chain": 26, "chain_name": "B", "nt_resnum": 128, "nt_name": "C", "nt_code": "C", "nt_id": "///B/128", "linked_nts": [ "///B/127", "///B/129" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -60.482, "beta": 178.530, "gamma": 41.413, "delta": 78.752, "epsilon": -146.775, "zeta": -76.033, "epsilon_zeta": -70.742, "bb_type": "BI", "chi": -162.890, "glyco_bond": "anti", "C5prime_xyz": [ -1.335, 8.727, 0.714 ], "P_xyz": [ 1.169, 9.119, 1.385 ], "form": "A", "ssZp": 4.427, "Dp": 4.605, "splay_angle": 23.638, "splay_distance": 3.757, "splay_ratio": 0.208, "d22": null, "d64": null, "eta": 161.350, "theta": -149.781, "eta_prime": 173.684, "theta_prime": -146.050, "eta_base": -141.426, "theta_base": -124.681, "v0": 2.548, "v1": -24.643, "v2": 36.525, "v3": -36.048, "v4": 21.154, "amplitude": 37.804, "phase_angle": 14.948, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.702, "filter_rmsd": 0.065, "frame": { "rmsd": 0.010, "origin": [ 89.233, 50.485, 92.559 ], "x_axis": [ 0.640, 0.076, -0.765 ], "y_axis": [ -0.678, -0.412, -0.609 ], "z_axis": [ -0.361, 0.908, -0.212 ], "quaternion": [ 0.504, -0.752, 0.200, 0.374 ] } }, { "index": 185, "index_chain": 27, "chain_name": "B", "nt_resnum": 129, "nt_name": "G", "nt_code": "G", "nt_id": "///B/129", "linked_nts": [ "///B/128", "///B/130" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -63.188, "beta": 174.417, "gamma": 48.471, "delta": 76.167, "epsilon": 77.379, "zeta": 61.167, "epsilon_zeta": 16.212, "bb_type": "--", "chi": -171.383, "glyco_bond": "anti", "C5prime_xyz": [ -1.601, 8.593, 1.229 ], "P_xyz": [ 0.868, 9.150, 1.798 ], "form": ".", "ssZp": 3.567, "Dp": 3.455, "splay_angle": 18.318, "splay_distance": 2.934, "splay_ratio": 0.159, "d22": null, "d64": null, "eta": -176.032, "theta": -140.864, "eta_prime": -163.988, "theta_prime": -143.391, "eta_base": -135.669, "theta_base": -121.880, "v0": 1.133, "v1": -23.564, "v2": 35.891, "v3": -36.149, "v4": 22.254, "amplitude": 37.525, "phase_angle": 16.969, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.890, "filter_rmsd": 0.007, "frame": { "rmsd": 0.007, "origin": [ 89.611, 54.217, 92.347 ], "x_axis": [ 0.364, -0.498, -0.788 ], "y_axis": [ -0.898, -0.411, -0.155 ], "z_axis": [ -0.246, 0.764, -0.596 ], "quaternion": [ -0.299, 0.770, -0.453, -0.336 ] } }, { "index": 186, "index_chain": 28, "chain_name": "B", "nt_resnum": 130, "nt_name": "U", "nt_code": "U", "nt_id": "///B/130", "linked_nts": [ "///B/129", "///B/131" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge,splayed-apart", "alpha": 139.892, "beta": 160.459, "gamma": 156.433, "delta": 143.470, "epsilon": -64.602, "zeta": -83.550, "epsilon_zeta": 18.948, "bb_type": "--", "chi": -134.370, "glyco_bond": "anti", "C5prime_xyz": [ -1.078, 8.479, -0.190 ], "P_xyz": [ 1.116, 9.067, -1.547 ], "form": ".", "ssZp": -0.108, "Dp": 1.035, "splay_angle": 138.513, "splay_distance": 18.572, "splay_ratio": 0.935, "d22": null, "d64": null, "eta": -120.598, "theta": -105.550, "eta_prime": -128.464, "theta_prime": -127.554, "eta_base": -110.945, "theta_base": -142.653, "v0": 2.369, "v1": 17.572, "v2": -29.549, "v3": 31.822, "v4": -21.714, "amplitude": 32.067, "phase_angle": 202.856, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.102, "frame": { "rmsd": 0.014, "origin": [ 89.878, 56.958, 91.333 ], "x_axis": [ -0.249, -0.472, -0.846 ], "y_axis": [ -0.968, 0.156, 0.198 ], "z_axis": [ 0.039, 0.868, -0.495 ], "quaternion": [ 0.321, -0.522, 0.689, 0.387 ] } }, { "index": 187, "index_chain": 29, "chain_name": "B", "nt_resnum": 131, "nt_name": "A", "nt_code": "A", "nt_id": "///B/131", "linked_nts": [ "///B/130", "///B/132" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,anti,~C2'-endo,non-stack,non-pair-contact,bulge,splayed-apart", "alpha": 41.696, "beta": -110.895, "gamma": 39.444, "delta": 132.822, "epsilon": 48.423, "zeta": 150.693, "epsilon_zeta": -102.270, "bb_type": "--", "chi": -103.306, "glyco_bond": "anti", "C5prime_xyz": [ -1.589, 7.905, -2.066 ], "P_xyz": [ 0.157, 9.351, -0.603 ], "form": ".", "ssZp": 0.181, "Dp": 0.323, "splay_angle": 155.903, "splay_distance": 18.418, "splay_ratio": 0.978, "d22": null, "d64": null, "eta": -69.749, "theta": -23.694, "eta_prime": 9.960, "theta_prime": -67.640, "eta_base": 25.516, "theta_base": -39.643, "v0": -8.659, "v1": 19.800, "v2": -22.896, "v3": 18.498, "v4": -6.282, "amplitude": 22.927, "phase_angle": 177.011, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.035, "frame": { "rmsd": 0.012, "origin": [ 80.539, 68.916, 102.043 ], "x_axis": [ -0.397, -0.519, 0.757 ], "y_axis": [ 0.279, -0.854, -0.440 ], "z_axis": [ 0.874, 0.036, 0.484 ], "quaternion": [ -0.241, 0.493, -0.122, 0.827 ] } }, { "index": 188, "index_chain": 30, "chain_name": "B", "nt_resnum": 132, "nt_name": "C", "nt_code": "C", "nt_id": "///B/132", "linked_nts": [ "///B/131", "///B/133" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge,phosphate,splayed-apart", "alpha": -61.316, "beta": 161.668, "gamma": 37.129, "delta": 77.130, "epsilon": -153.366, "zeta": -78.788, "epsilon_zeta": -74.578, "bb_type": "BI", "chi": -162.619, "glyco_bond": "anti", "C5prime_xyz": [ -1.575, 8.855, 0.642 ], "P_xyz": [ 0.905, 9.475, 1.153 ], "form": "A", "ssZp": 4.447, "Dp": 4.574, "splay_angle": 26.130, "splay_distance": 4.097, "splay_ratio": 0.227, "d22": null, "d64": null, "eta": 178.524, "theta": -156.731, "eta_prime": -130.848, "theta_prime": -153.934, "eta_base": -122.202, "theta_base": -129.939, "v0": -1.204, "v1": -22.282, "v2": 36.031, "v3": -37.807, "v4": 24.617, "amplitude": 38.454, "phase_angle": 20.448, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.062, "frame": { "rmsd": 0.003, "origin": [ 90.518, 59.484, 89.768 ], "x_axis": [ -0.866, -0.351, -0.357 ], "y_axis": [ -0.501, 0.592, 0.632 ], "z_axis": [ -0.011, 0.726, -0.688 ], "quaternion": [ 0.098, -0.240, 0.887, 0.383 ] } }, { "index": 189, "index_chain": 31, "chain_name": "B", "nt_resnum": 133, "nt_name": "A", "nt_code": "A", "nt_id": "///B/133", "linked_nts": [ "///B/132", "///B/134" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -60.303, "beta": 171.995, "gamma": 51.760, "delta": 79.793, "epsilon": -147.324, "zeta": -82.232, "epsilon_zeta": -65.092, "bb_type": "BI", "chi": -168.979, "glyco_bond": "anti", "C5prime_xyz": [ -1.476, 8.609, 1.036 ], "P_xyz": [ 1.088, 8.998, 1.434 ], "form": "A", "ssZp": 4.625, "Dp": 4.675, "splay_angle": 23.519, "splay_distance": 3.669, "splay_ratio": 0.206, "d22": null, "d64": null, "eta": 169.934, "theta": -151.809, "eta_prime": 179.102, "theta_prime": -150.403, "eta_base": -146.873, "theta_base": -127.961, "v0": 3.035, "v1": -25.398, "v2": 36.878, "v3": -36.159, "v4": 20.896, "amplitude": 38.032, "phase_angle": 14.154, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.902, "filter_rmsd": 0.037, "frame": { "rmsd": 0.003, "origin": [ 90.988, 61.317, 86.135 ], "x_axis": [ -0.984, -0.148, 0.100 ], "y_axis": [ -0.018, 0.637, 0.771 ], "z_axis": [ -0.178, 0.756, -0.629 ], "quaternion": [ -0.077, -0.046, 0.901, 0.423 ] } }, { "index": 190, "index_chain": 32, "chain_name": "B", "nt_resnum": 134, "nt_name": "G", "nt_code": "G", "nt_id": "///B/134", "linked_nts": [ "///B/133", "///B/135" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop", "alpha": -54.545, "beta": 162.369, "gamma": 54.976, "delta": 81.035, "epsilon": -147.420, "zeta": -79.627, "epsilon_zeta": -67.793, "bb_type": "BI", "chi": -171.882, "glyco_bond": "anti", "C5prime_xyz": [ -1.453, 8.650, 1.175 ], "P_xyz": [ 1.131, 9.005, 1.405 ], "form": "A", "ssZp": 4.614, "Dp": 4.640, "splay_angle": 22.374, "splay_distance": 3.510, "splay_ratio": 0.196, "d22": null, "d64": null, "eta": 171.832, "theta": -149.657, "eta_prime": -176.182, "theta_prime": -150.240, "eta_base": -140.181, "theta_base": -130.764, "v0": 2.398, "v1": -24.298, "v2": 35.731, "v3": -35.325, "v4": 20.761, "amplitude": 36.985, "phase_angle": 14.963, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.817, "filter_rmsd": 0.002, "frame": { "rmsd": 0.002, "origin": [ 90.053, 62.510, 82.793 ], "x_axis": [ -0.848, 0.137, 0.511 ], "y_axis": [ 0.471, 0.637, 0.610 ], "z_axis": [ -0.242, 0.758, -0.605 ], "quaternion": [ -0.214, 0.173, 0.879, 0.389 ] } }, { "index": 191, "index_chain": 33, "chain_name": "B", "nt_resnum": 135, "nt_name": "U", "nt_code": "U", "nt_id": "///B/135", "linked_nts": [ "///B/134", "///B/136" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop", "alpha": -58.628, "beta": 168.273, "gamma": 52.287, "delta": 80.103, "epsilon": -136.535, "zeta": -85.276, "epsilon_zeta": -51.259, "bb_type": "BI", "chi": -163.734, "glyco_bond": "anti", "C5prime_xyz": [ -1.326, 8.681, 0.732 ], "P_xyz": [ 1.257, 9.075, 0.870 ], "form": "A", "ssZp": 4.510, "Dp": 4.728, "splay_angle": 23.620, "splay_distance": 3.691, "splay_ratio": 0.205, "d22": null, "d64": null, "eta": 172.017, "theta": -148.896, "eta_prime": -177.814, "theta_prime": -147.298, "eta_base": -145.312, "theta_base": -122.509, "v0": 3.342, "v1": -25.695, "v2": 37.046, "v3": -36.158, "v4": 20.684, "amplitude": 38.132, "phase_angle": 13.706, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.918, "filter_rmsd": 0.106, "frame": { "rmsd": 0.003, "origin": [ 88.406, 63.679, 79.923 ], "x_axis": [ -0.512, 0.464, 0.723 ], "y_axis": [ 0.811, 0.539, 0.228 ], "z_axis": [ -0.284, 0.703, -0.652 ], "quaternion": [ -0.307, 0.388, 0.822, 0.283 ] } }, { "index": 192, "index_chain": 34, "chain_name": "B", "nt_resnum": 136, "nt_name": "A", "nt_code": "A", "nt_id": "///B/136", "linked_nts": [ "///B/135", "///B/137" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop", "alpha": -61.897, "beta": 153.581, "gamma": 62.220, "delta": 80.771, "epsilon": -142.992, "zeta": -75.214, "epsilon_zeta": -67.777, "bb_type": "BI", "chi": -171.807, "glyco_bond": "anti", "C5prime_xyz": [ -1.525, 8.578, 1.203 ], "P_xyz": [ 1.057, 8.977, 1.003 ], "form": "A", "ssZp": 4.650, "Dp": 4.682, "splay_angle": 23.084, "splay_distance": 3.573, "splay_ratio": 0.202, "d22": null, "d64": null, "eta": 165.107, "theta": -140.004, "eta_prime": 179.709, "theta_prime": -141.251, "eta_base": -140.187, "theta_base": -103.306, "v0": 2.931, "v1": -25.166, "v2": 36.590, "v3": -35.892, "v4": 20.821, "amplitude": 37.752, "phase_angle": 14.258, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.655, "filter_rmsd": 0.037, "frame": { "rmsd": 0.002, "origin": [ 86.118, 65.832, 77.987 ], "x_axis": [ 0.013, 0.550, 0.835 ], "y_axis": [ 0.949, 0.256, -0.184 ], "z_axis": [ -0.315, 0.795, -0.519 ], "quaternion": [ -0.433, 0.565, 0.664, 0.230 ] } }, { "index": 193, "index_chain": 35, "chain_name": "B", "nt_resnum": 137, "nt_name": "C", "nt_code": "C", "nt_id": "///B/137", "linked_nts": [ "///B/136", "///B/138" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,A-minor", "alpha": -60.565, "beta": 161.214, "gamma": 59.363, "delta": 81.403, "epsilon": -149.128, "zeta": -69.155, "epsilon_zeta": -79.974, "bb_type": "BI", "chi": -165.869, "glyco_bond": "anti", "C5prime_xyz": [ -1.304, 8.696, 0.881 ], "P_xyz": [ 1.303, 8.967, 0.750 ], "form": "A", "ssZp": 4.556, "Dp": 4.648, "splay_angle": 21.850, "splay_distance": 3.644, "splay_ratio": 0.197, "d22": 4.612, "d64": 4.697, "eta": 166.687, "theta": -141.526, "eta_prime": -174.115, "theta_prime": -136.633, "eta_base": -114.331, "theta_base": -132.198, "v0": 4.358, "v1": -26.139, "v2": 36.826, "v3": -35.224, "v4": 19.460, "amplitude": 37.655, "phase_angle": 12.047, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.874, "filter_rmsd": 0.064, "frame": { "rmsd": 0.003, "origin": [ 84.372, 68.946, 78.137 ], "x_axis": [ 0.611, 0.645, 0.459 ], "y_axis": [ 0.664, -0.102, -0.741 ], "z_axis": [ -0.432, 0.757, -0.491 ], "quaternion": [ 0.505, -0.742, -0.441, -0.009 ] } }, { "index": 194, "index_chain": 36, "chain_name": "B", "nt_resnum": 138, "nt_name": "C", "nt_code": "C", "nt_id": "///B/138", "linked_nts": [ "///B/137", "///B/139" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,junction-loop", "alpha": -60.788, "beta": -168.617, "gamma": 59.177, "delta": 143.810, "epsilon": -139.064, "zeta": 105.300, "epsilon_zeta": 115.636, "bb_type": "--", "chi": -120.973, "glyco_bond": "anti", "C5prime_xyz": [ -2.070, 8.639, -1.182 ], "P_xyz": [ 0.195, 9.744, -0.467 ], "form": ".", "ssZp": 1.827, "Dp": 1.801, "splay_angle": 84.785, "splay_distance": 12.148, "splay_ratio": 0.679, "d22": null, "d64": null, "eta": -170.752, "theta": 95.599, "eta_prime": -145.721, "theta_prime": 88.288, "eta_base": -136.097, "theta_base": 129.325, "v0": -23.103, "v1": 36.001, "v2": -34.486, "v3": 22.027, "v4": 0.465, "amplitude": 36.580, "phase_angle": 160.520, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1b", "suiteness": 0.895, "filter_rmsd": 0.063, "frame": { "rmsd": 0.003, "origin": [ 81.972, 71.665, 78.495 ], "x_axis": [ 0.932, 0.259, 0.252 ], "y_axis": [ 0.297, -0.153, -0.943 ], "z_axis": [ -0.206, 0.954, -0.219 ], "quaternion": [ 0.625, -0.759, -0.183, -0.015 ] } }, { "index": 195, "index_chain": 37, "chain_name": "B", "nt_resnum": 139, "nt_name": "A", "nt_code": "A", "nt_id": "///B/139", "linked_nts": [ "///B/138", "///B/140" ], "nt_type": "RNA", "dbn": ".", "summary": "~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,multiplet,junction-loop,phosphate", "alpha": -67.557, "beta": 150.670, "gamma": 44.156, "delta": 85.050, "epsilon": -134.308, "zeta": -80.916, "epsilon_zeta": -53.393, "bb_type": "BI", "chi": 177.027, "glyco_bond": "--", "C5prime_xyz": [ -1.101, 8.077, 1.869 ], "P_xyz": [ 1.454, 7.567, 2.238 ], "form": "A", "ssZp": 4.776, "Dp": 4.768, "splay_angle": 27.002, "splay_distance": 4.063, "splay_ratio": 0.236, "d22": null, "d64": null, "eta": -178.408, "theta": -130.852, "eta_prime": -172.530, "theta_prime": -129.864, "eta_base": -170.761, "theta_base": -109.249, "v0": 8.904, "v1": -28.435, "v2": 36.137, "v3": -32.018, "v4": 14.643, "amplitude": 36.264, "phase_angle": 4.791, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "0a", "suiteness": 0.298, "filter_rmsd": 0.039, "frame": { "rmsd": 0.005, "origin": [ 73.224, 65.698, 72.542 ], "x_axis": [ 0.008, 0.727, 0.686 ], "y_axis": [ 0.856, 0.350, -0.380 ], "z_axis": [ -0.517, 0.590, -0.620 ], "quaternion": [ -0.429, 0.565, 0.700, 0.075 ] } }, { "index": 196, "index_chain": 38, "chain_name": "B", "nt_resnum": 140, "nt_name": "A", "nt_code": "A", "nt_id": "///B/140", "linked_nts": [ "///B/139", "///B/141" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,junction-loop", "alpha": -52.430, "beta": 164.954, "gamma": 53.179, "delta": 81.483, "epsilon": -130.372, "zeta": -63.396, "epsilon_zeta": -66.976, "bb_type": "BI", "chi": -171.599, "glyco_bond": "anti", "C5prime_xyz": [ -1.292, 8.518, 1.170 ], "P_xyz": [ 1.317, 8.712, 1.349 ], "form": ".", "ssZp": 4.683, "Dp": 4.779, "splay_angle": 32.827, "splay_distance": 5.109, "splay_ratio": 0.284, "d22": null, "d64": null, "eta": 174.903, "theta": -120.358, "eta_prime": -170.000, "theta_prime": -117.682, "eta_base": -129.104, "theta_base": -75.609, "v0": 5.654, "v1": -27.662, "v2": 37.982, "v3": -35.710, "v4": 18.960, "amplitude": 38.610, "phase_angle": 10.352, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.750, "filter_rmsd": 0.038, "frame": { "rmsd": 0.002, "origin": [ 69.844, 67.776, 71.669 ], "x_axis": [ 0.452, 0.852, 0.263 ], "y_axis": [ 0.702, -0.158, -0.695 ], "z_axis": [ -0.551, 0.498, -0.670 ], "quaternion": [ -0.395, 0.755, 0.515, -0.095 ] } }, { "index": 197, "index_chain": 39, "chain_name": "B", "nt_resnum": 141, "nt_name": "G", "nt_code": "G", "nt_id": "///B/141", "linked_nts": [ "///B/140", "///B/142" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,junction-loop", "alpha": -59.861, "beta": 168.110, "gamma": 53.575, "delta": 79.230, "epsilon": -140.328, "zeta": -76.716, "epsilon_zeta": -63.612, "bb_type": "BI", "chi": -169.637, "glyco_bond": "anti", "C5prime_xyz": [ -1.429, 8.672, 1.018 ], "P_xyz": [ 1.144, 9.117, 1.212 ], "form": "A", "ssZp": 4.651, "Dp": 4.730, "splay_angle": 25.913, "splay_distance": 4.006, "splay_ratio": 0.225, "d22": null, "d64": null, "eta": 163.681, "theta": -141.357, "eta_prime": -171.488, "theta_prime": -138.333, "eta_base": -104.125, "theta_base": -100.886, "v0": 2.545, "v1": -25.490, "v2": 37.454, "v3": -37.041, "v4": 21.763, "amplitude": 38.765, "phase_angle": 14.945, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.784, "filter_rmsd": 0.004, "frame": { "rmsd": 0.004, "origin": [ 70.000, 72.636, 70.103 ], "x_axis": [ 0.890, 0.312, -0.333 ], "y_axis": [ 0.032, -0.771, -0.636 ], "z_axis": [ -0.455, 0.556, -0.696 ], "quaternion": [ -0.325, 0.916, 0.094, -0.215 ] } }, { "index": 198, "index_chain": 40, "chain_name": "B", "nt_resnum": 142, "nt_name": "U", "nt_code": "U", "nt_id": "///B/142", "linked_nts": [ "///B/141", "///B/143" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -53.299, "beta": 165.036, "gamma": 50.755, "delta": 79.099, "epsilon": -139.279, "zeta": -81.802, "epsilon_zeta": -57.478, "bb_type": "BI", "chi": -165.699, "glyco_bond": "anti", "C5prime_xyz": [ -1.343, 8.654, 0.855 ], "P_xyz": [ 1.264, 8.942, 1.021 ], "form": "A", "ssZp": 4.562, "Dp": 4.721, "splay_angle": 22.348, "splay_distance": 3.540, "splay_ratio": 0.196, "d22": 4.264, "d64": 4.354, "eta": 169.571, "theta": -145.540, "eta_prime": -174.268, "theta_prime": -143.738, "eta_base": -120.534, "theta_base": -118.754, "v0": 3.336, "v1": -26.057, "v2": 37.734, "v3": -36.826, "v4": 21.060, "amplitude": 38.853, "phase_angle": 13.785, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.833, "filter_rmsd": 0.105, "frame": { "rmsd": 0.002, "origin": [ 70.331, 75.713, 67.559 ], "x_axis": [ 0.719, -0.327, -0.614 ], "y_axis": [ -0.588, -0.757, -0.285 ], "z_axis": [ -0.371, 0.566, -0.736 ], "quaternion": [ -0.238, 0.896, -0.255, -0.275 ] } }, { "index": 199, "index_chain": 41, "chain_name": "B", "nt_resnum": 143, "nt_name": "C", "nt_code": "C", "nt_id": "///B/143", "linked_nts": [ "///B/142", "///B/144" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -55.256, "beta": 161.650, "gamma": 56.380, "delta": 80.030, "epsilon": -145.527, "zeta": -79.537, "epsilon_zeta": -65.990, "bb_type": "BI", "chi": -161.732, "glyco_bond": "anti", "C5prime_xyz": [ -1.422, 8.801, 0.636 ], "P_xyz": [ 1.166, 9.210, 0.587 ], "form": "A", "ssZp": 4.436, "Dp": 4.628, "splay_angle": 21.810, "splay_distance": 3.443, "splay_ratio": 0.189, "d22": 4.265, "d64": 4.021, "eta": 170.459, "theta": -147.092, "eta_prime": -175.820, "theta_prime": -146.721, "eta_base": -136.698, "theta_base": -119.706, "v0": 1.718, "v1": -24.188, "v2": 36.204, "v3": -36.260, "v4": 21.802, "amplitude": 37.681, "phase_angle": 16.097, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.807, "filter_rmsd": 0.063, "frame": { "rmsd": 0.003, "origin": [ 70.777, 78.174, 65.054 ], "x_axis": [ 0.331, -0.735, -0.591 ], "y_axis": [ -0.913, -0.407, -0.005 ], "z_axis": [ -0.237, 0.542, -0.806 ], "quaternion": [ -0.171, 0.798, -0.517, -0.260 ] } }, { "index": 200, "index_chain": 42, "chain_name": "B", "nt_resnum": 144, "nt_name": "U", "nt_code": "U", "nt_id": "///B/144", "linked_nts": [ "///B/143", "///B/145" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -58.259, "beta": 166.866, "gamma": 51.340, "delta": 81.075, "epsilon": -141.817, "zeta": -79.842, "epsilon_zeta": -61.974, "bb_type": "BI", "chi": -156.882, "glyco_bond": "anti", "C5prime_xyz": [ -1.361, 8.733, 0.363 ], "P_xyz": [ 1.242, 9.088, 0.378 ], "form": "A", "ssZp": 4.329, "Dp": 4.672, "splay_angle": 21.438, "splay_distance": 3.408, "splay_ratio": 0.186, "d22": 4.040, "d64": 3.900, "eta": 168.269, "theta": -144.675, "eta_prime": -179.469, "theta_prime": -143.987, "eta_base": -139.134, "theta_base": -114.332, "v0": 3.304, "v1": -25.126, "v2": 36.183, "v3": -35.298, "v4": 20.176, "amplitude": 37.235, "phase_angle": 13.650, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.908, "filter_rmsd": 0.106, "frame": { "rmsd": 0.003, "origin": [ 71.229, 79.614, 61.959 ], "x_axis": [ -0.200, -0.898, -0.393 ], "y_axis": [ -0.968, 0.118, 0.221 ], "z_axis": [ -0.152, 0.424, -0.893 ], "quaternion": [ 0.081, -0.627, 0.743, 0.217 ] } }, { "index": 201, "index_chain": 43, "chain_name": "B", "nt_resnum": 145, "nt_name": "C", "nt_code": "C", "nt_id": "///B/145", "linked_nts": [ "///B/144", "///B/146" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -57.069, "beta": 160.940, "gamma": 54.110, "delta": 80.193, "epsilon": -144.551, "zeta": -77.594, "epsilon_zeta": -66.957, "bb_type": "BI", "chi": -158.880, "glyco_bond": "anti", "C5prime_xyz": [ -1.336, 8.801, 0.448 ], "P_xyz": [ 1.250, 9.157, 0.273 ], "form": "A", "ssZp": 4.388, "Dp": 4.659, "splay_angle": 20.696, "splay_distance": 3.318, "splay_ratio": 0.180, "d22": null, "d64": null, "eta": 166.825, "theta": -146.404, "eta_prime": -178.631, "theta_prime": -148.140, "eta_base": -134.059, "theta_base": -128.299, "v0": 2.585, "v1": -24.843, "v2": 36.444, "v3": -35.964, "v4": 21.061, "amplitude": 37.691, "phase_angle": 14.783, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.855, "filter_rmsd": 0.064, "frame": { "rmsd": 0.002, "origin": [ 71.261, 79.655, 58.551 ], "x_axis": [ -0.677, -0.733, -0.062 ], "y_axis": [ -0.717, 0.639, 0.279 ], "z_axis": [ -0.165, 0.234, -0.958 ], "quaternion": [ -0.028, -0.401, 0.905, 0.142 ] } }, { "index": 202, "index_chain": 44, "chain_name": "B", "nt_resnum": 146, "nt_name": "A", "nt_code": "A", "nt_id": "///B/146", "linked_nts": [ "///B/145", "///B/147" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -64.919, "beta": 164.190, "gamma": 55.595, "delta": 78.738, "epsilon": -151.015, "zeta": -78.828, "epsilon_zeta": -72.187, "bb_type": "BI", "chi": -162.064, "glyco_bond": "anti", "C5prime_xyz": [ -1.506, 8.734, 0.642 ], "P_xyz": [ 1.059, 9.269, 0.572 ], "form": "A", "ssZp": 4.499, "Dp": 4.646, "splay_angle": 23.319, "splay_distance": 3.696, "splay_ratio": 0.204, "d22": null, "d64": null, "eta": 162.006, "theta": -154.308, "eta_prime": 175.298, "theta_prime": -155.704, "eta_base": -148.356, "theta_base": -141.647, "v0": 1.528, "v1": -24.740, "v2": 37.199, "v3": -37.401, "v4": 22.590, "amplitude": 38.779, "phase_angle": 16.413, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.926, "filter_rmsd": 0.037, "frame": { "rmsd": 0.003, "origin": [ 71.192, 79.159, 55.271 ], "x_axis": [ -0.886, -0.371, 0.279 ], "y_axis": [ -0.335, 0.927, 0.170 ], "z_axis": [ -0.321, 0.057, -0.945 ], "quaternion": [ -0.155, -0.182, 0.969, 0.059 ] } }, { "index": 203, "index_chain": 45, "chain_name": "B", "nt_resnum": 147, "nt_name": "G", "nt_code": "G", "nt_id": "///B/147", "linked_nts": [ "///B/146", "///B/148" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -73.542, "beta": 177.701, "gamma": 52.287, "delta": 78.638, "epsilon": -150.281, "zeta": -70.784, "epsilon_zeta": -79.497, "bb_type": "BI", "chi": -167.097, "glyco_bond": "anti", "C5prime_xyz": [ -1.440, 8.676, 0.954 ], "P_xyz": [ 1.113, 9.156, 1.337 ], "form": "A", "ssZp": 4.615, "Dp": 4.680, "splay_angle": 26.678, "splay_distance": 4.185, "splay_ratio": 0.235, "d22": null, "d64": null, "eta": 160.830, "theta": -146.942, "eta_prime": 168.247, "theta_prime": -145.195, "eta_base": -164.267, "theta_base": -119.234, "v0": 4.226, "v1": -27.181, "v2": 38.638, "v3": -37.187, "v4": 20.712, "amplitude": 39.585, "phase_angle": 12.559, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.893, "filter_rmsd": 0.004, "frame": { "rmsd": 0.004, "origin": [ 70.852, 77.680, 51.901 ], "x_axis": [ -0.797, 0.073, 0.600 ], "y_axis": [ 0.084, 0.996, -0.010 ], "z_axis": [ -0.598, 0.043, -0.800 ], "quaternion": [ -0.316, 0.041, 0.948, 0.009 ] } }, { "index": 204, "index_chain": 46, "chain_name": "B", "nt_resnum": 148, "nt_name": "G", "nt_code": "G", "nt_id": "///B/148", "linked_nts": [ "///B/147", "///B/149" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -64.195, "beta": 177.946, "gamma": 52.776, "delta": 77.734, "epsilon": -141.205, "zeta": -74.949, "epsilon_zeta": -66.256, "bb_type": "BI", "chi": -174.086, "glyco_bond": "anti", "C5prime_xyz": [ -1.576, 8.585, 1.361 ], "P_xyz": [ 0.931, 9.041, 2.021 ], "form": "A", "ssZp": 4.704, "Dp": 4.719, "splay_angle": 25.886, "splay_distance": 4.161, "splay_ratio": 0.232, "d22": null, "d64": null, "eta": 169.307, "theta": -142.037, "eta_prime": -179.785, "theta_prime": -137.982, "eta_base": -139.605, "theta_base": -107.784, "v0": 2.932, "v1": -26.436, "v2": 38.580, "v3": -37.958, "v4": 22.050, "amplitude": 39.844, "phase_angle": 14.470, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.950, "filter_rmsd": 0.003, "frame": { "rmsd": 0.003, "origin": [ 67.607, 76.160, 49.741 ], "x_axis": [ -0.481, 0.581, 0.657 ], "y_axis": [ 0.564, 0.779, -0.275 ], "z_axis": [ -0.671, 0.238, -0.702 ], "quaternion": [ -0.386, 0.333, 0.860, -0.011 ] } }, { "index": 205, "index_chain": 47, "chain_name": "B", "nt_resnum": 149, "nt_name": "G", "nt_code": "G", "nt_id": "///B/149", "linked_nts": [ "///B/148", "///B/150" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,hairpin-loop", "alpha": -57.303, "beta": 173.110, "gamma": 51.629, "delta": 78.064, "epsilon": -135.199, "zeta": -75.565, "epsilon_zeta": -59.634, "bb_type": "BI", "chi": -166.348, "glyco_bond": "anti", "C5prime_xyz": [ -1.711, 8.753, 0.926 ], "P_xyz": [ 0.812, 9.392, 1.352 ], "form": "A", "ssZp": 4.569, "Dp": 4.713, "splay_angle": 24.835, "splay_distance": 3.969, "splay_ratio": 0.217, "d22": null, "d64": null, "eta": 171.866, "theta": -138.321, "eta_prime": -175.529, "theta_prime": -135.496, "eta_base": -132.818, "theta_base": -93.989, "v0": 2.170, "v1": -25.516, "v2": 37.895, "v3": -37.661, "v4": 22.316, "amplitude": 39.321, "phase_angle": 15.476, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.896, "filter_rmsd": 0.005, "frame": { "rmsd": 0.005, "origin": [ 63.514, 76.569, 49.110 ], "x_axis": [ 0.031, 0.896, 0.444 ], "y_axis": [ 0.727, 0.284, -0.625 ], "z_axis": [ -0.686, 0.342, -0.642 ], "quaternion": [ -0.410, 0.589, 0.688, -0.103 ] } }, { "index": 206, "index_chain": 48, "chain_name": "B", "nt_resnum": 150, "nt_name": "G", "nt_code": "G", "nt_id": "///B/150", "linked_nts": [ "///B/149", "///B/151" ], "nt_type": "RNA", "dbn": ".", "summary": "u-turn,anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,multiplet,hairpin-loop,cap-acceptor", "alpha": -53.968, "beta": 167.364, "gamma": 44.325, "delta": 78.424, "epsilon": -136.476, "zeta": -51.508, "epsilon_zeta": -84.968, "bb_type": "BI", "chi": -160.871, "glyco_bond": "anti", "C5prime_xyz": [ -1.421, 8.772, 0.544 ], "P_xyz": [ 1.134, 9.332, 0.642 ], "form": ".", "ssZp": 4.452, "Dp": 4.748, "splay_angle": 83.865, "splay_distance": 11.575, "splay_ratio": 0.668, "d22": null, "d64": null, "eta": 162.832, "theta": -117.281, "eta_prime": 177.862, "theta_prime": -164.073, "eta_base": -125.105, "theta_base": 138.924, "v0": 4.687, "v1": -27.836, "v2": 39.152, "v3": -37.478, "v4": 20.651, "amplitude": 40.026, "phase_angle": 11.997, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.729, "filter_rmsd": 0.003, "frame": { "rmsd": 0.003, "origin": [ 61.104, 79.684, 48.625 ], "x_axis": [ 0.639, 0.769, -0.010 ], "y_axis": [ 0.424, -0.363, -0.830 ], "z_axis": [ -0.642, 0.526, -0.558 ], "quaternion": [ -0.424, 0.800, 0.373, -0.203 ] } }, { "index": 207, "index_chain": 49, "chain_name": "B", "nt_resnum": 151, "nt_name": "A", "nt_code": "A", "nt_id": "///B/151", "linked_nts": [ "///B/150", "///B/152" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,u-turn,anti,~C3'-endo,non-canonical,non-pair-contact,multiplet,hairpin-loop", "alpha": -175.928, "beta": 119.779, "gamma": 53.456, "delta": 83.695, "epsilon": -124.116, "zeta": -87.275, "epsilon_zeta": -36.842, "bb_type": "--", "chi": -174.128, "glyco_bond": "anti", "C5prime_xyz": [ -1.715, 8.575, 1.372 ], "P_xyz": [ 0.910, 8.340, 1.271 ], "form": ".", "ssZp": 4.476, "Dp": 4.573, "splay_angle": 22.322, "splay_distance": 3.493, "splay_ratio": 0.194, "d22": null, "d64": null, "eta": 20.104, "theta": -126.955, "eta_prime": 49.121, "theta_prime": -131.150, "eta_base": 26.067, "theta_base": -89.859, "v0": -0.881, "v1": -20.089, "v2": 32.085, "v3": -33.523, "v4": 21.713, "amplitude": 34.154, "phase_angle": 20.044, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1g", "suiteness": 0.295, "filter_rmsd": 0.038, "frame": { "rmsd": 0.005, "origin": [ 53.494, 72.935, 43.103 ], "x_axis": [ 0.525, -0.761, -0.381 ], "y_axis": [ 0.621, 0.649, -0.440 ], "z_axis": [ 0.582, -0.006, 0.813 ], "quaternion": [ 0.864, -0.126, 0.279, -0.400 ] } }, { "index": 208, "index_chain": 50, "chain_name": "B", "nt_resnum": 152, "nt_name": "A", "nt_code": "A", "nt_id": "///B/152", "linked_nts": [ "///B/151", "///B/153" ], "nt_type": "RNA", "dbn": ".", "summary": "u-turn,anti,~C3'-endo,BI,non-canonical,non-pair-contact,hairpin-loop,A-minor,ribose-zipper,cap-donor,phosphate", "alpha": -61.079, "beta": 144.293, "gamma": 65.814, "delta": 84.788, "epsilon": -139.216, "zeta": -75.354, "epsilon_zeta": -63.862, "bb_type": "BI", "chi": -158.513, "glyco_bond": "anti", "C5prime_xyz": [ -1.414, 8.725, 0.416 ], "P_xyz": [ 1.100, 8.845, -0.324 ], "form": ".", "ssZp": 4.293, "Dp": 4.597, "splay_angle": 21.754, "splay_distance": 3.436, "splay_ratio": 0.190, "d22": null, "d64": null, "eta": 162.808, "theta": -134.885, "eta_prime": -174.964, "theta_prime": -138.827, "eta_base": -109.786, "theta_base": -94.386, "v0": 1.328, "v1": -21.637, "v2": 32.512, "v3": -32.660, "v4": 19.820, "amplitude": 33.897, "phase_angle": 16.434, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.355, "filter_rmsd": 0.037, "frame": { "rmsd": 0.002, "origin": [ 56.169, 71.690, 44.972 ], "x_axis": [ 0.889, -0.094, -0.447 ], "y_axis": [ 0.158, 0.982, 0.107 ], "z_axis": [ 0.429, -0.166, 0.888 ], "quaternion": [ 0.969, 0.071, 0.226, -0.065 ] } }, { "index": 209, "index_chain": 51, "chain_name": "B", "nt_resnum": 153, "nt_name": "A", "nt_code": "A", "nt_id": "///B/153", "linked_nts": [ "///B/152", "///B/154" ], "nt_type": "RNA", "dbn": ".", "summary": "u-turn,anti,~C3'-endo,non-canonical,non-pair-contact,helix-end,multiplet,hairpin-loop,A-minor,ribose-zipper,phosphate", "alpha": -71.723, "beta": 156.888, "gamma": 67.691, "delta": 84.323, "epsilon": -130.132, "zeta": -38.831, "epsilon_zeta": -91.301, "bb_type": "--", "chi": -147.508, "glyco_bond": "anti", "C5prime_xyz": [ -1.184, 8.690, -0.161 ], "P_xyz": [ 1.295, 8.707, -1.025 ], "form": ".", "ssZp": 3.897, "Dp": 4.705, "splay_angle": 45.386, "splay_distance": 7.262, "splay_ratio": 0.386, "d22": null, "d64": null, "eta": 166.290, "theta": -99.235, "eta_prime": -174.631, "theta_prime": -96.028, "eta_base": -111.964, "theta_base": -57.200, "v0": 3.494, "v1": -24.042, "v2": 34.263, "v3": -33.165, "v4": 18.760, "amplitude": 35.167, "phase_angle": 13.023, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.582, "filter_rmsd": 0.039, "frame": { "rmsd": 0.004, "origin": [ 59.215, 71.497, 46.550 ], "x_axis": [ 0.767, 0.597, -0.234 ], "y_axis": [ -0.352, 0.697, 0.625 ], "z_axis": [ 0.537, -0.397, 0.745 ], "quaternion": [ 0.896, 0.285, 0.215, 0.265 ] } }, { "index": 210, "index_chain": 52, "chain_name": "B", "nt_resnum": 154, "nt_name": "C", "nt_code": "C", "nt_id": "///B/154", "linked_nts": [ "///B/153", "///B/155" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,hairpin-loop", "alpha": -91.924, "beta": 150.253, "gamma": 97.108, "delta": 81.636, "epsilon": -152.229, "zeta": -70.631, "epsilon_zeta": -81.599, "bb_type": "BI", "chi": -163.839, "glyco_bond": "anti", "C5prime_xyz": [ -1.264, 8.701, 0.768 ], "P_xyz": [ 0.903, 9.303, -0.588 ], "form": "A", "ssZp": 4.520, "Dp": 4.630, "splay_angle": 24.369, "splay_distance": 3.809, "splay_ratio": 0.212, "d22": 4.154, "d64": 4.367, "eta": 158.776, "theta": -147.121, "eta_prime": -155.514, "theta_prime": -152.132, "eta_base": -82.507, "theta_base": -124.642, "v0": 3.046, "v1": -24.969, "v2": 36.166, "v3": -35.355, "v4": 20.386, "amplitude": 37.271, "phase_angle": 13.988, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.002, "origin": [ 63.285, 76.994, 48.989 ], "x_axis": [ -0.084, 0.902, 0.424 ], "y_axis": [ -0.650, -0.372, 0.662 ], "z_axis": [ 0.755, -0.220, 0.618 ], "quaternion": [ 0.539, 0.409, 0.154, 0.720 ] } }, { "index": 211, "index_chain": 53, "chain_name": "B", "nt_resnum": 155, "nt_name": "U", "nt_code": "U", "nt_id": "///B/155", "linked_nts": [ "///B/154", "///B/156" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -61.177, "beta": 165.886, "gamma": 61.802, "delta": 82.039, "epsilon": -139.491, "zeta": -84.118, "epsilon_zeta": -55.372, "bb_type": "BI", "chi": -164.340, "glyco_bond": "anti", "C5prime_xyz": [ -1.465, 8.705, 0.799 ], "P_xyz": [ 1.143, 9.064, 0.838 ], "form": "A", "ssZp": 4.461, "Dp": 4.631, "splay_angle": 21.497, "splay_distance": 3.390, "splay_ratio": 0.187, "d22": 4.435, "d64": 4.046, "eta": 175.529, "theta": -145.760, "eta_prime": -167.962, "theta_prime": -145.575, "eta_base": -122.813, "theta_base": -119.729, "v0": 1.630, "v1": -23.118, "v2": 34.606, "v3": -34.651, "v4": 20.850, "amplitude": 36.020, "phase_angle": 16.106, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.854, "filter_rmsd": 0.106, "frame": { "rmsd": 0.004, "origin": [ 66.451, 77.865, 50.919 ], "x_axis": [ -0.436, 0.524, 0.732 ], "y_axis": [ -0.461, -0.828, 0.319 ], "z_axis": [ 0.773, -0.199, 0.602 ], "quaternion": [ 0.291, 0.444, 0.035, 0.847 ] } }, { "index": 212, "index_chain": 54, "chain_name": "B", "nt_resnum": 156, "nt_name": "U", "nt_code": "U", "nt_id": "///B/156", "linked_nts": [ "///B/155", "///B/157" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -60.278, "beta": 164.666, "gamma": 50.582, "delta": 81.014, "epsilon": -145.179, "zeta": -81.944, "epsilon_zeta": -63.235, "bb_type": "BI", "chi": -156.413, "glyco_bond": "anti", "C5prime_xyz": [ -1.347, 8.727, 0.331 ], "P_xyz": [ 1.256, 9.037, 0.291 ], "form": "A", "ssZp": 4.322, "Dp": 4.662, "splay_angle": 20.845, "splay_distance": 3.348, "splay_ratio": 0.182, "d22": 4.229, "d64": 4.116, "eta": 164.701, "theta": -149.126, "eta_prime": 177.187, "theta_prime": -149.903, "eta_base": -142.958, "theta_base": -136.712, "v0": 3.366, "v1": -25.353, "v2": 36.539, "v3": -35.588, "v4": 20.309, "amplitude": 37.591, "phase_angle": 13.586, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.832, "filter_rmsd": 0.106, "frame": { "rmsd": 0.004, "origin": [ 69.048, 78.401, 53.031 ], "x_axis": [ -0.708, -0.006, 0.706 ], "y_axis": [ -0.047, -0.997, -0.056 ], "z_axis": [ 0.705, -0.073, 0.706 ], "quaternion": [ 0.011, 0.382, -0.035, 0.923 ] } }, { "index": 213, "index_chain": 55, "chain_name": "B", "nt_resnum": 157, "nt_name": "U", "nt_code": "U", "nt_id": "///B/157", "linked_nts": [ "///B/156", "///B/158" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -58.543, "beta": 165.032, "gamma": 49.879, "delta": 79.649, "epsilon": -148.328, "zeta": -76.578, "epsilon_zeta": -71.751, "bb_type": "BI", "chi": -157.724, "glyco_bond": "anti", "C5prime_xyz": [ -1.533, 8.779, 0.387 ], "P_xyz": [ 1.032, 9.311, 0.411 ], "form": "A", "ssZp": 4.365, "Dp": 4.630, "splay_angle": 21.210, "splay_distance": 3.424, "splay_ratio": 0.186, "d22": null, "d64": null, "eta": 164.572, "theta": -147.918, "eta_prime": 175.012, "theta_prime": -148.237, "eta_base": -158.301, "theta_base": -122.648, "v0": 1.280, "v1": -24.093, "v2": 36.451, "v3": -36.732, "v4": 22.370, "amplitude": 38.062, "phase_angle": 16.734, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.869, "filter_rmsd": 0.104, "frame": { "rmsd": 0.002, "origin": [ 71.156, 79.549, 55.365 ], "x_axis": [ -0.807, -0.406, 0.428 ], "y_axis": [ 0.326, -0.912, -0.250 ], "z_axis": [ 0.492, -0.062, 0.869 ], "quaternion": [ -0.193, 0.243, -0.082, 0.947 ] } }, { "index": 214, "index_chain": 56, "chain_name": "B", "nt_resnum": 158, "nt_name": "G", "nt_code": "G", "nt_id": "///B/158", "linked_nts": [ "///B/157", "///B/159" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -60.947, "beta": 161.940, "gamma": 57.591, "delta": 79.329, "epsilon": -148.090, "zeta": -78.604, "epsilon_zeta": -69.487, "bb_type": "BI", "chi": -166.372, "glyco_bond": "anti", "C5prime_xyz": [ -1.670, 8.786, 0.885 ], "P_xyz": [ 0.885, 9.363, 0.983 ], "form": "A", "ssZp": 4.512, "Dp": 4.599, "splay_angle": 21.284, "splay_distance": 3.315, "splay_ratio": 0.185, "d22": null, "d64": null, "eta": 166.515, "theta": -150.944, "eta_prime": -179.403, "theta_prime": -151.848, "eta_base": -138.326, "theta_base": -122.116, "v0": 0.389, "v1": -23.162, "v2": 35.820, "v3": -36.616, "v4": 22.831, "amplitude": 37.671, "phase_angle": 18.035, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.900, "filter_rmsd": 0.003, "frame": { "rmsd": 0.003, "origin": [ 71.421, 80.072, 58.739 ], "x_axis": [ -0.616, -0.786, 0.058 ], "y_axis": [ 0.715, -0.588, -0.378 ], "z_axis": [ 0.331, -0.191, 0.924 ], "quaternion": [ -0.424, 0.110, -0.161, 0.884 ] } }, { "index": 215, "index_chain": 57, "chain_name": "B", "nt_resnum": 159, "nt_name": "A", "nt_code": "A", "nt_id": "///B/159", "linked_nts": [ "///B/158", "///B/160" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -64.262, "beta": 170.215, "gamma": 51.234, "delta": 80.319, "epsilon": -142.591, "zeta": -80.930, "epsilon_zeta": -61.661, "bb_type": "BI", "chi": -163.017, "glyco_bond": "anti", "C5prime_xyz": [ -1.201, 8.619, 0.680 ], "P_xyz": [ 1.398, 8.905, 0.760 ], "form": "A", "ssZp": 4.527, "Dp": 4.730, "splay_angle": 22.338, "splay_distance": 3.506, "splay_ratio": 0.195, "d22": null, "d64": null, "eta": 165.363, "theta": -148.212, "eta_prime": 176.051, "theta_prime": -147.437, "eta_base": -139.795, "theta_base": -127.002, "v0": 5.738, "v1": -27.710, "v2": 37.980, "v3": -35.702, "v4": 18.884, "amplitude": 38.596, "phase_angle": 10.250, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.945, "filter_rmsd": 0.037, "frame": { "rmsd": 0.002, "origin": [ 71.252, 79.635, 62.021 ], "x_axis": [ -0.098, -0.972, -0.212 ], "y_axis": [ 0.964, -0.040, -0.262 ], "z_axis": [ 0.247, -0.230, 0.941 ], "quaternion": [ 0.672, -0.012, 0.171, -0.721 ] } }, { "index": 216, "index_chain": 58, "chain_name": "B", "nt_resnum": 160, "nt_name": "G", "nt_code": "G", "nt_id": "///B/160", "linked_nts": [ "///B/159", "///B/161" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -58.325, "beta": 160.466, "gamma": 56.352, "delta": 79.321, "epsilon": -148.288, "zeta": -73.793, "epsilon_zeta": -74.495, "bb_type": "BI", "chi": -166.548, "glyco_bond": "anti", "C5prime_xyz": [ -1.424, 8.694, 0.871 ], "P_xyz": [ 1.162, 9.106, 0.703 ], "form": "A", "ssZp": 4.611, "Dp": 4.696, "splay_angle": 23.331, "splay_distance": 3.690, "splay_ratio": 0.206, "d22": null, "d64": null, "eta": 165.693, "theta": -143.863, "eta_prime": 179.481, "theta_prime": -144.181, "eta_base": -143.929, "theta_base": -118.201, "v0": 3.390, "v1": -26.446, "v2": 38.081, "v3": -37.156, "v4": 21.318, "amplitude": 39.202, "phase_angle": 13.731, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.847, "filter_rmsd": 0.004, "frame": { "rmsd": 0.004, "origin": [ 70.520, 78.346, 65.199 ], "x_axis": [ 0.347, -0.846, -0.406 ], "y_axis": [ 0.917, 0.397, -0.045 ], "z_axis": [ 0.199, -0.356, 0.913 ], "quaternion": [ 0.815, 0.095, 0.186, -0.541 ] } }, { "index": 217, "index_chain": 59, "chain_name": "B", "nt_resnum": 161, "nt_name": "A", "nt_code": "A", "nt_id": "///B/161", "linked_nts": [ "///B/160", "///B/162" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -62.168, "beta": 160.962, "gamma": 65.799, "delta": 80.508, "epsilon": -145.123, "zeta": -65.163, "epsilon_zeta": -79.959, "bb_type": "BI", "chi": -169.830, "glyco_bond": "anti", "C5prime_xyz": [ -1.698, 8.648, 1.098 ], "P_xyz": [ 0.874, 9.222, 0.985 ], "form": "A", "ssZp": 4.602, "Dp": 4.647, "splay_angle": 24.341, "splay_distance": 3.884, "splay_ratio": 0.214, "d22": null, "d64": null, "eta": 171.826, "theta": -133.948, "eta_prime": -170.878, "theta_prime": -135.538, "eta_base": -126.133, "theta_base": -94.694, "v0": 1.236, "v1": -23.889, "v2": 36.127, "v3": -36.382, "v4": 22.161, "amplitude": 37.724, "phase_angle": 16.729, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.701, "filter_rmsd": 0.038, "frame": { "rmsd": 0.004, "origin": [ 70.243, 75.493, 67.522 ], "x_axis": [ 0.779, -0.501, -0.376 ], "y_axis": [ 0.603, 0.763, 0.232 ], "z_axis": [ 0.171, -0.408, 0.897 ], "quaternion": [ 0.927, 0.172, 0.147, -0.298 ] } }, { "index": 218, "index_chain": 60, "chain_name": "B", "nt_resnum": 162, "nt_name": "U", "nt_code": "U", "nt_id": "///B/162", "linked_nts": [ "///B/161", "///B/163" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,junction-loop", "alpha": -69.686, "beta": 166.449, "gamma": 62.196, "delta": 80.143, "epsilon": -138.876, "zeta": -67.722, "epsilon_zeta": -71.154, "bb_type": "BI", "chi": -165.939, "glyco_bond": "anti", "C5prime_xyz": [ -1.628, 8.727, 0.844 ], "P_xyz": [ 0.926, 9.344, 0.752 ], "form": ".", "ssZp": 4.561, "Dp": 4.686, "splay_angle": 27.856, "splay_distance": 4.358, "splay_ratio": 0.242, "d22": null, "d64": null, "eta": 165.221, "theta": -132.269, "eta_prime": -174.588, "theta_prime": -128.869, "eta_base": -111.694, "theta_base": -76.710, "v0": 1.703, "v1": -24.440, "v2": 36.612, "v3": -36.548, "v4": 21.978, "amplitude": 38.094, "phase_angle": 16.034, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.837, "filter_rmsd": 0.103, "frame": { "rmsd": 0.003, "origin": [ 72.251, 72.560, 69.087 ], "x_axis": [ 0.985, 0.154, -0.075 ], "y_axis": [ -0.095, 0.854, 0.511 ], "z_axis": [ 0.143, -0.496, 0.856 ], "quaternion": [ 0.961, 0.262, 0.057, 0.065 ] } }, { "index": 219, "index_chain": 61, "chain_name": "B", "nt_resnum": 163, "nt_name": "G", "nt_code": "G", "nt_id": "///B/163", "linked_nts": [ "///B/162", "///B/164" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-canonical,non-pair-contact,helix,junction-loop,phosphate", "alpha": -62.801, "beta": 160.193, "gamma": 65.834, "delta": 85.540, "epsilon": -121.701, "zeta": -90.440, "epsilon_zeta": -31.261, "bb_type": "--", "chi": -155.000, "glyco_bond": "anti", "C5prime_xyz": [ -1.468, 8.815, 0.280 ], "P_xyz": [ 1.106, 9.140, -0.149 ], "form": ".", "ssZp": 4.048, "Dp": 4.596, "splay_angle": 19.087, "splay_distance": 3.163, "splay_ratio": 0.173, "d22": null, "d64": null, "eta": 175.969, "theta": -134.665, "eta_prime": -161.178, "theta_prime": -125.741, "eta_base": -92.070, "theta_base": -85.751, "v0": 1.782, "v1": -21.863, "v2": 32.512, "v3": -32.378, "v4": 19.336, "amplitude": 33.767, "phase_angle": 15.670, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.671, "filter_rmsd": 0.004, "frame": { "rmsd": 0.004, "origin": [ 75.946, 72.313, 71.383 ], "x_axis": [ 0.546, 0.738, 0.397 ], "y_axis": [ -0.783, 0.282, 0.554 ], "z_axis": [ 0.296, -0.613, 0.732 ], "quaternion": [ 0.800, 0.365, -0.031, 0.475 ] } }, { "index": 220, "index_chain": 62, "chain_name": "B", "nt_resnum": 164, "nt_name": "G", "nt_code": "G", "nt_id": "///B/164", "linked_nts": [ "///B/163", "///B/165" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C2'-endo,non-canonical,non-pair-contact,helix-end,multiplet,junction-loop,phosphate,splayed-apart", "alpha": -47.664, "beta": 160.997, "gamma": 57.253, "delta": 144.615, "epsilon": -117.479, "zeta": -63.676, "epsilon_zeta": -53.803, "bb_type": "--", "chi": -101.151, "glyco_bond": "anti", "C5prime_xyz": [ -1.950, 8.135, -2.047 ], "P_xyz": [ 0.647, 8.381, -2.306 ], "form": ".", "ssZp": 1.117, "Dp": 1.537, "splay_angle": 85.049, "splay_distance": 13.270, "splay_ratio": 0.678, "d22": null, "d64": null, "eta": -175.459, "theta": -57.585, "eta_prime": -142.479, "theta_prime": -75.102, "eta_base": -100.214, "theta_base": -36.694, "v0": -17.581, "v1": 31.304, "v2": -32.306, "v3": 23.014, "v4": -3.625, "amplitude": 33.104, "phase_angle": 167.389, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1b", "suiteness": 0.496, "filter_rmsd": 0.006, "frame": { "rmsd": 0.006, "origin": [ 76.800, 72.479, 74.424 ], "x_axis": [ -0.209, 0.902, 0.377 ], "y_axis": [ -0.716, -0.404, 0.569 ], "z_axis": [ 0.666, -0.151, 0.730 ], "quaternion": [ 0.528, 0.341, 0.137, 0.765 ] } }, { "index": 221, "index_chain": 63, "chain_name": "B", "nt_resnum": 165, "nt_name": "C", "nt_code": "C", "nt_id": "///B/165", "linked_nts": [ "///B/164", "///B/166" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,junction-loop,splayed-apart", "alpha": -72.825, "beta": 167.936, "gamma": 50.598, "delta": 82.415, "epsilon": -129.199, "zeta": -80.562, "epsilon_zeta": -48.637, "bb_type": "BI", "chi": -168.693, "glyco_bond": "anti", "C5prime_xyz": [ -1.341, 8.689, 1.053 ], "P_xyz": [ 1.215, 8.937, 1.613 ], "form": "A", "ssZp": 4.499, "Dp": 4.653, "splay_angle": 20.136, "splay_distance": 3.294, "splay_ratio": 0.176, "d22": 4.471, "d64": 4.240, "eta": 148.190, "theta": -136.555, "eta_prime": -167.525, "theta_prime": -134.742, "eta_base": -132.461, "theta_base": -111.186, "v0": 1.854, "v1": -23.256, "v2": 34.585, "v3": -34.509, "v4": 20.621, "amplitude": 35.934, "phase_angle": 15.751, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "2a", "suiteness": 0.625, "filter_rmsd": 0.066, "frame": { "rmsd": 0.005, "origin": [ 68.142, 69.812, 84.120 ], "x_axis": [ -0.640, 0.096, -0.762 ], "y_axis": [ 0.625, -0.512, -0.589 ], "z_axis": [ -0.446, -0.854, 0.268 ], "quaternion": [ -0.170, -0.389, -0.464, 0.778 ] } }, { "index": 222, "index_chain": 64, "chain_name": "B", "nt_resnum": 166, "nt_name": "C", "nt_code": "C", "nt_id": "///B/166", "linked_nts": [ "///B/165", "///B/167" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop,phosphate", "alpha": -68.172, "beta": 160.359, "gamma": 62.804, "delta": 80.739, "epsilon": -104.683, "zeta": -21.788, "epsilon_zeta": -82.895, "bb_type": "--", "chi": -153.053, "glyco_bond": "anti", "C5prime_xyz": [ -1.651, 8.909, 0.080 ], "P_xyz": [ 0.853, 9.510, -0.383 ], "form": ".", "ssZp": 3.726, "Dp": 4.576, "splay_angle": 22.297, "splay_distance": 3.787, "splay_ratio": 0.193, "d22": 3.794, "d64": 4.522, "eta": 173.333, "theta": -39.013, "eta_prime": -174.785, "theta_prime": -66.976, "eta_base": -141.989, "theta_base": -92.715, "v0": -2.171, "v1": -20.522, "v2": 33.981, "v3": -36.265, "v4": 24.280, "amplitude": 36.643, "phase_angle": 21.971, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.665, "filter_rmsd": 0.062, "frame": { "rmsd": 0.003, "origin": [ 65.499, 68.021, 84.929 ], "x_axis": [ -0.163, -0.091, -0.982 ], "y_axis": [ 0.747, -0.662, -0.063 ], "z_axis": [ -0.644, -0.744, 0.176 ], "quaternion": [ -0.296, -0.575, -0.285, 0.707 ] } }, { "index": 223, "index_chain": 65, "chain_name": "B", "nt_resnum": 167, "nt_name": "U", "nt_code": "U", "nt_id": "///B/167", "linked_nts": [ "///B/166", "///B/168" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C2'-endo,non-canonical,non-pair-contact,helix,hairpin-loop,splayed-apart", "alpha": -174.171, "beta": -168.746, "gamma": 52.715, "delta": 145.618, "epsilon": -95.126, "zeta": 80.966, "epsilon_zeta": 183.907, "bb_type": "--", "chi": -135.217, "glyco_bond": "anti", "C5prime_xyz": [ -1.880, 8.717, -0.458 ], "P_xyz": [ 0.167, 9.673, 0.862 ], "form": ".", "ssZp": 0.865, "Dp": 0.850, "splay_angle": 165.975, "splay_distance": 18.918, "splay_ratio": 0.993, "d22": 11.588, "d64": 14.978, "eta": 71.338, "theta": 122.112, "eta_prime": 123.927, "theta_prime": 86.499, "eta_base": 129.872, "theta_base": 142.794, "v0": -23.011, "v1": 36.682, "v2": -35.567, "v3": 23.195, "v4": -0.325, "amplitude": 37.458, "phase_angle": 161.714, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.105, "frame": { "rmsd": 0.002, "origin": [ 63.678, 65.340, 82.970 ], "x_axis": [ -0.224, 0.441, 0.869 ], "y_axis": [ 0.594, -0.645, 0.481 ], "z_axis": [ 0.772, 0.624, -0.118 ], "quaternion": [ -0.058, 0.620, 0.418, 0.662 ] } }, { "index": 224, "index_chain": 66, "chain_name": "B", "nt_resnum": 168, "nt_name": "U", "nt_code": "U", "nt_id": "///B/168", "linked_nts": [ "///B/167", "///B/169" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,anti,~C2'-endo,non-canonical,non-pair-contact,hairpin-loop,splayed-apart", "alpha": 59.060, "beta": 146.728, "gamma": 62.493, "delta": 145.635, "epsilon": -84.445, "zeta": 97.805, "epsilon_zeta": 177.750, "bb_type": "--", "chi": -131.476, "glyco_bond": "anti", "C5prime_xyz": [ -1.942, 8.693, -0.640 ], "P_xyz": [ 0.644, 8.952, -0.273 ], "form": ".", "ssZp": 0.471, "Dp": 0.536, "splay_angle": 139.571, "splay_distance": 18.083, "splay_ratio": 0.939, "d22": null, "d64": null, "eta": -12.112, "theta": 138.135, "eta_prime": -0.491, "theta_prime": 93.868, "eta_base": -62.643, "theta_base": 71.462, "v0": -22.331, "v1": 35.991, "v2": -35.119, "v3": 23.157, "v4": -0.715, "amplitude": 36.860, "phase_angle": 162.322, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "6p", "suiteness": 0.629, "filter_rmsd": 0.105, "frame": { "rmsd": 0.003, "origin": [ 75.026, 50.859, 78.564 ], "x_axis": [ 0.737, 0.642, -0.211 ], "y_axis": [ -0.551, 0.752, 0.362 ], "z_axis": [ 0.390, -0.151, 0.908 ], "quaternion": [ 0.922, 0.139, 0.163, 0.324 ] } }, { "index": 225, "index_chain": 67, "chain_name": "B", "nt_resnum": 169, "nt_name": "G", "nt_code": "G", "nt_id": "///B/169", "linked_nts": [ "///B/168", "///B/170" ], "nt_type": "RNA", "dbn": "]", "summary": "pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,hairpin-loop,splayed-apart", "alpha": 43.995, "beta": 175.010, "gamma": 51.157, "delta": 80.958, "epsilon": -152.463, "zeta": -69.582, "epsilon_zeta": -82.882, "bb_type": "BI", "chi": 178.684, "glyco_bond": "anti", "C5prime_xyz": [ -1.662, 8.456, 1.743 ], "P_xyz": [ 0.755, 8.771, 2.712 ], "form": "A", "ssZp": 4.576, "Dp": 4.613, "splay_angle": 27.798, "splay_distance": 4.224, "splay_ratio": 0.243, "d22": null, "d64": null, "eta": -31.003, "theta": -145.281, "eta_prime": -39.592, "theta_prime": -141.567, "eta_base": -17.039, "theta_base": -110.175, "v0": 0.826, "v1": -23.459, "v2": 35.751, "v3": -36.282, "v4": 22.312, "amplitude": 37.449, "phase_angle": 17.318, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "6d", "suiteness": 0.327, "filter_rmsd": 0.005, "frame": { "rmsd": 0.005, "origin": [ 58.069, 56.531, 81.270 ], "x_axis": [ -0.120, 0.037, 0.992 ], "y_axis": [ 0.749, -0.652, 0.115 ], "z_axis": [ 0.651, 0.757, 0.051 ], "quaternion": [ -0.264, 0.609, 0.323, 0.675 ] } }, { "index": 226, "index_chain": 68, "chain_name": "B", "nt_resnum": 170, "nt_name": "C", "nt_code": "C", "nt_id": "///B/170", "linked_nts": [ "///B/169", "///B/171" ], "nt_type": "RNA", "dbn": "]", "summary": "pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop", "alpha": -74.274, "beta": -168.238, "gamma": 52.052, "delta": 81.127, "epsilon": -152.937, "zeta": -46.279, "epsilon_zeta": -106.658, "bb_type": "BI", "chi": -169.520, "glyco_bond": "anti", "C5prime_xyz": [ -1.198, 8.604, 1.064 ], "P_xyz": [ 1.295, 8.734, 1.859 ], "form": ".", "ssZp": 4.614, "Dp": 4.692, "splay_angle": 32.166, "splay_distance": 4.835, "splay_ratio": 0.277, "d22": null, "d64": null, "eta": 170.175, "theta": -124.014, "eta_prime": -179.018, "theta_prime": -115.084, "eta_base": -135.369, "theta_base": -60.523, "v0": 5.690, "v1": -27.363, "v2": 37.808, "v3": -35.334, "v4": 18.864, "amplitude": 38.428, "phase_angle": 10.299, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.812, "filter_rmsd": 0.067, "frame": { "rmsd": 0.006, "origin": [ 58.996, 60.579, 82.039 ], "x_axis": [ 0.361, -0.426, 0.830 ], "y_axis": [ 0.577, -0.597, -0.557 ], "z_axis": [ 0.733, 0.679, 0.030 ], "quaternion": [ -0.445, 0.694, 0.054, 0.563 ] } }, { "index": 227, "index_chain": 69, "chain_name": "B", "nt_resnum": 171, "nt_name": "A", "nt_code": "A", "nt_id": "///B/171", "linked_nts": [ "///B/170", "///B/172" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C2'-endo,BII,non-canonical,non-pair-contact,helix,hairpin-loop,phosphate", "alpha": -115.889, "beta": 165.846, "gamma": 120.545, "delta": 149.909, "epsilon": -80.433, "zeta": 166.092, "epsilon_zeta": 113.475, "bb_type": "BII", "chi": -153.009, "glyco_bond": "anti", "C5prime_xyz": [ -1.327, 8.550, 0.744 ], "P_xyz": [ 1.315, 8.707, 0.557 ], "form": ".", "ssZp": 0.564, "Dp": 0.668, "splay_angle": 43.262, "splay_distance": 7.082, "splay_ratio": 0.380, "d22": null, "d64": null, "eta": -132.461, "theta": 150.299, "eta_prime": -112.985, "theta_prime": 154.234, "eta_base": -52.995, "theta_base": 165.069, "v0": -13.900, "v1": 30.039, "v2": -34.164, "v3": 27.017, "v4": -8.419, "amplitude": 34.276, "phase_angle": 175.377, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.045, "frame": { "rmsd": 0.015, "origin": [ 63.120, 60.195, 84.532 ], "x_axis": [ 0.593, -0.799, -0.097 ], "y_axis": [ 0.086, 0.183, -0.979 ], "z_axis": [ 0.801, 0.572, 0.177 ], "quaternion": [ 0.699, -0.555, 0.321, -0.317 ] } }, { "index": 228, "index_chain": 70, "chain_name": "B", "nt_resnum": 172, "nt_name": "A", "nt_code": "A", "nt_id": "///B/172", "linked_nts": [ "///B/171", "///B/173" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,hairpin-loop", "alpha": 158.178, "beta": -153.402, "gamma": 73.816, "delta": 82.427, "epsilon": -142.529, "zeta": -72.405, "epsilon_zeta": -70.123, "bb_type": "BI", "chi": -178.354, "glyco_bond": "anti", "C5prime_xyz": [ -1.196, 8.265, 1.590 ], "P_xyz": [ 1.372, 7.995, 2.107 ], "form": ".", "ssZp": 4.779, "Dp": 4.764, "splay_angle": 31.106, "splay_distance": 4.612, "splay_ratio": 0.271, "d22": null, "d64": null, "eta": 127.212, "theta": -132.741, "eta_prime": 120.560, "theta_prime": -129.714, "eta_base": 141.783, "theta_base": -102.439, "v0": 7.709, "v1": -29.280, "v2": 38.725, "v3": -35.163, "v4": 17.337, "amplitude": 39.052, "phase_angle": 7.416, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.003, "origin": [ 57.914, 64.996, 84.459 ], "x_axis": [ 0.733, -0.680, -0.028 ], "y_axis": [ 0.078, 0.125, -0.989 ], "z_axis": [ 0.676, 0.723, 0.145 ], "quaternion": [ 0.708, -0.605, 0.249, -0.268 ] } }, { "index": 229, "index_chain": 71, "chain_name": "B", "nt_resnum": 173, "nt_name": "A", "nt_code": "A", "nt_id": "///B/173", "linked_nts": [ "///B/172", "///B/174" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,hairpin-loop,phosphate", "alpha": -58.242, "beta": 167.731, "gamma": 60.964, "delta": 82.190, "epsilon": -127.547, "zeta": -77.126, "epsilon_zeta": -50.421, "bb_type": "BI", "chi": 178.618, "glyco_bond": "anti", "C5prime_xyz": [ -1.482, 8.333, 1.751 ], "P_xyz": [ 1.114, 8.494, 2.215 ], "form": "A", "ssZp": 4.729, "Dp": 4.736, "splay_angle": 26.777, "splay_distance": 4.096, "splay_ratio": 0.233, "d22": null, "d64": null, "eta": 179.042, "theta": -128.547, "eta_prime": -164.189, "theta_prime": -126.114, "eta_base": -117.275, "theta_base": -80.536, "v0": 4.837, "v1": -26.161, "v2": 36.320, "v3": -34.526, "v4": 18.714, "amplitude": 37.032, "phase_angle": 11.254, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.866, "filter_rmsd": 0.038, "frame": { "rmsd": 0.002, "origin": [ 61.773, 66.524, 86.471 ], "x_axis": [ 0.603, -0.453, -0.657 ], "y_axis": [ -0.516, 0.407, -0.754 ], "z_axis": [ 0.609, 0.793, 0.011 ], "quaternion": [ 0.711, -0.544, 0.445, 0.022 ] } }, { "index": 230, "index_chain": 72, "chain_name": "B", "nt_resnum": 174, "nt_name": "G", "nt_code": "G", "nt_id": "///B/174", "linked_nts": [ "///B/173", "///B/175" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop", "alpha": -53.477, "beta": 160.882, "gamma": 49.523, "delta": 82.040, "epsilon": -124.112, "zeta": -88.503, "epsilon_zeta": -35.610, "bb_type": "--", "chi": -169.143, "glyco_bond": "anti", "C5prime_xyz": [ -1.317, 8.621, 1.110 ], "P_xyz": [ 1.280, 8.825, 1.384 ], "form": "A", "ssZp": 4.585, "Dp": 4.745, "splay_angle": 20.655, "splay_distance": 3.254, "splay_ratio": 0.180, "d22": null, "d64": null, "eta": 166.857, "theta": -139.530, "eta_prime": -173.662, "theta_prime": -139.191, "eta_base": -107.742, "theta_base": -109.758, "v0": 5.117, "v1": -26.403, "v2": 36.498, "v3": -34.532, "v4": 18.560, "amplitude": 37.165, "phase_angle": 10.871, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.667, "filter_rmsd": 0.004, "frame": { "rmsd": 0.004, "origin": [ 65.420, 67.768, 85.083 ], "x_axis": [ -0.026, 0.020, -0.999 ], "y_axis": [ -0.781, 0.623, 0.033 ], "z_axis": [ 0.624, 0.782, -0.001 ], "quaternion": [ 0.632, -0.296, 0.642, 0.317 ] } }, { "index": 231, "index_chain": 73, "chain_name": "B", "nt_resnum": 175, "nt_name": "G", "nt_code": "G", "nt_id": "///B/175", "linked_nts": [ "///B/174", "///B/176" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,junction-loop", "alpha": -60.677, "beta": 150.918, "gamma": 55.894, "delta": 77.946, "epsilon": -138.697, "zeta": -69.671, "epsilon_zeta": -69.027, "bb_type": "BI", "chi": -170.281, "glyco_bond": "anti", "C5prime_xyz": [ -1.518, 8.648, 1.094 ], "P_xyz": [ 1.050, 9.070, 0.805 ], "form": ".", "ssZp": 4.685, "Dp": 4.754, "splay_angle": 29.379, "splay_distance": 4.634, "splay_ratio": 0.258, "d22": null, "d64": null, "eta": 156.012, "theta": -133.238, "eta_prime": 171.656, "theta_prime": -133.490, "eta_base": -140.034, "theta_base": -100.548, "v0": 3.456, "v1": -26.810, "v2": 38.683, "v3": -37.737, "v4": 21.593, "amplitude": 39.819, "phase_angle": 13.719, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.489, "filter_rmsd": 0.005, "frame": { "rmsd": 0.005, "origin": [ 67.953, 69.462, 83.941 ], "x_axis": [ -0.562, 0.238, -0.792 ], "y_axis": [ -0.559, 0.597, 0.576 ], "z_axis": [ 0.610, 0.766, -0.202 ], "quaternion": [ 0.456, -0.104, 0.768, 0.437 ] } }, { "index": 232, "index_chain": 74, "chain_name": "B", "nt_resnum": 176, "nt_name": "G", "nt_code": "G", "nt_id": "///B/176", "linked_nts": [ "///B/175", "///B/177" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-pair-contact,junction-loop", "alpha": -61.239, "beta": 168.645, "gamma": 59.266, "delta": 78.963, "epsilon": -135.031, "zeta": -70.745, "epsilon_zeta": -64.286, "bb_type": "BI", "chi": -173.896, "glyco_bond": "anti", "C5prime_xyz": [ -1.636, 8.653, 1.288 ], "P_xyz": [ 0.910, 9.250, 1.558 ], "form": "A", "ssZp": 4.694, "Dp": 4.722, "splay_angle": 23.646, "splay_distance": 3.745, "splay_ratio": 0.208, "d22": null, "d64": null, "eta": 170.263, "theta": -134.629, "eta_prime": -172.007, "theta_prime": -132.899, "eta_base": -117.737, "theta_base": -86.129, "v0": 1.241, "v1": -24.203, "v2": 36.682, "v3": -36.874, "v4": 22.434, "amplitude": 38.297, "phase_angle": 16.697, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.882, "filter_rmsd": 0.003, "frame": { "rmsd": 0.003, "origin": [ 69.022, 72.292, 80.430 ], "x_axis": [ -0.873, 0.463, -0.155 ], "y_axis": [ -0.039, 0.250, 0.967 ], "z_axis": [ 0.487, 0.850, -0.200 ], "quaternion": [ 0.210, 0.139, 0.762, 0.596 ] } }, { "index": 233, "index_chain": 75, "chain_name": "B", "nt_resnum": 177, "nt_name": "U", "nt_code": "U", "nt_id": "///B/177", "linked_nts": [ "///B/176", "///B/178" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-pair-contact,junction-loop,splayed-apart", "alpha": -69.011, "beta": 163.191, "gamma": 64.562, "delta": 80.972, "epsilon": -91.047, "zeta": 99.651, "epsilon_zeta": 169.302, "bb_type": "--", "chi": -164.391, "glyco_bond": "anti", "C5prime_xyz": [ -1.531, 8.709, 0.748 ], "P_xyz": [ 1.014, 9.270, 0.396 ], "form": ".", "ssZp": 4.148, "Dp": 4.695, "splay_angle": 94.918, "splay_distance": 13.293, "splay_ratio": 0.738, "d22": null, "d64": null, "eta": 176.983, "theta": 97.433, "eta_prime": -167.419, "theta_prime": 121.755, "eta_base": -106.639, "theta_base": 142.479, "v0": 1.904, "v1": -24.143, "v2": 35.922, "v3": -35.745, "v4": 21.312, "amplitude": 37.308, "phase_angle": 15.668, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.717, "filter_rmsd": 0.102, "frame": { "rmsd": 0.004, "origin": [ 67.953, 75.600, 79.037 ], "x_axis": [ -0.626, 0.529, 0.573 ], "y_axis": [ 0.676, 0.002, 0.736 ], "z_axis": [ 0.388, 0.849, -0.359 ], "quaternion": [ -0.066, 0.428, 0.705, 0.562 ] } }, { "index": 234, "index_chain": 76, "chain_name": "B", "nt_resnum": 178, "nt_name": "A", "nt_code": "A", "nt_id": "///B/178", "linked_nts": [ "///B/177", "///B/179" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C2'-endo,non-canonical,non-pair-contact,multiplet,junction-loop,splayed-apart", "alpha": 145.005, "beta": -121.142, "gamma": 141.718, "delta": 145.427, "epsilon": -105.621, "zeta": 97.596, "epsilon_zeta": 156.783, "bb_type": "--", "chi": -159.922, "glyco_bond": "anti", "C5prime_xyz": [ -2.222, 8.630, 0.932 ], "P_xyz": [ 0.355, 8.476, 1.294 ], "form": ".", "ssZp": 0.837, "Dp": 1.056, "splay_angle": 135.413, "splay_distance": 17.177, "splay_ratio": 0.925, "d22": null, "d64": null, "eta": -156.075, "theta": 127.510, "eta_prime": -142.658, "theta_prime": 55.209, "eta_base": -171.586, "theta_base": -2.719, "v0": -23.642, "v1": 37.442, "v2": -36.314, "v3": 23.520, "v4": -0.131, "amplitude": 38.297, "phase_angle": 161.482, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.039, "frame": { "rmsd": 0.005, "origin": [ 80.641, 74.184, 75.335 ], "x_axis": [ -0.902, -0.156, -0.402 ], "y_axis": [ -0.431, 0.286, 0.856 ], "z_axis": [ -0.018, 0.945, -0.325 ], "quaternion": [ 0.121, -0.185, 0.793, 0.568 ] } }, { "index": 235, "index_chain": 77, "chain_name": "B", "nt_resnum": 179, "nt_name": "U", "nt_code": "U", "nt_id": "///B/179", "linked_nts": [ "///B/178", "///B/180" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,anti,~C2'-endo,non-stack,junction-loop,splayed-apart", "alpha": 68.077, "beta": -173.525, "gamma": 69.684, "delta": 149.817, "epsilon": -89.600, "zeta": -55.305, "epsilon_zeta": -34.295, "bb_type": "--", "chi": -167.270, "glyco_bond": "anti", "C5prime_xyz": [ -1.951, 8.420, 1.354 ], "P_xyz": [ 0.064, 8.214, 3.043 ], "form": ".", "ssZp": 0.770, "Dp": 0.770, "splay_angle": 116.268, "splay_distance": 16.247, "splay_ratio": 0.850, "d22": null, "d64": null, "eta": 29.011, "theta": -30.797, "eta_prime": 43.171, "theta_prime": -50.867, "eta_base": 79.568, "theta_base": -30.347, "v0": -20.155, "v1": 35.681, "v2": -36.968, "v3": 26.093, "v4": -3.847, "amplitude": 37.914, "phase_angle": 167.178, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "6p", "suiteness": 0.615, "filter_rmsd": 0.104, "frame": { "rmsd": 0.002, "origin": [ 79.184, 81.987, 90.567 ], "x_axis": [ 0.517, 0.837, -0.180 ], "y_axis": [ 0.689, -0.531, -0.493 ], "z_axis": [ -0.508, 0.131, -0.851 ], "quaternion": [ -0.183, 0.851, 0.448, -0.202 ] } }, { "index": 236, "index_chain": 78, "chain_name": "B", "nt_resnum": 180, "nt_name": "G", "nt_code": "G", "nt_id": "///B/180", "linked_nts": [ "///B/179", "///B/181" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,junction-loop,splayed-apart", "alpha": -65.409, "beta": -168.188, "gamma": 56.100, "delta": 82.909, "epsilon": -149.602, "zeta": -79.545, "epsilon_zeta": -70.057, "bb_type": "BI", "chi": -164.485, "glyco_bond": "anti", "C5prime_xyz": [ -1.239, 8.667, 0.787 ], "P_xyz": [ 1.252, 8.998, 1.479 ], "form": ".", "ssZp": 4.475, "Dp": 4.599, "splay_angle": 22.602, "splay_distance": 4.000, "splay_ratio": 0.208, "d22": null, "d64": null, "eta": 161.504, "theta": -118.678, "eta_prime": -153.095, "theta_prime": -125.984, "eta_base": -125.047, "theta_base": -101.604, "v0": 4.588, "v1": -25.314, "v2": 35.329, "v3": -33.695, "v4": 18.379, "amplitude": 36.056, "phase_angle": 11.526, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "2a", "suiteness": 0.756, "filter_rmsd": 0.003, "frame": { "rmsd": 0.003, "origin": [ 81.732, 71.782, 78.184 ], "x_axis": [ 0.969, 0.094, 0.227 ], "y_axis": [ -0.244, 0.254, 0.936 ], "z_axis": [ 0.031, -0.963, 0.269 ], "quaternion": [ 0.789, 0.601, -0.062, 0.107 ] } }, { "index": 237, "index_chain": 79, "chain_name": "B", "nt_resnum": 181, "nt_name": "G", "nt_code": "G", "nt_id": "///B/181", "linked_nts": [ "///B/180", "///B/182" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,A-minor", "alpha": 142.225, "beta": -149.450, "gamma": -176.455, "delta": 81.738, "epsilon": -136.791, "zeta": -90.834, "epsilon_zeta": -45.958, "bb_type": "BI", "chi": 178.079, "glyco_bond": "anti", "C5prime_xyz": [ -1.573, 8.420, 1.760 ], "P_xyz": [ -0.063, 10.274, 0.684 ], "form": "A", "ssZp": 4.697, "Dp": 4.695, "splay_angle": 19.928, "splay_distance": 3.059, "splay_ratio": 0.175, "d22": null, "d64": null, "eta": 163.560, "theta": -176.762, "eta_prime": -176.785, "theta_prime": -162.979, "eta_base": -129.338, "theta_base": -138.838, "v0": 3.017, "v1": -24.707, "v2": 35.807, "v3": -35.061, "v4": 20.295, "amplitude": 36.916, "phase_angle": 14.076, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.717, "filter_rmsd": 0.005, "frame": { "rmsd": 0.005, "origin": [ 84.215, 68.667, 77.827 ], "x_axis": [ 0.707, 0.285, 0.647 ], "y_axis": [ -0.692, 0.096, 0.715 ], "z_axis": [ 0.142, -0.954, 0.265 ], "quaternion": [ 0.719, 0.580, -0.175, 0.340 ] } }, { "index": 238, "index_chain": 80, "chain_name": "B", "nt_resnum": 182, "nt_name": "U", "nt_code": "U", "nt_id": "///B/182", "linked_nts": [ "///B/181", "///B/183" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop,cap-donor,splayed-apart", "alpha": -40.376, "beta": 172.226, "gamma": 54.063, "delta": 147.446, "epsilon": -88.071, "zeta": -84.110, "epsilon_zeta": -3.961, "bb_type": "--", "chi": -123.155, "glyco_bond": "anti", "C5prime_xyz": [ -1.612, 8.500, -1.016 ], "P_xyz": [ 0.867, 8.920, -0.273 ], "form": ".", "ssZp": 0.597, "Dp": 0.853, "splay_angle": 155.987, "splay_distance": 19.232, "splay_ratio": 0.978, "d22": null, "d64": null, "eta": -149.619, "theta": -59.483, "eta_prime": -127.861, "theta_prime": -88.001, "eta_base": -112.376, "theta_base": -64.551, "v0": -17.452, "v1": 32.389, "v2": -34.066, "v3": 24.895, "v4": -4.899, "amplitude": 34.683, "phase_angle": 169.175, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1b", "suiteness": 0.538, "filter_rmsd": 0.105, "frame": { "rmsd": 0.002, "origin": [ 85.937, 66.147, 77.624 ], "x_axis": [ 0.177, 0.378, 0.909 ], "y_axis": [ -0.890, -0.333, 0.312 ], "z_axis": [ 0.421, -0.864, 0.278 ], "quaternion": [ 0.529, 0.555, -0.231, 0.599 ] } }, { "index": 239, "index_chain": 81, "chain_name": "B", "nt_resnum": 183, "nt_name": "A", "nt_code": "A", "nt_id": "///B/183", "linked_nts": [ "///B/182", "///B/184" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-canonical,non-pair-contact,multiplet,internal-loop,A-minor,ribose-zipper,cap-donor,phosphate,splayed-apart", "alpha": -46.106, "beta": -141.731, "gamma": 59.893, "delta": 82.910, "epsilon": -124.147, "zeta": -111.694, "epsilon_zeta": -12.453, "bb_type": "--", "chi": -157.891, "glyco_bond": "anti", "C5prime_xyz": [ -1.573, 8.804, 0.392 ], "P_xyz": [ 0.777, 9.243, 1.471 ], "form": ".", "ssZp": 4.181, "Dp": 4.623, "splay_angle": 18.278, "splay_distance": 3.057, "splay_ratio": 0.173, "d22": null, "d64": null, "eta": -140.695, "theta": -149.603, "eta_prime": -107.922, "theta_prime": -138.332, "eta_base": -108.246, "theta_base": -97.378, "v0": -0.589, "v1": -20.774, "v2": 32.920, "v3": -34.149, "v4": 21.933, "amplitude": 34.925, "phase_angle": 19.510, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "2a", "suiteness": 0.356, "filter_rmsd": 0.040, "frame": { "rmsd": 0.006, "origin": [ 71.439, 53.600, 76.129 ], "x_axis": [ -0.636, 0.705, 0.313 ], "y_axis": [ 0.749, 0.661, 0.031 ], "z_axis": [ -0.185, 0.255, -0.949 ], "quaternion": [ -0.138, 0.404, 0.901, 0.079 ] } }, { "index": 240, "index_chain": 82, "chain_name": "B", "nt_resnum": 184, "nt_name": "A", "nt_code": "A", "nt_id": "///B/184", "linked_nts": [ "///B/183", "///B/185" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-canonical,non-pair-contact,multiplet,internal-loop,A-minor,ribose-zipper,cap-acceptor,phosphate,splayed-apart", "alpha": -26.983, "beta": 146.617, "gamma": 36.002, "delta": 86.608, "epsilon": -151.967, "zeta": 53.474, "epsilon_zeta": 154.559, "bb_type": "--", "chi": -111.509, "glyco_bond": "anti", "C5prime_xyz": [ -1.553, 7.995, -2.123 ], "P_xyz": [ 0.969, 7.672, -2.806 ], "form": ".", "ssZp": 2.030, "Dp": 4.567, "splay_angle": 122.564, "splay_distance": 16.282, "splay_ratio": 0.878, "d22": null, "d64": null, "eta": 173.807, "theta": 16.594, "eta_prime": -174.056, "theta_prime": -42.021, "eta_base": -131.983, "theta_base": -104.769, "v0": 6.208, "v1": -24.218, "v2": 31.992, "v3": -29.386, "v4": 14.709, "amplitude": 32.298, "phase_angle": 7.904, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1L", "suiteness": 0.036, "filter_rmsd": 0.035, "frame": { "rmsd": 0.008, "origin": [ 70.949, 55.428, 73.729 ], "x_axis": [ -0.106, 0.959, 0.262 ], "y_axis": [ 0.760, 0.248, -0.600 ], "z_axis": [ -0.641, 0.136, -0.756 ], "quaternion": [ -0.311, 0.592, 0.726, -0.160 ] } }, { "index": 241, "index_chain": 83, "chain_name": "B", "nt_resnum": 185, "nt_name": "U", "nt_code": "U", "nt_id": "///B/185", "linked_nts": [ "///B/184", "///B/186" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C2'-endo,BII,non-stack,non-pair-contact,internal-loop,splayed-apart", "alpha": 69.165, "beta": 144.628, "gamma": 61.594, "delta": 145.927, "epsilon": -105.963, "zeta": -160.947, "epsilon_zeta": 54.984, "bb_type": "BII", "chi": -105.310, "glyco_bond": "anti", "C5prime_xyz": [ -2.250, 8.196, -1.847 ], "P_xyz": [ 0.366, 8.377, -2.095 ], "form": ".", "ssZp": 0.867, "Dp": 1.100, "splay_angle": 124.268, "splay_distance": 16.977, "splay_ratio": 0.884, "d22": null, "d64": null, "eta": -38.522, "theta": 171.814, "eta_prime": 41.391, "theta_prime": -179.012, "eta_base": 73.387, "theta_base": -133.750, "v0": -20.679, "v1": 34.315, "v2": -33.956, "v3": 23.035, "v4": -1.743, "amplitude": 35.346, "phase_angle": 163.874, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "5p", "suiteness": 0.767, "filter_rmsd": 0.105, "frame": { "rmsd": 0.010, "origin": [ 76.243, 62.943, 60.290 ], "x_axis": [ -0.693, -0.558, -0.456 ], "y_axis": [ -0.048, -0.595, 0.802 ], "z_axis": [ -0.719, 0.578, 0.386 ], "quaternion": [ -0.156, -0.359, 0.422, 0.818 ] } }, { "index": 242, "index_chain": 84, "chain_name": "B", "nt_resnum": 186, "nt_name": "A", "nt_code": "A", "nt_id": "///B/186", "linked_nts": [ "///B/185", "///B/187" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,multiplet,internal-loop,A-minor,cap-acceptor,phosphate,splayed-apart", "alpha": -80.925, "beta": -122.788, "gamma": 62.695, "delta": 87.196, "epsilon": -146.708, "zeta": -87.606, "epsilon_zeta": -59.103, "bb_type": "BI", "chi": -124.080, "glyco_bond": "anti", "C5prime_xyz": [ -1.666, 8.427, -1.546 ], "P_xyz": [ 0.853, 8.936, -1.024 ], "form": ".", "ssZp": 2.726, "Dp": 4.464, "splay_angle": 66.419, "splay_distance": 10.435, "splay_ratio": 0.549, "d22": null, "d64": null, "eta": -89.413, "theta": -147.899, "eta_prime": -125.148, "theta_prime": -164.039, "eta_base": -141.984, "theta_base": -153.860, "v0": 1.928, "v1": -20.756, "v2": 30.611, "v3": -30.400, "v4": 18.039, "amplitude": 31.734, "phase_angle": 15.290, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.004, "origin": [ 76.773, 67.227, 76.709 ], "x_axis": [ -0.763, -0.640, 0.095 ], "y_axis": [ 0.414, -0.597, -0.687 ], "z_axis": [ 0.496, -0.485, 0.720 ], "quaternion": [ -0.300, 0.169, -0.334, 0.877 ] } }, { "index": 243, "index_chain": 85, "chain_name": "B", "nt_resnum": 187, "nt_name": "A", "nt_code": "A", "nt_id": "///B/187", "linked_nts": [ "///B/186", "///B/188" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,syn,~C3'-endo,non-canonical,non-pair-contact,helix,internal-loop,phosphate", "alpha": 170.307, "beta": 103.206, "gamma": -179.779, "delta": 84.119, "epsilon": -73.386, "zeta": -29.602, "epsilon_zeta": -43.784, "bb_type": "--", "chi": 48.739, "glyco_bond": "syn", "C5prime_xyz": [ -5.375, 3.883, 1.282 ], "P_xyz": [ -6.964, 4.757, 3.184 ], "form": ".", "ssZp": -1.799, "Dp": 4.341, "splay_angle": 73.174, "splay_distance": 11.102, "splay_ratio": 0.602, "d22": null, "d64": null, "eta": 149.995, "theta": -111.313, "eta_prime": 135.178, "theta_prime": -103.575, "eta_base": 135.465, "theta_base": -98.006, "v0": -3.418, "v1": -18.115, "v2": 31.310, "v3": -34.150, "v4": 23.787, "amplitude": 34.317, "phase_angle": 24.167, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1f", "suiteness": 0.355, "filter_rmsd": 0.046, "frame": { "rmsd": 0.018, "origin": [ 85.152, 62.631, 80.900 ], "x_axis": [ 0.554, 0.526, 0.645 ], "y_axis": [ 0.750, 0.021, -0.661 ], "z_axis": [ -0.361, 0.850, -0.383 ], "quaternion": [ 0.546, -0.692, -0.461, -0.103 ] } }, { "index": 244, "index_chain": 86, "chain_name": "B", "nt_resnum": 188, "nt_name": "G", "nt_code": "G", "nt_id": "///B/188", "linked_nts": [ "///B/187", "///B/189" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,~C2'-endo,non-stack,non-canonical,non-pair-contact,internal-loop,cap-acceptor,splayed-apart", "alpha": -123.853, "beta": 126.092, "gamma": -144.852, "delta": 139.969, "epsilon": -140.628, "zeta": 117.982, "epsilon_zeta": 101.390, "bb_type": "--", "chi": 108.211, "glyco_bond": "--", "C5prime_xyz": [ -4.221, 5.764, 2.968 ], "P_xyz": [ -5.125, 7.216, 5.015 ], "form": ".", "ssZp": -1.158, "Dp": 1.966, "splay_angle": 112.685, "splay_distance": 15.467, "splay_ratio": 0.833, "d22": null, "d64": null, "eta": -107.702, "theta": 31.503, "eta_prime": -86.298, "theta_prime": 56.242, "eta_base": -62.492, "theta_base": 87.140, "v0": -23.244, "v1": 34.588, "v2": -31.503, "v3": 19.157, "v4": 2.311, "amplitude": 34.202, "phase_angle": 157.085, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.030, "frame": { "rmsd": 0.030, "origin": [ 76.137, 56.378, 79.206 ], "x_axis": [ -0.612, 0.781, 0.121 ], "y_axis": [ 0.791, 0.603, 0.104 ], "z_axis": [ 0.008, 0.159, -0.987 ], "quaternion": [ -0.032, 0.439, 0.895, 0.074 ] } }, { "index": 245, "index_chain": 87, "chain_name": "B", "nt_resnum": 189, "nt_name": "C", "nt_code": "C", "nt_id": "///B/189", "linked_nts": [ "///B/188", "///B/190" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop,splayed-apart", "alpha": -79.006, "beta": 161.831, "gamma": 46.979, "delta": 81.786, "epsilon": -140.219, "zeta": -79.450, "epsilon_zeta": -60.769, "bb_type": "BI", "chi": -163.397, "glyco_bond": "anti", "C5prime_xyz": [ -1.102, 8.706, 0.731 ], "P_xyz": [ 1.539, 8.736, 0.942 ], "form": "A", "ssZp": 4.490, "Dp": 4.685, "splay_angle": 23.694, "splay_distance": 3.731, "splay_ratio": 0.206, "d22": 4.146, "d64": 4.101, "eta": -178.177, "theta": -140.611, "eta_prime": -179.992, "theta_prime": -139.627, "eta_base": -174.885, "theta_base": -115.526, "v0": 4.155, "v1": -25.474, "v2": 36.082, "v3": -34.698, "v4": 19.188, "amplitude": 36.933, "phase_angle": 12.322, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "0a", "suiteness": 0.562, "filter_rmsd": 0.067, "frame": { "rmsd": 0.005, "origin": [ 89.663, 62.781, 83.110 ], "x_axis": [ -0.759, -0.046, 0.649 ], "y_axis": [ -0.380, -0.779, -0.499 ], "z_axis": [ 0.528, -0.626, 0.574 ], "quaternion": [ 0.095, 0.334, -0.319, 0.882 ] } }, { "index": 246, "index_chain": 88, "chain_name": "B", "nt_resnum": 190, "nt_name": "U", "nt_code": "U", "nt_id": "///B/190", "linked_nts": [ "///B/189", "///B/191" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -54.181, "beta": 166.222, "gamma": 47.889, "delta": 79.845, "epsilon": -140.327, "zeta": -79.038, "epsilon_zeta": -61.289, "bb_type": "BI", "chi": -162.549, "glyco_bond": "anti", "C5prime_xyz": [ -1.373, 8.679, 0.678 ], "P_xyz": [ 1.211, 9.055, 0.890 ], "form": "A", "ssZp": 4.495, "Dp": 4.717, "splay_angle": 23.144, "splay_distance": 3.752, "splay_ratio": 0.204, "d22": null, "d64": null, "eta": 168.179, "theta": -144.631, "eta_prime": -178.657, "theta_prime": -143.117, "eta_base": -139.365, "theta_base": -122.178, "v0": 3.345, "v1": -25.750, "v2": 37.068, "v3": -36.207, "v4": 20.735, "amplitude": 38.156, "phase_angle": 13.717, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.822, "filter_rmsd": 0.106, "frame": { "rmsd": 0.003, "origin": [ 91.125, 61.414, 86.259 ], "x_axis": [ -0.925, -0.338, 0.174 ], "y_axis": [ 0.103, -0.663, -0.742 ], "z_axis": [ 0.366, -0.668, 0.648 ], "quaternion": [ -0.123, 0.150, -0.392, 0.899 ] } }, { "index": 247, "index_chain": 89, "chain_name": "B", "nt_resnum": 191, "nt_name": "G", "nt_code": "G", "nt_id": "///B/191", "linked_nts": [ "///B/190", "///B/192" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge", "alpha": -62.338, "beta": 158.185, "gamma": 64.276, "delta": 80.102, "epsilon": -148.206, "zeta": -71.128, "epsilon_zeta": -77.078, "bb_type": "BI", "chi": -168.790, "glyco_bond": "anti", "C5prime_xyz": [ -1.899, 8.763, 1.060 ], "P_xyz": [ 0.627, 9.459, 1.089 ], "form": "A", "ssZp": 4.490, "Dp": 4.544, "splay_angle": 23.374, "splay_distance": 3.881, "splay_ratio": 0.208, "d22": null, "d64": null, "eta": 168.907, "theta": -140.294, "eta_prime": -175.283, "theta_prime": -141.176, "eta_base": -139.126, "theta_base": -109.798, "v0": -1.803, "v1": -20.929, "v2": 34.321, "v3": -36.365, "v4": 24.045, "amplitude": 36.849, "phase_angle": 21.348, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.717, "filter_rmsd": 0.006, "frame": { "rmsd": 0.006, "origin": [ 91.271, 59.939, 89.706 ], "x_axis": [ -0.826, -0.460, -0.324 ], "y_axis": [ 0.532, -0.450, -0.718 ], "z_axis": [ 0.185, -0.766, 0.616 ], "quaternion": [ -0.292, -0.041, -0.436, 0.850 ] } }, { "index": 248, "index_chain": 90, "chain_name": "B", "nt_resnum": 192, "nt_name": "A", "nt_code": "A", "nt_id": "///B/192", "linked_nts": [ "///B/191", "///B/193" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge", "alpha": -63.530, "beta": 159.921, "gamma": 61.732, "delta": 71.090, "epsilon": -134.640, "zeta": -78.578, "epsilon_zeta": -56.061, "bb_type": "BI", "chi": -170.558, "glyco_bond": "anti", "C5prime_xyz": [ -2.220, 8.845, 1.110 ], "P_xyz": [ 0.265, 9.666, 1.465 ], "form": ".", "ssZp": 4.487, "Dp": 4.554, "splay_angle": 21.449, "splay_distance": 3.386, "splay_ratio": 0.186, "d22": null, "d64": null, "eta": 168.040, "theta": -144.659, "eta_prime": -174.700, "theta_prime": -144.683, "eta_base": -125.197, "theta_base": -93.855, "v0": 0.337, "v1": -27.874, "v2": 43.561, "v3": -43.983, "v4": 27.634, "amplitude": 45.787, "phase_angle": 17.940, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.649, "filter_rmsd": 0.046, "frame": { "rmsd": 0.016, "origin": [ 89.796, 57.327, 92.168 ], "x_axis": [ -0.375, -0.593, -0.713 ], "y_axis": [ 0.909, -0.083, -0.409 ], "z_axis": [ 0.183, -0.801, 0.570 ], "quaternion": [ 0.527, 0.186, 0.425, -0.712 ] } }, { "index": 249, "index_chain": 91, "chain_name": "B", "nt_resnum": 193, "nt_name": "C", "nt_code": "C", "nt_id": "///B/193", "linked_nts": [ "///B/192", "///B/194" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -58.126, "beta": 160.945, "gamma": 48.748, "delta": 79.498, "epsilon": -142.829, "zeta": -76.761, "epsilon_zeta": -66.068, "bb_type": "BI", "chi": -163.412, "glyco_bond": "anti", "C5prime_xyz": [ -1.246, 8.719, 0.702 ], "P_xyz": [ 1.353, 9.031, 0.651 ], "form": "A", "ssZp": 4.539, "Dp": 4.715, "splay_angle": 21.934, "splay_distance": 3.508, "splay_ratio": 0.193, "d22": null, "d64": null, "eta": 158.526, "theta": -145.781, "eta_prime": 172.041, "theta_prime": -146.776, "eta_base": -120.149, "theta_base": -126.772, "v0": 5.159, "v1": -27.349, "v2": 37.983, "v3": -35.997, "v4": 19.437, "amplitude": 38.707, "phase_angle": 11.096, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.619, "filter_rmsd": 0.064, "frame": { "rmsd": 0.003, "origin": [ 89.442, 53.978, 92.517 ], "x_axis": [ 0.397, -0.406, -0.823 ], "y_axis": [ 0.913, 0.271, 0.306 ], "z_axis": [ 0.099, -0.873, 0.478 ], "quaternion": [ 0.733, 0.402, 0.315, -0.450 ] } }, { "index": 250, "index_chain": 92, "chain_name": "B", "nt_resnum": 194, "nt_name": "G", "nt_code": "G", "nt_id": "///B/194", "linked_nts": [ "///B/193", "///B/195" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -64.566, "beta": 162.966, "gamma": 59.255, "delta": 76.863, "epsilon": -144.943, "zeta": -70.991, "epsilon_zeta": -73.952, "bb_type": "BI", "chi": -172.397, "glyco_bond": "anti", "C5prime_xyz": [ -1.570, 8.662, 1.201 ], "P_xyz": [ 0.973, 9.255, 1.256 ], "form": ".", "ssZp": 4.677, "Dp": 4.702, "splay_angle": 28.837, "splay_distance": 4.668, "splay_ratio": 0.256, "d22": null, "d64": null, "eta": 164.088, "theta": -144.116, "eta_prime": 177.089, "theta_prime": -143.138, "eta_base": -145.563, "theta_base": -122.095, "v0": 1.525, "v1": -25.311, "v2": 38.184, "v3": -38.384, "v4": 23.199, "amplitude": 39.818, "phase_angle": 16.472, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.866, "filter_rmsd": 0.003, "frame": { "rmsd": 0.003, "origin": [ 88.601, 50.585, 92.809 ], "x_axis": [ 0.748, -0.035, -0.662 ], "y_axis": [ 0.622, 0.383, 0.683 ], "z_axis": [ 0.230, -0.923, 0.308 ], "quaternion": [ 0.781, 0.514, 0.286, -0.210 ] } }, { "index": 251, "index_chain": 93, "chain_name": "B", "nt_resnum": 195, "nt_name": "G", "nt_code": "G", "nt_id": "///B/195", "linked_nts": [ "///B/194", "///B/196" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop", "alpha": -61.166, "beta": 169.010, "gamma": 64.657, "delta": 78.060, "epsilon": -148.630, "zeta": -83.826, "epsilon_zeta": -64.805, "bb_type": "BI", "chi": -172.549, "glyco_bond": "anti", "C5prime_xyz": [ -1.826, 8.717, 1.203 ], "P_xyz": [ 0.637, 9.559, 1.376 ], "form": "A", "ssZp": 4.613, "Dp": 4.615, "splay_angle": 23.174, "splay_distance": 3.630, "splay_ratio": 0.204, "d22": null, "d64": null, "eta": 176.130, "theta": -158.520, "eta_prime": -168.508, "theta_prime": -156.401, "eta_base": -131.003, "theta_base": -132.991, "v0": 0.395, "v1": -23.711, "v2": 36.754, "v3": -37.508, "v4": 23.385, "amplitude": 38.649, "phase_angle": 18.015, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.744, "filter_rmsd": 0.004, "frame": { "rmsd": 0.004, "origin": [ 89.093, 46.079, 91.693 ], "x_axis": [ 0.961, 0.153, -0.230 ], "y_axis": [ 0.151, 0.409, 0.900 ], "z_axis": [ 0.232, -0.899, 0.370 ], "quaternion": [ 0.828, 0.544, 0.140, 0.001 ] } }, { "index": 252, "index_chain": 94, "chain_name": "B", "nt_resnum": 196, "nt_name": "A", "nt_code": "A", "nt_id": "///B/196", "linked_nts": [ "///B/195", "///B/197" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop", "alpha": -58.308, "beta": 170.031, "gamma": 55.485, "delta": 81.602, "epsilon": -136.970, "zeta": -81.236, "epsilon_zeta": -55.734, "bb_type": "BI", "chi": -161.219, "glyco_bond": "anti", "C5prime_xyz": [ -1.424, 8.719, 0.681 ], "P_xyz": [ 1.154, 9.096, 0.952 ], "form": "A", "ssZp": 4.379, "Dp": 4.637, "splay_angle": 22.372, "splay_distance": 3.552, "splay_ratio": 0.194, "d22": null, "d64": null, "eta": 177.873, "theta": -142.118, "eta_prime": -174.214, "theta_prime": -139.449, "eta_base": -143.618, "theta_base": -105.891, "v0": 3.019, "v1": -24.582, "v2": 35.622, "v3": -34.938, "v4": 20.160, "amplitude": 36.725, "phase_angle": 14.080, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.847, "filter_rmsd": 0.039, "frame": { "rmsd": 0.005, "origin": [ 89.778, 42.571, 91.058 ], "x_axis": [ 0.894, 0.365, 0.260 ], "y_axis": [ -0.351, 0.210, 0.912 ], "z_axis": [ 0.279, -0.907, 0.316 ], "quaternion": [ 0.778, 0.585, 0.006, 0.230 ] } }, { "index": 253, "index_chain": 95, "chain_name": "B", "nt_resnum": 197, "nt_name": "C", "nt_code": "C", "nt_id": "///B/197", "linked_nts": [ "///B/196", "///B/198" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BII,non-canonical,non-pair-contact,helix-end,multiplet,internal-loop", "alpha": -59.863, "beta": 162.990, "gamma": 54.246, "delta": 83.608, "epsilon": -93.124, "zeta": -159.675, "epsilon_zeta": 66.551, "bb_type": "BII", "chi": -156.704, "glyco_bond": "anti", "C5prime_xyz": [ -1.375, 8.801, 0.360 ], "P_xyz": [ 1.231, 9.077, 0.408 ], "form": ".", "ssZp": 3.707, "Dp": 4.546, "splay_angle": 56.121, "splay_distance": 8.896, "splay_ratio": 0.472, "d22": null, "d64": null, "eta": -178.002, "theta": 163.428, "eta_prime": -167.813, "theta_prime": -173.363, "eta_base": -127.721, "theta_base": -177.988, "v0": 0.804, "v1": -21.913, "v2": 33.396, "v3": -33.960, "v4": 20.953, "amplitude": 34.996, "phase_angle": 17.393, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.842, "filter_rmsd": 0.064, "frame": { "rmsd": 0.004, "origin": [ 92.096, 40.031, 91.948 ], "x_axis": [ 0.418, 0.593, 0.688 ], "y_axis": [ -0.782, -0.151, 0.605 ], "z_axis": [ 0.463, -0.791, 0.401 ], "quaternion": [ 0.646, 0.540, -0.087, 0.533 ] } }, { "index": 254, "index_chain": 96, "chain_name": "B", "nt_resnum": 198, "nt_name": "A", "nt_code": "A", "nt_id": "///B/198", "linked_nts": [ "///B/197", "///B/199" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C2'-endo,BII,non-canonical,non-pair-contact,helix-end,internal-loop,splayed-apart", "alpha": -75.167, "beta": 141.464, "gamma": 66.598, "delta": 148.332, "epsilon": -104.996, "zeta": 147.986, "epsilon_zeta": 107.018, "bb_type": "BII", "chi": -131.571, "glyco_bond": "anti", "C5prime_xyz": [ -2.154, 8.677, -0.494 ], "P_xyz": [ 0.427, 8.947, -0.117 ], "form": ".", "ssZp": 0.751, "Dp": 0.920, "splay_angle": 135.965, "splay_distance": 18.242, "splay_ratio": 0.927, "d22": null, "d64": null, "eta": -160.565, "theta": 138.718, "eta_prime": -151.901, "theta_prime": 82.603, "eta_base": -174.513, "theta_base": 54.500, "v0": -22.025, "v1": 36.558, "v2": -36.356, "v3": 24.650, "v4": -1.884, "amplitude": 37.818, "phase_angle": 164.017, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "3b", "suiteness": 0.015, "filter_rmsd": 0.037, "frame": { "rmsd": 0.009, "origin": [ 91.430, 31.282, 90.485 ], "x_axis": [ 0.459, 0.886, 0.067 ], "y_axis": [ -0.638, 0.276, 0.719 ], "z_axis": [ 0.618, -0.373, 0.692 ], "quaternion": [ 0.779, 0.350, 0.177, 0.489 ] } }, { "index": 255, "index_chain": 97, "chain_name": "B", "nt_resnum": 199, "nt_name": "U", "nt_code": "U", "nt_id": "///B/199", "linked_nts": [ "///B/198", "///B/200" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,anti,~C3'-endo,non-stack,internal-loop,splayed-apart", "alpha": -55.975, "beta": -135.151, "gamma": 168.914, "delta": 82.031, "epsilon": -98.056, "zeta": -31.253, "epsilon_zeta": -66.803, "bb_type": "--", "chi": -159.640, "glyco_bond": "anti", "C5prime_xyz": [ -1.688, 8.782, 0.480 ], "P_xyz": [ -0.215, 9.687, -1.504 ], "form": ".", "ssZp": 4.020, "Dp": 4.658, "splay_angle": 136.672, "splay_distance": 17.306, "splay_ratio": 0.929, "d22": null, "d64": null, "eta": 30.991, "theta": -52.607, "eta_prime": 26.614, "theta_prime": -48.667, "eta_base": 42.306, "theta_base": -58.145, "v0": 1.682, "v1": -23.598, "v2": 35.346, "v3": -35.264, "v4": 21.224, "amplitude": 36.772, "phase_angle": 16.007, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.103, "frame": { "rmsd": 0.007, "origin": [ 74.793, 29.599, 97.778 ], "x_axis": [ 0.267, 0.777, 0.571 ], "y_axis": [ 0.950, -0.111, -0.293 ], "z_axis": [ -0.165, 0.620, -0.767 ], "quaternion": [ -0.312, 0.732, 0.589, 0.139 ] } }, { "index": 256, "index_chain": 98, "chain_name": "B", "nt_resnum": 200, "nt_name": "G", "nt_code": "G", "nt_id": "///B/200", "linked_nts": [ "///B/199", "///B/201" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,internal-loop,splayed-apart", "alpha": -142.117, "beta": -129.758, "gamma": 147.766, "delta": 81.506, "epsilon": -143.326, "zeta": -78.642, "epsilon_zeta": -64.683, "bb_type": "BI", "chi": 179.586, "glyco_bond": "anti", "C5prime_xyz": [ -1.527, 8.378, 1.780 ], "P_xyz": [ 0.850, 8.937, 0.802 ], "form": "A", "ssZp": 4.625, "Dp": 4.671, "splay_angle": 28.201, "splay_distance": 4.371, "splay_ratio": 0.247, "d22": null, "d64": null, "eta": -166.536, "theta": -145.872, "eta_prime": -119.998, "theta_prime": -153.555, "eta_base": -70.212, "theta_base": -139.117, "v0": 4.793, "v1": -26.339, "v2": 36.696, "v3": -34.969, "v4": 18.965, "amplitude": 37.437, "phase_angle": 11.414, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.007, "frame": { "rmsd": 0.007, "origin": [ 89.310, 32.774, 88.909 ], "x_axis": [ 0.161, -0.837, -0.524 ], "y_axis": [ -0.871, -0.370, 0.324 ], "z_axis": [ -0.464, 0.404, -0.788 ], "quaternion": [ -0.026, 0.761, -0.561, -0.324 ] } }, { "index": 257, "index_chain": 99, "chain_name": "B", "nt_resnum": 201, "nt_name": "G", "nt_code": "G", "nt_id": "///B/201", "linked_nts": [ "///B/200", "///B/202" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,A-minor", "alpha": -59.387, "beta": 177.494, "gamma": 48.837, "delta": 81.255, "epsilon": -141.182, "zeta": -68.690, "epsilon_zeta": -72.492, "bb_type": "BI", "chi": -169.895, "glyco_bond": "anti", "C5prime_xyz": [ -1.371, 8.607, 1.172 ], "P_xyz": [ 1.135, 8.963, 1.860 ], "form": ".", "ssZp": 4.637, "Dp": 4.699, "splay_angle": 25.341, "splay_distance": 3.890, "splay_ratio": 0.220, "d22": null, "d64": null, "eta": 173.502, "theta": -134.970, "eta_prime": -177.448, "theta_prime": -129.936, "eta_base": -146.697, "theta_base": -79.798, "v0": 4.861, "v1": -26.647, "v2": 37.104, "v3": -35.318, "v4": 19.221, "amplitude": 37.851, "phase_angle": 11.403, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.913, "filter_rmsd": 0.003, "frame": { "rmsd": 0.003, "origin": [ 89.708, 35.249, 85.327 ], "x_axis": [ -0.297, -0.916, -0.269 ], "y_axis": [ -0.783, 0.072, 0.618 ], "z_axis": [ -0.546, 0.394, -0.739 ], "quaternion": [ -0.095, -0.585, 0.726, 0.348 ] } }, { "index": 258, "index_chain": 100, "chain_name": "B", "nt_resnum": 202, "nt_name": "U", "nt_code": "U", "nt_id": "///B/202", "linked_nts": [ "///B/201", "///B/203" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -62.214, "beta": 166.700, "gamma": 56.673, "delta": 81.445, "epsilon": -136.730, "zeta": -89.886, "epsilon_zeta": -46.844, "bb_type": "BI", "chi": -161.840, "glyco_bond": "anti", "C5prime_xyz": [ -1.270, 8.670, 0.634 ], "P_xyz": [ 1.355, 8.880, 0.613 ], "form": "A", "ssZp": 4.453, "Dp": 4.714, "splay_angle": 21.559, "splay_distance": 3.461, "splay_ratio": 0.188, "d22": 4.507, "d64": 4.396, "eta": 167.344, "theta": -148.351, "eta_prime": -172.079, "theta_prime": -148.618, "eta_base": -104.516, "theta_base": -138.580, "v0": 2.969, "v1": -24.790, "v2": 35.949, "v3": -35.242, "v4": 20.352, "amplitude": 37.069, "phase_angle": 14.121, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.945, "filter_rmsd": 0.107, "frame": { "rmsd": 0.003, "origin": [ 87.426, 33.923, 82.470 ], "x_axis": [ -0.797, -0.541, 0.270 ], "y_axis": [ -0.360, 0.783, 0.507 ], "z_axis": [ -0.485, 0.307, -0.819 ], "quaternion": [ -0.205, -0.244, 0.922, 0.221 ] } }, { "index": 259, "index_chain": 101, "chain_name": "B", "nt_resnum": 203, "nt_name": "C", "nt_code": "C", "nt_id": "///B/203", "linked_nts": [ "///B/202", "///B/204" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -52.423, "beta": 161.524, "gamma": 46.215, "delta": 79.298, "epsilon": -148.036, "zeta": -76.361, "epsilon_zeta": -71.675, "bb_type": "BI", "chi": -156.827, "glyco_bond": "anti", "C5prime_xyz": [ -1.422, 8.842, 0.317 ], "P_xyz": [ 1.157, 9.318, 0.340 ], "form": "A", "ssZp": 4.340, "Dp": 4.633, "splay_angle": 24.219, "splay_distance": 3.904, "splay_ratio": 0.211, "d22": 4.130, "d64": 4.242, "eta": 164.468, "theta": -147.564, "eta_prime": 173.989, "theta_prime": -147.036, "eta_base": -163.049, "theta_base": -123.418, "v0": 0.490, "v1": -23.413, "v2": 36.129, "v3": -36.835, "v4": 22.927, "amplitude": 37.962, "phase_angle": 17.873, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.617, "filter_rmsd": 0.063, "frame": { "rmsd": 0.002, "origin": [ 86.567, 33.657, 79.128 ], "x_axis": [ -0.731, -0.222, 0.645 ], "y_axis": [ -0.084, 0.968, 0.237 ], "z_axis": [ -0.677, 0.119, -0.726 ], "quaternion": [ -0.357, -0.083, 0.925, 0.096 ] } }, { "index": 260, "index_chain": 102, "chain_name": "B", "nt_resnum": 204, "nt_name": "C", "nt_code": "C", "nt_id": "///B/204", "linked_nts": [ "///B/203", "///B/205" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -57.473, "beta": 171.923, "gamma": 48.028, "delta": 79.843, "epsilon": -144.288, "zeta": -67.501, "epsilon_zeta": -76.786, "bb_type": "BI", "chi": -162.247, "glyco_bond": "anti", "C5prime_xyz": [ -1.466, 8.810, 0.593 ], "P_xyz": [ 1.081, 9.356, 0.897 ], "form": "A", "ssZp": 4.471, "Dp": 4.654, "splay_angle": 23.198, "splay_distance": 3.749, "splay_ratio": 0.203, "d22": 3.835, "d64": 3.927, "eta": 168.352, "theta": -138.000, "eta_prime": 179.746, "theta_prime": -135.559, "eta_base": -143.824, "theta_base": -97.508, "v0": 0.130, "v1": -22.762, "v2": 35.490, "v3": -36.358, "v4": 22.840, "amplitude": 37.399, "phase_angle": 18.386, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.898, "filter_rmsd": 0.063, "frame": { "rmsd": 0.004, "origin": [ 83.502, 32.695, 76.909 ], "x_axis": [ -0.483, 0.266, 0.835 ], "y_axis": [ 0.287, 0.948, -0.136 ], "z_axis": [ -0.828, 0.174, -0.534 ], "quaternion": [ -0.483, 0.160, 0.861, 0.011 ] } }, { "index": 261, "index_chain": 103, "chain_name": "B", "nt_resnum": 205, "nt_name": "U", "nt_code": "U", "nt_id": "///B/205", "linked_nts": [ "///B/204", "///B/206" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop", "alpha": -64.287, "beta": 169.651, "gamma": 56.054, "delta": 79.731, "epsilon": -120.271, "zeta": -71.776, "epsilon_zeta": -48.494, "bb_type": "--", "chi": -159.030, "glyco_bond": "anti", "C5prime_xyz": [ -1.623, 8.796, 0.410 ], "P_xyz": [ 0.914, 9.452, 0.303 ], "form": ".", "ssZp": 4.227, "Dp": 4.719, "splay_angle": 35.723, "splay_distance": 5.651, "splay_ratio": 0.307, "d22": null, "d64": null, "eta": 171.323, "theta": -121.359, "eta_prime": -172.839, "theta_prime": -115.699, "eta_base": -121.236, "theta_base": -65.394, "v0": -0.070, "v1": -22.690, "v2": 35.587, "v3": -36.561, "v4": 23.089, "amplitude": 37.565, "phase_angle": 18.680, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.969, "filter_rmsd": 0.104, "frame": { "rmsd": 0.005, "origin": [ 79.813, 33.195, 77.354 ], "x_axis": [ -0.108, 0.782, 0.613 ], "y_axis": [ 0.399, 0.599, -0.694 ], "z_axis": [ -0.911, 0.170, -0.377 ], "quaternion": [ 0.528, -0.409, -0.722, 0.182 ] } }, { "index": 262, "index_chain": 104, "chain_name": "B", "nt_resnum": 206, "nt_name": "A", "nt_code": "A", "nt_id": "///B/206", "linked_nts": [ "///B/205", "///B/207" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-canonical,non-pair-contact,helix,internal-loop", "alpha": -54.589, "beta": 162.348, "gamma": 52.985, "delta": 82.110, "epsilon": -154.557, "zeta": -128.504, "epsilon_zeta": -26.053, "bb_type": "--", "chi": -151.253, "glyco_bond": "anti", "C5prime_xyz": [ -1.275, 8.742, 0.052 ], "P_xyz": [ 1.326, 9.027, -0.177 ], "form": ".", "ssZp": 4.190, "Dp": 4.574, "splay_angle": 52.210, "splay_distance": 7.996, "splay_ratio": 0.440, "d22": null, "d64": null, "eta": 160.327, "theta": 160.890, "eta_prime": -171.922, "theta_prime": 160.523, "eta_base": -103.170, "theta_base": 162.120, "v0": 3.093, "v1": -24.423, "v2": 35.186, "v3": -34.443, "v4": 19.782, "amplitude": 36.241, "phase_angle": 13.855, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.533, "filter_rmsd": 0.038, "frame": { "rmsd": 0.004, "origin": [ 77.967, 38.530, 77.601 ], "x_axis": [ 0.606, 0.767, -0.210 ], "y_axis": [ 0.052, -0.302, -0.952 ], "z_axis": [ -0.794, 0.565, -0.223 ], "quaternion": [ 0.520, -0.730, -0.281, 0.344 ] } }, { "index": 263, "index_chain": 105, "chain_name": "B", "nt_resnum": 207, "nt_name": "A", "nt_code": "A", "nt_id": "///B/207", "linked_nts": [ "///B/206", "///B/208" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-canonical,non-pair-contact,helix,internal-loop", "alpha": -52.472, "beta": 141.360, "gamma": 61.677, "delta": 78.407, "epsilon": -120.068, "zeta": -64.754, "epsilon_zeta": -55.314, "bb_type": "--", "chi": -166.903, "glyco_bond": "anti", "C5prime_xyz": [ -1.530, 8.674, 0.930 ], "P_xyz": [ 0.997, 8.968, 0.329 ], "form": ".", "ssZp": 4.528, "Dp": 4.778, "splay_angle": 42.734, "splay_distance": 6.549, "splay_ratio": 0.364, "d22": null, "d64": null, "eta": -177.723, "theta": -111.363, "eta_prime": 176.227, "theta_prime": -107.321, "eta_base": 169.709, "theta_base": -58.467, "v0": 1.541, "v1": -24.926, "v2": 37.581, "v3": -37.713, "v4": 22.789, "amplitude": 39.174, "phase_angle": 16.397, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "7a", "suiteness": 0.595, "filter_rmsd": 0.037, "frame": { "rmsd": 0.002, "origin": [ 70.460, 35.905, 78.434 ], "x_axis": [ 0.485, 0.867, 0.115 ], "y_axis": [ 0.306, -0.045, -0.951 ], "z_axis": [ -0.819, 0.497, -0.287 ], "quaternion": [ 0.537, -0.674, -0.435, 0.261 ] } }, { "index": 264, "index_chain": 106, "chain_name": "B", "nt_resnum": 208, "nt_name": "C", "nt_code": "C", "nt_id": "///B/208", "linked_nts": [ "///B/207", "///B/209" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop", "alpha": -51.768, "beta": 151.147, "gamma": 57.984, "delta": 79.436, "epsilon": -141.905, "zeta": -79.531, "epsilon_zeta": -62.374, "bb_type": "BI", "chi": -166.122, "glyco_bond": "anti", "C5prime_xyz": [ -1.275, 8.701, 0.892 ], "P_xyz": [ 1.318, 8.868, 0.563 ], "form": "A", "ssZp": 4.569, "Dp": 4.707, "splay_angle": 20.919, "splay_distance": 3.397, "splay_ratio": 0.186, "d22": 4.628, "d64": 4.380, "eta": 159.945, "theta": -144.482, "eta_prime": -165.010, "theta_prime": -140.052, "eta_base": -84.759, "theta_base": -133.197, "v0": 4.043, "v1": -26.574, "v2": 37.956, "v3": -36.526, "v4": 20.560, "amplitude": 38.918, "phase_angle": 12.767, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.439, "filter_rmsd": 0.066, "frame": { "rmsd": 0.005, "origin": [ 71.824, 41.457, 75.239 ], "x_axis": [ 0.497, 0.197, -0.845 ], "y_axis": [ -0.493, -0.738, -0.461 ], "z_axis": [ -0.715, 0.645, -0.269 ], "quaternion": [ -0.350, 0.791, -0.093, -0.493 ] } }, { "index": 265, "index_chain": 107, "chain_name": "B", "nt_resnum": 209, "nt_name": "C", "nt_code": "C", "nt_id": "///B/209", "linked_nts": [ "///B/208", "///B/210" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge,splayed-apart", "alpha": -41.886, "beta": -175.086, "gamma": 46.747, "delta": 136.598, "epsilon": -80.434, "zeta": -95.998, "epsilon_zeta": 15.563, "bb_type": "--", "chi": -122.253, "glyco_bond": "anti", "C5prime_xyz": [ -1.530, 8.592, -1.222 ], "P_xyz": [ 0.813, 9.463, -0.487 ], "form": ".", "ssZp": 0.655, "Dp": 1.233, "splay_angle": 140.466, "splay_distance": 19.160, "splay_ratio": 0.941, "d22": null, "d64": null, "eta": -144.602, "theta": -54.471, "eta_prime": -131.143, "theta_prime": -98.736, "eta_base": -125.511, "theta_base": -114.194, "v0": -20.362, "v1": 30.895, "v2": -29.307, "v3": 18.301, "v4": 1.135, "amplitude": 31.331, "phase_angle": 159.296, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1b", "suiteness": 0.520, "filter_rmsd": 0.071, "frame": { "rmsd": 0.010, "origin": [ 70.884, 44.708, 74.941 ], "x_axis": [ 0.431, -0.389, -0.814 ], "y_axis": [ -0.810, -0.564, -0.159 ], "z_axis": [ -0.398, 0.728, -0.558 ], "quaternion": [ -0.278, 0.799, -0.375, -0.379 ] } }, { "index": 266, "index_chain": 108, "chain_name": "B", "nt_resnum": 210, "nt_name": "A", "nt_code": "A", "nt_id": "///B/210", "linked_nts": [ "///B/209", "///B/211" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,anti,~C2'-endo,non-pair-contact,bulge,splayed-apart", "alpha": 67.243, "beta": -144.619, "gamma": 29.254, "delta": 142.764, "epsilon": -89.775, "zeta": -65.484, "epsilon_zeta": -24.290, "bb_type": "--", "chi": -116.786, "glyco_bond": "anti", "C5prime_xyz": [ -1.367, 8.360, -1.348 ], "P_xyz": [ 0.369, 9.813, 0.074 ], "form": ".", "ssZp": 0.606, "Dp": 1.314, "splay_angle": 171.865, "splay_distance": 19.153, "splay_ratio": 0.998, "d22": null, "d64": null, "eta": -57.235, "theta": -51.834, "eta_prime": -3.526, "theta_prime": -72.871, "eta_base": 12.538, "theta_base": -69.807, "v0": -17.403, "v1": 30.619, "v2": -31.509, "v3": 22.303, "v4": -3.281, "amplitude": 32.341, "phase_angle": 166.973, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.037, "frame": { "rmsd": 0.007, "origin": [ 51.840, 45.612, 76.833 ], "x_axis": [ -0.263, -0.674, 0.690 ], "y_axis": [ 0.940, -0.341, 0.024 ], "z_axis": [ 0.219, 0.655, 0.723 ], "quaternion": [ 0.529, -0.298, -0.222, -0.763 ] } }, { "index": 267, "index_chain": 109, "chain_name": "B", "nt_resnum": 211, "nt_name": "C", "nt_code": "C", "nt_id": "///B/211", "linked_nts": [ "///B/210", "///B/212" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,bulge,A-minor,phosphate,splayed-apart", "alpha": -43.260, "beta": -128.484, "gamma": 66.860, "delta": 80.469, "epsilon": -149.344, "zeta": -68.999, "epsilon_zeta": -80.344, "bb_type": "BI", "chi": -169.269, "glyco_bond": "anti", "C5prime_xyz": [ -1.210, 8.643, 1.057 ], "P_xyz": [ 1.154, 8.348, 2.193 ], "form": ".", "ssZp": 4.631, "Dp": 4.673, "splay_angle": 29.111, "splay_distance": 4.617, "splay_ratio": 0.255, "d22": null, "d64": null, "eta": -132.430, "theta": -139.094, "eta_prime": -92.049, "theta_prime": -135.674, "eta_base": -73.033, "theta_base": -117.510, "v0": 3.062, "v1": -25.589, "v2": 37.199, "v3": -36.374, "v4": 20.995, "amplitude": 38.351, "phase_angle": 14.081, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "2a", "suiteness": 0.147, "filter_rmsd": 0.066, "frame": { "rmsd": 0.004, "origin": [ 70.445, 47.393, 72.647 ], "x_axis": [ -0.129, -0.800, -0.586 ], "y_axis": [ -0.896, -0.160, 0.415 ], "z_axis": [ -0.426, 0.579, -0.696 ], "quaternion": [ -0.062, 0.657, -0.645, -0.385 ] } }, { "index": 268, "index_chain": 110, "chain_name": "B", "nt_resnum": 212, "nt_name": "G", "nt_code": "G", "nt_id": "///B/212", "linked_nts": [ "///B/211", "///B/213" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,A-minor,phosphate", "alpha": -72.904, "beta": 160.397, "gamma": 81.918, "delta": 78.942, "epsilon": -149.183, "zeta": -76.898, "epsilon_zeta": -72.285, "bb_type": "BI", "chi": 179.738, "glyco_bond": "anti", "C5prime_xyz": [ -1.728, 8.531, 1.632 ], "P_xyz": [ 0.767, 9.311, 1.482 ], "form": "A", "ssZp": 4.614, "Dp": 4.618, "splay_angle": 24.505, "splay_distance": 3.924, "splay_ratio": 0.219, "d22": null, "d64": null, "eta": 175.689, "theta": -151.596, "eta_prime": -166.068, "theta_prime": -153.749, "eta_base": -129.468, "theta_base": -136.969, "v0": -1.861, "v1": -21.441, "v2": 35.135, "v3": -37.228, "v4": 24.655, "amplitude": 37.728, "phase_angle": 21.366, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.081, "filter_rmsd": 0.003, "frame": { "rmsd": 0.003, "origin": [ 70.466, 49.574, 68.577 ], "x_axis": [ -0.539, -0.750, -0.382 ], "y_axis": [ -0.699, 0.146, 0.700 ], "z_axis": [ -0.469, 0.644, -0.604 ], "quaternion": [ -0.029, -0.479, 0.757, 0.444 ] } }, { "index": 269, "index_chain": 111, "chain_name": "B", "nt_resnum": 213, "nt_name": "C", "nt_code": "C", "nt_id": "///B/213", "linked_nts": [ "///B/212", "///B/214" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,cap-donor", "alpha": -64.544, "beta": -179.041, "gamma": 51.126, "delta": 80.088, "epsilon": -143.221, "zeta": -65.658, "epsilon_zeta": -77.563, "bb_type": "BI", "chi": -163.933, "glyco_bond": "anti", "C5prime_xyz": [ -1.377, 8.764, 0.692 ], "P_xyz": [ 1.161, 9.319, 1.064 ], "form": "A", "ssZp": 4.540, "Dp": 4.693, "splay_angle": 23.183, "splay_distance": 3.876, "splay_ratio": 0.208, "d22": null, "d64": null, "eta": 171.377, "theta": -137.930, "eta_prime": 179.539, "theta_prime": -136.637, "eta_base": -151.286, "theta_base": -109.105, "v0": 1.694, "v1": -24.283, "v2": 36.406, "v3": -36.335, "v4": 21.800, "amplitude": 37.876, "phase_angle": 16.014, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.947, "filter_rmsd": 0.063, "frame": { "rmsd": 0.004, "origin": [ 70.830, 51.117, 64.988 ], "x_axis": [ -0.843, -0.539, -0.007 ], "y_axis": [ -0.352, 0.542, 0.763 ], "z_axis": [ -0.407, 0.645, -0.646 ], "quaternion": [ -0.115, -0.256, 0.870, 0.404 ] } }, { "index": 270, "index_chain": 112, "chain_name": "B", "nt_resnum": 214, "nt_name": "A", "nt_code": "A", "nt_id": "///B/214", "linked_nts": [ "///B/213", "///B/215" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,internal-loop", "alpha": -71.227, "beta": 168.471, "gamma": 64.275, "delta": 75.178, "epsilon": -152.622, "zeta": -74.083, "epsilon_zeta": -78.538, "bb_type": "BI", "chi": -168.382, "glyco_bond": "anti", "C5prime_xyz": [ -1.897, 8.792, 0.927 ], "P_xyz": [ 0.531, 9.764, 1.018 ], "form": "A", "ssZp": 4.543, "Dp": 4.585, "splay_angle": 23.644, "splay_distance": 3.811, "splay_ratio": 0.209, "d22": null, "d64": null, "eta": 163.989, "theta": -156.212, "eta_prime": -178.201, "theta_prime": -156.327, "eta_base": -133.417, "theta_base": -132.209, "v0": -3.765, "v1": -20.869, "v2": 36.131, "v3": -39.338, "v4": 27.116, "amplitude": 39.529, "phase_angle": 23.931, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.731, "filter_rmsd": 0.038, "frame": { "rmsd": 0.003, "origin": [ 68.530, 51.243, 61.871 ], "x_axis": [ -0.782, -0.300, 0.547 ], "y_axis": [ 0.123, 0.786, 0.606 ], "z_axis": [ -0.611, 0.541, -0.578 ], "quaternion": [ -0.326, -0.050, 0.887, 0.323 ] } }, { "index": 271, "index_chain": 113, "chain_name": "B", "nt_resnum": 215, "nt_name": "G", "nt_code": "G", "nt_id": "///B/215", "linked_nts": [ "///B/214", "///B/216" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,internal-loop", "alpha": -72.378, "beta": 165.116, "gamma": 68.549, "delta": 78.325, "epsilon": -151.454, "zeta": -68.425, "epsilon_zeta": -83.029, "bb_type": "BI", "chi": -171.403, "glyco_bond": "anti", "C5prime_xyz": [ -1.660, 8.700, 1.108 ], "P_xyz": [ 0.852, 9.419, 0.920 ], "form": "A", "ssZp": 4.646, "Dp": 4.650, "splay_angle": 26.528, "splay_distance": 4.065, "splay_ratio": 0.231, "d22": null, "d64": null, "eta": 167.540, "theta": -144.719, "eta_prime": -179.347, "theta_prime": -144.701, "eta_base": -140.567, "theta_base": -106.213, "v0": 0.595, "v1": -24.106, "v2": 37.091, "v3": -37.743, "v4": 23.429, "amplitude": 38.938, "phase_angle": 17.718, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.564, "filter_rmsd": 0.004, "frame": { "rmsd": 0.004, "origin": [ 65.900, 51.324, 59.114 ], "x_axis": [ -0.646, 0.141, 0.750 ], "y_axis": [ 0.465, 0.852, 0.241 ], "z_axis": [ -0.605, 0.505, -0.616 ], "quaternion": [ -0.384, 0.172, 0.882, 0.211 ] } }, { "index": 272, "index_chain": 114, "chain_name": "B", "nt_resnum": 216, "nt_name": "C", "nt_code": "C", "nt_id": "///B/216", "linked_nts": [ "///B/215", "///B/217" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,internal-loop", "alpha": -68.885, "beta": -179.343, "gamma": 54.503, "delta": 80.329, "epsilon": -144.086, "zeta": -74.081, "epsilon_zeta": -70.005, "bb_type": "BI", "chi": -165.513, "glyco_bond": "anti", "C5prime_xyz": [ -1.128, 8.649, 0.825 ], "P_xyz": [ 1.475, 8.856, 1.131 ], "form": "A", "ssZp": 4.583, "Dp": 4.719, "splay_angle": 26.105, "splay_distance": 4.134, "splay_ratio": 0.229, "d22": 4.067, "d64": 4.489, "eta": 169.859, "theta": -142.753, "eta_prime": -176.487, "theta_prime": -139.999, "eta_base": -121.715, "theta_base": -115.858, "v0": 5.623, "v1": -27.473, "v2": 37.858, "v3": -35.577, "v4": 18.870, "amplitude": 38.489, "phase_angle": 10.384, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.948, "filter_rmsd": 0.066, "frame": { "rmsd": 0.005, "origin": [ 62.113, 52.555, 58.299 ], "x_axis": [ -0.099, 0.676, 0.731 ], "y_axis": [ 0.774, 0.514, -0.370 ], "z_axis": [ -0.626, 0.529, -0.574 ], "quaternion": [ -0.459, 0.490, 0.739, 0.053 ] } }, { "index": 273, "index_chain": 115, "chain_name": "B", "nt_resnum": 217, "nt_name": "C", "nt_code": "C", "nt_id": "///B/217", "linked_nts": [ "///B/216", "///B/218" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,isolated-canonical,non-pair-contact,helix,multiplet,internal-loop", "alpha": -55.653, "beta": 166.948, "gamma": 55.253, "delta": 79.307, "epsilon": -134.325, "zeta": -69.463, "epsilon_zeta": -64.862, "bb_type": "BI", "chi": -170.674, "glyco_bond": "anti", "C5prime_xyz": [ -1.539, 8.718, 1.157 ], "P_xyz": [ 0.998, 9.178, 1.600 ], "form": ".", "ssZp": 4.565, "Dp": 4.656, "splay_angle": 24.775, "splay_distance": 3.906, "splay_ratio": 0.215, "d22": null, "d64": null, "eta": 175.459, "theta": -131.584, "eta_prime": -171.261, "theta_prime": -121.847, "eta_base": -133.989, "theta_base": -74.537, "v0": 1.896, "v1": -24.415, "v2": 36.472, "v3": -36.400, "v4": 21.794, "amplitude": 37.914, "phase_angle": 15.857, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.901, "filter_rmsd": 0.065, "frame": { "rmsd": 0.006, "origin": [ 58.538, 54.555, 57.745 ], "x_axis": [ 0.447, 0.716, 0.537 ], "y_axis": [ 0.733, 0.052, -0.679 ], "z_axis": [ -0.513, 0.696, -0.501 ], "quaternion": [ -0.499, 0.689, 0.526, 0.008 ] } }, { "index": 274, "index_chain": 116, "chain_name": "B", "nt_resnum": 218, "nt_name": "A", "nt_code": "A", "nt_id": "///B/218", "linked_nts": [ "///B/217", "///B/219" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C2'-endo,BII,non-canonical,non-pair-contact,helix,ss-non-loop", "alpha": -51.847, "beta": 175.209, "gamma": 60.184, "delta": 140.844, "epsilon": -92.807, "zeta": 175.086, "epsilon_zeta": 92.107, "bb_type": "BII", "chi": -125.154, "glyco_bond": "anti", "C5prime_xyz": [ -1.644, 8.598, -1.056 ], "P_xyz": [ 0.869, 9.155, -0.637 ], "form": ".", "ssZp": 0.894, "Dp": 1.120, "splay_angle": 39.562, "splay_distance": 6.628, "splay_ratio": 0.350, "d22": null, "d64": null, "eta": -155.738, "theta": 154.672, "eta_prime": -127.481, "theta_prime": 143.098, "eta_base": -77.616, "theta_base": 159.932, "v0": -20.538, "v1": 32.526, "v2": -31.475, "v3": 20.435, "v4": -0.101, "amplitude": 33.202, "phase_angle": 161.439, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1b", "suiteness": 0.841, "filter_rmsd": 0.041, "frame": { "rmsd": 0.006, "origin": [ 58.689, 58.458, 57.733 ], "x_axis": [ 0.932, 0.354, -0.078 ], "y_axis": [ 0.018, -0.261, -0.965 ], "z_axis": [ -0.362, 0.898, -0.249 ], "quaternion": [ 0.596, -0.781, -0.119, 0.141 ] } }, { "index": 275, "index_chain": 117, "chain_name": "B", "nt_resnum": 219, "nt_name": "A", "nt_code": "A", "nt_id": "///B/219", "linked_nts": [ "///B/218", "///B/220" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-canonical,non-pair-contact,helix,ss-non-loop", "alpha": -135.415, "beta": 147.648, "gamma": 46.815, "delta": 82.657, "epsilon": -124.861, "zeta": -75.829, "epsilon_zeta": -49.032, "bb_type": "--", "chi": -179.396, "glyco_bond": "anti", "C5prime_xyz": [ -1.449, 8.362, 1.623 ], "P_xyz": [ 1.129, 8.289, 1.930 ], "form": ".", "ssZp": 4.716, "Dp": 4.744, "splay_angle": 29.408, "splay_distance": 4.426, "splay_ratio": 0.254, "d22": null, "d64": null, "eta": 143.714, "theta": -122.245, "eta_prime": 132.929, "theta_prime": -120.523, "eta_base": 154.679, "theta_base": -69.237, "v0": 4.647, "v1": -25.850, "v2": 36.117, "v3": -34.462, "v4": 18.841, "amplitude": 36.869, "phase_angle": 11.595, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "4g", "suiteness": 0.546, "filter_rmsd": 0.040, "frame": { "rmsd": 0.005, "origin": [ 52.670, 55.700, 58.031 ], "x_axis": [ 0.815, 0.569, -0.107 ], "y_axis": [ 0.109, -0.332, -0.937 ], "z_axis": [ -0.569, 0.752, -0.333 ], "quaternion": [ 0.536, -0.787, -0.215, 0.214 ] } }, { "index": 276, "index_chain": 118, "chain_name": "B", "nt_resnum": 220, "nt_name": "G", "nt_code": "G", "nt_id": "///B/220", "linked_nts": [ "///B/219", "///B/221" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack", "alpha": -56.686, "beta": 157.443, "gamma": 53.005, "delta": 82.613, "epsilon": -145.242, "zeta": -70.035, "epsilon_zeta": -75.207, "bb_type": "BI", "chi": -170.954, "glyco_bond": "anti", "C5prime_xyz": [ -1.163, 8.565, 1.160 ], "P_xyz": [ 1.459, 8.521, 1.291 ], "form": "A", "ssZp": 4.624, "Dp": 4.670, "splay_angle": 23.796, "splay_distance": 3.702, "splay_ratio": 0.207, "d22": null, "d64": null, "eta": 159.904, "theta": -134.267, "eta_prime": -175.444, "theta_prime": -134.630, "eta_base": -97.439, "theta_base": -104.208, "v0": 5.916, "v1": -26.866, "v2": 36.467, "v3": -34.101, "v4": 17.859, "amplitude": 36.996, "phase_angle": 9.697, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.624, "filter_rmsd": 0.005, "frame": { "rmsd": 0.005, "origin": [ 53.397, 59.563, 55.998 ], "x_axis": [ 0.549, -0.012, -0.836 ], "y_axis": [ -0.653, -0.630, -0.420 ], "z_axis": [ -0.522, 0.777, -0.354 ], "quaternion": [ -0.376, 0.796, -0.209, -0.426 ] } }, { "index": 277, "index_chain": 119, "chain_name": "B", "nt_resnum": 221, "nt_name": "U", "nt_code": "U", "nt_id": "///B/221", "linked_nts": [ "///B/220", "///B/222" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -62.137, "beta": 166.707, "gamma": 57.134, "delta": 80.466, "epsilon": -134.303, "zeta": -86.005, "epsilon_zeta": -48.298, "bb_type": "BI", "chi": -167.088, "glyco_bond": "anti", "C5prime_xyz": [ -1.445, 8.649, 0.949 ], "P_xyz": [ 1.150, 8.971, 1.138 ], "form": "A", "ssZp": 4.546, "Dp": 4.707, "splay_angle": 19.691, "splay_distance": 3.075, "splay_ratio": 0.171, "d22": 4.232, "d64": 3.968, "eta": 170.373, "theta": -144.551, "eta_prime": -172.234, "theta_prime": -143.001, "eta_base": -121.850, "theta_base": -107.375, "v0": 3.298, "v1": -25.648, "v2": 36.978, "v3": -36.131, "v4": 20.721, "amplitude": 38.073, "phase_angle": 13.777, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.955, "filter_rmsd": 0.106, "frame": { "rmsd": 0.004, "origin": [ 53.163, 62.696, 54.038 ], "x_axis": [ 0.038, -0.403, -0.915 ], "y_axis": [ -0.867, -0.469, 0.170 ], "z_axis": [ -0.497, 0.786, -0.367 ], "quaternion": [ -0.225, 0.684, -0.464, -0.516 ] } }, { "index": 278, "index_chain": 120, "chain_name": "B", "nt_resnum": 222, "nt_name": "C", "nt_code": "C", "nt_id": "///B/222", "linked_nts": [ "///B/221", "///B/223" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -57.061, "beta": 150.983, "gamma": 60.642, "delta": 81.759, "epsilon": -155.124, "zeta": -72.356, "epsilon_zeta": -82.768, "bb_type": "BI", "chi": -160.280, "glyco_bond": "anti", "C5prime_xyz": [ -1.330, 8.783, 0.526 ], "P_xyz": [ 1.245, 8.962, 0.053 ], "form": "A", "ssZp": 4.409, "Dp": 4.569, "splay_angle": 26.404, "splay_distance": 4.221, "splay_ratio": 0.230, "d22": 4.543, "d64": 4.663, "eta": 163.711, "theta": -145.002, "eta_prime": -177.342, "theta_prime": -149.728, "eta_base": -123.841, "theta_base": -134.040, "v0": 1.653, "v1": -23.565, "v2": 35.243, "v3": -35.260, "v4": 21.217, "amplitude": 36.677, "phase_angle": 16.077, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.611, "filter_rmsd": 0.064, "frame": { "rmsd": 0.002, "origin": [ 52.490, 64.689, 51.795 ], "x_axis": [ -0.494, -0.579, -0.648 ], "y_axis": [ -0.802, 0.017, 0.597 ], "z_axis": [ -0.334, 0.815, -0.473 ], "quaternion": [ 0.111, -0.490, 0.704, 0.501 ] } }, { "index": 279, "index_chain": 121, "chain_name": "B", "nt_resnum": 223, "nt_name": "C", "nt_code": "C", "nt_id": "///B/223", "linked_nts": [ "///B/222", "///B/224" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,bulge,A-minor,ribose-zipper,phosphate", "alpha": -65.370, "beta": -178.991, "gamma": 49.651, "delta": 80.486, "epsilon": -141.127, "zeta": -73.944, "epsilon_zeta": -67.184, "bb_type": "BI", "chi": -163.505, "glyco_bond": "anti", "C5prime_xyz": [ -1.348, 8.773, 0.696 ], "P_xyz": [ 1.177, 9.258, 1.257 ], "form": "A", "ssZp": 4.490, "Dp": 4.674, "splay_angle": 22.206, "splay_distance": 3.622, "splay_ratio": 0.195, "d22": 4.024, "d64": 4.202, "eta": 171.030, "theta": -141.055, "eta_prime": 179.584, "theta_prime": -137.940, "eta_base": -150.611, "theta_base": -107.999, "v0": 0.815, "v1": -23.455, "v2": 35.830, "v3": -36.324, "v4": 22.395, "amplitude": 37.537, "phase_angle": 17.349, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.936, "filter_rmsd": 0.064, "frame": { "rmsd": 0.001, "origin": [ 52.305, 67.657, 48.800 ], "x_axis": [ -0.718, -0.676, -0.165 ], "y_axis": [ -0.442, 0.260, 0.859 ], "z_axis": [ -0.538, 0.689, -0.485 ], "quaternion": [ -0.119, -0.356, 0.785, 0.493 ] } }, { "index": 280, "index_chain": 122, "chain_name": "B", "nt_resnum": 224, "nt_name": "U", "nt_code": "U", "nt_id": "///B/224", "linked_nts": [ "///B/223", "///B/225" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,bulge,ribose-zipper", "alpha": -57.363, "beta": 162.667, "gamma": 55.259, "delta": 78.644, "epsilon": -138.699, "zeta": -72.793, "epsilon_zeta": -65.906, "bb_type": "BI", "chi": -160.968, "glyco_bond": "anti", "C5prime_xyz": [ -1.734, 8.814, 0.517 ], "P_xyz": [ 0.780, 9.538, 0.425 ], "form": "A", "ssZp": 4.404, "Dp": 4.661, "splay_angle": 19.388, "splay_distance": 3.302, "splay_ratio": 0.174, "d22": null, "d64": null, "eta": 167.985, "theta": -138.816, "eta_prime": -175.645, "theta_prime": -132.033, "eta_base": -131.684, "theta_base": -115.584, "v0": -0.924, "v1": -22.456, "v2": 35.958, "v3": -37.461, "v4": 24.211, "amplitude": 38.250, "phase_angle": 19.937, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.889, "filter_rmsd": 0.102, "frame": { "rmsd": 0.003, "origin": [ 50.066, 68.428, 46.059 ], "x_axis": [ -0.787, -0.493, 0.372 ], "y_axis": [ -0.053, 0.654, 0.755 ], "z_axis": [ -0.615, 0.574, -0.540 ], "quaternion": [ -0.286, -0.158, 0.863, 0.385 ] } }, { "index": 281, "index_chain": 123, "chain_name": "B", "nt_resnum": 225, "nt_name": "A", "nt_code": "A", "nt_id": "///B/225", "linked_nts": [ "///B/224", "///B/226" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C2'-endo,BII,non-canonical,non-pair-contact,multiplet,bulge", "alpha": -47.841, "beta": -175.835, "gamma": 46.030, "delta": 140.553, "epsilon": -104.297, "zeta": 154.285, "epsilon_zeta": 101.418, "bb_type": "BII", "chi": -110.549, "glyco_bond": "anti", "C5prime_xyz": [ -2.352, 8.358, -1.743 ], "P_xyz": [ -0.158, 9.794, -1.494 ], "form": ".", "ssZp": 1.084, "Dp": 1.182, "splay_angle": 39.759, "splay_distance": 6.596, "splay_ratio": 0.348, "d22": null, "d64": null, "eta": -161.961, "theta": 135.752, "eta_prime": -139.394, "theta_prime": 124.191, "eta_base": -121.219, "theta_base": 138.888, "v0": -23.842, "v1": 35.179, "v2": -32.641, "v3": 19.702, "v4": 2.420, "amplitude": 35.346, "phase_angle": 157.438, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1b", "suiteness": 0.637, "filter_rmsd": 0.038, "frame": { "rmsd": 0.004, "origin": [ 47.324, 68.304, 44.223 ], "x_axis": [ -0.400, -0.315, 0.861 ], "y_axis": [ 0.048, 0.931, 0.363 ], "z_axis": [ -0.915, 0.186, -0.357 ], "quaternion": [ 0.542, 0.082, -0.820, -0.167 ] } }, { "index": 282, "index_chain": 124, "chain_name": "B", "nt_resnum": 226, "nt_name": "A", "nt_code": "A", "nt_id": "///B/226", "linked_nts": [ "///B/225", "///B/227" ], "nt_type": "RNA", "dbn": "(", "summary": "turn,anti,~C3'-endo,isolated-canonical,non-canonical,non-pair-contact,helix,multiplet,bulge", "alpha": -128.855, "beta": 148.398, "gamma": 49.872, "delta": 82.967, "epsilon": -125.056, "zeta": -63.090, "epsilon_zeta": -61.966, "bb_type": "--", "chi": -172.938, "glyco_bond": "anti", "C5prime_xyz": [ -1.405, 8.516, 1.308 ], "P_xyz": [ 1.217, 8.548, 1.485 ], "form": ".", "ssZp": 4.623, "Dp": 4.708, "splay_angle": 34.194, "splay_distance": 5.291, "splay_ratio": 0.294, "d22": null, "d64": null, "eta": 148.134, "theta": -110.965, "eta_prime": 137.714, "theta_prime": -109.979, "eta_base": 152.955, "theta_base": -59.286, "v0": 3.639, "v1": -24.387, "v2": 34.726, "v3": -33.556, "v4": 18.892, "amplitude": 35.621, "phase_angle": 12.872, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "4g", "suiteness": 0.392, "filter_rmsd": 0.037, "frame": { "rmsd": 0.003, "origin": [ 51.132, 70.033, 39.122 ], "x_axis": [ -0.727, -0.253, 0.638 ], "y_axis": [ -0.021, 0.937, 0.349 ], "z_axis": [ -0.686, 0.240, -0.687 ], "quaternion": [ -0.362, -0.075, 0.915, 0.161 ] } }, { "index": 283, "index_chain": 125, "chain_name": "B", "nt_resnum": 227, "nt_name": "G", "nt_code": "G", "nt_id": "///B/227", "linked_nts": [ "///B/226", "///B/228" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge", "alpha": -64.259, "beta": 163.774, "gamma": 52.713, "delta": 81.323, "epsilon": -141.078, "zeta": -72.811, "epsilon_zeta": -68.266, "bb_type": "BI", "chi": -167.537, "glyco_bond": "anti", "C5prime_xyz": [ -1.314, 8.657, 0.993 ], "P_xyz": [ 1.291, 8.905, 1.187 ], "form": "A", "ssZp": 4.588, "Dp": 4.693, "splay_angle": 21.854, "splay_distance": 3.445, "splay_ratio": 0.191, "d22": null, "d64": null, "eta": 154.532, "theta": -137.445, "eta_prime": -176.988, "theta_prime": -136.369, "eta_base": -97.993, "theta_base": -101.866, "v0": 3.245, "v1": -25.265, "v2": 36.468, "v3": -35.602, "v4": 20.412, "amplitude": 37.547, "phase_angle": 13.769, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.665, "filter_rmsd": 0.003, "frame": { "rmsd": 0.003, "origin": [ 46.113, 71.287, 40.236 ], "x_axis": [ -0.185, 0.673, 0.716 ], "y_axis": [ 0.582, 0.662, -0.472 ], "z_axis": [ -0.792, 0.329, -0.514 ], "quaternion": [ -0.491, 0.409, 0.768, -0.047 ] } }, { "index": 284, "index_chain": 126, "chain_name": "B", "nt_resnum": 228, "nt_name": "U", "nt_code": "U", "nt_id": "///B/228", "linked_nts": [ "///B/227", "///B/229" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -64.647, "beta": 167.878, "gamma": 57.073, "delta": 79.920, "epsilon": -143.015, "zeta": -80.975, "epsilon_zeta": -62.041, "bb_type": "BI", "chi": -158.958, "glyco_bond": "anti", "C5prime_xyz": [ -1.374, 8.745, 0.484 ], "P_xyz": [ 1.215, 9.141, 0.442 ], "form": "A", "ssZp": 4.377, "Dp": 4.661, "splay_angle": 22.575, "splay_distance": 3.552, "splay_ratio": 0.196, "d22": 4.201, "d64": 3.950, "eta": 166.187, "theta": -147.880, "eta_prime": -177.180, "theta_prime": -146.921, "eta_base": -125.470, "theta_base": -119.388, "v0": 1.915, "v1": -24.311, "v2": 36.289, "v3": -36.179, "v4": 21.590, "amplitude": 37.709, "phase_angle": 15.771, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.948, "filter_rmsd": 0.105, "frame": { "rmsd": 0.003, "origin": [ 43.021, 72.796, 40.397 ], "x_axis": [ 0.281, 0.914, 0.292 ], "y_axis": [ 0.445, 0.146, -0.884 ], "z_axis": [ -0.851, 0.378, -0.365 ], "quaternion": [ 0.515, -0.612, -0.555, 0.228 ] } }, { "index": 285, "index_chain": 127, "chain_name": "B", "nt_resnum": 229, "nt_name": "C", "nt_code": "C", "nt_id": "///B/229", "linked_nts": [ "///B/228", "///B/230" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -61.958, "beta": 167.904, "gamma": 52.687, "delta": 80.085, "epsilon": -146.955, "zeta": -74.335, "epsilon_zeta": -72.620, "bb_type": "BI", "chi": -160.438, "glyco_bond": "anti", "C5prime_xyz": [ -1.235, 8.757, 0.523 ], "P_xyz": [ 1.374, 9.011, 0.562 ], "form": "A", "ssZp": 4.434, "Dp": 4.665, "splay_angle": 22.902, "splay_distance": 3.700, "splay_ratio": 0.201, "d22": null, "d64": null, "eta": 165.693, "theta": -144.141, "eta_prime": 177.698, "theta_prime": -143.802, "eta_base": -141.355, "theta_base": -125.062, "v0": 2.032, "v1": -24.496, "v2": 36.489, "v3": -36.289, "v4": 21.611, "amplitude": 37.886, "phase_angle": 15.608, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.910, "filter_rmsd": 0.065, "frame": { "rmsd": 0.003, "origin": [ 40.125, 74.848, 40.277 ], "x_axis": [ 0.656, 0.735, -0.174 ], "y_axis": [ 0.137, -0.342, -0.930 ], "z_axis": [ -0.743, 0.586, -0.325 ], "quaternion": [ -0.497, 0.762, 0.286, -0.301 ] } }, { "index": 286, "index_chain": 128, "chain_name": "B", "nt_resnum": 230, "nt_name": "A", "nt_code": "A", "nt_id": "///B/230", "linked_nts": [ "///B/229", "///B/231" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,A-minor", "alpha": -59.923, "beta": 166.378, "gamma": 58.029, "delta": 79.191, "epsilon": -151.775, "zeta": -76.300, "epsilon_zeta": -75.475, "bb_type": "BI", "chi": -161.959, "glyco_bond": "anti", "C5prime_xyz": [ -1.674, 8.789, 0.629 ], "P_xyz": [ 0.860, 9.431, 0.697 ], "form": "A", "ssZp": 4.419, "Dp": 4.561, "splay_angle": 23.298, "splay_distance": 3.686, "splay_ratio": 0.202, "d22": null, "d64": null, "eta": 170.834, "theta": -151.270, "eta_prime": -174.655, "theta_prime": -151.173, "eta_base": -140.899, "theta_base": -123.923, "v0": -1.238, "v1": -21.712, "v2": 35.090, "v3": -36.827, "v4": 24.020, "amplitude": 37.462, "phase_angle": 20.497, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.929, "filter_rmsd": 0.037, "frame": { "rmsd": 0.003, "origin": [ 38.007, 77.878, 40.433 ], "x_axis": [ 0.751, 0.401, -0.525 ], "y_axis": [ -0.218, -0.599, -0.770 ], "z_axis": [ -0.623, 0.693, -0.362 ], "quaternion": [ -0.444, 0.823, 0.056, -0.349 ] } }, { "index": 287, "index_chain": 129, "chain_name": "B", "nt_resnum": 231, "nt_name": "A", "nt_code": "A", "nt_id": "///B/231", "linked_nts": [ "///B/230", "///B/232" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -61.404, "beta": 172.636, "gamma": 48.137, "delta": 79.953, "epsilon": -140.042, "zeta": -74.728, "epsilon_zeta": -65.315, "bb_type": "BI", "chi": -161.148, "glyco_bond": "anti", "C5prime_xyz": [ -1.395, 8.694, 0.621 ], "P_xyz": [ 1.166, 9.119, 0.932 ], "form": "A", "ssZp": 4.446, "Dp": 4.700, "splay_angle": 20.806, "splay_distance": 3.333, "splay_ratio": 0.182, "d22": null, "d64": null, "eta": 168.293, "theta": -141.695, "eta_prime": 178.363, "theta_prime": -139.827, "eta_base": -142.277, "theta_base": -106.164, "v0": 4.072, "v1": -26.327, "v2": 37.459, "v3": -36.107, "v4": 20.155, "amplitude": 38.390, "phase_angle": 12.644, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.922, "filter_rmsd": 0.039, "frame": { "rmsd": 0.003, "origin": [ 36.681, 81.245, 39.729 ], "x_axis": [ 0.587, -0.092, -0.804 ], "y_axis": [ -0.611, -0.702, -0.366 ], "z_axis": [ -0.531, 0.706, -0.468 ], "quaternion": [ -0.323, 0.830, -0.212, -0.402 ] } }, { "index": 288, "index_chain": 130, "chain_name": "B", "nt_resnum": 232, "nt_name": "C", "nt_code": "C", "nt_id": "///B/232", "linked_nts": [ "///B/231", "///B/233" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -62.092, "beta": 162.723, "gamma": 56.866, "delta": 77.494, "epsilon": -151.450, "zeta": -72.516, "epsilon_zeta": -78.934, "bb_type": "BI", "chi": -160.567, "glyco_bond": "anti", "C5prime_xyz": [ -1.462, 8.812, 0.527 ], "P_xyz": [ 1.091, 9.306, 0.259 ], "form": "A", "ssZp": 4.473, "Dp": 4.650, "splay_angle": 22.970, "splay_distance": 3.656, "splay_ratio": 0.202, "d22": null, "d64": null, "eta": 161.558, "theta": -147.993, "eta_prime": 178.568, "theta_prime": -150.154, "eta_base": -130.322, "theta_base": -128.027, "v0": 1.368, "v1": -25.102, "v2": 37.983, "v3": -38.253, "v4": 23.256, "amplitude": 39.652, "phase_angle": 16.686, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.891, "filter_rmsd": 0.062, "frame": { "rmsd": 0.003, "origin": [ 36.741, 83.678, 37.453 ], "x_axis": [ 0.177, -0.555, -0.813 ], "y_axis": [ -0.913, -0.401, 0.075 ], "z_axis": [ -0.367, 0.729, -0.578 ], "quaternion": [ -0.223, 0.734, -0.500, -0.402 ] } }, { "index": 289, "index_chain": 131, "chain_name": "B", "nt_resnum": 233, "nt_name": "A", "nt_code": "A", "nt_id": "///B/233", "linked_nts": [ "///B/232", "///B/234" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -71.469, "beta": 166.075, "gamma": 64.963, "delta": 77.229, "epsilon": -137.798, "zeta": -105.637, "epsilon_zeta": -32.161, "bb_type": "--", "chi": -176.122, "glyco_bond": "anti", "C5prime_xyz": [ -1.747, 8.552, 1.384 ], "P_xyz": [ 0.801, 9.211, 1.463 ], "form": "A", "ssZp": 4.735, "Dp": 4.740, "splay_angle": 23.473, "splay_distance": 3.692, "splay_ratio": 0.208, "d22": null, "d64": null, "eta": 166.006, "theta": -155.483, "eta_prime": 178.419, "theta_prime": -152.543, "eta_base": -142.346, "theta_base": -131.952, "v0": 2.524, "v1": -26.435, "v2": 38.909, "v3": -38.505, "v4": 22.646, "amplitude": 40.290, "phase_angle": 15.047, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.723, "filter_rmsd": 0.037, "frame": { "rmsd": 0.006, "origin": [ 37.101, 86.070, 34.712 ], "x_axis": [ -0.201, -0.821, -0.535 ], "y_axis": [ -0.886, -0.081, 0.457 ], "z_axis": [ -0.418, 0.566, -0.711 ], "quaternion": [ 0.043, -0.631, 0.676, 0.378 ] } }, { "index": 290, "index_chain": 132, "chain_name": "B", "nt_resnum": 234, "nt_name": "G", "nt_code": "G", "nt_id": "///B/234", "linked_nts": [ "///B/233", "///B/235" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -17.213, "beta": 139.990, "gamma": 40.545, "delta": 80.345, "epsilon": -146.143, "zeta": -44.710, "epsilon_zeta": -101.433, "bb_type": "BI", "chi": -162.201, "glyco_bond": "anti", "C5prime_xyz": [ -1.760, 8.838, 0.658 ], "P_xyz": [ 0.841, 9.197, 0.796 ], "form": "A", "ssZp": 4.436, "Dp": 4.583, "splay_angle": 21.898, "splay_distance": 3.805, "splay_ratio": 0.198, "d22": null, "d64": null, "eta": 178.188, "theta": -121.596, "eta_prime": -169.677, "theta_prime": -135.865, "eta_base": -138.650, "theta_base": -115.408, "v0": -0.811, "v1": -21.574, "v2": 34.274, "v3": -35.702, "v4": 23.013, "amplitude": 36.425, "phase_angle": 19.789, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.007, "frame": { "rmsd": 0.007, "origin": [ 37.624, 87.583, 31.384 ], "x_axis": [ -0.615, -0.731, -0.297 ], "y_axis": [ -0.723, 0.371, 0.583 ], "z_axis": [ -0.316, 0.573, -0.756 ], "quaternion": [ -0.006, -0.439, 0.828, 0.349 ] } }, { "index": 291, "index_chain": 133, "chain_name": "B", "nt_resnum": 235, "nt_name": "A", "nt_code": "A", "nt_id": "///B/235", "linked_nts": [ "///B/234", "///B/236" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,hairpin-loop", "alpha": -135.486, "beta": 129.168, "gamma": 137.047, "delta": 80.458, "epsilon": -118.767, "zeta": -95.401, "epsilon_zeta": -23.366, "bb_type": "--", "chi": -178.847, "glyco_bond": "anti", "C5prime_xyz": [ -1.199, 8.267, 1.659 ], "P_xyz": [ -0.043, 10.149, 0.194 ], "form": ".", "ssZp": 4.840, "Dp": 4.862, "splay_angle": 75.046, "splay_distance": 10.273, "splay_ratio": 0.609, "d22": null, "d64": null, "eta": 161.175, "theta": -144.792, "eta_prime": 175.003, "theta_prime": 178.178, "eta_base": -140.660, "theta_base": 105.435, "v0": 8.073, "v1": -29.977, "v2": 39.114, "v3": -35.540, "v4": 17.327, "amplitude": 39.409, "phase_angle": 7.017, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.037, "frame": { "rmsd": 0.006, "origin": [ 36.985, 87.637, 27.634 ], "x_axis": [ -0.890, -0.457, -0.002 ], "y_axis": [ -0.379, 0.735, 0.562 ], "z_axis": [ -0.255, 0.501, -0.827 ], "quaternion": [ -0.068, -0.225, 0.929, 0.286 ] } }, { "index": 292, "index_chain": 134, "chain_name": "B", "nt_resnum": 236, "nt_name": "U", "nt_code": "U", "nt_id": "///B/236", "linked_nts": [ "///B/235", "///B/237" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-stack,hairpin-loop,splayed-apart", "alpha": 94.137, "beta": -171.117, "gamma": 146.289, "delta": 84.676, "epsilon": -146.467, "zeta": -125.095, "epsilon_zeta": -21.372, "bb_type": "--", "chi": -98.678, "glyco_bond": "anti", "C5prime_xyz": [ -2.073, 7.575, -2.736 ], "P_xyz": [ -1.591, 6.574, -5.144 ], "form": ".", "ssZp": 0.994, "Dp": 4.643, "splay_angle": 137.590, "splay_distance": 18.253, "splay_ratio": 0.932, "d22": 9.989, "d64": 13.023, "eta": 54.151, "theta": 143.436, "eta_prime": 76.331, "theta_prime": 120.447, "eta_base": 30.860, "theta_base": 99.027, "v0": 4.290, "v1": -24.645, "v2": 34.453, "v3": -32.868, "v4": 18.024, "amplitude": 35.184, "phase_angle": 11.700, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.108, "frame": { "rmsd": 0.007, "origin": [ 44.149, 94.934, 28.615 ], "x_axis": [ -0.020, -0.513, 0.858 ], "y_axis": [ -0.794, -0.514, -0.326 ], "z_axis": [ 0.608, -0.688, -0.397 ], "quaternion": [ 0.132, 0.688, -0.475, 0.533 ] } }, { "index": 293, "index_chain": 135, "chain_name": "B", "nt_resnum": 237, "nt_name": "C", "nt_code": "C", "nt_id": "///B/237", "linked_nts": [ "///B/236", "///B/238" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-stack,non-pair-contact,hairpin-loop,splayed-apart", "alpha": 159.647, "beta": 92.894, "gamma": 127.964, "delta": 82.537, "epsilon": -162.104, "zeta": -149.027, "epsilon_zeta": -13.076, "bb_type": "--", "chi": -173.982, "glyco_bond": "anti", "C5prime_xyz": [ -1.050, 8.461, 1.460 ], "P_xyz": [ 0.094, 9.539, -0.676 ], "form": ".", "ssZp": 4.437, "Dp": 4.542, "splay_angle": 73.174, "splay_distance": 10.485, "splay_ratio": 0.596, "d22": 8.347, "d64": 9.474, "eta": 85.009, "theta": 142.018, "eta_prime": 93.179, "theta_prime": 165.060, "eta_base": 108.837, "theta_base": -169.334, "v0": 5.685, "v1": -26.629, "v2": 36.120, "v3": -33.951, "v4": 17.809, "amplitude": 36.669, "phase_angle": 9.922, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.070, "frame": { "rmsd": 0.014, "origin": [ 33.816, 88.498, 15.015 ], "x_axis": [ 0.461, 0.845, -0.271 ], "y_axis": [ 0.378, 0.089, 0.921 ], "z_axis": [ 0.803, -0.527, -0.278 ], "quaternion": [ 0.564, 0.642, 0.476, 0.207 ] } }, { "index": 294, "index_chain": 136, "chain_name": "B", "nt_resnum": 238, "nt_name": "U", "nt_code": "U", "nt_id": "///B/238", "linked_nts": [ "///B/237", "///B/239" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,anti,~C3'-endo,non-stack,non-pair-contact,hairpin-loop,splayed-apart", "alpha": 82.564, "beta": 119.821, "gamma": -3.685, "delta": 83.591, "epsilon": -148.799, "zeta": 141.628, "epsilon_zeta": 69.573, "bb_type": "--", "chi": -173.719, "glyco_bond": "anti", "C5prime_xyz": [ -1.549, 8.608, 1.303 ], "P_xyz": [ 0.372, 8.326, 3.095 ], "form": ".", "ssZp": 4.448, "Dp": 4.488, "splay_angle": 119.022, "splay_distance": 17.437, "splay_ratio": 0.864, "d22": 9.727, "d64": 12.435, "eta": -135.916, "theta": 44.988, "eta_prime": -162.862, "theta_prime": 20.127, "eta_base": 179.867, "theta_base": 3.897, "v0": 0.438, "v1": -21.305, "v2": 32.765, "v3": -33.526, "v4": 20.972, "amplitude": 34.450, "phase_angle": 17.995, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.107, "frame": { "rmsd": 0.005, "origin": [ 38.259, 79.239, 12.904 ], "x_axis": [ -0.132, 0.890, -0.436 ], "y_axis": [ -0.366, 0.365, 0.856 ], "z_axis": [ 0.921, 0.273, 0.278 ], "quaternion": [ 0.615, 0.237, 0.552, 0.511 ] } }, { "index": 295, "index_chain": 137, "chain_name": "B", "nt_resnum": 239, "nt_name": "U", "nt_code": "U", "nt_id": "///B/239", "linked_nts": [ "///B/238", "///B/240" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,hairpin-loop,splayed-apart", "alpha": -43.577, "beta": -92.431, "gamma": -100.362, "delta": 81.361, "epsilon": -142.115, "zeta": -105.437, "epsilon_zeta": -36.678, "bb_type": "BI", "chi": -165.112, "glyco_bond": "anti", "C5prime_xyz": [ -1.640, 8.760, 0.772 ], "P_xyz": [ -2.811, 10.910, -0.201 ], "form": "A", "ssZp": 4.465, "Dp": 4.585, "splay_angle": 20.580, "splay_distance": 3.320, "splay_ratio": 0.180, "d22": 4.391, "d64": 4.093, "eta": 156.755, "theta": 158.919, "eta_prime": 167.046, "theta_prime": 175.058, "eta_base": -151.876, "theta_base": -137.950, "v0": -2.694, "v1": -19.327, "v2": 32.693, "v3": -35.111, "v4": 23.851, "amplitude": 35.468, "phase_angle": 22.816, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.105, "frame": { "rmsd": 0.002, "origin": [ 36.756, 87.831, 28.002 ], "x_axis": [ -0.778, -0.385, 0.497 ], "y_axis": [ 0.149, -0.881, -0.450 ], "z_axis": [ 0.611, -0.276, 0.742 ], "quaternion": [ -0.145, 0.300, -0.197, 0.922 ] } }, { "index": 296, "index_chain": 138, "chain_name": "B", "nt_resnum": 240, "nt_name": "C", "nt_code": "C", "nt_id": "///B/240", "linked_nts": [ "///B/239", "///B/241" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": 149.936, "beta": -133.576, "gamma": 162.878, "delta": 81.459, "epsilon": -134.853, "zeta": -80.490, "epsilon_zeta": -54.363, "bb_type": "BI", "chi": -165.226, "glyco_bond": "anti", "C5prime_xyz": [ -1.222, 8.668, 0.876 ], "P_xyz": [ 0.614, 9.365, -0.880 ], "form": "A", "ssZp": 4.536, "Dp": 4.723, "splay_angle": 26.164, "splay_distance": 4.122, "splay_ratio": 0.227, "d22": 4.079, "d64": 4.030, "eta": 152.491, "theta": -149.396, "eta_prime": 173.732, "theta_prime": -153.107, "eta_base": -131.680, "theta_base": -126.774, "v0": 4.822, "v1": -26.322, "v2": 36.745, "v3": -34.962, "v4": 19.000, "amplitude": 37.485, "phase_angle": 11.407, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.083, "filter_rmsd": 0.065, "frame": { "rmsd": 0.003, "origin": [ 37.005, 86.999, 31.207 ], "x_axis": [ -0.558, -0.824, 0.101 ], "y_axis": [ 0.724, -0.542, -0.427 ], "z_axis": [ 0.406, -0.165, 0.899 ], "quaternion": [ -0.447, 0.146, -0.171, 0.866 ] } }, { "index": 297, "index_chain": 139, "chain_name": "B", "nt_resnum": 241, "nt_name": "U", "nt_code": "U", "nt_id": "///B/241", "linked_nts": [ "///B/240", "///B/242" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -52.206, "beta": 167.314, "gamma": 43.920, "delta": 79.733, "epsilon": -145.578, "zeta": -79.559, "epsilon_zeta": -66.019, "bb_type": "BI", "chi": -164.521, "glyco_bond": "anti", "C5prime_xyz": [ -1.444, 8.678, 0.803 ], "P_xyz": [ 1.108, 9.069, 1.233 ], "form": "A", "ssZp": 4.535, "Dp": 4.668, "splay_angle": 21.805, "splay_distance": 3.474, "splay_ratio": 0.192, "d22": null, "d64": null, "eta": 165.403, "theta": -148.178, "eta_prime": 179.564, "theta_prime": -146.784, "eta_base": -137.301, "theta_base": -122.276, "v0": 3.220, "v1": -25.751, "v2": 37.286, "v3": -36.472, "v4": 20.960, "amplitude": 38.416, "phase_angle": 13.929, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.689, "filter_rmsd": 0.105, "frame": { "rmsd": 0.002, "origin": [ 36.996, 85.610, 35.088 ], "x_axis": [ -0.135, -0.897, -0.421 ], "y_axis": [ 0.912, 0.054, -0.407 ], "z_axis": [ 0.388, -0.439, 0.810 ], "quaternion": [ 0.658, 0.012, 0.308, -0.688 ] } }, { "index": 298, "index_chain": 140, "chain_name": "B", "nt_resnum": 242, "nt_name": "G", "nt_code": "G", "nt_id": "///B/242", "linked_nts": [ "///B/241", "///B/243" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -56.010, "beta": 163.184, "gamma": 53.066, "delta": 79.234, "epsilon": -142.357, "zeta": -84.016, "epsilon_zeta": -58.341, "bb_type": "BI", "chi": -169.275, "glyco_bond": "anti", "C5prime_xyz": [ -1.607, 8.724, 1.071 ], "P_xyz": [ 0.949, 9.197, 1.400 ], "form": "A", "ssZp": 4.571, "Dp": 4.643, "splay_angle": 20.005, "splay_distance": 3.144, "splay_ratio": 0.175, "d22": null, "d64": null, "eta": 168.197, "theta": -151.563, "eta_prime": -179.370, "theta_prime": -150.903, "eta_base": -140.703, "theta_base": -128.241, "v0": 1.654, "v1": -24.223, "v2": 36.322, "v3": -36.388, "v4": 21.896, "amplitude": 37.818, "phase_angle": 16.167, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.865, "filter_rmsd": 0.003, "frame": { "rmsd": 0.003, "origin": [ 36.649, 83.504, 37.829 ], "x_axis": [ 0.278, -0.653, -0.704 ], "y_axis": [ 0.867, 0.487, -0.109 ], "z_axis": [ 0.414, -0.580, 0.701 ], "quaternion": [ 0.785, 0.150, 0.356, -0.484 ] } }, { "index": 299, "index_chain": 141, "chain_name": "B", "nt_resnum": 243, "nt_name": "U", "nt_code": "U", "nt_id": "///B/243", "linked_nts": [ "///B/242", "///B/244" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -61.706, "beta": 165.894, "gamma": 53.993, "delta": 82.073, "epsilon": -142.062, "zeta": -74.355, "epsilon_zeta": -67.707, "bb_type": "BI", "chi": -161.858, "glyco_bond": "anti", "C5prime_xyz": [ -1.376, 8.699, 0.622 ], "P_xyz": [ 1.213, 9.075, 0.613 ], "form": "A", "ssZp": 4.468, "Dp": 4.671, "splay_angle": 25.041, "splay_distance": 3.993, "splay_ratio": 0.218, "d22": 3.708, "d64": 4.011, "eta": 167.170, "theta": -140.727, "eta_prime": 177.590, "theta_prime": -140.676, "eta_base": -147.202, "theta_base": -111.127, "v0": 3.302, "v1": -24.695, "v2": 35.522, "v3": -34.562, "v4": 19.748, "amplitude": 36.536, "phase_angle": 13.533, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.852, "filter_rmsd": 0.105, "frame": { "rmsd": 0.003, "origin": [ 36.570, 81.000, 39.728 ], "x_axis": [ 0.670, -0.282, -0.686 ], "y_axis": [ 0.652, 0.665, 0.364 ], "z_axis": [ 0.354, -0.691, 0.630 ], "quaternion": [ 0.861, 0.306, 0.302, -0.271 ] } }, { "index": 300, "index_chain": 142, "chain_name": "B", "nt_resnum": 244, "nt_name": "U", "nt_code": "U", "nt_id": "///B/244", "linked_nts": [ "///B/243", "///B/245" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,A-minor", "alpha": -69.700, "beta": 160.815, "gamma": 64.924, "delta": 79.266, "epsilon": -130.293, "zeta": -86.771, "epsilon_zeta": -43.522, "bb_type": "BI", "chi": -176.202, "glyco_bond": "anti", "C5prime_xyz": [ -1.803, 8.650, 1.475 ], "P_xyz": [ 0.743, 9.223, 1.535 ], "form": "A", "ssZp": 4.728, "Dp": 4.672, "splay_angle": 19.438, "splay_distance": 3.350, "splay_ratio": 0.178, "d22": null, "d64": null, "eta": 168.841, "theta": -143.390, "eta_prime": -175.948, "theta_prime": -145.026, "eta_base": -129.839, "theta_base": -127.842, "v0": 4.305, "v1": -28.634, "v2": 40.809, "v3": -39.090, "v4": 22.074, "amplitude": 41.827, "phase_angle": 12.665, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.726, "filter_rmsd": 0.107, "frame": { "rmsd": 0.012, "origin": [ 38.273, 77.455, 40.416 ], "x_axis": [ 0.820, 0.291, -0.493 ], "y_axis": [ 0.140, 0.733, 0.665 ], "z_axis": [ 0.555, -0.615, 0.561 ], "quaternion": [ 0.882, 0.363, 0.297, 0.043 ] } }, { "index": 301, "index_chain": 143, "chain_name": "B", "nt_resnum": 245, "nt_name": "G", "nt_code": "G", "nt_id": "///B/245", "linked_nts": [ "///B/244", "///B/246" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -51.544, "beta": 149.834, "gamma": 53.749, "delta": 69.667, "epsilon": -141.191, "zeta": -86.938, "epsilon_zeta": -54.253, "bb_type": "BI", "chi": -168.786, "glyco_bond": "anti", "C5prime_xyz": [ -2.055, 8.978, 0.921 ], "P_xyz": [ 0.448, 9.896, 1.040 ], "form": "A", "ssZp": 4.491, "Dp": 4.617, "splay_angle": 22.023, "splay_distance": 3.482, "splay_ratio": 0.192, "d22": null, "d64": null, "eta": 162.071, "theta": -156.056, "eta_prime": 175.773, "theta_prime": -154.143, "eta_base": -149.640, "theta_base": -119.957, "v0": -0.867, "v1": -28.002, "v2": 44.746, "v3": -46.379, "v4": 29.662, "amplitude": 47.484, "phase_angle": 19.552, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.406, "filter_rmsd": 0.016, "frame": { "rmsd": 0.016, "origin": [ 39.890, 74.535, 40.125 ], "x_axis": [ 0.719, 0.672, -0.177 ], "y_axis": [ -0.188, 0.433, 0.881 ], "z_axis": [ 0.669, -0.601, 0.438 ], "quaternion": [ 0.805, 0.460, 0.263, 0.267 ] } }, { "index": 302, "index_chain": 144, "chain_name": "B", "nt_resnum": 246, "nt_name": "A", "nt_code": "A", "nt_id": "///B/246", "linked_nts": [ "///B/245", "///B/247" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -48.065, "beta": 153.313, "gamma": 53.736, "delta": 80.885, "epsilon": -137.240, "zeta": -71.999, "epsilon_zeta": -65.241, "bb_type": "BI", "chi": -166.171, "glyco_bond": "anti", "C5prime_xyz": [ -1.623, 8.704, 0.916 ], "P_xyz": [ 0.973, 9.151, 0.930 ], "form": "A", "ssZp": 4.533, "Dp": 4.661, "splay_angle": 21.798, "splay_distance": 3.535, "splay_ratio": 0.192, "d22": null, "d64": null, "eta": 171.538, "theta": -132.951, "eta_prime": -177.047, "theta_prime": -133.750, "eta_base": -131.436, "theta_base": -96.565, "v0": 0.874, "v1": -23.062, "v2": 35.157, "v3": -35.608, "v4": 21.870, "amplitude": 36.807, "phase_angle": 17.223, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.424, "filter_rmsd": 0.037, "frame": { "rmsd": 0.004, "origin": [ 42.944, 72.871, 40.302 ], "x_axis": [ 0.449, 0.831, 0.328 ], "y_axis": [ -0.523, -0.053, 0.851 ], "z_axis": [ 0.725, -0.553, 0.411 ], "quaternion": [ 0.672, 0.522, 0.148, 0.504 ] } }, { "index": 303, "index_chain": 145, "chain_name": "B", "nt_resnum": 247, "nt_name": "U", "nt_code": "U", "nt_id": "///B/247", "linked_nts": [ "///B/246", "///B/248" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge", "alpha": -67.678, "beta": 168.728, "gamma": 57.058, "delta": 80.282, "epsilon": -139.719, "zeta": -95.892, "epsilon_zeta": -43.827, "bb_type": "BI", "chi": -153.780, "glyco_bond": "anti", "C5prime_xyz": [ -1.627, 8.826, 0.114 ], "P_xyz": [ 0.910, 9.474, -0.118 ], "form": ".", "ssZp": 4.201, "Dp": 4.648, "splay_angle": 45.030, "splay_distance": 7.296, "splay_ratio": 0.384, "d22": null, "d64": null, "eta": 163.609, "theta": -162.151, "eta_prime": -178.804, "theta_prime": -149.451, "eta_base": -124.236, "theta_base": -147.821, "v0": 0.051, "v1": -22.688, "v2": 35.315, "v3": -36.257, "v4": 22.817, "amplitude": 37.236, "phase_angle": 18.485, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.912, "filter_rmsd": 0.104, "frame": { "rmsd": 0.002, "origin": [ 46.243, 73.190, 41.532 ], "x_axis": [ -0.081, 0.640, 0.764 ], "y_axis": [ -0.519, -0.681, 0.516 ], "z_axis": [ 0.851, -0.355, 0.387 ], "quaternion": [ 0.395, 0.551, 0.055, 0.733 ] } }, { "index": 304, "index_chain": 146, "chain_name": "B", "nt_resnum": 248, "nt_name": "A", "nt_code": "A", "nt_id": "///B/248", "linked_nts": [ "///B/247", "///B/249" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C2'-endo,BII,non-canonical,non-pair-contact,helix,multiplet,bulge,phosphate", "alpha": -49.421, "beta": -172.141, "gamma": 67.684, "delta": 147.734, "epsilon": -122.381, "zeta": -172.341, "epsilon_zeta": 49.960, "bb_type": "BII", "chi": -103.732, "glyco_bond": "anti", "C5prime_xyz": [ -2.898, 8.119, -1.939 ], "P_xyz": [ -0.646, 9.492, -2.146 ], "form": ".", "ssZp": 1.522, "Dp": 1.488, "splay_angle": 26.844, "splay_distance": 4.496, "splay_ratio": 0.232, "d22": null, "d64": null, "eta": -144.773, "theta": -176.858, "eta_prime": -130.442, "theta_prime": 140.207, "eta_base": -143.007, "theta_base": 83.694, "v0": -26.397, "v1": 40.118, "v2": -37.626, "v3": 23.453, "v4": 1.650, "amplitude": 40.333, "phase_angle": 158.888, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1b", "suiteness": 0.501, "filter_rmsd": 0.036, "frame": { "rmsd": 0.009, "origin": [ 53.066, 70.936, 42.794 ], "x_axis": [ -0.267, 0.670, 0.693 ], "y_axis": [ -0.594, -0.681, 0.429 ], "z_axis": [ 0.759, -0.297, 0.580 ], "quaternion": [ 0.397, 0.457, 0.041, 0.795 ] } }, { "index": 305, "index_chain": 147, "chain_name": "B", "nt_resnum": 249, "nt_name": "U", "nt_code": "U", "nt_id": "///B/249", "linked_nts": [ "///B/248", "///B/250" ], "nt_type": "RNA", "dbn": ")", "summary": "turn,anti,~C3'-endo,BI,non-stack,isolated-canonical,helix,multiplet,bulge", "alpha": -77.191, "beta": 120.820, "gamma": -5.849, "delta": 85.019, "epsilon": -164.419, "zeta": -51.894, "epsilon_zeta": -112.525, "bb_type": "BI", "chi": -170.602, "glyco_bond": "anti", "C5prime_xyz": [ -2.096, 8.823, 0.909 ], "P_xyz": [ -0.468, 9.199, 2.954 ], "form": ".", "ssZp": 3.925, "Dp": 4.038, "splay_angle": 72.047, "splay_distance": 10.382, "splay_ratio": 0.589, "d22": null, "d64": null, "eta": 103.758, "theta": -128.498, "eta_prime": 89.785, "theta_prime": -117.884, "eta_base": 49.475, "theta_base": -83.960, "v0": -11.173, "v1": -9.774, "v2": 25.422, "v3": -32.572, "v4": 27.662, "amplitude": 32.362, "phase_angle": 38.229, "puckering": "C4'-exo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.104, "frame": { "rmsd": 0.006, "origin": [ 50.802, 70.308, 38.961 ], "x_axis": [ -0.984, 0.049, 0.173 ], "y_axis": [ -0.034, -0.995, 0.090 ], "z_axis": [ 0.177, 0.083, 0.981 ], "quaternion": [ 0.021, 0.088, 0.044, 0.995 ] } }, { "index": 306, "index_chain": 148, "chain_name": "B", "nt_resnum": 250, "nt_name": "G", "nt_code": "G", "nt_id": "///B/250", "linked_nts": [ "///B/249", "///B/251" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,bulge,A-minor", "alpha": -99.252, "beta": -137.825, "gamma": 75.506, "delta": 83.295, "epsilon": -153.143, "zeta": -74.238, "epsilon_zeta": -78.905, "bb_type": "BI", "chi": -167.547, "glyco_bond": "anti", "C5prime_xyz": [ -1.048, 8.576, 0.972 ], "P_xyz": [ 1.466, 8.198, 1.693 ], "form": ".", "ssZp": 4.565, "Dp": 4.632, "splay_angle": 24.567, "splay_distance": 4.250, "splay_ratio": 0.226, "d22": null, "d64": null, "eta": -168.168, "theta": -109.683, "eta_prime": -152.134, "theta_prime": -119.181, "eta_base": -114.901, "theta_base": -97.401, "v0": 5.267, "v1": -26.182, "v2": 36.042, "v3": -34.002, "v4": 18.134, "amplitude": 36.663, "phase_angle": 10.564, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1m", "suiteness": 0.126, "filter_rmsd": 0.005, "frame": { "rmsd": 0.005, "origin": [ 52.435, 68.035, 48.959 ], "x_axis": [ -0.586, -0.810, -0.022 ], "y_axis": [ 0.403, -0.267, -0.875 ], "z_axis": [ 0.703, -0.522, 0.483 ], "quaternion": [ -0.397, 0.223, -0.457, 0.764 ] } }, { "index": 307, "index_chain": 149, "chain_name": "B", "nt_resnum": 251, "nt_name": "G", "nt_code": "G", "nt_id": "///B/251", "linked_nts": [ "///B/250", "///B/252" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": 149.242, "beta": -155.858, "gamma": -179.251, "delta": 80.964, "epsilon": -123.397, "zeta": -88.854, "epsilon_zeta": -34.542, "bb_type": "--", "chi": 176.304, "glyco_bond": "anti", "C5prime_xyz": [ -1.284, 8.307, 1.855 ], "P_xyz": [ 0.422, 10.089, 0.980 ], "form": "A", "ssZp": 4.769, "Dp": 4.773, "splay_angle": 22.823, "splay_distance": 3.544, "splay_ratio": 0.200, "d22": null, "d64": null, "eta": 164.511, "theta": -165.883, "eta_prime": -176.441, "theta_prime": -159.760, "eta_base": -127.284, "theta_base": -128.036, "v0": 3.833, "v1": -25.757, "v2": 36.710, "v3": -35.581, "v4": 20.040, "amplitude": 37.672, "phase_angle": 12.974, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.879, "filter_rmsd": 0.008, "frame": { "rmsd": 0.008, "origin": [ 52.629, 65.094, 52.021 ], "x_axis": [ -0.295, -0.793, -0.533 ], "y_axis": [ 0.693, 0.207, -0.691 ], "z_axis": [ 0.658, -0.573, 0.488 ], "quaternion": [ 0.592, -0.050, 0.503, -0.628 ] } }, { "index": 308, "index_chain": 150, "chain_name": "B", "nt_resnum": 252, "nt_name": "A", "nt_code": "A", "nt_id": "///B/252", "linked_nts": [ "///B/251", "///B/253" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -52.917, "beta": 157.184, "gamma": 51.929, "delta": 78.671, "epsilon": -140.612, "zeta": -72.425, "epsilon_zeta": -68.187, "bb_type": "BI", "chi": -165.944, "glyco_bond": "anti", "C5prime_xyz": [ -1.430, 8.665, 0.833 ], "P_xyz": [ 1.158, 9.018, 0.725 ], "form": "A", "ssZp": 4.591, "Dp": 4.737, "splay_angle": 23.783, "splay_distance": 3.816, "splay_ratio": 0.210, "d22": null, "d64": null, "eta": 164.750, "theta": -137.230, "eta_prime": -179.534, "theta_prime": -135.973, "eta_base": -136.274, "theta_base": -103.888, "v0": 2.460, "v1": -25.521, "v2": 37.633, "v3": -37.196, "v4": 21.889, "amplitude": 38.967, "phase_angle": 15.032, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.492, "filter_rmsd": 0.037, "frame": { "rmsd": 0.003, "origin": [ 53.294, 62.332, 54.139 ], "x_axis": [ 0.187, -0.565, -0.804 ], "y_axis": [ 0.801, 0.562, -0.209 ], "z_axis": [ 0.569, -0.604, 0.557 ], "quaternion": [ 0.759, 0.130, 0.452, -0.450 ] } }, { "index": 309, "index_chain": 151, "chain_name": "B", "nt_resnum": 253, "nt_name": "U", "nt_code": "U", "nt_id": "///B/253", "linked_nts": [ "///B/252", "///B/254" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BII,canonical,non-pair-contact,helix,stem-end,coaxial-stack,splayed-apart", "alpha": -57.713, "beta": 161.511, "gamma": 61.541, "delta": 80.398, "epsilon": -131.566, "zeta": 168.406, "epsilon_zeta": 60.028, "bb_type": "BII", "chi": -160.941, "glyco_bond": "anti", "C5prime_xyz": [ -1.698, 8.797, 0.561 ], "P_xyz": [ 0.835, 9.420, 0.307 ], "form": ".", "ssZp": 4.370, "Dp": 4.663, "splay_angle": 92.895, "splay_distance": 13.078, "splay_ratio": 0.725, "d22": null, "d64": null, "eta": 174.556, "theta": 103.001, "eta_prime": -167.698, "theta_prime": 108.809, "eta_base": -118.711, "theta_base": 128.586, "v0": -0.009, "v1": -22.630, "v2": 35.429, "v3": -36.355, "v4": 22.924, "amplitude": 37.378, "phase_angle": 18.582, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.811, "filter_rmsd": 0.105, "frame": { "rmsd": 0.005, "origin": [ 54.545, 58.727, 54.233 ], "x_axis": [ 0.619, -0.109, -0.778 ], "y_axis": [ 0.609, 0.692, 0.387 ], "z_axis": [ 0.496, -0.713, 0.495 ], "quaternion": [ 0.838, 0.328, 0.380, -0.214 ] } }, { "index": 310, "index_chain": 152, "chain_name": "B", "nt_resnum": 254, "nt_name": "G", "nt_code": "G", "nt_id": "///B/254", "linked_nts": [ "///B/253", "///B/255" ], "nt_type": "RNA", "dbn": "]", "summary": "pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,splayed-apart", "alpha": -74.050, "beta": 146.662, "gamma": 38.573, "delta": 80.157, "epsilon": -144.900, "zeta": -67.989, "epsilon_zeta": -76.911, "bb_type": "BI", "chi": -174.850, "glyco_bond": "anti", "C5prime_xyz": [ -1.428, 8.558, 1.399 ], "P_xyz": [ 1.159, 8.583, 1.883 ], "form": "A", "ssZp": 4.672, "Dp": 4.686, "splay_angle": 24.428, "splay_distance": 3.835, "splay_ratio": 0.216, "d22": null, "d64": null, "eta": 166.862, "theta": -133.429, "eta_prime": 162.191, "theta_prime": -133.464, "eta_base": 150.347, "theta_base": -99.394, "v0": 2.399, "v1": -24.837, "v2": 36.520, "v3": -36.153, "v4": 21.293, "amplitude": 37.816, "phase_angle": 15.044, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "3a", "suiteness": 0.724, "filter_rmsd": 0.004, "frame": { "rmsd": 0.004, "origin": [ 52.421, 61.329, 66.872 ], "x_axis": [ -0.449, -0.389, -0.804 ], "y_axis": [ 0.800, 0.227, -0.556 ], "z_axis": [ 0.399, -0.893, 0.209 ], "quaternion": [ 0.497, 0.170, 0.605, -0.598 ] } }, { "index": 311, "index_chain": 153, "chain_name": "B", "nt_resnum": 255, "nt_name": "C", "nt_code": "C", "nt_id": "///B/255", "linked_nts": [ "///B/254", "///B/256" ], "nt_type": "RNA", "dbn": "]", "summary": "pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack", "alpha": -62.435, "beta": 175.118, "gamma": 51.379, "delta": 80.037, "epsilon": -127.738, "zeta": -69.228, "epsilon_zeta": -58.510, "bb_type": "BI", "chi": -166.379, "glyco_bond": "anti", "C5prime_xyz": [ -1.272, 8.696, 0.899 ], "P_xyz": [ 1.299, 9.094, 1.250 ], "form": ".", "ssZp": 4.573, "Dp": 4.769, "splay_angle": 33.903, "splay_distance": 5.314, "splay_ratio": 0.292, "d22": null, "d64": null, "eta": 170.456, "theta": -124.478, "eta_prime": -174.744, "theta_prime": -118.396, "eta_base": -122.097, "theta_base": -75.245, "v0": 3.672, "v1": -26.058, "v2": 37.325, "v3": -36.141, "v4": 20.422, "amplitude": 38.330, "phase_angle": 13.148, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.978, "filter_rmsd": 0.064, "frame": { "rmsd": 0.002, "origin": [ 51.845, 57.539, 66.779 ], "x_axis": [ 0.206, -0.151, -0.967 ], "y_axis": [ 0.906, 0.402, 0.131 ], "z_axis": [ 0.369, -0.903, 0.220 ], "quaternion": [ 0.676, 0.382, 0.494, -0.391 ] } }, { "index": 312, "index_chain": 154, "chain_name": "B", "nt_resnum": 256, "nt_name": "A", "nt_code": "A", "nt_id": "///B/256", "linked_nts": [ "///B/255", "///B/257" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,multiplet,ss-non-loop", "alpha": -48.406, "beta": 160.273, "gamma": 48.992, "delta": 77.511, "epsilon": -127.576, "zeta": -78.054, "epsilon_zeta": -49.522, "bb_type": "BI", "chi": -173.527, "glyco_bond": "anti", "C5prime_xyz": [ -1.697, 8.603, 1.307 ], "P_xyz": [ 0.845, 9.079, 1.762 ], "form": ".", "ssZp": 4.650, "Dp": 4.725, "splay_angle": 30.173, "splay_distance": 4.795, "splay_ratio": 0.263, "d22": null, "d64": null, "eta": 166.596, "theta": -130.472, "eta_prime": -169.170, "theta_prime": -125.266, "eta_base": -104.858, "theta_base": -83.148, "v0": 0.194, "v1": -23.689, "v2": 37.019, "v3": -37.901, "v4": 23.715, "amplitude": 38.997, "phase_angle": 18.325, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.592, "filter_rmsd": 0.038, "frame": { "rmsd": 0.003, "origin": [ 54.581, 54.145, 63.741 ], "x_axis": [ 0.724, 0.450, -0.522 ], "y_axis": [ 0.364, 0.394, 0.844 ], "z_axis": [ 0.586, -0.801, 0.121 ], "quaternion": [ 0.748, 0.550, 0.370, 0.029 ] } }, { "index": 313, "index_chain": 155, "chain_name": "B", "nt_resnum": 257, "nt_name": "G", "nt_code": "G", "nt_id": "///B/257", "linked_nts": [ "///B/256", "///B/258" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,multiplet,ss-non-loop", "alpha": -41.855, "beta": 156.025, "gamma": 50.717, "delta": 77.683, "epsilon": -152.046, "zeta": -100.827, "epsilon_zeta": -51.219, "bb_type": "BI", "chi": -167.614, "glyco_bond": "anti", "C5prime_xyz": [ -1.753, 8.791, 1.021 ], "P_xyz": [ 0.779, 9.354, 1.346 ], "form": ".", "ssZp": 4.493, "Dp": 4.547, "splay_angle": 28.366, "splay_distance": 4.852, "splay_ratio": 0.255, "d22": null, "d64": null, "eta": 168.762, "theta": -143.626, "eta_prime": -168.394, "theta_prime": -154.475, "eta_base": -105.925, "theta_base": -157.364, "v0": -0.618, "v1": -22.374, "v2": 35.639, "v3": -37.033, "v4": 23.708, "amplitude": 37.824, "phase_angle": 19.567, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.430, "filter_rmsd": 0.005, "frame": { "rmsd": 0.005, "origin": [ 58.933, 52.786, 62.255 ], "x_axis": [ 0.682, 0.681, 0.265 ], "y_axis": [ -0.301, -0.068, 0.951 ], "z_axis": [ 0.666, -0.729, 0.158 ], "quaternion": [ 0.666, 0.631, 0.151, 0.369 ] } }, { "index": 314, "index_chain": 156, "chain_name": "B", "nt_resnum": 258, "nt_name": "U", "nt_code": "U", "nt_id": "///B/258", "linked_nts": [ "///B/257", "///B/259" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-canonical,non-pair-contact,multiplet,ss-non-loop", "alpha": 148.077, "beta": -162.037, "gamma": -178.282, "delta": 80.495, "epsilon": -109.161, "zeta": -85.313, "epsilon_zeta": -23.848, "bb_type": "--", "chi": -174.027, "glyco_bond": "anti", "C5prime_xyz": [ -1.267, 8.400, 1.378 ], "P_xyz": [ 0.254, 10.203, 0.274 ], "form": ".", "ssZp": 4.609, "Dp": 4.796, "splay_angle": 32.718, "splay_distance": 5.202, "splay_ratio": 0.283, "d22": 4.000, "d64": 4.281, "eta": 163.591, "theta": -150.856, "eta_prime": 165.425, "theta_prime": -142.530, "eta_base": 172.247, "theta_base": -103.715, "v0": 5.485, "v1": -27.080, "v2": 37.191, "v3": -35.229, "v4": 18.741, "amplitude": 37.836, "phase_angle": 10.593, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.354, "filter_rmsd": 0.107, "frame": { "rmsd": 0.005, "origin": [ 60.925, 49.505, 59.286 ], "x_axis": [ 0.480, 0.758, 0.441 ], "y_axis": [ -0.369, -0.282, 0.886 ], "z_axis": [ 0.796, -0.588, 0.144 ], "quaternion": [ 0.579, 0.636, 0.153, 0.486 ] } }, { "index": 315, "index_chain": 157, "chain_name": "B", "nt_resnum": 259, "nt_name": "U", "nt_code": "U", "nt_id": "///B/259", "linked_nts": [ "///B/258", "///B/260" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,multiplet,ss-non-loop", "alpha": -39.874, "beta": 159.103, "gamma": 43.402, "delta": 78.102, "epsilon": -136.769, "zeta": -85.963, "epsilon_zeta": -50.806, "bb_type": "BI", "chi": -164.372, "glyco_bond": "anti", "C5prime_xyz": [ -1.667, 8.765, 0.758 ], "P_xyz": [ 0.849, 9.367, 1.054 ], "form": "A", "ssZp": 4.485, "Dp": 4.672, "splay_angle": 28.237, "splay_distance": 4.539, "splay_ratio": 0.246, "d22": 4.937, "d64": 4.997, "eta": 165.463, "theta": -150.642, "eta_prime": -174.250, "theta_prime": -146.754, "eta_base": -123.280, "theta_base": -126.712, "v0": -0.546, "v1": -22.616, "v2": 35.918, "v3": -37.216, "v4": 23.795, "amplitude": 38.081, "phase_angle": 19.406, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.131, "filter_rmsd": 0.103, "frame": { "rmsd": 0.002, "origin": [ 65.766, 49.662, 61.184 ], "x_axis": [ -0.174, 0.480, 0.860 ], "y_axis": [ -0.618, -0.733, 0.285 ], "z_axis": [ 0.767, -0.482, 0.424 ], "quaternion": [ 0.360, 0.533, -0.064, 0.763 ] } }, { "index": 316, "index_chain": 158, "chain_name": "B", "nt_resnum": 260, "nt_name": "C", "nt_code": "C", "nt_id": "///B/260", "linked_nts": [ "///B/259", null ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-canonical,non-pair-contact,multiplet,ss-non-loop", "alpha": -62.973, "beta": 173.646, "gamma": 54.296, "delta": 79.022, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": -155.492, "glyco_bond": "anti", "C5prime_xyz": [ -1.455, 8.848, 0.224 ], "P_xyz": [ 1.087, 9.454, 0.231 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": 0.246, "v1": -23.095, "v2": 35.840, "v3": -36.751, "v4": 23.013, "amplitude": 37.744, "phase_angle": 18.273, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.790, "filter_rmsd": 0.063, "frame": { "rmsd": 0.002, "origin": [ 69.842, 49.172, 63.120 ], "x_axis": [ -0.636, 0.179, 0.751 ], "y_axis": [ -0.428, -0.891, -0.150 ], "z_axis": [ 0.642, -0.417, 0.643 ], "quaternion": [ 0.170, 0.391, -0.159, 0.890 ] } } ], "num_hbonds": 540, "hbonds": [ { "index": 1, "atom1_serNum": 16, "atom2_serNum": 3298, "donAcc_type": "standard", "distance": 3.233, "atom1_id": "///A/103/N7", "atom2_id": "///A/256/N6", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 2, "atom1_serNum": 19, "atom2_serNum": 2472, "donAcc_type": "standard", "distance": 3.524, "atom1_id": "///A/103/O6", "atom2_id": "///A/217/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 3, "atom1_serNum": 20, "atom2_serNum": 2470, "donAcc_type": "standard", "distance": 3.195, "atom1_id": "///A/103/N1", "atom2_id": "///A/217/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 4, "atom1_serNum": 22, "atom2_serNum": 2469, "donAcc_type": "standard", "distance": 2.727, "atom1_id": "///A/103/N2", "atom2_id": "///A/217/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 5, "atom1_serNum": 27, "atom2_serNum": 3323, "donAcc_type": "standard", "distance": 2.540, "atom1_id": "///A/104/OP2", "atom2_id": "///A/257/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 6, "atom1_serNum": 39, "atom2_serNum": 3323, "donAcc_type": "standard", "distance": 3.177, "atom1_id": "///A/104/N7", "atom2_id": "///A/257/N2", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 7, "atom1_serNum": 42, "atom2_serNum": 2450, "donAcc_type": "standard", "distance": 3.134, "atom1_id": "///A/104/N6", "atom2_id": "///A/216/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 8, "atom1_serNum": 42, "atom2_serNum": 3343, "donAcc_type": "standard", "distance": 3.505, "atom1_id": "///A/104/N6", "atom2_id": "///A/258/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 9, "atom1_serNum": 57, "atom2_serNum": 90, "donAcc_type": "acceptable", "distance": 2.987, "atom1_id": "///A/105/O2'", "atom2_id": "///A/107/OP1", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 10, "atom1_serNum": 61, "atom2_serNum": 3341, "donAcc_type": "standard", "distance": 2.879, "atom1_id": "///A/105/N7", "atom2_id": "///A/258/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 11, "atom1_serNum": 64, "atom2_serNum": 2429, "donAcc_type": "standard", "distance": 2.803, "atom1_id": "///A/105/N6", "atom2_id": "///A/215/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 12, "atom1_serNum": 64, "atom2_serNum": 3343, "donAcc_type": "standard", "distance": 3.397, "atom1_id": "///A/105/N6", "atom2_id": "///A/258/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 13, "atom1_serNum": 65, "atom2_serNum": 2430, "donAcc_type": "standard", "distance": 2.653, "atom1_id": "///A/105/N1", "atom2_id": "///A/215/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 14, "atom1_serNum": 92, "atom2_serNum": 3376, "donAcc_type": "acceptable", "distance": 3.492, "atom1_id": "///A/107/O5'", "atom2_id": "///A/260/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 15, "atom1_serNum": 104, "atom2_serNum": 2408, "donAcc_type": "standard", "distance": 2.697, "atom1_id": "///A/107/N3", "atom2_id": "///A/214/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 16, "atom1_serNum": 106, "atom2_serNum": 2407, "donAcc_type": "standard", "distance": 3.017, "atom1_id": "///A/107/O4", "atom2_id": "///A/214/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 17, "atom1_serNum": 106, "atom2_serNum": 3361, "donAcc_type": "standard", "distance": 2.726, "atom1_id": "///A/107/O4", "atom2_id": "///A/259/N3", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 18, "atom1_serNum": 111, "atom2_serNum": 3376, "donAcc_type": "acceptable", "distance": 2.608, "atom1_id": "///A/108/OP2", "atom2_id": "///A/260/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 19, "atom1_serNum": 123, "atom2_serNum": 3380, "donAcc_type": "questionable", "distance": 2.789, "atom1_id": "///A/108/N7", "atom2_id": "///A/260/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 20, "atom1_serNum": 126, "atom2_serNum": 2387, "donAcc_type": "standard", "distance": 2.703, "atom1_id": "///A/108/O6", "atom2_id": "///A/213/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 21, "atom1_serNum": 126, "atom2_serNum": 3383, "donAcc_type": "standard", "distance": 3.158, "atom1_id": "///A/108/O6", "atom2_id": "///A/260/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 22, "atom1_serNum": 127, "atom2_serNum": 2385, "donAcc_type": "standard", "distance": 2.697, "atom1_id": "///A/108/N1", "atom2_id": "///A/213/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 23, "atom1_serNum": 129, "atom2_serNum": 2384, "donAcc_type": "standard", "distance": 2.618, "atom1_id": "///A/108/N2", "atom2_id": "///A/213/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 24, "atom1_serNum": 142, "atom2_serNum": 1761, "donAcc_type": "acceptable", "distance": 2.751, "atom1_id": "///A/109/O2'", "atom2_id": "///A/184/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 25, "atom1_serNum": 146, "atom2_serNum": 1761, "donAcc_type": "acceptable", "distance": 2.791, "atom1_id": "///A/109/O2", "atom2_id": "///A/184/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 26, "atom1_serNum": 146, "atom2_serNum": 2367, "donAcc_type": "standard", "distance": 2.972, "atom1_id": "///A/109/O2", "atom2_id": "///A/212/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 27, "atom1_serNum": 147, "atom2_serNum": 2365, "donAcc_type": "standard", "distance": 2.983, "atom1_id": "///A/109/N3", "atom2_id": "///A/212/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 28, "atom1_serNum": 149, "atom2_serNum": 2364, "donAcc_type": "standard", "distance": 2.867, "atom1_id": "///A/109/N4", "atom2_id": "///A/212/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 29, "atom1_serNum": 158, "atom2_serNum": 1757, "donAcc_type": "questionable", "distance": 3.154, "atom1_id": "///A/110/O4'", "atom2_id": "///A/184/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 30, "atom1_serNum": 162, "atom2_serNum": 1739, "donAcc_type": "acceptable", "distance": 2.929, "atom1_id": "///A/110/O2'", "atom2_id": "///A/183/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 31, "atom1_serNum": 162, "atom2_serNum": 1749, "donAcc_type": "acceptable", "distance": 2.652, "atom1_id": "///A/110/O2'", "atom2_id": "///A/183/N3", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 32, "atom1_serNum": 169, "atom2_serNum": 2344, "donAcc_type": "standard", "distance": 2.740, "atom1_id": "///A/110/O6", "atom2_id": "///A/211/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 33, "atom1_serNum": 170, "atom2_serNum": 2342, "donAcc_type": "standard", "distance": 2.855, "atom1_id": "///A/110/N1", "atom2_id": "///A/211/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 34, "atom1_serNum": 172, "atom2_serNum": 1747, "donAcc_type": "standard", "distance": 3.724, "atom1_id": "///A/110/N2", "atom2_id": "///A/183/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 35, "atom1_serNum": 172, "atom2_serNum": 2341, "donAcc_type": "standard", "distance": 2.837, "atom1_id": "///A/110/N2", "atom2_id": "///A/211/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 36, "atom1_serNum": 185, "atom2_serNum": 1417, "donAcc_type": "acceptable", "distance": 3.243, "atom1_id": "///A/111/O2'", "atom2_id": "///A/168/O2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 37, "atom1_serNum": 185, "atom2_serNum": 1418, "donAcc_type": "acceptable", "distance": 3.386, "atom1_id": "///A/111/O2'", "atom2_id": "///A/168/N3", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 38, "atom1_serNum": 192, "atom2_serNum": 2302, "donAcc_type": "standard", "distance": 2.957, "atom1_id": "///A/111/O6", "atom2_id": "///A/209/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 39, "atom1_serNum": 193, "atom2_serNum": 2300, "donAcc_type": "standard", "distance": 3.048, "atom1_id": "///A/111/N1", "atom2_id": "///A/209/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 40, "atom1_serNum": 195, "atom2_serNum": 2299, "donAcc_type": "standard", "distance": 2.987, "atom1_id": "///A/111/N2", "atom2_id": "///A/209/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 41, "atom1_serNum": 215, "atom2_serNum": 2282, "donAcc_type": "standard", "distance": 3.009, "atom1_id": "///A/112/O6", "atom2_id": "///A/208/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 42, "atom1_serNum": 216, "atom2_serNum": 2280, "donAcc_type": "standard", "distance": 2.845, "atom1_id": "///A/112/N1", "atom2_id": "///A/208/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 43, "atom1_serNum": 218, "atom2_serNum": 2279, "donAcc_type": "standard", "distance": 2.586, "atom1_id": "///A/112/N2", "atom2_id": "///A/208/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 44, "atom1_serNum": 231, "atom2_serNum": 2260, "donAcc_type": "acceptable", "distance": 3.126, "atom1_id": "///A/113/O2'", "atom2_id": "///A/207/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 45, "atom1_serNum": 239, "atom2_serNum": 2231, "donAcc_type": "acceptable", "distance": 3.377, "atom1_id": "///A/113/N1", "atom2_id": "///A/206/O2'", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 46, "atom1_serNum": 241, "atom2_serNum": 2260, "donAcc_type": "standard", "distance": 2.727, "atom1_id": "///A/113/N3", "atom2_id": "///A/207/N6", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 47, "atom1_serNum": 260, "atom2_serNum": 2241, "donAcc_type": "standard", "distance": 2.950, "atom1_id": "///A/114/N6", "atom2_id": "///A/206/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 48, "atom1_serNum": 275, "atom2_serNum": 293, "donAcc_type": "acceptable", "distance": 3.160, "atom1_id": "///A/115/O2'", "atom2_id": "///A/116/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 49, "atom1_serNum": 282, "atom2_serNum": 2218, "donAcc_type": "standard", "distance": 3.641, "atom1_id": "///A/115/N6", "atom2_id": "///A/205/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 50, "atom1_serNum": 304, "atom2_serNum": 2216, "donAcc_type": "standard", "distance": 3.546, "atom1_id": "///A/116/O6", "atom2_id": "///A/205/N3", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 51, "atom1_serNum": 305, "atom2_serNum": 2215, "donAcc_type": "standard", "distance": 3.058, "atom1_id": "///A/116/N1", "atom2_id": "///A/205/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 52, "atom1_serNum": 307, "atom2_serNum": 2215, "donAcc_type": "standard", "distance": 3.001, "atom1_id": "///A/116/N2", "atom2_id": "///A/205/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 53, "atom1_serNum": 327, "atom2_serNum": 2198, "donAcc_type": "standard", "distance": 2.766, "atom1_id": "///A/117/O6", "atom2_id": "///A/204/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 54, "atom1_serNum": 328, "atom2_serNum": 2196, "donAcc_type": "standard", "distance": 2.838, "atom1_id": "///A/117/N1", "atom2_id": "///A/204/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 55, "atom1_serNum": 330, "atom2_serNum": 2195, "donAcc_type": "standard", "distance": 2.876, "atom1_id": "///A/117/N2", "atom2_id": "///A/204/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 56, "atom1_serNum": 350, "atom2_serNum": 2178, "donAcc_type": "standard", "distance": 2.675, "atom1_id": "///A/118/O6", "atom2_id": "///A/203/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 57, "atom1_serNum": 351, "atom2_serNum": 2176, "donAcc_type": "standard", "distance": 2.731, "atom1_id": "///A/118/N1", "atom2_id": "///A/203/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 58, "atom1_serNum": 353, "atom2_serNum": 2175, "donAcc_type": "standard", "distance": 2.695, "atom1_id": "///A/118/N2", "atom2_id": "///A/203/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 59, "atom1_serNum": 373, "atom2_serNum": 2156, "donAcc_type": "standard", "distance": 2.713, "atom1_id": "///A/119/O6", "atom2_id": "///A/202/N3", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 60, "atom1_serNum": 374, "atom2_serNum": 2155, "donAcc_type": "standard", "distance": 2.605, "atom1_id": "///A/119/N1", "atom2_id": "///A/202/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 61, "atom1_serNum": 393, "atom2_serNum": 2136, "donAcc_type": "standard", "distance": 2.652, "atom1_id": "///A/120/O2", "atom2_id": "///A/201/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 62, "atom1_serNum": 394, "atom2_serNum": 2135, "donAcc_type": "standard", "distance": 2.888, "atom1_id": "///A/120/N3", "atom2_id": "///A/201/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 63, "atom1_serNum": 409, "atom2_serNum": 451, "donAcc_type": "acceptable", "distance": 3.570, "atom1_id": "///A/121/O2'", "atom2_id": "///A/123/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 64, "atom1_serNum": 413, "atom2_serNum": 2115, "donAcc_type": "standard", "distance": 2.858, "atom1_id": "///A/121/O2", "atom2_id": "///A/200/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 65, "atom1_serNum": 414, "atom2_serNum": 2113, "donAcc_type": "standard", "distance": 2.864, "atom1_id": "///A/121/N3", "atom2_id": "///A/200/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 66, "atom1_serNum": 416, "atom2_serNum": 2112, "donAcc_type": "standard", "distance": 2.781, "atom1_id": "///A/121/N4", "atom2_id": "///A/200/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 67, "atom1_serNum": 436, "atom2_serNum": 2063, "donAcc_type": "acceptable", "distance": 2.811, "atom1_id": "///A/122/N6", "atom2_id": "///A/198/O2'", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 68, "atom1_serNum": 451, "atom2_serNum": 466, "donAcc_type": "acceptable", "distance": 2.594, "atom1_id": "///A/123/O2'", "atom2_id": "///A/124/O5'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 69, "atom1_serNum": 451, "atom2_serNum": 469, "donAcc_type": "acceptable", "distance": 2.942, "atom1_id": "///A/123/O2'", "atom2_id": "///A/124/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 70, "atom1_serNum": 459, "atom2_serNum": 2067, "donAcc_type": "questionable", "distance": 3.116, "atom1_id": "///A/123/N1", "atom2_id": "///A/198/N7", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 71, "atom1_serNum": 478, "atom2_serNum": 2138, "donAcc_type": "standard", "distance": 3.150, "atom1_id": "///A/124/N3", "atom2_id": "///A/201/N2", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 72, "atom1_serNum": 480, "atom2_serNum": 2048, "donAcc_type": "standard", "distance": 3.407, "atom1_id": "///A/124/N4", "atom2_id": "///A/197/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 73, "atom1_serNum": 480, "atom2_serNum": 2139, "donAcc_type": "standard", "distance": 3.628, "atom1_id": "///A/124/N4", "atom2_id": "///A/201/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 74, "atom1_serNum": 485, "atom2_serNum": 519, "donAcc_type": "questionable", "distance": 3.196, "atom1_id": "///A/125/OP2", "atom2_id": "///A/126/N7", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 75, "atom1_serNum": 515, "atom2_serNum": 2151, "donAcc_type": "acceptable", "distance": 2.654, "atom1_id": "///A/126/O2'", "atom2_id": "///A/202/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 76, "atom1_serNum": 522, "atom2_serNum": 2028, "donAcc_type": "standard", "distance": 2.911, "atom1_id": "///A/126/O6", "atom2_id": "///A/196/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 77, "atom1_serNum": 523, "atom2_serNum": 2029, "donAcc_type": "standard", "distance": 2.956, "atom1_id": "///A/126/N1", "atom2_id": "///A/196/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 78, "atom1_serNum": 525, "atom2_serNum": 2128, "donAcc_type": "acceptable", "distance": 3.064, "atom1_id": "///A/126/N2", "atom2_id": "///A/201/O2'", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 79, "atom1_serNum": 525, "atom2_serNum": 2147, "donAcc_type": "standard", "distance": 3.543, "atom1_id": "///A/126/N2", "atom2_id": "///A/202/O4'", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 80, "atom1_serNum": 542, "atom2_serNum": 2008, "donAcc_type": "standard", "distance": 3.433, "atom1_id": "///A/127/O2", "atom2_id": "///A/195/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 81, "atom1_serNum": 543, "atom2_serNum": 2006, "donAcc_type": "standard", "distance": 3.128, "atom1_id": "///A/127/N3", "atom2_id": "///A/195/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 82, "atom1_serNum": 545, "atom2_serNum": 2005, "donAcc_type": "standard", "distance": 2.903, "atom1_id": "///A/127/N4", "atom2_id": "///A/195/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 83, "atom1_serNum": 562, "atom2_serNum": 1985, "donAcc_type": "standard", "distance": 2.755, "atom1_id": "///A/128/O2", "atom2_id": "///A/194/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 84, "atom1_serNum": 563, "atom2_serNum": 1983, "donAcc_type": "standard", "distance": 2.927, "atom1_id": "///A/128/N3", "atom2_id": "///A/194/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 85, "atom1_serNum": 565, "atom2_serNum": 1982, "donAcc_type": "standard", "distance": 3.042, "atom1_id": "///A/128/N4", "atom2_id": "///A/194/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 86, "atom1_serNum": 585, "atom2_serNum": 1962, "donAcc_type": "standard", "distance": 2.943, "atom1_id": "///A/129/O6", "atom2_id": "///A/193/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 87, "atom1_serNum": 586, "atom2_serNum": 1960, "donAcc_type": "standard", "distance": 2.880, "atom1_id": "///A/129/N1", "atom2_id": "///A/193/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 88, "atom1_serNum": 588, "atom2_serNum": 1959, "donAcc_type": "standard", "distance": 2.798, "atom1_id": "///A/129/N2", "atom2_id": "///A/193/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 89, "atom1_serNum": 588, "atom2_serNum": 1960, "donAcc_type": "standard", "distance": 2.942, "atom1_id": "///A/129/N2", "atom2_id": "///A/193/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 90, "atom1_serNum": 606, "atom2_serNum": 1941, "donAcc_type": "standard", "distance": 3.226, "atom1_id": "///A/130/N3", "atom2_id": "///A/192/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 91, "atom1_serNum": 608, "atom2_serNum": 1940, "donAcc_type": "standard", "distance": 2.573, "atom1_id": "///A/130/O4", "atom2_id": "///A/192/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 92, "atom1_serNum": 621, "atom2_serNum": 634, "donAcc_type": "acceptable", "distance": 2.847, "atom1_id": "///A/131/O2'", "atom2_id": "///A/132/OP1", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 93, "atom1_serNum": 628, "atom2_serNum": 6419, "donAcc_type": "acceptable", "distance": 3.380, "atom1_id": "///A/131/N6", "atom2_id": "///B/244/O2'", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 94, "atom1_serNum": 629, "atom2_serNum": 6419, "donAcc_type": "acceptable", "distance": 3.328, "atom1_id": "///A/131/N1", "atom2_id": "///B/244/O2'", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 95, "atom1_serNum": 647, "atom2_serNum": 1920, "donAcc_type": "standard", "distance": 3.323, "atom1_id": "///A/132/O2", "atom2_id": "///A/191/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 96, "atom1_serNum": 648, "atom2_serNum": 1918, "donAcc_type": "standard", "distance": 3.167, "atom1_id": "///A/132/N3", "atom2_id": "///A/191/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 97, "atom1_serNum": 650, "atom2_serNum": 1917, "donAcc_type": "standard", "distance": 2.822, "atom1_id": "///A/132/N4", "atom2_id": "///A/191/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 98, "atom1_serNum": 670, "atom2_serNum": 1897, "donAcc_type": "standard", "distance": 2.973, "atom1_id": "///A/133/N6", "atom2_id": "///A/190/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 99, "atom1_serNum": 671, "atom2_serNum": 1895, "donAcc_type": "standard", "distance": 2.708, "atom1_id": "///A/133/N1", "atom2_id": "///A/190/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 100, "atom1_serNum": 692, "atom2_serNum": 1877, "donAcc_type": "standard", "distance": 3.033, "atom1_id": "///A/134/O6", "atom2_id": "///A/189/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 101, "atom1_serNum": 693, "atom2_serNum": 1875, "donAcc_type": "standard", "distance": 2.898, "atom1_id": "///A/134/N1", "atom2_id": "///A/189/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 102, "atom1_serNum": 695, "atom2_serNum": 1874, "donAcc_type": "standard", "distance": 2.755, "atom1_id": "///A/134/N2", "atom2_id": "///A/189/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 103, "atom1_serNum": 713, "atom2_serNum": 1829, "donAcc_type": "standard", "distance": 2.864, "atom1_id": "///A/135/N3", "atom2_id": "///A/187/N7", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 104, "atom1_serNum": 715, "atom2_serNum": 1832, "donAcc_type": "standard", "distance": 3.360, "atom1_id": "///A/135/O4", "atom2_id": "///A/187/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 105, "atom1_serNum": 735, "atom2_serNum": 1726, "donAcc_type": "standard", "distance": 2.967, "atom1_id": "///A/136/N6", "atom2_id": "///A/182/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 106, "atom1_serNum": 736, "atom2_serNum": 1724, "donAcc_type": "standard", "distance": 3.097, "atom1_id": "///A/136/N1", "atom2_id": "///A/182/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 107, "atom1_serNum": 750, "atom2_serNum": 1803, "donAcc_type": "acceptable", "distance": 2.610, "atom1_id": "///A/137/O2'", "atom2_id": "///A/186/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 108, "atom1_serNum": 754, "atom2_serNum": 1706, "donAcc_type": "standard", "distance": 2.939, "atom1_id": "///A/137/O2", "atom2_id": "///A/181/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 109, "atom1_serNum": 754, "atom2_serNum": 1723, "donAcc_type": "questionable", "distance": 3.147, "atom1_id": "///A/137/O2", "atom2_id": "///A/182/O2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 110, "atom1_serNum": 754, "atom2_serNum": 1803, "donAcc_type": "acceptable", "distance": 2.719, "atom1_id": "///A/137/O2", "atom2_id": "///A/186/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 111, "atom1_serNum": 755, "atom2_serNum": 1704, "donAcc_type": "standard", "distance": 2.858, "atom1_id": "///A/137/N3", "atom2_id": "///A/181/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 112, "atom1_serNum": 757, "atom2_serNum": 1703, "donAcc_type": "standard", "distance": 3.017, "atom1_id": "///A/137/N4", "atom2_id": "///A/181/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 113, "atom1_serNum": 774, "atom2_serNum": 1340, "donAcc_type": "standard", "distance": 3.471, "atom1_id": "///A/138/O2", "atom2_id": "///A/164/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 114, "atom1_serNum": 774, "atom2_serNum": 1683, "donAcc_type": "standard", "distance": 2.839, "atom1_id": "///A/138/O2", "atom2_id": "///A/180/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 115, "atom1_serNum": 775, "atom2_serNum": 1681, "donAcc_type": "standard", "distance": 2.765, "atom1_id": "///A/138/N3", "atom2_id": "///A/180/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 116, "atom1_serNum": 777, "atom2_serNum": 1680, "donAcc_type": "standard", "distance": 2.569, "atom1_id": "///A/138/N4", "atom2_id": "///A/180/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 117, "atom1_serNum": 782, "atom2_serNum": 1315, "donAcc_type": "standard", "distance": 2.907, "atom1_id": "///A/139/OP2", "atom2_id": "///A/163/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 118, "atom1_serNum": 782, "atom2_serNum": 1317, "donAcc_type": "standard", "distance": 3.353, "atom1_id": "///A/139/OP2", "atom2_id": "///A/163/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 119, "atom1_serNum": 786, "atom2_serNum": 1799, "donAcc_type": "questionable", "distance": 3.319, "atom1_id": "///A/139/O4'", "atom2_id": "///A/186/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 120, "atom1_serNum": 790, "atom2_serNum": 1783, "donAcc_type": "acceptable", "distance": 2.824, "atom1_id": "///A/139/O2'", "atom2_id": "///A/185/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 121, "atom1_serNum": 790, "atom2_serNum": 1787, "donAcc_type": "acceptable", "distance": 2.937, "atom1_id": "///A/139/O2'", "atom2_id": "///A/185/O2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 122, "atom1_serNum": 794, "atom2_serNum": 1340, "donAcc_type": "standard", "distance": 2.912, "atom1_id": "///A/139/N7", "atom2_id": "///A/164/N2", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 123, "atom1_serNum": 797, "atom2_serNum": 1326, "donAcc_type": "standard", "distance": 3.032, "atom1_id": "///A/139/N6", "atom2_id": "///A/164/O4'", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 124, "atom1_serNum": 797, "atom2_serNum": 1341, "donAcc_type": "standard", "distance": 3.186, "atom1_id": "///A/139/N6", "atom2_id": "///A/164/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 125, "atom1_serNum": 816, "atom2_serNum": 1317, "donAcc_type": "standard", "distance": 2.735, "atom1_id": "///A/140/N7", "atom2_id": "///A/163/N2", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 126, "atom1_serNum": 819, "atom2_serNum": 1307, "donAcc_type": "acceptable", "distance": 2.923, "atom1_id": "///A/140/N6", "atom2_id": "///A/163/O2'", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 127, "atom1_serNum": 819, "atom2_serNum": 1318, "donAcc_type": "standard", "distance": 2.714, "atom1_id": "///A/140/N6", "atom2_id": "///A/163/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 128, "atom1_serNum": 841, "atom2_serNum": 1292, "donAcc_type": "standard", "distance": 2.615, "atom1_id": "///A/141/O6", "atom2_id": "///A/162/N3", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 129, "atom1_serNum": 842, "atom2_serNum": 1291, "donAcc_type": "standard", "distance": 2.618, "atom1_id": "///A/141/N1", "atom2_id": "///A/162/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 130, "atom1_serNum": 862, "atom2_serNum": 1273, "donAcc_type": "standard", "distance": 2.649, "atom1_id": "///A/142/N3", "atom2_id": "///A/161/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 131, "atom1_serNum": 864, "atom2_serNum": 1272, "donAcc_type": "standard", "distance": 2.692, "atom1_id": "///A/142/O4", "atom2_id": "///A/161/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 132, "atom1_serNum": 881, "atom2_serNum": 1252, "donAcc_type": "standard", "distance": 2.892, "atom1_id": "///A/143/O2", "atom2_id": "///A/160/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 133, "atom1_serNum": 882, "atom2_serNum": 1250, "donAcc_type": "standard", "distance": 2.943, "atom1_id": "///A/143/N3", "atom2_id": "///A/160/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 134, "atom1_serNum": 884, "atom2_serNum": 1249, "donAcc_type": "standard", "distance": 2.898, "atom1_id": "///A/143/N4", "atom2_id": "///A/160/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 135, "atom1_serNum": 902, "atom2_serNum": 1228, "donAcc_type": "standard", "distance": 2.926, "atom1_id": "///A/144/N3", "atom2_id": "///A/159/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 136, "atom1_serNum": 904, "atom2_serNum": 1227, "donAcc_type": "standard", "distance": 3.170, "atom1_id": "///A/144/O4", "atom2_id": "///A/159/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 137, "atom1_serNum": 917, "atom2_serNum": 933, "donAcc_type": "acceptable", "distance": 3.205, "atom1_id": "///A/145/O2'", "atom2_id": "///A/146/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 138, "atom1_serNum": 921, "atom2_serNum": 1207, "donAcc_type": "standard", "distance": 2.768, "atom1_id": "///A/145/O2", "atom2_id": "///A/158/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 139, "atom1_serNum": 922, "atom2_serNum": 1205, "donAcc_type": "standard", "distance": 3.001, "atom1_id": "///A/145/N3", "atom2_id": "///A/158/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 140, "atom1_serNum": 924, "atom2_serNum": 1204, "donAcc_type": "standard", "distance": 3.095, "atom1_id": "///A/145/N4", "atom2_id": "///A/158/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 141, "atom1_serNum": 944, "atom2_serNum": 1184, "donAcc_type": "standard", "distance": 2.715, "atom1_id": "///A/146/N6", "atom2_id": "///A/157/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 142, "atom1_serNum": 945, "atom2_serNum": 1182, "donAcc_type": "standard", "distance": 2.572, "atom1_id": "///A/146/N1", "atom2_id": "///A/157/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 143, "atom1_serNum": 966, "atom2_serNum": 1162, "donAcc_type": "standard", "distance": 2.711, "atom1_id": "///A/147/O6", "atom2_id": "///A/156/N3", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 144, "atom1_serNum": 967, "atom2_serNum": 1161, "donAcc_type": "standard", "distance": 2.564, "atom1_id": "///A/147/N1", "atom2_id": "///A/156/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 145, "atom1_serNum": 969, "atom2_serNum": 1161, "donAcc_type": "standard", "distance": 3.248, "atom1_id": "///A/147/N2", "atom2_id": "///A/156/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 146, "atom1_serNum": 989, "atom2_serNum": 1142, "donAcc_type": "standard", "distance": 2.989, "atom1_id": "///A/148/O6", "atom2_id": "///A/155/N3", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 147, "atom1_serNum": 990, "atom2_serNum": 1141, "donAcc_type": "standard", "distance": 2.741, "atom1_id": "///A/148/N1", "atom2_id": "///A/155/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 148, "atom1_serNum": 1012, "atom2_serNum": 1124, "donAcc_type": "standard", "distance": 3.176, "atom1_id": "///A/149/O6", "atom2_id": "///A/154/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 149, "atom1_serNum": 1013, "atom2_serNum": 1122, "donAcc_type": "standard", "distance": 2.991, "atom1_id": "///A/149/N1", "atom2_id": "///A/154/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 150, "atom1_serNum": 1015, "atom2_serNum": 1121, "donAcc_type": "standard", "distance": 2.695, "atom1_id": "///A/149/N2", "atom2_id": "///A/154/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 151, "atom1_serNum": 1028, "atom2_serNum": 1077, "donAcc_type": "acceptable", "distance": 3.051, "atom1_id": "///A/150/O2'", "atom2_id": "///A/152/N7", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 152, "atom1_serNum": 1038, "atom2_serNum": 1087, "donAcc_type": "standard", "distance": 2.861, "atom1_id": "///A/150/N2", "atom2_id": "///A/153/OP2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 153, "atom1_serNum": 1038, "atom2_serNum": 1099, "donAcc_type": "standard", "distance": 2.745, "atom1_id": "///A/150/N2", "atom2_id": "///A/153/N7", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 154, "atom1_serNum": 1058, "atom2_serNum": 3126, "donAcc_type": "standard", "distance": 3.047, "atom1_id": "///A/151/N6", "atom2_id": "///A/248/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 155, "atom1_serNum": 1059, "atom2_serNum": 3125, "donAcc_type": "standard", "distance": 2.924, "atom1_id": "///A/151/N1", "atom2_id": "///A/248/N6", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 156, "atom1_serNum": 1073, "atom2_serNum": 2610, "donAcc_type": "acceptable", "distance": 3.049, "atom1_id": "///A/152/O2'", "atom2_id": "///A/224/O3'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 157, "atom1_serNum": 1073, "atom2_serNum": 2612, "donAcc_type": "acceptable", "distance": 2.616, "atom1_id": "///A/152/O2'", "atom2_id": "///A/224/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 158, "atom1_serNum": 1080, "atom2_serNum": 3160, "donAcc_type": "acceptable", "distance": 2.890, "atom1_id": "///A/152/N6", "atom2_id": "///A/250/O2'", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 159, "atom1_serNum": 1083, "atom2_serNum": 2612, "donAcc_type": "acceptable", "distance": 2.692, "atom1_id": "///A/152/N3", "atom2_id": "///A/224/O2'", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 160, "atom1_serNum": 1091, "atom2_serNum": 2608, "donAcc_type": "questionable", "distance": 3.360, "atom1_id": "///A/153/O4'", "atom2_id": "///A/224/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 161, "atom1_serNum": 1095, "atom2_serNum": 2592, "donAcc_type": "acceptable", "distance": 2.878, "atom1_id": "///A/153/O2'", "atom2_id": "///A/223/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 162, "atom1_serNum": 1095, "atom2_serNum": 2596, "donAcc_type": "acceptable", "distance": 2.773, "atom1_id": "///A/153/O2'", "atom2_id": "///A/223/O2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 163, "atom1_serNum": 1103, "atom2_serNum": 3160, "donAcc_type": "acceptable", "distance": 3.209, "atom1_id": "///A/153/N1", "atom2_id": "///A/250/O2'", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 164, "atom1_serNum": 1105, "atom2_serNum": 3170, "donAcc_type": "standard", "distance": 2.794, "atom1_id": "///A/153/N3", "atom2_id": "///A/250/N2", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 165, "atom1_serNum": 1117, "atom2_serNum": 3181, "donAcc_type": "acceptable", "distance": 3.075, "atom1_id": "///A/154/O2'", "atom2_id": "///A/251/O3'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 166, "atom1_serNum": 1117, "atom2_serNum": 3183, "donAcc_type": "acceptable", "distance": 2.673, "atom1_id": "///A/154/O2'", "atom2_id": "///A/251/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 167, "atom1_serNum": 1157, "atom2_serNum": 1173, "donAcc_type": "acceptable", "distance": 3.251, "atom1_id": "///A/156/O2'", "atom2_id": "///A/157/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 168, "atom1_serNum": 1197, "atom2_serNum": 1216, "donAcc_type": "acceptable", "distance": 3.173, "atom1_id": "///A/158/O2'", "atom2_id": "///A/159/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 169, "atom1_serNum": 1298, "atom2_serNum": 1616, "donAcc_type": "standard", "distance": 3.010, "atom1_id": "///A/163/OP1", "atom2_id": "///A/177/N3", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 170, "atom1_serNum": 1321, "atom2_serNum": 1360, "donAcc_type": "standard", "distance": 3.153, "atom1_id": "///A/164/OP1", "atom2_id": "///A/165/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 171, "atom1_serNum": 1322, "atom2_serNum": 1596, "donAcc_type": "standard", "distance": 2.888, "atom1_id": "///A/164/OP2", "atom2_id": "///A/176/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 172, "atom1_serNum": 1322, "atom2_serNum": 1598, "donAcc_type": "standard", "distance": 3.181, "atom1_id": "///A/164/OP2", "atom2_id": "///A/176/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 173, "atom1_serNum": 1328, "atom2_serNum": 1810, "donAcc_type": "standard", "distance": 3.307, "atom1_id": "///A/164/O3'", "atom2_id": "///A/186/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 174, "atom1_serNum": 1330, "atom2_serNum": 1349, "donAcc_type": "acceptable", "distance": 2.976, "atom1_id": "///A/164/O2'", "atom2_id": "///A/165/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 175, "atom1_serNum": 1330, "atom2_serNum": 1696, "donAcc_type": "acceptable", "distance": 2.997, "atom1_id": "///A/164/O2'", "atom2_id": "///A/181/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 176, "atom1_serNum": 1337, "atom2_serNum": 1638, "donAcc_type": "standard", "distance": 3.163, "atom1_id": "///A/164/O6", "atom2_id": "///A/178/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 177, "atom1_serNum": 1357, "atom2_serNum": 1575, "donAcc_type": "standard", "distance": 2.836, "atom1_id": "///A/165/O2", "atom2_id": "///A/175/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 178, "atom1_serNum": 1358, "atom2_serNum": 1573, "donAcc_type": "standard", "distance": 2.861, "atom1_id": "///A/165/N3", "atom2_id": "///A/175/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 179, "atom1_serNum": 1360, "atom2_serNum": 1572, "donAcc_type": "standard", "distance": 2.847, "atom1_id": "///A/165/N4", "atom2_id": "///A/175/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 180, "atom1_serNum": 1365, "atom2_serNum": 1393, "donAcc_type": "acceptable", "distance": 2.495, "atom1_id": "///A/166/OP2", "atom2_id": "///A/167/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 181, "atom1_serNum": 1373, "atom2_serNum": 5949, "donAcc_type": "acceptable", "distance": 2.999, "atom1_id": "///A/166/O2'", "atom2_id": "///B/222/OP1", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 182, "atom1_serNum": 1377, "atom2_serNum": 1552, "donAcc_type": "standard", "distance": 2.889, "atom1_id": "///A/166/O2", "atom2_id": "///A/174/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 183, "atom1_serNum": 1378, "atom2_serNum": 1550, "donAcc_type": "standard", "distance": 2.955, "atom1_id": "///A/166/N3", "atom2_id": "///A/174/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 184, "atom1_serNum": 1380, "atom2_serNum": 1549, "donAcc_type": "standard", "distance": 2.921, "atom1_id": "///A/166/N4", "atom2_id": "///A/174/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 185, "atom1_serNum": 1400, "atom2_serNum": 1527, "donAcc_type": "standard", "distance": 2.670, "atom1_id": "///A/167/O4", "atom2_id": "///A/173/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 186, "atom1_serNum": 1420, "atom2_serNum": 1855, "donAcc_type": "standard", "distance": 3.051, "atom1_id": "///A/168/O4", "atom2_id": "///A/188/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 187, "atom1_serNum": 1420, "atom2_serNum": 1857, "donAcc_type": "standard", "distance": 2.980, "atom1_id": "///A/168/O4", "atom2_id": "///A/188/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 188, "atom1_serNum": 1433, "atom2_serNum": 2348, "donAcc_type": "acceptable", "distance": 3.509, "atom1_id": "///A/169/O2'", "atom2_id": "///A/212/OP1", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 189, "atom1_serNum": 1440, "atom2_serNum": 6664, "donAcc_type": "standard", "distance": 2.921, "atom1_id": "///A/169/O6", "atom2_id": "///B/255/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 190, "atom1_serNum": 1441, "atom2_serNum": 6662, "donAcc_type": "standard", "distance": 2.854, "atom1_id": "///A/169/N1", "atom2_id": "///B/255/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 191, "atom1_serNum": 1443, "atom2_serNum": 6661, "donAcc_type": "standard", "distance": 2.697, "atom1_id": "///A/169/N2", "atom2_id": "///B/255/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 192, "atom1_serNum": 1460, "atom2_serNum": 6644, "donAcc_type": "standard", "distance": 2.726, "atom1_id": "///A/170/O2", "atom2_id": "///B/254/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 193, "atom1_serNum": 1461, "atom2_serNum": 6642, "donAcc_type": "standard", "distance": 2.883, "atom1_id": "///A/170/N3", "atom2_id": "///B/254/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 194, "atom1_serNum": 1463, "atom2_serNum": 6641, "donAcc_type": "standard", "distance": 2.894, "atom1_id": "///A/170/N4", "atom2_id": "///B/254/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 195, "atom1_serNum": 1486, "atom2_serNum": 1505, "donAcc_type": "standard", "distance": 3.406, "atom1_id": "///A/171/N3", "atom2_id": "///A/172/N6", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 196, "atom1_serNum": 1552, "atom2_serNum": 5956, "donAcc_type": "standard", "distance": 3.282, "atom1_id": "///A/174/N2", "atom2_id": "///B/222/O3'", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 197, "atom1_serNum": 1552, "atom2_serNum": 5958, "donAcc_type": "acceptable", "distance": 3.388, "atom1_id": "///A/174/N2", "atom2_id": "///B/222/O2'", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 198, "atom1_serNum": 1565, "atom2_serNum": 5969, "donAcc_type": "acceptable", "distance": 3.560, "atom1_id": "///A/175/O2'", "atom2_id": "///B/223/OP1", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 199, "atom1_serNum": 1607, "atom2_serNum": 1673, "donAcc_type": "acceptable", "distance": 3.319, "atom1_id": "///A/177/O4'", "atom2_id": "///A/180/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 200, "atom1_serNum": 1611, "atom2_serNum": 1635, "donAcc_type": "acceptable", "distance": 3.831, "atom1_id": "///A/177/O2'", "atom2_id": "///A/178/N7", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 201, "atom1_serNum": 1653, "atom2_serNum": 1657, "donAcc_type": "acceptable", "distance": 2.795, "atom1_id": "///A/179/O2'", "atom2_id": "///A/179/O2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 202, "atom1_serNum": 1696, "atom2_serNum": 1811, "donAcc_type": "acceptable", "distance": 2.482, "atom1_id": "///A/181/O2'", "atom2_id": "///A/186/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 203, "atom1_serNum": 1706, "atom2_serNum": 1813, "donAcc_type": "standard", "distance": 2.918, "atom1_id": "///A/181/N2", "atom2_id": "///A/186/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 204, "atom1_serNum": 1719, "atom2_serNum": 1843, "donAcc_type": "acceptable", "distance": 3.228, "atom1_id": "///A/182/O2'", "atom2_id": "///A/188/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 205, "atom1_serNum": 1723, "atom2_serNum": 1803, "donAcc_type": "acceptable", "distance": 3.248, "atom1_id": "///A/182/O2", "atom2_id": "///A/186/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 206, "atom1_serNum": 1730, "atom2_serNum": 1795, "donAcc_type": "questionable", "distance": 3.204, "atom1_id": "///A/183/OP1", "atom2_id": "///A/186/OP2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 207, "atom1_serNum": 1752, "atom2_serNum": 1794, "donAcc_type": "questionable", "distance": 2.921, "atom1_id": "///A/184/OP1", "atom2_id": "///A/186/OP1", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 208, "atom1_serNum": 1753, "atom2_serNum": 1795, "donAcc_type": "questionable", "distance": 3.111, "atom1_id": "///A/184/OP2", "atom2_id": "///A/186/OP2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 209, "atom1_serNum": 1769, "atom2_serNum": 2357, "donAcc_type": "acceptable", "distance": 2.559, "atom1_id": "///A/184/N1", "atom2_id": "///A/212/O2'", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 210, "atom1_serNum": 1771, "atom2_serNum": 2367, "donAcc_type": "standard", "distance": 3.053, "atom1_id": "///A/184/N3", "atom2_id": "///A/212/N2", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 211, "atom1_serNum": 1783, "atom2_serNum": 1787, "donAcc_type": "acceptable", "distance": 2.979, "atom1_id": "///A/185/O2'", "atom2_id": "///A/185/O2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 212, "atom1_serNum": 2043, "atom2_serNum": 2105, "donAcc_type": "acceptable", "distance": 2.813, "atom1_id": "///A/197/O2'", "atom2_id": "///A/200/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 213, "atom1_serNum": 2043, "atom2_serNum": 2116, "donAcc_type": "acceptable", "distance": 2.679, "atom1_id": "///A/197/O2'", "atom2_id": "///A/200/N3", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 214, "atom1_serNum": 2043, "atom2_serNum": 2124, "donAcc_type": "acceptable", "distance": 3.582, "atom1_id": "///A/197/O2'", "atom2_id": "///A/201/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 215, "atom1_serNum": 2047, "atom2_serNum": 2115, "donAcc_type": "standard", "distance": 2.673, "atom1_id": "///A/197/O2", "atom2_id": "///A/200/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 216, "atom1_serNum": 2231, "atom2_serNum": 2245, "donAcc_type": "acceptable", "distance": 2.710, "atom1_id": "///A/206/O2'", "atom2_id": "///A/207/OP2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 217, "atom1_serNum": 2245, "atom2_serNum": 2282, "donAcc_type": "standard", "distance": 3.781, "atom1_id": "///A/207/OP2", "atom2_id": "///A/208/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 218, "atom1_serNum": 2295, "atom2_serNum": 2330, "donAcc_type": "acceptable", "distance": 3.237, "atom1_id": "///A/209/O2'", "atom2_id": "///A/211/O5'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 219, "atom1_serNum": 2407, "atom2_serNum": 3363, "donAcc_type": "standard", "distance": 3.708, "atom1_id": "///A/214/N6", "atom2_id": "///A/259/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 220, "atom1_serNum": 2485, "atom2_serNum": 2536, "donAcc_type": "acceptable", "distance": 3.083, "atom1_id": "///A/218/O2'", "atom2_id": "///A/220/O6", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 221, "atom1_serNum": 2485, "atom2_serNum": 3235, "donAcc_type": "acceptable", "distance": 3.043, "atom1_id": "///A/218/O2'", "atom2_id": "///A/253/O4", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 222, "atom1_serNum": 2495, "atom2_serNum": 2514, "donAcc_type": "standard", "distance": 2.972, "atom1_id": "///A/218/N3", "atom2_id": "///A/219/N6", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 223, "atom1_serNum": 2536, "atom2_serNum": 3233, "donAcc_type": "standard", "distance": 2.809, "atom1_id": "///A/220/O6", "atom2_id": "///A/253/N3", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 224, "atom1_serNum": 2537, "atom2_serNum": 3232, "donAcc_type": "standard", "distance": 2.671, "atom1_id": "///A/220/N1", "atom2_id": "///A/253/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 225, "atom1_serNum": 2557, "atom2_serNum": 3214, "donAcc_type": "standard", "distance": 2.882, "atom1_id": "///A/221/N3", "atom2_id": "///A/252/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 226, "atom1_serNum": 2559, "atom2_serNum": 3213, "donAcc_type": "standard", "distance": 2.975, "atom1_id": "///A/221/O4", "atom2_id": "///A/252/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 227, "atom1_serNum": 2563, "atom2_serNum": 4759, "donAcc_type": "acceptable", "distance": 2.847, "atom1_id": "///A/222/OP1", "atom2_id": "///B/166/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 228, "atom1_serNum": 2570, "atom2_serNum": 4938, "donAcc_type": "standard", "distance": 3.203, "atom1_id": "///A/222/O3'", "atom2_id": "///B/174/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 229, "atom1_serNum": 2572, "atom2_serNum": 4938, "donAcc_type": "acceptable", "distance": 3.382, "atom1_id": "///A/222/O2'", "atom2_id": "///B/174/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 230, "atom1_serNum": 2576, "atom2_serNum": 3193, "donAcc_type": "standard", "distance": 2.791, "atom1_id": "///A/222/O2", "atom2_id": "///A/251/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 231, "atom1_serNum": 2577, "atom2_serNum": 3191, "donAcc_type": "standard", "distance": 2.906, "atom1_id": "///A/222/N3", "atom2_id": "///A/251/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 232, "atom1_serNum": 2579, "atom2_serNum": 3190, "donAcc_type": "standard", "distance": 3.053, "atom1_id": "///A/222/N4", "atom2_id": "///A/251/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 233, "atom1_serNum": 2583, "atom2_serNum": 4951, "donAcc_type": "acceptable", "distance": 3.621, "atom1_id": "///A/223/OP1", "atom2_id": "///B/175/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 234, "atom1_serNum": 2596, "atom2_serNum": 3170, "donAcc_type": "standard", "distance": 2.941, "atom1_id": "///A/223/O2", "atom2_id": "///A/250/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 235, "atom1_serNum": 2597, "atom2_serNum": 3168, "donAcc_type": "standard", "distance": 2.942, "atom1_id": "///A/223/N3", "atom2_id": "///A/250/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 236, "atom1_serNum": 2599, "atom2_serNum": 3167, "donAcc_type": "standard", "distance": 2.847, "atom1_id": "///A/223/N4", "atom2_id": "///A/250/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 237, "atom1_serNum": 2616, "atom2_serNum": 3125, "donAcc_type": "standard", "distance": 2.815, "atom1_id": "///A/224/O2", "atom2_id": "///A/248/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 238, "atom1_serNum": 2617, "atom2_serNum": 3122, "donAcc_type": "standard", "distance": 3.009, "atom1_id": "///A/224/N3", "atom2_id": "///A/248/N7", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 239, "atom1_serNum": 2632, "atom2_serNum": 2683, "donAcc_type": "acceptable", "distance": 3.129, "atom1_id": "///A/225/O2'", "atom2_id": "///A/227/O6", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 240, "atom1_serNum": 2632, "atom2_serNum": 3105, "donAcc_type": "acceptable", "distance": 2.856, "atom1_id": "///A/225/O2'", "atom2_id": "///A/247/O4", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 241, "atom1_serNum": 2639, "atom2_serNum": 3110, "donAcc_type": "standard", "distance": 2.772, "atom1_id": "///A/225/N6", "atom2_id": "///A/248/OP2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 242, "atom1_serNum": 2642, "atom2_serNum": 2661, "donAcc_type": "standard", "distance": 3.086, "atom1_id": "///A/225/N3", "atom2_id": "///A/226/N6", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 243, "atom1_serNum": 2661, "atom2_serNum": 3147, "donAcc_type": "standard", "distance": 2.651, "atom1_id": "///A/226/N6", "atom2_id": "///A/249/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 244, "atom1_serNum": 2662, "atom2_serNum": 3145, "donAcc_type": "standard", "distance": 2.870, "atom1_id": "///A/226/N1", "atom2_id": "///A/249/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 245, "atom1_serNum": 2683, "atom2_serNum": 3103, "donAcc_type": "standard", "distance": 2.782, "atom1_id": "///A/227/O6", "atom2_id": "///A/247/N3", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 246, "atom1_serNum": 2684, "atom2_serNum": 3102, "donAcc_type": "standard", "distance": 2.680, "atom1_id": "///A/227/N1", "atom2_id": "///A/247/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 247, "atom1_serNum": 2704, "atom2_serNum": 3084, "donAcc_type": "standard", "distance": 2.970, "atom1_id": "///A/228/N3", "atom2_id": "///A/246/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 248, "atom1_serNum": 2706, "atom2_serNum": 3083, "donAcc_type": "standard", "distance": 3.044, "atom1_id": "///A/228/O4", "atom2_id": "///A/246/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 249, "atom1_serNum": 2723, "atom2_serNum": 3063, "donAcc_type": "standard", "distance": 2.730, "atom1_id": "///A/229/O2", "atom2_id": "///A/245/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 250, "atom1_serNum": 2724, "atom2_serNum": 3061, "donAcc_type": "standard", "distance": 2.810, "atom1_id": "///A/229/N3", "atom2_id": "///A/245/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 251, "atom1_serNum": 2726, "atom2_serNum": 3060, "donAcc_type": "standard", "distance": 2.817, "atom1_id": "///A/229/N4", "atom2_id": "///A/245/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 252, "atom1_serNum": 2739, "atom2_serNum": 2757, "donAcc_type": "acceptable", "distance": 3.266, "atom1_id": "///A/230/O2'", "atom2_id": "///A/231/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 253, "atom1_serNum": 2746, "atom2_serNum": 3040, "donAcc_type": "standard", "distance": 2.815, "atom1_id": "///A/230/N6", "atom2_id": "///A/244/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 254, "atom1_serNum": 2747, "atom2_serNum": 3038, "donAcc_type": "standard", "distance": 2.800, "atom1_id": "///A/230/N1", "atom2_id": "///A/244/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 255, "atom1_serNum": 2768, "atom2_serNum": 2997, "donAcc_type": "standard", "distance": 3.007, "atom1_id": "///A/231/N6", "atom2_id": "///A/242/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 256, "atom1_serNum": 2768, "atom2_serNum": 3020, "donAcc_type": "standard", "distance": 2.733, "atom1_id": "///A/231/N6", "atom2_id": "///A/243/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 257, "atom1_serNum": 2769, "atom2_serNum": 3018, "donAcc_type": "standard", "distance": 2.687, "atom1_id": "///A/231/N1", "atom2_id": "///A/243/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 258, "atom1_serNum": 2787, "atom2_serNum": 3000, "donAcc_type": "standard", "distance": 2.526, "atom1_id": "///A/232/O2", "atom2_id": "///A/242/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 259, "atom1_serNum": 2788, "atom2_serNum": 2998, "donAcc_type": "standard", "distance": 2.746, "atom1_id": "///A/232/N3", "atom2_id": "///A/242/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 260, "atom1_serNum": 2790, "atom2_serNum": 2997, "donAcc_type": "standard", "distance": 2.851, "atom1_id": "///A/232/N4", "atom2_id": "///A/242/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 261, "atom1_serNum": 2810, "atom2_serNum": 2977, "donAcc_type": "standard", "distance": 2.811, "atom1_id": "///A/233/N6", "atom2_id": "///A/241/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 262, "atom1_serNum": 2811, "atom2_serNum": 2975, "donAcc_type": "standard", "distance": 2.761, "atom1_id": "///A/233/N1", "atom2_id": "///A/241/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 263, "atom1_serNum": 2832, "atom2_serNum": 2957, "donAcc_type": "standard", "distance": 3.096, "atom1_id": "///A/234/O6", "atom2_id": "///A/240/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 264, "atom1_serNum": 2833, "atom2_serNum": 2955, "donAcc_type": "standard", "distance": 3.250, "atom1_id": "///A/234/N1", "atom2_id": "///A/240/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 265, "atom1_serNum": 2835, "atom2_serNum": 2954, "donAcc_type": "standard", "distance": 3.448, "atom1_id": "///A/234/N2", "atom2_id": "///A/240/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 266, "atom1_serNum": 2855, "atom2_serNum": 2937, "donAcc_type": "standard", "distance": 2.328, "atom1_id": "///A/235/N6", "atom2_id": "///A/239/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 267, "atom1_serNum": 2856, "atom2_serNum": 2935, "donAcc_type": "standard", "distance": 2.642, "atom1_id": "///A/235/N1", "atom2_id": "///A/239/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 268, "atom1_serNum": 2882, "atom2_serNum": 2934, "donAcc_type": "questionable", "distance": 3.021, "atom1_id": "///A/237/OP2", "atom2_id": "///A/239/O2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 269, "atom1_serNum": 2888, "atom2_serNum": 2926, "donAcc_type": "questionable", "distance": 3.164, "atom1_id": "///A/237/O3'", "atom2_id": "///A/239/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 270, "atom1_serNum": 2903, "atom2_serNum": 2926, "donAcc_type": "questionable", "distance": 2.677, "atom1_id": "///A/238/O5'", "atom2_id": "///A/239/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 271, "atom1_serNum": 3033, "atom2_serNum": 3049, "donAcc_type": "acceptable", "distance": 3.240, "atom1_id": "///A/244/O2'", "atom2_id": "///A/245/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 272, "atom1_serNum": 3053, "atom2_serNum": 3072, "donAcc_type": "acceptable", "distance": 2.887, "atom1_id": "///A/245/O2'", "atom2_id": "///A/246/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 273, "atom1_serNum": 3118, "atom2_serNum": 3164, "donAcc_type": "acceptable", "distance": 2.629, "atom1_id": "///A/248/O2'", "atom2_id": "///A/250/N7", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 274, "atom1_serNum": 3228, "atom2_serNum": 3252, "donAcc_type": "acceptable", "distance": 3.328, "atom1_id": "///A/253/O2'", "atom2_id": "///A/254/N7", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 275, "atom1_serNum": 3255, "atom2_serNum": 4849, "donAcc_type": "standard", "distance": 3.102, "atom1_id": "///A/254/O6", "atom2_id": "///B/170/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 276, "atom1_serNum": 3256, "atom2_serNum": 4847, "donAcc_type": "standard", "distance": 3.159, "atom1_id": "///A/254/N1", "atom2_id": "///B/170/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 277, "atom1_serNum": 3258, "atom2_serNum": 4846, "donAcc_type": "standard", "distance": 3.082, "atom1_id": "///A/254/N2", "atom2_id": "///B/170/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 278, "atom1_serNum": 3275, "atom2_serNum": 4829, "donAcc_type": "standard", "distance": 2.791, "atom1_id": "///A/255/O2", "atom2_id": "///B/169/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 279, "atom1_serNum": 3276, "atom2_serNum": 4827, "donAcc_type": "standard", "distance": 2.982, "atom1_id": "///A/255/N3", "atom2_id": "///B/169/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 280, "atom1_serNum": 3278, "atom2_serNum": 4826, "donAcc_type": "standard", "distance": 3.049, "atom1_id": "///A/255/N4", "atom2_id": "///B/169/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 281, "atom1_serNum": 3402, "atom2_serNum": 6684, "donAcc_type": "standard", "distance": 3.219, "atom1_id": "///B/103/N7", "atom2_id": "///B/256/N6", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 282, "atom1_serNum": 3405, "atom2_serNum": 5858, "donAcc_type": "standard", "distance": 3.094, "atom1_id": "///B/103/O6", "atom2_id": "///B/217/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 283, "atom1_serNum": 3406, "atom2_serNum": 5856, "donAcc_type": "standard", "distance": 2.930, "atom1_id": "///B/103/N1", "atom2_id": "///B/217/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 284, "atom1_serNum": 3408, "atom2_serNum": 5855, "donAcc_type": "standard", "distance": 2.622, "atom1_id": "///B/103/N2", "atom2_id": "///B/217/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 285, "atom1_serNum": 3413, "atom2_serNum": 6709, "donAcc_type": "standard", "distance": 2.409, "atom1_id": "///B/104/OP2", "atom2_id": "///B/257/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 286, "atom1_serNum": 3425, "atom2_serNum": 6709, "donAcc_type": "standard", "distance": 3.318, "atom1_id": "///B/104/N7", "atom2_id": "///B/257/N2", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 287, "atom1_serNum": 3428, "atom2_serNum": 5836, "donAcc_type": "standard", "distance": 2.972, "atom1_id": "///B/104/N6", "atom2_id": "///B/216/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 288, "atom1_serNum": 3435, "atom2_serNum": 6726, "donAcc_type": "questionable", "distance": 2.920, "atom1_id": "///B/105/OP2", "atom2_id": "///B/258/O2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 289, "atom1_serNum": 3443, "atom2_serNum": 6742, "donAcc_type": "acceptable", "distance": 2.821, "atom1_id": "///B/105/O2'", "atom2_id": "///B/259/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 290, "atom1_serNum": 3447, "atom2_serNum": 6727, "donAcc_type": "standard", "distance": 2.863, "atom1_id": "///B/105/N7", "atom2_id": "///B/258/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 291, "atom1_serNum": 3450, "atom2_serNum": 5815, "donAcc_type": "standard", "distance": 2.960, "atom1_id": "///B/105/N6", "atom2_id": "///B/215/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 292, "atom1_serNum": 3450, "atom2_serNum": 6729, "donAcc_type": "standard", "distance": 3.018, "atom1_id": "///B/105/N6", "atom2_id": "///B/258/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 293, "atom1_serNum": 3451, "atom2_serNum": 5816, "donAcc_type": "standard", "distance": 2.924, "atom1_id": "///B/105/N1", "atom2_id": "///B/215/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 294, "atom1_serNum": 3490, "atom2_serNum": 5794, "donAcc_type": "standard", "distance": 2.931, "atom1_id": "///B/107/N3", "atom2_id": "///B/214/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 295, "atom1_serNum": 3492, "atom2_serNum": 5793, "donAcc_type": "standard", "distance": 3.159, "atom1_id": "///B/107/O4", "atom2_id": "///B/214/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 296, "atom1_serNum": 3492, "atom2_serNum": 6747, "donAcc_type": "standard", "distance": 3.135, "atom1_id": "///B/107/O4", "atom2_id": "///B/259/N3", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 297, "atom1_serNum": 3497, "atom2_serNum": 6762, "donAcc_type": "acceptable", "distance": 2.631, "atom1_id": "///B/108/OP2", "atom2_id": "///B/260/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 298, "atom1_serNum": 3509, "atom2_serNum": 6766, "donAcc_type": "questionable", "distance": 2.927, "atom1_id": "///B/108/N7", "atom2_id": "///B/260/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 299, "atom1_serNum": 3512, "atom2_serNum": 5773, "donAcc_type": "standard", "distance": 2.900, "atom1_id": "///B/108/O6", "atom2_id": "///B/213/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 300, "atom1_serNum": 3512, "atom2_serNum": 6769, "donAcc_type": "standard", "distance": 2.852, "atom1_id": "///B/108/O6", "atom2_id": "///B/260/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 301, "atom1_serNum": 3513, "atom2_serNum": 5771, "donAcc_type": "standard", "distance": 2.773, "atom1_id": "///B/108/N1", "atom2_id": "///B/213/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 302, "atom1_serNum": 3515, "atom2_serNum": 5770, "donAcc_type": "standard", "distance": 2.542, "atom1_id": "///B/108/N2", "atom2_id": "///B/213/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 303, "atom1_serNum": 3528, "atom2_serNum": 5147, "donAcc_type": "acceptable", "distance": 2.633, "atom1_id": "///B/109/O2'", "atom2_id": "///B/184/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 304, "atom1_serNum": 3532, "atom2_serNum": 5147, "donAcc_type": "acceptable", "distance": 2.876, "atom1_id": "///B/109/O2", "atom2_id": "///B/184/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 305, "atom1_serNum": 3532, "atom2_serNum": 5753, "donAcc_type": "standard", "distance": 2.865, "atom1_id": "///B/109/O2", "atom2_id": "///B/212/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 306, "atom1_serNum": 3533, "atom2_serNum": 5751, "donAcc_type": "standard", "distance": 2.955, "atom1_id": "///B/109/N3", "atom2_id": "///B/212/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 307, "atom1_serNum": 3535, "atom2_serNum": 5750, "donAcc_type": "standard", "distance": 2.907, "atom1_id": "///B/109/N4", "atom2_id": "///B/212/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 308, "atom1_serNum": 3544, "atom2_serNum": 5143, "donAcc_type": "questionable", "distance": 3.142, "atom1_id": "///B/110/O4'", "atom2_id": "///B/184/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 309, "atom1_serNum": 3548, "atom2_serNum": 5125, "donAcc_type": "acceptable", "distance": 2.962, "atom1_id": "///B/110/O2'", "atom2_id": "///B/183/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 310, "atom1_serNum": 3548, "atom2_serNum": 5135, "donAcc_type": "acceptable", "distance": 2.732, "atom1_id": "///B/110/O2'", "atom2_id": "///B/183/N3", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 311, "atom1_serNum": 3555, "atom2_serNum": 5730, "donAcc_type": "standard", "distance": 3.025, "atom1_id": "///B/110/O6", "atom2_id": "///B/211/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 312, "atom1_serNum": 3556, "atom2_serNum": 5728, "donAcc_type": "standard", "distance": 3.054, "atom1_id": "///B/110/N1", "atom2_id": "///B/211/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 313, "atom1_serNum": 3558, "atom2_serNum": 5133, "donAcc_type": "standard", "distance": 3.643, "atom1_id": "///B/110/N2", "atom2_id": "///B/183/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 314, "atom1_serNum": 3558, "atom2_serNum": 5727, "donAcc_type": "standard", "distance": 2.936, "atom1_id": "///B/110/N2", "atom2_id": "///B/211/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 315, "atom1_serNum": 3571, "atom2_serNum": 4803, "donAcc_type": "acceptable", "distance": 2.980, "atom1_id": "///B/111/O2'", "atom2_id": "///B/168/O2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 316, "atom1_serNum": 3571, "atom2_serNum": 4804, "donAcc_type": "acceptable", "distance": 3.014, "atom1_id": "///B/111/O2'", "atom2_id": "///B/168/N3", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 317, "atom1_serNum": 3578, "atom2_serNum": 5688, "donAcc_type": "standard", "distance": 2.795, "atom1_id": "///B/111/O6", "atom2_id": "///B/209/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 318, "atom1_serNum": 3579, "atom2_serNum": 5686, "donAcc_type": "standard", "distance": 2.951, "atom1_id": "///B/111/N1", "atom2_id": "///B/209/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 319, "atom1_serNum": 3581, "atom2_serNum": 5685, "donAcc_type": "standard", "distance": 2.949, "atom1_id": "///B/111/N2", "atom2_id": "///B/209/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 320, "atom1_serNum": 3601, "atom2_serNum": 5668, "donAcc_type": "standard", "distance": 3.073, "atom1_id": "///B/112/O6", "atom2_id": "///B/208/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 321, "atom1_serNum": 3602, "atom2_serNum": 5666, "donAcc_type": "standard", "distance": 3.013, "atom1_id": "///B/112/N1", "atom2_id": "///B/208/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 322, "atom1_serNum": 3604, "atom2_serNum": 5665, "donAcc_type": "standard", "distance": 2.868, "atom1_id": "///B/112/N2", "atom2_id": "///B/208/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 323, "atom1_serNum": 3617, "atom2_serNum": 3635, "donAcc_type": "acceptable", "distance": 3.443, "atom1_id": "///B/113/O2'", "atom2_id": "///B/114/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 324, "atom1_serNum": 3617, "atom2_serNum": 5646, "donAcc_type": "acceptable", "distance": 3.167, "atom1_id": "///B/113/O2'", "atom2_id": "///B/207/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 325, "atom1_serNum": 3627, "atom2_serNum": 5646, "donAcc_type": "standard", "distance": 2.874, "atom1_id": "///B/113/N3", "atom2_id": "///B/207/N6", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 326, "atom1_serNum": 3646, "atom2_serNum": 5617, "donAcc_type": "acceptable", "distance": 3.079, "atom1_id": "///B/114/N6", "atom2_id": "///B/206/O2'", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 327, "atom1_serNum": 3646, "atom2_serNum": 5627, "donAcc_type": "standard", "distance": 2.938, "atom1_id": "///B/114/N6", "atom2_id": "///B/206/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 328, "atom1_serNum": 3668, "atom2_serNum": 5627, "donAcc_type": "standard", "distance": 3.343, "atom1_id": "///B/115/N6", "atom2_id": "///B/206/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 329, "atom1_serNum": 3690, "atom2_serNum": 5602, "donAcc_type": "standard", "distance": 2.661, "atom1_id": "///B/116/O6", "atom2_id": "///B/205/N3", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 330, "atom1_serNum": 3691, "atom2_serNum": 5601, "donAcc_type": "standard", "distance": 2.649, "atom1_id": "///B/116/N1", "atom2_id": "///B/205/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 331, "atom1_serNum": 3713, "atom2_serNum": 5584, "donAcc_type": "standard", "distance": 2.835, "atom1_id": "///B/117/O6", "atom2_id": "///B/204/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 332, "atom1_serNum": 3714, "atom2_serNum": 5582, "donAcc_type": "standard", "distance": 2.952, "atom1_id": "///B/117/N1", "atom2_id": "///B/204/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 333, "atom1_serNum": 3716, "atom2_serNum": 5581, "donAcc_type": "standard", "distance": 2.985, "atom1_id": "///B/117/N2", "atom2_id": "///B/204/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 334, "atom1_serNum": 3736, "atom2_serNum": 5564, "donAcc_type": "standard", "distance": 2.830, "atom1_id": "///B/118/O6", "atom2_id": "///B/203/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 335, "atom1_serNum": 3737, "atom2_serNum": 5562, "donAcc_type": "standard", "distance": 2.755, "atom1_id": "///B/118/N1", "atom2_id": "///B/203/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 336, "atom1_serNum": 3739, "atom2_serNum": 5561, "donAcc_type": "standard", "distance": 2.740, "atom1_id": "///B/118/N2", "atom2_id": "///B/203/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 337, "atom1_serNum": 3759, "atom2_serNum": 5542, "donAcc_type": "standard", "distance": 2.769, "atom1_id": "///B/119/O6", "atom2_id": "///B/202/N3", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 338, "atom1_serNum": 3760, "atom2_serNum": 5541, "donAcc_type": "standard", "distance": 2.647, "atom1_id": "///B/119/N1", "atom2_id": "///B/202/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 339, "atom1_serNum": 3775, "atom2_serNum": 3791, "donAcc_type": "acceptable", "distance": 3.162, "atom1_id": "///B/120/O2'", "atom2_id": "///B/121/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 340, "atom1_serNum": 3775, "atom2_serNum": 3886, "donAcc_type": "acceptable", "distance": 2.303, "atom1_id": "///B/120/O2'", "atom2_id": "///B/125/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 341, "atom1_serNum": 3779, "atom2_serNum": 5522, "donAcc_type": "standard", "distance": 2.794, "atom1_id": "///B/120/O2", "atom2_id": "///B/201/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 342, "atom1_serNum": 3780, "atom2_serNum": 5521, "donAcc_type": "standard", "distance": 3.008, "atom1_id": "///B/120/N3", "atom2_id": "///B/201/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 343, "atom1_serNum": 3795, "atom2_serNum": 3847, "donAcc_type": "acceptable", "distance": 2.729, "atom1_id": "///B/121/O2'", "atom2_id": "///B/123/N3", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 344, "atom1_serNum": 3799, "atom2_serNum": 5501, "donAcc_type": "standard", "distance": 3.164, "atom1_id": "///B/121/O2", "atom2_id": "///B/200/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 345, "atom1_serNum": 3800, "atom2_serNum": 5499, "donAcc_type": "standard", "distance": 3.049, "atom1_id": "///B/121/N3", "atom2_id": "///B/200/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 346, "atom1_serNum": 3802, "atom2_serNum": 5498, "donAcc_type": "standard", "distance": 2.826, "atom1_id": "///B/121/N4", "atom2_id": "///B/200/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 347, "atom1_serNum": 3815, "atom2_serNum": 3825, "donAcc_type": "acceptable", "distance": 2.862, "atom1_id": "///B/122/O2'", "atom2_id": "///B/122/N3", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 348, "atom1_serNum": 3837, "atom2_serNum": 5436, "donAcc_type": "acceptable", "distance": 3.119, "atom1_id": "///B/123/O2'", "atom2_id": "///B/197/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 349, "atom1_serNum": 3844, "atom2_serNum": 5453, "donAcc_type": "standard", "distance": 3.044, "atom1_id": "///B/123/N6", "atom2_id": "///B/198/N7", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 350, "atom1_serNum": 3845, "atom2_serNum": 5456, "donAcc_type": "standard", "distance": 3.370, "atom1_id": "///B/123/N1", "atom2_id": "///B/198/N6", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 351, "atom1_serNum": 3845, "atom2_serNum": 5501, "donAcc_type": "standard", "distance": 3.408, "atom1_id": "///B/123/N1", "atom2_id": "///B/200/N2", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 352, "atom1_serNum": 3863, "atom2_serNum": 5524, "donAcc_type": "standard", "distance": 3.364, "atom1_id": "///B/124/O2", "atom2_id": "///B/201/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 353, "atom1_serNum": 3864, "atom2_serNum": 5524, "donAcc_type": "standard", "distance": 2.987, "atom1_id": "///B/124/N3", "atom2_id": "///B/201/N2", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 354, "atom1_serNum": 3866, "atom2_serNum": 5415, "donAcc_type": "standard", "distance": 3.298, "atom1_id": "///B/124/N4", "atom2_id": "///B/196/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 355, "atom1_serNum": 3866, "atom2_serNum": 5433, "donAcc_type": "standard", "distance": 2.866, "atom1_id": "///B/124/N4", "atom2_id": "///B/197/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 356, "atom1_serNum": 3866, "atom2_serNum": 5434, "donAcc_type": "standard", "distance": 3.220, "atom1_id": "///B/124/N4", "atom2_id": "///B/197/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 357, "atom1_serNum": 3866, "atom2_serNum": 5525, "donAcc_type": "standard", "distance": 3.709, "atom1_id": "///B/124/N4", "atom2_id": "///B/201/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 358, "atom1_serNum": 3871, "atom2_serNum": 3905, "donAcc_type": "questionable", "distance": 3.156, "atom1_id": "///B/125/OP2", "atom2_id": "///B/126/N7", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 359, "atom1_serNum": 3889, "atom2_serNum": 3897, "donAcc_type": "questionable", "distance": 3.102, "atom1_id": "///B/125/N3", "atom2_id": "///B/126/O4'", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 360, "atom1_serNum": 3901, "atom2_serNum": 5537, "donAcc_type": "acceptable", "distance": 2.644, "atom1_id": "///B/126/O2'", "atom2_id": "///B/202/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 361, "atom1_serNum": 3908, "atom2_serNum": 5414, "donAcc_type": "standard", "distance": 2.867, "atom1_id": "///B/126/O6", "atom2_id": "///B/196/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 362, "atom1_serNum": 3909, "atom2_serNum": 5415, "donAcc_type": "standard", "distance": 2.990, "atom1_id": "///B/126/N1", "atom2_id": "///B/196/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 363, "atom1_serNum": 3911, "atom2_serNum": 5514, "donAcc_type": "acceptable", "distance": 3.068, "atom1_id": "///B/126/N2", "atom2_id": "///B/201/O2'", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 364, "atom1_serNum": 3911, "atom2_serNum": 5533, "donAcc_type": "standard", "distance": 3.063, "atom1_id": "///B/126/N2", "atom2_id": "///B/202/O4'", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 365, "atom1_serNum": 3924, "atom2_serNum": 5528, "donAcc_type": "acceptable", "distance": 3.563, "atom1_id": "///B/127/O2'", "atom2_id": "///B/202/OP1", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 366, "atom1_serNum": 3928, "atom2_serNum": 5394, "donAcc_type": "standard", "distance": 3.073, "atom1_id": "///B/127/O2", "atom2_id": "///B/195/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 367, "atom1_serNum": 3929, "atom2_serNum": 5392, "donAcc_type": "standard", "distance": 2.894, "atom1_id": "///B/127/N3", "atom2_id": "///B/195/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 368, "atom1_serNum": 3931, "atom2_serNum": 5391, "donAcc_type": "standard", "distance": 2.866, "atom1_id": "///B/127/N4", "atom2_id": "///B/195/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 369, "atom1_serNum": 3948, "atom2_serNum": 5371, "donAcc_type": "standard", "distance": 2.606, "atom1_id": "///B/128/O2", "atom2_id": "///B/194/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 370, "atom1_serNum": 3949, "atom2_serNum": 5369, "donAcc_type": "standard", "distance": 2.875, "atom1_id": "///B/128/N3", "atom2_id": "///B/194/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 371, "atom1_serNum": 3951, "atom2_serNum": 5368, "donAcc_type": "standard", "distance": 3.052, "atom1_id": "///B/128/N4", "atom2_id": "///B/194/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 372, "atom1_serNum": 3964, "atom2_serNum": 3980, "donAcc_type": "acceptable", "distance": 2.295, "atom1_id": "///B/129/O2'", "atom2_id": "///B/130/O5'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 373, "atom1_serNum": 3964, "atom2_serNum": 3983, "donAcc_type": "acceptable", "distance": 3.183, "atom1_id": "///B/129/O2'", "atom2_id": "///B/130/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 374, "atom1_serNum": 3971, "atom2_serNum": 5348, "donAcc_type": "standard", "distance": 2.884, "atom1_id": "///B/129/O6", "atom2_id": "///B/193/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 375, "atom1_serNum": 3972, "atom2_serNum": 5346, "donAcc_type": "standard", "distance": 2.794, "atom1_id": "///B/129/N1", "atom2_id": "///B/193/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 376, "atom1_serNum": 3974, "atom2_serNum": 5345, "donAcc_type": "standard", "distance": 2.613, "atom1_id": "///B/129/N2", "atom2_id": "///B/193/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 377, "atom1_serNum": 3987, "atom2_serNum": 4005, "donAcc_type": "acceptable", "distance": 3.172, "atom1_id": "///B/130/O2'", "atom2_id": "///B/131/O3'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 378, "atom1_serNum": 3992, "atom2_serNum": 5327, "donAcc_type": "standard", "distance": 2.896, "atom1_id": "///B/130/N3", "atom2_id": "///B/192/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 379, "atom1_serNum": 3994, "atom2_serNum": 5326, "donAcc_type": "standard", "distance": 2.750, "atom1_id": "///B/130/O4", "atom2_id": "///B/192/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 380, "atom1_serNum": 4007, "atom2_serNum": 4020, "donAcc_type": "acceptable", "distance": 3.095, "atom1_id": "///B/131/O2'", "atom2_id": "///B/132/OP1", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 381, "atom1_serNum": 4029, "atom2_serNum": 4045, "donAcc_type": "acceptable", "distance": 3.226, "atom1_id": "///B/132/O2'", "atom2_id": "///B/133/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 382, "atom1_serNum": 4033, "atom2_serNum": 5306, "donAcc_type": "standard", "distance": 3.090, "atom1_id": "///B/132/O2", "atom2_id": "///B/191/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 383, "atom1_serNum": 4034, "atom2_serNum": 5304, "donAcc_type": "standard", "distance": 3.321, "atom1_id": "///B/132/N3", "atom2_id": "///B/191/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 384, "atom1_serNum": 4036, "atom2_serNum": 5303, "donAcc_type": "standard", "distance": 3.427, "atom1_id": "///B/132/N4", "atom2_id": "///B/191/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 385, "atom1_serNum": 4056, "atom2_serNum": 5283, "donAcc_type": "standard", "distance": 2.998, "atom1_id": "///B/133/N6", "atom2_id": "///B/190/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 386, "atom1_serNum": 4057, "atom2_serNum": 5281, "donAcc_type": "standard", "distance": 2.748, "atom1_id": "///B/133/N1", "atom2_id": "///B/190/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 387, "atom1_serNum": 4078, "atom2_serNum": 5263, "donAcc_type": "standard", "distance": 2.927, "atom1_id": "///B/134/O6", "atom2_id": "///B/189/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 388, "atom1_serNum": 4079, "atom2_serNum": 5261, "donAcc_type": "standard", "distance": 2.877, "atom1_id": "///B/134/N1", "atom2_id": "///B/189/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 389, "atom1_serNum": 4081, "atom2_serNum": 5260, "donAcc_type": "standard", "distance": 2.756, "atom1_id": "///B/134/N2", "atom2_id": "///B/189/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 390, "atom1_serNum": 4099, "atom2_serNum": 5215, "donAcc_type": "standard", "distance": 2.895, "atom1_id": "///B/135/N3", "atom2_id": "///B/187/N7", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 391, "atom1_serNum": 4101, "atom2_serNum": 5218, "donAcc_type": "standard", "distance": 3.249, "atom1_id": "///B/135/O4", "atom2_id": "///B/187/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 392, "atom1_serNum": 4121, "atom2_serNum": 5089, "donAcc_type": "standard", "distance": 3.273, "atom1_id": "///B/136/N6", "atom2_id": "///B/181/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 393, "atom1_serNum": 4121, "atom2_serNum": 5112, "donAcc_type": "standard", "distance": 2.837, "atom1_id": "///B/136/N6", "atom2_id": "///B/182/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 394, "atom1_serNum": 4122, "atom2_serNum": 5110, "donAcc_type": "standard", "distance": 2.986, "atom1_id": "///B/136/N1", "atom2_id": "///B/182/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 395, "atom1_serNum": 4136, "atom2_serNum": 5189, "donAcc_type": "acceptable", "distance": 2.640, "atom1_id": "///B/137/O2'", "atom2_id": "///B/186/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 396, "atom1_serNum": 4140, "atom2_serNum": 5092, "donAcc_type": "standard", "distance": 2.876, "atom1_id": "///B/137/O2", "atom2_id": "///B/181/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 397, "atom1_serNum": 4140, "atom2_serNum": 5189, "donAcc_type": "acceptable", "distance": 2.697, "atom1_id": "///B/137/O2", "atom2_id": "///B/186/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 398, "atom1_serNum": 4141, "atom2_serNum": 5090, "donAcc_type": "standard", "distance": 2.901, "atom1_id": "///B/137/N3", "atom2_id": "///B/181/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 399, "atom1_serNum": 4143, "atom2_serNum": 5089, "donAcc_type": "standard", "distance": 3.091, "atom1_id": "///B/137/N4", "atom2_id": "///B/181/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 400, "atom1_serNum": 4160, "atom2_serNum": 5069, "donAcc_type": "standard", "distance": 2.962, "atom1_id": "///B/138/O2", "atom2_id": "///B/180/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 401, "atom1_serNum": 4161, "atom2_serNum": 5067, "donAcc_type": "standard", "distance": 2.896, "atom1_id": "///B/138/N3", "atom2_id": "///B/180/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 402, "atom1_serNum": 4163, "atom2_serNum": 5066, "donAcc_type": "standard", "distance": 2.731, "atom1_id": "///B/138/N4", "atom2_id": "///B/180/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 403, "atom1_serNum": 4168, "atom2_serNum": 4701, "donAcc_type": "standard", "distance": 2.836, "atom1_id": "///B/139/OP2", "atom2_id": "///B/163/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 404, "atom1_serNum": 4168, "atom2_serNum": 4703, "donAcc_type": "standard", "distance": 3.270, "atom1_id": "///B/139/OP2", "atom2_id": "///B/163/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 405, "atom1_serNum": 4176, "atom2_serNum": 5169, "donAcc_type": "acceptable", "distance": 2.874, "atom1_id": "///B/139/O2'", "atom2_id": "///B/185/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 406, "atom1_serNum": 4180, "atom2_serNum": 4726, "donAcc_type": "standard", "distance": 2.805, "atom1_id": "///B/139/N7", "atom2_id": "///B/164/N2", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 407, "atom1_serNum": 4183, "atom2_serNum": 4712, "donAcc_type": "standard", "distance": 3.207, "atom1_id": "///B/139/N6", "atom2_id": "///B/164/O4'", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 408, "atom1_serNum": 4183, "atom2_serNum": 4727, "donAcc_type": "standard", "distance": 3.141, "atom1_id": "///B/139/N6", "atom2_id": "///B/164/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 409, "atom1_serNum": 4202, "atom2_serNum": 4703, "donAcc_type": "standard", "distance": 2.814, "atom1_id": "///B/140/N7", "atom2_id": "///B/163/N2", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 410, "atom1_serNum": 4205, "atom2_serNum": 4693, "donAcc_type": "acceptable", "distance": 2.914, "atom1_id": "///B/140/N6", "atom2_id": "///B/163/O2'", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 411, "atom1_serNum": 4205, "atom2_serNum": 4704, "donAcc_type": "standard", "distance": 2.778, "atom1_id": "///B/140/N6", "atom2_id": "///B/163/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 412, "atom1_serNum": 4227, "atom2_serNum": 4678, "donAcc_type": "standard", "distance": 2.580, "atom1_id": "///B/141/O6", "atom2_id": "///B/162/N3", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 413, "atom1_serNum": 4228, "atom2_serNum": 4677, "donAcc_type": "standard", "distance": 2.554, "atom1_id": "///B/141/N1", "atom2_id": "///B/162/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 414, "atom1_serNum": 4248, "atom2_serNum": 4659, "donAcc_type": "standard", "distance": 2.737, "atom1_id": "///B/142/N3", "atom2_id": "///B/161/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 415, "atom1_serNum": 4250, "atom2_serNum": 4658, "donAcc_type": "standard", "distance": 2.784, "atom1_id": "///B/142/O4", "atom2_id": "///B/161/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 416, "atom1_serNum": 4267, "atom2_serNum": 4638, "donAcc_type": "standard", "distance": 2.903, "atom1_id": "///B/143/O2", "atom2_id": "///B/160/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 417, "atom1_serNum": 4268, "atom2_serNum": 4636, "donAcc_type": "standard", "distance": 2.908, "atom1_id": "///B/143/N3", "atom2_id": "///B/160/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 418, "atom1_serNum": 4270, "atom2_serNum": 4635, "donAcc_type": "standard", "distance": 2.848, "atom1_id": "///B/143/N4", "atom2_id": "///B/160/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 419, "atom1_serNum": 4288, "atom2_serNum": 4614, "donAcc_type": "standard", "distance": 2.924, "atom1_id": "///B/144/N3", "atom2_id": "///B/159/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 420, "atom1_serNum": 4290, "atom2_serNum": 4613, "donAcc_type": "standard", "distance": 3.165, "atom1_id": "///B/144/O4", "atom2_id": "///B/159/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 421, "atom1_serNum": 4307, "atom2_serNum": 4593, "donAcc_type": "standard", "distance": 2.630, "atom1_id": "///B/145/O2", "atom2_id": "///B/158/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 422, "atom1_serNum": 4308, "atom2_serNum": 4591, "donAcc_type": "standard", "distance": 2.845, "atom1_id": "///B/145/N3", "atom2_id": "///B/158/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 423, "atom1_serNum": 4310, "atom2_serNum": 4590, "donAcc_type": "standard", "distance": 2.950, "atom1_id": "///B/145/N4", "atom2_id": "///B/158/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 424, "atom1_serNum": 4330, "atom2_serNum": 4570, "donAcc_type": "standard", "distance": 2.682, "atom1_id": "///B/146/N6", "atom2_id": "///B/157/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 425, "atom1_serNum": 4331, "atom2_serNum": 4568, "donAcc_type": "standard", "distance": 2.539, "atom1_id": "///B/146/N1", "atom2_id": "///B/157/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 426, "atom1_serNum": 4352, "atom2_serNum": 4548, "donAcc_type": "standard", "distance": 2.784, "atom1_id": "///B/147/O6", "atom2_id": "///B/156/N3", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 427, "atom1_serNum": 4353, "atom2_serNum": 4547, "donAcc_type": "standard", "distance": 2.586, "atom1_id": "///B/147/N1", "atom2_id": "///B/156/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 428, "atom1_serNum": 4355, "atom2_serNum": 4547, "donAcc_type": "standard", "distance": 3.207, "atom1_id": "///B/147/N2", "atom2_id": "///B/156/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 429, "atom1_serNum": 4375, "atom2_serNum": 4528, "donAcc_type": "standard", "distance": 2.995, "atom1_id": "///B/148/O6", "atom2_id": "///B/155/N3", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 430, "atom1_serNum": 4376, "atom2_serNum": 4527, "donAcc_type": "standard", "distance": 2.807, "atom1_id": "///B/148/N1", "atom2_id": "///B/155/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 431, "atom1_serNum": 4398, "atom2_serNum": 4510, "donAcc_type": "standard", "distance": 3.112, "atom1_id": "///B/149/O6", "atom2_id": "///B/154/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 432, "atom1_serNum": 4399, "atom2_serNum": 4508, "donAcc_type": "standard", "distance": 2.953, "atom1_id": "///B/149/N1", "atom2_id": "///B/154/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 433, "atom1_serNum": 4401, "atom2_serNum": 4507, "donAcc_type": "standard", "distance": 2.671, "atom1_id": "///B/149/N2", "atom2_id": "///B/154/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 434, "atom1_serNum": 4414, "atom2_serNum": 4463, "donAcc_type": "acceptable", "distance": 2.936, "atom1_id": "///B/150/O2'", "atom2_id": "///B/152/N7", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 435, "atom1_serNum": 4424, "atom2_serNum": 4473, "donAcc_type": "standard", "distance": 2.666, "atom1_id": "///B/150/N2", "atom2_id": "///B/153/OP2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 436, "atom1_serNum": 4424, "atom2_serNum": 4485, "donAcc_type": "standard", "distance": 2.743, "atom1_id": "///B/150/N2", "atom2_id": "///B/153/N7", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 437, "atom1_serNum": 4444, "atom2_serNum": 6512, "donAcc_type": "standard", "distance": 2.971, "atom1_id": "///B/151/N6", "atom2_id": "///B/248/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 438, "atom1_serNum": 4445, "atom2_serNum": 6511, "donAcc_type": "standard", "distance": 2.987, "atom1_id": "///B/151/N1", "atom2_id": "///B/248/N6", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 439, "atom1_serNum": 4459, "atom2_serNum": 5996, "donAcc_type": "acceptable", "distance": 3.108, "atom1_id": "///B/152/O2'", "atom2_id": "///B/224/O3'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 440, "atom1_serNum": 4459, "atom2_serNum": 5998, "donAcc_type": "acceptable", "distance": 2.769, "atom1_id": "///B/152/O2'", "atom2_id": "///B/224/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 441, "atom1_serNum": 4466, "atom2_serNum": 6546, "donAcc_type": "acceptable", "distance": 2.910, "atom1_id": "///B/152/N6", "atom2_id": "///B/250/O2'", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 442, "atom1_serNum": 4469, "atom2_serNum": 5998, "donAcc_type": "acceptable", "distance": 2.571, "atom1_id": "///B/152/N3", "atom2_id": "///B/224/O2'", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 443, "atom1_serNum": 4481, "atom2_serNum": 5978, "donAcc_type": "acceptable", "distance": 2.708, "atom1_id": "///B/153/O2'", "atom2_id": "///B/223/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 444, "atom1_serNum": 4481, "atom2_serNum": 5982, "donAcc_type": "acceptable", "distance": 2.900, "atom1_id": "///B/153/O2'", "atom2_id": "///B/223/O2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 445, "atom1_serNum": 4481, "atom2_serNum": 5994, "donAcc_type": "acceptable", "distance": 3.528, "atom1_id": "///B/153/O2'", "atom2_id": "///B/224/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 446, "atom1_serNum": 4489, "atom2_serNum": 6546, "donAcc_type": "acceptable", "distance": 3.157, "atom1_id": "///B/153/N1", "atom2_id": "///B/250/O2'", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 447, "atom1_serNum": 4491, "atom2_serNum": 6556, "donAcc_type": "standard", "distance": 2.781, "atom1_id": "///B/153/N3", "atom2_id": "///B/250/N2", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 448, "atom1_serNum": 4503, "atom2_serNum": 6567, "donAcc_type": "acceptable", "distance": 3.089, "atom1_id": "///B/154/O2'", "atom2_id": "///B/251/O3'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 449, "atom1_serNum": 4503, "atom2_serNum": 6569, "donAcc_type": "acceptable", "distance": 2.669, "atom1_id": "///B/154/O2'", "atom2_id": "///B/251/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 450, "atom1_serNum": 4583, "atom2_serNum": 4602, "donAcc_type": "acceptable", "distance": 3.287, "atom1_id": "///B/158/O2'", "atom2_id": "///B/159/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 451, "atom1_serNum": 4684, "atom2_serNum": 5002, "donAcc_type": "standard", "distance": 3.044, "atom1_id": "///B/163/OP1", "atom2_id": "///B/177/N3", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 452, "atom1_serNum": 4707, "atom2_serNum": 4746, "donAcc_type": "standard", "distance": 3.202, "atom1_id": "///B/164/OP1", "atom2_id": "///B/165/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 453, "atom1_serNum": 4708, "atom2_serNum": 4982, "donAcc_type": "standard", "distance": 2.928, "atom1_id": "///B/164/OP2", "atom2_id": "///B/176/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 454, "atom1_serNum": 4708, "atom2_serNum": 4984, "donAcc_type": "standard", "distance": 3.216, "atom1_id": "///B/164/OP2", "atom2_id": "///B/176/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 455, "atom1_serNum": 4716, "atom2_serNum": 4735, "donAcc_type": "acceptable", "distance": 3.026, "atom1_id": "///B/164/O2'", "atom2_id": "///B/165/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 456, "atom1_serNum": 4716, "atom2_serNum": 5082, "donAcc_type": "acceptable", "distance": 2.995, "atom1_id": "///B/164/O2'", "atom2_id": "///B/181/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 457, "atom1_serNum": 4716, "atom2_serNum": 5196, "donAcc_type": "acceptable", "distance": 3.346, "atom1_id": "///B/164/O2'", "atom2_id": "///B/186/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 458, "atom1_serNum": 4723, "atom2_serNum": 5024, "donAcc_type": "standard", "distance": 3.105, "atom1_id": "///B/164/O6", "atom2_id": "///B/178/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 459, "atom1_serNum": 4743, "atom2_serNum": 4961, "donAcc_type": "standard", "distance": 2.777, "atom1_id": "///B/165/O2", "atom2_id": "///B/175/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 460, "atom1_serNum": 4744, "atom2_serNum": 4959, "donAcc_type": "standard", "distance": 2.843, "atom1_id": "///B/165/N3", "atom2_id": "///B/175/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 461, "atom1_serNum": 4746, "atom2_serNum": 4958, "donAcc_type": "standard", "distance": 2.815, "atom1_id": "///B/165/N4", "atom2_id": "///B/175/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 462, "atom1_serNum": 4751, "atom2_serNum": 4779, "donAcc_type": "acceptable", "distance": 2.545, "atom1_id": "///B/166/OP2", "atom2_id": "///B/167/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 463, "atom1_serNum": 4763, "atom2_serNum": 4938, "donAcc_type": "standard", "distance": 2.963, "atom1_id": "///B/166/O2", "atom2_id": "///B/174/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 464, "atom1_serNum": 4764, "atom2_serNum": 4936, "donAcc_type": "standard", "distance": 2.960, "atom1_id": "///B/166/N3", "atom2_id": "///B/174/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 465, "atom1_serNum": 4766, "atom2_serNum": 4935, "donAcc_type": "standard", "distance": 2.864, "atom1_id": "///B/166/N4", "atom2_id": "///B/174/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 466, "atom1_serNum": 4786, "atom2_serNum": 4913, "donAcc_type": "standard", "distance": 2.741, "atom1_id": "///B/167/O4", "atom2_id": "///B/173/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 467, "atom1_serNum": 4806, "atom2_serNum": 5241, "donAcc_type": "standard", "distance": 3.100, "atom1_id": "///B/168/O4", "atom2_id": "///B/188/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 468, "atom1_serNum": 4806, "atom2_serNum": 5243, "donAcc_type": "standard", "distance": 2.742, "atom1_id": "///B/168/O4", "atom2_id": "///B/188/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 469, "atom1_serNum": 4819, "atom2_serNum": 5721, "donAcc_type": "acceptable", "distance": 3.438, "atom1_id": "///B/169/O2'", "atom2_id": "///B/211/O3'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 470, "atom1_serNum": 4819, "atom2_serNum": 5734, "donAcc_type": "acceptable", "distance": 3.576, "atom1_id": "///B/169/O2'", "atom2_id": "///B/212/OP1", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 471, "atom1_serNum": 4872, "atom2_serNum": 4891, "donAcc_type": "standard", "distance": 3.325, "atom1_id": "///B/171/N3", "atom2_id": "///B/172/N6", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 472, "atom1_serNum": 4993, "atom2_serNum": 5059, "donAcc_type": "acceptable", "distance": 3.327, "atom1_id": "///B/177/O4'", "atom2_id": "///B/180/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 473, "atom1_serNum": 4997, "atom2_serNum": 5021, "donAcc_type": "acceptable", "distance": 3.701, "atom1_id": "///B/177/O2'", "atom2_id": "///B/178/N7", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 474, "atom1_serNum": 5017, "atom2_serNum": 5027, "donAcc_type": "acceptable", "distance": 3.157, "atom1_id": "///B/178/O2'", "atom2_id": "///B/178/N3", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 475, "atom1_serNum": 5039, "atom2_serNum": 5043, "donAcc_type": "acceptable", "distance": 2.718, "atom1_id": "///B/179/O2'", "atom2_id": "///B/179/O2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 476, "atom1_serNum": 5082, "atom2_serNum": 5197, "donAcc_type": "acceptable", "distance": 2.634, "atom1_id": "///B/181/O2'", "atom2_id": "///B/186/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 477, "atom1_serNum": 5092, "atom2_serNum": 5199, "donAcc_type": "standard", "distance": 2.819, "atom1_id": "///B/181/N2", "atom2_id": "///B/186/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 478, "atom1_serNum": 5105, "atom2_serNum": 5229, "donAcc_type": "acceptable", "distance": 3.207, "atom1_id": "///B/182/O2'", "atom2_id": "///B/188/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 479, "atom1_serNum": 5109, "atom2_serNum": 5189, "donAcc_type": "acceptable", "distance": 3.154, "atom1_id": "///B/182/O2", "atom2_id": "///B/186/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 480, "atom1_serNum": 5116, "atom2_serNum": 5181, "donAcc_type": "questionable", "distance": 3.115, "atom1_id": "///B/183/OP1", "atom2_id": "///B/186/OP2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 481, "atom1_serNum": 5138, "atom2_serNum": 5180, "donAcc_type": "questionable", "distance": 2.960, "atom1_id": "///B/184/OP1", "atom2_id": "///B/186/OP1", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 482, "atom1_serNum": 5139, "atom2_serNum": 5181, "donAcc_type": "questionable", "distance": 3.097, "atom1_id": "///B/184/OP2", "atom2_id": "///B/186/OP2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 483, "atom1_serNum": 5155, "atom2_serNum": 5743, "donAcc_type": "acceptable", "distance": 2.621, "atom1_id": "///B/184/N1", "atom2_id": "///B/212/O2'", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 484, "atom1_serNum": 5157, "atom2_serNum": 5753, "donAcc_type": "standard", "distance": 2.935, "atom1_id": "///B/184/N3", "atom2_id": "///B/212/N2", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 485, "atom1_serNum": 5429, "atom2_serNum": 5491, "donAcc_type": "acceptable", "distance": 2.930, "atom1_id": "///B/197/O2'", "atom2_id": "///B/200/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 486, "atom1_serNum": 5429, "atom2_serNum": 5501, "donAcc_type": "acceptable", "distance": 3.353, "atom1_id": "///B/197/O2'", "atom2_id": "///B/200/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 487, "atom1_serNum": 5429, "atom2_serNum": 5502, "donAcc_type": "acceptable", "distance": 2.590, "atom1_id": "///B/197/O2'", "atom2_id": "///B/200/N3", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 488, "atom1_serNum": 5429, "atom2_serNum": 5510, "donAcc_type": "acceptable", "distance": 3.449, "atom1_id": "///B/197/O2'", "atom2_id": "///B/201/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 489, "atom1_serNum": 5433, "atom2_serNum": 5501, "donAcc_type": "standard", "distance": 3.155, "atom1_id": "///B/197/O2", "atom2_id": "///B/200/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 490, "atom1_serNum": 5617, "atom2_serNum": 5635, "donAcc_type": "acceptable", "distance": 2.993, "atom1_id": "///B/206/O2'", "atom2_id": "///B/207/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 491, "atom1_serNum": 5681, "atom2_serNum": 5715, "donAcc_type": "acceptable", "distance": 2.599, "atom1_id": "///B/209/O2'", "atom2_id": "///B/211/OP2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 492, "atom1_serNum": 5681, "atom2_serNum": 5716, "donAcc_type": "acceptable", "distance": 2.603, "atom1_id": "///B/209/O2'", "atom2_id": "///B/211/O5'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 493, "atom1_serNum": 5871, "atom2_serNum": 5922, "donAcc_type": "acceptable", "distance": 2.925, "atom1_id": "///B/218/O2'", "atom2_id": "///B/220/O6", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 494, "atom1_serNum": 5871, "atom2_serNum": 6621, "donAcc_type": "acceptable", "distance": 3.251, "atom1_id": "///B/218/O2'", "atom2_id": "///B/253/O4", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 495, "atom1_serNum": 5881, "atom2_serNum": 5900, "donAcc_type": "standard", "distance": 2.907, "atom1_id": "///B/218/N3", "atom2_id": "///B/219/N6", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 496, "atom1_serNum": 5922, "atom2_serNum": 6619, "donAcc_type": "standard", "distance": 2.861, "atom1_id": "///B/220/O6", "atom2_id": "///B/253/N3", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 497, "atom1_serNum": 5923, "atom2_serNum": 6618, "donAcc_type": "standard", "distance": 2.710, "atom1_id": "///B/220/N1", "atom2_id": "///B/253/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 498, "atom1_serNum": 5943, "atom2_serNum": 6600, "donAcc_type": "standard", "distance": 2.847, "atom1_id": "///B/221/N3", "atom2_id": "///B/252/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 499, "atom1_serNum": 5945, "atom2_serNum": 6599, "donAcc_type": "standard", "distance": 3.065, "atom1_id": "///B/221/O4", "atom2_id": "///B/252/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 500, "atom1_serNum": 5962, "atom2_serNum": 6579, "donAcc_type": "standard", "distance": 2.808, "atom1_id": "///B/222/O2", "atom2_id": "///B/251/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 501, "atom1_serNum": 5963, "atom2_serNum": 6577, "donAcc_type": "standard", "distance": 3.014, "atom1_id": "///B/222/N3", "atom2_id": "///B/251/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 502, "atom1_serNum": 5965, "atom2_serNum": 6576, "donAcc_type": "standard", "distance": 3.210, "atom1_id": "///B/222/N4", "atom2_id": "///B/251/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 503, "atom1_serNum": 5982, "atom2_serNum": 6556, "donAcc_type": "standard", "distance": 2.926, "atom1_id": "///B/223/O2", "atom2_id": "///B/250/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 504, "atom1_serNum": 5983, "atom2_serNum": 6554, "donAcc_type": "standard", "distance": 2.919, "atom1_id": "///B/223/N3", "atom2_id": "///B/250/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 505, "atom1_serNum": 5985, "atom2_serNum": 6553, "donAcc_type": "standard", "distance": 2.871, "atom1_id": "///B/223/N4", "atom2_id": "///B/250/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 506, "atom1_serNum": 6002, "atom2_serNum": 6511, "donAcc_type": "standard", "distance": 2.792, "atom1_id": "///B/224/O2", "atom2_id": "///B/248/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 507, "atom1_serNum": 6003, "atom2_serNum": 6508, "donAcc_type": "standard", "distance": 2.986, "atom1_id": "///B/224/N3", "atom2_id": "///B/248/N7", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 508, "atom1_serNum": 6018, "atom2_serNum": 6069, "donAcc_type": "acceptable", "distance": 3.172, "atom1_id": "///B/225/O2'", "atom2_id": "///B/227/O6", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 509, "atom1_serNum": 6018, "atom2_serNum": 6491, "donAcc_type": "acceptable", "distance": 2.905, "atom1_id": "///B/225/O2'", "atom2_id": "///B/247/O4", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 510, "atom1_serNum": 6025, "atom2_serNum": 6496, "donAcc_type": "standard", "distance": 2.942, "atom1_id": "///B/225/N6", "atom2_id": "///B/248/OP2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 511, "atom1_serNum": 6028, "atom2_serNum": 6047, "donAcc_type": "standard", "distance": 3.112, "atom1_id": "///B/225/N3", "atom2_id": "///B/226/N6", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 512, "atom1_serNum": 6047, "atom2_serNum": 6533, "donAcc_type": "standard", "distance": 2.610, "atom1_id": "///B/226/N6", "atom2_id": "///B/249/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 513, "atom1_serNum": 6048, "atom2_serNum": 6531, "donAcc_type": "standard", "distance": 2.867, "atom1_id": "///B/226/N1", "atom2_id": "///B/249/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 514, "atom1_serNum": 6069, "atom2_serNum": 6489, "donAcc_type": "standard", "distance": 2.670, "atom1_id": "///B/227/O6", "atom2_id": "///B/247/N3", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 515, "atom1_serNum": 6070, "atom2_serNum": 6488, "donAcc_type": "standard", "distance": 2.580, "atom1_id": "///B/227/N1", "atom2_id": "///B/247/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 516, "atom1_serNum": 6072, "atom2_serNum": 6488, "donAcc_type": "standard", "distance": 3.316, "atom1_id": "///B/227/N2", "atom2_id": "///B/247/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 517, "atom1_serNum": 6090, "atom2_serNum": 6470, "donAcc_type": "standard", "distance": 2.916, "atom1_id": "///B/228/N3", "atom2_id": "///B/246/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 518, "atom1_serNum": 6092, "atom2_serNum": 6469, "donAcc_type": "standard", "distance": 2.908, "atom1_id": "///B/228/O4", "atom2_id": "///B/246/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 519, "atom1_serNum": 6109, "atom2_serNum": 6449, "donAcc_type": "standard", "distance": 2.825, "atom1_id": "///B/229/O2", "atom2_id": "///B/245/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 520, "atom1_serNum": 6110, "atom2_serNum": 6447, "donAcc_type": "standard", "distance": 2.846, "atom1_id": "///B/229/N3", "atom2_id": "///B/245/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 521, "atom1_serNum": 6112, "atom2_serNum": 6446, "donAcc_type": "standard", "distance": 2.792, "atom1_id": "///B/229/N4", "atom2_id": "///B/245/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 522, "atom1_serNum": 6125, "atom2_serNum": 6143, "donAcc_type": "acceptable", "distance": 3.234, "atom1_id": "///B/230/O2'", "atom2_id": "///B/231/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 523, "atom1_serNum": 6132, "atom2_serNum": 6426, "donAcc_type": "standard", "distance": 2.745, "atom1_id": "///B/230/N6", "atom2_id": "///B/244/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 524, "atom1_serNum": 6133, "atom2_serNum": 6424, "donAcc_type": "standard", "distance": 2.732, "atom1_id": "///B/230/N1", "atom2_id": "///B/244/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 525, "atom1_serNum": 6154, "atom2_serNum": 6383, "donAcc_type": "standard", "distance": 3.003, "atom1_id": "///B/231/N6", "atom2_id": "///B/242/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 526, "atom1_serNum": 6154, "atom2_serNum": 6406, "donAcc_type": "standard", "distance": 2.774, "atom1_id": "///B/231/N6", "atom2_id": "///B/243/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 527, "atom1_serNum": 6155, "atom2_serNum": 6404, "donAcc_type": "standard", "distance": 2.727, "atom1_id": "///B/231/N1", "atom2_id": "///B/243/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 528, "atom1_serNum": 6173, "atom2_serNum": 6386, "donAcc_type": "standard", "distance": 2.588, "atom1_id": "///B/232/O2", "atom2_id": "///B/242/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 529, "atom1_serNum": 6174, "atom2_serNum": 6384, "donAcc_type": "standard", "distance": 2.821, "atom1_id": "///B/232/N3", "atom2_id": "///B/242/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 530, "atom1_serNum": 6176, "atom2_serNum": 6383, "donAcc_type": "standard", "distance": 2.958, "atom1_id": "///B/232/N4", "atom2_id": "///B/242/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 531, "atom1_serNum": 6196, "atom2_serNum": 6363, "donAcc_type": "standard", "distance": 2.869, "atom1_id": "///B/233/N6", "atom2_id": "///B/241/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 532, "atom1_serNum": 6197, "atom2_serNum": 6361, "donAcc_type": "standard", "distance": 2.739, "atom1_id": "///B/233/N1", "atom2_id": "///B/241/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 533, "atom1_serNum": 6218, "atom2_serNum": 6343, "donAcc_type": "standard", "distance": 2.988, "atom1_id": "///B/234/O6", "atom2_id": "///B/240/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 534, "atom1_serNum": 6219, "atom2_serNum": 6341, "donAcc_type": "standard", "distance": 3.199, "atom1_id": "///B/234/N1", "atom2_id": "///B/240/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 535, "atom1_serNum": 6221, "atom2_serNum": 6340, "donAcc_type": "standard", "distance": 3.483, "atom1_id": "///B/234/N2", "atom2_id": "///B/240/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 536, "atom1_serNum": 6241, "atom2_serNum": 6323, "donAcc_type": "standard", "distance": 2.371, "atom1_id": "///B/235/N6", "atom2_id": "///B/239/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 537, "atom1_serNum": 6242, "atom2_serNum": 6321, "donAcc_type": "standard", "distance": 2.755, "atom1_id": "///B/235/N1", "atom2_id": "///B/239/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 538, "atom1_serNum": 6289, "atom2_serNum": 6312, "donAcc_type": "questionable", "distance": 2.785, "atom1_id": "///B/238/O5'", "atom2_id": "///B/239/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 539, "atom1_serNum": 6504, "atom2_serNum": 6550, "donAcc_type": "acceptable", "distance": 2.624, "atom1_id": "///B/248/O2'", "atom2_id": "///B/250/N7", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 540, "atom1_serNum": 6614, "atom2_serNum": 6638, "donAcc_type": "acceptable", "distance": 3.496, "atom1_id": "///B/253/O2'", "atom2_id": "///B/254/N7", "atom_pair": "O:N", "residue_pair": "nt:nt" } ], "refCoords": { "purine": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 -0.5000 0.4000", " 3 N -2.2500 -0.5000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 1.2500 5.0000 0.4000", " 6 C 1.2500 -0.5000 0.4000", " 7 C 1.2500 -0.5000 -0.4000", " 8 C 1.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 -0.5000 0.4000", " 11 C -2.2500 -0.5000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ], "pyrimidine": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 1.0000 0.4000", " 3 N -2.2500 1.0000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 1.2500 5.0000 0.4000", " 6 C 1.2500 1.0000 0.4000", " 7 C 1.2500 1.0000 -0.4000", " 8 C 1.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 1.0000 0.4000", " 11 C -2.2500 1.0000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ], "wc_pair": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 -5.0000 0.4000", " 3 N -2.2500 -5.0000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 2.2500 5.0000 0.4000", " 6 C 2.2500 -5.0000 0.4000", " 7 C 2.2500 -5.0000 -0.4000", " 8 C 2.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 -5.0000 0.4000", " 11 C -2.2500 -5.0000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ] }, "metadata": { "license": "http://innovation.columbia.edu/technologies/CU20391", "url": "http://x3dna.org/", "url_alt": "http://home.x3dna.org/", "forum": "http://forum.x3dna.org/", "citation": "Lu et al. (2015). 'DSSR: an integrated software tool for dissecting the spatial structure of RNA.' Nucleic Acids Res., 43(21):e142 [doi:10.1093/nar/gkv716].", "str_id": "6d8l", "num_naChains": 2, "naChains": "A=158,B=158", "num_atoms": 6795, "num_waters": 3, "num_metals": 22, "metals_desc": "Mg=22", "num_notes": 52, "notes": [ { "Aminors": "A-minor interactions (including types I and II)" }, { "Cstem_index": "stem index of the 'Canonical' helix in k-turn" }, { "Cstem_pair": "Cstem bp delineating the k-turn internal loop" }, { "Dp": "perpendicular distance of the 3' P atom to the glycosidic bond" }, { "GA_pair": "sheared G-A pair in k-turn" }, { "HtypePknot": "H-type pseudoknot" }, { "Kturn": "kink-turn (k-turn)" }, { "LW": "Leontis-Westhof" }, { "NCstem_index": "stem index of the 'Non-Canonical' helix in k-turn" }, { "NCstem_pair": "NCstem bp delineating the k-turn internal loop" }, { "Uturn": "U-turn of the UNR- or GNRA-type" }, { "aa": "amino acid" }, { "atom_pair": "symbols of the two atoms involved in an H-bond" }, { "auxfiles": "auxiliary files" }, { "glyco_bond": "conformation of base related to sugar (syn or anti)" }, { "bb_type": "backbone conformation, BI or BII" }, { "bending_angle": "angle between two helical axes" }, { "bp": "base pair" }, { "bseq": "base sequence in one-letter code" }, { "bulge": "bulge loop" }, { "coaxStacks": "coaxial stacking of stems within a helix" }, { "dbn": "dot bracket notation" }, { "desc": "description" }, { "donAcc_type": "donor/acceptor type of the atom pair in an H-bond" }, { "epsilon_zeta": "difference between epsilon and zeta torsion angles" }, { "hairpin": "hairpin loop" }, { "hbond": "hydrogen bond (H-bond)" }, { "helix": "defined by base-stacking interactions, regardless of bp type and backbone connectivity" }, { "id": "identifier" }, { "iloop": "internal loop" }, { "index": "serial number" }, { "isoCanonPairs": "isolated canonical pairs" }, { "junction": "(multi-branched) junction loop" }, { "kissingLoop": "kissing loop" }, { "multiplet": "3+ bases in a coplanar geometry" }, { "na": "nucleic acid" }, { "nonPair": "two nts not forming a pair, but with H-bonding/stacking interactions" }, { "nonStack": "nucleotide not involved in stacking interactions" }, { "nt": "nucleotide" }, { "num": "number" }, { "oArea": "overlap areas between two bases, including exocyclic atoms" }, { "oArea_ring": "overlap areas between two bases, including only ring atoms" }, { "phosContacts": "H-bonding and atom-capping interactions involving a phosphate" }, { "residue_pair": "types of the two residues involved in an H-bond" }, { "rmsd": "root-mean-squares deviation" }, { "serNum": "serial number" }, { "ssSegments": "single-stranded segments not involved in loops" }, { "ssZp": "Z-coordinate of the 3' phosphorus atom with reference to the 5' base plane" }, { "sstr": "secondary structure in dbn" }, { "stem": "helix consisting of only canonical pairs, with a continuous backbone" }, { "str_id": "structure identifier, derived from inpfile with extension removed" }, { "vert_dist": "vertical distance from an atom to a base plane" } ], "num_auxfiles": 20, "auxfiles": [ { "index": 1, "name": "dssr-pairs.pdb", "desc": "an ensemble of base pairs" }, { "index": 2, "name": "dssr-multiplets.pdb", "desc": "an ensemble of multiplets" }, { "index": 3, "name": "dssr-stems.pdb", "desc": "an ensemble of stems" }, { "index": 4, "name": "dssr-helices.pdb", "desc": "an ensemble of helices (coaxial stacking)" }, { "index": 5, "name": "dssr-hairpins.pdb", "desc": "an ensemble of hairpin loops" }, { "index": 6, "name": "dssr-bulges.pdb", "desc": "an ensemble of bulges" }, { "index": 7, "name": "dssr-iloops.pdb", "desc": "an ensemble of internal loops" }, { "index": 8, "name": "dssr-junctions.pdb", "desc": "an ensemble of junctions (multi-branch)" }, { "index": 9, "name": "dssr-2ndstrs.bpseq", "desc": "secondary structure in bpseq format" }, { "index": 10, "name": "dssr-2ndstrs.ct", "desc": "secondary structure in connectivity table format" }, { "index": 11, "name": "dssr-2ndstrs.dbn", "desc": "secondary structure in dot-bracket notation" }, { "index": 12, "name": "dssr-torsions.txt", "desc": "backbone torsion angles and suite names" }, { "index": 13, "name": "dssr-splays.pdb", "desc": "an ensemble of splayed-apart units" }, { "index": 14, "name": "dssr-Aminors.pdb", "desc": "an ensemble of A minor motifs (types I and II)" }, { "index": 15, "name": "dssr-stacks.pdb", "desc": "an ensemble of base stacks" }, { "index": 16, "name": "dssr-atom2bases.pdb", "desc": "an ensemble of atom-base stacking interactions" }, { "index": 17, "name": "dssr-rotmat.txt", "desc": "position vector and rotation matrix" }, { "index": 18, "name": "dssr-viewV.pdb", "desc": "vertical view of the principal moment of inertia" }, { "index": 19, "name": "dssr-viewH.pdb", "desc": "horizontal view of the principal moment of inertia" }, { "index": 20, "name": "dssr-viewT.pdb", "desc": "top view of the principal moment of inertia" } ], "time_used": "999" } }