**************************************************************************** File name: 6ck5.pdb no. of DNA/RNA chains: 2 [A=108,B=100] no. of nucleotides: 208 no. of atoms: 4545 no. of waters: 52 no. of metals: 31 [Mg=8,K=3,Ba=20] **************************************************************************** List of 105 base pairs nt1 nt2 bp name Saenger LW DSSR 1 A.U1 A.A110 U-A WC 20-XX cWW cW-W 2 A.G2 A.C109 G-C WC 19-XIX cWW cW-W 3 A.A3 A.U108 A-U WC 20-XX cWW cW-W 4 A.A4 A.U107 A-U WC 20-XX cWW cW-W 5 A.A5 A.U106 A-U WC 20-XX cWW cW-W 6 A.G6 A.A74 G+A -- 10-X tSW tm+W 7 A.G6 A.G105 G-G -- -- cWW cW-W 8 A.U7 A.A55 U-A WC 20-XX cWW cW-W 9 A.G8 A.C54 G-C WC 19-XIX cWW cW-W 10 A.U9 A.A53 U-A WC 20-XX cWW cW-W 11 A.A10 A.U52 A-U WC 20-XX cWW cW-W 12 A.C11 A.G51 C-G WC 19-XIX cWW cW-W 13 A.C12 A.G50 C-G WC 19-XIX cWW cW-W 14 A.U13 A.A47 U-A rHoogsteen 24-XXIV tWH tW-M 15 A.A14 A.G46 A-G Sheared 11-XI tHS tM-m 16 A.G15 A.C45 G-C WC 19-XIX cWW cW-W 17 A.G15 A.A90 G-A -- -- cWS cW-m 18 A.G16 A.C44 G-C WC 19-XIX cWW cW-W 19 A.G17 A.U19 G+U -- -- cWH cW+M 20 A.G17 A.A43 G-A Imino 08-VIII cWW cW-W 21 A.G17 A.A87 G-A -- -- cSW cm-W 22 A.U18 A.C20 U+C -- -- c.H c.+M 23 A.C20 A.G42 C-G WC 19-XIX cWW cW-W 24 A.C21 A.G37 C-G -- -- -- -- 25 A.C21 A.G41 C-G WC 19-XIX cWW cW-W 26 A.A22 A.U39 A-U WC 20-XX cWW cW-W 27 A.G23 A.U36 G-U Wobble 28-XXVIII cWW cW-W 28 A.C24 A.G35 C-G WC 19-XIX cWW cW-W 29 A.C25 A.G34 C-G WC 19-XIX cWW cW-W 30 A.U26 A.A33 U-A WC 20-XX cWW cW-W 31 A.A27 A.U32 A-U WC 20-XX cWW cW-W 32 A.U28 A.G31 U+G -- -- tSW tm+W 33 A.G37 A.G41 G+G -- 06-VI cWH cW+M 34 A.C45 A.A89 C+A -- -- tSW tm+W 35 A.G48 A.A76 G+A Linker -- tSS tm+m 36 A.G56 A.C73 G-C WC 19-XIX cWW cW-W 37 A.G57 A.C72 G-C WC 19-XIX cWW cW-W 38 A.U58 A.A71 U-A WC 20-XX cWW cW-W 39 A.A59 A.U70 A-U WC 20-XX cWW cW-W 40 A.U60 A.A69 U-A WC 20-XX cWW cW-W 41 A.A61 A.U68 A-U WC 20-XX cWW cW-W 42 A.C75 A.G96 C-G WC 19-XIX cWW cW-W 43 A.C75 A.G104 C-G -- -- cSS cm-m 44 A.C75 A.G105 C-G -- -- cSS cm-m 45 A.C77 A.G100 C-G WC 19-XIX cWW cW-W 46 A.C78 A.G99 C-G WC 19-XIX cWW cW-W 47 A.U79 A.A98 U-A WC 20-XX cWW cW-W 48 A.U80 A.G97 U-G Wobble 28-XXVIII cWW cW-W 49 A.A81 A.G95 A+G -- -- cHW cM+W 50 A.G82 A.C94 G-C WC 19-XIX cWW cW-W 51 A.G83 A.C93 G-C WC 19-XIX cWW cW-W 52 A.G84 A.C92 G-C WC 19-XIX cWW cW-W 53 A.A85 A.A90 A-A -- -- tWH tW-M 54 A.U102 A.A103 U+A Platform -- cWH cW+M 55 B.G0 B.C111 G-C WC 19-XIX cWW cW-W 56 B.U1 B.A110 U-A WC 20-XX cWW cW-W 57 B.G2 B.C109 G-C WC 19-XIX cWW cW-W 58 B.A3 B.U108 A-U WC 20-XX cWW cW-W 59 B.A4 B.U107 A-U WC 20-XX cWW cW-W 60 B.A5 B.U106 A-U WC 20-XX cWW cW-W 61 B.G6 B.A74 G+A -- 10-X tSW tm+W 62 B.G6 B.G105 G-G -- -- cWW cW-W 63 B.U7 B.A55 U-A WC 20-XX cWW cW-W 64 B.G8 B.C54 G-C WC 19-XIX cWW cW-W 65 B.U9 B.A53 U-A WC 20-XX cWW cW-W 66 B.A10 B.U52 A-U WC 20-XX cWW cW-W 67 B.C11 B.G51 C-G WC 19-XIX cWW cW-W 68 B.C12 B.G50 C-G WC 19-XIX cWW cW-W 69 B.U13 B.A47 U-A rHoogsteen 24-XXIV tWH tW-M 70 B.A14 B.G46 A-G Sheared 11-XI tHS tM-m 71 B.G15 B.C45 G-C WC 19-XIX cWW cW-W 72 B.G15 B.A90 G-A -- -- cWS cW-m 73 B.G16 B.C44 G-C WC 19-XIX cWW cW-W 74 B.G17 B.U19 G+U -- -- cWH cW+M 75 B.G17 B.A43 G+A -- -- cWH cW+M 76 B.G17 B.A87 G-A -- -- cSW cm-W 77 B.U18 B.C20 U+C -- -- c.H c.+M 78 B.C20 B.G42 C-G WC 19-XIX cWW cW-W 79 B.C21 B.G37 C-G -- -- -- -- 80 B.C21 B.G41 C-G WC 19-XIX cWW cW-W 81 B.A22 B.U39 A-U WC 20-XX cWW cW-W 82 B.G23 B.U36 G-U Wobble 28-XXVIII cWW cW-W 83 B.C24 B.G35 C-G WC 19-XIX cWW cW-W 84 B.C25 B.G34 C-G WC 19-XIX cWW cW-W 85 B.U26 B.A33 U-A WC 20-XX cWW cW-W 86 B.A27 B.U32 A-U WC 20-XX cWW cW-W 87 B.G37 B.G41 G+G -- 06-VI cWH cW+M 88 B.C45 B.A89 C+A -- -- tSW tm+W 89 B.G48 B.A76 G+A Linker -- tSS tm+m 90 B.G56 B.C73 G-C WC 19-XIX cWW cW-W 91 B.G57 B.C72 G-C WC 19-XIX cWW cW-W 92 B.C75 B.G96 C-G WC 19-XIX cWW cW-W 93 B.C75 B.G104 C-G -- -- cSS cm-m 94 B.C75 B.G105 C-G -- -- cSS cm-m 95 B.C77 B.G100 C-G WC 19-XIX cWW cW-W 96 B.C78 B.G99 C-G WC 19-XIX cWW cW-W 97 B.U79 B.A98 U-A WC 20-XX cWW cW-W 98 B.U80 B.G97 U-G Wobble 28-XXVIII cWW cW-W 99 B.A81 B.G95 A+G -- -- cHW cM+W 100 B.G82 B.C94 G-C WC 19-XIX cWW cW-W 101 B.G83 B.C93 G-C WC 19-XIX cWW cW-W 102 B.G84 B.C92 G-C WC 19-XIX cWW cW-W 103 B.A85 B.A90 A-A ~rHoogsteen -- tWH tW-M 104 B.C86 B.A89 C-A ~rHoogsteen 25-XXV tWH tW-M 105 B.U102 B.A103 U+A Platform -- cSH cm+M **************************************************************************** List of 13 multiplets 1 nts=3 GAG A.G6,A.A74,A.G105 2 nts=3 GAA A.G17,A.A43,A.A87 3 nts=3 UCG A.U18,A.C20,A.G42 4 nts=3 CGG A.C21,A.G37,A.G41 5 nts=3 CGG A.C75,A.G96,A.G104 6 nts=3 GAG B.G6,B.A74,B.G105 7 nts=3 GAA B.G17,B.A43,B.A87 8 nts=3 UCG B.U18,B.C20,B.G42 9 nts=3 CGG B.C21,B.G37,B.G41 10 nts=3 CGG B.C75,B.G96,B.G104 11 nts=4 GCAA A.G15,A.C45,A.A85,A.A90 12 nts=4 GCAA B.G15,B.C45,B.A85,B.A90 13 nts=4 GCCA B.G15,B.C45,B.C86,B.A89 **************************************************************************** List of 6 helices Note: A helix is defined by base-stacking interactions, regardless of pair type and backbone connectivity, and may contain more than one stem. helix#number[stems-contained] bps=number-of-base-pairs in the helix bp-type: '|' for a canonical WC/wobble pair, '.' otherwise helix-form: classification of a dinucleotide step comprising the bp above the given designation and the bp that follows it. Types include 'A', 'B' or 'Z' for the common A-, B- and Z-form helices, '.' for an unclassified step, and 'x' for a step without a continuous backbone. -------------------------------------------------------------------- helix#1[1] bps=8 strand-1 5'-UGAAAACA-3' bp-type |||||.|. strand-2 3'-ACUUUGGG-5' helix-form A...xxx 1 A.U1 A.A110 U-A WC 20-XX cWW cW-W 2 A.G2 A.C109 G-C WC 19-XIX cWW cW-W 3 A.A3 A.U108 A-U WC 20-XX cWW cW-W 4 A.A4 A.U107 A-U WC 20-XX cWW cW-W 5 A.A5 A.U106 A-U WC 20-XX cWW cW-W 6 A.A74 A.G6 A+G -- 10-X tWS tW+m 7 A.C75 A.G96 C-G WC 19-XIX cWW cW-W 8 A.A76 A.G48 A+G Linker -- tSS tm+m -------------------------------------------------------------------------- helix#2[6] bps=26 strand-1 5'-GUAGGUUGGACCGAGGUACAGGUAUA-3' bp-type .||||||||.||..|||||||||||| strand-2 3'-UAUCCGACCGGGAUCCAUGUCCAUAU-5' helix-form .AAA.xxAx....x.AAAAxAxAAA 1 A.G31 A.U28 G+U -- -- tWS tW+m 2 A.U32 A.A27 U-A WC 20-XX cWW cW-W 3 A.A33 A.U26 A-U WC 20-XX cWW cW-W 4 A.G34 A.C25 G-C WC 19-XIX cWW cW-W 5 A.G35 A.C24 G-C WC 19-XIX cWW cW-W 6 A.U36 A.G23 U-G Wobble 28-XXVIII cWW cW-W 7 A.U39 A.A22 U-A WC 20-XX cWW cW-W 8 A.G41 A.C21 G-C WC 19-XIX cWW cW-W 9 A.G42 A.C20 G-C WC 19-XIX cWW cW-W 10 A.A43 A.G17 A-G Imino 08-VIII cWW cW-W 11 A.C44 A.G16 C-G WC 19-XIX cWW cW-W 12 A.C45 A.G15 C-G WC 19-XIX cWW cW-W 13 A.G46 A.A14 G-A Sheared 11-XI tSH tm-M 14 A.A47 A.U13 A-U rHoogsteen 24-XXIV tHW tM-W 15 A.G50 A.C12 G-C WC 19-XIX cWW cW-W 16 A.G51 A.C11 G-C WC 19-XIX cWW cW-W 17 A.U52 A.A10 U-A WC 20-XX cWW cW-W 18 A.A53 A.U9 A-U WC 20-XX cWW cW-W 19 A.C54 A.G8 C-G WC 19-XIX cWW cW-W 20 A.A55 A.U7 A-U WC 20-XX cWW cW-W 21 A.G56 A.C73 G-C WC 19-XIX cWW cW-W 22 A.G57 A.C72 G-C WC 19-XIX cWW cW-W 23 A.U58 A.A71 U-A WC 20-XX cWW cW-W 24 A.A59 A.U70 A-U WC 20-XX cWW cW-W 25 A.U60 A.A69 U-A WC 20-XX cWW cW-W 26 A.A61 A.U68 A-U WC 20-XX cWW cW-W -------------------------------------------------------------------------- helix#3[2] bps=9 strand-1 5'-CCUUAGGGA-3' bp-type ||||.|||. strand-2 3'-GGAGGCCCA-5' helix-form AA.x.A.x 1 A.C77 A.G100 C-G WC 19-XIX cWW cW-W 2 A.C78 A.G99 C-G WC 19-XIX cWW cW-W 3 A.U79 A.A98 U-A WC 20-XX cWW cW-W 4 A.U80 A.G97 U-G Wobble 28-XXVIII cWW cW-W 5 A.A81 A.G95 A+G -- -- cHW cM+W 6 A.G82 A.C94 G-C WC 19-XIX cWW cW-W 7 A.G83 A.C93 G-C WC 19-XIX cWW cW-W 8 A.G84 A.C92 G-C WC 19-XIX cWW cW-W 9 A.A85 A.A90 A-A -- -- tWH tW-M -------------------------------------------------------------------------- helix#4[1] bps=9 strand-1 5'-GUGAAAACA-3' bp-type ||||||.|. strand-2 3'-CACUUUGGG-5' helix-form .A...xxx 1 B.G0 B.C111 G-C WC 19-XIX cWW cW-W 2 B.U1 B.A110 U-A WC 20-XX cWW cW-W 3 B.G2 B.C109 G-C WC 19-XIX cWW cW-W 4 B.A3 B.U108 A-U WC 20-XX cWW cW-W 5 B.A4 B.U107 A-U WC 20-XX cWW cW-W 6 B.A5 B.U106 A-U WC 20-XX cWW cW-W 7 B.A74 B.G6 A+G -- 10-X tWS tW+m 8 B.C75 B.G96 C-G WC 19-XIX cWW cW-W 9 B.A76 B.G48 A+G Linker -- tSS tm+m -------------------------------------------------------------------------- helix#5[5] bps=21 strand-1 5'-UAGGUUGGGCCGAGGUACAGG-3' bp-type ||||||||.||..|||||||| strand-2 3'-AUCCGACCUGGAUCCAUGUCC-5' helix-form AAA.xxAxxA..x.AAAAxA 1 B.U32 B.A27 U-A WC 20-XX cWW cW-W 2 B.A33 B.U26 A-U WC 20-XX cWW cW-W 3 B.G34 B.C25 G-C WC 19-XIX cWW cW-W 4 B.G35 B.C24 G-C WC 19-XIX cWW cW-W 5 B.U36 B.G23 U-G Wobble 28-XXVIII cWW cW-W 6 B.U39 B.A22 U-A WC 20-XX cWW cW-W 7 B.G41 B.C21 G-C WC 19-XIX cWW cW-W 8 B.G42 B.C20 G-C WC 19-XIX cWW cW-W 9 B.G17 B.U19 G+U -- -- cWH cW+M 10 B.C44 B.G16 C-G WC 19-XIX cWW cW-W 11 B.C45 B.G15 C-G WC 19-XIX cWW cW-W 12 B.G46 B.A14 G-A Sheared 11-XI tSH tm-M 13 B.A47 B.U13 A-U rHoogsteen 24-XXIV tHW tM-W 14 B.G50 B.C12 G-C WC 19-XIX cWW cW-W 15 B.G51 B.C11 G-C WC 19-XIX cWW cW-W 16 B.U52 B.A10 U-A WC 20-XX cWW cW-W 17 B.A53 B.U9 A-U WC 20-XX cWW cW-W 18 B.C54 B.G8 C-G WC 19-XIX cWW cW-W 19 B.A55 B.U7 A-U WC 20-XX cWW cW-W 20 B.G56 B.C73 G-C WC 19-XIX cWW cW-W 21 B.G57 B.C72 G-C WC 19-XIX cWW cW-W -------------------------------------------------------------------------- helix#6[2] bps=10 strand-1 5'-CCUUAGGGAC-3' bp-type ||||.|||.. strand-2 3'-GGAGGCCCAA-5' helix-form AA.x.A.x. 1 B.C77 B.G100 C-G WC 19-XIX cWW cW-W 2 B.C78 B.G99 C-G WC 19-XIX cWW cW-W 3 B.U79 B.A98 U-A WC 20-XX cWW cW-W 4 B.U80 B.G97 U-G Wobble 28-XXVIII cWW cW-W 5 B.A81 B.G95 A+G -- -- cHW cM+W 6 B.G82 B.C94 G-C WC 19-XIX cWW cW-W 7 B.G83 B.C93 G-C WC 19-XIX cWW cW-W 8 B.G84 B.C92 G-C WC 19-XIX cWW cW-W 9 B.A85 B.A90 A-A ~rHoogsteen -- tWH tW-M 10 B.C86 B.A89 C-A ~rHoogsteen 25-XXV tWH tW-M **************************************************************************** List of 17 stems Note: A stem is defined as a helix consisting strictly of canonical WC/wobble pairs with a continuous backbone. stem#number[#helix-number containing this stem] Other terms are defined as in the above Helix section. -------------------------------------------------------------------- stem#1[#1] bps=5 strand-1 5'-UGAAA-3' bp-type ||||| strand-2 3'-ACUUU-5' helix-form A... 1 A.U1 A.A110 U-A WC 20-XX cWW cW-W 2 A.G2 A.C109 G-C WC 19-XIX cWW cW-W 3 A.A3 A.U108 A-U WC 20-XX cWW cW-W 4 A.A4 A.U107 A-U WC 20-XX cWW cW-W 5 A.A5 A.U106 A-U WC 20-XX cWW cW-W -------------------------------------------------------------------------- stem#2[#2] bps=6 strand-1 5'-UGUACC-3' bp-type |||||| strand-2 3'-ACAUGG-5' helix-form AAAA. 1 A.U7 A.A55 U-A WC 20-XX cWW cW-W 2 A.G8 A.C54 G-C WC 19-XIX cWW cW-W 3 A.U9 A.A53 U-A WC 20-XX cWW cW-W 4 A.A10 A.U52 A-U WC 20-XX cWW cW-W 5 A.C11 A.G51 C-G WC 19-XIX cWW cW-W 6 A.C12 A.G50 C-G WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#3[#2] bps=2 strand-1 5'-GG-3' bp-type || strand-2 3'-CC-5' helix-form . 1 A.G15 A.C45 G-C WC 19-XIX cWW cW-W 2 A.G16 A.C44 G-C WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#4[#2] bps=2 strand-1 5'-CC-3' bp-type || strand-2 3'-GG-5' helix-form A 1 A.C20 A.G42 C-G WC 19-XIX cWW cW-W 2 A.C21 A.G41 C-G WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#5[#2] bps=5 strand-1 5'-GCCUA-3' bp-type ||||| strand-2 3'-UGGAU-5' helix-form .AAA 1 A.G23 A.U36 G-U Wobble 28-XXVIII cWW cW-W 2 A.C24 A.G35 C-G WC 19-XIX cWW cW-W 3 A.C25 A.G34 C-G WC 19-XIX cWW cW-W 4 A.U26 A.A33 U-A WC 20-XX cWW cW-W 5 A.A27 A.U32 A-U WC 20-XX cWW cW-W -------------------------------------------------------------------------- stem#6[#2] bps=2 strand-1 5'-GG-3' bp-type || strand-2 3'-CC-5' helix-form A 1 A.G56 A.C73 G-C WC 19-XIX cWW cW-W 2 A.G57 A.C72 G-C WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#7[#2] bps=4 strand-1 5'-UAUA-3' bp-type |||| strand-2 3'-AUAU-5' helix-form AAA 1 A.U58 A.A71 U-A WC 20-XX cWW cW-W 2 A.A59 A.U70 A-U WC 20-XX cWW cW-W 3 A.U60 A.A69 U-A WC 20-XX cWW cW-W 4 A.A61 A.U68 A-U WC 20-XX cWW cW-W -------------------------------------------------------------------------- stem#8[#3] bps=4 strand-1 5'-CCUU-3' bp-type |||| strand-2 3'-GGAG-5' helix-form AA. 1 A.C77 A.G100 C-G WC 19-XIX cWW cW-W 2 A.C78 A.G99 C-G WC 19-XIX cWW cW-W 3 A.U79 A.A98 U-A WC 20-XX cWW cW-W 4 A.U80 A.G97 U-G Wobble 28-XXVIII cWW cW-W -------------------------------------------------------------------------- stem#9[#3] bps=3 strand-1 5'-GGG-3' bp-type ||| strand-2 3'-CCC-5' helix-form A. 1 A.G82 A.C94 G-C WC 19-XIX cWW cW-W 2 A.G83 A.C93 G-C WC 19-XIX cWW cW-W 3 A.G84 A.C92 G-C WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#10[#4] bps=6 strand-1 5'-GUGAAA-3' bp-type |||||| strand-2 3'-CACUUU-5' helix-form .A... 1 B.G0 B.C111 G-C WC 19-XIX cWW cW-W 2 B.U1 B.A110 U-A WC 20-XX cWW cW-W 3 B.G2 B.C109 G-C WC 19-XIX cWW cW-W 4 B.A3 B.U108 A-U WC 20-XX cWW cW-W 5 B.A4 B.U107 A-U WC 20-XX cWW cW-W 6 B.A5 B.U106 A-U WC 20-XX cWW cW-W -------------------------------------------------------------------------- stem#11[#5] bps=6 strand-1 5'-UGUACC-3' bp-type |||||| strand-2 3'-ACAUGG-5' helix-form AAAA. 1 B.U7 B.A55 U-A WC 20-XX cWW cW-W 2 B.G8 B.C54 G-C WC 19-XIX cWW cW-W 3 B.U9 B.A53 U-A WC 20-XX cWW cW-W 4 B.A10 B.U52 A-U WC 20-XX cWW cW-W 5 B.C11 B.G51 C-G WC 19-XIX cWW cW-W 6 B.C12 B.G50 C-G WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#12[#5] bps=2 strand-1 5'-GG-3' bp-type || strand-2 3'-CC-5' helix-form A 1 B.G15 B.C45 G-C WC 19-XIX cWW cW-W 2 B.G16 B.C44 G-C WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#13[#5] bps=2 strand-1 5'-CC-3' bp-type || strand-2 3'-GG-5' helix-form A 1 B.C20 B.G42 C-G WC 19-XIX cWW cW-W 2 B.C21 B.G41 C-G WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#14[#5] bps=5 strand-1 5'-GCCUA-3' bp-type ||||| strand-2 3'-UGGAU-5' helix-form .AAA 1 B.G23 B.U36 G-U Wobble 28-XXVIII cWW cW-W 2 B.C24 B.G35 C-G WC 19-XIX cWW cW-W 3 B.C25 B.G34 C-G WC 19-XIX cWW cW-W 4 B.U26 B.A33 U-A WC 20-XX cWW cW-W 5 B.A27 B.U32 A-U WC 20-XX cWW cW-W -------------------------------------------------------------------------- stem#15[#5] bps=2 strand-1 5'-GG-3' bp-type || strand-2 3'-CC-5' helix-form A 1 B.G56 B.C73 G-C WC 19-XIX cWW cW-W 2 B.G57 B.C72 G-C WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#16[#6] bps=4 strand-1 5'-CCUU-3' bp-type |||| strand-2 3'-GGAG-5' helix-form AA. 1 B.C77 B.G100 C-G WC 19-XIX cWW cW-W 2 B.C78 B.G99 C-G WC 19-XIX cWW cW-W 3 B.U79 B.A98 U-A WC 20-XX cWW cW-W 4 B.U80 B.G97 U-G Wobble 28-XXVIII cWW cW-W -------------------------------------------------------------------------- stem#17[#6] bps=3 strand-1 5'-GGG-3' bp-type ||| strand-2 3'-CCC-5' helix-form A. 1 B.G82 B.C94 G-C WC 19-XIX cWW cW-W 2 B.G83 B.C93 G-C WC 19-XIX cWW cW-W 3 B.G84 B.C92 G-C WC 19-XIX cWW cW-W **************************************************************************** List of 4 isolated WC/wobble pairs Note: Isolated WC/wobble pairs are assigned negative indices to differentiate them from the stem numbers, which are positive. -------------------------------------------------------------------- [#2] -1 A.A22 A.U39 A-U WC 20-XX cWW cW-W [#1] -2 A.C75 A.G96 C-G WC 19-XIX cWW cW-W [#5] -3 B.A22 B.U39 A-U WC 20-XX cWW cW-W [#4] -4 B.C75 B.G96 C-G WC 19-XIX cWW cW-W **************************************************************************** List of 4 coaxial stacks 1 Helix#2 contains 6 stems: [#5,#4,#3,#2,#6,#7] 2 Helix#3 contains 2 stems: [#8,#9] 3 Helix#5 contains 5 stems: [#14,#13,#12,#11,#15] 4 Helix#6 contains 2 stems: [#16,#17] **************************************************************************** List of 37 base stacks Note: A stack is an ordered list of nucleotides assembled together via base-stacking interactions, regardless of backbone connectivity. Stacking interactions within a stem are *not* included. 1 nts=2 GU A.G31,A.U32 2 nts=2 CG A.C45,A.G46 3 nts=2 AG A.A55,A.G56 4 nts=2 GU A.G57,A.U58 5 nts=2 AU A.A67,A.U68 6 nts=2 AC A.A71,A.C72 7 nts=2 AG A.A81,A.G82 8 nts=2 GA A.G84,A.A85 9 nts=2 GG A.G104,A.G105 10 nts=2 AU B.A27,B.U28 11 nts=2 AG B.A55,B.G56 12 nts=2 AG B.A81,B.G82 13 nts=2 GG B.G104,B.G105 14 nts=3 CAG A.C21,A.A22,A.G23 15 nts=3 AUU A.A27,A.U28,A.U30 16 nts=3 GAC A.G42,A.A43,A.C44 17 nts=3 GAG A.G50,A.A47,A.G91 18 nts=3 AUU A.A61,A.U62,A.U63 19 nts=3 CGG A.C94,A.G95,A.G97 20 nts=3 GAU A.G100,A.A101,A.U102 21 nts=3 CAG B.C21,B.A22,B.G23 22 nts=3 GAC B.G42,B.A43,B.C44 23 nts=3 GAC B.G84,B.A85,B.C86 24 nts=3 CGG B.C94,B.G95,B.G97 25 nts=3 GAU B.G100,B.A101,B.U102 26 nts=4 CUAG A.C12,A.U13,A.A14,A.G15 27 nts=4 ACAU A.A76,A.C75,A.A74,A.U106 28 nts=4 CUGC B.C12,B.U13,B.G46,B.C45 29 nts=4 GAAG B.G15,B.A14,B.A47,B.G50 30 nts=4 ACAU B.A76,B.C75,B.A74,B.U106 31 nts=5 AGGGC A.A5,A.G6,A.G96,A.G48,A.C49 32 nts=5 GGUGU A.G16,A.G17,A.U18,A.G37,A.U39 33 nts=5 AGGGC B.A5,B.G6,B.G96,B.G48,B.C49 34 nts=5 GGUGU B.G16,B.G17,B.U18,B.G37,B.U39 35 nts=5 GUAUA B.G57,B.U58,B.A59,B.U60,B.A61 36 nts=7 CUAAAAC A.C20,A.U19,A.A87,A.A88,A.A89,A.A90,A.C92 37 nts=7 CUAAAAC B.C20,B.U19,B.A87,B.A88,B.A89,B.A90,B.C92 **************************************************************************** Nucleotides not involved in stacking interactions nts=10 UCCAGUUCCA A.U29,A.C40,A.C77,A.A103,B.G31,B.U32,B.U38,B.C40,B.C77,B.A103 **************************************************************************** List of 7 atom-base capping interactions dv: vertical distance of the atom above the nucleotide base ----------------------------------------------------------- type atom nt dv 1 sugar O4'@A.U30 A.G31 3.11 2 sugar O4'@A.G96 A.G48 3.10 3 sugar O4'@A.C49 A.A76 3.27 4 sugar O4'@A.G82 A.A81 3.31 5 sugar O4'@B.G96 B.G48 3.10 6 sugar O4'@B.C49 B.A76 3.26 7 sugar O4'@B.G82 B.A81 3.31 **************************************************************************** Note: For the various types of loops listed below, numbers within the first set of brackets are the number of loop nts. Numbers in the second set of brackets are the identities of the stems (positive) or isolated WC/wobble pairs (negative) to which they are linked. **************************************************************************** List of 3 hairpin loops 1 hairpin loop: nts=6; [4]; linked by [#5] summary: [1] 4 [A.27 A.32] 5 nts=6 AUUUGU A.A27,A.U28,A.U29,A.U30,A.G31,A.U32 nts=4 UUUG A.U28,A.U29,A.U30,A.G31 2 hairpin loop: nts=9; [7]; linked by [#9] summary: [1] 7 [A.84 A.92] 3 nts=9 GACAAAAGC A.G84,A.A85,A.C86,A.A87,A.A88,A.A89,A.A90,A.G91,A.C92 nts=7 ACAAAAG A.A85,A.C86,A.A87,A.A88,A.A89,A.A90,A.G91 3 hairpin loop: nts=9; [7]; linked by [#17] summary: [1] 7 [B.84 B.92] 3 nts=9 GACAAAAGC B.G84,B.A85,B.C86,B.A87,B.A88,B.A89,B.A90,B.G91,B.C92 nts=7 ACAAAAG B.A85,B.C86,B.A87,B.A88,B.A89,B.A90,B.G91 **************************************************************************** List of 4 bulges 1 bulge: nts=5; [0,1]; linked by [#4,#-1] summary: [2] 0 1 [A.21 A.41 A.22 A.39] 2 1 nts=5 CAUCG A.C21,A.A22,A.U39,A.C40,A.G41 nts=0 nts=1 C A.C40 2 bulge: nts=5; [0,1]; linked by [#13,#-3] summary: [2] 0 1 [B.21 B.41 B.22 B.39] 2 1 nts=5 CAUCG B.C21,B.A22,B.U39,B.C40,B.G41 nts=0 nts=1 C B.C40 3 bulge: nts=6; [0,2]; linked by [#-1,#5] summary: [2] 0 2 [A.22 A.39 A.23 A.36] 1 5 nts=6 AGUGUU A.A22,A.G23,A.U36,A.G37,A.U38,A.U39 nts=0 nts=2 GU A.G37,A.U38 4 bulge: nts=6; [0,2]; linked by [#-3,#14] summary: [2] 0 2 [B.22 B.39 B.23 B.36] 1 5 nts=6 AGUGUU B.A22,B.G23,B.U36,B.G37,B.U38,B.U39 nts=0 nts=2 GU B.G37,B.U38 **************************************************************************** List of 6 internal loops 1 asymmetric internal loop: nts=7; [1,2]; linked by [#8,#9] summary: [2] 1 2 [A.80 A.97 A.82 A.94] 4 3 nts=7 UAGCGGG A.U80,A.A81,A.G82,A.C94,A.G95,A.G96,A.G97 nts=1 A A.A81 nts=2 GG A.G95,A.G96 2 asymmetric internal loop: nts=7; [1,2]; linked by [#16,#17] summary: [2] 1 2 [B.80 B.97 B.82 B.94] 4 3 nts=7 UAGCGGG B.U80,B.A81,B.G82,B.C94,B.G95,B.G96,B.G97 nts=1 A B.A81 nts=2 GG B.G95,B.G96 3 asymmetric internal loop: nts=8; [3,1]; linked by [#3,#4] summary: [2] 3 1 [A.16 A.44 A.20 A.42] 2 2 nts=8 GGUUCGAC A.G16,A.G17,A.U18,A.U19,A.C20,A.G42,A.A43,A.C44 nts=3 GUU A.G17,A.U18,A.U19 nts=1 A A.A43 4 asymmetric internal loop: nts=8; [3,1]; linked by [#12,#13] summary: [2] 3 1 [B.16 B.44 B.20 B.42] 2 2 nts=8 GGUUCGAC B.G16,B.G17,B.U18,B.U19,B.C20,B.G42,B.A43,B.C44 nts=3 GUU B.G17,B.U18,B.U19 nts=1 A B.A43 5 asymmetric internal loop: nts=10; [2,4]; linked by [#2,#3] summary: [2] 2 4 [A.12 A.50 A.15 A.45] 6 2 nts=10 CUAGCGAGCG A.C12,A.U13,A.A14,A.G15,A.C45,A.G46,A.A47,A.G48,A.C49,A.G50 nts=2 UA A.U13,A.A14 nts=4 GAGC A.G46,A.A47,A.G48,A.C49 6 asymmetric internal loop: nts=10; [2,4]; linked by [#11,#12] summary: [2] 2 4 [B.12 B.50 B.15 B.45] 6 2 nts=10 CUAGCGAGCG B.C12,B.U13,B.A14,B.G15,B.C45,B.G46,B.A47,B.G48,B.C49,B.G50 nts=2 UA B.U13,B.A14 nts=4 GAGC B.G46,B.A47,B.G48,B.C49 **************************************************************************** List of 12 non-loop single-stranded segments 1 nts=1 G A.G0 2 nts=1 G A.G6 3 nts=3* UUA A.U62,A.U63,A.A67 4 nts=1 A A.A74 5 nts=1 A A.A76 6 nts=5 AUAGG A.A101,A.U102,A.A103,A.G104,A.G105 7 nts=1 G B.G6 8 nts=2* UG B.U28,B.G31 9 nts=4 UAUA B.U58,B.A59,B.U60,B.A61 10 nts=1 A B.A74 11 nts=1 A B.A76 12 nts=5 AUAGG B.A101,B.U102,B.A103,B.G104,B.G105 **************************************************************************** List of 4 A-minor motifs (types I, II, or X) 1 type=X A|G-A A.A87|A.G17,A.A43 Imino -A.G17 H-bonds[1]: "N1-N2(amino)[3.03]" +A.A43 H-bonds[0]: "" 2 type=I A|G-C A.A90|A.G15,A.C45 WC -A.G15 H-bonds[2]: "O2'(hydroxyl)-O2'(hydroxyl)[3.55],N3-N2(amino)[2.83]" +A.C45 H-bonds[2]: "N6(amino)-O2'(hydroxyl)[3.40],N1-O2'(hydroxyl)[2.90]" 3 type=X A|G-C B.A87|B.G16,B.C44 WC -B.G16 H-bonds[0]: "" +B.C44 H-bonds[1]: "N6(amino)-O2'(hydroxyl)[3.59]" 4 type=I A|G-C B.A90|B.G15,B.C45 WC -B.G15 H-bonds[2]: "O2'(hydroxyl)-O2'(hydroxyl)[3.54],N3-N2(amino)[2.83]" +B.C45 H-bonds[2]: "N6(amino)-O2'(hydroxyl)[3.33],N1-O2'(hydroxyl)[2.95]" **************************************************************************** List of 4 ribose zippers 1 nts=6 GGGAAA A.G15,A.G16,A.G17,A.A88,A.A89,A.A90 2 nts=4 ACGG A.A74,A.C75,A.G104,A.G105 3 nts=6 GGGAAA B.G15,B.G16,B.G17,B.A88,B.A89,B.A90 4 nts=4 ACGG B.A74,B.C75,B.G104,B.G105 **************************************************************************** List of 23 splayed-apart dinucleotides 1 A.G6 A.U7 angle=159 distance=19.0 ratio=0.98 2 A.U28 A.U29 angle=112 distance=15.2 ratio=0.83 3 A.U39 A.C40 angle=153 distance=18.3 ratio=0.97 4 A.C40 A.G41 angle=147 distance=19.1 ratio=0.96 5 A.C49 A.G50 angle=96 distance=14.9 ratio=0.75 6 A.C73 A.A74 angle=122 distance=15.6 ratio=0.88 7 A.A76 A.C77 angle=115 distance=15.1 ratio=0.84 8 A.A90 A.G91 angle=99 distance=14.6 ratio=0.76 9 A.G91 A.C92 angle=125 distance=16.7 ratio=0.89 10 A.G95 A.G96 angle=130 distance=17.8 ratio=0.91 11 A.G96 A.G97 angle=113 distance=15.7 ratio=0.83 12 B.G6 B.U7 angle=158 distance=18.9 ratio=0.98 13 B.G37 B.U38 angle=143 distance=18.8 ratio=0.95 14 B.U38 B.U39 angle=148 distance=19.6 ratio=0.96 15 B.U39 B.C40 angle=145 distance=15.5 ratio=0.96 16 B.C40 B.G41 angle=122 distance=17.1 ratio=0.87 17 B.C49 B.G50 angle=96 distance=14.7 ratio=0.75 18 B.C73 B.A74 angle=121 distance=15.5 ratio=0.87 19 B.A76 B.C77 angle=114 distance=15.1 ratio=0.84 20 B.A90 B.G91 angle=98 distance=14.4 ratio=0.75 21 B.G91 B.C92 angle=125 distance=16.6 ratio=0.89 22 B.G95 B.G96 angle=130 distance=17.9 ratio=0.90 23 B.G96 B.G97 angle=122 distance=15.8 ratio=0.88 ---------------------------------------------------------------- Summary of 15 splayed-apart units 1 nts=2 GU A.G6,A.U7 2 nts=2 UU A.U28,A.U29 3 nts=3 UCG A.U39,A.C40,A.G41 4 nts=2 CG A.C49,A.G50 5 nts=2 CA A.C73,A.A74 6 nts=2 AC A.A76,A.C77 7 nts=3 AGC A.A90,A.G91,A.C92 8 nts=3 GGG A.G95,A.G96,A.G97 9 nts=2 GU B.G6,B.U7 10 nts=5 GUUCG B.G37,B.U38,B.U39,B.C40,B.G41 11 nts=2 CG B.C49,B.G50 12 nts=2 CA B.C73,B.A74 13 nts=2 AC B.A76,B.C77 14 nts=3 AGC B.A90,B.G91,B.C92 15 nts=3 GGG B.G95,B.G96,B.G97 **************************************************************************** This structure contains 1-order pseudoknot o You may want to run DSSR again with the '--nested' option which removes pseudoknots to get a fully nested secondary structure representation. **************************************************************************** Secondary structures in dot-bracket notation (dbn) as a whole and per chain >6ck5 nts=208 [whole] GUGAAAGUGUACCUAGGGUUCCAGCCUAUUUGUAGGUGUUCGGACCGAGCGGUACAGGUAUAUU&AUAUA&CCACACCUUAGGGACAAAAGCCCGGGAGGAUAGGUUUCA&GUGAAAGUGUACCUAGGGUUCCAGCCUAU&GUAGGUGUUCGGACCGAGCGGUACAGGUAUA&CCACACCUUAGGGACAAAAGCCCGGGAGGAUAGGUUUCAC .(((((.((((((..((...((((((((....)))))..).)).))....))))))((((((..&.))))&)).[.((((.(((.......))).])))).....)))))&((((((.((((((..((...((((((((.&.)))))..).)).))....))))))((....&)).[.((((.(((.......))).])))).....)))))) >6ck5-A #1 nts=108 0.14(2.92) [chain] RNA* GUGAAAGUGUACCUAGGGUUCCAGCCUAUUUGUAGGUGUUCGGACCGAGCGGUACAGGUAUAUU&AUAUA&CCACACCUUAGGGACAAAAGCCCGGGAGGAUAGGUUUCA .(((((.((((((..((...((((((((....)))))..).)).))....))))))((((((..&.))))&)).[.((((.(((.......))).])))).....))))) >6ck5-B #2 nts=100 0.10(2.98) [chain] RNA* GUGAAAGUGUACCUAGGGUUCCAGCCUAU&GUAGGUGUUCGGACCGAGCGGUACAGGUAUA&CCACACCUUAGGGACAAAAGCCCGGGAGGAUAGGUUUCAC ((((((.((((((..((...((((((((.&.)))))..).)).))....))))))((....&)).[.((((.(((.......))).])))).....)))))) **************************************************************************** Summary of structural features of 208 nucleotides Note: the first five columns are: (1) serial number, (2) one-letter shorthand name, (3) dbn, (4) id string, (5) rmsd (~zero) of base ring atoms fitted against those in a standard base reference frame. The sixth (last) column contains a comma-separated list of features whose meanings are mostly self-explanatory, except for: turn: angle C1'(i-1)--C1'(i)--C1'(i+1) < 90 degrees break: no backbone linkage between O3'(i-1) and P(i) 1 G . A.G0 --- ~C3'-endo,BI,non-stack,ss-non-loop 2 U ( A.U1 0.004 anti,~C3'-endo,canonical,non-pair-contact,helix-end,stem-end 3 G ( A.G2 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 4 A ( A.A3 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 5 A ( A.A4 0.009 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 6 A ( A.A5 0.011 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end 7 G . A.G6 0.012 anti,~C3'-endo,non-canonical,non-pair-contact,helix,multiplet,ss-non-loop,splayed-apart 8 U ( A.U7 0.007 anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,splayed-apart 9 G ( A.G8 0.008 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 10 U ( A.U9 0.009 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 11 A ( A.A10 0.009 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 12 C ( A.C11 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 13 C ( A.C12 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop 14 U . A.U13 0.006 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop 15 A . A.A14 0.009 anti,~C3'-endo,non-canonical,non-pair-contact,helix,internal-loop 16 G ( A.G15 0.010 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,internal-loop,A-minor,ribose-zipper 17 G ( A.G16 0.009 anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop,ribose-zipper 18 G . A.G17 0.016 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,internal-loop,A-minor,ribose-zipper 19 U . A.U18 0.007 anti,~C2'-endo,BII,non-canonical,non-pair-contact,multiplet,internal-loop,phosphate 20 U . A.U19 0.008 anti,~C3'-endo,BI,non-canonical,non-pair-contact,internal-loop,phosphate 21 C ( A.C20 0.008 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,internal-loop 22 C ( A.C21 0.011 anti,~C3'-endo,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,bulge 23 A ( A.A22 0.024 anti,~C3'-endo,BI,isolated-canonical,non-pair-contact,helix,bulge,phosphate 24 G ( A.G23 0.009 anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge 25 C ( A.C24 0.010 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 26 C ( A.C25 0.010 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 27 U ( A.U26 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 28 A ( A.A27 0.009 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop 29 U . A.U28 0.004 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,hairpin-loop,splayed-apart 30 U . A.U29 0.006 turn,anti,~C2'-endo,non-stack,non-pair-contact,hairpin-loop,phosphate,splayed-apart 31 U . A.U30 0.007 turn,syn,~C2'-endo,non-pair-contact,hairpin-loop,cap-donor 32 G . A.G31 0.007 turn,syn,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,hairpin-loop,cap-acceptor 33 U ) A.U32 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop 34 A ) A.A33 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 35 G ) A.G34 0.008 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 36 G ) A.G35 0.008 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 37 U ) A.U36 0.014 anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge 38 G . A.G37 0.019 turn,anti,~C2'-endo,BII,non-canonical,non-pair-contact,multiplet,bulge 39 U . A.U38 --- turn,non-stack,bulge 40 U ) A.U39 0.005 turn,anti,~C2'-endo,BII,isolated-canonical,non-pair-contact,helix,bulge,phosphate,splayed-apart 41 C . A.C40 0.005 turn,~C2'-endo,non-stack,bulge,splayed-apart 42 G ) A.G41 0.018 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,bulge,splayed-apart 43 G ) A.G42 0.021 anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,internal-loop 44 A . A.A43 0.014 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,internal-loop,A-minor 45 C ) A.C44 0.026 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop 46 C ) A.C45 0.022 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,internal-loop,A-minor,phosphate 47 G . A.G46 0.028 anti,~C3'-endo,non-canonical,non-pair-contact,helix,internal-loop 48 A . A.A47 0.020 anti,~C2'-endo,non-canonical,non-pair-contact,helix,internal-loop,phosphate 49 G . A.G48 0.007 turn,anti,~C3'-endo,non-canonical,non-pair-contact,helix-end,internal-loop,cap-acceptor,phosphate 50 C . A.C49 0.017 anti,~C3'-endo,non-pair-contact,internal-loop,cap-donor,phosphate,splayed-apart 51 G ) A.G50 0.015 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop,splayed-apart 52 G ) A.G51 0.017 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 53 U ) A.U52 0.007 anti,~C3'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack 54 A ) A.A53 0.007 anti,~C3'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack 55 C ) A.C54 0.009 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 56 A ) A.A55 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack 57 G ( A.G56 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack 58 G ( A.G57 0.011 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack 59 U ( A.U58 0.009 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack 60 A ( A.A59 0.003 anti,~C3'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack 61 U ( A.U60 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 62 A ( A.A61 0.008 anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack 63 U . A.U62 0.004 anti,~C3'-endo,non-pair-contact,ss-non-loop 64 U . A.U63 0.003 break,anti,~C3'-endo,non-pair-contact,ss-non-loop 65 A . A.A67 0.006 anti,~C3'-endo,non-pair-contact,ss-non-loop 66 U ) A.U68 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack 67 A ) A.A69 0.002 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 68 U ) A.U70 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 69 A ) A.A71 0.005 break,anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack 70 C ) A.C72 0.004 anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack 71 C ) A.C73 0.008 anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,splayed-apart 72 A . A.A74 0.009 anti,~C3'-endo,non-canonical,non-pair-contact,helix,multiplet,ss-non-loop,ribose-zipper,splayed-apart 73 C [ A.C75 0.003 pseudoknotted,anti,~C3'-endo,isolated-canonical,non-canonical,non-pair-contact,helix,multiplet,ribose-zipper 74 A . A.A76 0.008 anti,~C3'-endo,non-canonical,non-pair-contact,helix-end,ss-non-loop,cap-acceptor,splayed-apart 75 C ( A.C77 0.004 anti,~C3'-endo,BI,non-stack,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,phosphate,splayed-apart 76 C ( A.C78 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 77 U ( A.U79 0.007 anti,~C3'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack 78 U ( A.U80 0.009 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop 79 A . A.A81 0.008 anti,~C3'-endo,non-canonical,non-pair-contact,helix,internal-loop,cap-acceptor 80 G ( A.G82 0.006 anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop,cap-donor 81 G ( A.G83 0.017 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 82 G ( A.G84 0.008 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop 83 A . A.A85 0.015 anti,~C3'-endo,non-canonical,non-pair-contact,helix-end,multiplet,hairpin-loop 84 C . A.C86 --- ~C2'-endo,non-stack,hairpin-loop 85 A . A.A87 0.011 turn,anti,~C3'-endo,non-canonical,non-pair-contact,multiplet,hairpin-loop,A-minor 86 A . A.A88 0.006 anti,~C3'-endo,BI,non-pair-contact,hairpin-loop,ribose-zipper 87 A . A.A89 0.020 anti,~C3'-endo,non-canonical,non-pair-contact,hairpin-loop,ribose-zipper 88 A . A.A90 0.033 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,multiplet,hairpin-loop,A-minor,ribose-zipper,splayed-apart 89 G . A.G91 0.011 turn,anti,~C2'-endo,non-pair-contact,hairpin-loop,phosphate,splayed-apart 90 C ) A.C92 0.012 ~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop,phosphate,splayed-apart 91 C ) A.C93 0.010 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 92 C ) A.C94 0.005 anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop,phosphate 93 G . A.G95 0.010 anti,~C2'-endo,non-canonical,non-pair-contact,helix,internal-loop,splayed-apart 94 G ] A.G96 0.017 pseudoknotted,turn,anti,~C3'-endo,isolated-canonical,non-pair-contact,helix,multiplet,internal-loop,cap-donor,splayed-apart 95 G ) A.G97 0.009 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop,phosphate,splayed-apart 96 A ) A.A98 0.010 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 97 G ) A.G99 0.014 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 98 G ) A.G100 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack 99 A . A.A101 0.004 anti,~C3'-endo,BI,non-pair-contact,ss-non-loop 100 U . A.U102 0.007 anti,~C2'-endo,non-canonical,non-pair-contact,ss-non-loop 101 A . A.A103 0.010 anti,~C2'-endo,BII,non-stack,non-canonical,non-pair-contact,ss-non-loop,phosphate 102 G . A.G104 0.004 anti,~C3'-endo,BII,non-canonical,non-pair-contact,multiplet,ss-non-loop,ribose-zipper,phosphate 103 G . A.G105 0.003 anti,~C3'-endo,BI,non-canonical,non-pair-contact,multiplet,ss-non-loop,ribose-zipper 104 U ) A.U106 0.010 anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end 105 U ) A.U107 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 106 U ) A.U108 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 107 C ) A.C109 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 108 A ) A.A110 0.009 anti,~C3'-endo,canonical,non-pair-contact,helix-end,stem-end 109 G ( B.G0 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end 110 U ( B.U1 0.005 anti,~C3'-endo,canonical,non-pair-contact,helix,stem 111 G ( B.G2 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 112 A ( B.A3 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 113 A ( B.A4 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 114 A ( B.A5 0.010 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end 115 G . B.G6 0.012 anti,~C3'-endo,non-canonical,non-pair-contact,helix,multiplet,ss-non-loop,splayed-apart 116 U ( B.U7 0.004 anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,splayed-apart 117 G ( B.G8 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 118 U ( B.U9 0.008 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 119 A ( B.A10 0.009 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 120 C ( B.C11 0.002 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 121 C ( B.C12 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop,phosphate 122 U . B.U13 0.005 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop 123 A . B.A14 0.007 anti,~C3'-endo,non-canonical,non-pair-contact,helix,internal-loop,phosphate 124 G ( B.G15 0.009 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,internal-loop,A-minor,ribose-zipper 125 G ( B.G16 0.008 anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop,A-minor,ribose-zipper 126 G . B.G17 0.013 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,internal-loop,ribose-zipper 127 U . B.U18 0.005 anti,~C2'-endo,BII,non-canonical,non-pair-contact,multiplet,internal-loop,phosphate 128 U . B.U19 0.005 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop,phosphate 129 C ( B.C20 0.011 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,internal-loop 130 C ( B.C21 0.005 anti,~C3'-endo,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,bulge 131 A ( B.A22 0.022 anti,~C3'-endo,BI,isolated-canonical,non-pair-contact,helix,bulge 132 G ( B.G23 0.010 anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge 133 C ( B.C24 0.008 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 134 C ( B.C25 0.012 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 135 U ( B.U26 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 136 A ( B.A27 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack 137 U . B.U28 0.007 break,anti,~C3'-endo,non-pair-contact,ss-non-loop 138 G . B.G31 0.003 anti,~C3'-endo,BI,non-stack,non-pair-contact,ss-non-loop 139 U ) B.U32 0.005 anti,~C3'-endo,BI,non-stack,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack 140 A ) B.A33 0.008 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 141 G ) B.G34 0.012 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 142 G ) B.G35 0.009 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 143 U ) B.U36 0.009 anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge 144 G . B.G37 0.018 turn,anti,~C2'-endo,non-canonical,non-pair-contact,multiplet,bulge,splayed-apart 145 U . B.U38 0.006 turn,anti,~C2'-endo,non-stack,bulge,splayed-apart 146 U ) B.U39 0.006 turn,anti,~C2'-endo,isolated-canonical,non-pair-contact,helix,bulge,splayed-apart 147 C . B.C40 0.004 turn,syn,~C2'-endo,non-stack,bulge,splayed-apart 148 G ) B.G41 0.015 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,bulge,splayed-apart 149 G ) B.G42 0.023 anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,internal-loop 150 A . B.A43 0.027 syn,~C3'-endo,BI,non-canonical,non-pair-contact,multiplet,internal-loop 151 C ) B.C44 0.017 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop,A-minor 152 C ) B.C45 0.026 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,internal-loop,A-minor,phosphate 153 G . B.G46 0.016 anti,~C3'-endo,non-canonical,non-pair-contact,helix,internal-loop 154 A . B.A47 0.013 anti,~C2'-endo,non-canonical,non-pair-contact,helix,internal-loop,phosphate 155 G . B.G48 0.010 turn,anti,~C3'-endo,non-canonical,non-pair-contact,helix-end,internal-loop,cap-acceptor,phosphate 156 C . B.C49 0.015 anti,~C3'-endo,non-pair-contact,internal-loop,cap-donor,phosphate,splayed-apart 157 G ) B.G50 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop,splayed-apart 158 G ) B.G51 0.012 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 159 U ) B.U52 0.006 anti,~C3'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack 160 A ) B.A53 0.006 anti,~C3'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack 161 C ) B.C54 0.008 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 162 A ) B.A55 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack 163 G ( B.G56 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack 164 G ( B.G57 0.008 anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack 165 U . B.U58 0.006 anti,~C3'-endo,BI,non-pair-contact,ss-non-loop 166 A . B.A59 0.003 anti,~C3'-endo,BI,non-pair-contact,ss-non-loop 167 U . B.U60 0.005 anti,~C3'-endo,BI,non-pair-contact,ss-non-loop 168 A . B.A61 0.005 break,anti,~C3'-endo,non-pair-contact,ss-non-loop 169 C ) B.C72 0.005 anti,~C3'-endo,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack 170 C ) B.C73 0.008 anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,splayed-apart 171 A . B.A74 0.005 anti,~C3'-endo,non-canonical,non-pair-contact,helix,multiplet,ss-non-loop,ribose-zipper,splayed-apart 172 C [ B.C75 0.004 pseudoknotted,anti,~C3'-endo,BI,isolated-canonical,non-canonical,non-pair-contact,helix,multiplet,ribose-zipper 173 A . B.A76 0.009 anti,~C3'-endo,non-canonical,non-pair-contact,helix-end,ss-non-loop,cap-acceptor,splayed-apart 174 C ( B.C77 0.004 anti,~C3'-endo,BI,non-stack,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,phosphate,splayed-apart 175 C ( B.C78 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 176 U ( B.U79 0.004 anti,~C3'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack 177 U ( B.U80 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop 178 A . B.A81 0.006 anti,~C3'-endo,non-canonical,non-pair-contact,helix,internal-loop,cap-acceptor 179 G ( B.G82 0.004 anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop,cap-donor 180 G ( B.G83 0.012 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 181 G ( B.G84 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop 182 A . B.A85 0.007 anti,~C3'-endo,non-canonical,non-pair-contact,helix,multiplet,hairpin-loop 183 C . B.C86 0.007 anti,~C3'-endo,non-canonical,non-pair-contact,helix-end,multiplet,hairpin-loop,phosphate 184 A . B.A87 0.012 turn,anti,~C3'-endo,non-canonical,non-pair-contact,multiplet,hairpin-loop,A-minor 185 A . B.A88 0.009 anti,~C3'-endo,BI,non-pair-contact,hairpin-loop,ribose-zipper 186 A . B.A89 0.019 anti,~C3'-endo,non-canonical,non-pair-contact,helix-end,multiplet,hairpin-loop,ribose-zipper,phosphate 187 A . B.A90 0.016 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,hairpin-loop,A-minor,ribose-zipper,splayed-apart 188 G . B.G91 0.003 turn,anti,~C2'-endo,non-pair-contact,hairpin-loop,phosphate,splayed-apart 189 C ) B.C92 0.016 ~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop,phosphate,splayed-apart 190 C ) B.C93 0.011 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 191 C ) B.C94 0.007 anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop,phosphate 192 G . B.G95 0.007 anti,~C2'-endo,non-canonical,non-pair-contact,helix,internal-loop,splayed-apart 193 G ] B.G96 0.017 pseudoknotted,turn,anti,~C3'-endo,isolated-canonical,non-pair-contact,helix,multiplet,internal-loop,cap-donor,splayed-apart 194 G ) B.G97 0.009 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop,phosphate,splayed-apart 195 A ) B.A98 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 196 G ) B.G99 0.012 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 197 G ) B.G100 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack 198 A . B.A101 0.003 anti,~C3'-endo,BI,non-pair-contact,ss-non-loop 199 U . B.U102 0.007 anti,~C2'-endo,non-canonical,non-pair-contact,ss-non-loop 200 A . B.A103 0.009 anti,~C2'-endo,BII,non-stack,non-canonical,non-pair-contact,ss-non-loop 201 G . B.G104 0.004 anti,~C3'-endo,BII,non-canonical,non-pair-contact,multiplet,ss-non-loop,ribose-zipper 202 G . B.G105 0.003 anti,~C3'-endo,BI,non-canonical,non-pair-contact,multiplet,ss-non-loop,ribose-zipper 203 U ) B.U106 0.011 anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end 204 U ) B.U107 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 205 U ) B.U108 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 206 C ) B.C109 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 207 A ) B.A110 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 208 C ) B.C111 0.006 anti,~C3'-endo,canonical,non-pair-contact,helix-end,stem-end **************************************************************************** List of 19 additional files 1 dssr-pairs.pdb -- an ensemble of base pairs 2 dssr-multiplets.pdb -- an ensemble of multiplets 3 dssr-stems.pdb -- an ensemble of stems 4 dssr-helices.pdb -- an ensemble of helices (coaxial stacking) 5 dssr-hairpins.pdb -- an ensemble of hairpin loops 6 dssr-bulges.pdb -- an ensemble of bulges 7 dssr-iloops.pdb -- an ensemble of internal loops 8 dssr-2ndstrs.bpseq -- secondary structure in bpseq format 9 dssr-2ndstrs.ct -- secondary structure in connectivity table format 10 dssr-2ndstrs.dbn -- secondary structure in dot-bracket notation 11 dssr-torsions.txt -- backbone torsion angles and suite names 12 dssr-splays.pdb -- an ensemble of splayed-apart units 13 dssr-Aminors.pdb -- an ensemble of A minor motifs (types I and II) 14 dssr-stacks.pdb -- an ensemble of base stacks 15 dssr-atom2bases.pdb -- an ensemble of atom-base stacking interactions 16 dssr-rotmat.txt -- position vector and rotation matrix 17 dssr-viewV.pdb -- vertical view of the principal moment of inertia 18 dssr-viewH.pdb -- horizontal view of the principal moment of inertia 19 dssr-viewT.pdb -- top view of the principal moment of inertia