{ "num_pairs": 20, "pairs": [ { "index": 1, "nt1": "///P/1", "nt2": "///V/21", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -107.635, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 57.608, "chi2": -102.813, "conf2": "anti", "pucker2": "----", "lambda2": 55.194, "C1C1_dist": 11.011, "N1N9_dist": 9.364, "C6C8_dist": 10.385, "CNNC_torsion": -6.647, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[3.57],N1(imino)-N3[3.38],N2(amino)-O2(carbonyl)[3.09]", "interBase_angle": 20.922, "planarity": 0.228, "simple_Shear": 0.043, "simple_Stretch": 0.475, "simple_Buckle": -17.648, "simple_Propeller": -11.238, "bp_simpleParams": [ 0.043, 0.475, -0.362, -17.648, -11.238, 5.086 ], "bp_params": [ 0.051, 0.474, -0.362, -17.863, -10.893, 5.048 ], "frame": { "rmsd": null, "origin": [ 1.285, -49.912, 34.128 ], "x_axis": [ -0.592, 0.734, 0.331 ], "y_axis": [ 0.674, 0.677, -0.296 ], "z_axis": [ -0.441, 0.048, -0.896 ], "quaternion": [ -0.217, 0.396, 0.890, -0.070 ] } }, { "index": 2, "nt1": "///P/2", "nt2": "///V/20", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -128.792, "conf1": "anti", "pucker1": "----", "lambda1": 53.055, "chi2": -119.813, "conf2": "anti", "pucker2": "----", "lambda2": 53.323, "C1C1_dist": 10.685, "N1N9_dist": 8.911, "C6C8_dist": 9.803, "CNNC_torsion": -17.941, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.76],N3-N1(imino)[2.86],N4(amino)-O6(carbonyl)[2.88]", "interBase_angle": 13.003, "planarity": 0.205, "simple_Shear": 0.055, "simple_Stretch": -0.226, "simple_Buckle": -9.465, "simple_Propeller": -8.917, "bp_simpleParams": [ 0.055, -0.226, 0.806, -9.465, -8.917, -2.291 ], "bp_params": [ 0.054, -0.226, 0.806, -9.505, -8.873, -2.290 ], "frame": { "rmsd": null, "origin": [ 0.194, -49.999, 30.978 ], "x_axis": [ -0.136, 0.961, 0.240 ], "y_axis": [ 0.942, 0.200, -0.269 ], "z_axis": [ -0.307, 0.189, -0.933 ], "quaternion": [ -0.181, 0.632, 0.753, -0.027 ] } }, { "index": 3, "nt1": "///P/3", "nt2": "///V/19", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -124.084, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 49.709, "chi2": -94.529, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 56.772, "C1C1_dist": 10.725, "N1N9_dist": 8.965, "C6C8_dist": 9.903, "CNNC_torsion": -10.220, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.89],O4(carbonyl)-N6(amino)[3.01]", "interBase_angle": 9.056, "planarity": 0.145, "simple_Shear": -0.524, "simple_Stretch": -0.046, "simple_Buckle": 1.317, "simple_Propeller": -8.960, "bp_simpleParams": [ -0.524, -0.046, 0.329, 1.317, -8.960, -1.526 ], "bp_params": [ -0.520, -0.075, 0.329, 1.824, -8.871, -1.530 ], "frame": { "rmsd": null, "origin": [ -1.148, -49.776, 28.333 ], "x_axis": [ 0.326, 0.941, 0.092 ], "y_axis": [ 0.891, -0.273, -0.364 ], "z_axis": [ -0.317, 0.200, -0.927 ], "quaternion": [ -0.177, 0.795, 0.576, -0.071 ] } }, { "index": 4, "nt1": "///P/4", "nt2": "///V/18", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -96.001, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.649, "chi2": -106.985, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.706, "C1C1_dist": 10.839, "N1N9_dist": 9.099, "C6C8_dist": 10.033, "CNNC_torsion": -8.039, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[3.10],N1(imino)-N3[3.07],N2(amino)-O2(carbonyl)[3.00]", "interBase_angle": 16.360, "planarity": 0.238, "simple_Shear": -0.122, "simple_Stretch": 0.076, "simple_Buckle": 13.340, "simple_Propeller": -9.471, "bp_simpleParams": [ -0.122, 0.076, 0.054, 13.340, -9.471, 0.396 ], "bp_params": [ -0.123, 0.075, 0.054, 13.465, -9.292, 0.395 ], "frame": { "rmsd": null, "origin": [ -1.640, -48.877, 25.432 ], "x_axis": [ 0.816, 0.578, 0.000 ], "y_axis": [ 0.524, -0.740, -0.422 ], "z_axis": [ -0.244, 0.345, -0.906 ], "quaternion": [ -0.206, 0.930, 0.296, -0.065 ] } }, { "index": 5, "nt1": "///P/5", "nt2": "///V/17", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -101.099, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 54.370, "chi2": -108.796, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 51.704, "C1C1_dist": 10.794, "N1N9_dist": 9.014, "C6C8_dist": 9.954, "CNNC_torsion": -9.116, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.12],N1-N3(imino)[3.05]", "interBase_angle": 20.605, "planarity": 0.299, "simple_Shear": 0.283, "simple_Stretch": -0.018, "simple_Buckle": 3.613, "simple_Propeller": -20.286, "bp_simpleParams": [ 0.283, -0.018, -0.712, 3.613, -20.286, 1.927 ], "bp_params": [ 0.283, -0.027, -0.712, 2.940, -20.395, 1.958 ], "frame": { "rmsd": null, "origin": [ -2.809, -47.728, 22.184 ], "x_axis": [ 0.970, -0.043, -0.239 ], "y_axis": [ -0.142, -0.899, -0.415 ], "z_axis": [ -0.197, 0.437, -0.878 ], "quaternion": [ -0.220, 0.968, -0.048, -0.113 ] } }, { "index": 6, "nt1": "///P/6", "nt2": "///V/16", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -93.552, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 56.343, "chi2": -145.830, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 56.391, "C1C1_dist": 10.417, "N1N9_dist": 8.782, "C6C8_dist": 9.839, "CNNC_torsion": -10.711, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.87],O4(carbonyl)-N6(amino)[3.21]", "interBase_angle": 22.562, "planarity": 0.294, "simple_Shear": 0.149, "simple_Stretch": -0.065, "simple_Buckle": 11.242, "simple_Propeller": -19.562, "bp_simpleParams": [ 0.149, -0.065, -0.424, 11.242, -19.562, 6.067 ], "bp_params": [ 0.149, -0.066, -0.424, 11.150, -19.615, 6.129 ], "frame": { "rmsd": null, "origin": [ -2.574, -46.422, 19.398 ], "x_axis": [ 0.799, -0.539, -0.265 ], "y_axis": [ -0.597, -0.761, -0.252 ], "z_axis": [ -0.066, 0.360, -0.931 ], "quaternion": [ -0.164, 0.934, -0.304, -0.089 ] } }, { "index": 7, "nt1": "///P/7", "nt2": "///V/15", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -103.143, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 54.152, "chi2": -114.134, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 54.446, "C1C1_dist": 10.763, "N1N9_dist": 9.046, "C6C8_dist": 9.981, "CNNC_torsion": 0.743, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[3.07],N1(imino)-N3[3.04],N2(amino)-O2(carbonyl)[2.91]", "interBase_angle": 17.811, "planarity": 0.195, "simple_Shear": -0.149, "simple_Stretch": 0.014, "simple_Buckle": -14.551, "simple_Propeller": -10.271, "bp_simpleParams": [ -0.149, 0.014, -0.693, -14.551, -10.271, 1.779 ], "bp_params": [ -0.149, 0.013, -0.693, -14.520, -10.315, 1.772 ], "frame": { "rmsd": null, "origin": [ -2.502, -45.444, 15.662 ], "x_axis": [ 0.271, -0.952, -0.141 ], "y_axis": [ -0.957, -0.251, -0.148 ], "z_axis": [ 0.105, 0.175, -0.979 ], "quaternion": [ -0.102, 0.791, -0.604, -0.011 ] } }, { "index": 8, "nt1": "///P/8", "nt2": "///V/14", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -107.556, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 51.270, "chi2": -98.308, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 54.601, "C1C1_dist": 10.798, "N1N9_dist": 9.028, "C6C8_dist": 9.948, "CNNC_torsion": -4.024, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.84],N3-N1(imino)[2.92],N4(amino)-O6(carbonyl)[2.91]", "interBase_angle": 7.271, "planarity": 0.100, "simple_Shear": -0.122, "simple_Stretch": -0.077, "simple_Buckle": 0.566, "simple_Propeller": -7.249, "bp_simpleParams": [ -0.122, -0.077, -0.182, 0.566, -7.249, -0.344 ], "bp_params": [ -0.121, -0.079, -0.182, 0.687, -7.239, -0.344 ], "frame": { "rmsd": null, "origin": [ -1.906, -44.903, 12.957 ], "x_axis": [ -0.199, -0.974, -0.111 ], "y_axis": [ -0.977, 0.206, -0.060 ], "z_axis": [ 0.082, 0.096, -0.992 ], "quaternion": [ 0.062, -0.630, 0.774, 0.012 ] } }, { "index": 9, "nt1": "///P/9", "nt2": "///V/13", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -114.607, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 55.786, "chi2": -141.727, "conf2": "anti", "pucker2": "----", "lambda2": 53.778, "C1C1_dist": 10.691, "N1N9_dist": 8.986, "C6C8_dist": 9.976, "CNNC_torsion": -10.017, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[3.07],N1(imino)-N3[2.94],N2(amino)-O2(carbonyl)[2.78]", "interBase_angle": 13.720, "planarity": 0.196, "simple_Shear": 0.018, "simple_Stretch": -0.026, "simple_Buckle": 7.261, "simple_Propeller": -11.642, "bp_simpleParams": [ 0.018, -0.026, 0.065, 7.261, -11.642, 2.804 ], "bp_params": [ 0.018, -0.026, 0.065, 7.213, -11.671, 2.813 ], "frame": { "rmsd": null, "origin": [ -2.544, -44.916, 9.675 ], "x_axis": [ -0.697, -0.710, 0.101 ], "y_axis": [ -0.715, 0.699, -0.016 ], "z_axis": [ -0.060, -0.084, -0.995 ], "quaternion": [ -0.044, -0.387, 0.921, -0.027 ] } }, { "index": 10, "nt1": "///P/10", "nt2": "///V/12", "bp": "C-T", "name": "--", "Saenger": "--", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -110.358, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 70.324, "chi2": -115.176, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 42.474, "C1C1_dist": 9.207, "N1N9_dist": 7.606, "C6C8_dist": 8.747, "CNNC_torsion": -18.855, "hbonds_num": 2, "hbonds_desc": "O2(carbonyl)-N3(imino)[3.34],N3*O4(carbonyl)[2.98]", "unusual_base2base_hbonds": 1, "interBase_angle": 16.598, "planarity": 0.217, "simple_Shear": 2.722, "simple_Stretch": -0.945, "simple_Buckle": 14.999, "simple_Propeller": -7.107, "bp_simpleParams": [ 2.722, -0.945, 0.457, 14.999, -7.107, 4.957 ], "bp_params": [ 2.373, -1.635, 0.457, 12.591, -10.814, 4.949 ], "frame": { "rmsd": null, "origin": [ -3.080, -45.408, 6.570 ], "x_axis": [ -0.982, -0.082, 0.169 ], "y_axis": [ -0.095, 0.993, -0.075 ], "z_axis": [ -0.162, -0.090, -0.983 ], "quaternion": [ -0.083, -0.044, 0.995, -0.041 ] } }, { "index": 11, "nt1": "///P/12", "nt2": "///V/10", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -80.771, "conf1": "--", "pucker1": "~C2'-endo", "lambda1": 53.563, "chi2": -92.417, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.858, "C1C1_dist": 10.419, "N1N9_dist": 8.672, "C6C8_dist": 9.607, "CNNC_torsion": 2.039, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.46],N3-N1(imino)[2.62],N4(amino)-O6(carbonyl)[2.66]", "interBase_angle": 6.414, "planarity": 0.079, "simple_Shear": 0.136, "simple_Stretch": -0.404, "simple_Buckle": 6.288, "simple_Propeller": -1.267, "bp_simpleParams": [ 0.136, -0.404, -0.358, 6.288, -1.267, 0.701 ], "bp_params": [ 0.133, -0.406, -0.358, 6.277, -1.319, 0.700 ], "frame": { "rmsd": null, "origin": [ -8.521, -48.063, -0.094 ], "x_axis": [ -0.811, 0.540, 0.224 ], "y_axis": [ 0.347, 0.753, -0.559 ], "z_axis": [ -0.470, -0.376, -0.799 ], "quaternion": [ -0.189, 0.242, 0.917, -0.255 ] } }, { "index": 12, "nt1": "///P/13", "nt2": "///V/9", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -90.771, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 54.798, "chi2": -95.514, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 50.292, "C1C1_dist": 10.614, "N1N9_dist": 8.827, "C6C8_dist": 9.728, "CNNC_torsion": -12.402, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.69],N1(imino)-N3[2.69],N2(amino)-O2(carbonyl)[2.66]", "interBase_angle": 11.942, "planarity": 0.152, "simple_Shear": 0.257, "simple_Stretch": -0.295, "simple_Buckle": -0.289, "simple_Propeller": -11.938, "bp_simpleParams": [ 0.257, -0.295, 0.067, -0.289, -11.938, -1.295 ], "bp_params": [ 0.248, -0.303, 0.067, -0.651, -11.924, -1.302 ], "frame": { "rmsd": null, "origin": [ -8.700, -48.587, -4.222 ], "x_axis": [ -0.354, 0.908, -0.223 ], "y_axis": [ 0.840, 0.204, -0.503 ], "z_axis": [ -0.412, -0.365, -0.835 ], "quaternion": [ -0.061, 0.565, 0.773, -0.281 ] } }, { "index": 13, "nt1": "///P/14", "nt2": "///V/8", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -107.677, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 55.715, "chi2": -117.216, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 49.449, "C1C1_dist": 10.633, "N1N9_dist": 8.841, "C6C8_dist": 9.741, "CNNC_torsion": -14.538, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.84],N1-N3(imino)[2.76]", "interBase_angle": 10.613, "planarity": 0.156, "simple_Shear": 0.555, "simple_Stretch": -0.199, "simple_Buckle": 6.208, "simple_Propeller": -8.608, "bp_simpleParams": [ 0.555, -0.199, 0.522, 6.208, -8.608, -3.082 ], "bp_params": [ 0.543, -0.231, 0.522, 5.697, -8.954, -3.088 ], "frame": { "rmsd": null, "origin": [ -9.715, -49.768, -6.864 ], "x_axis": [ 0.255, 0.876, -0.409 ], "y_axis": [ 0.917, -0.354, -0.185 ], "z_axis": [ -0.307, -0.328, -0.894 ], "quaternion": [ 0.045, 0.791, 0.567, -0.226 ] } }, { "index": 14, "nt1": "///P/15", "nt2": "///V/7", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -123.798, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 55.484, "chi2": -109.873, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.996, "C1C1_dist": 10.725, "N1N9_dist": 9.026, "C6C8_dist": 10.033, "CNNC_torsion": -9.467, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.68],N3-N1(imino)[2.99],N4(amino)-O6(carbonyl)[3.19]", "interBase_angle": 8.530, "planarity": 0.123, "simple_Shear": 0.109, "simple_Stretch": 0.009, "simple_Buckle": -1.363, "simple_Propeller": -8.420, "bp_simpleParams": [ 0.109, 0.009, 0.347, -1.363, -8.420, 3.754 ], "bp_params": [ 0.110, 0.009, 0.347, -1.410, -8.412, 3.764 ], "frame": { "rmsd": null, "origin": [ -11.091, -49.867, -10.303 ], "x_axis": [ 0.665, 0.577, -0.474 ], "y_axis": [ 0.656, -0.754, 0.004 ], "z_axis": [ -0.356, -0.314, -0.880 ], "quaternion": [ 0.087, 0.908, 0.339, -0.228 ] } }, { "index": 15, "nt1": "///P/16", "nt2": "///V/6", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -104.788, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 55.912, "chi2": -132.742, "conf2": "anti", "pucker2": "----", "lambda2": 55.876, "C1C1_dist": 10.493, "N1N9_dist": 8.846, "C6C8_dist": 9.887, "CNNC_torsion": -14.470, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[3.13],N1(imino)-N3[2.85],N2(amino)-O2(carbonyl)[2.54]", "interBase_angle": 14.457, "planarity": 0.198, "simple_Shear": -0.088, "simple_Stretch": -0.120, "simple_Buckle": 8.350, "simple_Propeller": -11.802, "bp_simpleParams": [ -0.088, -0.120, 0.582, 8.350, -11.802, 4.493 ], "bp_params": [ -0.087, -0.120, 0.582, 8.431, -11.745, 4.505 ], "frame": { "rmsd": null, "origin": [ -11.867, -51.117, -12.995 ], "x_axis": [ 0.948, 0.042, -0.316 ], "y_axis": [ 0.134, -0.952, 0.275 ], "z_axis": [ -0.289, -0.303, -0.908 ], "quaternion": [ 0.148, 0.976, 0.045, -0.155 ] } }, { "index": 16, "nt1": "///P/17", "nt2": "///V/5", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -120.307, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 56.559, "chi2": -104.901, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 56.083, "C1C1_dist": 10.541, "N1N9_dist": 8.907, "C6C8_dist": 9.964, "CNNC_torsion": -12.086, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[3.15],N1(imino)-N3[2.90],N2(amino)-O2(carbonyl)[2.61]", "interBase_angle": 11.927, "planarity": 0.157, "simple_Shear": -0.193, "simple_Stretch": -0.056, "simple_Buckle": 1.450, "simple_Propeller": -11.839, "bp_simpleParams": [ -0.193, -0.056, 0.243, 1.450, -11.839, 5.094 ], "bp_params": [ -0.192, -0.059, 0.243, 1.626, -11.816, 5.121 ], "frame": { "rmsd": null, "origin": [ -12.623, -51.907, -16.269 ], "x_axis": [ 0.887, -0.459, -0.043 ], "y_axis": [ -0.417, -0.839, 0.349 ], "z_axis": [ -0.196, -0.292, -0.936 ], "quaternion": [ 0.167, 0.957, -0.229, -0.062 ] } }, { "index": 17, "nt1": "///P/18", "nt2": "///V/4", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -111.828, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 54.341, "chi2": -120.970, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 56.530, "C1C1_dist": 10.509, "N1N9_dist": 8.843, "C6C8_dist": 9.873, "CNNC_torsion": -9.031, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.17],N1-N3(imino)[2.89]", "interBase_angle": 7.346, "planarity": 0.118, "simple_Shear": -0.229, "simple_Stretch": -0.079, "simple_Buckle": -2.796, "simple_Propeller": -6.793, "bp_simpleParams": [ -0.229, -0.079, 0.239, -2.796, -6.793, 3.108 ], "bp_params": [ -0.228, -0.083, 0.239, -2.676, -6.841, 3.113 ], "frame": { "rmsd": null, "origin": [ -13.330, -52.528, -19.409 ], "x_axis": [ 0.450, -0.847, 0.282 ], "y_axis": [ -0.878, -0.360, 0.317 ], "z_axis": [ -0.167, -0.390, -0.906 ], "quaternion": [ 0.214, 0.824, -0.523, 0.035 ] } }, { "index": 18, "nt1": "///P/19", "nt2": "///V/3", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -107.647, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.457, "chi2": -112.992, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.462, "C1C1_dist": 10.584, "N1N9_dist": 8.820, "C6C8_dist": 9.772, "CNNC_torsion": -14.296, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.79],O4(carbonyl)-N6(amino)[2.95]", "interBase_angle": 14.069, "planarity": 0.181, "simple_Shear": 0.059, "simple_Stretch": -0.190, "simple_Buckle": -2.746, "simple_Propeller": -13.798, "bp_simpleParams": [ 0.059, -0.190, 0.197, -2.746, -13.798, -0.600 ], "bp_params": [ 0.058, -0.190, 0.197, -2.775, -13.792, -0.604 ], "frame": { "rmsd": null, "origin": [ -13.666, -53.007, -22.780 ], "x_axis": [ -0.129, -0.907, 0.400 ], "y_axis": [ -0.974, 0.192, 0.123 ], "z_axis": [ -0.188, -0.374, -0.908 ], "quaternion": [ -0.197, -0.630, 0.747, -0.084 ] } }, { "index": 19, "nt1": "///P/20", "nt2": "///V/2", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -98.494, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.454, "chi2": -104.825, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 50.872, "C1C1_dist": 10.726, "N1N9_dist": 8.929, "C6C8_dist": 9.815, "CNNC_torsion": -15.472, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.94],N3-N1(imino)[2.88],N4(amino)-O6(carbonyl)[2.86]", "interBase_angle": 17.377, "planarity": 0.220, "simple_Shear": 0.412, "simple_Stretch": -0.203, "simple_Buckle": 1.020, "simple_Propeller": -17.347, "bp_simpleParams": [ 0.412, -0.203, -0.023, 1.020, -17.347, -1.605 ], "bp_params": [ 0.405, -0.218, -0.023, 0.379, -17.373, -1.623 ], "frame": { "rmsd": null, "origin": [ -13.959, -54.136, -25.720 ], "x_axis": [ -0.678, -0.640, 0.361 ], "y_axis": [ -0.722, 0.673, -0.161 ], "z_axis": [ -0.140, -0.370, -0.918 ], "quaternion": [ -0.139, -0.377, 0.904, -0.147 ] } }, { "index": 20, "nt1": "///P/21", "nt2": "///V/1", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -88.301, "conf1": "--", "pucker1": "~C2'-endo", "lambda1": 60.769, "chi2": -90.651, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 59.306, "C1C1_dist": 10.073, "N1N9_dist": 8.598, "C6C8_dist": 9.748, "CNNC_torsion": 7.993, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.27],N3-N1(imino)[2.82],N4(amino)-O6(carbonyl)[3.24]", "interBase_angle": 18.439, "planarity": 0.229, "simple_Shear": 0.268, "simple_Stretch": -0.168, "simple_Buckle": 18.406, "simple_Propeller": -1.108, "bp_simpleParams": [ 0.268, -0.168, -1.107, 18.406, -1.108, 11.111 ], "bp_params": [ 0.265, -0.173, -1.107, 18.379, -1.480, 10.970 ], "frame": { "rmsd": null, "origin": [ -16.600, -54.655, -28.452 ], "x_axis": [ -0.976, -0.143, 0.162 ], "y_axis": [ -0.207, 0.832, -0.515 ], "z_axis": [ -0.061, -0.537, -0.842 ], "quaternion": [ -0.058, -0.092, 0.955, -0.275 ] } } ], "num_helices": 1, "helices": [ { "index": 1, "num_stems": 2, "strand1": "GCTGATGCGCCGACGGATCC", "strand2": "CGACTACGCTGCTGCCTAGG", "bp_type": "|||||||||.||||||||||", "helix_form": "BBBB.BBB.x.BBBBBBB.", "helical_rise": 3.402, "helical_rise_std": 1.210, "helical_radius": 10.001, "helical_radius_std": 3.267, "helical_axis": [ -0.106, 0.075, -0.992 ], "point1": [ -3.319, -50.321, 34.797 ], "point2": [ -10.176, -45.446, -29.334 ], "num_pairs": 20, "pairs": [ { "index": 1, "nt1": "///P/1", "nt2": "///V/21", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.051, 0.474, -0.362, -17.863, -10.893, 5.048 ], "step_params": [ -0.514, -0.058, 3.294, -10.798, 3.601, 29.934 ], "heli_params": [ -0.780, -1.091, 3.251, 6.676, 20.016, 31.979 ], "bp2_params": [ 0.054, -0.226, 0.806, -9.505, -8.873, -2.290 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.294, "simple_Twist": 30.301, "simple_hRise": 3.254, "simple_hTwist": 32.322 }, { "index": 2, "nt1": "///P/2", "nt2": "///V/20", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.054, -0.226, 0.806, -9.505, -8.873, -2.290 ], "step_params": [ -0.369, -0.417, 2.921, 0.687, 0.624, 28.098 ], "heli_params": [ -0.988, 0.903, 2.902, 1.285, -1.415, 28.113 ], "bp2_params": [ -0.520, -0.075, 0.329, 1.824, -8.871, -1.530 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.921, "simple_Twist": 31.427, "simple_hRise": 2.904, "simple_hTwist": 31.441 }, { "index": 3, "nt1": "///P/3", "nt2": "///V/19", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.520, -0.075, 0.329, 1.824, -8.871, -1.530 ], "step_params": [ 0.266, 0.277, 3.053, 1.764, 9.221, 34.778 ], "heli_params": [ -0.796, -0.193, 3.035, 15.089, -2.886, 35.985 ], "bp2_params": [ -0.123, 0.075, 0.054, 13.465, -9.292, 0.395 ], "groove_widths": [ 14.256, null, 16.996, null ], "simple_Rise": 3.053, "simple_Twist": 33.005, "simple_hRise": 3.029, "simple_hTwist": 34.278 }, { "index": 4, "nt1": "///P/4", "nt2": "///V/18", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.123, 0.075, 0.054, 13.465, -9.292, 0.395 ], "step_params": [ -0.427, 0.165, 3.609, 4.777, 3.836, 39.751 ], "heli_params": [ -0.239, 1.217, 3.536, 5.600, -6.975, 40.201 ], "bp2_params": [ 0.283, -0.027, -0.712, 2.940, -20.395, 1.958 ], "groove_widths": [ 12.988, 12.717, 15.369, 14.927 ], "simple_Rise": 3.609, "simple_Twist": 37.033, "simple_hRise": 3.527, "simple_hTwist": 37.519 }, { "index": 5, "nt1": "///P/5", "nt2": "///V/17", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.283, -0.027, -0.712, 2.940, -20.395, 1.958 ], "step_params": [ 0.563, -0.311, 3.018, -1.966, 9.021, 29.176 ], "heli_params": [ -2.208, -1.421, 2.758, 17.368, 3.786, 30.571 ], "bp2_params": [ 0.149, -0.066, -0.424, 11.150, -19.615, 6.129 ], "groove_widths": [ 12.895, 12.580, 16.810, 16.213 ], "simple_Rise": 3.018, "simple_Twist": 30.779, "simple_hRise": 2.778, "simple_hTwist": 32.102 }, { "index": 6, "nt1": "///P/6", "nt2": "///V/16", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.149, -0.066, -0.424, 11.150, -19.615, 6.129 ], "step_params": [ 0.052, 0.042, 3.862, 1.825, 14.609, 37.180 ], "heli_params": [ -1.942, 0.175, 3.626, 21.890, -2.734, 39.893 ], "bp2_params": [ -0.149, 0.013, -0.693, -14.520, -10.315, 1.772 ], "groove_widths": [ 14.157, 13.864, 16.525, 15.666 ], "simple_Rise": 3.862, "simple_Twist": 37.772, "simple_hRise": 3.634, "simple_hTwist": 40.442 }, { "index": 7, "nt1": "///P/7", "nt2": "///V/15", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.149, 0.013, -0.693, -14.520, -10.315, 1.772 ], "step_params": [ -0.154, -0.342, 2.797, -1.519, 4.519, 26.905 ], "heli_params": [ -1.678, 0.006, 2.709, 9.616, 3.231, 27.316 ], "bp2_params": [ -0.121, -0.079, -0.182, 0.687, -7.239, -0.344 ], "groove_widths": [ 15.529, 14.870, 18.881, 17.651 ], "simple_Rise": 2.797, "simple_Twist": 26.961, "simple_hRise": 2.709, "simple_hTwist": 27.372 }, { "index": 8, "nt1": "///P/8", "nt2": "///V/14", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.121, -0.079, -0.182, 0.687, -7.239, -0.344 ], "step_params": [ 0.348, 0.579, 3.275, -2.294, 12.945, 32.628 ], "heli_params": [ -1.045, -0.931, 3.235, 21.963, 3.892, 35.110 ], "bp2_params": [ 0.018, -0.026, 0.065, 7.213, -11.671, 2.813 ], "groove_widths": [ 17.256, 15.275, 16.594, 15.173 ], "simple_Rise": 3.275, "simple_Twist": 32.201, "simple_hRise": 3.232, "simple_hTwist": 34.715 }, { "index": 9, "nt1": "///P/9", "nt2": "///V/13", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.018, -0.026, 0.065, 7.213, -11.671, 2.813 ], "step_params": [ 0.262, -0.117, 3.176, -2.184, 5.481, 40.246 ], "heli_params": [ -0.757, -0.612, 3.116, 7.913, 3.154, 40.659 ], "bp2_params": [ 2.373, -1.635, 0.457, 12.591, -10.814, 4.949 ], "groove_widths": [ 19.242, 16.380, 17.521, 17.497 ], "simple_Rise": 3.176, "simple_Twist": 25.121, "simple_hRise": 3.048, "simple_hTwist": 25.794 }, { "index": 10, "nt1": "///P/10", "nt2": "///V/12", "bp": "C-T", "name": "--", "Saenger": "--", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 2.373, -1.635, 0.457, 12.591, -10.814, 4.949 ], "step_params": [ 2.644, -1.353, 8.499, 21.617, 15.416, 35.256 ], "heli_params": [ -5.880, 2.167, 7.689, 22.018, -30.874, 43.880 ], "bp2_params": [ 0.133, -0.406, -0.358, 6.277, -1.319, 0.700 ], "groove_widths": [ 17.675, 15.265, 20.423, 20.422 ], "simple_Rise": 8.499, "simple_Twist": 49.417, "simple_hRise": 8.215, "simple_hTwist": 55.700 }, { "index": 11, "nt1": "///P/12", "nt2": "///V/10", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.133, -0.406, -0.358, 6.277, -1.319, 0.700 ], "step_params": [ -0.252, 1.996, 3.647, -3.650, -1.636, 43.293 ], "heli_params": [ 2.870, -0.050, 3.582, -2.212, 4.935, 43.469 ], "bp2_params": [ 0.248, -0.303, 0.067, -0.651, -11.924, -1.302 ], "groove_widths": [ 15.143, 13.290, 22.274, 21.697 ], "simple_Rise": 3.647, "simple_Twist": 42.870, "simple_hRise": 3.581, "simple_hTwist": 43.048 }, { "index": 12, "nt1": "///P/13", "nt2": "///V/9", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.248, -0.303, 0.067, -0.651, -11.924, -1.302 ], "step_params": [ -0.119, 0.087, 3.062, -6.634, 2.837, 37.139 ], "heli_params": [ -0.209, -0.620, 3.036, 4.404, 10.297, 37.810 ], "bp2_params": [ 0.543, -0.231, 0.522, 5.697, -8.954, -3.088 ], "groove_widths": [ 13.914, 13.011, 17.989, 16.852 ], "simple_Rise": 3.062, "simple_Twist": 35.471, "simple_hRise": 3.032, "simple_hTwist": 36.175 }, { "index": 13, "nt1": "///P/14", "nt2": "///V/8", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.543, -0.231, 0.522, 5.697, -8.954, -3.088 ], "step_params": [ 0.818, -0.732, 3.540, 2.801, -1.088, 29.663 ], "heli_params": [ -1.173, -0.949, 3.624, -2.118, -5.453, 29.811 ], "bp2_params": [ 0.110, 0.009, 0.347, -1.410, -8.412, 3.764 ], "groove_widths": [ 12.602, 12.520, 16.764, 16.717 ], "simple_Rise": 3.540, "simple_Twist": 32.108, "simple_hRise": 3.618, "simple_hTwist": 32.245 }, { "index": 14, "nt1": "///P/15", "nt2": "///V/7", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.110, 0.009, 0.347, -1.410, -8.412, 3.764 ], "step_params": [ 0.061, 0.368, 3.045, -0.817, 4.093, 36.185 ], "heli_params": [ 0.057, -0.203, 3.065, 6.563, 1.310, 36.417 ], "bp2_params": [ -0.087, -0.120, 0.582, 8.431, -11.745, 4.505 ], "groove_widths": [ 12.682, 12.596, 17.369, 16.979 ], "simple_Rise": 3.045, "simple_Twist": 37.417, "simple_hRise": 3.065, "simple_hTwist": 37.641 }, { "index": 15, "nt1": "///P/16", "nt2": "///V/6", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.087, -0.120, 0.582, 8.431, -11.745, 4.505 ], "step_params": [ 0.044, -0.263, 3.441, 1.924, 5.248, 32.974 ], "heli_params": [ -1.366, 0.256, 3.358, 9.163, -3.360, 33.431 ], "bp2_params": [ -0.192, -0.059, 0.243, 1.626, -11.816, 5.121 ], "groove_widths": [ 13.128, 13.001, 18.502, 18.142 ], "simple_Rise": 3.441, "simple_Twist": 33.446, "simple_hRise": 3.360, "simple_hTwist": 33.897 }, { "index": 16, "nt1": "///P/17", "nt2": "///V/5", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.192, -0.059, 0.243, 1.626, -11.816, 5.121 ], "step_params": [ -0.440, -0.281, 3.236, -3.026, 5.331, 38.766 ], "heli_params": [ -1.048, 0.297, 3.195, 7.971, 4.524, 39.230 ], "bp2_params": [ -0.228, -0.083, 0.239, -2.676, -6.841, 3.113 ], "groove_widths": [ 12.387, 12.260, 17.723, 17.367 ], "simple_Rise": 3.236, "simple_Twist": 38.686, "simple_hRise": 3.195, "simple_hTwist": 39.150 }, { "index": 17, "nt1": "///P/18", "nt2": "///V/4", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.228, -0.083, 0.239, -2.676, -6.841, 3.113 ], "step_params": [ -0.812, -0.397, 3.300, -1.073, -1.116, 34.492 ], "heli_params": [ -0.493, 1.199, 3.333, -1.881, 1.808, 34.525 ], "bp2_params": [ 0.058, -0.190, 0.197, -2.775, -13.792, -0.604 ], "groove_widths": [ 11.571, null, 17.176, null ], "simple_Rise": 3.300, "simple_Twist": 33.068, "simple_hRise": 3.335, "simple_hTwist": 33.103 }, { "index": 18, "nt1": "///P/19", "nt2": "///V/3", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.058, -0.190, 0.197, -2.775, -13.792, -0.604 ], "step_params": [ -0.154, -0.179, 3.154, 2.335, -1.579, 35.592 ], "heli_params": [ -0.073, 0.577, 3.143, -2.579, -3.813, 35.699 ], "bp2_params": [ 0.405, -0.218, -0.023, 0.379, -17.373, -1.623 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.154, "simple_Twist": 33.551, "simple_hRise": 3.141, "simple_hTwist": 33.666 }, { "index": 19, "nt1": "///P/20", "nt2": "///V/2", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.405, -0.218, -0.023, 0.379, -17.373, -1.623 ], "step_params": [ 1.664, 1.849, 2.921, 11.418, 1.219, 35.882 ], "heli_params": [ 2.712, -1.124, 3.337, 1.918, -17.974, 37.617 ], "bp2_params": [ 0.265, -0.173, -1.107, 18.379, -1.480, 10.970 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.921, "simple_Twist": 36.706, "simple_hRise": 3.330, "simple_hTwist": 38.401 }, { "index": 20, "nt1": "///P/21", "nt2": "///V/1", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] } ], "num_stems": 2, "stems": [ { "index": 1, "helix_index": 1, "strand1": "GCTGATGCG", "strand2": "CGACTACGC", "bp_type": "|||||||||", "helix_form": "BBBB.BBB", "helical_rise": 3.274, "helical_rise_std": 0.349, "helical_radius": 9.881, "helical_radius_std": 0.379, "helical_axis": [ -0.158, 0.150, -0.976 ], "point1": [ 0.688, -49.462, 34.770 ], "point2": [ -3.469, -45.512, 9.142 ], "num_pairs": 9, "pairs": [ { "index": 1, "nt1": "///P/1", "nt2": "///V/21", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.051, 0.474, -0.362, -17.863, -10.893, 5.048 ], "step_params": [ -0.514, -0.058, 3.294, -10.798, 3.601, 29.934 ], "heli_params": [ -0.780, -1.091, 3.251, 6.676, 20.016, 31.979 ], "bp2_params": [ 0.054, -0.226, 0.806, -9.505, -8.873, -2.290 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.294, "simple_Twist": 30.301, "simple_hRise": 3.254, "simple_hTwist": 32.322 }, { "index": 2, "nt1": "///P/2", "nt2": "///V/20", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.054, -0.226, 0.806, -9.505, -8.873, -2.290 ], "step_params": [ -0.369, -0.417, 2.921, 0.687, 0.624, 28.098 ], "heli_params": [ -0.988, 0.903, 2.902, 1.285, -1.415, 28.113 ], "bp2_params": [ -0.520, -0.075, 0.329, 1.824, -8.871, -1.530 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.921, "simple_Twist": 31.427, "simple_hRise": 2.904, "simple_hTwist": 31.441 }, { "index": 3, "nt1": "///P/3", "nt2": "///V/19", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.520, -0.075, 0.329, 1.824, -8.871, -1.530 ], "step_params": [ 0.266, 0.277, 3.053, 1.764, 9.221, 34.778 ], "heli_params": [ -0.796, -0.193, 3.035, 15.089, -2.886, 35.985 ], "bp2_params": [ -0.123, 0.075, 0.054, 13.465, -9.292, 0.395 ], "groove_widths": [ 14.256, null, 16.996, null ], "simple_Rise": 3.053, "simple_Twist": 33.005, "simple_hRise": 3.029, "simple_hTwist": 34.278 }, { "index": 4, "nt1": "///P/4", "nt2": "///V/18", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.123, 0.075, 0.054, 13.465, -9.292, 0.395 ], "step_params": [ -0.427, 0.165, 3.609, 4.777, 3.836, 39.751 ], "heli_params": [ -0.239, 1.217, 3.536, 5.600, -6.975, 40.201 ], "bp2_params": [ 0.283, -0.027, -0.712, 2.940, -20.395, 1.958 ], "groove_widths": [ 12.988, 12.717, 15.369, 14.927 ], "simple_Rise": 3.609, "simple_Twist": 37.033, "simple_hRise": 3.527, "simple_hTwist": 37.519 }, { "index": 5, "nt1": "///P/5", "nt2": "///V/17", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.283, -0.027, -0.712, 2.940, -20.395, 1.958 ], "step_params": [ 0.563, -0.311, 3.018, -1.966, 9.021, 29.176 ], "heli_params": [ -2.208, -1.421, 2.758, 17.368, 3.786, 30.571 ], "bp2_params": [ 0.149, -0.066, -0.424, 11.150, -19.615, 6.129 ], "groove_widths": [ 12.895, 12.580, 16.810, 16.213 ], "simple_Rise": 3.018, "simple_Twist": 30.779, "simple_hRise": 2.778, "simple_hTwist": 32.102 }, { "index": 6, "nt1": "///P/6", "nt2": "///V/16", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.149, -0.066, -0.424, 11.150, -19.615, 6.129 ], "step_params": [ 0.052, 0.042, 3.862, 1.825, 14.609, 37.180 ], "heli_params": [ -1.942, 0.175, 3.626, 21.890, -2.734, 39.893 ], "bp2_params": [ -0.149, 0.013, -0.693, -14.520, -10.315, 1.772 ], "groove_widths": [ 14.157, null, 16.525, null ], "simple_Rise": 3.862, "simple_Twist": 37.772, "simple_hRise": 3.634, "simple_hTwist": 40.442 }, { "index": 7, "nt1": "///P/7", "nt2": "///V/15", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.149, 0.013, -0.693, -14.520, -10.315, 1.772 ], "step_params": [ -0.154, -0.342, 2.797, -1.519, 4.519, 26.905 ], "heli_params": [ -1.678, 0.006, 2.709, 9.616, 3.231, 27.316 ], "bp2_params": [ -0.121, -0.079, -0.182, 0.687, -7.239, -0.344 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.797, "simple_Twist": 26.961, "simple_hRise": 2.709, "simple_hTwist": 27.372 }, { "index": 8, "nt1": "///P/8", "nt2": "///V/14", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.121, -0.079, -0.182, 0.687, -7.239, -0.344 ], "step_params": [ 0.348, 0.579, 3.275, -2.294, 12.945, 32.628 ], "heli_params": [ -1.045, -0.931, 3.235, 21.963, 3.892, 35.110 ], "bp2_params": [ 0.018, -0.026, 0.065, 7.213, -11.671, 2.813 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.275, "simple_Twist": 32.201, "simple_hRise": 3.232, "simple_hTwist": 34.715 }, { "index": 9, "nt1": "///P/9", "nt2": "///V/13", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 2, "helix_index": 1, "strand1": "CGACGGATCC", "strand2": "GCTGCCTAGG", "bp_type": "||||||||||", "helix_form": ".BBBBBBB.", "helical_rise": 3.299, "helical_rise_std": 0.289, "helical_radius": 9.548, "helical_radius_std": 1.673, "helical_axis": [ -0.270, -0.347, -0.898 ], "point1": [ -6.843, -46.788, -1.898 ], "point2": [ -14.823, -57.021, -28.404 ], "num_pairs": 10, "pairs": [ { "index": 1, "nt1": "///P/12", "nt2": "///V/10", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.133, -0.406, -0.358, 6.277, -1.319, 0.700 ], "step_params": [ -0.252, 1.996, 3.647, -3.650, -1.636, 43.293 ], "heli_params": [ 2.870, -0.050, 3.582, -2.212, 4.935, 43.469 ], "bp2_params": [ 0.248, -0.303, 0.067, -0.651, -11.924, -1.302 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.647, "simple_Twist": 42.870, "simple_hRise": 3.581, "simple_hTwist": 43.048 }, { "index": 2, "nt1": "///P/13", "nt2": "///V/9", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.248, -0.303, 0.067, -0.651, -11.924, -1.302 ], "step_params": [ -0.119, 0.087, 3.062, -6.634, 2.837, 37.139 ], "heli_params": [ -0.209, -0.620, 3.036, 4.404, 10.297, 37.810 ], "bp2_params": [ 0.543, -0.231, 0.522, 5.697, -8.954, -3.088 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.062, "simple_Twist": 35.471, "simple_hRise": 3.032, "simple_hTwist": 36.175 }, { "index": 3, "nt1": "///P/14", "nt2": "///V/8", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.543, -0.231, 0.522, 5.697, -8.954, -3.088 ], "step_params": [ 0.818, -0.732, 3.540, 2.801, -1.088, 29.663 ], "heli_params": [ -1.173, -0.949, 3.624, -2.118, -5.453, 29.811 ], "bp2_params": [ 0.110, 0.009, 0.347, -1.410, -8.412, 3.764 ], "groove_widths": [ 12.602, null, 16.764, null ], "simple_Rise": 3.540, "simple_Twist": 32.108, "simple_hRise": 3.618, "simple_hTwist": 32.245 }, { "index": 4, "nt1": "///P/15", "nt2": "///V/7", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.110, 0.009, 0.347, -1.410, -8.412, 3.764 ], "step_params": [ 0.061, 0.368, 3.045, -0.817, 4.093, 36.185 ], "heli_params": [ 0.057, -0.203, 3.065, 6.563, 1.310, 36.417 ], "bp2_params": [ -0.087, -0.120, 0.582, 8.431, -11.745, 4.505 ], "groove_widths": [ 12.682, 12.596, 17.369, 16.979 ], "simple_Rise": 3.045, "simple_Twist": 37.417, "simple_hRise": 3.065, "simple_hTwist": 37.641 }, { "index": 5, "nt1": "///P/16", "nt2": "///V/6", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.087, -0.120, 0.582, 8.431, -11.745, 4.505 ], "step_params": [ 0.044, -0.263, 3.441, 1.924, 5.248, 32.974 ], "heli_params": [ -1.366, 0.256, 3.358, 9.163, -3.360, 33.431 ], "bp2_params": [ -0.192, -0.059, 0.243, 1.626, -11.816, 5.121 ], "groove_widths": [ 13.128, 13.001, 18.502, 18.142 ], "simple_Rise": 3.441, "simple_Twist": 33.446, "simple_hRise": 3.360, "simple_hTwist": 33.897 }, { "index": 6, "nt1": "///P/17", "nt2": "///V/5", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.192, -0.059, 0.243, 1.626, -11.816, 5.121 ], "step_params": [ -0.440, -0.281, 3.236, -3.026, 5.331, 38.766 ], "heli_params": [ -1.048, 0.297, 3.195, 7.971, 4.524, 39.230 ], "bp2_params": [ -0.228, -0.083, 0.239, -2.676, -6.841, 3.113 ], "groove_widths": [ 12.387, 12.260, 17.723, 17.367 ], "simple_Rise": 3.236, "simple_Twist": 38.686, "simple_hRise": 3.195, "simple_hTwist": 39.150 }, { "index": 7, "nt1": "///P/18", "nt2": "///V/4", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.228, -0.083, 0.239, -2.676, -6.841, 3.113 ], "step_params": [ -0.812, -0.397, 3.300, -1.073, -1.116, 34.492 ], "heli_params": [ -0.493, 1.199, 3.333, -1.881, 1.808, 34.525 ], "bp2_params": [ 0.058, -0.190, 0.197, -2.775, -13.792, -0.604 ], "groove_widths": [ 11.571, null, 17.176, null ], "simple_Rise": 3.300, "simple_Twist": 33.068, "simple_hRise": 3.335, "simple_hTwist": 33.103 }, { "index": 8, "nt1": "///P/19", "nt2": "///V/3", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.058, -0.190, 0.197, -2.775, -13.792, -0.604 ], "step_params": [ -0.154, -0.179, 3.154, 2.335, -1.579, 35.592 ], "heli_params": [ -0.073, 0.577, 3.143, -2.579, -3.813, 35.699 ], "bp2_params": [ 0.405, -0.218, -0.023, 0.379, -17.373, -1.623 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.154, "simple_Twist": 33.551, "simple_hRise": 3.141, "simple_hTwist": 33.666 }, { "index": 9, "nt1": "///P/20", "nt2": "///V/2", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.405, -0.218, -0.023, 0.379, -17.373, -1.623 ], "step_params": [ 1.664, 1.849, 2.921, 11.418, 1.219, 35.882 ], "heli_params": [ 2.712, -1.124, 3.337, 1.918, -17.974, 37.617 ], "bp2_params": [ 0.265, -0.173, -1.107, 18.379, -1.480, 10.970 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.921, "simple_Twist": 36.706, "simple_hRise": 3.330, "simple_hTwist": 38.401 }, { "index": 10, "nt1": "///P/21", "nt2": "///V/1", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] } ], "num_coaxStacks": 1, "coaxStacks": [ { "index": 1, "helix_index": 1, "num_stems": 2, "stem_indices": [ 1, 2 ] } ], "num_stacks": 4, "stacks": [ { "index": 1, "num_nts": 2, "nts_short": "RC", "nts_long": "///A/177,///P/12" }, { "index": 2, "num_nts": 2, "nts_short": "GC", "nts_long": "///P/9,///P/10" }, { "index": 3, "num_nts": 2, "nts_short": "GA", "nts_long": "///V/10,///V/11" }, { "index": 4, "num_nts": 2, "nts_short": "TC", "nts_long": "///V/12,///V/13" } ], "num_iloops": 1, "iloops": [ { "index": 1, "type": "symmetric internal loop", "bridging_nts": [ 2, 2 ], "stem_indices": [ 1, 2 ], "summary": "[2] 2 2 [P.9 V.13 P.12 V.10] 9 10", "num_nts": 8, "nts_short": "GC?CGATC", "nts_long": "///P/9,///P/10,///P/11,///P/12,///V/10,///V/11,///V/12,///V/13", "num_stems": 2, "bridges": [ { "index": 1, "num_nts": 2, "nts_short": "C?", "nts_long": "///P/10,///P/11" }, { "index": 2, "num_nts": 2, "nts_short": "AT", "nts_long": "///V/11,///V/12" } ] } ], "dbn": { "all_chains": { "num_nts": 42, "num_chars": 43, "bseq": "GCTGATGCGC?CGACGGATCC&GGATCCGTCGATCGCATCAGC", "bseqUP": "GCTGATGCGC?CGACGGATCC&GGATCCGTCGATCGCATCAGC", "sstr": "(((((((((..((((((((((&))))))))))..)))))))))", "form": ".BBBBB.B.--.BBBBBBBB-&.BBBBB.B...BB.B.BBBB-" }, "chain_P": { "num_nts": 21, "num_chars": 21, "bseq": "GCTGATGCGC?CGACGGATCC", "bseqUP": "GCTGATGCGC?CGACGGATCC", "sstr": "(((((((((..((((((((((", "form": ".BBBBB.B.--.BBBBBBBB-" }, "chain_V": { "num_nts": 21, "num_chars": 21, "bseq": "GGATCCGTCGATCGCATCAGC", "bseqUP": "GGATCCGTCGATCGCATCAGC", "sstr": "))))))))))..)))))))))", "form": ".BBBBB.B...BB.B.BBBB-" } }, "chains": { "chain_P": { "num_nts": 21, "bseq": "GCTGATGCGC?CGACGGATCC", "sstr": "(((((((((..((((((((((", "form": ".BBBBB.B.--.BBBBBBBB-", "helical_rise": 3.327, "helical_rise_std": 0.852, "helical_axis": [ -0.321, -0.098, -0.942 ], "point1": [ 5.133, -43.716, 32.967 ], "point2": [ -16.671, -50.394, -31.081 ], "num_chars": 61, "suite": "G!!C!!T!!G!!A!!T!!G!!C!!G!!C2u?2uC4bG!!A!!C!!G!!G!!A!!T!!C!!C" }, "chain_V": { "num_nts": 21, "bseq": "GGATCCGTCGATCGCATCAGC", "sstr": "))))))))))..)))))))))", "form": ".BBBBB.B...BB.B.BBBB-", "helical_rise": 3.209, "helical_rise_std": 0.657, "helical_axis": [ 0.183, 0.101, 0.978 ], "point1": [ -11.646, -52.743, -28.422 ], "point2": [ 0.064, -46.296, 34.069 ], "num_chars": 61, "suite": "G4bG!!A!!T!!C!!C1bG!!T!!C!!G!!A!!T!!C1bG!!C!!A1bT!!C!!A!!G!!C" } }, "num_nts": 42, "nts": [ { "index": 1, "index_chain": 1, "chain_name": "P", "nt_resnum": 1, "nt_name": "DG", "nt_code": "G", "nt_id": "///P/1", "linked_nts": [ null, "///P/2" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack", "alpha": null, "beta": null, "gamma": -153.046, "delta": 158.609, "epsilon": -153.694, "zeta": -119.826, "epsilon_zeta": -33.868, "bb_type": "BI", "chi": -107.635, "glyco_bond": "anti", "C5prime_xyz": [ -1.515, 8.166, -1.512 ], "P_xyz": [ null, null, null ], "form": ".", "ssZp": 1.581, "Dp": 1.638, "splay_angle": 21.853, "splay_distance": 3.913, "splay_ratio": 0.192, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": -8.485, "v1": 30.699, "v2": -40.021, "v3": 36.159, "v4": -17.566, "amplitude": 40.299, "phase_angle": 186.733, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.004, "frame": { "rmsd": 0.004, "origin": [ 1.509, -49.741, 34.228 ], "x_axis": [ -0.594, 0.769, 0.236 ], "y_axis": [ 0.757, 0.634, -0.161 ], "z_axis": [ -0.274, 0.083, -0.958 ], "quaternion": [ -0.143, 0.427, 0.892, -0.022 ] } }, { "index": 2, "index_chain": 2, "chain_name": "P", "nt_resnum": 2, "nt_name": "DC", "nt_code": "C", "nt_id": "///P/2", "linked_nts": [ "///P/1", "///P/3" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -39.357, "beta": 151.921, "gamma": 29.949, "delta": 95.663, "epsilon": 166.638, "zeta": -79.675, "epsilon_zeta": -113.687, "bb_type": "BI", "chi": -128.792, "glyco_bond": "anti", "C5prime_xyz": [ -2.771, 8.674, -1.626 ], "P_xyz": [ -0.788, 10.357, -1.612 ], "form": "B", "ssZp": 2.595, "Dp": 2.758, "splay_angle": 16.122, "splay_distance": 2.780, "splay_ratio": 0.141, "d22": 4.313, "d64": 3.818, "eta": 163.435, "theta": -168.922, "eta_prime": -178.256, "theta_prime": -171.602, "eta_base": -139.712, "theta_base": -142.156, "v0": -38.017, "v1": 22.066, "v2": 0.466, "v3": -22.211, "v4": 38.222, "amplitude": 39.161, "phase_angle": 89.318, "puckering": "O4'-endo", "sugar_class": "--", "bin": "23p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.064, "frame": { "rmsd": 0.007, "origin": [ -0.039, -49.919, 30.639 ], "x_axis": [ -0.176, 0.970, 0.170 ], "y_axis": [ 0.960, 0.207, -0.187 ], "z_axis": [ -0.217, 0.130, -0.968 ], "quaternion": [ -0.126, 0.630, 0.766, -0.019 ] } }, { "index": 3, "index_chain": 3, "chain_name": "P", "nt_resnum": 3, "nt_name": "DT", "nt_code": "T", "nt_id": "///P/3", "linked_nts": [ "///P/2", "///P/4" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -74.492, "beta": -178.963, "gamma": 61.663, "delta": 119.196, "epsilon": -159.918, "zeta": -106.563, "epsilon_zeta": -53.355, "bb_type": "BI", "chi": -124.084, "glyco_bond": "anti", "C5prime_xyz": [ -2.452, 8.620, -1.452 ], "P_xyz": [ -0.162, 9.877, -1.452 ], "form": "B", "ssZp": 2.535, "Dp": 2.593, "splay_angle": 17.577, "splay_distance": 2.992, "splay_ratio": 0.153, "d22": null, "d64": null, "eta": 174.145, "theta": -145.294, "eta_prime": -170.526, "theta_prime": -147.904, "eta_base": -137.190, "theta_base": -105.983, "v0": -33.498, "v1": 31.430, "v2": -18.041, "v3": -0.554, "v4": 21.263, "amplitude": 33.464, "phase_angle": 122.623, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.002, "origin": [ -1.318, -49.977, 28.171 ], "x_axis": [ 0.288, 0.957, 0.025 ], "y_axis": [ 0.889, -0.258, -0.378 ], "z_axis": [ -0.356, 0.131, -0.925 ], "quaternion": [ -0.162, 0.786, 0.587, -0.105 ] } }, { "index": 4, "index_chain": 4, "chain_name": "P", "nt_resnum": 4, "nt_name": "DG", "nt_code": "G", "nt_id": "///P/4", "linked_nts": [ "///P/3", "///P/5" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -39.288, "beta": 163.234, "gamma": 35.057, "delta": 143.981, "epsilon": -166.086, "zeta": -139.248, "epsilon_zeta": -26.837, "bb_type": "--", "chi": -96.001, "glyco_bond": "anti", "C5prime_xyz": [ -2.574, 8.015, -2.310 ], "P_xyz": [ -0.310, 9.312, -2.496 ], "form": "B", "ssZp": 1.946, "Dp": 2.038, "splay_angle": 19.717, "splay_distance": 3.241, "splay_ratio": 0.172, "d22": null, "d64": null, "eta": 163.574, "theta": -156.931, "eta_prime": -163.048, "theta_prime": -170.504, "eta_base": -116.777, "theta_base": -123.322, "v0": -25.874, "v1": 39.974, "v2": -38.087, "v3": 24.246, "v4": 0.702, "amplitude": 40.492, "phase_angle": 160.156, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.004, "frame": { "rmsd": 0.004, "origin": [ -1.677, -48.931, 25.392 ], "x_axis": [ 0.793, 0.605, -0.073 ], "y_axis": [ 0.485, -0.699, -0.525 ], "z_axis": [ -0.368, 0.381, -0.848 ], "quaternion": [ -0.248, 0.914, 0.298, -0.121 ] } }, { "index": 5, "index_chain": 5, "chain_name": "P", "nt_resnum": 5, "nt_name": "DA", "nt_code": "A", "nt_id": "///P/5", "linked_nts": [ "///P/4", "///P/6" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -30.333, "beta": 165.072, "gamma": 25.278, "delta": 139.339, "epsilon": 174.668, "zeta": -85.789, "epsilon_zeta": -99.543, "bb_type": "BI", "chi": -101.099, "glyco_bond": "anti", "C5prime_xyz": [ -1.920, 8.015, -2.158 ], "P_xyz": [ 0.504, 9.004, -2.067 ], "form": "B", "ssZp": 2.154, "Dp": 2.265, "splay_angle": 18.538, "splay_distance": 3.193, "splay_ratio": 0.163, "d22": null, "d64": null, "eta": 168.344, "theta": -129.563, "eta_prime": -172.528, "theta_prime": -143.254, "eta_base": -121.555, "theta_base": -106.485, "v0": -15.874, "v1": 28.306, "v2": -29.298, "v3": 20.819, "v4": -3.298, "amplitude": 30.015, "phase_angle": 167.455, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.005, "origin": [ -2.600, -47.877, 22.469 ], "x_axis": [ 0.918, 0.022, -0.397 ], "y_axis": [ -0.165, -0.888, -0.430 ], "z_axis": [ -0.362, 0.460, -0.811 ], "quaternion": [ -0.234, 0.951, -0.037, -0.200 ] } }, { "index": 6, "index_chain": 6, "chain_name": "P", "nt_resnum": 6, "nt_name": "DT", "nt_code": "T", "nt_id": "///P/6", "linked_nts": [ "///P/5", "///P/7" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -55.292, "beta": -170.281, "gamma": 35.599, "delta": 138.221, "epsilon": -176.360, "zeta": -111.938, "epsilon_zeta": -64.422, "bb_type": "BI", "chi": -93.552, "glyco_bond": "anti", "C5prime_xyz": [ -2.745, 7.909, -2.392 ], "P_xyz": [ -0.805, 9.661, -2.619 ], "form": "B", "ssZp": 2.166, "Dp": 2.254, "splay_angle": 22.350, "splay_distance": 3.734, "splay_ratio": 0.194, "d22": null, "d64": null, "eta": 166.338, "theta": -153.473, "eta_prime": -166.223, "theta_prime": -159.019, "eta_base": -122.336, "theta_base": -118.764, "v0": -26.091, "v1": 37.293, "v2": -33.777, "v3": 19.658, "v4": 3.713, "amplitude": 37.128, "phase_angle": 155.471, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.004, "origin": [ -2.480, -46.513, 19.584 ], "x_axis": [ 0.748, -0.502, -0.435 ], "y_axis": [ -0.649, -0.693, -0.316 ], "z_axis": [ -0.143, 0.518, -0.843 ], "quaternion": [ -0.230, 0.906, -0.317, -0.159 ] } }, { "index": 7, "index_chain": 7, "chain_name": "P", "nt_resnum": 7, "nt_name": "DG", "nt_code": "G", "nt_id": "///P/7", "linked_nts": [ "///P/6", "///P/8" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -48.920, "beta": -177.445, "gamma": 33.498, "delta": 141.283, "epsilon": -169.584, "zeta": -112.482, "epsilon_zeta": -57.102, "bb_type": "BI", "chi": -103.143, "glyco_bond": "anti", "C5prime_xyz": [ -2.144, 8.177, -1.997 ], "P_xyz": [ 0.077, 9.510, -1.668 ], "form": ".", "ssZp": 2.136, "Dp": 2.223, "splay_angle": 17.366, "splay_distance": 3.091, "splay_ratio": 0.154, "d22": null, "d64": null, "eta": 168.565, "theta": -139.357, "eta_prime": -172.614, "theta_prime": -152.561, "eta_base": -128.014, "theta_base": -126.303, "v0": -19.798, "v1": 32.465, "v2": -32.220, "v3": 21.591, "v4": -1.376, "amplitude": 33.596, "phase_angle": 163.541, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.004, "frame": { "rmsd": 0.004, "origin": [ -2.565, -45.436, 16.011 ], "x_axis": [ 0.259, -0.938, -0.230 ], "y_axis": [ -0.965, -0.262, -0.020 ], "z_axis": [ -0.041, 0.227, -0.973 ], "quaternion": [ -0.078, 0.790, -0.603, -0.086 ] } }, { "index": 8, "index_chain": 8, "chain_name": "P", "nt_resnum": 8, "nt_name": "DC", "nt_code": "C", "nt_id": "///P/8", "linked_nts": [ "///P/7", "///P/9" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -34.573, "beta": 166.061, "gamma": 25.751, "delta": 119.485, "epsilon": -166.028, "zeta": -110.514, "epsilon_zeta": -55.514, "bb_type": "BI", "chi": -107.556, "glyco_bond": "anti", "C5prime_xyz": [ -2.764, 8.300, -2.123 ], "P_xyz": [ -0.828, 10.021, -2.425 ], "form": "B", "ssZp": 2.339, "Dp": 2.540, "splay_angle": 20.411, "splay_distance": 3.480, "splay_ratio": 0.179, "d22": null, "d64": null, "eta": 170.623, "theta": -162.172, "eta_prime": -174.639, "theta_prime": -161.524, "eta_base": -141.766, "theta_base": -117.825, "v0": -34.913, "v1": 33.837, "v2": -20.352, "v3": 0.947, "v4": 21.208, "amplitude": 35.365, "phase_angle": 125.133, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.003, "origin": [ -1.863, -44.861, 13.056 ], "x_axis": [ -0.190, -0.966, -0.173 ], "y_axis": [ -0.977, 0.204, -0.067 ], "z_axis": [ 0.100, 0.156, -0.983 ], "quaternion": [ 0.089, -0.630, 0.771, 0.029 ] } }, { "index": 9, "index_chain": 9, "chain_name": "P", "nt_resnum": 9, "nt_name": "DG", "nt_code": "G", "nt_id": "///P/9", "linked_nts": [ "///P/8", "///P/10" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop", "alpha": -64.088, "beta": 157.833, "gamma": 64.777, "delta": 132.322, "epsilon": -175.205, "zeta": -89.594, "epsilon_zeta": -85.612, "bb_type": "BI", "chi": -114.607, "glyco_bond": "anti", "C5prime_xyz": [ -2.503, 8.468, -1.644 ], "P_xyz": [ -0.051, 9.193, -2.086 ], "form": ".", "ssZp": 2.447, "Dp": 2.418, "splay_angle": 21.377, "splay_distance": 3.735, "splay_ratio": 0.190, "d22": null, "d64": null, "eta": 162.268, "theta": -123.940, "eta_prime": -166.006, "theta_prime": -144.841, "eta_base": -119.032, "theta_base": -94.730, "v0": -30.295, "v1": 36.841, "v2": -29.142, "v3": 12.599, "v4": 10.836, "amplitude": 36.061, "phase_angle": 143.913, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.003, "frame": { "rmsd": 0.003, "origin": [ -2.543, -44.934, 9.643 ], "x_axis": [ -0.714, -0.700, -0.002 ], "y_axis": [ -0.698, 0.712, -0.079 ], "z_axis": [ 0.057, -0.055, -0.997 ], "quaternion": [ 0.016, -0.378, 0.925, -0.036 ] } }, { "index": 10, "index_chain": 10, "chain_name": "P", "nt_resnum": 10, "nt_name": "DC", "nt_code": "C", "nt_id": "///P/10", "linked_nts": [ "///P/9", "///P/11" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,non-canonical,non-pair-contact,helix,internal-loop", "alpha": -60.640, "beta": 175.180, "gamma": 49.233, "delta": 134.797, "epsilon": -125.644, "zeta": -49.377, "epsilon_zeta": -76.267, "bb_type": "--", "chi": -110.358, "glyco_bond": "anti", "C5prime_xyz": [ -2.855, 8.393, -1.836 ], "P_xyz": [ -0.836, 10.015, -1.979 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": -179.080, "theta": -63.376, "eta_prime": -153.156, "theta_prime": -85.391, "eta_base": -97.535, "theta_base": null, "v0": -38.675, "v1": 45.253, "v2": -34.158, "v3": 13.213, "v4": 15.511, "amplitude": 44.178, "phase_angle": 140.642, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.061, "frame": { "rmsd": 0.004, "origin": [ -4.205, -46.337, 6.607 ], "x_axis": [ -0.996, -0.052, 0.068 ], "y_axis": [ -0.064, 0.980, -0.186 ], "z_axis": [ -0.057, -0.190, -0.980 ], "quaternion": [ -0.032, -0.029, 0.995, -0.094 ] } }, { "index": 11, "index_chain": 11, "chain_name": "P", "nt_resnum": 11, "nt_name": "DV3", "nt_code": "?", "is_modified": true, "nt_id": "///P/11", "linked_nts": [ "///P/10", "///P/12" ], "nt_type": "DNA", "dbn": ".", "summary": "modified,turn,non-stack,internal-loop,phosphate", "alpha": -100.389, "beta": 148.024, "gamma": -171.467, "delta": 143.591, "epsilon": -105.049, "zeta": -74.517, "epsilon_zeta": -30.532, "bb_type": "--", "chi": null, "glyco_bond": "--", "C5prime_xyz": [ null, null, null ], "P_xyz": [ null, null, null ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": -66.018, "theta": -124.562, "eta_prime": -35.059, "theta_prime": -158.394, "eta_base": null, "theta_base": null, "v0": 17.618, "v1": -3.332, "v2": -17.005, "v3": 26.520, "v4": -30.875, "amplitude": 30.613, "phase_angle": 236.257, "puckering": "C4'-endo", "sugar_class": "--", "bin": "22t", "cluster": "2u", "suiteness": 0.237, "filter_rmsd": null }, { "index": 12, "index_chain": 12, "chain_name": "P", "nt_resnum": 12, "nt_name": "DC", "nt_code": "C", "nt_id": "///P/12", "linked_nts": [ "///P/11", "///P/13" ], "nt_type": "DNA", "dbn": "(", "summary": "~C2'-endo,BII,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop,phosphate", "alpha": -58.807, "beta": -139.898, "gamma": -178.681, "delta": 155.004, "epsilon": -92.316, "zeta": 160.532, "epsilon_zeta": 107.152, "bb_type": "BII", "chi": -80.771, "glyco_bond": "--", "C5prime_xyz": [ -2.521, 7.557, -2.618 ], "P_xyz": [ -1.436, 6.594, -4.770 ], "form": ".", "ssZp": 0.462, "Dp": 0.565, "splay_angle": 25.262, "splay_distance": 4.409, "splay_ratio": 0.236, "d22": null, "d64": null, "eta": 17.887, "theta": 126.039, "eta_prime": 47.711, "theta_prime": 147.093, "eta_base": null, "theta_base": -145.228, "v0": -18.937, "v1": 38.430, "v2": -42.143, "v3": 32.264, "v4": -8.567, "amplitude": 42.484, "phase_angle": 172.735, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22t", "cluster": "2u", "suiteness": 0.270, "filter_rmsd": 0.065, "frame": { "rmsd": 0.004, "origin": [ -8.561, -48.113, 0.178 ], "x_axis": [ -0.815, 0.540, 0.211 ], "y_axis": [ 0.326, 0.728, -0.603 ], "z_axis": [ -0.479, -0.422, -0.769 ], "quaternion": [ -0.190, 0.238, 0.910, -0.282 ] } }, { "index": 13, "index_chain": 13, "chain_name": "P", "nt_resnum": 13, "nt_name": "DG", "nt_code": "G", "nt_id": "///P/13", "linked_nts": [ "///P/12", "///P/14" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -59.232, "beta": 139.514, "gamma": 30.734, "delta": 143.303, "epsilon": 173.283, "zeta": -107.023, "epsilon_zeta": -79.694, "bb_type": "BI", "chi": -90.771, "glyco_bond": "anti", "C5prime_xyz": [ -2.106, 7.735, -2.504 ], "P_xyz": [ 0.476, 8.125, -2.416 ], "form": "B", "ssZp": 1.753, "Dp": 1.950, "splay_angle": 19.970, "splay_distance": 3.305, "splay_ratio": 0.174, "d22": null, "d64": null, "eta": 159.327, "theta": -134.976, "eta_prime": -169.169, "theta_prime": -162.025, "eta_base": -111.940, "theta_base": -116.947, "v0": -12.902, "v1": 28.671, "v2": -32.656, "v3": 26.050, "v4": -8.579, "amplitude": 32.734, "phase_angle": 176.048, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "4b", "suiteness": 0.267, "filter_rmsd": 0.004, "frame": { "rmsd": 0.004, "origin": [ -8.885, -48.518, -4.201 ], "x_axis": [ -0.404, 0.863, -0.303 ], "y_axis": [ 0.838, 0.216, -0.502 ], "z_axis": [ -0.368, -0.456, -0.810 ], "quaternion": [ -0.021, 0.546, 0.779, -0.307 ] } }, { "index": 14, "index_chain": 14, "chain_name": "P", "nt_resnum": 14, "nt_name": "DA", "nt_code": "A", "nt_id": "///P/14", "linked_nts": [ "///P/13", "///P/15" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -59.566, "beta": 176.031, "gamma": 54.785, "delta": 143.491, "epsilon": -158.262, "zeta": -118.416, "epsilon_zeta": -39.845, "bb_type": "BI", "chi": -107.677, "glyco_bond": "anti", "C5prime_xyz": [ -2.140, 8.269, -1.806 ], "P_xyz": [ 0.267, 9.240, -1.674 ], "form": "B", "ssZp": 1.848, "Dp": 1.926, "splay_angle": 19.857, "splay_distance": 3.550, "splay_ratio": 0.176, "d22": null, "d64": null, "eta": 173.707, "theta": -130.400, "eta_prime": -162.876, "theta_prime": -149.530, "eta_base": -113.851, "theta_base": -107.722, "v0": -21.932, "v1": 35.896, "v2": -35.496, "v3": 23.875, "v4": -1.512, "amplitude": 37.028, "phase_angle": 163.461, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.036, "frame": { "rmsd": 0.004, "origin": [ -9.832, -49.575, -7.187 ], "x_axis": [ 0.204, 0.858, -0.471 ], "y_axis": [ 0.906, -0.348, -0.241 ], "z_axis": [ -0.371, -0.377, -0.849 ], "quaternion": [ 0.044, 0.775, 0.569, -0.272 ] } }, { "index": 15, "index_chain": 15, "chain_name": "P", "nt_resnum": 15, "nt_name": "DC", "nt_code": "C", "nt_id": "///P/15", "linked_nts": [ "///P/14", "///P/16" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -35.087, "beta": 147.833, "gamma": 36.902, "delta": 110.008, "epsilon": -162.730, "zeta": -121.527, "epsilon_zeta": -41.203, "bb_type": "BI", "chi": -123.798, "glyco_bond": "anti", "C5prime_xyz": [ -3.089, 8.561, -1.653 ], "P_xyz": [ -1.125, 10.228, -1.787 ], "form": "B", "ssZp": 2.483, "Dp": 2.515, "splay_angle": 18.855, "splay_distance": 3.178, "splay_ratio": 0.165, "d22": null, "d64": null, "eta": 171.736, "theta": -168.847, "eta_prime": -168.154, "theta_prime": -167.623, "eta_base": -119.503, "theta_base": -123.075, "v0": -43.969, "v1": 36.648, "v2": -16.253, "v3": -8.323, "v4": 32.625, "amplitude": 42.712, "phase_angle": 112.366, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.062, "frame": { "rmsd": 0.003, "origin": [ -11.113, -49.893, -10.482 ], "x_axis": [ 0.659, 0.527, -0.537 ], "y_axis": [ 0.640, -0.768, 0.032 ], "z_axis": [ -0.395, -0.365, -0.843 ], "quaternion": [ 0.110, 0.904, 0.323, -0.258 ] } }, { "index": 16, "index_chain": 16, "chain_name": "P", "nt_resnum": 16, "nt_name": "DG", "nt_code": "G", "nt_id": "///P/16", "linked_nts": [ "///P/15", "///P/17" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -42.110, "beta": 159.756, "gamma": 41.613, "delta": 139.877, "epsilon": -164.232, "zeta": -114.968, "epsilon_zeta": -49.264, "bb_type": "BI", "chi": -104.788, "glyco_bond": "anti", "C5prime_xyz": [ -2.385, 8.246, -1.959 ], "P_xyz": [ 0.019, 9.218, -1.937 ], "form": "B", "ssZp": 2.083, "Dp": 2.142, "splay_angle": 19.264, "splay_distance": 3.289, "splay_ratio": 0.168, "d22": null, "d64": null, "eta": 169.778, "theta": -138.310, "eta_prime": -165.077, "theta_prime": -155.162, "eta_base": -118.820, "theta_base": -116.185, "v0": -25.398, "v1": 36.703, "v2": -33.563, "v3": 19.903, "v4": 3.153, "amplitude": 36.655, "phase_angle": 156.296, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.003, "frame": { "rmsd": 0.003, "origin": [ -12.001, -51.150, -13.262 ], "x_axis": [ 0.916, -0.024, -0.399 ], "y_axis": [ 0.073, -0.972, 0.225 ], "z_axis": [ -0.393, -0.235, -0.889 ], "quaternion": [ 0.118, 0.972, 0.013, -0.204 ] } }, { "index": 17, "index_chain": 17, "chain_name": "P", "nt_resnum": 17, "nt_name": "DG", "nt_code": "G", "nt_id": "///P/17", "linked_nts": [ "///P/16", "///P/18" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -60.701, "beta": 159.132, "gamma": 58.198, "delta": 119.597, "epsilon": 176.288, "zeta": -99.111, "epsilon_zeta": -84.601, "bb_type": "BI", "chi": -120.307, "glyco_bond": "anti", "C5prime_xyz": [ -2.763, 8.516, -1.643 ], "P_xyz": [ -0.487, 9.727, -1.890 ], "form": "B", "ssZp": 2.379, "Dp": 2.469, "splay_angle": 20.073, "splay_distance": 3.291, "splay_ratio": 0.174, "d22": null, "d64": null, "eta": 164.769, "theta": -156.607, "eta_prime": -169.661, "theta_prime": -166.878, "eta_base": -123.912, "theta_base": -126.490, "v0": -36.188, "v1": 34.892, "v2": -20.921, "v3": 1.007, "v4": 21.835, "amplitude": 36.462, "phase_angle": 125.014, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.006, "frame": { "rmsd": 0.006, "origin": [ -12.720, -51.874, -16.389 ], "x_axis": [ 0.843, -0.523, -0.124 ], "y_axis": [ -0.459, -0.820, 0.342 ], "z_axis": [ -0.281, -0.231, -0.932 ], "quaternion": [ 0.151, 0.948, -0.259, -0.107 ] } }, { "index": 18, "index_chain": 18, "chain_name": "P", "nt_resnum": 18, "nt_name": "DA", "nt_code": "A", "nt_id": "///P/18", "linked_nts": [ "///P/17", "///P/19" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -69.145, "beta": -168.058, "gamma": 51.811, "delta": 143.401, "epsilon": -173.105, "zeta": -123.929, "epsilon_zeta": -49.176, "bb_type": "BI", "chi": -111.828, "glyco_bond": "anti", "C5prime_xyz": [ -1.891, 8.343, -1.589 ], "P_xyz": [ 0.396, 9.418, -0.994 ], "form": "B", "ssZp": 2.045, "Dp": 2.086, "splay_angle": 20.083, "splay_distance": 3.373, "splay_ratio": 0.175, "d22": null, "d64": null, "eta": 168.475, "theta": -146.299, "eta_prime": -170.490, "theta_prime": -159.681, "eta_base": -125.007, "theta_base": -125.553, "v0": -18.249, "v1": 32.649, "v2": -33.709, "v3": 23.995, "v4": -3.857, "amplitude": 34.531, "phase_angle": 167.476, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.037, "frame": { "rmsd": 0.004, "origin": [ -13.364, -52.464, -19.562 ], "x_axis": [ 0.414, -0.879, 0.237 ], "y_axis": [ -0.885, -0.328, 0.331 ], "z_axis": [ -0.214, -0.347, -0.913 ], "quaternion": [ 0.208, 0.815, -0.541, 0.007 ] } }, { "index": 19, "index_chain": 19, "chain_name": "P", "nt_resnum": 19, "nt_name": "DT", "nt_code": "T", "nt_id": "///P/19", "linked_nts": [ "///P/18", "///P/20" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -20.498, "beta": 170.144, "gamma": 16.602, "delta": 137.175, "epsilon": 177.520, "zeta": -106.515, "epsilon_zeta": -75.965, "bb_type": "BI", "chi": -107.647, "glyco_bond": "anti", "C5prime_xyz": [ -2.036, 8.260, -1.829 ], "P_xyz": [ 0.092, 9.683, -1.312 ], "form": "B", "ssZp": 2.229, "Dp": 2.263, "splay_angle": 18.042, "splay_distance": 3.047, "splay_ratio": 0.157, "d22": 4.392, "d64": 3.935, "eta": 171.808, "theta": -148.318, "eta_prime": -169.061, "theta_prime": -156.905, "eta_base": -128.052, "theta_base": -115.937, "v0": -17.546, "v1": 28.763, "v2": -28.490, "v3": 19.095, "v4": -1.237, "amplitude": 29.714, "phase_angle": 163.498, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.005, "origin": [ -13.596, -53.088, -22.869 ], "x_axis": [ -0.147, -0.946, 0.288 ], "y_axis": [ -0.970, 0.195, 0.147 ], "z_axis": [ -0.195, -0.257, -0.946 ], "quaternion": [ -0.159, -0.633, 0.756, -0.037 ] } }, { "index": 20, "index_chain": 20, "chain_name": "P", "nt_resnum": 20, "nt_name": "DC", "nt_code": "C", "nt_id": "///P/20", "linked_nts": [ "///P/19", "///P/21" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -26.246, "beta": 176.516, "gamma": 23.766, "delta": 144.761, "epsilon": -131.373, "zeta": -124.963, "epsilon_zeta": -6.410, "bb_type": "--", "chi": -98.494, "glyco_bond": "anti", "C5prime_xyz": [ -2.247, 8.098, -2.145 ], "P_xyz": [ -0.127, 9.599, -1.983 ], "form": "B", "ssZp": 1.478, "Dp": 1.667, "splay_angle": 20.118, "splay_distance": 3.522, "splay_ratio": 0.181, "d22": 4.716, "d64": 3.254, "eta": -171.040, "theta": -123.097, "eta_prime": -153.786, "theta_prime": -137.917, "eta_base": -111.261, "theta_base": -75.120, "v0": -22.625, "v1": 36.554, "v2": -35.911, "v3": 23.876, "v4": -1.049, "amplitude": 37.596, "phase_angle": 162.780, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.003, "origin": [ -14.016, -54.335, -25.618 ], "x_axis": [ -0.681, -0.699, 0.221 ], "y_axis": [ -0.732, 0.662, -0.161 ], "z_axis": [ -0.034, -0.271, -0.962 ], "quaternion": [ -0.070, -0.393, 0.909, -0.119 ] } }, { "index": 21, "index_chain": 21, "chain_name": "P", "nt_resnum": 21, "nt_name": "DC", "nt_code": "C", "nt_id": "///P/21", "linked_nts": [ "///P/20", null ], "nt_type": "DNA", "dbn": "(", "summary": "~C2'-endo,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack", "alpha": 45.382, "beta": -137.337, "gamma": -110.117, "delta": 159.674, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": -88.301, "glyco_bond": "--", "C5prime_xyz": [ -1.425, 7.388, -2.280 ], "P_xyz": [ -0.768, 7.884, -4.752 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": 4.529, "v1": 19.087, "v2": -33.897, "v3": 37.573, "v4": -26.773, "amplitude": 37.560, "phase_angle": 205.513, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.064, "frame": { "rmsd": 0.004, "origin": [ -16.678, -54.449, -27.920 ], "x_axis": [ -0.993, -0.080, 0.090 ], "y_axis": [ -0.119, 0.746, -0.655 ], "z_axis": [ -0.015, -0.661, -0.750 ], "quaternion": [ -0.028, -0.053, 0.934, -0.352 ] } }, { "index": 22, "index_chain": 1, "chain_name": "V", "nt_resnum": 1, "nt_name": "DG", "nt_code": "G", "nt_id": "///V/1", "linked_nts": [ null, "///V/2" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BII,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack", "alpha": null, "beta": null, "gamma": 57.931, "delta": 122.992, "epsilon": -105.066, "zeta": 159.704, "epsilon_zeta": 95.231, "bb_type": "BII", "chi": -90.651, "glyco_bond": "anti", "C5prime_xyz": [ -3.637, 7.597, -2.546 ], "P_xyz": [ null, null, null ], "form": ".", "ssZp": 1.077, "Dp": 1.414, "splay_angle": 23.535, "splay_distance": 4.211, "splay_ratio": 0.220, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": -40.666, "v1": 41.034, "v2": -26.052, "v3": 3.692, "v4": 22.775, "amplitude": 41.846, "phase_angle": 128.504, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.003, "frame": { "rmsd": 0.003, "origin": [ -16.523, -54.862, -28.984 ], "x_axis": [ -0.952, -0.223, 0.208 ], "y_axis": [ 0.286, -0.889, 0.356 ], "z_axis": [ 0.106, 0.399, 0.911 ], "quaternion": [ -0.131, 0.081, 0.195, 0.969 ] } }, { "index": 23, "index_chain": 2, "chain_name": "V", "nt_resnum": 2, "nt_name": "DG", "nt_code": "G", "nt_id": "///V/2", "linked_nts": [ "///V/1", "///V/3" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -65.555, "beta": 131.006, "gamma": 46.623, "delta": 134.907, "epsilon": -175.764, "zeta": -104.589, "epsilon_zeta": -71.175, "bb_type": "BI", "chi": -104.825, "glyco_bond": "anti", "C5prime_xyz": [ -2.277, 8.229, -2.086 ], "P_xyz": [ 0.319, 8.479, -2.132 ], "form": "B", "ssZp": 1.929, "Dp": 2.082, "splay_angle": 19.071, "splay_distance": 3.294, "splay_ratio": 0.167, "d22": null, "d64": null, "eta": 162.005, "theta": -126.940, "eta_prime": -169.825, "theta_prime": -157.352, "eta_base": -134.012, "theta_base": -112.459, "v0": -24.239, "v1": 34.045, "v2": -30.594, "v3": 17.567, "v4": 3.908, "amplitude": 33.856, "phase_angle": 154.643, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "4b", "suiteness": 0.018, "filter_rmsd": 0.006, "frame": { "rmsd": 0.006, "origin": [ -13.902, -53.937, -25.821 ], "x_axis": [ -0.659, -0.568, 0.494 ], "y_axis": [ 0.712, -0.683, 0.165 ], "z_axis": [ 0.243, 0.460, 0.854 ], "quaternion": [ -0.358, 0.206, 0.175, 0.894 ] } }, { "index": 24, "index_chain": 3, "chain_name": "V", "nt_resnum": 3, "nt_name": "DA", "nt_code": "A", "nt_id": "///V/3", "linked_nts": [ "///V/2", "///V/4" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -45.518, "beta": 170.529, "gamma": 40.476, "delta": 123.559, "epsilon": -177.049, "zeta": -90.158, "epsilon_zeta": -86.891, "bb_type": "BI", "chi": -112.992, "glyco_bond": "anti", "C5prime_xyz": [ -2.497, 8.361, -1.900 ], "P_xyz": [ -0.415, 9.882, -1.922 ], "form": "B", "ssZp": 2.187, "Dp": 2.319, "splay_angle": 19.814, "splay_distance": 3.479, "splay_ratio": 0.175, "d22": null, "d64": null, "eta": 173.168, "theta": -144.264, "eta_prime": -165.557, "theta_prime": -153.441, "eta_base": -113.875, "theta_base": -106.035, "v0": -30.823, "v1": 33.189, "v2": -23.232, "v3": 6.318, "v4": 15.206, "amplitude": 33.178, "phase_angle": 134.445, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.037, "frame": { "rmsd": 0.006, "origin": [ -13.737, -52.925, -22.690 ], "x_axis": [ -0.112, -0.855, 0.507 ], "y_axis": [ 0.978, -0.186, -0.098 ], "z_axis": [ 0.179, 0.485, 0.856 ], "quaternion": [ 0.624, -0.234, -0.132, -0.734 ] } }, { "index": 25, "index_chain": 4, "chain_name": "V", "nt_resnum": 4, "nt_name": "DT", "nt_code": "T", "nt_id": "///V/4", "linked_nts": [ "///V/3", "///V/5" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -59.696, "beta": 169.022, "gamma": 56.064, "delta": 120.465, "epsilon": -168.503, "zeta": -114.291, "epsilon_zeta": -54.212, "bb_type": "BI", "chi": -120.970, "glyco_bond": "anti", "C5prime_xyz": [ -2.844, 8.497, -1.662 ], "P_xyz": [ -0.815, 10.058, -1.870 ], "form": "B", "ssZp": 2.321, "Dp": 2.384, "splay_angle": 19.323, "splay_distance": 3.266, "splay_ratio": 0.168, "d22": 4.267, "d64": 3.651, "eta": 173.591, "theta": -158.392, "eta_prime": -161.928, "theta_prime": -163.314, "eta_base": -109.325, "theta_base": -114.488, "v0": -40.519, "v1": 39.388, "v2": -23.732, "v3": 1.420, "v4": 24.246, "amplitude": 40.956, "phase_angle": 125.412, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.105, "frame": { "rmsd": 0.004, "origin": [ -13.295, -52.593, -19.256 ], "x_axis": [ 0.482, -0.813, 0.328 ], "y_axis": [ 0.868, 0.392, -0.305 ], "z_axis": [ 0.119, 0.431, 0.894 ], "quaternion": [ 0.832, -0.221, -0.063, -0.505 ] } }, { "index": 26, "index_chain": 5, "chain_name": "V", "nt_resnum": 5, "nt_name": "DC", "nt_code": "C", "nt_id": "///V/5", "linked_nts": [ "///V/4", "///V/6" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -35.348, "beta": 169.430, "gamma": 26.470, "delta": 140.551, "epsilon": -162.659, "zeta": -122.148, "epsilon_zeta": -40.511, "bb_type": "BI", "chi": -104.901, "glyco_bond": "anti", "C5prime_xyz": [ -2.280, 8.307, -1.927 ], "P_xyz": [ -0.083, 9.696, -1.677 ], "form": "B", "ssZp": 2.201, "Dp": 2.217, "splay_angle": 20.928, "splay_distance": 3.615, "splay_ratio": 0.182, "d22": 4.139, "d64": 3.848, "eta": 170.114, "theta": -145.451, "eta_prime": -168.386, "theta_prime": -158.205, "eta_base": -115.192, "theta_base": -119.395, "v0": -25.392, "v1": 37.171, "v2": -34.187, "v3": 20.441, "v4": 2.839, "amplitude": 37.177, "phase_angle": 156.863, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.003, "origin": [ -12.526, -51.940, -16.149 ], "x_axis": [ 0.921, -0.389, 0.037 ], "y_axis": [ 0.375, 0.853, -0.364 ], "z_axis": [ 0.110, 0.349, 0.930 ], "quaternion": [ 0.962, -0.185, 0.019, -0.198 ] } }, { "index": 27, "index_chain": 6, "chain_name": "V", "nt_resnum": 6, "nt_name": "DC", "nt_code": "C", "nt_id": "///V/6", "linked_nts": [ "///V/5", "///V/7" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -44.931, "beta": 155.632, "gamma": 38.916, "delta": 98.391, "epsilon": 170.713, "zeta": -81.773, "epsilon_zeta": -107.514, "bb_type": "BI", "chi": -132.742, "glyco_bond": "anti", "C5prime_xyz": [ -2.363, 8.811, -1.245 ], "P_xyz": [ -0.044, 9.988, -1.293 ], "form": "B", "ssZp": 3.038, "Dp": 3.134, "splay_angle": 17.797, "splay_distance": 2.961, "splay_ratio": 0.157, "d22": null, "d64": null, "eta": 166.791, "theta": -164.229, "eta_prime": -179.182, "theta_prime": -164.246, "eta_base": -131.365, "theta_base": -124.786, "v0": -30.138, "v1": 14.634, "v2": 4.857, "v3": -22.241, "v4": 33.163, "amplitude": 32.909, "phase_angle": 81.514, "puckering": "O4'-endo", "sugar_class": "--", "bin": "23p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.064, "frame": { "rmsd": 0.003, "origin": [ -11.734, -51.084, -12.728 ], "x_axis": [ 0.965, 0.113, -0.236 ], "y_axis": [ -0.190, 0.924, -0.333 ], "z_axis": [ 0.180, 0.366, 0.913 ], "quaternion": [ 0.975, -0.179, 0.107, 0.078 ] } }, { "index": 28, "index_chain": 7, "chain_name": "V", "nt_resnum": 7, "nt_name": "DG", "nt_code": "G", "nt_id": "///V/7", "linked_nts": [ "///V/6", "///V/8" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -65.617, "beta": -173.225, "gamma": 57.315, "delta": 143.609, "epsilon": -178.985, "zeta": -115.509, "epsilon_zeta": -63.476, "bb_type": "BI", "chi": -109.873, "glyco_bond": "anti", "C5prime_xyz": [ -1.713, 8.327, -1.726 ], "P_xyz": [ 0.813, 8.998, -1.426 ], "form": ".", "ssZp": 2.182, "Dp": 2.191, "splay_angle": 22.690, "splay_distance": 3.876, "splay_ratio": 0.198, "d22": null, "d64": null, "eta": 168.208, "theta": -140.700, "eta_prime": -162.087, "theta_prime": -159.699, "eta_base": -118.071, "theta_base": -133.818, "v0": -16.195, "v1": 31.021, "v2": -33.197, "v3": 24.500, "v4": -5.441, "amplitude": 33.668, "phase_angle": 170.403, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1b", "suiteness": 0.081, "filter_rmsd": 0.010, "frame": { "rmsd": 0.010, "origin": [ -11.069, -49.841, -10.125 ], "x_axis": [ 0.668, 0.622, -0.408 ], "y_axis": [ -0.675, 0.738, 0.021 ], "z_axis": [ 0.314, 0.261, 0.913 ], "quaternion": [ 0.911, -0.066, 0.198, 0.356 ] } }, { "index": 29, "index_chain": 8, "chain_name": "V", "nt_resnum": 8, "nt_name": "DT", "nt_code": "T", "nt_id": "///V/8", "linked_nts": [ "///V/7", "///V/9" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -30.790, "beta": 172.642, "gamma": 31.583, "delta": 139.401, "epsilon": -166.976, "zeta": -103.109, "epsilon_zeta": -63.866, "bb_type": "BI", "chi": -117.216, "glyco_bond": "anti", "C5prime_xyz": [ -2.135, 8.552, -1.459 ], "P_xyz": [ -0.050, 9.987, -0.766 ], "form": "B", "ssZp": 2.052, "Dp": 2.123, "splay_angle": 16.723, "splay_distance": 2.855, "splay_ratio": 0.147, "d22": 4.512, "d64": 3.802, "eta": 178.146, "theta": -137.232, "eta_prime": -162.191, "theta_prime": -146.849, "eta_base": -129.264, "theta_base": -103.979, "v0": -25.374, "v1": 37.287, "v2": -34.471, "v3": 20.781, "v4": 2.591, "amplitude": 37.377, "phase_angle": 157.258, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.003, "origin": [ -9.598, -49.961, -6.541 ], "x_axis": [ 0.302, 0.890, -0.341 ], "y_axis": [ -0.923, 0.363, 0.131 ], "z_axis": [ 0.240, 0.275, 0.931 ], "quaternion": [ 0.805, -0.045, 0.180, 0.563 ] } }, { "index": 30, "index_chain": 9, "chain_name": "V", "nt_resnum": 9, "nt_name": "DC", "nt_code": "C", "nt_id": "///V/9", "linked_nts": [ "///V/8", "///V/10" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -55.158, "beta": 179.632, "gamma": 35.275, "delta": 135.505, "epsilon": -166.953, "zeta": -140.759, "epsilon_zeta": -26.194, "bb_type": "--", "chi": -95.514, "glyco_bond": "anti", "C5prime_xyz": [ -2.531, 7.977, -2.439 ], "P_xyz": [ -0.463, 9.504, -2.812 ], "form": ".", "ssZp": 1.892, "Dp": 2.082, "splay_angle": 23.094, "splay_distance": 3.931, "splay_ratio": 0.216, "d22": null, "d64": null, "eta": 166.907, "theta": -172.538, "eta_prime": -169.206, "theta_prime": -174.711, "eta_base": -120.449, "theta_base": -116.807, "v0": -26.949, "v1": 36.317, "v2": -31.479, "v3": 16.898, "v4": 6.056, "amplitude": 35.792, "phase_angle": 151.582, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.004, "origin": [ -8.516, -48.657, -4.243 ], "x_axis": [ -0.299, 0.944, -0.141 ], "y_axis": [ -0.841, -0.191, 0.506 ], "z_axis": [ 0.451, 0.270, 0.851 ], "quaternion": [ 0.583, 0.101, 0.254, 0.765 ] } }, { "index": 31, "index_chain": 10, "chain_name": "V", "nt_resnum": 10, "nt_name": "DG", "nt_code": "G", "nt_id": "///V/10", "linked_nts": [ "///V/9", "///V/11" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop", "alpha": -27.092, "beta": 164.055, "gamma": 33.176, "delta": 148.200, "epsilon": 164.048, "zeta": -83.013, "epsilon_zeta": -112.939, "bb_type": "BI", "chi": -92.417, "glyco_bond": "anti", "C5prime_xyz": [ -1.612, 7.626, -2.313 ], "P_xyz": [ 0.924, 8.048, -2.076 ], "form": ".", "ssZp": 1.589, "Dp": 1.798, "splay_angle": 26.956, "splay_distance": 4.348, "splay_ratio": 0.242, "d22": null, "d64": null, "eta": 169.634, "theta": -120.045, "eta_prime": -159.228, "theta_prime": -144.736, "eta_base": -104.276, "theta_base": -76.250, "v0": -1.867, "v1": 20.643, "v2": -30.500, "v3": 30.274, "v4": -18.241, "amplitude": 31.648, "phase_angle": 195.485, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.004, "frame": { "rmsd": 0.004, "origin": [ -8.481, -48.014, -0.365 ], "x_axis": [ -0.808, 0.539, 0.236 ], "y_axis": [ -0.368, -0.776, 0.513 ], "z_axis": [ 0.460, 0.328, 0.825 ], "quaternion": [ 0.246, 0.188, 0.228, 0.923 ] } }, { "index": 32, "index_chain": 11, "chain_name": "V", "nt_resnum": 11, "nt_name": "DA", "nt_code": "A", "nt_id": "///V/11", "linked_nts": [ "///V/10", "///V/12" ], "nt_type": "DNA", "dbn": ".", "summary": "~C3'-endo,BI,non-pair-contact,internal-loop", "alpha": -76.233, "beta": -156.035, "gamma": 45.282, "delta": 104.966, "epsilon": 147.444, "zeta": -81.488, "epsilon_zeta": -131.068, "bb_type": "BI", "chi": -89.619, "glyco_bond": "--", "C5prime_xyz": [ -2.051, 7.205, -2.850 ], "P_xyz": [ 0.448, 7.639, -3.424 ], "form": ".", "ssZp": 1.472, "Dp": 3.254, "splay_angle": 53.444, "splay_distance": 8.782, "splay_ratio": 0.450, "d22": null, "d64": null, "eta": 169.194, "theta": 176.763, "eta_prime": -168.583, "theta_prime": 177.070, "eta_base": -94.904, "theta_base": -179.427, "v0": 7.066, "v1": -16.911, "v2": 19.709, "v3": -16.148, "v4": 5.872, "amplitude": 19.719, "phase_angle": 358.152, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.035, "frame": { "rmsd": 0.006, "origin": [ -9.329, -48.442, 3.878 ], "x_axis": [ -0.731, -0.293, 0.616 ], "y_axis": [ 0.559, -0.774, 0.296 ], "z_axis": [ 0.390, 0.561, 0.730 ], "quaternion": [ -0.237, 0.280, 0.238, 0.899 ] } }, { "index": 33, "index_chain": 12, "chain_name": "V", "nt_resnum": 12, "nt_name": "DT", "nt_code": "T", "nt_id": "///V/12", "linked_nts": [ "///V/11", "///V/13" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop", "alpha": -74.580, "beta": -141.512, "gamma": 62.283, "delta": 135.267, "epsilon": 179.244, "zeta": -96.255, "epsilon_zeta": -84.501, "bb_type": "BI", "chi": -115.176, "glyco_bond": "anti", "C5prime_xyz": [ -1.819, 8.438, -1.559 ], "P_xyz": [ 0.248, 9.513, -0.412 ], "form": "B", "ssZp": 1.735, "Dp": 1.927, "splay_angle": 18.356, "splay_distance": 3.254, "splay_ratio": 0.163, "d22": 4.014, "d64": 3.590, "eta": -171.356, "theta": -107.506, "eta_prime": -165.994, "theta_prime": -133.934, "eta_base": -167.072, "theta_base": -83.522, "v0": -16.249, "v1": 27.345, "v2": -27.683, "v3": 19.179, "v4": -2.147, "amplitude": 28.613, "phase_angle": 165.353, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.008, "origin": [ -1.956, -44.480, 6.533 ], "x_axis": [ -0.958, -0.121, 0.259 ], "y_axis": [ 0.113, -0.993, -0.044 ], "z_axis": [ 0.263, -0.012, 0.965 ], "quaternion": [ -0.059, 0.132, -0.014, 0.989 ] } }, { "index": 34, "index_chain": 13, "chain_name": "V", "nt_resnum": 13, "nt_name": "DC", "nt_code": "C", "nt_id": "///V/13", "linked_nts": [ "///V/12", "///V/14" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop", "alpha": 149.156, "beta": -157.398, "gamma": 170.411, "delta": 96.483, "epsilon": -159.733, "zeta": -86.534, "epsilon_zeta": -73.199, "bb_type": "BI", "chi": -141.727, "glyco_bond": "anti", "C5prime_xyz": [ -2.270, 8.973, -0.786 ], "P_xyz": [ -0.849, 9.936, -2.668 ], "form": "B", "ssZp": 3.025, "Dp": 3.218, "splay_angle": 18.639, "splay_distance": 3.208, "splay_ratio": 0.165, "d22": null, "d64": null, "eta": 163.346, "theta": -177.676, "eta_prime": -179.510, "theta_prime": -168.099, "eta_base": -117.733, "theta_base": -135.215, "v0": -29.690, "v1": 14.116, "v2": 5.419, "v3": -22.688, "v4": 33.276, "amplitude": 32.867, "phase_angle": 80.511, "puckering": "O4'-endo", "sugar_class": "--", "bin": "23t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.003, "origin": [ -2.545, -44.898, 9.706 ], "x_axis": [ -0.667, -0.717, 0.201 ], "y_axis": [ 0.724, -0.688, -0.051 ], "z_axis": [ 0.175, 0.111, 0.978 ], "quaternion": [ -0.395, 0.103, 0.016, 0.913 ] } }, { "index": 35, "index_chain": 14, "chain_name": "V", "nt_resnum": 14, "nt_name": "DG", "nt_code": "G", "nt_id": "///V/14", "linked_nts": [ "///V/13", "///V/15" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -49.320, "beta": -178.237, "gamma": 35.356, "delta": 143.520, "epsilon": -166.004, "zeta": -107.749, "epsilon_zeta": -58.255, "bb_type": "BI", "chi": -98.308, "glyco_bond": "anti", "C5prime_xyz": [ -2.066, 7.979, -2.186 ], "P_xyz": [ 0.211, 9.216, -2.046 ], "form": ".", "ssZp": 1.838, "Dp": 2.038, "splay_angle": 14.608, "splay_distance": 2.555, "splay_ratio": 0.128, "d22": null, "d64": null, "eta": 167.820, "theta": -136.996, "eta_prime": -163.206, "theta_prime": -153.102, "eta_base": -128.745, "theta_base": -118.457, "v0": -16.902, "v1": 31.101, "v2": -32.767, "v3": 24.012, "v4": -4.696, "amplitude": 33.361, "phase_angle": 169.169, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1b", "suiteness": 0.154, "filter_rmsd": 0.005, "frame": { "rmsd": 0.005, "origin": [ -1.949, -44.945, 12.858 ], "x_axis": [ -0.206, -0.977, -0.048 ], "y_axis": [ 0.976, -0.209, 0.054 ], "z_axis": [ -0.063, -0.036, 0.997 ], "quaternion": [ 0.629, 0.036, -0.006, -0.777 ] } }, { "index": 36, "index_chain": 15, "chain_name": "V", "nt_resnum": 15, "nt_name": "DC", "nt_code": "C", "nt_id": "///V/15", "linked_nts": [ "///V/14", "///V/16" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -60.875, "beta": 156.805, "gamma": 52.953, "delta": 115.573, "epsilon": -166.791, "zeta": -118.978, "epsilon_zeta": -47.813, "bb_type": "BI", "chi": -114.134, "glyco_bond": "anti", "C5prime_xyz": [ -3.034, 8.444, -1.851 ], "P_xyz": [ -0.938, 9.712, -2.722 ], "form": "B", "ssZp": 2.713, "Dp": 2.713, "splay_angle": 24.010, "splay_distance": 4.003, "splay_ratio": 0.210, "d22": null, "d64": null, "eta": 162.050, "theta": -167.349, "eta_prime": -177.956, "theta_prime": -176.036, "eta_base": -136.294, "theta_base": -129.168, "v0": -40.427, "v1": 36.712, "v2": -19.429, "v3": -3.220, "v4": 27.221, "amplitude": 39.992, "phase_angle": 119.066, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.005, "origin": [ -2.439, -45.452, 15.313 ], "x_axis": [ 0.270, -0.962, -0.050 ], "y_axis": [ 0.930, 0.247, 0.272 ], "z_axis": [ -0.249, -0.119, 0.961 ], "quaternion": [ 0.787, 0.124, -0.063, -0.601 ] } }, { "index": 37, "index_chain": 16, "chain_name": "V", "nt_resnum": 16, "nt_name": "DA", "nt_code": "A", "nt_id": "///V/16", "linked_nts": [ "///V/15", "///V/17" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -58.181, "beta": 160.100, "gamma": 48.508, "delta": 101.544, "epsilon": -169.367, "zeta": -81.599, "epsilon_zeta": -87.767, "bb_type": "BI", "chi": -145.830, "glyco_bond": "anti", "C5prime_xyz": [ -1.595, 8.767, -0.360 ], "P_xyz": [ 0.981, 9.226, -0.263 ], "form": ".", "ssZp": 3.583, "Dp": 3.705, "splay_angle": 17.880, "splay_distance": 2.984, "splay_ratio": 0.155, "d22": null, "d64": null, "eta": 167.565, "theta": -144.289, "eta_prime": 177.191, "theta_prime": -144.831, "eta_base": -128.607, "theta_base": -126.205, "v0": -11.943, "v1": -1.374, "v2": 12.992, "v3": -20.134, "v4": 20.356, "amplitude": 21.072, "phase_angle": 51.935, "puckering": "C4'-exo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.037, "frame": { "rmsd": 0.007, "origin": [ -2.667, -46.330, 19.212 ], "x_axis": [ 0.834, -0.544, -0.092 ], "y_axis": [ 0.551, 0.818, 0.164 ], "z_axis": [ -0.014, -0.188, 0.982 ], "quaternion": [ 0.953, 0.092, 0.021, -0.287 ] } }, { "index": 38, "index_chain": 17, "chain_name": "V", "nt_resnum": 17, "nt_name": "DT", "nt_code": "T", "nt_id": "///V/17", "linked_nts": [ "///V/16", "///V/18" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -44.296, "beta": 175.099, "gamma": 43.514, "delta": 143.105, "epsilon": -163.046, "zeta": -114.893, "epsilon_zeta": -48.152, "bb_type": "BI", "chi": -108.796, "glyco_bond": "anti", "C5prime_xyz": [ -2.212, 8.374, -1.764 ], "P_xyz": [ 0.125, 9.542, -1.364 ], "form": "B", "ssZp": 2.012, "Dp": 2.047, "splay_angle": 23.594, "splay_distance": 4.039, "splay_ratio": 0.205, "d22": 4.053, "d64": 3.679, "eta": 173.842, "theta": -132.257, "eta_prime": -153.483, "theta_prime": -144.766, "eta_base": -127.067, "theta_base": -98.825, "v0": -23.579, "v1": 37.216, "v2": -36.062, "v3": 23.372, "v4": -0.148, "amplitude": 38.042, "phase_angle": 161.436, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1b", "suiteness": 0.151, "filter_rmsd": 0.106, "frame": { "rmsd": 0.002, "origin": [ -3.018, -47.579, 21.900 ], "x_axis": [ 0.992, -0.102, -0.072 ], "y_axis": [ 0.122, 0.911, 0.394 ], "z_axis": [ 0.026, -0.399, 0.916 ], "quaternion": [ 0.977, 0.203, 0.025, -0.057 ] } }, { "index": 39, "index_chain": 18, "chain_name": "V", "nt_resnum": 18, "nt_name": "DC", "nt_code": "C", "nt_id": "///V/18", "linked_nts": [ "///V/17", "///V/19" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -32.980, "beta": 167.814, "gamma": 19.588, "delta": 139.437, "epsilon": -173.767, "zeta": -119.339, "epsilon_zeta": -54.428, "bb_type": "BI", "chi": -106.985, "glyco_bond": "anti", "C5prime_xyz": [ -2.345, 8.371, -1.838 ], "P_xyz": [ -0.278, 9.920, -1.478 ], "form": "B", "ssZp": 2.421, "Dp": 2.369, "splay_angle": 19.402, "splay_distance": 3.178, "splay_ratio": 0.169, "d22": null, "d64": null, "eta": 162.293, "theta": -153.453, "eta_prime": -171.167, "theta_prime": -157.459, "eta_base": -115.979, "theta_base": -119.862, "v0": -27.823, "v1": 38.820, "v2": -34.490, "v3": 19.238, "v4": 5.071, "amplitude": 38.474, "phase_angle": 153.694, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.064, "frame": { "rmsd": 0.005, "origin": [ -1.603, -48.823, 25.472 ], "x_axis": [ 0.829, 0.554, 0.077 ], "y_axis": [ -0.548, 0.776, 0.313 ], "z_axis": [ 0.114, -0.302, 0.947 ], "quaternion": [ 0.942, 0.163, 0.010, 0.292 ] } }, { "index": 40, "index_chain": 19, "chain_name": "V", "nt_resnum": 19, "nt_name": "DA", "nt_code": "A", "nt_id": "///V/19", "linked_nts": [ "///V/18", "///V/20" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -36.133, "beta": 179.409, "gamma": 30.026, "delta": 147.238, "epsilon": -167.730, "zeta": -114.093, "epsilon_zeta": -53.637, "bb_type": "BI", "chi": -94.529, "glyco_bond": "anti", "C5prime_xyz": [ -2.150, 7.831, -2.273 ], "P_xyz": [ 0.109, 9.132, -2.074 ], "form": "B", "ssZp": 1.834, "Dp": 2.002, "splay_angle": 18.145, "splay_distance": 3.192, "splay_ratio": 0.160, "d22": null, "d64": null, "eta": 175.063, "theta": -136.430, "eta_prime": -164.783, "theta_prime": -154.140, "eta_base": -124.301, "theta_base": -121.510, "v0": -15.637, "v1": 31.819, "v2": -35.033, "v3": 26.977, "v4": -7.406, "amplitude": 35.290, "phase_angle": 173.086, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.036, "frame": { "rmsd": 0.005, "origin": [ -0.977, -49.574, 28.496 ], "x_axis": [ 0.361, 0.919, 0.159 ], "y_axis": [ -0.890, 0.289, 0.351 ], "z_axis": [ 0.277, -0.268, 0.923 ], "quaternion": [ 0.802, 0.193, 0.037, 0.564 ] } }, { "index": 41, "index_chain": 20, "chain_name": "V", "nt_resnum": 20, "nt_name": "DG", "nt_code": "G", "nt_id": "///V/20", "linked_nts": [ "///V/19", "///V/21" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -47.594, "beta": 157.507, "gamma": 45.240, "delta": 98.602, "epsilon": 177.631, "zeta": -84.804, "epsilon_zeta": -97.565, "bb_type": "BI", "chi": -119.813, "glyco_bond": "anti", "C5prime_xyz": [ -3.046, 8.395, -1.887 ], "P_xyz": [ -1.031, 9.876, -2.538 ], "form": "B", "ssZp": 2.582, "Dp": 2.833, "splay_angle": 16.298, "splay_distance": 2.783, "splay_ratio": 0.142, "d22": null, "d64": null, "eta": 171.165, "theta": -162.200, "eta_prime": -174.596, "theta_prime": -164.543, "eta_base": -135.783, "theta_base": -121.744, "v0": -37.999, "v1": 23.213, "v2": -1.236, "v3": -20.421, "v4": 36.960, "amplitude": 38.553, "phase_angle": 91.838, "puckering": "O4'-endo", "sugar_class": "--", "bin": "23p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.004, "frame": { "rmsd": 0.004, "origin": [ 0.428, -50.078, 31.317 ], "x_axis": [ -0.091, 0.949, 0.303 ], "y_axis": [ -0.915, -0.200, 0.351 ], "z_axis": [ 0.394, -0.246, 0.886 ], "quaternion": [ 0.632, 0.236, 0.036, 0.738 ] } }, { "index": 42, "index_chain": 21, "chain_name": "V", "nt_resnum": 21, "nt_name": "DC", "nt_code": "C", "nt_id": "///V/21", "linked_nts": [ "///V/20", null ], "nt_type": "DNA", "dbn": ")", "summary": "anti,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack", "alpha": -67.027, "beta": 179.582, "gamma": 55.074, "delta": 109.008, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": -102.813, "glyco_bond": "anti", "C5prime_xyz": [ -2.737, 8.071, -2.376 ], "P_xyz": [ -0.494, 9.127, -3.106 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": -27.511, "v1": 19.865, "v2": -5.762, "v3": -9.651, "v4": 23.478, "amplitude": 26.785, "phase_angle": 102.423, "puckering": "O4'-endo", "sugar_class": "--", "bin": "33p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.062, "frame": { "rmsd": 0.005, "origin": [ 1.060, -50.082, 34.027 ], "x_axis": [ -0.569, 0.701, 0.431 ], "y_axis": [ -0.568, -0.713, 0.410 ], "z_axis": [ 0.595, -0.012, 0.804 ], "quaternion": [ 0.361, 0.292, 0.113, 0.878 ] } } ], "num_hbonds": 585, "hbonds": [ { "index": 1, "atom1_serNum": 4, "atom2_serNum": 1786, "donAcc_type": "standard", "distance": 3.140, "atom1_id": "///A/43/O", "atom2_id": "///A/277/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2, "atom1_serNum": 25, "atom2_serNum": 41, "donAcc_type": "acceptable", "distance": 2.710, "atom1_id": "///A/45/OH", "atom2_id": "///A/47/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 3, "atom1_serNum": 42, "atom2_serNum": 1965, "donAcc_type": "standard", "distance": 2.960, "atom1_id": "///A/47/OD2", "atom2_id": "///A/300/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 4, "atom1_serNum": 46, "atom2_serNum": 1964, "donAcc_type": "standard", "distance": 2.587, "atom1_id": "///A/48/O", "atom2_id": "///A/299/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 5, "atom1_serNum": 53, "atom2_serNum": 65, "donAcc_type": "standard", "distance": 3.255, "atom1_id": "///A/49/O", "atom2_id": "///A/51/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 6, "atom1_serNum": 53, "atom2_serNum": 1949, "donAcc_type": "questionable", "distance": 3.366, "atom1_id": "///A/49/O", "atom2_id": "///A/297/OD2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 7, "atom1_serNum": 57, "atom2_serNum": 63, "donAcc_type": "standard", "distance": 2.802, "atom1_id": "///A/50/N", "atom2_id": "///A/50/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 8, "atom1_serNum": 63, "atom2_serNum": 1982, "donAcc_type": "standard", "distance": 2.885, "atom1_id": "///A/50/OD1", "atom2_id": "///A/301/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 9, "atom1_serNum": 64, "atom2_serNum": 1983, "donAcc_type": "standard", "distance": 2.858, "atom1_id": "///A/50/OD2", "atom2_id": "///A/301/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 10, "atom1_serNum": 64, "atom2_serNum": 2087, "donAcc_type": "acceptable", "distance": 2.605, "atom1_id": "///A/50/OD2", "atom2_id": "///A/315/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 11, "atom1_serNum": 65, "atom2_serNum": 1949, "donAcc_type": "standard", "distance": 2.965, "atom1_id": "///A/51/N", "atom2_id": "///A/297/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 12, "atom1_serNum": 72, "atom2_serNum": 90, "donAcc_type": "acceptable", "distance": 2.671, "atom1_id": "///A/51/OE1", "atom2_id": "///A/53/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 13, "atom1_serNum": 77, "atom2_serNum": 133, "donAcc_type": "standard", "distance": 2.863, "atom1_id": "///A/52/O", "atom2_id": "///A/60/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 14, "atom1_serNum": 94, "atom2_serNum": 120, "donAcc_type": "standard", "distance": 2.688, "atom1_id": "///A/54/N", "atom2_id": "///A/58/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 15, "atom1_serNum": 97, "atom2_serNum": 113, "donAcc_type": "standard", "distance": 2.518, "atom1_id": "///A/54/O", "atom2_id": "///A/57/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 16, "atom1_serNum": 99, "atom2_serNum": 112, "donAcc_type": "acceptable", "distance": 3.187, "atom1_id": "///A/54/OG", "atom2_id": "///A/56/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 17, "atom1_serNum": 99, "atom2_serNum": 117, "donAcc_type": "acceptable", "distance": 3.267, "atom1_id": "///A/54/OG", "atom2_id": "///A/58/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 18, "atom1_serNum": 138, "atom2_serNum": 2091, "donAcc_type": "standard", "distance": 2.803, "atom1_id": "///A/61/N", "atom2_id": "///A/316/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 19, "atom1_serNum": 143, "atom2_serNum": 2101, "donAcc_type": "acceptable", "distance": 3.058, "atom1_id": "///A/61/OG1", "atom2_id": "///A/318/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 20, "atom1_serNum": 143, "atom2_serNum": 2104, "donAcc_type": "acceptable", "distance": 2.886, "atom1_id": "///A/61/OG1", "atom2_id": "///A/318/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 21, "atom1_serNum": 145, "atom2_serNum": 2091, "donAcc_type": "standard", "distance": 2.964, "atom1_id": "///A/62/N", "atom2_id": "///A/316/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 22, "atom1_serNum": 148, "atom2_serNum": 2088, "donAcc_type": "standard", "distance": 2.896, "atom1_id": "///A/62/O", "atom2_id": "///A/316/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 23, "atom1_serNum": 153, "atom2_serNum": 383, "donAcc_type": "standard", "distance": 3.038, "atom1_id": "///A/63/N", "atom2_id": "///A/90/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 24, "atom1_serNum": 156, "atom2_serNum": 376, "donAcc_type": "standard", "distance": 2.728, "atom1_id": "///A/63/O", "atom2_id": "///A/90/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 25, "atom1_serNum": 156, "atom2_serNum": 384, "donAcc_type": "standard", "distance": 3.294, "atom1_id": "///A/63/O", "atom2_id": "///A/91/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 26, "atom1_serNum": 161, "atom2_serNum": 358, "donAcc_type": "standard", "distance": 3.157, "atom1_id": "///A/63/NZ", "atom2_id": "///A/87/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 27, "atom1_serNum": 161, "atom2_serNum": 2087, "donAcc_type": "acceptable", "distance": 2.796, "atom1_id": "///A/63/NZ", "atom2_id": "///A/315/OH", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 28, "atom1_serNum": 162, "atom2_serNum": 2071, "donAcc_type": "standard", "distance": 2.838, "atom1_id": "///A/64/N", "atom2_id": "///A/314/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 29, "atom1_serNum": 165, "atom2_serNum": 2068, "donAcc_type": "standard", "distance": 2.627, "atom1_id": "///A/64/O", "atom2_id": "///A/314/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 30, "atom1_serNum": 170, "atom2_serNum": 387, "donAcc_type": "standard", "distance": 2.992, "atom1_id": "///A/65/N", "atom2_id": "///A/91/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 31, "atom1_serNum": 173, "atom2_serNum": 400, "donAcc_type": "standard", "distance": 2.808, "atom1_id": "///A/65/O", "atom2_id": "///A/93/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 32, "atom1_serNum": 176, "atom2_serNum": 2056, "donAcc_type": "standard", "distance": 2.822, "atom1_id": "///A/66/N", "atom2_id": "///A/312/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 33, "atom1_serNum": 179, "atom2_serNum": 2053, "donAcc_type": "standard", "distance": 2.953, "atom1_id": "///A/66/O", "atom2_id": "///A/312/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 34, "atom1_serNum": 181, "atom2_serNum": 422, "donAcc_type": "acceptable", "distance": 3.146, "atom1_id": "///A/66/OG", "atom2_id": "///A/95/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 35, "atom1_serNum": 182, "atom2_serNum": 403, "donAcc_type": "standard", "distance": 2.743, "atom1_id": "///A/67/N", "atom2_id": "///A/93/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 36, "atom1_serNum": 185, "atom2_serNum": 414, "donAcc_type": "standard", "distance": 2.954, "atom1_id": "///A/67/O", "atom2_id": "///A/95/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 37, "atom1_serNum": 190, "atom2_serNum": 2033, "donAcc_type": "standard", "distance": 2.844, "atom1_id": "///A/67/NE1", "atom2_id": "///A/309/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 38, "atom1_serNum": 196, "atom2_serNum": 421, "donAcc_type": "standard", "distance": 2.995, "atom1_id": "///A/68/N", "atom2_id": "///A/95/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 39, "atom1_serNum": 199, "atom2_serNum": 2021, "donAcc_type": "acceptable", "distance": 2.919, "atom1_id": "///A/68/O", "atom2_id": "///A/307/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 40, "atom1_serNum": 202, "atom2_serNum": 211, "donAcc_type": "standard", "distance": 3.078, "atom1_id": "///A/68/OD1", "atom2_id": "///A/70/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 41, "atom1_serNum": 203, "atom2_serNum": 1238, "donAcc_type": "standard", "distance": 2.919, "atom1_id": "///A/68/ND2", "atom2_id": "///A/210/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 42, "atom1_serNum": 204, "atom2_serNum": 417, "donAcc_type": "standard", "distance": 3.062, "atom1_id": "///A/69/N", "atom2_id": "///A/95/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 43, "atom1_serNum": 218, "atom2_serNum": 1723, "donAcc_type": "acceptable", "distance": 2.771, "atom1_id": "///A/70/OD2", "atom2_id": "///A/269/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 44, "atom1_serNum": 219, "atom2_serNum": 426, "donAcc_type": "standard", "distance": 2.894, "atom1_id": "///A/71/N", "atom2_id": "///A/96/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 45, "atom1_serNum": 222, "atom2_serNum": 247, "donAcc_type": "standard", "distance": 2.919, "atom1_id": "///A/71/O", "atom2_id": "///A/75/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 46, "atom1_serNum": 223, "atom2_serNum": 435, "donAcc_type": "standard", "distance": 2.772, "atom1_id": "///A/72/N", "atom2_id": "///A/97/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 47, "atom1_serNum": 226, "atom2_serNum": 261, "donAcc_type": "standard", "distance": 2.933, "atom1_id": "///A/72/O", "atom2_id": "///A/76/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 48, "atom1_serNum": 234, "atom2_serNum": 269, "donAcc_type": "standard", "distance": 3.263, "atom1_id": "///A/73/O", "atom2_id": "///A/77/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 49, "atom1_serNum": 241, "atom2_serNum": 442, "donAcc_type": "standard", "distance": 2.994, "atom1_id": "///A/73/NH2", "atom2_id": "///A/98/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 50, "atom1_serNum": 241, "atom2_serNum": 4972, "donAcc_type": "standard", "distance": 3.167, "atom1_id": "///A/73/NH2", "atom2_id": "///V/16/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 51, "atom1_serNum": 242, "atom2_serNum": 4953, "donAcc_type": "standard", "distance": 3.181, "atom1_id": "///A/74/N", "atom2_id": "///V/15/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 52, "atom1_serNum": 245, "atom2_serNum": 278, "donAcc_type": "standard", "distance": 2.905, "atom1_id": "///A/74/O", "atom2_id": "///A/78/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 53, "atom1_serNum": 250, "atom2_serNum": 296, "donAcc_type": "standard", "distance": 2.970, "atom1_id": "///A/75/O", "atom2_id": "///A/80/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 54, "atom1_serNum": 264, "atom2_serNum": 287, "donAcc_type": "standard", "distance": 2.965, "atom1_id": "///A/76/O", "atom2_id": "///A/79/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 55, "atom1_serNum": 286, "atom2_serNum": 4931, "donAcc_type": "standard", "distance": 2.412, "atom1_id": "///A/78/NZ", "atom2_id": "///V/14/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 56, "atom1_serNum": 290, "atom2_serNum": 316, "donAcc_type": "standard", "distance": 3.450, "atom1_id": "///A/79/O", "atom2_id": "///A/83/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 57, "atom1_serNum": 299, "atom2_serNum": 330, "donAcc_type": "standard", "distance": 3.154, "atom1_id": "///A/80/O", "atom2_id": "///A/84/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 58, "atom1_serNum": 303, "atom2_serNum": 337, "donAcc_type": "standard", "distance": 3.155, "atom1_id": "///A/81/O", "atom2_id": "///A/85/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 59, "atom1_serNum": 311, "atom2_serNum": 346, "donAcc_type": "standard", "distance": 3.135, "atom1_id": "///A/82/O", "atom2_id": "///A/86/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 60, "atom1_serNum": 319, "atom2_serNum": 355, "donAcc_type": "standard", "distance": 2.949, "atom1_id": "///A/83/O", "atom2_id": "///A/87/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 61, "atom1_serNum": 333, "atom2_serNum": 364, "donAcc_type": "standard", "distance": 2.784, "atom1_id": "///A/84/O", "atom2_id": "///A/88/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 62, "atom1_serNum": 363, "atom2_serNum": 1980, "donAcc_type": "standard", "distance": 2.767, "atom1_id": "///A/87/OE2", "atom2_id": "///A/301/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 63, "atom1_serNum": 363, "atom2_serNum": 1983, "donAcc_type": "standard", "distance": 2.860, "atom1_id": "///A/87/OE2", "atom2_id": "///A/301/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 64, "atom1_serNum": 363, "atom2_serNum": 2066, "donAcc_type": "acceptable", "distance": 2.960, "atom1_id": "///A/87/OE2", "atom2_id": "///A/313/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 65, "atom1_serNum": 379, "atom2_serNum": 703, "donAcc_type": "standard", "distance": 2.794, "atom1_id": "///A/90/O", "atom2_id": "///A/136/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 66, "atom1_serNum": 382, "atom2_serNum": 710, "donAcc_type": "standard", "distance": 2.848, "atom1_id": "///A/90/OD1", "atom2_id": "///A/136/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 67, "atom1_serNum": 392, "atom2_serNum": 689, "donAcc_type": "standard", "distance": 2.663, "atom1_id": "///A/92/N", "atom2_id": "///A/134/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 68, "atom1_serNum": 395, "atom2_serNum": 686, "donAcc_type": "standard", "distance": 2.776, "atom1_id": "///A/92/O", "atom2_id": "///A/134/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 69, "atom1_serNum": 406, "atom2_serNum": 677, "donAcc_type": "standard", "distance": 2.806, "atom1_id": "///A/94/N", "atom2_id": "///A/132/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 70, "atom1_serNum": 409, "atom2_serNum": 674, "donAcc_type": "standard", "distance": 3.023, "atom1_id": "///A/94/O", "atom2_id": "///A/132/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 71, "atom1_serNum": 422, "atom2_serNum": 908, "donAcc_type": "acceptable", "distance": 3.245, "atom1_id": "///A/95/NE2", "atom2_id": "///A/169/OG1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 72, "atom1_serNum": 423, "atom2_serNum": 666, "donAcc_type": "standard", "distance": 2.848, "atom1_id": "///A/96/N", "atom2_id": "///A/130/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 73, "atom1_serNum": 431, "atom2_serNum": 926, "donAcc_type": "acceptable", "distance": 2.739, "atom1_id": "///A/96/OE2", "atom2_id": "///A/171/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 74, "atom1_serNum": 432, "atom2_serNum": 666, "donAcc_type": "standard", "distance": 2.990, "atom1_id": "///A/97/N", "atom2_id": "///A/130/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 75, "atom1_serNum": 439, "atom2_serNum": 660, "donAcc_type": "standard", "distance": 2.881, "atom1_id": "///A/98/N", "atom2_id": "///A/129/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 76, "atom1_serNum": 457, "atom2_serNum": 477, "donAcc_type": "standard", "distance": 2.879, "atom1_id": "///A/100/O", "atom2_id": "///A/103/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 77, "atom1_serNum": 457, "atom2_serNum": 486, "donAcc_type": "standard", "distance": 3.508, "atom1_id": "///A/100/O", "atom2_id": "///A/104/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 78, "atom1_serNum": 459, "atom2_serNum": 475, "donAcc_type": "acceptable", "distance": 2.571, "atom1_id": "///A/100/OG", "atom2_id": "///A/102/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 79, "atom1_serNum": 463, "atom2_serNum": 486, "donAcc_type": "standard", "distance": 3.236, "atom1_id": "///A/101/O", "atom2_id": "///A/104/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 80, "atom1_serNum": 468, "atom2_serNum": 2826, "donAcc_type": "standard", "distance": 2.841, "atom1_id": "///A/101/OE2", "atom2_id": "///B/138/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 81, "atom1_serNum": 497, "atom2_serNum": 515, "donAcc_type": "standard", "distance": 3.083, "atom1_id": "///A/105/O", "atom2_id": "///A/108/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 82, "atom1_serNum": 504, "atom2_serNum": 523, "donAcc_type": "standard", "distance": 2.993, "atom1_id": "///A/106/O", "atom2_id": "///A/109/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 83, "atom1_serNum": 506, "atom2_serNum": 513, "donAcc_type": "standard", "distance": 2.592, "atom1_id": "///A/107/N", "atom2_id": "///A/107/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 84, "atom1_serNum": 509, "atom2_serNum": 532, "donAcc_type": "standard", "distance": 2.907, "atom1_id": "///A/107/O", "atom2_id": "///A/110/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 85, "atom1_serNum": 518, "atom2_serNum": 592, "donAcc_type": "standard", "distance": 2.692, "atom1_id": "///A/108/O", "atom2_id": "///A/117/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 86, "atom1_serNum": 563, "atom2_serNum": 592, "donAcc_type": "standard", "distance": 3.089, "atom1_id": "///A/114/O", "atom2_id": "///A/117/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 87, "atom1_serNum": 574, "atom2_serNum": 698, "donAcc_type": "standard", "distance": 3.255, "atom1_id": "///A/116/N", "atom2_id": "///A/135/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 88, "atom1_serNum": 577, "atom2_serNum": 694, "donAcc_type": "standard", "distance": 2.946, "atom1_id": "///A/116/O", "atom2_id": "///A/135/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 89, "atom1_serNum": 580, "atom2_serNum": 706, "donAcc_type": "acceptable", "distance": 3.187, "atom1_id": "///A/116/ND1", "atom2_id": "///A/136/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 90, "atom1_serNum": 591, "atom2_serNum": 613, "donAcc_type": "standard", "distance": 3.740, "atom1_id": "///A/117/OE1", "atom2_id": "///A/119/NE1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 91, "atom1_serNum": 593, "atom2_serNum": 681, "donAcc_type": "standard", "distance": 2.892, "atom1_id": "///A/118/N", "atom2_id": "///A/133/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 92, "atom1_serNum": 596, "atom2_serNum": 678, "donAcc_type": "standard", "distance": 2.780, "atom1_id": "///A/118/O", "atom2_id": "///A/133/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 93, "atom1_serNum": 608, "atom2_serNum": 2682, "donAcc_type": "standard", "distance": 2.973, "atom1_id": "///A/119/O", "atom2_id": "///B/116/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 94, "atom1_serNum": 619, "atom2_serNum": 670, "donAcc_type": "standard", "distance": 2.810, "atom1_id": "///A/120/N", "atom2_id": "///A/131/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 95, "atom1_serNum": 622, "atom2_serNum": 667, "donAcc_type": "standard", "distance": 2.753, "atom1_id": "///A/120/O", "atom2_id": "///A/131/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 96, "atom1_serNum": 642, "atom2_serNum": 2841, "donAcc_type": "acceptable", "distance": 3.278, "atom1_id": "///A/123/OG", "atom2_id": "///B/140/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 97, "atom1_serNum": 662, "atom2_serNum": 792, "donAcc_type": "acceptable", "distance": 3.787, "atom1_id": "///A/129/OG", "atom2_id": "///A/154/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 98, "atom1_serNum": 663, "atom2_serNum": 797, "donAcc_type": "standard", "distance": 3.501, "atom1_id": "///A/130/N", "atom2_id": "///A/155/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 99, "atom1_serNum": 701, "atom2_serNum": 717, "donAcc_type": "acceptable", "distance": 2.689, "atom1_id": "///A/135/OG", "atom2_id": "///A/137/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 100, "atom1_serNum": 735, "atom2_serNum": 839, "donAcc_type": "standard", "distance": 2.580, "atom1_id": "///A/140/N", "atom2_id": "///A/161/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 101, "atom1_serNum": 743, "atom2_serNum": 839, "donAcc_type": "standard", "distance": 3.415, "atom1_id": "///A/141/N", "atom2_id": "///A/161/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 102, "atom1_serNum": 746, "atom2_serNum": 836, "donAcc_type": "standard", "distance": 2.795, "atom1_id": "///A/141/O", "atom2_id": "///A/161/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 103, "atom1_serNum": 752, "atom2_serNum": 2625, "donAcc_type": "standard", "distance": 3.502, "atom1_id": "///A/142/N", "atom2_id": "///B/109/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 104, "atom1_serNum": 759, "atom2_serNum": 827, "donAcc_type": "standard", "distance": 2.861, "atom1_id": "///A/143/N", "atom2_id": "///A/159/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 105, "atom1_serNum": 762, "atom2_serNum": 824, "donAcc_type": "standard", "distance": 2.895, "atom1_id": "///A/143/O", "atom2_id": "///A/159/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 106, "atom1_serNum": 776, "atom2_serNum": 2672, "donAcc_type": "acceptable", "distance": 2.610, "atom1_id": "///A/144/OH", "atom2_id": "///B/115/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 107, "atom1_serNum": 777, "atom2_serNum": 812, "donAcc_type": "standard", "distance": 3.103, "atom1_id": "///A/145/N", "atom2_id": "///A/157/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 108, "atom1_serNum": 801, "atom2_serNum": 915, "donAcc_type": "standard", "distance": 2.936, "atom1_id": "///A/156/O", "atom2_id": "///A/171/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 109, "atom1_serNum": 807, "atom2_serNum": 918, "donAcc_type": "standard", "distance": 2.959, "atom1_id": "///A/156/NH1", "atom2_id": "///A/171/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 110, "atom1_serNum": 816, "atom2_serNum": 906, "donAcc_type": "standard", "distance": 3.147, "atom1_id": "///A/158/N", "atom2_id": "///A/169/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 111, "atom1_serNum": 819, "atom2_serNum": 903, "donAcc_type": "standard", "distance": 3.072, "atom1_id": "///A/158/O", "atom2_id": "///A/169/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 112, "atom1_serNum": 831, "atom2_serNum": 891, "donAcc_type": "standard", "distance": 2.874, "atom1_id": "///A/160/N", "atom2_id": "///A/167/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 113, "atom1_serNum": 834, "atom2_serNum": 888, "donAcc_type": "standard", "distance": 2.837, "atom1_id": "///A/160/O", "atom2_id": "///A/167/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 114, "atom1_serNum": 843, "atom2_serNum": 1190, "donAcc_type": "standard", "distance": 3.290, "atom1_id": "///A/161/OE1", "atom2_id": "///A/203/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 115, "atom1_serNum": 845, "atom2_serNum": 873, "donAcc_type": "standard", "distance": 2.848, "atom1_id": "///A/162/N", "atom2_id": "///A/165/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 116, "atom1_serNum": 848, "atom2_serNum": 1190, "donAcc_type": "standard", "distance": 3.009, "atom1_id": "///A/162/O", "atom2_id": "///A/203/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 117, "atom1_serNum": 859, "atom2_serNum": 1190, "donAcc_type": "standard", "distance": 2.451, "atom1_id": "///A/163/O", "atom2_id": "///A/203/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 118, "atom1_serNum": 881, "atom2_serNum": 1194, "donAcc_type": "standard", "distance": 3.075, "atom1_id": "///A/166/N", "atom2_id": "///A/204/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 119, "atom1_serNum": 884, "atom2_serNum": 1206, "donAcc_type": "standard", "distance": 2.847, "atom1_id": "///A/166/O", "atom2_id": "///A/206/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 120, "atom1_serNum": 896, "atom2_serNum": 1209, "donAcc_type": "standard", "distance": 2.759, "atom1_id": "///A/168/N", "atom2_id": "///A/206/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 121, "atom1_serNum": 899, "atom2_serNum": 1221, "donAcc_type": "standard", "distance": 2.853, "atom1_id": "///A/168/O", "atom2_id": "///A/208/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 122, "atom1_serNum": 910, "atom2_serNum": 1224, "donAcc_type": "standard", "distance": 3.032, "atom1_id": "///A/170/N", "atom2_id": "///A/208/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 123, "atom1_serNum": 913, "atom2_serNum": 1231, "donAcc_type": "standard", "distance": 3.143, "atom1_id": "///A/170/O", "atom2_id": "///A/210/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 124, "atom1_serNum": 927, "atom2_serNum": 1234, "donAcc_type": "standard", "distance": 2.986, "atom1_id": "///A/172/N", "atom2_id": "///A/210/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 125, "atom1_serNum": 930, "atom2_serNum": 1254, "donAcc_type": "standard", "distance": 2.464, "atom1_id": "///A/172/O", "atom2_id": "///A/212/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 126, "atom1_serNum": 937, "atom2_serNum": 1041, "donAcc_type": "standard", "distance": 3.177, "atom1_id": "///A/173/O", "atom2_id": "///A/185/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 127, "atom1_serNum": 947, "atom2_serNum": 949, "donAcc_type": "standard", "distance": 2.804, "atom1_id": "///A/174/OD1", "atom2_id": "///A/175/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 128, "atom1_serNum": 947, "atom2_serNum": 954, "donAcc_type": "standard", "distance": 2.659, "atom1_id": "///A/174/OD1", "atom2_id": "///A/176/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 129, "atom1_serNum": 948, "atom2_serNum": 4454, "donAcc_type": "standard", "distance": 3.426, "atom1_id": "///A/174/ND2", "atom2_id": "///P/11/O4'", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 130, "atom1_serNum": 952, "atom2_serNum": 992, "donAcc_type": "standard", "distance": 2.942, "atom1_id": "///A/175/O", "atom2_id": "///A/181/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 131, "atom1_serNum": 957, "atom2_serNum": 973, "donAcc_type": "standard", "distance": 3.202, "atom1_id": "///A/176/O", "atom2_id": "///A/179/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 132, "atom1_serNum": 961, "atom2_serNum": 981, "donAcc_type": "standard", "distance": 3.446, "atom1_id": "///A/177/O", "atom2_id": "///A/180/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 133, "atom1_serNum": 965, "atom2_serNum": 4463, "donAcc_type": "standard", "distance": 3.244, "atom1_id": "///A/177/NE", "atom2_id": "///P/12/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 134, "atom1_serNum": 976, "atom2_serNum": 1003, "donAcc_type": "standard", "distance": 2.995, "atom1_id": "///A/179/O", "atom2_id": "///A/182/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 135, "atom1_serNum": 995, "atom2_serNum": 1032, "donAcc_type": "standard", "distance": 3.138, "atom1_id": "///A/181/O", "atom2_id": "///A/185/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 136, "atom1_serNum": 1006, "atom2_serNum": 1043, "donAcc_type": "standard", "distance": 2.964, "atom1_id": "///A/182/O", "atom2_id": "///A/186/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 137, "atom1_serNum": 1014, "atom2_serNum": 1052, "donAcc_type": "standard", "distance": 2.946, "atom1_id": "///A/183/O", "atom2_id": "///A/187/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 138, "atom1_serNum": 1023, "atom2_serNum": 1063, "donAcc_type": "standard", "distance": 2.621, "atom1_id": "///A/184/O", "atom2_id": "///A/188/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 139, "atom1_serNum": 1035, "atom2_serNum": 1077, "donAcc_type": "standard", "distance": 2.741, "atom1_id": "///A/185/O", "atom2_id": "///A/189/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 140, "atom1_serNum": 1039, "atom2_serNum": 1083, "donAcc_type": "standard", "distance": 2.800, "atom1_id": "///A/185/NE", "atom2_id": "///A/189/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 141, "atom1_serNum": 1041, "atom2_serNum": 1250, "donAcc_type": "standard", "distance": 3.041, "atom1_id": "///A/185/NH1", "atom2_id": "///A/212/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 142, "atom1_serNum": 1041, "atom2_serNum": 1443, "donAcc_type": "standard", "distance": 3.263, "atom1_id": "///A/185/NH1", "atom2_id": "///A/236/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 143, "atom1_serNum": 1042, "atom2_serNum": 1242, "donAcc_type": "standard", "distance": 3.244, "atom1_id": "///A/185/NH2", "atom2_id": "///A/211/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 144, "atom1_serNum": 1042, "atom2_serNum": 1250, "donAcc_type": "standard", "distance": 3.203, "atom1_id": "///A/185/NH2", "atom2_id": "///A/212/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 145, "atom1_serNum": 1046, "atom2_serNum": 1085, "donAcc_type": "standard", "distance": 3.288, "atom1_id": "///A/186/O", "atom2_id": "///A/190/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 146, "atom1_serNum": 1055, "atom2_serNum": 1094, "donAcc_type": "standard", "distance": 3.101, "atom1_id": "///A/187/O", "atom2_id": "///A/191/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 147, "atom1_serNum": 1066, "atom2_serNum": 1099, "donAcc_type": "standard", "distance": 2.748, "atom1_id": "///A/188/O", "atom2_id": "///A/192/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 148, "atom1_serNum": 1080, "atom2_serNum": 1110, "donAcc_type": "standard", "distance": 2.964, "atom1_id": "///A/189/O", "atom2_id": "///A/193/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 149, "atom1_serNum": 1088, "atom2_serNum": 1121, "donAcc_type": "standard", "distance": 3.036, "atom1_id": "///A/190/O", "atom2_id": "///A/194/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 150, "atom1_serNum": 1092, "atom2_serNum": 1129, "donAcc_type": "standard", "distance": 3.141, "atom1_id": "///A/190/OE1", "atom2_id": "///A/194/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 151, "atom1_serNum": 1097, "atom2_serNum": 1130, "donAcc_type": "standard", "distance": 2.907, "atom1_id": "///A/191/O", "atom2_id": "///A/195/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 152, "atom1_serNum": 1102, "atom2_serNum": 1141, "donAcc_type": "standard", "distance": 2.666, "atom1_id": "///A/192/O", "atom2_id": "///A/196/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 153, "atom1_serNum": 1113, "atom2_serNum": 1149, "donAcc_type": "standard", "distance": 2.849, "atom1_id": "///A/193/O", "atom2_id": "///A/197/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 154, "atom1_serNum": 1119, "atom2_serNum": 1467, "donAcc_type": "standard", "distance": 3.302, "atom1_id": "///A/193/NH1", "atom2_id": "///A/239/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 155, "atom1_serNum": 1124, "atom2_serNum": 1154, "donAcc_type": "standard", "distance": 2.991, "atom1_id": "///A/194/O", "atom2_id": "///A/198/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 156, "atom1_serNum": 1144, "atom2_serNum": 1158, "donAcc_type": "standard", "distance": 3.160, "atom1_id": "///A/196/O", "atom2_id": "///A/199/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 157, "atom1_serNum": 1152, "atom2_serNum": 1158, "donAcc_type": "standard", "distance": 2.898, "atom1_id": "///A/197/O", "atom2_id": "///A/199/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 158, "atom1_serNum": 1157, "atom2_serNum": 1166, "donAcc_type": "standard", "distance": 3.221, "atom1_id": "///A/198/O", "atom2_id": "///A/200/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 159, "atom1_serNum": 1176, "atom2_serNum": 1182, "donAcc_type": "acceptable", "distance": 3.333, "atom1_id": "///A/201/OG", "atom2_id": "///A/203/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 160, "atom1_serNum": 1198, "atom2_serNum": 1883, "donAcc_type": "acceptable", "distance": 2.471, "atom1_id": "///A/205/N", "atom2_id": "///A/288/OG", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 161, "atom1_serNum": 1201, "atom2_serNum": 1878, "donAcc_type": "standard", "distance": 3.069, "atom1_id": "///A/205/O", "atom2_id": "///A/288/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 162, "atom1_serNum": 1201, "atom2_serNum": 1883, "donAcc_type": "acceptable", "distance": 3.084, "atom1_id": "///A/205/O", "atom2_id": "///A/288/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 163, "atom1_serNum": 1213, "atom2_serNum": 1865, "donAcc_type": "standard", "distance": 2.911, "atom1_id": "///A/207/N", "atom2_id": "///A/286/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 164, "atom1_serNum": 1216, "atom2_serNum": 1862, "donAcc_type": "standard", "distance": 2.648, "atom1_id": "///A/207/O", "atom2_id": "///A/286/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 165, "atom1_serNum": 1227, "atom2_serNum": 1842, "donAcc_type": "standard", "distance": 3.112, "atom1_id": "///A/209/N", "atom2_id": "///A/284/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 166, "atom1_serNum": 1230, "atom2_serNum": 1839, "donAcc_type": "standard", "distance": 3.086, "atom1_id": "///A/209/O", "atom2_id": "///A/284/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 167, "atom1_serNum": 1237, "atom2_serNum": 1247, "donAcc_type": "standard", "distance": 3.121, "atom1_id": "///A/210/OD1", "atom2_id": "///A/212/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 168, "atom1_serNum": 1239, "atom2_serNum": 1826, "donAcc_type": "standard", "distance": 2.911, "atom1_id": "///A/211/N", "atom2_id": "///A/282/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 169, "atom1_serNum": 1247, "atom2_serNum": 1826, "donAcc_type": "standard", "distance": 3.406, "atom1_id": "///A/212/N", "atom2_id": "///A/282/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 170, "atom1_serNum": 1258, "atom2_serNum": 1815, "donAcc_type": "questionable", "distance": 3.221, "atom1_id": "///A/213/O", "atom2_id": "///A/281/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 171, "atom1_serNum": 1258, "atom2_serNum": 1850, "donAcc_type": "acceptable", "distance": 2.819, "atom1_id": "///A/213/O", "atom2_id": "///A/284/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 172, "atom1_serNum": 1262, "atom2_serNum": 1400, "donAcc_type": "standard", "distance": 2.835, "atom1_id": "///A/214/N", "atom2_id": "///A/231/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 173, "atom1_serNum": 1267, "atom2_serNum": 1850, "donAcc_type": "acceptable", "distance": 3.207, "atom1_id": "///A/215/N", "atom2_id": "///A/284/OH", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 174, "atom1_serNum": 1270, "atom2_serNum": 1451, "donAcc_type": "standard", "distance": 2.811, "atom1_id": "///A/215/O", "atom2_id": "///A/237/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 175, "atom1_serNum": 1277, "atom2_serNum": 1310, "donAcc_type": "standard", "distance": 2.798, "atom1_id": "///A/216/N", "atom2_id": "///A/219/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 176, "atom1_serNum": 1280, "atom2_serNum": 1303, "donAcc_type": "standard", "distance": 2.984, "atom1_id": "///A/216/O", "atom2_id": "///A/219/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 177, "atom1_serNum": 1284, "atom2_serNum": 1454, "donAcc_type": "standard", "distance": 2.822, "atom1_id": "///A/216/OE1", "atom2_id": "///A/237/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 178, "atom1_serNum": 1289, "atom2_serNum": 1314, "donAcc_type": "questionable", "distance": 3.256, "atom1_id": "///A/217/O", "atom2_id": "///A/220/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 179, "atom1_serNum": 1306, "atom2_serNum": 1812, "donAcc_type": "standard", "distance": 2.770, "atom1_id": "///A/219/O", "atom2_id": "///A/281/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 180, "atom1_serNum": 1309, "atom2_serNum": 1581, "donAcc_type": "standard", "distance": 2.858, "atom1_id": "///A/219/OD1", "atom2_id": "///A/254/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 181, "atom1_serNum": 1309, "atom2_serNum": 1819, "donAcc_type": "standard", "distance": 2.561, "atom1_id": "///A/219/OD1", "atom2_id": "///A/281/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 182, "atom1_serNum": 1309, "atom2_serNum": 1822, "donAcc_type": "standard", "distance": 3.090, "atom1_id": "///A/219/OD1", "atom2_id": "///A/281/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 183, "atom1_serNum": 1319, "atom2_serNum": 1797, "donAcc_type": "standard", "distance": 2.991, "atom1_id": "///A/221/N", "atom2_id": "///A/279/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 184, "atom1_serNum": 1322, "atom2_serNum": 1328, "donAcc_type": "standard", "distance": 3.235, "atom1_id": "///A/221/O", "atom2_id": "///A/221/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 185, "atom1_serNum": 1333, "atom2_serNum": 1365, "donAcc_type": "standard", "distance": 2.597, "atom1_id": "///A/222/O", "atom2_id": "///A/226/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 186, "atom1_serNum": 1337, "atom2_serNum": 4483, "donAcc_type": "standard", "distance": 2.705, "atom1_id": "///A/222/ND2", "atom2_id": "///P/13/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 187, "atom1_serNum": 1348, "atom2_serNum": 1366, "donAcc_type": "standard", "distance": 3.869, "atom1_id": "///A/224/O", "atom2_id": "///A/227/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 188, "atom1_serNum": 1353, "atom2_serNum": 4784, "donAcc_type": "questionable", "distance": 2.826, "atom1_id": "///A/224/NZ", "atom2_id": "///V/6/N4", "atom_pair": "N:N", "residue_pair": "aa:nt" }, { "index": 189, "atom1_serNum": 1361, "atom2_serNum": 1384, "donAcc_type": "standard", "distance": 2.903, "atom1_id": "///A/226/O", "atom2_id": "///A/229/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 190, "atom1_serNum": 1365, "atom2_serNum": 4483, "donAcc_type": "standard", "distance": 2.943, "atom1_id": "///A/226/ND2", "atom2_id": "///P/13/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 191, "atom1_serNum": 1374, "atom2_serNum": 1453, "donAcc_type": "questionable", "distance": 3.256, "atom1_id": "///A/227/NZ", "atom2_id": "///A/237/NH1", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 192, "atom1_serNum": 1387, "atom2_serNum": 1401, "donAcc_type": "standard", "distance": 3.140, "atom1_id": "///A/229/O", "atom2_id": "///A/232/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 193, "atom1_serNum": 1391, "atom2_serNum": 1395, "donAcc_type": "standard", "distance": 2.529, "atom1_id": "///A/229/ND2", "atom2_id": "///A/230/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 194, "atom1_serNum": 1391, "atom2_serNum": 4460, "donAcc_type": "standard", "distance": 3.860, "atom1_id": "///A/229/ND2", "atom2_id": "///P/11/O3'", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 195, "atom1_serNum": 1397, "atom2_serNum": 1442, "donAcc_type": "standard", "distance": 3.029, "atom1_id": "///A/231/N", "atom2_id": "///A/236/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 196, "atom1_serNum": 1412, "atom2_serNum": 1442, "donAcc_type": "standard", "distance": 3.160, "atom1_id": "///A/233/N", "atom2_id": "///A/236/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 197, "atom1_serNum": 1415, "atom2_serNum": 1444, "donAcc_type": "standard", "distance": 2.922, "atom1_id": "///A/233/O", "atom2_id": "///A/237/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 198, "atom1_serNum": 1417, "atom2_serNum": 1435, "donAcc_type": "acceptable", "distance": 2.891, "atom1_id": "///A/233/OG1", "atom2_id": "///A/236/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 199, "atom1_serNum": 1417, "atom2_serNum": 1442, "donAcc_type": "acceptable", "distance": 2.699, "atom1_id": "///A/233/OG1", "atom2_id": "///A/236/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 200, "atom1_serNum": 1422, "atom2_serNum": 1455, "donAcc_type": "standard", "distance": 2.913, "atom1_id": "///A/234/O", "atom2_id": "///A/238/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 201, "atom1_serNum": 1429, "atom2_serNum": 1464, "donAcc_type": "standard", "distance": 3.090, "atom1_id": "///A/235/O", "atom2_id": "///A/239/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 202, "atom1_serNum": 1438, "atom2_serNum": 1464, "donAcc_type": "standard", "distance": 2.789, "atom1_id": "///A/236/O", "atom2_id": "///A/239/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 203, "atom1_serNum": 1438, "atom2_serNum": 1468, "donAcc_type": "standard", "distance": 2.926, "atom1_id": "///A/236/O", "atom2_id": "///A/240/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 204, "atom1_serNum": 1447, "atom2_serNum": 1479, "donAcc_type": "standard", "distance": 2.959, "atom1_id": "///A/237/O", "atom2_id": "///A/241/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 205, "atom1_serNum": 1458, "atom2_serNum": 1483, "donAcc_type": "standard", "distance": 2.900, "atom1_id": "///A/238/O", "atom2_id": "///A/242/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 206, "atom1_serNum": 1463, "atom2_serNum": 1491, "donAcc_type": "standard", "distance": 2.950, "atom1_id": "///A/238/NE2", "atom2_id": "///A/242/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 207, "atom1_serNum": 1467, "atom2_serNum": 1492, "donAcc_type": "standard", "distance": 3.069, "atom1_id": "///A/239/O", "atom2_id": "///A/243/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 208, "atom1_serNum": 1471, "atom2_serNum": 1500, "donAcc_type": "standard", "distance": 3.186, "atom1_id": "///A/240/O", "atom2_id": "///A/244/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 209, "atom1_serNum": 1482, "atom2_serNum": 1508, "donAcc_type": "standard", "distance": 3.283, "atom1_id": "///A/241/O", "atom2_id": "///A/245/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 210, "atom1_serNum": 1486, "atom2_serNum": 1517, "donAcc_type": "standard", "distance": 2.486, "atom1_id": "///A/242/O", "atom2_id": "///A/246/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 211, "atom1_serNum": 1495, "atom2_serNum": 1522, "donAcc_type": "standard", "distance": 3.102, "atom1_id": "///A/243/O", "atom2_id": "///A/247/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 212, "atom1_serNum": 1503, "atom2_serNum": 1536, "donAcc_type": "standard", "distance": 2.593, "atom1_id": "///A/244/O", "atom2_id": "///A/249/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 213, "atom1_serNum": 1511, "atom2_serNum": 1516, "donAcc_type": "standard", "distance": 2.844, "atom1_id": "///A/245/O", "atom2_id": "///A/245/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 214, "atom1_serNum": 1544, "atom2_serNum": 1873, "donAcc_type": "standard", "distance": 2.721, "atom1_id": "///A/250/N", "atom2_id": "///A/287/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 215, "atom1_serNum": 1547, "atom2_serNum": 1557, "donAcc_type": "standard", "distance": 3.206, "atom1_id": "///A/250/O", "atom2_id": "///A/252/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 216, "atom1_serNum": 1547, "atom2_serNum": 1870, "donAcc_type": "standard", "distance": 2.981, "atom1_id": "///A/250/O", "atom2_id": "///A/287/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 217, "atom1_serNum": 1552, "atom2_serNum": 1574, "donAcc_type": "standard", "distance": 2.980, "atom1_id": "///A/251/O", "atom2_id": "///A/254/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 218, "atom1_serNum": 1552, "atom2_serNum": 1585, "donAcc_type": "standard", "distance": 2.787, "atom1_id": "///A/251/O", "atom2_id": "///A/255/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 219, "atom1_serNum": 1555, "atom2_serNum": 1821, "donAcc_type": "standard", "distance": 3.122, "atom1_id": "///A/251/OD1", "atom2_id": "///A/281/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 220, "atom1_serNum": 1556, "atom2_serNum": 1822, "donAcc_type": "standard", "distance": 2.554, "atom1_id": "///A/251/OD2", "atom2_id": "///A/281/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 221, "atom1_serNum": 1557, "atom2_serNum": 1854, "donAcc_type": "standard", "distance": 3.102, "atom1_id": "///A/252/N", "atom2_id": "///A/285/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 222, "atom1_serNum": 1560, "atom2_serNum": 1595, "donAcc_type": "standard", "distance": 3.339, "atom1_id": "///A/252/O", "atom2_id": "///A/256/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 223, "atom1_serNum": 1562, "atom2_serNum": 1955, "donAcc_type": "acceptable", "distance": 2.740, "atom1_id": "///A/252/OG", "atom2_id": "///A/298/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 224, "atom1_serNum": 1566, "atom2_serNum": 1603, "donAcc_type": "standard", "distance": 2.937, "atom1_id": "///A/253/O", "atom2_id": "///A/257/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 225, "atom1_serNum": 1583, "atom2_serNum": 1606, "donAcc_type": "standard", "distance": 2.936, "atom1_id": "///A/254/NH1", "atom2_id": "///A/257/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 226, "atom1_serNum": 1583, "atom2_serNum": 1633, "donAcc_type": "standard", "distance": 3.272, "atom1_id": "///A/254/NH1", "atom2_id": "///A/260/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 227, "atom1_serNum": 1584, "atom2_serNum": 1633, "donAcc_type": "standard", "distance": 3.015, "atom1_id": "///A/254/NH2", "atom2_id": "///A/260/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 228, "atom1_serNum": 1606, "atom2_serNum": 1630, "donAcc_type": "standard", "distance": 3.257, "atom1_id": "///A/257/O", "atom2_id": "///A/260/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 229, "atom1_serNum": 1614, "atom2_serNum": 1948, "donAcc_type": "acceptable", "distance": 2.919, "atom1_id": "///A/257/OH", "atom2_id": "///A/297/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 230, "atom1_serNum": 1647, "atom2_serNum": 1786, "donAcc_type": "standard", "distance": 3.026, "atom1_id": "///A/262/O", "atom2_id": "///A/277/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 231, "atom1_serNum": 1673, "atom2_serNum": 1801, "donAcc_type": "standard", "distance": 2.762, "atom1_id": "///A/265/N", "atom2_id": "///A/280/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 232, "atom1_serNum": 1676, "atom2_serNum": 2040, "donAcc_type": "standard", "distance": 2.984, "atom1_id": "///A/265/O", "atom2_id": "///A/310/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 233, "atom1_serNum": 1678, "atom2_serNum": 1823, "donAcc_type": "acceptable", "distance": 3.109, "atom1_id": "///A/265/OG1", "atom2_id": "///A/282/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 234, "atom1_serNum": 1678, "atom2_serNum": 1831, "donAcc_type": "acceptable", "distance": 3.202, "atom1_id": "///A/265/OG1", "atom2_id": "///A/283/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 235, "atom1_serNum": 1678, "atom2_serNum": 1838, "donAcc_type": "acceptable", "distance": 2.622, "atom1_id": "///A/265/OG1", "atom2_id": "///A/283/OD2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 236, "atom1_serNum": 1680, "atom2_serNum": 1801, "donAcc_type": "standard", "distance": 2.891, "atom1_id": "///A/266/N", "atom2_id": "///A/280/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 237, "atom1_serNum": 1683, "atom2_serNum": 1798, "donAcc_type": "standard", "distance": 2.875, "atom1_id": "///A/266/O", "atom2_id": "///A/280/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 238, "atom1_serNum": 1691, "atom2_serNum": 2025, "donAcc_type": "standard", "distance": 3.106, "atom1_id": "///A/267/N", "atom2_id": "///A/308/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 239, "atom1_serNum": 1699, "atom2_serNum": 1785, "donAcc_type": "standard", "distance": 2.956, "atom1_id": "///A/267/NE1", "atom2_id": "///A/277/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 240, "atom1_serNum": 1708, "atom2_serNum": 1748, "donAcc_type": "standard", "distance": 3.848, "atom1_id": "///A/268/O", "atom2_id": "///A/273/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 241, "atom1_serNum": 1715, "atom2_serNum": 1740, "donAcc_type": "standard", "distance": 3.785, "atom1_id": "///A/269/O", "atom2_id": "///A/272/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 242, "atom1_serNum": 1727, "atom2_serNum": 1748, "donAcc_type": "standard", "distance": 3.312, "atom1_id": "///A/270/O", "atom2_id": "///A/273/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 243, "atom1_serNum": 1743, "atom2_serNum": 1769, "donAcc_type": "acceptable", "distance": 2.644, "atom1_id": "///A/272/O", "atom2_id": "///A/275/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 244, "atom1_serNum": 1743, "atom2_serNum": 1770, "donAcc_type": "standard", "distance": 3.580, "atom1_id": "///A/272/O", "atom2_id": "///A/276/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 245, "atom1_serNum": 1751, "atom2_serNum": 1779, "donAcc_type": "standard", "distance": 3.165, "atom1_id": "///A/273/O", "atom2_id": "///A/277/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 246, "atom1_serNum": 1751, "atom2_serNum": 1787, "donAcc_type": "standard", "distance": 2.846, "atom1_id": "///A/273/O", "atom2_id": "///A/278/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 247, "atom1_serNum": 1756, "atom2_serNum": 1779, "donAcc_type": "standard", "distance": 2.827, "atom1_id": "///A/274/O", "atom2_id": "///A/277/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 248, "atom1_serNum": 1762, "atom2_serNum": 2019, "donAcc_type": "standard", "distance": 3.337, "atom1_id": "///A/274/NH1", "atom2_id": "///A/307/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 249, "atom1_serNum": 1763, "atom2_serNum": 1987, "donAcc_type": "standard", "distance": 2.888, "atom1_id": "///A/274/NH2", "atom2_id": "///A/302/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 250, "atom1_serNum": 1763, "atom2_serNum": 2002, "donAcc_type": "standard", "distance": 3.212, "atom1_id": "///A/274/NH2", "atom2_id": "///A/304/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 251, "atom1_serNum": 1778, "atom2_serNum": 4504, "donAcc_type": "standard", "distance": 3.362, "atom1_id": "///A/276/NZ", "atom2_id": "///P/14/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 252, "atom1_serNum": 1806, "atom2_serNum": 4482, "donAcc_type": "standard", "distance": 2.910, "atom1_id": "///A/280/NE1", "atom2_id": "///P/13/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 253, "atom1_serNum": 1838, "atom2_serNum": 2036, "donAcc_type": "acceptable", "distance": 2.771, "atom1_id": "///A/283/OD2", "atom2_id": "///A/309/ND1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 254, "atom1_serNum": 1881, "atom2_serNum": 1900, "donAcc_type": "standard", "distance": 2.953, "atom1_id": "///A/288/O", "atom2_id": "///A/291/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 255, "atom1_serNum": 1887, "atom2_serNum": 1908, "donAcc_type": "standard", "distance": 3.160, "atom1_id": "///A/289/O", "atom2_id": "///A/292/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 256, "atom1_serNum": 1903, "atom2_serNum": 1928, "donAcc_type": "standard", "distance": 3.297, "atom1_id": "///A/291/O", "atom2_id": "///A/295/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 257, "atom1_serNum": 1911, "atom2_serNum": 1928, "donAcc_type": "standard", "distance": 3.090, "atom1_id": "///A/292/O", "atom2_id": "///A/295/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 258, "atom1_serNum": 1926, "atom2_serNum": 1936, "donAcc_type": "standard", "distance": 3.426, "atom1_id": "///A/294/O", "atom2_id": "///A/296/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 259, "atom1_serNum": 1926, "atom2_serNum": 2096, "donAcc_type": "standard", "distance": 2.785, "atom1_id": "///A/294/O", "atom2_id": "///A/317/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 260, "atom1_serNum": 1936, "atom2_serNum": 2079, "donAcc_type": "standard", "distance": 2.892, "atom1_id": "///A/296/N", "atom2_id": "///A/315/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 261, "atom1_serNum": 1942, "atom2_serNum": 2079, "donAcc_type": "standard", "distance": 3.422, "atom1_id": "///A/297/N", "atom2_id": "///A/315/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 262, "atom1_serNum": 1945, "atom2_serNum": 2076, "donAcc_type": "standard", "distance": 2.902, "atom1_id": "///A/297/O", "atom2_id": "///A/315/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 263, "atom1_serNum": 1948, "atom2_serNum": 1950, "donAcc_type": "standard", "distance": 2.591, "atom1_id": "///A/297/OD1", "atom2_id": "///A/298/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 264, "atom1_serNum": 1949, "atom2_serNum": 1964, "donAcc_type": "standard", "distance": 2.926, "atom1_id": "///A/297/OD2", "atom2_id": "///A/299/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 265, "atom1_serNum": 1956, "atom2_serNum": 2064, "donAcc_type": "standard", "distance": 2.652, "atom1_id": "///A/299/N", "atom2_id": "///A/313/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 266, "atom1_serNum": 1959, "atom2_serNum": 2061, "donAcc_type": "standard", "distance": 2.961, "atom1_id": "///A/299/O", "atom2_id": "///A/313/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 267, "atom1_serNum": 1968, "atom2_serNum": 1984, "donAcc_type": "standard", "distance": 3.144, "atom1_id": "///A/300/O", "atom2_id": "///A/302/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 268, "atom1_serNum": 1973, "atom2_serNum": 2049, "donAcc_type": "standard", "distance": 2.845, "atom1_id": "///A/301/N", "atom2_id": "///A/311/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 269, "atom1_serNum": 1976, "atom2_serNum": 1999, "donAcc_type": "standard", "distance": 3.265, "atom1_id": "///A/301/O", "atom2_id": "///A/304/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 270, "atom1_serNum": 1993, "atom2_serNum": 2004, "donAcc_type": "standard", "distance": 3.284, "atom1_id": "///A/303/O", "atom2_id": "///A/305/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 271, "atom1_serNum": 2021, "atom2_serNum": 2028, "donAcc_type": "acceptable", "distance": 3.072, "atom1_id": "///A/307/OG", "atom2_id": "///A/308/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 272, "atom1_serNum": 2021, "atom2_serNum": 2030, "donAcc_type": "acceptable", "distance": 2.927, "atom1_id": "///A/307/OG", "atom2_id": "///A/309/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 273, "atom1_serNum": 2022, "atom2_serNum": 2028, "donAcc_type": "standard", "distance": 2.612, "atom1_id": "///A/308/N", "atom2_id": "///A/308/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 274, "atom1_serNum": 2028, "atom2_serNum": 2030, "donAcc_type": "standard", "distance": 3.260, "atom1_id": "///A/308/OD1", "atom2_id": "///A/309/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 275, "atom1_serNum": 2039, "atom2_serNum": 4446, "donAcc_type": "standard", "distance": 2.998, "atom1_id": "///A/309/NE2", "atom2_id": "///P/11/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 276, "atom1_serNum": 2135, "atom2_serNum": 2151, "donAcc_type": "acceptable", "distance": 2.311, "atom1_id": "///B/45/OH", "atom2_id": "///B/47/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 277, "atom1_serNum": 2152, "atom2_serNum": 4091, "donAcc_type": "standard", "distance": 3.085, "atom1_id": "///B/47/OD2", "atom2_id": "///B/300/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 278, "atom1_serNum": 2163, "atom2_serNum": 2175, "donAcc_type": "standard", "distance": 3.206, "atom1_id": "///B/49/O", "atom2_id": "///B/51/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 279, "atom1_serNum": 2167, "atom2_serNum": 2173, "donAcc_type": "standard", "distance": 2.730, "atom1_id": "///B/50/N", "atom2_id": "///B/50/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 280, "atom1_serNum": 2173, "atom2_serNum": 4108, "donAcc_type": "standard", "distance": 2.894, "atom1_id": "///B/50/OD1", "atom2_id": "///B/301/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 281, "atom1_serNum": 2174, "atom2_serNum": 2189, "donAcc_type": "standard", "distance": 3.406, "atom1_id": "///B/50/OD2", "atom2_id": "///B/52/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 282, "atom1_serNum": 2174, "atom2_serNum": 4109, "donAcc_type": "standard", "distance": 3.223, "atom1_id": "///B/50/OD2", "atom2_id": "///B/301/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 283, "atom1_serNum": 2174, "atom2_serNum": 4213, "donAcc_type": "acceptable", "distance": 2.979, "atom1_id": "///B/50/OD2", "atom2_id": "///B/315/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 284, "atom1_serNum": 2175, "atom2_serNum": 4075, "donAcc_type": "standard", "distance": 2.745, "atom1_id": "///B/51/N", "atom2_id": "///B/297/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 285, "atom1_serNum": 2184, "atom2_serNum": 2232, "donAcc_type": "standard", "distance": 2.965, "atom1_id": "///B/52/O", "atom2_id": "///B/60/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 286, "atom1_serNum": 2197, "atom2_serNum": 2223, "donAcc_type": "standard", "distance": 2.888, "atom1_id": "///B/54/N", "atom2_id": "///B/58/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 287, "atom1_serNum": 2200, "atom2_serNum": 2216, "donAcc_type": "standard", "distance": 2.718, "atom1_id": "///B/54/O", "atom2_id": "///B/57/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 288, "atom1_serNum": 2202, "atom2_serNum": 2215, "donAcc_type": "acceptable", "distance": 3.249, "atom1_id": "///B/54/OG", "atom2_id": "///B/56/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 289, "atom1_serNum": 2202, "atom2_serNum": 2220, "donAcc_type": "acceptable", "distance": 3.122, "atom1_id": "///B/54/OG", "atom2_id": "///B/58/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 290, "atom1_serNum": 2202, "atom2_serNum": 4045, "donAcc_type": "acceptable", "distance": 3.966, "atom1_id": "///B/54/OG", "atom2_id": "///B/293/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 291, "atom1_serNum": 2237, "atom2_serNum": 4217, "donAcc_type": "standard", "distance": 3.118, "atom1_id": "///B/61/N", "atom2_id": "///B/316/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 292, "atom1_serNum": 2242, "atom2_serNum": 4227, "donAcc_type": "acceptable", "distance": 2.890, "atom1_id": "///B/61/OG1", "atom2_id": "///B/318/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 293, "atom1_serNum": 2244, "atom2_serNum": 4217, "donAcc_type": "standard", "distance": 3.253, "atom1_id": "///B/62/N", "atom2_id": "///B/316/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 294, "atom1_serNum": 2247, "atom2_serNum": 4214, "donAcc_type": "standard", "distance": 3.200, "atom1_id": "///B/62/O", "atom2_id": "///B/316/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 295, "atom1_serNum": 2252, "atom2_serNum": 2482, "donAcc_type": "standard", "distance": 3.008, "atom1_id": "///B/63/N", "atom2_id": "///B/90/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 296, "atom1_serNum": 2255, "atom2_serNum": 2475, "donAcc_type": "standard", "distance": 2.652, "atom1_id": "///B/63/O", "atom2_id": "///B/90/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 297, "atom1_serNum": 2255, "atom2_serNum": 2483, "donAcc_type": "standard", "distance": 3.067, "atom1_id": "///B/63/O", "atom2_id": "///B/91/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 298, "atom1_serNum": 2260, "atom2_serNum": 2457, "donAcc_type": "standard", "distance": 2.739, "atom1_id": "///B/63/NZ", "atom2_id": "///B/87/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 299, "atom1_serNum": 2261, "atom2_serNum": 4197, "donAcc_type": "standard", "distance": 3.031, "atom1_id": "///B/64/N", "atom2_id": "///B/314/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 300, "atom1_serNum": 2264, "atom2_serNum": 4194, "donAcc_type": "standard", "distance": 2.692, "atom1_id": "///B/64/O", "atom2_id": "///B/314/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 301, "atom1_serNum": 2269, "atom2_serNum": 2486, "donAcc_type": "standard", "distance": 2.809, "atom1_id": "///B/65/N", "atom2_id": "///B/91/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 302, "atom1_serNum": 2272, "atom2_serNum": 2499, "donAcc_type": "standard", "distance": 2.754, "atom1_id": "///B/65/O", "atom2_id": "///B/93/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 303, "atom1_serNum": 2275, "atom2_serNum": 4182, "donAcc_type": "standard", "distance": 2.833, "atom1_id": "///B/66/N", "atom2_id": "///B/312/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 304, "atom1_serNum": 2278, "atom2_serNum": 4179, "donAcc_type": "standard", "distance": 2.851, "atom1_id": "///B/66/O", "atom2_id": "///B/312/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 305, "atom1_serNum": 2280, "atom2_serNum": 2521, "donAcc_type": "acceptable", "distance": 3.188, "atom1_id": "///B/66/OG", "atom2_id": "///B/95/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 306, "atom1_serNum": 2281, "atom2_serNum": 2502, "donAcc_type": "standard", "distance": 2.842, "atom1_id": "///B/67/N", "atom2_id": "///B/93/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 307, "atom1_serNum": 2284, "atom2_serNum": 2513, "donAcc_type": "standard", "distance": 3.058, "atom1_id": "///B/67/O", "atom2_id": "///B/95/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 308, "atom1_serNum": 2289, "atom2_serNum": 4159, "donAcc_type": "standard", "distance": 3.247, "atom1_id": "///B/67/NE1", "atom2_id": "///B/309/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 309, "atom1_serNum": 2295, "atom2_serNum": 2520, "donAcc_type": "standard", "distance": 3.286, "atom1_id": "///B/68/N", "atom2_id": "///B/95/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 310, "atom1_serNum": 2298, "atom2_serNum": 4147, "donAcc_type": "acceptable", "distance": 2.760, "atom1_id": "///B/68/O", "atom2_id": "///B/307/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 311, "atom1_serNum": 2301, "atom2_serNum": 2310, "donAcc_type": "standard", "distance": 2.886, "atom1_id": "///B/68/OD1", "atom2_id": "///B/70/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 312, "atom1_serNum": 2302, "atom2_serNum": 2529, "donAcc_type": "standard", "distance": 2.942, "atom1_id": "///B/68/ND2", "atom2_id": "///B/96/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 313, "atom1_serNum": 2302, "atom2_serNum": 3357, "donAcc_type": "standard", "distance": 2.925, "atom1_id": "///B/68/ND2", "atom2_id": "///B/210/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 314, "atom1_serNum": 2303, "atom2_serNum": 2516, "donAcc_type": "standard", "distance": 3.156, "atom1_id": "///B/69/N", "atom2_id": "///B/95/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 315, "atom1_serNum": 2316, "atom2_serNum": 2546, "donAcc_type": "standard", "distance": 3.838, "atom1_id": "///B/70/OD1", "atom2_id": "///B/98/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 316, "atom1_serNum": 2317, "atom2_serNum": 4154, "donAcc_type": "questionable", "distance": 2.782, "atom1_id": "///B/70/OD2", "atom2_id": "///B/308/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 317, "atom1_serNum": 2318, "atom2_serNum": 2525, "donAcc_type": "standard", "distance": 2.850, "atom1_id": "///B/71/N", "atom2_id": "///B/96/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 318, "atom1_serNum": 2321, "atom2_serNum": 2346, "donAcc_type": "standard", "distance": 2.897, "atom1_id": "///B/71/O", "atom2_id": "///B/75/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 319, "atom1_serNum": 2322, "atom2_serNum": 2534, "donAcc_type": "standard", "distance": 2.649, "atom1_id": "///B/72/N", "atom2_id": "///B/97/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 320, "atom1_serNum": 2325, "atom2_serNum": 2360, "donAcc_type": "standard", "distance": 2.903, "atom1_id": "///B/72/O", "atom2_id": "///B/76/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 321, "atom1_serNum": 2333, "atom2_serNum": 2368, "donAcc_type": "standard", "distance": 2.950, "atom1_id": "///B/73/O", "atom2_id": "///B/77/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 322, "atom1_serNum": 2340, "atom2_serNum": 2541, "donAcc_type": "standard", "distance": 2.985, "atom1_id": "///B/73/NH2", "atom2_id": "///B/98/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 323, "atom1_serNum": 2344, "atom2_serNum": 2377, "donAcc_type": "standard", "distance": 2.943, "atom1_id": "///B/74/O", "atom2_id": "///B/78/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 324, "atom1_serNum": 2349, "atom2_serNum": 2395, "donAcc_type": "standard", "distance": 3.103, "atom1_id": "///B/75/O", "atom2_id": "///B/80/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 325, "atom1_serNum": 2363, "atom2_serNum": 2386, "donAcc_type": "standard", "distance": 2.823, "atom1_id": "///B/76/O", "atom2_id": "///B/79/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 326, "atom1_serNum": 2389, "atom2_serNum": 2407, "donAcc_type": "standard", "distance": 2.936, "atom1_id": "///B/79/O", "atom2_id": "///B/82/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 327, "atom1_serNum": 2389, "atom2_serNum": 2415, "donAcc_type": "standard", "distance": 3.253, "atom1_id": "///B/79/O", "atom2_id": "///B/83/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 328, "atom1_serNum": 2398, "atom2_serNum": 2429, "donAcc_type": "standard", "distance": 2.822, "atom1_id": "///B/80/O", "atom2_id": "///B/84/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 329, "atom1_serNum": 2402, "atom2_serNum": 2436, "donAcc_type": "standard", "distance": 2.804, "atom1_id": "///B/81/O", "atom2_id": "///B/85/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 330, "atom1_serNum": 2410, "atom2_serNum": 2445, "donAcc_type": "standard", "distance": 3.134, "atom1_id": "///B/82/O", "atom2_id": "///B/86/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 331, "atom1_serNum": 2418, "atom2_serNum": 2454, "donAcc_type": "standard", "distance": 2.837, "atom1_id": "///B/83/O", "atom2_id": "///B/87/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 332, "atom1_serNum": 2432, "atom2_serNum": 2463, "donAcc_type": "standard", "distance": 2.824, "atom1_id": "///B/84/O", "atom2_id": "///B/88/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 333, "atom1_serNum": 2462, "atom2_serNum": 4106, "donAcc_type": "standard", "distance": 2.894, "atom1_id": "///B/87/OE2", "atom2_id": "///B/301/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 334, "atom1_serNum": 2462, "atom2_serNum": 4109, "donAcc_type": "standard", "distance": 2.500, "atom1_id": "///B/87/OE2", "atom2_id": "///B/301/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 335, "atom1_serNum": 2462, "atom2_serNum": 4192, "donAcc_type": "acceptable", "distance": 2.856, "atom1_id": "///B/87/OE2", "atom2_id": "///B/313/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 336, "atom1_serNum": 2478, "atom2_serNum": 2806, "donAcc_type": "standard", "distance": 2.946, "atom1_id": "///B/90/O", "atom2_id": "///B/136/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 337, "atom1_serNum": 2491, "atom2_serNum": 2795, "donAcc_type": "standard", "distance": 2.717, "atom1_id": "///B/92/N", "atom2_id": "///B/134/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 338, "atom1_serNum": 2494, "atom2_serNum": 2792, "donAcc_type": "standard", "distance": 2.771, "atom1_id": "///B/92/O", "atom2_id": "///B/134/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 339, "atom1_serNum": 2505, "atom2_serNum": 2783, "donAcc_type": "standard", "distance": 2.820, "atom1_id": "///B/94/N", "atom2_id": "///B/132/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 340, "atom1_serNum": 2508, "atom2_serNum": 2780, "donAcc_type": "standard", "distance": 2.910, "atom1_id": "///B/94/O", "atom2_id": "///B/132/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 341, "atom1_serNum": 2521, "atom2_serNum": 3027, "donAcc_type": "acceptable", "distance": 2.852, "atom1_id": "///B/95/NE2", "atom2_id": "///B/169/OG1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 342, "atom1_serNum": 2522, "atom2_serNum": 2772, "donAcc_type": "standard", "distance": 2.741, "atom1_id": "///B/96/N", "atom2_id": "///B/130/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 343, "atom1_serNum": 2531, "atom2_serNum": 2772, "donAcc_type": "standard", "distance": 2.950, "atom1_id": "///B/97/N", "atom2_id": "///B/130/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 344, "atom1_serNum": 2538, "atom2_serNum": 2766, "donAcc_type": "standard", "distance": 2.951, "atom1_id": "///B/98/N", "atom2_id": "///B/129/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 345, "atom1_serNum": 2556, "atom2_serNum": 2576, "donAcc_type": "standard", "distance": 2.995, "atom1_id": "///B/100/O", "atom2_id": "///B/103/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 346, "atom1_serNum": 2562, "atom2_serNum": 2585, "donAcc_type": "standard", "distance": 3.227, "atom1_id": "///B/101/O", "atom2_id": "///B/104/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 347, "atom1_serNum": 2579, "atom2_serNum": 2593, "donAcc_type": "standard", "distance": 3.138, "atom1_id": "///B/103/O", "atom2_id": "///B/105/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 348, "atom1_serNum": 2596, "atom2_serNum": 2614, "donAcc_type": "standard", "distance": 3.217, "atom1_id": "///B/105/O", "atom2_id": "///B/108/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 349, "atom1_serNum": 2603, "atom2_serNum": 2622, "donAcc_type": "standard", "distance": 2.938, "atom1_id": "///B/106/O", "atom2_id": "///B/109/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 350, "atom1_serNum": 2608, "atom2_serNum": 2631, "donAcc_type": "standard", "distance": 3.008, "atom1_id": "///B/107/O", "atom2_id": "///B/110/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 351, "atom1_serNum": 2617, "atom2_serNum": 2640, "donAcc_type": "standard", "distance": 3.221, "atom1_id": "///B/108/O", "atom2_id": "///B/111/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 352, "atom1_serNum": 2617, "atom2_serNum": 2691, "donAcc_type": "standard", "distance": 2.975, "atom1_id": "///B/108/O", "atom2_id": "///B/117/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 353, "atom1_serNum": 2643, "atom2_serNum": 2659, "donAcc_type": "standard", "distance": 3.535, "atom1_id": "///B/111/O", "atom2_id": "///B/114/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 354, "atom1_serNum": 2662, "atom2_serNum": 2691, "donAcc_type": "standard", "distance": 2.791, "atom1_id": "///B/114/O", "atom2_id": "///B/117/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 355, "atom1_serNum": 2673, "atom2_serNum": 2803, "donAcc_type": "standard", "distance": 3.152, "atom1_id": "///B/116/N", "atom2_id": "///B/135/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 356, "atom1_serNum": 2676, "atom2_serNum": 2800, "donAcc_type": "standard", "distance": 2.816, "atom1_id": "///B/116/O", "atom2_id": "///B/135/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 357, "atom1_serNum": 2692, "atom2_serNum": 2787, "donAcc_type": "standard", "distance": 2.955, "atom1_id": "///B/118/N", "atom2_id": "///B/133/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 358, "atom1_serNum": 2695, "atom2_serNum": 2784, "donAcc_type": "standard", "distance": 2.886, "atom1_id": "///B/118/O", "atom2_id": "///B/133/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 359, "atom1_serNum": 2718, "atom2_serNum": 2776, "donAcc_type": "standard", "distance": 3.198, "atom1_id": "///B/120/N", "atom2_id": "///B/131/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 360, "atom1_serNum": 2721, "atom2_serNum": 2773, "donAcc_type": "standard", "distance": 3.243, "atom1_id": "///B/120/O", "atom2_id": "///B/131/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 361, "atom1_serNum": 2732, "atom2_serNum": 2741, "donAcc_type": "acceptable", "distance": 2.594, "atom1_id": "///B/122/O", "atom2_id": "///B/123/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 362, "atom1_serNum": 2732, "atom2_serNum": 2742, "donAcc_type": "standard", "distance": 2.635, "atom1_id": "///B/122/O", "atom2_id": "///B/124/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 363, "atom1_serNum": 2754, "atom2_serNum": 3045, "donAcc_type": "acceptable", "distance": 3.690, "atom1_id": "///B/128/O", "atom2_id": "///B/171/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 364, "atom1_serNum": 2768, "atom2_serNum": 2907, "donAcc_type": "acceptable", "distance": 2.983, "atom1_id": "///B/129/OG", "atom2_id": "///B/154/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 365, "atom1_serNum": 2769, "atom2_serNum": 2916, "donAcc_type": "standard", "distance": 3.115, "atom1_id": "///B/130/N", "atom2_id": "///B/155/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 366, "atom1_serNum": 2805, "atom2_serNum": 2820, "donAcc_type": "acceptable", "distance": 2.765, "atom1_id": "///B/135/OG", "atom2_id": "///B/137/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 367, "atom1_serNum": 2820, "atom2_serNum": 2831, "donAcc_type": "standard", "distance": 3.291, "atom1_id": "///B/137/O", "atom2_id": "///B/139/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 368, "atom1_serNum": 2838, "atom2_serNum": 2958, "donAcc_type": "standard", "distance": 2.735, "atom1_id": "///B/140/N", "atom2_id": "///B/161/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 369, "atom1_serNum": 2849, "atom2_serNum": 2955, "donAcc_type": "standard", "distance": 3.073, "atom1_id": "///B/141/O", "atom2_id": "///B/161/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 370, "atom1_serNum": 2862, "atom2_serNum": 2946, "donAcc_type": "standard", "distance": 2.953, "atom1_id": "///B/143/N", "atom2_id": "///B/159/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 371, "atom1_serNum": 2865, "atom2_serNum": 2943, "donAcc_type": "standard", "distance": 2.884, "atom1_id": "///B/143/O", "atom2_id": "///B/159/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 372, "atom1_serNum": 2880, "atom2_serNum": 2931, "donAcc_type": "standard", "distance": 3.005, "atom1_id": "///B/145/N", "atom2_id": "///B/157/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 373, "atom1_serNum": 2911, "atom2_serNum": 3146, "donAcc_type": "acceptable", "distance": 2.719, "atom1_id": "///B/154/OE1", "atom2_id": "///B/184/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 374, "atom1_serNum": 2912, "atom2_serNum": 2927, "donAcc_type": "standard", "distance": 3.256, "atom1_id": "///B/154/OE2", "atom2_id": "///B/156/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 375, "atom1_serNum": 2912, "atom2_serNum": 3116, "donAcc_type": "standard", "distance": 3.929, "atom1_id": "///B/154/OE2", "atom2_id": "///B/181/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 376, "atom1_serNum": 2920, "atom2_serNum": 3034, "donAcc_type": "standard", "distance": 2.848, "atom1_id": "///B/156/O", "atom2_id": "///B/171/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 377, "atom1_serNum": 2926, "atom2_serNum": 3037, "donAcc_type": "standard", "distance": 2.609, "atom1_id": "///B/156/NH1", "atom2_id": "///B/171/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 378, "atom1_serNum": 2935, "atom2_serNum": 3025, "donAcc_type": "standard", "distance": 3.161, "atom1_id": "///B/158/N", "atom2_id": "///B/169/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 379, "atom1_serNum": 2938, "atom2_serNum": 3022, "donAcc_type": "standard", "distance": 2.969, "atom1_id": "///B/158/O", "atom2_id": "///B/169/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 380, "atom1_serNum": 2950, "atom2_serNum": 3010, "donAcc_type": "standard", "distance": 2.744, "atom1_id": "///B/160/N", "atom2_id": "///B/167/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 381, "atom1_serNum": 2953, "atom2_serNum": 3007, "donAcc_type": "standard", "distance": 2.734, "atom1_id": "///B/160/O", "atom2_id": "///B/167/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 382, "atom1_serNum": 2962, "atom2_serNum": 3309, "donAcc_type": "standard", "distance": 3.595, "atom1_id": "///B/161/OE1", "atom2_id": "///B/203/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 383, "atom1_serNum": 2964, "atom2_serNum": 2992, "donAcc_type": "standard", "distance": 3.024, "atom1_id": "///B/162/N", "atom2_id": "///B/165/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 384, "atom1_serNum": 2967, "atom2_serNum": 3309, "donAcc_type": "standard", "distance": 2.989, "atom1_id": "///B/162/O", "atom2_id": "///B/203/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 385, "atom1_serNum": 2978, "atom2_serNum": 3309, "donAcc_type": "standard", "distance": 2.651, "atom1_id": "///B/163/O", "atom2_id": "///B/203/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 386, "atom1_serNum": 3000, "atom2_serNum": 3313, "donAcc_type": "standard", "distance": 2.719, "atom1_id": "///B/166/N", "atom2_id": "///B/204/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 387, "atom1_serNum": 3003, "atom2_serNum": 3325, "donAcc_type": "standard", "distance": 2.826, "atom1_id": "///B/166/O", "atom2_id": "///B/206/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 388, "atom1_serNum": 3015, "atom2_serNum": 3328, "donAcc_type": "standard", "distance": 2.707, "atom1_id": "///B/168/N", "atom2_id": "///B/206/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 389, "atom1_serNum": 3018, "atom2_serNum": 3340, "donAcc_type": "standard", "distance": 2.903, "atom1_id": "///B/168/O", "atom2_id": "///B/208/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 390, "atom1_serNum": 3029, "atom2_serNum": 3343, "donAcc_type": "standard", "distance": 3.111, "atom1_id": "///B/170/N", "atom2_id": "///B/208/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 391, "atom1_serNum": 3032, "atom2_serNum": 3350, "donAcc_type": "standard", "distance": 3.200, "atom1_id": "///B/170/O", "atom2_id": "///B/210/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 392, "atom1_serNum": 3046, "atom2_serNum": 3353, "donAcc_type": "standard", "distance": 2.888, "atom1_id": "///B/172/N", "atom2_id": "///B/210/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 393, "atom1_serNum": 3049, "atom2_serNum": 3373, "donAcc_type": "standard", "distance": 2.447, "atom1_id": "///B/172/O", "atom2_id": "///B/212/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 394, "atom1_serNum": 3056, "atom2_serNum": 3156, "donAcc_type": "standard", "distance": 3.053, "atom1_id": "///B/173/O", "atom2_id": "///B/185/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 395, "atom1_serNum": 3066, "atom2_serNum": 3073, "donAcc_type": "standard", "distance": 2.926, "atom1_id": "///B/174/OD1", "atom2_id": "///B/176/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 396, "atom1_serNum": 3068, "atom2_serNum": 3562, "donAcc_type": "standard", "distance": 3.902, "atom1_id": "///B/175/N", "atom2_id": "///B/236/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 397, "atom1_serNum": 3071, "atom2_serNum": 3107, "donAcc_type": "standard", "distance": 2.810, "atom1_id": "///B/175/O", "atom2_id": "///B/181/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 398, "atom1_serNum": 3071, "atom2_serNum": 3118, "donAcc_type": "standard", "distance": 3.269, "atom1_id": "///B/175/O", "atom2_id": "///B/182/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 399, "atom1_serNum": 3076, "atom2_serNum": 3092, "donAcc_type": "standard", "distance": 2.777, "atom1_id": "///B/176/O", "atom2_id": "///B/179/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 400, "atom1_serNum": 3095, "atom2_serNum": 3118, "donAcc_type": "standard", "distance": 3.238, "atom1_id": "///B/179/O", "atom2_id": "///B/182/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 401, "atom1_serNum": 3110, "atom2_serNum": 3147, "donAcc_type": "standard", "distance": 2.876, "atom1_id": "///B/181/O", "atom2_id": "///B/185/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 402, "atom1_serNum": 3121, "atom2_serNum": 3158, "donAcc_type": "standard", "distance": 2.652, "atom1_id": "///B/182/O", "atom2_id": "///B/186/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 403, "atom1_serNum": 3129, "atom2_serNum": 3167, "donAcc_type": "standard", "distance": 3.126, "atom1_id": "///B/183/O", "atom2_id": "///B/187/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 404, "atom1_serNum": 3138, "atom2_serNum": 3172, "donAcc_type": "standard", "distance": 3.080, "atom1_id": "///B/184/O", "atom2_id": "///B/188/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 405, "atom1_serNum": 3150, "atom2_serNum": 3186, "donAcc_type": "standard", "distance": 2.951, "atom1_id": "///B/185/O", "atom2_id": "///B/189/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 406, "atom1_serNum": 3154, "atom2_serNum": 3192, "donAcc_type": "standard", "distance": 3.214, "atom1_id": "///B/185/NE", "atom2_id": "///B/189/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 407, "atom1_serNum": 3156, "atom2_serNum": 3369, "donAcc_type": "standard", "distance": 3.185, "atom1_id": "///B/185/NH1", "atom2_id": "///B/212/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 408, "atom1_serNum": 3157, "atom2_serNum": 3361, "donAcc_type": "standard", "distance": 3.189, "atom1_id": "///B/185/NH2", "atom2_id": "///B/211/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 409, "atom1_serNum": 3157, "atom2_serNum": 3369, "donAcc_type": "standard", "distance": 3.229, "atom1_id": "///B/185/NH2", "atom2_id": "///B/212/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 410, "atom1_serNum": 3161, "atom2_serNum": 3194, "donAcc_type": "standard", "distance": 3.243, "atom1_id": "///B/186/O", "atom2_id": "///B/190/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 411, "atom1_serNum": 3170, "atom2_serNum": 3203, "donAcc_type": "standard", "distance": 2.809, "atom1_id": "///B/187/O", "atom2_id": "///B/191/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 412, "atom1_serNum": 3175, "atom2_serNum": 3208, "donAcc_type": "standard", "distance": 2.863, "atom1_id": "///B/188/O", "atom2_id": "///B/192/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 413, "atom1_serNum": 3189, "atom2_serNum": 3219, "donAcc_type": "standard", "distance": 3.245, "atom1_id": "///B/189/O", "atom2_id": "///B/193/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 414, "atom1_serNum": 3197, "atom2_serNum": 3230, "donAcc_type": "standard", "distance": 3.265, "atom1_id": "///B/190/O", "atom2_id": "///B/194/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 415, "atom1_serNum": 3206, "atom2_serNum": 3239, "donAcc_type": "standard", "distance": 3.035, "atom1_id": "///B/191/O", "atom2_id": "///B/195/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 416, "atom1_serNum": 3211, "atom2_serNum": 3250, "donAcc_type": "standard", "distance": 2.892, "atom1_id": "///B/192/O", "atom2_id": "///B/196/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 417, "atom1_serNum": 3222, "atom2_serNum": 3258, "donAcc_type": "standard", "distance": 2.959, "atom1_id": "///B/193/O", "atom2_id": "///B/197/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 418, "atom1_serNum": 3226, "atom2_serNum": 3586, "donAcc_type": "standard", "distance": 3.984, "atom1_id": "///B/193/NE", "atom2_id": "///B/239/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 419, "atom1_serNum": 3233, "atom2_serNum": 3258, "donAcc_type": "standard", "distance": 3.211, "atom1_id": "///B/194/O", "atom2_id": "///B/197/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 420, "atom1_serNum": 3242, "atom2_serNum": 3271, "donAcc_type": "standard", "distance": 3.811, "atom1_id": "///B/195/O", "atom2_id": "///B/199/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 421, "atom1_serNum": 3253, "atom2_serNum": 3279, "donAcc_type": "standard", "distance": 3.323, "atom1_id": "///B/196/O", "atom2_id": "///B/200/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 422, "atom1_serNum": 3261, "atom2_serNum": 3284, "donAcc_type": "standard", "distance": 3.347, "atom1_id": "///B/197/O", "atom2_id": "///B/201/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 423, "atom1_serNum": 3261, "atom2_serNum": 3289, "donAcc_type": "acceptable", "distance": 2.835, "atom1_id": "///B/197/O", "atom2_id": "///B/201/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 424, "atom1_serNum": 3266, "atom2_serNum": 3639, "donAcc_type": "standard", "distance": 2.742, "atom1_id": "///B/197/NZ", "atom2_id": "///B/246/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 425, "atom1_serNum": 3270, "atom2_serNum": 3297, "donAcc_type": "standard", "distance": 3.058, "atom1_id": "///B/198/O", "atom2_id": "///B/202/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 426, "atom1_serNum": 3274, "atom2_serNum": 3290, "donAcc_type": "standard", "distance": 2.666, "atom1_id": "///B/199/O", "atom2_id": "///B/202/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 427, "atom1_serNum": 3274, "atom2_serNum": 3301, "donAcc_type": "standard", "distance": 3.547, "atom1_id": "///B/199/O", "atom2_id": "///B/203/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 428, "atom1_serNum": 3317, "atom2_serNum": 4002, "donAcc_type": "acceptable", "distance": 3.061, "atom1_id": "///B/205/N", "atom2_id": "///B/288/OG", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 429, "atom1_serNum": 3320, "atom2_serNum": 3997, "donAcc_type": "standard", "distance": 3.228, "atom1_id": "///B/205/O", "atom2_id": "///B/288/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 430, "atom1_serNum": 3332, "atom2_serNum": 3984, "donAcc_type": "standard", "distance": 2.975, "atom1_id": "///B/207/N", "atom2_id": "///B/286/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 431, "atom1_serNum": 3335, "atom2_serNum": 3981, "donAcc_type": "standard", "distance": 2.777, "atom1_id": "///B/207/O", "atom2_id": "///B/286/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 432, "atom1_serNum": 3346, "atom2_serNum": 3961, "donAcc_type": "standard", "distance": 3.097, "atom1_id": "///B/209/N", "atom2_id": "///B/284/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 433, "atom1_serNum": 3349, "atom2_serNum": 3358, "donAcc_type": "standard", "distance": 3.249, "atom1_id": "///B/209/O", "atom2_id": "///B/211/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 434, "atom1_serNum": 3349, "atom2_serNum": 3958, "donAcc_type": "standard", "distance": 3.079, "atom1_id": "///B/209/O", "atom2_id": "///B/284/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 435, "atom1_serNum": 3356, "atom2_serNum": 3366, "donAcc_type": "standard", "distance": 3.010, "atom1_id": "///B/210/OD1", "atom2_id": "///B/212/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 436, "atom1_serNum": 3358, "atom2_serNum": 3945, "donAcc_type": "standard", "distance": 2.839, "atom1_id": "///B/211/N", "atom2_id": "///B/282/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 437, "atom1_serNum": 3377, "atom2_serNum": 3934, "donAcc_type": "questionable", "distance": 3.304, "atom1_id": "///B/213/O", "atom2_id": "///B/281/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 438, "atom1_serNum": 3377, "atom2_serNum": 3969, "donAcc_type": "acceptable", "distance": 2.536, "atom1_id": "///B/213/O", "atom2_id": "///B/284/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 439, "atom1_serNum": 3381, "atom2_serNum": 3519, "donAcc_type": "standard", "distance": 2.981, "atom1_id": "///B/214/N", "atom2_id": "///B/231/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 440, "atom1_serNum": 3386, "atom2_serNum": 3969, "donAcc_type": "acceptable", "distance": 3.222, "atom1_id": "///B/215/N", "atom2_id": "///B/284/OH", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 441, "atom1_serNum": 3389, "atom2_serNum": 3570, "donAcc_type": "standard", "distance": 2.615, "atom1_id": "///B/215/O", "atom2_id": "///B/237/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 442, "atom1_serNum": 3389, "atom2_serNum": 3573, "donAcc_type": "standard", "distance": 3.071, "atom1_id": "///B/215/O", "atom2_id": "///B/237/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 443, "atom1_serNum": 3396, "atom2_serNum": 3429, "donAcc_type": "standard", "distance": 3.370, "atom1_id": "///B/216/N", "atom2_id": "///B/219/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 444, "atom1_serNum": 3399, "atom2_serNum": 3422, "donAcc_type": "standard", "distance": 2.565, "atom1_id": "///B/216/O", "atom2_id": "///B/219/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 445, "atom1_serNum": 3403, "atom2_serNum": 3573, "donAcc_type": "standard", "distance": 2.838, "atom1_id": "///B/216/OE1", "atom2_id": "///B/237/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 446, "atom1_serNum": 3408, "atom2_serNum": 3430, "donAcc_type": "standard", "distance": 3.197, "atom1_id": "///B/217/O", "atom2_id": "///B/220/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 447, "atom1_serNum": 3408, "atom2_serNum": 3433, "donAcc_type": "questionable", "distance": 2.741, "atom1_id": "///B/217/O", "atom2_id": "///B/220/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 448, "atom1_serNum": 3425, "atom2_serNum": 3931, "donAcc_type": "standard", "distance": 2.911, "atom1_id": "///B/219/O", "atom2_id": "///B/281/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 449, "atom1_serNum": 3428, "atom2_serNum": 3703, "donAcc_type": "standard", "distance": 2.945, "atom1_id": "///B/219/OD1", "atom2_id": "///B/254/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 450, "atom1_serNum": 3428, "atom2_serNum": 3940, "donAcc_type": "standard", "distance": 2.412, "atom1_id": "///B/219/OD1", "atom2_id": "///B/281/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 451, "atom1_serNum": 3438, "atom2_serNum": 3916, "donAcc_type": "standard", "distance": 3.077, "atom1_id": "///B/221/N", "atom2_id": "///B/279/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 452, "atom1_serNum": 3476, "atom2_serNum": 3510, "donAcc_type": "standard", "distance": 3.749, "atom1_id": "///B/225/O", "atom2_id": "///B/229/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 453, "atom1_serNum": 3480, "atom2_serNum": 3503, "donAcc_type": "standard", "distance": 2.817, "atom1_id": "///B/226/O", "atom2_id": "///B/229/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 454, "atom1_serNum": 3483, "atom2_serNum": 3510, "donAcc_type": "standard", "distance": 2.826, "atom1_id": "///B/226/OD1", "atom2_id": "///B/229/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 455, "atom1_serNum": 3493, "atom2_serNum": 3502, "donAcc_type": "questionable", "distance": 2.917, "atom1_id": "///B/227/NZ", "atom2_id": "///B/228/NZ", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 456, "atom1_serNum": 3506, "atom2_serNum": 3520, "donAcc_type": "standard", "distance": 2.836, "atom1_id": "///B/229/O", "atom2_id": "///B/232/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 457, "atom1_serNum": 3516, "atom2_serNum": 3561, "donAcc_type": "standard", "distance": 2.663, "atom1_id": "///B/231/N", "atom2_id": "///B/236/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 458, "atom1_serNum": 3531, "atom2_serNum": 3561, "donAcc_type": "standard", "distance": 3.134, "atom1_id": "///B/233/N", "atom2_id": "///B/236/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 459, "atom1_serNum": 3534, "atom2_serNum": 3563, "donAcc_type": "standard", "distance": 3.161, "atom1_id": "///B/233/O", "atom2_id": "///B/237/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 460, "atom1_serNum": 3536, "atom2_serNum": 3554, "donAcc_type": "acceptable", "distance": 3.125, "atom1_id": "///B/233/OG1", "atom2_id": "///B/236/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 461, "atom1_serNum": 3536, "atom2_serNum": 3561, "donAcc_type": "acceptable", "distance": 2.880, "atom1_id": "///B/233/OG1", "atom2_id": "///B/236/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 462, "atom1_serNum": 3538, "atom2_serNum": 3552, "donAcc_type": "standard", "distance": 3.288, "atom1_id": "///B/234/N", "atom2_id": "///B/235/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 463, "atom1_serNum": 3541, "atom2_serNum": 3574, "donAcc_type": "standard", "distance": 2.786, "atom1_id": "///B/234/O", "atom2_id": "///B/238/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 464, "atom1_serNum": 3545, "atom2_serNum": 3552, "donAcc_type": "standard", "distance": 2.517, "atom1_id": "///B/235/N", "atom2_id": "///B/235/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 465, "atom1_serNum": 3548, "atom2_serNum": 3583, "donAcc_type": "standard", "distance": 2.931, "atom1_id": "///B/235/O", "atom2_id": "///B/239/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 466, "atom1_serNum": 3557, "atom2_serNum": 3587, "donAcc_type": "standard", "distance": 3.127, "atom1_id": "///B/236/O", "atom2_id": "///B/240/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 467, "atom1_serNum": 3566, "atom2_serNum": 3598, "donAcc_type": "standard", "distance": 3.123, "atom1_id": "///B/237/O", "atom2_id": "///B/241/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 468, "atom1_serNum": 3577, "atom2_serNum": 3602, "donAcc_type": "standard", "distance": 2.833, "atom1_id": "///B/238/O", "atom2_id": "///B/242/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 469, "atom1_serNum": 3586, "atom2_serNum": 3611, "donAcc_type": "standard", "distance": 2.760, "atom1_id": "///B/239/O", "atom2_id": "///B/243/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 470, "atom1_serNum": 3590, "atom2_serNum": 3619, "donAcc_type": "standard", "distance": 3.006, "atom1_id": "///B/240/O", "atom2_id": "///B/244/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 471, "atom1_serNum": 3601, "atom2_serNum": 3627, "donAcc_type": "standard", "distance": 2.907, "atom1_id": "///B/241/O", "atom2_id": "///B/245/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 472, "atom1_serNum": 3605, "atom2_serNum": 3636, "donAcc_type": "standard", "distance": 2.700, "atom1_id": "///B/242/O", "atom2_id": "///B/246/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 473, "atom1_serNum": 3614, "atom2_serNum": 3641, "donAcc_type": "standard", "distance": 3.485, "atom1_id": "///B/243/O", "atom2_id": "///B/247/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 474, "atom1_serNum": 3622, "atom2_serNum": 3655, "donAcc_type": "standard", "distance": 3.178, "atom1_id": "///B/244/O", "atom2_id": "///B/249/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 475, "atom1_serNum": 3663, "atom2_serNum": 3992, "donAcc_type": "standard", "distance": 2.699, "atom1_id": "///B/250/N", "atom2_id": "///B/287/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 476, "atom1_serNum": 3666, "atom2_serNum": 3676, "donAcc_type": "standard", "distance": 3.049, "atom1_id": "///B/250/O", "atom2_id": "///B/252/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 477, "atom1_serNum": 3666, "atom2_serNum": 3989, "donAcc_type": "standard", "distance": 3.002, "atom1_id": "///B/250/O", "atom2_id": "///B/287/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 478, "atom1_serNum": 3671, "atom2_serNum": 3704, "donAcc_type": "standard", "distance": 2.754, "atom1_id": "///B/251/O", "atom2_id": "///B/255/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 479, "atom1_serNum": 3674, "atom2_serNum": 3682, "donAcc_type": "standard", "distance": 3.298, "atom1_id": "///B/251/OD1", "atom2_id": "///B/253/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 480, "atom1_serNum": 3674, "atom2_serNum": 3941, "donAcc_type": "standard", "distance": 2.452, "atom1_id": "///B/251/OD1", "atom2_id": "///B/281/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 481, "atom1_serNum": 3675, "atom2_serNum": 3940, "donAcc_type": "standard", "distance": 3.173, "atom1_id": "///B/251/OD2", "atom2_id": "///B/281/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 482, "atom1_serNum": 3675, "atom2_serNum": 3941, "donAcc_type": "standard", "distance": 2.690, "atom1_id": "///B/251/OD2", "atom2_id": "///B/281/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 483, "atom1_serNum": 3676, "atom2_serNum": 3973, "donAcc_type": "standard", "distance": 2.984, "atom1_id": "///B/252/N", "atom2_id": "///B/285/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 484, "atom1_serNum": 3681, "atom2_serNum": 3973, "donAcc_type": "acceptable", "distance": 2.619, "atom1_id": "///B/252/OG", "atom2_id": "///B/285/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 485, "atom1_serNum": 3681, "atom2_serNum": 4081, "donAcc_type": "acceptable", "distance": 3.160, "atom1_id": "///B/252/OG", "atom2_id": "///B/298/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 486, "atom1_serNum": 3685, "atom2_serNum": 3722, "donAcc_type": "standard", "distance": 2.882, "atom1_id": "///B/253/O", "atom2_id": "///B/257/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 487, "atom1_serNum": 3702, "atom2_serNum": 3725, "donAcc_type": "standard", "distance": 2.815, "atom1_id": "///B/254/NH1", "atom2_id": "///B/257/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 488, "atom1_serNum": 3702, "atom2_serNum": 3752, "donAcc_type": "standard", "distance": 3.266, "atom1_id": "///B/254/NH1", "atom2_id": "///B/260/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 489, "atom1_serNum": 3725, "atom2_serNum": 3749, "donAcc_type": "standard", "distance": 3.495, "atom1_id": "///B/257/O", "atom2_id": "///B/260/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 490, "atom1_serNum": 3733, "atom2_serNum": 4074, "donAcc_type": "acceptable", "distance": 2.811, "atom1_id": "///B/257/OH", "atom2_id": "///B/297/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 491, "atom1_serNum": 3733, "atom2_serNum": 4090, "donAcc_type": "acceptable", "distance": 3.587, "atom1_id": "///B/257/OH", "atom2_id": "///B/299/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 492, "atom1_serNum": 3766, "atom2_serNum": 3904, "donAcc_type": "questionable", "distance": 3.061, "atom1_id": "///B/262/O", "atom2_id": "///B/277/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 493, "atom1_serNum": 3792, "atom2_serNum": 3920, "donAcc_type": "standard", "distance": 2.673, "atom1_id": "///B/265/N", "atom2_id": "///B/280/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 494, "atom1_serNum": 3795, "atom2_serNum": 4166, "donAcc_type": "standard", "distance": 2.912, "atom1_id": "///B/265/O", "atom2_id": "///B/310/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 495, "atom1_serNum": 3797, "atom2_serNum": 3942, "donAcc_type": "acceptable", "distance": 3.166, "atom1_id": "///B/265/OG1", "atom2_id": "///B/282/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 496, "atom1_serNum": 3797, "atom2_serNum": 3950, "donAcc_type": "acceptable", "distance": 3.150, "atom1_id": "///B/265/OG1", "atom2_id": "///B/283/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 497, "atom1_serNum": 3797, "atom2_serNum": 3957, "donAcc_type": "acceptable", "distance": 2.604, "atom1_id": "///B/265/OG1", "atom2_id": "///B/283/OD2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 498, "atom1_serNum": 3799, "atom2_serNum": 3920, "donAcc_type": "standard", "distance": 2.854, "atom1_id": "///B/266/N", "atom2_id": "///B/280/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 499, "atom1_serNum": 3802, "atom2_serNum": 3917, "donAcc_type": "standard", "distance": 2.806, "atom1_id": "///B/266/O", "atom2_id": "///B/280/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 500, "atom1_serNum": 3810, "atom2_serNum": 4151, "donAcc_type": "standard", "distance": 2.946, "atom1_id": "///B/267/N", "atom2_id": "///B/308/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 501, "atom1_serNum": 3827, "atom2_serNum": 3867, "donAcc_type": "standard", "distance": 3.950, "atom1_id": "///B/268/O", "atom2_id": "///B/273/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 502, "atom1_serNum": 3846, "atom2_serNum": 3867, "donAcc_type": "standard", "distance": 2.854, "atom1_id": "///B/270/O", "atom2_id": "///B/273/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 503, "atom1_serNum": 3854, "atom2_serNum": 3897, "donAcc_type": "standard", "distance": 2.872, "atom1_id": "///B/271/O", "atom2_id": "///B/276/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 504, "atom1_serNum": 3862, "atom2_serNum": 3889, "donAcc_type": "standard", "distance": 3.619, "atom1_id": "///B/272/O", "atom2_id": "///B/276/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 505, "atom1_serNum": 3870, "atom2_serNum": 3898, "donAcc_type": "standard", "distance": 2.952, "atom1_id": "///B/273/O", "atom2_id": "///B/277/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 506, "atom1_serNum": 3870, "atom2_serNum": 3906, "donAcc_type": "standard", "distance": 2.811, "atom1_id": "///B/273/O", "atom2_id": "///B/278/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 507, "atom1_serNum": 3881, "atom2_serNum": 4145, "donAcc_type": "standard", "distance": 3.252, "atom1_id": "///B/274/NH1", "atom2_id": "///B/307/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 508, "atom1_serNum": 3882, "atom2_serNum": 4113, "donAcc_type": "standard", "distance": 2.514, "atom1_id": "///B/274/NH2", "atom2_id": "///B/302/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 509, "atom1_serNum": 3882, "atom2_serNum": 4128, "donAcc_type": "standard", "distance": 3.040, "atom1_id": "///B/274/NH2", "atom2_id": "///B/304/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 510, "atom1_serNum": 3901, "atom2_serNum": 3905, "donAcc_type": "standard", "distance": 2.234, "atom1_id": "///B/277/O", "atom2_id": "///B/277/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 511, "atom1_serNum": 3957, "atom2_serNum": 4162, "donAcc_type": "acceptable", "distance": 2.925, "atom1_id": "///B/283/OD2", "atom2_id": "///B/309/ND1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 512, "atom1_serNum": 4000, "atom2_serNum": 4026, "donAcc_type": "standard", "distance": 3.091, "atom1_id": "///B/288/O", "atom2_id": "///B/291/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 513, "atom1_serNum": 4007, "atom2_serNum": 4034, "donAcc_type": "standard", "distance": 3.005, "atom1_id": "///B/289/O", "atom2_id": "///B/292/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 514, "atom1_serNum": 4029, "atom2_serNum": 4049, "donAcc_type": "standard", "distance": 2.780, "atom1_id": "///B/291/O", "atom2_id": "///B/294/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 515, "atom1_serNum": 4029, "atom2_serNum": 4054, "donAcc_type": "standard", "distance": 3.291, "atom1_id": "///B/291/O", "atom2_id": "///B/295/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 516, "atom1_serNum": 4037, "atom2_serNum": 4054, "donAcc_type": "standard", "distance": 3.005, "atom1_id": "///B/292/O", "atom2_id": "///B/295/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 517, "atom1_serNum": 4052, "atom2_serNum": 4062, "donAcc_type": "standard", "distance": 2.994, "atom1_id": "///B/294/O", "atom2_id": "///B/296/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 518, "atom1_serNum": 4052, "atom2_serNum": 4222, "donAcc_type": "standard", "distance": 2.880, "atom1_id": "///B/294/O", "atom2_id": "///B/317/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 519, "atom1_serNum": 4062, "atom2_serNum": 4205, "donAcc_type": "standard", "distance": 2.924, "atom1_id": "///B/296/N", "atom2_id": "///B/315/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 520, "atom1_serNum": 4071, "atom2_serNum": 4202, "donAcc_type": "standard", "distance": 3.276, "atom1_id": "///B/297/O", "atom2_id": "///B/315/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 521, "atom1_serNum": 4074, "atom2_serNum": 4076, "donAcc_type": "standard", "distance": 2.656, "atom1_id": "///B/297/OD1", "atom2_id": "///B/298/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 522, "atom1_serNum": 4074, "atom2_serNum": 4090, "donAcc_type": "standard", "distance": 3.236, "atom1_id": "///B/297/OD1", "atom2_id": "///B/299/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 523, "atom1_serNum": 4075, "atom2_serNum": 4090, "donAcc_type": "standard", "distance": 2.342, "atom1_id": "///B/297/OD2", "atom2_id": "///B/299/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 524, "atom1_serNum": 4082, "atom2_serNum": 4190, "donAcc_type": "standard", "distance": 2.775, "atom1_id": "///B/299/N", "atom2_id": "///B/313/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 525, "atom1_serNum": 4085, "atom2_serNum": 4187, "donAcc_type": "standard", "distance": 3.207, "atom1_id": "///B/299/O", "atom2_id": "///B/313/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 526, "atom1_serNum": 4099, "atom2_serNum": 4175, "donAcc_type": "standard", "distance": 2.963, "atom1_id": "///B/301/N", "atom2_id": "///B/311/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 527, "atom1_serNum": 4102, "atom2_serNum": 4125, "donAcc_type": "standard", "distance": 3.092, "atom1_id": "///B/301/O", "atom2_id": "///B/304/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 528, "atom1_serNum": 4109, "atom2_serNum": 4213, "donAcc_type": "acceptable", "distance": 3.540, "atom1_id": "///B/301/NH2", "atom2_id": "///B/315/OH", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 529, "atom1_serNum": 4119, "atom2_serNum": 4130, "donAcc_type": "standard", "distance": 3.258, "atom1_id": "///B/303/O", "atom2_id": "///B/305/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 530, "atom1_serNum": 4147, "atom2_serNum": 4156, "donAcc_type": "acceptable", "distance": 3.253, "atom1_id": "///B/307/OG", "atom2_id": "///B/309/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 531, "atom1_serNum": 4148, "atom2_serNum": 4154, "donAcc_type": "standard", "distance": 2.633, "atom1_id": "///B/308/N", "atom2_id": "///B/308/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 532, "atom1_serNum": 4154, "atom2_serNum": 4156, "donAcc_type": "standard", "distance": 3.275, "atom1_id": "///B/308/OD1", "atom2_id": "///B/309/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 533, "atom1_serNum": 4250, "atom2_serNum": 5090, "donAcc_type": "standard", "distance": 3.567, "atom1_id": "///P/1/O6", "atom2_id": "///V/21/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 534, "atom1_serNum": 4251, "atom2_serNum": 5088, "donAcc_type": "standard", "distance": 3.379, "atom1_id": "///P/1/N1", "atom2_id": "///V/21/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 535, "atom1_serNum": 4253, "atom2_serNum": 5087, "donAcc_type": "standard", "distance": 3.086, "atom1_id": "///P/1/N2", "atom2_id": "///V/21/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 536, "atom1_serNum": 4269, "atom2_serNum": 5071, "donAcc_type": "standard", "distance": 2.763, "atom1_id": "///P/2/O2", "atom2_id": "///V/20/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 537, "atom1_serNum": 4270, "atom2_serNum": 5069, "donAcc_type": "standard", "distance": 2.857, "atom1_id": "///P/2/N3", "atom2_id": "///V/20/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 538, "atom1_serNum": 4272, "atom2_serNum": 5068, "donAcc_type": "standard", "distance": 2.881, "atom1_id": "///P/2/N4", "atom2_id": "///V/20/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 539, "atom1_serNum": 4289, "atom2_serNum": 5048, "donAcc_type": "standard", "distance": 2.893, "atom1_id": "///P/3/N3", "atom2_id": "///V/19/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 540, "atom1_serNum": 4291, "atom2_serNum": 5047, "donAcc_type": "standard", "distance": 3.011, "atom1_id": "///P/3/O4", "atom2_id": "///V/19/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 541, "atom1_serNum": 4311, "atom2_serNum": 5028, "donAcc_type": "standard", "distance": 3.095, "atom1_id": "///P/4/O6", "atom2_id": "///V/18/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 542, "atom1_serNum": 4312, "atom2_serNum": 5026, "donAcc_type": "standard", "distance": 3.075, "atom1_id": "///P/4/N1", "atom2_id": "///V/18/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 543, "atom1_serNum": 4314, "atom2_serNum": 5025, "donAcc_type": "standard", "distance": 3.005, "atom1_id": "///P/4/N2", "atom2_id": "///V/18/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 544, "atom1_serNum": 4333, "atom2_serNum": 5008, "donAcc_type": "standard", "distance": 3.118, "atom1_id": "///P/5/N6", "atom2_id": "///V/17/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 545, "atom1_serNum": 4334, "atom2_serNum": 5006, "donAcc_type": "standard", "distance": 3.046, "atom1_id": "///P/5/N1", "atom2_id": "///V/17/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 546, "atom1_serNum": 4352, "atom2_serNum": 4988, "donAcc_type": "standard", "distance": 2.869, "atom1_id": "///P/6/N3", "atom2_id": "///V/16/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 547, "atom1_serNum": 4354, "atom2_serNum": 4987, "donAcc_type": "standard", "distance": 3.214, "atom1_id": "///P/6/O4", "atom2_id": "///V/16/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 548, "atom1_serNum": 4374, "atom2_serNum": 4968, "donAcc_type": "standard", "distance": 3.071, "atom1_id": "///P/7/O6", "atom2_id": "///V/15/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 549, "atom1_serNum": 4375, "atom2_serNum": 4966, "donAcc_type": "standard", "distance": 3.041, "atom1_id": "///P/7/N1", "atom2_id": "///V/15/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 550, "atom1_serNum": 4377, "atom2_serNum": 4965, "donAcc_type": "standard", "distance": 2.910, "atom1_id": "///P/7/N2", "atom2_id": "///V/15/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 551, "atom1_serNum": 4393, "atom2_serNum": 4949, "donAcc_type": "standard", "distance": 2.840, "atom1_id": "///P/8/O2", "atom2_id": "///V/14/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 552, "atom1_serNum": 4394, "atom2_serNum": 4947, "donAcc_type": "standard", "distance": 2.925, "atom1_id": "///P/8/N3", "atom2_id": "///V/14/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 553, "atom1_serNum": 4396, "atom2_serNum": 4946, "donAcc_type": "standard", "distance": 2.913, "atom1_id": "///P/8/N4", "atom2_id": "///V/14/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 554, "atom1_serNum": 4415, "atom2_serNum": 4927, "donAcc_type": "standard", "distance": 3.067, "atom1_id": "///P/9/O6", "atom2_id": "///V/13/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 555, "atom1_serNum": 4416, "atom2_serNum": 4925, "donAcc_type": "standard", "distance": 2.941, "atom1_id": "///P/9/N1", "atom2_id": "///V/13/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 556, "atom1_serNum": 4418, "atom2_serNum": 4924, "donAcc_type": "standard", "distance": 2.781, "atom1_id": "///P/9/N2", "atom2_id": "///V/13/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 557, "atom1_serNum": 4434, "atom2_serNum": 4905, "donAcc_type": "standard", "distance": 3.342, "atom1_id": "///P/10/O2", "atom2_id": "///V/12/N3", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 558, "atom1_serNum": 4435, "atom2_serNum": 4907, "donAcc_type": "questionable", "distance": 2.980, "atom1_id": "///P/10/N3", "atom2_id": "///V/12/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 559, "atom1_serNum": 4475, "atom2_serNum": 4867, "donAcc_type": "standard", "distance": 2.465, "atom1_id": "///P/12/O2", "atom2_id": "///V/10/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 560, "atom1_serNum": 4476, "atom2_serNum": 4865, "donAcc_type": "standard", "distance": 2.618, "atom1_id": "///P/12/N3", "atom2_id": "///V/10/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 561, "atom1_serNum": 4478, "atom2_serNum": 4864, "donAcc_type": "standard", "distance": 2.656, "atom1_id": "///P/12/N4", "atom2_id": "///V/10/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 562, "atom1_serNum": 4497, "atom2_serNum": 4845, "donAcc_type": "standard", "distance": 2.688, "atom1_id": "///P/13/O6", "atom2_id": "///V/9/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 563, "atom1_serNum": 4498, "atom2_serNum": 4843, "donAcc_type": "standard", "distance": 2.694, "atom1_id": "///P/13/N1", "atom2_id": "///V/9/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 564, "atom1_serNum": 4500, "atom2_serNum": 4842, "donAcc_type": "standard", "distance": 2.655, "atom1_id": "///P/13/N2", "atom2_id": "///V/9/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 565, "atom1_serNum": 4519, "atom2_serNum": 4825, "donAcc_type": "standard", "distance": 2.845, "atom1_id": "///P/14/N6", "atom2_id": "///V/8/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 566, "atom1_serNum": 4520, "atom2_serNum": 4823, "donAcc_type": "standard", "distance": 2.758, "atom1_id": "///P/14/N1", "atom2_id": "///V/8/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 567, "atom1_serNum": 4537, "atom2_serNum": 4806, "donAcc_type": "standard", "distance": 2.678, "atom1_id": "///P/15/O2", "atom2_id": "///V/7/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 568, "atom1_serNum": 4538, "atom2_serNum": 4804, "donAcc_type": "standard", "distance": 2.989, "atom1_id": "///P/15/N3", "atom2_id": "///V/7/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 569, "atom1_serNum": 4540, "atom2_serNum": 4803, "donAcc_type": "standard", "distance": 3.190, "atom1_id": "///P/15/N4", "atom2_id": "///V/7/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 570, "atom1_serNum": 4559, "atom2_serNum": 4784, "donAcc_type": "standard", "distance": 3.126, "atom1_id": "///P/16/O6", "atom2_id": "///V/6/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 571, "atom1_serNum": 4560, "atom2_serNum": 4782, "donAcc_type": "standard", "distance": 2.850, "atom1_id": "///P/16/N1", "atom2_id": "///V/6/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 572, "atom1_serNum": 4562, "atom2_serNum": 4781, "donAcc_type": "standard", "distance": 2.537, "atom1_id": "///P/16/N2", "atom2_id": "///V/6/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 573, "atom1_serNum": 4581, "atom2_serNum": 4765, "donAcc_type": "standard", "distance": 3.154, "atom1_id": "///P/17/O6", "atom2_id": "///V/5/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 574, "atom1_serNum": 4582, "atom2_serNum": 4763, "donAcc_type": "standard", "distance": 2.905, "atom1_id": "///P/17/N1", "atom2_id": "///V/5/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 575, "atom1_serNum": 4584, "atom2_serNum": 4762, "donAcc_type": "standard", "distance": 2.612, "atom1_id": "///P/17/N2", "atom2_id": "///V/5/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 576, "atom1_serNum": 4603, "atom2_serNum": 4745, "donAcc_type": "standard", "distance": 3.167, "atom1_id": "///P/18/N6", "atom2_id": "///V/4/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 577, "atom1_serNum": 4604, "atom2_serNum": 4743, "donAcc_type": "standard", "distance": 2.886, "atom1_id": "///P/18/N1", "atom2_id": "///V/4/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 578, "atom1_serNum": 4622, "atom2_serNum": 4725, "donAcc_type": "standard", "distance": 2.789, "atom1_id": "///P/19/N3", "atom2_id": "///V/3/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 579, "atom1_serNum": 4624, "atom2_serNum": 4724, "donAcc_type": "standard", "distance": 2.952, "atom1_id": "///P/19/O4", "atom2_id": "///V/3/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 580, "atom1_serNum": 4641, "atom2_serNum": 4705, "donAcc_type": "standard", "distance": 2.943, "atom1_id": "///P/20/O2", "atom2_id": "///V/2/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 581, "atom1_serNum": 4642, "atom2_serNum": 4703, "donAcc_type": "standard", "distance": 2.879, "atom1_id": "///P/20/N3", "atom2_id": "///V/2/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 582, "atom1_serNum": 4644, "atom2_serNum": 4702, "donAcc_type": "standard", "distance": 2.864, "atom1_id": "///P/20/N4", "atom2_id": "///V/2/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 583, "atom1_serNum": 4660, "atom2_serNum": 4683, "donAcc_type": "standard", "distance": 2.268, "atom1_id": "///P/21/O2", "atom2_id": "///V/1/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 584, "atom1_serNum": 4661, "atom2_serNum": 4681, "donAcc_type": "standard", "distance": 2.816, "atom1_id": "///P/21/N3", "atom2_id": "///V/1/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 585, "atom1_serNum": 4663, "atom2_serNum": 4680, "donAcc_type": "standard", "distance": 3.243, "atom1_id": "///P/21/N4", "atom2_id": "///V/1/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" } ], "refCoords": { "purine": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 -0.5000 0.4000", " 3 N -2.2500 -0.5000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 1.2500 5.0000 0.4000", " 6 C 1.2500 -0.5000 0.4000", " 7 C 1.2500 -0.5000 -0.4000", " 8 C 1.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 -0.5000 0.4000", " 11 C -2.2500 -0.5000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ], "pyrimidine": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 1.0000 0.4000", " 3 N -2.2500 1.0000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 1.2500 5.0000 0.4000", " 6 C 1.2500 1.0000 0.4000", " 7 C 1.2500 1.0000 -0.4000", " 8 C 1.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 1.0000 0.4000", " 11 C -2.2500 1.0000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ], "wc_pair": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 -5.0000 0.4000", " 3 N -2.2500 -5.0000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 2.2500 5.0000 0.4000", " 6 C 2.2500 -5.0000 0.4000", " 7 C 2.2500 -5.0000 -0.4000", " 8 C 2.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 -5.0000 0.4000", " 11 C -2.2500 -5.0000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ] }, "metadata": { "license": "http://innovation.columbia.edu/technologies/CU20391", "url": "http://x3dna.org/", "url_alt": "http://home.x3dna.org/", "forum": "http://forum.x3dna.org/", "citation": "Lu et al. (2015). 'DSSR: an integrated software tool for dissecting the spatial structure of RNA.' Nucleic Acids Res., 43(21):e142 [doi:10.1093/nar/gkv716].", "str_id": "6bou", "num_aaChains": 2, "aaChains": "A=267,B=269", "num_naChains": 2, "naChains": "P=21,V=21", "num_atoms": 5120, "num_waters": 60, "num_notes": 52, "notes": [ { "Aminors": "A-minor interactions (including types I and II)" }, { "Cstem_index": "stem index of the 'Canonical' helix in k-turn" }, { "Cstem_pair": "Cstem bp delineating the k-turn internal loop" }, { "Dp": "perpendicular distance of the 3' P atom to the glycosidic bond" }, { "GA_pair": "sheared G-A pair in k-turn" }, { "HtypePknot": "H-type pseudoknot" }, { "Kturn": "kink-turn (k-turn)" }, { "LW": "Leontis-Westhof" }, { "NCstem_index": "stem index of the 'Non-Canonical' helix in k-turn" }, { "NCstem_pair": "NCstem bp delineating the k-turn internal loop" }, { "Uturn": "U-turn of the UNR- or GNRA-type" }, { "aa": "amino acid" }, { "atom_pair": "symbols of the two atoms involved in an H-bond" }, { "auxfiles": "auxiliary files" }, { "glyco_bond": "conformation of base related to sugar (syn or anti)" }, { "bb_type": "backbone conformation, BI or BII" }, { "bending_angle": "angle between two helical axes" }, { "bp": "base pair" }, { "bseq": "base sequence in one-letter code" }, { "bulge": "bulge loop" }, { "coaxStacks": "coaxial stacking of stems within a helix" }, { "dbn": "dot bracket notation" }, { "desc": "description" }, { "donAcc_type": "donor/acceptor type of the atom pair in an H-bond" }, { "epsilon_zeta": "difference between epsilon and zeta torsion angles" }, { "hairpin": "hairpin loop" }, { "hbond": "hydrogen bond (H-bond)" }, { "helix": "defined by base-stacking interactions, regardless of bp type and backbone connectivity" }, { "id": "identifier" }, { "iloop": "internal loop" }, { "index": "serial number" }, { "isoCanonPairs": "isolated canonical pairs" }, { "junction": "(multi-branched) junction loop" }, { "kissingLoop": "kissing loop" }, { "multiplet": "3+ bases in a coplanar geometry" }, { "na": "nucleic acid" }, { "nonPair": "two nts not forming a pair, but with H-bonding/stacking interactions" }, { "nonStack": "nucleotide not involved in stacking interactions" }, { "nt": "nucleotide" }, { "num": "number" }, { "oArea": "overlap areas between two bases, including exocyclic atoms" }, { "oArea_ring": "overlap areas between two bases, including only ring atoms" }, { "phosContacts": "H-bonding and atom-capping interactions involving a phosphate" }, { "residue_pair": "types of the two residues involved in an H-bond" }, { "rmsd": "root-mean-squares deviation" }, { "serNum": "serial number" }, { "ssSegments": "single-stranded segments not involved in loops" }, { "ssZp": "Z-coordinate of the 3' phosphorus atom with reference to the 5' base plane" }, { "sstr": "secondary structure in dbn" }, { "stem": "helix consisting of only canonical pairs, with a continuous backbone" }, { "str_id": "structure identifier, derived from inpfile with extension removed" }, { "vert_dist": "vertical distance from an atom to a base plane" } ], "num_auxfiles": 13, "auxfiles": [ { "index": 1, "name": "dssr-pairs.pdb", "desc": "an ensemble of base pairs" }, { "index": 2, "name": "dssr-stems.pdb", "desc": "an ensemble of stems" }, { "index": 3, "name": "dssr-helices.pdb", "desc": "an ensemble of helices (coaxial stacking)" }, { "index": 4, "name": "dssr-iloops.pdb", "desc": "an ensemble of internal loops" }, { "index": 5, "name": "dssr-2ndstrs.bpseq", "desc": "secondary structure in bpseq format" }, { "index": 6, "name": "dssr-2ndstrs.ct", "desc": "secondary structure in connectivity table format" }, { "index": 7, "name": "dssr-2ndstrs.dbn", "desc": "secondary structure in dot-bracket notation" }, { "index": 8, "name": "dssr-torsions.txt", "desc": "backbone torsion angles and suite names" }, { "index": 9, "name": "dssr-stacks.pdb", "desc": "an ensemble of base stacks" }, { "index": 10, "name": "dssr-rotmat.txt", "desc": "position vector and rotation matrix" }, { "index": 11, "name": "dssr-viewV.pdb", "desc": "vertical view of the principal moment of inertia" }, { "index": 12, "name": "dssr-viewH.pdb", "desc": "horizontal view of the principal moment of inertia" }, { "index": 13, "name": "dssr-viewT.pdb", "desc": "top view of the principal moment of inertia" } ], "time_used": "999" } }