{ "num_pairs": 25, "pairs": [ { "index": 1, "nt1": "///P/1", "nt2": "///T/37", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -97.827, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 50.064, "chi2": -95.410, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 59.243, "C1C1_dist": 10.543, "N1N9_dist": 8.841, "C6C8_dist": 9.771, "CNNC_torsion": -5.877, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.94],N1(imino)-N3[2.96],N2(amino)-O2(carbonyl)[2.88]", "interBase_angle": 13.044, "planarity": 0.213, "simple_Shear": -0.874, "simple_Stretch": -0.194, "simple_Buckle": 9.121, "simple_Propeller": -9.324, "bp_simpleParams": [ -0.874, -0.194, -0.142, 9.121, -9.324, 0.578 ], "bp_params": [ -0.854, -0.268, -0.142, 9.887, -8.508, 0.578 ], "frame": { "rmsd": null, "origin": [ 98.195, 139.517, 87.981 ], "x_axis": [ -0.915, -0.381, -0.129 ], "y_axis": [ 0.355, -0.611, -0.707 ], "z_axis": [ 0.191, -0.693, 0.695 ], "quaternion": [ -0.205, 0.017, -0.390, 0.897 ] } }, { "index": 2, "nt1": "///P/2", "nt2": "///T/36", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -96.970, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 51.986, "chi2": -93.499, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 61.070, "C1C1_dist": 10.401, "N1N9_dist": 8.782, "C6C8_dist": 9.778, "CNNC_torsion": -11.488, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[3.08],N1(imino)-N3[2.95],N2(amino)-O2(carbonyl)[2.84]", "interBase_angle": 17.479, "planarity": 0.268, "simple_Shear": -0.926, "simple_Stretch": -0.170, "simple_Buckle": 8.549, "simple_Propeller": -15.246, "bp_simpleParams": [ -0.926, -0.170, -0.115, 8.549, -15.246, 3.931 ], "bp_params": [ -0.906, -0.256, -0.115, 9.910, -14.398, 3.948 ], "frame": { "rmsd": null, "origin": [ 99.007, 136.851, 89.974 ], "x_axis": [ -0.527, -0.653, -0.544 ], "y_axis": [ 0.834, -0.273, -0.479 ], "z_axis": [ 0.164, -0.706, 0.689 ], "quaternion": [ -0.471, -0.120, -0.376, 0.789 ] } }, { "index": 3, "nt1": "///P/3", "nt2": "///T/35", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -95.508, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.605, "chi2": -91.526, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 60.482, "C1C1_dist": 10.303, "N1N9_dist": 8.704, "C6C8_dist": 9.695, "CNNC_torsion": -14.093, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.99],N1-N3(imino)[2.83]", "interBase_angle": 19.941, "planarity": 0.249, "simple_Shear": -0.596, "simple_Stretch": -0.223, "simple_Buckle": 6.258, "simple_Propeller": -18.933, "bp_simpleParams": [ -0.596, -0.223, -0.029, 6.258, -18.933, 2.363 ], "bp_params": [ -0.582, -0.259, -0.029, 7.340, -18.541, 2.390 ], "frame": { "rmsd": null, "origin": [ 100.158, 134.526, 92.172 ], "x_axis": [ 0.153, -0.644, -0.749 ], "y_axis": [ 0.973, 0.230, 0.001 ], "z_axis": [ 0.172, -0.729, 0.662 ], "quaternion": [ 0.715, 0.255, 0.322, -0.565 ] } }, { "index": 4, "nt1": "///P/4", "nt2": "///T/34", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -96.040, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 52.133, "chi2": -90.899, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 60.632, "C1C1_dist": 10.351, "N1N9_dist": 8.735, "C6C8_dist": 9.701, "CNNC_torsion": -15.528, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.96],N1(imino)-N3[2.89],N2(amino)-O2(carbonyl)[2.87]", "interBase_angle": 20.494, "planarity": 0.274, "simple_Shear": -0.967, "simple_Stretch": -0.280, "simple_Buckle": 1.170, "simple_Propeller": -20.460, "bp_simpleParams": [ -0.967, -0.280, -0.034, 1.170, -20.460, 2.098 ], "bp_params": [ -0.936, -0.370, -0.034, 3.080, -20.261, 2.130 ], "frame": { "rmsd": null, "origin": [ 101.204, 132.294, 94.492 ], "x_axis": [ 0.707, -0.341, -0.620 ], "y_axis": [ 0.680, 0.568, 0.463 ], "z_axis": [ 0.195, -0.749, 0.633 ], "quaternion": [ 0.853, 0.355, 0.239, -0.299 ] } }, { "index": 5, "nt1": "///P/5", "nt2": "///T/33", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -94.446, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.951, "chi2": -98.988, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 58.560, "C1C1_dist": 10.475, "N1N9_dist": 8.848, "C6C8_dist": 9.835, "CNNC_torsion": -12.840, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.82],O4(carbonyl)-N6(amino)[2.97]", "interBase_angle": 17.482, "planarity": 0.224, "simple_Shear": -0.308, "simple_Stretch": -0.115, "simple_Buckle": -2.008, "simple_Propeller": -17.366, "bp_simpleParams": [ -0.308, -0.115, -0.163, -2.008, -17.366, 2.040 ], "bp_params": [ -0.303, -0.126, -0.163, -1.388, -17.426, 2.063 ], "frame": { "rmsd": null, "origin": [ 102.206, 130.047, 96.911 ], "x_axis": [ 0.972, 0.157, -0.174 ], "y_axis": [ 0.038, 0.627, 0.778 ], "z_axis": [ 0.232, -0.763, 0.604 ], "quaternion": [ 0.895, 0.431, 0.113, 0.033 ] } }, { "index": 6, "nt1": "///P/6", "nt2": "///T/32", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -95.725, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 56.225, "chi2": -92.479, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.704, "C1C1_dist": 10.587, "N1N9_dist": 8.892, "C6C8_dist": 9.833, "CNNC_torsion": -5.185, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.93],N1-N3(imino)[2.85]", "interBase_angle": 15.259, "planarity": 0.200, "simple_Shear": 0.048, "simple_Stretch": -0.128, "simple_Buckle": -1.931, "simple_Propeller": -15.136, "bp_simpleParams": [ 0.048, -0.128, -0.361, -1.931, -15.136, 0.400 ], "bp_params": [ 0.046, -0.129, -0.361, -2.086, -15.116, 0.404 ], "frame": { "rmsd": null, "origin": [ 102.824, 127.765, 99.344 ], "x_axis": [ 0.773, 0.529, 0.350 ], "y_axis": [ -0.580, 0.366, 0.728 ], "z_axis": [ 0.257, -0.766, 0.590 ], "quaternion": [ 0.826, 0.452, -0.028, 0.336 ] } }, { "index": 7, "nt1": "///P/7", "nt2": "///T/31", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -96.393, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 55.609, "chi2": -94.916, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 55.240, "C1C1_dist": 10.610, "N1N9_dist": 8.941, "C6C8_dist": 9.904, "CNNC_torsion": -6.068, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.92],N1(imino)-N3[2.90],N2(amino)-O2(carbonyl)[2.84]", "interBase_angle": 14.704, "planarity": 0.208, "simple_Shear": -0.046, "simple_Stretch": -0.132, "simple_Buckle": -1.357, "simple_Propeller": -14.641, "bp_simpleParams": [ -0.046, -0.132, -0.386, -1.357, -14.641, 2.207 ], "bp_params": [ -0.046, -0.132, -0.386, -1.361, -14.641, 2.225 ], "frame": { "rmsd": null, "origin": [ 103.385, 125.354, 101.615 ], "x_axis": [ 0.299, 0.663, 0.687 ], "y_axis": [ -0.914, -0.009, 0.406 ], "z_axis": [ 0.276, -0.749, 0.603 ], "quaternion": [ 0.688, 0.420, -0.149, 0.573 ] } }, { "index": 8, "nt1": "///P/8", "nt2": "///T/30", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -97.132, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 56.885, "chi2": -96.958, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 54.294, "C1C1_dist": 10.412, "N1N9_dist": 8.745, "C6C8_dist": 9.736, "CNNC_torsion": -5.026, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.82],O4(carbonyl)-N6(amino)[2.95]", "interBase_angle": 13.795, "planarity": 0.198, "simple_Shear": 0.331, "simple_Stretch": -0.220, "simple_Buckle": -0.972, "simple_Propeller": -13.761, "bp_simpleParams": [ 0.331, -0.220, -0.419, -0.972, -13.761, 2.745 ], "bp_params": [ 0.324, -0.230, -0.419, -1.368, -13.727, 2.764 ], "frame": { "rmsd": null, "origin": [ 103.906, 122.791, 103.764 ], "x_axis": [ -0.341, 0.539, 0.770 ], "y_axis": [ -0.898, -0.430, -0.097 ], "z_axis": [ 0.278, -0.725, 0.630 ], "quaternion": [ 0.464, 0.338, -0.265, 0.775 ] } }, { "index": 9, "nt1": "///P/9", "nt2": "///T/29", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -94.199, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 57.173, "chi2": -91.159, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 57.364, "C1C1_dist": 10.311, "N1N9_dist": 8.721, "C6C8_dist": 9.739, "CNNC_torsion": -3.576, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.96],N1-N3(imino)[2.80]", "interBase_angle": 13.327, "planarity": 0.194, "simple_Shear": -0.231, "simple_Stretch": -0.219, "simple_Buckle": -1.595, "simple_Propeller": -13.231, "bp_simpleParams": [ -0.231, -0.219, -0.490, -1.595, -13.231, 3.928 ], "bp_params": [ -0.227, -0.223, -0.490, -1.354, -13.258, 3.954 ], "frame": { "rmsd": null, "origin": [ 104.475, 120.285, 105.874 ], "x_axis": [ -0.794, 0.273, 0.543 ], "y_axis": [ -0.562, -0.672, -0.483 ], "z_axis": [ 0.233, -0.689, 0.687 ], "quaternion": [ 0.235, 0.219, -0.330, 0.888 ] } }, { "index": 10, "nt1": "///P/10", "nt2": "///T/28", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -94.002, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 58.102, "chi2": -94.786, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 58.004, "C1C1_dist": 10.414, "N1N9_dist": 8.865, "C6C8_dist": 9.874, "CNNC_torsion": -3.950, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.82],N3-N1(imino)[2.92],N4(amino)-O6(carbonyl)[2.95]", "interBase_angle": 11.725, "planarity": 0.218, "simple_Shear": 0.280, "simple_Stretch": -0.164, "simple_Buckle": -1.630, "simple_Propeller": -11.611, "bp_simpleParams": [ 0.280, -0.164, -0.550, -1.630, -11.611, 3.728 ], "bp_params": [ 0.276, -0.171, -0.550, -1.908, -11.569, 3.746 ], "frame": { "rmsd": null, "origin": [ 105.029, 117.688, 108.032 ], "x_axis": [ -0.983, -0.157, 0.095 ], "y_axis": [ 0.047, -0.714, -0.698 ], "z_axis": [ 0.177, -0.682, 0.710 ], "quaternion": [ -0.055, 0.074, -0.374, 0.923 ] } }, { "index": 11, "nt1": "///P/11", "nt2": "///T/27", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -93.854, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 57.671, "chi2": -92.633, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 56.545, "C1C1_dist": 10.315, "N1N9_dist": 8.723, "C6C8_dist": 9.741, "CNNC_torsion": 1.008, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.82],O4(carbonyl)-N6(amino)[2.98]", "interBase_angle": 10.295, "planarity": 0.175, "simple_Shear": 0.269, "simple_Stretch": -0.224, "simple_Buckle": 0.667, "simple_Propeller": -10.274, "bp_simpleParams": [ 0.269, -0.224, -0.589, 0.667, -10.274, 3.822 ], "bp_params": [ 0.264, -0.230, -0.589, 0.440, -10.286, 3.837 ], "frame": { "rmsd": null, "origin": [ 105.615, 115.186, 110.176 ], "x_axis": [ -0.790, -0.502, -0.353 ], "y_axis": [ 0.600, -0.515, -0.611 ], "z_axis": [ 0.125, -0.695, 0.708 ], "quaternion": [ -0.317, -0.066, -0.376, 0.868 ] } }, { "index": 12, "nt1": "///P/12", "nt2": "///T/26", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -96.072, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 55.885, "chi2": -95.130, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 59.868, "C1C1_dist": 10.192, "N1N9_dist": 8.627, "C6C8_dist": 9.678, "CNNC_torsion": -1.829, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.99],N1-N3(imino)[2.80]", "interBase_angle": 9.972, "planarity": 0.191, "simple_Shear": -0.478, "simple_Stretch": -0.280, "simple_Buckle": 1.000, "simple_Propeller": -9.922, "bp_simpleParams": [ -0.478, -0.280, -0.633, 1.000, -9.922, 5.365 ], "bp_params": [ -0.466, -0.300, -0.633, 1.428, -9.869, 5.384 ], "frame": { "rmsd": null, "origin": [ 106.137, 112.727, 112.360 ], "x_axis": [ -0.371, -0.623, -0.689 ], "y_axis": [ 0.927, -0.199, -0.319 ], "z_axis": [ 0.062, -0.757, 0.651 ], "quaternion": [ 0.520, 0.210, 0.361, -0.745 ] } }, { "index": 13, "nt1": "///P/13", "nt2": "///T/25", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -94.369, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.420, "chi2": -96.908, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 58.696, "C1C1_dist": 10.458, "N1N9_dist": 8.820, "C6C8_dist": 9.796, "CNNC_torsion": 0.039, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.94],N1(imino)-N3[2.93],N2(amino)-O2(carbonyl)[2.85]", "interBase_angle": 11.619, "planarity": 0.237, "simple_Shear": -0.605, "simple_Stretch": -0.235, "simple_Buckle": 2.320, "simple_Propeller": -11.385, "bp_simpleParams": [ -0.605, -0.235, -0.640, 2.320, -11.385, 3.130 ], "bp_params": [ -0.590, -0.270, -0.640, 2.959, -11.236, 3.144 ], "frame": { "rmsd": null, "origin": [ 106.642, 110.157, 114.473 ], "x_axis": [ 0.217, -0.579, -0.786 ], "y_axis": [ 0.974, 0.182, 0.135 ], "z_axis": [ 0.065, -0.795, 0.604 ], "quaternion": [ 0.708, 0.328, 0.301, -0.549 ] } }, { "index": 14, "nt1": "///P/14", "nt2": "///T/24", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -97.600, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 52.938, "chi2": -95.667, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 57.500, "C1C1_dist": 10.499, "N1N9_dist": 8.826, "C6C8_dist": 9.788, "CNNC_torsion": -0.063, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.92],N1(imino)-N3[2.92],N2(amino)-O2(carbonyl)[2.87]", "interBase_angle": 13.993, "planarity": 0.258, "simple_Shear": -0.550, "simple_Stretch": -0.246, "simple_Buckle": 2.445, "simple_Propeller": -13.778, "bp_simpleParams": [ -0.550, -0.246, -0.639, 2.445, -13.778, 2.880 ], "bp_params": [ -0.537, -0.274, -0.639, 3.145, -13.635, 2.900 ], "frame": { "rmsd": null, "origin": [ 107.230, 107.550, 116.539 ], "x_axis": [ 0.736, -0.309, -0.602 ], "y_axis": [ 0.668, 0.472, 0.575 ], "z_axis": [ 0.107, -0.825, 0.554 ], "quaternion": [ 0.831, 0.421, 0.213, -0.294 ] } }, { "index": 15, "nt1": "///P/15", "nt2": "///T/23", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -99.257, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 54.038, "chi2": -93.346, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 57.738, "C1C1_dist": 10.359, "N1N9_dist": 8.709, "C6C8_dist": 9.700, "CNNC_torsion": -1.204, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.94],N1-N3(imino)[2.83]", "interBase_angle": 12.716, "planarity": 0.213, "simple_Shear": -0.413, "simple_Stretch": -0.262, "simple_Buckle": 1.845, "simple_Propeller": -12.582, "bp_simpleParams": [ -0.413, -0.262, -0.617, 1.845, -12.582, 3.113 ], "bp_params": [ -0.403, -0.278, -0.617, 2.309, -12.505, 3.131 ], "frame": { "rmsd": null, "origin": [ 107.772, 105.001, 118.686 ], "x_axis": [ 0.978, 0.104, -0.180 ], "y_axis": [ 0.093, 0.557, 0.825 ], "z_axis": [ 0.187, -0.824, 0.535 ], "quaternion": [ 0.876, 0.471, 0.105, 0.003 ] } }, { "index": 16, "nt1": "///P/16", "nt2": "///T/22", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -93.853, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 56.102, "chi2": -97.381, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 54.982, "C1C1_dist": 10.575, "N1N9_dist": 8.920, "C6C8_dist": 9.872, "CNNC_torsion": -0.732, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.85],N3-N1(imino)[2.94],N4(amino)-O6(carbonyl)[2.92]", "interBase_angle": 10.804, "planarity": 0.179, "simple_Shear": 0.348, "simple_Stretch": -0.168, "simple_Buckle": 1.944, "simple_Propeller": -10.627, "bp_simpleParams": [ 0.348, -0.168, -0.585, 1.944, -10.627, 1.609 ], "bp_params": [ 0.342, -0.178, -0.585, 1.620, -10.682, 1.616 ], "frame": { "rmsd": null, "origin": [ 108.479, 102.445, 120.826 ], "x_axis": [ 0.802, 0.504, 0.319 ], "y_axis": [ -0.530, 0.357, 0.769 ], "z_axis": [ 0.274, -0.786, 0.554 ], "quaternion": [ 0.824, 0.472, -0.013, 0.314 ] } }, { "index": 17, "nt1": "///P/17", "nt2": "///T/21", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -94.067, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 54.820, "chi2": -99.172, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.965, "C1C1_dist": 10.659, "N1N9_dist": 8.953, "C6C8_dist": 9.881, "CNNC_torsion": 3.278, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.90],N1(imino)-N3[2.94],N2(amino)-O2(carbonyl)[2.88]", "interBase_angle": 10.614, "planarity": 0.225, "simple_Shear": -0.077, "simple_Stretch": -0.172, "simple_Buckle": 1.943, "simple_Propeller": -10.435, "bp_simpleParams": [ -0.077, -0.172, -0.698, 1.943, -10.435, 0.905 ], "bp_params": [ -0.077, -0.172, -0.698, 1.977, -10.428, 0.909 ], "frame": { "rmsd": null, "origin": [ 109.410, 100.025, 122.951 ], "x_axis": [ 0.380, 0.718, 0.583 ], "y_axis": [ -0.845, 0.013, 0.535 ], "z_axis": [ 0.377, -0.696, 0.612 ], "quaternion": [ 0.708, 0.435, -0.073, 0.552 ] } }, { "index": 18, "nt1": "///P/18", "nt2": "///T/20", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -99.211, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 58.792, "chi2": -92.814, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 52.975, "C1C1_dist": 10.941, "N1N9_dist": 9.300, "C6C8_dist": 10.345, "CNNC_torsion": -14.139, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.63],N1-N3(imino)[3.30]", "interBase_angle": 19.194, "planarity": 0.248, "simple_Shear": 0.435, "simple_Stretch": 0.417, "simple_Buckle": -2.191, "simple_Propeller": -19.068, "bp_simpleParams": [ 0.435, 0.417, -0.082, -2.191, -19.068, 4.804 ], "bp_params": [ 0.456, 0.394, -0.082, -3.147, -18.934, 4.869 ], "frame": { "rmsd": null, "origin": [ 109.745, 97.660, 125.147 ], "x_axis": [ -0.315, 0.614, 0.724 ], "y_axis": [ -0.877, -0.480, 0.026 ], "z_axis": [ 0.363, -0.626, 0.690 ], "quaternion": [ 0.473, 0.345, -0.191, 0.788 ] } }, { "index": 19, "nt1": "///P/19", "nt2": "///T/19", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -99.612, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 52.847, "chi2": -99.655, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 50.367, "C1C1_dist": 10.513, "N1N9_dist": 8.690, "C6C8_dist": 9.469, "CNNC_torsion": -9.480, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.46],N1-N3(imino)[2.61]", "interBase_angle": 19.869, "planarity": 0.253, "simple_Shear": 0.099, "simple_Stretch": -0.388, "simple_Buckle": -13.864, "simple_Propeller": -14.232, "bp_simpleParams": [ 0.099, -0.388, -0.170, -13.864, -14.232, -7.083 ], "bp_params": [ 0.091, -0.390, -0.170, -14.162, -13.936, -7.082 ], "frame": { "rmsd": null, "origin": [ 111.407, 94.848, 127.319 ], "x_axis": [ -0.802, 0.241, 0.547 ], "y_axis": [ -0.516, -0.742, -0.429 ], "z_axis": [ 0.303, -0.626, 0.719 ], "quaternion": [ 0.209, 0.235, -0.292, 0.903 ] } }, { "index": 20, "nt1": "///P/20", "nt2": "///T/18", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -104.052, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 52.479, "chi2": -128.929, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.915, "C1C1_dist": 10.662, "N1N9_dist": 8.910, "C6C8_dist": 9.842, "CNNC_torsion": 19.108, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.90],N1(imino)-N3[2.87],N2(amino)-O2(carbonyl)[2.83]", "interBase_angle": 16.639, "planarity": 0.230, "simple_Shear": -0.149, "simple_Stretch": -0.167, "simple_Buckle": -5.974, "simple_Propeller": 15.530, "bp_simpleParams": [ -0.149, -0.167, -0.234, -5.974, 15.530, -0.192 ], "bp_params": [ -0.146, -0.169, -0.234, -6.166, 15.454, -0.194 ], "frame": { "rmsd": null, "origin": [ 112.343, 92.629, 129.797 ], "x_axis": [ -0.917, -0.264, 0.299 ], "y_axis": [ -0.046, -0.674, -0.737 ], "z_axis": [ 0.396, -0.690, 0.606 ], "quaternion": [ -0.061, 0.194, -0.399, 0.894 ] } }, { "index": 21, "nt1": "///P/21", "nt2": "///T/17", "bp": "G-C", "name": "--", "Saenger": "--", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -116.954, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 58.540, "chi2": -126.355, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 75.653, "C1C1_dist": 10.620, "N1N9_dist": 9.503, "C6C8_dist": 10.968, "CNNC_torsion": 7.244, "hbonds_num": 1, "hbonds_desc": "N2(amino)-O2(carbonyl)[2.97]", "interBase_angle": 2.664, "planarity": 0.142, "simple_Shear": -1.469, "simple_Stretch": 1.297, "simple_Buckle": 1.302, "simple_Propeller": 2.325, "bp_simpleParams": [ -1.469, 1.297, -0.684, 1.302, 2.325, 26.294 ], "bp_params": [ -1.640, 1.073, -0.684, 0.955, 2.488, 26.300 ], "frame": { "rmsd": null, "origin": [ 112.827, 90.275, 131.220 ], "x_axis": [ -0.933, -0.327, -0.150 ], "y_axis": [ 0.309, -0.515, -0.799 ], "z_axis": [ 0.184, -0.792, 0.582 ], "quaternion": [ -0.183, 0.010, -0.457, 0.870 ] } }, { "index": 22, "nt1": "///P/22", "nt2": "///T/16", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -107.813, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 63.112, "chi2": -87.683, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 48.029, "C1C1_dist": 10.309, "N1N9_dist": 8.668, "C6C8_dist": 9.626, "CNNC_torsion": -0.572, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.89],N1-N3(imino)[2.81]", "interBase_angle": 7.272, "planarity": 0.201, "simple_Shear": 1.336, "simple_Stretch": -0.241, "simple_Buckle": 6.930, "simple_Propeller": -2.204, "bp_simpleParams": [ 1.336, -0.241, -0.704, 6.930, -2.204, 0.465 ], "bp_params": [ 1.290, -0.423, -0.704, 6.560, -3.138, 0.465 ], "frame": { "rmsd": null, "origin": [ 114.391, 88.872, 133.538 ], "x_axis": [ -0.412, -0.626, -0.662 ], "y_axis": [ 0.893, -0.133, -0.431 ], "z_axis": [ 0.182, -0.769, 0.613 ], "quaternion": [ 0.517, 0.164, 0.408, -0.735 ] } }, { "index": 23, "nt1": "///P/23", "nt2": "///T/15", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -90.902, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 56.334, "chi2": -100.916, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 56.611, "C1C1_dist": 11.030, "N1N9_dist": 9.412, "C6C8_dist": 10.450, "CNNC_torsion": 1.523, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[3.24],N3-N1(imino)[3.50],N4(amino)-O6(carbonyl)[3.65]", "interBase_angle": 9.585, "planarity": 0.227, "simple_Shear": 0.043, "simple_Stretch": 0.378, "simple_Buckle": 6.547, "simple_Propeller": -7.000, "bp_simpleParams": [ 0.043, 0.378, -1.167, 6.547, -7.000, 5.805 ], "bp_params": [ 0.042, 0.378, -1.167, 6.563, -6.985, 5.806 ], "frame": { "rmsd": null, "origin": [ 115.653, 85.965, 135.541 ], "x_axis": [ 0.159, -0.601, -0.783 ], "y_axis": [ 0.975, 0.220, 0.029 ], "z_axis": [ 0.155, -0.768, 0.621 ], "quaternion": [ 0.707, 0.282, 0.332, -0.557 ] } }, { "index": 24, "nt1": "///P/24", "nt2": "///T/14", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -120.216, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 53.624, "chi2": -102.191, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 57.341, "C1C1_dist": 10.225, "N1N9_dist": 8.576, "C6C8_dist": 9.546, "CNNC_torsion": 14.707, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.79],O4(carbonyl)-N6(amino)[2.90]", "interBase_angle": 2.964, "planarity": 0.289, "simple_Shear": -0.400, "simple_Stretch": -0.487, "simple_Buckle": 1.735, "simple_Propeller": -2.404, "bp_simpleParams": [ -0.400, -0.487, -1.376, 1.735, -2.404, 1.819 ], "bp_params": [ -0.377, -0.505, -1.376, 1.842, -2.323, 1.819 ], "frame": { "rmsd": null, "origin": [ 116.297, 83.459, 138.734 ], "x_axis": [ 0.731, -0.328, -0.599 ], "y_axis": [ 0.660, 0.563, 0.497 ], "z_axis": [ 0.174, -0.759, 0.628 ], "quaternion": [ 0.855, 0.367, 0.226, -0.289 ] } }, { "index": 25, "nt1": "///P/25", "nt2": "///T/13", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -111.346, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 54.103, "chi2": -115.111, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 34.161, "C1C1_dist": 10.447, "N1N9_dist": 8.387, "C6C8_dist": 8.900, "CNNC_torsion": 20.783, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N1(imino)[2.71],N3-N1(imino)[3.03],N4(amino)-O6(carbonyl)[2.74]", "interBase_angle": 27.912, "planarity": 0.368, "simple_Shear": 1.929, "simple_Stretch": -0.799, "simple_Buckle": 3.592, "simple_Propeller": 27.680, "bp_simpleParams": [ 1.929, -0.799, -0.253, 3.592, 27.680, -17.895 ], "bp_params": [ 1.728, -1.171, -0.253, 9.027, 26.412, -18.319 ], "frame": { "rmsd": null, "origin": [ 117.364, 80.687, 141.547 ], "x_axis": [ 0.951, 0.103, -0.293 ], "y_axis": [ 0.165, 0.632, 0.757 ], "z_axis": [ 0.263, -0.768, 0.584 ], "quaternion": [ 0.890, 0.429, 0.156, -0.018 ] } } ], "num_helices": 1, "helices": [ { "index": 1, "num_stems": 2, "strand1": "GGAGTAGTACTAGGACGAAGGACTC", "strand2": "CCTCATCATGATCCTGCTTCCTGAG", "bp_type": "||||||||||||||||||||.||||", "helix_form": "BBBBBBBBBBBBBBBBBBB.....", "helical_rise": 3.409, "helical_rise_std": 0.384, "helical_radius": 9.272, "helical_radius_std": 0.651, "helical_axis": [ 0.237, -0.722, 0.650 ], "point1": [ 97.814, 138.995, 88.361 ], "point2": [ 117.217, 79.917, 141.568 ], "num_pairs": 25, "pairs": [ { "index": 1, "nt1": "///P/1", "nt2": "///T/37", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.854, -0.268, -0.142, 9.887, -8.508, 0.578 ], "step_params": [ 0.125, 0.488, 3.389, 0.403, 1.698, 36.698 ], "heli_params": [ 0.534, -0.141, 3.409, 2.695, -0.639, 36.738 ], "bp2_params": [ -0.906, -0.256, -0.115, 9.910, -14.398, 3.948 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.389, "simple_Twist": 37.298, "simple_hRise": 3.408, "simple_hTwist": 37.337 }, { "index": 2, "nt1": "///P/2", "nt2": "///T/36", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.906, -0.256, -0.115, 9.910, -14.398, 3.948 ], "step_params": [ -0.128, 0.584, 3.348, -0.846, 1.891, 41.566 ], "heli_params": [ 0.616, 0.088, 3.372, 2.663, 1.191, 41.615 ], "bp2_params": [ -0.582, -0.259, -0.029, 7.340, -18.541, 2.390 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.348, "simple_Twist": 39.655, "simple_hRise": 3.373, "simple_hTwist": 39.707 }, { "index": 3, "nt1": "///P/3", "nt2": "///T/35", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.582, -0.259, -0.029, 7.340, -18.541, 2.390 ], "step_params": [ -0.040, 0.517, 3.345, -0.271, 2.380, 37.502 ], "heli_params": [ 0.484, 0.025, 3.370, 3.697, 0.421, 37.575 ], "bp2_params": [ -0.936, -0.370, -0.034, 3.080, -20.261, 2.130 ], "groove_widths": [ 9.764, null, 15.354, null ], "simple_Rise": 3.345, "simple_Twist": 39.477, "simple_hRise": 3.369, "simple_hTwist": 39.547 }, { "index": 4, "nt1": "///P/4", "nt2": "///T/34", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.936, -0.370, -0.034, 3.080, -20.261, 2.130 ], "step_params": [ 0.083, 0.524, 3.410, 0.827, 2.702, 42.090 ], "heli_params": [ 0.437, -0.027, 3.437, 3.756, -1.150, 42.181 ], "bp2_params": [ -0.303, -0.126, -0.163, -1.388, -17.426, 2.063 ], "groove_widths": [ 9.883, 9.831, 16.464, 16.458 ], "simple_Rise": 3.410, "simple_Twist": 38.113, "simple_hRise": 3.439, "simple_hTwist": 38.213 }, { "index": 5, "nt1": "///P/5", "nt2": "///T/33", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.303, -0.126, -0.163, -1.388, -17.426, 2.063 ], "step_params": [ -0.043, 0.552, 3.347, 1.136, 1.195, 39.302 ], "heli_params": [ 0.674, 0.202, 3.359, 1.776, -1.688, 39.335 ], "bp2_params": [ 0.046, -0.129, -0.361, -2.086, -15.116, 0.404 ], "groove_widths": [ 9.917, 9.896, 17.032, 17.012 ], "simple_Rise": 3.347, "simple_Twist": 37.582, "simple_hRise": 3.359, "simple_hTwist": 37.617 }, { "index": 6, "nt1": "///P/6", "nt2": "///T/32", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.046, -0.129, -0.361, -2.086, -15.116, 0.404 ], "step_params": [ 0.041, 0.445, 3.329, 0.232, 1.644, 34.670 ], "heli_params": [ 0.489, -0.033, 3.346, 2.757, -0.389, 34.709 ], "bp2_params": [ -0.046, -0.132, -0.386, -1.361, -14.641, 2.225 ], "groove_widths": [ 10.431, 10.429, 17.552, 17.550 ], "simple_Rise": 3.329, "simple_Twist": 35.140, "simple_hRise": 3.346, "simple_hTwist": 35.177 }, { "index": 7, "nt1": "///P/7", "nt2": "///T/31", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.046, -0.132, -0.386, -1.361, -14.641, 2.225 ], "step_params": [ 0.013, 0.427, 3.358, 0.203, 2.087, 38.308 ], "heli_params": [ 0.381, 0.007, 3.376, 3.177, -0.309, 38.364 ], "bp2_params": [ 0.324, -0.230, -0.419, -1.368, -13.727, 2.764 ], "groove_widths": [ 10.869, 10.833, 18.085, 18.084 ], "simple_Rise": 3.358, "simple_Twist": 36.263, "simple_hRise": 3.377, "simple_hTwist": 36.322 }, { "index": 8, "nt1": "///P/8", "nt2": "///T/30", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.324, -0.230, -0.419, -1.368, -13.727, 2.764 ], "step_params": [ 0.046, 0.328, 3.308, 0.184, 4.615, 32.916 ], "heli_params": [ -0.213, -0.049, 3.323, 8.094, -0.323, 33.230 ], "bp2_params": [ -0.227, -0.223, -0.490, -1.354, -13.258, 3.954 ], "groove_widths": [ 11.105, 11.020, 17.689, 17.675 ], "simple_Rise": 3.308, "simple_Twist": 36.037, "simple_hRise": 3.324, "simple_hTwist": 36.322 }, { "index": 9, "nt1": "///P/9", "nt2": "///T/29", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.227, -0.223, -0.490, -1.354, -13.258, 3.954 ], "step_params": [ 0.046, 0.369, 3.401, 0.221, 3.498, 37.747 ], "heli_params": [ 0.100, -0.041, 3.421, 5.393, -0.340, 37.903 ], "bp2_params": [ 0.276, -0.171, -0.550, -1.908, -11.569, 3.746 ], "groove_widths": [ 11.703, 11.560, 18.243, 18.219 ], "simple_Rise": 3.401, "simple_Twist": 34.686, "simple_hRise": 3.421, "simple_hTwist": 34.857 }, { "index": 10, "nt1": "///P/10", "nt2": "///T/28", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.276, -0.171, -0.550, -1.908, -11.569, 3.746 ], "step_params": [ 0.023, 0.312, 3.332, 0.481, 3.041, 34.616 ], "heli_params": [ 0.047, 0.036, 3.347, 5.099, -0.807, 34.748 ], "bp2_params": [ 0.264, -0.230, -0.589, 0.440, -10.286, 3.837 ], "groove_widths": [ 11.623, 11.436, 18.864, 18.813 ], "simple_Rise": 3.332, "simple_Twist": 34.861, "simple_hRise": 3.347, "simple_hTwist": 34.993 }, { "index": 11, "nt1": "///P/11", "nt2": "///T/27", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.264, -0.230, -0.589, 0.440, -10.286, 3.837 ], "step_params": [ -0.060, 0.221, 3.322, -0.052, 6.008, 31.388 ], "heli_params": [ -0.712, 0.099, 3.306, 10.978, 0.095, 31.944 ], "bp2_params": [ -0.466, -0.300, -0.633, 1.428, -9.869, 5.384 ], "groove_widths": [ 11.652, 11.477, 18.612, 18.590 ], "simple_Rise": 3.322, "simple_Twist": 35.656, "simple_hRise": 3.314, "simple_hTwist": 36.142 }, { "index": 12, "nt1": "///P/12", "nt2": "///T/26", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.466, -0.300, -0.633, 1.428, -9.869, 5.384 ], "step_params": [ -0.050, 0.289, 3.353, -0.435, 3.445, 34.598 ], "heli_params": [ -0.057, 0.015, 3.365, 5.775, 0.729, 34.767 ], "bp2_params": [ -0.590, -0.270, -0.640, 2.959, -11.236, 3.144 ], "groove_widths": [ 11.875, 11.713, 18.461, 18.456 ], "simple_Rise": 3.353, "simple_Twist": 35.197, "simple_hRise": 3.365, "simple_hTwist": 35.363 }, { "index": 13, "nt1": "///P/13", "nt2": "///T/25", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.590, -0.270, -0.640, 2.959, -11.236, 3.144 ], "step_params": [ 0.008, 0.343, 3.360, -0.408, 4.102, 35.483 ], "heli_params": [ -0.054, -0.074, 3.377, 6.703, 0.667, 35.714 ], "bp2_params": [ -0.537, -0.274, -0.639, 3.145, -13.635, 2.900 ], "groove_widths": [ 11.495, 11.334, 17.964, 17.933 ], "simple_Rise": 3.360, "simple_Twist": 35.229, "simple_hRise": 3.377, "simple_hTwist": 35.462 }, { "index": 14, "nt1": "///P/14", "nt2": "///T/24", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.537, -0.274, -0.639, 3.145, -13.635, 2.900 ], "step_params": [ -0.111, 0.374, 3.355, -1.085, 4.565, 36.959 ], "heli_params": [ -0.040, 0.024, 3.377, 7.166, 1.704, 37.245 ], "bp2_params": [ -0.403, -0.278, -0.617, 2.309, -12.505, 3.131 ], "groove_widths": [ 11.674, 11.502, 18.077, 17.941 ], "simple_Rise": 3.355, "simple_Twist": 36.108, "simple_hRise": 3.377, "simple_hTwist": 36.402 }, { "index": 15, "nt1": "///P/15", "nt2": "///T/23", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.403, -0.278, -0.617, 2.309, -12.505, 3.131 ], "step_params": [ 0.008, 0.350, 3.389, -0.760, 5.523, 38.363 ], "heli_params": [ -0.179, -0.109, 3.404, 8.350, 1.149, 38.751 ], "bp2_params": [ 0.342, -0.178, -0.585, 1.620, -10.682, 1.616 ], "groove_widths": [ 12.469, 12.290, 16.684, 16.470 ], "simple_Rise": 3.389, "simple_Twist": 34.092, "simple_hRise": 3.401, "simple_hTwist": 34.531 }, { "index": 16, "nt1": "///P/16", "nt2": "///T/22", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.342, -0.178, -0.585, 1.620, -10.682, 1.616 ], "step_params": [ 0.022, 0.243, 3.344, 0.931, 8.459, 30.354 ], "heli_params": [ -1.185, 0.139, 3.290, 15.770, -1.736, 31.497 ], "bp2_params": [ -0.077, -0.172, -0.698, 1.977, -10.428, 0.909 ], "groove_widths": [ 12.396, 12.266, 16.026, 15.645 ], "simple_Rise": 3.344, "simple_Twist": 32.878, "simple_hRise": 3.303, "simple_hTwist": 33.933 }, { "index": 17, "nt1": "///P/17", "nt2": "///T/21", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.077, -0.172, -0.698, 1.977, -10.428, 0.909 ], "step_params": [ -0.128, 0.879, 3.120, -1.079, 5.940, 41.558 ], "heli_params": [ 0.626, 0.070, 3.212, 8.318, 1.511, 41.975 ], "bp2_params": [ 0.456, 0.394, -0.082, -3.147, -18.934, 4.869 ], "groove_widths": [ 11.560, 11.481, 15.880, 15.733 ], "simple_Rise": 3.120, "simple_Twist": 38.546, "simple_hRise": 3.217, "simple_hTwist": 38.998 }, { "index": 18, "nt1": "///P/18", "nt2": "///T/20", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.456, 0.394, -0.082, -3.147, -18.934, 4.869 ], "step_params": [ -0.767, 0.093, 3.846, -2.155, 3.165, 37.091 ], "heli_params": [ -0.351, 0.862, 3.877, 4.959, 3.376, 37.282 ], "bp2_params": [ 0.091, -0.390, -0.170, -14.162, -13.936, -7.082 ], "groove_widths": [ 11.714, 11.662, 16.478, 16.283 ], "simple_Rise": 3.846, "simple_Twist": 38.639, "simple_hRise": 3.876, "simple_hTwist": 38.821 }, { "index": 19, "nt1": "///P/19", "nt2": "///T/19", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.091, -0.390, -0.170, -14.162, -13.936, -7.082 ], "step_params": [ 0.326, -0.075, 3.439, -5.061, -7.633, 32.548 ], "heli_params": [ 1.167, -1.419, 3.287, -13.294, 8.815, 33.778 ], "bp2_params": [ -0.146, -0.169, -0.234, -6.166, 15.454, -0.194 ], "groove_widths": [ 12.621, 12.604, 18.052, 18.051 ], "simple_Rise": 3.439, "simple_Twist": 34.480, "simple_hRise": 3.302, "simple_hTwist": 35.640 }, { "index": 20, "nt1": "///P/20", "nt2": "///T/18", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.146, -0.169, -0.234, -6.166, 15.454, -0.194 ], "step_params": [ 0.379, 0.315, 2.750, -3.076, 13.244, 22.698 ], "heli_params": [ -2.354, -1.537, 2.481, 30.398, 7.060, 26.413 ], "bp2_params": [ -1.640, 1.073, -0.684, 0.955, 2.488, 26.300 ], "groove_widths": [ 13.529, 13.524, 18.051, 17.897 ], "simple_Rise": 2.750, "simple_Twist": 30.660, "simple_hRise": 2.612, "simple_hTwist": 33.473 }, { "index": 21, "nt1": "///P/21", "nt2": "///T/17", "bp": "G-C", "name": "--", "Saenger": "--", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -1.640, 1.073, -0.684, 0.955, 2.488, 26.300 ], "step_params": [ -1.460, -0.020, 2.766, 1.789, -1.390, 46.463 ], "heli_params": [ 0.073, 1.975, 2.711, -1.760, -2.266, 46.516 ], "bp2_params": [ 1.290, -0.423, -0.704, 6.560, -3.138, 0.465 ], "groove_widths": [ 13.856, 13.699, 17.503, 17.502 ], "simple_Rise": 2.766, "simple_Twist": 30.342, "simple_hRise": 2.676, "simple_hTwist": 30.424 }, { "index": 22, "nt1": "///P/22", "nt2": "///T/16", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 1.290, -0.423, -0.704, 6.560, -3.138, 0.465 ], "step_params": [ 0.168, 0.680, 3.682, 1.599, -0.136, 33.959 ], "heli_params": [ 1.188, 0.000, 3.684, -0.232, -2.735, 33.996 ], "bp2_params": [ 0.042, 0.378, -1.167, 6.563, -6.985, 5.806 ], "groove_widths": [ 13.658, null, 17.209, null ], "simple_Rise": 3.682, "simple_Twist": 40.998, "simple_hRise": 3.684, "simple_hTwist": 41.028 }, { "index": 23, "nt1": "///P/23", "nt2": "///T/15", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.042, 0.378, -1.167, 6.563, -6.985, 5.806 ], "step_params": [ -0.785, 0.409, 4.013, -1.299, -0.035, 38.548 ], "heli_params": [ 0.625, 0.992, 4.036, -0.053, 1.967, 38.569 ], "bp2_params": [ -0.377, -0.505, -1.376, 1.842, -2.323, 1.819 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 4.013, "simple_Twist": 40.862, "simple_hRise": 4.035, "simple_hTwist": 40.882 }, { "index": 24, "nt1": "///P/24", "nt2": "///T/14", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.377, -0.505, -1.376, 1.842, -2.323, 1.819 ], "step_params": [ -0.046, 0.513, 4.058, -0.203, 5.703, 32.756 ], "heli_params": [ -0.300, 0.038, 4.087, 10.017, 0.356, 33.236 ], "bp2_params": [ 1.728, -1.171, -0.253, 9.027, 26.412, -18.319 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 4.058, "simple_Twist": 20.393, "simple_hRise": 4.049, "simple_hTwist": 21.168 }, { "index": 25, "nt1": "///P/25", "nt2": "///T/13", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] } ], "num_stems": 2, "stems": [ { "index": 1, "helix_index": 1, "strand1": "GGAGTAGTACTAGGACGAAG", "strand2": "CCTCATCATGATCCTGCTTC", "bp_type": "||||||||||||||||||||", "helix_form": "BBBBBBBBBBBBBBBBBBB", "helical_rise": 3.334, "helical_rise_std": 0.180, "helical_radius": 9.299, "helical_radius_std": 0.506, "helical_axis": [ 0.222, -0.730, 0.647 ], "point1": [ 98.211, 139.283, 88.468 ], "point2": [ 112.213, 93.189, 129.344 ], "num_pairs": 20, "pairs": [ { "index": 1, "nt1": "///P/1", "nt2": "///T/37", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.854, -0.268, -0.142, 9.887, -8.508, 0.578 ], "step_params": [ 0.125, 0.488, 3.389, 0.403, 1.698, 36.698 ], "heli_params": [ 0.534, -0.141, 3.409, 2.695, -0.639, 36.738 ], "bp2_params": [ -0.906, -0.256, -0.115, 9.910, -14.398, 3.948 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.389, "simple_Twist": 37.298, "simple_hRise": 3.408, "simple_hTwist": 37.337 }, { "index": 2, "nt1": "///P/2", "nt2": "///T/36", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.906, -0.256, -0.115, 9.910, -14.398, 3.948 ], "step_params": [ -0.128, 0.584, 3.348, -0.846, 1.891, 41.566 ], "heli_params": [ 0.616, 0.088, 3.372, 2.663, 1.191, 41.615 ], "bp2_params": [ -0.582, -0.259, -0.029, 7.340, -18.541, 2.390 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.348, "simple_Twist": 39.655, "simple_hRise": 3.373, "simple_hTwist": 39.707 }, { "index": 3, "nt1": "///P/3", "nt2": "///T/35", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.582, -0.259, -0.029, 7.340, -18.541, 2.390 ], "step_params": [ -0.040, 0.517, 3.345, -0.271, 2.380, 37.502 ], "heli_params": [ 0.484, 0.025, 3.370, 3.697, 0.421, 37.575 ], "bp2_params": [ -0.936, -0.370, -0.034, 3.080, -20.261, 2.130 ], "groove_widths": [ 9.764, null, 15.354, null ], "simple_Rise": 3.345, "simple_Twist": 39.477, "simple_hRise": 3.369, "simple_hTwist": 39.547 }, { "index": 4, "nt1": "///P/4", "nt2": "///T/34", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.936, -0.370, -0.034, 3.080, -20.261, 2.130 ], "step_params": [ 0.083, 0.524, 3.410, 0.827, 2.702, 42.090 ], "heli_params": [ 0.437, -0.027, 3.437, 3.756, -1.150, 42.181 ], "bp2_params": [ -0.303, -0.126, -0.163, -1.388, -17.426, 2.063 ], "groove_widths": [ 9.883, 9.831, 16.464, 16.458 ], "simple_Rise": 3.410, "simple_Twist": 38.113, "simple_hRise": 3.439, "simple_hTwist": 38.213 }, { "index": 5, "nt1": "///P/5", "nt2": "///T/33", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.303, -0.126, -0.163, -1.388, -17.426, 2.063 ], "step_params": [ -0.043, 0.552, 3.347, 1.136, 1.195, 39.302 ], "heli_params": [ 0.674, 0.202, 3.359, 1.776, -1.688, 39.335 ], "bp2_params": [ 0.046, -0.129, -0.361, -2.086, -15.116, 0.404 ], "groove_widths": [ 9.917, 9.896, 17.032, 17.012 ], "simple_Rise": 3.347, "simple_Twist": 37.582, "simple_hRise": 3.359, "simple_hTwist": 37.617 }, { "index": 6, "nt1": "///P/6", "nt2": "///T/32", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.046, -0.129, -0.361, -2.086, -15.116, 0.404 ], "step_params": [ 0.041, 0.445, 3.329, 0.232, 1.644, 34.670 ], "heli_params": [ 0.489, -0.033, 3.346, 2.757, -0.389, 34.709 ], "bp2_params": [ -0.046, -0.132, -0.386, -1.361, -14.641, 2.225 ], "groove_widths": [ 10.431, 10.429, 17.552, 17.550 ], "simple_Rise": 3.329, "simple_Twist": 35.140, "simple_hRise": 3.346, "simple_hTwist": 35.177 }, { "index": 7, "nt1": "///P/7", "nt2": "///T/31", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.046, -0.132, -0.386, -1.361, -14.641, 2.225 ], "step_params": [ 0.013, 0.427, 3.358, 0.203, 2.087, 38.308 ], "heli_params": [ 0.381, 0.007, 3.376, 3.177, -0.309, 38.364 ], "bp2_params": [ 0.324, -0.230, -0.419, -1.368, -13.727, 2.764 ], "groove_widths": [ 10.869, 10.833, 18.085, 18.084 ], "simple_Rise": 3.358, "simple_Twist": 36.263, "simple_hRise": 3.377, "simple_hTwist": 36.322 }, { "index": 8, "nt1": "///P/8", "nt2": "///T/30", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.324, -0.230, -0.419, -1.368, -13.727, 2.764 ], "step_params": [ 0.046, 0.328, 3.308, 0.184, 4.615, 32.916 ], "heli_params": [ -0.213, -0.049, 3.323, 8.094, -0.323, 33.230 ], "bp2_params": [ -0.227, -0.223, -0.490, -1.354, -13.258, 3.954 ], "groove_widths": [ 11.105, 11.020, 17.689, 17.675 ], "simple_Rise": 3.308, "simple_Twist": 36.037, "simple_hRise": 3.324, "simple_hTwist": 36.322 }, { "index": 9, "nt1": "///P/9", "nt2": "///T/29", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.227, -0.223, -0.490, -1.354, -13.258, 3.954 ], "step_params": [ 0.046, 0.369, 3.401, 0.221, 3.498, 37.747 ], "heli_params": [ 0.100, -0.041, 3.421, 5.393, -0.340, 37.903 ], "bp2_params": [ 0.276, -0.171, -0.550, -1.908, -11.569, 3.746 ], "groove_widths": [ 11.703, 11.560, 18.243, 18.219 ], "simple_Rise": 3.401, "simple_Twist": 34.686, "simple_hRise": 3.421, "simple_hTwist": 34.857 }, { "index": 10, "nt1": "///P/10", "nt2": "///T/28", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.276, -0.171, -0.550, -1.908, -11.569, 3.746 ], "step_params": [ 0.023, 0.312, 3.332, 0.481, 3.041, 34.616 ], "heli_params": [ 0.047, 0.036, 3.347, 5.099, -0.807, 34.748 ], "bp2_params": [ 0.264, -0.230, -0.589, 0.440, -10.286, 3.837 ], "groove_widths": [ 11.623, 11.436, 18.864, 18.813 ], "simple_Rise": 3.332, "simple_Twist": 34.861, "simple_hRise": 3.347, "simple_hTwist": 34.993 }, { "index": 11, "nt1": "///P/11", "nt2": "///T/27", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.264, -0.230, -0.589, 0.440, -10.286, 3.837 ], "step_params": [ -0.060, 0.221, 3.322, -0.052, 6.008, 31.388 ], "heli_params": [ -0.712, 0.099, 3.306, 10.978, 0.095, 31.944 ], "bp2_params": [ -0.466, -0.300, -0.633, 1.428, -9.869, 5.384 ], "groove_widths": [ 11.652, 11.477, 18.612, 18.590 ], "simple_Rise": 3.322, "simple_Twist": 35.656, "simple_hRise": 3.314, "simple_hTwist": 36.142 }, { "index": 12, "nt1": "///P/12", "nt2": "///T/26", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.466, -0.300, -0.633, 1.428, -9.869, 5.384 ], "step_params": [ -0.050, 0.289, 3.353, -0.435, 3.445, 34.598 ], "heli_params": [ -0.057, 0.015, 3.365, 5.775, 0.729, 34.767 ], "bp2_params": [ -0.590, -0.270, -0.640, 2.959, -11.236, 3.144 ], "groove_widths": [ 11.875, 11.713, 18.461, 18.456 ], "simple_Rise": 3.353, "simple_Twist": 35.197, "simple_hRise": 3.365, "simple_hTwist": 35.363 }, { "index": 13, "nt1": "///P/13", "nt2": "///T/25", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.590, -0.270, -0.640, 2.959, -11.236, 3.144 ], "step_params": [ 0.008, 0.343, 3.360, -0.408, 4.102, 35.483 ], "heli_params": [ -0.054, -0.074, 3.377, 6.703, 0.667, 35.714 ], "bp2_params": [ -0.537, -0.274, -0.639, 3.145, -13.635, 2.900 ], "groove_widths": [ 11.495, 11.334, 17.964, 17.933 ], "simple_Rise": 3.360, "simple_Twist": 35.229, "simple_hRise": 3.377, "simple_hTwist": 35.462 }, { "index": 14, "nt1": "///P/14", "nt2": "///T/24", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.537, -0.274, -0.639, 3.145, -13.635, 2.900 ], "step_params": [ -0.111, 0.374, 3.355, -1.085, 4.565, 36.959 ], "heli_params": [ -0.040, 0.024, 3.377, 7.166, 1.704, 37.245 ], "bp2_params": [ -0.403, -0.278, -0.617, 2.309, -12.505, 3.131 ], "groove_widths": [ 11.674, 11.502, 18.077, 17.941 ], "simple_Rise": 3.355, "simple_Twist": 36.108, "simple_hRise": 3.377, "simple_hTwist": 36.402 }, { "index": 15, "nt1": "///P/15", "nt2": "///T/23", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.403, -0.278, -0.617, 2.309, -12.505, 3.131 ], "step_params": [ 0.008, 0.350, 3.389, -0.760, 5.523, 38.363 ], "heli_params": [ -0.179, -0.109, 3.404, 8.350, 1.149, 38.751 ], "bp2_params": [ 0.342, -0.178, -0.585, 1.620, -10.682, 1.616 ], "groove_widths": [ 12.469, 12.290, 16.684, 16.470 ], "simple_Rise": 3.389, "simple_Twist": 34.092, "simple_hRise": 3.401, "simple_hTwist": 34.531 }, { "index": 16, "nt1": "///P/16", "nt2": "///T/22", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.342, -0.178, -0.585, 1.620, -10.682, 1.616 ], "step_params": [ 0.022, 0.243, 3.344, 0.931, 8.459, 30.354 ], "heli_params": [ -1.185, 0.139, 3.290, 15.770, -1.736, 31.497 ], "bp2_params": [ -0.077, -0.172, -0.698, 1.977, -10.428, 0.909 ], "groove_widths": [ 12.396, 12.266, 16.026, 15.645 ], "simple_Rise": 3.344, "simple_Twist": 32.878, "simple_hRise": 3.303, "simple_hTwist": 33.933 }, { "index": 17, "nt1": "///P/17", "nt2": "///T/21", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.077, -0.172, -0.698, 1.977, -10.428, 0.909 ], "step_params": [ -0.128, 0.879, 3.120, -1.079, 5.940, 41.558 ], "heli_params": [ 0.626, 0.070, 3.212, 8.318, 1.511, 41.975 ], "bp2_params": [ 0.456, 0.394, -0.082, -3.147, -18.934, 4.869 ], "groove_widths": [ 11.560, null, 15.880, null ], "simple_Rise": 3.120, "simple_Twist": 38.546, "simple_hRise": 3.217, "simple_hTwist": 38.998 }, { "index": 18, "nt1": "///P/18", "nt2": "///T/20", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.456, 0.394, -0.082, -3.147, -18.934, 4.869 ], "step_params": [ -0.767, 0.093, 3.846, -2.155, 3.165, 37.091 ], "heli_params": [ -0.351, 0.862, 3.877, 4.959, 3.376, 37.282 ], "bp2_params": [ 0.091, -0.390, -0.170, -14.162, -13.936, -7.082 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.846, "simple_Twist": 38.639, "simple_hRise": 3.876, "simple_hTwist": 38.821 }, { "index": 19, "nt1": "///P/19", "nt2": "///T/19", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.091, -0.390, -0.170, -14.162, -13.936, -7.082 ], "step_params": [ 0.326, -0.075, 3.439, -5.061, -7.633, 32.548 ], "heli_params": [ 1.167, -1.419, 3.287, -13.294, 8.815, 33.778 ], "bp2_params": [ -0.146, -0.169, -0.234, -6.166, 15.454, -0.194 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.439, "simple_Twist": 34.480, "simple_hRise": 3.302, "simple_hTwist": 35.640 }, { "index": 20, "nt1": "///P/20", "nt2": "///T/18", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 2, "helix_index": 1, "strand1": "ACTC", "strand2": "TGAG", "bp_type": "||||", "helix_form": "...", "helical_rise": 3.958, "helical_rise_std": 0.638, "helical_radius": 9.014, "helical_radius_std": 0.557, "helical_axis": [ 0.219, -0.731, 0.646 ], "point1": [ 115.026, 89.072, 134.316 ], "point2": [ 117.625, 80.385, 141.986 ], "num_pairs": 4, "pairs": [ { "index": 1, "nt1": "///P/22", "nt2": "///T/16", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 1.290, -0.423, -0.704, 6.560, -3.138, 0.465 ], "step_params": [ 0.168, 0.680, 3.682, 1.599, -0.136, 33.959 ], "heli_params": [ 1.188, 0.000, 3.684, -0.232, -2.735, 33.996 ], "bp2_params": [ 0.042, 0.378, -1.167, 6.563, -6.985, 5.806 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.682, "simple_Twist": 40.998, "simple_hRise": 3.684, "simple_hTwist": 41.028 }, { "index": 2, "nt1": "///P/23", "nt2": "///T/15", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.042, 0.378, -1.167, 6.563, -6.985, 5.806 ], "step_params": [ -0.785, 0.409, 4.013, -1.299, -0.035, 38.548 ], "heli_params": [ 0.625, 0.992, 4.036, -0.053, 1.967, 38.569 ], "bp2_params": [ -0.377, -0.505, -1.376, 1.842, -2.323, 1.819 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 4.013, "simple_Twist": 40.862, "simple_hRise": 4.035, "simple_hTwist": 40.882 }, { "index": 3, "nt1": "///P/24", "nt2": "///T/14", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.377, -0.505, -1.376, 1.842, -2.323, 1.819 ], "step_params": [ -0.046, 0.513, 4.058, -0.203, 5.703, 32.756 ], "heli_params": [ -0.300, 0.038, 4.087, 10.017, 0.356, 33.236 ], "bp2_params": [ 1.728, -1.171, -0.253, 9.027, 26.412, -18.319 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 4.058, "simple_Twist": 20.393, "simple_hRise": 4.049, "simple_hTwist": 21.168 }, { "index": 4, "nt1": "///P/25", "nt2": "///T/13", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] } ], "num_coaxStacks": 1, "coaxStacks": [ { "index": 1, "helix_index": 1, "num_stems": 2, "stem_indices": [ 1, 2 ] } ], "num_stacks": 3, "stacks": [ { "index": 1, "num_nts": 2, "nts_short": "GG", "nts_long": "///T/12,///T/13" }, { "index": 2, "num_nts": 3, "nts_short": "GGA", "nts_long": "///P/20,///P/21,///P/22" }, { "index": 3, "num_nts": 3, "nts_short": "TCC", "nts_long": "///T/16,///T/17,///T/18" } ], "num_iloops": 1, "iloops": [ { "index": 1, "type": "symmetric internal loop", "bridging_nts": [ 1, 1 ], "stem_indices": [ 1, 2 ], "summary": "[2] 1 1 [P.20 T.18 P.22 T.16] 20 4", "num_nts": 6, "nts_short": "GGATCC", "nts_long": "///P/20,///P/21,///P/22,///T/16,///T/17,///T/18", "num_stems": 2, "bridges": [ { "index": 1, "num_nts": 1, "nts_short": "G", "nts_long": "///P/21" }, { "index": 2, "num_nts": 1, "nts_short": "C", "nts_long": "///T/17" } ] } ], "num_ssSegments": 1, "ssSegments": [ { "index": 1, "num_nts": 1, "nts_short": "G", "nts_long": "///T/12" } ], "dbn": { "all_chains": { "num_nts": 51, "num_chars": 52, "bseq": "GGAGTAGTACTAGGACGAAGGACTC&GGAGTCCTTCGTCCTAGTACTACTCC", "sstr": "((((((((((((((((((((.((((&.)))).))))))))))))))))))))", "form": "BBBBBBBBBBBBBBBBBBB.B.B.-&BBBB..BBBBBBBBBBBBBBBBBBB-" }, "chain_P": { "num_nts": 25, "num_chars": 25, "bseq": "GGAGTAGTACTAGGACGAAGGACTC", "sstr": "((((((((((((((((((((.((((", "form": "BBBBBBBBBBBBBBBBBBB.B.B.-" }, "chain_T": { "num_nts": 26, "num_chars": 26, "bseq": "GGAGTCCTTCGTCCTAGTACTACTCC", "sstr": ".)))).))))))))))))))))))))", "form": "BBBB..BBBBBBBBBBBBBBBBBBB-" } }, "chains": { "chain_P": { "num_nts": 25, "bseq": "GGAGTAGTACTAGGACGAAGGACTC", "sstr": "((((((((((((((((((((.((((", "form": "BBBBBBBBBBBBBBBBBBB.B.B.-", "helical_rise": 3.418, "helical_rise_std": 0.444, "helical_axis": [ 0.243, -0.726, 0.644 ], "point1": [ 97.563, 138.973, 88.659 ], "point2": [ 117.518, 79.306, 141.564 ], "num_chars": 73, "suite": "G!!G4bA4bG!!T!!A!!G!!T!!A!!C!!T!!A!!G!!G!!A!!C!!G!!A!!A!!G!!G!!A4bC!!T1bC" }, "chain_T": { "num_nts": 26, "bseq": "GGAGTCCTTCGTCCTAGTACTACTCC", "sstr": ".)))).))))))))))))))))))))", "form": "BBBB..BBBBBBBBBBBBBBBBBBB-", "helical_rise": 3.373, "helical_rise_std": 0.324, "helical_axis": [ -0.246, 0.714, -0.656 ], "point1": [ 118.216, 78.569, 143.392 ], "point2": [ 97.525, 138.718, 88.124 ], "num_chars": 76, "suite": "G!!G!!A!!G!!T!!C1bC!!T!!T!!C!!G!!T!!C!!C!!T!!A!!G!!T!!A!!C!!T4bA!!C!!T!!C!!C" } }, "num_nts": 51, "nts": [ { "index": 1, "index_chain": 1, "chain_name": "P", "nt_resnum": 1, "nt_name": "DG", "nt_code": "G", "nt_id": "///P/1", "linked_nts": [ null, "///P/2" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack", "alpha": null, "beta": 171.639, "gamma": 31.378, "delta": 151.934, "epsilon": -146.405, "zeta": -146.007, "epsilon_zeta": -0.398, "bb_type": "--", "chi": -97.827, "glyco_bond": "anti", "C5prime_xyz": [ -2.541, 8.136, -2.098 ], "P_xyz": [ -0.427, 9.734, -1.904 ], "form": "B", "ssZp": 1.714, "Dp": 1.735, "splay_angle": 20.489, "splay_distance": 3.426, "splay_ratio": 0.178, "d22": null, "d64": null, "eta": null, "theta": -148.833, "eta_prime": null, "theta_prime": -157.615, "eta_base": null, "theta_base": -109.205, "v0": -21.367, "v1": 38.749, "v2": -40.248, "v3": 28.839, "v4": -4.753, "amplitude": 41.160, "phase_angle": 167.914, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.008, "frame": { "rmsd": 0.008, "origin": [ 98.525, 139.811, 88.081 ], "x_axis": [ -0.898, -0.433, -0.078 ], "y_axis": [ 0.377, -0.665, -0.644 ], "z_axis": [ 0.227, -0.608, 0.761 ], "quaternion": [ -0.222, 0.041, -0.343, 0.912 ] } }, { "index": 2, "index_chain": 2, "chain_name": "P", "nt_resnum": 2, "nt_name": "DG", "nt_code": "G", "nt_id": "///P/2", "linked_nts": [ "///P/1", "///P/3" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -44.727, "beta": 144.355, "gamma": 45.712, "delta": 147.326, "epsilon": -144.913, "zeta": -153.992, "epsilon_zeta": 9.079, "bb_type": "--", "chi": -96.970, "glyco_bond": "anti", "C5prime_xyz": [ -2.937, 8.095, -2.154 ], "P_xyz": [ -0.511, 9.213, -2.368 ], "form": "B", "ssZp": 1.783, "Dp": 1.820, "splay_angle": 20.757, "splay_distance": 3.420, "splay_ratio": 0.180, "d22": null, "d64": null, "eta": 169.198, "theta": -146.484, "eta_prime": -160.751, "theta_prime": -163.020, "eta_base": -112.263, "theta_base": -110.944, "v0": -25.606, "v1": 41.575, "v2": -40.606, "v3": 26.959, "v4": -0.956, "amplitude": 42.563, "phase_angle": 162.557, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.006, "frame": { "rmsd": 0.006, "origin": [ 99.129, 137.223, 90.242 ], "x_axis": [ -0.477, -0.746, -0.465 ], "y_axis": [ 0.865, -0.304, -0.399 ], "z_axis": [ 0.156, -0.593, 0.790 ], "quaternion": [ 0.502, 0.096, 0.309, -0.802 ] } }, { "index": 3, "index_chain": 3, "chain_name": "P", "nt_resnum": 3, "nt_name": "DA", "nt_code": "A", "nt_id": "///P/3", "linked_nts": [ "///P/2", "///P/4" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -37.273, "beta": 143.435, "gamma": 35.999, "delta": 148.588, "epsilon": -146.844, "zeta": -152.298, "epsilon_zeta": 5.454, "bb_type": "--", "chi": -95.508, "glyco_bond": "anti", "C5prime_xyz": [ -2.905, 7.931, -2.240 ], "P_xyz": [ -0.490, 9.069, -2.289 ], "form": "B", "ssZp": 1.814, "Dp": 1.801, "splay_angle": 20.353, "splay_distance": 3.366, "splay_ratio": 0.177, "d22": null, "d64": null, "eta": 168.849, "theta": -145.355, "eta_prime": -164.397, "theta_prime": -161.275, "eta_base": -112.002, "theta_base": -115.082, "v0": -25.474, "v1": 40.400, "v2": -39.117, "v3": 25.460, "v4": -0.174, "amplitude": 41.245, "phase_angle": 161.518, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "4b", "suiteness": 0.010, "filter_rmsd": 0.037, "frame": { "rmsd": 0.007, "origin": [ 99.985, 134.694, 92.380 ], "x_axis": [ 0.194, -0.750, -0.632 ], "y_axis": [ 0.977, 0.202, 0.060 ], "z_axis": [ 0.082, -0.629, 0.773 ], "quaternion": [ 0.736, 0.234, 0.242, -0.587 ] } }, { "index": 4, "index_chain": 4, "chain_name": "P", "nt_resnum": 4, "nt_name": "DG", "nt_code": "G", "nt_id": "///P/4", "linked_nts": [ "///P/3", "///P/5" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -38.177, "beta": 144.193, "gamma": 37.967, "delta": 150.262, "epsilon": -148.245, "zeta": -152.538, "epsilon_zeta": 4.293, "bb_type": "--", "chi": -96.040, "glyco_bond": "anti", "C5prime_xyz": [ -3.011, 7.983, -2.149 ], "P_xyz": [ -0.634, 9.175, -2.291 ], "form": "B", "ssZp": 1.971, "Dp": 1.889, "splay_angle": 20.777, "splay_distance": 3.417, "splay_ratio": 0.180, "d22": null, "d64": null, "eta": 168.286, "theta": -142.448, "eta_prime": -163.655, "theta_prime": -159.902, "eta_base": -116.665, "theta_base": -106.398, "v0": -25.951, "v1": 41.229, "v2": -39.682, "v3": 26.029, "v4": -0.325, "amplitude": 41.841, "phase_angle": 161.516, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "4b", "suiteness": 0.010, "filter_rmsd": 0.006, "frame": { "rmsd": 0.006, "origin": [ 100.744, 132.361, 94.686 ], "x_axis": [ 0.741, -0.458, -0.491 ], "y_axis": [ 0.670, 0.557, 0.490 ], "z_axis": [ 0.049, -0.692, 0.720 ], "quaternion": [ 0.869, 0.340, 0.156, -0.325 ] } }, { "index": 5, "index_chain": 5, "chain_name": "P", "nt_resnum": 5, "nt_name": "DT", "nt_code": "T", "nt_id": "///P/5", "linked_nts": [ "///P/4", "///P/6" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -32.044, "beta": 146.126, "gamma": 30.028, "delta": 149.616, "epsilon": -151.336, "zeta": -157.994, "epsilon_zeta": 6.658, "bb_type": "--", "chi": -94.446, "glyco_bond": "anti", "C5prime_xyz": [ -2.899, 7.926, -2.267 ], "P_xyz": [ -0.576, 9.182, -2.353 ], "form": "B", "ssZp": 1.982, "Dp": 1.940, "splay_angle": 20.106, "splay_distance": 3.292, "splay_ratio": 0.175, "d22": null, "d64": null, "eta": 168.608, "theta": -150.593, "eta_prime": -164.984, "theta_prime": -164.626, "eta_base": -109.577, "theta_base": -115.718, "v0": -27.420, "v1": 41.162, "v2": -38.566, "v3": 23.942, "v4": 1.973, "amplitude": 41.433, "phase_angle": 158.559, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.107, "frame": { "rmsd": 0.002, "origin": [ 102.037, 130.046, 96.840 ], "x_axis": [ 0.996, 0.052, -0.066 ], "y_axis": [ 0.018, 0.636, 0.772 ], "z_axis": [ 0.082, -0.770, 0.632 ], "quaternion": [ 0.903, 0.427, 0.041, 0.009 ] } }, { "index": 6, "index_chain": 6, "chain_name": "P", "nt_resnum": 6, "nt_name": "DA", "nt_code": "A", "nt_id": "///P/6", "linked_nts": [ "///P/5", "///P/7" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -27.889, "beta": 144.966, "gamma": 30.762, "delta": 145.962, "epsilon": -150.887, "zeta": -153.434, "epsilon_zeta": 2.547, "bb_type": "--", "chi": -95.725, "glyco_bond": "anti", "C5prime_xyz": [ -2.816, 7.912, -2.228 ], "P_xyz": [ -0.426, 9.046, -2.263 ], "form": "B", "ssZp": 1.914, "Dp": 1.860, "splay_angle": 20.055, "splay_distance": 3.347, "splay_ratio": 0.174, "d22": null, "d64": null, "eta": 174.988, "theta": -147.737, "eta_prime": -162.117, "theta_prime": -161.845, "eta_base": -112.736, "theta_base": -117.373, "v0": -24.801, "v1": 38.972, "v2": -37.349, "v3": 24.023, "v4": 0.282, "amplitude": 39.549, "phase_angle": 160.799, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.003, "origin": [ 102.833, 127.892, 99.199 ], "x_axis": [ 0.797, 0.425, 0.428 ], "y_axis": [ -0.587, 0.379, 0.716 ], "z_axis": [ 0.142, -0.822, 0.552 ], "quaternion": [ 0.826, 0.466, -0.087, 0.306 ] } }, { "index": 7, "index_chain": 7, "chain_name": "P", "nt_resnum": 7, "nt_name": "DG", "nt_code": "G", "nt_id": "///P/7", "linked_nts": [ "///P/6", "///P/8" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -26.764, "beta": 139.448, "gamma": 31.567, "delta": 145.443, "epsilon": -148.678, "zeta": -155.828, "epsilon_zeta": 7.150, "bb_type": "--", "chi": -96.393, "glyco_bond": "anti", "C5prime_xyz": [ -3.015, 8.051, -2.152 ], "P_xyz": [ -0.661, 9.234, -2.227 ], "form": "B", "ssZp": 1.996, "Dp": 1.853, "splay_angle": 20.361, "splay_distance": 3.374, "splay_ratio": 0.177, "d22": null, "d64": null, "eta": 171.791, "theta": -149.495, "eta_prime": -162.351, "theta_prime": -164.120, "eta_base": -116.968, "theta_base": -114.607, "v0": -27.593, "v1": 41.257, "v2": -38.334, "v3": 23.379, "v4": 2.470, "amplitude": 41.378, "phase_angle": 157.886, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.006, "frame": { "rmsd": 0.006, "origin": [ 103.385, 125.484, 101.456 ], "x_axis": [ 0.313, 0.562, 0.766 ], "y_axis": [ -0.923, -0.011, 0.385 ], "z_axis": [ 0.225, -0.827, 0.515 ], "quaternion": [ 0.674, 0.450, -0.201, 0.551 ] } }, { "index": 8, "index_chain": 8, "chain_name": "P", "nt_resnum": 8, "nt_name": "DT", "nt_code": "T", "nt_id": "///P/8", "linked_nts": [ "///P/7", "///P/9" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -29.622, "beta": 142.876, "gamma": 32.524, "delta": 145.540, "epsilon": -143.369, "zeta": -147.966, "epsilon_zeta": 4.597, "bb_type": "--", "chi": -97.132, "glyco_bond": "anti", "C5prime_xyz": [ -2.810, 8.074, -2.182 ], "P_xyz": [ -0.446, 9.230, -2.156 ], "form": "B", "ssZp": 1.688, "Dp": 1.669, "splay_angle": 19.608, "splay_distance": 3.293, "splay_ratio": 0.170, "d22": null, "d64": null, "eta": 177.216, "theta": -144.414, "eta_prime": -159.505, "theta_prime": -159.033, "eta_base": -110.236, "theta_base": -117.189, "v0": -26.353, "v1": 39.821, "v2": -37.629, "v3": 23.314, "v4": 1.832, "amplitude": 40.334, "phase_angle": 158.898, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.107, "frame": { "rmsd": 0.005, "origin": [ 103.895, 123.079, 103.768 ], "x_axis": [ -0.328, 0.438, 0.837 ], "y_axis": [ -0.894, -0.431, -0.124 ], "z_axis": [ 0.307, -0.789, 0.533 ], "quaternion": [ 0.440, 0.378, -0.302, 0.757 ] } }, { "index": 9, "index_chain": 9, "chain_name": "P", "nt_resnum": 9, "nt_name": "DA", "nt_code": "A", "nt_id": "///P/9", "linked_nts": [ "///P/8", "///P/10" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -36.660, "beta": 147.702, "gamma": 28.608, "delta": 145.897, "epsilon": -147.613, "zeta": -153.586, "epsilon_zeta": 5.973, "bb_type": "--", "chi": -94.199, "glyco_bond": "anti", "C5prime_xyz": [ -3.030, 7.842, -2.323 ], "P_xyz": [ -0.828, 9.272, -2.480 ], "form": "B", "ssZp": 1.819, "Dp": 1.837, "splay_angle": 20.561, "splay_distance": 3.411, "splay_ratio": 0.178, "d22": null, "d64": null, "eta": 169.231, "theta": -150.958, "eta_prime": -166.321, "theta_prime": -162.451, "eta_base": -123.295, "theta_base": -114.439, "v0": -28.479, "v1": 41.564, "v2": -38.114, "v3": 22.765, "v4": 3.254, "amplitude": 41.500, "phase_angle": 156.695, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.040, "frame": { "rmsd": 0.016, "origin": [ 104.570, 120.498, 105.698 ], "x_axis": [ -0.781, 0.168, 0.601 ], "y_axis": [ -0.538, -0.670, -0.512 ], "z_axis": [ 0.317, -0.723, 0.613 ], "quaternion": [ 0.202, 0.262, -0.353, 0.875 ] } }, { "index": 10, "index_chain": 10, "chain_name": "P", "nt_resnum": 10, "nt_name": "DC", "nt_code": "C", "nt_id": "///P/10", "linked_nts": [ "///P/9", "///P/11" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -30.391, "beta": 143.395, "gamma": 30.858, "delta": 145.488, "epsilon": -143.754, "zeta": -152.688, "epsilon_zeta": 8.934, "bb_type": "--", "chi": -94.002, "glyco_bond": "anti", "C5prime_xyz": [ -3.004, 7.971, -2.241 ], "P_xyz": [ -0.699, 9.253, -2.342 ], "form": "B", "ssZp": 1.824, "Dp": 1.746, "splay_angle": 19.835, "splay_distance": 3.326, "splay_ratio": 0.172, "d22": 4.410, "d64": 3.626, "eta": 174.507, "theta": -148.370, "eta_prime": -161.621, "theta_prime": -162.064, "eta_base": -113.967, "theta_base": -118.505, "v0": -27.382, "v1": 40.519, "v2": -37.494, "v3": 22.928, "v4": 2.574, "amplitude": 40.552, "phase_angle": 157.607, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.062, "frame": { "rmsd": 0.004, "origin": [ 104.840, 117.915, 107.910 ], "x_axis": [ -0.958, -0.248, 0.142 ], "y_axis": [ 0.074, -0.695, -0.715 ], "z_axis": [ 0.276, -0.675, 0.685 ], "quaternion": [ -0.088, 0.114, -0.380, 0.914 ] } }, { "index": 11, "index_chain": 11, "chain_name": "P", "nt_resnum": 11, "nt_name": "DT", "nt_code": "T", "nt_id": "///P/11", "linked_nts": [ "///P/10", "///P/12" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -34.966, "beta": 145.413, "gamma": 28.321, "delta": 145.014, "epsilon": -150.967, "zeta": -163.983, "epsilon_zeta": 13.017, "bb_type": "--", "chi": -93.854, "glyco_bond": "anti", "C5prime_xyz": [ -3.069, 7.946, -2.188 ], "P_xyz": [ -0.812, 9.272, -2.423 ], "form": "B", "ssZp": 2.216, "Dp": 2.001, "splay_angle": 20.122, "splay_distance": 3.329, "splay_ratio": 0.175, "d22": null, "d64": null, "eta": 167.973, "theta": -157.784, "eta_prime": -169.728, "theta_prime": -168.197, "eta_base": -124.346, "theta_base": -130.031, "v0": -28.323, "v1": 41.412, "v2": -37.654, "v3": 22.577, "v4": 3.435, "amplitude": 41.086, "phase_angle": 156.415, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.004, "origin": [ 105.405, 115.384, 109.991 ], "x_axis": [ -0.755, -0.579, -0.308 ], "y_axis": [ 0.627, -0.499, -0.599 ], "z_axis": [ 0.193, -0.645, 0.739 ], "quaternion": [ -0.348, -0.033, -0.360, 0.865 ] } }, { "index": 12, "index_chain": 12, "chain_name": "P", "nt_resnum": 12, "nt_name": "DA", "nt_code": "A", "nt_id": "///P/12", "linked_nts": [ "///P/11", "///P/13" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -22.191, "beta": 139.412, "gamma": 27.857, "delta": 145.679, "epsilon": -145.273, "zeta": -149.783, "epsilon_zeta": 4.511, "bb_type": "--", "chi": -96.072, "glyco_bond": "anti", "C5prime_xyz": [ -2.827, 7.983, -2.196 ], "P_xyz": [ -0.470, 9.161, -1.967 ], "form": "B", "ssZp": 1.719, "Dp": 1.737, "splay_angle": 20.007, "splay_distance": 3.369, "splay_ratio": 0.174, "d22": null, "d64": null, "eta": 176.763, "theta": -142.512, "eta_prime": -163.019, "theta_prime": -156.412, "eta_base": -124.933, "theta_base": -116.445, "v0": -25.416, "v1": 39.105, "v2": -37.202, "v3": 23.497, "v4": 1.032, "amplitude": 39.633, "phase_angle": 159.831, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.043, "frame": { "rmsd": 0.023, "origin": [ 106.065, 113.142, 112.362 ], "x_axis": [ -0.321, -0.695, -0.644 ], "y_axis": [ 0.944, -0.175, -0.281 ], "z_axis": [ 0.082, -0.698, 0.712 ], "quaternion": [ 0.551, 0.189, 0.329, -0.743 ] } }, { "index": 13, "index_chain": 13, "chain_name": "P", "nt_resnum": 13, "nt_name": "DG", "nt_code": "G", "nt_id": "///P/13", "linked_nts": [ "///P/12", "///P/14" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -31.479, "beta": 144.586, "gamma": 26.491, "delta": 144.422, "epsilon": -148.628, "zeta": -158.664, "epsilon_zeta": 10.036, "bb_type": "--", "chi": -94.369, "glyco_bond": "anti", "C5prime_xyz": [ -3.097, 7.956, -2.240 ], "P_xyz": [ -0.881, 9.368, -2.383 ], "form": "B", "ssZp": 2.040, "Dp": 1.910, "splay_angle": 20.306, "splay_distance": 3.386, "splay_ratio": 0.176, "d22": null, "d64": null, "eta": 168.952, "theta": -154.213, "eta_prime": -167.680, "theta_prime": -165.014, "eta_base": -125.326, "theta_base": -120.372, "v0": -28.933, "v1": 41.740, "v2": -37.821, "v3": 22.250, "v4": 3.949, "amplitude": 41.473, "phase_angle": 155.776, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.011, "frame": { "rmsd": 0.011, "origin": [ 106.426, 110.558, 114.493 ], "x_axis": [ 0.248, -0.650, -0.719 ], "y_axis": [ 0.969, 0.180, 0.171 ], "z_axis": [ 0.018, -0.738, 0.674 ], "quaternion": [ 0.725, 0.314, 0.254, -0.558 ] } }, { "index": 14, "index_chain": 14, "chain_name": "P", "nt_resnum": 14, "nt_name": "DG", "nt_code": "G", "nt_id": "///P/14", "linked_nts": [ "///P/13", "///P/15" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -26.393, "beta": 140.629, "gamma": 27.533, "delta": 147.362, "epsilon": -148.908, "zeta": -158.528, "epsilon_zeta": 9.620, "bb_type": "--", "chi": -97.600, "glyco_bond": "anti", "C5prime_xyz": [ -2.954, 8.093, -2.086 ], "P_xyz": [ -0.612, 9.317, -2.069 ], "form": "B", "ssZp": 2.183, "Dp": 1.992, "splay_angle": 20.535, "splay_distance": 3.393, "splay_ratio": 0.178, "d22": null, "d64": null, "eta": 170.881, "theta": -149.746, "eta_prime": -166.709, "theta_prime": -162.313, "eta_base": -120.412, "theta_base": -117.404, "v0": -28.242, "v1": 42.096, "v2": -38.792, "v3": 23.637, "v4": 2.686, "amplitude": 41.980, "phase_angle": 157.527, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.011, "frame": { "rmsd": 0.011, "origin": [ 106.907, 107.832, 116.445 ], "x_axis": [ 0.759, -0.394, -0.518 ], "y_axis": [ 0.651, 0.460, 0.604 ], "z_axis": [ 0.000, -0.796, 0.606 ], "quaternion": [ 0.840, 0.416, 0.154, -0.311 ] } }, { "index": 15, "index_chain": 15, "chain_name": "P", "nt_resnum": 15, "nt_name": "DA", "nt_code": "A", "nt_id": "///P/15", "linked_nts": [ "///P/14", "///P/16" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -26.813, "beta": 144.540, "gamma": 26.952, "delta": 150.511, "epsilon": -147.283, "zeta": -152.534, "epsilon_zeta": 5.251, "bb_type": "--", "chi": -99.257, "glyco_bond": "anti", "C5prime_xyz": [ -2.639, 8.061, -2.110 ], "P_xyz": [ -0.258, 9.212, -1.916 ], "form": "B", "ssZp": 1.922, "Dp": 1.875, "splay_angle": 20.816, "splay_distance": 3.453, "splay_ratio": 0.181, "d22": null, "d64": null, "eta": 172.402, "theta": -140.028, "eta_prime": -165.220, "theta_prime": -152.281, "eta_base": -117.857, "theta_base": -106.366, "v0": -25.534, "v1": 40.376, "v2": -38.922, "v3": 25.137, "v4": 0.100, "amplitude": 41.125, "phase_angle": 161.160, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.039, "frame": { "rmsd": 0.010, "origin": [ 107.505, 105.157, 118.443 ], "x_axis": [ 0.995, 0.028, -0.099 ], "y_axis": [ 0.068, 0.540, 0.839 ], "z_axis": [ 0.077, -0.841, 0.535 ], "quaternion": [ 0.876, 0.480, 0.050, -0.011 ] } }, { "index": 16, "index_chain": 16, "chain_name": "P", "nt_resnum": 16, "nt_name": "DC", "nt_code": "C", "nt_id": "///P/16", "linked_nts": [ "///P/15", "///P/17" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -25.034, "beta": 143.014, "gamma": 23.295, "delta": 145.463, "epsilon": -147.141, "zeta": -150.474, "epsilon_zeta": 3.334, "bb_type": "--", "chi": -93.853, "glyco_bond": "anti", "C5prime_xyz": [ -2.834, 7.973, -2.270 ], "P_xyz": [ -0.507, 9.228, -2.247 ], "form": "B", "ssZp": 1.993, "Dp": 1.934, "splay_angle": 19.503, "splay_distance": 3.294, "splay_ratio": 0.170, "d22": null, "d64": null, "eta": 169.575, "theta": -146.676, "eta_prime": -166.992, "theta_prime": -157.358, "eta_base": -117.513, "theta_base": -122.047, "v0": -27.855, "v1": 40.393, "v2": -36.793, "v3": 21.814, "v4": 3.573, "amplitude": 40.221, "phase_angle": 156.173, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.005, "origin": [ 108.583, 102.730, 120.650 ], "x_axis": [ 0.817, 0.434, 0.379 ], "y_axis": [ -0.538, 0.339, 0.772 ], "z_axis": [ 0.206, -0.835, 0.511 ], "quaternion": [ 0.817, 0.492, -0.053, 0.298 ] } }, { "index": 17, "index_chain": 17, "chain_name": "P", "nt_resnum": 17, "nt_name": "DG", "nt_code": "G", "nt_id": "///P/17", "linked_nts": [ "///P/16", "///P/18" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -33.361, "beta": 144.562, "gamma": 30.276, "delta": 147.221, "epsilon": -147.944, "zeta": 170.419, "epsilon_zeta": 41.637, "bb_type": "--", "chi": -94.067, "glyco_bond": "anti", "C5prime_xyz": [ -3.042, 7.984, -2.168 ], "P_xyz": [ -0.759, 9.271, -2.395 ], "form": "B", "ssZp": 2.178, "Dp": 1.999, "splay_angle": 22.078, "splay_distance": 3.629, "splay_ratio": 0.201, "d22": null, "d64": null, "eta": 167.759, "theta": -166.800, "eta_prime": -168.134, "theta_prime": -174.416, "eta_base": -130.328, "theta_base": -115.633, "v0": -29.504, "v1": 43.205, "v2": -38.954, "v3": 23.396, "v4": 3.622, "amplitude": 42.582, "phase_angle": 156.177, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.012, "frame": { "rmsd": 0.012, "origin": [ 109.337, 100.239, 122.670 ], "x_axis": [ 0.406, 0.652, 0.640 ], "y_axis": [ -0.842, -0.005, 0.539 ], "z_axis": [ 0.355, -0.758, 0.547 ], "quaternion": [ 0.698, 0.465, -0.102, 0.535 ] } }, { "index": 18, "index_chain": 18, "chain_name": "P", "nt_resnum": 18, "nt_name": "DA", "nt_code": "A", "nt_id": "///P/18", "linked_nts": [ "///P/17", "///P/19" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -4.149, "beta": 117.452, "gamma": 28.716, "delta": 143.226, "epsilon": -179.380, "zeta": -116.597, "epsilon_zeta": -62.784, "bb_type": "BI", "chi": -99.211, "glyco_bond": "anti", "C5prime_xyz": [ -2.244, 8.028, -2.153 ], "P_xyz": [ 0.331, 8.324, -1.536 ], "form": "B", "ssZp": 1.978, "Dp": 2.012, "splay_angle": 23.514, "splay_distance": 3.913, "splay_ratio": 0.204, "d22": null, "d64": null, "eta": 166.353, "theta": -129.184, "eta_prime": -165.886, "theta_prime": -154.982, "eta_base": -106.854, "theta_base": -126.035, "v0": -19.415, "v1": 34.562, "v2": -35.723, "v3": 25.272, "v4": -3.870, "amplitude": 36.623, "phase_angle": 167.271, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.007, "origin": [ 109.485, 97.731, 125.288 ], "x_axis": [ -0.290, 0.482, 0.827 ], "y_axis": [ -0.876, -0.482, -0.027 ], "z_axis": [ 0.386, -0.732, 0.562 ], "quaternion": [ 0.444, 0.397, -0.248, 0.764 ] } }, { "index": 19, "index_chain": 19, "chain_name": "P", "nt_resnum": 19, "nt_name": "DA", "nt_code": "A", "nt_id": "///P/19", "linked_nts": [ "///P/18", "///P/20" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -30.608, "beta": -173.771, "gamma": 22.043, "delta": 149.212, "epsilon": -179.023, "zeta": -115.012, "epsilon_zeta": -64.012, "bb_type": "BI", "chi": -99.612, "glyco_bond": "anti", "C5prime_xyz": [ -2.019, 7.948, -2.124 ], "P_xyz": [ 0.040, 9.578, -1.685 ], "form": "B", "ssZp": 1.909, "Dp": 2.031, "splay_angle": 20.458, "splay_distance": 3.431, "splay_ratio": 0.179, "d22": null, "d64": null, "eta": 174.629, "theta": -146.973, "eta_prime": -166.512, "theta_prime": -157.572, "eta_base": -130.230, "theta_base": -116.435, "v0": -16.068, "v1": 32.586, "v2": -35.732, "v3": 27.191, "v4": -7.170, "amplitude": 36.033, "phase_angle": 172.594, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.037, "frame": { "rmsd": 0.007, "origin": [ 111.445, 95.057, 127.366 ], "x_axis": [ -0.727, 0.198, 0.657 ], "y_axis": [ -0.601, -0.646, -0.470 ], "z_axis": [ 0.332, -0.737, 0.589 ], "quaternion": [ 0.232, 0.287, -0.351, 0.861 ] } }, { "index": 20, "index_chain": 20, "chain_name": "P", "nt_resnum": 20, "nt_name": "DG", "nt_code": "G", "nt_id": "///P/20", "linked_nts": [ "///P/19", "///P/21" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop", "alpha": -34.016, "beta": 178.326, "gamma": 23.646, "delta": 148.027, "epsilon": -159.326, "zeta": -167.994, "epsilon_zeta": 8.668, "bb_type": "--", "chi": -104.052, "glyco_bond": "anti", "C5prime_xyz": [ -2.121, 8.205, -1.824 ], "P_xyz": [ 0.043, 9.684, -1.424 ], "form": ".", "ssZp": 2.238, "Dp": 2.131, "splay_angle": 15.943, "splay_distance": 2.778, "splay_ratio": 0.152, "d22": null, "d64": null, "eta": 171.798, "theta": -169.474, "eta_prime": -169.251, "theta_prime": -172.665, "eta_base": -122.783, "theta_base": -127.695, "v0": -21.465, "v1": 37.348, "v2": -37.678, "v3": 26.294, "v4": -3.060, "amplitude": 38.875, "phase_angle": 165.746, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.015, "frame": { "rmsd": 0.015, "origin": [ 112.368, 92.786, 129.766 ], "x_axis": [ -0.962, -0.165, 0.219 ], "y_axis": [ -0.066, -0.636, -0.769 ], "z_axis": [ 0.266, -0.754, 0.601 ], "quaternion": [ -0.028, 0.136, -0.426, 0.894 ] } }, { "index": 21, "index_chain": 21, "chain_name": "P", "nt_resnum": 21, "nt_name": "DG", "nt_code": "G", "nt_id": "///P/21", "linked_nts": [ "///P/20", "///P/22" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop", "alpha": -14.520, "beta": 128.180, "gamma": 28.713, "delta": 145.197, "epsilon": -178.102, "zeta": -108.974, "epsilon_zeta": -69.128, "bb_type": "BI", "chi": -116.954, "glyco_bond": "anti", "C5prime_xyz": [ -1.770, 8.436, -1.401 ], "P_xyz": [ 0.745, 8.530, -0.511 ], "form": "B", "ssZp": 2.084, "Dp": 2.017, "splay_angle": 17.290, "splay_distance": 2.885, "splay_ratio": 0.151, "d22": null, "d64": null, "eta": 155.711, "theta": -125.231, "eta_prime": -175.802, "theta_prime": -151.551, "eta_base": -125.009, "theta_base": -121.331, "v0": -17.535, "v1": 33.373, "v2": -35.594, "v3": 26.219, "v4": -5.588, "amplitude": 36.131, "phase_angle": 170.109, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.009, "frame": { "rmsd": 0.009, "origin": [ 113.695, 90.538, 130.715 ], "x_axis": [ -0.842, -0.421, -0.339 ], "y_axis": [ 0.516, -0.437, -0.737 ], "z_axis": [ 0.161, -0.795, 0.585 ], "quaternion": [ -0.277, -0.052, -0.453, 0.846 ] } }, { "index": 22, "index_chain": 22, "chain_name": "P", "nt_resnum": 22, "nt_name": "DA", "nt_code": "A", "nt_id": "///P/22", "linked_nts": [ "///P/21", "///P/23" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop,phosphate", "alpha": -40.317, "beta": -172.126, "gamma": 22.132, "delta": 153.217, "epsilon": -131.176, "zeta": -166.290, "epsilon_zeta": 35.114, "bb_type": "--", "chi": -107.813, "glyco_bond": "anti", "C5prime_xyz": [ -1.925, 8.104, -1.812 ], "P_xyz": [ 0.130, 9.626, -1.219 ], "form": ".", "ssZp": 1.585, "Dp": 1.699, "splay_angle": 21.407, "splay_distance": 3.700, "splay_ratio": 0.199, "d22": null, "d64": null, "eta": -177.809, "theta": -158.264, "eta_prime": -161.820, "theta_prime": -156.478, "eta_base": -123.155, "theta_base": -112.152, "v0": -16.998, "v1": 32.447, "v2": -34.635, "v3": 25.551, "v4": -5.540, "amplitude": 35.145, "phase_angle": 170.230, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.009, "origin": [ 113.873, 88.767, 132.986 ], "x_axis": [ -0.404, -0.647, -0.646 ], "y_axis": [ 0.904, -0.173, -0.392 ], "z_axis": [ 0.142, -0.742, 0.655 ], "quaternion": [ 0.519, 0.169, 0.380, -0.747 ] } }, { "index": 23, "index_chain": 23, "chain_name": "P", "nt_resnum": 23, "nt_name": "DC", "nt_code": "C", "nt_id": "///P/23", "linked_nts": [ "///P/22", "///P/24" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -28.538, "beta": 136.383, "gamma": 27.845, "delta": 148.097, "epsilon": 169.009, "zeta": -113.467, "epsilon_zeta": -77.524, "bb_type": "BI", "chi": -90.902, "glyco_bond": "anti", "C5prime_xyz": [ -2.287, 7.791, -2.444 ], "P_xyz": [ 0.292, 8.342, -2.262 ], "form": "B", "ssZp": 2.025, "Dp": 2.090, "splay_angle": 25.280, "splay_distance": 4.027, "splay_ratio": 0.219, "d22": 5.301, "d64": 4.334, "eta": 153.170, "theta": -141.313, "eta_prime": -171.066, "theta_prime": -168.538, "eta_base": -123.840, "theta_base": -137.152, "v0": -18.775, "v1": 34.433, "v2": -36.080, "v3": 26.039, "v4": -4.714, "amplitude": 36.810, "phase_angle": 168.567, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "4b", "suiteness": 0.010, "filter_rmsd": 0.063, "frame": { "rmsd": 0.005, "origin": [ 115.750, 86.442, 135.168 ], "x_axis": [ 0.215, -0.637, -0.740 ], "y_axis": [ 0.972, 0.209, 0.103 ], "z_axis": [ 0.089, -0.742, 0.665 ], "quaternion": [ 0.723, 0.292, 0.287, -0.557 ] } }, { "index": 24, "index_chain": 24, "chain_name": "P", "nt_resnum": 24, "nt_name": "DT", "nt_code": "T", "nt_id": "///P/24", "linked_nts": [ "///P/23", "///P/25" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -72.621, "beta": -151.544, "gamma": 33.024, "delta": 102.788, "epsilon": -169.767, "zeta": -72.835, "epsilon_zeta": -96.932, "bb_type": "BI", "chi": -120.216, "glyco_bond": "anti", "C5prime_xyz": [ -1.149, 8.051, -1.740 ], "P_xyz": [ 1.370, 8.769, -1.757 ], "form": ".", "ssZp": 2.911, "Dp": 4.259, "splay_angle": 29.069, "splay_distance": 4.743, "splay_ratio": 0.253, "d22": 4.566, "d64": 4.176, "eta": 171.027, "theta": -150.813, "eta_prime": 164.171, "theta_prime": -141.668, "eta_base": -156.034, "theta_base": -122.158, "v0": 11.423, "v1": -24.151, "v2": 26.733, "v3": -20.602, "v4": 5.953, "amplitude": 26.894, "phase_angle": 353.744, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.108, "frame": { "rmsd": 0.008, "origin": [ 115.873, 83.901, 138.289 ], "x_axis": [ 0.744, -0.335, -0.578 ], "y_axis": [ 0.651, 0.556, 0.517 ], "z_axis": [ 0.149, -0.761, 0.632 ], "quaternion": [ 0.856, 0.373, 0.212, -0.288 ] } }, { "index": 25, "index_chain": 25, "chain_name": "P", "nt_resnum": 25, "nt_name": "DC", "nt_code": "C", "nt_id": "///P/25", "linked_nts": [ "///P/24", null ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack", "alpha": -70.208, "beta": 177.625, "gamma": 80.209, "delta": 143.930, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": -111.346, "glyco_bond": "anti", "C5prime_xyz": [ -1.952, 8.402, -1.632 ], "P_xyz": [ 0.665, 8.797, -1.825 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": -19.695, "v1": 33.767, "v2": -34.281, "v3": 23.736, "v4": -2.640, "amplitude": 35.393, "phase_angle": 165.602, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1b", "suiteness": 0.054, "filter_rmsd": 0.063, "frame": { "rmsd": 0.004, "origin": [ 118.055, 80.503, 140.776 ], "x_axis": [ 0.825, 0.186, -0.534 ], "y_axis": [ 0.330, 0.608, 0.722 ], "z_axis": [ 0.459, -0.771, 0.440 ], "quaternion": [ 0.848, 0.440, 0.293, -0.042 ] } }, { "index": 26, "index_chain": 1, "chain_name": "T", "nt_resnum": 12, "nt_name": "DG", "nt_code": "G", "nt_id": "///T/12", "linked_nts": [ null, "///T/13" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,BI,non-pair-contact,ss-non-loop", "alpha": null, "beta": 75.733, "gamma": 147.540, "delta": 148.065, "epsilon": -169.512, "zeta": -128.383, "epsilon_zeta": -41.129, "bb_type": "BI", "chi": -102.215, "glyco_bond": "anti", "C5prime_xyz": [ -2.182, 8.130, -1.974 ], "P_xyz": [ -2.364, 7.011, -4.382 ], "form": "B", "ssZp": 2.254, "Dp": 2.128, "splay_angle": 20.235, "splay_distance": 3.362, "splay_ratio": 0.176, "d22": null, "d64": null, "eta": null, "theta": 84.533, "eta_prime": null, "theta_prime": 148.225, "eta_base": null, "theta_base": -168.962, "v0": -19.722, "v1": 34.702, "v2": -35.480, "v3": 24.983, "v4": -3.445, "amplitude": 36.471, "phase_angle": 166.609, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.007, "frame": { "rmsd": 0.007, "origin": [ 118.519, 78.642, 144.028 ], "x_axis": [ 0.753, 0.641, 0.148 ], "y_axis": [ 0.469, -0.365, -0.804 ], "z_axis": [ -0.461, 0.675, -0.575 ], "quaternion": [ -0.451, 0.821, 0.338, -0.096 ] } }, { "index": 27, "index_chain": 2, "chain_name": "T", "nt_resnum": 13, "nt_name": "DG", "nt_code": "G", "nt_id": "///T/13", "linked_nts": [ "///T/12", "///T/14" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack", "alpha": -46.702, "beta": 172.969, "gamma": 34.247, "delta": 143.702, "epsilon": -162.500, "zeta": -118.584, "epsilon_zeta": -43.916, "bb_type": "BI", "chi": -115.111, "glyco_bond": "anti", "C5prime_xyz": [ -1.663, 8.478, -1.435 ], "P_xyz": [ 0.586, 9.513, -0.343 ], "form": "B", "ssZp": 1.495, "Dp": 1.749, "splay_angle": 22.723, "splay_distance": 3.803, "splay_ratio": 0.198, "d22": null, "d64": null, "eta": 169.324, "theta": -135.612, "eta_prime": -171.937, "theta_prime": -145.844, "eta_base": -136.330, "theta_base": -93.419, "v0": -15.429, "v1": 31.149, "v2": -34.500, "v3": 25.840, "v4": -6.647, "amplitude": 34.803, "phase_angle": 172.440, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.008, "frame": { "rmsd": 0.008, "origin": [ 116.673, 80.871, 142.317 ], "x_axis": [ 0.999, 0.041, -0.031 ], "y_axis": [ 0.006, -0.693, -0.721 ], "z_axis": [ -0.051, 0.720, -0.692 ], "quaternion": [ -0.391, 0.920, 0.013, -0.022 ] } }, { "index": 28, "index_chain": 3, "chain_name": "T", "nt_resnum": 14, "nt_name": "DA", "nt_code": "A", "nt_id": "///T/14", "linked_nts": [ "///T/13", "///T/15" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -27.831, "beta": 163.854, "gamma": 23.437, "delta": 145.353, "epsilon": -160.006, "zeta": -138.774, "epsilon_zeta": -21.232, "bb_type": "--", "chi": -102.191, "glyco_bond": "anti", "C5prime_xyz": [ -2.170, 8.051, -2.051 ], "P_xyz": [ 0.129, 9.278, -1.845 ], "form": "B", "ssZp": 1.966, "Dp": 1.984, "splay_angle": 25.664, "splay_distance": 4.257, "splay_ratio": 0.223, "d22": null, "d64": null, "eta": 170.501, "theta": -148.721, "eta_prime": -160.618, "theta_prime": -157.823, "eta_base": -103.129, "theta_base": -110.903, "v0": -20.148, "v1": 34.998, "v2": -35.495, "v3": 24.655, "v4": -3.065, "amplitude": 36.597, "phase_angle": 165.907, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.037, "frame": { "rmsd": 0.006, "origin": [ 116.721, 83.017, 139.178 ], "x_axis": [ 0.716, -0.322, -0.619 ], "y_axis": [ -0.669, -0.570, -0.477 ], "z_axis": [ -0.199, 0.756, -0.623 ], "quaternion": [ -0.362, 0.853, -0.290, -0.240 ] } }, { "index": 29, "index_chain": 4, "chain_name": "T", "nt_resnum": 15, "nt_name": "DG", "nt_code": "G", "nt_id": "///T/15", "linked_nts": [ "///T/14", "///T/16" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -20.288, "beta": 150.939, "gamma": 33.781, "delta": 136.798, "epsilon": -178.855, "zeta": -110.134, "epsilon_zeta": -68.721, "bb_type": "BI", "chi": -100.916, "glyco_bond": "anti", "C5prime_xyz": [ -2.220, 8.143, -2.150 ], "P_xyz": [ 0.173, 9.063, -2.057 ], "form": "B", "ssZp": 1.732, "Dp": 1.855, "splay_angle": 24.020, "splay_distance": 3.989, "splay_ratio": 0.208, "d22": null, "d64": null, "eta": 176.907, "theta": -146.218, "eta_prime": -152.509, "theta_prime": -162.908, "eta_base": -105.409, "theta_base": -130.950, "v0": -20.076, "v1": 33.163, "v2": -32.914, "v3": 22.043, "v4": -1.394, "amplitude": 34.309, "phase_angle": 163.606, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.008, "frame": { "rmsd": 0.008, "origin": [ 115.555, 85.488, 135.914 ], "x_axis": [ 0.098, -0.566, -0.818 ], "y_axis": [ -0.971, -0.236, 0.047 ], "z_axis": [ -0.220, 0.790, -0.573 ], "quaternion": [ -0.269, 0.690, -0.556, -0.376 ] } }, { "index": 30, "index_chain": 5, "chain_name": "T", "nt_resnum": 16, "nt_name": "DT", "nt_code": "T", "nt_id": "///T/16", "linked_nts": [ "///T/15", "///T/17" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop", "alpha": -38.535, "beta": -166.614, "gamma": 26.338, "delta": 146.077, "epsilon": 158.929, "zeta": -79.629, "epsilon_zeta": -121.442, "bb_type": "BI", "chi": -87.683, "glyco_bond": "anti", "C5prime_xyz": [ -2.046, 7.634, -2.515 ], "P_xyz": [ -0.022, 9.352, -2.181 ], "form": ".", "ssZp": 1.480, "Dp": 1.749, "splay_angle": 24.065, "splay_distance": 3.920, "splay_ratio": 0.209, "d22": 3.560, "d64": 2.897, "eta": 171.879, "theta": -136.103, "eta_prime": -163.775, "theta_prime": -160.819, "eta_base": -129.997, "theta_base": -77.898, "v0": -12.517, "v1": 30.568, "v2": -36.434, "v3": 29.782, "v4": -10.976, "amplitude": 36.441, "phase_angle": 178.811, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.108, "frame": { "rmsd": 0.015, "origin": [ 114.910, 88.977, 134.090 ], "x_axis": [ -0.421, -0.604, -0.676 ], "y_axis": [ -0.880, 0.090, 0.467 ], "z_axis": [ -0.221, 0.792, -0.569 ], "quaternion": [ 0.158, -0.514, 0.721, 0.436 ] } }, { "index": 31, "index_chain": 6, "chain_name": "T", "nt_resnum": 17, "nt_name": "DC", "nt_code": "C", "nt_id": "///T/17", "linked_nts": [ "///T/16", "///T/18" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop", "alpha": -61.638, "beta": -160.123, "gamma": 19.563, "delta": 92.471, "epsilon": -167.739, "zeta": -89.888, "epsilon_zeta": -77.851, "bb_type": "BI", "chi": -126.355, "glyco_bond": "anti", "C5prime_xyz": [ -1.146, 8.302, -1.525 ], "P_xyz": [ 1.224, 9.351, -1.448 ], "form": ".", "ssZp": 3.242, "Dp": 4.447, "splay_angle": 19.493, "splay_distance": 3.129, "splay_ratio": 0.172, "d22": 3.873, "d64": 3.472, "eta": 155.727, "theta": -177.037, "eta_prime": 160.145, "theta_prime": -167.049, "eta_base": -103.112, "theta_base": -165.937, "v0": 6.332, "v1": -23.689, "v2": 30.628, "v3": -27.751, "v4": 13.595, "amplitude": 30.848, "phase_angle": 6.851, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.009, "origin": [ 111.960, 90.012, 131.725 ], "x_axis": [ -0.974, -0.220, 0.049 ], "y_axis": [ -0.088, 0.573, 0.814 ], "z_axis": [ -0.207, 0.789, -0.578 ], "quaternion": [ -0.073, -0.087, 0.884, 0.454 ] } }, { "index": 32, "index_chain": 7, "chain_name": "T", "nt_resnum": 18, "nt_name": "DC", "nt_code": "C", "nt_id": "///T/18", "linked_nts": [ "///T/17", "///T/19" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop", "alpha": -60.497, "beta": 155.834, "gamma": 77.565, "delta": 142.155, "epsilon": -145.809, "zeta": -141.566, "epsilon_zeta": -4.243, "bb_type": "--", "chi": -128.929, "glyco_bond": "anti", "C5prime_xyz": [ -1.759, 8.700, -0.674 ], "P_xyz": [ 0.868, 8.756, -0.790 ], "form": "B", "ssZp": 2.045, "Dp": 1.841, "splay_angle": 20.627, "splay_distance": 3.483, "splay_ratio": 0.180, "d22": 5.226, "d64": 4.804, "eta": 177.757, "theta": -139.230, "eta_prime": -149.357, "theta_prime": -158.370, "eta_base": -150.834, "theta_base": -126.084, "v0": -19.843, "v1": 33.531, "v2": -33.628, "v3": 22.575, "v4": -1.834, "amplitude": 34.920, "phase_angle": 164.365, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1b", "suiteness": 0.231, "filter_rmsd": 0.064, "frame": { "rmsd": 0.009, "origin": [ 112.319, 92.472, 129.827 ], "x_axis": [ -0.855, -0.353, 0.379 ], "y_axis": [ 0.020, 0.709, 0.705 ], "z_axis": [ -0.518, 0.611, -0.599 ], "quaternion": [ -0.252, -0.094, 0.889, 0.370 ] } }, { "index": 33, "index_chain": 8, "chain_name": "T", "nt_resnum": 19, "nt_name": "DT", "nt_code": "T", "nt_id": "///T/19", "linked_nts": [ "///T/18", "///T/20" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -24.382, "beta": 142.370, "gamma": 31.519, "delta": 150.733, "epsilon": -141.621, "zeta": -155.320, "epsilon_zeta": 13.699, "bb_type": "--", "chi": -99.655, "glyco_bond": "anti", "C5prime_xyz": [ -2.816, 8.128, -2.017 ], "P_xyz": [ -0.465, 9.270, -1.899 ], "form": "B", "ssZp": 1.901, "Dp": 1.828, "splay_angle": 24.103, "splay_distance": 3.962, "splay_ratio": 0.209, "d22": 4.585, "d64": 3.784, "eta": 174.451, "theta": -140.019, "eta_prime": -154.135, "theta_prime": -152.783, "eta_base": -117.961, "theta_base": -101.620, "v0": -27.647, "v1": 42.198, "v2": -39.665, "v3": 24.686, "v4": 1.698, "amplitude": 42.486, "phase_angle": 159.001, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.107, "frame": { "rmsd": 0.006, "origin": [ 111.369, 94.640, 127.272 ], "x_axis": [ -0.864, 0.259, 0.432 ], "y_axis": [ 0.428, 0.829, 0.360 ], "z_axis": [ -0.265, 0.496, -0.827 ], "quaternion": [ -0.186, 0.183, 0.938, 0.228 ] } }, { "index": 34, "index_chain": 9, "chain_name": "T", "nt_resnum": 20, "nt_name": "DT", "nt_code": "T", "nt_id": "///T/20", "linked_nts": [ "///T/19", "///T/21" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -28.838, "beta": 143.579, "gamma": 28.590, "delta": 149.078, "epsilon": -155.557, "zeta": -153.387, "epsilon_zeta": -2.170, "bb_type": "--", "chi": -92.814, "glyco_bond": "anti", "C5prime_xyz": [ -2.810, 7.927, -2.289 ], "P_xyz": [ -0.444, 9.093, -2.334 ], "form": "B", "ssZp": 2.057, "Dp": 2.040, "splay_angle": 17.541, "splay_distance": 2.889, "splay_ratio": 0.153, "d22": 3.975, "d64": 2.836, "eta": 168.352, "theta": -148.207, "eta_prime": -163.598, "theta_prime": -162.353, "eta_base": -109.625, "theta_base": -108.095, "v0": -27.192, "v1": 41.852, "v2": -39.354, "v3": 24.820, "v4": 1.421, "amplitude": 42.056, "phase_angle": 159.351, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.105, "frame": { "rmsd": 0.004, "origin": [ 110.005, 97.588, 125.005 ], "x_axis": [ -0.335, 0.728, 0.598 ], "y_axis": [ 0.883, 0.465, -0.072 ], "z_axis": [ -0.330, 0.504, -0.798 ], "quaternion": [ -0.288, 0.500, 0.806, 0.134 ] } }, { "index": 35, "index_chain": 10, "chain_name": "T", "nt_resnum": 21, "nt_name": "DC", "nt_code": "C", "nt_id": "///T/21", "linked_nts": [ "///T/20", "///T/22" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -31.931, "beta": 142.887, "gamma": 32.459, "delta": 150.387, "epsilon": -146.079, "zeta": -147.864, "epsilon_zeta": 1.785, "bb_type": "--", "chi": -99.172, "glyco_bond": "anti", "C5prime_xyz": [ -2.600, 8.182, -2.000 ], "P_xyz": [ -0.118, 9.089, -1.844 ], "form": "B", "ssZp": 2.018, "Dp": 1.840, "splay_angle": 20.311, "splay_distance": 3.425, "splay_ratio": 0.176, "d22": null, "d64": null, "eta": 167.200, "theta": -137.811, "eta_prime": -168.109, "theta_prime": -153.246, "eta_base": -110.932, "theta_base": -117.855, "v0": -23.946, "v1": 39.077, "v2": -38.176, "v3": 25.427, "v4": -0.972, "amplitude": 39.988, "phase_angle": 162.687, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.008, "origin": [ 109.483, 99.810, 123.233 ], "x_axis": [ 0.351, 0.778, 0.521 ], "y_axis": [ 0.849, -0.030, -0.528 ], "z_axis": [ -0.395, 0.627, -0.671 ], "quaternion": [ -0.403, 0.716, 0.568, 0.044 ] } }, { "index": 36, "index_chain": 11, "chain_name": "T", "nt_resnum": 22, "nt_name": "DG", "nt_code": "G", "nt_id": "///T/22", "linked_nts": [ "///T/21", "///T/23" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -37.924, "beta": 144.764, "gamma": 35.247, "delta": 148.764, "epsilon": -143.989, "zeta": -158.726, "epsilon_zeta": 14.737, "bb_type": "--", "chi": -97.381, "glyco_bond": "anti", "C5prime_xyz": [ -3.076, 8.039, -2.122 ], "P_xyz": [ -0.789, 9.388, -2.178 ], "form": "B", "ssZp": 1.939, "Dp": 1.906, "splay_angle": 20.652, "splay_distance": 3.408, "splay_ratio": 0.179, "d22": null, "d64": null, "eta": 167.536, "theta": -146.191, "eta_prime": -164.900, "theta_prime": -159.884, "eta_base": -126.250, "theta_base": -111.128, "v0": -28.889, "v1": 43.195, "v2": -40.033, "v3": 24.694, "v4": 2.288, "amplitude": 43.165, "phase_angle": 158.041, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.021, "frame": { "rmsd": 0.021, "origin": [ 108.375, 102.161, 121.002 ], "x_axis": [ 0.781, 0.570, 0.255 ], "y_axis": [ 0.523, -0.376, -0.765 ], "z_axis": [ -0.340, 0.731, -0.592 ], "quaternion": [ -0.451, 0.829, 0.330, -0.026 ] } }, { "index": 37, "index_chain": 12, "chain_name": "T", "nt_resnum": 23, "nt_name": "DT", "nt_code": "T", "nt_id": "///T/23", "linked_nts": [ "///T/22", "///T/24" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -28.536, "beta": 142.104, "gamma": 25.476, "delta": 145.604, "epsilon": -149.986, "zeta": -160.065, "epsilon_zeta": 10.079, "bb_type": "--", "chi": -93.346, "glyco_bond": "anti", "C5prime_xyz": [ -3.014, 7.932, -2.247 ], "P_xyz": [ -0.723, 9.242, -2.269 ], "form": "B", "ssZp": 2.053, "Dp": 1.913, "splay_angle": 20.277, "splay_distance": 3.374, "splay_ratio": 0.176, "d22": 4.401, "d64": 3.625, "eta": 169.758, "theta": -151.597, "eta_prime": -167.674, "theta_prime": -163.219, "eta_base": -116.673, "theta_base": -116.010, "v0": -27.914, "v1": 40.942, "v2": -37.442, "v3": 22.410, "v4": 3.345, "amplitude": 40.788, "phase_angle": 156.632, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.107, "frame": { "rmsd": 0.006, "origin": [ 108.039, 104.845, 118.930 ], "x_axis": [ 0.949, 0.177, -0.261 ], "y_axis": [ -0.114, -0.579, -0.808 ], "z_axis": [ -0.294, 0.796, -0.529 ], "quaternion": [ -0.459, 0.874, 0.018, -0.159 ] } }, { "index": 38, "index_chain": 13, "chain_name": "T", "nt_resnum": 24, "nt_name": "DC", "nt_code": "C", "nt_id": "///T/24", "linked_nts": [ "///T/23", "///T/25" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -23.193, "beta": 137.692, "gamma": 28.626, "delta": 144.484, "epsilon": -147.368, "zeta": -151.729, "epsilon_zeta": 4.361, "bb_type": "--", "chi": -95.667, "glyco_bond": "anti", "C5prime_xyz": [ -2.898, 8.081, -2.176 ], "P_xyz": [ -0.523, 9.206, -2.157 ], "form": "B", "ssZp": 1.976, "Dp": 1.860, "splay_angle": 20.194, "splay_distance": 3.381, "splay_ratio": 0.176, "d22": 4.420, "d64": 3.626, "eta": 174.271, "theta": -147.807, "eta_prime": -162.848, "theta_prime": -161.140, "eta_base": -114.800, "theta_base": -116.557, "v0": -27.931, "v1": 41.084, "v2": -37.816, "v3": 22.818, "v4": 3.044, "amplitude": 41.062, "phase_angle": 157.067, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.062, "frame": { "rmsd": 0.005, "origin": [ 107.553, 107.268, 116.633 ], "x_axis": [ 0.700, -0.222, -0.679 ], "y_axis": [ -0.682, -0.490, -0.543 ], "z_axis": [ -0.212, 0.843, -0.494 ], "quaternion": [ -0.423, 0.819, -0.276, -0.272 ] } }, { "index": 39, "index_chain": 14, "chain_name": "T", "nt_resnum": 25, "nt_name": "DC", "nt_code": "C", "nt_id": "///T/25", "linked_nts": [ "///T/24", "///T/26" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -34.640, "beta": 145.453, "gamma": 34.607, "delta": 146.076, "epsilon": -147.324, "zeta": -151.021, "epsilon_zeta": 3.697, "bb_type": "--", "chi": -96.908, "glyco_bond": "anti", "C5prime_xyz": [ -2.828, 8.094, -2.157 ], "P_xyz": [ -0.460, 9.246, -2.261 ], "form": "B", "ssZp": 1.879, "Dp": 1.804, "splay_angle": 20.126, "splay_distance": 3.368, "splay_ratio": 0.175, "d22": 4.466, "d64": 3.641, "eta": 173.277, "theta": -147.373, "eta_prime": -162.441, "theta_prime": -161.789, "eta_base": -117.025, "theta_base": -117.299, "v0": -25.695, "v1": 39.829, "v2": -37.779, "v3": 24.047, "v4": 0.908, "amplitude": 40.211, "phase_angle": 159.972, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.003, "origin": [ 106.858, 109.756, 114.452 ], "x_axis": [ 0.182, -0.504, -0.844 ], "y_axis": [ -0.977, -0.189, -0.097 ], "z_axis": [ -0.111, 0.842, -0.527 ], "quaternion": [ -0.341, 0.689, -0.538, -0.347 ] } }, { "index": 40, "index_chain": 15, "chain_name": "T", "nt_resnum": 26, "nt_name": "DT", "nt_code": "T", "nt_id": "///T/26", "linked_nts": [ "///T/25", "///T/27" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -31.742, "beta": 147.650, "gamma": 27.823, "delta": 145.479, "epsilon": -147.076, "zeta": -154.363, "epsilon_zeta": 7.287, "bb_type": "--", "chi": -95.130, "glyco_bond": "anti", "C5prime_xyz": [ -2.848, 7.957, -2.264 ], "P_xyz": [ -0.563, 9.264, -2.322 ], "form": "B", "ssZp": 1.838, "Dp": 1.810, "splay_angle": 20.045, "splay_distance": 3.361, "splay_ratio": 0.174, "d22": null, "d64": null, "eta": 172.739, "theta": -149.176, "eta_prime": -165.016, "theta_prime": -160.315, "eta_base": -119.414, "theta_base": -123.384, "v0": -26.483, "v1": 39.451, "v2": -36.791, "v3": 22.489, "v4": 2.360, "amplitude": 39.687, "phase_angle": 157.975, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.107, "frame": { "rmsd": 0.003, "origin": [ 106.209, 112.313, 112.357 ], "x_axis": [ -0.419, -0.546, -0.726 ], "y_axis": [ -0.907, 0.215, 0.362 ], "z_axis": [ -0.042, 0.810, -0.585 ], "quaternion": [ 0.230, -0.488, 0.745, 0.393 ] } }, { "index": 41, "index_chain": 16, "chain_name": "T", "nt_resnum": 27, "nt_name": "DA", "nt_code": "A", "nt_id": "///T/27", "linked_nts": [ "///T/26", "///T/28" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -25.937, "beta": 142.524, "gamma": 23.154, "delta": 145.968, "epsilon": -150.776, "zeta": -162.148, "epsilon_zeta": 11.372, "bb_type": "--", "chi": -92.633, "glyco_bond": "anti", "C5prime_xyz": [ -3.100, 7.806, -2.313 ], "P_xyz": [ -0.896, 9.244, -2.364 ], "form": "B", "ssZp": 1.972, "Dp": 1.919, "splay_angle": 20.551, "splay_distance": 3.370, "splay_ratio": 0.178, "d22": null, "d64": null, "eta": 169.194, "theta": -155.951, "eta_prime": -167.609, "theta_prime": -166.285, "eta_base": -129.041, "theta_base": -122.564, "v0": -29.730, "v1": 42.180, "v2": -37.845, "v3": 21.968, "v4": 4.502, "amplitude": 41.775, "phase_angle": 154.947, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.040, "frame": { "rmsd": 0.015, "origin": [ 105.825, 114.988, 110.361 ], "x_axis": [ -0.818, -0.420, -0.394 ], "y_axis": [ -0.573, 0.527, 0.628 ], "z_axis": [ -0.056, 0.739, -0.671 ], "quaternion": [ 0.097, -0.286, 0.868, 0.394 ] } }, { "index": 42, "index_chain": 17, "chain_name": "T", "nt_resnum": 28, "nt_name": "DG", "nt_code": "G", "nt_id": "///T/28", "linked_nts": [ "///T/27", "///T/29" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -23.892, "beta": 139.068, "gamma": 31.942, "delta": 148.209, "epsilon": -143.245, "zeta": -155.777, "epsilon_zeta": 12.532, "bb_type": "--", "chi": -94.786, "glyco_bond": "anti", "C5prime_xyz": [ -3.028, 7.892, -2.217 ], "P_xyz": [ -0.683, 9.114, -2.114 ], "form": "B", "ssZp": 1.677, "Dp": 1.691, "splay_angle": 20.818, "splay_distance": 3.456, "splay_ratio": 0.181, "d22": null, "d64": null, "eta": 177.840, "theta": -141.485, "eta_prime": -158.232, "theta_prime": -157.369, "eta_base": -115.827, "theta_base": -110.525, "v0": -25.143, "v1": 39.991, "v2": -38.824, "v3": 25.711, "v4": -0.679, "amplitude": 40.814, "phase_angle": 162.035, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.008, "frame": { "rmsd": 0.008, "origin": [ 105.217, 117.461, 108.154 ], "x_axis": [ -0.997, -0.064, 0.044 ], "y_axis": [ -0.016, 0.728, 0.685 ], "z_axis": [ -0.076, 0.682, -0.727 ], "quaternion": [ -0.032, -0.022, 0.929, 0.368 ] } }, { "index": 43, "index_chain": 18, "chain_name": "T", "nt_resnum": 29, "nt_name": "DT", "nt_code": "T", "nt_id": "///T/29", "linked_nts": [ "///T/28", "///T/30" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -26.777, "beta": 141.044, "gamma": 21.590, "delta": 143.262, "epsilon": -152.048, "zeta": -163.615, "epsilon_zeta": 11.567, "bb_type": "--", "chi": -91.159, "glyco_bond": "anti", "C5prime_xyz": [ -3.148, 7.830, -2.312 ], "P_xyz": [ -0.906, 9.216, -2.447 ], "form": "B", "ssZp": 2.132, "Dp": 1.978, "splay_angle": 20.260, "splay_distance": 3.371, "splay_ratio": 0.177, "d22": null, "d64": null, "eta": 167.161, "theta": -157.891, "eta_prime": -171.265, "theta_prime": -167.806, "eta_base": -121.750, "theta_base": -127.916, "v0": -29.260, "v1": 40.678, "v2": -36.015, "v3": 20.151, "v4": 5.486, "amplitude": 40.245, "phase_angle": 153.496, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.107, "frame": { "rmsd": 0.005, "origin": [ 104.380, 120.073, 106.050 ], "x_axis": [ -0.796, 0.373, 0.476 ], "y_axis": [ 0.587, 0.667, 0.458 ], "z_axis": [ -0.147, 0.645, -0.750 ], "quaternion": [ -0.174, 0.268, 0.896, 0.308 ] } }, { "index": 44, "index_chain": 19, "chain_name": "T", "nt_resnum": 30, "nt_name": "DA", "nt_code": "A", "nt_id": "///T/30", "linked_nts": [ "///T/29", "///T/31" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -20.847, "beta": 136.269, "gamma": 28.751, "delta": 143.750, "epsilon": -147.561, "zeta": -155.105, "epsilon_zeta": 7.543, "bb_type": "--", "chi": -96.958, "glyco_bond": "anti", "C5prime_xyz": [ -2.908, 8.040, -2.140 ], "P_xyz": [ -0.525, 9.158, -2.048 ], "form": "B", "ssZp": 1.924, "Dp": 1.812, "splay_angle": 20.520, "splay_distance": 3.411, "splay_ratio": 0.178, "d22": null, "d64": null, "eta": 176.424, "theta": -147.522, "eta_prime": -162.571, "theta_prime": -160.775, "eta_base": -122.706, "theta_base": -112.536, "v0": -27.139, "v1": 40.543, "v2": -37.633, "v3": 22.943, "v4": 2.473, "amplitude": 40.640, "phase_angle": 157.823, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.040, "frame": { "rmsd": 0.013, "origin": [ 103.916, 122.503, 103.760 ], "x_axis": [ -0.351, 0.632, 0.691 ], "y_axis": [ 0.903, 0.423, 0.072 ], "z_axis": [ -0.246, 0.650, -0.719 ], "quaternion": [ -0.297, 0.486, 0.789, 0.229 ] } }, { "index": 45, "index_chain": 20, "chain_name": "T", "nt_resnum": 31, "nt_name": "DC", "nt_code": "C", "nt_id": "///T/31", "linked_nts": [ "///T/30", "///T/32" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -26.648, "beta": 141.341, "gamma": 30.311, "delta": 143.856, "epsilon": -144.667, "zeta": -151.663, "epsilon_zeta": 6.996, "bb_type": "--", "chi": -94.916, "glyco_bond": "anti", "C5prime_xyz": [ -2.830, 8.031, -2.246 ], "P_xyz": [ -0.465, 9.208, -2.201 ], "form": "B", "ssZp": 1.669, "Dp": 1.672, "splay_angle": 19.991, "splay_distance": 3.372, "splay_ratio": 0.174, "d22": 4.405, "d64": 3.623, "eta": 177.045, "theta": -145.748, "eta_prime": -159.216, "theta_prime": -158.772, "eta_base": -110.884, "theta_base": -115.558, "v0": -25.639, "v1": 39.309, "v2": -37.411, "v3": 23.669, "v4": 1.092, "amplitude": 39.864, "phase_angle": 159.797, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.005, "origin": [ 103.385, 125.225, 101.774 ], "x_axis": [ 0.278, 0.753, 0.596 ], "y_axis": [ 0.905, 0.003, -0.426 ], "z_axis": [ -0.322, 0.658, -0.681 ], "quaternion": [ -0.387, 0.699, 0.593, 0.098 ] } }, { "index": 46, "index_chain": 21, "chain_name": "T", "nt_resnum": 32, "nt_name": "DT", "nt_code": "T", "nt_id": "///T/32", "linked_nts": [ "///T/31", "///T/33" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -30.030, "beta": 140.453, "gamma": 28.323, "delta": 142.378, "epsilon": -150.143, "zeta": -160.206, "epsilon_zeta": 10.063, "bb_type": "--", "chi": -92.479, "glyco_bond": "anti", "C5prime_xyz": [ -3.201, 7.909, -2.246 ], "P_xyz": [ -0.938, 9.237, -2.464 ], "form": "B", "ssZp": 2.080, "Dp": 1.902, "splay_angle": 21.231, "splay_distance": 3.504, "splay_ratio": 0.185, "d22": null, "d64": null, "eta": 169.346, "theta": -158.408, "eta_prime": -166.047, "theta_prime": -170.649, "eta_base": -121.789, "theta_base": -116.753, "v0": -29.285, "v1": 41.538, "v2": -36.940, "v3": 21.185, "v4": 4.930, "amplitude": 40.975, "phase_angle": 154.360, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.009, "origin": [ 102.815, 127.638, 99.489 ], "x_axis": [ 0.734, 0.624, 0.268 ], "y_axis": [ 0.572, -0.355, -0.740 ], "z_axis": [ -0.367, 0.696, -0.617 ], "quaternion": [ -0.436, 0.822, 0.364, -0.030 ] } }, { "index": 47, "index_chain": 22, "chain_name": "T", "nt_resnum": 33, "nt_name": "DA", "nt_code": "A", "nt_id": "///T/33", "linked_nts": [ "///T/32", "///T/34" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -29.880, "beta": 138.636, "gamma": 40.411, "delta": 150.718, "epsilon": -141.165, "zeta": -149.238, "epsilon_zeta": 8.073, "bb_type": "--", "chi": -98.988, "glyco_bond": "anti", "C5prime_xyz": [ -2.726, 8.093, -2.061 ], "P_xyz": [ -0.255, 9.044, -1.937 ], "form": "B", "ssZp": 1.442, "Dp": 1.543, "splay_angle": 21.405, "splay_distance": 3.531, "splay_ratio": 0.186, "d22": null, "d64": null, "eta": 179.073, "theta": -136.114, "eta_prime": -152.255, "theta_prime": -155.254, "eta_base": -101.550, "theta_base": -101.337, "v0": -22.567, "v1": 39.481, "v2": -40.561, "v3": 28.480, "v4": -3.803, "amplitude": 41.698, "phase_angle": 166.589, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "4b", "suiteness": 0.010, "filter_rmsd": 0.038, "frame": { "rmsd": 0.006, "origin": [ 102.375, 130.048, 96.983 ], "x_axis": [ 0.925, 0.261, -0.277 ], "y_axis": [ -0.058, -0.623, -0.780 ], "z_axis": [ -0.376, 0.738, -0.561 ], "quaternion": [ -0.431, 0.882, 0.057, -0.185 ] } }, { "index": 48, "index_chain": 23, "chain_name": "T", "nt_resnum": 34, "nt_name": "DC", "nt_code": "C", "nt_id": "///T/34", "linked_nts": [ "///T/33", "///T/35" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -37.437, "beta": 143.656, "gamma": 33.898, "delta": 146.439, "epsilon": -148.826, "zeta": -158.865, "epsilon_zeta": 10.038, "bb_type": "--", "chi": -90.899, "glyco_bond": "anti", "C5prime_xyz": [ -3.023, 7.855, -2.423 ], "P_xyz": [ -0.682, 9.107, -2.570 ], "form": "B", "ssZp": 1.686, "Dp": 1.769, "splay_angle": 20.719, "splay_distance": 3.430, "splay_ratio": 0.180, "d22": 4.511, "d64": 3.605, "eta": 167.864, "theta": -150.814, "eta_prime": -162.462, "theta_prime": -165.270, "eta_base": -108.365, "theta_base": -115.295, "v0": -26.134, "v1": 40.157, "v2": -38.321, "v3": 24.338, "v4": 0.939, "amplitude": 40.776, "phase_angle": 160.015, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.006, "origin": [ 101.663, 132.227, 94.298 ], "x_axis": [ 0.647, -0.216, -0.731 ], "y_axis": [ -0.685, -0.585, -0.434 ], "z_axis": [ -0.334, 0.782, -0.526 ], "quaternion": [ -0.366, 0.830, -0.271, -0.321 ] } }, { "index": 49, "index_chain": 24, "chain_name": "T", "nt_resnum": 35, "nt_name": "DT", "nt_code": "T", "nt_id": "///T/35", "linked_nts": [ "///T/34", "///T/36" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -27.124, "beta": 139.325, "gamma": 32.421, "delta": 146.896, "epsilon": -148.686, "zeta": -156.396, "epsilon_zeta": 7.710, "bb_type": "--", "chi": -91.526, "glyco_bond": "anti", "C5prime_xyz": [ -3.082, 7.823, -2.340 ], "P_xyz": [ -0.729, 9.023, -2.404 ], "form": "B", "ssZp": 1.733, "Dp": 1.744, "splay_angle": 20.733, "splay_distance": 3.420, "splay_ratio": 0.180, "d22": 4.566, "d64": 3.649, "eta": 173.472, "theta": -148.585, "eta_prime": -160.313, "theta_prime": -165.616, "eta_base": -112.128, "theta_base": -110.080, "v0": -25.510, "v1": 39.693, "v2": -38.115, "v3": 24.599, "v4": 0.383, "amplitude": 40.375, "phase_angle": 160.740, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.107, "frame": { "rmsd": 0.006, "origin": [ 100.331, 134.358, 91.964 ], "x_axis": [ 0.099, -0.525, -0.845 ], "y_axis": [ -0.962, -0.269, 0.055 ], "z_axis": [ -0.256, 0.807, -0.532 ], "quaternion": [ -0.273, 0.689, -0.540, -0.400 ] } }, { "index": 50, "index_chain": 25, "chain_name": "T", "nt_resnum": 36, "nt_name": "DC", "nt_code": "C", "nt_id": "///T/36", "linked_nts": [ "///T/35", "///T/37" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -29.662, "beta": 142.840, "gamma": 33.189, "delta": 144.538, "epsilon": -146.772, "zeta": -149.944, "epsilon_zeta": 3.171, "bb_type": "--", "chi": -93.499, "glyco_bond": "anti", "C5prime_xyz": [ -2.809, 7.989, -2.363 ], "P_xyz": [ -0.414, 9.115, -2.402 ], "form": "B", "ssZp": 1.576, "Dp": 1.675, "splay_angle": 20.415, "splay_distance": 3.449, "splay_ratio": 0.177, "d22": 4.519, "d64": 3.738, "eta": 176.968, "theta": -148.138, "eta_prime": -159.360, "theta_prime": -163.429, "eta_base": -105.566, "theta_base": -118.476, "v0": -24.614, "v1": 38.383, "v2": -37.111, "v3": 23.794, "v4": 0.401, "amplitude": 39.279, "phase_angle": 160.877, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.004, "origin": [ 98.884, 136.480, 89.705 ], "x_axis": [ -0.575, -0.551, -0.605 ], "y_axis": [ -0.800, 0.227, 0.555 ], "z_axis": [ -0.168, 0.803, -0.571 ], "quaternion": [ 0.142, -0.438, 0.770, 0.441 ] } }, { "index": 51, "index_chain": 26, "chain_name": "T", "nt_resnum": 37, "nt_name": "DC", "nt_code": "C", "nt_id": "///T/37", "linked_nts": [ "///T/36", null ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack", "alpha": -35.558, "beta": 145.416, "gamma": 33.879, "delta": 140.548, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": -95.410, "glyco_bond": "anti", "C5prime_xyz": [ -2.932, 8.040, -2.278 ], "P_xyz": [ -0.613, 9.302, -2.415 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": -28.531, "v1": 41.356, "v2": -37.830, "v3": 22.358, "v4": 3.720, "amplitude": 41.333, "phase_angle": 156.243, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.006, "origin": [ 97.865, 139.223, 87.880 ], "x_axis": [ -0.930, -0.324, -0.174 ], "y_axis": [ -0.335, 0.550, 0.765 ], "z_axis": [ -0.152, 0.770, -0.620 ], "quaternion": [ 0.006, -0.187, 0.880, 0.436 ] } } ], "num_hbonds": 2041, "hbonds": [ { "index": 1, "atom1_serNum": 34, "atom2_serNum": 2013, "donAcc_type": "acceptable", "distance": 3.436, "atom1_id": "///A/5/O", "atom2_id": "///A/260/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 2, "atom1_serNum": 53, "atom2_serNum": 2013, "donAcc_type": "acceptable", "distance": 3.789, "atom1_id": "///A/7/N", "atom2_id": "///A/260/OG1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 3, "atom1_serNum": 63, "atom2_serNum": 295, "donAcc_type": "standard", "distance": 3.209, "atom1_id": "///A/8/O", "atom2_id": "///A/40/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 4, "atom1_serNum": 69, "atom2_serNum": 1862, "donAcc_type": "standard", "distance": 2.858, "atom1_id": "///A/8/NE2", "atom2_id": "///A/241/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 5, "atom1_serNum": 81, "atom2_serNum": 1532, "donAcc_type": "standard", "distance": 2.789, "atom1_id": "///A/10/O", "atom2_id": "///A/202/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 6, "atom1_serNum": 85, "atom2_serNum": 505, "donAcc_type": "standard", "distance": 2.745, "atom1_id": "///A/10/NE", "atom2_id": "///A/69/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 7, "atom1_serNum": 87, "atom2_serNum": 1287, "donAcc_type": "standard", "distance": 3.924, "atom1_id": "///A/10/NH1", "atom2_id": "///A/169/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 8, "atom1_serNum": 89, "atom2_serNum": 313, "donAcc_type": "acceptable", "distance": 2.890, "atom1_id": "///A/11/N", "atom2_id": "///A/42/OG1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 9, "atom1_serNum": 92, "atom2_serNum": 308, "donAcc_type": "standard", "distance": 2.940, "atom1_id": "///A/11/O", "atom2_id": "///A/42/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 10, "atom1_serNum": 92, "atom2_serNum": 313, "donAcc_type": "acceptable", "distance": 2.707, "atom1_id": "///A/11/O", "atom2_id": "///A/42/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 11, "atom1_serNum": 96, "atom2_serNum": 1535, "donAcc_type": "standard", "distance": 3.117, "atom1_id": "///A/12/N", "atom2_id": "///A/202/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 12, "atom1_serNum": 102, "atom2_serNum": 160, "donAcc_type": "acceptable", "distance": 2.508, "atom1_id": "///A/12/ND1", "atom2_id": "///A/19/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 13, "atom1_serNum": 105, "atom2_serNum": 311, "donAcc_type": "standard", "distance": 3.061, "atom1_id": "///A/12/NE2", "atom2_id": "///A/42/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 14, "atom1_serNum": 105, "atom2_serNum": 505, "donAcc_type": "standard", "distance": 2.728, "atom1_id": "///A/12/NE2", "atom2_id": "///A/69/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 15, "atom1_serNum": 106, "atom2_serNum": 321, "donAcc_type": "standard", "distance": 2.723, "atom1_id": "///A/13/N", "atom2_id": "///A/43/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 16, "atom1_serNum": 109, "atom2_serNum": 132, "donAcc_type": "standard", "distance": 3.307, "atom1_id": "///A/13/O", "atom2_id": "///A/16/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 17, "atom1_serNum": 109, "atom2_serNum": 157, "donAcc_type": "questionable", "distance": 3.353, "atom1_id": "///A/13/O", "atom2_id": "///A/19/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 18, "atom1_serNum": 111, "atom2_serNum": 120, "donAcc_type": "acceptable", "distance": 2.991, "atom1_id": "///A/13/OG", "atom2_id": "///A/15/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 19, "atom1_serNum": 111, "atom2_serNum": 321, "donAcc_type": "acceptable", "distance": 2.582, "atom1_id": "///A/13/OG", "atom2_id": "///A/43/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 20, "atom1_serNum": 111, "atom2_serNum": 322, "donAcc_type": "acceptable", "distance": 2.889, "atom1_id": "///A/13/OG", "atom2_id": "///A/43/OD2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 21, "atom1_serNum": 112, "atom2_serNum": 118, "donAcc_type": "standard", "distance": 2.820, "atom1_id": "///A/14/N", "atom2_id": "///A/14/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 22, "atom1_serNum": 115, "atom2_serNum": 138, "donAcc_type": "standard", "distance": 3.102, "atom1_id": "///A/14/O", "atom2_id": "///A/17/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 23, "atom1_serNum": 115, "atom2_serNum": 1658, "donAcc_type": "standard", "distance": 3.378, "atom1_id": "///A/14/O", "atom2_id": "///A/216/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 24, "atom1_serNum": 119, "atom2_serNum": 187, "donAcc_type": "standard", "distance": 3.677, "atom1_id": "///A/14/OD2", "atom2_id": "///A/23/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 25, "atom1_serNum": 119, "atom2_serNum": 3965, "donAcc_type": "standard", "distance": 3.280, "atom1_id": "///A/14/OD2", "atom2_id": "///A/505/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 26, "atom1_serNum": 123, "atom2_serNum": 348, "donAcc_type": "standard", "distance": 2.782, "atom1_id": "///A/15/O", "atom2_id": "///A/46/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 27, "atom1_serNum": 131, "atom2_serNum": 390, "donAcc_type": "acceptable", "distance": 3.530, "atom1_id": "///A/15/OH", "atom2_id": "///A/52/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 28, "atom1_serNum": 135, "atom2_serNum": 146, "donAcc_type": "standard", "distance": 2.651, "atom1_id": "///A/16/O", "atom2_id": "///A/18/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 29, "atom1_serNum": 137, "atom2_serNum": 321, "donAcc_type": "acceptable", "distance": 3.375, "atom1_id": "///A/16/OG", "atom2_id": "///A/43/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 30, "atom1_serNum": 137, "atom2_serNum": 323, "donAcc_type": "acceptable", "distance": 2.566, "atom1_id": "///A/16/OG", "atom2_id": "///A/44/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 31, "atom1_serNum": 161, "atom2_serNum": 1807, "donAcc_type": "acceptable", "distance": 3.342, "atom1_id": "///A/19/OD2", "atom2_id": "///A/234/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 32, "atom1_serNum": 165, "atom2_serNum": 1630, "donAcc_type": "standard", "distance": 3.019, "atom1_id": "///A/20/O", "atom2_id": "///A/213/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 33, "atom1_serNum": 165, "atom2_serNum": 1655, "donAcc_type": "standard", "distance": 3.237, "atom1_id": "///A/20/O", "atom2_id": "///A/216/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 34, "atom1_serNum": 166, "atom2_serNum": 1542, "donAcc_type": "standard", "distance": 3.251, "atom1_id": "///A/21/N", "atom2_id": "///A/203/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 35, "atom1_serNum": 182, "atom2_serNum": 207, "donAcc_type": "standard", "distance": 3.196, "atom1_id": "///A/23/O", "atom2_id": "///A/27/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 36, "atom1_serNum": 191, "atom2_serNum": 215, "donAcc_type": "standard", "distance": 3.118, "atom1_id": "///A/24/O", "atom2_id": "///A/28/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 37, "atom1_serNum": 198, "atom2_serNum": 222, "donAcc_type": "standard", "distance": 2.879, "atom1_id": "///A/25/O", "atom2_id": "///A/29/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 38, "atom1_serNum": 203, "atom2_serNum": 231, "donAcc_type": "standard", "distance": 3.147, "atom1_id": "///A/26/O", "atom2_id": "///A/30/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 39, "atom1_serNum": 210, "atom2_serNum": 240, "donAcc_type": "standard", "distance": 3.229, "atom1_id": "///A/27/O", "atom2_id": "///A/31/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 40, "atom1_serNum": 218, "atom2_serNum": 245, "donAcc_type": "standard", "distance": 3.185, "atom1_id": "///A/28/O", "atom2_id": "///A/32/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 41, "atom1_serNum": 225, "atom2_serNum": 250, "donAcc_type": "standard", "distance": 2.932, "atom1_id": "///A/29/O", "atom2_id": "///A/33/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 42, "atom1_serNum": 234, "atom2_serNum": 255, "donAcc_type": "standard", "distance": 2.795, "atom1_id": "///A/30/O", "atom2_id": "///A/34/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 43, "atom1_serNum": 243, "atom2_serNum": 263, "donAcc_type": "standard", "distance": 3.287, "atom1_id": "///A/31/O", "atom2_id": "///A/35/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 44, "atom1_serNum": 243, "atom2_serNum": 267, "donAcc_type": "standard", "distance": 3.023, "atom1_id": "///A/31/O", "atom2_id": "///A/36/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 45, "atom1_serNum": 248, "atom2_serNum": 263, "donAcc_type": "standard", "distance": 2.805, "atom1_id": "///A/32/O", "atom2_id": "///A/35/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 46, "atom1_serNum": 278, "atom2_serNum": 458, "donAcc_type": "standard", "distance": 3.792, "atom1_id": "///A/37/O", "atom2_id": "///A/63/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 47, "atom1_serNum": 311, "atom2_serNum": 313, "donAcc_type": "acceptable", "distance": 2.728, "atom1_id": "///A/42/O", "atom2_id": "///A/42/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 48, "atom1_serNum": 318, "atom2_serNum": 334, "donAcc_type": "standard", "distance": 3.134, "atom1_id": "///A/43/O", "atom2_id": "///A/45/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 49, "atom1_serNum": 318, "atom2_serNum": 498, "donAcc_type": "standard", "distance": 3.095, "atom1_id": "///A/43/O", "atom2_id": "///A/69/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 50, "atom1_serNum": 334, "atom2_serNum": 501, "donAcc_type": "standard", "distance": 2.664, "atom1_id": "///A/45/N", "atom2_id": "///A/69/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 51, "atom1_serNum": 337, "atom2_serNum": 4232, "donAcc_type": "standard", "distance": 3.718, "atom1_id": "///A/45/O", "atom2_id": "///A/540/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 52, "atom1_serNum": 339, "atom2_serNum": 501, "donAcc_type": "acceptable", "distance": 2.678, "atom1_id": "///A/45/OG1", "atom2_id": "///A/69/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 53, "atom1_serNum": 347, "atom2_serNum": 357, "donAcc_type": "standard", "distance": 3.205, "atom1_id": "///A/46/OD1", "atom2_id": "///A/48/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 54, "atom1_serNum": 349, "atom2_serNum": 4231, "donAcc_type": "standard", "distance": 3.518, "atom1_id": "///A/47/N", "atom2_id": "///A/540/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 55, "atom1_serNum": 352, "atom2_serNum": 367, "donAcc_type": "standard", "distance": 3.047, "atom1_id": "///A/47/O", "atom2_id": "///A/50/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 56, "atom1_serNum": 366, "atom2_serNum": 391, "donAcc_type": "standard", "distance": 2.812, "atom1_id": "///A/49/O", "atom2_id": "///A/53/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 57, "atom1_serNum": 370, "atom2_serNum": 402, "donAcc_type": "standard", "distance": 2.870, "atom1_id": "///A/50/O", "atom2_id": "///A/54/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 58, "atom1_serNum": 378, "atom2_serNum": 414, "donAcc_type": "standard", "distance": 3.139, "atom1_id": "///A/51/O", "atom2_id": "///A/55/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 59, "atom1_serNum": 385, "atom2_serNum": 418, "donAcc_type": "standard", "distance": 2.960, "atom1_id": "///A/52/O", "atom2_id": "///A/56/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 60, "atom1_serNum": 394, "atom2_serNum": 423, "donAcc_type": "standard", "distance": 2.789, "atom1_id": "///A/53/O", "atom2_id": "///A/57/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 61, "atom1_serNum": 405, "atom2_serNum": 427, "donAcc_type": "standard", "distance": 3.098, "atom1_id": "///A/54/O", "atom2_id": "///A/58/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 62, "atom1_serNum": 413, "atom2_serNum": 2092, "donAcc_type": "acceptable", "distance": 3.634, "atom1_id": "///A/54/OH", "atom2_id": "///A/271/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 63, "atom1_serNum": 417, "atom2_serNum": 437, "donAcc_type": "standard", "distance": 3.278, "atom1_id": "///A/55/O", "atom2_id": "///A/59/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 64, "atom1_serNum": 421, "atom2_serNum": 441, "donAcc_type": "standard", "distance": 3.109, "atom1_id": "///A/56/O", "atom2_id": "///A/60/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 65, "atom1_serNum": 426, "atom2_serNum": 446, "donAcc_type": "standard", "distance": 3.035, "atom1_id": "///A/57/O", "atom2_id": "///A/61/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 66, "atom1_serNum": 426, "atom2_serNum": 450, "donAcc_type": "standard", "distance": 2.675, "atom1_id": "///A/57/O", "atom2_id": "///A/62/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 67, "atom1_serNum": 466, "atom2_serNum": 2042, "donAcc_type": "standard", "distance": 2.721, "atom1_id": "///A/63/NZ", "atom2_id": "///A/264/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 68, "atom1_serNum": 466, "atom2_serNum": 2067, "donAcc_type": "standard", "distance": 2.671, "atom1_id": "///A/63/NZ", "atom2_id": "///A/267/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 69, "atom1_serNum": 466, "atom2_serNum": 2076, "donAcc_type": "standard", "distance": 2.526, "atom1_id": "///A/63/NZ", "atom2_id": "///A/268/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 70, "atom1_serNum": 466, "atom2_serNum": 16284, "donAcc_type": "acceptable", "distance": 3.583, "atom1_id": "///A/63/NZ", "atom2_id": "///D/225/ND1", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 71, "atom1_serNum": 485, "atom2_serNum": 647, "donAcc_type": "standard", "distance": 3.027, "atom1_id": "///A/66/O", "atom2_id": "///A/88/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 72, "atom1_serNum": 493, "atom2_serNum": 635, "donAcc_type": "standard", "distance": 3.258, "atom1_id": "///A/68/N", "atom2_id": "///A/86/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 73, "atom1_serNum": 496, "atom2_serNum": 632, "donAcc_type": "standard", "distance": 3.339, "atom1_id": "///A/68/O", "atom2_id": "///A/86/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 74, "atom1_serNum": 504, "atom2_serNum": 630, "donAcc_type": "acceptable", "distance": 2.979, "atom1_id": "///A/69/OD1", "atom2_id": "///A/85/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 75, "atom1_serNum": 506, "atom2_serNum": 620, "donAcc_type": "standard", "distance": 2.791, "atom1_id": "///A/70/N", "atom2_id": "///A/84/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 76, "atom1_serNum": 509, "atom2_serNum": 617, "donAcc_type": "standard", "distance": 2.835, "atom1_id": "///A/70/O", "atom2_id": "///A/84/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 77, "atom1_serNum": 520, "atom2_serNum": 853, "donAcc_type": "standard", "distance": 3.355, "atom1_id": "///A/71/O", "atom2_id": "///A/116/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 78, "atom1_serNum": 525, "atom2_serNum": 603, "donAcc_type": "standard", "distance": 2.825, "atom1_id": "///A/72/N", "atom2_id": "///A/82/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 79, "atom1_serNum": 528, "atom2_serNum": 600, "donAcc_type": "standard", "distance": 3.347, "atom1_id": "///A/72/O", "atom2_id": "///A/82/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 80, "atom1_serNum": 532, "atom2_serNum": 856, "donAcc_type": "standard", "distance": 2.614, "atom1_id": "///A/73/N", "atom2_id": "///A/116/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 81, "atom1_serNum": 535, "atom2_serNum": 869, "donAcc_type": "standard", "distance": 3.558, "atom1_id": "///A/73/O", "atom2_id": "///A/118/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 82, "atom1_serNum": 544, "atom2_serNum": 574, "donAcc_type": "questionable", "distance": 3.302, "atom1_id": "///A/74/O", "atom2_id": "///A/78/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 83, "atom1_serNum": 554, "atom2_serNum": 879, "donAcc_type": "standard", "distance": 3.229, "atom1_id": "///A/75/OD2", "atom2_id": "///A/118/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 84, "atom1_serNum": 566, "atom2_serNum": 575, "donAcc_type": "standard", "distance": 3.285, "atom1_id": "///A/77/O", "atom2_id": "///A/79/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 85, "atom1_serNum": 566, "atom2_serNum": 583, "donAcc_type": "standard", "distance": 3.424, "atom1_id": "///A/77/O", "atom2_id": "///A/80/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 86, "atom1_serNum": 591, "atom2_serNum": 1053, "donAcc_type": "standard", "distance": 3.765, "atom1_id": "///A/80/OE2", "atom2_id": "///A/141/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 87, "atom1_serNum": 607, "atom2_serNum": 1016, "donAcc_type": "standard", "distance": 3.276, "atom1_id": "///A/83/N", "atom2_id": "///A/136/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 88, "atom1_serNum": 628, "atom2_serNum": 980, "donAcc_type": "standard", "distance": 2.696, "atom1_id": "///A/85/O", "atom2_id": "///A/131/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 89, "atom1_serNum": 639, "atom2_serNum": 967, "donAcc_type": "standard", "distance": 2.504, "atom1_id": "///A/87/N", "atom2_id": "///A/129/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 90, "atom1_serNum": 642, "atom2_serNum": 964, "donAcc_type": "standard", "distance": 2.490, "atom1_id": "///A/87/O", "atom2_id": "///A/129/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 91, "atom1_serNum": 652, "atom2_serNum": 955, "donAcc_type": "standard", "distance": 2.528, "atom1_id": "///A/89/N", "atom2_id": "///A/127/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 92, "atom1_serNum": 655, "atom2_serNum": 2070, "donAcc_type": "standard", "distance": 2.608, "atom1_id": "///A/89/O", "atom2_id": "///A/268/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 93, "atom1_serNum": 657, "atom2_serNum": 955, "donAcc_type": "standard", "distance": 3.475, "atom1_id": "///A/90/N", "atom2_id": "///A/127/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 94, "atom1_serNum": 660, "atom2_serNum": 684, "donAcc_type": "standard", "distance": 2.920, "atom1_id": "///A/90/O", "atom2_id": "///A/94/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 95, "atom1_serNum": 664, "atom2_serNum": 673, "donAcc_type": "questionable", "distance": 3.112, "atom1_id": "///A/90/ND2", "atom2_id": "///A/92/N", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 96, "atom1_serNum": 664, "atom2_serNum": 680, "donAcc_type": "questionable", "distance": 3.089, "atom1_id": "///A/90/ND2", "atom2_id": "///A/93/N", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 97, "atom1_serNum": 668, "atom2_serNum": 696, "donAcc_type": "standard", "distance": 3.243, "atom1_id": "///A/91/O", "atom2_id": "///A/95/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 98, "atom1_serNum": 671, "atom2_serNum": 2085, "donAcc_type": "standard", "distance": 2.983, "atom1_id": "///A/91/OD1", "atom2_id": "///A/270/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 99, "atom1_serNum": 672, "atom2_serNum": 2088, "donAcc_type": "standard", "distance": 2.818, "atom1_id": "///A/91/ND2", "atom2_id": "///A/270/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 100, "atom1_serNum": 676, "atom2_serNum": 705, "donAcc_type": "standard", "distance": 3.045, "atom1_id": "///A/92/O", "atom2_id": "///A/96/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 101, "atom1_serNum": 683, "atom2_serNum": 713, "donAcc_type": "standard", "distance": 2.688, "atom1_id": "///A/93/O", "atom2_id": "///A/97/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 102, "atom1_serNum": 687, "atom2_serNum": 721, "donAcc_type": "standard", "distance": 2.897, "atom1_id": "///A/94/O", "atom2_id": "///A/98/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 103, "atom1_serNum": 687, "atom2_serNum": 726, "donAcc_type": "acceptable", "distance": 2.787, "atom1_id": "///A/94/O", "atom2_id": "///A/98/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 104, "atom1_serNum": 695, "atom2_serNum": 4108, "donAcc_type": "acceptable", "distance": 3.279, "atom1_id": "///A/94/OH", "atom2_id": "///A/525/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 105, "atom1_serNum": 699, "atom2_serNum": 728, "donAcc_type": "standard", "distance": 3.030, "atom1_id": "///A/95/O", "atom2_id": "///A/99/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 106, "atom1_serNum": 704, "atom2_serNum": 4100, "donAcc_type": "standard", "distance": 3.487, "atom1_id": "///A/95/NE2", "atom2_id": "///A/524/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 107, "atom1_serNum": 708, "atom2_serNum": 736, "donAcc_type": "standard", "distance": 2.906, "atom1_id": "///A/96/O", "atom2_id": "///A/100/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 108, "atom1_serNum": 712, "atom2_serNum": 946, "donAcc_type": "standard", "distance": 2.766, "atom1_id": "///A/96/ND2", "atom2_id": "///A/126/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 109, "atom1_serNum": 716, "atom2_serNum": 744, "donAcc_type": "standard", "distance": 3.121, "atom1_id": "///A/97/O", "atom2_id": "///A/101/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 110, "atom1_serNum": 724, "atom2_serNum": 752, "donAcc_type": "standard", "distance": 3.224, "atom1_id": "///A/98/O", "atom2_id": "///A/102/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 111, "atom1_serNum": 724, "atom2_serNum": 757, "donAcc_type": "acceptable", "distance": 2.720, "atom1_id": "///A/98/O", "atom2_id": "///A/102/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 112, "atom1_serNum": 731, "atom2_serNum": 758, "donAcc_type": "standard", "distance": 2.977, "atom1_id": "///A/99/O", "atom2_id": "///A/103/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 113, "atom1_serNum": 739, "atom2_serNum": 767, "donAcc_type": "standard", "distance": 3.104, "atom1_id": "///A/100/O", "atom2_id": "///A/104/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 114, "atom1_serNum": 747, "atom2_serNum": 772, "donAcc_type": "standard", "distance": 3.277, "atom1_id": "///A/101/O", "atom2_id": "///A/105/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 115, "atom1_serNum": 755, "atom2_serNum": 784, "donAcc_type": "standard", "distance": 2.920, "atom1_id": "///A/102/O", "atom2_id": "///A/106/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 116, "atom1_serNum": 761, "atom2_serNum": 793, "donAcc_type": "standard", "distance": 3.053, "atom1_id": "///A/103/O", "atom2_id": "///A/107/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 117, "atom1_serNum": 783, "atom2_serNum": 4232, "donAcc_type": "acceptable", "distance": 3.677, "atom1_id": "///A/105/OH", "atom2_id": "///A/540/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 118, "atom1_serNum": 803, "atom2_serNum": 867, "donAcc_type": "standard", "distance": 3.304, "atom1_id": "///A/107/NH2", "atom2_id": "///A/117/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 119, "atom1_serNum": 808, "atom2_serNum": 4165, "donAcc_type": "standard", "distance": 3.607, "atom1_id": "///A/109/N", "atom2_id": "///A/532/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 120, "atom1_serNum": 819, "atom2_serNum": 4151, "donAcc_type": "acceptable", "distance": 2.086, "atom1_id": "///A/109/OH", "atom2_id": "///A/530/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 121, "atom1_serNum": 823, "atom2_serNum": 834, "donAcc_type": "standard", "distance": 3.081, "atom1_id": "///A/110/O", "atom2_id": "///A/113/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 122, "atom1_serNum": 864, "atom2_serNum": 888, "donAcc_type": "standard", "distance": 3.047, "atom1_id": "///A/117/O", "atom2_id": "///A/120/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 123, "atom1_serNum": 872, "atom2_serNum": 902, "donAcc_type": "standard", "distance": 3.069, "atom1_id": "///A/118/O", "atom2_id": "///A/121/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 124, "atom1_serNum": 876, "atom2_serNum": 886, "donAcc_type": "standard", "distance": 3.027, "atom1_id": "///A/118/NE", "atom2_id": "///A/119/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 125, "atom1_serNum": 879, "atom2_serNum": 886, "donAcc_type": "standard", "distance": 3.047, "atom1_id": "///A/118/NH2", "atom2_id": "///A/119/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 126, "atom1_serNum": 883, "atom2_serNum": 910, "donAcc_type": "standard", "distance": 3.027, "atom1_id": "///A/119/O", "atom2_id": "///A/122/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 127, "atom1_serNum": 891, "atom2_serNum": 927, "donAcc_type": "standard", "distance": 3.058, "atom1_id": "///A/120/O", "atom2_id": "///A/124/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 128, "atom1_serNum": 905, "atom2_serNum": 941, "donAcc_type": "questionable", "distance": 3.148, "atom1_id": "///A/121/O", "atom2_id": "///A/125/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 129, "atom1_serNum": 938, "atom2_serNum": 956, "donAcc_type": "standard", "distance": 3.427, "atom1_id": "///A/125/O", "atom2_id": "///A/128/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 130, "atom1_serNum": 938, "atom2_serNum": 1248, "donAcc_type": "standard", "distance": 2.826, "atom1_id": "///A/125/O", "atom2_id": "///A/165/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 131, "atom1_serNum": 941, "atom2_serNum": 1205, "donAcc_type": "questionable", "distance": 2.865, "atom1_id": "///A/125/OD1", "atom2_id": "///A/161/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 132, "atom1_serNum": 959, "atom2_serNum": 1245, "donAcc_type": "standard", "distance": 3.437, "atom1_id": "///A/128/O", "atom2_id": "///A/165/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 133, "atom1_serNum": 972, "atom2_serNum": 1241, "donAcc_type": "standard", "distance": 3.489, "atom1_id": "///A/130/N", "atom2_id": "///A/165/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 134, "atom1_serNum": 975, "atom2_serNum": 1261, "donAcc_type": "standard", "distance": 3.475, "atom1_id": "///A/130/O", "atom2_id": "///A/167/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 135, "atom1_serNum": 988, "atom2_serNum": 1264, "donAcc_type": "standard", "distance": 2.997, "atom1_id": "///A/132/N", "atom2_id": "///A/167/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 136, "atom1_serNum": 993, "atom2_serNum": 998, "donAcc_type": "acceptable", "distance": 3.450, "atom1_id": "///A/132/OG", "atom2_id": "///A/134/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 137, "atom1_serNum": 993, "atom2_serNum": 1280, "donAcc_type": "acceptable", "distance": 2.737, "atom1_id": "///A/132/OG", "atom2_id": "///A/169/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 138, "atom1_serNum": 994, "atom2_serNum": 1287, "donAcc_type": "standard", "distance": 3.807, "atom1_id": "///A/133/N", "atom2_id": "///A/169/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 139, "atom1_serNum": 997, "atom2_serNum": 1013, "donAcc_type": "standard", "distance": 3.553, "atom1_id": "///A/133/O", "atom2_id": "///A/136/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 140, "atom1_serNum": 1001, "atom2_serNum": 1021, "donAcc_type": "standard", "distance": 3.142, "atom1_id": "///A/134/O", "atom2_id": "///A/137/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 141, "atom1_serNum": 1005, "atom2_serNum": 1051, "donAcc_type": "standard", "distance": 3.686, "atom1_id": "///A/135/O", "atom2_id": "///A/141/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 142, "atom1_serNum": 1011, "atom2_serNum": 1341, "donAcc_type": "standard", "distance": 3.255, "atom1_id": "///A/135/NH1", "atom2_id": "///A/176/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 143, "atom1_serNum": 1024, "atom2_serNum": 1044, "donAcc_type": "standard", "distance": 2.929, "atom1_id": "///A/137/O", "atom2_id": "///A/141/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 144, "atom1_serNum": 1028, "atom2_serNum": 1055, "donAcc_type": "standard", "distance": 3.191, "atom1_id": "///A/138/O", "atom2_id": "///A/142/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 145, "atom1_serNum": 1028, "atom2_serNum": 1060, "donAcc_type": "acceptable", "distance": 2.728, "atom1_id": "///A/138/O", "atom2_id": "///A/142/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 146, "atom1_serNum": 1036, "atom2_serNum": 1061, "donAcc_type": "standard", "distance": 2.763, "atom1_id": "///A/139/O", "atom2_id": "///A/143/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 147, "atom1_serNum": 1043, "atom2_serNum": 1069, "donAcc_type": "standard", "distance": 2.962, "atom1_id": "///A/140/O", "atom2_id": "///A/144/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 148, "atom1_serNum": 1047, "atom2_serNum": 1077, "donAcc_type": "standard", "distance": 3.024, "atom1_id": "///A/141/O", "atom2_id": "///A/145/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 149, "atom1_serNum": 1058, "atom2_serNum": 1088, "donAcc_type": "standard", "distance": 3.132, "atom1_id": "///A/142/O", "atom2_id": "///A/146/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 150, "atom1_serNum": 1058, "atom2_serNum": 1092, "donAcc_type": "standard", "distance": 3.319, "atom1_id": "///A/142/O", "atom2_id": "///A/147/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 151, "atom1_serNum": 1095, "atom2_serNum": 1119, "donAcc_type": "standard", "distance": 2.973, "atom1_id": "///A/147/O", "atom2_id": "///A/151/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 152, "atom1_serNum": 1103, "atom2_serNum": 1126, "donAcc_type": "standard", "distance": 3.050, "atom1_id": "///A/148/O", "atom2_id": "///A/152/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 153, "atom1_serNum": 1109, "atom2_serNum": 1134, "donAcc_type": "standard", "distance": 3.012, "atom1_id": "///A/149/O", "atom2_id": "///A/153/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 154, "atom1_serNum": 1114, "atom2_serNum": 1143, "donAcc_type": "standard", "distance": 3.052, "atom1_id": "///A/150/O", "atom2_id": "///A/154/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 155, "atom1_serNum": 1122, "atom2_serNum": 1149, "donAcc_type": "standard", "distance": 3.086, "atom1_id": "///A/151/O", "atom2_id": "///A/155/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 156, "atom1_serNum": 1129, "atom2_serNum": 1156, "donAcc_type": "standard", "distance": 3.073, "atom1_id": "///A/152/O", "atom2_id": "///A/156/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 157, "atom1_serNum": 1152, "atom2_serNum": 1172, "donAcc_type": "standard", "distance": 2.713, "atom1_id": "///A/155/O", "atom2_id": "///A/158/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 158, "atom1_serNum": 1152, "atom2_serNum": 1184, "donAcc_type": "standard", "distance": 3.036, "atom1_id": "///A/155/O", "atom2_id": "///A/159/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 159, "atom1_serNum": 1159, "atom2_serNum": 1193, "donAcc_type": "standard", "distance": 3.012, "atom1_id": "///A/156/O", "atom2_id": "///A/160/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 160, "atom1_serNum": 1164, "atom2_serNum": 1202, "donAcc_type": "standard", "distance": 2.979, "atom1_id": "///A/157/O", "atom2_id": "///A/161/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 161, "atom1_serNum": 1164, "atom2_serNum": 1208, "donAcc_type": "acceptable", "distance": 3.198, "atom1_id": "///A/157/O", "atom2_id": "///A/161/ND1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 162, "atom1_serNum": 1175, "atom2_serNum": 1212, "donAcc_type": "standard", "distance": 2.846, "atom1_id": "///A/158/O", "atom2_id": "///A/162/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 163, "atom1_serNum": 1215, "atom2_serNum": 1238, "donAcc_type": "standard", "distance": 2.953, "atom1_id": "///A/162/O", "atom2_id": "///A/165/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 164, "atom1_serNum": 1233, "atom2_serNum": 2062, "donAcc_type": "standard", "distance": 2.674, "atom1_id": "///A/164/O", "atom2_id": "///A/266/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 165, "atom1_serNum": 1237, "atom2_serNum": 16196, "donAcc_type": "standard", "distance": 3.905, "atom1_id": "///A/164/OD2", "atom2_id": "///D/213/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 166, "atom1_serNum": 1252, "atom2_serNum": 1486, "donAcc_type": "questionable", "distance": 3.331, "atom1_id": "///A/166/O", "atom2_id": "///A/195/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 167, "atom1_serNum": 1272, "atom2_serNum": 1486, "donAcc_type": "standard", "distance": 3.134, "atom1_id": "///A/168/N", "atom2_id": "///A/195/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 168, "atom1_serNum": 1275, "atom2_serNum": 1497, "donAcc_type": "standard", "distance": 3.310, "atom1_id": "///A/168/O", "atom2_id": "///A/197/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 169, "atom1_serNum": 1283, "atom2_serNum": 1388, "donAcc_type": "acceptable", "distance": 2.620, "atom1_id": "///A/169/O", "atom2_id": "///A/181/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 170, "atom1_serNum": 1289, "atom2_serNum": 1500, "donAcc_type": "standard", "distance": 3.645, "atom1_id": "///A/170/N", "atom2_id": "///A/197/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 171, "atom1_serNum": 1308, "atom2_serNum": 1868, "donAcc_type": "standard", "distance": 3.947, "atom1_id": "///A/172/O", "atom2_id": "///A/241/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 172, "atom1_serNum": 1312, "atom2_serNum": 1369, "donAcc_type": "standard", "distance": 3.723, "atom1_id": "///A/172/NE", "atom2_id": "///A/179/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 173, "atom1_serNum": 1315, "atom2_serNum": 1370, "donAcc_type": "standard", "distance": 3.723, "atom1_id": "///A/172/NH2", "atom2_id": "///A/179/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 174, "atom1_serNum": 1316, "atom2_serNum": 1360, "donAcc_type": "standard", "distance": 3.123, "atom1_id": "///A/173/N", "atom2_id": "///A/178/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 175, "atom1_serNum": 1319, "atom2_serNum": 1813, "donAcc_type": "acceptable", "distance": 3.306, "atom1_id": "///A/173/O", "atom2_id": "///A/235/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 176, "atom1_serNum": 1321, "atom2_serNum": 1334, "donAcc_type": "acceptable", "distance": 2.838, "atom1_id": "///A/173/OG1", "atom2_id": "///A/175/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 177, "atom1_serNum": 1321, "atom2_serNum": 1337, "donAcc_type": "acceptable", "distance": 2.936, "atom1_id": "///A/173/OG1", "atom2_id": "///A/175/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 178, "atom1_serNum": 1321, "atom2_serNum": 1360, "donAcc_type": "acceptable", "distance": 3.094, "atom1_id": "///A/173/OG1", "atom2_id": "///A/178/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 179, "atom1_serNum": 1321, "atom2_serNum": 1361, "donAcc_type": "acceptable", "distance": 2.933, "atom1_id": "///A/173/OG1", "atom2_id": "///A/178/OE2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 180, "atom1_serNum": 1323, "atom2_serNum": 1360, "donAcc_type": "standard", "distance": 3.185, "atom1_id": "///A/174/N", "atom2_id": "///A/178/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 181, "atom1_serNum": 1327, "atom2_serNum": 1360, "donAcc_type": "standard", "distance": 3.041, "atom1_id": "///A/175/N", "atom2_id": "///A/178/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 182, "atom1_serNum": 1330, "atom2_serNum": 1353, "donAcc_type": "standard", "distance": 3.286, "atom1_id": "///A/175/O", "atom2_id": "///A/178/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 183, "atom1_serNum": 1336, "atom2_serNum": 1791, "donAcc_type": "standard", "distance": 3.250, "atom1_id": "///A/175/NH1", "atom2_id": "///A/233/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 184, "atom1_serNum": 1348, "atom2_serNum": 1377, "donAcc_type": "standard", "distance": 2.966, "atom1_id": "///A/177/O", "atom2_id": "///A/181/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 185, "atom1_serNum": 1356, "atom2_serNum": 1389, "donAcc_type": "standard", "distance": 2.882, "atom1_id": "///A/178/O", "atom2_id": "///A/182/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 186, "atom1_serNum": 1365, "atom2_serNum": 1397, "donAcc_type": "standard", "distance": 2.889, "atom1_id": "///A/179/O", "atom2_id": "///A/183/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 187, "atom1_serNum": 1374, "atom2_serNum": 1407, "donAcc_type": "standard", "distance": 3.199, "atom1_id": "///A/180/O", "atom2_id": "///A/184/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 188, "atom1_serNum": 1380, "atom2_serNum": 1412, "donAcc_type": "standard", "distance": 2.707, "atom1_id": "///A/181/O", "atom2_id": "///A/185/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 189, "atom1_serNum": 1392, "atom2_serNum": 1417, "donAcc_type": "standard", "distance": 2.930, "atom1_id": "///A/182/O", "atom2_id": "///A/186/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 190, "atom1_serNum": 1400, "atom2_serNum": 1424, "donAcc_type": "standard", "distance": 3.319, "atom1_id": "///A/183/O", "atom2_id": "///A/187/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 191, "atom1_serNum": 1410, "atom2_serNum": 1433, "donAcc_type": "standard", "distance": 3.074, "atom1_id": "///A/184/O", "atom2_id": "///A/188/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 192, "atom1_serNum": 1415, "atom2_serNum": 1441, "donAcc_type": "standard", "distance": 2.792, "atom1_id": "///A/185/O", "atom2_id": "///A/189/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 193, "atom1_serNum": 1420, "atom2_serNum": 1446, "donAcc_type": "standard", "distance": 3.152, "atom1_id": "///A/186/O", "atom2_id": "///A/190/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 194, "atom1_serNum": 1427, "atom2_serNum": 1455, "donAcc_type": "standard", "distance": 3.019, "atom1_id": "///A/187/O", "atom2_id": "///A/191/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 195, "atom1_serNum": 1436, "atom2_serNum": 1460, "donAcc_type": "standard", "distance": 2.934, "atom1_id": "///A/188/O", "atom2_id": "///A/192/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 196, "atom1_serNum": 1444, "atom2_serNum": 1471, "donAcc_type": "standard", "distance": 3.145, "atom1_id": "///A/189/O", "atom2_id": "///A/193/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 197, "atom1_serNum": 1444, "atom2_serNum": 1475, "donAcc_type": "standard", "distance": 3.482, "atom1_id": "///A/189/O", "atom2_id": "///A/194/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 198, "atom1_serNum": 1453, "atom2_serNum": 16168, "donAcc_type": "acceptable", "distance": 3.349, "atom1_id": "///A/190/OE1", "atom2_id": "///D/210/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 199, "atom1_serNum": 1493, "atom2_serNum": 2007, "donAcc_type": "standard", "distance": 2.606, "atom1_id": "///A/196/O", "atom2_id": "///A/259/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 200, "atom1_serNum": 1504, "atom2_serNum": 1985, "donAcc_type": "standard", "distance": 3.596, "atom1_id": "///A/198/N", "atom2_id": "///A/256/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 201, "atom1_serNum": 1514, "atom2_serNum": 1524, "donAcc_type": "acceptable", "distance": 3.494, "atom1_id": "///A/199/OG1", "atom2_id": "///A/201/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 202, "atom1_serNum": 1522, "atom2_serNum": 1868, "donAcc_type": "standard", "distance": 3.198, "atom1_id": "///A/200/OD1", "atom2_id": "///A/241/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 203, "atom1_serNum": 1523, "atom2_serNum": 1824, "donAcc_type": "standard", "distance": 3.004, "atom1_id": "///A/200/ND2", "atom2_id": "///A/237/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 204, "atom1_serNum": 1523, "atom2_serNum": 1842, "donAcc_type": "standard", "distance": 3.419, "atom1_id": "///A/200/ND2", "atom2_id": "///A/239/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 205, "atom1_serNum": 1527, "atom2_serNum": 1837, "donAcc_type": "questionable", "distance": 2.926, "atom1_id": "///A/201/O", "atom2_id": "///A/238/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 206, "atom1_serNum": 1530, "atom2_serNum": 1548, "donAcc_type": "standard", "distance": 2.743, "atom1_id": "///A/201/OD1", "atom2_id": "///A/203/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 207, "atom1_serNum": 1530, "atom2_serNum": 1549, "donAcc_type": "standard", "distance": 2.845, "atom1_id": "///A/201/OD1", "atom2_id": "///A/203/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 208, "atom1_serNum": 1535, "atom2_serNum": 1548, "donAcc_type": "standard", "distance": 3.118, "atom1_id": "///A/202/O", "atom2_id": "///A/203/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 209, "atom1_serNum": 1539, "atom2_serNum": 1833, "donAcc_type": "standard", "distance": 2.927, "atom1_id": "///A/203/N", "atom2_id": "///A/238/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 210, "atom1_serNum": 1550, "atom2_serNum": 1833, "donAcc_type": "standard", "distance": 3.345, "atom1_id": "///A/204/N", "atom2_id": "///A/238/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 211, "atom1_serNum": 1553, "atom2_serNum": 1851, "donAcc_type": "standard", "distance": 3.042, "atom1_id": "///A/204/O", "atom2_id": "///A/240/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 212, "atom1_serNum": 1561, "atom2_serNum": 1596, "donAcc_type": "standard", "distance": 3.673, "atom1_id": "///A/205/N", "atom2_id": "///A/209/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 213, "atom1_serNum": 1564, "atom2_serNum": 1851, "donAcc_type": "standard", "distance": 2.907, "atom1_id": "///A/205/O", "atom2_id": "///A/240/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 214, "atom1_serNum": 1569, "atom2_serNum": 1596, "donAcc_type": "standard", "distance": 3.229, "atom1_id": "///A/206/N", "atom2_id": "///A/209/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 215, "atom1_serNum": 1572, "atom2_serNum": 1589, "donAcc_type": "standard", "distance": 2.828, "atom1_id": "///A/206/O", "atom2_id": "///A/209/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 216, "atom1_serNum": 1580, "atom2_serNum": 1597, "donAcc_type": "standard", "distance": 3.369, "atom1_id": "///A/207/O", "atom2_id": "///A/210/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 217, "atom1_serNum": 1582, "atom2_serNum": 1817, "donAcc_type": "acceptable", "distance": 2.842, "atom1_id": "///A/207/OG", "atom2_id": "///A/236/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 218, "atom1_serNum": 1592, "atom2_serNum": 1621, "donAcc_type": "standard", "distance": 3.099, "atom1_id": "///A/209/O", "atom2_id": "///A/213/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 219, "atom1_serNum": 1600, "atom2_serNum": 1631, "donAcc_type": "standard", "distance": 2.936, "atom1_id": "///A/210/O", "atom2_id": "///A/214/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 220, "atom1_serNum": 1611, "atom2_serNum": 1640, "donAcc_type": "standard", "distance": 3.173, "atom1_id": "///A/211/O", "atom2_id": "///A/215/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 221, "atom1_serNum": 1619, "atom2_serNum": 1648, "donAcc_type": "standard", "distance": 2.866, "atom1_id": "///A/212/O", "atom2_id": "///A/216/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 222, "atom1_serNum": 1624, "atom2_serNum": 1659, "donAcc_type": "standard", "distance": 2.924, "atom1_id": "///A/213/O", "atom2_id": "///A/217/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 223, "atom1_serNum": 1634, "atom2_serNum": 1666, "donAcc_type": "standard", "distance": 3.061, "atom1_id": "///A/214/O", "atom2_id": "///A/218/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 224, "atom1_serNum": 1638, "atom2_serNum": 1769, "donAcc_type": "standard", "distance": 3.447, "atom1_id": "///A/214/OE1", "atom2_id": "///A/230/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 225, "atom1_serNum": 1643, "atom2_serNum": 1671, "donAcc_type": "standard", "distance": 2.967, "atom1_id": "///A/215/O", "atom2_id": "///A/219/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 226, "atom1_serNum": 1651, "atom2_serNum": 1679, "donAcc_type": "standard", "distance": 3.301, "atom1_id": "///A/216/O", "atom2_id": "///A/220/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 227, "atom1_serNum": 1657, "atom2_serNum": 3968, "donAcc_type": "standard", "distance": 2.651, "atom1_id": "///A/216/NH1", "atom2_id": "///A/505/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 228, "atom1_serNum": 1658, "atom2_serNum": 3968, "donAcc_type": "standard", "distance": 3.103, "atom1_id": "///A/216/NH2", "atom2_id": "///A/505/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 229, "atom1_serNum": 1662, "atom2_serNum": 1689, "donAcc_type": "standard", "distance": 2.804, "atom1_id": "///A/217/O", "atom2_id": "///A/221/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 230, "atom1_serNum": 1669, "atom2_serNum": 1697, "donAcc_type": "standard", "distance": 2.807, "atom1_id": "///A/218/O", "atom2_id": "///A/222/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 231, "atom1_serNum": 1669, "atom2_serNum": 1701, "donAcc_type": "standard", "distance": 2.928, "atom1_id": "///A/218/O", "atom2_id": "///A/223/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 232, "atom1_serNum": 1674, "atom2_serNum": 3521, "donAcc_type": "standard", "distance": 3.812, "atom1_id": "///A/219/O", "atom2_id": "///A/447/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 233, "atom1_serNum": 1685, "atom2_serNum": 3975, "donAcc_type": "acceptable", "distance": 3.224, "atom1_id": "///A/220/ND1", "atom2_id": "///A/506/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 234, "atom1_serNum": 1715, "atom2_serNum": 1735, "donAcc_type": "standard", "distance": 3.063, "atom1_id": "///A/224/O", "atom2_id": "///A/227/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 235, "atom1_serNum": 1719, "atom2_serNum": 3525, "donAcc_type": "standard", "distance": 2.890, "atom1_id": "///A/225/N", "atom2_id": "///A/448/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 236, "atom1_serNum": 1722, "atom2_serNum": 1768, "donAcc_type": "standard", "distance": 3.510, "atom1_id": "///A/225/O", "atom2_id": "///A/230/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 237, "atom1_serNum": 1738, "atom2_serNum": 1759, "donAcc_type": "standard", "distance": 3.123, "atom1_id": "///A/227/O", "atom2_id": "///A/230/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 238, "atom1_serNum": 1738, "atom2_serNum": 1786, "donAcc_type": "standard", "distance": 3.743, "atom1_id": "///A/227/O", "atom2_id": "///A/232/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 239, "atom1_serNum": 1741, "atom2_serNum": 1743, "donAcc_type": "standard", "distance": 2.965, "atom1_id": "///A/227/OD1", "atom2_id": "///A/228/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 240, "atom1_serNum": 1741, "atom2_serNum": 1750, "donAcc_type": "standard", "distance": 2.903, "atom1_id": "///A/227/OD1", "atom2_id": "///A/229/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 241, "atom1_serNum": 1762, "atom2_serNum": 1786, "donAcc_type": "standard", "distance": 2.694, "atom1_id": "///A/230/O", "atom2_id": "///A/232/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 242, "atom1_serNum": 1808, "atom2_serNum": 1838, "donAcc_type": "questionable", "distance": 3.071, "atom1_id": "///A/235/N", "atom2_id": "///A/238/NE2", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 243, "atom1_serNum": 1811, "atom2_serNum": 1830, "donAcc_type": "standard", "distance": 3.282, "atom1_id": "///A/235/O", "atom2_id": "///A/238/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 244, "atom1_serNum": 1824, "atom2_serNum": 1839, "donAcc_type": "standard", "distance": 2.915, "atom1_id": "///A/237/O", "atom2_id": "///A/239/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 245, "atom1_serNum": 1829, "atom2_serNum": 1869, "donAcc_type": "questionable", "distance": 3.063, "atom1_id": "///A/237/NE2", "atom2_id": "///A/241/NH2", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 246, "atom1_serNum": 1842, "atom2_serNum": 1859, "donAcc_type": "standard", "distance": 2.853, "atom1_id": "///A/239/O", "atom2_id": "///A/241/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 247, "atom1_serNum": 1850, "atom2_serNum": 1902, "donAcc_type": "acceptable", "distance": 3.825, "atom1_id": "///A/239/OH", "atom2_id": "///A/245/OE2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 248, "atom1_serNum": 1870, "atom2_serNum": 1901, "donAcc_type": "standard", "distance": 2.798, "atom1_id": "///A/242/N", "atom2_id": "///A/245/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 249, "atom1_serNum": 1873, "atom2_serNum": 1903, "donAcc_type": "standard", "distance": 3.105, "atom1_id": "///A/242/O", "atom2_id": "///A/246/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 250, "atom1_serNum": 1875, "atom2_serNum": 1901, "donAcc_type": "acceptable", "distance": 3.177, "atom1_id": "///A/242/OG", "atom2_id": "///A/245/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 251, "atom1_serNum": 1879, "atom2_serNum": 1911, "donAcc_type": "standard", "distance": 2.834, "atom1_id": "///A/243/O", "atom2_id": "///A/247/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 252, "atom1_serNum": 1888, "atom2_serNum": 1917, "donAcc_type": "standard", "distance": 3.010, "atom1_id": "///A/244/O", "atom2_id": "///A/248/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 253, "atom1_serNum": 1893, "atom2_serNum": 1925, "donAcc_type": "questionable", "distance": 3.042, "atom1_id": "///A/244/OE2", "atom2_id": "///A/248/OE2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 254, "atom1_serNum": 1897, "atom2_serNum": 1926, "donAcc_type": "standard", "distance": 3.122, "atom1_id": "///A/245/O", "atom2_id": "///A/249/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 255, "atom1_serNum": 1906, "atom2_serNum": 1934, "donAcc_type": "standard", "distance": 3.260, "atom1_id": "///A/246/O", "atom2_id": "///A/250/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 256, "atom1_serNum": 1937, "atom2_serNum": 1958, "donAcc_type": "standard", "distance": 2.816, "atom1_id": "///A/250/O", "atom2_id": "///A/253/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 257, "atom1_serNum": 1950, "atom2_serNum": 1956, "donAcc_type": "standard", "distance": 2.700, "atom1_id": "///A/252/N", "atom2_id": "///A/252/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 258, "atom1_serNum": 1961, "atom2_serNum": 1982, "donAcc_type": "standard", "distance": 3.179, "atom1_id": "///A/253/O", "atom2_id": "///A/256/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 259, "atom1_serNum": 1969, "atom2_serNum": 1995, "donAcc_type": "standard", "distance": 3.073, "atom1_id": "///A/254/O", "atom2_id": "///A/258/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 260, "atom1_serNum": 1976, "atom2_serNum": 2000, "donAcc_type": "standard", "distance": 2.795, "atom1_id": "///A/255/O", "atom2_id": "///A/259/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 261, "atom1_serNum": 1981, "atom2_serNum": 2007, "donAcc_type": "standard", "distance": 3.305, "atom1_id": "///A/255/OE2", "atom2_id": "///A/259/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 262, "atom1_serNum": 1981, "atom2_serNum": 16189, "donAcc_type": "questionable", "distance": 2.656, "atom1_id": "///A/255/OE2", "atom2_id": "///D/213/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 263, "atom1_serNum": 1990, "atom2_serNum": 2008, "donAcc_type": "standard", "distance": 2.943, "atom1_id": "///A/257/O", "atom2_id": "///A/260/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 264, "atom1_serNum": 1990, "atom2_serNum": 2013, "donAcc_type": "acceptable", "distance": 2.380, "atom1_id": "///A/257/O", "atom2_id": "///A/260/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 265, "atom1_serNum": 1998, "atom2_serNum": 2022, "donAcc_type": "standard", "distance": 3.143, "atom1_id": "///A/258/O", "atom2_id": "///A/262/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 266, "atom1_serNum": 2003, "atom2_serNum": 2031, "donAcc_type": "standard", "distance": 3.059, "atom1_id": "///A/259/O", "atom2_id": "///A/263/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 267, "atom1_serNum": 2006, "atom2_serNum": 16204, "donAcc_type": "standard", "distance": 3.663, "atom1_id": "///A/259/OD1", "atom2_id": "///D/215/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 268, "atom1_serNum": 2007, "atom2_serNum": 16189, "donAcc_type": "standard", "distance": 3.084, "atom1_id": "///A/259/ND2", "atom2_id": "///D/213/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 269, "atom1_serNum": 2011, "atom2_serNum": 2039, "donAcc_type": "standard", "distance": 2.965, "atom1_id": "///A/260/O", "atom2_id": "///A/264/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 270, "atom1_serNum": 2018, "atom2_serNum": 2044, "donAcc_type": "standard", "distance": 3.159, "atom1_id": "///A/261/O", "atom2_id": "///A/265/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 271, "atom1_serNum": 2025, "atom2_serNum": 2053, "donAcc_type": "standard", "distance": 3.278, "atom1_id": "///A/262/O", "atom2_id": "///A/266/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 272, "atom1_serNum": 2034, "atom2_serNum": 2064, "donAcc_type": "standard", "distance": 3.311, "atom1_id": "///A/263/O", "atom2_id": "///A/267/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 273, "atom1_serNum": 2047, "atom2_serNum": 2077, "donAcc_type": "standard", "distance": 2.790, "atom1_id": "///A/265/O", "atom2_id": "///A/268/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 274, "atom1_serNum": 2077, "atom2_serNum": 16254, "donAcc_type": "standard", "distance": 3.206, "atom1_id": "///A/268/ND2", "atom2_id": "///D/221/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 275, "atom1_serNum": 2081, "atom2_serNum": 16309, "donAcc_type": "standard", "distance": 3.162, "atom1_id": "///A/269/O", "atom2_id": "///D/228/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 276, "atom1_serNum": 2118, "atom2_serNum": 4294, "donAcc_type": "standard", "distance": 3.376, "atom1_id": "///A/274/N", "atom2_id": "///A/548/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 277, "atom1_serNum": 2125, "atom2_serNum": 4311, "donAcc_type": "questionable", "distance": 3.253, "atom1_id": "///A/275/O", "atom2_id": "///A/550/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 278, "atom1_serNum": 2143, "atom2_serNum": 4311, "donAcc_type": "standard", "distance": 3.697, "atom1_id": "///A/277/N", "atom2_id": "///A/550/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 279, "atom1_serNum": 2181, "atom2_serNum": 2196, "donAcc_type": "standard", "distance": 2.856, "atom1_id": "///A/281/O", "atom2_id": "///A/283/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 280, "atom1_serNum": 2199, "atom2_serNum": 2215, "donAcc_type": "standard", "distance": 3.105, "atom1_id": "///A/283/O", "atom2_id": "///A/286/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 281, "atom1_serNum": 2201, "atom2_serNum": 2218, "donAcc_type": "acceptable", "distance": 3.000, "atom1_id": "///A/283/OG1", "atom2_id": "///A/286/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 282, "atom1_serNum": 2226, "atom2_serNum": 2253, "donAcc_type": "standard", "distance": 3.147, "atom1_id": "///A/287/O", "atom2_id": "///A/291/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 283, "atom1_serNum": 2232, "atom2_serNum": 2265, "donAcc_type": "standard", "distance": 3.182, "atom1_id": "///A/288/O", "atom2_id": "///A/292/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 284, "atom1_serNum": 2239, "atom2_serNum": 2273, "donAcc_type": "standard", "distance": 3.057, "atom1_id": "///A/289/O", "atom2_id": "///A/293/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 285, "atom1_serNum": 2243, "atom2_serNum": 2627, "donAcc_type": "standard", "distance": 3.470, "atom1_id": "///A/289/OE1", "atom2_id": "///A/333/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 286, "atom1_serNum": 2248, "atom2_serNum": 2280, "donAcc_type": "standard", "distance": 2.980, "atom1_id": "///A/290/O", "atom2_id": "///A/294/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 287, "atom1_serNum": 2256, "atom2_serNum": 2289, "donAcc_type": "standard", "distance": 3.051, "atom1_id": "///A/291/O", "atom2_id": "///A/295/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 288, "atom1_serNum": 2268, "atom2_serNum": 2300, "donAcc_type": "standard", "distance": 2.914, "atom1_id": "///A/292/O", "atom2_id": "///A/296/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 289, "atom1_serNum": 2276, "atom2_serNum": 2305, "donAcc_type": "standard", "distance": 2.961, "atom1_id": "///A/293/O", "atom2_id": "///A/297/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 290, "atom1_serNum": 2283, "atom2_serNum": 2314, "donAcc_type": "standard", "distance": 3.101, "atom1_id": "///A/294/O", "atom2_id": "///A/298/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 291, "atom1_serNum": 2292, "atom2_serNum": 2323, "donAcc_type": "standard", "distance": 2.878, "atom1_id": "///A/295/O", "atom2_id": "///A/299/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 292, "atom1_serNum": 2303, "atom2_serNum": 2327, "donAcc_type": "standard", "distance": 2.886, "atom1_id": "///A/296/O", "atom2_id": "///A/300/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 293, "atom1_serNum": 2308, "atom2_serNum": 2335, "donAcc_type": "standard", "distance": 3.113, "atom1_id": "///A/297/O", "atom2_id": "///A/301/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 294, "atom1_serNum": 2317, "atom2_serNum": 2344, "donAcc_type": "standard", "distance": 3.411, "atom1_id": "///A/298/O", "atom2_id": "///A/302/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 295, "atom1_serNum": 2326, "atom2_serNum": 2353, "donAcc_type": "standard", "distance": 3.179, "atom1_id": "///A/299/O", "atom2_id": "///A/303/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 296, "atom1_serNum": 2330, "atom2_serNum": 2364, "donAcc_type": "standard", "distance": 2.920, "atom1_id": "///A/300/O", "atom2_id": "///A/304/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 297, "atom1_serNum": 2338, "atom2_serNum": 2372, "donAcc_type": "standard", "distance": 3.250, "atom1_id": "///A/301/O", "atom2_id": "///A/305/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 298, "atom1_serNum": 2347, "atom2_serNum": 2377, "donAcc_type": "standard", "distance": 3.021, "atom1_id": "///A/302/O", "atom2_id": "///A/306/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 299, "atom1_serNum": 2356, "atom2_serNum": 2388, "donAcc_type": "standard", "distance": 2.708, "atom1_id": "///A/303/O", "atom2_id": "///A/307/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 300, "atom1_serNum": 2360, "atom2_serNum": 2910, "donAcc_type": "standard", "distance": 3.421, "atom1_id": "///A/303/NE", "atom2_id": "///A/372/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 301, "atom1_serNum": 2367, "atom2_serNum": 2396, "donAcc_type": "standard", "distance": 2.822, "atom1_id": "///A/304/O", "atom2_id": "///A/308/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 302, "atom1_serNum": 2399, "atom2_serNum": 2456, "donAcc_type": "standard", "distance": 3.833, "atom1_id": "///A/308/O", "atom2_id": "///A/314/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 303, "atom1_serNum": 2417, "atom2_serNum": 2449, "donAcc_type": "standard", "distance": 2.989, "atom1_id": "///A/310/O", "atom2_id": "///A/314/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 304, "atom1_serNum": 2425, "atom2_serNum": 2460, "donAcc_type": "standard", "distance": 3.227, "atom1_id": "///A/311/O", "atom2_id": "///A/315/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 305, "atom1_serNum": 2434, "atom2_serNum": 2468, "donAcc_type": "standard", "distance": 3.377, "atom1_id": "///A/312/O", "atom2_id": "///A/316/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 306, "atom1_serNum": 2443, "atom2_serNum": 2477, "donAcc_type": "standard", "distance": 2.883, "atom1_id": "///A/313/O", "atom2_id": "///A/317/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 307, "atom1_serNum": 2452, "atom2_serNum": 2488, "donAcc_type": "standard", "distance": 3.008, "atom1_id": "///A/314/O", "atom2_id": "///A/318/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 308, "atom1_serNum": 2487, "atom2_serNum": 2526, "donAcc_type": "acceptable", "distance": 3.870, "atom1_id": "///A/317/NH2", "atom2_id": "///A/321/OH", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 309, "atom1_serNum": 2487, "atom2_serNum": 3002, "donAcc_type": "standard", "distance": 3.634, "atom1_id": "///A/317/NH2", "atom2_id": "///A/383/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 310, "atom1_serNum": 2491, "atom2_serNum": 2515, "donAcc_type": "standard", "distance": 2.908, "atom1_id": "///A/318/O", "atom2_id": "///A/321/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 311, "atom1_serNum": 2491, "atom2_serNum": 2527, "donAcc_type": "standard", "distance": 3.267, "atom1_id": "///A/318/O", "atom2_id": "///A/322/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 312, "atom1_serNum": 2497, "atom2_serNum": 2533, "donAcc_type": "standard", "distance": 2.950, "atom1_id": "///A/318/NH1", "atom2_id": "///A/322/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 313, "atom1_serNum": 2497, "atom2_serNum": 2534, "donAcc_type": "standard", "distance": 2.503, "atom1_id": "///A/318/NH1", "atom2_id": "///A/322/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 314, "atom1_serNum": 2502, "atom2_serNum": 2535, "donAcc_type": "standard", "distance": 2.908, "atom1_id": "///A/319/O", "atom2_id": "///A/323/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 315, "atom1_serNum": 2509, "atom2_serNum": 2544, "donAcc_type": "standard", "distance": 2.978, "atom1_id": "///A/320/O", "atom2_id": "///A/324/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 316, "atom1_serNum": 2518, "atom2_serNum": 2555, "donAcc_type": "standard", "distance": 2.656, "atom1_id": "///A/321/O", "atom2_id": "///A/325/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 317, "atom1_serNum": 2526, "atom2_serNum": 2979, "donAcc_type": "acceptable", "distance": 2.697, "atom1_id": "///A/321/OH", "atom2_id": "///A/380/OD2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 318, "atom1_serNum": 2530, "atom2_serNum": 2563, "donAcc_type": "standard", "distance": 2.958, "atom1_id": "///A/322/O", "atom2_id": "///A/326/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 319, "atom1_serNum": 2538, "atom2_serNum": 2572, "donAcc_type": "standard", "distance": 3.044, "atom1_id": "///A/323/O", "atom2_id": "///A/327/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 320, "atom1_serNum": 2547, "atom2_serNum": 2579, "donAcc_type": "standard", "distance": 3.038, "atom1_id": "///A/324/O", "atom2_id": "///A/328/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 321, "atom1_serNum": 2553, "atom2_serNum": 2587, "donAcc_type": "standard", "distance": 3.128, "atom1_id": "///A/324/NH1", "atom2_id": "///A/328/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 322, "atom1_serNum": 2553, "atom2_serNum": 2880, "donAcc_type": "standard", "distance": 3.643, "atom1_id": "///A/324/NH1", "atom2_id": "///A/367/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 323, "atom1_serNum": 2553, "atom2_serNum": 3026, "donAcc_type": "standard", "distance": 3.884, "atom1_id": "///A/324/NH1", "atom2_id": "///A/386/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 324, "atom1_serNum": 2558, "atom2_serNum": 2588, "donAcc_type": "standard", "distance": 2.832, "atom1_id": "///A/325/O", "atom2_id": "///A/329/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 325, "atom1_serNum": 2566, "atom2_serNum": 2596, "donAcc_type": "standard", "distance": 3.018, "atom1_id": "///A/326/O", "atom2_id": "///A/330/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 326, "atom1_serNum": 2570, "atom2_serNum": 2604, "donAcc_type": "standard", "distance": 3.229, "atom1_id": "///A/326/OE1", "atom2_id": "///A/330/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 327, "atom1_serNum": 2575, "atom2_serNum": 2605, "donAcc_type": "standard", "distance": 3.507, "atom1_id": "///A/327/O", "atom2_id": "///A/331/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 328, "atom1_serNum": 2582, "atom2_serNum": 2605, "donAcc_type": "standard", "distance": 2.943, "atom1_id": "///A/328/O", "atom2_id": "///A/331/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 329, "atom1_serNum": 2582, "atom2_serNum": 2612, "donAcc_type": "standard", "distance": 3.004, "atom1_id": "///A/328/O", "atom2_id": "///A/332/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 330, "atom1_serNum": 2586, "atom2_serNum": 2886, "donAcc_type": "acceptable", "distance": 3.360, "atom1_id": "///A/328/OE1", "atom2_id": "///A/368/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 331, "atom1_serNum": 2586, "atom2_serNum": 2887, "donAcc_type": "standard", "distance": 3.497, "atom1_id": "///A/328/OE1", "atom2_id": "///A/369/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 332, "atom1_serNum": 2591, "atom2_serNum": 2620, "donAcc_type": "standard", "distance": 3.148, "atom1_id": "///A/329/O", "atom2_id": "///A/333/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 333, "atom1_serNum": 2599, "atom2_serNum": 2628, "donAcc_type": "standard", "distance": 3.068, "atom1_id": "///A/330/O", "atom2_id": "///A/334/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 334, "atom1_serNum": 2608, "atom2_serNum": 2637, "donAcc_type": "standard", "distance": 2.936, "atom1_id": "///A/331/O", "atom2_id": "///A/335/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 335, "atom1_serNum": 2615, "atom2_serNum": 2645, "donAcc_type": "standard", "distance": 3.221, "atom1_id": "///A/332/O", "atom2_id": "///A/336/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 336, "atom1_serNum": 2615, "atom2_serNum": 2649, "donAcc_type": "standard", "distance": 3.327, "atom1_id": "///A/332/O", "atom2_id": "///A/337/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 337, "atom1_serNum": 2652, "atom2_serNum": 2671, "donAcc_type": "standard", "distance": 3.031, "atom1_id": "///A/337/O", "atom2_id": "///A/340/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 338, "atom1_serNum": 2652, "atom2_serNum": 2683, "donAcc_type": "standard", "distance": 3.342, "atom1_id": "///A/337/O", "atom2_id": "///A/341/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 339, "atom1_serNum": 2663, "atom2_serNum": 2694, "donAcc_type": "standard", "distance": 3.119, "atom1_id": "///A/338/O", "atom2_id": "///A/342/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 340, "atom1_serNum": 2670, "atom2_serNum": 2702, "donAcc_type": "standard", "distance": 2.968, "atom1_id": "///A/339/O", "atom2_id": "///A/343/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 341, "atom1_serNum": 2674, "atom2_serNum": 2710, "donAcc_type": "standard", "distance": 3.266, "atom1_id": "///A/340/O", "atom2_id": "///A/344/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 342, "atom1_serNum": 2686, "atom2_serNum": 2717, "donAcc_type": "standard", "distance": 2.973, "atom1_id": "///A/341/O", "atom2_id": "///A/345/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 343, "atom1_serNum": 2697, "atom2_serNum": 2725, "donAcc_type": "standard", "distance": 3.105, "atom1_id": "///A/342/O", "atom2_id": "///A/346/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 344, "atom1_serNum": 2705, "atom2_serNum": 2734, "donAcc_type": "standard", "distance": 2.888, "atom1_id": "///A/343/O", "atom2_id": "///A/347/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 345, "atom1_serNum": 2713, "atom2_serNum": 2745, "donAcc_type": "standard", "distance": 2.889, "atom1_id": "///A/344/O", "atom2_id": "///A/348/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 346, "atom1_serNum": 2720, "atom2_serNum": 2753, "donAcc_type": "standard", "distance": 3.050, "atom1_id": "///A/345/O", "atom2_id": "///A/349/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 347, "atom1_serNum": 2728, "atom2_serNum": 2762, "donAcc_type": "standard", "distance": 2.851, "atom1_id": "///A/346/O", "atom2_id": "///A/350/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 348, "atom1_serNum": 2737, "atom2_serNum": 2776, "donAcc_type": "standard", "distance": 3.163, "atom1_id": "///A/347/O", "atom2_id": "///A/351/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 349, "atom1_serNum": 2737, "atom2_serNum": 2781, "donAcc_type": "acceptable", "distance": 2.461, "atom1_id": "///A/347/O", "atom2_id": "///A/351/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 350, "atom1_serNum": 2748, "atom2_serNum": 2782, "donAcc_type": "standard", "distance": 3.254, "atom1_id": "///A/348/O", "atom2_id": "///A/352/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 351, "atom1_serNum": 2756, "atom2_serNum": 2782, "donAcc_type": "standard", "distance": 2.979, "atom1_id": "///A/349/O", "atom2_id": "///A/352/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 352, "atom1_serNum": 2756, "atom2_serNum": 2791, "donAcc_type": "standard", "distance": 3.037, "atom1_id": "///A/349/O", "atom2_id": "///A/353/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 353, "atom1_serNum": 2760, "atom2_serNum": 2940, "donAcc_type": "standard", "distance": 2.759, "atom1_id": "///A/349/OE1", "atom2_id": "///A/375/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 354, "atom1_serNum": 2761, "atom2_serNum": 2797, "donAcc_type": "standard", "distance": 3.063, "atom1_id": "///A/349/NE2", "atom2_id": "///A/353/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 355, "atom1_serNum": 2765, "atom2_serNum": 2799, "donAcc_type": "standard", "distance": 3.003, "atom1_id": "///A/350/O", "atom2_id": "///A/354/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 356, "atom1_serNum": 2765, "atom2_serNum": 2805, "donAcc_type": "questionable", "distance": 2.788, "atom1_id": "///A/350/O", "atom2_id": "///A/354/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 357, "atom1_serNum": 2779, "atom2_serNum": 2811, "donAcc_type": "standard", "distance": 2.888, "atom1_id": "///A/351/O", "atom2_id": "///A/356/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 358, "atom1_serNum": 2790, "atom2_serNum": 2935, "donAcc_type": "standard", "distance": 2.695, "atom1_id": "///A/352/NZ", "atom2_id": "///A/375/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 359, "atom1_serNum": 2802, "atom2_serNum": 2811, "donAcc_type": "standard", "distance": 3.042, "atom1_id": "///A/354/O", "atom2_id": "///A/356/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 360, "atom1_serNum": 2835, "atom2_serNum": 2856, "donAcc_type": "standard", "distance": 2.473, "atom1_id": "///A/359/O", "atom2_id": "///A/362/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 361, "atom1_serNum": 2846, "atom2_serNum": 2856, "donAcc_type": "standard", "distance": 2.657, "atom1_id": "///A/361/O", "atom2_id": "///A/362/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 362, "atom1_serNum": 2850, "atom2_serNum": 2868, "donAcc_type": "standard", "distance": 2.737, "atom1_id": "///A/362/O", "atom2_id": "///A/365/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 363, "atom1_serNum": 2854, "atom2_serNum": 2944, "donAcc_type": "standard", "distance": 2.385, "atom1_id": "///A/362/NE", "atom2_id": "///A/376/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 364, "atom1_serNum": 2857, "atom2_serNum": 2944, "donAcc_type": "standard", "distance": 2.837, "atom1_id": "///A/362/NH2", "atom2_id": "///A/376/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 365, "atom1_serNum": 2865, "atom2_serNum": 2877, "donAcc_type": "standard", "distance": 3.198, "atom1_id": "///A/364/O", "atom2_id": "///A/367/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 366, "atom1_serNum": 2865, "atom2_serNum": 5978, "donAcc_type": "acceptable", "distance": 3.324, "atom1_id": "///A/364/O", "atom2_id": "///A/759/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 367, "atom1_serNum": 2867, "atom2_serNum": 5962, "donAcc_type": "acceptable", "distance": 2.306, "atom1_id": "///A/364/OG", "atom2_id": "///A/757/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 368, "atom1_serNum": 2871, "atom2_serNum": 2881, "donAcc_type": "standard", "distance": 3.073, "atom1_id": "///A/365/O", "atom2_id": "///A/368/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 369, "atom1_serNum": 2884, "atom2_serNum": 2907, "donAcc_type": "standard", "distance": 3.234, "atom1_id": "///A/368/O", "atom2_id": "///A/372/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 370, "atom1_serNum": 2886, "atom2_serNum": 2902, "donAcc_type": "acceptable", "distance": 3.154, "atom1_id": "///A/368/OG", "atom2_id": "///A/371/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 371, "atom1_serNum": 2890, "atom2_serNum": 2919, "donAcc_type": "standard", "distance": 2.708, "atom1_id": "///A/369/O", "atom2_id": "///A/373/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 372, "atom1_serNum": 2898, "atom2_serNum": 2924, "donAcc_type": "standard", "distance": 2.846, "atom1_id": "///A/370/O", "atom2_id": "///A/374/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 373, "atom1_serNum": 2905, "atom2_serNum": 2932, "donAcc_type": "standard", "distance": 3.170, "atom1_id": "///A/371/O", "atom2_id": "///A/375/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 374, "atom1_serNum": 2905, "atom2_serNum": 2941, "donAcc_type": "standard", "distance": 2.645, "atom1_id": "///A/371/O", "atom2_id": "///A/376/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 375, "atom1_serNum": 2905, "atom2_serNum": 2949, "donAcc_type": "standard", "distance": 3.152, "atom1_id": "///A/371/O", "atom2_id": "///A/377/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 376, "atom1_serNum": 2910, "atom2_serNum": 2932, "donAcc_type": "standard", "distance": 2.935, "atom1_id": "///A/372/O", "atom2_id": "///A/375/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 377, "atom1_serNum": 2975, "atom2_serNum": 3004, "donAcc_type": "standard", "distance": 3.517, "atom1_id": "///A/380/O", "atom2_id": "///A/384/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 378, "atom1_serNum": 2978, "atom2_serNum": 2987, "donAcc_type": "standard", "distance": 2.984, "atom1_id": "///A/380/OD1", "atom2_id": "///A/382/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 379, "atom1_serNum": 2983, "atom2_serNum": 3015, "donAcc_type": "standard", "distance": 2.994, "atom1_id": "///A/381/O", "atom2_id": "///A/385/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 380, "atom1_serNum": 2983, "atom2_serNum": 3023, "donAcc_type": "standard", "distance": 2.995, "atom1_id": "///A/381/O", "atom2_id": "///A/386/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 381, "atom1_serNum": 3034, "atom2_serNum": 3059, "donAcc_type": "standard", "distance": 3.552, "atom1_id": "///A/387/O", "atom2_id": "///A/390/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 382, "atom1_serNum": 3042, "atom2_serNum": 3070, "donAcc_type": "standard", "distance": 2.866, "atom1_id": "///A/388/O", "atom2_id": "///A/391/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 383, "atom1_serNum": 3042, "atom2_serNum": 3081, "donAcc_type": "standard", "distance": 2.935, "atom1_id": "///A/388/O", "atom2_id": "///A/392/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 384, "atom1_serNum": 3050, "atom2_serNum": 3057, "donAcc_type": "standard", "distance": 2.785, "atom1_id": "///A/389/N", "atom2_id": "///A/389/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 385, "atom1_serNum": 3053, "atom2_serNum": 5600, "donAcc_type": "standard", "distance": 3.689, "atom1_id": "///A/389/O", "atom2_id": "///A/710/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 386, "atom1_serNum": 3062, "atom2_serNum": 3068, "donAcc_type": "standard", "distance": 2.864, "atom1_id": "///A/390/O", "atom2_id": "///A/390/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 387, "atom1_serNum": 3062, "atom2_serNum": 5600, "donAcc_type": "standard", "distance": 3.389, "atom1_id": "///A/390/O", "atom2_id": "///A/710/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 388, "atom1_serNum": 3066, "atom2_serNum": 5424, "donAcc_type": "standard", "distance": 3.573, "atom1_id": "///A/390/NE", "atom2_id": "///A/687/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 389, "atom1_serNum": 3092, "atom2_serNum": 3113, "donAcc_type": "standard", "distance": 3.171, "atom1_id": "///A/393/O", "atom2_id": "///A/396/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 390, "atom1_serNum": 3095, "atom2_serNum": 3097, "donAcc_type": "standard", "distance": 3.226, "atom1_id": "///A/393/OD1", "atom2_id": "///A/394/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 391, "atom1_serNum": 3095, "atom2_serNum": 3104, "donAcc_type": "standard", "distance": 3.258, "atom1_id": "///A/393/OD1", "atom2_id": "///A/395/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 392, "atom1_serNum": 3096, "atom2_serNum": 5545, "donAcc_type": "standard", "distance": 3.525, "atom1_id": "///A/393/ND2", "atom2_id": "///A/703/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 393, "atom1_serNum": 3096, "atom2_serNum": 5562, "donAcc_type": "standard", "distance": 2.312, "atom1_id": "///A/393/ND2", "atom2_id": "///A/706/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 394, "atom1_serNum": 3112, "atom2_serNum": 5532, "donAcc_type": "acceptable", "distance": 3.367, "atom1_id": "///A/395/OE2", "atom2_id": "///A/701/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 395, "atom1_serNum": 3148, "atom2_serNum": 3160, "donAcc_type": "standard", "distance": 2.768, "atom1_id": "///A/400/O", "atom2_id": "///A/402/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 396, "atom1_serNum": 3158, "atom2_serNum": 3171, "donAcc_type": "standard", "distance": 3.076, "atom1_id": "///A/401/OD1", "atom2_id": "///A/403/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 397, "atom1_serNum": 3159, "atom2_serNum": 4289, "donAcc_type": "questionable", "distance": 2.874, "atom1_id": "///A/401/OD2", "atom2_id": "///A/547/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 398, "atom1_serNum": 3159, "atom2_serNum": 4335, "donAcc_type": "standard", "distance": 3.628, "atom1_id": "///A/401/OD2", "atom2_id": "///A/553/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 399, "atom1_serNum": 3177, "atom2_serNum": 4347, "donAcc_type": "standard", "distance": 3.400, "atom1_id": "///A/403/OD1", "atom2_id": "///A/555/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 400, "atom1_serNum": 3194, "atom2_serNum": 4350, "donAcc_type": "standard", "distance": 3.720, "atom1_id": "///A/406/N", "atom2_id": "///A/555/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 401, "atom1_serNum": 3197, "atom2_serNum": 4366, "donAcc_type": "standard", "distance": 2.790, "atom1_id": "///A/406/O", "atom2_id": "///A/557/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 402, "atom1_serNum": 3208, "atom2_serNum": 3228, "donAcc_type": "standard", "distance": 3.066, "atom1_id": "///A/407/O", "atom2_id": "///A/410/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 403, "atom1_serNum": 3211, "atom2_serNum": 4369, "donAcc_type": "standard", "distance": 3.796, "atom1_id": "///A/408/N", "atom2_id": "///A/557/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 404, "atom1_serNum": 3214, "atom2_serNum": 3237, "donAcc_type": "standard", "distance": 3.259, "atom1_id": "///A/408/O", "atom2_id": "///A/411/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 405, "atom1_serNum": 3214, "atom2_serNum": 3246, "donAcc_type": "standard", "distance": 2.848, "atom1_id": "///A/408/O", "atom2_id": "///A/411/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 406, "atom1_serNum": 3231, "atom2_serNum": 3265, "donAcc_type": "standard", "distance": 3.205, "atom1_id": "///A/410/O", "atom2_id": "///A/414/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 407, "atom1_serNum": 3240, "atom2_serNum": 3272, "donAcc_type": "standard", "distance": 2.749, "atom1_id": "///A/411/O", "atom2_id": "///A/415/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 408, "atom1_serNum": 3251, "atom2_serNum": 3280, "donAcc_type": "standard", "distance": 3.029, "atom1_id": "///A/412/O", "atom2_id": "///A/416/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 409, "atom1_serNum": 3259, "atom2_serNum": 3289, "donAcc_type": "standard", "distance": 3.138, "atom1_id": "///A/413/O", "atom2_id": "///A/417/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 410, "atom1_serNum": 3268, "atom2_serNum": 3299, "donAcc_type": "standard", "distance": 2.969, "atom1_id": "///A/414/O", "atom2_id": "///A/418/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 411, "atom1_serNum": 3275, "atom2_serNum": 3306, "donAcc_type": "standard", "distance": 2.872, "atom1_id": "///A/415/O", "atom2_id": "///A/419/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 412, "atom1_serNum": 3283, "atom2_serNum": 3311, "donAcc_type": "standard", "distance": 3.037, "atom1_id": "///A/416/O", "atom2_id": "///A/420/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 413, "atom1_serNum": 3292, "atom2_serNum": 3319, "donAcc_type": "standard", "distance": 3.053, "atom1_id": "///A/417/O", "atom2_id": "///A/421/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 414, "atom1_serNum": 3302, "atom2_serNum": 3327, "donAcc_type": "standard", "distance": 3.110, "atom1_id": "///A/418/O", "atom2_id": "///A/422/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 415, "atom1_serNum": 3309, "atom2_serNum": 3339, "donAcc_type": "standard", "distance": 2.758, "atom1_id": "///A/419/O", "atom2_id": "///A/423/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 416, "atom1_serNum": 3342, "atom2_serNum": 3362, "donAcc_type": "standard", "distance": 2.899, "atom1_id": "///A/423/O", "atom2_id": "///A/426/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 417, "atom1_serNum": 3357, "atom2_serNum": 4082, "donAcc_type": "standard", "distance": 3.125, "atom1_id": "///A/425/O", "atom2_id": "///A/522/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 418, "atom1_serNum": 3365, "atom2_serNum": 4054, "donAcc_type": "standard", "distance": 3.522, "atom1_id": "///A/426/O", "atom2_id": "///A/518/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 419, "atom1_serNum": 3374, "atom2_serNum": 4042, "donAcc_type": "standard", "distance": 3.509, "atom1_id": "///A/428/N", "atom2_id": "///A/516/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 420, "atom1_serNum": 3377, "atom2_serNum": 4039, "donAcc_type": "standard", "distance": 2.681, "atom1_id": "///A/428/O", "atom2_id": "///A/516/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 421, "atom1_serNum": 3379, "atom2_serNum": 3383, "donAcc_type": "acceptable", "distance": 2.965, "atom1_id": "///A/428/OG", "atom2_id": "///A/429/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 422, "atom1_serNum": 3380, "atom2_serNum": 4206, "donAcc_type": "standard", "distance": 3.130, "atom1_id": "///A/429/N", "atom2_id": "///A/537/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 423, "atom1_serNum": 3383, "atom2_serNum": 4217, "donAcc_type": "standard", "distance": 2.609, "atom1_id": "///A/429/O", "atom2_id": "///A/539/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 424, "atom1_serNum": 3389, "atom2_serNum": 4031, "donAcc_type": "standard", "distance": 2.639, "atom1_id": "///A/430/N", "atom2_id": "///A/514/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 425, "atom1_serNum": 3392, "atom2_serNum": 4024, "donAcc_type": "standard", "distance": 2.548, "atom1_id": "///A/430/O", "atom2_id": "///A/513/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 426, "atom1_serNum": 3397, "atom2_serNum": 4220, "donAcc_type": "standard", "distance": 3.567, "atom1_id": "///A/431/N", "atom2_id": "///A/539/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 427, "atom1_serNum": 3405, "atom2_serNum": 4012, "donAcc_type": "standard", "distance": 3.707, "atom1_id": "///A/432/N", "atom2_id": "///A/511/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 428, "atom1_serNum": 3426, "atom2_serNum": 3972, "donAcc_type": "standard", "distance": 3.393, "atom1_id": "///A/434/O", "atom2_id": "///A/506/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 429, "atom1_serNum": 3430, "atom2_serNum": 3982, "donAcc_type": "standard", "distance": 2.749, "atom1_id": "///A/435/O", "atom2_id": "///A/506/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 430, "atom1_serNum": 3432, "atom2_serNum": 17810, "donAcc_type": "acceptable", "distance": 2.408, "atom1_id": "///A/435/OG1", "atom2_id": "///P/23/OP1", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 431, "atom1_serNum": 3434, "atom2_serNum": 3961, "donAcc_type": "standard", "distance": 2.656, "atom1_id": "///A/436/N", "atom2_id": "///A/504/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 432, "atom1_serNum": 3437, "atom2_serNum": 3954, "donAcc_type": "standard", "distance": 2.561, "atom1_id": "///A/436/O", "atom2_id": "///A/503/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 433, "atom1_serNum": 3445, "atom2_serNum": 3466, "donAcc_type": "standard", "distance": 2.776, "atom1_id": "///A/437/O", "atom2_id": "///A/441/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 434, "atom1_serNum": 3450, "atom2_serNum": 3473, "donAcc_type": "standard", "distance": 3.235, "atom1_id": "///A/438/O", "atom2_id": "///A/442/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 435, "atom1_serNum": 3452, "atom2_serNum": 17789, "donAcc_type": "standard", "distance": 3.201, "atom1_id": "///A/439/N", "atom2_id": "///P/22/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 436, "atom1_serNum": 3455, "atom2_serNum": 3481, "donAcc_type": "standard", "distance": 3.111, "atom1_id": "///A/439/O", "atom2_id": "///A/443/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 437, "atom1_serNum": 3460, "atom2_serNum": 3622, "donAcc_type": "standard", "distance": 2.901, "atom1_id": "///A/439/NZ", "atom2_id": "///A/460/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 438, "atom1_serNum": 3460, "atom2_serNum": 3645, "donAcc_type": "standard", "distance": 2.703, "atom1_id": "///A/439/NZ", "atom2_id": "///A/463/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 439, "atom1_serNum": 3461, "atom2_serNum": 17789, "donAcc_type": "standard", "distance": 3.172, "atom1_id": "///A/440/N", "atom2_id": "///P/22/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 440, "atom1_serNum": 3464, "atom2_serNum": 3492, "donAcc_type": "standard", "distance": 2.760, "atom1_id": "///A/440/O", "atom2_id": "///A/444/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 441, "atom1_serNum": 3469, "atom2_serNum": 3500, "donAcc_type": "standard", "distance": 3.031, "atom1_id": "///A/441/O", "atom2_id": "///A/445/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 442, "atom1_serNum": 3476, "atom2_serNum": 3507, "donAcc_type": "standard", "distance": 2.871, "atom1_id": "///A/442/O", "atom2_id": "///A/446/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 443, "atom1_serNum": 3484, "atom2_serNum": 3511, "donAcc_type": "standard", "distance": 3.146, "atom1_id": "///A/443/O", "atom2_id": "///A/447/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 444, "atom1_serNum": 3490, "atom2_serNum": 17772, "donAcc_type": "standard", "distance": 3.157, "atom1_id": "///A/443/NH1", "atom2_id": "///P/21/O4'", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 445, "atom1_serNum": 3495, "atom2_serNum": 3522, "donAcc_type": "standard", "distance": 3.235, "atom1_id": "///A/444/O", "atom2_id": "///A/448/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 446, "atom1_serNum": 3498, "atom2_serNum": 3521, "donAcc_type": "standard", "distance": 3.214, "atom1_id": "///A/444/OD1", "atom2_id": "///A/447/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 447, "atom1_serNum": 3503, "atom2_serNum": 3529, "donAcc_type": "standard", "distance": 2.870, "atom1_id": "///A/445/O", "atom2_id": "///A/449/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 448, "atom1_serNum": 3510, "atom2_serNum": 3541, "donAcc_type": "standard", "distance": 3.078, "atom1_id": "///A/446/O", "atom2_id": "///A/451/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 449, "atom1_serNum": 3514, "atom2_serNum": 3537, "donAcc_type": "standard", "distance": 2.956, "atom1_id": "///A/447/O", "atom2_id": "///A/450/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 450, "atom1_serNum": 3520, "atom2_serNum": 18054, "donAcc_type": "standard", "distance": 3.728, "atom1_id": "///A/447/NH1", "atom2_id": "///T/21/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 451, "atom1_serNum": 3532, "atom2_serNum": 15785, "donAcc_type": "standard", "distance": 2.761, "atom1_id": "///A/449/O", "atom2_id": "///D/141/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 452, "atom1_serNum": 3554, "atom2_serNum": 3574, "donAcc_type": "standard", "distance": 3.231, "atom1_id": "///A/452/O", "atom2_id": "///A/455/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 453, "atom1_serNum": 3561, "atom2_serNum": 3592, "donAcc_type": "standard", "distance": 3.004, "atom1_id": "///A/453/O", "atom2_id": "///A/457/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 454, "atom1_serNum": 3573, "atom2_serNum": 3600, "donAcc_type": "standard", "distance": 3.214, "atom1_id": "///A/454/O", "atom2_id": "///A/458/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 455, "atom1_serNum": 3577, "atom2_serNum": 3611, "donAcc_type": "standard", "distance": 3.679, "atom1_id": "///A/455/O", "atom2_id": "///A/459/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 456, "atom1_serNum": 3588, "atom2_serNum": 3611, "donAcc_type": "standard", "distance": 2.987, "atom1_id": "///A/456/O", "atom2_id": "///A/459/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 457, "atom1_serNum": 3588, "atom2_serNum": 3619, "donAcc_type": "standard", "distance": 2.992, "atom1_id": "///A/456/O", "atom2_id": "///A/460/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 458, "atom1_serNum": 3595, "atom2_serNum": 3625, "donAcc_type": "standard", "distance": 3.009, "atom1_id": "///A/457/O", "atom2_id": "///A/461/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 459, "atom1_serNum": 3598, "atom2_serNum": 3624, "donAcc_type": "acceptable", "distance": 3.417, "atom1_id": "///A/457/OD1", "atom2_id": "///A/460/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 460, "atom1_serNum": 3610, "atom2_serNum": 8210, "donAcc_type": "acceptable", "distance": 2.746, "atom1_id": "///A/458/NH2", "atom2_id": "///A/1060/OG", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 461, "atom1_serNum": 3614, "atom2_serNum": 3634, "donAcc_type": "standard", "distance": 3.112, "atom1_id": "///A/459/O", "atom2_id": "///A/462/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 462, "atom1_serNum": 3622, "atom2_serNum": 3642, "donAcc_type": "standard", "distance": 3.067, "atom1_id": "///A/460/O", "atom2_id": "///A/463/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 463, "atom1_serNum": 3664, "atom2_serNum": 3670, "donAcc_type": "standard", "distance": 2.682, "atom1_id": "///A/466/N", "atom2_id": "///A/466/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 464, "atom1_serNum": 3667, "atom2_serNum": 3683, "donAcc_type": "standard", "distance": 3.531, "atom1_id": "///A/466/O", "atom2_id": "///A/469/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 465, "atom1_serNum": 3694, "atom2_serNum": 3720, "donAcc_type": "standard", "distance": 2.866, "atom1_id": "///A/470/O", "atom2_id": "///A/474/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 466, "atom1_serNum": 3696, "atom2_serNum": 3711, "donAcc_type": "acceptable", "distance": 3.162, "atom1_id": "///A/470/OG1", "atom2_id": "///A/473/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 467, "atom1_serNum": 3698, "atom2_serNum": 3953, "donAcc_type": "standard", "distance": 2.705, "atom1_id": "///A/471/N", "atom2_id": "///A/502/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 468, "atom1_serNum": 3701, "atom2_serNum": 3725, "donAcc_type": "standard", "distance": 2.970, "atom1_id": "///A/471/O", "atom2_id": "///A/475/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 469, "atom1_serNum": 3709, "atom2_serNum": 3736, "donAcc_type": "standard", "distance": 3.474, "atom1_id": "///A/472/O", "atom2_id": "///A/476/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 470, "atom1_serNum": 3714, "atom2_serNum": 3745, "donAcc_type": "standard", "distance": 3.126, "atom1_id": "///A/473/O", "atom2_id": "///A/477/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 471, "atom1_serNum": 3723, "atom2_serNum": 3750, "donAcc_type": "standard", "distance": 3.052, "atom1_id": "///A/474/O", "atom2_id": "///A/478/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 472, "atom1_serNum": 3753, "atom2_serNum": 3775, "donAcc_type": "standard", "distance": 3.276, "atom1_id": "///A/478/O", "atom2_id": "///A/481/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 473, "atom1_serNum": 3758, "atom2_serNum": 3766, "donAcc_type": "standard", "distance": 2.847, "atom1_id": "///A/478/OE2", "atom2_id": "///A/480/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 474, "atom1_serNum": 3762, "atom2_serNum": 3790, "donAcc_type": "standard", "distance": 3.534, "atom1_id": "///A/479/O", "atom2_id": "///A/483/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 475, "atom1_serNum": 3769, "atom2_serNum": 3799, "donAcc_type": "standard", "distance": 3.001, "atom1_id": "///A/480/O", "atom2_id": "///A/484/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 476, "atom1_serNum": 3778, "atom2_serNum": 3807, "donAcc_type": "standard", "distance": 3.109, "atom1_id": "///A/481/O", "atom2_id": "///A/485/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 477, "atom1_serNum": 3786, "atom2_serNum": 3819, "donAcc_type": "standard", "distance": 3.227, "atom1_id": "///A/482/O", "atom2_id": "///A/486/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 478, "atom1_serNum": 3793, "atom2_serNum": 3828, "donAcc_type": "standard", "distance": 3.179, "atom1_id": "///A/483/O", "atom2_id": "///A/487/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 479, "atom1_serNum": 3802, "atom2_serNum": 3833, "donAcc_type": "standard", "distance": 2.913, "atom1_id": "///A/484/O", "atom2_id": "///A/488/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 480, "atom1_serNum": 3818, "atom2_serNum": 3874, "donAcc_type": "acceptable", "distance": 2.718, "atom1_id": "///A/485/OH", "atom2_id": "///A/492/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 481, "atom1_serNum": 3818, "atom2_serNum": 3902, "donAcc_type": "acceptable", "distance": 2.641, "atom1_id": "///A/485/OH", "atom2_id": "///A/496/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 482, "atom1_serNum": 3836, "atom2_serNum": 3866, "donAcc_type": "standard", "distance": 2.940, "atom1_id": "///A/488/O", "atom2_id": "///A/492/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 483, "atom1_serNum": 3839, "atom2_serNum": 3850, "donAcc_type": "standard", "distance": 2.929, "atom1_id": "///A/488/OD1", "atom2_id": "///A/490/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 484, "atom1_serNum": 3839, "atom2_serNum": 3859, "donAcc_type": "standard", "distance": 2.816, "atom1_id": "///A/488/OD1", "atom2_id": "///A/491/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 485, "atom1_serNum": 3844, "atom2_serNum": 3875, "donAcc_type": "standard", "distance": 3.039, "atom1_id": "///A/489/O", "atom2_id": "///A/493/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 486, "atom1_serNum": 3853, "atom2_serNum": 3880, "donAcc_type": "standard", "distance": 3.017, "atom1_id": "///A/490/O", "atom2_id": "///A/494/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 487, "atom1_serNum": 3862, "atom2_serNum": 3888, "donAcc_type": "standard", "distance": 2.835, "atom1_id": "///A/491/O", "atom2_id": "///A/495/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 488, "atom1_serNum": 3869, "atom2_serNum": 3896, "donAcc_type": "standard", "distance": 2.888, "atom1_id": "///A/492/O", "atom2_id": "///A/496/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 489, "atom1_serNum": 3874, "atom2_serNum": 3903, "donAcc_type": "standard", "distance": 2.905, "atom1_id": "///A/492/NZ", "atom2_id": "///A/496/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 490, "atom1_serNum": 3878, "atom2_serNum": 3904, "donAcc_type": "standard", "distance": 3.306, "atom1_id": "///A/493/O", "atom2_id": "///A/497/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 491, "atom1_serNum": 3883, "atom2_serNum": 3912, "donAcc_type": "standard", "distance": 2.828, "atom1_id": "///A/494/O", "atom2_id": "///A/498/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 492, "atom1_serNum": 3891, "atom2_serNum": 3917, "donAcc_type": "standard", "distance": 2.815, "atom1_id": "///A/495/O", "atom2_id": "///A/499/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 493, "atom1_serNum": 3902, "atom2_serNum": 3926, "donAcc_type": "standard", "distance": 3.641, "atom1_id": "///A/496/OD1", "atom2_id": "///A/499/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 494, "atom1_serNum": 3907, "atom2_serNum": 3937, "donAcc_type": "standard", "distance": 3.305, "atom1_id": "///A/497/O", "atom2_id": "///A/501/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 495, "atom1_serNum": 3915, "atom2_serNum": 3945, "donAcc_type": "standard", "distance": 3.022, "atom1_id": "///A/498/O", "atom2_id": "///A/502/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 496, "atom1_serNum": 3940, "atom2_serNum": 3958, "donAcc_type": "standard", "distance": 3.202, "atom1_id": "///A/501/O", "atom2_id": "///A/504/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 497, "atom1_serNum": 3989, "atom2_serNum": 4008, "donAcc_type": "standard", "distance": 3.384, "atom1_id": "///A/507/OD1", "atom2_id": "///A/510/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 498, "atom1_serNum": 4027, "atom2_serNum": 4355, "donAcc_type": "standard", "distance": 3.334, "atom1_id": "///A/513/O", "atom2_id": "///A/556/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 499, "atom1_serNum": 4032, "atom2_serNum": 4339, "donAcc_type": "standard", "distance": 2.615, "atom1_id": "///A/515/N", "atom2_id": "///A/554/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 500, "atom1_serNum": 4035, "atom2_serNum": 4336, "donAcc_type": "standard", "distance": 2.684, "atom1_id": "///A/515/O", "atom2_id": "///A/554/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 501, "atom1_serNum": 4046, "atom2_serNum": 4323, "donAcc_type": "standard", "distance": 3.501, "atom1_id": "///A/517/N", "atom2_id": "///A/552/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 502, "atom1_serNum": 4071, "atom2_serNum": 4104, "donAcc_type": "acceptable", "distance": 2.570, "atom1_id": "///A/520/OG1", "atom2_id": "///A/524/OD2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 503, "atom1_serNum": 4076, "atom2_serNum": 4097, "donAcc_type": "standard", "distance": 2.980, "atom1_id": "///A/521/O", "atom2_id": "///A/524/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 504, "atom1_serNum": 4081, "atom2_serNum": 4095, "donAcc_type": "acceptable", "distance": 3.555, "atom1_id": "///A/521/NZ", "atom2_id": "///A/523/OG1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 505, "atom1_serNum": 4081, "atom2_serNum": 4103, "donAcc_type": "standard", "distance": 3.107, "atom1_id": "///A/521/NZ", "atom2_id": "///A/524/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 506, "atom1_serNum": 4085, "atom2_serNum": 4105, "donAcc_type": "standard", "distance": 2.748, "atom1_id": "///A/522/O", "atom2_id": "///A/525/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 507, "atom1_serNum": 4085, "atom2_serNum": 4116, "donAcc_type": "standard", "distance": 3.049, "atom1_id": "///A/522/O", "atom2_id": "///A/526/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 508, "atom1_serNum": 4124, "atom2_serNum": 4224, "donAcc_type": "standard", "distance": 2.767, "atom1_id": "///A/527/O", "atom2_id": "///A/540/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 509, "atom1_serNum": 4136, "atom2_serNum": 4213, "donAcc_type": "standard", "distance": 2.602, "atom1_id": "///A/529/N", "atom2_id": "///A/538/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 510, "atom1_serNum": 4139, "atom2_serNum": 4210, "donAcc_type": "standard", "distance": 2.592, "atom1_id": "///A/529/O", "atom2_id": "///A/538/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 511, "atom1_serNum": 4154, "atom2_serNum": 4187, "donAcc_type": "standard", "distance": 2.753, "atom1_id": "///A/531/N", "atom2_id": "///A/535/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 512, "atom1_serNum": 4157, "atom2_serNum": 4180, "donAcc_type": "standard", "distance": 2.927, "atom1_id": "///A/531/O", "atom2_id": "///A/534/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 513, "atom1_serNum": 4160, "atom2_serNum": 4171, "donAcc_type": "standard", "distance": 3.004, "atom1_id": "///A/531/OD1", "atom2_id": "///A/533/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 514, "atom1_serNum": 4160, "atom2_serNum": 4180, "donAcc_type": "standard", "distance": 3.294, "atom1_id": "///A/531/OD1", "atom2_id": "///A/534/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 515, "atom1_serNum": 4160, "atom2_serNum": 4184, "donAcc_type": "standard", "distance": 2.729, "atom1_id": "///A/531/OD1", "atom2_id": "///A/535/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 516, "atom1_serNum": 4161, "atom2_serNum": 4199, "donAcc_type": "acceptable", "distance": 3.167, "atom1_id": "///A/531/OD2", "atom2_id": "///A/536/ND1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 517, "atom1_serNum": 4220, "atom2_serNum": 4222, "donAcc_type": "acceptable", "distance": 2.882, "atom1_id": "///A/539/O", "atom2_id": "///A/539/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 518, "atom1_serNum": 4222, "atom2_serNum": 4236, "donAcc_type": "acceptable", "distance": 2.855, "atom1_id": "///A/539/OG1", "atom2_id": "///A/541/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 519, "atom1_serNum": 4247, "atom2_serNum": 4275, "donAcc_type": "standard", "distance": 2.680, "atom1_id": "///A/542/O", "atom2_id": "///A/546/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 520, "atom1_serNum": 4250, "atom2_serNum": 4267, "donAcc_type": "standard", "distance": 3.149, "atom1_id": "///A/542/OD1", "atom2_id": "///A/545/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 521, "atom1_serNum": 4255, "atom2_serNum": 4282, "donAcc_type": "standard", "distance": 3.443, "atom1_id": "///A/543/O", "atom2_id": "///A/547/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 522, "atom1_serNum": 4260, "atom2_serNum": 4354, "donAcc_type": "standard", "distance": 2.855, "atom1_id": "///A/543/NZ", "atom2_id": "///A/555/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 523, "atom1_serNum": 4264, "atom2_serNum": 4291, "donAcc_type": "standard", "distance": 3.199, "atom1_id": "///A/544/O", "atom2_id": "///A/548/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 524, "atom1_serNum": 4270, "atom2_serNum": 4303, "donAcc_type": "standard", "distance": 3.016, "atom1_id": "///A/545/O", "atom2_id": "///A/549/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 525, "atom1_serNum": 4278, "atom2_serNum": 4312, "donAcc_type": "standard", "distance": 3.561, "atom1_id": "///A/546/O", "atom2_id": "///A/551/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 526, "atom1_serNum": 4285, "atom2_serNum": 4308, "donAcc_type": "standard", "distance": 2.916, "atom1_id": "///A/547/O", "atom2_id": "///A/550/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 527, "atom1_serNum": 4289, "atom2_serNum": 4327, "donAcc_type": "standard", "distance": 3.500, "atom1_id": "///A/547/OE1", "atom2_id": "///A/553/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 528, "atom1_serNum": 4335, "atom2_serNum": 4353, "donAcc_type": "standard", "distance": 2.945, "atom1_id": "///A/553/NZ", "atom2_id": "///A/555/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 529, "atom1_serNum": 4389, "atom2_serNum": 4419, "donAcc_type": "standard", "distance": 2.989, "atom1_id": "///A/560/O", "atom2_id": "///A/564/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 530, "atom1_serNum": 4395, "atom2_serNum": 6212, "donAcc_type": "standard", "distance": 2.693, "atom1_id": "///A/560/NH1", "atom2_id": "///A/789/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 531, "atom1_serNum": 4400, "atom2_serNum": 4427, "donAcc_type": "standard", "distance": 2.874, "atom1_id": "///A/561/O", "atom2_id": "///A/565/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 532, "atom1_serNum": 4407, "atom2_serNum": 4435, "donAcc_type": "standard", "distance": 2.901, "atom1_id": "///A/562/O", "atom2_id": "///A/566/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 533, "atom1_serNum": 4415, "atom2_serNum": 4443, "donAcc_type": "standard", "distance": 3.004, "atom1_id": "///A/563/O", "atom2_id": "///A/567/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 534, "atom1_serNum": 4422, "atom2_serNum": 4457, "donAcc_type": "standard", "distance": 2.865, "atom1_id": "///A/564/O", "atom2_id": "///A/568/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 535, "atom1_serNum": 4430, "atom2_serNum": 4462, "donAcc_type": "standard", "distance": 2.740, "atom1_id": "///A/565/O", "atom2_id": "///A/569/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 536, "atom1_serNum": 4438, "atom2_serNum": 4470, "donAcc_type": "standard", "distance": 3.027, "atom1_id": "///A/566/O", "atom2_id": "///A/570/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 537, "atom1_serNum": 4446, "atom2_serNum": 4479, "donAcc_type": "standard", "distance": 3.204, "atom1_id": "///A/567/O", "atom2_id": "///A/571/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 538, "atom1_serNum": 4460, "atom2_serNum": 4487, "donAcc_type": "standard", "distance": 2.831, "atom1_id": "///A/568/O", "atom2_id": "///A/572/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 539, "atom1_serNum": 4465, "atom2_serNum": 4495, "donAcc_type": "standard", "distance": 2.836, "atom1_id": "///A/569/O", "atom2_id": "///A/573/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 540, "atom1_serNum": 4473, "atom2_serNum": 4503, "donAcc_type": "standard", "distance": 3.137, "atom1_id": "///A/570/O", "atom2_id": "///A/574/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 541, "atom1_serNum": 4490, "atom2_serNum": 4512, "donAcc_type": "standard", "distance": 3.018, "atom1_id": "///A/572/O", "atom2_id": "///A/575/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 542, "atom1_serNum": 4498, "atom2_serNum": 4523, "donAcc_type": "standard", "distance": 3.078, "atom1_id": "///A/573/O", "atom2_id": "///A/576/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 543, "atom1_serNum": 4501, "atom2_serNum": 4583, "donAcc_type": "standard", "distance": 2.750, "atom1_id": "///A/573/OD1", "atom2_id": "///A/584/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 544, "atom1_serNum": 4526, "atom2_serNum": 4548, "donAcc_type": "standard", "distance": 2.719, "atom1_id": "///A/576/O", "atom2_id": "///A/579/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 545, "atom1_serNum": 4526, "atom2_serNum": 4556, "donAcc_type": "standard", "distance": 2.513, "atom1_id": "///A/576/O", "atom2_id": "///A/580/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 546, "atom1_serNum": 4526, "atom2_serNum": 4560, "donAcc_type": "standard", "distance": 3.327, "atom1_id": "///A/576/O", "atom2_id": "///A/581/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 547, "atom1_serNum": 4568, "atom2_serNum": 6136, "donAcc_type": "acceptable", "distance": 3.241, "atom1_id": "///A/581/OE2", "atom2_id": "///A/778/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 548, "atom1_serNum": 4594, "atom2_serNum": 4612, "donAcc_type": "standard", "distance": 2.751, "atom1_id": "///A/585/O", "atom2_id": "///A/588/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 549, "atom1_serNum": 4597, "atom2_serNum": 4607, "donAcc_type": "standard", "distance": 3.281, "atom1_id": "///A/585/OD1", "atom2_id": "///A/587/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 550, "atom1_serNum": 4602, "atom2_serNum": 4617, "donAcc_type": "standard", "distance": 3.536, "atom1_id": "///A/586/O", "atom2_id": "///A/589/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 551, "atom1_serNum": 4628, "atom2_serNum": 6054, "donAcc_type": "acceptable", "distance": 2.699, "atom1_id": "///A/590/O", "atom2_id": "///A/769/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 552, "atom1_serNum": 4640, "atom2_serNum": 4646, "donAcc_type": "standard", "distance": 2.608, "atom1_id": "///A/592/N", "atom2_id": "///A/592/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 553, "atom1_serNum": 4648, "atom2_serNum": 6054, "donAcc_type": "acceptable", "distance": 3.268, "atom1_id": "///A/593/N", "atom2_id": "///A/769/OH", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 554, "atom1_serNum": 4651, "atom2_serNum": 4680, "donAcc_type": "standard", "distance": 3.151, "atom1_id": "///A/593/O", "atom2_id": "///A/597/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 555, "atom1_serNum": 4655, "atom2_serNum": 4674, "donAcc_type": "standard", "distance": 2.818, "atom1_id": "///A/593/OD2", "atom2_id": "///A/596/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 556, "atom1_serNum": 4655, "atom2_serNum": 4679, "donAcc_type": "acceptable", "distance": 2.966, "atom1_id": "///A/593/OD2", "atom2_id": "///A/596/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 557, "atom1_serNum": 4659, "atom2_serNum": 4691, "donAcc_type": "standard", "distance": 2.587, "atom1_id": "///A/594/O", "atom2_id": "///A/598/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 558, "atom1_serNum": 4664, "atom2_serNum": 4698, "donAcc_type": "standard", "distance": 2.995, "atom1_id": "///A/594/NZ", "atom2_id": "///A/598/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 559, "atom1_serNum": 4668, "atom2_serNum": 4699, "donAcc_type": "standard", "distance": 2.963, "atom1_id": "///A/595/O", "atom2_id": "///A/599/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 560, "atom1_serNum": 4673, "atom2_serNum": 6113, "donAcc_type": "standard", "distance": 2.673, "atom1_id": "///A/595/NZ", "atom2_id": "///A/776/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 561, "atom1_serNum": 4677, "atom2_serNum": 4707, "donAcc_type": "standard", "distance": 3.034, "atom1_id": "///A/596/O", "atom2_id": "///A/600/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 562, "atom1_serNum": 4683, "atom2_serNum": 4715, "donAcc_type": "standard", "distance": 2.939, "atom1_id": "///A/597/O", "atom2_id": "///A/601/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 563, "atom1_serNum": 4694, "atom2_serNum": 4724, "donAcc_type": "standard", "distance": 3.029, "atom1_id": "///A/598/O", "atom2_id": "///A/602/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 564, "atom1_serNum": 4702, "atom2_serNum": 4741, "donAcc_type": "standard", "distance": 3.429, "atom1_id": "///A/599/O", "atom2_id": "///A/604/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 565, "atom1_serNum": 4710, "atom2_serNum": 4735, "donAcc_type": "standard", "distance": 2.898, "atom1_id": "///A/600/O", "atom2_id": "///A/603/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 566, "atom1_serNum": 4718, "atom2_serNum": 4911, "donAcc_type": "standard", "distance": 2.528, "atom1_id": "///A/601/O", "atom2_id": "///A/624/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 567, "atom1_serNum": 4733, "atom2_serNum": 4748, "donAcc_type": "standard", "distance": 2.632, "atom1_id": "///A/602/NH1", "atom2_id": "///A/604/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 568, "atom1_serNum": 4738, "atom2_serNum": 4750, "donAcc_type": "standard", "distance": 3.016, "atom1_id": "///A/603/O", "atom2_id": "///A/605/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 569, "atom1_serNum": 4740, "atom2_serNum": 4845, "donAcc_type": "acceptable", "distance": 3.717, "atom1_id": "///A/603/OG", "atom2_id": "///A/617/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 570, "atom1_serNum": 4744, "atom2_serNum": 6109, "donAcc_type": "standard", "distance": 2.426, "atom1_id": "///A/604/O", "atom2_id": "///A/775/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 571, "atom1_serNum": 4753, "atom2_serNum": 4769, "donAcc_type": "standard", "distance": 3.289, "atom1_id": "///A/605/O", "atom2_id": "///A/608/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 572, "atom1_serNum": 4760, "atom2_serNum": 6109, "donAcc_type": "standard", "distance": 3.371, "atom1_id": "///A/606/O", "atom2_id": "///A/775/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 573, "atom1_serNum": 4762, "atom2_serNum": 4850, "donAcc_type": "acceptable", "distance": 2.519, "atom1_id": "///A/606/OG1", "atom2_id": "///A/617/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 574, "atom1_serNum": 4772, "atom2_serNum": 4796, "donAcc_type": "standard", "distance": 3.029, "atom1_id": "///A/608/O", "atom2_id": "///A/611/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 575, "atom1_serNum": 4776, "atom2_serNum": 6069, "donAcc_type": "acceptable", "distance": 3.460, "atom1_id": "///A/609/N", "atom2_id": "///A/771/OG1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 576, "atom1_serNum": 4794, "atom2_serNum": 6042, "donAcc_type": "acceptable", "distance": 2.544, "atom1_id": "///A/610/OE1", "atom2_id": "///A/768/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 577, "atom1_serNum": 4816, "atom2_serNum": 4842, "donAcc_type": "standard", "distance": 3.056, "atom1_id": "///A/613/O", "atom2_id": "///A/617/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 578, "atom1_serNum": 4822, "atom2_serNum": 4851, "donAcc_type": "standard", "distance": 2.859, "atom1_id": "///A/614/O", "atom2_id": "///A/618/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 579, "atom1_serNum": 4826, "atom2_serNum": 4857, "donAcc_type": "standard", "distance": 3.013, "atom1_id": "///A/614/NE", "atom2_id": "///A/618/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 580, "atom1_serNum": 4833, "atom2_serNum": 4859, "donAcc_type": "standard", "distance": 2.949, "atom1_id": "///A/615/O", "atom2_id": "///A/619/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 581, "atom1_serNum": 4837, "atom2_serNum": 4867, "donAcc_type": "standard", "distance": 2.911, "atom1_id": "///A/616/O", "atom2_id": "///A/620/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 582, "atom1_serNum": 4845, "atom2_serNum": 4875, "donAcc_type": "standard", "distance": 3.109, "atom1_id": "///A/617/O", "atom2_id": "///A/621/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 583, "atom1_serNum": 4854, "atom2_serNum": 4884, "donAcc_type": "standard", "distance": 3.281, "atom1_id": "///A/618/O", "atom2_id": "///A/622/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 584, "atom1_serNum": 4862, "atom2_serNum": 4895, "donAcc_type": "standard", "distance": 2.824, "atom1_id": "///A/619/O", "atom2_id": "///A/623/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 585, "atom1_serNum": 4870, "atom2_serNum": 4903, "donAcc_type": "standard", "distance": 2.743, "atom1_id": "///A/620/O", "atom2_id": "///A/624/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 586, "atom1_serNum": 4878, "atom2_serNum": 4911, "donAcc_type": "standard", "distance": 3.228, "atom1_id": "///A/621/O", "atom2_id": "///A/624/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 587, "atom1_serNum": 4925, "atom2_serNum": 5154, "donAcc_type": "standard", "distance": 3.043, "atom1_id": "///A/626/OD1", "atom2_id": "///A/655/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 588, "atom1_serNum": 4926, "atom2_serNum": 5154, "donAcc_type": "standard", "distance": 2.746, "atom1_id": "///A/626/OD2", "atom2_id": "///A/655/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 589, "atom1_serNum": 4930, "atom2_serNum": 4961, "donAcc_type": "standard", "distance": 3.377, "atom1_id": "///A/627/O", "atom2_id": "///A/631/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 590, "atom1_serNum": 4936, "atom2_serNum": 4969, "donAcc_type": "standard", "distance": 2.884, "atom1_id": "///A/628/O", "atom2_id": "///A/632/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 591, "atom1_serNum": 4947, "atom2_serNum": 4977, "donAcc_type": "standard", "distance": 3.078, "atom1_id": "///A/629/O", "atom2_id": "///A/633/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 592, "atom1_serNum": 4951, "atom2_serNum": 5972, "donAcc_type": "standard", "distance": 3.470, "atom1_id": "///A/629/OE1", "atom2_id": "///A/758/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 593, "atom1_serNum": 4956, "atom2_serNum": 4982, "donAcc_type": "standard", "distance": 3.245, "atom1_id": "///A/630/O", "atom2_id": "///A/634/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 594, "atom1_serNum": 4960, "atom2_serNum": 5376, "donAcc_type": "acceptable", "distance": 3.497, "atom1_id": "///A/630/OD2", "atom2_id": "///A/681/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 595, "atom1_serNum": 4972, "atom2_serNum": 5994, "donAcc_type": "acceptable", "distance": 2.629, "atom1_id": "///A/632/O", "atom2_id": "///A/761/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 596, "atom1_serNum": 4980, "atom2_serNum": 4997, "donAcc_type": "standard", "distance": 2.943, "atom1_id": "///A/633/O", "atom2_id": "///A/636/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 597, "atom1_serNum": 4980, "atom2_serNum": 5002, "donAcc_type": "standard", "distance": 2.913, "atom1_id": "///A/633/O", "atom2_id": "///A/637/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 598, "atom1_serNum": 4985, "atom2_serNum": 5010, "donAcc_type": "standard", "distance": 2.957, "atom1_id": "///A/634/O", "atom2_id": "///A/638/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 599, "atom1_serNum": 5000, "atom2_serNum": 5030, "donAcc_type": "standard", "distance": 2.681, "atom1_id": "///A/636/O", "atom2_id": "///A/639/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 600, "atom1_serNum": 5005, "atom2_serNum": 5021, "donAcc_type": "standard", "distance": 2.839, "atom1_id": "///A/637/O", "atom2_id": "///A/639/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 601, "atom1_serNum": 5024, "atom2_serNum": 5050, "donAcc_type": "standard", "distance": 3.330, "atom1_id": "///A/639/O", "atom2_id": "///A/643/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 602, "atom1_serNum": 5030, "atom2_serNum": 5932, "donAcc_type": "standard", "distance": 3.023, "atom1_id": "///A/639/NH1", "atom2_id": "///A/754/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 603, "atom1_serNum": 5031, "atom2_serNum": 5932, "donAcc_type": "standard", "distance": 2.362, "atom1_id": "///A/639/NH2", "atom2_id": "///A/754/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 604, "atom1_serNum": 5035, "atom2_serNum": 5058, "donAcc_type": "standard", "distance": 3.101, "atom1_id": "///A/640/O", "atom2_id": "///A/644/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 605, "atom1_serNum": 5035, "atom2_serNum": 5066, "donAcc_type": "standard", "distance": 3.088, "atom1_id": "///A/640/O", "atom2_id": "///A/644/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 606, "atom1_serNum": 5042, "atom2_serNum": 5067, "donAcc_type": "standard", "distance": 3.007, "atom1_id": "///A/641/O", "atom2_id": "///A/645/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 607, "atom1_serNum": 5046, "atom2_serNum": 5077, "donAcc_type": "standard", "distance": 3.196, "atom1_id": "///A/642/O", "atom2_id": "///A/647/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 608, "atom1_serNum": 5046, "atom2_serNum": 5085, "donAcc_type": "standard", "distance": 3.314, "atom1_id": "///A/642/O", "atom2_id": "///A/648/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 609, "atom1_serNum": 5053, "atom2_serNum": 5073, "donAcc_type": "standard", "distance": 3.694, "atom1_id": "///A/643/O", "atom2_id": "///A/646/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 610, "atom1_serNum": 5076, "atom2_serNum": 5100, "donAcc_type": "standard", "distance": 2.999, "atom1_id": "///A/646/O", "atom2_id": "///A/650/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 611, "atom1_serNum": 5080, "atom2_serNum": 5108, "donAcc_type": "standard", "distance": 2.844, "atom1_id": "///A/647/O", "atom2_id": "///A/651/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 612, "atom1_serNum": 5088, "atom2_serNum": 5119, "donAcc_type": "standard", "distance": 2.968, "atom1_id": "///A/648/O", "atom2_id": "///A/652/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 613, "atom1_serNum": 5095, "atom2_serNum": 5127, "donAcc_type": "standard", "distance": 2.846, "atom1_id": "///A/649/O", "atom2_id": "///A/653/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 614, "atom1_serNum": 5103, "atom2_serNum": 5135, "donAcc_type": "standard", "distance": 2.771, "atom1_id": "///A/650/O", "atom2_id": "///A/654/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 615, "atom1_serNum": 5111, "atom2_serNum": 5146, "donAcc_type": "standard", "distance": 2.992, "atom1_id": "///A/651/O", "atom2_id": "///A/655/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 616, "atom1_serNum": 5122, "atom2_serNum": 5155, "donAcc_type": "standard", "distance": 3.370, "atom1_id": "///A/652/O", "atom2_id": "///A/656/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 617, "atom1_serNum": 5122, "atom2_serNum": 5161, "donAcc_type": "acceptable", "distance": 3.240, "atom1_id": "///A/652/O", "atom2_id": "///A/656/ND1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 618, "atom1_serNum": 5130, "atom2_serNum": 5169, "donAcc_type": "standard", "distance": 3.063, "atom1_id": "///A/653/O", "atom2_id": "///A/658/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 619, "atom1_serNum": 5133, "atom2_serNum": 5176, "donAcc_type": "standard", "distance": 3.103, "atom1_id": "///A/653/OD1", "atom2_id": "///A/658/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 620, "atom1_serNum": 5133, "atom2_serNum": 5179, "donAcc_type": "standard", "distance": 3.053, "atom1_id": "///A/653/OD1", "atom2_id": "///A/658/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 621, "atom1_serNum": 5142, "atom2_serNum": 5368, "donAcc_type": "standard", "distance": 3.523, "atom1_id": "///A/654/NE", "atom2_id": "///A/681/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 622, "atom1_serNum": 5144, "atom2_serNum": 5188, "donAcc_type": "standard", "distance": 3.585, "atom1_id": "///A/654/NH1", "atom2_id": "///A/659/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 623, "atom1_serNum": 5145, "atom2_serNum": 5227, "donAcc_type": "standard", "distance": 2.591, "atom1_id": "///A/654/NH2", "atom2_id": "///A/664/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 624, "atom1_serNum": 5212, "atom2_serNum": 5276, "donAcc_type": "standard", "distance": 3.303, "atom1_id": "///A/663/N", "atom2_id": "///A/669/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 625, "atom1_serNum": 5215, "atom2_serNum": 5278, "donAcc_type": "standard", "distance": 3.013, "atom1_id": "///A/663/O", "atom2_id": "///A/670/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 626, "atom1_serNum": 5231, "atom2_serNum": 5258, "donAcc_type": "standard", "distance": 3.151, "atom1_id": "///A/665/N", "atom2_id": "///A/668/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 627, "atom1_serNum": 5238, "atom2_serNum": 5246, "donAcc_type": "standard", "distance": 3.073, "atom1_id": "///A/665/OD2", "atom2_id": "///A/667/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 628, "atom1_serNum": 5238, "atom2_serNum": 5255, "donAcc_type": "standard", "distance": 3.474, "atom1_id": "///A/665/OD2", "atom2_id": "///A/668/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 629, "atom1_serNum": 5242, "atom2_serNum": 5277, "donAcc_type": "standard", "distance": 2.622, "atom1_id": "///A/666/O", "atom2_id": "///A/669/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 630, "atom1_serNum": 5249, "atom2_serNum": 5269, "donAcc_type": "standard", "distance": 3.061, "atom1_id": "///A/667/O", "atom2_id": "///A/669/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 631, "atom1_serNum": 5281, "atom2_serNum": 5303, "donAcc_type": "standard", "distance": 2.969, "atom1_id": "///A/670/O", "atom2_id": "///A/673/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 632, "atom1_serNum": 5284, "atom2_serNum": 5302, "donAcc_type": "acceptable", "distance": 2.653, "atom1_id": "///A/670/ND1", "atom2_id": "///A/672/OG", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 633, "atom1_serNum": 5291, "atom2_serNum": 5311, "donAcc_type": "standard", "distance": 3.152, "atom1_id": "///A/671/O", "atom2_id": "///A/674/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 634, "atom1_serNum": 5306, "atom2_serNum": 5334, "donAcc_type": "standard", "distance": 2.782, "atom1_id": "///A/673/O", "atom2_id": "///A/677/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 635, "atom1_serNum": 5314, "atom2_serNum": 5342, "donAcc_type": "standard", "distance": 2.682, "atom1_id": "///A/674/O", "atom2_id": "///A/678/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 636, "atom1_serNum": 5330, "atom2_serNum": 5443, "donAcc_type": "standard", "distance": 3.270, "atom1_id": "///A/676/O", "atom2_id": "///A/689/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 637, "atom1_serNum": 5337, "atom2_serNum": 5358, "donAcc_type": "standard", "distance": 3.173, "atom1_id": "///A/677/O", "atom2_id": "///A/680/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 638, "atom1_serNum": 5337, "atom2_serNum": 5363, "donAcc_type": "acceptable", "distance": 3.187, "atom1_id": "///A/677/O", "atom2_id": "///A/680/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 639, "atom1_serNum": 5337, "atom2_serNum": 5365, "donAcc_type": "standard", "distance": 3.299, "atom1_id": "///A/677/O", "atom2_id": "///A/681/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 640, "atom1_serNum": 5337, "atom2_serNum": 5377, "donAcc_type": "standard", "distance": 3.119, "atom1_id": "///A/677/O", "atom2_id": "///A/682/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 641, "atom1_serNum": 5345, "atom2_serNum": 5365, "donAcc_type": "standard", "distance": 3.172, "atom1_id": "///A/678/O", "atom2_id": "///A/681/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 642, "atom1_serNum": 5361, "atom2_serNum": 5381, "donAcc_type": "standard", "distance": 3.062, "atom1_id": "///A/680/O", "atom2_id": "///A/683/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 643, "atom1_serNum": 5363, "atom2_serNum": 5384, "donAcc_type": "acceptable", "distance": 2.685, "atom1_id": "///A/680/OG1", "atom2_id": "///A/683/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 644, "atom1_serNum": 5363, "atom2_serNum": 5443, "donAcc_type": "acceptable", "distance": 3.219, "atom1_id": "///A/680/OG1", "atom2_id": "///A/689/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 645, "atom1_serNum": 5384, "atom2_serNum": 5397, "donAcc_type": "standard", "distance": 3.207, "atom1_id": "///A/683/O", "atom2_id": "///A/685/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 646, "atom1_serNum": 5397, "atom2_serNum": 5442, "donAcc_type": "standard", "distance": 2.722, "atom1_id": "///A/685/N", "atom2_id": "///A/689/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 647, "atom1_serNum": 5400, "atom2_serNum": 5945, "donAcc_type": "standard", "distance": 3.738, "atom1_id": "///A/685/O", "atom2_id": "///A/756/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 648, "atom1_serNum": 5405, "atom2_serNum": 5442, "donAcc_type": "standard", "distance": 3.038, "atom1_id": "///A/686/N", "atom2_id": "///A/689/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 649, "atom1_serNum": 5408, "atom2_serNum": 5444, "donAcc_type": "standard", "distance": 3.271, "atom1_id": "///A/686/O", "atom2_id": "///A/690/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 650, "atom1_serNum": 5417, "atom2_serNum": 5948, "donAcc_type": "standard", "distance": 3.221, "atom1_id": "///A/687/N", "atom2_id": "///A/756/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 651, "atom1_serNum": 5420, "atom2_serNum": 5451, "donAcc_type": "standard", "distance": 3.318, "atom1_id": "///A/687/O", "atom2_id": "///A/691/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 652, "atom1_serNum": 5425, "atom2_serNum": 5944, "donAcc_type": "standard", "distance": 2.455, "atom1_id": "///A/687/NE2", "atom2_id": "///A/755/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 653, "atom1_serNum": 5426, "atom2_serNum": 5433, "donAcc_type": "standard", "distance": 2.721, "atom1_id": "///A/688/N", "atom2_id": "///A/688/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 654, "atom1_serNum": 5429, "atom2_serNum": 5459, "donAcc_type": "standard", "distance": 2.905, "atom1_id": "///A/688/O", "atom2_id": "///A/692/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 655, "atom1_serNum": 5433, "atom2_serNum": 5964, "donAcc_type": "standard", "distance": 2.760, "atom1_id": "///A/688/OE1", "atom2_id": "///A/758/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 656, "atom1_serNum": 5434, "atom2_serNum": 5963, "donAcc_type": "standard", "distance": 2.864, "atom1_id": "///A/688/OE2", "atom2_id": "///A/757/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 657, "atom1_serNum": 5434, "atom2_serNum": 5973, "donAcc_type": "standard", "distance": 2.706, "atom1_id": "///A/688/OE2", "atom2_id": "///A/759/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 658, "atom1_serNum": 5438, "atom2_serNum": 5468, "donAcc_type": "standard", "distance": 2.919, "atom1_id": "///A/689/O", "atom2_id": "///A/693/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 659, "atom1_serNum": 5447, "atom2_serNum": 5476, "donAcc_type": "standard", "distance": 3.318, "atom1_id": "///A/690/O", "atom2_id": "///A/694/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 660, "atom1_serNum": 5454, "atom2_serNum": 5481, "donAcc_type": "standard", "distance": 3.036, "atom1_id": "///A/691/O", "atom2_id": "///A/695/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 661, "atom1_serNum": 5462, "atom2_serNum": 5490, "donAcc_type": "standard", "distance": 2.886, "atom1_id": "///A/692/O", "atom2_id": "///A/696/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 662, "atom1_serNum": 5471, "atom2_serNum": 5497, "donAcc_type": "standard", "distance": 2.833, "atom1_id": "///A/693/O", "atom2_id": "///A/697/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 663, "atom1_serNum": 5479, "atom2_serNum": 5511, "donAcc_type": "standard", "distance": 3.059, "atom1_id": "///A/694/O", "atom2_id": "///A/699/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 664, "atom1_serNum": 5479, "atom2_serNum": 5515, "donAcc_type": "standard", "distance": 2.932, "atom1_id": "///A/694/O", "atom2_id": "///A/700/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 665, "atom1_serNum": 5500, "atom2_serNum": 5784, "donAcc_type": "standard", "distance": 3.210, "atom1_id": "///A/697/O", "atom2_id": "///A/734/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 666, "atom1_serNum": 5510, "atom2_serNum": 5728, "donAcc_type": "acceptable", "distance": 3.823, "atom1_id": "///A/698/OG", "atom2_id": "///A/727/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 667, "atom1_serNum": 5526, "atom2_serNum": 5725, "donAcc_type": "acceptable", "distance": 3.361, "atom1_id": "///A/700/OH", "atom2_id": "///A/727/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 668, "atom1_serNum": 5530, "atom2_serNum": 5550, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///A/701/O", "atom2_id": "///A/705/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 669, "atom1_serNum": 5532, "atom2_serNum": 5546, "donAcc_type": "acceptable", "distance": 3.016, "atom1_id": "///A/701/OG1", "atom2_id": "///A/704/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 670, "atom1_serNum": 5537, "atom2_serNum": 5555, "donAcc_type": "standard", "distance": 3.109, "atom1_id": "///A/702/O", "atom2_id": "///A/706/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 671, "atom1_serNum": 5545, "atom2_serNum": 5563, "donAcc_type": "standard", "distance": 3.185, "atom1_id": "///A/703/O", "atom2_id": "///A/707/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 672, "atom1_serNum": 5549, "atom2_serNum": 5571, "donAcc_type": "standard", "distance": 3.154, "atom1_id": "///A/704/O", "atom2_id": "///A/708/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 673, "atom1_serNum": 5553, "atom2_serNum": 5579, "donAcc_type": "standard", "distance": 3.201, "atom1_id": "///A/705/O", "atom2_id": "///A/709/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 674, "atom1_serNum": 5558, "atom2_serNum": 5590, "donAcc_type": "standard", "distance": 3.108, "atom1_id": "///A/706/O", "atom2_id": "///A/710/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 675, "atom1_serNum": 5561, "atom2_serNum": 5588, "donAcc_type": "standard", "distance": 2.328, "atom1_id": "///A/706/OD1", "atom2_id": "///A/709/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 676, "atom1_serNum": 5561, "atom2_serNum": 5589, "donAcc_type": "standard", "distance": 3.356, "atom1_id": "///A/706/OD1", "atom2_id": "///A/709/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 677, "atom1_serNum": 5562, "atom2_serNum": 5597, "donAcc_type": "standard", "distance": 2.751, "atom1_id": "///A/706/OD2", "atom2_id": "///A/710/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 678, "atom1_serNum": 5562, "atom2_serNum": 5600, "donAcc_type": "standard", "distance": 3.089, "atom1_id": "///A/706/OD2", "atom2_id": "///A/710/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 679, "atom1_serNum": 5566, "atom2_serNum": 5601, "donAcc_type": "standard", "distance": 3.088, "atom1_id": "///A/707/O", "atom2_id": "///A/711/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 680, "atom1_serNum": 5574, "atom2_serNum": 5606, "donAcc_type": "standard", "distance": 2.897, "atom1_id": "///A/708/O", "atom2_id": "///A/712/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 681, "atom1_serNum": 5582, "atom2_serNum": 5614, "donAcc_type": "standard", "distance": 3.204, "atom1_id": "///A/709/O", "atom2_id": "///A/713/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 682, "atom1_serNum": 5593, "atom2_serNum": 5614, "donAcc_type": "standard", "distance": 3.091, "atom1_id": "///A/710/O", "atom2_id": "///A/713/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 683, "atom1_serNum": 5593, "atom2_serNum": 5618, "donAcc_type": "standard", "distance": 3.398, "atom1_id": "///A/710/O", "atom2_id": "///A/714/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 684, "atom1_serNum": 5604, "atom2_serNum": 5627, "donAcc_type": "standard", "distance": 3.164, "atom1_id": "///A/711/O", "atom2_id": "///A/715/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 685, "atom1_serNum": 5621, "atom2_serNum": 5644, "donAcc_type": "standard", "distance": 2.823, "atom1_id": "///A/714/O", "atom2_id": "///A/716/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 686, "atom1_serNum": 5648, "atom2_serNum": 5678, "donAcc_type": "standard", "distance": 3.805, "atom1_id": "///A/717/O", "atom2_id": "///A/721/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 687, "atom1_serNum": 5655, "atom2_serNum": 5678, "donAcc_type": "standard", "distance": 2.972, "atom1_id": "///A/718/O", "atom2_id": "///A/721/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 688, "atom1_serNum": 5664, "atom2_serNum": 5683, "donAcc_type": "standard", "distance": 3.265, "atom1_id": "///A/719/O", "atom2_id": "///A/722/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 689, "atom1_serNum": 5673, "atom2_serNum": 5692, "donAcc_type": "standard", "distance": 2.902, "atom1_id": "///A/720/O", "atom2_id": "///A/723/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 690, "atom1_serNum": 5673, "atom2_serNum": 5701, "donAcc_type": "standard", "distance": 2.754, "atom1_id": "///A/720/O", "atom2_id": "///A/724/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 691, "atom1_serNum": 5686, "atom2_serNum": 5712, "donAcc_type": "standard", "distance": 3.184, "atom1_id": "///A/722/O", "atom2_id": "///A/725/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 692, "atom1_serNum": 5686, "atom2_serNum": 5718, "donAcc_type": "standard", "distance": 3.132, "atom1_id": "///A/722/O", "atom2_id": "///A/726/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 693, "atom1_serNum": 5695, "atom2_serNum": 5725, "donAcc_type": "standard", "distance": 2.722, "atom1_id": "///A/723/O", "atom2_id": "///A/727/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 694, "atom1_serNum": 5710, "atom2_serNum": 5874, "donAcc_type": "standard", "distance": 2.999, "atom1_id": "///A/724/NH1", "atom2_id": "///A/746/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 695, "atom1_serNum": 5710, "atom2_serNum": 5898, "donAcc_type": "standard", "distance": 3.620, "atom1_id": "///A/724/NH1", "atom2_id": "///A/749/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 696, "atom1_serNum": 5715, "atom2_serNum": 5741, "donAcc_type": "standard", "distance": 3.238, "atom1_id": "///A/725/O", "atom2_id": "///A/729/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 697, "atom1_serNum": 5721, "atom2_serNum": 5750, "donAcc_type": "standard", "distance": 2.895, "atom1_id": "///A/726/O", "atom2_id": "///A/730/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 698, "atom1_serNum": 5739, "atom2_serNum": 5759, "donAcc_type": "standard", "distance": 3.015, "atom1_id": "///A/728/O", "atom2_id": "///A/732/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 699, "atom1_serNum": 5744, "atom2_serNum": 5768, "donAcc_type": "standard", "distance": 3.098, "atom1_id": "///A/729/O", "atom2_id": "///A/733/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 700, "atom1_serNum": 5753, "atom2_serNum": 5777, "donAcc_type": "standard", "distance": 3.192, "atom1_id": "///A/730/O", "atom2_id": "///A/734/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 701, "atom1_serNum": 5757, "atom2_serNum": 5777, "donAcc_type": "standard", "distance": 3.006, "atom1_id": "///A/731/O", "atom2_id": "///A/734/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 702, "atom1_serNum": 5757, "atom2_serNum": 5785, "donAcc_type": "standard", "distance": 3.171, "atom1_id": "///A/731/O", "atom2_id": "///A/735/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 703, "atom1_serNum": 5757, "atom2_serNum": 5789, "donAcc_type": "standard", "distance": 3.077, "atom1_id": "///A/731/O", "atom2_id": "///A/736/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 704, "atom1_serNum": 5762, "atom2_serNum": 5785, "donAcc_type": "standard", "distance": 2.886, "atom1_id": "///A/732/O", "atom2_id": "///A/735/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 705, "atom1_serNum": 5767, "atom2_serNum": 5792, "donAcc_type": "questionable", "distance": 3.308, "atom1_id": "///A/732/OE2", "atom2_id": "///A/736/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 706, "atom1_serNum": 5767, "atom2_serNum": 5805, "donAcc_type": "standard", "distance": 3.038, "atom1_id": "///A/732/OE2", "atom2_id": "///A/738/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 707, "atom1_serNum": 5800, "atom2_serNum": 5827, "donAcc_type": "standard", "distance": 2.993, "atom1_id": "///A/737/O", "atom2_id": "///A/741/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 708, "atom1_serNum": 5803, "atom2_serNum": 5810, "donAcc_type": "standard", "distance": 3.237, "atom1_id": "///A/737/OD1", "atom2_id": "///A/739/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 709, "atom1_serNum": 5803, "atom2_serNum": 5819, "donAcc_type": "standard", "distance": 3.456, "atom1_id": "///A/737/OD1", "atom2_id": "///A/740/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 710, "atom1_serNum": 5808, "atom2_serNum": 5832, "donAcc_type": "standard", "distance": 2.920, "atom1_id": "///A/738/O", "atom2_id": "///A/742/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 711, "atom1_serNum": 5813, "atom2_serNum": 5840, "donAcc_type": "standard", "distance": 2.864, "atom1_id": "///A/739/O", "atom2_id": "///A/743/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 712, "atom1_serNum": 5822, "atom2_serNum": 5849, "donAcc_type": "standard", "distance": 2.908, "atom1_id": "///A/740/O", "atom2_id": "///A/744/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 713, "atom1_serNum": 5830, "atom2_serNum": 5857, "donAcc_type": "standard", "distance": 3.070, "atom1_id": "///A/741/O", "atom2_id": "///A/745/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 714, "atom1_serNum": 5835, "atom2_serNum": 5868, "donAcc_type": "standard", "distance": 3.069, "atom1_id": "///A/742/O", "atom2_id": "///A/746/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 715, "atom1_serNum": 5843, "atom2_serNum": 5876, "donAcc_type": "standard", "distance": 3.415, "atom1_id": "///A/743/O", "atom2_id": "///A/747/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 716, "atom1_serNum": 5852, "atom2_serNum": 5884, "donAcc_type": "standard", "distance": 2.819, "atom1_id": "///A/744/O", "atom2_id": "///A/748/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 717, "atom1_serNum": 5860, "atom2_serNum": 5891, "donAcc_type": "standard", "distance": 2.941, "atom1_id": "///A/745/O", "atom2_id": "///A/749/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 718, "atom1_serNum": 5871, "atom2_serNum": 5900, "donAcc_type": "standard", "distance": 3.066, "atom1_id": "///A/746/O", "atom2_id": "///A/750/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 719, "atom1_serNum": 5879, "atom2_serNum": 5909, "donAcc_type": "standard", "distance": 3.000, "atom1_id": "///A/747/O", "atom2_id": "///A/751/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 720, "atom1_serNum": 5887, "atom2_serNum": 5920, "donAcc_type": "standard", "distance": 2.731, "atom1_id": "///A/748/O", "atom2_id": "///A/752/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 721, "atom1_serNum": 5912, "atom2_serNum": 5941, "donAcc_type": "standard", "distance": 2.913, "atom1_id": "///A/751/O", "atom2_id": "///A/755/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 722, "atom1_serNum": 5948, "atom2_serNum": 5964, "donAcc_type": "standard", "distance": 3.155, "atom1_id": "///A/756/O", "atom2_id": "///A/758/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 723, "atom1_serNum": 5959, "atom2_serNum": 5989, "donAcc_type": "standard", "distance": 2.928, "atom1_id": "///A/757/O", "atom2_id": "///A/761/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 724, "atom1_serNum": 5963, "atom2_serNum": 5978, "donAcc_type": "acceptable", "distance": 2.560, "atom1_id": "///A/757/ND2", "atom2_id": "///A/759/OG", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 725, "atom1_serNum": 5963, "atom2_serNum": 5979, "donAcc_type": "questionable", "distance": 3.215, "atom1_id": "///A/757/ND2", "atom2_id": "///A/760/N", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 726, "atom1_serNum": 5967, "atom2_serNum": 5995, "donAcc_type": "standard", "distance": 2.734, "atom1_id": "///A/758/O", "atom2_id": "///A/762/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 727, "atom1_serNum": 5976, "atom2_serNum": 6000, "donAcc_type": "standard", "distance": 3.278, "atom1_id": "///A/759/O", "atom2_id": "///A/763/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 728, "atom1_serNum": 5982, "atom2_serNum": 6005, "donAcc_type": "standard", "distance": 3.640, "atom1_id": "///A/760/O", "atom2_id": "///A/764/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 729, "atom1_serNum": 5992, "atom2_serNum": 6017, "donAcc_type": "standard", "distance": 2.771, "atom1_id": "///A/761/O", "atom2_id": "///A/765/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 730, "atom1_serNum": 5998, "atom2_serNum": 6022, "donAcc_type": "standard", "distance": 2.888, "atom1_id": "///A/762/O", "atom2_id": "///A/766/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 731, "atom1_serNum": 6008, "atom2_serNum": 6030, "donAcc_type": "standard", "distance": 2.907, "atom1_id": "///A/764/O", "atom2_id": "///A/767/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 732, "atom1_serNum": 6008, "atom2_serNum": 6037, "donAcc_type": "standard", "distance": 3.090, "atom1_id": "///A/764/O", "atom2_id": "///A/768/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 733, "atom1_serNum": 6020, "atom2_serNum": 6043, "donAcc_type": "standard", "distance": 2.919, "atom1_id": "///A/765/O", "atom2_id": "///A/769/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 734, "atom1_serNum": 6025, "atom2_serNum": 6055, "donAcc_type": "standard", "distance": 3.036, "atom1_id": "///A/766/O", "atom2_id": "///A/770/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 735, "atom1_serNum": 6033, "atom2_serNum": 6064, "donAcc_type": "standard", "distance": 3.035, "atom1_id": "///A/767/O", "atom2_id": "///A/771/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 736, "atom1_serNum": 6040, "atom2_serNum": 6069, "donAcc_type": "acceptable", "distance": 2.784, "atom1_id": "///A/768/O", "atom2_id": "///A/771/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 737, "atom1_serNum": 6040, "atom2_serNum": 6071, "donAcc_type": "standard", "distance": 2.817, "atom1_id": "///A/768/O", "atom2_id": "///A/772/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 738, "atom1_serNum": 6046, "atom2_serNum": 6079, "donAcc_type": "standard", "distance": 2.859, "atom1_id": "///A/769/O", "atom2_id": "///A/773/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 739, "atom1_serNum": 6058, "atom2_serNum": 6093, "donAcc_type": "standard", "distance": 3.084, "atom1_id": "///A/770/O", "atom2_id": "///A/774/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 740, "atom1_serNum": 6067, "atom2_serNum": 6101, "donAcc_type": "standard", "distance": 3.177, "atom1_id": "///A/771/O", "atom2_id": "///A/775/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 741, "atom1_serNum": 6074, "atom2_serNum": 6110, "donAcc_type": "standard", "distance": 3.125, "atom1_id": "///A/772/O", "atom2_id": "///A/776/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 742, "atom1_serNum": 6082, "atom2_serNum": 6115, "donAcc_type": "standard", "distance": 2.879, "atom1_id": "///A/773/O", "atom2_id": "///A/777/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 743, "atom1_serNum": 6096, "atom2_serNum": 6125, "donAcc_type": "standard", "distance": 2.622, "atom1_id": "///A/774/O", "atom2_id": "///A/778/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 744, "atom1_serNum": 6147, "atom2_serNum": 6177, "donAcc_type": "standard", "distance": 2.932, "atom1_id": "///A/780/O", "atom2_id": "///A/784/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 745, "atom1_serNum": 6152, "atom2_serNum": 6182, "donAcc_type": "standard", "distance": 2.829, "atom1_id": "///A/781/O", "atom2_id": "///A/785/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 746, "atom1_serNum": 6161, "atom2_serNum": 6187, "donAcc_type": "standard", "distance": 2.872, "atom1_id": "///A/782/O", "atom2_id": "///A/786/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 747, "atom1_serNum": 6172, "atom2_serNum": 6194, "donAcc_type": "standard", "distance": 2.913, "atom1_id": "///A/783/O", "atom2_id": "///A/787/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 748, "atom1_serNum": 6180, "atom2_serNum": 6202, "donAcc_type": "standard", "distance": 2.865, "atom1_id": "///A/784/O", "atom2_id": "///A/788/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 749, "atom1_serNum": 6180, "atom2_serNum": 6474, "donAcc_type": "standard", "distance": 2.848, "atom1_id": "///A/784/O", "atom2_id": "///A/822/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 750, "atom1_serNum": 6185, "atom2_serNum": 6207, "donAcc_type": "acceptable", "distance": 2.431, "atom1_id": "///A/785/O", "atom2_id": "///A/788/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 751, "atom1_serNum": 6185, "atom2_serNum": 6209, "donAcc_type": "standard", "distance": 2.817, "atom1_id": "///A/785/O", "atom2_id": "///A/789/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 752, "atom1_serNum": 6190, "atom2_serNum": 6214, "donAcc_type": "standard", "distance": 3.386, "atom1_id": "///A/786/O", "atom2_id": "///A/790/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 753, "atom1_serNum": 6233, "atom2_serNum": 6246, "donAcc_type": "standard", "distance": 3.348, "atom1_id": "///A/792/O", "atom2_id": "///A/794/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 754, "atom1_serNum": 6233, "atom2_serNum": 6604, "donAcc_type": "standard", "distance": 2.494, "atom1_id": "///A/792/O", "atom2_id": "///A/839/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 755, "atom1_serNum": 6241, "atom2_serNum": 6271, "donAcc_type": "standard", "distance": 3.005, "atom1_id": "///A/793/O", "atom2_id": "///A/797/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 756, "atom1_serNum": 6244, "atom2_serNum": 6253, "donAcc_type": "standard", "distance": 2.645, "atom1_id": "///A/793/OD1", "atom2_id": "///A/795/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 757, "atom1_serNum": 6244, "atom2_serNum": 6262, "donAcc_type": "standard", "distance": 2.985, "atom1_id": "///A/793/OD1", "atom2_id": "///A/796/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 758, "atom1_serNum": 6249, "atom2_serNum": 6278, "donAcc_type": "standard", "distance": 2.954, "atom1_id": "///A/794/O", "atom2_id": "///A/798/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 759, "atom1_serNum": 6256, "atom2_serNum": 6285, "donAcc_type": "standard", "distance": 2.948, "atom1_id": "///A/795/O", "atom2_id": "///A/799/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 760, "atom1_serNum": 6265, "atom2_serNum": 6289, "donAcc_type": "standard", "distance": 2.708, "atom1_id": "///A/796/O", "atom2_id": "///A/800/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 761, "atom1_serNum": 6274, "atom2_serNum": 6297, "donAcc_type": "standard", "distance": 2.977, "atom1_id": "///A/797/O", "atom2_id": "///A/801/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 762, "atom1_serNum": 6281, "atom2_serNum": 6304, "donAcc_type": "standard", "distance": 3.156, "atom1_id": "///A/798/O", "atom2_id": "///A/802/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 763, "atom1_serNum": 6288, "atom2_serNum": 6312, "donAcc_type": "standard", "distance": 2.992, "atom1_id": "///A/799/O", "atom2_id": "///A/803/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 764, "atom1_serNum": 6292, "atom2_serNum": 6321, "donAcc_type": "standard", "distance": 2.861, "atom1_id": "///A/800/O", "atom2_id": "///A/804/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 765, "atom1_serNum": 6300, "atom2_serNum": 6327, "donAcc_type": "standard", "distance": 2.822, "atom1_id": "///A/801/O", "atom2_id": "///A/805/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 766, "atom1_serNum": 6307, "atom2_serNum": 6341, "donAcc_type": "standard", "distance": 3.114, "atom1_id": "///A/802/O", "atom2_id": "///A/806/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 767, "atom1_serNum": 6315, "atom2_serNum": 6352, "donAcc_type": "standard", "distance": 3.097, "atom1_id": "///A/803/O", "atom2_id": "///A/807/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 768, "atom1_serNum": 6324, "atom2_serNum": 6352, "donAcc_type": "standard", "distance": 2.964, "atom1_id": "///A/804/O", "atom2_id": "///A/807/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 769, "atom1_serNum": 6324, "atom2_serNum": 6360, "donAcc_type": "standard", "distance": 3.114, "atom1_id": "///A/804/O", "atom2_id": "///A/808/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 770, "atom1_serNum": 6327, "atom2_serNum": 6367, "donAcc_type": "standard", "distance": 3.788, "atom1_id": "///A/805/N", "atom2_id": "///A/809/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 771, "atom1_serNum": 6330, "atom2_serNum": 6360, "donAcc_type": "standard", "distance": 3.125, "atom1_id": "///A/805/O", "atom2_id": "///A/808/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 772, "atom1_serNum": 6381, "atom2_serNum": 6543, "donAcc_type": "standard", "distance": 3.474, "atom1_id": "///A/811/N", "atom2_id": "///A/831/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 773, "atom1_serNum": 6389, "atom2_serNum": 6543, "donAcc_type": "standard", "distance": 2.764, "atom1_id": "///A/812/N", "atom2_id": "///A/831/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 774, "atom1_serNum": 6414, "atom2_serNum": 6441, "donAcc_type": "standard", "distance": 2.762, "atom1_id": "///A/815/O", "atom2_id": "///A/819/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 775, "atom1_serNum": 6418, "atom2_serNum": 6435, "donAcc_type": "standard", "distance": 3.005, "atom1_id": "///A/815/OD2", "atom2_id": "///A/818/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 776, "atom1_serNum": 6419, "atom2_serNum": 6976, "donAcc_type": "standard", "distance": 3.573, "atom1_id": "///A/816/N", "atom2_id": "///A/887/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 777, "atom1_serNum": 6422, "atom2_serNum": 6699, "donAcc_type": "standard", "distance": 3.102, "atom1_id": "///A/816/O", "atom2_id": "///A/853/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 778, "atom1_serNum": 6422, "atom2_serNum": 6702, "donAcc_type": "standard", "distance": 2.733, "atom1_id": "///A/816/O", "atom2_id": "///A/853/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 779, "atom1_serNum": 6444, "atom2_serNum": 6702, "donAcc_type": "standard", "distance": 2.459, "atom1_id": "///A/819/O", "atom2_id": "///A/853/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 780, "atom1_serNum": 6448, "atom2_serNum": 6571, "donAcc_type": "standard", "distance": 2.892, "atom1_id": "///A/820/O", "atom2_id": "///A/835/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 781, "atom1_serNum": 6456, "atom2_serNum": 6579, "donAcc_type": "standard", "distance": 3.309, "atom1_id": "///A/821/O", "atom2_id": "///A/836/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 782, "atom1_serNum": 6486, "atom2_serNum": 6551, "donAcc_type": "standard", "distance": 3.145, "atom1_id": "///A/824/N", "atom2_id": "///A/832/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 783, "atom1_serNum": 6489, "atom2_serNum": 6548, "donAcc_type": "standard", "distance": 3.066, "atom1_id": "///A/824/O", "atom2_id": "///A/832/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 784, "atom1_serNum": 6503, "atom2_serNum": 6530, "donAcc_type": "standard", "distance": 3.211, "atom1_id": "///A/826/N", "atom2_id": "///A/829/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 785, "atom1_serNum": 6511, "atom2_serNum": 6517, "donAcc_type": "standard", "distance": 2.814, "atom1_id": "///A/827/N", "atom2_id": "///A/827/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 786, "atom1_serNum": 6522, "atom2_serNum": 6531, "donAcc_type": "standard", "distance": 2.879, "atom1_id": "///A/828/O", "atom2_id": "///A/830/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 787, "atom1_serNum": 6566, "atom2_serNum": 7311, "donAcc_type": "acceptable", "distance": 2.656, "atom1_id": "///A/833/OH", "atom2_id": "///A/946/OE2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 788, "atom1_serNum": 6574, "atom2_serNum": 6588, "donAcc_type": "standard", "distance": 3.075, "atom1_id": "///A/835/O", "atom2_id": "///A/838/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 789, "atom1_serNum": 6604, "atom2_serNum": 17725, "donAcc_type": "standard", "distance": 3.646, "atom1_id": "///A/839/NZ", "atom2_id": "///P/19/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 790, "atom1_serNum": 6619, "atom2_serNum": 6640, "donAcc_type": "standard", "distance": 3.355, "atom1_id": "///A/842/O", "atom2_id": "///A/846/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 791, "atom1_serNum": 6623, "atom2_serNum": 6648, "donAcc_type": "standard", "distance": 3.142, "atom1_id": "///A/843/O", "atom2_id": "///A/847/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 792, "atom1_serNum": 6632, "atom2_serNum": 6657, "donAcc_type": "standard", "distance": 2.890, "atom1_id": "///A/844/O", "atom2_id": "///A/848/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 793, "atom1_serNum": 6636, "atom2_serNum": 6662, "donAcc_type": "standard", "distance": 2.910, "atom1_id": "///A/845/O", "atom2_id": "///A/849/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 794, "atom1_serNum": 6643, "atom2_serNum": 6670, "donAcc_type": "standard", "distance": 3.169, "atom1_id": "///A/846/O", "atom2_id": "///A/850/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 795, "atom1_serNum": 6651, "atom2_serNum": 6678, "donAcc_type": "standard", "distance": 2.713, "atom1_id": "///A/847/O", "atom2_id": "///A/851/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 796, "atom1_serNum": 6660, "atom2_serNum": 6687, "donAcc_type": "standard", "distance": 2.897, "atom1_id": "///A/848/O", "atom2_id": "///A/852/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 797, "atom1_serNum": 6665, "atom2_serNum": 6692, "donAcc_type": "standard", "distance": 3.018, "atom1_id": "///A/849/O", "atom2_id": "///A/853/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 798, "atom1_serNum": 6673, "atom2_serNum": 6703, "donAcc_type": "standard", "distance": 2.890, "atom1_id": "///A/850/O", "atom2_id": "///A/854/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 799, "atom1_serNum": 6681, "atom2_serNum": 6703, "donAcc_type": "standard", "distance": 2.955, "atom1_id": "///A/851/O", "atom2_id": "///A/854/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 800, "atom1_serNum": 6681, "atom2_serNum": 6711, "donAcc_type": "standard", "distance": 3.103, "atom1_id": "///A/851/O", "atom2_id": "///A/855/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 801, "atom1_serNum": 6686, "atom2_serNum": 6710, "donAcc_type": "standard", "distance": 3.362, "atom1_id": "///A/851/OE2", "atom2_id": "///A/854/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 802, "atom1_serNum": 6690, "atom2_serNum": 6720, "donAcc_type": "standard", "distance": 2.968, "atom1_id": "///A/852/O", "atom2_id": "///A/856/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 803, "atom1_serNum": 6727, "atom2_serNum": 6827, "donAcc_type": "standard", "distance": 3.138, "atom1_id": "///A/857/O", "atom2_id": "///A/868/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 804, "atom1_serNum": 6751, "atom2_serNum": 6797, "donAcc_type": "standard", "distance": 3.352, "atom1_id": "///A/860/N", "atom2_id": "///A/864/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 805, "atom1_serNum": 6765, "atom2_serNum": 6798, "donAcc_type": "standard", "distance": 2.963, "atom1_id": "///A/861/O", "atom2_id": "///A/865/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 806, "atom1_serNum": 6774, "atom2_serNum": 6806, "donAcc_type": "standard", "distance": 3.047, "atom1_id": "///A/862/O", "atom2_id": "///A/866/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 807, "atom1_serNum": 6782, "atom2_serNum": 6812, "donAcc_type": "standard", "distance": 2.949, "atom1_id": "///A/863/O", "atom2_id": "///A/867/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 808, "atom1_serNum": 6793, "atom2_serNum": 6817, "donAcc_type": "standard", "distance": 3.252, "atom1_id": "///A/864/O", "atom2_id": "///A/868/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 809, "atom1_serNum": 6793, "atom2_serNum": 6824, "donAcc_type": "standard", "distance": 3.063, "atom1_id": "///A/864/O", "atom2_id": "///A/868/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 810, "atom1_serNum": 6801, "atom2_serNum": 6828, "donAcc_type": "standard", "distance": 3.028, "atom1_id": "///A/865/O", "atom2_id": "///A/869/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 811, "atom1_serNum": 6838, "atom2_serNum": 6868, "donAcc_type": "standard", "distance": 3.213, "atom1_id": "///A/870/O", "atom2_id": "///A/874/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 812, "atom1_serNum": 6841, "atom2_serNum": 6859, "donAcc_type": "standard", "distance": 3.064, "atom1_id": "///A/870/OD1", "atom2_id": "///A/873/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 813, "atom1_serNum": 6846, "atom2_serNum": 6848, "donAcc_type": "acceptable", "distance": 3.006, "atom1_id": "///A/871/O", "atom2_id": "///A/871/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 814, "atom1_serNum": 6879, "atom2_serNum": 6913, "donAcc_type": "standard", "distance": 2.874, "atom1_id": "///A/875/O", "atom2_id": "///A/879/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 815, "atom1_serNum": 6882, "atom2_serNum": 6895, "donAcc_type": "standard", "distance": 2.698, "atom1_id": "///A/875/OD1", "atom2_id": "///A/877/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 816, "atom1_serNum": 6883, "atom2_serNum": 18134, "donAcc_type": "standard", "distance": 3.234, "atom1_id": "///A/875/ND2", "atom2_id": "///T/25/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 817, "atom1_serNum": 6887, "atom2_serNum": 6921, "donAcc_type": "standard", "distance": 2.971, "atom1_id": "///A/876/O", "atom2_id": "///A/880/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 818, "atom1_serNum": 6893, "atom2_serNum": 18117, "donAcc_type": "standard", "distance": 3.306, "atom1_id": "///A/876/NH1", "atom2_id": "///T/24/O5'", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 819, "atom1_serNum": 6894, "atom2_serNum": 18135, "donAcc_type": "standard", "distance": 2.863, "atom1_id": "///A/876/NH2", "atom2_id": "///T/25/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 820, "atom1_serNum": 6898, "atom2_serNum": 6930, "donAcc_type": "standard", "distance": 3.343, "atom1_id": "///A/877/O", "atom2_id": "///A/881/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 821, "atom1_serNum": 6909, "atom2_serNum": 6939, "donAcc_type": "standard", "distance": 3.148, "atom1_id": "///A/878/O", "atom2_id": "///A/882/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 822, "atom1_serNum": 6916, "atom2_serNum": 6947, "donAcc_type": "standard", "distance": 3.108, "atom1_id": "///A/879/O", "atom2_id": "///A/883/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 823, "atom1_serNum": 6924, "atom2_serNum": 6955, "donAcc_type": "standard", "distance": 3.105, "atom1_id": "///A/880/O", "atom2_id": "///A/884/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 824, "atom1_serNum": 6933, "atom2_serNum": 6963, "donAcc_type": "standard", "distance": 2.768, "atom1_id": "///A/881/O", "atom2_id": "///A/885/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 825, "atom1_serNum": 6942, "atom2_serNum": 6969, "donAcc_type": "standard", "distance": 3.340, "atom1_id": "///A/882/O", "atom2_id": "///A/886/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 826, "atom1_serNum": 6942, "atom2_serNum": 6973, "donAcc_type": "standard", "distance": 3.236, "atom1_id": "///A/882/O", "atom2_id": "///A/887/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 827, "atom1_serNum": 6950, "atom2_serNum": 6969, "donAcc_type": "standard", "distance": 2.948, "atom1_id": "///A/883/O", "atom2_id": "///A/886/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 828, "atom1_serNum": 6950, "atom2_serNum": 7046, "donAcc_type": "standard", "distance": 3.939, "atom1_id": "///A/883/O", "atom2_id": "///A/895/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 829, "atom1_serNum": 6966, "atom2_serNum": 6968, "donAcc_type": "acceptable", "distance": 3.008, "atom1_id": "///A/885/O", "atom2_id": "///A/885/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 830, "atom1_serNum": 6981, "atom2_serNum": 7008, "donAcc_type": "standard", "distance": 2.815, "atom1_id": "///A/888/O", "atom2_id": "///A/891/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 831, "atom1_serNum": 6981, "atom2_serNum": 7016, "donAcc_type": "standard", "distance": 3.201, "atom1_id": "///A/888/O", "atom2_id": "///A/892/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 832, "atom1_serNum": 7011, "atom2_serNum": 7020, "donAcc_type": "standard", "distance": 3.161, "atom1_id": "///A/891/O", "atom2_id": "///A/893/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 833, "atom1_serNum": 7030, "atom2_serNum": 7058, "donAcc_type": "standard", "distance": 2.874, "atom1_id": "///A/894/O", "atom2_id": "///A/898/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 834, "atom1_serNum": 7040, "atom2_serNum": 7066, "donAcc_type": "standard", "distance": 2.823, "atom1_id": "///A/895/O", "atom2_id": "///A/899/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 835, "atom1_serNum": 7051, "atom2_serNum": 7074, "donAcc_type": "standard", "distance": 3.272, "atom1_id": "///A/896/O", "atom2_id": "///A/900/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 836, "atom1_serNum": 7056, "atom2_serNum": 7082, "donAcc_type": "standard", "distance": 2.950, "atom1_id": "///A/897/O", "atom2_id": "///A/901/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 837, "atom1_serNum": 7061, "atom2_serNum": 7087, "donAcc_type": "acceptable", "distance": 2.888, "atom1_id": "///A/898/O", "atom2_id": "///A/901/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 838, "atom1_serNum": 7061, "atom2_serNum": 7088, "donAcc_type": "standard", "distance": 3.260, "atom1_id": "///A/898/O", "atom2_id": "///A/902/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 839, "atom1_serNum": 7085, "atom2_serNum": 7108, "donAcc_type": "standard", "distance": 3.149, "atom1_id": "///A/901/O", "atom2_id": "///A/905/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 840, "atom1_serNum": 7091, "atom2_serNum": 7113, "donAcc_type": "standard", "distance": 2.642, "atom1_id": "///A/902/O", "atom2_id": "///A/906/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 841, "atom1_serNum": 7099, "atom2_serNum": 7121, "donAcc_type": "standard", "distance": 2.724, "atom1_id": "///A/903/O", "atom2_id": "///A/907/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 842, "atom1_serNum": 7103, "atom2_serNum": 7130, "donAcc_type": "standard", "distance": 2.692, "atom1_id": "///A/904/O", "atom2_id": "///A/908/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 843, "atom1_serNum": 7111, "atom2_serNum": 7135, "donAcc_type": "standard", "distance": 2.727, "atom1_id": "///A/905/O", "atom2_id": "///A/909/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 844, "atom1_serNum": 7116, "atom2_serNum": 7140, "donAcc_type": "standard", "distance": 3.126, "atom1_id": "///A/906/O", "atom2_id": "///A/910/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 845, "atom1_serNum": 7124, "atom2_serNum": 7148, "donAcc_type": "standard", "distance": 3.290, "atom1_id": "///A/907/O", "atom2_id": "///A/911/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 846, "atom1_serNum": 7129, "atom2_serNum": 13011, "donAcc_type": "standard", "distance": 3.490, "atom1_id": "///A/907/NZ", "atom2_id": "///C/149/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 847, "atom1_serNum": 7133, "atom2_serNum": 7148, "donAcc_type": "standard", "distance": 2.811, "atom1_id": "///A/908/O", "atom2_id": "///A/911/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 848, "atom1_serNum": 7133, "atom2_serNum": 7157, "donAcc_type": "standard", "distance": 2.926, "atom1_id": "///A/908/O", "atom2_id": "///A/912/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 849, "atom1_serNum": 7138, "atom2_serNum": 7157, "donAcc_type": "standard", "distance": 2.700, "atom1_id": "///A/909/O", "atom2_id": "///A/912/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 850, "atom1_serNum": 7138, "atom2_serNum": 7167, "donAcc_type": "standard", "distance": 2.735, "atom1_id": "///A/909/O", "atom2_id": "///A/913/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 851, "atom1_serNum": 7143, "atom2_serNum": 7172, "donAcc_type": "standard", "distance": 3.096, "atom1_id": "///A/910/O", "atom2_id": "///A/914/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 852, "atom1_serNum": 7151, "atom2_serNum": 7181, "donAcc_type": "standard", "distance": 2.971, "atom1_id": "///A/911/O", "atom2_id": "///A/915/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 853, "atom1_serNum": 7155, "atom2_serNum": 13025, "donAcc_type": "standard", "distance": 3.704, "atom1_id": "///A/911/OE1", "atom2_id": "///C/151/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 854, "atom1_serNum": 7160, "atom2_serNum": 7186, "donAcc_type": "standard", "distance": 3.066, "atom1_id": "///A/912/O", "atom2_id": "///A/916/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 855, "atom1_serNum": 7166, "atom2_serNum": 7194, "donAcc_type": "standard", "distance": 2.584, "atom1_id": "///A/912/NE2", "atom2_id": "///A/916/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 856, "atom1_serNum": 7170, "atom2_serNum": 7195, "donAcc_type": "standard", "distance": 3.073, "atom1_id": "///A/913/O", "atom2_id": "///A/917/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 857, "atom1_serNum": 7175, "atom2_serNum": 7200, "donAcc_type": "standard", "distance": 3.212, "atom1_id": "///A/914/O", "atom2_id": "///A/918/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 858, "atom1_serNum": 7189, "atom2_serNum": 7208, "donAcc_type": "standard", "distance": 2.660, "atom1_id": "///A/916/O", "atom2_id": "///A/919/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 859, "atom1_serNum": 7203, "atom2_serNum": 7212, "donAcc_type": "standard", "distance": 2.093, "atom1_id": "///A/918/O", "atom2_id": "///A/920/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 860, "atom1_serNum": 7212, "atom2_serNum": 14694, "donAcc_type": "standard", "distance": 3.185, "atom1_id": "///A/920/N", "atom2_id": "///C/365/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 861, "atom1_serNum": 7221, "atom2_serNum": 14679, "donAcc_type": "standard", "distance": 3.495, "atom1_id": "///A/921/N", "atom2_id": "///C/363/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 862, "atom1_serNum": 7229, "atom2_serNum": 7235, "donAcc_type": "standard", "distance": 2.679, "atom1_id": "///A/922/N", "atom2_id": "///A/922/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 863, "atom1_serNum": 7237, "atom2_serNum": 13217, "donAcc_type": "standard", "distance": 3.677, "atom1_id": "///A/923/N", "atom2_id": "///C/174/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 864, "atom1_serNum": 7240, "atom2_serNum": 7256, "donAcc_type": "standard", "distance": 2.672, "atom1_id": "///A/923/O", "atom2_id": "///A/925/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 865, "atom1_serNum": 7299, "atom2_serNum": 7312, "donAcc_type": "standard", "distance": 2.996, "atom1_id": "///A/945/O", "atom2_id": "///A/947/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 866, "atom1_serNum": 7315, "atom2_serNum": 7343, "donAcc_type": "standard", "distance": 3.176, "atom1_id": "///A/947/O", "atom2_id": "///A/951/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 867, "atom1_serNum": 7324, "atom2_serNum": 7351, "donAcc_type": "standard", "distance": 3.003, "atom1_id": "///A/948/O", "atom2_id": "///A/952/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 868, "atom1_serNum": 7331, "atom2_serNum": 7355, "donAcc_type": "standard", "distance": 3.155, "atom1_id": "///A/949/O", "atom2_id": "///A/953/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 869, "atom1_serNum": 7338, "atom2_serNum": 7364, "donAcc_type": "standard", "distance": 3.171, "atom1_id": "///A/950/O", "atom2_id": "///A/954/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 870, "atom1_serNum": 7346, "atom2_serNum": 7375, "donAcc_type": "standard", "distance": 3.139, "atom1_id": "///A/951/O", "atom2_id": "///A/955/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 871, "atom1_serNum": 7354, "atom2_serNum": 7384, "donAcc_type": "standard", "distance": 3.050, "atom1_id": "///A/952/O", "atom2_id": "///A/956/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 872, "atom1_serNum": 7358, "atom2_serNum": 7389, "donAcc_type": "acceptable", "distance": 2.664, "atom1_id": "///A/953/O", "atom2_id": "///A/956/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 873, "atom1_serNum": 7358, "atom2_serNum": 7391, "donAcc_type": "standard", "distance": 2.478, "atom1_id": "///A/953/O", "atom2_id": "///A/957/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 874, "atom1_serNum": 7367, "atom2_serNum": 7399, "donAcc_type": "standard", "distance": 2.454, "atom1_id": "///A/954/O", "atom2_id": "///A/958/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 875, "atom1_serNum": 7382, "atom2_serNum": 8868, "donAcc_type": "standard", "distance": 3.682, "atom1_id": "///A/955/OE1", "atom2_id": "///A/1141/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 876, "atom1_serNum": 7387, "atom2_serNum": 7867, "donAcc_type": "acceptable", "distance": 3.886, "atom1_id": "///A/956/O", "atom2_id": "///A/1018/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 877, "atom1_serNum": 7402, "atom2_serNum": 7406, "donAcc_type": "questionable", "distance": 2.105, "atom1_id": "///A/958/O", "atom2_id": "///A/959/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 878, "atom1_serNum": 7422, "atom2_serNum": 7538, "donAcc_type": "acceptable", "distance": 2.647, "atom1_id": "///A/960/OH", "atom2_id": "///A/974/OE2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 879, "atom1_serNum": 7426, "atom2_serNum": 7436, "donAcc_type": "acceptable", "distance": 2.710, "atom1_id": "///A/961/O", "atom2_id": "///A/962/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 880, "atom1_serNum": 7434, "atom2_serNum": 7436, "donAcc_type": "acceptable", "distance": 2.862, "atom1_id": "///A/962/O", "atom2_id": "///A/962/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 881, "atom1_serNum": 7455, "atom2_serNum": 7467, "donAcc_type": "standard", "distance": 2.734, "atom1_id": "///A/965/O", "atom2_id": "///A/967/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 882, "atom1_serNum": 7462, "atom2_serNum": 7484, "donAcc_type": "standard", "distance": 2.695, "atom1_id": "///A/966/O", "atom2_id": "///A/969/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 883, "atom1_serNum": 7483, "atom2_serNum": 8373, "donAcc_type": "standard", "distance": 2.657, "atom1_id": "///A/968/NE2", "atom2_id": "///A/1081/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 884, "atom1_serNum": 7483, "atom2_serNum": 8978, "donAcc_type": "standard", "distance": 3.283, "atom1_id": "///A/968/NE2", "atom2_id": "///A/1156/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 885, "atom1_serNum": 7495, "atom2_serNum": 8384, "donAcc_type": "acceptable", "distance": 3.584, "atom1_id": "///A/969/OH", "atom2_id": "///A/1082/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 886, "atom1_serNum": 7499, "atom2_serNum": 7522, "donAcc_type": "standard", "distance": 3.050, "atom1_id": "///A/970/O", "atom2_id": "///A/973/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 887, "atom1_serNum": 7507, "atom2_serNum": 7533, "donAcc_type": "questionable", "distance": 2.590, "atom1_id": "///A/971/O", "atom2_id": "///A/974/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 888, "atom1_serNum": 7537, "atom2_serNum": 7539, "donAcc_type": "standard", "distance": 2.955, "atom1_id": "///A/974/OE1", "atom2_id": "///A/975/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 889, "atom1_serNum": 7537, "atom2_serNum": 7695, "donAcc_type": "questionable", "distance": 2.842, "atom1_id": "///A/974/OE1", "atom2_id": "///A/994/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 890, "atom1_serNum": 7549, "atom2_serNum": 7679, "donAcc_type": "standard", "distance": 3.618, "atom1_id": "///A/975/NH2", "atom2_id": "///A/992/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 891, "atom1_serNum": 7569, "atom2_serNum": 7880, "donAcc_type": "standard", "distance": 2.993, "atom1_id": "///A/978/N", "atom2_id": "///A/1020/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 892, "atom1_serNum": 7572, "atom2_serNum": 7584, "donAcc_type": "standard", "distance": 3.051, "atom1_id": "///A/978/O", "atom2_id": "///A/981/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 893, "atom1_serNum": 7572, "atom2_serNum": 7595, "donAcc_type": "standard", "distance": 3.142, "atom1_id": "///A/978/O", "atom2_id": "///A/982/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 894, "atom1_serNum": 7573, "atom2_serNum": 7909, "donAcc_type": "acceptable", "distance": 3.208, "atom1_id": "///A/979/N", "atom2_id": "///A/1023/OG", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 895, "atom1_serNum": 7576, "atom2_serNum": 7603, "donAcc_type": "standard", "distance": 3.162, "atom1_id": "///A/979/O", "atom2_id": "///A/983/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 896, "atom1_serNum": 7606, "atom2_serNum": 7620, "donAcc_type": "standard", "distance": 3.276, "atom1_id": "///A/983/O", "atom2_id": "///A/985/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 897, "atom1_serNum": 7668, "atom2_serNum": 15905, "donAcc_type": "standard", "distance": 3.420, "atom1_id": "///A/990/NE", "atom2_id": "///D/156/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 898, "atom1_serNum": 7670, "atom2_serNum": 8166, "donAcc_type": "acceptable", "distance": 3.191, "atom1_id": "///A/990/NH1", "atom2_id": "///A/1055/OG", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 899, "atom1_serNum": 7672, "atom2_serNum": 8157, "donAcc_type": "standard", "distance": 2.533, "atom1_id": "///A/991/N", "atom2_id": "///A/1054/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 900, "atom1_serNum": 7675, "atom2_serNum": 8154, "donAcc_type": "standard", "distance": 3.067, "atom1_id": "///A/991/O", "atom2_id": "///A/1054/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 901, "atom1_serNum": 7685, "atom2_serNum": 8144, "donAcc_type": "standard", "distance": 3.130, "atom1_id": "///A/993/N", "atom2_id": "///A/1052/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 902, "atom1_serNum": 7688, "atom2_serNum": 8141, "donAcc_type": "standard", "distance": 2.761, "atom1_id": "///A/993/O", "atom2_id": "///A/1052/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 903, "atom1_serNum": 7688, "atom2_serNum": 8144, "donAcc_type": "questionable", "distance": 2.565, "atom1_id": "///A/993/O", "atom2_id": "///A/1052/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 904, "atom1_serNum": 7700, "atom2_serNum": 8131, "donAcc_type": "standard", "distance": 2.616, "atom1_id": "///A/995/N", "atom2_id": "///A/1050/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 905, "atom1_serNum": 7703, "atom2_serNum": 8128, "donAcc_type": "standard", "distance": 2.644, "atom1_id": "///A/995/O", "atom2_id": "///A/1050/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 906, "atom1_serNum": 7703, "atom2_serNum": 8131, "donAcc_type": "questionable", "distance": 2.553, "atom1_id": "///A/995/O", "atom2_id": "///A/1050/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 907, "atom1_serNum": 7712, "atom2_serNum": 7865, "donAcc_type": "standard", "distance": 3.220, "atom1_id": "///A/997/N", "atom2_id": "///A/1018/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 908, "atom1_serNum": 7715, "atom2_serNum": 8115, "donAcc_type": "questionable", "distance": 2.894, "atom1_id": "///A/997/O", "atom2_id": "///A/1048/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 909, "atom1_serNum": 7717, "atom2_serNum": 7867, "donAcc_type": "acceptable", "distance": 3.117, "atom1_id": "///A/998/N", "atom2_id": "///A/1018/OG1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 910, "atom1_serNum": 7721, "atom2_serNum": 7867, "donAcc_type": "acceptable", "distance": 2.870, "atom1_id": "///A/999/N", "atom2_id": "///A/1018/OG1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 911, "atom1_serNum": 7724, "atom2_serNum": 7862, "donAcc_type": "standard", "distance": 2.887, "atom1_id": "///A/999/O", "atom2_id": "///A/1018/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 912, "atom1_serNum": 7736, "atom2_serNum": 7851, "donAcc_type": "standard", "distance": 3.285, "atom1_id": "///A/1001/N", "atom2_id": "///A/1016/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 913, "atom1_serNum": 7739, "atom2_serNum": 7848, "donAcc_type": "standard", "distance": 3.385, "atom1_id": "///A/1001/O", "atom2_id": "///A/1016/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 914, "atom1_serNum": 7751, "atom2_serNum": 7836, "donAcc_type": "standard", "distance": 3.195, "atom1_id": "///A/1003/O", "atom2_id": "///A/1014/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 915, "atom1_serNum": 7751, "atom2_serNum": 7839, "donAcc_type": "questionable", "distance": 2.483, "atom1_id": "///A/1003/O", "atom2_id": "///A/1014/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 916, "atom1_serNum": 7762, "atom2_serNum": 7767, "donAcc_type": "standard", "distance": 2.633, "atom1_id": "///A/1004/NH1", "atom2_id": "///A/1005/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 917, "atom1_serNum": 7762, "atom2_serNum": 7816, "donAcc_type": "standard", "distance": 2.763, "atom1_id": "///A/1004/NH1", "atom2_id": "///A/1011/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 918, "atom1_serNum": 7796, "atom2_serNum": 7809, "donAcc_type": "standard", "distance": 3.201, "atom1_id": "///A/1009/O", "atom2_id": "///A/1010/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 919, "atom1_serNum": 7796, "atom2_serNum": 11155, "donAcc_type": "standard", "distance": 3.380, "atom1_id": "///A/1009/O", "atom2_id": "///B/276/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 920, "atom1_serNum": 7801, "atom2_serNum": 11123, "donAcc_type": "standard", "distance": 2.744, "atom1_id": "///A/1009/NZ", "atom2_id": "///B/271/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 921, "atom1_serNum": 7801, "atom2_serNum": 11146, "donAcc_type": "acceptable", "distance": 2.252, "atom1_id": "///A/1009/NZ", "atom2_id": "///B/274/OG", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 922, "atom1_serNum": 7811, "atom2_serNum": 11153, "donAcc_type": "standard", "distance": 2.947, "atom1_id": "///A/1010/NH1", "atom2_id": "///B/275/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 923, "atom1_serNum": 7812, "atom2_serNum": 11163, "donAcc_type": "standard", "distance": 2.611, "atom1_id": "///A/1010/NH2", "atom2_id": "///B/276/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 924, "atom1_serNum": 7820, "atom2_serNum": 7832, "donAcc_type": "standard", "distance": 2.278, "atom1_id": "///A/1012/O", "atom2_id": "///A/1013/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 925, "atom1_serNum": 7844, "atom2_serNum": 7945, "donAcc_type": "standard", "distance": 2.616, "atom1_id": "///A/1015/N", "atom2_id": "///A/1028/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 926, "atom1_serNum": 7847, "atom2_serNum": 7940, "donAcc_type": "questionable", "distance": 2.320, "atom1_id": "///A/1015/O", "atom2_id": "///A/1027/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 927, "atom1_serNum": 7847, "atom2_serNum": 7942, "donAcc_type": "standard", "distance": 3.107, "atom1_id": "///A/1015/O", "atom2_id": "///A/1028/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 928, "atom1_serNum": 7856, "atom2_serNum": 7928, "donAcc_type": "standard", "distance": 2.651, "atom1_id": "///A/1017/N", "atom2_id": "///A/1026/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 929, "atom1_serNum": 7859, "atom2_serNum": 7925, "donAcc_type": "standard", "distance": 2.805, "atom1_id": "///A/1017/O", "atom2_id": "///A/1026/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 930, "atom1_serNum": 7865, "atom2_serNum": 7867, "donAcc_type": "acceptable", "distance": 2.948, "atom1_id": "///A/1018/O", "atom2_id": "///A/1018/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 931, "atom1_serNum": 7869, "atom2_serNum": 7913, "donAcc_type": "standard", "distance": 2.991, "atom1_id": "///A/1019/N", "atom2_id": "///A/1024/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 932, "atom1_serNum": 7872, "atom2_serNum": 7888, "donAcc_type": "questionable", "distance": 3.351, "atom1_id": "///A/1019/O", "atom2_id": "///A/1021/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 933, "atom1_serNum": 7872, "atom2_serNum": 7913, "donAcc_type": "questionable", "distance": 2.672, "atom1_id": "///A/1019/O", "atom2_id": "///A/1024/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 934, "atom1_serNum": 7888, "atom2_serNum": 7904, "donAcc_type": "standard", "distance": 2.457, "atom1_id": "///A/1021/O", "atom2_id": "///A/1023/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 935, "atom1_serNum": 7968, "atom2_serNum": 7981, "donAcc_type": "acceptable", "distance": 2.487, "atom1_id": "///A/1031/O", "atom2_id": "///A/1032/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 936, "atom1_serNum": 8007, "atom2_serNum": 8042, "donAcc_type": "standard", "distance": 3.105, "atom1_id": "///A/1036/O", "atom2_id": "///A/1040/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 937, "atom1_serNum": 8015, "atom2_serNum": 8020, "donAcc_type": "standard", "distance": 3.034, "atom1_id": "///A/1037/O", "atom2_id": "///A/1037/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 938, "atom1_serNum": 8015, "atom2_serNum": 8051, "donAcc_type": "standard", "distance": 3.280, "atom1_id": "///A/1037/O", "atom2_id": "///A/1041/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 939, "atom1_serNum": 8024, "atom2_serNum": 8059, "donAcc_type": "standard", "distance": 3.038, "atom1_id": "///A/1038/O", "atom2_id": "///A/1042/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 940, "atom1_serNum": 8032, "atom2_serNum": 8259, "donAcc_type": "acceptable", "distance": 3.363, "atom1_id": "///A/1038/OH", "atom2_id": "///A/1068/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 941, "atom1_serNum": 8036, "atom2_serNum": 8067, "donAcc_type": "standard", "distance": 3.328, "atom1_id": "///A/1039/O", "atom2_id": "///A/1043/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 942, "atom1_serNum": 8062, "atom2_serNum": 8070, "donAcc_type": "questionable", "distance": 2.043, "atom1_id": "///A/1042/O", "atom2_id": "///A/1043/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 943, "atom1_serNum": 8079, "atom2_serNum": 8107, "donAcc_type": "questionable", "distance": 2.319, "atom1_id": "///A/1044/O", "atom2_id": "///A/1047/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 944, "atom1_serNum": 8088, "atom2_serNum": 8107, "donAcc_type": "questionable", "distance": 3.315, "atom1_id": "///A/1045/O", "atom2_id": "///A/1047/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 945, "atom1_serNum": 8135, "atom2_serNum": 8270, "donAcc_type": "standard", "distance": 2.853, "atom1_id": "///A/1051/N", "atom2_id": "///A/1069/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 946, "atom1_serNum": 8138, "atom2_serNum": 8270, "donAcc_type": "questionable", "distance": 2.406, "atom1_id": "///A/1051/O", "atom2_id": "///A/1069/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 947, "atom1_serNum": 8145, "atom2_serNum": 8247, "donAcc_type": "standard", "distance": 3.049, "atom1_id": "///A/1053/N", "atom2_id": "///A/1066/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 948, "atom1_serNum": 8148, "atom2_serNum": 8230, "donAcc_type": "questionable", "distance": 3.092, "atom1_id": "///A/1053/O", "atom2_id": "///A/1064/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 949, "atom1_serNum": 8148, "atom2_serNum": 8244, "donAcc_type": "standard", "distance": 3.470, "atom1_id": "///A/1053/O", "atom2_id": "///A/1066/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 950, "atom1_serNum": 8161, "atom2_serNum": 8230, "donAcc_type": "standard", "distance": 3.706, "atom1_id": "///A/1055/N", "atom2_id": "///A/1064/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 951, "atom1_serNum": 8185, "atom2_serNum": 8235, "donAcc_type": "standard", "distance": 2.628, "atom1_id": "///A/1057/OD2", "atom2_id": "///A/1064/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 952, "atom1_serNum": 8193, "atom2_serNum": 15793, "donAcc_type": "standard", "distance": 3.182, "atom1_id": "///A/1058/OD2", "atom2_id": "///D/142/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 953, "atom1_serNum": 8294, "atom2_serNum": 8324, "donAcc_type": "standard", "distance": 2.833, "atom1_id": "///A/1072/O", "atom2_id": "///A/1076/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 954, "atom1_serNum": 8302, "atom2_serNum": 8329, "donAcc_type": "standard", "distance": 2.565, "atom1_id": "///A/1073/O", "atom2_id": "///A/1077/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 955, "atom1_serNum": 8310, "atom2_serNum": 8340, "donAcc_type": "standard", "distance": 2.756, "atom1_id": "///A/1074/O", "atom2_id": "///A/1078/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 956, "atom1_serNum": 8318, "atom2_serNum": 8349, "donAcc_type": "standard", "distance": 3.563, "atom1_id": "///A/1075/O", "atom2_id": "///A/1079/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 957, "atom1_serNum": 8318, "atom2_serNum": 8385, "donAcc_type": "standard", "distance": 2.248, "atom1_id": "///A/1075/O", "atom2_id": "///A/1082/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 958, "atom1_serNum": 8327, "atom2_serNum": 8349, "donAcc_type": "standard", "distance": 2.635, "atom1_id": "///A/1076/O", "atom2_id": "///A/1079/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 959, "atom1_serNum": 8336, "atom2_serNum": 8840, "donAcc_type": "standard", "distance": 2.279, "atom1_id": "///A/1077/NE", "atom2_id": "///A/1138/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 960, "atom1_serNum": 8338, "atom2_serNum": 8957, "donAcc_type": "standard", "distance": 2.710, "atom1_id": "///A/1077/NH1", "atom2_id": "///A/1153/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 961, "atom1_serNum": 8338, "atom2_serNum": 8958, "donAcc_type": "standard", "distance": 2.948, "atom1_id": "///A/1077/NH1", "atom2_id": "///A/1153/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 962, "atom1_serNum": 8347, "atom2_serNum": 8385, "donAcc_type": "standard", "distance": 2.532, "atom1_id": "///A/1078/OE1", "atom2_id": "///A/1082/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 963, "atom1_serNum": 8349, "atom2_serNum": 8382, "donAcc_type": "questionable", "distance": 3.055, "atom1_id": "///A/1079/N", "atom2_id": "///A/1082/NE", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 964, "atom1_serNum": 8357, "atom2_serNum": 8957, "donAcc_type": "standard", "distance": 2.588, "atom1_id": "///A/1079/NZ", "atom2_id": "///A/1153/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 965, "atom1_serNum": 8393, "atom2_serNum": 8646, "donAcc_type": "standard", "distance": 3.416, "atom1_id": "///A/1084/O", "atom2_id": "///A/1116/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 966, "atom1_serNum": 8398, "atom2_serNum": 8966, "donAcc_type": "standard", "distance": 2.707, "atom1_id": "///A/1085/N", "atom2_id": "///A/1154/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 967, "atom1_serNum": 8401, "atom2_serNum": 8947, "donAcc_type": "questionable", "distance": 2.590, "atom1_id": "///A/1085/O", "atom2_id": "///A/1152/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 968, "atom1_serNum": 8403, "atom2_serNum": 8649, "donAcc_type": "standard", "distance": 3.829, "atom1_id": "///A/1086/N", "atom2_id": "///A/1116/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 969, "atom1_serNum": 8406, "atom2_serNum": 8664, "donAcc_type": "standard", "distance": 3.678, "atom1_id": "///A/1086/O", "atom2_id": "///A/1118/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 970, "atom1_serNum": 8414, "atom2_serNum": 8935, "donAcc_type": "questionable", "distance": 3.021, "atom1_id": "///A/1087/O", "atom2_id": "///A/1150/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 971, "atom1_serNum": 8435, "atom2_serNum": 8451, "donAcc_type": "standard", "distance": 3.094, "atom1_id": "///A/1090/O", "atom2_id": "///A/1092/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 972, "atom1_serNum": 8471, "atom2_serNum": 8493, "donAcc_type": "standard", "distance": 2.826, "atom1_id": "///A/1094/O", "atom2_id": "///A/1097/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 973, "atom1_serNum": 8471, "atom2_serNum": 8501, "donAcc_type": "standard", "distance": 3.222, "atom1_id": "///A/1094/O", "atom2_id": "///A/1098/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 974, "atom1_serNum": 8479, "atom2_serNum": 8509, "donAcc_type": "standard", "distance": 2.943, "atom1_id": "///A/1095/O", "atom2_id": "///A/1099/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 975, "atom1_serNum": 8487, "atom2_serNum": 8528, "donAcc_type": "standard", "distance": 3.091, "atom1_id": "///A/1096/O", "atom2_id": "///A/1101/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 976, "atom1_serNum": 8512, "atom2_serNum": 8547, "donAcc_type": "standard", "distance": 2.584, "atom1_id": "///A/1099/O", "atom2_id": "///A/1103/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 977, "atom1_serNum": 8520, "atom2_serNum": 8556, "donAcc_type": "standard", "distance": 2.862, "atom1_id": "///A/1100/O", "atom2_id": "///A/1104/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 978, "atom1_serNum": 8520, "atom2_serNum": 8561, "donAcc_type": "acceptable", "distance": 3.114, "atom1_id": "///A/1100/O", "atom2_id": "///A/1104/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 979, "atom1_serNum": 8531, "atom2_serNum": 8562, "donAcc_type": "standard", "distance": 3.455, "atom1_id": "///A/1101/O", "atom2_id": "///A/1105/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 980, "atom1_serNum": 8539, "atom2_serNum": 8570, "donAcc_type": "standard", "distance": 2.891, "atom1_id": "///A/1102/O", "atom2_id": "///A/1106/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 981, "atom1_serNum": 8565, "atom2_serNum": 8586, "donAcc_type": "standard", "distance": 3.152, "atom1_id": "///A/1105/O", "atom2_id": "///A/1108/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 982, "atom1_serNum": 8573, "atom2_serNum": 8807, "donAcc_type": "standard", "distance": 3.691, "atom1_id": "///A/1106/O", "atom2_id": "///A/1134/NE1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 983, "atom1_serNum": 8589, "atom2_serNum": 8831, "donAcc_type": "standard", "distance": 2.472, "atom1_id": "///A/1108/O", "atom2_id": "///A/1137/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 984, "atom1_serNum": 8607, "atom2_serNum": 8816, "donAcc_type": "standard", "distance": 3.465, "atom1_id": "///A/1110/N", "atom2_id": "///A/1135/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 985, "atom1_serNum": 8610, "atom2_serNum": 8827, "donAcc_type": "questionable", "distance": 2.972, "atom1_id": "///A/1110/O", "atom2_id": "///A/1136/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 986, "atom1_serNum": 8616, "atom2_serNum": 8624, "donAcc_type": "standard", "distance": 2.516, "atom1_id": "///A/1111/O", "atom2_id": "///A/1113/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 987, "atom1_serNum": 8620, "atom2_serNum": 8622, "donAcc_type": "acceptable", "distance": 2.696, "atom1_id": "///A/1112/O", "atom2_id": "///A/1112/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 988, "atom1_serNum": 8627, "atom2_serNum": 8824, "donAcc_type": "standard", "distance": 3.768, "atom1_id": "///A/1113/O", "atom2_id": "///A/1136/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 989, "atom1_serNum": 8659, "atom2_serNum": 8753, "donAcc_type": "standard", "distance": 3.722, "atom1_id": "///A/1117/O", "atom2_id": "///A/1128/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 990, "atom1_serNum": 8675, "atom2_serNum": 8752, "donAcc_type": "acceptable", "distance": 2.794, "atom1_id": "///A/1118/OH", "atom2_id": "///A/1127/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 991, "atom1_serNum": 8679, "atom2_serNum": 8697, "donAcc_type": "standard", "distance": 2.909, "atom1_id": "///A/1119/O", "atom2_id": "///A/1121/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 992, "atom1_serNum": 8687, "atom2_serNum": 17334, "donAcc_type": "acceptable", "distance": 3.933, "atom1_id": "///A/1119/OH", "atom2_id": "///E/621/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 993, "atom1_serNum": 8697, "atom2_serNum": 8724, "donAcc_type": "standard", "distance": 3.214, "atom1_id": "///A/1121/N", "atom2_id": "///A/1124/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 994, "atom1_serNum": 8704, "atom2_serNum": 8720, "donAcc_type": "standard", "distance": 3.248, "atom1_id": "///A/1121/NE", "atom2_id": "///A/1123/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 995, "atom1_serNum": 8716, "atom2_serNum": 17253, "donAcc_type": "standard", "distance": 2.694, "atom1_id": "///A/1123/O", "atom2_id": "///E/610/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 996, "atom1_serNum": 8720, "atom2_serNum": 17275, "donAcc_type": "standard", "distance": 3.031, "atom1_id": "///A/1123/OD2", "atom2_id": "///E/613/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 997, "atom1_serNum": 8790, "atom2_serNum": 8797, "donAcc_type": "acceptable", "distance": 2.603, "atom1_id": "///A/1132/O", "atom2_id": "///A/1133/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 998, "atom1_serNum": 8802, "atom2_serNum": 8822, "donAcc_type": "standard", "distance": 3.373, "atom1_id": "///A/1134/O", "atom2_id": "///A/1135/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 999, "atom1_serNum": 8840, "atom2_serNum": 8858, "donAcc_type": "standard", "distance": 3.632, "atom1_id": "///A/1138/O", "atom2_id": "///A/1141/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1000, "atom1_serNum": 8847, "atom2_serNum": 8877, "donAcc_type": "standard", "distance": 3.757, "atom1_id": "///A/1139/O", "atom2_id": "///A/1143/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1001, "atom1_serNum": 8853, "atom2_serNum": 8885, "donAcc_type": "standard", "distance": 2.704, "atom1_id": "///A/1140/O", "atom2_id": "///A/1144/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1002, "atom1_serNum": 8861, "atom2_serNum": 8893, "donAcc_type": "standard", "distance": 2.817, "atom1_id": "///A/1141/O", "atom2_id": "///A/1145/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1003, "atom1_serNum": 8865, "atom2_serNum": 8900, "donAcc_type": "standard", "distance": 3.256, "atom1_id": "///A/1141/NE", "atom2_id": "///A/1145/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1004, "atom1_serNum": 8872, "atom2_serNum": 8901, "donAcc_type": "standard", "distance": 3.164, "atom1_id": "///A/1142/O", "atom2_id": "///A/1146/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1005, "atom1_serNum": 8880, "atom2_serNum": 8901, "donAcc_type": "standard", "distance": 3.169, "atom1_id": "///A/1143/O", "atom2_id": "///A/1146/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1006, "atom1_serNum": 8888, "atom2_serNum": 8909, "donAcc_type": "standard", "distance": 3.298, "atom1_id": "///A/1144/O", "atom2_id": "///A/1147/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1007, "atom1_serNum": 8912, "atom2_serNum": 8924, "donAcc_type": "standard", "distance": 2.652, "atom1_id": "///A/1147/O", "atom2_id": "///A/1149/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1008, "atom1_serNum": 8947, "atom2_serNum": 8966, "donAcc_type": "questionable", "distance": 2.856, "atom1_id": "///A/1152/O", "atom2_id": "///A/1154/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1009, "atom1_serNum": 8959, "atom2_serNum": 8966, "donAcc_type": "standard", "distance": 2.631, "atom1_id": "///A/1154/N", "atom2_id": "///A/1154/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1010, "atom1_serNum": 9022, "atom2_serNum": 9507, "donAcc_type": "standard", "distance": 3.063, "atom1_id": "///B/1/N", "atom2_id": "///B/64/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1011, "atom1_serNum": 9025, "atom2_serNum": 9707, "donAcc_type": "standard", "distance": 2.725, "atom1_id": "///B/1/O", "atom2_id": "///B/92/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1012, "atom1_serNum": 9030, "atom2_serNum": 9502, "donAcc_type": "standard", "distance": 3.320, "atom1_id": "///B/2/N", "atom2_id": "///B/64/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1013, "atom1_serNum": 9033, "atom2_serNum": 9499, "donAcc_type": "standard", "distance": 2.805, "atom1_id": "///B/2/O", "atom2_id": "///B/64/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1014, "atom1_serNum": 9033, "atom2_serNum": 9502, "donAcc_type": "questionable", "distance": 2.730, "atom1_id": "///B/2/O", "atom2_id": "///B/64/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1015, "atom1_serNum": 9038, "atom2_serNum": 9507, "donAcc_type": "standard", "distance": 3.332, "atom1_id": "///B/2/NZ", "atom2_id": "///B/64/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1016, "atom1_serNum": 9042, "atom2_serNum": 9691, "donAcc_type": "standard", "distance": 2.954, "atom1_id": "///B/3/O", "atom2_id": "///B/90/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1017, "atom1_serNum": 9060, "atom2_serNum": 9681, "donAcc_type": "questionable", "distance": 3.279, "atom1_id": "///B/5/O", "atom2_id": "///B/88/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1018, "atom1_serNum": 9067, "atom2_serNum": 9093, "donAcc_type": "standard", "distance": 2.969, "atom1_id": "///B/6/O", "atom2_id": "///B/9/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1019, "atom1_serNum": 9073, "atom2_serNum": 9667, "donAcc_type": "standard", "distance": 3.808, "atom1_id": "///B/7/N", "atom2_id": "///B/86/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1020, "atom1_serNum": 9076, "atom2_serNum": 9103, "donAcc_type": "standard", "distance": 3.017, "atom1_id": "///B/7/O", "atom2_id": "///B/10/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1021, "atom1_serNum": 9076, "atom2_serNum": 9111, "donAcc_type": "standard", "distance": 3.001, "atom1_id": "///B/7/O", "atom2_id": "///B/11/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1022, "atom1_serNum": 9080, "atom2_serNum": 9618, "donAcc_type": "standard", "distance": 3.079, "atom1_id": "///B/7/NE", "atom2_id": "///B/79/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1023, "atom1_serNum": 9082, "atom2_serNum": 9092, "donAcc_type": "standard", "distance": 2.776, "atom1_id": "///B/7/NH1", "atom2_id": "///B/8/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1024, "atom1_serNum": 9083, "atom2_serNum": 9624, "donAcc_type": "standard", "distance": 2.556, "atom1_id": "///B/7/NH2", "atom2_id": "///B/80/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1025, "atom1_serNum": 9083, "atom2_serNum": 9639, "donAcc_type": "standard", "distance": 2.241, "atom1_id": "///B/7/NH2", "atom2_id": "///B/82/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1026, "atom1_serNum": 9091, "atom2_serNum": 9660, "donAcc_type": "standard", "distance": 2.788, "atom1_id": "///B/8/OE1", "atom2_id": "///B/85/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1027, "atom1_serNum": 9106, "atom2_serNum": 9135, "donAcc_type": "standard", "distance": 2.927, "atom1_id": "///B/10/O", "atom2_id": "///B/14/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1028, "atom1_serNum": 9114, "atom2_serNum": 9143, "donAcc_type": "standard", "distance": 3.043, "atom1_id": "///B/11/O", "atom2_id": "///B/15/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1029, "atom1_serNum": 9122, "atom2_serNum": 9152, "donAcc_type": "standard", "distance": 3.111, "atom1_id": "///B/12/O", "atom2_id": "///B/16/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1030, "atom1_serNum": 9131, "atom2_serNum": 9152, "donAcc_type": "standard", "distance": 2.982, "atom1_id": "///B/13/O", "atom2_id": "///B/16/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1031, "atom1_serNum": 9131, "atom2_serNum": 9161, "donAcc_type": "standard", "distance": 2.844, "atom1_id": "///B/13/O", "atom2_id": "///B/17/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1032, "atom1_serNum": 9138, "atom2_serNum": 9168, "donAcc_type": "standard", "distance": 3.103, "atom1_id": "///B/14/O", "atom2_id": "///B/18/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1033, "atom1_serNum": 9138, "atom2_serNum": 9173, "donAcc_type": "acceptable", "distance": 2.715, "atom1_id": "///B/14/O", "atom2_id": "///B/18/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1034, "atom1_serNum": 9155, "atom2_serNum": 9174, "donAcc_type": "standard", "distance": 3.259, "atom1_id": "///B/16/O", "atom2_id": "///B/19/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1035, "atom1_serNum": 9155, "atom2_serNum": 10581, "donAcc_type": "questionable", "distance": 3.287, "atom1_id": "///B/16/O", "atom2_id": "///B/202/OE2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1036, "atom1_serNum": 9196, "atom2_serNum": 9201, "donAcc_type": "standard", "distance": 2.591, "atom1_id": "///B/22/O", "atom2_id": "///B/24/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1037, "atom1_serNum": 9204, "atom2_serNum": 9219, "donAcc_type": "standard", "distance": 2.539, "atom1_id": "///B/24/O", "atom2_id": "///B/26/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1038, "atom1_serNum": 9204, "atom2_serNum": 9224, "donAcc_type": "acceptable", "distance": 2.940, "atom1_id": "///B/24/O", "atom2_id": "///B/26/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1039, "atom1_serNum": 9208, "atom2_serNum": 18196, "donAcc_type": "standard", "distance": 2.841, "atom1_id": "///B/24/NE", "atom2_id": "///T/28/O5'", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 1040, "atom1_serNum": 9211, "atom2_serNum": 18195, "donAcc_type": "standard", "distance": 2.519, "atom1_id": "///B/24/NH2", "atom2_id": "///T/28/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 1041, "atom1_serNum": 9222, "atom2_serNum": 9234, "donAcc_type": "standard", "distance": 3.137, "atom1_id": "///B/26/O", "atom2_id": "///B/28/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1042, "atom1_serNum": 9229, "atom2_serNum": 9249, "donAcc_type": "standard", "distance": 2.882, "atom1_id": "///B/27/O", "atom2_id": "///B/30/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1043, "atom1_serNum": 9237, "atom2_serNum": 9257, "donAcc_type": "standard", "distance": 2.937, "atom1_id": "///B/28/O", "atom2_id": "///B/31/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1044, "atom1_serNum": 9244, "atom2_serNum": 9261, "donAcc_type": "standard", "distance": 3.124, "atom1_id": "///B/29/O", "atom2_id": "///B/32/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1045, "atom1_serNum": 9260, "atom2_serNum": 9552, "donAcc_type": "standard", "distance": 2.703, "atom1_id": "///B/31/O", "atom2_id": "///B/72/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1046, "atom1_serNum": 9261, "atom2_serNum": 9267, "donAcc_type": "standard", "distance": 2.921, "atom1_id": "///B/32/N", "atom2_id": "///B/32/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1047, "atom1_serNum": 9268, "atom2_serNum": 9534, "donAcc_type": "standard", "distance": 3.199, "atom1_id": "///B/32/ND2", "atom2_id": "///B/69/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1048, "atom1_serNum": 9269, "atom2_serNum": 9541, "donAcc_type": "standard", "distance": 2.855, "atom1_id": "///B/33/N", "atom2_id": "///B/70/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1049, "atom1_serNum": 9272, "atom2_serNum": 9538, "donAcc_type": "standard", "distance": 3.598, "atom1_id": "///B/33/O", "atom2_id": "///B/70/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1050, "atom1_serNum": 9277, "atom2_serNum": 9358, "donAcc_type": "standard", "distance": 3.671, "atom1_id": "///B/34/N", "atom2_id": "///B/45/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1051, "atom1_serNum": 9280, "atom2_serNum": 9344, "donAcc_type": "questionable", "distance": 3.017, "atom1_id": "///B/34/O", "atom2_id": "///B/43/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1052, "atom1_serNum": 9280, "atom2_serNum": 9355, "donAcc_type": "standard", "distance": 3.276, "atom1_id": "///B/34/O", "atom2_id": "///B/45/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1053, "atom1_serNum": 9285, "atom2_serNum": 9527, "donAcc_type": "standard", "distance": 3.507, "atom1_id": "///B/35/N", "atom2_id": "///B/68/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1054, "atom1_serNum": 9288, "atom2_serNum": 9524, "donAcc_type": "standard", "distance": 3.886, "atom1_id": "///B/35/O", "atom2_id": "///B/68/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1055, "atom1_serNum": 9293, "atom2_serNum": 9344, "donAcc_type": "standard", "distance": 3.377, "atom1_id": "///B/36/N", "atom2_id": "///B/43/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1056, "atom1_serNum": 9296, "atom2_serNum": 9329, "donAcc_type": "questionable", "distance": 3.364, "atom1_id": "///B/36/O", "atom2_id": "///B/41/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1057, "atom1_serNum": 9296, "atom2_serNum": 9341, "donAcc_type": "standard", "distance": 2.831, "atom1_id": "///B/36/O", "atom2_id": "///B/43/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1058, "atom1_serNum": 9302, "atom2_serNum": 9518, "donAcc_type": "standard", "distance": 3.338, "atom1_id": "///B/37/N", "atom2_id": "///B/66/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1059, "atom1_serNum": 9305, "atom2_serNum": 9515, "donAcc_type": "standard", "distance": 3.483, "atom1_id": "///B/37/O", "atom2_id": "///B/66/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1060, "atom1_serNum": 9309, "atom2_serNum": 9329, "donAcc_type": "standard", "distance": 3.106, "atom1_id": "///B/38/N", "atom2_id": "///B/41/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1061, "atom1_serNum": 9312, "atom2_serNum": 9326, "donAcc_type": "standard", "distance": 3.085, "atom1_id": "///B/38/O", "atom2_id": "///B/41/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1062, "atom1_serNum": 9312, "atom2_serNum": 9329, "donAcc_type": "questionable", "distance": 2.917, "atom1_id": "///B/38/O", "atom2_id": "///B/41/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1063, "atom1_serNum": 9321, "atom2_serNum": 9331, "donAcc_type": "acceptable", "distance": 2.977, "atom1_id": "///B/39/OD2", "atom2_id": "///B/41/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1064, "atom1_serNum": 9325, "atom2_serNum": 9331, "donAcc_type": "acceptable", "distance": 2.965, "atom1_id": "///B/40/O", "atom2_id": "///B/41/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1065, "atom1_serNum": 9325, "atom2_serNum": 9458, "donAcc_type": "standard", "distance": 3.246, "atom1_id": "///B/40/O", "atom2_id": "///B/59/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1066, "atom1_serNum": 9333, "atom2_serNum": 9449, "donAcc_type": "standard", "distance": 3.712, "atom1_id": "///B/42/N", "atom2_id": "///B/57/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1067, "atom1_serNum": 9336, "atom2_serNum": 9446, "donAcc_type": "standard", "distance": 3.668, "atom1_id": "///B/42/O", "atom2_id": "///B/57/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1068, "atom1_serNum": 9346, "atom2_serNum": 9444, "donAcc_type": "acceptable", "distance": 2.823, "atom1_id": "///B/43/OG", "atom2_id": "///B/56/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1069, "atom1_serNum": 9347, "atom2_serNum": 9433, "donAcc_type": "standard", "distance": 2.997, "atom1_id": "///B/44/N", "atom2_id": "///B/55/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1070, "atom1_serNum": 9350, "atom2_serNum": 9418, "donAcc_type": "questionable", "distance": 3.219, "atom1_id": "///B/44/O", "atom2_id": "///B/53/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1071, "atom1_serNum": 9350, "atom2_serNum": 9430, "donAcc_type": "standard", "distance": 3.511, "atom1_id": "///B/44/O", "atom2_id": "///B/55/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1072, "atom1_serNum": 9362, "atom2_serNum": 9418, "donAcc_type": "standard", "distance": 2.929, "atom1_id": "///B/46/N", "atom2_id": "///B/53/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1073, "atom1_serNum": 9365, "atom2_serNum": 9415, "donAcc_type": "standard", "distance": 2.735, "atom1_id": "///B/46/O", "atom2_id": "///B/53/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1074, "atom1_serNum": 9371, "atom2_serNum": 9381, "donAcc_type": "acceptable", "distance": 2.945, "atom1_id": "///B/47/OG1", "atom2_id": "///B/49/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1075, "atom1_serNum": 9371, "atom2_serNum": 9401, "donAcc_type": "acceptable", "distance": 2.656, "atom1_id": "///B/47/OG1", "atom2_id": "///B/51/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1076, "atom1_serNum": 9373, "atom2_serNum": 9401, "donAcc_type": "standard", "distance": 3.247, "atom1_id": "///B/48/N", "atom2_id": "///B/51/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1077, "atom1_serNum": 9379, "atom2_serNum": 9389, "donAcc_type": "standard", "distance": 2.977, "atom1_id": "///B/48/OD1", "atom2_id": "///B/50/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1078, "atom1_serNum": 9379, "atom2_serNum": 9398, "donAcc_type": "standard", "distance": 2.823, "atom1_id": "///B/48/OD1", "atom2_id": "///B/51/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1079, "atom1_serNum": 9392, "atom2_serNum": 10829, "donAcc_type": "standard", "distance": 3.126, "atom1_id": "///B/50/O", "atom2_id": "///B/235/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1080, "atom1_serNum": 9397, "atom2_serNum": 10837, "donAcc_type": "standard", "distance": 3.259, "atom1_id": "///B/50/OE2", "atom2_id": "///B/235/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1081, "atom1_serNum": 9406, "atom2_serNum": 10819, "donAcc_type": "standard", "distance": 2.609, "atom1_id": "///B/52/N", "atom2_id": "///B/233/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1082, "atom1_serNum": 9409, "atom2_serNum": 10816, "donAcc_type": "standard", "distance": 2.773, "atom1_id": "///B/52/O", "atom2_id": "///B/233/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1083, "atom1_serNum": 9423, "atom2_serNum": 10800, "donAcc_type": "standard", "distance": 2.566, "atom1_id": "///B/54/N", "atom2_id": "///B/231/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1084, "atom1_serNum": 9426, "atom2_serNum": 10797, "donAcc_type": "standard", "distance": 2.876, "atom1_id": "///B/54/O", "atom2_id": "///B/231/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1085, "atom1_serNum": 9476, "atom2_serNum": 9495, "donAcc_type": "acceptable", "distance": 2.854, "atom1_id": "///B/61/O", "atom2_id": "///B/63/ND1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1086, "atom1_serNum": 9529, "atom2_serNum": 9856, "donAcc_type": "acceptable", "distance": 3.499, "atom1_id": "///B/68/OG1", "atom2_id": "///B/110/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1087, "atom1_serNum": 9529, "atom2_serNum": 9861, "donAcc_type": "acceptable", "distance": 3.011, "atom1_id": "///B/68/OG1", "atom2_id": "///B/111/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1088, "atom1_serNum": 9531, "atom2_serNum": 9861, "donAcc_type": "standard", "distance": 3.295, "atom1_id": "///B/69/N", "atom2_id": "///B/111/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1089, "atom1_serNum": 9541, "atom2_serNum": 9552, "donAcc_type": "standard", "distance": 3.299, "atom1_id": "///B/70/O", "atom2_id": "///B/72/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1090, "atom1_serNum": 9548, "atom2_serNum": 9577, "donAcc_type": "standard", "distance": 2.992, "atom1_id": "///B/71/O", "atom2_id": "///B/75/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1091, "atom1_serNum": 9555, "atom2_serNum": 9588, "donAcc_type": "standard", "distance": 2.849, "atom1_id": "///B/72/O", "atom2_id": "///B/76/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1092, "atom1_serNum": 9560, "atom2_serNum": 9599, "donAcc_type": "standard", "distance": 2.977, "atom1_id": "///B/73/O", "atom2_id": "///B/77/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1093, "atom1_serNum": 9571, "atom2_serNum": 9607, "donAcc_type": "standard", "distance": 3.134, "atom1_id": "///B/74/O", "atom2_id": "///B/78/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1094, "atom1_serNum": 9576, "atom2_serNum": 14206, "donAcc_type": "standard", "distance": 3.050, "atom1_id": "///B/74/NZ", "atom2_id": "///C/300/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1095, "atom1_serNum": 9580, "atom2_serNum": 9615, "donAcc_type": "standard", "distance": 3.229, "atom1_id": "///B/75/O", "atom2_id": "///B/79/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1096, "atom1_serNum": 9591, "atom2_serNum": 9621, "donAcc_type": "standard", "distance": 2.931, "atom1_id": "///B/76/O", "atom2_id": "///B/80/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1097, "atom1_serNum": 9602, "atom2_serNum": 9632, "donAcc_type": "standard", "distance": 2.811, "atom1_id": "///B/77/O", "atom2_id": "///B/81/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1098, "atom1_serNum": 9605, "atom2_serNum": 9631, "donAcc_type": "standard", "distance": 2.925, "atom1_id": "///B/77/OD1", "atom2_id": "///B/80/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1099, "atom1_serNum": 9610, "atom2_serNum": 9636, "donAcc_type": "standard", "distance": 3.114, "atom1_id": "///B/78/O", "atom2_id": "///B/82/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1100, "atom1_serNum": 9635, "atom2_serNum": 13958, "donAcc_type": "standard", "distance": 3.797, "atom1_id": "///B/81/O", "atom2_id": "///C/269/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1101, "atom1_serNum": 9647, "atom2_serNum": 9664, "donAcc_type": "standard", "distance": 3.180, "atom1_id": "///B/83/O", "atom2_id": "///B/86/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1102, "atom1_serNum": 9672, "atom2_serNum": 9787, "donAcc_type": "acceptable", "distance": 2.691, "atom1_id": "///B/87/O", "atom2_id": "///B/101/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1103, "atom1_serNum": 9686, "atom2_serNum": 9774, "donAcc_type": "standard", "distance": 2.771, "atom1_id": "///B/89/N", "atom2_id": "///B/100/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1104, "atom1_serNum": 9689, "atom2_serNum": 9771, "donAcc_type": "standard", "distance": 3.021, "atom1_id": "///B/89/O", "atom2_id": "///B/100/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1105, "atom1_serNum": 9698, "atom2_serNum": 9759, "donAcc_type": "standard", "distance": 3.369, "atom1_id": "///B/91/N", "atom2_id": "///B/98/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1106, "atom1_serNum": 9701, "atom2_serNum": 9756, "donAcc_type": "standard", "distance": 3.141, "atom1_id": "///B/91/O", "atom2_id": "///B/98/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1107, "atom1_serNum": 9715, "atom2_serNum": 9740, "donAcc_type": "standard", "distance": 2.834, "atom1_id": "///B/93/N", "atom2_id": "///B/96/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1108, "atom1_serNum": 9718, "atom2_serNum": 9728, "donAcc_type": "standard", "distance": 3.055, "atom1_id": "///B/93/O", "atom2_id": "///B/95/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1109, "atom1_serNum": 9718, "atom2_serNum": 9737, "donAcc_type": "standard", "distance": 3.136, "atom1_id": "///B/93/O", "atom2_id": "///B/96/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1110, "atom1_serNum": 9747, "atom2_serNum": 14184, "donAcc_type": "standard", "distance": 3.811, "atom1_id": "///B/96/NH2", "atom2_id": "///C/298/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1111, "atom1_serNum": 9748, "atom2_serNum": 9840, "donAcc_type": "standard", "distance": 3.036, "atom1_id": "///B/97/N", "atom2_id": "///B/108/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1112, "atom1_serNum": 9751, "atom2_serNum": 9837, "donAcc_type": "standard", "distance": 2.691, "atom1_id": "///B/97/O", "atom2_id": "///B/108/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1113, "atom1_serNum": 9764, "atom2_serNum": 9823, "donAcc_type": "standard", "distance": 2.970, "atom1_id": "///B/99/N", "atom2_id": "///B/106/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1114, "atom1_serNum": 9767, "atom2_serNum": 9820, "donAcc_type": "standard", "distance": 3.014, "atom1_id": "///B/99/O", "atom2_id": "///B/106/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1115, "atom1_serNum": 9782, "atom2_serNum": 9806, "donAcc_type": "standard", "distance": 3.138, "atom1_id": "///B/101/N", "atom2_id": "///B/104/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1116, "atom1_serNum": 9785, "atom2_serNum": 9792, "donAcc_type": "standard", "distance": 2.771, "atom1_id": "///B/101/O", "atom2_id": "///B/103/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1117, "atom1_serNum": 9785, "atom2_serNum": 9803, "donAcc_type": "standard", "distance": 2.970, "atom1_id": "///B/101/O", "atom2_id": "///B/104/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1118, "atom1_serNum": 9801, "atom2_serNum": 9808, "donAcc_type": "acceptable", "distance": 2.815, "atom1_id": "///B/103/NH1", "atom2_id": "///B/104/OG", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1119, "atom1_serNum": 9809, "atom2_serNum": 14225, "donAcc_type": "standard", "distance": 2.851, "atom1_id": "///B/105/N", "atom2_id": "///C/303/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1120, "atom1_serNum": 9812, "atom2_serNum": 14222, "donAcc_type": "standard", "distance": 2.661, "atom1_id": "///B/105/O", "atom2_id": "///C/303/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1121, "atom1_serNum": 9816, "atom2_serNum": 14229, "donAcc_type": "standard", "distance": 2.681, "atom1_id": "///B/105/NE", "atom2_id": "///C/303/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1122, "atom1_serNum": 9818, "atom2_serNum": 9836, "donAcc_type": "acceptable", "distance": 3.589, "atom1_id": "///B/105/NH1", "atom2_id": "///B/107/OG", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1123, "atom1_serNum": 9819, "atom2_serNum": 14215, "donAcc_type": "standard", "distance": 3.086, "atom1_id": "///B/105/NH2", "atom2_id": "///C/301/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1124, "atom1_serNum": 9831, "atom2_serNum": 14211, "donAcc_type": "standard", "distance": 3.211, "atom1_id": "///B/107/N", "atom2_id": "///C/301/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1125, "atom1_serNum": 9834, "atom2_serNum": 14208, "donAcc_type": "standard", "distance": 3.211, "atom1_id": "///B/107/O", "atom2_id": "///C/301/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1126, "atom1_serNum": 9850, "atom2_serNum": 14207, "donAcc_type": "acceptable", "distance": 3.625, "atom1_id": "///B/109/OG", "atom2_id": "///C/300/OE2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1127, "atom1_serNum": 9869, "atom2_serNum": 9883, "donAcc_type": "standard", "distance": 3.145, "atom1_id": "///B/112/O", "atom2_id": "///B/115/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1128, "atom1_serNum": 9876, "atom2_serNum": 9891, "donAcc_type": "standard", "distance": 2.844, "atom1_id": "///B/113/O", "atom2_id": "///B/116/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1129, "atom1_serNum": 9915, "atom2_serNum": 9917, "donAcc_type": "standard", "distance": 3.039, "atom1_id": "///B/118/OD1", "atom2_id": "///B/119/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1130, "atom1_serNum": 9944, "atom2_serNum": 10751, "donAcc_type": "standard", "distance": 3.913, "atom1_id": "///B/122/O", "atom2_id": "///B/224/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1131, "atom1_serNum": 9969, "atom2_serNum": 9994, "donAcc_type": "acceptable", "distance": 2.725, "atom1_id": "///B/124/OG", "atom2_id": "///B/127/OE2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1132, "atom1_serNum": 9970, "atom2_serNum": 10702, "donAcc_type": "standard", "distance": 2.971, "atom1_id": "///B/125/N", "atom2_id": "///B/218/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1133, "atom1_serNum": 9982, "atom2_serNum": 10699, "donAcc_type": "standard", "distance": 3.583, "atom1_id": "///B/126/O", "atom2_id": "///B/218/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1134, "atom1_serNum": 9995, "atom2_serNum": 10686, "donAcc_type": "standard", "distance": 3.182, "atom1_id": "///B/128/N", "atom2_id": "///B/216/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1135, "atom1_serNum": 9998, "atom2_serNum": 10683, "donAcc_type": "standard", "distance": 2.720, "atom1_id": "///B/128/O", "atom2_id": "///B/216/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1136, "atom1_serNum": 10013, "atom2_serNum": 10667, "donAcc_type": "standard", "distance": 2.797, "atom1_id": "///B/130/N", "atom2_id": "///B/214/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1137, "atom1_serNum": 10016, "atom2_serNum": 10664, "donAcc_type": "standard", "distance": 3.080, "atom1_id": "///B/130/O", "atom2_id": "///B/214/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1138, "atom1_serNum": 10024, "atom2_serNum": 10049, "donAcc_type": "standard", "distance": 3.551, "atom1_id": "///B/131/O", "atom2_id": "///B/135/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1139, "atom1_serNum": 10031, "atom2_serNum": 10049, "donAcc_type": "standard", "distance": 2.920, "atom1_id": "///B/132/O", "atom2_id": "///B/135/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1140, "atom1_serNum": 10031, "atom2_serNum": 10057, "donAcc_type": "standard", "distance": 3.052, "atom1_id": "///B/132/O", "atom2_id": "///B/136/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1141, "atom1_serNum": 10035, "atom2_serNum": 10633, "donAcc_type": "standard", "distance": 3.085, "atom1_id": "///B/132/OE1", "atom2_id": "///B/209/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1142, "atom1_serNum": 10036, "atom2_serNum": 10652, "donAcc_type": "standard", "distance": 2.485, "atom1_id": "///B/132/NE2", "atom2_id": "///B/212/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1143, "atom1_serNum": 10040, "atom2_serNum": 10066, "donAcc_type": "standard", "distance": 3.090, "atom1_id": "///B/133/O", "atom2_id": "///B/137/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1144, "atom1_serNum": 10045, "atom2_serNum": 10077, "donAcc_type": "standard", "distance": 3.087, "atom1_id": "///B/134/O", "atom2_id": "///B/138/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1145, "atom1_serNum": 10052, "atom2_serNum": 10085, "donAcc_type": "standard", "distance": 3.180, "atom1_id": "///B/135/O", "atom2_id": "///B/139/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1146, "atom1_serNum": 10060, "atom2_serNum": 10093, "donAcc_type": "standard", "distance": 3.013, "atom1_id": "///B/136/O", "atom2_id": "///B/140/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1147, "atom1_serNum": 10069, "atom2_serNum": 10102, "donAcc_type": "standard", "distance": 2.875, "atom1_id": "///B/137/O", "atom2_id": "///B/141/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1148, "atom1_serNum": 10080, "atom2_serNum": 10112, "donAcc_type": "acceptable", "distance": 2.981, "atom1_id": "///B/138/O", "atom2_id": "///B/142/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1149, "atom1_serNum": 10088, "atom2_serNum": 10107, "donAcc_type": "standard", "distance": 2.921, "atom1_id": "///B/139/O", "atom2_id": "///B/142/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1150, "atom1_serNum": 10088, "atom2_serNum": 10114, "donAcc_type": "standard", "distance": 2.883, "atom1_id": "///B/139/O", "atom2_id": "///B/143/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1151, "atom1_serNum": 10105, "atom2_serNum": 11808, "donAcc_type": "acceptable", "distance": 3.515, "atom1_id": "///B/141/O", "atom2_id": "///B/359/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1152, "atom1_serNum": 10110, "atom2_serNum": 10134, "donAcc_type": "standard", "distance": 3.150, "atom1_id": "///B/142/O", "atom2_id": "///B/145/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1153, "atom1_serNum": 10117, "atom2_serNum": 10140, "donAcc_type": "standard", "distance": 3.090, "atom1_id": "///B/143/O", "atom2_id": "///B/146/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1154, "atom1_serNum": 10126, "atom2_serNum": 10392, "donAcc_type": "standard", "distance": 3.204, "atom1_id": "///B/144/O", "atom2_id": "///B/176/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1155, "atom1_serNum": 10143, "atom2_serNum": 10367, "donAcc_type": "questionable", "distance": 3.306, "atom1_id": "///B/146/O", "atom2_id": "///B/173/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1156, "atom1_serNum": 10151, "atom2_serNum": 10543, "donAcc_type": "standard", "distance": 2.291, "atom1_id": "///B/147/O", "atom2_id": "///B/197/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1157, "atom1_serNum": 10178, "atom2_serNum": 10180, "donAcc_type": "standard", "distance": 2.832, "atom1_id": "///B/150/OD1", "atom2_id": "///B/151/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1158, "atom1_serNum": 10178, "atom2_serNum": 10187, "donAcc_type": "standard", "distance": 2.942, "atom1_id": "///B/150/OD1", "atom2_id": "///B/152/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1159, "atom1_serNum": 10178, "atom2_serNum": 10196, "donAcc_type": "standard", "distance": 2.896, "atom1_id": "///B/150/OD1", "atom2_id": "///B/152/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1160, "atom1_serNum": 10179, "atom2_serNum": 10364, "donAcc_type": "questionable", "distance": 3.102, "atom1_id": "///B/150/OD2", "atom2_id": "///B/173/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1161, "atom1_serNum": 10183, "atom2_serNum": 10198, "donAcc_type": "standard", "distance": 2.916, "atom1_id": "///B/151/O", "atom2_id": "///B/153/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1162, "atom1_serNum": 10190, "atom2_serNum": 10222, "donAcc_type": "standard", "distance": 2.954, "atom1_id": "///B/152/O", "atom2_id": "///B/155/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1163, "atom1_serNum": 10201, "atom2_serNum": 10230, "donAcc_type": "standard", "distance": 3.020, "atom1_id": "///B/153/O", "atom2_id": "///B/156/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1164, "atom1_serNum": 10225, "atom2_serNum": 10238, "donAcc_type": "standard", "distance": 2.845, "atom1_id": "///B/155/O", "atom2_id": "///B/157/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1165, "atom1_serNum": 10242, "atom2_serNum": 10523, "donAcc_type": "standard", "distance": 3.325, "atom1_id": "///B/158/N", "atom2_id": "///B/195/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1166, "atom1_serNum": 10245, "atom2_serNum": 10508, "donAcc_type": "questionable", "distance": 3.104, "atom1_id": "///B/158/O", "atom2_id": "///B/193/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1167, "atom1_serNum": 10245, "atom2_serNum": 10520, "donAcc_type": "standard", "distance": 3.500, "atom1_id": "///B/158/O", "atom2_id": "///B/195/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1168, "atom1_serNum": 10250, "atom2_serNum": 10345, "donAcc_type": "standard", "distance": 3.151, "atom1_id": "///B/159/N", "atom2_id": "///B/170/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1169, "atom1_serNum": 10253, "atom2_serNum": 10342, "donAcc_type": "standard", "distance": 3.360, "atom1_id": "///B/159/O", "atom2_id": "///B/170/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1170, "atom1_serNum": 10258, "atom2_serNum": 10508, "donAcc_type": "standard", "distance": 3.165, "atom1_id": "///B/160/N", "atom2_id": "///B/193/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1171, "atom1_serNum": 10261, "atom2_serNum": 10492, "donAcc_type": "questionable", "distance": 3.254, "atom1_id": "///B/160/O", "atom2_id": "///B/191/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1172, "atom1_serNum": 10261, "atom2_serNum": 10505, "donAcc_type": "standard", "distance": 3.685, "atom1_id": "///B/160/O", "atom2_id": "///B/193/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1173, "atom1_serNum": 10269, "atom2_serNum": 10327, "donAcc_type": "standard", "distance": 3.410, "atom1_id": "///B/161/N", "atom2_id": "///B/168/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1174, "atom1_serNum": 10272, "atom2_serNum": 10324, "donAcc_type": "standard", "distance": 3.094, "atom1_id": "///B/161/O", "atom2_id": "///B/168/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1175, "atom1_serNum": 10276, "atom2_serNum": 10913, "donAcc_type": "acceptable", "distance": 3.473, "atom1_id": "///B/161/OE1", "atom2_id": "///B/244/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1176, "atom1_serNum": 10276, "atom2_serNum": 10924, "donAcc_type": "standard", "distance": 3.037, "atom1_id": "///B/161/OE1", "atom2_id": "///B/245/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1177, "atom1_serNum": 10277, "atom2_serNum": 10504, "donAcc_type": "acceptable", "distance": 2.724, "atom1_id": "///B/161/OE2", "atom2_id": "///B/192/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1178, "atom1_serNum": 10278, "atom2_serNum": 10492, "donAcc_type": "standard", "distance": 3.607, "atom1_id": "///B/162/N", "atom2_id": "///B/191/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1179, "atom1_serNum": 10281, "atom2_serNum": 10488, "donAcc_type": "acceptable", "distance": 3.606, "atom1_id": "///B/162/O", "atom2_id": "///B/190/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1180, "atom1_serNum": 10283, "atom2_serNum": 10479, "donAcc_type": "acceptable", "distance": 2.706, "atom1_id": "///B/162/OG1", "atom2_id": "///B/189/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1181, "atom1_serNum": 10283, "atom2_serNum": 10489, "donAcc_type": "acceptable", "distance": 3.270, "atom1_id": "///B/162/OG1", "atom2_id": "///B/191/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1182, "atom1_serNum": 10285, "atom2_serNum": 10310, "donAcc_type": "standard", "distance": 3.044, "atom1_id": "///B/163/N", "atom2_id": "///B/166/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1183, "atom1_serNum": 10288, "atom2_serNum": 10307, "donAcc_type": "standard", "distance": 2.966, "atom1_id": "///B/163/O", "atom2_id": "///B/166/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1184, "atom1_serNum": 10294, "atom2_serNum": 10471, "donAcc_type": "standard", "distance": 3.191, "atom1_id": "///B/164/N", "atom2_id": "///B/188/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1185, "atom1_serNum": 10297, "atom2_serNum": 10456, "donAcc_type": "questionable", "distance": 3.233, "atom1_id": "///B/164/O", "atom2_id": "///B/186/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1186, "atom1_serNum": 10297, "atom2_serNum": 10468, "donAcc_type": "standard", "distance": 2.852, "atom1_id": "///B/164/O", "atom2_id": "///B/188/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1187, "atom1_serNum": 10301, "atom2_serNum": 10441, "donAcc_type": "standard", "distance": 3.956, "atom1_id": "///B/165/O", "atom2_id": "///B/184/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1188, "atom1_serNum": 10314, "atom2_serNum": 10333, "donAcc_type": "standard", "distance": 3.485, "atom1_id": "///B/166/OE1", "atom2_id": "///B/168/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1189, "atom1_serNum": 10316, "atom2_serNum": 10429, "donAcc_type": "standard", "distance": 3.482, "atom1_id": "///B/167/N", "atom2_id": "///B/182/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1190, "atom1_serNum": 10319, "atom2_serNum": 10426, "donAcc_type": "standard", "distance": 3.051, "atom1_id": "///B/167/O", "atom2_id": "///B/182/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1191, "atom1_serNum": 10331, "atom2_serNum": 10913, "donAcc_type": "acceptable", "distance": 3.874, "atom1_id": "///B/168/NE", "atom2_id": "///B/244/OH", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1192, "atom1_serNum": 10333, "atom2_serNum": 10425, "donAcc_type": "acceptable", "distance": 3.040, "atom1_id": "///B/168/NH1", "atom2_id": "///B/181/OG", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1193, "atom1_serNum": 10335, "atom2_serNum": 10417, "donAcc_type": "standard", "distance": 2.683, "atom1_id": "///B/169/N", "atom2_id": "///B/180/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1194, "atom1_serNum": 10338, "atom2_serNum": 10414, "donAcc_type": "standard", "distance": 3.099, "atom1_id": "///B/169/O", "atom2_id": "///B/180/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1195, "atom1_serNum": 10340, "atom2_serNum": 10417, "donAcc_type": "acceptable", "distance": 3.131, "atom1_id": "///B/169/OG1", "atom2_id": "///B/180/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1196, "atom1_serNum": 10349, "atom2_serNum": 10405, "donAcc_type": "standard", "distance": 3.355, "atom1_id": "///B/171/N", "atom2_id": "///B/178/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1197, "atom1_serNum": 10352, "atom2_serNum": 10402, "donAcc_type": "standard", "distance": 3.311, "atom1_id": "///B/171/O", "atom2_id": "///B/178/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1198, "atom1_serNum": 10359, "atom2_serNum": 10369, "donAcc_type": "acceptable", "distance": 3.185, "atom1_id": "///B/172/OG1", "atom2_id": "///B/174/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1199, "atom1_serNum": 10359, "atom2_serNum": 10386, "donAcc_type": "acceptable", "distance": 2.640, "atom1_id": "///B/172/OG1", "atom2_id": "///B/176/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1200, "atom1_serNum": 10361, "atom2_serNum": 10386, "donAcc_type": "standard", "distance": 3.468, "atom1_id": "///B/173/N", "atom2_id": "///B/176/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1201, "atom1_serNum": 10368, "atom2_serNum": 10392, "donAcc_type": "standard", "distance": 2.771, "atom1_id": "///B/173/OD2", "atom2_id": "///B/176/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1202, "atom1_serNum": 10372, "atom2_serNum": 16113, "donAcc_type": "standard", "distance": 3.530, "atom1_id": "///B/174/O", "atom2_id": "///D/185/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1203, "atom1_serNum": 10376, "atom2_serNum": 11823, "donAcc_type": "standard", "distance": 3.352, "atom1_id": "///B/175/O", "atom2_id": "///B/362/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1204, "atom1_serNum": 10379, "atom2_serNum": 16102, "donAcc_type": "acceptable", "distance": 3.744, "atom1_id": "///B/175/ND1", "atom2_id": "///D/183/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1205, "atom1_serNum": 10393, "atom2_serNum": 11564, "donAcc_type": "standard", "distance": 2.994, "atom1_id": "///B/176/NH2", "atom2_id": "///B/326/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1206, "atom1_serNum": 10394, "atom2_serNum": 11812, "donAcc_type": "standard", "distance": 2.720, "atom1_id": "///B/177/N", "atom2_id": "///B/360/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1207, "atom1_serNum": 10397, "atom2_serNum": 11809, "donAcc_type": "standard", "distance": 2.904, "atom1_id": "///B/177/O", "atom2_id": "///B/360/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1208, "atom1_serNum": 10407, "atom2_serNum": 11795, "donAcc_type": "standard", "distance": 2.823, "atom1_id": "///B/179/N", "atom2_id": "///B/358/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1209, "atom1_serNum": 10410, "atom2_serNum": 11792, "donAcc_type": "standard", "distance": 2.967, "atom1_id": "///B/179/O", "atom2_id": "///B/358/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1210, "atom1_serNum": 10420, "atom2_serNum": 11784, "donAcc_type": "standard", "distance": 2.888, "atom1_id": "///B/181/N", "atom2_id": "///B/356/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1211, "atom1_serNum": 10423, "atom2_serNum": 10425, "donAcc_type": "acceptable", "distance": 3.113, "atom1_id": "///B/181/O", "atom2_id": "///B/181/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1212, "atom1_serNum": 10425, "atom2_serNum": 11784, "donAcc_type": "acceptable", "distance": 2.568, "atom1_id": "///B/181/OG", "atom2_id": "///B/356/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1213, "atom1_serNum": 10515, "atom2_serNum": 10846, "donAcc_type": "standard", "distance": 3.190, "atom1_id": "///B/194/O", "atom2_id": "///B/237/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1214, "atom1_serNum": 10530, "atom2_serNum": 10554, "donAcc_type": "standard", "distance": 2.744, "atom1_id": "///B/196/O", "atom2_id": "///B/199/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1215, "atom1_serNum": 10530, "atom2_serNum": 10558, "donAcc_type": "standard", "distance": 3.078, "atom1_id": "///B/196/O", "atom2_id": "///B/200/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1216, "atom1_serNum": 10537, "atom2_serNum": 10565, "donAcc_type": "standard", "distance": 2.935, "atom1_id": "///B/197/O", "atom2_id": "///B/201/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1217, "atom1_serNum": 10548, "atom2_serNum": 10573, "donAcc_type": "standard", "distance": 3.002, "atom1_id": "///B/198/O", "atom2_id": "///B/202/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1218, "atom1_serNum": 10557, "atom2_serNum": 10582, "donAcc_type": "standard", "distance": 2.988, "atom1_id": "///B/199/O", "atom2_id": "///B/203/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1219, "atom1_serNum": 10561, "atom2_serNum": 10590, "donAcc_type": "standard", "distance": 2.884, "atom1_id": "///B/200/O", "atom2_id": "///B/204/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1220, "atom1_serNum": 10568, "atom2_serNum": 10598, "donAcc_type": "standard", "distance": 2.981, "atom1_id": "///B/201/O", "atom2_id": "///B/205/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1221, "atom1_serNum": 10576, "atom2_serNum": 10609, "donAcc_type": "standard", "distance": 3.073, "atom1_id": "///B/202/O", "atom2_id": "///B/206/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1222, "atom1_serNum": 10580, "atom2_serNum": 10607, "donAcc_type": "standard", "distance": 3.880, "atom1_id": "///B/202/OE1", "atom2_id": "///B/205/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1223, "atom1_serNum": 10585, "atom2_serNum": 10617, "donAcc_type": "standard", "distance": 3.557, "atom1_id": "///B/203/O", "atom2_id": "///B/207/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1224, "atom1_serNum": 10593, "atom2_serNum": 10617, "donAcc_type": "standard", "distance": 3.225, "atom1_id": "///B/204/O", "atom2_id": "///B/207/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1225, "atom1_serNum": 10612, "atom2_serNum": 10625, "donAcc_type": "standard", "distance": 3.379, "atom1_id": "///B/206/O", "atom2_id": "///B/208/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1226, "atom1_serNum": 10631, "atom2_serNum": 10637, "donAcc_type": "standard", "distance": 2.976, "atom1_id": "///B/208/OD1", "atom2_id": "///B/210/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1227, "atom1_serNum": 10660, "atom2_serNum": 10774, "donAcc_type": "standard", "distance": 3.852, "atom1_id": "///B/213/O", "atom2_id": "///B/228/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1228, "atom1_serNum": 10672, "atom2_serNum": 10760, "donAcc_type": "standard", "distance": 2.515, "atom1_id": "///B/215/N", "atom2_id": "///B/226/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1229, "atom1_serNum": 10675, "atom2_serNum": 10757, "donAcc_type": "standard", "distance": 2.595, "atom1_id": "///B/215/O", "atom2_id": "///B/226/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1230, "atom1_serNum": 10690, "atom2_serNum": 10744, "donAcc_type": "standard", "distance": 2.650, "atom1_id": "///B/217/N", "atom2_id": "///B/224/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1231, "atom1_serNum": 10693, "atom2_serNum": 10741, "donAcc_type": "standard", "distance": 2.702, "atom1_id": "///B/217/O", "atom2_id": "///B/224/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1232, "atom1_serNum": 10698, "atom2_serNum": 10750, "donAcc_type": "questionable", "distance": 3.337, "atom1_id": "///B/217/NE2", "atom2_id": "///B/224/NH1", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 1233, "atom1_serNum": 10707, "atom2_serNum": 10728, "donAcc_type": "standard", "distance": 3.059, "atom1_id": "///B/219/N", "atom2_id": "///B/222/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1234, "atom1_serNum": 10724, "atom2_serNum": 10860, "donAcc_type": "standard", "distance": 3.753, "atom1_id": "///B/221/ND2", "atom2_id": "///B/238/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1235, "atom1_serNum": 10733, "atom2_serNum": 10826, "donAcc_type": "standard", "distance": 2.747, "atom1_id": "///B/223/N", "atom2_id": "///B/234/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1236, "atom1_serNum": 10736, "atom2_serNum": 10823, "donAcc_type": "standard", "distance": 2.964, "atom1_id": "///B/223/O", "atom2_id": "///B/234/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1237, "atom1_serNum": 10752, "atom2_serNum": 10808, "donAcc_type": "standard", "distance": 2.745, "atom1_id": "///B/225/N", "atom2_id": "///B/232/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1238, "atom1_serNum": 10755, "atom2_serNum": 10805, "donAcc_type": "standard", "distance": 2.922, "atom1_id": "///B/225/O", "atom2_id": "///B/232/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1239, "atom1_serNum": 10767, "atom2_serNum": 10789, "donAcc_type": "standard", "distance": 3.113, "atom1_id": "///B/227/N", "atom2_id": "///B/230/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1240, "atom1_serNum": 10770, "atom2_serNum": 10778, "donAcc_type": "standard", "distance": 2.971, "atom1_id": "///B/227/O", "atom2_id": "///B/229/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1241, "atom1_serNum": 10770, "atom2_serNum": 10786, "donAcc_type": "standard", "distance": 3.016, "atom1_id": "///B/227/O", "atom2_id": "///B/230/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1242, "atom1_serNum": 10828, "atom2_serNum": 10832, "donAcc_type": "acceptable", "distance": 3.017, "atom1_id": "///B/234/OG", "atom2_id": "///B/235/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1243, "atom1_serNum": 10890, "atom2_serNum": 10902, "donAcc_type": "standard", "distance": 3.084, "atom1_id": "///B/242/O", "atom2_id": "///B/244/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1244, "atom1_serNum": 10897, "atom2_serNum": 10925, "donAcc_type": "standard", "distance": 2.976, "atom1_id": "///B/243/O", "atom2_id": "///B/246/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1245, "atom1_serNum": 10900, "atom2_serNum": 10921, "donAcc_type": "standard", "distance": 3.351, "atom1_id": "///B/243/OD1", "atom2_id": "///B/245/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1246, "atom1_serNum": 10905, "atom2_serNum": 10943, "donAcc_type": "standard", "distance": 3.537, "atom1_id": "///B/244/O", "atom2_id": "///B/248/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1247, "atom1_serNum": 10970, "atom2_serNum": 10982, "donAcc_type": "standard", "distance": 3.061, "atom1_id": "///B/251/O", "atom2_id": "///B/253/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1248, "atom1_serNum": 10982, "atom2_serNum": 11670, "donAcc_type": "standard", "distance": 3.758, "atom1_id": "///B/253/N", "atom2_id": "///B/340/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1249, "atom1_serNum": 10989, "atom2_serNum": 10998, "donAcc_type": "standard", "distance": 3.311, "atom1_id": "///B/253/OD2", "atom2_id": "///B/254/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1250, "atom1_serNum": 10993, "atom2_serNum": 11667, "donAcc_type": "standard", "distance": 3.114, "atom1_id": "///B/254/O", "atom2_id": "///B/340/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1251, "atom1_serNum": 10998, "atom2_serNum": 11678, "donAcc_type": "standard", "distance": 3.653, "atom1_id": "///B/254/NZ", "atom2_id": "///B/341/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1252, "atom1_serNum": 11002, "atom2_serNum": 11445, "donAcc_type": "standard", "distance": 3.513, "atom1_id": "///B/255/O", "atom2_id": "///B/311/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1253, "atom1_serNum": 11009, "atom2_serNum": 11654, "donAcc_type": "standard", "distance": 2.672, "atom1_id": "///B/256/N", "atom2_id": "///B/338/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1254, "atom1_serNum": 11012, "atom2_serNum": 11651, "donAcc_type": "standard", "distance": 2.578, "atom1_id": "///B/256/O", "atom2_id": "///B/338/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1255, "atom1_serNum": 11017, "atom2_serNum": 11429, "donAcc_type": "standard", "distance": 2.712, "atom1_id": "///B/257/N", "atom2_id": "///B/309/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1256, "atom1_serNum": 11020, "atom2_serNum": 11426, "donAcc_type": "standard", "distance": 3.056, "atom1_id": "///B/257/O", "atom2_id": "///B/309/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1257, "atom1_serNum": 11024, "atom2_serNum": 11632, "donAcc_type": "standard", "distance": 3.423, "atom1_id": "///B/257/OE1", "atom2_id": "///B/335/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1258, "atom1_serNum": 11026, "atom2_serNum": 11636, "donAcc_type": "standard", "distance": 3.400, "atom1_id": "///B/258/N", "atom2_id": "///B/336/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1259, "atom1_serNum": 11029, "atom2_serNum": 11633, "donAcc_type": "standard", "distance": 3.564, "atom1_id": "///B/258/O", "atom2_id": "///B/336/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1260, "atom1_serNum": 11034, "atom2_serNum": 11057, "donAcc_type": "standard", "distance": 3.028, "atom1_id": "///B/259/O", "atom2_id": "///B/263/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1261, "atom1_serNum": 11035, "atom2_serNum": 11619, "donAcc_type": "standard", "distance": 3.567, "atom1_id": "///B/260/N", "atom2_id": "///B/334/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1262, "atom1_serNum": 11038, "atom2_serNum": 11065, "donAcc_type": "standard", "distance": 2.906, "atom1_id": "///B/260/O", "atom2_id": "///B/264/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1263, "atom1_serNum": 11044, "atom2_serNum": 11074, "donAcc_type": "standard", "distance": 2.930, "atom1_id": "///B/261/O", "atom2_id": "///B/265/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1264, "atom1_serNum": 11047, "atom2_serNum": 11073, "donAcc_type": "standard", "distance": 3.965, "atom1_id": "///B/261/OD1", "atom2_id": "///B/264/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1265, "atom1_serNum": 11052, "atom2_serNum": 11074, "donAcc_type": "standard", "distance": 2.953, "atom1_id": "///B/262/O", "atom2_id": "///B/265/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1266, "atom1_serNum": 11052, "atom2_serNum": 11083, "donAcc_type": "standard", "distance": 3.121, "atom1_id": "///B/262/O", "atom2_id": "///B/266/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1267, "atom1_serNum": 11060, "atom2_serNum": 11088, "donAcc_type": "standard", "distance": 3.135, "atom1_id": "///B/263/O", "atom2_id": "///B/267/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1268, "atom1_serNum": 11068, "atom2_serNum": 11099, "donAcc_type": "standard", "distance": 3.034, "atom1_id": "///B/264/O", "atom2_id": "///B/268/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1269, "atom1_serNum": 11073, "atom2_serNum": 11575, "donAcc_type": "standard", "distance": 3.056, "atom1_id": "///B/264/NZ", "atom2_id": "///B/328/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1270, "atom1_serNum": 11077, "atom2_serNum": 11104, "donAcc_type": "standard", "distance": 3.031, "atom1_id": "///B/265/O", "atom2_id": "///B/269/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1271, "atom1_serNum": 11081, "atom2_serNum": 11113, "donAcc_type": "standard", "distance": 2.788, "atom1_id": "///B/265/OE1", "atom2_id": "///B/269/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1272, "atom1_serNum": 11086, "atom2_serNum": 11115, "donAcc_type": "standard", "distance": 2.956, "atom1_id": "///B/266/O", "atom2_id": "///B/270/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1273, "atom1_serNum": 11091, "atom2_serNum": 11120, "donAcc_type": "standard", "distance": 2.934, "atom1_id": "///B/267/O", "atom2_id": "///B/271/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1274, "atom1_serNum": 11102, "atom2_serNum": 11125, "donAcc_type": "standard", "distance": 3.744, "atom1_id": "///B/268/O", "atom2_id": "///B/272/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1275, "atom1_serNum": 11111, "atom2_serNum": 11394, "donAcc_type": "standard", "distance": 3.089, "atom1_id": "///B/269/NE", "atom2_id": "///B/304/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1276, "atom1_serNum": 11113, "atom2_serNum": 12480, "donAcc_type": "standard", "distance": 2.527, "atom1_id": "///B/269/NH1", "atom2_id": "///C/81/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1277, "atom1_serNum": 11114, "atom2_serNum": 11394, "donAcc_type": "standard", "distance": 3.155, "atom1_id": "///B/269/NH2", "atom2_id": "///B/304/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1278, "atom1_serNum": 11118, "atom2_serNum": 11133, "donAcc_type": "standard", "distance": 3.172, "atom1_id": "///B/270/O", "atom2_id": "///B/273/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1279, "atom1_serNum": 11123, "atom2_serNum": 11141, "donAcc_type": "standard", "distance": 3.168, "atom1_id": "///B/271/O", "atom2_id": "///B/274/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1280, "atom1_serNum": 11123, "atom2_serNum": 11146, "donAcc_type": "acceptable", "distance": 2.835, "atom1_id": "///B/271/O", "atom2_id": "///B/274/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1281, "atom1_serNum": 11150, "atom2_serNum": 11184, "donAcc_type": "standard", "distance": 2.776, "atom1_id": "///B/275/O", "atom2_id": "///B/279/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1282, "atom1_serNum": 11154, "atom2_serNum": 11164, "donAcc_type": "questionable", "distance": 3.057, "atom1_id": "///B/275/ND2", "atom2_id": "///B/277/N", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 1283, "atom1_serNum": 11154, "atom2_serNum": 11173, "donAcc_type": "questionable", "distance": 3.272, "atom1_id": "///B/275/ND2", "atom2_id": "///B/278/N", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 1284, "atom1_serNum": 11172, "atom2_serNum": 15881, "donAcc_type": "standard", "distance": 2.586, "atom1_id": "///B/277/NZ", "atom2_id": "///D/153/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1285, "atom1_serNum": 11187, "atom2_serNum": 11501, "donAcc_type": "questionable", "distance": 3.345, "atom1_id": "///B/279/O", "atom2_id": "///B/319/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1286, "atom1_serNum": 11187, "atom2_serNum": 11517, "donAcc_type": "standard", "distance": 3.110, "atom1_id": "///B/279/O", "atom2_id": "///B/321/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1287, "atom1_serNum": 11199, "atom2_serNum": 11501, "donAcc_type": "standard", "distance": 3.731, "atom1_id": "///B/281/N", "atom2_id": "///B/319/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1288, "atom1_serNum": 11202, "atom2_serNum": 11498, "donAcc_type": "standard", "distance": 3.580, "atom1_id": "///B/281/O", "atom2_id": "///B/319/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1289, "atom1_serNum": 11206, "atom2_serNum": 11304, "donAcc_type": "standard", "distance": 2.857, "atom1_id": "///B/282/N", "atom2_id": "///B/293/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1290, "atom1_serNum": 11209, "atom2_serNum": 11301, "donAcc_type": "standard", "distance": 2.852, "atom1_id": "///B/282/O", "atom2_id": "///B/293/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1291, "atom1_serNum": 11209, "atom2_serNum": 11306, "donAcc_type": "acceptable", "distance": 2.999, "atom1_id": "///B/282/O", "atom2_id": "///B/293/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1292, "atom1_serNum": 11215, "atom2_serNum": 11484, "donAcc_type": "standard", "distance": 3.945, "atom1_id": "///B/282/NH1", "atom2_id": "///B/316/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1293, "atom1_serNum": 11216, "atom2_serNum": 11855, "donAcc_type": "questionable", "distance": 3.362, "atom1_id": "///B/282/NH2", "atom2_id": "///B/365/NH1", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 1294, "atom1_serNum": 11216, "atom2_serNum": 11865, "donAcc_type": "standard", "distance": 2.887, "atom1_id": "///B/282/NH2", "atom2_id": "///B/366/OXT", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1295, "atom1_serNum": 11217, "atom2_serNum": 11489, "donAcc_type": "standard", "distance": 3.089, "atom1_id": "///B/283/N", "atom2_id": "///B/317/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1296, "atom1_serNum": 11220, "atom2_serNum": 11486, "donAcc_type": "standard", "distance": 2.980, "atom1_id": "///B/283/O", "atom2_id": "///B/317/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1297, "atom1_serNum": 11225, "atom2_serNum": 11287, "donAcc_type": "standard", "distance": 2.900, "atom1_id": "///B/284/N", "atom2_id": "///B/291/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1298, "atom1_serNum": 11228, "atom2_serNum": 11284, "donAcc_type": "standard", "distance": 2.873, "atom1_id": "///B/284/O", "atom2_id": "///B/291/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1299, "atom1_serNum": 11236, "atom2_serNum": 14991, "donAcc_type": "acceptable", "distance": 3.290, "atom1_id": "///B/284/OH", "atom2_id": "///D/42/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1300, "atom1_serNum": 11237, "atom2_serNum": 11472, "donAcc_type": "standard", "distance": 2.925, "atom1_id": "///B/285/N", "atom2_id": "///B/315/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1301, "atom1_serNum": 11240, "atom2_serNum": 11469, "donAcc_type": "standard", "distance": 3.531, "atom1_id": "///B/285/O", "atom2_id": "///B/315/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1302, "atom1_serNum": 11244, "atom2_serNum": 11270, "donAcc_type": "standard", "distance": 3.165, "atom1_id": "///B/286/N", "atom2_id": "///B/289/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1303, "atom1_serNum": 11247, "atom2_serNum": 11259, "donAcc_type": "standard", "distance": 2.749, "atom1_id": "///B/286/O", "atom2_id": "///B/288/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1304, "atom1_serNum": 11247, "atom2_serNum": 11267, "donAcc_type": "standard", "distance": 2.963, "atom1_id": "///B/286/O", "atom2_id": "///B/289/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1305, "atom1_serNum": 11262, "atom2_serNum": 11419, "donAcc_type": "standard", "distance": 3.222, "atom1_id": "///B/288/O", "atom2_id": "///B/308/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1306, "atom1_serNum": 11266, "atom2_serNum": 11436, "donAcc_type": "standard", "distance": 3.177, "atom1_id": "///B/288/ND2", "atom2_id": "///B/310/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1307, "atom1_serNum": 11276, "atom2_serNum": 11406, "donAcc_type": "standard", "distance": 2.738, "atom1_id": "///B/290/N", "atom2_id": "///B/306/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1308, "atom1_serNum": 11279, "atom2_serNum": 11403, "donAcc_type": "standard", "distance": 2.635, "atom1_id": "///B/290/O", "atom2_id": "///B/306/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1309, "atom1_serNum": 11293, "atom2_serNum": 11389, "donAcc_type": "standard", "distance": 2.867, "atom1_id": "///B/292/N", "atom2_id": "///B/304/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1310, "atom1_serNum": 11296, "atom2_serNum": 11386, "donAcc_type": "standard", "distance": 2.803, "atom1_id": "///B/292/O", "atom2_id": "///B/304/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1311, "atom1_serNum": 11306, "atom2_serNum": 14994, "donAcc_type": "acceptable", "distance": 3.788, "atom1_id": "///B/293/OG1", "atom2_id": "///D/42/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1312, "atom1_serNum": 11308, "atom2_serNum": 11375, "donAcc_type": "standard", "distance": 2.675, "atom1_id": "///B/294/N", "atom2_id": "///B/302/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1313, "atom1_serNum": 11311, "atom2_serNum": 11372, "donAcc_type": "standard", "distance": 3.171, "atom1_id": "///B/294/O", "atom2_id": "///B/302/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1314, "atom1_serNum": 11319, "atom2_serNum": 11370, "donAcc_type": "questionable", "distance": 2.874, "atom1_id": "///B/295/OD1", "atom2_id": "///B/301/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1315, "atom1_serNum": 11319, "atom2_serNum": 14993, "donAcc_type": "standard", "distance": 3.148, "atom1_id": "///B/295/OD1", "atom2_id": "///D/42/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1316, "atom1_serNum": 11320, "atom2_serNum": 14994, "donAcc_type": "questionable", "distance": 3.041, "atom1_id": "///B/295/ND2", "atom2_id": "///D/42/NH2", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 1317, "atom1_serNum": 11321, "atom2_serNum": 11357, "donAcc_type": "standard", "distance": 3.146, "atom1_id": "///B/296/N", "atom2_id": "///B/300/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1318, "atom1_serNum": 11324, "atom2_serNum": 11345, "donAcc_type": "standard", "distance": 2.900, "atom1_id": "///B/296/O", "atom2_id": "///B/299/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1319, "atom1_serNum": 11327, "atom2_serNum": 11336, "donAcc_type": "standard", "distance": 3.048, "atom1_id": "///B/296/OD1", "atom2_id": "///B/298/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1320, "atom1_serNum": 11327, "atom2_serNum": 11354, "donAcc_type": "standard", "distance": 3.367, "atom1_id": "///B/296/OD1", "atom2_id": "///B/300/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1321, "atom1_serNum": 11328, "atom2_serNum": 11361, "donAcc_type": "standard", "distance": 2.901, "atom1_id": "///B/296/ND2", "atom2_id": "///B/300/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1322, "atom1_serNum": 11328, "atom2_serNum": 12421, "donAcc_type": "questionable", "distance": 3.300, "atom1_id": "///B/296/ND2", "atom2_id": "///C/74/NZ", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 1323, "atom1_serNum": 11336, "atom2_serNum": 11343, "donAcc_type": "standard", "distance": 3.210, "atom1_id": "///B/298/N", "atom2_id": "///B/298/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1324, "atom1_serNum": 11361, "atom2_serNum": 12421, "donAcc_type": "standard", "distance": 3.000, "atom1_id": "///B/300/OE1", "atom2_id": "///C/74/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1325, "atom1_serNum": 11362, "atom2_serNum": 12695, "donAcc_type": "acceptable", "distance": 2.709, "atom1_id": "///B/300/OE2", "atom2_id": "///C/109/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1326, "atom1_serNum": 11380, "atom2_serNum": 12654, "donAcc_type": "standard", "distance": 3.320, "atom1_id": "///B/303/O", "atom2_id": "///C/105/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1327, "atom1_serNum": 11393, "atom2_serNum": 12646, "donAcc_type": "standard", "distance": 3.575, "atom1_id": "///B/304/OE1", "atom2_id": "///C/103/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1328, "atom1_serNum": 11398, "atom2_serNum": 12644, "donAcc_type": "standard", "distance": 2.712, "atom1_id": "///B/305/O", "atom2_id": "///C/103/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1329, "atom1_serNum": 11444, "atom2_serNum": 11458, "donAcc_type": "acceptable", "distance": 2.467, "atom1_id": "///B/310/OH", "atom2_id": "///B/313/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1330, "atom1_serNum": 11484, "atom2_serNum": 14972, "donAcc_type": "standard", "distance": 2.845, "atom1_id": "///B/316/OE1", "atom2_id": "///D/40/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1331, "atom1_serNum": 11497, "atom2_serNum": 11838, "donAcc_type": "standard", "distance": 2.808, "atom1_id": "///B/318/O", "atom2_id": "///B/364/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1332, "atom1_serNum": 11501, "atom2_serNum": 11517, "donAcc_type": "standard", "distance": 3.210, "atom1_id": "///B/319/O", "atom2_id": "///B/321/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1333, "atom1_serNum": 11512, "atom2_serNum": 11542, "donAcc_type": "standard", "distance": 3.421, "atom1_id": "///B/320/O", "atom2_id": "///B/324/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1334, "atom1_serNum": 11515, "atom2_serNum": 11524, "donAcc_type": "standard", "distance": 2.883, "atom1_id": "///B/320/OD1", "atom2_id": "///B/322/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1335, "atom1_serNum": 11515, "atom2_serNum": 11530, "donAcc_type": "standard", "distance": 3.330, "atom1_id": "///B/320/OD1", "atom2_id": "///B/323/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1336, "atom1_serNum": 11520, "atom2_serNum": 11549, "donAcc_type": "standard", "distance": 2.930, "atom1_id": "///B/321/O", "atom2_id": "///B/325/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1337, "atom1_serNum": 11527, "atom2_serNum": 11557, "donAcc_type": "standard", "distance": 2.994, "atom1_id": "///B/322/O", "atom2_id": "///B/326/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1338, "atom1_serNum": 11533, "atom2_serNum": 11565, "donAcc_type": "standard", "distance": 3.300, "atom1_id": "///B/323/O", "atom2_id": "///B/327/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1339, "atom1_serNum": 11545, "atom2_serNum": 11572, "donAcc_type": "standard", "distance": 3.131, "atom1_id": "///B/324/O", "atom2_id": "///B/328/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1340, "atom1_serNum": 11552, "atom2_serNum": 11580, "donAcc_type": "standard", "distance": 2.841, "atom1_id": "///B/325/O", "atom2_id": "///B/329/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1341, "atom1_serNum": 11560, "atom2_serNum": 11588, "donAcc_type": "standard", "distance": 3.111, "atom1_id": "///B/326/O", "atom2_id": "///B/330/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1342, "atom1_serNum": 11568, "atom2_serNum": 11588, "donAcc_type": "standard", "distance": 2.928, "atom1_id": "///B/327/O", "atom2_id": "///B/330/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1343, "atom1_serNum": 11568, "atom2_serNum": 11593, "donAcc_type": "standard", "distance": 2.778, "atom1_id": "///B/327/O", "atom2_id": "///B/331/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1344, "atom1_serNum": 11591, "atom2_serNum": 11601, "donAcc_type": "standard", "distance": 3.135, "atom1_id": "///B/330/O", "atom2_id": "///B/332/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1345, "atom1_serNum": 11628, "atom2_serNum": 11754, "donAcc_type": "questionable", "distance": 2.862, "atom1_id": "///B/335/O", "atom2_id": "///B/351/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1346, "atom1_serNum": 11628, "atom2_serNum": 11756, "donAcc_type": "standard", "distance": 3.070, "atom1_id": "///B/335/O", "atom2_id": "///B/352/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1347, "atom1_serNum": 11640, "atom2_serNum": 11742, "donAcc_type": "standard", "distance": 2.792, "atom1_id": "///B/337/N", "atom2_id": "///B/350/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1348, "atom1_serNum": 11643, "atom2_serNum": 11739, "donAcc_type": "standard", "distance": 3.000, "atom1_id": "///B/337/O", "atom2_id": "///B/350/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1349, "atom1_serNum": 11659, "atom2_serNum": 11725, "donAcc_type": "standard", "distance": 2.968, "atom1_id": "///B/339/N", "atom2_id": "///B/348/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1350, "atom1_serNum": 11662, "atom2_serNum": 11722, "donAcc_type": "standard", "distance": 3.236, "atom1_id": "///B/339/O", "atom2_id": "///B/348/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1351, "atom1_serNum": 11685, "atom2_serNum": 11703, "donAcc_type": "standard", "distance": 3.251, "atom1_id": "///B/342/O", "atom2_id": "///B/345/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1352, "atom1_serNum": 11688, "atom2_serNum": 11696, "donAcc_type": "standard", "distance": 3.099, "atom1_id": "///B/342/OD1", "atom2_id": "///B/344/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1353, "atom1_serNum": 11688, "atom2_serNum": 11708, "donAcc_type": "acceptable", "distance": 2.642, "atom1_id": "///B/342/OD1", "atom2_id": "///B/345/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1354, "atom1_serNum": 11715, "atom2_serNum": 11819, "donAcc_type": "standard", "distance": 2.842, "atom1_id": "///B/347/N", "atom2_id": "///B/361/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1355, "atom1_serNum": 11718, "atom2_serNum": 11816, "donAcc_type": "standard", "distance": 3.142, "atom1_id": "///B/347/O", "atom2_id": "///B/361/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1356, "atom1_serNum": 11729, "atom2_serNum": 11747, "donAcc_type": "questionable", "distance": 3.014, "atom1_id": "///B/348/OE1", "atom2_id": "///B/350/OE2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1357, "atom1_serNum": 11731, "atom2_serNum": 11800, "donAcc_type": "standard", "distance": 2.545, "atom1_id": "///B/349/N", "atom2_id": "///B/359/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1358, "atom1_serNum": 11734, "atom2_serNum": 11797, "donAcc_type": "standard", "distance": 2.764, "atom1_id": "///B/349/O", "atom2_id": "///B/359/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1359, "atom1_serNum": 11754, "atom2_serNum": 11756, "donAcc_type": "standard", "distance": 2.897, "atom1_id": "///B/351/OD1", "atom2_id": "///B/352/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1360, "atom1_serNum": 11754, "atom2_serNum": 11761, "donAcc_type": "standard", "distance": 3.120, "atom1_id": "///B/351/OD1", "atom2_id": "///B/353/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1361, "atom1_serNum": 11834, "atom2_serNum": 16099, "donAcc_type": "standard", "distance": 3.567, "atom1_id": "///B/363/O", "atom2_id": "///D/183/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1362, "atom1_serNum": 11846, "atom2_serNum": 16089, "donAcc_type": "standard", "distance": 2.687, "atom1_id": "///B/365/N", "atom2_id": "///D/181/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1363, "atom1_serNum": 11849, "atom2_serNum": 16078, "donAcc_type": "questionable", "distance": 3.340, "atom1_id": "///B/365/O", "atom2_id": "///D/179/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1364, "atom1_serNum": 11870, "atom2_serNum": 12552, "donAcc_type": "standard", "distance": 2.667, "atom1_id": "///C/1/O", "atom2_id": "///C/92/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1365, "atom1_serNum": 11875, "atom2_serNum": 12347, "donAcc_type": "standard", "distance": 2.837, "atom1_id": "///C/2/N", "atom2_id": "///C/64/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1366, "atom1_serNum": 11878, "atom2_serNum": 12344, "donAcc_type": "standard", "distance": 2.794, "atom1_id": "///C/2/O", "atom2_id": "///C/64/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1367, "atom1_serNum": 11884, "atom2_serNum": 12539, "donAcc_type": "standard", "distance": 3.002, "atom1_id": "///C/3/N", "atom2_id": "///C/90/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1368, "atom1_serNum": 11887, "atom2_serNum": 12536, "donAcc_type": "standard", "distance": 3.214, "atom1_id": "///C/3/O", "atom2_id": "///C/90/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1369, "atom1_serNum": 11900, "atom2_serNum": 12330, "donAcc_type": "acceptable", "distance": 3.919, "atom1_id": "///C/4/OG1", "atom2_id": "///C/62/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1370, "atom1_serNum": 11902, "atom2_serNum": 12526, "donAcc_type": "standard", "distance": 3.792, "atom1_id": "///C/5/N", "atom2_id": "///C/88/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1371, "atom1_serNum": 11905, "atom2_serNum": 12523, "donAcc_type": "standard", "distance": 3.549, "atom1_id": "///C/5/O", "atom2_id": "///C/88/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1372, "atom1_serNum": 11912, "atom2_serNum": 11938, "donAcc_type": "standard", "distance": 3.020, "atom1_id": "///C/6/O", "atom2_id": "///C/9/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1373, "atom1_serNum": 11912, "atom2_serNum": 11948, "donAcc_type": "standard", "distance": 3.277, "atom1_id": "///C/6/O", "atom2_id": "///C/10/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1374, "atom1_serNum": 11916, "atom2_serNum": 11944, "donAcc_type": "acceptable", "distance": 2.786, "atom1_id": "///C/6/OE1", "atom2_id": "///C/9/ND1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1375, "atom1_serNum": 11918, "atom2_serNum": 12512, "donAcc_type": "standard", "distance": 3.104, "atom1_id": "///C/7/N", "atom2_id": "///C/86/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1376, "atom1_serNum": 11921, "atom2_serNum": 11956, "donAcc_type": "standard", "distance": 2.863, "atom1_id": "///C/7/O", "atom2_id": "///C/11/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1377, "atom1_serNum": 11925, "atom2_serNum": 12463, "donAcc_type": "standard", "distance": 3.620, "atom1_id": "///C/7/NE", "atom2_id": "///C/79/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1378, "atom1_serNum": 11927, "atom2_serNum": 11937, "donAcc_type": "standard", "distance": 2.758, "atom1_id": "///C/7/NH1", "atom2_id": "///C/8/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1379, "atom1_serNum": 11928, "atom2_serNum": 12469, "donAcc_type": "standard", "distance": 3.142, "atom1_id": "///C/7/NH2", "atom2_id": "///C/80/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1380, "atom1_serNum": 11937, "atom2_serNum": 12505, "donAcc_type": "standard", "distance": 3.634, "atom1_id": "///C/8/OE2", "atom2_id": "///C/85/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1381, "atom1_serNum": 11951, "atom2_serNum": 11980, "donAcc_type": "standard", "distance": 3.051, "atom1_id": "///C/10/O", "atom2_id": "///C/14/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1382, "atom1_serNum": 11959, "atom2_serNum": 11988, "donAcc_type": "standard", "distance": 3.019, "atom1_id": "///C/11/O", "atom2_id": "///C/15/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1383, "atom1_serNum": 11967, "atom2_serNum": 11997, "donAcc_type": "standard", "distance": 2.819, "atom1_id": "///C/12/O", "atom2_id": "///C/16/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1384, "atom1_serNum": 11972, "atom2_serNum": 12004, "donAcc_type": "standard", "distance": 2.898, "atom1_id": "///C/12/NZ", "atom2_id": "///C/16/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1385, "atom1_serNum": 11976, "atom2_serNum": 12006, "donAcc_type": "standard", "distance": 2.821, "atom1_id": "///C/13/O", "atom2_id": "///C/17/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1386, "atom1_serNum": 11983, "atom2_serNum": 12013, "donAcc_type": "standard", "distance": 2.949, "atom1_id": "///C/14/O", "atom2_id": "///C/18/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1387, "atom1_serNum": 11983, "atom2_serNum": 12018, "donAcc_type": "acceptable", "distance": 2.822, "atom1_id": "///C/14/O", "atom2_id": "///C/18/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1388, "atom1_serNum": 11991, "atom2_serNum": 12019, "donAcc_type": "standard", "distance": 3.113, "atom1_id": "///C/15/O", "atom2_id": "///C/19/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1389, "atom1_serNum": 12000, "atom2_serNum": 13426, "donAcc_type": "questionable", "distance": 2.639, "atom1_id": "///C/16/O", "atom2_id": "///C/202/OE2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1390, "atom1_serNum": 12016, "atom2_serNum": 12030, "donAcc_type": "standard", "distance": 2.774, "atom1_id": "///C/18/O", "atom2_id": "///C/21/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1391, "atom1_serNum": 12049, "atom2_serNum": 12053, "donAcc_type": "standard", "distance": 3.131, "atom1_id": "///C/24/O", "atom2_id": "///C/24/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1392, "atom1_serNum": 12056, "atom2_serNum": 17516, "donAcc_type": "standard", "distance": 3.712, "atom1_id": "///C/24/NH2", "atom2_id": "///P/9/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 1393, "atom1_serNum": 12074, "atom2_serNum": 12094, "donAcc_type": "standard", "distance": 2.996, "atom1_id": "///C/27/O", "atom2_id": "///C/30/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1394, "atom1_serNum": 12082, "atom2_serNum": 12102, "donAcc_type": "standard", "distance": 2.879, "atom1_id": "///C/28/O", "atom2_id": "///C/31/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1395, "atom1_serNum": 12089, "atom2_serNum": 12106, "donAcc_type": "standard", "distance": 2.880, "atom1_id": "///C/29/O", "atom2_id": "///C/32/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1396, "atom1_serNum": 12105, "atom2_serNum": 12397, "donAcc_type": "standard", "distance": 2.638, "atom1_id": "///C/31/O", "atom2_id": "///C/72/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1397, "atom1_serNum": 12106, "atom2_serNum": 12112, "donAcc_type": "standard", "distance": 2.898, "atom1_id": "///C/32/N", "atom2_id": "///C/32/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1398, "atom1_serNum": 12114, "atom2_serNum": 12386, "donAcc_type": "standard", "distance": 2.741, "atom1_id": "///C/33/N", "atom2_id": "///C/70/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1399, "atom1_serNum": 12117, "atom2_serNum": 12383, "donAcc_type": "standard", "distance": 2.875, "atom1_id": "///C/33/O", "atom2_id": "///C/70/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1400, "atom1_serNum": 12122, "atom2_serNum": 12203, "donAcc_type": "standard", "distance": 3.378, "atom1_id": "///C/34/N", "atom2_id": "///C/45/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1401, "atom1_serNum": 12125, "atom2_serNum": 12200, "donAcc_type": "standard", "distance": 3.114, "atom1_id": "///C/34/O", "atom2_id": "///C/45/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1402, "atom1_serNum": 12130, "atom2_serNum": 12372, "donAcc_type": "standard", "distance": 2.991, "atom1_id": "///C/35/N", "atom2_id": "///C/68/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1403, "atom1_serNum": 12138, "atom2_serNum": 12189, "donAcc_type": "standard", "distance": 2.979, "atom1_id": "///C/36/N", "atom2_id": "///C/43/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1404, "atom1_serNum": 12141, "atom2_serNum": 12174, "donAcc_type": "questionable", "distance": 3.299, "atom1_id": "///C/36/O", "atom2_id": "///C/41/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1405, "atom1_serNum": 12141, "atom2_serNum": 12186, "donAcc_type": "standard", "distance": 2.769, "atom1_id": "///C/36/O", "atom2_id": "///C/43/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1406, "atom1_serNum": 12146, "atom2_serNum": 12205, "donAcc_type": "acceptable", "distance": 3.329, "atom1_id": "///C/36/NE2", "atom2_id": "///C/45/OG1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1407, "atom1_serNum": 12147, "atom2_serNum": 12363, "donAcc_type": "standard", "distance": 3.478, "atom1_id": "///C/37/N", "atom2_id": "///C/66/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1408, "atom1_serNum": 12150, "atom2_serNum": 12360, "donAcc_type": "standard", "distance": 3.384, "atom1_id": "///C/37/O", "atom2_id": "///C/66/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1409, "atom1_serNum": 12154, "atom2_serNum": 12174, "donAcc_type": "standard", "distance": 3.173, "atom1_id": "///C/38/N", "atom2_id": "///C/41/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1410, "atom1_serNum": 12157, "atom2_serNum": 12171, "donAcc_type": "standard", "distance": 3.097, "atom1_id": "///C/38/O", "atom2_id": "///C/41/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1411, "atom1_serNum": 12170, "atom2_serNum": 12176, "donAcc_type": "acceptable", "distance": 2.743, "atom1_id": "///C/40/O", "atom2_id": "///C/41/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1412, "atom1_serNum": 12178, "atom2_serNum": 12294, "donAcc_type": "standard", "distance": 2.876, "atom1_id": "///C/42/N", "atom2_id": "///C/57/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1413, "atom1_serNum": 12181, "atom2_serNum": 12278, "donAcc_type": "questionable", "distance": 3.293, "atom1_id": "///C/42/O", "atom2_id": "///C/55/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1414, "atom1_serNum": 12181, "atom2_serNum": 12291, "donAcc_type": "standard", "distance": 3.179, "atom1_id": "///C/42/O", "atom2_id": "///C/57/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1415, "atom1_serNum": 12192, "atom2_serNum": 12278, "donAcc_type": "standard", "distance": 3.105, "atom1_id": "///C/44/N", "atom2_id": "///C/55/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1416, "atom1_serNum": 12195, "atom2_serNum": 12275, "donAcc_type": "standard", "distance": 3.516, "atom1_id": "///C/44/O", "atom2_id": "///C/55/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1417, "atom1_serNum": 12207, "atom2_serNum": 12263, "donAcc_type": "standard", "distance": 3.540, "atom1_id": "///C/46/N", "atom2_id": "///C/53/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1418, "atom1_serNum": 12210, "atom2_serNum": 12260, "donAcc_type": "standard", "distance": 3.132, "atom1_id": "///C/46/O", "atom2_id": "///C/53/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1419, "atom1_serNum": 12216, "atom2_serNum": 12226, "donAcc_type": "acceptable", "distance": 3.054, "atom1_id": "///C/47/OG1", "atom2_id": "///C/49/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1420, "atom1_serNum": 12216, "atom2_serNum": 12246, "donAcc_type": "acceptable", "distance": 2.552, "atom1_id": "///C/47/OG1", "atom2_id": "///C/51/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1421, "atom1_serNum": 12218, "atom2_serNum": 12246, "donAcc_type": "standard", "distance": 3.202, "atom1_id": "///C/48/N", "atom2_id": "///C/51/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1422, "atom1_serNum": 12224, "atom2_serNum": 12234, "donAcc_type": "standard", "distance": 2.803, "atom1_id": "///C/48/OD1", "atom2_id": "///C/50/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1423, "atom1_serNum": 12224, "atom2_serNum": 12243, "donAcc_type": "standard", "distance": 2.806, "atom1_id": "///C/48/OD1", "atom2_id": "///C/51/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1424, "atom1_serNum": 12237, "atom2_serNum": 13673, "donAcc_type": "acceptable", "distance": 2.720, "atom1_id": "///C/50/O", "atom2_id": "///C/234/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1425, "atom1_serNum": 12237, "atom2_serNum": 13674, "donAcc_type": "standard", "distance": 2.748, "atom1_id": "///C/50/O", "atom2_id": "///C/235/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1426, "atom1_serNum": 12251, "atom2_serNum": 13664, "donAcc_type": "standard", "distance": 2.468, "atom1_id": "///C/52/N", "atom2_id": "///C/233/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1427, "atom1_serNum": 12254, "atom2_serNum": 13661, "donAcc_type": "standard", "distance": 2.723, "atom1_id": "///C/52/O", "atom2_id": "///C/233/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1428, "atom1_serNum": 12268, "atom2_serNum": 13645, "donAcc_type": "standard", "distance": 2.617, "atom1_id": "///C/54/N", "atom2_id": "///C/231/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1429, "atom1_serNum": 12271, "atom2_serNum": 13642, "donAcc_type": "standard", "distance": 2.747, "atom1_id": "///C/54/O", "atom2_id": "///C/231/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1430, "atom1_serNum": 12280, "atom2_serNum": 13626, "donAcc_type": "standard", "distance": 3.151, "atom1_id": "///C/56/N", "atom2_id": "///C/229/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1431, "atom1_serNum": 12321, "atom2_serNum": 12340, "donAcc_type": "acceptable", "distance": 2.947, "atom1_id": "///C/61/O", "atom2_id": "///C/63/ND1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1432, "atom1_serNum": 12376, "atom2_serNum": 12706, "donAcc_type": "standard", "distance": 3.000, "atom1_id": "///C/69/N", "atom2_id": "///C/111/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1433, "atom1_serNum": 12379, "atom2_serNum": 12703, "donAcc_type": "standard", "distance": 2.949, "atom1_id": "///C/69/O", "atom2_id": "///C/111/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1434, "atom1_serNum": 12379, "atom2_serNum": 12706, "donAcc_type": "questionable", "distance": 2.893, "atom1_id": "///C/69/O", "atom2_id": "///C/111/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1435, "atom1_serNum": 12386, "atom2_serNum": 12397, "donAcc_type": "standard", "distance": 3.166, "atom1_id": "///C/70/O", "atom2_id": "///C/72/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1436, "atom1_serNum": 12393, "atom2_serNum": 12422, "donAcc_type": "standard", "distance": 3.283, "atom1_id": "///C/71/O", "atom2_id": "///C/75/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1437, "atom1_serNum": 12400, "atom2_serNum": 12433, "donAcc_type": "standard", "distance": 2.878, "atom1_id": "///C/72/O", "atom2_id": "///C/76/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1438, "atom1_serNum": 12405, "atom2_serNum": 12444, "donAcc_type": "standard", "distance": 2.904, "atom1_id": "///C/73/O", "atom2_id": "///C/77/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1439, "atom1_serNum": 12409, "atom2_serNum": 12451, "donAcc_type": "standard", "distance": 3.210, "atom1_id": "///C/73/NE", "atom2_id": "///C/77/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1440, "atom1_serNum": 12412, "atom2_serNum": 12450, "donAcc_type": "standard", "distance": 2.750, "atom1_id": "///C/73/NH2", "atom2_id": "///C/77/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1441, "atom1_serNum": 12416, "atom2_serNum": 12452, "donAcc_type": "standard", "distance": 2.916, "atom1_id": "///C/74/O", "atom2_id": "///C/78/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1442, "atom1_serNum": 12425, "atom2_serNum": 12460, "donAcc_type": "standard", "distance": 2.953, "atom1_id": "///C/75/O", "atom2_id": "///C/79/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1443, "atom1_serNum": 12436, "atom2_serNum": 12466, "donAcc_type": "standard", "distance": 2.810, "atom1_id": "///C/76/O", "atom2_id": "///C/80/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1444, "atom1_serNum": 12447, "atom2_serNum": 12477, "donAcc_type": "standard", "distance": 2.846, "atom1_id": "///C/77/O", "atom2_id": "///C/81/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1445, "atom1_serNum": 12450, "atom2_serNum": 12475, "donAcc_type": "standard", "distance": 2.694, "atom1_id": "///C/77/OD1", "atom2_id": "///C/80/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1446, "atom1_serNum": 12455, "atom2_serNum": 12481, "donAcc_type": "standard", "distance": 3.388, "atom1_id": "///C/78/O", "atom2_id": "///C/82/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1447, "atom1_serNum": 12492, "atom2_serNum": 12509, "donAcc_type": "standard", "distance": 3.277, "atom1_id": "///C/83/O", "atom2_id": "///C/86/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1448, "atom1_serNum": 12517, "atom2_serNum": 12632, "donAcc_type": "acceptable", "distance": 2.705, "atom1_id": "///C/87/O", "atom2_id": "///C/101/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1449, "atom1_serNum": 12531, "atom2_serNum": 12619, "donAcc_type": "standard", "distance": 2.449, "atom1_id": "///C/89/N", "atom2_id": "///C/100/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1450, "atom1_serNum": 12534, "atom2_serNum": 12616, "donAcc_type": "standard", "distance": 2.614, "atom1_id": "///C/89/O", "atom2_id": "///C/100/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1451, "atom1_serNum": 12543, "atom2_serNum": 12604, "donAcc_type": "standard", "distance": 3.131, "atom1_id": "///C/91/N", "atom2_id": "///C/98/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1452, "atom1_serNum": 12546, "atom2_serNum": 12601, "donAcc_type": "standard", "distance": 3.271, "atom1_id": "///C/91/O", "atom2_id": "///C/98/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1453, "atom1_serNum": 12551, "atom2_serNum": 12567, "donAcc_type": "standard", "distance": 3.649, "atom1_id": "///C/91/NE2", "atom2_id": "///C/93/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1454, "atom1_serNum": 12560, "atom2_serNum": 12585, "donAcc_type": "standard", "distance": 3.058, "atom1_id": "///C/93/N", "atom2_id": "///C/96/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1455, "atom1_serNum": 12563, "atom2_serNum": 12573, "donAcc_type": "standard", "distance": 3.231, "atom1_id": "///C/93/O", "atom2_id": "///C/95/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1456, "atom1_serNum": 12576, "atom2_serNum": 12696, "donAcc_type": "standard", "distance": 3.946, "atom1_id": "///C/95/O", "atom2_id": "///C/110/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1457, "atom1_serNum": 12591, "atom2_serNum": 12681, "donAcc_type": "acceptable", "distance": 2.650, "atom1_id": "///C/96/NH1", "atom2_id": "///C/107/OG", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1458, "atom1_serNum": 12593, "atom2_serNum": 12685, "donAcc_type": "standard", "distance": 3.402, "atom1_id": "///C/97/N", "atom2_id": "///C/108/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1459, "atom1_serNum": 12596, "atom2_serNum": 12682, "donAcc_type": "standard", "distance": 2.989, "atom1_id": "///C/97/O", "atom2_id": "///C/108/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1460, "atom1_serNum": 12609, "atom2_serNum": 12668, "donAcc_type": "standard", "distance": 3.070, "atom1_id": "///C/99/N", "atom2_id": "///C/106/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1461, "atom1_serNum": 12612, "atom2_serNum": 12665, "donAcc_type": "standard", "distance": 2.792, "atom1_id": "///C/99/O", "atom2_id": "///C/106/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1462, "atom1_serNum": 12627, "atom2_serNum": 12651, "donAcc_type": "standard", "distance": 3.129, "atom1_id": "///C/101/N", "atom2_id": "///C/104/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1463, "atom1_serNum": 12630, "atom2_serNum": 12648, "donAcc_type": "standard", "distance": 2.869, "atom1_id": "///C/101/O", "atom2_id": "///C/104/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1464, "atom1_serNum": 12714, "atom2_serNum": 12728, "donAcc_type": "standard", "distance": 3.031, "atom1_id": "///C/112/O", "atom2_id": "///C/115/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1465, "atom1_serNum": 12721, "atom2_serNum": 12736, "donAcc_type": "standard", "distance": 2.988, "atom1_id": "///C/113/O", "atom2_id": "///C/116/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1466, "atom1_serNum": 12739, "atom2_serNum": 12754, "donAcc_type": "standard", "distance": 2.942, "atom1_id": "///C/116/O", "atom2_id": "///C/118/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1467, "atom1_serNum": 12750, "atom2_serNum": 12762, "donAcc_type": "standard", "distance": 3.086, "atom1_id": "///C/117/O", "atom2_id": "///C/119/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1468, "atom1_serNum": 12761, "atom2_serNum": 12765, "donAcc_type": "standard", "distance": 2.878, "atom1_id": "///C/118/ND2", "atom2_id": "///C/119/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1469, "atom1_serNum": 12789, "atom2_serNum": 13596, "donAcc_type": "standard", "distance": 3.963, "atom1_id": "///C/122/O", "atom2_id": "///C/224/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1470, "atom1_serNum": 12800, "atom2_serNum": 12807, "donAcc_type": "standard", "distance": 2.864, "atom1_id": "///C/123/N", "atom2_id": "///C/123/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1471, "atom1_serNum": 12814, "atom2_serNum": 12839, "donAcc_type": "acceptable", "distance": 2.843, "atom1_id": "///C/124/OG", "atom2_id": "///C/127/OE2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1472, "atom1_serNum": 12815, "atom2_serNum": 13547, "donAcc_type": "standard", "distance": 2.651, "atom1_id": "///C/125/N", "atom2_id": "///C/218/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1473, "atom1_serNum": 12824, "atom2_serNum": 13547, "donAcc_type": "standard", "distance": 3.369, "atom1_id": "///C/126/N", "atom2_id": "///C/218/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1474, "atom1_serNum": 12827, "atom2_serNum": 13544, "donAcc_type": "standard", "distance": 2.646, "atom1_id": "///C/126/O", "atom2_id": "///C/218/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1475, "atom1_serNum": 12840, "atom2_serNum": 13531, "donAcc_type": "standard", "distance": 2.845, "atom1_id": "///C/128/N", "atom2_id": "///C/216/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1476, "atom1_serNum": 12843, "atom2_serNum": 13528, "donAcc_type": "standard", "distance": 2.678, "atom1_id": "///C/128/O", "atom2_id": "///C/216/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1477, "atom1_serNum": 12851, "atom2_serNum": 13305, "donAcc_type": "standard", "distance": 3.021, "atom1_id": "///C/129/N", "atom2_id": "///C/186/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1478, "atom1_serNum": 12854, "atom2_serNum": 13306, "donAcc_type": "standard", "distance": 2.521, "atom1_id": "///C/129/O", "atom2_id": "///C/186/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1479, "atom1_serNum": 12858, "atom2_serNum": 13512, "donAcc_type": "standard", "distance": 3.141, "atom1_id": "///C/130/N", "atom2_id": "///C/214/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1480, "atom1_serNum": 12869, "atom2_serNum": 12887, "donAcc_type": "standard", "distance": 3.210, "atom1_id": "///C/131/O", "atom2_id": "///C/134/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1481, "atom1_serNum": 12869, "atom2_serNum": 12894, "donAcc_type": "standard", "distance": 3.400, "atom1_id": "///C/131/O", "atom2_id": "///C/135/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1482, "atom1_serNum": 12876, "atom2_serNum": 12902, "donAcc_type": "standard", "distance": 3.018, "atom1_id": "///C/132/O", "atom2_id": "///C/136/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1483, "atom1_serNum": 12880, "atom2_serNum": 13494, "donAcc_type": "standard", "distance": 2.832, "atom1_id": "///C/132/OE1", "atom2_id": "///C/212/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1484, "atom1_serNum": 12881, "atom2_serNum": 13476, "donAcc_type": "standard", "distance": 3.304, "atom1_id": "///C/132/NE2", "atom2_id": "///C/208/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1485, "atom1_serNum": 12881, "atom2_serNum": 13477, "donAcc_type": "standard", "distance": 3.185, "atom1_id": "///C/132/NE2", "atom2_id": "///C/208/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1486, "atom1_serNum": 12885, "atom2_serNum": 12911, "donAcc_type": "standard", "distance": 3.307, "atom1_id": "///C/133/O", "atom2_id": "///C/137/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1487, "atom1_serNum": 12890, "atom2_serNum": 12922, "donAcc_type": "standard", "distance": 2.885, "atom1_id": "///C/134/O", "atom2_id": "///C/138/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1488, "atom1_serNum": 12897, "atom2_serNum": 12930, "donAcc_type": "standard", "distance": 3.067, "atom1_id": "///C/135/O", "atom2_id": "///C/139/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1489, "atom1_serNum": 12905, "atom2_serNum": 12938, "donAcc_type": "standard", "distance": 2.867, "atom1_id": "///C/136/O", "atom2_id": "///C/140/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1490, "atom1_serNum": 12914, "atom2_serNum": 12947, "donAcc_type": "standard", "distance": 2.979, "atom1_id": "///C/137/O", "atom2_id": "///C/141/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1491, "atom1_serNum": 12933, "atom2_serNum": 12952, "donAcc_type": "standard", "distance": 3.224, "atom1_id": "///C/139/O", "atom2_id": "///C/142/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1492, "atom1_serNum": 12933, "atom2_serNum": 12959, "donAcc_type": "standard", "distance": 2.839, "atom1_id": "///C/139/O", "atom2_id": "///C/143/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1493, "atom1_serNum": 12945, "atom2_serNum": 14454, "donAcc_type": "standard", "distance": 3.497, "atom1_id": "///C/140/OE1", "atom2_id": "///C/332/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1494, "atom1_serNum": 12950, "atom2_serNum": 14653, "donAcc_type": "acceptable", "distance": 3.477, "atom1_id": "///C/141/O", "atom2_id": "///C/359/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1495, "atom1_serNum": 12955, "atom2_serNum": 12979, "donAcc_type": "standard", "distance": 3.189, "atom1_id": "///C/142/O", "atom2_id": "///C/145/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1496, "atom1_serNum": 12962, "atom2_serNum": 12985, "donAcc_type": "standard", "distance": 3.453, "atom1_id": "///C/143/O", "atom2_id": "///C/146/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1497, "atom1_serNum": 12971, "atom2_serNum": 13237, "donAcc_type": "standard", "distance": 3.701, "atom1_id": "///C/144/O", "atom2_id": "///C/176/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1498, "atom1_serNum": 12982, "atom2_serNum": 13206, "donAcc_type": "standard", "distance": 3.234, "atom1_id": "///C/145/O", "atom2_id": "///C/173/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1499, "atom1_serNum": 12996, "atom2_serNum": 13386, "donAcc_type": "standard", "distance": 2.842, "atom1_id": "///C/147/O", "atom2_id": "///C/197/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1500, "atom1_serNum": 13017, "atom2_serNum": 13082, "donAcc_type": "questionable", "distance": 3.136, "atom1_id": "///C/150/N", "atom2_id": "///C/156/ND2", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 1501, "atom1_serNum": 13020, "atom2_serNum": 13081, "donAcc_type": "questionable", "distance": 3.002, "atom1_id": "///C/150/O", "atom2_id": "///C/156/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1502, "atom1_serNum": 13023, "atom2_serNum": 13025, "donAcc_type": "standard", "distance": 2.881, "atom1_id": "///C/150/OD1", "atom2_id": "///C/151/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1503, "atom1_serNum": 13023, "atom2_serNum": 13032, "donAcc_type": "standard", "distance": 3.136, "atom1_id": "///C/150/OD1", "atom2_id": "///C/152/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1504, "atom1_serNum": 13024, "atom2_serNum": 13041, "donAcc_type": "standard", "distance": 3.518, "atom1_id": "///C/150/OD2", "atom2_id": "///C/152/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1505, "atom1_serNum": 13028, "atom2_serNum": 13043, "donAcc_type": "standard", "distance": 2.809, "atom1_id": "///C/151/O", "atom2_id": "///C/153/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1506, "atom1_serNum": 13035, "atom2_serNum": 13055, "donAcc_type": "standard", "distance": 2.742, "atom1_id": "///C/152/O", "atom2_id": "///C/154/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1507, "atom1_serNum": 13035, "atom2_serNum": 13067, "donAcc_type": "standard", "distance": 2.819, "atom1_id": "///C/152/O", "atom2_id": "///C/155/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1508, "atom1_serNum": 13070, "atom2_serNum": 13083, "donAcc_type": "standard", "distance": 2.752, "atom1_id": "///C/155/O", "atom2_id": "///C/157/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1509, "atom1_serNum": 13078, "atom2_serNum": 13379, "donAcc_type": "standard", "distance": 3.293, "atom1_id": "///C/156/O", "atom2_id": "///C/197/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1510, "atom1_serNum": 13087, "atom2_serNum": 13368, "donAcc_type": "standard", "distance": 3.132, "atom1_id": "///C/158/N", "atom2_id": "///C/195/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1511, "atom1_serNum": 13090, "atom2_serNum": 13365, "donAcc_type": "standard", "distance": 3.159, "atom1_id": "///C/158/O", "atom2_id": "///C/195/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1512, "atom1_serNum": 13095, "atom2_serNum": 13190, "donAcc_type": "standard", "distance": 3.566, "atom1_id": "///C/159/N", "atom2_id": "///C/170/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1513, "atom1_serNum": 13098, "atom2_serNum": 13187, "donAcc_type": "standard", "distance": 3.465, "atom1_id": "///C/159/O", "atom2_id": "///C/170/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1514, "atom1_serNum": 13103, "atom2_serNum": 13353, "donAcc_type": "standard", "distance": 2.800, "atom1_id": "///C/160/N", "atom2_id": "///C/193/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1515, "atom1_serNum": 13106, "atom2_serNum": 13349, "donAcc_type": "acceptable", "distance": 3.681, "atom1_id": "///C/160/O", "atom2_id": "///C/192/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1516, "atom1_serNum": 13106, "atom2_serNum": 13350, "donAcc_type": "standard", "distance": 3.279, "atom1_id": "///C/160/O", "atom2_id": "///C/193/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1517, "atom1_serNum": 13114, "atom2_serNum": 13172, "donAcc_type": "standard", "distance": 3.152, "atom1_id": "///C/161/N", "atom2_id": "///C/168/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1518, "atom1_serNum": 13117, "atom2_serNum": 13169, "donAcc_type": "standard", "distance": 2.956, "atom1_id": "///C/161/O", "atom2_id": "///C/168/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1519, "atom1_serNum": 13122, "atom2_serNum": 13349, "donAcc_type": "acceptable", "distance": 2.655, "atom1_id": "///C/161/OE2", "atom2_id": "///C/192/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1520, "atom1_serNum": 13123, "atom2_serNum": 13337, "donAcc_type": "standard", "distance": 3.499, "atom1_id": "///C/162/N", "atom2_id": "///C/191/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1521, "atom1_serNum": 13130, "atom2_serNum": 13155, "donAcc_type": "standard", "distance": 3.129, "atom1_id": "///C/163/N", "atom2_id": "///C/166/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1522, "atom1_serNum": 13133, "atom2_serNum": 13152, "donAcc_type": "standard", "distance": 3.076, "atom1_id": "///C/163/O", "atom2_id": "///C/166/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1523, "atom1_serNum": 13137, "atom2_serNum": 13179, "donAcc_type": "standard", "distance": 3.842, "atom1_id": "///C/163/OE1", "atom2_id": "///C/168/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1524, "atom1_serNum": 13142, "atom2_serNum": 13313, "donAcc_type": "standard", "distance": 3.374, "atom1_id": "///C/164/O", "atom2_id": "///C/188/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1525, "atom1_serNum": 13146, "atom2_serNum": 13286, "donAcc_type": "standard", "distance": 3.004, "atom1_id": "///C/165/O", "atom2_id": "///C/184/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1526, "atom1_serNum": 13146, "atom2_serNum": 13294, "donAcc_type": "standard", "distance": 3.211, "atom1_id": "///C/165/O", "atom2_id": "///C/185/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1527, "atom1_serNum": 13151, "atom2_serNum": 13312, "donAcc_type": "acceptable", "distance": 3.179, "atom1_id": "///C/165/OE2", "atom2_id": "///C/187/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1528, "atom1_serNum": 13159, "atom2_serNum": 13178, "donAcc_type": "standard", "distance": 3.137, "atom1_id": "///C/166/OE1", "atom2_id": "///C/168/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1529, "atom1_serNum": 13161, "atom2_serNum": 13274, "donAcc_type": "standard", "distance": 3.302, "atom1_id": "///C/167/N", "atom2_id": "///C/182/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1530, "atom1_serNum": 13164, "atom2_serNum": 13270, "donAcc_type": "acceptable", "distance": 3.050, "atom1_id": "///C/167/O", "atom2_id": "///C/181/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1531, "atom1_serNum": 13164, "atom2_serNum": 13271, "donAcc_type": "standard", "distance": 3.162, "atom1_id": "///C/167/O", "atom2_id": "///C/182/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1532, "atom1_serNum": 13164, "atom2_serNum": 13274, "donAcc_type": "questionable", "distance": 3.069, "atom1_id": "///C/167/O", "atom2_id": "///C/182/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1533, "atom1_serNum": 13178, "atom2_serNum": 13270, "donAcc_type": "acceptable", "distance": 3.072, "atom1_id": "///C/168/NH1", "atom2_id": "///C/181/OG", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1534, "atom1_serNum": 13180, "atom2_serNum": 13262, "donAcc_type": "standard", "distance": 2.818, "atom1_id": "///C/169/N", "atom2_id": "///C/180/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1535, "atom1_serNum": 13183, "atom2_serNum": 13259, "donAcc_type": "standard", "distance": 3.172, "atom1_id": "///C/169/O", "atom2_id": "///C/180/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1536, "atom1_serNum": 13185, "atom2_serNum": 13262, "donAcc_type": "acceptable", "distance": 2.619, "atom1_id": "///C/169/OG1", "atom2_id": "///C/180/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1537, "atom1_serNum": 13194, "atom2_serNum": 13250, "donAcc_type": "standard", "distance": 3.051, "atom1_id": "///C/171/N", "atom2_id": "///C/178/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1538, "atom1_serNum": 13197, "atom2_serNum": 13247, "donAcc_type": "standard", "distance": 3.168, "atom1_id": "///C/171/O", "atom2_id": "///C/178/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1539, "atom1_serNum": 13204, "atom2_serNum": 13214, "donAcc_type": "acceptable", "distance": 3.238, "atom1_id": "///C/172/OG1", "atom2_id": "///C/174/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1540, "atom1_serNum": 13204, "atom2_serNum": 13231, "donAcc_type": "acceptable", "distance": 2.506, "atom1_id": "///C/172/OG1", "atom2_id": "///C/176/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1541, "atom1_serNum": 13206, "atom2_serNum": 13231, "donAcc_type": "standard", "distance": 3.632, "atom1_id": "///C/173/N", "atom2_id": "///C/176/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1542, "atom1_serNum": 13212, "atom2_serNum": 13218, "donAcc_type": "standard", "distance": 2.969, "atom1_id": "///C/173/OD1", "atom2_id": "///C/175/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1543, "atom1_serNum": 13212, "atom2_serNum": 13228, "donAcc_type": "standard", "distance": 3.318, "atom1_id": "///C/173/OD1", "atom2_id": "///C/176/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1544, "atom1_serNum": 13213, "atom2_serNum": 13237, "donAcc_type": "standard", "distance": 3.086, "atom1_id": "///C/173/OD2", "atom2_id": "///C/176/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1545, "atom1_serNum": 13221, "atom2_serNum": 14668, "donAcc_type": "standard", "distance": 3.608, "atom1_id": "///C/175/O", "atom2_id": "///C/362/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1546, "atom1_serNum": 13238, "atom2_serNum": 14409, "donAcc_type": "standard", "distance": 3.069, "atom1_id": "///C/176/NH2", "atom2_id": "///C/326/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1547, "atom1_serNum": 13239, "atom2_serNum": 14657, "donAcc_type": "standard", "distance": 2.706, "atom1_id": "///C/177/N", "atom2_id": "///C/360/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1548, "atom1_serNum": 13242, "atom2_serNum": 14654, "donAcc_type": "standard", "distance": 2.939, "atom1_id": "///C/177/O", "atom2_id": "///C/360/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1549, "atom1_serNum": 13252, "atom2_serNum": 14640, "donAcc_type": "standard", "distance": 2.759, "atom1_id": "///C/179/N", "atom2_id": "///C/358/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1550, "atom1_serNum": 13255, "atom2_serNum": 14637, "donAcc_type": "standard", "distance": 2.811, "atom1_id": "///C/179/O", "atom2_id": "///C/358/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1551, "atom1_serNum": 13265, "atom2_serNum": 14629, "donAcc_type": "standard", "distance": 2.949, "atom1_id": "///C/181/N", "atom2_id": "///C/356/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1552, "atom1_serNum": 13289, "atom2_serNum": 13306, "donAcc_type": "standard", "distance": 3.065, "atom1_id": "///C/184/O", "atom2_id": "///C/186/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1553, "atom1_serNum": 13343, "atom2_serNum": 13555, "donAcc_type": "standard", "distance": 3.588, "atom1_id": "///C/191/NE2", "atom2_id": "///C/219/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1554, "atom1_serNum": 13360, "atom2_serNum": 13691, "donAcc_type": "standard", "distance": 3.542, "atom1_id": "///C/194/O", "atom2_id": "///C/237/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1555, "atom1_serNum": 13375, "atom2_serNum": 13399, "donAcc_type": "standard", "distance": 3.020, "atom1_id": "///C/196/O", "atom2_id": "///C/199/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1556, "atom1_serNum": 13375, "atom2_serNum": 13403, "donAcc_type": "standard", "distance": 3.025, "atom1_id": "///C/196/O", "atom2_id": "///C/200/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1557, "atom1_serNum": 13382, "atom2_serNum": 13410, "donAcc_type": "standard", "distance": 2.988, "atom1_id": "///C/197/O", "atom2_id": "///C/201/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1558, "atom1_serNum": 13393, "atom2_serNum": 13418, "donAcc_type": "standard", "distance": 3.186, "atom1_id": "///C/198/O", "atom2_id": "///C/202/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1559, "atom1_serNum": 13402, "atom2_serNum": 13427, "donAcc_type": "standard", "distance": 2.926, "atom1_id": "///C/199/O", "atom2_id": "///C/203/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1560, "atom1_serNum": 13406, "atom2_serNum": 13435, "donAcc_type": "standard", "distance": 3.044, "atom1_id": "///C/200/O", "atom2_id": "///C/204/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1561, "atom1_serNum": 13413, "atom2_serNum": 13443, "donAcc_type": "standard", "distance": 2.991, "atom1_id": "///C/201/O", "atom2_id": "///C/205/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1562, "atom1_serNum": 13421, "atom2_serNum": 13454, "donAcc_type": "standard", "distance": 3.182, "atom1_id": "///C/202/O", "atom2_id": "///C/206/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1563, "atom1_serNum": 13430, "atom2_serNum": 13462, "donAcc_type": "standard", "distance": 3.335, "atom1_id": "///C/203/O", "atom2_id": "///C/207/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1564, "atom1_serNum": 13438, "atom2_serNum": 13462, "donAcc_type": "standard", "distance": 3.162, "atom1_id": "///C/204/O", "atom2_id": "///C/207/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1565, "atom1_serNum": 13457, "atom2_serNum": 13470, "donAcc_type": "standard", "distance": 2.759, "atom1_id": "///C/206/O", "atom2_id": "///C/208/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1566, "atom1_serNum": 13465, "atom2_serNum": 13478, "donAcc_type": "standard", "distance": 2.685, "atom1_id": "///C/207/O", "atom2_id": "///C/209/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1567, "atom1_serNum": 13473, "atom2_serNum": 13482, "donAcc_type": "standard", "distance": 2.361, "atom1_id": "///C/208/O", "atom2_id": "///C/210/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1568, "atom1_serNum": 13492, "atom2_serNum": 13494, "donAcc_type": "standard", "distance": 3.028, "atom1_id": "///C/211/OD1", "atom2_id": "///C/212/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1569, "atom1_serNum": 13501, "atom2_serNum": 13505, "donAcc_type": "standard", "distance": 2.882, "atom1_id": "///C/212/ND2", "atom2_id": "///C/213/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1570, "atom1_serNum": 13517, "atom2_serNum": 13605, "donAcc_type": "standard", "distance": 2.696, "atom1_id": "///C/215/N", "atom2_id": "///C/226/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1571, "atom1_serNum": 13520, "atom2_serNum": 13602, "donAcc_type": "standard", "distance": 2.702, "atom1_id": "///C/215/O", "atom2_id": "///C/226/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1572, "atom1_serNum": 13535, "atom2_serNum": 13589, "donAcc_type": "standard", "distance": 2.881, "atom1_id": "///C/217/N", "atom2_id": "///C/224/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1573, "atom1_serNum": 13538, "atom2_serNum": 13586, "donAcc_type": "standard", "distance": 2.776, "atom1_id": "///C/217/O", "atom2_id": "///C/224/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1574, "atom1_serNum": 13543, "atom2_serNum": 13595, "donAcc_type": "questionable", "distance": 3.007, "atom1_id": "///C/217/NE2", "atom2_id": "///C/224/NH1", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 1575, "atom1_serNum": 13552, "atom2_serNum": 13573, "donAcc_type": "standard", "distance": 2.761, "atom1_id": "///C/219/N", "atom2_id": "///C/222/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1576, "atom1_serNum": 13565, "atom2_serNum": 13683, "donAcc_type": "standard", "distance": 2.578, "atom1_id": "///C/221/O", "atom2_id": "///C/236/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1577, "atom1_serNum": 13578, "atom2_serNum": 13671, "donAcc_type": "standard", "distance": 2.831, "atom1_id": "///C/223/N", "atom2_id": "///C/234/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1578, "atom1_serNum": 13581, "atom2_serNum": 13668, "donAcc_type": "standard", "distance": 3.135, "atom1_id": "///C/223/O", "atom2_id": "///C/234/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1579, "atom1_serNum": 13597, "atom2_serNum": 13653, "donAcc_type": "standard", "distance": 2.933, "atom1_id": "///C/225/N", "atom2_id": "///C/232/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1580, "atom1_serNum": 13600, "atom2_serNum": 13650, "donAcc_type": "standard", "distance": 2.878, "atom1_id": "///C/225/O", "atom2_id": "///C/232/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1581, "atom1_serNum": 13612, "atom2_serNum": 13634, "donAcc_type": "standard", "distance": 3.171, "atom1_id": "///C/227/N", "atom2_id": "///C/230/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1582, "atom1_serNum": 13615, "atom2_serNum": 13631, "donAcc_type": "standard", "distance": 2.957, "atom1_id": "///C/227/O", "atom2_id": "///C/230/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1583, "atom1_serNum": 13673, "atom2_serNum": 13677, "donAcc_type": "acceptable", "distance": 2.920, "atom1_id": "///C/234/OG", "atom2_id": "///C/235/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1584, "atom1_serNum": 13709, "atom2_serNum": 13721, "donAcc_type": "standard", "distance": 3.310, "atom1_id": "///C/239/O", "atom2_id": "///C/241/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1585, "atom1_serNum": 13735, "atom2_serNum": 13747, "donAcc_type": "standard", "distance": 3.285, "atom1_id": "///C/242/O", "atom2_id": "///C/244/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1586, "atom1_serNum": 13742, "atom2_serNum": 13770, "donAcc_type": "standard", "distance": 3.007, "atom1_id": "///C/243/O", "atom2_id": "///C/246/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1587, "atom1_serNum": 13745, "atom2_serNum": 13759, "donAcc_type": "standard", "distance": 3.275, "atom1_id": "///C/243/OD1", "atom2_id": "///C/245/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1588, "atom1_serNum": 13745, "atom2_serNum": 13766, "donAcc_type": "standard", "distance": 3.143, "atom1_id": "///C/243/OD1", "atom2_id": "///C/245/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1589, "atom1_serNum": 13750, "atom2_serNum": 13788, "donAcc_type": "standard", "distance": 3.157, "atom1_id": "///C/244/O", "atom2_id": "///C/248/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1590, "atom1_serNum": 13815, "atom2_serNum": 13827, "donAcc_type": "standard", "distance": 3.156, "atom1_id": "///C/251/O", "atom2_id": "///C/253/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1591, "atom1_serNum": 13827, "atom2_serNum": 14515, "donAcc_type": "standard", "distance": 3.618, "atom1_id": "///C/253/N", "atom2_id": "///C/340/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1592, "atom1_serNum": 13834, "atom2_serNum": 13843, "donAcc_type": "standard", "distance": 2.821, "atom1_id": "///C/253/OD2", "atom2_id": "///C/254/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1593, "atom1_serNum": 13843, "atom2_serNum": 14523, "donAcc_type": "standard", "distance": 3.506, "atom1_id": "///C/254/NZ", "atom2_id": "///C/341/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1594, "atom1_serNum": 13847, "atom2_serNum": 14290, "donAcc_type": "standard", "distance": 3.952, "atom1_id": "///C/255/O", "atom2_id": "///C/311/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1595, "atom1_serNum": 13854, "atom2_serNum": 14499, "donAcc_type": "standard", "distance": 3.124, "atom1_id": "///C/256/N", "atom2_id": "///C/338/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1596, "atom1_serNum": 13857, "atom2_serNum": 14496, "donAcc_type": "standard", "distance": 2.725, "atom1_id": "///C/256/O", "atom2_id": "///C/338/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1597, "atom1_serNum": 13862, "atom2_serNum": 14274, "donAcc_type": "standard", "distance": 3.193, "atom1_id": "///C/257/N", "atom2_id": "///C/309/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1598, "atom1_serNum": 13865, "atom2_serNum": 14271, "donAcc_type": "standard", "distance": 3.210, "atom1_id": "///C/257/O", "atom2_id": "///C/309/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1599, "atom1_serNum": 13871, "atom2_serNum": 14481, "donAcc_type": "standard", "distance": 3.355, "atom1_id": "///C/258/N", "atom2_id": "///C/336/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1600, "atom1_serNum": 13874, "atom2_serNum": 14478, "donAcc_type": "standard", "distance": 3.092, "atom1_id": "///C/258/O", "atom2_id": "///C/336/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1601, "atom1_serNum": 13879, "atom2_serNum": 13902, "donAcc_type": "standard", "distance": 3.078, "atom1_id": "///C/259/O", "atom2_id": "///C/263/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1602, "atom1_serNum": 13880, "atom2_serNum": 14464, "donAcc_type": "standard", "distance": 2.731, "atom1_id": "///C/260/N", "atom2_id": "///C/334/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1603, "atom1_serNum": 13883, "atom2_serNum": 13910, "donAcc_type": "standard", "distance": 2.790, "atom1_id": "///C/260/O", "atom2_id": "///C/264/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1604, "atom1_serNum": 13889, "atom2_serNum": 13919, "donAcc_type": "standard", "distance": 2.804, "atom1_id": "///C/261/O", "atom2_id": "///C/265/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1605, "atom1_serNum": 13892, "atom2_serNum": 13918, "donAcc_type": "standard", "distance": 3.954, "atom1_id": "///C/261/OD1", "atom2_id": "///C/264/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1606, "atom1_serNum": 13897, "atom2_serNum": 13928, "donAcc_type": "standard", "distance": 3.216, "atom1_id": "///C/262/O", "atom2_id": "///C/266/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1607, "atom1_serNum": 13905, "atom2_serNum": 13933, "donAcc_type": "standard", "distance": 2.991, "atom1_id": "///C/263/O", "atom2_id": "///C/267/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1608, "atom1_serNum": 13913, "atom2_serNum": 13944, "donAcc_type": "standard", "distance": 2.935, "atom1_id": "///C/264/O", "atom2_id": "///C/268/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1609, "atom1_serNum": 13918, "atom2_serNum": 14420, "donAcc_type": "standard", "distance": 3.244, "atom1_id": "///C/264/NZ", "atom2_id": "///C/328/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1610, "atom1_serNum": 13922, "atom2_serNum": 13949, "donAcc_type": "standard", "distance": 3.139, "atom1_id": "///C/265/O", "atom2_id": "///C/269/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1611, "atom1_serNum": 13931, "atom2_serNum": 13960, "donAcc_type": "standard", "distance": 2.994, "atom1_id": "///C/266/O", "atom2_id": "///C/270/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1612, "atom1_serNum": 13936, "atom2_serNum": 13965, "donAcc_type": "standard", "distance": 3.017, "atom1_id": "///C/267/O", "atom2_id": "///C/271/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1613, "atom1_serNum": 13952, "atom2_serNum": 13970, "donAcc_type": "standard", "distance": 3.233, "atom1_id": "///C/269/O", "atom2_id": "///C/272/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1614, "atom1_serNum": 13956, "atom2_serNum": 14239, "donAcc_type": "standard", "distance": 3.575, "atom1_id": "///C/269/NE", "atom2_id": "///C/304/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1615, "atom1_serNum": 13959, "atom2_serNum": 14238, "donAcc_type": "standard", "distance": 3.155, "atom1_id": "///C/269/NH2", "atom2_id": "///C/304/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1616, "atom1_serNum": 13963, "atom2_serNum": 13978, "donAcc_type": "standard", "distance": 3.217, "atom1_id": "///C/270/O", "atom2_id": "///C/273/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1617, "atom1_serNum": 13968, "atom2_serNum": 13986, "donAcc_type": "standard", "distance": 3.285, "atom1_id": "///C/271/O", "atom2_id": "///C/274/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1618, "atom1_serNum": 13968, "atom2_serNum": 13991, "donAcc_type": "acceptable", "distance": 2.592, "atom1_id": "///C/271/O", "atom2_id": "///C/274/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1619, "atom1_serNum": 13995, "atom2_serNum": 14029, "donAcc_type": "standard", "distance": 2.843, "atom1_id": "///C/275/O", "atom2_id": "///C/279/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1620, "atom1_serNum": 13998, "atom2_serNum": 14009, "donAcc_type": "standard", "distance": 2.755, "atom1_id": "///C/275/OD1", "atom2_id": "///C/277/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1621, "atom1_serNum": 13998, "atom2_serNum": 14018, "donAcc_type": "standard", "distance": 3.086, "atom1_id": "///C/275/OD1", "atom2_id": "///C/278/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1622, "atom1_serNum": 14032, "atom2_serNum": 14362, "donAcc_type": "standard", "distance": 2.516, "atom1_id": "///C/279/O", "atom2_id": "///C/321/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1623, "atom1_serNum": 14044, "atom2_serNum": 14346, "donAcc_type": "standard", "distance": 3.173, "atom1_id": "///C/281/N", "atom2_id": "///C/319/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1624, "atom1_serNum": 14047, "atom2_serNum": 14343, "donAcc_type": "standard", "distance": 3.238, "atom1_id": "///C/281/O", "atom2_id": "///C/319/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1625, "atom1_serNum": 14051, "atom2_serNum": 14149, "donAcc_type": "standard", "distance": 2.660, "atom1_id": "///C/282/N", "atom2_id": "///C/293/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1626, "atom1_serNum": 14054, "atom2_serNum": 14146, "donAcc_type": "standard", "distance": 2.737, "atom1_id": "///C/282/O", "atom2_id": "///C/293/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1627, "atom1_serNum": 14062, "atom2_serNum": 14334, "donAcc_type": "standard", "distance": 2.642, "atom1_id": "///C/283/N", "atom2_id": "///C/317/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1628, "atom1_serNum": 14065, "atom2_serNum": 14331, "donAcc_type": "standard", "distance": 3.084, "atom1_id": "///C/283/O", "atom2_id": "///C/317/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1629, "atom1_serNum": 14070, "atom2_serNum": 14132, "donAcc_type": "standard", "distance": 2.484, "atom1_id": "///C/284/N", "atom2_id": "///C/291/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1630, "atom1_serNum": 14073, "atom2_serNum": 14129, "donAcc_type": "standard", "distance": 2.590, "atom1_id": "///C/284/O", "atom2_id": "///C/291/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1631, "atom1_serNum": 14082, "atom2_serNum": 14317, "donAcc_type": "standard", "distance": 3.107, "atom1_id": "///C/285/N", "atom2_id": "///C/315/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1632, "atom1_serNum": 14085, "atom2_serNum": 14314, "donAcc_type": "standard", "distance": 3.140, "atom1_id": "///C/285/O", "atom2_id": "///C/315/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1633, "atom1_serNum": 14089, "atom2_serNum": 14115, "donAcc_type": "standard", "distance": 2.946, "atom1_id": "///C/286/N", "atom2_id": "///C/289/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1634, "atom1_serNum": 14092, "atom2_serNum": 14104, "donAcc_type": "standard", "distance": 2.961, "atom1_id": "///C/286/O", "atom2_id": "///C/288/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1635, "atom1_serNum": 14092, "atom2_serNum": 14112, "donAcc_type": "standard", "distance": 2.978, "atom1_id": "///C/286/O", "atom2_id": "///C/289/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1636, "atom1_serNum": 14092, "atom2_serNum": 14115, "donAcc_type": "questionable", "distance": 2.851, "atom1_id": "///C/286/O", "atom2_id": "///C/289/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1637, "atom1_serNum": 14104, "atom2_serNum": 14281, "donAcc_type": "standard", "distance": 3.485, "atom1_id": "///C/288/N", "atom2_id": "///C/310/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1638, "atom1_serNum": 14107, "atom2_serNum": 14264, "donAcc_type": "standard", "distance": 3.109, "atom1_id": "///C/288/O", "atom2_id": "///C/308/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1639, "atom1_serNum": 14107, "atom2_serNum": 14267, "donAcc_type": "questionable", "distance": 2.953, "atom1_id": "///C/288/O", "atom2_id": "///C/308/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1640, "atom1_serNum": 14121, "atom2_serNum": 14251, "donAcc_type": "standard", "distance": 3.276, "atom1_id": "///C/290/N", "atom2_id": "///C/306/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1641, "atom1_serNum": 14124, "atom2_serNum": 14248, "donAcc_type": "standard", "distance": 3.473, "atom1_id": "///C/290/O", "atom2_id": "///C/306/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1642, "atom1_serNum": 14138, "atom2_serNum": 14234, "donAcc_type": "standard", "distance": 3.606, "atom1_id": "///C/292/N", "atom2_id": "///C/304/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1643, "atom1_serNum": 14141, "atom2_serNum": 14231, "donAcc_type": "standard", "distance": 3.572, "atom1_id": "///C/292/O", "atom2_id": "///C/304/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1644, "atom1_serNum": 14153, "atom2_serNum": 14220, "donAcc_type": "standard", "distance": 3.455, "atom1_id": "///C/294/N", "atom2_id": "///C/302/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1645, "atom1_serNum": 14166, "atom2_serNum": 14202, "donAcc_type": "standard", "distance": 3.543, "atom1_id": "///C/296/N", "atom2_id": "///C/300/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1646, "atom1_serNum": 14169, "atom2_serNum": 14190, "donAcc_type": "standard", "distance": 3.071, "atom1_id": "///C/296/O", "atom2_id": "///C/299/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1647, "atom1_serNum": 14172, "atom2_serNum": 14190, "donAcc_type": "standard", "distance": 3.097, "atom1_id": "///C/296/OD1", "atom2_id": "///C/299/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1648, "atom1_serNum": 14172, "atom2_serNum": 14199, "donAcc_type": "standard", "distance": 2.846, "atom1_id": "///C/296/OD1", "atom2_id": "///C/300/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1649, "atom1_serNum": 14173, "atom2_serNum": 14206, "donAcc_type": "standard", "distance": 3.183, "atom1_id": "///C/296/ND2", "atom2_id": "///C/300/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1650, "atom1_serNum": 14289, "atom2_serNum": 14303, "donAcc_type": "acceptable", "distance": 2.452, "atom1_id": "///C/310/OH", "atom2_id": "///C/313/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1651, "atom1_serNum": 14325, "atom2_serNum": 14540, "donAcc_type": "acceptable", "distance": 2.603, "atom1_id": "///C/316/O", "atom2_id": "///C/343/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1652, "atom1_serNum": 14342, "atom2_serNum": 14683, "donAcc_type": "standard", "distance": 2.608, "atom1_id": "///C/318/O", "atom2_id": "///C/364/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1653, "atom1_serNum": 14357, "atom2_serNum": 14387, "donAcc_type": "standard", "distance": 3.721, "atom1_id": "///C/320/O", "atom2_id": "///C/324/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1654, "atom1_serNum": 14360, "atom2_serNum": 14369, "donAcc_type": "standard", "distance": 2.868, "atom1_id": "///C/320/OD1", "atom2_id": "///C/322/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1655, "atom1_serNum": 14360, "atom2_serNum": 14374, "donAcc_type": "acceptable", "distance": 3.071, "atom1_id": "///C/320/OD1", "atom2_id": "///C/322/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1656, "atom1_serNum": 14360, "atom2_serNum": 14375, "donAcc_type": "standard", "distance": 3.376, "atom1_id": "///C/320/OD1", "atom2_id": "///C/323/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1657, "atom1_serNum": 14365, "atom2_serNum": 14394, "donAcc_type": "standard", "distance": 2.864, "atom1_id": "///C/321/O", "atom2_id": "///C/325/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1658, "atom1_serNum": 14372, "atom2_serNum": 14402, "donAcc_type": "standard", "distance": 2.959, "atom1_id": "///C/322/O", "atom2_id": "///C/326/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1659, "atom1_serNum": 14390, "atom2_serNum": 14417, "donAcc_type": "standard", "distance": 2.962, "atom1_id": "///C/324/O", "atom2_id": "///C/328/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1660, "atom1_serNum": 14397, "atom2_serNum": 14425, "donAcc_type": "standard", "distance": 2.962, "atom1_id": "///C/325/O", "atom2_id": "///C/329/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1661, "atom1_serNum": 14405, "atom2_serNum": 14433, "donAcc_type": "standard", "distance": 3.300, "atom1_id": "///C/326/O", "atom2_id": "///C/330/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1662, "atom1_serNum": 14413, "atom2_serNum": 14438, "donAcc_type": "standard", "distance": 2.843, "atom1_id": "///C/327/O", "atom2_id": "///C/331/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1663, "atom1_serNum": 14436, "atom2_serNum": 14446, "donAcc_type": "standard", "distance": 3.065, "atom1_id": "///C/330/O", "atom2_id": "///C/332/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1664, "atom1_serNum": 14473, "atom2_serNum": 14599, "donAcc_type": "questionable", "distance": 2.895, "atom1_id": "///C/335/O", "atom2_id": "///C/351/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1665, "atom1_serNum": 14473, "atom2_serNum": 14601, "donAcc_type": "standard", "distance": 3.080, "atom1_id": "///C/335/O", "atom2_id": "///C/352/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1666, "atom1_serNum": 14485, "atom2_serNum": 14587, "donAcc_type": "standard", "distance": 2.614, "atom1_id": "///C/337/N", "atom2_id": "///C/350/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1667, "atom1_serNum": 14488, "atom2_serNum": 14584, "donAcc_type": "standard", "distance": 2.866, "atom1_id": "///C/337/O", "atom2_id": "///C/350/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1668, "atom1_serNum": 14492, "atom2_serNum": 14592, "donAcc_type": "standard", "distance": 3.102, "atom1_id": "///C/337/NE", "atom2_id": "///C/350/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1669, "atom1_serNum": 14495, "atom2_serNum": 14604, "donAcc_type": "standard", "distance": 3.340, "atom1_id": "///C/337/NH2", "atom2_id": "///C/352/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1670, "atom1_serNum": 14504, "atom2_serNum": 14570, "donAcc_type": "standard", "distance": 2.617, "atom1_id": "///C/339/N", "atom2_id": "///C/348/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1671, "atom1_serNum": 14507, "atom2_serNum": 14567, "donAcc_type": "standard", "distance": 2.576, "atom1_id": "///C/339/O", "atom2_id": "///C/348/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1672, "atom1_serNum": 14530, "atom2_serNum": 14548, "donAcc_type": "standard", "distance": 3.234, "atom1_id": "///C/342/O", "atom2_id": "///C/345/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1673, "atom1_serNum": 14533, "atom2_serNum": 14541, "donAcc_type": "standard", "distance": 3.262, "atom1_id": "///C/342/OD1", "atom2_id": "///C/344/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1674, "atom1_serNum": 14533, "atom2_serNum": 14553, "donAcc_type": "acceptable", "distance": 2.737, "atom1_id": "///C/342/OD1", "atom2_id": "///C/345/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1675, "atom1_serNum": 14563, "atom2_serNum": 14645, "donAcc_type": "questionable", "distance": 3.345, "atom1_id": "///C/347/O", "atom2_id": "///C/359/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1676, "atom1_serNum": 14574, "atom2_serNum": 14591, "donAcc_type": "questionable", "distance": 3.124, "atom1_id": "///C/348/OE1", "atom2_id": "///C/350/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1677, "atom1_serNum": 14576, "atom2_serNum": 14645, "donAcc_type": "standard", "distance": 2.716, "atom1_id": "///C/349/N", "atom2_id": "///C/359/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1678, "atom1_serNum": 14579, "atom2_serNum": 14642, "donAcc_type": "standard", "distance": 2.742, "atom1_id": "///C/349/O", "atom2_id": "///C/359/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1679, "atom1_serNum": 14596, "atom2_serNum": 14611, "donAcc_type": "standard", "distance": 3.512, "atom1_id": "///C/351/O", "atom2_id": "///C/354/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1680, "atom1_serNum": 14599, "atom2_serNum": 14601, "donAcc_type": "standard", "distance": 2.947, "atom1_id": "///C/351/OD1", "atom2_id": "///C/352/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1681, "atom1_serNum": 14599, "atom2_serNum": 14606, "donAcc_type": "standard", "distance": 3.051, "atom1_id": "///C/351/OD1", "atom2_id": "///C/353/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1682, "atom1_serNum": 14614, "atom2_serNum": 14626, "donAcc_type": "standard", "distance": 2.948, "atom1_id": "///C/354/O", "atom2_id": "///C/356/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1683, "atom1_serNum": 14616, "atom2_serNum": 14631, "donAcc_type": "acceptable", "distance": 3.387, "atom1_id": "///C/354/OG", "atom2_id": "///C/356/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1684, "atom1_serNum": 14620, "atom2_serNum": 14625, "donAcc_type": "standard", "distance": 2.795, "atom1_id": "///C/355/O", "atom2_id": "///C/355/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1685, "atom1_serNum": 14715, "atom2_serNum": 15402, "donAcc_type": "standard", "distance": 3.174, "atom1_id": "///D/7/O", "atom2_id": "///D/94/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1686, "atom1_serNum": 14722, "atom2_serNum": 15365, "donAcc_type": "standard", "distance": 3.823, "atom1_id": "///D/7/NH2", "atom2_id": "///D/89/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1687, "atom1_serNum": 14723, "atom2_serNum": 14954, "donAcc_type": "standard", "distance": 3.078, "atom1_id": "///D/8/N", "atom2_id": "///D/38/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1688, "atom1_serNum": 14726, "atom2_serNum": 14951, "donAcc_type": "standard", "distance": 2.971, "atom1_id": "///D/8/O", "atom2_id": "///D/38/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1689, "atom1_serNum": 14726, "atom2_serNum": 14954, "donAcc_type": "questionable", "distance": 2.408, "atom1_id": "///D/8/O", "atom2_id": "///D/38/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1690, "atom1_serNum": 14730, "atom2_serNum": 16053, "donAcc_type": "acceptable", "distance": 2.920, "atom1_id": "///D/8/OE1", "atom2_id": "///D/175/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1691, "atom1_serNum": 14731, "atom2_serNum": 14965, "donAcc_type": "questionable", "distance": 3.035, "atom1_id": "///D/8/NE2", "atom2_id": "///D/40/N", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 1692, "atom1_serNum": 14731, "atom2_serNum": 14973, "donAcc_type": "questionable", "distance": 3.380, "atom1_id": "///D/8/NE2", "atom2_id": "///D/41/N", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 1693, "atom1_serNum": 14732, "atom2_serNum": 15405, "donAcc_type": "standard", "distance": 2.809, "atom1_id": "///D/9/N", "atom2_id": "///D/94/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1694, "atom1_serNum": 14735, "atom2_serNum": 15405, "donAcc_type": "questionable", "distance": 2.784, "atom1_id": "///D/9/O", "atom2_id": "///D/94/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1695, "atom1_serNum": 14735, "atom2_serNum": 15419, "donAcc_type": "standard", "distance": 3.456, "atom1_id": "///D/9/O", "atom2_id": "///D/96/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1696, "atom1_serNum": 14740, "atom2_serNum": 14938, "donAcc_type": "standard", "distance": 2.958, "atom1_id": "///D/10/N", "atom2_id": "///D/36/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1697, "atom1_serNum": 14743, "atom2_serNum": 14935, "donAcc_type": "standard", "distance": 3.004, "atom1_id": "///D/10/O", "atom2_id": "///D/36/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1698, "atom1_serNum": 14743, "atom2_serNum": 14938, "donAcc_type": "questionable", "distance": 2.878, "atom1_id": "///D/10/O", "atom2_id": "///D/36/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1699, "atom1_serNum": 14755, "atom2_serNum": 14929, "donAcc_type": "standard", "distance": 3.130, "atom1_id": "///D/12/N", "atom2_id": "///D/34/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1700, "atom1_serNum": 14758, "atom2_serNum": 14929, "donAcc_type": "questionable", "distance": 2.871, "atom1_id": "///D/12/O", "atom2_id": "///D/34/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1701, "atom1_serNum": 14762, "atom2_serNum": 14778, "donAcc_type": "questionable", "distance": 2.796, "atom1_id": "///D/12/OD2", "atom2_id": "///D/14/OE2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1702, "atom1_serNum": 14762, "atom2_serNum": 15965, "donAcc_type": "questionable", "distance": 3.060, "atom1_id": "///D/12/OD2", "atom2_id": "///D/164/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1703, "atom1_serNum": 14768, "atom2_serNum": 15480, "donAcc_type": "acceptable", "distance": 3.460, "atom1_id": "///D/13/OG1", "atom2_id": "///D/103/OD2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1704, "atom1_serNum": 14773, "atom2_serNum": 14901, "donAcc_type": "standard", "distance": 3.966, "atom1_id": "///D/14/O", "atom2_id": "///D/31/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1705, "atom1_serNum": 14778, "atom2_serNum": 15990, "donAcc_type": "questionable", "distance": 3.011, "atom1_id": "///D/14/OE2", "atom2_id": "///D/167/OD2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1706, "atom1_serNum": 14782, "atom2_serNum": 14793, "donAcc_type": "standard", "distance": 2.851, "atom1_id": "///D/15/O", "atom2_id": "///D/17/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1707, "atom1_serNum": 14789, "atom2_serNum": 14880, "donAcc_type": "acceptable", "distance": 3.134, "atom1_id": "///D/16/O", "atom2_id": "///D/28/ND1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1708, "atom1_serNum": 14791, "atom2_serNum": 14887, "donAcc_type": "acceptable", "distance": 2.598, "atom1_id": "///D/16/OG1", "atom2_id": "///D/29/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1709, "atom1_serNum": 14805, "atom2_serNum": 14842, "donAcc_type": "standard", "distance": 3.487, "atom1_id": "///D/19/N", "atom2_id": "///D/24/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1710, "atom1_serNum": 14812, "atom2_serNum": 14825, "donAcc_type": "standard", "distance": 2.888, "atom1_id": "///D/19/ND2", "atom2_id": "///D/21/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1711, "atom1_serNum": 14833, "atom2_serNum": 14839, "donAcc_type": "standard", "distance": 3.298, "atom1_id": "///D/22/O", "atom2_id": "///D/24/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1712, "atom1_serNum": 14837, "atom2_serNum": 14861, "donAcc_type": "standard", "distance": 3.058, "atom1_id": "///D/23/O", "atom2_id": "///D/26/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1713, "atom1_serNum": 14848, "atom2_serNum": 15460, "donAcc_type": "standard", "distance": 3.279, "atom1_id": "///D/24/NE2", "atom2_id": "///D/101/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1714, "atom1_serNum": 14848, "atom2_serNum": 15465, "donAcc_type": "standard", "distance": 3.507, "atom1_id": "///D/24/NE2", "atom2_id": "///D/102/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1715, "atom1_serNum": 14852, "atom2_serNum": 14874, "donAcc_type": "standard", "distance": 3.074, "atom1_id": "///D/25/O", "atom2_id": "///D/28/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1716, "atom1_serNum": 14873, "atom2_serNum": 15111, "donAcc_type": "standard", "distance": 2.813, "atom1_id": "///D/27/O", "atom2_id": "///D/56/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1717, "atom1_serNum": 14892, "atom2_serNum": 15539, "donAcc_type": "standard", "distance": 2.622, "atom1_id": "///D/29/NZ", "atom2_id": "///D/110/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1718, "atom1_serNum": 14893, "atom2_serNum": 15540, "donAcc_type": "standard", "distance": 2.737, "atom1_id": "///D/30/N", "atom2_id": "///D/110/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1719, "atom1_serNum": 14904, "atom2_serNum": 15070, "donAcc_type": "standard", "distance": 2.750, "atom1_id": "///D/31/O", "atom2_id": "///D/52/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1720, "atom1_serNum": 14917, "atom2_serNum": 15050, "donAcc_type": "standard", "distance": 3.362, "atom1_id": "///D/32/OE2", "atom2_id": "///D/49/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1721, "atom1_serNum": 14918, "atom2_serNum": 15054, "donAcc_type": "standard", "distance": 2.715, "atom1_id": "///D/33/N", "atom2_id": "///D/50/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1722, "atom1_serNum": 14921, "atom2_serNum": 15051, "donAcc_type": "standard", "distance": 2.737, "atom1_id": "///D/33/O", "atom2_id": "///D/50/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1723, "atom1_serNum": 14930, "atom2_serNum": 15033, "donAcc_type": "standard", "distance": 2.601, "atom1_id": "///D/35/N", "atom2_id": "///D/48/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1724, "atom1_serNum": 14933, "atom2_serNum": 15030, "donAcc_type": "standard", "distance": 2.721, "atom1_id": "///D/35/O", "atom2_id": "///D/48/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1725, "atom1_serNum": 14942, "atom2_serNum": 15028, "donAcc_type": "standard", "distance": 3.750, "atom1_id": "///D/37/N", "atom2_id": "///D/47/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1726, "atom1_serNum": 14950, "atom2_serNum": 15021, "donAcc_type": "standard", "distance": 3.847, "atom1_id": "///D/37/OE2", "atom2_id": "///D/46/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1727, "atom1_serNum": 14958, "atom2_serNum": 14987, "donAcc_type": "standard", "distance": 3.015, "atom1_id": "///D/39/N", "atom2_id": "///D/42/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1728, "atom1_serNum": 14961, "atom2_serNum": 14984, "donAcc_type": "standard", "distance": 3.065, "atom1_id": "///D/39/O", "atom2_id": "///D/42/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1729, "atom1_serNum": 14965, "atom2_serNum": 14971, "donAcc_type": "standard", "distance": 2.839, "atom1_id": "///D/40/N", "atom2_id": "///D/40/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1730, "atom1_serNum": 14982, "atom2_serNum": 16057, "donAcc_type": "standard", "distance": 2.757, "atom1_id": "///D/41/NH1", "atom2_id": "///D/176/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1731, "atom1_serNum": 14982, "atom2_serNum": 16080, "donAcc_type": "acceptable", "distance": 2.605, "atom1_id": "///D/41/NH1", "atom2_id": "///D/179/OG1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1732, "atom1_serNum": 14983, "atom2_serNum": 16057, "donAcc_type": "standard", "distance": 2.618, "atom1_id": "///D/41/NH2", "atom2_id": "///D/176/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1733, "atom1_serNum": 15008, "atom2_serNum": 15014, "donAcc_type": "acceptable", "distance": 3.406, "atom1_id": "///D/44/OG1", "atom2_id": "///D/46/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1734, "atom1_serNum": 15013, "atom2_serNum": 15022, "donAcc_type": "standard", "distance": 2.963, "atom1_id": "///D/45/O", "atom2_id": "///D/47/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1735, "atom1_serNum": 15017, "atom2_serNum": 15373, "donAcc_type": "acceptable", "distance": 2.772, "atom1_id": "///D/46/O", "atom2_id": "///D/89/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1736, "atom1_serNum": 15073, "atom2_serNum": 15237, "donAcc_type": "questionable", "distance": 2.975, "atom1_id": "///D/52/O", "atom2_id": "///D/73/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1737, "atom1_serNum": 15078, "atom2_serNum": 15270, "donAcc_type": "standard", "distance": 3.138, "atom1_id": "///D/53/N", "atom2_id": "///D/77/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1738, "atom1_serNum": 15086, "atom2_serNum": 15261, "donAcc_type": "standard", "distance": 3.969, "atom1_id": "///D/53/NZ", "atom2_id": "///D/76/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1739, "atom1_serNum": 15109, "atom2_serNum": 15116, "donAcc_type": "standard", "distance": 2.967, "atom1_id": "///D/56/NE", "atom2_id": "///D/57/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1740, "atom1_serNum": 15112, "atom2_serNum": 15116, "donAcc_type": "standard", "distance": 3.359, "atom1_id": "///D/56/NH2", "atom2_id": "///D/57/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1741, "atom1_serNum": 15112, "atom2_serNum": 15134, "donAcc_type": "standard", "distance": 3.501, "atom1_id": "///D/56/NH2", "atom2_id": "///D/59/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1742, "atom1_serNum": 15121, "atom2_serNum": 15213, "donAcc_type": "standard", "distance": 2.591, "atom1_id": "///D/58/N", "atom2_id": "///D/70/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1743, "atom1_serNum": 15131, "atom2_serNum": 15157, "donAcc_type": "standard", "distance": 2.939, "atom1_id": "///D/59/O", "atom2_id": "///D/63/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1744, "atom1_serNum": 15139, "atom2_serNum": 15168, "donAcc_type": "standard", "distance": 3.281, "atom1_id": "///D/60/O", "atom2_id": "///D/64/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1745, "atom1_serNum": 15146, "atom2_serNum": 15172, "donAcc_type": "standard", "distance": 3.170, "atom1_id": "///D/61/O", "atom2_id": "///D/65/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1746, "atom1_serNum": 15155, "atom2_serNum": 15179, "donAcc_type": "standard", "distance": 3.609, "atom1_id": "///D/62/O", "atom2_id": "///D/66/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1747, "atom1_serNum": 15160, "atom2_serNum": 15189, "donAcc_type": "standard", "distance": 2.846, "atom1_id": "///D/63/O", "atom2_id": "///D/67/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1748, "atom1_serNum": 15204, "atom2_serNum": 15223, "donAcc_type": "standard", "distance": 3.139, "atom1_id": "///D/69/O", "atom2_id": "///D/72/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1749, "atom1_serNum": 15209, "atom2_serNum": 15234, "donAcc_type": "standard", "distance": 2.991, "atom1_id": "///D/70/O", "atom2_id": "///D/73/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1750, "atom1_serNum": 15209, "atom2_serNum": 15242, "donAcc_type": "standard", "distance": 3.462, "atom1_id": "///D/70/O", "atom2_id": "///D/74/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1751, "atom1_serNum": 15214, "atom2_serNum": 15221, "donAcc_type": "standard", "distance": 2.652, "atom1_id": "///D/71/N", "atom2_id": "///D/71/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1752, "atom1_serNum": 15226, "atom2_serNum": 15266, "donAcc_type": "standard", "distance": 2.749, "atom1_id": "///D/72/O", "atom2_id": "///D/76/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1753, "atom1_serNum": 15256, "atom2_serNum": 15266, "donAcc_type": "standard", "distance": 2.658, "atom1_id": "///D/75/OD1", "atom2_id": "///D/76/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1754, "atom1_serNum": 15274, "atom2_serNum": 15305, "donAcc_type": "standard", "distance": 2.761, "atom1_id": "///D/78/N", "atom2_id": "///D/81/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1755, "atom1_serNum": 15277, "atom2_serNum": 15297, "donAcc_type": "standard", "distance": 3.128, "atom1_id": "///D/78/O", "atom2_id": "///D/81/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1756, "atom1_serNum": 15279, "atom2_serNum": 15292, "donAcc_type": "acceptable", "distance": 3.024, "atom1_id": "///D/78/OG1", "atom2_id": "///D/80/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1757, "atom1_serNum": 15279, "atom2_serNum": 15304, "donAcc_type": "acceptable", "distance": 2.559, "atom1_id": "///D/78/OG1", "atom2_id": "///D/81/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1758, "atom1_serNum": 15284, "atom2_serNum": 15313, "donAcc_type": "standard", "distance": 2.930, "atom1_id": "///D/79/O", "atom2_id": "///D/83/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1759, "atom1_serNum": 15297, "atom2_serNum": 15304, "donAcc_type": "standard", "distance": 2.920, "atom1_id": "///D/81/N", "atom2_id": "///D/81/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1760, "atom1_serNum": 15309, "atom2_serNum": 15335, "donAcc_type": "standard", "distance": 2.832, "atom1_id": "///D/82/O", "atom2_id": "///D/86/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1761, "atom1_serNum": 15316, "atom2_serNum": 15346, "donAcc_type": "standard", "distance": 2.956, "atom1_id": "///D/83/O", "atom2_id": "///D/87/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1762, "atom1_serNum": 15321, "atom2_serNum": 15354, "donAcc_type": "standard", "distance": 2.960, "atom1_id": "///D/84/O", "atom2_id": "///D/88/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1763, "atom1_serNum": 15324, "atom2_serNum": 15592, "donAcc_type": "standard", "distance": 3.058, "atom1_id": "///D/84/OD1", "atom2_id": "///D/116/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1764, "atom1_serNum": 15325, "atom2_serNum": 15593, "donAcc_type": "standard", "distance": 2.914, "atom1_id": "///D/84/OD2", "atom2_id": "///D/116/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1765, "atom1_serNum": 15329, "atom2_serNum": 15362, "donAcc_type": "standard", "distance": 3.271, "atom1_id": "///D/85/O", "atom2_id": "///D/89/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1766, "atom1_serNum": 15338, "atom2_serNum": 15374, "donAcc_type": "standard", "distance": 3.226, "atom1_id": "///D/86/O", "atom2_id": "///D/90/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1767, "atom1_serNum": 15349, "atom2_serNum": 15382, "donAcc_type": "standard", "distance": 2.802, "atom1_id": "///D/87/O", "atom2_id": "///D/91/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1768, "atom1_serNum": 15360, "atom2_serNum": 15391, "donAcc_type": "standard", "distance": 2.678, "atom1_id": "///D/88/OD1", "atom2_id": "///D/91/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1769, "atom1_serNum": 15377, "atom2_serNum": 15397, "donAcc_type": "standard", "distance": 3.422, "atom1_id": "///D/90/O", "atom2_id": "///D/93/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1770, "atom1_serNum": 15409, "atom2_serNum": 15673, "donAcc_type": "standard", "distance": 3.229, "atom1_id": "///D/94/OE1", "atom2_id": "///D/126/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1771, "atom1_serNum": 15410, "atom2_serNum": 15673, "donAcc_type": "standard", "distance": 2.589, "atom1_id": "///D/94/OE2", "atom2_id": "///D/126/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1772, "atom1_serNum": 15410, "atom2_serNum": 15686, "donAcc_type": "acceptable", "distance": 2.609, "atom1_id": "///D/94/OE2", "atom2_id": "///D/128/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1773, "atom1_serNum": 15411, "atom2_serNum": 15668, "donAcc_type": "standard", "distance": 3.321, "atom1_id": "///D/95/N", "atom2_id": "///D/126/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1774, "atom1_serNum": 15414, "atom2_serNum": 15681, "donAcc_type": "standard", "distance": 2.887, "atom1_id": "///D/95/O", "atom2_id": "///D/128/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1775, "atom1_serNum": 15414, "atom2_serNum": 15684, "donAcc_type": "questionable", "distance": 2.779, "atom1_id": "///D/95/O", "atom2_id": "///D/128/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1776, "atom1_serNum": 15426, "atom2_serNum": 15684, "donAcc_type": "standard", "distance": 2.657, "atom1_id": "///D/97/N", "atom2_id": "///D/128/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1777, "atom1_serNum": 15429, "atom2_serNum": 15694, "donAcc_type": "questionable", "distance": 2.455, "atom1_id": "///D/97/O", "atom2_id": "///D/129/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1778, "atom1_serNum": 15429, "atom2_serNum": 15696, "donAcc_type": "standard", "distance": 2.547, "atom1_id": "///D/97/O", "atom2_id": "///D/130/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1779, "atom1_serNum": 15437, "atom2_serNum": 15479, "donAcc_type": "questionable", "distance": 2.972, "atom1_id": "///D/98/O", "atom2_id": "///D/103/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1780, "atom1_serNum": 15444, "atom2_serNum": 15694, "donAcc_type": "standard", "distance": 2.634, "atom1_id": "///D/99/N", "atom2_id": "///D/129/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1781, "atom1_serNum": 15447, "atom2_serNum": 15462, "donAcc_type": "standard", "distance": 2.749, "atom1_id": "///D/99/O", "atom2_id": "///D/102/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1782, "atom1_serNum": 15447, "atom2_serNum": 15473, "donAcc_type": "standard", "distance": 3.776, "atom1_id": "///D/99/O", "atom2_id": "///D/103/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1783, "atom1_serNum": 15455, "atom2_serNum": 15481, "donAcc_type": "standard", "distance": 2.885, "atom1_id": "///D/100/O", "atom2_id": "///D/104/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1784, "atom1_serNum": 15465, "atom2_serNum": 15493, "donAcc_type": "standard", "distance": 3.126, "atom1_id": "///D/102/O", "atom2_id": "///D/106/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1785, "atom1_serNum": 15473, "atom2_serNum": 15479, "donAcc_type": "standard", "distance": 2.820, "atom1_id": "///D/103/N", "atom2_id": "///D/103/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1786, "atom1_serNum": 15476, "atom2_serNum": 15504, "donAcc_type": "standard", "distance": 2.829, "atom1_id": "///D/103/O", "atom2_id": "///D/107/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1787, "atom1_serNum": 15484, "atom2_serNum": 15512, "donAcc_type": "standard", "distance": 2.877, "atom1_id": "///D/104/O", "atom2_id": "///D/108/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1788, "atom1_serNum": 15492, "atom2_serNum": 15520, "donAcc_type": "standard", "distance": 3.108, "atom1_id": "///D/105/O", "atom2_id": "///D/109/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1789, "atom1_serNum": 15496, "atom2_serNum": 15532, "donAcc_type": "standard", "distance": 2.933, "atom1_id": "///D/106/O", "atom2_id": "///D/110/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1790, "atom1_serNum": 15507, "atom2_serNum": 15541, "donAcc_type": "standard", "distance": 2.960, "atom1_id": "///D/107/O", "atom2_id": "///D/111/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1791, "atom1_serNum": 15515, "atom2_serNum": 15552, "donAcc_type": "standard", "distance": 2.944, "atom1_id": "///D/108/O", "atom2_id": "///D/112/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1792, "atom1_serNum": 15515, "atom2_serNum": 15557, "donAcc_type": "acceptable", "distance": 2.896, "atom1_id": "///D/108/O", "atom2_id": "///D/112/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1793, "atom1_serNum": 15518, "atom2_serNum": 15626, "donAcc_type": "standard", "distance": 2.874, "atom1_id": "///D/108/OD1", "atom2_id": "///D/121/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1794, "atom1_serNum": 15518, "atom2_serNum": 15631, "donAcc_type": "acceptable", "distance": 2.851, "atom1_id": "///D/108/OD1", "atom2_id": "///D/121/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1795, "atom1_serNum": 15523, "atom2_serNum": 15557, "donAcc_type": "acceptable", "distance": 2.697, "atom1_id": "///D/109/O", "atom2_id": "///D/112/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1796, "atom1_serNum": 15523, "atom2_serNum": 15558, "donAcc_type": "standard", "distance": 3.139, "atom1_id": "///D/109/O", "atom2_id": "///D/113/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1797, "atom1_serNum": 15535, "atom2_serNum": 15566, "donAcc_type": "standard", "distance": 3.325, "atom1_id": "///D/110/O", "atom2_id": "///D/114/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1798, "atom1_serNum": 15544, "atom2_serNum": 15566, "donAcc_type": "standard", "distance": 3.241, "atom1_id": "///D/111/O", "atom2_id": "///D/114/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1799, "atom1_serNum": 15555, "atom2_serNum": 15574, "donAcc_type": "standard", "distance": 3.068, "atom1_id": "///D/112/O", "atom2_id": "///D/115/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1800, "atom1_serNum": 15597, "atom2_serNum": 15610, "donAcc_type": "standard", "distance": 3.217, "atom1_id": "///D/117/O", "atom2_id": "///D/119/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1801, "atom1_serNum": 15620, "atom2_serNum": 15641, "donAcc_type": "standard", "distance": 2.929, "atom1_id": "///D/120/O", "atom2_id": "///D/123/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1802, "atom1_serNum": 15620, "atom2_serNum": 15646, "donAcc_type": "acceptable", "distance": 2.623, "atom1_id": "///D/120/O", "atom2_id": "///D/123/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1803, "atom1_serNum": 15629, "atom2_serNum": 15648, "donAcc_type": "standard", "distance": 3.185, "atom1_id": "///D/121/O", "atom2_id": "///D/124/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1804, "atom1_serNum": 15629, "atom2_serNum": 15659, "donAcc_type": "standard", "distance": 2.857, "atom1_id": "///D/121/O", "atom2_id": "///D/125/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1805, "atom1_serNum": 15673, "atom2_serNum": 15686, "donAcc_type": "acceptable", "distance": 3.006, "atom1_id": "///D/126/NZ", "atom2_id": "///D/128/OG1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1806, "atom1_serNum": 15691, "atom2_serNum": 15715, "donAcc_type": "standard", "distance": 3.721, "atom1_id": "///D/129/O", "atom2_id": "///D/133/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1807, "atom1_serNum": 15694, "atom2_serNum": 15702, "donAcc_type": "standard", "distance": 2.827, "atom1_id": "///D/129/OD1", "atom2_id": "///D/131/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1808, "atom1_serNum": 15695, "atom2_serNum": 15710, "donAcc_type": "standard", "distance": 2.687, "atom1_id": "///D/129/OD2", "atom2_id": "///D/132/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1809, "atom1_serNum": 15695, "atom2_serNum": 15737, "donAcc_type": "standard", "distance": 2.938, "atom1_id": "///D/129/OD2", "atom2_id": "///D/135/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1810, "atom1_serNum": 15699, "atom2_serNum": 15722, "donAcc_type": "standard", "distance": 2.991, "atom1_id": "///D/130/O", "atom2_id": "///D/134/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1811, "atom1_serNum": 15705, "atom2_serNum": 15727, "donAcc_type": "standard", "distance": 2.783, "atom1_id": "///D/131/O", "atom2_id": "///D/135/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1812, "atom1_serNum": 15705, "atom2_serNum": 15734, "donAcc_type": "standard", "distance": 3.045, "atom1_id": "///D/131/O", "atom2_id": "///D/135/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1813, "atom1_serNum": 15713, "atom2_serNum": 15738, "donAcc_type": "standard", "distance": 3.054, "atom1_id": "///D/132/O", "atom2_id": "///D/136/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1814, "atom1_serNum": 15718, "atom2_serNum": 15747, "donAcc_type": "standard", "distance": 2.960, "atom1_id": "///D/133/O", "atom2_id": "///D/137/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1815, "atom1_serNum": 15725, "atom2_serNum": 15755, "donAcc_type": "standard", "distance": 2.711, "atom1_id": "///D/134/O", "atom2_id": "///D/138/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1816, "atom1_serNum": 15758, "atom2_serNum": 15777, "donAcc_type": "standard", "distance": 3.376, "atom1_id": "///D/138/O", "atom2_id": "///D/141/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1817, "atom1_serNum": 15758, "atom2_serNum": 15804, "donAcc_type": "standard", "distance": 3.024, "atom1_id": "///D/138/O", "atom2_id": "///D/143/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1818, "atom1_serNum": 15780, "atom2_serNum": 15797, "donAcc_type": "standard", "distance": 3.174, "atom1_id": "///D/141/O", "atom2_id": "///D/143/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1819, "atom1_serNum": 15789, "atom2_serNum": 15860, "donAcc_type": "standard", "distance": 3.511, "atom1_id": "///D/142/O", "atom2_id": "///D/151/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1820, "atom1_serNum": 15795, "atom2_serNum": 15825, "donAcc_type": "standard", "distance": 2.694, "atom1_id": "///D/142/NH1", "atom2_id": "///D/146/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1821, "atom1_serNum": 15795, "atom2_serNum": 15826, "donAcc_type": "standard", "distance": 3.151, "atom1_id": "///D/142/NH1", "atom2_id": "///D/146/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1822, "atom1_serNum": 15796, "atom2_serNum": 15826, "donAcc_type": "standard", "distance": 2.763, "atom1_id": "///D/142/NH2", "atom2_id": "///D/146/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1823, "atom1_serNum": 15803, "atom2_serNum": 15860, "donAcc_type": "standard", "distance": 3.726, "atom1_id": "///D/143/OD1", "atom2_id": "///D/151/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1824, "atom1_serNum": 15808, "atom2_serNum": 15832, "donAcc_type": "standard", "distance": 2.911, "atom1_id": "///D/144/O", "atom2_id": "///D/148/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1825, "atom1_serNum": 15814, "atom2_serNum": 15840, "donAcc_type": "standard", "distance": 2.750, "atom1_id": "///D/145/O", "atom2_id": "///D/149/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1826, "atom1_serNum": 15822, "atom2_serNum": 15846, "donAcc_type": "standard", "distance": 3.087, "atom1_id": "///D/146/O", "atom2_id": "///D/150/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1827, "atom1_serNum": 15830, "atom2_serNum": 15851, "donAcc_type": "standard", "distance": 3.002, "atom1_id": "///D/147/O", "atom2_id": "///D/151/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1828, "atom1_serNum": 15835, "atom2_serNum": 15862, "donAcc_type": "standard", "distance": 2.851, "atom1_id": "///D/148/O", "atom2_id": "///D/152/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1829, "atom1_serNum": 15843, "atom2_serNum": 15874, "donAcc_type": "standard", "distance": 3.098, "atom1_id": "///D/149/O", "atom2_id": "///D/153/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1830, "atom1_serNum": 15843, "atom2_serNum": 15883, "donAcc_type": "standard", "distance": 2.937, "atom1_id": "///D/149/O", "atom2_id": "///D/154/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1831, "atom1_serNum": 15849, "atom2_serNum": 15874, "donAcc_type": "standard", "distance": 3.200, "atom1_id": "///D/150/O", "atom2_id": "///D/153/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1832, "atom1_serNum": 15894, "atom2_serNum": 15931, "donAcc_type": "standard", "distance": 2.736, "atom1_id": "///D/155/O", "atom2_id": "///D/159/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1833, "atom1_serNum": 15897, "atom2_serNum": 15907, "donAcc_type": "standard", "distance": 2.812, "atom1_id": "///D/155/OD1", "atom2_id": "///D/157/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1834, "atom1_serNum": 15897, "atom2_serNum": 15912, "donAcc_type": "acceptable", "distance": 2.648, "atom1_id": "///D/155/OD1", "atom2_id": "///D/157/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1835, "atom1_serNum": 15897, "atom2_serNum": 15913, "donAcc_type": "standard", "distance": 2.825, "atom1_id": "///D/155/OD1", "atom2_id": "///D/158/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1836, "atom1_serNum": 15899, "atom2_serNum": 15905, "donAcc_type": "standard", "distance": 2.900, "atom1_id": "///D/156/N", "atom2_id": "///D/156/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1837, "atom1_serNum": 15925, "atom2_serNum": 15954, "donAcc_type": "acceptable", "distance": 3.675, "atom1_id": "///D/159/O", "atom2_id": "///D/162/ND1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1838, "atom1_serNum": 15932, "atom2_serNum": 16034, "donAcc_type": "standard", "distance": 3.208, "atom1_id": "///D/159/NH2", "atom2_id": "///D/173/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1839, "atom1_serNum": 15936, "atom2_serNum": 15948, "donAcc_type": "standard", "distance": 3.144, "atom1_id": "///D/160/O", "atom2_id": "///D/162/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1840, "atom1_serNum": 15936, "atom2_serNum": 15954, "donAcc_type": "acceptable", "distance": 2.948, "atom1_id": "///D/160/O", "atom2_id": "///D/162/ND1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1841, "atom1_serNum": 15961, "atom2_serNum": 15975, "donAcc_type": "standard", "distance": 3.069, "atom1_id": "///D/163/O", "atom2_id": "///D/166/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1842, "atom1_serNum": 15961, "atom2_serNum": 15983, "donAcc_type": "standard", "distance": 3.498, "atom1_id": "///D/163/O", "atom2_id": "///D/167/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1843, "atom1_serNum": 15965, "atom2_serNum": 15991, "donAcc_type": "standard", "distance": 2.839, "atom1_id": "///D/164/O", "atom2_id": "///D/168/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1844, "atom1_serNum": 15970, "atom2_serNum": 15996, "donAcc_type": "standard", "distance": 3.066, "atom1_id": "///D/165/O", "atom2_id": "///D/169/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1845, "atom1_serNum": 15978, "atom2_serNum": 16005, "donAcc_type": "standard", "distance": 3.051, "atom1_id": "///D/166/O", "atom2_id": "///D/170/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1846, "atom1_serNum": 15986, "atom2_serNum": 16013, "donAcc_type": "standard", "distance": 2.699, "atom1_id": "///D/167/O", "atom2_id": "///D/171/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1847, "atom1_serNum": 15994, "atom2_serNum": 16021, "donAcc_type": "standard", "distance": 2.912, "atom1_id": "///D/168/O", "atom2_id": "///D/172/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1848, "atom1_serNum": 15999, "atom2_serNum": 16026, "donAcc_type": "standard", "distance": 3.154, "atom1_id": "///D/169/O", "atom2_id": "///D/173/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1849, "atom1_serNum": 16004, "atom2_serNum": 16034, "donAcc_type": "standard", "distance": 2.784, "atom1_id": "///D/169/NE2", "atom2_id": "///D/173/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1850, "atom1_serNum": 16008, "atom2_serNum": 16035, "donAcc_type": "standard", "distance": 2.918, "atom1_id": "///D/170/O", "atom2_id": "///D/174/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1851, "atom1_serNum": 16016, "atom2_serNum": 16042, "donAcc_type": "standard", "distance": 2.727, "atom1_id": "///D/171/O", "atom2_id": "///D/175/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1852, "atom1_serNum": 16024, "atom2_serNum": 16054, "donAcc_type": "standard", "distance": 2.925, "atom1_id": "///D/172/O", "atom2_id": "///D/176/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1853, "atom1_serNum": 16029, "atom2_serNum": 16062, "donAcc_type": "standard", "distance": 3.002, "atom1_id": "///D/173/O", "atom2_id": "///D/177/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1854, "atom1_serNum": 16038, "atom2_serNum": 16067, "donAcc_type": "standard", "distance": 2.924, "atom1_id": "///D/174/O", "atom2_id": "///D/178/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1855, "atom1_serNum": 16045, "atom2_serNum": 16075, "donAcc_type": "standard", "distance": 3.044, "atom1_id": "///D/175/O", "atom2_id": "///D/179/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1856, "atom1_serNum": 16045, "atom2_serNum": 16080, "donAcc_type": "acceptable", "distance": 2.596, "atom1_id": "///D/175/O", "atom2_id": "///D/179/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1857, "atom1_serNum": 16065, "atom2_serNum": 16082, "donAcc_type": "standard", "distance": 3.354, "atom1_id": "///D/177/O", "atom2_id": "///D/180/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1858, "atom1_serNum": 16070, "atom2_serNum": 16085, "donAcc_type": "questionable", "distance": 3.010, "atom1_id": "///D/178/O", "atom2_id": "///D/180/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1859, "atom1_serNum": 16097, "atom2_serNum": 16102, "donAcc_type": "questionable", "distance": 2.930, "atom1_id": "///D/182/OE1", "atom2_id": "///D/183/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1860, "atom1_serNum": 16116, "atom2_serNum": 16128, "donAcc_type": "standard", "distance": 2.753, "atom1_id": "///D/185/O", "atom2_id": "///D/187/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1861, "atom1_serNum": 16131, "atom2_serNum": 16141, "donAcc_type": "standard", "distance": 3.332, "atom1_id": "///D/187/O", "atom2_id": "///D/189/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1862, "atom1_serNum": 16149, "atom2_serNum": 16156, "donAcc_type": "standard", "distance": 2.659, "atom1_id": "///D/208/N", "atom2_id": "///D/208/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1863, "atom1_serNum": 16227, "atom2_serNum": 16258, "donAcc_type": "standard", "distance": 3.025, "atom1_id": "///D/218/N", "atom2_id": "///D/221/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1864, "atom1_serNum": 16230, "atom2_serNum": 16260, "donAcc_type": "standard", "distance": 2.850, "atom1_id": "///D/218/O", "atom2_id": "///D/222/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1865, "atom1_serNum": 16237, "atom2_serNum": 16268, "donAcc_type": "standard", "distance": 2.964, "atom1_id": "///D/219/O", "atom2_id": "///D/223/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1866, "atom1_serNum": 16245, "atom2_serNum": 16273, "donAcc_type": "standard", "distance": 3.085, "atom1_id": "///D/220/O", "atom2_id": "///D/224/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1867, "atom1_serNum": 16254, "atom2_serNum": 16278, "donAcc_type": "standard", "distance": 2.811, "atom1_id": "///D/221/O", "atom2_id": "///D/225/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1868, "atom1_serNum": 16263, "atom2_serNum": 16288, "donAcc_type": "standard", "distance": 2.865, "atom1_id": "///D/222/O", "atom2_id": "///D/226/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1869, "atom1_serNum": 16271, "atom2_serNum": 16297, "donAcc_type": "standard", "distance": 2.988, "atom1_id": "///D/223/O", "atom2_id": "///D/227/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1870, "atom1_serNum": 16276, "atom2_serNum": 16302, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///D/224/O", "atom2_id": "///D/228/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1871, "atom1_serNum": 16281, "atom2_serNum": 16313, "donAcc_type": "standard", "distance": 2.861, "atom1_id": "///D/225/O", "atom2_id": "///D/229/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1872, "atom1_serNum": 16291, "atom2_serNum": 16321, "donAcc_type": "standard", "distance": 2.894, "atom1_id": "///D/226/O", "atom2_id": "///D/230/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1873, "atom1_serNum": 16295, "atom2_serNum": 16423, "donAcc_type": "standard", "distance": 2.690, "atom1_id": "///D/226/OE1", "atom2_id": "///D/242/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1874, "atom1_serNum": 16300, "atom2_serNum": 16329, "donAcc_type": "standard", "distance": 3.125, "atom1_id": "///D/227/O", "atom2_id": "///D/231/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1875, "atom1_serNum": 16305, "atom2_serNum": 16311, "donAcc_type": "standard", "distance": 3.018, "atom1_id": "///D/228/O", "atom2_id": "///D/228/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1876, "atom1_serNum": 16305, "atom2_serNum": 16337, "donAcc_type": "standard", "distance": 3.150, "atom1_id": "///D/228/O", "atom2_id": "///D/232/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1877, "atom1_serNum": 16316, "atom2_serNum": 16344, "donAcc_type": "standard", "distance": 2.893, "atom1_id": "///D/229/O", "atom2_id": "///D/233/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1878, "atom1_serNum": 16324, "atom2_serNum": 16353, "donAcc_type": "standard", "distance": 2.786, "atom1_id": "///D/230/O", "atom2_id": "///D/234/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1879, "atom1_serNum": 16332, "atom2_serNum": 16362, "donAcc_type": "standard", "distance": 2.996, "atom1_id": "///D/231/O", "atom2_id": "///D/235/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1880, "atom1_serNum": 16340, "atom2_serNum": 16371, "donAcc_type": "standard", "distance": 2.762, "atom1_id": "///D/232/O", "atom2_id": "///D/236/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1881, "atom1_serNum": 16347, "atom2_serNum": 16375, "donAcc_type": "standard", "distance": 2.836, "atom1_id": "///D/233/O", "atom2_id": "///D/237/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1882, "atom1_serNum": 16351, "atom2_serNum": 16422, "donAcc_type": "standard", "distance": 3.425, "atom1_id": "///D/233/OE1", "atom2_id": "///D/242/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1883, "atom1_serNum": 16388, "atom2_serNum": 16413, "donAcc_type": "standard", "distance": 2.997, "atom1_id": "///D/239/O", "atom2_id": "///D/242/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1884, "atom1_serNum": 16388, "atom2_serNum": 16424, "donAcc_type": "standard", "distance": 2.565, "atom1_id": "///D/239/O", "atom2_id": "///D/243/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1885, "atom1_serNum": 16394, "atom2_serNum": 16424, "donAcc_type": "standard", "distance": 2.242, "atom1_id": "///D/240/O", "atom2_id": "///D/243/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1886, "atom1_serNum": 16433, "atom2_serNum": 16435, "donAcc_type": "acceptable", "distance": 2.597, "atom1_id": "///E/506/O", "atom2_id": "///E/506/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1887, "atom1_serNum": 16440, "atom2_serNum": 16461, "donAcc_type": "standard", "distance": 2.385, "atom1_id": "///E/507/O", "atom2_id": "///E/510/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1888, "atom1_serNum": 16447, "atom2_serNum": 16471, "donAcc_type": "standard", "distance": 2.871, "atom1_id": "///E/508/O", "atom2_id": "///E/512/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1889, "atom1_serNum": 16456, "atom2_serNum": 16480, "donAcc_type": "standard", "distance": 2.723, "atom1_id": "///E/509/O", "atom2_id": "///E/513/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1890, "atom1_serNum": 16464, "atom2_serNum": 16488, "donAcc_type": "standard", "distance": 2.921, "atom1_id": "///E/510/O", "atom2_id": "///E/514/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1891, "atom1_serNum": 16469, "atom2_serNum": 16493, "donAcc_type": "standard", "distance": 3.012, "atom1_id": "///E/511/O", "atom2_id": "///E/515/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1892, "atom1_serNum": 16474, "atom2_serNum": 16493, "donAcc_type": "standard", "distance": 2.968, "atom1_id": "///E/512/O", "atom2_id": "///E/515/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1893, "atom1_serNum": 16474, "atom2_serNum": 16498, "donAcc_type": "standard", "distance": 3.311, "atom1_id": "///E/512/O", "atom2_id": "///E/516/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1894, "atom1_serNum": 16483, "atom2_serNum": 16507, "donAcc_type": "standard", "distance": 3.096, "atom1_id": "///E/513/O", "atom2_id": "///E/517/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1895, "atom1_serNum": 16491, "atom2_serNum": 16512, "donAcc_type": "standard", "distance": 2.855, "atom1_id": "///E/514/O", "atom2_id": "///E/518/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1896, "atom1_serNum": 16496, "atom2_serNum": 16520, "donAcc_type": "standard", "distance": 2.796, "atom1_id": "///E/515/O", "atom2_id": "///E/519/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1897, "atom1_serNum": 16501, "atom2_serNum": 16529, "donAcc_type": "standard", "distance": 3.073, "atom1_id": "///E/516/O", "atom2_id": "///E/520/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1898, "atom1_serNum": 16510, "atom2_serNum": 16529, "donAcc_type": "standard", "distance": 3.220, "atom1_id": "///E/517/O", "atom2_id": "///E/520/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1899, "atom1_serNum": 16510, "atom2_serNum": 16540, "donAcc_type": "standard", "distance": 2.719, "atom1_id": "///E/517/O", "atom2_id": "///E/521/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1900, "atom1_serNum": 16543, "atom2_serNum": 16574, "donAcc_type": "standard", "distance": 3.188, "atom1_id": "///E/521/O", "atom2_id": "///E/525/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1901, "atom1_serNum": 16547, "atom2_serNum": 16569, "donAcc_type": "standard", "distance": 2.957, "atom1_id": "///E/521/OD2", "atom2_id": "///E/524/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1902, "atom1_serNum": 16551, "atom2_serNum": 16579, "donAcc_type": "standard", "distance": 2.888, "atom1_id": "///E/522/O", "atom2_id": "///E/526/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1903, "atom1_serNum": 16558, "atom2_serNum": 16588, "donAcc_type": "standard", "distance": 2.819, "atom1_id": "///E/523/O", "atom2_id": "///E/527/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1904, "atom1_serNum": 16563, "atom2_serNum": 16691, "donAcc_type": "standard", "distance": 2.734, "atom1_id": "///E/523/NE1", "atom2_id": "///E/540/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1905, "atom1_serNum": 16572, "atom2_serNum": 16595, "donAcc_type": "standard", "distance": 3.036, "atom1_id": "///E/524/O", "atom2_id": "///E/528/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1906, "atom1_serNum": 16577, "atom2_serNum": 16601, "donAcc_type": "standard", "distance": 2.962, "atom1_id": "///E/525/O", "atom2_id": "///E/529/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1907, "atom1_serNum": 16582, "atom2_serNum": 16610, "donAcc_type": "standard", "distance": 2.844, "atom1_id": "///E/526/O", "atom2_id": "///E/530/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1908, "atom1_serNum": 16591, "atom2_serNum": 16618, "donAcc_type": "standard", "distance": 2.862, "atom1_id": "///E/527/O", "atom2_id": "///E/531/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1909, "atom1_serNum": 16591, "atom2_serNum": 16624, "donAcc_type": "standard", "distance": 3.548, "atom1_id": "///E/527/O", "atom2_id": "///E/532/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1910, "atom1_serNum": 16598, "atom2_serNum": 16623, "donAcc_type": "acceptable", "distance": 2.789, "atom1_id": "///E/528/O", "atom2_id": "///E/531/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1911, "atom1_serNum": 16642, "atom2_serNum": 16672, "donAcc_type": "standard", "distance": 2.783, "atom1_id": "///E/534/O", "atom2_id": "///E/538/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1912, "atom1_serNum": 16651, "atom2_serNum": 16681, "donAcc_type": "standard", "distance": 3.122, "atom1_id": "///E/535/O", "atom2_id": "///E/539/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1913, "atom1_serNum": 16659, "atom2_serNum": 16688, "donAcc_type": "standard", "distance": 3.019, "atom1_id": "///E/536/O", "atom2_id": "///E/540/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1914, "atom1_serNum": 16666, "atom2_serNum": 16693, "donAcc_type": "standard", "distance": 2.689, "atom1_id": "///E/537/O", "atom2_id": "///E/541/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1915, "atom1_serNum": 16675, "atom2_serNum": 16701, "donAcc_type": "standard", "distance": 2.903, "atom1_id": "///E/538/O", "atom2_id": "///E/542/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1916, "atom1_serNum": 16675, "atom2_serNum": 16708, "donAcc_type": "standard", "distance": 2.837, "atom1_id": "///E/538/O", "atom2_id": "///E/542/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1917, "atom1_serNum": 16691, "atom2_serNum": 16712, "donAcc_type": "questionable", "distance": 3.190, "atom1_id": "///E/540/O", "atom2_id": "///E/543/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1918, "atom1_serNum": 16696, "atom2_serNum": 17142, "donAcc_type": "acceptable", "distance": 3.135, "atom1_id": "///E/541/O", "atom2_id": "///E/598/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1919, "atom1_serNum": 16696, "atom2_serNum": 17151, "donAcc_type": "standard", "distance": 3.268, "atom1_id": "///E/541/O", "atom2_id": "///E/600/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1920, "atom1_serNum": 16704, "atom2_serNum": 16821, "donAcc_type": "standard", "distance": 3.138, "atom1_id": "///E/542/O", "atom2_id": "///E/557/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1921, "atom1_serNum": 16714, "atom2_serNum": 16806, "donAcc_type": "standard", "distance": 3.214, "atom1_id": "///E/544/N", "atom2_id": "///E/555/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1922, "atom1_serNum": 16755, "atom2_serNum": 16780, "donAcc_type": "standard", "distance": 2.878, "atom1_id": "///E/548/N", "atom2_id": "///E/551/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1923, "atom1_serNum": 16775, "atom2_serNum": 17010, "donAcc_type": "standard", "distance": 2.865, "atom1_id": "///E/550/OD1", "atom2_id": "///E/580/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1924, "atom1_serNum": 16792, "atom2_serNum": 16803, "donAcc_type": "standard", "distance": 3.085, "atom1_id": "///E/553/O", "atom2_id": "///E/555/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1925, "atom1_serNum": 16795, "atom2_serNum": 17055, "donAcc_type": "standard", "distance": 3.639, "atom1_id": "///E/554/N", "atom2_id": "///E/587/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1926, "atom1_serNum": 16798, "atom2_serNum": 16813, "donAcc_type": "standard", "distance": 3.095, "atom1_id": "///E/554/O", "atom2_id": "///E/556/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1927, "atom1_serNum": 16798, "atom2_serNum": 17067, "donAcc_type": "standard", "distance": 3.587, "atom1_id": "///E/554/O", "atom2_id": "///E/589/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1928, "atom1_serNum": 16824, "atom2_serNum": 16844, "donAcc_type": "standard", "distance": 2.872, "atom1_id": "///E/557/O", "atom2_id": "///E/560/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1929, "atom1_serNum": 16835, "atom2_serNum": 16837, "donAcc_type": "acceptable", "distance": 3.082, "atom1_id": "///E/558/O", "atom2_id": "///E/558/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1930, "atom1_serNum": 16847, "atom2_serNum": 16874, "donAcc_type": "standard", "distance": 2.935, "atom1_id": "///E/560/O", "atom2_id": "///E/563/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1931, "atom1_serNum": 16856, "atom2_serNum": 16882, "donAcc_type": "standard", "distance": 3.144, "atom1_id": "///E/561/O", "atom2_id": "///E/564/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1932, "atom1_serNum": 16877, "atom2_serNum": 16890, "donAcc_type": "standard", "distance": 3.131, "atom1_id": "///E/563/O", "atom2_id": "///E/565/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1933, "atom1_serNum": 16893, "atom2_serNum": 16913, "donAcc_type": "standard", "distance": 2.924, "atom1_id": "///E/565/O", "atom2_id": "///E/568/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1934, "atom1_serNum": 16893, "atom2_serNum": 16918, "donAcc_type": "standard", "distance": 2.975, "atom1_id": "///E/565/O", "atom2_id": "///E/569/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1935, "atom1_serNum": 16901, "atom2_serNum": 16927, "donAcc_type": "standard", "distance": 2.842, "atom1_id": "///E/566/O", "atom2_id": "///E/570/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1936, "atom1_serNum": 16916, "atom2_serNum": 16945, "donAcc_type": "standard", "distance": 2.814, "atom1_id": "///E/568/O", "atom2_id": "///E/572/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1937, "atom1_serNum": 16921, "atom2_serNum": 16953, "donAcc_type": "standard", "distance": 2.677, "atom1_id": "///E/569/O", "atom2_id": "///E/573/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1938, "atom1_serNum": 16925, "atom2_serNum": 17059, "donAcc_type": "standard", "distance": 2.960, "atom1_id": "///E/569/OE1", "atom2_id": "///E/588/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1939, "atom1_serNum": 16930, "atom2_serNum": 16958, "donAcc_type": "standard", "distance": 3.045, "atom1_id": "///E/570/O", "atom2_id": "///E/574/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1940, "atom1_serNum": 16939, "atom2_serNum": 16967, "donAcc_type": "standard", "distance": 3.108, "atom1_id": "///E/571/O", "atom2_id": "///E/575/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1941, "atom1_serNum": 16944, "atom2_serNum": 16965, "donAcc_type": "standard", "distance": 2.714, "atom1_id": "///E/571/NZ", "atom2_id": "///E/574/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1942, "atom1_serNum": 16948, "atom2_serNum": 16972, "donAcc_type": "standard", "distance": 2.746, "atom1_id": "///E/572/O", "atom2_id": "///E/576/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1943, "atom1_serNum": 16956, "atom2_serNum": 16980, "donAcc_type": "standard", "distance": 2.786, "atom1_id": "///E/573/O", "atom2_id": "///E/577/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1944, "atom1_serNum": 16956, "atom2_serNum": 16985, "donAcc_type": "acceptable", "distance": 2.660, "atom1_id": "///E/573/O", "atom2_id": "///E/577/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1945, "atom1_serNum": 16961, "atom2_serNum": 16986, "donAcc_type": "standard", "distance": 2.895, "atom1_id": "///E/574/O", "atom2_id": "///E/578/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1946, "atom1_serNum": 16970, "atom2_serNum": 16994, "donAcc_type": "standard", "distance": 2.919, "atom1_id": "///E/575/O", "atom2_id": "///E/579/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1947, "atom1_serNum": 16975, "atom2_serNum": 17002, "donAcc_type": "standard", "distance": 2.851, "atom1_id": "///E/576/O", "atom2_id": "///E/580/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1948, "atom1_serNum": 16983, "atom2_serNum": 17011, "donAcc_type": "standard", "distance": 2.821, "atom1_id": "///E/577/O", "atom2_id": "///E/581/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1949, "atom1_serNum": 16983, "atom2_serNum": 17015, "donAcc_type": "standard", "distance": 3.446, "atom1_id": "///E/577/O", "atom2_id": "///E/582/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1950, "atom1_serNum": 16985, "atom2_serNum": 17028, "donAcc_type": "acceptable", "distance": 3.916, "atom1_id": "///E/577/OG", "atom2_id": "///E/584/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1951, "atom1_serNum": 17018, "atom2_serNum": 17028, "donAcc_type": "standard", "distance": 3.172, "atom1_id": "///E/582/O", "atom2_id": "///E/584/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1952, "atom1_serNum": 17031, "atom2_serNum": 17044, "donAcc_type": "standard", "distance": 2.976, "atom1_id": "///E/584/O", "atom2_id": "///E/586/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1953, "atom1_serNum": 17074, "atom2_serNum": 17081, "donAcc_type": "standard", "distance": 3.016, "atom1_id": "///E/590/N", "atom2_id": "///E/590/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1954, "atom1_serNum": 17089, "atom2_serNum": 17099, "donAcc_type": "standard", "distance": 3.438, "atom1_id": "///E/591/OD1", "atom2_id": "///E/593/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1955, "atom1_serNum": 17105, "atom2_serNum": 17114, "donAcc_type": "standard", "distance": 2.906, "atom1_id": "///E/593/OD1", "atom2_id": "///E/595/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1956, "atom1_serNum": 17117, "atom2_serNum": 17135, "donAcc_type": "standard", "distance": 2.968, "atom1_id": "///E/595/O", "atom2_id": "///E/597/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1957, "atom1_serNum": 17140, "atom2_serNum": 17168, "donAcc_type": "standard", "distance": 3.247, "atom1_id": "///E/598/O", "atom2_id": "///E/602/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1958, "atom1_serNum": 17142, "atom2_serNum": 17159, "donAcc_type": "acceptable", "distance": 3.117, "atom1_id": "///E/598/OG1", "atom2_id": "///E/601/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1959, "atom1_serNum": 17154, "atom2_serNum": 17193, "donAcc_type": "standard", "distance": 3.756, "atom1_id": "///E/600/O", "atom2_id": "///E/604/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1960, "atom1_serNum": 17171, "atom2_serNum": 17207, "donAcc_type": "standard", "distance": 3.997, "atom1_id": "///E/602/O", "atom2_id": "///E/606/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1961, "atom1_serNum": 17185, "atom2_serNum": 17207, "donAcc_type": "standard", "distance": 2.851, "atom1_id": "///E/603/O", "atom2_id": "///E/606/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1962, "atom1_serNum": 17185, "atom2_serNum": 17215, "donAcc_type": "standard", "distance": 3.059, "atom1_id": "///E/603/O", "atom2_id": "///E/607/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1963, "atom1_serNum": 17196, "atom2_serNum": 17227, "donAcc_type": "standard", "distance": 3.685, "atom1_id": "///E/604/O", "atom2_id": "///E/608/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1964, "atom1_serNum": 17205, "atom2_serNum": 17236, "donAcc_type": "standard", "distance": 3.809, "atom1_id": "///E/605/O", "atom2_id": "///E/609/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1965, "atom1_serNum": 17230, "atom2_serNum": 17262, "donAcc_type": "standard", "distance": 2.986, "atom1_id": "///E/608/O", "atom2_id": "///E/612/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1966, "atom1_serNum": 17239, "atom2_serNum": 17267, "donAcc_type": "standard", "distance": 2.956, "atom1_id": "///E/609/O", "atom2_id": "///E/613/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1967, "atom1_serNum": 17248, "atom2_serNum": 17276, "donAcc_type": "standard", "distance": 3.009, "atom1_id": "///E/610/O", "atom2_id": "///E/614/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1968, "atom1_serNum": 17257, "atom2_serNum": 17281, "donAcc_type": "standard", "distance": 2.969, "atom1_id": "///E/611/O", "atom2_id": "///E/615/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1969, "atom1_serNum": 17265, "atom2_serNum": 17292, "donAcc_type": "standard", "distance": 2.967, "atom1_id": "///E/612/O", "atom2_id": "///E/616/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1970, "atom1_serNum": 17270, "atom2_serNum": 17301, "donAcc_type": "standard", "distance": 2.998, "atom1_id": "///E/613/O", "atom2_id": "///E/617/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1971, "atom1_serNum": 17274, "atom2_serNum": 17299, "donAcc_type": "questionable", "distance": 3.354, "atom1_id": "///E/613/OE1", "atom2_id": "///E/616/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1972, "atom1_serNum": 17279, "atom2_serNum": 17306, "donAcc_type": "acceptable", "distance": 2.897, "atom1_id": "///E/614/O", "atom2_id": "///E/617/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1973, "atom1_serNum": 17279, "atom2_serNum": 17307, "donAcc_type": "standard", "distance": 3.002, "atom1_id": "///E/614/O", "atom2_id": "///E/618/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1974, "atom1_serNum": 17284, "atom2_serNum": 17315, "donAcc_type": "standard", "distance": 2.905, "atom1_id": "///E/615/O", "atom2_id": "///E/619/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1975, "atom1_serNum": 17295, "atom2_serNum": 17323, "donAcc_type": "standard", "distance": 2.924, "atom1_id": "///E/616/O", "atom2_id": "///E/620/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1976, "atom1_serNum": 17304, "atom2_serNum": 17328, "donAcc_type": "standard", "distance": 3.030, "atom1_id": "///E/617/O", "atom2_id": "///E/621/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1977, "atom1_serNum": 17310, "atom2_serNum": 17328, "donAcc_type": "standard", "distance": 3.217, "atom1_id": "///E/618/O", "atom2_id": "///E/621/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1978, "atom1_serNum": 17326, "atom2_serNum": 17343, "donAcc_type": "standard", "distance": 2.662, "atom1_id": "///E/620/O", "atom2_id": "///E/622/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1979, "atom1_serNum": 17361, "atom2_serNum": 18390, "donAcc_type": "standard", "distance": 2.941, "atom1_id": "///P/1/O6", "atom2_id": "///T/37/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1980, "atom1_serNum": 17362, "atom2_serNum": 18388, "donAcc_type": "standard", "distance": 2.955, "atom1_id": "///P/1/N1", "atom2_id": "///T/37/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1981, "atom1_serNum": 17364, "atom2_serNum": 18387, "donAcc_type": "standard", "distance": 2.879, "atom1_id": "///P/1/N2", "atom2_id": "///T/37/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1982, "atom1_serNum": 17383, "atom2_serNum": 18371, "donAcc_type": "standard", "distance": 3.080, "atom1_id": "///P/2/O6", "atom2_id": "///T/36/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1983, "atom1_serNum": 17384, "atom2_serNum": 18369, "donAcc_type": "standard", "distance": 2.949, "atom1_id": "///P/2/N1", "atom2_id": "///T/36/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1984, "atom1_serNum": 17386, "atom2_serNum": 18368, "donAcc_type": "standard", "distance": 2.843, "atom1_id": "///P/2/N2", "atom2_id": "///T/36/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1985, "atom1_serNum": 17405, "atom2_serNum": 18351, "donAcc_type": "standard", "distance": 2.990, "atom1_id": "///P/3/N6", "atom2_id": "///T/35/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1986, "atom1_serNum": 17406, "atom2_serNum": 18349, "donAcc_type": "standard", "distance": 2.827, "atom1_id": "///P/3/N1", "atom2_id": "///T/35/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1987, "atom1_serNum": 17426, "atom2_serNum": 18332, "donAcc_type": "standard", "distance": 2.958, "atom1_id": "///P/4/O6", "atom2_id": "///T/34/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1988, "atom1_serNum": 17427, "atom2_serNum": 18330, "donAcc_type": "standard", "distance": 2.887, "atom1_id": "///P/4/N1", "atom2_id": "///T/34/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1989, "atom1_serNum": 17429, "atom2_serNum": 18329, "donAcc_type": "standard", "distance": 2.874, "atom1_id": "///P/4/N2", "atom2_id": "///T/34/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1990, "atom1_serNum": 17429, "atom2_serNum": 18348, "donAcc_type": "standard", "distance": 2.528, "atom1_id": "///P/4/N2", "atom2_id": "///T/35/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1991, "atom1_serNum": 17446, "atom2_serNum": 18312, "donAcc_type": "standard", "distance": 2.817, "atom1_id": "///P/5/N3", "atom2_id": "///T/33/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1992, "atom1_serNum": 17448, "atom2_serNum": 18311, "donAcc_type": "standard", "distance": 2.973, "atom1_id": "///P/5/O4", "atom2_id": "///T/33/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1993, "atom1_serNum": 17468, "atom2_serNum": 18291, "donAcc_type": "standard", "distance": 2.929, "atom1_id": "///P/6/N6", "atom2_id": "///T/32/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1994, "atom1_serNum": 17469, "atom2_serNum": 18289, "donAcc_type": "standard", "distance": 2.852, "atom1_id": "///P/6/N1", "atom2_id": "///T/32/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1995, "atom1_serNum": 17489, "atom2_serNum": 18272, "donAcc_type": "standard", "distance": 2.924, "atom1_id": "///P/7/O6", "atom2_id": "///T/31/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1996, "atom1_serNum": 17490, "atom2_serNum": 18270, "donAcc_type": "standard", "distance": 2.898, "atom1_id": "///P/7/N1", "atom2_id": "///T/31/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1997, "atom1_serNum": 17492, "atom2_serNum": 18269, "donAcc_type": "standard", "distance": 2.839, "atom1_id": "///P/7/N2", "atom2_id": "///T/31/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1998, "atom1_serNum": 17492, "atom2_serNum": 18288, "donAcc_type": "standard", "distance": 2.703, "atom1_id": "///P/7/N2", "atom2_id": "///T/32/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1999, "atom1_serNum": 17509, "atom2_serNum": 18252, "donAcc_type": "standard", "distance": 2.816, "atom1_id": "///P/8/N3", "atom2_id": "///T/30/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 2000, "atom1_serNum": 17511, "atom2_serNum": 18251, "donAcc_type": "standard", "distance": 2.951, "atom1_id": "///P/8/O4", "atom2_id": "///T/30/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 2001, "atom1_serNum": 17531, "atom2_serNum": 18231, "donAcc_type": "standard", "distance": 2.964, "atom1_id": "///P/9/N6", "atom2_id": "///T/29/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 2002, "atom1_serNum": 17532, "atom2_serNum": 18229, "donAcc_type": "standard", "distance": 2.799, "atom1_id": "///P/9/N1", "atom2_id": "///T/29/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 2003, "atom1_serNum": 17549, "atom2_serNum": 18212, "donAcc_type": "standard", "distance": 2.825, "atom1_id": "///P/10/O2", "atom2_id": "///T/28/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 2004, "atom1_serNum": 17550, "atom2_serNum": 18210, "donAcc_type": "standard", "distance": 2.916, "atom1_id": "///P/10/N3", "atom2_id": "///T/28/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 2005, "atom1_serNum": 17552, "atom2_serNum": 18209, "donAcc_type": "standard", "distance": 2.951, "atom1_id": "///P/10/N4", "atom2_id": "///T/28/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 2006, "atom1_serNum": 17569, "atom2_serNum": 18189, "donAcc_type": "standard", "distance": 2.816, "atom1_id": "///P/11/N3", "atom2_id": "///T/27/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 2007, "atom1_serNum": 17571, "atom2_serNum": 18188, "donAcc_type": "standard", "distance": 2.976, "atom1_id": "///P/11/O4", "atom2_id": "///T/27/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 2008, "atom1_serNum": 17591, "atom2_serNum": 18168, "donAcc_type": "standard", "distance": 2.989, "atom1_id": "///P/12/N6", "atom2_id": "///T/26/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 2009, "atom1_serNum": 17592, "atom2_serNum": 18166, "donAcc_type": "standard", "distance": 2.799, "atom1_id": "///P/12/N1", "atom2_id": "///T/26/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 2010, "atom1_serNum": 17612, "atom2_serNum": 18149, "donAcc_type": "standard", "distance": 2.936, "atom1_id": "///P/13/O6", "atom2_id": "///T/25/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 2011, "atom1_serNum": 17613, "atom2_serNum": 18147, "donAcc_type": "standard", "distance": 2.927, "atom1_id": "///P/13/N1", "atom2_id": "///T/25/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 2012, "atom1_serNum": 17615, "atom2_serNum": 18146, "donAcc_type": "standard", "distance": 2.847, "atom1_id": "///P/13/N2", "atom2_id": "///T/25/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 2013, "atom1_serNum": 17634, "atom2_serNum": 18130, "donAcc_type": "standard", "distance": 2.918, "atom1_id": "///P/14/O6", "atom2_id": "///T/24/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 2014, "atom1_serNum": 17635, "atom2_serNum": 18128, "donAcc_type": "standard", "distance": 2.921, "atom1_id": "///P/14/N1", "atom2_id": "///T/24/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 2015, "atom1_serNum": 17637, "atom2_serNum": 18127, "donAcc_type": "standard", "distance": 2.867, "atom1_id": "///P/14/N2", "atom2_id": "///T/24/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 2016, "atom1_serNum": 17656, "atom2_serNum": 18110, "donAcc_type": "standard", "distance": 2.942, "atom1_id": "///P/15/N6", "atom2_id": "///T/23/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 2017, "atom1_serNum": 17657, "atom2_serNum": 18108, "donAcc_type": "standard", "distance": 2.834, "atom1_id": "///P/15/N1", "atom2_id": "///T/23/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 2018, "atom1_serNum": 17674, "atom2_serNum": 18091, "donAcc_type": "standard", "distance": 2.851, "atom1_id": "///P/16/O2", "atom2_id": "///T/22/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 2019, "atom1_serNum": 17675, "atom2_serNum": 18089, "donAcc_type": "standard", "distance": 2.938, "atom1_id": "///P/16/N3", "atom2_id": "///T/22/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 2020, "atom1_serNum": 17677, "atom2_serNum": 18088, "donAcc_type": "standard", "distance": 2.925, "atom1_id": "///P/16/N4", "atom2_id": "///T/22/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 2021, "atom1_serNum": 17696, "atom2_serNum": 18069, "donAcc_type": "standard", "distance": 2.902, "atom1_id": "///P/17/O6", "atom2_id": "///T/21/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 2022, "atom1_serNum": 17697, "atom2_serNum": 18067, "donAcc_type": "standard", "distance": 2.943, "atom1_id": "///P/17/N1", "atom2_id": "///T/21/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 2023, "atom1_serNum": 17699, "atom2_serNum": 18066, "donAcc_type": "standard", "distance": 2.884, "atom1_id": "///P/17/N2", "atom2_id": "///T/21/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 2024, "atom1_serNum": 17718, "atom2_serNum": 18049, "donAcc_type": "standard", "distance": 3.632, "atom1_id": "///P/18/N6", "atom2_id": "///T/20/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 2025, "atom1_serNum": 17719, "atom2_serNum": 18047, "donAcc_type": "standard", "distance": 3.301, "atom1_id": "///P/18/N1", "atom2_id": "///T/20/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 2026, "atom1_serNum": 17739, "atom2_serNum": 18029, "donAcc_type": "standard", "distance": 2.460, "atom1_id": "///P/19/N6", "atom2_id": "///T/19/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 2027, "atom1_serNum": 17740, "atom2_serNum": 18027, "donAcc_type": "standard", "distance": 2.605, "atom1_id": "///P/19/N1", "atom2_id": "///T/19/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 2028, "atom1_serNum": 17760, "atom2_serNum": 18010, "donAcc_type": "standard", "distance": 2.902, "atom1_id": "///P/20/O6", "atom2_id": "///T/18/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 2029, "atom1_serNum": 17761, "atom2_serNum": 18008, "donAcc_type": "standard", "distance": 2.869, "atom1_id": "///P/20/N1", "atom2_id": "///T/18/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 2030, "atom1_serNum": 17763, "atom2_serNum": 18007, "donAcc_type": "standard", "distance": 2.829, "atom1_id": "///P/20/N2", "atom2_id": "///T/18/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 2031, "atom1_serNum": 17785, "atom2_serNum": 17988, "donAcc_type": "standard", "distance": 2.970, "atom1_id": "///P/21/N2", "atom2_id": "///T/17/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 2032, "atom1_serNum": 17804, "atom2_serNum": 17971, "donAcc_type": "standard", "distance": 2.886, "atom1_id": "///P/22/N6", "atom2_id": "///T/16/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 2033, "atom1_serNum": 17805, "atom2_serNum": 17969, "donAcc_type": "standard", "distance": 2.811, "atom1_id": "///P/22/N1", "atom2_id": "///T/16/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 2034, "atom1_serNum": 17822, "atom2_serNum": 17952, "donAcc_type": "standard", "distance": 3.244, "atom1_id": "///P/23/O2", "atom2_id": "///T/15/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 2035, "atom1_serNum": 17823, "atom2_serNum": 17950, "donAcc_type": "standard", "distance": 3.502, "atom1_id": "///P/23/N3", "atom2_id": "///T/15/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 2036, "atom1_serNum": 17825, "atom2_serNum": 17949, "donAcc_type": "standard", "distance": 3.653, "atom1_id": "///P/23/N4", "atom2_id": "///T/15/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 2037, "atom1_serNum": 17842, "atom2_serNum": 17929, "donAcc_type": "standard", "distance": 2.786, "atom1_id": "///P/24/N3", "atom2_id": "///T/14/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 2038, "atom1_serNum": 17844, "atom2_serNum": 17928, "donAcc_type": "standard", "distance": 2.898, "atom1_id": "///P/24/O4", "atom2_id": "///T/14/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 2039, "atom1_serNum": 17861, "atom2_serNum": 17907, "donAcc_type": "standard", "distance": 2.707, "atom1_id": "///P/25/O2", "atom2_id": "///T/13/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 2040, "atom1_serNum": 17862, "atom2_serNum": 17907, "donAcc_type": "standard", "distance": 3.025, "atom1_id": "///P/25/N3", "atom2_id": "///T/13/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 2041, "atom1_serNum": 17864, "atom2_serNum": 17906, "donAcc_type": "standard", "distance": 2.739, "atom1_id": "///P/25/N4", "atom2_id": "///T/13/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" } ], "refCoords": { "purine": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 -0.5000 0.4000", " 3 N -2.2500 -0.5000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 1.2500 5.0000 0.4000", " 6 C 1.2500 -0.5000 0.4000", " 7 C 1.2500 -0.5000 -0.4000", " 8 C 1.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 -0.5000 0.4000", " 11 C -2.2500 -0.5000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ], "pyrimidine": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 1.0000 0.4000", " 3 N -2.2500 1.0000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 1.2500 5.0000 0.4000", " 6 C 1.2500 1.0000 0.4000", " 7 C 1.2500 1.0000 -0.4000", " 8 C 1.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 1.0000 0.4000", " 11 C -2.2500 1.0000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ], "wc_pair": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 -5.0000 0.4000", " 3 N -2.2500 -5.0000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 2.2500 5.0000 0.4000", " 6 C 2.2500 -5.0000 0.4000", " 7 C 2.2500 -5.0000 -0.4000", " 8 C 2.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 -5.0000 0.4000", " 11 C -2.2500 -5.0000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ] }, "metadata": { "license": "http://innovation.columbia.edu/technologies/CU20391", "url": "http://x3dna.org/", "url_alt": "http://home.x3dna.org/", "forum": "http://forum.x3dna.org/", "citation": "Lu et al. (2015). 'DSSR: an integrated software tool for dissecting the spatial structure of RNA.' Nucleic Acids Res., 43(21):e142 [doi:10.1093/nar/gkv716].", "str_id": "5fkv", "num_aaChains": 5, "aaChains": "A=1145,B=366,C=366,D=219,E=117", "num_naChains": 2, "naChains": "P=25,T=26", "num_atoms": 18386, "num_waters": 0, "num_notes": 52, "notes": [ { "Aminors": "A-minor interactions (including types I and II)" }, { "Cstem_index": "stem index of the 'Canonical' helix in k-turn" }, { "Cstem_pair": "Cstem bp delineating the k-turn internal loop" }, { "Dp": "perpendicular distance of the 3' P atom to the glycosidic bond" }, { "GA_pair": "sheared G-A pair in k-turn" }, { "HtypePknot": "H-type pseudoknot" }, { "Kturn": "kink-turn (k-turn)" }, { "LW": "Leontis-Westhof" }, { "NCstem_index": "stem index of the 'Non-Canonical' helix in k-turn" }, { "NCstem_pair": "NCstem bp delineating the k-turn internal loop" }, { "Uturn": "U-turn of the UNR- or GNRA-type" }, { "aa": "amino acid" }, { "atom_pair": "symbols of the two atoms involved in an H-bond" }, { "auxfiles": "auxiliary files" }, { "glyco_bond": "conformation of base related to sugar (syn or anti)" }, { "bb_type": "backbone conformation, BI or BII" }, { "bending_angle": "angle between two helical axes" }, { "bp": "base pair" }, { "bseq": "base sequence in one-letter code" }, { "bulge": "bulge loop" }, { "coaxStacks": "coaxial stacking of stems within a helix" }, { "dbn": "dot bracket notation" }, { "desc": "description" }, { "donAcc_type": "donor/acceptor type of the atom pair in an H-bond" }, { "epsilon_zeta": "difference between epsilon and zeta torsion angles" }, { "hairpin": "hairpin loop" }, { "hbond": "hydrogen bond (H-bond)" }, { "helix": "defined by base-stacking interactions, regardless of bp type and backbone connectivity" }, { "id": "identifier" }, { "iloop": "internal loop" }, { "index": "serial number" }, { "isoCanonPairs": "isolated canonical pairs" }, { "junction": "(multi-branched) junction loop" }, { "kissingLoop": "kissing loop" }, { "multiplet": "3+ bases in a coplanar geometry" }, { "na": "nucleic acid" }, { "nonPair": "two nts not forming a pair, but with H-bonding/stacking interactions" }, { "nonStack": "nucleotide not involved in stacking interactions" }, { "nt": "nucleotide" }, { "num": "number" }, { "oArea": "overlap areas between two bases, including exocyclic atoms" }, { "oArea_ring": "overlap areas between two bases, including only ring atoms" }, { "phosContacts": "H-bonding and atom-capping interactions involving a phosphate" }, { "residue_pair": "types of the two residues involved in an H-bond" }, { "rmsd": "root-mean-squares deviation" }, { "serNum": "serial number" }, { "ssSegments": "single-stranded segments not involved in loops" }, { "ssZp": "Z-coordinate of the 3' phosphorus atom with reference to the 5' base plane" }, { "sstr": "secondary structure in dbn" }, { "stem": "helix consisting of only canonical pairs, with a continuous backbone" }, { "str_id": "structure identifier, derived from inpfile with extension removed" }, { "vert_dist": "vertical distance from an atom to a base plane" } ], "num_auxfiles": 9, "auxfiles": [ { "index": 1, "name": "dssr-pairs.pdb", "desc": "an ensemble of base pairs" }, { "index": 2, "name": "dssr-stems.pdb", "desc": "an ensemble of stems" }, { "index": 3, "name": "dssr-helices.pdb", "desc": "an ensemble of helices (coaxial stacking)" }, { "index": 4, "name": "dssr-iloops.pdb", "desc": "an ensemble of internal loops" }, { "index": 5, "name": "dssr-2ndstrs.bpseq", "desc": "secondary structure in bpseq format" }, { "index": 6, "name": "dssr-2ndstrs.ct", "desc": "secondary structure in connectivity table format" }, { "index": 7, "name": "dssr-2ndstrs.dbn", "desc": "secondary structure in dot-bracket notation" }, { "index": 8, "name": "dssr-torsions.txt", "desc": "backbone torsion angles and suite names" }, { "index": 9, "name": "dssr-stacks.pdb", "desc": "an ensemble of base stacks" } ], "time_used": "999" } }