{ "num_pairs": 38, "pairs": [ { "index": 1, "nt1": "///S/1", "nt2": "///X/3", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -110.797, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 51.918, "chi2": -147.157, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 50.349, "C1C1_dist": 10.816, "N1N9_dist": 8.976, "C6C8_dist": 9.783, "CNNC_torsion": 0.099, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.67],N1-N3(imino)[2.85]", "interBase_angle": 1.297, "planarity": 0.023, "simple_Shear": 0.120, "simple_Stretch": -0.159, "simple_Buckle": 0.793, "simple_Propeller": -1.027, "bp_simpleParams": [ 0.120, -0.159, 0.112, 0.793, -1.027, -6.584 ], "bp_params": [ 0.117, -0.161, 0.112, 0.777, -1.039, -6.584 ], "frame": { "rmsd": null, "origin": [ 29.630, -17.898, 3.514 ], "x_axis": [ -0.836, 0.501, -0.225 ], "y_axis": [ -0.375, -0.221, 0.900 ], "z_axis": [ 0.401, 0.837, 0.373 ], "quaternion": [ 0.281, 0.056, 0.557, 0.779 ] } }, { "index": 2, "nt1": "///S/2", "nt2": "///X/2", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -94.352, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 57.736, "chi2": -160.854, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 52.964, "C1C1_dist": 10.396, "N1N9_dist": 8.734, "C6C8_dist": 9.672, "CNNC_torsion": -12.766, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.75],N1(imino)-N3[2.68],N2(amino)-O2(carbonyl)[2.57]", "interBase_angle": 19.366, "planarity": 0.253, "simple_Shear": 0.475, "simple_Stretch": -0.261, "simple_Buckle": 16.576, "simple_Propeller": -10.014, "bp_simpleParams": [ 0.475, -0.261, 0.534, 16.576, -10.014, -0.096 ], "bp_params": [ 0.463, -0.283, 0.534, 16.123, -10.728, -0.095 ], "frame": { "rmsd": null, "origin": [ 30.442, -15.141, 4.394 ], "x_axis": [ -0.937, 0.216, 0.276 ], "y_axis": [ 0.136, -0.502, 0.854 ], "z_axis": [ 0.323, 0.837, 0.441 ], "quaternion": [ 0.024, 0.176, 0.498, 0.848 ] } }, { "index": 3, "nt1": "///S/3", "nt2": "///X/1", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -127.869, "conf1": "anti", "pucker1": "----", "lambda1": 55.058, "chi2": -166.665, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 55.186, "C1C1_dist": 10.215, "N1N9_dist": 8.542, "C6C8_dist": 9.526, "CNNC_torsion": -13.832, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.35],N3-N1(imino)[2.49],N4(amino)-O6(carbonyl)[2.69]", "interBase_angle": 18.674, "planarity": 0.227, "simple_Shear": 0.106, "simple_Stretch": -0.495, "simple_Buckle": 4.640, "simple_Propeller": -18.088, "bp_simpleParams": [ 0.106, -0.495, 0.184, 4.640, -18.088, 2.217 ], "bp_params": [ 0.105, -0.495, 0.184, 4.556, -18.110, 2.244 ], "frame": { "rmsd": null, "origin": [ 31.096, -11.646, 5.199 ], "x_axis": [ -0.704, -0.107, 0.703 ], "y_axis": [ 0.633, -0.542, 0.552 ], "z_axis": [ 0.322, 0.833, 0.449 ], "quaternion": [ -0.225, 0.312, 0.422, 0.821 ] } }, { "index": 4, "nt1": "///S/4", "nt2": "///Y/14", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -110.166, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 55.393, "chi2": -103.641, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.509, "C1C1_dist": 10.345, "N1N9_dist": 8.641, "C6C8_dist": 9.572, "CNNC_torsion": 0.093, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.49],N3-N1(imino)[2.60],N4(amino)-O6(carbonyl)[2.58]", "interBase_angle": 3.864, "planarity": 0.074, "simple_Shear": 0.260, "simple_Stretch": -0.456, "simple_Buckle": -1.585, "simple_Propeller": -3.524, "bp_simpleParams": [ 0.260, -0.456, -0.165, -1.585, -3.524, -0.213 ], "bp_params": [ 0.250, -0.462, -0.165, -1.661, -3.489, -0.213 ], "frame": { "rmsd": null, "origin": [ 31.779, -8.369, 6.327 ], "x_axis": [ -0.301, -0.364, 0.881 ], "y_axis": [ 0.919, -0.356, 0.167 ], "z_axis": [ 0.254, 0.861, 0.442 ], "quaternion": [ -0.443, 0.392, 0.354, 0.724 ] } }, { "index": 5, "nt1": "///S/5", "nt2": "///Y/13", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -97.462, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 56.388, "chi2": -127.146, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 50.025, "C1C1_dist": 10.379, "N1N9_dist": 8.635, "C6C8_dist": 9.498, "CNNC_torsion": -10.838, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.49],N1-N3(imino)[2.53]", "interBase_angle": 11.958, "planarity": 0.144, "simple_Shear": 0.702, "simple_Stretch": -0.380, "simple_Buckle": 11.438, "simple_Propeller": -3.487, "bp_simpleParams": [ 0.702, -0.380, 0.191, 11.438, -3.487, -3.963 ], "bp_params": [ 0.672, -0.431, 0.191, 11.156, -4.307, -3.947 ], "frame": { "rmsd": null, "origin": [ 32.944, -5.672, 7.438 ], "x_axis": [ 0.272, -0.587, 0.762 ], "y_axis": [ 0.925, -0.060, -0.376 ], "z_axis": [ 0.267, 0.807, 0.527 ], "quaternion": [ 0.659, -0.449, -0.188, -0.573 ] } }, { "index": 6, "nt1": "///S/6", "nt2": "///Y/12", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -131.545, "conf1": "anti", "pucker1": "----", "lambda1": 56.695, "chi2": -154.632, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 51.997, "C1C1_dist": 10.565, "N1N9_dist": 8.862, "C6C8_dist": 9.799, "CNNC_torsion": -5.884, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.73],N3-N1(imino)[2.89],N4(amino)-O6(carbonyl)[2.93]", "interBase_angle": 11.048, "planarity": 0.157, "simple_Shear": 0.540, "simple_Stretch": -0.188, "simple_Buckle": 9.245, "simple_Propeller": -6.049, "bp_simpleParams": [ 0.540, -0.188, 0.180, 9.245, -6.049, 0.349 ], "bp_params": [ 0.531, -0.213, 0.180, 8.952, -6.474, 0.349 ], "frame": { "rmsd": null, "origin": [ 33.462, -3.406, 10.258 ], "x_axis": [ 0.710, -0.531, 0.462 ], "y_axis": [ 0.645, 0.228, -0.729 ], "z_axis": [ 0.282, 0.816, 0.505 ], "quaternion": [ 0.782, -0.494, -0.057, -0.376 ] } }, { "index": 7, "nt1": "///S/7", "nt2": "///Y/11", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -109.132, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 54.144, "chi2": -147.501, "conf2": "anti", "pucker2": "----", "lambda2": 53.779, "C1C1_dist": 10.706, "N1N9_dist": 8.990, "C6C8_dist": 9.892, "CNNC_torsion": 3.021, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.84],N1(imino)-N3[2.91],N2(amino)-O2(carbonyl)[2.83]", "interBase_angle": 7.684, "planarity": 0.110, "simple_Shear": -0.071, "simple_Stretch": -0.115, "simple_Buckle": 7.654, "simple_Propeller": -0.671, "bp_simpleParams": [ -0.071, -0.115, 0.006, 7.654, -0.671, -1.554 ], "bp_params": [ -0.071, -0.115, 0.006, 7.656, -0.648, -1.551 ], "frame": { "rmsd": null, "origin": [ 34.276, -1.343, 12.631 ], "x_axis": [ 0.892, -0.452, -0.018 ], "y_axis": [ 0.236, 0.499, -0.834 ], "z_axis": [ 0.386, 0.739, 0.551 ], "quaternion": [ 0.858, -0.459, 0.118, -0.201 ] } }, { "index": 8, "nt1": "///S/8", "nt2": "///Y/10", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -135.431, "conf1": "anti", "pucker1": "----", "lambda1": 51.605, "chi2": -119.269, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 51.405, "C1C1_dist": 10.828, "N1N9_dist": 9.006, "C6C8_dist": 9.812, "CNNC_torsion": -9.906, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.98],N3-N1(imino)[2.87],N4(amino)-O6(carbonyl)[2.67]", "interBase_angle": 9.383, "planarity": 0.130, "simple_Shear": 0.047, "simple_Stretch": -0.204, "simple_Buckle": -5.146, "simple_Propeller": -7.846, "bp_simpleParams": [ 0.047, -0.204, 0.326, -5.146, -7.846, -6.015 ], "bp_params": [ 0.047, -0.204, 0.326, -5.161, -7.836, -6.023 ], "frame": { "rmsd": null, "origin": [ 35.249, 0.964, 15.589 ], "x_axis": [ 0.862, -0.176, -0.475 ], "y_axis": [ -0.262, 0.647, -0.716 ], "z_axis": [ 0.434, 0.742, 0.512 ], "quaternion": [ 0.869, -0.419, 0.262, 0.025 ] } }, { "index": 9, "nt1": "///S/9", "nt2": "///Y/9", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -115.279, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 52.730, "chi2": -96.072, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 58.725, "C1C1_dist": 10.656, "N1N9_dist": 9.010, "C6C8_dist": 9.990, "CNNC_torsion": -0.353, "hbonds_num": 4, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.73],N3-N1(imino)[2.95],N3-N2(amino)[3.13],N4(amino)-O6(carbonyl)[3.03]", "interBase_angle": 10.760, "planarity": 0.123, "simple_Shear": -0.501, "simple_Stretch": 0.010, "simple_Buckle": -10.263, "simple_Propeller": 3.233, "bp_simpleParams": [ -0.501, 0.010, 0.368, -10.263, 3.233, 2.303 ], "bp_params": [ -0.500, -0.018, 0.368, -10.430, 2.646, 2.295 ], "frame": { "rmsd": null, "origin": [ 37.506, 3.018, 17.090 ], "x_axis": [ 0.508, 0.132, -0.851 ], "y_axis": [ -0.682, 0.666, -0.304 ], "z_axis": [ 0.526, 0.735, 0.428 ], "quaternion": [ 0.807, -0.322, 0.427, 0.252 ] } }, { "index": 10, "nt1": "///S/10", "nt2": "///Y/8", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -107.286, "conf1": "anti", "pucker1": "----", "lambda1": 52.413, "chi2": -99.736, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.304, "C1C1_dist": 10.574, "N1N9_dist": 8.806, "C6C8_dist": 9.669, "CNNC_torsion": -2.576, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.72],O4(carbonyl)-N6(amino)[2.66]", "interBase_angle": 6.739, "planarity": 0.084, "simple_Shear": -0.110, "simple_Stretch": -0.266, "simple_Buckle": -5.420, "simple_Propeller": -4.005, "bp_simpleParams": [ -0.110, -0.266, 0.054, -5.420, -4.005, -4.036 ], "bp_params": [ -0.106, -0.267, 0.054, -5.363, -4.082, -4.034 ], "frame": { "rmsd": null, "origin": [ 39.232, 5.141, 19.089 ], "x_axis": [ 0.048, 0.436, -0.899 ], "y_axis": [ -0.836, 0.510, 0.203 ], "z_axis": [ 0.547, 0.742, 0.389 ], "quaternion": [ 0.698, -0.193, 0.518, 0.456 ] } }, { "index": 11, "nt1": "///U/11", "nt2": "///V/12", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -97.430, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 55.321, "chi2": -103.588, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 45.539, "C1C1_dist": 10.691, "N1N9_dist": 8.824, "C6C8_dist": 9.569, "CNNC_torsion": 0.338, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.38],N1-N3(imino)[2.64]", "interBase_angle": 2.631, "planarity": 0.078, "simple_Shear": 0.875, "simple_Stretch": -0.324, "simple_Buckle": -0.930, "simple_Propeller": -2.461, "bp_simpleParams": [ 0.875, -0.324, -0.377, -0.930, -2.461, -9.195 ], "bp_params": [ 0.842, -0.403, -0.377, -1.152, -2.365, -9.196 ], "frame": { "rmsd": null, "origin": [ 81.316, -98.668, 47.536 ], "x_axis": [ 0.576, 0.598, 0.558 ], "y_axis": [ 0.604, 0.150, -0.783 ], "z_axis": [ -0.551, 0.788, -0.275 ], "quaternion": [ 0.602, -0.652, -0.461, -0.003 ] } }, { "index": 12, "nt1": "///U/12", "nt2": "///V/11", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -104.526, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 59.241, "chi2": -133.270, "conf2": "anti", "pucker2": "----", "lambda2": 58.682, "C1C1_dist": 10.215, "N1N9_dist": 8.707, "C6C8_dist": 9.824, "CNNC_torsion": -6.044, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[3.08],N1(imino)-N3[2.75],N2(amino)-O2(carbonyl)[2.40]", "interBase_angle": 14.160, "planarity": 0.204, "simple_Shear": -0.056, "simple_Stretch": -0.159, "simple_Buckle": 7.511, "simple_Propeller": -12.004, "bp_simpleParams": [ -0.056, -0.159, 0.019, 7.511, -12.004, 8.397 ], "bp_params": [ -0.056, -0.159, 0.019, 7.548, -11.981, 8.424 ], "frame": { "rmsd": null, "origin": [ 80.244, -95.565, 47.358 ], "x_axis": [ 0.857, 0.466, 0.219 ], "y_axis": [ 0.330, -0.171, -0.928 ], "z_axis": [ -0.395, 0.868, -0.300 ], "quaternion": [ 0.589, -0.763, -0.261, 0.058 ] } }, { "index": 13, "nt1": "///U/13", "nt2": "///V/10", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -117.052, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 54.009, "chi2": -102.858, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.282, "C1C1_dist": 10.429, "N1N9_dist": 8.694, "C6C8_dist": 9.606, "CNNC_torsion": -9.344, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.64],N1-N3(imino)[2.64]", "interBase_angle": 12.791, "planarity": 0.172, "simple_Shear": 0.141, "simple_Stretch": -0.347, "simple_Buckle": 3.130, "simple_Propeller": -12.402, "bp_simpleParams": [ 0.141, -0.347, -0.237, 3.130, -12.402, -1.473 ], "bp_params": [ 0.135, -0.350, -0.237, 2.904, -12.457, -1.482 ], "frame": { "rmsd": null, "origin": [ 78.297, -92.696, 46.700 ], "x_axis": [ 0.878, 0.288, -0.383 ], "y_axis": [ -0.251, -0.404, -0.880 ], "z_axis": [ -0.408, 0.868, -0.283 ], "quaternion": [ 0.546, -0.801, -0.011, 0.247 ] } }, { "index": 14, "nt1": "///U/14", "nt2": "///V/9", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -123.361, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 51.794, "chi2": -132.485, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.093, "C1C1_dist": 10.757, "N1N9_dist": 8.974, "C6C8_dist": 9.836, "CNNC_torsion": -4.721, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.85],N3-N1(imino)[2.84],N4(amino)-O6(carbonyl)[2.74]", "interBase_angle": 9.329, "planarity": 0.109, "simple_Shear": -0.029, "simple_Stretch": -0.189, "simple_Buckle": 2.560, "simple_Propeller": -8.971, "bp_simpleParams": [ -0.029, -0.189, 0.057, 2.560, -8.971, -3.225 ], "bp_params": [ -0.027, -0.189, 0.057, 2.627, -8.951, -3.234 ], "frame": { "rmsd": null, "origin": [ 77.758, -89.329, 46.396 ], "x_axis": [ 0.592, 0.024, -0.805 ], "y_axis": [ -0.675, -0.531, -0.512 ], "z_axis": [ -0.440, 0.847, -0.298 ], "quaternion": [ -0.437, 0.778, -0.209, -0.400 ] } }, { "index": 15, "nt1": "///U/15", "nt2": "///V/8", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -109.712, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 52.437, "chi2": -119.981, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 50.007, "C1C1_dist": 10.812, "N1N9_dist": 8.982, "C6C8_dist": 9.779, "CNNC_torsion": -16.322, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.96],O4(carbonyl)-N6(amino)[2.85]", "interBase_angle": 11.623, "planarity": 0.173, "simple_Shear": 0.382, "simple_Stretch": -0.162, "simple_Buckle": -2.379, "simple_Propeller": -11.377, "bp_simpleParams": [ 0.382, -0.162, 0.454, -2.379, -11.377, -7.242 ], "bp_params": [ 0.376, -0.176, 0.454, -2.777, -11.287, -7.275 ], "frame": { "rmsd": null, "origin": [ 76.604, -86.080, 45.822 ], "x_axis": [ 0.032, -0.303, -0.953 ], "y_axis": [ -0.894, -0.434, 0.108 ], "z_axis": [ -0.446, 0.848, -0.285 ], "quaternion": [ -0.280, 0.662, -0.452, -0.529 ] } }, { "index": 16, "nt1": "///U/16", "nt2": "///V/7", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -94.293, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 55.378, "chi2": -127.289, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 51.135, "C1C1_dist": 10.554, "N1N9_dist": 8.806, "C6C8_dist": 9.713, "CNNC_torsion": -4.999, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.73],N3-N1(imino)[2.78],N4(amino)-O6(carbonyl)[2.74]", "interBase_angle": 8.995, "planarity": 0.120, "simple_Shear": 0.482, "simple_Stretch": -0.311, "simple_Buckle": -0.171, "simple_Propeller": -8.993, "bp_simpleParams": [ 0.482, -0.311, -0.097, -0.171, -8.993, -0.904 ], "bp_params": [ 0.468, -0.332, -0.097, -0.564, -8.977, -0.907 ], "frame": { "rmsd": null, "origin": [ 75.495, -83.293, 44.372 ], "x_axis": [ -0.541, -0.425, -0.726 ], "y_axis": [ -0.764, -0.114, 0.635 ], "z_axis": [ -0.352, 0.898, -0.263 ], "quaternion": [ 0.144, -0.457, 0.650, 0.590 ] } }, { "index": 17, "nt1": "///U/17", "nt2": "///V/6", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -128.998, "conf1": "anti", "pucker1": "----", "lambda1": 53.203, "chi2": -103.916, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 57.910, "C1C1_dist": 10.641, "N1N9_dist": 8.987, "C6C8_dist": 9.986, "CNNC_torsion": -9.211, "hbonds_num": 4, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.67],N3-N1(imino)[2.93],N3-N2(amino)[3.09],N4(amino)-O6(carbonyl)[3.07]", "interBase_angle": 9.363, "planarity": 0.132, "simple_Shear": -0.502, "simple_Stretch": -0.021, "simple_Buckle": -7.414, "simple_Propeller": -5.718, "bp_simpleParams": [ -0.502, -0.021, 0.462, -7.414, -5.718, 2.714 ], "bp_params": [ -0.500, -0.048, 0.462, -7.099, -6.105, 2.713 ], "frame": { "rmsd": null, "origin": [ 74.380, -80.430, 42.789 ], "x_axis": [ -0.780, -0.505, -0.369 ], "y_axis": [ -0.459, 0.061, 0.887 ], "z_axis": [ -0.425, 0.861, -0.279 ], "quaternion": [ -0.019, -0.331, 0.728, 0.600 ] } }, { "index": 18, "nt1": "///U/18", "nt2": "///V/5", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -120.314, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 51.314, "chi2": -96.622, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 54.588, "C1C1_dist": 10.940, "N1N9_dist": 9.178, "C6C8_dist": 10.058, "CNNC_torsion": -22.616, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[3.08],O4(carbonyl)-N6(amino)[3.15]", "interBase_angle": 17.010, "planarity": 0.249, "simple_Shear": -0.282, "simple_Stretch": 0.099, "simple_Buckle": -0.169, "simple_Propeller": -17.009, "bp_simpleParams": [ -0.282, 0.099, 0.446, -0.169, -17.009, -3.877 ], "bp_params": [ -0.286, 0.090, 0.446, 0.386, -17.006, -3.920 ], "frame": { "rmsd": null, "origin": [ 73.661, -77.581, 41.558 ], "x_axis": [ -0.884, -0.419, 0.207 ], "y_axis": [ 0.048, 0.360, 0.932 ], "z_axis": [ -0.464, 0.834, -0.298 ], "quaternion": [ -0.211, -0.116, 0.797, 0.554 ] } }, { "index": 19, "nt1": "///U/19", "nt2": "///V/4", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -119.519, "conf1": "anti", "pucker1": "----", "lambda1": 58.023, "chi2": -91.598, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 62.325, "C1C1_dist": 11.128, "N1N9_dist": 9.678, "C6C8_dist": 10.897, "CNNC_torsion": -8.745, "hbonds_num": 1, "hbonds_desc": "O2(carbonyl)-N2(amino)[3.17]", "interBase_angle": 11.277, "planarity": 0.132, "simple_Shear": -0.308, "simple_Stretch": 0.949, "simple_Buckle": 6.048, "simple_Propeller": -9.518, "bp_simpleParams": [ -0.308, 0.949, -0.080, 6.048, -9.518, 13.072 ], "bp_params": [ -0.345, 0.936, -0.080, 6.409, -9.279, 13.095 ], "frame": { "rmsd": null, "origin": [ 71.335, -75.104, 41.221 ], "x_axis": [ -0.693, -0.133, 0.708 ], "y_axis": [ 0.538, 0.559, 0.631 ], "z_axis": [ -0.480, 0.819, -0.316 ], "quaternion": [ -0.371, 0.126, 0.801, 0.452 ] } }, { "index": 20, "nt1": "///V/1", "nt2": "///W/3", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -159.726, "conf1": "anti", "pucker1": "----", "lambda1": 39.736, "chi2": -121.138, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 39.375, "C1C1_dist": 12.064, "N1N9_dist": 9.795, "C6C8_dist": 10.042, "CNNC_torsion": -0.868, "hbonds_num": 1, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.43]", "interBase_angle": 9.211, "planarity": 0.099, "simple_Shear": -0.054, "simple_Stretch": 0.340, "simple_Buckle": -3.677, "simple_Propeller": -8.445, "bp_simpleParams": [ -0.054, 0.340, -0.272, -3.677, -8.445, -29.345 ], "bp_params": [ -0.055, 0.340, -0.272, -3.650, -8.457, -29.407 ], "frame": { "rmsd": null, "origin": [ 56.053, -84.379, 33.849 ], "x_axis": [ -0.742, -0.069, 0.667 ], "y_axis": [ 0.591, -0.536, 0.603 ], "z_axis": [ 0.316, 0.841, 0.438 ], "quaternion": [ -0.200, 0.298, 0.438, 0.824 ] } }, { "index": 21, "nt1": "///V/2", "nt2": "///W/2", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -139.960, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 53.219, "chi2": -122.049, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 51.312, "C1C1_dist": 10.527, "N1N9_dist": 8.732, "C6C8_dist": 9.591, "CNNC_torsion": -7.084, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.68],N3-N1(imino)[2.70],N4(amino)-O6(carbonyl)[2.59]", "interBase_angle": 4.597, "planarity": 0.164, "simple_Shear": 0.256, "simple_Stretch": -0.447, "simple_Buckle": 3.607, "simple_Propeller": -2.850, "bp_simpleParams": [ 0.256, -0.447, 0.566, 3.607, -2.850, -3.478 ], "bp_params": [ 0.247, -0.452, 0.566, 3.547, -2.925, -3.477 ], "frame": { "rmsd": null, "origin": [ 56.037, -81.384, 35.356 ], "x_axis": [ -0.381, -0.352, 0.855 ], "y_axis": [ 0.841, -0.517, 0.162 ], "z_axis": [ 0.385, 0.781, 0.493 ], "quaternion": [ -0.386, 0.401, 0.305, 0.773 ] } }, { "index": 22, "nt1": "///V/3", "nt2": "///W/1", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -156.375, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 49.806, "chi2": -105.659, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 50.850, "C1C1_dist": 10.666, "N1N9_dist": 8.787, "C6C8_dist": 9.589, "CNNC_torsion": -1.552, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.66],O4(carbonyl)-N6(amino)[2.49]", "interBase_angle": 3.448, "planarity": 0.052, "simple_Shear": -0.193, "simple_Stretch": -0.344, "simple_Buckle": -2.410, "simple_Propeller": -2.465, "bp_simpleParams": [ -0.193, -0.344, -0.089, -2.410, -2.465, -6.607 ], "bp_params": [ -0.185, -0.348, -0.089, -2.352, -2.521, -6.608 ], "frame": { "rmsd": null, "origin": [ 56.445, -78.453, 37.292 ], "x_axis": [ 0.050, -0.518, 0.854 ], "y_axis": [ 0.964, -0.198, -0.176 ], "z_axis": [ 0.260, 0.832, 0.490 ], "quaternion": [ 0.579, -0.435, -0.256, -0.640 ] } }, { "index": 23, "nt1": "///W/4", "nt2": "///T/14", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -135.006, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 44.385, "chi2": -110.256, "conf2": "anti", "pucker2": "----", "lambda2": 49.473, "C1C1_dist": 11.078, "N1N9_dist": 9.075, "C6C8_dist": 9.681, "CNNC_torsion": -9.893, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[3.29],N3-N1(imino)[2.87],N4(amino)-O6(carbonyl)[2.34]", "interBase_angle": 15.505, "planarity": 0.204, "simple_Shear": -0.509, "simple_Stretch": -0.186, "simple_Buckle": -14.789, "simple_Propeller": -4.657, "bp_simpleParams": [ -0.509, -0.186, 0.369, -14.789, -4.657, -14.518 ], "bp_params": [ -0.498, -0.212, 0.369, -14.536, -5.397, -14.419 ], "frame": { "rmsd": null, "origin": [ 54.699, -88.147, 33.472 ], "x_axis": [ -0.897, 0.252, 0.362 ], "y_axis": [ -0.173, 0.554, -0.814 ], "z_axis": [ -0.406, -0.793, -0.454 ], "quaternion": [ -0.225, 0.023, 0.852, -0.472 ] } }, { "index": 24, "nt1": "///W/5", "nt2": "///T/13", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -117.952, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 49.461, "chi2": -98.757, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 44.824, "C1C1_dist": 10.769, "N1N9_dist": 8.785, "C6C8_dist": 9.353, "CNNC_torsion": -11.217, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.08],N1-N3(imino)[2.60]", "interBase_angle": 9.608, "planarity": 0.190, "simple_Shear": 0.473, "simple_Stretch": -0.467, "simple_Buckle": -7.724, "simple_Propeller": -5.714, "bp_simpleParams": [ 0.473, -0.467, 0.400, -7.724, -5.714, -17.288 ], "bp_params": [ 0.448, -0.491, 0.400, -8.013, -5.301, -17.265 ], "frame": { "rmsd": null, "origin": [ 53.564, -90.757, 32.385 ], "x_axis": [ -0.818, 0.536, -0.209 ], "y_axis": [ 0.399, 0.269, -0.876 ], "z_axis": [ -0.414, -0.800, -0.434 ], "quaternion": [ -0.065, 0.295, 0.794, -0.528 ] } }, { "index": 25, "nt1": "///W/6", "nt2": "///T/12", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -110.870, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 46.720, "chi2": -147.809, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 51.984, "C1C1_dist": 10.795, "N1N9_dist": 8.894, "C6C8_dist": 9.615, "CNNC_torsion": -2.230, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.93],N3-N1(imino)[2.70],N4(amino)-O6(carbonyl)[2.33]", "interBase_angle": 5.719, "planarity": 0.113, "simple_Shear": -0.395, "simple_Stretch": -0.360, "simple_Buckle": 5.703, "simple_Propeller": -0.438, "bp_simpleParams": [ -0.395, -0.360, 0.190, 5.703, -0.438, -9.494 ], "bp_params": [ -0.379, -0.377, 0.190, 5.716, -0.192, -9.482 ], "frame": { "rmsd": null, "origin": [ 51.170, -92.953, 31.894 ], "x_axis": [ -0.500, 0.580, -0.643 ], "y_axis": [ 0.746, -0.089, -0.660 ], "z_axis": [ -0.440, -0.809, -0.389 ], "quaternion": [ 0.076, 0.494, 0.671, -0.548 ] } }, { "index": 26, "nt1": "///W/7", "nt2": "///T/11", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -118.996, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 52.037, "chi2": -147.285, "conf2": "anti", "pucker2": "----", "lambda2": 47.418, "C1C1_dist": 10.839, "N1N9_dist": 8.955, "C6C8_dist": 9.678, "CNNC_torsion": -4.483, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.39],N1(imino)-N3[2.75],N2(amino)-O2(carbonyl)[2.99]", "interBase_angle": 6.861, "planarity": 0.086, "simple_Shear": 0.324, "simple_Stretch": -0.303, "simple_Buckle": 6.664, "simple_Propeller": -1.633, "bp_simpleParams": [ 0.324, -0.303, 0.298, 6.664, -1.633, -9.485 ], "bp_params": [ 0.313, -0.315, 0.298, 6.602, -1.869, -9.471 ], "frame": { "rmsd": null, "origin": [ 48.947, -95.033, 30.527 ], "x_axis": [ 0.053, 0.429, -0.902 ], "y_axis": [ 0.882, -0.444, -0.159 ], "z_axis": [ -0.469, -0.787, -0.402 ], "quaternion": [ 0.228, 0.689, 0.476, -0.497 ] } }, { "index": 27, "nt1": "///W/8", "nt2": "///T/10", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -132.643, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 51.825, "chi2": -127.925, "conf2": "anti", "pucker2": "----", "lambda2": 50.459, "C1C1_dist": 10.657, "N1N9_dist": 8.822, "C6C8_dist": 9.634, "CNNC_torsion": -12.218, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.78],N3-N1(imino)[2.71],N4(amino)-O6(carbonyl)[2.56]", "interBase_angle": 8.256, "planarity": 0.134, "simple_Shear": 0.175, "simple_Stretch": -0.392, "simple_Buckle": -3.153, "simple_Propeller": -7.630, "bp_simpleParams": [ 0.175, -0.392, 0.445, -3.153, -7.630, -5.617 ], "bp_params": [ 0.169, -0.394, 0.445, -3.259, -7.585, -5.627 ], "frame": { "rmsd": null, "origin": [ 46.322, -97.449, 29.244 ], "x_axis": [ 0.571, 0.147, -0.808 ], "y_axis": [ 0.689, -0.620, 0.375 ], "z_axis": [ -0.445, -0.771, -0.455 ], "quaternion": [ 0.352, 0.813, 0.257, -0.385 ] } }, { "index": 28, "nt1": "///W/9", "nt2": "///T/9", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -148.987, "conf1": "anti", "pucker1": "----", "lambda1": 57.248, "chi2": -95.001, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 58.506, "C1C1_dist": 10.351, "N1N9_dist": 8.796, "C6C8_dist": 9.832, "CNNC_torsion": -9.505, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.50],N3-N1(imino)[2.84],N4(amino)-O6(carbonyl)[3.04]", "interBase_angle": 14.305, "planarity": 0.182, "simple_Shear": -0.057, "simple_Stretch": -0.145, "simple_Buckle": -14.284, "simple_Propeller": -0.772, "bp_simpleParams": [ -0.057, -0.145, 0.830, -14.284, -0.772, 4.946 ], "bp_params": [ -0.056, -0.145, 0.830, -14.276, -0.914, 4.907 ], "frame": { "rmsd": null, "origin": [ 45.166, -99.778, 26.838 ], "x_axis": [ 0.889, -0.125, -0.441 ], "y_axis": [ 0.283, -0.606, 0.743 ], "z_axis": [ -0.360, -0.785, -0.504 ], "quaternion": [ 0.441, 0.866, 0.046, -0.231 ] } }, { "index": 29, "nt1": "///W/10", "nt2": "///T/8", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -107.440, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 50.810, "chi2": -99.754, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 49.732, "C1C1_dist": 10.725, "N1N9_dist": 8.857, "C6C8_dist": 9.595, "CNNC_torsion": -2.053, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.79],O4(carbonyl)-N6(amino)[2.48]", "interBase_angle": 7.656, "planarity": 0.128, "simple_Shear": 0.162, "simple_Stretch": -0.328, "simple_Buckle": -2.837, "simple_Propeller": -7.111, "bp_simpleParams": [ 0.162, -0.328, -0.335, -2.837, -7.111, -9.139 ], "bp_params": [ 0.158, -0.330, -0.335, -2.932, -7.073, -9.153 ], "frame": { "rmsd": null, "origin": [ 43.472, -101.532, 24.873 ], "x_axis": [ 0.900, -0.433, 0.057 ], "y_axis": [ -0.303, -0.524, 0.796 ], "z_axis": [ -0.315, -0.734, -0.602 ], "quaternion": [ 0.440, 0.870, -0.212, -0.074 ] } }, { "index": 30, "nt1": "///X/4", "nt2": "///Z/19", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -106.982, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 54.868, "chi2": -104.194, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 48.514, "C1C1_dist": 11.604, "N1N9_dist": 9.794, "C6C8_dist": 10.605, "CNNC_torsion": -3.453, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[3.43],N1(imino)-N3[3.64],N2(amino)-O2(carbonyl)[3.71]", "interBase_angle": 11.306, "planarity": 0.141, "simple_Shear": 0.554, "simple_Stretch": 0.643, "simple_Buckle": -10.051, "simple_Propeller": -5.177, "bp_simpleParams": [ 0.554, 0.643, -0.046, -10.051, -5.177, -5.442 ], "bp_params": [ 0.592, 0.608, -0.046, -10.354, -4.542, -5.424 ], "frame": { "rmsd": null, "origin": [ 29.799, -21.926, -12.334 ], "x_axis": [ -0.790, 0.136, 0.597 ], "y_axis": [ 0.565, 0.540, 0.624 ], "z_axis": [ -0.238, 0.830, -0.504 ], "quaternion": [ -0.248, 0.208, 0.842, 0.432 ] } }, { "index": 31, "nt1": "///X/5", "nt2": "///Z/18", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -90.335, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 50.844, "chi2": -124.598, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 48.926, "C1C1_dist": 10.989, "N1N9_dist": 9.096, "C6C8_dist": 9.860, "CNNC_torsion": -19.624, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.80],N1-N3(imino)[2.97]", "interBase_angle": 14.018, "planarity": 0.202, "simple_Shear": 0.037, "simple_Stretch": -0.070, "simple_Buckle": -2.874, "simple_Propeller": -13.720, "bp_simpleParams": [ 0.037, -0.070, 0.235, -2.874, -13.720, -8.552 ], "bp_params": [ 0.036, -0.071, 0.235, -2.980, -13.697, -8.610 ], "frame": { "rmsd": null, "origin": [ 29.153, -19.420, -14.366 ], "x_axis": [ -0.343, 0.436, 0.832 ], "y_axis": [ 0.911, 0.370, 0.181 ], "z_axis": [ -0.229, 0.820, -0.524 ], "quaternion": [ -0.355, 0.451, 0.748, 0.335 ] } }, { "index": 32, "nt1": "///X/6", "nt2": "///Z/17", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -109.987, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 57.568, "chi2": -119.086, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 51.742, "C1C1_dist": 10.744, "N1N9_dist": 9.054, "C6C8_dist": 10.017, "CNNC_torsion": -10.298, "hbonds_num": 4, "hbonds_desc": "O6(carbonyl)-N4(amino)[3.03],N1(imino)-N3[2.95],N2(amino)-O2(carbonyl)[2.78],N2(amino)-N3[3.12]", "interBase_angle": 8.894, "planarity": 0.124, "simple_Shear": 0.553, "simple_Stretch": -0.004, "simple_Buckle": 1.411, "simple_Propeller": -8.781, "bp_simpleParams": [ 0.553, -0.004, 0.287, 1.411, -8.781, 0.932 ], "bp_params": [ 0.552, -0.037, 0.287, 0.884, -8.850, 0.935 ], "frame": { "rmsd": null, "origin": [ 28.181, -16.566, -15.408 ], "x_axis": [ 0.269, 0.477, 0.837 ], "y_axis": [ 0.931, 0.093, -0.353 ], "z_axis": [ -0.246, 0.874, -0.419 ], "quaternion": [ -0.486, 0.632, 0.557, 0.234 ] } }, { "index": 33, "nt1": "///X/7", "nt2": "///Z/16", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -111.622, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 51.724, "chi2": -105.629, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.686, "C1C1_dist": 10.529, "N1N9_dist": 8.755, "C6C8_dist": 9.624, "CNNC_torsion": -10.963, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.57],N1(imino)-N3[2.66],N2(amino)-O2(carbonyl)[2.68]", "interBase_angle": 9.677, "planarity": 0.126, "simple_Shear": -0.245, "simple_Stretch": -0.404, "simple_Buckle": 0.586, "simple_Propeller": -9.659, "bp_simpleParams": [ -0.245, -0.404, 0.063, 0.586, -9.659, -2.904 ], "bp_params": [ -0.236, -0.409, 0.063, 0.782, -9.645, -2.914 ], "frame": { "rmsd": null, "origin": [ 26.664, -13.757, -16.873 ], "x_axis": [ 0.683, 0.429, 0.592 ], "y_axis": [ 0.701, -0.157, -0.695 ], "z_axis": [ -0.205, 0.890, -0.408 ], "quaternion": [ 0.529, -0.750, -0.377, -0.129 ] } }, { "index": 34, "nt1": "///X/8", "nt2": "///Z/15", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -102.747, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 49.131, "chi2": -99.705, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 54.759, "C1C1_dist": 10.760, "N1N9_dist": 8.962, "C6C8_dist": 9.795, "CNNC_torsion": -11.058, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.89],N1-N3(imino)[3.00]", "interBase_angle": 8.447, "planarity": 0.113, "simple_Shear": -0.606, "simple_Stretch": -0.133, "simple_Buckle": -0.817, "simple_Propeller": -8.408, "bp_simpleParams": [ -0.606, -0.133, 0.055, -0.817, -8.408, -5.163 ], "bp_params": [ -0.598, -0.167, 0.055, -0.336, -8.440, -5.177 ], "frame": { "rmsd": null, "origin": [ 25.490, -10.856, -18.204 ], "x_axis": [ 0.954, 0.286, 0.089 ], "y_axis": [ 0.205, -0.404, -0.891 ], "z_axis": [ -0.219, 0.869, -0.444 ], "quaternion": [ 0.526, -0.837, -0.146, 0.039 ] } }, { "index": 35, "nt1": "///X/9", "nt2": "///Z/14", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -91.663, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 54.478, "chi2": -104.144, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 52.730, "C1C1_dist": 10.729, "N1N9_dist": 8.991, "C6C8_dist": 9.873, "CNNC_torsion": -2.959, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.77],N1(imino)-N3[2.90],N2(amino)-O2(carbonyl)[2.92]", "interBase_angle": 8.314, "planarity": 0.144, "simple_Shear": 0.016, "simple_Stretch": -0.167, "simple_Buckle": -0.452, "simple_Propeller": -8.302, "bp_simpleParams": [ 0.016, -0.167, -0.428, -0.452, -8.302, -2.084 ], "bp_params": [ 0.015, -0.167, -0.428, -0.501, -8.299, -2.089 ], "frame": { "rmsd": null, "origin": [ 25.201, -7.816, -19.540 ], "x_axis": [ 0.861, -0.071, -0.504 ], "y_axis": [ -0.480, -0.440, -0.759 ], "z_axis": [ -0.167, 0.895, -0.413 ], "quaternion": [ 0.502, -0.824, 0.167, 0.204 ] } }, { "index": 36, "nt1": "///X/10", "nt2": "///Z/13", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -108.519, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 51.608, "chi2": -106.541, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 54.542, "C1C1_dist": 10.501, "N1N9_dist": 8.736, "C6C8_dist": 9.608, "CNNC_torsion": -10.260, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.62],O4(carbonyl)-N6(amino)[2.58]", "interBase_angle": 11.895, "planarity": 0.149, "simple_Shear": -0.350, "simple_Stretch": -0.331, "simple_Buckle": -4.811, "simple_Propeller": -10.878, "bp_simpleParams": [ -0.350, -0.331, -0.009, -4.811, -10.878, -3.565 ], "bp_params": [ -0.337, -0.344, -0.009, -4.389, -11.055, -3.579 ], "frame": { "rmsd": null, "origin": [ 24.848, -4.459, -20.277 ], "x_axis": [ 0.483, -0.273, -0.832 ], "y_axis": [ -0.843, -0.401, -0.358 ], "z_axis": [ -0.236, 0.874, -0.424 ], "quaternion": [ -0.406, 0.760, -0.367, -0.351 ] } }, { "index": 37, "nt1": "///X/11", "nt2": "///Z/12", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -107.762, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 54.921, "chi2": -105.251, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 59.633, "C1C1_dist": 10.521, "N1N9_dist": 8.941, "C6C8_dist": 9.978, "CNNC_torsion": -10.854, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.63],N3-N1(imino)[2.90],N4(amino)-O6(carbonyl)[3.10]", "interBase_angle": 11.523, "planarity": 0.163, "simple_Shear": -0.338, "simple_Stretch": -0.016, "simple_Buckle": -8.457, "simple_Propeller": -7.826, "bp_simpleParams": [ -0.338, -0.016, 0.230, -8.457, -7.826, 4.464 ], "bp_params": [ -0.337, -0.028, 0.230, -8.170, -8.126, 4.464 ], "frame": { "rmsd": null, "origin": [ 24.619, -1.702, -22.385 ], "x_axis": [ -0.119, -0.462, -0.879 ], "y_axis": [ -0.966, -0.150, 0.210 ], "z_axis": [ -0.229, 0.874, -0.429 ], "quaternion": [ -0.275, 0.604, -0.591, -0.458 ] } }, { "index": 38, "nt1": "///X/12", "nt2": "///Z/11", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -80.670, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 47.324, "chi2": -117.443, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 56.388, "C1C1_dist": 10.992, "N1N9_dist": 9.185, "C6C8_dist": 9.995, "CNNC_torsion": 6.262, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[3.05],O4(carbonyl)-N6(amino)[2.92]", "interBase_angle": 7.722, "planarity": 0.103, "simple_Shear": -0.933, "simple_Stretch": 0.115, "simple_Buckle": 7.689, "simple_Propeller": -0.713, "bp_simpleParams": [ -0.933, 0.115, -0.393, 7.689, -0.713, -6.230 ], "bp_params": [ -0.940, 0.023, -0.393, 7.722, 0.044, -6.216 ], "frame": { "rmsd": null, "origin": [ 24.464, 1.063, -23.514 ], "x_axis": [ -0.485, -0.581, -0.654 ], "y_axis": [ -0.851, 0.140, 0.506 ], "z_axis": [ -0.203, 0.802, -0.562 ], "quaternion": [ 0.152, -0.484, 0.739, 0.442 ] } } ], "num_helices": 4, "helices": [ { "index": 1, "num_stems": 2, "strand1": "AGCCACGCCT", "strand2": "TCGGTGCGGA", "bp_type": "||||||||||", "helix_form": ".BxBBB.BB", "helical_rise": 3.227, "helical_rise_std": 0.376, "helical_radius": 9.777, "helical_radius_std": 0.633, "helical_axis": [ 0.400, 0.787, 0.470 ], "point1": [ 27.915, -16.926, 3.620 ], "point2": [ 39.528, 5.900, 17.263 ], "num_pairs": 10, "pairs": [ { "index": 1, "nt1": "///S/1", "nt2": "///X/3", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.117, -0.161, 0.112, 0.777, -1.039, -6.584 ], "step_params": [ 0.337, -0.371, 2.964, -4.138, 4.288, 33.810 ], "heli_params": [ -1.229, -1.151, 2.838, 7.302, 7.047, 34.316 ], "bp2_params": [ 0.463, -0.283, 0.534, 16.123, -10.728, -0.095 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.964, "simple_Twist": 32.343, "simple_hRise": 2.830, "simple_hTwist": 32.873 }, { "index": 2, "nt1": "///S/2", "nt2": "///X/2", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.463, -0.283, 0.534, 16.123, -10.728, -0.095 ], "step_params": [ 0.055, -1.056, 3.488, -0.471, 0.278, 33.922 ], "heli_params": [ -1.857, -0.174, 3.479, 0.476, 0.807, 33.927 ], "bp2_params": [ 0.105, -0.495, 0.184, 4.556, -18.110, 2.244 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.488, "simple_Twist": 35.560, "simple_hRise": 3.479, "simple_hTwist": 35.564 }, { "index": 3, "nt1": "///S/3", "nt2": "///X/1", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.105, -0.495, 0.184, 4.556, -18.110, 2.244 ], "step_params": [ -0.261, -0.566, 3.478, 4.044, 1.307, 29.548 ], "heli_params": [ -1.385, 1.393, 3.385, 2.545, -7.877, 29.845 ], "bp2_params": [ 0.250, -0.462, -0.165, -1.661, -3.489, -0.213 ], "groove_widths": [ 14.562, null, 18.869, null ], "simple_Rise": 3.478, "simple_Twist": 28.542, "simple_hRise": 3.381, "simple_hTwist": 28.850 }, { "index": 4, "nt1": "///S/4", "nt2": "///Y/14", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.250, -0.462, -0.165, -1.661, -3.489, -0.213 ], "step_params": [ -0.400, 0.366, 3.093, -0.878, 5.723, 36.054 ], "heli_params": [ -0.173, 0.522, 3.121, 9.173, 1.407, 36.501 ], "bp2_params": [ 0.672, -0.431, 0.191, 11.156, -4.307, -3.947 ], "groove_widths": [ 15.788, 15.295, 17.165, 16.841 ], "simple_Rise": 3.093, "simple_Twist": 34.006, "simple_hRise": 3.121, "simple_hTwist": 34.480 }, { "index": 5, "nt1": "///S/5", "nt2": "///Y/13", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.672, -0.431, 0.191, 11.156, -4.307, -3.947 ], "step_params": [ 0.752, -0.993, 3.436, -1.459, -0.626, 30.997 ], "heli_params": [ -1.730, -1.699, 3.417, -1.170, 2.729, 31.037 ], "bp2_params": [ 0.531, -0.213, 0.180, 8.952, -6.474, 0.349 ], "groove_widths": [ 14.894, 14.164, 19.127, 18.886 ], "simple_Rise": 3.436, "simple_Twist": 31.738, "simple_hRise": 3.417, "simple_hTwist": 31.777 }, { "index": 6, "nt1": "///S/6", "nt2": "///Y/12", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.531, -0.213, 0.180, 8.952, -6.474, 0.349 ], "step_params": [ 0.162, -0.825, 3.138, 1.079, 7.784, 29.060 ], "heli_params": [ -3.071, -0.107, 2.830, 15.166, -2.103, 30.082 ], "bp2_params": [ -0.071, -0.115, 0.006, 7.656, -0.648, -1.551 ], "groove_widths": [ 12.953, 12.532, 19.178, 18.336 ], "simple_Rise": 3.138, "simple_Twist": 32.325, "simple_hRise": 2.870, "simple_hTwist": 33.242 }, { "index": 7, "nt1": "///S/7", "nt2": "///Y/11", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.071, -0.115, 0.006, 7.656, -0.648, -1.551 ], "step_params": [ -0.608, -1.047, 3.681, -1.866, 3.043, 30.897 ], "heli_params": [ -2.603, 0.736, 3.594, 5.688, 3.488, 31.098 ], "bp2_params": [ 0.047, -0.204, 0.326, -5.161, -7.836, -6.023 ], "groove_widths": [ 13.312, null, 19.429, null ], "simple_Rise": 3.681, "simple_Twist": 30.017, "simple_hRise": 3.590, "simple_hTwist": 30.224 }, { "index": 8, "nt1": "///S/8", "nt2": "///Y/10", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.047, -0.204, 0.326, -5.161, -7.836, -6.023 ], "step_params": [ 0.527, -0.568, 3.312, 0.342, 7.126, 34.273 ], "heli_params": [ -2.015, -0.825, 3.139, 11.933, -0.572, 34.986 ], "bp2_params": [ -0.500, -0.018, 0.368, -10.430, 2.646, 2.295 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.312, "simple_Twist": 37.318, "simple_hRise": 3.159, "simple_hTwist": 37.970 }, { "index": 9, "nt1": "///S/9", "nt2": "///Y/9", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.500, -0.018, 0.368, -10.430, 2.646, 2.295 ], "step_params": [ -0.698, -0.190, 3.310, 0.568, 2.531, 32.037 ], "heli_params": [ -0.800, 1.363, 3.273, 4.576, -1.027, 32.139 ], "bp2_params": [ -0.106, -0.267, 0.054, -5.363, -4.082, -4.034 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.310, "simple_Twist": 29.875, "simple_hRise": 3.270, "simple_hTwist": 29.985 }, { "index": 10, "nt1": "///S/10", "nt2": "///Y/8", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 2, "num_stems": 1, "strand1": "AGACTCCTC", "strand2": "TCTGAGGAG", "bp_type": "|||||||||", "helix_form": ".B.BBBBB", "helical_rise": 3.344, "helical_rise_std": 0.298, "helical_radius": 9.554, "helical_radius_std": 0.964, "helical_axis": [ -0.424, 0.846, -0.323 ], "point1": [ 82.670, -97.793, 48.712 ], "point2": [ 71.274, -75.077, 40.049 ], "num_pairs": 9, "pairs": [ { "index": 1, "nt1": "///U/11", "nt2": "///V/12", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.842, -0.403, -0.377, -1.152, -2.365, -9.196 ], "step_params": [ 0.869, -0.442, 3.140, -5.551, 8.560, 25.240 ], "heli_params": [ -2.901, -3.120, 2.607, 18.646, 12.091, 27.193 ], "bp2_params": [ -0.056, -0.159, 0.019, 7.548, -11.981, 8.424 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.140, "simple_Twist": 30.370, "simple_hRise": 2.721, "simple_hTwist": 31.999 }, { "index": 2, "nt1": "///U/12", "nt2": "///V/11", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.056, -0.159, 0.019, 7.548, -11.981, 8.424 ], "step_params": [ -0.594, -0.316, 3.465, 1.001, -0.754, 36.590 ], "heli_params": [ -0.393, 1.091, 3.454, -1.200, -1.593, 36.610 ], "bp2_params": [ 0.135, -0.350, -0.237, 2.904, -12.457, -1.482 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.465, "simple_Twist": 35.299, "simple_hRise": 3.453, "simple_hTwist": 35.321 }, { "index": 3, "nt1": "///U/13", "nt2": "///V/10", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.135, -0.350, -0.237, 2.904, -12.457, -1.482 ], "step_params": [ 0.341, -1.153, 3.204, -2.147, -1.064, 33.360 ], "heli_params": [ -1.832, -0.941, 3.211, -1.850, 3.734, 33.444 ], "bp2_params": [ -0.027, -0.189, 0.057, 2.627, -8.951, -3.234 ], "groove_widths": [ 11.171, null, 18.694, null ], "simple_Rise": 3.204, "simple_Twist": 34.186, "simple_hRise": 3.211, "simple_hTwist": 34.268 }, { "index": 4, "nt1": "///U/14", "nt2": "///V/9", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.027, -0.189, 0.057, 2.627, -8.951, -3.234 ], "step_params": [ -0.326, -0.571, 3.434, -0.077, -0.856, 38.829 ], "heli_params": [ -0.749, 0.480, 3.446, -1.287, 0.116, 38.838 ], "bp2_params": [ 0.376, -0.176, 0.454, -2.777, -11.287, -7.275 ], "groove_widths": [ 10.451, 10.365, 17.983, 17.953 ], "simple_Rise": 3.434, "simple_Twist": 36.373, "simple_hRise": 3.446, "simple_hTwist": 36.383 }, { "index": 5, "nt1": "///U/15", "nt2": "///V/8", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.376, -0.176, 0.454, -2.777, -11.287, -7.275 ], "step_params": [ 0.464, -0.369, 3.278, 5.042, -3.634, 36.453 ], "heli_params": [ -0.083, -0.040, 3.330, -5.757, -7.989, 36.962 ], "bp2_params": [ 0.468, -0.332, -0.097, -0.564, -8.977, -0.907 ], "groove_widths": [ 11.373, 11.331, 19.288, 19.226 ], "simple_Rise": 3.278, "simple_Twist": 36.154, "simple_hRise": 3.331, "simple_hTwist": 36.667 }, { "index": 6, "nt1": "///U/16", "nt2": "///V/7", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.468, -0.332, -0.097, -0.564, -8.977, -0.907 ], "step_params": [ 0.292, -0.642, 3.384, -1.965, 4.360, 24.902 ], "heli_params": [ -2.743, -1.242, 3.194, 9.992, 4.505, 25.350 ], "bp2_params": [ -0.500, -0.048, 0.462, -7.099, -6.105, 2.713 ], "groove_widths": [ 12.055, null, 18.023, null ], "simple_Rise": 3.384, "simple_Twist": 30.201, "simple_hRise": 3.236, "simple_hTwist": 30.569 }, { "index": 7, "nt1": "///U/17", "nt2": "///V/6", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.500, -0.048, 0.462, -7.099, -6.105, 2.713 ], "step_params": [ -0.653, -0.413, 3.090, 0.907, 2.802, 34.299 ], "heli_params": [ -1.106, 1.236, 3.030, 4.740, -1.535, 34.422 ], "bp2_params": [ -0.286, 0.090, 0.446, 0.386, -17.006, -3.920 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.090, "simple_Twist": 33.031, "simple_hRise": 3.027, "simple_hTwist": 33.158 }, { "index": 8, "nt1": "///U/18", "nt2": "///V/5", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.286, 0.090, 0.446, 0.386, -17.006, -3.920 ], "step_params": [ 1.033, 0.198, 3.249, 1.518, 0.482, 35.404 ], "heli_params": [ 0.254, -1.474, 3.292, 0.792, -2.494, 35.438 ], "bp2_params": [ -0.345, 0.936, -0.080, 6.409, -9.279, 13.095 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.249, "simple_Twist": 35.823, "simple_hRise": 3.291, "simple_hTwist": 35.857 }, { "index": 9, "nt1": "///U/19", "nt2": "///V/4", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 3, "num_stems": 2, "strand1": "AGCCACGCCT", "strand2": "TCGGTGCGGA", "bp_type": "||||||||||", "helix_form": "..x...BBB", "helical_rise": 3.211, "helical_rise_std": 0.260, "helical_radius": 9.948, "helical_radius_std": 0.711, "helical_axis": [ -0.389, -0.781, -0.489 ], "point1": [ 56.420, -79.526, 38.642 ], "point2": [ 45.199, -102.061, 24.549 ], "num_pairs": 10, "pairs": [ { "index": 1, "nt1": "///W/1", "nt2": "///V/3", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.185, -0.348, -0.089, 2.352, -2.521, -6.608 ], "step_params": [ -0.265, -0.712, 3.453, -7.712, -0.226, 26.794 ], "heli_params": [ -1.421, -1.421, 3.401, -0.476, 16.220, 27.863 ], "bp2_params": [ -0.247, -0.452, 0.566, -3.547, -2.925, -3.477 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.453, "simple_Twist": 29.212, "simple_hRise": 3.415, "simple_hTwist": 30.192 }, { "index": 2, "nt1": "///W/2", "nt2": "///V/2", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.247, -0.452, 0.566, -3.547, -2.925, -3.477 ], "step_params": [ -0.585, -1.052, 3.130, 6.025, 0.916, 28.730 ], "heli_params": [ -2.261, 2.364, 2.915, 1.820, -11.972, 29.356 ], "bp2_params": [ 0.055, 0.340, -0.272, 3.650, -8.457, -29.407 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.130, "simple_Twist": 27.203, "simple_hRise": 2.899, "simple_hTwist": 27.864 }, { "index": 3, "nt1": "///W/3", "nt2": "///V/1", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.055, 0.340, -0.272, 3.650, -8.457, -29.407 ], "step_params": [ 0.618, -1.338, 3.742, -4.210, 4.149, 26.834 ], "heli_params": [ -3.942, -2.440, 3.366, 8.805, 8.934, 27.466 ], "bp2_params": [ -0.498, -0.212, 0.369, -14.536, -5.397, -14.419 ], "groove_widths": [ 14.299, null, 19.283, null ], "simple_Rise": 3.742, "simple_Twist": 29.443, "simple_hRise": 3.406, "simple_hTwist": 30.018 }, { "index": 4, "nt1": "///W/4", "nt2": "///T/14", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.498, -0.212, 0.369, -14.536, -5.397, -14.419 ], "step_params": [ -0.157, -0.302, 3.028, 1.246, 0.316, 37.444 ], "heli_params": [ -0.508, 0.396, 3.019, 0.491, -1.941, 37.466 ], "bp2_params": [ 0.448, -0.491, 0.400, -8.013, -5.301, -17.265 ], "groove_widths": [ 15.165, 15.016, 17.041, 16.751 ], "simple_Rise": 3.028, "simple_Twist": 32.577, "simple_hRise": 3.017, "simple_hTwist": 32.602 }, { "index": 5, "nt1": "///W/5", "nt2": "///T/13", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.448, -0.491, 0.400, -8.013, -5.301, -17.265 ], "step_params": [ 0.561, -1.235, 2.992, 3.014, -0.411, 31.365 ], "heli_params": [ -2.203, -0.513, 3.047, -0.758, -5.559, 31.508 ], "bp2_params": [ -0.379, -0.377, 0.190, 5.716, -0.192, -9.482 ], "groove_widths": [ 14.137, 13.791, 18.176, 17.801 ], "simple_Rise": 2.992, "simple_Twist": 35.810, "simple_hRise": 3.041, "simple_hTwist": 35.935 }, { "index": 6, "nt1": "///W/6", "nt2": "///T/12", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.379, -0.377, 0.190, 5.716, -0.192, -9.482 ], "step_params": [ 0.516, -0.749, 3.211, 1.433, 1.706, 36.626 ], "heli_params": [ -1.418, -0.627, 3.191, 2.712, -2.278, 36.691 ], "bp2_params": [ 0.313, -0.315, 0.298, 6.602, -1.869, -9.471 ], "groove_widths": [ 12.023, 11.714, 19.322, 18.684 ], "simple_Rise": 3.211, "simple_Twist": 33.228, "simple_hRise": 3.188, "simple_hTwist": 33.300 }, { "index": 7, "nt1": "///W/7", "nt2": "///T/11", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.313, -0.315, 0.298, 6.602, -1.869, -9.471 ], "step_params": [ -0.437, -0.993, 3.633, -0.240, 3.433, 34.575 ], "heli_params": [ -2.239, 0.691, 3.524, 5.759, 0.402, 34.741 ], "bp2_params": [ 0.169, -0.394, 0.445, -3.259, -7.585, -5.627 ], "groove_widths": [ 12.882, null, 17.830, null ], "simple_Rise": 3.633, "simple_Twist": 35.086, "simple_hRise": 3.526, "simple_hTwist": 35.250 }, { "index": 8, "nt1": "///W/8", "nt2": "///T/10", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.169, -0.394, 0.445, -3.259, -7.585, -5.627 ], "step_params": [ 0.669, -0.544, 3.435, -1.401, 5.528, 31.833 ], "heli_params": [ -1.988, -1.458, 3.265, 9.978, 2.530, 32.327 ], "bp2_params": [ -0.056, -0.145, 0.830, -14.276, -0.914, 4.907 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.435, "simple_Twist": 32.894, "simple_hRise": 3.273, "simple_hTwist": 33.371 }, { "index": 9, "nt1": "///W/9", "nt2": "///T/9", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.056, -0.145, 0.830, -14.276, -0.914, 4.907 ], "step_params": [ -0.730, -0.550, 2.996, 6.347, 2.687, 34.027 ], "heli_params": [ -1.289, 2.090, 2.769, 4.533, -10.709, 34.698 ], "bp2_params": [ 0.158, -0.330, -0.335, -2.932, -7.073, -9.153 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.996, "simple_Twist": 32.879, "simple_hRise": 2.758, "simple_hTwist": 33.574 }, { "index": 10, "nt1": "///W/10", "nt2": "///T/8", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 4, "num_stems": 1, "strand1": "GAGGAGTCT", "strand2": "CTCCTCAGA", "bp_type": "|||||||||", "helix_form": "BBBBB.BB", "helical_rise": 3.386, "helical_rise_std": 0.297, "helical_radius": 9.411, "helical_radius_std": 0.594, "helical_axis": [ -0.226, 0.860, -0.458 ], "point1": [ 29.734, -22.392, -11.950 ], "point2": [ 23.576, 1.044, -24.420 ], "num_pairs": 9, "pairs": [ { "index": 1, "nt1": "///X/4", "nt2": "///Z/19", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.592, 0.608, -0.046, -10.354, -4.542, -5.424 ], "step_params": [ -0.389, -0.150, 3.264, 0.374, -1.355, 34.173 ], "heli_params": [ -0.042, 0.720, 3.263, -2.305, -0.637, 34.201 ], "bp2_params": [ 0.036, -0.071, 0.235, -2.980, -13.697, -8.610 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.264, "simple_Twist": 36.984, "simple_hRise": 3.263, "simple_hTwist": 37.010 }, { "index": 2, "nt1": "///X/5", "nt2": "///Z/18", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.036, -0.071, 0.235, -2.980, -13.697, -8.610 ], "step_params": [ 0.487, -0.211, 3.146, 0.757, 6.793, 35.070 ], "heli_params": [ -1.285, -0.690, 3.062, 11.142, -1.242, 35.709 ], "bp2_params": [ 0.552, -0.037, 0.287, 0.884, -8.850, 0.935 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.146, "simple_Twist": 32.306, "simple_hRise": 3.050, "simple_hTwist": 33.003 }, { "index": 3, "nt1": "///X/6", "nt2": "///Z/17", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.552, -0.037, 0.287, 0.884, -8.850, 0.935 ], "step_params": [ -0.498, -0.593, 3.426, -1.584, 2.036, 27.886 ], "heli_params": [ -1.729, 0.638, 3.398, 4.212, 3.278, 28.003 ], "bp2_params": [ -0.236, -0.409, 0.063, 0.782, -9.645, -2.914 ], "groove_widths": [ 12.455, null, 17.706, null ], "simple_Rise": 3.426, "simple_Twist": 32.125, "simple_hRise": 3.403, "simple_hTwist": 32.226 }, { "index": 4, "nt1": "///X/7", "nt2": "///Z/16", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.236, -0.409, 0.063, 0.782, -9.645, -2.914 ], "step_params": [ -0.380, -0.287, 3.368, -1.708, -1.826, 34.185 ], "heli_params": [ -0.189, 0.368, 3.392, -3.101, 2.900, 34.273 ], "bp2_params": [ -0.598, -0.167, 0.055, -0.336, -8.440, -5.177 ], "groove_widths": [ 11.891, 11.874, 18.299, 18.281 ], "simple_Rise": 3.368, "simple_Twist": 36.164, "simple_hRise": 3.391, "simple_hTwist": 36.248 }, { "index": 5, "nt1": "///X/8", "nt2": "///Z/15", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.598, -0.167, 0.055, -0.336, -8.440, -5.177 ], "step_params": [ 0.334, -0.179, 3.311, 2.666, 2.618, 40.811 ], "heli_params": [ -0.545, -0.182, 3.308, 3.745, -3.813, 40.975 ], "bp2_params": [ 0.015, -0.167, -0.428, -0.501, -8.299, -2.089 ], "groove_widths": [ 11.005, 10.985, 17.134, 17.061 ], "simple_Rise": 3.311, "simple_Twist": 37.543, "simple_hRise": 3.307, "simple_hTwist": 37.722 }, { "index": 6, "nt1": "///X/9", "nt2": "///Z/14", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.015, -0.167, -0.428, -0.501, -8.299, -2.089 ], "step_params": [ -0.307, -0.780, 3.352, -3.593, -2.095, 31.235 ], "heli_params": [ -1.032, -0.130, 3.409, -3.869, 6.636, 31.504 ], "bp2_params": [ -0.337, -0.344, -0.009, -4.389, -11.055, -3.579 ], "groove_widths": [ 10.564, null, 18.165, null ], "simple_Rise": 3.352, "simple_Twist": 33.020, "simple_hRise": 3.407, "simple_hTwist": 33.274 }, { "index": 7, "nt1": "///X/10", "nt2": "///Z/13", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.337, -0.344, -0.009, -4.389, -11.055, -3.579 ], "step_params": [ 0.785, -0.421, 3.362, 0.379, 0.309, 36.905 ], "heli_params": [ -0.709, -1.187, 3.366, 0.488, -0.599, 36.908 ], "bp2_params": [ -0.337, -0.028, 0.230, -8.170, -8.126, 4.464 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.362, "simple_Twist": 36.683, "simple_hRise": 3.366, "simple_hTwist": 36.686 }, { "index": 8, "nt1": "///X/11", "nt2": "///Z/12", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.337, -0.028, 0.230, -8.170, -8.126, 4.464 ], "step_params": [ -0.567, -0.327, 2.918, 4.170, 7.807, 24.574 ], "heli_params": [ -2.564, 2.239, 2.565, 17.627, -9.416, 26.097 ], "bp2_params": [ -0.940, 0.023, -0.393, 7.722, 0.044, -6.216 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.918, "simple_Twist": 28.049, "simple_hRise": 2.624, "simple_hTwist": 29.385 }, { "index": 9, "nt1": "///X/12", "nt2": "///Z/11", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W" } ] } ], "num_stems": 6, "stems": [ { "index": 1, "helix_index": 1, "strand1": "AGC", "strand2": "TCG", "bp_type": "|||", "helix_form": ".B", "helical_rise": 3.549, "helical_rise_std": 0.443, "helical_radius": 9.311, "helical_radius_std": 2.022, "helical_axis": [ 0.398, 0.873, 0.282 ], "point1": [ 29.020, -18.161, 4.972 ], "point2": [ 31.905, -11.823, 7.018 ], "num_pairs": 3, "pairs": [ { "index": 1, "nt1": "///S/1", "nt2": "///X/3", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.117, -0.161, 0.112, 0.777, -1.039, -6.584 ], "step_params": [ 0.337, -0.371, 2.964, -4.138, 4.288, 33.810 ], "heli_params": [ -1.229, -1.151, 2.838, 7.302, 7.047, 34.316 ], "bp2_params": [ 0.463, -0.283, 0.534, 16.123, -10.728, -0.095 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.964, "simple_Twist": 32.343, "simple_hRise": 2.830, "simple_hTwist": 32.873 }, { "index": 2, "nt1": "///S/2", "nt2": "///X/2", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.463, -0.283, 0.534, 16.123, -10.728, -0.095 ], "step_params": [ 0.055, -1.056, 3.488, -0.471, 0.278, 33.922 ], "heli_params": [ -1.857, -0.174, 3.479, 0.476, 0.807, 33.927 ], "bp2_params": [ 0.105, -0.495, 0.184, 4.556, -18.110, 2.244 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.488, "simple_Twist": 35.560, "simple_hRise": 3.479, "simple_hTwist": 35.564 }, { "index": 3, "nt1": "///S/3", "nt2": "///X/1", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 2, "helix_index": 1, "strand1": "CACGCCT", "strand2": "GTGCGGA", "bp_type": "|||||||", "helix_form": "BBB.BB", "helical_rise": 3.254, "helical_rise_std": 0.303, "helical_radius": 9.953, "helical_radius_std": 0.527, "helical_axis": [ 0.414, 0.782, 0.465 ], "point1": [ 31.658, -9.450, 8.090 ], "point2": [ 39.734, 5.822, 17.173 ], "num_pairs": 7, "pairs": [ { "index": 1, "nt1": "///S/4", "nt2": "///Y/14", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.250, -0.462, -0.165, -1.661, -3.489, -0.213 ], "step_params": [ -0.400, 0.366, 3.093, -0.878, 5.723, 36.054 ], "heli_params": [ -0.173, 0.522, 3.121, 9.173, 1.407, 36.501 ], "bp2_params": [ 0.672, -0.431, 0.191, 11.156, -4.307, -3.947 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.093, "simple_Twist": 34.006, "simple_hRise": 3.121, "simple_hTwist": 34.480 }, { "index": 2, "nt1": "///S/5", "nt2": "///Y/13", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.672, -0.431, 0.191, 11.156, -4.307, -3.947 ], "step_params": [ 0.752, -0.993, 3.436, -1.459, -0.626, 30.997 ], "heli_params": [ -1.730, -1.699, 3.417, -1.170, 2.729, 31.037 ], "bp2_params": [ 0.531, -0.213, 0.180, 8.952, -6.474, 0.349 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.436, "simple_Twist": 31.738, "simple_hRise": 3.417, "simple_hTwist": 31.777 }, { "index": 3, "nt1": "///S/6", "nt2": "///Y/12", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.531, -0.213, 0.180, 8.952, -6.474, 0.349 ], "step_params": [ 0.162, -0.825, 3.138, 1.079, 7.784, 29.060 ], "heli_params": [ -3.071, -0.107, 2.830, 15.166, -2.103, 30.082 ], "bp2_params": [ -0.071, -0.115, 0.006, 7.656, -0.648, -1.551 ], "groove_widths": [ 12.953, null, 19.178, null ], "simple_Rise": 3.138, "simple_Twist": 32.325, "simple_hRise": 2.870, "simple_hTwist": 33.242 }, { "index": 4, "nt1": "///S/7", "nt2": "///Y/11", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.071, -0.115, 0.006, 7.656, -0.648, -1.551 ], "step_params": [ -0.608, -1.047, 3.681, -1.866, 3.043, 30.897 ], "heli_params": [ -2.603, 0.736, 3.594, 5.688, 3.488, 31.098 ], "bp2_params": [ 0.047, -0.204, 0.326, -5.161, -7.836, -6.023 ], "groove_widths": [ 13.312, null, 19.429, null ], "simple_Rise": 3.681, "simple_Twist": 30.017, "simple_hRise": 3.590, "simple_hTwist": 30.224 }, { "index": 5, "nt1": "///S/8", "nt2": "///Y/10", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.047, -0.204, 0.326, -5.161, -7.836, -6.023 ], "step_params": [ 0.527, -0.568, 3.312, 0.342, 7.126, 34.273 ], "heli_params": [ -2.015, -0.825, 3.139, 11.933, -0.572, 34.986 ], "bp2_params": [ -0.500, -0.018, 0.368, -10.430, 2.646, 2.295 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.312, "simple_Twist": 37.318, "simple_hRise": 3.159, "simple_hTwist": 37.970 }, { "index": 6, "nt1": "///S/9", "nt2": "///Y/9", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.500, -0.018, 0.368, -10.430, 2.646, 2.295 ], "step_params": [ -0.698, -0.190, 3.310, 0.568, 2.531, 32.037 ], "heli_params": [ -0.800, 1.363, 3.273, 4.576, -1.027, 32.139 ], "bp2_params": [ -0.106, -0.267, 0.054, -5.363, -4.082, -4.034 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.310, "simple_Twist": 29.875, "simple_hRise": 3.270, "simple_hTwist": 29.985 }, { "index": 7, "nt1": "///S/10", "nt2": "///Y/8", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 3, "helix_index": 2, "strand1": "AGACTCCTC", "strand2": "TCTGAGGAG", "bp_type": "|||||||||", "helix_form": ".B.BBBBB", "helical_rise": 3.344, "helical_rise_std": 0.298, "helical_radius": 9.554, "helical_radius_std": 0.964, "helical_axis": [ -0.424, 0.846, -0.323 ], "point1": [ 82.670, -97.793, 48.712 ], "point2": [ 71.274, -75.077, 40.049 ], "num_pairs": 9, "pairs": [ { "index": 1, "nt1": "///U/11", "nt2": "///V/12", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.842, -0.403, -0.377, -1.152, -2.365, -9.196 ], "step_params": [ 0.869, -0.442, 3.140, -5.551, 8.560, 25.240 ], "heli_params": [ -2.901, -3.120, 2.607, 18.646, 12.091, 27.193 ], "bp2_params": [ -0.056, -0.159, 0.019, 7.548, -11.981, 8.424 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.140, "simple_Twist": 30.370, "simple_hRise": 2.721, "simple_hTwist": 31.999 }, { "index": 2, "nt1": "///U/12", "nt2": "///V/11", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.056, -0.159, 0.019, 7.548, -11.981, 8.424 ], "step_params": [ -0.594, -0.316, 3.465, 1.001, -0.754, 36.590 ], "heli_params": [ -0.393, 1.091, 3.454, -1.200, -1.593, 36.610 ], "bp2_params": [ 0.135, -0.350, -0.237, 2.904, -12.457, -1.482 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.465, "simple_Twist": 35.299, "simple_hRise": 3.453, "simple_hTwist": 35.321 }, { "index": 3, "nt1": "///U/13", "nt2": "///V/10", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.135, -0.350, -0.237, 2.904, -12.457, -1.482 ], "step_params": [ 0.341, -1.153, 3.204, -2.147, -1.064, 33.360 ], "heli_params": [ -1.832, -0.941, 3.211, -1.850, 3.734, 33.444 ], "bp2_params": [ -0.027, -0.189, 0.057, 2.627, -8.951, -3.234 ], "groove_widths": [ 11.171, null, 18.694, null ], "simple_Rise": 3.204, "simple_Twist": 34.186, "simple_hRise": 3.211, "simple_hTwist": 34.268 }, { "index": 4, "nt1": "///U/14", "nt2": "///V/9", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.027, -0.189, 0.057, 2.627, -8.951, -3.234 ], "step_params": [ -0.326, -0.571, 3.434, -0.077, -0.856, 38.829 ], "heli_params": [ -0.749, 0.480, 3.446, -1.287, 0.116, 38.838 ], "bp2_params": [ 0.376, -0.176, 0.454, -2.777, -11.287, -7.275 ], "groove_widths": [ 10.451, 10.365, 17.983, 17.953 ], "simple_Rise": 3.434, "simple_Twist": 36.373, "simple_hRise": 3.446, "simple_hTwist": 36.383 }, { "index": 5, "nt1": "///U/15", "nt2": "///V/8", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.376, -0.176, 0.454, -2.777, -11.287, -7.275 ], "step_params": [ 0.464, -0.369, 3.278, 5.042, -3.634, 36.453 ], "heli_params": [ -0.083, -0.040, 3.330, -5.757, -7.989, 36.962 ], "bp2_params": [ 0.468, -0.332, -0.097, -0.564, -8.977, -0.907 ], "groove_widths": [ 11.373, 11.331, 19.288, 19.226 ], "simple_Rise": 3.278, "simple_Twist": 36.154, "simple_hRise": 3.331, "simple_hTwist": 36.667 }, { "index": 6, "nt1": "///U/16", "nt2": "///V/7", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.468, -0.332, -0.097, -0.564, -8.977, -0.907 ], "step_params": [ 0.292, -0.642, 3.384, -1.965, 4.360, 24.902 ], "heli_params": [ -2.743, -1.242, 3.194, 9.992, 4.505, 25.350 ], "bp2_params": [ -0.500, -0.048, 0.462, -7.099, -6.105, 2.713 ], "groove_widths": [ 12.055, null, 18.023, null ], "simple_Rise": 3.384, "simple_Twist": 30.201, "simple_hRise": 3.236, "simple_hTwist": 30.569 }, { "index": 7, "nt1": "///U/17", "nt2": "///V/6", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.500, -0.048, 0.462, -7.099, -6.105, 2.713 ], "step_params": [ -0.653, -0.413, 3.090, 0.907, 2.802, 34.299 ], "heli_params": [ -1.106, 1.236, 3.030, 4.740, -1.535, 34.422 ], "bp2_params": [ -0.286, 0.090, 0.446, 0.386, -17.006, -3.920 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.090, "simple_Twist": 33.031, "simple_hRise": 3.027, "simple_hTwist": 33.158 }, { "index": 8, "nt1": "///U/18", "nt2": "///V/5", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.286, 0.090, 0.446, 0.386, -17.006, -3.920 ], "step_params": [ 1.033, 0.198, 3.249, 1.518, 0.482, 35.404 ], "heli_params": [ 0.254, -1.474, 3.292, 0.792, -2.494, 35.438 ], "bp2_params": [ -0.345, 0.936, -0.080, 6.409, -9.279, 13.095 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.249, "simple_Twist": 35.823, "simple_hRise": 3.291, "simple_hTwist": 35.857 }, { "index": 9, "nt1": "///U/19", "nt2": "///V/4", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 4, "helix_index": 3, "strand1": "GCT", "strand2": "CGA", "bp_type": "|||", "helix_form": "..", "helical_rise": 2.018, "helical_rise_std": 0.235, "helical_radius": 9.207, "helical_radius_std": 0.637, "helical_axis": [ 0.756, 0.421, 0.501 ], "point1": [ 53.303, -83.764, 37.684 ], "point2": [ 56.165, -82.168, 39.579 ], "num_pairs": 3, "pairs": [ { "index": 1, "nt1": "///V/1", "nt2": "///W/3", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.055, 0.340, -0.272, -3.650, -8.457, -29.407 ], "step_params": [ 0.585, -1.052, 3.130, -6.025, 0.916, 28.730 ], "heli_params": [ -2.261, -2.364, 2.915, 1.820, 11.972, 29.356 ], "bp2_params": [ 0.247, -0.452, 0.566, 3.547, -2.925, -3.477 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.130, "simple_Twist": 27.203, "simple_hRise": 2.899, "simple_hTwist": 27.864 }, { "index": 2, "nt1": "///V/2", "nt2": "///W/2", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.247, -0.452, 0.566, 3.547, -2.925, -3.477 ], "step_params": [ 0.265, -0.712, 3.453, 7.712, -0.226, 26.794 ], "heli_params": [ -1.421, 1.421, 3.401, -0.476, -16.220, 27.863 ], "bp2_params": [ -0.185, -0.348, -0.089, -2.352, -2.521, -6.608 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.453, "simple_Twist": 29.212, "simple_hRise": 3.415, "simple_hTwist": 30.192 }, { "index": 3, "nt1": "///V/3", "nt2": "///W/1", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 5, "helix_index": 3, "strand1": "CACGCCT", "strand2": "GTGCGGA", "bp_type": "|||||||", "helix_form": "...BBB", "helical_rise": 3.295, "helical_rise_std": 0.193, "helical_radius": 9.936, "helical_radius_std": 0.485, "helical_axis": [ -0.418, -0.772, -0.478 ], "point1": [ 53.186, -86.792, 34.132 ], "point2": [ 44.892, -102.114, 24.653 ], "num_pairs": 7, "pairs": [ { "index": 1, "nt1": "///W/4", "nt2": "///T/14", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.498, -0.212, 0.369, -14.536, -5.397, -14.419 ], "step_params": [ -0.157, -0.302, 3.028, 1.246, 0.316, 37.444 ], "heli_params": [ -0.508, 0.396, 3.019, 0.491, -1.941, 37.466 ], "bp2_params": [ 0.448, -0.491, 0.400, -8.013, -5.301, -17.265 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.028, "simple_Twist": 32.577, "simple_hRise": 3.017, "simple_hTwist": 32.602 }, { "index": 2, "nt1": "///W/5", "nt2": "///T/13", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.448, -0.491, 0.400, -8.013, -5.301, -17.265 ], "step_params": [ 0.561, -1.235, 2.992, 3.014, -0.411, 31.365 ], "heli_params": [ -2.203, -0.513, 3.047, -0.758, -5.559, 31.508 ], "bp2_params": [ -0.379, -0.377, 0.190, 5.716, -0.192, -9.482 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.992, "simple_Twist": 35.810, "simple_hRise": 3.041, "simple_hTwist": 35.935 }, { "index": 3, "nt1": "///W/6", "nt2": "///T/12", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.379, -0.377, 0.190, 5.716, -0.192, -9.482 ], "step_params": [ 0.516, -0.749, 3.211, 1.433, 1.706, 36.626 ], "heli_params": [ -1.418, -0.627, 3.191, 2.712, -2.278, 36.691 ], "bp2_params": [ 0.313, -0.315, 0.298, 6.602, -1.869, -9.471 ], "groove_widths": [ 12.023, null, 19.322, null ], "simple_Rise": 3.211, "simple_Twist": 33.228, "simple_hRise": 3.188, "simple_hTwist": 33.300 }, { "index": 4, "nt1": "///W/7", "nt2": "///T/11", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.313, -0.315, 0.298, 6.602, -1.869, -9.471 ], "step_params": [ -0.437, -0.993, 3.633, -0.240, 3.433, 34.575 ], "heli_params": [ -2.239, 0.691, 3.524, 5.759, 0.402, 34.741 ], "bp2_params": [ 0.169, -0.394, 0.445, -3.259, -7.585, -5.627 ], "groove_widths": [ 12.882, null, 17.830, null ], "simple_Rise": 3.633, "simple_Twist": 35.086, "simple_hRise": 3.526, "simple_hTwist": 35.250 }, { "index": 5, "nt1": "///W/8", "nt2": "///T/10", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.169, -0.394, 0.445, -3.259, -7.585, -5.627 ], "step_params": [ 0.669, -0.544, 3.435, -1.401, 5.528, 31.833 ], "heli_params": [ -1.988, -1.458, 3.265, 9.978, 2.530, 32.327 ], "bp2_params": [ -0.056, -0.145, 0.830, -14.276, -0.914, 4.907 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.435, "simple_Twist": 32.894, "simple_hRise": 3.273, "simple_hTwist": 33.371 }, { "index": 6, "nt1": "///W/9", "nt2": "///T/9", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.056, -0.145, 0.830, -14.276, -0.914, 4.907 ], "step_params": [ -0.730, -0.550, 2.996, 6.347, 2.687, 34.027 ], "heli_params": [ -1.289, 2.090, 2.769, 4.533, -10.709, 34.698 ], "bp2_params": [ 0.158, -0.330, -0.335, -2.932, -7.073, -9.153 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.996, "simple_Twist": 32.879, "simple_hRise": 2.758, "simple_hTwist": 33.574 }, { "index": 7, "nt1": "///W/10", "nt2": "///T/8", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 6, "helix_index": 4, "strand1": "GAGGAGTCT", "strand2": "CTCCTCAGA", "bp_type": "|||||||||", "helix_form": "BBBBB.BB", "helical_rise": 3.386, "helical_rise_std": 0.297, "helical_radius": 9.411, "helical_radius_std": 0.594, "helical_axis": [ -0.226, 0.860, -0.458 ], "point1": [ 29.734, -22.392, -11.950 ], "point2": [ 23.576, 1.044, -24.420 ], "num_pairs": 9, "pairs": [ { "index": 1, "nt1": "///X/4", "nt2": "///Z/19", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.592, 0.608, -0.046, -10.354, -4.542, -5.424 ], "step_params": [ -0.389, -0.150, 3.264, 0.374, -1.355, 34.173 ], "heli_params": [ -0.042, 0.720, 3.263, -2.305, -0.637, 34.201 ], "bp2_params": [ 0.036, -0.071, 0.235, -2.980, -13.697, -8.610 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.264, "simple_Twist": 36.984, "simple_hRise": 3.263, "simple_hTwist": 37.010 }, { "index": 2, "nt1": "///X/5", "nt2": "///Z/18", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.036, -0.071, 0.235, -2.980, -13.697, -8.610 ], "step_params": [ 0.487, -0.211, 3.146, 0.757, 6.793, 35.070 ], "heli_params": [ -1.285, -0.690, 3.062, 11.142, -1.242, 35.709 ], "bp2_params": [ 0.552, -0.037, 0.287, 0.884, -8.850, 0.935 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.146, "simple_Twist": 32.306, "simple_hRise": 3.050, "simple_hTwist": 33.003 }, { "index": 3, "nt1": "///X/6", "nt2": "///Z/17", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.552, -0.037, 0.287, 0.884, -8.850, 0.935 ], "step_params": [ -0.498, -0.593, 3.426, -1.584, 2.036, 27.886 ], "heli_params": [ -1.729, 0.638, 3.398, 4.212, 3.278, 28.003 ], "bp2_params": [ -0.236, -0.409, 0.063, 0.782, -9.645, -2.914 ], "groove_widths": [ 12.455, null, 17.706, null ], "simple_Rise": 3.426, "simple_Twist": 32.125, "simple_hRise": 3.403, "simple_hTwist": 32.226 }, { "index": 4, "nt1": "///X/7", "nt2": "///Z/16", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.236, -0.409, 0.063, 0.782, -9.645, -2.914 ], "step_params": [ -0.380, -0.287, 3.368, -1.708, -1.826, 34.185 ], "heli_params": [ -0.189, 0.368, 3.392, -3.101, 2.900, 34.273 ], "bp2_params": [ -0.598, -0.167, 0.055, -0.336, -8.440, -5.177 ], "groove_widths": [ 11.891, 11.874, 18.299, 18.281 ], "simple_Rise": 3.368, "simple_Twist": 36.164, "simple_hRise": 3.391, "simple_hTwist": 36.248 }, { "index": 5, "nt1": "///X/8", "nt2": "///Z/15", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.598, -0.167, 0.055, -0.336, -8.440, -5.177 ], "step_params": [ 0.334, -0.179, 3.311, 2.666, 2.618, 40.811 ], "heli_params": [ -0.545, -0.182, 3.308, 3.745, -3.813, 40.975 ], "bp2_params": [ 0.015, -0.167, -0.428, -0.501, -8.299, -2.089 ], "groove_widths": [ 11.005, 10.985, 17.134, 17.061 ], "simple_Rise": 3.311, "simple_Twist": 37.543, "simple_hRise": 3.307, "simple_hTwist": 37.722 }, { "index": 6, "nt1": "///X/9", "nt2": "///Z/14", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.015, -0.167, -0.428, -0.501, -8.299, -2.089 ], "step_params": [ -0.307, -0.780, 3.352, -3.593, -2.095, 31.235 ], "heli_params": [ -1.032, -0.130, 3.409, -3.869, 6.636, 31.504 ], "bp2_params": [ -0.337, -0.344, -0.009, -4.389, -11.055, -3.579 ], "groove_widths": [ 10.564, null, 18.165, null ], "simple_Rise": 3.352, "simple_Twist": 33.020, "simple_hRise": 3.407, "simple_hTwist": 33.274 }, { "index": 7, "nt1": "///X/10", "nt2": "///Z/13", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.337, -0.344, -0.009, -4.389, -11.055, -3.579 ], "step_params": [ 0.785, -0.421, 3.362, 0.379, 0.309, 36.905 ], "heli_params": [ -0.709, -1.187, 3.366, 0.488, -0.599, 36.908 ], "bp2_params": [ -0.337, -0.028, 0.230, -8.170, -8.126, 4.464 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.362, "simple_Twist": 36.683, "simple_hRise": 3.366, "simple_hTwist": 36.686 }, { "index": 8, "nt1": "///X/11", "nt2": "///Z/12", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.337, -0.028, 0.230, -8.170, -8.126, 4.464 ], "step_params": [ -0.567, -0.327, 2.918, 4.170, 7.807, 24.574 ], "heli_params": [ -2.564, 2.239, 2.565, 17.627, -9.416, 26.097 ], "bp2_params": [ -0.940, 0.023, -0.393, 7.722, 0.044, -6.216 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.918, "simple_Twist": 28.049, "simple_hRise": 2.624, "simple_hTwist": 29.385 }, { "index": 9, "nt1": "///X/12", "nt2": "///Z/11", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W" } ] } ], "num_coaxStacks": 2, "coaxStacks": [ { "index": 1, "helix_index": 1, "num_stems": 2, "stem_indices": [ 1, 2 ] }, { "index": 2, "helix_index": 3, "num_stems": 2, "stem_indices": [ 4, 5 ] } ], "num_stacks": 10, "stacks": [ { "index": 1, "num_nts": 2, "nts_short": "CC", "nts_long": "///S/3,///S/4" }, { "index": 2, "num_nts": 2, "nts_short": "CT", "nts_long": "///U/19,///U/20" }, { "index": 3, "num_nts": 2, "nts_short": "TT", "nts_long": "///U/21,///U/22" }, { "index": 4, "num_nts": 2, "nts_short": "GG", "nts_long": "///V/1,///T/14" }, { "index": 5, "num_nts": 2, "nts_short": "CC", "nts_long": "///W/3,///W/4" }, { "index": 6, "num_nts": 2, "nts_short": "GG", "nts_long": "///X/1,///Y/14" }, { "index": 7, "num_nts": 2, "nts_short": "CT", "nts_long": "///Z/19,///Z/20" }, { "index": 8, "num_nts": 2, "nts_short": "TT", "nts_long": "///Z/21,///Z/22" }, { "index": 9, "num_nts": 3, "nts_short": "ETR", "nts_long": "///A/675,///S/0,///A/706" }, { "index": 10, "num_nts": 3, "nts_short": "ETR", "nts_long": "///B/675,///W/0,///B/706" } ], "num_ssSegments": 4, "ssSegments": [ { "index": 1, "num_nts": 1, "nts_short": "T", "nts_long": "///S/0" }, { "index": 2, "num_nts": 3, "nts_short": "TTT", "nts_long": "///U/20,///U/21,///U/22" }, { "index": 3, "num_nts": 1, "nts_short": "T", "nts_long": "///W/0" }, { "index": 4, "num_nts": 3, "nts_short": "TTT", "nts_long": "///Z/20,///Z/21,///Z/22" } ], "num_splayUnits": 4, "splayUnits": [ { "index": 1, "num_nts": 2, "nts_short": "TA", "nts_long": "///S/0,///S/1" }, { "index": 2, "num_nts": 2, "nts_short": "TG", "nts_long": "///V/3,///V/4" }, { "index": 3, "num_nts": 2, "nts_short": "TA", "nts_long": "///W/0,///W/1" }, { "index": 4, "num_nts": 2, "nts_short": "TG", "nts_long": "///X/3,///X/4" } ], "pseudoknot_order": 2, "pseudoknot_nts": [ { "index": 1, "symbols": "[]", "num_nts": 20, "nts_short": "GCTAGCCACGCCTAGGCGTG", "nts_long": "///V/1,///V/2,///V/3,///W/1,///W/2,///W/3,///W/4,///W/5,///W/6,///W/7,///W/8,///W/9,///W/10,///T/8,///T/9,///T/10,///T/11,///T/12,///T/13,///T/14" }, { "index": 2, "symbols": "{}", "num_nts": 6, "nts_short": "AGCGCT", "nts_long": "///S/1,///S/2,///S/3,///X/1,///X/2,///X/3" } ], "dbn": { "all_chains": { "num_nts": 84, "num_chars": 91, "bseq": "TAGCCACGCCT&AGACTCCTCTTT&GCTGAGGAGTCT&TAGCCACGCCT&GCTGAGGAGTCT&AGACTCCTCTTT&AGGCGTG&AGGCGTG", "sstr": ".{{{(((((((&(((((((((...&[[[)))))))))&.]]][[[[[[[&}}}(((((((((&)))))))))...&)))))))&]]]]]]]", "form": ".B.BBBB..B-&BB.BBBBBB..-&...BBBBB.B.-&.B..B.BBB.-&AA..BBBB.B.-&BBBBBBBBB..-&BB...B-&BB...B-" }, "chain_S": { "num_nts": 11, "num_chars": 11, "bseq": "TAGCCACGCCT", "sstr": ".{{{(((((((", "form": ".B.BBBB..B-" }, "chain_U": { "num_nts": 12, "num_chars": 12, "bseq": "AGACTCCTCTTT", "sstr": "(((((((((...", "form": "BB.BBBBBB..-" }, "chain_V": { "num_nts": 12, "num_chars": 12, "bseq": "GCTGAGGAGTCT", "sstr": "[[[)))))))))", "form": "...BBBBB.B.-" }, "chain_W": { "num_nts": 11, "num_chars": 11, "bseq": "TAGCCACGCCT", "sstr": ".]]][[[[[[[", "form": ".B..B.BBB.-" }, "chain_X": { "num_nts": 12, "num_chars": 12, "bseq": "GCTGAGGAGTCT", "sstr": "}}}(((((((((", "form": "AA..BBBB.B.-" }, "chain_Z": { "num_nts": 12, "num_chars": 12, "bseq": "AGACTCCTCTTT", "sstr": ")))))))))...", "form": "BBBBBBBBB..-" }, "chain_Y": { "num_nts": 7, "num_chars": 7, "bseq": "AGGCGTG", "sstr": ")))))))", "form": "BB...B-" }, "chain_T": { "num_nts": 7, "num_chars": 7, "bseq": "AGGCGTG", "sstr": "]]]]]]]", "form": "BB...B-" } }, "chains": { "chain_S": { "num_nts": 11, "bseq": "TAGCCACGCCT", "sstr": ".{{{(((((((", "form": ".B.BBBB..B-", "helical_rise": 2.066, "helical_rise_std": 1.303, "helical_axis": [ 0.854, 0.427, 0.297 ], "point1": [ 24.021, -12.621, 10.067 ], "point2": [ 41.744, -3.752, 16.225 ], "num_chars": 31, "suite": "T!!A!!G!!C!!C!!A!!C!!G!!C!!C!!T" }, "chain_U": { "num_nts": 12, "bseq": "AGACTCCTCTTT", "sstr": "(((((((((...", "form": "BB.BBBBBB..-", "helical_rise": 3.384, "helical_rise_std": 0.779, "helical_axis": [ -0.501, 0.828, -0.253 ], "point1": [ 86.792, -96.498, 44.940 ], "point2": [ 68.158, -65.723, 35.550 ], "num_chars": 34, "suite": "A!!G!!A!!C!!T!!C!!C!!T!!C!!T!!T!!T" }, "chain_V": { "num_nts": 12, "bseq": "GCTGAGGAGTCT", "sstr": "[[[)))))))))", "form": "...BBBBB.B.-", "helical_rise": 0.466, "helical_rise_std": 1.774, "helical_axis": [ -0.208, 0.304, 0.930 ], "point1": [ 68.545, -89.826, 39.099 ], "point2": [ 67.424, -88.184, 44.122 ], "num_chars": 34, "suite": "G!!C!!T!!G!!A!!G!!G!!A!!G!!T!!C1bT" }, "chain_W": { "num_nts": 11, "bseq": "TAGCCACGCCT", "sstr": ".]]][[[[[[[", "form": ".B..B.BBB.-", "helical_rise": 2.193, "helical_rise_std": 1.246, "helical_axis": [ -0.175, -0.485, -0.857 ], "point1": [ 49.943, -82.848, 41.562 ], "point2": [ 46.080, -93.550, 22.682 ], "num_chars": 31, "suite": "T!!A!!G!!C!!C!!A!!C!!G!!C!!C!!T" }, "chain_X": { "num_nts": 12, "bseq": "GCTGAGGAGTCT", "sstr": "}}}(((((((((", "form": "AA..BBBB.B.-", "helical_rise": 0.039, "helical_rise_std": 1.797, "helical_axis": [ -0.897, -0.429, 0.104 ], "point1": [ 28.423, -7.626, -9.467 ], "point2": [ 27.702, -7.971, -9.383 ], "num_chars": 34, "suite": "G1aC1aT!!G!!A!!G!!G!!A!!G!!T!!C!!T" }, "chain_Z": { "num_nts": 12, "bseq": "AGACTCCTCTTT", "sstr": ")))))))))...", "form": "BBBBBBBBB..-", "helical_rise": 3.445, "helical_rise_std": 0.639, "helical_axis": [ 0.138, -0.852, 0.506 ], "point1": [ 27.601, 0.464, -27.063 ], "point2": [ 32.895, -32.107, -7.723 ], "num_chars": 34, "suite": "A!!G!!A!!C!!T!!C!!C!!T!!C!!T!!T!!T" }, "chain_Y": { "num_nts": 7, "bseq": "AGGCGTG", "sstr": ")))))))", "form": "BB...B-", "helical_rise": 3.521, "helical_rise_std": 0.143, "helical_axis": [ -0.547, -0.680, -0.488 ], "point1": [ 40.566, 4.629, 18.464 ], "point2": [ 28.904, -9.866, 8.057 ], "num_chars": 19, "suite": "A!!G!!G!!C!!G!!T!!G" }, "chain_T": { "num_nts": 7, "bseq": "AGGCGTG", "sstr": "]]]]]]]", "form": "BB...B-", "helical_rise": 3.238, "helical_rise_std": 0.156, "helical_axis": [ 0.394, 0.782, 0.483 ], "point1": [ 45.394, -101.718, 24.784 ], "point2": [ 53.051, -86.538, 34.165 ], "num_chars": 19, "suite": "A!!G!!G1aC!!G!!T!!G" } }, "num_nts": 84, "nts": [ { "index": 1, "index_chain": 1, "chain_name": "S", "nt_resnum": 0, "nt_name": "DT", "nt_code": "T", "nt_id": "///S/0", "linked_nts": [ null, "///S/1" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,non-pair-contact,ss-non-loop,phosphate,splayed-apart", "alpha": null, "beta": -138.719, "gamma": -130.540, "delta": 113.493, "epsilon": -160.043, "zeta": 67.747, "epsilon_zeta": 132.210, "bb_type": "--", "chi": -90.405, "glyco_bond": "anti", "C5prime_xyz": [ -3.356, 7.574, -2.676 ], "P_xyz": [ -4.391, 7.246, -5.078 ], "form": ".", "ssZp": 1.687, "Dp": 2.564, "splay_angle": 122.287, "splay_distance": 16.888, "splay_ratio": 0.876, "d22": null, "d64": null, "eta": null, "theta": -20.629, "eta_prime": null, "theta_prime": -58.311, "eta_base": null, "theta_base": -105.995, "v0": -32.895, "v1": 29.529, "v2": -15.495, "v3": -3.237, "v4": 22.725, "amplitude": 32.632, "phase_angle": 118.349, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.107, "frame": { "rmsd": 0.003, "origin": [ 22.302, -12.844, 17.831 ], "x_axis": [ 0.319, 0.930, -0.182 ], "y_axis": [ 0.599, -0.347, -0.722 ], "z_axis": [ -0.734, 0.121, -0.668 ], "quaternion": [ -0.276, 0.764, 0.501, -0.300 ] } }, { "index": 2, "index_chain": 2, "chain_name": "S", "nt_resnum": 1, "nt_name": "DA", "nt_code": "A", "nt_id": "///S/1", "linked_nts": [ "///S/0", "///S/2" ], "nt_type": "DNA", "dbn": "{", "summary": "pseudoknotted,anti,~C2'-endo,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,splayed-apart", "alpha": 77.700, "beta": -177.293, "gamma": 58.895, "delta": 157.715, "epsilon": -171.687, "zeta": -160.187, "epsilon_zeta": -11.500, "bb_type": "--", "chi": -110.797, "glyco_bond": "anti", "C5prime_xyz": [ -2.008, 8.299, -1.500 ], "P_xyz": [ 0.494, 8.901, -0.876 ], "form": "B", "ssZp": 2.159, "Dp": 2.130, "splay_angle": 20.023, "splay_distance": 3.239, "splay_ratio": 0.174, "d22": null, "d64": null, "eta": -32.893, "theta": -125.397, "eta_prime": 43.530, "theta_prime": -142.224, "eta_base": 89.186, "theta_base": -101.821, "v0": -20.557, "v1": 37.383, "v2": -39.346, "v3": 28.310, "v4": -5.024, "amplitude": 40.150, "phase_angle": 168.514, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.004, "origin": [ 29.633, -17.804, 3.449 ], "x_axis": [ -0.809, 0.520, -0.273 ], "y_axis": [ -0.420, -0.186, 0.888 ], "z_axis": [ 0.411, 0.834, 0.369 ], "quaternion": [ 0.306, 0.045, 0.560, 0.769 ] } }, { "index": 3, "index_chain": 3, "chain_name": "S", "nt_resnum": 2, "nt_name": "DG", "nt_code": "G", "nt_id": "///S/2", "linked_nts": [ "///S/1", "///S/3" ], "nt_type": "DNA", "dbn": "{", "summary": "pseudoknotted,anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": 30.970, "beta": 114.587, "gamma": 9.085, "delta": 142.850, "epsilon": 164.928, "zeta": -167.088, "epsilon_zeta": -27.985, "bb_type": "--", "chi": -94.352, "glyco_bond": "anti", "C5prime_xyz": [ -2.875, 7.918, -2.332 ], "P_xyz": [ -0.604, 9.202, -1.855 ], "form": ".", "ssZp": 2.337, "Dp": 2.250, "splay_angle": 21.487, "splay_distance": 3.484, "splay_ratio": 0.189, "d22": null, "d64": null, "eta": 156.852, "theta": -149.627, "eta_prime": -170.395, "theta_prime": -167.563, "eta_base": -118.156, "theta_base": -124.828, "v0": -25.536, "v1": 39.105, "v2": -36.926, "v3": 23.179, "v4": 1.266, "amplitude": 39.450, "phase_angle": 159.395, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.004, "frame": { "rmsd": 0.004, "origin": [ 30.292, -14.796, 4.454 ], "x_axis": [ -0.903, 0.297, 0.310 ], "y_axis": [ 0.185, -0.381, 0.906 ], "z_axis": [ 0.387, 0.876, 0.289 ], "quaternion": [ 0.035, 0.217, 0.555, 0.802 ] } }, { "index": 4, "index_chain": 4, "chain_name": "S", "nt_resnum": 3, "nt_name": "DC", "nt_code": "C", "nt_id": "///S/3", "linked_nts": [ "///S/2", "///S/4" ], "nt_type": "DNA", "dbn": "{", "summary": "pseudoknotted,anti,canonical,non-pair-contact,helix,stem-end,coaxial-stack", "alpha": 42.966, "beta": 98.701, "gamma": 19.797, "delta": 112.715, "epsilon": -174.049, "zeta": -136.045, "epsilon_zeta": -38.004, "bb_type": "--", "chi": -127.869, "glyco_bond": "anti", "C5prime_xyz": [ -2.722, 8.699, -1.438 ], "P_xyz": [ -0.287, 9.472, -0.756 ], "form": "B", "ssZp": 3.045, "Dp": 2.978, "splay_angle": 19.711, "splay_distance": 3.325, "splay_ratio": 0.172, "d22": 4.044, "d64": 3.820, "eta": 175.482, "theta": -144.861, "eta_prime": -177.611, "theta_prime": -149.224, "eta_base": -127.569, "theta_base": -121.472, "v0": -35.902, "v1": 26.878, "v2": -8.461, "v3": -12.211, "v4": 30.233, "amplitude": 35.221, "phase_angle": 103.900, "puckering": "O4'-endo", "sugar_class": "--", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.006, "origin": [ 30.932, -11.441, 5.140 ], "x_axis": [ -0.633, 0.017, 0.774 ], "y_axis": [ 0.660, -0.509, 0.552 ], "z_axis": [ 0.403, 0.860, 0.311 ], "quaternion": [ -0.205, 0.376, 0.451, 0.783 ] } }, { "index": 5, "index_chain": 5, "chain_name": "S", "nt_resnum": 4, "nt_name": "DC", "nt_code": "C", "nt_id": "///S/4", "linked_nts": [ "///S/3", "///S/5" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack", "alpha": 15.568, "beta": 127.094, "gamma": 17.493, "delta": 133.371, "epsilon": -170.265, "zeta": -177.726, "epsilon_zeta": 7.461, "bb_type": "--", "chi": -110.166, "glyco_bond": "anti", "C5prime_xyz": [ -2.820, 8.377, -1.857 ], "P_xyz": [ -0.598, 9.712, -1.263 ], "form": "B", "ssZp": 2.513, "Dp": 2.449, "splay_angle": 20.416, "splay_distance": 3.295, "splay_ratio": 0.181, "d22": null, "d64": null, "eta": 170.611, "theta": -157.628, "eta_prime": -165.064, "theta_prime": -156.652, "eta_base": -128.748, "theta_base": -118.433, "v0": -33.874, "v1": 41.372, "v2": -32.726, "v3": 14.017, "v4": 12.156, "amplitude": 40.491, "phase_angle": 143.923, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.005, "origin": [ 31.509, -8.403, 6.363 ], "x_axis": [ -0.294, -0.337, 0.894 ], "y_axis": [ 0.915, -0.370, 0.162 ], "z_axis": [ 0.276, 0.866, 0.417 ], "quaternion": [ -0.434, 0.406, 0.356, 0.721 ] } }, { "index": 6, "index_chain": 6, "chain_name": "S", "nt_resnum": 5, "nt_name": "DA", "nt_code": "A", "nt_id": "///S/5", "linked_nts": [ "///S/4", "///S/6" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": 35.790, "beta": 94.765, "gamma": 30.754, "delta": 132.199, "epsilon": -159.037, "zeta": -130.427, "epsilon_zeta": -28.609, "bb_type": "--", "chi": -97.462, "glyco_bond": "anti", "C5prime_xyz": [ -2.884, 7.938, -2.443 ], "P_xyz": [ -0.322, 8.501, -1.982 ], "form": "B", "ssZp": 1.730, "Dp": 1.888, "splay_angle": 20.076, "splay_distance": 3.596, "splay_ratio": 0.177, "d22": null, "d64": null, "eta": 175.813, "theta": -125.937, "eta_prime": -162.273, "theta_prime": -155.946, "eta_base": -122.880, "theta_base": -112.021, "v0": -28.616, "v1": 36.021, "v2": -29.620, "v3": 13.740, "v4": 9.244, "amplitude": 35.485, "phase_angle": 146.586, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.004, "origin": [ 32.862, -5.779, 7.825 ], "x_axis": [ 0.247, -0.557, 0.793 ], "y_axis": [ 0.955, 0.000, -0.298 ], "z_axis": [ 0.165, 0.831, 0.532 ], "quaternion": [ 0.667, -0.423, -0.235, -0.567 ] } }, { "index": 7, "index_chain": 7, "chain_name": "S", "nt_resnum": 6, "nt_name": "DC", "nt_code": "C", "nt_id": "///S/6", "linked_nts": [ "///S/5", "///S/7" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -26.368, "beta": 134.810, "gamma": 34.776, "delta": 94.317, "epsilon": 176.062, "zeta": -132.678, "epsilon_zeta": -51.260, "bb_type": "BI", "chi": -131.545, "glyco_bond": "anti", "C5prime_xyz": [ -3.160, 8.684, -1.409 ], "P_xyz": [ -1.082, 10.295, -1.599 ], "form": "B", "ssZp": 3.030, "Dp": 2.917, "splay_angle": 18.489, "splay_distance": 3.120, "splay_ratio": 0.161, "d22": null, "d64": null, "eta": 168.178, "theta": -166.127, "eta_prime": -177.215, "theta_prime": -162.929, "eta_base": -125.077, "theta_base": -131.293, "v0": -41.164, "v1": 26.388, "v2": -2.362, "v3": -21.763, "v4": 39.640, "amplitude": 41.966, "phase_angle": 93.226, "puckering": "O4'-endo", "sugar_class": "--", "bin": "23p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.062, "frame": { "rmsd": 0.004, "origin": [ 33.607, -3.498, 10.504 ], "x_axis": [ 0.726, -0.484, 0.489 ], "y_axis": [ 0.661, 0.294, -0.690 ], "z_axis": [ 0.190, 0.824, 0.534 ], "quaternion": [ 0.799, -0.474, -0.093, -0.358 ] } }, { "index": 8, "index_chain": 8, "chain_name": "S", "nt_resnum": 7, "nt_name": "DG", "nt_code": "G", "nt_id": "///S/7", "linked_nts": [ "///S/6", "///S/8" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": 33.174, "beta": 112.976, "gamma": 5.917, "delta": 133.755, "epsilon": 176.552, "zeta": -171.998, "epsilon_zeta": -11.450, "bb_type": "--", "chi": -109.132, "glyco_bond": "anti", "C5prime_xyz": [ -2.900, 8.319, -1.891 ], "P_xyz": [ -0.862, 9.693, -0.932 ], "form": ".", "ssZp": 2.459, "Dp": 2.356, "splay_angle": 24.772, "splay_distance": 4.027, "splay_ratio": 0.216, "d22": null, "d64": null, "eta": 163.205, "theta": -157.113, "eta_prime": -171.699, "theta_prime": -163.417, "eta_base": -133.866, "theta_base": -130.285, "v0": -33.703, "v1": 40.330, "v2": -31.327, "v3": 12.656, "v4": 12.969, "amplitude": 39.559, "phase_angle": 142.364, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.004, "frame": { "rmsd": 0.004, "origin": [ 34.232, -1.353, 12.681 ], "x_axis": [ 0.890, -0.456, -0.004 ], "y_axis": [ 0.273, 0.541, -0.795 ], "z_axis": [ 0.364, 0.707, 0.606 ], "quaternion": [ 0.871, -0.431, 0.106, -0.209 ] } }, { "index": 9, "index_chain": 9, "chain_name": "S", "nt_resnum": 8, "nt_name": "DC", "nt_code": "C", "nt_id": "///S/8", "linked_nts": [ "///S/7", "///S/9" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": 39.435, "beta": 93.333, "gamma": 29.474, "delta": 103.911, "epsilon": 161.972, "zeta": -80.130, "epsilon_zeta": -117.898, "bb_type": "BI", "chi": -135.431, "glyco_bond": "anti", "C5prime_xyz": [ -2.948, 8.757, -1.250 ], "P_xyz": [ -0.578, 9.524, -0.374 ], "form": ".", "ssZp": 2.774, "Dp": 2.767, "splay_angle": 20.683, "splay_distance": 3.407, "splay_ratio": 0.182, "d22": 4.113, "d64": 3.612, "eta": 173.488, "theta": -140.133, "eta_prime": -172.186, "theta_prime": -149.319, "eta_base": -131.859, "theta_base": -110.025, "v0": -41.778, "v1": 31.173, "v2": -9.487, "v3": -14.552, "v4": 35.221, "amplitude": 40.988, "phase_angle": 103.383, "puckering": "O4'-endo", "sugar_class": "--", "bin": "23p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.062, "frame": { "rmsd": 0.003, "origin": [ 35.366, 1.015, 15.734 ], "x_axis": [ 0.903, -0.156, -0.401 ], "y_axis": [ -0.233, 0.606, -0.761 ], "z_axis": [ 0.362, 0.780, 0.510 ], "quaternion": [ 0.869, -0.443, 0.220, 0.022 ] } }, { "index": 10, "index_chain": 10, "chain_name": "S", "nt_resnum": 9, "nt_name": "DC", "nt_code": "C", "nt_id": "///S/9", "linked_nts": [ "///S/8", "///S/10" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -93.360, "beta": -154.528, "gamma": 70.977, "delta": 146.382, "epsilon": -160.181, "zeta": -170.950, "epsilon_zeta": 10.769, "bb_type": "--", "chi": -115.279, "glyco_bond": "anti", "C5prime_xyz": [ -2.275, 8.500, -1.546 ], "P_xyz": [ -0.042, 9.609, -0.793 ], "form": "B", "ssZp": 1.743, "Dp": 1.919, "splay_angle": 19.233, "splay_distance": 3.216, "splay_ratio": 0.168, "d22": 4.404, "d64": 4.080, "eta": 170.243, "theta": -140.025, "eta_prime": -162.581, "theta_prime": -153.798, "eta_base": -114.791, "theta_base": -123.813, "v0": -28.887, "v1": 40.074, "v2": -35.696, "v3": 20.022, "v4": 5.359, "amplitude": 39.818, "phase_angle": 153.699, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.062, "frame": { "rmsd": 0.006, "origin": [ 37.482, 3.115, 17.384 ], "x_axis": [ 0.482, 0.126, -0.867 ], "y_axis": [ -0.737, 0.594, -0.323 ], "z_axis": [ 0.474, 0.795, 0.379 ], "quaternion": [ 0.783, -0.357, 0.428, 0.276 ] } }, { "index": 11, "index_chain": 11, "chain_name": "S", "nt_resnum": 10, "nt_name": "DT", "nt_code": "T", "nt_id": "///S/10", "linked_nts": [ "///S/9", null ], "nt_type": "DNA", "dbn": "(", "summary": "anti,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack", "alpha": 33.162, "beta": 97.007, "gamma": -1.241, "delta": 99.661, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": -107.286, "glyco_bond": "anti", "C5prime_xyz": [ -3.050, 8.046, -2.333 ], "P_xyz": [ -0.975, 9.547, -1.702 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": -34.400, "v1": 20.485, "v2": -0.212, "v3": -19.694, "v4": 34.125, "amplitude": 35.320, "phase_angle": 90.344, "puckering": "O4'-endo", "sugar_class": "--", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.107, "frame": { "rmsd": 0.006, "origin": [ 39.355, 5.070, 19.120 ], "x_axis": [ 0.097, 0.445, -0.890 ], "y_axis": [ -0.858, 0.491, 0.152 ], "z_axis": [ 0.505, 0.749, 0.430 ], "quaternion": [ 0.710, -0.210, 0.491, 0.459 ] } }, { "index": 12, "index_chain": 1, "chain_name": "U", "nt_resnum": 11, "nt_name": "DA", "nt_code": "A", "nt_id": "///U/11", "linked_nts": [ null, "///U/12" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix-end,stem-end", "alpha": null, "beta": 151.878, "gamma": 49.302, "delta": 154.567, "epsilon": -155.812, "zeta": -130.779, "epsilon_zeta": -25.033, "bb_type": "--", "chi": -97.430, "glyco_bond": "anti", "C5prime_xyz": [ -2.250, 7.964, -2.119 ], "P_xyz": [ 0.333, 8.355, -2.080 ], "form": "B", "ssZp": 1.589, "Dp": 1.617, "splay_angle": 19.748, "splay_distance": 3.372, "splay_ratio": 0.173, "d22": null, "d64": null, "eta": null, "theta": -123.024, "eta_prime": null, "theta_prime": -153.011, "eta_base": null, "theta_base": -109.272, "v0": -18.383, "v1": 35.441, "v2": -38.319, "v3": 28.731, "v4": -6.596, "amplitude": 38.788, "phase_angle": 171.086, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.037, "frame": { "rmsd": 0.003, "origin": [ 81.540, -98.595, 47.981 ], "x_axis": [ 0.513, 0.601, 0.613 ], "y_axis": [ 0.653, 0.191, -0.733 ], "z_axis": [ -0.557, 0.777, -0.294 ], "quaternion": [ 0.594, -0.636, -0.493, -0.022 ] } }, { "index": 13, "index_chain": 2, "chain_name": "U", "nt_resnum": 12, "nt_name": "DG", "nt_code": "G", "nt_id": "///U/12", "linked_nts": [ "///U/11", "///U/13" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": -40.226, "beta": 152.757, "gamma": 30.307, "delta": 137.128, "epsilon": -165.448, "zeta": -174.045, "epsilon_zeta": 8.597, "bb_type": "--", "chi": -104.526, "glyco_bond": "anti", "C5prime_xyz": [ -3.035, 8.191, -1.969 ], "P_xyz": [ -0.895, 9.716, -2.025 ], "form": "B", "ssZp": 2.434, "Dp": 2.276, "splay_angle": 20.663, "splay_distance": 3.385, "splay_ratio": 0.179, "d22": null, "d64": null, "eta": 160.744, "theta": -163.130, "eta_prime": -173.617, "theta_prime": -170.733, "eta_base": -123.496, "theta_base": -133.142, "v0": -33.636, "v1": 41.879, "v2": -33.569, "v3": 15.205, "v4": 11.192, "amplitude": 40.825, "phase_angle": 145.314, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.006, "frame": { "rmsd": 0.006, "origin": [ 80.190, -95.556, 47.423 ], "x_axis": [ 0.830, 0.544, 0.120 ], "y_axis": [ 0.240, -0.156, -0.958 ], "z_axis": [ -0.503, 0.824, -0.260 ], "quaternion": [ 0.595, -0.749, -0.262, 0.128 ] } }, { "index": 14, "index_chain": 3, "chain_name": "U", "nt_resnum": 13, "nt_name": "DA", "nt_code": "A", "nt_id": "///U/13", "linked_nts": [ "///U/12", "///U/14" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": 14.857, "beta": 106.846, "gamma": 29.540, "delta": 113.639, "epsilon": -176.552, "zeta": -98.149, "epsilon_zeta": -78.403, "bb_type": "BI", "chi": -117.052, "glyco_bond": "anti", "C5prime_xyz": [ -2.872, 8.414, -1.878 ], "P_xyz": [ -0.447, 9.334, -1.376 ], "form": ".", "ssZp": 2.261, "Dp": 2.374, "splay_angle": 19.413, "splay_distance": 3.538, "splay_ratio": 0.175, "d22": null, "d64": null, "eta": 177.945, "theta": -136.640, "eta_prime": -166.215, "theta_prime": -154.583, "eta_base": -126.361, "theta_base": -116.971, "v0": -37.490, "v1": 34.935, "v2": -19.687, "v3": -1.498, "v4": 24.326, "amplitude": 37.505, "phase_angle": 121.662, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.005, "origin": [ 78.448, -92.708, 46.861 ], "x_axis": [ 0.832, 0.386, -0.398 ], "y_axis": [ -0.252, -0.377, -0.891 ], "z_axis": [ -0.494, 0.842, -0.217 ], "quaternion": [ 0.556, -0.779, -0.043, 0.286 ] } }, { "index": 15, "index_chain": 4, "chain_name": "U", "nt_resnum": 14, "nt_name": "DC", "nt_code": "C", "nt_id": "///U/14", "linked_nts": [ "///U/13", "///U/15" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": -38.987, "beta": 168.150, "gamma": 35.418, "delta": 122.914, "epsilon": -175.447, "zeta": -135.555, "epsilon_zeta": -39.892, "bb_type": "--", "chi": -123.361, "glyco_bond": "anti", "C5prime_xyz": [ -2.700, 8.651, -1.509 ], "P_xyz": [ -0.796, 10.478, -1.280 ], "form": "B", "ssZp": 2.603, "Dp": 2.551, "splay_angle": 22.274, "splay_distance": 3.669, "splay_ratio": 0.194, "d22": 4.561, "d64": 4.169, "eta": 170.739, "theta": -165.364, "eta_prime": -169.537, "theta_prime": -165.895, "eta_base": -122.680, "theta_base": -123.539, "v0": -37.138, "v1": 38.214, "v2": -24.747, "v3": 3.879, "v4": 20.633, "amplitude": 38.833, "phase_angle": 129.587, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.003, "origin": [ 77.801, -89.255, 46.447 ], "x_axis": [ 0.576, 0.105, -0.811 ], "y_axis": [ -0.669, -0.509, -0.541 ], "z_axis": [ -0.469, 0.854, -0.223 ], "quaternion": [ -0.459, 0.759, -0.186, -0.421 ] } }, { "index": 16, "index_chain": 5, "chain_name": "U", "nt_resnum": 15, "nt_name": "DT", "nt_code": "T", "nt_id": "///U/15", "linked_nts": [ "///U/14", "///U/16" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": 3.983, "beta": 148.671, "gamma": 16.242, "delta": 137.374, "epsilon": 168.945, "zeta": -89.799, "epsilon_zeta": -101.256, "bb_type": "BI", "chi": -109.712, "glyco_bond": "anti", "C5prime_xyz": [ -2.110, 8.326, -1.804 ], "P_xyz": [ 0.111, 9.538, -1.058 ], "form": "B", "ssZp": 2.033, "Dp": 2.088, "splay_angle": 18.311, "splay_distance": 3.079, "splay_ratio": 0.162, "d22": 4.355, "d64": 3.896, "eta": 173.494, "theta": -137.779, "eta_prime": -160.556, "theta_prime": -151.819, "eta_base": -114.735, "theta_base": -104.870, "v0": -23.546, "v1": 34.524, "v2": -32.050, "v3": 19.172, "v4": 2.566, "amplitude": 34.766, "phase_angle": 157.200, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.005, "origin": [ 76.587, -85.906, 45.569 ], "x_axis": [ 0.043, -0.189, -0.981 ], "y_axis": [ -0.882, -0.468, 0.051 ], "z_axis": [ -0.469, 0.863, -0.187 ], "quaternion": [ -0.312, 0.652, -0.411, -0.556 ] } }, { "index": 17, "index_chain": 6, "chain_name": "U", "nt_resnum": 16, "nt_name": "DC", "nt_code": "C", "nt_id": "///U/16", "linked_nts": [ "///U/15", "///U/17" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": -61.368, "beta": -160.396, "gamma": 40.904, "delta": 151.258, "epsilon": -161.614, "zeta": -140.496, "epsilon_zeta": -21.118, "bb_type": "--", "chi": -94.293, "glyco_bond": "anti", "C5prime_xyz": [ -2.338, 7.951, -2.312 ], "P_xyz": [ -0.222, 9.538, -2.210 ], "form": "B", "ssZp": 1.931, "Dp": 1.955, "splay_angle": 21.330, "splay_distance": 3.706, "splay_ratio": 0.187, "d22": 3.937, "d64": 3.990, "eta": 173.549, "theta": -147.239, "eta_prime": -163.563, "theta_prime": -159.673, "eta_base": -110.847, "theta_base": -126.132, "v0": -20.735, "v1": 36.727, "v2": -38.127, "v3": 27.139, "v4": -4.176, "amplitude": 39.062, "phase_angle": 167.438, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.062, "frame": { "rmsd": 0.004, "origin": [ 75.512, -83.417, 44.110 ], "x_axis": [ -0.561, -0.352, -0.749 ], "y_axis": [ -0.767, -0.121, 0.630 ], "z_axis": [ -0.313, 0.928, -0.202 ], "quaternion": [ 0.170, -0.437, 0.641, 0.608 ] } }, { "index": 18, "index_chain": 7, "chain_name": "U", "nt_resnum": 17, "nt_name": "DC", "nt_code": "C", "nt_id": "///U/17", "linked_nts": [ "///U/16", "///U/18" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -29.824, "beta": 139.134, "gamma": 42.867, "delta": 107.416, "epsilon": -167.669, "zeta": -115.889, "epsilon_zeta": -51.780, "bb_type": "BI", "chi": -128.998, "glyco_bond": "anti", "C5prime_xyz": [ -3.080, 8.588, -1.551 ], "P_xyz": [ -0.890, 10.040, -1.434 ], "form": "B", "ssZp": 2.422, "Dp": 2.490, "splay_angle": 18.439, "splay_distance": 3.175, "splay_ratio": 0.161, "d22": 4.654, "d64": 4.233, "eta": 176.524, "theta": -161.703, "eta_prime": -168.512, "theta_prime": -167.998, "eta_base": -130.552, "theta_base": -135.164, "v0": -44.009, "v1": 34.740, "v2": -12.840, "v3": -12.344, "v4": 35.111, "amplitude": 42.969, "phase_angle": 107.387, "puckering": "O4'-endo", "sugar_class": "--", "bin": "23p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.062, "frame": { "rmsd": 0.004, "origin": [ 74.488, -80.106, 42.795 ], "x_axis": [ -0.813, -0.458, -0.360 ], "y_axis": [ -0.414, 0.017, 0.910 ], "z_axis": [ -0.411, 0.889, -0.203 ], "quaternion": [ -0.018, -0.306, 0.713, 0.631 ] } }, { "index": 19, "index_chain": 8, "chain_name": "U", "nt_resnum": 18, "nt_name": "DT", "nt_code": "T", "nt_id": "///U/18", "linked_nts": [ "///U/17", "///U/19" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -43.942, "beta": 154.271, "gamma": 55.891, "delta": 119.409, "epsilon": -160.732, "zeta": -96.810, "epsilon_zeta": -63.922, "bb_type": "BI", "chi": -120.314, "glyco_bond": "anti", "C5prime_xyz": [ -2.739, 8.511, -1.768 ], "P_xyz": [ -0.466, 9.840, -1.776 ], "form": "B", "ssZp": 1.818, "Dp": 2.152, "splay_angle": 18.687, "splay_distance": 3.153, "splay_ratio": 0.162, "d22": 4.279, "d64": 3.286, "eta": -178.788, "theta": -140.554, "eta_prime": -160.088, "theta_prime": -152.903, "eta_base": -125.526, "theta_base": -95.313, "v0": -36.159, "v1": 36.275, "v2": -23.198, "v3": 2.832, "v4": 20.649, "amplitude": 37.391, "phase_angle": 128.347, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.107, "frame": { "rmsd": 0.008, "origin": [ 73.686, -77.319, 41.504 ], "x_axis": [ -0.944, -0.303, 0.128 ], "y_axis": [ 0.014, 0.352, 0.936 ], "z_axis": [ -0.329, 0.885, -0.329 ], "quaternion": [ -0.141, -0.089, 0.810, 0.562 ] } }, { "index": 20, "index_chain": 9, "chain_name": "U", "nt_resnum": 19, "nt_name": "DC", "nt_code": "C", "nt_id": "///U/19", "linked_nts": [ "///U/18", "///U/20" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,BI,canonical,non-pair-contact,helix-end,stem-end,phosphate", "alpha": -84.353, "beta": 164.555, "gamma": 68.496, "delta": 110.084, "epsilon": -177.588, "zeta": -96.477, "epsilon_zeta": -81.111, "bb_type": "BI", "chi": -119.519, "glyco_bond": "anti", "C5prime_xyz": [ -2.565, 8.497, -1.834 ], "P_xyz": [ -0.229, 9.351, -2.672 ], "form": "B", "ssZp": 2.501, "Dp": 2.789, "splay_angle": 21.249, "splay_distance": 3.605, "splay_ratio": 0.184, "d22": 4.347, "d64": 3.839, "eta": 156.469, "theta": -157.567, "eta_prime": -178.559, "theta_prime": -166.712, "eta_base": -113.525, "theta_base": -136.446, "v0": -33.406, "v1": 23.404, "v2": -5.607, "v3": -13.568, "v4": 29.471, "amplitude": 32.924, "phase_angle": 99.806, "puckering": "O4'-endo", "sugar_class": "--", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.005, "origin": [ 71.725, -74.852, 41.406 ], "x_axis": [ -0.668, 0.002, 0.744 ], "y_axis": [ 0.592, 0.608, 0.530 ], "z_axis": [ -0.451, 0.794, -0.407 ], "quaternion": [ -0.365, 0.181, 0.819, 0.404 ] } }, { "index": 21, "index_chain": 10, "chain_name": "U", "nt_resnum": 20, "nt_name": "DT", "nt_code": "T", "nt_id": "///U/20", "linked_nts": [ "///U/19", "///U/21" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,non-pair-contact,ss-non-loop,phosphate", "alpha": -52.496, "beta": -179.342, "gamma": 45.464, "delta": 124.811, "epsilon": -91.152, "zeta": -45.392, "epsilon_zeta": -45.760, "bb_type": "--", "chi": -116.964, "glyco_bond": "anti", "C5prime_xyz": [ -2.095, 8.429, -1.709 ], "P_xyz": [ 0.210, 9.666, -1.533 ], "form": ".", "ssZp": 0.960, "Dp": 1.800, "splay_angle": 71.237, "splay_distance": 11.237, "splay_ratio": 0.588, "d22": 7.339, "d64": 9.009, "eta": -156.961, "theta": -36.012, "eta_prime": -149.474, "theta_prime": -96.189, "eta_base": -120.607, "theta_base": -133.233, "v0": -24.499, "v1": 26.666, "v2": -18.882, "v3": 5.118, "v4": 12.088, "amplitude": 26.708, "phase_angle": 134.988, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.004, "origin": [ 69.840, -72.133, 39.973 ], "x_axis": [ -0.225, 0.194, 0.955 ], "y_axis": [ 0.821, 0.566, 0.079 ], "z_axis": [ -0.525, 0.802, -0.286 ], "quaternion": [ 0.513, -0.352, -0.721, -0.305 ] } }, { "index": 22, "index_chain": 11, "chain_name": "U", "nt_resnum": 21, "nt_name": "DT", "nt_code": "T", "nt_id": "///U/21", "linked_nts": [ "///U/20", "///U/22" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,non-pair-contact,ss-non-loop", "alpha": -165.344, "beta": 124.467, "gamma": 58.723, "delta": 138.511, "epsilon": -53.179, "zeta": 95.568, "epsilon_zeta": 211.253, "bb_type": "--", "chi": -128.601, "glyco_bond": "anti", "C5prime_xyz": [ -2.064, 8.674, -0.918 ], "P_xyz": [ 0.564, 8.515, -0.704 ], "form": ".", "ssZp": -0.006, "Dp": 0.145, "splay_angle": 20.915, "splay_distance": 3.547, "splay_ratio": 0.185, "d22": 4.501, "d64": 4.535, "eta": 47.195, "theta": 135.788, "eta_prime": 120.540, "theta_prime": 102.383, "eta_base": 121.413, "theta_base": 134.082, "v0": -24.383, "v1": 34.653, "v2": -31.348, "v3": 18.018, "v4": 3.771, "amplitude": 34.562, "phase_angle": 155.098, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.107, "frame": { "rmsd": 0.001, "origin": [ 70.739, -63.752, 32.543 ], "x_axis": [ -0.269, -0.935, -0.232 ], "y_axis": [ 0.830, -0.348, 0.436 ], "z_axis": [ -0.488, -0.076, 0.870 ], "quaternion": [ 0.560, 0.228, -0.114, -0.788 ] } }, { "index": 23, "index_chain": 12, "chain_name": "U", "nt_resnum": 22, "nt_name": "DT", "nt_code": "T", "nt_id": "///U/22", "linked_nts": [ "///U/21", null ], "nt_type": "DNA", "dbn": ".", "summary": "non-pair-contact,ss-non-loop", "alpha": -110.903, "beta": 161.335, "gamma": 40.600, "delta": 102.685, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": 122.950, "glyco_bond": "--", "C5prime_xyz": [ -3.946, 7.360, 2.659 ], "P_xyz": [ -4.122, 6.467, 5.163 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": -38.609, "v1": 27.220, "v2": -6.480, "v3": -15.832, "v4": 34.231, "amplitude": 38.209, "phase_angle": 99.764, "puckering": "O4'-endo", "sugar_class": "--", "bin": "23p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.108, "frame": { "rmsd": 0.004, "origin": [ 72.088, -60.767, 31.183 ], "x_axis": [ -0.407, -0.882, -0.238 ], "y_axis": [ 0.904, -0.426, 0.032 ], "z_axis": [ -0.130, -0.202, 0.971 ], "quaternion": [ 0.533, 0.110, 0.051, -0.837 ] } }, { "index": 24, "index_chain": 1, "chain_name": "V", "nt_resnum": 1, "nt_name": "DG", "nt_code": "G", "nt_id": "///V/1", "linked_nts": [ null, "///V/2" ], "nt_type": "DNA", "dbn": "[", "summary": "pseudoknotted,anti,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack", "alpha": null, "beta": 171.235, "gamma": 40.388, "delta": 100.974, "epsilon": -162.637, "zeta": -69.817, "epsilon_zeta": -92.820, "bb_type": "BI", "chi": -159.726, "glyco_bond": "anti", "C5prime_xyz": [ -2.354, 9.008, 0.127 ], "P_xyz": [ -0.565, 10.578, 0.914 ], "form": ".", "ssZp": 3.290, "Dp": 3.227, "splay_angle": 21.768, "splay_distance": 3.887, "splay_ratio": 0.195, "d22": null, "d64": null, "eta": null, "theta": -140.977, "eta_prime": null, "theta_prime": -143.093, "eta_base": null, "theta_base": -98.667, "v0": -31.015, "v1": 16.885, "v2": 2.315, "v3": -20.360, "v4": 32.489, "amplitude": 32.817, "phase_angle": 85.954, "puckering": "O4'-endo", "sugar_class": "--", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.004, "frame": { "rmsd": 0.004, "origin": [ 56.131, -84.583, 33.874 ], "x_axis": [ -0.840, 0.136, 0.525 ], "y_axis": [ 0.379, -0.546, 0.747 ], "z_axis": [ 0.389, 0.827, 0.407 ], "quaternion": [ -0.073, 0.273, 0.471, 0.836 ] } }, { "index": 25, "index_chain": 2, "chain_name": "V", "nt_resnum": 2, "nt_name": "DC", "nt_code": "C", "nt_id": "///V/2", "linked_nts": [ "///V/1", "///V/3" ], "nt_type": "DNA", "dbn": "[", "summary": "pseudoknotted,anti,~C3'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -56.843, "beta": -175.517, "gamma": 13.248, "delta": 63.888, "epsilon": 77.082, "zeta": 43.323, "epsilon_zeta": 33.759, "bb_type": "--", "chi": -139.960, "glyco_bond": "anti", "C5prime_xyz": [ -1.808, 8.897, -0.740 ], "P_xyz": [ 0.216, 10.465, -0.130 ], "form": ".", "ssZp": 2.794, "Dp": 3.207, "splay_angle": 17.601, "splay_distance": 3.172, "splay_ratio": 0.154, "d22": 3.950, "d64": 3.996, "eta": 172.921, "theta": -142.511, "eta_prime": -170.241, "theta_prime": -148.881, "eta_base": -116.485, "theta_base": -118.800, "v0": -8.627, "v1": -17.541, "v2": 35.164, "v3": -41.192, "v4": 31.323, "amplitude": 40.786, "phase_angle": 30.442, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.003, "origin": [ 55.909, -81.089, 35.564 ], "x_axis": [ -0.397, -0.316, 0.861 ], "y_axis": [ 0.841, -0.502, 0.204 ], "z_axis": [ 0.368, 0.805, 0.465 ], "quaternion": [ -0.376, 0.400, 0.328, 0.769 ] } }, { "index": 26, "index_chain": 3, "chain_name": "V", "nt_resnum": 3, "nt_name": "DT", "nt_code": "T", "nt_id": "///V/3", "linked_nts": [ "///V/2", "///V/4" ], "nt_type": "DNA", "dbn": "[", "summary": "pseudoknotted,anti,~C3'-endo,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,splayed-apart", "alpha": 80.455, "beta": -173.915, "gamma": -172.710, "delta": 95.357, "epsilon": -97.468, "zeta": 101.365, "epsilon_zeta": 161.166, "bb_type": "--", "chi": -156.375, "glyco_bond": "anti", "C5prime_xyz": [ -1.298, 8.703, 0.382 ], "P_xyz": [ -0.118, 10.412, -1.250 ], "form": ".", "ssZp": 3.466, "Dp": 4.200, "splay_angle": 114.851, "splay_distance": 15.475, "splay_ratio": 0.844, "d22": null, "d64": null, "eta": 174.171, "theta": 40.892, "eta_prime": -178.720, "theta_prime": -2.813, "eta_base": -141.499, "theta_base": -84.338, "v0": 1.315, "v1": -17.831, "v2": 26.429, "v3": -26.168, "v4": 15.811, "amplitude": 27.451, "phase_angle": 15.680, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.107, "frame": { "rmsd": 0.002, "origin": [ 56.260, -78.408, 37.222 ], "x_axis": [ 0.000, -0.487, 0.873 ], "y_axis": [ 0.960, -0.243, -0.136 ], "z_axis": [ 0.279, 0.839, 0.467 ], "quaternion": [ 0.553, -0.441, -0.269, -0.654 ] } }, { "index": 27, "index_chain": 4, "chain_name": "V", "nt_resnum": 4, "nt_name": "DG", "nt_code": "G", "nt_id": "///V/4", "linked_nts": [ "///V/3", "///V/5" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix-end,stem-end,splayed-apart", "alpha": 108.649, "beta": 123.539, "gamma": 70.109, "delta": 142.029, "epsilon": 166.040, "zeta": -168.625, "epsilon_zeta": -25.335, "bb_type": "--", "chi": -91.598, "glyco_bond": "anti", "C5prime_xyz": [ -2.689, 7.876, -2.501 ], "P_xyz": [ -0.248, 7.456, -3.468 ], "form": "B", "ssZp": 2.116, "Dp": 2.185, "splay_angle": 23.668, "splay_distance": 3.711, "splay_ratio": 0.205, "d22": null, "d64": null, "eta": -33.025, "theta": -139.746, "eta_prime": 66.439, "theta_prime": 173.381, "eta_base": 135.335, "theta_base": -157.897, "v0": -25.966, "v1": 38.771, "v2": -36.445, "v3": 22.188, "v4": 2.214, "amplitude": 39.240, "phase_angle": 158.245, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.003, "frame": { "rmsd": 0.003, "origin": [ 70.944, -75.356, 41.035 ], "x_axis": [ -0.714, -0.257, 0.652 ], "y_axis": [ -0.487, -0.486, -0.725 ], "z_axis": [ 0.503, -0.835, 0.222 ], "quaternion": [ 0.074, 0.371, -0.501, 0.778 ] } }, { "index": 28, "index_chain": 5, "chain_name": "V", "nt_resnum": 5, "nt_name": "DA", "nt_code": "A", "nt_id": "///V/5", "linked_nts": [ "///V/4", "///V/6" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": 31.897, "beta": 122.833, "gamma": 22.075, "delta": 134.722, "epsilon": 164.900, "zeta": -91.339, "epsilon_zeta": -103.761, "bb_type": "BI", "chi": -96.622, "glyco_bond": "anti", "C5prime_xyz": [ -2.686, 7.890, -2.349 ], "P_xyz": [ -0.189, 8.733, -2.050 ], "form": "B", "ssZp": 2.274, "Dp": 2.290, "splay_angle": 18.999, "splay_distance": 3.201, "splay_ratio": 0.168, "d22": null, "d64": null, "eta": 175.680, "theta": -130.727, "eta_prime": -168.235, "theta_prime": -152.770, "eta_base": -140.305, "theta_base": -109.022, "v0": -25.255, "v1": 35.819, "v2": -32.244, "v3": 18.454, "v4": 4.072, "amplitude": 35.634, "phase_angle": 154.802, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.037, "frame": { "rmsd": 0.004, "origin": [ 73.636, -77.843, 41.612 ], "x_axis": [ -0.804, -0.525, 0.280 ], "y_axis": [ -0.077, -0.375, -0.924 ], "z_axis": [ 0.590, -0.764, 0.261 ], "quaternion": [ -0.143, 0.279, -0.540, 0.781 ] } }, { "index": 29, "index_chain": 6, "chain_name": "V", "nt_resnum": 6, "nt_name": "DG", "nt_code": "G", "nt_id": "///V/6", "linked_nts": [ "///V/5", "///V/7" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -65.719, "beta": -165.240, "gamma": 49.102, "delta": 131.492, "epsilon": -172.858, "zeta": -130.225, "epsilon_zeta": -42.633, "bb_type": "BI", "chi": -103.916, "glyco_bond": "anti", "C5prime_xyz": [ -2.495, 8.167, -2.129 ], "P_xyz": [ -0.306, 9.592, -2.133 ], "form": "B", "ssZp": 2.298, "Dp": 2.396, "splay_angle": 18.964, "splay_distance": 3.274, "splay_ratio": 0.165, "d22": null, "d64": null, "eta": 172.050, "theta": -158.237, "eta_prime": -170.665, "theta_prime": -167.697, "eta_base": -118.713, "theta_base": -142.062, "v0": -29.014, "v1": 34.648, "v2": -26.993, "v3": 10.792, "v4": 11.301, "amplitude": 34.108, "phase_angle": 142.316, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.003, "frame": { "rmsd": 0.003, "origin": [ 74.272, -80.754, 42.782 ], "x_axis": [ -0.746, -0.552, -0.373 ], "y_axis": [ 0.503, -0.100, -0.858 ], "z_axis": [ 0.437, -0.828, 0.352 ], "quaternion": [ -0.356, 0.022, -0.569, 0.741 ] } }, { "index": 30, "index_chain": 7, "chain_name": "V", "nt_resnum": 7, "nt_name": "DG", "nt_code": "G", "nt_id": "///V/7", "linked_nts": [ "///V/6", "///V/8" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": -27.362, "beta": 139.350, "gamma": 48.073, "delta": 128.947, "epsilon": -169.844, "zeta": 179.103, "epsilon_zeta": 11.053, "bb_type": "--", "chi": -127.289, "glyco_bond": "anti", "C5prime_xyz": [ -2.953, 8.672, -1.335 ], "P_xyz": [ -0.645, 9.961, -1.125 ], "form": "B", "ssZp": 2.397, "Dp": 2.475, "splay_angle": 22.799, "splay_distance": 3.591, "splay_ratio": 0.198, "d22": null, "d64": null, "eta": 169.572, "theta": -160.011, "eta_prime": -166.460, "theta_prime": -163.778, "eta_base": -135.491, "theta_base": -123.584, "v0": -43.134, "v1": 45.428, "v2": -30.309, "v3": 6.286, "v4": 22.607, "amplitude": 45.607, "phase_angle": 131.650, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.005, "frame": { "rmsd": 0.005, "origin": [ 75.478, -83.169, 44.635 ], "x_axis": [ -0.518, -0.495, -0.698 ], "y_axis": [ 0.762, 0.105, -0.639 ], "z_axis": [ 0.390, -0.863, 0.322 ], "quaternion": [ -0.477, -0.117, -0.570, 0.658 ] } }, { "index": 31, "index_chain": 8, "chain_name": "V", "nt_resnum": 8, "nt_name": "DA", "nt_code": "A", "nt_id": "///V/8", "linked_nts": [ "///V/7", "///V/9" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": 37.154, "beta": 86.976, "gamma": 33.473, "delta": 119.266, "epsilon": -174.318, "zeta": -103.478, "epsilon_zeta": -70.840, "bb_type": "BI", "chi": -119.981, "glyco_bond": "anti", "C5prime_xyz": [ -3.119, 8.387, -1.752 ], "P_xyz": [ -0.727, 9.017, -0.836 ], "form": "B", "ssZp": 2.241, "Dp": 2.341, "splay_angle": 19.480, "splay_distance": 3.346, "splay_ratio": 0.173, "d22": null, "d64": null, "eta": 174.684, "theta": -132.028, "eta_prime": -165.201, "theta_prime": -154.168, "eta_base": -120.901, "theta_base": -105.863, "v0": -41.444, "v1": 39.292, "v2": -22.748, "v3": -0.596, "v4": 26.074, "amplitude": 41.658, "phase_angle": 123.098, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.006, "origin": [ 76.620, -86.253, 46.075 ], "x_axis": [ 0.017, -0.411, -0.912 ], "y_axis": [ 0.908, 0.389, -0.158 ], "z_axis": [ 0.419, -0.825, 0.379 ], "quaternion": [ 0.668, 0.250, 0.498, -0.493 ] } }, { "index": 32, "index_chain": 9, "chain_name": "V", "nt_resnum": 9, "nt_name": "DG", "nt_code": "G", "nt_id": "///V/9", "linked_nts": [ "///V/8", "///V/10" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -75.698, "beta": 162.571, "gamma": 73.092, "delta": 134.167, "epsilon": -171.565, "zeta": -145.663, "epsilon_zeta": -25.901, "bb_type": "--", "chi": -132.485, "glyco_bond": "anti", "C5prime_xyz": [ -2.613, 8.809, -0.940 ], "P_xyz": [ -0.274, 9.967, -1.081 ], "form": ".", "ssZp": 2.443, "Dp": 2.461, "splay_angle": 19.270, "splay_distance": 3.313, "splay_ratio": 0.175, "d22": null, "d64": null, "eta": 162.687, "theta": -147.063, "eta_prime": -168.594, "theta_prime": -161.924, "eta_base": -109.134, "theta_base": -128.964, "v0": -37.214, "v1": 42.383, "v2": -31.013, "v3": 10.264, "v4": 16.594, "amplitude": 41.729, "phase_angle": 138.005, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.005, "frame": { "rmsd": 0.005, "origin": [ 77.715, -89.404, 46.345 ], "x_axis": [ 0.606, -0.057, -0.793 ], "y_axis": [ 0.683, 0.549, 0.482 ], "z_axis": [ 0.408, -0.834, 0.372 ], "quaternion": [ 0.795, 0.414, 0.378, -0.233 ] } }, { "index": 33, "index_chain": 10, "chain_name": "V", "nt_resnum": 10, "nt_name": "DT", "nt_code": "T", "nt_id": "///V/10", "linked_nts": [ "///V/9", "///V/11" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": 26.886, "beta": 144.058, "gamma": -11.514, "delta": 149.706, "epsilon": -172.373, "zeta": -111.859, "epsilon_zeta": -60.514, "bb_type": "BI", "chi": -102.858, "glyco_bond": "anti", "C5prime_xyz": [ -2.235, 8.112, -1.970 ], "P_xyz": [ -0.480, 9.879, -1.181 ], "form": "B", "ssZp": 2.004, "Dp": 2.008, "splay_angle": 21.620, "splay_distance": 3.683, "splay_ratio": 0.190, "d22": 4.175, "d64": 3.909, "eta": 173.978, "theta": -142.822, "eta_prime": -165.989, "theta_prime": -155.552, "eta_base": -126.620, "theta_base": -103.965, "v0": -20.898, "v1": 37.103, "v2": -38.261, "v3": 27.278, "v4": -4.180, "amplitude": 39.221, "phase_angle": 167.297, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.107, "frame": { "rmsd": 0.003, "origin": [ 78.145, -92.683, 46.538 ], "x_axis": [ 0.914, 0.187, -0.360 ], "y_axis": [ 0.254, 0.429, 0.867 ], "z_axis": [ 0.316, -0.884, 0.345 ], "quaternion": [ 0.820, 0.534, 0.206, -0.020 ] } }, { "index": 34, "index_chain": 11, "chain_name": "V", "nt_resnum": 11, "nt_name": "DC", "nt_code": "C", "nt_id": "///V/11", "linked_nts": [ "///V/10", "///V/12" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -69.044, "beta": 169.604, "gamma": 53.619, "delta": 98.286, "epsilon": -174.749, "zeta": -87.474, "epsilon_zeta": -87.275, "bb_type": "BI", "chi": -133.270, "glyco_bond": "anti", "C5prime_xyz": [ -2.411, 8.777, -1.197 ], "P_xyz": [ -0.044, 9.889, -1.449 ], "form": ".", "ssZp": 3.271, "Dp": 3.486, "splay_angle": 18.999, "splay_distance": 3.271, "splay_ratio": 0.166, "d22": 4.518, "d64": 4.245, "eta": 164.490, "theta": -157.299, "eta_prime": 177.034, "theta_prime": -158.473, "eta_base": -121.405, "theta_base": -154.022, "v0": -28.668, "v1": 11.378, "v2": 8.757, "v3": -25.575, "v4": 34.212, "amplitude": 33.599, "phase_angle": 74.892, "puckering": "O4'-endo", "sugar_class": "--", "bin": "23p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.062, "frame": { "rmsd": 0.004, "origin": [ 80.298, -95.574, 47.293 ], "x_axis": [ 0.864, 0.389, 0.318 ], "y_axis": [ -0.417, 0.201, 0.886 ], "z_axis": [ 0.281, -0.899, 0.336 ], "quaternion": [ 0.775, 0.576, -0.012, 0.260 ] } }, { "index": 35, "index_chain": 12, "chain_name": "V", "nt_resnum": 12, "nt_name": "DT", "nt_code": "T", "nt_id": "///V/12", "linked_nts": [ "///V/11", null ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix-end,stem-end,phosphate", "alpha": -48.634, "beta": -177.616, "gamma": 44.052, "delta": 134.681, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": -103.588, "glyco_bond": "anti", "C5prime_xyz": [ -2.595, 8.165, -2.133 ], "P_xyz": [ -0.484, 9.774, -2.097 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": -27.176, "v1": 36.195, "v2": -31.346, "v3": 16.363, "v4": 6.603, "amplitude": 35.861, "phase_angle": 150.938, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1b", "suiteness": 0.161, "filter_rmsd": 0.107, "frame": { "rmsd": 0.004, "origin": [ 81.092, -98.741, 47.092 ], "x_axis": [ 0.633, 0.592, 0.499 ], "y_axis": [ -0.549, -0.110, 0.828 ], "z_axis": [ 0.546, -0.798, 0.255 ], "quaternion": [ 0.667, 0.610, 0.018, 0.428 ] } }, { "index": 36, "index_chain": 1, "chain_name": "W", "nt_resnum": 0, "nt_name": "DT", "nt_code": "T", "nt_id": "///W/0", "linked_nts": [ null, "///W/1" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,non-pair-contact,ss-non-loop,phosphate,splayed-apart", "alpha": null, "beta": -150.019, "gamma": -147.538, "delta": 117.417, "epsilon": -161.706, "zeta": 73.161, "epsilon_zeta": 125.133, "bb_type": "--", "chi": -96.574, "glyco_bond": "anti", "C5prime_xyz": [ -3.218, 7.861, -2.473 ], "P_xyz": [ -3.755, 7.738, -5.055 ], "form": ".", "ssZp": 2.123, "Dp": 2.647, "splay_angle": 127.501, "splay_distance": 16.431, "splay_ratio": 0.898, "d22": null, "d64": null, "eta": null, "theta": -6.660, "eta_prime": null, "theta_prime": -46.275, "eta_base": null, "theta_base": -110.040, "v0": -34.694, "v1": 32.075, "v2": -17.668, "v3": -2.122, "v4": 23.103, "amplitude": 34.722, "phase_angle": 120.586, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.107, "frame": { "rmsd": 0.004, "origin": [ 42.209, -83.978, 43.022 ], "x_axis": [ 0.134, -0.909, -0.395 ], "y_axis": [ 0.692, 0.371, -0.619 ], "z_axis": [ 0.709, -0.191, 0.679 ], "quaternion": [ 0.739, -0.145, 0.374, -0.542 ] } }, { "index": 37, "index_chain": 2, "chain_name": "W", "nt_resnum": 1, "nt_name": "DA", "nt_code": "A", "nt_id": "///W/1", "linked_nts": [ "///W/0", "///W/2" ], "nt_type": "DNA", "dbn": "]", "summary": "pseudoknotted,anti,~C2'-endo,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,splayed-apart", "alpha": 62.756, "beta": -162.848, "gamma": 61.216, "delta": 143.443, "epsilon": 156.719, "zeta": -128.226, "epsilon_zeta": -75.054, "bb_type": "--", "chi": -105.659, "glyco_bond": "anti", "C5prime_xyz": [ -1.275, 7.905, -1.798 ], "P_xyz": [ 1.256, 7.973, -1.058 ], "form": "B", "ssZp": 1.719, "Dp": 1.773, "splay_angle": 23.067, "splay_distance": 3.902, "splay_ratio": 0.201, "d22": null, "d64": null, "eta": -38.687, "theta": -120.189, "eta_prime": 37.383, "theta_prime": -149.482, "eta_base": 96.387, "theta_base": -117.727, "v0": -0.628, "v1": 17.221, "v2": -26.141, "v3": 26.083, "v4": -16.232, "amplitude": 27.323, "phase_angle": 196.914, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.003, "origin": [ 56.629, -78.499, 37.362 ], "x_axis": [ 0.100, -0.546, 0.832 ], "y_axis": [ -0.965, 0.149, 0.214 ], "z_axis": [ -0.241, -0.824, -0.512 ], "quaternion": [ -0.429, -0.605, 0.625, -0.244 ] } }, { "index": 38, "index_chain": 3, "chain_name": "W", "nt_resnum": 2, "nt_name": "DG", "nt_code": "G", "nt_id": "///W/2", "linked_nts": [ "///W/1", "///W/3" ], "nt_type": "DNA", "dbn": "]", "summary": "pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": 55.262, "beta": 105.029, "gamma": -15.545, "delta": 94.414, "epsilon": 175.087, "zeta": -75.046, "epsilon_zeta": -109.867, "bb_type": "BI", "chi": -122.049, "glyco_bond": "anti", "C5prime_xyz": [ -2.176, 8.584, -1.693 ], "P_xyz": [ -0.207, 9.902, -0.465 ], "form": ".", "ssZp": 2.804, "Dp": 3.443, "splay_angle": 15.724, "splay_distance": 2.833, "splay_ratio": 0.139, "d22": null, "d64": null, "eta": 169.431, "theta": -152.462, "eta_prime": 177.631, "theta_prime": -152.207, "eta_base": -139.512, "theta_base": -138.755, "v0": -19.887, "v1": 4.583, "v2": 11.057, "v3": -22.664, "v4": 27.009, "amplitude": 26.506, "phase_angle": 65.346, "puckering": "C4'-exo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.003, "frame": { "rmsd": 0.003, "origin": [ 56.166, -81.678, 35.148 ], "x_axis": [ -0.366, -0.387, 0.846 ], "y_axis": [ -0.840, 0.529, -0.121 ], "z_axis": [ -0.401, -0.755, -0.519 ], "quaternion": [ -0.401, -0.395, 0.777, -0.282 ] } }, { "index": 39, "index_chain": 4, "chain_name": "W", "nt_resnum": 3, "nt_name": "DC", "nt_code": "C", "nt_id": "///W/3", "linked_nts": [ "///W/2", "///W/4" ], "nt_type": "DNA", "dbn": "]", "summary": "pseudoknotted,anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack", "alpha": -38.689, "beta": 163.755, "gamma": 50.001, "delta": 114.846, "epsilon": 175.827, "zeta": -104.585, "epsilon_zeta": -79.588, "bb_type": "BI", "chi": -121.138, "glyco_bond": "anti", "C5prime_xyz": [ -3.014, 8.578, -1.597 ], "P_xyz": [ -0.980, 10.245, -1.793 ], "form": ".", "ssZp": 2.562, "Dp": 2.475, "splay_angle": 24.195, "splay_distance": 4.404, "splay_ratio": 0.219, "d22": 3.772, "d64": 4.368, "eta": -179.265, "theta": -152.700, "eta_prime": -153.718, "theta_prime": -163.618, "eta_base": -136.163, "theta_base": -120.230, "v0": -39.624, "v1": 37.845, "v2": -21.822, "v3": -0.646, "v4": 25.098, "amplitude": 40.011, "phase_angle": 123.052, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.062, "frame": { "rmsd": 0.006, "origin": [ 55.975, -84.176, 33.825 ], "x_axis": [ -0.586, -0.256, 0.769 ], "y_axis": [ -0.774, 0.459, -0.436 ], "z_axis": [ -0.242, -0.851, -0.467 ], "quaternion": [ -0.319, -0.325, 0.792, -0.406 ] } }, { "index": 40, "index_chain": 5, "chain_name": "W", "nt_resnum": 4, "nt_name": "DC", "nt_code": "C", "nt_id": "///W/4", "linked_nts": [ "///W/3", "///W/5" ], "nt_type": "DNA", "dbn": "[", "summary": "pseudoknotted,anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,phosphate", "alpha": -6.635, "beta": 164.043, "gamma": 11.077, "delta": 123.762, "epsilon": -168.038, "zeta": -100.043, "epsilon_zeta": -67.995, "bb_type": "BI", "chi": -135.006, "glyco_bond": "anti", "C5prime_xyz": [ -2.309, 8.885, -0.870 ], "P_xyz": [ -0.775, 10.670, 0.419 ], "form": "B", "ssZp": 2.476, "Dp": 2.492, "splay_angle": 17.788, "splay_distance": 3.101, "splay_ratio": 0.158, "d22": null, "d64": null, "eta": -179.648, "theta": -148.681, "eta_prime": -163.900, "theta_prime": -147.741, "eta_base": -112.249, "theta_base": -103.687, "v0": -32.623, "v1": 35.357, "v2": -24.894, "v3": 6.438, "v4": 16.310, "amplitude": 35.491, "phase_angle": 134.542, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.062, "frame": { "rmsd": 0.005, "origin": [ 54.866, -88.415, 33.385 ], "x_axis": [ -0.893, 0.133, 0.429 ], "y_axis": [ -0.236, 0.673, -0.701 ], "z_axis": [ -0.382, -0.728, -0.570 ], "quaternion": [ -0.229, -0.029, 0.885, -0.403 ] } }, { "index": 41, "index_chain": 6, "chain_name": "W", "nt_resnum": 5, "nt_name": "DA", "nt_code": "A", "nt_id": "///W/5", "linked_nts": [ "///W/4", "///W/6" ], "nt_type": "DNA", "dbn": "[", "summary": "pseudoknotted,anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -50.744, "beta": 167.944, "gamma": 45.111, "delta": 131.118, "epsilon": 162.533, "zeta": -96.712, "epsilon_zeta": -100.754, "bb_type": "BI", "chi": -117.952, "glyco_bond": "anti", "C5prime_xyz": [ -2.748, 8.471, -1.604 ], "P_xyz": [ -0.622, 10.025, -1.371 ], "form": ".", "ssZp": 2.375, "Dp": 2.445, "splay_angle": 17.772, "splay_distance": 3.118, "splay_ratio": 0.167, "d22": null, "d64": null, "eta": 156.628, "theta": -143.765, "eta_prime": -167.669, "theta_prime": -157.060, "eta_base": -114.954, "theta_base": -122.092, "v0": -34.919, "v1": 40.583, "v2": -30.590, "v3": 11.171, "v4": 14.621, "amplitude": 39.923, "phase_angle": 140.016, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.003, "origin": [ 53.200, -90.864, 32.467 ], "x_axis": [ -0.890, 0.444, -0.101 ], "y_axis": [ 0.296, 0.396, -0.869 ], "z_axis": [ -0.347, -0.804, -0.484 ], "quaternion": [ -0.074, 0.222, 0.832, -0.503 ] } }, { "index": 42, "index_chain": 7, "chain_name": "W", "nt_resnum": 6, "nt_name": "DC", "nt_code": "C", "nt_id": "///W/6", "linked_nts": [ "///W/5", "///W/7" ], "nt_type": "DNA", "dbn": "[", "summary": "pseudoknotted,anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -109.312, "beta": -156.256, "gamma": 87.759, "delta": 137.749, "epsilon": -165.678, "zeta": -146.742, "epsilon_zeta": -18.936, "bb_type": "--", "chi": -110.870, "glyco_bond": "anti", "C5prime_xyz": [ -2.903, 8.398, -1.821 ], "P_xyz": [ -0.636, 9.686, -2.150 ], "form": "B", "ssZp": 2.483, "Dp": 2.400, "splay_angle": 20.583, "splay_distance": 3.478, "splay_ratio": 0.181, "d22": null, "d64": null, "eta": 165.411, "theta": -148.811, "eta_prime": -172.848, "theta_prime": -161.931, "eta_base": -130.540, "theta_base": -114.739, "v0": -37.697, "v1": 44.660, "v2": -34.135, "v3": 13.352, "v4": 14.895, "amplitude": 43.684, "phase_angle": 141.388, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.062, "frame": { "rmsd": 0.004, "origin": [ 51.082, -93.123, 32.103 ], "x_axis": [ -0.558, 0.588, -0.585 ], "y_axis": [ 0.679, -0.081, -0.729 ], "z_axis": [ -0.476, -0.805, -0.354 ], "quaternion": [ 0.040, 0.468, 0.677, -0.567 ] } }, { "index": 43, "index_chain": 8, "chain_name": "W", "nt_resnum": 7, "nt_name": "DG", "nt_code": "G", "nt_id": "///W/7", "linked_nts": [ "///W/6", "///W/8" ], "nt_type": "DNA", "dbn": "[", "summary": "pseudoknotted,anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -12.612, "beta": 130.904, "gamma": 37.990, "delta": 128.656, "epsilon": -166.560, "zeta": -120.917, "epsilon_zeta": -45.643, "bb_type": "BI", "chi": -118.996, "glyco_bond": "anti", "C5prime_xyz": [ -3.023, 8.509, -1.624 ], "P_xyz": [ -0.722, 9.782, -1.276 ], "form": "B", "ssZp": 2.229, "Dp": 2.292, "splay_angle": 22.992, "splay_distance": 3.842, "splay_ratio": 0.201, "d22": null, "d64": null, "eta": 172.982, "theta": -149.851, "eta_prime": -161.389, "theta_prime": -162.938, "eta_base": -109.039, "theta_base": -124.989, "v0": -39.442, "v1": 43.137, "v2": -30.307, "v3": 8.461, "v4": 18.998, "amplitude": 42.824, "phase_angle": 135.049, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.002, "frame": { "rmsd": 0.002, "origin": [ 48.747, -95.013, 30.351 ], "x_axis": [ -0.025, 0.455, -0.890 ], "y_axis": [ 0.854, -0.453, -0.256 ], "z_axis": [ -0.519, -0.767, -0.378 ], "quaternion": [ 0.190, 0.672, 0.487, -0.524 ] } }, { "index": 44, "index_chain": 9, "chain_name": "W", "nt_resnum": 8, "nt_name": "DC", "nt_code": "C", "nt_id": "///W/8", "linked_nts": [ "///W/7", "///W/9" ], "nt_type": "DNA", "dbn": "[", "summary": "pseudoknotted,anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -82.625, "beta": 169.642, "gamma": 73.552, "delta": 122.910, "epsilon": -159.016, "zeta": -97.552, "epsilon_zeta": -61.464, "bb_type": "BI", "chi": -132.643, "glyco_bond": "anti", "C5prime_xyz": [ -2.473, 8.798, -1.038 ], "P_xyz": [ -0.034, 9.765, -1.004 ], "form": "B", "ssZp": 2.436, "Dp": 2.422, "splay_angle": 21.183, "splay_distance": 3.713, "splay_ratio": 0.186, "d22": 3.776, "d64": 3.605, "eta": 173.124, "theta": -134.223, "eta_prime": -171.852, "theta_prime": -149.040, "eta_base": -127.797, "theta_base": -104.307, "v0": -36.367, "v1": 35.009, "v2": -20.827, "v3": 0.286, "v4": 22.536, "amplitude": 36.867, "phase_angle": 124.397, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.062, "frame": { "rmsd": 0.002, "origin": [ 46.135, -97.486, 29.000 ], "x_axis": [ 0.506, 0.124, -0.854 ], "y_axis": [ 0.728, -0.592, 0.345 ], "z_axis": [ -0.462, -0.796, -0.390 ], "quaternion": [ 0.362, 0.789, 0.270, -0.417 ] } }, { "index": 45, "index_chain": 10, "chain_name": "W", "nt_resnum": 9, "nt_name": "DC", "nt_code": "C", "nt_id": "///W/9", "linked_nts": [ "///W/8", "///W/10" ], "nt_type": "DNA", "dbn": "[", "summary": "pseudoknotted,anti,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -71.027, "beta": 155.946, "gamma": 69.212, "delta": 98.682, "epsilon": -166.643, "zeta": -109.984, "epsilon_zeta": -56.659, "bb_type": "BI", "chi": -148.987, "glyco_bond": "anti", "C5prime_xyz": [ -2.707, 8.941, -0.672 ], "P_xyz": [ -0.431, 10.245, -0.584 ], "form": ".", "ssZp": 2.612, "Dp": 2.729, "splay_angle": 14.498, "splay_distance": 2.545, "splay_ratio": 0.128, "d22": 4.351, "d64": 4.015, "eta": 168.642, "theta": -157.480, "eta_prime": -170.180, "theta_prime": -159.610, "eta_base": -115.023, "theta_base": -137.171, "v0": -40.026, "v1": 25.945, "v2": -3.142, "v3": -20.047, "v4": 37.684, "amplitude": 40.316, "phase_angle": 94.470, "puckering": "O4'-endo", "sugar_class": "--", "bin": "23p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.004, "origin": [ 44.972, -100.057, 26.588 ], "x_axis": [ 0.899, -0.153, -0.410 ], "y_axis": [ 0.288, -0.498, 0.818 ], "z_axis": [ -0.329, -0.854, -0.404 ], "quaternion": [ 0.499, 0.837, 0.040, -0.221 ] } }, { "index": 46, "index_chain": 11, "chain_name": "W", "nt_resnum": 10, "nt_name": "DT", "nt_code": "T", "nt_id": "///W/10", "linked_nts": [ "///W/9", null ], "nt_type": "DNA", "dbn": "[", "summary": "pseudoknotted,anti,~C2'-endo,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack", "alpha": -11.942, "beta": 147.830, "gamma": 19.260, "delta": 133.240, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": -107.440, "glyco_bond": "anti", "C5prime_xyz": [ -2.872, 8.206, -2.080 ], "P_xyz": [ -0.956, 9.970, -1.669 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": -37.785, "v1": 42.514, "v2": -31.303, "v3": 10.336, "v4": 16.851, "amplitude": 42.137, "phase_angle": 137.978, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.006, "origin": [ 43.646, -101.357, 24.847 ], "x_axis": [ 0.899, -0.436, -0.044 ], "y_axis": [ -0.223, -0.542, 0.810 ], "z_axis": [ -0.377, -0.719, -0.584 ], "quaternion": [ 0.440, 0.870, -0.190, -0.121 ] } }, { "index": 47, "index_chain": 1, "chain_name": "X", "nt_resnum": 1, "nt_name": "DG", "nt_code": "G", "nt_id": "///X/1", "linked_nts": [ null, "///X/2" ], "nt_type": "DNA", "dbn": "}", "summary": "pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack", "alpha": null, "beta": -165.719, "gamma": 52.520, "delta": 84.290, "epsilon": -145.622, "zeta": -84.614, "epsilon_zeta": -61.008, "bb_type": "BI", "chi": -166.665, "glyco_bond": "anti", "C5prime_xyz": [ -1.673, 8.807, 0.857 ], "P_xyz": [ -0.026, 10.245, 1.810 ], "form": "A", "ssZp": 4.304, "Dp": 4.408, "splay_angle": 23.246, "splay_distance": 3.808, "splay_ratio": 0.202, "d22": null, "d64": null, "eta": null, "theta": -162.938, "eta_prime": null, "theta_prime": -153.775, "eta_base": null, "theta_base": -117.771, "v0": -4.629, "v1": -17.696, "v2": 31.752, "v3": -35.180, "v4": 25.106, "amplitude": 35.264, "phase_angle": 25.789, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.003, "frame": { "rmsd": 0.003, "origin": [ 31.260, -11.852, 5.257 ], "x_axis": [ -0.760, -0.224, 0.611 ], "y_axis": [ -0.608, 0.579, -0.543 ], "z_axis": [ -0.232, -0.784, -0.576 ], "quaternion": [ -0.247, -0.243, 0.854, -0.389 ] } }, { "index": 48, "index_chain": 2, "chain_name": "X", "nt_resnum": 2, "nt_name": "DC", "nt_code": "C", "nt_id": "///X/2", "linked_nts": [ "///X/1", "///X/3" ], "nt_type": "DNA", "dbn": "}", "summary": "pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -41.133, "beta": 157.264, "gamma": 43.496, "delta": 82.907, "epsilon": -150.198, "zeta": -80.862, "epsilon_zeta": -69.336, "bb_type": "BI", "chi": -160.854, "glyco_bond": "anti", "C5prime_xyz": [ -1.750, 8.928, 0.425 ], "P_xyz": [ 0.792, 9.521, 0.879 ], "form": "A", "ssZp": 4.219, "Dp": 4.370, "splay_angle": 17.223, "splay_distance": 2.791, "splay_ratio": 0.150, "d22": 4.434, "d64": 3.848, "eta": 171.131, "theta": -148.734, "eta_prime": -172.467, "theta_prime": -147.571, "eta_base": -130.205, "theta_base": -122.189, "v0": -8.485, "v1": -15.243, "v2": 31.500, "v3": -37.193, "v4": 28.758, "amplitude": 36.907, "phase_angle": 31.407, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.428, "filter_rmsd": 0.062, "frame": { "rmsd": 0.003, "origin": [ 30.592, -15.485, 4.333 ], "x_axis": [ -0.963, 0.140, 0.229 ], "y_axis": [ -0.096, 0.616, -0.782 ], "z_axis": [ -0.250, -0.775, -0.580 ], "quaternion": [ -0.135, 0.012, 0.889, -0.438 ] } }, { "index": 49, "index_chain": 3, "chain_name": "X", "nt_resnum": 3, "nt_name": "DT", "nt_code": "T", "nt_id": "///X/3", "linked_nts": [ "///X/2", "///X/4" ], "nt_type": "DNA", "dbn": "}", "summary": "pseudoknotted,anti,~C3'-endo,BII,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,splayed-apart", "alpha": -74.060, "beta": 169.956, "gamma": 63.346, "delta": 93.961, "epsilon": -116.974, "zeta": 153.682, "epsilon_zeta": 89.345, "bb_type": "BII", "chi": -147.157, "glyco_bond": "anti", "C5prime_xyz": [ -1.665, 8.834, -0.332 ], "P_xyz": [ 0.909, 9.284, -0.676 ], "form": ".", "ssZp": 3.457, "Dp": 4.230, "splay_angle": 124.453, "splay_distance": 15.981, "splay_ratio": 0.886, "d22": null, "d64": null, "eta": 177.144, "theta": 87.940, "eta_prime": -172.726, "theta_prime": 32.992, "eta_base": -140.560, "theta_base": -82.095, "v0": -9.847, "v1": -11.141, "v2": 26.224, "v3": -32.547, "v4": 26.807, "amplitude": 32.305, "phase_angle": 35.730, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.486, "filter_rmsd": 0.106, "frame": { "rmsd": 0.003, "origin": [ 29.626, -17.992, 3.579 ], "x_axis": [ -0.859, 0.480, -0.177 ], "y_axis": [ 0.329, 0.255, -0.909 ], "z_axis": [ -0.391, -0.840, -0.377 ], "quaternion": [ -0.068, 0.256, 0.789, -0.554 ] } }, { "index": 50, "index_chain": 4, "chain_name": "X", "nt_resnum": 4, "nt_name": "DG", "nt_code": "G", "nt_id": "///X/4", "linked_nts": [ "///X/3", "///X/5" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix-end,stem-end,splayed-apart", "alpha": -70.952, "beta": -125.450, "gamma": 141.400, "delta": 157.083, "epsilon": 152.610, "zeta": -172.437, "epsilon_zeta": -34.953, "bb_type": "--", "chi": -106.982, "glyco_bond": "anti", "C5prime_xyz": [ -1.991, 8.308, -1.659 ], "P_xyz": [ 0.510, 7.634, -2.325 ], "form": ".", "ssZp": 1.874, "Dp": 2.108, "splay_angle": 23.299, "splay_distance": 3.509, "splay_ratio": 0.203, "d22": null, "d64": null, "eta": -81.701, "theta": -104.579, "eta_prime": 43.727, "theta_prime": -168.355, "eta_base": 148.135, "theta_base": -139.301, "v0": -18.467, "v1": 37.912, "v2": -42.001, "v3": 32.427, "v4": -8.841, "amplitude": 42.287, "phase_angle": 173.332, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.002, "frame": { "rmsd": 0.002, "origin": [ 29.742, -21.741, -11.956 ], "x_axis": [ -0.825, 0.148, 0.546 ], "y_axis": [ 0.544, 0.471, 0.695 ], "z_axis": [ -0.154, 0.870, -0.469 ], "quaternion": [ -0.210, 0.208, 0.831, 0.470 ] } }, { "index": 51, "index_chain": 5, "chain_name": "X", "nt_resnum": 5, "nt_name": "DA", "nt_code": "A", "nt_id": "///X/5", "linked_nts": [ "///X/4", "///X/6" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": 77.742, "beta": 96.532, "gamma": 16.970, "delta": 134.014, "epsilon": 155.925, "zeta": -97.361, "epsilon_zeta": -106.714, "bb_type": "BI", "chi": -90.335, "glyco_bond": "anti", "C5prime_xyz": [ -2.909, 7.669, -2.630 ], "P_xyz": [ -0.455, 8.558, -2.146 ], "form": "B", "ssZp": 2.202, "Dp": 2.280, "splay_angle": 20.052, "splay_distance": 3.249, "splay_ratio": 0.175, "d22": null, "d64": null, "eta": 172.568, "theta": -135.164, "eta_prime": -173.213, "theta_prime": -157.254, "eta_base": -137.925, "theta_base": -110.429, "v0": -27.933, "v1": 37.657, "v2": -32.595, "v3": 17.247, "v4": 6.470, "amplitude": 37.143, "phase_angle": 151.348, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.003, "origin": [ 29.087, -19.329, -14.419 ], "x_axis": [ -0.434, 0.504, 0.747 ], "y_axis": [ 0.886, 0.388, 0.253 ], "z_axis": [ -0.162, 0.772, -0.615 ], "quaternion": [ -0.291, 0.445, 0.780, 0.328 ] } }, { "index": 52, "index_chain": 6, "chain_name": "X", "nt_resnum": 6, "nt_name": "DG", "nt_code": "G", "nt_id": "///X/6", "linked_nts": [ "///X/5", "///X/7" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": -91.325, "beta": -167.886, "gamma": 82.729, "delta": 139.217, "epsilon": 176.273, "zeta": -169.213, "epsilon_zeta": -14.513, "bb_type": "--", "chi": -109.987, "glyco_bond": "anti", "C5prime_xyz": [ -2.451, 8.373, -1.829 ], "P_xyz": [ 0.008, 9.214, -2.150 ], "form": "B", "ssZp": 2.333, "Dp": 2.275, "splay_angle": 21.593, "splay_distance": 3.493, "splay_ratio": 0.188, "d22": null, "d64": null, "eta": 164.192, "theta": -150.641, "eta_prime": -167.889, "theta_prime": -166.236, "eta_base": -113.370, "theta_base": -139.367, "v0": -29.927, "v1": 38.907, "v2": -32.811, "v3": 16.219, "v4": 8.422, "amplitude": 38.339, "phase_angle": 148.850, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.003, "frame": { "rmsd": 0.003, "origin": [ 28.203, -16.311, -15.231 ], "x_axis": [ 0.257, 0.544, 0.799 ], "y_axis": [ 0.927, 0.095, -0.363 ], "z_axis": [ -0.273, 0.834, -0.480 ], "quaternion": [ -0.467, 0.641, 0.574, 0.205 ] } }, { "index": 53, "index_chain": 7, "chain_name": "X", "nt_resnum": 7, "nt_name": "DG", "nt_code": "G", "nt_id": "///X/7", "linked_nts": [ "///X/6", "///X/8" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": 41.614, "beta": 97.285, "gamma": 24.719, "delta": 122.267, "epsilon": 174.120, "zeta": -161.015, "epsilon_zeta": -24.865, "bb_type": "--", "chi": -111.622, "glyco_bond": "anti", "C5prime_xyz": [ -2.994, 8.328, -2.033 ], "P_xyz": [ -0.699, 9.328, -1.228 ], "form": "B", "ssZp": 2.098, "Dp": 2.286, "splay_angle": 21.263, "splay_distance": 3.407, "splay_ratio": 0.185, "d22": null, "d64": null, "eta": 173.118, "theta": -152.176, "eta_prime": -166.506, "theta_prime": -162.978, "eta_base": -135.172, "theta_base": -125.557, "v0": -39.455, "v1": 41.036, "v2": -27.227, "v3": 5.166, "v4": 21.156, "amplitude": 41.521, "phase_angle": 130.976, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.007, "frame": { "rmsd": 0.007, "origin": [ 26.434, -13.747, -16.813 ], "x_axis": [ 0.645, 0.506, 0.573 ], "y_axis": [ 0.716, -0.138, -0.684 ], "z_axis": [ -0.267, 0.851, -0.452 ], "quaternion": [ 0.514, -0.747, -0.409, -0.102 ] } }, { "index": 54, "index_chain": 8, "chain_name": "X", "nt_resnum": 8, "nt_name": "DA", "nt_code": "A", "nt_id": "///X/8", "linked_nts": [ "///X/7", "///X/9" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": 38.625, "beta": 109.566, "gamma": 13.433, "delta": 135.731, "epsilon": 170.285, "zeta": -137.155, "epsilon_zeta": -52.561, "bb_type": "--", "chi": -102.747, "glyco_bond": "anti", "C5prime_xyz": [ -2.684, 8.107, -2.181 ], "P_xyz": [ -0.454, 9.159, -1.294 ], "form": "B", "ssZp": 2.039, "Dp": 2.173, "splay_angle": 19.285, "splay_distance": 3.160, "splay_ratio": 0.170, "d22": null, "d64": null, "eta": 169.324, "theta": -137.741, "eta_prime": -168.803, "theta_prime": -155.693, "eta_base": -125.969, "theta_base": -105.104, "v0": -31.152, "v1": 39.385, "v2": -32.573, "v3": 15.362, "v4": 9.648, "amplitude": 38.790, "phase_angle": 147.113, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.039, "frame": { "rmsd": 0.010, "origin": [ 25.182, -10.883, -18.169 ], "x_axis": [ 0.925, 0.367, 0.097 ], "y_axis": [ 0.247, -0.391, -0.887 ], "z_axis": [ -0.288, 0.844, -0.452 ], "quaternion": [ 0.520, -0.832, -0.185, 0.057 ] } }, { "index": 55, "index_chain": 9, "chain_name": "X", "nt_resnum": 9, "nt_name": "DG", "nt_code": "G", "nt_id": "///X/9", "linked_nts": [ "///X/8", "///X/10" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": 39.863, "beta": 149.897, "gamma": -18.476, "delta": 160.222, "epsilon": 172.798, "zeta": -111.893, "epsilon_zeta": -75.309, "bb_type": "BI", "chi": -91.663, "glyco_bond": "anti", "C5prime_xyz": [ -1.859, 7.672, -2.326 ], "P_xyz": [ 0.078, 9.369, -1.938 ], "form": ".", "ssZp": 1.486, "Dp": 1.550, "splay_angle": 21.583, "splay_distance": 3.706, "splay_ratio": 0.193, "d22": null, "d64": null, "eta": 174.483, "theta": -147.388, "eta_prime": -159.090, "theta_prime": -164.944, "eta_base": -104.425, "theta_base": -127.145, "v0": -6.610, "v1": 27.603, "v2": -36.870, "v3": 33.938, "v4": -17.215, "amplitude": 37.278, "phase_angle": 188.490, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.007, "frame": { "rmsd": 0.007, "origin": [ 25.283, -7.971, -19.392 ], "x_axis": [ 0.855, 0.002, -0.518 ], "y_axis": [ -0.464, -0.444, -0.767 ], "z_axis": [ -0.231, 0.896, -0.379 ], "quaternion": [ 0.508, -0.818, 0.141, 0.229 ] } }, { "index": 56, "index_chain": 10, "chain_name": "X", "nt_resnum": 10, "nt_name": "DT", "nt_code": "T", "nt_id": "///X/10", "linked_nts": [ "///X/9", "///X/11" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -52.463, "beta": -172.892, "gamma": 39.151, "delta": 135.317, "epsilon": 176.205, "zeta": -99.855, "epsilon_zeta": -83.940, "bb_type": "BI", "chi": -108.519, "glyco_bond": "anti", "C5prime_xyz": [ -2.477, 8.280, -1.880 ], "P_xyz": [ -0.514, 9.948, -1.431 ], "form": "B", "ssZp": 2.126, "Dp": 2.192, "splay_angle": 20.946, "splay_distance": 3.602, "splay_ratio": 0.186, "d22": 4.116, "d64": 3.893, "eta": 172.616, "theta": -146.296, "eta_prime": -169.358, "theta_prime": -156.816, "eta_base": -126.984, "theta_base": -106.135, "v0": -26.838, "v1": 36.517, "v2": -31.981, "v3": 17.251, "v4": 5.786, "amplitude": 36.153, "phase_angle": 152.203, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.107, "frame": { "rmsd": 0.003, "origin": [ 24.912, -4.348, -20.073 ], "x_axis": [ 0.483, -0.175, -0.858 ], "y_axis": [ -0.818, -0.441, -0.370 ], "z_axis": [ -0.314, 0.880, -0.356 ], "quaternion": [ -0.414, 0.755, -0.329, -0.388 ] } }, { "index": 57, "index_chain": 11, "chain_name": "X", "nt_resnum": 11, "nt_name": "DC", "nt_code": "C", "nt_id": "///X/11", "linked_nts": [ "///X/10", "///X/12" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -41.136, "beta": -177.278, "gamma": 36.730, "delta": 134.069, "epsilon": 177.902, "zeta": -87.380, "epsilon_zeta": -94.718, "bb_type": "BI", "chi": -107.762, "glyco_bond": "anti", "C5prime_xyz": [ -2.236, 8.339, -1.944 ], "P_xyz": [ -0.218, 9.959, -1.483 ], "form": ".", "ssZp": 1.761, "Dp": 1.991, "splay_angle": 16.672, "splay_distance": 2.819, "splay_ratio": 0.146, "d22": 4.282, "d64": 3.810, "eta": 178.064, "theta": -129.481, "eta_prime": -157.314, "theta_prime": -142.621, "eta_base": -102.424, "theta_base": -133.836, "v0": -23.680, "v1": 34.878, "v2": -32.367, "v3": 19.445, "v4": 2.469, "amplitude": 35.074, "phase_angle": 157.344, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.007, "origin": [ 24.627, -1.522, -22.289 ], "x_axis": [ -0.174, -0.407, -0.897 ], "y_axis": [ -0.942, -0.197, 0.272 ], "z_axis": [ -0.288, 0.892, -0.349 ], "quaternion": [ -0.264, 0.586, -0.576, -0.505 ] } }, { "index": 58, "index_chain": 12, "chain_name": "X", "nt_resnum": 12, "nt_name": "DT", "nt_code": "T", "nt_id": "///X/12", "linked_nts": [ "///X/11", null ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix-end,stem-end", "alpha": -116.499, "beta": -151.683, "gamma": 58.091, "delta": 130.558, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": -80.670, "glyco_bond": "anti", "C5prime_xyz": [ -3.695, 7.302, -2.621 ], "P_xyz": [ -1.858, 8.950, -3.599 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": -34.375, "v1": 38.951, "v2": -28.567, "v3": 9.524, "v4": 15.321, "amplitude": 38.432, "phase_angle": 138.015, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.107, "frame": { "rmsd": 0.005, "origin": [ 24.722, 1.180, -23.090 ], "x_axis": [ -0.437, -0.591, -0.678 ], "y_axis": [ -0.888, 0.162, 0.431 ], "z_axis": [ -0.145, 0.790, -0.595 ], "quaternion": [ 0.180, -0.499, 0.741, 0.412 ] } }, { "index": 59, "index_chain": 1, "chain_name": "Z", "nt_resnum": 11, "nt_name": "DA", "nt_code": "A", "nt_id": "///Z/11", "linked_nts": [ null, "///Z/12" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix-end,stem-end", "alpha": null, "beta": 115.545, "gamma": 43.324, "delta": 125.112, "epsilon": -168.969, "zeta": -108.409, "epsilon_zeta": -60.560, "bb_type": "BI", "chi": -117.443, "glyco_bond": "anti", "C5prime_xyz": [ -2.274, 8.450, -1.685 ], "P_xyz": [ 0.323, 8.440, -1.419 ], "form": "B", "ssZp": 2.255, "Dp": 2.408, "splay_angle": 18.722, "splay_distance": 3.206, "splay_ratio": 0.163, "d22": null, "d64": null, "eta": null, "theta": -125.569, "eta_prime": null, "theta_prime": -147.130, "eta_base": null, "theta_base": -115.716, "v0": -29.434, "v1": 31.100, "v2": -21.334, "v3": 4.826, "v4": 15.353, "amplitude": 31.436, "phase_angle": 132.738, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.005, "origin": [ 24.207, 0.945, -23.937 ], "x_axis": [ -0.529, -0.576, -0.623 ], "y_axis": [ 0.808, -0.117, -0.578 ], "z_axis": [ 0.260, -0.809, 0.527 ], "quaternion": [ -0.469, -0.123, -0.471, 0.737 ] } }, { "index": 60, "index_chain": 2, "chain_name": "Z", "nt_resnum": 12, "nt_name": "DG", "nt_code": "G", "nt_id": "///Z/12", "linked_nts": [ "///Z/11", "///Z/13" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": -37.480, "beta": 161.920, "gamma": 35.729, "delta": 139.319, "epsilon": -164.083, "zeta": -170.065, "epsilon_zeta": 5.983, "bb_type": "--", "chi": -105.251, "glyco_bond": "anti", "C5prime_xyz": [ -2.930, 8.202, -1.961 ], "P_xyz": [ -0.789, 9.736, -1.846 ], "form": "B", "ssZp": 2.267, "Dp": 2.203, "splay_angle": 20.544, "splay_distance": 3.355, "splay_ratio": 0.178, "d22": null, "d64": null, "eta": 166.988, "theta": -164.130, "eta_prime": -163.868, "theta_prime": -171.686, "eta_base": -123.448, "theta_base": -134.784, "v0": -33.035, "v1": 42.069, "v2": -34.631, "v3": 16.643, "v4": 9.925, "amplitude": 41.147, "phase_angle": 147.315, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.003, "frame": { "rmsd": 0.003, "origin": [ 24.612, -1.882, -22.481 ], "x_axis": [ -0.067, -0.519, -0.852 ], "y_axis": [ 0.984, 0.109, -0.143 ], "z_axis": [ 0.167, -0.848, 0.504 ], "quaternion": [ 0.622, 0.283, 0.410, -0.604 ] } }, { "index": 61, "index_chain": 3, "chain_name": "Z", "nt_resnum": 13, "nt_name": "DA", "nt_code": "A", "nt_id": "///Z/13", "linked_nts": [ "///Z/12", "///Z/14" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": 9.438, "beta": 125.413, "gamma": 15.354, "delta": 134.765, "epsilon": -174.504, "zeta": -116.195, "epsilon_zeta": -58.310, "bb_type": "BI", "chi": -106.541, "glyco_bond": "anti", "C5prime_xyz": [ -2.442, 8.258, -1.963 ], "P_xyz": [ -0.129, 9.291, -1.225 ], "form": "B", "ssZp": 2.068, "Dp": 2.091, "splay_angle": 18.387, "splay_distance": 3.208, "splay_ratio": 0.163, "d22": null, "d64": null, "eta": 174.018, "theta": -136.611, "eta_prime": -168.591, "theta_prime": -151.850, "eta_base": -129.260, "theta_base": -114.329, "v0": -25.186, "v1": 35.436, "v2": -32.102, "v3": 18.153, "v4": 4.257, "amplitude": 35.511, "phase_angle": 154.689, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.005, "origin": [ 24.783, -4.570, -20.480 ], "x_axis": [ 0.476, -0.368, -0.799 ], "y_axis": [ 0.866, 0.357, 0.351 ], "z_axis": [ 0.156, -0.859, 0.488 ], "quaternion": [ 0.762, 0.397, 0.313, -0.405 ] } }, { "index": 62, "index_chain": 4, "chain_name": "Z", "nt_resnum": 14, "nt_name": "DC", "nt_code": "C", "nt_id": "///Z/14", "linked_nts": [ "///Z/13", "///Z/15" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem", "alpha": -26.738, "beta": 161.809, "gamma": 26.458, "delta": 138.251, "epsilon": -178.341, "zeta": -162.661, "epsilon_zeta": -15.680, "bb_type": "--", "chi": -104.144, "glyco_bond": "anti", "C5prime_xyz": [ -2.883, 8.256, -1.969 ], "P_xyz": [ -0.912, 9.971, -1.732 ], "form": "B", "ssZp": 2.282, "Dp": 2.248, "splay_angle": 22.304, "splay_distance": 3.548, "splay_ratio": 0.193, "d22": 4.558, "d64": 3.786, "eta": 167.509, "theta": -161.963, "eta_prime": -166.143, "theta_prime": -166.896, "eta_base": -121.403, "theta_base": -120.720, "v0": -33.440, "v1": 43.156, "v2": -35.992, "v3": 17.764, "v4": 9.514, "amplitude": 42.292, "phase_angle": 148.326, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.003, "origin": [ 25.118, -7.661, -19.688 ], "x_axis": [ 0.862, -0.144, -0.486 ], "y_axis": [ 0.497, 0.434, 0.752 ], "z_axis": [ 0.103, -0.889, 0.445 ], "quaternion": [ 0.828, 0.496, 0.178, -0.194 ] } }, { "index": 63, "index_chain": 5, "chain_name": "Z", "nt_resnum": 15, "nt_name": "DT", "nt_code": "T", "nt_id": "///Z/15", "linked_nts": [ "///Z/14", "///Z/16" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": 31.447, "beta": 125.300, "gamma": 5.104, "delta": 138.420, "epsilon": 171.653, "zeta": -101.979, "epsilon_zeta": -86.368, "bb_type": "BI", "chi": -99.705, "glyco_bond": "anti", "C5prime_xyz": [ -2.141, 8.006, -2.225 ], "P_xyz": [ 0.125, 9.046, -1.403 ], "form": "B", "ssZp": 1.964, "Dp": 2.076, "splay_angle": 20.204, "splay_distance": 3.398, "splay_ratio": 0.177, "d22": 4.325, "d64": 3.994, "eta": 174.455, "theta": -139.234, "eta_prime": -167.857, "theta_prime": -154.947, "eta_base": -118.858, "theta_base": -113.887, "v0": -18.808, "v1": 31.380, "v2": -31.493, "v3": 21.217, "v4": -1.687, "amplitude": 32.716, "phase_angle": 164.279, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.004, "origin": [ 25.798, -10.828, -18.240 ], "x_axis": [ 0.976, 0.203, 0.081 ], "y_axis": [ -0.160, 0.411, 0.897 ], "z_axis": [ 0.148, -0.889, 0.434 ], "quaternion": [ 0.840, 0.532, 0.020, 0.108 ] } }, { "index": 64, "index_chain": 6, "chain_name": "Z", "nt_resnum": 16, "nt_name": "DC", "nt_code": "C", "nt_id": "///Z/16", "linked_nts": [ "///Z/15", "///Z/17" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -46.068, "beta": -176.691, "gamma": 40.878, "delta": 132.629, "epsilon": -178.166, "zeta": -101.081, "epsilon_zeta": -77.085, "bb_type": "BI", "chi": -105.629, "glyco_bond": "anti", "C5prime_xyz": [ -2.350, 8.229, -2.034 ], "P_xyz": [ -0.131, 9.636, -1.884 ], "form": "B", "ssZp": 2.262, "Dp": 2.338, "splay_angle": 20.506, "splay_distance": 3.571, "splay_ratio": 0.180, "d22": 4.253, "d64": 4.132, "eta": 174.742, "theta": -144.277, "eta_prime": -165.590, "theta_prime": -155.384, "eta_base": -118.023, "theta_base": -121.788, "v0": -24.327, "v1": 31.950, "v2": -27.305, "v3": 13.809, "v4": 6.449, "amplitude": 31.594, "phase_angle": 149.796, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.004, "origin": [ 26.895, -13.766, -16.932 ], "x_axis": [ 0.715, 0.348, 0.606 ], "y_axis": [ -0.684, 0.172, 0.708 ], "z_axis": [ 0.142, -0.921, 0.362 ], "quaternion": [ 0.750, 0.543, -0.155, 0.344 ] } }, { "index": 65, "index_chain": 7, "chain_name": "Z", "nt_resnum": 17, "nt_name": "DC", "nt_code": "C", "nt_id": "///Z/17", "linked_nts": [ "///Z/16", "///Z/18" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -52.861, "beta": 173.499, "gamma": 51.685, "delta": 111.129, "epsilon": -172.074, "zeta": -104.438, "epsilon_zeta": -67.636, "bb_type": "BI", "chi": -119.086, "glyco_bond": "anti", "C5prime_xyz": [ -2.817, 8.442, -1.827 ], "P_xyz": [ -0.704, 9.971, -1.970 ], "form": "B", "ssZp": 2.382, "Dp": 2.555, "splay_angle": 18.236, "splay_distance": 3.158, "splay_ratio": 0.159, "d22": 4.155, "d64": 3.681, "eta": 178.030, "theta": -158.726, "eta_prime": -165.567, "theta_prime": -164.459, "eta_base": -126.821, "theta_base": -128.649, "v0": -37.285, "v1": 29.534, "v2": -11.461, "v3": -9.716, "v4": 29.357, "amplitude": 36.265, "phase_angle": 108.423, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.062, "frame": { "rmsd": 0.005, "origin": [ 28.160, -16.821, -15.585 ], "x_axis": [ 0.279, 0.408, 0.869 ], "y_axis": [ -0.935, -0.089, 0.343 ], "z_axis": [ 0.217, -0.909, 0.356 ], "quaternion": [ 0.622, 0.503, -0.262, 0.540 ] } }, { "index": 66, "index_chain": 8, "chain_name": "Z", "nt_resnum": 18, "nt_name": "DT", "nt_code": "T", "nt_id": "///Z/18", "linked_nts": [ "///Z/17", "///Z/19" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -49.887, "beta": 157.882, "gamma": 59.576, "delta": 115.737, "epsilon": -161.002, "zeta": -97.573, "epsilon_zeta": -63.429, "bb_type": "BI", "chi": -124.598, "glyco_bond": "anti", "C5prime_xyz": [ -2.708, 8.581, -1.695 ], "P_xyz": [ -0.434, 9.875, -1.720 ], "form": "B", "ssZp": 1.775, "Dp": 2.111, "splay_angle": 18.282, "splay_distance": 3.120, "splay_ratio": 0.159, "d22": 4.405, "d64": 3.545, "eta": -177.906, "theta": -146.663, "eta_prime": -159.177, "theta_prime": -154.054, "eta_base": -121.575, "theta_base": -112.339, "v0": -37.788, "v1": 33.786, "v2": -17.834, "v3": -3.721, "v4": 26.027, "amplitude": 37.441, "phase_angle": 118.444, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.006, "origin": [ 29.218, -19.511, -14.313 ], "x_axis": [ -0.243, 0.364, 0.899 ], "y_axis": [ -0.925, -0.365, -0.102 ], "z_axis": [ 0.291, -0.857, 0.426 ], "quaternion": [ 0.452, 0.417, -0.336, 0.713 ] } }, { "index": 67, "index_chain": 9, "chain_name": "Z", "nt_resnum": 19, "nt_name": "DC", "nt_code": "C", "nt_id": "///Z/19", "linked_nts": [ "///Z/18", "///Z/20" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,phosphate", "alpha": -71.328, "beta": 172.684, "gamma": 48.712, "delta": 128.376, "epsilon": -173.802, "zeta": -121.636, "epsilon_zeta": -52.167, "bb_type": "BI", "chi": -104.194, "glyco_bond": "anti", "C5prime_xyz": [ -2.716, 8.168, -2.128 ], "P_xyz": [ -0.506, 9.471, -2.505 ], "form": "B", "ssZp": 2.208, "Dp": 2.258, "splay_angle": 18.659, "splay_distance": 3.223, "splay_ratio": 0.163, "d22": 4.225, "d64": 3.629, "eta": 157.469, "theta": -148.967, "eta_prime": -175.832, "theta_prime": -162.745, "eta_base": -128.662, "theta_base": -129.122, "v0": -32.200, "v1": 36.260, "v2": -26.499, "v3": 8.649, "v4": 14.588, "amplitude": 35.869, "phase_angle": 137.628, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.062, "frame": { "rmsd": 0.002, "origin": [ 29.856, -22.112, -12.712 ], "x_axis": [ -0.753, 0.133, 0.644 ], "y_axis": [ -0.576, -0.608, -0.547 ], "z_axis": [ 0.319, -0.783, 0.534 ], "quaternion": [ 0.208, 0.283, -0.391, 0.851 ] } }, { "index": 68, "index_chain": 10, "chain_name": "Z", "nt_resnum": 20, "nt_name": "DT", "nt_code": "T", "nt_id": "///Z/20", "linked_nts": [ "///Z/19", "///Z/21" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,non-pair-contact,ss-non-loop,phosphate", "alpha": 22.241, "beta": 178.843, "gamma": -33.518, "delta": 162.008, "epsilon": -93.956, "zeta": -36.068, "epsilon_zeta": -57.887, "bb_type": "--", "chi": -96.400, "glyco_bond": "anti", "C5prime_xyz": [ -1.665, 7.707, -2.106 ], "P_xyz": [ -0.102, 9.805, -2.270 ], "form": ".", "ssZp": 0.192, "Dp": 0.779, "splay_angle": 64.890, "splay_distance": 10.099, "splay_ratio": 0.542, "d22": 6.971, "d64": 7.933, "eta": -154.951, "theta": -37.078, "eta_prime": -146.271, "theta_prime": -100.794, "eta_base": -115.939, "theta_base": -125.060, "v0": -5.658, "v1": 26.651, "v2": -36.082, "v3": 33.673, "v4": -17.678, "amplitude": 36.608, "phase_angle": 189.731, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.107, "frame": { "rmsd": 0.002, "origin": [ 30.697, -24.281, -10.482 ], "x_axis": [ -0.982, -0.084, 0.170 ], "y_axis": [ -0.067, -0.685, -0.725 ], "z_axis": [ 0.177, -0.723, 0.667 ], "quaternion": [ -0.005, 0.095, -0.397, 0.913 ] } }, { "index": 69, "index_chain": 11, "chain_name": "Z", "nt_resnum": 21, "nt_name": "DT", "nt_code": "T", "nt_id": "///Z/21", "linked_nts": [ "///Z/20", "///Z/22" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,non-pair-contact,ss-non-loop", "alpha": -153.221, "beta": 101.160, "gamma": 60.398, "delta": 93.676, "epsilon": 113.330, "zeta": -104.582, "epsilon_zeta": -142.088, "bb_type": "--", "chi": -153.750, "glyco_bond": "anti", "C5prime_xyz": [ -2.139, 8.919, -0.066 ], "P_xyz": [ 0.461, 8.428, 0.065 ], "form": ".", "ssZp": 1.663, "Dp": 2.036, "splay_angle": 20.512, "splay_distance": 3.288, "splay_ratio": 0.178, "d22": 4.437, "d64": 4.012, "eta": -5.926, "theta": -171.680, "eta_prime": 106.665, "theta_prime": 118.020, "eta_base": 125.455, "theta_base": 91.401, "v0": -24.802, "v1": 13.270, "v2": 2.051, "v3": -16.369, "v4": 26.122, "amplitude": 26.257, "phase_angle": 85.521, "puckering": "O4'-endo", "sugar_class": "--", "bin": "23p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.108, "frame": { "rmsd": 0.005, "origin": [ 36.380, -32.576, -9.535 ], "x_axis": [ 0.082, 0.958, 0.273 ], "y_axis": [ -0.081, 0.279, -0.957 ], "z_axis": [ -0.993, 0.057, 0.101 ], "quaternion": [ 0.605, -0.419, -0.524, 0.430 ] } }, { "index": 70, "index_chain": 12, "chain_name": "Z", "nt_resnum": 22, "nt_name": "DT", "nt_code": "T", "nt_id": "///Z/22", "linked_nts": [ "///Z/21", null ], "nt_type": "DNA", "dbn": ".", "summary": "non-pair-contact,ss-non-loop,phosphate", "alpha": 19.029, "beta": 120.694, "gamma": -2.801, "delta": 104.481, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": 137.236, "glyco_bond": "--", "C5prime_xyz": [ -3.506, 7.765, 2.509 ], "P_xyz": [ -4.056, 6.689, 4.882 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": -37.226, "v1": 26.255, "v2": -6.323, "v3": -15.168, "v4": 33.064, "amplitude": 36.845, "phase_angle": 99.882, "puckering": "O4'-endo", "sugar_class": "--", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.107, "frame": { "rmsd": 0.004, "origin": [ 39.232, -33.805, -10.614 ], "x_axis": [ 0.240, 0.970, 0.027 ], "y_axis": [ 0.024, 0.022, -0.999 ], "z_axis": [ -0.970, 0.240, -0.018 ], "quaternion": [ 0.558, -0.556, -0.447, 0.424 ] } }, { "index": 71, "index_chain": 1, "chain_name": "Y", "nt_resnum": 8, "nt_name": "DA", "nt_code": "A", "nt_id": "///Y/8", "linked_nts": [ null, "///Y/9" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack", "alpha": null, "beta": 102.209, "gamma": -18.659, "delta": 143.583, "epsilon": -170.295, "zeta": -153.939, "epsilon_zeta": -16.356, "bb_type": "--", "chi": -99.736, "glyco_bond": "anti", "C5prime_xyz": [ -2.595, 8.042, -2.121 ], "P_xyz": [ -1.018, 9.731, -0.810 ], "form": "B", "ssZp": 2.319, "Dp": 2.198, "splay_angle": 21.848, "splay_distance": 3.585, "splay_ratio": 0.190, "d22": null, "d64": null, "eta": null, "theta": -148.227, "eta_prime": null, "theta_prime": -147.125, "eta_base": null, "theta_base": -103.971, "v0": -25.184, "v1": 38.105, "v2": -35.686, "v3": 22.123, "v4": 1.731, "amplitude": 38.311, "phase_angle": 158.665, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.037, "frame": { "rmsd": 0.004, "origin": [ 39.108, 5.212, 19.058 ], "x_axis": [ -0.001, 0.428, -0.904 ], "y_axis": [ 0.810, -0.530, -0.252 ], "z_axis": [ -0.587, -0.732, -0.347 ], "quaternion": [ 0.175, 0.685, 0.452, -0.544 ] } }, { "index": 72, "index_chain": 2, "chain_name": "Y", "nt_resnum": 9, "nt_name": "DG", "nt_code": "G", "nt_id": "///Y/9", "linked_nts": [ "///Y/8", "///Y/10" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": 15.825, "beta": 122.004, "gamma": 14.483, "delta": 148.845, "epsilon": -126.585, "zeta": -173.379, "epsilon_zeta": 46.794, "bb_type": "BII", "chi": -96.072, "glyco_bond": "anti", "C5prime_xyz": [ -2.998, 8.009, -2.190 ], "P_xyz": [ -0.674, 9.250, -1.859 ], "form": "B", "ssZp": 1.746, "Dp": 1.530, "splay_angle": 20.026, "splay_distance": 3.408, "splay_ratio": 0.174, "d22": null, "d64": null, "eta": -179.648, "theta": -152.098, "eta_prime": -155.227, "theta_prime": -167.967, "eta_base": -110.948, "theta_base": -133.252, "v0": -30.147, "v1": 43.052, "v2": -38.879, "v3": 22.593, "v4": 4.481, "amplitude": 42.801, "phase_angle": 155.280, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.006, "frame": { "rmsd": 0.006, "origin": [ 37.530, 2.922, 16.795 ], "x_axis": [ 0.534, 0.134, -0.835 ], "y_axis": [ 0.621, -0.732, 0.280 ], "z_axis": [ -0.574, -0.668, -0.474 ], "quaternion": [ 0.286, 0.828, 0.228, -0.426 ] } }, { "index": 73, "index_chain": 3, "chain_name": "Y", "nt_resnum": 10, "nt_name": "DG", "nt_code": "G", "nt_id": "///Y/10", "linked_nts": [ "///Y/9", "///Y/11" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -40.530, "beta": 132.216, "gamma": 29.976, "delta": 114.352, "epsilon": 179.600, "zeta": -79.938, "epsilon_zeta": -100.462, "bb_type": "BI", "chi": -119.269, "glyco_bond": "anti", "C5prime_xyz": [ -2.720, 8.512, -1.745 ], "P_xyz": [ -0.374, 9.713, -1.483 ], "form": ".", "ssZp": 2.396, "Dp": 2.450, "splay_angle": 20.503, "splay_distance": 3.728, "splay_ratio": 0.185, "d22": null, "d64": null, "eta": 165.824, "theta": -134.297, "eta_prime": 179.944, "theta_prime": -151.704, "eta_base": -140.411, "theta_base": -112.130, "v0": -35.090, "v1": 31.493, "v2": -16.519, "v3": -3.238, "v4": 23.969, "amplitude": 34.663, "phase_angle": 118.460, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.006, "frame": { "rmsd": 0.006, "origin": [ 35.131, 0.914, 15.443 ], "x_axis": [ 0.816, -0.190, -0.546 ], "y_axis": [ 0.284, -0.691, 0.665 ], "z_axis": [ -0.503, -0.698, -0.510 ], "quaternion": [ 0.392, 0.868, 0.027, -0.302 ] } }, { "index": 74, "index_chain": 4, "chain_name": "Y", "nt_resnum": 11, "nt_name": "DC", "nt_code": "C", "nt_id": "///Y/11", "linked_nts": [ "///Y/10", "///Y/12" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -83.219, "beta": 173.935, "gamma": 65.556, "delta": 88.482, "epsilon": 176.348, "zeta": -82.026, "epsilon_zeta": -101.626, "bb_type": "BI", "chi": -147.501, "glyco_bond": "anti", "C5prime_xyz": [ -2.858, 8.892, -0.731 ], "P_xyz": [ -0.846, 10.531, -0.870 ], "form": ".", "ssZp": 3.306, "Dp": 3.203, "splay_angle": 20.128, "splay_distance": 3.396, "splay_ratio": 0.176, "d22": null, "d64": null, "eta": 164.410, "theta": -171.168, "eta_prime": -179.952, "theta_prime": -171.434, "eta_base": -128.665, "theta_base": -138.546, "v0": -40.105, "v1": 19.135, "v2": 7.727, "v3": -31.620, "v4": 44.968, "amplitude": 44.805, "phase_angle": 80.069, "puckering": "O4'-endo", "sugar_class": "--", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.061, "frame": { "rmsd": 0.005, "origin": [ 34.321, -1.332, 12.580 ], "x_axis": [ 0.892, -0.450, -0.032 ], "y_axis": [ -0.198, -0.454, 0.869 ], "z_axis": [ -0.406, -0.769, -0.494 ], "quaternion": [ 0.486, 0.843, -0.192, -0.130 ] } }, { "index": 75, "index_chain": 5, "chain_name": "Y", "nt_resnum": 12, "nt_name": "DG", "nt_code": "G", "nt_id": "///Y/12", "linked_nts": [ "///Y/11", "///Y/13" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -89.182, "beta": 172.179, "gamma": 89.925, "delta": 121.098, "epsilon": -162.015, "zeta": -86.559, "epsilon_zeta": -75.456, "bb_type": "BI", "chi": -154.632, "glyco_bond": "anti", "C5prime_xyz": [ -2.280, 8.930, -0.063 ], "P_xyz": [ 0.138, 9.851, 0.120 ], "form": ".", "ssZp": 2.307, "Dp": 2.483, "splay_angle": 20.912, "splay_distance": 3.732, "splay_ratio": 0.188, "d22": null, "d64": null, "eta": 179.179, "theta": -134.380, "eta_prime": -159.797, "theta_prime": -146.546, "eta_base": -122.020, "theta_base": -124.610, "v0": -35.397, "v1": 28.183, "v2": -11.288, "v3": -8.819, "v4": 27.587, "amplitude": 34.392, "phase_angle": 109.160, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.005, "frame": { "rmsd": 0.005, "origin": [ 33.317, -3.314, 10.012 ], "x_axis": [ 0.690, -0.578, 0.436 ], "y_axis": [ -0.622, -0.164, 0.766 ], "z_axis": [ -0.371, -0.800, -0.472 ], "quaternion": [ 0.513, 0.762, -0.393, 0.021 ] } }, { "index": 76, "index_chain": 6, "chain_name": "Y", "nt_resnum": 13, "nt_name": "DT", "nt_code": "T", "nt_id": "///Y/13", "linked_nts": [ "///Y/12", "///Y/14" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -76.552, "beta": -178.040, "gamma": 54.249, "delta": 120.245, "epsilon": -160.826, "zeta": -111.948, "epsilon_zeta": -48.878, "bb_type": "BI", "chi": -127.146, "glyco_bond": "anti", "C5prime_xyz": [ -2.749, 8.551, -1.526 ], "P_xyz": [ -0.885, 10.306, -1.186 ], "form": "B", "ssZp": 2.143, "Dp": 2.348, "splay_angle": 17.951, "splay_distance": 3.033, "splay_ratio": 0.156, "d22": null, "d64": null, "eta": 166.446, "theta": -151.052, "eta_prime": -169.959, "theta_prime": -152.246, "eta_base": -138.034, "theta_base": -103.739, "v0": -41.061, "v1": 36.218, "v2": -18.296, "v3": -4.813, "v4": 28.425, "amplitude": 40.301, "phase_angle": 116.999, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.007, "origin": [ 33.026, -5.565, 7.050 ], "x_axis": [ 0.291, -0.621, 0.728 ], "y_axis": [ -0.884, 0.116, 0.452 ], "z_axis": [ -0.366, -0.775, -0.516 ], "quaternion": [ 0.472, 0.650, -0.579, 0.139 ] } }, { "index": 77, "index_chain": 7, "chain_name": "Y", "nt_resnum": 14, "nt_name": "DG", "nt_code": "G", "nt_id": "///Y/14", "linked_nts": [ "///Y/13", null ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,phosphate", "alpha": -44.387, "beta": 162.422, "gamma": 34.118, "delta": 125.217, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": -103.641, "glyco_bond": "anti", "C5prime_xyz": [ -2.801, 8.110, -2.177 ], "P_xyz": [ -0.569, 9.501, -2.320 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": -32.577, "v1": 33.780, "v2": -22.448, "v3": 4.214, "v4": 17.602, "amplitude": 34.282, "phase_angle": 130.905, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.004, "frame": { "rmsd": 0.004, "origin": [ 32.050, -8.335, 6.292 ], "x_axis": [ -0.307, -0.391, 0.868 ], "y_axis": [ -0.923, 0.343, -0.172 ], "z_axis": [ -0.231, -0.854, -0.466 ], "quaternion": [ -0.378, -0.452, 0.727, -0.353 ] } }, { "index": 78, "index_chain": 1, "chain_name": "T", "nt_resnum": 8, "nt_name": "DA", "nt_code": "A", "nt_id": "///T/8", "linked_nts": [ null, "///T/9" ], "nt_type": "DNA", "dbn": "]", "summary": "pseudoknotted,anti,~C2'-endo,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack", "alpha": null, "beta": -142.372, "gamma": 73.454, "delta": 134.189, "epsilon": 160.234, "zeta": -153.947, "epsilon_zeta": -45.819, "bb_type": "--", "chi": -99.754, "glyco_bond": "anti", "C5prime_xyz": [ -3.211, 7.981, -2.178 ], "P_xyz": [ -1.132, 9.587, -2.400 ], "form": "B", "ssZp": 2.551, "Dp": 2.406, "splay_angle": 24.117, "splay_distance": 3.732, "splay_ratio": 0.209, "d22": null, "d64": null, "eta": null, "theta": -158.733, "eta_prime": null, "theta_prime": -166.426, "eta_base": null, "theta_base": -117.985, "v0": -35.121, "v1": 42.867, "v2": -33.687, "v3": 14.465, "v4": 12.621, "amplitude": 41.796, "phase_angle": 143.706, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.005, "origin": [ 43.298, -101.707, 24.899 ], "x_axis": [ 0.889, -0.430, 0.157 ], "y_axis": [ 0.382, 0.510, -0.770 ], "z_axis": [ 0.251, 0.745, 0.618 ], "quaternion": [ 0.869, -0.436, 0.027, -0.234 ] } }, { "index": 79, "index_chain": 2, "chain_name": "T", "nt_resnum": 9, "nt_name": "DG", "nt_code": "G", "nt_id": "///T/9", "linked_nts": [ "///T/8", "///T/10" ], "nt_type": "DNA", "dbn": "]", "summary": "pseudoknotted,anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": 47.925, "beta": 120.399, "gamma": 10.500, "delta": 151.138, "epsilon": -145.393, "zeta": -155.092, "epsilon_zeta": 9.699, "bb_type": "--", "chi": -95.001, "glyco_bond": "anti", "C5prime_xyz": [ -2.453, 7.923, -2.271 ], "P_xyz": [ -0.121, 8.926, -1.448 ], "form": "B", "ssZp": 1.608, "Dp": 1.677, "splay_angle": 19.539, "splay_distance": 3.380, "splay_ratio": 0.170, "d22": null, "d64": null, "eta": -171.237, "theta": -136.007, "eta_prime": -155.898, "theta_prime": -156.032, "eta_base": -108.341, "theta_base": -126.004, "v0": -19.155, "v1": 35.362, "v2": -37.425, "v3": 27.348, "v4": -5.285, "amplitude": 38.095, "phase_angle": 169.242, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.003, "frame": { "rmsd": 0.003, "origin": [ 45.361, -99.500, 27.089 ], "x_axis": [ 0.881, -0.089, -0.465 ], "y_axis": [ -0.275, 0.704, -0.655 ], "z_axis": [ 0.385, 0.705, 0.596 ], "quaternion": [ 0.892, -0.381, 0.238, 0.052 ] } }, { "index": 80, "index_chain": 3, "chain_name": "T", "nt_resnum": 10, "nt_name": "DG", "nt_code": "G", "nt_id": "///T/10", "linked_nts": [ "///T/9", "///T/11" ], "nt_type": "DNA", "dbn": "]", "summary": "pseudoknotted,anti,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -29.359, "beta": 124.924, "gamma": 38.701, "delta": 104.275, "epsilon": -171.160, "zeta": -86.553, "epsilon_zeta": -84.607, "bb_type": "BI", "chi": -127.925, "glyco_bond": "anti", "C5prime_xyz": [ -3.110, 8.539, -1.652 ], "P_xyz": [ -0.855, 9.890, -1.540 ], "form": ".", "ssZp": 2.343, "Dp": 2.445, "splay_angle": 20.476, "splay_distance": 3.743, "splay_ratio": 0.184, "d22": null, "d64": null, "eta": 169.454, "theta": -142.623, "eta_prime": -176.289, "theta_prime": -156.467, "eta_base": -140.165, "theta_base": -116.780, "v0": -45.682, "v1": 34.449, "v2": -10.975, "v3": -15.215, "v4": 37.797, "amplitude": 44.631, "phase_angle": 104.236, "puckering": "O4'-endo", "sugar_class": "--", "bin": "23p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.007, "frame": { "rmsd": 0.007, "origin": [ 46.508, -97.412, 29.487 ], "x_axis": [ 0.633, 0.165, -0.757 ], "y_axis": [ -0.647, 0.650, -0.399 ], "z_axis": [ 0.426, 0.742, 0.518 ], "quaternion": [ 0.837, -0.341, 0.353, 0.243 ] } }, { "index": 81, "index_chain": 4, "chain_name": "T", "nt_resnum": 11, "nt_name": "DC", "nt_code": "C", "nt_id": "///T/11", "linked_nts": [ "///T/10", "///T/12" ], "nt_type": "DNA", "dbn": "]", "summary": "pseudoknotted,anti,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -71.380, "beta": 164.517, "gamma": 63.684, "delta": 92.285, "epsilon": 169.119, "zeta": -81.305, "epsilon_zeta": -109.576, "bb_type": "BI", "chi": -147.285, "glyco_bond": "anti", "C5prime_xyz": [ -2.892, 8.881, -0.827 ], "P_xyz": [ -0.934, 10.579, -0.946 ], "form": ".", "ssZp": 2.927, "Dp": 2.902, "splay_angle": 19.584, "splay_distance": 3.251, "splay_ratio": 0.171, "d22": null, "d64": null, "eta": 167.534, "theta": -170.641, "eta_prime": -175.246, "theta_prime": -170.948, "eta_base": -126.039, "theta_base": -128.437, "v0": -43.710, "v1": 26.178, "v2": 0.113, "v3": -25.678, "v4": 43.398, "amplitude": 45.152, "phase_angle": 89.857, "puckering": "O4'-endo", "sugar_class": "--", "bin": "33p", "cluster": "1a", "suiteness": 0.028, "filter_rmsd": 0.062, "frame": { "rmsd": 0.002, "origin": [ 49.147, -95.053, 30.703 ], "x_axis": [ 0.135, 0.408, -0.903 ], "y_axis": [ -0.899, 0.433, 0.061 ], "z_axis": [ 0.416, 0.804, 0.425 ], "quaternion": [ 0.706, -0.263, 0.467, 0.463 ] } }, { "index": 82, "index_chain": 5, "chain_name": "T", "nt_resnum": 12, "nt_name": "DG", "nt_code": "G", "nt_id": "///T/12", "linked_nts": [ "///T/11", "///T/13" ], "nt_type": "DNA", "dbn": "]", "summary": "pseudoknotted,anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -110.816, "beta": 177.693, "gamma": 106.222, "delta": 133.872, "epsilon": -153.680, "zeta": -100.766, "epsilon_zeta": -52.914, "bb_type": "BI", "chi": -147.809, "glyco_bond": "anti", "C5prime_xyz": [ -2.189, 8.867, -0.170 ], "P_xyz": [ 0.268, 9.686, -0.099 ], "form": ".", "ssZp": 1.879, "Dp": 2.181, "splay_angle": 19.664, "splay_distance": 3.472, "splay_ratio": 0.177, "d22": null, "d64": null, "eta": 175.180, "theta": -129.864, "eta_prime": -158.776, "theta_prime": -145.102, "eta_base": -112.232, "theta_base": -125.399, "v0": -33.936, "v1": 37.974, "v2": -27.860, "v3": 9.148, "v4": 15.182, "amplitude": 37.650, "phase_angle": 137.728, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.004, "frame": { "rmsd": 0.004, "origin": [ 51.258, -92.783, 31.685 ], "x_axis": [ -0.434, 0.576, -0.693 ], "y_axis": [ -0.806, 0.096, 0.584 ], "z_axis": [ 0.403, 0.812, 0.422 ], "quaternion": [ 0.521, -0.109, 0.526, 0.663 ] } }, { "index": 83, "index_chain": 6, "chain_name": "T", "nt_resnum": 13, "nt_name": "DT", "nt_code": "T", "nt_id": "///T/13", "linked_nts": [ "///T/12", "///T/14" ], "nt_type": "DNA", "dbn": "]", "summary": "pseudoknotted,anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -44.562, "beta": -175.341, "gamma": 15.486, "delta": 148.325, "epsilon": -141.850, "zeta": -158.500, "epsilon_zeta": 16.650, "bb_type": "--", "chi": -98.757, "glyco_bond": "anti", "C5prime_xyz": [ -2.654, 7.960, -2.162 ], "P_xyz": [ -1.207, 10.039, -1.830 ], "form": "B", "ssZp": 1.465, "Dp": 1.601, "splay_angle": 18.215, "splay_distance": 3.103, "splay_ratio": 0.159, "d22": null, "d64": null, "eta": 167.841, "theta": -152.337, "eta_prime": -166.674, "theta_prime": -158.662, "eta_base": -139.275, "theta_base": -103.955, "v0": -29.120, "v1": 40.784, "v2": -36.364, "v3": 20.831, "v4": 4.919, "amplitude": 40.374, "phase_angle": 154.246, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.008, "origin": [ 53.928, -90.651, 32.303 ], "x_axis": [ -0.733, 0.598, -0.323 ], "y_axis": [ -0.484, -0.125, 0.866 ], "z_axis": [ 0.478, 0.792, 0.381 ], "quaternion": [ 0.362, 0.052, 0.554, 0.748 ] } }, { "index": 84, "index_chain": 7, "chain_name": "T", "nt_resnum": 14, "nt_name": "DG", "nt_code": "G", "nt_id": "///T/14", "linked_nts": [ "///T/13", null ], "nt_type": "DNA", "dbn": "]", "summary": "pseudoknotted,anti,canonical,non-pair-contact,helix,stem-end,coaxial-stack,phosphate", "alpha": -10.743, "beta": 120.035, "gamma": 11.869, "delta": 104.671, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": -110.256, "glyco_bond": "anti", "C5prime_xyz": [ -2.900, 8.231, -2.215 ], "P_xyz": [ -0.622, 9.595, -2.250 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": -32.972, "v1": 21.124, "v2": -2.442, "v3": -16.616, "v4": 31.293, "amplitude": 33.233, "phase_angle": 94.214, "puckering": "O4'-endo", "sugar_class": "--", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.003, "frame": { "rmsd": 0.003, "origin": [ 54.532, -87.880, 33.560 ], "x_axis": [ -0.899, 0.345, 0.269 ], "y_axis": [ 0.113, -0.410, 0.905 ], "z_axis": [ 0.423, 0.844, 0.330 ], "quaternion": [ 0.071, 0.213, 0.538, 0.812 ] } } ], "num_hbonds": 1446, "hbonds": [ { "index": 1, "atom1_serNum": 11, "atom2_serNum": 385, "donAcc_type": "standard", "distance": 3.792, "atom1_id": "///A/371/O", "atom2_id": "///A/416/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2, "atom1_serNum": 25, "atom2_serNum": 53, "donAcc_type": "standard", "distance": 3.051, "atom1_id": "///A/373/O", "atom2_id": "///A/376/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 3, "atom1_serNum": 25, "atom2_serNum": 61, "donAcc_type": "standard", "distance": 3.158, "atom1_id": "///A/373/O", "atom2_id": "///A/377/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 4, "atom1_serNum": 29, "atom2_serNum": 11297, "donAcc_type": "standard", "distance": 3.355, "atom1_id": "///A/374/N", "atom2_id": "///Z/22/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 5, "atom1_serNum": 32, "atom2_serNum": 72, "donAcc_type": "standard", "distance": 3.008, "atom1_id": "///A/374/O", "atom2_id": "///A/378/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 6, "atom1_serNum": 40, "atom2_serNum": 11258, "donAcc_type": "acceptable", "distance": 2.399, "atom1_id": "///A/374/OH", "atom2_id": "///Z/20/OP2", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 7, "atom1_serNum": 52, "atom2_serNum": 587, "donAcc_type": "acceptable", "distance": 3.008, "atom1_id": "///A/375/OH", "atom2_id": "///A/438/OE2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 8, "atom1_serNum": 56, "atom2_serNum": 89, "donAcc_type": "standard", "distance": 2.992, "atom1_id": "///A/376/O", "atom2_id": "///A/380/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 9, "atom1_serNum": 64, "atom2_serNum": 97, "donAcc_type": "standard", "distance": 3.100, "atom1_id": "///A/377/O", "atom2_id": "///A/381/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 10, "atom1_serNum": 71, "atom2_serNum": 1599, "donAcc_type": "questionable", "distance": 3.124, "atom1_id": "///A/377/NH2", "atom2_id": "///A/581/NH1", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 11, "atom1_serNum": 75, "atom2_serNum": 104, "donAcc_type": "standard", "distance": 3.307, "atom1_id": "///A/378/O", "atom2_id": "///A/382/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 12, "atom1_serNum": 77, "atom2_serNum": 1550, "donAcc_type": "acceptable", "distance": 3.452, "atom1_id": "///A/378/OG", "atom2_id": "///A/575/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 13, "atom1_serNum": 77, "atom2_serNum": 1558, "donAcc_type": "acceptable", "distance": 2.733, "atom1_id": "///A/378/OG", "atom2_id": "///A/576/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 14, "atom1_serNum": 77, "atom2_serNum": 1586, "donAcc_type": "acceptable", "distance": 3.148, "atom1_id": "///A/378/OG", "atom2_id": "///A/580/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 15, "atom1_serNum": 81, "atom2_serNum": 111, "donAcc_type": "standard", "distance": 3.120, "atom1_id": "///A/379/O", "atom2_id": "///A/383/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 16, "atom1_serNum": 92, "atom2_serNum": 119, "donAcc_type": "standard", "distance": 2.875, "atom1_id": "///A/380/O", "atom2_id": "///A/384/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 17, "atom1_serNum": 100, "atom2_serNum": 128, "donAcc_type": "standard", "distance": 2.814, "atom1_id": "///A/381/O", "atom2_id": "///A/385/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 18, "atom1_serNum": 100, "atom2_serNum": 133, "donAcc_type": "acceptable", "distance": 2.632, "atom1_id": "///A/381/O", "atom2_id": "///A/385/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 19, "atom1_serNum": 107, "atom2_serNum": 135, "donAcc_type": "standard", "distance": 3.116, "atom1_id": "///A/382/O", "atom2_id": "///A/386/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 20, "atom1_serNum": 114, "atom2_serNum": 142, "donAcc_type": "standard", "distance": 2.806, "atom1_id": "///A/383/O", "atom2_id": "///A/387/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 21, "atom1_serNum": 122, "atom2_serNum": 150, "donAcc_type": "standard", "distance": 2.986, "atom1_id": "///A/384/O", "atom2_id": "///A/388/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 22, "atom1_serNum": 138, "atom2_serNum": 159, "donAcc_type": "standard", "distance": 3.244, "atom1_id": "///A/386/O", "atom2_id": "///A/389/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 23, "atom1_serNum": 162, "atom2_serNum": 192, "donAcc_type": "standard", "distance": 2.974, "atom1_id": "///A/389/O", "atom2_id": "///A/393/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 24, "atom1_serNum": 165, "atom2_serNum": 3777, "donAcc_type": "standard", "distance": 2.751, "atom1_id": "///A/389/OD1", "atom2_id": "///A/861/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 25, "atom1_serNum": 183, "atom2_serNum": 1686, "donAcc_type": "standard", "distance": 3.128, "atom1_id": "///A/391/OD2", "atom2_id": "///A/591/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 26, "atom1_serNum": 183, "atom2_serNum": 3769, "donAcc_type": "standard", "distance": 3.836, "atom1_id": "///A/391/OD2", "atom2_id": "///A/860/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 27, "atom1_serNum": 187, "atom2_serNum": 208, "donAcc_type": "standard", "distance": 2.996, "atom1_id": "///A/392/O", "atom2_id": "///A/395/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 28, "atom1_serNum": 195, "atom2_serNum": 270, "donAcc_type": "standard", "distance": 3.256, "atom1_id": "///A/393/O", "atom2_id": "///A/401/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 29, "atom1_serNum": 227, "atom2_serNum": 260, "donAcc_type": "standard", "distance": 2.746, "atom1_id": "///A/397/N", "atom2_id": "///A/400/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 30, "atom1_serNum": 230, "atom2_serNum": 262, "donAcc_type": "standard", "distance": 2.863, "atom1_id": "///A/397/O", "atom2_id": "///A/401/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 31, "atom1_serNum": 233, "atom2_serNum": 253, "donAcc_type": "standard", "distance": 2.611, "atom1_id": "///A/397/OD1", "atom2_id": "///A/400/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 32, "atom1_serNum": 238, "atom2_serNum": 271, "donAcc_type": "standard", "distance": 2.742, "atom1_id": "///A/398/O", "atom2_id": "///A/402/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 33, "atom1_serNum": 247, "atom2_serNum": 275, "donAcc_type": "standard", "distance": 3.395, "atom1_id": "///A/399/O", "atom2_id": "///A/403/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 34, "atom1_serNum": 256, "atom2_serNum": 275, "donAcc_type": "standard", "distance": 3.068, "atom1_id": "///A/400/O", "atom2_id": "///A/403/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 35, "atom1_serNum": 256, "atom2_serNum": 283, "donAcc_type": "standard", "distance": 3.594, "atom1_id": "///A/400/O", "atom2_id": "///A/404/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 36, "atom1_serNum": 260, "atom2_serNum": 1757, "donAcc_type": "standard", "distance": 3.053, "atom1_id": "///A/400/OE1", "atom2_id": "///A/599/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 37, "atom1_serNum": 261, "atom2_serNum": 1351, "donAcc_type": "standard", "distance": 3.170, "atom1_id": "///A/400/OE2", "atom2_id": "///A/547/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 38, "atom1_serNum": 261, "atom2_serNum": 1760, "donAcc_type": "standard", "distance": 3.175, "atom1_id": "///A/400/OE2", "atom2_id": "///A/599/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 39, "atom1_serNum": 265, "atom2_serNum": 290, "donAcc_type": "standard", "distance": 3.345, "atom1_id": "///A/401/O", "atom2_id": "///A/405/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 40, "atom1_serNum": 265, "atom2_serNum": 295, "donAcc_type": "acceptable", "distance": 3.187, "atom1_id": "///A/401/O", "atom2_id": "///A/405/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 41, "atom1_serNum": 274, "atom2_serNum": 297, "donAcc_type": "standard", "distance": 2.731, "atom1_id": "///A/402/O", "atom2_id": "///A/406/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 42, "atom1_serNum": 278, "atom2_serNum": 306, "donAcc_type": "standard", "distance": 2.834, "atom1_id": "///A/403/O", "atom2_id": "///A/407/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 43, "atom1_serNum": 286, "atom2_serNum": 317, "donAcc_type": "standard", "distance": 2.973, "atom1_id": "///A/404/O", "atom2_id": "///A/408/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 44, "atom1_serNum": 293, "atom2_serNum": 317, "donAcc_type": "standard", "distance": 2.799, "atom1_id": "///A/405/O", "atom2_id": "///A/408/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 45, "atom1_serNum": 293, "atom2_serNum": 329, "donAcc_type": "standard", "distance": 2.861, "atom1_id": "///A/405/O", "atom2_id": "///A/409/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 46, "atom1_serNum": 300, "atom2_serNum": 338, "donAcc_type": "standard", "distance": 3.315, "atom1_id": "///A/406/O", "atom2_id": "///A/410/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 47, "atom1_serNum": 309, "atom2_serNum": 338, "donAcc_type": "standard", "distance": 2.881, "atom1_id": "///A/407/O", "atom2_id": "///A/410/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 48, "atom1_serNum": 309, "atom2_serNum": 376, "donAcc_type": "standard", "distance": 2.948, "atom1_id": "///A/407/O", "atom2_id": "///A/415/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 49, "atom1_serNum": 346, "atom2_serNum": 671, "donAcc_type": "standard", "distance": 2.965, "atom1_id": "///A/411/N", "atom2_id": "///A/449/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 50, "atom1_serNum": 349, "atom2_serNum": 368, "donAcc_type": "standard", "distance": 2.948, "atom1_id": "///A/411/O", "atom2_id": "///A/415/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 51, "atom1_serNum": 351, "atom2_serNum": 364, "donAcc_type": "acceptable", "distance": 3.080, "atom1_id": "///A/411/OG", "atom2_id": "///A/414/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 52, "atom1_serNum": 351, "atom2_serNum": 670, "donAcc_type": "acceptable", "distance": 2.898, "atom1_id": "///A/411/OG", "atom2_id": "///A/449/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 53, "atom1_serNum": 355, "atom2_serNum": 377, "donAcc_type": "standard", "distance": 2.865, "atom1_id": "///A/412/O", "atom2_id": "///A/416/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 54, "atom1_serNum": 360, "atom2_serNum": 386, "donAcc_type": "standard", "distance": 2.974, "atom1_id": "///A/413/O", "atom2_id": "///A/417/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 55, "atom1_serNum": 367, "atom2_serNum": 394, "donAcc_type": "standard", "distance": 3.252, "atom1_id": "///A/414/O", "atom2_id": "///A/418/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 56, "atom1_serNum": 371, "atom2_serNum": 394, "donAcc_type": "standard", "distance": 2.896, "atom1_id": "///A/415/O", "atom2_id": "///A/418/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 57, "atom1_serNum": 371, "atom2_serNum": 406, "donAcc_type": "standard", "distance": 3.001, "atom1_id": "///A/415/O", "atom2_id": "///A/419/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 58, "atom1_serNum": 380, "atom2_serNum": 413, "donAcc_type": "standard", "distance": 3.072, "atom1_id": "///A/416/O", "atom2_id": "///A/420/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 59, "atom1_serNum": 385, "atom2_serNum": 582, "donAcc_type": "standard", "distance": 3.841, "atom1_id": "///A/416/NZ", "atom2_id": "///A/438/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 60, "atom1_serNum": 389, "atom2_serNum": 424, "donAcc_type": "standard", "distance": 3.097, "atom1_id": "///A/417/O", "atom2_id": "///A/421/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 61, "atom1_serNum": 397, "atom2_serNum": 432, "donAcc_type": "standard", "distance": 2.632, "atom1_id": "///A/418/O", "atom2_id": "///A/422/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 62, "atom1_serNum": 409, "atom2_serNum": 443, "donAcc_type": "standard", "distance": 2.851, "atom1_id": "///A/419/O", "atom2_id": "///A/423/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 63, "atom1_serNum": 416, "atom2_serNum": 452, "donAcc_type": "standard", "distance": 3.011, "atom1_id": "///A/420/O", "atom2_id": "///A/424/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 64, "atom1_serNum": 422, "atom2_serNum": 11258, "donAcc_type": "standard", "distance": 2.798, "atom1_id": "///A/420/NH1", "atom2_id": "///Z/20/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 65, "atom1_serNum": 423, "atom2_serNum": 587, "donAcc_type": "standard", "distance": 2.800, "atom1_id": "///A/420/NH2", "atom2_id": "///A/438/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 66, "atom1_serNum": 423, "atom2_serNum": 11258, "donAcc_type": "standard", "distance": 3.227, "atom1_id": "///A/420/NH2", "atom2_id": "///Z/20/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 67, "atom1_serNum": 435, "atom2_serNum": 1311, "donAcc_type": "standard", "distance": 2.983, "atom1_id": "///A/422/O", "atom2_id": "///A/542/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 68, "atom1_serNum": 435, "atom2_serNum": 1312, "donAcc_type": "standard", "distance": 3.004, "atom1_id": "///A/422/O", "atom2_id": "///A/542/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 69, "atom1_serNum": 435, "atom2_serNum": 1518, "donAcc_type": "standard", "distance": 3.828, "atom1_id": "///A/422/O", "atom2_id": "///A/570/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 70, "atom1_serNum": 450, "atom2_serNum": 1519, "donAcc_type": "standard", "distance": 3.134, "atom1_id": "///A/423/OE1", "atom2_id": "///A/571/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 71, "atom1_serNum": 451, "atom2_serNum": 1522, "donAcc_type": "standard", "distance": 3.313, "atom1_id": "///A/423/NE2", "atom2_id": "///A/571/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 72, "atom1_serNum": 459, "atom2_serNum": 569, "donAcc_type": "acceptable", "distance": 2.808, "atom1_id": "///A/424/NE", "atom2_id": "///A/436/OH", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 73, "atom1_serNum": 459, "atom2_serNum": 11239, "donAcc_type": "standard", "distance": 3.337, "atom1_id": "///A/424/NE", "atom2_id": "///Z/19/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 74, "atom1_serNum": 461, "atom2_serNum": 11218, "donAcc_type": "standard", "distance": 2.847, "atom1_id": "///A/424/NH1", "atom2_id": "///Z/18/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 75, "atom1_serNum": 462, "atom2_serNum": 535, "donAcc_type": "standard", "distance": 3.327, "atom1_id": "///A/424/NH2", "atom2_id": "///A/433/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 76, "atom1_serNum": 463, "atom2_serNum": 11219, "donAcc_type": "standard", "distance": 3.014, "atom1_id": "///A/425/N", "atom2_id": "///Z/18/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 77, "atom1_serNum": 471, "atom2_serNum": 11199, "donAcc_type": "standard", "distance": 3.437, "atom1_id": "///A/425/NZ", "atom2_id": "///Z/17/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 78, "atom1_serNum": 494, "atom2_serNum": 810, "donAcc_type": "standard", "distance": 2.691, "atom1_id": "///A/428/NE1", "atom2_id": "///A/467/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 79, "atom1_serNum": 500, "atom2_serNum": 1253, "donAcc_type": "standard", "distance": 2.882, "atom1_id": "///A/429/N", "atom2_id": "///A/535/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 80, "atom1_serNum": 503, "atom2_serNum": 1250, "donAcc_type": "standard", "distance": 3.132, "atom1_id": "///A/429/O", "atom2_id": "///A/535/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 81, "atom1_serNum": 511, "atom2_serNum": 532, "donAcc_type": "standard", "distance": 2.782, "atom1_id": "///A/430/O", "atom2_id": "///A/433/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 82, "atom1_serNum": 516, "atom2_serNum": 877, "donAcc_type": "standard", "distance": 2.550, "atom1_id": "///A/430/NZ", "atom2_id": "///A/476/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 83, "atom1_serNum": 516, "atom2_serNum": 878, "donAcc_type": "standard", "distance": 3.369, "atom1_id": "///A/430/NZ", "atom2_id": "///A/476/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 84, "atom1_serNum": 517, "atom2_serNum": 1238, "donAcc_type": "standard", "distance": 2.534, "atom1_id": "///A/431/N", "atom2_id": "///A/533/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 85, "atom1_serNum": 520, "atom2_serNum": 541, "donAcc_type": "standard", "distance": 3.631, "atom1_id": "///A/431/O", "atom2_id": "///A/434/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 86, "atom1_serNum": 540, "atom2_serNum": 10981, "donAcc_type": "standard", "distance": 3.436, "atom1_id": "///A/433/NZ", "atom2_id": "///X/8/O3'", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 87, "atom1_serNum": 561, "atom2_serNum": 588, "donAcc_type": "standard", "distance": 3.058, "atom1_id": "///A/436/O", "atom2_id": "///A/439/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 88, "atom1_serNum": 561, "atom2_serNum": 596, "donAcc_type": "standard", "distance": 3.158, "atom1_id": "///A/436/O", "atom2_id": "///A/440/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 89, "atom1_serNum": 569, "atom2_serNum": 11239, "donAcc_type": "acceptable", "distance": 2.955, "atom1_id": "///A/436/OH", "atom2_id": "///Z/19/OP2", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 90, "atom1_serNum": 579, "atom2_serNum": 586, "donAcc_type": "standard", "distance": 2.964, "atom1_id": "///A/438/N", "atom2_id": "///A/438/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 91, "atom1_serNum": 616, "atom2_serNum": 630, "donAcc_type": "acceptable", "distance": 2.777, "atom1_id": "///A/442/OD2", "atom2_id": "///A/444/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 92, "atom1_serNum": 620, "atom2_serNum": 646, "donAcc_type": "standard", "distance": 2.812, "atom1_id": "///A/443/O", "atom2_id": "///A/447/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 93, "atom1_serNum": 628, "atom2_serNum": 654, "donAcc_type": "standard", "distance": 2.842, "atom1_id": "///A/444/O", "atom2_id": "///A/448/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 94, "atom1_serNum": 635, "atom2_serNum": 654, "donAcc_type": "standard", "distance": 2.794, "atom1_id": "///A/445/O", "atom2_id": "///A/448/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 95, "atom1_serNum": 635, "atom2_serNum": 663, "donAcc_type": "standard", "distance": 2.845, "atom1_id": "///A/445/O", "atom2_id": "///A/449/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 96, "atom1_serNum": 642, "atom2_serNum": 672, "donAcc_type": "standard", "distance": 3.083, "atom1_id": "///A/446/O", "atom2_id": "///A/450/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 97, "atom1_serNum": 649, "atom2_serNum": 680, "donAcc_type": "standard", "distance": 2.815, "atom1_id": "///A/447/O", "atom2_id": "///A/451/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 98, "atom1_serNum": 649, "atom2_serNum": 685, "donAcc_type": "acceptable", "distance": 2.513, "atom1_id": "///A/447/O", "atom2_id": "///A/451/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 99, "atom1_serNum": 657, "atom2_serNum": 687, "donAcc_type": "standard", "distance": 2.860, "atom1_id": "///A/448/O", "atom2_id": "///A/452/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 100, "atom1_serNum": 666, "atom2_serNum": 695, "donAcc_type": "standard", "distance": 2.738, "atom1_id": "///A/449/O", "atom2_id": "///A/453/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 101, "atom1_serNum": 675, "atom2_serNum": 700, "donAcc_type": "standard", "distance": 3.114, "atom1_id": "///A/450/O", "atom2_id": "///A/454/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 102, "atom1_serNum": 675, "atom2_serNum": 704, "donAcc_type": "standard", "distance": 2.729, "atom1_id": "///A/450/O", "atom2_id": "///A/455/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 103, "atom1_serNum": 675, "atom2_serNum": 715, "donAcc_type": "standard", "distance": 3.120, "atom1_id": "///A/450/O", "atom2_id": "///A/456/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 104, "atom1_serNum": 683, "atom2_serNum": 700, "donAcc_type": "standard", "distance": 2.948, "atom1_id": "///A/451/O", "atom2_id": "///A/454/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 105, "atom1_serNum": 707, "atom2_serNum": 1276, "donAcc_type": "standard", "distance": 2.843, "atom1_id": "///A/455/O", "atom2_id": "///A/538/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 106, "atom1_serNum": 723, "atom2_serNum": 1260, "donAcc_type": "standard", "distance": 2.881, "atom1_id": "///A/457/N", "atom2_id": "///A/536/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 107, "atom1_serNum": 726, "atom2_serNum": 1257, "donAcc_type": "standard", "distance": 2.918, "atom1_id": "///A/457/O", "atom2_id": "///A/536/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 108, "atom1_serNum": 730, "atom2_serNum": 1264, "donAcc_type": "standard", "distance": 2.807, "atom1_id": "///A/457/OE1", "atom2_id": "///A/536/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 109, "atom1_serNum": 730, "atom2_serNum": 1267, "donAcc_type": "standard", "distance": 2.794, "atom1_id": "///A/457/OE1", "atom2_id": "///A/536/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 110, "atom1_serNum": 732, "atom2_serNum": 762, "donAcc_type": "standard", "distance": 3.292, "atom1_id": "///A/458/N", "atom2_id": "///A/461/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 111, "atom1_serNum": 735, "atom2_serNum": 754, "donAcc_type": "standard", "distance": 2.466, "atom1_id": "///A/458/O", "atom2_id": "///A/461/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 112, "atom1_serNum": 739, "atom2_serNum": 1247, "donAcc_type": "standard", "distance": 2.737, "atom1_id": "///A/459/N", "atom2_id": "///A/534/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 113, "atom1_serNum": 742, "atom2_serNum": 763, "donAcc_type": "standard", "distance": 2.768, "atom1_id": "///A/459/O", "atom2_id": "///A/462/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 114, "atom1_serNum": 746, "atom2_serNum": 1244, "donAcc_type": "standard", "distance": 2.583, "atom1_id": "///A/459/OE1", "atom2_id": "///A/534/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 115, "atom1_serNum": 751, "atom2_serNum": 779, "donAcc_type": "standard", "distance": 3.017, "atom1_id": "///A/460/O", "atom2_id": "///A/463/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 116, "atom1_serNum": 757, "atom2_serNum": 771, "donAcc_type": "standard", "distance": 3.183, "atom1_id": "///A/461/O", "atom2_id": "///A/463/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 117, "atom1_serNum": 766, "atom2_serNum": 1212, "donAcc_type": "standard", "distance": 3.271, "atom1_id": "///A/462/O", "atom2_id": "///A/528/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 118, "atom1_serNum": 783, "atom2_serNum": 803, "donAcc_type": "standard", "distance": 3.108, "atom1_id": "///A/464/O", "atom2_id": "///A/467/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 119, "atom1_serNum": 783, "atom2_serNum": 812, "donAcc_type": "standard", "distance": 3.091, "atom1_id": "///A/464/O", "atom2_id": "///A/468/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 120, "atom1_serNum": 792, "atom2_serNum": 812, "donAcc_type": "standard", "distance": 2.519, "atom1_id": "///A/465/O", "atom2_id": "///A/468/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 121, "atom1_serNum": 792, "atom2_serNum": 819, "donAcc_type": "standard", "distance": 2.907, "atom1_id": "///A/465/O", "atom2_id": "///A/469/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 122, "atom1_serNum": 800, "atom2_serNum": 827, "donAcc_type": "standard", "distance": 3.209, "atom1_id": "///A/466/O", "atom2_id": "///A/470/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 123, "atom1_serNum": 806, "atom2_serNum": 836, "donAcc_type": "standard", "distance": 3.322, "atom1_id": "///A/467/O", "atom2_id": "///A/471/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 124, "atom1_serNum": 815, "atom2_serNum": 844, "donAcc_type": "standard", "distance": 3.503, "atom1_id": "///A/468/O", "atom2_id": "///A/472/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 125, "atom1_serNum": 822, "atom2_serNum": 844, "donAcc_type": "standard", "distance": 2.742, "atom1_id": "///A/469/O", "atom2_id": "///A/472/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 126, "atom1_serNum": 852, "atom2_serNum": 877, "donAcc_type": "standard", "distance": 3.012, "atom1_id": "///A/473/N", "atom2_id": "///A/476/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 127, "atom1_serNum": 855, "atom2_serNum": 879, "donAcc_type": "standard", "distance": 2.634, "atom1_id": "///A/473/O", "atom2_id": "///A/477/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 128, "atom1_serNum": 858, "atom2_serNum": 11017, "donAcc_type": "standard", "distance": 3.174, "atom1_id": "///A/474/N", "atom2_id": "///X/10/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 129, "atom1_serNum": 861, "atom2_serNum": 887, "donAcc_type": "standard", "distance": 2.913, "atom1_id": "///A/474/O", "atom2_id": "///A/478/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 130, "atom1_serNum": 866, "atom2_serNum": 896, "donAcc_type": "standard", "distance": 3.227, "atom1_id": "///A/475/O", "atom2_id": "///A/479/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 131, "atom1_serNum": 873, "atom2_serNum": 902, "donAcc_type": "standard", "distance": 3.132, "atom1_id": "///A/476/O", "atom2_id": "///A/480/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 132, "atom1_serNum": 882, "atom2_serNum": 910, "donAcc_type": "standard", "distance": 2.900, "atom1_id": "///A/477/O", "atom2_id": "///A/481/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 133, "atom1_serNum": 890, "atom2_serNum": 915, "donAcc_type": "standard", "distance": 2.952, "atom1_id": "///A/478/O", "atom2_id": "///A/482/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 134, "atom1_serNum": 895, "atom2_serNum": 986, "donAcc_type": "standard", "distance": 3.071, "atom1_id": "///A/478/NZ", "atom2_id": "///A/490/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 135, "atom1_serNum": 899, "atom2_serNum": 929, "donAcc_type": "acceptable", "distance": 2.831, "atom1_id": "///A/479/O", "atom2_id": "///A/483/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 136, "atom1_serNum": 913, "atom2_serNum": 963, "donAcc_type": "questionable", "distance": 3.087, "atom1_id": "///A/481/O", "atom2_id": "///A/487/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 137, "atom1_serNum": 918, "atom2_serNum": 931, "donAcc_type": "standard", "distance": 2.557, "atom1_id": "///A/482/O", "atom2_id": "///A/484/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 138, "atom1_serNum": 934, "atom2_serNum": 960, "donAcc_type": "standard", "distance": 3.044, "atom1_id": "///A/484/O", "atom2_id": "///A/487/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 139, "atom1_serNum": 968, "atom2_serNum": 980, "donAcc_type": "standard", "distance": 2.794, "atom1_id": "///A/488/O", "atom2_id": "///A/490/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 140, "atom1_serNum": 972, "atom2_serNum": 983, "donAcc_type": "standard", "distance": 3.150, "atom1_id": "///A/488/ND2", "atom2_id": "///A/490/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 141, "atom1_serNum": 995, "atom2_serNum": 1028, "donAcc_type": "standard", "distance": 3.367, "atom1_id": "///A/492/O", "atom2_id": "///A/496/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 142, "atom1_serNum": 1001, "atom2_serNum": 11037, "donAcc_type": "standard", "distance": 3.354, "atom1_id": "///A/493/N", "atom2_id": "///X/11/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 143, "atom1_serNum": 1001, "atom2_serNum": 11038, "donAcc_type": "standard", "distance": 3.253, "atom1_id": "///A/493/N", "atom2_id": "///X/11/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 144, "atom1_serNum": 1004, "atom2_serNum": 1036, "donAcc_type": "standard", "distance": 3.339, "atom1_id": "///A/493/O", "atom2_id": "///A/497/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 145, "atom1_serNum": 1009, "atom2_serNum": 11017, "donAcc_type": "standard", "distance": 2.660, "atom1_id": "///A/493/NZ", "atom2_id": "///X/10/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 146, "atom1_serNum": 1013, "atom2_serNum": 1043, "donAcc_type": "standard", "distance": 3.247, "atom1_id": "///A/494/O", "atom2_id": "///A/498/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 147, "atom1_serNum": 1022, "atom2_serNum": 1051, "donAcc_type": "standard", "distance": 2.796, "atom1_id": "///A/495/O", "atom2_id": "///A/499/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 148, "atom1_serNum": 1031, "atom2_serNum": 1056, "donAcc_type": "standard", "distance": 2.872, "atom1_id": "///A/496/O", "atom2_id": "///A/500/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 149, "atom1_serNum": 1039, "atom2_serNum": 1067, "donAcc_type": "standard", "distance": 2.984, "atom1_id": "///A/497/O", "atom2_id": "///A/501/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 150, "atom1_serNum": 1046, "atom2_serNum": 1075, "donAcc_type": "standard", "distance": 3.236, "atom1_id": "///A/498/O", "atom2_id": "///A/502/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 151, "atom1_serNum": 1054, "atom2_serNum": 1075, "donAcc_type": "standard", "distance": 2.988, "atom1_id": "///A/499/O", "atom2_id": "///A/502/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 152, "atom1_serNum": 1054, "atom2_serNum": 1084, "donAcc_type": "standard", "distance": 3.117, "atom1_id": "///A/499/O", "atom2_id": "///A/503/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 153, "atom1_serNum": 1087, "atom2_serNum": 1115, "donAcc_type": "standard", "distance": 3.332, "atom1_id": "///A/503/O", "atom2_id": "///A/507/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 154, "atom1_serNum": 1109, "atom2_serNum": 1126, "donAcc_type": "standard", "distance": 3.178, "atom1_id": "///A/506/O", "atom2_id": "///A/508/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 155, "atom1_serNum": 1118, "atom2_serNum": 1139, "donAcc_type": "standard", "distance": 3.263, "atom1_id": "///A/507/O", "atom2_id": "///A/519/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 156, "atom1_serNum": 1118, "atom2_serNum": 1147, "donAcc_type": "standard", "distance": 3.453, "atom1_id": "///A/507/O", "atom2_id": "///A/520/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 157, "atom1_serNum": 1129, "atom2_serNum": 1147, "donAcc_type": "standard", "distance": 2.899, "atom1_id": "///A/508/O", "atom2_id": "///A/520/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 158, "atom1_serNum": 1129, "atom2_serNum": 1151, "donAcc_type": "standard", "distance": 3.332, "atom1_id": "///A/508/O", "atom2_id": "///A/521/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 159, "atom1_serNum": 1142, "atom2_serNum": 1156, "donAcc_type": "standard", "distance": 3.077, "atom1_id": "///A/519/O", "atom2_id": "///A/522/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 160, "atom1_serNum": 1142, "atom2_serNum": 1163, "donAcc_type": "standard", "distance": 3.120, "atom1_id": "///A/519/O", "atom2_id": "///A/523/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 161, "atom1_serNum": 1150, "atom2_serNum": 1171, "donAcc_type": "standard", "distance": 3.173, "atom1_id": "///A/520/O", "atom2_id": "///A/524/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 162, "atom1_serNum": 1154, "atom2_serNum": 1179, "donAcc_type": "standard", "distance": 3.176, "atom1_id": "///A/521/O", "atom2_id": "///A/525/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 163, "atom1_serNum": 1159, "atom2_serNum": 1188, "donAcc_type": "standard", "distance": 3.146, "atom1_id": "///A/522/O", "atom2_id": "///A/526/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 164, "atom1_serNum": 1166, "atom2_serNum": 1188, "donAcc_type": "standard", "distance": 2.870, "atom1_id": "///A/523/O", "atom2_id": "///A/526/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 165, "atom1_serNum": 1166, "atom2_serNum": 1199, "donAcc_type": "standard", "distance": 2.614, "atom1_id": "///A/523/O", "atom2_id": "///A/527/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 166, "atom1_serNum": 1174, "atom2_serNum": 1204, "donAcc_type": "standard", "distance": 2.846, "atom1_id": "///A/524/O", "atom2_id": "///A/528/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 167, "atom1_serNum": 1182, "atom2_serNum": 1213, "donAcc_type": "standard", "distance": 3.263, "atom1_id": "///A/525/O", "atom2_id": "///A/529/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 168, "atom1_serNum": 1191, "atom2_serNum": 1218, "donAcc_type": "standard", "distance": 2.507, "atom1_id": "///A/526/O", "atom2_id": "///A/530/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 169, "atom1_serNum": 1202, "atom2_serNum": 1226, "donAcc_type": "standard", "distance": 2.838, "atom1_id": "///A/527/O", "atom2_id": "///A/531/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 170, "atom1_serNum": 1207, "atom2_serNum": 1231, "donAcc_type": "standard", "distance": 3.088, "atom1_id": "///A/528/O", "atom2_id": "///A/532/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 171, "atom1_serNum": 1238, "atom2_serNum": 1249, "donAcc_type": "acceptable", "distance": 2.901, "atom1_id": "///A/533/O", "atom2_id": "///A/534/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 172, "atom1_serNum": 1271, "atom2_serNum": 1282, "donAcc_type": "standard", "distance": 3.234, "atom1_id": "///A/537/O", "atom2_id": "///A/539/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 173, "atom1_serNum": 1279, "atom2_serNum": 1302, "donAcc_type": "standard", "distance": 3.188, "atom1_id": "///A/538/O", "atom2_id": "///A/542/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 174, "atom1_serNum": 1285, "atom2_serNum": 1313, "donAcc_type": "standard", "distance": 2.969, "atom1_id": "///A/539/O", "atom2_id": "///A/543/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 175, "atom1_serNum": 1294, "atom2_serNum": 1318, "donAcc_type": "standard", "distance": 3.570, "atom1_id": "///A/540/O", "atom2_id": "///A/544/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 176, "atom1_serNum": 1298, "atom2_serNum": 1318, "donAcc_type": "standard", "distance": 2.970, "atom1_id": "///A/541/O", "atom2_id": "///A/544/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 177, "atom1_serNum": 1298, "atom2_serNum": 1325, "donAcc_type": "standard", "distance": 3.362, "atom1_id": "///A/541/O", "atom2_id": "///A/545/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 178, "atom1_serNum": 1305, "atom2_serNum": 1325, "donAcc_type": "standard", "distance": 2.973, "atom1_id": "///A/542/O", "atom2_id": "///A/545/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 179, "atom1_serNum": 1305, "atom2_serNum": 1336, "donAcc_type": "standard", "distance": 3.110, "atom1_id": "///A/542/O", "atom2_id": "///A/546/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 180, "atom1_serNum": 1312, "atom2_serNum": 1509, "donAcc_type": "standard", "distance": 2.698, "atom1_id": "///A/542/NH2", "atom2_id": "///A/569/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 181, "atom1_serNum": 1316, "atom2_serNum": 1342, "donAcc_type": "standard", "distance": 3.048, "atom1_id": "///A/543/O", "atom2_id": "///A/547/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 182, "atom1_serNum": 1321, "atom2_serNum": 1353, "donAcc_type": "standard", "distance": 2.979, "atom1_id": "///A/544/O", "atom2_id": "///A/548/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 183, "atom1_serNum": 1328, "atom2_serNum": 1361, "donAcc_type": "standard", "distance": 2.802, "atom1_id": "///A/545/O", "atom2_id": "///A/549/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 184, "atom1_serNum": 1339, "atom2_serNum": 1369, "donAcc_type": "standard", "distance": 2.645, "atom1_id": "///A/546/O", "atom2_id": "///A/550/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 185, "atom1_serNum": 1341, "atom2_serNum": 1509, "donAcc_type": "acceptable", "distance": 3.917, "atom1_id": "///A/546/OG", "atom2_id": "///A/569/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 186, "atom1_serNum": 1345, "atom2_serNum": 1377, "donAcc_type": "standard", "distance": 3.080, "atom1_id": "///A/547/O", "atom2_id": "///A/551/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 187, "atom1_serNum": 1356, "atom2_serNum": 1385, "donAcc_type": "standard", "distance": 2.902, "atom1_id": "///A/548/O", "atom2_id": "///A/552/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 188, "atom1_serNum": 1364, "atom2_serNum": 1396, "donAcc_type": "standard", "distance": 3.145, "atom1_id": "///A/549/O", "atom2_id": "///A/553/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 189, "atom1_serNum": 1372, "atom2_serNum": 1396, "donAcc_type": "standard", "distance": 3.043, "atom1_id": "///A/550/O", "atom2_id": "///A/553/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 190, "atom1_serNum": 1372, "atom2_serNum": 1401, "donAcc_type": "acceptable", "distance": 2.668, "atom1_id": "///A/550/O", "atom2_id": "///A/553/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 191, "atom1_serNum": 1372, "atom2_serNum": 1402, "donAcc_type": "standard", "distance": 3.429, "atom1_id": "///A/550/O", "atom2_id": "///A/554/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 192, "atom1_serNum": 1380, "atom2_serNum": 1402, "donAcc_type": "standard", "distance": 3.116, "atom1_id": "///A/551/O", "atom2_id": "///A/554/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 193, "atom1_serNum": 1388, "atom2_serNum": 1415, "donAcc_type": "acceptable", "distance": 2.862, "atom1_id": "///A/552/O", "atom2_id": "///A/555/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 194, "atom1_serNum": 1388, "atom2_serNum": 1417, "donAcc_type": "standard", "distance": 3.334, "atom1_id": "///A/552/O", "atom2_id": "///A/556/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 195, "atom1_serNum": 1399, "atom2_serNum": 1431, "donAcc_type": "standard", "distance": 2.658, "atom1_id": "///A/553/O", "atom2_id": "///A/558/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 196, "atom1_serNum": 1399, "atom2_serNum": 1439, "donAcc_type": "standard", "distance": 3.437, "atom1_id": "///A/553/O", "atom2_id": "///A/559/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 197, "atom1_serNum": 1415, "atom2_serNum": 3776, "donAcc_type": "acceptable", "distance": 3.294, "atom1_id": "///A/555/OG1", "atom2_id": "///A/861/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 198, "atom1_serNum": 1420, "atom2_serNum": 1431, "donAcc_type": "standard", "distance": 2.362, "atom1_id": "///A/556/O", "atom2_id": "///A/558/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 199, "atom1_serNum": 1420, "atom2_serNum": 1439, "donAcc_type": "standard", "distance": 2.782, "atom1_id": "///A/556/O", "atom2_id": "///A/559/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 200, "atom1_serNum": 1446, "atom2_serNum": 1527, "donAcc_type": "standard", "distance": 3.001, "atom1_id": "///A/559/OE1", "atom2_id": "///A/572/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 201, "atom1_serNum": 1447, "atom2_serNum": 1513, "donAcc_type": "questionable", "distance": 3.307, "atom1_id": "///A/559/OE2", "atom2_id": "///A/570/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 202, "atom1_serNum": 1451, "atom2_serNum": 1478, "donAcc_type": "standard", "distance": 3.416, "atom1_id": "///A/560/O", "atom2_id": "///A/564/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 203, "atom1_serNum": 1459, "atom2_serNum": 1483, "donAcc_type": "standard", "distance": 2.844, "atom1_id": "///A/561/O", "atom2_id": "///A/565/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 204, "atom1_serNum": 1459, "atom2_serNum": 1489, "donAcc_type": "standard", "distance": 3.325, "atom1_id": "///A/561/O", "atom2_id": "///A/566/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 205, "atom1_serNum": 1476, "atom2_serNum": 1510, "donAcc_type": "standard", "distance": 2.986, "atom1_id": "///A/563/O", "atom2_id": "///A/570/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 206, "atom1_serNum": 1481, "atom2_serNum": 1504, "donAcc_type": "questionable", "distance": 3.364, "atom1_id": "///A/564/O", "atom2_id": "///A/568/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 207, "atom1_serNum": 1481, "atom2_serNum": 1506, "donAcc_type": "standard", "distance": 3.584, "atom1_id": "///A/564/O", "atom2_id": "///A/569/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 208, "atom1_serNum": 1496, "atom2_serNum": 1847, "donAcc_type": "standard", "distance": 3.533, "atom1_id": "///A/567/O", "atom2_id": "///A/610/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 209, "atom1_serNum": 1530, "atom2_serNum": 1555, "donAcc_type": "standard", "distance": 3.035, "atom1_id": "///A/572/O", "atom2_id": "///A/576/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 210, "atom1_serNum": 1532, "atom2_serNum": 1547, "donAcc_type": "acceptable", "distance": 3.228, "atom1_id": "///A/572/OG", "atom2_id": "///A/575/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 211, "atom1_serNum": 1536, "atom2_serNum": 1563, "donAcc_type": "standard", "distance": 3.056, "atom1_id": "///A/573/O", "atom2_id": "///A/577/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 212, "atom1_serNum": 1538, "atom2_serNum": 11272, "donAcc_type": "acceptable", "distance": 2.467, "atom1_id": "///A/573/OG1", "atom2_id": "///Z/20/O4", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 213, "atom1_serNum": 1543, "atom2_serNum": 1570, "donAcc_type": "standard", "distance": 2.982, "atom1_id": "///A/574/O", "atom2_id": "///A/578/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 214, "atom1_serNum": 1543, "atom2_serNum": 1577, "donAcc_type": "standard", "distance": 2.723, "atom1_id": "///A/574/O", "atom2_id": "///A/578/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 215, "atom1_serNum": 1550, "atom2_serNum": 1578, "donAcc_type": "standard", "distance": 2.889, "atom1_id": "///A/575/O", "atom2_id": "///A/579/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 216, "atom1_serNum": 1566, "atom2_serNum": 1600, "donAcc_type": "standard", "distance": 2.448, "atom1_id": "///A/577/O", "atom2_id": "///A/581/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 217, "atom1_serNum": 1573, "atom2_serNum": 1590, "donAcc_type": "standard", "distance": 2.770, "atom1_id": "///A/578/O", "atom2_id": "///A/581/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 218, "atom1_serNum": 1573, "atom2_serNum": 1601, "donAcc_type": "standard", "distance": 3.045, "atom1_id": "///A/578/O", "atom2_id": "///A/582/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 219, "atom1_serNum": 1576, "atom2_serNum": 11290, "donAcc_type": "standard", "distance": 3.856, "atom1_id": "///A/578/OD1", "atom2_id": "///Z/21/N3", "atom_pair": "O:N", "residue_pair": "aa:nt" }, { "index": 220, "atom1_serNum": 1597, "atom2_serNum": 11289, "donAcc_type": "standard", "distance": 3.112, "atom1_id": "///A/581/NE", "atom2_id": "///Z/21/O2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 221, "atom1_serNum": 1599, "atom2_serNum": 11298, "donAcc_type": "standard", "distance": 3.081, "atom1_id": "///A/581/NH1", "atom2_id": "///Z/22/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 222, "atom1_serNum": 1612, "atom2_serNum": 4189, "donAcc_type": "standard", "distance": 3.035, "atom1_id": "///A/583/O", "atom2_id": "///A/913/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 223, "atom1_serNum": 1617, "atom2_serNum": 4188, "donAcc_type": "standard", "distance": 3.216, "atom1_id": "///A/583/OE2", "atom2_id": "///A/912/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 224, "atom1_serNum": 1653, "atom2_serNum": 3773, "donAcc_type": "acceptable", "distance": 2.464, "atom1_id": "///A/587/OH", "atom2_id": "///A/861/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 225, "atom1_serNum": 1653, "atom2_serNum": 3789, "donAcc_type": "acceptable", "distance": 2.900, "atom1_id": "///A/587/OH", "atom2_id": "///A/864/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 226, "atom1_serNum": 1659, "atom2_serNum": 3712, "donAcc_type": "acceptable", "distance": 2.877, "atom1_id": "///A/588/OG1", "atom2_id": "///A/853/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 227, "atom1_serNum": 1669, "atom2_serNum": 3751, "donAcc_type": "standard", "distance": 2.963, "atom1_id": "///A/590/N", "atom2_id": "///A/859/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 228, "atom1_serNum": 1672, "atom2_serNum": 3733, "donAcc_type": "standard", "distance": 2.792, "atom1_id": "///A/590/O", "atom2_id": "///A/857/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 229, "atom1_serNum": 1688, "atom2_serNum": 3739, "donAcc_type": "standard", "distance": 2.834, "atom1_id": "///A/592/N", "atom2_id": "///A/857/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 230, "atom1_serNum": 1697, "atom2_serNum": 3739, "donAcc_type": "standard", "distance": 2.901, "atom1_id": "///A/593/N", "atom2_id": "///A/857/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 231, "atom1_serNum": 1700, "atom2_serNum": 3768, "donAcc_type": "standard", "distance": 3.355, "atom1_id": "///A/593/O", "atom2_id": "///A/860/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 232, "atom1_serNum": 1700, "atom2_serNum": 3769, "donAcc_type": "standard", "distance": 2.597, "atom1_id": "///A/593/O", "atom2_id": "///A/860/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 233, "atom1_serNum": 1702, "atom2_serNum": 3740, "donAcc_type": "acceptable", "distance": 2.649, "atom1_id": "///A/593/OG1", "atom2_id": "///A/857/OD2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 234, "atom1_serNum": 1733, "atom2_serNum": 1776, "donAcc_type": "standard", "distance": 3.165, "atom1_id": "///A/597/N", "atom2_id": "///A/601/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 235, "atom1_serNum": 1745, "atom2_serNum": 1769, "donAcc_type": "standard", "distance": 3.009, "atom1_id": "///A/598/O", "atom2_id": "///A/601/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 236, "atom1_serNum": 1745, "atom2_serNum": 1777, "donAcc_type": "standard", "distance": 3.267, "atom1_id": "///A/598/O", "atom2_id": "///A/602/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 237, "atom1_serNum": 1748, "atom2_serNum": 1761, "donAcc_type": "standard", "distance": 3.271, "atom1_id": "///A/598/OD1", "atom2_id": "///A/600/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 238, "atom1_serNum": 1748, "atom2_serNum": 1769, "donAcc_type": "standard", "distance": 3.037, "atom1_id": "///A/598/OD1", "atom2_id": "///A/601/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 239, "atom1_serNum": 1753, "atom2_serNum": 1785, "donAcc_type": "standard", "distance": 3.263, "atom1_id": "///A/599/O", "atom2_id": "///A/603/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 240, "atom1_serNum": 1764, "atom2_serNum": 1793, "donAcc_type": "standard", "distance": 2.832, "atom1_id": "///A/600/O", "atom2_id": "///A/604/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 241, "atom1_serNum": 1772, "atom2_serNum": 1804, "donAcc_type": "standard", "distance": 2.890, "atom1_id": "///A/601/O", "atom2_id": "///A/605/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 242, "atom1_serNum": 1776, "atom2_serNum": 2167, "donAcc_type": "standard", "distance": 2.531, "atom1_id": "///A/601/OD2", "atom2_id": "///A/650/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 243, "atom1_serNum": 1780, "atom2_serNum": 1816, "donAcc_type": "standard", "distance": 2.766, "atom1_id": "///A/602/O", "atom2_id": "///A/606/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 244, "atom1_serNum": 1788, "atom2_serNum": 1821, "donAcc_type": "standard", "distance": 2.966, "atom1_id": "///A/603/O", "atom2_id": "///A/607/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 245, "atom1_serNum": 1796, "atom2_serNum": 1826, "donAcc_type": "standard", "distance": 3.161, "atom1_id": "///A/604/O", "atom2_id": "///A/608/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 246, "atom1_serNum": 1807, "atom2_serNum": 1826, "donAcc_type": "standard", "distance": 2.943, "atom1_id": "///A/605/O", "atom2_id": "///A/608/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 247, "atom1_serNum": 1807, "atom2_serNum": 1831, "donAcc_type": "standard", "distance": 2.901, "atom1_id": "///A/605/O", "atom2_id": "///A/609/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 248, "atom1_serNum": 1819, "atom2_serNum": 1838, "donAcc_type": "standard", "distance": 3.092, "atom1_id": "///A/606/O", "atom2_id": "///A/610/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 249, "atom1_serNum": 1824, "atom2_serNum": 1848, "donAcc_type": "standard", "distance": 3.208, "atom1_id": "///A/607/O", "atom2_id": "///A/611/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 250, "atom1_serNum": 1829, "atom2_serNum": 1848, "donAcc_type": "standard", "distance": 3.022, "atom1_id": "///A/608/O", "atom2_id": "///A/611/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 251, "atom1_serNum": 1829, "atom2_serNum": 1856, "donAcc_type": "standard", "distance": 2.993, "atom1_id": "///A/608/O", "atom2_id": "///A/612/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 252, "atom1_serNum": 1834, "atom2_serNum": 1864, "donAcc_type": "standard", "distance": 3.004, "atom1_id": "///A/609/O", "atom2_id": "///A/613/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 253, "atom1_serNum": 1841, "atom2_serNum": 1870, "donAcc_type": "standard", "distance": 3.024, "atom1_id": "///A/610/O", "atom2_id": "///A/614/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 254, "atom1_serNum": 1851, "atom2_serNum": 1878, "donAcc_type": "standard", "distance": 2.948, "atom1_id": "///A/611/O", "atom2_id": "///A/615/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 255, "atom1_serNum": 1859, "atom2_serNum": 1886, "donAcc_type": "standard", "distance": 2.961, "atom1_id": "///A/612/O", "atom2_id": "///A/616/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 256, "atom1_serNum": 1859, "atom2_serNum": 1891, "donAcc_type": "acceptable", "distance": 3.140, "atom1_id": "///A/612/O", "atom2_id": "///A/616/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 257, "atom1_serNum": 1867, "atom2_serNum": 1892, "donAcc_type": "standard", "distance": 2.807, "atom1_id": "///A/613/O", "atom2_id": "///A/617/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 258, "atom1_serNum": 1873, "atom2_serNum": 1898, "donAcc_type": "standard", "distance": 3.038, "atom1_id": "///A/614/O", "atom2_id": "///A/618/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 259, "atom1_serNum": 1881, "atom2_serNum": 1903, "donAcc_type": "standard", "distance": 3.038, "atom1_id": "///A/615/O", "atom2_id": "///A/619/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 260, "atom1_serNum": 1889, "atom2_serNum": 1911, "donAcc_type": "standard", "distance": 2.936, "atom1_id": "///A/616/O", "atom2_id": "///A/620/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 261, "atom1_serNum": 1891, "atom2_serNum": 2354, "donAcc_type": "acceptable", "distance": 3.149, "atom1_id": "///A/616/OG", "atom2_id": "///A/672/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 262, "atom1_serNum": 1891, "atom2_serNum": 2357, "donAcc_type": "acceptable", "distance": 3.141, "atom1_id": "///A/616/OG", "atom2_id": "///A/672/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 263, "atom1_serNum": 1895, "atom2_serNum": 1916, "donAcc_type": "standard", "distance": 3.099, "atom1_id": "///A/617/O", "atom2_id": "///A/621/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 264, "atom1_serNum": 1901, "atom2_serNum": 1916, "donAcc_type": "standard", "distance": 2.708, "atom1_id": "///A/618/O", "atom2_id": "///A/621/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 265, "atom1_serNum": 1901, "atom2_serNum": 1924, "donAcc_type": "standard", "distance": 3.019, "atom1_id": "///A/618/O", "atom2_id": "///A/622/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 266, "atom1_serNum": 1901, "atom2_serNum": 1928, "donAcc_type": "standard", "distance": 3.433, "atom1_id": "///A/618/O", "atom2_id": "///A/623/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 267, "atom1_serNum": 1906, "atom2_serNum": 1924, "donAcc_type": "standard", "distance": 2.810, "atom1_id": "///A/619/O", "atom2_id": "///A/622/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 268, "atom1_serNum": 1914, "atom2_serNum": 10827, "donAcc_type": "questionable", "distance": 2.832, "atom1_id": "///A/620/O", "atom2_id": "///X/1/OP2", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 269, "atom1_serNum": 1927, "atom2_serNum": 1936, "donAcc_type": "standard", "distance": 2.841, "atom1_id": "///A/622/O", "atom2_id": "///A/624/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 270, "atom1_serNum": 1931, "atom2_serNum": 1959, "donAcc_type": "standard", "distance": 2.959, "atom1_id": "///A/623/O", "atom2_id": "///A/626/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 271, "atom1_serNum": 1931, "atom2_serNum": 1968, "donAcc_type": "standard", "distance": 3.223, "atom1_id": "///A/623/O", "atom2_id": "///A/627/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 272, "atom1_serNum": 1939, "atom2_serNum": 1973, "donAcc_type": "standard", "distance": 3.132, "atom1_id": "///A/624/O", "atom2_id": "///A/628/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 273, "atom1_serNum": 1953, "atom2_serNum": 1982, "donAcc_type": "standard", "distance": 3.302, "atom1_id": "///A/625/O", "atom2_id": "///A/629/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 274, "atom1_serNum": 1962, "atom2_serNum": 1991, "donAcc_type": "standard", "distance": 2.876, "atom1_id": "///A/626/O", "atom2_id": "///A/630/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 275, "atom1_serNum": 1971, "atom2_serNum": 1999, "donAcc_type": "standard", "distance": 2.884, "atom1_id": "///A/627/O", "atom2_id": "///A/631/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 276, "atom1_serNum": 1976, "atom2_serNum": 2004, "donAcc_type": "standard", "distance": 2.990, "atom1_id": "///A/628/O", "atom2_id": "///A/632/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 277, "atom1_serNum": 1985, "atom2_serNum": 2004, "donAcc_type": "standard", "distance": 2.689, "atom1_id": "///A/629/O", "atom2_id": "///A/632/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 278, "atom1_serNum": 1985, "atom2_serNum": 2013, "donAcc_type": "standard", "distance": 2.723, "atom1_id": "///A/629/O", "atom2_id": "///A/633/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 279, "atom1_serNum": 1994, "atom2_serNum": 2019, "donAcc_type": "standard", "distance": 3.010, "atom1_id": "///A/630/O", "atom2_id": "///A/634/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 280, "atom1_serNum": 2002, "atom2_serNum": 2024, "donAcc_type": "standard", "distance": 2.721, "atom1_id": "///A/631/O", "atom2_id": "///A/635/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 281, "atom1_serNum": 2007, "atom2_serNum": 2033, "donAcc_type": "standard", "distance": 3.044, "atom1_id": "///A/632/O", "atom2_id": "///A/636/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 282, "atom1_serNum": 2016, "atom2_serNum": 2033, "donAcc_type": "standard", "distance": 3.173, "atom1_id": "///A/633/O", "atom2_id": "///A/636/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 283, "atom1_serNum": 2022, "atom2_serNum": 2052, "donAcc_type": "standard", "distance": 2.984, "atom1_id": "///A/634/O", "atom2_id": "///A/638/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 284, "atom1_serNum": 2027, "atom2_serNum": 2073, "donAcc_type": "standard", "distance": 2.872, "atom1_id": "///A/635/O", "atom2_id": "///A/639/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 285, "atom1_serNum": 2032, "atom2_serNum": 2508, "donAcc_type": "standard", "distance": 3.077, "atom1_id": "///A/635/NZ", "atom2_id": "///A/689/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 286, "atom1_serNum": 2036, "atom2_serNum": 2066, "donAcc_type": "standard", "distance": 2.664, "atom1_id": "///A/636/O", "atom2_id": "///A/639/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 287, "atom1_serNum": 2036, "atom2_serNum": 2074, "donAcc_type": "standard", "distance": 2.923, "atom1_id": "///A/636/O", "atom2_id": "///A/640/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 288, "atom1_serNum": 2043, "atom2_serNum": 2050, "donAcc_type": "standard", "distance": 3.415, "atom1_id": "///A/636/NH2", "atom2_id": "///A/637/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 289, "atom1_serNum": 2044, "atom2_serNum": 2050, "donAcc_type": "standard", "distance": 2.621, "atom1_id": "///A/637/N", "atom2_id": "///A/637/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 290, "atom1_serNum": 2047, "atom2_serNum": 2085, "donAcc_type": "standard", "distance": 3.075, "atom1_id": "///A/637/O", "atom2_id": "///A/641/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 291, "atom1_serNum": 2055, "atom2_serNum": 2093, "donAcc_type": "standard", "distance": 3.225, "atom1_id": "///A/638/O", "atom2_id": "///A/642/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 292, "atom1_serNum": 2088, "atom2_serNum": 2102, "donAcc_type": "standard", "distance": 2.615, "atom1_id": "///A/641/O", "atom2_id": "///A/643/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 293, "atom1_serNum": 2088, "atom2_serNum": 2110, "donAcc_type": "standard", "distance": 3.112, "atom1_id": "///A/641/O", "atom2_id": "///A/644/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 294, "atom1_serNum": 2105, "atom2_serNum": 2150, "donAcc_type": "standard", "distance": 2.678, "atom1_id": "///A/643/O", "atom2_id": "///A/648/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 295, "atom1_serNum": 2113, "atom2_serNum": 2150, "donAcc_type": "standard", "distance": 2.721, "atom1_id": "///A/644/O", "atom2_id": "///A/648/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 296, "atom1_serNum": 2116, "atom2_serNum": 2127, "donAcc_type": "acceptable", "distance": 3.020, "atom1_id": "///A/644/ND1", "atom2_id": "///A/646/N", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 297, "atom1_serNum": 2116, "atom2_serNum": 2132, "donAcc_type": "acceptable", "distance": 2.788, "atom1_id": "///A/644/ND1", "atom2_id": "///A/646/OG", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 298, "atom1_serNum": 2123, "atom2_serNum": 2141, "donAcc_type": "standard", "distance": 3.217, "atom1_id": "///A/645/O", "atom2_id": "///A/648/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 299, "atom1_serNum": 2130, "atom2_serNum": 2152, "donAcc_type": "standard", "distance": 2.890, "atom1_id": "///A/646/O", "atom2_id": "///A/649/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 300, "atom1_serNum": 2130, "atom2_serNum": 2158, "donAcc_type": "standard", "distance": 3.270, "atom1_id": "///A/646/O", "atom2_id": "///A/650/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 301, "atom1_serNum": 2136, "atom2_serNum": 2158, "donAcc_type": "standard", "distance": 2.835, "atom1_id": "///A/647/O", "atom2_id": "///A/650/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 302, "atom1_serNum": 2136, "atom2_serNum": 2168, "donAcc_type": "standard", "distance": 2.785, "atom1_id": "///A/647/O", "atom2_id": "///A/651/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 303, "atom1_serNum": 2151, "atom2_serNum": 2176, "donAcc_type": "standard", "distance": 2.923, "atom1_id": "///A/648/NH2", "atom2_id": "///A/651/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 304, "atom1_serNum": 2155, "atom2_serNum": 2177, "donAcc_type": "standard", "distance": 3.126, "atom1_id": "///A/649/O", "atom2_id": "///A/652/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 305, "atom1_serNum": 2161, "atom2_serNum": 2185, "donAcc_type": "standard", "distance": 2.722, "atom1_id": "///A/650/O", "atom2_id": "///A/653/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 306, "atom1_serNum": 2188, "atom2_serNum": 2234, "donAcc_type": "standard", "distance": 3.063, "atom1_id": "///A/653/O", "atom2_id": "///A/658/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 307, "atom1_serNum": 2188, "atom2_serNum": 2237, "donAcc_type": "standard", "distance": 2.833, "atom1_id": "///A/653/O", "atom2_id": "///A/658/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 308, "atom1_serNum": 2196, "atom2_serNum": 2219, "donAcc_type": "standard", "distance": 2.719, "atom1_id": "///A/654/O", "atom2_id": "///A/657/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 309, "atom1_serNum": 2196, "atom2_serNum": 2227, "donAcc_type": "standard", "distance": 2.840, "atom1_id": "///A/654/O", "atom2_id": "///A/658/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 310, "atom1_serNum": 2203, "atom2_serNum": 2238, "donAcc_type": "standard", "distance": 3.259, "atom1_id": "///A/655/O", "atom2_id": "///A/659/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 311, "atom1_serNum": 2222, "atom2_serNum": 2244, "donAcc_type": "standard", "distance": 2.873, "atom1_id": "///A/657/O", "atom2_id": "///A/660/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 312, "atom1_serNum": 2230, "atom2_serNum": 2260, "donAcc_type": "acceptable", "distance": 2.836, "atom1_id": "///A/658/O", "atom2_id": "///A/661/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 313, "atom1_serNum": 2236, "atom2_serNum": 2577, "donAcc_type": "standard", "distance": 2.858, "atom1_id": "///A/658/NH1", "atom2_id": "///A/698/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 314, "atom1_serNum": 2258, "atom2_serNum": 2287, "donAcc_type": "standard", "distance": 3.271, "atom1_id": "///A/661/O", "atom2_id": "///A/665/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 315, "atom1_serNum": 2260, "atom2_serNum": 2273, "donAcc_type": "acceptable", "distance": 3.224, "atom1_id": "///A/661/OG1", "atom2_id": "///A/664/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 316, "atom1_serNum": 2265, "atom2_serNum": 2295, "donAcc_type": "standard", "distance": 2.827, "atom1_id": "///A/662/O", "atom2_id": "///A/666/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 317, "atom1_serNum": 2272, "atom2_serNum": 2307, "donAcc_type": "standard", "distance": 2.900, "atom1_id": "///A/663/O", "atom2_id": "///A/667/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 318, "atom1_serNum": 2272, "atom2_serNum": 2312, "donAcc_type": "acceptable", "distance": 2.714, "atom1_id": "///A/663/O", "atom2_id": "///A/667/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 319, "atom1_serNum": 2276, "atom2_serNum": 2314, "donAcc_type": "standard", "distance": 2.910, "atom1_id": "///A/664/O", "atom2_id": "///A/668/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 320, "atom1_serNum": 2290, "atom2_serNum": 2325, "donAcc_type": "standard", "distance": 2.854, "atom1_id": "///A/665/O", "atom2_id": "///A/669/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 321, "atom1_serNum": 2298, "atom2_serNum": 2333, "donAcc_type": "standard", "distance": 2.768, "atom1_id": "///A/666/O", "atom2_id": "///A/670/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 322, "atom1_serNum": 2310, "atom2_serNum": 2341, "donAcc_type": "standard", "distance": 2.824, "atom1_id": "///A/667/O", "atom2_id": "///A/671/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 323, "atom1_serNum": 2317, "atom2_serNum": 2347, "donAcc_type": "standard", "distance": 3.142, "atom1_id": "///A/668/O", "atom2_id": "///A/672/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 324, "atom1_serNum": 2328, "atom2_serNum": 2358, "donAcc_type": "standard", "distance": 2.931, "atom1_id": "///A/669/O", "atom2_id": "///A/673/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 325, "atom1_serNum": 2336, "atom2_serNum": 2369, "donAcc_type": "standard", "distance": 3.096, "atom1_id": "///A/670/O", "atom2_id": "///A/674/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 326, "atom1_serNum": 2344, "atom2_serNum": 2369, "donAcc_type": "standard", "distance": 2.886, "atom1_id": "///A/671/O", "atom2_id": "///A/674/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 327, "atom1_serNum": 2344, "atom2_serNum": 2376, "donAcc_type": "standard", "distance": 3.121, "atom1_id": "///A/671/O", "atom2_id": "///A/675/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 328, "atom1_serNum": 2346, "atom2_serNum": 2655, "donAcc_type": "acceptable", "distance": 2.767, "atom1_id": "///A/671/OG", "atom2_id": "///A/707/NE1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 329, "atom1_serNum": 2350, "atom2_serNum": 2385, "donAcc_type": "standard", "distance": 2.866, "atom1_id": "///A/672/O", "atom2_id": "///A/676/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 330, "atom1_serNum": 2356, "atom2_serNum": 2384, "donAcc_type": "standard", "distance": 2.793, "atom1_id": "///A/672/NH1", "atom2_id": "///A/675/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 331, "atom1_serNum": 2361, "atom2_serNum": 2393, "donAcc_type": "standard", "distance": 2.931, "atom1_id": "///A/673/O", "atom2_id": "///A/677/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 332, "atom1_serNum": 2372, "atom2_serNum": 2401, "donAcc_type": "standard", "distance": 2.950, "atom1_id": "///A/674/O", "atom2_id": "///A/678/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 333, "atom1_serNum": 2379, "atom2_serNum": 2410, "donAcc_type": "standard", "distance": 3.014, "atom1_id": "///A/675/O", "atom2_id": "///A/679/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 334, "atom1_serNum": 2388, "atom2_serNum": 2421, "donAcc_type": "standard", "distance": 3.048, "atom1_id": "///A/676/O", "atom2_id": "///A/680/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 335, "atom1_serNum": 2396, "atom2_serNum": 2439, "donAcc_type": "standard", "distance": 2.953, "atom1_id": "///A/677/O", "atom2_id": "///A/682/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 336, "atom1_serNum": 2404, "atom2_serNum": 2429, "donAcc_type": "standard", "distance": 2.783, "atom1_id": "///A/678/O", "atom2_id": "///A/681/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 337, "atom1_serNum": 2408, "atom2_serNum": 2690, "donAcc_type": "standard", "distance": 2.685, "atom1_id": "///A/678/OE1", "atom2_id": "///A/710/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 338, "atom1_serNum": 2408, "atom2_serNum": 2722, "donAcc_type": "standard", "distance": 2.835, "atom1_id": "///A/678/OE1", "atom2_id": "///A/714/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 339, "atom1_serNum": 2409, "atom2_serNum": 9904, "donAcc_type": "standard", "distance": 2.846, "atom1_id": "///A/678/NE2", "atom2_id": "///S/0/O4", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 340, "atom1_serNum": 2420, "atom2_serNum": 11444, "donAcc_type": "standard", "distance": 2.832, "atom1_id": "///A/679/NH2", "atom2_id": "///Y/14/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 341, "atom1_serNum": 2424, "atom2_serNum": 2439, "donAcc_type": "standard", "distance": 2.692, "atom1_id": "///A/680/O", "atom2_id": "///A/682/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 342, "atom1_serNum": 2432, "atom2_serNum": 2447, "donAcc_type": "standard", "distance": 2.690, "atom1_id": "///A/681/O", "atom2_id": "///A/683/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 343, "atom1_serNum": 2438, "atom2_serNum": 11424, "donAcc_type": "standard", "distance": 2.934, "atom1_id": "///A/681/NE2", "atom2_id": "///Y/13/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 344, "atom1_serNum": 2442, "atom2_serNum": 2477, "donAcc_type": "standard", "distance": 3.293, "atom1_id": "///A/682/O", "atom2_id": "///A/686/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 345, "atom1_serNum": 2462, "atom2_serNum": 2489, "donAcc_type": "standard", "distance": 3.038, "atom1_id": "///A/684/O", "atom2_id": "///A/688/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 346, "atom1_serNum": 2471, "atom2_serNum": 2500, "donAcc_type": "standard", "distance": 2.816, "atom1_id": "///A/685/O", "atom2_id": "///A/689/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 347, "atom1_serNum": 2480, "atom2_serNum": 2509, "donAcc_type": "standard", "distance": 2.934, "atom1_id": "///A/686/O", "atom2_id": "///A/690/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 348, "atom1_serNum": 2485, "atom2_serNum": 2517, "donAcc_type": "standard", "distance": 2.882, "atom1_id": "///A/687/O", "atom2_id": "///A/691/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 349, "atom1_serNum": 2492, "atom2_serNum": 2526, "donAcc_type": "standard", "distance": 2.782, "atom1_id": "///A/688/O", "atom2_id": "///A/692/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 350, "atom1_serNum": 2503, "atom2_serNum": 2532, "donAcc_type": "standard", "distance": 2.994, "atom1_id": "///A/689/O", "atom2_id": "///A/693/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 351, "atom1_serNum": 2512, "atom2_serNum": 2540, "donAcc_type": "standard", "distance": 2.972, "atom1_id": "///A/690/O", "atom2_id": "///A/694/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 352, "atom1_serNum": 2520, "atom2_serNum": 2548, "donAcc_type": "standard", "distance": 3.013, "atom1_id": "///A/691/O", "atom2_id": "///A/695/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 353, "atom1_serNum": 2520, "atom2_serNum": 2553, "donAcc_type": "acceptable", "distance": 3.171, "atom1_id": "///A/691/O", "atom2_id": "///A/695/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 354, "atom1_serNum": 2529, "atom2_serNum": 2548, "donAcc_type": "standard", "distance": 2.686, "atom1_id": "///A/692/O", "atom2_id": "///A/695/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 355, "atom1_serNum": 2529, "atom2_serNum": 2553, "donAcc_type": "acceptable", "distance": 2.198, "atom1_id": "///A/692/O", "atom2_id": "///A/695/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 356, "atom1_serNum": 2535, "atom2_serNum": 2562, "donAcc_type": "standard", "distance": 2.971, "atom1_id": "///A/693/O", "atom2_id": "///A/696/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 357, "atom1_serNum": 2543, "atom2_serNum": 2631, "donAcc_type": "standard", "distance": 2.288, "atom1_id": "///A/694/O", "atom2_id": "///A/704/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 358, "atom1_serNum": 2557, "atom2_serNum": 2631, "donAcc_type": "standard", "distance": 3.491, "atom1_id": "///A/696/O", "atom2_id": "///A/704/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 359, "atom1_serNum": 2561, "atom2_serNum": 2574, "donAcc_type": "standard", "distance": 2.743, "atom1_id": "///A/696/OE1", "atom2_id": "///A/698/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 360, "atom1_serNum": 2561, "atom2_serNum": 2582, "donAcc_type": "standard", "distance": 2.873, "atom1_id": "///A/696/OE1", "atom2_id": "///A/699/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 361, "atom1_serNum": 2562, "atom2_serNum": 2585, "donAcc_type": "standard", "distance": 3.396, "atom1_id": "///A/696/NE2", "atom2_id": "///A/699/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 362, "atom1_serNum": 2572, "atom2_serNum": 2889, "donAcc_type": "standard", "distance": 2.933, "atom1_id": "///A/697/NH1", "atom2_id": "///A/735/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 363, "atom1_serNum": 2573, "atom2_serNum": 2889, "donAcc_type": "standard", "distance": 2.880, "atom1_id": "///A/697/NH2", "atom2_id": "///A/735/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 364, "atom1_serNum": 2597, "atom2_serNum": 2615, "donAcc_type": "standard", "distance": 2.870, "atom1_id": "///A/700/O", "atom2_id": "///A/703/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 365, "atom1_serNum": 2603, "atom2_serNum": 2621, "donAcc_type": "standard", "distance": 3.162, "atom1_id": "///A/701/O", "atom2_id": "///A/704/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 366, "atom1_serNum": 2607, "atom2_serNum": 2613, "donAcc_type": "standard", "distance": 2.632, "atom1_id": "///A/702/N", "atom2_id": "///A/702/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 367, "atom1_serNum": 2614, "atom2_serNum": 4486, "donAcc_type": "standard", "distance": 2.746, "atom1_id": "///A/702/OD2", "atom2_id": "///A/952/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 368, "atom1_serNum": 2614, "atom2_serNum": 4489, "donAcc_type": "standard", "distance": 2.835, "atom1_id": "///A/702/OD2", "atom2_id": "///A/952/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 369, "atom1_serNum": 2618, "atom2_serNum": 2647, "donAcc_type": "standard", "distance": 3.102, "atom1_id": "///A/703/O", "atom2_id": "///A/707/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 370, "atom1_serNum": 2624, "atom2_serNum": 2661, "donAcc_type": "standard", "distance": 2.647, "atom1_id": "///A/704/O", "atom2_id": "///A/708/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 371, "atom1_serNum": 2630, "atom2_serNum": 2890, "donAcc_type": "standard", "distance": 2.445, "atom1_id": "///A/704/NH1", "atom2_id": "///A/735/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 372, "atom1_serNum": 2635, "atom2_serNum": 2675, "donAcc_type": "standard", "distance": 3.185, "atom1_id": "///A/705/O", "atom2_id": "///A/709/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 373, "atom1_serNum": 2639, "atom2_serNum": 2683, "donAcc_type": "standard", "distance": 2.942, "atom1_id": "///A/706/O", "atom2_id": "///A/710/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 374, "atom1_serNum": 2643, "atom2_serNum": 9889, "donAcc_type": "standard", "distance": 2.843, "atom1_id": "///A/706/NE", "atom2_id": "///S/0/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 375, "atom1_serNum": 2650, "atom2_serNum": 2694, "donAcc_type": "standard", "distance": 2.597, "atom1_id": "///A/707/O", "atom2_id": "///A/711/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 376, "atom1_serNum": 2664, "atom2_serNum": 2702, "donAcc_type": "standard", "distance": 2.917, "atom1_id": "///A/708/O", "atom2_id": "///A/712/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 377, "atom1_serNum": 2669, "atom2_serNum": 2890, "donAcc_type": "standard", "distance": 2.960, "atom1_id": "///A/708/NE1", "atom2_id": "///A/735/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 378, "atom1_serNum": 2678, "atom2_serNum": 2707, "donAcc_type": "standard", "distance": 2.800, "atom1_id": "///A/709/O", "atom2_id": "///A/713/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 379, "atom1_serNum": 2681, "atom2_serNum": 2970, "donAcc_type": "acceptable", "distance": 2.733, "atom1_id": "///A/709/OD1", "atom2_id": "///A/745/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 380, "atom1_serNum": 2682, "atom2_serNum": 2942, "donAcc_type": "acceptable", "distance": 2.966, "atom1_id": "///A/709/OD2", "atom2_id": "///A/742/ND1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 381, "atom1_serNum": 2682, "atom2_serNum": 2970, "donAcc_type": "acceptable", "distance": 2.998, "atom1_id": "///A/709/OD2", "atom2_id": "///A/745/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 382, "atom1_serNum": 2686, "atom2_serNum": 2715, "donAcc_type": "standard", "distance": 3.084, "atom1_id": "///A/710/O", "atom2_id": "///A/714/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 383, "atom1_serNum": 2692, "atom2_serNum": 11403, "donAcc_type": "standard", "distance": 3.011, "atom1_id": "///A/710/NH1", "atom2_id": "///Y/12/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 384, "atom1_serNum": 2693, "atom2_serNum": 2721, "donAcc_type": "standard", "distance": 3.309, "atom1_id": "///A/710/NH2", "atom2_id": "///A/714/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 385, "atom1_serNum": 2693, "atom2_serNum": 11402, "donAcc_type": "standard", "distance": 2.757, "atom1_id": "///A/710/NH2", "atom2_id": "///Y/12/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 386, "atom1_serNum": 2697, "atom2_serNum": 2715, "donAcc_type": "standard", "distance": 2.820, "atom1_id": "///A/711/O", "atom2_id": "///A/714/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 387, "atom1_serNum": 2697, "atom2_serNum": 2723, "donAcc_type": "standard", "distance": 2.934, "atom1_id": "///A/711/O", "atom2_id": "///A/715/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 388, "atom1_serNum": 2705, "atom2_serNum": 2731, "donAcc_type": "standard", "distance": 2.886, "atom1_id": "///A/712/O", "atom2_id": "///A/716/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 389, "atom1_serNum": 2710, "atom2_serNum": 2741, "donAcc_type": "standard", "distance": 2.930, "atom1_id": "///A/713/O", "atom2_id": "///A/717/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 390, "atom1_serNum": 2718, "atom2_serNum": 2750, "donAcc_type": "standard", "distance": 2.914, "atom1_id": "///A/714/O", "atom2_id": "///A/718/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 391, "atom1_serNum": 2718, "atom2_serNum": 2760, "donAcc_type": "standard", "distance": 2.858, "atom1_id": "///A/714/O", "atom2_id": "///A/719/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 392, "atom1_serNum": 2726, "atom2_serNum": 2777, "donAcc_type": "standard", "distance": 3.058, "atom1_id": "///A/715/O", "atom2_id": "///A/721/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 393, "atom1_serNum": 2737, "atom2_serNum": 3009, "donAcc_type": "acceptable", "distance": 2.962, "atom1_id": "///A/716/ND1", "atom2_id": "///A/749/NH1", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 394, "atom1_serNum": 2744, "atom2_serNum": 2776, "donAcc_type": "standard", "distance": 3.511, "atom1_id": "///A/717/O", "atom2_id": "///A/720/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 395, "atom1_serNum": 2759, "atom2_serNum": 11402, "donAcc_type": "standard", "distance": 2.954, "atom1_id": "///A/718/NE2", "atom2_id": "///Y/12/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 396, "atom1_serNum": 2763, "atom2_serNum": 2777, "donAcc_type": "standard", "distance": 2.346, "atom1_id": "///A/719/O", "atom2_id": "///A/721/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 397, "atom1_serNum": 2771, "atom2_serNum": 2788, "donAcc_type": "standard", "distance": 3.021, "atom1_id": "///A/720/O", "atom2_id": "///A/722/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 398, "atom1_serNum": 2780, "atom2_serNum": 2812, "donAcc_type": "standard", "distance": 3.205, "atom1_id": "///A/721/O", "atom2_id": "///A/725/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 399, "atom1_serNum": 2799, "atom2_serNum": 2819, "donAcc_type": "standard", "distance": 3.030, "atom1_id": "///A/723/O", "atom2_id": "///A/726/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 400, "atom1_serNum": 2799, "atom2_serNum": 2827, "donAcc_type": "standard", "distance": 3.565, "atom1_id": "///A/723/O", "atom2_id": "///A/727/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 401, "atom1_serNum": 2808, "atom2_serNum": 2827, "donAcc_type": "standard", "distance": 2.760, "atom1_id": "///A/724/O", "atom2_id": "///A/727/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 402, "atom1_serNum": 2808, "atom2_serNum": 2836, "donAcc_type": "standard", "distance": 2.772, "atom1_id": "///A/724/O", "atom2_id": "///A/728/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 403, "atom1_serNum": 2815, "atom2_serNum": 2842, "donAcc_type": "standard", "distance": 2.976, "atom1_id": "///A/725/O", "atom2_id": "///A/729/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 404, "atom1_serNum": 2822, "atom2_serNum": 2850, "donAcc_type": "standard", "distance": 2.835, "atom1_id": "///A/726/O", "atom2_id": "///A/730/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 405, "atom1_serNum": 2822, "atom2_serNum": 2855, "donAcc_type": "acceptable", "distance": 2.465, "atom1_id": "///A/726/O", "atom2_id": "///A/730/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 406, "atom1_serNum": 2830, "atom2_serNum": 2857, "donAcc_type": "standard", "distance": 2.934, "atom1_id": "///A/727/O", "atom2_id": "///A/731/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 407, "atom1_serNum": 2839, "atom2_serNum": 2866, "donAcc_type": "standard", "distance": 2.927, "atom1_id": "///A/728/O", "atom2_id": "///A/732/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 408, "atom1_serNum": 2845, "atom2_serNum": 2870, "donAcc_type": "standard", "distance": 3.073, "atom1_id": "///A/729/O", "atom2_id": "///A/733/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 409, "atom1_serNum": 2853, "atom2_serNum": 2878, "donAcc_type": "standard", "distance": 3.072, "atom1_id": "///A/730/O", "atom2_id": "///A/734/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 410, "atom1_serNum": 2860, "atom2_serNum": 2878, "donAcc_type": "standard", "distance": 2.941, "atom1_id": "///A/731/O", "atom2_id": "///A/734/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 411, "atom1_serNum": 2860, "atom2_serNum": 2883, "donAcc_type": "standard", "distance": 3.066, "atom1_id": "///A/731/O", "atom2_id": "///A/735/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 412, "atom1_serNum": 2869, "atom2_serNum": 2883, "donAcc_type": "standard", "distance": 3.255, "atom1_id": "///A/732/O", "atom2_id": "///A/735/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 413, "atom1_serNum": 2873, "atom2_serNum": 2956, "donAcc_type": "standard", "distance": 2.498, "atom1_id": "///A/733/O", "atom2_id": "///A/743/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 414, "atom1_serNum": 2886, "atom2_serNum": 2907, "donAcc_type": "standard", "distance": 2.867, "atom1_id": "///A/735/O", "atom2_id": "///A/738/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 415, "atom1_serNum": 2886, "atom2_serNum": 2955, "donAcc_type": "standard", "distance": 3.665, "atom1_id": "///A/735/O", "atom2_id": "///A/743/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 416, "atom1_serNum": 2889, "atom2_serNum": 2898, "donAcc_type": "standard", "distance": 3.157, "atom1_id": "///A/735/OD1", "atom2_id": "///A/737/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 417, "atom1_serNum": 2894, "atom2_serNum": 2921, "donAcc_type": "standard", "distance": 2.866, "atom1_id": "///A/736/O", "atom2_id": "///A/739/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 418, "atom1_serNum": 2910, "atom2_serNum": 2955, "donAcc_type": "standard", "distance": 2.243, "atom1_id": "///A/738/O", "atom2_id": "///A/743/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 419, "atom1_serNum": 2917, "atom2_serNum": 2936, "donAcc_type": "standard", "distance": 3.288, "atom1_id": "///A/739/O", "atom2_id": "///A/742/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 420, "atom1_serNum": 2917, "atom2_serNum": 2946, "donAcc_type": "standard", "distance": 3.006, "atom1_id": "///A/739/O", "atom2_id": "///A/743/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 421, "atom1_serNum": 2923, "atom2_serNum": 3864, "donAcc_type": "standard", "distance": 3.202, "atom1_id": "///A/739/NH1", "atom2_id": "///A/873/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 422, "atom1_serNum": 2923, "atom2_serNum": 4467, "donAcc_type": "standard", "distance": 2.863, "atom1_id": "///A/739/NH1", "atom2_id": "///A/950/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 423, "atom1_serNum": 2924, "atom2_serNum": 3865, "donAcc_type": "standard", "distance": 2.485, "atom1_id": "///A/739/NH2", "atom2_id": "///A/873/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 424, "atom1_serNum": 2928, "atom2_serNum": 2957, "donAcc_type": "standard", "distance": 2.838, "atom1_id": "///A/740/O", "atom2_id": "///A/744/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 425, "atom1_serNum": 2930, "atom2_serNum": 4493, "donAcc_type": "acceptable", "distance": 2.973, "atom1_id": "///A/740/OG1", "atom2_id": "///A/953/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 426, "atom1_serNum": 2935, "atom2_serNum": 2965, "donAcc_type": "standard", "distance": 2.854, "atom1_id": "///A/741/O", "atom2_id": "///A/745/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 427, "atom1_serNum": 2939, "atom2_serNum": 2971, "donAcc_type": "standard", "distance": 2.836, "atom1_id": "///A/742/O", "atom2_id": "///A/746/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 428, "atom1_serNum": 2945, "atom2_serNum": 9889, "donAcc_type": "standard", "distance": 2.736, "atom1_id": "///A/742/NE2", "atom2_id": "///S/0/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 429, "atom1_serNum": 2949, "atom2_serNum": 2979, "donAcc_type": "standard", "distance": 3.055, "atom1_id": "///A/743/O", "atom2_id": "///A/747/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 430, "atom1_serNum": 2960, "atom2_serNum": 2991, "donAcc_type": "standard", "distance": 2.782, "atom1_id": "///A/744/O", "atom2_id": "///A/748/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 431, "atom1_serNum": 2968, "atom2_serNum": 3000, "donAcc_type": "standard", "distance": 3.306, "atom1_id": "///A/745/O", "atom2_id": "///A/749/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 432, "atom1_serNum": 2974, "atom2_serNum": 3011, "donAcc_type": "standard", "distance": 3.105, "atom1_id": "///A/746/O", "atom2_id": "///A/750/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 433, "atom1_serNum": 2982, "atom2_serNum": 3016, "donAcc_type": "standard", "distance": 3.203, "atom1_id": "///A/747/O", "atom2_id": "///A/751/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 434, "atom1_serNum": 2994, "atom2_serNum": 3023, "donAcc_type": "standard", "distance": 3.075, "atom1_id": "///A/748/O", "atom2_id": "///A/752/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 435, "atom1_serNum": 3003, "atom2_serNum": 3034, "donAcc_type": "standard", "distance": 2.898, "atom1_id": "///A/749/O", "atom2_id": "///A/753/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 436, "atom1_serNum": 3009, "atom2_serNum": 11383, "donAcc_type": "standard", "distance": 3.062, "atom1_id": "///A/749/NH1", "atom2_id": "///Y/11/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 437, "atom1_serNum": 3010, "atom2_serNum": 11383, "donAcc_type": "standard", "distance": 2.803, "atom1_id": "///A/749/NH2", "atom2_id": "///Y/11/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 438, "atom1_serNum": 3014, "atom2_serNum": 3042, "donAcc_type": "standard", "distance": 2.712, "atom1_id": "///A/750/O", "atom2_id": "///A/754/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 439, "atom1_serNum": 3019, "atom2_serNum": 3053, "donAcc_type": "standard", "distance": 2.963, "atom1_id": "///A/751/O", "atom2_id": "///A/755/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 440, "atom1_serNum": 3033, "atom2_serNum": 11363, "donAcc_type": "standard", "distance": 3.279, "atom1_id": "///A/752/NH2", "atom2_id": "///Y/10/O5'", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 441, "atom1_serNum": 3037, "atom2_serNum": 3062, "donAcc_type": "standard", "distance": 3.094, "atom1_id": "///A/753/O", "atom2_id": "///A/756/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 442, "atom1_serNum": 3065, "atom2_serNum": 3081, "donAcc_type": "standard", "distance": 3.372, "atom1_id": "///A/756/O", "atom2_id": "///A/759/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 443, "atom1_serNum": 3065, "atom2_serNum": 3087, "donAcc_type": "standard", "distance": 3.093, "atom1_id": "///A/756/O", "atom2_id": "///A/760/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 444, "atom1_serNum": 3067, "atom2_serNum": 3080, "donAcc_type": "acceptable", "distance": 2.987, "atom1_id": "///A/756/OG", "atom2_id": "///A/758/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 445, "atom1_serNum": 3071, "atom2_serNum": 3087, "donAcc_type": "standard", "distance": 2.757, "atom1_id": "///A/757/O", "atom2_id": "///A/760/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 446, "atom1_serNum": 3090, "atom2_serNum": 3105, "donAcc_type": "standard", "distance": 2.571, "atom1_id": "///A/760/O", "atom2_id": "///A/762/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 447, "atom1_serNum": 3128, "atom2_serNum": 3162, "donAcc_type": "standard", "distance": 2.946, "atom1_id": "///A/764/O", "atom2_id": "///A/767/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 448, "atom1_serNum": 3146, "atom2_serNum": 3163, "donAcc_type": "standard", "distance": 2.436, "atom1_id": "///A/766/O", "atom2_id": "///A/768/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 449, "atom1_serNum": 3166, "atom2_serNum": 3180, "donAcc_type": "standard", "distance": 3.399, "atom1_id": "///A/768/O", "atom2_id": "///A/770/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 450, "atom1_serNum": 3183, "atom2_serNum": 3196, "donAcc_type": "standard", "distance": 2.683, "atom1_id": "///A/770/O", "atom2_id": "///A/772/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 451, "atom1_serNum": 3190, "atom2_serNum": 3204, "donAcc_type": "standard", "distance": 2.606, "atom1_id": "///A/771/O", "atom2_id": "///A/773/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 452, "atom1_serNum": 3199, "atom2_serNum": 3209, "donAcc_type": "standard", "distance": 2.905, "atom1_id": "///A/772/O", "atom2_id": "///A/774/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 453, "atom1_serNum": 3207, "atom2_serNum": 3216, "donAcc_type": "standard", "distance": 2.924, "atom1_id": "///A/773/O", "atom2_id": "///A/775/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 454, "atom1_serNum": 3236, "atom2_serNum": 3249, "donAcc_type": "standard", "distance": 3.113, "atom1_id": "///A/777/O", "atom2_id": "///A/779/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 455, "atom1_serNum": 3243, "atom2_serNum": 4894, "donAcc_type": "standard", "distance": 3.156, "atom1_id": "///A/778/O", "atom2_id": "///A/1003/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 456, "atom1_serNum": 3255, "atom2_serNum": 4916, "donAcc_type": "acceptable", "distance": 2.734, "atom1_id": "///A/779/ND1", "atom2_id": "///A/1005/NE2", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 457, "atom1_serNum": 3259, "atom2_serNum": 4897, "donAcc_type": "standard", "distance": 2.962, "atom1_id": "///A/780/N", "atom2_id": "///A/1003/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 458, "atom1_serNum": 3262, "atom2_serNum": 4907, "donAcc_type": "standard", "distance": 2.863, "atom1_id": "///A/780/O", "atom2_id": "///A/1005/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 459, "atom1_serNum": 3273, "atom2_serNum": 4910, "donAcc_type": "standard", "distance": 2.837, "atom1_id": "///A/782/N", "atom2_id": "///A/1005/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 460, "atom1_serNum": 3276, "atom2_serNum": 4924, "donAcc_type": "standard", "distance": 2.930, "atom1_id": "///A/782/O", "atom2_id": "///A/1007/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 461, "atom1_serNum": 3288, "atom2_serNum": 4927, "donAcc_type": "standard", "distance": 2.771, "atom1_id": "///A/784/N", "atom2_id": "///A/1007/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 462, "atom1_serNum": 3291, "atom2_serNum": 3303, "donAcc_type": "standard", "distance": 3.186, "atom1_id": "///A/784/O", "atom2_id": "///A/786/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 463, "atom1_serNum": 3291, "atom2_serNum": 4936, "donAcc_type": "standard", "distance": 3.142, "atom1_id": "///A/784/O", "atom2_id": "///A/1009/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 464, "atom1_serNum": 3295, "atom2_serNum": 3350, "donAcc_type": "standard", "distance": 2.867, "atom1_id": "///A/785/O", "atom2_id": "///A/798/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 465, "atom1_serNum": 3311, "atom2_serNum": 3335, "donAcc_type": "standard", "distance": 3.024, "atom1_id": "///A/787/N", "atom2_id": "///A/796/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 466, "atom1_serNum": 3331, "atom2_serNum": 9990, "donAcc_type": "acceptable", "distance": 3.163, "atom1_id": "///A/795/OG", "atom2_id": "///S/5/OP1", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 467, "atom1_serNum": 3331, "atom2_serNum": 9992, "donAcc_type": "acceptable", "distance": 3.090, "atom1_id": "///A/795/OG", "atom2_id": "///S/5/O5'", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 468, "atom1_serNum": 3339, "atom2_serNum": 3383, "donAcc_type": "standard", "distance": 3.070, "atom1_id": "///A/797/N", "atom2_id": "///A/812/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 469, "atom1_serNum": 3342, "atom2_serNum": 3380, "donAcc_type": "standard", "distance": 3.085, "atom1_id": "///A/797/O", "atom2_id": "///A/812/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 470, "atom1_serNum": 3357, "atom2_serNum": 3368, "donAcc_type": "standard", "distance": 3.004, "atom1_id": "///A/799/N", "atom2_id": "///A/810/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 471, "atom1_serNum": 3360, "atom2_serNum": 3365, "donAcc_type": "standard", "distance": 2.627, "atom1_id": "///A/799/O", "atom2_id": "///A/810/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 472, "atom1_serNum": 3386, "atom2_serNum": 3415, "donAcc_type": "standard", "distance": 2.857, "atom1_id": "///A/813/N", "atom2_id": "///A/816/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 473, "atom1_serNum": 3389, "atom2_serNum": 3417, "donAcc_type": "standard", "distance": 3.047, "atom1_id": "///A/813/O", "atom2_id": "///A/817/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 474, "atom1_serNum": 3391, "atom2_serNum": 3399, "donAcc_type": "acceptable", "distance": 3.191, "atom1_id": "///A/813/OG", "atom2_id": "///A/815/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 475, "atom1_serNum": 3391, "atom2_serNum": 3408, "donAcc_type": "acceptable", "distance": 3.139, "atom1_id": "///A/813/OG", "atom2_id": "///A/816/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 476, "atom1_serNum": 3395, "atom2_serNum": 3425, "donAcc_type": "standard", "distance": 3.300, "atom1_id": "///A/814/O", "atom2_id": "///A/818/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 477, "atom1_serNum": 3399, "atom2_serNum": 3406, "donAcc_type": "standard", "distance": 3.197, "atom1_id": "///A/815/N", "atom2_id": "///A/815/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 478, "atom1_serNum": 3402, "atom2_serNum": 3425, "donAcc_type": "standard", "distance": 2.909, "atom1_id": "///A/815/O", "atom2_id": "///A/818/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 479, "atom1_serNum": 3402, "atom2_serNum": 3430, "donAcc_type": "standard", "distance": 2.933, "atom1_id": "///A/815/O", "atom2_id": "///A/819/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 480, "atom1_serNum": 3411, "atom2_serNum": 3438, "donAcc_type": "standard", "distance": 3.155, "atom1_id": "///A/816/O", "atom2_id": "///A/820/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 481, "atom1_serNum": 3411, "atom2_serNum": 3475, "donAcc_type": "standard", "distance": 3.978, "atom1_id": "///A/816/O", "atom2_id": "///A/823/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 482, "atom1_serNum": 3420, "atom2_serNum": 3443, "donAcc_type": "standard", "distance": 3.201, "atom1_id": "///A/817/O", "atom2_id": "///A/821/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 483, "atom1_serNum": 3428, "atom2_serNum": 3453, "donAcc_type": "standard", "distance": 2.955, "atom1_id": "///A/818/O", "atom2_id": "///A/822/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 484, "atom1_serNum": 3433, "atom2_serNum": 3465, "donAcc_type": "standard", "distance": 2.893, "atom1_id": "///A/819/O", "atom2_id": "///A/823/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 485, "atom1_serNum": 3441, "atom2_serNum": 3465, "donAcc_type": "standard", "distance": 2.894, "atom1_id": "///A/820/O", "atom2_id": "///A/823/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 486, "atom1_serNum": 3441, "atom2_serNum": 3476, "donAcc_type": "standard", "distance": 3.098, "atom1_id": "///A/820/O", "atom2_id": "///A/824/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 487, "atom1_serNum": 3446, "atom2_serNum": 3487, "donAcc_type": "standard", "distance": 2.998, "atom1_id": "///A/821/O", "atom2_id": "///A/825/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 488, "atom1_serNum": 3446, "atom2_serNum": 3492, "donAcc_type": "acceptable", "distance": 2.845, "atom1_id": "///A/821/O", "atom2_id": "///A/825/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 489, "atom1_serNum": 3456, "atom2_serNum": 3497, "donAcc_type": "standard", "distance": 2.963, "atom1_id": "///A/822/O", "atom2_id": "///A/827/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 490, "atom1_serNum": 3464, "atom2_serNum": 4893, "donAcc_type": "acceptable", "distance": 2.207, "atom1_id": "///A/822/OH", "atom2_id": "///A/1002/OE2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 491, "atom1_serNum": 3468, "atom2_serNum": 3493, "donAcc_type": "standard", "distance": 3.095, "atom1_id": "///A/823/O", "atom2_id": "///A/826/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 492, "atom1_serNum": 3508, "atom2_serNum": 3514, "donAcc_type": "standard", "distance": 2.637, "atom1_id": "///A/828/N", "atom2_id": "///A/828/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 493, "atom1_serNum": 3514, "atom2_serNum": 4592, "donAcc_type": "standard", "distance": 2.717, "atom1_id": "///A/828/OD1", "atom2_id": "///A/966/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 494, "atom1_serNum": 3515, "atom2_serNum": 3524, "donAcc_type": "standard", "distance": 3.337, "atom1_id": "///A/828/OD2", "atom2_id": "///A/829/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 495, "atom1_serNum": 3516, "atom2_serNum": 4573, "donAcc_type": "standard", "distance": 3.093, "atom1_id": "///A/829/N", "atom2_id": "///A/964/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 496, "atom1_serNum": 3519, "atom2_serNum": 4570, "donAcc_type": "standard", "distance": 2.819, "atom1_id": "///A/829/O", "atom2_id": "///A/964/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 497, "atom1_serNum": 3529, "atom2_serNum": 4559, "donAcc_type": "standard", "distance": 2.671, "atom1_id": "///A/831/N", "atom2_id": "///A/962/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 498, "atom1_serNum": 3532, "atom2_serNum": 4556, "donAcc_type": "standard", "distance": 2.981, "atom1_id": "///A/831/O", "atom2_id": "///A/962/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 499, "atom1_serNum": 3543, "atom2_serNum": 4543, "donAcc_type": "acceptable", "distance": 3.311, "atom1_id": "///A/832/ND1", "atom2_id": "///A/960/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 500, "atom1_serNum": 3547, "atom2_serNum": 4543, "donAcc_type": "standard", "distance": 3.109, "atom1_id": "///A/833/N", "atom2_id": "///A/960/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 501, "atom1_serNum": 3550, "atom2_serNum": 3564, "donAcc_type": "standard", "distance": 2.870, "atom1_id": "///A/833/O", "atom2_id": "///A/836/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 502, "atom1_serNum": 3550, "atom2_serNum": 3569, "donAcc_type": "acceptable", "distance": 3.079, "atom1_id": "///A/833/O", "atom2_id": "///A/836/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 503, "atom1_serNum": 3551, "atom2_serNum": 4543, "donAcc_type": "standard", "distance": 3.147, "atom1_id": "///A/834/N", "atom2_id": "///A/960/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 504, "atom1_serNum": 3559, "atom2_serNum": 4546, "donAcc_type": "questionable", "distance": 2.946, "atom1_id": "///A/834/OE2", "atom2_id": "///A/960/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 505, "atom1_serNum": 3563, "atom2_serNum": 3588, "donAcc_type": "standard", "distance": 2.919, "atom1_id": "///A/835/O", "atom2_id": "///A/839/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 506, "atom1_serNum": 3567, "atom2_serNum": 3594, "donAcc_type": "standard", "distance": 2.889, "atom1_id": "///A/836/O", "atom2_id": "///A/840/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 507, "atom1_serNum": 3569, "atom2_serNum": 4259, "donAcc_type": "acceptable", "distance": 2.485, "atom1_id": "///A/836/OG", "atom2_id": "///A/921/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 508, "atom1_serNum": 3573, "atom2_serNum": 3601, "donAcc_type": "standard", "distance": 3.142, "atom1_id": "///A/837/O", "atom2_id": "///A/841/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 509, "atom1_serNum": 3580, "atom2_serNum": 3609, "donAcc_type": "standard", "distance": 2.826, "atom1_id": "///A/838/O", "atom2_id": "///A/842/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 510, "atom1_serNum": 3591, "atom2_serNum": 3621, "donAcc_type": "standard", "distance": 2.771, "atom1_id": "///A/839/O", "atom2_id": "///A/843/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 511, "atom1_serNum": 3593, "atom2_serNum": 4210, "donAcc_type": "acceptable", "distance": 2.552, "atom1_id": "///A/839/OG", "atom2_id": "///A/916/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 512, "atom1_serNum": 3597, "atom2_serNum": 3625, "donAcc_type": "standard", "distance": 2.764, "atom1_id": "///A/840/O", "atom2_id": "///A/844/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 513, "atom1_serNum": 3604, "atom2_serNum": 3633, "donAcc_type": "standard", "distance": 2.945, "atom1_id": "///A/841/O", "atom2_id": "///A/845/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 514, "atom1_serNum": 3612, "atom2_serNum": 3641, "donAcc_type": "standard", "distance": 2.813, "atom1_id": "///A/842/O", "atom2_id": "///A/846/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 515, "atom1_serNum": 3624, "atom2_serNum": 3649, "donAcc_type": "standard", "distance": 3.001, "atom1_id": "///A/843/O", "atom2_id": "///A/847/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 516, "atom1_serNum": 3628, "atom2_serNum": 4121, "donAcc_type": "acceptable", "distance": 2.859, "atom1_id": "///A/844/O", "atom2_id": "///A/905/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 517, "atom1_serNum": 3636, "atom2_serNum": 3972, "donAcc_type": "standard", "distance": 2.703, "atom1_id": "///A/845/O", "atom2_id": "///A/886/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 518, "atom1_serNum": 3644, "atom2_serNum": 3671, "donAcc_type": "standard", "distance": 2.759, "atom1_id": "///A/846/O", "atom2_id": "///A/849/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 519, "atom1_serNum": 3644, "atom2_serNum": 3679, "donAcc_type": "standard", "distance": 3.064, "atom1_id": "///A/846/O", "atom2_id": "///A/850/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 520, "atom1_serNum": 3652, "atom2_serNum": 3679, "donAcc_type": "standard", "distance": 3.086, "atom1_id": "///A/847/O", "atom2_id": "///A/850/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 521, "atom1_serNum": 3652, "atom2_serNum": 3687, "donAcc_type": "standard", "distance": 3.129, "atom1_id": "///A/847/O", "atom2_id": "///A/851/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 522, "atom1_serNum": 3669, "atom2_serNum": 3972, "donAcc_type": "standard", "distance": 2.999, "atom1_id": "///A/848/OD1", "atom2_id": "///A/886/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 523, "atom1_serNum": 3670, "atom2_serNum": 3973, "donAcc_type": "standard", "distance": 2.652, "atom1_id": "///A/848/OD2", "atom2_id": "///A/886/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 524, "atom1_serNum": 3674, "atom2_serNum": 3914, "donAcc_type": "standard", "distance": 3.526, "atom1_id": "///A/849/O", "atom2_id": "///A/879/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 525, "atom1_serNum": 3721, "atom2_serNum": 3741, "donAcc_type": "standard", "distance": 3.839, "atom1_id": "///A/855/O", "atom2_id": "///A/858/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 526, "atom1_serNum": 3729, "atom2_serNum": 3741, "donAcc_type": "standard", "distance": 2.935, "atom1_id": "///A/856/O", "atom2_id": "///A/858/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 527, "atom1_serNum": 3739, "atom2_serNum": 3768, "donAcc_type": "standard", "distance": 2.676, "atom1_id": "///A/857/OD1", "atom2_id": "///A/860/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 528, "atom1_serNum": 3744, "atom2_serNum": 3797, "donAcc_type": "standard", "distance": 2.937, "atom1_id": "///A/858/O", "atom2_id": "///A/864/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 529, "atom1_serNum": 3744, "atom2_serNum": 3821, "donAcc_type": "standard", "distance": 3.007, "atom1_id": "///A/858/O", "atom2_id": "///A/868/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 530, "atom1_serNum": 3759, "atom2_serNum": 3796, "donAcc_type": "standard", "distance": 2.592, "atom1_id": "///A/860/N", "atom2_id": "///A/864/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 531, "atom1_serNum": 3770, "atom2_serNum": 3796, "donAcc_type": "standard", "distance": 3.057, "atom1_id": "///A/861/N", "atom2_id": "///A/864/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 532, "atom1_serNum": 3797, "atom2_serNum": 3806, "donAcc_type": "standard", "distance": 3.043, "atom1_id": "///A/864/NE2", "atom2_id": "///A/866/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 533, "atom1_serNum": 3801, "atom2_serNum": 4201, "donAcc_type": "standard", "distance": 3.086, "atom1_id": "///A/865/O", "atom2_id": "///A/915/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 534, "atom1_serNum": 3817, "atom2_serNum": 3837, "donAcc_type": "standard", "distance": 2.888, "atom1_id": "///A/867/O", "atom2_id": "///A/870/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 535, "atom1_serNum": 3829, "atom2_serNum": 3835, "donAcc_type": "standard", "distance": 2.811, "atom1_id": "///A/869/N", "atom2_id": "///A/869/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 536, "atom1_serNum": 3832, "atom2_serNum": 3851, "donAcc_type": "standard", "distance": 2.975, "atom1_id": "///A/869/O", "atom2_id": "///A/872/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 537, "atom1_serNum": 3832, "atom2_serNum": 3856, "donAcc_type": "acceptable", "distance": 3.156, "atom1_id": "///A/869/O", "atom2_id": "///A/872/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 538, "atom1_serNum": 3835, "atom2_serNum": 3916, "donAcc_type": "standard", "distance": 3.298, "atom1_id": "///A/869/OD1", "atom2_id": "///A/879/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 539, "atom1_serNum": 3836, "atom2_serNum": 3871, "donAcc_type": "acceptable", "distance": 3.322, "atom1_id": "///A/869/OD2", "atom2_id": "///A/874/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 540, "atom1_serNum": 3836, "atom2_serNum": 3916, "donAcc_type": "standard", "distance": 3.046, "atom1_id": "///A/869/OD2", "atom2_id": "///A/879/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 541, "atom1_serNum": 3861, "atom2_serNum": 3894, "donAcc_type": "standard", "distance": 3.478, "atom1_id": "///A/873/O", "atom2_id": "///A/877/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 542, "atom1_serNum": 3869, "atom2_serNum": 3901, "donAcc_type": "standard", "distance": 2.784, "atom1_id": "///A/874/O", "atom2_id": "///A/878/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 543, "atom1_serNum": 3875, "atom2_serNum": 3916, "donAcc_type": "standard", "distance": 3.202, "atom1_id": "///A/875/O", "atom2_id": "///A/879/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 544, "atom1_serNum": 3886, "atom2_serNum": 3907, "donAcc_type": "standard", "distance": 2.974, "atom1_id": "///A/876/O", "atom2_id": "///A/879/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 545, "atom1_serNum": 3886, "atom2_serNum": 3918, "donAcc_type": "standard", "distance": 2.792, "atom1_id": "///A/876/O", "atom2_id": "///A/880/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 546, "atom1_serNum": 3897, "atom2_serNum": 3918, "donAcc_type": "standard", "distance": 3.336, "atom1_id": "///A/877/O", "atom2_id": "///A/880/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 547, "atom1_serNum": 3910, "atom2_serNum": 3941, "donAcc_type": "standard", "distance": 2.897, "atom1_id": "///A/879/O", "atom2_id": "///A/883/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 548, "atom1_serNum": 3921, "atom2_serNum": 3949, "donAcc_type": "standard", "distance": 2.745, "atom1_id": "///A/880/O", "atom2_id": "///A/884/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 549, "atom1_serNum": 3927, "atom2_serNum": 3957, "donAcc_type": "standard", "distance": 3.830, "atom1_id": "///A/880/NH1", "atom2_id": "///A/884/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 550, "atom1_serNum": 3932, "atom2_serNum": 3958, "donAcc_type": "standard", "distance": 3.123, "atom1_id": "///A/881/O", "atom2_id": "///A/885/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 551, "atom1_serNum": 3939, "atom2_serNum": 3963, "donAcc_type": "standard", "distance": 3.056, "atom1_id": "///A/882/O", "atom2_id": "///A/886/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 552, "atom1_serNum": 3944, "atom2_serNum": 3974, "donAcc_type": "standard", "distance": 2.852, "atom1_id": "///A/883/O", "atom2_id": "///A/887/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 553, "atom1_serNum": 3952, "atom2_serNum": 3982, "donAcc_type": "standard", "distance": 3.058, "atom1_id": "///A/884/O", "atom2_id": "///A/888/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 554, "atom1_serNum": 3956, "atom2_serNum": 4430, "donAcc_type": "standard", "distance": 2.981, "atom1_id": "///A/884/OE1", "atom2_id": "///A/945/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 555, "atom1_serNum": 3956, "atom2_serNum": 4431, "donAcc_type": "standard", "distance": 3.021, "atom1_id": "///A/884/OE1", "atom2_id": "///A/945/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 556, "atom1_serNum": 3957, "atom2_serNum": 4430, "donAcc_type": "standard", "distance": 3.388, "atom1_id": "///A/884/OE2", "atom2_id": "///A/945/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 557, "atom1_serNum": 3961, "atom2_serNum": 3991, "donAcc_type": "standard", "distance": 3.025, "atom1_id": "///A/885/O", "atom2_id": "///A/889/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 558, "atom1_serNum": 3966, "atom2_serNum": 3999, "donAcc_type": "standard", "distance": 3.060, "atom1_id": "///A/886/O", "atom2_id": "///A/890/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 559, "atom1_serNum": 3977, "atom2_serNum": 4007, "donAcc_type": "standard", "distance": 3.270, "atom1_id": "///A/887/O", "atom2_id": "///A/891/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 560, "atom1_serNum": 3977, "atom2_serNum": 4403, "donAcc_type": "acceptable", "distance": 2.950, "atom1_id": "///A/887/O", "atom2_id": "///A/941/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 561, "atom1_serNum": 3985, "atom2_serNum": 4017, "donAcc_type": "standard", "distance": 3.151, "atom1_id": "///A/888/O", "atom2_id": "///A/892/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 562, "atom1_serNum": 3990, "atom2_serNum": 4023, "donAcc_type": "standard", "distance": 2.968, "atom1_id": "///A/888/NE2", "atom2_id": "///A/892/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 563, "atom1_serNum": 3990, "atom2_serNum": 4024, "donAcc_type": "standard", "distance": 2.589, "atom1_id": "///A/888/NE2", "atom2_id": "///A/892/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 564, "atom1_serNum": 3994, "atom2_serNum": 4025, "donAcc_type": "standard", "distance": 2.772, "atom1_id": "///A/889/O", "atom2_id": "///A/893/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 565, "atom1_serNum": 4002, "atom2_serNum": 4025, "donAcc_type": "standard", "distance": 3.024, "atom1_id": "///A/890/O", "atom2_id": "///A/893/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 566, "atom1_serNum": 4013, "atom2_serNum": 4023, "donAcc_type": "acceptable", "distance": 2.974, "atom1_id": "///A/891/ND1", "atom2_id": "///A/892/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 567, "atom1_serNum": 4033, "atom2_serNum": 4046, "donAcc_type": "standard", "distance": 2.650, "atom1_id": "///A/894/O", "atom2_id": "///A/896/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 568, "atom1_serNum": 4033, "atom2_serNum": 4055, "donAcc_type": "standard", "distance": 3.074, "atom1_id": "///A/894/O", "atom2_id": "///A/897/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 569, "atom1_serNum": 4033, "atom2_serNum": 4061, "donAcc_type": "standard", "distance": 3.478, "atom1_id": "///A/894/O", "atom2_id": "///A/898/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 570, "atom1_serNum": 4044, "atom2_serNum": 4353, "donAcc_type": "acceptable", "distance": 3.145, "atom1_id": "///A/895/OE1", "atom2_id": "///A/933/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 571, "atom1_serNum": 4049, "atom2_serNum": 4080, "donAcc_type": "standard", "distance": 2.656, "atom1_id": "///A/896/O", "atom2_id": "///A/900/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 572, "atom1_serNum": 4058, "atom2_serNum": 4085, "donAcc_type": "standard", "distance": 2.672, "atom1_id": "///A/897/O", "atom2_id": "///A/901/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 573, "atom1_serNum": 4064, "atom2_serNum": 4099, "donAcc_type": "standard", "distance": 3.055, "atom1_id": "///A/898/O", "atom2_id": "///A/902/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 574, "atom1_serNum": 4072, "atom2_serNum": 4106, "donAcc_type": "standard", "distance": 3.209, "atom1_id": "///A/899/O", "atom2_id": "///A/903/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 575, "atom1_serNum": 4072, "atom2_serNum": 4324, "donAcc_type": "standard", "distance": 2.717, "atom1_id": "///A/899/O", "atom2_id": "///A/929/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 576, "atom1_serNum": 4078, "atom2_serNum": 4353, "donAcc_type": "acceptable", "distance": 2.616, "atom1_id": "///A/899/NH1", "atom2_id": "///A/933/OG", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 577, "atom1_serNum": 4078, "atom2_serNum": 4622, "donAcc_type": "questionable", "distance": 3.423, "atom1_id": "///A/899/NH1", "atom2_id": "///A/969/NH1", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 578, "atom1_serNum": 4079, "atom2_serNum": 4301, "donAcc_type": "questionable", "distance": 2.748, "atom1_id": "///A/899/NH2", "atom2_id": "///A/926/NE2", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 579, "atom1_serNum": 4079, "atom2_serNum": 4331, "donAcc_type": "standard", "distance": 3.405, "atom1_id": "///A/899/NH2", "atom2_id": "///A/930/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 580, "atom1_serNum": 4083, "atom2_serNum": 4111, "donAcc_type": "standard", "distance": 2.887, "atom1_id": "///A/900/O", "atom2_id": "///A/904/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 581, "atom1_serNum": 4088, "atom2_serNum": 4116, "donAcc_type": "standard", "distance": 3.215, "atom1_id": "///A/901/O", "atom2_id": "///A/905/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 582, "atom1_serNum": 4102, "atom2_serNum": 4123, "donAcc_type": "standard", "distance": 2.843, "atom1_id": "///A/902/O", "atom2_id": "///A/906/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 583, "atom1_serNum": 4109, "atom2_serNum": 4137, "donAcc_type": "standard", "distance": 3.031, "atom1_id": "///A/903/O", "atom2_id": "///A/907/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 584, "atom1_serNum": 4109, "atom2_serNum": 4143, "donAcc_type": "acceptable", "distance": 2.804, "atom1_id": "///A/903/O", "atom2_id": "///A/907/ND1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 585, "atom1_serNum": 4114, "atom2_serNum": 4147, "donAcc_type": "standard", "distance": 2.945, "atom1_id": "///A/904/O", "atom2_id": "///A/908/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 586, "atom1_serNum": 4119, "atom2_serNum": 4156, "donAcc_type": "standard", "distance": 2.617, "atom1_id": "///A/905/O", "atom2_id": "///A/909/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 587, "atom1_serNum": 4126, "atom2_serNum": 4165, "donAcc_type": "standard", "distance": 2.837, "atom1_id": "///A/906/O", "atom2_id": "///A/910/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 588, "atom1_serNum": 4131, "atom2_serNum": 4173, "donAcc_type": "standard", "distance": 2.924, "atom1_id": "///A/906/NE1", "atom2_id": "///A/910/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 589, "atom1_serNum": 4154, "atom2_serNum": 8996, "donAcc_type": "questionable", "distance": 2.764, "atom1_id": "///A/908/OE1", "atom2_id": "///B/896/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 590, "atom1_serNum": 4154, "atom2_serNum": 9003, "donAcc_type": "acceptable", "distance": 3.132, "atom1_id": "///A/908/OE1", "atom2_id": "///B/897/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 591, "atom1_serNum": 4159, "atom2_serNum": 4178, "donAcc_type": "standard", "distance": 2.945, "atom1_id": "///A/909/O", "atom2_id": "///A/912/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 592, "atom1_serNum": 4163, "atom2_serNum": 4187, "donAcc_type": "standard", "distance": 3.292, "atom1_id": "///A/909/OE1", "atom2_id": "///A/912/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 593, "atom1_serNum": 4181, "atom2_serNum": 4196, "donAcc_type": "standard", "distance": 3.293, "atom1_id": "///A/912/O", "atom2_id": "///A/914/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 594, "atom1_serNum": 4181, "atom2_serNum": 4236, "donAcc_type": "standard", "distance": 2.638, "atom1_id": "///A/912/O", "atom2_id": "///A/919/NE1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 595, "atom1_serNum": 4199, "atom2_serNum": 4215, "donAcc_type": "standard", "distance": 2.918, "atom1_id": "///A/914/O", "atom2_id": "///A/917/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 596, "atom1_serNum": 4225, "atom2_serNum": 4250, "donAcc_type": "standard", "distance": 2.993, "atom1_id": "///A/918/O", "atom2_id": "///A/921/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 597, "atom1_serNum": 4242, "atom2_serNum": 4248, "donAcc_type": "standard", "distance": 2.822, "atom1_id": "///A/920/N", "atom2_id": "///A/920/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 598, "atom1_serNum": 4253, "atom2_serNum": 4257, "donAcc_type": "standard", "distance": 3.028, "atom1_id": "///A/921/O", "atom2_id": "///A/921/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 599, "atom1_serNum": 4272, "atom2_serNum": 4309, "donAcc_type": "standard", "distance": 2.827, "atom1_id": "///A/923/N", "atom2_id": "///A/927/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 600, "atom1_serNum": 4282, "atom2_serNum": 4302, "donAcc_type": "standard", "distance": 2.966, "atom1_id": "///A/924/O", "atom2_id": "///A/927/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 601, "atom1_serNum": 4282, "atom2_serNum": 4311, "donAcc_type": "standard", "distance": 3.514, "atom1_id": "///A/924/O", "atom2_id": "///A/928/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 602, "atom1_serNum": 4288, "atom2_serNum": 4316, "donAcc_type": "standard", "distance": 3.116, "atom1_id": "///A/925/O", "atom2_id": "///A/929/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 603, "atom1_serNum": 4296, "atom2_serNum": 4301, "donAcc_type": "standard", "distance": 2.942, "atom1_id": "///A/926/O", "atom2_id": "///A/926/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 604, "atom1_serNum": 4296, "atom2_serNum": 4325, "donAcc_type": "standard", "distance": 3.037, "atom1_id": "///A/926/O", "atom2_id": "///A/930/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 605, "atom1_serNum": 4301, "atom2_serNum": 4331, "donAcc_type": "standard", "distance": 2.995, "atom1_id": "///A/926/NE2", "atom2_id": "///A/930/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 606, "atom1_serNum": 4305, "atom2_serNum": 4333, "donAcc_type": "standard", "distance": 2.987, "atom1_id": "///A/927/O", "atom2_id": "///A/931/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 607, "atom1_serNum": 4314, "atom2_serNum": 4341, "donAcc_type": "standard", "distance": 2.922, "atom1_id": "///A/928/O", "atom2_id": "///A/932/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 608, "atom1_serNum": 4319, "atom2_serNum": 4348, "donAcc_type": "standard", "distance": 2.932, "atom1_id": "///A/929/O", "atom2_id": "///A/933/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 609, "atom1_serNum": 4319, "atom2_serNum": 4353, "donAcc_type": "acceptable", "distance": 2.929, "atom1_id": "///A/929/O", "atom2_id": "///A/933/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 610, "atom1_serNum": 4328, "atom2_serNum": 4354, "donAcc_type": "standard", "distance": 3.105, "atom1_id": "///A/930/O", "atom2_id": "///A/934/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 611, "atom1_serNum": 4331, "atom2_serNum": 4623, "donAcc_type": "standard", "distance": 3.684, "atom1_id": "///A/930/OD1", "atom2_id": "///A/969/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 612, "atom1_serNum": 4336, "atom2_serNum": 4360, "donAcc_type": "standard", "distance": 2.820, "atom1_id": "///A/931/O", "atom2_id": "///A/935/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 613, "atom1_serNum": 4344, "atom2_serNum": 4368, "donAcc_type": "standard", "distance": 2.784, "atom1_id": "///A/932/O", "atom2_id": "///A/936/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 614, "atom1_serNum": 4371, "atom2_serNum": 4383, "donAcc_type": "standard", "distance": 3.056, "atom1_id": "///A/936/O", "atom2_id": "///A/939/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 615, "atom1_serNum": 4371, "atom2_serNum": 4390, "donAcc_type": "standard", "distance": 3.276, "atom1_id": "///A/936/O", "atom2_id": "///A/940/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 616, "atom1_serNum": 4375, "atom2_serNum": 4398, "donAcc_type": "standard", "distance": 2.625, "atom1_id": "///A/937/O", "atom2_id": "///A/941/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 617, "atom1_serNum": 4379, "atom2_serNum": 4404, "donAcc_type": "standard", "distance": 3.074, "atom1_id": "///A/938/O", "atom2_id": "///A/942/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 618, "atom1_serNum": 4386, "atom2_serNum": 4408, "donAcc_type": "standard", "distance": 3.134, "atom1_id": "///A/939/O", "atom2_id": "///A/943/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 619, "atom1_serNum": 4393, "atom2_serNum": 4415, "donAcc_type": "standard", "distance": 3.222, "atom1_id": "///A/940/O", "atom2_id": "///A/944/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 620, "atom1_serNum": 4401, "atom2_serNum": 4421, "donAcc_type": "standard", "distance": 2.851, "atom1_id": "///A/941/O", "atom2_id": "///A/945/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 621, "atom1_serNum": 4407, "atom2_serNum": 4432, "donAcc_type": "standard", "distance": 3.238, "atom1_id": "///A/942/O", "atom2_id": "///A/946/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 622, "atom1_serNum": 4411, "atom2_serNum": 4442, "donAcc_type": "standard", "distance": 2.930, "atom1_id": "///A/943/O", "atom2_id": "///A/947/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 623, "atom1_serNum": 4418, "atom2_serNum": 4450, "donAcc_type": "standard", "distance": 3.147, "atom1_id": "///A/944/O", "atom2_id": "///A/948/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 624, "atom1_serNum": 4424, "atom2_serNum": 4455, "donAcc_type": "standard", "distance": 2.797, "atom1_id": "///A/945/O", "atom2_id": "///A/949/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 625, "atom1_serNum": 4435, "atom2_serNum": 4460, "donAcc_type": "standard", "distance": 2.826, "atom1_id": "///A/946/O", "atom2_id": "///A/950/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 626, "atom1_serNum": 4463, "atom2_serNum": 4500, "donAcc_type": "standard", "distance": 2.871, "atom1_id": "///A/950/O", "atom2_id": "///A/954/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 627, "atom1_serNum": 4466, "atom2_serNum": 4490, "donAcc_type": "standard", "distance": 2.977, "atom1_id": "///A/950/OD1", "atom2_id": "///A/953/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 628, "atom1_serNum": 4471, "atom2_serNum": 4506, "donAcc_type": "standard", "distance": 2.799, "atom1_id": "///A/951/O", "atom2_id": "///A/955/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 629, "atom1_serNum": 4482, "atom2_serNum": 4488, "donAcc_type": "standard", "distance": 3.335, "atom1_id": "///A/952/O", "atom2_id": "///A/952/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 630, "atom1_serNum": 4488, "atom2_serNum": 9890, "donAcc_type": "standard", "distance": 3.100, "atom1_id": "///A/952/NH1", "atom2_id": "///S/0/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 631, "atom1_serNum": 4489, "atom2_serNum": 9890, "donAcc_type": "standard", "distance": 2.977, "atom1_id": "///A/952/NH2", "atom2_id": "///S/0/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 632, "atom1_serNum": 4503, "atom2_serNum": 4798, "donAcc_type": "standard", "distance": 2.850, "atom1_id": "///A/954/O", "atom2_id": "///A/990/NE1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 633, "atom1_serNum": 4547, "atom2_serNum": 4678, "donAcc_type": "standard", "distance": 2.908, "atom1_id": "///A/960/OD2", "atom2_id": "///A/976/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 634, "atom1_serNum": 4548, "atom2_serNum": 4665, "donAcc_type": "standard", "distance": 2.917, "atom1_id": "///A/961/N", "atom2_id": "///A/974/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 635, "atom1_serNum": 4551, "atom2_serNum": 4662, "donAcc_type": "standard", "distance": 2.969, "atom1_id": "///A/961/O", "atom2_id": "///A/974/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 636, "atom1_serNum": 4563, "atom2_serNum": 4648, "donAcc_type": "standard", "distance": 2.956, "atom1_id": "///A/963/N", "atom2_id": "///A/972/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 637, "atom1_serNum": 4566, "atom2_serNum": 4645, "donAcc_type": "standard", "distance": 2.609, "atom1_id": "///A/963/O", "atom2_id": "///A/972/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 638, "atom1_serNum": 4584, "atom2_serNum": 4627, "donAcc_type": "standard", "distance": 2.674, "atom1_id": "///A/965/N", "atom2_id": "///A/970/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 639, "atom1_serNum": 4587, "atom2_serNum": 4613, "donAcc_type": "standard", "distance": 2.810, "atom1_id": "///A/965/O", "atom2_id": "///A/969/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 640, "atom1_serNum": 4590, "atom2_serNum": 4592, "donAcc_type": "standard", "distance": 2.888, "atom1_id": "///A/965/OD1", "atom2_id": "///A/966/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 641, "atom1_serNum": 4653, "atom2_serNum": 4892, "donAcc_type": "standard", "distance": 3.122, "atom1_id": "///A/972/NZ", "atom2_id": "///A/1002/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 642, "atom1_serNum": 4654, "atom2_serNum": 4872, "donAcc_type": "standard", "distance": 2.817, "atom1_id": "///A/973/N", "atom2_id": "///A/1000/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 643, "atom1_serNum": 4657, "atom2_serNum": 4885, "donAcc_type": "standard", "distance": 2.976, "atom1_id": "///A/973/O", "atom2_id": "///A/1002/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 644, "atom1_serNum": 4669, "atom2_serNum": 4888, "donAcc_type": "standard", "distance": 2.898, "atom1_id": "///A/975/N", "atom2_id": "///A/1002/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 645, "atom1_serNum": 4672, "atom2_serNum": 4901, "donAcc_type": "standard", "distance": 3.030, "atom1_id": "///A/975/O", "atom2_id": "///A/1004/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 646, "atom1_serNum": 4677, "atom2_serNum": 4693, "donAcc_type": "standard", "distance": 2.274, "atom1_id": "///A/975/OE2", "atom2_id": "///A/977/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 647, "atom1_serNum": 4685, "atom2_serNum": 4904, "donAcc_type": "standard", "distance": 3.284, "atom1_id": "///A/977/N", "atom2_id": "///A/1004/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 648, "atom1_serNum": 4688, "atom2_serNum": 4917, "donAcc_type": "standard", "distance": 3.227, "atom1_id": "///A/977/O", "atom2_id": "///A/1006/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 649, "atom1_serNum": 4693, "atom2_serNum": 4720, "donAcc_type": "standard", "distance": 2.481, "atom1_id": "///A/977/NZ", "atom2_id": "///A/981/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 650, "atom1_serNum": 4693, "atom2_serNum": 4773, "donAcc_type": "questionable", "distance": 3.149, "atom1_id": "///A/977/NZ", "atom2_id": "///A/987/NE2", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 651, "atom1_serNum": 4694, "atom2_serNum": 4719, "donAcc_type": "standard", "distance": 3.422, "atom1_id": "///A/978/N", "atom2_id": "///A/981/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 652, "atom1_serNum": 4720, "atom2_serNum": 4724, "donAcc_type": "questionable", "distance": 3.147, "atom1_id": "///A/981/OD2", "atom2_id": "///A/982/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 653, "atom1_serNum": 4731, "atom2_serNum": 11362, "donAcc_type": "standard", "distance": 3.040, "atom1_id": "///A/982/NH2", "atom2_id": "///Y/10/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 654, "atom1_serNum": 4740, "atom2_serNum": 4772, "donAcc_type": "standard", "distance": 2.964, "atom1_id": "///A/984/N", "atom2_id": "///A/987/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 655, "atom1_serNum": 4743, "atom2_serNum": 4774, "donAcc_type": "standard", "distance": 3.119, "atom1_id": "///A/984/O", "atom2_id": "///A/988/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 656, "atom1_serNum": 4749, "atom2_serNum": 4782, "donAcc_type": "standard", "distance": 3.028, "atom1_id": "///A/985/O", "atom2_id": "///A/989/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 657, "atom1_serNum": 4759, "atom2_serNum": 4790, "donAcc_type": "standard", "distance": 3.132, "atom1_id": "///A/986/O", "atom2_id": "///A/990/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 658, "atom1_serNum": 4764, "atom2_serNum": 9887, "donAcc_type": "acceptable", "distance": 3.276, "atom1_id": "///A/986/NZ", "atom2_id": "///S/0/OP3", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 659, "atom1_serNum": 4768, "atom2_serNum": 4804, "donAcc_type": "standard", "distance": 3.039, "atom1_id": "///A/987/O", "atom2_id": "///A/991/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 660, "atom1_serNum": 4777, "atom2_serNum": 4812, "donAcc_type": "standard", "distance": 3.240, "atom1_id": "///A/988/O", "atom2_id": "///A/992/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 661, "atom1_serNum": 4785, "atom2_serNum": 4817, "donAcc_type": "standard", "distance": 2.824, "atom1_id": "///A/989/O", "atom2_id": "///A/993/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 662, "atom1_serNum": 4793, "atom2_serNum": 4826, "donAcc_type": "standard", "distance": 2.761, "atom1_id": "///A/990/O", "atom2_id": "///A/994/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 663, "atom1_serNum": 4807, "atom2_serNum": 4834, "donAcc_type": "standard", "distance": 2.964, "atom1_id": "///A/991/O", "atom2_id": "///A/995/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 664, "atom1_serNum": 4815, "atom2_serNum": 4834, "donAcc_type": "standard", "distance": 3.010, "atom1_id": "///A/992/O", "atom2_id": "///A/995/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 665, "atom1_serNum": 4815, "atom2_serNum": 4843, "donAcc_type": "standard", "distance": 2.963, "atom1_id": "///A/992/O", "atom2_id": "///A/996/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 666, "atom1_serNum": 4820, "atom2_serNum": 4852, "donAcc_type": "standard", "distance": 3.237, "atom1_id": "///A/993/O", "atom2_id": "///A/997/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 667, "atom1_serNum": 4829, "atom2_serNum": 4864, "donAcc_type": "standard", "distance": 3.052, "atom1_id": "///A/994/O", "atom2_id": "///A/999/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 668, "atom1_serNum": 4837, "atom2_serNum": 4860, "donAcc_type": "standard", "distance": 2.259, "atom1_id": "///A/995/O", "atom2_id": "///A/998/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 669, "atom1_serNum": 4837, "atom2_serNum": 4864, "donAcc_type": "standard", "distance": 3.503, "atom1_id": "///A/995/O", "atom2_id": "///A/999/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 670, "atom1_serNum": 4867, "atom2_serNum": 4878, "donAcc_type": "standard", "distance": 3.079, "atom1_id": "///A/999/O", "atom2_id": "///A/1001/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 671, "atom1_serNum": 4968, "atom2_serNum": 4996, "donAcc_type": "standard", "distance": 2.975, "atom1_id": "///B/373/O", "atom2_id": "///B/376/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 672, "atom1_serNum": 4968, "atom2_serNum": 5004, "donAcc_type": "standard", "distance": 3.133, "atom1_id": "///B/373/O", "atom2_id": "///B/377/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 673, "atom1_serNum": 4975, "atom2_serNum": 5015, "donAcc_type": "standard", "distance": 2.980, "atom1_id": "///B/374/O", "atom2_id": "///B/378/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 674, "atom1_serNum": 4983, "atom2_serNum": 10292, "donAcc_type": "acceptable", "distance": 2.528, "atom1_id": "///B/374/OH", "atom2_id": "///U/20/OP2", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 675, "atom1_serNum": 4983, "atom2_serNum": 10293, "donAcc_type": "acceptable", "distance": 3.192, "atom1_id": "///B/374/OH", "atom2_id": "///U/20/O5'", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 676, "atom1_serNum": 4995, "atom2_serNum": 5530, "donAcc_type": "acceptable", "distance": 2.978, "atom1_id": "///B/375/OH", "atom2_id": "///B/438/OE2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 677, "atom1_serNum": 4999, "atom2_serNum": 5032, "donAcc_type": "standard", "distance": 2.872, "atom1_id": "///B/376/O", "atom2_id": "///B/380/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 678, "atom1_serNum": 5007, "atom2_serNum": 5040, "donAcc_type": "standard", "distance": 3.135, "atom1_id": "///B/377/O", "atom2_id": "///B/381/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 679, "atom1_serNum": 5014, "atom2_serNum": 6542, "donAcc_type": "questionable", "distance": 2.882, "atom1_id": "///B/377/NH2", "atom2_id": "///B/581/NH1", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 680, "atom1_serNum": 5018, "atom2_serNum": 5047, "donAcc_type": "standard", "distance": 3.263, "atom1_id": "///B/378/O", "atom2_id": "///B/382/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 681, "atom1_serNum": 5020, "atom2_serNum": 6493, "donAcc_type": "acceptable", "distance": 3.445, "atom1_id": "///B/378/OG", "atom2_id": "///B/575/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 682, "atom1_serNum": 5020, "atom2_serNum": 6501, "donAcc_type": "acceptable", "distance": 2.495, "atom1_id": "///B/378/OG", "atom2_id": "///B/576/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 683, "atom1_serNum": 5020, "atom2_serNum": 6529, "donAcc_type": "acceptable", "distance": 3.315, "atom1_id": "///B/378/OG", "atom2_id": "///B/580/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 684, "atom1_serNum": 5024, "atom2_serNum": 5054, "donAcc_type": "standard", "distance": 3.150, "atom1_id": "///B/379/O", "atom2_id": "///B/383/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 685, "atom1_serNum": 5035, "atom2_serNum": 5062, "donAcc_type": "standard", "distance": 2.882, "atom1_id": "///B/380/O", "atom2_id": "///B/384/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 686, "atom1_serNum": 5043, "atom2_serNum": 5071, "donAcc_type": "standard", "distance": 2.858, "atom1_id": "///B/381/O", "atom2_id": "///B/385/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 687, "atom1_serNum": 5043, "atom2_serNum": 5076, "donAcc_type": "acceptable", "distance": 2.683, "atom1_id": "///B/381/O", "atom2_id": "///B/385/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 688, "atom1_serNum": 5050, "atom2_serNum": 5078, "donAcc_type": "standard", "distance": 3.170, "atom1_id": "///B/382/O", "atom2_id": "///B/386/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 689, "atom1_serNum": 5057, "atom2_serNum": 5085, "donAcc_type": "standard", "distance": 2.836, "atom1_id": "///B/383/O", "atom2_id": "///B/387/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 690, "atom1_serNum": 5065, "atom2_serNum": 5085, "donAcc_type": "standard", "distance": 2.841, "atom1_id": "///B/384/O", "atom2_id": "///B/387/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 691, "atom1_serNum": 5065, "atom2_serNum": 5093, "donAcc_type": "standard", "distance": 2.950, "atom1_id": "///B/384/O", "atom2_id": "///B/388/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 692, "atom1_serNum": 5081, "atom2_serNum": 5102, "donAcc_type": "standard", "distance": 3.160, "atom1_id": "///B/386/O", "atom2_id": "///B/389/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 693, "atom1_serNum": 5096, "atom2_serNum": 5110, "donAcc_type": "standard", "distance": 3.257, "atom1_id": "///B/388/O", "atom2_id": "///B/390/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 694, "atom1_serNum": 5105, "atom2_serNum": 5135, "donAcc_type": "standard", "distance": 3.027, "atom1_id": "///B/389/O", "atom2_id": "///B/393/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 695, "atom1_serNum": 5108, "atom2_serNum": 8720, "donAcc_type": "standard", "distance": 2.845, "atom1_id": "///B/389/OD1", "atom2_id": "///B/861/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 696, "atom1_serNum": 5126, "atom2_serNum": 6629, "donAcc_type": "standard", "distance": 2.962, "atom1_id": "///B/391/OD2", "atom2_id": "///B/591/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 697, "atom1_serNum": 5126, "atom2_serNum": 8712, "donAcc_type": "standard", "distance": 3.955, "atom1_id": "///B/391/OD2", "atom2_id": "///B/860/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 698, "atom1_serNum": 5130, "atom2_serNum": 5151, "donAcc_type": "standard", "distance": 2.984, "atom1_id": "///B/392/O", "atom2_id": "///B/395/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 699, "atom1_serNum": 5138, "atom2_serNum": 5213, "donAcc_type": "standard", "distance": 3.235, "atom1_id": "///B/393/O", "atom2_id": "///B/401/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 700, "atom1_serNum": 5154, "atom2_serNum": 6294, "donAcc_type": "standard", "distance": 3.962, "atom1_id": "///B/395/O", "atom2_id": "///B/547/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 701, "atom1_serNum": 5170, "atom2_serNum": 5203, "donAcc_type": "standard", "distance": 2.751, "atom1_id": "///B/397/N", "atom2_id": "///B/400/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 702, "atom1_serNum": 5173, "atom2_serNum": 5205, "donAcc_type": "standard", "distance": 2.766, "atom1_id": "///B/397/O", "atom2_id": "///B/401/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 703, "atom1_serNum": 5176, "atom2_serNum": 5187, "donAcc_type": "standard", "distance": 3.037, "atom1_id": "///B/397/OD1", "atom2_id": "///B/399/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 704, "atom1_serNum": 5176, "atom2_serNum": 5196, "donAcc_type": "standard", "distance": 2.637, "atom1_id": "///B/397/OD1", "atom2_id": "///B/400/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 705, "atom1_serNum": 5181, "atom2_serNum": 5214, "donAcc_type": "standard", "distance": 2.728, "atom1_id": "///B/398/O", "atom2_id": "///B/402/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 706, "atom1_serNum": 5190, "atom2_serNum": 5214, "donAcc_type": "standard", "distance": 3.060, "atom1_id": "///B/399/O", "atom2_id": "///B/402/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 707, "atom1_serNum": 5190, "atom2_serNum": 5218, "donAcc_type": "standard", "distance": 3.376, "atom1_id": "///B/399/O", "atom2_id": "///B/403/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 708, "atom1_serNum": 5199, "atom2_serNum": 5226, "donAcc_type": "standard", "distance": 3.626, "atom1_id": "///B/400/O", "atom2_id": "///B/404/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 709, "atom1_serNum": 5204, "atom2_serNum": 6294, "donAcc_type": "standard", "distance": 3.383, "atom1_id": "///B/400/OE2", "atom2_id": "///B/547/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 710, "atom1_serNum": 5204, "atom2_serNum": 6700, "donAcc_type": "standard", "distance": 2.762, "atom1_id": "///B/400/OE2", "atom2_id": "///B/599/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 711, "atom1_serNum": 5204, "atom2_serNum": 6703, "donAcc_type": "standard", "distance": 2.768, "atom1_id": "///B/400/OE2", "atom2_id": "///B/599/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 712, "atom1_serNum": 5208, "atom2_serNum": 5238, "donAcc_type": "acceptable", "distance": 3.163, "atom1_id": "///B/401/O", "atom2_id": "///B/405/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 713, "atom1_serNum": 5217, "atom2_serNum": 5238, "donAcc_type": "acceptable", "distance": 3.141, "atom1_id": "///B/402/O", "atom2_id": "///B/405/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 714, "atom1_serNum": 5217, "atom2_serNum": 5240, "donAcc_type": "standard", "distance": 2.729, "atom1_id": "///B/402/O", "atom2_id": "///B/406/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 715, "atom1_serNum": 5221, "atom2_serNum": 5249, "donAcc_type": "standard", "distance": 2.831, "atom1_id": "///B/403/O", "atom2_id": "///B/407/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 716, "atom1_serNum": 5229, "atom2_serNum": 5260, "donAcc_type": "standard", "distance": 2.992, "atom1_id": "///B/404/O", "atom2_id": "///B/408/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 717, "atom1_serNum": 5236, "atom2_serNum": 5260, "donAcc_type": "standard", "distance": 2.695, "atom1_id": "///B/405/O", "atom2_id": "///B/408/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 718, "atom1_serNum": 5236, "atom2_serNum": 5272, "donAcc_type": "standard", "distance": 2.769, "atom1_id": "///B/405/O", "atom2_id": "///B/409/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 719, "atom1_serNum": 5243, "atom2_serNum": 5281, "donAcc_type": "standard", "distance": 3.305, "atom1_id": "///B/406/O", "atom2_id": "///B/410/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 720, "atom1_serNum": 5252, "atom2_serNum": 5281, "donAcc_type": "standard", "distance": 2.951, "atom1_id": "///B/407/O", "atom2_id": "///B/410/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 721, "atom1_serNum": 5252, "atom2_serNum": 5319, "donAcc_type": "standard", "distance": 2.814, "atom1_id": "///B/407/O", "atom2_id": "///B/415/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 722, "atom1_serNum": 5289, "atom2_serNum": 5614, "donAcc_type": "standard", "distance": 3.033, "atom1_id": "///B/411/N", "atom2_id": "///B/449/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 723, "atom1_serNum": 5292, "atom2_serNum": 5311, "donAcc_type": "standard", "distance": 2.917, "atom1_id": "///B/411/O", "atom2_id": "///B/415/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 724, "atom1_serNum": 5294, "atom2_serNum": 5307, "donAcc_type": "acceptable", "distance": 3.128, "atom1_id": "///B/411/OG", "atom2_id": "///B/414/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 725, "atom1_serNum": 5294, "atom2_serNum": 5613, "donAcc_type": "acceptable", "distance": 3.074, "atom1_id": "///B/411/OG", "atom2_id": "///B/449/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 726, "atom1_serNum": 5298, "atom2_serNum": 5320, "donAcc_type": "standard", "distance": 2.788, "atom1_id": "///B/412/O", "atom2_id": "///B/416/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 727, "atom1_serNum": 5303, "atom2_serNum": 5320, "donAcc_type": "standard", "distance": 2.738, "atom1_id": "///B/413/O", "atom2_id": "///B/416/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 728, "atom1_serNum": 5303, "atom2_serNum": 5329, "donAcc_type": "standard", "distance": 2.952, "atom1_id": "///B/413/O", "atom2_id": "///B/417/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 729, "atom1_serNum": 5310, "atom2_serNum": 5337, "donAcc_type": "standard", "distance": 3.228, "atom1_id": "///B/414/O", "atom2_id": "///B/418/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 730, "atom1_serNum": 5314, "atom2_serNum": 5337, "donAcc_type": "standard", "distance": 2.830, "atom1_id": "///B/415/O", "atom2_id": "///B/418/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 731, "atom1_serNum": 5314, "atom2_serNum": 5349, "donAcc_type": "standard", "distance": 3.010, "atom1_id": "///B/415/O", "atom2_id": "///B/419/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 732, "atom1_serNum": 5323, "atom2_serNum": 5356, "donAcc_type": "standard", "distance": 3.042, "atom1_id": "///B/416/O", "atom2_id": "///B/420/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 733, "atom1_serNum": 5328, "atom2_serNum": 5525, "donAcc_type": "standard", "distance": 3.576, "atom1_id": "///B/416/NZ", "atom2_id": "///B/438/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 734, "atom1_serNum": 5332, "atom2_serNum": 5367, "donAcc_type": "standard", "distance": 3.140, "atom1_id": "///B/417/O", "atom2_id": "///B/421/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 735, "atom1_serNum": 5340, "atom2_serNum": 5375, "donAcc_type": "standard", "distance": 2.687, "atom1_id": "///B/418/O", "atom2_id": "///B/422/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 736, "atom1_serNum": 5352, "atom2_serNum": 5375, "donAcc_type": "standard", "distance": 2.997, "atom1_id": "///B/419/O", "atom2_id": "///B/422/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 737, "atom1_serNum": 5352, "atom2_serNum": 5386, "donAcc_type": "standard", "distance": 2.797, "atom1_id": "///B/419/O", "atom2_id": "///B/423/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 738, "atom1_serNum": 5359, "atom2_serNum": 5395, "donAcc_type": "standard", "distance": 3.002, "atom1_id": "///B/420/O", "atom2_id": "///B/424/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 739, "atom1_serNum": 5365, "atom2_serNum": 10292, "donAcc_type": "standard", "distance": 2.636, "atom1_id": "///B/420/NH1", "atom2_id": "///U/20/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 740, "atom1_serNum": 5366, "atom2_serNum": 5530, "donAcc_type": "standard", "distance": 2.683, "atom1_id": "///B/420/NH2", "atom2_id": "///B/438/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 741, "atom1_serNum": 5378, "atom2_serNum": 6254, "donAcc_type": "standard", "distance": 3.062, "atom1_id": "///B/422/O", "atom2_id": "///B/542/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 742, "atom1_serNum": 5378, "atom2_serNum": 6255, "donAcc_type": "standard", "distance": 2.960, "atom1_id": "///B/422/O", "atom2_id": "///B/542/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 743, "atom1_serNum": 5378, "atom2_serNum": 6461, "donAcc_type": "standard", "distance": 3.715, "atom1_id": "///B/422/O", "atom2_id": "///B/570/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 744, "atom1_serNum": 5393, "atom2_serNum": 6462, "donAcc_type": "standard", "distance": 3.143, "atom1_id": "///B/423/OE1", "atom2_id": "///B/571/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 745, "atom1_serNum": 5394, "atom2_serNum": 6465, "donAcc_type": "standard", "distance": 3.403, "atom1_id": "///B/423/NE2", "atom2_id": "///B/571/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 746, "atom1_serNum": 5398, "atom2_serNum": 6461, "donAcc_type": "standard", "distance": 3.032, "atom1_id": "///B/424/O", "atom2_id": "///B/570/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 747, "atom1_serNum": 5402, "atom2_serNum": 5512, "donAcc_type": "acceptable", "distance": 2.771, "atom1_id": "///B/424/NE", "atom2_id": "///B/436/OH", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 748, "atom1_serNum": 5402, "atom2_serNum": 10273, "donAcc_type": "standard", "distance": 3.123, "atom1_id": "///B/424/NE", "atom2_id": "///U/19/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 749, "atom1_serNum": 5404, "atom2_serNum": 10252, "donAcc_type": "standard", "distance": 2.802, "atom1_id": "///B/424/NH1", "atom2_id": "///U/18/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 750, "atom1_serNum": 5405, "atom2_serNum": 5478, "donAcc_type": "standard", "distance": 3.295, "atom1_id": "///B/424/NH2", "atom2_id": "///B/433/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 751, "atom1_serNum": 5406, "atom2_serNum": 10253, "donAcc_type": "standard", "distance": 2.788, "atom1_id": "///B/425/N", "atom2_id": "///U/18/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 752, "atom1_serNum": 5414, "atom2_serNum": 10233, "donAcc_type": "standard", "distance": 2.975, "atom1_id": "///B/425/NZ", "atom2_id": "///U/17/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 753, "atom1_serNum": 5437, "atom2_serNum": 5753, "donAcc_type": "standard", "distance": 2.852, "atom1_id": "///B/428/NE1", "atom2_id": "///B/467/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 754, "atom1_serNum": 5443, "atom2_serNum": 6196, "donAcc_type": "standard", "distance": 2.882, "atom1_id": "///B/429/N", "atom2_id": "///B/535/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 755, "atom1_serNum": 5446, "atom2_serNum": 6193, "donAcc_type": "standard", "distance": 3.231, "atom1_id": "///B/429/O", "atom2_id": "///B/535/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 756, "atom1_serNum": 5454, "atom2_serNum": 5475, "donAcc_type": "standard", "distance": 2.846, "atom1_id": "///B/430/O", "atom2_id": "///B/433/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 757, "atom1_serNum": 5459, "atom2_serNum": 5820, "donAcc_type": "standard", "distance": 2.713, "atom1_id": "///B/430/NZ", "atom2_id": "///B/476/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 758, "atom1_serNum": 5460, "atom2_serNum": 6181, "donAcc_type": "standard", "distance": 2.718, "atom1_id": "///B/431/N", "atom2_id": "///B/533/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 759, "atom1_serNum": 5463, "atom2_serNum": 5484, "donAcc_type": "standard", "distance": 3.671, "atom1_id": "///B/431/O", "atom2_id": "///B/434/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 760, "atom1_serNum": 5483, "atom2_serNum": 10507, "donAcc_type": "standard", "distance": 3.248, "atom1_id": "///B/433/NZ", "atom2_id": "///V/8/O3'", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 761, "atom1_serNum": 5483, "atom2_serNum": 10521, "donAcc_type": "standard", "distance": 2.513, "atom1_id": "///B/433/NZ", "atom2_id": "///V/9/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 762, "atom1_serNum": 5504, "atom2_serNum": 5531, "donAcc_type": "standard", "distance": 3.044, "atom1_id": "///B/436/O", "atom2_id": "///B/439/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 763, "atom1_serNum": 5504, "atom2_serNum": 5539, "donAcc_type": "standard", "distance": 3.182, "atom1_id": "///B/436/O", "atom2_id": "///B/440/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 764, "atom1_serNum": 5512, "atom2_serNum": 10273, "donAcc_type": "acceptable", "distance": 2.898, "atom1_id": "///B/436/OH", "atom2_id": "///U/19/OP2", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 765, "atom1_serNum": 5522, "atom2_serNum": 5529, "donAcc_type": "standard", "distance": 2.969, "atom1_id": "///B/438/N", "atom2_id": "///B/438/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 766, "atom1_serNum": 5559, "atom2_serNum": 5573, "donAcc_type": "acceptable", "distance": 2.909, "atom1_id": "///B/442/OD2", "atom2_id": "///B/444/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 767, "atom1_serNum": 5563, "atom2_serNum": 5589, "donAcc_type": "standard", "distance": 2.775, "atom1_id": "///B/443/O", "atom2_id": "///B/447/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 768, "atom1_serNum": 5571, "atom2_serNum": 5597, "donAcc_type": "standard", "distance": 2.875, "atom1_id": "///B/444/O", "atom2_id": "///B/448/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 769, "atom1_serNum": 5578, "atom2_serNum": 5606, "donAcc_type": "standard", "distance": 2.910, "atom1_id": "///B/445/O", "atom2_id": "///B/449/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 770, "atom1_serNum": 5585, "atom2_serNum": 5615, "donAcc_type": "standard", "distance": 3.063, "atom1_id": "///B/446/O", "atom2_id": "///B/450/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 771, "atom1_serNum": 5592, "atom2_serNum": 5623, "donAcc_type": "standard", "distance": 2.807, "atom1_id": "///B/447/O", "atom2_id": "///B/451/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 772, "atom1_serNum": 5592, "atom2_serNum": 5628, "donAcc_type": "acceptable", "distance": 2.448, "atom1_id": "///B/447/O", "atom2_id": "///B/451/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 773, "atom1_serNum": 5600, "atom2_serNum": 5623, "donAcc_type": "standard", "distance": 2.959, "atom1_id": "///B/448/O", "atom2_id": "///B/451/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 774, "atom1_serNum": 5600, "atom2_serNum": 5630, "donAcc_type": "standard", "distance": 2.803, "atom1_id": "///B/448/O", "atom2_id": "///B/452/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 775, "atom1_serNum": 5609, "atom2_serNum": 5638, "donAcc_type": "standard", "distance": 2.764, "atom1_id": "///B/449/O", "atom2_id": "///B/453/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 776, "atom1_serNum": 5618, "atom2_serNum": 5643, "donAcc_type": "standard", "distance": 3.128, "atom1_id": "///B/450/O", "atom2_id": "///B/454/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 777, "atom1_serNum": 5618, "atom2_serNum": 5647, "donAcc_type": "standard", "distance": 2.742, "atom1_id": "///B/450/O", "atom2_id": "///B/455/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 778, "atom1_serNum": 5618, "atom2_serNum": 5658, "donAcc_type": "standard", "distance": 3.138, "atom1_id": "///B/450/O", "atom2_id": "///B/456/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 779, "atom1_serNum": 5626, "atom2_serNum": 5643, "donAcc_type": "standard", "distance": 3.096, "atom1_id": "///B/451/O", "atom2_id": "///B/454/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 780, "atom1_serNum": 5650, "atom2_serNum": 6219, "donAcc_type": "standard", "distance": 2.984, "atom1_id": "///B/455/O", "atom2_id": "///B/538/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 781, "atom1_serNum": 5666, "atom2_serNum": 6203, "donAcc_type": "standard", "distance": 2.840, "atom1_id": "///B/457/N", "atom2_id": "///B/536/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 782, "atom1_serNum": 5669, "atom2_serNum": 6200, "donAcc_type": "standard", "distance": 2.936, "atom1_id": "///B/457/O", "atom2_id": "///B/536/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 783, "atom1_serNum": 5673, "atom2_serNum": 6207, "donAcc_type": "standard", "distance": 2.739, "atom1_id": "///B/457/OE1", "atom2_id": "///B/536/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 784, "atom1_serNum": 5673, "atom2_serNum": 6210, "donAcc_type": "standard", "distance": 2.990, "atom1_id": "///B/457/OE1", "atom2_id": "///B/536/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 785, "atom1_serNum": 5675, "atom2_serNum": 5705, "donAcc_type": "standard", "distance": 3.624, "atom1_id": "///B/458/N", "atom2_id": "///B/461/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 786, "atom1_serNum": 5678, "atom2_serNum": 5697, "donAcc_type": "standard", "distance": 2.718, "atom1_id": "///B/458/O", "atom2_id": "///B/461/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 787, "atom1_serNum": 5682, "atom2_serNum": 6190, "donAcc_type": "standard", "distance": 2.653, "atom1_id": "///B/459/N", "atom2_id": "///B/534/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 788, "atom1_serNum": 5685, "atom2_serNum": 5706, "donAcc_type": "standard", "distance": 2.736, "atom1_id": "///B/459/O", "atom2_id": "///B/462/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 789, "atom1_serNum": 5689, "atom2_serNum": 6187, "donAcc_type": "standard", "distance": 2.648, "atom1_id": "///B/459/OE1", "atom2_id": "///B/534/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 790, "atom1_serNum": 5694, "atom2_serNum": 5722, "donAcc_type": "standard", "distance": 2.981, "atom1_id": "///B/460/O", "atom2_id": "///B/463/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 791, "atom1_serNum": 5700, "atom2_serNum": 5714, "donAcc_type": "standard", "distance": 3.160, "atom1_id": "///B/461/O", "atom2_id": "///B/463/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 792, "atom1_serNum": 5709, "atom2_serNum": 6155, "donAcc_type": "standard", "distance": 3.250, "atom1_id": "///B/462/O", "atom2_id": "///B/528/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 793, "atom1_serNum": 5726, "atom2_serNum": 5746, "donAcc_type": "standard", "distance": 3.159, "atom1_id": "///B/464/O", "atom2_id": "///B/467/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 794, "atom1_serNum": 5726, "atom2_serNum": 5755, "donAcc_type": "standard", "distance": 3.086, "atom1_id": "///B/464/O", "atom2_id": "///B/468/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 795, "atom1_serNum": 5735, "atom2_serNum": 5755, "donAcc_type": "standard", "distance": 2.548, "atom1_id": "///B/465/O", "atom2_id": "///B/468/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 796, "atom1_serNum": 5735, "atom2_serNum": 5762, "donAcc_type": "standard", "distance": 2.894, "atom1_id": "///B/465/O", "atom2_id": "///B/469/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 797, "atom1_serNum": 5743, "atom2_serNum": 5770, "donAcc_type": "standard", "distance": 3.176, "atom1_id": "///B/466/O", "atom2_id": "///B/470/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 798, "atom1_serNum": 5749, "atom2_serNum": 5779, "donAcc_type": "standard", "distance": 3.301, "atom1_id": "///B/467/O", "atom2_id": "///B/471/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 799, "atom1_serNum": 5758, "atom2_serNum": 5787, "donAcc_type": "standard", "distance": 3.529, "atom1_id": "///B/468/O", "atom2_id": "///B/472/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 800, "atom1_serNum": 5765, "atom2_serNum": 5787, "donAcc_type": "standard", "distance": 2.756, "atom1_id": "///B/469/O", "atom2_id": "///B/472/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 801, "atom1_serNum": 5795, "atom2_serNum": 5820, "donAcc_type": "standard", "distance": 2.999, "atom1_id": "///B/473/N", "atom2_id": "///B/476/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 802, "atom1_serNum": 5798, "atom2_serNum": 5822, "donAcc_type": "standard", "distance": 2.600, "atom1_id": "///B/473/O", "atom2_id": "///B/477/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 803, "atom1_serNum": 5801, "atom2_serNum": 10543, "donAcc_type": "standard", "distance": 2.595, "atom1_id": "///B/474/N", "atom2_id": "///V/10/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 804, "atom1_serNum": 5804, "atom2_serNum": 5830, "donAcc_type": "standard", "distance": 2.909, "atom1_id": "///B/474/O", "atom2_id": "///B/478/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 805, "atom1_serNum": 5809, "atom2_serNum": 5839, "donAcc_type": "standard", "distance": 3.271, "atom1_id": "///B/475/O", "atom2_id": "///B/479/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 806, "atom1_serNum": 5816, "atom2_serNum": 5845, "donAcc_type": "standard", "distance": 3.138, "atom1_id": "///B/476/O", "atom2_id": "///B/480/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 807, "atom1_serNum": 5825, "atom2_serNum": 5853, "donAcc_type": "standard", "distance": 2.960, "atom1_id": "///B/477/O", "atom2_id": "///B/481/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 808, "atom1_serNum": 5833, "atom2_serNum": 5858, "donAcc_type": "standard", "distance": 2.967, "atom1_id": "///B/478/O", "atom2_id": "///B/482/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 809, "atom1_serNum": 5838, "atom2_serNum": 5929, "donAcc_type": "standard", "distance": 3.021, "atom1_id": "///B/478/NZ", "atom2_id": "///B/490/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 810, "atom1_serNum": 5842, "atom2_serNum": 5872, "donAcc_type": "acceptable", "distance": 2.861, "atom1_id": "///B/479/O", "atom2_id": "///B/483/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 811, "atom1_serNum": 5856, "atom2_serNum": 5906, "donAcc_type": "questionable", "distance": 3.053, "atom1_id": "///B/481/O", "atom2_id": "///B/487/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 812, "atom1_serNum": 5861, "atom2_serNum": 5874, "donAcc_type": "standard", "distance": 2.521, "atom1_id": "///B/482/O", "atom2_id": "///B/484/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 813, "atom1_serNum": 5877, "atom2_serNum": 5903, "donAcc_type": "standard", "distance": 3.031, "atom1_id": "///B/484/O", "atom2_id": "///B/487/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 814, "atom1_serNum": 5911, "atom2_serNum": 5923, "donAcc_type": "standard", "distance": 2.748, "atom1_id": "///B/488/O", "atom2_id": "///B/490/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 815, "atom1_serNum": 5915, "atom2_serNum": 5926, "donAcc_type": "standard", "distance": 3.111, "atom1_id": "///B/488/ND2", "atom2_id": "///B/490/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 816, "atom1_serNum": 5938, "atom2_serNum": 5971, "donAcc_type": "standard", "distance": 3.380, "atom1_id": "///B/492/O", "atom2_id": "///B/496/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 817, "atom1_serNum": 5943, "atom2_serNum": 10582, "donAcc_type": "standard", "distance": 2.701, "atom1_id": "///B/492/NE2", "atom2_id": "///V/12/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 818, "atom1_serNum": 5944, "atom2_serNum": 10564, "donAcc_type": "standard", "distance": 2.867, "atom1_id": "///B/493/N", "atom2_id": "///V/11/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 819, "atom1_serNum": 5947, "atom2_serNum": 5979, "donAcc_type": "standard", "distance": 3.355, "atom1_id": "///B/493/O", "atom2_id": "///B/497/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 820, "atom1_serNum": 5952, "atom2_serNum": 10543, "donAcc_type": "standard", "distance": 3.183, "atom1_id": "///B/493/NZ", "atom2_id": "///V/10/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 821, "atom1_serNum": 5953, "atom2_serNum": 10563, "donAcc_type": "standard", "distance": 3.657, "atom1_id": "///B/494/N", "atom2_id": "///V/11/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 822, "atom1_serNum": 5956, "atom2_serNum": 5986, "donAcc_type": "standard", "distance": 3.237, "atom1_id": "///B/494/O", "atom2_id": "///B/498/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 823, "atom1_serNum": 5965, "atom2_serNum": 5986, "donAcc_type": "standard", "distance": 2.838, "atom1_id": "///B/495/O", "atom2_id": "///B/498/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 824, "atom1_serNum": 5965, "atom2_serNum": 5994, "donAcc_type": "standard", "distance": 2.786, "atom1_id": "///B/495/O", "atom2_id": "///B/499/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 825, "atom1_serNum": 5974, "atom2_serNum": 5999, "donAcc_type": "standard", "distance": 2.932, "atom1_id": "///B/496/O", "atom2_id": "///B/500/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 826, "atom1_serNum": 5982, "atom2_serNum": 6010, "donAcc_type": "standard", "distance": 3.023, "atom1_id": "///B/497/O", "atom2_id": "///B/501/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 827, "atom1_serNum": 5989, "atom2_serNum": 6018, "donAcc_type": "standard", "distance": 3.241, "atom1_id": "///B/498/O", "atom2_id": "///B/502/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 828, "atom1_serNum": 5997, "atom2_serNum": 6018, "donAcc_type": "standard", "distance": 2.941, "atom1_id": "///B/499/O", "atom2_id": "///B/502/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 829, "atom1_serNum": 5997, "atom2_serNum": 6027, "donAcc_type": "standard", "distance": 3.112, "atom1_id": "///B/499/O", "atom2_id": "///B/503/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 830, "atom1_serNum": 6030, "atom2_serNum": 6058, "donAcc_type": "standard", "distance": 3.334, "atom1_id": "///B/503/O", "atom2_id": "///B/507/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 831, "atom1_serNum": 6052, "atom2_serNum": 6069, "donAcc_type": "standard", "distance": 3.220, "atom1_id": "///B/506/O", "atom2_id": "///B/508/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 832, "atom1_serNum": 6061, "atom2_serNum": 6082, "donAcc_type": "standard", "distance": 3.284, "atom1_id": "///B/507/O", "atom2_id": "///B/519/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 833, "atom1_serNum": 6061, "atom2_serNum": 6090, "donAcc_type": "standard", "distance": 3.469, "atom1_id": "///B/507/O", "atom2_id": "///B/520/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 834, "atom1_serNum": 6072, "atom2_serNum": 6090, "donAcc_type": "standard", "distance": 2.893, "atom1_id": "///B/508/O", "atom2_id": "///B/520/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 835, "atom1_serNum": 6072, "atom2_serNum": 6094, "donAcc_type": "standard", "distance": 3.310, "atom1_id": "///B/508/O", "atom2_id": "///B/521/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 836, "atom1_serNum": 6085, "atom2_serNum": 6099, "donAcc_type": "standard", "distance": 3.040, "atom1_id": "///B/519/O", "atom2_id": "///B/522/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 837, "atom1_serNum": 6085, "atom2_serNum": 6106, "donAcc_type": "standard", "distance": 3.099, "atom1_id": "///B/519/O", "atom2_id": "///B/523/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 838, "atom1_serNum": 6093, "atom2_serNum": 6114, "donAcc_type": "standard", "distance": 3.190, "atom1_id": "///B/520/O", "atom2_id": "///B/524/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 839, "atom1_serNum": 6097, "atom2_serNum": 6122, "donAcc_type": "standard", "distance": 3.194, "atom1_id": "///B/521/O", "atom2_id": "///B/525/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 840, "atom1_serNum": 6102, "atom2_serNum": 6131, "donAcc_type": "standard", "distance": 3.174, "atom1_id": "///B/522/O", "atom2_id": "///B/526/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 841, "atom1_serNum": 6109, "atom2_serNum": 6131, "donAcc_type": "standard", "distance": 2.917, "atom1_id": "///B/523/O", "atom2_id": "///B/526/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 842, "atom1_serNum": 6109, "atom2_serNum": 6142, "donAcc_type": "standard", "distance": 2.631, "atom1_id": "///B/523/O", "atom2_id": "///B/527/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 843, "atom1_serNum": 6117, "atom2_serNum": 6147, "donAcc_type": "standard", "distance": 2.854, "atom1_id": "///B/524/O", "atom2_id": "///B/528/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 844, "atom1_serNum": 6125, "atom2_serNum": 6156, "donAcc_type": "standard", "distance": 3.231, "atom1_id": "///B/525/O", "atom2_id": "///B/529/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 845, "atom1_serNum": 6134, "atom2_serNum": 6161, "donAcc_type": "standard", "distance": 2.499, "atom1_id": "///B/526/O", "atom2_id": "///B/530/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 846, "atom1_serNum": 6145, "atom2_serNum": 6169, "donAcc_type": "standard", "distance": 2.873, "atom1_id": "///B/527/O", "atom2_id": "///B/531/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 847, "atom1_serNum": 6150, "atom2_serNum": 6174, "donAcc_type": "standard", "distance": 3.096, "atom1_id": "///B/528/O", "atom2_id": "///B/532/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 848, "atom1_serNum": 6181, "atom2_serNum": 6192, "donAcc_type": "acceptable", "distance": 2.927, "atom1_id": "///B/533/O", "atom2_id": "///B/534/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 849, "atom1_serNum": 6214, "atom2_serNum": 6225, "donAcc_type": "standard", "distance": 3.172, "atom1_id": "///B/537/O", "atom2_id": "///B/539/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 850, "atom1_serNum": 6222, "atom2_serNum": 6245, "donAcc_type": "standard", "distance": 3.174, "atom1_id": "///B/538/O", "atom2_id": "///B/542/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 851, "atom1_serNum": 6228, "atom2_serNum": 6256, "donAcc_type": "standard", "distance": 3.085, "atom1_id": "///B/539/O", "atom2_id": "///B/543/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 852, "atom1_serNum": 6237, "atom2_serNum": 6261, "donAcc_type": "standard", "distance": 3.511, "atom1_id": "///B/540/O", "atom2_id": "///B/544/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 853, "atom1_serNum": 6241, "atom2_serNum": 6268, "donAcc_type": "standard", "distance": 3.419, "atom1_id": "///B/541/O", "atom2_id": "///B/545/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 854, "atom1_serNum": 6248, "atom2_serNum": 6268, "donAcc_type": "standard", "distance": 2.977, "atom1_id": "///B/542/O", "atom2_id": "///B/545/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 855, "atom1_serNum": 6248, "atom2_serNum": 6279, "donAcc_type": "standard", "distance": 3.096, "atom1_id": "///B/542/O", "atom2_id": "///B/546/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 856, "atom1_serNum": 6255, "atom2_serNum": 6452, "donAcc_type": "standard", "distance": 2.683, "atom1_id": "///B/542/NH2", "atom2_id": "///B/569/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 857, "atom1_serNum": 6259, "atom2_serNum": 6285, "donAcc_type": "standard", "distance": 3.059, "atom1_id": "///B/543/O", "atom2_id": "///B/547/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 858, "atom1_serNum": 6264, "atom2_serNum": 6296, "donAcc_type": "standard", "distance": 3.031, "atom1_id": "///B/544/O", "atom2_id": "///B/548/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 859, "atom1_serNum": 6271, "atom2_serNum": 6304, "donAcc_type": "standard", "distance": 2.804, "atom1_id": "///B/545/O", "atom2_id": "///B/549/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 860, "atom1_serNum": 6282, "atom2_serNum": 6312, "donAcc_type": "standard", "distance": 2.699, "atom1_id": "///B/546/O", "atom2_id": "///B/550/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 861, "atom1_serNum": 6288, "atom2_serNum": 6320, "donAcc_type": "standard", "distance": 3.127, "atom1_id": "///B/547/O", "atom2_id": "///B/551/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 862, "atom1_serNum": 6299, "atom2_serNum": 6328, "donAcc_type": "standard", "distance": 2.870, "atom1_id": "///B/548/O", "atom2_id": "///B/552/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 863, "atom1_serNum": 6307, "atom2_serNum": 6339, "donAcc_type": "standard", "distance": 3.115, "atom1_id": "///B/549/O", "atom2_id": "///B/553/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 864, "atom1_serNum": 6315, "atom2_serNum": 6344, "donAcc_type": "acceptable", "distance": 2.821, "atom1_id": "///B/550/O", "atom2_id": "///B/553/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 865, "atom1_serNum": 6323, "atom2_serNum": 6345, "donAcc_type": "standard", "distance": 2.976, "atom1_id": "///B/551/O", "atom2_id": "///B/554/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 866, "atom1_serNum": 6331, "atom2_serNum": 6358, "donAcc_type": "acceptable", "distance": 2.894, "atom1_id": "///B/552/O", "atom2_id": "///B/555/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 867, "atom1_serNum": 6331, "atom2_serNum": 6360, "donAcc_type": "standard", "distance": 3.416, "atom1_id": "///B/552/O", "atom2_id": "///B/556/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 868, "atom1_serNum": 6342, "atom2_serNum": 6374, "donAcc_type": "standard", "distance": 2.665, "atom1_id": "///B/553/O", "atom2_id": "///B/558/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 869, "atom1_serNum": 6342, "atom2_serNum": 6382, "donAcc_type": "standard", "distance": 3.386, "atom1_id": "///B/553/O", "atom2_id": "///B/559/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 870, "atom1_serNum": 6358, "atom2_serNum": 8719, "donAcc_type": "acceptable", "distance": 3.042, "atom1_id": "///B/555/OG1", "atom2_id": "///B/861/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 871, "atom1_serNum": 6363, "atom2_serNum": 6374, "donAcc_type": "standard", "distance": 2.330, "atom1_id": "///B/556/O", "atom2_id": "///B/558/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 872, "atom1_serNum": 6363, "atom2_serNum": 6382, "donAcc_type": "standard", "distance": 2.745, "atom1_id": "///B/556/O", "atom2_id": "///B/559/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 873, "atom1_serNum": 6389, "atom2_serNum": 6470, "donAcc_type": "standard", "distance": 3.059, "atom1_id": "///B/559/OE1", "atom2_id": "///B/572/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 874, "atom1_serNum": 6394, "atom2_serNum": 6421, "donAcc_type": "standard", "distance": 3.360, "atom1_id": "///B/560/O", "atom2_id": "///B/564/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 875, "atom1_serNum": 6402, "atom2_serNum": 6426, "donAcc_type": "standard", "distance": 2.845, "atom1_id": "///B/561/O", "atom2_id": "///B/565/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 876, "atom1_serNum": 6402, "atom2_serNum": 6432, "donAcc_type": "standard", "distance": 3.266, "atom1_id": "///B/561/O", "atom2_id": "///B/566/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 877, "atom1_serNum": 6419, "atom2_serNum": 6453, "donAcc_type": "standard", "distance": 2.993, "atom1_id": "///B/563/O", "atom2_id": "///B/570/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 878, "atom1_serNum": 6424, "atom2_serNum": 6447, "donAcc_type": "questionable", "distance": 3.301, "atom1_id": "///B/564/O", "atom2_id": "///B/568/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 879, "atom1_serNum": 6424, "atom2_serNum": 6449, "donAcc_type": "standard", "distance": 3.610, "atom1_id": "///B/564/O", "atom2_id": "///B/569/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 880, "atom1_serNum": 6439, "atom2_serNum": 6790, "donAcc_type": "standard", "distance": 2.999, "atom1_id": "///B/567/O", "atom2_id": "///B/610/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 881, "atom1_serNum": 6473, "atom2_serNum": 6498, "donAcc_type": "standard", "distance": 3.036, "atom1_id": "///B/572/O", "atom2_id": "///B/576/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 882, "atom1_serNum": 6475, "atom2_serNum": 6490, "donAcc_type": "acceptable", "distance": 3.263, "atom1_id": "///B/572/OG", "atom2_id": "///B/575/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 883, "atom1_serNum": 6479, "atom2_serNum": 6506, "donAcc_type": "standard", "distance": 3.066, "atom1_id": "///B/573/O", "atom2_id": "///B/577/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 884, "atom1_serNum": 6481, "atom2_serNum": 10304, "donAcc_type": "acceptable", "distance": 3.166, "atom1_id": "///B/573/OG1", "atom2_id": "///U/20/N3", "atom_pair": "O:N", "residue_pair": "aa:nt" }, { "index": 885, "atom1_serNum": 6481, "atom2_serNum": 10306, "donAcc_type": "acceptable", "distance": 2.704, "atom1_id": "///B/573/OG1", "atom2_id": "///U/20/O4", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 886, "atom1_serNum": 6486, "atom2_serNum": 6513, "donAcc_type": "standard", "distance": 3.042, "atom1_id": "///B/574/O", "atom2_id": "///B/578/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 887, "atom1_serNum": 6486, "atom2_serNum": 6520, "donAcc_type": "standard", "distance": 2.751, "atom1_id": "///B/574/O", "atom2_id": "///B/578/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 888, "atom1_serNum": 6493, "atom2_serNum": 6521, "donAcc_type": "standard", "distance": 2.899, "atom1_id": "///B/575/O", "atom2_id": "///B/579/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 889, "atom1_serNum": 6509, "atom2_serNum": 6543, "donAcc_type": "standard", "distance": 2.404, "atom1_id": "///B/577/O", "atom2_id": "///B/581/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 890, "atom1_serNum": 6516, "atom2_serNum": 6533, "donAcc_type": "standard", "distance": 2.685, "atom1_id": "///B/578/O", "atom2_id": "///B/581/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 891, "atom1_serNum": 6516, "atom2_serNum": 6544, "donAcc_type": "standard", "distance": 3.064, "atom1_id": "///B/578/O", "atom2_id": "///B/582/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 892, "atom1_serNum": 6555, "atom2_serNum": 9132, "donAcc_type": "standard", "distance": 2.937, "atom1_id": "///B/583/O", "atom2_id": "///B/913/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 893, "atom1_serNum": 6560, "atom2_serNum": 9131, "donAcc_type": "standard", "distance": 3.133, "atom1_id": "///B/583/OE2", "atom2_id": "///B/912/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 894, "atom1_serNum": 6584, "atom2_serNum": 9130, "donAcc_type": "acceptable", "distance": 3.495, "atom1_id": "///B/586/OG", "atom2_id": "///B/912/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 895, "atom1_serNum": 6596, "atom2_serNum": 8716, "donAcc_type": "acceptable", "distance": 2.428, "atom1_id": "///B/587/OH", "atom2_id": "///B/861/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 896, "atom1_serNum": 6596, "atom2_serNum": 8732, "donAcc_type": "acceptable", "distance": 2.954, "atom1_id": "///B/587/OH", "atom2_id": "///B/864/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 897, "atom1_serNum": 6602, "atom2_serNum": 8655, "donAcc_type": "acceptable", "distance": 2.650, "atom1_id": "///B/588/OG1", "atom2_id": "///B/853/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 898, "atom1_serNum": 6612, "atom2_serNum": 8694, "donAcc_type": "standard", "distance": 3.057, "atom1_id": "///B/590/N", "atom2_id": "///B/859/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 899, "atom1_serNum": 6615, "atom2_serNum": 8676, "donAcc_type": "standard", "distance": 2.729, "atom1_id": "///B/590/O", "atom2_id": "///B/857/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 900, "atom1_serNum": 6631, "atom2_serNum": 8682, "donAcc_type": "standard", "distance": 2.949, "atom1_id": "///B/592/N", "atom2_id": "///B/857/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 901, "atom1_serNum": 6640, "atom2_serNum": 8682, "donAcc_type": "standard", "distance": 3.027, "atom1_id": "///B/593/N", "atom2_id": "///B/857/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 902, "atom1_serNum": 6643, "atom2_serNum": 8712, "donAcc_type": "standard", "distance": 2.687, "atom1_id": "///B/593/O", "atom2_id": "///B/860/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 903, "atom1_serNum": 6645, "atom2_serNum": 8683, "donAcc_type": "acceptable", "distance": 2.797, "atom1_id": "///B/593/OG1", "atom2_id": "///B/857/OD2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 904, "atom1_serNum": 6676, "atom2_serNum": 6719, "donAcc_type": "standard", "distance": 3.162, "atom1_id": "///B/597/N", "atom2_id": "///B/601/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 905, "atom1_serNum": 6688, "atom2_serNum": 6720, "donAcc_type": "standard", "distance": 3.239, "atom1_id": "///B/598/O", "atom2_id": "///B/602/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 906, "atom1_serNum": 6691, "atom2_serNum": 6712, "donAcc_type": "standard", "distance": 3.034, "atom1_id": "///B/598/OD1", "atom2_id": "///B/601/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 907, "atom1_serNum": 6696, "atom2_serNum": 6728, "donAcc_type": "standard", "distance": 3.203, "atom1_id": "///B/599/O", "atom2_id": "///B/603/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 908, "atom1_serNum": 6707, "atom2_serNum": 6736, "donAcc_type": "standard", "distance": 2.758, "atom1_id": "///B/600/O", "atom2_id": "///B/604/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 909, "atom1_serNum": 6715, "atom2_serNum": 6747, "donAcc_type": "standard", "distance": 2.999, "atom1_id": "///B/601/O", "atom2_id": "///B/605/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 910, "atom1_serNum": 6719, "atom2_serNum": 7110, "donAcc_type": "standard", "distance": 2.480, "atom1_id": "///B/601/OD2", "atom2_id": "///B/650/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 911, "atom1_serNum": 6723, "atom2_serNum": 6759, "donAcc_type": "standard", "distance": 2.831, "atom1_id": "///B/602/O", "atom2_id": "///B/606/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 912, "atom1_serNum": 6731, "atom2_serNum": 6764, "donAcc_type": "standard", "distance": 2.999, "atom1_id": "///B/603/O", "atom2_id": "///B/607/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 913, "atom1_serNum": 6739, "atom2_serNum": 6769, "donAcc_type": "standard", "distance": 3.085, "atom1_id": "///B/604/O", "atom2_id": "///B/608/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 914, "atom1_serNum": 6750, "atom2_serNum": 6774, "donAcc_type": "standard", "distance": 2.923, "atom1_id": "///B/605/O", "atom2_id": "///B/609/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 915, "atom1_serNum": 6762, "atom2_serNum": 6781, "donAcc_type": "standard", "distance": 3.039, "atom1_id": "///B/606/O", "atom2_id": "///B/610/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 916, "atom1_serNum": 6767, "atom2_serNum": 6791, "donAcc_type": "standard", "distance": 3.149, "atom1_id": "///B/607/O", "atom2_id": "///B/611/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 917, "atom1_serNum": 6772, "atom2_serNum": 6791, "donAcc_type": "standard", "distance": 2.884, "atom1_id": "///B/608/O", "atom2_id": "///B/611/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 918, "atom1_serNum": 6772, "atom2_serNum": 6799, "donAcc_type": "standard", "distance": 2.935, "atom1_id": "///B/608/O", "atom2_id": "///B/612/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 919, "atom1_serNum": 6777, "atom2_serNum": 6807, "donAcc_type": "standard", "distance": 3.070, "atom1_id": "///B/609/O", "atom2_id": "///B/613/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 920, "atom1_serNum": 6784, "atom2_serNum": 6813, "donAcc_type": "standard", "distance": 3.109, "atom1_id": "///B/610/O", "atom2_id": "///B/614/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 921, "atom1_serNum": 6794, "atom2_serNum": 6821, "donAcc_type": "standard", "distance": 2.954, "atom1_id": "///B/611/O", "atom2_id": "///B/615/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 922, "atom1_serNum": 6802, "atom2_serNum": 6829, "donAcc_type": "standard", "distance": 2.905, "atom1_id": "///B/612/O", "atom2_id": "///B/616/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 923, "atom1_serNum": 6802, "atom2_serNum": 6834, "donAcc_type": "acceptable", "distance": 3.109, "atom1_id": "///B/612/O", "atom2_id": "///B/616/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 924, "atom1_serNum": 6810, "atom2_serNum": 6835, "donAcc_type": "standard", "distance": 2.704, "atom1_id": "///B/613/O", "atom2_id": "///B/617/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 925, "atom1_serNum": 6816, "atom2_serNum": 6841, "donAcc_type": "standard", "distance": 2.842, "atom1_id": "///B/614/O", "atom2_id": "///B/618/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 926, "atom1_serNum": 6824, "atom2_serNum": 6846, "donAcc_type": "standard", "distance": 3.051, "atom1_id": "///B/615/O", "atom2_id": "///B/619/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 927, "atom1_serNum": 6832, "atom2_serNum": 6854, "donAcc_type": "standard", "distance": 3.004, "atom1_id": "///B/616/O", "atom2_id": "///B/620/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 928, "atom1_serNum": 6834, "atom2_serNum": 7297, "donAcc_type": "acceptable", "distance": 3.158, "atom1_id": "///B/616/OG", "atom2_id": "///B/672/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 929, "atom1_serNum": 6834, "atom2_serNum": 7300, "donAcc_type": "acceptable", "distance": 3.097, "atom1_id": "///B/616/OG", "atom2_id": "///B/672/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 930, "atom1_serNum": 6838, "atom2_serNum": 6859, "donAcc_type": "standard", "distance": 3.160, "atom1_id": "///B/617/O", "atom2_id": "///B/621/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 931, "atom1_serNum": 6844, "atom2_serNum": 6859, "donAcc_type": "standard", "distance": 2.736, "atom1_id": "///B/618/O", "atom2_id": "///B/621/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 932, "atom1_serNum": 6844, "atom2_serNum": 6867, "donAcc_type": "standard", "distance": 3.021, "atom1_id": "///B/618/O", "atom2_id": "///B/622/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 933, "atom1_serNum": 6844, "atom2_serNum": 6871, "donAcc_type": "standard", "distance": 3.392, "atom1_id": "///B/618/O", "atom2_id": "///B/623/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 934, "atom1_serNum": 6849, "atom2_serNum": 6867, "donAcc_type": "standard", "distance": 2.930, "atom1_id": "///B/619/O", "atom2_id": "///B/622/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 935, "atom1_serNum": 6857, "atom2_serNum": 10353, "donAcc_type": "questionable", "distance": 2.814, "atom1_id": "///B/620/O", "atom2_id": "///V/1/OP2", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 936, "atom1_serNum": 6870, "atom2_serNum": 6879, "donAcc_type": "standard", "distance": 2.925, "atom1_id": "///B/622/O", "atom2_id": "///B/624/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 937, "atom1_serNum": 6874, "atom2_serNum": 6902, "donAcc_type": "standard", "distance": 2.873, "atom1_id": "///B/623/O", "atom2_id": "///B/626/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 938, "atom1_serNum": 6874, "atom2_serNum": 6911, "donAcc_type": "standard", "distance": 3.179, "atom1_id": "///B/623/O", "atom2_id": "///B/627/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 939, "atom1_serNum": 6882, "atom2_serNum": 6916, "donAcc_type": "standard", "distance": 3.111, "atom1_id": "///B/624/O", "atom2_id": "///B/628/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 940, "atom1_serNum": 6896, "atom2_serNum": 6925, "donAcc_type": "standard", "distance": 3.282, "atom1_id": "///B/625/O", "atom2_id": "///B/629/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 941, "atom1_serNum": 6905, "atom2_serNum": 6934, "donAcc_type": "standard", "distance": 2.915, "atom1_id": "///B/626/O", "atom2_id": "///B/630/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 942, "atom1_serNum": 6914, "atom2_serNum": 6942, "donAcc_type": "standard", "distance": 2.868, "atom1_id": "///B/627/O", "atom2_id": "///B/631/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 943, "atom1_serNum": 6919, "atom2_serNum": 6947, "donAcc_type": "standard", "distance": 3.012, "atom1_id": "///B/628/O", "atom2_id": "///B/632/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 944, "atom1_serNum": 6928, "atom2_serNum": 6947, "donAcc_type": "standard", "distance": 2.750, "atom1_id": "///B/629/O", "atom2_id": "///B/632/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 945, "atom1_serNum": 6928, "atom2_serNum": 6956, "donAcc_type": "standard", "distance": 2.695, "atom1_id": "///B/629/O", "atom2_id": "///B/633/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 946, "atom1_serNum": 6937, "atom2_serNum": 6962, "donAcc_type": "standard", "distance": 2.994, "atom1_id": "///B/630/O", "atom2_id": "///B/634/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 947, "atom1_serNum": 6945, "atom2_serNum": 6967, "donAcc_type": "standard", "distance": 2.730, "atom1_id": "///B/631/O", "atom2_id": "///B/635/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 948, "atom1_serNum": 6950, "atom2_serNum": 6976, "donAcc_type": "standard", "distance": 3.010, "atom1_id": "///B/632/O", "atom2_id": "///B/636/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 949, "atom1_serNum": 6959, "atom2_serNum": 6976, "donAcc_type": "standard", "distance": 3.085, "atom1_id": "///B/633/O", "atom2_id": "///B/636/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 950, "atom1_serNum": 6959, "atom2_serNum": 6987, "donAcc_type": "standard", "distance": 3.362, "atom1_id": "///B/633/O", "atom2_id": "///B/637/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 951, "atom1_serNum": 6965, "atom2_serNum": 6995, "donAcc_type": "standard", "distance": 3.023, "atom1_id": "///B/634/O", "atom2_id": "///B/638/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 952, "atom1_serNum": 6970, "atom2_serNum": 7016, "donAcc_type": "standard", "distance": 2.925, "atom1_id": "///B/635/O", "atom2_id": "///B/639/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 953, "atom1_serNum": 6975, "atom2_serNum": 7451, "donAcc_type": "standard", "distance": 3.003, "atom1_id": "///B/635/NZ", "atom2_id": "///B/689/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 954, "atom1_serNum": 6979, "atom2_serNum": 7009, "donAcc_type": "standard", "distance": 2.691, "atom1_id": "///B/636/O", "atom2_id": "///B/639/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 955, "atom1_serNum": 6979, "atom2_serNum": 7017, "donAcc_type": "standard", "distance": 2.938, "atom1_id": "///B/636/O", "atom2_id": "///B/640/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 956, "atom1_serNum": 6986, "atom2_serNum": 6993, "donAcc_type": "standard", "distance": 3.415, "atom1_id": "///B/636/NH2", "atom2_id": "///B/637/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 957, "atom1_serNum": 6987, "atom2_serNum": 6993, "donAcc_type": "standard", "distance": 2.629, "atom1_id": "///B/637/N", "atom2_id": "///B/637/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 958, "atom1_serNum": 6990, "atom2_serNum": 7028, "donAcc_type": "standard", "distance": 3.088, "atom1_id": "///B/637/O", "atom2_id": "///B/641/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 959, "atom1_serNum": 6998, "atom2_serNum": 7036, "donAcc_type": "standard", "distance": 3.258, "atom1_id": "///B/638/O", "atom2_id": "///B/642/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 960, "atom1_serNum": 7031, "atom2_serNum": 7045, "donAcc_type": "standard", "distance": 2.623, "atom1_id": "///B/641/O", "atom2_id": "///B/643/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 961, "atom1_serNum": 7031, "atom2_serNum": 7053, "donAcc_type": "standard", "distance": 3.145, "atom1_id": "///B/641/O", "atom2_id": "///B/644/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 962, "atom1_serNum": 7048, "atom2_serNum": 7093, "donAcc_type": "standard", "distance": 2.676, "atom1_id": "///B/643/O", "atom2_id": "///B/648/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 963, "atom1_serNum": 7056, "atom2_serNum": 7093, "donAcc_type": "standard", "distance": 2.723, "atom1_id": "///B/644/O", "atom2_id": "///B/648/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 964, "atom1_serNum": 7059, "atom2_serNum": 7070, "donAcc_type": "acceptable", "distance": 3.005, "atom1_id": "///B/644/ND1", "atom2_id": "///B/646/N", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 965, "atom1_serNum": 7059, "atom2_serNum": 7075, "donAcc_type": "acceptable", "distance": 2.726, "atom1_id": "///B/644/ND1", "atom2_id": "///B/646/OG", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 966, "atom1_serNum": 7066, "atom2_serNum": 7084, "donAcc_type": "standard", "distance": 3.185, "atom1_id": "///B/645/O", "atom2_id": "///B/648/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 967, "atom1_serNum": 7073, "atom2_serNum": 7095, "donAcc_type": "standard", "distance": 2.941, "atom1_id": "///B/646/O", "atom2_id": "///B/649/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 968, "atom1_serNum": 7073, "atom2_serNum": 7101, "donAcc_type": "standard", "distance": 3.214, "atom1_id": "///B/646/O", "atom2_id": "///B/650/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 969, "atom1_serNum": 7079, "atom2_serNum": 7101, "donAcc_type": "standard", "distance": 2.788, "atom1_id": "///B/647/O", "atom2_id": "///B/650/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 970, "atom1_serNum": 7079, "atom2_serNum": 7111, "donAcc_type": "standard", "distance": 2.759, "atom1_id": "///B/647/O", "atom2_id": "///B/651/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 971, "atom1_serNum": 7094, "atom2_serNum": 7119, "donAcc_type": "standard", "distance": 3.001, "atom1_id": "///B/648/NH2", "atom2_id": "///B/651/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 972, "atom1_serNum": 7104, "atom2_serNum": 7128, "donAcc_type": "standard", "distance": 2.726, "atom1_id": "///B/650/O", "atom2_id": "///B/653/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 973, "atom1_serNum": 7131, "atom2_serNum": 7177, "donAcc_type": "standard", "distance": 2.965, "atom1_id": "///B/653/O", "atom2_id": "///B/658/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 974, "atom1_serNum": 7131, "atom2_serNum": 7180, "donAcc_type": "standard", "distance": 2.746, "atom1_id": "///B/653/O", "atom2_id": "///B/658/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 975, "atom1_serNum": 7139, "atom2_serNum": 7162, "donAcc_type": "standard", "distance": 2.795, "atom1_id": "///B/654/O", "atom2_id": "///B/657/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 976, "atom1_serNum": 7139, "atom2_serNum": 7170, "donAcc_type": "standard", "distance": 2.774, "atom1_id": "///B/654/O", "atom2_id": "///B/658/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 977, "atom1_serNum": 7146, "atom2_serNum": 7181, "donAcc_type": "standard", "distance": 3.305, "atom1_id": "///B/655/O", "atom2_id": "///B/659/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 978, "atom1_serNum": 7165, "atom2_serNum": 7187, "donAcc_type": "standard", "distance": 2.813, "atom1_id": "///B/657/O", "atom2_id": "///B/660/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 979, "atom1_serNum": 7173, "atom2_serNum": 7203, "donAcc_type": "acceptable", "distance": 2.985, "atom1_id": "///B/658/O", "atom2_id": "///B/661/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 980, "atom1_serNum": 7179, "atom2_serNum": 7520, "donAcc_type": "standard", "distance": 2.830, "atom1_id": "///B/658/NH1", "atom2_id": "///B/698/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 981, "atom1_serNum": 7201, "atom2_serNum": 7230, "donAcc_type": "standard", "distance": 3.226, "atom1_id": "///B/661/O", "atom2_id": "///B/665/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 982, "atom1_serNum": 7203, "atom2_serNum": 7216, "donAcc_type": "acceptable", "distance": 3.250, "atom1_id": "///B/661/OG1", "atom2_id": "///B/664/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 983, "atom1_serNum": 7208, "atom2_serNum": 7238, "donAcc_type": "standard", "distance": 2.782, "atom1_id": "///B/662/O", "atom2_id": "///B/666/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 984, "atom1_serNum": 7215, "atom2_serNum": 7250, "donAcc_type": "standard", "distance": 2.979, "atom1_id": "///B/663/O", "atom2_id": "///B/667/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 985, "atom1_serNum": 7215, "atom2_serNum": 7255, "donAcc_type": "acceptable", "distance": 2.679, "atom1_id": "///B/663/O", "atom2_id": "///B/667/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 986, "atom1_serNum": 7219, "atom2_serNum": 7257, "donAcc_type": "standard", "distance": 2.925, "atom1_id": "///B/664/O", "atom2_id": "///B/668/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 987, "atom1_serNum": 7233, "atom2_serNum": 7268, "donAcc_type": "standard", "distance": 2.840, "atom1_id": "///B/665/O", "atom2_id": "///B/669/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 988, "atom1_serNum": 7241, "atom2_serNum": 7276, "donAcc_type": "standard", "distance": 2.797, "atom1_id": "///B/666/O", "atom2_id": "///B/670/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 989, "atom1_serNum": 7253, "atom2_serNum": 7284, "donAcc_type": "standard", "distance": 2.905, "atom1_id": "///B/667/O", "atom2_id": "///B/671/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 990, "atom1_serNum": 7260, "atom2_serNum": 7290, "donAcc_type": "standard", "distance": 3.244, "atom1_id": "///B/668/O", "atom2_id": "///B/672/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 991, "atom1_serNum": 7271, "atom2_serNum": 7301, "donAcc_type": "standard", "distance": 3.033, "atom1_id": "///B/669/O", "atom2_id": "///B/673/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 992, "atom1_serNum": 7279, "atom2_serNum": 7312, "donAcc_type": "standard", "distance": 3.090, "atom1_id": "///B/670/O", "atom2_id": "///B/674/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 993, "atom1_serNum": 7287, "atom2_serNum": 7319, "donAcc_type": "standard", "distance": 3.091, "atom1_id": "///B/671/O", "atom2_id": "///B/675/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 994, "atom1_serNum": 7289, "atom2_serNum": 7598, "donAcc_type": "acceptable", "distance": 2.762, "atom1_id": "///B/671/OG", "atom2_id": "///B/707/NE1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 995, "atom1_serNum": 7289, "atom2_serNum": 10616, "donAcc_type": "acceptable", "distance": 3.821, "atom1_id": "///B/671/OG", "atom2_id": "///W/0/O2", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 996, "atom1_serNum": 7293, "atom2_serNum": 7328, "donAcc_type": "standard", "distance": 2.775, "atom1_id": "///B/672/O", "atom2_id": "///B/676/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 997, "atom1_serNum": 7299, "atom2_serNum": 7327, "donAcc_type": "standard", "distance": 2.807, "atom1_id": "///B/672/NH1", "atom2_id": "///B/675/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 998, "atom1_serNum": 7304, "atom2_serNum": 7336, "donAcc_type": "standard", "distance": 2.825, "atom1_id": "///B/673/O", "atom2_id": "///B/677/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 999, "atom1_serNum": 7315, "atom2_serNum": 7344, "donAcc_type": "standard", "distance": 2.946, "atom1_id": "///B/674/O", "atom2_id": "///B/678/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1000, "atom1_serNum": 7322, "atom2_serNum": 7353, "donAcc_type": "standard", "distance": 3.111, "atom1_id": "///B/675/O", "atom2_id": "///B/679/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1001, "atom1_serNum": 7331, "atom2_serNum": 7364, "donAcc_type": "standard", "distance": 3.098, "atom1_id": "///B/676/O", "atom2_id": "///B/680/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1002, "atom1_serNum": 7339, "atom2_serNum": 7382, "donAcc_type": "standard", "distance": 2.866, "atom1_id": "///B/677/O", "atom2_id": "///B/682/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1003, "atom1_serNum": 7347, "atom2_serNum": 7372, "donAcc_type": "standard", "distance": 2.771, "atom1_id": "///B/678/O", "atom2_id": "///B/681/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1004, "atom1_serNum": 7351, "atom2_serNum": 7633, "donAcc_type": "standard", "distance": 2.785, "atom1_id": "///B/678/OE1", "atom2_id": "///B/710/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1005, "atom1_serNum": 7351, "atom2_serNum": 7665, "donAcc_type": "standard", "distance": 2.809, "atom1_id": "///B/678/OE1", "atom2_id": "///B/714/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1006, "atom1_serNum": 7352, "atom2_serNum": 10619, "donAcc_type": "standard", "distance": 2.986, "atom1_id": "///B/678/NE2", "atom2_id": "///W/0/O4", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 1007, "atom1_serNum": 7362, "atom2_serNum": 11594, "donAcc_type": "standard", "distance": 2.308, "atom1_id": "///B/679/NH1", "atom2_id": "///T/14/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 1008, "atom1_serNum": 7363, "atom2_serNum": 11593, "donAcc_type": "standard", "distance": 2.544, "atom1_id": "///B/679/NH2", "atom2_id": "///T/14/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 1009, "atom1_serNum": 7367, "atom2_serNum": 7382, "donAcc_type": "standard", "distance": 2.734, "atom1_id": "///B/680/O", "atom2_id": "///B/682/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1010, "atom1_serNum": 7375, "atom2_serNum": 7390, "donAcc_type": "standard", "distance": 2.760, "atom1_id": "///B/681/O", "atom2_id": "///B/683/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1011, "atom1_serNum": 7381, "atom2_serNum": 11573, "donAcc_type": "standard", "distance": 2.971, "atom1_id": "///B/681/NE2", "atom2_id": "///T/13/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 1012, "atom1_serNum": 7385, "atom2_serNum": 7420, "donAcc_type": "standard", "distance": 3.287, "atom1_id": "///B/682/O", "atom2_id": "///B/686/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1013, "atom1_serNum": 7405, "atom2_serNum": 7432, "donAcc_type": "standard", "distance": 3.028, "atom1_id": "///B/684/O", "atom2_id": "///B/688/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1014, "atom1_serNum": 7414, "atom2_serNum": 7443, "donAcc_type": "standard", "distance": 2.775, "atom1_id": "///B/685/O", "atom2_id": "///B/689/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1015, "atom1_serNum": 7423, "atom2_serNum": 7452, "donAcc_type": "standard", "distance": 2.845, "atom1_id": "///B/686/O", "atom2_id": "///B/690/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1016, "atom1_serNum": 7428, "atom2_serNum": 7460, "donAcc_type": "standard", "distance": 2.911, "atom1_id": "///B/687/O", "atom2_id": "///B/691/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1017, "atom1_serNum": 7435, "atom2_serNum": 7469, "donAcc_type": "standard", "distance": 2.766, "atom1_id": "///B/688/O", "atom2_id": "///B/692/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1018, "atom1_serNum": 7446, "atom2_serNum": 7475, "donAcc_type": "standard", "distance": 2.960, "atom1_id": "///B/689/O", "atom2_id": "///B/693/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1019, "atom1_serNum": 7455, "atom2_serNum": 7483, "donAcc_type": "standard", "distance": 2.980, "atom1_id": "///B/690/O", "atom2_id": "///B/694/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1020, "atom1_serNum": 7463, "atom2_serNum": 7491, "donAcc_type": "standard", "distance": 3.099, "atom1_id": "///B/691/O", "atom2_id": "///B/695/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1021, "atom1_serNum": 7472, "atom2_serNum": 7491, "donAcc_type": "standard", "distance": 2.716, "atom1_id": "///B/692/O", "atom2_id": "///B/695/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1022, "atom1_serNum": 7472, "atom2_serNum": 7496, "donAcc_type": "acceptable", "distance": 2.280, "atom1_id": "///B/692/O", "atom2_id": "///B/695/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1023, "atom1_serNum": 7478, "atom2_serNum": 7505, "donAcc_type": "standard", "distance": 3.008, "atom1_id": "///B/693/O", "atom2_id": "///B/696/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1024, "atom1_serNum": 7486, "atom2_serNum": 7574, "donAcc_type": "standard", "distance": 2.356, "atom1_id": "///B/694/O", "atom2_id": "///B/704/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1025, "atom1_serNum": 7500, "atom2_serNum": 7574, "donAcc_type": "standard", "distance": 3.549, "atom1_id": "///B/696/O", "atom2_id": "///B/704/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1026, "atom1_serNum": 7504, "atom2_serNum": 7517, "donAcc_type": "standard", "distance": 2.807, "atom1_id": "///B/696/OE1", "atom2_id": "///B/698/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1027, "atom1_serNum": 7504, "atom2_serNum": 7525, "donAcc_type": "standard", "distance": 2.891, "atom1_id": "///B/696/OE1", "atom2_id": "///B/699/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1028, "atom1_serNum": 7505, "atom2_serNum": 7528, "donAcc_type": "standard", "distance": 3.388, "atom1_id": "///B/696/NE2", "atom2_id": "///B/699/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1029, "atom1_serNum": 7515, "atom2_serNum": 7832, "donAcc_type": "standard", "distance": 2.899, "atom1_id": "///B/697/NH1", "atom2_id": "///B/735/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1030, "atom1_serNum": 7516, "atom2_serNum": 7832, "donAcc_type": "standard", "distance": 2.800, "atom1_id": "///B/697/NH2", "atom2_id": "///B/735/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1031, "atom1_serNum": 7540, "atom2_serNum": 7558, "donAcc_type": "standard", "distance": 2.923, "atom1_id": "///B/700/O", "atom2_id": "///B/703/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1032, "atom1_serNum": 7546, "atom2_serNum": 7564, "donAcc_type": "standard", "distance": 3.143, "atom1_id": "///B/701/O", "atom2_id": "///B/704/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1033, "atom1_serNum": 7550, "atom2_serNum": 7556, "donAcc_type": "standard", "distance": 2.722, "atom1_id": "///B/702/N", "atom2_id": "///B/702/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1034, "atom1_serNum": 7557, "atom2_serNum": 9429, "donAcc_type": "standard", "distance": 2.708, "atom1_id": "///B/702/OD2", "atom2_id": "///B/952/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1035, "atom1_serNum": 7557, "atom2_serNum": 9432, "donAcc_type": "standard", "distance": 2.902, "atom1_id": "///B/702/OD2", "atom2_id": "///B/952/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1036, "atom1_serNum": 7561, "atom2_serNum": 7590, "donAcc_type": "standard", "distance": 3.039, "atom1_id": "///B/703/O", "atom2_id": "///B/707/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1037, "atom1_serNum": 7567, "atom2_serNum": 7604, "donAcc_type": "standard", "distance": 2.671, "atom1_id": "///B/704/O", "atom2_id": "///B/708/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1038, "atom1_serNum": 7573, "atom2_serNum": 7833, "donAcc_type": "standard", "distance": 2.402, "atom1_id": "///B/704/NH1", "atom2_id": "///B/735/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1039, "atom1_serNum": 7578, "atom2_serNum": 7618, "donAcc_type": "standard", "distance": 3.066, "atom1_id": "///B/705/O", "atom2_id": "///B/709/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1040, "atom1_serNum": 7582, "atom2_serNum": 7626, "donAcc_type": "standard", "distance": 2.872, "atom1_id": "///B/706/O", "atom2_id": "///B/710/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1041, "atom1_serNum": 7586, "atom2_serNum": 10604, "donAcc_type": "standard", "distance": 2.913, "atom1_id": "///B/706/NE", "atom2_id": "///W/0/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 1042, "atom1_serNum": 7589, "atom2_serNum": 10604, "donAcc_type": "standard", "distance": 3.167, "atom1_id": "///B/706/NH2", "atom2_id": "///W/0/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 1043, "atom1_serNum": 7593, "atom2_serNum": 7637, "donAcc_type": "standard", "distance": 2.593, "atom1_id": "///B/707/O", "atom2_id": "///B/711/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1044, "atom1_serNum": 7607, "atom2_serNum": 7645, "donAcc_type": "standard", "distance": 2.869, "atom1_id": "///B/708/O", "atom2_id": "///B/712/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1045, "atom1_serNum": 7612, "atom2_serNum": 7833, "donAcc_type": "standard", "distance": 2.999, "atom1_id": "///B/708/NE1", "atom2_id": "///B/735/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1046, "atom1_serNum": 7621, "atom2_serNum": 7650, "donAcc_type": "standard", "distance": 2.774, "atom1_id": "///B/709/O", "atom2_id": "///B/713/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1047, "atom1_serNum": 7624, "atom2_serNum": 7913, "donAcc_type": "acceptable", "distance": 2.785, "atom1_id": "///B/709/OD1", "atom2_id": "///B/745/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1048, "atom1_serNum": 7625, "atom2_serNum": 7885, "donAcc_type": "acceptable", "distance": 2.956, "atom1_id": "///B/709/OD2", "atom2_id": "///B/742/ND1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1049, "atom1_serNum": 7625, "atom2_serNum": 7913, "donAcc_type": "acceptable", "distance": 3.090, "atom1_id": "///B/709/OD2", "atom2_id": "///B/745/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1050, "atom1_serNum": 7629, "atom2_serNum": 7658, "donAcc_type": "standard", "distance": 3.054, "atom1_id": "///B/710/O", "atom2_id": "///B/714/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1051, "atom1_serNum": 7635, "atom2_serNum": 11552, "donAcc_type": "standard", "distance": 3.055, "atom1_id": "///B/710/NH1", "atom2_id": "///T/12/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 1052, "atom1_serNum": 7636, "atom2_serNum": 7664, "donAcc_type": "standard", "distance": 3.215, "atom1_id": "///B/710/NH2", "atom2_id": "///B/714/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1053, "atom1_serNum": 7636, "atom2_serNum": 11551, "donAcc_type": "standard", "distance": 2.805, "atom1_id": "///B/710/NH2", "atom2_id": "///T/12/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 1054, "atom1_serNum": 7640, "atom2_serNum": 7666, "donAcc_type": "standard", "distance": 2.960, "atom1_id": "///B/711/O", "atom2_id": "///B/715/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1055, "atom1_serNum": 7648, "atom2_serNum": 7674, "donAcc_type": "standard", "distance": 2.964, "atom1_id": "///B/712/O", "atom2_id": "///B/716/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1056, "atom1_serNum": 7653, "atom2_serNum": 7684, "donAcc_type": "standard", "distance": 2.832, "atom1_id": "///B/713/O", "atom2_id": "///B/717/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1057, "atom1_serNum": 7661, "atom2_serNum": 7693, "donAcc_type": "standard", "distance": 2.968, "atom1_id": "///B/714/O", "atom2_id": "///B/718/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1058, "atom1_serNum": 7661, "atom2_serNum": 7703, "donAcc_type": "standard", "distance": 2.874, "atom1_id": "///B/714/O", "atom2_id": "///B/719/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1059, "atom1_serNum": 7669, "atom2_serNum": 7720, "donAcc_type": "standard", "distance": 2.935, "atom1_id": "///B/715/O", "atom2_id": "///B/721/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1060, "atom1_serNum": 7680, "atom2_serNum": 7952, "donAcc_type": "acceptable", "distance": 2.923, "atom1_id": "///B/716/ND1", "atom2_id": "///B/749/NH1", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 1061, "atom1_serNum": 7687, "atom2_serNum": 7719, "donAcc_type": "standard", "distance": 3.404, "atom1_id": "///B/717/O", "atom2_id": "///B/720/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1062, "atom1_serNum": 7702, "atom2_serNum": 11551, "donAcc_type": "standard", "distance": 2.940, "atom1_id": "///B/718/NE2", "atom2_id": "///T/12/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 1063, "atom1_serNum": 7706, "atom2_serNum": 7720, "donAcc_type": "standard", "distance": 2.266, "atom1_id": "///B/719/O", "atom2_id": "///B/721/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1064, "atom1_serNum": 7714, "atom2_serNum": 7731, "donAcc_type": "standard", "distance": 2.989, "atom1_id": "///B/720/O", "atom2_id": "///B/722/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1065, "atom1_serNum": 7723, "atom2_serNum": 7755, "donAcc_type": "standard", "distance": 3.201, "atom1_id": "///B/721/O", "atom2_id": "///B/725/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1066, "atom1_serNum": 7742, "atom2_serNum": 7762, "donAcc_type": "standard", "distance": 3.054, "atom1_id": "///B/723/O", "atom2_id": "///B/726/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1067, "atom1_serNum": 7742, "atom2_serNum": 7770, "donAcc_type": "standard", "distance": 3.608, "atom1_id": "///B/723/O", "atom2_id": "///B/727/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1068, "atom1_serNum": 7751, "atom2_serNum": 7770, "donAcc_type": "standard", "distance": 2.700, "atom1_id": "///B/724/O", "atom2_id": "///B/727/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1069, "atom1_serNum": 7751, "atom2_serNum": 7779, "donAcc_type": "standard", "distance": 2.731, "atom1_id": "///B/724/O", "atom2_id": "///B/728/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1070, "atom1_serNum": 7758, "atom2_serNum": 7785, "donAcc_type": "standard", "distance": 3.018, "atom1_id": "///B/725/O", "atom2_id": "///B/729/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1071, "atom1_serNum": 7765, "atom2_serNum": 7793, "donAcc_type": "standard", "distance": 2.847, "atom1_id": "///B/726/O", "atom2_id": "///B/730/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1072, "atom1_serNum": 7765, "atom2_serNum": 7798, "donAcc_type": "acceptable", "distance": 2.445, "atom1_id": "///B/726/O", "atom2_id": "///B/730/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1073, "atom1_serNum": 7773, "atom2_serNum": 7800, "donAcc_type": "standard", "distance": 2.925, "atom1_id": "///B/727/O", "atom2_id": "///B/731/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1074, "atom1_serNum": 7782, "atom2_serNum": 7809, "donAcc_type": "standard", "distance": 2.899, "atom1_id": "///B/728/O", "atom2_id": "///B/732/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1075, "atom1_serNum": 7788, "atom2_serNum": 7813, "donAcc_type": "standard", "distance": 3.057, "atom1_id": "///B/729/O", "atom2_id": "///B/733/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1076, "atom1_serNum": 7796, "atom2_serNum": 7821, "donAcc_type": "standard", "distance": 3.126, "atom1_id": "///B/730/O", "atom2_id": "///B/734/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1077, "atom1_serNum": 7803, "atom2_serNum": 7821, "donAcc_type": "standard", "distance": 2.903, "atom1_id": "///B/731/O", "atom2_id": "///B/734/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1078, "atom1_serNum": 7803, "atom2_serNum": 7826, "donAcc_type": "standard", "distance": 3.103, "atom1_id": "///B/731/O", "atom2_id": "///B/735/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1079, "atom1_serNum": 7812, "atom2_serNum": 7826, "donAcc_type": "standard", "distance": 3.147, "atom1_id": "///B/732/O", "atom2_id": "///B/735/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1080, "atom1_serNum": 7816, "atom2_serNum": 7899, "donAcc_type": "standard", "distance": 2.608, "atom1_id": "///B/733/O", "atom2_id": "///B/743/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1081, "atom1_serNum": 7829, "atom2_serNum": 7850, "donAcc_type": "standard", "distance": 2.904, "atom1_id": "///B/735/O", "atom2_id": "///B/738/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1082, "atom1_serNum": 7829, "atom2_serNum": 7898, "donAcc_type": "standard", "distance": 3.483, "atom1_id": "///B/735/O", "atom2_id": "///B/743/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1083, "atom1_serNum": 7832, "atom2_serNum": 7841, "donAcc_type": "standard", "distance": 3.184, "atom1_id": "///B/735/OD1", "atom2_id": "///B/737/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1084, "atom1_serNum": 7837, "atom2_serNum": 7864, "donAcc_type": "standard", "distance": 2.859, "atom1_id": "///B/736/O", "atom2_id": "///B/739/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1085, "atom1_serNum": 7853, "atom2_serNum": 7898, "donAcc_type": "standard", "distance": 2.116, "atom1_id": "///B/738/O", "atom2_id": "///B/743/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1086, "atom1_serNum": 7860, "atom2_serNum": 7879, "donAcc_type": "standard", "distance": 3.298, "atom1_id": "///B/739/O", "atom2_id": "///B/742/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1087, "atom1_serNum": 7860, "atom2_serNum": 7889, "donAcc_type": "standard", "distance": 2.910, "atom1_id": "///B/739/O", "atom2_id": "///B/743/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1088, "atom1_serNum": 7866, "atom2_serNum": 8807, "donAcc_type": "standard", "distance": 3.277, "atom1_id": "///B/739/NH1", "atom2_id": "///B/873/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1089, "atom1_serNum": 7866, "atom2_serNum": 9410, "donAcc_type": "standard", "distance": 2.810, "atom1_id": "///B/739/NH1", "atom2_id": "///B/950/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1090, "atom1_serNum": 7867, "atom2_serNum": 8808, "donAcc_type": "standard", "distance": 2.637, "atom1_id": "///B/739/NH2", "atom2_id": "///B/873/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1091, "atom1_serNum": 7871, "atom2_serNum": 7900, "donAcc_type": "standard", "distance": 2.924, "atom1_id": "///B/740/O", "atom2_id": "///B/744/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1092, "atom1_serNum": 7873, "atom2_serNum": 9436, "donAcc_type": "acceptable", "distance": 2.897, "atom1_id": "///B/740/OG1", "atom2_id": "///B/953/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1093, "atom1_serNum": 7878, "atom2_serNum": 7908, "donAcc_type": "standard", "distance": 2.906, "atom1_id": "///B/741/O", "atom2_id": "///B/745/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1094, "atom1_serNum": 7882, "atom2_serNum": 7914, "donAcc_type": "standard", "distance": 2.830, "atom1_id": "///B/742/O", "atom2_id": "///B/746/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1095, "atom1_serNum": 7888, "atom2_serNum": 10604, "donAcc_type": "standard", "distance": 2.542, "atom1_id": "///B/742/NE2", "atom2_id": "///W/0/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 1096, "atom1_serNum": 7892, "atom2_serNum": 7922, "donAcc_type": "standard", "distance": 3.128, "atom1_id": "///B/743/O", "atom2_id": "///B/747/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1097, "atom1_serNum": 7903, "atom2_serNum": 7934, "donAcc_type": "standard", "distance": 2.755, "atom1_id": "///B/744/O", "atom2_id": "///B/748/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1098, "atom1_serNum": 7911, "atom2_serNum": 7943, "donAcc_type": "standard", "distance": 3.280, "atom1_id": "///B/745/O", "atom2_id": "///B/749/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1099, "atom1_serNum": 7917, "atom2_serNum": 7954, "donAcc_type": "standard", "distance": 3.035, "atom1_id": "///B/746/O", "atom2_id": "///B/750/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1100, "atom1_serNum": 7925, "atom2_serNum": 7959, "donAcc_type": "standard", "distance": 3.151, "atom1_id": "///B/747/O", "atom2_id": "///B/751/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1101, "atom1_serNum": 7937, "atom2_serNum": 7966, "donAcc_type": "standard", "distance": 3.045, "atom1_id": "///B/748/O", "atom2_id": "///B/752/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1102, "atom1_serNum": 7946, "atom2_serNum": 7977, "donAcc_type": "standard", "distance": 2.881, "atom1_id": "///B/749/O", "atom2_id": "///B/753/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1103, "atom1_serNum": 7952, "atom2_serNum": 11532, "donAcc_type": "standard", "distance": 2.946, "atom1_id": "///B/749/NH1", "atom2_id": "///T/11/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 1104, "atom1_serNum": 7953, "atom2_serNum": 11532, "donAcc_type": "standard", "distance": 2.812, "atom1_id": "///B/749/NH2", "atom2_id": "///T/11/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 1105, "atom1_serNum": 7957, "atom2_serNum": 7985, "donAcc_type": "standard", "distance": 2.783, "atom1_id": "///B/750/O", "atom2_id": "///B/754/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1106, "atom1_serNum": 7962, "atom2_serNum": 7996, "donAcc_type": "standard", "distance": 2.991, "atom1_id": "///B/751/O", "atom2_id": "///B/755/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1107, "atom1_serNum": 7980, "atom2_serNum": 8005, "donAcc_type": "standard", "distance": 3.025, "atom1_id": "///B/753/O", "atom2_id": "///B/756/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1108, "atom1_serNum": 8008, "atom2_serNum": 8024, "donAcc_type": "standard", "distance": 3.337, "atom1_id": "///B/756/O", "atom2_id": "///B/759/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1109, "atom1_serNum": 8008, "atom2_serNum": 8030, "donAcc_type": "standard", "distance": 3.098, "atom1_id": "///B/756/O", "atom2_id": "///B/760/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1110, "atom1_serNum": 8010, "atom2_serNum": 8023, "donAcc_type": "acceptable", "distance": 2.952, "atom1_id": "///B/756/OG", "atom2_id": "///B/758/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1111, "atom1_serNum": 8014, "atom2_serNum": 8030, "donAcc_type": "standard", "distance": 2.753, "atom1_id": "///B/757/O", "atom2_id": "///B/760/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1112, "atom1_serNum": 8033, "atom2_serNum": 8048, "donAcc_type": "standard", "distance": 2.632, "atom1_id": "///B/760/O", "atom2_id": "///B/762/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1113, "atom1_serNum": 8071, "atom2_serNum": 8105, "donAcc_type": "standard", "distance": 2.968, "atom1_id": "///B/764/O", "atom2_id": "///B/767/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1114, "atom1_serNum": 8089, "atom2_serNum": 8106, "donAcc_type": "standard", "distance": 2.425, "atom1_id": "///B/766/O", "atom2_id": "///B/768/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1115, "atom1_serNum": 8089, "atom2_serNum": 8115, "donAcc_type": "standard", "distance": 3.937, "atom1_id": "///B/766/O", "atom2_id": "///B/769/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1116, "atom1_serNum": 8109, "atom2_serNum": 8123, "donAcc_type": "standard", "distance": 3.399, "atom1_id": "///B/768/O", "atom2_id": "///B/770/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1117, "atom1_serNum": 8126, "atom2_serNum": 8139, "donAcc_type": "standard", "distance": 2.676, "atom1_id": "///B/770/O", "atom2_id": "///B/772/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1118, "atom1_serNum": 8133, "atom2_serNum": 8147, "donAcc_type": "standard", "distance": 2.575, "atom1_id": "///B/771/O", "atom2_id": "///B/773/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1119, "atom1_serNum": 8142, "atom2_serNum": 8152, "donAcc_type": "standard", "distance": 3.110, "atom1_id": "///B/772/O", "atom2_id": "///B/774/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1120, "atom1_serNum": 8150, "atom2_serNum": 8159, "donAcc_type": "standard", "distance": 3.004, "atom1_id": "///B/773/O", "atom2_id": "///B/775/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1121, "atom1_serNum": 8166, "atom2_serNum": 9784, "donAcc_type": "questionable", "distance": 3.163, "atom1_id": "///B/775/OE1", "atom2_id": "///B/995/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1122, "atom1_serNum": 8179, "atom2_serNum": 8192, "donAcc_type": "standard", "distance": 3.043, "atom1_id": "///B/777/O", "atom2_id": "///B/779/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1123, "atom1_serNum": 8186, "atom2_serNum": 9837, "donAcc_type": "standard", "distance": 3.139, "atom1_id": "///B/778/O", "atom2_id": "///B/1003/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1124, "atom1_serNum": 8198, "atom2_serNum": 9859, "donAcc_type": "acceptable", "distance": 2.549, "atom1_id": "///B/779/ND1", "atom2_id": "///B/1005/NE2", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 1125, "atom1_serNum": 8202, "atom2_serNum": 9840, "donAcc_type": "standard", "distance": 3.006, "atom1_id": "///B/780/N", "atom2_id": "///B/1003/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1126, "atom1_serNum": 8205, "atom2_serNum": 9850, "donAcc_type": "standard", "distance": 2.747, "atom1_id": "///B/780/O", "atom2_id": "///B/1005/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1127, "atom1_serNum": 8216, "atom2_serNum": 9853, "donAcc_type": "standard", "distance": 2.857, "atom1_id": "///B/782/N", "atom2_id": "///B/1005/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1128, "atom1_serNum": 8219, "atom2_serNum": 9867, "donAcc_type": "standard", "distance": 2.852, "atom1_id": "///B/782/O", "atom2_id": "///B/1007/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1129, "atom1_serNum": 8231, "atom2_serNum": 9870, "donAcc_type": "standard", "distance": 2.903, "atom1_id": "///B/784/N", "atom2_id": "///B/1007/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1130, "atom1_serNum": 8234, "atom2_serNum": 8246, "donAcc_type": "standard", "distance": 3.212, "atom1_id": "///B/784/O", "atom2_id": "///B/786/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1131, "atom1_serNum": 8234, "atom2_serNum": 9879, "donAcc_type": "standard", "distance": 3.143, "atom1_id": "///B/784/O", "atom2_id": "///B/1009/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1132, "atom1_serNum": 8238, "atom2_serNum": 8293, "donAcc_type": "standard", "distance": 2.829, "atom1_id": "///B/785/O", "atom2_id": "///B/798/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1133, "atom1_serNum": 8254, "atom2_serNum": 8278, "donAcc_type": "standard", "distance": 3.131, "atom1_id": "///B/787/N", "atom2_id": "///B/796/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1134, "atom1_serNum": 8269, "atom2_serNum": 10705, "donAcc_type": "standard", "distance": 3.963, "atom1_id": "///B/795/N", "atom2_id": "///W/5/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 1135, "atom1_serNum": 8282, "atom2_serNum": 8326, "donAcc_type": "standard", "distance": 2.923, "atom1_id": "///B/797/N", "atom2_id": "///B/812/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1136, "atom1_serNum": 8285, "atom2_serNum": 8323, "donAcc_type": "standard", "distance": 3.082, "atom1_id": "///B/797/O", "atom2_id": "///B/812/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1137, "atom1_serNum": 8300, "atom2_serNum": 8311, "donAcc_type": "standard", "distance": 3.029, "atom1_id": "///B/799/N", "atom2_id": "///B/810/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1138, "atom1_serNum": 8303, "atom2_serNum": 8308, "donAcc_type": "standard", "distance": 2.719, "atom1_id": "///B/799/O", "atom2_id": "///B/810/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1139, "atom1_serNum": 8329, "atom2_serNum": 8358, "donAcc_type": "standard", "distance": 2.806, "atom1_id": "///B/813/N", "atom2_id": "///B/816/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1140, "atom1_serNum": 8332, "atom2_serNum": 8360, "donAcc_type": "standard", "distance": 3.027, "atom1_id": "///B/813/O", "atom2_id": "///B/817/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1141, "atom1_serNum": 8334, "atom2_serNum": 8342, "donAcc_type": "acceptable", "distance": 3.044, "atom1_id": "///B/813/OG", "atom2_id": "///B/815/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1142, "atom1_serNum": 8334, "atom2_serNum": 8351, "donAcc_type": "acceptable", "distance": 3.125, "atom1_id": "///B/813/OG", "atom2_id": "///B/816/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1143, "atom1_serNum": 8338, "atom2_serNum": 8368, "donAcc_type": "standard", "distance": 3.304, "atom1_id": "///B/814/O", "atom2_id": "///B/818/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1144, "atom1_serNum": 8342, "atom2_serNum": 8349, "donAcc_type": "standard", "distance": 3.153, "atom1_id": "///B/815/N", "atom2_id": "///B/815/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1145, "atom1_serNum": 8345, "atom2_serNum": 8373, "donAcc_type": "standard", "distance": 2.925, "atom1_id": "///B/815/O", "atom2_id": "///B/819/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1146, "atom1_serNum": 8354, "atom2_serNum": 8381, "donAcc_type": "standard", "distance": 3.160, "atom1_id": "///B/816/O", "atom2_id": "///B/820/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1147, "atom1_serNum": 8354, "atom2_serNum": 8418, "donAcc_type": "standard", "distance": 3.986, "atom1_id": "///B/816/O", "atom2_id": "///B/823/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1148, "atom1_serNum": 8363, "atom2_serNum": 8386, "donAcc_type": "standard", "distance": 3.191, "atom1_id": "///B/817/O", "atom2_id": "///B/821/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1149, "atom1_serNum": 8371, "atom2_serNum": 8396, "donAcc_type": "standard", "distance": 2.959, "atom1_id": "///B/818/O", "atom2_id": "///B/822/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1150, "atom1_serNum": 8376, "atom2_serNum": 8408, "donAcc_type": "standard", "distance": 2.876, "atom1_id": "///B/819/O", "atom2_id": "///B/823/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1151, "atom1_serNum": 8384, "atom2_serNum": 8408, "donAcc_type": "standard", "distance": 2.851, "atom1_id": "///B/820/O", "atom2_id": "///B/823/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1152, "atom1_serNum": 8384, "atom2_serNum": 8419, "donAcc_type": "standard", "distance": 3.022, "atom1_id": "///B/820/O", "atom2_id": "///B/824/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1153, "atom1_serNum": 8389, "atom2_serNum": 8430, "donAcc_type": "standard", "distance": 3.015, "atom1_id": "///B/821/O", "atom2_id": "///B/825/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1154, "atom1_serNum": 8389, "atom2_serNum": 8435, "donAcc_type": "acceptable", "distance": 2.927, "atom1_id": "///B/821/O", "atom2_id": "///B/825/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1155, "atom1_serNum": 8399, "atom2_serNum": 8440, "donAcc_type": "standard", "distance": 3.023, "atom1_id": "///B/822/O", "atom2_id": "///B/827/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1156, "atom1_serNum": 8407, "atom2_serNum": 9836, "donAcc_type": "acceptable", "distance": 2.228, "atom1_id": "///B/822/OH", "atom2_id": "///B/1002/OE2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1157, "atom1_serNum": 8411, "atom2_serNum": 8436, "donAcc_type": "standard", "distance": 3.065, "atom1_id": "///B/823/O", "atom2_id": "///B/826/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1158, "atom1_serNum": 8451, "atom2_serNum": 8457, "donAcc_type": "standard", "distance": 2.676, "atom1_id": "///B/828/N", "atom2_id": "///B/828/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1159, "atom1_serNum": 8457, "atom2_serNum": 9535, "donAcc_type": "standard", "distance": 2.897, "atom1_id": "///B/828/OD1", "atom2_id": "///B/966/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1160, "atom1_serNum": 8458, "atom2_serNum": 8467, "donAcc_type": "standard", "distance": 3.308, "atom1_id": "///B/828/OD2", "atom2_id": "///B/829/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1161, "atom1_serNum": 8459, "atom2_serNum": 9516, "donAcc_type": "standard", "distance": 3.322, "atom1_id": "///B/829/N", "atom2_id": "///B/964/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1162, "atom1_serNum": 8462, "atom2_serNum": 9513, "donAcc_type": "standard", "distance": 3.056, "atom1_id": "///B/829/O", "atom2_id": "///B/964/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1163, "atom1_serNum": 8472, "atom2_serNum": 9502, "donAcc_type": "standard", "distance": 2.761, "atom1_id": "///B/831/N", "atom2_id": "///B/962/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1164, "atom1_serNum": 8475, "atom2_serNum": 9499, "donAcc_type": "standard", "distance": 3.006, "atom1_id": "///B/831/O", "atom2_id": "///B/962/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1165, "atom1_serNum": 8486, "atom2_serNum": 9486, "donAcc_type": "acceptable", "distance": 3.336, "atom1_id": "///B/832/ND1", "atom2_id": "///B/960/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1166, "atom1_serNum": 8490, "atom2_serNum": 9486, "donAcc_type": "standard", "distance": 3.090, "atom1_id": "///B/833/N", "atom2_id": "///B/960/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1167, "atom1_serNum": 8493, "atom2_serNum": 8503, "donAcc_type": "standard", "distance": 2.962, "atom1_id": "///B/833/O", "atom2_id": "///B/835/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1168, "atom1_serNum": 8493, "atom2_serNum": 8507, "donAcc_type": "standard", "distance": 2.879, "atom1_id": "///B/833/O", "atom2_id": "///B/836/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1169, "atom1_serNum": 8494, "atom2_serNum": 9486, "donAcc_type": "standard", "distance": 3.101, "atom1_id": "///B/834/N", "atom2_id": "///B/960/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1170, "atom1_serNum": 8502, "atom2_serNum": 9489, "donAcc_type": "questionable", "distance": 2.887, "atom1_id": "///B/834/OE2", "atom2_id": "///B/960/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1171, "atom1_serNum": 8506, "atom2_serNum": 8531, "donAcc_type": "standard", "distance": 2.858, "atom1_id": "///B/835/O", "atom2_id": "///B/839/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1172, "atom1_serNum": 8510, "atom2_serNum": 8537, "donAcc_type": "standard", "distance": 2.779, "atom1_id": "///B/836/O", "atom2_id": "///B/840/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1173, "atom1_serNum": 8512, "atom2_serNum": 9202, "donAcc_type": "acceptable", "distance": 2.729, "atom1_id": "///B/836/OG", "atom2_id": "///B/921/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1174, "atom1_serNum": 8516, "atom2_serNum": 8544, "donAcc_type": "standard", "distance": 3.080, "atom1_id": "///B/837/O", "atom2_id": "///B/841/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1175, "atom1_serNum": 8523, "atom2_serNum": 8552, "donAcc_type": "standard", "distance": 2.819, "atom1_id": "///B/838/O", "atom2_id": "///B/842/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1176, "atom1_serNum": 8534, "atom2_serNum": 8564, "donAcc_type": "standard", "distance": 2.813, "atom1_id": "///B/839/O", "atom2_id": "///B/843/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1177, "atom1_serNum": 8536, "atom2_serNum": 9153, "donAcc_type": "acceptable", "distance": 2.539, "atom1_id": "///B/839/OG", "atom2_id": "///B/916/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1178, "atom1_serNum": 8540, "atom2_serNum": 8568, "donAcc_type": "standard", "distance": 2.682, "atom1_id": "///B/840/O", "atom2_id": "///B/844/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1179, "atom1_serNum": 8547, "atom2_serNum": 8576, "donAcc_type": "standard", "distance": 2.832, "atom1_id": "///B/841/O", "atom2_id": "///B/845/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1180, "atom1_serNum": 8555, "atom2_serNum": 8584, "donAcc_type": "standard", "distance": 2.757, "atom1_id": "///B/842/O", "atom2_id": "///B/846/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1181, "atom1_serNum": 8567, "atom2_serNum": 8592, "donAcc_type": "standard", "distance": 2.947, "atom1_id": "///B/843/O", "atom2_id": "///B/847/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1182, "atom1_serNum": 8571, "atom2_serNum": 9064, "donAcc_type": "acceptable", "distance": 3.006, "atom1_id": "///B/844/O", "atom2_id": "///B/905/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1183, "atom1_serNum": 8579, "atom2_serNum": 8915, "donAcc_type": "standard", "distance": 2.765, "atom1_id": "///B/845/O", "atom2_id": "///B/886/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1184, "atom1_serNum": 8587, "atom2_serNum": 8614, "donAcc_type": "standard", "distance": 2.769, "atom1_id": "///B/846/O", "atom2_id": "///B/849/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1185, "atom1_serNum": 8587, "atom2_serNum": 8622, "donAcc_type": "standard", "distance": 2.921, "atom1_id": "///B/846/O", "atom2_id": "///B/850/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1186, "atom1_serNum": 8595, "atom2_serNum": 8630, "donAcc_type": "standard", "distance": 3.075, "atom1_id": "///B/847/O", "atom2_id": "///B/851/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1187, "atom1_serNum": 8606, "atom2_serNum": 8612, "donAcc_type": "standard", "distance": 2.512, "atom1_id": "///B/848/N", "atom2_id": "///B/848/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1188, "atom1_serNum": 8612, "atom2_serNum": 8915, "donAcc_type": "standard", "distance": 2.989, "atom1_id": "///B/848/OD1", "atom2_id": "///B/886/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1189, "atom1_serNum": 8612, "atom2_serNum": 8916, "donAcc_type": "standard", "distance": 3.102, "atom1_id": "///B/848/OD1", "atom2_id": "///B/886/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1190, "atom1_serNum": 8613, "atom2_serNum": 8916, "donAcc_type": "standard", "distance": 2.579, "atom1_id": "///B/848/OD2", "atom2_id": "///B/886/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1191, "atom1_serNum": 8617, "atom2_serNum": 8857, "donAcc_type": "standard", "distance": 3.523, "atom1_id": "///B/849/O", "atom2_id": "///B/879/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1192, "atom1_serNum": 8664, "atom2_serNum": 8684, "donAcc_type": "standard", "distance": 3.640, "atom1_id": "///B/855/O", "atom2_id": "///B/858/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1193, "atom1_serNum": 8672, "atom2_serNum": 8684, "donAcc_type": "standard", "distance": 2.964, "atom1_id": "///B/856/O", "atom2_id": "///B/858/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1194, "atom1_serNum": 8682, "atom2_serNum": 8711, "donAcc_type": "standard", "distance": 2.476, "atom1_id": "///B/857/OD1", "atom2_id": "///B/860/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1195, "atom1_serNum": 8687, "atom2_serNum": 8740, "donAcc_type": "standard", "distance": 3.082, "atom1_id": "///B/858/O", "atom2_id": "///B/864/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1196, "atom1_serNum": 8687, "atom2_serNum": 8764, "donAcc_type": "standard", "distance": 2.982, "atom1_id": "///B/858/O", "atom2_id": "///B/868/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1197, "atom1_serNum": 8702, "atom2_serNum": 8739, "donAcc_type": "standard", "distance": 2.572, "atom1_id": "///B/860/N", "atom2_id": "///B/864/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1198, "atom1_serNum": 8713, "atom2_serNum": 8739, "donAcc_type": "standard", "distance": 3.164, "atom1_id": "///B/861/N", "atom2_id": "///B/864/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1199, "atom1_serNum": 8740, "atom2_serNum": 8749, "donAcc_type": "standard", "distance": 2.926, "atom1_id": "///B/864/NE2", "atom2_id": "///B/866/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1200, "atom1_serNum": 8744, "atom2_serNum": 9144, "donAcc_type": "standard", "distance": 3.009, "atom1_id": "///B/865/O", "atom2_id": "///B/915/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1201, "atom1_serNum": 8760, "atom2_serNum": 8780, "donAcc_type": "standard", "distance": 2.832, "atom1_id": "///B/867/O", "atom2_id": "///B/870/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1202, "atom1_serNum": 8772, "atom2_serNum": 8778, "donAcc_type": "standard", "distance": 2.816, "atom1_id": "///B/869/N", "atom2_id": "///B/869/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1203, "atom1_serNum": 8775, "atom2_serNum": 8794, "donAcc_type": "standard", "distance": 3.103, "atom1_id": "///B/869/O", "atom2_id": "///B/872/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1204, "atom1_serNum": 8778, "atom2_serNum": 8859, "donAcc_type": "standard", "distance": 3.312, "atom1_id": "///B/869/OD1", "atom2_id": "///B/879/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1205, "atom1_serNum": 8779, "atom2_serNum": 8814, "donAcc_type": "acceptable", "distance": 3.472, "atom1_id": "///B/869/OD2", "atom2_id": "///B/874/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1206, "atom1_serNum": 8779, "atom2_serNum": 8859, "donAcc_type": "standard", "distance": 2.895, "atom1_id": "///B/869/OD2", "atom2_id": "///B/879/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1207, "atom1_serNum": 8804, "atom2_serNum": 8837, "donAcc_type": "standard", "distance": 3.432, "atom1_id": "///B/873/O", "atom2_id": "///B/877/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1208, "atom1_serNum": 8812, "atom2_serNum": 8844, "donAcc_type": "standard", "distance": 2.743, "atom1_id": "///B/874/O", "atom2_id": "///B/878/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1209, "atom1_serNum": 8812, "atom2_serNum": 8849, "donAcc_type": "acceptable", "distance": 3.162, "atom1_id": "///B/874/O", "atom2_id": "///B/878/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1210, "atom1_serNum": 8818, "atom2_serNum": 8859, "donAcc_type": "standard", "distance": 3.331, "atom1_id": "///B/875/O", "atom2_id": "///B/879/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1211, "atom1_serNum": 8829, "atom2_serNum": 8850, "donAcc_type": "standard", "distance": 2.984, "atom1_id": "///B/876/O", "atom2_id": "///B/879/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1212, "atom1_serNum": 8829, "atom2_serNum": 8861, "donAcc_type": "standard", "distance": 2.870, "atom1_id": "///B/876/O", "atom2_id": "///B/880/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1213, "atom1_serNum": 8840, "atom2_serNum": 8861, "donAcc_type": "standard", "distance": 3.284, "atom1_id": "///B/877/O", "atom2_id": "///B/880/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1214, "atom1_serNum": 8853, "atom2_serNum": 8884, "donAcc_type": "standard", "distance": 2.938, "atom1_id": "///B/879/O", "atom2_id": "///B/883/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1215, "atom1_serNum": 8864, "atom2_serNum": 8892, "donAcc_type": "standard", "distance": 2.736, "atom1_id": "///B/880/O", "atom2_id": "///B/884/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1216, "atom1_serNum": 8870, "atom2_serNum": 8900, "donAcc_type": "standard", "distance": 3.876, "atom1_id": "///B/880/NH1", "atom2_id": "///B/884/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1217, "atom1_serNum": 8875, "atom2_serNum": 8901, "donAcc_type": "standard", "distance": 3.079, "atom1_id": "///B/881/O", "atom2_id": "///B/885/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1218, "atom1_serNum": 8882, "atom2_serNum": 8906, "donAcc_type": "standard", "distance": 3.014, "atom1_id": "///B/882/O", "atom2_id": "///B/886/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1219, "atom1_serNum": 8887, "atom2_serNum": 8917, "donAcc_type": "standard", "distance": 2.955, "atom1_id": "///B/883/O", "atom2_id": "///B/887/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1220, "atom1_serNum": 8895, "atom2_serNum": 8925, "donAcc_type": "standard", "distance": 3.175, "atom1_id": "///B/884/O", "atom2_id": "///B/888/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1221, "atom1_serNum": 8899, "atom2_serNum": 9373, "donAcc_type": "standard", "distance": 3.126, "atom1_id": "///B/884/OE1", "atom2_id": "///B/945/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1222, "atom1_serNum": 8899, "atom2_serNum": 9374, "donAcc_type": "standard", "distance": 3.016, "atom1_id": "///B/884/OE1", "atom2_id": "///B/945/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1223, "atom1_serNum": 8900, "atom2_serNum": 9373, "donAcc_type": "standard", "distance": 3.332, "atom1_id": "///B/884/OE2", "atom2_id": "///B/945/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1224, "atom1_serNum": 8904, "atom2_serNum": 8925, "donAcc_type": "standard", "distance": 2.997, "atom1_id": "///B/885/O", "atom2_id": "///B/888/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1225, "atom1_serNum": 8904, "atom2_serNum": 8934, "donAcc_type": "standard", "distance": 2.960, "atom1_id": "///B/885/O", "atom2_id": "///B/889/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1226, "atom1_serNum": 8909, "atom2_serNum": 8942, "donAcc_type": "standard", "distance": 2.978, "atom1_id": "///B/886/O", "atom2_id": "///B/890/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1227, "atom1_serNum": 8920, "atom2_serNum": 8950, "donAcc_type": "standard", "distance": 3.186, "atom1_id": "///B/887/O", "atom2_id": "///B/891/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1228, "atom1_serNum": 8920, "atom2_serNum": 9346, "donAcc_type": "acceptable", "distance": 3.039, "atom1_id": "///B/887/O", "atom2_id": "///B/941/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1229, "atom1_serNum": 8928, "atom2_serNum": 8960, "donAcc_type": "standard", "distance": 3.011, "atom1_id": "///B/888/O", "atom2_id": "///B/892/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1230, "atom1_serNum": 8933, "atom2_serNum": 8966, "donAcc_type": "standard", "distance": 3.092, "atom1_id": "///B/888/NE2", "atom2_id": "///B/892/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1231, "atom1_serNum": 8933, "atom2_serNum": 8967, "donAcc_type": "standard", "distance": 2.576, "atom1_id": "///B/888/NE2", "atom2_id": "///B/892/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1232, "atom1_serNum": 8937, "atom2_serNum": 8968, "donAcc_type": "standard", "distance": 2.818, "atom1_id": "///B/889/O", "atom2_id": "///B/893/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1233, "atom1_serNum": 8956, "atom2_serNum": 8966, "donAcc_type": "acceptable", "distance": 3.080, "atom1_id": "///B/891/ND1", "atom2_id": "///B/892/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1234, "atom1_serNum": 8976, "atom2_serNum": 8989, "donAcc_type": "standard", "distance": 2.772, "atom1_id": "///B/894/O", "atom2_id": "///B/896/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1235, "atom1_serNum": 8976, "atom2_serNum": 8998, "donAcc_type": "standard", "distance": 3.108, "atom1_id": "///B/894/O", "atom2_id": "///B/897/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1236, "atom1_serNum": 8976, "atom2_serNum": 9004, "donAcc_type": "standard", "distance": 3.387, "atom1_id": "///B/894/O", "atom2_id": "///B/898/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1237, "atom1_serNum": 8987, "atom2_serNum": 9296, "donAcc_type": "acceptable", "distance": 3.106, "atom1_id": "///B/895/OE1", "atom2_id": "///B/933/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1238, "atom1_serNum": 8992, "atom2_serNum": 9023, "donAcc_type": "standard", "distance": 2.609, "atom1_id": "///B/896/O", "atom2_id": "///B/900/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1239, "atom1_serNum": 9001, "atom2_serNum": 9028, "donAcc_type": "standard", "distance": 2.655, "atom1_id": "///B/897/O", "atom2_id": "///B/901/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1240, "atom1_serNum": 9007, "atom2_serNum": 9028, "donAcc_type": "standard", "distance": 2.861, "atom1_id": "///B/898/O", "atom2_id": "///B/901/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1241, "atom1_serNum": 9007, "atom2_serNum": 9042, "donAcc_type": "standard", "distance": 2.962, "atom1_id": "///B/898/O", "atom2_id": "///B/902/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1242, "atom1_serNum": 9015, "atom2_serNum": 9049, "donAcc_type": "standard", "distance": 3.294, "atom1_id": "///B/899/O", "atom2_id": "///B/903/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1243, "atom1_serNum": 9015, "atom2_serNum": 9267, "donAcc_type": "standard", "distance": 2.700, "atom1_id": "///B/899/O", "atom2_id": "///B/929/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1244, "atom1_serNum": 9021, "atom2_serNum": 9296, "donAcc_type": "acceptable", "distance": 2.710, "atom1_id": "///B/899/NH1", "atom2_id": "///B/933/OG", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1245, "atom1_serNum": 9022, "atom2_serNum": 9244, "donAcc_type": "questionable", "distance": 2.812, "atom1_id": "///B/899/NH2", "atom2_id": "///B/926/NE2", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 1246, "atom1_serNum": 9022, "atom2_serNum": 9274, "donAcc_type": "standard", "distance": 3.396, "atom1_id": "///B/899/NH2", "atom2_id": "///B/930/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1247, "atom1_serNum": 9026, "atom2_serNum": 9054, "donAcc_type": "standard", "distance": 2.989, "atom1_id": "///B/900/O", "atom2_id": "///B/904/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1248, "atom1_serNum": 9031, "atom2_serNum": 9059, "donAcc_type": "standard", "distance": 3.243, "atom1_id": "///B/901/O", "atom2_id": "///B/905/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1249, "atom1_serNum": 9031, "atom2_serNum": 9064, "donAcc_type": "acceptable", "distance": 3.173, "atom1_id": "///B/901/O", "atom2_id": "///B/905/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1250, "atom1_serNum": 9045, "atom2_serNum": 9066, "donAcc_type": "standard", "distance": 2.892, "atom1_id": "///B/902/O", "atom2_id": "///B/906/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1251, "atom1_serNum": 9052, "atom2_serNum": 9080, "donAcc_type": "standard", "distance": 2.957, "atom1_id": "///B/903/O", "atom2_id": "///B/907/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1252, "atom1_serNum": 9057, "atom2_serNum": 9090, "donAcc_type": "standard", "distance": 2.999, "atom1_id": "///B/904/O", "atom2_id": "///B/908/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1253, "atom1_serNum": 9062, "atom2_serNum": 9099, "donAcc_type": "standard", "distance": 2.671, "atom1_id": "///B/905/O", "atom2_id": "///B/909/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1254, "atom1_serNum": 9069, "atom2_serNum": 9108, "donAcc_type": "standard", "distance": 2.842, "atom1_id": "///B/906/O", "atom2_id": "///B/910/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1255, "atom1_serNum": 9074, "atom2_serNum": 9116, "donAcc_type": "standard", "distance": 3.026, "atom1_id": "///B/906/NE1", "atom2_id": "///B/910/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1256, "atom1_serNum": 9102, "atom2_serNum": 9121, "donAcc_type": "standard", "distance": 2.920, "atom1_id": "///B/909/O", "atom2_id": "///B/912/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1257, "atom1_serNum": 9106, "atom2_serNum": 9130, "donAcc_type": "standard", "distance": 3.294, "atom1_id": "///B/909/OE1", "atom2_id": "///B/912/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1258, "atom1_serNum": 9124, "atom2_serNum": 9139, "donAcc_type": "standard", "distance": 3.359, "atom1_id": "///B/912/O", "atom2_id": "///B/914/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1259, "atom1_serNum": 9124, "atom2_serNum": 9179, "donAcc_type": "standard", "distance": 2.511, "atom1_id": "///B/912/O", "atom2_id": "///B/919/NE1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1260, "atom1_serNum": 9142, "atom2_serNum": 9158, "donAcc_type": "standard", "distance": 2.935, "atom1_id": "///B/914/O", "atom2_id": "///B/917/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1261, "atom1_serNum": 9168, "atom2_serNum": 9193, "donAcc_type": "standard", "distance": 2.973, "atom1_id": "///B/918/O", "atom2_id": "///B/921/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1262, "atom1_serNum": 9185, "atom2_serNum": 9191, "donAcc_type": "standard", "distance": 2.820, "atom1_id": "///B/920/N", "atom2_id": "///B/920/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1263, "atom1_serNum": 9196, "atom2_serNum": 9200, "donAcc_type": "standard", "distance": 2.986, "atom1_id": "///B/921/O", "atom2_id": "///B/921/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1264, "atom1_serNum": 9215, "atom2_serNum": 9252, "donAcc_type": "standard", "distance": 2.852, "atom1_id": "///B/923/N", "atom2_id": "///B/927/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1265, "atom1_serNum": 9225, "atom2_serNum": 9245, "donAcc_type": "standard", "distance": 2.909, "atom1_id": "///B/924/O", "atom2_id": "///B/927/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1266, "atom1_serNum": 9225, "atom2_serNum": 9254, "donAcc_type": "standard", "distance": 3.469, "atom1_id": "///B/924/O", "atom2_id": "///B/928/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1267, "atom1_serNum": 9231, "atom2_serNum": 9259, "donAcc_type": "standard", "distance": 3.100, "atom1_id": "///B/925/O", "atom2_id": "///B/929/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1268, "atom1_serNum": 9239, "atom2_serNum": 9244, "donAcc_type": "standard", "distance": 2.974, "atom1_id": "///B/926/O", "atom2_id": "///B/926/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1269, "atom1_serNum": 9239, "atom2_serNum": 9268, "donAcc_type": "standard", "distance": 3.055, "atom1_id": "///B/926/O", "atom2_id": "///B/930/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1270, "atom1_serNum": 9244, "atom2_serNum": 9274, "donAcc_type": "standard", "distance": 3.032, "atom1_id": "///B/926/NE2", "atom2_id": "///B/930/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1271, "atom1_serNum": 9248, "atom2_serNum": 9276, "donAcc_type": "standard", "distance": 2.980, "atom1_id": "///B/927/O", "atom2_id": "///B/931/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1272, "atom1_serNum": 9257, "atom2_serNum": 9284, "donAcc_type": "standard", "distance": 3.002, "atom1_id": "///B/928/O", "atom2_id": "///B/932/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1273, "atom1_serNum": 9262, "atom2_serNum": 9291, "donAcc_type": "standard", "distance": 3.083, "atom1_id": "///B/929/O", "atom2_id": "///B/933/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1274, "atom1_serNum": 9262, "atom2_serNum": 9296, "donAcc_type": "acceptable", "distance": 2.905, "atom1_id": "///B/929/O", "atom2_id": "///B/933/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1275, "atom1_serNum": 9271, "atom2_serNum": 9297, "donAcc_type": "standard", "distance": 3.098, "atom1_id": "///B/930/O", "atom2_id": "///B/934/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1276, "atom1_serNum": 9279, "atom2_serNum": 9297, "donAcc_type": "standard", "distance": 2.836, "atom1_id": "///B/931/O", "atom2_id": "///B/934/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1277, "atom1_serNum": 9279, "atom2_serNum": 9303, "donAcc_type": "standard", "distance": 2.776, "atom1_id": "///B/931/O", "atom2_id": "///B/935/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1278, "atom1_serNum": 9287, "atom2_serNum": 9311, "donAcc_type": "standard", "distance": 2.766, "atom1_id": "///B/932/O", "atom2_id": "///B/936/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1279, "atom1_serNum": 9314, "atom2_serNum": 9326, "donAcc_type": "standard", "distance": 3.134, "atom1_id": "///B/936/O", "atom2_id": "///B/939/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1280, "atom1_serNum": 9314, "atom2_serNum": 9333, "donAcc_type": "standard", "distance": 3.206, "atom1_id": "///B/936/O", "atom2_id": "///B/940/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1281, "atom1_serNum": 9318, "atom2_serNum": 9341, "donAcc_type": "standard", "distance": 2.738, "atom1_id": "///B/937/O", "atom2_id": "///B/941/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1282, "atom1_serNum": 9322, "atom2_serNum": 9347, "donAcc_type": "standard", "distance": 3.006, "atom1_id": "///B/938/O", "atom2_id": "///B/942/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1283, "atom1_serNum": 9329, "atom2_serNum": 9351, "donAcc_type": "standard", "distance": 3.095, "atom1_id": "///B/939/O", "atom2_id": "///B/943/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1284, "atom1_serNum": 9336, "atom2_serNum": 9358, "donAcc_type": "standard", "distance": 3.251, "atom1_id": "///B/940/O", "atom2_id": "///B/944/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1285, "atom1_serNum": 9344, "atom2_serNum": 9364, "donAcc_type": "standard", "distance": 2.846, "atom1_id": "///B/941/O", "atom2_id": "///B/945/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1286, "atom1_serNum": 9350, "atom2_serNum": 9375, "donAcc_type": "standard", "distance": 3.266, "atom1_id": "///B/942/O", "atom2_id": "///B/946/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1287, "atom1_serNum": 9354, "atom2_serNum": 9385, "donAcc_type": "standard", "distance": 3.039, "atom1_id": "///B/943/O", "atom2_id": "///B/947/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1288, "atom1_serNum": 9361, "atom2_serNum": 9393, "donAcc_type": "standard", "distance": 3.051, "atom1_id": "///B/944/O", "atom2_id": "///B/948/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1289, "atom1_serNum": 9367, "atom2_serNum": 9398, "donAcc_type": "standard", "distance": 2.860, "atom1_id": "///B/945/O", "atom2_id": "///B/949/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1290, "atom1_serNum": 9378, "atom2_serNum": 9403, "donAcc_type": "standard", "distance": 2.796, "atom1_id": "///B/946/O", "atom2_id": "///B/950/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1291, "atom1_serNum": 9406, "atom2_serNum": 9443, "donAcc_type": "standard", "distance": 2.954, "atom1_id": "///B/950/O", "atom2_id": "///B/954/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1292, "atom1_serNum": 9409, "atom2_serNum": 9433, "donAcc_type": "standard", "distance": 2.916, "atom1_id": "///B/950/OD1", "atom2_id": "///B/953/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1293, "atom1_serNum": 9414, "atom2_serNum": 9443, "donAcc_type": "standard", "distance": 2.987, "atom1_id": "///B/951/O", "atom2_id": "///B/954/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1294, "atom1_serNum": 9414, "atom2_serNum": 9449, "donAcc_type": "standard", "distance": 2.745, "atom1_id": "///B/951/O", "atom2_id": "///B/955/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1295, "atom1_serNum": 9425, "atom2_serNum": 9431, "donAcc_type": "standard", "distance": 3.265, "atom1_id": "///B/952/O", "atom2_id": "///B/952/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1296, "atom1_serNum": 9425, "atom2_serNum": 9459, "donAcc_type": "standard", "distance": 3.666, "atom1_id": "///B/952/O", "atom2_id": "///B/955/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1297, "atom1_serNum": 9432, "atom2_serNum": 10605, "donAcc_type": "standard", "distance": 3.358, "atom1_id": "///B/952/NH2", "atom2_id": "///W/0/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 1298, "atom1_serNum": 9446, "atom2_serNum": 9741, "donAcc_type": "standard", "distance": 2.812, "atom1_id": "///B/954/O", "atom2_id": "///B/990/NE1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1299, "atom1_serNum": 9483, "atom2_serNum": 9619, "donAcc_type": "standard", "distance": 3.357, "atom1_id": "///B/960/N", "atom2_id": "///B/975/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1300, "atom1_serNum": 9490, "atom2_serNum": 9621, "donAcc_type": "standard", "distance": 2.927, "atom1_id": "///B/960/OD2", "atom2_id": "///B/976/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1301, "atom1_serNum": 9491, "atom2_serNum": 9608, "donAcc_type": "standard", "distance": 2.899, "atom1_id": "///B/961/N", "atom2_id": "///B/974/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1302, "atom1_serNum": 9494, "atom2_serNum": 9605, "donAcc_type": "standard", "distance": 2.999, "atom1_id": "///B/961/O", "atom2_id": "///B/974/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1303, "atom1_serNum": 9506, "atom2_serNum": 9591, "donAcc_type": "standard", "distance": 2.952, "atom1_id": "///B/963/N", "atom2_id": "///B/972/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1304, "atom1_serNum": 9509, "atom2_serNum": 9588, "donAcc_type": "standard", "distance": 2.600, "atom1_id": "///B/963/O", "atom2_id": "///B/972/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1305, "atom1_serNum": 9527, "atom2_serNum": 9570, "donAcc_type": "standard", "distance": 2.645, "atom1_id": "///B/965/N", "atom2_id": "///B/970/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1306, "atom1_serNum": 9530, "atom2_serNum": 9556, "donAcc_type": "standard", "distance": 2.912, "atom1_id": "///B/965/O", "atom2_id": "///B/969/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1307, "atom1_serNum": 9533, "atom2_serNum": 9535, "donAcc_type": "standard", "distance": 2.838, "atom1_id": "///B/965/OD1", "atom2_id": "///B/966/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1308, "atom1_serNum": 9533, "atom2_serNum": 9541, "donAcc_type": "standard", "distance": 3.221, "atom1_id": "///B/965/OD1", "atom2_id": "///B/967/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1309, "atom1_serNum": 9538, "atom2_serNum": 9563, "donAcc_type": "standard", "distance": 3.652, "atom1_id": "///B/966/O", "atom2_id": "///B/969/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1310, "atom1_serNum": 9596, "atom2_serNum": 9835, "donAcc_type": "standard", "distance": 3.045, "atom1_id": "///B/972/NZ", "atom2_id": "///B/1002/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1311, "atom1_serNum": 9597, "atom2_serNum": 9815, "donAcc_type": "standard", "distance": 2.825, "atom1_id": "///B/973/N", "atom2_id": "///B/1000/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1312, "atom1_serNum": 9600, "atom2_serNum": 9828, "donAcc_type": "standard", "distance": 3.096, "atom1_id": "///B/973/O", "atom2_id": "///B/1002/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1313, "atom1_serNum": 9612, "atom2_serNum": 9831, "donAcc_type": "standard", "distance": 2.910, "atom1_id": "///B/975/N", "atom2_id": "///B/1002/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1314, "atom1_serNum": 9615, "atom2_serNum": 9844, "donAcc_type": "standard", "distance": 2.960, "atom1_id": "///B/975/O", "atom2_id": "///B/1004/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1315, "atom1_serNum": 9620, "atom2_serNum": 9636, "donAcc_type": "standard", "distance": 2.357, "atom1_id": "///B/975/OE2", "atom2_id": "///B/977/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1316, "atom1_serNum": 9628, "atom2_serNum": 9847, "donAcc_type": "standard", "distance": 3.368, "atom1_id": "///B/977/N", "atom2_id": "///B/1004/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1317, "atom1_serNum": 9631, "atom2_serNum": 9860, "donAcc_type": "standard", "distance": 3.214, "atom1_id": "///B/977/O", "atom2_id": "///B/1006/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1318, "atom1_serNum": 9636, "atom2_serNum": 9663, "donAcc_type": "standard", "distance": 2.430, "atom1_id": "///B/977/NZ", "atom2_id": "///B/981/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1319, "atom1_serNum": 9636, "atom2_serNum": 9716, "donAcc_type": "questionable", "distance": 3.191, "atom1_id": "///B/977/NZ", "atom2_id": "///B/987/NE2", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 1320, "atom1_serNum": 9637, "atom2_serNum": 9662, "donAcc_type": "standard", "distance": 3.383, "atom1_id": "///B/978/N", "atom2_id": "///B/981/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1321, "atom1_serNum": 9655, "atom2_serNum": 10727, "donAcc_type": "standard", "distance": 3.602, "atom1_id": "///B/980/ND2", "atom2_id": "///W/6/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 1322, "atom1_serNum": 9663, "atom2_serNum": 9667, "donAcc_type": "questionable", "distance": 3.187, "atom1_id": "///B/981/OD2", "atom2_id": "///B/982/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1323, "atom1_serNum": 9674, "atom2_serNum": 11511, "donAcc_type": "standard", "distance": 2.818, "atom1_id": "///B/982/NH2", "atom2_id": "///T/10/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 1324, "atom1_serNum": 9683, "atom2_serNum": 9715, "donAcc_type": "standard", "distance": 3.037, "atom1_id": "///B/984/N", "atom2_id": "///B/987/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1325, "atom1_serNum": 9686, "atom2_serNum": 9717, "donAcc_type": "standard", "distance": 3.143, "atom1_id": "///B/984/O", "atom2_id": "///B/988/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1326, "atom1_serNum": 9692, "atom2_serNum": 9717, "donAcc_type": "standard", "distance": 2.943, "atom1_id": "///B/985/O", "atom2_id": "///B/988/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1327, "atom1_serNum": 9692, "atom2_serNum": 9725, "donAcc_type": "standard", "distance": 3.035, "atom1_id": "///B/985/O", "atom2_id": "///B/989/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1328, "atom1_serNum": 9702, "atom2_serNum": 9725, "donAcc_type": "standard", "distance": 3.215, "atom1_id": "///B/986/O", "atom2_id": "///B/989/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1329, "atom1_serNum": 9702, "atom2_serNum": 9733, "donAcc_type": "standard", "distance": 3.116, "atom1_id": "///B/986/O", "atom2_id": "///B/990/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1330, "atom1_serNum": 9707, "atom2_serNum": 10602, "donAcc_type": "acceptable", "distance": 3.073, "atom1_id": "///B/986/NZ", "atom2_id": "///W/0/OP3", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 1331, "atom1_serNum": 9707, "atom2_serNum": 10645, "donAcc_type": "standard", "distance": 3.129, "atom1_id": "///B/986/NZ", "atom2_id": "///W/2/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 1332, "atom1_serNum": 9711, "atom2_serNum": 9747, "donAcc_type": "standard", "distance": 3.087, "atom1_id": "///B/987/O", "atom2_id": "///B/991/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1333, "atom1_serNum": 9720, "atom2_serNum": 9755, "donAcc_type": "standard", "distance": 3.282, "atom1_id": "///B/988/O", "atom2_id": "///B/992/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1334, "atom1_serNum": 9728, "atom2_serNum": 9760, "donAcc_type": "standard", "distance": 2.799, "atom1_id": "///B/989/O", "atom2_id": "///B/993/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1335, "atom1_serNum": 9736, "atom2_serNum": 9769, "donAcc_type": "standard", "distance": 2.656, "atom1_id": "///B/990/O", "atom2_id": "///B/994/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1336, "atom1_serNum": 9750, "atom2_serNum": 9777, "donAcc_type": "standard", "distance": 2.924, "atom1_id": "///B/991/O", "atom2_id": "///B/995/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1337, "atom1_serNum": 9758, "atom2_serNum": 9786, "donAcc_type": "standard", "distance": 2.986, "atom1_id": "///B/992/O", "atom2_id": "///B/996/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1338, "atom1_serNum": 9763, "atom2_serNum": 9795, "donAcc_type": "standard", "distance": 3.245, "atom1_id": "///B/993/O", "atom2_id": "///B/997/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1339, "atom1_serNum": 9772, "atom2_serNum": 9807, "donAcc_type": "standard", "distance": 3.141, "atom1_id": "///B/994/O", "atom2_id": "///B/999/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1340, "atom1_serNum": 9780, "atom2_serNum": 9803, "donAcc_type": "standard", "distance": 2.440, "atom1_id": "///B/995/O", "atom2_id": "///B/998/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1341, "atom1_serNum": 9780, "atom2_serNum": 9807, "donAcc_type": "standard", "distance": 3.642, "atom1_id": "///B/995/O", "atom2_id": "///B/999/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1342, "atom1_serNum": 9810, "atom2_serNum": 9821, "donAcc_type": "standard", "distance": 3.059, "atom1_id": "///B/999/O", "atom2_id": "///B/1001/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1343, "atom1_serNum": 9887, "atom2_serNum": 9930, "donAcc_type": "acceptable", "distance": 3.006, "atom1_id": "///S/0/OP3", "atom2_id": "///S/2/OP1", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 1344, "atom1_serNum": 9924, "atom2_serNum": 10882, "donAcc_type": "standard", "distance": 2.668, "atom1_id": "///S/1/N6", "atom2_id": "///X/3/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1345, "atom1_serNum": 9925, "atom2_serNum": 10880, "donAcc_type": "standard", "distance": 2.846, "atom1_id": "///S/1/N1", "atom2_id": "///X/3/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1346, "atom1_serNum": 9945, "atom2_serNum": 10863, "donAcc_type": "standard", "distance": 2.751, "atom1_id": "///S/2/O6", "atom2_id": "///X/2/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1347, "atom1_serNum": 9946, "atom2_serNum": 10861, "donAcc_type": "standard", "distance": 2.684, "atom1_id": "///S/2/N1", "atom2_id": "///X/2/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1348, "atom1_serNum": 9948, "atom2_serNum": 10860, "donAcc_type": "standard", "distance": 2.573, "atom1_id": "///S/2/N2", "atom2_id": "///X/2/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1349, "atom1_serNum": 9964, "atom2_serNum": 10844, "donAcc_type": "standard", "distance": 2.347, "atom1_id": "///S/3/O2", "atom2_id": "///X/1/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1350, "atom1_serNum": 9965, "atom2_serNum": 10842, "donAcc_type": "standard", "distance": 2.495, "atom1_id": "///S/3/N3", "atom2_id": "///X/1/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1351, "atom1_serNum": 9967, "atom2_serNum": 10841, "donAcc_type": "standard", "distance": 2.694, "atom1_id": "///S/3/N4", "atom2_id": "///X/1/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1352, "atom1_serNum": 9983, "atom2_serNum": 11462, "donAcc_type": "standard", "distance": 2.493, "atom1_id": "///S/4/O2", "atom2_id": "///Y/14/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1353, "atom1_serNum": 9984, "atom2_serNum": 11460, "donAcc_type": "standard", "distance": 2.598, "atom1_id": "///S/4/N3", "atom2_id": "///Y/14/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1354, "atom1_serNum": 9986, "atom2_serNum": 11459, "donAcc_type": "standard", "distance": 2.575, "atom1_id": "///S/4/N4", "atom2_id": "///Y/14/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1355, "atom1_serNum": 10005, "atom2_serNum": 11439, "donAcc_type": "standard", "distance": 2.489, "atom1_id": "///S/5/N6", "atom2_id": "///Y/13/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1356, "atom1_serNum": 10006, "atom2_serNum": 11437, "donAcc_type": "standard", "distance": 2.535, "atom1_id": "///S/5/N1", "atom2_id": "///Y/13/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1357, "atom1_serNum": 10023, "atom2_serNum": 11420, "donAcc_type": "standard", "distance": 2.729, "atom1_id": "///S/6/O2", "atom2_id": "///Y/12/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1358, "atom1_serNum": 10024, "atom2_serNum": 11418, "donAcc_type": "standard", "distance": 2.892, "atom1_id": "///S/6/N3", "atom2_id": "///Y/12/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1359, "atom1_serNum": 10026, "atom2_serNum": 11417, "donAcc_type": "standard", "distance": 2.925, "atom1_id": "///S/6/N4", "atom2_id": "///Y/12/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1360, "atom1_serNum": 10045, "atom2_serNum": 11398, "donAcc_type": "standard", "distance": 2.842, "atom1_id": "///S/7/O6", "atom2_id": "///Y/11/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1361, "atom1_serNum": 10046, "atom2_serNum": 11396, "donAcc_type": "standard", "distance": 2.910, "atom1_id": "///S/7/N1", "atom2_id": "///Y/11/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1362, "atom1_serNum": 10048, "atom2_serNum": 11395, "donAcc_type": "standard", "distance": 2.834, "atom1_id": "///S/7/N2", "atom2_id": "///Y/11/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1363, "atom1_serNum": 10064, "atom2_serNum": 11379, "donAcc_type": "standard", "distance": 2.980, "atom1_id": "///S/8/O2", "atom2_id": "///Y/10/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1364, "atom1_serNum": 10065, "atom2_serNum": 11377, "donAcc_type": "standard", "distance": 2.870, "atom1_id": "///S/8/N3", "atom2_id": "///Y/10/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1365, "atom1_serNum": 10067, "atom2_serNum": 11376, "donAcc_type": "standard", "distance": 2.669, "atom1_id": "///S/8/N4", "atom2_id": "///Y/10/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1366, "atom1_serNum": 10083, "atom2_serNum": 11357, "donAcc_type": "standard", "distance": 2.731, "atom1_id": "///S/9/O2", "atom2_id": "///Y/9/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1367, "atom1_serNum": 10084, "atom2_serNum": 11355, "donAcc_type": "standard", "distance": 2.952, "atom1_id": "///S/9/N3", "atom2_id": "///Y/9/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1368, "atom1_serNum": 10084, "atom2_serNum": 11357, "donAcc_type": "standard", "distance": 3.127, "atom1_id": "///S/9/N3", "atom2_id": "///Y/9/N2", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1369, "atom1_serNum": 10086, "atom2_serNum": 11354, "donAcc_type": "standard", "distance": 3.034, "atom1_id": "///S/9/N4", "atom2_id": "///Y/9/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1370, "atom1_serNum": 10103, "atom2_serNum": 11334, "donAcc_type": "standard", "distance": 2.721, "atom1_id": "///S/10/N3", "atom2_id": "///Y/8/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1371, "atom1_serNum": 10105, "atom2_serNum": 11333, "donAcc_type": "standard", "distance": 2.656, "atom1_id": "///S/10/O4", "atom2_id": "///Y/8/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1372, "atom1_serNum": 10126, "atom2_serNum": 10597, "donAcc_type": "standard", "distance": 2.382, "atom1_id": "///U/11/N6", "atom2_id": "///V/12/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1373, "atom1_serNum": 10127, "atom2_serNum": 10595, "donAcc_type": "standard", "distance": 2.644, "atom1_id": "///U/11/N1", "atom2_id": "///V/12/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1374, "atom1_serNum": 10147, "atom2_serNum": 10578, "donAcc_type": "standard", "distance": 3.083, "atom1_id": "///U/12/O6", "atom2_id": "///V/11/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1375, "atom1_serNum": 10148, "atom2_serNum": 10576, "donAcc_type": "standard", "distance": 2.751, "atom1_id": "///U/12/N1", "atom2_id": "///V/11/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1376, "atom1_serNum": 10150, "atom2_serNum": 10575, "donAcc_type": "standard", "distance": 2.400, "atom1_id": "///U/12/N2", "atom2_id": "///V/11/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1377, "atom1_serNum": 10169, "atom2_serNum": 10558, "donAcc_type": "standard", "distance": 2.638, "atom1_id": "///U/13/N6", "atom2_id": "///V/10/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1378, "atom1_serNum": 10170, "atom2_serNum": 10556, "donAcc_type": "standard", "distance": 2.639, "atom1_id": "///U/13/N1", "atom2_id": "///V/10/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1379, "atom1_serNum": 10187, "atom2_serNum": 10539, "donAcc_type": "standard", "distance": 2.849, "atom1_id": "///U/14/O2", "atom2_id": "///V/9/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1380, "atom1_serNum": 10188, "atom2_serNum": 10537, "donAcc_type": "standard", "distance": 2.840, "atom1_id": "///U/14/N3", "atom2_id": "///V/9/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1381, "atom1_serNum": 10190, "atom2_serNum": 10536, "donAcc_type": "standard", "distance": 2.740, "atom1_id": "///U/14/N4", "atom2_id": "///V/9/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1382, "atom1_serNum": 10207, "atom2_serNum": 10516, "donAcc_type": "standard", "distance": 2.960, "atom1_id": "///U/15/N3", "atom2_id": "///V/8/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1383, "atom1_serNum": 10209, "atom2_serNum": 10515, "donAcc_type": "standard", "distance": 2.850, "atom1_id": "///U/15/O4", "atom2_id": "///V/8/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1384, "atom1_serNum": 10226, "atom2_serNum": 10496, "donAcc_type": "standard", "distance": 2.732, "atom1_id": "///U/16/O2", "atom2_id": "///V/7/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1385, "atom1_serNum": 10227, "atom2_serNum": 10494, "donAcc_type": "standard", "distance": 2.775, "atom1_id": "///U/16/N3", "atom2_id": "///V/7/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1386, "atom1_serNum": 10229, "atom2_serNum": 10493, "donAcc_type": "standard", "distance": 2.743, "atom1_id": "///U/16/N4", "atom2_id": "///V/7/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1387, "atom1_serNum": 10245, "atom2_serNum": 10474, "donAcc_type": "standard", "distance": 2.669, "atom1_id": "///U/17/O2", "atom2_id": "///V/6/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1388, "atom1_serNum": 10246, "atom2_serNum": 10472, "donAcc_type": "standard", "distance": 2.927, "atom1_id": "///U/17/N3", "atom2_id": "///V/6/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1389, "atom1_serNum": 10246, "atom2_serNum": 10474, "donAcc_type": "standard", "distance": 3.095, "atom1_id": "///U/17/N3", "atom2_id": "///V/6/N2", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1390, "atom1_serNum": 10248, "atom2_serNum": 10471, "donAcc_type": "standard", "distance": 3.066, "atom1_id": "///U/17/N4", "atom2_id": "///V/6/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1391, "atom1_serNum": 10265, "atom2_serNum": 10451, "donAcc_type": "standard", "distance": 3.077, "atom1_id": "///U/18/N3", "atom2_id": "///V/5/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1392, "atom1_serNum": 10267, "atom2_serNum": 10450, "donAcc_type": "standard", "distance": 3.154, "atom1_id": "///U/18/O4", "atom2_id": "///V/5/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1393, "atom1_serNum": 10284, "atom2_serNum": 10431, "donAcc_type": "standard", "distance": 3.169, "atom1_id": "///U/19/O2", "atom2_id": "///V/4/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1394, "atom1_serNum": 10316, "atom2_serNum": 10336, "donAcc_type": "questionable", "distance": 3.185, "atom1_id": "///U/21/O4'", "atom2_id": "///U/22/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 1395, "atom1_serNum": 10367, "atom2_serNum": 10682, "donAcc_type": "standard", "distance": 2.433, "atom1_id": "///V/1/O6", "atom2_id": "///W/3/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1396, "atom1_serNum": 10386, "atom2_serNum": 10663, "donAcc_type": "standard", "distance": 2.685, "atom1_id": "///V/2/O2", "atom2_id": "///W/2/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1397, "atom1_serNum": 10387, "atom2_serNum": 10661, "donAcc_type": "standard", "distance": 2.699, "atom1_id": "///V/2/N3", "atom2_id": "///W/2/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1398, "atom1_serNum": 10389, "atom2_serNum": 10660, "donAcc_type": "standard", "distance": 2.585, "atom1_id": "///V/2/N4", "atom2_id": "///W/2/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1399, "atom1_serNum": 10406, "atom2_serNum": 10640, "donAcc_type": "standard", "distance": 2.660, "atom1_id": "///V/3/N3", "atom2_id": "///W/1/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1400, "atom1_serNum": 10408, "atom2_serNum": 10639, "donAcc_type": "standard", "distance": 2.486, "atom1_id": "///V/3/O4", "atom2_id": "///W/1/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1401, "atom1_serNum": 10602, "atom2_serNum": 10645, "donAcc_type": "acceptable", "distance": 2.813, "atom1_id": "///W/0/OP3", "atom2_id": "///W/2/OP1", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 1402, "atom1_serNum": 10698, "atom2_serNum": 11611, "donAcc_type": "standard", "distance": 3.286, "atom1_id": "///W/4/O2", "atom2_id": "///T/14/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1403, "atom1_serNum": 10699, "atom2_serNum": 11609, "donAcc_type": "standard", "distance": 2.865, "atom1_id": "///W/4/N3", "atom2_id": "///T/14/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1404, "atom1_serNum": 10701, "atom2_serNum": 11588, "donAcc_type": "standard", "distance": 3.281, "atom1_id": "///W/4/N4", "atom2_id": "///T/13/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1405, "atom1_serNum": 10701, "atom2_serNum": 11608, "donAcc_type": "standard", "distance": 2.342, "atom1_id": "///W/4/N4", "atom2_id": "///T/14/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1406, "atom1_serNum": 10720, "atom2_serNum": 11588, "donAcc_type": "standard", "distance": 2.082, "atom1_id": "///W/5/N6", "atom2_id": "///T/13/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1407, "atom1_serNum": 10721, "atom2_serNum": 11586, "donAcc_type": "standard", "distance": 2.605, "atom1_id": "///W/5/N1", "atom2_id": "///T/13/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1408, "atom1_serNum": 10738, "atom2_serNum": 11569, "donAcc_type": "standard", "distance": 2.931, "atom1_id": "///W/6/O2", "atom2_id": "///T/12/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1409, "atom1_serNum": 10739, "atom2_serNum": 11567, "donAcc_type": "standard", "distance": 2.701, "atom1_id": "///W/6/N3", "atom2_id": "///T/12/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1410, "atom1_serNum": 10741, "atom2_serNum": 11566, "donAcc_type": "standard", "distance": 2.332, "atom1_id": "///W/6/N4", "atom2_id": "///T/12/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1411, "atom1_serNum": 10760, "atom2_serNum": 11547, "donAcc_type": "standard", "distance": 2.391, "atom1_id": "///W/7/O6", "atom2_id": "///T/11/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1412, "atom1_serNum": 10761, "atom2_serNum": 11545, "donAcc_type": "standard", "distance": 2.754, "atom1_id": "///W/7/N1", "atom2_id": "///T/11/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1413, "atom1_serNum": 10763, "atom2_serNum": 11544, "donAcc_type": "standard", "distance": 2.986, "atom1_id": "///W/7/N2", "atom2_id": "///T/11/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1414, "atom1_serNum": 10779, "atom2_serNum": 11528, "donAcc_type": "standard", "distance": 2.780, "atom1_id": "///W/8/O2", "atom2_id": "///T/10/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1415, "atom1_serNum": 10780, "atom2_serNum": 11526, "donAcc_type": "standard", "distance": 2.715, "atom1_id": "///W/8/N3", "atom2_id": "///T/10/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1416, "atom1_serNum": 10782, "atom2_serNum": 11503, "donAcc_type": "standard", "distance": 3.173, "atom1_id": "///W/8/N4", "atom2_id": "///T/9/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1417, "atom1_serNum": 10782, "atom2_serNum": 11525, "donAcc_type": "standard", "distance": 2.561, "atom1_id": "///W/8/N4", "atom2_id": "///T/10/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1418, "atom1_serNum": 10798, "atom2_serNum": 11506, "donAcc_type": "standard", "distance": 2.500, "atom1_id": "///W/9/O2", "atom2_id": "///T/9/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1419, "atom1_serNum": 10799, "atom2_serNum": 11504, "donAcc_type": "standard", "distance": 2.838, "atom1_id": "///W/9/N3", "atom2_id": "///T/9/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1420, "atom1_serNum": 10801, "atom2_serNum": 11503, "donAcc_type": "standard", "distance": 3.044, "atom1_id": "///W/9/N4", "atom2_id": "///T/9/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1421, "atom1_serNum": 10818, "atom2_serNum": 11483, "donAcc_type": "standard", "distance": 2.793, "atom1_id": "///W/10/N3", "atom2_id": "///T/8/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1422, "atom1_serNum": 10820, "atom2_serNum": 11482, "donAcc_type": "standard", "distance": 2.484, "atom1_id": "///W/10/O4", "atom2_id": "///T/8/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1423, "atom1_serNum": 10902, "atom2_serNum": 11253, "donAcc_type": "standard", "distance": 3.426, "atom1_id": "///X/4/O6", "atom2_id": "///Z/19/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1424, "atom1_serNum": 10903, "atom2_serNum": 11251, "donAcc_type": "standard", "distance": 3.635, "atom1_id": "///X/4/N1", "atom2_id": "///Z/19/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1425, "atom1_serNum": 10905, "atom2_serNum": 11250, "donAcc_type": "standard", "distance": 3.710, "atom1_id": "///X/4/N2", "atom2_id": "///Z/19/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1426, "atom1_serNum": 10924, "atom2_serNum": 11233, "donAcc_type": "standard", "distance": 2.800, "atom1_id": "///X/5/N6", "atom2_id": "///Z/18/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1427, "atom1_serNum": 10925, "atom2_serNum": 11231, "donAcc_type": "standard", "distance": 2.970, "atom1_id": "///X/5/N1", "atom2_id": "///Z/18/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1428, "atom1_serNum": 10945, "atom2_serNum": 11214, "donAcc_type": "standard", "distance": 3.026, "atom1_id": "///X/6/O6", "atom2_id": "///Z/17/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1429, "atom1_serNum": 10946, "atom2_serNum": 11212, "donAcc_type": "standard", "distance": 2.952, "atom1_id": "///X/6/N1", "atom2_id": "///Z/17/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1430, "atom1_serNum": 10948, "atom2_serNum": 11211, "donAcc_type": "standard", "distance": 2.781, "atom1_id": "///X/6/N2", "atom2_id": "///Z/17/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1431, "atom1_serNum": 10948, "atom2_serNum": 11212, "donAcc_type": "standard", "distance": 3.124, "atom1_id": "///X/6/N2", "atom2_id": "///Z/17/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1432, "atom1_serNum": 10967, "atom2_serNum": 11195, "donAcc_type": "standard", "distance": 2.569, "atom1_id": "///X/7/O6", "atom2_id": "///Z/16/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1433, "atom1_serNum": 10968, "atom2_serNum": 11193, "donAcc_type": "standard", "distance": 2.663, "atom1_id": "///X/7/N1", "atom2_id": "///Z/16/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1434, "atom1_serNum": 10970, "atom2_serNum": 11192, "donAcc_type": "standard", "distance": 2.685, "atom1_id": "///X/7/N2", "atom2_id": "///Z/16/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1435, "atom1_serNum": 10989, "atom2_serNum": 11175, "donAcc_type": "standard", "distance": 2.887, "atom1_id": "///X/8/N6", "atom2_id": "///Z/15/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1436, "atom1_serNum": 10990, "atom2_serNum": 11173, "donAcc_type": "standard", "distance": 2.996, "atom1_id": "///X/8/N1", "atom2_id": "///Z/15/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1437, "atom1_serNum": 11010, "atom2_serNum": 11156, "donAcc_type": "standard", "distance": 2.771, "atom1_id": "///X/9/O6", "atom2_id": "///Z/14/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1438, "atom1_serNum": 11011, "atom2_serNum": 11154, "donAcc_type": "standard", "distance": 2.896, "atom1_id": "///X/9/N1", "atom2_id": "///Z/14/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1439, "atom1_serNum": 11013, "atom2_serNum": 11153, "donAcc_type": "standard", "distance": 2.919, "atom1_id": "///X/9/N2", "atom2_id": "///Z/14/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1440, "atom1_serNum": 11030, "atom2_serNum": 11136, "donAcc_type": "standard", "distance": 2.621, "atom1_id": "///X/10/N3", "atom2_id": "///Z/13/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1441, "atom1_serNum": 11032, "atom2_serNum": 11135, "donAcc_type": "standard", "distance": 2.580, "atom1_id": "///X/10/O4", "atom2_id": "///Z/13/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1442, "atom1_serNum": 11049, "atom2_serNum": 11116, "donAcc_type": "standard", "distance": 2.629, "atom1_id": "///X/11/O2", "atom2_id": "///Z/12/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1443, "atom1_serNum": 11050, "atom2_serNum": 11114, "donAcc_type": "standard", "distance": 2.905, "atom1_id": "///X/11/N3", "atom2_id": "///Z/12/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1444, "atom1_serNum": 11052, "atom2_serNum": 11113, "donAcc_type": "standard", "distance": 3.104, "atom1_id": "///X/11/N4", "atom2_id": "///Z/12/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1445, "atom1_serNum": 11069, "atom2_serNum": 11093, "donAcc_type": "standard", "distance": 3.050, "atom1_id": "///X/12/N3", "atom2_id": "///Z/11/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1446, "atom1_serNum": 11071, "atom2_serNum": 11092, "donAcc_type": "standard", "distance": 2.924, "atom1_id": "///X/12/O4", "atom2_id": "///Z/11/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" } ], "refCoords": { "purine": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 -0.5000 0.4000", " 3 N -2.2500 -0.5000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 1.2500 5.0000 0.4000", " 6 C 1.2500 -0.5000 0.4000", " 7 C 1.2500 -0.5000 -0.4000", " 8 C 1.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 -0.5000 0.4000", " 11 C -2.2500 -0.5000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ], "pyrimidine": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 1.0000 0.4000", " 3 N -2.2500 1.0000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 1.2500 5.0000 0.4000", " 6 C 1.2500 1.0000 0.4000", " 7 C 1.2500 1.0000 -0.4000", " 8 C 1.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 1.0000 0.4000", " 11 C -2.2500 1.0000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ], "wc_pair": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 -5.0000 0.4000", " 3 N -2.2500 -5.0000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 2.2500 5.0000 0.4000", " 6 C 2.2500 -5.0000 0.4000", " 7 C 2.2500 -5.0000 -0.4000", " 8 C 2.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 -5.0000 0.4000", " 11 C -2.2500 -5.0000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ] }, "metadata": { "license": "http://innovation.columbia.edu/technologies/CU20391", "url": "http://x3dna.org/", "url_alt": "http://home.x3dna.org/", "forum": "http://forum.x3dna.org/", "citation": "Lu et al. (2015). 'DSSR: an integrated software tool for dissecting the spatial structure of RNA.' Nucleic Acids Res., 43(21):e142 [doi:10.1093/nar/gkv716].", "str_id": "4ri9", "num_aaChains": 2, "aaChains": "A=615,B=615", "num_naChains": 8, "naChains": "S=11,T=7,U=12,V=12,W=11,X=12,Y=7,Z=12", "num_atoms": 11606, "num_waters": 0, "num_metals": 2, "metals_desc": "Ba=2", "num_notes": 52, "notes": [ { "Aminors": "A-minor interactions (including types I and II)" }, { "Cstem_index": "stem index of the 'Canonical' helix in k-turn" }, { "Cstem_pair": "Cstem bp delineating the k-turn internal loop" }, { "Dp": "perpendicular distance of the 3' P atom to the glycosidic bond" }, { "GA_pair": "sheared G-A pair in k-turn" }, { "HtypePknot": "H-type pseudoknot" }, { "Kturn": "kink-turn (k-turn)" }, { "LW": "Leontis-Westhof" }, { "NCstem_index": "stem index of the 'Non-Canonical' helix in k-turn" }, { "NCstem_pair": "NCstem bp delineating the k-turn internal loop" }, { "Uturn": "U-turn of the UNR- or GNRA-type" }, { "aa": "amino acid" }, { "atom_pair": "symbols of the two atoms involved in an H-bond" }, { "auxfiles": "auxiliary files" }, { "glyco_bond": "conformation of base related to sugar (syn or anti)" }, { "bb_type": "backbone conformation, BI or BII" }, { "bending_angle": "angle between two helical axes" }, { "bp": "base pair" }, { "bseq": "base sequence in one-letter code" }, { "bulge": "bulge loop" }, { "coaxStacks": "coaxial stacking of stems within a helix" }, { "dbn": "dot bracket notation" }, { "desc": "description" }, { "donAcc_type": "donor/acceptor type of the atom pair in an H-bond" }, { "epsilon_zeta": "difference between epsilon and zeta torsion angles" }, { "hairpin": "hairpin loop" }, { "hbond": "hydrogen bond (H-bond)" }, { "helix": "defined by base-stacking interactions, regardless of bp type and backbone connectivity" }, { "id": "identifier" }, { "iloop": "internal loop" }, { "index": "serial number" }, { "isoCanonPairs": "isolated canonical pairs" }, { "junction": "(multi-branched) junction loop" }, { "kissingLoop": "kissing loop" }, { "multiplet": "3+ bases in a coplanar geometry" }, { "na": "nucleic acid" }, { "nonPair": "two nts not forming a pair, but with H-bonding/stacking interactions" }, { "nonStack": "nucleotide not involved in stacking interactions" }, { "nt": "nucleotide" }, { "num": "number" }, { "oArea": "overlap areas between two bases, including exocyclic atoms" }, { "oArea_ring": "overlap areas between two bases, including only ring atoms" }, { "phosContacts": "H-bonding and atom-capping interactions involving a phosphate" }, { "residue_pair": "types of the two residues involved in an H-bond" }, { "rmsd": "root-mean-squares deviation" }, { "serNum": "serial number" }, { "ssSegments": "single-stranded segments not involved in loops" }, { "ssZp": "Z-coordinate of the 3' phosphorus atom with reference to the 5' base plane" }, { "sstr": "secondary structure in dbn" }, { "stem": "helix consisting of only canonical pairs, with a continuous backbone" }, { "str_id": "structure identifier, derived from inpfile with extension removed" }, { "vert_dist": "vertical distance from an atom to a base plane" } ], "num_auxfiles": 13, "auxfiles": [ { "index": 1, "name": "dssr-pairs.pdb", "desc": "an ensemble of base pairs" }, { "index": 2, "name": "dssr-stems.pdb", "desc": "an ensemble of stems" }, { "index": 3, "name": "dssr-helices.pdb", "desc": "an ensemble of helices (coaxial stacking)" }, { "index": 4, "name": "dssr-2ndstrs.bpseq", "desc": "secondary structure in bpseq format" }, { "index": 5, "name": "dssr-2ndstrs.ct", "desc": "secondary structure in connectivity table format" }, { "index": 6, "name": "dssr-2ndstrs.dbn", "desc": "secondary structure in dot-bracket notation" }, { "index": 7, "name": "dssr-torsions.txt", "desc": "backbone torsion angles and suite names" }, { "index": 8, "name": "dssr-splays.pdb", "desc": "an ensemble of splayed-apart units" }, { "index": 9, "name": "dssr-stacks.pdb", "desc": "an ensemble of base stacks" }, { "index": 10, "name": "dssr-rotmat.txt", "desc": "position vector and rotation matrix" }, { "index": 11, "name": "dssr-viewV.pdb", "desc": "vertical view of the principal moment of inertia" }, { "index": 12, "name": "dssr-viewH.pdb", "desc": "horizontal view of the principal moment of inertia" }, { "index": 13, "name": "dssr-viewT.pdb", "desc": "top view of the principal moment of inertia" } ], "time_used": "999" } }