{ "num_pairs": 18, "pairs": [ { "index": 1, "nt1": "///A/3", "nt2": "///B/46", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -175.878, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 50.600, "chi2": -158.017, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 58.583, "C1C1_dist": 10.495, "N1N9_dist": 8.797, "C6C8_dist": 9.740, "CNNC_torsion": 2.248, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.92],N1(imino)-N3[2.89],N2(amino)-O2(carbonyl)[2.74]", "interBase_angle": 3.305, "planarity": 0.064, "simple_Shear": -0.868, "simple_Stretch": -0.259, "simple_Buckle": -2.266, "simple_Propeller": -2.406, "bp_simpleParams": [ -0.868, -0.259, -0.284, -2.266, -2.406, 0.923 ], "bp_params": [ -0.844, -0.329, -0.284, -2.062, -2.583, 0.923 ], "frame": { "rmsd": null, "origin": [ -1.007, -15.888, -40.535 ], "x_axis": [ -0.646, -0.693, 0.320 ], "y_axis": [ 0.603, -0.721, -0.342 ], "z_axis": [ 0.468, -0.028, 0.883 ], "quaternion": [ -0.359, 0.219, -0.103, 0.901 ] } }, { "index": 2, "nt1": "///A/4", "nt2": "///B/45", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -163.035, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 49.855, "chi2": -167.935, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 56.342, "C1C1_dist": 10.744, "N1N9_dist": 8.977, "C6C8_dist": 9.842, "CNNC_torsion": -2.975, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.80],N3-N1(imino)[2.81],N4(amino)-O6(carbonyl)[2.72]", "interBase_angle": 8.855, "planarity": 0.119, "simple_Shear": -0.403, "simple_Stretch": -0.185, "simple_Buckle": 2.642, "simple_Propeller": -8.451, "bp_simpleParams": [ -0.403, -0.185, 0.228, 2.642, -8.451, -3.272 ], "bp_params": [ -0.394, -0.203, 0.228, 3.017, -8.325, -3.280 ], "frame": { "rmsd": null, "origin": [ -0.746, -14.142, -36.832 ], "x_axis": [ -0.186, -0.976, 0.114 ], "y_axis": [ 0.815, -0.218, -0.537 ], "z_axis": [ 0.548, -0.007, 0.836 ], "quaternion": [ 0.598, -0.221, 0.181, -0.748 ] } }, { "index": 3, "nt1": "///A/5", "nt2": "///B/44", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -167.192, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 51.225, "chi2": -160.036, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 60.370, "C1C1_dist": 10.455, "N1N9_dist": 8.810, "C6C8_dist": 9.800, "CNNC_torsion": 5.298, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[3.09],N1(imino)-N3[2.97],N2(amino)-O2(carbonyl)[2.74]", "interBase_angle": 3.330, "planarity": 0.100, "simple_Shear": -1.024, "simple_Stretch": -0.180, "simple_Buckle": 3.330, "simple_Propeller": -0.060, "bp_simpleParams": [ -1.024, -0.180, -0.265, 3.330, -0.060, 2.984 ], "bp_params": [ -1.002, -0.279, -0.265, 3.320, 0.264, 2.982 ], "frame": { "rmsd": null, "origin": [ -0.328, -14.506, -33.371 ], "x_axis": [ 0.154, -0.952, -0.264 ], "y_axis": [ 0.819, 0.273, -0.504 ], "z_axis": [ 0.552, -0.139, 0.822 ], "quaternion": [ 0.750, -0.122, 0.272, -0.591 ] } }, { "index": 4, "nt1": "///A/6", "nt2": "///B/43", "bp": "U-U", "name": "--", "Saenger": "16-XVI", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -167.290, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 36.566, "chi2": -164.100, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 57.748, "C1C1_dist": 10.138, "N1N9_dist": 8.182, "C6C8_dist": 8.862, "CNNC_torsion": 5.045, "hbonds_num": 1, "hbonds_desc": "O4(carbonyl)-N3(imino)[2.89]", "interBase_angle": 12.990, "planarity": 0.171, "simple_Shear": -2.081, "simple_Stretch": -0.906, "simple_Buckle": 3.074, "simple_Propeller": -12.621, "bp_simpleParams": [ -2.081, -0.906, -0.497, 3.074, -12.621, -17.056 ], "bp_params": [ -1.843, -1.324, -0.497, 5.655, -11.694, -17.123 ], "frame": { "rmsd": null, "origin": [ -0.157, -15.162, -29.553 ], "x_axis": [ 0.519, -0.689, -0.506 ], "y_axis": [ 0.612, 0.712, -0.343 ], "z_axis": [ 0.597, -0.132, 0.792 ], "quaternion": [ 0.869, -0.061, 0.317, -0.374 ] } }, { "index": 5, "nt1": "///A/7", "nt2": "///B/42", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -174.182, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 54.739, "chi2": -173.063, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 52.917, "C1C1_dist": 10.759, "N1N9_dist": 9.026, "C6C8_dist": 9.925, "CNNC_torsion": -0.382, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.85],N3-N1(imino)[2.93],N4(amino)-O6(carbonyl)[2.83]", "interBase_angle": 1.917, "planarity": 0.026, "simple_Shear": 0.240, "simple_Stretch": -0.111, "simple_Buckle": -0.526, "simple_Propeller": -1.843, "bp_simpleParams": [ 0.240, -0.111, 0.065, -0.526, -1.843, -1.735 ], "bp_params": [ 0.238, -0.116, 0.065, -0.562, -1.833, -1.735 ], "frame": { "rmsd": null, "origin": [ 1.841, -17.915, -26.908 ], "x_axis": [ 0.749, -0.069, -0.659 ], "y_axis": [ 0.104, 0.994, 0.015 ], "z_axis": [ 0.655, -0.080, 0.752 ], "quaternion": [ 0.935, 0.025, 0.351, -0.046 ] } }, { "index": 6, "nt1": "///A/9", "nt2": "///B/39", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -160.024, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 55.638, "chi2": -140.615, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 59.186, "C1C1_dist": 10.582, "N1N9_dist": 9.005, "C6C8_dist": 10.056, "CNNC_torsion": -11.815, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.79],N3-N1(imino)[3.02],N4(amino)-O6(carbonyl)[3.26]", "interBase_angle": 19.668, "planarity": 0.224, "simple_Shear": -0.012, "simple_Stretch": 0.070, "simple_Buckle": 7.970, "simple_Propeller": -17.981, "bp_simpleParams": [ -0.012, 0.070, -0.098, 7.970, -17.981, 5.532 ], "bp_params": [ -0.013, 0.070, -0.098, 8.129, -17.909, 5.587 ], "frame": { "rmsd": null, "origin": [ 8.214, -20.426, -23.817 ], "x_axis": [ 0.185, 0.916, -0.355 ], "y_axis": [ -0.700, 0.376, 0.607 ], "z_axis": [ 0.690, 0.136, 0.711 ], "quaternion": [ 0.754, 0.156, 0.346, 0.536 ] } }, { "index": 7, "nt1": "///A/10", "nt2": "///B/38", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -168.064, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 53.773, "chi2": -169.376, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 57.248, "C1C1_dist": 10.757, "N1N9_dist": 9.103, "C6C8_dist": 10.054, "CNNC_torsion": -19.642, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.23],N1-N3(imino)[3.13]", "interBase_angle": 16.108, "planarity": 0.203, "simple_Shear": -0.270, "simple_Stretch": 0.120, "simple_Buckle": 6.346, "simple_Propeller": -14.806, "bp_simpleParams": [ -0.270, 0.120, 0.460, 6.346, -14.806, -0.373 ], "bp_params": [ -0.273, 0.113, 0.460, 6.707, -14.646, -0.376 ], "frame": { "rmsd": null, "origin": [ 11.412, -20.125, -22.294 ], "x_axis": [ -0.359, 0.924, -0.128 ], "y_axis": [ -0.720, -0.187, 0.668 ], "z_axis": [ 0.594, 0.332, 0.733 ], "quaternion": [ 0.545, 0.154, 0.331, 0.755 ] } }, { "index": 8, "nt1": "///A/11", "nt2": "///B/37", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -162.218, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 59.526, "chi2": -168.683, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 53.730, "C1C1_dist": 10.675, "N1N9_dist": 9.066, "C6C8_dist": 10.113, "CNNC_torsion": -12.337, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.86],N3-N1(imino)[3.13],N4(amino)-O6(carbonyl)[3.38]", "interBase_angle": 16.203, "planarity": 0.197, "simple_Shear": 0.638, "simple_Stretch": 0.122, "simple_Buckle": 5.209, "simple_Propeller": -15.343, "bp_simpleParams": [ 0.638, 0.122, 0.017, 5.209, -15.343, 5.627 ], "bp_params": [ 0.644, 0.086, 0.017, 4.310, -15.619, 5.676 ], "frame": { "rmsd": null, "origin": [ 13.790, -17.554, -21.039 ], "x_axis": [ -0.726, 0.636, 0.259 ], "y_axis": [ -0.307, -0.638, 0.706 ], "z_axis": [ 0.615, 0.433, 0.659 ], "quaternion": [ 0.271, 0.251, 0.328, 0.869 ] } }, { "index": 9, "nt1": "///A/12", "nt2": "///B/36", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -160.835, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 53.628, "chi2": -167.818, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 54.041, "C1C1_dist": 10.747, "N1N9_dist": 9.015, "C6C8_dist": 9.943, "CNNC_torsion": -3.462, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.79],N3-N1(imino)[2.92],N4(amino)-O6(carbonyl)[2.93]", "interBase_angle": 4.728, "planarity": 0.055, "simple_Shear": 0.060, "simple_Stretch": -0.087, "simple_Buckle": 0.959, "simple_Propeller": -4.630, "bp_simpleParams": [ 0.060, -0.087, 0.034, 0.959, -4.630, -0.228 ], "bp_params": [ 0.060, -0.087, 0.034, 0.953, -4.631, -0.228 ], "frame": { "rmsd": null, "origin": [ 16.602, -14.921, -20.241 ], "x_axis": [ -0.830, 0.201, 0.521 ], "y_axis": [ 0.093, -0.870, 0.484 ], "z_axis": [ 0.550, 0.450, 0.703 ], "quaternion": [ 0.029, 0.290, 0.253, 0.922 ] } }, { "index": 10, "nt1": "///A/13", "nt2": "///B/35", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -166.114, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 56.318, "chi2": -155.908, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 55.879, "C1C1_dist": 10.682, "N1N9_dist": 9.044, "C6C8_dist": 10.063, "CNNC_torsion": -7.837, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[3.25],N1(imino)-N3[3.03],N2(amino)-O2(carbonyl)[2.76]", "interBase_angle": 12.558, "planarity": 0.171, "simple_Shear": -0.155, "simple_Stretch": 0.038, "simple_Buckle": -2.265, "simple_Propeller": -12.352, "bp_simpleParams": [ -0.155, 0.038, 0.305, -2.265, -12.352, 3.537 ], "bp_params": [ -0.156, 0.037, 0.305, -2.136, -12.375, 3.557 ], "frame": { "rmsd": null, "origin": [ 17.418, -12.057, -18.228 ], "x_axis": [ -0.760, -0.305, 0.574 ], "y_axis": [ 0.504, -0.833, 0.226 ], "z_axis": [ 0.409, 0.461, 0.787 ], "quaternion": [ -0.220, 0.267, 0.187, 0.919 ] } }, { "index": 11, "nt1": "///A/14", "nt2": "///B/34", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -159.688, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 55.098, "chi2": -151.711, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 53.493, "C1C1_dist": 10.653, "N1N9_dist": 8.938, "C6C8_dist": 9.877, "CNNC_torsion": -13.087, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.94],N1(imino)-N3[2.86],N2(amino)-O2(carbonyl)[2.94]", "interBase_angle": 24.870, "planarity": 0.301, "simple_Shear": -0.081, "simple_Stretch": -0.146, "simple_Buckle": -5.805, "simple_Propeller": -24.183, "bp_simpleParams": [ -0.081, -0.146, -0.219, -5.805, -24.183, 1.429 ], "bp_params": [ -0.081, -0.146, -0.219, -5.756, -24.195, 1.459 ], "frame": { "rmsd": null, "origin": [ 17.662, -9.676, -15.538 ], "x_axis": [ -0.409, -0.784, 0.467 ], "y_axis": [ 0.879, -0.477, -0.031 ], "z_axis": [ 0.247, 0.397, 0.884 ], "quaternion": [ -0.500, 0.214, 0.110, 0.832 ] } }, { "index": 12, "nt1": "///A/15", "nt2": "///B/33", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -163.530, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 61.378, "chi2": -160.583, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 54.649, "C1C1_dist": 10.058, "N1N9_dist": 8.513, "C6C8_dist": 9.599, "CNNC_torsion": -16.535, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.66],O4(carbonyl)-N6(amino)[3.04]", "interBase_angle": 18.084, "planarity": 0.221, "simple_Shear": 0.561, "simple_Stretch": -0.318, "simple_Buckle": -1.260, "simple_Propeller": -18.040, "bp_simpleParams": [ 0.561, -0.318, 0.337, -1.260, -18.040, 6.238 ], "bp_params": [ 0.543, -0.347, 0.337, -2.194, -17.951, 6.314 ], "frame": { "rmsd": null, "origin": [ 17.466, -9.144, -12.323 ], "x_axis": [ 0.151, -0.959, 0.241 ], "y_axis": [ 0.944, 0.067, -0.324 ], "z_axis": [ 0.295, 0.277, 0.915 ], "quaternion": [ 0.730, -0.206, 0.018, -0.651 ] } }, { "index": 13, "nt1": "///A/16", "nt2": "///B/32", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -152.538, "conf1": "anti", "pucker1": "----", "lambda1": 53.946, "chi2": -154.900, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 54.497, "C1C1_dist": 10.473, "N1N9_dist": 8.759, "C6C8_dist": 9.645, "CNNC_torsion": -5.246, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.61],N1(imino)-N3[2.73],N2(amino)-O2(carbonyl)[2.86]", "interBase_angle": 17.564, "planarity": 0.225, "simple_Shear": -0.255, "simple_Stretch": -0.380, "simple_Buckle": -7.648, "simple_Propeller": -15.812, "bp_simpleParams": [ -0.255, -0.380, -0.558, -7.648, -15.812, -1.114 ], "bp_params": [ -0.249, -0.384, -0.558, -7.347, -15.954, -1.122 ], "frame": { "rmsd": null, "origin": [ 16.861, -9.294, -8.707 ], "x_axis": [ 0.464, -0.858, -0.220 ], "y_axis": [ 0.834, 0.507, -0.218 ], "z_axis": [ 0.299, -0.082, 0.951 ], "quaternion": [ 0.855, -0.040, 0.152, -0.495 ] } }, { "index": 14, "nt1": "///A/19", "nt2": "///B/30", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": 177.769, "conf1": "--", "pucker1": "~C3'-endo", "lambda1": 50.481, "chi2": -166.125, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 56.564, "C1C1_dist": 10.905, "N1N9_dist": 9.156, "C6C8_dist": 10.069, "CNNC_torsion": 8.295, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[3.16],N1(imino)-N3[3.16],N2(amino)-O2(carbonyl)[3.07]", "interBase_angle": 2.340, "planarity": 0.102, "simple_Shear": -0.618, "simple_Stretch": 0.047, "simple_Buckle": -0.505, "simple_Propeller": -2.285, "bp_simpleParams": [ -0.618, 0.047, -0.409, -0.505, -2.285, -0.295 ], "bp_params": [ -0.620, 0.012, -0.409, -0.374, -2.310, -0.295 ], "frame": { "rmsd": null, "origin": [ 17.057, -13.014, -1.890 ], "x_axis": [ 0.876, 0.221, -0.429 ], "y_axis": [ -0.093, 0.950, 0.299 ], "z_axis": [ 0.474, -0.222, 0.852 ], "quaternion": [ 0.959, 0.136, 0.235, 0.082 ] } }, { "index": 15, "nt1": "///A/20", "nt2": "///B/29", "bp": "U-U", "name": "--", "Saenger": "--", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -159.312, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 55.050, "chi2": -161.293, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 42.277, "C1C1_dist": 10.531, "N1N9_dist": 8.603, "C6C8_dist": 9.368, "CNNC_torsion": 6.155, "hbonds_num": 1, "hbonds_desc": "O4(carbonyl)*O4(carbonyl)[3.20]", "interBase_angle": 12.761, "planarity": 0.193, "simple_Shear": 1.332, "simple_Stretch": -0.611, "simple_Buckle": 1.521, "simple_Propeller": -12.670, "bp_simpleParams": [ 1.332, -0.611, -0.835, 1.521, -12.670, -13.197 ], "bp_params": [ 1.239, -0.782, -0.835, -0.177, -12.759, -13.279 ], "frame": { "rmsd": null, "origin": [ 18.636, -16.510, 0.419 ], "x_axis": [ 0.629, 0.757, -0.181 ], "y_axis": [ -0.572, 0.607, 0.552 ], "z_axis": [ 0.527, -0.244, 0.814 ], "quaternion": [ 0.873, 0.228, 0.203, 0.380 ] } }, { "index": 16, "nt1": "///A/21", "nt2": "///B/28", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -158.552, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 58.595, "chi2": -172.440, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 53.578, "C1C1_dist": 10.316, "N1N9_dist": 8.684, "C6C8_dist": 9.682, "CNNC_torsion": 5.595, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.51],N3-N1(imino)[2.75],N4(amino)-O6(carbonyl)[2.85]", "interBase_angle": 5.293, "planarity": 0.073, "simple_Shear": 0.604, "simple_Stretch": -0.325, "simple_Buckle": 4.874, "simple_Propeller": 2.063, "bp_simpleParams": [ 0.604, -0.325, -0.337, 4.874, 2.063, 2.634 ], "bp_params": [ 0.584, -0.359, -0.337, 4.983, 1.786, 2.632 ], "frame": { "rmsd": null, "origin": [ 22.213, -16.802, 1.942 ], "x_axis": [ 0.205, 0.976, 0.078 ], "y_axis": [ -0.822, 0.128, 0.555 ], "z_axis": [ 0.532, -0.177, 0.828 ], "quaternion": [ 0.735, 0.249, 0.154, 0.611 ] } }, { "index": 17, "nt1": "///A/22", "nt2": "///B/27", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -170.172, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 50.494, "chi2": -165.354, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 58.101, "C1C1_dist": 10.592, "N1N9_dist": 8.883, "C6C8_dist": 9.794, "CNNC_torsion": -1.391, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.96],N1(imino)-N3[2.97],N2(amino)-O2(carbonyl)[2.91]", "interBase_angle": 8.852, "planarity": 0.114, "simple_Shear": -0.928, "simple_Stretch": -0.200, "simple_Buckle": 0.457, "simple_Propeller": -8.840, "bp_simpleParams": [ -0.928, -0.200, 0.049, 0.457, -8.840, -0.868 ], "bp_params": [ -0.907, -0.282, 0.049, 1.237, -8.765, -0.870 ], "frame": { "rmsd": null, "origin": [ 25.731, -16.451, 3.676 ], "x_axis": [ -0.188, 0.967, 0.171 ], "y_axis": [ -0.811, -0.251, 0.528 ], "z_axis": [ 0.553, -0.039, 0.832 ], "quaternion": [ 0.590, 0.240, 0.162, 0.753 ] } }, { "index": 18, "nt1": "///A/23", "nt2": "///B/26", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -148.819, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 59.080, "chi2": 173.232, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 55.339, "C1C1_dist": 10.916, "N1N9_dist": 9.323, "C6C8_dist": 10.388, "CNNC_torsion": 8.487, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.97],N3-N1(imino)[3.36],N4(amino)-O6(carbonyl)[3.61]", "interBase_angle": 6.115, "planarity": 0.082, "simple_Shear": 0.464, "simple_Stretch": 0.382, "simple_Buckle": 4.303, "simple_Propeller": 4.345, "bp_simpleParams": [ 0.464, 0.382, -0.249, 4.303, 4.345, 6.059 ], "bp_params": [ 0.479, 0.363, -0.249, 4.480, 4.162, 6.058 ], "frame": { "rmsd": null, "origin": [ 28.513, -14.401, 5.758 ], "x_axis": [ -0.688, 0.559, 0.462 ], "y_axis": [ -0.438, -0.828, 0.350 ], "z_axis": [ 0.578, 0.039, 0.815 ], "quaternion": [ 0.273, 0.285, 0.107, 0.913 ] } } ], "num_helices": 1, "helices": [ { "index": 1, "num_stems": 3, "strand1": "GCGUCCACCGGUGGUCGC", "strand2": "CGCUGGUGGCCACCUGCG", "bp_type": "|||.||||||||||.|||", "helix_form": "AA..xAAAAAA.x..AA", "helical_rise": 3.117, "helical_rise_std": 0.995, "helical_radius": 9.529, "helical_radius_std": 1.981, "helical_axis": [ 0.492, 0.245, 0.835 ], "point1": [ 0.352, -21.461, -39.132 ], "point2": [ 26.327, -8.516, 4.911 ], "num_pairs": 18, "pairs": [ { "index": 1, "nt1": "///A/3", "nt2": "///B/46", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.844, -0.329, -0.284, -2.062, -2.583, 0.923 ], "step_params": [ -0.759, -2.331, 3.290, -4.071, -3.697, 33.439 ], "heli_params": [ -3.371, 0.609, 3.584, -6.372, 7.016, 33.876 ], "bp2_params": [ -0.394, -0.203, 0.228, 3.017, -8.325, -3.280 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.290, "simple_Twist": 30.767, "simple_hRise": 3.606, "simple_hTwist": 31.243 }, { "index": 2, "nt1": "///A/4", "nt2": "///B/45", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.394, -0.203, 0.228, 3.017, -8.325, -3.280 ], "step_params": [ 0.090, -1.569, 3.133, -0.413, 7.619, 28.536 ], "heli_params": [ -4.533, -0.255, 2.633, 15.118, 0.819, 29.518 ], "bp2_params": [ -1.002, -0.279, -0.265, 3.320, 0.264, 2.982 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.133, "simple_Twist": 32.092, "simple_hRise": 2.698, "simple_hTwist": 32.963 }, { "index": 3, "nt1": "///A/5", "nt2": "///B/44", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -1.002, -0.279, -0.265, 3.320, 0.264, 2.982 ], "step_params": [ -0.883, -1.891, 3.269, -2.838, 1.239, 29.552 ], "heli_params": [ -3.948, 1.127, 3.257, 2.421, 5.545, 29.710 ], "bp2_params": [ -1.843, -1.324, -0.497, 5.655, -11.694, -17.123 ], "groove_widths": [ 18.044, null, 16.217, null ], "simple_Rise": 3.269, "simple_Twist": 34.639, "simple_hRise": 3.261, "simple_hTwist": 34.773 }, { "index": 4, "nt1": "///A/6", "nt2": "///B/43", "bp": "U-U", "name": "--", "Saenger": "16-XVI", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -1.843, -1.324, -0.497, 5.655, -11.694, -17.123 ], "step_params": [ 0.866, -2.226, 3.586, -4.385, 2.446, 39.682 ], "heli_params": [ -3.554, -1.802, 3.338, 3.586, 6.429, 39.985 ], "bp2_params": [ 0.238, -0.116, 0.065, -0.562, -1.833, -1.735 ], "groove_widths": [ 19.292, 13.878, 15.272, 15.271 ], "simple_Rise": 3.586, "simple_Twist": 27.799, "simple_hRise": 3.211, "simple_hTwist": 28.240 }, { "index": 5, "nt1": "///A/7", "nt2": "///B/42", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.238, -0.116, 0.065, -0.562, -1.833, -1.735 ], "step_params": [ 0.781, -3.665, 6.514, -8.911, 9.157, 71.698 ], "heli_params": [ -3.670, -1.221, 5.955, 7.757, 7.549, 72.677 ], "bp2_params": [ -0.013, 0.070, -0.098, 8.129, -17.909, 5.587 ], "groove_widths": [ 20.097, 14.434, 12.918, 11.493 ], "simple_Rise": 6.514, "simple_Twist": 73.215, "simple_hRise": 5.972, "simple_hTwist": 74.168 }, { "index": 6, "nt1": "///A/9", "nt2": "///B/39", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.013, 0.070, -0.098, 8.129, -17.909, 5.587 ], "step_params": [ -0.339, -1.419, 3.242, -6.058, 11.035, 32.575 ], "heli_params": [ -3.933, -0.294, 2.656, 18.819, 10.332, 34.861 ], "bp2_params": [ -0.273, 0.113, 0.460, 6.707, -14.646, -0.376 ], "groove_widths": [ 21.144, 15.313, 11.713, 10.022 ], "simple_Rise": 3.242, "simple_Twist": 34.036, "simple_hRise": 2.688, "simple_hTwist": 36.225 }, { "index": 7, "nt1": "///A/10", "nt2": "///B/38", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.273, 0.113, 0.460, 6.707, -14.646, -0.376 ], "step_params": [ 0.782, -1.528, 3.301, 6.247, 3.765, 35.172 ], "heli_params": [ -3.021, -0.369, 3.213, 6.148, -10.202, 35.897 ], "bp2_params": [ 0.644, 0.086, 0.017, 4.310, -15.619, 5.676 ], "groove_widths": [ 18.683, 14.900, 16.008, 11.867 ], "simple_Rise": 3.301, "simple_Twist": 30.131, "simple_hRise": 3.185, "simple_hTwist": 30.982 }, { "index": 8, "nt1": "///A/11", "nt2": "///B/37", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.644, 0.086, 0.017, 4.310, -15.619, 5.676 ], "step_params": [ -0.793, -1.909, 3.347, -1.226, 4.430, 29.738 ], "heli_params": [ -4.572, 1.280, 3.066, 8.566, 2.370, 30.083 ], "bp2_params": [ 0.060, -0.087, 0.034, 0.953, -4.631, -0.228 ], "groove_widths": [ 16.300, 15.051, 16.637, 13.787 ], "simple_Rise": 3.347, "simple_Twist": 32.639, "simple_hRise": 3.095, "simple_hTwist": 32.952 }, { "index": 9, "nt1": "///A/12", "nt2": "///B/36", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.060, -0.087, 0.034, 0.953, -4.631, -0.228 ], "step_params": [ 0.306, -1.594, 3.207, 1.291, 9.334, 28.239 ], "heli_params": [ -4.881, -0.351, 2.571, 18.492, -2.558, 29.740 ], "bp2_params": [ -0.156, 0.037, 0.305, -2.136, -12.375, 3.557 ], "groove_widths": [ 17.010, 15.976, 16.023, 13.542 ], "simple_Rise": 3.207, "simple_Twist": 29.457, "simple_hRise": 2.602, "simple_hTwist": 30.896 }, { "index": 10, "nt1": "///A/13", "nt2": "///B/35", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.156, 0.037, 0.305, -2.136, -12.375, 3.557 ], "step_params": [ -0.072, -1.275, 3.367, 3.691, 10.852, 33.517 ], "heli_params": [ -3.652, 0.647, 2.809, 18.170, -6.180, 35.369 ], "bp2_params": [ -0.081, -0.146, -0.219, -5.756, -24.195, 1.459 ], "groove_widths": [ 17.267, 15.965, 15.050, 11.401 ], "simple_Rise": 3.367, "simple_Twist": 32.898, "simple_hRise": 2.795, "simple_hTwist": 34.786 }, { "index": 11, "nt1": "///A/14", "nt2": "///B/34", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.081, -0.146, -0.219, -5.756, -24.195, 1.459 ], "step_params": [ 0.768, -0.960, 3.024, -3.805, 6.635, 36.046 ], "heli_params": [ -2.320, -1.675, 2.719, 10.575, 6.065, 36.822 ], "bp2_params": [ 0.543, -0.347, 0.337, -2.194, -17.951, 6.314 ], "groove_widths": [ 19.741, 15.604, 14.968, 9.987 ], "simple_Rise": 3.024, "simple_Twist": 32.694, "simple_hRise": 2.680, "simple_hTwist": 33.553 }, { "index": 12, "nt1": "///A/15", "nt2": "///B/33", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.543, -0.347, 0.337, -2.194, -17.951, 6.314 ], "step_params": [ -0.047, -1.738, 3.231, 6.568, 19.684, 26.556 ], "heli_params": [ -5.666, 0.968, 1.559, 36.579, -12.205, 33.586 ], "bp2_params": [ -0.249, -0.384, -0.558, -7.347, -15.954, -1.122 ], "groove_widths": [ 21.802, 15.396, 12.814, 10.839 ], "simple_Rise": 3.231, "simple_Twist": 30.888, "simple_hRise": 1.799, "simple_hTwist": 37.070 }, { "index": 13, "nt1": "///A/16", "nt2": "///B/32", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.249, -0.384, -0.558, -7.347, -15.954, -1.122 ], "step_params": [ -1.226, -3.476, 6.838, 2.937, 13.771, 70.739 ], "heli_params": [ -3.883, 1.241, 6.116, 11.778, -2.512, 71.948 ], "bp2_params": [ -0.620, 0.012, -0.409, -0.374, -2.310, -0.295 ], "groove_widths": [ 20.683, 14.648, 14.655, 12.920 ], "simple_Rise": 6.838, "simple_Twist": 72.761, "simple_hRise": 6.145, "simple_hTwist": 73.925 }, { "index": 14, "nt1": "///A/19", "nt2": "///B/30", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.620, 0.012, -0.409, -0.374, -2.310, -0.295 ], "step_params": [ -1.325, -2.414, 3.530, 3.077, 2.505, 37.246 ], "heli_params": [ -4.102, 2.484, 3.251, 3.908, -4.800, 37.449 ], "bp2_params": [ 1.239, -0.782, -0.835, -0.177, -12.759, -13.279 ], "groove_widths": [ 19.889, 14.474, 15.789, 15.773 ], "simple_Rise": 3.530, "simple_Twist": 27.211, "simple_hRise": 3.133, "simple_hTwist": 27.493 }, { "index": 15, "nt1": "///A/20", "nt2": "///B/29", "bp": "U-U", "name": "--", "Saenger": "--", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 1.239, -0.782, -0.835, -0.177, -12.759, -13.279 ], "step_params": [ 1.218, -1.852, 3.208, -1.748, 3.472, 31.295 ], "heli_params": [ -4.016, -2.547, 2.920, 6.406, 3.224, 31.530 ], "bp2_params": [ 0.584, -0.359, -0.337, 4.983, 1.786, 2.632 ], "groove_widths": [ 18.380, null, 15.015, null ], "simple_Rise": 3.208, "simple_Twist": 34.745, "simple_hRise": 2.952, "simple_hTwist": 34.955 }, { "index": 16, "nt1": "///A/21", "nt2": "///B/28", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.584, -0.359, -0.337, 4.983, 1.786, 2.632 ], "step_params": [ 0.591, -2.036, 3.318, 1.429, 7.909, 21.927 ], "heli_params": [ -7.504, -1.015, 2.474, 19.952, -3.604, 23.336 ], "bp2_params": [ -0.907, -0.282, 0.049, 1.237, -8.765, -0.870 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.318, "simple_Twist": 30.440, "simple_hRise": 2.740, "simple_hTwist": 31.459 }, { "index": 17, "nt1": "///A/22", "nt2": "///B/27", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.907, -0.282, 0.049, 1.237, -8.765, -0.870 ], "step_params": [ 1.031, -2.093, 3.291, 3.995, 2.659, 41.426 ], "heli_params": [ -3.222, -1.027, 3.238, 3.743, -5.625, 41.691 ], "bp2_params": [ 0.479, 0.363, -0.249, 4.480, 4.162, 6.058 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.291, "simple_Twist": 33.738, "simple_hRise": 3.219, "simple_hTwist": 34.068 }, { "index": 18, "nt1": "///A/23", "nt2": "///B/26", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] } ], "num_stems": 3, "stems": [ { "index": 1, "helix_index": 1, "strand1": "GCG", "strand2": "CGC", "bp_type": "|||", "helix_form": "AA", "helical_rise": 3.217, "helical_rise_std": 0.126, "helical_radius": 9.255, "helical_radius_std": 0.662, "helical_axis": [ 0.593, 0.002, 0.805 ], "point1": [ -3.456, -17.948, -38.442 ], "point2": [ 0.381, -17.934, -33.230 ], "num_pairs": 3, "pairs": [ { "index": 1, "nt1": "///A/3", "nt2": "///B/46", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.844, -0.329, -0.284, -2.062, -2.583, 0.923 ], "step_params": [ -0.759, -2.331, 3.290, -4.071, -3.697, 33.439 ], "heli_params": [ -3.371, 0.609, 3.584, -6.372, 7.016, 33.876 ], "bp2_params": [ -0.394, -0.203, 0.228, 3.017, -8.325, -3.280 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.290, "simple_Twist": 30.767, "simple_hRise": 3.606, "simple_hTwist": 31.243 }, { "index": 2, "nt1": "///A/4", "nt2": "///B/45", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.394, -0.203, 0.228, 3.017, -8.325, -3.280 ], "step_params": [ 0.090, -1.569, 3.133, -0.413, 7.619, 28.536 ], "heli_params": [ -4.533, -0.255, 2.633, 15.118, 0.819, 29.518 ], "bp2_params": [ -1.002, -0.279, -0.265, 3.320, 0.264, 2.982 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.133, "simple_Twist": 32.092, "simple_hRise": 2.698, "simple_hTwist": 32.963 }, { "index": 3, "nt1": "///A/5", "nt2": "///B/44", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 2, "helix_index": 1, "strand1": "CACCGGUG", "strand2": "GUGGCCAC", "bp_type": "||||||||", "helix_form": "AAAAAA.", "helical_rise": 2.786, "helical_rise_std": 0.304, "helical_radius": 9.158, "helical_radius_std": 0.362, "helical_axis": [ 0.501, 0.268, 0.823 ], "point1": [ 9.194, -16.762, -25.290 ], "point2": [ 18.985, -11.524, -9.204 ], "num_pairs": 8, "pairs": [ { "index": 1, "nt1": "///A/9", "nt2": "///B/39", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.013, 0.070, -0.098, 8.129, -17.909, 5.587 ], "step_params": [ -0.339, -1.419, 3.242, -6.058, 11.035, 32.575 ], "heli_params": [ -3.933, -0.294, 2.656, 18.819, 10.332, 34.861 ], "bp2_params": [ -0.273, 0.113, 0.460, 6.707, -14.646, -0.376 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.242, "simple_Twist": 34.036, "simple_hRise": 2.688, "simple_hTwist": 36.225 }, { "index": 2, "nt1": "///A/10", "nt2": "///B/38", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.273, 0.113, 0.460, 6.707, -14.646, -0.376 ], "step_params": [ 0.782, -1.528, 3.301, 6.247, 3.765, 35.172 ], "heli_params": [ -3.021, -0.369, 3.213, 6.148, -10.202, 35.897 ], "bp2_params": [ 0.644, 0.086, 0.017, 4.310, -15.619, 5.676 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.301, "simple_Twist": 30.131, "simple_hRise": 3.185, "simple_hTwist": 30.982 }, { "index": 3, "nt1": "///A/11", "nt2": "///B/37", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.644, 0.086, 0.017, 4.310, -15.619, 5.676 ], "step_params": [ -0.793, -1.909, 3.347, -1.226, 4.430, 29.738 ], "heli_params": [ -4.572, 1.280, 3.066, 8.566, 2.370, 30.083 ], "bp2_params": [ 0.060, -0.087, 0.034, 0.953, -4.631, -0.228 ], "groove_widths": [ 16.300, null, 16.637, null ], "simple_Rise": 3.347, "simple_Twist": 32.639, "simple_hRise": 3.095, "simple_hTwist": 32.952 }, { "index": 4, "nt1": "///A/12", "nt2": "///B/36", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.060, -0.087, 0.034, 0.953, -4.631, -0.228 ], "step_params": [ 0.306, -1.594, 3.207, 1.291, 9.334, 28.239 ], "heli_params": [ -4.881, -0.351, 2.571, 18.492, -2.558, 29.740 ], "bp2_params": [ -0.156, 0.037, 0.305, -2.136, -12.375, 3.557 ], "groove_widths": [ 17.010, 15.976, 16.023, 13.542 ], "simple_Rise": 3.207, "simple_Twist": 29.457, "simple_hRise": 2.602, "simple_hTwist": 30.896 }, { "index": 5, "nt1": "///A/13", "nt2": "///B/35", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.156, 0.037, 0.305, -2.136, -12.375, 3.557 ], "step_params": [ -0.072, -1.275, 3.367, 3.691, 10.852, 33.517 ], "heli_params": [ -3.652, 0.647, 2.809, 18.170, -6.180, 35.369 ], "bp2_params": [ -0.081, -0.146, -0.219, -5.756, -24.195, 1.459 ], "groove_widths": [ 17.267, null, 15.050, null ], "simple_Rise": 3.367, "simple_Twist": 32.898, "simple_hRise": 2.795, "simple_hTwist": 34.786 }, { "index": 6, "nt1": "///A/14", "nt2": "///B/34", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.081, -0.146, -0.219, -5.756, -24.195, 1.459 ], "step_params": [ 0.768, -0.960, 3.024, -3.805, 6.635, 36.046 ], "heli_params": [ -2.320, -1.675, 2.719, 10.575, 6.065, 36.822 ], "bp2_params": [ 0.543, -0.347, 0.337, -2.194, -17.951, 6.314 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.024, "simple_Twist": 32.694, "simple_hRise": 2.680, "simple_hTwist": 33.553 }, { "index": 7, "nt1": "///A/15", "nt2": "///B/33", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.543, -0.347, 0.337, -2.194, -17.951, 6.314 ], "step_params": [ -0.047, -1.738, 3.231, 6.568, 19.684, 26.556 ], "heli_params": [ -5.666, 0.968, 1.559, 36.579, -12.205, 33.586 ], "bp2_params": [ -0.249, -0.384, -0.558, -7.347, -15.954, -1.122 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.231, "simple_Twist": 30.888, "simple_hRise": 1.799, "simple_hTwist": 37.070 }, { "index": 8, "nt1": "///A/16", "nt2": "///B/32", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 3, "helix_index": 1, "strand1": "CGC", "strand2": "GCG", "bp_type": "|||", "helix_form": "AA", "helical_rise": 2.655, "helical_rise_std": 0.105, "helical_radius": 9.492, "helical_radius_std": 0.344, "helical_axis": [ 0.316, -0.023, 0.949 ], "point1": [ 22.851, -11.704, 1.752 ], "point2": [ 24.508, -11.825, 6.729 ], "num_pairs": 3, "pairs": [ { "index": 1, "nt1": "///A/21", "nt2": "///B/28", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.584, -0.359, -0.337, 4.983, 1.786, 2.632 ], "step_params": [ 0.591, -2.036, 3.318, 1.429, 7.909, 21.927 ], "heli_params": [ -7.504, -1.015, 2.474, 19.952, -3.604, 23.336 ], "bp2_params": [ -0.907, -0.282, 0.049, 1.237, -8.765, -0.870 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.318, "simple_Twist": 30.440, "simple_hRise": 2.740, "simple_hTwist": 31.459 }, { "index": 2, "nt1": "///A/22", "nt2": "///B/27", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.907, -0.282, 0.049, 1.237, -8.765, -0.870 ], "step_params": [ 1.031, -2.093, 3.291, 3.995, 2.659, 41.426 ], "heli_params": [ -3.222, -1.027, 3.238, 3.743, -5.625, 41.691 ], "bp2_params": [ 0.479, 0.363, -0.249, 4.480, 4.162, 6.058 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.291, "simple_Twist": 33.738, "simple_hRise": 3.219, "simple_hTwist": 34.068 }, { "index": 3, "nt1": "///A/23", "nt2": "///B/26", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] } ], "num_isoCanonPairs": 2, "isoCanonPairs": [ { "index": -1, "helix_index": 1, "nt1": "///A/7", "nt2": "///B/42", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" }, { "index": -2, "helix_index": 1, "nt1": "///A/19", "nt2": "///B/30", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ], "num_coaxStacks": 1, "coaxStacks": [ { "index": 1, "helix_index": 1, "num_stems": 3, "stem_indices": [ 1, 2, 3 ] } ], "num_stacks": 6, "stacks": [ { "index": 1, "num_nts": 2, "nts_short": "AA", "nts_long": "///A/17,///A/18" }, { "index": 2, "num_nts": 2, "nts_short": "AA", "nts_long": "///B/40,///B/41" }, { "index": 3, "num_nts": 3, "nts_short": "GUC", "nts_long": "///A/5,///A/6,///A/7" }, { "index": 4, "num_nts": 3, "nts_short": "GUC", "nts_long": "///B/28,///B/29,///B/30" }, { "index": 5, "num_nts": 5, "nts_short": "CAGUC", "nts_long": "///A/9,///A/8,///B/42,///B/43,///B/44" }, { "index": 6, "num_nts": 5, "nts_short": "CUGAC", "nts_long": "///A/21,///A/20,///A/19,///B/31,///B/32" } ], "num_iloops": 4, "iloops": [ { "index": 1, "type": "symmetric internal loop", "bridging_nts": [ 1, 1 ], "stem_indices": [ 1, -1 ], "summary": "[2] 1 1 [A.5 B.44 A.7 B.42] 3 1", "num_nts": 6, "nts_short": "GUCGUC", "nts_long": "///A/5,///A/6,///A/7,///B/42,///B/43,///B/44", "num_stems": 2, "bridges": [ { "index": 1, "num_nts": 1, "nts_short": "U", "nts_long": "///A/6" }, { "index": 2, "num_nts": 1, "nts_short": "U", "nts_long": "///B/43" } ] }, { "index": 2, "type": "symmetric internal loop", "bridging_nts": [ 1, 1 ], "stem_indices": [ -2, 3 ], "summary": "[2] 1 1 [A.19 B.30 A.21 B.28] 1 3", "num_nts": 6, "nts_short": "GUCGUC", "nts_long": "///A/19,///A/20,///A/21,///B/28,///B/29,///B/30", "num_stems": 2, "bridges": [ { "index": 1, "num_nts": 1, "nts_short": "U", "nts_long": "///A/20" }, { "index": 2, "num_nts": 1, "nts_short": "U", "nts_long": "///B/29" } ] }, { "index": 3, "type": "asymmetric internal loop", "bridging_nts": [ 1, 2 ], "stem_indices": [ -1, 2 ], "summary": "[2] 1 2 [A.7 B.42 A.9 B.39] 1 8", "num_nts": 7, "nts_short": "CACGAAG", "nts_long": "///A/7,///A/8,///A/9,///B/39,///B/40,///B/41,///B/42", "num_stems": 2, "bridges": [ { "index": 1, "num_nts": 1, "nts_short": "A", "nts_long": "///A/8" }, { "index": 2, "num_nts": 2, "nts_short": "AA", "nts_long": "///B/40,///B/41" } ] }, { "index": 4, "type": "asymmetric internal loop", "bridging_nts": [ 2, 1 ], "stem_indices": [ 2, -2 ], "summary": "[2] 2 1 [A.16 B.32 A.19 B.30] 8 1", "num_nts": 7, "nts_short": "GAAGCAC", "nts_long": "///A/16,///A/17,///A/18,///A/19,///B/30,///B/31,///B/32", "num_stems": 2, "bridges": [ { "index": 1, "num_nts": 2, "nts_short": "AA", "nts_long": "///A/17,///A/18" }, { "index": 2, "num_nts": 1, "nts_short": "A", "nts_long": "///B/31" } ] } ], "num_splayUnits": 4, "splayUnits": [ { "index": 1, "num_nts": 2, "nts_short": "GA", "nts_long": "///A/16,///A/17" }, { "index": 2, "num_nts": 2, "nts_short": "AG", "nts_long": "///A/18,///A/19" }, { "index": 3, "num_nts": 2, "nts_short": "GA", "nts_long": "///B/39,///B/40" }, { "index": 4, "num_nts": 2, "nts_short": "AG", "nts_long": "///B/41,///B/42" } ], "dbn": { "all_chains": { "num_nts": 42, "num_chars": 43, "bseq": "GCGUCACACCGGUGAAGUCGC&GCGUCACACCGGUGAAGUCGC", "sstr": "(((.(.((((((((..(.(((&))).).))))))))..).)))", "form": "AA..AAAAAAAAA.A.AAAA-&AAA.AAAAAAAAA...AAAA-" }, "chain_A": { "num_nts": 21, "num_chars": 21, "bseq": "GCGUCACACCGGUGAAGUCGC", "sstr": "(((.(.((((((((..(.(((", "form": "AA..AAAAAAAAA.A.AAAA-" }, "chain_B": { "num_nts": 21, "num_chars": 21, "bseq": "GCGUCACACCGGUGAAGUCGC", "sstr": "))).).))))))))..).)))", "form": "AAA.AAAAAAAAA...AAAA-" } }, "chains": { "chain_A": { "num_nts": 21, "bseq": "GCGUCACACCGGUGAAGUCGC", "sstr": "(((.(.((((((((..(.(((", "form": "AA..AAAAAAAAA.A.AAAA-", "helical_rise": 2.725, "helical_rise_std": 1.581, "helical_axis": [ 0.442, -0.232, 0.866 ], "point1": [ 1.908, -2.900, -38.536 ], "point2": [ 26.127, -15.603, 8.879 ], "num_chars": 61, "suite": "G1aC1aG1aU1aC1aA1aC1aA1aC1aC1aG1aG1aU1aG!!A1aA3dG1aU1aC1aG1aC" }, "chain_B": { "num_nts": 21, "bseq": "GCGUCACACCGGUGAAGUCGC", "sstr": "))).).))))))))..).)))", "form": "AAA.AAAAAAAAA...AAAA-", "helical_rise": 2.749, "helical_rise_std": 0.918, "helical_axis": [ -0.575, 0.004, -0.818 ], "point1": [ 29.304, -19.859, 5.186 ], "point2": [ -2.281, -19.648, -39.724 ], "num_chars": 61, "suite": "G1aC1aG1aU1aC1aA1aC1aA1aC1aC1aG1aG1aU1aG!!A1aA7dG1aU1aC1aG1aC" } }, "num_nts": 42, "nts": [ { "index": 1, "index_chain": 1, "chain_name": "A", "nt_resnum": 3, "nt_name": "G", "nt_code": "G", "nt_id": "///A/3", "linked_nts": [ null, "///A/4" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack", "alpha": null, "beta": -172.817, "gamma": 70.090, "delta": 85.444, "epsilon": -160.795, "zeta": -66.537, "epsilon_zeta": -94.258, "bb_type": "BI", "chi": -175.878, "glyco_bond": "anti", "C5prime_xyz": [ -1.589, 8.577, 1.462 ], "P_xyz": [ 1.004, 8.949, 2.052 ], "form": "A", "ssZp": 4.504, "Dp": 4.458, "splay_angle": 26.997, "splay_distance": 4.324, "splay_ratio": 0.239, "d22": null, "d64": null, "eta": null, "theta": -143.484, "eta_prime": null, "theta_prime": -144.231, "eta_base": null, "theta_base": -124.764, "v0": 0.929, "v1": -22.791, "v2": 34.721, "v3": -35.215, "v4": 21.606, "amplitude": 36.349, "phase_angle": 17.211, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.004, "frame": { "rmsd": 0.004, "origin": [ -0.900, -15.473, -40.739 ], "x_axis": [ -0.631, -0.699, 0.337 ], "y_axis": [ 0.599, -0.715, -0.361 ], "z_axis": [ 0.493, -0.025, 0.870 ], "quaternion": [ -0.362, 0.231, -0.108, 0.897 ] } }, { "index": 2, "index_chain": 2, "chain_name": "A", "nt_resnum": 4, "nt_name": "C", "nt_code": "C", "nt_id": "///A/4", "linked_nts": [ "///A/3", "///A/5" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -77.768, "beta": -168.957, "gamma": 55.836, "delta": 81.176, "epsilon": -157.237, "zeta": -71.787, "epsilon_zeta": -85.450, "bb_type": "BI", "chi": -163.035, "glyco_bond": "anti", "C5prime_xyz": [ -1.441, 8.834, 0.701 ], "P_xyz": [ 1.077, 9.396, 1.124 ], "form": "A", "ssZp": 4.576, "Dp": 4.594, "splay_angle": 21.666, "splay_distance": 3.432, "splay_ratio": 0.191, "d22": null, "d64": null, "eta": 169.361, "theta": -151.823, "eta_prime": -179.042, "theta_prime": -150.499, "eta_base": -144.496, "theta_base": -125.838, "v0": 0.100, "v1": -25.684, "v2": 40.102, "v3": -40.945, "v4": 25.678, "amplitude": 42.240, "phase_angle": 18.309, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.719, "filter_rmsd": 0.063, "frame": { "rmsd": 0.008, "origin": [ -0.730, -13.928, -36.705 ], "x_axis": [ -0.170, -0.967, 0.190 ], "y_axis": [ 0.825, -0.245, -0.509 ], "z_axis": [ 0.539, 0.070, 0.839 ], "quaternion": [ 0.597, -0.243, 0.146, -0.751 ] } }, { "index": 3, "index_chain": 3, "chain_name": "A", "nt_resnum": 5, "nt_name": "G", "nt_code": "G", "nt_id": "///A/5", "linked_nts": [ "///A/4", "///A/6" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop,phosphate", "alpha": -77.866, "beta": -179.239, "gamma": 57.053, "delta": 80.722, "epsilon": -162.613, "zeta": -68.818, "epsilon_zeta": -93.795, "bb_type": "BI", "chi": -167.192, "glyco_bond": "anti", "C5prime_xyz": [ -1.410, 8.688, 1.008 ], "P_xyz": [ 1.157, 9.138, 1.255 ], "form": ".", "ssZp": 4.679, "Dp": 4.586, "splay_angle": 26.825, "splay_distance": 4.360, "splay_ratio": 0.240, "d22": null, "d64": null, "eta": 162.589, "theta": -152.272, "eta_prime": 174.325, "theta_prime": -153.603, "eta_base": -146.815, "theta_base": -144.463, "v0": 1.987, "v1": -26.056, "v2": 38.965, "v3": -38.759, "v4": 23.252, "amplitude": 40.498, "phase_angle": 15.815, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.815, "filter_rmsd": 0.009, "frame": { "rmsd": 0.009, "origin": [ -0.592, -14.048, -33.277 ], "x_axis": [ 0.174, -0.944, -0.279 ], "y_axis": [ 0.831, 0.293, -0.473 ], "z_axis": [ 0.529, -0.149, 0.836 ], "quaternion": [ 0.759, -0.107, 0.266, -0.585 ] } }, { "index": 4, "index_chain": 4, "chain_name": "A", "nt_resnum": 6, "nt_name": "U", "nt_code": "U", "nt_id": "///A/6", "linked_nts": [ "///A/5", "///A/7" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop,phosphate", "alpha": -59.400, "beta": 178.975, "gamma": 51.662, "delta": 77.075, "epsilon": -142.948, "zeta": -71.984, "epsilon_zeta": -70.964, "bb_type": "BI", "chi": -167.290, "glyco_bond": "anti", "C5prime_xyz": [ -1.666, 8.752, 1.025 ], "P_xyz": [ 0.803, 9.525, 1.389 ], "form": ".", "ssZp": 4.722, "Dp": 4.706, "splay_angle": 31.457, "splay_distance": 4.829, "splay_ratio": 0.272, "d22": 3.765, "d64": 4.229, "eta": 176.953, "theta": -143.619, "eta_prime": -174.884, "theta_prime": -137.873, "eta_base": -153.954, "theta_base": -94.680, "v0": -2.345, "v1": -24.209, "v2": 40.214, "v3": -42.483, "v4": 28.213, "amplitude": 43.231, "phase_angle": 21.532, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.829, "filter_rmsd": 0.103, "frame": { "rmsd": 0.011, "origin": [ -1.189, -14.966, -29.056 ], "x_axis": [ 0.474, -0.798, -0.372 ], "y_axis": [ 0.718, 0.595, -0.361 ], "z_axis": [ 0.510, -0.096, 0.855 ], "quaternion": [ 0.855, -0.078, 0.258, -0.444 ] } }, { "index": 5, "index_chain": 5, "chain_name": "A", "nt_resnum": 7, "nt_name": "C", "nt_code": "C", "nt_id": "///A/7", "linked_nts": [ "///A/6", "///A/8" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,isolated-canonical,non-pair-contact,helix,internal-loop", "alpha": -62.300, "beta": 169.340, "gamma": 55.814, "delta": 83.352, "epsilon": -160.665, "zeta": -66.527, "epsilon_zeta": -94.138, "bb_type": "BI", "chi": -174.182, "glyco_bond": "anti", "C5prime_xyz": [ -1.409, 8.570, 1.388 ], "P_xyz": [ 1.193, 8.886, 1.584 ], "form": "A", "ssZp": 4.673, "Dp": 4.599, "splay_angle": 25.489, "splay_distance": 3.871, "splay_ratio": 0.225, "d22": null, "d64": null, "eta": 164.878, "theta": -144.769, "eta_prime": -174.526, "theta_prime": -144.602, "eta_base": -111.658, "theta_base": -117.790, "v0": 3.296, "v1": -26.790, "v2": 38.926, "v3": -37.867, "v4": 21.716, "amplitude": 40.088, "phase_angle": 13.832, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.923, "filter_rmsd": 0.062, "frame": { "rmsd": 0.009, "origin": [ 1.946, -17.984, -26.963 ], "x_axis": [ 0.758, -0.085, -0.647 ], "y_axis": [ 0.112, 0.994, 0.001 ], "z_axis": [ 0.643, -0.074, 0.762 ], "quaternion": [ 0.937, 0.020, 0.344, -0.053 ] } }, { "index": 6, "index_chain": 6, "chain_name": "A", "nt_resnum": 8, "nt_name": "A", "nt_code": "A", "nt_id": "///A/8", "linked_nts": [ "///A/7", "///A/9" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-pair-contact,internal-loop", "alpha": -69.282, "beta": -170.728, "gamma": 54.624, "delta": 83.523, "epsilon": -146.441, "zeta": -71.344, "epsilon_zeta": -75.097, "bb_type": "BI", "chi": -163.247, "glyco_bond": "anti", "C5prime_xyz": [ -1.131, 8.598, 0.704 ], "P_xyz": [ 1.428, 8.801, 1.171 ], "form": "A", "ssZp": 4.498, "Dp": 4.677, "splay_angle": 24.291, "splay_distance": 3.810, "splay_ratio": 0.212, "d22": null, "d64": null, "eta": 178.362, "theta": -139.819, "eta_prime": -170.740, "theta_prime": -136.495, "eta_base": -130.818, "theta_base": -104.036, "v0": 6.643, "v1": -29.310, "v2": 39.891, "v3": -37.041, "v4": 19.259, "amplitude": 40.435, "phase_angle": 9.410, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.815, "filter_rmsd": 0.037, "frame": { "rmsd": 0.005, "origin": [ 4.601, -20.162, -25.178 ], "x_axis": [ 0.705, 0.530, -0.472 ], "y_axis": [ -0.356, 0.839, 0.411 ], "z_axis": [ 0.614, -0.122, 0.780 ], "quaternion": [ 0.912, 0.146, 0.298, 0.243 ] } }, { "index": 7, "index_chain": 7, "chain_name": "A", "nt_resnum": 9, "nt_name": "C", "nt_code": "C", "nt_id": "///A/9", "linked_nts": [ "///A/8", "///A/10" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop", "alpha": -57.319, "beta": 171.255, "gamma": 47.956, "delta": 79.853, "epsilon": -139.894, "zeta": -82.784, "epsilon_zeta": -57.111, "bb_type": "BI", "chi": -160.024, "glyco_bond": "anti", "C5prime_xyz": [ -1.246, 8.762, 0.553 ], "P_xyz": [ 1.361, 9.078, 0.738 ], "form": "A", "ssZp": 4.440, "Dp": 4.711, "splay_angle": 24.667, "splay_distance": 3.837, "splay_ratio": 0.214, "d22": null, "d64": null, "eta": 169.351, "theta": -149.689, "eta_prime": -175.433, "theta_prime": -147.565, "eta_base": -128.694, "theta_base": -124.334, "v0": 3.671, "v1": -27.011, "v2": 39.043, "v3": -37.844, "v4": 21.552, "amplitude": 40.142, "phase_angle": 13.439, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.902, "filter_rmsd": 0.065, "frame": { "rmsd": 0.005, "origin": [ 8.154, -20.426, -23.828 ], "x_axis": [ 0.262, 0.942, -0.211 ], "y_axis": [ -0.664, 0.335, 0.668 ], "z_axis": [ 0.700, -0.035, 0.713 ], "quaternion": [ 0.760, 0.231, 0.300, 0.528 ] } }, { "index": 8, "index_chain": 8, "chain_name": "A", "nt_resnum": 10, "nt_name": "A", "nt_code": "A", "nt_id": "///A/10", "linked_nts": [ "///A/9", "///A/11" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -65.595, "beta": 165.052, "gamma": 56.491, "delta": 79.807, "epsilon": -132.647, "zeta": -79.762, "epsilon_zeta": -52.886, "bb_type": "BI", "chi": -168.064, "glyco_bond": "anti", "C5prime_xyz": [ -1.335, 8.538, 0.972 ], "P_xyz": [ 1.237, 8.880, 0.859 ], "form": "A", "ssZp": 4.630, "Dp": 4.808, "splay_angle": 22.907, "splay_distance": 3.633, "splay_ratio": 0.202, "d22": null, "d64": null, "eta": 167.511, "theta": -138.598, "eta_prime": 176.834, "theta_prime": -136.707, "eta_base": -148.995, "theta_base": -103.352, "v0": 5.995, "v1": -30.155, "v2": 41.370, "v3": -39.127, "v4": 21.062, "amplitude": 42.101, "phase_angle": 10.692, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.860, "filter_rmsd": 0.036, "frame": { "rmsd": 0.008, "origin": [ 11.556, -20.185, -22.070 ], "x_axis": [ -0.276, 0.960, -0.038 ], "y_axis": [ -0.684, -0.168, 0.710 ], "z_axis": [ 0.675, 0.222, 0.703 ], "quaternion": [ 0.561, 0.217, 0.318, 0.733 ] } }, { "index": 9, "index_chain": 9, "chain_name": "A", "nt_resnum": 11, "nt_name": "C", "nt_code": "C", "nt_id": "///A/11", "linked_nts": [ "///A/10", "///A/12" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -55.601, "beta": 155.958, "gamma": 57.681, "delta": 79.637, "epsilon": -163.064, "zeta": -72.658, "epsilon_zeta": -90.407, "bb_type": "BI", "chi": -162.218, "glyco_bond": "anti", "C5prime_xyz": [ -1.459, 8.835, 0.639 ], "P_xyz": [ 1.079, 9.268, 0.159 ], "form": "A", "ssZp": 4.491, "Dp": 4.540, "splay_angle": 25.461, "splay_distance": 3.993, "splay_ratio": 0.223, "d22": 4.762, "d64": 4.819, "eta": 163.727, "theta": -154.841, "eta_prime": -175.022, "theta_prime": -158.073, "eta_base": -120.781, "theta_base": -143.820, "v0": 0.277, "v1": -26.864, "v2": 42.141, "v3": -42.828, "v4": 26.783, "amplitude": 44.343, "phase_angle": 18.131, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.717, "filter_rmsd": 0.061, "frame": { "rmsd": 0.008, "origin": [ 13.548, -17.373, -20.919 ], "x_axis": [ -0.649, 0.659, 0.380 ], "y_axis": [ -0.250, -0.657, 0.712 ], "z_axis": [ 0.719, 0.366, 0.591 ], "quaternion": [ 0.267, 0.323, 0.317, 0.851 ] } }, { "index": 10, "index_chain": 10, "chain_name": "A", "nt_resnum": 12, "nt_name": "C", "nt_code": "C", "nt_id": "///A/12", "linked_nts": [ "///A/11", "///A/13" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -71.338, "beta": -172.619, "gamma": 51.613, "delta": 81.536, "epsilon": -151.980, "zeta": -69.882, "epsilon_zeta": -82.098, "bb_type": "BI", "chi": -160.835, "glyco_bond": "anti", "C5prime_xyz": [ -1.163, 8.724, 0.484 ], "P_xyz": [ 1.387, 9.114, 0.865 ], "form": "A", "ssZp": 4.421, "Dp": 4.674, "splay_angle": 23.312, "splay_distance": 3.693, "splay_ratio": 0.204, "d22": null, "d64": null, "eta": 172.466, "theta": -147.170, "eta_prime": 178.222, "theta_prime": -144.805, "eta_base": -156.457, "theta_base": -120.052, "v0": 6.667, "v1": -30.637, "v2": 41.632, "v3": -38.931, "v4": 20.403, "amplitude": 42.243, "phase_angle": 9.756, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.798, "filter_rmsd": 0.064, "frame": { "rmsd": 0.005, "origin": [ 16.583, -14.870, -20.234 ], "x_axis": [ -0.807, 0.220, 0.548 ], "y_axis": [ 0.096, -0.866, 0.491 ], "z_axis": [ 0.583, 0.449, 0.678 ], "quaternion": [ 0.034, 0.309, 0.257, 0.915 ] } }, { "index": 11, "index_chain": 11, "chain_name": "A", "nt_resnum": 13, "nt_name": "G", "nt_code": "G", "nt_id": "///A/13", "linked_nts": [ "///A/12", "///A/14" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -70.190, "beta": 171.104, "gamma": 60.136, "delta": 81.548, "epsilon": -145.268, "zeta": -82.176, "epsilon_zeta": -63.091, "bb_type": "BI", "chi": -166.114, "glyco_bond": "anti", "C5prime_xyz": [ -1.448, 8.723, 0.823 ], "P_xyz": [ 1.128, 9.219, 0.718 ], "form": "A", "ssZp": 4.605, "Dp": 4.700, "splay_angle": 21.632, "splay_distance": 3.413, "splay_ratio": 0.190, "d22": null, "d64": null, "eta": 167.739, "theta": -149.250, "eta_prime": -177.096, "theta_prime": -148.779, "eta_base": -137.723, "theta_base": -123.430, "v0": 2.184, "v1": -26.562, "v2": 39.421, "v3": -39.130, "v4": 23.335, "amplitude": 40.915, "phase_angle": 15.531, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.903, "filter_rmsd": 0.004, "frame": { "rmsd": 0.004, "origin": [ 17.549, -11.978, -18.149 ], "x_axis": [ -0.695, -0.280, 0.662 ], "y_axis": [ 0.518, -0.834, 0.191 ], "z_axis": [ 0.498, 0.476, 0.725 ], "quaternion": [ -0.221, 0.322, 0.185, 0.902 ] } }, { "index": 12, "index_chain": 12, "chain_name": "A", "nt_resnum": 14, "nt_name": "G", "nt_code": "G", "nt_id": "///A/14", "linked_nts": [ "///A/13", "///A/15" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -55.655, "beta": 164.687, "gamma": 51.860, "delta": 82.660, "epsilon": -146.100, "zeta": -71.276, "epsilon_zeta": -74.825, "bb_type": "BI", "chi": -159.688, "glyco_bond": "anti", "C5prime_xyz": [ -1.407, 8.779, 0.542 ], "P_xyz": [ 1.189, 9.165, 0.427 ], "form": "A", "ssZp": 4.462, "Dp": 4.640, "splay_angle": 22.818, "splay_distance": 3.621, "splay_ratio": 0.199, "d22": null, "d64": null, "eta": 169.789, "theta": -138.484, "eta_prime": -177.257, "theta_prime": -138.436, "eta_base": -137.520, "theta_base": -101.270, "v0": 2.246, "v1": -25.832, "v2": 38.377, "v3": -38.054, "v4": 22.480, "amplitude": 39.799, "phase_angle": 15.365, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.844, "filter_rmsd": 0.008, "frame": { "rmsd": 0.008, "origin": [ 17.588, -9.653, -15.651 ], "x_axis": [ -0.332, -0.693, 0.640 ], "y_axis": [ 0.867, -0.491, -0.081 ], "z_axis": [ 0.370, 0.528, 0.764 ], "quaternion": [ -0.485, 0.314, 0.139, 0.804 ] } }, { "index": 13, "index_chain": 13, "chain_name": "A", "nt_resnum": 15, "nt_name": "U", "nt_code": "U", "nt_id": "///A/15", "linked_nts": [ "///A/14", "///A/16" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -61.670, "beta": 165.898, "gamma": 54.849, "delta": 82.721, "epsilon": -139.970, "zeta": -85.200, "epsilon_zeta": -54.770, "bb_type": "BI", "chi": -163.530, "glyco_bond": "anti", "C5prime_xyz": [ -1.474, 8.725, 0.695 ], "P_xyz": [ 1.101, 9.218, 0.608 ], "form": "A", "ssZp": 4.531, "Dp": 4.705, "splay_angle": 19.021, "splay_distance": 3.254, "splay_ratio": 0.174, "d22": null, "d64": null, "eta": 166.681, "theta": -144.018, "eta_prime": -175.450, "theta_prime": -139.880, "eta_base": -119.408, "theta_base": -128.735, "v0": 3.333, "v1": -27.362, "v2": 39.546, "v3": -38.586, "v4": 22.244, "amplitude": 40.741, "phase_angle": 13.906, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.959, "filter_rmsd": 0.104, "frame": { "rmsd": 0.004, "origin": [ 17.393, -9.370, -12.047 ], "x_axis": [ 0.248, -0.899, 0.361 ], "y_axis": [ 0.926, 0.110, -0.362 ], "z_axis": [ 0.285, 0.424, 0.859 ], "quaternion": [ 0.745, -0.264, -0.025, -0.613 ] } }, { "index": 14, "index_chain": 14, "chain_name": "A", "nt_resnum": 16, "nt_name": "G", "nt_code": "G", "nt_id": "///A/16", "linked_nts": [ "///A/15", "///A/17" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop,splayed-apart", "alpha": -50.319, "beta": 156.403, "gamma": 69.109, "delta": 106.319, "epsilon": -143.534, "zeta": -38.262, "epsilon_zeta": -105.272, "bb_type": "BI", "chi": -152.538, "glyco_bond": "anti", "C5prime_xyz": [ -2.559, 8.889, -0.223 ], "P_xyz": [ -0.119, 9.870, -0.038 ], "form": ".", "ssZp": 2.635, "Dp": 2.699, "splay_angle": 113.932, "splay_distance": 16.560, "splay_ratio": 0.838, "d22": null, "d64": null, "eta": -169.387, "theta": -47.965, "eta_prime": -149.503, "theta_prime": -94.432, "eta_base": -130.938, "theta_base": -142.082, "v0": -22.986, "v1": 7.214, "v2": 9.857, "v3": -23.460, "v4": 29.020, "amplitude": 28.616, "phase_angle": 69.850, "puckering": "C4'-exo", "sugar_class": "--", "bin": "33p", "cluster": "1a", "suiteness": 0.010, "filter_rmsd": 0.007, "frame": { "rmsd": 0.007, "origin": [ 16.560, -9.262, -8.903 ], "x_axis": [ 0.497, -0.864, -0.084 ], "y_axis": [ 0.820, 0.499, -0.280 ], "z_axis": [ 0.284, 0.071, 0.956 ], "quaternion": [ 0.859, -0.102, 0.107, -0.490 ] } }, { "index": 15, "index_chain": 15, "chain_name": "A", "nt_resnum": 17, "nt_name": "A", "nt_code": "A", "nt_id": "///A/17", "linked_nts": [ "///A/16", "///A/18" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-pair-contact,internal-loop,splayed-apart", "alpha": 98.514, "beta": 133.332, "gamma": 50.896, "delta": 73.971, "epsilon": -160.358, "zeta": -64.640, "epsilon_zeta": -95.717, "bb_type": "BI", "chi": -167.686, "glyco_bond": "anti", "C5prime_xyz": [ -2.295, 8.939, 0.767 ], "P_xyz": [ 0.189, 9.792, 0.527 ], "form": "A", "ssZp": 4.530, "Dp": 4.448, "splay_angle": 23.886, "splay_distance": 3.786, "splay_ratio": 0.209, "d22": null, "d64": null, "eta": -77.120, "theta": -144.291, "eta_prime": -20.242, "theta_prime": -147.459, "eta_base": 28.841, "theta_base": -103.959, "v0": -12.893, "v1": -14.122, "v2": 34.176, "v3": -42.254, "v4": 34.736, "amplitude": 42.119, "phase_angle": 35.764, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.005, "origin": [ 19.470, 3.849, 0.785 ], "x_axis": [ -0.721, 0.574, -0.388 ], "y_axis": [ 0.175, -0.392, -0.903 ], "z_axis": [ -0.671, -0.719, 0.182 ], "quaternion": [ 0.132, -0.350, -0.535, 0.757 ] } }, { "index": 16, "index_chain": 16, "chain_name": "A", "nt_resnum": 18, "nt_name": "A", "nt_code": "A", "nt_id": "///A/18", "linked_nts": [ "///A/17", "///A/19" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-pair-contact,internal-loop,phosphate,splayed-apart", "alpha": -75.298, "beta": -173.693, "gamma": 51.308, "delta": 84.335, "epsilon": -98.894, "zeta": -135.461, "epsilon_zeta": 36.566, "bb_type": "--", "chi": -155.213, "glyco_bond": "anti", "C5prime_xyz": [ -1.356, 8.723, 0.228 ], "P_xyz": [ 1.204, 9.248, 0.467 ], "form": ".", "ssZp": 3.823, "Dp": 4.724, "splay_angle": 145.008, "splay_distance": 16.529, "splay_ratio": 0.954, "d22": null, "d64": null, "eta": -179.456, "theta": -124.784, "eta_prime": -170.890, "theta_prime": -111.110, "eta_base": -118.043, "theta_base": -80.355, "v0": 2.089, "v1": -25.432, "v2": 37.540, "v3": -37.493, "v4": 22.435, "amplitude": 38.989, "phase_angle": 15.668, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.714, "filter_rmsd": 0.038, "frame": { "rmsd": 0.003, "origin": [ 15.749, 3.200, 1.045 ], "x_axis": [ -0.335, 0.150, -0.930 ], "y_axis": [ 0.554, -0.767, -0.323 ], "z_axis": [ -0.762, -0.624, 0.174 ], "quaternion": [ -0.134, -0.561, -0.314, 0.754 ] } }, { "index": 17, "index_chain": 17, "chain_name": "A", "nt_resnum": 19, "nt_name": "G", "nt_code": "G", "nt_id": "///A/19", "linked_nts": [ "///A/18", "///A/20" ], "nt_type": "RNA", "dbn": "(", "summary": "~C3'-endo,BI,isolated-canonical,non-pair-contact,helix,internal-loop,phosphate,splayed-apart", "alpha": 56.117, "beta": 141.599, "gamma": 43.522, "delta": 85.355, "epsilon": -138.040, "zeta": -75.357, "epsilon_zeta": -62.683, "bb_type": "BI", "chi": 177.769, "glyco_bond": "--", "C5prime_xyz": [ -0.816, 7.975, 1.912 ], "P_xyz": [ 1.724, 7.328, 1.665 ], "form": "A", "ssZp": 4.938, "Dp": 4.799, "splay_angle": 27.724, "splay_distance": 4.265, "splay_ratio": 0.249, "d22": null, "d64": null, "eta": -111.156, "theta": -129.020, "eta_prime": -103.791, "theta_prime": -130.442, "eta_base": -108.316, "theta_base": -123.458, "v0": 17.946, "v1": -37.681, "v2": 42.222, "v3": -32.713, "v4": 9.340, "amplitude": 42.452, "phase_angle": 354.037, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "3d", "suiteness": 0.250, "filter_rmsd": 0.014, "frame": { "rmsd": 0.014, "origin": [ 16.688, -13.032, -1.930 ], "x_axis": [ 0.885, 0.214, -0.413 ], "y_axis": [ -0.092, 0.951, 0.295 ], "z_axis": [ 0.456, -0.223, 0.862 ], "quaternion": [ 0.961, 0.135, 0.226, 0.080 ] } }, { "index": 18, "index_chain": 18, "chain_name": "A", "nt_resnum": 20, "nt_name": "U", "nt_code": "U", "nt_id": "///A/20", "linked_nts": [ "///A/19", "///A/21" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop", "alpha": -51.499, "beta": -178.016, "gamma": 46.772, "delta": 80.838, "epsilon": -152.570, "zeta": -66.997, "epsilon_zeta": -85.574, "bb_type": "BI", "chi": -159.312, "glyco_bond": "anti", "C5prime_xyz": [ -1.209, 8.652, 0.522 ], "P_xyz": [ 1.355, 9.020, 0.866 ], "form": "A", "ssZp": 4.479, "Dp": 4.683, "splay_angle": 25.057, "splay_distance": 3.862, "splay_ratio": 0.218, "d22": 4.050, "d64": 4.021, "eta": 178.090, "theta": -144.186, "eta_prime": -169.226, "theta_prime": -139.814, "eta_base": -141.287, "theta_base": -104.914, "v0": 7.209, "v1": -29.862, "v2": 39.992, "v3": -36.879, "v4": 18.777, "amplitude": 40.446, "phase_angle": 8.587, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.755, "filter_rmsd": 0.104, "frame": { "rmsd": 0.004, "origin": [ 19.028, -16.177, -0.249 ], "x_axis": [ 0.745, 0.650, -0.152 ], "y_axis": [ -0.490, 0.687, 0.537 ], "z_axis": [ 0.453, -0.325, 0.830 ], "quaternion": [ 0.903, 0.239, 0.168, 0.315 ] } }, { "index": 19, "index_chain": 19, "chain_name": "A", "nt_resnum": 21, "nt_name": "C", "nt_code": "C", "nt_id": "///A/21", "linked_nts": [ "///A/20", "///A/22" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop", "alpha": -64.695, "beta": 179.551, "gamma": 51.986, "delta": 82.817, "epsilon": -141.936, "zeta": -77.473, "epsilon_zeta": -64.464, "bb_type": "BI", "chi": -158.552, "glyco_bond": "anti", "C5prime_xyz": [ -1.164, 8.694, 0.436 ], "P_xyz": [ 1.428, 8.904, 0.668 ], "form": "A", "ssZp": 4.383, "Dp": 4.724, "splay_angle": 24.476, "splay_distance": 4.060, "splay_ratio": 0.216, "d22": null, "d64": null, "eta": 172.600, "theta": -142.596, "eta_prime": -173.673, "theta_prime": -142.705, "eta_base": -127.241, "theta_base": -131.376, "v0": 5.158, "v1": -27.735, "v2": 38.524, "v3": -36.648, "v4": 19.883, "amplitude": 39.282, "phase_angle": 11.275, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.964, "filter_rmsd": 0.061, "frame": { "rmsd": 0.004, "origin": [ 22.331, -16.510, 1.725 ], "x_axis": [ 0.178, 0.981, 0.078 ], "y_axis": [ -0.802, 0.098, 0.589 ], "z_axis": [ 0.570, -0.168, 0.804 ], "quaternion": [ 0.721, 0.262, 0.170, 0.618 ] } }, { "index": 20, "index_chain": 20, "chain_name": "A", "nt_resnum": 22, "nt_name": "G", "nt_code": "G", "nt_id": "///A/22", "linked_nts": [ "///A/21", "///A/23" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -60.040, "beta": 156.847, "gamma": 62.503, "delta": 75.581, "epsilon": -161.715, "zeta": -58.805, "epsilon_zeta": -102.911, "bb_type": "BI", "chi": -170.172, "glyco_bond": "anti", "C5prime_xyz": [ -1.908, 8.822, 1.108 ], "P_xyz": [ 0.485, 9.762, 0.687 ], "form": "A", "ssZp": 4.757, "Dp": 4.603, "splay_angle": 25.226, "splay_distance": 4.027, "splay_ratio": 0.226, "d22": null, "d64": null, "eta": 164.517, "theta": -144.908, "eta_prime": -178.327, "theta_prime": -145.171, "eta_base": -148.160, "theta_base": -106.628, "v0": -6.016, "v1": -21.952, "v2": 40.040, "v3": -44.312, "v4": 31.781, "amplitude": 44.557, "phase_angle": 26.020, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.729, "filter_rmsd": 0.012, "frame": { "rmsd": 0.012, "origin": [ 25.944, -16.855, 3.545 ], "x_axis": [ -0.139, 0.963, 0.229 ], "y_axis": [ -0.806, -0.244, 0.539 ], "z_axis": [ 0.575, -0.110, 0.811 ], "quaternion": [ 0.597, 0.271, 0.145, 0.741 ] } }, { "index": 21, "index_chain": 21, "chain_name": "A", "nt_resnum": 23, "nt_name": "C", "nt_code": "C", "nt_id": "///A/23", "linked_nts": [ "///A/22", null ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack", "alpha": -72.288, "beta": -162.229, "gamma": 47.376, "delta": 76.721, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": -148.819, "glyco_bond": "anti", "C5prime_xyz": [ -1.281, 8.812, -0.097 ], "P_xyz": [ 1.237, 9.351, 0.451 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": 3.479, "v1": -26.513, "v2": 38.292, "v3": -37.439, "v4": 21.347, "amplitude": 39.418, "phase_angle": 13.730, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.595, "filter_rmsd": 0.064, "frame": { "rmsd": 0.006, "origin": [ 28.196, -14.422, 5.830 ], "x_axis": [ -0.730, 0.513, 0.452 ], "y_axis": [ -0.377, -0.854, 0.359 ], "z_axis": [ 0.570, 0.092, 0.817 ], "quaternion": [ 0.241, 0.277, 0.122, 0.922 ] } }, { "index": 22, "index_chain": 1, "chain_name": "B", "nt_resnum": 26, "nt_name": "G", "nt_code": "G", "nt_id": "///B/26", "linked_nts": [ null, "///B/27" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack", "alpha": null, "beta": 144.072, "gamma": 57.523, "delta": 82.521, "epsilon": -156.423, "zeta": -71.362, "epsilon_zeta": -85.061, "bb_type": "BI", "chi": 173.232, "glyco_bond": "anti", "C5prime_xyz": [ -1.833, 8.361, 2.031 ], "P_xyz": [ 0.804, 8.687, 2.270 ], "form": "A", "ssZp": 4.556, "Dp": 4.507, "splay_angle": 27.254, "splay_distance": 4.155, "splay_ratio": 0.240, "d22": null, "d64": null, "eta": null, "theta": -142.999, "eta_prime": null, "theta_prime": -145.106, "eta_base": null, "theta_base": -122.634, "v0": -1.898, "v1": -21.193, "v2": 34.835, "v3": -37.024, "v4": 24.568, "amplitude": 37.448, "phase_angle": 21.530, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.009, "frame": { "rmsd": 0.009, "origin": [ 28.829, -14.380, 5.685 ], "x_axis": [ -0.642, 0.603, 0.474 ], "y_axis": [ 0.495, 0.798, -0.344 ], "z_axis": [ -0.585, 0.014, -0.811 ], "quaternion": [ -0.294, 0.304, 0.901, -0.092 ] } }, { "index": 23, "index_chain": 2, "chain_name": "B", "nt_resnum": 27, "nt_name": "C", "nt_code": "C", "nt_id": "///B/27", "linked_nts": [ "///B/26", "///B/28" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -81.477, "beta": -163.181, "gamma": 53.433, "delta": 84.201, "epsilon": -159.302, "zeta": -73.879, "epsilon_zeta": -85.423, "bb_type": "BI", "chi": -165.354, "glyco_bond": "anti", "C5prime_xyz": [ -1.133, 8.639, 0.872 ], "P_xyz": [ 1.408, 8.821, 1.512 ], "form": "A", "ssZp": 4.628, "Dp": 4.633, "splay_angle": 25.229, "splay_distance": 3.940, "splay_ratio": 0.222, "d22": null, "d64": null, "eta": 168.178, "theta": -152.640, "eta_prime": 177.743, "theta_prime": -151.248, "eta_base": -143.590, "theta_base": -139.082, "v0": 5.949, "v1": -28.614, "v2": 39.078, "v3": -36.686, "v4": 19.382, "amplitude": 39.698, "phase_angle": 10.138, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.622, "filter_rmsd": 0.062, "frame": { "rmsd": 0.004, "origin": [ 25.518, -16.047, 3.808 ], "x_axis": [ -0.236, 0.966, 0.110 ], "y_axis": [ 0.815, 0.258, -0.518 ], "z_axis": [ -0.529, -0.032, -0.848 ], "quaternion": [ -0.209, 0.582, 0.765, -0.180 ] } }, { "index": 24, "index_chain": 3, "chain_name": "B", "nt_resnum": 28, "nt_name": "G", "nt_code": "G", "nt_id": "///B/28", "linked_nts": [ "///B/27", "///B/29" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop,phosphate", "alpha": -78.789, "beta": -176.425, "gamma": 56.056, "delta": 80.953, "epsilon": -166.278, "zeta": -72.411, "epsilon_zeta": -93.866, "bb_type": "BI", "chi": -172.440, "glyco_bond": "anti", "C5prime_xyz": [ -1.467, 8.594, 1.222 ], "P_xyz": [ 1.088, 9.023, 1.641 ], "form": "A", "ssZp": 4.642, "Dp": 4.588, "splay_angle": 25.875, "splay_distance": 4.007, "splay_ratio": 0.231, "d22": null, "d64": null, "eta": 162.509, "theta": -158.959, "eta_prime": 172.271, "theta_prime": -158.407, "eta_base": -161.390, "theta_base": -148.040, "v0": 2.491, "v1": -27.149, "v2": 40.302, "v3": -39.781, "v4": 23.491, "amplitude": 41.757, "phase_angle": 15.171, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.772, "filter_rmsd": 0.006, "frame": { "rmsd": 0.006, "origin": [ 22.096, -17.094, 2.158 ], "x_axis": [ 0.232, 0.969, 0.079 ], "y_axis": [ 0.839, -0.159, -0.520 ], "z_axis": [ -0.492, 0.187, -0.850 ], "quaternion": [ -0.236, 0.748, 0.604, -0.138 ] } }, { "index": 25, "index_chain": 4, "chain_name": "B", "nt_resnum": 29, "nt_name": "U", "nt_code": "U", "nt_id": "///B/29", "linked_nts": [ "///B/28", "///B/30" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop,phosphate", "alpha": -69.627, "beta": -170.296, "gamma": 51.067, "delta": 77.961, "epsilon": -145.742, "zeta": -64.708, "epsilon_zeta": -81.034, "bb_type": "BI", "chi": -161.293, "glyco_bond": "anti", "C5prime_xyz": [ -1.207, 8.637, 0.712 ], "P_xyz": [ 1.376, 9.032, 0.890 ], "form": ".", "ssZp": 4.617, "Dp": 4.748, "splay_angle": 31.960, "splay_distance": 4.908, "splay_ratio": 0.279, "d22": 3.908, "d64": 4.617, "eta": 172.679, "theta": -138.839, "eta_prime": 176.341, "theta_prime": -133.119, "eta_base": -164.827, "theta_base": -97.568, "v0": 4.076, "v1": -28.252, "v2": 40.705, "v3": -39.309, "v4": 22.138, "amplitude": 41.790, "phase_angle": 13.086, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.726, "filter_rmsd": 0.104, "frame": { "rmsd": 0.012, "origin": [ 18.243, -16.843, 1.086 ], "x_axis": [ 0.496, 0.844, -0.204 ], "y_axis": [ 0.632, -0.512, -0.581 ], "z_axis": [ -0.595, 0.159, -0.788 ], "quaternion": [ -0.221, 0.836, 0.441, -0.239 ] } }, { "index": 26, "index_chain": 5, "chain_name": "B", "nt_resnum": 30, "nt_name": "C", "nt_code": "C", "nt_id": "///B/30", "linked_nts": [ "///B/29", "///B/31" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,isolated-canonical,non-pair-contact,helix,internal-loop", "alpha": -55.121, "beta": 177.454, "gamma": 53.573, "delta": 79.841, "epsilon": -151.441, "zeta": -75.886, "epsilon_zeta": -75.556, "bb_type": "BI", "chi": -166.125, "glyco_bond": "anti", "C5prime_xyz": [ -1.217, 8.688, 0.929 ], "P_xyz": [ 1.369, 9.046, 1.097 ], "form": "A", "ssZp": 4.664, "Dp": 4.691, "splay_angle": 26.453, "splay_distance": 4.000, "splay_ratio": 0.230, "d22": null, "d64": null, "eta": 175.959, "theta": -150.403, "eta_prime": -165.825, "theta_prime": -147.078, "eta_base": -113.351, "theta_base": -119.432, "v0": 4.584, "v1": -28.892, "v2": 41.135, "v3": -39.437, "v4": 21.976, "amplitude": 42.125, "phase_angle": 12.444, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.878, "filter_rmsd": 0.063, "frame": { "rmsd": 0.009, "origin": [ 17.426, -12.997, -1.851 ], "x_axis": [ 0.866, 0.228, -0.446 ], "y_axis": [ 0.094, -0.948, -0.303 ], "z_axis": [ -0.492, 0.221, -0.842 ], "quaternion": [ -0.137, 0.956, 0.084, -0.245 ] } }, { "index": 27, "index_chain": 6, "chain_name": "B", "nt_resnum": 31, "nt_name": "A", "nt_code": "A", "nt_id": "///B/31", "linked_nts": [ "///B/30", "///B/32" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-pair-contact,internal-loop", "alpha": -56.180, "beta": 171.608, "gamma": 51.723, "delta": 82.231, "epsilon": -143.271, "zeta": -73.291, "epsilon_zeta": -69.980, "bb_type": "BI", "chi": -170.025, "glyco_bond": "anti", "C5prime_xyz": [ -1.253, 8.505, 1.193 ], "P_xyz": [ 1.348, 8.673, 1.439 ], "form": "A", "ssZp": 4.771, "Dp": 4.737, "splay_angle": 24.160, "splay_distance": 3.839, "splay_ratio": 0.214, "d22": null, "d64": null, "eta": 175.499, "theta": -138.234, "eta_prime": -172.373, "theta_prime": -135.812, "eta_base": -132.403, "theta_base": -108.239, "v0": 5.842, "v1": -28.670, "v2": 39.471, "v3": -37.042, "v4": 19.748, "amplitude": 40.130, "phase_angle": 10.392, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.913, "filter_rmsd": 0.038, "frame": { "rmsd": 0.010, "origin": [ 16.535, -10.643, -4.960 ], "x_axis": [ 0.811, -0.351, -0.468 ], "y_axis": [ -0.388, -0.921, 0.017 ], "z_axis": [ -0.437, 0.167, -0.884 ], "quaternion": [ -0.039, 0.951, -0.194, -0.238 ] } }, { "index": 28, "index_chain": 7, "chain_name": "B", "nt_resnum": 32, "nt_name": "C", "nt_code": "C", "nt_id": "///B/32", "linked_nts": [ "///B/31", "///B/33" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop", "alpha": -57.024, "beta": 173.063, "gamma": 49.652, "delta": 81.503, "epsilon": -149.133, "zeta": -75.370, "epsilon_zeta": -73.763, "bb_type": "BI", "chi": -154.900, "glyco_bond": "anti", "C5prime_xyz": [ -1.365, 8.838, 0.321 ], "P_xyz": [ 1.226, 9.292, 0.319 ], "form": "A", "ssZp": 4.361, "Dp": 4.607, "splay_angle": 25.675, "splay_distance": 4.125, "splay_ratio": 0.223, "d22": null, "d64": null, "eta": 171.539, "theta": -146.644, "eta_prime": -173.551, "theta_prime": -144.980, "eta_base": -130.780, "theta_base": -122.410, "v0": 0.122, "v1": -23.973, "v2": 37.636, "v3": -38.487, "v4": 24.071, "amplitude": 39.656, "phase_angle": 18.370, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.921, "filter_rmsd": 0.063, "frame": { "rmsd": 0.008, "origin": [ 17.162, -9.327, -8.511 ], "x_axis": [ 0.431, -0.831, -0.352 ], "y_axis": [ -0.849, -0.505, 0.155 ], "z_axis": [ -0.306, 0.232, -0.923 ], "quaternion": [ -0.023, 0.845, -0.497, -0.195 ] } }, { "index": 29, "index_chain": 8, "chain_name": "B", "nt_resnum": 33, "nt_name": "A", "nt_code": "A", "nt_id": "///B/33", "linked_nts": [ "///B/32", "///B/34" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -58.481, "beta": 176.217, "gamma": 46.194, "delta": 80.423, "epsilon": -151.564, "zeta": -79.310, "epsilon_zeta": -72.254, "bb_type": "BI", "chi": -160.583, "glyco_bond": "anti", "C5prime_xyz": [ -1.478, 8.753, 0.502 ], "P_xyz": [ 1.043, 9.342, 0.931 ], "form": "A", "ssZp": 4.405, "Dp": 4.619, "splay_angle": 18.838, "splay_distance": 2.938, "splay_ratio": 0.164, "d22": null, "d64": null, "eta": 169.458, "theta": -155.113, "eta_prime": -179.572, "theta_prime": -153.166, "eta_base": -145.479, "theta_base": -125.773, "v0": 0.230, "v1": -24.298, "v2": 37.803, "v3": -38.749, "v4": 24.325, "amplitude": 39.824, "phase_angle": 18.330, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.876, "filter_rmsd": 0.037, "frame": { "rmsd": 0.003, "origin": [ 17.539, -8.919, -12.599 ], "x_axis": [ 0.052, -0.992, 0.112 ], "y_axis": [ -0.954, -0.016, 0.301 ], "z_axis": [ -0.297, -0.122, -0.947 ], "quaternion": [ 0.149, 0.710, -0.685, -0.065 ] } }, { "index": 30, "index_chain": 9, "chain_name": "B", "nt_resnum": 34, "nt_name": "C", "nt_code": "C", "nt_id": "///B/34", "linked_nts": [ "///B/33", "///B/35" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -65.908, "beta": 170.728, "gamma": 51.966, "delta": 82.601, "epsilon": -151.199, "zeta": -71.454, "epsilon_zeta": -79.745, "bb_type": "BI", "chi": -151.711, "glyco_bond": "anti", "C5prime_xyz": [ -1.044, 8.718, 0.080 ], "P_xyz": [ 1.560, 8.889, -0.260 ], "form": "A", "ssZp": 4.323, "Dp": 4.692, "splay_angle": 24.442, "splay_distance": 3.802, "splay_ratio": 0.212, "d22": 4.094, "d64": 3.925, "eta": 163.851, "theta": -144.515, "eta_prime": 174.606, "theta_prime": -144.262, "eta_base": -146.413, "theta_base": -118.382, "v0": 7.963, "v1": -29.781, "v2": 38.921, "v3": -35.473, "v4": 17.406, "amplitude": 39.230, "phase_angle": 7.201, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.940, "filter_rmsd": 0.064, "frame": { "rmsd": 0.006, "origin": [ 17.737, -9.700, -15.424 ], "x_axis": [ -0.458, -0.847, 0.271 ], "y_axis": [ -0.882, 0.471, -0.019 ], "z_axis": [ -0.111, -0.247, -0.962 ], "quaternion": [ -0.112, -0.508, 0.850, -0.078 ] } }, { "index": 31, "index_chain": 10, "chain_name": "B", "nt_resnum": 35, "nt_name": "C", "nt_code": "C", "nt_id": "///B/35", "linked_nts": [ "///B/34", "///B/36" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -64.560, "beta": -178.342, "gamma": 46.298, "delta": 84.436, "epsilon": -156.875, "zeta": -71.015, "epsilon_zeta": -85.859, "bb_type": "BI", "chi": -155.908, "glyco_bond": "anti", "C5prime_xyz": [ -0.965, 8.650, 0.405 ], "P_xyz": [ 1.635, 8.845, 0.562 ], "form": "A", "ssZp": 4.496, "Dp": 4.639, "splay_angle": 22.103, "splay_distance": 3.500, "splay_ratio": 0.194, "d22": null, "d64": null, "eta": 166.792, "theta": -148.119, "eta_prime": 179.408, "theta_prime": -147.305, "eta_base": -139.910, "theta_base": -130.050, "v0": 8.553, "v1": -30.337, "v2": 39.245, "v3": -35.466, "v4": 17.004, "amplitude": 39.493, "phase_angle": 6.415, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.874, "filter_rmsd": 0.065, "frame": { "rmsd": 0.010, "origin": [ 17.287, -12.135, -18.308 ], "x_axis": [ -0.815, -0.328, 0.478 ], "y_axis": [ -0.486, 0.836, -0.256 ], "z_axis": [ -0.316, -0.441, -0.840 ], "quaternion": [ -0.212, -0.218, 0.934, -0.186 ] } }, { "index": 32, "index_chain": 11, "chain_name": "B", "nt_resnum": 36, "nt_name": "G", "nt_code": "G", "nt_id": "///B/36", "linked_nts": [ "///B/35", "///B/37" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -65.392, "beta": 172.842, "gamma": 52.425, "delta": 82.442, "epsilon": -154.663, "zeta": -66.622, "epsilon_zeta": -88.042, "bb_type": "BI", "chi": -167.818, "glyco_bond": "anti", "C5prime_xyz": [ -1.414, 8.716, 1.004 ], "P_xyz": [ 1.165, 9.126, 1.304 ], "form": "A", "ssZp": 4.606, "Dp": 4.582, "splay_angle": 24.161, "splay_distance": 3.894, "splay_ratio": 0.215, "d22": null, "d64": null, "eta": 166.553, "theta": -142.491, "eta_prime": -179.458, "theta_prime": -142.498, "eta_base": -146.286, "theta_base": -116.308, "v0": 1.851, "v1": -25.833, "v2": 38.931, "v3": -38.720, "v4": 23.175, "amplitude": 40.487, "phase_angle": 15.936, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.931, "filter_rmsd": 0.005, "frame": { "rmsd": 0.005, "origin": [ 16.621, -14.973, -20.247 ], "x_axis": [ -0.851, 0.181, 0.493 ], "y_axis": [ -0.090, 0.874, -0.477 ], "z_axis": [ -0.517, -0.450, -0.728 ], "quaternion": [ -0.272, 0.024, 0.929, -0.249 ] } }, { "index": 33, "index_chain": 12, "chain_name": "B", "nt_resnum": 37, "nt_name": "G", "nt_code": "G", "nt_id": "///B/37", "linked_nts": [ "///B/36", "///B/38" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -64.873, "beta": 171.618, "gamma": 60.365, "delta": 80.249, "epsilon": -159.393, "zeta": -71.641, "epsilon_zeta": -87.752, "bb_type": "BI", "chi": -168.683, "glyco_bond": "anti", "C5prime_xyz": [ -1.552, 8.759, 0.909 ], "P_xyz": [ 0.969, 9.404, 1.059 ], "form": "A", "ssZp": 4.476, "Dp": 4.564, "splay_angle": 24.938, "splay_distance": 3.863, "splay_ratio": 0.217, "d22": null, "d64": null, "eta": 172.324, "theta": -153.033, "eta_prime": -170.479, "theta_prime": -151.772, "eta_base": -125.893, "theta_base": -124.788, "v0": 1.280, "v1": -26.547, "v2": 40.210, "v3": -40.648, "v4": 24.928, "amplitude": 42.039, "phase_angle": 16.964, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.893, "filter_rmsd": 0.007, "frame": { "rmsd": 0.007, "origin": [ 14.032, -17.735, -21.158 ], "x_axis": [ -0.785, 0.605, 0.132 ], "y_axis": [ 0.367, 0.626, -0.687 ], "z_axis": [ -0.499, -0.491, -0.714 ], "quaternion": [ -0.178, 0.275, 0.884, -0.333 ] } }, { "index": 34, "index_chain": 13, "chain_name": "B", "nt_resnum": 38, "nt_name": "U", "nt_code": "U", "nt_id": "///B/38", "linked_nts": [ "///B/37", "///B/39" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -69.241, "beta": 176.180, "gamma": 56.271, "delta": 82.768, "epsilon": -150.784, "zeta": -70.116, "epsilon_zeta": -80.669, "bb_type": "BI", "chi": -169.376, "glyco_bond": "anti", "C5prime_xyz": [ -1.501, 8.628, 0.893 ], "P_xyz": [ 1.083, 8.948, 1.336 ], "form": "A", "ssZp": 4.383, "Dp": 4.610, "splay_angle": 20.352, "splay_distance": 3.279, "splay_ratio": 0.183, "d22": null, "d64": null, "eta": 168.136, "theta": -140.498, "eta_prime": -177.764, "theta_prime": -137.298, "eta_base": -135.680, "theta_base": -110.825, "v0": 5.405, "v1": -28.893, "v2": 40.622, "v3": -38.397, "v4": 20.593, "amplitude": 41.407, "phase_angle": 11.173, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.899, "filter_rmsd": 0.108, "frame": { "rmsd": 0.014, "origin": [ 11.267, -20.064, -22.518 ], "x_axis": [ -0.432, 0.875, -0.221 ], "y_axis": [ 0.751, 0.213, -0.625 ], "z_axis": [ -0.500, -0.436, -0.749 ], "quaternion": [ -0.090, 0.525, 0.773, -0.343 ] } }, { "index": 35, "index_chain": 14, "chain_name": "B", "nt_resnum": 39, "nt_name": "G", "nt_code": "G", "nt_id": "///B/39", "linked_nts": [ "///B/38", "///B/40" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop,splayed-apart", "alpha": -62.141, "beta": -172.446, "gamma": 50.525, "delta": 84.793, "epsilon": 66.792, "zeta": 104.529, "epsilon_zeta": -37.737, "bb_type": "--", "chi": -140.615, "glyco_bond": "anti", "C5prime_xyz": [ -1.694, 8.734, -0.484 ], "P_xyz": [ 0.823, 9.352, -0.087 ], "form": ".", "ssZp": 1.959, "Dp": 2.192, "splay_angle": 108.195, "splay_distance": 16.094, "splay_ratio": 0.810, "d22": null, "d64": null, "eta": -158.852, "theta": -73.737, "eta_prime": -139.613, "theta_prime": -132.590, "eta_base": -107.794, "theta_base": -168.085, "v0": -2.693, "v1": -16.120, "v2": 27.705, "v3": -30.363, "v4": 20.695, "amplitude": 30.283, "phase_angle": 23.813, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.884, "filter_rmsd": 0.015, "frame": { "rmsd": 0.015, "origin": [ 8.273, -20.427, -23.806 ], "x_axis": [ 0.116, 0.863, -0.491 ], "y_axis": [ 0.743, -0.403, -0.534 ], "z_axis": [ -0.659, -0.303, -0.688 ], "quaternion": [ -0.078, 0.743, 0.541, -0.387 ] } }, { "index": 36, "index_chain": 15, "chain_name": "B", "nt_resnum": 40, "nt_name": "A", "nt_code": "A", "nt_id": "///B/40", "linked_nts": [ "///B/39", "///B/41" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-pair-contact,internal-loop,phosphate,splayed-apart", "alpha": 32.852, "beta": 165.414, "gamma": 76.267, "delta": 74.647, "epsilon": -158.221, "zeta": -79.267, "epsilon_zeta": -78.954, "bb_type": "BI", "chi": -140.687, "glyco_bond": "anti", "C5prime_xyz": [ -2.308, 8.867, -0.783 ], "P_xyz": [ -0.273, 9.852, -2.126 ], "form": ".", "ssZp": 3.675, "Dp": 4.418, "splay_angle": 18.003, "splay_distance": 2.964, "splay_ratio": 0.164, "d22": null, "d64": null, "eta": -37.248, "theta": -166.246, "eta_prime": 19.887, "theta_prime": -163.002, "eta_base": 39.961, "theta_base": -122.446, "v0": -9.650, "v1": -17.814, "v2": 36.898, "v3": -43.286, "v4": 33.351, "amplitude": 43.087, "phase_angle": 31.089, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.037, "frame": { "rmsd": 0.008, "origin": [ 6.320, -36.353, -25.064 ], "x_axis": [ 0.244, 0.022, 0.970 ], "y_axis": [ 0.447, 0.885, -0.132 ], "z_axis": [ -0.861, 0.466, 0.206 ], "quaternion": [ 0.764, -0.196, -0.599, -0.139 ] } }, { "index": 37, "index_chain": 16, "chain_name": "B", "nt_resnum": 41, "nt_name": "A", "nt_code": "A", "nt_id": "///B/41", "linked_nts": [ "///B/40", "///B/42" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-pair-contact,internal-loop,splayed-apart", "alpha": -70.421, "beta": 177.518, "gamma": 56.311, "delta": 90.599, "epsilon": -104.226, "zeta": -136.721, "epsilon_zeta": 32.495, "bb_type": "--", "chi": -121.393, "glyco_bond": "anti", "C5prime_xyz": [ -1.417, 8.243, -1.692 ], "P_xyz": [ 1.144, 8.213, -2.281 ], "form": ".", "ssZp": 1.630, "Dp": 4.578, "splay_angle": 132.427, "splay_distance": 17.218, "splay_ratio": 0.916, "d22": null, "d64": null, "eta": -173.424, "theta": -116.805, "eta_prime": -167.970, "theta_prime": -102.372, "eta_base": -128.595, "theta_base": -67.243, "v0": 6.217, "v1": -26.453, "v2": 35.419, "v3": -32.895, "v4": 16.943, "amplitude": 35.855, "phase_angle": 8.950, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.652, "filter_rmsd": 0.040, "frame": { "rmsd": 0.007, "origin": [ 4.707, -34.462, -23.451 ], "x_axis": [ 0.626, 0.440, 0.644 ], "y_axis": [ -0.117, 0.869, -0.481 ], "z_axis": [ -0.771, 0.226, 0.595 ], "quaternion": [ 0.879, -0.201, -0.403, 0.158 ] } }, { "index": 38, "index_chain": 17, "chain_name": "B", "nt_resnum": 42, "nt_name": "G", "nt_code": "G", "nt_id": "///B/42", "linked_nts": [ "///B/41", "///B/43" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,isolated-canonical,non-pair-contact,helix,internal-loop,splayed-apart", "alpha": 60.221, "beta": 124.687, "gamma": 47.144, "delta": 79.633, "epsilon": -151.039, "zeta": -66.768, "epsilon_zeta": -84.271, "bb_type": "BI", "chi": -173.063, "glyco_bond": "anti", "C5prime_xyz": [ -1.530, 8.639, 1.204 ], "P_xyz": [ 1.070, 8.441, 0.830 ], "form": "A", "ssZp": 4.651, "Dp": 4.674, "splay_angle": 25.172, "splay_distance": 4.141, "splay_ratio": 0.230, "d22": null, "d64": null, "eta": -127.970, "theta": -128.763, "eta_prime": -118.584, "theta_prime": -136.633, "eta_base": -127.556, "theta_base": -122.040, "v0": 1.235, "v1": -26.358, "v2": 40.348, "v3": -40.522, "v4": 24.632, "amplitude": 42.154, "phase_angle": 16.829, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "7d", "suiteness": 0.075, "filter_rmsd": 0.007, "frame": { "rmsd": 0.007, "origin": [ 1.737, -17.847, -26.853 ], "x_axis": [ 0.740, -0.052, -0.671 ], "y_axis": [ -0.096, -0.995, -0.029 ], "z_axis": [ -0.666, 0.086, -0.741 ], "quaternion": [ -0.031, 0.932, -0.040, -0.358 ] } }, { "index": 39, "index_chain": 18, "chain_name": "B", "nt_resnum": 43, "nt_name": "U", "nt_code": "U", "nt_id": "///B/43", "linked_nts": [ "///B/42", "///B/44" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop", "alpha": -62.151, "beta": 178.880, "gamma": 58.877, "delta": 82.820, "epsilon": -148.876, "zeta": -77.159, "epsilon_zeta": -71.717, "bb_type": "BI", "chi": -164.100, "glyco_bond": "anti", "C5prime_xyz": [ -1.695, 8.782, 0.737 ], "P_xyz": [ 0.796, 9.601, 0.929 ], "form": "A", "ssZp": 4.534, "Dp": 4.554, "splay_angle": 22.714, "splay_distance": 3.565, "splay_ratio": 0.197, "d22": 4.327, "d64": 4.074, "eta": 178.788, "theta": -150.523, "eta_prime": -167.415, "theta_prime": -148.683, "eta_base": -130.133, "theta_base": -110.923, "v0": -2.353, "v1": -21.259, "v2": 35.187, "v3": -37.751, "v4": 25.253, "amplitude": 37.992, "phase_angle": 22.156, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.927, "filter_rmsd": 0.104, "frame": { "rmsd": 0.009, "origin": [ 0.875, -15.359, -30.049 ], "x_axis": [ 0.535, -0.559, -0.633 ], "y_axis": [ -0.507, -0.812, 0.289 ], "z_axis": [ -0.676, 0.166, -0.718 ], "quaternion": [ 0.035, 0.875, -0.305, -0.374 ] } }, { "index": 40, "index_chain": 19, "chain_name": "B", "nt_resnum": 44, "nt_name": "C", "nt_code": "C", "nt_id": "///B/44", "linked_nts": [ "///B/43", "///B/45" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop", "alpha": -69.226, "beta": 169.949, "gamma": 54.917, "delta": 81.737, "epsilon": -150.454, "zeta": -80.255, "epsilon_zeta": -70.199, "bb_type": "BI", "chi": -160.036, "glyco_bond": "anti", "C5prime_xyz": [ -1.203, 8.750, 0.487 ], "P_xyz": [ 1.387, 9.044, 0.406 ], "form": "A", "ssZp": 4.433, "Dp": 4.668, "splay_angle": 23.093, "splay_distance": 3.615, "splay_ratio": 0.201, "d22": null, "d64": null, "eta": 163.319, "theta": -151.669, "eta_prime": 177.879, "theta_prime": -152.861, "eta_base": -130.133, "theta_base": -135.354, "v0": 5.510, "v1": -29.536, "v2": 40.985, "v3": -38.911, "v4": 21.048, "amplitude": 41.777, "phase_angle": 11.173, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.958, "filter_rmsd": 0.062, "frame": { "rmsd": 0.006, "origin": [ -0.063, -14.963, -33.465 ], "x_axis": [ 0.134, -0.959, -0.249 ], "y_axis": [ -0.807, -0.252, 0.535 ], "z_axis": [ -0.575, 0.129, -0.808 ], "quaternion": [ 0.137, 0.740, -0.596, -0.278 ] } }, { "index": 41, "index_chain": 20, "chain_name": "B", "nt_resnum": 45, "nt_name": "G", "nt_code": "G", "nt_id": "///B/45", "linked_nts": [ "///B/44", "///B/46" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -60.889, "beta": 165.137, "gamma": 50.561, "delta": 80.074, "epsilon": -160.165, "zeta": -64.980, "epsilon_zeta": -95.185, "bb_type": "BI", "chi": -167.935, "glyco_bond": "anti", "C5prime_xyz": [ -1.382, 8.656, 1.028 ], "P_xyz": [ 1.206, 9.035, 0.848 ], "form": "A", "ssZp": 4.712, "Dp": 4.650, "splay_angle": 24.561, "splay_distance": 3.910, "splay_ratio": 0.224, "d22": null, "d64": null, "eta": 159.851, "theta": -143.313, "eta_prime": 173.582, "theta_prime": -143.504, "eta_base": -149.401, "theta_base": -116.916, "v0": 3.452, "v1": -28.696, "v2": 41.932, "v3": -40.692, "v4": 23.384, "amplitude": 43.196, "phase_angle": 13.896, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.906, "filter_rmsd": 0.008, "frame": { "rmsd": 0.008, "origin": [ -0.763, -14.355, -36.959 ], "x_axis": [ -0.203, -0.978, 0.038 ], "y_axis": [ -0.807, 0.189, 0.560 ], "z_axis": [ -0.555, 0.083, -0.828 ], "quaternion": [ -0.199, -0.599, 0.745, 0.216 ] } }, { "index": 42, "index_chain": 21, "chain_name": "B", "nt_resnum": 46, "nt_name": "C", "nt_code": "C", "nt_id": "///B/46", "linked_nts": [ "///B/45", null ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack", "alpha": -57.511, "beta": -177.951, "gamma": 54.199, "delta": 71.550, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": -158.017, "glyco_bond": "anti", "C5prime_xyz": [ -1.285, 8.829, 0.421 ], "P_xyz": [ 1.312, 9.243, 0.628 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": 2.839, "v1": -26.508, "v2": 39.099, "v3": -38.299, "v4": 22.349, "amplitude": 40.400, "phase_angle": 14.581, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.686, "filter_rmsd": 0.061, "frame": { "rmsd": 0.005, "origin": [ -1.114, -16.303, -40.331 ], "x_axis": [ -0.662, -0.686, 0.303 ], "y_axis": [ -0.606, 0.727, 0.324 ], "z_axis": [ -0.442, 0.031, -0.896 ], "quaternion": [ -0.206, -0.356, 0.906, 0.098 ] } } ], "num_hbonds": 78, "hbonds": [ { "index": 1, "atom1_serNum": 19, "atom2_serNum": 899, "donAcc_type": "standard", "distance": 2.924, "atom1_id": "///A/3/O6", "atom2_id": "///B/46/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 2, "atom1_serNum": 20, "atom2_serNum": 897, "donAcc_type": "standard", "distance": 2.892, "atom1_id": "///A/3/N1", "atom2_id": "///B/46/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 3, "atom1_serNum": 22, "atom2_serNum": 896, "donAcc_type": "standard", "distance": 2.740, "atom1_id": "///A/3/N2", "atom2_id": "///B/46/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 4, "atom1_serNum": 39, "atom2_serNum": 879, "donAcc_type": "standard", "distance": 2.796, "atom1_id": "///A/4/O2", "atom2_id": "///B/45/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 5, "atom1_serNum": 40, "atom2_serNum": 877, "donAcc_type": "standard", "distance": 2.812, "atom1_id": "///A/4/N3", "atom2_id": "///B/45/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 6, "atom1_serNum": 42, "atom2_serNum": 876, "donAcc_type": "standard", "distance": 2.721, "atom1_id": "///A/4/N4", "atom2_id": "///B/45/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 7, "atom1_serNum": 47, "atom2_serNum": 925, "donAcc_type": "unknown", "distance": 2.855, "atom1_id": "///A/5/OP2", "atom2_id": "///A/101/N33", "atom_pair": "O:N", "residue_pair": "nt:ligand" }, { "index": 8, "atom1_serNum": 55, "atom2_serNum": 74, "donAcc_type": "acceptable", "distance": 3.102, "atom1_id": "///A/5/O2'", "atom2_id": "///A/6/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 9, "atom1_serNum": 62, "atom2_serNum": 856, "donAcc_type": "standard", "distance": 3.089, "atom1_id": "///A/5/O6", "atom2_id": "///B/44/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 10, "atom1_serNum": 62, "atom2_serNum": 928, "donAcc_type": "acceptable", "distance": 3.110, "atom1_id": "///A/5/O6", "atom2_id": "///A/101/O23", "atom_pair": "O:O", "residue_pair": "nt:ligand" }, { "index": 11, "atom1_serNum": 63, "atom2_serNum": 854, "donAcc_type": "standard", "distance": 2.972, "atom1_id": "///A/5/N1", "atom2_id": "///B/44/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 12, "atom1_serNum": 65, "atom2_serNum": 853, "donAcc_type": "standard", "distance": 2.738, "atom1_id": "///A/5/N2", "atom2_id": "///B/44/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 13, "atom1_serNum": 70, "atom2_serNum": 929, "donAcc_type": "acceptable", "distance": 2.686, "atom1_id": "///A/6/OP2", "atom2_id": "///A/101/O43", "atom_pair": "O:O", "residue_pair": "nt:ligand" }, { "index": 14, "atom1_serNum": 85, "atom2_serNum": 834, "donAcc_type": "standard", "distance": 2.887, "atom1_id": "///A/6/O4", "atom2_id": "///B/43/N3", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 15, "atom1_serNum": 102, "atom2_serNum": 816, "donAcc_type": "standard", "distance": 2.851, "atom1_id": "///A/7/O2", "atom2_id": "///B/42/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 16, "atom1_serNum": 103, "atom2_serNum": 814, "donAcc_type": "standard", "distance": 2.934, "atom1_id": "///A/7/N3", "atom2_id": "///B/42/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 17, "atom1_serNum": 105, "atom2_serNum": 813, "donAcc_type": "standard", "distance": 2.831, "atom1_id": "///A/7/N4", "atom2_id": "///B/42/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 18, "atom1_serNum": 105, "atom2_serNum": 932, "donAcc_type": "standard", "distance": 3.090, "atom1_id": "///A/7/N4", "atom2_id": "///A/101/O53", "atom_pair": "N:O", "residue_pair": "nt:ligand" }, { "index": 19, "atom1_serNum": 125, "atom2_serNum": 930, "donAcc_type": "standard", "distance": 3.294, "atom1_id": "///A/8/N6", "atom2_id": "///A/101/O51", "atom_pair": "N:O", "residue_pair": "nt:ligand" }, { "index": 20, "atom1_serNum": 126, "atom2_serNum": 926, "donAcc_type": "standard", "distance": 2.856, "atom1_id": "///A/8/N1", "atom2_id": "///A/101/N61", "atom_pair": "N:N", "residue_pair": "nt:ligand" }, { "index": 21, "atom1_serNum": 144, "atom2_serNum": 749, "donAcc_type": "standard", "distance": 2.788, "atom1_id": "///A/9/O2", "atom2_id": "///B/39/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 22, "atom1_serNum": 145, "atom2_serNum": 747, "donAcc_type": "standard", "distance": 3.016, "atom1_id": "///A/9/N3", "atom2_id": "///B/39/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 23, "atom1_serNum": 147, "atom2_serNum": 746, "donAcc_type": "standard", "distance": 3.260, "atom1_id": "///A/9/N4", "atom2_id": "///B/39/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 24, "atom1_serNum": 167, "atom2_serNum": 726, "donAcc_type": "standard", "distance": 3.234, "atom1_id": "///A/10/N6", "atom2_id": "///B/38/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 25, "atom1_serNum": 168, "atom2_serNum": 724, "donAcc_type": "standard", "distance": 3.131, "atom1_id": "///A/10/N1", "atom2_id": "///B/38/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 26, "atom1_serNum": 186, "atom2_serNum": 706, "donAcc_type": "standard", "distance": 2.859, "atom1_id": "///A/11/O2", "atom2_id": "///B/37/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 27, "atom1_serNum": 187, "atom2_serNum": 704, "donAcc_type": "standard", "distance": 3.134, "atom1_id": "///A/11/N3", "atom2_id": "///B/37/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 28, "atom1_serNum": 189, "atom2_serNum": 703, "donAcc_type": "standard", "distance": 3.382, "atom1_id": "///A/11/N4", "atom2_id": "///B/37/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 29, "atom1_serNum": 206, "atom2_serNum": 683, "donAcc_type": "standard", "distance": 2.794, "atom1_id": "///A/12/O2", "atom2_id": "///B/36/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 30, "atom1_serNum": 207, "atom2_serNum": 681, "donAcc_type": "standard", "distance": 2.925, "atom1_id": "///A/12/N3", "atom2_id": "///B/36/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 31, "atom1_serNum": 209, "atom2_serNum": 680, "donAcc_type": "standard", "distance": 2.928, "atom1_id": "///A/12/N4", "atom2_id": "///B/36/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 32, "atom1_serNum": 229, "atom2_serNum": 660, "donAcc_type": "standard", "distance": 3.251, "atom1_id": "///A/13/O6", "atom2_id": "///B/35/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 33, "atom1_serNum": 230, "atom2_serNum": 658, "donAcc_type": "standard", "distance": 3.027, "atom1_id": "///A/13/N1", "atom2_id": "///B/35/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 34, "atom1_serNum": 232, "atom2_serNum": 657, "donAcc_type": "standard", "distance": 2.762, "atom1_id": "///A/13/N2", "atom2_id": "///B/35/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 35, "atom1_serNum": 252, "atom2_serNum": 618, "donAcc_type": "standard", "distance": 2.889, "atom1_id": "///A/14/O6", "atom2_id": "///B/33/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 36, "atom1_serNum": 252, "atom2_serNum": 640, "donAcc_type": "standard", "distance": 2.935, "atom1_id": "///A/14/O6", "atom2_id": "///B/34/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 37, "atom1_serNum": 253, "atom2_serNum": 638, "donAcc_type": "standard", "distance": 2.861, "atom1_id": "///A/14/N1", "atom2_id": "///B/34/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 38, "atom1_serNum": 255, "atom2_serNum": 637, "donAcc_type": "standard", "distance": 2.937, "atom1_id": "///A/14/N2", "atom2_id": "///B/34/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 39, "atom1_serNum": 273, "atom2_serNum": 619, "donAcc_type": "standard", "distance": 2.656, "atom1_id": "///A/15/N3", "atom2_id": "///B/33/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 40, "atom1_serNum": 275, "atom2_serNum": 618, "donAcc_type": "standard", "distance": 3.037, "atom1_id": "///A/15/O4", "atom2_id": "///B/33/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 41, "atom1_serNum": 295, "atom2_serNum": 598, "donAcc_type": "standard", "distance": 2.608, "atom1_id": "///A/16/O6", "atom2_id": "///B/32/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 42, "atom1_serNum": 296, "atom2_serNum": 596, "donAcc_type": "standard", "distance": 2.731, "atom1_id": "///A/16/N1", "atom2_id": "///B/32/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 43, "atom1_serNum": 298, "atom2_serNum": 595, "donAcc_type": "standard", "distance": 2.864, "atom1_id": "///A/16/N2", "atom2_id": "///B/32/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 44, "atom1_serNum": 324, "atom2_serNum": 955, "donAcc_type": "standard", "distance": 2.853, "atom1_id": "///A/18/OP1", "atom2_id": "///B/101/N32", "atom_pair": "O:N", "residue_pair": "nt:ligand" }, { "index": 45, "atom1_serNum": 346, "atom2_serNum": 955, "donAcc_type": "standard", "distance": 3.341, "atom1_id": "///A/19/OP1", "atom2_id": "///B/101/N32", "atom_pair": "O:N", "residue_pair": "nt:ligand" }, { "index": 46, "atom1_serNum": 359, "atom2_serNum": 955, "donAcc_type": "standard", "distance": 2.767, "atom1_id": "///A/19/N7", "atom2_id": "///B/101/N32", "atom_pair": "N:N", "residue_pair": "nt:ligand" }, { "index": 47, "atom1_serNum": 362, "atom2_serNum": 556, "donAcc_type": "standard", "distance": 3.156, "atom1_id": "///A/19/O6", "atom2_id": "///B/30/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 48, "atom1_serNum": 363, "atom2_serNum": 554, "donAcc_type": "standard", "distance": 3.159, "atom1_id": "///A/19/N1", "atom2_id": "///B/30/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 49, "atom1_serNum": 365, "atom2_serNum": 553, "donAcc_type": "standard", "distance": 3.067, "atom1_id": "///A/19/N2", "atom2_id": "///B/30/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 50, "atom1_serNum": 385, "atom2_serNum": 536, "donAcc_type": "questionable", "distance": 3.204, "atom1_id": "///A/20/O4", "atom2_id": "///B/29/O4", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 51, "atom1_serNum": 385, "atom2_serNum": 953, "donAcc_type": "standard", "distance": 2.565, "atom1_id": "///A/20/O4", "atom2_id": "///B/101/N12", "atom_pair": "O:N", "residue_pair": "nt:ligand" }, { "index": 52, "atom1_serNum": 402, "atom2_serNum": 516, "donAcc_type": "standard", "distance": 2.510, "atom1_id": "///A/21/O2", "atom2_id": "///B/28/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 53, "atom1_serNum": 403, "atom2_serNum": 514, "donAcc_type": "standard", "distance": 2.749, "atom1_id": "///A/21/N3", "atom2_id": "///B/28/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 54, "atom1_serNum": 405, "atom2_serNum": 513, "donAcc_type": "standard", "distance": 2.852, "atom1_id": "///A/21/N4", "atom2_id": "///B/28/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 55, "atom1_serNum": 425, "atom2_serNum": 493, "donAcc_type": "standard", "distance": 2.958, "atom1_id": "///A/22/O6", "atom2_id": "///B/27/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 56, "atom1_serNum": 426, "atom2_serNum": 491, "donAcc_type": "standard", "distance": 2.975, "atom1_id": "///A/22/N1", "atom2_id": "///B/27/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 57, "atom1_serNum": 428, "atom2_serNum": 490, "donAcc_type": "standard", "distance": 2.909, "atom1_id": "///A/22/N2", "atom2_id": "///B/27/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 58, "atom1_serNum": 445, "atom2_serNum": 473, "donAcc_type": "standard", "distance": 2.972, "atom1_id": "///A/23/O2", "atom2_id": "///B/26/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 59, "atom1_serNum": 446, "atom2_serNum": 471, "donAcc_type": "standard", "distance": 3.356, "atom1_id": "///A/23/N3", "atom2_id": "///B/26/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 60, "atom1_serNum": 448, "atom2_serNum": 470, "donAcc_type": "standard", "distance": 3.609, "atom1_id": "///A/23/N4", "atom2_id": "///B/26/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 61, "atom1_serNum": 498, "atom2_serNum": 956, "donAcc_type": "unknown", "distance": 2.857, "atom1_id": "///B/28/OP2", "atom2_id": "///B/101/N33", "atom_pair": "O:N", "residue_pair": "nt:ligand" }, { "index": 62, "atom1_serNum": 513, "atom2_serNum": 959, "donAcc_type": "acceptable", "distance": 3.214, "atom1_id": "///B/28/O6", "atom2_id": "///B/101/O23", "atom_pair": "O:O", "residue_pair": "nt:ligand" }, { "index": 63, "atom1_serNum": 521, "atom2_serNum": 960, "donAcc_type": "acceptable", "distance": 2.722, "atom1_id": "///B/29/OP2", "atom2_id": "///B/101/O43", "atom_pair": "O:O", "residue_pair": "nt:ligand" }, { "index": 64, "atom1_serNum": 536, "atom2_serNum": 963, "donAcc_type": "questionable", "distance": 3.124, "atom1_id": "///B/29/O4", "atom2_id": "///B/101/O53", "atom_pair": "O:O", "residue_pair": "nt:ligand" }, { "index": 65, "atom1_serNum": 556, "atom2_serNum": 963, "donAcc_type": "standard", "distance": 2.866, "atom1_id": "///B/30/N4", "atom2_id": "///B/101/O53", "atom_pair": "N:O", "residue_pair": "nt:ligand" }, { "index": 66, "atom1_serNum": 576, "atom2_serNum": 961, "donAcc_type": "standard", "distance": 3.385, "atom1_id": "///B/31/N6", "atom2_id": "///B/101/O51", "atom_pair": "N:O", "residue_pair": "nt:ligand" }, { "index": 67, "atom1_serNum": 577, "atom2_serNum": 957, "donAcc_type": "standard", "distance": 2.853, "atom1_id": "///B/31/N1", "atom2_id": "///B/101/N61", "atom_pair": "N:N", "residue_pair": "nt:ligand" }, { "index": 68, "atom1_serNum": 595, "atom2_serNum": 957, "donAcc_type": "standard", "distance": 2.814, "atom1_id": "///B/32/O2", "atom2_id": "///B/101/N61", "atom_pair": "O:N", "residue_pair": "nt:ligand" }, { "index": 69, "atom1_serNum": 596, "atom2_serNum": 957, "donAcc_type": "standard", "distance": 3.299, "atom1_id": "///B/32/N3", "atom2_id": "///B/101/N61", "atom_pair": "N:N", "residue_pair": "nt:ligand" }, { "index": 70, "atom1_serNum": 611, "atom2_serNum": 629, "donAcc_type": "acceptable", "distance": 3.165, "atom1_id": "///B/33/O2'", "atom2_id": "///B/34/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 71, "atom1_serNum": 739, "atom2_serNum": 753, "donAcc_type": "acceptable", "distance": 2.377, "atom1_id": "///B/39/O2'", "atom2_id": "///B/40/OP1", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 72, "atom1_serNum": 739, "atom2_serNum": 755, "donAcc_type": "acceptable", "distance": 2.865, "atom1_id": "///B/39/O2'", "atom2_id": "///B/40/O5'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 73, "atom1_serNum": 762, "atom2_serNum": 780, "donAcc_type": "acceptable", "distance": 3.176, "atom1_id": "///B/40/O2'", "atom2_id": "///B/41/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 74, "atom1_serNum": 810, "atom2_serNum": 924, "donAcc_type": "standard", "distance": 2.929, "atom1_id": "///B/42/N7", "atom2_id": "///A/101/N32", "atom_pair": "N:N", "residue_pair": "nt:ligand" }, { "index": 75, "atom1_serNum": 813, "atom2_serNum": 931, "donAcc_type": "acceptable", "distance": 3.755, "atom1_id": "///B/42/O6", "atom2_id": "///A/101/O52", "atom_pair": "O:O", "residue_pair": "nt:ligand" }, { "index": 76, "atom1_serNum": 829, "atom2_serNum": 845, "donAcc_type": "acceptable", "distance": 3.195, "atom1_id": "///B/43/O2'", "atom2_id": "///B/44/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 77, "atom1_serNum": 836, "atom2_serNum": 922, "donAcc_type": "standard", "distance": 2.628, "atom1_id": "///B/43/O4", "atom2_id": "///A/101/N12", "atom_pair": "O:N", "residue_pair": "nt:ligand" }, { "index": 78, "atom1_serNum": 923, "atom2_serNum": 931, "donAcc_type": "acceptable", "distance": 3.186, "atom1_id": "///A/101/N21", "atom2_id": "///A/101/O52", "atom_pair": "N:O", "residue_pair": "ligand:ligand" } ], "refCoords": { "purine": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 -0.5000 0.4000", " 3 N -2.2500 -0.5000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 1.2500 5.0000 0.4000", " 6 C 1.2500 -0.5000 0.4000", " 7 C 1.2500 -0.5000 -0.4000", " 8 C 1.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 -0.5000 0.4000", " 11 C -2.2500 -0.5000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ], "pyrimidine": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 1.0000 0.4000", " 3 N -2.2500 1.0000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 1.2500 5.0000 0.4000", " 6 C 1.2500 1.0000 0.4000", " 7 C 1.2500 1.0000 -0.4000", " 8 C 1.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 1.0000 0.4000", " 11 C -2.2500 1.0000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ], "wc_pair": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 -5.0000 0.4000", " 3 N -2.2500 -5.0000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 2.2500 5.0000 0.4000", " 6 C 2.2500 -5.0000 0.4000", " 7 C 2.2500 -5.0000 -0.4000", " 8 C 2.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 -5.0000 0.4000", " 11 C -2.2500 -5.0000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ] }, "metadata": { "license": "http://innovation.columbia.edu/technologies/CU20391", "url": "http://x3dna.org/", "url_alt": "http://home.x3dna.org/", "forum": "http://forum.x3dna.org/", "citation": "Lu et al. (2015). 'DSSR: an integrated software tool for dissecting the spatial structure of RNA.' Nucleic Acids Res., 43(21):e142 [doi:10.1093/nar/gkv716].", "str_id": "4f8v", "num_naChains": 2, "naChains": "A=21,B=21", "num_atoms": 965, "num_waters": 3, "num_notes": 52, "notes": [ { "Aminors": "A-minor interactions (including types I and II)" }, { "Cstem_index": "stem index of the 'Canonical' helix in k-turn" }, { "Cstem_pair": "Cstem bp delineating the k-turn internal loop" }, { "Dp": "perpendicular distance of the 3' P atom to the glycosidic bond" }, { "GA_pair": "sheared G-A pair in k-turn" }, { "HtypePknot": "H-type pseudoknot" }, { "Kturn": "kink-turn (k-turn)" }, { "LW": "Leontis-Westhof" }, { "NCstem_index": "stem index of the 'Non-Canonical' helix in k-turn" }, { "NCstem_pair": "NCstem bp delineating the k-turn internal loop" }, { "Uturn": "U-turn of the UNR- or GNRA-type" }, { "aa": "amino acid" }, { "atom_pair": "symbols of the two atoms involved in an H-bond" }, { "auxfiles": "auxiliary files" }, { "glyco_bond": "conformation of base related to sugar (syn or anti)" }, { "bb_type": "backbone conformation, BI or BII" }, { "bending_angle": "angle between two helical axes" }, { "bp": "base pair" }, { "bseq": "base sequence in one-letter code" }, { "bulge": "bulge loop" }, { "coaxStacks": "coaxial stacking of stems within a helix" }, { "dbn": "dot bracket notation" }, { "desc": "description" }, { "donAcc_type": "donor/acceptor type of the atom pair in an H-bond" }, { "epsilon_zeta": "difference between epsilon and zeta torsion angles" }, { "hairpin": "hairpin loop" }, { "hbond": "hydrogen bond (H-bond)" }, { "helix": "defined by base-stacking interactions, regardless of bp type and backbone connectivity" }, { "id": "identifier" }, { "iloop": "internal loop" }, { "index": "serial number" }, { "isoCanonPairs": "isolated canonical pairs" }, { "junction": "(multi-branched) junction loop" }, { "kissingLoop": "kissing loop" }, { "multiplet": "3+ bases in a coplanar geometry" }, { "na": "nucleic acid" }, { "nonPair": "two nts not forming a pair, but with H-bonding/stacking interactions" }, { "nonStack": "nucleotide not involved in stacking interactions" }, { "nt": "nucleotide" }, { "num": "number" }, { "oArea": "overlap areas between two bases, including exocyclic atoms" }, { "oArea_ring": "overlap areas between two bases, including only ring atoms" }, { "phosContacts": "H-bonding and atom-capping interactions involving a phosphate" }, { "residue_pair": "types of the two residues involved in an H-bond" }, { "rmsd": "root-mean-squares deviation" }, { "serNum": "serial number" }, { "ssSegments": "single-stranded segments not involved in loops" }, { "ssZp": "Z-coordinate of the 3' phosphorus atom with reference to the 5' base plane" }, { "sstr": "secondary structure in dbn" }, { "stem": "helix consisting of only canonical pairs, with a continuous backbone" }, { "str_id": "structure identifier, derived from inpfile with extension removed" }, { "vert_dist": "vertical distance from an atom to a base plane" } ], "num_auxfiles": 10, "auxfiles": [ { "index": 1, "name": "dssr-pairs.pdb", "desc": "an ensemble of base pairs" }, { "index": 2, "name": "dssr-stems.pdb", "desc": "an ensemble of stems" }, { "index": 3, "name": "dssr-helices.pdb", "desc": "an ensemble of helices (coaxial stacking)" }, { "index": 4, "name": "dssr-iloops.pdb", "desc": "an ensemble of internal loops" }, { "index": 5, "name": "dssr-2ndstrs.bpseq", "desc": "secondary structure in bpseq format" }, { "index": 6, "name": "dssr-2ndstrs.ct", "desc": "secondary structure in connectivity table format" }, { "index": 7, "name": "dssr-2ndstrs.dbn", "desc": "secondary structure in dot-bracket notation" }, { "index": 8, "name": "dssr-torsions.txt", "desc": "backbone torsion angles and suite names" }, { "index": 9, "name": "dssr-splays.pdb", "desc": "an ensemble of splayed-apart units" }, { "index": 10, "name": "dssr-stacks.pdb", "desc": "an ensemble of base stacks" } ], "time_used": "999" } }