{ "num_pairs": 63, "pairs": [ { "index": 1, "nt1": "///E/2", "nt2": "///E/71", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -176.934, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 53.872, "chi2": -110.855, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 52.819, "C1C1_dist": 10.728, "N1N9_dist": 8.976, "C6C8_dist": 9.873, "CNNC_torsion": -8.467, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.86],N3-N1(imino)[2.96],N4(amino)-O6(carbonyl)[2.93]", "interBase_angle": 9.699, "planarity": 0.225, "simple_Shear": 0.216, "simple_Stretch": -0.148, "simple_Buckle": 9.055, "simple_Propeller": -3.476, "bp_simpleParams": [ 0.216, -0.148, 0.581, 9.055, -3.476, -1.493 ], "bp_params": [ 0.213, -0.151, 0.581, 9.001, -3.612, -1.489 ], "frame": { "rmsd": null, "origin": [ 35.823, -4.394, 13.483 ], "x_axis": [ 0.967, 0.241, 0.087 ], "y_axis": [ 0.041, 0.191, -0.981 ], "z_axis": [ -0.253, 0.951, 0.175 ], "quaternion": [ 0.764, -0.633, -0.111, 0.066 ] } }, { "index": 2, "nt1": "///E/3", "nt2": "///E/70", "bp": "U-A", "name": "--", "Saenger": "--", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -168.265, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 57.832, "chi2": 159.422, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 63.329, "C1C1_dist": 8.951, "N1N9_dist": 7.516, "C6C8_dist": 8.614, "CNNC_torsion": -20.054, "hbonds_num": 0, "hbonds_desc": "", "interBase_angle": 10.750, "planarity": 0.645, "simple_Shear": -0.280, "simple_Stretch": -1.593, "simple_Buckle": 10.562, "simple_Propeller": -1.999, "bp_simpleParams": [ -0.280, -1.593, 2.329, 10.562, -1.999, 8.533 ], "bp_params": [ -0.224, -1.602, 2.329, 10.626, -1.626, 8.497 ], "frame": { "rmsd": null, "origin": [ 35.955, -0.303, 15.112 ], "x_axis": [ 0.762, 0.081, -0.642 ], "y_axis": [ -0.558, -0.422, -0.715 ], "z_axis": [ -0.328, 0.903, -0.276 ], "quaternion": [ 0.516, -0.784, 0.152, 0.309 ] } }, { "index": 3, "nt1": "///E/5", "nt2": "///E/68", "bp": "G-C", "name": "~Wobble", "Saenger": "--", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -161.579, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 44.164, "chi2": -167.471, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 59.904, "C1C1_dist": 10.575, "N1N9_dist": 8.797, "C6C8_dist": 9.645, "CNNC_torsion": -13.988, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[3.08],N1(imino)-O2(carbonyl)[3.12],N1(imino)-N3[3.17]", "interBase_angle": 25.474, "planarity": 0.363, "simple_Shear": -1.562, "simple_Stretch": -0.254, "simple_Buckle": 2.100, "simple_Propeller": -25.387, "bp_simpleParams": [ -1.562, -0.254, -0.360, 2.100, -25.387, -1.332 ], "bp_params": [ -1.502, -0.497, -0.360, 6.041, -24.747, -1.362 ], "frame": { "rmsd": null, "origin": [ 37.705, 7.558, 15.757 ], "x_axis": [ 0.010, -0.321, -0.947 ], "y_axis": [ -0.998, 0.059, -0.030 ], "z_axis": [ 0.065, 0.945, -0.319 ], "quaternion": [ 0.433, -0.564, 0.585, 0.391 ] } }, { "index": 4, "nt1": "///E/6", "nt2": "///E/67", "bp": "U-G", "name": "--", "Saenger": "--", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -158.085, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 60.456, "chi2": -153.930, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 56.600, "C1C1_dist": 10.229, "N1N9_dist": 8.705, "C6C8_dist": 9.805, "CNNC_torsion": -15.854, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.64],N3(imino)*N1(imino)[2.89],O4(carbonyl)*O6(carbonyl)[3.22]", "unusual_base2base_hbonds": 2, "interBase_angle": 29.609, "planarity": 0.347, "simple_Shear": 0.415, "simple_Stretch": -0.132, "simple_Buckle": 13.991, "simple_Propeller": -26.095, "bp_simpleParams": [ 0.415, -0.132, -0.411, 13.991, -26.095, 9.062 ], "bp_params": [ 0.411, -0.141, -0.411, 13.231, -26.489, 9.251 ], "frame": { "rmsd": null, "origin": [ 38.483, 10.281, 13.869 ], "x_axis": [ -0.597, -0.220, -0.771 ], "y_axis": [ -0.801, 0.213, 0.560 ], "z_axis": [ 0.041, 0.952, -0.303 ], "quaternion": [ 0.280, -0.351, 0.727, 0.520 ] } }, { "index": 5, "nt1": "///E/7", "nt2": "///E/66", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": 156.527, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 52.915, "chi2": -159.053, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 56.091, "C1C1_dist": 10.545, "N1N9_dist": 8.852, "C6C8_dist": 9.757, "CNNC_torsion": -28.182, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.09],N1-N3(imino)[2.93]", "interBase_angle": 24.970, "planarity": 0.385, "simple_Shear": -0.205, "simple_Stretch": -0.142, "simple_Buckle": -15.020, "simple_Propeller": -19.947, "bp_simpleParams": [ -0.205, -0.142, 0.665, -15.020, -19.947, -2.882 ], "bp_params": [ -0.204, -0.143, 0.665, -14.892, -20.043, -2.902 ], "frame": { "rmsd": null, "origin": [ 38.561, 13.361, 10.951 ], "x_axis": [ -0.904, -0.304, -0.301 ], "y_axis": [ -0.383, 0.266, 0.884 ], "z_axis": [ -0.188, 0.915, -0.357 ], "quaternion": [ 0.035, -0.216, 0.795, 0.566 ] } }, { "index": 6, "nt1": "///E/8", "nt2": "///E/14", "bp": "U-A", "name": "rHoogsteen", "Saenger": "24-XXIV", "LW": "tWH", "DSSR": "tW-M", "intra_chain": true, "chi1": -133.951, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 23.981, "chi2": -167.674, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 9.986, "C1C1_dist": 10.246, "N1N9_dist": 7.517, "C6C8_dist": 6.358, "CNNC_torsion": -158.139, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N6(amino)[2.73],N3(imino)-N7[3.06],O4(carbonyl)*N7[2.52]", "unusual_base2base_hbonds": 1, "interBase_angle": 26.959, "planarity": 0.279, "simple_Shear": 3.038, "simple_Stretch": 0.587, "simple_Buckle": 21.171, "simple_Propeller": -16.691, "bp_simpleParams": [ 3.038, 0.587, -1.655, 21.171, -16.691, -96.551 ], "bp_params": [ 2.959, -0.905, -1.655, 10.943, -24.638, -97.614 ], "frame": { "rmsd": null, "origin": [ 35.396, 24.976, 23.880 ], "x_axis": [ 0.506, -0.862, 0.030 ], "y_axis": [ 0.497, 0.263, -0.827 ], "z_axis": [ 0.704, 0.434, 0.562 ], "quaternion": [ 0.763, -0.413, 0.221, -0.445 ] } }, { "index": 7, "nt1": "///E/8", "nt2": "///E/48", "bp": "U-C", "name": "--", "Saenger": "--", "LW": "cSS", "DSSR": "cm-m", "intra_chain": true, "chi1": -133.951, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 138.835, "chi2": -153.032, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 105.895, "C1C1_dist": 4.588, "N1N9_dist": 6.157, "C6C8_dist": 8.797, "CNNC_torsion": 27.407, "hbonds_num": 2, "hbonds_desc": "O4'-O2'(hydroxyl)[3.61],O2(carbonyl)*O2(carbonyl)[2.81]", "interBase_angle": 11.993, "planarity": 0.274, "simple_Shear": 0.398, "simple_Stretch": 5.692, "simple_Buckle": 3.506, "simple_Propeller": 11.469, "bp_simpleParams": [ 0.398, 5.692, 0.421, 3.506, 11.469, 144.473 ], "bp_params": [ 1.182, 5.582, 0.421, 5.050, 10.878, 144.590 ], "frame": { "rmsd": null, "origin": [ 34.997, 25.324, 21.922 ], "x_axis": [ -0.753, 0.174, 0.635 ], "y_axis": [ 0.235, -0.830, 0.506 ], "z_axis": [ 0.615, 0.530, 0.584 ], "quaternion": [ -0.017, 0.351, 0.291, 0.890 ] } }, { "index": 8, "nt1": "///E/9", "nt2": "///E/23", "bp": "G+C", "name": "--", "Saenger": "--", "LW": "tHH", "DSSR": "tM+M", "intra_chain": true, "chi1": -167.976, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 10.864, "chi2": -154.231, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 5.912, "C1C1_dist": 12.163, "N1N9_dist": 9.289, "C6C8_dist": 7.614, "CNNC_torsion": -151.597, "hbonds_num": 2, "hbonds_desc": "N7-N4(amino)[3.18],O6(carbonyl)-N4(amino)[3.37]", "interBase_angle": 19.138, "planarity": 0.257, "simple_Shear": -7.617, "simple_Stretch": 1.275, "simple_Buckle": -11.876, "simple_Propeller": 15.008, "bp_simpleParams": [ -7.617, 1.275, 0.768, -11.876, 15.008, 176.030 ], "bp_params": [ 5.063, -5.831, 0.768, -0.412, -19.134, 176.085 ], "frame": { "rmsd": null, "origin": [ 43.037, 26.970, 27.451 ], "x_axis": [ -0.304, 0.871, 0.385 ], "y_axis": [ -0.418, -0.485, 0.768 ], "z_axis": [ 0.856, 0.073, 0.512 ], "quaternion": [ 0.425, 0.409, 0.277, 0.758 ] } }, { "index": 9, "nt1": "///E/10", "nt2": "///E/25", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -179.050, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 52.738, "chi2": -159.143, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 55.146, "C1C1_dist": 10.681, "N1N9_dist": 8.952, "C6C8_dist": 9.874, "CNNC_torsion": -1.865, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.89],N1(imino)-N3[2.89],N2(amino)-O2(carbonyl)[2.76]", "interBase_angle": 9.689, "planarity": 0.110, "simple_Shear": -0.216, "simple_Stretch": -0.131, "simple_Buckle": -7.869, "simple_Propeller": -5.654, "bp_simpleParams": [ -0.216, -0.131, -0.106, -7.869, -5.654, -0.089 ], "bp_params": [ -0.214, -0.135, -0.106, -7.784, -5.770, -0.089 ], "frame": { "rmsd": null, "origin": [ 48.873, 24.787, 28.726 ], "x_axis": [ -0.458, 0.882, -0.107 ], "y_axis": [ 0.391, 0.092, -0.916 ], "z_axis": [ -0.798, -0.461, -0.387 ], "quaternion": [ -0.248, 0.457, 0.696, -0.495 ] } }, { "index": 10, "nt1": "///E/11", "nt2": "///E/24", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -163.212, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 55.011, "chi2": -169.062, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 54.058, "C1C1_dist": 10.847, "N1N9_dist": 9.146, "C6C8_dist": 10.084, "CNNC_torsion": -0.007, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.93],N3-N1(imino)[3.08],N4(amino)-O6(carbonyl)[3.07]", "interBase_angle": 0.325, "planarity": 0.012, "simple_Shear": 0.244, "simple_Stretch": 0.049, "simple_Buckle": -0.289, "simple_Propeller": -0.148, "bp_simpleParams": [ 0.244, 0.049, 0.035, -0.289, -0.148, -0.086 ], "bp_params": [ 0.245, 0.045, 0.035, -0.288, -0.150, -0.086 ], "frame": { "rmsd": null, "origin": [ 45.708, 23.447, 29.340 ], "x_axis": [ -0.140, 0.758, -0.637 ], "y_axis": [ 0.589, -0.454, -0.669 ], "z_axis": [ -0.796, -0.469, -0.383 ], "quaternion": [ -0.077, 0.651, 0.517, -0.550 ] } }, { "index": 11, "nt1": "///E/12", "nt2": "///E/23", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -171.701, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 52.541, "chi2": -154.231, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 56.970, "C1C1_dist": 10.819, "N1N9_dist": 9.128, "C6C8_dist": 10.068, "CNNC_torsion": -2.271, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[3.14],N1(imino)-N3[3.12],N2(amino)-O2(carbonyl)[2.94]", "interBase_angle": 12.020, "planarity": 0.180, "simple_Shear": -0.331, "simple_Stretch": 0.087, "simple_Buckle": -11.561, "simple_Propeller": -3.290, "bp_simpleParams": [ -0.331, 0.087, 0.171, -11.561, -3.290, 0.785 ], "bp_params": [ -0.333, 0.078, 0.171, -11.473, -3.584, 0.781 ], "frame": { "rmsd": null, "origin": [ 42.154, 23.180, 28.591 ], "x_axis": [ 0.378, 0.499, -0.780 ], "y_axis": [ 0.531, -0.807, -0.258 ], "z_axis": [ -0.758, -0.317, -0.570 ], "quaternion": [ 0.018, 0.830, 0.310, -0.463 ] } }, { "index": 12, "nt1": "///E/13", "nt2": "///E/22", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": 178.711, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 53.008, "chi2": 152.298, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 50.777, "C1C1_dist": 10.835, "N1N9_dist": 9.025, "C6C8_dist": 9.898, "CNNC_torsion": -3.243, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.93],N3-N1(imino)[2.98],N4(amino)-O6(carbonyl)[2.92]", "interBase_angle": 5.277, "planarity": 0.146, "simple_Shear": 0.274, "simple_Stretch": -0.120, "simple_Buckle": 5.094, "simple_Propeller": 1.379, "bp_simpleParams": [ 0.274, -0.120, 0.396, 5.094, 1.379, -2.185 ], "bp_params": [ 0.271, -0.126, 0.396, 5.124, 1.260, -2.182 ], "frame": { "rmsd": null, "origin": [ 39.406, 24.871, 25.893 ], "x_axis": [ 0.571, -0.068, -0.818 ], "y_axis": [ 0.258, -0.931, 0.258 ], "z_axis": [ -0.779, -0.359, -0.514 ], "quaternion": [ 0.178, 0.868, 0.055, -0.460 ] } }, { "index": 13, "nt1": "///E/15", "nt2": "///E/48", "bp": "G+C", "name": "rWC", "Saenger": "22-XXII", "LW": "tWW", "DSSR": "tW+W", "intra_chain": true, "chi1": -149.046, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 50.471, "chi2": -153.032, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 48.114, "C1C1_dist": 11.059, "N1N9_dist": 9.406, "C6C8_dist": 10.941, "CNNC_torsion": 159.771, "hbonds_num": 1, "hbonds_desc": "N2(amino)-N3[2.79]", "interBase_angle": 25.874, "planarity": 0.317, "simple_Shear": 3.608, "simple_Stretch": 1.564, "simple_Buckle": 13.268, "simple_Propeller": -22.214, "bp_simpleParams": [ 3.608, 1.564, 0.745, 13.268, -22.214, 178.472 ], "bp_params": [ -0.178, 3.928, 0.745, 25.497, 4.404, 178.434 ], "frame": { "rmsd": null, "origin": [ 34.823, 25.432, 20.067 ], "x_axis": [ 0.617, 0.074, -0.783 ], "y_axis": [ 0.254, -0.961, 0.109 ], "z_axis": [ -0.745, -0.266, -0.612 ], "quaternion": [ 0.105, 0.893, 0.092, -0.428 ] } }, { "index": 14, "nt1": "///E/16", "nt2": "///E/59", "bp": "U+U", "name": "--", "Saenger": "--", "LW": "tWW", "DSSR": "tW+W", "intra_chain": true, "chi1": -144.480, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 27.942, "chi2": -157.808, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 35.897, "C1C1_dist": 9.223, "N1N9_dist": 6.901, "C6C8_dist": 7.869, "CNNC_torsion": -169.633, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)*O4(carbonyl)[3.01],N3(imino)*N3(imino)[2.81],O4(carbonyl)*O2(carbonyl)[2.46]", "unusual_base2base_hbonds": 3, "interBase_angle": 36.702, "planarity": 0.341, "simple_Shear": 1.692, "simple_Stretch": -1.644, "simple_Buckle": 35.375, "simple_Propeller": -9.781, "bp_simpleParams": [ 1.692, -1.644, 0.082, 35.375, -9.781, 171.432 ], "bp_params": [ 1.880, 1.424, 0.082, 14.749, 33.608, 171.723 ], "frame": { "rmsd": null, "origin": [ 31.749, 28.296, 18.763 ], "x_axis": [ 0.654, 0.094, -0.750 ], "y_axis": [ 0.259, -0.960, 0.105 ], "z_axis": [ -0.711, -0.263, -0.653 ], "quaternion": [ 0.102, 0.904, 0.098, -0.404 ] } }, { "index": 15, "nt1": "///E/21", "nt2": "///E/47", "bp": "A-U", "name": "--", "Saenger": "--", "LW": "tHS", "DSSR": "tM-m", "intra_chain": true, "chi1": -165.105, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 19.620, "chi2": -146.693, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 80.989, "C1C1_dist": 7.859, "N1N9_dist": 6.540, "C6C8_dist": 6.473, "CNNC_torsion": -174.992, "hbonds_num": 2, "hbonds_desc": "N7*O2(carbonyl)[2.64],N6(amino)-O2'(hydroxyl)[3.24]", "interBase_angle": 14.447, "planarity": 0.307, "simple_Shear": -8.343, "simple_Stretch": 2.930, "simple_Buckle": 4.316, "simple_Propeller": -13.787, "bp_simpleParams": [ -8.343, 2.930, 1.589, 4.316, -13.787, -49.406 ], "bp_params": [ -5.801, -6.674, 1.589, 14.405, -1.092, -49.064 ], "frame": { "rmsd": null, "origin": [ 37.729, 31.550, 18.245 ], "x_axis": [ 0.466, 0.652, -0.598 ], "y_axis": [ -0.684, 0.694, 0.225 ], "z_axis": [ 0.562, 0.304, 0.770 ], "quaternion": [ 0.856, -0.023, 0.339, 0.390 ] } }, { "index": 16, "nt1": "///E/22", "nt2": "///E/46", "bp": "G-G", "name": "--", "Saenger": "--", "LW": "tHW", "DSSR": "tM-W", "intra_chain": true, "chi1": 152.298, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 33.482, "chi2": -80.168, "conf2": "--", "pucker2": "~C3'-endo", "lambda2": 41.818, "C1C1_dist": 10.380, "N1N9_dist": 8.270, "C6C8_dist": 7.380, "CNNC_torsion": 170.490, "hbonds_num": 3, "hbonds_desc": "N7-N1(imino)[2.95],N7-N2(amino)[2.59],O6(carbonyl)-N2(amino)[3.16]", "interBase_angle": 7.468, "planarity": 0.366, "simple_Shear": -5.331, "simple_Stretch": 3.672, "simple_Buckle": -0.220, "simple_Propeller": -7.465, "bp_simpleParams": [ -5.331, 3.672, -1.745, -0.220, -7.465, -98.849 ], "bp_params": [ -6.013, -2.399, -1.745, 6.089, -4.324, -98.809 ], "frame": { "rmsd": null, "origin": [ 39.743, 27.917, 24.697 ], "x_axis": [ 0.126, 0.618, -0.776 ], "y_axis": [ -0.655, 0.639, 0.403 ], "z_axis": [ 0.745, 0.457, 0.486 ], "quaternion": [ 0.750, -0.018, 0.507, 0.424 ] } }, { "index": 17, "nt1": "///E/26", "nt2": "///E/44", "bp": "A-U", "name": "--", "Saenger": "--", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -166.009, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 43.794, "chi2": -173.571, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 32.803, "C1C1_dist": 12.675, "N1N9_dist": 10.398, "C6C8_dist": 10.244, "CNNC_torsion": -18.274, "hbonds_num": 1, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.01]", "interBase_angle": 42.703, "planarity": 0.569, "simple_Shear": 1.369, "simple_Stretch": 1.878, "simple_Buckle": 42.642, "simple_Propeller": 2.284, "bp_simpleParams": [ 1.369, 1.878, 0.107, 42.642, 2.284, -50.944 ], "bp_params": [ 1.639, 1.647, 0.107, 42.481, -4.346, -47.917 ], "frame": { "rmsd": null, "origin": [ 50.471, 29.370, 28.493 ], "x_axis": [ -0.679, 0.156, 0.717 ], "y_axis": [ 0.149, -0.927, 0.343 ], "z_axis": [ 0.719, 0.340, 0.606 ], "quaternion": [ 0.002, 0.401, 0.191, 0.896 ] } }, { "index": 18, "nt1": "///E/27", "nt2": "///E/43", "bp": "G-U", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -163.144, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 52.954, "chi2": -151.027, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 69.765, "C1C1_dist": 10.290, "N1N9_dist": 8.911, "C6C8_dist": 10.158, "CNNC_torsion": -12.210, "hbonds_num": 2, "hbonds_desc": "N1(imino)*N3(imino)[3.31],N2(amino)-O2(carbonyl)[2.75]", "interBase_angle": 16.603, "planarity": 0.267, "simple_Shear": -0.954, "simple_Stretch": 0.280, "simple_Buckle": 2.972, "simple_Propeller": -16.334, "bp_simpleParams": [ -0.954, 0.280, -0.333, 2.972, -16.334, 15.134 ], "bp_params": [ -0.976, 0.190, -0.333, 4.455, -15.994, 15.270 ], "frame": { "rmsd": null, "origin": [ 49.952, 32.312, 33.476 ], "x_axis": [ -0.654, -0.405, 0.639 ], "y_axis": [ 0.559, -0.828, 0.048 ], "z_axis": [ 0.510, 0.388, 0.768 ], "quaternion": [ -0.267, 0.319, 0.121, 0.901 ] } }, { "index": 19, "nt1": "///E/28", "nt2": "///E/42", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -143.481, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 55.949, "chi2": -163.714, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 58.334, "C1C1_dist": 10.425, "N1N9_dist": 8.847, "C6C8_dist": 9.835, "CNNC_torsion": -15.621, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[3.02],N3-N1(imino)[2.90],N4(amino)-O6(carbonyl)[3.01]", "interBase_angle": 35.731, "planarity": 0.397, "simple_Shear": 0.047, "simple_Stretch": -0.090, "simple_Buckle": 18.055, "simple_Propeller": -30.833, "bp_simpleParams": [ 0.047, -0.090, -0.629, 18.055, -30.833, 5.330 ], "bp_params": [ 0.049, -0.089, -0.629, 18.485, -30.578, 5.459 ], "frame": { "rmsd": null, "origin": [ 51.083, 34.507, 35.400 ], "x_axis": [ -0.224, -0.823, 0.522 ], "y_axis": [ 0.843, -0.432, -0.320 ], "z_axis": [ 0.489, 0.369, 0.791 ], "quaternion": [ 0.533, -0.323, -0.016, -0.782 ] } }, { "index": 20, "nt1": "///E/29", "nt2": "///E/41", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -160.736, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 65.779, "chi2": -154.265, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 61.787, "C1C1_dist": 9.908, "N1N9_dist": 8.618, "C6C8_dist": 9.853, "CNNC_torsion": -4.254, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.31],N1-N3(imino)[2.80]", "interBase_angle": 12.371, "planarity": 0.160, "simple_Shear": 0.026, "simple_Stretch": -0.041, "simple_Buckle": -5.912, "simple_Propeller": -10.867, "bp_simpleParams": [ 0.026, -0.041, -0.468, -5.912, -10.867, 13.167 ], "bp_params": [ 0.025, -0.041, -0.468, -6.018, -10.809, 13.207 ], "frame": { "rmsd": null, "origin": [ 51.860, 35.080, 39.742 ], "x_axis": [ 0.058, -0.992, 0.109 ], "y_axis": [ 0.848, -0.008, -0.531 ], "z_axis": [ 0.528, 0.123, 0.841 ], "quaternion": [ 0.688, -0.238, 0.152, -0.669 ] } }, { "index": 21, "nt1": "///E/30", "nt2": "///E/40", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -171.669, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 54.979, "chi2": -158.184, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 61.416, "C1C1_dist": 10.402, "N1N9_dist": 8.871, "C6C8_dist": 9.879, "CNNC_torsion": 7.307, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[3.11],N1(imino)-N3[3.00],N2(amino)-O2(carbonyl)[2.80]", "interBase_angle": 15.471, "planarity": 0.172, "simple_Shear": -0.455, "simple_Stretch": -0.053, "simple_Buckle": -15.228, "simple_Propeller": -2.733, "bp_simpleParams": [ -0.455, -0.053, -0.599, -15.228, -2.733, 3.014 ], "bp_params": [ -0.452, -0.070, -0.599, -15.113, -3.313, 2.989 ], "frame": { "rmsd": null, "origin": [ 52.285, 35.500, 43.418 ], "x_axis": [ 0.331, -0.860, -0.389 ], "y_axis": [ 0.692, 0.502, -0.519 ], "z_axis": [ 0.641, -0.097, 0.761 ], "quaternion": [ 0.805, -0.131, 0.320, -0.482 ] } }, { "index": 22, "nt1": "///E/31", "nt2": "///E/39", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -166.280, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 64.117, "chi2": -155.183, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 58.509, "C1C1_dist": 10.005, "N1N9_dist": 8.597, "C6C8_dist": 9.749, "CNNC_torsion": 0.382, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.16],N1-N3(imino)[2.76]", "interBase_angle": 14.806, "planarity": 0.213, "simple_Shear": 0.142, "simple_Stretch": -0.084, "simple_Buckle": -14.798, "simple_Propeller": -0.473, "bp_simpleParams": [ 0.142, -0.084, 0.183, -14.798, -0.473, 9.555 ], "bp_params": [ 0.140, -0.087, 0.183, -14.805, -0.172, 9.476 ], "frame": { "rmsd": null, "origin": [ 53.567, 33.688, 46.566 ], "x_axis": [ 0.590, -0.525, -0.613 ], "y_axis": [ 0.418, 0.849, -0.325 ], "z_axis": [ 0.691, -0.065, 0.720 ], "quaternion": [ 0.889, -0.073, 0.367, -0.265 ] } }, { "index": 23, "nt1": "///E/32", "nt2": "///E/38", "bp": "U-A", "name": "--", "Saenger": "--", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -108.878, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 81.975, "chi2": 179.733, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 26.003, "C1C1_dist": 11.121, "N1N9_dist": 9.633, "C6C8_dist": 10.322, "CNNC_torsion": 9.317, "hbonds_num": 1, "hbonds_desc": "O2(carbonyl)-N6(amino)[2.81]", "interBase_angle": 16.932, "planarity": 0.261, "simple_Shear": 4.971, "simple_Stretch": 1.742, "simple_Buckle": 3.416, "simple_Propeller": 16.584, "bp_simpleParams": [ 4.971, 1.742, 0.455, 3.416, 16.584, -3.988 ], "bp_params": [ 5.173, -0.992, 0.455, 11.271, 12.636, -3.994 ], "frame": { "rmsd": null, "origin": [ 55.015, 32.650, 48.856 ], "x_axis": [ 0.646, 0.302, -0.701 ], "y_axis": [ -0.088, 0.942, 0.325 ], "z_axis": [ 0.758, -0.148, 0.635 ], "quaternion": [ 0.898, 0.132, 0.406, 0.109 ] } }, { "index": 24, "nt1": "///E/49", "nt2": "///E/65", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -174.453, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 54.533, "chi2": -161.751, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 53.354, "C1C1_dist": 10.801, "N1N9_dist": 9.073, "C6C8_dist": 10.017, "CNNC_torsion": -6.806, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.92],N3-N1(imino)[3.00],N4(amino)-O6(carbonyl)[3.02]", "interBase_angle": 11.706, "planarity": 0.155, "simple_Shear": 0.193, "simple_Stretch": -0.019, "simple_Buckle": 1.433, "simple_Propeller": -11.617, "bp_simpleParams": [ 0.193, -0.019, -0.226, 1.433, -11.617, 1.061 ], "bp_params": [ 0.193, -0.022, -0.226, 1.265, -11.637, 1.067 ], "frame": { "rmsd": null, "origin": [ 39.678, 15.410, 8.007 ], "x_axis": [ -0.909, -0.165, 0.383 ], "y_axis": [ 0.232, 0.563, 0.793 ], "z_axis": [ -0.347, 0.810, -0.473 ], "quaternion": [ -0.213, 0.020, 0.858, 0.467 ] } }, { "index": 25, "nt1": "///E/50", "nt2": "///E/64", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -162.034, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 57.395, "chi2": -159.835, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 59.857, "C1C1_dist": 10.328, "N1N9_dist": 8.803, "C6C8_dist": 9.845, "CNNC_torsion": -12.156, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.86],O4(carbonyl)-N6(amino)[3.09]", "interBase_angle": 21.766, "planarity": 0.267, "simple_Shear": -0.162, "simple_Stretch": -0.024, "simple_Buckle": -14.616, "simple_Propeller": -16.129, "bp_simpleParams": [ -0.162, -0.024, 0.110, -14.616, -16.129, 4.249 ], "bp_params": [ -0.162, -0.026, 0.110, -14.402, -16.320, 4.260 ], "frame": { "rmsd": null, "origin": [ 36.860, 17.143, 6.189 ], "x_axis": [ -0.398, -0.020, 0.917 ], "y_axis": [ 0.706, 0.631, 0.321 ], "z_axis": [ -0.586, 0.775, -0.237 ], "quaternion": [ -0.499, 0.228, 0.753, 0.364 ] } }, { "index": 26, "nt1": "///E/51", "nt2": "///E/63", "bp": "U-G", "name": "--", "Saenger": "--", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -155.467, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 58.692, "chi2": -156.900, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 54.072, "C1C1_dist": 10.555, "N1N9_dist": 8.933, "C6C8_dist": 9.943, "CNNC_torsion": -6.260, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.70],N3(imino)*N1(imino)[2.99],O4(carbonyl)*O6(carbonyl)[3.09]", "unusual_base2base_hbonds": 2, "interBase_angle": 12.207, "planarity": 0.169, "simple_Shear": 0.264, "simple_Stretch": -0.074, "simple_Buckle": -3.118, "simple_Propeller": -11.802, "bp_simpleParams": [ 0.264, -0.074, -0.034, -3.118, -11.802, 2.473 ], "bp_params": [ 0.262, -0.080, -0.034, -3.375, -11.731, 2.485 ], "frame": { "rmsd": null, "origin": [ 33.948, 18.728, 4.686 ], "x_axis": [ -0.075, 0.306, 0.949 ], "y_axis": [ 0.815, 0.567, -0.118 ], "z_axis": [ -0.574, 0.765, -0.292 ], "quaternion": [ 0.548, -0.403, -0.695, -0.233 ] } }, { "index": 27, "nt1": "///E/52", "nt2": "///E/62", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -155.161, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 54.557, "chi2": -158.523, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 56.243, "C1C1_dist": 10.693, "N1N9_dist": 9.031, "C6C8_dist": 9.967, "CNNC_torsion": 0.580, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.00],N1-N3(imino)[2.99]", "interBase_angle": 3.944, "planarity": 0.047, "simple_Shear": -0.113, "simple_Stretch": 0.020, "simple_Buckle": 3.793, "simple_Propeller": 1.080, "bp_simpleParams": [ -0.113, 0.020, 0.014, 3.793, 1.080, -0.913 ], "bp_params": [ -0.113, 0.019, 0.014, 3.786, 1.105, -0.912 ], "frame": { "rmsd": null, "origin": [ 31.268, 20.502, 4.209 ], "x_axis": [ 0.466, 0.417, 0.780 ], "y_axis": [ 0.717, 0.339, -0.609 ], "z_axis": [ -0.518, 0.844, -0.141 ], "quaternion": [ 0.645, -0.563, -0.503, -0.117 ] } }, { "index": 28, "nt1": "///E/53", "nt2": "///E/61", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": 177.801, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 54.370, "chi2": -170.892, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 52.953, "C1C1_dist": 10.873, "N1N9_dist": 9.135, "C6C8_dist": 10.064, "CNNC_torsion": -10.883, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[3.02],N1(imino)-N3[3.03],N2(amino)-O2(carbonyl)[2.94]", "interBase_angle": 12.047, "planarity": 0.152, "simple_Shear": -0.020, "simple_Stretch": 0.029, "simple_Buckle": -0.987, "simple_Propeller": -12.006, "bp_simpleParams": [ -0.020, 0.029, -0.041, -0.987, -12.006, 0.020 ], "bp_params": [ -0.020, 0.029, -0.041, -1.019, -12.004, 0.020 ], "frame": { "rmsd": null, "origin": [ 29.290, 23.460, 5.808 ], "x_axis": [ 0.810, 0.475, 0.344 ], "y_axis": [ 0.337, 0.103, -0.936 ], "z_axis": [ -0.480, 0.874, -0.077 ], "quaternion": [ 0.677, -0.668, -0.304, 0.051 ] } }, { "index": 29, "nt1": "///E/54", "nt2": "///E/58", "bp": "U-A", "name": "rHoogsteen", "Saenger": "24-XXIV", "LW": "tWH", "DSSR": "tW-M", "intra_chain": true, "chi1": -156.674, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 32.510, "chi2": -102.723, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 16.226, "C1C1_dist": 10.394, "N1N9_dist": 7.842, "C6C8_dist": 7.046, "CNNC_torsion": -174.229, "hbonds_num": 2, "hbonds_desc": "O2(carbonyl)-N6(amino)[3.02],N3(imino)-N7[3.51]", "interBase_angle": 36.475, "planarity": 0.425, "simple_Shear": 4.176, "simple_Stretch": 1.350, "simple_Buckle": 21.297, "simple_Propeller": -29.612, "bp_simpleParams": [ 4.176, 1.350, -0.584, 21.297, -29.612, -89.164 ], "bp_params": [ 4.123, -1.503, -0.584, -1.611, -36.439, -92.104 ], "frame": { "rmsd": null, "origin": [ 26.245, 26.236, 8.716 ], "x_axis": [ 0.489, -0.037, -0.871 ], "y_axis": [ -0.718, -0.584, -0.378 ], "z_axis": [ -0.495, 0.811, -0.312 ], "quaternion": [ -0.385, 0.772, -0.245, -0.442 ] } }, { "index": 30, "nt1": "///F/3", "nt2": "///F/70", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -164.419, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 52.664, "chi2": -159.690, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 65.149, "C1C1_dist": 10.670, "N1N9_dist": 9.168, "C6C8_dist": 10.288, "CNNC_torsion": 12.280, "hbonds_num": 1, "hbonds_desc": "N3(imino)-N1[3.27]", "interBase_angle": 14.540, "planarity": 0.188, "simple_Shear": -1.034, "simple_Stretch": 0.415, "simple_Buckle": -0.692, "simple_Propeller": 14.523, "bp_simpleParams": [ -1.034, 0.415, -0.213, -0.692, 14.523, 7.585 ], "bp_params": [ -1.074, 0.298, -0.213, -2.295, 14.358, 7.644 ], "frame": { "rmsd": null, "origin": [ 128.996, 87.131, 25.004 ], "x_axis": [ -0.633, -0.413, -0.655 ], "y_axis": [ 0.757, -0.153, -0.636 ], "z_axis": [ 0.163, -0.898, 0.409 ], "quaternion": [ -0.395, -0.166, -0.517, 0.741 ] } }, { "index": 31, "nt1": "///F/4", "nt2": "///F/69", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -176.211, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 50.154, "chi2": -176.250, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 53.591, "C1C1_dist": 11.577, "N1N9_dist": 9.763, "C6C8_dist": 10.594, "CNNC_torsion": -2.072, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[3.70],N3-N1(imino)[3.63],N4(amino)-O6(carbonyl)[3.41]", "interBase_angle": 11.589, "planarity": 0.154, "simple_Shear": -0.187, "simple_Stretch": 0.561, "simple_Buckle": 6.829, "simple_Propeller": -9.363, "bp_simpleParams": [ -0.187, 0.561, -0.676, 6.829, -9.363, -3.810 ], "bp_params": [ -0.201, 0.556, -0.676, 7.060, -9.190, -3.815 ], "frame": { "rmsd": null, "origin": [ 127.448, 84.579, 26.765 ], "x_axis": [ -0.095, -0.385, -0.918 ], "y_axis": [ 0.994, 0.012, -0.108 ], "z_axis": [ 0.053, -0.923, 0.382 ], "quaternion": [ 0.570, 0.357, 0.426, -0.605 ] } }, { "index": 32, "nt1": "///F/5", "nt2": "///F/68", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": 163.905, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 50.843, "chi2": -162.207, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 53.777, "C1C1_dist": 10.851, "N1N9_dist": 9.063, "C6C8_dist": 9.914, "CNNC_torsion": -4.892, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.90],N1(imino)-N3[3.01],N2(amino)-O2(carbonyl)[2.98]", "interBase_angle": 15.328, "planarity": 0.194, "simple_Shear": -0.254, "simple_Stretch": -0.041, "simple_Buckle": -13.679, "simple_Propeller": -6.915, "bp_simpleParams": [ -0.254, -0.041, 0.003, -13.679, -6.915, -3.164 ], "bp_params": [ -0.254, -0.045, 0.003, -13.570, -7.127, -3.148 ], "frame": { "rmsd": null, "origin": [ 126.082, 80.852, 27.744 ], "x_axis": [ 0.427, -0.027, -0.904 ], "y_axis": [ 0.875, 0.266, 0.405 ], "z_axis": [ 0.229, -0.964, 0.138 ], "quaternion": [ 0.677, 0.506, 0.419, -0.333 ] } }, { "index": 33, "nt1": "///F/6", "nt2": "///F/67", "bp": "U-G", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -143.813, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 83.045, "chi2": -158.412, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 43.898, "C1C1_dist": 10.238, "N1N9_dist": 9.022, "C6C8_dist": 10.263, "CNNC_torsion": -18.863, "hbonds_num": 1, "hbonds_desc": "O2(carbonyl)-N1(imino)[2.90]", "interBase_angle": 25.137, "planarity": 0.345, "simple_Shear": 3.248, "simple_Stretch": 0.943, "simple_Buckle": 4.224, "simple_Propeller": -24.779, "bp_simpleParams": [ 3.248, 0.943, -0.018, 4.224, -24.779, 19.333 ], "bp_params": [ 3.378, -0.172, -0.018, -4.181, -24.787, 19.773 ], "frame": { "rmsd": null, "origin": [ 126.746, 77.321, 26.777 ], "x_axis": [ 0.959, 0.013, -0.282 ], "y_axis": [ 0.280, 0.082, 0.956 ], "z_axis": [ 0.036, -0.997, 0.075 ], "quaternion": [ 0.727, 0.671, 0.109, -0.092 ] } }, { "index": 34, "nt1": "///F/7", "nt2": "///F/65", "bp": "A-G", "name": "--", "Saenger": "--", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -167.242, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 26.804, "chi2": -172.154, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 40.373, "C1C1_dist": 13.485, "N1N9_dist": 11.070, "C6C8_dist": 10.922, "CNNC_torsion": -17.948, "hbonds_num": 1, "hbonds_desc": "N6(amino)-O6(carbonyl)[2.73]", "interBase_angle": 29.500, "planarity": 0.512, "simple_Shear": -1.151, "simple_Stretch": 1.607, "simple_Buckle": -3.093, "simple_Propeller": -29.338, "bp_simpleParams": [ -1.151, 1.607, -1.797, -3.093, -29.338, -35.402 ], "bp_params": [ -1.345, 1.448, -1.797, 0.706, -29.492, -36.528 ], "frame": { "rmsd": null, "origin": [ 127.401, 73.085, 25.534 ], "x_axis": [ 0.925, 0.243, 0.291 ], "y_axis": [ -0.310, 0.043, 0.950 ], "z_axis": [ 0.219, -0.969, 0.115 ], "quaternion": [ 0.722, 0.665, -0.025, 0.192 ] } }, { "index": 35, "nt1": "///F/7", "nt2": "///F/66", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -167.242, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 50.076, "chi2": -169.045, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 53.997, "C1C1_dist": 10.573, "N1N9_dist": 8.792, "C6C8_dist": 9.614, "CNNC_torsion": -38.178, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.08],N1-N3(imino)[2.90]", "interBase_angle": 20.436, "planarity": 0.399, "simple_Shear": 0.089, "simple_Stretch": -0.413, "simple_Buckle": 10.265, "simple_Propeller": -17.671, "bp_simpleParams": [ 0.089, -0.413, 1.553, 10.265, -17.671, -7.725 ], "bp_params": [ 0.087, -0.414, 1.553, 10.114, -17.758, -7.788 ], "frame": { "rmsd": null, "origin": [ 126.203, 74.606, 26.025 ], "x_axis": [ 0.990, 0.134, 0.052 ], "y_axis": [ -0.069, 0.121, 0.990 ], "z_axis": [ 0.126, -0.984, 0.129 ], "quaternion": [ 0.748, 0.660, 0.025, 0.068 ] } }, { "index": 36, "nt1": "///F/8", "nt2": "///F/14", "bp": "U-A", "name": "rHoogsteen", "Saenger": "24-XXIV", "LW": "tWH", "DSSR": "tW-M", "intra_chain": true, "chi1": -143.824, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 29.887, "chi2": 172.856, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 31.533, "C1C1_dist": 9.152, "N1N9_dist": 6.798, "C6C8_dist": 5.814, "CNNC_torsion": -176.503, "hbonds_num": 1, "hbonds_desc": "N3(imino)-N7[2.91]", "interBase_angle": 6.675, "planarity": 0.098, "simple_Shear": 4.530, "simple_Stretch": 2.548, "simple_Buckle": 6.555, "simple_Propeller": -1.259, "bp_simpleParams": [ 4.530, 2.548, -0.701, 6.555, -1.259, -111.626 ], "bp_params": [ 4.678, -2.264, -0.701, 2.709, -6.100, -111.686 ], "frame": { "rmsd": null, "origin": [ 125.338, 68.081, 43.622 ], "x_axis": [ -0.342, 0.569, -0.747 ], "y_axis": [ -0.007, -0.797, -0.604 ], "z_axis": [ -0.940, -0.202, 0.277 ], "quaternion": [ 0.185, -0.543, -0.259, 0.777 ] } }, { "index": 37, "nt1": "///F/8", "nt2": "///F/21", "bp": "U+A", "name": "--", "Saenger": "--", "LW": "tSW", "DSSR": "tm+W", "intra_chain": true, "chi1": -143.824, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 104.514, "chi2": -148.888, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 44.426, "C1C1_dist": 8.924, "N1N9_dist": 8.579, "C6C8_dist": 10.532, "CNNC_torsion": 152.856, "hbonds_num": 2, "hbonds_desc": "O2'(hydroxyl)-N6(amino)[3.23],O2'(hydroxyl)-N1[3.20]", "interBase_angle": 31.680, "planarity": 0.379, "simple_Shear": 5.950, "simple_Stretch": 4.274, "simple_Buckle": 18.649, "simple_Propeller": -25.609, "bp_simpleParams": [ 5.950, 4.274, 1.408, 18.649, -25.609, -123.121 ], "bp_params": [ -0.977, -7.261, 1.408, -31.409, 4.140, -121.308 ], "frame": { "rmsd": null, "origin": [ 124.399, 67.445, 40.217 ], "x_axis": [ -0.425, 0.485, -0.764 ], "y_axis": [ -0.243, -0.874, -0.420 ], "z_axis": [ -0.872, 0.007, 0.490 ], "quaternion": [ 0.218, -0.490, -0.124, 0.835 ] } }, { "index": 38, "nt1": "///F/9", "nt2": "///F/23", "bp": "G+C", "name": "--", "Saenger": "--", "LW": "tHH", "DSSR": "tM+M", "intra_chain": true, "chi1": -163.086, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 9.506, "chi2": -157.501, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 6.139, "C1C1_dist": 12.415, "N1N9_dist": 9.528, "C6C8_dist": 7.966, "CNNC_torsion": -107.565, "hbonds_num": 2, "hbonds_desc": "N7-N4(amino)[3.42],O6(carbonyl)-N4(amino)[2.93]", "interBase_angle": 26.264, "planarity": 0.318, "simple_Shear": -7.152, "simple_Stretch": 1.287, "simple_Buckle": -16.739, "simple_Propeller": 20.238, "bp_simpleParams": [ -7.152, 1.287, 0.636, -16.739, 20.238, -178.969 ], "bp_params": [ -4.373, 5.804, 0.636, 1.514, 26.220, -178.996 ], "frame": { "rmsd": null, "origin": [ 117.369, 65.785, 43.528 ], "x_axis": [ -0.161, 0.651, -0.742 ], "y_axis": [ -0.128, -0.759, -0.638 ], "z_axis": [ -0.979, -0.008, 0.206 ], "quaternion": [ 0.267, -0.590, -0.222, 0.729 ] } }, { "index": 39, "nt1": "///F/10", "nt2": "///F/25", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -163.614, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 56.973, "chi2": -145.708, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 60.432, "C1C1_dist": 10.261, "N1N9_dist": 8.744, "C6C8_dist": 9.819, "CNNC_torsion": -3.202, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[3.14],N1(imino)-N3[2.98],N2(amino)-O2(carbonyl)[2.79]", "interBase_angle": 15.352, "planarity": 0.283, "simple_Shear": -0.328, "simple_Stretch": -0.225, "simple_Buckle": -8.835, "simple_Propeller": -12.555, "bp_simpleParams": [ -0.328, -0.225, -1.209, -8.835, -12.555, 8.565 ], "bp_params": [ -0.323, -0.233, -1.209, -8.530, -12.765, 8.594 ], "frame": { "rmsd": null, "origin": [ 112.162, 66.814, 42.750 ], "x_axis": [ 0.606, -0.762, 0.228 ], "y_axis": [ 0.081, -0.226, -0.971 ], "z_axis": [ 0.791, 0.607, -0.076 ], "quaternion": [ 0.571, -0.691, 0.247, -0.369 ] } }, { "index": 40, "nt1": "///F/10", "nt2": "///F/45", "bp": "G-G", "name": "--", "Saenger": "--", "LW": "cHH", "DSSR": "cM-M", "intra_chain": true, "chi1": -163.614, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 44.302, "chi2": 6.866, "conf2": "syn", "pucker2": "~C3'-endo", "lambda2": 70.612, "C1C1_dist": 8.548, "N1N9_dist": 7.033, "C6C8_dist": 4.634, "CNNC_torsion": 10.581, "hbonds_num": 1, "hbonds_desc": "O6(carbonyl)*N7[3.63]", "interBase_angle": 30.642, "planarity": 0.432, "simple_Shear": -1.538, "simple_Stretch": 7.404, "simple_Buckle": -22.864, "simple_Propeller": -20.401, "bp_simpleParams": [ -1.538, 7.404, 0.686, -22.864, -20.401, 141.121 ], "bp_params": [ -2.134, -7.255, 0.686, 29.791, 7.172, 139.944 ], "frame": { "rmsd": null, "origin": [ 113.197, 63.214, 43.465 ], "x_axis": [ 0.312, 0.000, 0.950 ], "y_axis": [ 0.435, -0.889, -0.142 ], "z_axis": [ 0.845, 0.457, -0.277 ], "quaternion": [ -0.190, 0.787, 0.138, 0.570 ] } }, { "index": 41, "nt1": "///F/11", "nt2": "///F/24", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -174.154, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 56.534, "chi2": -156.479, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 53.630, "C1C1_dist": 10.643, "N1N9_dist": 8.968, "C6C8_dist": 9.895, "CNNC_torsion": -2.122, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.91],N3-N1(imino)[3.03],N4(amino)-O6(carbonyl)[3.05]", "interBase_angle": 19.172, "planarity": 0.259, "simple_Shear": 0.290, "simple_Stretch": 0.013, "simple_Buckle": -18.388, "simple_Propeller": -5.428, "bp_simpleParams": [ 0.290, 0.013, 0.175, -18.388, -5.428, 0.289 ], "bp_params": [ 0.290, 0.005, 0.175, -18.543, -4.873, 0.286 ], "frame": { "rmsd": null, "origin": [ 114.654, 69.639, 43.609 ], "x_axis": [ 0.328, -0.881, -0.340 ], "y_axis": [ -0.396, 0.199, -0.896 ], "z_axis": [ 0.857, 0.429, -0.284 ], "quaternion": [ 0.557, -0.594, 0.537, -0.217 ] } }, { "index": 42, "nt1": "///F/12", "nt2": "///F/23", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -169.076, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 56.932, "chi2": -157.501, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 57.096, "C1C1_dist": 10.590, "N1N9_dist": 8.997, "C6C8_dist": 10.011, "CNNC_torsion": -7.426, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[3.16],N1(imino)-N3[3.01],N2(amino)-O2(carbonyl)[2.78]", "interBase_angle": 12.618, "planarity": 0.185, "simple_Shear": -0.145, "simple_Stretch": 0.003, "simple_Buckle": -7.577, "simple_Propeller": -10.090, "bp_simpleParams": [ -0.145, 0.003, 0.358, -7.577, -10.090, 2.693 ], "bp_params": [ -0.145, 0.002, 0.358, -7.500, -10.148, 2.698 ], "frame": { "rmsd": null, "origin": [ 117.862, 69.515, 43.680 ], "x_axis": [ -0.047, -0.718, -0.695 ], "y_axis": [ -0.435, 0.641, -0.633 ], "z_axis": [ 0.899, 0.272, -0.342 ], "quaternion": [ 0.559, -0.405, 0.712, -0.126 ] } }, { "index": 43, "nt1": "///F/13", "nt2": "///F/22", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -177.349, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 49.775, "chi2": 165.470, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 51.052, "C1C1_dist": 10.808, "N1N9_dist": 8.953, "C6C8_dist": 9.774, "CNNC_torsion": -23.019, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.92],N3-N1(imino)[2.88],N4(amino)-O6(carbonyl)[2.88]", "interBase_angle": 18.478, "planarity": 0.274, "simple_Shear": 0.030, "simple_Stretch": -0.248, "simple_Buckle": 4.743, "simple_Propeller": -17.859, "bp_simpleParams": [ 0.030, -0.248, 0.599, 4.743, -17.859, -5.980 ], "bp_params": [ 0.031, -0.247, 0.599, 4.777, -17.850, -6.048 ], "frame": { "rmsd": null, "origin": [ 121.175, 68.259, 42.927 ], "x_axis": [ -0.227, -0.246, -0.942 ], "y_axis": [ -0.302, 0.938, -0.172 ], "z_axis": [ 0.926, 0.246, -0.287 ], "quaternion": [ 0.597, -0.175, 0.783, 0.023 ] } }, { "index": 44, "nt1": "///F/14", "nt2": "///F/21", "bp": "A-A", "name": "--", "Saenger": "--", "LW": "tWS", "DSSR": "tW-m", "intra_chain": true, "chi1": 172.856, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 20.171, "chi2": -148.888, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 92.763, "C1C1_dist": 10.989, "N1N9_dist": 9.730, "C6C8_dist": 10.319, "CNNC_torsion": -27.736, "hbonds_num": 1, "hbonds_desc": "N6(amino)-N3[3.44]", "interBase_angle": 35.130, "planarity": 0.452, "simple_Shear": -6.425, "simple_Stretch": 2.918, "simple_Buckle": -29.595, "simple_Propeller": -18.927, "bp_simpleParams": [ -6.425, 2.918, -1.315, -29.595, -18.927, 10.889 ], "bp_params": [ -6.776, -1.973, -1.315, -10.330, -33.577, 11.329 ], "frame": { "rmsd": null, "origin": [ 124.863, 65.140, 41.378 ], "x_axis": [ -0.399, -0.445, -0.802 ], "y_axis": [ -0.180, 0.895, -0.407 ], "z_axis": [ 0.899, -0.019, -0.438 ], "quaternion": [ 0.514, -0.189, 0.826, -0.129 ] } }, { "index": 45, "nt1": "///F/15", "nt2": "///F/21", "bp": "G-A", "name": "--", "Saenger": "--", "LW": "cWS", "DSSR": "cW-m", "intra_chain": true, "chi1": -172.409, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 87.238, "chi2": -148.888, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 110.017, "C1C1_dist": 7.830, "N1N9_dist": 8.273, "C6C8_dist": 10.569, "CNNC_torsion": -17.609, "hbonds_num": 1, "hbonds_desc": "N2(amino)-N3[2.90]", "interBase_angle": 33.549, "planarity": 0.672, "simple_Shear": -1.192, "simple_Stretch": 3.679, "simple_Buckle": -30.642, "simple_Propeller": -13.661, "bp_simpleParams": [ -1.192, 3.679, 2.668, -30.642, -13.661, 89.710 ], "bp_params": [ -1.769, 3.440, 2.668, -28.178, -18.209, 88.688 ], "frame": { "rmsd": null, "origin": [ 125.700, 65.964, 38.455 ], "x_axis": [ -0.436, 0.214, -0.874 ], "y_axis": [ 0.117, 0.977, 0.180 ], "z_axis": [ 0.892, -0.023, -0.451 ], "quaternion": [ 0.522, 0.098, 0.846, 0.046 ] } }, { "index": 46, "nt1": "///F/15", "nt2": "///F/48", "bp": "G+C", "name": "rWC", "Saenger": "22-XXII", "LW": "tWW", "DSSR": "tW+W", "intra_chain": true, "chi1": -172.409, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 42.077, "chi2": -171.621, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 74.759, "C1C1_dist": 10.598, "N1N9_dist": 9.427, "C6C8_dist": 11.178, "CNNC_torsion": 164.206, "hbonds_num": 1, "hbonds_desc": "N2(amino)-O2(carbonyl)[3.27]", "interBase_angle": 28.354, "planarity": 0.311, "simple_Shear": 4.533, "simple_Stretch": 3.016, "simple_Buckle": -24.258, "simple_Propeller": -14.679, "bp_simpleParams": [ 4.533, 3.016, -0.758, -24.258, -14.679, 146.156 ], "bp_params": [ -0.437, 5.427, -0.758, 0.938, -28.338, 147.128 ], "frame": { "rmsd": null, "origin": [ 128.382, 64.838, 39.162 ], "x_axis": [ -0.424, -0.307, -0.852 ], "y_axis": [ -0.246, 0.945, -0.218 ], "z_axis": [ 0.872, 0.117, -0.476 ], "quaternion": [ 0.511, -0.164, 0.843, -0.030 ] } }, { "index": 47, "nt1": "///F/16", "nt2": "///F/59", "bp": "U+U", "name": "--", "Saenger": "--", "LW": "tWW", "DSSR": "tW+W", "intra_chain": true, "chi1": -166.849, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 27.819, "chi2": -161.126, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 47.117, "C1C1_dist": 9.056, "N1N9_dist": 6.976, "C6C8_dist": 8.306, "CNNC_torsion": -170.768, "hbonds_num": 2, "hbonds_desc": "N3(imino)-O2(carbonyl)[2.81],O4(carbonyl)*O2(carbonyl)[2.52]", "unusual_base2base_hbonds": 1, "interBase_angle": 15.506, "planarity": 0.208, "simple_Shear": 2.604, "simple_Stretch": -1.236, "simple_Buckle": 15.073, "simple_Propeller": 3.639, "bp_simpleParams": [ 2.604, -1.236, 0.735, 15.073, 3.639, 159.538 ], "bp_params": [ 1.870, 2.194, 0.735, 0.416, 15.501, 159.721 ], "frame": { "rmsd": null, "origin": [ 131.551, 62.999, 39.626 ], "x_axis": [ -0.234, -0.267, -0.935 ], "y_axis": [ -0.420, 0.895, -0.150 ], "z_axis": [ 0.877, 0.357, -0.321 ], "quaternion": [ 0.579, -0.219, 0.783, 0.066 ] } }, { "index": 48, "nt1": "///F/18", "nt2": "///F/55", "bp": "G+U", "name": "--", "Saenger": "--", "LW": "tW.", "DSSR": "tW+.", "intra_chain": true, "chi1": -138.853, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 38.160, "chi2": -146.634, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 97.049, "C1C1_dist": 9.746, "N1N9_dist": 9.006, "C6C8_dist": 10.724, "CNNC_torsion": -121.002, "hbonds_num": 2, "hbonds_desc": "N1(imino)-O2(carbonyl)[3.07],N2(amino)-O2(carbonyl)[3.05]", "interBase_angle": 48.738, "planarity": 0.622, "simple_Shear": 4.061, "simple_Stretch": 3.448, "simple_Buckle": -2.973, "simple_Propeller": 48.647, "bp_simpleParams": [ 4.061, 3.448, 0.336, -2.973, 48.647, 116.808 ], "bp_params": [ -0.823, 5.264, 0.336, -42.970, 22.999, 114.066 ], "frame": { "rmsd": null, "origin": [ 140.305, 60.772, 32.508 ], "x_axis": [ 0.710, -0.009, -0.704 ], "y_axis": [ 0.627, 0.463, 0.626 ], "z_axis": [ 0.320, -0.886, 0.334 ], "quaternion": [ 0.792, 0.478, 0.324, -0.201 ] } }, { "index": 49, "nt1": "///F/19", "nt2": "///F/56", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -114.669, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 75.918, "chi2": -162.441, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 58.654, "C1C1_dist": 10.141, "N1N9_dist": 9.033, "C6C8_dist": 10.439, "CNNC_torsion": -23.666, "hbonds_num": 2, "hbonds_desc": "N2(amino)-O2(carbonyl)[3.01],N2(amino)-N3[2.65]", "interBase_angle": 50.003, "planarity": 0.556, "simple_Shear": 0.755, "simple_Stretch": 1.231, "simple_Buckle": -32.415, "simple_Propeller": -38.074, "bp_simpleParams": [ 0.755, 1.231, -0.437, -32.415, -38.074, 31.552 ], "bp_params": [ 0.919, 1.114, -0.437, -37.207, -33.406, 31.359 ], "frame": { "rmsd": null, "origin": [ 142.643, 54.924, 39.447 ], "x_axis": [ 0.603, 0.480, 0.638 ], "y_axis": [ -0.749, 0.066, 0.659 ], "z_axis": [ 0.274, -0.875, 0.399 ], "quaternion": [ 0.719, 0.533, -0.127, 0.427 ] } }, { "index": 50, "nt1": "///F/22", "nt2": "///F/46", "bp": "G-G", "name": "--", "Saenger": "07-VII", "LW": "tHW", "DSSR": "tM-W", "intra_chain": true, "chi1": 165.470, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 35.458, "chi2": -124.223, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 36.824, "C1C1_dist": 11.294, "N1N9_dist": 9.108, "C6C8_dist": 8.052, "CNNC_torsion": -177.672, "hbonds_num": 3, "hbonds_desc": "N7-N1(imino)[3.29],N7-N2(amino)[3.27],O6(carbonyl)-N2(amino)[3.34]", "interBase_angle": 9.235, "planarity": 0.146, "simple_Shear": -4.645, "simple_Stretch": 4.686, "simple_Buckle": 6.162, "simple_Propeller": 6.879, "bp_simpleParams": [ -4.645, 4.686, 0.435, 6.162, 6.879, -108.700 ], "bp_params": [ -6.517, -1.028, 0.435, -1.979, 9.020, -108.860 ], "frame": { "rmsd": null, "origin": [ 121.199, 65.164, 42.032 ], "x_axis": [ -0.032, -0.918, -0.395 ], "y_axis": [ 0.483, -0.360, 0.798 ], "z_axis": [ -0.875, -0.165, 0.455 ], "quaternion": [ 0.516, 0.467, -0.233, -0.679 ] } }, { "index": 51, "nt1": "///F/26", "nt2": "///F/44", "bp": "A-U", "name": "--", "Saenger": "--", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": 162.673, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 39.368, "chi2": 177.121, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 28.656, "C1C1_dist": 13.019, "N1N9_dist": 10.601, "C6C8_dist": 10.344, "CNNC_torsion": -6.839, "hbonds_num": 1, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.90]", "interBase_angle": 41.683, "planarity": 0.468, "simple_Shear": 1.123, "simple_Stretch": 1.885, "simple_Buckle": 33.968, "simple_Propeller": 24.158, "bp_simpleParams": [ 1.123, 1.885, 1.081, 33.968, 24.158, -52.237 ], "bp_params": [ 1.404, 1.686, 1.081, 37.461, 18.279, -50.415 ], "frame": { "rmsd": null, "origin": [ 110.458, 62.071, 42.257 ], "x_axis": [ 0.354, 0.022, 0.935 ], "y_axis": [ -0.191, 0.980, 0.050 ], "z_axis": [ -0.916, -0.196, 0.351 ], "quaternion": [ 0.819, 0.075, -0.565, 0.065 ] } }, { "index": 52, "nt1": "///F/27", "nt2": "///F/43", "bp": "G-U", "name": "--", "Saenger": "--", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -173.116, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 50.811, "chi2": -162.146, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 64.215, "C1C1_dist": 10.568, "N1N9_dist": 9.016, "C6C8_dist": 10.051, "CNNC_torsion": -1.682, "hbonds_num": 2, "hbonds_desc": "N1(imino)*N3(imino)[3.24],N2(amino)-O2(carbonyl)[2.84]", "unusual_base2base_hbonds": 1, "interBase_angle": 10.990, "planarity": 0.152, "simple_Shear": -0.743, "simple_Stretch": 0.114, "simple_Buckle": 10.128, "simple_Propeller": -4.265, "bp_simpleParams": [ -0.743, 0.114, 0.161, 10.128, -4.265, 3.775 ], "bp_params": [ -0.749, 0.061, 0.161, 10.405, -3.536, 3.761 ], "frame": { "rmsd": null, "origin": [ 108.818, 60.132, 47.110 ], "x_axis": [ 0.232, 0.513, 0.826 ], "y_axis": [ -0.406, 0.823, -0.397 ], "z_axis": [ -0.884, -0.244, 0.399 ], "quaternion": [ 0.783, -0.049, -0.546, 0.293 ] } }, { "index": 53, "nt1": "///F/28", "nt2": "///F/42", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -148.951, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 58.832, "chi2": -166.969, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 58.040, "C1C1_dist": 10.450, "N1N9_dist": 8.919, "C6C8_dist": 9.939, "CNNC_torsion": -1.543, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.89],N3-N1(imino)[3.03],N4(amino)-O6(carbonyl)[3.16]", "interBase_angle": 26.580, "planarity": 0.287, "simple_Shear": 0.228, "simple_Stretch": 0.031, "simple_Buckle": 20.322, "simple_Propeller": -17.132, "bp_simpleParams": [ 0.228, 0.031, -0.863, 20.322, -17.132, 6.365 ], "bp_params": [ 0.228, 0.030, -0.863, 20.269, -17.195, 6.340 ], "frame": { "rmsd": null, "origin": [ 106.935, 58.087, 49.355 ], "x_axis": [ -0.071, 0.874, 0.481 ], "y_axis": [ -0.556, 0.366, -0.746 ], "z_axis": [ -0.828, -0.321, 0.460 ], "quaternion": [ 0.662, -0.160, -0.494, 0.540 ] } }, { "index": 54, "nt1": "///F/29", "nt2": "///F/41", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -167.784, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 61.682, "chi2": -179.476, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 61.602, "C1C1_dist": 10.064, "N1N9_dist": 8.670, "C6C8_dist": 9.863, "CNNC_torsion": 7.687, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.38],N1-N3(imino)[2.87]", "interBase_angle": 14.255, "planarity": 0.175, "simple_Shear": -0.106, "simple_Stretch": -0.002, "simple_Buckle": 11.599, "simple_Propeller": 8.287, "bp_simpleParams": [ -0.106, -0.002, 0.688, 11.599, 8.287, 12.540 ], "bp_params": [ -0.106, -0.002, 0.688, 11.602, 8.283, 12.509 ], "frame": { "rmsd": null, "origin": [ 104.745, 57.274, 52.724 ], "x_axis": [ -0.202, 0.979, 0.016 ], "y_axis": [ -0.263, -0.039, -0.964 ], "z_axis": [ -0.943, -0.199, 0.265 ], "quaternion": [ 0.506, -0.378, -0.474, 0.614 ] } }, { "index": 55, "nt1": "///F/30", "nt2": "///F/40", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -168.100, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 55.487, "chi2": -163.315, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 60.192, "C1C1_dist": 10.568, "N1N9_dist": 9.008, "C6C8_dist": 10.057, "CNNC_torsion": 6.877, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[3.29],N1(imino)-N3[3.10],N2(amino)-O2(carbonyl)[2.76]", "interBase_angle": 10.650, "planarity": 0.137, "simple_Shear": -0.399, "simple_Stretch": 0.067, "simple_Buckle": -10.438, "simple_Propeller": -2.111, "bp_simpleParams": [ -0.399, 0.067, -0.670, -10.438, -2.111, 5.562 ], "bp_params": [ -0.401, 0.054, -0.670, -10.363, -2.454, 5.541 ], "frame": { "rmsd": null, "origin": [ 101.986, 57.189, 56.142 ], "x_axis": [ -0.171, 0.840, -0.515 ], "y_axis": [ -0.342, -0.541, -0.768 ], "z_axis": [ -0.924, 0.045, 0.380 ], "quaternion": [ 0.409, -0.497, -0.250, 0.723 ] } }, { "index": 56, "nt1": "///F/31", "nt2": "///F/39", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -161.868, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 57.977, "chi2": -158.226, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 59.312, "C1C1_dist": 10.351, "N1N9_dist": 8.827, "C6C8_dist": 9.875, "CNNC_torsion": 8.707, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.10],N1-N3(imino)[2.88]", "interBase_angle": 11.992, "planarity": 0.143, "simple_Shear": -0.083, "simple_Stretch": -0.025, "simple_Buckle": -11.620, "simple_Propeller": 2.963, "bp_simpleParams": [ -0.083, -0.025, -0.396, -11.620, 2.963, 4.378 ], "bp_params": [ -0.082, -0.025, -0.396, -11.635, 2.902, 4.357 ], "frame": { "rmsd": null, "origin": [ 99.493, 59.004, 58.596 ], "x_axis": [ -0.203, 0.504, -0.839 ], "y_axis": [ -0.238, -0.857, -0.457 ], "z_axis": [ -0.950, 0.107, 0.294 ], "quaternion": [ 0.242, -0.583, -0.114, 0.767 ] } }, { "index": 57, "nt1": "///F/32", "nt2": "///F/38", "bp": "U-A", "name": "--", "Saenger": "--", "LW": "tWW", "DSSR": "tW-W", "intra_chain": true, "chi1": -116.675, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 83.522, "chi2": 155.805, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 19.134, "C1C1_dist": 11.265, "N1N9_dist": 9.758, "C6C8_dist": 10.363, "CNNC_torsion": 6.423, "hbonds_num": 1, "hbonds_desc": "O2(carbonyl)-N6(amino)[2.92]", "interBase_angle": 26.481, "planarity": 0.358, "simple_Shear": 5.637, "simple_Stretch": 2.245, "simple_Buckle": -2.434, "simple_Propeller": 26.369, "bp_simpleParams": [ 5.637, 2.245, 0.369, -2.434, 26.369, -4.762 ], "bp_params": [ 5.901, -1.412, 0.369, 13.236, 22.936, -4.828 ], "frame": { "rmsd": null, "origin": [ 96.982, 59.657, 59.561 ], "x_axis": [ -0.213, -0.440, -0.872 ], "y_axis": [ -0.020, -0.890, 0.455 ], "z_axis": [ -0.977, 0.115, 0.181 ], "quaternion": [ -0.139, -0.612, 0.188, 0.756 ] } }, { "index": 58, "nt1": "///F/49", "nt2": "///F/65", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -171.002, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 50.610, "chi2": -172.154, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 58.191, "C1C1_dist": 10.525, "N1N9_dist": 8.828, "C6C8_dist": 9.687, "CNNC_torsion": -18.155, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.90],N3-N1(imino)[2.89],N4(amino)-O6(carbonyl)[2.99]", "interBase_angle": 41.609, "planarity": 0.478, "simple_Shear": -0.259, "simple_Stretch": 0.030, "simple_Buckle": 30.030, "simple_Propeller": -28.801, "bp_simpleParams": [ -0.259, 0.030, -0.095, 30.030, -28.801, -1.391 ], "bp_params": [ -0.261, 0.013, -0.095, 31.858, -26.765, -1.378 ], "frame": { "rmsd": null, "origin": [ 128.317, 72.352, 25.090 ], "x_axis": [ 0.806, 0.265, 0.529 ], "y_axis": [ -0.432, -0.348, 0.832 ], "z_axis": [ 0.404, -0.899, -0.167 ], "quaternion": [ 0.568, 0.762, -0.055, 0.306 ] } }, { "index": 59, "nt1": "///F/50", "nt2": "///F/64", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -166.802, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 51.986, "chi2": 169.836, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 46.334, "C1C1_dist": 11.586, "N1N9_dist": 9.668, "C6C8_dist": 10.297, "CNNC_torsion": 9.174, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[3.77],O4(carbonyl)-N6(amino)[3.29]", "interBase_angle": 14.398, "planarity": 0.302, "simple_Shear": 0.594, "simple_Stretch": 0.475, "simple_Buckle": -14.327, "simple_Propeller": -1.427, "bp_simpleParams": [ 0.594, 0.475, -0.780, -14.327, -1.427, -13.565 ], "bp_params": [ 0.620, 0.440, -0.780, -14.385, -0.592, -13.460 ], "frame": { "rmsd": null, "origin": [ 131.855, 69.589, 22.723 ], "x_axis": [ 0.169, 0.113, 0.979 ], "y_axis": [ -0.788, -0.582, 0.204 ], "z_axis": [ 0.592, -0.806, -0.009 ], "quaternion": [ 0.380, 0.663, -0.254, 0.592 ] } }, { "index": 60, "nt1": "///F/51", "nt2": "///F/63", "bp": "U-G", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -163.114, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 70.516, "chi2": -159.250, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 54.601, "C1C1_dist": 10.459, "N1N9_dist": 9.123, "C6C8_dist": 10.374, "CNNC_torsion": 2.214, "hbonds_num": 1, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.79]", "interBase_angle": 13.556, "planarity": 0.157, "simple_Shear": 1.219, "simple_Stretch": 0.579, "simple_Buckle": -13.503, "simple_Propeller": 1.201, "bp_simpleParams": [ 1.219, 0.579, 0.273, -13.503, 1.201, 14.795 ], "bp_params": [ 1.278, 0.434, 0.273, -13.274, 2.752, 14.701 ], "frame": { "rmsd": null, "origin": [ 134.625, 67.787, 24.227 ], "x_axis": [ -0.322, 0.020, 0.946 ], "y_axis": [ -0.788, -0.560, -0.256 ], "z_axis": [ 0.525, -0.828, 0.196 ], "quaternion": [ 0.280, 0.510, -0.376, 0.721 ] } }, { "index": 61, "nt1": "///F/52", "nt2": "///F/62", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -162.078, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 61.725, "chi2": -164.396, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 56.997, "C1C1_dist": 10.937, "N1N9_dist": 9.443, "C6C8_dist": 10.577, "CNNC_torsion": -5.010, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.91],N1-N3(imino)[3.50]", "interBase_angle": 9.047, "planarity": 0.128, "simple_Shear": 0.336, "simple_Stretch": 0.666, "simple_Buckle": -6.204, "simple_Propeller": -6.586, "bp_simpleParams": [ 0.336, 0.666, 0.203, -6.204, -6.586, 8.221 ], "bp_params": [ 0.363, 0.651, 0.203, -6.469, -6.325, 8.221 ], "frame": { "rmsd": null, "origin": [ 137.145, 66.266, 25.835 ], "x_axis": [ -0.672, -0.258, 0.695 ], "y_axis": [ -0.480, -0.562, -0.673 ], "z_axis": [ 0.564, -0.786, 0.254 ], "quaternion": [ 0.071, 0.399, -0.463, 0.789 ] } }, { "index": 62, "nt1": "///F/53", "nt2": "///F/61", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -173.177, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 46.068, "chi2": 176.453, "conf2": "--", "pucker2": "~C3'-endo", "lambda2": 45.962, "C1C1_dist": 11.431, "N1N9_dist": 9.396, "C6C8_dist": 9.985, "CNNC_torsion": 7.666, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.67],N1(imino)-N3[3.21],N2(amino)-O2(carbonyl)[3.63]", "interBase_angle": 4.505, "planarity": 0.077, "simple_Shear": -0.129, "simple_Stretch": 0.035, "simple_Buckle": 0.580, "simple_Propeller": 4.468, "bp_simpleParams": [ -0.129, 0.035, -0.222, 0.580, 4.468, -14.731 ], "bp_params": [ -0.130, 0.034, -0.222, 0.537, 4.473, -14.742 ], "frame": { "rmsd": null, "origin": [ 139.545, 65.443, 28.592 ], "x_axis": [ -0.899, -0.384, 0.212 ], "y_axis": [ -0.012, -0.462, -0.887 ], "z_axis": [ 0.438, -0.799, 0.411 ], "quaternion": [ -0.112, 0.195, -0.506, 0.832 ] } }, { "index": 63, "nt1": "///F/54", "nt2": "///F/58", "bp": "U-A", "name": "--", "Saenger": "--", "LW": "tWH", "DSSR": "tW-M", "intra_chain": true, "chi1": -151.379, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 18.765, "chi2": -145.831, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 15.222, "C1C1_dist": 11.644, "N1N9_dist": 8.863, "C6C8_dist": 7.394, "CNNC_torsion": -102.615, "hbonds_num": 3, "hbonds_desc": "N3(imino)*N6(amino)[3.36],O4(carbonyl)*N7[3.12],O4(carbonyl)-N6(amino)[3.52]", "unusual_base2base_hbonds": 1, "interBase_angle": 25.894, "planarity": 0.388, "simple_Shear": 1.635, "simple_Stretch": 2.221, "simple_Buckle": 21.228, "simple_Propeller": 14.828, "bp_simpleParams": [ 1.635, 2.221, -0.449, 21.228, 14.828, -114.088 ], "bp_params": [ 2.274, 1.561, -0.449, 24.942, 6.957, -112.929 ], "frame": { "rmsd": null, "origin": [ 140.555, 64.249, 32.790 ], "x_axis": [ -0.119, -0.508, -0.853 ], "y_axis": [ 0.929, 0.247, -0.276 ], "z_axis": [ 0.352, -0.825, 0.442 ], "quaternion": [ 0.627, 0.219, 0.481, -0.573 ] } } ], "num_multiplets": 7, "multiplets": [ { "index": 1, "num_nts": 3, "nts_short": "UAC", "nts_long": "///E/8,///E/14,///E/48", "planarity": 0.423 }, { "index": 2, "num_nts": 3, "nts_short": "GGC", "nts_long": "///E/9,///E/12,///E/23", "planarity": 0.440 }, { "index": 3, "num_nts": 3, "nts_short": "CGG", "nts_long": "///E/13,///E/22,///E/46", "planarity": 0.361 }, { "index": 4, "num_nts": 3, "nts_short": "UAA", "nts_long": "///F/8,///F/14,///F/21", "planarity": 0.408 }, { "index": 5, "num_nts": 3, "nts_short": "GGC", "nts_long": "///F/9,///F/12,///F/23", "planarity": 0.521 }, { "index": 6, "num_nts": 3, "nts_short": "GCG", "nts_long": "///F/10,///F/25,///F/45", "planarity": 0.432 }, { "index": 7, "num_nts": 3, "nts_short": "CGG", "nts_long": "///F/13,///F/22,///F/46", "planarity": 0.292 } ], "num_helices": 5, "helices": [ { "index": 1, "num_stems": 0, "strand1": "CU", "strand2": "GA", "bp_type": "|.", "helix_form": ".", "helical_rise": 3.414, "helical_rise_std": 0.078, "helical_radius": 8.279, "helical_radius_std": 3.365, "helical_axis": [ -0.553, 0.832, -0.048 ], "point1": [ 37.134, -2.156, 11.766 ], "point2": [ 35.246, 0.685, 11.602 ], "num_pairs": 2, "pairs": [ { "index": 1, "nt1": "///E/2", "nt2": "///E/71", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.213, -0.151, 0.581, 9.001, -3.612, -1.489 ], "step_params": [ 0.714, -2.158, 3.774, -26.361, 3.407, 46.736 ], "heli_params": [ -2.639, -2.624, 2.869, 3.945, 30.521, 53.395 ], "bp2_params": [ -0.224, -1.602, 2.329, 10.626, -1.626, 8.497 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.774, "simple_Twist": 49.201, "simple_hRise": 2.931, "simple_hTwist": 55.526 }, { "index": 2, "nt1": "///E/3", "nt2": "///E/70", "bp": "U-A", "name": "--", "Saenger": "--", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 2, "num_stems": 2, "strand1": "GUACUUAGU", "strand2": "CGUGAGUCA", "bp_type": "|.|||.||.", "helix_form": "..x.AAAx", "helical_rise": 2.785, "helical_rise_std": 0.506, "helical_radius": 8.722, "helical_radius_std": 2.032, "helical_axis": [ -0.384, 0.893, -0.235 ], "point1": [ 38.603, 7.046, 10.603 ], "point2": [ 30.061, 26.885, 5.392 ], "num_pairs": 9, "pairs": [ { "index": 1, "nt1": "///E/5", "nt2": "///E/68", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -1.502, -0.497, -0.360, 6.041, -24.747, -1.362 ], "step_params": [ 0.710, -0.871, 3.212, -1.623, -0.532, 37.310 ], "heli_params": [ -1.292, -1.318, 3.191, -0.831, 2.535, 37.348 ], "bp2_params": [ 0.411, -0.141, -0.411, 13.231, -26.489, 9.251 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.212, "simple_Twist": 27.323, "simple_hRise": 3.181, "simple_hTwist": 27.375 }, { "index": 2, "nt1": "///E/6", "nt2": "///E/67", "bp": "U-G", "name": "--", "Saenger": "--", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.411, -0.141, -0.411, 13.231, -26.489, 9.251 ], "step_params": [ 0.775, -1.583, 3.860, -5.271, 12.674, 30.584 ], "heli_params": [ -4.993, -2.279, 2.833, 22.650, 9.420, 33.456 ], "bp2_params": [ -0.204, -0.143, 0.665, -14.892, -20.043, -2.902 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.860, "simple_Twist": 31.937, "simple_hRise": 2.884, "simple_hTwist": 34.691 }, { "index": 3, "nt1": "///E/7", "nt2": "///E/66", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.204, -0.143, 0.665, -14.892, -20.043, -2.902 ], "step_params": [ -1.785, -1.896, 2.707, 7.904, 10.020, 39.742 ], "heli_params": [ -3.418, 3.103, 1.825, 14.298, -11.279, 41.662 ], "bp2_params": [ 0.193, -0.022, -0.226, 1.265, -11.637, 1.067 ], "groove_widths": [ 16.566, null, 14.421, null ], "simple_Rise": 2.707, "simple_Twist": 38.726, "simple_hRise": 1.799, "simple_hTwist": 40.698 }, { "index": 4, "nt1": "///E/49", "nt2": "///E/65", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.193, -0.022, -0.226, 1.265, -11.637, 1.067 ], "step_params": [ 0.538, -1.590, 3.381, 0.085, 19.445, 39.901 ], "heli_params": [ -3.811, -0.707, 2.396, 26.664, -0.117, 44.213 ], "bp2_params": [ -0.162, -0.026, 0.110, -14.402, -16.320, 4.260 ], "groove_widths": [ 16.715, 15.209, 15.320, 13.760 ], "simple_Rise": 3.381, "simple_Twist": 41.087, "simple_hRise": 2.430, "simple_hTwist": 45.276 }, { "index": 5, "nt1": "///E/50", "nt2": "///E/64", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.162, -0.026, 0.110, -14.402, -16.320, 4.260 ], "step_params": [ -0.502, -1.435, 3.308, 0.171, -3.261, 26.419 ], "heli_params": [ -2.230, 1.137, 3.453, -7.100, -0.372, 26.617 ], "bp2_params": [ 0.262, -0.080, -0.034, -3.375, -11.731, 2.485 ], "groove_widths": [ 16.992, 15.739, 15.168, 10.410 ], "simple_Rise": 3.308, "simple_Twist": 24.944, "simple_hRise": 3.460, "simple_hTwist": 25.153 }, { "index": 6, "nt1": "///E/51", "nt2": "///E/63", "bp": "U-G", "name": "--", "Saenger": "--", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.262, -0.080, -0.034, -3.375, -11.731, 2.485 ], "step_params": [ -0.298, -1.197, 3.006, -1.417, 10.176, 32.031 ], "heli_params": [ -3.515, 0.315, 2.529, 17.876, 2.489, 33.597 ], "bp2_params": [ -0.113, 0.019, 0.014, 3.786, 1.105, -0.912 ], "groove_widths": [ 16.978, null, 15.768, null ], "simple_Rise": 3.006, "simple_Twist": 33.923, "simple_hRise": 2.562, "simple_hTwist": 35.401 }, { "index": 7, "nt1": "///E/52", "nt2": "///E/62", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.113, 0.019, 0.014, 3.786, 1.105, -0.912 ], "step_params": [ 0.985, -1.729, 3.356, 1.362, 4.408, 32.151 ], "heli_params": [ -3.863, -1.523, 3.135, 7.908, -2.444, 32.471 ], "bp2_params": [ -0.020, 0.029, -0.041, -1.019, -12.004, 0.020 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.356, "simple_Twist": 31.779, "simple_hRise": 3.132, "simple_hTwist": 32.103 }, { "index": 8, "nt1": "///E/53", "nt2": "///E/61", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.020, 0.029, -0.041, -1.019, -12.004, 0.020 ], "step_params": [ -2.566, -2.843, 3.281, -13.683, 3.066, 86.206 ], "heli_params": [ -2.133, 1.550, 3.497, 2.231, 9.956, 87.118 ], "bp2_params": [ 4.123, -1.503, -0.584, -1.611, -36.439, -92.104 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.281, "simple_Twist": 62.450, "simple_hRise": 3.588, "simple_hTwist": 63.850 }, { "index": 9, "nt1": "///E/54", "nt2": "///E/58", "bp": "U-A", "name": "rHoogsteen", "Saenger": "24-XXIV", "LW": "tWH", "DSSR": "tW-M" } ] }, { "index": 3, "num_stems": 2, "strand1": "AUCUGUUGCGCAGU", "strand2": "UAGACGACGCGUCU", "bp_type": ".|||||.||||...", "helix_form": ".AA...xAA.xxx", "helical_rise": 2.957, "helical_rise_std": 0.722, "helical_radius": 9.465, "helical_radius_std": 2.340, "helical_axis": [ -0.739, -0.262, -0.621 ], "point1": [ 60.177, 32.785, 43.000 ], "point2": [ 31.752, 22.708, 19.135 ], "num_pairs": 14, "pairs": [ { "index": 1, "nt1": "///E/38", "nt2": "///E/32", "bp": "A-U", "name": "--", "Saenger": "--", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -5.173, -0.992, 0.455, -11.271, 12.636, -3.994 ], "step_params": [ 0.587, -0.830, 2.717, -4.022, 6.734, 48.886 ], "heli_params": [ -1.395, -0.942, 2.536, 8.077, 4.824, 49.473 ], "bp2_params": [ -0.140, -0.087, 0.183, 14.805, -0.172, 9.476 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.717, "simple_Twist": 21.240, "simple_hRise": 2.205, "simple_hTwist": 22.627 }, { "index": 2, "nt1": "///E/39", "nt2": "///E/31", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.140, -0.087, 0.183, 14.805, -0.172, 9.476 ], "step_params": [ -0.303, -1.905, 3.334, 3.979, 1.249, 27.678 ], "heli_params": [ -4.235, 1.570, 3.173, 2.593, -8.258, 27.985 ], "bp2_params": [ 0.452, -0.070, -0.599, 15.113, -3.313, 2.989 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.334, "simple_Twist": 24.751, "simple_hRise": 3.149, "simple_hTwist": 25.094 }, { "index": 3, "nt1": "///E/40", "nt2": "///E/30", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.452, -0.070, -0.599, 15.113, -3.313, 2.989 ], "step_params": [ 0.828, -1.667, 3.225, 4.482, 14.288, 30.855 ], "heli_params": [ -4.859, -0.772, 2.343, 25.086, -7.869, 34.217 ], "bp2_params": [ -0.025, -0.041, -0.468, 6.018, -10.809, 13.207 ], "groove_widths": [ 16.495, null, 18.446, null ], "simple_Rise": 3.225, "simple_Twist": 33.428, "simple_hRise": 2.424, "simple_hTwist": 36.541 }, { "index": 4, "nt1": "///E/41", "nt2": "///E/29", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.025, -0.041, -0.468, 6.018, -10.809, 13.207 ], "step_params": [ -0.846, -1.474, 4.110, 3.920, 14.017, 27.300 ], "heli_params": [ -5.870, 2.457, 2.883, 27.368, -7.654, 30.872 ], "bp2_params": [ -0.049, -0.089, -0.629, -18.485, -30.578, 5.459 ], "groove_widths": [ 16.183, 14.975, 16.835, 11.812 ], "simple_Rise": 4.110, "simple_Twist": 26.114, "simple_hRise": 2.818, "simple_hTwist": 29.834 }, { "index": 5, "nt1": "///E/42", "nt2": "///E/28", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.049, -0.089, -0.629, -18.485, -30.578, 5.459 ], "step_params": [ 0.767, -0.911, 2.895, -0.333, 2.083, 35.575 ], "heli_params": [ -1.754, -1.295, 2.832, 3.405, 0.544, 35.636 ], "bp2_params": [ 0.976, 0.190, -0.333, -4.455, -15.994, 15.270 ], "groove_widths": [ 17.971, 14.420, 14.760, 11.277 ], "simple_Rise": 2.895, "simple_Twist": 31.267, "simple_hRise": 2.822, "simple_hTwist": 31.336 }, { "index": 6, "nt1": "///E/43", "nt2": "///E/27", "bp": "U-G", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.976, 0.190, -0.333, -4.455, -15.994, 15.270 ], "step_params": [ -3.460, -2.006, 4.214, -5.076, 14.587, 29.624 ], "heli_params": [ -6.507, 4.985, 3.414, 26.391, 9.184, 33.328 ], "bp2_params": [ -1.639, 1.647, 0.107, -42.481, -4.346, -47.917 ], "groove_widths": [ 18.930, 14.322, 12.950, 10.905 ], "simple_Rise": 4.214, "simple_Twist": 41.904, "simple_hRise": 3.726, "simple_hTwist": 44.539 }, { "index": 7, "nt1": "///E/44", "nt2": "///E/26", "bp": "U-A", "name": "--", "Saenger": "--", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -1.639, 1.647, 0.107, -42.481, -4.346, -47.917 ], "step_params": [ -1.950, -3.324, 2.959, 14.696, 3.459, 68.723 ], "heli_params": [ -2.994, 2.129, 2.404, 3.027, -12.861, 70.163 ], "bp2_params": [ -0.214, -0.135, -0.106, -7.784, -5.770, -0.089 ], "groove_widths": [ 17.494, 14.858, 12.055, 11.252 ], "simple_Rise": 2.959, "simple_Twist": 62.755, "simple_hRise": 2.333, "simple_hTwist": 64.365 }, { "index": 8, "nt1": "///E/10", "nt2": "///E/25", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.214, -0.135, -0.106, -7.784, -5.770, -0.089 ], "step_params": [ -0.402, -1.887, 2.910, 0.052, -0.536, 36.762 ], "heli_params": [ -2.926, 0.643, 2.936, -0.849, -0.083, 36.765 ], "bp2_params": [ 0.245, 0.045, 0.035, -0.288, -0.150, -0.086 ], "groove_widths": [ 16.956, 15.303, 11.415, 11.378 ], "simple_Rise": 2.910, "simple_Twist": 34.445, "simple_hRise": 2.938, "simple_hTwist": 34.449 }, { "index": 9, "nt1": "///E/11", "nt2": "///E/24", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.245, 0.045, 0.035, -0.288, -0.150, -0.086 ], "step_params": [ -0.058, -1.648, 3.248, -0.738, 14.055, 31.835 ], "heli_params": [ -4.682, -0.004, 2.336, 24.200, 1.270, 34.734 ], "bp2_params": [ -0.333, 0.078, 0.171, -11.473, -3.584, 0.781 ], "groove_widths": [ 16.850, 15.469, 16.018, 10.435 ], "simple_Rise": 3.248, "simple_Twist": 34.761, "simple_hRise": 2.426, "simple_hTwist": 37.420 }, { "index": 10, "nt1": "///E/12", "nt2": "///E/23", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.333, 0.078, 0.171, -11.473, -3.584, 0.781 ], "step_params": [ 1.289, -2.644, 3.006, -1.687, -3.871, 34.726 ], "heli_params": [ -3.844, -2.387, 3.208, -6.456, 2.814, 34.974 ], "bp2_params": [ 0.271, -0.126, 0.396, 5.124, 1.260, -2.182 ], "groove_widths": [ 16.448, 14.697, 9.582, 8.860 ], "simple_Rise": 3.006, "simple_Twist": 31.676, "simple_hRise": 3.226, "simple_hTwist": 31.949 }, { "index": 11, "nt1": "///E/13", "nt2": "///E/22", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.271, -0.126, 0.396, 5.124, 1.260, -2.182 ], "step_params": [ -1.723, -0.995, 4.023, -0.687, 6.639, 70.883 ], "heli_params": [ -1.133, 1.452, 3.943, 5.712, 0.591, 71.156 ], "bp2_params": [ -2.959, -0.905, -1.655, -10.943, -24.638, -97.614 ], "groove_widths": [ 15.807, null, 18.563, null ], "simple_Rise": 4.023, "simple_Twist": 88.799, "simple_hRise": 3.967, "simple_hTwist": 88.998 }, { "index": 12, "nt1": "///E/14", "nt2": "///E/8", "bp": "A-U", "name": "rHoogsteen", "Saenger": "24-XXIV", "LW": "tHW", "DSSR": "tM-W", "bp1_params": [ -2.959, -0.905, -1.655, -10.943, -24.638, -97.614 ], "step_params": [ 1.345, -2.644, 2.504, 8.910, -5.139, -77.116 ], "heli_params": [ 2.213, 1.255, 2.210, 4.105, 7.118, -77.693 ], "bp2_params": [ -0.178, 3.928, 0.745, 25.497, 4.404, 178.434 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.504, "simple_Twist": 1.290, "simple_hRise": 2.779, "simple_hTwist": 10.367 }, { "index": 13, "nt1": "///E/15", "nt2": "///E/48", "bp": "G+C", "name": "rWC", "Saenger": "22-XXII", "LW": "tWW", "DSSR": "tW+W", "bp1_params": [ -0.178, 3.928, 0.745, 25.497, 4.404, 178.434 ], "step_params": [ -0.713, -3.678, 2.305, -0.050, 3.037, -0.394 ], "heli_params": [ -33.694, -15.012, 3.932, -82.601, -1.347, -3.063 ], "bp2_params": [ 1.880, 1.424, 0.082, 14.749, 33.608, 171.723 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.305, "simple_Twist": 18.450, "simple_hRise": 1.684, "simple_hTwist": 18.696 }, { "index": 14, "nt1": "///E/16", "nt2": "///E/59", "bp": "U+U", "name": "--", "Saenger": "--", "LW": "tWW", "DSSR": "tW+W" } ] }, { "index": 4, "num_stems": 2, "strand1": "UCGUACUUAGUUC", "strand2": "AGCGUGAGUCAGG", "bp_type": "||||||||||..|", "helix_form": ".A..x....xx.", "helical_rise": 2.974, "helical_rise_std": 1.018, "helical_radius": 8.940, "helical_radius_std": 2.263, "helical_axis": [ 0.478, -0.843, 0.247 ], "point1": [ 126.142, 84.766, 23.318 ], "point2": [ 143.139, 54.817, 32.095 ], "num_pairs": 13, "pairs": [ { "index": 1, "nt1": "///F/3", "nt2": "///F/70", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -1.074, 0.298, -0.213, -2.295, 14.358, 7.644 ], "step_params": [ 0.170, -1.954, 2.858, 5.069, 4.338, 34.647 ], "heli_params": [ -3.767, 0.353, 2.601, 7.201, -8.415, 35.264 ], "bp2_params": [ -0.201, 0.556, -0.676, 7.060, -9.190, -3.815 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.858, "simple_Twist": 29.885, "simple_hRise": 2.550, "simple_hTwist": 30.604 }, { "index": 2, "nt1": "///F/4", "nt2": "///F/69", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.201, 0.556, -0.676, 7.060, -9.190, -3.815 ], "step_params": [ -0.306, -1.877, 3.619, -7.495, 15.797, 33.558 ], "heli_params": [ -4.945, -0.496, 2.527, 25.336, 12.021, 37.724 ], "bp2_params": [ -0.254, -0.045, 0.003, -13.570, -7.127, -3.148 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.619, "simple_Twist": 33.448, "simple_hRise": 2.523, "simple_hTwist": 37.626 }, { "index": 3, "nt1": "///F/5", "nt2": "///F/68", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.254, -0.045, 0.003, -13.570, -7.127, -3.148 ], "step_params": [ 1.023, -0.892, 3.465, 10.151, -6.111, 48.191 ], "heli_params": [ -0.564, -0.389, 3.677, -7.355, -12.218, 49.542 ], "bp2_params": [ 3.378, -0.172, -0.018, -4.181, -24.787, 19.773 ], "groove_widths": [ 17.434, null, 15.461, null ], "simple_Rise": 3.465, "simple_Twist": 27.632, "simple_hRise": 3.712, "simple_hTwist": 30.019 }, { "index": 4, "nt1": "///F/6", "nt2": "///F/67", "bp": "U-G", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 3.378, -0.172, -0.018, -4.181, -24.787, 19.773 ], "step_params": [ -0.639, -1.101, 2.571, -3.702, 4.842, 19.999 ], "heli_params": [ -4.615, 0.554, 2.321, 13.541, 10.354, 20.899 ], "bp2_params": [ 0.087, -0.414, 1.553, 10.114, -17.758, -7.788 ], "groove_widths": [ 18.406, 16.711, 15.277, 9.686 ], "simple_Rise": 2.571, "simple_Twist": 39.044, "simple_hRise": 2.471, "simple_hTwist": 39.498 }, { "index": 5, "nt1": "///F/7", "nt2": "///F/66", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.087, -0.414, 1.553, 10.114, -17.758, -7.788 ], "step_params": [ 1.101, -1.262, 2.760, 21.225, 11.023, 29.107 ], "heli_params": [ -3.258, 0.783, 2.404, 18.494, -35.610, 37.508 ], "bp2_params": [ -0.261, 0.013, -0.095, 31.858, -26.765, -1.378 ], "groove_widths": [ 17.075, 15.380, 15.832, 12.929 ], "simple_Rise": 2.760, "simple_Twist": 33.004, "simple_hRise": 2.489, "simple_hTwist": 40.562 }, { "index": 6, "nt1": "///F/49", "nt2": "///F/65", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.261, 0.013, -0.095, 31.858, -26.765, -1.378 ], "step_params": [ -0.702, -2.492, 4.365, 4.804, 14.294, 44.724 ], "heli_params": [ -4.549, 1.359, 3.373, 18.183, -6.111, 47.074 ], "bp2_params": [ 0.620, 0.440, -0.780, -14.385, -0.592, -13.460 ], "groove_widths": [ 16.004, 14.466, 16.799, 15.669 ], "simple_Rise": 4.365, "simple_Twist": 38.315, "simple_hRise": 3.170, "simple_hTwist": 41.072 }, { "index": 7, "nt1": "///F/50", "nt2": "///F/64", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.620, 0.440, -0.780, -14.385, -0.592, -13.460 ], "step_params": [ 1.174, -1.303, 3.179, -3.620, 11.971, 26.514 ], "heli_params": [ -4.828, -3.003, 2.220, 24.446, 7.393, 29.268 ], "bp2_params": [ 1.278, 0.434, 0.273, -13.274, 2.752, 14.701 ], "groove_widths": [ 16.407, 15.218, 15.318, 11.354 ], "simple_Rise": 3.179, "simple_Twist": 22.716, "simple_hRise": 2.038, "simple_hTwist": 25.892 }, { "index": 8, "nt1": "///F/51", "nt2": "///F/63", "bp": "U-G", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 1.278, 0.434, 0.273, -13.274, 2.752, 14.701 ], "step_params": [ 0.226, -1.554, 2.963, 4.476, 1.331, 29.709 ], "heli_params": [ -3.242, 0.391, 2.894, 2.575, -8.662, 30.065 ], "bp2_params": [ 0.363, 0.651, 0.203, -6.469, -6.325, 8.221 ], "groove_widths": [ 17.164, 15.702, 15.306, 11.490 ], "simple_Rise": 2.963, "simple_Twist": 34.652, "simple_hRise": 2.909, "simple_hTwist": 34.955 }, { "index": 9, "nt1": "///F/52", "nt2": "///F/62", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.363, 0.651, 0.203, -6.469, -6.325, 8.221 ], "step_params": [ -0.414, -2.472, 2.786, 5.056, 10.405, 30.137 ], "heli_params": [ -5.787, 1.395, 1.766, 19.146, -9.305, 32.233 ], "bp2_params": [ -0.130, 0.034, -0.222, 0.537, 4.473, -14.742 ], "groove_widths": [ 17.442, 15.118, 13.672, 6.871 ], "simple_Rise": 2.786, "simple_Twist": 32.797, "simple_hRise": 1.857, "simple_hTwist": 34.725 }, { "index": 10, "nt1": "///F/53", "nt2": "///F/61", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.130, 0.034, -0.222, 0.537, 4.473, -14.742 ], "step_params": [ -1.876, -2.558, 3.163, 4.243, 3.488, 83.064 ], "heli_params": [ -2.006, 1.510, 2.992, 2.628, -3.197, 83.213 ], "bp2_params": [ 2.274, 1.561, -0.449, 24.942, 6.957, -112.929 ], "groove_widths": [ 18.249, null, 24.390, null ], "simple_Rise": 3.163, "simple_Twist": 70.691, "simple_hRise": 2.949, "simple_hTwist": 70.876 }, { "index": 11, "nt1": "///F/54", "nt2": "///F/58", "bp": "U-A", "name": "--", "Saenger": "--", "LW": "tWH", "DSSR": "tW-M", "bp1_params": [ 2.274, 1.561, -0.449, 24.942, 6.957, -112.929 ], "step_params": [ 1.142, -1.776, 2.788, 4.283, 5.974, 58.344 ], "heli_params": [ -2.070, -0.978, 2.681, 6.102, -4.374, 58.764 ], "bp2_params": [ 0.823, -5.264, -0.336, 42.970, -22.999, -114.066 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.788, "simple_Twist": -30.510, "simple_hRise": 2.892, "simple_hTwist": -31.362 }, { "index": 12, "nt1": "///F/55", "nt2": "///F/18", "bp": "U+G", "name": "--", "Saenger": "--", "LW": "t.W", "DSSR": "t.+W", "bp1_params": [ 0.823, -5.264, -0.336, 42.970, -22.999, -114.066 ], "step_params": [ -4.156, 0.190, 8.397, 2.465, -3.927, -88.489 ], "heli_params": [ 0.077, -2.842, 8.488, 2.812, 1.765, -88.586 ], "bp2_params": [ -0.919, 1.114, -0.437, 37.207, -33.406, 31.359 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 8.397, "simple_Twist": 4.104, "simple_hRise": 3.793, "simple_hTwist": 6.191 }, { "index": 13, "nt1": "///F/56", "nt2": "///F/19", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 5, "num_stems": 2, "strand1": "AUCUGUUGCGCAGU", "strand2": "UAGACGACGCGACU", "bp_type": ".||||..||||...", "helix_form": ".A....x.A..xx", "helical_rise": 3.074, "helical_rise_std": 0.607, "helical_radius": 9.642, "helical_radius_std": 2.471, "helical_axis": [ 0.910, 0.250, -0.332 ], "point1": [ 94.121, 59.222, 53.117 ], "point2": [ 130.562, 69.254, 39.822 ], "num_pairs": 14, "pairs": [ { "index": 1, "nt1": "///F/38", "nt2": "///F/32", "bp": "A-U", "name": "--", "Saenger": "--", "LW": "tWW", "DSSR": "tW-W", "bp1_params": [ -5.901, -1.412, 0.369, -13.236, 22.936, -4.828 ], "step_params": [ 0.323, -0.364, 2.725, -0.178, 6.681, 56.052 ], "heli_params": [ -0.697, -0.350, 2.669, 7.081, 0.189, 56.417 ], "bp2_params": [ 0.082, -0.025, -0.396, 11.635, 2.902, 4.357 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.725, "simple_Twist": 22.915, "simple_hRise": 2.516, "simple_hTwist": 23.857 }, { "index": 2, "nt1": "///F/39", "nt2": "///F/31", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.082, -0.025, -0.396, 11.635, 2.902, 4.357 ], "step_params": [ -0.030, -2.146, 3.306, 0.979, 6.205, 26.343 ], "heli_params": [ -6.057, 0.297, 2.734, 13.375, -2.111, 27.069 ], "bp2_params": [ 0.401, 0.054, -0.670, 10.363, -2.454, 5.541 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.306, "simple_Twist": 24.769, "simple_hRise": 2.693, "simple_hTwist": 25.541 }, { "index": 3, "nt1": "///F/40", "nt2": "///F/30", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.401, 0.054, -0.670, 10.363, -2.454, 5.541 ], "step_params": [ 0.514, -2.281, 3.719, -10.590, 11.379, 29.991 ], "heli_params": [ -5.777, -2.603, 2.410, 20.360, 18.947, 33.697 ], "bp2_params": [ 0.106, -0.002, 0.688, -11.602, 8.283, 12.509 ], "groove_widths": [ 16.555, null, 19.010, null ], "simple_Rise": 3.719, "simple_Twist": 31.702, "simple_hRise": 2.489, "simple_hTwist": 35.220 }, { "index": 4, "nt1": "///F/41", "nt2": "///F/29", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.106, -0.002, 0.688, -11.602, 8.283, 12.509 ], "step_params": [ -0.495, -2.235, 3.400, 13.992, 4.774, 28.507 ], "heli_params": [ -4.873, 3.311, 2.496, 8.973, -26.297, 32.042 ], "bp2_params": [ -0.228, 0.030, -0.863, -20.269, -17.195, 6.340 ], "groove_widths": [ 16.056, 14.880, 17.609, 14.358 ], "simple_Rise": 3.400, "simple_Twist": 29.484, "simple_hRise": 2.532, "simple_hTwist": 32.909 }, { "index": 5, "nt1": "///F/42", "nt2": "///F/28", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.228, 0.030, -0.863, -20.269, -17.195, 6.340 ], "step_params": [ 0.160, -1.663, 3.159, -6.464, -0.549, 33.991 ], "heli_params": [ -2.716, -1.233, 3.102, -0.929, 10.933, 34.586 ], "bp2_params": [ 0.749, 0.061, 0.161, -10.405, -3.536, 3.761 ], "groove_widths": [ 17.618, 14.143, 16.714, 14.680 ], "simple_Rise": 3.159, "simple_Twist": 29.758, "simple_hRise": 3.085, "simple_hTwist": 30.442 }, { "index": 6, "nt1": "///F/43", "nt2": "///F/27", "bp": "U-G", "name": "--", "Saenger": "--", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.749, 0.061, 0.161, -10.405, -3.536, 3.761 ], "step_params": [ -3.361, -2.198, 3.725, -3.591, 2.330, 29.936 ], "heli_params": [ -4.768, 5.590, 3.914, 4.481, 6.907, 30.233 ], "bp2_params": [ -1.404, 1.686, 1.081, -37.461, 18.279, -50.415 ], "groove_widths": [ 18.102, 13.729, 15.206, 14.250 ], "simple_Rise": 3.725, "simple_Twist": 41.198, "simple_hRise": 3.868, "simple_hTwist": 41.410 }, { "index": 7, "nt1": "///F/44", "nt2": "///F/26", "bp": "U-A", "name": "--", "Saenger": "--", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -1.404, 1.686, 1.081, -37.461, 18.279, -50.415 ], "step_params": [ -1.376, -3.525, 3.366, 29.309, -3.749, 68.136 ], "heli_params": [ -2.824, 2.084, 2.826, -3.199, -25.007, 73.551 ], "bp2_params": [ -0.323, -0.233, -1.209, -8.530, -12.765, 8.594 ], "groove_widths": [ 16.568, 14.177, 14.323, 13.906 ], "simple_Rise": 3.366, "simple_Twist": 62.047, "simple_hRise": 2.741, "simple_hTwist": 68.085 }, { "index": 8, "nt1": "///F/10", "nt2": "///F/25", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.323, -0.233, -1.209, -8.530, -12.765, 8.594 ], "step_params": [ -1.170, -1.421, 3.397, -11.383, 11.539, 35.987 ], "heli_params": [ -3.523, 0.343, 3.041, 17.618, 17.380, 39.359 ], "bp2_params": [ 0.290, 0.005, 0.175, -18.543, -4.873, 0.286 ], "groove_widths": [ 16.781, 15.150, 12.417, 12.386 ], "simple_Rise": 3.397, "simple_Twist": 32.756, "simple_hRise": 2.981, "simple_hTwist": 36.448 }, { "index": 9, "nt1": "///F/11", "nt2": "///F/24", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.290, 0.005, 0.175, -18.543, -4.873, 0.286 ], "step_params": [ 0.520, -1.553, 2.762, 2.297, 9.617, 29.936 ], "heli_params": [ -4.260, -0.624, 2.202, 18.009, -4.301, 31.491 ], "bp2_params": [ -0.145, 0.002, 0.358, -7.500, -10.148, 2.698 ], "groove_widths": [ 17.214, 15.961, 16.718, 14.538 ], "simple_Rise": 2.762, "simple_Twist": 32.338, "simple_hRise": 2.251, "simple_hTwist": 33.777 }, { "index": 10, "nt1": "///F/12", "nt2": "///F/23", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.145, 0.002, 0.358, -7.500, -10.148, 2.698 ], "step_params": [ 0.776, -1.974, 2.936, 3.176, -2.154, 32.600 ], "heli_params": [ -3.150, -0.868, 3.116, -3.821, -5.633, 32.819 ], "bp2_params": [ 0.031, -0.247, 0.599, 4.777, -17.850, -6.048 ], "groove_widths": [ 16.716, 15.489, 20.995, 16.721 ], "simple_Rise": 2.936, "simple_Twist": 31.947, "simple_hRise": 3.120, "simple_hTwist": 32.170 }, { "index": 11, "nt1": "///F/13", "nt2": "///F/22", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.031, -0.247, 0.599, 4.777, -17.850, -6.048 ], "step_params": [ 1.342, -3.296, 3.615, 11.231, 13.505, -10.696 ], "heli_params": [ 0.874, 10.722, 3.318, -45.284, 37.660, -20.543 ], "bp2_params": [ -6.776, -1.973, -1.315, -10.330, -33.577, 11.329 ], "groove_widths": [ 15.687, null, 18.431, null ], "simple_Rise": 3.615, "simple_Twist": 28.646, "simple_hRise": 2.242, "simple_hTwist": 33.506 }, { "index": 12, "nt1": "///F/14", "nt2": "///F/21", "bp": "A-A", "name": "--", "Saenger": "--", "LW": "tWS", "DSSR": "tW-m", "bp1_params": [ -6.776, -1.973, -1.315, -10.330, -33.577, 11.329 ], "step_params": [ 0.521, -0.335, 4.123, -8.222, -0.477, 8.555 ], "heli_params": [ -0.859, -15.630, 2.627, -2.549, 43.913, 11.870 ], "bp2_params": [ -0.437, 5.427, -0.758, 0.938, -28.338, 147.128 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 4.123, "simple_Twist": 55.274, "simple_hRise": 4.017, "simple_hTwist": 55.836 }, { "index": 13, "nt1": "///F/15", "nt2": "///F/48", "bp": "G+C", "name": "rWC", "Saenger": "22-XXII", "LW": "tWW", "DSSR": "tW+W", "bp1_params": [ -0.437, 5.427, -0.758, 0.938, -28.338, 147.128 ], "step_params": [ -0.922, -2.841, 2.172, -11.092, -12.109, -0.638 ], "heli_params": [ 8.801, -2.182, -2.631, 64.736, -59.299, -16.434 ], "bp2_params": [ 1.870, 2.194, 0.735, 0.416, 15.501, 159.721 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.172, "simple_Twist": 20.726, "simple_hRise": 3.384, "simple_hTwist": 26.387 }, { "index": 14, "nt1": "///F/16", "nt2": "///F/59", "bp": "U+U", "name": "--", "Saenger": "--", "LW": "tWW", "DSSR": "tW+W" } ] } ], "num_stems": 8, "stems": [ { "index": 1, "helix_index": 3, "strand1": "GCGC", "strand2": "CGCG", "bp_type": "||||", "helix_form": "AA.", "helical_rise": 2.880, "helical_rise_std": 0.144, "helical_radius": 9.132, "helical_radius_std": 1.388, "helical_axis": [ -0.718, -0.474, -0.510 ], "point1": [ 47.822, 27.228, 28.525 ], "point2": [ 41.607, 23.126, 24.110 ], "num_pairs": 4, "pairs": [ { "index": 1, "nt1": "///E/10", "nt2": "///E/25", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.214, -0.135, -0.106, -7.784, -5.770, -0.089 ], "step_params": [ -0.402, -1.887, 2.910, 0.052, -0.536, 36.762 ], "heli_params": [ -2.926, 0.643, 2.936, -0.849, -0.083, 36.765 ], "bp2_params": [ 0.245, 0.045, 0.035, -0.288, -0.150, -0.086 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.910, "simple_Twist": 34.445, "simple_hRise": 2.938, "simple_hTwist": 34.449 }, { "index": 2, "nt1": "///E/11", "nt2": "///E/24", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.245, 0.045, 0.035, -0.288, -0.150, -0.086 ], "step_params": [ -0.058, -1.648, 3.248, -0.738, 14.055, 31.835 ], "heli_params": [ -4.682, -0.004, 2.336, 24.200, 1.270, 34.734 ], "bp2_params": [ -0.333, 0.078, 0.171, -11.473, -3.584, 0.781 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.248, "simple_Twist": 34.761, "simple_hRise": 2.426, "simple_hTwist": 37.420 }, { "index": 3, "nt1": "///E/12", "nt2": "///E/23", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.333, 0.078, 0.171, -11.473, -3.584, 0.781 ], "step_params": [ 1.289, -2.644, 3.006, -1.687, -3.871, 34.726 ], "heli_params": [ -3.844, -2.387, 3.208, -6.456, 2.814, 34.974 ], "bp2_params": [ 0.271, -0.126, 0.396, 5.124, 1.260, -2.182 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.006, "simple_Twist": 31.676, "simple_hRise": 3.226, "simple_hTwist": 31.949 }, { "index": 4, "nt1": "///E/13", "nt2": "///E/22", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 2, "helix_index": 3, "strand1": "GCAGA", "strand2": "UGUCU", "bp_type": "|||||", "helix_form": "..AA", "helical_rise": 2.282, "helical_rise_std": 0.103, "helical_radius": 9.599, "helical_radius_std": 0.623, "helical_axis": [ 0.808, 0.139, 0.573 ], "point1": [ 48.641, 30.260, 37.400 ], "point2": [ 55.800, 31.488, 42.475 ], "num_pairs": 5, "pairs": [ { "index": 1, "nt1": "///E/27", "nt2": "///E/43", "bp": "G-U", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.976, 0.190, -0.333, 4.455, -15.994, 15.270 ], "step_params": [ -0.767, -0.911, 2.895, 0.333, 2.083, 35.575 ], "heli_params": [ -1.754, 1.295, 2.832, 3.405, -0.544, 35.636 ], "bp2_params": [ 0.049, -0.089, -0.629, 18.485, -30.578, 5.459 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.895, "simple_Twist": 31.267, "simple_hRise": 2.822, "simple_hTwist": 31.336 }, { "index": 2, "nt1": "///E/28", "nt2": "///E/42", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.049, -0.089, -0.629, 18.485, -30.578, 5.459 ], "step_params": [ 0.846, -1.474, 4.110, -3.920, 14.017, 27.300 ], "heli_params": [ -5.870, -2.457, 2.883, 27.368, 7.654, 30.872 ], "bp2_params": [ 0.025, -0.041, -0.468, -6.018, -10.809, 13.207 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 4.110, "simple_Twist": 26.114, "simple_hRise": 2.818, "simple_hTwist": 29.834 }, { "index": 3, "nt1": "///E/29", "nt2": "///E/41", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.025, -0.041, -0.468, -6.018, -10.809, 13.207 ], "step_params": [ -0.828, -1.667, 3.225, -4.482, 14.288, 30.855 ], "heli_params": [ -4.859, 0.772, 2.343, 25.086, 7.869, 34.217 ], "bp2_params": [ -0.452, -0.070, -0.599, -15.113, -3.313, 2.989 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.225, "simple_Twist": 33.428, "simple_hRise": 2.424, "simple_hTwist": 36.541 }, { "index": 4, "nt1": "///E/30", "nt2": "///E/40", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.452, -0.070, -0.599, -15.113, -3.313, 2.989 ], "step_params": [ 0.303, -1.905, 3.334, -3.979, 1.249, 27.678 ], "heli_params": [ -4.235, -1.570, 3.173, 2.593, 8.258, 27.985 ], "bp2_params": [ 0.140, -0.087, 0.183, -14.805, -0.172, 9.476 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.334, "simple_Twist": 24.751, "simple_hRise": 3.149, "simple_hTwist": 25.094 }, { "index": 5, "nt1": "///E/31", "nt2": "///E/39", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 3, "helix_index": 2, "strand1": "CU", "strand2": "GA", "bp_type": "||", "helix_form": ".", "helical_rise": 2.295, "helical_rise_std": 0.043, "helical_radius": 8.250, "helical_radius_std": 1.357, "helical_axis": [ -0.292, 0.944, -0.152 ], "point1": [ 37.121, 14.829, 9.770 ], "point2": [ 36.450, 16.997, 9.419 ], "num_pairs": 2, "pairs": [ { "index": 1, "nt1": "///E/49", "nt2": "///E/65", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.193, -0.022, -0.226, 1.265, -11.637, 1.067 ], "step_params": [ 0.538, -1.590, 3.381, 0.085, 19.445, 39.901 ], "heli_params": [ -3.811, -0.707, 2.396, 26.664, -0.117, 44.213 ], "bp2_params": [ -0.162, -0.026, 0.110, -14.402, -16.320, 4.260 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.381, "simple_Twist": 41.087, "simple_hRise": 2.430, "simple_hTwist": 45.276 }, { "index": 2, "nt1": "///E/50", "nt2": "///E/64", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 4, "helix_index": 2, "strand1": "AG", "strand2": "UC", "bp_type": "||", "helix_form": "A", "helical_rise": 2.878, "helical_rise_std": 0.060, "helical_radius": 9.588, "helical_radius_std": 1.669, "helical_axis": [ -0.457, 0.857, -0.238 ], "point1": [ 34.435, 22.999, 6.060 ], "point2": [ 33.121, 25.463, 5.375 ], "num_pairs": 2, "pairs": [ { "index": 1, "nt1": "///E/52", "nt2": "///E/62", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.113, 0.019, 0.014, 3.786, 1.105, -0.912 ], "step_params": [ 0.985, -1.729, 3.356, 1.362, 4.408, 32.151 ], "heli_params": [ -3.863, -1.523, 3.135, 7.908, -2.444, 32.471 ], "bp2_params": [ -0.020, 0.029, -0.041, -1.019, -12.004, 0.020 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.356, "simple_Twist": 31.779, "simple_hRise": 3.132, "simple_hTwist": 32.103 }, { "index": 2, "nt1": "///E/53", "nt2": "///E/61", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 5, "helix_index": 4, "strand1": "UCGUA", "strand2": "AGCGU", "bp_type": "|||||", "helix_form": ".A..", "helical_rise": 2.530, "helical_rise_std": 0.294, "helical_radius": 9.258, "helical_radius_std": 0.504, "helical_axis": [ 0.357, -0.868, 0.346 ], "point1": [ 126.414, 84.833, 22.306 ], "point2": [ 129.969, 76.196, 25.745 ], "num_pairs": 5, "pairs": [ { "index": 1, "nt1": "///F/3", "nt2": "///F/70", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -1.074, 0.298, -0.213, -2.295, 14.358, 7.644 ], "step_params": [ 0.170, -1.954, 2.858, 5.069, 4.338, 34.647 ], "heli_params": [ -3.767, 0.353, 2.601, 7.201, -8.415, 35.264 ], "bp2_params": [ -0.201, 0.556, -0.676, 7.060, -9.190, -3.815 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.858, "simple_Twist": 29.885, "simple_hRise": 2.550, "simple_hTwist": 30.604 }, { "index": 2, "nt1": "///F/4", "nt2": "///F/69", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.201, 0.556, -0.676, 7.060, -9.190, -3.815 ], "step_params": [ -0.306, -1.877, 3.619, -7.495, 15.797, 33.558 ], "heli_params": [ -4.945, -0.496, 2.527, 25.336, 12.021, 37.724 ], "bp2_params": [ -0.254, -0.045, 0.003, -13.570, -7.127, -3.148 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.619, "simple_Twist": 33.448, "simple_hRise": 2.523, "simple_hTwist": 37.626 }, { "index": 3, "nt1": "///F/5", "nt2": "///F/68", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.254, -0.045, 0.003, -13.570, -7.127, -3.148 ], "step_params": [ 1.023, -0.892, 3.465, 10.151, -6.111, 48.191 ], "heli_params": [ -0.564, -0.389, 3.677, -7.355, -12.218, 49.542 ], "bp2_params": [ 3.378, -0.172, -0.018, -4.181, -24.787, 19.773 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.465, "simple_Twist": 27.632, "simple_hRise": 3.712, "simple_hTwist": 30.019 }, { "index": 4, "nt1": "///F/6", "nt2": "///F/67", "bp": "U-G", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 3.378, -0.172, -0.018, -4.181, -24.787, 19.773 ], "step_params": [ -0.639, -1.101, 2.571, -3.702, 4.842, 19.999 ], "heli_params": [ -4.615, 0.554, 2.321, 13.541, 10.354, 20.899 ], "bp2_params": [ 0.087, -0.414, 1.553, 10.114, -17.758, -7.788 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.571, "simple_Twist": 39.044, "simple_hRise": 2.471, "simple_hTwist": 39.498 }, { "index": 5, "nt1": "///F/7", "nt2": "///F/66", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 6, "helix_index": 5, "strand1": "GCGC", "strand2": "CGCG", "bp_type": "||||", "helix_form": ".A.", "helical_rise": 2.294, "helical_rise_std": 0.262, "helical_radius": 8.853, "helical_radius_std": 1.155, "helical_axis": [ 0.694, 0.481, -0.535 ], "point1": [ 114.029, 64.833, 43.649 ], "point2": [ 118.730, 68.093, 40.024 ], "num_pairs": 4, "pairs": [ { "index": 1, "nt1": "///F/10", "nt2": "///F/25", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.323, -0.233, -1.209, -8.530, -12.765, 8.594 ], "step_params": [ -1.170, -1.421, 3.397, -11.383, 11.539, 35.987 ], "heli_params": [ -3.523, 0.343, 3.041, 17.618, 17.380, 39.359 ], "bp2_params": [ 0.290, 0.005, 0.175, -18.543, -4.873, 0.286 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.397, "simple_Twist": 32.756, "simple_hRise": 2.981, "simple_hTwist": 36.448 }, { "index": 2, "nt1": "///F/11", "nt2": "///F/24", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.290, 0.005, 0.175, -18.543, -4.873, 0.286 ], "step_params": [ 0.520, -1.553, 2.762, 2.297, 9.617, 29.936 ], "heli_params": [ -4.260, -0.624, 2.202, 18.009, -4.301, 31.491 ], "bp2_params": [ -0.145, 0.002, 0.358, -7.500, -10.148, 2.698 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.762, "simple_Twist": 32.338, "simple_hRise": 2.251, "simple_hTwist": 33.777 }, { "index": 3, "nt1": "///F/12", "nt2": "///F/23", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.145, 0.002, 0.358, -7.500, -10.148, 2.698 ], "step_params": [ 0.776, -1.974, 2.936, 3.176, -2.154, 32.600 ], "heli_params": [ -3.150, -0.868, 3.116, -3.821, -5.633, 32.819 ], "bp2_params": [ 0.031, -0.247, 0.599, 4.777, -17.850, -6.048 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.936, "simple_Twist": 31.947, "simple_hRise": 3.120, "simple_hTwist": 32.170 }, { "index": 4, "nt1": "///F/13", "nt2": "///F/22", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 7, "helix_index": 5, "strand1": "CAGA", "strand2": "GUCU", "bp_type": "||||", "helix_form": "..A", "helical_rise": 2.108, "helical_rise_std": 0.095, "helical_radius": 10.001, "helical_radius_std": 0.437, "helical_axis": [ -0.985, -0.162, 0.066 ], "point1": [ 105.403, 63.000, 52.687 ], "point2": [ 99.353, 62.005, 53.093 ], "num_pairs": 4, "pairs": [ { "index": 1, "nt1": "///F/28", "nt2": "///F/42", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.228, 0.030, -0.863, 20.269, -17.195, 6.340 ], "step_params": [ 0.495, -2.235, 3.400, -13.992, 4.774, 28.507 ], "heli_params": [ -4.873, -3.311, 2.496, 8.973, 26.297, 32.042 ], "bp2_params": [ -0.106, -0.002, 0.688, 11.602, 8.283, 12.509 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.400, "simple_Twist": 29.484, "simple_hRise": 2.532, "simple_hTwist": 32.909 }, { "index": 2, "nt1": "///F/29", "nt2": "///F/41", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.106, -0.002, 0.688, 11.602, 8.283, 12.509 ], "step_params": [ -0.514, -2.281, 3.719, 10.590, 11.379, 29.991 ], "heli_params": [ -5.777, 2.603, 2.410, 20.360, -18.947, 33.697 ], "bp2_params": [ -0.401, 0.054, -0.670, -10.363, -2.454, 5.541 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.719, "simple_Twist": 31.702, "simple_hRise": 2.489, "simple_hTwist": 35.220 }, { "index": 3, "nt1": "///F/30", "nt2": "///F/40", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.401, 0.054, -0.670, -10.363, -2.454, 5.541 ], "step_params": [ 0.030, -2.146, 3.306, -0.979, 6.205, 26.343 ], "heli_params": [ -6.057, -0.297, 2.734, 13.375, 2.111, 27.069 ], "bp2_params": [ -0.082, -0.025, -0.396, -11.635, 2.902, 4.357 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.306, "simple_Twist": 24.769, "simple_hRise": 2.693, "simple_hTwist": 25.541 }, { "index": 4, "nt1": "///F/31", "nt2": "///F/39", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 8, "helix_index": 4, "strand1": "CUUAG", "strand2": "GAGUC", "bp_type": "|||||", "helix_form": "....", "helical_rise": 2.427, "helical_rise_std": 0.579, "helical_radius": 9.099, "helical_radius_std": 0.565, "helical_axis": [ 0.364, -0.924, 0.116 ], "point1": [ 131.691, 72.635, 27.101 ], "point2": [ 135.195, 63.749, 28.213 ], "num_pairs": 5, "pairs": [ { "index": 1, "nt1": "///F/49", "nt2": "///F/65", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.261, 0.013, -0.095, 31.858, -26.765, -1.378 ], "step_params": [ -0.702, -2.492, 4.365, 4.804, 14.294, 44.724 ], "heli_params": [ -4.549, 1.359, 3.373, 18.183, -6.111, 47.074 ], "bp2_params": [ 0.620, 0.440, -0.780, -14.385, -0.592, -13.460 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 4.365, "simple_Twist": 38.315, "simple_hRise": 3.170, "simple_hTwist": 41.072 }, { "index": 2, "nt1": "///F/50", "nt2": "///F/64", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.620, 0.440, -0.780, -14.385, -0.592, -13.460 ], "step_params": [ 1.174, -1.303, 3.179, -3.620, 11.971, 26.514 ], "heli_params": [ -4.828, -3.003, 2.220, 24.446, 7.393, 29.268 ], "bp2_params": [ 1.278, 0.434, 0.273, -13.274, 2.752, 14.701 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.179, "simple_Twist": 22.716, "simple_hRise": 2.038, "simple_hTwist": 25.892 }, { "index": 3, "nt1": "///F/51", "nt2": "///F/63", "bp": "U-G", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 1.278, 0.434, 0.273, -13.274, 2.752, 14.701 ], "step_params": [ 0.226, -1.554, 2.963, 4.476, 1.331, 29.709 ], "heli_params": [ -3.242, 0.391, 2.894, 2.575, -8.662, 30.065 ], "bp2_params": [ 0.363, 0.651, 0.203, -6.469, -6.325, 8.221 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.963, "simple_Twist": 34.652, "simple_hRise": 2.909, "simple_hTwist": 34.955 }, { "index": 4, "nt1": "///F/52", "nt2": "///F/62", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.363, 0.651, 0.203, -6.469, -6.325, 8.221 ], "step_params": [ -0.414, -2.472, 2.786, 5.056, 10.405, 30.137 ], "heli_params": [ -5.787, 1.395, 1.766, 19.146, -9.305, 32.233 ], "bp2_params": [ -0.130, 0.034, -0.222, 0.537, 4.473, -14.742 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.786, "simple_Twist": 32.797, "simple_hRise": 1.857, "simple_hTwist": 34.725 }, { "index": 5, "nt1": "///F/53", "nt2": "///F/61", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] } ], "num_isoCanonPairs": 3, "isoCanonPairs": [ { "index": -1, "helix_index": 1, "nt1": "///E/2", "nt2": "///E/71", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" }, { "index": -2, "helix_index": 2, "nt1": "///E/7", "nt2": "///E/66", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W" }, { "index": -3, "helix_index": 4, "nt1": "///F/19", "nt2": "///F/56", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ], "num_coaxStacks": 4, "coaxStacks": [ { "index": 1, "helix_index": 2, "num_stems": 2, "stem_indices": [ 3, 4 ] }, { "index": 2, "helix_index": 3, "num_stems": 2, "stem_indices": [ 2, 1 ] }, { "index": 3, "helix_index": 4, "num_stems": 2, "stem_indices": [ 5, 8 ] }, { "index": 4, "helix_index": 5, "num_stems": 2, "stem_indices": [ 7, 6 ] } ], "num_stacks": 33, "stacks": [ { "index": 1, "num_nts": 2, "nts_short": "HG", "nts_long": "///A/86,///E/34" }, { "index": 2, "num_nts": 2, "nts_short": "RC", "nts_long": "///A/170,///E/35" }, { "index": 3, "num_nts": 2, "nts_short": "FU", "nts_long": "///A/190,///E/33" }, { "index": 4, "num_nts": 2, "nts_short": "Ya", "nts_long": "///A/292,///E/37" }, { "index": 5, "num_nts": 2, "nts_short": "UC", "nts_long": "///E/8,///E/13" }, { "index": 6, "num_nts": 2, "nts_short": "GG", "nts_long": "///E/19,///E/57" }, { "index": 7, "num_nts": 2, "nts_short": "CA", "nts_long": "///E/25,///E/26" }, { "index": 8, "num_nts": 2, "nts_short": "AU", "nts_long": "///E/31,///E/32" }, { "index": 9, "num_nts": 2, "nts_short": "UU", "nts_long": "///E/50,///E/51" }, { "index": 10, "num_nts": 2, "nts_short": "AC", "nts_long": "///E/58,///E/61" }, { "index": 11, "num_nts": 2, "nts_short": "GU", "nts_long": "///E/65,///E/66" }, { "index": 12, "num_nts": 2, "nts_short": "HG", "nts_long": "///B/86,///F/34" }, { "index": 13, "num_nts": 2, "nts_short": "RC", "nts_long": "///B/170,///F/35" }, { "index": 14, "num_nts": 2, "nts_short": "FU", "nts_long": "///B/190,///F/33" }, { "index": 15, "num_nts": 2, "nts_short": "YA", "nts_long": "///B/292,///F/37" }, { "index": 16, "num_nts": 2, "nts_short": "AC", "nts_long": "///F/7,///F/49" }, { "index": 17, "num_nts": 2, "nts_short": "UC", "nts_long": "///F/8,///F/13" }, { "index": 18, "num_nts": 2, "nts_short": "AU", "nts_long": "///F/31,///F/32" }, { "index": 19, "num_nts": 2, "nts_short": "GU", "nts_long": "///F/42,///F/43" }, { "index": 20, "num_nts": 2, "nts_short": "AC", "nts_long": "///F/58,///F/61" }, { "index": 21, "num_nts": 2, "nts_short": "GU", "nts_long": "///F/65,///F/66" }, { "index": 22, "num_nts": 3, "nts_short": "GAG", "nts_long": "///E/15,///E/14,///E/22" }, { "index": 23, "num_nts": 3, "nts_short": "AGA", "nts_long": "///E/52,///E/63,///E/64" }, { "index": 24, "num_nts": 3, "nts_short": "GUU", "nts_long": "///E/53,///E/54,///E/55" }, { "index": 25, "num_nts": 3, "nts_short": "GAG", "nts_long": "///F/15,///F/14,///F/22" }, { "index": 26, "num_nts": 3, "nts_short": "GUU", "nts_long": "///F/53,///F/54,///F/55" }, { "index": 27, "num_nts": 4, "nts_short": "YAAU", "nts_long": "///A/114,///E/36,///E/38,///E/39" }, { "index": 28, "num_nts": 4, "nts_short": "CAGC", "nts_long": "///E/49,///E/7,///E/67,///E/68" }, { "index": 29, "num_nts": 4, "nts_short": "YAAU", "nts_long": "///B/114,///F/36,///F/38,///F/39" }, { "index": 30, "num_nts": 4, "nts_short": "GAGC", "nts_long": "///F/10,///F/26,///F/27,///F/28" }, { "index": 31, "num_nts": 5, "nts_short": "UGGAG", "nts_long": "///E/6,///E/5,///E/69,///E/70,///E/71" }, { "index": 32, "num_nts": 9, "nts_short": "GUGGGACUC", "nts_long": "///E/27,///E/44,///E/45,///E/9,///E/46,///E/21,///E/48,///E/59,///E/60" }, { "index": 33, "num_nts": 11, "nts_short": "UGGGACUCGGC", "nts_long": "///F/44,///F/45,///F/9,///F/46,///F/21,///F/48,///F/59,///F/60,///F/18,///F/57,///F/56" } ], "nonStack": { "num_nts": 11, "nts_short": "CUCGUUCCUUG", "nts_long": "///E/2,///E/3,///E/4,///E/18,///E/20,///E/47,///E/56,///F/2,///F/20,///F/47,///F/71" }, "num_atom2bases": 7, "atom2bases": [ { "index": 1, "type": "sugar", "atom": "///E/36/O4'", "nt": "///E/38", "vert_dist": 2.797 }, { "index": 2, "type": "sugar", "atom": "///E/59/O4'", "nt": "///E/48", "vert_dist": 3.174 }, { "index": 3, "type": "phosphate", "atom": "///E/57/OP2", "nt": "///E/55", "vert_dist": 3.004 }, { "index": 4, "type": "sugar", "atom": "///F/15/O4'", "nt": "///F/14", "vert_dist": 3.233 }, { "index": 5, "type": "sugar", "atom": "///F/18/O2'", "nt": "///F/19", "vert_dist": 2.953 }, { "index": 6, "type": "sugar", "atom": "///F/36/O4'", "nt": "///F/38", "vert_dist": 2.683 }, { "index": 7, "type": "phosphate", "atom": "///F/57/OP2", "nt": "///F/55", "vert_dist": 2.921 } ], "num_hairpins": 6, "hairpins": [ { "index": 1, "type": "hairpin loop", "bridging_nts": [ 7 ], "stem_indices": [ 1 ], "summary": "[1] 7 [E.13 E.22] 4", "num_nts": 9, "nts_short": "CAGUGGUAG", "nts_long": "///E/13,///E/14,///E/15,///E/16,///E/18,///E/19,///E/20,///E/21,///E/22", "num_stems": 1, "bridges": [ { "index": 1, "num_nts": 7, "nts_short": "AGUGGUA", "nts_long": "///E/14,///E/15,///E/16,///E/18,///E/19,///E/20,///E/21" } ] }, { "index": 2, "type": "hairpin loop", "bridging_nts": [ 7 ], "stem_indices": [ 2 ], "summary": "[1] 7 [E.31 E.39] 5", "num_nts": 9, "nts_short": "AUUGCAaAU", "nts_long": "///E/31,///E/32,///E/33,///E/34,///E/35,///E/36,///E/37,///E/38,///E/39", "num_stems": 1, "bridges": [ { "index": 1, "num_nts": 7, "nts_short": "UUGCAaA", "nts_long": "///E/32,///E/33,///E/34,///E/35,///E/36,///E/37,///E/38" } ] }, { "index": 3, "type": "hairpin loop", "bridging_nts": [ 7 ], "stem_indices": [ 4 ], "summary": "[1] 7 [E.53 E.61] 2", "num_nts": 9, "nts_short": "GUUCGAUCC", "nts_long": "///E/53,///E/54,///E/55,///E/56,///E/57,///E/58,///E/59,///E/60,///E/61", "num_stems": 1, "bridges": [ { "index": 1, "num_nts": 7, "nts_short": "UUCGAUC", "nts_long": "///E/54,///E/55,///E/56,///E/57,///E/58,///E/59,///E/60" } ] }, { "index": 4, "type": "hairpin loop", "bridging_nts": [ 7 ], "stem_indices": [ 6 ], "summary": "[1] 7 [F.13 F.22] 4", "num_nts": 9, "nts_short": "CAGUGGUAG", "nts_long": "///F/13,///F/14,///F/15,///F/16,///F/18,///F/19,///F/20,///F/21,///F/22", "num_stems": 1, "bridges": [ { "index": 1, "num_nts": 7, "nts_short": "AGUGGUA", "nts_long": "///F/14,///F/15,///F/16,///F/18,///F/19,///F/20,///F/21" } ] }, { "index": 5, "type": "hairpin loop", "bridging_nts": [ 7 ], "stem_indices": [ 7 ], "summary": "[1] 7 [F.31 F.39] 4", "num_nts": 9, "nts_short": "AUUGCAAAU", "nts_long": "///F/31,///F/32,///F/33,///F/34,///F/35,///F/36,///F/37,///F/38,///F/39", "num_stems": 1, "bridges": [ { "index": 1, "num_nts": 7, "nts_short": "UUGCAAA", "nts_long": "///F/32,///F/33,///F/34,///F/35,///F/36,///F/37,///F/38" } ] }, { "index": 6, "type": "hairpin loop", "bridging_nts": [ 7 ], "stem_indices": [ 8 ], "summary": "[1] 7 [F.53 F.61] 5", "num_nts": 9, "nts_short": "GUUCGAUCC", "nts_long": "///F/53,///F/54,///F/55,///F/56,///F/57,///F/58,///F/59,///F/60,///F/61", "num_stems": 1, "bridges": [ { "index": 1, "num_nts": 7, "nts_short": "UUCGAUC", "nts_long": "///F/54,///F/55,///F/56,///F/57,///F/58,///F/59,///F/60" } ] } ], "num_iloops": 2, "iloops": [ { "index": 1, "type": "symmetric internal loop", "bridging_nts": [ 1, 1 ], "stem_indices": [ 3, 4 ], "summary": "[2] 1 1 [E.50 E.64 E.52 E.62] 2 2", "num_nts": 6, "nts_short": "UUAUGA", "nts_long": "///E/50,///E/51,///E/52,///E/62,///E/63,///E/64", "num_stems": 2, "bridges": [ { "index": 1, "num_nts": 1, "nts_short": "U", "nts_long": "///E/51" }, { "index": 2, "num_nts": 1, "nts_short": "G", "nts_long": "///E/63" } ] }, { "index": 2, "type": "symmetric internal loop", "bridging_nts": [ 4, 4 ], "stem_indices": [ -1, -2 ], "summary": "[2] 4 4 [E.2 E.71 E.7 E.66] 1 1", "num_nts": 12, "nts_short": "CUCGUAUGCGAG", "nts_long": "///E/2,///E/3,///E/4,///E/5,///E/6,///E/7,///E/66,///E/67,///E/68,///E/69,///E/70,///E/71", "num_stems": 2, "bridges": [ { "index": 1, "num_nts": 4, "nts_short": "UCGU", "nts_long": "///E/3,///E/4,///E/5,///E/6" }, { "index": 2, "num_nts": 4, "nts_short": "GCGA", "nts_long": "///E/67,///E/68,///E/69,///E/70" } ] } ], "num_junctions": 2, "junctions": [ { "index": 1, "type": "4-way junction", "bridging_nts": [ 2, 1, 5, 0 ], "stem_indices": [ -2, 1, 2, 3 ], "summary": "[4] 2 1 5 0 [E.7 E.66 E.10 E.25 E.27 E.43 E.49 E.65] 1 4 5 2", "num_nts": 16, "nts_short": "AUGGCAGUUGGUCCGU", "nts_long": "///E/7,///E/8,///E/9,///E/10,///E/25,///E/26,///E/27,///E/43,///E/44,///E/45,///E/46,///E/47,///E/48,///E/49,///E/65,///E/66", "num_stems": 4, "bridges": [ { "index": 1, "num_nts": 2, "nts_short": "UG", "nts_long": "///E/8,///E/9" }, { "index": 2, "num_nts": 1, "nts_short": "A", "nts_long": "///E/26" }, { "index": 3, "num_nts": 5, "nts_short": "UGGUC", "nts_long": "///E/44,///E/45,///E/46,///E/47,///E/48" }, { "index": 4, "num_nts": 0, "nts_short": "", "nts_long": "" } ] }, { "index": 2, "type": "4-way junction", "bridging_nts": [ 2, 2, 6, 0 ], "stem_indices": [ 5, 6, 7, 8 ], "summary": "[4] 2 2 6 0 [F.7 F.66 F.10 F.25 F.28 F.42 F.49 F.65] 5 4 4 5", "num_nts": 18, "nts_short": "AUGGCAGCGUUGGUCCGU", "nts_long": "///F/7,///F/8,///F/9,///F/10,///F/25,///F/26,///F/27,///F/28,///F/42,///F/43,///F/44,///F/45,///F/46,///F/47,///F/48,///F/49,///F/65,///F/66", "num_stems": 4, "bridges": [ { "index": 1, "num_nts": 2, "nts_short": "UG", "nts_long": "///F/8,///F/9" }, { "index": 2, "num_nts": 2, "nts_short": "AG", "nts_long": "///F/26,///F/27" }, { "index": 3, "num_nts": 6, "nts_short": "UUGGUC", "nts_long": "///F/43,///F/44,///F/45,///F/46,///F/47,///F/48" }, { "index": 4, "num_nts": 0, "nts_short": "", "nts_long": "" } ] } ], "num_ssSegments": 2, "ssSegments": [ { "index": 1, "num_nts": 1, "nts_short": "C", "nts_long": "///F/2" }, { "index": 2, "num_nts": 1, "nts_short": "G", "nts_long": "///F/71" } ], "num_kissingLoops": 1, "kissingLoops": [ { "index": 1, "stem_index": -3, "is_isoCanonPair": true, "hairpin_indices": [ 4, 6 ] } ], "num_splayUnits": 13, "splayUnits": [ { "index": 1, "num_nts": 2, "nts_short": "AU", "nts_long": "///E/7,///E/8" }, { "index": 2, "num_nts": 2, "nts_short": "UG", "nts_long": "///E/16,///E/18" }, { "index": 3, "num_nts": 3, "nts_short": "GUA", "nts_long": "///E/19,///E/20,///E/21" }, { "index": 4, "num_nts": 4, "nts_short": "UUGC", "nts_long": "///E/32,///E/33,///E/34,///E/35" }, { "index": 5, "num_nts": 3, "nts_short": "AaA", "nts_long": "///E/36,///E/37,///E/38" }, { "index": 6, "num_nts": 2, "nts_short": "CC", "nts_long": "///E/48,///E/49" }, { "index": 7, "num_nts": 2, "nts_short": "UC", "nts_long": "///E/55,///E/56" }, { "index": 8, "num_nts": 2, "nts_short": "AU", "nts_long": "///F/7,///F/8" }, { "index": 9, "num_nts": 3, "nts_short": "GUA", "nts_long": "///F/19,///F/20,///F/21" }, { "index": 10, "num_nts": 4, "nts_short": "UUGC", "nts_long": "///F/32,///F/33,///F/34,///F/35" }, { "index": 11, "num_nts": 3, "nts_short": "AAA", "nts_long": "///F/36,///F/37,///F/38" }, { "index": 12, "num_nts": 4, "nts_short": "GUCC", "nts_long": "///F/46,///F/47,///F/48,///F/49" }, { "index": 13, "num_nts": 2, "nts_short": "CC", "nts_long": "///F/60,///F/61" } ], "pseudoknot_order": 1, "pseudoknot_nts": [ { "index": 1, "symbols": "[]", "num_nts": 2, "nts_short": "GC", "nts_long": "///F/19,///F/56" } ], "dbn": { "all_chains": { "num_nts": 138, "num_chars": 139, "bseq": "CUCGUAUGGCGCAGUGGUAGCGCAGCAGAUUGCAaAUCUGUUGGUCCUUAGUUCGAUCCUGAGUGCGAG&CUCGUAUGGCGCAGUGGUAGCGCAGCAGAUUGCAAAUCUGUUGGUCCUUAGUUCGAUCCUGAGUGCGAG", "bseqUP": "CUCGUAUGGCGCAGUGGUAGCGCAGCAGAUUGCAAAUCUGUUGGUCCUUAGUUCGAUCCUGAGUGCGAG&CUCGUAUGGCGCAGUGGUAGCGCAGCAGAUUGCAAAUCUGUUGGUCCUUAGUUCGAUCCUGAGUGCGAG", "sstr": "(....(..((((.......)))).(((((.......))))).....((.((.......)).)))....)&.(((((..((((....[..))))..((((.......))))......(((((..]....)))))))))).", "form": "...A....AA.........AAAA.AAAA........AAAA......AAAAA.......AAAA.AAA.A-&.AA.....AA.........AAA..AAAA........A.AA......AAA.A.....A.AAA.AAAAA.-" }, "chain_E": { "num_nts": 69, "num_chars": 69, "bseq": "CUCGUAUGGCGCAGUGGUAGCGCAGCAGAUUGCAaAUCUGUUGGUCCUUAGUUCGAUCCUGAGUGCGAG", "bseqUP": "CUCGUAUGGCGCAGUGGUAGCGCAGCAGAUUGCAAAUCUGUUGGUCCUUAGUUCGAUCCUGAGUGCGAG", "sstr": "(....(..((((.......)))).(((((.......))))).....((.((.......)).)))....)", "form": "...A....AA.........AAAA.AAAA........AAAA......AAAAA.......AAAA.AAA.A-" }, "chain_F": { "num_nts": 69, "num_chars": 69, "bseq": "CUCGUAUGGCGCAGUGGUAGCGCAGCAGAUUGCAAAUCUGUUGGUCCUUAGUUCGAUCCUGAGUGCGAG", "bseqUP": "CUCGUAUGGCGCAGUGGUAGCGCAGCAGAUUGCAAAUCUGUUGGUCCUUAGUUCGAUCCUGAGUGCGAG", "sstr": ".(((((..((((....[..))))..((((.......))))......(((((..]....)))))))))).", "form": ".AA.....AA.........AAA..AAAA........A.AA......AAA.A.....A.AAA.AAAAA.-" } }, "chains": { "chain_E": { "num_nts": 69, "bseq": "CUCGUAUGGCGCAGUGGUAGCGCAGCAGAUUGCAaAUCUGUUGGUCCUUAGUUCGAUCCUGAGUGCGAG", "sstr": "(....(..((((.......)))).(((((.......))))).....((.((.......)).)))....)", "form": "...A....AA.........AAAA.AAAA........AAAA......AAAAA.......AAAA.AAA.A-", "helical_rise": 0.094, "helical_rise_std": 3.231, "helical_axis": [ -0.780, -0.270, 0.564 ], "point1": [ 36.162, 25.342, 25.321 ], "point2": [ 30.736, 23.465, 29.242 ], "num_chars": 205, "suite": "C1mU1aC1cG1aU!!A5jU!!G!!G1aC1aG1cC1aA1aG7aU!!G!!G1eU!!A1eG1aC1aG1aC1aA1aG1aC1aA1aG1aA1aU!!U!!G!!C2[A!!a!!A1aU1aC1aU1aG1aU&aU!!G1mG!!U!!C!!C1aU1aU1aA1cG1aU1cU1gC1aG1aA!!U1aC1mC1aU1aG1aA1aG1aU1aG1cC1mG1cA1mG" }, "chain_F": { "num_nts": 69, "bseq": "CUCGUAUGGCGCAGUGGUAGCGCAGCAGAUUGCAAAUCUGUUGGUCCUUAGUUCGAUCCUGAGUGCGAG", "sstr": ".(((((..((((....[..))))..((((.......))))......(((((..]....)))))))))).", "form": ".AA.....AA.........AAA..AAAA........A.AA......AAA.A.....A.AAA.AAAAA.-", "helical_rise": 0.081, "helical_rise_std": 3.332, "helical_axis": [ 0.647, 0.221, 0.730 ], "point1": [ 118.688, 63.521, 38.271 ], "point2": [ 122.309, 64.759, 42.357 ], "num_chars": 205, "suite": "C1mU1cC1cG1aU!!A!!U!!G!!G1aC1aG1cC1eA1aG7aU!!G!!G1eU!!A1eG1aC1aG1aC1cA1aG1aC1aA1aG1aA1aU!!U!!G!!C2[A!!A!!A1aU1aC1aU1aG1aU&aU1fG!!G!!U!!C!!C1aU1aU1aA1cG1mU1aU1gC1aG7aA!!U1aC1mC1aU1aG!!A1mG1aU1aG1aC1aG1mA1aG" } }, "num_nts": 138, "nts": [ { "index": 1, "index_chain": 1, "chain_name": "E", "nt_resnum": 2, "nt_name": "C", "nt_code": "C", "nt_id": "///E/2", "linked_nts": [ null, "///E/3" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,non-stack,isolated-canonical,helix-end,internal-loop", "alpha": null, "beta": 107.627, "gamma": 78.637, "delta": 84.796, "epsilon": -169.900, "zeta": -55.876, "epsilon_zeta": -114.025, "bb_type": "BI", "chi": -176.934, "glyco_bond": "anti", "C5prime_xyz": [ -1.529, 8.550, 1.495 ], "P_xyz": [ 0.751, 8.541, 0.096 ], "form": ".", "ssZp": 4.415, "Dp": 4.424, "splay_angle": 37.891, "splay_distance": 5.494, "splay_ratio": 0.325, "d22": 4.712, "d64": 4.499, "eta": null, "theta": -118.603, "eta_prime": null, "theta_prime": -136.853, "eta_base": null, "theta_base": -109.212, "v0": 1.972, "v1": -24.857, "v2": 37.118, "v3": -36.799, "v4": 21.962, "amplitude": 38.541, "phase_angle": 15.617, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.006, "origin": [ 35.849, -4.106, 13.617 ], "x_axis": [ 0.958, 0.268, 0.106 ], "y_axis": [ 0.032, 0.268, -0.963 ], "z_axis": [ -0.286, 0.925, 0.248 ], "quaternion": [ 0.786, -0.600, -0.125, 0.075 ] } }, { "index": 2, "index_chain": 2, "chain_name": "E", "nt_resnum": 3, "nt_name": "U", "nt_code": "U", "nt_id": "///E/3", "linked_nts": [ "///E/2", "///E/4" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-stack,non-canonical,helix-end,internal-loop", "alpha": -108.961, "beta": -130.287, "gamma": 57.094, "delta": 81.409, "epsilon": -142.309, "zeta": -84.120, "epsilon_zeta": -58.188, "bb_type": "BI", "chi": -168.265, "glyco_bond": "anti", "C5prime_xyz": [ -1.117, 8.500, 1.034 ], "P_xyz": [ 1.185, 8.118, 2.256 ], "form": ".", "ssZp": 4.672, "Dp": 4.764, "splay_angle": 31.077, "splay_distance": 4.792, "splay_ratio": 0.271, "d22": 4.645, "d64": 5.393, "eta": 170.852, "theta": -141.812, "eta_prime": 178.757, "theta_prime": -133.320, "eta_base": -134.371, "theta_base": -111.671, "v0": 6.952, "v1": -29.344, "v2": 39.642, "v3": -36.565, "v4": 18.643, "amplitude": 40.115, "phase_angle": 8.811, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1m", "suiteness": 0.036, "filter_rmsd": 0.107, "frame": { "rmsd": 0.007, "origin": [ 35.934, 1.078, 15.435 ], "x_axis": [ 0.712, 0.068, -0.698 ], "y_axis": [ -0.641, -0.342, -0.687 ], "z_axis": [ -0.286, 0.937, -0.200 ], "quaternion": [ 0.541, -0.751, 0.191, 0.328 ] } }, { "index": 3, "index_chain": 3, "chain_name": "E", "nt_resnum": 4, "nt_name": "C", "nt_code": "C", "nt_id": "///E/4", "linked_nts": [ "///E/3", "///E/5" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-stack,non-pair-contact,internal-loop", "alpha": -37.869, "beta": 157.554, "gamma": 56.511, "delta": 82.921, "epsilon": -156.312, "zeta": -99.286, "epsilon_zeta": -57.026, "bb_type": "BI", "chi": -167.480, "glyco_bond": "anti", "C5prime_xyz": [ -1.630, 8.753, 0.911 ], "P_xyz": [ 0.966, 9.092, 1.067 ], "form": ".", "ssZp": 4.372, "Dp": 4.485, "splay_angle": 15.237, "splay_distance": 2.708, "splay_ratio": 0.144, "d22": null, "d64": null, "eta": -175.950, "theta": -137.618, "eta_prime": -157.668, "theta_prime": -154.527, "eta_base": -124.297, "theta_base": -175.637, "v0": 1.111, "v1": -24.066, "v2": 36.707, "v3": -37.030, "v4": 22.658, "amplitude": 38.382, "phase_angle": 16.987, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.387, "filter_rmsd": 0.063, "frame": { "rmsd": 0.005, "origin": [ 36.700, 5.784, 14.965 ], "x_axis": [ 0.305, -0.115, -0.945 ], "y_axis": [ -0.885, -0.400, -0.237 ], "z_axis": [ -0.351, 0.909, -0.224 ], "quaternion": [ -0.413, 0.694, -0.360, -0.467 ] } }, { "index": 4, "index_chain": 4, "chain_name": "E", "nt_resnum": 5, "nt_name": "G", "nt_code": "G", "nt_id": "///E/5", "linked_nts": [ "///E/4", "///E/6" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,internal-loop", "alpha": 142.290, "beta": -151.620, "gamma": 173.287, "delta": 83.371, "epsilon": -143.101, "zeta": -73.207, "epsilon_zeta": -69.894, "bb_type": "BI", "chi": -161.579, "glyco_bond": "anti", "C5prime_xyz": [ -1.119, 8.648, 0.642 ], "P_xyz": [ 0.295, 9.869, -1.209 ], "form": "A", "ssZp": 4.491, "Dp": 4.715, "splay_angle": 24.087, "splay_distance": 3.725, "splay_ratio": 0.209, "d22": null, "d64": null, "eta": 151.719, "theta": -157.953, "eta_prime": 161.467, "theta_prime": -154.325, "eta_base": 160.487, "theta_base": -108.806, "v0": 5.438, "v1": -27.746, "v2": 38.380, "v3": -36.251, "v4": 19.438, "amplitude": 39.071, "phase_angle": 10.787, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.373, "filter_rmsd": 0.003, "frame": { "rmsd": 0.003, "origin": [ 37.934, 7.614, 16.533 ], "x_axis": [ 0.041, -0.112, -0.993 ], "y_axis": [ -0.993, 0.109, -0.053 ], "z_axis": [ 0.114, 0.988, -0.107 ], "quaternion": [ 0.510, -0.510, 0.542, 0.431 ] } }, { "index": 5, "index_chain": 5, "chain_name": "E", "nt_resnum": 6, "nt_name": "U", "nt_code": "U", "nt_id": "///E/6", "linked_nts": [ "///E/5", "///E/7" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-canonical,non-pair-contact,helix,internal-loop", "alpha": -50.101, "beta": 157.391, "gamma": 51.541, "delta": 82.162, "epsilon": -134.905, "zeta": -123.396, "epsilon_zeta": -11.509, "bb_type": "--", "chi": -158.085, "glyco_bond": "anti", "C5prime_xyz": [ -1.402, 8.713, 0.470 ], "P_xyz": [ 1.192, 8.909, 0.193 ], "form": ".", "ssZp": 4.372, "Dp": 4.711, "splay_angle": 29.207, "splay_distance": 4.689, "splay_ratio": 0.253, "d22": null, "d64": null, "eta": 170.440, "theta": -130.360, "eta_prime": -168.017, "theta_prime": -129.950, "eta_base": -106.123, "theta_base": -110.183, "v0": 2.585, "v1": -25.728, "v2": 38.047, "v3": -37.521, "v4": 21.950, "amplitude": 39.371, "phase_angle": 14.901, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.734, "filter_rmsd": 0.104, "frame": { "rmsd": 0.006, "origin": [ 38.408, 10.025, 13.733 ], "x_axis": [ -0.623, 0.027, -0.782 ], "y_axis": [ -0.735, 0.322, 0.596 ], "z_axis": [ 0.268, 0.946, -0.180 ], "quaternion": [ 0.360, -0.243, 0.729, 0.529 ] } }, { "index": 6, "index_chain": 6, "chain_name": "E", "nt_resnum": 7, "nt_name": "A", "nt_code": "A", "nt_id": "///E/7", "linked_nts": [ "///E/6", "///E/8" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,isolated-canonical,non-pair-contact,helix,internal-loop,junction-loop,splayed-apart", "alpha": 121.203, "beta": -93.087, "gamma": -172.699, "delta": 89.040, "epsilon": -145.666, "zeta": 101.563, "epsilon_zeta": 112.771, "bb_type": "--", "chi": 156.527, "glyco_bond": "anti", "C5prime_xyz": [ -2.591, 7.864, 2.482 ], "P_xyz": [ -0.668, 9.339, 1.490 ], "form": ".", "ssZp": 3.328, "Dp": 4.152, "splay_angle": 120.077, "splay_distance": 16.485, "splay_ratio": 0.868, "d22": null, "d64": null, "eta": -170.343, "theta": 23.983, "eta_prime": -151.000, "theta_prime": -5.582, "eta_base": -110.347, "theta_base": -23.674, "v0": -1.487, "v1": -20.863, "v2": 33.731, "v3": -35.758, "v4": 23.576, "amplitude": 36.143, "phase_angle": 21.051, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.039, "frame": { "rmsd": 0.007, "origin": [ 38.618, 13.677, 10.800 ], "x_axis": [ -0.918, -0.141, -0.371 ], "y_axis": [ -0.390, 0.139, 0.910 ], "z_axis": [ -0.077, 0.980, -0.183 ], "quaternion": [ 0.098, -0.177, 0.748, 0.632 ] } }, { "index": 7, "index_chain": 7, "chain_name": "E", "nt_resnum": 8, "nt_name": "U", "nt_code": "U", "nt_id": "///E/8", "linked_nts": [ "///E/7", "///E/9" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-canonical,non-pair-contact,helix,multiplet,junction-loop,splayed-apart", "alpha": 106.835, "beta": 158.114, "gamma": 169.363, "delta": 86.882, "epsilon": -98.486, "zeta": -89.393, "epsilon_zeta": -9.093, "bb_type": "--", "chi": -133.951, "glyco_bond": "anti", "C5prime_xyz": [ -1.366, 8.580, -1.047 ], "P_xyz": [ -1.067, 9.729, -3.406 ], "form": ".", "ssZp": 2.412, "Dp": 4.564, "splay_angle": 69.187, "splay_distance": 11.534, "splay_ratio": 0.568, "d22": null, "d64": null, "eta": 135.711, "theta": 169.368, "eta_prime": 153.485, "theta_prime": 168.211, "eta_base": -165.861, "theta_base": 171.015, "v0": 3.697, "v1": -25.184, "v2": 35.770, "v3": -34.791, "v4": 19.747, "amplitude": 36.729, "phase_angle": 13.118, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "5j", "suiteness": 0.010, "filter_rmsd": 0.103, "frame": { "rmsd": 0.004, "origin": [ 35.338, 23.223, 23.833 ], "x_axis": [ 0.002, -0.730, 0.683 ], "y_axis": [ 0.848, -0.361, -0.388 ], "z_axis": [ 0.530, 0.580, 0.618 ], "quaternion": [ 0.561, -0.432, -0.068, -0.703 ] } }, { "index": 8, "index_chain": 8, "chain_name": "E", "nt_resnum": 9, "nt_name": "G", "nt_code": "G", "nt_id": "///E/9", "linked_nts": [ "///E/8", "///E/10" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-canonical,non-pair-contact,multiplet,junction-loop", "alpha": -138.861, "beta": 90.592, "gamma": 146.321, "delta": 89.942, "epsilon": 11.820, "zeta": -165.309, "epsilon_zeta": -182.872, "bb_type": "--", "chi": -167.976, "glyco_bond": "anti", "C5prime_xyz": [ -1.284, 8.561, 1.000 ], "P_xyz": [ -1.532, 9.987, -1.233 ], "form": ".", "ssZp": 3.290, "Dp": 3.288, "splay_angle": 54.210, "splay_distance": 8.191, "splay_ratio": 0.465, "d22": null, "d64": null, "eta": -142.782, "theta": -74.399, "eta_prime": -170.586, "theta_prime": -102.307, "eta_base": 176.173, "theta_base": -99.469, "v0": 4.322, "v1": -26.418, "v2": 36.651, "v3": -35.218, "v4": 19.706, "amplitude": 37.484, "phase_angle": 12.100, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.011, "frame": { "rmsd": 0.011, "origin": [ 43.814, 30.618, 26.381 ], "x_axis": [ -0.426, -0.455, 0.782 ], "y_axis": [ 0.144, -0.887, -0.438 ], "z_axis": [ 0.893, -0.074, 0.443 ], "quaternion": [ -0.180, 0.504, -0.154, 0.830 ] } }, { "index": 9, "index_chain": 9, "chain_name": "E", "nt_resnum": 10, "nt_name": "G", "nt_code": "G", "nt_id": "///E/10", "linked_nts": [ "///E/9", "///E/11" ], "nt_type": "RNA", "dbn": "(", "summary": "turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop,phosphate", "alpha": 142.864, "beta": -113.336, "gamma": 75.271, "delta": 86.911, "epsilon": -154.356, "zeta": -68.678, "epsilon_zeta": -85.677, "bb_type": "BI", "chi": -179.050, "glyco_bond": "anti", "C5prime_xyz": [ -1.268, 8.385, 1.620 ], "P_xyz": [ 0.970, 7.381, 2.672 ], "form": "A", "ssZp": 4.614, "Dp": 4.625, "splay_angle": 22.366, "splay_distance": 3.484, "splay_ratio": 0.199, "d22": null, "d64": null, "eta": 33.547, "theta": -127.395, "eta_prime": 99.363, "theta_prime": -128.367, "eta_base": 141.166, "theta_base": -110.698, "v0": 7.326, "v1": -28.027, "v2": 36.824, "v3": -33.617, "v4": 16.675, "amplitude": 37.142, "phase_angle": 7.509, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.003, "frame": { "rmsd": 0.003, "origin": [ 48.938, 24.711, 28.819 ], "x_axis": [ -0.497, 0.858, -0.127 ], "y_axis": [ 0.443, 0.125, -0.888 ], "z_axis": [ -0.746, -0.498, -0.442 ], "quaternion": [ -0.215, 0.453, 0.718, -0.482 ] } }, { "index": 10, "index_chain": 10, "chain_name": "E", "nt_resnum": 11, "nt_name": "C", "nt_code": "C", "nt_id": "///E/11", "linked_nts": [ "///E/10", "///E/12" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -86.214, "beta": -170.449, "gamma": 59.559, "delta": 83.841, "epsilon": -163.639, "zeta": -68.055, "epsilon_zeta": -95.585, "bb_type": "BI", "chi": -163.212, "glyco_bond": "anti", "C5prime_xyz": [ -1.261, 8.719, 0.736 ], "P_xyz": [ 1.345, 8.993, 1.056 ], "form": "A", "ssZp": 4.571, "Dp": 4.576, "splay_angle": 24.091, "splay_distance": 3.721, "splay_ratio": 0.210, "d22": null, "d64": null, "eta": 162.021, "theta": -148.695, "eta_prime": 176.760, "theta_prime": -149.165, "eta_base": -142.612, "theta_base": -125.538, "v0": 3.350, "v1": -25.704, "v2": 37.064, "v3": -36.076, "v4": 20.699, "amplitude": 38.143, "phase_angle": 13.659, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.552, "filter_rmsd": 0.062, "frame": { "rmsd": 0.006, "origin": [ 45.690, 23.521, 29.240 ], "x_axis": [ -0.142, 0.757, -0.637 ], "y_axis": [ 0.591, -0.452, -0.668 ], "z_axis": [ -0.794, -0.471, -0.383 ], "quaternion": [ -0.076, 0.651, 0.518, -0.550 ] } }, { "index": 11, "index_chain": 11, "chain_name": "E", "nt_resnum": 12, "nt_name": "G", "nt_code": "G", "nt_id": "///E/12", "linked_nts": [ "///E/11", "///E/13" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet", "alpha": -75.114, "beta": -174.607, "gamma": 50.486, "delta": 80.295, "epsilon": -158.084, "zeta": -62.709, "epsilon_zeta": -95.375, "bb_type": "BI", "chi": -171.701, "glyco_bond": "anti", "C5prime_xyz": [ -1.245, 8.593, 1.235 ], "P_xyz": [ 1.286, 8.778, 1.877 ], "form": ".", "ssZp": 4.670, "Dp": 4.639, "splay_angle": 25.297, "splay_distance": 4.443, "splay_ratio": 0.242, "d22": null, "d64": null, "eta": 162.090, "theta": -121.845, "eta_prime": 172.693, "theta_prime": -128.871, "eta_base": -146.246, "theta_base": -105.127, "v0": 3.514, "v1": -27.045, "v2": 39.517, "v3": -38.254, "v4": 21.702, "amplitude": 40.654, "phase_angle": 13.588, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.769, "filter_rmsd": 0.008, "frame": { "rmsd": 0.008, "origin": [ 42.046, 23.038, 28.662 ], "x_axis": [ 0.359, 0.482, -0.799 ], "y_axis": [ 0.603, -0.774, -0.196 ], "z_axis": [ -0.712, -0.411, -0.569 ], "quaternion": [ 0.065, 0.822, 0.330, -0.460 ] } }, { "index": 12, "index_chain": 12, "chain_name": "E", "nt_resnum": 13, "nt_name": "C", "nt_code": "C", "nt_id": "///E/13", "linked_nts": [ "///E/12", "///E/14" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,hairpin-loop", "alpha": 177.054, "beta": -177.141, "gamma": 166.435, "delta": 84.717, "epsilon": -153.134, "zeta": -78.654, "epsilon_zeta": -74.479, "bb_type": "BI", "chi": 178.711, "glyco_bond": "anti", "C5prime_xyz": [ -1.082, 8.253, 1.726 ], "P_xyz": [ 0.536, 10.107, 0.740 ], "form": ".", "ssZp": 4.679, "Dp": 4.693, "splay_angle": 30.706, "splay_distance": 4.630, "splay_ratio": 0.272, "d22": null, "d64": null, "eta": 166.253, "theta": -176.961, "eta_prime": -174.310, "theta_prime": -171.497, "eta_base": -124.145, "theta_base": -157.774, "v0": 9.752, "v1": -31.445, "v2": 39.830, "v3": -35.215, "v4": 16.120, "amplitude": 39.966, "phase_angle": 4.728, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.426, "filter_rmsd": 0.064, "frame": { "rmsd": 0.005, "origin": [ 39.313, 24.849, 25.664 ], "x_axis": [ 0.575, -0.046, -0.817 ], "y_axis": [ 0.234, -0.947, 0.219 ], "z_axis": [ -0.784, -0.317, -0.534 ], "quaternion": [ 0.153, 0.874, 0.054, -0.458 ] } }, { "index": 13, "index_chain": 13, "chain_name": "E", "nt_resnum": 14, "nt_name": "A", "nt_code": "A", "nt_id": "///E/14", "linked_nts": [ "///E/13", "///E/15" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,hairpin-loop", "alpha": -73.922, "beta": -174.361, "gamma": 67.548, "delta": 88.052, "epsilon": -157.188, "zeta": -44.812, "epsilon_zeta": -112.376, "bb_type": "BI", "chi": -167.674, "glyco_bond": "anti", "C5prime_xyz": [ -1.338, 8.567, 0.962 ], "P_xyz": [ 1.286, 8.902, 1.074 ], "form": ".", "ssZp": 4.585, "Dp": 4.579, "splay_angle": 32.699, "splay_distance": 5.050, "splay_ratio": 0.284, "d22": null, "d64": null, "eta": -179.728, "theta": -117.791, "eta_prime": -169.904, "theta_prime": -117.060, "eta_base": -151.891, "theta_base": -69.270, "v0": 5.491, "v1": -27.076, "v2": 37.041, "v3": -34.830, "v4": 18.628, "amplitude": 37.658, "phase_angle": 10.384, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.569, "filter_rmsd": 0.037, "frame": { "rmsd": 0.004, "origin": [ 35.455, 26.729, 23.926 ], "x_axis": [ 0.542, -0.444, -0.713 ], "y_axis": [ -0.023, -0.856, 0.516 ], "z_axis": [ -0.840, -0.263, -0.475 ], "quaternion": [ 0.230, 0.848, -0.138, -0.458 ] } }, { "index": 14, "index_chain": 14, "chain_name": "E", "nt_resnum": 15, "nt_name": "G", "nt_code": "G", "nt_id": "///E/15", "linked_nts": [ "///E/14", "///E/16" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-canonical,non-pair-contact,helix,hairpin-loop", "alpha": -90.065, "beta": -176.007, "gamma": 67.467, "delta": 85.657, "epsilon": -146.658, "zeta": -122.846, "epsilon_zeta": -23.812, "bb_type": "--", "chi": -149.046, "glyco_bond": "anti", "C5prime_xyz": [ -1.348, 8.773, -0.152 ], "P_xyz": [ 1.211, 9.125, -0.632 ], "form": ".", "ssZp": 4.128, "Dp": 4.659, "splay_angle": 34.573, "splay_distance": 5.315, "splay_ratio": 0.299, "d22": null, "d64": null, "eta": 165.021, "theta": 171.105, "eta_prime": -165.607, "theta_prime": 171.783, "eta_base": -92.999, "theta_base": 157.675, "v0": 3.146, "v1": -25.968, "v2": 37.595, "v3": -36.718, "v4": 21.153, "amplitude": 38.738, "phase_angle": 13.958, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.224, "filter_rmsd": 0.003, "frame": { "rmsd": 0.003, "origin": [ 34.989, 23.438, 20.124 ], "x_axis": [ 0.095, -0.995, -0.042 ], "y_axis": [ -0.645, -0.093, 0.758 ], "z_axis": [ -0.758, -0.045, -0.650 ], "quaternion": [ 0.296, 0.678, -0.605, -0.295 ] } }, { "index": 15, "index_chain": 15, "chain_name": "E", "nt_resnum": 16, "nt_name": "U", "nt_code": "U", "nt_id": "///E/16", "linked_nts": [ "///E/15", "///E/18" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,hairpin-loop,splayed-apart", "alpha": -65.621, "beta": 150.482, "gamma": 52.409, "delta": 84.204, "epsilon": -158.200, "zeta": -100.666, "epsilon_zeta": -57.534, "bb_type": "BI", "chi": -144.480, "glyco_bond": "anti", "C5prime_xyz": [ -1.194, 8.655, -0.398 ], "P_xyz": [ 1.300, 8.413, -1.207 ], "form": ".", "ssZp": 4.012, "Dp": 4.632, "splay_angle": 101.017, "splay_distance": 15.306, "splay_ratio": 0.774, "d22": null, "d64": null, "eta": 160.271, "theta": -120.119, "eta_prime": 159.527, "theta_prime": -150.804, "eta_base": 149.946, "theta_base": -159.397, "v0": 4.764, "v1": -27.467, "v2": 38.437, "v3": -36.655, "v4": 20.074, "amplitude": 39.253, "phase_angle": 11.700, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "7a", "suiteness": 0.776, "filter_rmsd": 0.104, "frame": { "rmsd": 0.005, "origin": [ 32.519, 27.690, 18.106 ], "x_axis": [ 0.239, -0.971, -0.031 ], "y_axis": [ -0.821, -0.219, 0.528 ], "z_axis": [ -0.519, -0.101, -0.849 ], "quaternion": [ 0.207, 0.759, -0.590, -0.181 ] } }, { "index": 16, "index_chain": 16, "chain_name": "E", "nt_resnum": 18, "nt_name": "G", "nt_code": "G", "nt_id": "///E/18", "linked_nts": [ "///E/16", "///E/19" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,anti,BI,non-stack,non-pair-contact,hairpin-loop,splayed-apart", "alpha": 177.289, "beta": -110.746, "gamma": -62.170, "delta": 117.420, "epsilon": -132.774, "zeta": -96.494, "epsilon_zeta": -36.281, "bb_type": "BI", "chi": -93.858, "glyco_bond": "anti", "C5prime_xyz": [ -1.793, 7.671, -2.273 ], "P_xyz": [ -2.219, 9.778, -3.777 ], "form": ".", "ssZp": 1.158, "Dp": 3.252, "splay_angle": 40.760, "splay_distance": 6.943, "splay_ratio": 0.370, "d22": null, "d64": null, "eta": -22.241, "theta": 178.596, "eta_prime": -20.177, "theta_prime": -164.045, "eta_base": -44.352, "theta_base": -122.249, "v0": -2.606, "v1": 13.917, "v2": -19.656, "v3": 18.848, "v4": -10.055, "amplitude": 20.064, "phase_angle": 191.566, "puckering": "C3'-exo", "sugar_class": "pucker-CHK", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.006, "frame": { "rmsd": 0.006, "origin": [ 20.462, 29.127, 8.787 ], "x_axis": [ -0.909, 0.399, 0.118 ], "y_axis": [ 0.235, 0.259, 0.937 ], "z_axis": [ 0.343, 0.880, -0.330 ], "quaternion": [ 0.071, 0.201, 0.790, 0.575 ] } }, { "index": 17, "index_chain": 17, "chain_name": "E", "nt_resnum": 19, "nt_name": "G", "nt_code": "G", "nt_id": "///E/19", "linked_nts": [ "///E/18", "///E/20" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-pair-contact,hairpin-loop,phosphate,splayed-apart", "alpha": -74.636, "beta": 174.364, "gamma": 61.151, "delta": 87.046, "epsilon": -169.799, "zeta": -129.030, "epsilon_zeta": -40.769, "bb_type": "BI", "chi": -103.279, "glyco_bond": "anti", "C5prime_xyz": [ -1.675, 7.716, -2.635 ], "P_xyz": [ 0.534, 7.110, -3.937 ], "form": ".", "ssZp": 1.606, "Dp": 4.470, "splay_angle": 114.890, "splay_distance": 17.344, "splay_ratio": 0.843, "d22": null, "d64": null, "eta": 164.343, "theta": 122.936, "eta_prime": -178.349, "theta_prime": 105.827, "eta_base": -143.244, "theta_base": 103.680, "v0": 7.548, "v1": -28.894, "v2": 37.982, "v3": -34.695, "v4": 17.247, "amplitude": 38.314, "phase_angle": 7.553, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.006, "frame": { "rmsd": 0.006, "origin": [ 21.268, 35.061, 12.299 ], "x_axis": [ -0.624, 0.027, 0.781 ], "y_axis": [ 0.781, 0.019, 0.624 ], "z_axis": [ 0.002, 0.999, -0.033 ], "quaternion": [ -0.301, 0.312, 0.647, 0.627 ] } }, { "index": 18, "index_chain": 18, "chain_name": "E", "nt_resnum": 20, "nt_name": "U", "nt_code": "U", "nt_id": "///E/20", "linked_nts": [ "///E/19", "///E/21" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-stack,hairpin-loop,splayed-apart", "alpha": -87.449, "beta": 69.732, "gamma": 178.566, "delta": 81.842, "epsilon": -139.543, "zeta": 147.972, "epsilon_zeta": 72.485, "bb_type": "--", "chi": -175.030, "glyco_bond": "anti", "C5prime_xyz": [ -1.314, 8.413, 1.404 ], "P_xyz": [ -2.362, 10.438, 0.125 ], "form": ".", "ssZp": 4.753, "Dp": 4.772, "splay_angle": 93.113, "splay_distance": 12.667, "splay_ratio": 0.726, "d22": null, "d64": null, "eta": -128.031, "theta": 38.928, "eta_prime": -157.680, "theta_prime": 89.896, "eta_base": -156.901, "theta_base": 123.264, "v0": 6.330, "v1": -28.521, "v2": 38.670, "v3": -36.142, "v4": 18.802, "amplitude": 39.218, "phase_angle": 9.583, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1e", "suiteness": 0.010, "filter_rmsd": 0.104, "frame": { "rmsd": 0.003, "origin": [ 38.485, 36.887, 11.267 ], "x_axis": [ 0.122, 0.972, -0.203 ], "y_axis": [ -0.829, 0.212, 0.518 ], "z_axis": [ 0.546, 0.105, 0.831 ], "quaternion": [ 0.736, 0.140, 0.255, 0.612 ] } }, { "index": 19, "index_chain": 19, "chain_name": "E", "nt_resnum": 21, "nt_name": "A", "nt_code": "A", "nt_id": "///E/21", "linked_nts": [ "///E/20", "///E/22" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-canonical,non-pair-contact,hairpin-loop,splayed-apart", "alpha": 147.835, "beta": -118.956, "gamma": 166.748, "delta": 81.830, "epsilon": -122.399, "zeta": -76.619, "epsilon_zeta": -45.780, "bb_type": "--", "chi": -165.105, "glyco_bond": "anti", "C5prime_xyz": [ -1.144, 8.551, 0.858 ], "P_xyz": [ 0.493, 8.935, -1.143 ], "form": ".", "ssZp": 4.469, "Dp": 4.788, "splay_angle": 41.519, "splay_distance": 6.845, "splay_ratio": 0.358, "d22": null, "d64": null, "eta": -157.348, "theta": -163.501, "eta_prime": 179.037, "theta_prime": 176.319, "eta_base": 143.824, "theta_base": 161.048, "v0": 7.457, "v1": -29.184, "v2": 38.775, "v3": -35.526, "v4": 17.826, "amplitude": 39.154, "phase_angle": 7.972, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.037, "frame": { "rmsd": 0.004, "origin": [ 39.103, 27.583, 19.841 ], "x_axis": [ 0.682, 0.294, -0.670 ], "y_axis": [ -0.357, 0.933, 0.046 ], "z_axis": [ 0.638, 0.208, 0.741 ], "quaternion": [ 0.916, -0.044, 0.357, 0.178 ] } }, { "index": 20, "index_chain": 20, "chain_name": "E", "nt_resnum": 22, "nt_name": "G", "nt_code": "G", "nt_id": "///E/22", "linked_nts": [ "///E/21", "///E/23" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,hairpin-loop,phosphate", "alpha": -101.240, "beta": 90.101, "gamma": 146.273, "delta": 86.423, "epsilon": -117.516, "zeta": -85.351, "epsilon_zeta": -32.165, "bb_type": "--", "chi": 152.298, "glyco_bond": "anti", "C5prime_xyz": [ -2.069, 7.495, 2.906 ], "P_xyz": [ -1.152, 9.812, 1.994 ], "form": "A", "ssZp": 4.252, "Dp": 4.615, "splay_angle": 24.987, "splay_distance": 3.981, "splay_ratio": 0.225, "d22": null, "d64": null, "eta": -169.544, "theta": -179.310, "eta_prime": -179.968, "theta_prime": -165.600, "eta_base": 175.116, "theta_base": -145.172, "v0": 6.045, "v1": -26.979, "v2": 36.416, "v3": -34.042, "v4": 17.697, "amplitude": 36.920, "phase_angle": 9.480, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1e", "suiteness": 0.112, "filter_rmsd": 0.006, "frame": { "rmsd": 0.006, "origin": [ 39.499, 24.892, 26.122 ], "x_axis": [ 0.568, -0.090, -0.818 ], "y_axis": [ -0.282, 0.912, -0.296 ], "z_axis": [ 0.773, 0.399, 0.493 ], "quaternion": [ 0.862, -0.202, 0.461, 0.056 ] } }, { "index": 21, "index_chain": 21, "chain_name": "E", "nt_resnum": 23, "nt_name": "C", "nt_code": "C", "nt_id": "///E/23", "linked_nts": [ "///E/22", "///E/24" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet", "alpha": -87.170, "beta": -175.564, "gamma": 59.455, "delta": 84.675, "epsilon": -161.682, "zeta": -71.153, "epsilon_zeta": -90.529, "bb_type": "BI", "chi": -154.231, "glyco_bond": "anti", "C5prime_xyz": [ -1.439, 8.809, 0.186 ], "P_xyz": [ 1.121, 9.335, 0.136 ], "form": "A", "ssZp": 4.346, "Dp": 4.537, "splay_angle": 22.647, "splay_distance": 3.586, "splay_ratio": 0.197, "d22": null, "d64": null, "eta": 153.859, "theta": -150.297, "eta_prime": 169.873, "theta_prime": -151.987, "eta_base": -162.061, "theta_base": -129.002, "v0": 1.171, "v1": -24.701, "v2": 37.432, "v3": -37.683, "v4": 22.990, "amplitude": 39.103, "phase_angle": 16.809, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.304, "filter_rmsd": 0.062, "frame": { "rmsd": 0.003, "origin": [ 42.261, 23.321, 28.520 ], "x_axis": [ 0.400, 0.513, -0.760 ], "y_axis": [ -0.456, 0.830, 0.321 ], "z_axis": [ 0.795, 0.219, 0.566 ], "quaternion": [ 0.836, 0.030, 0.465, 0.290 ] } }, { "index": 22, "index_chain": 22, "chain_name": "E", "nt_resnum": 24, "nt_name": "G", "nt_code": "G", "nt_id": "///E/24", "linked_nts": [ "///E/23", "///E/25" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -79.072, "beta": 177.656, "gamma": 58.597, "delta": 84.420, "epsilon": -165.196, "zeta": -60.369, "epsilon_zeta": -104.827, "bb_type": "BI", "chi": -169.062, "glyco_bond": "anti", "C5prime_xyz": [ -1.497, 8.672, 1.001 ], "P_xyz": [ 1.073, 9.103, 1.345 ], "form": "A", "ssZp": 4.445, "Dp": 4.507, "splay_angle": 21.921, "splay_distance": 3.518, "splay_ratio": 0.197, "d22": null, "d64": null, "eta": 161.249, "theta": -142.153, "eta_prime": 174.814, "theta_prime": -143.024, "eta_base": -144.914, "theta_base": -113.333, "v0": 2.052, "v1": -24.974, "v2": 37.342, "v3": -37.001, "v4": 21.995, "amplitude": 38.760, "phase_angle": 15.545, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.734, "filter_rmsd": 0.006, "frame": { "rmsd": 0.006, "origin": [ 45.726, 23.372, 29.440 ], "x_axis": [ -0.139, 0.758, -0.637 ], "y_axis": [ -0.587, 0.455, 0.669 ], "z_axis": [ 0.798, 0.467, 0.382 ], "quaternion": [ 0.652, 0.078, 0.551, 0.516 ] } }, { "index": 23, "index_chain": 23, "chain_name": "E", "nt_resnum": 25, "nt_name": "C", "nt_code": "C", "nt_id": "///E/25", "linked_nts": [ "///E/24", "///E/26" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop", "alpha": -73.962, "beta": -172.671, "gamma": 52.684, "delta": 81.328, "epsilon": -138.343, "zeta": -69.861, "epsilon_zeta": -68.482, "bb_type": "BI", "chi": -159.143, "glyco_bond": "anti", "C5prime_xyz": [ -1.397, 8.801, 0.530 ], "P_xyz": [ 1.135, 9.280, 0.955 ], "form": "A", "ssZp": 4.413, "Dp": 4.680, "splay_angle": 26.105, "splay_distance": 4.161, "splay_ratio": 0.226, "d22": null, "d64": null, "eta": 172.922, "theta": -134.641, "eta_prime": -175.115, "theta_prime": -129.160, "eta_base": -131.133, "theta_base": -87.038, "v0": 0.172, "v1": -23.503, "v2": 36.858, "v3": -37.681, "v4": 23.563, "amplitude": 38.827, "phase_angle": 18.324, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.716, "filter_rmsd": 0.062, "frame": { "rmsd": 0.005, "origin": [ 48.808, 24.863, 28.632 ], "x_axis": [ -0.416, 0.905, -0.090 ], "y_axis": [ -0.335, -0.061, 0.940 ], "z_axis": [ 0.845, 0.422, 0.329 ], "quaternion": [ 0.461, 0.281, 0.507, 0.672 ] } }, { "index": 24, "index_chain": 24, "chain_name": "E", "nt_resnum": 26, "nt_name": "A", "nt_code": "A", "nt_id": "///E/26", "linked_nts": [ "///E/25", "///E/27" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,junction-loop,phosphate", "alpha": -65.048, "beta": 162.712, "gamma": 60.432, "delta": 86.315, "epsilon": -150.268, "zeta": -60.330, "epsilon_zeta": -89.937, "bb_type": "BI", "chi": -166.009, "glyco_bond": "anti", "C5prime_xyz": [ -1.776, 8.698, 0.839 ], "P_xyz": [ 0.781, 9.244, 0.883 ], "form": ".", "ssZp": 4.393, "Dp": 4.463, "splay_angle": 33.009, "splay_distance": 5.135, "splay_ratio": 0.285, "d22": null, "d64": null, "eta": 164.677, "theta": -127.571, "eta_prime": -172.406, "theta_prime": -128.220, "eta_base": -112.974, "theta_base": -82.583, "v0": -1.316, "v1": -22.228, "v2": 36.042, "v3": -37.804, "v4": 24.544, "amplitude": 38.474, "phase_angle": 20.483, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.817, "filter_rmsd": 0.037, "frame": { "rmsd": 0.004, "origin": [ 50.077, 28.752, 29.396 ], "x_axis": [ -0.761, 0.461, 0.456 ], "y_axis": [ 0.104, -0.607, 0.788 ], "z_axis": [ 0.641, 0.647, 0.414 ], "quaternion": [ 0.107, 0.329, 0.430, 0.834 ] } }, { "index": 25, "index_chain": 25, "chain_name": "E", "nt_resnum": 27, "nt_name": "G", "nt_code": "G", "nt_id": "///E/27", "linked_nts": [ "///E/26", "///E/28" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop,phosphate", "alpha": -68.254, "beta": -174.224, "gamma": 45.893, "delta": 84.814, "epsilon": -152.544, "zeta": -68.980, "epsilon_zeta": -83.564, "bb_type": "BI", "chi": -163.144, "glyco_bond": "anti", "C5prime_xyz": [ -1.096, 8.716, 0.715 ], "P_xyz": [ 1.349, 8.914, 1.671 ], "form": "A", "ssZp": 4.301, "Dp": 4.489, "splay_angle": 18.699, "splay_distance": 3.014, "splay_ratio": 0.163, "d22": null, "d64": null, "eta": 167.677, "theta": -142.926, "eta_prime": -172.647, "theta_prime": -140.387, "eta_base": -108.284, "theta_base": -116.664, "v0": 3.133, "v1": -25.385, "v2": 37.018, "v3": -36.068, "v4": 20.856, "amplitude": 38.151, "phase_angle": 14.000, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.777, "filter_rmsd": 0.008, "frame": { "rmsd": 0.008, "origin": [ 50.240, 32.366, 33.041 ], "x_axis": [ -0.496, -0.449, 0.743 ], "y_axis": [ 0.651, -0.758, -0.023 ], "z_axis": [ 0.574, 0.473, 0.669 ], "quaternion": [ -0.322, 0.385, 0.131, 0.855 ] } }, { "index": 26, "index_chain": 26, "chain_name": "E", "nt_resnum": 28, "nt_name": "C", "nt_code": "C", "nt_id": "///E/28", "linked_nts": [ "///E/27", "///E/29" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -63.734, "beta": 177.087, "gamma": 42.965, "delta": 81.482, "epsilon": -151.966, "zeta": -63.099, "epsilon_zeta": -88.868, "bb_type": "BI", "chi": -143.481, "glyco_bond": "anti", "C5prime_xyz": [ -1.404, 8.748, -0.397 ], "P_xyz": [ 1.149, 9.281, -0.637 ], "form": "A", "ssZp": 3.920, "Dp": 4.644, "splay_angle": 27.792, "splay_distance": 4.505, "splay_ratio": 0.241, "d22": null, "d64": null, "eta": 162.960, "theta": -140.637, "eta_prime": 176.775, "theta_prime": -137.622, "eta_base": -146.582, "theta_base": -111.941, "v0": 2.088, "v1": -25.898, "v2": 38.682, "v3": -38.392, "v4": 22.846, "amplitude": 40.162, "phase_angle": 15.606, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.780, "filter_rmsd": 0.060, "frame": { "rmsd": 0.009, "origin": [ 50.886, 34.391, 35.178 ], "x_axis": [ -0.062, -0.704, 0.708 ], "y_axis": [ 0.919, -0.317, -0.235 ], "z_axis": [ 0.390, 0.636, 0.666 ], "quaternion": [ 0.567, -0.384, -0.140, -0.715 ] } }, { "index": 27, "index_chain": 27, "chain_name": "E", "nt_resnum": 29, "nt_name": "A", "nt_code": "A", "nt_id": "///E/29", "linked_nts": [ "///E/28", "///E/30" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -64.941, "beta": 178.500, "gamma": 50.858, "delta": 81.194, "epsilon": -155.721, "zeta": -80.481, "epsilon_zeta": -75.240, "bb_type": "BI", "chi": -160.736, "glyco_bond": "anti", "C5prime_xyz": [ -1.827, 8.679, 0.547 ], "P_xyz": [ 0.610, 9.497, 0.842 ], "form": "A", "ssZp": 4.411, "Dp": 4.580, "splay_angle": 23.997, "splay_distance": 3.807, "splay_ratio": 0.211, "d22": null, "d64": null, "eta": 168.115, "theta": -159.586, "eta_prime": -175.471, "theta_prime": -160.766, "eta_base": -135.573, "theta_base": -143.132, "v0": -0.769, "v1": -23.614, "v2": 37.752, "v3": -39.259, "v4": 25.230, "amplitude": 40.104, "phase_angle": 19.718, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.937, "filter_rmsd": 0.037, "frame": { "rmsd": 0.011, "origin": [ 51.720, 35.038, 39.558 ], "x_axis": [ 0.203, -0.972, 0.119 ], "y_axis": [ 0.801, 0.095, -0.591 ], "z_axis": [ 0.563, 0.216, 0.798 ], "quaternion": [ 0.724, -0.279, 0.153, -0.612 ] } }, { "index": 28, "index_chain": 28, "chain_name": "E", "nt_resnum": 30, "nt_name": "G", "nt_code": "G", "nt_id": "///E/30", "linked_nts": [ "///E/29", "///E/31" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -62.274, "beta": 175.301, "gamma": 46.038, "delta": 84.494, "epsilon": -161.416, "zeta": -60.933, "epsilon_zeta": -100.484, "bb_type": "BI", "chi": -171.669, "glyco_bond": "anti", "C5prime_xyz": [ -1.383, 8.583, 1.257 ], "P_xyz": [ 1.148, 9.096, 1.842 ], "form": "A", "ssZp": 4.632, "Dp": 4.520, "splay_angle": 26.639, "splay_distance": 4.254, "splay_ratio": 0.238, "d22": null, "d64": null, "eta": 165.164, "theta": -143.657, "eta_prime": 172.219, "theta_prime": -139.734, "eta_base": -157.757, "theta_base": -115.996, "v0": 6.662, "v1": -28.175, "v2": 37.696, "v3": -34.768, "v4": 17.889, "amplitude": 38.138, "phase_angle": 8.732, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.834, "filter_rmsd": 0.022, "frame": { "rmsd": 0.022, "origin": [ 51.994, 35.706, 43.296 ], "x_axis": [ 0.367, -0.847, -0.384 ], "y_axis": [ 0.593, 0.531, -0.605 ], "z_axis": [ 0.717, -0.006, 0.697 ], "quaternion": [ 0.805, -0.186, 0.342, -0.447 ] } }, { "index": 29, "index_chain": 29, "chain_name": "E", "nt_resnum": 31, "nt_name": "A", "nt_code": "A", "nt_id": "///E/31", "linked_nts": [ "///E/30", "///E/32" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop,phosphate", "alpha": -67.663, "beta": -175.021, "gamma": 55.350, "delta": 82.826, "epsilon": -147.865, "zeta": -71.497, "epsilon_zeta": -76.369, "bb_type": "BI", "chi": -166.280, "glyco_bond": "anti", "C5prime_xyz": [ -1.975, 8.684, 0.860 ], "P_xyz": [ 0.407, 9.323, 1.698 ], "form": ".", "ssZp": 4.341, "Dp": 4.470, "splay_angle": 21.347, "splay_distance": 3.345, "splay_ratio": 0.185, "d22": null, "d64": null, "eta": 178.821, "theta": -140.736, "eta_prime": -164.211, "theta_prime": -129.145, "eta_base": -127.709, "theta_base": -82.086, "v0": -1.504, "v1": -21.709, "v2": 35.582, "v3": -37.338, "v4": 24.541, "amplitude": 38.071, "phase_angle": 20.834, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.809, "filter_rmsd": 0.037, "frame": { "rmsd": 0.007, "origin": [ 53.654, 33.608, 46.603 ], "x_axis": [ 0.616, -0.453, -0.645 ], "y_axis": [ 0.275, 0.890, -0.363 ], "z_axis": [ 0.738, 0.046, 0.673 ], "quaternion": [ 0.891, -0.115, 0.388, -0.204 ] } }, { "index": 30, "index_chain": 30, "chain_name": "E", "nt_resnum": 32, "nt_name": "U", "nt_code": "U", "nt_id": "///E/32", "linked_nts": [ "///E/31", "///E/33" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C2'-endo,non-canonical,non-pair-contact,helix-end,hairpin-loop,phosphate,splayed-apart", "alpha": -42.841, "beta": 178.721, "gamma": 45.828, "delta": 97.893, "epsilon": 72.542, "zeta": 122.619, "epsilon_zeta": -50.077, "bb_type": "--", "chi": -108.878, "glyco_bond": "anti", "C5prime_xyz": [ -2.031, 8.241, -1.438 ], "P_xyz": [ 0.382, 9.015, -0.922 ], "form": ".", "ssZp": 0.861, "Dp": 0.603, "splay_angle": 115.991, "splay_distance": 16.498, "splay_ratio": 0.848, "d22": 9.192, "d64": 10.540, "eta": -164.677, "theta": -29.369, "eta_prime": -127.491, "theta_prime": -63.773, "eta_base": -80.962, "theta_base": -40.416, "v0": -6.457, "v1": 18.029, "v2": -22.916, "v3": 20.061, "v4": -8.409, "amplitude": 22.952, "phase_angle": 183.234, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.230, "filter_rmsd": 0.105, "frame": { "rmsd": 0.012, "origin": [ 56.902, 32.932, 47.026 ], "x_axis": [ 0.558, 0.289, -0.778 ], "y_axis": [ 0.010, 0.935, 0.355 ], "z_axis": [ 0.830, -0.206, 0.519 ], "quaternion": [ 0.868, 0.162, 0.463, 0.081 ] } }, { "index": 31, "index_chain": 31, "chain_name": "E", "nt_resnum": 33, "nt_name": "U", "nt_code": "U", "nt_id": "///E/33", "linked_nts": [ "///E/32", "///E/34" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,anti,~C2'-endo,non-pair-contact,hairpin-loop,phosphate,splayed-apart", "alpha": 15.242, "beta": 145.530, "gamma": -42.975, "delta": 109.563, "epsilon": 74.794, "zeta": -140.069, "epsilon_zeta": -145.137, "bb_type": "--", "chi": -108.902, "glyco_bond": "anti", "C5prime_xyz": [ -1.089, 7.820, -1.755 ], "P_xyz": [ 0.826, 9.437, -0.950 ], "form": ".", "ssZp": 0.480, "Dp": 1.127, "splay_angle": 159.225, "splay_distance": 19.274, "splay_ratio": 0.984, "d22": null, "d64": null, "eta": 179.888, "theta": 50.919, "eta_prime": -128.308, "theta_prime": 34.330, "eta_base": -127.300, "theta_base": 175.098, "v0": 3.564, "v1": 10.260, "v2": -19.994, "v3": 22.417, "v4": -16.007, "amplitude": 22.496, "phase_angle": 207.276, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.009, "origin": [ 59.927, 45.892, 56.777 ], "x_axis": [ -0.337, 0.356, -0.872 ], "y_axis": [ -0.631, -0.772, -0.072 ], "z_axis": [ -0.699, 0.526, 0.485 ], "quaternion": [ 0.307, -0.487, 0.141, 0.805 ] } }, { "index": 32, "index_chain": 32, "chain_name": "E", "nt_resnum": 34, "nt_name": "G", "nt_code": "G", "nt_id": "///E/34", "linked_nts": [ "///E/33", "///E/35" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C2'-endo,non-pair-contact,hairpin-loop,phosphate,splayed-apart", "alpha": -37.350, "beta": 151.511, "gamma": 168.572, "delta": 110.837, "epsilon": 63.233, "zeta": 84.964, "epsilon_zeta": -21.731, "bb_type": "--", "chi": -144.781, "glyco_bond": "anti", "C5prime_xyz": [ -0.860, 8.298, 0.273 ], "P_xyz": [ 1.059, 9.478, -1.059 ], "form": ".", "ssZp": 0.668, "Dp": 0.931, "splay_angle": 98.010, "splay_distance": 14.121, "splay_ratio": 0.756, "d22": null, "d64": null, "eta": -11.810, "theta": 150.671, "eta_prime": -21.520, "theta_prime": -172.753, "eta_base": -159.778, "theta_base": -134.779, "v0": 4.040, "v1": 9.426, "v2": -18.847, "v3": 21.801, "v4": -15.895, "amplitude": 21.574, "phase_angle": 209.119, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.009, "frame": { "rmsd": 0.009, "origin": [ 54.116, 30.959, 67.490 ], "x_axis": [ 0.103, 0.758, 0.645 ], "y_axis": [ 0.071, 0.641, -0.764 ], "z_axis": [ -0.992, 0.124, 0.012 ], "quaternion": [ 0.662, -0.335, -0.618, 0.259 ] } }, { "index": 33, "index_chain": 33, "chain_name": "E", "nt_resnum": 35, "nt_name": "C", "nt_code": "C", "nt_id": "///E/35", "linked_nts": [ "///E/34", "///E/36" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C2'-endo,non-pair-contact,hairpin-loop,phosphate,splayed-apart", "alpha": -128.019, "beta": -140.618, "gamma": 68.777, "delta": 133.586, "epsilon": -83.261, "zeta": -93.367, "epsilon_zeta": 10.106, "bb_type": "--", "chi": -136.672, "glyco_bond": "anti", "C5prime_xyz": [ -1.493, 8.623, -0.051 ], "P_xyz": [ 0.474, 8.575, 1.673 ], "form": ".", "ssZp": 1.313, "Dp": 1.555, "splay_angle": 80.303, "splay_distance": 12.332, "splay_ratio": 0.651, "d22": null, "d64": null, "eta": -111.322, "theta": -56.072, "eta_prime": -99.804, "theta_prime": -67.168, "eta_base": -100.792, "theta_base": -35.983, "v0": -6.325, "v1": 18.256, "v2": -22.886, "v3": 20.133, "v4": -8.610, "amplitude": 22.926, "phase_angle": 183.382, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.062, "frame": { "rmsd": 0.009, "origin": [ 45.462, 28.881, 56.526 ], "x_axis": [ -0.349, 0.850, 0.395 ], "y_axis": [ 0.927, 0.250, 0.281 ], "z_axis": [ 0.140, 0.464, -0.875 ], "quaternion": [ -0.081, 0.565, 0.786, 0.237 ] } }, { "index": 34, "index_chain": 34, "chain_name": "E", "nt_resnum": 36, "nt_name": "A", "nt_code": "A", "nt_id": "///E/36", "linked_nts": [ "///E/35", "///E/37" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C2'-endo,non-pair-contact,hairpin-loop,cap-donor,phosphate,splayed-apart", "alpha": -81.337, "beta": -170.809, "gamma": 52.410, "delta": 128.171, "epsilon": -29.000, "zeta": 85.238, "epsilon_zeta": 245.762, "bb_type": "--", "chi": -166.010, "glyco_bond": "anti", "C5prime_xyz": [ -1.747, 8.220, 1.417 ], "P_xyz": [ -0.086, 7.638, 3.379 ], "form": ".", "ssZp": 0.845, "Dp": 1.225, "splay_angle": 168.011, "splay_distance": 18.328, "splay_ratio": 0.995, "d22": null, "d64": null, "eta": 175.812, "theta": 142.630, "eta_prime": -144.434, "theta_prime": 99.928, "eta_base": -127.297, "theta_base": -161.588, "v0": -4.260, "v1": 15.536, "v2": -20.458, "v3": 18.867, "v4": -9.029, "amplitude": 20.627, "phase_angle": 187.332, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "2[", "suiteness": 0.060, "filter_rmsd": 0.038, "frame": { "rmsd": 0.006, "origin": [ 55.655, 35.159, 53.566 ], "x_axis": [ -0.825, 0.137, 0.549 ], "y_axis": [ -0.213, -0.974, -0.077 ], "z_axis": [ 0.524, -0.180, 0.832 ], "quaternion": [ 0.092, 0.281, -0.068, 0.953 ] } }, { "index": 35, "index_chain": 35, "chain_name": "E", "nt_resnum": 37, "nt_name": "6IA", "nt_code": "a", "is_modified": true, "nt_id": "///E/37", "linked_nts": [ "///E/36", "///E/38" ], "nt_type": "RNA", "dbn": ".", "summary": "modified,turn,~C2'-endo,non-pair-contact,hairpin-loop,phosphate,splayed-apart", "alpha": 132.941, "beta": 119.077, "gamma": -11.773, "delta": 113.073, "epsilon": 59.501, "zeta": 162.285, "epsilon_zeta": -102.784, "bb_type": "--", "chi": -80.721, "glyco_bond": "--", "C5prime_xyz": [ -1.777, 6.885, -2.883 ], "P_xyz": [ 0.490, 7.931, -2.086 ], "form": ".", "ssZp": -0.546, "Dp": 0.786, "splay_angle": 124.005, "splay_distance": 16.422, "splay_ratio": 0.883, "d22": null, "d64": null, "eta": -18.791, "theta": -9.263, "eta_prime": 6.668, "theta_prime": -41.853, "eta_base": -104.799, "theta_base": 12.141, "v0": 2.754, "v1": 10.622, "v2": -19.663, "v3": 21.779, "v4": -15.191, "amplitude": 21.819, "phase_angle": 205.682, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.036, "frame": { "rmsd": 0.011, "origin": [ 62.777, 19.608, 46.983 ], "x_axis": [ 0.666, 0.060, 0.743 ], "y_axis": [ -0.622, 0.595, 0.509 ], "z_axis": [ -0.412, -0.801, 0.434 ], "quaternion": [ 0.821, 0.399, -0.352, 0.208 ] } }, { "index": 36, "index_chain": 36, "chain_name": "E", "nt_resnum": 38, "nt_name": "A", "nt_code": "A", "nt_id": "///E/38", "linked_nts": [ "///E/37", "///E/39" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,hairpin-loop,cap-acceptor,phosphate,splayed-apart", "alpha": -70.541, "beta": 122.523, "gamma": 56.978, "delta": 81.739, "epsilon": -142.746, "zeta": -60.792, "epsilon_zeta": -81.954, "bb_type": "BI", "chi": 179.733, "glyco_bond": "anti", "C5prime_xyz": [ -1.895, 8.453, 1.725 ], "P_xyz": [ 0.670, 8.604, 1.356 ], "form": ".", "ssZp": 4.675, "Dp": 4.593, "splay_angle": 27.911, "splay_distance": 4.400, "splay_ratio": 0.247, "d22": null, "d64": null, "eta": 150.566, "theta": -118.393, "eta_prime": -155.905, "theta_prime": -123.822, "eta_base": -160.960, "theta_base": -79.945, "v0": -1.323, "v1": -22.950, "v2": 37.551, "v3": -39.048, "v4": 25.301, "amplitude": 40.034, "phase_angle": 20.287, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.041, "frame": { "rmsd": 0.009, "origin": [ 53.128, 32.369, 50.686 ], "x_axis": [ 0.719, 0.322, -0.616 ], "y_axis": [ 0.184, -0.943, -0.279 ], "z_axis": [ -0.670, 0.088, -0.737 ], "quaternion": [ -0.099, 0.922, 0.137, -0.349 ] } }, { "index": 37, "index_chain": 37, "chain_name": "E", "nt_resnum": 39, "nt_name": "U", "nt_code": "U", "nt_id": "///E/39", "linked_nts": [ "///E/38", "///E/40" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop", "alpha": -64.011, "beta": -177.459, "gamma": 43.699, "delta": 81.410, "epsilon": -159.453, "zeta": -72.705, "epsilon_zeta": -86.749, "bb_type": "BI", "chi": -155.183, "glyco_bond": "anti", "C5prime_xyz": [ -1.381, 8.783, 0.335 ], "P_xyz": [ 1.125, 9.289, 0.833 ], "form": "A", "ssZp": 4.350, "Dp": 4.508, "splay_angle": 21.580, "splay_distance": 3.476, "splay_ratio": 0.189, "d22": 4.222, "d64": 4.592, "eta": 161.824, "theta": -152.857, "eta_prime": -176.574, "theta_prime": -150.886, "eta_base": -104.786, "theta_base": -131.600, "v0": 0.150, "v1": -24.595, "v2": 38.819, "v3": -39.311, "v4": 24.608, "amplitude": 40.852, "phase_angle": 18.154, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.774, "filter_rmsd": 0.107, "frame": { "rmsd": 0.008, "origin": [ 53.481, 33.767, 46.529 ], "x_axis": [ 0.545, -0.592, -0.594 ], "y_axis": [ -0.550, -0.787, 0.279 ], "z_axis": [ -0.632, 0.174, -0.755 ], "quaternion": [ 0.030, 0.878, -0.325, -0.349 ] } }, { "index": 38, "index_chain": 38, "chain_name": "E", "nt_resnum": 40, "nt_name": "C", "nt_code": "C", "nt_id": "///E/40", "linked_nts": [ "///E/39", "///E/41" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -60.145, "beta": 170.235, "gamma": 52.555, "delta": 81.968, "epsilon": -150.293, "zeta": -78.204, "epsilon_zeta": -72.090, "bb_type": "BI", "chi": -158.184, "glyco_bond": "anti", "C5prime_xyz": [ -1.653, 8.777, 0.512 ], "P_xyz": [ 0.886, 9.392, 0.430 ], "form": "A", "ssZp": 4.450, "Dp": 4.586, "splay_angle": 23.117, "splay_distance": 3.663, "splay_ratio": 0.201, "d22": 4.142, "d64": 4.013, "eta": 171.297, "theta": -148.888, "eta_prime": -177.054, "theta_prime": -147.693, "eta_base": -146.497, "theta_base": -118.366, "v0": -2.315, "v1": -21.752, "v2": 36.363, "v3": -38.637, "v4": 25.758, "amplitude": 39.187, "phase_angle": 21.887, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.900, "filter_rmsd": 0.062, "frame": { "rmsd": 0.009, "origin": [ 52.577, 35.294, 43.540 ], "x_axis": [ 0.294, -0.868, -0.401 ], "y_axis": [ -0.779, -0.460, 0.425 ], "z_axis": [ -0.554, 0.187, -0.811 ], "quaternion": [ 0.074, 0.801, -0.514, -0.298 ] } }, { "index": 39, "index_chain": 39, "chain_name": "E", "nt_resnum": 41, "nt_name": "U", "nt_code": "U", "nt_id": "///E/41", "linked_nts": [ "///E/40", "///E/42" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -53.594, "beta": 173.697, "gamma": 42.453, "delta": 81.429, "epsilon": -154.166, "zeta": -78.194, "epsilon_zeta": -75.972, "bb_type": "BI", "chi": -154.265, "glyco_bond": "anti", "C5prime_xyz": [ -1.373, 8.725, 0.225 ], "P_xyz": [ 1.193, 9.195, 0.429 ], "form": "A", "ssZp": 4.346, "Dp": 4.650, "splay_angle": 27.717, "splay_distance": 4.393, "splay_ratio": 0.240, "d22": null, "d64": null, "eta": 169.341, "theta": -154.853, "eta_prime": 179.995, "theta_prime": -153.501, "eta_base": -138.522, "theta_base": -136.294, "v0": 3.369, "v1": -26.236, "v2": 37.696, "v3": -36.985, "v4": 21.283, "amplitude": 38.830, "phase_angle": 13.878, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.715, "filter_rmsd": 0.106, "frame": { "rmsd": 0.007, "origin": [ 52.000, 35.121, 39.927 ], "x_axis": [ -0.090, -0.992, 0.084 ], "y_axis": [ -0.870, 0.119, 0.479 ], "z_axis": [ -0.486, -0.030, -0.874 ], "quaternion": [ -0.197, -0.645, 0.722, 0.156 ] } }, { "index": 40, "index_chain": 40, "chain_name": "E", "nt_resnum": 42, "nt_name": "G", "nt_code": "G", "nt_id": "///E/42", "linked_nts": [ "///E/41", "///E/43" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -55.660, "beta": 167.080, "gamma": 55.059, "delta": 84.235, "epsilon": -155.877, "zeta": -60.995, "epsilon_zeta": -94.882, "bb_type": "BI", "chi": -163.714, "glyco_bond": "anti", "C5prime_xyz": [ -1.423, 8.696, 0.733 ], "P_xyz": [ 1.132, 9.231, 0.637 ], "form": "A", "ssZp": 4.522, "Dp": 4.599, "splay_angle": 20.919, "splay_distance": 3.337, "splay_ratio": 0.185, "d22": null, "d64": null, "eta": 174.826, "theta": -137.403, "eta_prime": -172.896, "theta_prime": -136.918, "eta_base": -143.771, "theta_base": -97.947, "v0": 5.074, "v1": -27.822, "v2": 38.575, "v3": -36.673, "v4": 20.064, "amplitude": 39.345, "phase_angle": 11.355, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.873, "filter_rmsd": 0.008, "frame": { "rmsd": 0.008, "origin": [ 51.279, 34.624, 35.622 ], "x_axis": [ -0.398, -0.858, 0.324 ], "y_axis": [ -0.742, 0.509, 0.437 ], "z_axis": [ -0.540, -0.066, -0.839 ], "quaternion": [ -0.261, -0.483, 0.828, 0.112 ] } }, { "index": 41, "index_chain": 41, "chain_name": "E", "nt_resnum": 43, "nt_name": "U", "nt_code": "U", "nt_id": "///E/43", "linked_nts": [ "///E/42", "///E/44" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop,phosphate", "alpha": -77.782, "beta": 178.467, "gamma": 62.190, "delta": 84.602, "epsilon": -171.374, "zeta": -88.313, "epsilon_zeta": -83.061, "bb_type": "BI", "chi": -151.027, "glyco_bond": "anti", "C5prime_xyz": [ -1.642, 8.742, -0.078 ], "P_xyz": [ 0.929, 9.294, -0.291 ], "form": ".", "ssZp": 4.122, "Dp": 4.379, "splay_angle": 43.512, "splay_distance": 6.823, "splay_ratio": 0.371, "d22": 5.835, "d64": 6.817, "eta": 164.214, "theta": -173.395, "eta_prime": -171.887, "theta_prime": -176.623, "eta_base": -113.042, "theta_base": -168.728, "v0": 2.861, "v1": -24.969, "v2": 36.117, "v3": -35.559, "v4": 20.644, "amplitude": 37.275, "phase_angle": 14.319, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.724, "filter_rmsd": 0.104, "frame": { "rmsd": 0.012, "origin": [ 49.665, 32.258, 33.911 ], "x_axis": [ -0.786, -0.337, 0.519 ], "y_axis": [ -0.440, 0.894, -0.086 ], "z_axis": [ -0.435, -0.296, -0.850 ], "quaternion": [ -0.254, -0.207, 0.939, -0.102 ] } }, { "index": 42, "index_chain": 42, "chain_name": "E", "nt_resnum": 44, "nt_name": "U", "nt_code": "U", "nt_id": "///E/44", "linked_nts": [ "///E/43", "///E/45" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-canonical,non-pair-contact,helix,junction-loop,phosphate", "alpha": -53.489, "beta": -178.919, "gamma": 50.172, "delta": 86.718, "epsilon": -154.817, "zeta": -8.485, "epsilon_zeta": -146.332, "bb_type": "--", "chi": -173.571, "glyco_bond": "anti", "C5prime_xyz": [ -1.755, 8.569, 1.296 ], "P_xyz": [ 0.587, 9.100, 2.303 ], "form": ".", "ssZp": 4.427, "Dp": 4.444, "splay_angle": 33.936, "splay_distance": 4.914, "splay_ratio": 0.294, "d22": null, "d64": null, "eta": -173.466, "theta": -102.657, "eta_prime": -174.756, "theta_prime": -122.589, "eta_base": -166.128, "theta_base": -49.493, "v0": -1.120, "v1": -21.985, "v2": 35.206, "v3": -37.080, "v4": 23.980, "amplitude": 37.551, "phase_angle": 20.353, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "&a", "suiteness": 0.837, "filter_rmsd": 0.101, "frame": { "rmsd": 0.009, "origin": [ 50.866, 29.987, 27.590 ], "x_axis": [ -0.692, -0.265, 0.671 ], "y_axis": [ -0.180, 0.964, 0.194 ], "z_axis": [ -0.699, 0.013, -0.715 ], "quaternion": [ -0.373, -0.121, 0.918, 0.056 ] } }, { "index": 43, "index_chain": 43, "chain_name": "E", "nt_resnum": 45, "nt_name": "G", "nt_code": "G", "nt_id": "///E/45", "linked_nts": [ "///E/44", "///E/46" ], "nt_type": "RNA", "dbn": ".", "summary": "syn,~C3'-endo,non-pair-contact,junction-loop,phosphate", "alpha": -159.022, "beta": 95.341, "gamma": 172.272, "delta": 87.508, "epsilon": -113.313, "zeta": -49.457, "epsilon_zeta": -63.856, "bb_type": "--", "chi": -7.911, "glyco_bond": "syn", "C5prime_xyz": [ -4.956, 3.782, -1.962 ], "P_xyz": [ -7.307, 3.296, -0.939 ], "form": ".", "ssZp": -4.544, "Dp": 4.601, "splay_angle": 52.601, "splay_distance": 7.849, "splay_ratio": 0.443, "d22": null, "d64": null, "eta": 170.428, "theta": -159.507, "eta_prime": 178.168, "theta_prime": -140.999, "eta_base": -89.164, "theta_base": -128.365, "v0": 1.827, "v1": -24.643, "v2": 36.625, "v3": -36.772, "v4": 22.092, "amplitude": 38.108, "phase_angle": 16.034, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.006, "frame": { "rmsd": 0.006, "origin": [ 46.248, 31.626, 27.956 ], "x_axis": [ -0.274, -0.924, 0.268 ], "y_axis": [ 0.564, -0.380, -0.733 ], "z_axis": [ 0.779, -0.049, 0.625 ], "quaternion": [ -0.493, 0.347, -0.259, 0.755 ] } }, { "index": 44, "index_chain": 44, "chain_name": "E", "nt_resnum": 46, "nt_name": "G", "nt_code": "G", "nt_id": "///E/46", "linked_nts": [ "///E/45", "///E/47" ], "nt_type": "RNA", "dbn": ".", "summary": "~C3'-endo,non-canonical,non-pair-contact,multiplet,junction-loop", "alpha": -49.242, "beta": -142.118, "gamma": 49.656, "delta": 85.756, "epsilon": -179.317, "zeta": 35.284, "epsilon_zeta": 145.399, "bb_type": "--", "chi": -80.168, "glyco_bond": "--", "C5prime_xyz": [ -2.844, 6.933, -3.167 ], "P_xyz": [ -0.684, 7.489, -4.553 ], "form": ".", "ssZp": 0.271, "Dp": 4.202, "splay_angle": 48.655, "splay_distance": 8.831, "splay_ratio": 0.414, "d22": null, "d64": null, "eta": -161.081, "theta": -91.502, "eta_prime": -133.903, "theta_prime": -103.444, "eta_base": -142.060, "theta_base": -105.678, "v0": 1.275, "v1": -23.223, "v2": 34.687, "v3": -35.252, "v4": 21.478, "amplitude": 36.234, "phase_angle": 16.800, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1m", "suiteness": 0.345, "filter_rmsd": 0.005, "frame": { "rmsd": 0.005, "origin": [ 39.987, 30.942, 23.271 ], "x_axis": [ -0.463, 0.856, -0.230 ], "y_axis": [ 0.527, 0.056, -0.848 ], "z_axis": [ -0.713, -0.514, -0.477 ], "quaternion": [ -0.171, 0.489, 0.706, -0.482 ] } }, { "index": 45, "index_chain": 45, "chain_name": "E", "nt_resnum": 47, "nt_name": "U", "nt_code": "U", "nt_id": "///E/47", "linked_nts": [ "///E/46", "///E/48" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,anti,~C3'-endo,BI,non-stack,non-canonical,non-pair-contact,junction-loop,phosphate", "alpha": -145.347, "beta": 81.177, "gamma": -156.974, "delta": 82.405, "epsilon": 171.884, "zeta": -84.309, "epsilon_zeta": -103.806, "bb_type": "BI", "chi": -146.693, "glyco_bond": "anti", "C5prime_xyz": [ -1.493, 8.790, -0.240 ], "P_xyz": [ -3.073, 10.699, -1.067 ], "form": ".", "ssZp": 3.972, "Dp": 4.186, "splay_angle": 55.535, "splay_distance": 8.926, "splay_ratio": 0.467, "d22": 7.309, "d64": 8.518, "eta": -130.010, "theta": 79.226, "eta_prime": -120.868, "theta_prime": 101.784, "eta_base": -115.594, "theta_base": 102.450, "v0": 2.036, "v1": -24.639, "v2": 36.467, "v3": -36.356, "v4": 21.775, "amplitude": 37.872, "phase_angle": 15.657, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.105, "frame": { "rmsd": 0.007, "origin": [ 36.354, 35.518, 16.650 ], "x_axis": [ 0.109, 0.860, -0.498 ], "y_axis": [ 0.873, -0.322, -0.367 ], "z_axis": [ -0.476, -0.395, -0.786 ], "quaternion": [ 0.009, 0.744, 0.582, -0.327 ] } }, { "index": 46, "index_chain": 46, "chain_name": "E", "nt_resnum": 48, "nt_name": "C", "nt_code": "C", "nt_id": "///E/48", "linked_nts": [ "///E/47", "///E/49" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C2'-endo,non-canonical,non-pair-contact,helix,multiplet,junction-loop,cap-acceptor,splayed-apart", "alpha": -131.650, "beta": 117.375, "gamma": 160.747, "delta": 124.552, "epsilon": -135.239, "zeta": 175.994, "epsilon_zeta": 48.767, "bb_type": "--", "chi": -153.032, "glyco_bond": "anti", "C5prime_xyz": [ -1.137, 8.345, 0.786 ], "P_xyz": [ 0.462, 9.837, -0.679 ], "form": ".", "ssZp": 2.690, "Dp": 2.815, "splay_angle": 146.202, "splay_distance": 17.719, "splay_ratio": 0.957, "d22": 11.414, "d64": 13.725, "eta": -147.200, "theta": 72.952, "eta_prime": -166.362, "theta_prime": 82.867, "eta_base": 172.685, "theta_base": -135.879, "v0": -0.983, "v1": 13.813, "v2": -20.884, "v3": 21.159, "v4": -12.594, "amplitude": 21.774, "phase_angle": 196.434, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "32t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.002, "origin": [ 34.657, 27.425, 20.011 ], "x_axis": [ -0.406, 0.879, -0.249 ], "y_axis": [ 0.595, 0.048, -0.802 ], "z_axis": [ -0.693, -0.474, -0.542 ], "quaternion": [ -0.157, 0.522, 0.706, -0.452 ] } }, { "index": 47, "index_chain": 47, "chain_name": "E", "nt_resnum": 49, "nt_name": "C", "nt_code": "C", "nt_id": "///E/49", "linked_nts": [ "///E/48", "///E/50" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop,phosphate,splayed-apart", "alpha": -31.343, "beta": -133.096, "gamma": 64.064, "delta": 86.683, "epsilon": -141.117, "zeta": -66.531, "epsilon_zeta": -74.587, "bb_type": "BI", "chi": -174.453, "glyco_bond": "anti", "C5prime_xyz": [ -1.169, 8.436, 1.369 ], "P_xyz": [ 1.101, 7.912, 2.591 ], "form": "A", "ssZp": 4.692, "Dp": 4.706, "splay_angle": 24.805, "splay_distance": 3.901, "splay_ratio": 0.217, "d22": 4.234, "d64": 3.961, "eta": -65.803, "theta": -123.392, "eta_prime": -81.043, "theta_prime": -120.947, "eta_base": 149.654, "theta_base": -91.039, "v0": 6.825, "v1": -28.610, "v2": 38.104, "v3": -35.320, "v4": 18.070, "amplitude": 38.548, "phase_angle": 8.705, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.001, "origin": [ 39.627, 15.296, 8.089 ], "x_axis": [ -0.937, -0.077, 0.340 ], "y_axis": [ 0.238, 0.573, 0.785 ], "z_axis": [ -0.255, 0.816, -0.518 ], "quaternion": [ -0.171, 0.046, 0.870, 0.460 ] } }, { "index": 48, "index_chain": 48, "chain_name": "E", "nt_resnum": 50, "nt_name": "U", "nt_code": "U", "nt_id": "///E/50", "linked_nts": [ "///E/49", "///E/51" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop", "alpha": -79.158, "beta": -173.504, "gamma": 51.794, "delta": 82.666, "epsilon": -156.847, "zeta": -71.954, "epsilon_zeta": -84.893, "bb_type": "BI", "chi": -162.034, "glyco_bond": "anti", "C5prime_xyz": [ -1.379, 8.693, 0.656 ], "P_xyz": [ 1.163, 9.128, 1.199 ], "form": "A", "ssZp": 4.486, "Dp": 4.586, "splay_angle": 21.832, "splay_distance": 3.558, "splay_ratio": 0.194, "d22": 4.573, "d64": 4.952, "eta": 158.484, "theta": -149.544, "eta_prime": 176.069, "theta_prime": -147.246, "eta_base": -134.649, "theta_base": -129.938, "v0": 4.228, "v1": -26.448, "v2": 37.447, "v3": -35.938, "v4": 20.083, "amplitude": 38.342, "phase_angle": 12.403, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.751, "filter_rmsd": 0.104, "frame": { "rmsd": 0.002, "origin": [ 36.851, 17.179, 6.098 ], "x_axis": [ -0.442, 0.115, 0.890 ], "y_axis": [ 0.787, 0.525, 0.323 ], "z_axis": [ -0.430, 0.843, -0.323 ], "quaternion": [ -0.436, 0.298, 0.757, 0.385 ] } }, { "index": 49, "index_chain": 49, "chain_name": "E", "nt_resnum": 51, "nt_name": "U", "nt_code": "U", "nt_id": "///E/51", "linked_nts": [ "///E/50", "///E/52" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop", "alpha": -59.605, "beta": 169.091, "gamma": 59.234, "delta": 83.614, "epsilon": -155.797, "zeta": -74.927, "epsilon_zeta": -80.870, "bb_type": "BI", "chi": -155.467, "glyco_bond": "anti", "C5prime_xyz": [ -1.775, 8.843, 0.284 ], "P_xyz": [ 0.756, 9.534, 0.159 ], "form": "A", "ssZp": 4.302, "Dp": 4.457, "splay_angle": 20.144, "splay_distance": 3.263, "splay_ratio": 0.175, "d22": null, "d64": null, "eta": 175.895, "theta": -150.181, "eta_prime": -168.708, "theta_prime": -152.449, "eta_base": -139.352, "theta_base": -132.323, "v0": 0.115, "v1": -23.028, "v2": 35.777, "v3": -36.622, "v4": 23.087, "amplitude": 37.699, "phase_angle": 18.371, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.888, "filter_rmsd": 0.104, "frame": { "rmsd": 0.005, "origin": [ 33.915, 18.732, 4.820 ], "x_axis": [ -0.114, 0.395, 0.912 ], "y_axis": [ 0.834, 0.536, -0.128 ], "z_axis": [ -0.539, 0.746, -0.391 ], "quaternion": [ 0.508, -0.430, -0.714, -0.216 ] } }, { "index": 50, "index_chain": 50, "chain_name": "E", "nt_resnum": 52, "nt_name": "A", "nt_code": "A", "nt_id": "///E/52", "linked_nts": [ "///E/51", "///E/53" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop", "alpha": -77.777, "beta": 175.913, "gamma": 57.923, "delta": 84.660, "epsilon": -174.450, "zeta": -77.813, "epsilon_zeta": -96.637, "bb_type": "BI", "chi": -155.161, "glyco_bond": "anti", "C5prime_xyz": [ -1.556, 8.799, 0.202 ], "P_xyz": [ 1.018, 9.375, 0.315 ], "form": "A", "ssZp": 4.130, "Dp": 4.291, "splay_angle": 23.207, "splay_distance": 3.896, "splay_ratio": 0.207, "d22": null, "d64": null, "eta": 160.677, "theta": -130.739, "eta_prime": 174.871, "theta_prime": -139.702, "eta_base": -149.986, "theta_base": -111.110, "v0": 1.563, "v1": -23.621, "v2": 35.481, "v3": -35.543, "v4": 21.421, "amplitude": 36.953, "phase_angle": 16.227, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.809, "filter_rmsd": 0.038, "frame": { "rmsd": 0.005, "origin": [ 31.245, 20.488, 4.158 ], "x_axis": [ 0.466, 0.406, 0.787 ], "y_axis": [ 0.704, 0.370, -0.607 ], "z_axis": [ -0.537, 0.836, -0.113 ], "quaternion": [ 0.656, -0.550, -0.504, -0.113 ] } }, { "index": 51, "index_chain": 51, "chain_name": "E", "nt_resnum": 53, "nt_name": "G", "nt_code": "G", "nt_id": "///E/53", "linked_nts": [ "///E/52", "///E/54" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop", "alpha": 155.267, "beta": -146.905, "gamma": 168.263, "delta": 82.756, "epsilon": -149.405, "zeta": -67.288, "epsilon_zeta": -82.117, "bb_type": "BI", "chi": 177.801, "glyco_bond": "anti", "C5prime_xyz": [ -1.666, 8.384, 1.781 ], "P_xyz": [ 0.245, 9.849, 0.775 ], "form": "A", "ssZp": 4.569, "Dp": 4.604, "splay_angle": 22.636, "splay_distance": 3.556, "splay_ratio": 0.201, "d22": null, "d64": null, "eta": 164.280, "theta": -155.750, "eta_prime": -174.696, "theta_prime": -156.345, "eta_base": -122.145, "theta_base": -122.266, "v0": 2.326, "v1": -24.649, "v2": 36.416, "v3": -36.130, "v4": 21.404, "amplitude": 37.745, "phase_angle": 15.251, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.657, "filter_rmsd": 0.007, "frame": { "rmsd": 0.007, "origin": [ 29.297, 23.439, 5.793 ], "x_axis": [ 0.755, 0.564, 0.334 ], "y_axis": [ 0.342, 0.095, -0.935 ], "z_axis": [ -0.559, 0.820, -0.121 ], "quaternion": [ 0.658, -0.667, -0.339, 0.084 ] } }, { "index": 52, "index_chain": 52, "chain_name": "E", "nt_resnum": 54, "nt_name": "U", "nt_code": "U", "nt_id": "///E/54", "linked_nts": [ "///E/53", "///E/55" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-canonical,non-pair-contact,helix-end,hairpin-loop", "alpha": -60.661, "beta": -176.752, "gamma": 42.660, "delta": 81.728, "epsilon": -127.392, "zeta": -76.765, "epsilon_zeta": -50.627, "bb_type": "--", "chi": -156.674, "glyco_bond": "anti", "C5prime_xyz": [ -1.240, 8.698, 0.390 ], "P_xyz": [ 1.288, 9.097, 0.974 ], "form": ".", "ssZp": 4.196, "Dp": 4.715, "splay_angle": 38.226, "splay_distance": 6.256, "splay_ratio": 0.329, "d22": 3.970, "d64": 4.419, "eta": 174.643, "theta": -97.442, "eta_prime": -173.738, "theta_prime": -100.272, "eta_base": -128.779, "theta_base": -63.094, "v0": 3.375, "v1": -25.857, "v2": 37.536, "v3": -36.671, "v4": 20.894, "amplitude": 38.648, "phase_angle": 13.780, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.764, "filter_rmsd": 0.106, "frame": { "rmsd": 0.004, "origin": [ 27.938, 26.361, 7.296 ], "x_axis": [ 0.725, 0.579, -0.372 ], "y_axis": [ -0.271, -0.257, -0.928 ], "z_axis": [ -0.633, 0.774, -0.029 ], "quaternion": [ 0.600, -0.709, -0.109, 0.354 ] } }, { "index": 53, "index_chain": 53, "chain_name": "E", "nt_resnum": 55, "nt_name": "U", "nt_code": "U", "nt_id": "///E/55", "linked_nts": [ "///E/54", "///E/56" ], "nt_type": "RNA", "dbn": ".", "summary": "u-turn,anti,~C3'-endo,non-pair-contact,hairpin-loop,cap-acceptor,splayed-apart", "alpha": 160.999, "beta": -153.729, "gamma": 168.954, "delta": 81.454, "epsilon": -124.389, "zeta": -95.024, "epsilon_zeta": -29.365, "bb_type": "--", "chi": -166.004, "glyco_bond": "anti", "C5prime_xyz": [ -1.276, 8.548, 0.904 ], "P_xyz": [ 0.373, 9.785, -0.676 ], "form": ".", "ssZp": 4.478, "Dp": 4.791, "splay_angle": 85.858, "splay_distance": 12.282, "splay_ratio": 0.681, "d22": 7.791, "d64": 10.500, "eta": 155.874, "theta": -135.981, "eta_prime": -175.763, "theta_prime": -177.059, "eta_base": -118.897, "theta_base": 124.737, "v0": 5.666, "v1": -27.453, "v2": 37.503, "v3": -35.559, "v4": 19.022, "amplitude": 38.145, "phase_angle": 10.534, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.298, "filter_rmsd": 0.107, "frame": { "rmsd": 0.005, "origin": [ 29.467, 31.238, 3.688 ], "x_axis": [ 0.419, -0.208, -0.884 ], "y_axis": [ -0.849, -0.436, -0.299 ], "z_axis": [ -0.323, 0.875, -0.360 ], "quaternion": [ -0.395, 0.744, -0.355, -0.406 ] } }, { "index": 54, "index_chain": 54, "chain_name": "E", "nt_resnum": 56, "nt_name": "C", "nt_code": "C", "nt_id": "///E/56", "linked_nts": [ "///E/55", "///E/57" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,u-turn,anti,~C3'-endo,BI,non-stack,non-pair-contact,hairpin-loop,splayed-apart", "alpha": 136.982, "beta": -161.883, "gamma": 69.572, "delta": 85.923, "epsilon": -131.243, "zeta": -80.010, "epsilon_zeta": -51.234, "bb_type": "BI", "chi": -128.860, "glyco_bond": "anti", "C5prime_xyz": [ -1.398, 8.584, -1.314 ], "P_xyz": [ 1.157, 8.662, -1.987 ], "form": ".", "ssZp": 2.798, "Dp": 4.665, "splay_angle": 36.022, "splay_distance": 5.839, "splay_ratio": 0.315, "d22": null, "d64": null, "eta": 31.088, "theta": -132.330, "eta_prime": 50.517, "theta_prime": -134.534, "eta_base": 21.608, "theta_base": -105.663, "v0": 3.862, "v1": -26.336, "v2": 37.639, "v3": -36.190, "v4": 20.454, "amplitude": 38.607, "phase_angle": 12.860, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1g", "suiteness": 0.041, "filter_rmsd": 0.062, "frame": { "rmsd": 0.006, "origin": [ 20.231, 35.315, 10.683 ], "x_axis": [ -0.276, -0.946, 0.169 ], "y_axis": [ 0.290, -0.250, -0.924 ], "z_axis": [ 0.916, -0.206, 0.343 ], "quaternion": [ -0.452, 0.397, -0.413, 0.683 ] } }, { "index": 55, "index_chain": 55, "chain_name": "E", "nt_resnum": 57, "nt_name": "G", "nt_code": "G", "nt_id": "///E/57", "linked_nts": [ "///E/56", "///E/58" ], "nt_type": "RNA", "dbn": ".", "summary": "u-turn,~C3'-endo,BI,non-pair-contact,hairpin-loop,cap-donor,phosphate", "alpha": -94.714, "beta": 177.572, "gamma": 58.692, "delta": 87.173, "epsilon": -158.863, "zeta": -72.408, "epsilon_zeta": -86.455, "bb_type": "BI", "chi": 166.732, "glyco_bond": "--", "C5prime_xyz": [ -1.623, 7.972, 2.294 ], "P_xyz": [ 0.843, 7.968, 3.246 ], "form": ".", "ssZp": 4.290, "Dp": 4.572, "splay_angle": 33.786, "splay_distance": 4.748, "splay_ratio": 0.292, "d22": null, "d64": null, "eta": 144.168, "theta": -148.667, "eta_prime": 159.922, "theta_prime": -145.167, "eta_base": -154.425, "theta_base": -122.728, "v0": 6.308, "v1": -27.412, "v2": 36.728, "v3": -34.245, "v4": 17.695, "amplitude": 37.202, "phase_angle": 9.156, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.299, "filter_rmsd": 0.007, "frame": { "rmsd": 0.007, "origin": [ 23.921, 30.790, 10.634 ], "x_axis": [ -0.946, 0.096, -0.309 ], "y_axis": [ 0.292, 0.665, -0.687 ], "z_axis": [ 0.140, -0.740, -0.658 ], "quaternion": [ 0.124, 0.107, 0.904, -0.395 ] } }, { "index": 56, "index_chain": 56, "chain_name": "E", "nt_resnum": 58, "nt_name": "A", "nt_code": "A", "nt_id": "///E/58", "linked_nts": [ "///E/57", "///E/59" ], "nt_type": "RNA", "dbn": ".", "summary": "u-turn,anti,~C3'-endo,non-canonical,non-pair-contact,helix-end,hairpin-loop,phosphate", "alpha": -56.723, "beta": -168.698, "gamma": 72.935, "delta": 75.250, "epsilon": 83.382, "zeta": 68.849, "epsilon_zeta": 14.533, "bb_type": "--", "chi": -102.723, "glyco_bond": "anti", "C5prime_xyz": [ -1.889, 7.724, -2.598 ], "P_xyz": [ 0.210, 7.281, -4.091 ], "form": ".", "ssZp": 1.185, "Dp": 3.304, "splay_angle": 73.369, "splay_distance": 11.631, "splay_ratio": 0.598, "d22": null, "d64": null, "eta": -130.711, "theta": -120.924, "eta_prime": -115.934, "theta_prime": -170.254, "eta_base": -102.761, "theta_base": 144.806, "v0": 6.255, "v1": -28.101, "v2": 38.236, "v3": -35.617, "v4": 18.530, "amplitude": 38.773, "phase_angle": 9.547, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.349, "filter_rmsd": 0.039, "frame": { "rmsd": 0.005, "origin": [ 24.553, 26.110, 10.137 ], "x_axis": [ -0.093, -0.614, -0.784 ], "y_axis": [ 0.947, 0.189, -0.259 ], "z_axis": [ 0.307, -0.767, 0.564 ], "quaternion": [ 0.644, 0.197, 0.423, -0.606 ] } }, { "index": 57, "index_chain": 57, "chain_name": "E", "nt_resnum": 59, "nt_name": "U", "nt_code": "U", "nt_id": "///E/59", "linked_nts": [ "///E/58", "///E/60" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,hairpin-loop,cap-donor,phosphate", "alpha": 109.520, "beta": 159.688, "gamma": 48.731, "delta": 85.285, "epsilon": -146.671, "zeta": -65.495, "epsilon_zeta": -81.176, "bb_type": "BI", "chi": -157.808, "glyco_bond": "anti", "C5prime_xyz": [ -1.610, 8.812, 0.394 ], "P_xyz": [ 0.978, 9.222, 0.644 ], "form": ".", "ssZp": 4.200, "Dp": 4.442, "splay_angle": 29.995, "splay_distance": 4.824, "splay_ratio": 0.259, "d22": 3.837, "d64": 3.914, "eta": 31.415, "theta": -129.692, "eta_prime": 58.241, "theta_prime": -127.339, "eta_base": 55.576, "theta_base": -82.536, "v0": 1.166, "v1": -23.139, "v2": 34.931, "v3": -35.266, "v4": 21.593, "amplitude": 36.497, "phase_angle": 16.847, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.103, "frame": { "rmsd": 0.005, "origin": [ 30.979, 28.902, 19.421 ], "x_axis": [ -0.327, 0.915, -0.237 ], "y_axis": [ 0.451, -0.069, -0.890 ], "z_axis": [ -0.830, -0.398, -0.390 ], "quaternion": [ -0.231, 0.532, 0.642, -0.502 ] } }, { "index": 58, "index_chain": 58, "chain_name": "E", "nt_resnum": 60, "nt_name": "C", "nt_code": "C", "nt_id": "///E/60", "linked_nts": [ "///E/59", "///E/61" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-pair-contact,hairpin-loop,phosphate", "alpha": -63.751, "beta": 160.871, "gamma": 62.663, "delta": 91.676, "epsilon": -96.037, "zeta": -59.225, "epsilon_zeta": -36.812, "bb_type": "--", "chi": -161.200, "glyco_bond": "anti", "C5prime_xyz": [ -1.564, 8.851, 0.516 ], "P_xyz": [ 1.054, 9.229, 0.523 ], "form": ".", "ssZp": 3.623, "Dp": 4.204, "splay_angle": 83.871, "splay_distance": 12.713, "splay_ratio": 0.669, "d22": 5.643, "d64": 6.633, "eta": -174.018, "theta": -68.233, "eta_prime": -153.613, "theta_prime": -71.004, "eta_base": -96.005, "theta_base": -45.386, "v0": -0.470, "v1": -21.740, "v2": 34.259, "v3": -35.504, "v4": 22.643, "amplitude": 36.294, "phase_angle": 19.277, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.600, "filter_rmsd": 0.063, "frame": { "rmsd": 0.006, "origin": [ 27.285, 30.036, 16.532 ], "x_axis": [ 0.224, 0.574, -0.787 ], "y_axis": [ 0.536, -0.747, -0.393 ], "z_axis": [ -0.814, -0.334, -0.476 ], "quaternion": [ -0.019, 0.782, 0.355, -0.512 ] } }, { "index": 59, "index_chain": 59, "chain_name": "E", "nt_resnum": 61, "nt_name": "C", "nt_code": "C", "nt_id": "///E/61", "linked_nts": [ "///E/60", "///E/62" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop", "alpha": -93.370, "beta": -140.947, "gamma": 56.184, "delta": 87.096, "epsilon": -157.467, "zeta": -68.970, "epsilon_zeta": -88.497, "bb_type": "BI", "chi": -170.892, "glyco_bond": "anti", "C5prime_xyz": [ -1.381, 8.640, 1.143 ], "P_xyz": [ 0.781, 8.578, 2.675 ], "form": "A", "ssZp": 4.386, "Dp": 4.456, "splay_angle": 24.734, "splay_distance": 3.907, "splay_ratio": 0.216, "d22": 4.791, "d64": 4.589, "eta": 150.906, "theta": -140.646, "eta_prime": -177.231, "theta_prime": -136.684, "eta_base": -139.478, "theta_base": -116.439, "v0": 3.158, "v1": -25.175, "v2": 36.368, "v3": -35.491, "v4": 20.370, "amplitude": 37.452, "phase_angle": 13.817, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1m", "suiteness": 0.056, "filter_rmsd": 0.064, "frame": { "rmsd": 0.003, "origin": [ 29.283, 23.482, 5.824 ], "x_axis": [ 0.856, 0.381, 0.350 ], "y_axis": [ -0.333, -0.111, 0.936 ], "z_axis": [ 0.396, -0.918, 0.032 ], "quaternion": [ 0.667, 0.695, 0.017, 0.268 ] } }, { "index": 60, "index_chain": 60, "chain_name": "E", "nt_resnum": 62, "nt_name": "U", "nt_code": "U", "nt_id": "///E/62", "linked_nts": [ "///E/61", "///E/63" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop", "alpha": -90.630, "beta": -162.998, "gamma": 55.427, "delta": 84.987, "epsilon": -163.210, "zeta": -70.181, "epsilon_zeta": -93.030, "bb_type": "BI", "chi": -158.523, "glyco_bond": "anti", "C5prime_xyz": [ -1.471, 8.706, 0.452 ], "P_xyz": [ 1.039, 9.187, 1.012 ], "form": "A", "ssZp": 4.408, "Dp": 4.511, "splay_angle": 20.694, "splay_distance": 3.245, "splay_ratio": 0.181, "d22": null, "d64": null, "eta": 161.113, "theta": -150.683, "eta_prime": 172.380, "theta_prime": -149.739, "eta_base": -155.817, "theta_base": -121.474, "v0": 2.041, "v1": -24.875, "v2": 36.904, "v3": -36.754, "v4": 21.879, "amplitude": 38.316, "phase_angle": 15.603, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.391, "filter_rmsd": 0.103, "frame": { "rmsd": 0.003, "origin": [ 31.291, 20.517, 4.260 ], "x_axis": [ 0.467, 0.427, 0.774 ], "y_axis": [ -0.730, -0.307, 0.610 ], "z_axis": [ 0.499, -0.850, 0.169 ], "quaternion": [ 0.576, 0.634, -0.120, 0.502 ] } }, { "index": 61, "index_chain": 61, "chain_name": "E", "nt_resnum": 63, "nt_name": "G", "nt_code": "G", "nt_id": "///E/63", "linked_nts": [ "///E/62", "///E/64" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop", "alpha": -71.526, "beta": 179.266, "gamma": 53.373, "delta": 82.146, "epsilon": -150.192, "zeta": -73.689, "epsilon_zeta": -76.504, "bb_type": "BI", "chi": -156.900, "glyco_bond": "anti", "C5prime_xyz": [ -1.196, 8.746, 0.370 ], "P_xyz": [ 1.407, 9.042, 0.412 ], "form": "A", "ssZp": 4.432, "Dp": 4.685, "splay_angle": 23.454, "splay_distance": 3.735, "splay_ratio": 0.204, "d22": null, "d64": null, "eta": 167.416, "theta": -145.321, "eta_prime": 178.384, "theta_prime": -142.831, "eta_base": -140.764, "theta_base": -119.577, "v0": 4.087, "v1": -26.784, "v2": 38.135, "v3": -36.673, "v4": 20.629, "amplitude": 39.090, "phase_angle": 12.691, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.820, "filter_rmsd": 0.009, "frame": { "rmsd": 0.009, "origin": [ 33.980, 18.723, 4.552 ], "x_axis": [ -0.032, 0.214, 0.976 ], "y_axis": [ -0.798, -0.594, 0.104 ], "z_axis": [ 0.602, -0.775, 0.190 ], "quaternion": [ 0.375, 0.586, -0.249, 0.674 ] } }, { "index": 62, "index_chain": 62, "chain_name": "E", "nt_resnum": 64, "nt_name": "A", "nt_code": "A", "nt_id": "///E/64", "linked_nts": [ "///E/63", "///E/65" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop", "alpha": -59.141, "beta": 157.662, "gamma": 67.564, "delta": 84.616, "epsilon": -153.955, "zeta": -76.622, "epsilon_zeta": -77.332, "bb_type": "BI", "chi": -159.835, "glyco_bond": "anti", "C5prime_xyz": [ -1.687, 8.750, 0.549 ], "P_xyz": [ 0.798, 9.304, -0.131 ], "form": "A", "ssZp": 4.487, "Dp": 4.550, "splay_angle": 23.423, "splay_distance": 3.660, "splay_ratio": 0.203, "d22": null, "d64": null, "eta": 173.904, "theta": -147.147, "eta_prime": -165.169, "theta_prime": -151.633, "eta_base": -124.975, "theta_base": -128.953, "v0": 2.598, "v1": -25.132, "v2": 36.838, "v3": -36.256, "v4": 21.242, "amplitude": 38.087, "phase_angle": 14.711, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.606, "filter_rmsd": 0.037, "frame": { "rmsd": 0.007, "origin": [ 36.869, 17.107, 6.281 ], "x_axis": [ -0.328, -0.151, 0.933 ], "y_axis": [ -0.612, -0.718, -0.332 ], "z_axis": [ 0.720, -0.679, 0.143 ], "quaternion": [ 0.156, 0.558, -0.342, 0.740 ] } }, { "index": 63, "index_chain": 63, "chain_name": "E", "nt_resnum": 65, "nt_name": "G", "nt_code": "G", "nt_id": "///E/65", "linked_nts": [ "///E/64", "///E/66" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop", "alpha": -91.295, "beta": -170.422, "gamma": 58.258, "delta": 83.858, "epsilon": -149.549, "zeta": -53.395, "epsilon_zeta": -96.153, "bb_type": "BI", "chi": -161.751, "glyco_bond": "anti", "C5prime_xyz": [ -1.157, 8.707, 0.609 ], "P_xyz": [ 1.452, 8.958, 0.915 ], "form": ".", "ssZp": 4.511, "Dp": 4.677, "splay_angle": 25.165, "splay_distance": 4.211, "splay_ratio": 0.226, "d22": null, "d64": null, "eta": 158.352, "theta": -125.620, "eta_prime": 166.351, "theta_prime": -122.157, "eta_base": -156.062, "theta_base": -89.365, "v0": 6.216, "v1": -28.320, "v2": 38.524, "v3": -35.811, "v4": 18.707, "amplitude": 39.067, "phase_angle": 9.566, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.428, "filter_rmsd": 0.008, "frame": { "rmsd": 0.008, "origin": [ 39.730, 15.523, 7.926 ], "x_axis": [ -0.871, -0.252, 0.421 ], "y_axis": [ -0.229, -0.552, -0.802 ], "z_axis": [ 0.434, -0.795, 0.423 ], "quaternion": [ -0.007, 0.254, -0.473, 0.844 ] } }, { "index": 64, "index_chain": 64, "chain_name": "E", "nt_resnum": 66, "nt_name": "U", "nt_code": "U", "nt_id": "///E/66", "linked_nts": [ "///E/65", "///E/67" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,isolated-canonical,non-pair-contact,helix,internal-loop,junction-loop", "alpha": -70.463, "beta": 173.706, "gamma": 65.673, "delta": 83.920, "epsilon": -164.271, "zeta": -70.751, "epsilon_zeta": -93.521, "bb_type": "BI", "chi": -159.053, "glyco_bond": "anti", "C5prime_xyz": [ -2.206, 8.856, 0.378 ], "P_xyz": [ 0.214, 9.879, 0.490 ], "form": "A", "ssZp": 4.122, "Dp": 4.261, "splay_angle": 23.662, "splay_distance": 3.837, "splay_ratio": 0.207, "d22": null, "d64": null, "eta": 170.559, "theta": -152.029, "eta_prime": -161.067, "theta_prime": -154.388, "eta_base": -106.765, "theta_base": -127.729, "v0": -1.833, "v1": -21.472, "v2": 35.187, "v3": -37.147, "v4": 24.519, "amplitude": 37.743, "phase_angle": 21.211, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.612, "filter_rmsd": 0.106, "frame": { "rmsd": 0.010, "origin": [ 38.504, 13.045, 11.102 ], "x_axis": [ -0.872, -0.445, -0.203 ], "y_axis": [ 0.393, -0.390, -0.833 ], "z_axis": [ 0.291, -0.806, 0.515 ], "quaternion": [ -0.251, 0.027, -0.492, 0.833 ] } }, { "index": 65, "index_chain": 65, "chain_name": "E", "nt_resnum": 67, "nt_name": "G", "nt_code": "G", "nt_id": "///E/67", "linked_nts": [ "///E/66", "///E/68" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop", "alpha": -83.270, "beta": -168.878, "gamma": 52.034, "delta": 84.632, "epsilon": -172.345, "zeta": -84.469, "epsilon_zeta": -87.876, "bb_type": "BI", "chi": -153.930, "glyco_bond": "anti", "C5prime_xyz": [ -1.411, 8.846, 0.165 ], "P_xyz": [ 1.130, 9.443, 0.599 ], "form": "A", "ssZp": 4.240, "Dp": 4.397, "splay_angle": 20.558, "splay_distance": 3.366, "splay_ratio": 0.182, "d22": null, "d64": null, "eta": 161.929, "theta": -138.105, "eta_prime": 171.754, "theta_prime": -143.672, "eta_base": -148.389, "theta_base": -115.250, "v0": 1.769, "v1": -24.122, "v2": 36.092, "v3": -35.915, "v4": 21.511, "amplitude": 37.518, "phase_angle": 15.849, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.589, "filter_rmsd": 0.006, "frame": { "rmsd": 0.006, "origin": [ 38.558, 10.537, 14.005 ], "x_axis": [ -0.514, -0.441, -0.735 ], "y_axis": [ 0.837, -0.070, -0.543 ], "z_axis": [ 0.188, -0.895, 0.405 ], "quaternion": [ -0.453, -0.194, -0.510, 0.705 ] } }, { "index": 66, "index_chain": 66, "chain_name": "E", "nt_resnum": 68, "nt_name": "C", "nt_code": "C", "nt_id": "///E/68", "linked_nts": [ "///E/67", "///E/69" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,internal-loop", "alpha": 163.651, "beta": -148.209, "gamma": 160.905, "delta": 84.829, "epsilon": -154.786, "zeta": -58.781, "epsilon_zeta": -96.005, "bb_type": "BI", "chi": -167.471, "glyco_bond": "anti", "C5prime_xyz": [ -1.118, 8.592, 0.984 ], "P_xyz": [ 0.671, 9.536, -0.691 ], "form": "A", "ssZp": 4.614, "Dp": 4.620, "splay_angle": 30.295, "splay_distance": 4.681, "splay_ratio": 0.263, "d22": null, "d64": null, "eta": 158.860, "theta": -142.631, "eta_prime": -179.990, "theta_prime": -147.178, "eta_base": -131.373, "theta_base": -117.038, "v0": 5.245, "v1": -27.026, "v2": 37.350, "v3": -35.403, "v4": 19.039, "amplitude": 38.039, "phase_angle": 10.916, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.375, "filter_rmsd": 0.063, "frame": { "rmsd": 0.005, "origin": [ 37.476, 7.503, 14.980 ], "x_axis": [ -0.011, -0.516, -0.857 ], "y_axis": [ 1.000, -0.017, -0.002 ], "z_axis": [ -0.014, -0.857, 0.516 ], "quaternion": [ 0.610, 0.350, 0.346, -0.621 ] } }, { "index": 67, "index_chain": 67, "chain_name": "E", "nt_resnum": 69, "nt_name": "G", "nt_code": "G", "nt_id": "///E/69", "linked_nts": [ "///E/68", "///E/70" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-pair-contact,internal-loop", "alpha": -91.980, "beta": -154.861, "gamma": 53.711, "delta": 83.580, "epsilon": -154.836, "zeta": -110.621, "epsilon_zeta": -44.215, "bb_type": "BI", "chi": -172.902, "glyco_bond": "anti", "C5prime_xyz": [ -1.525, 8.612, 1.246 ], "P_xyz": [ 0.723, 8.791, 2.573 ], "form": ".", "ssZp": 4.508, "Dp": 4.553, "splay_angle": 28.850, "splay_distance": 4.647, "splay_ratio": 0.254, "d22": null, "d64": null, "eta": 162.821, "theta": -142.122, "eta_prime": 177.039, "theta_prime": -143.738, "eta_base": -135.909, "theta_base": -132.475, "v0": 2.571, "v1": -25.262, "v2": 37.168, "v3": -36.677, "v4": 21.541, "amplitude": 38.457, "phase_angle": 14.876, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1m", "suiteness": 0.457, "filter_rmsd": 0.006, "frame": { "rmsd": 0.006, "origin": [ 36.490, 2.927, 15.068 ], "x_axis": [ 0.568, 0.141, -0.811 ], "y_axis": [ 0.681, 0.472, 0.559 ], "z_axis": [ 0.462, -0.870, 0.172 ], "quaternion": [ 0.744, 0.481, 0.428, -0.182 ] } }, { "index": 68, "index_chain": 68, "chain_name": "E", "nt_resnum": 70, "nt_name": "A", "nt_code": "A", "nt_id": "///E/70", "linked_nts": [ "///E/69", "///E/71" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,internal-loop", "alpha": 138.984, "beta": -121.864, "gamma": 179.821, "delta": 83.078, "epsilon": -163.193, "zeta": -69.754, "epsilon_zeta": -93.439, "bb_type": "BI", "chi": 159.422, "glyco_bond": "anti", "C5prime_xyz": [ -1.922, 7.701, 2.657 ], "P_xyz": [ -0.195, 9.462, 1.711 ], "form": "A", "ssZp": 4.137, "Dp": 4.593, "splay_angle": 22.279, "splay_distance": 3.332, "splay_ratio": 0.207, "d22": null, "d64": null, "eta": 166.170, "theta": -157.978, "eta_prime": -171.696, "theta_prime": -151.838, "eta_base": -137.710, "theta_base": -138.847, "v0": 5.305, "v1": -27.667, "v2": 38.515, "v3": -36.330, "v4": 19.542, "amplitude": 39.227, "phase_angle": 10.934, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.028, "filter_rmsd": 0.038, "frame": { "rmsd": 0.007, "origin": [ 35.976, -1.683, 14.789 ], "x_axis": [ 0.804, 0.105, -0.585 ], "y_axis": [ 0.467, 0.497, 0.731 ], "z_axis": [ 0.368, -0.861, 0.350 ], "quaternion": [ 0.814, 0.489, 0.293, -0.111 ] } }, { "index": 69, "index_chain": 69, "chain_name": "E", "nt_resnum": 71, "nt_name": "G", "nt_code": "G", "nt_id": "///E/71", "linked_nts": [ "///E/70", null ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,isolated-canonical,non-pair-contact,helix-end,internal-loop", "alpha": -110.844, "beta": -106.951, "gamma": 59.865, "delta": 79.972, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": -110.855, "glyco_bond": "anti", "C5prime_xyz": [ -1.748, 8.128, -2.237 ], "P_xyz": [ 0.845, 8.403, -1.858 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": 2.240, "v1": -24.761, "v2": 36.688, "v3": -36.283, "v4": 21.508, "amplitude": 38.028, "phase_angle": 15.253, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1m", "suiteness": 0.015, "filter_rmsd": 0.004, "frame": { "rmsd": 0.004, "origin": [ 35.797, -4.682, 13.349 ], "x_axis": [ 0.975, 0.213, 0.070 ], "y_axis": [ -0.047, -0.113, 0.993 ], "z_axis": [ 0.219, -0.971, -0.100 ], "quaternion": [ 0.664, 0.739, 0.056, 0.098 ] } }, { "index": 70, "index_chain": 1, "chain_name": "F", "nt_resnum": 2, "nt_name": "C", "nt_code": "C", "nt_id": "///F/2", "linked_nts": [ null, "///F/3" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-stack,non-pair-contact,ss-non-loop", "alpha": null, "beta": 117.084, "gamma": 67.033, "delta": 86.628, "epsilon": -179.691, "zeta": -71.841, "epsilon_zeta": -107.849, "bb_type": "BI", "chi": -174.190, "glyco_bond": "anti", "C5prime_xyz": [ -1.730, 8.696, 1.255 ], "P_xyz": [ 0.913, 8.516, 0.793 ], "form": ".", "ssZp": 3.808, "Dp": 4.015, "splay_angle": 29.720, "splay_distance": 4.534, "splay_ratio": 0.257, "d22": 5.414, "d64": 5.162, "eta": null, "theta": -140.663, "eta_prime": null, "theta_prime": -154.588, "eta_base": null, "theta_base": -141.491, "v0": 0.754, "v1": -22.301, "v2": 33.986, "v3": -34.600, "v4": 21.411, "amplitude": 35.633, "phase_angle": 17.488, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.064, "frame": { "rmsd": 0.006, "origin": [ 128.788, 89.868, 21.452 ], "x_axis": [ -0.913, -0.153, -0.378 ], "y_axis": [ 0.406, -0.410, -0.816 ], "z_axis": [ -0.030, -0.899, 0.437 ], "quaternion": [ -0.168, -0.123, -0.516, 0.831 ] } }, { "index": 71, "index_chain": 2, "chain_name": "F", "nt_resnum": 3, "nt_name": "U", "nt_code": "U", "nt_id": "///F/3", "linked_nts": [ "///F/2", "///F/4" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack", "alpha": -109.347, "beta": -143.978, "gamma": 69.322, "delta": 86.944, "epsilon": -175.967, "zeta": -77.281, "epsilon_zeta": -98.686, "bb_type": "BI", "chi": -164.419, "glyco_bond": "anti", "C5prime_xyz": [ -1.369, 8.640, 0.738 ], "P_xyz": [ 1.123, 8.571, 1.603 ], "form": "A", "ssZp": 4.242, "Dp": 4.329, "splay_angle": 19.713, "splay_distance": 3.369, "splay_ratio": 0.181, "d22": 4.381, "d64": 4.820, "eta": 169.374, "theta": -126.873, "eta_prime": 176.847, "theta_prime": -135.436, "eta_base": -153.566, "theta_base": -116.631, "v0": 4.160, "v1": -25.864, "v2": 36.475, "v3": -35.104, "v4": 19.588, "amplitude": 37.345, "phase_angle": 12.393, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1m", "suiteness": 0.010, "filter_rmsd": 0.106, "frame": { "rmsd": 0.004, "origin": [ 129.432, 87.426, 25.217 ], "x_axis": [ -0.598, -0.306, -0.741 ], "y_axis": [ 0.796, -0.114, -0.595 ], "z_axis": [ 0.097, -0.945, 0.312 ], "quaternion": [ -0.387, -0.226, -0.541, 0.711 ] } }, { "index": 72, "index_chain": 3, "chain_name": "F", "nt_resnum": 4, "nt_name": "C", "nt_code": "C", "nt_id": "///F/4", "linked_nts": [ "///F/3", "///F/5" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": 160.452, "beta": -148.766, "gamma": 165.665, "delta": 85.088, "epsilon": -141.535, "zeta": -94.403, "epsilon_zeta": -47.131, "bb_type": "BI", "chi": -176.211, "glyco_bond": "anti", "C5prime_xyz": [ -1.584, 8.570, 1.452 ], "P_xyz": [ 0.428, 9.857, 0.375 ], "form": "A", "ssZp": 4.451, "Dp": 4.507, "splay_angle": 28.062, "splay_distance": 4.574, "splay_ratio": 0.245, "d22": null, "d64": null, "eta": 168.717, "theta": -139.261, "eta_prime": -173.381, "theta_prime": -149.971, "eta_base": -132.445, "theta_base": -123.799, "v0": 1.324, "v1": -23.543, "v2": 35.587, "v3": -35.880, "v4": 21.794, "amplitude": 37.149, "phase_angle": 16.675, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.556, "filter_rmsd": 0.063, "frame": { "rmsd": 0.004, "origin": [ 127.716, 84.933, 26.698 ], "x_axis": [ -0.126, -0.456, -0.881 ], "y_axis": [ 0.992, -0.059, -0.112 ], "z_axis": [ -0.001, -0.888, 0.460 ], "quaternion": [ 0.564, 0.344, 0.390, -0.641 ] } }, { "index": 73, "index_chain": 4, "chain_name": "F", "nt_resnum": 5, "nt_name": "G", "nt_code": "G", "nt_id": "///F/5", "linked_nts": [ "///F/4", "///F/6" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": 154.573, "beta": -151.365, "gamma": 166.118, "delta": 84.164, "epsilon": -122.026, "zeta": -71.634, "epsilon_zeta": -50.392, "bb_type": "--", "chi": 163.905, "glyco_bond": "anti", "C5prime_xyz": [ -1.806, 7.949, 2.455 ], "P_xyz": [ 0.315, 9.437, 2.150 ], "form": ".", "ssZp": 4.572, "Dp": 4.650, "splay_angle": 29.036, "splay_distance": 4.515, "splay_ratio": 0.253, "d22": null, "d64": null, "eta": 156.740, "theta": -137.605, "eta_prime": 172.911, "theta_prime": -130.940, "eta_base": -142.588, "theta_base": -78.715, "v0": 2.628, "v1": -24.584, "v2": 35.895, "v3": -35.470, "v4": 20.922, "amplitude": 37.126, "phase_angle": 14.796, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.347, "filter_rmsd": 0.005, "frame": { "rmsd": 0.005, "origin": [ 126.009, 80.848, 27.850 ], "x_axis": [ 0.420, -0.097, -0.902 ], "y_axis": [ 0.855, 0.375, 0.358 ], "z_axis": [ 0.304, -0.922, 0.240 ], "quaternion": [ 0.713, 0.449, 0.423, -0.333 ] } }, { "index": 74, "index_chain": 5, "chain_name": "F", "nt_resnum": 6, "nt_name": "U", "nt_code": "U", "nt_id": "///F/6", "linked_nts": [ "///F/5", "///F/7" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -43.449, "beta": 160.585, "gamma": 44.835, "delta": 80.411, "epsilon": -158.339, "zeta": -137.142, "epsilon_zeta": -21.197, "bb_type": "--", "chi": -143.813, "glyco_bond": "anti", "C5prime_xyz": [ -1.525, 8.786, -0.390 ], "P_xyz": [ 1.038, 9.152, -0.728 ], "form": ".", "ssZp": 3.924, "Dp": 4.556, "splay_angle": 25.202, "splay_distance": 4.053, "splay_ratio": 0.218, "d22": null, "d64": null, "eta": 165.062, "theta": -162.804, "eta_prime": -165.939, "theta_prime": -161.189, "eta_base": -93.465, "theta_base": -163.170, "v0": 2.023, "v1": -25.781, "v2": 38.572, "v3": -38.370, "v4": 22.986, "amplitude": 40.083, "phase_angle": 15.782, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.395, "filter_rmsd": 0.106, "frame": { "rmsd": 0.008, "origin": [ 128.342, 77.345, 26.217 ], "x_axis": [ 0.980, -0.178, -0.089 ], "y_axis": [ 0.116, 0.150, 0.982 ], "z_axis": [ -0.161, -0.973, 0.168 ], "quaternion": [ 0.758, 0.645, -0.024, -0.097 ] } }, { "index": 75, "index_chain": 6, "chain_name": "F", "nt_resnum": 7, "nt_name": "A", "nt_code": "A", "nt_id": "///F/7", "linked_nts": [ "///F/6", "///F/8" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop,splayed-apart", "alpha": 130.890, "beta": -92.751, "gamma": -179.900, "delta": 93.711, "epsilon": -137.348, "zeta": 46.638, "epsilon_zeta": 176.014, "bb_type": "--", "chi": -167.242, "glyco_bond": "anti", "C5prime_xyz": [ -2.093, 8.831, 0.625 ], "P_xyz": [ -0.053, 9.184, -1.053 ], "form": ".", "ssZp": 2.877, "Dp": 3.447, "splay_angle": 120.523, "splay_distance": 16.957, "splay_ratio": 0.868, "d22": null, "d64": null, "eta": -157.609, "theta": -35.888, "eta_prime": -153.225, "theta_prime": -43.787, "eta_base": -153.283, "theta_base": -29.113, "v0": -4.529, "v1": -16.080, "v2": 28.894, "v3": -32.762, "v4": 23.619, "amplitude": 32.357, "phase_angle": 26.754, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.040, "frame": { "rmsd": 0.012, "origin": [ 126.358, 73.823, 25.922 ], "x_axis": [ 1.000, -0.022, -0.003 ], "y_axis": [ 0.004, 0.032, 0.999 ], "z_axis": [ -0.022, -0.999, 0.032 ], "quaternion": [ 0.718, 0.696, -0.007, -0.009 ] } }, { "index": 76, "index_chain": 7, "chain_name": "F", "nt_resnum": 8, "nt_name": "U", "nt_code": "U", "nt_id": "///F/8", "linked_nts": [ "///F/7", "///F/9" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-canonical,non-pair-contact,multiplet,junction-loop,splayed-apart", "alpha": -113.665, "beta": -134.523, "gamma": 39.262, "delta": 83.168, "epsilon": -142.270, "zeta": -178.340, "epsilon_zeta": 36.070, "bb_type": "--", "chi": -143.824, "glyco_bond": "anti", "C5prime_xyz": [ -1.269, 8.706, -0.446 ], "P_xyz": [ 0.972, 9.537, 0.636 ], "form": ".", "ssZp": 3.821, "Dp": 4.674, "splay_angle": 73.919, "splay_distance": 11.399, "splay_ratio": 0.601, "d22": null, "d64": null, "eta": 159.299, "theta": 144.552, "eta_prime": -167.001, "theta_prime": 173.726, "eta_base": -141.225, "theta_base": -174.971, "v0": 2.824, "v1": -25.206, "v2": 36.697, "v3": -36.018, "v4": 21.004, "amplitude": 37.887, "phase_angle": 14.397, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.104, "frame": { "rmsd": 0.006, "origin": [ 124.874, 70.386, 42.461 ], "x_axis": [ -0.196, 0.977, 0.083 ], "y_axis": [ -0.340, 0.012, -0.940 ], "z_axis": [ -0.920, -0.213, 0.330 ], "quaternion": [ 0.535, -0.340, -0.469, 0.615 ] } }, { "index": 77, "index_chain": 8, "chain_name": "F", "nt_resnum": 9, "nt_name": "G", "nt_code": "G", "nt_id": "///F/9", "linked_nts": [ "///F/8", "///F/10" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-canonical,non-pair-contact,multiplet,junction-loop", "alpha": 154.947, "beta": -124.241, "gamma": 173.395, "delta": 87.001, "epsilon": -76.781, "zeta": -128.562, "epsilon_zeta": 51.781, "bb_type": "--", "chi": -163.086, "glyco_bond": "anti", "C5prime_xyz": [ -1.692, 8.771, 0.678 ], "P_xyz": [ -0.184, 9.552, -1.316 ], "form": ".", "ssZp": 3.685, "Dp": 4.263, "splay_angle": 44.457, "splay_distance": 7.056, "splay_ratio": 0.386, "d22": null, "d64": null, "eta": -143.413, "theta": -69.268, "eta_prime": -175.271, "theta_prime": -111.885, "eta_base": 161.949, "theta_base": -111.860, "v0": -2.112, "v1": -20.543, "v2": 33.814, "v3": -36.208, "v4": 24.109, "amplitude": 36.450, "phase_angle": 21.924, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.007, "frame": { "rmsd": 0.007, "origin": [ 117.039, 62.156, 43.363 ], "x_axis": [ 0.141, 0.764, 0.630 ], "y_axis": [ 0.063, 0.628, -0.776 ], "z_axis": [ -0.988, 0.150, 0.040 ], "quaternion": [ 0.673, -0.344, -0.601, 0.260 ] } }, { "index": 78, "index_chain": 9, "chain_name": "F", "nt_resnum": 10, "nt_name": "G", "nt_code": "G", "nt_id": "///F/10", "linked_nts": [ "///F/9", "///F/11" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,junction-loop", "alpha": -165.578, "beta": -108.320, "gamma": 62.994, "delta": 88.069, "epsilon": -162.471, "zeta": -69.768, "epsilon_zeta": -92.703, "bb_type": "BI", "chi": -163.614, "glyco_bond": "anti", "C5prime_xyz": [ -1.237, 8.619, 0.682 ], "P_xyz": [ 0.889, 8.057, 2.087 ], "form": "A", "ssZp": 4.428, "Dp": 4.537, "splay_angle": 28.799, "splay_distance": 4.404, "splay_ratio": 0.249, "d22": null, "d64": null, "eta": 59.863, "theta": -138.356, "eta_prime": 114.281, "theta_prime": -138.409, "eta_base": 141.318, "theta_base": -116.801, "v0": 5.430, "v1": -27.774, "v2": 37.867, "v3": -35.959, "v4": 19.403, "amplitude": 38.545, "phase_angle": 10.765, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.009, "frame": { "rmsd": 0.009, "origin": [ 111.577, 66.596, 42.872 ], "x_axis": [ 0.691, -0.709, 0.141 ], "y_axis": [ -0.028, -0.221, -0.975 ], "z_axis": [ 0.723, 0.670, -0.172 ], "quaternion": [ 0.569, -0.722, 0.255, -0.299 ] } }, { "index": 79, "index_chain": 10, "chain_name": "F", "nt_resnum": 11, "nt_name": "C", "nt_code": "C", "nt_id": "///F/11", "linked_nts": [ "///F/10", "///F/12" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -84.647, "beta": -168.840, "gamma": 51.854, "delta": 81.879, "epsilon": -140.472, "zeta": -80.473, "epsilon_zeta": -60.000, "bb_type": "BI", "chi": -174.154, "glyco_bond": "anti", "C5prime_xyz": [ -1.113, 8.449, 1.393 ], "P_xyz": [ 1.460, 8.569, 2.027 ], "form": "A", "ssZp": 4.814, "Dp": 4.778, "splay_angle": 20.964, "splay_distance": 3.253, "splay_ratio": 0.188, "d22": null, "d64": null, "eta": 162.893, "theta": -146.985, "eta_prime": 170.655, "theta_prime": -141.697, "eta_base": -151.943, "theta_base": -115.115, "v0": 8.320, "v1": -30.102, "v2": 39.560, "v3": -35.471, "v4": 17.200, "amplitude": 39.830, "phase_angle": 6.675, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.549, "filter_rmsd": 0.065, "frame": { "rmsd": 0.006, "origin": [ 114.776, 69.550, 43.532 ], "x_axis": [ 0.362, -0.861, -0.357 ], "y_axis": [ -0.529, 0.126, -0.839 ], "z_axis": [ 0.768, 0.492, -0.410 ], "quaternion": [ 0.519, -0.641, 0.542, -0.160 ] } }, { "index": 80, "index_chain": 11, "chain_name": "F", "nt_resnum": 12, "nt_name": "G", "nt_code": "G", "nt_id": "///F/12", "linked_nts": [ "///F/11", "///F/13" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet", "alpha": -67.584, "beta": 163.814, "gamma": 65.680, "delta": 83.691, "epsilon": -147.619, "zeta": -95.962, "epsilon_zeta": -51.657, "bb_type": "BI", "chi": -169.076, "glyco_bond": "anti", "C5prime_xyz": [ -1.442, 8.609, 1.072 ], "P_xyz": [ 1.132, 8.962, 0.780 ], "form": ".", "ssZp": 4.675, "Dp": 4.683, "splay_angle": 21.885, "splay_distance": 3.823, "splay_ratio": 0.204, "d22": null, "d64": null, "eta": 169.210, "theta": -124.102, "eta_prime": -175.140, "theta_prime": -134.760, "eta_base": -134.673, "theta_base": -117.178, "v0": 4.303, "v1": -27.006, "v2": 38.338, "v3": -36.692, "v4": 20.589, "amplitude": 39.255, "phase_angle": 12.414, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.693, "filter_rmsd": 0.010, "frame": { "rmsd": 0.010, "origin": [ 118.026, 69.617, 43.669 ], "x_axis": [ 0.020, -0.674, -0.738 ], "y_axis": [ -0.493, 0.635, -0.594 ], "z_axis": [ 0.870, 0.376, -0.320 ], "quaternion": [ 0.578, -0.420, 0.696, -0.078 ] } }, { "index": 81, "index_chain": 12, "chain_name": "F", "nt_resnum": 13, "nt_name": "C", "nt_code": "C", "nt_id": "///F/13", "linked_nts": [ "///F/12", "///F/14" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,hairpin-loop,kissing-loop", "alpha": 136.929, "beta": -135.821, "gamma": -172.108, "delta": 81.289, "epsilon": -123.035, "zeta": -40.833, "epsilon_zeta": -82.202, "bb_type": "--", "chi": -177.349, "glyco_bond": "anti", "C5prime_xyz": [ -1.259, 8.443, 1.527 ], "P_xyz": [ 0.043, 10.082, -0.035 ], "form": ".", "ssZp": 4.746, "Dp": 4.784, "splay_angle": 29.333, "splay_distance": 5.320, "splay_ratio": 0.274, "d22": null, "d64": null, "eta": 171.082, "theta": -148.371, "eta_prime": -173.668, "theta_prime": -163.369, "eta_base": -132.572, "theta_base": -175.838, "v0": 4.277, "v1": -27.232, "v2": 39.004, "v3": -37.346, "v4": 20.988, "amplitude": 39.966, "phase_angle": 12.597, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.279, "filter_rmsd": 0.062, "frame": { "rmsd": 0.005, "origin": [ 121.486, 68.213, 42.848 ], "x_axis": [ -0.065, -0.258, -0.964 ], "y_axis": [ -0.267, 0.935, -0.232 ], "z_axis": [ 0.962, 0.242, -0.130 ], "quaternion": [ 0.660, -0.180, 0.730, 0.003 ] } }, { "index": 82, "index_chain": 13, "chain_name": "F", "nt_resnum": 14, "nt_name": "A", "nt_code": "A", "nt_id": "///F/14", "linked_nts": [ "///F/13", "///F/15" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-canonical,non-pair-contact,helix,multiplet,hairpin-loop,kissing-loop,cap-acceptor", "alpha": -124.305, "beta": 90.780, "gamma": 168.617, "delta": 80.312, "epsilon": -115.749, "zeta": -61.367, "epsilon_zeta": -54.382, "bb_type": "--", "chi": 172.856, "glyco_bond": "anti", "C5prime_xyz": [ -1.597, 8.142, 2.076 ], "P_xyz": [ -1.961, 10.535, 1.027 ], "form": ".", "ssZp": 4.828, "Dp": 4.788, "splay_angle": 42.918, "splay_distance": 6.300, "splay_ratio": 0.366, "d22": null, "d64": null, "eta": 178.303, "theta": -168.877, "eta_prime": 177.573, "theta_prime": -148.006, "eta_base": 174.099, "theta_base": -81.010, "v0": 5.471, "v1": -28.102, "v2": 39.111, "v3": -36.951, "v4": 19.822, "amplitude": 39.831, "phase_angle": 10.909, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1e", "suiteness": 0.060, "filter_rmsd": 0.037, "frame": { "rmsd": 0.005, "origin": [ 125.802, 65.776, 44.783 ], "x_axis": [ -0.151, -0.330, -0.932 ], "y_axis": [ -0.250, 0.925, -0.287 ], "z_axis": [ 0.956, 0.190, -0.222 ], "quaternion": [ 0.623, -0.191, 0.758, -0.032 ] } }, { "index": 83, "index_chain": 14, "chain_name": "F", "nt_resnum": 15, "nt_name": "G", "nt_code": "G", "nt_id": "///F/15", "linked_nts": [ "///F/14", "///F/16" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-canonical,non-pair-contact,helix,hairpin-loop,kissing-loop,cap-donor", "alpha": -60.822, "beta": 161.827, "gamma": 55.798, "delta": 84.674, "epsilon": -135.187, "zeta": -115.376, "epsilon_zeta": -19.811, "bb_type": "--", "chi": -172.409, "glyco_bond": "anti", "C5prime_xyz": [ -1.187, 8.535, 1.242 ], "P_xyz": [ 1.466, 8.539, 1.375 ], "form": ".", "ssZp": 4.634, "Dp": 4.718, "splay_angle": 34.426, "splay_distance": 5.168, "splay_ratio": 0.296, "d22": null, "d64": null, "eta": 156.610, "theta": -173.802, "eta_prime": -169.853, "theta_prime": -170.598, "eta_base": -82.674, "theta_base": -176.779, "v0": 7.293, "v1": -28.412, "v2": 37.810, "v3": -34.615, "v4": 17.218, "amplitude": 38.171, "phase_angle": 7.891, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.423, "filter_rmsd": 0.007, "frame": { "rmsd": 0.007, "origin": [ 127.477, 67.423, 38.937 ], "x_axis": [ -0.284, 0.831, -0.479 ], "y_axis": [ 0.122, 0.526, 0.841 ], "z_axis": [ 0.951, 0.181, -0.251 ], "quaternion": [ 0.498, 0.332, 0.718, 0.356 ] } }, { "index": 84, "index_chain": 15, "chain_name": "F", "nt_resnum": 16, "nt_name": "U", "nt_code": "U", "nt_id": "///F/16", "linked_nts": [ "///F/15", "///F/18" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,hairpin-loop,kissing-loop", "alpha": -69.166, "beta": 160.653, "gamma": 54.764, "delta": 85.011, "epsilon": -147.331, "zeta": -77.794, "epsilon_zeta": -69.536, "bb_type": "BI", "chi": -166.849, "glyco_bond": "anti", "C5prime_xyz": [ -1.237, 8.541, 0.938 ], "P_xyz": [ 1.383, 8.583, 0.839 ], "form": ".", "ssZp": 4.618, "Dp": 4.680, "splay_angle": 75.036, "splay_distance": 11.427, "splay_ratio": 0.612, "d22": null, "d64": null, "eta": 166.902, "theta": -143.214, "eta_prime": 165.666, "theta_prime": -156.007, "eta_base": 162.988, "theta_base": -159.385, "v0": 6.456, "v1": -28.584, "v2": 38.541, "v3": -36.001, "v4": 18.558, "amplitude": 39.059, "phase_angle": 9.344, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "7a", "suiteness": 0.580, "filter_rmsd": 0.107, "frame": { "rmsd": 0.007, "origin": [ 131.194, 63.863, 38.470 ], "x_axis": [ -0.472, 0.827, -0.305 ], "y_axis": [ 0.271, 0.465, 0.843 ], "z_axis": [ 0.839, 0.315, -0.444 ], "quaternion": [ 0.371, 0.356, 0.772, 0.375 ] } }, { "index": 85, "index_chain": 16, "chain_name": "F", "nt_resnum": 18, "nt_name": "G", "nt_code": "G", "nt_id": "///F/18", "linked_nts": [ "///F/16", "///F/19" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C2'-endo,non-canonical,non-pair-contact,helix,hairpin-loop,kissing-loop,cap-donor", "alpha": -62.028, "beta": 134.763, "gamma": 178.036, "delta": 103.774, "epsilon": 71.932, "zeta": 35.959, "epsilon_zeta": 35.973, "bb_type": "--", "chi": -138.853, "glyco_bond": "anti", "C5prime_xyz": [ -0.916, 8.327, -0.043 ], "P_xyz": [ 0.425, 9.898, -1.636 ], "form": ".", "ssZp": 0.962, "Dp": 1.128, "splay_angle": 55.093, "splay_distance": 8.536, "splay_ratio": 0.473, "d22": null, "d64": null, "eta": -21.087, "theta": 145.234, "eta_prime": -37.354, "theta_prime": 179.211, "eta_base": -62.243, "theta_base": -129.083, "v0": 2.316, "v1": 10.495, "v2": -18.987, "v3": 20.864, "v4": -14.300, "amplitude": 20.914, "phase_angle": 204.788, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "33t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.005, "frame": { "rmsd": 0.005, "origin": [ 141.718, 61.845, 34.502 ], "x_axis": [ 0.702, 0.712, -0.015 ], "y_axis": [ -0.272, 0.287, 0.919 ], "z_axis": [ 0.658, -0.641, 0.395 ], "quaternion": [ 0.772, 0.505, 0.218, 0.319 ] } }, { "index": 86, "index_chain": 17, "chain_name": "F", "nt_resnum": 19, "nt_name": "G", "nt_code": "G", "nt_id": "///F/19", "linked_nts": [ "///F/18", "///F/20" ], "nt_type": "RNA", "dbn": "[", "summary": "pseudoknotted,anti,~C3'-endo,BI,isolated-canonical,non-pair-contact,helix-end,hairpin-loop,kissing-loop,cap-acceptor,phosphate,splayed-apart", "alpha": -166.467, "beta": -115.937, "gamma": 72.966, "delta": 86.977, "epsilon": 172.783, "zeta": -116.944, "epsilon_zeta": -70.273, "bb_type": "BI", "chi": -114.669, "glyco_bond": "anti", "C5prime_xyz": [ -1.398, 8.060, -2.085 ], "P_xyz": [ 1.212, 7.682, -1.978 ], "form": ".", "ssZp": 2.576, "Dp": 4.286, "splay_angle": 99.851, "splay_distance": 15.733, "splay_ratio": 0.766, "d22": null, "d64": null, "eta": -173.540, "theta": 134.889, "eta_prime": -158.609, "theta_prime": 110.404, "eta_base": -121.437, "theta_base": 104.530, "v0": 8.994, "v1": -29.432, "v2": 37.133, "v3": -33.249, "v4": 15.435, "amplitude": 37.283, "phase_angle": 5.129, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.006, "frame": { "rmsd": 0.006, "origin": [ 142.443, 55.373, 40.019 ], "x_axis": [ 0.389, 0.305, 0.869 ], "y_axis": [ -0.908, 0.289, 0.305 ], "z_axis": [ -0.158, -0.908, 0.389 ], "quaternion": [ 0.719, 0.422, -0.357, 0.422 ] } }, { "index": 87, "index_chain": 18, "chain_name": "F", "nt_resnum": 20, "nt_name": "U", "nt_code": "U", "nt_id": "///F/20", "linked_nts": [ "///F/19", "///F/21" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BII,non-stack,non-pair-contact,hairpin-loop,kissing-loop,phosphate,splayed-apart", "alpha": -73.676, "beta": 68.695, "gamma": -178.666, "delta": 82.076, "epsilon": -129.724, "zeta": 141.602, "epsilon_zeta": 88.674, "bb_type": "BII", "chi": -161.956, "glyco_bond": "anti", "C5prime_xyz": [ -1.355, 8.676, 0.664 ], "P_xyz": [ -2.706, 10.422, -0.766 ], "form": ".", "ssZp": 4.448, "Dp": 4.764, "splay_angle": 85.486, "splay_distance": 12.071, "splay_ratio": 0.679, "d22": null, "d64": null, "eta": -128.591, "theta": 45.508, "eta_prime": -157.411, "theta_prime": 100.559, "eta_base": -157.488, "theta_base": 133.463, "v0": 3.876, "v1": -26.589, "v2": 38.086, "v3": -36.792, "v4": 20.696, "amplitude": 39.085, "phase_angle": 12.982, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1e", "suiteness": 0.010, "filter_rmsd": 0.105, "frame": { "rmsd": 0.004, "origin": [ 128.811, 55.116, 32.168 ], "x_axis": [ -0.318, -0.938, -0.141 ], "y_axis": [ 0.246, -0.226, 0.943 ], "z_axis": [ -0.916, 0.265, 0.302 ], "quaternion": [ -0.436, -0.389, 0.444, 0.679 ] } }, { "index": 88, "index_chain": 19, "chain_name": "F", "nt_resnum": 21, "nt_name": "A", "nt_code": "A", "nt_id": "///F/21", "linked_nts": [ "///F/20", "///F/22" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-canonical,non-pair-contact,helix,multiplet,hairpin-loop,kissing-loop,splayed-apart", "alpha": 142.095, "beta": -102.681, "gamma": 173.591, "delta": 84.402, "epsilon": -109.887, "zeta": -64.555, "epsilon_zeta": -45.332, "bb_type": "--", "chi": -148.888, "glyco_bond": "anti", "C5prime_xyz": [ -1.139, 8.683, -0.152 ], "P_xyz": [ -0.093, 8.441, -2.544 ], "form": ".", "ssZp": 3.515, "Dp": 4.689, "splay_angle": 40.861, "splay_distance": 7.011, "splay_ratio": 0.350, "d22": null, "d64": null, "eta": -134.975, "theta": -151.878, "eta_prime": -163.593, "theta_prime": -174.800, "eta_base": 163.644, "theta_base": 171.219, "v0": 4.038, "v1": -26.068, "v2": 37.073, "v3": -35.844, "v4": 20.116, "amplitude": 38.013, "phase_angle": 12.767, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.004, "origin": [ 123.924, 64.504, 37.972 ], "x_axis": [ -0.631, -0.494, -0.599 ], "y_axis": [ 0.168, -0.840, 0.517 ], "z_axis": [ -0.758, 0.226, 0.612 ], "quaternion": [ -0.188, -0.386, 0.211, 0.878 ] } }, { "index": 89, "index_chain": 20, "chain_name": "F", "nt_resnum": 22, "nt_name": "G", "nt_code": "G", "nt_id": "///F/22", "linked_nts": [ "///F/21", "///F/23" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,hairpin-loop,kissing-loop", "alpha": -102.253, "beta": 72.863, "gamma": 160.728, "delta": 84.744, "epsilon": -113.757, "zeta": -86.204, "epsilon_zeta": -27.553, "bb_type": "--", "chi": 165.470, "glyco_bond": "anti", "C5prime_xyz": [ -1.817, 7.990, 2.319 ], "P_xyz": [ -1.601, 10.161, 0.801 ], "form": "A", "ssZp": 4.412, "Dp": 4.640, "splay_angle": 21.108, "splay_distance": 3.424, "splay_ratio": 0.188, "d22": null, "d64": null, "eta": -173.017, "theta": 167.641, "eta_prime": 176.925, "theta_prime": -174.021, "eta_base": 173.162, "theta_base": -144.614, "v0": 6.169, "v1": -26.323, "v2": 35.080, "v3": -32.798, "v4": 16.942, "amplitude": 35.525, "phase_angle": 9.077, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1e", "suiteness": 0.058, "filter_rmsd": 0.013, "frame": { "rmsd": 0.013, "origin": [ 120.864, 68.305, 43.007 ], "x_axis": [ -0.384, -0.235, -0.893 ], "y_axis": [ 0.320, -0.941, 0.110 ], "z_axis": [ -0.866, -0.243, 0.437 ], "quaternion": [ -0.167, -0.529, -0.040, 0.831 ] } }, { "index": 90, "index_chain": 21, "chain_name": "F", "nt_resnum": 23, "nt_name": "C", "nt_code": "C", "nt_id": "///F/23", "linked_nts": [ "///F/22", "///F/24" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet", "alpha": -67.516, "beta": 166.382, "gamma": 48.812, "delta": 81.701, "epsilon": -151.850, "zeta": -80.065, "epsilon_zeta": -71.785, "bb_type": "BI", "chi": -157.501, "glyco_bond": "anti", "C5prime_xyz": [ -1.619, 8.842, 0.440 ], "P_xyz": [ 0.917, 9.441, 0.504 ], "form": "A", "ssZp": 4.378, "Dp": 4.509, "splay_angle": 19.751, "splay_distance": 3.181, "splay_ratio": 0.173, "d22": null, "d64": null, "eta": 152.474, "theta": -153.888, "eta_prime": 170.137, "theta_prime": -154.463, "eta_base": -152.695, "theta_base": -137.743, "v0": -2.006, "v1": -22.015, "v2": 36.430, "v3": -38.530, "v4": 25.510, "amplitude": 39.139, "phase_angle": 21.441, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.357, "filter_rmsd": 0.062, "frame": { "rmsd": 0.006, "origin": [ 117.698, 69.413, 43.692 ], "x_axis": [ -0.119, -0.753, -0.648 ], "y_axis": [ 0.378, -0.637, 0.671 ], "z_axis": [ -0.918, -0.165, 0.360 ], "quaternion": [ -0.389, -0.538, 0.174, 0.727 ] } }, { "index": 91, "index_chain": 22, "chain_name": "F", "nt_resnum": 24, "nt_name": "G", "nt_code": "G", "nt_id": "///F/24", "linked_nts": [ "///F/23", "///F/25" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -66.785, "beta": 173.244, "gamma": 49.092, "delta": 85.238, "epsilon": -157.940, "zeta": -60.631, "epsilon_zeta": -97.309, "bb_type": "BI", "chi": -156.479, "glyco_bond": "anti", "C5prime_xyz": [ -1.389, 8.804, 0.331 ], "P_xyz": [ 1.181, 9.312, 0.442 ], "form": "A", "ssZp": 4.342, "Dp": 4.527, "splay_angle": 20.635, "splay_distance": 3.403, "splay_ratio": 0.183, "d22": null, "d64": null, "eta": 162.672, "theta": -136.360, "eta_prime": 172.260, "theta_prime": -134.933, "eta_base": -158.369, "theta_base": -96.734, "v0": 1.403, "v1": -24.183, "v2": 36.607, "v3": -36.578, "v4": 22.186, "amplitude": 38.161, "phase_angle": 16.409, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.889, "filter_rmsd": 0.007, "frame": { "rmsd": 0.007, "origin": [ 114.533, 69.729, 43.685 ], "x_axis": [ 0.291, -0.898, -0.329 ], "y_axis": [ 0.251, -0.260, 0.932 ], "z_axis": [ -0.923, -0.354, 0.150 ], "quaternion": [ 0.543, 0.592, -0.273, -0.529 ] } }, { "index": 92, "index_chain": 23, "chain_name": "F", "nt_resnum": 25, "nt_name": "C", "nt_code": "C", "nt_id": "///F/25", "linked_nts": [ "///F/24", "///F/26" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,junction-loop", "alpha": -61.699, "beta": 178.117, "gamma": 47.379, "delta": 84.467, "epsilon": -163.062, "zeta": -85.892, "epsilon_zeta": -77.170, "bb_type": "BI", "chi": -145.708, "glyco_bond": "anti", "C5prime_xyz": [ -1.665, 8.844, -0.348 ], "P_xyz": [ 0.830, 9.614, -0.134 ], "form": ".", "ssZp": 3.827, "Dp": 4.339, "splay_angle": 30.543, "splay_distance": 5.040, "splay_ratio": 0.264, "d22": null, "d64": null, "eta": 170.019, "theta": -130.362, "eta_prime": -169.959, "theta_prime": -137.246, "eta_base": -116.135, "theta_base": -106.121, "v0": -0.844, "v1": -22.043, "v2": 35.208, "v3": -36.835, "v4": 23.709, "amplitude": 37.457, "phase_angle": 19.956, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.818, "filter_rmsd": 0.064, "frame": { "rmsd": 0.009, "origin": [ 112.748, 67.032, 42.628 ], "x_axis": [ 0.503, -0.809, 0.303 ], "y_axis": [ -0.180, 0.245, 0.953 ], "z_axis": [ -0.845, -0.534, -0.022 ], "quaternion": [ 0.657, 0.566, -0.437, -0.240 ] } }, { "index": 93, "index_chain": 24, "chain_name": "F", "nt_resnum": 26, "nt_name": "A", "nt_code": "A", "nt_id": "///F/26", "linked_nts": [ "///F/25", "///F/27" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-canonical,non-pair-contact,helix,junction-loop,phosphate", "alpha": 145.475, "beta": -145.188, "gamma": 173.477, "delta": 83.623, "epsilon": -116.586, "zeta": -78.821, "epsilon_zeta": -37.765, "bb_type": "--", "chi": 162.673, "glyco_bond": "anti", "C5prime_xyz": [ -1.873, 7.799, 2.536 ], "P_xyz": [ 0.072, 9.459, 2.126 ], "form": ".", "ssZp": 4.624, "Dp": 4.625, "splay_angle": 32.199, "splay_distance": 4.865, "splay_ratio": 0.278, "d22": null, "d64": null, "eta": 167.581, "theta": -144.803, "eta_prime": -177.936, "theta_prime": -137.605, "eta_base": -128.429, "theta_base": -87.574, "v0": 2.073, "v1": -24.739, "v2": 37.228, "v3": -37.051, "v4": 22.068, "amplitude": 38.679, "phase_angle": 15.747, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.647, "filter_rmsd": 0.040, "frame": { "rmsd": 0.005, "origin": [ 110.050, 62.806, 43.144 ], "x_axis": [ 0.639, -0.299, 0.709 ], "y_axis": [ -0.213, 0.817, 0.536 ], "z_axis": [ -0.739, -0.493, 0.458 ], "quaternion": [ 0.853, 0.302, -0.424, -0.025 ] } }, { "index": 94, "index_chain": 25, "chain_name": "F", "nt_resnum": 27, "nt_name": "G", "nt_code": "G", "nt_id": "///F/27", "linked_nts": [ "///F/26", "///F/28" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,junction-loop,phosphate", "alpha": -36.967, "beta": 160.823, "gamma": 32.256, "delta": 82.344, "epsilon": -151.529, "zeta": -67.624, "epsilon_zeta": -83.905, "bb_type": "BI", "chi": -173.116, "glyco_bond": "anti", "C5prime_xyz": [ -1.250, 8.565, 1.377 ], "P_xyz": [ 1.206, 8.580, 2.273 ], "form": "A", "ssZp": 4.714, "Dp": 4.598, "splay_angle": 20.068, "splay_distance": 3.187, "splay_ratio": 0.177, "d22": null, "d64": null, "eta": 162.639, "theta": -140.390, "eta_prime": -174.135, "theta_prime": -138.361, "eta_base": -105.004, "theta_base": -110.322, "v0": -0.494, "v1": -22.206, "v2": 35.148, "v3": -36.420, "v4": 23.396, "amplitude": 37.265, "phase_angle": 19.404, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.078, "filter_rmsd": 0.011, "frame": { "rmsd": 0.011, "origin": [ 108.647, 59.945, 46.821 ], "x_axis": [ 0.189, 0.530, 0.827 ], "y_axis": [ -0.491, 0.780, -0.388 ], "z_axis": [ -0.850, -0.333, 0.408 ], "quaternion": [ 0.771, -0.018, -0.544, 0.331 ] } }, { "index": 95, "index_chain": 26, "chain_name": "F", "nt_resnum": 28, "nt_name": "C", "nt_code": "C", "nt_id": "///F/28", "linked_nts": [ "///F/27", "///F/29" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop,phosphate", "alpha": -63.381, "beta": -179.503, "gamma": 45.070, "delta": 81.484, "epsilon": -153.818, "zeta": -69.968, "epsilon_zeta": -83.851, "bb_type": "BI", "chi": -148.951, "glyco_bond": "anti", "C5prime_xyz": [ -1.156, 8.717, -0.087 ], "P_xyz": [ 1.413, 9.179, -0.116 ], "form": "A", "ssZp": 4.161, "Dp": 4.652, "splay_angle": 30.320, "splay_distance": 4.748, "splay_ratio": 0.262, "d22": null, "d64": null, "eta": 166.201, "theta": -149.474, "eta_prime": 179.550, "theta_prime": -146.019, "eta_base": -137.522, "theta_base": -123.016, "v0": 5.470, "v1": -28.484, "v2": 39.346, "v3": -37.337, "v4": 20.091, "amplitude": 40.079, "phase_angle": 10.970, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.854, "filter_rmsd": 0.061, "frame": { "rmsd": 0.006, "origin": [ 107.275, 58.331, 49.201 ], "x_axis": [ -0.224, 0.826, 0.517 ], "y_axis": [ -0.681, 0.247, -0.690 ], "z_axis": [ -0.698, -0.506, 0.507 ], "quaternion": [ 0.619, -0.074, -0.491, 0.609 ] } }, { "index": 96, "index_chain": 27, "chain_name": "F", "nt_resnum": 29, "nt_name": "A", "nt_code": "A", "nt_id": "///F/29", "linked_nts": [ "///F/28", "///F/30" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -61.307, "beta": -176.551, "gamma": 45.771, "delta": 83.048, "epsilon": -159.804, "zeta": -76.083, "epsilon_zeta": -83.722, "bb_type": "BI", "chi": -167.784, "glyco_bond": "anti", "C5prime_xyz": [ -1.364, 8.550, 1.119 ], "P_xyz": [ 1.121, 8.952, 1.763 ], "form": "A", "ssZp": 4.704, "Dp": 4.571, "splay_angle": 25.095, "splay_distance": 3.905, "splay_ratio": 0.222, "d22": null, "d64": null, "eta": 169.940, "theta": -156.641, "eta_prime": -178.047, "theta_prime": -153.783, "eta_base": -143.287, "theta_base": -136.998, "v0": 3.263, "v1": -25.543, "v2": 36.970, "v3": -36.228, "v4": 20.738, "amplitude": 38.086, "phase_angle": 13.901, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.856, "filter_rmsd": 0.039, "frame": { "rmsd": 0.011, "origin": [ 104.431, 57.154, 52.816 ], "x_axis": [ -0.173, 0.979, -0.109 ], "y_axis": [ -0.341, -0.163, -0.926 ], "z_axis": [ -0.924, -0.123, 0.361 ], "quaternion": [ 0.506, -0.396, -0.403, 0.651 ] } }, { "index": 97, "index_chain": 28, "chain_name": "F", "nt_resnum": 30, "nt_name": "G", "nt_code": "G", "nt_id": "///F/30", "linked_nts": [ "///F/29", "///F/31" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -65.028, "beta": 179.640, "gamma": 50.515, "delta": 83.283, "epsilon": -158.253, "zeta": -68.705, "epsilon_zeta": -89.547, "bb_type": "BI", "chi": -168.100, "glyco_bond": "anti", "C5prime_xyz": [ -1.361, 8.649, 1.037 ], "P_xyz": [ 1.201, 9.002, 1.499 ], "form": "A", "ssZp": 4.599, "Dp": 4.575, "splay_angle": 25.201, "splay_distance": 4.122, "splay_ratio": 0.229, "d22": null, "d64": null, "eta": 168.820, "theta": -145.643, "eta_prime": 177.937, "theta_prime": -142.730, "eta_base": -154.143, "theta_base": -125.749, "v0": 2.125, "v1": -25.660, "v2": 38.478, "v3": -38.055, "v4": 22.470, "amplitude": 39.921, "phase_angle": 15.454, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.885, "filter_rmsd": 0.010, "frame": { "rmsd": 0.010, "origin": [ 102.320, 56.991, 56.097 ], "x_axis": [ -0.203, 0.813, -0.546 ], "y_axis": [ -0.248, -0.582, -0.774 ], "z_axis": [ -0.947, -0.022, 0.320 ], "quaternion": [ 0.366, -0.514, -0.274, 0.726 ] } }, { "index": 98, "index_chain": 29, "chain_name": "F", "nt_resnum": 31, "nt_name": "A", "nt_code": "A", "nt_id": "///F/31", "linked_nts": [ "///F/30", "///F/32" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop,phosphate", "alpha": -56.792, "beta": -179.184, "gamma": 55.929, "delta": 86.539, "epsilon": -147.214, "zeta": -74.034, "epsilon_zeta": -73.180, "bb_type": "BI", "chi": -161.868, "glyco_bond": "anti", "C5prime_xyz": [ -1.907, 8.791, 0.633 ], "P_xyz": [ 0.487, 9.531, 1.406 ], "form": ".", "ssZp": 4.130, "Dp": 4.241, "splay_angle": 25.177, "splay_distance": 3.977, "splay_ratio": 0.220, "d22": null, "d64": null, "eta": -173.320, "theta": -139.286, "eta_prime": -160.761, "theta_prime": -127.639, "eta_base": -134.904, "theta_base": -71.029, "v0": -4.069, "v1": -18.261, "v2": 32.460, "v3": -35.789, "v4": 25.080, "amplitude": 35.829, "phase_angle": 25.043, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.834, "filter_rmsd": 0.037, "frame": { "rmsd": 0.005, "origin": [ 99.692, 58.972, 58.578 ], "x_axis": [ -0.184, 0.469, -0.864 ], "y_axis": [ -0.134, -0.882, -0.451 ], "z_axis": [ -0.974, 0.033, 0.225 ], "quaternion": [ 0.199, -0.607, -0.138, 0.757 ] } }, { "index": 99, "index_chain": 30, "chain_name": "F", "nt_resnum": 32, "nt_name": "U", "nt_code": "U", "nt_id": "///F/32", "linked_nts": [ "///F/31", "///F/33" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C2'-endo,non-canonical,non-pair-contact,helix-end,hairpin-loop,phosphate,splayed-apart", "alpha": -43.290, "beta": 176.537, "gamma": 42.203, "delta": 99.339, "epsilon": 80.429, "zeta": 104.367, "epsilon_zeta": -23.939, "bb_type": "--", "chi": -116.675, "glyco_bond": "anti", "C5prime_xyz": [ -1.513, 8.290, -1.203 ], "P_xyz": [ 0.914, 8.713, -0.413 ], "form": ".", "ssZp": 0.881, "Dp": 0.902, "splay_angle": 124.705, "splay_distance": 17.377, "splay_ratio": 0.886, "d22": 9.039, "d64": 11.214, "eta": -174.482, "theta": -31.698, "eta_prime": -132.318, "theta_prime": -66.397, "eta_base": -74.660, "theta_base": -43.086, "v0": -3.164, "v1": 14.869, "v2": -20.944, "v3": 19.803, "v4": -10.275, "amplitude": 21.306, "phase_angle": 190.584, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.160, "filter_rmsd": 0.105, "frame": { "rmsd": 0.006, "origin": [ 96.187, 59.007, 56.701 ], "x_axis": [ -0.010, -0.427, -0.904 ], "y_axis": [ -0.135, -0.895, 0.425 ], "z_axis": [ -0.991, 0.126, -0.049 ], "quaternion": [ 0.107, 0.695, -0.202, -0.681 ] } }, { "index": 100, "index_chain": 31, "chain_name": "F", "nt_resnum": 33, "nt_name": "U", "nt_code": "U", "nt_id": "///F/33", "linked_nts": [ "///F/32", "///F/34" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,anti,~C2'-endo,non-pair-contact,hairpin-loop,phosphate,splayed-apart", "alpha": 26.976, "beta": 133.550, "gamma": -43.527, "delta": 112.706, "epsilon": 104.793, "zeta": -167.031, "epsilon_zeta": -88.176, "bb_type": "--", "chi": -131.278, "glyco_bond": "anti", "C5prime_xyz": [ -1.256, 8.349, -0.410 ], "P_xyz": [ -0.000, 9.551, 1.508 ], "form": ".", "ssZp": 1.544, "Dp": 1.398, "splay_angle": 149.181, "splay_distance": 18.722, "splay_ratio": 0.964, "d22": null, "d64": null, "eta": 175.837, "theta": 60.004, "eta_prime": -130.909, "theta_prime": 46.606, "eta_base": -125.337, "theta_base": -163.364, "v0": -1.675, "v1": 13.709, "v2": -20.372, "v3": 20.037, "v4": -11.304, "amplitude": 21.021, "phase_angle": 194.279, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.105, "frame": { "rmsd": 0.005, "origin": [ 88.391, 46.627, 66.077 ], "x_axis": [ 0.559, -0.504, -0.658 ], "y_axis": [ 0.513, 0.834, -0.203 ], "z_axis": [ 0.652, -0.224, 0.725 ], "quaternion": [ 0.883, 0.006, 0.371, -0.288 ] } }, { "index": 101, "index_chain": 32, "chain_name": "F", "nt_resnum": 34, "nt_name": "G", "nt_code": "G", "nt_id": "///F/34", "linked_nts": [ "///F/33", "///F/35" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C2'-endo,non-pair-contact,hairpin-loop,phosphate,splayed-apart", "alpha": -51.888, "beta": 138.670, "gamma": 169.542, "delta": 107.234, "epsilon": 47.293, "zeta": 70.253, "epsilon_zeta": -22.960, "bb_type": "--", "chi": -160.356, "glyco_bond": "anti", "C5prime_xyz": [ -1.205, 8.198, 1.140 ], "P_xyz": [ 0.631, 9.915, 0.389 ], "form": ".", "ssZp": 0.643, "Dp": 1.013, "splay_angle": 98.478, "splay_distance": 14.305, "splay_ratio": 0.759, "d22": null, "d64": null, "eta": -18.189, "theta": 143.595, "eta_prime": -33.155, "theta_prime": -179.783, "eta_base": 173.473, "theta_base": -142.576, "v0": 1.549, "v1": 12.484, "v2": -21.463, "v3": 23.079, "v4": -15.185, "amplitude": 23.228, "phase_angle": 202.476, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.006, "frame": { "rmsd": 0.006, "origin": [ 88.517, 62.172, 76.510 ], "x_axis": [ -0.622, -0.661, 0.419 ], "y_axis": [ 0.160, -0.631, -0.759 ], "z_axis": [ 0.766, -0.405, 0.499 ], "quaternion": [ -0.247, 0.357, -0.351, 0.829 ] } }, { "index": 102, "index_chain": 33, "chain_name": "F", "nt_resnum": 35, "nt_name": "C", "nt_code": "C", "nt_id": "///F/35", "linked_nts": [ "///F/34", "///F/36" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C2'-endo,non-pair-contact,hairpin-loop,phosphate,splayed-apart", "alpha": 166.101, "beta": -148.120, "gamma": 154.820, "delta": 130.065, "epsilon": -87.508, "zeta": -54.324, "epsilon_zeta": -33.183, "bb_type": "--", "chi": -149.914, "glyco_bond": "anti", "C5prime_xyz": [ -1.674, 8.545, 0.498 ], "P_xyz": [ 0.908, 8.706, 0.364 ], "form": ".", "ssZp": 1.108, "Dp": 1.695, "splay_angle": 78.699, "splay_distance": 12.543, "splay_ratio": 0.636, "d22": null, "d64": null, "eta": -96.620, "theta": -60.101, "eta_prime": -90.346, "theta_prime": -63.849, "eta_base": -95.001, "theta_base": -35.982, "v0": -7.891, "v1": 19.084, "v2": -22.795, "v3": 19.356, "v4": -7.160, "amplitude": 22.795, "phase_angle": 179.626, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.061, "frame": { "rmsd": 0.009, "origin": [ 101.382, 64.115, 70.565 ], "x_axis": [ 0.228, -0.915, 0.332 ], "y_axis": [ -0.904, -0.326, -0.276 ], "z_axis": [ 0.361, -0.237, -0.902 ], "quaternion": [ -0.012, 0.784, -0.581, 0.221 ] } }, { "index": 103, "index_chain": 34, "chain_name": "F", "nt_resnum": 36, "nt_name": "A", "nt_code": "A", "nt_id": "///F/36", "linked_nts": [ "///F/35", "///F/37" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C2'-endo,non-pair-contact,hairpin-loop,cap-donor,phosphate,splayed-apart", "alpha": -72.956, "beta": -176.028, "gamma": 53.203, "delta": 134.337, "epsilon": -124.340, "zeta": 133.775, "epsilon_zeta": 101.885, "bb_type": "--", "chi": -161.300, "glyco_bond": "anti", "C5prime_xyz": [ -2.283, 8.505, 1.042 ], "P_xyz": [ -0.912, 8.572, 3.293 ], "form": ".", "ssZp": 0.936, "Dp": 1.481, "splay_angle": 169.523, "splay_distance": 18.188, "splay_ratio": 0.996, "d22": null, "d64": null, "eta": 150.200, "theta": 141.475, "eta_prime": -156.415, "theta_prime": 91.945, "eta_base": -127.150, "theta_base": -167.030, "v0": -10.491, "v1": 22.975, "v2": -26.140, "v3": 21.517, "v4": -6.996, "amplitude": 26.190, "phase_angle": 176.478, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "2[", "suiteness": 0.169, "filter_rmsd": 0.038, "frame": { "rmsd": 0.007, "origin": [ 93.951, 57.408, 63.007 ], "x_axis": [ 0.345, -0.278, 0.897 ], "y_axis": [ 0.227, 0.951, 0.207 ], "z_axis": [ -0.911, 0.132, 0.391 ], "quaternion": [ 0.820, 0.023, -0.551, -0.154 ] } }, { "index": 104, "index_chain": 35, "chain_name": "F", "nt_resnum": 37, "nt_name": "A", "nt_code": "A", "nt_id": "///F/37", "linked_nts": [ "///F/36", "///F/38" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,~C2'-endo,non-pair-contact,hairpin-loop,phosphate,splayed-apart", "alpha": 54.394, "beta": -155.861, "gamma": 51.342, "delta": 114.236, "epsilon": 67.060, "zeta": 137.589, "epsilon_zeta": -70.529, "bb_type": "--", "chi": -79.287, "glyco_bond": "--", "C5prime_xyz": [ -2.019, 7.087, -2.833 ], "P_xyz": [ 0.429, 7.901, -2.825 ], "form": ".", "ssZp": -0.065, "Dp": 0.342, "splay_angle": 121.956, "splay_distance": 16.653, "splay_ratio": 0.874, "d22": null, "d64": null, "eta": -10.012, "theta": 6.179, "eta_prime": 19.917, "theta_prime": -38.175, "eta_base": -101.930, "theta_base": 5.682, "v0": -0.422, "v1": 13.581, "v2": -21.408, "v3": 21.863, "v4": -13.339, "amplitude": 22.489, "phase_angle": 197.835, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.040, "frame": { "rmsd": 0.009, "origin": [ 90.866, 72.929, 54.041 ], "x_axis": [ -0.910, 0.022, 0.414 ], "y_axis": [ 0.334, -0.552, 0.764 ], "z_axis": [ 0.246, 0.834, 0.495 ], "quaternion": [ -0.091, 0.192, 0.465, 0.860 ] } }, { "index": 105, "index_chain": 36, "chain_name": "F", "nt_resnum": 38, "nt_name": "A", "nt_code": "A", "nt_id": "///F/38", "linked_nts": [ "///F/37", "///F/39" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-canonical,non-pair-contact,helix-end,hairpin-loop,cap-acceptor,phosphate,splayed-apart", "alpha": 72.760, "beta": -102.562, "gamma": -179.140, "delta": 82.406, "epsilon": -102.678, "zeta": -77.215, "epsilon_zeta": -25.464, "bb_type": "--", "chi": 155.805, "glyco_bond": "anti", "C5prime_xyz": [ -2.200, 7.615, 2.720 ], "P_xyz": [ -0.308, 9.145, 1.812 ], "form": ".", "ssZp": 4.364, "Dp": 4.599, "splay_angle": 27.544, "splay_distance": 4.292, "splay_ratio": 0.242, "d22": null, "d64": null, "eta": 151.221, "theta": -132.942, "eta_prime": -158.146, "theta_prime": -131.156, "eta_base": -156.400, "theta_base": -74.313, "v0": 2.247, "v1": -24.807, "v2": 37.400, "v3": -37.154, "v4": 21.643, "amplitude": 38.796, "phase_angle": 15.418, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.039, "frame": { "rmsd": 0.008, "origin": [ 97.777, 60.307, 62.422 ], "x_axis": [ -0.399, -0.457, -0.795 ], "y_axis": [ -0.106, 0.884, -0.455 ], "z_axis": [ 0.911, -0.097, -0.401 ], "quaternion": [ 0.521, -0.172, 0.819, -0.168 ] } }, { "index": 106, "index_chain": 37, "chain_name": "F", "nt_resnum": 39, "nt_name": "U", "nt_code": "U", "nt_id": "///F/39", "linked_nts": [ "///F/38", "///F/40" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop", "alpha": -47.777, "beta": 159.386, "gamma": 35.627, "delta": 79.567, "epsilon": -154.520, "zeta": -83.494, "epsilon_zeta": -71.027, "bb_type": "BI", "chi": -158.226, "glyco_bond": "anti", "C5prime_xyz": [ -1.601, 8.762, 0.558 ], "P_xyz": [ 0.961, 9.180, 0.811 ], "form": "A", "ssZp": 4.514, "Dp": 4.590, "splay_angle": 23.848, "splay_distance": 3.764, "splay_ratio": 0.209, "d22": 4.234, "d64": 4.662, "eta": 144.631, "theta": -154.548, "eta_prime": 172.186, "theta_prime": -153.062, "eta_base": -104.419, "theta_base": -132.456, "v0": -1.769, "v1": -22.881, "v2": 37.688, "v3": -39.593, "v4": 25.819, "amplitude": 40.343, "phase_angle": 20.903, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.056, "filter_rmsd": 0.106, "frame": { "rmsd": 0.009, "origin": [ 99.294, 59.035, 58.614 ], "x_axis": [ -0.214, 0.540, -0.814 ], "y_axis": [ 0.341, 0.822, 0.455 ], "z_axis": [ 0.915, -0.181, -0.360 ], "quaternion": [ 0.559, 0.285, 0.774, 0.089 ] } }, { "index": 107, "index_chain": 38, "chain_name": "F", "nt_resnum": 40, "nt_name": "C", "nt_code": "C", "nt_id": "///F/40", "linked_nts": [ "///F/39", "///F/41" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -44.894, "beta": 163.340, "gamma": 49.065, "delta": 82.429, "epsilon": -144.408, "zeta": -78.424, "epsilon_zeta": -65.984, "bb_type": "BI", "chi": -163.315, "glyco_bond": "anti", "C5prime_xyz": [ -1.555, 8.759, 0.803 ], "P_xyz": [ 1.001, 9.188, 0.981 ], "form": ".", "ssZp": 4.538, "Dp": 4.603, "splay_angle": 31.092, "splay_distance": 4.923, "splay_ratio": 0.269, "d22": 4.105, "d64": 4.499, "eta": 177.990, "theta": -144.001, "eta_prime": -172.733, "theta_prime": -143.197, "eta_base": -142.074, "theta_base": -118.003, "v0": -0.010, "v1": -23.964, "v2": 37.475, "v3": -38.625, "v4": 24.318, "amplitude": 39.558, "phase_angle": 18.678, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.597, "filter_rmsd": 0.060, "frame": { "rmsd": 0.007, "origin": [ 101.652, 57.386, 56.187 ], "x_axis": [ -0.131, 0.863, -0.488 ], "y_axis": [ 0.431, 0.493, 0.756 ], "z_axis": [ 0.893, -0.111, -0.437 ], "quaternion": [ 0.481, 0.451, 0.718, 0.224 ] } }, { "index": 108, "index_chain": 39, "chain_name": "F", "nt_resnum": 41, "nt_name": "U", "nt_code": "U", "nt_id": "///F/41", "linked_nts": [ "///F/40", "///F/42" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -57.028, "beta": 172.692, "gamma": 47.311, "delta": 84.158, "epsilon": -156.172, "zeta": -78.514, "epsilon_zeta": -77.658, "bb_type": "BI", "chi": -179.476, "glyco_bond": "anti", "C5prime_xyz": [ -1.775, 8.479, 1.702 ], "P_xyz": [ 0.622, 8.951, 2.655 ], "form": "A", "ssZp": 4.615, "Dp": 4.532, "splay_angle": 21.243, "splay_distance": 3.509, "splay_ratio": 0.196, "d22": null, "d64": null, "eta": 167.635, "theta": -153.714, "eta_prime": -179.745, "theta_prime": -152.777, "eta_base": -138.106, "theta_base": -140.067, "v0": 0.519, "v1": -23.550, "v2": 36.181, "v3": -36.846, "v4": 22.944, "amplitude": 37.998, "phase_angle": 17.786, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.865, "filter_rmsd": 0.103, "frame": { "rmsd": 0.009, "origin": [ 105.059, 57.394, 52.633 ], "x_axis": [ -0.251, 0.958, 0.138 ], "y_axis": [ 0.195, -0.090, 0.977 ], "z_axis": [ 0.948, 0.272, -0.165 ], "quaternion": [ 0.352, 0.501, 0.576, 0.542 ] } }, { "index": 109, "index_chain": 40, "chain_name": "F", "nt_resnum": 42, "nt_name": "G", "nt_code": "G", "nt_id": "///F/42", "linked_nts": [ "///F/41", "///F/43" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop,phosphate", "alpha": -58.550, "beta": 168.251, "gamma": 55.848, "delta": 86.127, "epsilon": -162.892, "zeta": -61.083, "epsilon_zeta": -101.809, "bb_type": "BI", "chi": -166.969, "glyco_bond": "anti", "C5prime_xyz": [ -1.728, 8.751, 1.024 ], "P_xyz": [ 0.777, 9.442, 1.226 ], "form": "A", "ssZp": 4.515, "Dp": 4.357, "splay_angle": 24.368, "splay_distance": 4.039, "splay_ratio": 0.219, "d22": null, "d64": null, "eta": 172.970, "theta": -140.664, "eta_prime": -173.102, "theta_prime": -141.626, "eta_base": -146.551, "theta_base": -115.694, "v0": -0.391, "v1": -23.727, "v2": 37.485, "v3": -38.670, "v4": 24.483, "amplitude": 39.654, "phase_angle": 19.041, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.857, "filter_rmsd": 0.013, "frame": { "rmsd": 0.013, "origin": [ 106.594, 57.843, 49.510 ], "x_axis": [ 0.083, 0.883, 0.462 ], "y_axis": [ 0.398, -0.454, 0.797 ], "z_axis": [ 0.914, 0.118, -0.389 ], "quaternion": [ 0.245, 0.694, 0.461, 0.496 ] } }, { "index": 110, "index_chain": 41, "chain_name": "F", "nt_resnum": 43, "nt_name": "U", "nt_code": "U", "nt_id": "///F/43", "linked_nts": [ "///F/42", "///F/44" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,junction-loop,phosphate", "alpha": -78.374, "beta": -177.209, "gamma": 62.150, "delta": 86.135, "epsilon": -177.002, "zeta": -96.366, "epsilon_zeta": -80.636, "bb_type": "BI", "chi": -162.146, "glyco_bond": "anti", "C5prime_xyz": [ -2.045, 8.780, 0.552 ], "P_xyz": [ 0.366, 9.719, 0.933 ], "form": ".", "ssZp": 4.113, "Dp": 4.216, "splay_angle": 42.195, "splay_distance": 6.397, "splay_ratio": 0.361, "d22": 5.851, "d64": 6.863, "eta": 167.879, "theta": 177.948, "eta_prime": -171.205, "theta_prime": 176.719, "eta_base": -126.041, "theta_base": -170.658, "v0": -0.880, "v1": -22.701, "v2": 36.149, "v3": -37.582, "v4": 24.077, "amplitude": 38.397, "phase_angle": 19.701, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.640, "filter_rmsd": 0.103, "frame": { "rmsd": 0.009, "origin": [ 108.988, 60.318, 47.400 ], "x_axis": [ 0.270, 0.491, 0.828 ], "y_axis": [ 0.316, -0.858, 0.406 ], "z_axis": [ 0.910, 0.152, -0.387 ], "quaternion": [ 0.080, 0.793, 0.254, 0.548 ] } }, { "index": 111, "index_chain": 42, "chain_name": "F", "nt_resnum": 44, "nt_name": "U", "nt_code": "U", "nt_id": "///F/44", "linked_nts": [ "///F/43", "///F/45" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,junction-loop,phosphate", "alpha": -47.031, "beta": 174.963, "gamma": 50.758, "delta": 83.589, "epsilon": -159.957, "zeta": -28.326, "epsilon_zeta": -131.631, "bb_type": "BI", "chi": 177.121, "glyco_bond": "anti", "C5prime_xyz": [ -1.889, 8.371, 1.819 ], "P_xyz": [ 0.412, 8.605, 2.977 ], "form": ".", "ssZp": 4.371, "Dp": 4.403, "splay_angle": 35.953, "splay_distance": 5.010, "splay_ratio": 0.311, "d22": null, "d64": null, "eta": -171.827, "theta": -109.953, "eta_prime": -173.464, "theta_prime": -122.896, "eta_base": -163.166, "theta_base": -47.293, "v0": -2.307, "v1": -21.644, "v2": 36.200, "v3": -38.411, "v4": 25.683, "amplitude": 39.012, "phase_angle": 21.886, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "&a", "suiteness": 0.716, "filter_rmsd": 0.105, "frame": { "rmsd": 0.006, "origin": [ 110.865, 61.335, 41.369 ], "x_axis": [ 0.234, 0.437, 0.869 ], "y_axis": [ -0.024, -0.891, 0.454 ], "z_axis": [ 0.972, -0.127, -0.198 ], "quaternion": [ 0.191, 0.762, 0.136, 0.604 ] } }, { "index": 112, "index_chain": 43, "chain_name": "F", "nt_resnum": 45, "nt_name": "G", "nt_code": "G", "nt_id": "///F/45", "linked_nts": [ "///F/44", "///F/46" ], "nt_type": "RNA", "dbn": ".", "summary": "syn,~C3'-endo,non-canonical,non-pair-contact,multiplet,junction-loop", "alpha": -164.876, "beta": 136.631, "gamma": 164.196, "delta": 86.736, "epsilon": -85.632, "zeta": -123.965, "epsilon_zeta": 38.334, "bb_type": "--", "chi": 6.866, "glyco_bond": "syn", "C5prime_xyz": [ -5.428, 3.735, -1.031 ], "P_xyz": [ -7.279, 2.462, 0.344 ], "form": ".", "ssZp": -3.689, "Dp": 4.192, "splay_angle": 50.319, "splay_distance": 7.677, "splay_ratio": 0.425, "d22": null, "d64": null, "eta": -178.876, "theta": -162.155, "eta_prime": -169.170, "theta_prime": -138.239, "eta_base": -74.060, "theta_base": -136.801, "v0": -1.538, "v1": -21.216, "v2": 34.511, "v3": -36.559, "v4": 24.068, "amplitude": 36.987, "phase_angle": 21.084, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1f", "suiteness": 0.134, "filter_rmsd": 0.007, "frame": { "rmsd": 0.007, "origin": [ 114.816, 59.832, 44.058 ], "x_axis": [ -0.067, 0.925, 0.373 ], "y_axis": [ -0.415, 0.314, -0.854 ], "z_axis": [ -0.907, -0.213, 0.363 ], "quaternion": [ 0.634, -0.253, -0.505, 0.528 ] } }, { "index": 113, "index_chain": 44, "chain_name": "F", "nt_resnum": 46, "nt_name": "G", "nt_code": "G", "nt_id": "///F/46", "linked_nts": [ "///F/45", "///F/47" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-canonical,non-pair-contact,multiplet,junction-loop,phosphate,splayed-apart", "alpha": -3.388, "beta": 122.031, "gamma": 65.981, "delta": 87.387, "epsilon": 175.306, "zeta": 62.283, "epsilon_zeta": 113.023, "bb_type": "--", "chi": -124.223, "glyco_bond": "anti", "C5prime_xyz": [ -2.579, 8.633, -1.600 ], "P_xyz": [ -0.190, 8.707, -2.603 ], "form": ".", "ssZp": 2.383, "Dp": 2.993, "splay_angle": 112.217, "splay_distance": 17.569, "splay_ratio": 0.831, "d22": null, "d64": null, "eta": -162.580, "theta": -39.204, "eta_prime": -127.055, "theta_prime": -67.049, "eta_base": -144.508, "theta_base": -74.385, "v0": -8.911, "v1": -13.334, "v2": 29.007, "v3": -35.345, "v4": 27.816, "amplitude": 34.723, "phase_angle": 33.343, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.009, "frame": { "rmsd": 0.009, "origin": [ 121.534, 62.023, 41.057 ], "x_axis": [ 0.322, -0.834, 0.447 ], "y_axis": [ -0.354, -0.545, -0.760 ], "z_axis": [ 0.878, 0.086, -0.471 ], "quaternion": [ -0.277, 0.764, -0.389, 0.433 ] } }, { "index": 114, "index_chain": 45, "chain_name": "F", "nt_resnum": 47, "nt_name": "U", "nt_code": "U", "nt_id": "///F/47", "linked_nts": [ "///F/46", "///F/48" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,anti,~C3'-endo,non-stack,non-pair-contact,junction-loop,phosphate,splayed-apart", "alpha": -144.146, "beta": 130.551, "gamma": -163.837, "delta": 82.712, "epsilon": -136.221, "zeta": 132.209, "epsilon_zeta": 91.570, "bb_type": "--", "chi": -129.377, "glyco_bond": "anti", "C5prime_xyz": [ -1.556, 8.552, -1.181 ], "P_xyz": [ -2.219, 10.515, -2.759 ], "form": ".", "ssZp": 2.978, "Dp": 4.722, "splay_angle": 134.207, "splay_distance": 17.148, "splay_ratio": 0.921, "d22": 9.856, "d64": 12.330, "eta": -112.651, "theta": 9.898, "eta_prime": -81.086, "theta_prime": 55.136, "eta_base": -51.134, "theta_base": 134.808, "v0": 4.007, "v1": -26.387, "v2": 37.344, "v3": -36.091, "v4": 20.440, "amplitude": 38.298, "phase_angle": 12.812, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.107, "frame": { "rmsd": 0.012, "origin": [ 123.612, 52.846, 26.220 ], "x_axis": [ 0.273, 0.399, -0.876 ], "y_axis": [ -0.125, 0.917, 0.379 ], "z_axis": [ 0.954, 0.006, 0.300 ], "quaternion": [ 0.789, 0.118, 0.580, 0.166 ] } }, { "index": 115, "index_chain": 46, "chain_name": "F", "nt_resnum": 48, "nt_name": "C", "nt_code": "C", "nt_id": "///F/48", "linked_nts": [ "///F/47", "///F/49" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,anti,~C2'-endo,non-canonical,non-pair-contact,helix,junction-loop,splayed-apart", "alpha": -170.750, "beta": -171.089, "gamma": 164.426, "delta": 126.855, "epsilon": -126.895, "zeta": 59.578, "epsilon_zeta": 173.526, "bb_type": "--", "chi": -171.621, "glyco_bond": "anti", "C5prime_xyz": [ -1.342, 7.941, 1.774 ], "P_xyz": [ 1.202, 8.546, 1.692 ], "form": ".", "ssZp": 2.802, "Dp": 2.774, "splay_angle": 143.998, "splay_distance": 17.588, "splay_ratio": 0.951, "d22": 10.898, "d64": 13.859, "eta": -117.229, "theta": 57.444, "eta_prime": -132.237, "theta_prime": 38.303, "eta_base": 157.960, "theta_base": -108.304, "v0": 0.115, "v1": 13.244, "v2": -20.715, "v3": 21.795, "v4": -13.796, "amplitude": 21.963, "phase_angle": 199.408, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "32t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.005, "origin": [ 129.287, 62.252, 39.387 ], "x_axis": [ 0.066, -0.998, 0.004 ], "y_axis": [ -0.670, -0.047, -0.741 ], "z_axis": [ 0.740, 0.046, -0.672 ], "quaternion": [ -0.295, 0.668, -0.624, 0.278 ] } }, { "index": 116, "index_chain": 47, "chain_name": "F", "nt_resnum": 49, "nt_name": "C", "nt_code": "C", "nt_id": "///F/49", "linked_nts": [ "///F/48", "///F/50" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop,splayed-apart", "alpha": 43.089, "beta": 104.478, "gamma": 80.400, "delta": 84.329, "epsilon": -123.700, "zeta": -82.538, "epsilon_zeta": -41.161, "bb_type": "--", "chi": -171.002, "glyco_bond": "anti", "C5prime_xyz": [ -1.332, 8.555, 1.215 ], "P_xyz": [ 0.601, 8.454, -0.492 ], "form": "A", "ssZp": 4.599, "Dp": 4.719, "splay_angle": 28.826, "splay_distance": 4.616, "splay_ratio": 0.250, "d22": 4.186, "d64": 4.073, "eta": -68.203, "theta": -128.511, "eta_prime": -46.054, "theta_prime": -139.640, "eta_base": 100.654, "theta_base": -122.412, "v0": 1.140, "v1": -24.564, "v2": 37.549, "v3": -38.010, "v4": 23.202, "amplitude": 39.281, "phase_angle": 17.081, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.005, "origin": [ 128.190, 72.358, 25.034 ], "x_axis": [ 0.895, 0.070, 0.441 ], "y_axis": [ -0.320, -0.587, 0.743 ], "z_axis": [ 0.311, -0.806, -0.503 ], "quaternion": [ 0.448, 0.864, -0.072, 0.218 ] } }, { "index": 117, "index_chain": 48, "chain_name": "F", "nt_resnum": 50, "nt_name": "U", "nt_code": "U", "nt_id": "///F/50", "linked_nts": [ "///F/49", "///F/51" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -60.163, "beta": 174.114, "gamma": 42.690, "delta": 81.912, "epsilon": -145.992, "zeta": -67.895, "epsilon_zeta": -78.097, "bb_type": "BI", "chi": -166.802, "glyco_bond": "anti", "C5prime_xyz": [ -1.582, 8.714, 0.902 ], "P_xyz": [ 0.876, 9.279, 1.671 ], "form": "A", "ssZp": 4.506, "Dp": 4.608, "splay_angle": 25.134, "splay_distance": 3.994, "splay_ratio": 0.219, "d22": 3.874, "d64": 3.876, "eta": 161.078, "theta": -138.996, "eta_prime": 174.610, "theta_prime": -135.215, "eta_base": -145.642, "theta_base": -96.543, "v0": 2.481, "v1": -25.104, "v2": 36.979, "v3": -36.391, "v4": 21.438, "amplitude": 38.262, "phase_angle": 14.882, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.544, "filter_rmsd": 0.104, "frame": { "rmsd": 0.005, "origin": [ 131.504, 69.810, 23.075 ], "x_axis": [ 0.271, 0.164, 0.948 ], "y_axis": [ -0.829, -0.460, 0.317 ], "z_axis": [ 0.488, -0.873, 0.011 ], "quaternion": [ 0.453, 0.656, -0.254, 0.548 ] } }, { "index": 118, "index_chain": 49, "chain_name": "F", "nt_resnum": 51, "nt_name": "U", "nt_code": "U", "nt_id": "///F/51", "linked_nts": [ "///F/50", "///F/52" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -64.911, "beta": 176.633, "gamma": 48.940, "delta": 81.603, "epsilon": -163.336, "zeta": -75.154, "epsilon_zeta": -88.183, "bb_type": "BI", "chi": -163.114, "glyco_bond": "anti", "C5prime_xyz": [ -1.583, 8.704, 0.718 ], "P_xyz": [ 0.915, 9.236, 1.243 ], "form": "A", "ssZp": 4.434, "Dp": 4.502, "splay_angle": 20.353, "splay_distance": 3.209, "splay_ratio": 0.178, "d22": null, "d64": null, "eta": 163.647, "theta": -156.841, "eta_prime": -178.112, "theta_prime": -157.257, "eta_base": -123.337, "theta_base": -138.465, "v0": 1.036, "v1": -24.084, "v2": 36.656, "v3": -37.139, "v4": 22.795, "amplitude": 38.362, "phase_angle": 17.150, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.954, "filter_rmsd": 0.104, "frame": { "rmsd": 0.002, "origin": [ 134.320, 67.565, 24.803 ], "x_axis": [ -0.439, -0.018, 0.898 ], "y_axis": [ -0.793, -0.462, -0.397 ], "z_axis": [ 0.422, -0.887, 0.188 ], "quaternion": [ 0.268, 0.457, -0.444, 0.723 ] } }, { "index": 119, "index_chain": 50, "chain_name": "F", "nt_resnum": 52, "nt_name": "A", "nt_code": "A", "nt_id": "///F/52", "linked_nts": [ "///F/51", "///F/53" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -60.518, "beta": 166.495, "gamma": 56.535, "delta": 85.447, "epsilon": -162.789, "zeta": -62.439, "epsilon_zeta": -100.350, "bb_type": "BI", "chi": -162.078, "glyco_bond": "anti", "C5prime_xyz": [ -1.452, 8.713, 0.663 ], "P_xyz": [ 1.168, 9.122, 0.628 ], "form": ".", "ssZp": 4.443, "Dp": 4.472, "splay_angle": 19.847, "splay_distance": 3.828, "splay_ratio": 0.197, "d22": null, "d64": null, "eta": 170.290, "theta": -121.414, "eta_prime": -175.786, "theta_prime": -140.137, "eta_base": -142.535, "theta_base": -142.873, "v0": 3.201, "v1": -25.112, "v2": 36.267, "v3": -35.367, "v4": 20.308, "amplitude": 37.341, "phase_angle": 13.774, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.806, "filter_rmsd": 0.038, "frame": { "rmsd": 0.004, "origin": [ 136.923, 65.956, 25.767 ], "x_axis": [ -0.675, -0.338, 0.655 ], "y_axis": [ -0.465, -0.494, -0.734 ], "z_axis": [ 0.572, -0.801, 0.177 ], "quaternion": [ 0.042, 0.401, -0.501, 0.766 ] } }, { "index": 120, "index_chain": 51, "chain_name": "F", "nt_resnum": 53, "nt_name": "G", "nt_code": "G", "nt_id": "///F/53", "linked_nts": [ "///F/52", "///F/54" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop,kissing-loop", "alpha": 163.775, "beta": 169.917, "gamma": 168.244, "delta": 85.016, "epsilon": -167.473, "zeta": -68.343, "epsilon_zeta": -99.130, "bb_type": "BI", "chi": -173.177, "glyco_bond": "anti", "C5prime_xyz": [ -1.431, 8.594, 1.291 ], "P_xyz": [ -0.262, 10.649, 0.122 ], "form": "A", "ssZp": 4.483, "Dp": 4.449, "splay_angle": 23.823, "splay_distance": 3.668, "splay_ratio": 0.209, "d22": null, "d64": null, "eta": 157.263, "theta": 177.764, "eta_prime": 169.842, "theta_prime": -171.056, "eta_base": -170.841, "theta_base": -148.618, "v0": 2.645, "v1": -24.947, "v2": 36.550, "v3": -36.024, "v4": 21.095, "amplitude": 37.788, "phase_angle": 14.708, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.581, "filter_rmsd": 0.005, "frame": { "rmsd": 0.005, "origin": [ 139.554, 65.549, 28.518 ], "x_axis": [ -0.906, -0.290, 0.307 ], "y_axis": [ -0.127, -0.507, -0.852 ], "z_axis": [ 0.403, -0.812, 0.423 ], "quaternion": [ -0.048, 0.211, -0.494, 0.842 ] } }, { "index": 121, "index_chain": 52, "chain_name": "F", "nt_resnum": 54, "nt_name": "U", "nt_code": "U", "nt_id": "///F/54", "linked_nts": [ "///F/53", "///F/55" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,hairpin-loop,kissing-loop", "alpha": -102.090, "beta": -143.298, "gamma": 59.346, "delta": 87.083, "epsilon": -156.259, "zeta": -49.440, "epsilon_zeta": -106.819, "bb_type": "BI", "chi": -151.379, "glyco_bond": "anti", "C5prime_xyz": [ -1.275, 8.705, 0.004 ], "P_xyz": [ 1.212, 8.949, 0.818 ], "form": ".", "ssZp": 4.135, "Dp": 4.512, "splay_angle": 31.502, "splay_distance": 4.963, "splay_ratio": 0.272, "d22": 3.779, "d64": 3.489, "eta": 169.451, "theta": -121.399, "eta_prime": 174.555, "theta_prime": -117.409, "eta_base": -162.086, "theta_base": -70.092, "v0": 2.955, "v1": -24.673, "v2": 35.639, "v3": -35.080, "v4": 20.324, "amplitude": 36.764, "phase_angle": 14.211, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1m", "suiteness": 0.160, "filter_rmsd": 0.106, "frame": { "rmsd": 0.003, "origin": [ 141.065, 64.050, 31.505 ], "x_axis": [ -0.892, -0.302, -0.336 ], "y_axis": [ 0.431, -0.347, -0.833 ], "z_axis": [ 0.135, -0.888, 0.439 ], "quaternion": [ -0.224, -0.061, -0.526, 0.818 ] } }, { "index": 122, "index_chain": 53, "chain_name": "F", "nt_resnum": 55, "nt_name": "U", "nt_code": "U", "nt_id": "///F/55", "linked_nts": [ "///F/54", "///F/56" ], "nt_type": "RNA", "dbn": ".", "summary": "u-turn,anti,~C3'-endo,non-canonical,non-pair-contact,helix,hairpin-loop,kissing-loop,cap-acceptor", "alpha": -81.187, "beta": -169.459, "gamma": 48.742, "delta": 81.669, "epsilon": -121.029, "zeta": -46.616, "epsilon_zeta": -74.413, "bb_type": "--", "chi": -146.634, "glyco_bond": "anti", "C5prime_xyz": [ -1.167, 8.648, -0.262 ], "P_xyz": [ 1.434, 8.942, -0.084 ], "form": ".", "ssZp": 3.696, "Dp": 4.803, "splay_angle": 72.627, "splay_distance": 10.621, "splay_ratio": 0.593, "d22": 7.239, "d64": 9.558, "eta": 166.325, "theta": -89.922, "eta_prime": -173.381, "theta_prime": -136.955, "eta_base": -112.941, "theta_base": 162.437, "v0": 5.788, "v1": -28.446, "v2": 39.251, "v3": -36.947, "v4": 19.591, "amplitude": 39.915, "phase_angle": 10.461, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.506, "filter_rmsd": 0.108, "frame": { "rmsd": 0.008, "origin": [ 138.892, 59.699, 30.513 ], "x_axis": [ -0.166, -0.199, -0.966 ], "y_axis": [ 0.983, -0.108, -0.147 ], "z_axis": [ -0.075, -0.974, 0.214 ], "quaternion": [ -0.485, -0.427, -0.459, 0.610 ] } }, { "index": 123, "index_chain": 54, "chain_name": "F", "nt_resnum": 56, "nt_name": "C", "nt_code": "C", "nt_id": "///F/56", "linked_nts": [ "///F/55", "///F/57" ], "nt_type": "RNA", "dbn": "]", "summary": "pseudoknotted,turn,u-turn,anti,~C3'-endo,BI,isolated-canonical,non-pair-contact,helix-end,hairpin-loop,kissing-loop", "alpha": -179.065, "beta": 130.208, "gamma": 51.183, "delta": 84.521, "epsilon": -142.006, "zeta": -61.093, "epsilon_zeta": -80.913, "bb_type": "BI", "chi": -162.441, "glyco_bond": "anti", "C5prime_xyz": [ -1.382, 8.751, 0.694 ], "P_xyz": [ 1.205, 8.469, 0.314 ], "form": ".", "ssZp": 4.388, "Dp": 4.569, "splay_angle": 32.483, "splay_distance": 5.065, "splay_ratio": 0.280, "d22": null, "d64": null, "eta": 12.621, "theta": -115.889, "eta_prime": 52.729, "theta_prime": -120.121, "eta_base": 32.467, "theta_base": -80.272, "v0": 1.814, "v1": -24.149, "v2": 36.139, "v3": -36.033, "v4": 21.637, "amplitude": 37.579, "phase_angle": 15.912, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1g", "suiteness": 0.365, "filter_rmsd": 0.063, "frame": { "rmsd": 0.002, "origin": [ 142.844, 54.476, 38.874 ], "x_axis": [ 0.609, 0.735, 0.298 ], "y_axis": [ 0.448, -0.009, -0.894 ], "z_axis": [ -0.654, 0.678, -0.335 ], "quaternion": [ 0.562, -0.699, -0.423, 0.127 ] } }, { "index": 124, "index_chain": 55, "chain_name": "F", "nt_resnum": 57, "nt_name": "G", "nt_code": "G", "nt_id": "///F/57", "linked_nts": [ "///F/56", "///F/58" ], "nt_type": "RNA", "dbn": ".", "summary": "u-turn,anti,~C3'-endo,non-pair-contact,hairpin-loop,kissing-loop,cap-donor,phosphate", "alpha": -72.379, "beta": -174.095, "gamma": 51.727, "delta": 84.718, "epsilon": -108.171, "zeta": -132.705, "epsilon_zeta": 24.534, "bb_type": "--", "chi": -146.053, "glyco_bond": "anti", "C5prime_xyz": [ -0.960, 8.647, -0.330 ], "P_xyz": [ 1.677, 8.790, -0.363 ], "form": ".", "ssZp": 3.505, "Dp": 4.841, "splay_angle": 43.596, "splay_distance": 6.850, "splay_ratio": 0.375, "d22": null, "d64": null, "eta": 176.107, "theta": -161.579, "eta_prime": -167.092, "theta_prime": -146.649, "eta_base": -110.925, "theta_base": -125.831, "v0": 6.724, "v1": -27.804, "v2": 37.031, "v3": -34.207, "v4": 17.570, "amplitude": 37.452, "phase_angle": 8.607, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.835, "filter_rmsd": 0.005, "frame": { "rmsd": 0.005, "origin": [ 142.996, 59.378, 37.611 ], "x_axis": [ 0.795, 0.290, -0.533 ], "y_axis": [ -0.348, -0.502, -0.792 ], "z_axis": [ -0.497, 0.815, -0.298 ], "quaternion": [ -0.499, 0.805, -0.018, -0.320 ] } }, { "index": 125, "index_chain": 56, "chain_name": "F", "nt_resnum": 58, "nt_name": "A", "nt_code": "A", "nt_id": "///F/58", "linked_nts": [ "///F/57", "///F/59" ], "nt_type": "RNA", "dbn": ".", "summary": "u-turn,anti,~C3'-endo,non-canonical,non-pair-contact,helix,hairpin-loop,kissing-loop,phosphate", "alpha": -38.931, "beta": 122.524, "gamma": 70.151, "delta": 76.475, "epsilon": 72.595, "zeta": 78.643, "epsilon_zeta": -6.048, "bb_type": "--", "chi": -145.831, "glyco_bond": "anti", "C5prime_xyz": [ -1.416, 8.768, -0.302 ], "P_xyz": [ 0.631, 8.368, -1.848 ], "form": ".", "ssZp": 2.641, "Dp": 2.943, "splay_angle": 71.314, "splay_distance": 10.795, "splay_ratio": 0.585, "d22": null, "d64": null, "eta": -142.406, "theta": -123.835, "eta_prime": -131.471, "theta_prime": -178.835, "eta_base": -122.011, "theta_base": 126.143, "v0": 2.631, "v1": -25.328, "v2": 37.408, "v3": -36.623, "v4": 21.414, "amplitude": 38.664, "phase_angle": 14.641, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "7a", "suiteness": 0.050, "filter_rmsd": 0.039, "frame": { "rmsd": 0.004, "origin": [ 140.044, 64.448, 34.075 ], "x_axis": [ 0.642, 0.040, -0.766 ], "y_axis": [ -0.535, -0.693, -0.484 ], "z_axis": [ -0.550, 0.720, -0.423 ], "quaternion": [ -0.363, 0.830, -0.149, -0.396 ] } }, { "index": 126, "index_chain": 57, "chain_name": "F", "nt_resnum": 59, "nt_name": "U", "nt_code": "U", "nt_id": "///F/59", "linked_nts": [ "///F/58", "///F/60" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,hairpin-loop,kissing-loop,phosphate", "alpha": 88.741, "beta": 163.722, "gamma": 58.619, "delta": 88.587, "epsilon": -134.424, "zeta": -79.529, "epsilon_zeta": -54.896, "bb_type": "BI", "chi": -161.126, "glyco_bond": "anti", "C5prime_xyz": [ -1.070, 8.605, 0.614 ], "P_xyz": [ 1.567, 8.564, 0.478 ], "form": "A", "ssZp": 4.428, "Dp": 4.672, "splay_angle": 23.358, "splay_distance": 3.894, "splay_ratio": 0.204, "d22": 4.301, "d64": 4.497, "eta": 24.335, "theta": -133.837, "eta_prime": 57.767, "theta_prime": -133.557, "eta_base": 47.961, "theta_base": -125.137, "v0": 6.635, "v1": -27.061, "v2": 35.581, "v3": -32.965, "v4": 16.861, "amplitude": 35.965, "phase_angle": 8.379, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.006, "origin": [ 131.908, 62.136, 40.783 ], "x_axis": [ 0.397, -0.918, -0.024 ], "y_axis": [ -0.186, -0.055, -0.981 ], "z_axis": [ 0.899, 0.393, -0.193 ], "quaternion": [ 0.536, -0.641, 0.430, -0.341 ] } }, { "index": 127, "index_chain": 58, "chain_name": "F", "nt_resnum": 60, "nt_name": "C", "nt_code": "C", "nt_id": "///F/60", "linked_nts": [ "///F/59", "///F/61" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-pair-contact,hairpin-loop,kissing-loop,splayed-apart", "alpha": -71.234, "beta": 156.443, "gamma": 75.168, "delta": 94.673, "epsilon": -95.296, "zeta": -73.673, "epsilon_zeta": -21.623, "bb_type": "--", "chi": -159.564, "glyco_bond": "anti", "C5prime_xyz": [ -2.236, 8.946, 0.266 ], "P_xyz": [ 0.244, 9.795, 0.196 ], "form": ".", "ssZp": 2.939, "Dp": 3.413, "splay_angle": 93.000, "splay_distance": 13.698, "splay_ratio": 0.728, "d22": 6.571, "d64": 7.551, "eta": -169.707, "theta": -84.029, "eta_prime": -156.106, "theta_prime": -86.129, "eta_base": -137.993, "theta_base": -53.459, "v0": -8.069, "v1": -14.547, "v2": 29.900, "v3": -35.633, "v4": 27.466, "amplitude": 35.107, "phase_angle": 31.604, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.162, "filter_rmsd": 0.062, "frame": { "rmsd": 0.006, "origin": [ 135.601, 63.069, 41.590 ], "x_axis": [ -0.023, -0.943, -0.331 ], "y_axis": [ -0.249, 0.326, -0.912 ], "z_axis": [ 0.968, 0.061, -0.242 ], "quaternion": [ 0.515, -0.472, 0.631, -0.337 ] } }, { "index": 128, "index_chain": 59, "chain_name": "F", "nt_resnum": 61, "nt_name": "C", "nt_code": "C", "nt_id": "///F/61", "linked_nts": [ "///F/60", "///F/62" ], "nt_type": "RNA", "dbn": ")", "summary": "~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop,kissing-loop,splayed-apart", "alpha": -89.484, "beta": -149.424, "gamma": 58.606, "delta": 87.307, "epsilon": -153.375, "zeta": -62.979, "epsilon_zeta": -90.397, "bb_type": "BI", "chi": 176.453, "glyco_bond": "--", "C5prime_xyz": [ -1.308, 8.262, 1.860 ], "P_xyz": [ 0.926, 7.841, 3.228 ], "form": "A", "ssZp": 4.581, "Dp": 4.612, "splay_angle": 23.987, "splay_distance": 3.726, "splay_ratio": 0.213, "d22": 4.605, "d64": 4.362, "eta": 154.107, "theta": -129.549, "eta_prime": -177.379, "theta_prime": -126.784, "eta_base": -142.678, "theta_base": -99.068, "v0": 5.713, "v1": -27.035, "v2": 36.579, "v3": -34.450, "v4": 18.225, "amplitude": 37.148, "phase_angle": 10.037, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1m", "suiteness": 0.053, "filter_rmsd": 0.063, "frame": { "rmsd": 0.004, "origin": [ 139.535, 65.337, 28.666 ], "x_axis": [ -0.875, -0.470, 0.112 ], "y_axis": [ -0.099, 0.401, 0.911 ], "z_axis": [ -0.473, 0.786, -0.398 ], "quaternion": [ -0.179, -0.174, 0.818, 0.519 ] } }, { "index": 129, "index_chain": 60, "chain_name": "F", "nt_resnum": 62, "nt_name": "U", "nt_code": "U", "nt_id": "///F/62", "linked_nts": [ "///F/61", "///F/63" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -94.013, "beta": -160.615, "gamma": 56.849, "delta": 85.970, "epsilon": -176.619, "zeta": -68.745, "epsilon_zeta": -107.874, "bb_type": "BI", "chi": -164.396, "glyco_bond": "anti", "C5prime_xyz": [ -1.386, 8.670, 0.788 ], "P_xyz": [ 1.121, 8.970, 1.517 ], "form": "A", "ssZp": 4.412, "Dp": 4.406, "splay_angle": 24.008, "splay_distance": 3.612, "splay_ratio": 0.209, "d22": null, "d64": null, "eta": 156.872, "theta": -155.556, "eta_prime": 174.994, "theta_prime": -153.025, "eta_base": -137.443, "theta_base": -132.403, "v0": 2.141, "v1": -25.176, "v2": 37.369, "v3": -37.004, "v4": 21.907, "amplitude": 38.753, "phase_angle": 15.361, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.287, "filter_rmsd": 0.102, "frame": { "rmsd": 0.004, "origin": [ 137.366, 66.576, 25.902 ], "x_axis": [ -0.669, -0.171, 0.724 ], "y_axis": [ 0.498, 0.620, 0.606 ], "z_axis": [ -0.552, 0.766, -0.329 ], "quaternion": [ -0.394, 0.101, 0.809, 0.424 ] } }, { "index": 130, "index_chain": 61, "chain_name": "F", "nt_resnum": 63, "nt_name": "G", "nt_code": "G", "nt_id": "///F/63", "linked_nts": [ "///F/62", "///F/64" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -91.686, "beta": -154.434, "gamma": 57.557, "delta": 84.106, "epsilon": -130.687, "zeta": -136.206, "epsilon_zeta": 5.518, "bb_type": "--", "chi": -159.250, "glyco_bond": "anti", "C5prime_xyz": [ -1.007, 8.624, 0.499 ], "P_xyz": [ 1.550, 8.596, 1.094 ], "form": "A", "ssZp": 4.378, "Dp": 4.784, "splay_angle": 20.933, "splay_distance": 3.302, "splay_ratio": 0.182, "d22": null, "d64": null, "eta": 175.675, "theta": -144.585, "eta_prime": 177.253, "theta_prime": -146.482, "eta_base": -158.252, "theta_base": -143.213, "v0": 6.505, "v1": -28.341, "v2": 38.417, "v3": -35.738, "v4": 18.438, "amplitude": 38.927, "phase_angle": 9.285, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.191, "filter_rmsd": 0.004, "frame": { "rmsd": 0.004, "origin": [ 134.930, 68.008, 23.651 ], "x_axis": [ -0.214, 0.085, 0.973 ], "y_axis": [ 0.755, 0.646, 0.109 ], "z_axis": [ -0.620, 0.758, -0.202 ], "quaternion": [ 0.555, -0.292, -0.718, -0.302 ] } }, { "index": 131, "index_chain": 62, "chain_name": "F", "nt_resnum": 64, "nt_name": "A", "nt_code": "A", "nt_id": "///F/64", "linked_nts": [ "///F/63", "///F/65" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": 116.209, "beta": -99.455, "gamma": 172.421, "delta": 85.269, "epsilon": -155.195, "zeta": -46.320, "epsilon_zeta": -108.875, "bb_type": "BI", "chi": 169.836, "glyco_bond": "anti", "C5prime_xyz": [ -1.793, 8.107, 2.211 ], "P_xyz": [ 0.000, 9.133, 0.590 ], "form": ".", "ssZp": 4.439, "Dp": 4.536, "splay_angle": 36.771, "splay_distance": 5.543, "splay_ratio": 0.321, "d22": null, "d64": null, "eta": 151.700, "theta": -123.480, "eta_prime": 177.097, "theta_prime": -138.611, "eta_base": -160.339, "theta_base": -105.363, "v0": 1.639, "v1": -24.146, "v2": 36.446, "v3": -36.442, "v4": 21.823, "amplitude": 37.943, "phase_angle": 16.149, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.004, "origin": [ 132.207, 69.367, 22.371 ], "x_axis": [ 0.082, 0.037, 0.996 ], "y_axis": [ 0.722, 0.687, -0.085 ], "z_axis": [ -0.687, 0.726, 0.030 ], "quaternion": [ 0.671, -0.302, -0.628, -0.255 ] } }, { "index": 132, "index_chain": 63, "chain_name": "F", "nt_resnum": 65, "nt_name": "G", "nt_code": "G", "nt_id": "///F/65", "linked_nts": [ "///F/64", "///F/66" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop", "alpha": -85.799, "beta": -150.521, "gamma": 48.472, "delta": 85.122, "epsilon": -142.621, "zeta": -79.541, "epsilon_zeta": -63.080, "bb_type": "BI", "chi": -172.154, "glyco_bond": "anti", "C5prime_xyz": [ -1.476, 8.587, 1.233 ], "P_xyz": [ 0.642, 8.732, 2.773 ], "form": "A", "ssZp": 4.547, "Dp": 4.601, "splay_angle": 25.099, "splay_distance": 3.995, "splay_ratio": 0.219, "d22": null, "d64": null, "eta": 170.180, "theta": -145.381, "eta_prime": -171.181, "theta_prime": -139.602, "eta_base": -114.185, "theta_base": -115.953, "v0": 3.817, "v1": -25.963, "v2": 36.815, "v3": -35.785, "v4": 20.189, "amplitude": 37.786, "phase_angle": 13.017, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1m", "suiteness": 0.451, "filter_rmsd": 0.003, "frame": { "rmsd": 0.003, "origin": [ 128.444, 72.347, 25.145 ], "x_axis": [ 0.699, 0.473, 0.536 ], "y_axis": [ 0.560, 0.105, -0.822 ], "z_axis": [ -0.445, 0.875, -0.191 ], "quaternion": [ 0.635, -0.668, -0.386, -0.034 ] } }, { "index": 133, "index_chain": 64, "chain_name": "F", "nt_resnum": 66, "nt_name": "U", "nt_code": "U", "nt_id": "///F/66", "linked_nts": [ "///F/65", "///F/67" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop", "alpha": -65.444, "beta": 172.076, "gamma": 50.553, "delta": 83.308, "epsilon": -164.672, "zeta": -76.122, "epsilon_zeta": -88.550, "bb_type": "BI", "chi": -169.045, "glyco_bond": "anti", "C5prime_xyz": [ -1.774, 8.663, 1.014 ], "P_xyz": [ 0.712, 9.228, 1.571 ], "form": "A", "ssZp": 4.419, "Dp": 4.473, "splay_angle": 15.540, "splay_distance": 2.431, "splay_ratio": 0.139, "d22": null, "d64": null, "eta": 161.344, "theta": -156.920, "eta_prime": 176.112, "theta_prime": -158.242, "eta_base": -147.105, "theta_base": -140.821, "v0": 0.014, "v1": -23.857, "v2": 37.448, "v3": -38.362, "v4": 23.975, "amplitude": 39.479, "phase_angle": 18.457, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.908, "filter_rmsd": 0.103, "frame": { "rmsd": 0.007, "origin": [ 126.048, 75.389, 26.128 ], "x_axis": [ 0.951, 0.296, 0.091 ], "y_axis": [ 0.151, -0.186, -0.971 ], "z_axis": [ -0.271, 0.937, -0.222 ], "quaternion": [ 0.621, -0.768, -0.146, 0.058 ] } }, { "index": 134, "index_chain": 65, "chain_name": "F", "nt_resnum": 67, "nt_name": "G", "nt_code": "G", "nt_id": "///F/67", "linked_nts": [ "///F/66", "///F/68" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -80.410, "beta": -177.940, "gamma": 57.779, "delta": 85.951, "epsilon": -162.207, "zeta": -63.582, "epsilon_zeta": -98.625, "bb_type": "BI", "chi": -158.412, "glyco_bond": "anti", "C5prime_xyz": [ -1.200, 8.692, 0.434 ], "P_xyz": [ 1.417, 8.908, 0.449 ], "form": "A", "ssZp": 4.460, "Dp": 4.575, "splay_angle": 23.910, "splay_distance": 3.711, "splay_ratio": 0.208, "d22": null, "d64": null, "eta": 161.690, "theta": -140.918, "eta_prime": 170.765, "theta_prime": -142.374, "eta_base": -157.551, "theta_base": -112.301, "v0": 5.027, "v1": -27.585, "v2": 38.345, "v3": -36.491, "v4": 19.792, "amplitude": 39.109, "phase_angle": 11.341, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.663, "filter_rmsd": 0.003, "frame": { "rmsd": 0.003, "origin": [ 125.151, 77.297, 27.337 ], "x_axis": [ 0.868, 0.216, -0.448 ], "y_axis": [ -0.441, -0.084, -0.894 ], "z_axis": [ -0.230, 0.973, 0.022 ], "quaternion": [ 0.672, -0.694, 0.081, 0.244 ] } }, { "index": 135, "index_chain": 66, "chain_name": "F", "nt_resnum": 68, "nt_name": "C", "nt_code": "C", "nt_id": "///F/68", "linked_nts": [ "///F/67", "///F/69" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -71.182, "beta": -177.982, "gamma": 51.721, "delta": 81.252, "epsilon": -139.362, "zeta": -80.936, "epsilon_zeta": -58.426, "bb_type": "BI", "chi": -162.207, "glyco_bond": "anti", "C5prime_xyz": [ -1.168, 8.671, 0.685 ], "P_xyz": [ 1.426, 8.947, 0.911 ], "form": "A", "ssZp": 4.508, "Dp": 4.748, "splay_angle": 23.484, "splay_distance": 3.612, "splay_ratio": 0.204, "d22": null, "d64": null, "eta": 169.022, "theta": -147.527, "eta_prime": -178.041, "theta_prime": -144.394, "eta_base": -130.884, "theta_base": -116.026, "v0": 4.363, "v1": -27.827, "v2": 39.733, "v3": -38.114, "v4": 21.225, "amplitude": 40.700, "phase_angle": 12.518, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.808, "filter_rmsd": 0.062, "frame": { "rmsd": 0.003, "origin": [ 126.156, 80.856, 27.639 ], "x_axis": [ 0.440, 0.037, -0.897 ], "y_axis": [ -0.885, -0.149, -0.440 ], "z_axis": [ -0.151, 0.988, -0.033 ], "quaternion": [ 0.561, -0.637, 0.333, 0.411 ] } }, { "index": 136, "index_chain": 67, "chain_name": "F", "nt_resnum": 69, "nt_name": "G", "nt_code": "G", "nt_id": "///F/69", "linked_nts": [ "///F/68", "///F/70" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -77.342, "beta": 159.327, "gamma": 73.487, "delta": 88.090, "epsilon": -160.471, "zeta": -63.470, "epsilon_zeta": -97.001, "bb_type": "BI", "chi": -176.250, "glyco_bond": "anti", "C5prime_xyz": [ -1.406, 8.494, 1.425 ], "P_xyz": [ 1.186, 8.844, 1.063 ], "form": "A", "ssZp": 4.546, "Dp": 4.549, "splay_angle": 22.815, "splay_distance": 3.591, "splay_ratio": 0.203, "d22": null, "d64": null, "eta": 161.551, "theta": -131.671, "eta_prime": -179.430, "theta_prime": -138.510, "eta_base": -133.332, "theta_base": -117.424, "v0": 4.568, "v1": -26.718, "v2": 37.328, "v3": -35.697, "v4": 19.687, "amplitude": 38.140, "phase_angle": 11.847, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.322, "filter_rmsd": 0.005, "frame": { "rmsd": 0.005, "origin": [ 127.180, 84.225, 26.832 ], "x_axis": [ -0.069, -0.307, -0.949 ], "y_axis": [ -0.992, -0.080, 0.098 ], "z_axis": [ -0.106, 0.948, -0.299 ], "quaternion": [ -0.371, 0.572, -0.568, -0.461 ] } }, { "index": 137, "index_chain": 68, "chain_name": "F", "nt_resnum": 70, "nt_name": "A", "nt_code": "A", "nt_id": "///F/70", "linked_nts": [ "///F/69", "///F/71" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack", "alpha": -102.528, "beta": -152.156, "gamma": 57.549, "delta": 83.756, "epsilon": -162.693, "zeta": -86.301, "epsilon_zeta": -76.392, "bb_type": "BI", "chi": -159.690, "glyco_bond": "anti", "C5prime_xyz": [ -1.402, 8.713, 0.509 ], "P_xyz": [ 1.096, 9.101, 1.274 ], "form": ".", "ssZp": 4.450, "Dp": 4.540, "splay_angle": 34.400, "splay_distance": 5.212, "splay_ratio": 0.296, "d22": null, "d64": null, "eta": 157.263, "theta": -166.198, "eta_prime": 170.035, "theta_prime": -161.162, "eta_base": -148.550, "theta_base": -147.074, "v0": 3.353, "v1": -25.593, "v2": 36.911, "v3": -35.872, "v4": 20.531, "amplitude": 37.974, "phase_angle": 13.588, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1m", "suiteness": 0.176, "filter_rmsd": 0.037, "frame": { "rmsd": 0.002, "origin": [ 128.561, 86.836, 24.790 ], "x_axis": [ -0.658, -0.510, -0.554 ], "y_axis": [ -0.718, 0.205, 0.665 ], "z_axis": [ -0.225, 0.836, -0.501 ], "quaternion": [ 0.107, -0.399, 0.769, 0.488 ] } }, { "index": 138, "index_chain": 69, "chain_name": "F", "nt_resnum": 71, "nt_name": "G", "nt_code": "G", "nt_id": "///F/71", "linked_nts": [ "///F/70", null ], "nt_type": "RNA", "dbn": ".", "summary": "~C3'-endo,non-stack,ss-non-loop", "alpha": -89.743, "beta": -158.705, "gamma": 51.413, "delta": 77.488, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": 168.734, "glyco_bond": "--", "C5prime_xyz": [ -1.794, 8.125, 2.225 ], "P_xyz": [ 0.223, 7.954, 3.913 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": 3.842, "v1": -25.998, "v2": 37.121, "v3": -36.016, "v4": 20.258, "amplitude": 38.101, "phase_angle": 13.028, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.341, "filter_rmsd": 0.003, "frame": { "rmsd": 0.003, "origin": [ 129.796, 91.115, 22.082 ], "x_axis": [ -0.304, -0.944, 0.129 ], "y_axis": [ -0.193, 0.194, 0.962 ], "z_axis": [ -0.933, 0.268, -0.241 ], "quaternion": [ -0.403, -0.431, 0.659, 0.466 ] } } ], "num_hbonds": 1099, "hbonds": [ { "index": 1, "atom1_serNum": 4, "atom2_serNum": 16, "donAcc_type": "standard", "distance": 3.256, "atom1_id": "///A/13/O", "atom2_id": "///A/15/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2, "atom1_serNum": 10, "atom2_serNum": 1535, "donAcc_type": "standard", "distance": 3.337, "atom1_id": "///A/14/O", "atom2_id": "///A/200/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 3, "atom1_serNum": 24, "atom2_serNum": 2655, "donAcc_type": "standard", "distance": 3.061, "atom1_id": "///A/15/NZ", "atom2_id": "///A/339/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 4, "atom1_serNum": 25, "atom2_serNum": 1538, "donAcc_type": "standard", "distance": 3.125, "atom1_id": "///A/16/N", "atom2_id": "///A/200/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 5, "atom1_serNum": 28, "atom2_serNum": 1550, "donAcc_type": "standard", "distance": 3.130, "atom1_id": "///A/16/O", "atom2_id": "///A/202/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 6, "atom1_serNum": 32, "atom2_serNum": 753, "donAcc_type": "standard", "distance": 2.889, "atom1_id": "///A/17/N", "atom2_id": "///A/106/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 7, "atom1_serNum": 35, "atom2_serNum": 768, "donAcc_type": "questionable", "distance": 3.283, "atom1_id": "///A/17/O", "atom2_id": "///A/108/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 8, "atom1_serNum": 40, "atom2_serNum": 1553, "donAcc_type": "standard", "distance": 3.226, "atom1_id": "///A/18/N", "atom2_id": "///A/202/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 9, "atom1_serNum": 43, "atom2_serNum": 1569, "donAcc_type": "standard", "distance": 3.112, "atom1_id": "///A/18/O", "atom2_id": "///A/204/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 10, "atom1_serNum": 47, "atom2_serNum": 768, "donAcc_type": "standard", "distance": 2.907, "atom1_id": "///A/19/N", "atom2_id": "///A/108/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 11, "atom1_serNum": 55, "atom2_serNum": 1572, "donAcc_type": "standard", "distance": 2.885, "atom1_id": "///A/20/N", "atom2_id": "///A/204/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 12, "atom1_serNum": 58, "atom2_serNum": 1591, "donAcc_type": "standard", "distance": 2.926, "atom1_id": "///A/20/O", "atom2_id": "///A/206/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 13, "atom1_serNum": 60, "atom2_serNum": 803, "donAcc_type": "questionable", "distance": 3.162, "atom1_id": "///A/21/N", "atom2_id": "///A/113/NE2", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 14, "atom1_serNum": 63, "atom2_serNum": 101, "donAcc_type": "standard", "distance": 2.611, "atom1_id": "///A/21/O", "atom2_id": "///A/27/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 15, "atom1_serNum": 67, "atom2_serNum": 9642, "donAcc_type": "acceptable", "distance": 3.014, "atom1_id": "///A/22/O", "atom2_id": "///A/422/O2B", "atom_pair": "O:O", "residue_pair": "aa:ligand" }, { "index": 16, "atom1_serNum": 76, "atom2_serNum": 2312, "donAcc_type": "acceptable", "distance": 3.715, "atom1_id": "///A/23/OG1", "atom2_id": "///A/296/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 17, "atom1_serNum": 81, "atom2_serNum": 1686, "donAcc_type": "standard", "distance": 2.398, "atom1_id": "///A/24/O", "atom2_id": "///A/216/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 18, "atom1_serNum": 82, "atom2_serNum": 9639, "donAcc_type": "standard", "distance": 3.195, "atom1_id": "///A/25/N", "atom2_id": "///A/422/O3A", "atom_pair": "N:O", "residue_pair": "aa:ligand" }, { "index": 19, "atom1_serNum": 92, "atom2_serNum": 117, "donAcc_type": "standard", "distance": 2.607, "atom1_id": "///A/26/O", "atom2_id": "///A/30/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 20, "atom1_serNum": 96, "atom2_serNum": 125, "donAcc_type": "standard", "distance": 2.762, "atom1_id": "///A/27/O", "atom2_id": "///A/31/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 21, "atom1_serNum": 101, "atom2_serNum": 782, "donAcc_type": "standard", "distance": 2.582, "atom1_id": "///A/27/NZ", "atom2_id": "///A/110/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 22, "atom1_serNum": 102, "atom2_serNum": 9641, "donAcc_type": "acceptable", "distance": 3.159, "atom1_id": "///A/28/N", "atom2_id": "///A/422/O1B", "atom_pair": "N:O", "residue_pair": "aa:ligand" }, { "index": 23, "atom1_serNum": 105, "atom2_serNum": 130, "donAcc_type": "acceptable", "distance": 2.858, "atom1_id": "///A/28/O", "atom2_id": "///A/31/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 24, "atom1_serNum": 111, "atom2_serNum": 139, "donAcc_type": "standard", "distance": 3.939, "atom1_id": "///A/29/O", "atom2_id": "///A/33/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 25, "atom1_serNum": 120, "atom2_serNum": 148, "donAcc_type": "standard", "distance": 3.180, "atom1_id": "///A/30/O", "atom2_id": "///A/34/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 26, "atom1_serNum": 128, "atom2_serNum": 156, "donAcc_type": "standard", "distance": 3.149, "atom1_id": "///A/31/O", "atom2_id": "///A/35/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 27, "atom1_serNum": 134, "atom2_serNum": 161, "donAcc_type": "standard", "distance": 3.251, "atom1_id": "///A/32/O", "atom2_id": "///A/36/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 28, "atom1_serNum": 134, "atom2_serNum": 169, "donAcc_type": "standard", "distance": 3.239, "atom1_id": "///A/32/O", "atom2_id": "///A/36/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 29, "atom1_serNum": 142, "atom2_serNum": 170, "donAcc_type": "standard", "distance": 3.598, "atom1_id": "///A/33/O", "atom2_id": "///A/37/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 30, "atom1_serNum": 146, "atom2_serNum": 2572, "donAcc_type": "acceptable", "distance": 2.911, "atom1_id": "///A/33/OE1", "atom2_id": "///A/328/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 31, "atom1_serNum": 151, "atom2_serNum": 179, "donAcc_type": "standard", "distance": 3.029, "atom1_id": "///A/34/O", "atom2_id": "///A/38/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 32, "atom1_serNum": 159, "atom2_serNum": 198, "donAcc_type": "standard", "distance": 2.548, "atom1_id": "///A/35/O", "atom2_id": "///A/40/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 33, "atom1_serNum": 164, "atom2_serNum": 190, "donAcc_type": "standard", "distance": 2.645, "atom1_id": "///A/36/O", "atom2_id": "///A/39/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 34, "atom1_serNum": 169, "atom2_serNum": 423, "donAcc_type": "standard", "distance": 2.985, "atom1_id": "///A/36/NE2", "atom2_id": "///A/67/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 35, "atom1_serNum": 197, "atom2_serNum": 732, "donAcc_type": "standard", "distance": 2.731, "atom1_id": "///A/39/ND2", "atom2_id": "///A/103/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 36, "atom1_serNum": 202, "atom2_serNum": 745, "donAcc_type": "standard", "distance": 3.291, "atom1_id": "///A/41/N", "atom2_id": "///A/105/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 37, "atom1_serNum": 205, "atom2_serNum": 757, "donAcc_type": "standard", "distance": 2.638, "atom1_id": "///A/41/O", "atom2_id": "///A/107/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 38, "atom1_serNum": 209, "atom2_serNum": 463, "donAcc_type": "standard", "distance": 2.593, "atom1_id": "///A/41/OE1", "atom2_id": "///A/72/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 39, "atom1_serNum": 210, "atom2_serNum": 741, "donAcc_type": "standard", "distance": 2.800, "atom1_id": "///A/41/OE2", "atom2_id": "///A/104/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 40, "atom1_serNum": 211, "atom2_serNum": 440, "donAcc_type": "standard", "distance": 2.904, "atom1_id": "///A/42/N", "atom2_id": "///A/70/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 41, "atom1_serNum": 214, "atom2_serNum": 454, "donAcc_type": "standard", "distance": 3.326, "atom1_id": "///A/42/O", "atom2_id": "///A/72/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 42, "atom1_serNum": 221, "atom2_serNum": 772, "donAcc_type": "standard", "distance": 2.912, "atom1_id": "///A/43/O", "atom2_id": "///A/109/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 43, "atom1_serNum": 226, "atom2_serNum": 457, "donAcc_type": "standard", "distance": 3.501, "atom1_id": "///A/44/N", "atom2_id": "///A/72/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 44, "atom1_serNum": 232, "atom2_serNum": 240, "donAcc_type": "standard", "distance": 3.029, "atom1_id": "///A/44/OD1", "atom2_id": "///A/46/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 45, "atom1_serNum": 233, "atom2_serNum": 243, "donAcc_type": "standard", "distance": 3.119, "atom1_id": "///A/44/ND2", "atom2_id": "///A/46/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 46, "atom1_serNum": 233, "atom2_serNum": 467, "donAcc_type": "standard", "distance": 3.728, "atom1_id": "///A/44/ND2", "atom2_id": "///A/73/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 47, "atom1_serNum": 237, "atom2_serNum": 239, "donAcc_type": "acceptable", "distance": 2.700, "atom1_id": "///A/45/O", "atom2_id": "///A/45/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 48, "atom1_serNum": 246, "atom2_serNum": 248, "donAcc_type": "standard", "distance": 3.042, "atom1_id": "///A/46/OD1", "atom2_id": "///A/47/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 49, "atom1_serNum": 246, "atom2_serNum": 4089, "donAcc_type": "standard", "distance": 3.001, "atom1_id": "///A/46/OD1", "atom2_id": "///E/37/N6", "atom_pair": "O:N", "residue_pair": "aa:nt" }, { "index": 50, "atom1_serNum": 247, "atom2_serNum": 270, "donAcc_type": "standard", "distance": 3.767, "atom1_id": "///A/46/OD2", "atom2_id": "///A/49/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 51, "atom1_serNum": 253, "atom2_serNum": 792, "donAcc_type": "acceptable", "distance": 2.883, "atom1_id": "///A/47/OG", "atom2_id": "///A/112/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 52, "atom1_serNum": 253, "atom2_serNum": 827, "donAcc_type": "acceptable", "distance": 3.558, "atom1_id": "///A/47/OG", "atom2_id": "///A/115/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 53, "atom1_serNum": 265, "atom2_serNum": 479, "donAcc_type": "standard", "distance": 2.955, "atom1_id": "///A/49/O", "atom2_id": "///A/75/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 54, "atom1_serNum": 281, "atom2_serNum": 302, "donAcc_type": "questionable", "distance": 3.048, "atom1_id": "///A/51/O", "atom2_id": "///A/53/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 55, "atom1_serNum": 281, "atom2_serNum": 361, "donAcc_type": "standard", "distance": 3.164, "atom1_id": "///A/51/O", "atom2_id": "///A/60/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 56, "atom1_serNum": 289, "atom2_serNum": 535, "donAcc_type": "acceptable", "distance": 3.092, "atom1_id": "///A/51/OH", "atom2_id": "///A/81/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 57, "atom1_serNum": 290, "atom2_serNum": 500, "donAcc_type": "standard", "distance": 2.710, "atom1_id": "///A/52/N", "atom2_id": "///A/77/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 58, "atom1_serNum": 299, "atom2_serNum": 485, "donAcc_type": "standard", "distance": 2.746, "atom1_id": "///A/53/N", "atom2_id": "///A/75/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 59, "atom1_serNum": 302, "atom2_serNum": 361, "donAcc_type": "standard", "distance": 2.847, "atom1_id": "///A/53/O", "atom2_id": "///A/60/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 60, "atom1_serNum": 310, "atom2_serNum": 338, "donAcc_type": "standard", "distance": 3.617, "atom1_id": "///A/54/O", "atom2_id": "///A/58/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 61, "atom1_serNum": 318, "atom2_serNum": 338, "donAcc_type": "standard", "distance": 2.817, "atom1_id": "///A/55/O", "atom2_id": "///A/58/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 62, "atom1_serNum": 318, "atom2_serNum": 345, "donAcc_type": "standard", "distance": 2.795, "atom1_id": "///A/55/O", "atom2_id": "///A/59/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 63, "atom1_serNum": 341, "atom2_serNum": 343, "donAcc_type": "acceptable", "distance": 3.072, "atom1_id": "///A/58/O", "atom2_id": "///A/58/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 64, "atom1_serNum": 352, "atom2_serNum": 9643, "donAcc_type": "acceptable", "distance": 3.076, "atom1_id": "///A/59/ND2", "atom2_id": "///A/422/O3B", "atom_pair": "N:O", "residue_pair": "aa:ligand" }, { "index": 65, "atom1_serNum": 365, "atom2_serNum": 415, "donAcc_type": "standard", "distance": 2.691, "atom1_id": "///A/61/O", "atom2_id": "///A/66/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 66, "atom1_serNum": 382, "atom2_serNum": 405, "donAcc_type": "standard", "distance": 3.143, "atom1_id": "///A/63/O", "atom2_id": "///A/66/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 67, "atom1_serNum": 396, "atom2_serNum": 403, "donAcc_type": "standard", "distance": 2.827, "atom1_id": "///A/65/N", "atom2_id": "///A/65/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 68, "atom1_serNum": 408, "atom2_serNum": 429, "donAcc_type": "standard", "distance": 3.176, "atom1_id": "///A/66/O", "atom2_id": "///A/69/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 69, "atom1_serNum": 432, "atom2_serNum": 450, "donAcc_type": "acceptable", "distance": 2.732, "atom1_id": "///A/69/O", "atom2_id": "///A/71/ND1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 70, "atom1_serNum": 460, "atom2_serNum": 662, "donAcc_type": "acceptable", "distance": 3.878, "atom1_id": "///A/72/ND1", "atom2_id": "///A/95/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 71, "atom1_serNum": 487, "atom2_serNum": 493, "donAcc_type": "acceptable", "distance": 3.182, "atom1_id": "///A/76/N", "atom2_id": "///A/76/ND1", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 72, "atom1_serNum": 496, "atom2_serNum": 636, "donAcc_type": "standard", "distance": 2.726, "atom1_id": "///A/76/NE2", "atom2_id": "///A/91/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 73, "atom1_serNum": 504, "atom2_serNum": 539, "donAcc_type": "standard", "distance": 2.991, "atom1_id": "///A/78/N", "atom2_id": "///A/81/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 74, "atom1_serNum": 511, "atom2_serNum": 1883, "donAcc_type": "acceptable", "distance": 2.742, "atom1_id": "///A/78/OD2", "atom2_id": "///A/239/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 75, "atom1_serNum": 540, "atom2_serNum": 599, "donAcc_type": "standard", "distance": 2.693, "atom1_id": "///A/81/OE2", "atom2_id": "///A/87/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 76, "atom1_serNum": 549, "atom2_serNum": 1993, "donAcc_type": "standard", "distance": 2.771, "atom1_id": "///A/82/OE2", "atom2_id": "///A/252/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 77, "atom1_serNum": 553, "atom2_serNum": 4051, "donAcc_type": "questionable", "distance": 3.239, "atom1_id": "///A/83/O", "atom2_id": "///E/36/OP1", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 78, "atom1_serNum": 561, "atom2_serNum": 593, "donAcc_type": "acceptable", "distance": 3.771, "atom1_id": "///A/83/OH", "atom2_id": "///A/87/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 79, "atom1_serNum": 565, "atom2_serNum": 601, "donAcc_type": "standard", "distance": 3.565, "atom1_id": "///A/84/O", "atom2_id": "///A/88/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 80, "atom1_serNum": 574, "atom2_serNum": 4052, "donAcc_type": "standard", "distance": 3.083, "atom1_id": "///A/85/N", "atom2_id": "///E/36/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 81, "atom1_serNum": 583, "atom2_serNum": 621, "donAcc_type": "standard", "distance": 2.958, "atom1_id": "///A/86/O", "atom2_id": "///A/90/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 82, "atom1_serNum": 583, "atom2_serNum": 626, "donAcc_type": "acceptable", "distance": 3.138, "atom1_id": "///A/86/O", "atom2_id": "///A/90/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 83, "atom1_serNum": 586, "atom2_serNum": 619, "donAcc_type": "acceptable", "distance": 3.421, "atom1_id": "///A/86/ND1", "atom2_id": "///A/89/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 84, "atom1_serNum": 593, "atom2_serNum": 628, "donAcc_type": "standard", "distance": 3.038, "atom1_id": "///A/87/O", "atom2_id": "///A/91/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 85, "atom1_serNum": 597, "atom2_serNum": 635, "donAcc_type": "standard", "distance": 2.803, "atom1_id": "///A/87/NE", "atom2_id": "///A/91/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 86, "atom1_serNum": 604, "atom2_serNum": 637, "donAcc_type": "standard", "distance": 2.844, "atom1_id": "///A/88/O", "atom2_id": "///A/92/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 87, "atom1_serNum": 624, "atom2_serNum": 651, "donAcc_type": "standard", "distance": 2.867, "atom1_id": "///A/90/O", "atom2_id": "///A/94/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 88, "atom1_serNum": 631, "atom2_serNum": 659, "donAcc_type": "standard", "distance": 2.725, "atom1_id": "///A/91/O", "atom2_id": "///A/95/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 89, "atom1_serNum": 640, "atom2_serNum": 664, "donAcc_type": "standard", "distance": 2.925, "atom1_id": "///A/92/O", "atom2_id": "///A/96/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 90, "atom1_serNum": 646, "atom2_serNum": 672, "donAcc_type": "standard", "distance": 3.227, "atom1_id": "///A/93/O", "atom2_id": "///A/97/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 91, "atom1_serNum": 654, "atom2_serNum": 681, "donAcc_type": "standard", "distance": 3.319, "atom1_id": "///A/94/O", "atom2_id": "///A/98/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 92, "atom1_serNum": 662, "atom2_serNum": 689, "donAcc_type": "standard", "distance": 3.317, "atom1_id": "///A/95/O", "atom2_id": "///A/99/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 93, "atom1_serNum": 667, "atom2_serNum": 697, "donAcc_type": "standard", "distance": 2.836, "atom1_id": "///A/96/O", "atom2_id": "///A/100/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 94, "atom1_serNum": 675, "atom2_serNum": 697, "donAcc_type": "standard", "distance": 2.798, "atom1_id": "///A/97/O", "atom2_id": "///A/100/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 95, "atom1_serNum": 675, "atom2_serNum": 707, "donAcc_type": "standard", "distance": 2.921, "atom1_id": "///A/97/O", "atom2_id": "///A/101/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 96, "atom1_serNum": 684, "atom2_serNum": 718, "donAcc_type": "standard", "distance": 2.979, "atom1_id": "///A/98/O", "atom2_id": "///A/102/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 97, "atom1_serNum": 688, "atom2_serNum": 727, "donAcc_type": "standard", "distance": 2.850, "atom1_id": "///A/98/OD2", "atom2_id": "///A/102/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 98, "atom1_serNum": 692, "atom2_serNum": 718, "donAcc_type": "standard", "distance": 3.165, "atom1_id": "///A/99/O", "atom2_id": "///A/102/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 99, "atom1_serNum": 692, "atom2_serNum": 733, "donAcc_type": "standard", "distance": 3.247, "atom1_id": "///A/99/O", "atom2_id": "///A/104/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 100, "atom1_serNum": 786, "atom2_serNum": 800, "donAcc_type": "acceptable", "distance": 2.864, "atom1_id": "///A/111/O", "atom2_id": "///A/113/ND1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 101, "atom1_serNum": 786, "atom2_serNum": 2313, "donAcc_type": "standard", "distance": 3.079, "atom1_id": "///A/111/O", "atom2_id": "///A/296/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 102, "atom1_serNum": 790, "atom2_serNum": 804, "donAcc_type": "standard", "distance": 2.653, "atom1_id": "///A/112/O", "atom2_id": "///A/114/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 103, "atom1_serNum": 790, "atom2_serNum": 816, "donAcc_type": "standard", "distance": 3.012, "atom1_id": "///A/112/O", "atom2_id": "///A/115/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 104, "atom1_serNum": 792, "atom2_serNum": 4074, "donAcc_type": "acceptable", "distance": 2.869, "atom1_id": "///A/112/OG1", "atom2_id": "///E/37/OP2", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 105, "atom1_serNum": 794, "atom2_serNum": 800, "donAcc_type": "acceptable", "distance": 3.063, "atom1_id": "///A/113/N", "atom2_id": "///A/113/ND1", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 106, "atom1_serNum": 807, "atom2_serNum": 836, "donAcc_type": "standard", "distance": 2.726, "atom1_id": "///A/114/O", "atom2_id": "///A/117/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 107, "atom1_serNum": 815, "atom2_serNum": 3990, "donAcc_type": "acceptable", "distance": 3.838, "atom1_id": "///A/114/OH", "atom2_id": "///E/33/O5'", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 108, "atom1_serNum": 815, "atom2_serNum": 4031, "donAcc_type": "acceptable", "distance": 3.744, "atom1_id": "///A/114/OH", "atom2_id": "///E/35/OP1", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 109, "atom1_serNum": 819, "atom2_serNum": 845, "donAcc_type": "standard", "distance": 2.797, "atom1_id": "///A/115/O", "atom2_id": "///A/118/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 110, "atom1_serNum": 827, "atom2_serNum": 4051, "donAcc_type": "acceptable", "distance": 2.911, "atom1_id": "///A/115/OH", "atom2_id": "///E/36/OP1", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 111, "atom1_serNum": 831, "atom2_serNum": 852, "donAcc_type": "standard", "distance": 2.976, "atom1_id": "///A/116/O", "atom2_id": "///A/119/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 112, "atom1_serNum": 843, "atom2_serNum": 887, "donAcc_type": "standard", "distance": 2.978, "atom1_id": "///A/117/OE1", "atom2_id": "///A/122/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 113, "atom1_serNum": 848, "atom2_serNum": 850, "donAcc_type": "acceptable", "distance": 2.961, "atom1_id": "///A/118/O", "atom2_id": "///A/118/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 114, "atom1_serNum": 848, "atom2_serNum": 1523, "donAcc_type": "standard", "distance": 3.204, "atom1_id": "///A/118/O", "atom2_id": "///A/198/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 115, "atom1_serNum": 863, "atom2_serNum": 879, "donAcc_type": "standard", "distance": 3.220, "atom1_id": "///A/120/O", "atom2_id": "///A/122/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 116, "atom1_serNum": 871, "atom2_serNum": 1503, "donAcc_type": "standard", "distance": 3.098, "atom1_id": "///A/121/N", "atom2_id": "///A/196/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 117, "atom1_serNum": 874, "atom2_serNum": 1482, "donAcc_type": "standard", "distance": 3.529, "atom1_id": "///A/121/O", "atom2_id": "///A/193/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 118, "atom1_serNum": 874, "atom2_serNum": 1492, "donAcc_type": "standard", "distance": 3.420, "atom1_id": "///A/121/O", "atom2_id": "///A/195/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 119, "atom1_serNum": 879, "atom2_serNum": 897, "donAcc_type": "questionable", "distance": 2.761, "atom1_id": "///A/122/N", "atom2_id": "///A/123/NH1", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 120, "atom1_serNum": 887, "atom2_serNum": 2407, "donAcc_type": "standard", "distance": 3.300, "atom1_id": "///A/122/NZ", "atom2_id": "///A/307/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 121, "atom1_serNum": 891, "atom2_serNum": 897, "donAcc_type": "standard", "distance": 2.831, "atom1_id": "///A/123/O", "atom2_id": "///A/123/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 122, "atom1_serNum": 898, "atom2_serNum": 1523, "donAcc_type": "questionable", "distance": 2.907, "atom1_id": "///A/123/NH2", "atom2_id": "///A/198/NZ", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 123, "atom1_serNum": 899, "atom2_serNum": 4008, "donAcc_type": "standard", "distance": 3.688, "atom1_id": "///A/124/N", "atom2_id": "///E/34/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 124, "atom1_serNum": 912, "atom2_serNum": 930, "donAcc_type": "standard", "distance": 3.057, "atom1_id": "///A/125/OD1", "atom2_id": "///A/128/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 125, "atom1_serNum": 912, "atom2_serNum": 935, "donAcc_type": "acceptable", "distance": 2.697, "atom1_id": "///A/125/OD1", "atom2_id": "///A/128/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 126, "atom1_serNum": 917, "atom2_serNum": 1387, "donAcc_type": "standard", "distance": 2.768, "atom1_id": "///A/126/O", "atom2_id": "///A/181/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 127, "atom1_serNum": 919, "atom2_serNum": 1321, "donAcc_type": "acceptable", "distance": 3.270, "atom1_id": "///A/126/OG1", "atom2_id": "///A/174/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 128, "atom1_serNum": 929, "atom2_serNum": 4024, "donAcc_type": "standard", "distance": 2.610, "atom1_id": "///A/127/NZ", "atom2_id": "///E/34/O6", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 129, "atom1_serNum": 942, "atom2_serNum": 950, "donAcc_type": "standard", "distance": 2.881, "atom1_id": "///A/130/N", "atom2_id": "///A/130/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 130, "atom1_serNum": 979, "atom2_serNum": 1013, "donAcc_type": "standard", "distance": 3.498, "atom1_id": "///A/134/N", "atom2_id": "///A/137/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 131, "atom1_serNum": 982, "atom2_serNum": 1006, "donAcc_type": "standard", "distance": 2.595, "atom1_id": "///A/134/O", "atom2_id": "///A/137/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 132, "atom1_serNum": 982, "atom2_serNum": 1015, "donAcc_type": "standard", "distance": 2.985, "atom1_id": "///A/134/O", "atom2_id": "///A/138/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 133, "atom1_serNum": 989, "atom2_serNum": 1023, "donAcc_type": "standard", "distance": 2.876, "atom1_id": "///A/135/O", "atom2_id": "///A/139/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 134, "atom1_serNum": 1009, "atom2_serNum": 1039, "donAcc_type": "standard", "distance": 2.996, "atom1_id": "///A/137/O", "atom2_id": "///A/141/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 135, "atom1_serNum": 1018, "atom2_serNum": 1047, "donAcc_type": "standard", "distance": 2.621, "atom1_id": "///A/138/O", "atom2_id": "///A/142/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 136, "atom1_serNum": 1059, "atom2_serNum": 1272, "donAcc_type": "acceptable", "distance": 2.705, "atom1_id": "///A/143/O", "atom2_id": "///A/169/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 137, "atom1_serNum": 1061, "atom2_serNum": 1069, "donAcc_type": "acceptable", "distance": 3.547, "atom1_id": "///A/143/OG", "atom2_id": "///A/145/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 138, "atom1_serNum": 1065, "atom2_serNum": 1272, "donAcc_type": "acceptable", "distance": 3.058, "atom1_id": "///A/144/O", "atom2_id": "///A/169/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 139, "atom1_serNum": 1072, "atom2_serNum": 1099, "donAcc_type": "standard", "distance": 3.713, "atom1_id": "///A/145/O", "atom2_id": "///A/149/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 140, "atom1_serNum": 1076, "atom2_serNum": 1090, "donAcc_type": "questionable", "distance": 2.607, "atom1_id": "///A/145/OD2", "atom2_id": "///A/147/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 141, "atom1_serNum": 1087, "atom2_serNum": 1119, "donAcc_type": "standard", "distance": 2.913, "atom1_id": "///A/147/O", "atom2_id": "///A/151/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 142, "atom1_serNum": 1090, "atom2_serNum": 3019, "donAcc_type": "standard", "distance": 3.612, "atom1_id": "///A/147/OD1", "atom2_id": "///A/384/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 143, "atom1_serNum": 1095, "atom2_serNum": 1132, "donAcc_type": "acceptable", "distance": 2.705, "atom1_id": "///A/148/O", "atom2_id": "///A/152/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 144, "atom1_serNum": 1110, "atom2_serNum": 1134, "donAcc_type": "standard", "distance": 2.757, "atom1_id": "///A/150/O", "atom2_id": "///A/153/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 145, "atom1_serNum": 1110, "atom2_serNum": 1142, "donAcc_type": "standard", "distance": 2.893, "atom1_id": "///A/150/O", "atom2_id": "///A/154/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 146, "atom1_serNum": 1118, "atom2_serNum": 1198, "donAcc_type": "acceptable", "distance": 3.114, "atom1_id": "///A/150/OH", "atom2_id": "///A/161/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 147, "atom1_serNum": 1122, "atom2_serNum": 1149, "donAcc_type": "standard", "distance": 3.155, "atom1_id": "///A/151/O", "atom2_id": "///A/155/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 148, "atom1_serNum": 1130, "atom2_serNum": 1158, "donAcc_type": "standard", "distance": 3.428, "atom1_id": "///A/152/O", "atom2_id": "///A/156/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 149, "atom1_serNum": 1152, "atom2_serNum": 1164, "donAcc_type": "standard", "distance": 3.109, "atom1_id": "///A/155/O", "atom2_id": "///A/157/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 150, "atom1_serNum": 1167, "atom2_serNum": 1195, "donAcc_type": "standard", "distance": 3.462, "atom1_id": "///A/157/O", "atom2_id": "///A/161/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 151, "atom1_serNum": 1170, "atom2_serNum": 1424, "donAcc_type": "standard", "distance": 2.984, "atom1_id": "///A/157/OD1", "atom2_id": "///A/187/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 152, "atom1_serNum": 1171, "atom2_serNum": 1179, "donAcc_type": "standard", "distance": 3.268, "atom1_id": "///A/157/OD2", "atom2_id": "///A/159/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 153, "atom1_serNum": 1171, "atom2_serNum": 1187, "donAcc_type": "standard", "distance": 3.198, "atom1_id": "///A/157/OD2", "atom2_id": "///A/160/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 154, "atom1_serNum": 1175, "atom2_serNum": 1200, "donAcc_type": "standard", "distance": 3.311, "atom1_id": "///A/158/O", "atom2_id": "///A/162/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 155, "atom1_serNum": 1182, "atom2_serNum": 1200, "donAcc_type": "standard", "distance": 3.011, "atom1_id": "///A/159/O", "atom2_id": "///A/162/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 156, "atom1_serNum": 1186, "atom2_serNum": 1429, "donAcc_type": "acceptable", "distance": 3.764, "atom1_id": "///A/159/OD2", "atom2_id": "///A/187/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 157, "atom1_serNum": 1203, "atom2_serNum": 1205, "donAcc_type": "acceptable", "distance": 3.021, "atom1_id": "///A/162/O", "atom2_id": "///A/162/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 158, "atom1_serNum": 1205, "atom2_serNum": 2925, "donAcc_type": "acceptable", "distance": 3.076, "atom1_id": "///A/162/OG1", "atom2_id": "///A/372/ND1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 159, "atom1_serNum": 1215, "atom2_serNum": 3968, "donAcc_type": "standard", "distance": 2.736, "atom1_id": "///A/163/NZ", "atom2_id": "///E/32/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 160, "atom1_serNum": 1219, "atom2_serNum": 2928, "donAcc_type": "standard", "distance": 2.861, "atom1_id": "///A/164/O", "atom2_id": "///A/372/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 161, "atom1_serNum": 1227, "atom2_serNum": 3989, "donAcc_type": "acceptable", "distance": 2.875, "atom1_id": "///A/164/OH", "atom2_id": "///E/33/OP2", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 162, "atom1_serNum": 1231, "atom2_serNum": 1245, "donAcc_type": "standard", "distance": 2.654, "atom1_id": "///A/165/O", "atom2_id": "///A/167/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 163, "atom1_serNum": 1231, "atom2_serNum": 1253, "donAcc_type": "standard", "distance": 2.772, "atom1_id": "///A/165/O", "atom2_id": "///A/168/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 164, "atom1_serNum": 1234, "atom2_serNum": 1245, "donAcc_type": "acceptable", "distance": 2.887, "atom1_id": "///A/165/ND1", "atom2_id": "///A/167/N", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 165, "atom1_serNum": 1237, "atom2_serNum": 3038, "donAcc_type": "standard", "distance": 3.356, "atom1_id": "///A/165/NE2", "atom2_id": "///A/387/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 166, "atom1_serNum": 1248, "atom2_serNum": 1261, "donAcc_type": "standard", "distance": 2.858, "atom1_id": "///A/167/O", "atom2_id": "///A/169/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 167, "atom1_serNum": 1252, "atom2_serNum": 3005, "donAcc_type": "standard", "distance": 3.126, "atom1_id": "///A/167/ND2", "atom2_id": "///A/382/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 168, "atom1_serNum": 1252, "atom2_serNum": 4162, "donAcc_type": "standard", "distance": 2.838, "atom1_id": "///A/167/ND2", "atom2_id": "///E/41/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 169, "atom1_serNum": 1256, "atom2_serNum": 1295, "donAcc_type": "standard", "distance": 2.871, "atom1_id": "///A/168/O", "atom2_id": "///A/172/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 170, "atom1_serNum": 1260, "atom2_serNum": 1293, "donAcc_type": "standard", "distance": 3.106, "atom1_id": "///A/168/OD2", "atom2_id": "///A/171/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 171, "atom1_serNum": 1264, "atom2_serNum": 1302, "donAcc_type": "standard", "distance": 2.903, "atom1_id": "///A/169/O", "atom2_id": "///A/173/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 172, "atom1_serNum": 1276, "atom2_serNum": 1311, "donAcc_type": "standard", "distance": 3.052, "atom1_id": "///A/170/O", "atom2_id": "///A/174/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 173, "atom1_serNum": 1282, "atom2_serNum": 4040, "donAcc_type": "acceptable", "distance": 2.833, "atom1_id": "///A/170/NH1", "atom2_id": "///E/35/O2'", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 174, "atom1_serNum": 1282, "atom2_serNum": 4119, "donAcc_type": "standard", "distance": 2.909, "atom1_id": "///A/170/NH1", "atom2_id": "///E/38/N3", "atom_pair": "N:N", "residue_pair": "aa:nt" }, { "index": 175, "atom1_serNum": 1283, "atom2_serNum": 4109, "donAcc_type": "acceptable", "distance": 2.928, "atom1_id": "///A/170/NH2", "atom2_id": "///E/38/O2'", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 176, "atom1_serNum": 1287, "atom2_serNum": 1322, "donAcc_type": "standard", "distance": 2.943, "atom1_id": "///A/171/O", "atom2_id": "///A/175/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 177, "atom1_serNum": 1291, "atom2_serNum": 3988, "donAcc_type": "standard", "distance": 2.746, "atom1_id": "///A/171/NE", "atom2_id": "///E/33/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 178, "atom1_serNum": 1293, "atom2_serNum": 4135, "donAcc_type": "standard", "distance": 3.228, "atom1_id": "///A/171/NH1", "atom2_id": "///E/39/O2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 179, "atom1_serNum": 1294, "atom2_serNum": 4117, "donAcc_type": "standard", "distance": 2.823, "atom1_id": "///A/171/NH2", "atom2_id": "///E/38/N1", "atom_pair": "N:N", "residue_pair": "aa:nt" }, { "index": 180, "atom1_serNum": 1298, "atom2_serNum": 1330, "donAcc_type": "standard", "distance": 3.075, "atom1_id": "///A/172/O", "atom2_id": "///A/176/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 181, "atom1_serNum": 1305, "atom2_serNum": 1338, "donAcc_type": "standard", "distance": 3.107, "atom1_id": "///A/173/O", "atom2_id": "///A/177/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 182, "atom1_serNum": 1314, "atom2_serNum": 1318, "donAcc_type": "standard", "distance": 3.335, "atom1_id": "///A/174/O", "atom2_id": "///A/174/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 183, "atom1_serNum": 1314, "atom2_serNum": 1347, "donAcc_type": "standard", "distance": 3.216, "atom1_id": "///A/174/O", "atom2_id": "///A/178/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 184, "atom1_serNum": 1320, "atom2_serNum": 4008, "donAcc_type": "standard", "distance": 2.612, "atom1_id": "///A/174/NH1", "atom2_id": "///E/34/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 185, "atom1_serNum": 1325, "atom2_serNum": 1355, "donAcc_type": "standard", "distance": 3.119, "atom1_id": "///A/175/O", "atom2_id": "///A/179/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 186, "atom1_serNum": 1333, "atom2_serNum": 1367, "donAcc_type": "standard", "distance": 2.871, "atom1_id": "///A/176/O", "atom2_id": "///A/180/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 187, "atom1_serNum": 1341, "atom2_serNum": 1379, "donAcc_type": "standard", "distance": 2.939, "atom1_id": "///A/177/O", "atom2_id": "///A/181/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 188, "atom1_serNum": 1350, "atom2_serNum": 1388, "donAcc_type": "standard", "distance": 3.049, "atom1_id": "///A/178/O", "atom2_id": "///A/182/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 189, "atom1_serNum": 1350, "atom2_serNum": 1393, "donAcc_type": "acceptable", "distance": 2.572, "atom1_id": "///A/178/O", "atom2_id": "///A/182/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 190, "atom1_serNum": 1358, "atom2_serNum": 1395, "donAcc_type": "standard", "distance": 2.758, "atom1_id": "///A/179/O", "atom2_id": "///A/183/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 191, "atom1_serNum": 1393, "atom2_serNum": 1402, "donAcc_type": "acceptable", "distance": 2.957, "atom1_id": "///A/182/OG1", "atom2_id": "///A/184/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 192, "atom1_serNum": 1407, "atom2_serNum": 1472, "donAcc_type": "standard", "distance": 3.527, "atom1_id": "///A/184/NZ", "atom2_id": "///A/192/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 193, "atom1_serNum": 1411, "atom2_serNum": 1444, "donAcc_type": "acceptable", "distance": 3.070, "atom1_id": "///A/185/O", "atom2_id": "///A/189/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 194, "atom1_serNum": 1416, "atom2_serNum": 1438, "donAcc_type": "standard", "distance": 2.755, "atom1_id": "///A/185/NZ", "atom2_id": "///A/188/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 195, "atom1_serNum": 1420, "atom2_serNum": 1446, "donAcc_type": "standard", "distance": 3.353, "atom1_id": "///A/186/O", "atom2_id": "///A/190/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 196, "atom1_serNum": 1427, "atom2_serNum": 1457, "donAcc_type": "standard", "distance": 3.220, "atom1_id": "///A/187/O", "atom2_id": "///A/191/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 197, "atom1_serNum": 1433, "atom2_serNum": 1465, "donAcc_type": "standard", "distance": 3.233, "atom1_id": "///A/188/O", "atom2_id": "///A/192/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 198, "atom1_serNum": 1460, "atom2_serNum": 7492, "donAcc_type": "standard", "distance": 3.216, "atom1_id": "///A/191/O", "atom2_id": "///B/341/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 199, "atom1_serNum": 1463, "atom2_serNum": 7492, "donAcc_type": "standard", "distance": 3.009, "atom1_id": "///A/191/OD1", "atom2_id": "///B/341/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 200, "atom1_serNum": 1481, "atom2_serNum": 4001, "donAcc_type": "questionable", "distance": 2.579, "atom1_id": "///A/193/OE1", "atom2_id": "///E/33/O2", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 201, "atom1_serNum": 1482, "atom2_serNum": 4001, "donAcc_type": "standard", "distance": 3.074, "atom1_id": "///A/193/NE2", "atom2_id": "///E/33/O2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 202, "atom1_serNum": 1527, "atom2_serNum": 1543, "donAcc_type": "standard", "distance": 2.949, "atom1_id": "///A/199/O", "atom2_id": "///A/201/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 203, "atom1_serNum": 1527, "atom2_serNum": 1548, "donAcc_type": "acceptable", "distance": 2.680, "atom1_id": "///A/199/O", "atom2_id": "///A/201/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 204, "atom1_serNum": 1541, "atom2_serNum": 7244, "donAcc_type": "standard", "distance": 3.480, "atom1_id": "///A/200/OD1", "atom2_id": "///B/309/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 205, "atom1_serNum": 1561, "atom2_serNum": 2446, "donAcc_type": "standard", "distance": 2.925, "atom1_id": "///A/203/O", "atom2_id": "///A/313/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 206, "atom1_serNum": 1577, "atom2_serNum": 2449, "donAcc_type": "standard", "distance": 2.775, "atom1_id": "///A/205/N", "atom2_id": "///A/313/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 207, "atom1_serNum": 1580, "atom2_serNum": 1599, "donAcc_type": "standard", "distance": 2.905, "atom1_id": "///A/205/O", "atom2_id": "///A/207/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 208, "atom1_serNum": 1580, "atom2_serNum": 2466, "donAcc_type": "standard", "distance": 2.835, "atom1_id": "///A/205/O", "atom2_id": "///A/315/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 209, "atom1_serNum": 1602, "atom2_serNum": 2469, "donAcc_type": "questionable", "distance": 2.970, "atom1_id": "///A/207/O", "atom2_id": "///A/315/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 210, "atom1_serNum": 1602, "atom2_serNum": 2482, "donAcc_type": "standard", "distance": 2.830, "atom1_id": "///A/207/O", "atom2_id": "///A/317/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 211, "atom1_serNum": 1617, "atom2_serNum": 2492, "donAcc_type": "acceptable", "distance": 2.719, "atom1_id": "///A/209/N", "atom2_id": "///A/318/OG1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 212, "atom1_serNum": 1620, "atom2_serNum": 1649, "donAcc_type": "standard", "distance": 3.038, "atom1_id": "///A/209/O", "atom2_id": "///A/213/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 213, "atom1_serNum": 1629, "atom2_serNum": 1657, "donAcc_type": "standard", "distance": 2.885, "atom1_id": "///A/210/O", "atom2_id": "///A/214/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 214, "atom1_serNum": 1636, "atom2_serNum": 1657, "donAcc_type": "standard", "distance": 3.243, "atom1_id": "///A/211/O", "atom2_id": "///A/214/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 215, "atom1_serNum": 1636, "atom2_serNum": 1668, "donAcc_type": "standard", "distance": 3.073, "atom1_id": "///A/211/O", "atom2_id": "///A/215/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 216, "atom1_serNum": 1645, "atom2_serNum": 1677, "donAcc_type": "standard", "distance": 2.812, "atom1_id": "///A/212/O", "atom2_id": "///A/216/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 217, "atom1_serNum": 1652, "atom2_serNum": 1688, "donAcc_type": "standard", "distance": 3.145, "atom1_id": "///A/213/O", "atom2_id": "///A/217/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 218, "atom1_serNum": 1660, "atom2_serNum": 1696, "donAcc_type": "standard", "distance": 3.105, "atom1_id": "///A/214/O", "atom2_id": "///A/218/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 219, "atom1_serNum": 1671, "atom2_serNum": 1704, "donAcc_type": "standard", "distance": 3.099, "atom1_id": "///A/215/O", "atom2_id": "///A/219/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 220, "atom1_serNum": 1675, "atom2_serNum": 1711, "donAcc_type": "questionable", "distance": 2.703, "atom1_id": "///A/215/OE1", "atom2_id": "///A/219/OD2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 221, "atom1_serNum": 1680, "atom2_serNum": 1712, "donAcc_type": "standard", "distance": 2.899, "atom1_id": "///A/216/O", "atom2_id": "///A/220/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 222, "atom1_serNum": 1686, "atom2_serNum": 2485, "donAcc_type": "standard", "distance": 3.452, "atom1_id": "///A/216/NH1", "atom2_id": "///A/317/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 223, "atom1_serNum": 1687, "atom2_serNum": 2490, "donAcc_type": "standard", "distance": 2.664, "atom1_id": "///A/216/NH2", "atom2_id": "///A/318/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 224, "atom1_serNum": 1699, "atom2_serNum": 1730, "donAcc_type": "standard", "distance": 3.173, "atom1_id": "///A/218/O", "atom2_id": "///A/222/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 225, "atom1_serNum": 1707, "atom2_serNum": 1738, "donAcc_type": "standard", "distance": 3.164, "atom1_id": "///A/219/O", "atom2_id": "///A/223/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 226, "atom1_serNum": 1721, "atom2_serNum": 9635, "donAcc_type": "acceptable", "distance": 2.735, "atom1_id": "///A/220/NH1", "atom2_id": "///A/422/O1", "atom_pair": "N:O", "residue_pair": "aa:ligand" }, { "index": 227, "atom1_serNum": 1726, "atom2_serNum": 1746, "donAcc_type": "standard", "distance": 3.209, "atom1_id": "///A/221/O", "atom2_id": "///A/224/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 228, "atom1_serNum": 1733, "atom2_serNum": 1754, "donAcc_type": "standard", "distance": 2.911, "atom1_id": "///A/222/O", "atom2_id": "///A/225/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 229, "atom1_serNum": 1736, "atom2_serNum": 2222, "donAcc_type": "standard", "distance": 2.928, "atom1_id": "///A/222/OD1", "atom2_id": "///A/286/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 230, "atom1_serNum": 1749, "atom2_serNum": 1786, "donAcc_type": "standard", "distance": 3.332, "atom1_id": "///A/224/O", "atom2_id": "///A/229/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 231, "atom1_serNum": 1757, "atom2_serNum": 1782, "donAcc_type": "standard", "distance": 3.072, "atom1_id": "///A/225/O", "atom2_id": "///A/228/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 232, "atom1_serNum": 1757, "atom2_serNum": 1786, "donAcc_type": "standard", "distance": 3.215, "atom1_id": "///A/225/O", "atom2_id": "///A/229/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 233, "atom1_serNum": 1785, "atom2_serNum": 1808, "donAcc_type": "standard", "distance": 3.107, "atom1_id": "///A/228/O", "atom2_id": "///A/232/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 234, "atom1_serNum": 1789, "atom2_serNum": 1817, "donAcc_type": "standard", "distance": 3.106, "atom1_id": "///A/229/O", "atom2_id": "///A/233/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 235, "atom1_serNum": 1794, "atom2_serNum": 1825, "donAcc_type": "standard", "distance": 2.775, "atom1_id": "///A/230/O", "atom2_id": "///A/234/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 236, "atom1_serNum": 1802, "atom2_serNum": 1834, "donAcc_type": "standard", "distance": 2.632, "atom1_id": "///A/231/O", "atom2_id": "///A/235/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 237, "atom1_serNum": 1811, "atom2_serNum": 1843, "donAcc_type": "standard", "distance": 3.186, "atom1_id": "///A/232/O", "atom2_id": "///A/236/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 238, "atom1_serNum": 1820, "atom2_serNum": 1843, "donAcc_type": "standard", "distance": 2.897, "atom1_id": "///A/233/O", "atom2_id": "///A/236/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 239, "atom1_serNum": 1820, "atom2_serNum": 1851, "donAcc_type": "standard", "distance": 2.897, "atom1_id": "///A/233/O", "atom2_id": "///A/237/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 240, "atom1_serNum": 1828, "atom2_serNum": 1863, "donAcc_type": "standard", "distance": 3.208, "atom1_id": "///A/234/O", "atom2_id": "///A/238/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 241, "atom1_serNum": 1846, "atom2_serNum": 1884, "donAcc_type": "standard", "distance": 3.325, "atom1_id": "///A/236/O", "atom2_id": "///A/240/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 242, "atom1_serNum": 1854, "atom2_serNum": 1896, "donAcc_type": "standard", "distance": 3.234, "atom1_id": "///A/237/O", "atom2_id": "///A/241/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 243, "atom1_serNum": 1862, "atom2_serNum": 2090, "donAcc_type": "acceptable", "distance": 3.575, "atom1_id": "///A/237/OH", "atom2_id": "///A/264/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 244, "atom1_serNum": 1866, "atom2_serNum": 1902, "donAcc_type": "standard", "distance": 3.863, "atom1_id": "///A/238/O", "atom2_id": "///A/242/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 245, "atom1_serNum": 1887, "atom2_serNum": 1919, "donAcc_type": "standard", "distance": 3.076, "atom1_id": "///A/240/O", "atom2_id": "///A/244/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 246, "atom1_serNum": 1887, "atom2_serNum": 1928, "donAcc_type": "standard", "distance": 3.346, "atom1_id": "///A/240/O", "atom2_id": "///A/245/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 247, "atom1_serNum": 1899, "atom2_serNum": 1911, "donAcc_type": "standard", "distance": 3.163, "atom1_id": "///A/241/O", "atom2_id": "///A/243/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 248, "atom1_serNum": 1899, "atom2_serNum": 1919, "donAcc_type": "standard", "distance": 2.852, "atom1_id": "///A/241/O", "atom2_id": "///A/244/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 249, "atom1_serNum": 1922, "atom2_serNum": 1939, "donAcc_type": "standard", "distance": 2.751, "atom1_id": "///A/244/O", "atom2_id": "///A/246/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 250, "atom1_serNum": 1942, "atom2_serNum": 1953, "donAcc_type": "standard", "distance": 2.529, "atom1_id": "///A/246/O", "atom2_id": "///A/248/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 251, "atom1_serNum": 1965, "atom2_serNum": 2013, "donAcc_type": "standard", "distance": 2.899, "atom1_id": "///A/249/O", "atom2_id": "///A/255/NE1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 252, "atom1_serNum": 1970, "atom2_serNum": 1989, "donAcc_type": "standard", "distance": 2.661, "atom1_id": "///A/249/NE2", "atom2_id": "///A/252/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 253, "atom1_serNum": 1974, "atom2_serNum": 2066, "donAcc_type": "standard", "distance": 2.863, "atom1_id": "///A/250/O", "atom2_id": "///A/261/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 254, "atom1_serNum": 1984, "atom2_serNum": 4109, "donAcc_type": "acceptable", "distance": 3.074, "atom1_id": "///A/251/OE1", "atom2_id": "///E/38/O2'", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 255, "atom1_serNum": 1997, "atom2_serNum": 2019, "donAcc_type": "standard", "distance": 2.978, "atom1_id": "///A/253/O", "atom2_id": "///A/256/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 256, "atom1_serNum": 2001, "atom2_serNum": 2028, "donAcc_type": "standard", "distance": 2.673, "atom1_id": "///A/254/O", "atom2_id": "///A/257/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 257, "atom1_serNum": 2026, "atom2_serNum": 4082, "donAcc_type": "acceptable", "distance": 3.100, "atom1_id": "///A/256/OE1", "atom2_id": "///E/37/O2'", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 258, "atom1_serNum": 2027, "atom2_serNum": 2066, "donAcc_type": "questionable", "distance": 3.017, "atom1_id": "///A/256/NE2", "atom2_id": "///A/261/NZ", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 259, "atom1_serNum": 2031, "atom2_serNum": 2047, "donAcc_type": "standard", "distance": 3.472, "atom1_id": "///A/257/O", "atom2_id": "///A/260/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 260, "atom1_serNum": 2043, "atom2_serNum": 2074, "donAcc_type": "standard", "distance": 3.074, "atom1_id": "///A/259/N", "atom2_id": "///A/262/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 261, "atom1_serNum": 2046, "atom2_serNum": 2076, "donAcc_type": "standard", "distance": 2.735, "atom1_id": "///A/259/O", "atom2_id": "///A/263/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 262, "atom1_serNum": 2050, "atom2_serNum": 2076, "donAcc_type": "standard", "distance": 2.890, "atom1_id": "///A/260/O", "atom2_id": "///A/263/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 263, "atom1_serNum": 2050, "atom2_serNum": 2087, "donAcc_type": "standard", "distance": 3.024, "atom1_id": "///A/260/O", "atom2_id": "///A/264/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 264, "atom1_serNum": 2075, "atom2_serNum": 2202, "donAcc_type": "standard", "distance": 3.424, "atom1_id": "///A/262/OE2", "atom2_id": "///A/284/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 265, "atom1_serNum": 2079, "atom2_serNum": 2102, "donAcc_type": "standard", "distance": 3.124, "atom1_id": "///A/263/O", "atom2_id": "///A/266/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 266, "atom1_serNum": 2090, "atom2_serNum": 2116, "donAcc_type": "standard", "distance": 3.249, "atom1_id": "///A/264/O", "atom2_id": "///A/267/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 267, "atom1_serNum": 2090, "atom2_serNum": 2124, "donAcc_type": "standard", "distance": 2.846, "atom1_id": "///A/264/O", "atom2_id": "///A/268/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 268, "atom1_serNum": 2134, "atom2_serNum": 2171, "donAcc_type": "questionable", "distance": 3.301, "atom1_id": "///A/276/O", "atom2_id": "///A/280/OD2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 269, "atom1_serNum": 2150, "atom2_serNum": 2172, "donAcc_type": "standard", "distance": 3.115, "atom1_id": "///A/278/O", "atom2_id": "///A/281/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 270, "atom1_serNum": 2150, "atom2_serNum": 2178, "donAcc_type": "standard", "distance": 3.078, "atom1_id": "///A/278/O", "atom2_id": "///A/282/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 271, "atom1_serNum": 2158, "atom2_serNum": 2186, "donAcc_type": "standard", "distance": 2.968, "atom1_id": "///A/279/O", "atom2_id": "///A/283/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 272, "atom1_serNum": 2175, "atom2_serNum": 2206, "donAcc_type": "standard", "distance": 2.905, "atom1_id": "///A/281/O", "atom2_id": "///A/285/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 273, "atom1_serNum": 2181, "atom2_serNum": 2214, "donAcc_type": "standard", "distance": 3.005, "atom1_id": "///A/282/O", "atom2_id": "///A/286/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 274, "atom1_serNum": 2189, "atom2_serNum": 2223, "donAcc_type": "standard", "distance": 2.987, "atom1_id": "///A/283/O", "atom2_id": "///A/287/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 275, "atom1_serNum": 2189, "atom2_serNum": 2228, "donAcc_type": "acceptable", "distance": 3.067, "atom1_id": "///A/283/O", "atom2_id": "///A/287/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 276, "atom1_serNum": 2198, "atom2_serNum": 2230, "donAcc_type": "standard", "distance": 2.900, "atom1_id": "///A/284/O", "atom2_id": "///A/288/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 277, "atom1_serNum": 2204, "atom2_serNum": 3836, "donAcc_type": "standard", "distance": 3.518, "atom1_id": "///A/284/NH1", "atom2_id": "///E/26/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 278, "atom1_serNum": 2209, "atom2_serNum": 2241, "donAcc_type": "standard", "distance": 3.045, "atom1_id": "///A/285/O", "atom2_id": "///A/289/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 279, "atom1_serNum": 2209, "atom2_serNum": 2246, "donAcc_type": "acceptable", "distance": 2.768, "atom1_id": "///A/285/O", "atom2_id": "///A/289/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 280, "atom1_serNum": 2217, "atom2_serNum": 2248, "donAcc_type": "standard", "distance": 3.416, "atom1_id": "///A/286/O", "atom2_id": "///A/290/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 281, "atom1_serNum": 2226, "atom2_serNum": 2259, "donAcc_type": "standard", "distance": 3.024, "atom1_id": "///A/287/O", "atom2_id": "///A/291/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 282, "atom1_serNum": 2233, "atom2_serNum": 2268, "donAcc_type": "standard", "distance": 3.156, "atom1_id": "///A/288/O", "atom2_id": "///A/292/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 283, "atom1_serNum": 2239, "atom2_serNum": 2266, "donAcc_type": "standard", "distance": 3.402, "atom1_id": "///A/288/NH1", "atom2_id": "///A/291/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 284, "atom1_serNum": 2240, "atom2_serNum": 4078, "donAcc_type": "standard", "distance": 2.930, "atom1_id": "///A/288/NH2", "atom2_id": "///E/37/O4'", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 285, "atom1_serNum": 2240, "atom2_serNum": 4092, "donAcc_type": "standard", "distance": 2.907, "atom1_id": "///A/288/NH2", "atom2_id": "///E/37/N3", "atom_pair": "N:N", "residue_pair": "aa:nt" }, { "index": 286, "atom1_serNum": 2244, "atom2_serNum": 2280, "donAcc_type": "standard", "distance": 3.083, "atom1_id": "///A/289/O", "atom2_id": "///A/293/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 287, "atom1_serNum": 2251, "atom2_serNum": 2285, "donAcc_type": "standard", "distance": 2.805, "atom1_id": "///A/290/O", "atom2_id": "///A/294/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 288, "atom1_serNum": 2262, "atom2_serNum": 2294, "donAcc_type": "standard", "distance": 3.061, "atom1_id": "///A/291/O", "atom2_id": "///A/295/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 289, "atom1_serNum": 2267, "atom2_serNum": 3859, "donAcc_type": "standard", "distance": 2.614, "atom1_id": "///A/291/NE2", "atom2_id": "///E/27/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 290, "atom1_serNum": 2271, "atom2_serNum": 2305, "donAcc_type": "standard", "distance": 2.896, "atom1_id": "///A/292/O", "atom2_id": "///A/296/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 291, "atom1_serNum": 2279, "atom2_serNum": 4074, "donAcc_type": "acceptable", "distance": 3.424, "atom1_id": "///A/292/OH", "atom2_id": "///E/37/OP2", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 292, "atom1_serNum": 2283, "atom2_serNum": 2314, "donAcc_type": "standard", "distance": 3.062, "atom1_id": "///A/293/O", "atom2_id": "///A/297/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 293, "atom1_serNum": 2288, "atom2_serNum": 2321, "donAcc_type": "standard", "distance": 3.071, "atom1_id": "///A/294/O", "atom2_id": "///A/298/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 294, "atom1_serNum": 2293, "atom2_serNum": 3881, "donAcc_type": "standard", "distance": 3.192, "atom1_id": "///A/294/NZ", "atom2_id": "///E/28/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 295, "atom1_serNum": 2297, "atom2_serNum": 2330, "donAcc_type": "standard", "distance": 2.863, "atom1_id": "///A/295/O", "atom2_id": "///A/299/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 296, "atom1_serNum": 2303, "atom2_serNum": 4113, "donAcc_type": "standard", "distance": 3.485, "atom1_id": "///A/295/NH1", "atom2_id": "///E/38/N7", "atom_pair": "N:N", "residue_pair": "aa:nt" }, { "index": 297, "atom1_serNum": 2304, "atom2_serNum": 4101, "donAcc_type": "standard", "distance": 3.115, "atom1_id": "///A/295/NH2", "atom2_id": "///E/38/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 298, "atom1_serNum": 2308, "atom2_serNum": 2344, "donAcc_type": "standard", "distance": 3.034, "atom1_id": "///A/296/O", "atom2_id": "///A/300/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 299, "atom1_serNum": 2317, "atom2_serNum": 2352, "donAcc_type": "standard", "distance": 2.783, "atom1_id": "///A/297/O", "atom2_id": "///A/301/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 300, "atom1_serNum": 2324, "atom2_serNum": 2361, "donAcc_type": "standard", "distance": 2.709, "atom1_id": "///A/298/O", "atom2_id": "///A/302/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 301, "atom1_serNum": 2329, "atom2_serNum": 3902, "donAcc_type": "standard", "distance": 3.244, "atom1_id": "///A/298/NZ", "atom2_id": "///E/29/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 302, "atom1_serNum": 2333, "atom2_serNum": 2370, "donAcc_type": "standard", "distance": 2.863, "atom1_id": "///A/299/O", "atom2_id": "///A/303/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 303, "atom1_serNum": 2333, "atom2_serNum": 2378, "donAcc_type": "standard", "distance": 3.028, "atom1_id": "///A/299/O", "atom2_id": "///A/304/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 304, "atom1_serNum": 2347, "atom2_serNum": 2386, "donAcc_type": "standard", "distance": 3.039, "atom1_id": "///A/300/O", "atom2_id": "///A/305/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 305, "atom1_serNum": 2364, "atom2_serNum": 2873, "donAcc_type": "standard", "distance": 2.924, "atom1_id": "///A/302/O", "atom2_id": "///A/366/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 306, "atom1_serNum": 2369, "atom2_serNum": 3924, "donAcc_type": "standard", "distance": 3.096, "atom1_id": "///A/302/NZ", "atom2_id": "///E/30/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 307, "atom1_serNum": 2369, "atom2_serNum": 3925, "donAcc_type": "standard", "distance": 3.310, "atom1_id": "///A/302/NZ", "atom2_id": "///E/30/O5'", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 308, "atom1_serNum": 2369, "atom2_serNum": 3947, "donAcc_type": "standard", "distance": 3.138, "atom1_id": "///A/302/NZ", "atom2_id": "///E/31/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 309, "atom1_serNum": 2373, "atom2_serNum": 2401, "donAcc_type": "standard", "distance": 3.069, "atom1_id": "///A/303/O", "atom2_id": "///A/307/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 310, "atom1_serNum": 2381, "atom2_serNum": 2401, "donAcc_type": "standard", "distance": 2.866, "atom1_id": "///A/304/O", "atom2_id": "///A/307/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 311, "atom1_serNum": 2381, "atom2_serNum": 2409, "donAcc_type": "standard", "distance": 2.999, "atom1_id": "///A/304/O", "atom2_id": "///A/308/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 312, "atom1_serNum": 2389, "atom2_serNum": 2417, "donAcc_type": "standard", "distance": 3.060, "atom1_id": "///A/305/O", "atom2_id": "///A/309/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 313, "atom1_serNum": 2389, "atom2_serNum": 2426, "donAcc_type": "standard", "distance": 2.974, "atom1_id": "///A/305/O", "atom2_id": "///A/310/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 314, "atom1_serNum": 2397, "atom2_serNum": 2417, "donAcc_type": "standard", "distance": 2.973, "atom1_id": "///A/306/O", "atom2_id": "///A/309/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 315, "atom1_serNum": 2412, "atom2_serNum": 2430, "donAcc_type": "standard", "distance": 3.242, "atom1_id": "///A/308/O", "atom2_id": "///A/311/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 316, "atom1_serNum": 2425, "atom2_serNum": 6360, "donAcc_type": "standard", "distance": 3.477, "atom1_id": "///A/309/NZ", "atom2_id": "///B/200/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 317, "atom1_serNum": 2429, "atom2_serNum": 2736, "donAcc_type": "standard", "distance": 3.098, "atom1_id": "///A/310/O", "atom2_id": "///A/348/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 318, "atom1_serNum": 2436, "atom2_serNum": 2737, "donAcc_type": "standard", "distance": 2.493, "atom1_id": "///A/311/OD1", "atom2_id": "///A/348/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 319, "atom1_serNum": 2457, "atom2_serNum": 7639, "donAcc_type": "acceptable", "distance": 3.179, "atom1_id": "///A/313/OH", "atom2_id": "///B/359/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 320, "atom1_serNum": 2458, "atom2_serNum": 2730, "donAcc_type": "standard", "distance": 3.184, "atom1_id": "///A/314/N", "atom2_id": "///A/348/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 321, "atom1_serNum": 2461, "atom2_serNum": 2591, "donAcc_type": "standard", "distance": 2.662, "atom1_id": "///A/314/O", "atom2_id": "///A/330/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 322, "atom1_serNum": 2469, "atom2_serNum": 2482, "donAcc_type": "standard", "distance": 2.958, "atom1_id": "///A/315/O", "atom2_id": "///A/317/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 323, "atom1_serNum": 2480, "atom2_serNum": 2482, "donAcc_type": "standard", "distance": 3.169, "atom1_id": "///A/316/OD1", "atom2_id": "///A/317/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 324, "atom1_serNum": 2480, "atom2_serNum": 2487, "donAcc_type": "standard", "distance": 3.151, "atom1_id": "///A/316/OD1", "atom2_id": "///A/318/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 325, "atom1_serNum": 2480, "atom2_serNum": 2492, "donAcc_type": "acceptable", "distance": 3.074, "atom1_id": "///A/316/OD1", "atom2_id": "///A/318/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 326, "atom1_serNum": 2497, "atom2_serNum": 2516, "donAcc_type": "standard", "distance": 3.143, "atom1_id": "///A/319/O", "atom2_id": "///A/322/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 327, "atom1_serNum": 2500, "atom2_serNum": 2510, "donAcc_type": "standard", "distance": 2.722, "atom1_id": "///A/319/OD1", "atom2_id": "///A/321/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 328, "atom1_serNum": 2500, "atom2_serNum": 2515, "donAcc_type": "acceptable", "distance": 2.532, "atom1_id": "///A/319/OD1", "atom2_id": "///A/321/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 329, "atom1_serNum": 2501, "atom2_serNum": 2524, "donAcc_type": "standard", "distance": 2.901, "atom1_id": "///A/319/OD2", "atom2_id": "///A/322/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 330, "atom1_serNum": 2519, "atom2_serNum": 2547, "donAcc_type": "standard", "distance": 3.111, "atom1_id": "///A/322/O", "atom2_id": "///A/325/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 331, "atom1_serNum": 2519, "atom2_serNum": 2552, "donAcc_type": "acceptable", "distance": 2.972, "atom1_id": "///A/322/O", "atom2_id": "///A/325/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 332, "atom1_serNum": 2519, "atom2_serNum": 2554, "donAcc_type": "standard", "distance": 2.627, "atom1_id": "///A/322/O", "atom2_id": "///A/326/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 333, "atom1_serNum": 2528, "atom2_serNum": 2562, "donAcc_type": "standard", "distance": 2.648, "atom1_id": "///A/323/O", "atom2_id": "///A/327/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 334, "atom1_serNum": 2528, "atom2_serNum": 2567, "donAcc_type": "standard", "distance": 2.789, "atom1_id": "///A/323/O", "atom2_id": "///A/328/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 335, "atom1_serNum": 2542, "atom2_serNum": 2573, "donAcc_type": "standard", "distance": 2.660, "atom1_id": "///A/324/O", "atom2_id": "///A/329/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 336, "atom1_serNum": 2545, "atom2_serNum": 2572, "donAcc_type": "acceptable", "distance": 3.522, "atom1_id": "///A/324/OD1", "atom2_id": "///A/328/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 337, "atom1_serNum": 2546, "atom2_serNum": 2581, "donAcc_type": "standard", "distance": 3.460, "atom1_id": "///A/324/OD2", "atom2_id": "///A/329/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 338, "atom1_serNum": 2565, "atom2_serNum": 2593, "donAcc_type": "standard", "distance": 2.935, "atom1_id": "///A/327/O", "atom2_id": "///A/331/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 339, "atom1_serNum": 2570, "atom2_serNum": 2593, "donAcc_type": "standard", "distance": 2.842, "atom1_id": "///A/328/O", "atom2_id": "///A/331/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 340, "atom1_serNum": 2570, "atom2_serNum": 2598, "donAcc_type": "standard", "distance": 3.035, "atom1_id": "///A/328/O", "atom2_id": "///A/332/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 341, "atom1_serNum": 2576, "atom2_serNum": 2606, "donAcc_type": "standard", "distance": 3.164, "atom1_id": "///A/329/O", "atom2_id": "///A/333/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 342, "atom1_serNum": 2585, "atom2_serNum": 2611, "donAcc_type": "standard", "distance": 3.085, "atom1_id": "///A/330/O", "atom2_id": "///A/334/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 343, "atom1_serNum": 2596, "atom2_serNum": 2619, "donAcc_type": "standard", "distance": 2.749, "atom1_id": "///A/331/O", "atom2_id": "///A/335/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 344, "atom1_serNum": 2596, "atom2_serNum": 2624, "donAcc_type": "acceptable", "distance": 2.452, "atom1_id": "///A/331/O", "atom2_id": "///A/335/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 345, "atom1_serNum": 2601, "atom2_serNum": 2625, "donAcc_type": "standard", "distance": 2.566, "atom1_id": "///A/332/O", "atom2_id": "///A/336/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 346, "atom1_serNum": 2609, "atom2_serNum": 2633, "donAcc_type": "standard", "distance": 3.291, "atom1_id": "///A/333/O", "atom2_id": "///A/337/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 347, "atom1_serNum": 2609, "atom2_serNum": 2639, "donAcc_type": "questionable", "distance": 3.149, "atom1_id": "///A/333/O", "atom2_id": "///A/337/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 348, "atom1_serNum": 2614, "atom2_serNum": 2641, "donAcc_type": "standard", "distance": 3.169, "atom1_id": "///A/334/O", "atom2_id": "///A/338/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 349, "atom1_serNum": 2622, "atom2_serNum": 2652, "donAcc_type": "standard", "distance": 3.132, "atom1_id": "///A/335/O", "atom2_id": "///A/339/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 350, "atom1_serNum": 2628, "atom2_serNum": 2652, "donAcc_type": "standard", "distance": 2.815, "atom1_id": "///A/336/O", "atom2_id": "///A/339/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 351, "atom1_serNum": 2628, "atom2_serNum": 2660, "donAcc_type": "standard", "distance": 2.837, "atom1_id": "///A/336/O", "atom2_id": "///A/340/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 352, "atom1_serNum": 2636, "atom2_serNum": 2674, "donAcc_type": "standard", "distance": 2.871, "atom1_id": "///A/337/O", "atom2_id": "///A/342/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 353, "atom1_serNum": 2644, "atom2_serNum": 2666, "donAcc_type": "standard", "distance": 3.491, "atom1_id": "///A/338/O", "atom2_id": "///A/341/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 354, "atom1_serNum": 2673, "atom2_serNum": 6282, "donAcc_type": "standard", "distance": 2.904, "atom1_id": "///A/341/ND2", "atom2_id": "///B/191/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 355, "atom1_serNum": 2708, "atom2_serNum": 7663, "donAcc_type": "standard", "distance": 3.495, "atom1_id": "///A/345/NZ", "atom2_id": "///B/363/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 356, "atom1_serNum": 2712, "atom2_serNum": 2727, "donAcc_type": "standard", "distance": 2.575, "atom1_id": "///A/346/O", "atom2_id": "///A/348/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 357, "atom1_serNum": 2725, "atom2_serNum": 7640, "donAcc_type": "standard", "distance": 3.563, "atom1_id": "///A/347/OE1", "atom2_id": "///B/360/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 358, "atom1_serNum": 2726, "atom2_serNum": 7631, "donAcc_type": "standard", "distance": 3.066, "atom1_id": "///A/347/OE2", "atom2_id": "///B/359/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 359, "atom1_serNum": 2746, "atom2_serNum": 2764, "donAcc_type": "standard", "distance": 2.930, "atom1_id": "///A/350/O", "atom2_id": "///A/353/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 360, "atom1_serNum": 2775, "atom2_serNum": 2798, "donAcc_type": "standard", "distance": 3.343, "atom1_id": "///A/354/O", "atom2_id": "///A/357/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 361, "atom1_serNum": 2784, "atom2_serNum": 2806, "donAcc_type": "standard", "distance": 2.850, "atom1_id": "///A/355/O", "atom2_id": "///A/358/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 362, "atom1_serNum": 2784, "atom2_serNum": 2811, "donAcc_type": "acceptable", "distance": 2.820, "atom1_id": "///A/355/O", "atom2_id": "///A/358/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 363, "atom1_serNum": 2809, "atom2_serNum": 2811, "donAcc_type": "acceptable", "distance": 2.859, "atom1_id": "///A/358/O", "atom2_id": "///A/358/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 364, "atom1_serNum": 2809, "atom2_serNum": 2825, "donAcc_type": "standard", "distance": 2.824, "atom1_id": "///A/358/O", "atom2_id": "///A/361/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 365, "atom1_serNum": 2809, "atom2_serNum": 2834, "donAcc_type": "standard", "distance": 3.314, "atom1_id": "///A/358/O", "atom2_id": "///A/362/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 366, "atom1_serNum": 2809, "atom2_serNum": 2839, "donAcc_type": "acceptable", "distance": 3.089, "atom1_id": "///A/358/O", "atom2_id": "///A/362/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 367, "atom1_serNum": 2812, "atom2_serNum": 7545, "donAcc_type": "standard", "distance": 2.954, "atom1_id": "///A/359/N", "atom2_id": "///B/347/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 368, "atom1_serNum": 2815, "atom2_serNum": 2834, "donAcc_type": "standard", "distance": 3.208, "atom1_id": "///A/359/O", "atom2_id": "///A/362/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 369, "atom1_serNum": 2815, "atom2_serNum": 2848, "donAcc_type": "standard", "distance": 2.734, "atom1_id": "///A/359/O", "atom2_id": "///A/364/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 370, "atom1_serNum": 2821, "atom2_serNum": 7544, "donAcc_type": "standard", "distance": 3.599, "atom1_id": "///A/360/N", "atom2_id": "///B/347/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 371, "atom1_serNum": 2837, "atom2_serNum": 2856, "donAcc_type": "standard", "distance": 2.845, "atom1_id": "///A/362/O", "atom2_id": "///A/365/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 372, "atom1_serNum": 2844, "atom2_serNum": 2865, "donAcc_type": "standard", "distance": 2.866, "atom1_id": "///A/363/O", "atom2_id": "///A/366/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 373, "atom1_serNum": 2874, "atom2_serNum": 3946, "donAcc_type": "standard", "distance": 3.117, "atom1_id": "///A/367/N", "atom2_id": "///E/31/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 374, "atom1_serNum": 2888, "atom2_serNum": 2890, "donAcc_type": "standard", "distance": 2.847, "atom1_id": "///A/368/OD1", "atom2_id": "///A/369/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 375, "atom1_serNum": 2896, "atom2_serNum": 2917, "donAcc_type": "acceptable", "distance": 3.385, "atom1_id": "///A/369/OD1", "atom2_id": "///A/371/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 376, "atom1_serNum": 2897, "atom2_serNum": 3059, "donAcc_type": "standard", "distance": 2.662, "atom1_id": "///A/369/OD2", "atom2_id": "///A/391/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 377, "atom1_serNum": 2901, "atom2_serNum": 2925, "donAcc_type": "acceptable", "distance": 3.173, "atom1_id": "///A/370/O", "atom2_id": "///A/372/ND1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 378, "atom1_serNum": 2915, "atom2_serNum": 3055, "donAcc_type": "standard", "distance": 3.035, "atom1_id": "///A/371/O", "atom2_id": "///A/390/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 379, "atom1_serNum": 2917, "atom2_serNum": 2940, "donAcc_type": "acceptable", "distance": 3.188, "atom1_id": "///A/371/OG1", "atom2_id": "///A/373/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 380, "atom1_serNum": 2919, "atom2_serNum": 2925, "donAcc_type": "acceptable", "distance": 3.128, "atom1_id": "///A/372/N", "atom2_id": "///A/372/ND1", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 381, "atom1_serNum": 2929, "atom2_serNum": 3045, "donAcc_type": "standard", "distance": 3.010, "atom1_id": "///A/373/N", "atom2_id": "///A/388/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 382, "atom1_serNum": 2932, "atom2_serNum": 3042, "donAcc_type": "standard", "distance": 2.973, "atom1_id": "///A/373/O", "atom2_id": "///A/388/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 383, "atom1_serNum": 2940, "atom2_serNum": 3066, "donAcc_type": "acceptable", "distance": 3.604, "atom1_id": "///A/373/OH", "atom2_id": "///A/391/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 384, "atom1_serNum": 2948, "atom2_serNum": 3031, "donAcc_type": "standard", "distance": 3.269, "atom1_id": "///A/375/N", "atom2_id": "///A/386/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 385, "atom1_serNum": 2951, "atom2_serNum": 3027, "donAcc_type": "standard", "distance": 2.967, "atom1_id": "///A/375/O", "atom2_id": "///A/385/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 386, "atom1_serNum": 2957, "atom2_serNum": 3027, "donAcc_type": "standard", "distance": 3.764, "atom1_id": "///A/376/O", "atom2_id": "///A/385/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 387, "atom1_serNum": 2965, "atom2_serNum": 3202, "donAcc_type": "standard", "distance": 3.138, "atom1_id": "///A/377/O", "atom2_id": "///A/406/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 388, "atom1_serNum": 2972, "atom2_serNum": 3027, "donAcc_type": "standard", "distance": 3.681, "atom1_id": "///A/378/O", "atom2_id": "///A/385/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 389, "atom1_serNum": 2972, "atom2_serNum": 3028, "donAcc_type": "standard", "distance": 3.122, "atom1_id": "///A/378/O", "atom2_id": "///A/386/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 390, "atom1_serNum": 2982, "atom2_serNum": 3010, "donAcc_type": "standard", "distance": 2.938, "atom1_id": "///A/379/NE", "atom2_id": "///A/383/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 391, "atom1_serNum": 2985, "atom2_serNum": 3026, "donAcc_type": "standard", "distance": 3.562, "atom1_id": "///A/379/NH2", "atom2_id": "///A/385/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 392, "atom1_serNum": 2986, "atom2_serNum": 3014, "donAcc_type": "standard", "distance": 3.175, "atom1_id": "///A/380/N", "atom2_id": "///A/384/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 393, "atom1_serNum": 2989, "atom2_serNum": 3007, "donAcc_type": "standard", "distance": 3.014, "atom1_id": "///A/380/O", "atom2_id": "///A/383/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 394, "atom1_serNum": 2992, "atom2_serNum": 3168, "donAcc_type": "standard", "distance": 3.277, "atom1_id": "///A/380/OD1", "atom2_id": "///A/402/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 395, "atom1_serNum": 2993, "atom2_serNum": 4182, "donAcc_type": "standard", "distance": 2.673, "atom1_id": "///A/380/ND2", "atom2_id": "///E/42/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 396, "atom1_serNum": 2999, "atom2_serNum": 3006, "donAcc_type": "standard", "distance": 2.613, "atom1_id": "///A/382/N", "atom2_id": "///A/382/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 397, "atom1_serNum": 3006, "atom2_serNum": 3007, "donAcc_type": "standard", "distance": 3.285, "atom1_id": "///A/382/OD2", "atom2_id": "///A/383/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 398, "atom1_serNum": 3058, "atom2_serNum": 3077, "donAcc_type": "standard", "distance": 2.876, "atom1_id": "///A/390/O", "atom2_id": "///A/393/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 399, "atom1_serNum": 3058, "atom2_serNum": 3089, "donAcc_type": "standard", "distance": 2.640, "atom1_id": "///A/390/O", "atom2_id": "///A/394/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 400, "atom1_serNum": 3062, "atom2_serNum": 3103, "donAcc_type": "standard", "distance": 2.951, "atom1_id": "///A/391/O", "atom2_id": "///A/395/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 401, "atom1_serNum": 3080, "atom2_serNum": 3112, "donAcc_type": "standard", "distance": 2.844, "atom1_id": "///A/393/O", "atom2_id": "///A/396/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 402, "atom1_serNum": 3080, "atom2_serNum": 3120, "donAcc_type": "standard", "distance": 3.046, "atom1_id": "///A/393/O", "atom2_id": "///A/397/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 403, "atom1_serNum": 3088, "atom2_serNum": 3910, "donAcc_type": "acceptable", "distance": 3.735, "atom1_id": "///A/393/OH", "atom2_id": "///E/29/O2'", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 404, "atom1_serNum": 3092, "atom2_serNum": 3130, "donAcc_type": "standard", "distance": 3.306, "atom1_id": "///A/394/O", "atom2_id": "///A/398/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 405, "atom1_serNum": 3115, "atom2_serNum": 3138, "donAcc_type": "standard", "distance": 2.815, "atom1_id": "///A/396/O", "atom2_id": "///A/399/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 406, "atom1_serNum": 3115, "atom2_serNum": 3142, "donAcc_type": "standard", "distance": 3.086, "atom1_id": "///A/396/O", "atom2_id": "///A/400/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 407, "atom1_serNum": 3123, "atom2_serNum": 3142, "donAcc_type": "standard", "distance": 2.879, "atom1_id": "///A/397/O", "atom2_id": "///A/400/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 408, "atom1_serNum": 3123, "atom2_serNum": 3147, "donAcc_type": "acceptable", "distance": 3.002, "atom1_id": "///A/397/O", "atom2_id": "///A/400/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 409, "atom1_serNum": 3126, "atom2_serNum": 4205, "donAcc_type": "acceptable", "distance": 2.372, "atom1_id": "///A/397/ND1", "atom2_id": "///E/43/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 410, "atom1_serNum": 3145, "atom2_serNum": 3180, "donAcc_type": "standard", "distance": 2.853, "atom1_id": "///A/400/O", "atom2_id": "///A/404/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 411, "atom1_serNum": 3147, "atom2_serNum": 3170, "donAcc_type": "acceptable", "distance": 3.206, "atom1_id": "///A/400/OG", "atom2_id": "///A/403/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 412, "atom1_serNum": 3147, "atom2_serNum": 4205, "donAcc_type": "acceptable", "distance": 3.061, "atom1_id": "///A/400/OG", "atom2_id": "///E/43/OP1", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 413, "atom1_serNum": 3148, "atom2_serNum": 4225, "donAcc_type": "standard", "distance": 2.694, "atom1_id": "///A/401/N", "atom2_id": "///E/44/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 414, "atom1_serNum": 3151, "atom2_serNum": 3189, "donAcc_type": "standard", "distance": 2.669, "atom1_id": "///A/401/O", "atom2_id": "///A/405/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 415, "atom1_serNum": 3155, "atom2_serNum": 4246, "donAcc_type": "standard", "distance": 2.685, "atom1_id": "///A/401/NE", "atom2_id": "///E/45/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 416, "atom1_serNum": 3155, "atom2_serNum": 4247, "donAcc_type": "standard", "distance": 3.165, "atom1_id": "///A/401/NE", "atom2_id": "///E/45/O5'", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 417, "atom1_serNum": 3162, "atom2_serNum": 3195, "donAcc_type": "standard", "distance": 2.971, "atom1_id": "///A/402/O", "atom2_id": "///A/406/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 418, "atom1_serNum": 3168, "atom2_serNum": 4182, "donAcc_type": "standard", "distance": 3.781, "atom1_id": "///A/402/NH1", "atom2_id": "///E/42/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 419, "atom1_serNum": 3168, "atom2_serNum": 4206, "donAcc_type": "standard", "distance": 2.887, "atom1_id": "///A/402/NH1", "atom2_id": "///E/43/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 420, "atom1_serNum": 3173, "atom2_serNum": 3203, "donAcc_type": "standard", "distance": 2.712, "atom1_id": "///A/403/O", "atom2_id": "///A/407/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 421, "atom1_serNum": 3183, "atom2_serNum": 3211, "donAcc_type": "standard", "distance": 2.914, "atom1_id": "///A/404/O", "atom2_id": "///A/408/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 422, "atom1_serNum": 3192, "atom2_serNum": 3220, "donAcc_type": "standard", "distance": 2.823, "atom1_id": "///A/405/O", "atom2_id": "///A/409/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 423, "atom1_serNum": 3194, "atom2_serNum": 3750, "donAcc_type": "acceptable", "distance": 3.462, "atom1_id": "///A/405/OG", "atom2_id": "///E/22/OP1", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 424, "atom1_serNum": 3198, "atom2_serNum": 3229, "donAcc_type": "standard", "distance": 3.084, "atom1_id": "///A/406/O", "atom2_id": "///A/409/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 425, "atom1_serNum": 3206, "atom2_serNum": 3239, "donAcc_type": "standard", "distance": 3.261, "atom1_id": "///A/407/O", "atom2_id": "///A/411/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 426, "atom1_serNum": 3206, "atom2_serNum": 3244, "donAcc_type": "acceptable", "distance": 2.930, "atom1_id": "///A/407/O", "atom2_id": "///A/411/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 427, "atom1_serNum": 3214, "atom2_serNum": 3246, "donAcc_type": "standard", "distance": 3.251, "atom1_id": "///A/408/O", "atom2_id": "///A/412/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 428, "atom1_serNum": 3229, "atom2_serNum": 3237, "donAcc_type": "standard", "distance": 3.024, "atom1_id": "///A/409/NH1", "atom2_id": "///A/410/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 429, "atom1_serNum": 3249, "atom2_serNum": 3271, "donAcc_type": "standard", "distance": 3.133, "atom1_id": "///A/412/O", "atom2_id": "///A/415/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 430, "atom1_serNum": 3274, "atom2_serNum": 3308, "donAcc_type": "standard", "distance": 3.169, "atom1_id": "///A/415/O", "atom2_id": "///A/419/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 431, "atom1_serNum": 3282, "atom2_serNum": 3308, "donAcc_type": "standard", "distance": 3.022, "atom1_id": "///A/416/O", "atom2_id": "///A/419/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 432, "atom1_serNum": 3282, "atom2_serNum": 3322, "donAcc_type": "standard", "distance": 2.907, "atom1_id": "///A/416/O", "atom2_id": "///A/420/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 433, "atom1_serNum": 3356, "atom2_serNum": 4816, "donAcc_type": "standard", "distance": 2.861, "atom1_id": "///E/2/O2", "atom2_id": "///E/71/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 434, "atom1_serNum": 3357, "atom2_serNum": 4814, "donAcc_type": "standard", "distance": 2.961, "atom1_id": "///E/2/N3", "atom2_id": "///E/71/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 435, "atom1_serNum": 3359, "atom2_serNum": 4813, "donAcc_type": "standard", "distance": 2.927, "atom1_id": "///E/2/N4", "atom2_id": "///E/71/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 436, "atom1_serNum": 3399, "atom2_serNum": 4768, "donAcc_type": "standard", "distance": 3.187, "atom1_id": "///E/4/N4", "atom2_id": "///E/69/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 437, "atom1_serNum": 3419, "atom2_serNum": 4748, "donAcc_type": "standard", "distance": 3.076, "atom1_id": "///E/5/O6", "atom2_id": "///E/68/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 438, "atom1_serNum": 3420, "atom2_serNum": 4745, "donAcc_type": "standard", "distance": 3.122, "atom1_id": "///E/5/N1", "atom2_id": "///E/68/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 439, "atom1_serNum": 3420, "atom2_serNum": 4746, "donAcc_type": "standard", "distance": 3.174, "atom1_id": "///E/5/N1", "atom2_id": "///E/68/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 440, "atom1_serNum": 3422, "atom2_serNum": 4757, "donAcc_type": "standard", "distance": 3.107, "atom1_id": "///E/5/N2", "atom2_id": "///E/69/O4'", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 441, "atom1_serNum": 3439, "atom2_serNum": 4728, "donAcc_type": "standard", "distance": 2.640, "atom1_id": "///E/6/O2", "atom2_id": "///E/67/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 442, "atom1_serNum": 3439, "atom2_serNum": 4745, "donAcc_type": "questionable", "distance": 2.886, "atom1_id": "///E/6/O2", "atom2_id": "///E/68/O2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 443, "atom1_serNum": 3440, "atom2_serNum": 4726, "donAcc_type": "questionable", "distance": 2.885, "atom1_id": "///E/6/N3", "atom2_id": "///E/67/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 444, "atom1_serNum": 3442, "atom2_serNum": 4725, "donAcc_type": "questionable", "distance": 3.216, "atom1_id": "///E/6/O4", "atom2_id": "///E/67/O6", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 445, "atom1_serNum": 3455, "atom2_serNum": 4728, "donAcc_type": "acceptable", "distance": 3.312, "atom1_id": "///E/7/O2'", "atom2_id": "///E/67/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 446, "atom1_serNum": 3462, "atom2_serNum": 4682, "donAcc_type": "standard", "distance": 3.624, "atom1_id": "///E/7/N6", "atom2_id": "///E/65/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 447, "atom1_serNum": 3462, "atom2_serNum": 4705, "donAcc_type": "standard", "distance": 3.095, "atom1_id": "///E/7/N6", "atom2_id": "///E/66/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 448, "atom1_serNum": 3463, "atom2_serNum": 4703, "donAcc_type": "standard", "distance": 2.932, "atom1_id": "///E/7/N1", "atom2_id": "///E/66/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 449, "atom1_serNum": 3468, "atom2_serNum": 4333, "donAcc_type": "questionable", "distance": 3.307, "atom1_id": "///E/8/OP1", "atom2_id": "///E/49/O5'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 450, "atom1_serNum": 3473, "atom2_serNum": 4320, "donAcc_type": "acceptable", "distance": 3.615, "atom1_id": "///E/8/O4'", "atom2_id": "///E/48/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 451, "atom1_serNum": 3481, "atom2_serNum": 3613, "donAcc_type": "standard", "distance": 2.733, "atom1_id": "///E/8/O2", "atom2_id": "///E/14/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 452, "atom1_serNum": 3481, "atom2_serNum": 3636, "donAcc_type": "standard", "distance": 3.067, "atom1_id": "///E/8/O2", "atom2_id": "///E/15/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 453, "atom1_serNum": 3481, "atom2_serNum": 4324, "donAcc_type": "questionable", "distance": 2.809, "atom1_id": "///E/8/O2", "atom2_id": "///E/48/O2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 454, "atom1_serNum": 3482, "atom2_serNum": 3610, "donAcc_type": "standard", "distance": 3.062, "atom1_id": "///E/8/N3", "atom2_id": "///E/14/N7", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 455, "atom1_serNum": 3484, "atom2_serNum": 3610, "donAcc_type": "questionable", "distance": 2.524, "atom1_id": "///E/8/O4", "atom2_id": "///E/14/N7", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 456, "atom1_serNum": 3497, "atom2_serNum": 3511, "donAcc_type": "acceptable", "distance": 2.642, "atom1_id": "///E/9/O2'", "atom2_id": "///E/10/OP1", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 457, "atom1_serNum": 3497, "atom2_serNum": 4273, "donAcc_type": "acceptable", "distance": 3.317, "atom1_id": "///E/9/O2'", "atom2_id": "///E/46/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 458, "atom1_serNum": 3501, "atom2_serNum": 3789, "donAcc_type": "standard", "distance": 3.179, "atom1_id": "///E/9/N7", "atom2_id": "///E/23/N4", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 459, "atom1_serNum": 3504, "atom2_serNum": 3789, "donAcc_type": "standard", "distance": 3.369, "atom1_id": "///E/9/O6", "atom2_id": "///E/23/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 460, "atom1_serNum": 3527, "atom2_serNum": 3832, "donAcc_type": "standard", "distance": 2.887, "atom1_id": "///E/10/O6", "atom2_id": "///E/25/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 461, "atom1_serNum": 3528, "atom2_serNum": 3830, "donAcc_type": "standard", "distance": 2.893, "atom1_id": "///E/10/N1", "atom2_id": "///E/25/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 462, "atom1_serNum": 3530, "atom2_serNum": 3829, "donAcc_type": "standard", "distance": 2.765, "atom1_id": "///E/10/N2", "atom2_id": "///E/25/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 463, "atom1_serNum": 3543, "atom2_serNum": 3559, "donAcc_type": "acceptable", "distance": 3.251, "atom1_id": "///E/11/O2'", "atom2_id": "///E/12/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 464, "atom1_serNum": 3547, "atom2_serNum": 3812, "donAcc_type": "standard", "distance": 2.932, "atom1_id": "///E/11/O2", "atom2_id": "///E/24/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 465, "atom1_serNum": 3548, "atom2_serNum": 3810, "donAcc_type": "standard", "distance": 3.078, "atom1_id": "///E/11/N3", "atom2_id": "///E/24/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 466, "atom1_serNum": 3550, "atom2_serNum": 3809, "donAcc_type": "standard", "distance": 3.066, "atom1_id": "///E/11/N4", "atom2_id": "///E/24/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 467, "atom1_serNum": 3570, "atom2_serNum": 3789, "donAcc_type": "standard", "distance": 3.141, "atom1_id": "///E/12/O6", "atom2_id": "///E/23/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 468, "atom1_serNum": 3571, "atom2_serNum": 3787, "donAcc_type": "standard", "distance": 3.115, "atom1_id": "///E/12/N1", "atom2_id": "///E/23/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 469, "atom1_serNum": 3573, "atom2_serNum": 3786, "donAcc_type": "standard", "distance": 2.938, "atom1_id": "///E/12/N2", "atom2_id": "///E/23/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 470, "atom1_serNum": 3590, "atom2_serNum": 3769, "donAcc_type": "standard", "distance": 2.928, "atom1_id": "///E/13/O2", "atom2_id": "///E/22/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 471, "atom1_serNum": 3591, "atom2_serNum": 3767, "donAcc_type": "standard", "distance": 2.982, "atom1_id": "///E/13/N3", "atom2_id": "///E/22/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 472, "atom1_serNum": 3593, "atom2_serNum": 3766, "donAcc_type": "standard", "distance": 2.917, "atom1_id": "///E/13/N4", "atom2_id": "///E/22/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 473, "atom1_serNum": 3628, "atom2_serNum": 3647, "donAcc_type": "acceptable", "distance": 3.330, "atom1_id": "///E/15/O2'", "atom2_id": "///E/16/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 474, "atom1_serNum": 3638, "atom2_serNum": 4325, "donAcc_type": "standard", "distance": 2.786, "atom1_id": "///E/15/N2", "atom2_id": "///E/48/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 475, "atom1_serNum": 3651, "atom2_serNum": 3685, "donAcc_type": "acceptable", "distance": 2.743, "atom1_id": "///E/16/O2'", "atom2_id": "///E/19/OP1", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 476, "atom1_serNum": 3651, "atom2_serNum": 3686, "donAcc_type": "acceptable", "distance": 2.614, "atom1_id": "///E/16/O2'", "atom2_id": "///E/19/OP2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 477, "atom1_serNum": 3655, "atom2_serNum": 4557, "donAcc_type": "questionable", "distance": 3.009, "atom1_id": "///E/16/O2", "atom2_id": "///E/59/O4", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 478, "atom1_serNum": 3656, "atom2_serNum": 4555, "donAcc_type": "questionable", "distance": 2.809, "atom1_id": "///E/16/N3", "atom2_id": "///E/59/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 479, "atom1_serNum": 3658, "atom2_serNum": 4554, "donAcc_type": "questionable", "distance": 2.459, "atom1_id": "///E/16/O4", "atom2_id": "///E/59/O2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 480, "atom1_serNum": 3669, "atom2_serNum": 4575, "donAcc_type": "questionable", "distance": 3.061, "atom1_id": "///E/18/O3'", "atom2_id": "///E/60/N3", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 481, "atom1_serNum": 3671, "atom2_serNum": 3690, "donAcc_type": "acceptable", "distance": 3.128, "atom1_id": "///E/18/O2'", "atom2_id": "///E/19/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 482, "atom1_serNum": 3671, "atom2_serNum": 4515, "donAcc_type": "acceptable", "distance": 2.837, "atom1_id": "///E/18/O2'", "atom2_id": "///E/57/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 483, "atom1_serNum": 3678, "atom2_serNum": 4492, "donAcc_type": "standard", "distance": 3.293, "atom1_id": "///E/18/O6", "atom2_id": "///E/56/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 484, "atom1_serNum": 3682, "atom2_serNum": 4536, "donAcc_type": "questionable", "distance": 2.942, "atom1_id": "///E/18/N3", "atom2_id": "///E/58/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 485, "atom1_serNum": 3704, "atom2_serNum": 4490, "donAcc_type": "standard", "distance": 2.742, "atom1_id": "///E/19/N2", "atom2_id": "///E/56/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 486, "atom1_serNum": 3704, "atom2_serNum": 4509, "donAcc_type": "standard", "distance": 3.044, "atom1_id": "///E/19/N2", "atom2_id": "///E/57/N7", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 487, "atom1_serNum": 3741, "atom2_serNum": 4304, "donAcc_type": "questionable", "distance": 2.640, "atom1_id": "///E/21/N7", "atom2_id": "///E/47/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 488, "atom1_serNum": 3744, "atom2_serNum": 4300, "donAcc_type": "acceptable", "distance": 3.241, "atom1_id": "///E/21/N6", "atom2_id": "///E/47/O2'", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 489, "atom1_serNum": 3763, "atom2_serNum": 4285, "donAcc_type": "standard", "distance": 2.955, "atom1_id": "///E/22/N7", "atom2_id": "///E/46/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 490, "atom1_serNum": 3763, "atom2_serNum": 4287, "donAcc_type": "standard", "distance": 2.588, "atom1_id": "///E/22/N7", "atom2_id": "///E/46/N2", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 491, "atom1_serNum": 3766, "atom2_serNum": 4287, "donAcc_type": "standard", "distance": 3.159, "atom1_id": "///E/22/O6", "atom2_id": "///E/46/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 492, "atom1_serNum": 3782, "atom2_serNum": 3798, "donAcc_type": "acceptable", "distance": 3.181, "atom1_id": "///E/23/O2'", "atom2_id": "///E/24/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 493, "atom1_serNum": 3852, "atom2_serNum": 4241, "donAcc_type": "standard", "distance": 3.011, "atom1_id": "///E/26/N6", "atom2_id": "///E/44/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 494, "atom1_serNum": 3875, "atom2_serNum": 4219, "donAcc_type": "questionable", "distance": 3.314, "atom1_id": "///E/27/N1", "atom2_id": "///E/43/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 495, "atom1_serNum": 3877, "atom2_serNum": 4218, "donAcc_type": "standard", "distance": 2.750, "atom1_id": "///E/27/N2", "atom2_id": "///E/43/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 496, "atom1_serNum": 3894, "atom2_serNum": 4201, "donAcc_type": "standard", "distance": 3.024, "atom1_id": "///E/28/O2", "atom2_id": "///E/42/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 497, "atom1_serNum": 3894, "atom2_serNum": 4218, "donAcc_type": "questionable", "distance": 3.052, "atom1_id": "///E/28/O2", "atom2_id": "///E/43/O2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 498, "atom1_serNum": 3895, "atom2_serNum": 4199, "donAcc_type": "standard", "distance": 2.902, "atom1_id": "///E/28/N3", "atom2_id": "///E/42/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 499, "atom1_serNum": 3897, "atom2_serNum": 4198, "donAcc_type": "standard", "distance": 3.007, "atom1_id": "///E/28/N4", "atom2_id": "///E/42/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 500, "atom1_serNum": 3910, "atom2_serNum": 3928, "donAcc_type": "acceptable", "distance": 3.219, "atom1_id": "///E/29/O2'", "atom2_id": "///E/30/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 501, "atom1_serNum": 3917, "atom2_serNum": 4178, "donAcc_type": "standard", "distance": 3.305, "atom1_id": "///E/29/N6", "atom2_id": "///E/41/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 502, "atom1_serNum": 3918, "atom2_serNum": 4176, "donAcc_type": "standard", "distance": 2.798, "atom1_id": "///E/29/N1", "atom2_id": "///E/41/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 503, "atom1_serNum": 3939, "atom2_serNum": 4158, "donAcc_type": "standard", "distance": 3.108, "atom1_id": "///E/30/O6", "atom2_id": "///E/40/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 504, "atom1_serNum": 3940, "atom2_serNum": 4156, "donAcc_type": "standard", "distance": 3.000, "atom1_id": "///E/30/N1", "atom2_id": "///E/40/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 505, "atom1_serNum": 3942, "atom2_serNum": 4155, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///E/30/N2", "atom2_id": "///E/40/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 506, "atom1_serNum": 3962, "atom2_serNum": 4138, "donAcc_type": "standard", "distance": 3.161, "atom1_id": "///E/31/N6", "atom2_id": "///E/39/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 507, "atom1_serNum": 3963, "atom2_serNum": 4136, "donAcc_type": "standard", "distance": 2.761, "atom1_id": "///E/31/N1", "atom2_id": "///E/39/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 508, "atom1_serNum": 3977, "atom2_serNum": 4068, "donAcc_type": "acceptable", "distance": 2.538, "atom1_id": "///E/32/O2'", "atom2_id": "///E/36/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 509, "atom1_serNum": 3981, "atom2_serNum": 4116, "donAcc_type": "standard", "distance": 2.813, "atom1_id": "///E/32/O2", "atom2_id": "///E/38/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 510, "atom1_serNum": 3988, "atom2_serNum": 4067, "donAcc_type": "standard", "distance": 2.684, "atom1_id": "///E/33/OP1", "atom2_id": "///E/36/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 511, "atom1_serNum": 4017, "atom2_serNum": 4033, "donAcc_type": "acceptable", "distance": 2.876, "atom1_id": "///E/34/O2'", "atom2_id": "///E/35/O5'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 512, "atom1_serNum": 4032, "atom2_serNum": 4064, "donAcc_type": "questionable", "distance": 2.923, "atom1_id": "///E/35/OP2", "atom2_id": "///E/36/N7", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 513, "atom1_serNum": 4032, "atom2_serNum": 4067, "donAcc_type": "standard", "distance": 3.012, "atom1_id": "///E/35/OP2", "atom2_id": "///E/36/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 514, "atom1_serNum": 4060, "atom2_serNum": 4070, "donAcc_type": "acceptable", "distance": 3.212, "atom1_id": "///E/36/O2'", "atom2_id": "///E/36/N3", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 515, "atom1_serNum": 4082, "atom2_serNum": 4100, "donAcc_type": "acceptable", "distance": 2.922, "atom1_id": "///E/37/O2'", "atom2_id": "///E/38/OP1", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 516, "atom1_serNum": 4151, "atom2_serNum": 4167, "donAcc_type": "acceptable", "distance": 3.217, "atom1_id": "///E/40/O2'", "atom2_id": "///E/41/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 517, "atom1_serNum": 4171, "atom2_serNum": 4187, "donAcc_type": "acceptable", "distance": 2.965, "atom1_id": "///E/41/O2'", "atom2_id": "///E/42/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 518, "atom1_serNum": 4214, "atom2_serNum": 4230, "donAcc_type": "acceptable", "distance": 2.928, "atom1_id": "///E/43/O2'", "atom2_id": "///E/44/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 519, "atom1_serNum": 4226, "atom2_serNum": 4264, "donAcc_type": "standard", "distance": 3.731, "atom1_id": "///E/44/OP2", "atom2_id": "///E/45/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 520, "atom1_serNum": 4277, "atom2_serNum": 4291, "donAcc_type": "acceptable", "distance": 2.840, "atom1_id": "///E/46/O2'", "atom2_id": "///E/47/OP1", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 521, "atom1_serNum": 4300, "atom2_serNum": 4313, "donAcc_type": "acceptable", "distance": 2.693, "atom1_id": "///E/47/O2'", "atom2_id": "///E/48/O5'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 522, "atom1_serNum": 4300, "atom2_serNum": 4316, "donAcc_type": "acceptable", "distance": 3.109, "atom1_id": "///E/47/O2'", "atom2_id": "///E/48/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 523, "atom1_serNum": 4320, "atom2_serNum": 4332, "donAcc_type": "acceptable", "distance": 3.106, "atom1_id": "///E/48/O2'", "atom2_id": "///E/49/OP2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 524, "atom1_serNum": 4344, "atom2_serNum": 4685, "donAcc_type": "standard", "distance": 2.916, "atom1_id": "///E/49/O2", "atom2_id": "///E/65/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 525, "atom1_serNum": 4345, "atom2_serNum": 4683, "donAcc_type": "standard", "distance": 3.001, "atom1_id": "///E/49/N3", "atom2_id": "///E/65/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 526, "atom1_serNum": 4347, "atom2_serNum": 4682, "donAcc_type": "standard", "distance": 3.018, "atom1_id": "///E/49/N4", "atom2_id": "///E/65/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 527, "atom1_serNum": 4365, "atom2_serNum": 4661, "donAcc_type": "standard", "distance": 2.859, "atom1_id": "///E/50/N3", "atom2_id": "///E/64/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 528, "atom1_serNum": 4367, "atom2_serNum": 4660, "donAcc_type": "standard", "distance": 3.088, "atom1_id": "///E/50/O4", "atom2_id": "///E/64/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 529, "atom1_serNum": 4380, "atom2_serNum": 4396, "donAcc_type": "acceptable", "distance": 3.291, "atom1_id": "///E/51/O2'", "atom2_id": "///E/52/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 530, "atom1_serNum": 4384, "atom2_serNum": 4640, "donAcc_type": "standard", "distance": 2.698, "atom1_id": "///E/51/O2", "atom2_id": "///E/63/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 531, "atom1_serNum": 4385, "atom2_serNum": 4638, "donAcc_type": "questionable", "distance": 2.992, "atom1_id": "///E/51/N3", "atom2_id": "///E/63/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 532, "atom1_serNum": 4387, "atom2_serNum": 4637, "donAcc_type": "questionable", "distance": 3.091, "atom1_id": "///E/51/O4", "atom2_id": "///E/63/O6", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 533, "atom1_serNum": 4407, "atom2_serNum": 4617, "donAcc_type": "standard", "distance": 3.004, "atom1_id": "///E/52/N6", "atom2_id": "///E/62/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 534, "atom1_serNum": 4408, "atom2_serNum": 4615, "donAcc_type": "standard", "distance": 2.990, "atom1_id": "///E/52/N1", "atom2_id": "///E/62/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 535, "atom1_serNum": 4429, "atom2_serNum": 4597, "donAcc_type": "standard", "distance": 3.015, "atom1_id": "///E/53/O6", "atom2_id": "///E/61/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 536, "atom1_serNum": 4430, "atom2_serNum": 4595, "donAcc_type": "standard", "distance": 3.030, "atom1_id": "///E/53/N1", "atom2_id": "///E/61/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 537, "atom1_serNum": 4432, "atom2_serNum": 4594, "donAcc_type": "standard", "distance": 2.943, "atom1_id": "///E/53/N2", "atom2_id": "///E/61/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 538, "atom1_serNum": 4449, "atom2_serNum": 4535, "donAcc_type": "standard", "distance": 3.016, "atom1_id": "///E/54/O2", "atom2_id": "///E/58/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 539, "atom1_serNum": 4450, "atom2_serNum": 4532, "donAcc_type": "standard", "distance": 3.514, "atom1_id": "///E/54/N3", "atom2_id": "///E/58/N7", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 540, "atom1_serNum": 4470, "atom2_serNum": 4520, "donAcc_type": "standard", "distance": 2.609, "atom1_id": "///E/55/N3", "atom2_id": "///E/58/OP2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 541, "atom1_serNum": 4528, "atom2_serNum": 4541, "donAcc_type": "acceptable", "distance": 2.521, "atom1_id": "///E/58/O2'", "atom2_id": "///E/59/OP1", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 542, "atom1_serNum": 4528, "atom2_serNum": 4543, "donAcc_type": "acceptable", "distance": 2.465, "atom1_id": "///E/58/O2'", "atom2_id": "///E/59/O5'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 543, "atom1_serNum": 4562, "atom2_serNum": 4597, "donAcc_type": "standard", "distance": 3.007, "atom1_id": "///E/60/OP2", "atom2_id": "///E/61/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 544, "atom1_serNum": 4610, "atom2_serNum": 4626, "donAcc_type": "acceptable", "distance": 3.071, "atom1_id": "///E/62/O2'", "atom2_id": "///E/63/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 545, "atom1_serNum": 4823, "atom2_serNum": 4825, "donAcc_type": "acceptable", "distance": 2.650, "atom1_id": "///B/13/O", "atom2_id": "///B/13/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 546, "atom1_serNum": 4823, "atom2_serNum": 4835, "donAcc_type": "standard", "distance": 2.610, "atom1_id": "///B/13/O", "atom2_id": "///B/15/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 547, "atom1_serNum": 4825, "atom2_serNum": 4843, "donAcc_type": "acceptable", "distance": 2.564, "atom1_id": "///B/13/OG", "atom2_id": "///B/15/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 548, "atom1_serNum": 4829, "atom2_serNum": 6354, "donAcc_type": "standard", "distance": 2.868, "atom1_id": "///B/14/O", "atom2_id": "///B/200/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 549, "atom1_serNum": 4838, "atom2_serNum": 5525, "donAcc_type": "standard", "distance": 3.525, "atom1_id": "///B/15/O", "atom2_id": "///B/100/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 550, "atom1_serNum": 4843, "atom2_serNum": 7474, "donAcc_type": "standard", "distance": 3.415, "atom1_id": "///B/15/NZ", "atom2_id": "///B/339/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 551, "atom1_serNum": 4843, "atom2_serNum": 7491, "donAcc_type": "standard", "distance": 2.698, "atom1_id": "///B/15/NZ", "atom2_id": "///B/341/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 552, "atom1_serNum": 4844, "atom2_serNum": 6357, "donAcc_type": "standard", "distance": 2.803, "atom1_id": "///B/16/N", "atom2_id": "///B/200/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 553, "atom1_serNum": 4847, "atom2_serNum": 6369, "donAcc_type": "standard", "distance": 3.036, "atom1_id": "///B/16/O", "atom2_id": "///B/202/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 554, "atom1_serNum": 4851, "atom2_serNum": 5572, "donAcc_type": "standard", "distance": 3.100, "atom1_id": "///B/17/N", "atom2_id": "///B/106/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 555, "atom1_serNum": 4854, "atom2_serNum": 5584, "donAcc_type": "standard", "distance": 2.920, "atom1_id": "///B/17/O", "atom2_id": "///B/108/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 556, "atom1_serNum": 4859, "atom2_serNum": 6372, "donAcc_type": "standard", "distance": 3.036, "atom1_id": "///B/18/N", "atom2_id": "///B/202/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 557, "atom1_serNum": 4862, "atom2_serNum": 6388, "donAcc_type": "standard", "distance": 2.856, "atom1_id": "///B/18/O", "atom2_id": "///B/204/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 558, "atom1_serNum": 4866, "atom2_serNum": 5587, "donAcc_type": "standard", "distance": 2.878, "atom1_id": "///B/19/N", "atom2_id": "///B/108/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 559, "atom1_serNum": 4869, "atom2_serNum": 5598, "donAcc_type": "standard", "distance": 3.696, "atom1_id": "///B/19/O", "atom2_id": "///B/110/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 560, "atom1_serNum": 4874, "atom2_serNum": 6391, "donAcc_type": "standard", "distance": 2.849, "atom1_id": "///B/20/N", "atom2_id": "///B/204/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 561, "atom1_serNum": 4877, "atom2_serNum": 6410, "donAcc_type": "standard", "distance": 2.920, "atom1_id": "///B/20/O", "atom2_id": "///B/206/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 562, "atom1_serNum": 4879, "atom2_serNum": 5622, "donAcc_type": "questionable", "distance": 3.097, "atom1_id": "///B/21/N", "atom2_id": "///B/113/NE2", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 563, "atom1_serNum": 4886, "atom2_serNum": 4901, "donAcc_type": "standard", "distance": 3.955, "atom1_id": "///B/22/O", "atom2_id": "///B/25/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 564, "atom1_serNum": 4890, "atom2_serNum": 7131, "donAcc_type": "standard", "distance": 3.798, "atom1_id": "///B/23/N", "atom2_id": "///B/296/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 565, "atom1_serNum": 4893, "atom2_serNum": 4895, "donAcc_type": "acceptable", "distance": 2.530, "atom1_id": "///B/23/O", "atom2_id": "///B/23/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 566, "atom1_serNum": 4897, "atom2_serNum": 9651, "donAcc_type": "standard", "distance": 3.410, "atom1_id": "///B/24/N", "atom2_id": "///B/422/O3A", "atom_pair": "N:O", "residue_pair": "aa:ligand" }, { "index": 567, "atom1_serNum": 4900, "atom2_serNum": 6505, "donAcc_type": "standard", "distance": 2.584, "atom1_id": "///B/24/O", "atom2_id": "///B/216/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 568, "atom1_serNum": 4908, "atom2_serNum": 9651, "donAcc_type": "standard", "distance": 3.357, "atom1_id": "///B/26/N", "atom2_id": "///B/422/O3A", "atom_pair": "N:O", "residue_pair": "aa:ligand" }, { "index": 569, "atom1_serNum": 4911, "atom2_serNum": 4927, "donAcc_type": "standard", "distance": 2.777, "atom1_id": "///B/26/O", "atom2_id": "///B/29/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 570, "atom1_serNum": 4911, "atom2_serNum": 4936, "donAcc_type": "standard", "distance": 2.717, "atom1_id": "///B/26/O", "atom2_id": "///B/30/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 571, "atom1_serNum": 4915, "atom2_serNum": 4936, "donAcc_type": "standard", "distance": 2.931, "atom1_id": "///B/27/O", "atom2_id": "///B/30/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 572, "atom1_serNum": 4915, "atom2_serNum": 4944, "donAcc_type": "standard", "distance": 2.820, "atom1_id": "///B/27/O", "atom2_id": "///B/31/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 573, "atom1_serNum": 4915, "atom2_serNum": 4949, "donAcc_type": "acceptable", "distance": 3.173, "atom1_id": "///B/27/O", "atom2_id": "///B/31/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 574, "atom1_serNum": 4920, "atom2_serNum": 9653, "donAcc_type": "acceptable", "distance": 2.738, "atom1_id": "///B/27/NZ", "atom2_id": "///B/422/O1B", "atom_pair": "N:O", "residue_pair": "aa:ligand" }, { "index": 575, "atom1_serNum": 4921, "atom2_serNum": 9655, "donAcc_type": "acceptable", "distance": 3.111, "atom1_id": "///B/28/N", "atom2_id": "///B/422/O3B", "atom_pair": "N:O", "residue_pair": "aa:ligand" }, { "index": 576, "atom1_serNum": 4930, "atom2_serNum": 4958, "donAcc_type": "standard", "distance": 3.754, "atom1_id": "///B/29/O", "atom2_id": "///B/33/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 577, "atom1_serNum": 4934, "atom2_serNum": 4966, "donAcc_type": "standard", "distance": 3.043, "atom1_id": "///B/29/OE1", "atom2_id": "///B/33/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 578, "atom1_serNum": 4939, "atom2_serNum": 4958, "donAcc_type": "standard", "distance": 2.909, "atom1_id": "///B/30/O", "atom2_id": "///B/33/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 579, "atom1_serNum": 4939, "atom2_serNum": 4967, "donAcc_type": "standard", "distance": 2.887, "atom1_id": "///B/30/O", "atom2_id": "///B/34/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 580, "atom1_serNum": 4953, "atom2_serNum": 4975, "donAcc_type": "standard", "distance": 3.109, "atom1_id": "///B/32/O", "atom2_id": "///B/35/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 581, "atom1_serNum": 4953, "atom2_serNum": 4988, "donAcc_type": "standard", "distance": 2.810, "atom1_id": "///B/32/O", "atom2_id": "///B/36/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 582, "atom1_serNum": 4961, "atom2_serNum": 4988, "donAcc_type": "standard", "distance": 2.687, "atom1_id": "///B/33/O", "atom2_id": "///B/36/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 583, "atom1_serNum": 4961, "atom2_serNum": 4989, "donAcc_type": "standard", "distance": 3.270, "atom1_id": "///B/33/O", "atom2_id": "///B/37/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 584, "atom1_serNum": 4965, "atom2_serNum": 7391, "donAcc_type": "acceptable", "distance": 3.205, "atom1_id": "///B/33/OE1", "atom2_id": "///B/328/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 585, "atom1_serNum": 4978, "atom2_serNum": 5009, "donAcc_type": "standard", "distance": 2.739, "atom1_id": "///B/35/O", "atom2_id": "///B/39/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 586, "atom1_serNum": 4978, "atom2_serNum": 5017, "donAcc_type": "standard", "distance": 2.823, "atom1_id": "///B/35/O", "atom2_id": "///B/40/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 587, "atom1_serNum": 4983, "atom2_serNum": 5009, "donAcc_type": "standard", "distance": 3.205, "atom1_id": "///B/36/O", "atom2_id": "///B/39/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 588, "atom1_serNum": 5012, "atom2_serNum": 5561, "donAcc_type": "standard", "distance": 2.971, "atom1_id": "///B/39/O", "atom2_id": "///B/105/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 589, "atom1_serNum": 5016, "atom2_serNum": 5551, "donAcc_type": "standard", "distance": 2.923, "atom1_id": "///B/39/ND2", "atom2_id": "///B/103/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 590, "atom1_serNum": 5021, "atom2_serNum": 5564, "donAcc_type": "standard", "distance": 3.280, "atom1_id": "///B/41/N", "atom2_id": "///B/105/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 591, "atom1_serNum": 5024, "atom2_serNum": 5576, "donAcc_type": "standard", "distance": 2.941, "atom1_id": "///B/41/O", "atom2_id": "///B/107/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 592, "atom1_serNum": 5028, "atom2_serNum": 5282, "donAcc_type": "standard", "distance": 3.635, "atom1_id": "///B/41/OE1", "atom2_id": "///B/72/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 593, "atom1_serNum": 5028, "atom2_serNum": 5546, "donAcc_type": "standard", "distance": 3.134, "atom1_id": "///B/41/OE1", "atom2_id": "///B/102/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 594, "atom1_serNum": 5028, "atom2_serNum": 5547, "donAcc_type": "standard", "distance": 2.765, "atom1_id": "///B/41/OE1", "atom2_id": "///B/102/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 595, "atom1_serNum": 5029, "atom2_serNum": 5560, "donAcc_type": "standard", "distance": 3.193, "atom1_id": "///B/41/OE2", "atom2_id": "///B/104/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 596, "atom1_serNum": 5033, "atom2_serNum": 5273, "donAcc_type": "standard", "distance": 3.009, "atom1_id": "///B/42/O", "atom2_id": "///B/72/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 597, "atom1_serNum": 5037, "atom2_serNum": 5579, "donAcc_type": "standard", "distance": 3.006, "atom1_id": "///B/43/N", "atom2_id": "///B/107/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 598, "atom1_serNum": 5040, "atom2_serNum": 5591, "donAcc_type": "standard", "distance": 3.077, "atom1_id": "///B/43/O", "atom2_id": "///B/109/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 599, "atom1_serNum": 5045, "atom2_serNum": 5276, "donAcc_type": "standard", "distance": 2.948, "atom1_id": "///B/44/N", "atom2_id": "///B/72/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 600, "atom1_serNum": 5051, "atom2_serNum": 5059, "donAcc_type": "standard", "distance": 2.549, "atom1_id": "///B/44/OD1", "atom2_id": "///B/46/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 601, "atom1_serNum": 5053, "atom2_serNum": 5594, "donAcc_type": "standard", "distance": 2.780, "atom1_id": "///B/45/N", "atom2_id": "///B/109/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 602, "atom1_serNum": 5056, "atom2_serNum": 5058, "donAcc_type": "acceptable", "distance": 2.482, "atom1_id": "///B/45/O", "atom2_id": "///B/45/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 603, "atom1_serNum": 5056, "atom2_serNum": 5602, "donAcc_type": "standard", "distance": 3.061, "atom1_id": "///B/45/O", "atom2_id": "///B/111/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 604, "atom1_serNum": 5056, "atom2_serNum": 5606, "donAcc_type": "standard", "distance": 3.065, "atom1_id": "///B/45/O", "atom2_id": "///B/112/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 605, "atom1_serNum": 5062, "atom2_serNum": 5073, "donAcc_type": "standard", "distance": 2.524, "atom1_id": "///B/46/O", "atom2_id": "///B/48/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 606, "atom1_serNum": 5062, "atom2_serNum": 5090, "donAcc_type": "standard", "distance": 3.842, "atom1_id": "///B/46/O", "atom2_id": "///B/50/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 607, "atom1_serNum": 5065, "atom2_serNum": 5081, "donAcc_type": "standard", "distance": 3.274, "atom1_id": "///B/46/OD1", "atom2_id": "///B/49/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 608, "atom1_serNum": 5065, "atom2_serNum": 8908, "donAcc_type": "standard", "distance": 3.219, "atom1_id": "///B/46/OD1", "atom2_id": "///F/37/N6", "atom_pair": "O:N", "residue_pair": "aa:nt" }, { "index": 609, "atom1_serNum": 5066, "atom2_serNum": 8908, "donAcc_type": "standard", "distance": 2.881, "atom1_id": "///B/46/OD2", "atom2_id": "///F/37/N6", "atom_pair": "O:N", "residue_pair": "aa:nt" }, { "index": 610, "atom1_serNum": 5067, "atom2_serNum": 5611, "donAcc_type": "acceptable", "distance": 3.423, "atom1_id": "///B/47/N", "atom2_id": "///B/112/OG1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 611, "atom1_serNum": 5070, "atom2_serNum": 5072, "donAcc_type": "acceptable", "distance": 2.635, "atom1_id": "///B/47/O", "atom2_id": "///B/47/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 612, "atom1_serNum": 5072, "atom2_serNum": 8870, "donAcc_type": "acceptable", "distance": 3.653, "atom1_id": "///B/47/OG", "atom2_id": "///F/36/OP1", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 613, "atom1_serNum": 5076, "atom2_serNum": 5097, "donAcc_type": "standard", "distance": 2.791, "atom1_id": "///B/48/O", "atom2_id": "///B/51/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 614, "atom1_serNum": 5084, "atom2_serNum": 5180, "donAcc_type": "standard", "distance": 3.581, "atom1_id": "///B/49/O", "atom2_id": "///B/60/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 615, "atom1_serNum": 5084, "atom2_serNum": 5298, "donAcc_type": "standard", "distance": 2.789, "atom1_id": "///B/49/O", "atom2_id": "///B/75/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 616, "atom1_serNum": 5088, "atom2_serNum": 5167, "donAcc_type": "questionable", "distance": 3.178, "atom1_id": "///B/49/OE1", "atom2_id": "///B/59/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 617, "atom1_serNum": 5093, "atom2_serNum": 5306, "donAcc_type": "standard", "distance": 2.739, "atom1_id": "///B/50/O", "atom2_id": "///B/76/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 618, "atom1_serNum": 5093, "atom2_serNum": 5316, "donAcc_type": "standard", "distance": 2.629, "atom1_id": "///B/50/O", "atom2_id": "///B/77/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 619, "atom1_serNum": 5100, "atom2_serNum": 5121, "donAcc_type": "questionable", "distance": 3.207, "atom1_id": "///B/51/O", "atom2_id": "///B/53/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 620, "atom1_serNum": 5108, "atom2_serNum": 5369, "donAcc_type": "acceptable", "distance": 3.569, "atom1_id": "///B/51/OH", "atom2_id": "///B/83/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 621, "atom1_serNum": 5109, "atom2_serNum": 5319, "donAcc_type": "standard", "distance": 2.797, "atom1_id": "///B/52/N", "atom2_id": "///B/77/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 622, "atom1_serNum": 5117, "atom2_serNum": 5329, "donAcc_type": "standard", "distance": 2.975, "atom1_id": "///B/52/NZ", "atom2_id": "///B/78/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 623, "atom1_serNum": 5118, "atom2_serNum": 5304, "donAcc_type": "standard", "distance": 2.974, "atom1_id": "///B/53/N", "atom2_id": "///B/75/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 624, "atom1_serNum": 5121, "atom2_serNum": 5180, "donAcc_type": "standard", "distance": 3.363, "atom1_id": "///B/53/O", "atom2_id": "///B/60/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 625, "atom1_serNum": 5137, "atom2_serNum": 5149, "donAcc_type": "standard", "distance": 2.463, "atom1_id": "///B/55/O", "atom2_id": "///B/57/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 626, "atom1_serNum": 5137, "atom2_serNum": 5157, "donAcc_type": "standard", "distance": 3.297, "atom1_id": "///B/55/O", "atom2_id": "///B/58/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 627, "atom1_serNum": 5144, "atom2_serNum": 5164, "donAcc_type": "standard", "distance": 3.022, "atom1_id": "///B/56/O", "atom2_id": "///B/59/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 628, "atom1_serNum": 5170, "atom2_serNum": 9649, "donAcc_type": "acceptable", "distance": 3.044, "atom1_id": "///B/59/OD1", "atom2_id": "///B/422/O1A", "atom_pair": "O:O", "residue_pair": "aa:ligand" }, { "index": 629, "atom1_serNum": 5170, "atom2_serNum": 9654, "donAcc_type": "acceptable", "distance": 2.878, "atom1_id": "///B/59/OD1", "atom2_id": "///B/422/O2B", "atom_pair": "O:O", "residue_pair": "aa:ligand" }, { "index": 630, "atom1_serNum": 5181, "atom2_serNum": 5187, "donAcc_type": "acceptable", "distance": 2.703, "atom1_id": "///B/61/N", "atom2_id": "///B/61/ND1", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 631, "atom1_serNum": 5194, "atom2_serNum": 5224, "donAcc_type": "standard", "distance": 3.953, "atom1_id": "///B/62/O", "atom2_id": "///B/66/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 632, "atom1_serNum": 5201, "atom2_serNum": 5215, "donAcc_type": "standard", "distance": 2.594, "atom1_id": "///B/63/O", "atom2_id": "///B/65/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 633, "atom1_serNum": 5201, "atom2_serNum": 5224, "donAcc_type": "standard", "distance": 2.979, "atom1_id": "///B/63/O", "atom2_id": "///B/66/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 634, "atom1_serNum": 5227, "atom2_serNum": 5248, "donAcc_type": "standard", "distance": 2.659, "atom1_id": "///B/66/O", "atom2_id": "///B/69/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 635, "atom1_serNum": 5251, "atom2_serNum": 5263, "donAcc_type": "standard", "distance": 2.978, "atom1_id": "///B/69/O", "atom2_id": "///B/71/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 636, "atom1_serNum": 5251, "atom2_serNum": 5269, "donAcc_type": "acceptable", "distance": 2.524, "atom1_id": "///B/69/O", "atom2_id": "///B/71/ND1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 637, "atom1_serNum": 5263, "atom2_serNum": 5269, "donAcc_type": "acceptable", "distance": 3.061, "atom1_id": "///B/71/N", "atom2_id": "///B/71/ND1", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 638, "atom1_serNum": 5315, "atom2_serNum": 5455, "donAcc_type": "standard", "distance": 3.033, "atom1_id": "///B/76/NE2", "atom2_id": "///B/91/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 639, "atom1_serNum": 5323, "atom2_serNum": 5359, "donAcc_type": "standard", "distance": 2.760, "atom1_id": "///B/78/N", "atom2_id": "///B/81/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 640, "atom1_serNum": 5329, "atom2_serNum": 6702, "donAcc_type": "acceptable", "distance": 3.359, "atom1_id": "///B/78/OD1", "atom2_id": "///B/239/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 641, "atom1_serNum": 5330, "atom2_serNum": 5350, "donAcc_type": "acceptable", "distance": 2.588, "atom1_id": "///B/78/OD2", "atom2_id": "///B/80/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 642, "atom1_serNum": 5334, "atom2_serNum": 5351, "donAcc_type": "standard", "distance": 2.630, "atom1_id": "///B/79/O", "atom2_id": "///B/81/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 643, "atom1_serNum": 5348, "atom2_serNum": 5350, "donAcc_type": "acceptable", "distance": 2.706, "atom1_id": "///B/80/O", "atom2_id": "///B/80/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 644, "atom1_serNum": 5368, "atom2_serNum": 6789, "donAcc_type": "standard", "distance": 2.686, "atom1_id": "///B/82/OE2", "atom2_id": "///B/249/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 645, "atom1_serNum": 5372, "atom2_serNum": 8870, "donAcc_type": "questionable", "distance": 2.624, "atom1_id": "///B/83/O", "atom2_id": "///F/36/OP1", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 646, "atom1_serNum": 5384, "atom2_serNum": 5420, "donAcc_type": "standard", "distance": 3.534, "atom1_id": "///B/84/O", "atom2_id": "///B/88/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 647, "atom1_serNum": 5396, "atom2_serNum": 5431, "donAcc_type": "standard", "distance": 2.798, "atom1_id": "///B/85/O", "atom2_id": "///B/89/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 648, "atom1_serNum": 5402, "atom2_serNum": 5440, "donAcc_type": "standard", "distance": 2.999, "atom1_id": "///B/86/O", "atom2_id": "///B/90/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 649, "atom1_serNum": 5405, "atom2_serNum": 5438, "donAcc_type": "acceptable", "distance": 3.145, "atom1_id": "///B/86/ND1", "atom2_id": "///B/89/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 650, "atom1_serNum": 5412, "atom2_serNum": 5440, "donAcc_type": "standard", "distance": 3.195, "atom1_id": "///B/87/O", "atom2_id": "///B/90/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 651, "atom1_serNum": 5412, "atom2_serNum": 5447, "donAcc_type": "standard", "distance": 2.838, "atom1_id": "///B/87/O", "atom2_id": "///B/91/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 652, "atom1_serNum": 5419, "atom2_serNum": 5454, "donAcc_type": "standard", "distance": 2.949, "atom1_id": "///B/87/NH2", "atom2_id": "///B/91/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 653, "atom1_serNum": 5423, "atom2_serNum": 5456, "donAcc_type": "standard", "distance": 2.730, "atom1_id": "///B/88/O", "atom2_id": "///B/92/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 654, "atom1_serNum": 5434, "atom2_serNum": 5669, "donAcc_type": "acceptable", "distance": 3.977, "atom1_id": "///B/89/O", "atom2_id": "///B/118/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 655, "atom1_serNum": 5443, "atom2_serNum": 5470, "donAcc_type": "standard", "distance": 2.789, "atom1_id": "///B/90/O", "atom2_id": "///B/94/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 656, "atom1_serNum": 5443, "atom2_serNum": 5477, "donAcc_type": "standard", "distance": 3.206, "atom1_id": "///B/90/O", "atom2_id": "///B/94/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 657, "atom1_serNum": 5450, "atom2_serNum": 5478, "donAcc_type": "standard", "distance": 3.107, "atom1_id": "///B/91/O", "atom2_id": "///B/95/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 658, "atom1_serNum": 5459, "atom2_serNum": 5483, "donAcc_type": "standard", "distance": 3.008, "atom1_id": "///B/92/O", "atom2_id": "///B/96/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 659, "atom1_serNum": 5473, "atom2_serNum": 5491, "donAcc_type": "standard", "distance": 2.780, "atom1_id": "///B/94/O", "atom2_id": "///B/97/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 660, "atom1_serNum": 5473, "atom2_serNum": 5500, "donAcc_type": "standard", "distance": 3.321, "atom1_id": "///B/94/O", "atom2_id": "///B/98/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 661, "atom1_serNum": 5481, "atom2_serNum": 5508, "donAcc_type": "standard", "distance": 2.997, "atom1_id": "///B/95/O", "atom2_id": "///B/99/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 662, "atom1_serNum": 5486, "atom2_serNum": 5516, "donAcc_type": "standard", "distance": 2.911, "atom1_id": "///B/96/O", "atom2_id": "///B/100/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 663, "atom1_serNum": 5494, "atom2_serNum": 5516, "donAcc_type": "standard", "distance": 2.881, "atom1_id": "///B/97/O", "atom2_id": "///B/100/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 664, "atom1_serNum": 5494, "atom2_serNum": 5526, "donAcc_type": "standard", "distance": 2.897, "atom1_id": "///B/97/O", "atom2_id": "///B/101/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 665, "atom1_serNum": 5507, "atom2_serNum": 5546, "donAcc_type": "standard", "distance": 2.738, "atom1_id": "///B/98/OD2", "atom2_id": "///B/102/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 666, "atom1_serNum": 5511, "atom2_serNum": 5537, "donAcc_type": "standard", "distance": 3.551, "atom1_id": "///B/99/O", "atom2_id": "///B/102/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 667, "atom1_serNum": 5511, "atom2_serNum": 5552, "donAcc_type": "standard", "distance": 3.125, "atom1_id": "///B/99/O", "atom2_id": "///B/104/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 668, "atom1_serNum": 5579, "atom2_serNum": 5591, "donAcc_type": "standard", "distance": 3.344, "atom1_id": "///B/107/O", "atom2_id": "///B/109/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 669, "atom1_serNum": 5605, "atom2_serNum": 5613, "donAcc_type": "standard", "distance": 2.731, "atom1_id": "///B/111/O", "atom2_id": "///B/113/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 670, "atom1_serNum": 5605, "atom2_serNum": 7132, "donAcc_type": "standard", "distance": 3.379, "atom1_id": "///B/111/O", "atom2_id": "///B/296/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 671, "atom1_serNum": 5609, "atom2_serNum": 5635, "donAcc_type": "standard", "distance": 3.026, "atom1_id": "///B/112/O", "atom2_id": "///B/115/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 672, "atom1_serNum": 5611, "atom2_serNum": 8892, "donAcc_type": "acceptable", "distance": 3.160, "atom1_id": "///B/112/OG1", "atom2_id": "///F/37/OP1", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 673, "atom1_serNum": 5616, "atom2_serNum": 5647, "donAcc_type": "standard", "distance": 3.170, "atom1_id": "///B/113/O", "atom2_id": "///B/116/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 674, "atom1_serNum": 5626, "atom2_serNum": 5655, "donAcc_type": "standard", "distance": 3.054, "atom1_id": "///B/114/O", "atom2_id": "///B/117/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 675, "atom1_serNum": 5634, "atom2_serNum": 8850, "donAcc_type": "acceptable", "distance": 2.940, "atom1_id": "///B/114/OH", "atom2_id": "///F/35/OP1", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 676, "atom1_serNum": 5638, "atom2_serNum": 5664, "donAcc_type": "standard", "distance": 3.101, "atom1_id": "///B/115/O", "atom2_id": "///B/118/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 677, "atom1_serNum": 5646, "atom2_serNum": 8870, "donAcc_type": "acceptable", "distance": 3.037, "atom1_id": "///B/115/OH", "atom2_id": "///F/36/OP1", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 678, "atom1_serNum": 5646, "atom2_serNum": 8871, "donAcc_type": "acceptable", "distance": 2.625, "atom1_id": "///B/115/OH", "atom2_id": "///F/36/OP2", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 679, "atom1_serNum": 5650, "atom2_serNum": 5671, "donAcc_type": "standard", "distance": 3.122, "atom1_id": "///B/116/O", "atom2_id": "///B/119/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 680, "atom1_serNum": 5658, "atom2_serNum": 5682, "donAcc_type": "questionable", "distance": 2.527, "atom1_id": "///B/117/O", "atom2_id": "///B/120/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 681, "atom1_serNum": 5662, "atom2_serNum": 5706, "donAcc_type": "standard", "distance": 3.272, "atom1_id": "///B/117/OE1", "atom2_id": "///B/122/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 682, "atom1_serNum": 5663, "atom2_serNum": 8812, "donAcc_type": "standard", "distance": 3.480, "atom1_id": "///B/117/NE2", "atom2_id": "///F/33/O4'", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 683, "atom1_serNum": 5667, "atom2_serNum": 6342, "donAcc_type": "standard", "distance": 3.061, "atom1_id": "///B/118/O", "atom2_id": "///B/198/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 684, "atom1_serNum": 5674, "atom2_serNum": 6334, "donAcc_type": "standard", "distance": 3.353, "atom1_id": "///B/119/O", "atom2_id": "///B/198/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 685, "atom1_serNum": 5682, "atom2_serNum": 5698, "donAcc_type": "standard", "distance": 2.964, "atom1_id": "///B/120/O", "atom2_id": "///B/122/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 686, "atom1_serNum": 5690, "atom2_serNum": 6322, "donAcc_type": "standard", "distance": 3.140, "atom1_id": "///B/121/N", "atom2_id": "///B/196/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 687, "atom1_serNum": 5693, "atom2_serNum": 6301, "donAcc_type": "standard", "distance": 3.355, "atom1_id": "///B/121/O", "atom2_id": "///B/193/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 688, "atom1_serNum": 5706, "atom2_serNum": 7226, "donAcc_type": "standard", "distance": 2.902, "atom1_id": "///B/122/NZ", "atom2_id": "///B/307/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 689, "atom1_serNum": 5717, "atom2_serNum": 6342, "donAcc_type": "questionable", "distance": 3.126, "atom1_id": "///B/123/NH2", "atom2_id": "///B/198/NZ", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 690, "atom1_serNum": 5718, "atom2_serNum": 8828, "donAcc_type": "standard", "distance": 3.195, "atom1_id": "///B/124/N", "atom2_id": "///F/34/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 691, "atom1_serNum": 5721, "atom2_serNum": 6139, "donAcc_type": "standard", "distance": 3.744, "atom1_id": "///B/124/O", "atom2_id": "///B/174/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 692, "atom1_serNum": 5731, "atom2_serNum": 5733, "donAcc_type": "standard", "distance": 2.983, "atom1_id": "///B/125/OD1", "atom2_id": "///B/126/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 693, "atom1_serNum": 5731, "atom2_serNum": 5740, "donAcc_type": "standard", "distance": 3.561, "atom1_id": "///B/125/OD1", "atom2_id": "///B/127/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 694, "atom1_serNum": 5738, "atom2_serNum": 6139, "donAcc_type": "acceptable", "distance": 3.909, "atom1_id": "///B/126/OG1", "atom2_id": "///B/174/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 695, "atom1_serNum": 5760, "atom2_serNum": 5770, "donAcc_type": "acceptable", "distance": 3.636, "atom1_id": "///B/129/OG", "atom2_id": "///B/131/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 696, "atom1_serNum": 5760, "atom2_serNum": 6201, "donAcc_type": "acceptable", "distance": 2.892, "atom1_id": "///B/129/OG", "atom2_id": "///B/181/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 697, "atom1_serNum": 5764, "atom2_serNum": 5781, "donAcc_type": "standard", "distance": 2.771, "atom1_id": "///B/130/O", "atom2_id": "///B/132/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 698, "atom1_serNum": 5773, "atom2_serNum": 5790, "donAcc_type": "standard", "distance": 2.612, "atom1_id": "///B/131/O", "atom2_id": "///B/133/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 699, "atom1_serNum": 5784, "atom2_serNum": 5798, "donAcc_type": "standard", "distance": 2.528, "atom1_id": "///B/132/O", "atom2_id": "///B/134/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 700, "atom1_serNum": 5801, "atom2_serNum": 5834, "donAcc_type": "standard", "distance": 3.077, "atom1_id": "///B/134/O", "atom2_id": "///B/138/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 701, "atom1_serNum": 5808, "atom2_serNum": 5842, "donAcc_type": "standard", "distance": 2.884, "atom1_id": "///B/135/O", "atom2_id": "///B/139/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 702, "atom1_serNum": 5828, "atom2_serNum": 5858, "donAcc_type": "standard", "distance": 2.963, "atom1_id": "///B/137/O", "atom2_id": "///B/141/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 703, "atom1_serNum": 5837, "atom2_serNum": 5858, "donAcc_type": "standard", "distance": 2.742, "atom1_id": "///B/138/O", "atom2_id": "///B/141/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 704, "atom1_serNum": 5837, "atom2_serNum": 5866, "donAcc_type": "standard", "distance": 2.602, "atom1_id": "///B/138/O", "atom2_id": "///B/142/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 705, "atom1_serNum": 5878, "atom2_serNum": 6091, "donAcc_type": "acceptable", "distance": 2.668, "atom1_id": "///B/143/O", "atom2_id": "///B/169/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 706, "atom1_serNum": 5880, "atom2_serNum": 5888, "donAcc_type": "acceptable", "distance": 3.573, "atom1_id": "///B/143/OG", "atom2_id": "///B/145/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 707, "atom1_serNum": 5891, "atom2_serNum": 5918, "donAcc_type": "standard", "distance": 3.730, "atom1_id": "///B/145/O", "atom2_id": "///B/149/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 708, "atom1_serNum": 5895, "atom2_serNum": 5909, "donAcc_type": "questionable", "distance": 2.609, "atom1_id": "///B/145/OD2", "atom2_id": "///B/147/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 709, "atom1_serNum": 5906, "atom2_serNum": 5938, "donAcc_type": "standard", "distance": 2.970, "atom1_id": "///B/147/O", "atom2_id": "///B/151/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 710, "atom1_serNum": 5909, "atom2_serNum": 7838, "donAcc_type": "standard", "distance": 3.776, "atom1_id": "///B/147/OD1", "atom2_id": "///B/384/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 711, "atom1_serNum": 5914, "atom2_serNum": 5951, "donAcc_type": "acceptable", "distance": 2.630, "atom1_id": "///B/148/O", "atom2_id": "///B/152/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 712, "atom1_serNum": 5929, "atom2_serNum": 5953, "donAcc_type": "standard", "distance": 2.712, "atom1_id": "///B/150/O", "atom2_id": "///B/153/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 713, "atom1_serNum": 5929, "atom2_serNum": 5961, "donAcc_type": "standard", "distance": 2.852, "atom1_id": "///B/150/O", "atom2_id": "///B/154/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 714, "atom1_serNum": 5937, "atom2_serNum": 6017, "donAcc_type": "acceptable", "distance": 2.980, "atom1_id": "///B/150/OH", "atom2_id": "///B/161/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 715, "atom1_serNum": 5941, "atom2_serNum": 5968, "donAcc_type": "standard", "distance": 3.229, "atom1_id": "///B/151/O", "atom2_id": "///B/155/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 716, "atom1_serNum": 5949, "atom2_serNum": 5977, "donAcc_type": "standard", "distance": 3.432, "atom1_id": "///B/152/O", "atom2_id": "///B/156/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 717, "atom1_serNum": 5971, "atom2_serNum": 5983, "donAcc_type": "standard", "distance": 3.064, "atom1_id": "///B/155/O", "atom2_id": "///B/157/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 718, "atom1_serNum": 5986, "atom2_serNum": 6014, "donAcc_type": "standard", "distance": 3.504, "atom1_id": "///B/157/O", "atom2_id": "///B/161/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 719, "atom1_serNum": 5989, "atom2_serNum": 6243, "donAcc_type": "standard", "distance": 2.965, "atom1_id": "///B/157/OD1", "atom2_id": "///B/187/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 720, "atom1_serNum": 5990, "atom2_serNum": 5998, "donAcc_type": "standard", "distance": 3.244, "atom1_id": "///B/157/OD2", "atom2_id": "///B/159/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 721, "atom1_serNum": 5990, "atom2_serNum": 6006, "donAcc_type": "standard", "distance": 3.179, "atom1_id": "///B/157/OD2", "atom2_id": "///B/160/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 722, "atom1_serNum": 6001, "atom2_serNum": 6019, "donAcc_type": "standard", "distance": 2.955, "atom1_id": "///B/159/O", "atom2_id": "///B/162/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 723, "atom1_serNum": 6005, "atom2_serNum": 6248, "donAcc_type": "acceptable", "distance": 3.652, "atom1_id": "///B/159/OD2", "atom2_id": "///B/187/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 724, "atom1_serNum": 6022, "atom2_serNum": 6024, "donAcc_type": "acceptable", "distance": 2.888, "atom1_id": "///B/162/O", "atom2_id": "///B/162/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 725, "atom1_serNum": 6024, "atom2_serNum": 7744, "donAcc_type": "acceptable", "distance": 3.018, "atom1_id": "///B/162/OG1", "atom2_id": "///B/372/ND1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 726, "atom1_serNum": 6034, "atom2_serNum": 8787, "donAcc_type": "standard", "distance": 2.478, "atom1_id": "///B/163/NZ", "atom2_id": "///F/32/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 727, "atom1_serNum": 6038, "atom2_serNum": 7747, "donAcc_type": "standard", "distance": 3.083, "atom1_id": "///B/164/O", "atom2_id": "///B/372/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 728, "atom1_serNum": 6046, "atom2_serNum": 8808, "donAcc_type": "acceptable", "distance": 2.770, "atom1_id": "///B/164/OH", "atom2_id": "///F/33/OP2", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 729, "atom1_serNum": 6050, "atom2_serNum": 6072, "donAcc_type": "standard", "distance": 2.876, "atom1_id": "///B/165/O", "atom2_id": "///B/168/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 730, "atom1_serNum": 6053, "atom2_serNum": 6064, "donAcc_type": "acceptable", "distance": 2.849, "atom1_id": "///B/165/ND1", "atom2_id": "///B/167/N", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 731, "atom1_serNum": 6056, "atom2_serNum": 7857, "donAcc_type": "standard", "distance": 3.622, "atom1_id": "///B/165/NE2", "atom2_id": "///B/387/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 732, "atom1_serNum": 6067, "atom2_serNum": 6080, "donAcc_type": "standard", "distance": 2.822, "atom1_id": "///B/167/O", "atom2_id": "///B/169/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 733, "atom1_serNum": 6071, "atom2_serNum": 7824, "donAcc_type": "standard", "distance": 3.340, "atom1_id": "///B/167/ND2", "atom2_id": "///B/382/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 734, "atom1_serNum": 6071, "atom2_serNum": 8976, "donAcc_type": "standard", "distance": 3.111, "atom1_id": "///B/167/ND2", "atom2_id": "///F/41/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 735, "atom1_serNum": 6075, "atom2_serNum": 6114, "donAcc_type": "standard", "distance": 2.853, "atom1_id": "///B/168/O", "atom2_id": "///B/172/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 736, "atom1_serNum": 6079, "atom2_serNum": 6112, "donAcc_type": "standard", "distance": 3.080, "atom1_id": "///B/168/OD2", "atom2_id": "///B/171/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 737, "atom1_serNum": 6083, "atom2_serNum": 6121, "donAcc_type": "standard", "distance": 2.951, "atom1_id": "///B/169/O", "atom2_id": "///B/173/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 738, "atom1_serNum": 6095, "atom2_serNum": 6130, "donAcc_type": "standard", "distance": 3.147, "atom1_id": "///B/170/O", "atom2_id": "///B/174/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 739, "atom1_serNum": 6101, "atom2_serNum": 8933, "donAcc_type": "standard", "distance": 3.132, "atom1_id": "///B/170/NH1", "atom2_id": "///F/38/N3", "atom_pair": "N:N", "residue_pair": "aa:nt" }, { "index": 740, "atom1_serNum": 6106, "atom2_serNum": 6130, "donAcc_type": "standard", "distance": 2.869, "atom1_id": "///B/171/O", "atom2_id": "///B/174/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 741, "atom1_serNum": 6106, "atom2_serNum": 6141, "donAcc_type": "standard", "distance": 2.965, "atom1_id": "///B/171/O", "atom2_id": "///B/175/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 742, "atom1_serNum": 6110, "atom2_serNum": 8807, "donAcc_type": "standard", "distance": 2.836, "atom1_id": "///B/171/NE", "atom2_id": "///F/33/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 743, "atom1_serNum": 6112, "atom2_serNum": 8949, "donAcc_type": "standard", "distance": 3.313, "atom1_id": "///B/171/NH1", "atom2_id": "///F/39/O2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 744, "atom1_serNum": 6113, "atom2_serNum": 8931, "donAcc_type": "standard", "distance": 2.625, "atom1_id": "///B/171/NH2", "atom2_id": "///F/38/N1", "atom_pair": "N:N", "residue_pair": "aa:nt" }, { "index": 745, "atom1_serNum": 6117, "atom2_serNum": 6149, "donAcc_type": "standard", "distance": 3.076, "atom1_id": "///B/172/O", "atom2_id": "///B/176/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 746, "atom1_serNum": 6124, "atom2_serNum": 6157, "donAcc_type": "standard", "distance": 3.162, "atom1_id": "///B/173/O", "atom2_id": "///B/177/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 747, "atom1_serNum": 6133, "atom2_serNum": 6166, "donAcc_type": "standard", "distance": 3.244, "atom1_id": "///B/174/O", "atom2_id": "///B/178/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 748, "atom1_serNum": 6139, "atom2_serNum": 8827, "donAcc_type": "standard", "distance": 3.075, "atom1_id": "///B/174/NH1", "atom2_id": "///F/34/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 749, "atom1_serNum": 6144, "atom2_serNum": 6174, "donAcc_type": "standard", "distance": 3.072, "atom1_id": "///B/175/O", "atom2_id": "///B/179/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 750, "atom1_serNum": 6152, "atom2_serNum": 6186, "donAcc_type": "standard", "distance": 2.863, "atom1_id": "///B/176/O", "atom2_id": "///B/180/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 751, "atom1_serNum": 6160, "atom2_serNum": 6198, "donAcc_type": "standard", "distance": 2.903, "atom1_id": "///B/177/O", "atom2_id": "///B/181/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 752, "atom1_serNum": 6169, "atom2_serNum": 6207, "donAcc_type": "standard", "distance": 2.987, "atom1_id": "///B/178/O", "atom2_id": "///B/182/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 753, "atom1_serNum": 6169, "atom2_serNum": 6212, "donAcc_type": "acceptable", "distance": 2.552, "atom1_id": "///B/178/O", "atom2_id": "///B/182/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 754, "atom1_serNum": 6177, "atom2_serNum": 6214, "donAcc_type": "standard", "distance": 2.744, "atom1_id": "///B/179/O", "atom2_id": "///B/183/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 755, "atom1_serNum": 6212, "atom2_serNum": 6221, "donAcc_type": "acceptable", "distance": 3.017, "atom1_id": "///B/182/OG1", "atom2_id": "///B/184/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 756, "atom1_serNum": 6226, "atom2_serNum": 6291, "donAcc_type": "standard", "distance": 3.434, "atom1_id": "///B/184/NZ", "atom2_id": "///B/192/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 757, "atom1_serNum": 6230, "atom2_serNum": 6263, "donAcc_type": "acceptable", "distance": 3.035, "atom1_id": "///B/185/O", "atom2_id": "///B/189/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 758, "atom1_serNum": 6235, "atom2_serNum": 6257, "donAcc_type": "standard", "distance": 2.670, "atom1_id": "///B/185/NZ", "atom2_id": "///B/188/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 759, "atom1_serNum": 6239, "atom2_serNum": 6265, "donAcc_type": "standard", "distance": 3.355, "atom1_id": "///B/186/O", "atom2_id": "///B/190/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 760, "atom1_serNum": 6246, "atom2_serNum": 6276, "donAcc_type": "standard", "distance": 3.168, "atom1_id": "///B/187/O", "atom2_id": "///B/191/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 761, "atom1_serNum": 6252, "atom2_serNum": 6284, "donAcc_type": "standard", "distance": 3.161, "atom1_id": "///B/188/O", "atom2_id": "///B/192/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 762, "atom1_serNum": 6300, "atom2_serNum": 8820, "donAcc_type": "questionable", "distance": 2.413, "atom1_id": "///B/193/OE1", "atom2_id": "///F/33/O2", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 763, "atom1_serNum": 6300, "atom2_serNum": 8821, "donAcc_type": "standard", "distance": 2.827, "atom1_id": "///B/193/OE1", "atom2_id": "///F/33/N3", "atom_pair": "O:N", "residue_pair": "aa:nt" }, { "index": 764, "atom1_serNum": 6301, "atom2_serNum": 8820, "donAcc_type": "standard", "distance": 3.203, "atom1_id": "///B/193/NE2", "atom2_id": "///F/33/O2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 765, "atom1_serNum": 6346, "atom2_serNum": 6367, "donAcc_type": "acceptable", "distance": 2.669, "atom1_id": "///B/199/O", "atom2_id": "///B/201/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 766, "atom1_serNum": 6380, "atom2_serNum": 7265, "donAcc_type": "standard", "distance": 2.899, "atom1_id": "///B/203/O", "atom2_id": "///B/313/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 767, "atom1_serNum": 6396, "atom2_serNum": 7268, "donAcc_type": "standard", "distance": 2.788, "atom1_id": "///B/205/N", "atom2_id": "///B/313/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 768, "atom1_serNum": 6399, "atom2_serNum": 6418, "donAcc_type": "standard", "distance": 3.016, "atom1_id": "///B/205/O", "atom2_id": "///B/207/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 769, "atom1_serNum": 6399, "atom2_serNum": 7285, "donAcc_type": "standard", "distance": 2.707, "atom1_id": "///B/205/O", "atom2_id": "///B/315/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 770, "atom1_serNum": 6421, "atom2_serNum": 7288, "donAcc_type": "questionable", "distance": 3.015, "atom1_id": "///B/207/O", "atom2_id": "///B/315/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 771, "atom1_serNum": 6421, "atom2_serNum": 7301, "donAcc_type": "standard", "distance": 2.833, "atom1_id": "///B/207/O", "atom2_id": "///B/317/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 772, "atom1_serNum": 6436, "atom2_serNum": 7311, "donAcc_type": "acceptable", "distance": 2.778, "atom1_id": "///B/209/N", "atom2_id": "///B/318/OG1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 773, "atom1_serNum": 6439, "atom2_serNum": 6468, "donAcc_type": "standard", "distance": 3.030, "atom1_id": "///B/209/O", "atom2_id": "///B/213/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 774, "atom1_serNum": 6448, "atom2_serNum": 6476, "donAcc_type": "standard", "distance": 2.857, "atom1_id": "///B/210/O", "atom2_id": "///B/214/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 775, "atom1_serNum": 6455, "atom2_serNum": 6476, "donAcc_type": "standard", "distance": 3.050, "atom1_id": "///B/211/O", "atom2_id": "///B/214/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 776, "atom1_serNum": 6455, "atom2_serNum": 6487, "donAcc_type": "standard", "distance": 3.088, "atom1_id": "///B/211/O", "atom2_id": "///B/215/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 777, "atom1_serNum": 6464, "atom2_serNum": 6487, "donAcc_type": "standard", "distance": 2.806, "atom1_id": "///B/212/O", "atom2_id": "///B/215/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 778, "atom1_serNum": 6464, "atom2_serNum": 6496, "donAcc_type": "standard", "distance": 2.846, "atom1_id": "///B/212/O", "atom2_id": "///B/216/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 779, "atom1_serNum": 6471, "atom2_serNum": 6507, "donAcc_type": "standard", "distance": 3.094, "atom1_id": "///B/213/O", "atom2_id": "///B/217/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 780, "atom1_serNum": 6479, "atom2_serNum": 6515, "donAcc_type": "standard", "distance": 3.045, "atom1_id": "///B/214/O", "atom2_id": "///B/218/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 781, "atom1_serNum": 6490, "atom2_serNum": 6523, "donAcc_type": "standard", "distance": 3.046, "atom1_id": "///B/215/O", "atom2_id": "///B/219/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 782, "atom1_serNum": 6494, "atom2_serNum": 6530, "donAcc_type": "questionable", "distance": 2.823, "atom1_id": "///B/215/OE1", "atom2_id": "///B/219/OD2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 783, "atom1_serNum": 6499, "atom2_serNum": 6531, "donAcc_type": "standard", "distance": 2.960, "atom1_id": "///B/216/O", "atom2_id": "///B/220/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 784, "atom1_serNum": 6505, "atom2_serNum": 7304, "donAcc_type": "standard", "distance": 3.596, "atom1_id": "///B/216/NH1", "atom2_id": "///B/317/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 785, "atom1_serNum": 6506, "atom2_serNum": 7309, "donAcc_type": "standard", "distance": 2.763, "atom1_id": "///B/216/NH2", "atom2_id": "///B/318/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 786, "atom1_serNum": 6518, "atom2_serNum": 6542, "donAcc_type": "standard", "distance": 2.948, "atom1_id": "///B/218/O", "atom2_id": "///B/221/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 787, "atom1_serNum": 6518, "atom2_serNum": 6549, "donAcc_type": "standard", "distance": 3.177, "atom1_id": "///B/218/O", "atom2_id": "///B/222/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 788, "atom1_serNum": 6526, "atom2_serNum": 6557, "donAcc_type": "standard", "distance": 3.179, "atom1_id": "///B/219/O", "atom2_id": "///B/223/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 789, "atom1_serNum": 6540, "atom2_serNum": 9649, "donAcc_type": "acceptable", "distance": 3.215, "atom1_id": "///B/220/NH1", "atom2_id": "///B/422/O1A", "atom_pair": "N:O", "residue_pair": "aa:ligand" }, { "index": 790, "atom1_serNum": 6545, "atom2_serNum": 6565, "donAcc_type": "standard", "distance": 3.154, "atom1_id": "///B/221/O", "atom2_id": "///B/224/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 791, "atom1_serNum": 6552, "atom2_serNum": 6573, "donAcc_type": "standard", "distance": 2.934, "atom1_id": "///B/222/O", "atom2_id": "///B/225/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 792, "atom1_serNum": 6555, "atom2_serNum": 7041, "donAcc_type": "standard", "distance": 3.098, "atom1_id": "///B/222/OD1", "atom2_id": "///B/286/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 793, "atom1_serNum": 6568, "atom2_serNum": 6605, "donAcc_type": "standard", "distance": 3.265, "atom1_id": "///B/224/O", "atom2_id": "///B/229/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 794, "atom1_serNum": 6576, "atom2_serNum": 6601, "donAcc_type": "standard", "distance": 3.044, "atom1_id": "///B/225/O", "atom2_id": "///B/228/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 795, "atom1_serNum": 6576, "atom2_serNum": 6605, "donAcc_type": "standard", "distance": 3.156, "atom1_id": "///B/225/O", "atom2_id": "///B/229/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 796, "atom1_serNum": 6604, "atom2_serNum": 6627, "donAcc_type": "standard", "distance": 3.104, "atom1_id": "///B/228/O", "atom2_id": "///B/232/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 797, "atom1_serNum": 6608, "atom2_serNum": 6636, "donAcc_type": "standard", "distance": 3.183, "atom1_id": "///B/229/O", "atom2_id": "///B/233/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 798, "atom1_serNum": 6613, "atom2_serNum": 6644, "donAcc_type": "standard", "distance": 2.788, "atom1_id": "///B/230/O", "atom2_id": "///B/234/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 799, "atom1_serNum": 6621, "atom2_serNum": 6653, "donAcc_type": "standard", "distance": 2.635, "atom1_id": "///B/231/O", "atom2_id": "///B/235/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 800, "atom1_serNum": 6630, "atom2_serNum": 6662, "donAcc_type": "standard", "distance": 3.156, "atom1_id": "///B/232/O", "atom2_id": "///B/236/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 801, "atom1_serNum": 6639, "atom2_serNum": 6662, "donAcc_type": "standard", "distance": 2.863, "atom1_id": "///B/233/O", "atom2_id": "///B/236/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 802, "atom1_serNum": 6639, "atom2_serNum": 6670, "donAcc_type": "standard", "distance": 2.868, "atom1_id": "///B/233/O", "atom2_id": "///B/237/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 803, "atom1_serNum": 6647, "atom2_serNum": 6682, "donAcc_type": "standard", "distance": 3.219, "atom1_id": "///B/234/O", "atom2_id": "///B/238/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 804, "atom1_serNum": 6665, "atom2_serNum": 6703, "donAcc_type": "standard", "distance": 3.303, "atom1_id": "///B/236/O", "atom2_id": "///B/240/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 805, "atom1_serNum": 6673, "atom2_serNum": 6715, "donAcc_type": "standard", "distance": 3.535, "atom1_id": "///B/237/O", "atom2_id": "///B/241/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 806, "atom1_serNum": 6681, "atom2_serNum": 6909, "donAcc_type": "acceptable", "distance": 3.603, "atom1_id": "///B/237/OH", "atom2_id": "///B/264/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 807, "atom1_serNum": 6681, "atom2_serNum": 6946, "donAcc_type": "acceptable", "distance": 2.811, "atom1_id": "///B/237/OH", "atom2_id": "///B/268/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 808, "atom1_serNum": 6689, "atom2_serNum": 6729, "donAcc_type": "standard", "distance": 3.217, "atom1_id": "///B/238/OE1", "atom2_id": "///B/242/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 809, "atom1_serNum": 6706, "atom2_serNum": 6738, "donAcc_type": "standard", "distance": 3.501, "atom1_id": "///B/240/O", "atom2_id": "///B/244/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 810, "atom1_serNum": 6761, "atom2_serNum": 6772, "donAcc_type": "standard", "distance": 2.534, "atom1_id": "///B/246/O", "atom2_id": "///B/248/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 811, "atom1_serNum": 6761, "atom2_serNum": 6781, "donAcc_type": "standard", "distance": 3.332, "atom1_id": "///B/246/O", "atom2_id": "///B/249/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 812, "atom1_serNum": 6761, "atom2_serNum": 6790, "donAcc_type": "standard", "distance": 3.369, "atom1_id": "///B/246/O", "atom2_id": "///B/250/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 813, "atom1_serNum": 6784, "atom2_serNum": 6832, "donAcc_type": "standard", "distance": 3.535, "atom1_id": "///B/249/O", "atom2_id": "///B/255/NE1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 814, "atom1_serNum": 6793, "atom2_serNum": 6885, "donAcc_type": "standard", "distance": 3.218, "atom1_id": "///B/250/O", "atom2_id": "///B/261/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 815, "atom1_serNum": 6796, "atom2_serNum": 6803, "donAcc_type": "standard", "distance": 3.090, "atom1_id": "///B/251/N", "atom2_id": "///B/251/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 816, "atom1_serNum": 6808, "atom2_serNum": 6812, "donAcc_type": "standard", "distance": 3.368, "atom1_id": "///B/252/O", "atom2_id": "///B/252/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 817, "atom1_serNum": 6816, "atom2_serNum": 6838, "donAcc_type": "standard", "distance": 3.211, "atom1_id": "///B/253/O", "atom2_id": "///B/256/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 818, "atom1_serNum": 6820, "atom2_serNum": 6847, "donAcc_type": "standard", "distance": 2.748, "atom1_id": "///B/254/O", "atom2_id": "///B/257/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 819, "atom1_serNum": 6845, "atom2_serNum": 8901, "donAcc_type": "acceptable", "distance": 3.654, "atom1_id": "///B/256/OE1", "atom2_id": "///F/37/O2'", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 820, "atom1_serNum": 6846, "atom2_serNum": 6885, "donAcc_type": "questionable", "distance": 3.399, "atom1_id": "///B/256/NE2", "atom2_id": "///B/261/NZ", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 821, "atom1_serNum": 6850, "atom2_serNum": 6862, "donAcc_type": "standard", "distance": 3.299, "atom1_id": "///B/257/O", "atom2_id": "///B/259/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 822, "atom1_serNum": 6862, "atom2_serNum": 6893, "donAcc_type": "standard", "distance": 2.957, "atom1_id": "///B/259/N", "atom2_id": "///B/262/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 823, "atom1_serNum": 6869, "atom2_serNum": 6895, "donAcc_type": "standard", "distance": 2.936, "atom1_id": "///B/260/O", "atom2_id": "///B/263/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 824, "atom1_serNum": 6869, "atom2_serNum": 6906, "donAcc_type": "standard", "distance": 2.806, "atom1_id": "///B/260/O", "atom2_id": "///B/264/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 825, "atom1_serNum": 6894, "atom2_serNum": 7021, "donAcc_type": "standard", "distance": 3.561, "atom1_id": "///B/262/OE2", "atom2_id": "///B/284/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 826, "atom1_serNum": 6909, "atom2_serNum": 6935, "donAcc_type": "standard", "distance": 3.014, "atom1_id": "///B/264/O", "atom2_id": "///B/267/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 827, "atom1_serNum": 6909, "atom2_serNum": 6943, "donAcc_type": "standard", "distance": 3.153, "atom1_id": "///B/264/O", "atom2_id": "///B/268/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 828, "atom1_serNum": 6929, "atom2_serNum": 6960, "donAcc_type": "standard", "distance": 3.027, "atom1_id": "///B/266/NE1", "atom2_id": "///B/277/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 829, "atom1_serNum": 6953, "atom2_serNum": 6974, "donAcc_type": "standard", "distance": 2.914, "atom1_id": "///B/276/O", "atom2_id": "///B/279/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 830, "atom1_serNum": 6965, "atom2_serNum": 6989, "donAcc_type": "standard", "distance": 2.686, "atom1_id": "///B/277/NZ", "atom2_id": "///B/280/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 831, "atom1_serNum": 6969, "atom2_serNum": 6991, "donAcc_type": "standard", "distance": 3.076, "atom1_id": "///B/278/O", "atom2_id": "///B/281/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 832, "atom1_serNum": 6969, "atom2_serNum": 6997, "donAcc_type": "standard", "distance": 3.121, "atom1_id": "///B/278/O", "atom2_id": "///B/282/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 833, "atom1_serNum": 6977, "atom2_serNum": 7005, "donAcc_type": "standard", "distance": 3.008, "atom1_id": "///B/279/O", "atom2_id": "///B/283/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 834, "atom1_serNum": 6994, "atom2_serNum": 7025, "donAcc_type": "standard", "distance": 2.903, "atom1_id": "///B/281/O", "atom2_id": "///B/285/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 835, "atom1_serNum": 7000, "atom2_serNum": 7033, "donAcc_type": "standard", "distance": 2.996, "atom1_id": "///B/282/O", "atom2_id": "///B/286/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 836, "atom1_serNum": 7008, "atom2_serNum": 7042, "donAcc_type": "standard", "distance": 2.996, "atom1_id": "///B/283/O", "atom2_id": "///B/287/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 837, "atom1_serNum": 7008, "atom2_serNum": 7047, "donAcc_type": "acceptable", "distance": 2.957, "atom1_id": "///B/283/O", "atom2_id": "///B/287/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 838, "atom1_serNum": 7017, "atom2_serNum": 7049, "donAcc_type": "standard", "distance": 2.899, "atom1_id": "///B/284/O", "atom2_id": "///B/288/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 839, "atom1_serNum": 7023, "atom2_serNum": 8655, "donAcc_type": "standard", "distance": 2.627, "atom1_id": "///B/284/NH1", "atom2_id": "///F/26/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 840, "atom1_serNum": 7028, "atom2_serNum": 7060, "donAcc_type": "standard", "distance": 3.026, "atom1_id": "///B/285/O", "atom2_id": "///B/289/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 841, "atom1_serNum": 7028, "atom2_serNum": 7065, "donAcc_type": "acceptable", "distance": 2.792, "atom1_id": "///B/285/O", "atom2_id": "///B/289/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 842, "atom1_serNum": 7036, "atom2_serNum": 7067, "donAcc_type": "standard", "distance": 3.469, "atom1_id": "///B/286/O", "atom2_id": "///B/290/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 843, "atom1_serNum": 7045, "atom2_serNum": 7078, "donAcc_type": "standard", "distance": 3.042, "atom1_id": "///B/287/O", "atom2_id": "///B/291/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 844, "atom1_serNum": 7052, "atom2_serNum": 7087, "donAcc_type": "standard", "distance": 3.182, "atom1_id": "///B/288/O", "atom2_id": "///B/292/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 845, "atom1_serNum": 7058, "atom2_serNum": 7085, "donAcc_type": "standard", "distance": 3.395, "atom1_id": "///B/288/NH1", "atom2_id": "///B/291/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 846, "atom1_serNum": 7059, "atom2_serNum": 8897, "donAcc_type": "standard", "distance": 3.145, "atom1_id": "///B/288/NH2", "atom2_id": "///F/37/O4'", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 847, "atom1_serNum": 7059, "atom2_serNum": 8911, "donAcc_type": "standard", "distance": 3.158, "atom1_id": "///B/288/NH2", "atom2_id": "///F/37/N3", "atom_pair": "N:N", "residue_pair": "aa:nt" }, { "index": 848, "atom1_serNum": 7063, "atom2_serNum": 7099, "donAcc_type": "standard", "distance": 3.108, "atom1_id": "///B/289/O", "atom2_id": "///B/293/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 849, "atom1_serNum": 7070, "atom2_serNum": 7104, "donAcc_type": "standard", "distance": 2.828, "atom1_id": "///B/290/O", "atom2_id": "///B/294/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 850, "atom1_serNum": 7081, "atom2_serNum": 7113, "donAcc_type": "standard", "distance": 2.994, "atom1_id": "///B/291/O", "atom2_id": "///B/295/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 851, "atom1_serNum": 7086, "atom2_serNum": 8655, "donAcc_type": "standard", "distance": 3.737, "atom1_id": "///B/291/NE2", "atom2_id": "///F/26/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 852, "atom1_serNum": 7086, "atom2_serNum": 8678, "donAcc_type": "standard", "distance": 3.672, "atom1_id": "///B/291/NE2", "atom2_id": "///F/27/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 853, "atom1_serNum": 7090, "atom2_serNum": 7124, "donAcc_type": "standard", "distance": 2.939, "atom1_id": "///B/292/O", "atom2_id": "///B/296/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 854, "atom1_serNum": 7098, "atom2_serNum": 8893, "donAcc_type": "acceptable", "distance": 3.875, "atom1_id": "///B/292/OH", "atom2_id": "///F/37/OP2", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 855, "atom1_serNum": 7102, "atom2_serNum": 7133, "donAcc_type": "standard", "distance": 2.974, "atom1_id": "///B/293/O", "atom2_id": "///B/297/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 856, "atom1_serNum": 7107, "atom2_serNum": 7140, "donAcc_type": "standard", "distance": 2.987, "atom1_id": "///B/294/O", "atom2_id": "///B/298/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 857, "atom1_serNum": 7112, "atom2_serNum": 8677, "donAcc_type": "standard", "distance": 3.142, "atom1_id": "///B/294/NZ", "atom2_id": "///F/27/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 858, "atom1_serNum": 7112, "atom2_serNum": 8701, "donAcc_type": "standard", "distance": 3.270, "atom1_id": "///B/294/NZ", "atom2_id": "///F/28/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 859, "atom1_serNum": 7116, "atom2_serNum": 7149, "donAcc_type": "standard", "distance": 2.848, "atom1_id": "///B/295/O", "atom2_id": "///B/299/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 860, "atom1_serNum": 7122, "atom2_serNum": 8927, "donAcc_type": "standard", "distance": 3.394, "atom1_id": "///B/295/NH1", "atom2_id": "///F/38/N7", "atom_pair": "N:N", "residue_pair": "aa:nt" }, { "index": 861, "atom1_serNum": 7123, "atom2_serNum": 8915, "donAcc_type": "standard", "distance": 3.186, "atom1_id": "///B/295/NH2", "atom2_id": "///F/38/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 862, "atom1_serNum": 7127, "atom2_serNum": 7163, "donAcc_type": "standard", "distance": 3.081, "atom1_id": "///B/296/O", "atom2_id": "///B/300/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 863, "atom1_serNum": 7136, "atom2_serNum": 7163, "donAcc_type": "standard", "distance": 2.958, "atom1_id": "///B/297/O", "atom2_id": "///B/300/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 864, "atom1_serNum": 7136, "atom2_serNum": 7171, "donAcc_type": "standard", "distance": 2.871, "atom1_id": "///B/297/O", "atom2_id": "///B/301/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 865, "atom1_serNum": 7143, "atom2_serNum": 7180, "donAcc_type": "standard", "distance": 2.709, "atom1_id": "///B/298/O", "atom2_id": "///B/302/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 866, "atom1_serNum": 7148, "atom2_serNum": 8721, "donAcc_type": "standard", "distance": 3.158, "atom1_id": "///B/298/NZ", "atom2_id": "///F/29/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 867, "atom1_serNum": 7152, "atom2_serNum": 7189, "donAcc_type": "standard", "distance": 2.883, "atom1_id": "///B/299/O", "atom2_id": "///B/303/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 868, "atom1_serNum": 7152, "atom2_serNum": 7197, "donAcc_type": "standard", "distance": 2.958, "atom1_id": "///B/299/O", "atom2_id": "///B/304/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 869, "atom1_serNum": 7166, "atom2_serNum": 7205, "donAcc_type": "standard", "distance": 2.978, "atom1_id": "///B/300/O", "atom2_id": "///B/305/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 870, "atom1_serNum": 7179, "atom2_serNum": 7652, "donAcc_type": "standard", "distance": 3.263, "atom1_id": "///B/301/NZ", "atom2_id": "///B/361/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 871, "atom1_serNum": 7183, "atom2_serNum": 7692, "donAcc_type": "standard", "distance": 2.988, "atom1_id": "///B/302/O", "atom2_id": "///B/366/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 872, "atom1_serNum": 7188, "atom2_serNum": 8743, "donAcc_type": "standard", "distance": 2.899, "atom1_id": "///B/302/NZ", "atom2_id": "///F/30/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 873, "atom1_serNum": 7188, "atom2_serNum": 8766, "donAcc_type": "standard", "distance": 2.936, "atom1_id": "///B/302/NZ", "atom2_id": "///F/31/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 874, "atom1_serNum": 7192, "atom2_serNum": 7220, "donAcc_type": "standard", "distance": 3.069, "atom1_id": "///B/303/O", "atom2_id": "///B/307/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 875, "atom1_serNum": 7200, "atom2_serNum": 7220, "donAcc_type": "standard", "distance": 2.754, "atom1_id": "///B/304/O", "atom2_id": "///B/307/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 876, "atom1_serNum": 7200, "atom2_serNum": 7228, "donAcc_type": "standard", "distance": 3.026, "atom1_id": "///B/304/O", "atom2_id": "///B/308/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 877, "atom1_serNum": 7208, "atom2_serNum": 7236, "donAcc_type": "standard", "distance": 3.102, "atom1_id": "///B/305/O", "atom2_id": "///B/309/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 878, "atom1_serNum": 7208, "atom2_serNum": 7245, "donAcc_type": "standard", "distance": 2.951, "atom1_id": "///B/305/O", "atom2_id": "///B/310/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 879, "atom1_serNum": 7216, "atom2_serNum": 7236, "donAcc_type": "standard", "distance": 3.207, "atom1_id": "///B/306/O", "atom2_id": "///B/309/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 880, "atom1_serNum": 7231, "atom2_serNum": 7249, "donAcc_type": "standard", "distance": 3.232, "atom1_id": "///B/308/O", "atom2_id": "///B/311/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 881, "atom1_serNum": 7239, "atom2_serNum": 7249, "donAcc_type": "standard", "distance": 2.617, "atom1_id": "///B/309/O", "atom2_id": "///B/311/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 882, "atom1_serNum": 7248, "atom2_serNum": 7257, "donAcc_type": "standard", "distance": 3.295, "atom1_id": "///B/310/O", "atom2_id": "///B/312/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 883, "atom1_serNum": 7248, "atom2_serNum": 7555, "donAcc_type": "standard", "distance": 3.205, "atom1_id": "///B/310/O", "atom2_id": "///B/348/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 884, "atom1_serNum": 7255, "atom2_serNum": 7556, "donAcc_type": "standard", "distance": 2.537, "atom1_id": "///B/311/OD1", "atom2_id": "///B/348/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 885, "atom1_serNum": 7277, "atom2_serNum": 7549, "donAcc_type": "standard", "distance": 3.210, "atom1_id": "///B/314/N", "atom2_id": "///B/348/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 886, "atom1_serNum": 7280, "atom2_serNum": 7410, "donAcc_type": "standard", "distance": 2.612, "atom1_id": "///B/314/O", "atom2_id": "///B/330/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 887, "atom1_serNum": 7288, "atom2_serNum": 7301, "donAcc_type": "standard", "distance": 2.836, "atom1_id": "///B/315/O", "atom2_id": "///B/317/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 888, "atom1_serNum": 7299, "atom2_serNum": 7301, "donAcc_type": "standard", "distance": 3.221, "atom1_id": "///B/316/OD1", "atom2_id": "///B/317/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 889, "atom1_serNum": 7299, "atom2_serNum": 7306, "donAcc_type": "standard", "distance": 3.076, "atom1_id": "///B/316/OD1", "atom2_id": "///B/318/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 890, "atom1_serNum": 7299, "atom2_serNum": 7311, "donAcc_type": "acceptable", "distance": 2.955, "atom1_id": "///B/316/OD1", "atom2_id": "///B/318/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 891, "atom1_serNum": 7316, "atom2_serNum": 7335, "donAcc_type": "standard", "distance": 3.231, "atom1_id": "///B/319/O", "atom2_id": "///B/322/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 892, "atom1_serNum": 7319, "atom2_serNum": 7321, "donAcc_type": "standard", "distance": 3.039, "atom1_id": "///B/319/OD1", "atom2_id": "///B/320/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 893, "atom1_serNum": 7319, "atom2_serNum": 7329, "donAcc_type": "standard", "distance": 2.725, "atom1_id": "///B/319/OD1", "atom2_id": "///B/321/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 894, "atom1_serNum": 7319, "atom2_serNum": 7334, "donAcc_type": "acceptable", "distance": 2.458, "atom1_id": "///B/319/OD1", "atom2_id": "///B/321/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 895, "atom1_serNum": 7320, "atom2_serNum": 7334, "donAcc_type": "acceptable", "distance": 3.184, "atom1_id": "///B/319/OD2", "atom2_id": "///B/321/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 896, "atom1_serNum": 7320, "atom2_serNum": 7343, "donAcc_type": "standard", "distance": 2.857, "atom1_id": "///B/319/OD2", "atom2_id": "///B/322/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 897, "atom1_serNum": 7338, "atom2_serNum": 7366, "donAcc_type": "standard", "distance": 3.119, "atom1_id": "///B/322/O", "atom2_id": "///B/325/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 898, "atom1_serNum": 7338, "atom2_serNum": 7371, "donAcc_type": "acceptable", "distance": 2.926, "atom1_id": "///B/322/O", "atom2_id": "///B/325/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 899, "atom1_serNum": 7338, "atom2_serNum": 7373, "donAcc_type": "standard", "distance": 2.691, "atom1_id": "///B/322/O", "atom2_id": "///B/326/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 900, "atom1_serNum": 7347, "atom2_serNum": 7381, "donAcc_type": "standard", "distance": 2.734, "atom1_id": "///B/323/O", "atom2_id": "///B/327/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 901, "atom1_serNum": 7347, "atom2_serNum": 7386, "donAcc_type": "standard", "distance": 2.741, "atom1_id": "///B/323/O", "atom2_id": "///B/328/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 902, "atom1_serNum": 7361, "atom2_serNum": 7392, "donAcc_type": "standard", "distance": 2.664, "atom1_id": "///B/324/O", "atom2_id": "///B/329/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 903, "atom1_serNum": 7364, "atom2_serNum": 7391, "donAcc_type": "acceptable", "distance": 3.452, "atom1_id": "///B/324/OD1", "atom2_id": "///B/328/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 904, "atom1_serNum": 7365, "atom2_serNum": 7400, "donAcc_type": "standard", "distance": 3.483, "atom1_id": "///B/324/OD2", "atom2_id": "///B/329/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 905, "atom1_serNum": 7384, "atom2_serNum": 7412, "donAcc_type": "standard", "distance": 3.022, "atom1_id": "///B/327/O", "atom2_id": "///B/331/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 906, "atom1_serNum": 7389, "atom2_serNum": 7412, "donAcc_type": "standard", "distance": 2.725, "atom1_id": "///B/328/O", "atom2_id": "///B/331/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 907, "atom1_serNum": 7389, "atom2_serNum": 7417, "donAcc_type": "standard", "distance": 3.022, "atom1_id": "///B/328/O", "atom2_id": "///B/332/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 908, "atom1_serNum": 7395, "atom2_serNum": 7425, "donAcc_type": "standard", "distance": 3.099, "atom1_id": "///B/329/O", "atom2_id": "///B/333/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 909, "atom1_serNum": 7404, "atom2_serNum": 7430, "donAcc_type": "standard", "distance": 3.062, "atom1_id": "///B/330/O", "atom2_id": "///B/334/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 910, "atom1_serNum": 7415, "atom2_serNum": 7438, "donAcc_type": "standard", "distance": 2.751, "atom1_id": "///B/331/O", "atom2_id": "///B/335/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 911, "atom1_serNum": 7415, "atom2_serNum": 7443, "donAcc_type": "acceptable", "distance": 2.582, "atom1_id": "///B/331/O", "atom2_id": "///B/335/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 912, "atom1_serNum": 7420, "atom2_serNum": 7444, "donAcc_type": "standard", "distance": 2.610, "atom1_id": "///B/332/O", "atom2_id": "///B/336/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 913, "atom1_serNum": 7428, "atom2_serNum": 7452, "donAcc_type": "standard", "distance": 3.305, "atom1_id": "///B/333/O", "atom2_id": "///B/337/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 914, "atom1_serNum": 7428, "atom2_serNum": 7458, "donAcc_type": "questionable", "distance": 3.119, "atom1_id": "///B/333/O", "atom2_id": "///B/337/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 915, "atom1_serNum": 7433, "atom2_serNum": 7460, "donAcc_type": "standard", "distance": 3.198, "atom1_id": "///B/334/O", "atom2_id": "///B/338/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 916, "atom1_serNum": 7441, "atom2_serNum": 7471, "donAcc_type": "standard", "distance": 3.111, "atom1_id": "///B/335/O", "atom2_id": "///B/339/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 917, "atom1_serNum": 7447, "atom2_serNum": 7471, "donAcc_type": "standard", "distance": 2.756, "atom1_id": "///B/336/O", "atom2_id": "///B/339/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 918, "atom1_serNum": 7447, "atom2_serNum": 7479, "donAcc_type": "standard", "distance": 2.811, "atom1_id": "///B/336/O", "atom2_id": "///B/340/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 919, "atom1_serNum": 7455, "atom2_serNum": 7493, "donAcc_type": "standard", "distance": 2.886, "atom1_id": "///B/337/O", "atom2_id": "///B/342/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 920, "atom1_serNum": 7463, "atom2_serNum": 7485, "donAcc_type": "standard", "distance": 3.361, "atom1_id": "///B/338/O", "atom2_id": "///B/341/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 921, "atom1_serNum": 7581, "atom2_serNum": 7591, "donAcc_type": "standard", "distance": 3.081, "atom1_id": "///B/352/O", "atom2_id": "///B/354/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 922, "atom1_serNum": 7594, "atom2_serNum": 7617, "donAcc_type": "standard", "distance": 3.424, "atom1_id": "///B/354/O", "atom2_id": "///B/357/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 923, "atom1_serNum": 7603, "atom2_serNum": 7625, "donAcc_type": "standard", "distance": 2.725, "atom1_id": "///B/355/O", "atom2_id": "///B/358/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 924, "atom1_serNum": 7603, "atom2_serNum": 7630, "donAcc_type": "acceptable", "distance": 2.948, "atom1_id": "///B/355/O", "atom2_id": "///B/358/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 925, "atom1_serNum": 7628, "atom2_serNum": 7630, "donAcc_type": "acceptable", "distance": 2.759, "atom1_id": "///B/358/O", "atom2_id": "///B/358/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 926, "atom1_serNum": 7628, "atom2_serNum": 7644, "donAcc_type": "standard", "distance": 2.753, "atom1_id": "///B/358/O", "atom2_id": "///B/361/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 927, "atom1_serNum": 7628, "atom2_serNum": 7653, "donAcc_type": "standard", "distance": 3.247, "atom1_id": "///B/358/O", "atom2_id": "///B/362/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 928, "atom1_serNum": 7628, "atom2_serNum": 7658, "donAcc_type": "acceptable", "distance": 2.982, "atom1_id": "///B/358/O", "atom2_id": "///B/362/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 929, "atom1_serNum": 7630, "atom2_serNum": 7644, "donAcc_type": "acceptable", "distance": 3.178, "atom1_id": "///B/358/OG", "atom2_id": "///B/361/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 930, "atom1_serNum": 7634, "atom2_serNum": 7653, "donAcc_type": "standard", "distance": 3.218, "atom1_id": "///B/359/O", "atom2_id": "///B/362/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 931, "atom1_serNum": 7634, "atom2_serNum": 7667, "donAcc_type": "standard", "distance": 2.690, "atom1_id": "///B/359/O", "atom2_id": "///B/364/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 932, "atom1_serNum": 7647, "atom2_serNum": 7683, "donAcc_type": "standard", "distance": 2.602, "atom1_id": "///B/361/O", "atom2_id": "///B/365/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 933, "atom1_serNum": 7656, "atom2_serNum": 7675, "donAcc_type": "standard", "distance": 2.946, "atom1_id": "///B/362/O", "atom2_id": "///B/365/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 934, "atom1_serNum": 7663, "atom2_serNum": 7684, "donAcc_type": "standard", "distance": 2.888, "atom1_id": "///B/363/O", "atom2_id": "///B/366/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 935, "atom1_serNum": 7693, "atom2_serNum": 8765, "donAcc_type": "standard", "distance": 3.126, "atom1_id": "///B/367/N", "atom2_id": "///F/31/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 936, "atom1_serNum": 7707, "atom2_serNum": 7709, "donAcc_type": "standard", "distance": 2.946, "atom1_id": "///B/368/OD1", "atom2_id": "///B/369/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 937, "atom1_serNum": 7715, "atom2_serNum": 7736, "donAcc_type": "acceptable", "distance": 3.339, "atom1_id": "///B/369/OD1", "atom2_id": "///B/371/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 938, "atom1_serNum": 7716, "atom2_serNum": 7878, "donAcc_type": "standard", "distance": 2.536, "atom1_id": "///B/369/OD2", "atom2_id": "///B/391/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 939, "atom1_serNum": 7720, "atom2_serNum": 7744, "donAcc_type": "acceptable", "distance": 3.077, "atom1_id": "///B/370/O", "atom2_id": "///B/372/ND1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 940, "atom1_serNum": 7734, "atom2_serNum": 7874, "donAcc_type": "standard", "distance": 3.102, "atom1_id": "///B/371/O", "atom2_id": "///B/390/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 941, "atom1_serNum": 7736, "atom2_serNum": 7759, "donAcc_type": "acceptable", "distance": 3.040, "atom1_id": "///B/371/OG1", "atom2_id": "///B/373/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 942, "atom1_serNum": 7738, "atom2_serNum": 7744, "donAcc_type": "acceptable", "distance": 3.124, "atom1_id": "///B/372/N", "atom2_id": "///B/372/ND1", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 943, "atom1_serNum": 7748, "atom2_serNum": 7864, "donAcc_type": "standard", "distance": 3.019, "atom1_id": "///B/373/N", "atom2_id": "///B/388/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 944, "atom1_serNum": 7751, "atom2_serNum": 7861, "donAcc_type": "standard", "distance": 2.978, "atom1_id": "///B/373/O", "atom2_id": "///B/388/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 945, "atom1_serNum": 7767, "atom2_serNum": 7850, "donAcc_type": "standard", "distance": 3.280, "atom1_id": "///B/375/N", "atom2_id": "///B/386/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 946, "atom1_serNum": 7770, "atom2_serNum": 7846, "donAcc_type": "standard", "distance": 3.086, "atom1_id": "///B/375/O", "atom2_id": "///B/385/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 947, "atom1_serNum": 7776, "atom2_serNum": 7846, "donAcc_type": "standard", "distance": 3.699, "atom1_id": "///B/376/O", "atom2_id": "///B/385/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 948, "atom1_serNum": 7784, "atom2_serNum": 8021, "donAcc_type": "standard", "distance": 3.114, "atom1_id": "///B/377/O", "atom2_id": "///B/406/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 949, "atom1_serNum": 7791, "atom2_serNum": 7846, "donAcc_type": "standard", "distance": 3.600, "atom1_id": "///B/378/O", "atom2_id": "///B/385/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 950, "atom1_serNum": 7791, "atom2_serNum": 7847, "donAcc_type": "standard", "distance": 3.235, "atom1_id": "///B/378/O", "atom2_id": "///B/386/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 951, "atom1_serNum": 7801, "atom2_serNum": 7829, "donAcc_type": "standard", "distance": 2.895, "atom1_id": "///B/379/NE", "atom2_id": "///B/383/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 952, "atom1_serNum": 7804, "atom2_serNum": 7845, "donAcc_type": "standard", "distance": 3.658, "atom1_id": "///B/379/NH2", "atom2_id": "///B/385/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 953, "atom1_serNum": 7805, "atom2_serNum": 7833, "donAcc_type": "standard", "distance": 3.171, "atom1_id": "///B/380/N", "atom2_id": "///B/384/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 954, "atom1_serNum": 7808, "atom2_serNum": 7826, "donAcc_type": "standard", "distance": 3.021, "atom1_id": "///B/380/O", "atom2_id": "///B/383/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 955, "atom1_serNum": 7811, "atom2_serNum": 7987, "donAcc_type": "standard", "distance": 3.363, "atom1_id": "///B/380/OD1", "atom2_id": "///B/402/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 956, "atom1_serNum": 7811, "atom2_serNum": 7988, "donAcc_type": "standard", "distance": 2.579, "atom1_id": "///B/380/OD1", "atom2_id": "///B/402/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 957, "atom1_serNum": 7812, "atom2_serNum": 8996, "donAcc_type": "standard", "distance": 2.945, "atom1_id": "///B/380/ND2", "atom2_id": "///F/42/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 958, "atom1_serNum": 7818, "atom2_serNum": 7825, "donAcc_type": "standard", "distance": 2.546, "atom1_id": "///B/382/N", "atom2_id": "///B/382/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 959, "atom1_serNum": 7825, "atom2_serNum": 7826, "donAcc_type": "standard", "distance": 3.225, "atom1_id": "///B/382/OD2", "atom2_id": "///B/383/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 960, "atom1_serNum": 7877, "atom2_serNum": 7896, "donAcc_type": "standard", "distance": 3.017, "atom1_id": "///B/390/O", "atom2_id": "///B/393/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 961, "atom1_serNum": 7877, "atom2_serNum": 7908, "donAcc_type": "standard", "distance": 2.654, "atom1_id": "///B/390/O", "atom2_id": "///B/394/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 962, "atom1_serNum": 7881, "atom2_serNum": 7922, "donAcc_type": "standard", "distance": 2.960, "atom1_id": "///B/391/O", "atom2_id": "///B/395/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 963, "atom1_serNum": 7899, "atom2_serNum": 7939, "donAcc_type": "standard", "distance": 3.053, "atom1_id": "///B/393/O", "atom2_id": "///B/397/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 964, "atom1_serNum": 7907, "atom2_serNum": 8729, "donAcc_type": "acceptable", "distance": 3.152, "atom1_id": "///B/393/OH", "atom2_id": "///F/29/O2'", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 965, "atom1_serNum": 7911, "atom2_serNum": 7949, "donAcc_type": "standard", "distance": 3.330, "atom1_id": "///B/394/O", "atom2_id": "///B/398/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 966, "atom1_serNum": 7934, "atom2_serNum": 7957, "donAcc_type": "standard", "distance": 2.757, "atom1_id": "///B/396/O", "atom2_id": "///B/399/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 967, "atom1_serNum": 7934, "atom2_serNum": 7961, "donAcc_type": "standard", "distance": 2.981, "atom1_id": "///B/396/O", "atom2_id": "///B/400/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 968, "atom1_serNum": 7942, "atom2_serNum": 7961, "donAcc_type": "standard", "distance": 2.884, "atom1_id": "///B/397/O", "atom2_id": "///B/400/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 969, "atom1_serNum": 7942, "atom2_serNum": 7966, "donAcc_type": "acceptable", "distance": 2.928, "atom1_id": "///B/397/O", "atom2_id": "///B/400/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 970, "atom1_serNum": 7945, "atom2_serNum": 9019, "donAcc_type": "acceptable", "distance": 2.820, "atom1_id": "///B/397/ND1", "atom2_id": "///F/43/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 971, "atom1_serNum": 7964, "atom2_serNum": 7999, "donAcc_type": "standard", "distance": 2.827, "atom1_id": "///B/400/O", "atom2_id": "///B/404/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 972, "atom1_serNum": 7966, "atom2_serNum": 7989, "donAcc_type": "acceptable", "distance": 3.165, "atom1_id": "///B/400/OG", "atom2_id": "///B/403/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 973, "atom1_serNum": 7966, "atom2_serNum": 9019, "donAcc_type": "acceptable", "distance": 2.822, "atom1_id": "///B/400/OG", "atom2_id": "///F/43/OP1", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 974, "atom1_serNum": 7967, "atom2_serNum": 9039, "donAcc_type": "standard", "distance": 2.844, "atom1_id": "///B/401/N", "atom2_id": "///F/44/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 975, "atom1_serNum": 7970, "atom2_serNum": 8008, "donAcc_type": "standard", "distance": 2.590, "atom1_id": "///B/401/O", "atom2_id": "///B/405/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 976, "atom1_serNum": 7974, "atom2_serNum": 9078, "donAcc_type": "questionable", "distance": 3.369, "atom1_id": "///B/401/NE", "atom2_id": "///F/45/N2", "atom_pair": "N:N", "residue_pair": "aa:nt" }, { "index": 977, "atom1_serNum": 7977, "atom2_serNum": 9083, "donAcc_type": "standard", "distance": 3.536, "atom1_id": "///B/401/NH2", "atom2_id": "///F/46/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 978, "atom1_serNum": 7981, "atom2_serNum": 8014, "donAcc_type": "standard", "distance": 2.958, "atom1_id": "///B/402/O", "atom2_id": "///B/406/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 979, "atom1_serNum": 7987, "atom2_serNum": 8996, "donAcc_type": "standard", "distance": 3.581, "atom1_id": "///B/402/NH1", "atom2_id": "///F/42/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 980, "atom1_serNum": 7987, "atom2_serNum": 9020, "donAcc_type": "standard", "distance": 3.213, "atom1_id": "///B/402/NH1", "atom2_id": "///F/43/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 981, "atom1_serNum": 7992, "atom2_serNum": 8022, "donAcc_type": "standard", "distance": 2.854, "atom1_id": "///B/403/O", "atom2_id": "///B/407/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 982, "atom1_serNum": 8002, "atom2_serNum": 8030, "donAcc_type": "standard", "distance": 3.027, "atom1_id": "///B/404/O", "atom2_id": "///B/408/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 983, "atom1_serNum": 8011, "atom2_serNum": 8030, "donAcc_type": "standard", "distance": 2.876, "atom1_id": "///B/405/O", "atom2_id": "///B/408/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 984, "atom1_serNum": 8011, "atom2_serNum": 8039, "donAcc_type": "standard", "distance": 2.842, "atom1_id": "///B/405/O", "atom2_id": "///B/409/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 985, "atom1_serNum": 8017, "atom2_serNum": 8048, "donAcc_type": "standard", "distance": 3.057, "atom1_id": "///B/406/O", "atom2_id": "///B/409/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 986, "atom1_serNum": 8025, "atom2_serNum": 8058, "donAcc_type": "standard", "distance": 3.305, "atom1_id": "///B/407/O", "atom2_id": "///B/411/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 987, "atom1_serNum": 8025, "atom2_serNum": 8063, "donAcc_type": "acceptable", "distance": 3.086, "atom1_id": "///B/407/O", "atom2_id": "///B/411/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 988, "atom1_serNum": 8033, "atom2_serNum": 8065, "donAcc_type": "standard", "distance": 2.674, "atom1_id": "///B/408/O", "atom2_id": "///B/412/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 989, "atom1_serNum": 8048, "atom2_serNum": 8056, "donAcc_type": "standard", "distance": 3.037, "atom1_id": "///B/409/NH1", "atom2_id": "///B/410/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 990, "atom1_serNum": 8053, "atom2_serNum": 8085, "donAcc_type": "standard", "distance": 3.156, "atom1_id": "///B/410/O", "atom2_id": "///B/414/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 991, "atom1_serNum": 8075, "atom2_serNum": 8528, "donAcc_type": "standard", "distance": 2.797, "atom1_id": "///B/412/NH2", "atom2_id": "///F/20/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 992, "atom1_serNum": 8079, "atom2_serNum": 8098, "donAcc_type": "standard", "distance": 3.492, "atom1_id": "///B/413/O", "atom2_id": "///B/416/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 993, "atom1_serNum": 8088, "atom2_serNum": 8109, "donAcc_type": "standard", "distance": 2.995, "atom1_id": "///B/414/O", "atom2_id": "///B/417/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 994, "atom1_serNum": 8112, "atom2_serNum": 8150, "donAcc_type": "standard", "distance": 2.924, "atom1_id": "///B/417/O", "atom2_id": "///B/421/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 995, "atom1_serNum": 8116, "atom2_serNum": 8149, "donAcc_type": "standard", "distance": 2.980, "atom1_id": "///B/417/OE1", "atom2_id": "///B/420/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 996, "atom1_serNum": 8171, "atom2_serNum": 8184, "donAcc_type": "acceptable", "distance": 2.647, "atom1_id": "///F/2/O2'", "atom2_id": "///F/3/O5'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 997, "atom1_serNum": 8196, "atom2_serNum": 9606, "donAcc_type": "standard", "distance": 3.265, "atom1_id": "///F/3/N3", "atom2_id": "///F/70/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 998, "atom1_serNum": 8215, "atom2_serNum": 9585, "donAcc_type": "standard", "distance": 3.700, "atom1_id": "///F/4/O2", "atom2_id": "///F/69/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 999, "atom1_serNum": 8216, "atom2_serNum": 9583, "donAcc_type": "standard", "distance": 3.625, "atom1_id": "///F/4/N3", "atom2_id": "///F/69/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1000, "atom1_serNum": 8218, "atom2_serNum": 9582, "donAcc_type": "standard", "distance": 3.410, "atom1_id": "///F/4/N4", "atom2_id": "///F/69/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1001, "atom1_serNum": 8238, "atom2_serNum": 9562, "donAcc_type": "standard", "distance": 2.903, "atom1_id": "///F/5/O6", "atom2_id": "///F/68/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1002, "atom1_serNum": 8239, "atom2_serNum": 9560, "donAcc_type": "standard", "distance": 3.007, "atom1_id": "///F/5/N1", "atom2_id": "///F/68/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1003, "atom1_serNum": 8241, "atom2_serNum": 9559, "donAcc_type": "standard", "distance": 2.980, "atom1_id": "///F/5/N2", "atom2_id": "///F/68/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1004, "atom1_serNum": 8254, "atom2_serNum": 8270, "donAcc_type": "acceptable", "distance": 3.009, "atom1_id": "///F/6/O2'", "atom2_id": "///F/7/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 1005, "atom1_serNum": 8258, "atom2_serNum": 9540, "donAcc_type": "standard", "distance": 2.899, "atom1_id": "///F/6/O2", "atom2_id": "///F/67/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1006, "atom1_serNum": 8281, "atom2_serNum": 9496, "donAcc_type": "standard", "distance": 2.735, "atom1_id": "///F/7/N6", "atom2_id": "///F/65/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1007, "atom1_serNum": 8281, "atom2_serNum": 9519, "donAcc_type": "standard", "distance": 3.077, "atom1_id": "///F/7/N6", "atom2_id": "///F/66/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1008, "atom1_serNum": 8282, "atom2_serNum": 9517, "donAcc_type": "standard", "distance": 2.898, "atom1_id": "///F/7/N1", "atom2_id": "///F/66/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1009, "atom1_serNum": 8292, "atom2_serNum": 9134, "donAcc_type": "acceptable", "distance": 3.403, "atom1_id": "///F/8/O4'", "atom2_id": "///F/48/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 1010, "atom1_serNum": 8296, "atom2_serNum": 8563, "donAcc_type": "acceptable", "distance": 3.227, "atom1_id": "///F/8/O2'", "atom2_id": "///F/21/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1011, "atom1_serNum": 8296, "atom2_serNum": 8564, "donAcc_type": "acceptable", "distance": 3.201, "atom1_id": "///F/8/O2'", "atom2_id": "///F/21/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1012, "atom1_serNum": 8301, "atom2_serNum": 8429, "donAcc_type": "standard", "distance": 2.910, "atom1_id": "///F/8/N3", "atom2_id": "///F/14/N7", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1013, "atom1_serNum": 8316, "atom2_serNum": 9087, "donAcc_type": "acceptable", "distance": 2.678, "atom1_id": "///F/9/O2'", "atom2_id": "///F/46/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 1014, "atom1_serNum": 8320, "atom2_serNum": 8608, "donAcc_type": "standard", "distance": 3.420, "atom1_id": "///F/9/N7", "atom2_id": "///F/23/N4", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1015, "atom1_serNum": 8323, "atom2_serNum": 8608, "donAcc_type": "standard", "distance": 2.925, "atom1_id": "///F/9/O6", "atom2_id": "///F/23/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1016, "atom1_serNum": 8346, "atom2_serNum": 8651, "donAcc_type": "standard", "distance": 3.138, "atom1_id": "///F/10/O6", "atom2_id": "///F/25/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1017, "atom1_serNum": 8346, "atom2_serNum": 9072, "donAcc_type": "questionable", "distance": 3.625, "atom1_id": "///F/10/O6", "atom2_id": "///F/45/N7", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1018, "atom1_serNum": 8347, "atom2_serNum": 8649, "donAcc_type": "standard", "distance": 2.982, "atom1_id": "///F/10/N1", "atom2_id": "///F/25/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1019, "atom1_serNum": 8349, "atom2_serNum": 8648, "donAcc_type": "standard", "distance": 2.790, "atom1_id": "///F/10/N2", "atom2_id": "///F/25/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1020, "atom1_serNum": 8366, "atom2_serNum": 8631, "donAcc_type": "standard", "distance": 2.913, "atom1_id": "///F/11/O2", "atom2_id": "///F/24/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1021, "atom1_serNum": 8367, "atom2_serNum": 8629, "donAcc_type": "standard", "distance": 3.026, "atom1_id": "///F/11/N3", "atom2_id": "///F/24/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1022, "atom1_serNum": 8369, "atom2_serNum": 8628, "donAcc_type": "standard", "distance": 3.047, "atom1_id": "///F/11/N4", "atom2_id": "///F/24/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1023, "atom1_serNum": 8389, "atom2_serNum": 8608, "donAcc_type": "standard", "distance": 3.157, "atom1_id": "///F/12/O6", "atom2_id": "///F/23/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1024, "atom1_serNum": 8390, "atom2_serNum": 8606, "donAcc_type": "standard", "distance": 3.014, "atom1_id": "///F/12/N1", "atom2_id": "///F/23/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1025, "atom1_serNum": 8392, "atom2_serNum": 8605, "donAcc_type": "standard", "distance": 2.783, "atom1_id": "///F/12/N2", "atom2_id": "///F/23/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1026, "atom1_serNum": 8409, "atom2_serNum": 8588, "donAcc_type": "standard", "distance": 2.917, "atom1_id": "///F/13/O2", "atom2_id": "///F/22/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1027, "atom1_serNum": 8410, "atom2_serNum": 8586, "donAcc_type": "standard", "distance": 2.877, "atom1_id": "///F/13/N3", "atom2_id": "///F/22/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1028, "atom1_serNum": 8412, "atom2_serNum": 8585, "donAcc_type": "standard", "distance": 2.876, "atom1_id": "///F/13/N4", "atom2_id": "///F/22/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1029, "atom1_serNum": 8432, "atom2_serNum": 8566, "donAcc_type": "standard", "distance": 3.444, "atom1_id": "///F/14/N6", "atom2_id": "///F/21/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1030, "atom1_serNum": 8457, "atom2_serNum": 8566, "donAcc_type": "standard", "distance": 2.899, "atom1_id": "///F/15/N2", "atom2_id": "///F/21/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1031, "atom1_serNum": 8457, "atom2_serNum": 9138, "donAcc_type": "standard", "distance": 3.273, "atom1_id": "///F/15/N2", "atom2_id": "///F/48/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1032, "atom1_serNum": 8457, "atom2_serNum": 9368, "donAcc_type": "standard", "distance": 3.052, "atom1_id": "///F/15/N2", "atom2_id": "///F/59/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1033, "atom1_serNum": 8470, "atom2_serNum": 8488, "donAcc_type": "acceptable", "distance": 3.478, "atom1_id": "///F/16/O2'", "atom2_id": "///F/18/O3'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 1034, "atom1_serNum": 8470, "atom2_serNum": 8504, "donAcc_type": "acceptable", "distance": 2.539, "atom1_id": "///F/16/O2'", "atom2_id": "///F/19/OP1", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 1035, "atom1_serNum": 8475, "atom2_serNum": 9368, "donAcc_type": "standard", "distance": 2.807, "atom1_id": "///F/16/N3", "atom2_id": "///F/59/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1036, "atom1_serNum": 8477, "atom2_serNum": 9368, "donAcc_type": "questionable", "distance": 2.524, "atom1_id": "///F/16/O4", "atom2_id": "///F/59/O2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 1037, "atom1_serNum": 8490, "atom2_serNum": 8506, "donAcc_type": "acceptable", "distance": 2.641, "atom1_id": "///F/18/O2'", "atom2_id": "///F/19/O5'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 1038, "atom1_serNum": 8490, "atom2_serNum": 9329, "donAcc_type": "acceptable", "distance": 2.448, "atom1_id": "///F/18/O2'", "atom2_id": "///F/57/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1039, "atom1_serNum": 8498, "atom2_serNum": 9283, "donAcc_type": "standard", "distance": 3.066, "atom1_id": "///F/18/N1", "atom2_id": "///F/55/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1040, "atom1_serNum": 8500, "atom2_serNum": 9283, "donAcc_type": "standard", "distance": 3.055, "atom1_id": "///F/18/N2", "atom2_id": "///F/55/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1041, "atom1_serNum": 8513, "atom2_serNum": 8529, "donAcc_type": "acceptable", "distance": 3.176, "atom1_id": "///F/19/O2'", "atom2_id": "///F/20/O5'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 1042, "atom1_serNum": 8523, "atom2_serNum": 9303, "donAcc_type": "standard", "distance": 3.006, "atom1_id": "///F/19/N2", "atom2_id": "///F/56/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1043, "atom1_serNum": 8523, "atom2_serNum": 9304, "donAcc_type": "standard", "distance": 2.653, "atom1_id": "///F/19/N2", "atom2_id": "///F/56/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1044, "atom1_serNum": 8536, "atom2_serNum": 9141, "donAcc_type": "acceptable", "distance": 2.999, "atom1_id": "///F/20/O2'", "atom2_id": "///F/48/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1045, "atom1_serNum": 8540, "atom2_serNum": 9355, "donAcc_type": "questionable", "distance": 3.335, "atom1_id": "///F/20/O2", "atom2_id": "///F/59/OP1", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 1046, "atom1_serNum": 8582, "atom2_serNum": 9099, "donAcc_type": "standard", "distance": 3.285, "atom1_id": "///F/22/N7", "atom2_id": "///F/46/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1047, "atom1_serNum": 8582, "atom2_serNum": 9101, "donAcc_type": "standard", "distance": 3.273, "atom1_id": "///F/22/N7", "atom2_id": "///F/46/N2", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1048, "atom1_serNum": 8585, "atom2_serNum": 9101, "donAcc_type": "standard", "distance": 3.339, "atom1_id": "///F/22/O6", "atom2_id": "///F/46/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1049, "atom1_serNum": 8601, "atom2_serNum": 8617, "donAcc_type": "acceptable", "distance": 3.185, "atom1_id": "///F/23/O2'", "atom2_id": "///F/24/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 1050, "atom1_serNum": 8671, "atom2_serNum": 9055, "donAcc_type": "standard", "distance": 2.896, "atom1_id": "///F/26/N6", "atom2_id": "///F/44/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1051, "atom1_serNum": 8694, "atom2_serNum": 9033, "donAcc_type": "questionable", "distance": 3.236, "atom1_id": "///F/27/N1", "atom2_id": "///F/43/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1052, "atom1_serNum": 8696, "atom2_serNum": 9032, "donAcc_type": "standard", "distance": 2.842, "atom1_id": "///F/27/N2", "atom2_id": "///F/43/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1053, "atom1_serNum": 8713, "atom2_serNum": 9015, "donAcc_type": "standard", "distance": 2.886, "atom1_id": "///F/28/O2", "atom2_id": "///F/42/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1054, "atom1_serNum": 8714, "atom2_serNum": 9013, "donAcc_type": "standard", "distance": 3.027, "atom1_id": "///F/28/N3", "atom2_id": "///F/42/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1055, "atom1_serNum": 8716, "atom2_serNum": 9012, "donAcc_type": "standard", "distance": 3.160, "atom1_id": "///F/28/N4", "atom2_id": "///F/42/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1056, "atom1_serNum": 8729, "atom2_serNum": 8747, "donAcc_type": "acceptable", "distance": 3.131, "atom1_id": "///F/29/O2'", "atom2_id": "///F/30/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 1057, "atom1_serNum": 8736, "atom2_serNum": 8992, "donAcc_type": "standard", "distance": 3.385, "atom1_id": "///F/29/N6", "atom2_id": "///F/41/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1058, "atom1_serNum": 8737, "atom2_serNum": 8990, "donAcc_type": "standard", "distance": 2.868, "atom1_id": "///F/29/N1", "atom2_id": "///F/41/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1059, "atom1_serNum": 8758, "atom2_serNum": 8972, "donAcc_type": "standard", "distance": 3.288, "atom1_id": "///F/30/O6", "atom2_id": "///F/40/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1060, "atom1_serNum": 8759, "atom2_serNum": 8970, "donAcc_type": "standard", "distance": 3.100, "atom1_id": "///F/30/N1", "atom2_id": "///F/40/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1061, "atom1_serNum": 8761, "atom2_serNum": 8969, "donAcc_type": "standard", "distance": 2.764, "atom1_id": "///F/30/N2", "atom2_id": "///F/40/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1062, "atom1_serNum": 8781, "atom2_serNum": 8952, "donAcc_type": "standard", "distance": 3.105, "atom1_id": "///F/31/N6", "atom2_id": "///F/39/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1063, "atom1_serNum": 8782, "atom2_serNum": 8950, "donAcc_type": "standard", "distance": 2.882, "atom1_id": "///F/31/N1", "atom2_id": "///F/39/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1064, "atom1_serNum": 8796, "atom2_serNum": 8887, "donAcc_type": "acceptable", "distance": 2.470, "atom1_id": "///F/32/O2'", "atom2_id": "///F/36/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1065, "atom1_serNum": 8800, "atom2_serNum": 8930, "donAcc_type": "standard", "distance": 2.916, "atom1_id": "///F/32/O2", "atom2_id": "///F/38/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1066, "atom1_serNum": 8807, "atom2_serNum": 8886, "donAcc_type": "standard", "distance": 2.636, "atom1_id": "///F/33/OP1", "atom2_id": "///F/36/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1067, "atom1_serNum": 8816, "atom2_serNum": 8827, "donAcc_type": "acceptable", "distance": 2.524, "atom1_id": "///F/33/O2'", "atom2_id": "///F/34/OP1", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 1068, "atom1_serNum": 8851, "atom2_serNum": 8883, "donAcc_type": "questionable", "distance": 2.995, "atom1_id": "///F/35/OP2", "atom2_id": "///F/36/N7", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1069, "atom1_serNum": 8879, "atom2_serNum": 8889, "donAcc_type": "acceptable", "distance": 3.010, "atom1_id": "///F/36/O2'", "atom2_id": "///F/36/N3", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1070, "atom1_serNum": 8901, "atom2_serNum": 8914, "donAcc_type": "acceptable", "distance": 2.962, "atom1_id": "///F/37/O2'", "atom2_id": "///F/38/OP1", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 1071, "atom1_serNum": 8945, "atom2_serNum": 8961, "donAcc_type": "acceptable", "distance": 2.777, "atom1_id": "///F/39/O2'", "atom2_id": "///F/40/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 1072, "atom1_serNum": 8985, "atom2_serNum": 9001, "donAcc_type": "acceptable", "distance": 3.000, "atom1_id": "///F/41/O2'", "atom2_id": "///F/42/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 1073, "atom1_serNum": 9028, "atom2_serNum": 9041, "donAcc_type": "acceptable", "distance": 2.944, "atom1_id": "///F/43/O2'", "atom2_id": "///F/44/O5'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 1074, "atom1_serNum": 9028, "atom2_serNum": 9044, "donAcc_type": "acceptable", "distance": 2.762, "atom1_id": "///F/43/O2'", "atom2_id": "///F/44/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 1075, "atom1_serNum": 9091, "atom2_serNum": 9105, "donAcc_type": "acceptable", "distance": 2.498, "atom1_id": "///F/46/O2'", "atom2_id": "///F/47/OP1", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 1076, "atom1_serNum": 9134, "atom2_serNum": 9364, "donAcc_type": "acceptable", "distance": 3.610, "atom1_id": "///F/48/O2'", "atom2_id": "///F/59/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 1077, "atom1_serNum": 9158, "atom2_serNum": 9499, "donAcc_type": "standard", "distance": 2.899, "atom1_id": "///F/49/O2", "atom2_id": "///F/65/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1078, "atom1_serNum": 9159, "atom2_serNum": 9497, "donAcc_type": "standard", "distance": 2.887, "atom1_id": "///F/49/N3", "atom2_id": "///F/65/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1079, "atom1_serNum": 9161, "atom2_serNum": 9496, "donAcc_type": "standard", "distance": 2.990, "atom1_id": "///F/49/N4", "atom2_id": "///F/65/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1080, "atom1_serNum": 9179, "atom2_serNum": 9475, "donAcc_type": "standard", "distance": 3.775, "atom1_id": "///F/50/N3", "atom2_id": "///F/64/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1081, "atom1_serNum": 9181, "atom2_serNum": 9474, "donAcc_type": "standard", "distance": 3.288, "atom1_id": "///F/50/O4", "atom2_id": "///F/64/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1082, "atom1_serNum": 9194, "atom2_serNum": 9210, "donAcc_type": "acceptable", "distance": 2.599, "atom1_id": "///F/51/O2'", "atom2_id": "///F/52/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 1083, "atom1_serNum": 9198, "atom2_serNum": 9454, "donAcc_type": "standard", "distance": 2.789, "atom1_id": "///F/51/O2", "atom2_id": "///F/63/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1084, "atom1_serNum": 9221, "atom2_serNum": 9431, "donAcc_type": "standard", "distance": 3.910, "atom1_id": "///F/52/N6", "atom2_id": "///F/62/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1085, "atom1_serNum": 9222, "atom2_serNum": 9429, "donAcc_type": "standard", "distance": 3.503, "atom1_id": "///F/52/N1", "atom2_id": "///F/62/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1086, "atom1_serNum": 9243, "atom2_serNum": 9411, "donAcc_type": "standard", "distance": 2.666, "atom1_id": "///F/53/O6", "atom2_id": "///F/61/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1087, "atom1_serNum": 9244, "atom2_serNum": 9409, "donAcc_type": "standard", "distance": 3.207, "atom1_id": "///F/53/N1", "atom2_id": "///F/61/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1088, "atom1_serNum": 9246, "atom2_serNum": 9408, "donAcc_type": "standard", "distance": 3.627, "atom1_id": "///F/53/N2", "atom2_id": "///F/61/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1089, "atom1_serNum": 9264, "atom2_serNum": 9349, "donAcc_type": "questionable", "distance": 3.357, "atom1_id": "///F/54/N3", "atom2_id": "///F/58/N6", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1090, "atom1_serNum": 9266, "atom2_serNum": 9346, "donAcc_type": "questionable", "distance": 3.117, "atom1_id": "///F/54/O4", "atom2_id": "///F/58/N7", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1091, "atom1_serNum": 9266, "atom2_serNum": 9349, "donAcc_type": "standard", "distance": 3.516, "atom1_id": "///F/54/O4", "atom2_id": "///F/58/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1092, "atom1_serNum": 9279, "atom2_serNum": 9326, "donAcc_type": "acceptable", "distance": 2.614, "atom1_id": "///F/55/O2'", "atom2_id": "///F/57/O6", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 1093, "atom1_serNum": 9284, "atom2_serNum": 9334, "donAcc_type": "standard", "distance": 3.358, "atom1_id": "///F/55/N3", "atom2_id": "///F/58/OP2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1094, "atom1_serNum": 9286, "atom2_serNum": 9334, "donAcc_type": "questionable", "distance": 3.143, "atom1_id": "///F/55/O4", "atom2_id": "///F/58/OP2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 1095, "atom1_serNum": 9342, "atom2_serNum": 9355, "donAcc_type": "acceptable", "distance": 2.490, "atom1_id": "///F/58/O2'", "atom2_id": "///F/59/OP1", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 1096, "atom1_serNum": 9342, "atom2_serNum": 9357, "donAcc_type": "acceptable", "distance": 2.470, "atom1_id": "///F/58/O2'", "atom2_id": "///F/59/O5'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 1097, "atom1_serNum": 9376, "atom2_serNum": 9411, "donAcc_type": "standard", "distance": 3.985, "atom1_id": "///F/60/OP2", "atom2_id": "///F/61/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1098, "atom1_serNum": 9512, "atom2_serNum": 9528, "donAcc_type": "acceptable", "distance": 3.103, "atom1_id": "///F/66/O2'", "atom2_id": "///F/67/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 1099, "atom1_serNum": 9637, "atom2_serNum": 9641, "donAcc_type": "acceptable", "distance": 2.546, "atom1_id": "///A/422/O1A", "atom2_id": "///A/422/O1B", "atom_pair": "O:O", "residue_pair": "ligand:ligand" } ], "refCoords": { "purine": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 -0.5000 0.4000", " 3 N -2.2500 -0.5000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 1.2500 5.0000 0.4000", " 6 C 1.2500 -0.5000 0.4000", " 7 C 1.2500 -0.5000 -0.4000", " 8 C 1.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 -0.5000 0.4000", " 11 C -2.2500 -0.5000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ], "pyrimidine": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 1.0000 0.4000", " 3 N -2.2500 1.0000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 1.2500 5.0000 0.4000", " 6 C 1.2500 1.0000 0.4000", " 7 C 1.2500 1.0000 -0.4000", " 8 C 1.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 1.0000 0.4000", " 11 C -2.2500 1.0000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ], "wc_pair": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 -5.0000 0.4000", " 3 N -2.2500 -5.0000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 2.2500 5.0000 0.4000", " 6 C 2.2500 -5.0000 0.4000", " 7 C 2.2500 -5.0000 -0.4000", " 8 C 2.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 -5.0000 0.4000", " 11 C -2.2500 -5.0000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ] }, "metadata": { "license": "http://innovation.columbia.edu/technologies/CU20391", "url": "http://x3dna.org/", "url_alt": "http://home.x3dna.org/", "forum": "http://forum.x3dna.org/", "citation": "Lu et al. (2015). 'DSSR: an integrated software tool for dissecting the spatial structure of RNA.' Nucleic Acids Res., 43(21):e142 [doi:10.1093/nar/gkv716].", "str_id": "3epl", "num_aaChains": 2, "aaChains": "A=402,B=402", "num_naChains": 2, "naChains": "E=69,F=69", "num_atoms": 9775, "num_waters": 122, "num_metals": 6, "metals_desc": "Mg=4,Zn=2", "num_notes": 52, "notes": [ { "Aminors": "A-minor interactions (including types I and II)" }, { "Cstem_index": "stem index of the 'Canonical' helix in k-turn" }, { "Cstem_pair": "Cstem bp delineating the k-turn internal loop" }, { "Dp": "perpendicular distance of the 3' P atom to the glycosidic bond" }, { "GA_pair": "sheared G-A pair in k-turn" }, { "HtypePknot": "H-type pseudoknot" }, { "Kturn": "kink-turn (k-turn)" }, { "LW": "Leontis-Westhof" }, { "NCstem_index": "stem index of the 'Non-Canonical' helix in k-turn" }, { "NCstem_pair": "NCstem bp delineating the k-turn internal loop" }, { "Uturn": "U-turn of the UNR- or GNRA-type" }, { "aa": "amino acid" }, { "atom_pair": "symbols of the two atoms involved in an H-bond" }, { "auxfiles": "auxiliary files" }, { "glyco_bond": "conformation of base related to sugar (syn or anti)" }, { "bb_type": "backbone conformation, BI or BII" }, { "bending_angle": "angle between two helical axes" }, { "bp": "base pair" }, { "bseq": "base sequence in one-letter code" }, { "bulge": "bulge loop" }, { "coaxStacks": "coaxial stacking of stems within a helix" }, { "dbn": "dot bracket notation" }, { "desc": "description" }, { "donAcc_type": "donor/acceptor type of the atom pair in an H-bond" }, { "epsilon_zeta": "difference between epsilon and zeta torsion angles" }, { "hairpin": "hairpin loop" }, { "hbond": "hydrogen bond (H-bond)" }, { "helix": "defined by base-stacking interactions, regardless of bp type and backbone connectivity" }, { "id": "identifier" }, { "iloop": "internal loop" }, { "index": "serial number" }, { "isoCanonPairs": "isolated canonical pairs" }, { "junction": "(multi-branched) junction loop" }, { "kissingLoop": "kissing loop" }, { "multiplet": "3+ bases in a coplanar geometry" }, { "na": "nucleic acid" }, { "nonPair": "two nts not forming a pair, but with H-bonding/stacking interactions" }, { "nonStack": "nucleotide not involved in stacking interactions" }, { "nt": "nucleotide" }, { "num": "number" }, { "oArea": "overlap areas between two bases, including exocyclic atoms" }, { "oArea_ring": "overlap areas between two bases, including only ring atoms" }, { "phosContacts": "H-bonding and atom-capping interactions involving a phosphate" }, { "residue_pair": "types of the two residues involved in an H-bond" }, { "rmsd": "root-mean-squares deviation" }, { "serNum": "serial number" }, { "ssSegments": "single-stranded segments not involved in loops" }, { "ssZp": "Z-coordinate of the 3' phosphorus atom with reference to the 5' base plane" }, { "sstr": "secondary structure in dbn" }, { "stem": "helix consisting of only canonical pairs, with a continuous backbone" }, { "str_id": "structure identifier, derived from inpfile with extension removed" }, { "vert_dist": "vertical distance from an atom to a base plane" } ], "num_auxfiles": 18, "auxfiles": [ { "index": 1, "name": "dssr-pairs.pdb", "desc": "an ensemble of base pairs" }, { "index": 2, "name": "dssr-multiplets.pdb", "desc": "an ensemble of multiplets" }, { "index": 3, "name": "dssr-stems.pdb", "desc": "an ensemble of stems" }, { "index": 4, "name": "dssr-helices.pdb", "desc": "an ensemble of helices (coaxial stacking)" }, { "index": 5, "name": "dssr-hairpins.pdb", "desc": "an ensemble of hairpin loops" }, { "index": 6, "name": "dssr-iloops.pdb", "desc": "an ensemble of internal loops" }, { "index": 7, "name": "dssr-junctions.pdb", "desc": "an ensemble of junctions (multi-branch)" }, { "index": 8, "name": "dssr-2ndstrs.bpseq", "desc": "secondary structure in bpseq format" }, { "index": 9, "name": "dssr-2ndstrs.ct", "desc": "secondary structure in connectivity table format" }, { "index": 10, "name": "dssr-2ndstrs.dbn", "desc": "secondary structure in dot-bracket notation" }, { "index": 11, "name": "dssr-torsions.txt", "desc": "backbone torsion angles and suite names" }, { "index": 12, "name": "dssr-splays.pdb", "desc": "an ensemble of splayed-apart units" }, { "index": 13, "name": "dssr-stacks.pdb", "desc": "an ensemble of base stacks" }, { "index": 14, "name": "dssr-atom2bases.pdb", "desc": "an ensemble of atom-base stacking interactions" }, { "index": 15, "name": "dssr-rotmat.txt", "desc": "position vector and rotation matrix" }, { "index": 16, "name": "dssr-viewV.pdb", "desc": "vertical view of the principal moment of inertia" }, { "index": 17, "name": "dssr-viewH.pdb", "desc": "horizontal view of the principal moment of inertia" }, { "index": 18, "name": "dssr-viewT.pdb", "desc": "top view of the principal moment of inertia" } ], "time_used": "999" } }