{ "num_pairs": 140, "pairs": [ { "index": 1, "nt1": "///A/1", "nt2": "///A/72", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": 169.236, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 44.613, "chi2": -89.964, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 52.554, "C1C1_dist": 10.842, "N1N9_dist": 8.906, "C6C8_dist": 9.569, "CNNC_torsion": 24.884, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.79],N1(imino)-N3[3.02],N2(amino)-O2(carbonyl)[3.56]", "interBase_angle": 39.300, "planarity": 0.537, "simple_Shear": -0.330, "simple_Stretch": -0.079, "simple_Buckle": -29.121, "simple_Propeller": 26.391, "bp_simpleParams": [ -0.330, -0.079, -0.586, -29.121, 26.391, -12.081 ], "bp_params": [ -0.325, -0.099, -0.586, -30.703, 24.532, -11.943 ], "frame": { "rmsd": null, "origin": [ -14.320, -7.436, -35.121 ], "x_axis": [ -0.491, 0.773, 0.402 ], "y_axis": [ -0.320, 0.269, -0.908 ], "z_axis": [ -0.810, -0.575, 0.115 ], "quaternion": [ -0.473, 0.176, 0.641, -0.578 ] } }, { "index": 2, "nt1": "///A/2", "nt2": "///A/71", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -154.323, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 53.658, "chi2": -164.028, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 57.483, "C1C1_dist": 10.465, "N1N9_dist": 8.811, "C6C8_dist": 9.796, "CNNC_torsion": -5.146, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.55],N3-N1(imino)[2.76],N4(amino)-O6(carbonyl)[2.85]", "interBase_angle": 11.863, "planarity": 0.149, "simple_Shear": -0.293, "simple_Stretch": -0.193, "simple_Buckle": -10.569, "simple_Propeller": -5.387, "bp_simpleParams": [ -0.293, -0.193, 0.370, -10.569, -5.387, 2.013 ], "bp_params": [ -0.287, -0.202, 0.370, -10.399, -5.707, 2.008 ], "frame": { "rmsd": null, "origin": [ -17.368, -8.462, -33.429 ], "x_axis": [ -0.075, 0.970, -0.231 ], "y_axis": [ 0.110, -0.222, -0.969 ], "z_axis": [ -0.991, -0.098, -0.091 ], "quaternion": [ -0.391, 0.556, 0.486, -0.549 ] } }, { "index": 3, "nt1": "///A/3", "nt2": "///A/70", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -168.972, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 52.968, "chi2": -159.628, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 53.820, "C1C1_dist": 10.754, "N1N9_dist": 9.011, "C6C8_dist": 9.908, "CNNC_torsion": -9.117, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.89],N1(imino)-N3[2.92],N2(amino)-O2(carbonyl)[2.90]", "interBase_angle": 10.825, "planarity": 0.155, "simple_Shear": -0.077, "simple_Stretch": -0.135, "simple_Buckle": 0.671, "simple_Propeller": -10.804, "bp_simpleParams": [ -0.077, -0.135, 0.437, 0.671, -10.804, -2.541 ], "bp_params": [ -0.076, -0.135, 0.437, 0.702, -10.802, -2.553 ], "frame": { "rmsd": null, "origin": [ -20.451, -8.156, -32.519 ], "x_axis": [ 0.034, 0.739, -0.673 ], "y_axis": [ 0.133, -0.670, -0.730 ], "z_axis": [ -0.991, -0.065, -0.121 ], "quaternion": [ -0.246, 0.676, 0.323, -0.616 ] } }, { "index": 4, "nt1": "///A/4", "nt2": "///A/69", "bp": "G-U", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -175.267, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 42.791, "chi2": -162.520, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 68.511, "C1C1_dist": 10.442, "N1N9_dist": 8.844, "C6C8_dist": 9.770, "CNNC_torsion": -9.378, "hbonds_num": 2, "hbonds_desc": "O6(carbonyl)-N3(imino)[2.96],N1(imino)-O2(carbonyl)[2.81]", "interBase_angle": 11.678, "planarity": 0.151, "simple_Shear": -2.263, "simple_Stretch": 0.043, "simple_Buckle": 8.486, "simple_Propeller": -8.022, "bp_simpleParams": [ -2.263, 0.043, 0.650, 8.486, -8.022, 0.136 ], "bp_params": [ -2.215, -0.467, 0.650, 10.074, -5.906, 0.136 ], "frame": { "rmsd": null, "origin": [ -23.391, -6.718, -32.241 ], "x_axis": [ 0.245, 0.411, -0.878 ], "y_axis": [ 0.159, -0.911, -0.382 ], "z_axis": [ -0.956, -0.046, -0.288 ], "quaternion": [ -0.107, 0.782, 0.182, -0.587 ] } }, { "index": 5, "nt1": "///A/5", "nt2": "///A/68", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -160.873, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 57.447, "chi2": -161.748, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 58.168, "C1C1_dist": 10.255, "N1N9_dist": 8.701, "C6C8_dist": 9.736, "CNNC_torsion": -18.048, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.98],N1-N3(imino)[2.69]", "interBase_angle": 20.447, "planarity": 0.252, "simple_Shear": 0.115, "simple_Stretch": -0.202, "simple_Buckle": 6.623, "simple_Propeller": -19.344, "bp_simpleParams": [ 0.115, -0.202, 0.239, 6.623, -19.344, 3.645 ], "bp_params": [ 0.112, -0.203, 0.239, 6.336, -19.440, 3.692 ], "frame": { "rmsd": null, "origin": [ -26.604, -5.426, -33.011 ], "x_axis": [ 0.330, -0.319, -0.889 ], "y_axis": [ -0.104, -0.948, 0.301 ], "z_axis": [ -0.938, -0.007, -0.346 ], "quaternion": [ 0.095, 0.810, -0.130, -0.564 ] } }, { "index": 6, "nt1": "///A/6", "nt2": "///A/67", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -172.000, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 56.800, "chi2": -156.313, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 59.604, "C1C1_dist": 10.153, "N1N9_dist": 8.613, "C6C8_dist": 9.683, "CNNC_torsion": -18.184, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.62],O4(carbonyl)-N6(amino)[2.98]", "interBase_angle": 21.876, "planarity": 0.266, "simple_Shear": -0.496, "simple_Stretch": -0.226, "simple_Buckle": -10.161, "simple_Propeller": -19.373, "bp_simpleParams": [ -0.496, -0.226, 0.301, -10.161, -19.373, 5.470 ], "bp_params": [ -0.484, -0.250, 0.301, -9.162, -19.865, 5.536 ], "frame": { "rmsd": null, "origin": [ -29.312, -4.405, -35.633 ], "x_axis": [ 0.373, -0.724, -0.580 ], "y_axis": [ -0.277, -0.684, 0.675 ], "z_axis": [ -0.886, -0.091, -0.455 ], "quaternion": [ 0.242, 0.792, -0.316, -0.463 ] } }, { "index": 7, "nt1": "///A/7", "nt2": "///A/66", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -127.794, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 55.477, "chi2": -166.201, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 53.792, "C1C1_dist": 10.389, "N1N9_dist": 8.690, "C6C8_dist": 9.657, "CNNC_torsion": -1.964, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.64],O4(carbonyl)-N6(amino)[2.78]", "interBase_angle": 4.503, "planarity": 0.063, "simple_Shear": -0.060, "simple_Stretch": -0.286, "simple_Buckle": -2.651, "simple_Propeller": -3.639, "bp_simpleParams": [ -0.060, -0.286, -0.062, -2.651, -3.639, 1.456 ], "bp_params": [ -0.057, -0.287, -0.062, -2.612, -3.667, 1.456 ], "frame": { "rmsd": null, "origin": [ -31.509, -4.179, -38.126 ], "x_axis": [ 0.279, -0.960, -0.017 ], "y_axis": [ -0.511, -0.163, 0.844 ], "z_axis": [ -0.813, -0.227, -0.536 ], "quaternion": [ 0.381, 0.703, -0.523, -0.295 ] } }, { "index": 8, "nt1": "///A/8", "nt2": "///A/14", "bp": "U-A", "name": "rHoogsteen", "Saenger": "24-XXIV", "LW": "tWH", "DSSR": "tW-M", "intra_chain": true, "chi1": -159.597, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 29.666, "chi2": -175.315, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 19.672, "C1C1_dist": 9.651, "N1N9_dist": 7.108, "C6C8_dist": 6.083, "CNNC_torsion": 178.494, "hbonds_num": 2, "hbonds_desc": "O2(carbonyl)-N6(amino)[2.99],N3(imino)-N7[2.76]", "interBase_angle": 12.291, "planarity": 0.122, "simple_Shear": 4.294, "simple_Stretch": 1.461, "simple_Buckle": -11.621, "simple_Propeller": 4.004, "bp_simpleParams": [ 4.294, 1.461, 0.516, -11.621, 4.004, -101.017 ], "bp_params": [ 4.120, -1.898, 0.516, -5.678, 10.901, -101.202 ], "frame": { "rmsd": null, "origin": [ -46.301, -4.723, -27.106 ], "x_axis": [ 0.939, 0.300, -0.170 ], "y_axis": [ -0.274, 0.347, -0.897 ], "z_axis": [ -0.210, 0.889, 0.408 ], "quaternion": [ 0.821, -0.544, -0.012, 0.175 ] } }, { "index": 9, "nt1": "///A/8", "nt2": "///A/21", "bp": "U+A", "name": "--", "Saenger": "--", "LW": "tSW", "DSSR": "tm+W", "intra_chain": true, "chi1": -159.597, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 112.073, "chi2": -148.831, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 48.756, "C1C1_dist": 8.609, "N1N9_dist": 8.548, "C6C8_dist": 10.604, "CNNC_torsion": 157.178, "hbonds_num": 1, "hbonds_desc": "O2'(hydroxyl)-N1[2.61]", "interBase_angle": 18.394, "planarity": 0.240, "simple_Shear": 6.253, "simple_Stretch": 4.991, "simple_Buckle": -2.600, "simple_Propeller": -18.210, "bp_simpleParams": [ 6.253, 4.991, -0.024, -2.600, -18.210, -117.279 ], "bp_params": [ -1.289, -7.896, -0.024, -10.306, 15.236, -117.523 ], "frame": { "rmsd": null, "origin": [ -45.229, -2.575, -29.995 ], "x_axis": [ 0.884, 0.373, -0.280 ], "y_axis": [ -0.414, 0.349, -0.841 ], "z_axis": [ -0.216, 0.860, 0.463 ], "quaternion": [ 0.821, -0.518, 0.020, 0.240 ] } }, { "index": 10, "nt1": "///A/9", "nt2": "///A/23", "bp": "A+A", "name": "--", "Saenger": "02-II", "LW": "tHH", "DSSR": "tM+M", "intra_chain": true, "chi1": -68.228, "conf1": "--", "pucker1": "~C2'-endo", "lambda1": 14.593, "chi2": -161.501, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 10.663, "C1C1_dist": 10.901, "N1N9_dist": 8.059, "C6C8_dist": 6.150, "CNNC_torsion": 142.650, "hbonds_num": 3, "hbonds_desc": "N7-N6(amino)[2.73],N6(amino)-OP2[3.19],N6(amino)-N7[2.80]", "interBase_angle": 11.323, "planarity": 0.142, "simple_Shear": -7.828, "simple_Stretch": 0.276, "simple_Buckle": 7.537, "simple_Propeller": 8.450, "bp_simpleParams": [ -7.828, 0.276, -0.250, 7.537, 8.450, 178.794 ], "bp_params": [ 6.082, -4.937, -0.250, -11.106, -2.206, 178.788 ], "frame": { "rmsd": null, "origin": [ -47.603, 1.713, -25.633 ], "x_axis": [ -0.950, -0.309, 0.036 ], "y_axis": [ 0.195, -0.503, 0.842 ], "z_axis": [ -0.242, 0.807, 0.538 ], "quaternion": [ -0.146, -0.060, 0.477, 0.865 ] } }, { "index": 11, "nt1": "///A/10", "nt2": "///A/25", "bp": "g-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": 173.311, "conf1": "--", "pucker1": "~C3'-endo", "lambda1": 52.706, "chi2": -161.746, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 55.679, "C1C1_dist": 10.458, "N1N9_dist": 8.752, "C6C8_dist": 9.713, "CNNC_torsion": -8.076, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.77],N1(imino)-N3[2.71],N2(amino)-O2(carbonyl)[2.56]", "interBase_angle": 9.015, "planarity": 0.114, "simple_Shear": -0.217, "simple_Stretch": -0.307, "simple_Buckle": -4.438, "simple_Propeller": -7.847, "bp_simpleParams": [ -0.217, -0.307, -0.047, -4.438, -7.847, 1.085 ], "bp_params": [ -0.212, -0.310, -0.047, -4.317, -7.914, 1.087 ], "frame": { "rmsd": null, "origin": [ -45.905, 8.000, -23.981 ], "x_axis": [ -0.877, -0.357, -0.321 ], "y_axis": [ 0.198, 0.339, -0.920 ], "z_axis": [ 0.438, -0.870, -0.227 ], "quaternion": [ 0.243, -0.051, 0.782, -0.573 ] } }, { "index": 12, "nt1": "///A/10", "nt2": "///A/45", "bp": "g+G", "name": "--", "Saenger": "--", "LW": "cHS", "DSSR": "cM+m", "intra_chain": true, "chi1": 173.311, "conf1": "--", "pucker1": "~C3'-endo", "lambda1": 39.492, "chi2": -150.882, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 126.911, "C1C1_dist": 8.615, "N1N9_dist": 8.368, "C6C8_dist": 8.482, "CNNC_torsion": -2.993, "hbonds_num": 1, "hbonds_desc": "O6(carbonyl)-N2(amino)[2.95]", "interBase_angle": 27.250, "planarity": 0.431, "simple_Shear": -0.119, "simple_Stretch": 7.182, "simple_Buckle": -10.575, "simple_Propeller": -25.114, "bp_simpleParams": [ -0.119, 7.182, -1.033, -10.575, -25.114, 14.546 ], "bp_params": [ -7.141, -0.774, -1.033, 26.014, -8.114, 14.214 ], "frame": { "rmsd": null, "origin": [ -48.821, 6.380, -25.105 ], "x_axis": [ -0.894, -0.399, -0.206 ], "y_axis": [ -0.026, 0.503, -0.864 ], "z_axis": [ 0.448, -0.766, -0.460 ], "quaternion": [ 0.193, -0.126, 0.845, -0.482 ] } }, { "index": 13, "nt1": "///A/11", "nt2": "///A/24", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -161.334, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 56.393, "chi2": -158.166, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 56.149, "C1C1_dist": 10.355, "N1N9_dist": 8.737, "C6C8_dist": 9.767, "CNNC_torsion": -11.036, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.61],N3-N1(imino)[2.75],N4(amino)-O6(carbonyl)[3.00]", "interBase_angle": 19.845, "planarity": 0.258, "simple_Shear": 0.223, "simple_Stretch": -0.229, "simple_Buckle": -6.355, "simple_Propeller": -18.799, "bp_simpleParams": [ 0.223, -0.229, 0.193, -6.355, -18.799, 4.091 ], "bp_params": [ 0.218, -0.234, 0.193, -6.731, -18.668, 4.139 ], "frame": { "rmsd": null, "origin": [ -44.592, 4.715, -23.039 ], "x_axis": [ -0.606, 0.008, -0.795 ], "y_axis": [ 0.689, 0.504, -0.520 ], "z_axis": [ 0.397, -0.864, -0.311 ], "quaternion": [ 0.383, 0.224, 0.778, -0.445 ] } }, { "index": 14, "nt1": "///A/12", "nt2": "///A/23", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -160.139, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 53.517, "chi2": -161.501, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 52.530, "C1C1_dist": 10.670, "N1N9_dist": 8.908, "C6C8_dist": 9.793, "CNNC_torsion": -9.857, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.87],O4(carbonyl)-N6(amino)[2.88]", "interBase_angle": 10.123, "planarity": 0.122, "simple_Shear": -0.042, "simple_Stretch": -0.116, "simple_Buckle": -9.481, "simple_Propeller": -3.547, "bp_simpleParams": [ -0.042, -0.116, 0.426, -9.481, -3.547, -2.716 ], "bp_params": [ -0.041, -0.116, 0.426, -9.454, -3.619, -2.708 ], "frame": { "rmsd": null, "origin": [ -44.233, 1.304, -23.668 ], "x_axis": [ -0.192, 0.385, -0.903 ], "y_axis": [ 0.913, 0.408, -0.020 ], "z_axis": [ 0.361, -0.828, -0.429 ], "quaternion": [ 0.443, 0.455, 0.712, -0.298 ] } }, { "index": 15, "nt1": "///A/13", "nt2": "///A/22", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -168.256, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 55.202, "chi2": -176.664, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 54.616, "C1C1_dist": 10.633, "N1N9_dist": 8.951, "C6C8_dist": 9.923, "CNNC_torsion": -4.929, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.72],N3-N1(imino)[2.91],N4(amino)-O6(carbonyl)[3.01]", "interBase_angle": 6.000, "planarity": 0.070, "simple_Shear": 0.258, "simple_Stretch": -0.097, "simple_Buckle": 5.642, "simple_Propeller": -2.044, "bp_simpleParams": [ 0.258, -0.097, -0.083, 5.642, -2.044, 1.513 ], "bp_params": [ 0.256, -0.102, -0.083, 5.600, -2.156, 1.512 ], "frame": { "rmsd": null, "origin": [ -45.261, -0.803, -26.816 ], "x_axis": [ 0.248, 0.524, -0.815 ], "y_axis": [ 0.931, 0.103, 0.350 ], "z_axis": [ 0.267, -0.846, -0.462 ], "quaternion": [ 0.471, 0.634, 0.574, -0.216 ] } }, { "index": 16, "nt1": "///A/15", "nt2": "///A/48", "bp": "G+C", "name": "rWC", "Saenger": "22-XXII", "LW": "tWW", "DSSR": "tW+W", "intra_chain": true, "chi1": -166.857, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 37.363, "chi2": -143.043, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 61.012, "C1C1_dist": 10.434, "N1N9_dist": 8.834, "C6C8_dist": 10.356, "CNNC_torsion": -177.695, "hbonds_num": 2, "hbonds_desc": "N1(imino)-O2(carbonyl)[2.69],N2(amino)-N3[2.88]", "interBase_angle": 1.876, "planarity": 0.031, "simple_Shear": 3.674, "simple_Stretch": 1.356, "simple_Buckle": 1.085, "simple_Propeller": -1.530, "bp_simpleParams": [ 3.674, 1.356, 0.100, 1.085, -1.530, 152.091 ], "bp_params": [ 0.125, 3.914, 0.100, 1.826, 0.430, 152.087 ], "frame": { "rmsd": null, "origin": [ -46.460, -5.895, -32.339 ], "x_axis": [ 0.144, 0.541, -0.829 ], "y_axis": [ 0.950, 0.158, 0.268 ], "z_axis": [ 0.276, -0.826, -0.491 ], "quaternion": [ 0.450, 0.608, 0.613, -0.228 ] } }, { "index": 17, "nt1": "///A/18", "nt2": "///A/55", "bp": "G+P", "name": "--", "Saenger": "--", "LW": "tWS", "DSSR": "tW+m", "intra_chain": true, "chi1": -95.526, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 31.372, "chi2": -153.260, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 110.846, "C1C1_dist": 8.619, "N1N9_dist": 8.152, "C6C8_dist": 9.628, "CNNC_torsion": -131.728, "hbonds_num": 2, "hbonds_desc": "N1(imino)-O4(carbonyl)[2.80],N2(amino)-O4(carbonyl)[2.80]", "interBase_angle": 16.887, "planarity": 0.234, "simple_Shear": 4.319, "simple_Stretch": 3.798, "simple_Buckle": -11.206, "simple_Propeller": 12.632, "bp_simpleParams": [ 4.319, 3.798, -0.296, -11.206, 12.632, 93.314 ], "bp_params": [ -0.517, 5.729, -0.296, -16.812, -1.582, 92.701 ], "frame": { "rmsd": null, "origin": [ -49.064, -13.911, -45.546 ], "x_axis": [ 0.313, -0.324, -0.893 ], "y_axis": [ 0.148, -0.912, 0.383 ], "z_axis": [ -0.938, -0.252, -0.238 ], "quaternion": [ 0.202, 0.785, -0.056, -0.583 ] } }, { "index": 18, "nt1": "///A/19", "nt2": "///A/56", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -79.807, "conf1": "--", "pucker1": "~C2'-endo", "lambda1": 57.766, "chi2": -163.957, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 54.516, "C1C1_dist": 10.451, "N1N9_dist": 8.842, "C6C8_dist": 9.810, "CNNC_torsion": -31.882, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[3.12],N1(imino)-N3[2.94],N2(amino)-O2(carbonyl)[2.71]", "interBase_angle": 35.583, "planarity": 0.432, "simple_Shear": -0.340, "simple_Stretch": -0.003, "simple_Buckle": -25.102, "simple_Propeller": -25.220, "bp_simpleParams": [ -0.340, -0.003, 0.027, -25.102, -25.220, 2.452 ], "bp_params": [ -0.340, -0.005, 0.027, -24.980, -25.342, 2.457 ], "frame": { "rmsd": null, "origin": [ -56.286, -17.690, -41.951 ], "x_axis": [ 0.384, -0.869, 0.312 ], "y_axis": [ -0.097, 0.298, 0.949 ], "z_axis": [ -0.918, -0.395, 0.030 ], "quaternion": [ 0.654, 0.514, -0.470, -0.295 ] } }, { "index": 19, "nt1": "///A/22", "nt2": "///A/46", "bp": "G-g", "name": "--", "Saenger": "07-VII", "LW": "tHW", "DSSR": "tM-W", "intra_chain": true, "chi1": -176.664, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 31.165, "chi2": -63.456, "conf2": "--", "pucker2": "~C2'-endo", "lambda2": 29.056, "C1C1_dist": 11.218, "N1N9_dist": 8.818, "C6C8_dist": 7.600, "CNNC_torsion": -176.861, "hbonds_num": 2, "hbonds_desc": "N7-N1(imino)[2.82],O6(carbonyl)-N2(amino)[2.83]", "interBase_angle": 7.479, "planarity": 0.112, "simple_Shear": -3.905, "simple_Stretch": 3.906, "simple_Buckle": 7.023, "simple_Propeller": 2.569, "bp_simpleParams": [ -3.905, 3.906, -0.021, 7.023, 2.569, -114.506 ], "bp_params": [ -5.518, -0.249, -0.021, 2.842, 6.918, -114.585 ], "frame": { "rmsd": null, "origin": [ -47.165, -0.373, -28.616 ], "x_axis": [ -0.668, 0.213, -0.713 ], "y_axis": [ -0.683, -0.554, 0.475 ], "z_axis": [ -0.294, 0.805, 0.516 ], "quaternion": [ 0.271, -0.304, 0.387, 0.827 ] } }, { "index": 20, "nt1": "///A/26", "nt2": "///A/44", "bp": "g-A", "name": "Imino", "Saenger": "08-VIII", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -163.140, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 42.264, "chi2": -158.407, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 49.626, "C1C1_dist": 12.591, "N1N9_dist": 10.578, "C6C8_dist": 11.014, "CNNC_torsion": -30.654, "hbonds_num": 2, "hbonds_desc": "O6(carbonyl)-N6(amino)[2.91],N1(imino)-N1[2.84]", "interBase_angle": 41.496, "planarity": 0.547, "simple_Shear": -0.363, "simple_Stretch": 1.400, "simple_Buckle": 18.243, "simple_Propeller": -37.270, "bp_simpleParams": [ -0.363, 1.400, -0.386, 18.243, -37.270, -14.130 ], "bp_params": [ -0.451, 1.374, -0.386, 20.184, -36.256, -14.654 ], "frame": { "rmsd": null, "origin": [ -51.151, 9.331, -24.975 ], "x_axis": [ -0.435, -0.835, 0.335 ], "y_axis": [ 0.667, -0.049, 0.744 ], "z_axis": [ -0.605, 0.547, 0.578 ], "quaternion": [ 0.523, 0.094, -0.449, -0.718 ] } }, { "index": 21, "nt1": "///A/27", "nt2": "///A/43", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -163.320, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 51.850, "chi2": -159.837, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 52.375, "C1C1_dist": 10.603, "N1N9_dist": 8.809, "C6C8_dist": 9.680, "CNNC_torsion": -21.191, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.76],N3-N1(imino)[2.74],N4(amino)-O6(carbonyl)[2.75]", "interBase_angle": 22.116, "planarity": 0.272, "simple_Shear": 0.191, "simple_Stretch": -0.319, "simple_Buckle": 9.662, "simple_Propeller": -19.893, "bp_simpleParams": [ 0.191, -0.319, 0.236, 9.662, -19.893, -2.945 ], "bp_params": [ 0.188, -0.320, 0.236, 9.438, -20.001, -2.980 ], "frame": { "rmsd": null, "origin": [ -54.097, 10.304, -23.062 ], "x_axis": [ 0.149, -0.753, 0.641 ], "y_axis": [ 0.826, 0.451, 0.337 ], "z_axis": [ -0.543, 0.480, 0.689 ], "quaternion": [ 0.757, -0.047, -0.391, -0.522 ] } }, { "index": 22, "nt1": "///A/28", "nt2": "///A/42", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -162.563, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 53.651, "chi2": -170.120, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 55.936, "C1C1_dist": 10.445, "N1N9_dist": 8.759, "C6C8_dist": 9.681, "CNNC_torsion": -13.329, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.63],N3-N1(imino)[2.71],N4(amino)-O6(carbonyl)[2.69]", "interBase_angle": 10.504, "planarity": 0.181, "simple_Shear": 0.003, "simple_Stretch": -0.352, "simple_Buckle": 4.703, "simple_Propeller": -9.393, "bp_simpleParams": [ 0.003, -0.352, 0.471, 4.703, -9.393, -1.508 ], "bp_params": [ 0.005, -0.352, 0.471, 4.748, -9.370, -1.512 ], "frame": { "rmsd": null, "origin": [ -56.874, 10.765, -20.799 ], "x_axis": [ 0.661, -0.389, 0.642 ], "y_axis": [ 0.576, 0.811, -0.101 ], "z_axis": [ -0.481, 0.437, 0.760 ], "quaternion": [ 0.899, -0.150, -0.312, -0.268 ] } }, { "index": 23, "nt1": "///A/29", "nt2": "///A/41", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -164.691, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 61.857, "chi2": -155.829, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 62.769, "C1C1_dist": 10.072, "N1N9_dist": 8.710, "C6C8_dist": 9.942, "CNNC_torsion": -8.020, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.45],N1-N3(imino)[2.88]", "interBase_angle": 10.057, "planarity": 0.125, "simple_Shear": 0.062, "simple_Stretch": 0.059, "simple_Buckle": 5.082, "simple_Propeller": -8.678, "bp_simpleParams": [ 0.062, 0.059, 0.351, 5.082, -8.678, 12.005 ], "bp_params": [ 0.063, 0.058, 0.351, 4.983, -8.735, 12.028 ], "frame": { "rmsd": null, "origin": [ -58.659, 10.407, -17.784 ], "x_axis": [ 0.903, -0.048, 0.427 ], "y_axis": [ 0.213, 0.914, -0.347 ], "z_axis": [ -0.374, 0.404, 0.835 ], "quaternion": [ 0.955, -0.196, -0.210, -0.068 ] } }, { "index": 24, "nt1": "///A/30", "nt2": "///A/40", "bp": "G-c", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -157.235, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 57.222, "chi2": -176.299, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 48.535, "C1C1_dist": 10.713, "N1N9_dist": 8.958, "C6C8_dist": 9.846, "CNNC_torsion": -12.902, "hbonds_num": 4, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.77],N1(imino)-N3[2.82],N2(amino)-O2(carbonyl)[2.79],N2(amino)-N3[2.95]", "interBase_angle": 15.088, "planarity": 0.211, "simple_Shear": 0.785, "simple_Stretch": -0.148, "simple_Buckle": -3.449, "simple_Propeller": -14.689, "bp_simpleParams": [ 0.785, -0.148, -0.046, -3.449, -14.689, -1.756 ], "bp_params": [ 0.769, -0.215, -0.046, -4.675, -14.346, -1.769 ], "frame": { "rmsd": null, "origin": [ -60.374, 10.187, -14.132 ], "x_axis": [ 0.843, 0.536, 0.037 ], "y_axis": [ -0.453, 0.747, -0.487 ], "z_axis": [ -0.289, 0.394, 0.873 ], "quaternion": [ 0.930, -0.237, -0.088, 0.266 ] } }, { "index": 25, "nt1": "///A/31", "nt2": "///A/39", "bp": "A-P", "name": "--", "Saenger": "--", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -158.193, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 64.640, "chi2": -173.000, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 42.981, "C1C1_dist": 10.919, "N1N9_dist": 9.189, "C6C8_dist": 10.011, "CNNC_torsion": 0.917, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O2(carbonyl)[3.39],N1-N3(imino)[3.22]", "interBase_angle": 16.295, "planarity": 0.217, "simple_Shear": 2.060, "simple_Stretch": 0.307, "simple_Buckle": -2.722, "simple_Propeller": -16.066, "bp_simpleParams": [ 2.060, 0.307, 0.319, -2.722, -16.066, -5.177 ], "bp_params": [ 2.077, -0.148, 0.319, -6.137, -15.095, -5.215 ], "frame": { "rmsd": null, "origin": [ -60.130, 10.783, -10.807 ], "x_axis": [ 0.402, 0.835, -0.375 ], "y_axis": [ -0.894, 0.268, -0.360 ], "z_axis": [ -0.200, 0.480, 0.854 ], "quaternion": [ 0.794, -0.264, 0.055, 0.544 ] } }, { "index": 26, "nt1": "///A/32", "nt2": "///A/38", "bp": "c-A", "name": "--", "Saenger": "--", "LW": "..W", "DSSR": "..-W", "intra_chain": true, "chi1": -144.805, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 89.740, "chi2": -173.437, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 19.489, "C1C1_dist": 10.870, "N1N9_dist": 9.543, "C6C8_dist": 10.202, "CNNC_torsion": -15.760, "hbonds_num": 1, "hbonds_desc": "O2(carbonyl)-N6(amino)[2.81]", "interBase_angle": 4.031, "planarity": 0.161, "simple_Shear": 6.263, "simple_Stretch": 2.430, "simple_Buckle": 2.282, "simple_Propeller": 3.323, "bp_simpleParams": [ 6.263, 2.430, 0.746, 2.282, 3.323, -0.752 ], "bp_params": [ 6.406, -2.023, 0.746, 3.859, 1.165, -0.751 ], "frame": { "rmsd": null, "origin": [ -59.202, 12.800, -8.271 ], "x_axis": [ -0.375, 0.689, -0.620 ], "y_axis": [ -0.924, -0.333, 0.190 ], "z_axis": [ -0.076, 0.644, 0.761 ], "quaternion": [ 0.513, -0.221, 0.265, 0.786 ] } }, { "index": 27, "nt1": "///A/49", "nt2": "///A/65", "bp": "c-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -172.254, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 52.446, "chi2": -172.544, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 55.283, "C1C1_dist": 10.648, "N1N9_dist": 8.910, "C6C8_dist": 9.809, "CNNC_torsion": -3.186, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.76],N3-N1(imino)[2.79],N4(amino)-O6(carbonyl)[2.69]", "interBase_angle": 7.306, "planarity": 0.101, "simple_Shear": -0.104, "simple_Stretch": -0.228, "simple_Buckle": -0.907, "simple_Propeller": -7.250, "bp_simpleParams": [ -0.104, -0.228, 0.045, -0.907, -7.250, -2.182 ], "bp_params": [ -0.101, -0.230, 0.045, -0.804, -7.262, -2.187 ], "frame": { "rmsd": null, "origin": [ -33.012, -4.832, -41.646 ], "x_axis": [ -0.014, -0.872, 0.490 ], "y_axis": [ -0.603, 0.398, 0.691 ], "z_axis": [ -0.797, -0.286, -0.531 ], "quaternion": [ -0.462, -0.529, 0.697, 0.145 ] } }, { "index": 28, "nt1": "///A/50", "nt2": "///A/64", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -165.167, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 54.384, "chi2": -160.758, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 56.079, "C1C1_dist": 10.447, "N1N9_dist": 8.784, "C6C8_dist": 9.694, "CNNC_torsion": -7.980, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.73],O4(carbonyl)-N6(amino)[2.70]", "interBase_angle": 6.616, "planarity": 0.095, "simple_Shear": -0.135, "simple_Stretch": -0.245, "simple_Buckle": -3.306, "simple_Propeller": -5.731, "bp_simpleParams": [ -0.135, -0.245, 0.108, -3.306, -5.731, -2.428 ], "bp_params": [ -0.131, -0.247, 0.108, -3.205, -5.788, -2.430 ], "frame": { "rmsd": null, "origin": [ -34.318, -6.486, -44.966 ], "x_axis": [ -0.193, -0.524, 0.829 ], "y_axis": [ -0.528, 0.768, 0.363 ], "z_axis": [ -0.827, -0.368, -0.425 ], "quaternion": [ 0.536, 0.341, -0.772, 0.002 ] } }, { "index": 29, "nt1": "///A/51", "nt2": "///A/63", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -154.727, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 55.976, "chi2": -157.199, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 56.809, "C1C1_dist": 10.460, "N1N9_dist": 8.834, "C6C8_dist": 9.857, "CNNC_torsion": -6.546, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[3.08],N1(imino)-N3[2.84],N2(amino)-O2(carbonyl)[2.61]", "interBase_angle": 14.111, "planarity": 0.160, "simple_Shear": -0.308, "simple_Stretch": -0.149, "simple_Buckle": -4.945, "simple_Propeller": -13.216, "bp_simpleParams": [ -0.308, -0.149, 0.043, -4.945, -13.216, 4.228 ], "bp_params": [ -0.304, -0.157, 0.043, -4.613, -13.336, 4.254 ], "frame": { "rmsd": null, "origin": [ -36.526, -9.110, -46.186 ], "x_axis": [ -0.376, -0.015, 0.927 ], "y_axis": [ -0.382, 0.914, -0.140 ], "z_axis": [ -0.844, -0.407, -0.349 ], "quaternion": [ 0.545, 0.122, -0.812, 0.168 ] } }, { "index": 30, "nt1": "///A/52", "nt2": "///A/62", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -167.687, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 52.280, "chi2": -161.787, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 57.512, "C1C1_dist": 10.552, "N1N9_dist": 8.866, "C6C8_dist": 9.803, "CNNC_torsion": -9.291, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.80],O4(carbonyl)-N6(amino)[2.85]", "interBase_angle": 6.760, "planarity": 0.101, "simple_Shear": -0.565, "simple_Stretch": -0.119, "simple_Buckle": -1.731, "simple_Propeller": -6.535, "bp_simpleParams": [ -0.565, -0.119, 0.084, -1.731, -6.535, -0.426 ], "bp_params": [ -0.557, -0.153, 0.084, -1.325, -6.629, -0.426 ], "frame": { "rmsd": null, "origin": [ -39.032, -11.469, -46.523 ], "x_axis": [ -0.460, 0.450, 0.765 ], "y_axis": [ -0.152, 0.809, -0.568 ], "z_axis": [ -0.875, -0.378, -0.304 ], "quaternion": [ 0.511, -0.093, -0.802, 0.295 ] } }, { "index": 31, "nt1": "///A/53", "nt2": "///A/61", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -173.258, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 53.888, "chi2": -169.949, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 55.813, "C1C1_dist": 10.553, "N1N9_dist": 8.863, "C6C8_dist": 9.828, "CNNC_torsion": -3.478, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.96],N1(imino)-N3[2.87],N2(amino)-O2(carbonyl)[2.67]", "interBase_angle": 12.553, "planarity": 0.135, "simple_Shear": -0.347, "simple_Stretch": -0.143, "simple_Buckle": -10.903, "simple_Propeller": -6.220, "bp_simpleParams": [ -0.347, -0.143, -0.179, -10.903, -6.220, 1.824 ], "bp_params": [ -0.343, -0.153, -0.179, -10.733, -6.510, 1.819 ], "frame": { "rmsd": null, "origin": [ -42.446, -13.210, -45.276 ], "x_axis": [ -0.359, 0.865, 0.351 ], "y_axis": [ 0.063, 0.398, -0.915 ], "z_axis": [ -0.931, -0.306, -0.197 ], "quaternion": [ -0.459, 0.332, 0.699, -0.437 ] } }, { "index": 32, "nt1": "///A/54", "nt2": "///A/58", "bp": "t-a", "name": "rHoogsteen", "Saenger": "24-XXIV", "LW": "tWH", "DSSR": "tW-M", "intra_chain": true, "chi1": -156.090, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 31.795, "chi2": -85.189, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 23.320, "C1C1_dist": 9.776, "N1N9_dist": 7.300, "C6C8_dist": 6.320, "CNNC_torsion": 175.109, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N7[3.00],O2(carbonyl)-N6(amino)[2.89]", "interBase_angle": 2.621, "planarity": 0.046, "simple_Shear": 4.383, "simple_Stretch": 1.669, "simple_Buckle": -1.632, "simple_Propeller": 2.051, "bp_simpleParams": [ 4.383, 1.669, -0.050, -1.632, 2.051, -100.296 ], "bp_params": [ 4.310, -1.850, -0.050, 0.255, 2.608, -100.311 ], "frame": { "rmsd": null, "origin": [ -45.660, -15.218, -42.683 ], "x_axis": [ 0.021, 0.361, -0.932 ], "y_axis": [ 0.399, -0.858, -0.323 ], "z_axis": [ -0.917, -0.365, -0.162 ], "quaternion": [ 0.015, 0.714, 0.266, -0.647 ] } }, { "index": 33, "nt1": "///A/74", "nt2": "///K/2554", "bp": "C+U", "name": "--", "Saenger": "--", "LW": "cW.", "DSSR": "cW+.", "intra_chain": false, "chi1": 159.813, "conf1": "anti", "pucker1": "pucker-CHK", "lambda1": 21.890, "chi2": -133.829, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 28.324, "C1C1_dist": 13.308, "N1N9_dist": 10.638, "C6C8_dist": 10.148, "CNNC_torsion": -38.176, "hbonds_num": 1, "hbonds_desc": "N4(amino)-O4(carbonyl)[3.68]", "interBase_angle": 52.738, "planarity": 0.755, "simple_Shear": -5.206, "simple_Stretch": 1.517, "simple_Buckle": 34.570, "simple_Propeller": 39.827, "bp_simpleParams": [ -5.206, 1.517, 1.209, 34.570, 39.827, -159.828 ], "bp_params": [ -1.379, 5.244, 1.209, 51.991, -8.847, -157.664 ], "frame": { "rmsd": null, "origin": [ 4.658, 3.185, -22.104 ], "x_axis": [ -0.583, -0.813, 0.007 ], "y_axis": [ -0.738, 0.526, -0.423 ], "z_axis": [ 0.340, -0.251, -0.906 ], "quaternion": [ 0.096, -0.447, 0.868, -0.194 ] } }, { "index": 34, "nt1": "///A/75", "nt2": "///J/1955", "bp": "C-U", "name": "--", "Saenger": "--", "LW": "tHS", "DSSR": "tM-m", "intra_chain": false, "chi1": 172.827, "conf1": "anti", "pucker1": "----", "lambda1": 11.471, "chi2": -132.189, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 69.172, "C1C1_dist": 6.898, "N1N9_dist": 5.143, "C6C8_dist": 4.817, "CNNC_torsion": -147.343, "hbonds_num": 1, "hbonds_desc": "N4(amino)-O2(carbonyl)[3.12]", "interBase_angle": 50.195, "planarity": 0.707, "simple_Shear": -7.798, "simple_Stretch": -0.994, "simple_Buckle": 45.199, "simple_Propeller": 21.830, "bp_simpleParams": [ -7.798, -0.994, 2.731, 45.199, 21.830, -33.378 ], "bp_params": [ -3.871, -6.842, 2.731, 10.389, 49.108, -36.367 ], "frame": { "rmsd": null, "origin": [ 0.918, 8.155, -17.832 ], "x_axis": [ 0.750, 0.400, -0.527 ], "y_axis": [ 0.159, -0.882, -0.443 ], "z_axis": [ -0.642, 0.248, -0.725 ], "quaternion": [ -0.189, 0.916, 0.152, -0.319 ] } }, { "index": 35, "nt1": "///B/1", "nt2": "///B/72", "bp": "C-A", "name": "--", "Saenger": "--", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -154.032, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 41.019, "chi2": 165.937, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 49.356, "C1C1_dist": 11.917, "N1N9_dist": 9.853, "C6C8_dist": 10.326, "CNNC_torsion": -0.391, "hbonds_num": 2, "hbonds_desc": "N4(amino)*N6(amino)[3.02],N4(amino)-N1[3.46]", "unusual_base2base_hbonds": 1, "interBase_angle": 26.598, "planarity": 0.315, "simple_Shear": -0.831, "simple_Stretch": 0.765, "simple_Buckle": 23.983, "simple_Propeller": -11.500, "bp_simpleParams": [ -0.831, 0.765, -0.361, 23.983, -11.500, -18.864 ], "bp_params": [ -0.901, 0.681, -0.361, 25.023, -9.016, -18.483 ], "frame": { "rmsd": null, "origin": [ -7.071, -18.334, -13.912 ], "x_axis": [ -0.719, 0.688, 0.100 ], "y_axis": [ -0.253, -0.125, -0.959 ], "z_axis": [ -0.647, -0.715, 0.263 ], "quaternion": [ 0.324, -0.188, -0.577, 0.726 ] } }, { "index": 36, "nt1": "///B/2", "nt2": "///B/71", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -159.069, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 51.118, "chi2": -145.340, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 56.677, "C1C1_dist": 10.711, "N1N9_dist": 8.980, "C6C8_dist": 9.911, "CNNC_torsion": -1.158, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[3.04],N1(imino)-N3[3.01],N2(amino)-O2(carbonyl)[2.90]", "interBase_angle": 9.465, "planarity": 0.193, "simple_Shear": -0.571, "simple_Stretch": -0.107, "simple_Buckle": 4.722, "simple_Propeller": -8.203, "bp_simpleParams": [ -0.571, -0.107, -0.449, 4.722, -8.203, 1.311 ], "bp_params": [ -0.564, -0.138, -0.449, 5.153, -7.940, 1.313 ], "frame": { "rmsd": null, "origin": [ -10.276, -19.460, -11.364 ], "x_axis": [ -0.483, 0.747, -0.456 ], "y_axis": [ 0.038, -0.503, -0.864 ], "z_axis": [ -0.875, -0.435, 0.214 ], "quaternion": [ 0.239, -0.449, -0.438, 0.742 ] } }, { "index": 37, "nt1": "///B/3", "nt2": "///B/70", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -165.152, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 50.805, "chi2": -175.816, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 47.932, "C1C1_dist": 10.862, "N1N9_dist": 8.948, "C6C8_dist": 9.670, "CNNC_torsion": -17.464, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[3.21],N3-N1(imino)[2.96],N4(amino)-O6(carbonyl)[2.77]", "interBase_angle": 26.791, "planarity": 0.288, "simple_Shear": 0.718, "simple_Stretch": -0.226, "simple_Buckle": 16.643, "simple_Propeller": -20.995, "bp_simpleParams": [ 0.718, -0.226, -0.253, 16.643, -20.995, -7.189 ], "bp_params": [ 0.704, -0.266, -0.253, 15.407, -21.919, -7.259 ], "frame": { "rmsd": null, "origin": [ -13.429, -19.849, -9.708 ], "x_axis": [ -0.374, 0.236, -0.897 ], "y_axis": [ 0.346, -0.862, -0.371 ], "z_axis": [ -0.860, -0.449, 0.240 ], "quaternion": [ -0.035, -0.558, -0.261, 0.787 ] } }, { "index": 38, "nt1": "///B/4", "nt2": "///B/69", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -119.599, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 49.071, "chi2": -154.525, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 60.207, "C1C1_dist": 10.220, "N1N9_dist": 8.550, "C6C8_dist": 9.479, "CNNC_torsion": 31.386, "hbonds_num": 4, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.96],N1(imino)-O2(carbonyl)[2.85],N1(imino)-N3[2.89],N2(amino)-O2(carbonyl)[2.76]", "interBase_angle": 12.577, "planarity": 0.265, "simple_Shear": -1.262, "simple_Stretch": -0.530, "simple_Buckle": -1.192, "simple_Propeller": 12.521, "bp_simpleParams": [ -1.262, -0.530, -0.970, -1.192, 12.521, -1.629 ], "bp_params": [ -1.187, -0.681, -0.970, -2.719, 12.280, -1.638 ], "frame": { "rmsd": null, "origin": [ -17.733, -19.479, -9.359 ], "x_axis": [ 0.166, 0.133, -0.977 ], "y_axis": [ 0.396, -0.917, -0.057 ], "z_axis": [ -0.903, -0.377, -0.204 ], "quaternion": [ 0.106, 0.756, 0.175, -0.622 ] } }, { "index": 39, "nt1": "///B/5", "nt2": "///B/68", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -154.160, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 62.730, "chi2": -166.051, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 57.384, "C1C1_dist": 10.426, "N1N9_dist": 8.962, "C6C8_dist": 10.167, "CNNC_torsion": -4.279, "hbonds_num": 3, "hbonds_desc": "N1(imino)-N3[3.09],N2(amino)-O2(carbonyl)[2.53],N2(amino)-N3[2.96]", "interBase_angle": 8.846, "planarity": 0.148, "simple_Shear": 0.471, "simple_Stretch": 0.215, "simple_Buckle": 2.165, "simple_Propeller": -8.577, "bp_simpleParams": [ 0.471, 0.215, -0.297, 2.165, -8.577, 13.027 ], "bp_params": [ 0.482, 0.190, -0.297, 1.709, -8.680, 13.062 ], "frame": { "rmsd": null, "origin": [ -21.095, -19.984, -10.472 ], "x_axis": [ 0.374, -0.529, -0.762 ], "y_axis": [ 0.288, -0.715, 0.637 ], "z_axis": [ -0.882, -0.458, -0.115 ], "quaternion": [ 0.369, 0.742, -0.081, -0.554 ] } }, { "index": 40, "nt1": "///B/6", "nt2": "///B/67", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -161.186, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 60.821, "chi2": 163.353, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 38.759, "C1C1_dist": 12.095, "N1N9_dist": 10.230, "C6C8_dist": 10.962, "CNNC_torsion": 7.647, "hbonds_num": 2, "hbonds_desc": "N1(imino)*N4(amino)[3.37],N2(amino)-N3[3.46]", "interBase_angle": 9.425, "planarity": 0.121, "simple_Shear": 2.026, "simple_Stretch": 1.182, "simple_Buckle": -9.412, "simple_Propeller": -0.505, "bp_simpleParams": [ 2.026, 1.182, -0.471, -9.412, -0.505, -7.874 ], "bp_params": [ 2.226, 0.738, -0.471, -9.313, 1.451, -7.849 ], "frame": { "rmsd": null, "origin": [ -24.832, -19.961, -12.650 ], "x_axis": [ 0.472, -0.847, -0.244 ], "y_axis": [ -0.051, -0.302, 0.952 ], "z_axis": [ -0.880, -0.437, -0.186 ], "quaternion": [ 0.496, 0.700, -0.321, -0.402 ] } }, { "index": 41, "nt1": "///B/7", "nt2": "///B/66", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -158.578, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 45.343, "chi2": -157.727, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 51.623, "C1C1_dist": 10.994, "N1N9_dist": 9.052, "C6C8_dist": 9.705, "CNNC_torsion": -0.475, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.63],N1(imino)-N3[3.09],N2(amino)-O2(carbonyl)[3.45]", "interBase_angle": 11.493, "planarity": 0.129, "simple_Shear": -0.779, "simple_Stretch": -0.210, "simple_Buckle": -9.226, "simple_Propeller": -6.854, "bp_simpleParams": [ -0.779, -0.210, -0.338, -9.226, -6.854, -11.848 ], "bp_params": [ -0.761, -0.266, -0.338, -8.706, -7.503, -11.839 ], "frame": { "rmsd": null, "origin": [ -27.264, -21.231, -15.385 ], "x_axis": [ 0.705, -0.699, 0.122 ], "y_axis": [ -0.291, -0.128, 0.948 ], "z_axis": [ -0.647, -0.704, -0.294 ], "quaternion": [ 0.566, 0.729, -0.339, -0.180 ] } }, { "index": 42, "nt1": "///B/8", "nt2": "///B/14", "bp": "U-A", "name": "rHoogsteen", "Saenger": "24-XXIV", "LW": "tWH", "DSSR": "tW-M", "intra_chain": true, "chi1": -153.846, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 27.806, "chi2": 175.353, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 24.273, "C1C1_dist": 9.630, "N1N9_dist": 7.102, "C6C8_dist": 6.100, "CNNC_torsion": 173.410, "hbonds_num": 2, "hbonds_desc": "O2(carbonyl)-N6(amino)[3.06],N3(imino)-N7[2.79]", "interBase_angle": 19.761, "planarity": 0.222, "simple_Shear": 4.236, "simple_Stretch": 1.547, "simple_Buckle": -15.621, "simple_Propeller": 12.103, "bp_simpleParams": [ 4.236, 1.547, 0.443, -15.621, 12.103, -102.530 ], "bp_params": [ 4.118, -1.839, 0.443, -2.809, 19.561, -103.331 ], "frame": { "rmsd": null, "origin": [ -37.505, -23.927, 0.033 ], "x_axis": [ 0.609, 0.592, -0.528 ], "y_axis": [ -0.575, -0.128, -0.808 ], "z_axis": [ -0.546, 0.796, 0.262 ], "quaternion": [ 0.660, -0.607, -0.007, 0.442 ] } }, { "index": 43, "nt1": "///B/8", "nt2": "///B/21", "bp": "U+A", "name": "--", "Saenger": "--", "LW": "tSW", "DSSR": "tm+W", "intra_chain": true, "chi1": -153.846, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 92.984, "chi2": -174.062, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 56.462, "C1C1_dist": 8.383, "N1N9_dist": 8.105, "C6C8_dist": 10.366, "CNNC_torsion": 167.503, "hbonds_num": 1, "hbonds_desc": "O2'(hydroxyl)-N1[2.96]", "interBase_angle": 20.840, "planarity": 0.258, "simple_Shear": 6.751, "simple_Stretch": 4.028, "simple_Buckle": -16.432, "simple_Propeller": -12.818, "bp_simpleParams": [ 6.751, 4.028, -0.208, -16.432, -12.818, -142.062 ], "bp_params": [ -2.107, -7.574, -0.208, 3.075, 20.612, -142.619 ], "frame": { "rmsd": null, "origin": [ -38.345, -22.967, -3.234 ], "x_axis": [ 0.375, 0.523, -0.765 ], "y_axis": [ -0.750, -0.313, -0.582 ], "z_axis": [ -0.544, 0.793, 0.275 ], "quaternion": [ 0.578, -0.594, 0.096, 0.551 ] } }, { "index": 44, "nt1": "///B/10", "nt2": "///B/25", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": 175.196, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 52.249, "chi2": -158.393, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 63.117, "C1C1_dist": 10.155, "N1N9_dist": 8.603, "C6C8_dist": 9.627, "CNNC_torsion": 2.360, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[3.00],N1(imino)-N3[2.84],N2(amino)-O2(carbonyl)[2.64]", "interBase_angle": 15.151, "planarity": 0.181, "simple_Shear": -1.046, "simple_Stretch": -0.292, "simple_Buckle": -13.444, "simple_Propeller": -6.986, "bp_simpleParams": [ -1.046, -0.292, -0.468, -13.444, -6.986, 4.768 ], "bp_params": [ -1.013, -0.392, -0.468, -12.719, -8.233, 4.751 ], "frame": { "rmsd": null, "origin": [ -43.030, -12.299, -0.696 ], "x_axis": [ -0.554, -0.794, 0.250 ], "y_axis": [ -0.150, -0.201, -0.968 ], "z_axis": [ 0.819, -0.573, -0.008 ], "quaternion": [ -0.244, 0.405, -0.583, 0.661 ] } }, { "index": 45, "nt1": "///B/10", "nt2": "///B/45", "bp": "G+G", "name": "--", "Saenger": "--", "LW": "cHS", "DSSR": "cM+m", "intra_chain": true, "chi1": 175.196, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 48.011, "chi2": -148.198, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 109.633, "C1C1_dist": 9.297, "N1N9_dist": 8.820, "C6C8_dist": 8.843, "CNNC_torsion": 3.512, "hbonds_num": 1, "hbonds_desc": "O6(carbonyl)-N2(amino)[3.24]", "interBase_angle": 18.546, "planarity": 0.265, "simple_Shear": -0.532, "simple_Stretch": 7.150, "simple_Buckle": -15.960, "simple_Propeller": -9.447, "bp_simpleParams": [ -0.532, 7.150, -0.112, -15.960, -9.447, 19.962 ], "bp_params": [ -6.666, -2.638, -0.112, 13.750, -12.446, 19.938 ], "frame": { "rmsd": null, "origin": [ -45.209, -14.474, -0.536 ], "x_axis": [ -0.543, -0.744, 0.388 ], "y_axis": [ -0.400, -0.177, -0.899 ], "z_axis": [ 0.738, -0.644, -0.201 ], "quaternion": [ 0.140, -0.457, 0.626, -0.616 ] } }, { "index": 46, "nt1": "///B/11", "nt2": "///B/24", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -152.460, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 55.119, "chi2": -158.244, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 58.925, "C1C1_dist": 10.431, "N1N9_dist": 8.836, "C6C8_dist": 9.886, "CNNC_torsion": 0.892, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.21],N1-N3(imino)[2.90]", "interBase_angle": 8.592, "planarity": 0.113, "simple_Shear": -0.154, "simple_Stretch": -0.034, "simple_Buckle": -7.895, "simple_Propeller": 3.389, "bp_simpleParams": [ -0.154, -0.034, -0.469, -7.895, 3.389, 4.988 ], "bp_params": [ -0.153, -0.035, -0.469, -7.930, 3.306, 4.978 ], "frame": { "rmsd": null, "origin": [ -39.975, -13.548, 0.855 ], "x_axis": [ -0.558, -0.712, -0.426 ], "y_axis": [ 0.247, 0.347, -0.905 ], "z_axis": [ 0.792, -0.610, -0.017 ], "quaternion": [ 0.439, -0.168, 0.693, -0.546 ] } }, { "index": 47, "nt1": "///B/12", "nt2": "///B/23", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -152.584, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 56.733, "chi2": -164.850, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 54.136, "C1C1_dist": 10.729, "N1N9_dist": 9.066, "C6C8_dist": 10.081, "CNNC_torsion": -1.223, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[3.19],N1(imino)-N3[3.02],N2(amino)-O2(carbonyl)[2.77]", "interBase_angle": 8.024, "planarity": 0.159, "simple_Shear": 0.243, "simple_Stretch": 0.070, "simple_Buckle": 5.618, "simple_Propeller": -5.729, "bp_simpleParams": [ 0.243, 0.070, -0.230, 5.618, -5.729, 4.128 ], "bp_params": [ 0.245, 0.063, -0.230, 5.453, -5.886, 4.129 ], "frame": { "rmsd": null, "origin": [ -38.344, -16.155, 1.196 ], "x_axis": [ -0.384, -0.382, -0.841 ], "y_axis": [ 0.546, 0.640, -0.540 ], "z_axis": [ 0.744, -0.667, -0.037 ], "quaternion": [ 0.552, 0.057, 0.718, -0.420 ] } }, { "index": 48, "nt1": "///B/13", "nt2": "///B/22", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -154.789, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 55.406, "chi2": -174.241, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 55.484, "C1C1_dist": 10.686, "N1N9_dist": 9.017, "C6C8_dist": 9.946, "CNNC_torsion": 7.337, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.97],N3-N1(imino)[3.07],N4(amino)-O6(carbonyl)[3.07]", "interBase_angle": 22.383, "planarity": 0.267, "simple_Shear": 0.044, "simple_Stretch": -0.009, "simple_Buckle": 19.153, "simple_Propeller": -11.583, "bp_simpleParams": [ 0.044, -0.009, -1.119, 19.153, -11.583, 2.612 ], "bp_params": [ 0.044, -0.009, -1.119, 19.283, -11.365, 2.589 ], "frame": { "rmsd": null, "origin": [ -38.268, -19.865, 1.067 ], "x_axis": [ -0.272, 0.045, -0.961 ], "y_axis": [ 0.791, 0.579, -0.197 ], "z_axis": [ 0.548, -0.814, -0.193 ], "quaternion": [ 0.528, 0.292, 0.715, -0.354 ] } }, { "index": 49, "nt1": "///B/14", "nt2": "///B/21", "bp": "A-A", "name": "--", "Saenger": "--", "LW": "cWS", "DSSR": "cW-m", "intra_chain": true, "chi1": 175.353, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 28.604, "chi2": -174.062, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 117.816, "C1C1_dist": 9.791, "N1N9_dist": 9.202, "C6C8_dist": 10.348, "CNNC_torsion": -1.521, "hbonds_num": 2, "hbonds_desc": "N6(amino)-N3[2.97],N1-O2'(hydroxyl)[2.72]", "interBase_angle": 1.496, "planarity": 0.054, "simple_Shear": -6.122, "simple_Stretch": 3.423, "simple_Buckle": -0.602, "simple_Propeller": -1.369, "bp_simpleParams": [ -6.122, 3.423, -0.124, -0.602, -1.369, 39.100 ], "bp_params": [ -6.853, -1.492, -0.124, 0.456, -1.424, 39.103 ], "frame": { "rmsd": null, "origin": [ -40.008, -24.479, -2.949 ], "x_axis": [ -0.402, 0.136, -0.905 ], "y_axis": [ 0.669, 0.718, -0.189 ], "z_axis": [ 0.625, -0.682, -0.380 ], "quaternion": [ 0.484, 0.255, 0.791, -0.276 ] } }, { "index": 50, "nt1": "///B/15", "nt2": "///B/48", "bp": "G+C", "name": "--", "Saenger": "--", "LW": "tWW", "DSSR": "tW+W", "intra_chain": true, "chi1": -163.777, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 30.422, "chi2": -139.270, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 46.391, "C1C1_dist": 11.108, "N1N9_dist": 9.014, "C6C8_dist": 10.066, "CNNC_torsion": -175.537, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)*O2(carbonyl)[3.12],N1(imino)-N3[3.03],N2(amino)-N3[3.29]", "unusual_base2base_hbonds": 1, "interBase_angle": 6.749, "planarity": 0.097, "simple_Shear": 1.827, "simple_Stretch": 0.308, "simple_Buckle": 5.190, "simple_Propeller": -4.315, "bp_simpleParams": [ 1.827, 0.308, 0.327, 5.190, -4.315, 164.099 ], "bp_params": [ 0.030, 1.852, 0.327, 5.187, 4.318, 164.094 ], "frame": { "rmsd": null, "origin": [ -37.608, -26.429, -4.274 ], "x_axis": [ -0.392, 0.080, -0.916 ], "y_axis": [ 0.688, 0.687, -0.235 ], "z_axis": [ 0.610, -0.723, -0.324 ], "quaternion": [ 0.492, 0.248, 0.775, -0.309 ] } }, { "index": 51, "nt1": "///B/18", "nt2": "///B/55", "bp": "G+U", "name": "--", "Saenger": "--", "LW": "tWS", "DSSR": "tW+m", "intra_chain": true, "chi1": -141.885, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 22.462, "chi2": -142.814, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 97.209, "C1C1_dist": 9.467, "N1N9_dist": 8.542, "C6C8_dist": 9.957, "CNNC_torsion": -163.885, "hbonds_num": 1, "hbonds_desc": "N1(imino)-O2(carbonyl)[2.63]", "interBase_angle": 20.279, "planarity": 0.289, "simple_Shear": 3.800, "simple_Stretch": 3.152, "simple_Buckle": -17.076, "simple_Propeller": 10.940, "bp_simpleParams": [ 3.800, 3.152, 0.160, -17.076, 10.940, 103.255 ], "bp_params": [ -0.955, 4.844, 0.160, -17.746, -9.815, 102.787 ], "frame": { "rmsd": null, "origin": [ -37.210, -40.108, -11.961 ], "x_axis": [ 0.103, -0.548, -0.830 ], "y_axis": [ 0.469, -0.709, 0.526 ], "z_axis": [ -0.877, -0.444, 0.184 ], "quaternion": [ -0.380, -0.638, 0.031, 0.669 ] } }, { "index": 52, "nt1": "///B/19", "nt2": "///B/56", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -110.601, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 58.203, "chi2": -159.427, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 60.082, "C1C1_dist": 10.173, "N1N9_dist": 8.680, "C6C8_dist": 9.761, "CNNC_torsion": -24.568, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[3.47],N1(imino)-N3[2.99],N2(amino)-O2(carbonyl)[2.64]", "interBase_angle": 40.817, "planarity": 0.446, "simple_Shear": -0.842, "simple_Stretch": 0.131, "simple_Buckle": -31.158, "simple_Propeller": -26.366, "bp_simpleParams": [ -0.842, 0.131, -0.393, -31.158, -26.366, 11.943 ], "bp_params": [ -0.847, 0.089, -0.393, -29.922, -27.761, 11.909 ], "frame": { "rmsd": null, "origin": [ -41.451, -45.152, -5.879 ], "x_axis": [ 0.665, -0.596, 0.451 ], "y_axis": [ -0.089, 0.536, 0.840 ], "z_axis": [ -0.742, -0.598, 0.303 ], "quaternion": [ 0.791, 0.454, -0.377, -0.160 ] } }, { "index": 53, "nt1": "///B/26", "nt2": "///B/44", "bp": "G-A", "name": "--", "Saenger": "--", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -177.420, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 48.879, "chi2": -168.302, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 39.829, "C1C1_dist": 12.935, "N1N9_dist": 10.854, "C6C8_dist": 11.069, "CNNC_torsion": -20.205, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N6(amino)[3.18],N1(imino)-N1[3.41],N2(amino)-N1[3.19]", "interBase_angle": 32.984, "planarity": 0.494, "simple_Shear": 1.287, "simple_Stretch": 1.853, "simple_Buckle": 31.146, "simple_Propeller": -10.857, "bp_simpleParams": [ 1.287, 1.853, 0.197, 31.146, -10.857, -25.698 ], "bp_params": [ 1.506, 1.680, 0.197, 29.668, -14.414, -25.073 ], "frame": { "rmsd": null, "origin": [ -48.112, -13.263, -0.631 ], "x_axis": [ -0.029, -0.270, 0.963 ], "y_axis": [ 0.713, 0.669, 0.209 ], "z_axis": [ -0.701, 0.692, 0.173 ], "quaternion": [ 0.673, -0.179, -0.618, -0.365 ] } }, { "index": 54, "nt1": "///B/27", "nt2": "///B/43", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -169.173, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 48.303, "chi2": 174.138, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 49.549, "C1C1_dist": 10.913, "N1N9_dist": 8.983, "C6C8_dist": 9.654, "CNNC_torsion": 5.045, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.89],O4(carbonyl)-N6(amino)[2.57]", "interBase_angle": 19.456, "planarity": 0.231, "simple_Shear": -0.249, "simple_Stretch": -0.104, "simple_Buckle": 19.332, "simple_Propeller": 2.197, "bp_simpleParams": [ -0.249, -0.104, -0.484, 19.332, 2.197, -11.491 ], "bp_params": [ -0.246, -0.111, -0.484, 19.268, 2.695, -11.334 ], "frame": { "rmsd": null, "origin": [ -51.759, -12.533, 0.437 ], "x_axis": [ 0.419, 0.093, 0.903 ], "y_axis": [ 0.624, 0.694, -0.360 ], "z_axis": [ -0.660, 0.714, 0.232 ], "quaternion": [ 0.766, -0.351, -0.511, -0.173 ] } }, { "index": 55, "nt1": "///B/28", "nt2": "///B/42", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -179.380, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 57.891, "chi2": -166.759, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 56.091, "C1C1_dist": 10.321, "N1N9_dist": 8.718, "C6C8_dist": 9.758, "CNNC_torsion": 1.890, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.49],N3-N1(imino)[2.77],N4(amino)-O6(carbonyl)[2.96]", "interBase_angle": 8.524, "planarity": 0.138, "simple_Shear": 0.424, "simple_Stretch": -0.262, "simple_Buckle": -4.923, "simple_Propeller": 6.959, "bp_simpleParams": [ 0.424, -0.262, 0.529, -4.923, 6.959, 5.552 ], "bp_params": [ 0.414, -0.277, 0.529, -4.664, 7.135, 5.558 ], "frame": { "rmsd": null, "origin": [ -54.858, -10.670, 3.291 ], "x_axis": [ 0.783, 0.380, 0.493 ], "y_axis": [ 0.336, 0.409, -0.849 ], "z_axis": [ -0.524, 0.830, 0.192 ], "quaternion": [ 0.772, -0.544, -0.329, 0.014 ] } }, { "index": 56, "nt1": "///B/29", "nt2": "///B/41", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -164.511, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 50.171, "chi2": -168.311, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 58.084, "C1C1_dist": 10.328, "N1N9_dist": 8.610, "C6C8_dist": 9.539, "CNNC_torsion": 0.889, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.75],N1(imino)-N3[2.73],N2(amino)-O2(carbonyl)[2.57]", "interBase_angle": 3.399, "planarity": 0.054, "simple_Shear": -0.905, "simple_Stretch": -0.448, "simple_Buckle": 3.397, "simple_Propeller": 0.107, "bp_simpleParams": [ -0.905, -0.448, 0.246, 3.397, 0.107, 0.347 ], "bp_params": [ -0.863, -0.525, 0.246, 3.375, 0.400, 0.347 ], "frame": { "rmsd": null, "origin": [ -57.053, -9.509, 5.995 ], "x_axis": [ 0.856, 0.509, 0.092 ], "y_axis": [ -0.060, 0.274, -0.960 ], "z_axis": [ -0.514, 0.816, 0.265 ], "quaternion": [ 0.774, -0.574, -0.196, 0.184 ] } }, { "index": 57, "nt1": "///B/30", "nt2": "///B/40", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -170.998, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 47.779, "chi2": -166.860, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 63.096, "C1C1_dist": 10.228, "N1N9_dist": 8.580, "C6C8_dist": 9.557, "CNNC_torsion": 10.983, "hbonds_num": 4, "hbonds_desc": "O6(carbonyl)-N4(amino)[3.11],N1(imino)-O2(carbonyl)[2.73],N1(imino)-N3[2.96],N2(amino)-O2(carbonyl)[2.74]", "interBase_angle": 5.380, "planarity": 0.077, "simple_Shear": -1.552, "simple_Stretch": -0.336, "simple_Buckle": -4.324, "simple_Propeller": 3.201, "bp_simpleParams": [ -1.552, -0.336, -0.085, -4.324, 3.201, 3.271 ], "bp_params": [ -1.484, -0.566, -0.085, -4.757, 2.514, 3.269 ], "frame": { "rmsd": null, "origin": [ -57.321, -6.659, 8.632 ], "x_axis": [ 0.786, 0.444, -0.431 ], "y_axis": [ -0.491, 0.023, -0.871 ], "z_axis": [ -0.377, 0.896, 0.236 ], "quaternion": [ 0.715, -0.618, 0.019, 0.327 ] } }, { "index": 58, "nt1": "///B/31", "nt2": "///B/39", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": 169.462, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 49.300, "chi2": -161.819, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 54.473, "C1C1_dist": 10.571, "N1N9_dist": 8.758, "C6C8_dist": 9.537, "CNNC_torsion": 2.937, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.68],N1(imino)-N3[2.87],N2(amino)-O2(carbonyl)[2.94]", "interBase_angle": 23.402, "planarity": 0.315, "simple_Shear": -0.587, "simple_Stretch": -0.255, "simple_Buckle": -23.289, "simple_Propeller": 2.301, "bp_simpleParams": [ -0.587, -0.255, -0.109, -23.289, 2.301, -5.630 ], "bp_params": [ -0.571, -0.288, -0.109, -23.383, 0.954, -5.513 ], "frame": { "rmsd": null, "origin": [ -56.485, -2.939, 11.011 ], "x_axis": [ 0.414, 0.274, -0.868 ], "y_axis": [ -0.880, -0.125, -0.458 ], "z_axis": [ -0.234, 0.954, 0.189 ], "quaternion": [ 0.608, -0.581, 0.261, 0.475 ] } }, { "index": 59, "nt1": "///B/32", "nt2": "///B/38", "bp": "C-A", "name": "--", "Saenger": "--", "LW": "cWH", "DSSR": "cW-M", "intra_chain": true, "chi1": -177.981, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 63.762, "chi2": 175.569, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 23.387, "C1C1_dist": 10.788, "N1N9_dist": 8.829, "C6C8_dist": 9.087, "CNNC_torsion": -0.502, "hbonds_num": 2, "hbonds_desc": "O2(carbonyl)-N6(amino)[2.73],N3-N6(amino)[2.79]", "interBase_angle": 32.120, "planarity": 0.357, "simple_Shear": 3.970, "simple_Stretch": 0.254, "simple_Buckle": -29.695, "simple_Propeller": 12.244, "bp_simpleParams": [ 3.970, 0.254, 1.741, -29.695, 12.244, -21.738 ], "bp_params": [ 3.748, -1.333, 1.741, -22.609, 22.815, -21.762 ], "frame": { "rmsd": null, "origin": [ -55.775, 0.728, 12.419 ], "x_axis": [ -0.420, -0.025, -0.907 ], "y_axis": [ -0.842, -0.364, 0.399 ], "z_axis": [ -0.340, 0.931, 0.131 ], "quaternion": [ 0.295, -0.451, 0.481, 0.692 ] } }, { "index": 60, "nt1": "///B/33", "nt2": "///B/36", "bp": "U-U", "name": "--", "Saenger": "--", "LW": "tWH", "DSSR": "tW-M", "intra_chain": true, "chi1": -144.325, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 78.570, "chi2": -157.889, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 37.758, "C1C1_dist": 8.821, "N1N9_dist": 7.722, "C6C8_dist": 7.584, "CNNC_torsion": -161.728, "hbonds_num": 1, "hbonds_desc": "N3(imino)-OP2[2.67]", "interBase_angle": 27.977, "planarity": 0.338, "simple_Shear": 8.076, "simple_Stretch": 5.942, "simple_Buckle": -18.563, "simple_Propeller": 20.932, "bp_simpleParams": [ 8.076, 5.942, 1.079, -18.563, 20.932, -68.998 ], "bp_params": [ 7.336, -6.835, 1.079, 17.155, 22.100, -69.406 ], "frame": { "rmsd": null, "origin": [ -55.558, 5.615, 10.263 ], "x_axis": [ -0.858, -0.484, 0.172 ], "y_axis": [ 0.108, 0.157, 0.982 ], "z_axis": [ -0.502, 0.861, -0.082 ], "quaternion": [ -0.233, -0.130, 0.724, 0.636 ] } }, { "index": 61, "nt1": "///B/49", "nt2": "///B/65", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -155.223, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 54.085, "chi2": -174.661, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 41.777, "C1C1_dist": 11.218, "N1N9_dist": 9.263, "C6C8_dist": 9.905, "CNNC_torsion": 2.444, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.60],N1(imino)-N3[3.07],N2(amino)-N3[3.24]", "interBase_angle": 9.719, "planarity": 0.148, "simple_Shear": 1.091, "simple_Stretch": -0.010, "simple_Buckle": -5.854, "simple_Propeller": -7.758, "bp_simpleParams": [ 1.091, -0.010, -0.684, -5.854, -7.758, -11.861 ], "bp_params": [ 1.083, -0.135, -0.684, -6.702, -7.039, -11.863 ], "frame": { "rmsd": null, "origin": [ -28.130, -24.304, -17.874 ], "x_axis": [ 0.270, -0.609, 0.746 ], "y_axis": [ -0.797, 0.294, 0.528 ], "z_axis": [ -0.541, -0.737, -0.406 ], "quaternion": [ 0.538, 0.588, -0.598, 0.087 ] } }, { "index": 62, "nt1": "///B/50", "nt2": "///B/64", "bp": "U-G", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -155.634, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 68.132, "chi2": -150.250, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 51.896, "C1C1_dist": 9.879, "N1N9_dist": 8.438, "C6C8_dist": 9.563, "CNNC_torsion": -12.307, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N1(imino)[2.84],O2(carbonyl)-N2(amino)[2.83],N3(imino)-O6(carbonyl)[3.15]", "interBase_angle": 28.476, "planarity": 0.342, "simple_Shear": 1.553, "simple_Stretch": -0.218, "simple_Buckle": 19.003, "simple_Propeller": -21.208, "bp_simpleParams": [ 1.553, -0.218, -0.901, 19.003, -21.208, 13.700 ], "bp_params": [ 1.508, -0.431, -0.901, 15.857, -23.652, 13.868 ], "frame": { "rmsd": null, "origin": [ -28.791, -27.325, -18.043 ], "x_axis": [ -0.157, -0.371, 0.915 ], "y_axis": [ -0.881, 0.471, 0.039 ], "z_axis": [ -0.445, -0.800, -0.401 ], "quaternion": [ -0.478, -0.440, 0.712, -0.267 ] } }, { "index": 63, "nt1": "///B/51", "nt2": "///B/63", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -166.350, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 49.447, "chi2": 176.749, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 52.969, "C1C1_dist": 11.803, "N1N9_dist": 9.965, "C6C8_dist": 10.766, "CNNC_torsion": 0.296, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[3.90],N3-N1(imino)[3.80],N4(amino)-O6(carbonyl)[3.56]", "interBase_angle": 7.218, "planarity": 0.120, "simple_Shear": -0.226, "simple_Stretch": 0.751, "simple_Buckle": -1.823, "simple_Propeller": -6.984, "bp_simpleParams": [ -0.226, 0.751, -0.188, -1.823, -6.984, -5.847 ], "bp_params": [ -0.246, 0.745, -0.188, -1.638, -7.030, -5.857 ], "frame": { "rmsd": null, "origin": [ -28.855, -30.909, -19.201 ], "x_axis": [ -0.364, 0.260, 0.894 ], "y_axis": [ -0.694, 0.564, -0.447 ], "z_axis": [ -0.621, -0.784, -0.025 ], "quaternion": [ 0.542, 0.155, -0.699, 0.440 ] } }, { "index": 64, "nt1": "///B/52", "nt2": "///B/62", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -153.244, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 60.846, "chi2": -156.203, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 46.344, "C1C1_dist": 11.025, "N1N9_dist": 9.309, "C6C8_dist": 10.272, "CNNC_torsion": 29.087, "hbonds_num": 3, "hbonds_desc": "N1(imino)*N4(amino)[3.19],N2(amino)-O2(carbonyl)[3.11],N2(amino)-N3[2.81]", "unusual_base2base_hbonds": 1, "interBase_angle": 20.502, "planarity": 0.311, "simple_Shear": 1.341, "simple_Stretch": 0.294, "simple_Buckle": -2.396, "simple_Propeller": 20.361, "bp_simpleParams": [ 1.341, 0.294, -0.832, -2.396, 20.361, 0.474 ], "bp_params": [ 1.369, 0.106, -0.832, 0.475, 20.496, 0.482 ], "frame": { "rmsd": null, "origin": [ -30.057, -34.025, -17.098 ], "x_axis": [ -0.433, 0.751, 0.499 ], "y_axis": [ -0.522, 0.242, -0.818 ], "z_axis": [ -0.735, -0.615, 0.287 ], "quaternion": [ 0.523, -0.097, -0.589, 0.608 ] } }, { "index": 65, "nt1": "///B/53", "nt2": "///B/61", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -165.277, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 53.546, "chi2": -150.226, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 56.303, "C1C1_dist": 10.518, "N1N9_dist": 8.832, "C6C8_dist": 9.700, "CNNC_torsion": 0.046, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.96],N1(imino)-N3[2.99],N2(amino)-O2(carbonyl)[2.87]", "interBase_angle": 26.629, "planarity": 0.290, "simple_Shear": -0.382, "simple_Stretch": -0.147, "simple_Buckle": -25.560, "simple_Propeller": -7.470, "bp_simpleParams": [ -0.382, -0.147, -1.236, -25.560, -7.470, 0.154 ], "bp_params": [ -0.378, -0.157, -1.236, -25.385, -8.043, 0.150 ], "frame": { "rmsd": null, "origin": [ -32.363, -36.999, -13.992 ], "x_axis": [ -0.612, 0.787, 0.084 ], "y_axis": [ -0.286, -0.121, -0.951 ], "z_axis": [ -0.738, -0.606, 0.299 ], "quaternion": [ 0.376, -0.229, -0.546, 0.713 ] } }, { "index": 66, "nt1": "///B/54", "nt2": "///B/58", "bp": "t-A", "name": "rHoogsteen", "Saenger": "24-XXIV", "LW": "tWH", "DSSR": "tW-M", "intra_chain": true, "chi1": -152.999, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 24.406, "chi2": -77.485, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 19.772, "C1C1_dist": 9.982, "N1N9_dist": 7.345, "C6C8_dist": 6.223, "CNNC_torsion": -175.127, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N7[2.91],O2(carbonyl)-N6(amino)[3.14]", "interBase_angle": 15.608, "planarity": 0.218, "simple_Shear": 3.707, "simple_Stretch": 1.474, "simple_Buckle": -9.108, "simple_Propeller": 12.675, "bp_simpleParams": [ 3.707, 1.474, 0.143, -9.108, 12.675, -105.789 ], "bp_params": [ 3.800, -1.213, 0.143, 1.018, 15.575, -106.297 ], "frame": { "rmsd": null, "origin": [ -33.420, -39.160, -10.533 ], "x_axis": [ -0.223, 0.009, -0.975 ], "y_axis": [ 0.578, -0.804, -0.140 ], "z_axis": [ -0.785, -0.595, 0.174 ], "quaternion": [ -0.192, -0.593, -0.248, 0.742 ] } }, { "index": 67, "nt1": "///E/153", "nt2": "///E/168", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -158.932, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 54.229, "chi2": -164.588, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 53.154, "C1C1_dist": 10.748, "N1N9_dist": 9.012, "C6C8_dist": 9.919, "CNNC_torsion": -1.442, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.87],N3-N1(imino)[2.94],N4(amino)-O6(carbonyl)[2.89]", "interBase_angle": 6.203, "planarity": 0.070, "simple_Shear": 0.236, "simple_Stretch": -0.101, "simple_Buckle": 5.353, "simple_Propeller": -3.134, "bp_simpleParams": [ 0.236, -0.101, -0.187, 5.353, -3.134, -1.259 ], "bp_params": [ 0.234, -0.105, -0.187, 5.295, -3.231, -1.259 ], "frame": { "rmsd": null, "origin": [ 21.315, 94.789, -38.433 ], "x_axis": [ -0.204, -0.757, 0.621 ], "y_axis": [ -0.978, 0.132, -0.160 ], "z_axis": [ 0.039, -0.640, -0.767 ], "quaternion": [ -0.201, -0.598, 0.725, -0.276 ] } }, { "index": 68, "nt1": "///E/154", "nt2": "///E/167", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -164.644, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 56.599, "chi2": -160.495, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 56.664, "C1C1_dist": 10.540, "N1N9_dist": 8.928, "C6C8_dist": 9.899, "CNNC_torsion": 2.529, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.90],O4(carbonyl)-N6(amino)[2.97]", "interBase_angle": 1.058, "planarity": 0.015, "simple_Shear": 0.078, "simple_Stretch": -0.054, "simple_Buckle": -0.643, "simple_Propeller": -0.840, "bp_simpleParams": [ 0.078, -0.054, 0.025, -0.643, -0.840, 0.792 ], "bp_params": [ 0.077, -0.054, 0.025, -0.646, -0.838, 0.792 ], "frame": { "rmsd": null, "origin": [ 22.665, 91.873, -40.257 ], "x_axis": [ -0.663, -0.478, 0.576 ], "y_axis": [ -0.746, 0.482, -0.459 ], "z_axis": [ -0.058, -0.734, -0.676 ], "quaternion": [ -0.189, -0.364, 0.840, -0.355 ] } }, { "index": 69, "nt1": "///E/155", "nt2": "///E/166", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -156.991, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 53.327, "chi2": -179.865, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 50.312, "C1C1_dist": 10.825, "N1N9_dist": 9.013, "C6C8_dist": 9.852, "CNNC_torsion": -0.981, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.80],N1-N3(imino)[2.90]", "interBase_angle": 3.338, "planarity": 0.073, "simple_Shear": 0.190, "simple_Stretch": -0.084, "simple_Buckle": 2.200, "simple_Propeller": -2.511, "bp_simpleParams": [ 0.190, -0.084, -0.233, 2.200, -2.511, -4.557 ], "bp_params": [ 0.188, -0.088, -0.233, 2.143, -2.560, -4.558 ], "frame": { "rmsd": null, "origin": [ 23.212, 88.874, -41.406 ], "x_axis": [ -0.923, 0.058, 0.380 ], "y_axis": [ -0.271, 0.602, -0.751 ], "z_axis": [ -0.273, -0.796, -0.540 ], "quaternion": [ -0.186, -0.061, 0.875, -0.442 ] } }, { "index": 70, "nt1": "///E/156", "nt2": "///E/165", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -176.319, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 53.682, "chi2": -166.658, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 52.027, "C1C1_dist": 10.775, "N1N9_dist": 9.006, "C6C8_dist": 9.901, "CNNC_torsion": -0.763, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.88],N3-N1(imino)[2.94],N4(amino)-O6(carbonyl)[2.88]", "interBase_angle": 5.509, "planarity": 0.096, "simple_Shear": 0.191, "simple_Stretch": -0.131, "simple_Buckle": 3.848, "simple_Propeller": -3.943, "bp_simpleParams": [ 0.191, -0.131, -0.449, 3.848, -3.943, -1.346 ], "bp_params": [ 0.190, -0.133, -0.449, 3.792, -3.996, -1.346 ], "frame": { "rmsd": null, "origin": [ 21.819, 85.333, -41.134 ], "x_axis": [ -0.936, 0.351, -0.018 ], "y_axis": [ 0.188, 0.456, -0.870 ], "z_axis": [ -0.297, -0.818, -0.493 ], "quaternion": [ -0.082, 0.159, 0.849, -0.497 ] } }, { "index": 71, "nt1": "///E/157", "nt2": "///E/164", "bp": "U-G", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -169.651, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 69.486, "chi2": 176.635, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 42.990, "C1C1_dist": 10.347, "N1N9_dist": 8.776, "C6C8_dist": 9.730, "CNNC_torsion": 6.177, "hbonds_num": 2, "hbonds_desc": "O2(carbonyl)-N1(imino)[2.75],N3(imino)-O6(carbonyl)[2.87]", "interBase_angle": 3.071, "planarity": 0.083, "simple_Shear": 2.280, "simple_Stretch": -0.019, "simple_Buckle": -0.523, "simple_Propeller": -3.026, "bp_simpleParams": [ 2.280, -0.019, -0.225, -0.523, -3.026, 1.407 ], "bp_params": [ 2.218, -0.527, -0.225, -1.185, -2.833, 1.407 ], "frame": { "rmsd": null, "origin": [ 19.340, 82.349, -41.563 ], "x_axis": [ -0.581, 0.570, -0.581 ], "y_axis": [ 0.743, 0.079, -0.665 ], "z_axis": [ -0.333, -0.818, -0.469 ], "quaternion": [ 0.085, 0.450, 0.730, -0.508 ] } }, { "index": 72, "nt1": "///E/158", "nt2": "///E/162", "bp": "G-A", "name": "--", "Saenger": "--", "LW": "tWH", "DSSR": "tW-M", "intra_chain": true, "chi1": -157.535, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 57.246, "chi2": -155.065, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 8.742, "C1C1_dist": 13.411, "N1N9_dist": 11.260, "C6C8_dist": 10.976, "CNNC_torsion": 145.703, "hbonds_num": 1, "hbonds_desc": "N2(amino)*N6(amino)[2.84]", "interBase_angle": 27.317, "planarity": 0.481, "simple_Shear": 4.879, "simple_Stretch": 3.476, "simple_Buckle": -1.949, "simple_Propeller": 27.248, "bp_simpleParams": [ 4.879, 3.476, -2.022, -1.949, 27.248, -55.534 ], "bp_params": [ 5.990, 0.004, -2.022, 14.240, 23.312, -56.163 ], "frame": { "rmsd": null, "origin": [ 15.352, 75.800, -37.972 ], "x_axis": [ 0.077, 0.608, -0.790 ], "y_axis": [ 0.945, -0.296, -0.136 ], "z_axis": [ -0.317, -0.737, -0.597 ], "quaternion": [ 0.214, 0.702, 0.553, -0.394 ] } }, { "index": 73, "nt1": "///E/158", "nt2": "///E/163", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -157.535, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 51.179, "chi2": -167.708, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 64.206, "C1C1_dist": 10.178, "N1N9_dist": 8.644, "C6C8_dist": 9.779, "CNNC_torsion": 31.272, "hbonds_num": 3, "hbonds_desc": "N1(imino)-O2(carbonyl)[2.92],N1(imino)-N3[2.93],N2(amino)-O2(carbonyl)[2.65]", "interBase_angle": 32.212, "planarity": 0.420, "simple_Shear": -1.163, "simple_Stretch": -0.148, "simple_Buckle": -2.741, "simple_Propeller": 32.095, "bp_simpleParams": [ -1.163, -0.148, -0.704, -2.741, 32.095, 8.936 ], "bp_params": [ -1.137, -0.285, -0.704, -6.470, 31.556, 9.271 ], "frame": { "rmsd": null, "origin": [ 15.637, 78.468, -40.356 ], "x_axis": [ -0.463, 0.643, -0.610 ], "y_axis": [ 0.818, 0.045, -0.574 ], "z_axis": [ -0.342, -0.764, -0.547 ], "quaternion": [ 0.093, 0.509, 0.717, -0.467 ] } }, { "index": 74, "nt1": "///E/159", "nt2": "///E/162", "bp": "G-A", "name": "Sheared", "Saenger": "11-XI", "LW": "tSH", "DSSR": "tm-M", "intra_chain": true, "chi1": 175.351, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 88.395, "chi2": -155.065, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 10.321, "C1C1_dist": 9.738, "N1N9_dist": 8.385, "C6C8_dist": 8.524, "CNNC_torsion": -124.328, "hbonds_num": 3, "hbonds_desc": "N2(amino)-OP2[3.09],N2(amino)-N7[2.92],N3-N6(amino)[3.93]", "interBase_angle": 34.483, "planarity": 0.529, "simple_Shear": 7.708, "simple_Stretch": 2.730, "simple_Buckle": -10.597, "simple_Propeller": 32.815, "bp_simpleParams": [ 7.708, 2.730, 1.405, -10.597, 32.815, -15.236 ], "bp_params": [ 6.681, -4.714, 1.405, 20.862, 27.457, -15.437 ], "frame": { "rmsd": null, "origin": [ 13.973, 75.676, -39.460 ], "x_axis": [ 0.420, 0.537, -0.732 ], "y_axis": [ 0.865, -0.481, 0.144 ], "z_axis": [ -0.275, -0.693, -0.666 ], "quaternion": [ 0.261, 0.801, 0.437, -0.314 ] } }, { "index": 75, "nt1": "///E/160", "nt2": "///F/347", "bp": "A+G", "name": "--", "Saenger": "10-X", "LW": "tWS", "DSSR": "tW+m", "intra_chain": false, "chi1": -166.376, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 13.569, "chi2": -155.244, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 103.260, "C1C1_dist": 9.935, "N1N9_dist": 9.006, "C6C8_dist": 9.849, "CNNC_torsion": -147.936, "hbonds_num": 2, "hbonds_desc": "N6(amino)-N3[3.72],N1-N2(amino)[3.36]", "interBase_angle": 46.965, "planarity": 0.619, "simple_Shear": 2.808, "simple_Stretch": 4.657, "simple_Buckle": -43.444, "simple_Propeller": 17.841, "bp_simpleParams": [ 2.808, 4.657, 0.603, -43.444, 17.841, 75.329 ], "bp_params": [ -2.925, 4.584, 0.603, -34.820, -31.515, 74.906 ], "frame": { "rmsd": null, "origin": [ 9.107, 66.338, -37.761 ], "x_axis": [ 0.375, -0.558, 0.740 ], "y_axis": [ 0.921, 0.312, -0.232 ], "z_axis": [ -0.102, 0.769, 0.631 ], "quaternion": [ 0.761, -0.329, -0.276, -0.486 ] } }, { "index": 76, "nt1": "///F/339", "nt2": "///F/350", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -178.227, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 52.665, "chi2": -147.051, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 53.644, "C1C1_dist": 10.737, "N1N9_dist": 8.980, "C6C8_dist": 9.891, "CNNC_torsion": -4.365, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.84],N3-N1(imino)[2.90],N4(amino)-O6(carbonyl)[2.85]", "interBase_angle": 5.508, "planarity": 0.103, "simple_Shear": 0.063, "simple_Stretch": -0.144, "simple_Buckle": 0.875, "simple_Propeller": -5.438, "bp_simpleParams": [ 0.063, -0.144, -0.348, 0.875, -5.438, -0.836 ], "bp_params": [ 0.063, -0.144, -0.348, 0.865, -5.440, -0.837 ], "frame": { "rmsd": null, "origin": [ 0.888, 65.301, -27.380 ], "x_axis": [ 0.992, -0.081, 0.101 ], "y_axis": [ -0.101, -0.972, 0.210 ], "z_axis": [ 0.082, -0.219, -0.972 ], "quaternion": [ 0.108, 0.992, -0.046, 0.046 ] } }, { "index": 77, "nt1": "///F/340", "nt2": "///F/349", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -164.756, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 61.450, "chi2": -158.469, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 59.123, "C1C1_dist": 10.054, "N1N9_dist": 8.600, "C6C8_dist": 9.734, "CNNC_torsion": -1.713, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.71],O4(carbonyl)-N6(amino)[3.01]", "interBase_angle": 3.723, "planarity": 0.065, "simple_Shear": 0.127, "simple_Stretch": -0.188, "simple_Buckle": 3.662, "simple_Propeller": -0.671, "bp_simpleParams": [ 0.127, -0.188, 0.089, 3.662, -0.671, 7.819 ], "bp_params": [ 0.125, -0.189, 0.089, 3.657, -0.695, 7.815 ], "frame": { "rmsd": null, "origin": [ 2.198, 65.205, -30.692 ], "x_axis": [ 0.763, -0.558, 0.326 ], "y_axis": [ -0.628, -0.759, 0.171 ], "z_axis": [ 0.152, -0.335, -0.930 ], "quaternion": [ 0.136, 0.929, -0.319, 0.129 ] } }, { "index": 78, "nt1": "///F/341", "nt2": "///F/348", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -163.088, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 57.650, "chi2": 178.312, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 52.568, "C1C1_dist": 10.615, "N1N9_dist": 8.942, "C6C8_dist": 9.902, "CNNC_torsion": 3.115, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.79],N3-N1(imino)[2.93],N4(amino)-O6(carbonyl)[2.96]", "interBase_angle": 4.717, "planarity": 0.070, "simple_Shear": 0.398, "simple_Stretch": -0.121, "simple_Buckle": 3.198, "simple_Propeller": -3.468, "bp_simpleParams": [ 0.398, -0.121, -0.257, 3.198, -3.468, 1.141 ], "bp_params": [ 0.394, -0.134, -0.257, 3.077, -3.576, 1.141 ], "frame": { "rmsd": null, "origin": [ 4.435, 65.091, -33.579 ], "x_axis": [ 0.246, -0.841, 0.481 ], "y_axis": [ -0.926, -0.350, -0.139 ], "z_axis": [ 0.286, -0.412, -0.865 ], "quaternion": [ 0.087, 0.784, -0.563, 0.244 ] } }, { "index": 79, "nt1": "///F/342", "nt2": "///F/347", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -164.064, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 56.326, "chi2": -155.244, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 53.987, "C1C1_dist": 10.562, "N1N9_dist": 8.891, "C6C8_dist": 9.834, "CNNC_torsion": 9.219, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.76],N3-N1(imino)[2.86],N4(amino)-O6(carbonyl)[2.84]", "interBase_angle": 1.562, "planarity": 0.050, "simple_Shear": 0.323, "simple_Stretch": -0.193, "simple_Buckle": 0.199, "simple_Propeller": 1.549, "bp_simpleParams": [ 0.323, -0.193, -0.139, 0.199, 1.549, -0.119 ], "bp_params": [ 0.317, -0.202, -0.139, 0.242, 1.543, -0.119 ], "frame": { "rmsd": null, "origin": [ 7.621, 64.465, -36.176 ], "x_axis": [ -0.190, -0.878, 0.439 ], "y_axis": [ -0.945, 0.043, -0.323 ], "z_axis": [ 0.265, -0.476, -0.839 ], "quaternion": [ -0.060, -0.633, 0.720, -0.277 ] } }, { "index": 80, "nt1": "///F/343", "nt2": "///F/346", "bp": "U+G", "name": "--", "Saenger": "--", "LW": "tSW", "DSSR": "tm+W", "intra_chain": true, "chi1": -142.730, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 102.155, "chi2": 58.791, "conf2": "syn", "pucker2": "~C3'-endo", "lambda2": 21.976, "C1C1_dist": 9.715, "N1N9_dist": 8.890, "C6C8_dist": 10.281, "CNNC_torsion": 170.623, "hbonds_num": 2, "hbonds_desc": "O2'(hydroxyl)-O6(carbonyl)[2.72],O2(carbonyl)-N1(imino)[3.14]", "interBase_angle": 16.704, "planarity": 0.248, "simple_Shear": 3.813, "simple_Stretch": 3.657, "simple_Buckle": 16.704, "simple_Propeller": -0.106, "bp_simpleParams": [ 3.813, 3.657, -0.769, 16.704, -0.106, -99.680 ], "bp_params": [ 1.305, -5.119, -0.769, -8.316, -14.487, -99.983 ], "frame": { "rmsd": null, "origin": [ 9.646, 62.610, -38.311 ], "x_axis": [ -0.883, 0.049, -0.467 ], "y_axis": [ 0.351, 0.729, -0.588 ], "z_axis": [ 0.312, -0.683, -0.661 ], "quaternion": [ 0.215, 0.111, 0.905, -0.351 ] } }, { "index": 81, "nt1": "///G/1043", "nt2": "///G/1112", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -155.123, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 52.606, "chi2": -168.663, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 49.955, "C1C1_dist": 10.865, "N1N9_dist": 9.033, "C6C8_dist": 9.879, "CNNC_torsion": 1.851, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.91],N3-N1(imino)[2.93],N4(amino)-O6(carbonyl)[2.82]", "interBase_angle": 2.793, "planarity": 0.035, "simple_Shear": 0.203, "simple_Stretch": -0.137, "simple_Buckle": 2.784, "simple_Propeller": 0.227, "bp_simpleParams": [ 0.203, -0.137, -0.091, 2.784, 0.227, -3.355 ], "bp_params": [ 0.201, -0.140, -0.091, 2.787, 0.183, -3.354 ], "frame": { "rmsd": null, "origin": [ -12.381, -20.012, -94.217 ], "x_axis": [ 0.304, -0.948, 0.089 ], "y_axis": [ -0.850, -0.228, 0.475 ], "z_axis": [ -0.430, -0.220, -0.876 ], "quaternion": [ 0.224, 0.776, -0.579, -0.110 ] } }, { "index": 82, "nt1": "///G/1047", "nt2": "///G/1111", "bp": "G-A", "name": "Sheared", "Saenger": "11-XI", "LW": "tSH", "DSSR": "tm-M", "intra_chain": true, "chi1": -132.408, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 91.279, "chi2": -114.915, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 10.091, "C1C1_dist": 9.839, "N1N9_dist": 8.535, "C6C8_dist": 8.880, "CNNC_torsion": -106.472, "hbonds_num": 2, "hbonds_desc": "N2(amino)-N7[2.69],N3-N6(amino)[3.08]", "interBase_angle": 7.682, "planarity": 0.154, "simple_Shear": 7.492, "simple_Stretch": 2.590, "simple_Buckle": 3.318, "simple_Propeller": 6.929, "bp_simpleParams": [ 7.492, 2.590, 0.175, 3.318, 6.929, -10.725 ], "bp_params": [ 6.794, -4.084, 0.175, 7.442, 1.905, -10.704 ], "frame": { "rmsd": null, "origin": [ -14.985, -15.054, -103.001 ], "x_axis": [ -0.566, 0.278, -0.776 ], "y_axis": [ -0.823, -0.143, 0.549 ], "z_axis": [ 0.041, 0.950, 0.310 ], "quaternion": [ 0.387, -0.259, 0.528, 0.710 ] } }, { "index": 83, "nt1": "///G/1048", "nt2": "///G/1110", "bp": "A-G", "name": "Sheared", "Saenger": "11-XI", "LW": "tHS", "DSSR": "tM-m", "intra_chain": true, "chi1": -158.200, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 14.131, "chi2": -115.029, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 81.720, "C1C1_dist": 10.010, "N1N9_dist": 8.555, "C6C8_dist": 8.487, "CNNC_torsion": -151.461, "hbonds_num": 1, "hbonds_desc": "N7-N2(amino)[2.61]", "interBase_angle": 14.031, "planarity": 0.255, "simple_Shear": -7.949, "simple_Stretch": 3.685, "simple_Buckle": 4.705, "simple_Propeller": 13.219, "bp_simpleParams": [ -7.949, 3.685, 0.976, 4.705, 13.219, -38.063 ], "bp_params": [ -7.223, -4.960, 0.976, -8.987, 10.776, -38.112 ], "frame": { "rmsd": null, "origin": [ -13.913, -12.457, -99.967 ], "x_axis": [ -0.364, 0.448, -0.817 ], "y_axis": [ -0.930, -0.219, 0.294 ], "z_axis": [ -0.047, 0.867, 0.496 ], "quaternion": [ 0.478, -0.300, 0.403, 0.721 ] } }, { "index": 84, "nt1": "///G/1048", "nt2": "///G/1112", "bp": "A+G", "name": "Linker", "Saenger": "--", "LW": "tSS", "DSSR": "tm+m", "intra_chain": true, "chi1": -158.200, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 55.157, "chi2": -168.663, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 79.072, "C1C1_dist": 7.286, "N1N9_dist": 6.689, "C6C8_dist": 8.653, "CNNC_torsion": -157.747, "hbonds_num": 2, "hbonds_desc": "N1-O2'(hydroxyl)[2.58],N3-N2(amino)[2.89]", "interBase_angle": 59.481, "planarity": 0.669, "simple_Shear": 7.152, "simple_Stretch": 2.413, "simple_Buckle": -55.677, "simple_Propeller": 20.931, "bp_simpleParams": [ 7.152, 2.413, 2.284, -55.677, 20.931, 157.469 ], "bp_params": [ 3.550, 6.661, 2.284, -54.307, -24.264, 155.194 ], "frame": { "rmsd": null, "origin": [ -11.403, -16.524, -95.868 ], "x_axis": [ 0.955, 0.079, -0.285 ], "y_axis": [ -0.241, 0.765, -0.597 ], "z_axis": [ 0.171, 0.639, 0.750 ], "quaternion": [ 0.932, -0.332, 0.122, 0.086 ] } }, { "index": 85, "nt1": "///G/1051", "nt2": "///G/1108", "bp": "G-U", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -176.118, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 42.287, "chi2": -157.459, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 64.486, "C1C1_dist": 10.668, "N1N9_dist": 8.963, "C6C8_dist": 9.820, "CNNC_torsion": 6.140, "hbonds_num": 2, "hbonds_desc": "O6(carbonyl)-N3(imino)[2.92],N1(imino)-O2(carbonyl)[2.94]", "interBase_angle": 8.435, "planarity": 0.115, "simple_Shear": -2.235, "simple_Stretch": 0.091, "simple_Buckle": 8.406, "simple_Propeller": -0.697, "bp_simpleParams": [ -2.235, 0.091, 0.101, 8.406, -0.697, -3.069 ], "bp_params": [ -2.200, -0.402, 0.101, 8.354, 1.166, -3.061 ], "frame": { "rmsd": null, "origin": [ -16.011, -4.523, -98.962 ], "x_axis": [ -0.613, -0.737, 0.284 ], "y_axis": [ 0.478, -0.060, 0.876 ], "z_axis": [ -0.628, 0.674, 0.389 ], "quaternion": [ -0.423, -0.120, 0.540, 0.718 ] } }, { "index": 86, "nt1": "///G/1052", "nt2": "///G/1107", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -174.603, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 59.189, "chi2": -169.271, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 55.358, "C1C1_dist": 10.415, "N1N9_dist": 8.832, "C6C8_dist": 9.844, "CNNC_torsion": 2.941, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.75],N3-N1(imino)[2.88],N4(amino)-O6(carbonyl)[2.94]", "interBase_angle": 3.799, "planarity": 0.124, "simple_Shear": 0.417, "simple_Stretch": -0.188, "simple_Buckle": 1.199, "simple_Propeller": -3.605, "bp_simpleParams": [ 0.417, -0.188, -0.498, 1.199, -3.605, 3.003 ], "bp_params": [ 0.410, -0.203, -0.498, 1.064, -3.647, 3.004 ], "frame": { "rmsd": null, "origin": [ -19.825, -3.448, -98.034 ], "x_axis": [ -0.087, -0.616, 0.783 ], "y_axis": [ 0.744, 0.482, 0.462 ], "z_axis": [ -0.663, 0.623, 0.417 ], "quaternion": [ 0.673, -0.060, -0.537, -0.505 ] } }, { "index": 87, "nt1": "///G/1053", "nt2": "///G/1106", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -157.624, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 58.226, "chi2": -164.454, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 54.547, "C1C1_dist": 10.441, "N1N9_dist": 8.822, "C6C8_dist": 9.809, "CNNC_torsion": 4.812, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.70],N3-N1(imino)[2.83],N4(amino)-O6(carbonyl)[2.86]", "interBase_angle": 5.786, "planarity": 0.092, "simple_Shear": 0.341, "simple_Stretch": -0.214, "simple_Buckle": 3.759, "simple_Propeller": -4.399, "bp_simpleParams": [ 0.341, -0.214, -0.339, 3.759, -4.399, 1.922 ], "bp_params": [ 0.335, -0.224, -0.339, 3.630, -4.506, 1.922 ], "frame": { "rmsd": null, "origin": [ -23.037, -2.063, -97.008 ], "x_axis": [ 0.466, -0.356, 0.810 ], "y_axis": [ 0.601, 0.799, 0.005 ], "z_axis": [ -0.649, 0.485, 0.586 ], "quaternion": [ 0.844, -0.142, -0.432, -0.283 ] } }, { "index": 88, "nt1": "///G/1054", "nt2": "///G/1105", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -166.912, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 59.483, "chi2": -162.772, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 60.334, "C1C1_dist": 10.063, "N1N9_dist": 8.596, "C6C8_dist": 9.714, "CNNC_torsion": 8.138, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.96],N1-N3(imino)[2.68]", "interBase_angle": 3.030, "planarity": 0.051, "simple_Shear": -0.059, "simple_Stretch": -0.215, "simple_Buckle": -2.223, "simple_Propeller": 2.059, "bp_simpleParams": [ -0.059, -0.215, 0.015, -2.223, 2.059, 7.082 ], "bp_params": [ -0.059, -0.215, 0.015, -2.225, 2.057, 7.082 ], "frame": { "rmsd": null, "origin": [ -25.429, -1.938, -94.177 ], "x_axis": [ 0.783, 0.069, 0.618 ], "y_axis": [ 0.266, 0.861, -0.433 ], "z_axis": [ -0.562, 0.503, 0.656 ], "quaternion": [ 0.908, -0.258, -0.325, -0.054 ] } }, { "index": 89, "nt1": "///G/1055", "nt2": "///G/1085", "bp": "G+A", "name": "Linker", "Saenger": "--", "LW": "tSS", "DSSR": "tm+m", "intra_chain": true, "chi1": 173.190, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 89.338, "chi2": -139.994, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 66.081, "C1C1_dist": 8.129, "N1N9_dist": 8.017, "C6C8_dist": 10.354, "CNNC_torsion": 168.453, "hbonds_num": 2, "hbonds_desc": "O2'(hydroxyl)-N1[2.86],N2(amino)-N3[3.23]", "interBase_angle": 34.738, "planarity": 0.496, "simple_Shear": 7.095, "simple_Stretch": 4.380, "simple_Buckle": -29.826, "simple_Propeller": -17.808, "bp_simpleParams": [ 7.095, 4.380, -0.600, -29.826, -17.808, -156.406 ], "bp_params": [ -2.520, -7.949, -0.600, 11.209, 32.880, -157.231 ], "frame": { "rmsd": null, "origin": [ -31.054, -0.837, -92.677 ], "x_axis": [ -0.033, 0.915, -0.402 ], "y_axis": [ -0.895, -0.206, -0.395 ], "z_axis": [ -0.444, 0.347, 0.826 ], "quaternion": [ 0.630, -0.295, -0.017, 0.718 ] } }, { "index": 90, "nt1": "///G/1055", "nt2": "///G/1104", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": 173.190, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 55.790, "chi2": -163.065, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 55.654, "C1C1_dist": 10.628, "N1N9_dist": 8.977, "C6C8_dist": 9.953, "CNNC_torsion": -0.366, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.99],N1(imino)-N3[2.97],N2(amino)-O2(carbonyl)[2.86]", "interBase_angle": 6.275, "planarity": 0.145, "simple_Shear": -0.213, "simple_Stretch": -0.068, "simple_Buckle": -4.983, "simple_Propeller": 3.814, "bp_simpleParams": [ -0.213, -0.068, 0.287, -4.983, 3.814, 1.390 ], "bp_params": [ -0.212, -0.071, 0.287, -5.050, 3.724, 1.390 ], "frame": { "rmsd": null, "origin": [ -27.174, -1.296, -90.952 ], "x_axis": [ 0.922, 0.319, 0.221 ], "y_axis": [ -0.109, 0.759, -0.641 ], "z_axis": [ -0.373, 0.567, 0.735 ], "quaternion": [ 0.924, -0.327, -0.161, 0.116 ] } }, { "index": 91, "nt1": "///G/1056", "nt2": "///G/1103", "bp": "G-A", "name": "Sheared", "Saenger": "11-XI", "LW": "tSH", "DSSR": "tm-M", "intra_chain": true, "chi1": -132.836, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 94.558, "chi2": -166.606, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 11.871, "C1C1_dist": 9.406, "N1N9_dist": 8.195, "C6C8_dist": 8.600, "CNNC_torsion": 99.203, "hbonds_num": 3, "hbonds_desc": "O2'(hydroxyl)-N6(amino)[3.19],N2(amino)-N7[2.75],N3-N6(amino)[3.18]", "interBase_angle": 5.364, "planarity": 0.277, "simple_Shear": 7.506, "simple_Stretch": 2.119, "simple_Buckle": -5.026, "simple_Propeller": 1.874, "bp_simpleParams": [ 7.506, 2.119, -1.456, -5.026, 1.874, -7.498 ], "bp_params": [ 6.467, -4.360, -1.456, -1.818, 5.046, -7.505 ], "frame": { "rmsd": null, "origin": [ -28.568, -0.592, -87.240 ], "x_axis": [ 0.188, 0.860, -0.474 ], "y_axis": [ -0.975, 0.104, -0.198 ], "z_axis": [ -0.121, 0.499, 0.858 ], "quaternion": [ 0.733, -0.238, 0.120, 0.626 ] } }, { "index": 92, "nt1": "///G/1057", "nt2": "///G/1081", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -179.846, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 55.374, "chi2": -170.259, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 56.201, "C1C1_dist": 10.539, "N1N9_dist": 8.889, "C6C8_dist": 9.861, "CNNC_torsion": -3.819, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.94],N1-N3(imino)[2.86]", "interBase_angle": 0.941, "planarity": 0.019, "simple_Shear": -0.048, "simple_Stretch": -0.092, "simple_Buckle": 0.138, "simple_Propeller": -0.930, "bp_simpleParams": [ -0.048, -0.092, -0.008, 0.138, -0.930, 0.800 ], "bp_params": [ -0.048, -0.092, -0.008, 0.139, -0.930, 0.793 ], "frame": { "rmsd": null, "origin": [ -40.919, -3.426, -87.901 ], "x_axis": [ 0.671, -0.568, 0.477 ], "y_axis": [ 0.696, 0.703, -0.142 ], "z_axis": [ -0.255, 0.427, 0.868 ], "quaternion": [ 0.900, -0.158, -0.203, -0.351 ] } }, { "index": 93, "nt1": "///G/1058", "nt2": "///G/1080", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -158.443, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 57.559, "chi2": -169.935, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 59.530, "C1C1_dist": 10.309, "N1N9_dist": 8.782, "C6C8_dist": 9.835, "CNNC_torsion": 0.952, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.80],O4(carbonyl)-N6(amino)[2.98]", "interBase_angle": 1.961, "planarity": 0.037, "simple_Shear": -0.083, "simple_Stretch": -0.108, "simple_Buckle": -1.902, "simple_Propeller": -0.478, "bp_simpleParams": [ -0.083, -0.108, -0.074, -1.902, -0.478, 4.184 ], "bp_params": [ -0.081, -0.109, -0.074, -1.895, -0.504, 4.183 ], "frame": { "rmsd": null, "origin": [ -42.959, -3.843, -84.574 ], "x_axis": [ 0.929, -0.071, 0.364 ], "y_axis": [ 0.211, 0.908, -0.362 ], "z_axis": [ -0.305, 0.414, 0.858 ], "quaternion": [ 0.961, -0.202, -0.174, -0.073 ] } }, { "index": 94, "nt1": "///G/1059", "nt2": "///G/1079", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -144.317, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 52.623, "chi2": -166.371, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 52.900, "C1C1_dist": 10.830, "N1N9_dist": 9.055, "C6C8_dist": 9.935, "CNNC_torsion": 1.408, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.85],N1(imino)-N3[2.95],N2(amino)-O2(carbonyl)[2.91]", "interBase_angle": 1.051, "planarity": 0.019, "simple_Shear": -0.137, "simple_Stretch": -0.094, "simple_Buckle": -0.801, "simple_Propeller": -0.680, "bp_simpleParams": [ -0.137, -0.094, -0.054, -0.801, -0.680, -2.408 ], "bp_params": [ -0.136, -0.095, -0.054, -0.794, -0.687, -2.408 ], "frame": { "rmsd": null, "origin": [ -43.961, -4.273, -81.125 ], "x_axis": [ 0.944, 0.329, -0.039 ], "y_axis": [ -0.320, 0.874, -0.366 ], "z_axis": [ -0.086, 0.357, 0.930 ], "quaternion": [ 0.968, -0.187, -0.012, 0.168 ] } }, { "index": 95, "nt1": "///G/1060", "nt2": "///G/1088", "bp": "U+A", "name": "--", "Saenger": "--", "LW": "cWH", "DSSR": "cW+M", "intra_chain": true, "chi1": -134.507, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 65.123, "chi2": 63.525, "conf2": "syn", "pucker2": "~C2'-endo", "lambda2": 40.042, "C1C1_dist": 7.632, "N1N9_dist": 5.910, "C6C8_dist": 5.671, "CNNC_torsion": -9.902, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N7[2.20],O4(carbonyl)-N6(amino)[2.31]", "interBase_angle": 7.049, "planarity": 0.281, "simple_Shear": -2.094, "simple_Stretch": -0.126, "simple_Buckle": 2.415, "simple_Propeller": 6.623, "bp_simpleParams": [ -2.094, -0.126, 0.336, 2.415, 6.623, -76.471 ], "bp_params": [ -0.879, 1.905, 0.336, 7.047, 0.160, -76.366 ], "frame": { "rmsd": null, "origin": [ -44.538, -4.155, -77.651 ], "x_axis": [ -0.992, 0.069, -0.103 ], "y_axis": [ 0.084, 0.984, -0.156 ], "z_axis": [ 0.091, -0.164, -0.982 ], "quaternion": [ 0.049, 0.038, 0.995, -0.080 ] } }, { "index": 96, "nt1": "///G/1062", "nt2": "///G/1076", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -177.423, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 51.676, "chi2": -157.624, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 53.861, "C1C1_dist": 10.768, "N1N9_dist": 8.997, "C6C8_dist": 9.888, "CNNC_torsion": 1.708, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.85],N1(imino)-N3[2.92],N2(amino)-O2(carbonyl)[2.86]", "interBase_angle": 0.885, "planarity": 0.028, "simple_Shear": -0.226, "simple_Stretch": -0.136, "simple_Buckle": 0.575, "simple_Propeller": -0.673, "bp_simpleParams": [ -0.226, -0.136, -0.078, 0.575, -0.673, -1.827 ], "bp_params": [ -0.224, -0.140, -0.078, 0.587, -0.662, -1.827 ], "frame": { "rmsd": null, "origin": [ -41.104, -3.024, -70.161 ], "x_axis": [ 0.919, 0.394, 0.028 ], "y_axis": [ -0.213, 0.553, -0.806 ], "z_axis": [ -0.332, 0.734, 0.592 ], "quaternion": [ 0.875, -0.440, -0.103, 0.173 ] } }, { "index": 97, "nt1": "///G/1063", "nt2": "///G/1075", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -168.978, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 52.743, "chi2": -164.935, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 54.225, "C1C1_dist": 10.726, "N1N9_dist": 8.984, "C6C8_dist": 9.889, "CNNC_torsion": 1.657, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.86],N1(imino)-N3[2.91],N2(amino)-O2(carbonyl)[2.84]", "interBase_angle": 0.703, "planarity": 0.016, "simple_Shear": -0.219, "simple_Stretch": -0.136, "simple_Buckle": -0.501, "simple_Propeller": -0.492, "bp_simpleParams": [ -0.219, -0.136, -0.056, -0.501, -0.492, -1.395 ], "bp_params": [ -0.217, -0.140, -0.056, -0.492, -0.501, -1.395 ], "frame": { "rmsd": null, "origin": [ -41.437, -1.457, -67.022 ], "x_axis": [ 0.665, 0.501, -0.554 ], "y_axis": [ -0.715, 0.214, -0.666 ], "z_axis": [ -0.215, 0.839, 0.500 ], "quaternion": [ 0.771, -0.488, 0.110, 0.394 ] } }, { "index": 98, "nt1": "///G/1064", "nt2": "///G/1074", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -160.969, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 55.385, "chi2": -174.795, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 53.764, "C1C1_dist": 10.702, "N1N9_dist": 9.005, "C6C8_dist": 9.944, "CNNC_torsion": -0.471, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.83],N3-N1(imino)[2.94],N4(amino)-O6(carbonyl)[2.92]", "interBase_angle": 0.853, "planarity": 0.018, "simple_Shear": 0.215, "simple_Stretch": -0.087, "simple_Buckle": -0.681, "simple_Propeller": -0.514, "bp_simpleParams": [ 0.215, -0.087, -0.033, -0.681, -0.514, -0.068 ], "bp_params": [ 0.213, -0.090, -0.033, -0.690, -0.502, -0.068 ], "frame": { "rmsd": null, "origin": [ -40.120, 1.568, -65.081 ], "x_axis": [ 0.137, 0.511, -0.848 ], "y_axis": [ -0.976, -0.078, -0.205 ], "z_axis": [ -0.171, 0.856, 0.488 ], "quaternion": [ 0.622, -0.426, 0.272, 0.598 ] } }, { "index": 99, "nt1": "///G/1065", "nt2": "///G/1073", "bp": "U-A", "name": "--", "Saenger": "--", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -153.800, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 88.511, "chi2": -161.957, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 22.912, "C1C1_dist": 10.941, "N1N9_dist": 9.601, "C6C8_dist": 10.331, "CNNC_torsion": 14.646, "hbonds_num": 1, "hbonds_desc": "O2(carbonyl)-N6(amino)[2.83]", "interBase_angle": 19.087, "planarity": 0.300, "simple_Shear": 5.650, "simple_Stretch": 2.284, "simple_Buckle": -11.756, "simple_Propeller": -15.037, "bp_simpleParams": [ 5.650, 2.284, -0.465, -11.756, -15.037, 0.989 ], "bp_params": [ 5.937, -1.374, -0.465, -18.254, -5.578, 0.978 ], "frame": { "rmsd": null, "origin": [ -39.523, 5.365, -63.963 ], "x_axis": [ -0.690, 0.177, -0.702 ], "y_axis": [ -0.723, -0.220, 0.655 ], "z_axis": [ -0.038, 0.959, 0.279 ], "quaternion": [ 0.304, -0.250, 0.546, 0.740 ] } }, { "index": 100, "nt1": "///G/1071", "nt2": "///G/1091", "bp": "G+G", "name": "--", "Saenger": "06-VI", "LW": "cWH", "DSSR": "cW+M", "intra_chain": true, "chi1": -170.637, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 59.461, "chi2": -162.888, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 23.410, "C1C1_dist": 11.691, "N1N9_dist": 9.637, "C6C8_dist": 9.291, "CNNC_torsion": -10.554, "hbonds_num": 2, "hbonds_desc": "N1(imino)-O6(carbonyl)[2.74],N2(amino)-N7[3.03]", "interBase_angle": 9.008, "planarity": 0.187, "simple_Shear": -2.622, "simple_Stretch": 2.464, "simple_Buckle": 7.694, "simple_Propeller": -4.685, "bp_simpleParams": [ -2.622, 2.464, -0.441, 7.694, -4.685, -94.855 ], "bp_params": [ 1.372, 3.326, -0.441, -1.641, -8.857, -95.020 ], "frame": { "rmsd": null, "origin": [ -27.573, 4.790, -78.384 ], "x_axis": [ -0.769, 0.488, -0.413 ], "y_axis": [ -0.637, -0.644, 0.423 ], "z_axis": [ -0.060, 0.589, 0.806 ], "quaternion": [ 0.314, -0.132, 0.282, 0.897 ] } }, { "index": 101, "nt1": "///G/1071", "nt2": "///G/1100", "bp": "G-C", "name": "--", "Saenger": "--", "LW": "--", "DSSR": "--", "intra_chain": true, "chi1": -170.637, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 12.244, "chi2": -162.742, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 4.789, "C1C1_dist": 14.148, "N1N9_dist": 11.260, "C6C8_dist": 10.010, "CNNC_torsion": 73.411, "hbonds_num": 1, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.65]", "interBase_angle": 9.815, "planarity": 0.119, "simple_Shear": 0.885, "simple_Stretch": 3.259, "simple_Buckle": -1.023, "simple_Propeller": -9.761, "bp_simpleParams": [ 0.885, 3.259, -0.592, -1.023, -9.761, -94.304 ], "bp_params": [ 1.282, 3.124, -0.592, -2.221, -9.560, -94.492 ], "frame": { "rmsd": null, "origin": [ -27.673, 4.786, -78.300 ], "x_axis": [ -0.765, 0.487, -0.420 ], "y_axis": [ -0.641, -0.639, 0.426 ], "z_axis": [ -0.061, 0.595, 0.801 ], "quaternion": [ 0.315, -0.134, 0.285, 0.895 ] } }, { "index": 102, "nt1": "///G/1072", "nt2": "///G/1092", "bp": "C+C", "name": "--", "Saenger": "--", "LW": "cWH", "DSSR": "cW+M", "intra_chain": true, "chi1": -149.418, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 75.348, "chi2": -162.973, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 28.339, "C1C1_dist": 9.424, "N1N9_dist": 7.794, "C6C8_dist": 7.897, "CNNC_torsion": -7.560, "hbonds_num": 2, "hbonds_desc": "O2(carbonyl)-N4(amino)[2.90],N3-N4(amino)[2.65]", "interBase_angle": 14.948, "planarity": 0.174, "simple_Shear": -1.357, "simple_Stretch": 1.816, "simple_Buckle": 14.137, "simple_Propeller": 4.857, "bp_simpleParams": [ -1.357, 1.816, -0.874, 14.137, 4.857, -76.052 ], "bp_params": [ 1.476, 1.721, -0.874, 7.811, -12.745, -76.268 ], "frame": { "rmsd": null, "origin": [ -28.387, 8.121, -77.176 ], "x_axis": [ -0.997, -0.043, -0.066 ], "y_axis": [ -0.013, -0.737, 0.676 ], "z_axis": [ -0.077, 0.675, 0.734 ], "quaternion": [ -0.008, -0.038, 0.363, 0.931 ] } }, { "index": 103, "nt1": "///G/1072", "nt2": "///G/1099", "bp": "C-G", "name": "--", "Saenger": "--", "LW": "tW.", "DSSR": "tW-.", "intra_chain": true, "chi1": -149.418, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 23.145, "chi2": -168.386, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 9.612, "C1C1_dist": 13.404, "N1N9_dist": 10.620, "C6C8_dist": 9.770, "CNNC_torsion": 8.741, "hbonds_num": 1, "hbonds_desc": "N4(amino)-O6(carbonyl)[3.29]", "interBase_angle": 14.986, "planarity": 0.167, "simple_Shear": 1.354, "simple_Stretch": 2.029, "simple_Buckle": 9.992, "simple_Propeller": -11.169, "bp_simpleParams": [ 1.354, 2.029, -0.993, 9.992, -11.169, -76.363 ], "bp_params": [ 1.684, 1.765, -0.993, 7.911, -12.728, -76.575 ], "frame": { "rmsd": null, "origin": [ -28.290, 8.183, -77.141 ], "x_axis": [ -0.997, -0.044, -0.064 ], "y_axis": [ -0.010, -0.738, 0.675 ], "z_axis": [ -0.077, 0.674, 0.735 ], "quaternion": [ -0.009, -0.038, 0.362, 0.931 ] } }, { "index": 104, "nt1": "///G/1083", "nt2": "///G/1085", "bp": "U-A", "name": "--", "Saenger": "--", "LW": "tSH", "DSSR": "tm-M", "intra_chain": true, "chi1": -170.236, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 87.889, "chi2": -139.994, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 40.583, "C1C1_dist": 6.719, "N1N9_dist": 6.044, "C6C8_dist": 6.166, "CNNC_torsion": -161.599, "hbonds_num": 1, "hbonds_desc": "O2'(hydroxyl)-N7[2.80]", "interBase_angle": 36.163, "planarity": 0.503, "simple_Shear": 8.211, "simple_Stretch": 6.178, "simple_Buckle": -26.523, "simple_Propeller": 24.583, "bp_simpleParams": [ 8.211, 6.178, -0.271, -26.523, 24.583, -64.427 ], "bp_params": [ 5.751, -8.515, -0.271, 25.870, 25.269, -64.395 ], "frame": { "rmsd": null, "origin": [ -35.734, -5.152, -92.798 ], "x_axis": [ -0.835, -0.511, -0.202 ], "y_axis": [ -0.355, 0.783, -0.511 ], "z_axis": [ 0.419, -0.355, -0.835 ], "quaternion": [ 0.167, -0.233, 0.929, -0.233 ] } }, { "index": 105, "nt1": "///G/1087", "nt2": "///G/1102", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -98.675, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 53.379, "chi2": -172.825, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 54.693, "C1C1_dist": 10.755, "N1N9_dist": 9.034, "C6C8_dist": 9.951, "CNNC_torsion": -1.820, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.92],N1(imino)-N3[2.95],N2(amino)-O2(carbonyl)[2.85]", "interBase_angle": 0.965, "planarity": 0.020, "simple_Shear": -0.195, "simple_Stretch": -0.079, "simple_Buckle": -0.908, "simple_Propeller": -0.329, "bp_simpleParams": [ -0.195, -0.079, 0.003, -0.908, -0.329, -0.777 ], "bp_params": [ -0.193, -0.082, 0.003, -0.903, -0.342, -0.777 ], "frame": { "rmsd": null, "origin": [ -29.739, -1.143, -82.315 ], "x_axis": [ -0.478, 0.788, -0.388 ], "y_axis": [ -0.876, -0.457, 0.150 ], "z_axis": [ -0.059, 0.412, 0.909 ], "quaternion": [ 0.493, -0.133, 0.167, 0.843 ] } }, { "index": 106, "nt1": "///G/1089", "nt2": "///G/1090", "bp": "A+A", "name": "Platform", "Saenger": "--", "LW": "cSH", "DSSR": "cm+M", "intra_chain": true, "chi1": -159.165, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 132.723, "chi2": -158.513, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 40.662, "C1C1_dist": 7.276, "N1N9_dist": 7.163, "C6C8_dist": 7.175, "CNNC_torsion": -4.734, "hbonds_num": 1, "hbonds_desc": "O2'(hydroxyl)-N7[2.89]", "interBase_angle": 2.252, "planarity": 0.117, "simple_Shear": -0.043, "simple_Stretch": 6.817, "simple_Buckle": -0.092, "simple_Propeller": -2.250, "bp_simpleParams": [ -0.043, 6.817, -0.550, -0.092, -2.250, -3.705 ], "bp_params": [ 6.754, 0.927, -0.550, -2.243, -0.201, -3.704 ], "frame": { "rmsd": null, "origin": [ -29.995, 2.423, -80.789 ], "x_axis": [ -0.966, 0.202, -0.158 ], "y_axis": [ -0.256, -0.803, 0.538 ], "z_axis": [ -0.018, 0.561, 0.828 ], "quaternion": [ 0.121, -0.047, 0.290, 0.948 ] } }, { "index": 107, "nt1": "///G/1090", "nt2": "///G/1101", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -158.513, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 60.739, "chi2": 179.354, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 61.996, "C1C1_dist": 10.000, "N1N9_dist": 8.597, "C6C8_dist": 9.761, "CNNC_torsion": 5.912, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.05],N1-N3(imino)[2.72]", "interBase_angle": 0.974, "planarity": 0.028, "simple_Shear": -0.068, "simple_Stretch": -0.161, "simple_Buckle": -0.677, "simple_Propeller": 0.700, "bp_simpleParams": [ -0.068, -0.161, -0.050, -0.677, 0.700, 8.918 ], "bp_params": [ -0.068, -0.161, -0.050, -0.678, 0.699, 8.918 ], "frame": { "rmsd": null, "origin": [ -26.674, 2.226, -80.217 ], "x_axis": [ -0.954, 0.241, -0.180 ], "y_axis": [ -0.301, -0.778, 0.551 ], "z_axis": [ -0.007, 0.580, 0.815 ], "quaternion": [ 0.144, -0.050, 0.300, 0.942 ] } }, { "index": 108, "nt1": "///G/1091", "nt2": "///G/1100", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -162.888, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 55.137, "chi2": -162.742, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 55.967, "C1C1_dist": 10.642, "N1N9_dist": 8.988, "C6C8_dist": 9.945, "CNNC_torsion": 8.887, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.93],N1(imino)-N3[2.94],N2(amino)-O2(carbonyl)[2.81]", "interBase_angle": 0.931, "planarity": 0.046, "simple_Shear": -0.200, "simple_Stretch": -0.088, "simple_Buckle": -0.931, "simple_Propeller": 0.001, "bp_simpleParams": [ -0.200, -0.088, -0.144, -0.931, 0.001, 0.490 ], "bp_params": [ -0.198, -0.091, -0.144, -0.931, -0.014, 0.490 ], "frame": { "rmsd": null, "origin": [ -26.100, 5.652, -78.543 ], "x_axis": [ -0.986, -0.168, -0.003 ], "y_axis": [ 0.126, -0.750, 0.649 ], "z_axis": [ -0.111, 0.640, 0.760 ], "quaternion": [ -0.079, -0.030, 0.345, 0.935 ] } }, { "index": 109, "nt1": "///G/1092", "nt2": "///G/1099", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -162.973, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 55.336, "chi2": -168.386, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 53.877, "C1C1_dist": 10.703, "N1N9_dist": 9.009, "C6C8_dist": 9.943, "CNNC_torsion": 5.377, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.84],N3-N1(imino)[2.94],N4(amino)-O6(carbonyl)[2.92]", "interBase_angle": 0.138, "planarity": 0.031, "simple_Shear": 0.204, "simple_Stretch": -0.088, "simple_Buckle": 0.109, "simple_Propeller": -0.085, "bp_simpleParams": [ 0.204, -0.088, -0.093, 0.109, -0.085, -0.303 ], "bp_params": [ 0.203, -0.091, -0.093, 0.127, -0.053, -0.289 ], "frame": { "rmsd": null, "origin": [ -27.577, 9.144, -77.354 ], "x_axis": [ -0.773, -0.574, 0.270 ], "y_axis": [ 0.606, -0.543, 0.582 ], "z_axis": [ -0.188, 0.613, 0.767 ], "quaternion": [ -0.336, 0.023, 0.340, 0.878 ] } }, { "index": 110, "nt1": "///G/1093", "nt2": "///G/1098", "bp": "G-A", "name": "Sheared", "Saenger": "11-XI", "LW": "tSH", "DSSR": "tm-M", "intra_chain": true, "chi1": -158.734, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 97.828, "chi2": -166.886, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 9.201, "C1C1_dist": 9.687, "N1N9_dist": 8.529, "C6C8_dist": 8.999, "CNNC_torsion": 53.400, "hbonds_num": 3, "hbonds_desc": "O2'(hydroxyl)-N6(amino)[3.07],N2(amino)-N7[2.91],N3-N6(amino)[2.96]", "interBase_angle": 0.375, "planarity": 0.011, "simple_Shear": 7.452, "simple_Stretch": 2.548, "simple_Buckle": -0.318, "simple_Propeller": -0.199, "bp_simpleParams": [ 7.452, 2.548, -0.016, -0.318, -0.199, -2.411 ], "bp_params": [ 6.803, -3.969, -0.016, -0.358, 0.110, -2.411 ], "frame": { "rmsd": null, "origin": [ -29.303, 11.364, -75.220 ], "x_axis": [ 0.127, -0.803, 0.582 ], "y_axis": [ 0.948, 0.270, 0.166 ], "z_axis": [ -0.290, 0.531, 0.796 ], "quaternion": [ 0.740, -0.123, -0.295, -0.591 ] } }, { "index": 111, "nt1": "///I/2646", "nt2": "///I/2674", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -169.502, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 52.218, "chi2": -164.550, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 50.081, "C1C1_dist": 10.786, "N1N9_dist": 8.953, "C6C8_dist": 9.796, "CNNC_torsion": 10.587, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.88],N3-N1(imino)[2.86],N4(amino)-O6(carbonyl)[2.74]", "interBase_angle": 5.348, "planarity": 0.077, "simple_Shear": 0.248, "simple_Stretch": -0.220, "simple_Buckle": -0.137, "simple_Propeller": 5.346, "bp_simpleParams": [ 0.248, -0.220, 0.065, -0.137, 5.346, -3.738 ], "bp_params": [ 0.244, -0.225, 0.065, -0.028, 5.348, -3.741 ], "frame": { "rmsd": null, "origin": [ 19.909, 24.383, -47.561 ], "x_axis": [ 0.626, 0.502, -0.596 ], "y_axis": [ 0.153, -0.829, -0.538 ], "z_axis": [ -0.765, 0.246, -0.596 ], "quaternion": [ -0.224, 0.873, 0.188, -0.390 ] } }, { "index": 112, "nt1": "///I/2647", "nt2": "///I/2673", "bp": "U-G", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -166.528, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 69.667, "chi2": -178.312, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 40.282, "C1C1_dist": 10.428, "N1N9_dist": 8.815, "C6C8_dist": 9.718, "CNNC_torsion": 4.894, "hbonds_num": 2, "hbonds_desc": "O2(carbonyl)-N1(imino)[2.76],N3(imino)-O6(carbonyl)[2.82]", "interBase_angle": 5.611, "planarity": 0.071, "simple_Shear": 2.563, "simple_Stretch": 0.047, "simple_Buckle": 5.494, "simple_Propeller": 1.142, "bp_simpleParams": [ 2.563, 0.047, -0.145, 5.494, 1.142, -0.579 ], "bp_params": [ 2.492, -0.598, -0.145, 5.604, -0.277, -0.578 ], "frame": { "rmsd": null, "origin": [ 18.644, 27.237, -49.812 ], "x_axis": [ 0.623, -0.152, -0.767 ], "y_axis": [ -0.360, -0.927, -0.109 ], "z_axis": [ -0.694, 0.344, -0.632 ], "quaternion": [ -0.127, 0.892, -0.143, -0.410 ] } }, { "index": 113, "nt1": "///I/2648", "nt2": "///I/2672", "bp": "G-U", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -169.896, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 39.177, "chi2": -156.150, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 62.857, "C1C1_dist": 10.745, "N1N9_dist": 8.953, "C6C8_dist": 9.733, "CNNC_torsion": -0.246, "hbonds_num": 2, "hbonds_desc": "O6(carbonyl)-N3(imino)[2.82],N1(imino)-O2(carbonyl)[2.95]", "interBase_angle": 1.208, "planarity": 0.027, "simple_Shear": -2.237, "simple_Stretch": -0.008, "simple_Buckle": -1.031, "simple_Propeller": -0.629, "bp_simpleParams": [ -2.237, -0.008, 0.088, -1.031, -0.629, -6.389 ], "bp_params": [ -2.180, -0.499, 0.088, -0.867, -0.841, -6.389 ], "frame": { "rmsd": null, "origin": [ 16.292, 31.206, -50.931 ], "x_axis": [ 0.502, -0.332, -0.798 ], "y_axis": [ -0.423, -0.900, 0.108 ], "z_axis": [ -0.754, 0.283, -0.592 ], "quaternion": [ -0.051, 0.865, -0.218, -0.449 ] } }, { "index": 114, "nt1": "///I/2649", "nt2": "///I/2671", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -162.134, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 53.060, "chi2": -163.476, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 53.734, "C1C1_dist": 10.771, "N1N9_dist": 9.023, "C6C8_dist": 9.908, "CNNC_torsion": 0.676, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.89],N3-N1(imino)[2.92],N4(amino)-O6(carbonyl)[2.82]", "interBase_angle": 5.822, "planarity": 0.072, "simple_Shear": 0.119, "simple_Stretch": -0.112, "simple_Buckle": 5.728, "simple_Propeller": -1.044, "bp_simpleParams": [ 0.119, -0.112, -0.112, 5.728, -1.044, -2.333 ], "bp_params": [ 0.118, -0.113, -0.112, 5.720, -1.086, -2.331 ], "frame": { "rmsd": null, "origin": [ 14.714, 32.679, -53.679 ], "x_axis": [ 0.065, -0.834, -0.548 ], "y_axis": [ -0.639, -0.456, 0.619 ], "z_axis": [ -0.767, 0.310, -0.562 ], "quaternion": [ 0.107, 0.722, -0.510, -0.455 ] } }, { "index": 115, "nt1": "///I/2650", "nt2": "///I/2670", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -168.753, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 56.166, "chi2": -164.509, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 55.193, "C1C1_dist": 10.548, "N1N9_dist": 8.895, "C6C8_dist": 9.850, "CNNC_torsion": 2.782, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.87],O4(carbonyl)-N6(amino)[2.93]", "interBase_angle": 5.392, "planarity": 0.072, "simple_Shear": 0.102, "simple_Stretch": -0.091, "simple_Buckle": 5.206, "simple_Propeller": 1.402, "bp_simpleParams": [ 0.102, -0.091, -0.019, 5.206, 1.402, 0.127 ], "bp_params": [ 0.101, -0.091, -0.019, 5.214, 1.371, 0.127 ], "frame": { "rmsd": null, "origin": [ 13.091, 34.235, -56.725 ], "x_axis": [ -0.244, -0.957, -0.160 ], "y_axis": [ -0.540, -0.003, 0.842 ], "z_axis": [ -0.806, 0.292, -0.516 ], "quaternion": [ -0.244, -0.565, 0.663, 0.428 ] } }, { "index": 116, "nt1": "///I/2651", "nt2": "///I/2669", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -165.072, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 56.733, "chi2": -166.555, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 56.888, "C1C1_dist": 10.547, "N1N9_dist": 8.944, "C6C8_dist": 9.940, "CNNC_torsion": 3.668, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.78],N3-N1(imino)[2.93],N4(amino)-O6(carbonyl)[2.97]", "interBase_angle": 7.337, "planarity": 0.088, "simple_Shear": 0.185, "simple_Stretch": -0.080, "simple_Buckle": 5.690, "simple_Propeller": -4.632, "bp_simpleParams": [ 0.185, -0.080, -0.238, 5.690, -4.632, 2.000 ], "bp_params": [ 0.184, -0.083, -0.238, 5.628, -4.707, 1.999 ], "frame": { "rmsd": null, "origin": [ 11.349, 34.498, -59.824 ], "x_axis": [ -0.437, -0.808, 0.395 ], "y_axis": [ -0.352, 0.558, 0.752 ], "z_axis": [ -0.828, 0.189, -0.528 ], "quaternion": [ -0.385, -0.365, 0.794, 0.296 ] } }, { "index": 117, "nt1": "///I/2652", "nt2": "///I/2668", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -167.799, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 56.969, "chi2": -169.781, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 56.320, "C1C1_dist": 10.551, "N1N9_dist": 8.940, "C6C8_dist": 9.927, "CNNC_torsion": 5.571, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.75],N3-N1(imino)[2.91],N4(amino)-O6(carbonyl)[2.94]", "interBase_angle": 1.032, "planarity": 0.032, "simple_Shear": 0.222, "simple_Stretch": -0.105, "simple_Buckle": 0.471, "simple_Propeller": 0.919, "bp_simpleParams": [ 0.222, -0.105, -0.111, 0.471, 0.919, 1.622 ], "bp_params": [ 0.220, -0.109, -0.111, 0.487, 0.910, 1.622 ], "frame": { "rmsd": null, "origin": [ 9.148, 33.097, -63.048 ], "x_axis": [ -0.444, -0.477, 0.759 ], "y_axis": [ -0.120, 0.870, 0.477 ], "z_axis": [ -0.888, 0.121, -0.444 ], "quaternion": [ -0.496, -0.180, 0.830, 0.180 ] } }, { "index": 118, "nt1": "///I/2653", "nt2": "///I/2667", "bp": "U-C", "name": "--", "Saenger": "--", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -134.909, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 86.173, "chi2": -166.560, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 26.506, "C1C1_dist": 9.791, "N1N9_dist": 8.418, "C6C8_dist": 9.318, "CNNC_torsion": 15.039, "hbonds_num": 1, "hbonds_desc": "O2(carbonyl)-N4(amino)[3.01]", "interBase_angle": 18.668, "planarity": 0.325, "simple_Shear": 5.112, "simple_Stretch": 0.559, "simple_Buckle": 18.244, "simple_Propeller": 3.958, "bp_simpleParams": [ 5.112, 0.559, -1.746, 18.244, 3.958, 2.861 ], "bp_params": [ 4.687, -2.116, -1.746, 17.716, -5.888, 2.830 ], "frame": { "rmsd": null, "origin": [ 6.329, 32.221, -64.623 ], "x_axis": [ -0.416, 0.257, 0.872 ], "y_axis": [ -0.026, 0.956, -0.294 ], "z_axis": [ -0.909, -0.145, -0.391 ], "quaternion": [ 0.536, -0.069, -0.831, 0.132 ] } }, { "index": 119, "nt1": "///I/2654", "nt2": "///I/2666", "bp": "A-C", "name": "~rHoogsteen", "Saenger": "25-XXV", "LW": "tHW", "DSSR": "tM-W", "intra_chain": true, "chi1": -144.123, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 14.818, "chi2": 4.228, "conf2": "syn", "pucker2": "~C3'-endo", "lambda2": 27.624, "C1C1_dist": 11.251, "N1N9_dist": 8.545, "C6C8_dist": 7.632, "CNNC_torsion": -87.686, "hbonds_num": 3, "hbonds_desc": "N7-N4(amino)[3.25],N6(amino)-OP2[3.13],N6(amino)-N3[2.95]", "interBase_angle": 20.134, "planarity": 0.346, "simple_Shear": -2.786, "simple_Stretch": 0.797, "simple_Buckle": -19.660, "simple_Propeller": 4.344, "bp_simpleParams": [ -2.786, 0.797, 0.716, -19.660, 4.344, -84.525 ], "bp_params": [ -2.877, -0.346, 0.716, -19.798, -3.660, -83.699 ], "frame": { "rmsd": null, "origin": [ 2.501, 32.212, -63.251 ], "x_axis": [ 0.160, -0.156, -0.975 ], "y_axis": [ -0.119, 0.977, -0.176 ], "z_axis": [ 0.980, 0.144, 0.137 ], "quaternion": [ 0.754, -0.106, 0.648, -0.012 ] } }, { "index": 120, "nt1": "///I/2655", "nt2": "///I/2656", "bp": "G+U", "name": "Platform", "Saenger": "--", "LW": "cSH", "DSSR": "cm+M", "intra_chain": true, "chi1": -112.247, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 145.200, "chi2": -179.623, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 47.941, "C1C1_dist": 6.781, "N1N9_dist": 7.005, "C6C8_dist": 6.927, "CNNC_torsion": 15.160, "hbonds_num": 2, "hbonds_desc": "O2'(hydroxyl)-OP2[2.50],N2(amino)-O4(carbonyl)[3.23]", "interBase_angle": 18.389, "planarity": 0.272, "simple_Shear": 0.110, "simple_Stretch": 8.110, "simple_Buckle": -17.684, "simple_Propeller": -5.044, "bp_simpleParams": [ 0.110, 8.110, 0.979, -17.684, -5.044, 14.197 ], "bp_params": [ 8.024, 1.177, 0.979, -7.751, 16.676, 14.315 ], "frame": { "rmsd": null, "origin": [ -1.314, 33.714, -59.741 ], "x_axis": [ 0.033, 0.353, 0.935 ], "y_axis": [ -0.143, 0.928, -0.345 ], "z_axis": [ -0.989, -0.122, 0.081 ], "quaternion": [ 0.714, -0.078, -0.673, 0.174 ] } }, { "index": 121, "nt1": "///I/2656", "nt2": "///I/2665", "bp": "U-A", "name": "rHoogsteen", "Saenger": "24-XXIV", "LW": "tWH", "DSSR": "tW-M", "intra_chain": true, "chi1": -179.623, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 33.184, "chi2": 177.050, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 22.478, "C1C1_dist": 9.487, "N1N9_dist": 7.042, "C6C8_dist": 6.129, "CNNC_torsion": 178.228, "hbonds_num": 2, "hbonds_desc": "O2(carbonyl)-N6(amino)[2.92],N3(imino)-N7[2.83]", "interBase_angle": 6.268, "planarity": 0.091, "simple_Shear": 4.716, "simple_Stretch": 1.483, "simple_Buckle": 4.963, "simple_Propeller": -3.828, "bp_simpleParams": [ 4.716, 1.483, -0.618, 4.963, -3.828, -96.436 ], "bp_params": [ 4.335, -2.375, -0.618, 0.676, -6.231, -96.519 ], "frame": { "rmsd": null, "origin": [ -0.915, 30.455, -65.418 ], "x_axis": [ -0.167, 0.860, 0.483 ], "y_axis": [ -0.080, 0.476, -0.876 ], "z_axis": [ -0.983, -0.185, -0.011 ], "quaternion": [ 0.570, -0.303, -0.643, 0.412 ] } }, { "index": 122, "nt1": "///I/2657", "nt2": "///I/2664", "bp": "A-G", "name": "Sheared", "Saenger": "11-XI", "LW": "tHS", "DSSR": "tM-m", "intra_chain": true, "chi1": -172.448, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 7.982, "chi2": -166.027, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 96.623, "C1C1_dist": 9.719, "N1N9_dist": 8.530, "C6C8_dist": 8.981, "CNNC_torsion": 168.440, "hbonds_num": 3, "hbonds_desc": "N7-N2(amino)[2.87],N6(amino)-O2'(hydroxyl)[3.11],N6(amino)-N3[2.98]", "interBase_angle": 1.671, "planarity": 0.037, "simple_Shear": -7.469, "simple_Stretch": 2.560, "simple_Buckle": -0.128, "simple_Propeller": 1.666, "bp_simpleParams": [ -7.469, 2.560, 0.055, -0.128, 1.666, -3.758 ], "bp_params": [ -6.808, -3.998, 0.055, -1.347, 0.988, -3.758 ], "frame": { "rmsd": null, "origin": [ -5.023, 33.142, -61.846 ], "x_axis": [ -0.153, 0.756, 0.636 ], "y_axis": [ 0.014, 0.645, -0.764 ], "z_axis": [ -0.988, -0.108, -0.109 ], "quaternion": [ 0.588, -0.279, -0.691, 0.316 ] } }, { "index": 123, "nt1": "///I/2658", "nt2": "///I/2663", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -166.737, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 56.838, "chi2": -164.763, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 55.271, "C1C1_dist": 10.529, "N1N9_dist": 8.896, "C6C8_dist": 9.871, "CNNC_torsion": 9.951, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.74],N3-N1(imino)[2.88],N4(amino)-O6(carbonyl)[2.91]", "interBase_angle": 2.429, "planarity": 0.061, "simple_Shear": 0.346, "simple_Stretch": -0.154, "simple_Buckle": -1.826, "simple_Propeller": 1.602, "bp_simpleParams": [ 0.346, -0.154, -0.110, -1.826, 1.602, 1.158 ], "bp_params": [ 0.341, -0.164, -0.110, -1.777, 1.657, 1.158 ], "frame": { "rmsd": null, "origin": [ -8.449, 33.229, -60.961 ], "x_axis": [ 0.061, 0.932, -0.359 ], "y_axis": [ 0.101, -0.363, -0.926 ], "z_axis": [ -0.993, 0.020, -0.116 ], "quaternion": [ -0.381, 0.620, 0.416, -0.545 ] } }, { "index": 124, "nt1": "///I/2659", "nt2": "///I/2662", "bp": "G-A", "name": "Sheared", "Saenger": "11-XI", "LW": "tSH", "DSSR": "tm-M", "intra_chain": true, "chi1": -152.124, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 105.196, "chi2": -148.858, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 11.454, "C1C1_dist": 8.904, "N1N9_dist": 7.983, "C6C8_dist": 8.309, "CNNC_torsion": -124.553, "hbonds_num": 2, "hbonds_desc": "N2(amino)-OP2[2.76],N2(amino)-N7[3.49]", "interBase_angle": 16.007, "planarity": 0.318, "simple_Shear": 8.350, "simple_Stretch": 3.186, "simple_Buckle": 4.541, "simple_Propeller": 15.349, "bp_simpleParams": [ 8.350, 3.186, 1.045, 4.541, 15.349, -3.576 ], "bp_params": [ 7.040, -5.507, 1.045, 15.484, 4.057, -3.545 ], "frame": { "rmsd": null, "origin": [ -11.401, 33.144, -59.782 ], "x_axis": [ 0.277, 0.315, -0.908 ], "y_axis": [ -0.035, -0.941, -0.337 ], "z_axis": [ -0.960, 0.125, -0.250 ], "quaternion": [ -0.147, 0.786, 0.089, -0.594 ] } }, { "index": 125, "nt1": "///J/1945", "nt2": "///J/1961", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": 178.431, "conf1": "--", "pucker1": "~C3'-endo", "lambda1": 52.058, "chi2": -147.315, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 52.618, "C1C1_dist": 10.746, "N1N9_dist": 8.954, "C6C8_dist": 9.832, "CNNC_torsion": -7.380, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.74],N1(imino)-N3[2.83],N2(amino)-O2(carbonyl)[2.79]", "interBase_angle": 1.146, "planarity": 0.034, "simple_Shear": -0.037, "simple_Stretch": -0.198, "simple_Buckle": -0.059, "simple_Propeller": -1.144, "bp_simpleParams": [ -0.037, -0.198, 0.067, -0.059, -1.144, -2.426 ], "bp_params": [ -0.038, -0.198, 0.067, -0.059, -1.144, -2.425 ], "frame": { "rmsd": null, "origin": [ -9.507, 12.322, -7.456 ], "x_axis": [ 0.859, 0.035, 0.511 ], "y_axis": [ 0.440, -0.562, -0.700 ], "z_axis": [ 0.263, 0.826, -0.498 ], "quaternion": [ -0.447, 0.854, 0.139, 0.226 ] } }, { "index": 126, "nt1": "///J/1946", "nt2": "///J/1960", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -164.600, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 55.480, "chi2": -173.694, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 56.142, "C1C1_dist": 10.424, "N1N9_dist": 8.779, "C6C8_dist": 9.770, "CNNC_torsion": -7.817, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.76],O4(carbonyl)-N6(amino)[2.88]", "interBase_angle": 4.197, "planarity": 0.079, "simple_Shear": -0.083, "simple_Stretch": -0.174, "simple_Buckle": 2.823, "simple_Propeller": -3.107, "bp_simpleParams": [ -0.083, -0.174, 0.131, 2.823, -3.107, 1.783 ], "bp_params": [ -0.081, -0.175, 0.131, 2.865, -3.068, 1.783 ], "frame": { "rmsd": null, "origin": [ -8.726, 15.674, -8.077 ], "x_axis": [ 0.923, -0.383, 0.047 ], "y_axis": [ -0.171, -0.515, -0.840 ], "z_axis": [ 0.346, 0.767, -0.541 ], "quaternion": [ -0.466, 0.863, -0.160, 0.114 ] } }, { "index": 127, "nt1": "///J/1947", "nt2": "///J/1959", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -158.360, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 57.930, "chi2": -161.743, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 55.209, "C1C1_dist": 10.517, "N1N9_dist": 8.904, "C6C8_dist": 9.894, "CNNC_torsion": -2.279, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.74],N3-N1(imino)[2.91],N4(amino)-O6(carbonyl)[2.97]", "interBase_angle": 10.617, "planarity": 0.128, "simple_Shear": 0.319, "simple_Stretch": -0.096, "simple_Buckle": 9.682, "simple_Propeller": -4.356, "bp_simpleParams": [ 0.319, -0.096, -0.176, 9.682, -4.356, 2.164 ], "bp_params": [ 0.316, -0.105, -0.176, 9.570, -4.596, 2.158 ], "frame": { "rmsd": null, "origin": [ -7.240, 18.688, -8.144 ], "x_axis": [ 0.638, -0.706, -0.309 ], "y_axis": [ -0.610, -0.217, -0.762 ], "z_axis": [ 0.471, 0.675, -0.569 ], "quaternion": [ -0.462, 0.778, -0.422, 0.052 ] } }, { "index": 128, "nt1": "///J/1948", "nt2": "///J/1958", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -167.356, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 55.465, "chi2": -165.109, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 55.899, "C1C1_dist": 10.537, "N1N9_dist": 8.886, "C6C8_dist": 9.858, "CNNC_torsion": -1.574, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.88],N1(imino)-N3[2.85],N2(amino)-O2(carbonyl)[2.70]", "interBase_angle": 6.291, "planarity": 0.079, "simple_Shear": -0.173, "simple_Stretch": -0.162, "simple_Buckle": -4.567, "simple_Propeller": -4.327, "bp_simpleParams": [ -0.173, -0.162, 0.038, -4.567, -4.327, 1.189 ], "bp_params": [ -0.171, -0.164, 0.038, -4.514, -4.382, 1.189 ], "frame": { "rmsd": null, "origin": [ -3.997, 20.756, -8.888 ], "x_axis": [ 0.110, -0.857, -0.504 ], "y_axis": [ -0.840, 0.191, -0.509 ], "z_axis": [ 0.532, 0.479, -0.698 ], "quaternion": [ 0.388, -0.636, 0.667, -0.011 ] } }, { "index": 129, "nt1": "///J/1949", "nt2": "///J/1957", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -153.434, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 53.037, "chi2": -172.804, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 54.109, "C1C1_dist": 10.743, "N1N9_dist": 9.002, "C6C8_dist": 9.902, "CNNC_torsion": -0.572, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.86],N1(imino)-N3[2.93],N2(amino)-O2(carbonyl)[2.86]", "interBase_angle": 8.384, "planarity": 0.099, "simple_Shear": -0.178, "simple_Stretch": -0.106, "simple_Buckle": -7.865, "simple_Propeller": -2.905, "bp_simpleParams": [ -0.178, -0.106, -0.199, -7.865, -2.905, -1.468 ], "bp_params": [ -0.176, -0.108, -0.199, -7.830, -2.998, -1.465 ], "frame": { "rmsd": null, "origin": [ -0.603, 21.068, -10.700 ], "x_axis": [ -0.437, -0.639, -0.633 ], "y_axis": [ -0.693, 0.688, -0.217 ], "z_axis": [ 0.574, 0.344, -0.743 ], "quaternion": [ 0.356, -0.393, 0.847, 0.038 ] } }, { "index": 130, "nt1": "///J/1950", "nt2": "///J/1956", "bp": "G-U", "name": "--", "Saenger": "--", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -146.649, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 70.399, "chi2": -167.809, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 26.686, "C1C1_dist": 12.588, "N1N9_dist": 10.816, "C6C8_dist": 11.387, "CNNC_torsion": 31.314, "hbonds_num": 1, "hbonds_desc": "N2(amino)-O4(carbonyl)[2.72]", "interBase_angle": 18.842, "planarity": 0.252, "simple_Shear": 4.412, "simple_Stretch": 2.578, "simple_Buckle": -18.841, "simple_Propeller": 0.255, "bp_simpleParams": [ 4.412, 2.578, -0.769, -18.841, 0.255, -15.135 ], "bp_params": [ 5.099, 0.333, -0.769, -16.738, 8.653, -15.019 ], "frame": { "rmsd": null, "origin": [ 2.472, 20.802, -13.287 ], "x_axis": [ -0.844, 0.085, -0.529 ], "y_axis": [ 0.011, 0.990, 0.141 ], "z_axis": [ 0.536, 0.113, -0.837 ], "quaternion": [ 0.278, 0.025, 0.958, 0.066 ] } }, { "index": 131, "nt1": "///J/1952", "nt2": "///K/2560", "bp": "A-A", "name": "--", "Saenger": "--", "LW": "cWS", "DSSR": "cW-m", "intra_chain": false, "chi1": -158.202, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 87.716, "chi2": -157.028, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 155.484, "C1C1_dist": 5.444, "N1N9_dist": 6.779, "C6C8_dist": 9.170, "CNNC_torsion": -13.437, "hbonds_num": 2, "hbonds_desc": "O2'(hydroxyl)-O2'(hydroxyl)[2.94],N3-O2'(hydroxyl)[2.61]", "interBase_angle": 39.318, "planarity": 0.434, "simple_Shear": -0.984, "simple_Stretch": 6.081, "simple_Buckle": 35.465, "simple_Propeller": -16.974, "bp_simpleParams": [ -0.984, 6.081, -0.530, 35.465, -16.974, 142.069 ], "bp_params": [ -2.845, 5.464, -0.530, 39.050, -4.580, 139.960 ], "frame": { "rmsd": null, "origin": [ 8.036, 22.902, -27.952 ], "x_axis": [ 0.798, -0.467, -0.381 ], "y_axis": [ 0.602, 0.599, 0.527 ], "z_axis": [ -0.018, -0.650, 0.759 ], "quaternion": [ 0.888, 0.331, 0.102, -0.301 ] } }, { "index": 132, "nt1": "///J/1953", "nt2": "///K/2549", "bp": "A+G", "name": "Linker", "Saenger": "--", "LW": "tSS", "DSSR": "tm+m", "intra_chain": false, "chi1": -132.307, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 62.956, "chi2": -178.867, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 82.652, "C1C1_dist": 8.112, "N1N9_dist": 7.755, "C6C8_dist": 10.084, "CNNC_torsion": 165.442, "hbonds_num": 2, "hbonds_desc": "N1-O2'(hydroxyl)[2.59],N3-N2(amino)[2.69]", "interBase_angle": 15.890, "planarity": 0.198, "simple_Shear": 7.061, "simple_Stretch": 3.433, "simple_Buckle": 9.053, "simple_Propeller": -13.059, "bp_simpleParams": [ 7.061, 3.433, -0.566, 9.053, -13.059, 159.649 ], "bp_params": [ 2.829, 7.324, -0.566, 15.521, -3.406, 159.474 ], "frame": { "rmsd": null, "origin": [ 7.488, 21.163, -24.954 ], "x_axis": [ 0.983, 0.104, -0.152 ], "y_axis": [ 0.021, 0.758, 0.652 ], "z_axis": [ 0.183, -0.644, 0.743 ], "quaternion": [ 0.933, 0.347, 0.090, 0.022 ] } }, { "index": 133, "nt1": "///J/1954", "nt2": "///J/1956", "bp": "G+U", "name": "--", "Saenger": "--", "LW": "tSW", "DSSR": "tm+W", "intra_chain": true, "chi1": -100.492, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 102.334, "chi2": -167.809, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 19.395, "C1C1_dist": 7.504, "N1N9_dist": 6.571, "C6C8_dist": 7.474, "CNNC_torsion": 99.860, "hbonds_num": 2, "hbonds_desc": "O2'(hydroxyl)-O4(carbonyl)[2.60],N2(amino)-O2(carbonyl)[3.27]", "interBase_angle": 1.818, "planarity": 0.576, "simple_Shear": 1.862, "simple_Stretch": 1.424, "simple_Buckle": -1.792, "simple_Propeller": 0.305, "bp_simpleParams": [ 1.862, 1.424, -2.467, -1.792, 0.305, -72.415 ], "bp_params": [ 0.743, -2.223, -2.467, 0.870, 1.596, -72.418 ], "frame": { "rmsd": null, "origin": [ 6.068, 21.408, -12.968 ], "x_axis": [ -0.507, 0.751, -0.424 ], "y_axis": [ -0.626, -0.658, -0.418 ], "z_axis": [ -0.593, 0.054, 0.804 ], "quaternion": [ 0.400, -0.295, -0.105, 0.861 ] } }, { "index": 134, "nt1": "///J/1955", "nt2": "///K/2556", "bp": "U-C", "name": "--", "Saenger": "--", "LW": "..W", "DSSR": "..-W", "intra_chain": false, "chi1": -132.189, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 9.845, "chi2": -152.364, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 32.684, "C1C1_dist": 12.508, "N1N9_dist": 9.843, "C6C8_dist": 9.197, "CNNC_torsion": -67.351, "hbonds_num": 1, "hbonds_desc": "O4(carbonyl)-N4(amino)[3.38]", "interBase_angle": 45.269, "planarity": 0.469, "simple_Shear": -2.564, "simple_Stretch": 1.726, "simple_Buckle": -8.667, "simple_Propeller": 44.432, "bp_simpleParams": [ -2.564, 1.726, 1.645, -8.667, 44.432, -73.052 ], "bp_params": [ -3.013, 0.690, 1.645, -23.683, 38.580, -75.088 ], "frame": { "rmsd": null, "origin": [ 4.118, 6.636, -20.727 ], "x_axis": [ 0.602, 0.662, -0.447 ], "y_axis": [ -0.181, 0.658, 0.731 ], "z_axis": [ 0.778, -0.359, 0.516 ], "quaternion": [ 0.833, 0.327, 0.368, 0.253 ] } }, { "index": 135, "nt1": "///K/2547", "nt2": "///K/2561", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -151.078, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 61.369, "chi2": -157.052, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 59.068, "C1C1_dist": 10.165, "N1N9_dist": 8.709, "C6C8_dist": 9.799, "CNNC_torsion": 2.081, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.00],N1-N3(imino)[2.77]", "interBase_angle": 4.201, "planarity": 0.076, "simple_Shear": 0.006, "simple_Stretch": -0.138, "simple_Buckle": -4.187, "simple_Propeller": -0.344, "bp_simpleParams": [ 0.006, -0.138, 0.177, -4.187, -0.344, 5.669 ], "bp_params": [ 0.005, -0.138, 0.177, -4.189, -0.321, 5.665 ], "frame": { "rmsd": null, "origin": [ 7.223, 20.445, -33.071 ], "x_axis": [ -0.696, -0.717, -0.021 ], "y_axis": [ 0.655, -0.623, -0.428 ], "z_axis": [ 0.294, -0.312, 0.904 ], "quaternion": [ -0.382, 0.076, -0.206, 0.898 ] } }, { "index": 136, "nt1": "///K/2548", "nt2": "///K/2560", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -155.492, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 54.172, "chi2": -157.028, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 53.237, "C1C1_dist": 10.644, "N1N9_dist": 8.909, "C6C8_dist": 9.817, "CNNC_torsion": -6.312, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.85],O4(carbonyl)-N6(amino)[2.85]", "interBase_angle": 3.033, "planarity": 0.052, "simple_Shear": 0.061, "simple_Stretch": -0.131, "simple_Buckle": 0.391, "simple_Propeller": -3.008, "bp_simpleParams": [ 0.061, -0.131, 0.130, 0.391, -3.008, -1.756 ], "bp_params": [ 0.060, -0.131, 0.130, 0.387, -3.008, -1.756 ], "frame": { "rmsd": null, "origin": [ 7.466, 20.386, -29.666 ], "x_axis": [ -0.271, -0.899, -0.345 ], "y_axis": [ 0.937, -0.164, -0.308 ], "z_axis": [ 0.220, -0.407, 0.887 ], "quaternion": [ 0.602, 0.041, 0.234, -0.762 ] } }, { "index": 137, "nt1": "///K/2549", "nt2": "///K/2559", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -178.867, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 52.514, "chi2": -164.600, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 53.513, "C1C1_dist": 10.786, "N1N9_dist": 9.024, "C6C8_dist": 9.915, "CNNC_torsion": -7.350, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.87],N1(imino)-N3[2.93],N2(amino)-O2(carbonyl)[2.88]", "interBase_angle": 6.834, "planarity": 0.094, "simple_Shear": -0.158, "simple_Stretch": -0.110, "simple_Buckle": -3.616, "simple_Propeller": -5.798, "bp_simpleParams": [ -0.158, -0.110, 0.134, -3.616, -5.798, -2.030 ], "bp_params": [ -0.156, -0.112, 0.134, -3.554, -5.837, -2.032 ], "frame": { "rmsd": null, "origin": [ 6.129, 18.051, -27.019 ], "x_axis": [ 0.187, -0.770, -0.611 ], "y_axis": [ 0.963, 0.266, -0.040 ], "z_axis": [ 0.193, -0.581, 0.791 ], "quaternion": [ 0.749, 0.180, 0.268, -0.578 ] } }, { "index": 138, "nt1": "///K/2550", "nt2": "///K/2558", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -153.782, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 52.260, "chi2": -160.279, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 54.852, "C1C1_dist": 10.678, "N1N9_dist": 8.941, "C6C8_dist": 9.847, "CNNC_torsion": 0.176, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.85],N1(imino)-N3[2.90],N2(amino)-O2(carbonyl)[2.82]", "interBase_angle": 7.785, "planarity": 0.099, "simple_Shear": -0.294, "simple_Stretch": -0.155, "simple_Buckle": -7.400, "simple_Propeller": -2.420, "bp_simpleParams": [ -0.294, -0.155, -0.101, -7.400, -2.420, -1.188 ], "bp_params": [ -0.291, -0.162, -0.101, -7.340, -2.596, -1.186 ], "frame": { "rmsd": null, "origin": [ 4.841, 15.579, -24.539 ], "x_axis": [ 0.674, -0.360, -0.645 ], "y_axis": [ 0.688, 0.625, 0.369 ], "z_axis": [ 0.270, -0.693, 0.669 ], "quaternion": [ 0.861, 0.308, 0.266, -0.304 ] } }, { "index": 139, "nt1": "///K/2551", "nt2": "///K/2557", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -143.815, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 52.130, "chi2": -163.001, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 51.826, "C1C1_dist": 10.884, "N1N9_dist": 9.078, "C6C8_dist": 9.937, "CNNC_torsion": 4.559, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.95],N3-N1(imino)[2.95],N4(amino)-O6(carbonyl)[2.82]", "interBase_angle": 3.865, "planarity": 0.049, "simple_Shear": 0.086, "simple_Stretch": -0.093, "simple_Buckle": -1.494, "simple_Propeller": 3.564, "bp_simpleParams": [ 0.086, -0.093, 0.119, -1.494, 3.564, -3.316 ], "bp_params": [ 0.086, -0.093, 0.119, -1.480, 3.570, -3.317 ], "frame": { "rmsd": null, "origin": [ 5.910, 12.367, -23.735 ], "x_axis": [ 0.821, 0.237, -0.520 ], "y_axis": [ 0.267, 0.645, 0.716 ], "z_axis": [ 0.505, -0.726, 0.466 ], "quaternion": [ 0.856, 0.421, 0.299, -0.009 ] } }, { "index": 140, "nt1": "///K/2552", "nt2": "///K/2556", "bp": "U-C", "name": "--", "Saenger": "--", "LW": "tW.", "DSSR": "tW-.", "intra_chain": true, "chi1": -149.569, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 79.248, "chi2": -152.364, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 13.189, "C1C1_dist": 10.818, "N1N9_dist": 9.183, "C6C8_dist": 9.678, "CNNC_torsion": -44.847, "hbonds_num": 1, "hbonds_desc": "O2(carbonyl)-N4(amino)[3.02]", "interBase_angle": 19.080, "planarity": 0.269, "simple_Shear": 6.143, "simple_Stretch": 1.815, "simple_Buckle": 2.017, "simple_Propeller": 18.973, "bp_simpleParams": [ 6.143, 1.815, 1.009, 2.017, 18.973, -17.031 ], "bp_params": [ 5.937, -2.404, 1.009, 13.378, 13.605, -17.036 ], "frame": { "rmsd": null, "origin": [ 7.106, 9.465, -22.652 ], "x_axis": [ 0.631, 0.768, 0.111 ], "y_axis": [ -0.366, 0.169, 0.915 ], "z_axis": [ 0.684, -0.618, 0.387 ], "quaternion": [ 0.740, 0.518, 0.194, 0.383 ] } } ], "num_multiplets": 16, "multiplets": [ { "index": 1, "num_nts": 3, "nts_short": "UAA", "nts_long": "///A/8,///A/14,///A/21", "planarity": 0.226 }, { "index": 2, "num_nts": 3, "nts_short": "AUA", "nts_long": "///A/9,///A/12,///A/23", "planarity": 0.194 }, { "index": 3, "num_nts": 3, "nts_short": "gCG", "nts_long": "///A/10,///A/25,///A/45", "planarity": 0.453 }, { "index": 4, "num_nts": 3, "nts_short": "CGg", "nts_long": "///A/13,///A/22,///A/46", "planarity": 0.126 }, { "index": 5, "num_nts": 3, "nts_short": "UAA", "nts_long": "///B/8,///B/14,///B/21", "planarity": 0.288 }, { "index": 6, "num_nts": 3, "nts_short": "GCG", "nts_long": "///B/10,///B/25,///B/45", "planarity": 0.318 }, { "index": 7, "num_nts": 3, "nts_short": "ACG", "nts_long": "///E/160,///F/342,///F/347", "planarity": 0.648 }, { "index": 8, "num_nts": 3, "nts_short": "GGC", "nts_long": "///G/1071,///G/1091,///G/1100", "planarity": 0.166 }, { "index": 9, "num_nts": 3, "nts_short": "CCG", "nts_long": "///G/1072,///G/1092,///G/1099", "planarity": 0.144 }, { "index": 10, "num_nts": 3, "nts_short": "AAU", "nts_long": "///G/1089,///G/1090,///G/1101", "planarity": 0.139 }, { "index": 11, "num_nts": 3, "nts_short": "GUA", "nts_long": "///I/2655,///I/2656,///I/2665", "planarity": 0.220 }, { "index": 12, "num_nts": 3, "nts_short": "AUA", "nts_long": "///J/1952,///K/2548,///K/2560", "planarity": 0.439 }, { "index": 13, "num_nts": 3, "nts_short": "AGC", "nts_long": "///J/1953,///K/2549,///K/2559", "planarity": 0.170 }, { "index": 14, "num_nts": 4, "nts_short": "CUUC", "nts_long": "///A/75,///J/1955,///K/2552,///K/2556", "planarity": 0.692 }, { "index": 15, "num_nts": 4, "nts_short": "CAGG", "nts_long": "///G/1043,///G/1048,///G/1110,///G/1112", "planarity": 1.263 }, { "index": 16, "num_nts": 4, "nts_short": "GUAC", "nts_long": "///G/1055,///G/1083,///G/1085,///G/1104", "planarity": 0.424 } ], "num_helices": 11, "helices": [ { "index": 1, "num_stems": 2, "strand1": "GCGGAUUcUGUGtPC", "strand2": "CGCUUAAGACACaGG", "bp_type": "||||||||||||..|", "helix_form": ".A....xAAAAxx.", "helical_rise": 3.036, "helical_rise_std": 0.888, "helical_radius": 8.827, "helical_radius_std": 1.921, "helical_axis": [ -0.858, -0.312, -0.409 ], "point1": [ -16.171, -2.313, -32.098 ], "point2": [ -52.733, -15.596, -49.522 ], "num_pairs": 15, "pairs": [ { "index": 1, "nt1": "///A/1", "nt2": "///A/72", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.325, -0.099, -0.586, -30.703, 24.532, -11.943 ], "step_params": [ 0.233, -1.638, 3.236, -14.219, 28.597, 36.884 ], "heli_params": [ -3.853, -1.208, 1.497, 37.725, 18.758, 48.423 ], "bp2_params": [ -0.287, -0.202, 0.370, -10.399, -5.707, 2.008 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.236, "simple_Twist": 34.763, "simple_hRise": 1.394, "simple_hTwist": 46.870 }, { "index": 2, "nt1": "///A/2", "nt2": "///A/71", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.287, -0.202, 0.370, -10.399, -5.707, 2.008 ], "step_params": [ -0.085, -1.345, 2.935, -0.670, 2.477, 29.477 ], "heli_params": [ -3.096, 0.042, 2.816, 4.856, 1.314, 29.586 ], "bp2_params": [ -0.076, -0.135, 0.437, 0.702, -10.802, -2.553 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.935, "simple_Twist": 28.541, "simple_hRise": 2.811, "simple_hTwist": 28.654 }, { "index": 3, "nt1": "///A/3", "nt2": "///A/70", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.076, -0.135, 0.437, 0.702, -10.802, -2.553 ], "step_params": [ 0.228, -1.804, 2.735, -4.891, 8.559, 24.051 ], "heli_params": [ -5.757, -1.504, 1.908, 19.523, 11.156, 25.966 ], "bp2_params": [ -2.215, -0.467, 0.650, 10.074, -5.906, 0.136 ], "groove_widths": [ 17.228, null, 16.580, null ], "simple_Rise": 2.735, "simple_Twist": 36.017, "simple_hRise": 2.215, "simple_hTwist": 37.299 }, { "index": 4, "nt1": "///A/4", "nt2": "///A/69", "bp": "G-U", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -2.215, -0.467, 0.650, 10.074, -5.906, 0.136 ], "step_params": [ -0.220, -1.391, 3.255, 2.048, 3.547, 42.958 ], "heli_params": [ -2.232, 0.496, 3.123, 4.830, -2.789, 43.143 ], "bp2_params": [ 0.112, -0.203, 0.239, 6.336, -19.440, 3.692 ], "groove_widths": [ 16.548, 15.094, 15.503, 12.988 ], "simple_Rise": 3.255, "simple_Twist": 30.047, "simple_hRise": 3.053, "simple_hTwist": 30.319 }, { "index": 5, "nt1": "///A/5", "nt2": "///A/68", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.112, -0.203, 0.239, 6.336, -19.440, 3.692 ], "step_params": [ 0.459, -1.714, 3.479, -0.293, 8.447, 28.409 ], "heli_params": [ -5.120, -0.960, 2.857, 16.749, 0.581, 29.615 ], "bp2_params": [ -0.484, -0.250, 0.301, -9.162, -19.865, 5.536 ], "groove_widths": [ 17.031, 15.076, 14.560, 11.244 ], "simple_Rise": 3.479, "simple_Twist": 31.369, "simple_hRise": 2.926, "simple_hTwist": 32.460 }, { "index": 6, "nt1": "///A/6", "nt2": "///A/67", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.484, -0.250, 0.301, -9.162, -19.865, 5.536 ], "step_params": [ -0.185, -1.259, 3.078, 1.998, 9.797, 34.694 ], "heli_params": [ -3.268, 0.551, 2.623, 16.022, -3.267, 36.063 ], "bp2_params": [ -0.057, -0.287, -0.062, -2.612, -3.667, 1.456 ], "groove_widths": [ 17.378, 15.569, 16.037, 13.112 ], "simple_Rise": 3.078, "simple_Twist": 32.801, "simple_hRise": 2.590, "simple_hTwist": 34.251 }, { "index": 7, "nt1": "///A/7", "nt2": "///A/66", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.057, -0.287, -0.062, -2.612, -3.667, 1.456 ], "step_params": [ -0.461, -2.061, 3.259, 0.691, 3.472, 34.266 ], "heli_params": [ -4.001, 0.883, 3.032, 5.873, -1.169, 34.443 ], "bp2_params": [ -0.101, -0.230, 0.045, -0.804, -7.262, -2.187 ], "groove_widths": [ 16.589, 15.062, 17.687, 15.276 ], "simple_Rise": 3.259, "simple_Twist": 34.353, "simple_hRise": 3.032, "simple_hTwist": 34.529 }, { "index": 8, "nt1": "///A/49", "nt2": "///A/65", "bp": "c-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.101, -0.230, 0.045, -0.804, -7.262, -2.187 ], "step_params": [ -0.923, -2.096, 3.196, -1.483, 7.712, 29.005 ], "heli_params": [ -5.477, 1.506, 2.608, 15.052, 2.894, 30.027 ], "bp2_params": [ -0.131, -0.247, 0.108, -3.205, -5.788, -2.430 ], "groove_widths": [ 16.792, 15.407, 17.952, 17.043 ], "simple_Rise": 3.196, "simple_Twist": 28.941, "simple_hRise": 2.606, "simple_hTwist": 29.965 }, { "index": 9, "nt1": "///A/50", "nt2": "///A/64", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.131, -0.247, 0.108, -3.205, -5.788, -2.430 ], "step_params": [ 0.267, -1.430, 3.337, 0.965, 4.899, 31.559 ], "heli_params": [ -3.476, -0.313, 3.092, 8.938, -1.760, 31.942 ], "bp2_params": [ -0.304, -0.157, 0.043, -4.613, -13.336, 4.254 ], "groove_widths": [ 17.341, 16.296, 14.978, 12.054 ], "simple_Rise": 3.337, "simple_Twist": 32.667, "simple_hRise": 3.102, "simple_hTwist": 33.036 }, { "index": 10, "nt1": "///A/51", "nt2": "///A/63", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.304, -0.157, 0.043, -4.613, -13.336, 4.254 ], "step_params": [ 0.264, -1.308, 3.191, -1.005, 3.375, 28.740 ], "heli_params": [ -3.327, -0.739, 3.010, 6.767, 2.015, 28.950 ], "bp2_params": [ -0.557, -0.153, 0.084, -1.325, -6.629, -0.426 ], "groove_widths": [ 17.015, 15.757, 15.112, 12.175 ], "simple_Rise": 3.191, "simple_Twist": 30.287, "simple_hRise": 3.021, "simple_hTwist": 30.486 }, { "index": 11, "nt1": "///A/52", "nt2": "///A/62", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.557, -0.153, 0.084, -1.325, -6.629, -0.426 ], "step_params": [ 0.978, -1.976, 3.373, 2.014, 7.790, 33.726 ], "heli_params": [ -4.485, -1.340, 2.910, 13.195, -3.411, 34.645 ], "bp2_params": [ -0.343, -0.153, -0.179, -10.733, -6.510, 1.819 ], "groove_widths": [ 16.360, 14.426, 13.496, 7.966 ], "simple_Rise": 3.373, "simple_Twist": 32.310, "simple_hRise": 2.885, "simple_hTwist": 33.271 }, { "index": 12, "nt1": "///A/53", "nt2": "///A/61", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.343, -0.153, -0.179, -10.733, -6.510, 1.819 ], "step_params": [ -2.074, -2.583, 3.181, 0.436, -3.997, 91.242 ], "heli_params": [ -1.729, 1.458, 3.259, -2.795, -0.305, 91.311 ], "bp2_params": [ 4.310, -1.850, -0.050, 0.255, 2.608, -100.311 ], "groove_widths": [ 17.216, null, 23.397, null ], "simple_Rise": 3.181, "simple_Twist": 64.338, "simple_hRise": 3.306, "simple_hTwist": 64.450 }, { "index": 13, "nt1": "///A/54", "nt2": "///A/58", "bp": "t-a", "name": "rHoogsteen", "Saenger": "24-XXIV", "LW": "tWH", "DSSR": "tW-M", "bp1_params": [ 4.310, -1.850, -0.050, 0.255, 2.608, -100.311 ], "step_params": [ 2.153, -2.397, 3.334, 6.695, 4.203, 43.691 ], "heli_params": [ -3.578, -2.209, 3.379, 5.593, -8.909, 44.366 ], "bp2_params": [ 0.517, -5.729, 0.296, 16.812, 1.582, -92.701 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.334, "simple_Twist": -36.229, "simple_hRise": 3.149, "simple_hTwist": -37.054 }, { "index": 14, "nt1": "///A/55", "nt2": "///A/18", "bp": "P+G", "name": "--", "Saenger": "--", "LW": "tSW", "DSSR": "tm+W", "bp1_params": [ 0.517, -5.729, 0.296, 16.812, 1.582, -92.701 ], "step_params": [ -4.525, -0.708, 7.641, -1.133, -17.447, -95.905 ], "heli_params": [ 1.157, -3.063, 7.435, 11.674, -0.758, -97.100 ], "bp2_params": [ 0.340, -0.005, 0.027, 24.980, -25.342, 2.457 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 7.641, "simple_Twist": 9.312, "simple_hRise": 4.490, "simple_hTwist": 19.792 }, { "index": 15, "nt1": "///A/56", "nt2": "///A/19", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 2, "num_stems": 2, "strand1": "APcUGGAgCUCAG", "strand2": "cAGACCgCGAGUC", "bp_type": "..||||.||||..", "helix_form": "..AAA.xAA.xx", "helical_rise": 2.659, "helical_rise_std": 0.883, "helical_radius": 9.309, "helical_radius_std": 2.744, "helical_axis": [ 0.326, -0.734, -0.596 ], "point1": [ -55.517, 17.108, -12.282 ], "point2": [ -45.169, -6.210, -31.231 ], "num_pairs": 13, "pairs": [ { "index": 1, "nt1": "///A/38", "nt2": "///A/32", "bp": "A-c", "name": "--", "Saenger": "--", "LW": ".W.", "DSSR": ".W-.", "bp1_params": [ -6.406, -2.023, 0.746, -3.859, 1.165, -0.751 ], "step_params": [ -0.236, -1.364, 3.073, -6.997, 10.939, 47.844 ], "heli_params": [ -2.362, -0.186, 2.725, 13.207, 8.448, 49.475 ], "bp2_params": [ -2.077, -0.148, 0.319, 6.137, -15.095, -5.215 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.073, "simple_Twist": 22.748, "simple_hRise": 2.178, "simple_hTwist": 26.151 }, { "index": 2, "nt1": "///A/39", "nt2": "///A/31", "bp": "P-A", "name": "--", "Saenger": "--", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -2.077, -0.148, 0.319, 6.137, -15.095, -5.215 ], "step_params": [ 0.005, -1.413, 3.077, -0.499, 7.123, 38.763 ], "heli_params": [ -2.859, -0.061, 2.784, 10.622, 0.743, 39.390 ], "bp2_params": [ -0.769, -0.215, -0.046, 4.675, -14.346, -1.769 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.077, "simple_Twist": 31.716, "simple_hRise": 2.704, "simple_hTwist": 32.489 }, { "index": 3, "nt1": "///A/40", "nt2": "///A/30", "bp": "c-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.769, -0.215, -0.046, 4.675, -14.346, -1.769 ], "step_params": [ 0.775, -1.658, 3.603, -2.083, 4.921, 41.010 ], "heli_params": [ -2.912, -1.336, 3.349, 6.989, 2.958, 41.342 ], "bp2_params": [ -0.063, 0.058, 0.351, -4.983, -8.735, 12.028 ], "groove_widths": [ 16.544, null, 14.831, null ], "simple_Rise": 3.603, "simple_Twist": 36.926, "simple_hRise": 3.315, "simple_hTwist": 37.297 }, { "index": 4, "nt1": "///A/41", "nt2": "///A/29", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.063, 0.058, 0.351, -4.983, -8.735, 12.028 ], "step_params": [ -0.301, -1.779, 3.024, -0.154, 7.755, 26.075 ], "heli_params": [ -5.437, 0.609, 2.406, 16.723, 0.332, 27.185 ], "bp2_params": [ -0.005, -0.352, 0.471, -4.748, -9.370, -1.512 ], "groove_widths": [ 16.356, 15.245, 15.172, 9.313 ], "simple_Rise": 3.024, "simple_Twist": 25.924, "simple_hRise": 2.402, "simple_hTwist": 27.040 }, { "index": 5, "nt1": "///A/42", "nt2": "///A/28", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.005, -0.352, 0.471, -4.748, -9.370, -1.512 ], "step_params": [ -0.082, -1.515, 3.278, 1.471, 5.738, 36.155 ], "heli_params": [ -3.173, 0.325, 3.005, 9.170, -2.350, 36.621 ], "bp2_params": [ -0.188, -0.320, 0.236, -9.438, -20.001, -2.980 ], "groove_widths": [ 18.566, 15.583, 14.379, 8.489 ], "simple_Rise": 3.278, "simple_Twist": 36.669, "simple_hRise": 3.010, "simple_hTwist": 37.128 }, { "index": 6, "nt1": "///A/43", "nt2": "///A/27", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.188, -0.320, 0.236, -9.438, -20.001, -2.980 ], "step_params": [ -0.675, -1.091, 3.411, 5.634, 6.033, 38.422 ], "heli_params": [ -2.346, 1.679, 3.086, 9.040, -8.442, 39.266 ], "bp2_params": [ 0.451, 1.374, -0.386, -20.184, -36.256, -14.654 ], "groove_widths": [ 19.594, 15.387, 13.302, 9.152 ], "simple_Rise": 3.411, "simple_Twist": 34.207, "simple_hRise": 3.035, "simple_hTwist": 35.160 }, { "index": 7, "nt1": "///A/44", "nt2": "///A/26", "bp": "A-g", "name": "Imino", "Saenger": "08-VIII", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.451, 1.374, -0.386, -20.184, -36.256, -14.654 ], "step_params": [ -3.252, -2.868, 3.388, 21.074, 20.350, 52.444 ], "heli_params": [ -3.635, 4.048, 1.035, 21.260, -22.017, 59.562 ], "bp2_params": [ -0.212, -0.310, -0.047, -4.317, -7.914, 1.087 ], "groove_widths": [ 17.362, 14.562, 12.104, 9.148 ], "simple_Rise": 3.388, "simple_Twist": 57.049, "simple_hRise": 1.244, "simple_hTwist": 63.565 }, { "index": 8, "nt1": "///A/10", "nt2": "///A/25", "bp": "g-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.212, -0.310, -0.047, -4.317, -7.914, 1.087 ], "step_params": [ -0.954, -1.612, 3.146, -2.750, 4.610, 38.116 ], "heli_params": [ -2.986, 1.125, 2.997, 7.016, 4.186, 38.478 ], "bp2_params": [ 0.218, -0.234, 0.193, -6.731, -18.668, 4.139 ], "groove_widths": [ 16.448, 14.960, 11.814, 11.659 ], "simple_Rise": 3.146, "simple_Twist": 35.387, "simple_hRise": 2.982, "simple_hTwist": 35.779 }, { "index": 9, "nt1": "///A/11", "nt2": "///A/24", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.218, -0.234, 0.193, -6.731, -18.668, 4.139 ], "step_params": [ -0.281, -1.204, 3.260, -1.155, 7.308, 32.333 ], "heli_params": [ -3.289, 0.306, 2.933, 12.912, 2.041, 33.147 ], "bp2_params": [ -0.041, -0.116, 0.426, -9.454, -3.619, -2.708 ], "groove_widths": [ 16.833, 15.935, 15.109, 10.338 ], "simple_Rise": 3.260, "simple_Twist": 34.171, "simple_hRise": 2.955, "simple_hTwist": 34.939 }, { "index": 10, "nt1": "///A/12", "nt2": "///A/23", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.041, -0.116, 0.426, -9.454, -3.619, -2.708 ], "step_params": [ 1.734, -2.071, 2.848, 5.686, 1.041, 27.191 ], "heli_params": [ -4.541, -2.363, 3.060, 2.182, -11.923, 27.788 ], "bp2_params": [ 0.256, -0.102, -0.083, 5.600, -2.156, 1.512 ], "groove_widths": [ 16.740, null, 8.908, null ], "simple_Rise": 2.848, "simple_Twist": 25.630, "simple_hRise": 3.069, "simple_hTwist": 26.263 }, { "index": 11, "nt1": "///A/13", "nt2": "///A/22", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.256, -0.102, -0.083, 5.600, -2.156, 1.512 ], "step_params": [ -2.385, -0.295, 3.280, -0.337, -5.141, 57.866 ], "heli_params": [ -0.029, 2.439, 3.306, -5.302, 0.347, 58.075 ], "bp2_params": [ -4.120, -1.898, 0.516, 5.678, 10.901, -101.202 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.280, "simple_Twist": 84.945, "simple_hRise": 3.298, "simple_hTwist": 85.072 }, { "index": 12, "nt1": "///A/14", "nt2": "///A/8", "bp": "A-U", "name": "rHoogsteen", "Saenger": "24-XXIV", "LW": "tHW", "DSSR": "tM-W", "bp1_params": [ -4.120, -1.898, 0.516, 5.678, 10.901, -101.202 ], "step_params": [ 2.419, -3.447, 3.324, 0.964, 6.982, -63.639 ], "heli_params": [ 2.933, 2.327, 3.612, -6.600, 0.912, -63.988 ], "bp2_params": [ 0.125, 3.914, 0.100, 1.826, 0.430, 152.087 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.324, "simple_Twist": 5.673, "simple_hRise": -0.315, "simple_hTwist": 9.046 }, { "index": 13, "nt1": "///A/15", "nt2": "///A/48", "bp": "G+C", "name": "rWC", "Saenger": "22-XXII", "LW": "tWW", "DSSR": "tW+W" } ] }, { "index": 3, "num_stems": 2, "strand1": "CGCGGGGGUCGGtUC", "strand2": "ACGCCCCCGGCCAGG", "bp_type": ".|||||||||||..|", "helix_form": "AA....x....xx.", "helical_rise": 2.877, "helical_rise_std": 0.962, "helical_radius": 9.419, "helical_radius_std": 2.215, "helical_axis": [ -0.682, -0.728, -0.077 ], "point1": [ -13.341, -14.270, -12.963 ], "point2": [ -40.680, -43.459, -16.045 ], "num_pairs": 15, "pairs": [ { "index": 1, "nt1": "///B/1", "nt2": "///B/72", "bp": "C-A", "name": "--", "Saenger": "--", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.901, 0.681, -0.361, 25.023, -9.016, -18.483 ], "step_params": [ 0.691, -1.854, 3.758, 1.148, 20.957, 28.636 ], "heli_params": [ -6.084, -0.971, 2.006, 36.779, -2.014, 35.374 ], "bp2_params": [ -0.564, -0.138, -0.449, 5.153, -7.940, 1.313 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.758, "simple_Twist": 26.894, "simple_hRise": 1.891, "simple_hTwist": 33.995 }, { "index": 2, "nt1": "///B/2", "nt2": "///B/71", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.564, -0.138, -0.449, 5.153, -7.940, 1.313 ], "step_params": [ 0.041, -1.431, 3.284, 0.204, -1.879, 39.939 ], "heli_params": [ -1.874, -0.036, 3.345, -2.749, -0.299, 39.982 ], "bp2_params": [ 0.704, -0.266, -0.253, 15.407, -21.919, -7.259 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.284, "simple_Twist": 33.467, "simple_hRise": 3.357, "simple_hTwist": 33.519 }, { "index": 3, "nt1": "///B/3", "nt2": "///B/70", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.704, -0.266, -0.253, 15.407, -21.919, -7.259 ], "step_params": [ 0.200, -2.171, 3.745, -0.907, 26.148, 19.012 ], "heli_params": [ -7.739, -0.492, 0.478, 54.565, 1.893, 32.245 ], "bp2_params": [ -1.187, -0.681, -0.970, -2.719, 12.280, -1.638 ], "groove_widths": [ 16.777, null, 17.229, null ], "simple_Rise": 3.745, "simple_Twist": 29.046, "simple_hRise": 1.389, "simple_hTwist": 38.904 }, { "index": 4, "nt1": "///B/4", "nt2": "///B/69", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -1.187, -0.681, -0.970, -2.719, 12.280, -1.638 ], "step_params": [ 0.245, -1.100, 3.396, -6.107, -3.464, 42.499 ], "heli_params": [ -1.141, -0.964, 3.406, -4.740, 8.356, 43.049 ], "bp2_params": [ 0.482, 0.190, -0.297, 1.709, -8.680, 13.062 ], "groove_widths": [ 16.743, 15.255, 17.484, 12.860 ], "simple_Rise": 3.396, "simple_Twist": 33.046, "simple_hRise": 3.393, "simple_hTwist": 33.763 }, { "index": 5, "nt1": "///B/5", "nt2": "///B/68", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.482, 0.190, -0.297, 1.709, -8.680, 13.062 ], "step_params": [ -0.566, -2.311, 3.611, 4.041, 1.312, 35.890 ], "heli_params": [ -3.927, 1.529, 3.445, 2.119, -6.529, 36.133 ], "bp2_params": [ 2.226, 0.738, -0.471, -9.313, 1.451, -7.849 ], "groove_widths": [ 17.515, 15.633, 17.822, 13.612 ], "simple_Rise": 3.611, "simple_Twist": 28.028, "simple_hRise": 3.388, "simple_hTwist": 28.342 }, { "index": 6, "nt1": "///B/6", "nt2": "///B/67", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 2.226, 0.738, -0.471, -9.313, 1.451, -7.849 ], "step_params": [ -0.305, -2.017, 3.294, 5.043, 20.789, 16.609 ], "heli_params": [ -8.087, 1.567, 0.439, 51.113, -12.399, 27.024 ], "bp2_params": [ -0.761, -0.266, -0.338, -8.706, -7.503, -11.839 ], "groove_widths": [ 18.027, 16.304, 16.808, 14.961 ], "simple_Rise": 3.294, "simple_Twist": 31.121, "simple_hRise": 1.614, "simple_hTwist": 37.614 }, { "index": 7, "nt1": "///B/7", "nt2": "///B/66", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.761, -0.266, -0.338, -8.706, -7.503, -11.839 ], "step_params": [ 0.433, -1.780, 3.610, 8.912, 1.517, 45.157 ], "heli_params": [ -2.423, 0.296, 3.571, 1.952, -11.469, 46.007 ], "bp2_params": [ 1.083, -0.135, -0.684, -6.702, -7.039, -11.863 ], "groove_widths": [ 17.129, 15.823, 17.196, 14.271 ], "simple_Rise": 3.610, "simple_Twist": 35.668, "simple_hRise": 3.537, "simple_hTwist": 36.759 }, { "index": 8, "nt1": "///B/49", "nt2": "///B/65", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 1.083, -0.135, -0.684, -6.702, -7.039, -11.863 ], "step_params": [ 1.310, -0.688, 2.721, 6.119, 2.413, 29.916 ], "heli_params": [ -1.715, -1.437, 2.863, 4.605, -11.676, 30.615 ], "bp2_params": [ 1.508, -0.431, -0.901, 15.857, -23.652, 13.868 ], "groove_widths": [ 16.936, 15.366, 16.997, 15.613 ], "simple_Rise": 2.721, "simple_Twist": 27.272, "simple_hRise": 2.870, "simple_hTwist": 28.040 }, { "index": 9, "nt1": "///B/50", "nt2": "///B/64", "bp": "U-G", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 1.508, -0.431, -0.901, 15.857, -23.652, 13.868 ], "step_params": [ -0.856, -1.814, 3.189, -4.302, 23.567, 31.078 ], "heli_params": [ -5.043, 0.855, 1.580, 37.754, 6.892, 39.058 ], "bp2_params": [ -0.246, 0.745, -0.188, -1.638, -7.030, -5.857 ], "groove_widths": [ 17.258, 15.585, 15.570, 10.819 ], "simple_Rise": 3.189, "simple_Twist": 40.419, "simple_hRise": 1.977, "simple_hTwist": 46.728 }, { "index": 10, "nt1": "///B/51", "nt2": "///B/63", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.246, 0.745, -0.188, -1.638, -7.030, -5.857 ], "step_params": [ 0.367, -2.091, 3.327, 3.661, 21.157, 30.495 ], "heli_params": [ -5.647, -0.167, 1.620, 35.265, -6.102, 37.148 ], "bp2_params": [ 1.369, 0.106, -0.832, 0.475, 20.496, 0.482 ], "groove_widths": [ 16.805, 15.075, 17.194, 13.486 ], "simple_Rise": 3.327, "simple_Twist": 21.976, "simple_hRise": 1.018, "simple_hTwist": 30.631 }, { "index": 11, "nt1": "///B/52", "nt2": "///B/62", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 1.369, 0.106, -0.832, 0.475, 20.496, 0.482 ], "step_params": [ -0.185, -2.055, 4.422, 0.514, 0.721, 26.138 ], "heli_params": [ -4.804, 0.596, 4.360, 1.594, -1.136, 26.152 ], "bp2_params": [ -0.378, -0.157, -1.236, -25.385, -8.043, 0.150 ], "groove_widths": [ 16.727, 14.895, 15.230, 10.983 ], "simple_Rise": 4.422, "simple_Twist": 35.234, "simple_hRise": 4.377, "simple_hTwist": 35.245 }, { "index": 12, "nt1": "///B/53", "nt2": "///B/61", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.378, -0.157, -1.236, -25.385, -8.043, 0.150 ], "step_params": [ -2.585, -1.583, 2.926, -4.458, 6.280, 86.390 ], "heli_params": [ -1.278, 1.795, 2.933, 4.579, 3.251, 86.665 ], "bp2_params": [ 3.800, -1.213, 0.143, 1.018, 15.575, -106.297 ], "groove_widths": [ 18.026, null, 26.446, null ], "simple_Rise": 2.926, "simple_Twist": 61.852, "simple_hRise": 2.930, "simple_hTwist": 62.282 }, { "index": 13, "nt1": "///B/54", "nt2": "///B/58", "bp": "t-A", "name": "rHoogsteen", "Saenger": "24-XXIV", "LW": "tWH", "DSSR": "tW-M", "bp1_params": [ 3.800, -1.213, 0.143, 1.018, 15.575, -106.297 ], "step_params": [ 1.772, -1.612, 3.399, 9.789, -2.701, 38.671 ], "heli_params": [ -2.012, -1.330, 3.819, -3.995, -14.481, 39.933 ], "bp2_params": [ 0.955, -4.844, -0.160, 17.746, 9.815, -102.787 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.399, "simple_Twist": -34.425, "simple_hRise": 2.681, "simple_hTwist": -35.848 }, { "index": 14, "nt1": "///B/55", "nt2": "///B/18", "bp": "U+G", "name": "--", "Saenger": "--", "LW": "tSW", "DSSR": "tm+W", "bp1_params": [ 0.955, -4.844, -0.160, 17.746, 9.815, -102.787 ], "step_params": [ -4.701, 0.792, 7.595, -9.507, -9.752, -91.159 ], "heli_params": [ -0.123, -3.686, 7.231, 6.796, -6.626, -91.948 ], "bp2_params": [ 0.847, 0.089, -0.393, 29.922, -27.761, 11.909 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 7.595, "simple_Twist": 7.910, "simple_hRise": 6.171, "simple_hTwist": 15.740 }, { "index": 15, "nt1": "///B/56", "nt2": "///B/19", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 4, "num_stems": 2, "strand1": "UACCCGAAGAGCAG", "strand2": "UCGGGCUGCUCGUC", "bp_type": "..|||||.||||..", "helix_form": "x..AA..x.A.xx", "helical_rise": 3.067, "helical_rise_std": 0.960, "helical_radius": 9.028, "helical_radius_std": 2.397, "helical_axis": [ 0.610, -0.743, -0.276 ], "point1": [ -60.499, 3.481, 8.634 ], "point2": [ -36.152, -26.178, -2.384 ], "num_pairs": 14, "pairs": [ { "index": 1, "nt1": "///B/36", "nt2": "///B/33", "bp": "U-U", "name": "--", "Saenger": "--", "LW": "tHW", "DSSR": "tM-W", "bp1_params": [ -7.336, -6.835, 1.079, -17.155, 22.100, -69.406 ], "step_params": [ 0.923, -3.073, 4.275, -5.937, 14.766, 76.418 ], "heli_params": [ -2.958, -0.941, 3.657, 11.815, 4.751, 77.809 ], "bp2_params": [ -3.748, -1.333, 1.741, 22.609, 22.815, -21.762 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 4.275, "simple_Twist": 37.990, "simple_hRise": 2.774, "simple_hTwist": 41.075 }, { "index": 2, "nt1": "///B/38", "nt2": "///B/32", "bp": "A-C", "name": "--", "Saenger": "--", "LW": "cHW", "DSSR": "cM-W", "bp1_params": [ -3.748, -1.333, 1.741, 22.609, 22.815, -21.762 ], "step_params": [ 0.795, -1.777, 3.485, 6.314, 3.155, 52.595 ], "heli_params": [ -2.206, -0.459, 3.448, 3.542, -7.090, 53.033 ], "bp2_params": [ 0.571, -0.288, -0.109, 23.383, 0.954, -5.513 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.485, "simple_Twist": 29.624, "simple_hRise": 3.375, "simple_hTwist": 30.435 }, { "index": 3, "nt1": "///B/39", "nt2": "///B/31", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.571, -0.288, -0.109, 23.383, 0.954, -5.513 ], "step_params": [ -0.266, -2.534, 3.702, -4.192, 8.207, 33.918 ], "heli_params": [ -5.488, -0.216, 3.036, 13.755, 7.027, 35.112 ], "bp2_params": [ 1.484, -0.566, -0.085, 4.757, 2.514, 3.269 ], "groove_widths": [ 16.906, null, 14.545, null ], "simple_Rise": 3.702, "simple_Twist": 28.710, "simple_hRise": 2.893, "simple_hTwist": 30.123 }, { "index": 4, "nt1": "///B/40", "nt2": "///B/30", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 1.484, -0.566, -0.085, 4.757, 2.514, 3.269 ], "step_params": [ -0.717, -2.049, 3.230, 0.067, 9.277, 29.441 ], "heli_params": [ -5.470, 1.360, 2.483, 17.708, -0.129, 30.837 ], "bp2_params": [ 0.863, -0.525, 0.246, -3.375, 0.400, 0.347 ], "groove_widths": [ 16.596, 15.079, 16.067, 10.174 ], "simple_Rise": 3.230, "simple_Twist": 33.042, "simple_hRise": 2.576, "simple_hTwist": 34.285 }, { "index": 5, "nt1": "///B/41", "nt2": "///B/29", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.863, -0.525, 0.246, -3.375, 0.400, 0.347 ], "step_params": [ 0.524, -2.415, 2.715, -4.098, 1.385, 24.648 ], "heli_params": [ -5.903, -2.179, 2.460, 3.213, 9.505, 25.019 ], "bp2_params": [ -0.414, -0.277, 0.529, 4.664, 7.135, 5.558 ], "groove_widths": [ 16.416, 15.410, 15.802, 9.184 ], "simple_Rise": 2.715, "simple_Twist": 31.921, "simple_hRise": 2.526, "simple_hTwist": 32.205 }, { "index": 6, "nt1": "///B/42", "nt2": "///B/28", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.414, -0.277, 0.529, 4.664, 7.135, 5.558 ], "step_params": [ -0.699, -2.357, 3.895, 9.290, 4.903, 35.888 ], "heli_params": [ -4.407, 2.466, 3.281, 7.754, -14.693, 37.345 ], "bp2_params": [ 0.246, -0.111, -0.484, -19.268, 2.695, -11.334 ], "groove_widths": [ 17.521, 14.311, 14.186, 10.723 ], "simple_Rise": 3.895, "simple_Twist": 32.270, "simple_hRise": 3.195, "simple_hTwist": 33.893 }, { "index": 7, "nt1": "///B/43", "nt2": "///B/27", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.246, -0.111, -0.484, -19.268, 2.695, -11.334 ], "step_params": [ -0.250, -2.141, 3.214, 2.236, 3.695, 33.470 ], "heli_params": [ -4.256, 0.774, 2.945, 6.382, -3.863, 33.739 ], "bp2_params": [ -1.506, 1.680, 0.197, -29.668, -14.414, -25.073 ], "groove_widths": [ 17.616, 12.986, 15.021, 13.796 ], "simple_Rise": 3.214, "simple_Twist": 40.647, "simple_hRise": 2.999, "simple_hTwist": 40.866 }, { "index": 8, "nt1": "///B/44", "nt2": "///B/26", "bp": "A-G", "name": "--", "Saenger": "--", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -1.506, 1.680, 0.197, -29.668, -14.414, -25.073 ], "step_params": [ -2.610, -3.031, 3.280, 13.508, 0.139, 62.375 ], "heli_params": [ -2.878, 3.021, 2.716, 0.133, -12.882, 63.677 ], "bp2_params": [ -1.013, -0.392, -0.468, -12.719, -8.233, 4.751 ], "groove_widths": [ 16.497, 13.557, 14.733, 14.299 ], "simple_Rise": 3.280, "simple_Twist": 62.034, "simple_hRise": 2.712, "simple_hTwist": 63.344 }, { "index": 9, "nt1": "///B/10", "nt2": "///B/25", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -1.013, -0.392, -0.468, -12.719, -8.233, 4.751 ], "step_params": [ -0.948, -1.510, 3.182, -0.300, 2.671, 39.733 ], "heli_params": [ -2.513, 1.358, 3.085, 3.924, 0.440, 39.820 ], "bp2_params": [ -0.153, -0.035, -0.469, -7.930, 3.306, 4.978 ], "groove_widths": [ 16.962, 15.283, 13.661, 13.594 ], "simple_Rise": 3.182, "simple_Twist": 34.850, "simple_hRise": 3.069, "simple_hTwist": 34.950 }, { "index": 10, "nt1": "///B/11", "nt2": "///B/24", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.153, -0.035, -0.469, -7.930, 3.306, 4.978 ], "step_params": [ 0.445, -0.950, 2.910, 1.936, 3.935, 32.187 ], "heli_params": [ -2.304, -0.498, 2.799, 7.057, -3.471, 32.477 ], "bp2_params": [ 0.245, 0.063, -0.230, 5.453, -5.886, 4.129 ], "groove_widths": [ 17.688, 16.324, 15.589, 10.776 ], "simple_Rise": 2.910, "simple_Twist": 30.119, "simple_hRise": 2.789, "simple_hTwist": 30.430 }, { "index": 11, "nt1": "///B/12", "nt2": "///B/23", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.245, 0.063, -0.230, 5.453, -5.886, 4.129 ], "step_params": [ 0.698, -2.287, 2.841, 9.708, 13.607, 22.791 ], "heli_params": [ -7.011, 0.220, 1.452, 29.821, -21.276, 28.198 ], "bp2_params": [ 0.044, -0.009, -1.119, 19.283, -11.365, 2.589 ], "groove_widths": [ 17.310, null, 8.392, null ], "simple_Rise": 2.841, "simple_Twist": 24.225, "simple_hRise": 1.536, "simple_hTwist": 29.361 }, { "index": 12, "nt1": "///B/13", "nt2": "///B/22", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.044, -0.009, -1.119, 19.283, -11.365, 2.589 ], "step_params": [ -0.503, -1.579, 3.925, 1.124, 3.959, 68.329 ], "heli_params": [ -1.579, 0.497, 3.832, 3.522, -1.000, 68.438 ], "bp2_params": [ -4.118, -1.839, 0.443, 2.809, 19.561, -103.331 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.925, "simple_Twist": 93.277, "simple_hRise": 3.867, "simple_hTwist": 93.347 }, { "index": 13, "nt1": "///B/14", "nt2": "///B/8", "bp": "A-U", "name": "rHoogsteen", "Saenger": "24-XXIV", "LW": "tHW", "DSSR": "tM-W", "bp1_params": [ -4.118, -1.839, 0.443, 2.809, 19.561, -103.331 ], "step_params": [ 2.732, -2.773, 3.109, -3.783, 5.446, -72.916 ], "heli_params": [ 2.151, 2.170, 3.399, -4.573, -3.177, -73.175 ], "bp2_params": [ 0.030, 1.852, 0.327, 5.187, 4.318, 164.094 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.109, "simple_Twist": 8.067, "simple_hRise": -0.029, "simple_hTwist": 10.439 }, { "index": 14, "nt1": "///B/15", "nt2": "///B/48", "bp": "G+C", "name": "--", "Saenger": "--", "LW": "tWW", "DSSR": "tW+W" } ] }, { "index": 5, "num_stems": 1, "strand1": "CUACUGG", "strand2": "GAUGGCA", "bp_type": "||||||.", "helix_form": "AAA...", "helical_rise": 2.718, "helical_rise_std": 0.354, "helical_radius": 10.142, "helical_radius_std": 1.279, "helical_axis": [ -0.267, -0.667, -0.695 ], "point1": [ 18.727, 91.948, -34.656 ], "point2": [ 14.347, 80.988, -46.071 ], "num_pairs": 7, "pairs": [ { "index": 1, "nt1": "///E/153", "nt2": "///E/168", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.234, -0.105, -0.187, 5.295, -3.231, -1.259 ], "step_params": [ 0.139, -1.620, 3.318, -1.587, 9.212, 29.938 ], "heli_params": [ -4.636, -0.539, 2.702, 17.309, 2.982, 31.331 ], "bp2_params": [ 0.077, -0.054, 0.025, -0.646, -0.838, 0.792 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.318, "simple_Twist": 30.725, "simple_hRise": 2.721, "simple_hTwist": 32.082 }, { "index": 2, "nt1": "///E/154", "nt2": "///E/167", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.077, -0.054, 0.025, -0.646, -0.838, 0.792 ], "step_params": [ -0.376, -1.377, 2.928, 0.410, 14.995, 33.415 ], "heli_params": [ -3.875, 0.646, 2.132, 24.597, -0.672, 36.540 ], "bp2_params": [ 0.188, -0.088, -0.233, 2.143, -2.560, -4.558 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.928, "simple_Twist": 33.053, "simple_hRise": 2.122, "simple_hTwist": 36.211 }, { "index": 3, "nt1": "///E/155", "nt2": "///E/166", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.188, -0.088, -0.233, 2.143, -2.560, -4.558 ], "step_params": [ 0.620, -2.113, 3.115, 2.870, 1.609, 28.599 ], "heli_params": [ -4.591, -0.640, 3.040, 3.243, -5.785, 28.784 ], "bp2_params": [ 0.190, -0.133, -0.449, 3.792, -3.996, -1.346 ], "groove_widths": [ 16.668, null, 18.510, null ], "simple_Rise": 3.115, "simple_Twist": 28.499, "simple_hRise": 3.040, "simple_hTwist": 28.684 }, { "index": 4, "nt1": "///E/156", "nt2": "///E/165", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.190, -0.133, -0.449, 3.792, -3.996, -1.346 ], "step_params": [ 0.653, -1.747, 3.429, 2.142, 1.215, 41.003 ], "heli_params": [ -2.628, -0.688, 3.406, 1.733, -3.054, 41.074 ], "bp2_params": [ 2.218, -0.527, -0.225, -1.185, -2.833, 1.407 ], "groove_widths": [ 16.020, null, 21.857, null ], "simple_Rise": 3.429, "simple_Twist": 29.767, "simple_hRise": 3.394, "simple_hTwist": 29.866 }, { "index": 5, "nt1": "///E/157", "nt2": "///E/164", "bp": "U-G", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 2.218, -0.527, -0.225, -1.185, -2.833, 1.407 ], "step_params": [ -1.138, -3.894, 3.711, -2.579, 4.769, 6.565 ], "heli_params": [ -36.322, 2.212, 1.028, 34.820, 18.830, 8.513 ], "bp2_params": [ -1.137, -0.285, -0.704, -6.470, 31.556, 9.271 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.711, "simple_Twist": 25.719, "simple_hRise": 3.049, "simple_hTwist": 26.275 }, { "index": 6, "nt1": "///E/158", "nt2": "///E/163", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -1.137, -0.285, -0.704, -6.470, 31.556, 9.271 ], "step_params": [ -2.441, -1.170, 2.010, -4.252, 7.756, 52.913 ], "heli_params": [ -1.599, 2.543, 2.009, 8.635, 4.735, 53.595 ], "bp2_params": [ 6.681, -4.714, 1.405, 20.862, 27.457, -15.437 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.010, "simple_Twist": -1.120, "simple_hRise": 0.106, "simple_hTwist": -8.916 }, { "index": 7, "nt1": "///E/159", "nt2": "///E/162", "bp": "G-A", "name": "Sheared", "Saenger": "11-XI", "LW": "tSH", "DSSR": "tm-M" } ] }, { "index": 6, "num_stems": 1, "strand1": "CUCCU", "strand2": "GAGGG", "bp_type": "||||.", "helix_form": "AAA.", "helical_rise": 2.971, "helical_rise_std": 0.457, "helical_radius": 10.050, "helical_radius_std": 0.503, "helical_axis": [ 0.058, -0.480, -0.876 ], "point1": [ 6.516, 64.251, -26.483 ], "point2": [ 7.206, 58.583, -36.829 ], "num_pairs": 5, "pairs": [ { "index": 1, "nt1": "///F/339", "nt2": "///F/350", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.063, -0.144, -0.348, 0.865, -5.440, -0.837 ], "step_params": [ 0.534, -1.125, 3.338, -4.985, 6.498, 32.835 ], "heli_params": [ -2.960, -1.705, 2.958, 11.277, 8.652, 33.814 ], "bp2_params": [ 0.125, -0.189, 0.089, 3.657, -0.695, 7.815 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.338, "simple_Twist": 32.663, "simple_hRise": 2.955, "simple_hTwist": 33.647 }, { "index": 2, "nt1": "///F/340", "nt2": "///F/349", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.125, -0.189, 0.089, 3.657, -0.695, 7.815 ], "step_params": [ 0.016, -1.878, 3.135, 3.622, 8.830, 34.431 ], "heli_params": [ -4.202, 0.440, 2.579, 14.573, -5.978, 35.690 ], "bp2_params": [ 0.394, -0.134, -0.257, 3.077, -3.576, 1.141 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.135, "simple_Twist": 33.025, "simple_hRise": 2.551, "simple_hTwist": 34.340 }, { "index": 3, "nt1": "///F/341", "nt2": "///F/348", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.394, -0.134, -0.257, 3.077, -3.576, 1.141 ], "step_params": [ -0.573, -2.368, 3.369, -1.370, 3.941, 25.099 ], "heli_params": [ -6.487, 0.917, 2.995, 8.989, 3.125, 25.438 ], "bp2_params": [ 0.317, -0.202, -0.139, 0.242, 1.543, -0.119 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.369, "simple_Twist": 25.338, "simple_hRise": 2.999, "simple_hTwist": 25.674 }, { "index": 4, "nt1": "///F/342", "nt2": "///F/347", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.317, -0.202, -0.139, 0.242, 1.543, -0.119 ], "step_params": [ -0.903, -0.676, 3.290, 15.102, 5.004, 95.577 ], "heli_params": [ -0.537, 0.860, 3.131, 3.360, -10.142, 96.573 ], "bp2_params": [ 1.305, -5.119, -0.769, -8.316, -14.487, -99.983 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.290, "simple_Twist": -0.719, "simple_hRise": 1.217, "simple_hTwist": -15.925 }, { "index": 5, "nt1": "///F/343", "nt2": "///F/346", "bp": "U+G", "name": "--", "Saenger": "--", "LW": "tSW", "DSSR": "tm+W" } ] }, { "index": 7, "num_stems": 2, "strand1": "GAGCCAGGGAGCG", "strand2": "AGUGGUCACUCGA", "bp_type": "..|||||.||||.", "helix_form": ".x.AAA.xxAA.", "helical_rise": 3.317, "helical_rise_std": 1.300, "helical_radius": 8.595, "helical_radius_std": 2.245, "helical_axis": [ -0.391, 0.520, 0.759 ], "point1": [ -16.211, -12.586, -104.207 ], "point2": [ -31.707, 8.030, -74.136 ], "num_pairs": 13, "pairs": [ { "index": 1, "nt1": "///G/1047", "nt2": "///G/1111", "bp": "G-A", "name": "Sheared", "Saenger": "11-XI", "LW": "tSH", "DSSR": "tm-M", "bp1_params": [ 6.794, -4.084, 0.175, 7.442, 1.905, -10.704 ], "step_params": [ -2.027, -0.156, 3.601, -9.973, -7.982, -13.185 ], "heli_params": [ 4.465, -11.328, 1.430, 27.667, -34.566, -18.339 ], "bp2_params": [ -7.223, -4.960, 0.976, -8.987, 10.776, -38.112 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.601, "simple_Twist": 77.958, "simple_hRise": 3.796, "simple_hTwist": 78.833 }, { "index": 2, "nt1": "///G/1048", "nt2": "///G/1110", "bp": "A-G", "name": "Sheared", "Saenger": "11-XI", "LW": "tHS", "DSSR": "tM-m", "bp1_params": [ -7.223, -4.960, 0.976, -8.987, 10.776, -38.112 ], "step_params": [ 0.177, -3.146, 7.643, -9.793, 34.871, 106.483 ], "heli_params": [ -2.878, -0.379, 6.749, 21.379, 6.004, 110.668 ], "bp2_params": [ -2.200, -0.402, 0.101, 8.354, 1.166, -3.061 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 7.643, "simple_Twist": 71.262, "simple_hRise": 5.788, "simple_hTwist": 78.839 }, { "index": 3, "nt1": "///G/1051", "nt2": "///G/1108", "bp": "G-U", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -2.200, -0.402, 0.101, 8.354, 1.166, -3.061 ], "step_params": [ 1.178, -1.639, 3.535, 0.809, 3.770, 42.964 ], "heli_params": [ -2.624, -1.517, 3.406, 5.135, -1.102, 43.128 ], "bp2_params": [ 0.410, -0.203, -0.498, 1.064, -3.647, 3.004 ], "groove_widths": [ 21.683, null, 8.250, null ], "simple_Rise": 3.535, "simple_Twist": 28.717, "simple_hRise": 3.328, "simple_hTwist": 28.970 }, { "index": 4, "nt1": "///G/1052", "nt2": "///G/1107", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.410, -0.203, -0.498, 1.064, -3.647, 3.004 ], "step_params": [ -0.509, -1.189, 3.408, 2.385, 12.354, 33.505 ], "heli_params": [ -3.681, 1.167, 2.770, 20.551, -3.968, 35.726 ], "bp2_params": [ 0.335, -0.224, -0.339, 3.630, -4.506, 1.922 ], "groove_widths": [ 19.484, 15.191, 15.297, 11.870 ], "simple_Rise": 3.408, "simple_Twist": 33.997, "simple_hRise": 2.782, "simple_hTwist": 36.186 }, { "index": 5, "nt1": "///G/1053", "nt2": "///G/1106", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.335, -0.224, -0.339, 3.630, -4.506, 1.922 ], "step_params": [ 0.549, -1.652, 3.275, -2.269, 6.066, 32.186 ], "heli_params": [ -3.914, -1.342, 2.880, 10.805, 4.041, 32.814 ], "bp2_params": [ -0.059, -0.215, 0.015, -2.225, 2.057, 7.082 ], "groove_widths": [ 17.461, 16.176, 15.718, 10.370 ], "simple_Rise": 3.275, "simple_Twist": 34.272, "simple_hRise": 2.908, "simple_hTwist": 34.861 }, { "index": 6, "nt1": "///G/1054", "nt2": "///G/1105", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.059, -0.215, 0.015, -2.225, 2.057, 7.082 ], "step_params": [ -0.001, -1.466, 3.422, -1.449, 12.236, 25.563 ], "heli_params": [ -5.680, -0.316, 2.471, 25.827, 3.059, 28.333 ], "bp2_params": [ -0.212, -0.071, 0.287, -5.050, 3.724, 1.390 ], "groove_widths": [ 16.355, 14.321, 14.222, 11.921 ], "simple_Rise": 3.422, "simple_Twist": 26.651, "simple_hRise": 2.516, "simple_hTwist": 29.314 }, { "index": 7, "nt1": "///G/1055", "nt2": "///G/1104", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.212, -0.071, 0.287, -5.050, 3.724, 1.390 ], "step_params": [ -1.363, -0.748, 3.714, 15.488, 5.970, 70.467 ], "heli_params": [ -0.853, 1.722, 3.330, 5.104, -13.241, 72.149 ], "bp2_params": [ 6.467, -4.360, -1.456, -1.818, 5.046, -7.505 ], "groove_widths": [ 16.005, 11.005, 11.499, 10.740 ], "simple_Rise": 3.714, "simple_Twist": 24.971, "simple_hRise": 2.269, "simple_hTwist": 29.911 }, { "index": 8, "nt1": "///G/1056", "nt2": "///G/1103", "bp": "G-A", "name": "Sheared", "Saenger": "11-XI", "LW": "tSH", "DSSR": "tm-M", "bp1_params": [ 6.467, -4.360, -1.456, -1.818, 5.046, -7.505 ], "step_params": [ -2.590, 1.210, 4.214, 2.635, -6.240, 38.991 ], "heli_params": [ 2.692, 4.210, 3.808, -9.263, -3.912, 39.552 ], "bp2_params": [ -0.193, -0.082, 0.003, -0.903, -0.342, -0.777 ], "groove_widths": [ 16.348, 11.112, 10.113, 10.100 ], "simple_Rise": 4.214, "simple_Twist": 84.172, "simple_hRise": 4.067, "simple_hTwist": 84.393 }, { "index": 9, "nt1": "///G/1087", "nt2": "///G/1102", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.193, -0.082, 0.003, -0.903, -0.342, -0.777 ], "step_params": [ -1.260, -3.469, 3.394, 10.398, 4.736, 44.277 ], "heli_params": [ -4.862, 2.483, 2.683, 6.162, -13.530, 45.656 ], "bp2_params": [ -0.068, -0.161, -0.050, -0.678, 0.699, 8.918 ], "groove_widths": [ 16.321, 13.371, 11.738, 11.522 ], "simple_Rise": 3.394, "simple_Twist": 43.567, "simple_hRise": 2.669, "simple_hTwist": 44.970 }, { "index": 10, "nt1": "///G/1090", "nt2": "///G/1101", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.068, -0.161, -0.050, -0.678, 0.699, 8.918 ], "step_params": [ -0.625, -1.746, 3.381, 4.105, 6.325, 25.042 ], "heli_params": [ -5.504, 2.449, 2.730, 14.181, -9.205, 26.136 ], "bp2_params": [ -0.198, -0.091, -0.144, -0.931, -0.014, 0.490 ], "groove_widths": [ 16.900, null, 19.047, null ], "simple_Rise": 3.381, "simple_Twist": 25.856, "simple_hRise": 2.753, "simple_hTwist": 26.915 }, { "index": 11, "nt1": "///G/1091", "nt2": "///G/1100", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.198, -0.091, -0.144, -0.931, -0.014, 0.490 ], "step_params": [ 0.167, -2.177, 3.320, 0.396, 4.663, 30.573 ], "heli_params": [ -4.957, -0.238, 2.965, 8.777, -0.745, 30.921 ], "bp2_params": [ 0.203, -0.091, -0.093, 0.127, -0.053, -0.289 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.320, "simple_Twist": 28.280, "simple_hRise": 2.933, "simple_hTwist": 28.657 }, { "index": 12, "nt1": "///G/1092", "nt2": "///G/1099", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.203, -0.091, -0.093, 0.127, -0.053, -0.289 ], "step_params": [ -0.133, -1.080, 3.358, 3.814, 6.720, 58.359 ], "heli_params": [ -1.449, 0.334, 3.214, 6.858, -3.893, 58.824 ], "bp2_params": [ 6.803, -3.969, -0.016, -0.358, 0.110, -2.411 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.358, "simple_Twist": 14.702, "simple_hRise": 2.512, "simple_hTwist": 16.599 }, { "index": 13, "nt1": "///G/1093", "nt2": "///G/1098", "bp": "G-A", "name": "Sheared", "Saenger": "11-XI", "LW": "tSH", "DSSR": "tm-M" } ] }, { "index": 8, "num_stems": 2, "strand1": "AUGUGGCU", "strand2": "UACACCGA", "bp_type": "|||.|||.", "helix_form": ".AxxAA.", "helical_rise": 2.559, "helical_rise_std": 1.235, "helical_radius": 9.561, "helical_radius_std": 4.325, "helical_axis": [ -0.400, 0.719, 0.569 ], "point1": [ -37.987, -7.411, -79.009 ], "point2": [ -45.026, 5.246, -69.000 ], "num_pairs": 8, "pairs": [ { "index": 1, "nt1": "///G/1057", "nt2": "///G/1081", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.048, -0.092, -0.008, 0.139, -0.930, 0.793 ], "step_params": [ -0.120, -2.171, 3.267, 1.881, -2.399, 33.108 ], "heli_params": [ -3.386, 0.531, 3.400, -4.198, -3.293, 33.245 ], "bp2_params": [ -0.081, -0.109, -0.074, -1.895, -0.504, 4.183 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.267, "simple_Twist": 33.257, "simple_hRise": 3.399, "simple_hTwist": 33.393 }, { "index": 2, "nt1": "///G/1058", "nt2": "///G/1080", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.081, -0.109, -0.074, -1.895, -0.504, 4.183 ], "step_params": [ -0.487, -1.736, 3.135, 5.295, 12.546, 30.607 ], "heli_params": [ -4.778, 1.588, 2.166, 22.425, -9.464, 33.434 ], "bp2_params": [ -0.136, -0.095, -0.054, -0.794, -0.687, -2.408 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.135, "simple_Twist": 31.025, "simple_hRise": 2.180, "simple_hTwist": 33.814 }, { "index": 3, "nt1": "///G/1059", "nt2": "///G/1079", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.136, -0.095, -0.054, -0.794, -0.687, -2.408 ], "step_params": [ -0.368, -0.761, 3.421, 11.384, -1.631, -24.598 ], "heli_params": [ 2.062, 2.280, 3.215, 3.589, 25.046, -27.116 ], "bp2_params": [ -0.879, 1.905, 0.336, 7.047, 0.160, -76.366 ], "groove_widths": [ 18.834, null, 27.642, null ], "simple_Rise": 3.421, "simple_Twist": 24.032, "simple_hRise": 2.986, "simple_hTwist": 26.606 }, { "index": 4, "nt1": "///G/1060", "nt2": "///G/1088", "bp": "U+A", "name": "--", "Saenger": "--", "LW": "cWH", "DSSR": "cW+M", "bp1_params": [ -0.879, 1.905, 0.336, 7.047, 0.160, -76.366 ], "step_params": [ 4.665, -3.192, 6.100, -41.640, -10.627, 27.235 ], "heli_params": [ -2.750, -9.342, 0.253, -14.619, 57.281, 50.530 ], "bp2_params": [ -0.224, -0.140, -0.078, 0.587, -0.662, -1.827 ], "groove_widths": [ 19.319, 16.777, 26.825, 26.676 ], "simple_Rise": 6.100, "simple_Twist": -21.019, "simple_hRise": 6.085, "simple_hTwist": -47.620 }, { "index": 5, "nt1": "///G/1062", "nt2": "///G/1076", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.224, -0.140, -0.078, 0.587, -0.662, -1.827 ], "step_params": [ -0.384, -1.723, 3.050, -3.202, 9.912, 36.243 ], "heli_params": [ -3.790, 0.234, 2.532, 15.543, 5.020, 37.662 ], "bp2_params": [ -0.217, -0.140, -0.056, -0.492, -0.501, -1.395 ], "groove_widths": [ 21.759, null, 24.414, null ], "simple_Rise": 3.050, "simple_Twist": 36.286, "simple_hRise": 2.533, "simple_hTwist": 37.703 }, { "index": 6, "nt1": "///G/1063", "nt2": "///G/1075", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.217, -0.140, -0.056, -0.492, -0.501, -1.395 ], "step_params": [ 0.716, -1.858, 3.269, 1.882, 2.099, 35.140 ], "heli_params": [ -3.376, -0.907, 3.189, 3.470, -3.111, 35.249 ], "bp2_params": [ 0.213, -0.090, -0.033, -0.690, -0.502, -0.068 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.269, "simple_Twist": 32.755, "simple_hRise": 3.182, "simple_hTwist": 32.873 }, { "index": 7, "nt1": "///G/1064", "nt2": "///G/1074", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.213, -0.090, -0.033, -0.690, -0.502, -0.068 ], "step_params": [ 0.124, -1.097, 3.848, 11.326, 10.445, 53.097 ], "heli_params": [ -1.899, 0.641, 3.547, 11.415, -12.378, 55.131 ], "bp2_params": [ 5.937, -1.374, -0.465, -18.254, -5.578, 0.978 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.848, "simple_Twist": 21.147, "simple_hRise": 2.745, "simple_hTwist": 26.113 }, { "index": 8, "nt1": "///G/1065", "nt2": "///G/1073", "bp": "U-A", "name": "--", "Saenger": "--", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 9, "num_stems": 1, "strand1": "CUGCUCCUAUACG", "strand2": "GGUGAGGCCAGGA", "bp_type": "|||||||....|.", "helix_form": "...AAA..x...", "helical_rise": 2.885, "helical_rise_std": 0.620, "helical_radius": 8.625, "helical_radius_std": 2.538, "helical_axis": [ -0.888, 0.208, -0.410 ], "point1": [ 21.853, 27.254, -51.521 ], "point2": [ -8.738, 34.423, -65.632 ], "num_pairs": 13, "pairs": [ { "index": 1, "nt1": "///I/2646", "nt2": "///I/2674", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.244, -0.225, 0.065, -0.028, 5.348, -3.741 ], "step_params": [ 1.276, -1.801, 3.153, 4.983, 5.237, 39.215 ], "heli_params": [ -3.220, -1.323, 3.030, 7.723, -7.348, 39.850 ], "bp2_params": [ 2.492, -0.598, -0.145, 5.604, -0.277, -0.578 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.153, "simple_Twist": 26.905, "simple_hRise": 2.940, "simple_hTwist": 27.842 }, { "index": 2, "nt1": "///I/2647", "nt2": "///I/2673", "bp": "U-G", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 2.492, -0.598, -0.145, 5.604, -0.277, -0.578 ], "step_params": [ -1.399, -2.711, 3.637, -4.548, -2.881, 12.268 ], "heli_params": [ -7.776, -0.073, 4.387, -12.710, 20.065, 13.393 ], "bp2_params": [ -2.180, -0.499, 0.088, -0.867, -0.841, -6.389 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.637, "simple_Twist": 37.545, "simple_hRise": 3.963, "simple_hTwist": 37.915 }, { "index": 3, "nt1": "///I/2648", "nt2": "///I/2672", "bp": "G-U", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -2.180, -0.499, 0.088, -0.867, -0.841, -6.389 ], "step_params": [ 0.581, -1.215, 3.225, 0.035, -2.412, 41.633 ], "heli_params": [ -1.454, -0.812, 3.288, -3.390, -0.049, 41.700 ], "bp2_params": [ 0.118, -0.113, -0.112, 5.720, -1.086, -2.331 ], "groove_widths": [ 16.365, null, 18.195, null ], "simple_Rise": 3.225, "simple_Twist": 29.231, "simple_hRise": 3.313, "simple_hTwist": 29.328 }, { "index": 4, "nt1": "///I/2649", "nt2": "///I/2671", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.118, -0.113, -0.112, 5.720, -1.086, -2.331 ], "step_params": [ -0.147, -1.685, 3.387, -3.633, 0.209, 29.575 ], "heli_params": [ -3.322, -0.500, 3.369, 0.408, 7.083, 29.793 ], "bp2_params": [ 0.101, -0.091, -0.019, 5.214, 1.371, 0.127 ], "groove_widths": [ 16.581, 15.546, 16.602, 15.959 ], "simple_Rise": 3.387, "simple_Twist": 29.731, "simple_hRise": 3.369, "simple_hTwist": 29.947 }, { "index": 5, "nt1": "///I/2650", "nt2": "///I/2670", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.101, -0.091, -0.019, 5.214, 1.371, 0.127 ], "step_params": [ -0.019, -1.746, 3.108, 1.691, 5.810, 34.847 ], "heli_params": [ -3.653, 0.257, 2.786, 9.612, -2.798, 35.353 ], "bp2_params": [ 0.184, -0.083, -0.238, 5.628, -4.707, 1.999 ], "groove_widths": [ 16.701, 15.408, 17.654, 15.545 ], "simple_Rise": 3.108, "simple_Twist": 34.300, "simple_hRise": 2.780, "simple_hTwist": 34.814 }, { "index": 6, "nt1": "///I/2651", "nt2": "///I/2669", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.184, -0.083, -0.238, 5.628, -4.707, 1.999 ], "step_params": [ 0.016, -2.585, 3.244, -1.038, 7.026, 27.576 ], "heli_params": [ -6.700, -0.246, 2.519, 14.439, 2.133, 28.459 ], "bp2_params": [ 0.220, -0.109, -0.111, 0.487, 0.910, 1.622 ], "groove_widths": [ 16.820, 13.678, 16.559, 13.206 ], "simple_Rise": 3.244, "simple_Twist": 27.405, "simple_hRise": 2.513, "simple_hTwist": 28.293 }, { "index": 7, "nt1": "///I/2652", "nt2": "///I/2668", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.220, -0.109, -0.111, 0.487, 0.910, 1.622 ], "step_params": [ -0.138, -0.860, 3.230, 14.794, 5.059, 43.732 ], "heli_params": [ -1.511, 1.396, 2.928, 6.547, -19.147, 46.314 ], "bp2_params": [ 4.687, -2.116, -1.746, 17.716, -5.888, 2.830 ], "groove_widths": [ 20.116, 15.997, 12.951, 10.798 ], "simple_Rise": 3.230, "simple_Twist": 16.194, "simple_hRise": 2.052, "simple_hTwist": 22.473 }, { "index": 8, "nt1": "///I/2653", "nt2": "///I/2667", "bp": "U-C", "name": "--", "Saenger": "--", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 4.687, -2.116, -1.746, 17.716, -5.888, 2.830 ], "step_params": [ 2.400, -0.028, 3.283, 3.113, 14.822, -8.185 ], "heli_params": [ -8.548, 9.838, 1.157, -60.454, 12.695, -17.204 ], "bp2_params": [ -2.877, -0.346, 0.716, -19.798, -3.660, -83.699 ], "groove_widths": [ 22.056, 20.124, 11.866, 11.825 ], "simple_Rise": 3.283, "simple_Twist": 4.960, "simple_hRise": 1.467, "simple_hTwist": 15.932 }, { "index": 9, "nt1": "///I/2654", "nt2": "///I/2666", "bp": "A-C", "name": "~rHoogsteen", "Saenger": "25-XXV", "LW": "tHW", "DSSR": "tM-W", "bp1_params": [ -2.877, -0.346, 0.716, -19.798, -3.660, -83.699 ], "step_params": [ -2.216, 0.156, 3.810, 6.111, 4.560, 50.727 ], "heli_params": [ -0.175, 3.036, 3.539, 5.288, -7.087, 51.260 ], "bp2_params": [ 4.335, -2.375, -0.618, 0.676, -6.231, -96.519 ], "groove_widths": [ 19.235, 18.002, 17.102, 16.870 ], "simple_Rise": 3.810, "simple_Twist": 39.499, "simple_hRise": 3.440, "simple_hTwist": 40.199 }, { "index": 10, "nt1": "///I/2656", "nt2": "///I/2665", "bp": "U-A", "name": "rHoogsteen", "Saenger": "24-XXIV", "LW": "tWH", "DSSR": "tW-M", "bp1_params": [ 4.335, -2.375, -0.618, 0.676, -6.231, -96.519 ], "step_params": [ 4.828, -1.293, 3.447, -7.152, 0.472, -10.652 ], "heli_params": [ 4.977, 9.321, 5.593, -2.237, -33.936, -12.834 ], "bp2_params": [ -6.808, -3.998, 0.055, -1.347, 0.988, -3.758 ], "groove_widths": [ 17.549, null, 20.591, null ], "simple_Rise": 3.447, "simple_Twist": 60.941, "simple_hRise": 2.909, "simple_hTwist": 61.321 }, { "index": 11, "nt1": "///I/2657", "nt2": "///I/2664", "bp": "A-G", "name": "Sheared", "Saenger": "11-XI", "LW": "tHS", "DSSR": "tM-m", "bp1_params": [ -6.808, -3.998, 0.055, -1.347, 0.988, -3.758 ], "step_params": [ 0.441, -1.210, 3.297, -1.572, 7.180, 61.777 ], "heli_params": [ -1.497, -0.498, 3.142, 6.967, 1.526, 62.169 ], "bp2_params": [ 0.341, -0.164, -0.110, -1.777, 1.657, 1.158 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.297, "simple_Twist": 15.122, "simple_hRise": 2.414, "simple_hTwist": 16.805 }, { "index": 12, "nt1": "///I/2658", "nt2": "///I/2663", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.341, -0.164, -0.110, -1.777, 1.657, 1.158 ], "step_params": [ -1.425, -0.975, 2.671, -1.089, 9.894, 49.593 ], "heli_params": [ -1.700, 1.608, 2.475, 11.660, 1.284, 50.520 ], "bp2_params": [ 7.040, -5.507, 1.045, 15.484, 4.057, -3.545 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.671, "simple_Twist": -1.371, "simple_hRise": 1.170, "simple_hTwist": -10.048 }, { "index": 13, "nt1": "///I/2659", "nt2": "///I/2662", "bp": "G-A", "name": "Sheared", "Saenger": "11-XI", "LW": "tSH", "DSSR": "tm-M" } ] }, { "index": 10, "num_stems": 1, "strand1": "GUCGGG", "strand2": "CAGCCU", "bp_type": "|||||.", "helix_form": ".AAA.", "helical_rise": 1.916, "helical_rise_std": 0.409, "helical_radius": 8.817, "helical_radius_std": 1.449, "helical_axis": [ 0.169, 0.486, -0.858 ], "point1": [ -4.474, 13.440, -6.602 ], "point2": [ -2.926, 17.892, -14.461 ], "num_pairs": 6, "pairs": [ { "index": 1, "nt1": "///J/1945", "nt2": "///J/1961", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.038, -0.198, 0.067, -0.059, -1.144, -2.425 ], "step_params": [ -0.022, -1.329, 3.235, -4.588, 4.377, 36.371 ], "heli_params": [ -2.672, -0.566, 3.041, 6.948, 7.282, 36.901 ], "bp2_params": [ -0.081, -0.175, 0.131, 2.865, -3.068, 1.783 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.235, "simple_Twist": 36.779, "simple_hRise": 3.044, "simple_hTwist": 37.303 }, { "index": 2, "nt1": "///J/1946", "nt2": "///J/1960", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.081, -0.175, 0.131, 2.865, -3.068, 1.783 ], "step_params": [ -0.488, -1.754, 2.826, -0.431, 9.048, 31.185 ], "heli_params": [ -4.397, 0.814, 2.248, 16.402, 0.782, 32.443 ], "bp2_params": [ 0.316, -0.105, -0.176, 9.570, -4.596, 2.158 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.826, "simple_Twist": 28.982, "simple_hRise": 2.197, "simple_hTwist": 30.336 }, { "index": 3, "nt1": "///J/1947", "nt2": "///J/1959", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.316, -0.105, -0.176, 9.570, -4.596, 2.158 ], "step_params": [ -0.087, -2.087, 3.314, -2.443, 13.698, 31.025 ], "heli_params": [ -5.525, -0.198, 2.222, 24.145, 4.306, 33.932 ], "bp2_params": [ -0.171, -0.164, 0.038, -4.514, -4.382, 1.189 ], "groove_widths": [ 16.776, null, 15.360, null ], "simple_Rise": 3.314, "simple_Twist": 33.660, "simple_hRise": 2.319, "simple_hTwist": 36.346 }, { "index": 4, "nt1": "///J/1948", "nt2": "///J/1958", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.171, -0.164, 0.038, -4.514, -4.382, 1.189 ], "step_params": [ 0.216, -1.957, 3.320, 4.532, 7.224, 34.385 ], "heli_params": [ -4.241, 0.285, 2.867, 11.993, -7.523, 35.396 ], "bp2_params": [ -0.176, -0.108, -0.199, -7.830, -2.998, -1.465 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.320, "simple_Twist": 34.318, "simple_hRise": 2.866, "simple_hTwist": 35.331 }, { "index": 5, "nt1": "///J/1949", "nt2": "///J/1957", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.176, -0.108, -0.199, -7.830, -2.998, -1.465 ], "step_params": [ -0.594, -1.428, 3.718, 11.259, 9.084, 48.980 ], "heli_params": [ -2.348, 1.542, 3.222, 10.689, -13.249, 50.945 ], "bp2_params": [ 5.099, 0.333, -0.769, -16.738, 8.653, -15.019 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.718, "simple_Twist": 24.328, "simple_hRise": 2.525, "simple_hTwist": 28.249 }, { "index": 6, "nt1": "///J/1950", "nt2": "///J/1956", "bp": "G-U", "name": "--", "Saenger": "--", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 11, "num_stems": 1, "strand1": "AUGGCU", "strand2": "UACCGC", "bp_type": "|||||.", "helix_form": "AAAA.", "helical_rise": 2.788, "helical_rise_std": 0.469, "helical_radius": 9.017, "helical_radius_std": 1.029, "helical_axis": [ 0.423, -0.471, 0.774 ], "point1": [ 4.731, 18.636, -33.141 ], "point2": [ 10.667, 12.026, -22.290 ], "num_pairs": 6, "pairs": [ { "index": 1, "nt1": "///K/2547", "nt2": "///K/2561", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.005, -0.138, 0.177, -4.189, -0.321, 5.665 ], "step_params": [ -0.730, -1.132, 3.137, 0.929, 6.917, 32.105 ], "heli_params": [ -3.094, 1.437, 2.817, 12.326, -1.656, 32.835 ], "bp2_params": [ 0.060, -0.131, 0.130, 0.387, -3.008, -1.756 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.137, "simple_Twist": 31.673, "simple_hRise": 2.812, "simple_hTwist": 32.413 }, { "index": 2, "nt1": "///K/2548", "nt2": "///K/2560", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.060, -0.131, 0.130, 0.387, -3.008, -1.756 ], "step_params": [ 0.761, -1.994, 3.113, 1.034, 11.463, 29.496 ], "heli_params": [ -5.457, -1.235, 2.227, 21.511, -1.939, 31.615 ], "bp2_params": [ -0.156, -0.112, 0.134, -3.554, -5.837, -2.032 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.113, "simple_Twist": 30.577, "simple_hRise": 2.263, "simple_hTwist": 32.623 }, { "index": 3, "nt1": "///K/2549", "nt2": "///K/2559", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.156, -0.112, 0.134, -3.554, -5.837, -2.032 ], "step_params": [ -0.756, -1.936, 3.099, 0.398, 10.457, 35.699 ], "heli_params": [ -4.246, 1.233, 2.446, 16.622, -0.633, 37.153 ], "bp2_params": [ -0.291, -0.162, -0.101, -7.340, -2.596, -1.186 ], "groove_widths": [ 17.644, null, 15.082, null ], "simple_Rise": 3.099, "simple_Twist": 36.435, "simple_hRise": 2.462, "simple_hTwist": 37.859 }, { "index": 4, "nt1": "///K/2550", "nt2": "///K/2558", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.291, -0.162, -0.101, -7.340, -2.596, -1.186 ], "step_params": [ 0.549, -1.280, 3.188, 1.144, 17.920, 32.036 ], "heli_params": [ -4.217, -0.734, 2.208, 29.734, -1.898, 36.610 ], "bp2_params": [ 0.086, -0.093, 0.119, -1.480, 3.570, -3.317 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.188, "simple_Twist": 30.045, "simple_hRise": 2.131, "simple_hTwist": 34.895 }, { "index": 5, "nt1": "///K/2551", "nt2": "///K/2557", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.086, -0.093, 0.119, -1.480, 3.570, -3.317 ], "step_params": [ -0.917, -0.548, 3.143, 1.864, 12.681, 48.498 ], "heli_params": [ -1.508, 1.210, 2.889, 15.133, -2.225, 50.064 ], "bp2_params": [ 5.937, -2.404, 1.009, 13.378, 13.605, -17.036 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.143, "simple_Twist": 14.932, "simple_hRise": 1.955, "simple_hTwist": 19.655 }, { "index": 6, "nt1": "///K/2552", "nt2": "///K/2556", "bp": "U-C", "name": "--", "Saenger": "--", "LW": "tW.", "DSSR": "tW-." } ] } ], "num_stems": 17, "stems": [ { "index": 1, "helix_index": 1, "strand1": "GCGGAUU", "strand2": "CGCUUAA", "bp_type": "|||||||", "helix_form": ".A....", "helical_rise": 2.823, "helical_rise_std": 0.660, "helical_radius": 8.937, "helical_radius_std": 0.604, "helical_axis": [ -0.903, -0.252, -0.347 ], "point1": [ -14.898, -3.411, -32.418 ], "point2": [ -30.359, -7.729, -38.360 ], "num_pairs": 7, "pairs": [ { "index": 1, "nt1": "///A/1", "nt2": "///A/72", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.325, -0.099, -0.586, -30.703, 24.532, -11.943 ], "step_params": [ 0.233, -1.638, 3.236, -14.219, 28.597, 36.884 ], "heli_params": [ -3.853, -1.208, 1.497, 37.725, 18.758, 48.423 ], "bp2_params": [ -0.287, -0.202, 0.370, -10.399, -5.707, 2.008 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.236, "simple_Twist": 34.763, "simple_hRise": 1.394, "simple_hTwist": 46.870 }, { "index": 2, "nt1": "///A/2", "nt2": "///A/71", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.287, -0.202, 0.370, -10.399, -5.707, 2.008 ], "step_params": [ -0.085, -1.345, 2.935, -0.670, 2.477, 29.477 ], "heli_params": [ -3.096, 0.042, 2.816, 4.856, 1.314, 29.586 ], "bp2_params": [ -0.076, -0.135, 0.437, 0.702, -10.802, -2.553 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.935, "simple_Twist": 28.541, "simple_hRise": 2.811, "simple_hTwist": 28.654 }, { "index": 3, "nt1": "///A/3", "nt2": "///A/70", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.076, -0.135, 0.437, 0.702, -10.802, -2.553 ], "step_params": [ 0.228, -1.804, 2.735, -4.891, 8.559, 24.051 ], "heli_params": [ -5.757, -1.504, 1.908, 19.523, 11.156, 25.966 ], "bp2_params": [ -2.215, -0.467, 0.650, 10.074, -5.906, 0.136 ], "groove_widths": [ 17.228, null, 16.580, null ], "simple_Rise": 2.735, "simple_Twist": 36.017, "simple_hRise": 2.215, "simple_hTwist": 37.299 }, { "index": 4, "nt1": "///A/4", "nt2": "///A/69", "bp": "G-U", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -2.215, -0.467, 0.650, 10.074, -5.906, 0.136 ], "step_params": [ -0.220, -1.391, 3.255, 2.048, 3.547, 42.958 ], "heli_params": [ -2.232, 0.496, 3.123, 4.830, -2.789, 43.143 ], "bp2_params": [ 0.112, -0.203, 0.239, 6.336, -19.440, 3.692 ], "groove_widths": [ 16.548, null, 15.503, null ], "simple_Rise": 3.255, "simple_Twist": 30.047, "simple_hRise": 3.053, "simple_hTwist": 30.319 }, { "index": 5, "nt1": "///A/5", "nt2": "///A/68", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.112, -0.203, 0.239, 6.336, -19.440, 3.692 ], "step_params": [ 0.459, -1.714, 3.479, -0.293, 8.447, 28.409 ], "heli_params": [ -5.120, -0.960, 2.857, 16.749, 0.581, 29.615 ], "bp2_params": [ -0.484, -0.250, 0.301, -9.162, -19.865, 5.536 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.479, "simple_Twist": 31.369, "simple_hRise": 2.926, "simple_hTwist": 32.460 }, { "index": 6, "nt1": "///A/6", "nt2": "///A/67", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.484, -0.250, 0.301, -9.162, -19.865, 5.536 ], "step_params": [ -0.185, -1.259, 3.078, 1.998, 9.797, 34.694 ], "heli_params": [ -3.268, 0.551, 2.623, 16.022, -3.267, 36.063 ], "bp2_params": [ -0.057, -0.287, -0.062, -2.612, -3.667, 1.456 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.078, "simple_Twist": 32.801, "simple_hRise": 2.590, "simple_hTwist": 34.251 }, { "index": 7, "nt1": "///A/7", "nt2": "///A/66", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 2, "helix_index": 2, "strand1": "gCUC", "strand2": "CGAG", "bp_type": "||||", "helix_form": "AA.", "helical_rise": 2.394, "helical_rise_std": 0.225, "helical_radius": 8.710, "helical_radius_std": 1.340, "helical_axis": [ 0.616, -0.651, -0.443 ], "point1": [ -47.974, 6.305, -24.741 ], "point2": [ -43.625, 1.712, -27.865 ], "num_pairs": 4, "pairs": [ { "index": 1, "nt1": "///A/10", "nt2": "///A/25", "bp": "g-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.212, -0.310, -0.047, -4.317, -7.914, 1.087 ], "step_params": [ -0.954, -1.612, 3.146, -2.750, 4.610, 38.116 ], "heli_params": [ -2.986, 1.125, 2.997, 7.016, 4.186, 38.478 ], "bp2_params": [ 0.218, -0.234, 0.193, -6.731, -18.668, 4.139 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.146, "simple_Twist": 35.387, "simple_hRise": 2.982, "simple_hTwist": 35.779 }, { "index": 2, "nt1": "///A/11", "nt2": "///A/24", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.218, -0.234, 0.193, -6.731, -18.668, 4.139 ], "step_params": [ -0.281, -1.204, 3.260, -1.155, 7.308, 32.333 ], "heli_params": [ -3.289, 0.306, 2.933, 12.912, 2.041, 33.147 ], "bp2_params": [ -0.041, -0.116, 0.426, -9.454, -3.619, -2.708 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.260, "simple_Twist": 34.171, "simple_hRise": 2.955, "simple_hTwist": 34.939 }, { "index": 3, "nt1": "///A/12", "nt2": "///A/23", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.041, -0.116, 0.426, -9.454, -3.619, -2.708 ], "step_params": [ 1.734, -2.071, 2.848, 5.686, 1.041, 27.191 ], "heli_params": [ -4.541, -2.363, 3.060, 2.182, -11.923, 27.788 ], "bp2_params": [ 0.256, -0.102, -0.083, 5.600, -2.156, 1.512 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.848, "simple_Twist": 25.630, "simple_hRise": 3.069, "simple_hTwist": 26.263 }, { "index": 4, "nt1": "///A/13", "nt2": "///A/22", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 3, "helix_index": 2, "strand1": "CCAG", "strand2": "GGUc", "bp_type": "||||", "helix_form": "AAA", "helical_rise": 2.843, "helical_rise_std": 0.080, "helical_radius": 9.176, "helical_radius_std": 0.236, "helical_axis": [ -0.374, 0.531, 0.761 ], "point1": [ -53.571, 7.488, -20.341 ], "point2": [ -56.744, 11.993, -13.881 ], "num_pairs": 4, "pairs": [ { "index": 1, "nt1": "///A/27", "nt2": "///A/43", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.188, -0.320, 0.236, 9.438, -20.001, -2.980 ], "step_params": [ 0.082, -1.515, 3.278, -1.471, 5.738, 36.155 ], "heli_params": [ -3.173, -0.325, 3.005, 9.170, 2.350, 36.621 ], "bp2_params": [ 0.005, -0.352, 0.471, 4.748, -9.370, -1.512 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.278, "simple_Twist": 36.669, "simple_hRise": 3.010, "simple_hTwist": 37.128 }, { "index": 2, "nt1": "///A/28", "nt2": "///A/42", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.005, -0.352, 0.471, 4.748, -9.370, -1.512 ], "step_params": [ 0.301, -1.779, 3.024, 0.154, 7.755, 26.075 ], "heli_params": [ -5.437, -0.609, 2.406, 16.723, -0.332, 27.185 ], "bp2_params": [ 0.063, 0.058, 0.351, 4.983, -8.735, 12.028 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.024, "simple_Twist": 25.924, "simple_hRise": 2.402, "simple_hTwist": 27.040 }, { "index": 3, "nt1": "///A/29", "nt2": "///A/41", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.063, 0.058, 0.351, 4.983, -8.735, 12.028 ], "step_params": [ -0.775, -1.658, 3.603, 2.083, 4.921, 41.010 ], "heli_params": [ -2.912, 1.336, 3.349, 6.989, -2.958, 41.342 ], "bp2_params": [ 0.769, -0.215, -0.046, -4.675, -14.346, -1.769 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.603, "simple_Twist": 36.926, "simple_hRise": 3.315, "simple_hTwist": 37.297 }, { "index": 4, "nt1": "///A/30", "nt2": "///A/40", "bp": "G-c", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 4, "helix_index": 1, "strand1": "cUGUG", "strand2": "GACAC", "bp_type": "|||||", "helix_form": "AAAA", "helical_rise": 2.654, "helical_rise_std": 0.201, "helical_radius": 8.814, "helical_radius_std": 0.283, "helical_axis": [ -0.914, -0.150, -0.377 ], "point1": [ -32.945, -8.149, -40.724 ], "point2": [ -42.548, -9.729, -44.688 ], "num_pairs": 5, "pairs": [ { "index": 1, "nt1": "///A/49", "nt2": "///A/65", "bp": "c-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.101, -0.230, 0.045, -0.804, -7.262, -2.187 ], "step_params": [ -0.923, -2.096, 3.196, -1.483, 7.712, 29.005 ], "heli_params": [ -5.477, 1.506, 2.608, 15.052, 2.894, 30.027 ], "bp2_params": [ -0.131, -0.247, 0.108, -3.205, -5.788, -2.430 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.196, "simple_Twist": 28.941, "simple_hRise": 2.606, "simple_hTwist": 29.965 }, { "index": 2, "nt1": "///A/50", "nt2": "///A/64", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.131, -0.247, 0.108, -3.205, -5.788, -2.430 ], "step_params": [ 0.267, -1.430, 3.337, 0.965, 4.899, 31.559 ], "heli_params": [ -3.476, -0.313, 3.092, 8.938, -1.760, 31.942 ], "bp2_params": [ -0.304, -0.157, 0.043, -4.613, -13.336, 4.254 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.337, "simple_Twist": 32.667, "simple_hRise": 3.102, "simple_hTwist": 33.036 }, { "index": 3, "nt1": "///A/51", "nt2": "///A/63", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.304, -0.157, 0.043, -4.613, -13.336, 4.254 ], "step_params": [ 0.264, -1.308, 3.191, -1.005, 3.375, 28.740 ], "heli_params": [ -3.327, -0.739, 3.010, 6.767, 2.015, 28.950 ], "bp2_params": [ -0.557, -0.153, 0.084, -1.325, -6.629, -0.426 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.191, "simple_Twist": 30.287, "simple_hRise": 3.021, "simple_hTwist": 30.486 }, { "index": 4, "nt1": "///A/52", "nt2": "///A/62", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.557, -0.153, 0.084, -1.325, -6.629, -0.426 ], "step_params": [ 0.978, -1.976, 3.373, 2.014, 7.790, 33.726 ], "heli_params": [ -4.485, -1.340, 2.910, 13.195, -3.411, 34.645 ], "bp2_params": [ -0.343, -0.153, -0.179, -10.733, -6.510, 1.819 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.373, "simple_Twist": 32.310, "simple_hRise": 2.885, "simple_hTwist": 33.271 }, { "index": 5, "nt1": "///A/53", "nt2": "///A/61", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 5, "helix_index": 3, "strand1": "GCGGGG", "strand2": "CGCCCC", "bp_type": "||||||", "helix_form": "A....", "helical_rise": 2.707, "helical_rise_std": 0.470, "helical_radius": 9.779, "helical_radius_std": 0.804, "helical_axis": [ -0.764, -0.645, -0.018 ], "point1": [ -13.312, -16.465, -14.340 ], "point2": [ -23.604, -25.150, -14.580 ], "num_pairs": 6, "pairs": [ { "index": 1, "nt1": "///B/2", "nt2": "///B/71", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.564, -0.138, -0.449, 5.153, -7.940, 1.313 ], "step_params": [ 0.041, -1.431, 3.284, 0.204, -1.879, 39.939 ], "heli_params": [ -1.874, -0.036, 3.345, -2.749, -0.299, 39.982 ], "bp2_params": [ 0.704, -0.266, -0.253, 15.407, -21.919, -7.259 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.284, "simple_Twist": 33.467, "simple_hRise": 3.357, "simple_hTwist": 33.519 }, { "index": 2, "nt1": "///B/3", "nt2": "///B/70", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.704, -0.266, -0.253, 15.407, -21.919, -7.259 ], "step_params": [ 0.200, -2.171, 3.745, -0.907, 26.148, 19.012 ], "heli_params": [ -7.739, -0.492, 0.478, 54.565, 1.893, 32.245 ], "bp2_params": [ -1.187, -0.681, -0.970, -2.719, 12.280, -1.638 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.745, "simple_Twist": 29.046, "simple_hRise": 1.389, "simple_hTwist": 38.904 }, { "index": 3, "nt1": "///B/4", "nt2": "///B/69", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -1.187, -0.681, -0.970, -2.719, 12.280, -1.638 ], "step_params": [ 0.245, -1.100, 3.396, -6.107, -3.464, 42.499 ], "heli_params": [ -1.141, -0.964, 3.406, -4.740, 8.356, 43.049 ], "bp2_params": [ 0.482, 0.190, -0.297, 1.709, -8.680, 13.062 ], "groove_widths": [ 16.743, null, 17.484, null ], "simple_Rise": 3.396, "simple_Twist": 33.046, "simple_hRise": 3.393, "simple_hTwist": 33.763 }, { "index": 4, "nt1": "///B/5", "nt2": "///B/68", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.482, 0.190, -0.297, 1.709, -8.680, 13.062 ], "step_params": [ -0.566, -2.311, 3.611, 4.041, 1.312, 35.890 ], "heli_params": [ -3.927, 1.529, 3.445, 2.119, -6.529, 36.133 ], "bp2_params": [ 2.226, 0.738, -0.471, -9.313, 1.451, -7.849 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.611, "simple_Twist": 28.028, "simple_hRise": 3.388, "simple_hTwist": 28.342 }, { "index": 5, "nt1": "///B/6", "nt2": "///B/67", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 2.226, 0.738, -0.471, -9.313, 1.451, -7.849 ], "step_params": [ -0.305, -2.017, 3.294, 5.043, 20.789, 16.609 ], "heli_params": [ -8.087, 1.567, 0.439, 51.113, -12.399, 27.024 ], "bp2_params": [ -0.761, -0.266, -0.338, -8.706, -7.503, -11.839 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.294, "simple_Twist": 31.121, "simple_hRise": 1.614, "simple_hTwist": 37.614 }, { "index": 6, "nt1": "///B/7", "nt2": "///B/66", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 6, "helix_index": 4, "strand1": "GAGC", "strand2": "CUCG", "bp_type": "||||", "helix_form": ".A.", "helical_rise": 2.786, "helical_rise_std": 0.211, "helical_radius": 9.082, "helical_radius_std": 0.485, "helical_axis": [ 0.800, -0.526, -0.289 ], "point1": [ -44.717, -14.549, 0.095 ], "point2": [ -37.973, -18.988, -2.346 ], "num_pairs": 4, "pairs": [ { "index": 1, "nt1": "///B/10", "nt2": "///B/25", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -1.013, -0.392, -0.468, -12.719, -8.233, 4.751 ], "step_params": [ -0.948, -1.510, 3.182, -0.300, 2.671, 39.733 ], "heli_params": [ -2.513, 1.358, 3.085, 3.924, 0.440, 39.820 ], "bp2_params": [ -0.153, -0.035, -0.469, -7.930, 3.306, 4.978 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.182, "simple_Twist": 34.850, "simple_hRise": 3.069, "simple_hTwist": 34.950 }, { "index": 2, "nt1": "///B/11", "nt2": "///B/24", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.153, -0.035, -0.469, -7.930, 3.306, 4.978 ], "step_params": [ 0.445, -0.950, 2.910, 1.936, 3.935, 32.187 ], "heli_params": [ -2.304, -0.498, 2.799, 7.057, -3.471, 32.477 ], "bp2_params": [ 0.245, 0.063, -0.230, 5.453, -5.886, 4.129 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.910, "simple_Twist": 30.119, "simple_hRise": 2.789, "simple_hTwist": 30.430 }, { "index": 3, "nt1": "///B/12", "nt2": "///B/23", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.245, 0.063, -0.230, 5.453, -5.886, 4.129 ], "step_params": [ 0.698, -2.287, 2.841, 9.708, 13.607, 22.791 ], "heli_params": [ -7.011, 0.220, 1.452, 29.821, -21.276, 28.198 ], "bp2_params": [ 0.044, -0.009, -1.119, 19.283, -11.365, 2.589 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.841, "simple_Twist": 24.225, "simple_hRise": 1.536, "simple_hTwist": 29.361 }, { "index": 4, "nt1": "///B/13", "nt2": "///B/22", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 7, "helix_index": 4, "strand1": "UCGGG", "strand2": "AGCCC", "bp_type": "|||||", "helix_form": ".AA.", "helical_rise": 2.023, "helical_rise_std": 0.199, "helical_radius": 9.205, "helical_radius_std": 0.901, "helical_axis": [ -0.477, 0.878, -0.045 ], "point1": [ -50.429, -10.146, 5.862 ], "point2": [ -54.148, -3.308, 5.510 ], "num_pairs": 5, "pairs": [ { "index": 1, "nt1": "///B/27", "nt2": "///B/43", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.246, -0.111, -0.484, 19.268, 2.695, -11.334 ], "step_params": [ 0.699, -2.357, 3.895, -9.290, 4.903, 35.888 ], "heli_params": [ -4.407, -2.466, 3.281, 7.754, 14.693, 37.345 ], "bp2_params": [ 0.414, -0.277, 0.529, -4.664, 7.135, 5.558 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.895, "simple_Twist": 32.270, "simple_hRise": 3.195, "simple_hTwist": 33.893 }, { "index": 2, "nt1": "///B/28", "nt2": "///B/42", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.414, -0.277, 0.529, -4.664, 7.135, 5.558 ], "step_params": [ -0.524, -2.415, 2.715, 4.098, 1.385, 24.648 ], "heli_params": [ -5.903, 2.179, 2.460, 3.213, -9.505, 25.019 ], "bp2_params": [ -0.863, -0.525, 0.246, 3.375, 0.400, 0.347 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.715, "simple_Twist": 31.921, "simple_hRise": 2.526, "simple_hTwist": 32.205 }, { "index": 3, "nt1": "///B/29", "nt2": "///B/41", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.863, -0.525, 0.246, 3.375, 0.400, 0.347 ], "step_params": [ 0.717, -2.049, 3.230, -0.067, 9.277, 29.441 ], "heli_params": [ -5.470, -1.360, 2.483, 17.708, 0.129, 30.837 ], "bp2_params": [ -1.484, -0.566, -0.085, -4.757, 2.514, 3.269 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.230, "simple_Twist": 33.042, "simple_hRise": 2.576, "simple_hTwist": 34.285 }, { "index": 4, "nt1": "///B/30", "nt2": "///B/40", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -1.484, -0.566, -0.085, -4.757, 2.514, 3.269 ], "step_params": [ 0.266, -2.534, 3.702, 4.192, 8.207, 33.918 ], "heli_params": [ -5.488, 0.216, 3.036, 13.755, -7.027, 35.112 ], "bp2_params": [ -0.571, -0.288, -0.109, -23.383, 0.954, -5.513 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.702, "simple_Twist": 28.710, "simple_hRise": 2.893, "simple_hTwist": 30.123 }, { "index": 5, "nt1": "///B/31", "nt2": "///B/39", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 8, "helix_index": 3, "strand1": "GUCGG", "strand2": "CGGCC", "bp_type": "|||||", "helix_form": "....", "helical_rise": 2.399, "helical_rise_std": 0.675, "helical_radius": 9.372, "helical_radius_std": 0.685, "helical_axis": [ -0.807, -0.579, -0.117 ], "point1": [ -26.409, -26.722, -14.359 ], "point2": [ -34.107, -32.249, -15.480 ], "num_pairs": 5, "pairs": [ { "index": 1, "nt1": "///B/49", "nt2": "///B/65", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 1.083, -0.135, -0.684, -6.702, -7.039, -11.863 ], "step_params": [ 1.310, -0.688, 2.721, 6.119, 2.413, 29.916 ], "heli_params": [ -1.715, -1.437, 2.863, 4.605, -11.676, 30.615 ], "bp2_params": [ 1.508, -0.431, -0.901, 15.857, -23.652, 13.868 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.721, "simple_Twist": 27.272, "simple_hRise": 2.870, "simple_hTwist": 28.040 }, { "index": 2, "nt1": "///B/50", "nt2": "///B/64", "bp": "U-G", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 1.508, -0.431, -0.901, 15.857, -23.652, 13.868 ], "step_params": [ -0.856, -1.814, 3.189, -4.302, 23.567, 31.078 ], "heli_params": [ -5.043, 0.855, 1.580, 37.754, 6.892, 39.058 ], "bp2_params": [ -0.246, 0.745, -0.188, -1.638, -7.030, -5.857 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.189, "simple_Twist": 40.419, "simple_hRise": 1.977, "simple_hTwist": 46.728 }, { "index": 3, "nt1": "///B/51", "nt2": "///B/63", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.246, 0.745, -0.188, -1.638, -7.030, -5.857 ], "step_params": [ 0.367, -2.091, 3.327, 3.661, 21.157, 30.495 ], "heli_params": [ -5.647, -0.167, 1.620, 35.265, -6.102, 37.148 ], "bp2_params": [ 1.369, 0.106, -0.832, 0.475, 20.496, 0.482 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.327, "simple_Twist": 21.976, "simple_hRise": 1.018, "simple_hTwist": 30.631 }, { "index": 4, "nt1": "///B/52", "nt2": "///B/62", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 1.369, 0.106, -0.832, 0.475, 20.496, 0.482 ], "step_params": [ -0.185, -2.055, 4.422, 0.514, 0.721, 26.138 ], "heli_params": [ -4.804, 0.596, 4.360, 1.594, -1.136, 26.152 ], "bp2_params": [ -0.378, -0.157, -1.236, -25.385, -8.043, 0.150 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 4.422, "simple_Twist": 35.234, "simple_hRise": 4.377, "simple_hTwist": 35.245 }, { "index": 5, "nt1": "///B/53", "nt2": "///B/61", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 9, "helix_index": 5, "strand1": "CUACUG", "strand2": "GAUGGC", "bp_type": "||||||", "helix_form": "AAA..", "helical_rise": 2.507, "helical_rise_std": 0.294, "helical_radius": 10.105, "helical_radius_std": 1.224, "helical_axis": [ -0.301, -0.623, -0.722 ], "point1": [ 19.177, 91.616, -34.890 ], "point2": [ 15.437, 83.874, -43.856 ], "num_pairs": 6, "pairs": [ { "index": 1, "nt1": "///E/153", "nt2": "///E/168", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.234, -0.105, -0.187, 5.295, -3.231, -1.259 ], "step_params": [ 0.139, -1.620, 3.318, -1.587, 9.212, 29.938 ], "heli_params": [ -4.636, -0.539, 2.702, 17.309, 2.982, 31.331 ], "bp2_params": [ 0.077, -0.054, 0.025, -0.646, -0.838, 0.792 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.318, "simple_Twist": 30.725, "simple_hRise": 2.721, "simple_hTwist": 32.082 }, { "index": 2, "nt1": "///E/154", "nt2": "///E/167", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.077, -0.054, 0.025, -0.646, -0.838, 0.792 ], "step_params": [ -0.376, -1.377, 2.928, 0.410, 14.995, 33.415 ], "heli_params": [ -3.875, 0.646, 2.132, 24.597, -0.672, 36.540 ], "bp2_params": [ 0.188, -0.088, -0.233, 2.143, -2.560, -4.558 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.928, "simple_Twist": 33.053, "simple_hRise": 2.122, "simple_hTwist": 36.211 }, { "index": 3, "nt1": "///E/155", "nt2": "///E/166", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.188, -0.088, -0.233, 2.143, -2.560, -4.558 ], "step_params": [ 0.620, -2.113, 3.115, 2.870, 1.609, 28.599 ], "heli_params": [ -4.591, -0.640, 3.040, 3.243, -5.785, 28.784 ], "bp2_params": [ 0.190, -0.133, -0.449, 3.792, -3.996, -1.346 ], "groove_widths": [ 16.668, null, 18.510, null ], "simple_Rise": 3.115, "simple_Twist": 28.499, "simple_hRise": 3.040, "simple_hTwist": 28.684 }, { "index": 4, "nt1": "///E/156", "nt2": "///E/165", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.190, -0.133, -0.449, 3.792, -3.996, -1.346 ], "step_params": [ 0.653, -1.747, 3.429, 2.142, 1.215, 41.003 ], "heli_params": [ -2.628, -0.688, 3.406, 1.733, -3.054, 41.074 ], "bp2_params": [ 2.218, -0.527, -0.225, -1.185, -2.833, 1.407 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.429, "simple_Twist": 29.767, "simple_hRise": 3.394, "simple_hTwist": 29.866 }, { "index": 5, "nt1": "///E/157", "nt2": "///E/164", "bp": "U-G", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 2.218, -0.527, -0.225, -1.185, -2.833, 1.407 ], "step_params": [ -1.138, -3.894, 3.711, -2.579, 4.769, 6.565 ], "heli_params": [ -36.322, 2.212, 1.028, 34.820, 18.830, 8.513 ], "bp2_params": [ -1.137, -0.285, -0.704, -6.470, 31.556, 9.271 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.711, "simple_Twist": 25.719, "simple_hRise": 3.049, "simple_hTwist": 26.275 }, { "index": 6, "nt1": "///E/158", "nt2": "///E/163", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 10, "helix_index": 6, "strand1": "CUCC", "strand2": "GAGG", "bp_type": "||||", "helix_form": "AAA", "helical_rise": 2.692, "helical_rise_std": 0.270, "helical_radius": 9.969, "helical_radius_std": 0.393, "helical_axis": [ 0.053, -0.525, -0.849 ], "point1": [ 5.822, 64.267, -26.484 ], "point2": [ 6.247, 60.058, -33.288 ], "num_pairs": 4, "pairs": [ { "index": 1, "nt1": "///F/339", "nt2": "///F/350", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.063, -0.144, -0.348, 0.865, -5.440, -0.837 ], "step_params": [ 0.534, -1.125, 3.338, -4.985, 6.498, 32.835 ], "heli_params": [ -2.960, -1.705, 2.958, 11.277, 8.652, 33.814 ], "bp2_params": [ 0.125, -0.189, 0.089, 3.657, -0.695, 7.815 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.338, "simple_Twist": 32.663, "simple_hRise": 2.955, "simple_hTwist": 33.647 }, { "index": 2, "nt1": "///F/340", "nt2": "///F/349", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.125, -0.189, 0.089, 3.657, -0.695, 7.815 ], "step_params": [ 0.016, -1.878, 3.135, 3.622, 8.830, 34.431 ], "heli_params": [ -4.202, 0.440, 2.579, 14.573, -5.978, 35.690 ], "bp2_params": [ 0.394, -0.134, -0.257, 3.077, -3.576, 1.141 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.135, "simple_Twist": 33.025, "simple_hRise": 2.551, "simple_hTwist": 34.340 }, { "index": 3, "nt1": "///F/341", "nt2": "///F/348", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.394, -0.134, -0.257, 3.077, -3.576, 1.141 ], "step_params": [ -0.573, -2.368, 3.369, -1.370, 3.941, 25.099 ], "heli_params": [ -6.487, 0.917, 2.995, 8.989, 3.125, 25.438 ], "bp2_params": [ 0.317, -0.202, -0.139, 0.242, 1.543, -0.119 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.369, "simple_Twist": 25.338, "simple_hRise": 2.999, "simple_hTwist": 25.674 }, { "index": 4, "nt1": "///F/342", "nt2": "///F/347", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 11, "helix_index": 7, "strand1": "GCCAG", "strand2": "UGGUC", "bp_type": "|||||", "helix_form": ".AAA", "helical_rise": 2.742, "helical_rise_std": 0.435, "helical_radius": 8.973, "helical_radius_std": 0.611, "helical_axis": [ -0.446, 0.709, 0.546 ], "point1": [ -18.586, -7.318, -96.219 ], "point2": [ -23.426, 0.391, -90.286 ], "num_pairs": 5, "pairs": [ { "index": 1, "nt1": "///G/1051", "nt2": "///G/1108", "bp": "G-U", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -2.200, -0.402, 0.101, 8.354, 1.166, -3.061 ], "step_params": [ 1.178, -1.639, 3.535, 0.809, 3.770, 42.964 ], "heli_params": [ -2.624, -1.517, 3.406, 5.135, -1.102, 43.128 ], "bp2_params": [ 0.410, -0.203, -0.498, 1.064, -3.647, 3.004 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.535, "simple_Twist": 28.717, "simple_hRise": 3.328, "simple_hTwist": 28.970 }, { "index": 2, "nt1": "///G/1052", "nt2": "///G/1107", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.410, -0.203, -0.498, 1.064, -3.647, 3.004 ], "step_params": [ -0.509, -1.189, 3.408, 2.385, 12.354, 33.505 ], "heli_params": [ -3.681, 1.167, 2.770, 20.551, -3.968, 35.726 ], "bp2_params": [ 0.335, -0.224, -0.339, 3.630, -4.506, 1.922 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.408, "simple_Twist": 33.997, "simple_hRise": 2.782, "simple_hTwist": 36.186 }, { "index": 3, "nt1": "///G/1053", "nt2": "///G/1106", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.335, -0.224, -0.339, 3.630, -4.506, 1.922 ], "step_params": [ 0.549, -1.652, 3.275, -2.269, 6.066, 32.186 ], "heli_params": [ -3.914, -1.342, 2.880, 10.805, 4.041, 32.814 ], "bp2_params": [ -0.059, -0.215, 0.015, -2.225, 2.057, 7.082 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.275, "simple_Twist": 34.272, "simple_hRise": 2.908, "simple_hTwist": 34.861 }, { "index": 4, "nt1": "///G/1054", "nt2": "///G/1105", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.059, -0.215, 0.015, -2.225, 2.057, 7.082 ], "step_params": [ -0.001, -1.466, 3.422, -1.449, 12.236, 25.563 ], "heli_params": [ -5.680, -0.316, 2.471, 25.827, 3.059, 28.333 ], "bp2_params": [ -0.212, -0.071, 0.287, -5.050, 3.724, 1.390 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.422, "simple_Twist": 26.651, "simple_hRise": 2.516, "simple_hTwist": 29.314 }, { "index": 5, "nt1": "///G/1055", "nt2": "///G/1104", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 12, "helix_index": 8, "strand1": "AUG", "strand2": "UAC", "bp_type": "|||", "helix_form": ".A", "helical_rise": 2.083, "helical_rise_std": 0.394, "helical_radius": 9.654, "helical_radius_std": 0.966, "helical_axis": [ -0.086, 0.682, 0.726 ], "point1": [ -38.295, -6.408, -84.450 ], "point2": [ -38.643, -3.658, -81.525 ], "num_pairs": 3, "pairs": [ { "index": 1, "nt1": "///G/1057", "nt2": "///G/1081", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.048, -0.092, -0.008, 0.139, -0.930, 0.793 ], "step_params": [ -0.120, -2.171, 3.267, 1.881, -2.399, 33.108 ], "heli_params": [ -3.386, 0.531, 3.400, -4.198, -3.293, 33.245 ], "bp2_params": [ -0.081, -0.109, -0.074, -1.895, -0.504, 4.183 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.267, "simple_Twist": 33.257, "simple_hRise": 3.399, "simple_hTwist": 33.393 }, { "index": 2, "nt1": "///G/1058", "nt2": "///G/1080", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.081, -0.109, -0.074, -1.895, -0.504, 4.183 ], "step_params": [ -0.487, -1.736, 3.135, 5.295, 12.546, 30.607 ], "heli_params": [ -4.778, 1.588, 2.166, 22.425, -9.464, 33.434 ], "bp2_params": [ -0.136, -0.095, -0.054, -0.794, -0.687, -2.408 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.135, "simple_Twist": 31.025, "simple_hRise": 2.180, "simple_hTwist": 33.814 }, { "index": 3, "nt1": "///G/1059", "nt2": "///G/1079", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 13, "helix_index": 8, "strand1": "GGC", "strand2": "CCG", "bp_type": "|||", "helix_form": "AA", "helical_rise": 2.107, "helical_rise_std": 0.095, "helical_radius": 8.344, "helical_radius_std": 0.635, "helical_axis": [ -0.477, 0.839, 0.262 ], "point1": [ -37.887, -0.950, -69.946 ], "point2": [ -39.828, 2.467, -68.881 ], "num_pairs": 3, "pairs": [ { "index": 1, "nt1": "///G/1062", "nt2": "///G/1076", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.224, -0.140, -0.078, 0.587, -0.662, -1.827 ], "step_params": [ -0.384, -1.723, 3.050, -3.202, 9.912, 36.243 ], "heli_params": [ -3.790, 0.234, 2.532, 15.543, 5.020, 37.662 ], "bp2_params": [ -0.217, -0.140, -0.056, -0.492, -0.501, -1.395 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.050, "simple_Twist": 36.286, "simple_hRise": 2.533, "simple_hTwist": 37.703 }, { "index": 2, "nt1": "///G/1063", "nt2": "///G/1075", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.217, -0.140, -0.056, -0.492, -0.501, -1.395 ], "step_params": [ 0.716, -1.858, 3.269, 1.882, 2.099, 35.140 ], "heli_params": [ -3.376, -0.907, 3.189, 3.470, -3.111, 35.249 ], "bp2_params": [ 0.213, -0.090, -0.033, -0.690, -0.502, -0.068 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.269, "simple_Twist": 32.755, "simple_hRise": 3.182, "simple_hTwist": 32.873 }, { "index": 3, "nt1": "///G/1064", "nt2": "///G/1074", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 14, "helix_index": 7, "strand1": "AGC", "strand2": "UCG", "bp_type": "|||", "helix_form": "AA", "helical_rise": 3.604, "helical_rise_std": 0.084, "helical_radius": 9.616, "helical_radius_std": 0.751, "helical_axis": [ -0.183, 0.633, 0.752 ], "point1": [ -29.058, 2.879, -82.137 ], "point2": [ -30.400, 7.534, -76.611 ], "num_pairs": 3, "pairs": [ { "index": 1, "nt1": "///G/1090", "nt2": "///G/1101", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.068, -0.161, -0.050, -0.678, 0.699, 8.918 ], "step_params": [ -0.625, -1.746, 3.381, 4.105, 6.325, 25.042 ], "heli_params": [ -5.504, 2.449, 2.730, 14.181, -9.205, 26.136 ], "bp2_params": [ -0.198, -0.091, -0.144, -0.931, -0.014, 0.490 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.381, "simple_Twist": 25.856, "simple_hRise": 2.753, "simple_hTwist": 26.915 }, { "index": 2, "nt1": "///G/1091", "nt2": "///G/1100", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.198, -0.091, -0.144, -0.931, -0.014, 0.490 ], "step_params": [ 0.167, -2.177, 3.320, 0.396, 4.663, 30.573 ], "heli_params": [ -4.957, -0.238, 2.965, 8.777, -0.745, 30.921 ], "bp2_params": [ 0.203, -0.091, -0.093, 0.127, -0.053, -0.289 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.320, "simple_Twist": 28.280, "simple_hRise": 2.933, "simple_hTwist": 28.657 }, { "index": 3, "nt1": "///G/1092", "nt2": "///G/1099", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 15, "helix_index": 9, "strand1": "CUGCUCC", "strand2": "GGUGAGG", "bp_type": "|||||||", "helix_form": "...AAA", "helical_rise": 3.230, "helical_rise_std": 0.280, "helical_radius": 9.446, "helical_radius_std": 1.023, "helical_axis": [ -0.808, 0.262, -0.527 ], "point1": [ 22.277, 26.937, -50.223 ], "point2": [ 6.566, 32.035, -60.472 ], "num_pairs": 7, "pairs": [ { "index": 1, "nt1": "///I/2646", "nt2": "///I/2674", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.244, -0.225, 0.065, -0.028, 5.348, -3.741 ], "step_params": [ 1.276, -1.801, 3.153, 4.983, 5.237, 39.215 ], "heli_params": [ -3.220, -1.323, 3.030, 7.723, -7.348, 39.850 ], "bp2_params": [ 2.492, -0.598, -0.145, 5.604, -0.277, -0.578 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.153, "simple_Twist": 26.905, "simple_hRise": 2.940, "simple_hTwist": 27.842 }, { "index": 2, "nt1": "///I/2647", "nt2": "///I/2673", "bp": "U-G", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 2.492, -0.598, -0.145, 5.604, -0.277, -0.578 ], "step_params": [ -1.399, -2.711, 3.637, -4.548, -2.881, 12.268 ], "heli_params": [ -7.776, -0.073, 4.387, -12.710, 20.065, 13.393 ], "bp2_params": [ -2.180, -0.499, 0.088, -0.867, -0.841, -6.389 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.637, "simple_Twist": 37.545, "simple_hRise": 3.963, "simple_hTwist": 37.915 }, { "index": 3, "nt1": "///I/2648", "nt2": "///I/2672", "bp": "G-U", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -2.180, -0.499, 0.088, -0.867, -0.841, -6.389 ], "step_params": [ 0.581, -1.215, 3.225, 0.035, -2.412, 41.633 ], "heli_params": [ -1.454, -0.812, 3.288, -3.390, -0.049, 41.700 ], "bp2_params": [ 0.118, -0.113, -0.112, 5.720, -1.086, -2.331 ], "groove_widths": [ 16.365, null, 18.195, null ], "simple_Rise": 3.225, "simple_Twist": 29.231, "simple_hRise": 3.313, "simple_hTwist": 29.328 }, { "index": 4, "nt1": "///I/2649", "nt2": "///I/2671", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.118, -0.113, -0.112, 5.720, -1.086, -2.331 ], "step_params": [ -0.147, -1.685, 3.387, -3.633, 0.209, 29.575 ], "heli_params": [ -3.322, -0.500, 3.369, 0.408, 7.083, 29.793 ], "bp2_params": [ 0.101, -0.091, -0.019, 5.214, 1.371, 0.127 ], "groove_widths": [ 16.581, null, 16.602, null ], "simple_Rise": 3.387, "simple_Twist": 29.731, "simple_hRise": 3.369, "simple_hTwist": 29.947 }, { "index": 5, "nt1": "///I/2650", "nt2": "///I/2670", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.101, -0.091, -0.019, 5.214, 1.371, 0.127 ], "step_params": [ -0.019, -1.746, 3.108, 1.691, 5.810, 34.847 ], "heli_params": [ -3.653, 0.257, 2.786, 9.612, -2.798, 35.353 ], "bp2_params": [ 0.184, -0.083, -0.238, 5.628, -4.707, 1.999 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.108, "simple_Twist": 34.300, "simple_hRise": 2.780, "simple_hTwist": 34.814 }, { "index": 6, "nt1": "///I/2651", "nt2": "///I/2669", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.184, -0.083, -0.238, 5.628, -4.707, 1.999 ], "step_params": [ 0.016, -2.585, 3.244, -1.038, 7.026, 27.576 ], "heli_params": [ -6.700, -0.246, 2.519, 14.439, 2.133, 28.459 ], "bp2_params": [ 0.220, -0.109, -0.111, 0.487, 0.910, 1.622 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.244, "simple_Twist": 27.405, "simple_hRise": 2.513, "simple_hTwist": 28.293 }, { "index": 7, "nt1": "///I/2652", "nt2": "///I/2668", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 16, "helix_index": 10, "strand1": "GUCGG", "strand2": "CAGCC", "bp_type": "|||||", "helix_form": ".AAA", "helical_rise": 2.047, "helical_rise_std": 0.205, "helical_radius": 8.800, "helical_radius_std": 0.799, "helical_axis": [ 0.220, 0.510, -0.832 ], "point1": [ -5.025, 13.595, -6.126 ], "point2": [ -3.279, 17.645, -12.737 ], "num_pairs": 5, "pairs": [ { "index": 1, "nt1": "///J/1945", "nt2": "///J/1961", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.038, -0.198, 0.067, -0.059, -1.144, -2.425 ], "step_params": [ -0.022, -1.329, 3.235, -4.588, 4.377, 36.371 ], "heli_params": [ -2.672, -0.566, 3.041, 6.948, 7.282, 36.901 ], "bp2_params": [ -0.081, -0.175, 0.131, 2.865, -3.068, 1.783 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.235, "simple_Twist": 36.779, "simple_hRise": 3.044, "simple_hTwist": 37.303 }, { "index": 2, "nt1": "///J/1946", "nt2": "///J/1960", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.081, -0.175, 0.131, 2.865, -3.068, 1.783 ], "step_params": [ -0.488, -1.754, 2.826, -0.431, 9.048, 31.185 ], "heli_params": [ -4.397, 0.814, 2.248, 16.402, 0.782, 32.443 ], "bp2_params": [ 0.316, -0.105, -0.176, 9.570, -4.596, 2.158 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.826, "simple_Twist": 28.982, "simple_hRise": 2.197, "simple_hTwist": 30.336 }, { "index": 3, "nt1": "///J/1947", "nt2": "///J/1959", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.316, -0.105, -0.176, 9.570, -4.596, 2.158 ], "step_params": [ -0.087, -2.087, 3.314, -2.443, 13.698, 31.025 ], "heli_params": [ -5.525, -0.198, 2.222, 24.145, 4.306, 33.932 ], "bp2_params": [ -0.171, -0.164, 0.038, -4.514, -4.382, 1.189 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.314, "simple_Twist": 33.660, "simple_hRise": 2.319, "simple_hTwist": 36.346 }, { "index": 4, "nt1": "///J/1948", "nt2": "///J/1958", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.171, -0.164, 0.038, -4.514, -4.382, 1.189 ], "step_params": [ 0.216, -1.957, 3.320, 4.532, 7.224, 34.385 ], "heli_params": [ -4.241, 0.285, 2.867, 11.993, -7.523, 35.396 ], "bp2_params": [ -0.176, -0.108, -0.199, -7.830, -2.998, -1.465 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.320, "simple_Twist": 34.318, "simple_hRise": 2.866, "simple_hTwist": 35.331 }, { "index": 5, "nt1": "///J/1949", "nt2": "///J/1957", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 17, "helix_index": 11, "strand1": "AUGGC", "strand2": "UACCG", "bp_type": "|||||", "helix_form": "AAAA", "helical_rise": 2.705, "helical_rise_std": 0.437, "helical_radius": 9.257, "helical_radius_std": 0.982, "helical_axis": [ 0.437, -0.480, 0.760 ], "point1": [ 4.485, 18.440, -33.088 ], "point2": [ 9.264, 13.191, -24.779 ], "num_pairs": 5, "pairs": [ { "index": 1, "nt1": "///K/2547", "nt2": "///K/2561", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.005, -0.138, 0.177, -4.189, -0.321, 5.665 ], "step_params": [ -0.730, -1.132, 3.137, 0.929, 6.917, 32.105 ], "heli_params": [ -3.094, 1.437, 2.817, 12.326, -1.656, 32.835 ], "bp2_params": [ 0.060, -0.131, 0.130, 0.387, -3.008, -1.756 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.137, "simple_Twist": 31.673, "simple_hRise": 2.812, "simple_hTwist": 32.413 }, { "index": 2, "nt1": "///K/2548", "nt2": "///K/2560", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.060, -0.131, 0.130, 0.387, -3.008, -1.756 ], "step_params": [ 0.761, -1.994, 3.113, 1.034, 11.463, 29.496 ], "heli_params": [ -5.457, -1.235, 2.227, 21.511, -1.939, 31.615 ], "bp2_params": [ -0.156, -0.112, 0.134, -3.554, -5.837, -2.032 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.113, "simple_Twist": 30.577, "simple_hRise": 2.263, "simple_hTwist": 32.623 }, { "index": 3, "nt1": "///K/2549", "nt2": "///K/2559", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.156, -0.112, 0.134, -3.554, -5.837, -2.032 ], "step_params": [ -0.756, -1.936, 3.099, 0.398, 10.457, 35.699 ], "heli_params": [ -4.246, 1.233, 2.446, 16.622, -0.633, 37.153 ], "bp2_params": [ -0.291, -0.162, -0.101, -7.340, -2.596, -1.186 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.099, "simple_Twist": 36.435, "simple_hRise": 2.462, "simple_hTwist": 37.859 }, { "index": 4, "nt1": "///K/2550", "nt2": "///K/2558", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.291, -0.162, -0.101, -7.340, -2.596, -1.186 ], "step_params": [ 0.549, -1.280, 3.188, 1.144, 17.920, 32.036 ], "heli_params": [ -4.217, -0.734, 2.208, 29.734, -1.898, 36.610 ], "bp2_params": [ 0.086, -0.093, 0.119, -1.480, 3.570, -3.317 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.188, "simple_Twist": 30.045, "simple_hRise": 2.131, "simple_hTwist": 34.895 }, { "index": 5, "nt1": "///K/2551", "nt2": "///K/2557", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] } ], "num_isoCanonPairs": 5, "isoCanonPairs": [ { "index": -1, "helix_index": 1, "nt1": "///A/19", "nt2": "///A/56", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" }, { "index": -2, "helix_index": 3, "nt1": "///B/19", "nt2": "///B/56", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" }, { "index": -3, "helix_index": 0, "nt1": "///G/1043", "nt2": "///G/1112", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" }, { "index": -4, "helix_index": 7, "nt1": "///G/1087", "nt2": "///G/1102", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" }, { "index": -5, "helix_index": 9, "nt1": "///I/2658", "nt2": "///I/2663", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ], "num_coaxStacks": 6, "coaxStacks": [ { "index": 1, "helix_index": 1, "num_stems": 2, "stem_indices": [ 1, 4 ] }, { "index": 2, "helix_index": 2, "num_stems": 2, "stem_indices": [ 3, 2 ] }, { "index": 3, "helix_index": 3, "num_stems": 2, "stem_indices": [ 5, 8 ] }, { "index": 4, "helix_index": 4, "num_stems": 2, "stem_indices": [ 7, 6 ] }, { "index": 5, "helix_index": 7, "num_stems": 2, "stem_indices": [ 11, 14 ] }, { "index": 6, "helix_index": 8, "num_stems": 2, "stem_indices": [ 12, 13 ] } ], "num_stacks": 50, "stacks": [ { "index": 1, "num_nts": 2, "nts_short": "Uc", "nts_long": "///A/7,///A/49" }, { "index": 2, "num_nts": 2, "nts_short": "UC", "nts_long": "///A/8,///A/13" }, { "index": 3, "num_nts": 2, "nts_short": "GA", "nts_long": "///A/65,///A/66" }, { "index": 4, "num_nts": 2, "nts_short": "GG", "nts_long": "///B/7,///B/49" }, { "index": 5, "num_nts": 2, "nts_short": "CA", "nts_long": "///B/75,///B/76" }, { "index": 6, "num_nts": 2, "nts_short": "GG", "nts_long": "///E/158,///E/159" }, { "index": 7, "num_nts": 2, "nts_short": "GG", "nts_long": "///F/346,///F/347" }, { "index": 8, "num_nts": 2, "nts_short": "CC", "nts_long": "///G/1043,///G/1044" }, { "index": 9, "num_nts": 2, "nts_short": "AG", "nts_long": "///G/1050,///G/1051" }, { "index": 10, "num_nts": 2, "nts_short": "GG", "nts_long": "///G/1055,///G/1056" }, { "index": 11, "num_nts": 2, "nts_short": "GU", "nts_long": "///G/1059,///G/1060" }, { "index": 12, "num_nts": 2, "nts_short": "UA", "nts_long": "///G/1061,///G/1070" }, { "index": 13, "num_nts": 2, "nts_short": "AC", "nts_long": "///G/1090,///G/1102" }, { "index": 14, "num_nts": 2, "nts_short": "AA", "nts_long": "///J/1952,///J/1953" }, { "index": 15, "num_nts": 2, "nts_short": "UC", "nts_long": "///J/1956,///J/1957" }, { "index": 16, "num_nts": 2, "nts_short": "CU", "nts_long": "///K/2551,///K/2552" }, { "index": 17, "num_nts": 2, "nts_short": "CG", "nts_long": "///K/2556,///K/2557" }, { "index": 18, "num_nts": 3, "nts_short": "CgC", "nts_long": "///A/25,///A/26,///A/27" }, { "index": 19, "num_nts": 3, "nts_short": "gAC", "nts_long": "///A/46,///A/21,///A/48" }, { "index": 20, "num_nts": 3, "nts_short": "GtP", "nts_long": "///A/53,///A/54,///A/55" }, { "index": 21, "num_nts": 3, "nts_short": "AUU", "nts_long": "///A/76,///J/1944,///J/1955" }, { "index": 22, "num_nts": 3, "nts_short": "GAA", "nts_long": "///B/2,///B/72,///B/73" }, { "index": 23, "num_nts": 3, "nts_short": "CGU", "nts_long": "///B/25,///B/26,///B/27" }, { "index": 24, "num_nts": 3, "nts_short": "GCU", "nts_long": "///B/31,///B/32,///B/33" }, { "index": 25, "num_nts": 3, "nts_short": "GtU", "nts_long": "///B/53,///B/54,///B/55" }, { "index": 26, "num_nts": 3, "nts_short": "CUC", "nts_long": "///F/342,///F/343,///F/345" }, { "index": 27, "num_nts": 3, "nts_short": "CAA", "nts_long": "///G/1049,///G/1048,///G/1111" }, { "index": 28, "num_nts": 3, "nts_short": "GAC", "nts_long": "///G/1062,///G/1088,///G/1079" }, { "index": 29, "num_nts": 3, "nts_short": "CUU", "nts_long": "///G/1064,///G/1065,///G/1066" }, { "index": 30, "num_nts": 3, "nts_short": "CAU", "nts_long": "///G/1076,///G/1077,///G/1078" }, { "index": 31, "num_nts": 3, "nts_short": "CGU", "nts_long": "///G/1092,///G/1093,///G/1094" }, { "index": 32, "num_nts": 3, "nts_short": "GGU", "nts_long": "///J/1949,///J/1950,///J/1951" }, { "index": 33, "num_nts": 3, "nts_short": "GUU", "nts_long": "///K/2553,///K/2554,///K/2555" }, { "index": 34, "num_nts": 4, "nts_short": "GAcU", "nts_long": "///A/30,///A/31,///A/32,///A/33" }, { "index": 35, "num_nts": 4, "nts_short": "AAAA", "nts_long": "///G/1057,///G/1086,///G/1085,///G/1084" }, { "index": 36, "num_nts": 4, "nts_short": "CUAU", "nts_long": "///I/2652,///I/2653,///I/2654,///I/2656" }, { "index": 37, "num_nts": 5, "nts_short": "GGGaC", "nts_long": "///A/19,///A/57,///A/18,///A/58,///A/61" }, { "index": 38, "num_nts": 5, "nts_short": "GAGAU", "nts_long": "///B/22,///B/14,///B/15,///B/59,///B/60" }, { "index": 39, "num_nts": 5, "nts_short": "AUAAC", "nts_long": "///B/35,///B/36,///B/37,///B/38,///B/39" }, { "index": 40, "num_nts": 5, "nts_short": "CAGAC", "nts_long": "///B/56,///B/57,///B/18,///B/58,///B/61" }, { "index": 41, "num_nts": 5, "nts_short": "CAAAA", "nts_long": "///E/163,///E/162,///E/161,///E/160,///F/344" }, { "index": 42, "num_nts": 5, "nts_short": "CGGCU", "nts_long": "///G/1045,///G/1047,///G/1110,///G/1109,///G/1108" }, { "index": 43, "num_nts": 5, "nts_short": "AGAAG", "nts_long": "///G/1067,///G/1068,///G/1069,///G/1073,///G/1074" }, { "index": 44, "num_nts": 5, "nts_short": "AAUAG", "nts_long": "///G/1095,///G/1096,///G/1097,///G/1098,///G/1099" }, { "index": 45, "num_nts": 6, "nts_short": "CGAGAC", "nts_long": "///G/1072,///G/1071,///G/1089,///G/1087,///G/1103,///G/1104" }, { "index": 46, "num_nts": 6, "nts_short": "GGGAGA", "nts_long": "///I/2655,///I/2664,///I/2663,///I/2662,///I/2661,///I/2660" }, { "index": 47, "num_nts": 7, "nts_short": "gAAgAPc", "nts_long": "///A/34,///A/35,///A/36,///A/37,///A/38,///A/39,///A/40" }, { "index": 48, "num_nts": 7, "nts_short": "AAGGGAC", "nts_long": "///B/43,///B/44,///B/45,///B/9,///B/46,///B/21,///B/48" }, { "index": 49, "num_nts": 7, "nts_short": "GCAACCG", "nts_long": "///I/2659,///I/2658,///I/2657,///I/2665,///I/2666,///I/2667,///I/2668" }, { "index": 50, "num_nts": 9, "nts_short": "GAGAGAGUC", "nts_long": "///A/43,///A/44,///A/45,///A/9,///A/22,///A/14,///A/15,///A/59,///A/60" } ], "nonStack": { "num_nts": 17, "nts_short": "uuGUACUCCUUCUCAUG", "nts_long": "///A/16,///A/17,///A/20,///A/47,///A/73,///A/74,///B/8,///B/16,///B/17,///B/17,///B/20,///B/34,///B/47,///B/74,///G/1046,///G/1083,///G/1112" }, "num_atom2bases": 26, "atom2bases": [ { "index": 1, "type": "phosphate", "atom": "///A/35/OP2", "nt": "///A/33", "vert_dist": 3.443 }, { "index": 2, "type": "phosphate", "atom": "///A/35/O5'", "nt": "///A/33", "vert_dist": 2.775 }, { "index": 3, "type": "sugar", "atom": "///A/59/O4'", "nt": "///A/48", "vert_dist": 3.035 }, { "index": 4, "type": "phosphate", "atom": "///A/57/OP2", "nt": "///A/55", "vert_dist": 2.914 }, { "index": 5, "type": "phosphate", "atom": "///A/75/OP2", "nt": "///A/74", "vert_dist": 2.287 }, { "index": 6, "type": "sugar", "atom": "///A/76/O4'", "nt": "///A/75", "vert_dist": 2.500 }, { "index": 7, "type": "phosphate", "atom": "///J/1944/O5'", "nt": "///A/75", "vert_dist": 2.445 }, { "index": 8, "type": "phosphate", "atom": "///B/35/OP2", "nt": "///B/33", "vert_dist": 2.947 }, { "index": 9, "type": "sugar", "atom": "///B/59/O4'", "nt": "///B/48", "vert_dist": 3.091 }, { "index": 10, "type": "phosphate", "atom": "///B/57/OP2", "nt": "///B/55", "vert_dist": 3.209 }, { "index": 11, "type": "phosphate", "atom": "///E/161/OP2", "nt": "///E/159", "vert_dist": 2.752 }, { "index": 12, "type": "sugar", "atom": "///F/344/O2'", "nt": "///E/160", "vert_dist": 3.424 }, { "index": 13, "type": "sugar", "atom": "///E/163/O4'", "nt": "///E/162", "vert_dist": 3.277 }, { "index": 14, "type": "sugar", "atom": "///E/160/O4'", "nt": "///F/344", "vert_dist": 2.796 }, { "index": 15, "type": "sugar", "atom": "///F/345/O4'", "nt": "///F/346", "vert_dist": 3.248 }, { "index": 16, "type": "sugar", "atom": "///G/1045/O4'", "nt": "///G/1047", "vert_dist": 2.752 }, { "index": 17, "type": "phosphate", "atom": "///G/1068/OP2", "nt": "///G/1066", "vert_dist": 2.982 }, { "index": 18, "type": "phosphate", "atom": "///G/1096/OP2", "nt": "///G/1094", "vert_dist": 2.866 }, { "index": 19, "type": "sugar", "atom": "///I/2658/O4'", "nt": "///I/2657", "vert_dist": 3.440 }, { "index": 20, "type": "sugar", "atom": "///I/2663/O4'", "nt": "///I/2662", "vert_dist": 3.421 }, { "index": 21, "type": "sugar", "atom": "///J/1955/O4'", "nt": "///J/1944", "vert_dist": 2.687 }, { "index": 22, "type": "phosphate", "atom": "///J/1953/OP2", "nt": "///J/1951", "vert_dist": 3.089 }, { "index": 23, "type": "sugar", "atom": "///K/2550/O4'", "nt": "///J/1953", "vert_dist": 3.020 }, { "index": 24, "type": "phosphate", "atom": "///K/2554/OP2", "nt": "///K/2552", "vert_dist": 2.929 }, { "index": 25, "type": "phosphate", "atom": "///K/2554/O5'", "nt": "///K/2552", "vert_dist": 3.021 }, { "index": 26, "type": "sugar", "atom": "///K/2554/O4'", "nt": "///K/2553", "vert_dist": 3.421 } ], "num_hairpins": 13, "hairpins": [ { "index": 1, "type": "hairpin loop", "bridging_nts": [ 8 ], "stem_indices": [ 2 ], "summary": "[1] 8 [A.13 A.22] 4", "num_nts": 10, "nts_short": "CAGuuGGGAG", "nts_long": "///A/13,///A/14,///A/15,///A/16,///A/17,///A/18,///A/19,///A/20,///A/21,///A/22", "num_stems": 1, "bridges": [ { "index": 1, "num_nts": 8, "nts_short": "AGuuGGGA", "nts_long": "///A/14,///A/15,///A/16,///A/17,///A/18,///A/19,///A/20,///A/21" } ] }, { "index": 2, "type": "hairpin loop", "bridging_nts": [ 9 ], "stem_indices": [ 3 ], "summary": "[1] 9 [A.30 A.40] 4", "num_nts": 11, "nts_short": "GAcUgAAgAPc", "nts_long": "///A/30,///A/31,///A/32,///A/33,///A/34,///A/35,///A/36,///A/37,///A/38,///A/39,///A/40", "num_stems": 1, "bridges": [ { "index": 1, "num_nts": 9, "nts_short": "AcUgAAgAP", "nts_long": "///A/31,///A/32,///A/33,///A/34,///A/35,///A/36,///A/37,///A/38,///A/39" } ] }, { "index": 3, "type": "hairpin loop", "bridging_nts": [ 7 ], "stem_indices": [ 4 ], "summary": "[1] 7 [A.53 A.61] 5", "num_nts": 9, "nts_short": "GtPCGaUCC", "nts_long": "///A/53,///A/54,///A/55,///A/56,///A/57,///A/58,///A/59,///A/60,///A/61", "num_stems": 1, "bridges": [ { "index": 1, "num_nts": 7, "nts_short": "tPCGaUC", "nts_long": "///A/54,///A/55,///A/56,///A/57,///A/58,///A/59,///A/60" } ] }, { "index": 4, "type": "hairpin loop", "bridging_nts": [ 9 ], "stem_indices": [ 6 ], "summary": "[1] 9 [B.13 B.22] 4", "num_nts": 11, "nts_short": "CAGCCUGGUAG", "nts_long": "///B/13,///B/14,///B/15,///B/16,///B/17,///B/17,///B/18,///B/19,///B/20,///B/21,///B/22", "num_stems": 1, "bridges": [ { "index": 1, "num_nts": 9, "nts_short": "AGCCUGGUA", "nts_long": "///B/14,///B/15,///B/16,///B/17,///B/17,///B/18,///B/19,///B/20,///B/21" } ] }, { "index": 5, "type": "hairpin loop", "bridging_nts": [ 7 ], "stem_indices": [ 7 ], "summary": "[1] 7 [B.31 B.39] 5", "num_nts": 9, "nts_short": "GCUCAUAAC", "nts_long": "///B/31,///B/32,///B/33,///B/34,///B/35,///B/36,///B/37,///B/38,///B/39", "num_stems": 1, "bridges": [ { "index": 1, "num_nts": 7, "nts_short": "CUCAUAA", "nts_long": "///B/32,///B/33,///B/34,///B/35,///B/36,///B/37,///B/38" } ] }, { "index": 6, "type": "hairpin loop", "bridging_nts": [ 7 ], "stem_indices": [ 8 ], "summary": "[1] 7 [B.53 B.61] 5", "num_nts": 9, "nts_short": "GtUCAAAUC", "nts_long": "///B/53,///B/54,///B/55,///B/56,///B/57,///B/58,///B/59,///B/60,///B/61", "num_stems": 1, "bridges": [ { "index": 1, "num_nts": 7, "nts_short": "tUCAAAU", "nts_long": "///B/54,///B/55,///B/56,///B/57,///B/58,///B/59,///B/60" } ] }, { "index": 7, "type": "hairpin loop", "bridging_nts": [ 4 ], "stem_indices": [ 9 ], "summary": "[1] 4 [E.158 E.163] 6", "num_nts": 6, "nts_short": "GGAAAC", "nts_long": "///E/158,///E/159,///E/160,///E/161,///E/162,///E/163", "num_stems": 1, "bridges": [ { "index": 1, "num_nts": 4, "nts_short": "GAAA", "nts_long": "///E/159,///E/160,///E/161,///E/162" } ] }, { "index": 8, "type": "hairpin loop", "bridging_nts": [ 4 ], "stem_indices": [ 10 ], "summary": "[1] 4 [F.342 F.347] 4", "num_nts": 6, "nts_short": "CUACGG", "nts_long": "///F/342,///F/343,///F/344,///F/345,///F/346,///F/347", "num_stems": 1, "bridges": [ { "index": 1, "num_nts": 4, "nts_short": "UACG", "nts_long": "///F/343,///F/344,///F/345,///F/346" } ] }, { "index": 9, "type": "hairpin loop", "bridging_nts": [ 9 ], "stem_indices": [ 13 ], "summary": "[1] 9 [G.1064 G.1074] 3", "num_nts": 11, "nts_short": "CUUAGAAGCAG", "nts_long": "///G/1064,///G/1065,///G/1066,///G/1067,///G/1068,///G/1069,///G/1070,///G/1071,///G/1072,///G/1073,///G/1074", "num_stems": 1, "bridges": [ { "index": 1, "num_nts": 9, "nts_short": "UUAGAAGCA", "nts_long": "///G/1065,///G/1066,///G/1067,///G/1068,///G/1069,///G/1070,///G/1071,///G/1072,///G/1073" } ] }, { "index": 10, "type": "hairpin loop", "bridging_nts": [ 6 ], "stem_indices": [ 14 ], "summary": "[1] 6 [G.1092 G.1099] 3", "num_nts": 8, "nts_short": "CGUAAUAG", "nts_long": "///G/1092,///G/1093,///G/1094,///G/1095,///G/1096,///G/1097,///G/1098,///G/1099", "num_stems": 1, "bridges": [ { "index": 1, "num_nts": 6, "nts_short": "GUAAUA", "nts_long": "///G/1093,///G/1094,///G/1095,///G/1096,///G/1097,///G/1098" } ] }, { "index": 11, "type": "hairpin loop", "bridging_nts": [ 4 ], "stem_indices": [ -5 ], "summary": "[1] 4 [I.2658 I.2663] 1", "num_nts": 6, "nts_short": "CGAGAG", "nts_long": "///I/2658,///I/2659,///I/2660,///I/2661,///I/2662,///I/2663", "num_stems": 1, "bridges": [ { "index": 1, "num_nts": 4, "nts_short": "GAGA", "nts_long": "///I/2659,///I/2660,///I/2661,///I/2662" } ] }, { "index": 12, "type": "hairpin loop", "bridging_nts": [ 7 ], "stem_indices": [ 16 ], "summary": "[1] 7 [J.1949 J.1957] 5", "num_nts": 9, "nts_short": "GGUAAGUUC", "nts_long": "///J/1949,///J/1950,///J/1951,///J/1952,///J/1953,///J/1954,///J/1955,///J/1956,///J/1957", "num_stems": 1, "bridges": [ { "index": 1, "num_nts": 7, "nts_short": "GUAAGUU", "nts_long": "///J/1950,///J/1951,///J/1952,///J/1953,///J/1954,///J/1955,///J/1956" } ] }, { "index": 13, "type": "hairpin loop", "bridging_nts": [ 5 ], "stem_indices": [ 17 ], "summary": "[1] 5 [K.2551 K.2557] 5", "num_nts": 7, "nts_short": "CUGUUCG", "nts_long": "///K/2551,///K/2552,///K/2553,///K/2554,///K/2555,///K/2556,///K/2557", "num_stems": 1, "bridges": [ { "index": 1, "num_nts": 5, "nts_short": "UGUUC", "nts_long": "///K/2552,///K/2553,///K/2554,///K/2555,///K/2556" } ] } ], "num_bulges": 1, "bulges": [ { "index": 1, "type": "bulge", "bridging_nts": [ 2, 0 ], "stem_indices": [ -4, 14 ], "summary": "[2] 2 0 [G.1087 G.1102 G.1090 G.1101] 1 3", "num_nts": 6, "nts_short": "GAAAUC", "nts_long": "///G/1087,///G/1088,///G/1089,///G/1090,///G/1101,///G/1102", "num_stems": 2, "bridges": [ { "index": 1, "num_nts": 2, "nts_short": "AA", "nts_long": "///G/1088,///G/1089" }, { "index": 2, "num_nts": 0, "nts_short": "", "nts_long": "" } ] } ], "num_iloops": 3, "iloops": [ { "index": 1, "type": "symmetric internal loop", "bridging_nts": [ 2, 2 ], "stem_indices": [ 12, 13 ], "summary": "[2] 2 2 [G.1059 G.1079 G.1062 G.1076] 3 3", "num_nts": 8, "nts_short": "GUUGCAUC", "nts_long": "///G/1059,///G/1060,///G/1061,///G/1062,///G/1076,///G/1077,///G/1078,///G/1079", "num_stems": 2, "bridges": [ { "index": 1, "num_nts": 2, "nts_short": "UU", "nts_long": "///G/1060,///G/1061" }, { "index": 2, "num_nts": 2, "nts_short": "AU", "nts_long": "///G/1077,///G/1078" } ] }, { "index": 2, "type": "asymmetric internal loop", "bridging_nts": [ 5, 4 ], "stem_indices": [ 15, -5 ], "summary": "[2] 5 4 [I.2652 I.2668 I.2658 I.2663] 7 1", "num_nts": 13, "nts_short": "CUAGUACGGACCG", "nts_long": "///I/2652,///I/2653,///I/2654,///I/2655,///I/2656,///I/2657,///I/2658,///I/2663,///I/2664,///I/2665,///I/2666,///I/2667,///I/2668", "num_stems": 2, "bridges": [ { "index": 1, "num_nts": 5, "nts_short": "UAGUA", "nts_long": "///I/2653,///I/2654,///I/2655,///I/2656,///I/2657" }, { "index": 2, "num_nts": 4, "nts_short": "GACC", "nts_long": "///I/2664,///I/2665,///I/2666,///I/2667" } ] }, { "index": 3, "type": "asymmetric internal loop", "bridging_nts": [ 7, 3 ], "stem_indices": [ -3, 11 ], "summary": "[2] 7 3 [G.1043 G.1112 G.1051 G.1108] 1 5 k-turn:normal", "num_nts": 14, "nts_short": "CCCAGACAGUCGAG", "nts_long": "///G/1043,///G/1044,///G/1045,///G/1046,///G/1047,///G/1048,///G/1049,///G/1050,///G/1051,///G/1108,///G/1109,///G/1110,///G/1111,///G/1112", "num_stems": 2, "bridges": [ { "index": 1, "num_nts": 7, "nts_short": "CCAGACA", "nts_long": "///G/1044,///G/1045,///G/1046,///G/1047,///G/1048,///G/1049,///G/1050" }, { "index": 2, "num_nts": 3, "nts_short": "CGA", "nts_long": "///G/1109,///G/1110,///G/1111" } ] } ], "num_junctions": 2, "junctions": [ { "index": 1, "type": "3-way junction", "bridging_nts": [ 1, 5, 1 ], "stem_indices": [ 11, 12, -4 ], "summary": "[3] 1 5 1 [G.1055 G.1104 G.1057 G.1081 G.1087 G.1102] 5 3 1", "num_nts": 13, "nts_short": "GGAUUUAAAGCAC", "nts_long": "///G/1055,///G/1056,///G/1057,///G/1081,///G/1082,///G/1083,///G/1084,///G/1085,///G/1086,///G/1087,///G/1102,///G/1103,///G/1104", "num_stems": 3, "bridges": [ { "index": 1, "num_nts": 1, "nts_short": "G", "nts_long": "///G/1056" }, { "index": 2, "num_nts": 5, "nts_short": "UUAAA", "nts_long": "///G/1082,///G/1083,///G/1084,///G/1085,///G/1086" }, { "index": 3, "num_nts": 1, "nts_short": "A", "nts_long": "///G/1103" } ] }, { "index": 2, "type": "4-way junction", "bridging_nts": [ 2, 1, 5, 0 ], "stem_indices": [ 5, 6, 7, 8 ], "summary": "[4] 2 1 5 0 [B.7 B.66 B.10 B.25 B.27 B.43 B.49 B.65] 6 4 5 5", "num_nts": 16, "nts_short": "GUGGCGUAAGGUCGCC", "nts_long": "///B/7,///B/8,///B/9,///B/10,///B/25,///B/26,///B/27,///B/43,///B/44,///B/45,///B/46,///B/47,///B/48,///B/49,///B/65,///B/66", "num_stems": 4, "bridges": [ { "index": 1, "num_nts": 2, "nts_short": "UG", "nts_long": "///B/8,///B/9" }, { "index": 2, "num_nts": 1, "nts_short": "G", "nts_long": "///B/26" }, { "index": 3, "num_nts": 5, "nts_short": "AGGUC", "nts_long": "///B/44,///B/45,///B/46,///B/47,///B/48" }, { "index": 4, "num_nts": 0, "nts_short": "", "nts_long": "" } ] } ], "num_ssSegments": 7, "ssSegments": [ { "index": 1, "num_nts": 2, "nts_short": "UA", "nts_long": "///A/8,///A/9" }, { "index": 2, "num_nts": 1, "nts_short": "g", "nts_long": "///A/26" }, { "index": 3, "is_broken": true, "num_nts": 5, "nts_short": "AGgUC", "nts_long": "///A/44,///A/45,///A/46,///A/47,///A/48" }, { "index": 4, "num_nts": 4, "nts_short": "ACCA", "nts_long": "///A/73,///A/74,///A/75,///A/76" }, { "index": 5, "num_nts": 1, "nts_short": "C", "nts_long": "///B/1" }, { "index": 6, "num_nts": 5, "nts_short": "AACCA", "nts_long": "///B/72,///B/73,///B/74,///B/75,///B/76" }, { "index": 7, "num_nts": 1, "nts_short": "U", "nts_long": "///J/1944" } ], "num_kissingLoops": 2, "kissingLoops": [ { "index": 1, "stem_index": -2, "is_isoCanonPair": true, "hairpin_indices": [ 4, 6 ] }, { "index": 2, "stem_index": -1, "is_isoCanonPair": true, "hairpin_indices": [ 1, 3 ] } ], "num_Aminors": 7, "Aminors": [ { "index": 1, "type": "X", "desc_short": "A vs C-G (WC)", "desc_long": "///E/160 vs ///F/342,///F/347", "A_nt1": { "desc": "///E/160 vs ///F/342", "face_type": "-", "hbonds_num": 0, "hbonds_desc": "" }, "A_nt2": { "desc": "///E/160 vs ///F/347", "face_type": "+", "hbonds_num": 1, "hbonds_desc": "N1-N2(amino)[3.36]" } }, { "index": 2, "type": "X", "desc_short": "A vs C-G (WC)", "desc_long": "///E/161 vs ///F/342,///F/347", "A_nt1": { "desc": "///E/161 vs ///F/342", "face_type": "-", "hbonds_num": 0, "hbonds_desc": "" }, "A_nt2": { "desc": "///E/161 vs ///F/347", "face_type": "+", "hbonds_num": 1, "hbonds_desc": "N1-O2'(hydroxyl)[2.98]" } }, { "index": 3, "type": "X", "desc_short": "A vs C-G (WC)", "desc_long": "///G/1048 vs ///G/1043,///G/1112", "A_nt1": { "desc": "///G/1048 vs ///G/1043", "face_type": "-", "hbonds_num": 1, "hbonds_desc": "O2'(hydroxyl)-O2(carbonyl)[3.31]" }, "A_nt2": { "desc": "///G/1048 vs ///G/1112", "face_type": "+", "hbonds_num": 2, "hbonds_desc": "N1-O2'(hydroxyl)[2.58],N3-N2(amino)[2.89]" } }, { "index": 4, "type": "X", "desc_short": "A vs A-U (WC)", "desc_long": "///G/1084 vs ///G/1054,///G/1105", "A_nt1": { "desc": "///G/1084 vs ///G/1054", "face_type": "+", "hbonds_num": 0, "hbonds_desc": "" }, "A_nt2": { "desc": "///G/1084 vs ///G/1105", "face_type": "-", "hbonds_num": 1, "hbonds_desc": "O2'(hydroxyl)-O2'(hydroxyl)[2.74]" } }, { "index": 5, "type": "I", "desc_short": "A vs G-C (WC)", "desc_long": "///G/1085 vs ///G/1055,///G/1104", "A_nt1": { "desc": "///G/1085 vs ///G/1055", "face_type": "+", "hbonds_num": 2, "hbonds_desc": "N1-O2'(hydroxyl)[2.86],N3-N2(amino)[3.23]" }, "A_nt2": { "desc": "///G/1085 vs ///G/1104", "face_type": "-", "hbonds_num": 2, "hbonds_desc": "O2'(hydroxyl)-O2'(hydroxyl)[2.75],O2'(hydroxyl)-O2(carbonyl)[3.36]" } }, { "index": 6, "type": "II", "desc_short": "A vs U-A (WC)", "desc_long": "///J/1952 vs ///K/2548,///K/2560", "A_nt1": { "desc": "///J/1952 vs ///K/2548", "face_type": "+", "hbonds_num": 0, "hbonds_desc": "" }, "A_nt2": { "desc": "///J/1952 vs ///K/2560", "face_type": "-", "hbonds_num": 2, "hbonds_desc": "O2'(hydroxyl)-O2'(hydroxyl)[2.94],N3-O2'(hydroxyl)[2.61]" } }, { "index": 7, "type": "I", "desc_short": "A vs G-C (WC)", "desc_long": "///J/1953 vs ///K/2549,///K/2559", "A_nt1": { "desc": "///J/1953 vs ///K/2549", "face_type": "+", "hbonds_num": 2, "hbonds_desc": "N1-O2'(hydroxyl)[2.59],N3-N2(amino)[2.69]" }, "A_nt2": { "desc": "///J/1953 vs ///K/2559", "face_type": "-", "hbonds_num": 1, "hbonds_desc": "O2'(hydroxyl)-O2(carbonyl)[2.50]" } } ], "num_riboseZippers": 2, "riboseZippers": [ { "index": 1, "num_nts": 4, "nts_short": "AACU", "nts_long": "///G/1084,///G/1085,///G/1104,///G/1105" }, { "index": 2, "num_nts": 4, "nts_short": "AACA", "nts_long": "///J/1952,///J/1953,///K/2559,///K/2560" } ], "num_Kturns": 1, "Kturns": [ { "index": 1, "type": "Normal k-turn", "iloop_index": 3, "bounding_stems": [ -3, 11 ], "Cstem_index": -3, "NCstem_index": 11, "Cstem_pair": "C-G (///G/1043,///G/1112) WC", "NCstem_pair": "G-U (///G/1051,///G/1108) Wobble", "GA_pair": "G-A (///G/1047,///G/1111) Sheared", "bending_angle": 63.732, "strand1": { "num_nts": 13, "nts_short": "CCCAGACAGCCAG", "nts_long": "///G/1043,///G/1044,///G/1045,///G/1046,///G/1047,///G/1048,///G/1049,///G/1050,///G/1051,///G/1052,///G/1053,///G/1054,///G/1055" }, "strand2": { "num_nts": 9, "nts_short": "CUGGUCGAG", "nts_long": "///G/1104,///G/1105,///G/1106,///G/1107,///G/1108,///G/1109,///G/1110,///G/1111,///G/1112" } } ], "num_splayUnits": 20, "splayUnits": [ { "index": 1, "num_nts": 2, "nts_short": "UU", "nts_long": "///A/7,///A/8" }, { "index": 2, "num_nts": 4, "nts_short": "GuuG", "nts_long": "///A/15,///A/16,///A/17,///A/18" }, { "index": 3, "num_nts": 2, "nts_short": "GG", "nts_long": "///A/19,///A/20" }, { "index": 4, "num_nts": 4, "nts_short": "gUCc", "nts_long": "///A/46,///A/47,///A/48,///A/49" }, { "index": 5, "num_nts": 2, "nts_short": "CC", "nts_long": "///A/60,///A/61" }, { "index": 6, "num_nts": 2, "nts_short": "AC", "nts_long": "///A/73,///A/74" }, { "index": 7, "num_nts": 2, "nts_short": "GU", "nts_long": "///B/7,///B/8" }, { "index": 8, "num_nts": 2, "nts_short": "UG", "nts_long": "///B/17,///B/18" }, { "index": 9, "num_nts": 3, "nts_short": "GUA", "nts_long": "///B/19,///B/20,///B/21" }, { "index": 10, "num_nts": 4, "nts_short": "GUCG", "nts_long": "///B/46,///B/47,///B/48,///B/49" }, { "index": 11, "num_nts": 2, "nts_short": "AC", "nts_long": "///B/73,///B/74" }, { "index": 12, "num_nts": 3, "nts_short": "UAC", "nts_long": "///F/343,///F/344,///F/345" }, { "index": 13, "num_nts": 3, "nts_short": "CAG", "nts_long": "///G/1045,///G/1046,///G/1047" }, { "index": 14, "num_nts": 2, "nts_short": "GA", "nts_long": "///G/1056,///G/1057" }, { "index": 15, "num_nts": 3, "nts_short": "UUG", "nts_long": "///G/1060,///G/1061,///G/1062" }, { "index": 16, "num_nts": 3, "nts_short": "AAG", "nts_long": "///G/1069,///G/1070,///G/1071" }, { "index": 17, "num_nts": 2, "nts_short": "CA", "nts_long": "///G/1072,///G/1073" }, { "index": 18, "num_nts": 4, "nts_short": "AGAA", "nts_long": "///G/1086,///G/1087,///G/1088,///G/1089" }, { "index": 19, "num_nts": 2, "nts_short": "UG", "nts_long": "///J/1944,///J/1945" }, { "index": 20, "num_nts": 3, "nts_short": "GUU", "nts_long": "///J/1954,///J/1955,///J/1956" } ], "pseudoknot_order": 1, "pseudoknot_nts": [ { "index": 1, "symbols": "[]", "num_nts": 4, "nts_short": "GCGC", "nts_long": "///A/19,///A/56,///B/19,///B/56" } ], "dbn": { "all_chains": { "num_nts": 313, "num_chars": 321, "bseq": "GCGGAUUUAgCUCAGuuGGGAGAGCgCCAGAcUgAAgAPcUGGA&GgUCcUGUGtPCGaUCCACAGAAUUCGCACCA&CGCGGGGUGGAGCAGCCUGGUAGCUCGUCGGGCUCAUAACCCGAAGGUCGUCGGtUCAAAUCCGGCCCCCGCAACCA&CUACUGGAAACGGUAG&CUCCUACGGGAG&CCCAGACAGCCAGGAUGUUGGCUUAGAAGCAGCCAUCAUUUAAAGAAAGCGUAAUAGCUCACUGGUCGAG&CUGCUCCUAGUACGAGAGGACCGGAGUGG&UGUCGGGUAAGUUCCGAC&AUGGCUGUUCGCCAU", "bseqUP": "GCGGAUUUAGCUCAGUUGGGAGAGCGCCAGACUGAAGAUCUGGA&GGUCCUGUGTUCGAUCCACAGAAUUCGCACCA&CGCGGGGUGGAGCAGCCUGGUAGCUCGUCGGGCUCAUAACCCGAAGGUCGUCGGTUCAAAUCCGGCCCCCGCAACCA&CUACUGGAAACGGUAG&CUCCUACGGGAG&CCCAGACAGCCAGGAUGUUGGCUUAGAAGCAGCCAUCAUUUAAAGAAAGCGUAAUAGCUCACUGGUCGAG&CUGCUCCUAGUACGAGAGGACCGGAGUGG&UGUCGGGUAAGUUCCGAC&AUGGCUGUUCGCCAU", "sstr": "(((((((..((((.....[..)))).((((.........)))).&....(((((..]....))))))))))))....&.((((((..((((......[..)))).(((((.......))))).....(((((..]....))))))))))).....&((((((....))))))&((((....))))&(.......(((((.(((..(((.........)))..))).....(..(((......)))).)))))...)&(((((((.....(....)....)))))))&.(((((.......)))))&(((((.....)))))", "form": "AAAAAA...AA..........AAA.AAAAA.A......AAAAA-&....AAAAA..A....AAAAAAAAAA...L.-&AA..A....AA...........AAA.A.AA....A.A..AAAAA......A..A..B.....AAAAA.A.AA..A.-&AAAA.A.....AAAA-&AAAA..Z..AA-&.....AA...AA..AA...AA.......A..AAA..AA.........AA.A.....AA.A.AAAA....-&..AAAA....A............AAA.A-&.AAAA...B....AAAA-&A.AA......AAAA-" }, "chain_A": { "num_nts": 76, "num_chars": 77, "bseq": "GCGGAUUUAgCUCAGuuGGGAGAGCgCCAGAcUgAAgAPcUGGA&GgUCcUGUGtPCGaUCCACAGAAUUCGCACCA", "bseqUP": "GCGGAUUUAGCUCAGUUGGGAGAGCGCCAGACUGAAGAUCUGGA&GGUCCUGUGTUCGAUCCACAGAAUUCGCACCA", "sstr": "(((((((..((((.....[..)))).((((.........)))).&....(((((..]....))))))))))))....", "form": "AAAAAA...AA..........AAA.AAAAA.A......AAAAA-&....AAAAA..A....AAAAAAAAAA...L.-" }, "chain_B": { "num_nts": 77, "num_chars": 77, "bseq": "CGCGGGGUGGAGCAGCCUGGUAGCUCGUCGGGCUCAUAACCCGAAGGUCGUCGGtUCAAAUCCGGCCCCCGCAACCA", "bseqUP": "CGCGGGGUGGAGCAGCCUGGUAGCUCGUCGGGCUCAUAACCCGAAGGUCGUCGGTUCAAAUCCGGCCCCCGCAACCA", "sstr": ".((((((..((((......[..)))).(((((.......))))).....(((((..]....))))))))))).....", "form": "AA..A....AA...........AAA.A.AA....A.A..AAAAA......A..A..B.....AAAAA.A.AA..A.-" }, "chain_E": { "num_nts": 16, "num_chars": 16, "bseq": "CUACUGGAAACGGUAG", "bseqUP": "CUACUGGAAACGGUAG", "sstr": "((((((....))))))", "form": "AAAA.A.....AAAA-" }, "chain_F": { "num_nts": 12, "num_chars": 12, "bseq": "CUCCUACGGGAG", "bseqUP": "CUCCUACGGGAG", "sstr": "((((....))))", "form": "AAAA..Z..AA-" }, "chain_G": { "num_nts": 70, "num_chars": 70, "bseq": "CCCAGACAGCCAGGAUGUUGGCUUAGAAGCAGCCAUCAUUUAAAGAAAGCGUAAUAGCUCACUGGUCGAG", "bseqUP": "CCCAGACAGCCAGGAUGUUGGCUUAGAAGCAGCCAUCAUUUAAAGAAAGCGUAAUAGCUCACUGGUCGAG", "sstr": "(.......(((((.(((..(((.........)))..))).....(..(((......)))).)))))...)", "form": ".....AA...AA..AA...AA.......A..AAA..AA.........AA.A.....AA.A.AAAA....-" }, "chain_I": { "num_nts": 29, "num_chars": 29, "bseq": "CUGCUCCUAGUACGAGAGGACCGGAGUGG", "bseqUP": "CUGCUCCUAGUACGAGAGGACCGGAGUGG", "sstr": "(((((((.....(....)....)))))))", "form": "..AAAA....A............AAA.A-" }, "chain_J": { "num_nts": 18, "num_chars": 18, "bseq": "UGUCGGGUAAGUUCCGAC", "bseqUP": "UGUCGGGUAAGUUCCGAC", "sstr": ".(((((.......)))))", "form": ".AAAA...B....AAAA-" }, "chain_K": { "num_nts": 15, "num_chars": 15, "bseq": "AUGGCUGUUCGCCAU", "bseqUP": "AUGGCUGUUCGCCAU", "sstr": "(((((.....)))))", "form": "A.AA......AAAA-" } }, "chains": { "chain_A": { "num_nts": 76, "bseq": "GCGGAUUUAgCUCAGuuGGGAGAGCgCCAGAcUgAAgAPcUGGA&GgUCcUGUGtPCGaUCCACAGAAUUCGCACCA", "sstr": "(((((((..((((.....[..)))).((((.........)))).&....(((((..]....))))))))))))....", "form": "AAAAAA...AA..........AAA.AAAAA.A......AAAAA-&....AAAAA..A....AAAAAAAAAA...L.-", "helical_rise": 0.133, "helical_rise_std": 2.956, "helical_axis": [ 0.542, -0.537, 0.646 ], "point1": [ -36.142, -6.060, -21.764 ], "point2": [ -30.611, -11.543, -15.170 ], "num_chars": 226, "suite": "G!!C!!G1aG1aA1aU1bU2aU1[A2gg1aC1aU1cC1cA1aG7pu!!u!!G!!G2aG!!A1cG1aA1aG1aC!!g1aC1aC1aA1aG1aA1ac1mU1gg!!A!!A!!g1aA1aP1ac!!U1aG1aG1aA..G1[g4pU2uC6dc1aU1aG1aU1aG1at1aP1gC1aG1[a4dU1bC2aC1aA1aC1aA1aG1aA1aA1aU1aU1aC1aG!!C!!A!!C!!C!!A" }, "chain_B": { "num_nts": 77, "bseq": "CGCGGGGUGGAGCAGCCUGGUAGCUCGUCGGGCUCAUAACCCGAAGGUCGUCGGtUCAAAUCCGGCCCCCGCAACCA", "sstr": ".((((((..((((......[..)))).(((((.......))))).....(((((..]....))))))))))).....", "form": "AA..A....AA...........AAA.A.AA....A.A..AAAAA......A..A..B.....AAAAA.A.AA..A.-", "helical_rise": 0.219, "helical_rise_std": 3.303, "helical_axis": [ 0.687, 0.280, 0.670 ], "point1": [ -28.781, -16.615, 0.091 ], "point2": [ -16.614, -11.652, 11.948 ], "num_chars": 229, "suite": "C1aG1cC!!G!!G1aG1tG!!U7rG2gG1aA1aG1cC1fA1aG1bC!!C!!U!!G!!G!!U!!A7aG1aC1aU1aC1aG1aU1aC1aG1aG1cG1aC1aU1gC1aA1aU1cA1LA1aC1aC1aC1aG1cA1aA1aG1aG!!U!!C!!G1cU1LC1tG!!G1at1aU1gC1aA1[A4dA1bU2aC1aC1cG1mG1cC1aC!!C1aC1aC1aG!!C1cA!!A3aC!!C!!A" }, "chain_E": { "num_nts": 16, "bseq": "CUACUGGAAACGGUAG", "sstr": "((((((....))))))", "form": "AAAA.A.....AAAA-", "helical_rise": 0.373, "helical_rise_std": 1.804, "helical_axis": [ 0.437, -0.245, 0.866 ], "point1": [ 13.120, 84.666, -42.621 ], "point2": [ 15.781, 83.175, -37.343 ], "num_chars": 46, "suite": "C1aU!!A1cC1aU1aG1cG1gA1aA1aA1aC1eG1aG1cU1aA1aG" }, "chain_F": { "num_nts": 12, "bseq": "CUCCUACGGGAG", "sstr": "((((....))))", "form": "AAAA..Z..AA-", "helical_rise": 0.556, "helical_rise_std": 1.838, "helical_axis": [ 0.403, 0.752, 0.522 ], "point1": [ 6.432, 63.896, -37.921 ], "point2": [ 9.106, 68.887, -34.458 ], "num_chars": 34, "suite": "C1LU1aC1aC1aU1zA!!C6nG1aG1cG1aA1aG" }, "chain_G": { "num_nts": 70, "bseq": "CCCAGACAGCCAGGAUGUUGGCUUAGAAGCAGCCAUCAUUUAAAGAAAGCGUAAUAGCUCACUGGUCGAG", "sstr": "(.......(((((.(((..(((.........)))..))).....(..(((......)))).)))))...)", "form": ".....AA...AA..AA...AA.......A..AAA..AA.........AA.A.....AA.A.AAAA....-", "helical_rise": 0.030, "helical_rise_std": 3.171, "helical_axis": [ -0.224, 0.906, -0.360 ], "point1": [ -26.422, -14.722, -75.274 ], "point2": [ -26.920, -12.713, -76.073 ], "num_chars": 208, "suite": "C1cC!!C!!A!!G4aA1aC1aA1aG1aC1aC1aA1LG!!G9aA1aU1aG5zU6pU!!G1aG1aC1aU1aU1gA1aG1[A!!A6dG1aC3dA1aG1aC1aC1aA1aU5nC1aA1aU1aU1cU1gA1aA1aA3aG!!A0bA!!A1aG1aC1aG1aU1gA1aA1cU1aA1aG1aC1aU1aC1aA1aC1aU1aG1aG1aU1aC1bG4bA!!G" }, "chain_I": { "num_nts": 29, "bseq": "CUGCUCCUAGUACGAGAGGACCGGAGUGG", "sstr": "(((((((.....(....)....)))))))", "form": "..AAAA....A............AAA.A-", "helical_rise": 0.209, "helical_rise_std": 2.646, "helical_axis": [ 0.256, 0.940, -0.226 ], "point1": [ -2.535, 23.458, -54.971 ], "point2": [ -0.900, 29.468, -56.416 ], "num_chars": 85, "suite": "C1aU&aG1aC1aU1aC1aC1aU5zA4sG#aU1aA1aC1aG1gA1cG1aA1aG1aG1eA1aC1aC1aG1aG1aA1aG1aU1cG1aG" }, "chain_J": { "num_nts": 18, "bseq": "UGUCGGGUAAGUUCCGAC", "sstr": ".(((((.......)))))", "form": ".AAAA...B....AAAA-", "helical_rise": 0.150, "helical_rise_std": 2.634, "helical_axis": [ -0.725, 0.341, -0.599 ], "point1": [ -0.856, 16.209, -14.660 ], "point2": [ -3.237, 17.329, -16.628 ], "num_chars": 52, "suite": "U8dG1aU1aC1aG1aG1aG1aU1gA1aA1[G!!U2aU1aC1aC1aG1cA1aC" }, "chain_K": { "num_nts": 15, "bseq": "AUGGCUGUUCGCCAU", "sstr": "(((((.....)))))", "form": "A.AA......AAAA-", "helical_rise": 0.066, "helical_rise_std": 2.323, "helical_axis": [ -0.801, -0.399, -0.445 ], "point1": [ 11.445, 12.654, -27.408 ], "point2": [ 10.626, 12.246, -27.863 ], "num_chars": 43, "suite": "A1aU1cG1mG1aC1aU1gG!!U1aU1aC1aG1aC1aC1aA1aU" } }, "num_nts": 313, "nts": [ { "index": 1, "index_chain": 1, "chain_name": "A", "nt_resnum": 1, "nt_name": "G", "nt_code": "G", "nt_id": "///A/1", "linked_nts": [ null, "///A/2" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack", "alpha": null, "beta": -172.236, "gamma": 178.652, "delta": 101.068, "epsilon": -166.051, "zeta": -43.890, "epsilon_zeta": -122.161, "bb_type": "BI", "chi": 169.236, "glyco_bond": "anti", "C5prime_xyz": [ -0.997, 7.387, 2.352 ], "P_xyz": [ 1.174, 8.881, 2.206 ], "form": "A", "ssZp": 4.115, "Dp": 4.354, "splay_angle": 26.919, "splay_distance": 4.194, "splay_ratio": 0.238, "d22": null, "d64": null, "eta": null, "theta": -127.187, "eta_prime": null, "theta_prime": -129.482, "eta_base": null, "theta_base": -104.582, "v0": 22.488, "v1": -32.421, "v2": 29.496, "v3": -17.453, "v4": -3.037, "amplitude": 32.298, "phase_angle": 335.961, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.002, "frame": { "rmsd": 0.002, "origin": [ -13.986, -7.406, -35.175 ], "x_axis": [ -0.291, 0.823, 0.488 ], "y_axis": [ -0.113, 0.477, -0.872 ], "z_axis": [ -0.950, -0.308, -0.046 ], "quaternion": [ 0.534, -0.264, -0.673, 0.438 ] } }, { "index": 2, "index_chain": 2, "chain_name": "A", "nt_resnum": 2, "nt_name": "C", "nt_code": "C", "nt_id": "///A/2", "linked_nts": [ "///A/1", "///A/3" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -134.270, "beta": -120.635, "gamma": 52.899, "delta": 82.424, "epsilon": -175.135, "zeta": -59.630, "epsilon_zeta": -115.505, "bb_type": "BI", "chi": -154.323, "glyco_bond": "anti", "C5prime_xyz": [ -1.403, 8.844, 0.147 ], "P_xyz": [ 0.907, 9.120, 1.337 ], "form": "A", "ssZp": 4.372, "Dp": 4.474, "splay_angle": 20.468, "splay_distance": 3.269, "splay_ratio": 0.181, "d22": null, "d64": null, "eta": 140.045, "theta": -151.083, "eta_prime": 164.056, "theta_prime": -150.619, "eta_base": -150.119, "theta_base": -126.235, "v0": -1.128, "v1": -24.772, "v2": 39.548, "v3": -41.120, "v4": 26.667, "amplitude": 42.068, "phase_angle": 19.934, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.062, "frame": { "rmsd": 0.004, "origin": [ -17.552, -8.597, -33.315 ], "x_axis": [ -0.120, 0.960, -0.254 ], "y_axis": [ 0.202, -0.227, -0.953 ], "z_axis": [ -0.972, -0.165, -0.166 ], "quaternion": [ -0.349, 0.564, 0.515, -0.543 ] } }, { "index": 3, "index_chain": 3, "chain_name": "A", "nt_resnum": 3, "nt_name": "G", "nt_code": "G", "nt_id": "///A/3", "linked_nts": [ "///A/2", "///A/4" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -99.850, "beta": 173.343, "gamma": 83.054, "delta": 78.323, "epsilon": -144.471, "zeta": -83.665, "epsilon_zeta": -60.806, "bb_type": "BI", "chi": -168.972, "glyco_bond": "anti", "C5prime_xyz": [ -1.319, 8.657, 1.114 ], "P_xyz": [ 1.136, 9.266, 0.474 ], "form": "A", "ssZp": 4.725, "Dp": 4.731, "splay_angle": 23.815, "splay_distance": 3.732, "splay_ratio": 0.211, "d22": null, "d64": null, "eta": 164.968, "theta": -155.417, "eta_prime": 178.219, "theta_prime": -156.673, "eta_base": -142.029, "theta_base": -142.081, "v0": 1.759, "v1": -27.012, "v2": 40.899, "v3": -40.853, "v4": 24.676, "amplitude": 42.607, "phase_angle": 16.279, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.008, "frame": { "rmsd": 0.008, "origin": [ -20.678, -8.153, -32.471 ], "x_axis": [ -0.062, 0.745, -0.665 ], "y_axis": [ 0.126, -0.655, -0.745 ], "z_axis": [ -0.990, -0.130, -0.053 ], "quaternion": [ 0.240, -0.641, -0.339, 0.645 ] } }, { "index": 4, "index_chain": 4, "chain_name": "A", "nt_resnum": 4, "nt_name": "G", "nt_code": "G", "nt_id": "///A/4", "linked_nts": [ "///A/3", "///A/5" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -69.952, "beta": 161.492, "gamma": 66.357, "delta": 81.063, "epsilon": -153.739, "zeta": -64.845, "epsilon_zeta": -88.894, "bb_type": "BI", "chi": -175.267, "glyco_bond": "anti", "C5prime_xyz": [ -1.572, 8.587, 1.353 ], "P_xyz": [ 0.988, 9.103, 1.257 ], "form": "A", "ssZp": 4.575, "Dp": 4.624, "splay_angle": 23.975, "splay_distance": 3.642, "splay_ratio": 0.210, "d22": null, "d64": null, "eta": 168.369, "theta": -140.853, "eta_prime": 179.658, "theta_prime": -141.188, "eta_base": -150.931, "theta_base": -102.303, "v0": -0.220, "v1": -25.661, "v2": 40.725, "v3": -41.740, "v4": 26.378, "amplitude": 43.021, "phase_angle": 18.803, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.639, "filter_rmsd": 0.009, "frame": { "rmsd": 0.009, "origin": [ -24.011, -6.975, -31.273 ], "x_axis": [ 0.195, 0.409, -0.891 ], "y_axis": [ 0.074, -0.913, -0.402 ], "z_axis": [ -0.978, 0.013, -0.208 ], "quaternion": [ -0.136, 0.761, 0.158, -0.614 ] } }, { "index": 5, "index_chain": 5, "chain_name": "A", "nt_resnum": 5, "nt_name": "A", "nt_code": "A", "nt_id": "///A/5", "linked_nts": [ "///A/4", "///A/6" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -73.603, "beta": -174.901, "gamma": 51.057, "delta": 83.864, "epsilon": -151.002, "zeta": -66.227, "epsilon_zeta": -84.774, "bb_type": "BI", "chi": -160.873, "glyco_bond": "anti", "C5prime_xyz": [ -1.192, 8.560, 0.509 ], "P_xyz": [ 1.370, 8.800, 0.803 ], "form": "A", "ssZp": 4.426, "Dp": 4.722, "splay_angle": 24.743, "splay_distance": 3.956, "splay_ratio": 0.218, "d22": null, "d64": null, "eta": 168.172, "theta": -139.861, "eta_prime": -177.089, "theta_prime": -137.935, "eta_base": -120.651, "theta_base": -115.121, "v0": 7.896, "v1": -32.500, "v2": 43.224, "v3": -39.687, "v4": 20.313, "amplitude": 43.691, "phase_angle": 8.384, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.870, "filter_rmsd": 0.038, "frame": { "rmsd": 0.009, "origin": [ -26.687, -5.349, -33.133 ], "x_axis": [ 0.162, -0.341, -0.926 ], "y_axis": [ -0.162, -0.935, 0.316 ], "z_axis": [ -0.973, 0.099, -0.207 ], "quaternion": [ 0.072, 0.759, -0.166, -0.626 ] } }, { "index": 6, "index_chain": 6, "chain_name": "A", "nt_resnum": 6, "nt_name": "U", "nt_code": "U", "nt_id": "///A/6", "linked_nts": [ "///A/5", "///A/7" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -69.087, "beta": 164.804, "gamma": 64.209, "delta": 79.617, "epsilon": -151.487, "zeta": -75.857, "epsilon_zeta": -75.630, "bb_type": "BI", "chi": -172.000, "glyco_bond": "anti", "C5prime_xyz": [ -1.836, 8.637, 1.190 ], "P_xyz": [ 0.660, 9.343, 1.239 ], "form": "A", "ssZp": 4.566, "Dp": 4.589, "splay_angle": 19.996, "splay_distance": 3.218, "splay_ratio": 0.179, "d22": 4.284, "d64": 4.069, "eta": 169.943, "theta": -148.927, "eta_prime": -172.220, "theta_prime": -141.345, "eta_base": -131.347, "theta_base": -117.262, "v0": -1.762, "v1": -25.391, "v2": 41.547, "v3": -43.512, "v4": 28.610, "amplitude": 44.434, "phase_angle": 20.769, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.768, "filter_rmsd": 0.103, "frame": { "rmsd": 0.007, "origin": [ -29.501, -4.158, -35.645 ], "x_axis": [ 0.202, -0.766, -0.611 ], "y_axis": [ -0.213, -0.643, 0.736 ], "z_axis": [ -0.956, -0.019, -0.293 ], "quaternion": [ 0.258, 0.731, -0.335, -0.536 ] } }, { "index": 7, "index_chain": 7, "chain_name": "A", "nt_resnum": 7, "nt_name": "U", "nt_code": "U", "nt_id": "///A/7", "linked_nts": [ "///A/6", "///A/8" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,splayed-apart", "alpha": -53.626, "beta": 179.999, "gamma": 58.069, "delta": 138.391, "epsilon": -99.769, "zeta": -58.964, "epsilon_zeta": -40.804, "bb_type": "--", "chi": -127.794, "glyco_bond": "anti", "C5prime_xyz": [ -2.040, 8.630, -0.798 ], "P_xyz": [ 0.388, 9.380, -0.062 ], "form": ".", "ssZp": 1.429, "Dp": 1.338, "splay_angle": 127.635, "splay_distance": 17.320, "splay_ratio": 0.898, "d22": 9.172, "d64": 11.362, "eta": -156.493, "theta": -41.667, "eta_prime": -135.857, "theta_prime": -61.324, "eta_base": -111.159, "theta_base": -30.449, "v0": -23.334, "v1": 34.066, "v2": -31.095, "v3": 18.536, "v4": 2.842, "amplitude": 33.919, "phase_angle": 156.452, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1b", "suiteness": 0.828, "filter_rmsd": 0.106, "frame": { "rmsd": 0.007, "origin": [ -31.418, -4.122, -38.229 ], "x_axis": [ 0.246, -0.969, -0.023 ], "y_axis": [ -0.496, -0.146, 0.856 ], "z_axis": [ -0.833, -0.200, -0.516 ], "quaternion": [ 0.382, 0.691, -0.530, -0.310 ] } }, { "index": 8, "index_chain": 8, "chain_name": "A", "nt_resnum": 8, "nt_name": "U", "nt_code": "U", "nt_id": "///A/8", "linked_nts": [ "///A/7", "///A/9" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,ss-non-loop,splayed-apart", "alpha": -79.374, "beta": -140.848, "gamma": 50.322, "delta": 81.177, "epsilon": -147.745, "zeta": -112.718, "epsilon_zeta": -35.027, "bb_type": "BI", "chi": -159.597, "glyco_bond": "anti", "C5prime_xyz": [ -1.014, 8.596, 0.470 ], "P_xyz": [ 1.430, 8.812, 1.364 ], "form": ".", "ssZp": 4.518, "Dp": 4.768, "splay_angle": 61.850, "splay_distance": 9.208, "splay_ratio": 0.515, "d22": null, "d64": null, "eta": 164.193, "theta": 159.737, "eta_prime": -159.524, "theta_prime": -165.411, "eta_base": -145.027, "theta_base": 175.599, "v0": 11.144, "v1": -36.005, "v2": 45.309, "v3": -39.935, "v4": 18.336, "amplitude": 45.453, "phase_angle": 4.561, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "2a", "suiteness": 0.592, "filter_rmsd": 0.103, "frame": { "rmsd": 0.008, "origin": [ -44.162, -4.204, -26.500 ], "x_axis": [ 0.811, -0.098, 0.577 ], "y_axis": [ 0.570, 0.357, -0.741 ], "z_axis": [ -0.133, 0.929, 0.345 ], "quaternion": [ 0.793, -0.527, -0.224, -0.210 ] } }, { "index": 9, "index_chain": 9, "chain_name": "A", "nt_resnum": 9, "nt_name": "A", "nt_code": "A", "nt_id": "///A/9", "linked_nts": [ "///A/8", "///A/10" ], "nt_type": "RNA", "dbn": ".", "summary": "~C2'-endo,non-canonical,non-pair-contact,multiplet,ss-non-loop,phosphate", "alpha": -68.981, "beta": -137.019, "gamma": 48.490, "delta": 151.273, "epsilon": -98.503, "zeta": -82.345, "epsilon_zeta": -16.158, "bb_type": "--", "chi": -68.228, "glyco_bond": "--", "C5prime_xyz": [ -3.461, 6.955, -2.640 ], "P_xyz": [ -1.524, 8.537, -3.379 ], "form": ".", "ssZp": 1.094, "Dp": 1.011, "splay_angle": 56.003, "splay_distance": 8.833, "splay_ratio": 0.481, "d22": null, "d64": null, "eta": -138.092, "theta": -39.023, "eta_prime": -156.302, "theta_prime": -110.378, "eta_base": 160.717, "theta_base": -104.911, "v0": -21.475, "v1": 35.513, "v2": -34.919, "v3": 23.572, "v4": -1.690, "amplitude": 36.408, "phase_angle": 163.553, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1[", "suiteness": 0.126, "filter_rmsd": 0.039, "frame": { "rmsd": 0.016, "origin": [ -50.944, 1.914, -27.670 ], "x_axis": [ 0.207, -0.582, 0.787 ], "y_axis": [ 0.957, 0.288, -0.039 ], "z_axis": [ -0.204, 0.761, 0.616 ], "quaternion": [ 0.726, -0.275, -0.341, -0.530 ] } }, { "index": 10, "index_chain": 10, "chain_name": "A", "nt_resnum": 10, "nt_name": "2MG", "nt_code": "g", "is_modified": true, "nt_id": "///A/10", "linked_nts": [ "///A/9", "///A/11" ], "nt_type": "RNA", "dbn": "(", "summary": "modified,turn,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet", "alpha": -177.861, "beta": 148.308, "gamma": 57.091, "delta": 91.315, "epsilon": -134.666, "zeta": -76.317, "epsilon_zeta": -58.349, "bb_type": "BI", "chi": 173.311, "glyco_bond": "--", "C5prime_xyz": [ -1.476, 8.013, 2.057 ], "P_xyz": [ 1.088, 7.660, 2.396 ], "form": "A", "ssZp": 4.361, "Dp": 4.616, "splay_angle": 24.018, "splay_distance": 3.688, "splay_ratio": 0.209, "d22": null, "d64": null, "eta": 28.768, "theta": -127.075, "eta_prime": 97.024, "theta_prime": -130.049, "eta_base": 133.838, "theta_base": -111.196, "v0": 13.506, "v1": -33.295, "v2": 39.216, "v3": -32.147, "v4": 11.894, "amplitude": 39.226, "phase_angle": 358.690, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "2g", "suiteness": 0.595, "filter_rmsd": 0.017, "frame": { "rmsd": 0.017, "origin": [ -45.852, 8.006, -23.799 ], "x_axis": [ -0.843, -0.413, -0.346 ], "y_axis": [ 0.188, 0.375, -0.908 ], "z_axis": [ 0.504, -0.830, -0.239 ], "quaternion": [ 0.271, -0.072, 0.784, -0.554 ] } }, { "index": 11, "index_chain": 11, "chain_name": "A", "nt_resnum": 11, "nt_name": "C", "nt_code": "C", "nt_id": "///A/11", "linked_nts": [ "///A/10", "///A/12" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -75.044, "beta": 179.068, "gamma": 58.334, "delta": 89.359, "epsilon": -145.849, "zeta": -71.063, "epsilon_zeta": -74.787, "bb_type": "BI", "chi": -161.334, "glyco_bond": "anti", "C5prime_xyz": [ -1.122, 8.668, 0.703 ], "P_xyz": [ 1.456, 8.831, 1.103 ], "form": "A", "ssZp": 4.338, "Dp": 4.450, "splay_angle": 21.628, "splay_distance": 3.571, "splay_ratio": 0.189, "d22": 4.185, "d64": 4.056, "eta": 168.854, "theta": -134.844, "eta_prime": -176.266, "theta_prime": -136.169, "eta_base": -137.773, "theta_base": -116.437, "v0": 2.822, "v1": -20.825, "v2": 30.008, "v3": -29.337, "v4": 16.807, "amplitude": 30.885, "phase_angle": 13.691, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.577, "filter_rmsd": 0.065, "frame": { "rmsd": 0.007, "origin": [ -44.700, 4.573, -23.094 ], "x_axis": [ -0.506, -0.110, -0.855 ], "y_axis": [ 0.681, 0.558, -0.474 ], "z_axis": [ 0.529, -0.822, -0.208 ], "quaternion": [ 0.459, 0.189, 0.754, -0.430 ] } }, { "index": 12, "index_chain": 12, "chain_name": "A", "nt_resnum": 12, "nt_name": "U", "nt_code": "U", "nt_id": "///A/12", "linked_nts": [ "///A/11", "///A/13" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet", "alpha": -69.421, "beta": 173.087, "gamma": 49.463, "delta": 82.830, "epsilon": -161.996, "zeta": -73.409, "epsilon_zeta": -88.586, "bb_type": "BI", "chi": -160.139, "glyco_bond": "anti", "C5prime_xyz": [ -1.650, 8.862, 0.379 ], "P_xyz": [ 0.859, 9.608, 0.625 ], "form": ".", "ssZp": 4.303, "Dp": 4.486, "splay_angle": 19.711, "splay_distance": 3.812, "splay_ratio": 0.195, "d22": 4.057, "d64": 4.929, "eta": 157.539, "theta": -122.430, "eta_prime": 175.182, "theta_prime": -130.723, "eta_base": -146.595, "theta_base": -101.845, "v0": -7.474, "v1": -18.835, "v2": 36.525, "v3": -41.687, "v4": 30.807, "amplitude": 41.577, "phase_angle": 28.538, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.805, "filter_rmsd": 0.102, "frame": { "rmsd": 0.009, "origin": [ -44.206, 1.096, -23.740 ], "x_axis": [ -0.200, 0.348, -0.916 ], "y_axis": [ 0.875, 0.484, -0.008 ], "z_axis": [ 0.441, -0.803, -0.401 ], "quaternion": [ 0.470, 0.423, 0.722, -0.281 ] } }, { "index": 13, "index_chain": 13, "chain_name": "A", "nt_resnum": 13, "nt_name": "C", "nt_code": "C", "nt_id": "///A/13", "linked_nts": [ "///A/12", "///A/14" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,hairpin-loop,kissing-loop", "alpha": 137.957, "beta": -155.671, "gamma": -163.843, "delta": 79.319, "epsilon": -169.832, "zeta": -79.074, "epsilon_zeta": -90.758, "bb_type": "BI", "chi": -168.256, "glyco_bond": "anti", "C5prime_xyz": [ -1.511, 8.750, 0.937 ], "P_xyz": [ -0.453, 10.694, -0.449 ], "form": ".", "ssZp": 4.287, "Dp": 4.367, "splay_angle": 32.034, "splay_distance": 5.580, "splay_ratio": 0.286, "d22": null, "d64": null, "eta": 179.113, "theta": 179.695, "eta_prime": -165.537, "theta_prime": 176.510, "eta_base": -116.937, "theta_base": 179.723, "v0": -2.927, "v1": -21.169, "v2": 35.909, "v3": -38.611, "v4": 26.309, "amplitude": 38.980, "phase_angle": 22.897, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.447, "filter_rmsd": 0.064, "frame": { "rmsd": 0.011, "origin": [ -45.288, -0.706, -26.919 ], "x_axis": [ 0.265, 0.509, -0.819 ], "y_axis": [ 0.940, 0.055, 0.338 ], "z_axis": [ 0.216, -0.859, -0.463 ], "quaternion": [ 0.463, 0.647, 0.560, -0.233 ] } }, { "index": 14, "index_chain": 14, "chain_name": "A", "nt_resnum": 14, "nt_name": "A", "nt_code": "A", "nt_id": "///A/14", "linked_nts": [ "///A/13", "///A/15" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-canonical,non-pair-contact,helix,multiplet,hairpin-loop,kissing-loop", "alpha": 131.335, "beta": 177.128, "gamma": -153.072, "delta": 91.248, "epsilon": -117.316, "zeta": -65.322, "epsilon_zeta": -51.994, "bb_type": "--", "chi": -175.315, "glyco_bond": "anti", "C5prime_xyz": [ -1.226, 8.090, 1.458 ], "P_xyz": [ -0.129, 10.433, 1.334 ], "form": ".", "ssZp": 4.535, "Dp": 4.796, "splay_angle": 37.011, "splay_distance": 5.702, "splay_ratio": 0.319, "d22": null, "d64": null, "eta": 171.700, "theta": -145.173, "eta_prime": 172.136, "theta_prime": -132.474, "eta_base": -179.169, "theta_base": -75.159, "v0": 15.164, "v1": -34.327, "v2": 39.563, "v3": -31.785, "v4": 10.450, "amplitude": 39.633, "phase_angle": 356.590, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.050, "filter_rmsd": 0.040, "frame": { "rmsd": 0.017, "origin": [ -48.440, -5.241, -27.712 ], "x_axis": [ 0.360, 0.544, -0.758 ], "y_axis": [ 0.889, 0.048, 0.456 ], "z_axis": [ 0.285, -0.838, -0.466 ], "quaternion": [ 0.485, 0.667, 0.537, -0.178 ] } }, { "index": 15, "index_chain": 15, "chain_name": "A", "nt_resnum": 15, "nt_name": "G", "nt_code": "G", "nt_id": "///A/15", "linked_nts": [ "///A/14", "///A/16" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-canonical,non-pair-contact,helix-end,hairpin-loop,kissing-loop,splayed-apart", "alpha": -50.084, "beta": 160.207, "gamma": 41.362, "delta": 80.349, "epsilon": -141.729, "zeta": -160.660, "epsilon_zeta": 18.931, "bb_type": "--", "chi": -166.857, "glyco_bond": "anti", "C5prime_xyz": [ -1.402, 8.711, 0.964 ], "P_xyz": [ 1.181, 9.109, 0.844 ], "form": ".", "ssZp": 4.707, "Dp": 4.812, "splay_angle": 113.496, "splay_distance": 12.958, "splay_ratio": 0.838, "d22": null, "d64": null, "eta": 152.566, "theta": 151.610, "eta_prime": -176.810, "theta_prime": 124.099, "eta_base": -99.418, "theta_base": -131.345, "v0": 2.735, "v1": -28.341, "v2": 42.143, "v3": -41.456, "v4": 24.369, "amplitude": 43.629, "phase_angle": 14.998, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.301, "filter_rmsd": 0.017, "frame": { "rmsd": 0.017, "origin": [ -44.577, -5.594, -31.891 ], "x_axis": [ 0.961, 0.271, 0.053 ], "y_axis": [ 0.091, -0.493, 0.865 ], "z_axis": [ 0.261, -0.827, -0.498 ], "quaternion": [ 0.492, 0.859, 0.106, 0.091 ] } }, { "index": 16, "index_chain": 16, "chain_name": "A", "nt_resnum": 16, "nt_name": "H2U", "nt_code": "u", "is_modified": true, "nt_id": "///A/16", "linked_nts": [ "///A/15", "///A/17" ], "nt_type": "RNA", "dbn": ".", "summary": "modified,~C2'-endo,non-stack,non-pair-contact,hairpin-loop,kissing-loop,splayed-apart", "alpha": 60.915, "beta": -153.814, "gamma": 53.092, "delta": 153.848, "epsilon": 91.141, "zeta": -91.342, "epsilon_zeta": -177.517, "bb_type": "--", "chi": -40.824, "glyco_bond": "--", "C5prime_xyz": [ -3.382, 5.299, -2.584 ], "P_xyz": [ -1.111, 5.896, -3.762 ], "form": ".", "ssZp": 1.742, "Dp": 0.651, "splay_angle": 116.691, "splay_distance": 15.549, "splay_ratio": 0.851, "d22": 10.976, "d64": 14.385, "eta": -73.208, "theta": -142.188, "eta_prime": -8.016, "theta_prime": 118.392, "eta_base": -133.304, "theta_base": 144.999, "v0": 9.581, "v1": 16.200, "v2": -34.067, "v3": 40.446, "v4": -31.766, "amplitude": 40.184, "phase_angle": 212.030, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "7p", "suiteness": 0.520, "filter_rmsd": 0.171, "frame": { "rmsd": 0.147, "origin": [ -41.956, -18.244, -32.886 ], "x_axis": [ 0.922, -0.059, 0.382 ], "y_axis": [ -0.364, 0.204, 0.909 ], "z_axis": [ -0.131, -0.977, 0.167 ], "quaternion": [ 0.757, 0.623, -0.170, 0.101 ] } }, { "index": 17, "index_chain": 17, "chain_name": "A", "nt_resnum": 17, "nt_name": "H2U", "nt_code": "u", "is_modified": true, "nt_id": "///A/17", "linked_nts": [ "///A/16", "///A/18" ], "nt_type": "RNA", "dbn": ".", "summary": "modified,anti,~C2'-endo,non-stack,non-pair-contact,hairpin-loop,kissing-loop,phosphate,splayed-apart", "alpha": 135.921, "beta": 167.776, "gamma": 49.839, "delta": 137.025, "epsilon": -100.295, "zeta": -79.213, "epsilon_zeta": -21.082, "bb_type": "--", "chi": -103.619, "glyco_bond": "anti", "C5prime_xyz": [ -2.111, 7.928, -2.682 ], "P_xyz": [ 0.147, 9.168, -2.222 ], "form": ".", "ssZp": -0.917, "Dp": 1.019, "splay_angle": 105.165, "splay_distance": 16.142, "splay_ratio": 0.794, "d22": null, "d64": null, "eta": 6.022, "theta": -80.217, "eta_prime": -4.336, "theta_prime": -136.797, "eta_base": -18.226, "theta_base": -156.472, "v0": -28.048, "v1": 38.304, "v2": -33.401, "v3": 18.328, "v4": 5.856, "amplitude": 37.711, "phase_angle": 152.340, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.180, "frame": { "rmsd": 0.158, "origin": [ -56.842, -22.595, -31.772 ], "x_axis": [ -0.476, 0.110, 0.872 ], "y_axis": [ 0.694, 0.657, 0.296 ], "z_axis": [ -0.540, 0.746, -0.390 ], "quaternion": [ -0.445, 0.253, 0.794, 0.328 ] } }, { "index": 18, "index_chain": 18, "chain_name": "A", "nt_resnum": 18, "nt_name": "G", "nt_code": "G", "nt_id": "///A/18", "linked_nts": [ "///A/17", "///A/19" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,anti,~C2'-endo,BII,non-canonical,non-pair-contact,helix,hairpin-loop,kissing-loop,splayed-apart", "alpha": -110.589, "beta": 137.035, "gamma": -67.817, "delta": 177.678, "epsilon": -94.680, "zeta": -179.449, "epsilon_zeta": 84.769, "bb_type": "BII", "chi": -95.526, "glyco_bond": "anti", "C5prime_xyz": [ -2.115, 7.721, -1.731 ], "P_xyz": [ -0.947, 9.988, -1.501 ], "form": ".", "ssZp": 1.301, "Dp": 0.680, "splay_angle": 52.441, "splay_distance": 8.160, "splay_ratio": 0.448, "d22": null, "d64": null, "eta": -3.086, "theta": -174.917, "eta_prime": 43.951, "theta_prime": -161.134, "eta_base": 59.498, "theta_base": -122.929, "v0": -14.338, "v1": 36.824, "v2": -42.867, "v3": 36.440, "v4": -13.966, "amplitude": 42.867, "phase_angle": 179.672, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.026, "frame": { "rmsd": 0.026, "origin": [ -48.583, -16.401, -44.182 ], "x_axis": [ 0.413, -0.853, -0.319 ], "y_axis": [ -0.022, -0.359, 0.933 ], "z_axis": [ -0.911, -0.378, -0.167 ], "quaternion": [ 0.471, 0.696, -0.314, -0.442 ] } }, { "index": 19, "index_chain": 19, "chain_name": "A", "nt_resnum": 19, "nt_name": "G", "nt_code": "G", "nt_id": "///A/19", "linked_nts": [ "///A/18", "///A/20" ], "nt_type": "RNA", "dbn": "[", "summary": "pseudoknotted,~C2'-endo,isolated-canonical,non-pair-contact,helix-end,hairpin-loop,kissing-loop,phosphate,splayed-apart", "alpha": -76.767, "beta": 176.585, "gamma": 59.703, "delta": 157.406, "epsilon": -88.953, "zeta": -83.176, "epsilon_zeta": -5.778, "bb_type": "--", "chi": -79.807, "glyco_bond": "--", "C5prime_xyz": [ -2.109, 7.161, -3.055 ], "P_xyz": [ 0.435, 7.733, -3.155 ], "form": ".", "ssZp": -0.871, "Dp": 0.211, "splay_angle": 127.329, "splay_distance": 16.635, "splay_ratio": 0.897, "d22": null, "d64": null, "eta": -131.227, "theta": -39.190, "eta_prime": -119.821, "theta_prime": -72.121, "eta_base": -104.900, "theta_base": -9.259, "v0": -19.478, "v1": 37.175, "v2": -39.784, "v3": 29.139, "v4": -6.530, "amplitude": 40.364, "phase_angle": 170.275, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.019, "frame": { "rmsd": 0.019, "origin": [ -56.364, -17.548, -42.006 ], "x_axis": [ 0.175, -0.919, 0.354 ], "y_axis": [ 0.108, 0.375, 0.921 ], "z_axis": [ -0.979, -0.123, 0.164 ], "quaternion": [ 0.655, 0.399, -0.509, -0.392 ] } }, { "index": 20, "index_chain": 20, "chain_name": "A", "nt_resnum": 20, "nt_name": "G", "nt_code": "G", "nt_id": "///A/20", "linked_nts": [ "///A/19", "///A/21" ], "nt_type": "RNA", "dbn": ".", "summary": "~C3'-endo,non-stack,non-pair-contact,hairpin-loop,kissing-loop,splayed-apart", "alpha": -68.343, "beta": -159.315, "gamma": 37.119, "delta": 92.530, "epsilon": -127.114, "zeta": -67.196, "epsilon_zeta": -59.918, "bb_type": "--", "chi": 179.230, "glyco_bond": "--", "C5prime_xyz": [ -1.146, 8.062, 1.902 ], "P_xyz": [ 0.939, 7.635, 3.473 ], "form": ".", "ssZp": 4.766, "Dp": 4.710, "splay_angle": 56.273, "splay_distance": 9.686, "splay_ratio": 0.488, "d22": null, "d64": null, "eta": 160.842, "theta": -87.179, "eta_prime": -161.127, "theta_prime": -96.036, "eta_base": -171.238, "theta_base": -109.638, "v0": 12.970, "v1": -29.696, "v2": 33.996, "v3": -27.416, "v4": 9.192, "amplitude": 34.053, "phase_angle": 356.686, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "2a", "suiteness": 0.341, "filter_rmsd": 0.016, "frame": { "rmsd": 0.016, "origin": [ -51.969, -7.640, -29.387 ], "x_axis": [ 0.614, -0.725, -0.312 ], "y_axis": [ -0.716, -0.345, -0.608 ], "z_axis": [ 0.333, 0.596, -0.730 ], "quaternion": [ -0.367, 0.820, -0.439, 0.007 ] } }, { "index": 21, "index_chain": 21, "chain_name": "A", "nt_resnum": 21, "nt_name": "A", "nt_code": "A", "nt_id": "///A/21", "linked_nts": [ "///A/20", "///A/22" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,multiplet,hairpin-loop,kissing-loop", "alpha": 140.643, "beta": -153.607, "gamma": -70.348, "delta": 89.596, "epsilon": 179.078, "zeta": -81.084, "epsilon_zeta": -99.839, "bb_type": "BI", "chi": -148.831, "glyco_bond": "anti", "C5prime_xyz": [ -1.286, 8.660, -0.503 ], "P_xyz": [ -1.227, 11.248, -0.740 ], "form": ".", "ssZp": 3.698, "Dp": 4.130, "splay_angle": 40.024, "splay_distance": 6.859, "splay_ratio": 0.346, "d22": null, "d64": null, "eta": -86.446, "theta": 153.384, "eta_prime": -70.333, "theta_prime": 154.735, "eta_base": -61.231, "theta_base": 157.458, "v0": -3.105, "v1": -20.414, "v2": 33.383, "v3": -36.884, "v4": 25.429, "amplitude": 36.446, "phase_angle": 23.654, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33m", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.044, "frame": { "rmsd": 0.019, "origin": [ -46.295, -0.946, -33.490 ], "x_axis": [ 0.068, 0.611, -0.789 ], "y_axis": [ -0.954, -0.193, -0.231 ], "z_axis": [ -0.293, 0.768, 0.570 ], "quaternion": [ 0.601, -0.416, 0.206, 0.651 ] } }, { "index": 22, "index_chain": 22, "chain_name": "A", "nt_resnum": 22, "nt_name": "G", "nt_code": "G", "nt_id": "///A/22", "linked_nts": [ "///A/21", "///A/23" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,hairpin-loop,kissing-loop", "alpha": 155.100, "beta": 161.204, "gamma": 178.054, "delta": 87.285, "epsilon": -148.545, "zeta": -78.406, "epsilon_zeta": -70.139, "bb_type": "BI", "chi": -176.664, "glyco_bond": "anti", "C5prime_xyz": [ -1.077, 8.212, 1.444 ], "P_xyz": [ 0.036, 10.426, 0.664 ], "form": "A", "ssZp": 4.621, "Dp": 4.752, "splay_angle": 26.610, "splay_distance": 4.060, "splay_ratio": 0.232, "d22": null, "d64": null, "eta": 160.733, "theta": 170.563, "eta_prime": 156.506, "theta_prime": -179.199, "eta_base": 159.137, "theta_base": -161.544, "v0": 14.891, "v1": -33.052, "v2": 37.358, "v3": -29.788, "v4": 9.612, "amplitude": 37.461, "phase_angle": 355.751, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.395, "filter_rmsd": 0.011, "frame": { "rmsd": 0.011, "origin": [ -45.234, -0.900, -26.714 ], "x_axis": [ 0.230, 0.538, -0.811 ], "y_axis": [ -0.920, -0.151, -0.361 ], "z_axis": [ -0.317, 0.829, 0.460 ], "quaternion": [ 0.620, -0.480, 0.199, 0.587 ] } }, { "index": 23, "index_chain": 23, "chain_name": "A", "nt_resnum": 23, "nt_name": "A", "nt_code": "A", "nt_id": "///A/23", "linked_nts": [ "///A/22", "///A/24" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,phosphate", "alpha": -59.874, "beta": -179.999, "gamma": 47.265, "delta": 84.320, "epsilon": -152.056, "zeta": -73.427, "epsilon_zeta": -78.630, "bb_type": "BI", "chi": -161.501, "glyco_bond": "anti", "C5prime_xyz": [ -1.059, 8.572, 0.644 ], "P_xyz": [ 1.472, 8.833, 1.130 ], "form": "A", "ssZp": 4.427, "Dp": 4.683, "splay_angle": 22.192, "splay_distance": 3.407, "splay_ratio": 0.192, "d22": null, "d64": null, "eta": 175.818, "theta": -146.984, "eta_prime": -176.555, "theta_prime": -144.173, "eta_base": -158.297, "theta_base": -113.266, "v0": 8.235, "v1": -31.444, "v2": 40.941, "v3": -37.340, "v4": 18.499, "amplitude": 41.276, "phase_angle": 7.308, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.828, "filter_rmsd": 0.038, "frame": { "rmsd": 0.013, "origin": [ -44.261, 1.512, -23.596 ], "x_axis": [ -0.180, 0.419, -0.890 ], "y_axis": [ -0.944, -0.329, 0.036 ], "z_axis": [ -0.278, 0.846, 0.455 ], "quaternion": [ 0.486, -0.417, 0.315, 0.701 ] } }, { "index": 24, "index_chain": 24, "chain_name": "A", "nt_resnum": 24, "nt_name": "G", "nt_code": "G", "nt_id": "///A/24", "linked_nts": [ "///A/23", "///A/25" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -51.844, "beta": 175.050, "gamma": 32.033, "delta": 88.302, "epsilon": -147.388, "zeta": -66.685, "epsilon_zeta": -80.702, "bb_type": "BI", "chi": -158.166, "glyco_bond": "anti", "C5prime_xyz": [ -1.005, 8.512, 0.509 ], "P_xyz": [ 1.570, 8.702, 0.765 ], "form": "A", "ssZp": 4.567, "Dp": 4.746, "splay_angle": 22.717, "splay_distance": 3.662, "splay_ratio": 0.201, "d22": null, "d64": null, "eta": 166.592, "theta": -134.279, "eta_prime": -179.678, "theta_prime": -132.349, "eta_base": -134.988, "theta_base": -101.253, "v0": 9.866, "v1": -32.736, "v2": 41.384, "v3": -36.902, "v4": 17.188, "amplitude": 41.552, "phase_angle": 5.154, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.279, "filter_rmsd": 0.017, "frame": { "rmsd": 0.017, "origin": [ -44.483, 4.856, -22.983 ], "x_axis": [ -0.684, 0.134, -0.717 ], "y_axis": [ -0.684, -0.458, 0.568 ], "z_axis": [ -0.252, 0.879, 0.405 ], "quaternion": [ 0.256, -0.304, 0.453, 0.798 ] } }, { "index": 25, "index_chain": 25, "chain_name": "A", "nt_resnum": 25, "nt_name": "C", "nt_code": "C", "nt_id": "///A/25", "linked_nts": [ "///A/24", "///A/26" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet", "alpha": -57.815, "beta": 169.097, "gamma": 47.826, "delta": 77.532, "epsilon": -104.693, "zeta": -70.681, "epsilon_zeta": -34.012, "bb_type": "--", "chi": -161.746, "glyco_bond": "anti", "C5prime_xyz": [ -1.372, 8.808, 0.586 ], "P_xyz": [ 1.171, 9.391, 0.587 ], "form": ".", "ssZp": 3.352, "Dp": 4.055, "splay_angle": 30.961, "splay_distance": 4.753, "splay_ratio": 0.270, "d22": null, "d64": null, "eta": 162.563, "theta": -144.040, "eta_prime": -176.920, "theta_prime": -130.121, "eta_base": -124.214, "theta_base": -83.505, "v0": 1.592, "v1": -28.118, "v2": 42.205, "v3": -42.263, "v4": 25.798, "amplitude": 44.006, "phase_angle": 16.450, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.805, "filter_rmsd": 0.063, "frame": { "rmsd": 0.006, "origin": [ -45.957, 7.994, -24.163 ], "x_axis": [ -0.907, -0.299, -0.297 ], "y_axis": [ -0.205, -0.303, 0.931 ], "z_axis": [ -0.368, 0.905, 0.214 ], "quaternion": [ -0.030, -0.214, 0.590, 0.778 ] } }, { "index": 26, "index_chain": 26, "chain_name": "A", "nt_resnum": 26, "nt_name": "M2G", "nt_code": "g", "is_modified": true, "nt_id": "///A/26", "linked_nts": [ "///A/25", "///A/27" ], "nt_type": "RNA", "dbn": ".", "summary": "modified,anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,ss-non-loop", "alpha": -21.871, "beta": -177.282, "gamma": 62.682, "delta": 81.829, "epsilon": -136.371, "zeta": -71.660, "epsilon_zeta": -64.711, "bb_type": "BI", "chi": -163.140, "glyco_bond": "anti", "C5prime_xyz": [ -1.348, 8.709, 0.688 ], "P_xyz": [ 1.237, 9.062, 0.849 ], "form": "A", "ssZp": 4.413, "Dp": 4.719, "splay_angle": 26.619, "splay_distance": 4.239, "splay_ratio": 0.232, "d22": null, "d64": null, "eta": -171.230, "theta": -132.853, "eta_prime": -154.706, "theta_prime": -130.506, "eta_base": -103.062, "theta_base": -92.929, "v0": 4.823, "v1": -29.767, "v2": 42.402, "v3": -40.465, "v4": 22.442, "amplitude": 43.389, "phase_angle": 12.243, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.010, "frame": { "rmsd": 0.010, "origin": [ -50.477, 9.380, -24.651 ], "x_axis": [ -0.686, -0.627, 0.369 ], "y_axis": [ 0.481, -0.011, 0.877 ], "z_axis": [ -0.546, 0.779, 0.309 ], "quaternion": [ -0.391, -0.063, 0.585, 0.708 ] } }, { "index": 27, "index_chain": 27, "chain_name": "A", "nt_resnum": 27, "nt_name": "C", "nt_code": "C", "nt_id": "///A/27", "linked_nts": [ "///A/26", "///A/28" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack", "alpha": -60.658, "beta": 171.445, "gamma": 48.849, "delta": 81.741, "epsilon": -148.065, "zeta": -73.487, "epsilon_zeta": -74.578, "bb_type": "BI", "chi": -163.320, "glyco_bond": "anti", "C5prime_xyz": [ -1.376, 8.802, 0.625 ], "P_xyz": [ 1.181, 9.268, 0.918 ], "form": "A", "ssZp": 4.466, "Dp": 4.663, "splay_angle": 23.586, "splay_distance": 3.712, "splay_ratio": 0.205, "d22": 4.202, "d64": 4.024, "eta": 163.303, "theta": -144.505, "eta_prime": -178.796, "theta_prime": -143.110, "eta_base": -123.862, "theta_base": -112.383, "v0": 2.328, "v1": -27.385, "v2": 40.533, "v3": -40.054, "v4": 23.944, "amplitude": 42.036, "phase_angle": 15.367, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.890, "filter_rmsd": 0.061, "frame": { "rmsd": 0.006, "origin": [ -54.279, 10.217, -22.975 ], "x_axis": [ 0.026, -0.674, 0.738 ], "y_axis": [ 0.779, 0.477, 0.407 ], "z_axis": [ -0.626, 0.564, 0.538 ], "quaternion": [ 0.714, -0.055, -0.478, -0.509 ] } }, { "index": 28, "index_chain": 28, "chain_name": "A", "nt_resnum": 28, "nt_name": "C", "nt_code": "C", "nt_id": "///A/28", "linked_nts": [ "///A/27", "///A/29" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -72.140, "beta": 174.929, "gamma": 53.866, "delta": 81.255, "epsilon": -147.317, "zeta": -76.380, "epsilon_zeta": -70.936, "bb_type": "BI", "chi": -162.563, "glyco_bond": "anti", "C5prime_xyz": [ -1.306, 8.721, 0.608 ], "P_xyz": [ 1.276, 9.090, 0.705 ], "form": "A", "ssZp": 4.465, "Dp": 4.685, "splay_angle": 21.386, "splay_distance": 3.379, "splay_ratio": 0.188, "d22": null, "d64": null, "eta": 162.555, "theta": -145.457, "eta_prime": 175.632, "theta_prime": -145.034, "eta_base": -139.230, "theta_base": -117.964, "v0": 4.046, "v1": -29.995, "v2": 43.157, "v3": -41.908, "v4": 23.897, "amplitude": 44.373, "phase_angle": 13.449, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.950, "filter_rmsd": 0.064, "frame": { "rmsd": 0.005, "origin": [ -57.087, 10.723, -20.600 ], "x_axis": [ 0.611, -0.364, 0.703 ], "y_axis": [ 0.562, 0.825, -0.062 ], "z_axis": [ -0.557, 0.433, 0.709 ], "quaternion": [ 0.887, -0.139, -0.355, -0.261 ] } }, { "index": 29, "index_chain": 29, "chain_name": "A", "nt_resnum": 29, "nt_name": "A", "nt_code": "A", "nt_id": "///A/29", "linked_nts": [ "///A/28", "///A/30" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -56.382, "beta": 165.133, "gamma": 52.240, "delta": 82.774, "epsilon": -159.936, "zeta": -72.174, "epsilon_zeta": -87.762, "bb_type": "BI", "chi": -164.691, "glyco_bond": "anti", "C5prime_xyz": [ -1.434, 8.691, 0.820 ], "P_xyz": [ 1.155, 9.141, 0.923 ], "form": "A", "ssZp": 4.512, "Dp": 4.554, "splay_angle": 24.394, "splay_distance": 3.786, "splay_ratio": 0.213, "d22": null, "d64": null, "eta": 167.510, "theta": -150.696, "eta_prime": -176.559, "theta_prime": -151.024, "eta_base": -132.224, "theta_base": -127.346, "v0": 5.192, "v1": -27.921, "v2": 38.656, "v3": -36.751, "v4": 19.993, "amplitude": 39.411, "phase_angle": 11.234, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.902, "filter_rmsd": 0.037, "frame": { "rmsd": 0.006, "origin": [ -58.690, 10.503, -17.634 ], "x_axis": [ 0.887, 0.079, 0.455 ], "y_axis": [ 0.102, 0.927, -0.360 ], "z_axis": [ -0.450, 0.366, 0.814 ], "quaternion": [ 0.952, -0.191, -0.238, -0.006 ] } }, { "index": 30, "index_chain": 30, "chain_name": "A", "nt_resnum": 30, "nt_name": "G", "nt_code": "G", "nt_id": "///A/30", "linked_nts": [ "///A/29", "///A/31" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop", "alpha": -58.607, "beta": -176.750, "gamma": 38.718, "delta": 82.093, "epsilon": -166.568, "zeta": -56.722, "epsilon_zeta": -109.847, "bb_type": "BI", "chi": -157.235, "glyco_bond": "anti", "C5prime_xyz": [ -1.019, 8.674, 0.307 ], "P_xyz": [ 1.555, 8.953, 0.798 ], "form": "A", "ssZp": 4.345, "Dp": 4.609, "splay_angle": 22.126, "splay_distance": 3.374, "splay_ratio": 0.192, "d22": null, "d64": null, "eta": 169.327, "theta": -145.076, "eta_prime": -179.585, "theta_prime": -141.667, "eta_base": -142.141, "theta_base": -105.775, "v0": 6.608, "v1": -29.605, "v2": 40.624, "v3": -37.667, "v4": 19.666, "amplitude": 41.199, "phase_angle": 9.588, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.584, "filter_rmsd": 0.009, "frame": { "rmsd": 0.009, "origin": [ -59.994, 10.304, -14.085 ], "x_axis": [ 0.806, 0.572, 0.152 ], "y_axis": [ -0.427, 0.740, -0.520 ], "z_axis": [ -0.410, 0.354, 0.841 ], "quaternion": [ 0.920, -0.237, -0.153, 0.271 ] } }, { "index": 31, "index_chain": 31, "chain_name": "A", "nt_resnum": 31, "nt_name": "A", "nt_code": "A", "nt_id": "///A/31", "linked_nts": [ "///A/30", "///A/32" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,hairpin-loop", "alpha": -71.749, "beta": -175.026, "gamma": 49.119, "delta": 87.746, "epsilon": -143.505, "zeta": -62.193, "epsilon_zeta": -81.313, "bb_type": "BI", "chi": -158.193, "glyco_bond": "anti", "C5prime_xyz": [ -1.090, 8.543, 0.422 ], "P_xyz": [ 1.507, 8.714, 0.607 ], "form": ".", "ssZp": 4.465, "Dp": 4.756, "splay_angle": 25.808, "splay_distance": 3.975, "splay_ratio": 0.223, "d22": null, "d64": null, "eta": 171.259, "theta": -125.998, "eta_prime": -174.305, "theta_prime": -122.516, "eta_base": -125.354, "theta_base": -73.607, "v0": 8.251, "v1": -30.246, "v2": 39.261, "v3": -35.631, "v4": 17.386, "amplitude": 39.543, "phase_angle": 6.852, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.633, "filter_rmsd": 0.036, "frame": { "rmsd": 0.006, "origin": [ -59.678, 11.708, -11.034 ], "x_axis": [ 0.408, 0.880, -0.242 ], "y_axis": [ -0.862, 0.285, -0.418 ], "z_axis": [ -0.299, 0.380, 0.876 ], "quaternion": [ 0.801, -0.249, -0.018, 0.544 ] } }, { "index": 32, "index_chain": 32, "chain_name": "A", "nt_resnum": 32, "nt_name": "OMC", "nt_code": "c", "is_modified": true, "nt_id": "///A/32", "linked_nts": [ "///A/31", "///A/33" ], "nt_type": "RNA", "dbn": ".", "summary": "modified,anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,hairpin-loop", "alpha": -71.333, "beta": -179.388, "gamma": 48.257, "delta": 85.722, "epsilon": -164.206, "zeta": -49.751, "epsilon_zeta": -114.455, "bb_type": "BI", "chi": -144.805, "glyco_bond": "anti", "C5prime_xyz": [ -1.070, 8.634, -0.312 ], "P_xyz": [ 1.530, 8.804, -0.522 ], "form": "A", "ssZp": 4.079, "Dp": 4.579, "splay_angle": 29.448, "splay_distance": 4.679, "splay_ratio": 0.255, "d22": 3.731, "d64": 3.692, "eta": 159.108, "theta": -127.376, "eta_prime": -177.720, "theta_prime": -125.487, "eta_base": -109.285, "theta_base": -97.772, "v0": 6.127, "v1": -28.596, "v2": 38.988, "v3": -36.448, "v4": 19.227, "amplitude": 39.578, "phase_angle": 9.905, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.795, "filter_rmsd": 0.064, "frame": { "rmsd": 0.008, "origin": [ -59.498, 15.583, -10.166 ], "x_axis": [ -0.369, 0.684, -0.629 ], "y_axis": [ -0.928, -0.306, 0.211 ], "z_axis": [ -0.048, 0.662, 0.748 ], "quaternion": [ 0.518, -0.218, 0.280, 0.778 ] } }, { "index": 33, "index_chain": 33, "chain_name": "A", "nt_resnum": 33, "nt_name": "U", "nt_code": "U", "nt_id": "///A/33", "linked_nts": [ "///A/32", "///A/34" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-pair-contact,hairpin-loop,cap-acceptor", "alpha": -98.320, "beta": -149.520, "gamma": 56.186, "delta": 87.645, "epsilon": -125.192, "zeta": -39.079, "epsilon_zeta": -86.113, "bb_type": "--", "chi": -145.625, "glyco_bond": "anti", "C5prime_xyz": [ -1.560, 8.749, -0.227 ], "P_xyz": [ 0.971, 9.299, 0.239 ], "form": ".", "ssZp": 3.669, "Dp": 4.332, "splay_angle": 70.896, "splay_distance": 10.486, "splay_ratio": 0.584, "d22": null, "d64": null, "eta": 176.722, "theta": -93.282, "eta_prime": -167.941, "theta_prime": -143.037, "eta_base": -131.002, "theta_base": 155.028, "v0": -1.736, "v1": -19.947, "v2": 32.663, "v3": -34.629, "v4": 22.936, "amplitude": 35.077, "phase_angle": 21.379, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1m", "suiteness": 0.222, "filter_rmsd": 0.106, "frame": { "rmsd": 0.008, "origin": [ -60.793, 20.038, -9.558 ], "x_axis": [ -0.730, -0.107, -0.675 ], "y_axis": [ -0.496, -0.597, 0.631 ], "z_axis": [ -0.470, 0.795, 0.383 ], "quaternion": [ 0.118, -0.348, 0.433, 0.823 ] } }, { "index": 34, "index_chain": 34, "chain_name": "A", "nt_resnum": 34, "nt_name": "OMG", "nt_code": "g", "is_modified": true, "nt_id": "///A/34", "linked_nts": [ "///A/33", "///A/35" ], "nt_type": "RNA", "dbn": ".", "summary": "modified,turn,anti,~C3'-endo,non-pair-contact,hairpin-loop", "alpha": -169.696, "beta": 108.254, "gamma": 47.782, "delta": 86.622, "epsilon": -139.325, "zeta": -46.823, "epsilon_zeta": -92.502, "bb_type": "--", "chi": 174.894, "glyco_bond": "anti", "C5prime_xyz": [ -2.087, 8.534, 1.602 ], "P_xyz": [ 0.467, 8.001, 1.989 ], "form": ".", "ssZp": 4.354, "Dp": 4.572, "splay_angle": 23.965, "splay_distance": 4.174, "splay_ratio": 0.218, "d22": null, "d64": null, "eta": 8.793, "theta": -84.276, "eta_prime": 45.421, "theta_prime": -113.439, "eta_base": 27.255, "theta_base": -87.675, "v0": -9.418, "v1": -13.256, "v2": 29.326, "v3": -35.542, "v4": 28.458, "amplitude": 35.244, "phase_angle": 33.687, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1g", "suiteness": 0.033, "filter_rmsd": 0.012, "frame": { "rmsd": 0.012, "origin": [ -57.918, 22.569, 0.204 ], "x_axis": [ 0.308, -0.735, 0.605 ], "y_axis": [ -0.929, -0.371, 0.022 ], "z_axis": [ 0.208, -0.568, -0.796 ], "quaternion": [ 0.188, 0.787, -0.529, 0.258 ] } }, { "index": 35, "index_chain": 35, "chain_name": "A", "nt_resnum": 35, "nt_name": "A", "nt_code": "A", "nt_id": "///A/35", "linked_nts": [ "///A/34", "///A/36" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-pair-contact,hairpin-loop,cap-donor,phosphate", "alpha": 21.369, "beta": -113.093, "gamma": -116.578, "delta": 100.966, "epsilon": 143.374, "zeta": 18.202, "epsilon_zeta": 125.172, "bb_type": "--", "chi": -169.669, "glyco_bond": "anti", "C5prime_xyz": [ -0.526, 7.843, 1.133 ], "P_xyz": [ 0.127, 10.225, 0.293 ], "form": ".", "ssZp": 4.299, "Dp": 4.382, "splay_angle": 20.040, "splay_distance": 3.603, "splay_ratio": 0.180, "d22": null, "d64": null, "eta": 179.257, "theta": -146.892, "eta_prime": -175.047, "theta_prime": -144.335, "eta_base": -118.641, "theta_base": -116.548, "v0": 25.205, "v1": -38.225, "v2": 36.028, "v3": -22.562, "v4": -1.405, "amplitude": 38.558, "phase_angle": 339.131, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.005, "origin": [ -55.461, 19.447, -1.076 ], "x_axis": [ -0.415, -0.805, 0.425 ], "y_axis": [ -0.864, 0.201, -0.462 ], "z_axis": [ 0.286, -0.559, -0.779 ], "quaternion": [ -0.045, -0.539, 0.774, -0.330 ] } }, { "index": 36, "index_chain": 36, "chain_name": "A", "nt_resnum": 36, "nt_name": "A", "nt_code": "A", "nt_id": "///A/36", "linked_nts": [ "///A/35", "///A/37" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-pair-contact,hairpin-loop", "alpha": 91.121, "beta": -173.565, "gamma": 178.522, "delta": 80.007, "epsilon": -140.487, "zeta": -85.323, "epsilon_zeta": -55.165, "bb_type": "BI", "chi": -170.986, "glyco_bond": "anti", "C5prime_xyz": [ -1.223, 8.457, 1.223 ], "P_xyz": [ -0.174, 10.477, -0.036 ], "form": ".", "ssZp": 4.810, "Dp": 4.837, "splay_angle": 33.642, "splay_distance": 5.086, "splay_ratio": 0.292, "d22": null, "d64": null, "eta": 124.428, "theta": -160.401, "eta_prime": 155.444, "theta_prime": -149.313, "eta_base": -154.564, "theta_base": -102.920, "v0": 6.503, "v1": -31.402, "v2": 43.303, "v3": -40.359, "v4": 21.340, "amplitude": 43.988, "phase_angle": 10.123, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.037, "frame": { "rmsd": 0.008, "origin": [ -54.049, 16.327, -2.197 ], "x_axis": [ -0.846, -0.483, 0.225 ], "y_axis": [ -0.483, 0.517, -0.706 ], "z_axis": [ 0.225, -0.707, -0.671 ], "quaternion": [ -0.000, -0.277, 0.871, -0.406 ] } }, { "index": 37, "index_chain": 37, "chain_name": "A", "nt_resnum": 37, "nt_name": "YG", "nt_code": "g", "is_modified": true, "nt_id": "///A/37", "linked_nts": [ "///A/36", "///A/38" ], "nt_type": "RNA", "dbn": ".", "summary": "modified,anti,~C3'-endo,BI,non-pair-contact,hairpin-loop", "alpha": -7.617, "beta": 137.430, "gamma": 31.163, "delta": 81.692, "epsilon": -163.515, "zeta": -48.854, "epsilon_zeta": -114.661, "bb_type": "BI", "chi": -173.474, "glyco_bond": "anti", "C5prime_xyz": [ -1.679, 8.765, 1.232 ], "P_xyz": [ 0.852, 8.837, 1.880 ], "form": ".", "ssZp": 4.493, "Dp": 4.425, "splay_angle": 26.727, "splay_distance": 4.258, "splay_ratio": 0.235, "d22": null, "d64": null, "eta": 171.500, "theta": -123.894, "eta_prime": -163.096, "theta_prime": -126.939, "eta_base": -99.785, "theta_base": -86.113, "v0": -5.720, "v1": -20.324, "v2": 37.236, "v3": -41.373, "v4": 29.694, "amplitude": 41.510, "phase_angle": 26.229, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.026, "frame": { "rmsd": 0.026, "origin": [ -56.568, 12.103, -3.494 ], "x_axis": [ -0.931, 0.229, -0.284 ], "y_axis": [ 0.359, 0.713, -0.602 ], "z_axis": [ 0.065, -0.662, -0.746 ], "quaternion": [ 0.095, 0.159, 0.921, -0.343 ] } }, { "index": 38, "index_chain": 38, "chain_name": "A", "nt_resnum": 38, "nt_name": "A", "nt_code": "A", "nt_id": "///A/38", "linked_nts": [ "///A/37", "///A/39" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,hairpin-loop", "alpha": -93.521, "beta": -174.625, "gamma": 60.190, "delta": 75.464, "epsilon": -146.649, "zeta": -62.223, "epsilon_zeta": -84.425, "bb_type": "BI", "chi": -173.437, "glyco_bond": "anti", "C5prime_xyz": [ -1.725, 8.634, 1.197 ], "P_xyz": [ 0.760, 9.281, 1.627 ], "form": ".", "ssZp": 4.696, "Dp": 4.727, "splay_angle": 28.787, "splay_distance": 4.528, "splay_ratio": 0.255, "d22": null, "d64": null, "eta": 155.881, "theta": -137.785, "eta_prime": 176.004, "theta_prime": -134.197, "eta_base": -116.768, "theta_base": -93.437, "v0": -3.536, "v1": -24.954, "v2": 42.712, "v3": -45.581, "v4": 30.803, "amplitude": 46.295, "phase_angle": 22.692, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.258, "filter_rmsd": 0.037, "frame": { "rmsd": 0.007, "origin": [ -58.905, 10.016, -6.377 ], "x_axis": [ -0.382, 0.693, -0.611 ], "y_axis": [ 0.918, 0.359, -0.168 ], "z_axis": [ 0.103, -0.625, -0.773 ], "quaternion": [ 0.225, 0.508, 0.793, -0.250 ] } }, { "index": 39, "index_chain": 39, "chain_name": "A", "nt_resnum": 39, "nt_name": "PSU", "nt_code": "P", "is_modified": true, "nt_id": "///A/39", "linked_nts": [ "///A/38", "///A/40" ], "nt_type": "RNA", "dbn": ".", "summary": "modified,anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,hairpin-loop", "alpha": -82.815, "beta": 179.956, "gamma": 69.241, "delta": 84.495, "epsilon": -151.519, "zeta": -69.259, "epsilon_zeta": -82.260, "bb_type": "BI", "chi": -173.000, "glyco_bond": "anti", "C5prime_xyz": [ -1.590, 8.649, 1.365 ], "P_xyz": [ 0.957, 9.262, 1.292 ], "form": "A", "ssZp": 4.924, "Dp": 4.496, "splay_angle": 22.822, "splay_distance": 3.608, "splay_ratio": 0.202, "d22": null, "d64": null, "eta": 168.154, "theta": -141.025, "eta_prime": -173.592, "theta_prime": -142.694, "eta_base": -114.767, "theta_base": -107.424, "v0": -2.010, "v1": -22.144, "v2": 36.502, "v3": -38.684, "v4": 25.633, "amplitude": 39.223, "phase_angle": 21.469, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.447, "filter_rmsd": 0.098, "frame": { "rmsd": 0.021, "origin": [ -60.581, 9.859, -10.581 ], "x_axis": [ 0.380, 0.779, -0.499 ], "y_axis": [ 0.920, -0.261, 0.293 ], "z_axis": [ 0.098, -0.570, -0.816 ], "quaternion": [ 0.275, 0.784, 0.542, -0.128 ] } }, { "index": 40, "index_chain": 40, "chain_name": "A", "nt_resnum": 40, "nt_name": "5MC", "nt_code": "c", "is_modified": true, "nt_id": "///A/40", "linked_nts": [ "///A/39", "///A/41" ], "nt_type": "RNA", "dbn": ")", "summary": "modified,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop", "alpha": -90.840, "beta": 168.665, "gamma": 74.200, "delta": 81.434, "epsilon": -141.727, "zeta": -96.359, "epsilon_zeta": -45.368, "bb_type": "BI", "chi": -176.299, "glyco_bond": "anti", "C5prime_xyz": [ -1.585, 8.599, 1.370 ], "P_xyz": [ 0.976, 9.165, 1.261 ], "form": "A", "ssZp": 4.633, "Dp": 4.705, "splay_angle": 28.063, "splay_distance": 4.322, "splay_ratio": 0.245, "d22": 4.346, "d64": 4.174, "eta": 161.387, "theta": -134.139, "eta_prime": 177.832, "theta_prime": -137.011, "eta_base": -127.013, "theta_base": -100.307, "v0": -0.627, "v1": -25.214, "v2": 40.347, "v3": -41.472, "v4": 26.528, "amplitude": 42.742, "phase_angle": 19.270, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.205, "filter_rmsd": 0.062, "frame": { "rmsd": 0.009, "origin": [ -60.753, 10.070, -14.178 ], "x_axis": [ 0.864, 0.497, -0.080 ], "y_axis": [ 0.476, -0.756, 0.450 ], "z_axis": [ 0.163, -0.427, -0.889 ], "quaternion": [ 0.234, 0.937, 0.260, 0.022 ] } }, { "index": 41, "index_chain": 41, "chain_name": "A", "nt_resnum": 41, "nt_name": "U", "nt_code": "U", "nt_id": "///A/41", "linked_nts": [ "///A/40", "///A/42" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": 41.133, "beta": 162.255, "gamma": -47.460, "delta": 99.208, "epsilon": -152.448, "zeta": -68.527, "epsilon_zeta": -83.921, "bb_type": "BI", "chi": -155.829, "glyco_bond": "anti", "C5prime_xyz": [ -0.543, 8.020, 0.126 ], "P_xyz": [ 1.669, 8.911, 1.120 ], "form": "A", "ssZp": 4.422, "Dp": 4.716, "splay_angle": 22.506, "splay_distance": 3.674, "splay_ratio": 0.203, "d22": null, "d64": null, "eta": 167.101, "theta": -153.424, "eta_prime": 178.477, "theta_prime": -145.372, "eta_base": -126.927, "theta_base": -131.068, "v0": 26.521, "v1": -42.556, "v2": 41.715, "v3": -27.415, "v4": 0.824, "amplitude": 43.775, "phase_angle": 342.355, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "33m", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.105, "frame": { "rmsd": 0.008, "origin": [ -58.628, 10.312, -17.934 ], "x_axis": [ 0.899, -0.173, 0.401 ], "y_axis": [ -0.323, -0.882, 0.343 ], "z_axis": [ 0.294, -0.438, -0.849 ], "quaternion": [ 0.205, 0.953, -0.130, 0.182 ] } }, { "index": 42, "index_chain": 42, "chain_name": "A", "nt_resnum": 42, "nt_name": "G", "nt_code": "G", "nt_id": "///A/42", "linked_nts": [ "///A/41", "///A/43" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -57.270, "beta": 162.105, "gamma": 58.102, "delta": 83.154, "epsilon": -156.591, "zeta": -80.784, "epsilon_zeta": -75.807, "bb_type": "BI", "chi": -170.120, "glyco_bond": "anti", "C5prime_xyz": [ -1.907, 8.793, 0.929 ], "P_xyz": [ 0.621, 9.491, 0.978 ], "form": "A", "ssZp": 4.491, "Dp": 4.566, "splay_angle": 22.329, "splay_distance": 3.514, "splay_ratio": 0.197, "d22": null, "d64": null, "eta": 168.763, "theta": -152.104, "eta_prime": -169.488, "theta_prime": -152.879, "eta_base": -142.449, "theta_base": -123.471, "v0": -3.214, "v1": -23.173, "v2": 39.150, "v3": -41.685, "v4": 28.251, "amplitude": 42.384, "phase_angle": 22.528, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.284, "filter_rmsd": 0.012, "frame": { "rmsd": 0.012, "origin": [ -56.661, 10.806, -20.997 ], "x_axis": [ 0.705, -0.414, 0.576 ], "y_axis": [ -0.585, -0.799, 0.141 ], "z_axis": [ 0.402, -0.437, -0.805 ], "quaternion": [ 0.159, 0.909, -0.275, 0.269 ] } }, { "index": 43, "index_chain": 43, "chain_name": "A", "nt_resnum": 43, "nt_name": "G", "nt_code": "G", "nt_id": "///A/43", "linked_nts": [ "///A/42", "///A/44" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack", "alpha": -53.098, "beta": 168.487, "gamma": 51.396, "delta": 83.827, "epsilon": -151.222, "zeta": -77.882, "epsilon_zeta": -73.340, "bb_type": "BI", "chi": -159.837, "glyco_bond": "anti", "C5prime_xyz": [ -1.454, 8.762, 0.559 ], "P_xyz": [ 1.113, 9.135, 0.917 ], "form": "A", "ssZp": 4.234, "Dp": 4.498, "splay_angle": 20.221, "splay_distance": 3.196, "splay_ratio": 0.176, "d22": null, "d64": null, "eta": 178.837, "theta": -150.363, "eta_prime": -169.489, "theta_prime": -149.697, "eta_base": -128.188, "theta_base": -121.311, "v0": 1.417, "v1": -24.797, "v2": 37.556, "v3": -37.747, "v4": 23.049, "amplitude": 39.201, "phase_angle": 16.657, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.808, "filter_rmsd": 0.011, "frame": { "rmsd": 0.011, "origin": [ -53.915, 10.390, -23.150 ], "x_axis": [ 0.258, -0.817, 0.517 ], "y_axis": [ -0.861, -0.437, -0.262 ], "z_axis": [ 0.439, -0.377, -0.815 ], "quaternion": [ 0.036, 0.792, -0.529, 0.302 ] } }, { "index": 44, "index_chain": 44, "chain_name": "A", "nt_resnum": 44, "nt_name": "A", "nt_code": "A", "nt_id": "///A/44", "linked_nts": [ "///A/43", null ], "nt_type": "RNA", "dbn": ".", "is_broken": true, "summary": "break,anti,~C3'-endo,non-canonical,non-pair-contact,helix,ss-non-loop", "alpha": -71.649, "beta": 156.344, "gamma": 70.033, "delta": 84.072, "epsilon": -129.507, "zeta": -70.035, "epsilon_zeta": -59.472, "bb_type": "--", "chi": -158.407, "glyco_bond": "anti", "C5prime_xyz": [ -1.351, 8.715, 0.350 ], "P_xyz": [ 1.164, 8.944, -0.301 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": -0.343, "v1": -24.340, "v2": 38.498, "v3": -39.731, "v4": 25.172, "amplitude": 40.728, "phase_angle": 19.047, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.497, "filter_rmsd": 0.037, "frame": { "rmsd": 0.007, "origin": [ -51.824, 9.282, -25.298 ], "x_axis": [ -0.144, -0.970, 0.198 ], "y_axis": [ -0.798, -0.004, -0.603 ], "z_axis": [ 0.586, -0.245, -0.773 ], "quaternion": [ 0.140, -0.639, 0.692, -0.307 ] } }, { "index": 45, "index_chain": 45, "chain_name": "A", "nt_resnum": 45, "nt_name": "G", "nt_code": "G", "nt_id": "///A/45", "linked_nts": [ null, "///A/46" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-canonical,non-pair-contact,multiplet,ss-non-loop", "alpha": -48.378, "beta": 177.878, "gamma": 48.018, "delta": 89.534, "epsilon": -128.044, "zeta": -84.025, "epsilon_zeta": -44.019, "bb_type": "--", "chi": -150.882, "glyco_bond": "anti", "C5prime_xyz": [ -1.275, 8.769, 0.086 ], "P_xyz": [ 1.307, 9.111, 0.301 ], "form": ".", "ssZp": 3.951, "Dp": 4.563, "splay_angle": 41.239, "splay_distance": 6.729, "splay_ratio": 0.352, "d22": null, "d64": null, "eta": null, "theta": -141.524, "eta_prime": null, "theta_prime": -127.594, "eta_base": null, "theta_base": -132.209, "v0": 0.620, "v1": -23.468, "v2": 36.080, "v3": -36.501, "v4": 22.728, "amplitude": 37.844, "phase_angle": 17.561, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.014, "frame": { "rmsd": 0.014, "origin": [ -51.790, 4.754, -26.411 ], "x_axis": [ -0.901, -0.428, -0.074 ], "y_axis": [ -0.232, 0.618, -0.751 ], "z_axis": [ 0.367, -0.660, -0.656 ], "quaternion": [ 0.124, -0.185, 0.891, -0.396 ] } }, { "index": 46, "index_chain": 46, "chain_name": "A", "nt_resnum": 46, "nt_name": "7MG", "nt_code": "g", "is_modified": true, "nt_id": "///A/46", "linked_nts": [ "///A/45", "///A/47" ], "nt_type": "RNA", "dbn": ".", "summary": "modified,~C2'-endo,non-canonical,non-pair-contact,multiplet,ss-non-loop,splayed-apart", "alpha": -52.817, "beta": -145.547, "gamma": 42.768, "delta": 146.805, "epsilon": -99.072, "zeta": -134.840, "epsilon_zeta": 35.767, "bb_type": "--", "chi": -63.456, "glyco_bond": "--", "C5prime_xyz": [ -3.604, 6.659, -2.930 ], "P_xyz": [ -1.980, 8.369, -4.029 ], "form": ".", "ssZp": 0.554, "Dp": 0.873, "splay_angle": 139.654, "splay_distance": 18.656, "splay_ratio": 0.939, "d22": null, "d64": null, "eta": -143.207, "theta": -106.990, "eta_prime": -134.028, "theta_prime": -148.192, "eta_base": -149.081, "theta_base": -165.676, "v0": -25.306, "v1": 40.059, "v2": -38.767, "v3": 24.949, "v4": 0.007, "amplitude": 40.931, "phase_angle": 161.284, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1[", "suiteness": 0.609, "filter_rmsd": 0.043, "frame": { "rmsd": 0.043, "origin": [ -49.097, 0.154, -30.518 ], "x_axis": [ -0.939, -0.342, 0.021 ], "y_axis": [ -0.211, 0.529, -0.822 ], "z_axis": [ 0.270, -0.776, -0.570 ], "quaternion": [ 0.071, -0.159, 0.872, -0.458 ] } }, { "index": 47, "index_chain": 47, "chain_name": "A", "nt_resnum": 47, "nt_name": "U", "nt_code": "U", "nt_id": "///A/47", "linked_nts": [ "///A/46", "///A/48" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,anti,~C2'-endo,non-stack,non-pair-contact,ss-non-loop,splayed-apart", "alpha": 43.967, "beta": -157.806, "gamma": 52.819, "delta": 148.410, "epsilon": -87.471, "zeta": -80.127, "epsilon_zeta": -7.345, "bb_type": "--", "chi": -115.941, "glyco_bond": "anti", "C5prime_xyz": [ -2.017, 8.452, -1.283 ], "P_xyz": [ 0.198, 9.563, -0.408 ], "form": ".", "ssZp": 0.790, "Dp": 0.727, "splay_angle": 158.862, "splay_distance": 19.580, "splay_ratio": 0.983, "d22": 12.251, "d64": 15.646, "eta": -35.912, "theta": -50.145, "eta_prime": 2.348, "theta_prime": -86.304, "eta_base": 27.483, "theta_base": -101.379, "v0": -21.969, "v1": 37.930, "v2": -38.885, "v3": 27.109, "v4": -3.422, "amplitude": 40.039, "phase_angle": 166.213, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "4p", "suiteness": 0.389, "filter_rmsd": 0.106, "frame": { "rmsd": 0.009, "origin": [ -39.091, 5.758, -45.233 ], "x_axis": [ 0.310, 0.922, 0.231 ], "y_axis": [ -0.618, 0.011, 0.786 ], "z_axis": [ 0.722, -0.386, 0.574 ], "quaternion": [ 0.688, 0.426, 0.179, 0.560 ] } }, { "index": 48, "index_chain": 48, "chain_name": "A", "nt_resnum": 48, "nt_name": "C", "nt_code": "C", "nt_id": "///A/48", "linked_nts": [ "///A/47", "///A/49" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,anti,~C2'-endo,non-canonical,non-pair-contact,helix-end,ss-non-loop,cap-acceptor,splayed-apart", "alpha": -65.889, "beta": -175.272, "gamma": 153.198, "delta": 138.424, "epsilon": -141.705, "zeta": 80.015, "epsilon_zeta": 138.281, "bb_type": "--", "chi": -143.043, "glyco_bond": "anti", "C5prime_xyz": [ -1.827, 8.875, -0.095 ], "P_xyz": [ 0.367, 9.837, -1.068 ], "form": ".", "ssZp": 1.759, "Dp": 1.762, "splay_angle": 147.615, "splay_distance": 17.861, "splay_ratio": 0.960, "d22": 11.424, "d64": 13.920, "eta": -84.575, "theta": 51.204, "eta_prime": -32.244, "theta_prime": 16.015, "eta_base": -7.458, "theta_base": -101.715, "v0": -28.736, "v1": 39.872, "v2": -35.699, "v3": 19.612, "v4": 5.561, "amplitude": 39.858, "phase_angle": 153.593, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22t", "cluster": "2u", "suiteness": 0.027, "filter_rmsd": 0.070, "frame": { "rmsd": 0.013, "origin": [ -48.343, -6.196, -32.787 ], "x_axis": [ -0.883, -0.036, -0.468 ], "y_axis": [ 0.369, 0.563, -0.740 ], "z_axis": [ 0.290, -0.826, -0.484 ], "quaternion": [ 0.222, 0.097, 0.856, -0.457 ] } }, { "index": 49, "index_chain": 49, "chain_name": "A", "nt_resnum": 49, "nt_name": "5MC", "nt_code": "c", "is_modified": true, "nt_id": "///A/49", "linked_nts": [ "///A/48", "///A/50" ], "nt_type": "RNA", "dbn": "(", "summary": "modified,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,phosphate,splayed-apart", "alpha": 50.283, "beta": 172.672, "gamma": 40.692, "delta": 84.734, "epsilon": -152.817, "zeta": -77.294, "epsilon_zeta": -75.523, "bb_type": "BI", "chi": -172.254, "glyco_bond": "anti", "C5prime_xyz": [ -1.307, 8.515, 1.369 ], "P_xyz": [ 1.240, 8.470, 2.098 ], "form": "A", "ssZp": 4.688, "Dp": 4.622, "splay_angle": 25.481, "splay_distance": 3.974, "splay_ratio": 0.225, "d22": 4.709, "d64": 4.842, "eta": -56.991, "theta": -144.914, "eta_prime": -35.022, "theta_prime": -143.011, "eta_base": 97.156, "theta_base": -126.472, "v0": 5.744, "v1": -30.275, "v2": 42.296, "v3": -39.660, "v4": 21.142, "amplitude": 43.056, "phase_angle": 10.780, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "6d", "suiteness": 0.478, "filter_rmsd": 0.063, "frame": { "rmsd": 0.016, "origin": [ -32.960, -4.840, -41.762 ], "x_axis": [ -0.053, -0.895, 0.442 ], "y_axis": [ -0.599, 0.383, 0.703 ], "z_axis": [ -0.799, -0.228, -0.556 ], "quaternion": [ -0.440, -0.529, 0.706, 0.169 ] } }, { "index": 50, "index_chain": 50, "chain_name": "A", "nt_resnum": 50, "nt_name": "U", "nt_code": "U", "nt_id": "///A/50", "linked_nts": [ "///A/49", "///A/51" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -48.271, "beta": 177.239, "gamma": 37.077, "delta": 84.995, "epsilon": -149.624, "zeta": -79.820, "epsilon_zeta": -69.804, "bb_type": "BI", "chi": -165.167, "glyco_bond": "anti", "C5prime_xyz": [ -1.332, 8.630, 0.653 ], "P_xyz": [ 1.154, 9.050, 1.424 ], "form": "A", "ssZp": 4.368, "Dp": 4.678, "splay_angle": 23.289, "splay_distance": 3.622, "splay_ratio": 0.204, "d22": null, "d64": null, "eta": 173.448, "theta": -148.581, "eta_prime": -178.190, "theta_prime": -144.837, "eta_base": -149.382, "theta_base": -115.133, "v0": 7.755, "v1": -32.592, "v2": 43.413, "v3": -39.791, "v4": 20.292, "amplitude": 43.884, "phase_angle": 8.403, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.454, "filter_rmsd": 0.101, "frame": { "rmsd": 0.015, "origin": [ -34.284, -6.566, -45.088 ], "x_axis": [ -0.224, -0.558, 0.799 ], "y_axis": [ -0.510, 0.766, 0.392 ], "z_axis": [ -0.831, -0.319, -0.456 ], "quaternion": [ 0.521, 0.341, -0.782, -0.023 ] } }, { "index": 51, "index_chain": 51, "chain_name": "A", "nt_resnum": 51, "nt_name": "G", "nt_code": "G", "nt_id": "///A/51", "linked_nts": [ "///A/50", "///A/52" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -41.510, "beta": 174.457, "gamma": 30.779, "delta": 87.158, "epsilon": -154.719, "zeta": -72.904, "epsilon_zeta": -81.815, "bb_type": "BI", "chi": -154.727, "glyco_bond": "anti", "C5prime_xyz": [ -1.128, 8.658, 0.350 ], "P_xyz": [ 1.433, 9.006, 0.705 ], "form": "A", "ssZp": 4.527, "Dp": 4.685, "splay_angle": 22.127, "splay_distance": 3.526, "splay_ratio": 0.194, "d22": null, "d64": null, "eta": 171.332, "theta": -147.068, "eta_prime": -176.612, "theta_prime": -145.623, "eta_base": -135.574, "theta_base": -124.410, "v0": 8.529, "v1": -28.964, "v2": 36.872, "v3": -32.978, "v4": 15.507, "amplitude": 37.044, "phase_angle": 5.533, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.164, "filter_rmsd": 0.011, "frame": { "rmsd": 0.011, "origin": [ -36.457, -9.188, -46.323 ], "x_axis": [ -0.485, -0.025, 0.874 ], "y_axis": [ -0.331, 0.931, -0.157 ], "z_axis": [ -0.810, -0.365, -0.460 ], "quaternion": [ -0.497, -0.105, 0.848, -0.154 ] } }, { "index": 52, "index_chain": 52, "chain_name": "A", "nt_resnum": 52, "nt_name": "U", "nt_code": "U", "nt_id": "///A/52", "linked_nts": [ "///A/51", "///A/53" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -62.979, "beta": 167.030, "gamma": 50.684, "delta": 81.201, "epsilon": -159.982, "zeta": -66.509, "epsilon_zeta": -93.473, "bb_type": "BI", "chi": -167.687, "glyco_bond": "anti", "C5prime_xyz": [ -1.542, 8.689, 0.943 ], "P_xyz": [ 0.978, 9.262, 0.820 ], "form": "A", "ssZp": 4.701, "Dp": 4.663, "splay_angle": 25.180, "splay_distance": 4.047, "splay_ratio": 0.227, "d22": null, "d64": null, "eta": 163.322, "theta": -143.592, "eta_prime": 179.155, "theta_prime": -143.028, "eta_base": -141.750, "theta_base": -114.003, "v0": -2.707, "v1": -25.897, "v2": 42.988, "v3": -45.359, "v4": 30.260, "amplitude": 46.240, "phase_angle": 21.618, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.880, "filter_rmsd": 0.103, "frame": { "rmsd": 0.014, "origin": [ -38.929, -11.673, -46.706 ], "x_axis": [ -0.510, 0.425, 0.748 ], "y_axis": [ -0.144, 0.815, -0.561 ], "z_axis": [ -0.848, -0.394, -0.354 ], "quaternion": [ -0.488, 0.086, 0.818, -0.292 ] } }, { "index": 53, "index_chain": 53, "chain_name": "A", "nt_resnum": 53, "nt_name": "G", "nt_code": "G", "nt_id": "///A/53", "linked_nts": [ "///A/52", "///A/54" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop,kissing-loop", "alpha": -59.503, "beta": 173.016, "gamma": 53.957, "delta": 83.311, "epsilon": -166.952, "zeta": -60.414, "epsilon_zeta": -106.538, "bb_type": "BI", "chi": -173.258, "glyco_bond": "anti", "C5prime_xyz": [ -1.714, 8.738, 1.134 ], "P_xyz": [ 0.803, 9.330, 1.565 ], "form": "A", "ssZp": 4.562, "Dp": 4.548, "splay_angle": 23.874, "splay_distance": 3.765, "splay_ratio": 0.212, "d22": null, "d64": null, "eta": 172.256, "theta": -142.327, "eta_prime": -169.571, "theta_prime": -141.832, "eta_base": -120.556, "theta_base": -108.354, "v0": -7.869, "v1": -18.387, "v2": 35.872, "v3": -40.988, "v4": 30.752, "amplitude": 41.018, "phase_angle": 29.010, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.883, "filter_rmsd": 0.015, "frame": { "rmsd": 0.015, "origin": [ -42.305, -13.362, -45.249 ], "x_axis": [ -0.409, 0.854, 0.323 ], "y_axis": [ 0.155, 0.413, -0.897 ], "z_axis": [ -0.899, -0.316, -0.302 ], "quaternion": [ -0.419, 0.346, 0.729, -0.416 ] } }, { "index": 54, "index_chain": 54, "chain_name": "A", "nt_resnum": 54, "nt_name": "5MU", "nt_code": "t", "is_modified": true, "nt_id": "///A/54", "linked_nts": [ "///A/53", "///A/55" ], "nt_type": "RNA", "dbn": ".", "summary": "modified,anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,hairpin-loop,kissing-loop", "alpha": -85.619, "beta": -167.594, "gamma": 58.108, "delta": 79.959, "epsilon": -136.017, "zeta": -68.646, "epsilon_zeta": -67.370, "bb_type": "BI", "chi": -156.090, "glyco_bond": "anti", "C5prime_xyz": [ -1.529, 8.743, 0.227 ], "P_xyz": [ 1.022, 9.238, 0.409 ], "form": ".", "ssZp": 4.263, "Dp": 4.774, "splay_angle": 30.790, "splay_distance": 4.911, "splay_ratio": 0.266, "d22": null, "d64": null, "eta": 171.093, "theta": -129.086, "eta_prime": -177.297, "theta_prime": -123.508, "eta_base": -131.135, "theta_base": -81.808, "v0": 1.108, "v1": -26.916, "v2": 41.123, "v3": -41.382, "v4": 25.443, "amplitude": 43.012, "phase_angle": 17.043, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.488, "filter_rmsd": 0.109, "frame": { "rmsd": 0.011, "origin": [ -45.961, -13.638, -44.389 ], "x_axis": [ -0.278, 0.896, -0.347 ], "y_axis": [ 0.286, -0.267, -0.920 ], "z_axis": [ -0.917, -0.355, -0.182 ], "quaternion": [ 0.261, -0.541, -0.546, 0.584 ] } }, { "index": 55, "index_chain": 55, "chain_name": "A", "nt_resnum": 55, "nt_name": "PSU", "nt_code": "P", "is_modified": true, "nt_id": "///A/55", "linked_nts": [ "///A/54", "///A/56" ], "nt_type": "RNA", "dbn": ".", "summary": "modified,u-turn,anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,hairpin-loop,kissing-loop,cap-acceptor", "alpha": -53.870, "beta": 170.128, "gamma": 44.348, "delta": 79.649, "epsilon": -142.163, "zeta": -71.794, "epsilon_zeta": -70.369, "bb_type": "BI", "chi": -153.260, "glyco_bond": "anti", "C5prime_xyz": [ -1.625, 8.788, 0.276 ], "P_xyz": [ 0.958, 9.325, -0.030 ], "form": ".", "ssZp": 4.389, "Dp": 4.681, "splay_angle": 70.386, "splay_distance": 10.519, "splay_ratio": 0.576, "d22": null, "d64": null, "eta": 166.950, "theta": -115.334, "eta_prime": -173.292, "theta_prime": -155.041, "eta_base": -116.465, "theta_base": 145.199, "v0": 0.834, "v1": -26.198, "v2": 40.317, "v3": -40.618, "v4": 25.292, "amplitude": 42.250, "phase_angle": 17.397, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.749, "filter_rmsd": 0.099, "frame": { "rmsd": 0.019, "origin": [ -49.546, -11.420, -46.909 ], "x_axis": [ 0.218, 0.457, -0.862 ], "y_axis": [ 0.243, -0.881, -0.406 ], "z_axis": [ -0.945, -0.120, -0.303 ], "quaternion": [ -0.092, 0.775, 0.226, -0.583 ] } }, { "index": 56, "index_chain": 56, "chain_name": "A", "nt_resnum": 56, "nt_name": "C", "nt_code": "C", "nt_id": "///A/56", "linked_nts": [ "///A/55", "///A/57" ], "nt_type": "RNA", "dbn": "]", "summary": "pseudoknotted,turn,u-turn,anti,~C3'-endo,BI,isolated-canonical,non-pair-contact,helix-end,hairpin-loop,kissing-loop", "alpha": 167.227, "beta": 175.207, "gamma": 46.908, "delta": 85.973, "epsilon": -136.647, "zeta": -66.188, "epsilon_zeta": -70.458, "bb_type": "BI", "chi": -163.957, "glyco_bond": "anti", "C5prime_xyz": [ -1.258, 8.650, 0.673 ], "P_xyz": [ 1.281, 8.971, 1.113 ], "form": "A", "ssZp": 4.383, "Dp": 4.724, "splay_angle": 27.220, "splay_distance": 4.390, "splay_ratio": 0.236, "d22": null, "d64": null, "eta": 31.780, "theta": -127.435, "eta_prime": 50.959, "theta_prime": -124.396, "eta_base": 25.102, "theta_base": -86.645, "v0": 3.408, "v1": -26.888, "v2": 38.507, "v3": -37.824, "v4": 21.665, "amplitude": 39.658, "phase_angle": 13.838, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1g", "suiteness": 0.867, "filter_rmsd": 0.060, "frame": { "rmsd": 0.012, "origin": [ -56.209, -17.832, -41.896 ], "x_axis": [ 0.578, -0.759, 0.301 ], "y_axis": [ 0.270, -0.170, -0.948 ], "z_axis": [ 0.770, 0.629, 0.107 ], "quaternion": [ 0.616, -0.640, 0.191, -0.418 ] } }, { "index": 57, "index_chain": 57, "chain_name": "A", "nt_resnum": 57, "nt_name": "G", "nt_code": "G", "nt_id": "///A/57", "linked_nts": [ "///A/56", "///A/58" ], "nt_type": "RNA", "dbn": ".", "summary": "u-turn,anti,~C3'-endo,BI,non-pair-contact,hairpin-loop,kissing-loop,cap-donor,phosphate", "alpha": -65.660, "beta": 167.465, "gamma": 55.958, "delta": 81.637, "epsilon": -145.577, "zeta": -66.342, "epsilon_zeta": -79.235, "bb_type": "BI", "chi": -159.877, "glyco_bond": "anti", "C5prime_xyz": [ -1.539, 8.827, 0.403 ], "P_xyz": [ 0.987, 9.436, 0.522 ], "form": ".", "ssZp": 4.141, "Dp": 4.586, "splay_angle": 42.995, "splay_distance": 6.772, "splay_ratio": 0.367, "d22": null, "d64": null, "eta": 165.301, "theta": -140.375, "eta_prime": -173.089, "theta_prime": -129.625, "eta_base": -117.778, "theta_base": -110.322, "v0": 1.596, "v1": -26.252, "v2": 39.338, "v3": -39.712, "v4": 23.861, "amplitude": 41.015, "phase_angle": 16.440, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.874, "filter_rmsd": 0.022, "frame": { "rmsd": 0.022, "origin": [ -52.034, -17.848, -40.538 ], "x_axis": [ 0.382, -0.801, -0.462 ], "y_axis": [ -0.133, 0.447, -0.885 ], "z_axis": [ 0.915, 0.399, 0.064 ], "quaternion": [ 0.688, -0.467, 0.500, -0.243 ] } }, { "index": 58, "index_chain": 58, "chain_name": "A", "nt_resnum": 58, "nt_name": "1MA", "nt_code": "a", "is_modified": true, "nt_id": "///A/58", "linked_nts": [ "///A/57", "///A/59" ], "nt_type": "RNA", "dbn": ".", "summary": "modified,u-turn,anti,~C2'-endo,BII,non-canonical,non-pair-contact,helix,hairpin-loop,kissing-loop,phosphate", "alpha": -60.644, "beta": -150.723, "gamma": 69.149, "delta": 155.682, "epsilon": -81.626, "zeta": -163.170, "epsilon_zeta": 81.545, "bb_type": "BII", "chi": -85.189, "glyco_bond": "anti", "C5prime_xyz": [ -2.873, 7.792, -2.399 ], "P_xyz": [ -0.542, 8.888, -2.869 ], "form": ".", "ssZp": 0.892, "Dp": 0.620, "splay_angle": 73.484, "splay_distance": 11.505, "splay_ratio": 0.599, "d22": null, "d64": null, "eta": -132.994, "theta": -112.365, "eta_prime": -106.930, "theta_prime": -172.812, "eta_base": -103.434, "theta_base": 157.296, "v0": -23.889, "v1": 43.416, "v2": -44.739, "v3": 31.708, "v4": -5.089, "amplitude": 45.824, "phase_angle": 167.507, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1[", "suiteness": 0.429, "filter_rmsd": 0.057, "frame": { "rmsd": 0.048, "origin": [ -45.359, -16.799, -40.976 ], "x_axis": [ 0.308, -0.433, -0.847 ], "y_axis": [ -0.257, 0.820, -0.512 ], "z_axis": [ 0.916, 0.375, 0.141 ], "quaternion": [ 0.753, -0.294, 0.586, -0.058 ] } }, { "index": 59, "index_chain": 59, "chain_name": "A", "nt_resnum": 59, "nt_name": "U", "nt_code": "U", "nt_id": "///A/59", "linked_nts": [ "///A/58", "///A/60" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,anti,~C3'-endo,BI,non-pair-contact,hairpin-loop,kissing-loop,cap-donor", "alpha": 71.687, "beta": -158.198, "gamma": 66.716, "delta": 86.406, "epsilon": -149.818, "zeta": -54.945, "epsilon_zeta": -94.873, "bb_type": "BI", "chi": -168.597, "glyco_bond": "anti", "C5prime_xyz": [ -1.956, 8.699, 1.060 ], "P_xyz": [ 0.456, 9.143, 2.027 ], "form": ".", "ssZp": 4.524, "Dp": 4.408, "splay_angle": 28.331, "splay_distance": 4.499, "splay_ratio": 0.245, "d22": 4.053, "d64": 3.452, "eta": 2.484, "theta": -120.039, "eta_prime": 28.613, "theta_prime": -110.591, "eta_base": 48.836, "theta_base": -55.994, "v0": -5.690, "v1": -16.478, "v2": 30.728, "v3": -34.872, "v4": 25.724, "amplitude": 34.729, "phase_angle": 27.775, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "4d", "suiteness": 0.487, "filter_rmsd": 0.106, "frame": { "rmsd": 0.012, "origin": [ -46.459, -10.783, -31.231 ], "x_axis": [ -0.978, -0.187, 0.093 ], "y_axis": [ -0.183, 0.549, -0.816 ], "z_axis": [ 0.101, -0.815, -0.571 ], "quaternion": [ 0.002, -0.105, 0.880, -0.463 ] } }, { "index": 60, "index_chain": 60, "chain_name": "A", "nt_resnum": 60, "nt_name": "C", "nt_code": "C", "nt_id": "///A/60", "linked_nts": [ "///A/59", "///A/61" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C2'-endo,non-pair-contact,hairpin-loop,kissing-loop,phosphate,splayed-apart", "alpha": -71.809, "beta": -178.605, "gamma": 63.240, "delta": 150.947, "epsilon": -94.709, "zeta": -69.361, "epsilon_zeta": -25.348, "bb_type": "--", "chi": -115.432, "glyco_bond": "anti", "C5prime_xyz": [ -2.122, 8.532, -1.317 ], "P_xyz": [ 0.423, 9.214, -1.005 ], "form": ".", "ssZp": 1.115, "Dp": 0.911, "splay_angle": 89.908, "splay_distance": 13.717, "splay_ratio": 0.707, "d22": 6.255, "d64": 7.117, "eta": -173.377, "theta": -37.068, "eta_prime": -131.305, "theta_prime": -67.785, "eta_base": -69.251, "theta_base": -35.589, "v0": -27.378, "v1": 42.649, "v2": -41.031, "v3": 25.874, "v4": 1.028, "amplitude": 43.578, "phase_angle": 160.314, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1b", "suiteness": 0.682, "filter_rmsd": 0.064, "frame": { "rmsd": 0.011, "origin": [ -49.757, -12.701, -33.616 ], "x_axis": [ -0.672, 0.484, -0.561 ], "y_axis": [ 0.703, 0.179, -0.688 ], "z_axis": [ -0.233, -0.857, -0.460 ], "quaternion": [ 0.108, 0.391, 0.760, -0.508 ] } }, { "index": 61, "index_chain": 61, "chain_name": "A", "nt_resnum": 61, "nt_name": "C", "nt_code": "C", "nt_id": "///A/61", "linked_nts": [ "///A/60", "///A/62" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop,kissing-loop,splayed-apart", "alpha": -82.045, "beta": 179.250, "gamma": 33.902, "delta": 83.103, "epsilon": -157.340, "zeta": -70.003, "epsilon_zeta": -87.337, "bb_type": "BI", "chi": -169.949, "glyco_bond": "anti", "C5prime_xyz": [ -1.373, 8.677, 1.069 ], "P_xyz": [ 0.929, 9.040, 2.297 ], "form": "A", "ssZp": 4.471, "Dp": 4.518, "splay_angle": 25.832, "splay_distance": 4.024, "splay_ratio": 0.224, "d22": null, "d64": null, "eta": 119.145, "theta": -150.477, "eta_prime": 166.552, "theta_prime": -144.576, "eta_base": -158.314, "theta_base": -118.745, "v0": 2.654, "v1": -26.071, "v2": 38.241, "v3": -37.398, "v4": 22.062, "amplitude": 39.523, "phase_angle": 14.636, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "2a", "suiteness": 0.384, "filter_rmsd": 0.064, "frame": { "rmsd": 0.005, "origin": [ -42.586, -13.059, -45.303 ], "x_axis": [ -0.305, 0.876, 0.374 ], "y_axis": [ 0.030, -0.384, 0.923 ], "z_axis": [ 0.952, 0.293, 0.091 ], "quaternion": [ 0.317, 0.497, 0.456, 0.667 ] } }, { "index": 62, "index_chain": 62, "chain_name": "A", "nt_resnum": 62, "nt_name": "A", "nt_code": "A", "nt_id": "///A/62", "linked_nts": [ "///A/61", "///A/63" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -73.074, "beta": -172.947, "gamma": 51.513, "delta": 82.972, "epsilon": -157.373, "zeta": -67.650, "epsilon_zeta": -89.723, "bb_type": "BI", "chi": -161.787, "glyco_bond": "anti", "C5prime_xyz": [ -1.348, 8.664, 0.448 ], "P_xyz": [ 1.135, 8.958, 1.250 ], "form": "A", "ssZp": 4.080, "Dp": 4.576, "splay_angle": 21.496, "splay_distance": 3.396, "splay_ratio": 0.187, "d22": null, "d64": null, "eta": 171.396, "theta": -146.801, "eta_prime": -177.647, "theta_prime": -145.174, "eta_base": -144.098, "theta_base": -121.222, "v0": 6.605, "v1": -31.386, "v2": 43.287, "v3": -40.053, "v4": 21.231, "amplitude": 43.943, "phase_angle": 9.917, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.854, "filter_rmsd": 0.042, "frame": { "rmsd": 0.022, "origin": [ -39.135, -11.266, -46.341 ], "x_axis": [ -0.410, 0.475, 0.779 ], "y_axis": [ 0.161, -0.803, 0.574 ], "z_axis": [ 0.898, 0.360, 0.253 ], "quaternion": [ 0.100, 0.534, 0.298, 0.785 ] } }, { "index": 63, "index_chain": 63, "chain_name": "A", "nt_resnum": 63, "nt_name": "C", "nt_code": "C", "nt_id": "///A/63", "linked_nts": [ "///A/62", "///A/64" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -81.608, "beta": 175.479, "gamma": 62.732, "delta": 82.499, "epsilon": -150.520, "zeta": -75.713, "epsilon_zeta": -74.806, "bb_type": "BI", "chi": -157.199, "glyco_bond": "anti", "C5prime_xyz": [ -1.332, 8.787, 0.330 ], "P_xyz": [ 1.223, 9.131, 0.096 ], "form": "A", "ssZp": 4.375, "Dp": 4.651, "splay_angle": 23.050, "splay_distance": 3.659, "splay_ratio": 0.200, "d22": null, "d64": null, "eta": 164.640, "theta": -147.536, "eta_prime": 177.424, "theta_prime": -150.304, "eta_base": -145.528, "theta_base": -131.642, "v0": 3.598, "v1": -29.306, "v2": 42.386, "v3": -41.204, "v4": 23.823, "amplitude": 43.652, "phase_angle": 13.834, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.670, "filter_rmsd": 0.067, "frame": { "rmsd": 0.009, "origin": [ -36.595, -9.032, -46.048 ], "x_axis": [ -0.261, 0.001, 0.965 ], "y_axis": [ 0.426, -0.897, 0.116 ], "z_axis": [ 0.866, 0.442, 0.233 ], "quaternion": [ -0.137, 0.592, 0.181, 0.773 ] } }, { "index": 64, "index_chain": 64, "chain_name": "A", "nt_resnum": 64, "nt_name": "A", "nt_code": "A", "nt_id": "///A/64", "linked_nts": [ "///A/63", "///A/65" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -56.688, "beta": 176.060, "gamma": 38.067, "delta": 76.962, "epsilon": -146.098, "zeta": -75.737, "epsilon_zeta": -70.360, "bb_type": "BI", "chi": -160.758, "glyco_bond": "anti", "C5prime_xyz": [ -1.299, 8.631, 0.513 ], "P_xyz": [ 1.223, 9.170, 0.662 ], "form": "A", "ssZp": 4.529, "Dp": 4.818, "splay_angle": 24.200, "splay_distance": 3.891, "splay_ratio": 0.216, "d22": null, "d64": null, "eta": 163.958, "theta": -147.556, "eta_prime": 172.178, "theta_prime": -143.962, "eta_base": -154.031, "theta_base": -118.327, "v0": 4.740, "v1": -30.564, "v2": 43.242, "v3": -41.584, "v4": 23.369, "amplitude": 44.302, "phase_angle": 12.559, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.568, "filter_rmsd": 0.039, "frame": { "rmsd": 0.015, "origin": [ -34.351, -6.405, -44.844 ], "x_axis": [ -0.163, -0.488, 0.857 ], "y_axis": [ 0.548, -0.768, -0.333 ], "z_axis": [ 0.821, 0.415, 0.393 ], "quaternion": [ -0.340, 0.550, 0.027, 0.762 ] } }, { "index": 65, "index_chain": 65, "chain_name": "A", "nt_resnum": 65, "nt_name": "G", "nt_code": "G", "nt_id": "///A/65", "linked_nts": [ "///A/64", "///A/66" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack", "alpha": -41.430, "beta": 157.807, "gamma": 48.059, "delta": 79.897, "epsilon": -154.734, "zeta": -74.483, "epsilon_zeta": -80.251, "bb_type": "BI", "chi": -172.544, "glyco_bond": "anti", "C5prime_xyz": [ -1.650, 8.724, 1.049 ], "P_xyz": [ 0.868, 9.391, 1.037 ], "form": "A", "ssZp": 4.677, "Dp": 4.692, "splay_angle": 24.583, "splay_distance": 3.847, "splay_ratio": 0.218, "d22": null, "d64": null, "eta": 171.664, "theta": -150.870, "eta_prime": -171.154, "theta_prime": -148.968, "eta_base": -128.356, "theta_base": -119.870, "v0": -1.356, "v1": -26.264, "v2": 41.898, "v3": -43.751, "v4": 28.451, "amplitude": 44.627, "phase_angle": 20.141, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.497, "filter_rmsd": 0.017, "frame": { "rmsd": 0.017, "origin": [ -33.064, -4.824, -41.530 ], "x_axis": [ 0.025, -0.844, 0.536 ], "y_axis": [ 0.609, -0.412, -0.677 ], "z_axis": [ 0.792, 0.344, 0.504 ], "quaternion": [ 0.528, -0.483, 0.121, -0.688 ] } }, { "index": 66, "index_chain": 66, "chain_name": "A", "nt_resnum": 66, "nt_name": "A", "nt_code": "A", "nt_id": "///A/66", "linked_nts": [ "///A/65", "///A/67" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack", "alpha": -65.700, "beta": 175.237, "gamma": 58.872, "delta": 80.259, "epsilon": -148.088, "zeta": -74.382, "epsilon_zeta": -73.706, "bb_type": "BI", "chi": -166.201, "glyco_bond": "anti", "C5prime_xyz": [ -1.403, 8.727, 0.774 ], "P_xyz": [ 1.156, 9.106, 1.106 ], "form": "A", "ssZp": 4.404, "Dp": 4.610, "splay_angle": 22.310, "splay_distance": 3.474, "splay_ratio": 0.194, "d22": null, "d64": null, "eta": 176.298, "theta": -146.178, "eta_prime": -171.309, "theta_prime": -143.357, "eta_base": -130.175, "theta_base": -109.689, "v0": -0.324, "v1": -25.706, "v2": 40.737, "v3": -41.677, "v4": 26.598, "amplitude": 43.055, "phase_angle": 18.887, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.925, "filter_rmsd": 0.042, "frame": { "rmsd": 0.012, "origin": [ -31.599, -4.237, -38.022 ], "x_axis": [ 0.311, -0.950, -0.010 ], "y_axis": [ 0.526, 0.181, -0.831 ], "z_axis": [ 0.792, 0.254, 0.556 ], "quaternion": [ 0.716, -0.379, 0.280, -0.516 ] } }, { "index": 67, "index_chain": 67, "chain_name": "A", "nt_resnum": 67, "nt_name": "A", "nt_code": "A", "nt_id": "///A/67", "linked_nts": [ "///A/66", "///A/68" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -62.746, "beta": 171.905, "gamma": 48.439, "delta": 89.284, "epsilon": -158.212, "zeta": -76.972, "epsilon_zeta": -81.239, "bb_type": "BI", "chi": -156.313, "glyco_bond": "anti", "C5prime_xyz": [ -1.353, 8.688, 0.338 ], "P_xyz": [ 1.225, 8.936, 0.385 ], "form": "A", "ssZp": 4.320, "Dp": 4.552, "splay_angle": 24.453, "splay_distance": 3.868, "splay_ratio": 0.213, "d22": null, "d64": null, "eta": 165.693, "theta": -146.181, "eta_prime": -178.087, "theta_prime": -147.509, "eta_base": -129.214, "theta_base": -129.387, "v0": 3.784, "v1": -28.999, "v2": 42.022, "v3": -40.638, "v4": 23.146, "amplitude": 43.212, "phase_angle": 13.480, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.784, "filter_rmsd": 0.045, "frame": { "rmsd": 0.016, "origin": [ -29.123, -4.652, -35.621 ], "x_axis": [ 0.534, -0.668, -0.519 ], "y_axis": [ 0.318, 0.727, -0.609 ], "z_axis": [ 0.784, 0.160, 0.600 ], "quaternion": [ 0.846, -0.227, 0.385, -0.292 ] } }, { "index": 68, "index_chain": 68, "chain_name": "A", "nt_resnum": 68, "nt_name": "U", "nt_code": "U", "nt_id": "///A/68", "linked_nts": [ "///A/67", "///A/69" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -60.542, "beta": 173.506, "gamma": 46.492, "delta": 82.312, "epsilon": -155.313, "zeta": -64.366, "epsilon_zeta": -90.947, "bb_type": "BI", "chi": -161.748, "glyco_bond": "anti", "C5prime_xyz": [ -1.588, 8.702, 0.637 ], "P_xyz": [ 0.957, 9.205, 0.912 ], "form": "A", "ssZp": 4.472, "Dp": 4.624, "splay_angle": 24.615, "splay_distance": 3.882, "splay_ratio": 0.216, "d22": 3.674, "d64": 3.862, "eta": 169.187, "theta": -138.923, "eta_prime": -179.827, "theta_prime": -137.404, "eta_base": -146.885, "theta_base": -98.444, "v0": 2.765, "v1": -28.442, "v2": 41.830, "v3": -41.347, "v4": 24.314, "amplitude": 43.302, "phase_angle": 14.982, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.750, "filter_rmsd": 0.103, "frame": { "rmsd": 0.008, "origin": [ -26.521, -5.504, -32.889 ], "x_axis": [ 0.485, -0.278, -0.829 ], "y_axis": [ 0.038, 0.954, -0.298 ], "z_axis": [ 0.873, 0.113, 0.474 ], "quaternion": [ 0.853, -0.120, 0.499, -0.093 ] } }, { "index": 69, "index_chain": 69, "chain_name": "A", "nt_resnum": 69, "nt_name": "U", "nt_code": "U", "nt_id": "///A/69", "linked_nts": [ "///A/68", "///A/70" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -59.293, "beta": 171.421, "gamma": 47.270, "delta": 82.232, "epsilon": -154.850, "zeta": -78.801, "epsilon_zeta": -76.049, "bb_type": "BI", "chi": -162.520, "glyco_bond": "anti", "C5prime_xyz": [ -1.453, 8.683, 0.774 ], "P_xyz": [ 1.090, 9.176, 1.044 ], "form": "A", "ssZp": 4.572, "Dp": 4.623, "splay_angle": 19.397, "splay_distance": 3.129, "splay_ratio": 0.172, "d22": 4.608, "d64": 4.631, "eta": 169.259, "theta": -155.905, "eta_prime": -173.550, "theta_prime": -157.311, "eta_base": -116.930, "theta_base": -148.944, "v0": 2.034, "v1": -25.598, "v2": 37.912, "v3": -38.084, "v4": 22.822, "amplitude": 39.423, "phase_angle": 15.916, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.881, "filter_rmsd": 0.103, "frame": { "rmsd": 0.007, "origin": [ -22.772, -6.460, -33.209 ], "x_axis": [ 0.293, 0.416, -0.861 ], "y_axis": [ -0.242, 0.903, 0.354 ], "z_axis": [ 0.925, 0.105, 0.366 ], "quaternion": [ 0.800, 0.078, 0.558, 0.205 ] } }, { "index": 70, "index_chain": 70, "chain_name": "A", "nt_resnum": 70, "nt_name": "C", "nt_code": "C", "nt_id": "///A/70", "linked_nts": [ "///A/69", "///A/71" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -70.168, "beta": 168.457, "gamma": 54.807, "delta": 77.437, "epsilon": -156.013, "zeta": -69.262, "epsilon_zeta": -86.751, "bb_type": "BI", "chi": -159.628, "glyco_bond": "anti", "C5prime_xyz": [ -1.398, 8.805, 0.484 ], "P_xyz": [ 1.151, 9.340, 0.291 ], "form": "A", "ssZp": 4.466, "Dp": 4.673, "splay_angle": 20.317, "splay_distance": 3.197, "splay_ratio": 0.178, "d22": null, "d64": null, "eta": 163.408, "theta": -150.548, "eta_prime": 172.323, "theta_prime": -152.126, "eta_base": -166.199, "theta_base": -125.732, "v0": 2.492, "v1": -29.096, "v2": 43.097, "v3": -42.778, "v4": 25.598, "amplitude": 44.724, "phase_angle": 15.502, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.904, "filter_rmsd": 0.062, "frame": { "rmsd": 0.007, "origin": [ -20.225, -8.159, -32.568 ], "x_axis": [ 0.130, 0.727, -0.674 ], "y_axis": [ -0.136, 0.687, 0.714 ], "z_axis": [ 0.982, -0.001, 0.188 ], "quaternion": [ 0.708, 0.252, 0.585, 0.305 ] } }, { "index": 71, "index_chain": 71, "chain_name": "A", "nt_resnum": 71, "nt_name": "G", "nt_code": "G", "nt_id": "///A/71", "linked_nts": [ "///A/70", "///A/72" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -78.322, "beta": 170.210, "gamma": 61.697, "delta": 81.729, "epsilon": -166.084, "zeta": -52.895, "epsilon_zeta": -113.189, "bb_type": "BI", "chi": -164.028, "glyco_bond": "anti", "C5prime_xyz": [ -1.183, 8.694, 0.699 ], "P_xyz": [ 1.393, 9.086, 0.263 ], "form": ".", "ssZp": 4.562, "Dp": 4.617, "splay_angle": 20.344, "splay_distance": 3.078, "splay_ratio": 0.179, "d22": null, "d64": null, "eta": 158.136, "theta": -121.646, "eta_prime": 174.453, "theta_prime": -119.257, "eta_base": -139.090, "theta_base": -121.969, "v0": 8.449, "v1": -32.565, "v2": 42.941, "v3": -38.863, "v4": 19.194, "amplitude": 43.296, "phase_angle": 7.348, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.749, "filter_rmsd": 0.006, "frame": { "rmsd": 0.006, "origin": [ -17.184, -8.327, -33.543 ], "x_axis": [ -0.025, 0.977, -0.211 ], "y_axis": [ -0.020, 0.210, 0.977 ], "z_axis": [ 0.999, 0.029, 0.014 ], "quaternion": [ 0.548, 0.433, 0.553, 0.455 ] } }, { "index": 72, "index_chain": 72, "chain_name": "A", "nt_resnum": 72, "nt_name": "C", "nt_code": "C", "nt_id": "///A/72", "linked_nts": [ "///A/71", "///A/73" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack", "alpha": -128.288, "beta": -81.453, "gamma": 22.789, "delta": 91.401, "epsilon": -168.046, "zeta": -90.072, "epsilon_zeta": -77.974, "bb_type": "BI", "chi": -89.964, "glyco_bond": "anti", "C5prime_xyz": [ -1.763, 7.117, -3.024 ], "P_xyz": [ 0.422, 8.474, -2.529 ], "form": ".", "ssZp": 0.633, "Dp": 4.478, "splay_angle": 38.972, "splay_distance": 6.522, "splay_ratio": 0.417, "d22": null, "d64": null, "eta": 154.465, "theta": -159.684, "eta_prime": 155.826, "theta_prime": -169.842, "eta_base": 165.382, "theta_base": -124.595, "v0": 14.337, "v1": -32.156, "v2": 36.682, "v3": -29.412, "v4": 9.722, "amplitude": 36.760, "phase_angle": 356.271, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.003, "origin": [ -14.653, -7.466, -35.067 ], "x_axis": [ -0.690, 0.633, 0.351 ], "y_axis": [ 0.438, -0.021, 0.899 ], "z_axis": [ 0.576, 0.774, -0.263 ], "quaternion": [ 0.081, 0.385, 0.695, 0.602 ] } }, { "index": 73, "index_chain": 73, "chain_name": "A", "nt_resnum": 73, "nt_name": "A", "nt_code": "A", "nt_id": "///A/73", "linked_nts": [ "///A/72", "///A/74" ], "nt_type": "RNA", "dbn": ".", "summary": "syn,non-stack,non-pair-contact,ss-non-loop,splayed-apart", "alpha": 158.192, "beta": 157.637, "gamma": 153.855, "delta": 122.569, "epsilon": -177.106, "zeta": -149.746, "epsilon_zeta": -27.360, "bb_type": "--", "chi": 82.194, "glyco_bond": "syn", "C5prime_xyz": [ -3.164, 3.307, 2.372 ], "P_xyz": [ -1.743, 3.031, 4.557 ], "form": ".", "ssZp": -1.146, "Dp": 3.913, "splay_angle": 159.033, "splay_distance": 18.585, "splay_ratio": 0.984, "d22": null, "d64": null, "eta": 138.954, "theta": 107.471, "eta_prime": 150.637, "theta_prime": 161.739, "eta_base": -147.337, "theta_base": -150.806, "v0": 33.651, "v1": -29.745, "v2": 15.216, "v3": 3.768, "v4": -23.457, "amplitude": 33.144, "phase_angle": 297.328, "puckering": "C1'-endo", "sugar_class": "--", "bin": "32t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.037, "frame": { "rmsd": 0.002, "origin": [ -11.453, -4.018, -30.549 ], "x_axis": [ -0.497, -0.524, -0.692 ], "y_axis": [ 0.822, -0.540, -0.181 ], "z_axis": [ -0.279, -0.658, 0.699 ], "quaternion": [ -0.407, -0.293, -0.254, 0.827 ] } }, { "index": 74, "index_chain": 74, "chain_name": "A", "nt_resnum": 74, "nt_name": "C", "nt_code": "C", "nt_id": "///A/74", "linked_nts": [ "///A/73", "///A/75" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,non-stack,non-canonical,non-pair-contact,ss-non-loop,cap-acceptor,phosphate,splayed-apart", "alpha": -127.911, "beta": -73.349, "gamma": 147.541, "delta": 35.965, "epsilon": 152.175, "zeta": 159.063, "epsilon_zeta": -6.888, "bb_type": "--", "chi": 159.813, "glyco_bond": "anti", "C5prime_xyz": [ -1.000, 8.655, -0.561 ], "P_xyz": [ -2.297, 10.928, -0.424 ], "form": "L", "ssZp": -3.225, "Dp": 3.324, "splay_angle": 74.454, "splay_distance": 10.822, "splay_ratio": 0.641, "d22": 8.410, "d64": 11.051, "eta": -71.485, "theta": 136.249, "eta_prime": -159.689, "theta_prime": 176.988, "eta_base": 64.024, "theta_base": -174.584, "v0": -7.906, "v1": 28.732, "v2": -37.318, "v3": 33.740, "v4": -16.500, "amplitude": 37.579, "phase_angle": 186.755, "puckering": "C3'-exo", "sugar_class": "pucker-CHK", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.002, "origin": [ 3.330, 4.972, -23.765 ], "x_axis": [ 0.390, -0.532, 0.752 ], "y_axis": [ -0.630, -0.749, -0.203 ], "z_axis": [ 0.671, -0.395, -0.627 ], "quaternion": [ 0.058, 0.832, -0.349, 0.428 ] } }, { "index": 75, "index_chain": 75, "chain_name": "A", "nt_resnum": 75, "nt_name": "C", "nt_code": "C", "nt_id": "///A/75", "linked_nts": [ "///A/74", "///A/76" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,non-canonical,non-pair-contact,multiplet,ss-non-loop,cap-donor,cap-acceptor,phosphate", "alpha": 168.719, "beta": 8.517, "gamma": 78.028, "delta": -153.802, "epsilon": -18.673, "zeta": -78.345, "epsilon_zeta": 59.672, "bb_type": "--", "chi": 172.827, "glyco_bond": "anti", "C5prime_xyz": [ -4.001, 8.152, 0.157 ], "P_xyz": [ -4.243, 9.525, 2.375 ], "form": ".", "ssZp": 3.040, "Dp": 3.604, "splay_angle": 10.472, "splay_distance": 2.769, "splay_ratio": 0.159, "d22": null, "d64": null, "eta": 78.735, "theta": 176.373, "eta_prime": 29.664, "theta_prime": 148.613, "eta_base": 39.173, "theta_base": 112.679, "v0": -18.215, "v1": -3.430, "v2": 22.170, "v3": -33.184, "v4": 32.484, "amplitude": 34.276, "phase_angle": 49.699, "puckering": "C4'-endo", "sugar_class": "--", "is_L_sugar": true, "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.002, "origin": [ -1.954, 10.740, -16.286 ], "x_axis": [ 0.868, 0.496, -0.017 ], "y_axis": [ 0.407, -0.731, -0.548 ], "z_axis": [ -0.284, 0.468, -0.837 ], "quaternion": [ -0.274, 0.927, 0.244, -0.081 ] } }, { "index": 76, "index_chain": 76, "chain_name": "A", "nt_resnum": 76, "nt_name": "A", "nt_code": "A", "nt_id": "///A/76", "linked_nts": [ "///A/75", null ], "nt_type": "RNA", "dbn": ".", "summary": "~C3'-endo,non-pair-contact,ss-non-loop,cap-donor,phosphate", "alpha": -151.332, "beta": 126.044, "gamma": -109.152, "delta": -18.093, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": -64.457, "glyco_bond": "--", "C5prime_xyz": [ -4.025, 6.835, -2.733 ], "P_xyz": [ -6.139, 7.579, -1.380 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": 25.521, "v1": -37.198, "v2": 34.279, "v3": -20.506, "v4": -2.953, "amplitude": 37.288, "phase_angle": 336.823, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.037, "frame": { "rmsd": 0.003, "origin": [ -3.215, 13.063, -15.460 ], "x_axis": [ 0.216, 0.975, 0.046 ], "y_axis": [ 0.300, -0.022, -0.954 ], "z_axis": [ -0.929, 0.220, -0.297 ], "quaternion": [ -0.474, 0.619, 0.515, -0.357 ] } }, { "index": 77, "index_chain": 1, "chain_name": "B", "nt_resnum": 1, "nt_name": "C", "nt_code": "C", "nt_id": "///B/1", "linked_nts": [ null, "///B/2" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,ss-non-loop", "alpha": null, "beta": 171.586, "gamma": 175.070, "delta": 83.647, "epsilon": -141.892, "zeta": -68.742, "epsilon_zeta": -73.150, "bb_type": "BI", "chi": -154.032, "glyco_bond": "anti", "C5prime_xyz": [ -1.039, 8.710, 0.239 ], "P_xyz": [ -0.099, 10.492, -1.526 ], "form": "A", "ssZp": 4.298, "Dp": 4.697, "splay_angle": 28.060, "splay_distance": 4.588, "splay_ratio": 0.245, "d22": null, "d64": null, "eta": null, "theta": -167.866, "eta_prime": null, "theta_prime": -160.123, "eta_base": null, "theta_base": -129.159, "v0": 4.646, "v1": -25.571, "v2": 35.764, "v3": -34.052, "v4": 18.499, "amplitude": 36.493, "phase_angle": 11.470, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.064, "frame": { "rmsd": 0.005, "origin": [ -6.717, -18.558, -14.332 ], "x_axis": [ -0.694, 0.668, 0.268 ], "y_axis": [ -0.499, -0.177, -0.848 ], "z_axis": [ -0.519, -0.723, 0.456 ], "quaternion": [ 0.382, -0.082, -0.515, 0.763 ] } }, { "index": 78, "index_chain": 2, "chain_name": "B", "nt_resnum": 2, "nt_name": "G", "nt_code": "G", "nt_id": "///B/2", "linked_nts": [ "///B/1", "///B/3" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack", "alpha": -52.513, "beta": 176.860, "gamma": 45.255, "delta": 79.759, "epsilon": -169.427, "zeta": -82.974, "epsilon_zeta": -86.453, "bb_type": "BI", "chi": -159.069, "glyco_bond": "anti", "C5prime_xyz": [ -1.465, 8.892, 0.430 ], "P_xyz": [ 0.998, 9.577, 1.093 ], "form": "A", "ssZp": 4.216, "Dp": 4.380, "splay_angle": 23.066, "splay_distance": 3.755, "splay_ratio": 0.202, "d22": null, "d64": null, "eta": 169.927, "theta": -139.412, "eta_prime": -171.797, "theta_prime": -140.996, "eta_base": -130.528, "theta_base": -107.505, "v0": 2.102, "v1": -23.398, "v2": 34.492, "v3": -34.496, "v4": 20.457, "amplitude": 35.795, "phase_angle": 15.507, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.777, "filter_rmsd": 0.009, "frame": { "rmsd": 0.009, "origin": [ -9.946, -19.539, -11.223 ], "x_axis": [ -0.543, 0.710, -0.449 ], "y_axis": [ 0.006, -0.531, -0.847 ], "z_axis": [ -0.840, -0.463, 0.284 ], "quaternion": [ 0.229, -0.420, -0.427, 0.768 ] } }, { "index": 79, "index_chain": 3, "chain_name": "B", "nt_resnum": 3, "nt_name": "C", "nt_code": "C", "nt_id": "///B/3", "linked_nts": [ "///B/2", "///B/4" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": 163.549, "beta": -147.387, "gamma": 165.245, "delta": 81.332, "epsilon": -123.175, "zeta": -99.082, "epsilon_zeta": -24.093, "bb_type": "--", "chi": -165.152, "glyco_bond": "anti", "C5prime_xyz": [ -1.192, 8.645, 0.804 ], "P_xyz": [ 0.824, 9.510, -0.633 ], "form": ".", "ssZp": 4.229, "Dp": 4.702, "splay_angle": 24.213, "splay_distance": 4.282, "splay_ratio": 0.217, "d22": null, "d64": null, "eta": 170.380, "theta": -135.548, "eta_prime": -172.882, "theta_prime": -132.528, "eta_base": -125.690, "theta_base": -130.321, "v0": 5.554, "v1": -25.540, "v2": 35.090, "v3": -32.937, "v4": 17.328, "amplitude": 35.638, "phase_angle": 10.067, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.539, "filter_rmsd": 0.065, "frame": { "rmsd": 0.013, "origin": [ -13.498, -19.595, -10.005 ], "x_axis": [ -0.548, 0.215, -0.808 ], "y_axis": [ 0.199, -0.905, -0.376 ], "z_axis": [ -0.812, -0.367, 0.453 ], "quaternion": [ 0.005, -0.475, -0.218, 0.852 ] } }, { "index": 80, "index_chain": 4, "chain_name": "B", "nt_resnum": 4, "nt_name": "G", "nt_code": "G", "nt_id": "///B/4", "linked_nts": [ "///B/3", "///B/5" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": 33.944, "beta": 145.838, "gamma": -26.621, "delta": 144.618, "epsilon": 174.845, "zeta": -107.395, "epsilon_zeta": -77.759, "bb_type": "BI", "chi": -119.599, "glyco_bond": "anti", "C5prime_xyz": [ -2.291, 8.571, -0.818 ], "P_xyz": [ -0.871, 10.381, 0.464 ], "form": ".", "ssZp": 3.002, "Dp": 2.397, "splay_angle": 25.377, "splay_distance": 3.974, "splay_ratio": 0.220, "d22": null, "d64": null, "eta": 151.293, "theta": -159.431, "eta_prime": -178.303, "theta_prime": -166.738, "eta_base": -159.526, "theta_base": -108.128, "v0": -23.076, "v1": 36.183, "v2": -34.563, "v3": 22.220, "v4": 0.334, "amplitude": 36.634, "phase_angle": 160.642, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32m", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.021, "frame": { "rmsd": 0.021, "origin": [ -17.528, -19.063, -8.660 ], "x_axis": [ 0.255, 0.187, -0.949 ], "y_axis": [ 0.420, -0.905, -0.065 ], "z_axis": [ -0.871, -0.382, -0.309 ], "quaternion": [ 0.101, 0.786, 0.193, -0.579 ] } }, { "index": 81, "index_chain": 5, "chain_name": "B", "nt_resnum": 5, "nt_name": "G", "nt_code": "G", "nt_id": "///B/5", "linked_nts": [ "///B/4", "///B/6" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -68.463, "beta": -176.786, "gamma": 46.331, "delta": 81.097, "epsilon": -155.577, "zeta": -66.867, "epsilon_zeta": -88.710, "bb_type": "BI", "chi": -154.160, "glyco_bond": "anti", "C5prime_xyz": [ -1.046, 8.697, 0.160 ], "P_xyz": [ 1.561, 9.010, 0.496 ], "form": "A", "ssZp": 4.289, "Dp": 4.657, "splay_angle": 23.748, "splay_distance": 3.891, "splay_ratio": 0.210, "d22": null, "d64": null, "eta": 168.077, "theta": -145.372, "eta_prime": 169.543, "theta_prime": -144.289, "eta_base": -120.524, "theta_base": -126.413, "v0": 5.548, "v1": -26.688, "v2": 36.540, "v3": -34.291, "v4": 18.237, "amplitude": 37.130, "phase_angle": 10.229, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.011, "frame": { "rmsd": 0.011, "origin": [ -20.847, -20.111, -10.578 ], "x_axis": [ 0.335, -0.640, -0.692 ], "y_axis": [ 0.238, -0.653, 0.719 ], "z_axis": [ -0.912, -0.406, -0.066 ], "quaternion": [ 0.392, 0.717, -0.140, -0.559 ] } }, { "index": 82, "index_chain": 6, "chain_name": "B", "nt_resnum": 6, "nt_name": "G", "nt_code": "G", "nt_id": "///B/6", "linked_nts": [ "///B/5", "///B/7" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -53.922, "beta": 170.959, "gamma": 52.435, "delta": 79.902, "epsilon": -170.705, "zeta": -69.085, "epsilon_zeta": -101.620, "bb_type": "BI", "chi": -161.186, "glyco_bond": "anti", "C5prime_xyz": [ -1.480, 8.879, 0.590 ], "P_xyz": [ 1.074, 9.569, 0.759 ], "form": ".", "ssZp": 4.412, "Dp": 4.420, "splay_angle": 25.289, "splay_distance": 4.424, "splay_ratio": 0.232, "d22": null, "d64": null, "eta": 172.306, "theta": -147.532, "eta_prime": -170.366, "theta_prime": -149.830, "eta_base": -136.197, "theta_base": -150.655, "v0": 0.185, "v1": -22.554, "v2": 35.090, "v3": -35.945, "v4": 22.624, "amplitude": 36.971, "phase_angle": 18.354, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.864, "filter_rmsd": 0.006, "frame": { "rmsd": 0.006, "origin": [ -24.118, -20.913, -12.526 ], "x_axis": [ 0.480, -0.821, -0.307 ], "y_axis": [ 0.053, -0.322, 0.945 ], "z_axis": [ -0.875, -0.470, -0.111 ], "quaternion": [ 0.512, 0.692, -0.278, -0.428 ] } }, { "index": 83, "index_chain": 7, "chain_name": "B", "nt_resnum": 7, "nt_name": "G", "nt_code": "G", "nt_id": "///B/7", "linked_nts": [ "///B/6", "///B/8" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop,splayed-apart", "alpha": -171.171, "beta": 170.098, "gamma": 175.464, "delta": 143.718, "epsilon": -125.470, "zeta": 9.086, "epsilon_zeta": 225.444, "bb_type": "--", "chi": -158.578, "glyco_bond": "anti", "C5prime_xyz": [ -1.780, 8.589, 0.858 ], "P_xyz": [ 0.094, 10.284, 0.131 ], "form": ".", "ssZp": 1.502, "Dp": 1.613, "splay_angle": 129.787, "splay_distance": 17.516, "splay_ratio": 0.906, "d22": null, "d64": null, "eta": -137.941, "theta": -48.329, "eta_prime": -138.914, "theta_prime": -42.642, "eta_base": -139.965, "theta_base": -18.208, "v0": -18.186, "v1": 30.953, "v2": -31.044, "v3": 21.671, "v4": -2.406, "amplitude": 32.095, "phase_angle": 165.302, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32t", "cluster": "1t", "suiteness": 0.680, "filter_rmsd": 0.007, "frame": { "rmsd": 0.007, "origin": [ -27.384, -20.828, -15.508 ], "x_axis": [ 0.682, -0.732, 0.005 ], "y_axis": [ -0.170, -0.152, 0.974 ], "z_axis": [ -0.712, -0.664, -0.228 ], "quaternion": [ 0.570, 0.718, -0.314, -0.246 ] } }, { "index": 84, "index_chain": 8, "chain_name": "B", "nt_resnum": 8, "nt_name": "U", "nt_code": "U", "nt_id": "///B/8", "linked_nts": [ "///B/7", "///B/9" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-stack,non-canonical,non-pair-contact,helix,multiplet,junction-loop,splayed-apart", "alpha": -106.010, "beta": -137.075, "gamma": 54.358, "delta": 85.063, "epsilon": -121.186, "zeta": -136.249, "epsilon_zeta": 15.063, "bb_type": "--", "chi": -153.846, "glyco_bond": "anti", "C5prime_xyz": [ -1.477, 8.829, 0.211 ], "P_xyz": [ 0.784, 9.356, 1.487 ], "form": ".", "ssZp": 4.027, "Dp": 4.538, "splay_angle": 69.188, "splay_distance": 12.045, "splay_ratio": 0.572, "d22": null, "d64": null, "eta": 170.309, "theta": -166.807, "eta_prime": -155.728, "theta_prime": -165.353, "eta_base": -144.384, "theta_base": 172.452, "v0": 1.183, "v1": -21.586, "v2": 32.367, "v3": -32.772, "v4": 20.025, "amplitude": 33.805, "phase_angle": 16.775, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.105, "frame": { "rmsd": 0.008, "origin": [ -35.842, -22.415, -0.252 ], "x_axis": [ 0.872, 0.395, 0.289 ], "y_axis": [ 0.196, 0.260, -0.946 ], "z_axis": [ -0.448, 0.881, 0.149 ], "quaternion": [ 0.755, -0.605, -0.244, 0.066 ] } }, { "index": 85, "index_chain": 9, "chain_name": "B", "nt_resnum": 9, "nt_name": "G", "nt_code": "G", "nt_id": "///B/9", "linked_nts": [ "///B/8", "///B/10" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C2'-endo,non-pair-contact,junction-loop", "alpha": 46.681, "beta": -168.508, "gamma": -76.654, "delta": 139.821, "epsilon": -106.250, "zeta": -58.664, "epsilon_zeta": -47.586, "bb_type": "--", "chi": -97.449, "glyco_bond": "anti", "C5prime_xyz": [ -2.686, 8.101, -2.242 ], "P_xyz": [ -3.239, 10.233, -3.774 ], "form": ".", "ssZp": 1.301, "Dp": 1.308, "splay_angle": 66.287, "splay_distance": 10.658, "splay_ratio": 0.550, "d22": null, "d64": null, "eta": -156.803, "theta": -70.085, "eta_prime": -172.564, "theta_prime": -106.346, "eta_base": 153.522, "theta_base": -92.883, "v0": -23.594, "v1": 34.378, "v2": -31.116, "v3": 18.402, "v4": 3.107, "amplitude": 34.066, "phase_angle": 155.980, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32m", "cluster": "7r", "suiteness": 0.345, "filter_rmsd": 0.009, "frame": { "rmsd": 0.009, "origin": [ -47.624, -21.119, -2.397 ], "x_axis": [ 0.287, -0.042, 0.957 ], "y_axis": [ 0.772, 0.602, -0.205 ], "z_axis": [ -0.568, 0.797, 0.205 ], "quaternion": [ 0.724, -0.346, -0.527, -0.281 ] } }, { "index": 86, "index_chain": 10, "chain_name": "B", "nt_resnum": 10, "nt_name": "G", "nt_code": "G", "nt_id": "///B/10", "linked_nts": [ "///B/9", "///B/11" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,junction-loop", "alpha": -179.498, "beta": 170.511, "gamma": 69.520, "delta": 85.066, "epsilon": -148.171, "zeta": -72.183, "epsilon_zeta": -75.989, "bb_type": "BI", "chi": 175.196, "glyco_bond": "anti", "C5prime_xyz": [ -1.648, 8.268, 1.895 ], "P_xyz": [ 0.887, 8.690, 2.390 ], "form": "A", "ssZp": 4.516, "Dp": 4.592, "splay_angle": 23.370, "splay_distance": 3.580, "splay_ratio": 0.205, "d22": null, "d64": null, "eta": 44.196, "theta": -143.778, "eta_prime": 107.173, "theta_prime": -141.883, "eta_base": 147.849, "theta_base": -119.000, "v0": 4.261, "v1": -25.060, "v2": 34.771, "v3": -33.559, "v4": 18.587, "amplitude": 35.553, "phase_angle": 12.040, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "2g", "suiteness": 0.311, "filter_rmsd": 0.006, "frame": { "rmsd": 0.006, "origin": [ -42.912, -11.723, -0.632 ], "x_axis": [ -0.504, -0.839, 0.205 ], "y_axis": [ -0.221, -0.104, -0.970 ], "z_axis": [ 0.835, -0.534, -0.133 ], "quaternion": [ 0.254, -0.428, 0.619, -0.607 ] } }, { "index": 87, "index_chain": 11, "chain_name": "B", "nt_resnum": 11, "nt_name": "A", "nt_code": "A", "nt_id": "///B/11", "linked_nts": [ "///B/10", "///B/12" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -74.893, "beta": -161.646, "gamma": 43.943, "delta": 84.200, "epsilon": -161.543, "zeta": -61.599, "epsilon_zeta": -99.944, "bb_type": "BI", "chi": -152.460, "glyco_bond": "anti", "C5prime_xyz": [ -0.981, 8.601, 0.093 ], "P_xyz": [ 1.505, 8.842, 0.939 ], "form": "A", "ssZp": 4.154, "Dp": 4.547, "splay_angle": 20.336, "splay_distance": 3.217, "splay_ratio": 0.177, "d22": null, "d64": null, "eta": 167.011, "theta": -144.697, "eta_prime": 176.935, "theta_prime": -143.078, "eta_base": -148.307, "theta_base": -114.692, "v0": 6.480, "v1": -27.067, "v2": 36.459, "v3": -33.722, "v4": 17.203, "amplitude": 36.894, "phase_angle": 8.804, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.624, "filter_rmsd": 0.040, "frame": { "rmsd": 0.009, "origin": [ -40.122, -13.357, 0.908 ], "x_axis": [ -0.572, -0.677, -0.463 ], "y_axis": [ 0.218, 0.419, -0.882 ], "z_axis": [ 0.791, -0.605, -0.092 ], "quaternion": [ 0.434, -0.159, 0.722, -0.515 ] } }, { "index": 88, "index_chain": 12, "chain_name": "B", "nt_resnum": 12, "nt_name": "G", "nt_code": "G", "nt_id": "///B/12", "linked_nts": [ "///B/11", "///B/13" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -68.218, "beta": 177.302, "gamma": 51.593, "delta": 79.287, "epsilon": -158.994, "zeta": -68.226, "epsilon_zeta": -90.768, "bb_type": "BI", "chi": -152.584, "glyco_bond": "anti", "C5prime_xyz": [ -1.003, 8.736, 0.097 ], "P_xyz": [ 1.603, 9.061, -0.173 ], "form": ".", "ssZp": 4.329, "Dp": 4.644, "splay_angle": 17.821, "splay_distance": 3.310, "splay_ratio": 0.174, "d22": null, "d64": null, "eta": 164.209, "theta": -126.691, "eta_prime": 179.567, "theta_prime": -136.431, "eta_base": -135.951, "theta_base": -126.092, "v0": 3.529, "v1": -26.140, "v2": 37.955, "v3": -36.799, "v4": 21.035, "amplitude": 39.043, "phase_angle": 13.556, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.834, "filter_rmsd": 0.012, "frame": { "rmsd": 0.012, "origin": [ -38.459, -16.105, 1.080 ], "x_axis": [ -0.325, -0.394, -0.860 ], "y_axis": [ 0.594, 0.623, -0.510 ], "z_axis": [ 0.736, -0.676, 0.032 ], "quaternion": [ 0.576, 0.072, 0.692, -0.428 ] } }, { "index": 89, "index_chain": 13, "chain_name": "B", "nt_resnum": 13, "nt_name": "C", "nt_code": "C", "nt_id": "///B/13", "linked_nts": [ "///B/12", "///B/14" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop,kissing-loop", "alpha": 161.749, "beta": -177.217, "gamma": 174.275, "delta": 86.389, "epsilon": -160.880, "zeta": -49.315, "epsilon_zeta": -111.566, "bb_type": "BI", "chi": -154.789, "glyco_bond": "anti", "C5prime_xyz": [ -0.927, 8.652, 0.370 ], "P_xyz": [ 0.268, 10.174, -1.403 ], "form": ".", "ssZp": 4.409, "Dp": 4.514, "splay_angle": 33.897, "splay_distance": 6.114, "splay_ratio": 0.308, "d22": null, "d64": null, "eta": 162.557, "theta": -144.105, "eta_prime": 178.438, "theta_prime": -154.397, "eta_base": -152.119, "theta_base": -148.843, "v0": 4.855, "v1": -25.444, "v2": 35.351, "v3": -33.662, "v4": 18.060, "amplitude": 36.030, "phase_angle": 11.139, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.865, "filter_rmsd": 0.065, "frame": { "rmsd": 0.013, "origin": [ -38.585, -19.411, 1.155 ], "x_axis": [ -0.204, -0.031, -0.979 ], "y_axis": [ 0.879, 0.435, -0.196 ], "z_axis": [ 0.432, -0.900, -0.062 ], "quaternion": [ 0.541, 0.325, 0.652, -0.420 ] } }, { "index": 90, "index_chain": 14, "chain_name": "B", "nt_resnum": 14, "nt_name": "A", "nt_code": "A", "nt_id": "///B/14", "linked_nts": [ "///B/13", "///B/15" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,hairpin-loop,kissing-loop", "alpha": 166.784, "beta": 157.465, "gamma": -173.427, "delta": 83.413, "epsilon": -129.388, "zeta": -57.482, "epsilon_zeta": -71.906, "bb_type": "BI", "chi": 175.353, "glyco_bond": "anti", "C5prime_xyz": [ -1.537, 8.263, 1.969 ], "P_xyz": [ -0.821, 10.792, 1.718 ], "form": ".", "ssZp": 4.767, "Dp": 4.677, "splay_angle": 34.518, "splay_distance": 5.408, "splay_ratio": 0.300, "d22": null, "d64": null, "eta": 173.063, "theta": -158.360, "eta_prime": -177.674, "theta_prime": -142.047, "eta_base": -158.579, "theta_base": -83.073, "v0": 3.533, "v1": -25.439, "v2": 36.723, "v3": -35.476, "v4": 20.302, "amplitude": 37.742, "phase_angle": 13.343, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1f", "suiteness": 0.597, "filter_rmsd": 0.040, "frame": { "rmsd": 0.007, "origin": [ -39.168, -25.440, 0.318 ], "x_axis": [ -0.147, 0.360, -0.921 ], "y_axis": [ 0.765, 0.632, 0.125 ], "z_axis": [ 0.627, -0.687, -0.368 ], "quaternion": [ 0.528, 0.384, 0.733, -0.192 ] } }, { "index": 91, "index_chain": 15, "chain_name": "B", "nt_resnum": 15, "nt_name": "G", "nt_code": "G", "nt_id": "///B/15", "linked_nts": [ "///B/14", "///B/16" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-canonical,non-pair-contact,helix-end,hairpin-loop,kissing-loop", "alpha": -58.923, "beta": 167.085, "gamma": 55.389, "delta": 86.104, "epsilon": -119.687, "zeta": -57.112, "epsilon_zeta": -62.575, "bb_type": "--", "chi": -163.777, "glyco_bond": "anti", "C5prime_xyz": [ -1.539, 8.816, 0.781 ], "P_xyz": [ 1.060, 9.304, 0.992 ], "form": ".", "ssZp": 4.358, "Dp": 4.496, "splay_angle": 42.483, "splay_distance": 6.866, "splay_ratio": 0.362, "d22": null, "d64": null, "eta": 172.234, "theta": -101.385, "eta_prime": -159.613, "theta_prime": -94.102, "eta_base": -88.958, "theta_base": -63.130, "v0": -1.696, "v1": -19.571, "v2": 32.063, "v3": -34.106, "v4": 22.602, "amplitude": 34.457, "phase_angle": 21.480, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.690, "filter_rmsd": 0.008, "frame": { "rmsd": 0.008, "origin": [ -36.877, -25.911, -4.558 ], "x_axis": [ 0.650, 0.662, -0.373 ], "y_axis": [ 0.509, -0.016, 0.860 ], "z_axis": [ 0.563, -0.749, -0.348 ], "quaternion": [ 0.567, 0.710, 0.413, 0.067 ] } }, { "index": 92, "index_chain": 16, "chain_name": "B", "nt_resnum": 16, "nt_name": "C", "nt_code": "C", "nt_id": "///B/16", "linked_nts": [ "///B/15", "///B/17" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C2'-endo,non-stack,non-pair-contact,hairpin-loop,kissing-loop", "alpha": -73.025, "beta": -158.654, "gamma": 54.701, "delta": 141.942, "epsilon": -113.178, "zeta": -81.093, "epsilon_zeta": -32.085, "bb_type": "--", "chi": -118.464, "glyco_bond": "anti", "C5prime_xyz": [ -1.625, 8.487, -1.375 ], "P_xyz": [ 0.659, 9.412, -0.443 ], "form": ".", "ssZp": 1.056, "Dp": 1.412, "splay_angle": 59.815, "splay_distance": 9.396, "splay_ratio": 0.511, "d22": 9.764, "d64": 8.983, "eta": -178.495, "theta": -53.509, "eta_prime": -143.177, "theta_prime": -90.772, "eta_base": -104.905, "theta_base": -54.887, "v0": -16.571, "v1": 30.120, "v2": -31.531, "v3": 22.860, "v4": -4.139, "amplitude": 32.174, "phase_angle": 168.529, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1b", "suiteness": 0.444, "filter_rmsd": 0.063, "frame": { "rmsd": 0.005, "origin": [ -30.059, -25.743, -5.349 ], "x_axis": [ 0.014, 0.738, 0.674 ], "y_axis": [ -0.210, -0.657, 0.724 ], "z_axis": [ 0.978, -0.152, 0.146 ], "quaternion": [ 0.354, 0.617, 0.214, 0.669 ] } }, { "index": 93, "index_chain": 17, "chain_name": "B", "nt_resnum": 17, "nt_name": "C", "nt_code": "C", "nt_id": "///B/17", "linked_nts": [ "///B/16", "///B/17" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,~C3'-endo,non-stack,non-pair-contact,hairpin-loop,kissing-loop,phosphate", "alpha": 163.777, "beta": 163.392, "gamma": 164.302, "delta": 85.655, "epsilon": -142.769, "zeta": 62.032, "epsilon_zeta": 155.199, "bb_type": "--", "chi": -42.607, "glyco_bond": "--", "C5prime_xyz": [ -4.207, 5.365, -3.054 ], "P_xyz": [ -5.863, 3.578, -4.062 ], "form": ".", "ssZp": -2.952, "Dp": 4.432, "splay_angle": 29.395, "splay_distance": 4.880, "splay_ratio": 0.258, "d22": 4.274, "d64": 3.276, "eta": 132.226, "theta": -25.345, "eta_prime": 172.037, "theta_prime": -53.390, "eta_base": -150.530, "theta_base": -91.576, "v0": 0.179, "v1": -21.578, "v2": 33.487, "v3": -34.517, "v4": 21.638, "amplitude": 35.302, "phase_angle": 18.457, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.007, "origin": [ -26.489, -30.697, 1.792 ], "x_axis": [ 0.392, 0.028, 0.920 ], "y_axis": [ 0.358, -0.925, -0.125 ], "z_axis": [ 0.848, 0.378, -0.372 ], "quaternion": [ -0.153, 0.820, 0.118, 0.539 ] } }, { "index": 94, "index_chain": 18, "chain_name": "B", "nt_resnum": 17, "nt_name": "U", "nt_code": "U", "nt_id": "///B/17", "linked_nts": [ "///B/17", "///B/18" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,anti,~C3'-endo,non-stack,hairpin-loop,kissing-loop,splayed-apart", "alpha": 150.715, "beta": 178.597, "gamma": 52.570, "delta": 86.765, "epsilon": -114.521, "zeta": -92.847, "epsilon_zeta": -21.674, "bb_type": "--", "chi": -125.219, "glyco_bond": "anti", "C5prime_xyz": [ -1.543, 8.454, -1.382 ], "P_xyz": [ 1.016, 8.687, -2.003 ], "form": ".", "ssZp": 2.340, "Dp": 4.632, "splay_angle": 138.983, "splay_distance": 18.666, "splay_ratio": 0.937, "d22": null, "d64": null, "eta": 62.722, "theta": -132.983, "eta_prime": 106.664, "theta_prime": -143.379, "eta_base": 110.969, "theta_base": -125.905, "v0": 2.841, "v1": -23.057, "v2": 33.164, "v3": -32.730, "v4": 18.903, "amplitude": 34.202, "phase_angle": 14.152, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.007, "origin": [ -28.975, -33.504, 4.916 ], "x_axis": [ 0.649, 0.508, -0.566 ], "y_axis": [ 0.026, -0.759, -0.651 ], "z_axis": [ -0.760, 0.408, -0.506 ], "quaternion": [ -0.310, 0.853, 0.157, -0.389 ] } }, { "index": 95, "index_chain": 19, "chain_name": "B", "nt_resnum": 18, "nt_name": "G", "nt_code": "G", "nt_id": "///B/18", "linked_nts": [ "///B/17", "///B/19" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C2'-endo,BI,non-canonical,non-pair-contact,helix,hairpin-loop,kissing-loop,splayed-apart", "alpha": -62.392, "beta": -167.255, "gamma": 176.086, "delta": 144.482, "epsilon": -142.471, "zeta": -102.461, "epsilon_zeta": -40.010, "bb_type": "BI", "chi": -141.885, "glyco_bond": "anti", "C5prime_xyz": [ -1.605, 8.697, 0.005 ], "P_xyz": [ 0.440, 9.730, -1.279 ], "form": ".", "ssZp": 1.850, "Dp": 1.880, "splay_angle": 45.773, "splay_distance": 7.525, "splay_ratio": 0.389, "d22": null, "d64": null, "eta": -28.739, "theta": -130.382, "eta_prime": -18.151, "theta_prime": -135.518, "eta_base": -46.269, "theta_base": -106.083, "v0": -18.150, "v1": 31.824, "v2": -32.633, "v3": 23.157, "v4": -3.317, "amplitude": 33.515, "phase_angle": 166.831, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.007, "frame": { "rmsd": 0.007, "origin": [ -36.192, -41.600, -10.275 ], "x_axis": [ 0.488, -0.864, -0.125 ], "y_axis": [ 0.350, 0.063, 0.935 ], "z_axis": [ -0.800, -0.500, 0.333 ], "quaternion": [ 0.686, 0.523, -0.246, -0.442 ] } }, { "index": 96, "index_chain": 20, "chain_name": "B", "nt_resnum": 19, "nt_name": "G", "nt_code": "G", "nt_id": "///B/19", "linked_nts": [ "///B/18", "///B/20" ], "nt_type": "RNA", "dbn": "[", "summary": "pseudoknotted,anti,~C2'-endo,isolated-canonical,non-pair-contact,helix-end,hairpin-loop,kissing-loop,phosphate,splayed-apart", "alpha": 171.597, "beta": -167.213, "gamma": 170.888, "delta": 145.160, "epsilon": -104.871, "zeta": -35.854, "epsilon_zeta": -69.016, "bb_type": "--", "chi": -110.601, "glyco_bond": "anti", "C5prime_xyz": [ -2.279, 8.354, -1.778 ], "P_xyz": [ -0.622, 8.805, -3.771 ], "form": ".", "ssZp": 0.650, "Dp": 0.961, "splay_angle": 86.750, "splay_distance": 13.800, "splay_ratio": 0.687, "d22": null, "d64": null, "eta": -151.833, "theta": -47.622, "eta_prime": -133.116, "theta_prime": -61.207, "eta_base": -109.162, "theta_base": -38.473, "v0": -22.521, "v1": 35.265, "v2": -33.755, "v3": 21.848, "v4": 0.226, "amplitude": 35.742, "phase_angle": 160.807, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.010, "frame": { "rmsd": 0.010, "origin": [ -41.591, -44.758, -6.092 ], "x_axis": [ 0.477, -0.632, 0.611 ], "y_axis": [ 0.075, 0.722, 0.688 ], "z_axis": [ -0.876, -0.283, 0.392 ], "quaternion": [ 0.805, 0.302, -0.462, -0.220 ] } }, { "index": 97, "index_chain": 21, "chain_name": "B", "nt_resnum": 20, "nt_name": "U", "nt_code": "U", "nt_id": "///B/20", "linked_nts": [ "///B/19", "///B/21" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-stack,hairpin-loop,kissing-loop,splayed-apart", "alpha": 147.972, "beta": 170.853, "gamma": 174.734, "delta": 88.835, "epsilon": -86.805, "zeta": -53.506, "epsilon_zeta": -33.299, "bb_type": "--", "chi": -119.233, "glyco_bond": "anti", "C5prime_xyz": [ -1.567, 8.307, -1.783 ], "P_xyz": [ -1.133, 8.945, -4.278 ], "form": ".", "ssZp": 1.063, "Dp": 4.331, "splay_angle": 108.105, "splay_distance": 16.878, "splay_ratio": 0.810, "d22": null, "d64": null, "eta": 140.138, "theta": -105.726, "eta_prime": 177.137, "theta_prime": -98.089, "eta_base": -168.126, "theta_base": -93.023, "v0": 1.872, "v1": -21.212, "v2": 31.202, "v3": -31.392, "v4": 18.673, "amplitude": 32.410, "phase_angle": 15.693, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.105, "frame": { "rmsd": 0.006, "origin": [ -39.586, -36.356, 4.669 ], "x_axis": [ 0.886, 0.329, -0.326 ], "y_axis": [ -0.460, 0.534, -0.710 ], "z_axis": [ -0.060, 0.779, 0.624 ], "quaternion": [ 0.872, -0.427, 0.076, 0.226 ] } }, { "index": 98, "index_chain": 22, "chain_name": "B", "nt_resnum": 21, "nt_name": "A", "nt_code": "A", "nt_id": "///B/21", "linked_nts": [ "///B/20", "///B/22" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-canonical,non-pair-contact,multiplet,hairpin-loop,kissing-loop,splayed-apart", "alpha": -95.995, "beta": 170.685, "gamma": 163.674, "delta": 86.007, "epsilon": -111.476, "zeta": -153.064, "epsilon_zeta": 41.588, "bb_type": "--", "chi": -174.062, "glyco_bond": "anti", "C5prime_xyz": [ -1.464, 8.448, 1.297 ], "P_xyz": [ 0.139, 10.334, 0.406 ], "form": ".", "ssZp": 4.252, "Dp": 4.621, "splay_angle": 55.547, "splay_distance": 8.391, "splay_ratio": 0.466, "d22": null, "d64": null, "eta": -126.042, "theta": 126.766, "eta_prime": -98.565, "theta_prime": 140.710, "eta_base": -82.326, "theta_base": 151.058, "v0": 4.555, "v1": -24.701, "v2": 34.362, "v3": -32.970, "v4": 17.890, "amplitude": 35.071, "phase_angle": 11.546, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.040, "frame": { "rmsd": 0.013, "origin": [ -40.847, -23.519, -6.217 ], "x_axis": [ -0.609, -0.105, -0.786 ], "y_axis": [ -0.491, -0.728, 0.478 ], "z_axis": [ -0.622, 0.678, 0.392 ], "quaternion": [ 0.117, -0.426, 0.350, 0.826 ] } }, { "index": 99, "index_chain": 23, "chain_name": "B", "nt_resnum": 22, "nt_name": "G", "nt_code": "G", "nt_id": "///B/22", "linked_nts": [ "///B/21", "///B/23" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop,kissing-loop", "alpha": -72.356, "beta": 136.890, "gamma": 53.594, "delta": 79.664, "epsilon": -141.007, "zeta": -79.899, "epsilon_zeta": -61.108, "bb_type": "BI", "chi": -174.241, "glyco_bond": "anti", "C5prime_xyz": [ -1.460, 8.595, 1.366 ], "P_xyz": [ 1.127, 8.646, 1.043 ], "form": "A", "ssZp": 4.763, "Dp": 4.699, "splay_angle": 24.737, "splay_distance": 4.137, "splay_ratio": 0.224, "d22": null, "d64": null, "eta": 169.005, "theta": -139.586, "eta_prime": 163.516, "theta_prime": -144.536, "eta_base": 157.564, "theta_base": -137.739, "v0": 1.749, "v1": -25.143, "v2": 37.772, "v3": -37.755, "v4": 22.812, "amplitude": 39.325, "phase_angle": 16.155, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "7a", "suiteness": 0.324, "filter_rmsd": 0.010, "frame": { "rmsd": 0.010, "origin": [ -37.952, -20.319, 0.980 ], "x_axis": [ -0.347, 0.104, -0.932 ], "y_axis": [ -0.683, -0.709, 0.175 ], "z_axis": [ -0.643, 0.697, 0.317 ], "quaternion": [ 0.255, -0.511, 0.283, 0.770 ] } }, { "index": 100, "index_chain": 24, "chain_name": "B", "nt_resnum": 23, "nt_name": "C", "nt_code": "C", "nt_id": "///B/23", "linked_nts": [ "///B/22", "///B/24" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -52.744, "beta": 174.290, "gamma": 47.412, "delta": 78.630, "epsilon": -152.696, "zeta": -76.155, "epsilon_zeta": -76.541, "bb_type": "BI", "chi": -164.850, "glyco_bond": "anti", "C5prime_xyz": [ -1.683, 8.902, 0.718 ], "P_xyz": [ 0.685, 9.722, 1.437 ], "form": "A", "ssZp": 4.317, "Dp": 4.467, "splay_angle": 18.810, "splay_distance": 2.982, "splay_ratio": 0.164, "d22": 4.344, "d64": 3.768, "eta": 173.538, "theta": -156.624, "eta_prime": -177.077, "theta_prime": -153.629, "eta_base": -154.004, "theta_base": -125.337, "v0": -0.385, "v1": -23.439, "v2": 36.996, "v3": -38.162, "v4": 24.494, "amplitude": 39.170, "phase_angle": 19.178, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.796, "filter_rmsd": 0.060, "frame": { "rmsd": 0.008, "origin": [ -38.228, -16.205, 1.311 ], "x_axis": [ -0.441, -0.372, -0.817 ], "y_axis": [ -0.495, -0.659, 0.567 ], "z_axis": [ -0.749, 0.654, 0.106 ], "quaternion": [ 0.042, -0.527, 0.411, 0.743 ] } }, { "index": 101, "index_chain": 25, "chain_name": "B", "nt_resnum": 24, "nt_name": "U", "nt_code": "U", "nt_id": "///B/24", "linked_nts": [ "///B/23", "///B/25" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -71.957, "beta": 175.477, "gamma": 52.466, "delta": 83.677, "epsilon": -154.954, "zeta": -62.943, "epsilon_zeta": -92.011, "bb_type": "BI", "chi": -158.244, "glyco_bond": "anti", "C5prime_xyz": [ -1.394, 8.692, 0.295 ], "P_xyz": [ 1.198, 9.088, 0.546 ], "form": "A", "ssZp": 4.255, "Dp": 4.607, "splay_angle": 23.685, "splay_distance": 3.771, "splay_ratio": 0.207, "d22": 4.030, "d64": 4.252, "eta": 161.075, "theta": -137.667, "eta_prime": 173.246, "theta_prime": -139.011, "eta_base": -147.355, "theta_base": -104.471, "v0": 4.991, "v1": -27.447, "v2": 38.010, "v3": -36.083, "v4": 19.792, "amplitude": 38.766, "phase_angle": 11.329, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.921, "filter_rmsd": 0.101, "frame": { "rmsd": 0.013, "origin": [ -39.828, -13.740, 0.802 ], "x_axis": [ -0.548, -0.742, -0.386 ], "y_axis": [ -0.279, -0.273, 0.921 ], "z_axis": [ -0.789, 0.612, -0.057 ], "quaternion": [ -0.175, -0.442, 0.577, 0.664 ] } }, { "index": 102, "index_chain": 26, "chain_name": "B", "nt_resnum": 25, "nt_name": "C", "nt_code": "C", "nt_id": "///B/25", "linked_nts": [ "///B/24", "///B/26" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,junction-loop", "alpha": -69.926, "beta": 176.813, "gamma": 52.773, "delta": 81.725, "epsilon": -137.661, "zeta": -83.654, "epsilon_zeta": -54.007, "bb_type": "BI", "chi": -158.393, "glyco_bond": "anti", "C5prime_xyz": [ -1.247, 8.766, 0.600 ], "P_xyz": [ 1.345, 9.241, 0.454 ], "form": ".", "ssZp": 4.607, "Dp": 4.755, "splay_angle": 30.556, "splay_distance": 4.577, "splay_ratio": 0.265, "d22": null, "d64": null, "eta": 165.924, "theta": -146.003, "eta_prime": -179.058, "theta_prime": -139.590, "eta_base": -126.891, "theta_base": -93.101, "v0": 1.080, "v1": -23.622, "v2": 35.735, "v3": -36.186, "v4": 22.246, "amplitude": 37.378, "phase_angle": 17.050, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.916, "filter_rmsd": 0.064, "frame": { "rmsd": 0.017, "origin": [ -43.148, -12.875, -0.761 ], "x_axis": [ -0.608, -0.740, 0.286 ], "y_axis": [ 0.086, 0.297, 0.951 ], "z_axis": [ -0.789, 0.603, -0.117 ], "quaternion": [ -0.378, -0.230, 0.711, 0.546 ] } }, { "index": 103, "index_chain": 27, "chain_name": "B", "nt_resnum": 26, "nt_name": "G", "nt_code": "G", "nt_id": "///B/26", "linked_nts": [ "///B/25", "///B/27" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,junction-loop", "alpha": -59.438, "beta": 146.482, "gamma": 67.482, "delta": 89.762, "epsilon": -141.910, "zeta": -67.949, "epsilon_zeta": -73.961, "bb_type": "BI", "chi": -177.420, "glyco_bond": "anti", "C5prime_xyz": [ -1.134, 8.303, 1.604 ], "P_xyz": [ 1.448, 8.196, 1.082 ], "form": "A", "ssZp": 4.776, "Dp": 4.669, "splay_angle": 25.804, "splay_distance": 4.082, "splay_ratio": 0.227, "d22": null, "d64": null, "eta": 169.086, "theta": -125.281, "eta_prime": -167.302, "theta_prime": -134.109, "eta_base": -102.423, "theta_base": -118.545, "v0": 6.419, "v1": -26.446, "v2": 35.082, "v3": -32.394, "v4": 16.539, "amplitude": 35.468, "phase_angle": 8.464, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.412, "filter_rmsd": 0.010, "frame": { "rmsd": 0.010, "origin": [ -47.604, -12.835, 0.286 ], "x_axis": [ -0.235, -0.367, 0.900 ], "y_axis": [ 0.471, 0.767, 0.436 ], "z_axis": [ -0.850, 0.526, -0.007 ], "quaternion": [ 0.617, -0.037, -0.709, -0.340 ] } }, { "index": 104, "index_chain": 28, "chain_name": "B", "nt_resnum": 27, "nt_name": "U", "nt_code": "U", "nt_id": "///B/27", "linked_nts": [ "///B/26", "///B/28" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop", "alpha": -73.935, "beta": -169.821, "gamma": 43.486, "delta": 81.576, "epsilon": -150.108, "zeta": -66.354, "epsilon_zeta": -83.754, "bb_type": "BI", "chi": -169.173, "glyco_bond": "anti", "C5prime_xyz": [ -1.248, 8.606, 1.052 ], "P_xyz": [ 1.129, 9.056, 2.100 ], "form": ".", "ssZp": 4.609, "Dp": 4.651, "splay_angle": 33.993, "splay_distance": 5.131, "splay_ratio": 0.292, "d22": 4.063, "d64": 4.428, "eta": 160.956, "theta": -144.209, "eta_prime": 173.486, "theta_prime": -137.041, "eta_base": -147.905, "theta_base": -99.149, "v0": 6.454, "v1": -27.614, "v2": 36.845, "v3": -34.235, "v4": 17.749, "amplitude": 37.302, "phase_angle": 8.978, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.640, "filter_rmsd": 0.106, "frame": { "rmsd": 0.006, "origin": [ -51.685, -12.756, 0.290 ], "x_axis": [ 0.383, -0.002, 0.924 ], "y_axis": [ 0.546, 0.807, -0.224 ], "z_axis": [ -0.745, 0.590, 0.310 ], "quaternion": [ 0.791, -0.258, -0.528, -0.173 ] } }, { "index": 105, "index_chain": 29, "chain_name": "B", "nt_resnum": 28, "nt_name": "C", "nt_code": "C", "nt_id": "///B/28", "linked_nts": [ "///B/27", "///B/29" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -59.940, "beta": -177.761, "gamma": 42.551, "delta": 80.782, "epsilon": -148.460, "zeta": -77.364, "epsilon_zeta": -71.096, "bb_type": "BI", "chi": -179.380, "glyco_bond": "anti", "C5prime_xyz": [ -1.281, 8.353, 1.744 ], "P_xyz": [ 1.107, 8.275, 2.854 ], "form": "A", "ssZp": 4.723, "Dp": 4.645, "splay_angle": 23.357, "splay_distance": 3.796, "splay_ratio": 0.214, "d22": null, "d64": null, "eta": 168.723, "theta": -150.535, "eta_prime": -175.495, "theta_prime": -147.630, "eta_base": -124.333, "theta_base": -139.792, "v0": 5.218, "v1": -26.952, "v2": 37.717, "v3": -35.581, "v4": 19.047, "amplitude": 38.416, "phase_angle": 10.950, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.761, "filter_rmsd": 0.063, "frame": { "rmsd": 0.009, "origin": [ -54.881, -10.429, 3.561 ], "x_axis": [ 0.830, 0.345, 0.439 ], "y_axis": [ 0.316, 0.358, -0.879 ], "z_axis": [ -0.460, 0.868, 0.188 ], "quaternion": [ 0.771, -0.567, -0.292, 0.009 ] } }, { "index": 106, "index_chain": 30, "chain_name": "B", "nt_resnum": 29, "nt_name": "G", "nt_code": "G", "nt_id": "///B/29", "linked_nts": [ "///B/28", "///B/30" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -54.093, "beta": 178.450, "gamma": 43.858, "delta": 77.970, "epsilon": -152.619, "zeta": -68.759, "epsilon_zeta": -83.860, "bb_type": "BI", "chi": -164.511, "glyco_bond": "anti", "C5prime_xyz": [ -1.367, 8.752, 0.841 ], "P_xyz": [ 1.166, 9.340, 1.263 ], "form": "A", "ssZp": 4.655, "Dp": 4.672, "splay_angle": 24.476, "splay_distance": 3.986, "splay_ratio": 0.220, "d22": null, "d64": null, "eta": 170.287, "theta": -148.544, "eta_prime": 177.802, "theta_prime": -146.147, "eta_base": -163.872, "theta_base": -120.921, "v0": 1.635, "v1": -25.338, "v2": 38.164, "v3": -38.072, "v4": 22.987, "amplitude": 39.739, "phase_angle": 16.183, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.760, "filter_rmsd": 0.007, "frame": { "rmsd": 0.007, "origin": [ -57.470, -9.700, 6.240 ], "x_axis": [ 0.857, 0.507, 0.088 ], "y_axis": [ -0.078, 0.297, -0.952 ], "z_axis": [ -0.509, 0.809, 0.294 ], "quaternion": [ 0.782, -0.563, -0.191, 0.187 ] } }, { "index": 107, "index_chain": 31, "chain_name": "B", "nt_resnum": 30, "nt_name": "G", "nt_code": "G", "nt_id": "///B/30", "linked_nts": [ "///B/29", "///B/31" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -55.134, "beta": 177.131, "gamma": 46.231, "delta": 78.327, "epsilon": -167.195, "zeta": -69.970, "epsilon_zeta": -97.225, "bb_type": "BI", "chi": -170.998, "glyco_bond": "anti", "C5prime_xyz": [ -1.536, 8.717, 1.282 ], "P_xyz": [ 0.940, 9.365, 1.917 ], "form": ".", "ssZp": 4.723, "Dp": 4.504, "splay_angle": 27.676, "splay_distance": 4.693, "splay_ratio": 0.255, "d22": null, "d64": null, "eta": 168.679, "theta": -135.046, "eta_prime": -177.144, "theta_prime": -137.936, "eta_base": -136.115, "theta_base": -115.352, "v0": -0.026, "v1": -22.905, "v2": 35.896, "v3": -36.888, "v4": 23.303, "amplitude": 37.888, "phase_angle": 18.662, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.826, "filter_rmsd": 0.017, "frame": { "rmsd": 0.017, "origin": [ -57.750, -7.032, 9.188 ], "x_axis": [ 0.780, 0.423, -0.461 ], "y_axis": [ -0.498, -0.026, -0.867 ], "z_axis": [ -0.379, 0.906, 0.190 ], "quaternion": [ 0.697, -0.636, 0.029, 0.330 ] } }, { "index": 108, "index_chain": 32, "chain_name": "B", "nt_resnum": 31, "nt_name": "G", "nt_code": "G", "nt_id": "///B/31", "linked_nts": [ "///B/30", "///B/32" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop", "alpha": 177.854, "beta": -164.720, "gamma": 163.491, "delta": 84.647, "epsilon": -120.752, "zeta": -77.794, "epsilon_zeta": -42.958, "bb_type": "--", "chi": 169.462, "glyco_bond": "anti", "C5prime_xyz": [ -1.858, 8.112, 2.290 ], "P_xyz": [ 0.060, 9.846, 1.940 ], "form": ".", "ssZp": 4.681, "Dp": 4.562, "splay_angle": 30.366, "splay_distance": 4.846, "splay_ratio": 0.266, "d22": null, "d64": null, "eta": 177.669, "theta": -147.076, "eta_prime": -168.740, "theta_prime": -141.817, "eta_base": -130.279, "theta_base": -103.422, "v0": 0.890, "v1": -21.976, "v2": 33.503, "v3": -34.114, "v4": 20.895, "amplitude": 35.093, "phase_angle": 17.314, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.353, "filter_rmsd": 0.012, "frame": { "rmsd": 0.012, "origin": [ -56.463, -3.051, 11.315 ], "x_axis": [ 0.455, 0.281, -0.845 ], "y_axis": [ -0.794, -0.303, -0.528 ], "z_axis": [ -0.404, 0.911, 0.085 ], "quaternion": [ 0.556, -0.647, 0.198, 0.483 ] } }, { "index": 109, "index_chain": 33, "chain_name": "B", "nt_resnum": 32, "nt_name": "C", "nt_code": "C", "nt_id": "///B/32", "linked_nts": [ "///B/31", "///B/33" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-canonical,non-pair-contact,helix,hairpin-loop", "alpha": -52.985, "beta": 163.383, "gamma": 51.108, "delta": 78.011, "epsilon": -124.493, "zeta": -66.579, "epsilon_zeta": -57.914, "bb_type": "--", "chi": -177.981, "glyco_bond": "anti", "C5prime_xyz": [ -1.921, 8.693, 1.357 ], "P_xyz": [ 0.454, 9.281, 2.167 ], "form": ".", "ssZp": 4.467, "Dp": 4.535, "splay_angle": 29.577, "splay_distance": 4.783, "splay_ratio": 0.256, "d22": 4.038, "d64": 3.767, "eta": 169.172, "theta": -122.224, "eta_prime": -171.880, "theta_prime": -117.278, "eta_base": -119.455, "theta_base": -68.962, "v0": -6.074, "v1": -18.930, "v2": 35.310, "v3": -39.757, "v4": 28.959, "amplitude": 39.702, "phase_angle": 27.204, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.525, "filter_rmsd": 0.062, "frame": { "rmsd": 0.006, "origin": [ -56.296, 1.734, 10.566 ], "x_axis": [ -0.180, -0.096, -0.979 ], "y_axis": [ -0.799, -0.566, 0.203 ], "z_axis": [ -0.573, 0.819, 0.026 ], "quaternion": [ 0.264, -0.583, 0.384, 0.666 ] } }, { "index": 110, "index_chain": 34, "chain_name": "B", "nt_resnum": 33, "nt_name": "U", "nt_code": "U", "nt_id": "///B/33", "linked_nts": [ "///B/32", "///B/34" ], "nt_type": "RNA", "dbn": ".", "summary": "u-turn,anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,hairpin-loop,cap-acceptor", "alpha": -55.177, "beta": 178.254, "gamma": 39.995, "delta": 81.608, "epsilon": -143.600, "zeta": -49.168, "epsilon_zeta": -94.432, "bb_type": "BI", "chi": -144.325, "glyco_bond": "anti", "C5prime_xyz": [ -1.566, 8.755, -0.457 ], "P_xyz": [ 0.895, 9.525, -0.061 ], "form": ".", "ssZp": 3.671, "Dp": 4.532, "splay_angle": 64.185, "splay_distance": 9.657, "splay_ratio": 0.533, "d22": 8.662, "d64": 10.358, "eta": 161.625, "theta": -106.947, "eta_prime": -176.481, "theta_prime": -148.824, "eta_base": -112.942, "theta_base": 147.902, "v0": 1.955, "v1": -23.598, "v2": 34.921, "v3": -35.029, "v4": 20.804, "amplitude": 36.281, "phase_angle": 15.734, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.496, "filter_rmsd": 0.102, "frame": { "rmsd": 0.010, "origin": [ -59.345, 3.768, 7.493 ], "x_axis": [ -0.624, -0.681, -0.384 ], "y_axis": [ -0.407, -0.136, 0.903 ], "z_axis": [ -0.667, 0.720, -0.192 ], "quaternion": [ -0.109, -0.420, 0.648, 0.626 ] } }, { "index": 111, "index_chain": 35, "chain_name": "B", "nt_resnum": 34, "nt_name": "C", "nt_code": "C", "nt_id": "///B/34", "linked_nts": [ "///B/33", "///B/35" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,u-turn,~C3'-endo,non-stack,hairpin-loop", "alpha": 171.106, "beta": 148.970, "gamma": 47.880, "delta": 85.022, "epsilon": -125.056, "zeta": -76.771, "epsilon_zeta": -48.286, "bb_type": "--", "chi": 165.960, "glyco_bond": "--", "C5prime_xyz": [ -1.763, 8.052, 2.391 ], "P_xyz": [ 0.700, 7.897, 3.330 ], "form": "A", "ssZp": 4.524, "Dp": 4.554, "splay_angle": 19.554, "splay_distance": 3.136, "splay_ratio": 0.174, "d22": null, "d64": null, "eta": 24.280, "theta": -125.026, "eta_prime": 48.796, "theta_prime": -123.003, "eta_base": 26.975, "theta_base": -84.603, "v0": 2.823, "v1": -23.473, "v2": 33.809, "v3": -33.454, "v4": 19.437, "amplitude": 34.896, "phase_angle": 14.336, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1g", "suiteness": 0.688, "filter_rmsd": 0.062, "frame": { "rmsd": 0.005, "origin": [ -57.222, 11.938, 12.185 ], "x_axis": [ 0.338, 0.032, 0.941 ], "y_axis": [ -0.919, -0.207, 0.337 ], "z_axis": [ 0.205, -0.978, -0.041 ], "quaternion": [ 0.522, 0.630, -0.352, 0.455 ] } }, { "index": 112, "index_chain": 36, "chain_name": "B", "nt_resnum": 35, "nt_name": "A", "nt_code": "A", "nt_id": "///B/35", "linked_nts": [ "///B/34", "///B/36" ], "nt_type": "RNA", "dbn": ".", "summary": "u-turn,anti,~C3'-endo,BI,non-pair-contact,hairpin-loop,cap-donor,phosphate", "alpha": -60.532, "beta": 162.987, "gamma": 52.138, "delta": 82.656, "epsilon": -162.160, "zeta": -66.227, "epsilon_zeta": -95.933, "bb_type": "BI", "chi": -158.770, "glyco_bond": "anti", "C5prime_xyz": [ -1.526, 8.794, 0.339 ], "P_xyz": [ 1.038, 9.276, 0.630 ], "form": ".", "ssZp": 4.058, "Dp": 4.360, "splay_angle": 24.008, "splay_distance": 4.077, "splay_ratio": 0.213, "d22": null, "d64": null, "eta": 159.527, "theta": -147.506, "eta_prime": -176.487, "theta_prime": -151.724, "eta_base": -116.206, "theta_base": -144.051, "v0": -1.120, "v1": -20.175, "v2": 32.520, "v3": -34.257, "v4": 22.390, "amplitude": 34.738, "phase_angle": 20.586, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.661, "filter_rmsd": 0.041, "frame": { "rmsd": 0.013, "origin": [ -55.157, 9.733, 13.028 ], "x_axis": [ -0.381, -0.232, 0.895 ], "y_axis": [ -0.849, -0.297, -0.438 ], "z_axis": [ 0.367, -0.926, -0.084 ], "quaternion": [ 0.244, 0.500, -0.540, 0.631 ] } }, { "index": 113, "index_chain": 37, "chain_name": "B", "nt_resnum": 36, "nt_name": "U", "nt_code": "U", "nt_id": "///B/36", "linked_nts": [ "///B/35", "///B/37" ], "nt_type": "RNA", "dbn": ".", "summary": "u-turn,anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,hairpin-loop,phosphate", "alpha": -66.726, "beta": -178.559, "gamma": 49.138, "delta": 77.525, "epsilon": -156.965, "zeta": -81.709, "epsilon_zeta": -75.256, "bb_type": "BI", "chi": -157.889, "glyco_bond": "anti", "C5prime_xyz": [ -1.844, 8.894, 0.297 ], "P_xyz": [ 0.487, 9.974, 0.839 ], "form": "A", "ssZp": 4.220, "Dp": 4.417, "splay_angle": 25.060, "splay_distance": 4.197, "splay_ratio": 0.221, "d22": null, "d64": null, "eta": 168.674, "theta": -131.656, "eta_prime": 178.491, "theta_prime": -136.280, "eta_base": -160.620, "theta_base": -95.354, "v0": -5.318, "v1": -18.120, "v2": 33.283, "v3": -37.447, "v4": 27.028, "amplitude": 37.278, "phase_angle": 26.769, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.830, "filter_rmsd": 0.103, "frame": { "rmsd": 0.004, "origin": [ -51.771, 7.462, 13.032 ], "x_axis": [ -0.674, -0.242, 0.698 ], "y_axis": [ -0.672, -0.192, -0.715 ], "z_axis": [ 0.308, -0.951, -0.033 ], "quaternion": [ 0.159, 0.371, -0.615, 0.677 ] } }, { "index": 114, "index_chain": 38, "chain_name": "B", "nt_resnum": 37, "nt_name": "A", "nt_code": "A", "nt_id": "///B/37", "linked_nts": [ "///B/36", "///B/38" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-pair-contact,hairpin-loop", "alpha": 141.826, "beta": -150.351, "gamma": 178.860, "delta": 83.570, "epsilon": -108.458, "zeta": -76.511, "epsilon_zeta": -31.946, "bb_type": "--", "chi": 177.129, "glyco_bond": "anti", "C5prime_xyz": [ -1.487, 8.162, 1.872 ], "P_xyz": [ 0.282, 9.851, 0.965 ], "form": ".", "ssZp": 4.676, "Dp": 4.735, "splay_angle": 34.075, "splay_distance": 5.197, "splay_ratio": 0.293, "d22": null, "d64": null, "eta": 164.804, "theta": -142.348, "eta_prime": -179.114, "theta_prime": -135.035, "eta_base": -121.249, "theta_base": -82.421, "v0": 5.191, "v1": -25.666, "v2": 35.273, "v3": -33.474, "v4": 17.835, "amplitude": 35.894, "phase_angle": 10.669, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.750, "filter_rmsd": 0.039, "frame": { "rmsd": 0.006, "origin": [ -52.204, 3.845, 15.117 ], "x_axis": [ -0.988, -0.128, 0.086 ], "y_axis": [ -0.086, -0.002, -0.996 ], "z_axis": [ 0.128, -0.992, -0.009 ], "quaternion": [ 0.015, -0.076, 0.706, -0.704 ] } }, { "index": 115, "index_chain": 39, "chain_name": "B", "nt_resnum": 38, "nt_name": "A", "nt_code": "A", "nt_id": "///B/38", "linked_nts": [ "///B/37", "///B/39" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-canonical,non-pair-contact,helix,hairpin-loop", "alpha": -53.977, "beta": 146.561, "gamma": 59.337, "delta": 80.578, "epsilon": -126.716, "zeta": -66.775, "epsilon_zeta": -59.941, "bb_type": "--", "chi": 175.569, "glyco_bond": "anti", "C5prime_xyz": [ -1.793, 8.335, 1.753 ], "P_xyz": [ 0.765, 8.633, 2.005 ], "form": ".", "ssZp": 4.551, "Dp": 4.710, "splay_angle": 29.560, "splay_distance": 4.557, "splay_ratio": 0.257, "d22": null, "d64": null, "eta": 160.076, "theta": -120.344, "eta_prime": -172.259, "theta_prime": -119.847, "eta_base": -98.302, "theta_base": -68.007, "v0": 2.687, "v1": -25.952, "v2": 37.849, "v3": -37.404, "v4": 22.068, "amplitude": 39.152, "phase_angle": 14.825, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1L", "suiteness": 0.802, "filter_rmsd": 0.038, "frame": { "rmsd": 0.010, "origin": [ -55.254, -0.277, 14.271 ], "x_axis": [ -0.620, 0.129, -0.774 ], "y_axis": [ 0.780, 0.203, -0.592 ], "z_axis": [ 0.081, -0.971, -0.227 ], "quaternion": [ 0.298, 0.318, 0.716, -0.546 ] } }, { "index": 116, "index_chain": 40, "chain_name": "B", "nt_resnum": 39, "nt_name": "C", "nt_code": "C", "nt_id": "///B/39", "linked_nts": [ "///B/38", "///B/40" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop", "alpha": -60.971, "beta": 170.029, "gamma": 48.360, "delta": 83.907, "epsilon": -160.688, "zeta": -59.958, "epsilon_zeta": -100.730, "bb_type": "BI", "chi": -161.819, "glyco_bond": "anti", "C5prime_xyz": [ -1.264, 8.725, 0.623 ], "P_xyz": [ 1.317, 8.981, 1.012 ], "form": "A", "ssZp": 4.386, "Dp": 4.533, "splay_angle": 27.480, "splay_distance": 4.363, "splay_ratio": 0.238, "d22": 4.105, "d64": 4.264, "eta": 157.301, "theta": -138.989, "eta_prime": -176.659, "theta_prime": -139.331, "eta_base": -98.355, "theta_base": -111.929, "v0": 3.879, "v1": -25.077, "v2": 35.438, "v3": -34.290, "v4": 19.321, "amplitude": 36.333, "phase_angle": 12.737, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.706, "filter_rmsd": 0.062, "frame": { "rmsd": 0.007, "origin": [ -56.506, -2.827, 10.707 ], "x_axis": [ 0.368, 0.285, -0.885 ], "y_axis": [ 0.928, -0.057, 0.368 ], "z_axis": [ 0.054, -0.957, -0.286 ], "quaternion": [ 0.506, 0.654, 0.464, -0.318 ] } }, { "index": 117, "index_chain": 41, "chain_name": "B", "nt_resnum": 40, "nt_name": "C", "nt_code": "C", "nt_id": "///B/40", "linked_nts": [ "///B/39", "///B/41" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -68.454, "beta": -170.267, "gamma": 44.389, "delta": 82.406, "epsilon": -154.480, "zeta": -79.089, "epsilon_zeta": -75.392, "bb_type": "BI", "chi": -166.860, "glyco_bond": "anti", "C5prime_xyz": [ -1.302, 8.690, 1.070 ], "P_xyz": [ 1.092, 9.032, 2.151 ], "form": "A", "ssZp": 4.632, "Dp": 4.530, "splay_angle": 24.539, "splay_distance": 3.830, "splay_ratio": 0.213, "d22": 4.536, "d64": 4.543, "eta": 169.482, "theta": -156.167, "eta_prime": -177.605, "theta_prime": -151.205, "eta_base": -135.048, "theta_base": -129.014, "v0": 1.675, "v1": -22.294, "v2": 33.202, "v3": -33.331, "v4": 20.072, "amplitude": 34.552, "phase_angle": 16.069, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.705, "filter_rmsd": 0.063, "frame": { "rmsd": 0.009, "origin": [ -56.893, -6.285, 8.076 ], "x_axis": [ 0.792, 0.461, -0.401 ], "y_axis": [ 0.484, -0.073, 0.872 ], "z_axis": [ 0.373, -0.884, -0.281 ], "quaternion": [ 0.599, 0.732, 0.323, -0.009 ] } }, { "index": 118, "index_chain": 42, "chain_name": "B", "nt_resnum": 41, "nt_name": "C", "nt_code": "C", "nt_id": "///B/41", "linked_nts": [ "///B/40", "///B/42" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -60.303, "beta": 173.225, "gamma": 50.684, "delta": 85.021, "epsilon": -160.141, "zeta": -57.754, "epsilon_zeta": -102.387, "bb_type": "BI", "chi": -168.311, "glyco_bond": "anti", "C5prime_xyz": [ -1.362, 8.664, 1.030 ], "P_xyz": [ 1.155, 8.878, 1.706 ], "form": "A", "ssZp": 4.409, "Dp": 4.462, "splay_angle": 21.231, "splay_distance": 3.638, "splay_ratio": 0.193, "d22": null, "d64": null, "eta": 171.823, "theta": -136.052, "eta_prime": -177.108, "theta_prime": -138.195, "eta_base": -146.433, "theta_base": -121.906, "v0": 3.128, "v1": -24.253, "v2": 34.782, "v3": -34.151, "v4": 19.628, "amplitude": 35.824, "phase_angle": 13.853, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.899, "filter_rmsd": 0.062, "frame": { "rmsd": 0.005, "origin": [ -56.636, -9.317, 5.750 ], "x_axis": [ 0.854, 0.511, 0.096 ], "y_axis": [ 0.042, -0.252, 0.967 ], "z_axis": [ 0.518, -0.822, -0.237 ], "quaternion": [ 0.584, 0.765, 0.181, 0.201 ] } }, { "index": 119, "index_chain": 43, "chain_name": "B", "nt_resnum": 42, "nt_name": "G", "nt_code": "G", "nt_id": "///B/42", "linked_nts": [ "///B/41", "///B/43" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -71.352, "beta": -179.618, "gamma": 52.961, "delta": 78.710, "epsilon": -173.495, "zeta": -76.994, "epsilon_zeta": -96.501, "bb_type": "BI", "chi": -166.759, "glyco_bond": "anti", "C5prime_xyz": [ -2.013, 8.877, 0.734 ], "P_xyz": [ 0.281, 9.867, 1.495 ], "form": "A", "ssZp": 4.210, "Dp": 4.269, "splay_angle": 24.208, "splay_distance": 4.111, "splay_ratio": 0.219, "d22": null, "d64": null, "eta": 164.887, "theta": -145.535, "eta_prime": -176.897, "theta_prime": -151.742, "eta_base": -140.645, "theta_base": -130.057, "v0": -6.042, "v1": -18.252, "v2": 34.067, "v3": -38.594, "v4": 28.157, "amplitude": 38.401, "phase_angle": 27.483, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.786, "filter_rmsd": 0.009, "frame": { "rmsd": 0.009, "origin": [ -54.835, -10.912, 3.020 ], "x_axis": [ 0.732, 0.409, 0.545 ], "y_axis": [ -0.349, -0.462, 0.815 ], "z_axis": [ 0.585, -0.787, -0.195 ], "quaternion": [ 0.518, 0.773, 0.019, 0.366 ] } }, { "index": 120, "index_chain": 44, "chain_name": "B", "nt_resnum": 43, "nt_name": "A", "nt_code": "A", "nt_id": "///B/43", "linked_nts": [ "///B/42", "///B/44" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop", "alpha": 168.172, "beta": -166.127, "gamma": 170.462, "delta": 85.700, "epsilon": -134.380, "zeta": -84.227, "epsilon_zeta": -50.153, "bb_type": "BI", "chi": 174.138, "glyco_bond": "anti", "C5prime_xyz": [ -1.673, 8.183, 1.947 ], "P_xyz": [ 0.262, 9.882, 1.474 ], "form": "A", "ssZp": 4.307, "Dp": 4.491, "splay_angle": 25.201, "splay_distance": 4.096, "splay_ratio": 0.222, "d22": null, "d64": null, "eta": 175.576, "theta": -166.101, "eta_prime": -175.293, "theta_prime": -160.273, "eta_base": -139.749, "theta_base": -140.761, "v0": 3.213, "v1": -22.698, "v2": 32.546, "v3": -31.994, "v4": 18.088, "amplitude": 33.480, "phase_angle": 13.567, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.697, "filter_rmsd": 0.039, "frame": { "rmsd": 0.008, "origin": [ -51.833, -12.310, 0.585 ], "x_axis": [ 0.474, 0.166, 0.865 ], "y_axis": [ -0.683, -0.551, 0.480 ], "z_axis": [ 0.556, -0.818, -0.148 ], "quaternion": [ 0.440, 0.737, -0.175, 0.482 ] } }, { "index": 121, "index_chain": 45, "chain_name": "B", "nt_resnum": 44, "nt_name": "A", "nt_code": "A", "nt_id": "///B/44", "linked_nts": [ "///B/43", "///B/45" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,junction-loop", "alpha": -46.865, "beta": 155.684, "gamma": 59.379, "delta": 81.554, "epsilon": -142.174, "zeta": -67.593, "epsilon_zeta": -74.582, "bb_type": "BI", "chi": -168.302, "glyco_bond": "anti", "C5prime_xyz": [ -1.947, 8.847, 0.849 ], "P_xyz": [ 0.551, 9.513, 1.295 ], "form": ".", "ssZp": 4.031, "Dp": 4.226, "splay_angle": 24.075, "splay_distance": 3.868, "splay_ratio": 0.209, "d22": null, "d64": null, "eta": -179.087, "theta": -134.635, "eta_prime": -162.580, "theta_prime": -133.912, "eta_base": -134.803, "theta_base": -71.911, "v0": -3.856, "v1": -18.894, "v2": 33.214, "v3": -36.315, "v4": 25.518, "amplitude": 36.529, "phase_angle": 24.597, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.560, "filter_rmsd": 0.041, "frame": { "rmsd": 0.009, "origin": [ -48.620, -13.691, -1.548 ], "x_axis": [ 0.234, -0.252, 0.939 ], "y_axis": [ -0.838, -0.542, 0.063 ], "z_axis": [ 0.493, -0.801, -0.338 ], "quaternion": [ 0.297, 0.727, -0.375, 0.492 ] } }, { "index": 122, "index_chain": 46, "chain_name": "B", "nt_resnum": 45, "nt_name": "G", "nt_code": "G", "nt_id": "///B/45", "linked_nts": [ "///B/44", "///B/46" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-canonical,non-pair-contact,multiplet,junction-loop", "alpha": -64.576, "beta": 162.985, "gamma": 54.408, "delta": 85.814, "epsilon": -123.773, "zeta": -96.486, "epsilon_zeta": -27.286, "bb_type": "--", "chi": -148.198, "glyco_bond": "anti", "C5prime_xyz": [ -1.086, 8.797, -0.260 ], "P_xyz": [ 1.561, 8.944, -0.398 ], "form": ".", "ssZp": 3.573, "Dp": 4.574, "splay_angle": 43.600, "splay_distance": 7.096, "splay_ratio": 0.373, "d22": null, "d64": null, "eta": 168.360, "theta": -144.883, "eta_prime": -171.369, "theta_prime": -137.117, "eta_base": -95.715, "theta_base": -119.809, "v0": 4.291, "v1": -24.202, "v2": 33.684, "v3": -32.203, "v4": 17.800, "amplitude": 34.401, "phase_angle": 11.722, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.890, "filter_rmsd": 0.012, "frame": { "rmsd": 0.012, "origin": [ -47.506, -17.225, -0.440 ], "x_axis": [ -0.525, -0.643, 0.558 ], "y_axis": [ -0.581, -0.209, -0.787 ], "z_axis": [ 0.622, -0.737, -0.264 ], "quaternion": [ 0.026, -0.487, 0.629, -0.606 ] } }, { "index": 123, "index_chain": 47, "chain_name": "B", "nt_resnum": 46, "nt_name": "G", "nt_code": "G", "nt_id": "///B/46", "linked_nts": [ "///B/45", "///B/47" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-pair-contact,junction-loop,splayed-apart", "alpha": -50.493, "beta": 175.165, "gamma": 60.350, "delta": 84.635, "epsilon": -112.970, "zeta": -72.384, "epsilon_zeta": -40.586, "bb_type": "--", "chi": -111.637, "glyco_bond": "anti", "C5prime_xyz": [ -2.072, 8.196, -2.190 ], "P_xyz": [ 0.213, 8.466, -3.479 ], "form": ".", "ssZp": 1.229, "Dp": 4.474, "splay_angle": 161.238, "splay_distance": 17.621, "splay_ratio": 0.987, "d22": null, "d64": null, "eta": -158.171, "theta": -131.259, "eta_prime": -153.196, "theta_prime": -164.546, "eta_base": -144.316, "theta_base": 110.862, "v0": 0.029, "v1": -21.405, "v2": 33.147, "v3": -34.344, "v4": 21.689, "amplitude": 35.001, "phase_angle": 18.735, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.370, "filter_rmsd": 0.009, "frame": { "rmsd": 0.009, "origin": [ -44.254, -23.147, -2.610 ], "x_axis": [ -0.709, -0.688, 0.158 ], "y_axis": [ -0.292, 0.082, -0.953 ], "z_axis": [ 0.643, -0.721, -0.258 ], "quaternion": [ 0.169, -0.342, 0.716, -0.585 ] } }, { "index": 124, "index_chain": 48, "chain_name": "B", "nt_resnum": 47, "nt_name": "U", "nt_code": "U", "nt_id": "///B/47", "linked_nts": [ "///B/46", "///B/48" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,~C3'-endo,non-stack,junction-loop,splayed-apart", "alpha": -64.718, "beta": -105.036, "gamma": 168.952, "delta": 85.830, "epsilon": -149.912, "zeta": 70.536, "epsilon_zeta": 139.552, "bb_type": "--", "chi": -89.196, "glyco_bond": "--", "C5prime_xyz": [ -2.634, 7.380, -2.943 ], "P_xyz": [ -2.474, 5.345, -4.603 ], "form": ".", "ssZp": 0.381, "Dp": 4.329, "splay_angle": 133.653, "splay_distance": 18.378, "splay_ratio": 0.919, "d22": 9.756, "d64": 13.161, "eta": -23.967, "theta": -15.214, "eta_prime": 16.086, "theta_prime": -36.146, "eta_base": 85.064, "theta_base": -37.273, "v0": -0.168, "v1": -20.600, "v2": 32.313, "v3": -33.522, "v4": 21.279, "amplitude": 34.188, "phase_angle": 19.065, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.105, "frame": { "rmsd": 0.007, "origin": [ -43.822, -19.396, -19.821 ], "x_axis": [ 0.749, 0.663, 0.013 ], "y_axis": [ 0.496, -0.573, 0.652 ], "z_axis": [ 0.440, -0.482, -0.758 ], "quaternion": [ 0.323, 0.878, 0.330, 0.129 ] } }, { "index": 125, "index_chain": 49, "chain_name": "B", "nt_resnum": 48, "nt_name": "C", "nt_code": "C", "nt_id": "///B/48", "linked_nts": [ "///B/47", "///B/49" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,anti,~C2'-endo,non-canonical,non-pair-contact,helix-end,junction-loop,cap-acceptor,splayed-apart", "alpha": -74.772, "beta": -146.412, "gamma": 58.364, "delta": 139.235, "epsilon": -161.475, "zeta": 148.911, "epsilon_zeta": 49.614, "bb_type": "--", "chi": -139.270, "glyco_bond": "anti", "C5prime_xyz": [ -1.875, 8.827, -0.100 ], "P_xyz": [ 0.066, 9.563, 1.531 ], "form": ".", "ssZp": 2.485, "Dp": 2.236, "splay_angle": 143.412, "splay_distance": 17.253, "splay_ratio": 0.950, "d22": null, "d64": null, "eta": -151.231, "theta": 101.359, "eta_prime": -96.118, "theta_prime": 65.225, "eta_base": -79.440, "theta_base": -112.110, "v0": -22.022, "v1": 33.837, "v2": -32.063, "v3": 20.252, "v4": 0.886, "amplitude": 34.186, "phase_angle": 159.704, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.011, "origin": [ -38.339, -26.948, -3.990 ], "x_axis": [ -0.704, -0.704, 0.090 ], "y_axis": [ -0.274, 0.152, -0.950 ], "z_axis": [ 0.655, -0.693, -0.300 ], "quaternion": [ 0.192, -0.333, 0.734, -0.559 ] } }, { "index": 126, "index_chain": 50, "chain_name": "B", "nt_resnum": 49, "nt_name": "G", "nt_code": "G", "nt_id": "///B/49", "linked_nts": [ "///B/48", "///B/50" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop,phosphate,splayed-apart", "alpha": -29.637, "beta": -119.015, "gamma": 74.582, "delta": 88.187, "epsilon": -176.002, "zeta": -73.880, "epsilon_zeta": -102.122, "bb_type": "BI", "chi": -155.223, "glyco_bond": "anti", "C5prime_xyz": [ -1.509, 8.836, 0.230 ], "P_xyz": [ 0.929, 8.674, 1.244 ], "form": ".", "ssZp": 4.062, "Dp": 4.153, "splay_angle": 18.823, "splay_distance": 3.050, "splay_ratio": 0.164, "d22": null, "d64": null, "eta": -56.330, "theta": -117.919, "eta_prime": -40.718, "theta_prime": -127.925, "eta_base": 143.712, "theta_base": -81.419, "v0": -0.643, "v1": -20.401, "v2": 32.421, "v3": -33.820, "v4": 21.681, "amplitude": 34.438, "phase_angle": 19.708, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.003, "frame": { "rmsd": 0.003, "origin": [ -27.745, -24.402, -17.366 ], "x_axis": [ 0.312, -0.684, 0.660 ], "y_axis": [ -0.735, 0.266, 0.624 ], "z_axis": [ -0.602, -0.680, -0.419 ], "quaternion": [ 0.538, 0.605, -0.586, 0.024 ] } }, { "index": 127, "index_chain": 51, "chain_name": "B", "nt_resnum": 50, "nt_name": "U", "nt_code": "U", "nt_id": "///B/50", "linked_nts": [ "///B/49", "///B/51" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": 158.991, "beta": -153.161, "gamma": 158.079, "delta": 82.102, "epsilon": -113.876, "zeta": -108.590, "epsilon_zeta": -5.286, "bb_type": "--", "chi": -155.634, "glyco_bond": "anti", "C5prime_xyz": [ -1.118, 8.578, 0.316 ], "P_xyz": [ 0.698, 9.299, -1.400 ], "form": "A", "ssZp": 3.928, "Dp": 4.768, "splay_angle": 25.482, "splay_distance": 4.059, "splay_ratio": 0.221, "d22": 4.175, "d64": 3.881, "eta": 160.153, "theta": -166.168, "eta_prime": 179.019, "theta_prime": -164.236, "eta_base": -112.631, "theta_base": -152.919, "v0": 5.766, "v1": -26.367, "v2": 35.981, "v3": -33.914, "v4": 17.630, "amplitude": 36.530, "phase_angle": 9.942, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.294, "filter_rmsd": 0.106, "frame": { "rmsd": 0.009, "origin": [ -28.519, -27.345, -17.181 ], "x_axis": [ -0.343, -0.486, 0.804 ], "y_axis": [ -0.897, 0.424, -0.127 ], "z_axis": [ -0.279, -0.765, -0.581 ], "quaternion": [ -0.353, -0.451, 0.766, -0.291 ] } }, { "index": 128, "index_chain": 52, "chain_name": "B", "nt_resnum": 51, "nt_name": "C", "nt_code": "C", "nt_id": "///B/51", "linked_nts": [ "///B/50", "///B/52" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -53.127, "beta": 143.132, "gamma": 51.187, "delta": 83.060, "epsilon": -151.222, "zeta": -45.701, "epsilon_zeta": -105.521, "bb_type": "BI", "chi": -166.350, "glyco_bond": "anti", "C5prime_xyz": [ -1.545, 8.795, 0.847 ], "P_xyz": [ 1.078, 8.966, 0.855 ], "form": ".", "ssZp": 4.383, "Dp": 4.495, "splay_angle": 19.973, "splay_distance": 3.788, "splay_ratio": 0.193, "d22": null, "d64": null, "eta": 159.293, "theta": -97.213, "eta_prime": 170.489, "theta_prime": -116.259, "eta_base": -168.282, "theta_base": -101.117, "v0": -0.252, "v1": -21.895, "v2": 34.428, "v3": -35.648, "v4": 22.577, "amplitude": 36.422, "phase_angle": 19.047, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1L", "suiteness": 0.659, "filter_rmsd": 0.061, "frame": { "rmsd": 0.007, "origin": [ -29.010, -30.657, -19.475 ], "x_axis": [ -0.367, 0.182, 0.912 ], "y_axis": [ -0.705, 0.586, -0.400 ], "z_axis": [ -0.607, -0.790, -0.086 ], "quaternion": [ 0.532, 0.183, -0.714, 0.417 ] } }, { "index": 129, "index_chain": 53, "chain_name": "B", "nt_resnum": 52, "nt_name": "G", "nt_code": "G", "nt_id": "///B/52", "linked_nts": [ "///B/51", "///B/53" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": 159.861, "beta": 147.431, "gamma": -178.582, "delta": 139.987, "epsilon": -163.947, "zeta": -96.894, "epsilon_zeta": -67.053, "bb_type": "BI", "chi": -153.244, "glyco_bond": "anti", "C5prime_xyz": [ -1.359, 8.612, 0.766 ], "P_xyz": [ -0.135, 10.641, -0.374 ], "form": ".", "ssZp": 2.891, "Dp": 2.513, "splay_angle": 28.252, "splay_distance": 4.807, "splay_ratio": 0.248, "d22": null, "d64": null, "eta": 169.932, "theta": 176.029, "eta_prime": -170.849, "theta_prime": -176.138, "eta_base": -135.017, "theta_base": -144.246, "v0": -16.949, "v1": 29.269, "v2": -29.803, "v3": 20.696, "v4": -2.502, "amplitude": 30.727, "phase_angle": 165.912, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32t", "cluster": "1t", "suiteness": 0.102, "filter_rmsd": 0.015, "frame": { "rmsd": 0.015, "origin": [ -30.076, -33.243, -16.919 ], "x_axis": [ -0.298, 0.849, 0.436 ], "y_axis": [ -0.524, 0.236, -0.818 ], "z_axis": [ -0.798, -0.473, 0.374 ], "quaternion": [ 0.573, -0.151, -0.538, 0.599 ] } }, { "index": 130, "index_chain": 54, "chain_name": "B", "nt_resnum": 53, "nt_name": "G", "nt_code": "G", "nt_id": "///B/53", "linked_nts": [ "///B/52", "///B/54" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop,kissing-loop,phosphate", "alpha": -60.797, "beta": 175.482, "gamma": 42.821, "delta": 80.339, "epsilon": -154.025, "zeta": -69.595, "epsilon_zeta": -84.430, "bb_type": "BI", "chi": -165.277, "glyco_bond": "anti", "C5prime_xyz": [ -2.049, 8.933, 0.635 ], "P_xyz": [ 0.106, 9.974, 1.760 ], "form": "A", "ssZp": 4.059, "Dp": 4.230, "splay_angle": 21.758, "splay_distance": 3.639, "splay_ratio": 0.192, "d22": null, "d64": null, "eta": 167.481, "theta": -149.750, "eta_prime": -179.562, "theta_prime": -148.521, "eta_base": -138.683, "theta_base": -120.137, "v0": -6.784, "v1": -15.558, "v2": 30.738, "v3": -35.660, "v4": 26.684, "amplitude": 35.324, "phase_angle": 29.522, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.008, "frame": { "rmsd": 0.008, "origin": [ -31.769, -36.764, -14.119 ], "x_axis": [ -0.664, 0.742, 0.096 ], "y_axis": [ -0.121, 0.020, -0.992 ], "z_axis": [ -0.738, -0.670, 0.076 ], "quaternion": [ 0.329, -0.245, -0.634, 0.656 ] } }, { "index": 131, "index_chain": 55, "chain_name": "B", "nt_resnum": 54, "nt_name": "5MU", "nt_code": "t", "is_modified": true, "nt_id": "///B/54", "linked_nts": [ "///B/53", "///B/55" ], "nt_type": "RNA", "dbn": ".", "summary": "modified,anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,hairpin-loop,kissing-loop", "alpha": -68.295, "beta": -174.395, "gamma": 39.667, "delta": 79.217, "epsilon": -144.360, "zeta": -69.618, "epsilon_zeta": -74.742, "bb_type": "BI", "chi": -152.999, "glyco_bond": "anti", "C5prime_xyz": [ -1.478, 8.847, 0.106 ], "P_xyz": [ 0.939, 9.748, 0.665 ], "form": ".", "ssZp": 4.214, "Dp": 4.623, "splay_angle": 26.221, "splay_distance": 4.203, "splay_ratio": 0.227, "d22": 4.190, "d64": 4.034, "eta": 160.738, "theta": -143.301, "eta_prime": 169.501, "theta_prime": -135.900, "eta_base": -152.677, "theta_base": -91.577, "v0": -0.069, "v1": -21.879, "v2": 34.215, "v3": -35.371, "v4": 22.378, "amplitude": 36.153, "phase_angle": 18.844, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.640, "filter_rmsd": 0.108, "frame": { "rmsd": 0.005, "origin": [ -34.250, -38.697, -12.289 ], "x_axis": [ -0.526, 0.701, -0.482 ], "y_axis": [ 0.251, -0.414, -0.875 ], "z_axis": [ -0.813, -0.581, 0.041 ], "quaternion": [ 0.160, -0.460, -0.517, 0.704 ] } }, { "index": 132, "index_chain": 56, "chain_name": "B", "nt_resnum": 55, "nt_name": "U", "nt_code": "U", "nt_id": "///B/55", "linked_nts": [ "///B/54", "///B/56" ], "nt_type": "RNA", "dbn": ".", "summary": "u-turn,anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,hairpin-loop,kissing-loop,cap-acceptor", "alpha": -53.136, "beta": 170.663, "gamma": 48.509, "delta": 79.216, "epsilon": -138.287, "zeta": -68.815, "epsilon_zeta": -69.472, "bb_type": "BI", "chi": -142.814, "glyco_bond": "anti", "C5prime_xyz": [ -1.353, 8.765, -0.499 ], "P_xyz": [ 1.216, 9.212, -0.841 ], "form": ".", "ssZp": 3.731, "Dp": 4.710, "splay_angle": 70.935, "splay_distance": 11.009, "splay_ratio": 0.580, "d22": 8.097, "d64": 10.617, "eta": 171.632, "theta": -116.043, "eta_prime": -170.630, "theta_prime": -154.958, "eta_base": -117.523, "theta_base": 148.799, "v0": 3.373, "v1": -25.601, "v2": 37.020, "v3": -35.965, "v4": 20.671, "amplitude": 38.096, "phase_angle": 13.646, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.842, "filter_rmsd": 0.107, "frame": { "rmsd": 0.006, "origin": [ -38.227, -38.616, -13.646 ], "x_axis": [ -0.145, 0.284, -0.948 ], "y_axis": [ 0.347, -0.883, -0.317 ], "z_axis": [ -0.927, -0.375, 0.029 ], "quaternion": [ -0.022, -0.654, -0.241, 0.717 ] } }, { "index": 133, "index_chain": 57, "chain_name": "B", "nt_resnum": 56, "nt_name": "C", "nt_code": "C", "nt_id": "///B/56", "linked_nts": [ "///B/55", "///B/57" ], "nt_type": "RNA", "dbn": "]", "summary": "pseudoknotted,turn,u-turn,anti,~C3'-endo,BI,isolated-canonical,non-pair-contact,helix-end,hairpin-loop,kissing-loop", "alpha": 176.351, "beta": 168.737, "gamma": 51.269, "delta": 84.704, "epsilon": -138.933, "zeta": -70.599, "epsilon_zeta": -68.334, "bb_type": "BI", "chi": -159.427, "glyco_bond": "anti", "C5prime_xyz": [ -1.672, 8.905, 0.343 ], "P_xyz": [ 0.828, 9.501, 0.981 ], "form": "B", "ssZp": 3.880, "Dp": 4.310, "splay_angle": 26.441, "splay_distance": 4.329, "splay_ratio": 0.229, "d22": null, "d64": null, "eta": 38.856, "theta": -132.148, "eta_prime": 59.395, "theta_prime": -129.525, "eta_base": 32.716, "theta_base": -85.467, "v0": -1.184, "v1": -19.798, "v2": 31.986, "v3": -33.718, "v4": 22.074, "amplitude": 34.191, "phase_angle": 20.689, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1g", "suiteness": 0.903, "filter_rmsd": 0.064, "frame": { "rmsd": 0.010, "origin": [ -41.311, -45.546, -5.666 ], "x_axis": [ 0.841, -0.453, 0.297 ], "y_axis": [ 0.169, -0.301, -0.939 ], "z_axis": [ 0.515, 0.839, -0.176 ], "quaternion": [ 0.584, -0.761, 0.093, -0.266 ] } }, { "index": 134, "index_chain": 58, "chain_name": "B", "nt_resnum": 57, "nt_name": "A", "nt_code": "A", "nt_id": "///B/57", "linked_nts": [ "///B/56", "///B/58" ], "nt_type": "RNA", "dbn": ".", "summary": "u-turn,anti,~C3'-endo,BI,non-pair-contact,hairpin-loop,kissing-loop,cap-donor,phosphate", "alpha": -65.141, "beta": 170.021, "gamma": 49.517, "delta": 84.222, "epsilon": -146.523, "zeta": -68.332, "epsilon_zeta": -78.192, "bb_type": "BI", "chi": -148.027, "glyco_bond": "anti", "C5prime_xyz": [ -1.383, 8.751, -0.217 ], "P_xyz": [ 1.227, 9.175, -0.200 ], "form": ".", "ssZp": 3.902, "Dp": 4.528, "splay_angle": 42.576, "splay_distance": 6.742, "splay_ratio": 0.363, "d22": null, "d64": null, "eta": 162.048, "theta": -142.825, "eta_prime": -177.949, "theta_prime": -132.596, "eta_base": -120.710, "theta_base": -119.108, "v0": 0.515, "v1": -21.588, "v2": 33.200, "v3": -34.034, "v4": 21.174, "amplitude": 34.899, "phase_angle": 17.952, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.906, "filter_rmsd": 0.039, "frame": { "rmsd": 0.004, "origin": [ -37.561, -43.515, -6.410 ], "x_axis": [ 0.588, -0.680, -0.438 ], "y_axis": [ -0.457, 0.167, -0.874 ], "z_axis": [ 0.667, 0.714, -0.212 ], "quaternion": [ 0.621, -0.639, 0.445, -0.090 ] } }, { "index": 135, "index_chain": 59, "chain_name": "B", "nt_resnum": 58, "nt_name": "A", "nt_code": "A", "nt_id": "///B/58", "linked_nts": [ "///B/57", "///B/59" ], "nt_type": "RNA", "dbn": ".", "summary": "u-turn,anti,~C2'-endo,BII,non-canonical,non-pair-contact,helix,hairpin-loop,kissing-loop,phosphate", "alpha": -51.068, "beta": -144.391, "gamma": 57.758, "delta": 148.308, "epsilon": -83.024, "zeta": 177.585, "epsilon_zeta": 99.391, "bb_type": "BII", "chi": -77.485, "glyco_bond": "anti", "C5prime_xyz": [ -2.730, 7.144, -2.909 ], "P_xyz": [ -0.492, 8.542, -3.108 ], "form": ".", "ssZp": -0.189, "Dp": 0.436, "splay_angle": 75.375, "splay_distance": 11.902, "splay_ratio": 0.612, "d22": null, "d64": null, "eta": -126.452, "theta": -137.976, "eta_prime": -109.519, "theta_prime": 176.455, "eta_base": -113.557, "theta_base": 148.045, "v0": -17.924, "v1": 32.743, "v2": -34.081, "v3": 24.850, "v4": -4.585, "amplitude": 34.772, "phase_angle": 168.556, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1[", "suiteness": 0.821, "filter_rmsd": 0.038, "frame": { "rmsd": 0.005, "origin": [ -32.590, -39.623, -8.778 ], "x_axis": [ 0.272, -0.682, -0.679 ], "y_axis": [ -0.612, 0.421, -0.669 ], "z_axis": [ 0.742, 0.598, -0.303 ], "quaternion": [ 0.590, -0.537, 0.602, -0.030 ] } }, { "index": 136, "index_chain": 60, "chain_name": "B", "nt_resnum": 59, "nt_name": "A", "nt_code": "A", "nt_id": "///B/59", "linked_nts": [ "///B/58", "///B/60" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,anti,~C3'-endo,BI,non-pair-contact,hairpin-loop,kissing-loop,cap-donor", "alpha": 80.370, "beta": -159.844, "gamma": 64.672, "delta": 82.699, "epsilon": -131.083, "zeta": -60.741, "epsilon_zeta": -70.342, "bb_type": "BI", "chi": -172.435, "glyco_bond": "anti", "C5prime_xyz": [ -1.532, 8.637, 1.129 ], "P_xyz": [ 0.853, 9.025, 2.156 ], "form": ".", "ssZp": 4.454, "Dp": 4.622, "splay_angle": 30.396, "splay_distance": 4.791, "splay_ratio": 0.262, "d22": null, "d64": null, "eta": 24.106, "theta": -118.088, "eta_prime": 33.398, "theta_prime": -104.941, "eta_base": 55.686, "theta_base": -49.376, "v0": 1.370, "v1": -23.605, "v2": 35.358, "v3": -35.706, "v4": 21.843, "amplitude": 36.908, "phase_angle": 16.664, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "4d", "suiteness": 0.527, "filter_rmsd": 0.040, "frame": { "rmsd": 0.007, "origin": [ -36.434, -31.152, -1.354 ], "x_axis": [ -0.774, -0.589, 0.233 ], "y_axis": [ -0.373, 0.128, -0.919 ], "z_axis": [ 0.512, -0.798, -0.319 ], "quaternion": [ 0.094, -0.323, 0.745, -0.576 ] } }, { "index": 137, "index_chain": 61, "chain_name": "B", "nt_resnum": 60, "nt_name": "U", "nt_code": "U", "nt_id": "///B/60", "linked_nts": [ "///B/59", "///B/61" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C2'-endo,non-pair-contact,hairpin-loop,kissing-loop,phosphate", "alpha": -50.441, "beta": 170.703, "gamma": 54.812, "delta": 142.711, "epsilon": -103.754, "zeta": -68.218, "epsilon_zeta": -35.536, "bb_type": "--", "chi": -120.970, "glyco_bond": "anti", "C5prime_xyz": [ -1.910, 8.502, -1.102 ], "P_xyz": [ 0.556, 9.173, -0.552 ], "form": ".", "ssZp": 1.018, "Dp": 1.127, "splay_angle": 79.784, "splay_distance": 12.588, "splay_ratio": 0.642, "d22": 6.474, "d64": 6.722, "eta": -170.183, "theta": -51.176, "eta_prime": -129.339, "theta_prime": -75.450, "eta_base": -66.835, "theta_base": -45.665, "v0": -18.475, "v1": 32.393, "v2": -32.914, "v3": 23.381, "v4": -3.286, "amplitude": 33.840, "phase_angle": 166.564, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1b", "suiteness": 0.788, "filter_rmsd": 0.104, "frame": { "rmsd": 0.005, "origin": [ -38.724, -35.071, -2.889 ], "x_axis": [ -0.807, 0.026, -0.590 ], "y_axis": [ 0.568, 0.307, -0.764 ], "z_axis": [ 0.161, -0.952, -0.262 ], "quaternion": [ 0.243, 0.193, 0.771, -0.556 ] } }, { "index": 138, "index_chain": 62, "chain_name": "B", "nt_resnum": 61, "nt_name": "C", "nt_code": "C", "nt_id": "///B/61", "linked_nts": [ "///B/60", "///B/62" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop,kissing-loop,phosphate", "alpha": -96.601, "beta": -169.790, "gamma": 44.288, "delta": 84.153, "epsilon": -157.709, "zeta": -71.338, "epsilon_zeta": -86.372, "bb_type": "BI", "chi": -150.226, "glyco_bond": "anti", "C5prime_xyz": [ -1.225, 8.763, -0.106 ], "P_xyz": [ 1.276, 9.262, 0.590 ], "form": ".", "ssZp": 3.993, "Dp": 4.486, "splay_angle": 31.613, "splay_distance": 5.103, "splay_ratio": 0.273, "d22": 4.689, "d64": 4.888, "eta": 123.325, "theta": -150.915, "eta_prime": 167.048, "theta_prime": -146.431, "eta_base": -159.338, "theta_base": -127.218, "v0": 3.524, "v1": -24.324, "v2": 34.674, "v3": -33.813, "v4": 19.097, "amplitude": 35.617, "phase_angle": 13.217, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "2a", "suiteness": 0.464, "filter_rmsd": 0.064, "frame": { "rmsd": 0.008, "origin": [ -32.957, -37.235, -13.866 ], "x_axis": [ -0.560, 0.826, 0.057 ], "y_axis": [ 0.447, 0.243, 0.861 ], "z_axis": [ 0.697, 0.508, -0.505 ], "quaternion": [ 0.211, 0.419, 0.760, 0.450 ] } }, { "index": 139, "index_chain": 63, "chain_name": "B", "nt_resnum": 62, "nt_name": "C", "nt_code": "C", "nt_id": "///B/62", "linked_nts": [ "///B/61", "///B/63" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -63.796, "beta": -170.788, "gamma": 46.593, "delta": 84.577, "epsilon": -158.128, "zeta": -91.844, "epsilon_zeta": -66.284, "bb_type": "BI", "chi": -156.203, "glyco_bond": "anti", "C5prime_xyz": [ -1.368, 8.807, 0.314 ], "P_xyz": [ 1.092, 9.330, 1.090 ], "form": "A", "ssZp": 4.238, "Dp": 4.453, "splay_angle": 25.537, "splay_distance": 4.220, "splay_ratio": 0.223, "d22": null, "d64": null, "eta": 174.328, "theta": -135.020, "eta_prime": -176.700, "theta_prime": -141.921, "eta_base": -151.655, "theta_base": -121.857, "v0": 0.556, "v1": -21.645, "v2": 33.274, "v3": -34.128, "v4": 21.072, "amplitude": 34.959, "phase_angle": 17.860, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.801, "filter_rmsd": 0.062, "frame": { "rmsd": 0.005, "origin": [ -30.039, -34.807, -17.277 ], "x_axis": [ -0.555, 0.628, 0.545 ], "y_axis": [ 0.522, -0.247, 0.817 ], "z_axis": [ 0.648, 0.738, -0.190 ], "quaternion": [ 0.042, 0.470, 0.612, 0.635 ] } }, { "index": 140, "index_chain": 64, "chain_name": "B", "nt_resnum": 63, "nt_name": "G", "nt_code": "G", "nt_id": "///B/63", "linked_nts": [ "///B/62", "///B/64" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": 154.421, "beta": -152.898, "gamma": 168.310, "delta": 84.948, "epsilon": -164.266, "zeta": -49.206, "epsilon_zeta": -115.060, "bb_type": "BI", "chi": 176.749, "glyco_bond": "anti", "C5prime_xyz": [ -1.238, 8.175, 2.013 ], "P_xyz": [ 0.598, 9.702, 0.910 ], "form": "A", "ssZp": 4.749, "Dp": 4.545, "splay_angle": 24.021, "splay_distance": 3.874, "splay_ratio": 0.222, "d22": null, "d64": null, "eta": 154.090, "theta": -147.158, "eta_prime": 173.205, "theta_prime": -148.877, "eta_base": -145.727, "theta_base": -124.302, "v0": 3.933, "v1": -23.978, "v2": 33.905, "v3": -32.651, "v4": 18.162, "amplitude": 34.712, "phase_angle": 12.379, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.524, "filter_rmsd": 0.016, "frame": { "rmsd": 0.016, "origin": [ -28.700, -31.161, -18.927 ], "x_axis": [ -0.361, 0.336, 0.870 ], "y_axis": [ 0.686, -0.537, 0.492 ], "z_axis": [ 0.632, 0.774, -0.036 ], "quaternion": [ -0.128, 0.550, 0.464, 0.682 ] } }, { "index": 141, "index_chain": 65, "chain_name": "B", "nt_resnum": 64, "nt_name": "G", "nt_code": "G", "nt_id": "///B/64", "linked_nts": [ "///B/63", "///B/65" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -94.028, "beta": -134.472, "gamma": 40.024, "delta": 82.843, "epsilon": -160.490, "zeta": -113.781, "epsilon_zeta": -46.709, "bb_type": "BI", "chi": -150.250, "glyco_bond": "anti", "C5prime_xyz": [ -1.264, 8.749, 0.012 ], "P_xyz": [ 0.922, 9.267, 1.384 ], "form": "A", "ssZp": 4.217, "Dp": 4.555, "splay_angle": 19.930, "splay_distance": 3.189, "splay_ratio": 0.174, "d22": null, "d64": null, "eta": 163.994, "theta": -153.612, "eta_prime": 174.232, "theta_prime": -152.825, "eta_base": -148.768, "theta_base": -140.083, "v0": 2.288, "v1": -23.730, "v2": 34.922, "v3": -34.700, "v4": 20.355, "amplitude": 36.174, "phase_angle": 15.119, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1m", "suiteness": 0.177, "filter_rmsd": 0.006, "frame": { "rmsd": 0.006, "origin": [ -29.063, -27.304, -18.905 ], "x_axis": [ 0.048, -0.275, 0.960 ], "y_axis": [ 0.810, -0.552, -0.198 ], "z_axis": [ 0.585, 0.787, 0.196 ], "quaternion": [ -0.416, 0.592, 0.226, 0.652 ] } }, { "index": 142, "index_chain": 66, "chain_name": "B", "nt_resnum": 65, "nt_name": "C", "nt_code": "C", "nt_id": "///B/65", "linked_nts": [ "///B/64", "///B/66" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop", "alpha": 145.863, "beta": -125.038, "gamma": 168.872, "delta": 86.248, "epsilon": -152.637, "zeta": -61.499, "epsilon_zeta": -91.138, "bb_type": "BI", "chi": -174.661, "glyco_bond": "anti", "C5prime_xyz": [ -1.344, 8.508, 1.410 ], "P_xyz": [ 0.587, 9.303, -0.198 ], "form": "A", "ssZp": 4.514, "Dp": 4.515, "splay_angle": 27.766, "splay_distance": 4.270, "splay_ratio": 0.241, "d22": 4.525, "d64": 4.386, "eta": 159.962, "theta": -142.663, "eta_prime": 177.338, "theta_prime": -150.493, "eta_base": -158.515, "theta_base": -118.015, "v0": 3.163, "v1": -23.262, "v2": 33.450, "v3": -32.740, "v4": 18.650, "amplitude": 34.419, "phase_angle": 13.631, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.016, "filter_rmsd": 0.063, "frame": { "rmsd": 0.004, "origin": [ -28.515, -24.207, -18.381 ], "x_axis": [ 0.214, -0.533, 0.819 ], "y_axis": [ 0.853, -0.306, -0.422 ], "z_axis": [ 0.476, 0.789, 0.389 ], "quaternion": [ 0.569, -0.532, -0.151, -0.609 ] } }, { "index": 143, "index_chain": 67, "chain_name": "B", "nt_resnum": 66, "nt_name": "C", "nt_code": "C", "nt_id": "///B/66", "linked_nts": [ "///B/65", "///B/67" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop", "alpha": -75.179, "beta": -161.422, "gamma": 43.912, "delta": 84.036, "epsilon": -128.316, "zeta": -134.528, "epsilon_zeta": 6.212, "bb_type": "--", "chi": -157.727, "glyco_bond": "anti", "C5prime_xyz": [ -1.002, 8.641, 0.522 ], "P_xyz": [ 1.498, 8.815, 1.346 ], "form": "A", "ssZp": 4.422, "Dp": 4.783, "splay_angle": 24.977, "splay_distance": 3.953, "splay_ratio": 0.216, "d22": 3.883, "d64": 4.217, "eta": 170.757, "theta": -145.039, "eta_prime": -177.592, "theta_prime": -145.543, "eta_base": -130.870, "theta_base": -132.547, "v0": 5.909, "v1": -26.509, "v2": 35.805, "v3": -33.545, "v4": 17.432, "amplitude": 36.309, "phase_angle": 9.559, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.595, "filter_rmsd": 0.064, "frame": { "rmsd": 0.008, "origin": [ -27.144, -21.633, -15.262 ], "x_axis": [ 0.706, -0.667, 0.238 ], "y_axis": [ 0.413, 0.115, -0.904 ], "z_axis": [ 0.575, 0.736, 0.356 ], "quaternion": [ 0.738, -0.556, 0.114, -0.366 ] } }, { "index": 144, "index_chain": 68, "chain_name": "B", "nt_resnum": 67, "nt_name": "C", "nt_code": "C", "nt_id": "///B/67", "linked_nts": [ "///B/66", "///B/68" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": 121.458, "beta": -110.112, "gamma": 174.227, "delta": 82.484, "epsilon": -130.202, "zeta": -59.033, "epsilon_zeta": -71.169, "bb_type": "BI", "chi": 163.353, "glyco_bond": "anti", "C5prime_xyz": [ -1.804, 7.903, 2.477 ], "P_xyz": [ 0.256, 9.094, 1.357 ], "form": ".", "ssZp": 4.501, "Dp": 4.692, "splay_angle": 30.252, "splay_distance": 4.916, "splay_ratio": 0.273, "d22": 4.642, "d64": 5.089, "eta": 156.081, "theta": -127.226, "eta_prime": 172.174, "theta_prime": -136.270, "eta_base": -160.729, "theta_base": -107.968, "v0": 5.176, "v1": -26.333, "v2": 36.624, "v3": -34.593, "v4": 18.501, "amplitude": 37.290, "phase_angle": 10.841, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.064, "frame": { "rmsd": 0.007, "origin": [ -25.545, -19.010, -12.774 ], "x_axis": [ 0.451, -0.874, -0.182 ], "y_axis": [ 0.154, 0.277, -0.948 ], "z_axis": [ 0.879, 0.400, 0.259 ], "quaternion": [ 0.705, -0.478, 0.376, -0.364 ] } }, { "index": 145, "index_chain": 69, "chain_name": "B", "nt_resnum": 68, "nt_name": "C", "nt_code": "C", "nt_id": "///B/68", "linked_nts": [ "///B/67", "///B/69" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -68.858, "beta": -165.458, "gamma": 44.721, "delta": 80.163, "epsilon": -149.531, "zeta": -70.931, "epsilon_zeta": -78.600, "bb_type": "BI", "chi": -166.051, "glyco_bond": "anti", "C5prime_xyz": [ -1.517, 8.811, 0.868 ], "P_xyz": [ 0.780, 9.521, 1.950 ], "form": "A", "ssZp": 4.550, "Dp": 4.588, "splay_angle": 21.277, "splay_distance": 3.420, "splay_ratio": 0.188, "d22": 4.447, "d64": 4.346, "eta": 162.218, "theta": -149.736, "eta_prime": -179.067, "theta_prime": -145.060, "eta_base": -125.948, "theta_base": -112.051, "v0": 0.832, "v1": -23.734, "v2": 36.230, "v3": -36.819, "v4": 22.731, "amplitude": 37.971, "phase_angle": 17.419, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.614, "filter_rmsd": 0.062, "frame": { "rmsd": 0.005, "origin": [ -21.344, -19.857, -10.366 ], "x_axis": [ 0.402, -0.408, -0.819 ], "y_axis": [ -0.349, 0.759, -0.550 ], "z_axis": [ 0.846, 0.507, 0.163 ], "quaternion": [ 0.762, -0.347, 0.546, -0.019 ] } }, { "index": 146, "index_chain": 70, "chain_name": "B", "nt_resnum": 69, "nt_name": "C", "nt_code": "C", "nt_id": "///B/69", "linked_nts": [ "///B/68", "///B/70" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -73.392, "beta": -177.908, "gamma": 52.057, "delta": 79.332, "epsilon": -152.407, "zeta": -85.631, "epsilon_zeta": -66.775, "bb_type": "BI", "chi": -154.525, "glyco_bond": "anti", "C5prime_xyz": [ -1.296, 8.802, 0.244 ], "P_xyz": [ 1.273, 9.337, 0.205 ], "form": ".", "ssZp": 4.425, "Dp": 4.683, "splay_angle": 29.196, "splay_distance": 4.627, "splay_ratio": 0.254, "d22": null, "d64": null, "eta": 161.454, "theta": -161.220, "eta_prime": 173.839, "theta_prime": -159.995, "eta_base": -142.601, "theta_base": -148.293, "v0": 2.514, "v1": -25.723, "v2": 37.725, "v3": -37.362, "v4": 22.031, "amplitude": 39.059, "phase_angle": 15.021, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.915, "filter_rmsd": 0.061, "frame": { "rmsd": 0.008, "origin": [ -17.938, -19.895, -10.057 ], "x_axis": [ 0.073, 0.080, -0.994 ], "y_axis": [ -0.373, 0.927, 0.047 ], "z_axis": [ 0.925, 0.367, 0.097 ], "quaternion": [ 0.724, -0.111, 0.663, 0.156 ] } }, { "index": 147, "index_chain": 71, "chain_name": "B", "nt_resnum": 70, "nt_name": "G", "nt_code": "G", "nt_id": "///B/70", "linked_nts": [ "///B/69", "///B/71" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -53.714, "beta": 157.558, "gamma": 61.463, "delta": 79.196, "epsilon": -146.750, "zeta": -100.973, "epsilon_zeta": -45.777, "bb_type": "BI", "chi": -175.816, "glyco_bond": "anti", "C5prime_xyz": [ -1.666, 8.646, 1.427 ], "P_xyz": [ 0.903, 9.254, 1.364 ], "form": "A", "ssZp": 4.750, "Dp": 4.681, "splay_angle": 22.587, "splay_distance": 3.533, "splay_ratio": 0.201, "d22": null, "d64": null, "eta": 173.324, "theta": -143.413, "eta_prime": -175.904, "theta_prime": -144.527, "eta_base": -152.675, "theta_base": -109.036, "v0": 0.874, "v1": -24.461, "v2": 37.482, "v3": -37.801, "v4": 23.296, "amplitude": 39.242, "phase_angle": 17.224, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.682, "filter_rmsd": 0.006, "frame": { "rmsd": 0.006, "origin": [ -13.360, -20.103, -9.411 ], "x_axis": [ -0.179, 0.277, -0.944 ], "y_axis": [ -0.475, 0.816, 0.329 ], "z_axis": [ 0.862, 0.507, -0.014 ], "quaternion": [ 0.637, -0.070, 0.709, 0.295 ] } }, { "index": 148, "index_chain": 72, "chain_name": "B", "nt_resnum": 71, "nt_name": "C", "nt_code": "C", "nt_id": "///B/71", "linked_nts": [ "///B/70", "///B/72" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack", "alpha": 26.310, "beta": 152.039, "gamma": -18.208, "delta": 88.214, "epsilon": -173.561, "zeta": -85.205, "epsilon_zeta": -88.356, "bb_type": "BI", "chi": -145.340, "glyco_bond": "anti", "C5prime_xyz": [ -0.757, 8.481, -0.359 ], "P_xyz": [ 1.704, 9.026, 0.431 ], "form": "A", "ssZp": 4.129, "Dp": 4.537, "splay_angle": 24.861, "splay_distance": 3.961, "splay_ratio": 0.217, "d22": null, "d64": null, "eta": 171.620, "theta": -145.399, "eta_prime": -177.201, "theta_prime": -146.419, "eta_base": -126.773, "theta_base": -128.972, "v0": 10.844, "v1": -30.449, "v2": 37.459, "v3": -32.228, "v4": 13.522, "amplitude": 37.487, "phase_angle": 2.214, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.065, "frame": { "rmsd": 0.009, "origin": [ -10.606, -19.382, -11.504 ], "x_axis": [ -0.423, 0.782, -0.459 ], "y_axis": [ -0.073, 0.475, 0.877 ], "z_axis": [ 0.903, 0.404, -0.143 ], "quaternion": [ 0.477, 0.248, 0.714, 0.448 ] } }, { "index": 149, "index_chain": 73, "chain_name": "B", "nt_resnum": 72, "nt_name": "A", "nt_code": "A", "nt_id": "///B/72", "linked_nts": [ "///B/71", "///B/73" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-canonical,non-pair-contact,helix-end,ss-non-loop", "alpha": 152.497, "beta": -142.431, "gamma": 171.176, "delta": 86.612, "epsilon": -112.107, "zeta": -76.742, "epsilon_zeta": -35.365, "bb_type": "--", "chi": 165.937, "glyco_bond": "anti", "C5prime_xyz": [ -1.536, 7.825, 2.380 ], "P_xyz": [ 0.653, 9.181, 1.774 ], "form": ".", "ssZp": 4.629, "Dp": 4.715, "splay_angle": 20.718, "splay_distance": 3.655, "splay_ratio": 0.196, "d22": null, "d64": null, "eta": 174.427, "theta": -123.353, "eta_prime": -172.914, "theta_prime": -130.582, "eta_base": -141.761, "theta_base": -88.922, "v0": 5.989, "v1": -25.409, "v2": 34.113, "v3": -31.753, "v4": 16.346, "amplitude": 34.542, "phase_angle": 9.039, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.546, "filter_rmsd": 0.040, "frame": { "rmsd": 0.008, "origin": [ -7.426, -18.111, -13.493 ], "x_axis": [ -0.672, 0.737, -0.073 ], "y_axis": [ -0.007, 0.092, 0.996 ], "z_axis": [ 0.741, 0.669, -0.056 ], "quaternion": [ 0.302, 0.270, 0.675, 0.617 ] } }, { "index": 150, "index_chain": 74, "chain_name": "B", "nt_resnum": 73, "nt_name": "A", "nt_code": "A", "nt_id": "///B/73", "linked_nts": [ "///B/72", "///B/74" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-pair-contact,ss-non-loop,splayed-apart", "alpha": 39.745, "beta": -160.473, "gamma": -74.662, "delta": 96.435, "epsilon": -163.460, "zeta": 162.915, "epsilon_zeta": 33.625, "bb_type": "--", "chi": -135.987, "glyco_bond": "anti", "C5prime_xyz": [ -0.456, 7.881, -0.866 ], "P_xyz": [ 1.115, 9.919, -1.341 ], "form": ".", "ssZp": 3.669, "Dp": 4.641, "splay_angle": 121.806, "splay_distance": 15.511, "splay_ratio": 0.874, "d22": null, "d64": null, "eta": 156.390, "theta": 39.604, "eta_prime": 175.805, "theta_prime": 53.552, "eta_base": -117.525, "theta_base": 87.383, "v0": 23.168, "v1": -36.651, "v2": 35.617, "v3": -23.354, "v4": 0.324, "amplitude": 37.503, "phase_angle": 341.752, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "33m", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.006, "origin": [ -7.422, -14.788, -15.013 ], "x_axis": [ -0.240, 0.752, 0.613 ], "y_axis": [ 0.732, -0.275, 0.624 ], "z_axis": [ 0.638, 0.598, -0.484 ], "quaternion": [ 0.010, 0.616, 0.602, 0.508 ] } }, { "index": 151, "index_chain": 75, "chain_name": "B", "nt_resnum": 74, "nt_name": "C", "nt_code": "C", "nt_id": "///B/74", "linked_nts": [ "///B/73", "///B/75" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-stack,ss-non-loop,splayed-apart", "alpha": -82.952, "beta": 129.393, "gamma": 65.342, "delta": 84.652, "epsilon": -135.650, "zeta": -104.557, "epsilon_zeta": -31.093, "bb_type": "--", "chi": -179.624, "glyco_bond": "anti", "C5prime_xyz": [ -1.557, 8.463, 1.644 ], "P_xyz": [ 1.012, 8.514, 1.100 ], "form": "A", "ssZp": 4.666, "Dp": 4.645, "splay_angle": 23.426, "splay_distance": 3.875, "splay_ratio": 0.211, "d22": 5.236, "d64": 4.718, "eta": 163.761, "theta": -121.243, "eta_prime": 177.367, "theta_prime": -129.762, "eta_base": -178.066, "theta_base": -117.609, "v0": 1.647, "v1": -23.246, "v2": 34.798, "v3": -34.863, "v4": 20.938, "amplitude": 36.218, "phase_angle": 16.098, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "3a", "suiteness": 0.149, "filter_rmsd": 0.061, "frame": { "rmsd": 0.005, "origin": [ 5.202, -23.636, -13.304 ], "x_axis": [ -0.472, -0.027, -0.881 ], "y_axis": [ -0.499, 0.832, 0.241 ], "z_axis": [ 0.727, 0.554, -0.406 ], "quaternion": [ 0.488, -0.160, 0.823, 0.241 ] } }, { "index": 152, "index_chain": 76, "chain_name": "B", "nt_resnum": 75, "nt_name": "C", "nt_code": "C", "nt_id": "///B/75", "linked_nts": [ "///B/74", "///B/76" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-pair-contact,ss-non-loop", "alpha": 60.157, "beta": 150.868, "gamma": -52.545, "delta": 101.479, "epsilon": -125.182, "zeta": -42.324, "epsilon_zeta": -82.858, "bb_type": "--", "chi": -126.233, "glyco_bond": "anti", "C5prime_xyz": [ -0.777, 8.081, -1.310 ], "P_xyz": [ 1.237, 9.625, -0.677 ], "form": ".", "ssZp": 2.522, "Dp": 4.617, "splay_angle": 14.994, "splay_distance": 2.650, "splay_ratio": 0.135, "d22": null, "d64": null, "eta": 176.047, "theta": -132.463, "eta_prime": -176.340, "theta_prime": -129.840, "eta_base": -151.121, "theta_base": -122.218, "v0": 18.597, "v1": -32.024, "v2": 32.093, "v3": -22.514, "v4": 2.653, "amplitude": 33.142, "phase_angle": 345.549, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "33m", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.007, "origin": [ 7.890, -23.564, -16.095 ], "x_axis": [ -0.842, 0.362, -0.401 ], "y_axis": [ 0.068, 0.807, 0.587 ], "z_axis": [ 0.536, 0.467, -0.704 ], "quaternion": [ 0.256, 0.117, 0.915, 0.288 ] } }, { "index": 153, "index_chain": 77, "chain_name": "B", "nt_resnum": 76, "nt_name": "A", "nt_code": "A", "nt_id": "///B/76", "linked_nts": [ "///B/75", null ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C2'-endo,non-pair-contact,ss-non-loop", "alpha": -112.163, "beta": 83.537, "gamma": 163.148, "delta": 162.897, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": -120.358, "glyco_bond": "anti", "C5prime_xyz": [ -1.511, 8.342, -1.014 ], "P_xyz": [ -1.512, 8.603, -3.635 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": -11.112, "v1": 28.518, "v2": -33.743, "v3": 28.326, "v4": -11.081, "amplitude": 33.743, "phase_angle": 179.877, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.039, "frame": { "rmsd": 0.009, "origin": [ 8.960, -21.832, -17.791 ], "x_axis": [ -0.888, 0.373, -0.268 ], "y_axis": [ 0.289, 0.908, 0.304 ], "z_axis": [ 0.357, 0.193, -0.914 ], "quaternion": [ 0.162, 0.172, 0.963, 0.129 ] } }, { "index": 154, "index_chain": 1, "chain_name": "E", "nt_resnum": 153, "nt_name": "C", "nt_code": "C", "nt_id": "///E/153", "linked_nts": [ null, "///E/154" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end", "alpha": null, "beta": 178.034, "gamma": 43.381, "delta": 83.416, "epsilon": -150.495, "zeta": -72.922, "epsilon_zeta": -77.574, "bb_type": "BI", "chi": -158.932, "glyco_bond": "anti", "C5prime_xyz": [ -1.299, 8.772, 0.529 ], "P_xyz": [ 1.209, 9.191, 1.179 ], "form": "A", "ssZp": 4.380, "Dp": 4.548, "splay_angle": 23.295, "splay_distance": 3.752, "splay_ratio": 0.203, "d22": 3.991, "d64": 4.093, "eta": null, "theta": -144.807, "eta_prime": null, "theta_prime": -143.075, "eta_base": null, "theta_base": -117.434, "v0": 1.346, "v1": -22.681, "v2": 34.090, "v3": -34.416, "v4": 20.891, "amplitude": 35.572, "phase_angle": 16.601, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.062, "frame": { "rmsd": 0.002, "origin": [ 21.339, 94.754, -38.280 ], "x_axis": [ -0.191, -0.776, 0.602 ], "y_axis": [ -0.977, 0.095, -0.189 ], "z_axis": [ 0.089, -0.624, -0.776 ], "quaternion": [ -0.178, -0.610, 0.718, -0.283 ] } }, { "index": 155, "index_chain": 2, "chain_name": "E", "nt_resnum": 154, "nt_name": "U", "nt_code": "U", "nt_id": "///E/154", "linked_nts": [ "///E/153", "///E/155" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -59.887, "beta": 172.081, "gamma": 44.746, "delta": 79.711, "epsilon": -152.352, "zeta": -120.707, "epsilon_zeta": -31.645, "bb_type": "BI", "chi": -164.644, "glyco_bond": "anti", "C5prime_xyz": [ -1.542, 8.715, 0.858 ], "P_xyz": [ 0.973, 9.289, 1.291 ], "form": "A", "ssZp": 4.624, "Dp": 4.634, "splay_angle": 20.620, "splay_distance": 3.111, "splay_ratio": 0.179, "d22": null, "d64": null, "eta": 161.021, "theta": -161.957, "eta_prime": 174.677, "theta_prime": -154.972, "eta_base": -144.154, "theta_base": -128.600, "v0": -0.364, "v1": -23.110, "v2": 36.321, "v3": -37.528, "v4": 23.869, "amplitude": 38.431, "phase_angle": 19.074, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.842, "filter_rmsd": 0.104, "frame": { "rmsd": 0.004, "origin": [ 22.659, 91.832, -40.230 ], "x_axis": [ -0.669, -0.480, 0.568 ], "y_axis": [ -0.741, 0.490, -0.459 ], "z_axis": [ -0.058, -0.728, -0.683 ], "quaternion": [ -0.186, -0.362, 0.843, -0.352 ] } }, { "index": 156, "index_chain": 3, "chain_name": "E", "nt_resnum": 155, "nt_name": "A", "nt_code": "A", "nt_id": "///E/155", "linked_nts": [ "///E/154", "///E/156" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": 15.722, "beta": 122.534, "gamma": 16.212, "delta": 81.746, "epsilon": -169.816, "zeta": -71.071, "epsilon_zeta": -98.745, "bb_type": "BI", "chi": -156.991, "glyco_bond": "anti", "C5prime_xyz": [ -1.535, 8.797, 0.380 ], "P_xyz": [ 0.943, 8.643, 1.243 ], "form": "A", "ssZp": 4.241, "Dp": 4.359, "splay_angle": 21.143, "splay_distance": 3.708, "splay_ratio": 0.194, "d22": null, "d64": null, "eta": 173.617, "theta": -119.505, "eta_prime": -176.620, "theta_prime": -131.958, "eta_base": -143.921, "theta_base": -111.305, "v0": -1.851, "v1": -20.101, "v2": 33.062, "v3": -35.223, "v4": 23.370, "amplitude": 35.566, "phase_angle": 21.627, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.003, "origin": [ 23.170, 88.946, -41.274 ], "x_axis": [ -0.917, 0.017, 0.398 ], "y_axis": [ -0.313, 0.588, -0.746 ], "z_axis": [ -0.247, -0.808, -0.534 ], "quaternion": [ -0.185, -0.085, 0.872, -0.446 ] } }, { "index": 157, "index_chain": 4, "chain_name": "E", "nt_resnum": 156, "nt_name": "C", "nt_code": "C", "nt_id": "///E/156", "linked_nts": [ "///E/155", "///E/157" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": 153.891, "beta": -166.003, "gamma": 176.029, "delta": 86.543, "epsilon": -128.609, "zeta": -70.212, "epsilon_zeta": -58.397, "bb_type": "BI", "chi": -176.319, "glyco_bond": "anti", "C5prime_xyz": [ -1.210, 8.388, 1.534 ], "P_xyz": [ 0.408, 10.151, 0.460 ], "form": "A", "ssZp": 4.695, "Dp": 4.699, "splay_angle": 26.459, "splay_distance": 4.202, "splay_ratio": 0.231, "d22": 3.997, "d64": 4.302, "eta": 167.307, "theta": -152.961, "eta_prime": -179.813, "theta_prime": -147.800, "eta_base": -136.173, "theta_base": -107.435, "v0": 5.701, "v1": -25.617, "v2": 34.761, "v3": -32.616, "v4": 17.024, "amplitude": 35.267, "phase_angle": 9.718, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.947, "filter_rmsd": 0.063, "frame": { "rmsd": 0.002, "origin": [ 21.785, 85.519, -40.967 ], "x_axis": [ -0.948, 0.317, -0.024 ], "y_axis": [ 0.167, 0.433, -0.886 ], "z_axis": [ -0.271, -0.844, -0.463 ], "quaternion": [ -0.073, 0.144, 0.843, -0.513 ] } }, { "index": 158, "index_chain": 5, "chain_name": "E", "nt_resnum": 157, "nt_name": "U", "nt_code": "U", "nt_id": "///E/157", "linked_nts": [ "///E/156", "///E/158" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -66.720, "beta": 163.017, "gamma": 57.570, "delta": 79.944, "epsilon": -169.891, "zeta": -76.967, "epsilon_zeta": -92.924, "bb_type": "BI", "chi": -169.651, "glyco_bond": "anti", "C5prime_xyz": [ -1.653, 8.658, 1.130 ], "P_xyz": [ 0.883, 9.285, 1.011 ], "form": ".", "ssZp": 4.643, "Dp": 4.520, "splay_angle": 36.459, "splay_distance": 5.826, "splay_ratio": 0.325, "d22": null, "d64": null, "eta": 151.255, "theta": -166.497, "eta_prime": 178.834, "theta_prime": -166.358, "eta_base": -117.986, "theta_base": -167.417, "v0": -0.555, "v1": -23.686, "v2": 37.256, "v3": -38.516, "v4": 24.572, "amplitude": 39.453, "phase_angle": 19.212, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.724, "filter_rmsd": 0.104, "frame": { "rmsd": 0.008, "origin": [ 18.538, 83.052, -41.979 ], "x_axis": [ -0.580, 0.551, -0.600 ], "y_axis": [ 0.753, 0.081, -0.653 ], "z_axis": [ -0.311, -0.831, -0.462 ], "quaternion": [ 0.099, 0.447, 0.728, -0.509 ] } }, { "index": 159, "index_chain": 6, "chain_name": "E", "nt_resnum": 158, "nt_name": "G", "nt_code": "G", "nt_id": "///E/158", "linked_nts": [ "///E/157", "///E/159" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,hairpin-loop", "alpha": -67.716, "beta": -149.261, "gamma": 43.669, "delta": 82.458, "epsilon": -167.958, "zeta": -74.372, "epsilon_zeta": -93.586, "bb_type": "BI", "chi": -157.535, "glyco_bond": "anti", "C5prime_xyz": [ -1.590, 8.859, 0.412 ], "P_xyz": [ 0.511, 9.617, 1.785 ], "form": "A", "ssZp": 4.269, "Dp": 4.362, "splay_angle": 24.613, "splay_distance": 4.064, "splay_ratio": 0.217, "d22": null, "d64": null, "eta": -176.444, "theta": -133.834, "eta_prime": 178.692, "theta_prime": -137.009, "eta_base": 176.029, "theta_base": -97.640, "v0": -3.201, "v1": -19.504, "v2": 33.353, "v3": -36.265, "v4": 24.831, "amplitude": 36.390, "phase_angle": 23.575, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.341, "filter_rmsd": 0.002, "frame": { "rmsd": 0.002, "origin": [ 15.904, 78.365, -39.736 ], "x_axis": [ -0.290, 0.830, -0.476 ], "y_axis": [ 0.865, 0.016, -0.501 ], "z_axis": [ -0.409, -0.557, -0.723 ], "quaternion": [ 0.024, 0.595, 0.712, -0.371 ] } }, { "index": 160, "index_chain": 7, "chain_name": "E", "nt_resnum": 159, "nt_name": "G", "nt_code": "G", "nt_id": "///E/159", "linked_nts": [ "///E/158", "///E/160" ], "nt_type": "RNA", "dbn": ".", "summary": "u-turn,anti,~C3'-endo,non-canonical,non-pair-contact,helix-end,hairpin-loop,cap-acceptor", "alpha": 158.489, "beta": -161.262, "gamma": 165.786, "delta": 84.307, "epsilon": -116.523, "zeta": -53.529, "epsilon_zeta": -62.993, "bb_type": "--", "chi": 175.351, "glyco_bond": "anti", "C5prime_xyz": [ -1.338, 8.129, 2.012 ], "P_xyz": [ 0.679, 9.639, 1.310 ], "form": ".", "ssZp": 4.782, "Dp": 4.749, "splay_angle": 79.893, "splay_distance": 10.909, "splay_ratio": 0.642, "d22": null, "d64": null, "eta": 161.608, "theta": -116.624, "eta_prime": 177.204, "theta_prime": -166.675, "eta_base": -127.282, "theta_base": 132.597, "v0": 5.778, "v1": -25.914, "v2": 34.978, "v3": -32.792, "v4": 17.052, "amplitude": 35.472, "phase_angle": 9.571, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.673, "filter_rmsd": 0.003, "frame": { "rmsd": 0.003, "origin": [ 13.147, 78.116, -42.711 ], "x_axis": [ 0.379, 0.747, -0.546 ], "y_axis": [ 0.869, -0.490, -0.068 ], "z_axis": [ -0.318, -0.449, -0.835 ], "quaternion": [ 0.116, 0.822, 0.491, -0.263 ] } }, { "index": 161, "index_chain": 8, "chain_name": "E", "nt_resnum": 160, "nt_name": "A", "nt_code": "A", "nt_id": "///E/160", "linked_nts": [ "///E/159", "///E/161" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,u-turn,anti,~C3'-endo,BI,non-canonical,non-pair-contact,multiplet,hairpin-loop,A-minor,cap-donor,cap-acceptor", "alpha": -172.834, "beta": 123.776, "gamma": 46.167, "delta": 81.214, "epsilon": -139.889, "zeta": -78.475, "epsilon_zeta": -61.414, "bb_type": "BI", "chi": -166.376, "glyco_bond": "anti", "C5prime_xyz": [ -1.397, 8.622, 0.939 ], "P_xyz": [ 1.174, 8.220, 0.595 ], "form": ".", "ssZp": 4.630, "Dp": 4.692, "splay_angle": 26.245, "splay_distance": 4.004, "splay_ratio": 0.227, "d22": null, "d64": null, "eta": 6.614, "theta": -125.580, "eta_prime": 46.367, "theta_prime": -127.985, "eta_base": 23.827, "theta_base": -89.118, "v0": 1.690, "v1": -23.803, "v2": 35.463, "v3": -35.515, "v4": 21.330, "amplitude": 36.897, "phase_angle": 16.027, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1g", "suiteness": 0.249, "filter_rmsd": 0.037, "frame": { "rmsd": 0.004, "origin": [ 10.640, 68.101, -39.185 ], "x_axis": [ 0.858, -0.224, 0.463 ], "y_axis": [ 0.508, 0.231, -0.830 ], "z_axis": [ 0.079, 0.947, 0.312 ], "quaternion": [ 0.775, -0.573, -0.124, -0.236 ] } }, { "index": 162, "index_chain": 9, "chain_name": "E", "nt_resnum": 161, "nt_name": "A", "nt_code": "A", "nt_id": "///E/161", "linked_nts": [ "///E/160", "///E/162" ], "nt_type": "RNA", "dbn": ".", "summary": "u-turn,anti,~C3'-endo,BI,non-pair-contact,hairpin-loop,A-minor,cap-donor,phosphate", "alpha": -46.694, "beta": 153.134, "gamma": 58.920, "delta": 86.318, "epsilon": -150.110, "zeta": -70.592, "epsilon_zeta": -79.518, "bb_type": "BI", "chi": -159.714, "glyco_bond": "anti", "C5prime_xyz": [ -1.366, 8.698, 0.526 ], "P_xyz": [ 1.249, 8.806, 0.300 ], "form": ".", "ssZp": 4.293, "Dp": 4.499, "splay_angle": 21.983, "splay_distance": 3.434, "splay_ratio": 0.192, "d22": null, "d64": null, "eta": 173.892, "theta": -135.360, "eta_prime": -161.847, "theta_prime": -138.840, "eta_base": -96.817, "theta_base": -96.465, "v0": 1.888, "v1": -22.341, "v2": 33.134, "v3": -33.157, "v4": 19.745, "amplitude": 34.419, "phase_angle": 15.705, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.579, "filter_rmsd": 0.038, "frame": { "rmsd": 0.002, "origin": [ 13.180, 70.321, -37.029 ], "x_axis": [ 0.965, 0.092, -0.246 ], "y_axis": [ -0.261, 0.453, -0.853 ], "z_axis": [ 0.033, 0.887, 0.461 ], "quaternion": [ 0.848, -0.513, 0.082, 0.104 ] } }, { "index": 163, "index_chain": 10, "chain_name": "E", "nt_resnum": 162, "nt_name": "A", "nt_code": "A", "nt_id": "///E/162", "linked_nts": [ "///E/161", "///E/163" ], "nt_type": "RNA", "dbn": ".", "summary": "u-turn,anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,hairpin-loop,cap-acceptor,phosphate", "alpha": -74.855, "beta": 173.423, "gamma": 54.963, "delta": 85.876, "epsilon": -134.028, "zeta": -45.617, "epsilon_zeta": -88.411, "bb_type": "BI", "chi": -155.065, "glyco_bond": "anti", "C5prime_xyz": [ -1.022, 8.606, 0.264 ], "P_xyz": [ 1.606, 8.626, 0.196 ], "form": ".", "ssZp": 4.239, "Dp": 4.725, "splay_angle": 45.631, "splay_distance": 7.178, "splay_ratio": 0.388, "d22": null, "d64": null, "eta": 164.149, "theta": -102.469, "eta_prime": 179.686, "theta_prime": -92.911, "eta_base": -120.651, "theta_base": -56.351, "v0": 5.140, "v1": -25.515, "v2": 35.095, "v3": -33.158, "v4": 17.723, "amplitude": 35.705, "phase_angle": 10.606, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.840, "filter_rmsd": 0.038, "frame": { "rmsd": 0.003, "origin": [ 14.799, 73.236, -36.208 ], "x_axis": [ 0.481, 0.299, -0.824 ], "y_axis": [ -0.852, 0.381, -0.359 ], "z_axis": [ 0.207, 0.875, 0.438 ], "quaternion": [ 0.758, -0.407, 0.340, 0.379 ] } }, { "index": 164, "index_chain": 11, "chain_name": "E", "nt_resnum": 163, "nt_name": "C", "nt_code": "C", "nt_id": "///E/163", "linked_nts": [ "///E/162", "///E/164" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,hairpin-loop,cap-donor", "alpha": -58.950, "beta": 156.384, "gamma": 68.090, "delta": 83.272, "epsilon": -153.713, "zeta": -40.382, "epsilon_zeta": -113.331, "bb_type": "BI", "chi": -167.708, "glyco_bond": "anti", "C5prime_xyz": [ -1.562, 8.775, 0.965 ], "P_xyz": [ 0.996, 9.254, 0.646 ], "form": ".", "ssZp": 4.509, "Dp": 4.504, "splay_angle": 31.700, "splay_distance": 5.681, "splay_ratio": 0.289, "d22": null, "d64": null, "eta": 167.399, "theta": -130.906, "eta_prime": -148.323, "theta_prime": -148.384, "eta_base": -78.310, "theta_base": -157.026, "v0": -2.161, "v1": -20.703, "v2": 34.334, "v3": -36.505, "v4": 24.378, "amplitude": 36.987, "phase_angle": 21.835, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.360, "filter_rmsd": 0.062, "frame": { "rmsd": 0.003, "origin": [ 15.370, 78.571, -40.977 ], "x_axis": [ -0.608, 0.410, -0.680 ], "y_axis": [ -0.754, -0.031, 0.656 ], "z_axis": [ 0.248, 0.912, 0.328 ], "quaternion": [ 0.415, -0.154, 0.559, 0.701 ] } }, { "index": 165, "index_chain": 12, "chain_name": "E", "nt_resnum": 164, "nt_name": "G", "nt_code": "G", "nt_id": "///E/164", "linked_nts": [ "///E/163", "///E/165" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -137.336, "beta": 112.104, "gamma": 169.840, "delta": 86.164, "epsilon": -143.358, "zeta": -73.651, "epsilon_zeta": -69.707, "bb_type": "BI", "chi": 176.635, "glyco_bond": "anti", "C5prime_xyz": [ -1.348, 8.176, 1.980 ], "P_xyz": [ -1.168, 10.664, 1.176 ], "form": "A", "ssZp": 4.752, "Dp": 4.626, "splay_angle": 25.313, "splay_distance": 3.900, "splay_ratio": 0.222, "d22": null, "d64": null, "eta": -165.076, "theta": 166.474, "eta_prime": -166.639, "theta_prime": -174.028, "eta_base": -158.991, "theta_base": -131.969, "v0": 4.767, "v1": -24.559, "v2": 33.808, "v3": -32.228, "v4": 17.370, "amplitude": 34.443, "phase_angle": 11.025, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1e", "suiteness": 0.064, "filter_rmsd": 0.009, "frame": { "rmsd": 0.009, "origin": [ 20.143, 81.645, -41.146 ], "x_axis": [ -0.582, 0.589, -0.561 ], "y_axis": [ -0.732, -0.078, 0.677 ], "z_axis": [ 0.355, 0.804, 0.477 ], "quaternion": [ 0.452, -0.070, 0.507, 0.731 ] } }, { "index": 166, "index_chain": 13, "chain_name": "E", "nt_resnum": 165, "nt_name": "G", "nt_code": "G", "nt_id": "///E/165", "linked_nts": [ "///E/164", "///E/166" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -50.500, "beta": 172.581, "gamma": 45.617, "delta": 85.099, "epsilon": -165.328, "zeta": -74.773, "epsilon_zeta": -90.555, "bb_type": "BI", "chi": -166.658, "glyco_bond": "anti", "C5prime_xyz": [ -1.383, 8.661, 0.939 ], "P_xyz": [ 1.053, 8.844, 1.894 ], "form": "A", "ssZp": 4.182, "Dp": 4.336, "splay_angle": 22.921, "splay_distance": 3.923, "splay_ratio": 0.206, "d22": null, "d64": null, "eta": 173.290, "theta": -127.179, "eta_prime": -167.475, "theta_prime": -137.390, "eta_base": -119.768, "theta_base": -122.296, "v0": 1.999, "v1": -21.970, "v2": 32.473, "v3": -32.506, "v4": 19.244, "amplitude": 33.704, "phase_angle": 15.534, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.721, "filter_rmsd": 0.006, "frame": { "rmsd": 0.006, "origin": [ 21.854, 85.147, -41.301 ], "x_axis": [ -0.923, 0.385, -0.010 ], "y_axis": [ -0.209, -0.478, 0.853 ], "z_axis": [ 0.323, 0.789, 0.522 ], "quaternion": [ 0.174, 0.092, 0.480, 0.855 ] } }, { "index": 167, "index_chain": 14, "chain_name": "E", "nt_resnum": 166, "nt_name": "U", "nt_code": "U", "nt_id": "///E/166", "linked_nts": [ "///E/165", "///E/167" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem", "alpha": 152.374, "beta": -169.020, "gamma": 176.931, "delta": 87.106, "epsilon": -111.610, "zeta": -87.103, "epsilon_zeta": -24.507, "bb_type": "--", "chi": -179.865, "glyco_bond": "anti", "C5prime_xyz": [ -1.307, 8.190, 1.769 ], "P_xyz": [ 0.492, 9.970, 1.140 ], "form": "A", "ssZp": 4.548, "Dp": 4.653, "splay_angle": 20.853, "splay_distance": 3.405, "splay_ratio": 0.183, "d22": null, "d64": null, "eta": 168.268, "theta": -152.669, "eta_prime": 178.348, "theta_prime": -146.620, "eta_base": -149.703, "theta_base": -113.360, "v0": 5.606, "v1": -25.268, "v2": 34.373, "v3": -32.321, "v4": 16.835, "amplitude": 34.883, "phase_angle": 9.804, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.898, "filter_rmsd": 0.105, "frame": { "rmsd": 0.004, "origin": [ 23.255, 88.803, -41.538 ], "x_axis": [ -0.927, 0.100, 0.363 ], "y_axis": [ 0.229, -0.614, 0.756 ], "z_axis": [ 0.298, 0.783, 0.546 ], "quaternion": [ -0.037, 0.188, 0.438, 0.878 ] } }, { "index": 168, "index_chain": 15, "chain_name": "E", "nt_resnum": 167, "nt_name": "A", "nt_code": "A", "nt_id": "///E/167", "linked_nts": [ "///E/166", "///E/168" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -46.319, "beta": 153.161, "gamma": 39.594, "delta": 78.766, "epsilon": -155.168, "zeta": -77.863, "epsilon_zeta": -77.304, "bb_type": "BI", "chi": -160.495, "glyco_bond": "anti", "C5prime_xyz": [ -1.848, 8.827, 0.550 ], "P_xyz": [ 0.655, 9.502, 0.821 ], "form": "A", "ssZp": 4.418, "Dp": 4.495, "splay_angle": 22.347, "splay_distance": 3.641, "splay_ratio": 0.197, "d22": null, "d64": null, "eta": 152.032, "theta": -152.993, "eta_prime": 172.800, "theta_prime": -153.362, "eta_base": -140.619, "theta_base": -130.354, "v0": -2.282, "v1": -20.617, "v2": 34.304, "v3": -36.742, "v4": 24.694, "amplitude": 37.053, "phase_angle": 22.207, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.166, "filter_rmsd": 0.037, "frame": { "rmsd": 0.004, "origin": [ 22.671, 91.914, -40.283 ], "x_axis": [ -0.658, -0.476, 0.584 ], "y_axis": [ 0.751, -0.475, 0.459 ], "z_axis": [ 0.059, 0.741, 0.669 ], "quaternion": [ -0.366, 0.192, 0.358, 0.837 ] } }, { "index": 169, "index_chain": 16, "chain_name": "E", "nt_resnum": 168, "nt_name": "G", "nt_code": "G", "nt_id": "///E/168", "linked_nts": [ "///E/167", null ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix-end,stem-end", "alpha": -55.426, "beta": 167.520, "gamma": 51.865, "delta": 81.546, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": -164.588, "glyco_bond": "anti", "C5prime_xyz": [ -1.682, 8.833, 0.702 ], "P_xyz": [ 0.814, 9.470, 1.137 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": -1.416, "v1": -20.482, "v2": 33.375, "v3": -35.246, "v4": 23.165, "amplitude": 35.740, "phase_angle": 20.959, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.872, "filter_rmsd": 0.005, "frame": { "rmsd": 0.005, "origin": [ 21.291, 94.825, -38.586 ], "x_axis": [ -0.215, -0.737, 0.641 ], "y_axis": [ 0.977, -0.170, 0.132 ], "z_axis": [ 0.012, 0.655, 0.756 ], "quaternion": [ 0.585, -0.223, -0.269, -0.732 ] } }, { "index": 170, "index_chain": 1, "chain_name": "F", "nt_resnum": 339, "nt_name": "C", "nt_code": "C", "nt_id": "///F/339", "linked_nts": [ null, "///F/340" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix-end,stem-end", "alpha": null, "beta": -154.713, "gamma": 174.444, "delta": 85.786, "epsilon": -113.689, "zeta": -97.868, "epsilon_zeta": -15.821, "bb_type": "--", "chi": -178.227, "glyco_bond": "anti", "C5prime_xyz": [ -1.374, 8.372, 1.649 ], "P_xyz": [ 0.542, 9.895, 0.730 ], "form": "A", "ssZp": 4.528, "Dp": 4.636, "splay_angle": 23.864, "splay_distance": 3.780, "splay_ratio": 0.207, "d22": 4.078, "d64": 3.911, "eta": null, "theta": -156.848, "eta_prime": null, "theta_prime": -150.591, "eta_base": null, "theta_base": -114.765, "v0": 2.696, "v1": -23.587, "v2": 34.428, "v3": -33.986, "v4": 19.722, "amplitude": 35.563, "phase_angle": 14.511, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.002, "origin": [ 0.912, 65.407, -27.223 ], "x_axis": [ 0.995, -0.084, 0.054 ], "y_axis": [ -0.093, -0.975, 0.203 ], "z_axis": [ 0.035, -0.207, -0.978 ], "quaternion": [ 0.103, 0.993, -0.044, 0.022 ] } }, { "index": 171, "index_chain": 2, "chain_name": "F", "nt_resnum": 340, "nt_name": "U", "nt_code": "U", "nt_id": "///F/340", "linked_nts": [ "///F/339", "///F/341" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -39.397, "beta": 144.186, "gamma": 40.191, "delta": 78.907, "epsilon": -142.798, "zeta": -81.614, "epsilon_zeta": -61.183, "bb_type": "BI", "chi": -164.756, "glyco_bond": "anti", "C5prime_xyz": [ -1.775, 8.729, 0.856 ], "P_xyz": [ 0.803, 9.054, 1.062 ], "form": "A", "ssZp": 4.554, "Dp": 4.624, "splay_angle": 21.069, "splay_distance": 3.438, "splay_ratio": 0.187, "d22": 4.237, "d64": 4.392, "eta": 158.302, "theta": -143.893, "eta_prime": 176.392, "theta_prime": -146.132, "eta_base": -135.038, "theta_base": -124.308, "v0": -2.220, "v1": -21.010, "v2": 34.876, "v3": -37.251, "v4": 24.841, "amplitude": 37.607, "phase_angle": 21.970, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1L", "suiteness": 0.267, "filter_rmsd": 0.105, "frame": { "rmsd": 0.008, "origin": [ 2.312, 65.227, -30.729 ], "x_axis": [ 0.720, -0.611, 0.330 ], "y_axis": [ -0.674, -0.729, 0.119 ], "z_axis": [ 0.168, -0.308, -0.937 ], "quaternion": [ 0.116, 0.920, -0.349, 0.135 ] } }, { "index": 172, "index_chain": 3, "chain_name": "F", "nt_resnum": 341, "nt_name": "C", "nt_code": "C", "nt_id": "///F/341", "linked_nts": [ "///F/340", "///F/342" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -59.333, "beta": 165.037, "gamma": 52.484, "delta": 79.632, "epsilon": -156.488, "zeta": -78.395, "epsilon_zeta": -78.093, "bb_type": "BI", "chi": -163.088, "glyco_bond": "anti", "C5prime_xyz": [ -1.577, 8.823, 0.765 ], "P_xyz": [ 0.943, 9.487, 0.724 ], "form": "A", "ssZp": 4.616, "Dp": 4.579, "splay_angle": 25.788, "splay_distance": 4.175, "splay_ratio": 0.228, "d22": 4.567, "d64": 5.099, "eta": 163.307, "theta": -155.700, "eta_prime": 175.696, "theta_prime": -155.846, "eta_base": -145.032, "theta_base": -140.446, "v0": -0.293, "v1": -22.811, "v2": 35.672, "v3": -36.943, "v4": 23.562, "amplitude": 37.747, "phase_angle": 19.086, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.877, "filter_rmsd": 0.062, "frame": { "rmsd": 0.008, "origin": [ 4.509, 65.001, -33.364 ], "x_axis": [ 0.246, -0.857, 0.452 ], "y_axis": [ -0.921, -0.352, -0.167 ], "z_axis": [ 0.302, -0.376, -0.876 ], "quaternion": [ 0.066, 0.786, -0.565, 0.240 ] } }, { "index": 173, "index_chain": 4, "chain_name": "F", "nt_resnum": 342, "nt_name": "C", "nt_code": "C", "nt_id": "///F/342", "linked_nts": [ "///F/341", "///F/343" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,multiplet,hairpin-loop,A-minor", "alpha": -51.087, "beta": 174.511, "gamma": 45.654, "delta": 81.896, "epsilon": -150.574, "zeta": -64.254, "epsilon_zeta": -86.320, "bb_type": "BI", "chi": -164.064, "glyco_bond": "anti", "C5prime_xyz": [ -1.597, 8.807, 0.813 ], "P_xyz": [ 0.874, 9.456, 1.380 ], "form": "A", "ssZp": 4.547, "Dp": 4.541, "splay_angle": 21.578, "splay_distance": 3.442, "splay_ratio": 0.189, "d22": 4.145, "d64": 3.853, "eta": 175.915, "theta": -138.063, "eta_prime": -175.135, "theta_prime": -134.654, "eta_base": -149.479, "theta_base": -85.026, "v0": -2.789, "v1": -20.027, "v2": 33.968, "v3": -36.594, "v4": 24.807, "amplitude": 36.875, "phase_angle": 22.901, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.743, "filter_rmsd": 0.062, "frame": { "rmsd": 0.005, "origin": [ 7.668, 64.354, -36.016 ], "x_axis": [ -0.193, -0.872, 0.450 ], "y_axis": [ -0.945, 0.042, -0.324 ], "z_axis": [ 0.264, -0.488, -0.832 ], "quaternion": [ -0.065, -0.632, 0.719, -0.282 ] } }, { "index": 174, "index_chain": 5, "chain_name": "F", "nt_resnum": 343, "nt_name": "U", "nt_code": "U", "nt_id": "///F/343", "linked_nts": [ "///F/342", "///F/344" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,hairpin-loop,splayed-apart", "alpha": -65.174, "beta": 178.596, "gamma": 48.799, "delta": 82.233, "epsilon": -164.148, "zeta": -82.677, "epsilon_zeta": -81.471, "bb_type": "BI", "chi": -142.730, "glyco_bond": "anti", "C5prime_xyz": [ -1.388, 8.729, -0.458 ], "P_xyz": [ 1.174, 9.242, -0.673 ], "form": ".", "ssZp": 4.001, "Dp": 4.521, "splay_angle": 130.985, "splay_distance": 15.751, "splay_ratio": 0.910, "d22": null, "d64": null, "eta": 162.734, "theta": -174.075, "eta_prime": -177.188, "theta_prime": 144.475, "eta_base": -111.351, "theta_base": 94.538, "v0": 1.825, "v1": -23.851, "v2": 35.331, "v3": -35.334, "v4": 21.165, "amplitude": 36.723, "phase_angle": 15.826, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.930, "filter_rmsd": 0.105, "frame": { "rmsd": 0.004, "origin": [ 8.051, 61.039, -36.858 ], "x_axis": [ -0.785, -0.617, 0.061 ], "y_axis": [ -0.431, 0.473, -0.768 ], "z_axis": [ 0.445, -0.629, -0.637 ], "quaternion": [ 0.113, -0.308, 0.851, -0.411 ] } }, { "index": 175, "index_chain": 6, "chain_name": "F", "nt_resnum": 344, "nt_name": "A", "nt_code": "A", "nt_id": "///F/344", "linked_nts": [ "///F/343", "///F/345" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,anti,~C2'-endo,non-pair-contact,hairpin-loop,cap-donor,cap-acceptor,phosphate,splayed-apart", "alpha": -160.154, "beta": 125.517, "gamma": 53.237, "delta": 147.893, "epsilon": -80.250, "zeta": -77.979, "epsilon_zeta": -2.270, "bb_type": "--", "chi": -111.269, "glyco_bond": "anti", "C5prime_xyz": [ -2.102, 8.297, -1.645 ], "P_xyz": [ 0.511, 8.027, -1.525 ], "form": ".", "ssZp": 0.316, "Dp": 0.481, "splay_angle": 92.626, "splay_distance": 14.191, "splay_ratio": 0.723, "d22": null, "d64": null, "eta": 60.398, "theta": 4.143, "eta_prime": 86.828, "theta_prime": -44.551, "eta_base": 72.923, "theta_base": -25.617, "v0": -20.363, "v1": 34.387, "v2": -34.057, "v3": 23.377, "v4": -2.136, "amplitude": 35.357, "phase_angle": 164.414, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1z", "suiteness": 0.463, "filter_rmsd": 0.037, "frame": { "rmsd": 0.002, "origin": [ 10.880, 70.458, -49.161 ], "x_axis": [ -0.926, 0.358, 0.120 ], "y_axis": [ -0.224, -0.778, 0.587 ], "z_axis": [ 0.304, 0.517, 0.800 ], "quaternion": [ 0.155, 0.113, 0.295, 0.936 ] } }, { "index": 176, "index_chain": 7, "chain_name": "F", "nt_resnum": 345, "nt_name": "C", "nt_code": "C", "nt_id": "///F/345", "linked_nts": [ "///F/344", "///F/346" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,anti,~C2'-endo,non-pair-contact,hairpin-loop,cap-donor,splayed-apart", "alpha": 164.794, "beta": -165.382, "gamma": 160.553, "delta": 146.799, "epsilon": -93.432, "zeta": 111.944, "epsilon_zeta": 154.624, "bb_type": "--", "chi": -142.663, "glyco_bond": "anti", "C5prime_xyz": [ -1.686, 8.725, 0.028 ], "P_xyz": [ 0.683, 9.482, -0.787 ], "form": "Z", "ssZp": 0.756, "Dp": 0.852, "splay_angle": 32.188, "splay_distance": 5.491, "splay_ratio": 0.307, "d22": null, "d64": null, "eta": 161.480, "theta": 107.621, "eta_prime": -156.412, "theta_prime": 74.577, "eta_base": -151.072, "theta_base": 58.410, "v0": -21.013, "v1": 33.908, "v2": -32.846, "v3": 21.792, "v4": -0.696, "amplitude": 34.496, "phase_angle": 162.212, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.002, "origin": [ 6.895, 60.834, -39.523 ], "x_axis": [ -0.517, 0.253, -0.818 ], "y_axis": [ 0.851, 0.043, -0.524 ], "z_axis": [ -0.098, -0.966, -0.238 ], "quaternion": [ 0.269, 0.412, 0.670, -0.556 ] } }, { "index": 177, "index_chain": 8, "chain_name": "F", "nt_resnum": 346, "nt_name": "G", "nt_code": "G", "nt_id": "///F/346", "linked_nts": [ "///F/345", "///F/347" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,syn,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,hairpin-loop,cap-acceptor", "alpha": 53.551, "beta": -163.680, "gamma": 172.011, "delta": 83.378, "epsilon": -128.541, "zeta": -61.315, "epsilon_zeta": -67.226, "bb_type": "BI", "chi": 58.791, "glyco_bond": "syn", "C5prime_xyz": [ -5.311, 4.027, 1.748 ], "P_xyz": [ -5.387, 3.479, 4.313 ], "form": ".", "ssZp": -2.219, "Dp": 4.361, "splay_angle": 32.676, "splay_distance": 5.035, "splay_ratio": 0.292, "d22": null, "d64": null, "eta": 119.816, "theta": -141.900, "eta_prime": 101.200, "theta_prime": -127.933, "eta_base": 113.034, "theta_base": -134.237, "v0": -3.988, "v1": -17.774, "v2": 31.262, "v3": -34.664, "v4": 24.388, "amplitude": 34.549, "phase_angle": 25.196, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23t", "cluster": "6n", "suiteness": 0.486, "filter_rmsd": 0.002, "frame": { "rmsd": 0.002, "origin": [ 11.241, 64.182, -39.764 ], "x_axis": [ -0.305, 0.608, -0.733 ], "y_axis": [ 0.937, 0.330, -0.116 ], "z_axis": [ 0.172, -0.722, -0.670 ], "quaternion": [ 0.298, 0.509, 0.759, -0.276 ] } }, { "index": 178, "index_chain": 9, "chain_name": "F", "nt_resnum": 347, "nt_name": "G", "nt_code": "G", "nt_id": "///F/347", "linked_nts": [ "///F/346", "///F/348" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,multiplet,hairpin-loop,A-minor", "alpha": -51.406, "beta": 154.603, "gamma": 76.556, "delta": 83.645, "epsilon": 179.224, "zeta": -72.649, "epsilon_zeta": -108.127, "bb_type": "BI", "chi": -155.244, "glyco_bond": "anti", "C5prime_xyz": [ -1.501, 8.817, 0.302 ], "P_xyz": [ 0.731, 9.242, -0.998 ], "form": ".", "ssZp": 4.432, "Dp": 4.368, "splay_angle": 24.062, "splay_distance": 4.142, "splay_ratio": 0.220, "d22": null, "d64": null, "eta": 177.306, "theta": -133.892, "eta_prime": -137.762, "theta_prime": -150.629, "eta_base": -118.779, "theta_base": -137.415, "v0": -0.412, "v1": -22.882, "v2": 35.990, "v3": -37.133, "v4": 23.644, "amplitude": 38.081, "phase_angle": 19.078, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.188, "filter_rmsd": 0.011, "frame": { "rmsd": 0.011, "origin": [ 7.574, 64.575, -36.337 ], "x_axis": [ -0.188, -0.885, 0.427 ], "y_axis": [ 0.946, -0.045, 0.322 ], "z_axis": [ -0.265, 0.464, 0.845 ], "quaternion": [ 0.635, -0.056, -0.272, -0.721 ] } }, { "index": 179, "index_chain": 10, "chain_name": "F", "nt_resnum": 348, "nt_name": "G", "nt_code": "G", "nt_id": "///F/348", "linked_nts": [ "///F/347", "///F/349" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": 157.394, "beta": -158.835, "gamma": 177.704, "delta": 85.183, "epsilon": -139.274, "zeta": -73.301, "epsilon_zeta": -65.973, "bb_type": "BI", "chi": 178.312, "glyco_bond": "anti", "C5prime_xyz": [ -1.427, 8.260, 1.865 ], "P_xyz": [ 0.351, 10.020, 1.079 ], "form": "A", "ssZp": 4.672, "Dp": 4.640, "splay_angle": 24.582, "splay_distance": 3.879, "splay_ratio": 0.217, "d22": null, "d64": null, "eta": 175.045, "theta": -159.595, "eta_prime": -171.249, "theta_prime": -154.465, "eta_base": -134.089, "theta_base": -124.291, "v0": 3.555, "v1": -24.003, "v2": 34.219, "v3": -33.302, "v4": 18.768, "amplitude": 35.133, "phase_angle": 13.102, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.788, "filter_rmsd": 0.003, "frame": { "rmsd": 0.003, "origin": [ 4.361, 65.180, -33.795 ], "x_axis": [ 0.246, -0.825, 0.509 ], "y_axis": [ 0.931, 0.347, 0.111 ], "z_axis": [ -0.268, 0.447, 0.853 ], "quaternion": [ 0.782, -0.107, -0.248, -0.561 ] } }, { "index": 180, "index_chain": 11, "chain_name": "F", "nt_resnum": 349, "nt_name": "A", "nt_code": "A", "nt_id": "///F/349", "linked_nts": [ "///F/348", "///F/350" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -56.487, "beta": -175.736, "gamma": 39.995, "delta": 84.384, "epsilon": -158.143, "zeta": -73.710, "epsilon_zeta": -84.433, "bb_type": "BI", "chi": -158.469, "glyco_bond": "anti", "C5prime_xyz": [ -1.458, 8.674, 0.465 ], "P_xyz": [ 0.897, 9.156, 1.507 ], "form": "A", "ssZp": 4.206, "Dp": 4.455, "splay_angle": 20.817, "splay_distance": 3.348, "splay_ratio": 0.181, "d22": null, "d64": null, "eta": 169.355, "theta": -151.065, "eta_prime": -176.636, "theta_prime": -147.448, "eta_base": -136.833, "theta_base": -126.640, "v0": 1.565, "v1": -22.334, "v2": 33.340, "v3": -33.632, "v4": 20.227, "amplitude": 34.732, "phase_angle": 16.277, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.627, "filter_rmsd": 0.036, "frame": { "rmsd": 0.008, "origin": [ 2.084, 65.183, -30.655 ], "x_axis": [ 0.803, -0.504, 0.318 ], "y_axis": [ 0.579, 0.784, -0.222 ], "z_axis": [ -0.137, 0.363, 0.922 ], "quaternion": [ 0.937, -0.156, -0.121, -0.289 ] } }, { "index": 181, "index_chain": 12, "chain_name": "F", "nt_resnum": 350, "nt_name": "G", "nt_code": "G", "nt_id": "///F/350", "linked_nts": [ "///F/349", null ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix-end,stem-end", "alpha": -61.714, "beta": 176.018, "gamma": 53.824, "delta": 85.329, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": -147.051, "glyco_bond": "anti", "C5prime_xyz": [ -1.435, 8.810, -0.269 ], "P_xyz": [ 1.127, 9.316, -0.092 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": 1.885, "v1": -21.722, "v2": 31.950, "v3": -32.069, "v4": 19.087, "amplitude": 33.180, "phase_angle": 15.651, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.888, "filter_rmsd": 0.006, "frame": { "rmsd": 0.006, "origin": [ 0.864, 65.196, -27.537 ], "x_axis": [ 0.986, -0.077, 0.149 ], "y_axis": [ 0.109, 0.970, -0.217 ], "z_axis": [ -0.128, 0.230, 0.965 ], "quaternion": [ 0.990, -0.113, -0.070, -0.047 ] } }, { "index": 182, "index_chain": 1, "chain_name": "G", "nt_resnum": 1043, "nt_name": "C", "nt_code": "C", "nt_id": "///G/1043", "linked_nts": [ null, "///G/1044" ], "nt_type": "RNA", "dbn": "(", "summary": "k-turn,anti,~C3'-endo,BI,isolated-canonical,non-pair-contact,multiplet,internal-loop,A-minor", "alpha": null, "beta": -176.836, "gamma": 47.163, "delta": 84.890, "epsilon": -153.034, "zeta": -97.517, "epsilon_zeta": -55.517, "bb_type": "BI", "chi": -155.123, "glyco_bond": "anti", "C5prime_xyz": [ -1.366, 8.834, 0.274 ], "P_xyz": [ 1.128, 9.395, 0.873 ], "form": ".", "ssZp": 4.208, "Dp": 4.440, "splay_angle": 21.248, "splay_distance": 3.473, "splay_ratio": 0.185, "d22": 3.836, "d64": 3.845, "eta": null, "theta": -127.805, "eta_prime": null, "theta_prime": -131.121, "eta_base": null, "theta_base": -88.787, "v0": -1.244, "v1": -19.531, "v2": 31.895, "v3": -33.710, "v4": 22.068, "amplitude": 34.142, "phase_angle": 20.904, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.062, "frame": { "rmsd": 0.002, "origin": [ -12.272, -20.082, -94.201 ], "x_axis": [ 0.330, -0.941, 0.077 ], "y_axis": [ -0.851, -0.261, 0.456 ], "z_axis": [ -0.409, -0.216, -0.887 ], "quaternion": [ 0.213, 0.787, -0.569, -0.105 ] } }, { "index": 183, "index_chain": 2, "chain_name": "G", "nt_resnum": 1044, "nt_name": "C", "nt_code": "C", "nt_id": "///G/1044", "linked_nts": [ "///G/1043", "///G/1045" ], "nt_type": "RNA", "dbn": ".", "summary": "k-turn,anti,~C3'-endo,non-pair-contact,internal-loop", "alpha": 143.701, "beta": -127.180, "gamma": 169.226, "delta": 83.990, "epsilon": -139.844, "zeta": -155.980, "epsilon_zeta": 16.135, "bb_type": "--", "chi": -172.083, "glyco_bond": "anti", "C5prime_xyz": [ -1.403, 8.640, 1.187 ], "P_xyz": [ 0.359, 9.488, -0.563 ], "form": ".", "ssZp": 4.603, "Dp": 4.619, "splay_angle": 80.943, "splay_distance": 12.958, "splay_ratio": 0.654, "d22": 9.937, "d64": 12.398, "eta": 156.446, "theta": 165.497, "eta_prime": -177.183, "theta_prime": 179.723, "eta_base": -114.399, "theta_base": 156.097, "v0": 1.504, "v1": -23.167, "v2": 34.637, "v3": -34.830, "v4": 20.984, "amplitude": 36.085, "phase_angle": 16.286, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.202, "filter_rmsd": 0.063, "frame": { "rmsd": 0.002, "origin": [ -12.565, -22.681, -96.487 ], "x_axis": [ -0.224, -0.913, 0.342 ], "y_axis": [ -0.951, 0.281, 0.126 ], "z_axis": [ -0.211, -0.297, -0.931 ], "quaternion": [ -0.177, -0.597, 0.780, -0.055 ] } }, { "index": 184, "index_chain": 3, "chain_name": "G", "nt_resnum": 1045, "nt_name": "C", "nt_code": "C", "nt_id": "///G/1045", "linked_nts": [ "///G/1044", "///G/1046" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,k-turn,anti,~C2'-endo,non-pair-contact,internal-loop,cap-donor,splayed-apart", "alpha": 88.640, "beta": 125.669, "gamma": -69.663, "delta": 141.774, "epsilon": -99.698, "zeta": 42.944, "epsilon_zeta": 217.358, "bb_type": "--", "chi": -96.238, "glyco_bond": "anti", "C5prime_xyz": [ -2.237, 7.958, -2.297 ], "P_xyz": [ -1.962, 10.565, -2.213 ], "form": ".", "ssZp": 0.510, "Dp": 1.130, "splay_angle": 172.100, "splay_distance": 18.756, "splay_ratio": 0.998, "d22": null, "d64": null, "eta": -161.994, "theta": 64.086, "eta_prime": 170.133, "theta_prime": 35.752, "eta_base": 135.440, "theta_base": -105.553, "v0": -19.509, "v1": 32.656, "v2": -32.319, "v3": 22.062, "v4": -1.819, "amplitude": 33.600, "phase_angle": 164.127, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32m", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.002, "origin": [ -10.840, -15.415, -107.077 ], "x_axis": [ 0.762, -0.189, 0.620 ], "y_axis": [ -0.604, -0.555, 0.573 ], "z_axis": [ 0.236, -0.810, -0.536 ], "quaternion": [ 0.409, 0.845, -0.235, 0.253 ] } }, { "index": 185, "index_chain": 4, "chain_name": "G", "nt_resnum": 1046, "nt_name": "A", "nt_code": "A", "nt_id": "///G/1046", "linked_nts": [ "///G/1045", "///G/1047" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,k-turn,anti,~C2'-endo,non-stack,internal-loop,splayed-apart", "alpha": 78.203, "beta": 123.314, "gamma": 71.281, "delta": 147.993, "epsilon": -134.176, "zeta": 90.324, "epsilon_zeta": 135.500, "bb_type": "--", "chi": -126.596, "glyco_bond": "anti", "C5prime_xyz": [ -2.089, 8.590, -0.882 ], "P_xyz": [ 0.504, 8.250, -1.180 ], "form": ".", "ssZp": 1.630, "Dp": 1.654, "splay_angle": 102.476, "splay_distance": 16.042, "splay_ratio": 0.780, "d22": null, "d64": null, "eta": -55.649, "theta": 64.142, "eta_prime": 6.366, "theta_prime": 4.661, "eta_base": 149.279, "theta_base": 10.426, "v0": -22.933, "v1": 35.125, "v2": -33.170, "v3": 21.035, "v4": 0.988, "amplitude": 35.395, "phase_angle": 159.577, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.037, "frame": { "rmsd": 0.003, "origin": [ -27.304, -24.128, -104.883 ], "x_axis": [ 0.506, -0.764, -0.400 ], "y_axis": [ 0.846, 0.530, 0.057 ], "z_axis": [ 0.169, -0.367, 0.915 ], "quaternion": [ 0.859, 0.123, 0.166, -0.469 ] } }, { "index": 186, "index_chain": 5, "chain_name": "G", "nt_resnum": 1047, "nt_name": "G", "nt_code": "G", "nt_id": "///G/1047", "linked_nts": [ "///G/1046", "///G/1048" ], "nt_type": "RNA", "dbn": ".", "summary": "k-turn,anti,~C2'-endo,non-canonical,non-pair-contact,helix-end,internal-loop,cap-acceptor,splayed-apart", "alpha": -52.730, "beta": -76.715, "gamma": -85.083, "delta": 146.444, "epsilon": -147.519, "zeta": -164.448, "epsilon_zeta": 16.929, "bb_type": "--", "chi": -132.408, "glyco_bond": "anti", "C5prime_xyz": [ -0.966, 8.382, -0.264 ], "P_xyz": [ -1.606, 10.608, -1.455 ], "form": ".", "ssZp": 2.654, "Dp": 2.245, "splay_angle": 64.716, "splay_distance": 10.471, "splay_ratio": 0.536, "d22": null, "d64": null, "eta": -175.728, "theta": 93.444, "eta_prime": -163.463, "theta_prime": 124.645, "eta_base": -157.882, "theta_base": 147.165, "v0": -7.012, "v1": 21.783, "v2": -27.209, "v3": 24.115, "v4": -10.938, "amplitude": 27.285, "phase_angle": 184.275, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "22m", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.025, "frame": { "rmsd": 0.025, "origin": [ -15.224, -13.735, -106.732 ], "x_axis": [ -0.488, 0.268, -0.830 ], "y_axis": [ -0.868, -0.056, 0.492 ], "z_axis": [ 0.085, 0.962, 0.260 ], "quaternion": [ 0.423, -0.277, 0.541, 0.672 ] } }, { "index": 187, "index_chain": 6, "chain_name": "G", "nt_resnum": 1048, "nt_name": "A", "nt_code": "A", "nt_id": "///G/1048", "linked_nts": [ "///G/1047", "///G/1049" ], "nt_type": "RNA", "dbn": ".", "summary": "k-turn,anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,internal-loop,A-minor,phosphate", "alpha": -62.967, "beta": 177.588, "gamma": 39.029, "delta": 84.883, "epsilon": -158.469, "zeta": -58.724, "epsilon_zeta": -99.745, "bb_type": "BI", "chi": -158.200, "glyco_bond": "anti", "C5prime_xyz": [ -1.567, 8.778, 0.399 ], "P_xyz": [ 0.756, 9.419, 1.427 ], "form": "A", "ssZp": 4.039, "Dp": 4.305, "splay_angle": 18.468, "splay_distance": 3.038, "splay_ratio": 0.161, "d22": null, "d64": null, "eta": -169.660, "theta": -136.545, "eta_prime": 174.009, "theta_prime": -135.668, "eta_base": 177.144, "theta_base": -101.163, "v0": -0.748, "v1": -19.413, "v2": 31.099, "v3": -32.718, "v4": 21.133, "amplitude": 33.133, "phase_angle": 20.185, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "4a", "suiteness": 0.049, "filter_rmsd": 0.039, "frame": { "rmsd": 0.006, "origin": [ -10.315, -13.106, -97.504 ], "x_axis": [ -0.034, 0.439, -0.898 ], "y_axis": [ -0.987, -0.153, -0.038 ], "z_axis": [ -0.154, 0.885, 0.439 ], "quaternion": [ 0.559, -0.412, 0.332, 0.638 ] } }, { "index": 188, "index_chain": 7, "chain_name": "G", "nt_resnum": 1049, "nt_name": "C", "nt_code": "C", "nt_id": "///G/1049", "linked_nts": [ "///G/1048", "///G/1050" ], "nt_type": "RNA", "dbn": ".", "summary": "k-turn,anti,~C3'-endo,BI,non-pair-contact,internal-loop", "alpha": -84.965, "beta": -167.692, "gamma": 46.125, "delta": 82.526, "epsilon": -158.239, "zeta": -64.812, "epsilon_zeta": -93.427, "bb_type": "BI", "chi": -141.126, "glyco_bond": "anti", "C5prime_xyz": [ -1.374, 8.790, -0.562 ], "P_xyz": [ 1.143, 9.498, -0.396 ], "form": "A", "ssZp": 3.847, "Dp": 4.504, "splay_angle": 29.033, "splay_distance": 4.726, "splay_ratio": 0.251, "d22": null, "d64": null, "eta": 154.294, "theta": -146.336, "eta_prime": 169.462, "theta_prime": -145.516, "eta_base": -142.672, "theta_base": -119.484, "v0": 0.775, "v1": -21.838, "v2": 33.600, "v3": -34.227, "v4": 21.132, "amplitude": 35.245, "phase_angle": 17.571, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.533, "filter_rmsd": 0.063, "frame": { "rmsd": 0.003, "origin": [ -10.086, -10.083, -97.299 ], "x_axis": [ -0.615, 0.078, -0.785 ], "y_axis": [ -0.780, -0.203, 0.591 ], "z_axis": [ -0.113, 0.976, 0.186 ], "quaternion": [ 0.303, -0.317, 0.554, 0.708 ] } }, { "index": 189, "index_chain": 8, "chain_name": "G", "nt_resnum": 1050, "nt_name": "A", "nt_code": "A", "nt_id": "///G/1050", "linked_nts": [ "///G/1049", "///G/1051" ], "nt_type": "RNA", "dbn": ".", "summary": "k-turn,anti,~C3'-endo,BI,non-pair-contact,internal-loop", "alpha": -69.024, "beta": -179.286, "gamma": 47.848, "delta": 80.415, "epsilon": -144.453, "zeta": -68.067, "epsilon_zeta": -76.386, "bb_type": "BI", "chi": 179.520, "glyco_bond": "anti", "C5prime_xyz": [ -1.850, 8.496, 1.634 ], "P_xyz": [ 0.391, 9.035, 2.877 ], "form": ".", "ssZp": 4.556, "Dp": 4.563, "splay_angle": 30.589, "splay_distance": 4.791, "splay_ratio": 0.267, "d22": null, "d64": null, "eta": 165.202, "theta": -139.195, "eta_prime": 176.959, "theta_prime": -133.487, "eta_base": -144.462, "theta_base": -95.087, "v0": -0.348, "v1": -21.727, "v2": 34.183, "v3": -35.496, "v4": 22.643, "amplitude": 36.210, "phase_angle": 19.260, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.872, "filter_rmsd": 0.038, "frame": { "rmsd": 0.002, "origin": [ -11.297, -5.575, -98.036 ], "x_axis": [ -0.581, -0.659, -0.477 ], "y_axis": [ -0.202, -0.451, 0.869 ], "z_axis": [ -0.788, 0.602, 0.129 ], "quaternion": [ -0.155, -0.430, 0.500, 0.735 ] } }, { "index": 190, "index_chain": 9, "chain_name": "G", "nt_resnum": 1051, "nt_name": "G", "nt_code": "G", "nt_id": "///G/1051", "linked_nts": [ "///G/1050", "///G/1052" ], "nt_type": "RNA", "dbn": "(", "summary": "k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop", "alpha": -53.253, "beta": 170.011, "gamma": 47.042, "delta": 80.406, "epsilon": -134.083, "zeta": -73.454, "epsilon_zeta": -60.629, "bb_type": "BI", "chi": -176.118, "glyco_bond": "anti", "C5prime_xyz": [ -1.663, 8.567, 1.601 ], "P_xyz": [ 0.798, 9.016, 2.369 ], "form": ".", "ssZp": 4.846, "Dp": 4.669, "splay_angle": 28.287, "splay_distance": 4.516, "splay_ratio": 0.248, "d22": null, "d64": null, "eta": 171.964, "theta": -131.692, "eta_prime": -169.903, "theta_prime": -125.473, "eta_base": -115.710, "theta_base": -81.900, "v0": -2.178, "v1": -21.022, "v2": 34.734, "v3": -37.008, "v4": 24.764, "amplitude": 37.430, "phase_angle": 21.879, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.828, "filter_rmsd": 0.014, "frame": { "rmsd": 0.014, "origin": [ -15.464, -3.666, -99.431 ], "x_axis": [ -0.618, -0.743, 0.257 ], "y_axis": [ 0.415, -0.031, 0.910 ], "z_axis": [ -0.668, 0.669, 0.327 ], "quaternion": [ -0.412, -0.146, 0.561, 0.703 ] } }, { "index": 191, "index_chain": 10, "chain_name": "G", "nt_resnum": 1052, "nt_name": "C", "nt_code": "C", "nt_id": "///G/1052", "linked_nts": [ "///G/1051", "///G/1053" ], "nt_type": "RNA", "dbn": "(", "summary": "k-turn,anti,~C3'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -50.368, "beta": 156.374, "gamma": 56.875, "delta": 83.949, "epsilon": -118.703, "zeta": -93.053, "epsilon_zeta": -25.650, "bb_type": "--", "chi": -174.603, "glyco_bond": "anti", "C5prime_xyz": [ -2.015, 8.702, 1.328 ], "P_xyz": [ 0.485, 9.334, 1.746 ], "form": ".", "ssZp": 4.425, "Dp": 4.419, "splay_angle": 22.541, "splay_distance": 3.648, "splay_ratio": 0.195, "d22": 4.897, "d64": 4.392, "eta": 178.127, "theta": -141.041, "eta_prime": -160.952, "theta_prime": -141.460, "eta_base": -101.049, "theta_base": -119.713, "v0": -6.491, "v1": -16.582, "v2": 31.998, "v3": -36.849, "v4": 27.291, "amplitude": 36.501, "phase_angle": 28.759, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.683, "filter_rmsd": 0.062, "frame": { "rmsd": 0.007, "origin": [ -19.754, -3.779, -98.024 ], "x_axis": [ -0.089, -0.583, 0.808 ], "y_axis": [ 0.740, 0.504, 0.445 ], "z_axis": [ -0.666, 0.637, 0.387 ], "quaternion": [ 0.671, -0.072, -0.549, -0.493 ] } }, { "index": 192, "index_chain": 11, "chain_name": "G", "nt_resnum": 1053, "nt_name": "C", "nt_code": "C", "nt_id": "///G/1053", "linked_nts": [ "///G/1052", "///G/1054" ], "nt_type": "RNA", "dbn": "(", "summary": "k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -81.894, "beta": 157.029, "gamma": 62.089, "delta": 83.349, "epsilon": -165.142, "zeta": -66.312, "epsilon_zeta": -98.829, "bb_type": "BI", "chi": -157.624, "glyco_bond": "anti", "C5prime_xyz": [ -1.583, 8.837, 0.441 ], "P_xyz": [ 0.906, 9.312, -0.220 ], "form": "A", "ssZp": 4.485, "Dp": 4.478, "splay_angle": 24.424, "splay_distance": 3.831, "splay_ratio": 0.213, "d22": null, "d64": null, "eta": 145.880, "theta": -145.976, "eta_prime": 163.583, "theta_prime": -152.177, "eta_base": -158.353, "theta_base": -126.661, "v0": -2.316, "v1": -20.849, "v2": 34.654, "v3": -36.952, "v4": 24.706, "amplitude": 37.379, "phase_angle": 22.016, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.308, "filter_rmsd": 0.063, "frame": { "rmsd": 0.010, "origin": [ -22.916, -2.294, -96.973 ], "x_axis": [ 0.450, -0.323, 0.833 ], "y_axis": [ 0.573, 0.820, 0.009 ], "z_axis": [ -0.686, 0.473, 0.554 ], "quaternion": [ 0.840, -0.138, -0.452, -0.267 ] } }, { "index": 193, "index_chain": 12, "chain_name": "G", "nt_resnum": 1054, "nt_name": "A", "nt_code": "A", "nt_id": "///G/1054", "linked_nts": [ "///G/1053", "///G/1055" ], "nt_type": "RNA", "dbn": "(", "summary": "k-turn,anti,~C3'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack,A-minor", "alpha": -74.351, "beta": -173.645, "gamma": 47.923, "delta": 78.956, "epsilon": -127.450, "zeta": -110.627, "epsilon_zeta": -16.823, "bb_type": "--", "chi": -166.912, "glyco_bond": "anti", "C5prime_xyz": [ -1.346, 8.574, 1.028 ], "P_xyz": [ 1.200, 9.011, 1.477 ], "form": "A", "ssZp": 4.728, "Dp": 4.826, "splay_angle": 25.816, "splay_distance": 3.848, "splay_ratio": 0.223, "d22": null, "d64": null, "eta": 166.291, "theta": -163.677, "eta_prime": 174.081, "theta_prime": -155.637, "eta_base": -144.628, "theta_base": -131.231, "v0": 2.355, "v1": -25.808, "v2": 38.030, "v3": -37.684, "v4": 22.271, "amplitude": 39.408, "phase_angle": 15.196, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.731, "filter_rmsd": 0.038, "frame": { "rmsd": 0.012, "origin": [ -25.485, -2.029, -94.143 ], "x_axis": [ 0.809, 0.112, 0.577 ], "y_axis": [ 0.227, 0.846, -0.482 ], "z_axis": [ -0.543, 0.521, 0.659 ], "quaternion": [ 0.910, -0.276, -0.308, -0.031 ] } }, { "index": 194, "index_chain": 13, "chain_name": "G", "nt_resnum": 1055, "nt_name": "G", "nt_code": "G", "nt_id": "///G/1055", "linked_nts": [ "///G/1054", "///G/1056" ], "nt_type": "RNA", "dbn": "(", "summary": "k-turn,anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,junction-loop,A-minor", "alpha": -46.936, "beta": 125.375, "gamma": 69.572, "delta": 85.538, "epsilon": -166.187, "zeta": -51.243, "epsilon_zeta": -114.944, "bb_type": "BI", "chi": 173.190, "glyco_bond": "anti", "C5prime_xyz": [ -1.897, 8.267, 1.916 ], "P_xyz": [ 0.663, 8.521, 1.418 ], "form": ".", "ssZp": 4.204, "Dp": 4.471, "splay_angle": 25.729, "splay_distance": 3.780, "splay_ratio": 0.226, "d22": null, "d64": null, "eta": 163.239, "theta": -107.432, "eta_prime": -174.330, "theta_prime": -119.696, "eta_base": -135.799, "theta_base": -66.324, "v0": 1.433, "v1": -23.702, "v2": 35.466, "v3": -35.708, "v4": 21.577, "amplitude": 36.973, "phase_angle": 16.412, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1L", "suiteness": 0.566, "filter_rmsd": 0.010, "frame": { "rmsd": 0.010, "origin": [ -27.322, -1.276, -90.847 ], "x_axis": [ 0.932, 0.309, 0.190 ], "y_axis": [ -0.104, 0.730, -0.676 ], "z_axis": [ -0.347, 0.610, 0.712 ], "quaternion": [ 0.918, -0.350, -0.146, 0.112 ] } }, { "index": 195, "index_chain": 14, "chain_name": "G", "nt_resnum": 1056, "nt_name": "G", "nt_code": "G", "nt_id": "///G/1056", "linked_nts": [ "///G/1055", "///G/1057" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-canonical,non-pair-contact,helix,junction-loop,splayed-apart", "alpha": -123.989, "beta": -132.259, "gamma": 66.186, "delta": 87.827, "epsilon": -166.976, "zeta": 135.908, "epsilon_zeta": 57.116, "bb_type": "--", "chi": -132.836, "glyco_bond": "anti", "C5prime_xyz": [ -1.238, 8.570, -1.050 ], "P_xyz": [ 1.358, 8.563, -0.593 ], "form": ".", "ssZp": 3.407, "Dp": 4.415, "splay_angle": 123.134, "splay_distance": 16.068, "splay_ratio": 0.880, "d22": null, "d64": null, "eta": 157.229, "theta": 59.811, "eta_prime": 178.970, "theta_prime": 62.011, "eta_base": -101.692, "theta_base": 88.481, "v0": 3.052, "v1": -23.794, "v2": 34.295, "v3": -33.564, "v4": 19.195, "amplitude": 35.313, "phase_angle": 13.793, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.002, "frame": { "rmsd": 0.002, "origin": [ -25.747, 1.600, -88.966 ], "x_axis": [ 0.257, 0.830, -0.496 ], "y_axis": [ -0.958, 0.150, -0.244 ], "z_axis": [ -0.128, 0.538, 0.833 ], "quaternion": [ 0.748, -0.261, 0.123, 0.597 ] } }, { "index": 196, "index_chain": 15, "chain_name": "G", "nt_resnum": 1057, "nt_name": "A", "nt_code": "A", "nt_id": "///G/1057", "linked_nts": [ "///G/1056", "///G/1058" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,junction-loop,splayed-apart", "alpha": -75.152, "beta": 135.496, "gamma": 51.886, "delta": 83.961, "epsilon": -152.542, "zeta": -66.247, "epsilon_zeta": -86.295, "bb_type": "BI", "chi": -179.846, "glyco_bond": "anti", "C5prime_xyz": [ -1.795, 8.457, 1.574 ], "P_xyz": [ 0.814, 8.453, 1.856 ], "form": "A", "ssZp": 4.336, "Dp": 4.477, "splay_angle": 23.993, "splay_distance": 3.909, "splay_ratio": 0.215, "d22": null, "d64": null, "eta": 160.782, "theta": -131.126, "eta_prime": -174.266, "theta_prime": -136.860, "eta_base": -165.519, "theta_base": -119.445, "v0": 0.465, "v1": -21.726, "v2": 33.422, "v3": -34.300, "v4": 21.348, "amplitude": 35.146, "phase_angle": 18.018, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "9a", "suiteness": 0.611, "filter_rmsd": 0.038, "frame": { "rmsd": 0.006, "origin": [ -40.966, -3.447, -87.909 ], "x_axis": [ 0.674, -0.560, 0.483 ], "y_axis": [ 0.691, 0.708, -0.144 ], "z_axis": [ -0.261, 0.431, 0.864 ], "quaternion": [ 0.901, -0.160, -0.206, -0.347 ] } }, { "index": 197, "index_chain": 16, "chain_name": "G", "nt_resnum": 1058, "nt_name": "U", "nt_code": "U", "nt_id": "///G/1058", "linked_nts": [ "///G/1057", "///G/1059" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -72.835, "beta": -171.452, "gamma": 50.690, "delta": 83.706, "epsilon": -161.307, "zeta": -66.580, "epsilon_zeta": -94.727, "bb_type": "BI", "chi": -158.443, "glyco_bond": "anti", "C5prime_xyz": [ -1.623, 8.792, 0.412 ], "P_xyz": [ 0.814, 9.510, 1.064 ], "form": "A", "ssZp": 4.312, "Dp": 4.436, "splay_angle": 21.736, "splay_distance": 3.641, "splay_ratio": 0.194, "d22": null, "d64": null, "eta": 166.700, "theta": -148.507, "eta_prime": -178.887, "theta_prime": -147.252, "eta_base": -140.910, "theta_base": -131.404, "v0": -0.889, "v1": -21.110, "v2": 33.736, "v3": -35.290, "v4": 22.768, "amplitude": 35.907, "phase_angle": 20.023, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.851, "filter_rmsd": 0.105, "frame": { "rmsd": 0.004, "origin": [ -42.997, -3.905, -84.601 ], "x_axis": [ 0.935, -0.036, 0.354 ], "y_axis": [ 0.182, 0.903, -0.390 ], "z_axis": [ -0.306, 0.429, 0.850 ], "quaternion": [ 0.960, -0.213, -0.172, -0.057 ] } }, { "index": 198, "index_chain": 17, "chain_name": "G", "nt_resnum": 1059, "nt_name": "G", "nt_code": "G", "nt_id": "///G/1059", "linked_nts": [ "///G/1058", "///G/1060" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop", "alpha": -72.927, "beta": -167.929, "gamma": 47.872, "delta": 82.290, "epsilon": -155.117, "zeta": 32.164, "epsilon_zeta": 172.719, "bb_type": "--", "chi": -144.317, "glyco_bond": "anti", "C5prime_xyz": [ -1.566, 8.871, -0.431 ], "P_xyz": [ 0.868, 9.783, -0.087 ], "form": ".", "ssZp": 3.860, "Dp": 4.445, "splay_angle": 20.876, "splay_distance": 3.385, "splay_ratio": 0.183, "d22": null, "d64": null, "eta": 169.271, "theta": -41.523, "eta_prime": 178.222, "theta_prime": -77.814, "eta_base": -157.735, "theta_base": -131.297, "v0": -1.173, "v1": -20.522, "v2": 33.009, "v3": -34.825, "v4": 22.734, "amplitude": 35.267, "phase_angle": 20.612, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.746, "filter_rmsd": 0.002, "frame": { "rmsd": 0.002, "origin": [ -44.008, -4.346, -81.131 ], "x_axis": [ 0.950, 0.313, -0.025 ], "y_axis": [ -0.299, 0.878, -0.373 ], "z_axis": [ -0.094, 0.361, 0.928 ], "quaternion": [ 0.969, -0.189, -0.018, 0.158 ] } }, { "index": 199, "index_chain": 18, "chain_name": "G", "nt_resnum": 1060, "nt_name": "U", "nt_code": "U", "nt_id": "///G/1060", "linked_nts": [ "///G/1059", "///G/1061" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C2'-endo,non-canonical,non-pair-contact,helix,internal-loop,phosphate,splayed-apart", "alpha": 163.862, "beta": 157.066, "gamma": 49.856, "delta": 144.726, "epsilon": -78.467, "zeta": 117.675, "epsilon_zeta": 163.858, "bb_type": "--", "chi": -134.507, "glyco_bond": "anti", "C5prime_xyz": [ -1.739, 8.693, -0.389 ], "P_xyz": [ 0.679, 8.962, 0.599 ], "form": ".", "ssZp": 0.479, "Dp": 0.559, "splay_angle": 108.152, "splay_distance": 16.221, "splay_ratio": 0.810, "d22": 10.056, "d64": 13.018, "eta": 61.807, "theta": 166.223, "eta_prime": 120.908, "theta_prime": 107.174, "eta_base": 97.510, "theta_base": 85.858, "v0": -19.654, "v1": 32.782, "v2": -32.617, "v3": 22.324, "v4": -1.884, "amplitude": 33.882, "phase_angle": 164.294, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "5z", "suiteness": 0.688, "filter_rmsd": 0.111, "frame": { "rmsd": 0.029, "origin": [ -44.006, -3.275, -77.920 ], "x_axis": [ -0.836, -0.547, 0.054 ], "y_axis": [ -0.543, 0.807, -0.233 ], "z_axis": [ 0.084, -0.224, -0.971 ], "quaternion": [ 0.008, -0.287, 0.950, -0.120 ] } }, { "index": 200, "index_chain": 19, "chain_name": "G", "nt_resnum": 1061, "nt_name": "U", "nt_code": "U", "nt_id": "///G/1061", "linked_nts": [ "///G/1060", "///G/1062" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,anti,~C2'-endo,non-pair-contact,internal-loop,splayed-apart", "alpha": 70.823, "beta": -148.060, "gamma": 54.175, "delta": 141.908, "epsilon": -126.295, "zeta": -82.793, "epsilon_zeta": -43.501, "bb_type": "--", "chi": -121.122, "glyco_bond": "anti", "C5prime_xyz": [ -2.103, 8.554, -1.233 ], "P_xyz": [ -0.173, 9.883, -0.054 ], "form": ".", "ssZp": 1.543, "Dp": 1.559, "splay_angle": 119.660, "splay_distance": 15.871, "splay_ratio": 0.866, "d22": null, "d64": null, "eta": 34.914, "theta": -43.203, "eta_prime": 30.757, "theta_prime": -102.507, "eta_base": 23.139, "theta_base": -169.772, "v0": -22.103, "v1": 34.244, "v2": -32.571, "v3": 20.829, "v4": 0.599, "amplitude": 34.621, "phase_angle": 160.186, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "6p", "suiteness": 0.180, "filter_rmsd": 0.104, "frame": { "rmsd": 0.002, "origin": [ -45.277, 11.997, -72.602 ], "x_axis": [ -0.531, 0.652, -0.541 ], "y_axis": [ 0.162, -0.549, -0.820 ], "z_axis": [ -0.832, -0.523, 0.186 ], "quaternion": [ 0.163, -0.456, -0.446, 0.753 ] } }, { "index": 201, "index_chain": 20, "chain_name": "G", "nt_resnum": 1062, "nt_name": "G", "nt_code": "G", "nt_id": "///G/1062", "linked_nts": [ "///G/1061", "///G/1063" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop,splayed-apart", "alpha": 99.198, "beta": 132.726, "gamma": 52.131, "delta": 85.298, "epsilon": -143.139, "zeta": -75.801, "epsilon_zeta": -67.338, "bb_type": "BI", "chi": -177.423, "glyco_bond": "anti", "C5prime_xyz": [ -1.363, 8.427, 1.582 ], "P_xyz": [ 1.245, 8.097, 1.505 ], "form": "A", "ssZp": 4.634, "Dp": 4.601, "splay_angle": 22.977, "splay_distance": 3.583, "splay_ratio": 0.201, "d22": null, "d64": null, "eta": -79.942, "theta": -130.973, "eta_prime": -12.933, "theta_prime": -136.835, "eta_base": 54.205, "theta_base": -118.695, "v0": 3.526, "v1": -23.783, "v2": 33.836, "v3": -32.885, "v4": 18.548, "amplitude": 34.732, "phase_angle": 13.044, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.004, "frame": { "rmsd": 0.004, "origin": [ -41.179, -3.135, -70.131 ], "x_axis": [ 0.920, 0.389, 0.044 ], "y_axis": [ -0.200, 0.563, -0.802 ], "z_axis": [ -0.337, 0.729, 0.596 ], "quaternion": [ 0.877, -0.436, -0.108, 0.168 ] } }, { "index": 202, "index_chain": 21, "chain_name": "G", "nt_resnum": 1063, "nt_name": "G", "nt_code": "G", "nt_id": "///G/1063", "linked_nts": [ "///G/1062", "///G/1064" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -71.489, "beta": 178.709, "gamma": 50.968, "delta": 83.878, "epsilon": -149.950, "zeta": -65.958, "epsilon_zeta": -83.993, "bb_type": "BI", "chi": -168.978, "glyco_bond": "anti", "C5prime_xyz": [ -1.387, 8.632, 1.077 ], "P_xyz": [ 1.130, 8.905, 1.775 ], "form": "A", "ssZp": 4.560, "Dp": 4.587, "splay_angle": 23.681, "splay_distance": 3.877, "splay_ratio": 0.210, "d22": null, "d64": null, "eta": 162.977, "theta": -136.230, "eta_prime": 175.823, "theta_prime": -134.067, "eta_base": -143.890, "theta_base": -104.488, "v0": 1.936, "v1": -23.093, "v2": 34.217, "v3": -34.180, "v4": 20.357, "amplitude": 35.535, "phase_angle": 15.653, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.909, "filter_rmsd": 0.002, "frame": { "rmsd": 0.002, "origin": [ -41.453, -1.550, -66.930 ], "x_axis": [ 0.673, 0.502, -0.543 ], "y_axis": [ -0.706, 0.216, -0.675 ], "z_axis": [ -0.221, 0.837, 0.500 ], "quaternion": [ 0.773, -0.489, 0.104, 0.391 ] } }, { "index": 203, "index_chain": 22, "chain_name": "G", "nt_resnum": 1064, "nt_name": "C", "nt_code": "C", "nt_id": "///G/1064", "linked_nts": [ "///G/1063", "///G/1065" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop,phosphate", "alpha": -59.696, "beta": 174.235, "gamma": 53.370, "delta": 83.332, "epsilon": -152.963, "zeta": -57.820, "epsilon_zeta": -95.143, "bb_type": "BI", "chi": -160.969, "glyco_bond": "anti", "C5prime_xyz": [ -1.661, 8.874, 0.539 ], "P_xyz": [ 0.829, 9.569, 0.955 ], "form": ".", "ssZp": 4.313, "Dp": 4.425, "splay_angle": 28.558, "splay_distance": 4.544, "splay_ratio": 0.247, "d22": 3.686, "d64": 3.687, "eta": 172.064, "theta": -131.569, "eta_prime": -169.476, "theta_prime": -128.059, "eta_base": -123.455, "theta_base": -74.504, "v0": -2.748, "v1": -19.475, "v2": 32.867, "v3": -35.513, "v4": 24.149, "amplitude": 35.705, "phase_angle": 22.999, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.946, "filter_rmsd": 0.062, "frame": { "rmsd": 0.002, "origin": [ -40.059, 1.612, -65.171 ], "x_axis": [ 0.137, 0.515, -0.846 ], "y_axis": [ -0.975, -0.083, -0.208 ], "z_axis": [ -0.177, 0.853, 0.491 ], "quaternion": [ 0.622, -0.427, 0.269, 0.599 ] } }, { "index": 204, "index_chain": 23, "chain_name": "G", "nt_resnum": 1065, "nt_name": "U", "nt_code": "U", "nt_id": "///G/1065", "linked_nts": [ "///G/1064", "///G/1066" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,hairpin-loop", "alpha": -65.906, "beta": 172.061, "gamma": 53.417, "delta": 84.963, "epsilon": -142.851, "zeta": -66.361, "epsilon_zeta": -76.490, "bb_type": "BI", "chi": -153.800, "glyco_bond": "anti", "C5prime_xyz": [ -1.430, 8.769, 0.177 ], "P_xyz": [ 1.159, 9.201, 0.281 ], "form": ".", "ssZp": 4.158, "Dp": 4.548, "splay_angle": 26.357, "splay_distance": 4.228, "splay_ratio": 0.228, "d22": 3.921, "d64": 3.513, "eta": 167.551, "theta": -129.951, "eta_prime": -168.016, "theta_prime": -127.308, "eta_base": -96.702, "theta_base": -82.910, "v0": 0.897, "v1": -21.906, "v2": 33.339, "v3": -33.924, "v4": 20.861, "amplitude": 34.921, "phase_angle": 17.312, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.840, "filter_rmsd": 0.104, "frame": { "rmsd": 0.001, "origin": [ -41.066, 5.818, -66.563 ], "x_axis": [ -0.700, 0.219, -0.680 ], "y_axis": [ -0.704, -0.370, 0.606 ], "z_axis": [ -0.119, 0.903, 0.413 ], "quaternion": [ 0.293, -0.254, 0.479, 0.788 ] } }, { "index": 205, "index_chain": 24, "chain_name": "G", "nt_resnum": 1066, "nt_name": "U", "nt_code": "U", "nt_id": "///G/1066", "linked_nts": [ "///G/1065", "///G/1067" ], "nt_type": "RNA", "dbn": ".", "summary": "u-turn,anti,~C3'-endo,BI,non-pair-contact,hairpin-loop,cap-acceptor", "alpha": -65.914, "beta": 172.441, "gamma": 52.957, "delta": 85.569, "epsilon": -148.726, "zeta": -67.063, "epsilon_zeta": -81.663, "bb_type": "BI", "chi": -145.561, "glyco_bond": "anti", "C5prime_xyz": [ -1.391, 8.738, -0.323 ], "P_xyz": [ 1.200, 9.124, -0.499 ], "form": ".", "ssZp": 3.905, "Dp": 4.536, "splay_angle": 73.293, "splay_distance": 11.092, "splay_ratio": 0.597, "d22": null, "d64": null, "eta": 164.751, "theta": -114.750, "eta_prime": -173.380, "theta_prime": -158.174, "eta_base": -113.747, "theta_base": 141.873, "v0": 1.312, "v1": -22.445, "v2": 33.717, "v3": -34.050, "v4": 20.673, "amplitude": 35.186, "phase_angle": 16.615, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.909, "filter_rmsd": 0.105, "frame": { "rmsd": 0.001, "origin": [ -43.943, 8.903, -66.844 ], "x_axis": [ -0.944, -0.317, -0.092 ], "y_axis": [ -0.020, -0.221, 0.975 ], "z_axis": [ -0.329, 0.922, 0.202 ], "quaternion": [ -0.096, -0.137, 0.617, 0.769 ] } }, { "index": 206, "index_chain": 25, "chain_name": "G", "nt_resnum": 1067, "nt_name": "A", "nt_code": "A", "nt_id": "///G/1067", "linked_nts": [ "///G/1066", "///G/1068" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,u-turn,anti,~C3'-endo,BI,non-pair-contact,hairpin-loop", "alpha": 164.570, "beta": 167.923, "gamma": 52.350, "delta": 84.784, "epsilon": -142.939, "zeta": -62.293, "epsilon_zeta": -80.646, "bb_type": "BI", "chi": -164.032, "glyco_bond": "anti", "C5prime_xyz": [ -1.445, 8.686, 0.759 ], "P_xyz": [ 1.130, 9.017, 1.164 ], "form": ".", "ssZp": 4.384, "Dp": 4.548, "splay_angle": 23.721, "splay_distance": 3.751, "splay_ratio": 0.206, "d22": null, "d64": null, "eta": 28.131, "theta": -125.775, "eta_prime": 48.876, "theta_prime": -124.602, "eta_base": 26.546, "theta_base": -73.970, "v0": 1.281, "v1": -22.016, "v2": 33.078, "v3": -33.486, "v4": 20.355, "amplitude": 34.535, "phase_angle": 16.700, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1g", "suiteness": 0.901, "filter_rmsd": 0.038, "frame": { "rmsd": 0.002, "origin": [ -35.857, 15.002, -62.323 ], "x_axis": [ 0.515, -0.631, 0.580 ], "y_axis": [ -0.835, -0.215, 0.507 ], "z_axis": [ -0.195, -0.746, -0.637 ], "quaternion": [ 0.407, 0.769, -0.476, 0.125 ] } }, { "index": 207, "index_chain": 26, "chain_name": "G", "nt_resnum": 1068, "nt_name": "G", "nt_code": "G", "nt_id": "///G/1068", "linked_nts": [ "///G/1067", "///G/1069" ], "nt_type": "RNA", "dbn": ".", "summary": "u-turn,anti,~C3'-endo,BI,non-pair-contact,hairpin-loop,cap-donor,phosphate", "alpha": -76.240, "beta": 179.757, "gamma": 52.124, "delta": 84.352, "epsilon": -148.291, "zeta": -60.310, "epsilon_zeta": -87.981, "bb_type": "BI", "chi": -143.469, "glyco_bond": "anti", "C5prime_xyz": [ -1.215, 8.723, -0.441 ], "P_xyz": [ 1.394, 9.029, -0.540 ], "form": ".", "ssZp": 3.837, "Dp": 4.602, "splay_angle": 19.802, "splay_distance": 3.305, "splay_ratio": 0.173, "d22": null, "d64": null, "eta": 158.224, "theta": -129.946, "eta_prime": 179.671, "theta_prime": -124.712, "eta_base": -112.315, "theta_base": -158.858, "v0": 3.030, "v1": -23.867, "v2": 34.442, "v3": -33.757, "v4": 19.382, "amplitude": 35.481, "phase_angle": 13.904, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.830, "filter_rmsd": 0.002, "frame": { "rmsd": 0.002, "origin": [ -35.454, 11.276, -62.181 ], "x_axis": [ -0.315, -0.456, 0.833 ], "y_axis": [ -0.949, 0.129, -0.289 ], "z_axis": [ 0.024, -0.881, -0.473 ], "quaternion": [ -0.292, -0.507, 0.692, -0.422 ] } }, { "index": 208, "index_chain": 27, "chain_name": "G", "nt_resnum": 1069, "nt_name": "A", "nt_code": "A", "nt_id": "///G/1069", "linked_nts": [ "///G/1068", "///G/1070" ], "nt_type": "RNA", "dbn": ".", "summary": "u-turn,anti,~C2'-endo,non-pair-contact,hairpin-loop,phosphate,splayed-apart", "alpha": -80.309, "beta": -151.632, "gamma": 43.427, "delta": 143.472, "epsilon": -130.106, "zeta": 94.912, "epsilon_zeta": 134.982, "bb_type": "--", "chi": -76.339, "glyco_bond": "anti", "C5prime_xyz": [ -3.221, 7.205, -2.761 ], "P_xyz": [ -1.425, 8.974, -3.485 ], "form": ".", "ssZp": 1.276, "Dp": 1.641, "splay_angle": 87.601, "splay_distance": 14.094, "splay_ratio": 0.692, "d22": null, "d64": null, "eta": 171.021, "theta": 106.291, "eta_prime": -166.713, "theta_prime": 69.810, "eta_base": 165.257, "theta_base": 46.347, "v0": -22.701, "v1": 35.116, "v2": -33.300, "v3": 21.246, "v4": 0.714, "amplitude": 35.435, "phase_angle": 160.008, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1[", "suiteness": 0.584, "filter_rmsd": 0.038, "frame": { "rmsd": 0.005, "origin": [ -33.865, 8.964, -63.929 ], "x_axis": [ -0.271, 0.203, 0.941 ], "y_axis": [ -0.947, -0.229, -0.224 ], "z_axis": [ 0.171, -0.952, 0.254 ], "quaternion": [ 0.434, 0.420, -0.444, 0.662 ] } }, { "index": 209, "index_chain": 28, "chain_name": "G", "nt_resnum": 1070, "nt_name": "A", "nt_code": "A", "nt_id": "///G/1070", "linked_nts": [ "///G/1069", "///G/1071" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,anti,~C2'-endo,non-pair-contact,hairpin-loop,phosphate,splayed-apart", "alpha": 60.086, "beta": 173.512, "gamma": 176.828, "delta": 144.652, "epsilon": -148.022, "zeta": 49.527, "epsilon_zeta": 162.451, "bb_type": "--", "chi": -127.941, "glyco_bond": "anti", "C5prime_xyz": [ -1.896, 8.614, -0.811 ], "P_xyz": [ -0.434, 9.794, -2.641 ], "form": ".", "ssZp": 1.895, "Dp": 1.916, "splay_angle": 123.083, "splay_distance": 16.262, "splay_ratio": 0.879, "d22": null, "d64": null, "eta": 123.134, "theta": 7.781, "eta_prime": 121.419, "theta_prime": -34.599, "eta_base": 113.012, "theta_base": -107.246, "v0": -20.509, "v1": 33.355, "v2": -32.744, "v3": 21.889, "v4": -1.080, "amplitude": 34.249, "phase_angle": 162.956, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.001, "origin": [ -41.536, 13.874, -74.685 ], "x_axis": [ 0.132, 0.464, 0.876 ], "y_axis": [ 0.368, -0.844, 0.391 ], "z_axis": [ 0.920, 0.271, -0.282 ], "quaternion": [ 0.040, 0.751, 0.277, 0.598 ] } }, { "index": 210, "index_chain": 29, "chain_name": "G", "nt_resnum": 1071, "nt_name": "G", "nt_code": "G", "nt_id": "///G/1071", "linked_nts": [ "///G/1070", "///G/1072" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,multiplet,hairpin-loop,phosphate,splayed-apart", "alpha": 70.473, "beta": 159.359, "gamma": 54.118, "delta": 86.103, "epsilon": -141.209, "zeta": -65.627, "epsilon_zeta": -75.582, "bb_type": "BI", "chi": -170.637, "glyco_bond": "anti", "C5prime_xyz": [ -1.349, 8.572, 1.172 ], "P_xyz": [ 1.262, 8.596, 1.478 ], "form": "A", "ssZp": 4.515, "Dp": 4.581, "splay_angle": 21.887, "splay_distance": 3.445, "splay_ratio": 0.190, "d22": null, "d64": null, "eta": -40.752, "theta": -124.542, "eta_prime": 7.281, "theta_prime": -125.790, "eta_base": 93.618, "theta_base": -83.497, "v0": 3.198, "v1": -23.427, "v2": 33.524, "v3": -32.826, "v4": 18.700, "amplitude": 34.486, "phase_angle": 13.569, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "6d", "suiteness": 0.104, "filter_rmsd": 0.002, "frame": { "rmsd": 0.002, "origin": [ -29.146, 3.924, -78.141 ], "x_axis": [ -0.052, 0.840, -0.540 ], "y_axis": [ -0.999, -0.048, 0.020 ], "z_axis": [ -0.009, 0.540, 0.842 ], "quaternion": [ 0.660, -0.197, 0.201, 0.697 ] } }, { "index": 211, "index_chain": 30, "chain_name": "G", "nt_resnum": 1072, "nt_name": "C", "nt_code": "C", "nt_id": "///G/1072", "linked_nts": [ "///G/1071", "///G/1073" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BII,non-canonical,non-pair-contact,multiplet,hairpin-loop,splayed-apart", "alpha": -76.877, "beta": -178.874, "gamma": 51.806, "delta": 85.363, "epsilon": -133.537, "zeta": -176.567, "epsilon_zeta": 43.030, "bb_type": "BII", "chi": -149.418, "glyco_bond": "anti", "C5prime_xyz": [ -1.182, 8.752, -0.071 ], "P_xyz": [ 1.422, 9.055, 0.027 ], "form": ".", "ssZp": 3.990, "Dp": 4.658, "splay_angle": 157.814, "splay_distance": 18.090, "splay_ratio": 0.981, "d22": null, "d64": null, "eta": 161.709, "theta": 144.267, "eta_prime": 179.223, "theta_prime": 137.836, "eta_base": -120.627, "theta_base": -68.849, "v0": 2.542, "v1": -23.594, "v2": 34.454, "v3": -34.056, "v4": 19.892, "amplitude": 35.619, "phase_angle": 14.697, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.804, "filter_rmsd": 0.063, "frame": { "rmsd": 0.002, "origin": [ -29.100, 7.161, -76.964 ], "x_axis": [ -0.777, 0.453, -0.437 ], "y_axis": [ -0.628, -0.520, 0.578 ], "z_axis": [ 0.035, 0.724, 0.689 ], "quaternion": [ 0.313, -0.116, 0.377, 0.864 ] } }, { "index": 212, "index_chain": 31, "chain_name": "G", "nt_resnum": 1073, "nt_name": "A", "nt_code": "A", "nt_id": "///G/1073", "linked_nts": [ "///G/1072", "///G/1074" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,hairpin-loop,splayed-apart", "alpha": 74.084, "beta": 170.324, "gamma": 53.759, "delta": 84.749, "epsilon": -142.184, "zeta": -57.628, "epsilon_zeta": -84.556, "bb_type": "BI", "chi": -161.957, "glyco_bond": "anti", "C5prime_xyz": [ -1.273, 8.652, 0.667 ], "P_xyz": [ 1.336, 8.859, 0.886 ], "form": ".", "ssZp": 4.434, "Dp": 4.623, "splay_angle": 34.299, "splay_distance": 5.430, "splay_ratio": 0.295, "d22": null, "d64": null, "eta": -28.839, "theta": -120.663, "eta_prime": -34.456, "theta_prime": -118.673, "eta_base": 175.005, "theta_base": -80.164, "v0": 2.607, "v1": -23.596, "v2": 34.391, "v3": -33.995, "v4": 19.816, "amplitude": 35.542, "phase_angle": 14.619, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "3d", "suiteness": 0.596, "filter_rmsd": 0.038, "frame": { "rmsd": 0.002, "origin": [ -37.981, 4.913, -61.364 ], "x_axis": [ -0.684, 0.130, -0.718 ], "y_axis": [ 0.728, 0.063, -0.682 ], "z_axis": [ -0.043, -0.990, -0.138 ], "quaternion": [ 0.246, 0.313, 0.686, -0.609 ] } }, { "index": 213, "index_chain": 32, "chain_name": "G", "nt_resnum": 1074, "nt_name": "G", "nt_code": "G", "nt_id": "///G/1074", "linked_nts": [ "///G/1073", "///G/1075" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop", "alpha": -64.864, "beta": 174.831, "gamma": 51.786, "delta": 83.004, "epsilon": -152.017, "zeta": -75.597, "epsilon_zeta": -76.420, "bb_type": "BI", "chi": -174.795, "glyco_bond": "anti", "C5prime_xyz": [ -1.689, 8.614, 1.371 ], "P_xyz": [ 0.739, 9.047, 2.265 ], "form": "A", "ssZp": 4.489, "Dp": 4.500, "splay_angle": 24.152, "splay_distance": 3.793, "splay_ratio": 0.211, "d22": null, "d64": null, "eta": 163.934, "theta": -148.791, "eta_prime": -170.700, "theta_prime": -146.693, "eta_base": -108.302, "theta_base": -121.403, "v0": -0.156, "v1": -21.399, "v2": 33.473, "v3": -34.717, "v4": 21.989, "amplitude": 35.401, "phase_angle": 18.995, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.841, "filter_rmsd": 0.003, "frame": { "rmsd": 0.003, "origin": [ -40.182, 1.524, -64.992 ], "x_axis": [ 0.137, 0.508, -0.851 ], "y_axis": [ 0.977, 0.073, 0.201 ], "z_axis": [ 0.164, -0.859, -0.486 ], "quaternion": [ 0.426, 0.623, 0.596, -0.276 ] } }, { "index": 214, "index_chain": 33, "chain_name": "G", "nt_resnum": 1075, "nt_name": "C", "nt_code": "C", "nt_id": "///G/1075", "linked_nts": [ "///G/1074", "///G/1076" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -70.874, "beta": -178.367, "gamma": 52.139, "delta": 84.505, "epsilon": -155.373, "zeta": -64.823, "epsilon_zeta": -90.549, "bb_type": "BI", "chi": -164.935, "glyco_bond": "anti", "C5prime_xyz": [ -1.317, 8.706, 0.856 ], "P_xyz": [ 1.223, 9.054, 1.412 ], "form": "A", "ssZp": 4.534, "Dp": 4.542, "splay_angle": 21.417, "splay_distance": 3.467, "splay_ratio": 0.189, "d22": 4.177, "d64": 4.127, "eta": 166.992, "theta": -140.117, "eta_prime": 178.071, "theta_prime": -139.456, "eta_base": -144.405, "theta_base": -110.892, "v0": 1.695, "v1": -23.144, "v2": 34.496, "v3": -34.551, "v4": 20.726, "amplitude": 35.886, "phase_angle": 15.998, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.922, "filter_rmsd": 0.063, "frame": { "rmsd": 0.003, "origin": [ -41.421, -1.364, -67.115 ], "x_axis": [ 0.657, 0.500, -0.564 ], "y_axis": [ 0.724, -0.211, 0.657 ], "z_axis": [ 0.209, -0.840, -0.501 ], "quaternion": [ 0.486, 0.770, 0.398, -0.115 ] } }, { "index": 215, "index_chain": 34, "chain_name": "G", "nt_resnum": 1076, "nt_name": "C", "nt_code": "C", "nt_id": "///G/1076", "linked_nts": [ "///G/1075", "///G/1077" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop", "alpha": -71.547, "beta": -175.665, "gamma": 50.644, "delta": 83.678, "epsilon": -158.234, "zeta": -66.121, "epsilon_zeta": -92.113, "bb_type": "BI", "chi": -157.624, "glyco_bond": "anti", "C5prime_xyz": [ -1.364, 8.823, 0.400 ], "P_xyz": [ 1.154, 9.382, 0.876 ], "form": "A", "ssZp": 4.358, "Dp": 4.487, "splay_angle": 22.728, "splay_distance": 3.622, "splay_ratio": 0.198, "d22": null, "d64": null, "eta": 165.585, "theta": -144.594, "eta_prime": -179.438, "theta_prime": -142.784, "eta_base": -135.521, "theta_base": -107.544, "v0": 0.387, "v1": -21.988, "v2": 33.903, "v3": -34.793, "v4": 21.718, "amplitude": 35.671, "phase_angle": 18.115, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.878, "filter_rmsd": 0.062, "frame": { "rmsd": 0.002, "origin": [ -41.030, -2.912, -70.192 ], "x_axis": [ 0.917, 0.398, 0.011 ], "y_axis": [ 0.226, -0.543, 0.809 ], "z_axis": [ 0.328, -0.740, -0.588 ], "quaternion": [ 0.444, 0.873, 0.179, 0.097 ] } }, { "index": 216, "index_chain": 35, "chain_name": "G", "nt_resnum": 1077, "nt_name": "A", "nt_code": "A", "nt_id": "///G/1077", "linked_nts": [ "///G/1076", "///G/1078" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-pair-contact,internal-loop", "alpha": -66.478, "beta": 172.536, "gamma": 54.358, "delta": 83.543, "epsilon": -149.792, "zeta": -50.937, "epsilon_zeta": -98.856, "bb_type": "BI", "chi": -164.777, "glyco_bond": "anti", "C5prime_xyz": [ -1.502, 8.704, 0.798 ], "P_xyz": [ 1.057, 9.167, 1.156 ], "form": ".", "ssZp": 4.474, "Dp": 4.554, "splay_angle": 30.027, "splay_distance": 4.767, "splay_ratio": 0.260, "d22": null, "d64": null, "eta": 167.412, "theta": -122.091, "eta_prime": -175.354, "theta_prime": -119.584, "eta_base": -124.499, "theta_base": -69.811, "v0": 0.510, "v1": -22.126, "v2": 34.037, "v3": -34.849, "v4": 21.674, "amplitude": 35.774, "phase_angle": 17.926, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.910, "filter_rmsd": 0.038, "frame": { "rmsd": 0.001, "origin": [ -38.801, -4.303, -72.685 ], "x_axis": [ 0.821, 0.096, 0.563 ], "y_axis": [ -0.357, -0.683, 0.637 ], "z_axis": [ 0.446, -0.724, -0.527 ], "quaternion": [ 0.391, 0.870, -0.075, 0.290 ] } }, { "index": 217, "index_chain": 36, "chain_name": "G", "nt_resnum": 1078, "nt_name": "U", "nt_code": "U", "nt_id": "///G/1078", "linked_nts": [ "///G/1077", "///G/1079" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-pair-contact,internal-loop", "alpha": -71.407, "beta": -178.720, "gamma": 50.583, "delta": 85.812, "epsilon": -86.482, "zeta": 107.732, "epsilon_zeta": 165.786, "bb_type": "--", "chi": -154.258, "glyco_bond": "anti", "C5prime_xyz": [ -1.453, 8.772, 0.195 ], "P_xyz": [ 1.088, 9.324, 0.583 ], "form": ".", "ssZp": 3.462, "Dp": 4.454, "splay_angle": 82.951, "splay_distance": 13.407, "splay_ratio": 0.662, "d22": 8.335, "d64": 10.548, "eta": -177.427, "theta": 110.861, "eta_prime": -156.643, "theta_prime": 100.182, "eta_base": -93.350, "theta_base": 106.155, "v0": 0.402, "v1": -21.725, "v2": 33.468, "v3": -34.351, "v4": 21.455, "amplitude": 35.212, "phase_angle": 18.106, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.670, "filter_rmsd": 0.104, "frame": { "rmsd": 0.002, "origin": [ -34.772, -6.614, -71.617 ], "x_axis": [ 0.093, -0.416, 0.905 ], "y_axis": [ -0.818, -0.550, -0.169 ], "z_axis": [ 0.568, -0.724, -0.391 ], "quaternion": [ 0.195, 0.713, -0.433, 0.516 ] } }, { "index": 218, "index_chain": 37, "chain_name": "G", "nt_resnum": 1079, "nt_name": "C", "nt_code": "C", "nt_id": "///G/1079", "linked_nts": [ "///G/1078", "///G/1080" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop", "alpha": 71.971, "beta": -156.023, "gamma": -179.202, "delta": 84.457, "epsilon": -145.240, "zeta": -70.937, "epsilon_zeta": -74.302, "bb_type": "BI", "chi": -166.371, "glyco_bond": "anti", "C5prime_xyz": [ -1.293, 8.682, 0.979 ], "P_xyz": [ 0.113, 10.276, -0.554 ], "form": "A", "ssZp": 4.565, "Dp": 4.590, "splay_angle": 22.244, "splay_distance": 3.592, "splay_ratio": 0.195, "d22": null, "d64": null, "eta": 153.018, "theta": -165.001, "eta_prime": 153.104, "theta_prime": -162.183, "eta_base": 166.236, "theta_base": -130.874, "v0": 1.537, "v1": -22.853, "v2": 34.404, "v3": -34.504, "v4": 20.729, "amplitude": 35.834, "phase_angle": 16.240, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "5n", "suiteness": 0.564, "filter_rmsd": 0.063, "frame": { "rmsd": 0.005, "origin": [ -43.914, -4.199, -81.120 ], "x_axis": [ 0.937, 0.345, -0.052 ], "y_axis": [ 0.340, -0.870, 0.358 ], "z_axis": [ 0.078, -0.353, -0.932 ], "quaternion": [ 0.184, 0.967, 0.177, 0.007 ] } }, { "index": 219, "index_chain": 38, "chain_name": "G", "nt_resnum": 1080, "nt_name": "A", "nt_code": "A", "nt_id": "///G/1080", "linked_nts": [ "///G/1079", "///G/1081" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -63.475, "beta": 169.528, "gamma": 50.463, "delta": 81.681, "epsilon": -157.092, "zeta": -73.754, "epsilon_zeta": -83.337, "bb_type": "BI", "chi": -169.935, "glyco_bond": "anti", "C5prime_xyz": [ -1.832, 8.654, 1.127 ], "P_xyz": [ 0.632, 9.298, 1.726 ], "form": "A", "ssZp": 4.530, "Dp": 4.492, "splay_angle": 24.678, "splay_distance": 3.941, "splay_ratio": 0.218, "d22": null, "d64": null, "eta": 161.496, "theta": -149.866, "eta_prime": 179.197, "theta_prime": -148.782, "eta_base": -133.905, "theta_base": -123.031, "v0": -1.666, "v1": -20.575, "v2": 33.620, "v3": -35.687, "v4": 23.565, "amplitude": 36.085, "phase_angle": 21.300, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.958, "filter_rmsd": 0.036, "frame": { "rmsd": 0.008, "origin": [ -42.921, -3.781, -84.547 ], "x_axis": [ 0.922, -0.106, 0.373 ], "y_axis": [ -0.240, -0.911, 0.335 ], "z_axis": [ 0.304, -0.398, -0.865 ], "quaternion": [ 0.191, 0.962, -0.090, 0.176 ] } }, { "index": 220, "index_chain": 39, "chain_name": "G", "nt_resnum": 1081, "nt_name": "U", "nt_code": "U", "nt_id": "///G/1081", "linked_nts": [ "///G/1080", "///G/1082" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,junction-loop", "alpha": -56.520, "beta": 170.431, "gamma": 54.243, "delta": 83.781, "epsilon": -161.127, "zeta": -50.326, "epsilon_zeta": -110.800, "bb_type": "BI", "chi": -170.259, "glyco_bond": "anti", "C5prime_xyz": [ -1.765, 8.691, 1.047 ], "P_xyz": [ 0.715, 9.262, 1.666 ], "form": ".", "ssZp": 4.337, "Dp": 4.392, "splay_angle": 20.395, "splay_distance": 3.721, "splay_ratio": 0.195, "d22": 4.290, "d64": 4.517, "eta": 173.807, "theta": -129.804, "eta_prime": -170.539, "theta_prime": -131.963, "eta_base": -129.613, "theta_base": -113.689, "v0": -1.538, "v1": -20.459, "v2": 33.378, "v3": -35.280, "v4": 23.203, "amplitude": 35.767, "phase_angle": 21.063, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.891, "filter_rmsd": 0.104, "frame": { "rmsd": 0.003, "origin": [ -40.872, -3.406, -87.893 ], "x_axis": [ 0.668, -0.576, 0.471 ], "y_axis": [ -0.701, -0.699, 0.140 ], "z_axis": [ 0.248, -0.423, -0.871 ], "quaternion": [ 0.157, 0.900, -0.355, 0.200 ] } }, { "index": 221, "index_chain": 40, "chain_name": "G", "nt_resnum": 1082, "nt_name": "U", "nt_code": "U", "nt_id": "///G/1082", "linked_nts": [ "///G/1081", "///G/1083" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-pair-contact,junction-loop", "alpha": -82.252, "beta": -155.612, "gamma": 40.493, "delta": 83.329, "epsilon": -163.430, "zeta": -74.971, "epsilon_zeta": -88.460, "bb_type": "BI", "chi": -139.235, "glyco_bond": "anti", "C5prime_xyz": [ -2.021, 8.906, -0.380 ], "P_xyz": [ 0.027, 10.313, 0.465 ], "form": ".", "ssZp": 3.872, "Dp": 3.998, "splay_angle": 37.793, "splay_distance": 6.399, "splay_ratio": 0.324, "d22": 4.546, "d64": 5.267, "eta": 162.449, "theta": -126.749, "eta_prime": 177.494, "theta_prime": -124.816, "eta_base": -149.783, "theta_base": -87.466, "v0": -7.023, "v1": -14.585, "v2": 29.280, "v3": -34.446, "v4": 26.133, "amplitude": 33.971, "phase_angle": 30.470, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.312, "filter_rmsd": 0.107, "frame": { "rmsd": 0.036, "origin": [ -37.751, -3.710, -89.896 ], "x_axis": [ 0.110, -0.752, 0.650 ], "y_axis": [ -0.912, -0.336, -0.235 ], "z_axis": [ 0.395, -0.567, -0.723 ], "quaternion": [ 0.113, 0.736, -0.565, 0.355 ] } }, { "index": 222, "index_chain": 41, "chain_name": "G", "nt_resnum": 1083, "nt_name": "U", "nt_code": "U", "nt_id": "///G/1083", "linked_nts": [ "///G/1082", "///G/1084" ], "nt_type": "RNA", "dbn": ".", "summary": "u-turn,anti,~C3'-endo,BI,non-stack,non-canonical,non-pair-contact,multiplet,junction-loop", "alpha": 152.950, "beta": -147.134, "gamma": 178.537, "delta": 85.458, "epsilon": -148.307, "zeta": -89.122, "epsilon_zeta": -59.185, "bb_type": "BI", "chi": -170.236, "glyco_bond": "anti", "C5prime_xyz": [ -1.525, 8.601, 1.117 ], "P_xyz": [ 0.043, 10.055, -0.397 ], "form": ".", "ssZp": 4.461, "Dp": 4.507, "splay_angle": 81.128, "splay_distance": 11.717, "splay_ratio": 0.650, "d22": null, "d64": null, "eta": 174.296, "theta": -153.950, "eta_prime": -161.336, "theta_prime": 167.426, "eta_base": -108.537, "theta_base": 108.021, "v0": 1.359, "v1": -22.370, "v2": 33.653, "v3": -34.012, "v4": 20.687, "amplitude": 35.126, "phase_angle": 16.648, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.821, "filter_rmsd": 0.104, "frame": { "rmsd": 0.001, "origin": [ -36.681, -9.905, -91.089 ], "x_axis": [ -0.629, -0.698, 0.343 ], "y_axis": [ -0.719, 0.354, -0.598 ], "z_axis": [ 0.296, -0.622, -0.724 ], "quaternion": [ -0.014, -0.431, 0.823, -0.371 ] } }, { "index": 223, "index_chain": 42, "chain_name": "G", "nt_resnum": 1084, "nt_name": "A", "nt_code": "A", "nt_id": "///G/1084", "linked_nts": [ "///G/1083", "///G/1085" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,u-turn,anti,~C3'-endo,BI,non-pair-contact,junction-loop,A-minor,ribose-zipper", "alpha": 162.887, "beta": -169.005, "gamma": 53.268, "delta": 85.527, "epsilon": -147.297, "zeta": -66.753, "epsilon_zeta": -80.545, "bb_type": "BI", "chi": -142.404, "glyco_bond": "anti", "C5prime_xyz": [ -1.237, 8.657, -0.489 ], "P_xyz": [ 1.363, 8.999, -0.308 ], "form": ".", "ssZp": 3.751, "Dp": 4.575, "splay_angle": 22.829, "splay_distance": 3.722, "splay_ratio": 0.198, "d22": null, "d64": null, "eta": 40.660, "theta": -133.931, "eta_prime": 53.704, "theta_prime": -131.223, "eta_base": 22.812, "theta_base": -98.664, "v0": 3.065, "v1": -23.586, "v2": 33.984, "v3": -33.309, "v4": 19.085, "amplitude": 34.998, "phase_angle": 13.827, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1g", "suiteness": 0.461, "filter_rmsd": 0.038, "frame": { "rmsd": 0.002, "origin": [ -32.328, -0.939, -97.248 ], "x_axis": [ -0.848, 0.525, -0.076 ], "y_axis": [ -0.499, -0.838, -0.220 ], "z_axis": [ -0.180, -0.149, 0.972 ], "quaternion": [ 0.268, -0.067, -0.096, 0.956 ] } }, { "index": 224, "index_chain": 43, "chain_name": "G", "nt_resnum": 1085, "nt_name": "A", "nt_code": "A", "nt_id": "///G/1085", "linked_nts": [ "///G/1084", "///G/1086" ], "nt_type": "RNA", "dbn": ".", "summary": "u-turn,anti,~C3'-endo,BI,non-canonical,non-pair-contact,multiplet,junction-loop,A-minor,ribose-zipper", "alpha": -64.686, "beta": 174.780, "gamma": 51.178, "delta": 83.438, "epsilon": -149.721, "zeta": -69.059, "epsilon_zeta": -80.661, "bb_type": "BI", "chi": -139.994, "glyco_bond": "anti", "C5prime_xyz": [ -1.467, 8.725, -0.657 ], "P_xyz": [ 1.093, 9.236, -0.908 ], "form": ".", "ssZp": 3.657, "Dp": 4.524, "splay_angle": 41.318, "splay_distance": 6.338, "splay_ratio": 0.396, "d22": null, "d64": null, "eta": 166.609, "theta": -139.315, "eta_prime": -175.389, "theta_prime": -137.636, "eta_base": -130.902, "theta_base": -70.565, "v0": 0.687, "v1": -21.953, "v2": 33.553, "v3": -34.260, "v4": 21.183, "amplitude": 35.205, "phase_angle": 17.623, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.935, "filter_rmsd": 0.038, "frame": { "rmsd": 0.001, "origin": [ -34.787, -0.398, -94.507 ], "x_axis": [ -0.865, -0.029, -0.500 ], "y_axis": [ -0.001, -0.998, 0.061 ], "z_axis": [ -0.501, 0.053, 0.864 ], "quaternion": [ -0.007, -0.259, 0.030, 0.965 ] } }, { "index": 225, "index_chain": 44, "chain_name": "G", "nt_resnum": 1086, "nt_name": "A", "nt_code": "A", "nt_id": "///G/1086", "linked_nts": [ "///G/1085", "///G/1087" ], "nt_type": "RNA", "dbn": ".", "summary": "u-turn,syn,~C3'-endo,BII,non-pair-contact,junction-loop,phosphate,splayed-apart", "alpha": -59.264, "beta": 171.136, "gamma": 53.035, "delta": 84.279, "epsilon": -136.846, "zeta": 177.502, "epsilon_zeta": 45.652, "bb_type": "BII", "chi": 54.369, "glyco_bond": "syn", "C5prime_xyz": [ -5.418, 4.364, 1.796 ], "P_xyz": [ -5.674, 1.857, 2.513 ], "form": ".", "ssZp": -2.234, "Dp": 4.098, "splay_angle": 116.016, "splay_distance": 14.552, "splay_ratio": 0.848, "d22": null, "d64": null, "eta": 175.096, "theta": 102.652, "eta_prime": -169.426, "theta_prime": 115.582, "eta_base": -95.509, "theta_base": 89.195, "v0": -8.839, "v1": -13.611, "v2": 29.319, "v3": -35.521, "v4": 27.908, "amplitude": 34.969, "phase_angle": 33.026, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.943, "filter_rmsd": 0.090, "frame": { "rmsd": 0.085, "origin": [ -38.872, -4.968, -92.896 ], "x_axis": [ -0.214, 0.719, -0.661 ], "y_axis": [ 0.603, 0.630, 0.490 ], "z_axis": [ 0.768, -0.294, -0.568 ], "quaternion": [ 0.460, 0.426, 0.777, 0.063 ] } }, { "index": 226, "index_chain": 45, "chain_name": "G", "nt_resnum": 1087, "nt_name": "G", "nt_code": "G", "nt_id": "///G/1087", "linked_nts": [ "///G/1086", "///G/1088" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,isolated-canonical,non-pair-contact,helix,bulge,junction-loop,phosphate,splayed-apart", "alpha": -110.481, "beta": 173.474, "gamma": 48.395, "delta": 85.533, "epsilon": -107.258, "zeta": -79.902, "epsilon_zeta": -27.355, "bb_type": "--", "chi": -98.675, "glyco_bond": "anti", "C5prime_xyz": [ -2.074, 7.708, -2.753 ], "P_xyz": [ 0.257, 7.735, -3.974 ], "form": ".", "ssZp": -0.045, "Dp": 4.533, "splay_angle": 128.973, "splay_distance": 16.621, "splay_ratio": 0.904, "d22": null, "d64": null, "eta": 172.915, "theta": -112.706, "eta_prime": 155.147, "theta_prime": -117.235, "eta_base": 159.457, "theta_base": -110.031, "v0": 1.494, "v1": -21.854, "v2": 32.628, "v3": -32.900, "v4": 19.891, "amplitude": 34.001, "phase_angle": 16.341, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "3a", "suiteness": 0.097, "filter_rmsd": 0.005, "frame": { "rmsd": 0.005, "origin": [ -29.657, -1.200, -82.282 ], "x_axis": [ -0.472, 0.792, -0.386 ], "y_axis": [ -0.879, -0.455, 0.141 ], "z_axis": [ -0.064, 0.406, 0.912 ], "quaternion": [ 0.496, -0.134, 0.162, 0.842 ] } }, { "index": 227, "index_chain": 46, "chain_name": "G", "nt_resnum": 1088, "nt_name": "A", "nt_code": "A", "nt_id": "///G/1088", "linked_nts": [ "///G/1087", "///G/1089" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,syn,~C2'-endo,non-canonical,non-pair-contact,helix,bulge,phosphate,splayed-apart", "alpha": -55.797, "beta": 144.261, "gamma": 178.401, "delta": 145.467, "epsilon": -152.389, "zeta": 117.842, "epsilon_zeta": 89.769, "bb_type": "--", "chi": 63.525, "glyco_bond": "syn", "C5prime_xyz": [ -5.308, 4.061, 1.432 ], "P_xyz": [ -6.207, 3.256, 3.760 ], "form": ".", "ssZp": -1.941, "Dp": 1.991, "splay_angle": 102.476, "splay_distance": 14.497, "splay_ratio": 0.780, "d22": null, "d64": null, "eta": -47.848, "theta": 34.257, "eta_prime": -41.330, "theta_prime": 58.674, "eta_base": -46.236, "theta_base": 72.073, "v0": -22.048, "v1": 34.763, "v2": -33.474, "v3": 21.828, "v4": -0.073, "amplitude": 35.344, "phase_angle": 161.281, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.073, "frame": { "rmsd": 0.057, "origin": [ -45.070, -5.034, -77.383 ], "x_axis": [ -0.731, 0.667, -0.141 ], "y_axis": [ 0.675, 0.738, -0.011 ], "z_axis": [ 0.097, -0.103, -0.990 ], "quaternion": [ 0.064, 0.361, 0.930, -0.031 ] } }, { "index": 228, "index_chain": 47, "chain_name": "G", "nt_resnum": 1089, "nt_name": "A", "nt_code": "A", "nt_id": "///G/1089", "linked_nts": [ "///G/1088", "///G/1090" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C2'-endo,non-canonical,non-pair-contact,multiplet,bulge,phosphate,splayed-apart", "alpha": -67.187, "beta": 159.481, "gamma": 44.759, "delta": 142.919, "epsilon": -99.849, "zeta": -127.059, "epsilon_zeta": 27.210, "bb_type": "--", "chi": -159.165, "glyco_bond": "anti", "C5prime_xyz": [ -1.828, 8.608, 0.858 ], "P_xyz": [ 0.149, 8.537, 2.575 ], "form": ".", "ssZp": 1.040, "Dp": 1.119, "splay_angle": 41.541, "splay_distance": 6.840, "splay_ratio": 0.358, "d22": null, "d64": null, "eta": -162.255, "theta": -121.523, "eta_prime": -153.809, "theta_prime": -151.515, "eta_base": -144.115, "theta_base": -158.863, "v0": -20.013, "v1": 32.630, "v2": -32.062, "v3": 21.492, "v4": -1.110, "amplitude": 33.515, "phase_angle": 163.068, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "0b", "suiteness": 0.158, "filter_rmsd": 0.038, "frame": { "rmsd": 0.002, "origin": [ -33.372, 2.581, -81.302 ], "x_axis": [ -0.958, 0.230, -0.174 ], "y_axis": [ -0.287, -0.807, 0.516 ], "z_axis": [ -0.022, 0.544, 0.839 ], "quaternion": [ 0.136, -0.051, 0.279, 0.949 ] } }, { "index": 229, "index_chain": 48, "chain_name": "G", "nt_resnum": 1090, "nt_name": "A", "nt_code": "A", "nt_id": "///G/1090", "linked_nts": [ "///G/1089", "///G/1091" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,bulge", "alpha": -152.775, "beta": 162.699, "gamma": 57.721, "delta": 83.484, "epsilon": -150.635, "zeta": -82.629, "epsilon_zeta": -68.005, "bb_type": "BI", "chi": -158.513, "glyco_bond": "anti", "C5prime_xyz": [ -1.460, 8.676, 0.492 ], "P_xyz": [ 1.120, 8.978, 0.148 ], "form": "A", "ssZp": 4.480, "Dp": 4.621, "splay_angle": 23.698, "splay_distance": 3.820, "splay_ratio": 0.208, "d22": null, "d64": null, "eta": 100.432, "theta": -150.992, "eta_prime": 120.100, "theta_prime": -154.805, "eta_base": 133.997, "theta_base": -146.766, "v0": 1.935, "v1": -23.838, "v2": 35.361, "v3": -35.301, "v4": 21.012, "amplitude": 36.727, "phase_angle": 15.675, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.036, "frame": { "rmsd": 0.009, "origin": [ -26.618, 2.266, -80.276 ], "x_axis": [ -0.974, 0.176, -0.142 ], "y_axis": [ -0.225, -0.798, 0.559 ], "z_axis": [ -0.015, 0.576, 0.817 ], "quaternion": [ 0.106, -0.041, 0.300, 0.947 ] } }, { "index": 230, "index_chain": 49, "chain_name": "G", "nt_resnum": 1091, "nt_name": "G", "nt_code": "G", "nt_id": "///G/1091", "linked_nts": [ "///G/1090", "///G/1092" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet", "alpha": -64.451, "beta": 164.340, "gamma": 59.512, "delta": 81.377, "epsilon": -160.319, "zeta": -67.877, "epsilon_zeta": -92.442, "bb_type": "BI", "chi": -162.888, "glyco_bond": "anti", "C5prime_xyz": [ -1.613, 8.804, 0.741 ], "P_xyz": [ 0.906, 9.442, 0.429 ], "form": "A", "ssZp": 4.624, "Dp": 4.548, "splay_angle": 24.455, "splay_distance": 4.009, "splay_ratio": 0.219, "d22": null, "d64": null, "eta": 165.785, "theta": -147.233, "eta_prime": 177.487, "theta_prime": -149.971, "eta_base": -158.072, "theta_base": -129.226, "v0": -1.353, "v1": -21.930, "v2": 35.453, "v3": -37.209, "v4": 24.274, "amplitude": 37.862, "phase_angle": 20.550, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.845, "filter_rmsd": 0.010, "frame": { "rmsd": 0.010, "origin": [ -26.000, 5.657, -78.627 ], "x_axis": [ -0.985, -0.171, 0.000 ], "y_axis": [ 0.131, -0.754, 0.643 ], "z_axis": [ -0.110, 0.634, 0.766 ], "quaternion": [ -0.081, -0.029, 0.341, 0.936 ] } }, { "index": 231, "index_chain": 50, "chain_name": "G", "nt_resnum": 1092, "nt_name": "C", "nt_code": "C", "nt_id": "///G/1092", "linked_nts": [ "///G/1091", "///G/1093" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,hairpin-loop", "alpha": -65.252, "beta": 179.889, "gamma": 55.204, "delta": 81.963, "epsilon": -154.256, "zeta": -50.583, "epsilon_zeta": -103.673, "bb_type": "BI", "chi": -162.973, "glyco_bond": "anti", "C5prime_xyz": [ -1.594, 8.850, 0.723 ], "P_xyz": [ 0.904, 9.578, 1.044 ], "form": ".", "ssZp": 4.550, "Dp": 4.534, "splay_angle": 31.612, "splay_distance": 4.999, "splay_ratio": 0.274, "d22": null, "d64": null, "eta": 173.021, "theta": -127.949, "eta_prime": -174.305, "theta_prime": -124.304, "eta_base": -138.011, "theta_base": -72.003, "v0": -2.278, "v1": -20.756, "v2": 34.487, "v3": -36.716, "v4": 24.568, "amplitude": 37.186, "phase_angle": 21.965, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.889, "filter_rmsd": 0.061, "frame": { "rmsd": 0.006, "origin": [ -27.674, 9.082, -77.389 ], "x_axis": [ -0.775, -0.572, 0.268 ], "y_axis": [ 0.603, -0.543, 0.583 ], "z_axis": [ -0.188, 0.614, 0.766 ], "quaternion": [ -0.335, 0.023, 0.341, 0.878 ] } }, { "index": 232, "index_chain": 51, "chain_name": "G", "nt_resnum": 1093, "nt_name": "G", "nt_code": "G", "nt_id": "///G/1093", "linked_nts": [ "///G/1092", "///G/1094" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,hairpin-loop", "alpha": -72.008, "beta": 179.470, "gamma": 54.422, "delta": 83.127, "epsilon": -162.705, "zeta": -69.091, "epsilon_zeta": -93.614, "bb_type": "BI", "chi": -158.734, "glyco_bond": "anti", "C5prime_xyz": [ -1.362, 8.811, 0.443 ], "P_xyz": [ 1.205, 9.298, 0.729 ], "form": "A", "ssZp": 4.360, "Dp": 4.473, "splay_angle": 24.919, "splay_distance": 4.068, "splay_ratio": 0.219, "d22": null, "d64": null, "eta": 163.595, "theta": -151.055, "eta_prime": -168.730, "theta_prime": -150.499, "eta_base": -93.992, "theta_base": -143.727, "v0": 0.707, "v1": -22.300, "v2": 34.172, "v3": -34.777, "v4": 21.524, "amplitude": 35.843, "phase_angle": 17.566, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.676, "filter_rmsd": 0.003, "frame": { "rmsd": 0.003, "origin": [ -30.752, 8.092, -73.576 ], "x_axis": [ 0.107, -0.809, 0.578 ], "y_axis": [ 0.952, 0.251, 0.176 ], "z_axis": [ -0.287, 0.531, 0.797 ], "quaternion": [ 0.734, -0.121, -0.295, -0.600 ] } }, { "index": 233, "index_chain": 52, "chain_name": "G", "nt_resnum": 1094, "nt_name": "U", "nt_code": "U", "nt_id": "///G/1094", "linked_nts": [ "///G/1093", "///G/1095" ], "nt_type": "RNA", "dbn": ".", "summary": "u-turn,anti,~C3'-endo,BI,non-pair-contact,hairpin-loop,cap-acceptor", "alpha": -78.353, "beta": -161.699, "gamma": 46.882, "delta": 83.828, "epsilon": -143.938, "zeta": -66.896, "epsilon_zeta": -77.042, "bb_type": "BI", "chi": -150.000, "glyco_bond": "anti", "C5prime_xyz": [ -1.491, 8.798, -0.059 ], "P_xyz": [ 0.911, 9.577, 0.657 ], "form": ".", "ssZp": 4.039, "Dp": 4.538, "splay_angle": 74.286, "splay_distance": 11.170, "splay_ratio": 0.604, "d22": null, "d64": null, "eta": 169.939, "theta": -114.041, "eta_prime": 174.561, "theta_prime": -153.236, "eta_base": -172.187, "theta_base": 150.271, "v0": -0.097, "v1": -21.366, "v2": 33.421, "v3": -34.557, "v4": 21.853, "amplitude": 35.318, "phase_angle": 18.863, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.596, "filter_rmsd": 0.105, "frame": { "rmsd": 0.002, "origin": [ -33.777, 9.857, -71.506 ], "x_axis": [ 0.539, -0.789, 0.296 ], "y_axis": [ 0.826, 0.564, -0.000 ], "z_axis": [ -0.166, 0.244, 0.955 ], "quaternion": [ 0.874, -0.070, -0.132, -0.462 ] } }, { "index": 234, "index_chain": 53, "chain_name": "G", "nt_resnum": 1095, "nt_name": "A", "nt_code": "A", "nt_id": "///G/1095", "linked_nts": [ "///G/1094", "///G/1096" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,u-turn,anti,~C3'-endo,BI,non-pair-contact,hairpin-loop", "alpha": 162.173, "beta": 170.645, "gamma": 52.137, "delta": 85.037, "epsilon": -139.465, "zeta": -70.333, "epsilon_zeta": -69.133, "bb_type": "BI", "chi": -149.249, "glyco_bond": "anti", "C5prime_xyz": [ -1.293, 8.722, -0.102 ], "P_xyz": [ 1.319, 9.005, -0.107 ], "form": ".", "ssZp": 3.956, "Dp": 4.590, "splay_angle": 24.655, "splay_distance": 3.972, "splay_ratio": 0.214, "d22": null, "d64": null, "eta": 26.181, "theta": -130.990, "eta_prime": 48.900, "theta_prime": -129.950, "eta_base": 24.096, "theta_base": -87.805, "v0": 2.220, "v1": -22.819, "v2": 33.504, "v3": -33.309, "v4": 19.619, "amplitude": 34.708, "phase_angle": 15.134, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1g", "suiteness": 0.917, "filter_rmsd": 0.038, "frame": { "rmsd": 0.002, "origin": [ -37.731, 20.243, -70.375 ], "x_axis": [ 0.472, 0.441, -0.763 ], "y_axis": [ 0.869, -0.378, 0.319 ], "z_axis": [ -0.148, -0.814, -0.562 ], "quaternion": [ 0.365, 0.777, 0.422, -0.293 ] } }, { "index": 235, "index_chain": 54, "chain_name": "G", "nt_resnum": 1096, "nt_name": "A", "nt_code": "A", "nt_id": "///G/1096", "linked_nts": [ "///G/1095", "///G/1097" ], "nt_type": "RNA", "dbn": ".", "summary": "u-turn,anti,~C3'-endo,BI,non-pair-contact,hairpin-loop,cap-donor,phosphate", "alpha": -68.829, "beta": 165.662, "gamma": 54.351, "delta": 84.264, "epsilon": -158.977, "zeta": -52.604, "epsilon_zeta": -106.373, "bb_type": "BI", "chi": -158.393, "glyco_bond": "anti", "C5prime_xyz": [ -1.333, 8.709, 0.431 ], "P_xyz": [ 1.277, 8.982, 0.416 ], "form": ".", "ssZp": 4.354, "Dp": 4.504, "splay_angle": 18.810, "splay_distance": 3.570, "splay_ratio": 0.183, "d22": null, "d64": null, "eta": 155.762, "theta": -105.712, "eta_prime": 178.561, "theta_prime": -121.233, "eta_base": -120.350, "theta_base": -95.951, "v0": 1.904, "v1": -23.097, "v2": 34.252, "v3": -34.253, "v4": 20.386, "amplitude": 35.580, "phase_angle": 15.703, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.902, "filter_rmsd": 0.038, "frame": { "rmsd": 0.001, "origin": [ -36.337, 18.673, -73.746 ], "x_axis": [ 0.932, 0.359, -0.051 ], "y_axis": [ 0.297, -0.675, 0.676 ], "z_axis": [ 0.209, -0.645, -0.735 ], "quaternion": [ 0.361, 0.914, 0.179, 0.043 ] } }, { "index": 236, "index_chain": 55, "chain_name": "G", "nt_resnum": 1097, "nt_name": "U", "nt_code": "U", "nt_id": "///G/1097", "linked_nts": [ "///G/1096", "///G/1098" ], "nt_type": "RNA", "dbn": ".", "summary": "u-turn,anti,~C3'-endo,BI,non-pair-contact,hairpin-loop,phosphate", "alpha": 157.137, "beta": 177.584, "gamma": 174.508, "delta": 85.051, "epsilon": -138.974, "zeta": -47.830, "epsilon_zeta": -91.145, "bb_type": "BI", "chi": -155.537, "glyco_bond": "anti", "C5prime_xyz": [ -1.393, 8.745, 0.283 ], "P_xyz": [ -0.477, 10.456, -1.492 ], "form": ".", "ssZp": 4.261, "Dp": 4.623, "splay_angle": 49.529, "splay_distance": 7.724, "splay_ratio": 0.419, "d22": null, "d64": null, "eta": 158.481, "theta": -143.623, "eta_prime": 178.033, "theta_prime": -129.636, "eta_base": -133.241, "theta_base": -88.110, "v0": 1.318, "v1": -22.861, "v2": 34.416, "v3": -34.660, "v4": 21.060, "amplitude": 35.909, "phase_angle": 16.582, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.718, "filter_rmsd": 0.104, "frame": { "rmsd": 0.002, "origin": [ -34.023, 19.262, -76.399 ], "x_axis": [ 0.934, 0.012, 0.356 ], "y_axis": [ -0.109, -0.941, 0.319 ], "z_axis": [ 0.339, -0.337, -0.878 ], "quaternion": [ 0.169, 0.969, -0.025, 0.179 ] } }, { "index": 237, "index_chain": 56, "chain_name": "G", "nt_resnum": 1098, "nt_name": "A", "nt_code": "A", "nt_id": "///G/1098", "linked_nts": [ "///G/1097", "///G/1099" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,hairpin-loop", "alpha": -57.222, "beta": 169.756, "gamma": 56.678, "delta": 83.009, "epsilon": -139.720, "zeta": -56.515, "epsilon_zeta": -83.205, "bb_type": "BI", "chi": -166.886, "glyco_bond": "anti", "C5prime_xyz": [ -1.490, 8.660, 0.973 ], "P_xyz": [ 1.092, 9.064, 1.225 ], "form": ".", "ssZp": 4.571, "Dp": 4.622, "splay_angle": 34.822, "splay_distance": 5.462, "splay_ratio": 0.300, "d22": null, "d64": null, "eta": 172.927, "theta": -119.518, "eta_prime": -151.804, "theta_prime": -116.099, "eta_base": -89.717, "theta_base": -68.638, "v0": 0.800, "v1": -22.542, "v2": 34.482, "v3": -35.037, "v4": 21.609, "amplitude": 36.140, "phase_angle": 17.423, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.590, "filter_rmsd": 0.038, "frame": { "rmsd": 0.004, "origin": [ -27.854, 14.636, -76.864 ], "x_axis": [ 0.146, -0.797, 0.586 ], "y_axis": [ -0.945, -0.288, -0.156 ], "z_axis": [ 0.294, -0.531, -0.795 ], "quaternion": [ 0.126, 0.747, -0.583, 0.295 ] } }, { "index": 238, "index_chain": 57, "chain_name": "G", "nt_resnum": 1099, "nt_name": "G", "nt_code": "G", "nt_id": "///G/1099", "linked_nts": [ "///G/1098", "///G/1100" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,hairpin-loop", "alpha": -62.480, "beta": 169.261, "gamma": 51.496, "delta": 81.853, "epsilon": -153.629, "zeta": -69.927, "epsilon_zeta": -83.701, "bb_type": "BI", "chi": -168.386, "glyco_bond": "anti", "C5prime_xyz": [ -1.483, 8.692, 1.067 ], "P_xyz": [ 1.078, 9.119, 1.420 ], "form": "A", "ssZp": 4.641, "Dp": 4.580, "splay_angle": 24.308, "splay_distance": 3.950, "splay_ratio": 0.216, "d22": null, "d64": null, "eta": 160.077, "theta": -144.642, "eta_prime": -170.611, "theta_prime": -144.902, "eta_base": -96.358, "theta_base": -124.010, "v0": 0.583, "v1": -22.676, "v2": 34.857, "v3": -35.550, "v4": 22.056, "amplitude": 36.600, "phase_angle": 17.754, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.818, "filter_rmsd": 0.006, "frame": { "rmsd": 0.006, "origin": [ -27.480, 9.206, -77.318 ], "x_axis": [ -0.772, -0.576, 0.271 ], "y_axis": [ -0.608, 0.542, -0.580 ], "z_axis": [ 0.187, -0.612, -0.768 ], "quaternion": [ -0.024, -0.337, 0.878, -0.340 ] } }, { "index": 239, "index_chain": 58, "chain_name": "G", "nt_resnum": 1100, "nt_name": "C", "nt_code": "C", "nt_id": "///G/1100", "linked_nts": [ "///G/1099", "///G/1101" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet", "alpha": -65.585, "beta": -178.148, "gamma": 49.982, "delta": 80.916, "epsilon": -145.844, "zeta": -77.273, "epsilon_zeta": -68.572, "bb_type": "BI", "chi": -162.742, "glyco_bond": "anti", "C5prime_xyz": [ -1.498, 8.808, 0.763 ], "P_xyz": [ 0.997, 9.467, 1.198 ], "form": "A", "ssZp": 4.619, "Dp": 4.625, "splay_angle": 24.457, "splay_distance": 3.893, "splay_ratio": 0.213, "d22": 3.864, "d64": 4.376, "eta": 169.791, "theta": -149.441, "eta_prime": -179.378, "theta_prime": -147.650, "eta_base": -144.880, "theta_base": -120.507, "v0": -1.283, "v1": -21.587, "v2": 34.895, "v3": -36.726, "v4": 23.985, "amplitude": 37.283, "phase_angle": 20.619, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.945, "filter_rmsd": 0.063, "frame": { "rmsd": 0.008, "origin": [ -26.200, 5.647, -78.459 ], "x_axis": [ -0.986, -0.165, -0.005 ], "y_axis": [ -0.121, 0.745, -0.656 ], "z_axis": [ 0.112, -0.646, -0.755 ], "quaternion": [ 0.031, -0.076, 0.934, -0.349 ] } }, { "index": 240, "index_chain": 59, "chain_name": "G", "nt_resnum": 1101, "nt_name": "U", "nt_code": "U", "nt_id": "///G/1101", "linked_nts": [ "///G/1100", "///G/1102" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,bulge", "alpha": -68.830, "beta": 158.176, "gamma": 65.719, "delta": 81.852, "epsilon": -155.305, "zeta": -57.217, "epsilon_zeta": -98.087, "bb_type": "BI", "chi": 179.354, "glyco_bond": "anti", "C5prime_xyz": [ -1.861, 8.456, 1.696 ], "P_xyz": [ 0.647, 9.204, 1.602 ], "form": ".", "ssZp": 4.728, "Dp": 4.624, "splay_angle": 30.150, "splay_distance": 5.005, "splay_ratio": 0.279, "d22": 4.470, "d64": 5.318, "eta": 160.945, "theta": -132.785, "eta_prime": 179.049, "theta_prime": -136.403, "eta_base": -134.947, "theta_base": -111.339, "v0": -1.686, "v1": -22.345, "v2": 36.417, "v3": -38.260, "v4": 25.150, "amplitude": 38.976, "phase_angle": 20.879, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.682, "filter_rmsd": 0.105, "frame": { "rmsd": 0.009, "origin": [ -26.731, 2.186, -80.159 ], "x_axis": [ -0.928, 0.304, -0.218 ], "y_axis": [ 0.374, 0.754, -0.541 ], "z_axis": [ -0.000, -0.583, -0.813 ], "quaternion": [ 0.058, 0.181, 0.935, -0.300 ] } }, { "index": 241, "index_chain": 60, "chain_name": "G", "nt_resnum": 1102, "nt_name": "C", "nt_code": "C", "nt_id": "///G/1102", "linked_nts": [ "///G/1101", "///G/1103" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,isolated-canonical,non-pair-contact,helix,bulge,junction-loop", "alpha": -70.534, "beta": -164.535, "gamma": 53.544, "delta": 82.116, "epsilon": -160.760, "zeta": -68.802, "epsilon_zeta": -91.958, "bb_type": "BI", "chi": -172.825, "glyco_bond": "anti", "C5prime_xyz": [ -1.895, 8.816, 1.146 ], "P_xyz": [ 0.250, 9.600, 2.446 ], "form": "A", "ssZp": 4.342, "Dp": 4.327, "splay_angle": 24.528, "splay_distance": 3.921, "splay_ratio": 0.215, "d22": null, "d64": null, "eta": 175.742, "theta": -151.716, "eta_prime": -168.319, "theta_prime": -147.085, "eta_base": -123.197, "theta_base": -113.165, "v0": -5.597, "v1": -17.341, "v2": 32.191, "v3": -36.379, "v4": 26.515, "amplitude": 36.228, "phase_angle": 27.306, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.706, "filter_rmsd": 0.062, "frame": { "rmsd": 0.003, "origin": [ -29.821, -1.087, -82.348 ], "x_axis": [ -0.484, 0.784, -0.390 ], "y_axis": [ 0.874, 0.459, -0.160 ], "z_axis": [ 0.053, -0.418, -0.907 ], "quaternion": [ 0.131, 0.491, 0.844, -0.171 ] } }, { "index": 242, "index_chain": 61, "chain_name": "G", "nt_resnum": 1103, "nt_name": "A", "nt_code": "A", "nt_id": "///G/1103", "linked_nts": [ "///G/1102", "///G/1104" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,junction-loop", "alpha": -73.578, "beta": 178.494, "gamma": 62.056, "delta": 85.131, "epsilon": -141.389, "zeta": -50.564, "epsilon_zeta": -90.825, "bb_type": "BI", "chi": -166.606, "glyco_bond": "anti", "C5prime_xyz": [ -1.680, 8.738, 0.850 ], "P_xyz": [ 0.828, 9.285, 1.422 ], "form": ".", "ssZp": 4.304, "Dp": 4.446, "splay_angle": 46.913, "splay_distance": 7.203, "splay_ratio": 0.398, "d22": null, "d64": null, "eta": 175.487, "theta": -113.632, "eta_prime": -170.957, "theta_prime": -107.490, "eta_base": -128.163, "theta_base": -60.433, "v0": -2.977, "v1": -18.375, "v2": 31.587, "v3": -34.320, "v4": 23.522, "amplitude": 34.466, "phase_angle": 23.586, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.767, "filter_rmsd": 0.038, "frame": { "rmsd": 0.003, "origin": [ -31.388, -2.785, -85.515 ], "x_axis": [ 0.118, 0.887, -0.446 ], "y_axis": [ 0.986, -0.054, 0.155 ], "z_axis": [ 0.114, -0.459, -0.881 ], "quaternion": [ 0.214, 0.716, 0.654, -0.116 ] } }, { "index": 243, "index_chain": 62, "chain_name": "G", "nt_resnum": 1104, "nt_name": "C", "nt_code": "C", "nt_id": "///G/1104", "linked_nts": [ "///G/1103", "///G/1105" ], "nt_type": "RNA", "dbn": ")", "summary": "k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,junction-loop,A-minor,ribose-zipper", "alpha": -69.618, "beta": 179.849, "gamma": 50.972, "delta": 88.140, "epsilon": -140.161, "zeta": -79.867, "epsilon_zeta": -60.294, "bb_type": "BI", "chi": -163.065, "glyco_bond": "anti", "C5prime_xyz": [ -1.197, 8.617, 0.813 ], "P_xyz": [ 1.359, 8.679, 1.419 ], "form": "A", "ssZp": 4.446, "Dp": 4.591, "splay_angle": 22.233, "splay_distance": 3.600, "splay_ratio": 0.194, "d22": 4.148, "d64": 4.161, "eta": 166.680, "theta": -137.870, "eta_prime": -163.048, "theta_prime": -136.804, "eta_base": -96.020, "theta_base": -118.175, "v0": 2.738, "v1": -22.912, "v2": 33.367, "v3": -32.939, "v4": 19.049, "amplitude": 34.447, "phase_angle": 14.384, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.624, "filter_rmsd": 0.063, "frame": { "rmsd": 0.003, "origin": [ -27.027, -1.317, -91.057 ], "x_axis": [ 0.910, 0.327, 0.253 ], "y_axis": [ 0.115, -0.788, 0.606 ], "z_axis": [ 0.397, -0.522, -0.755 ], "quaternion": [ 0.303, 0.929, 0.119, 0.175 ] } }, { "index": 244, "index_chain": 63, "chain_name": "G", "nt_resnum": 1105, "nt_name": "U", "nt_code": "U", "nt_id": "///G/1105", "linked_nts": [ "///G/1104", "///G/1106" ], "nt_type": "RNA", "dbn": ")", "summary": "k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,A-minor,ribose-zipper", "alpha": -62.243, "beta": 163.808, "gamma": 52.714, "delta": 83.129, "epsilon": -167.240, "zeta": -74.877, "epsilon_zeta": -92.363, "bb_type": "BI", "chi": -162.772, "glyco_bond": "anti", "C5prime_xyz": [ -1.761, 8.767, 0.716 ], "P_xyz": [ 0.775, 9.391, 0.846 ], "form": "A", "ssZp": 4.437, "Dp": 4.377, "splay_angle": 23.015, "splay_distance": 3.597, "splay_ratio": 0.201, "d22": null, "d64": null, "eta": 160.078, "theta": -156.803, "eta_prime": 177.873, "theta_prime": -159.212, "eta_base": -145.628, "theta_base": -139.002, "v0": -2.906, "v1": -19.252, "v2": 32.918, "v3": -35.645, "v4": 24.257, "amplitude": 35.831, "phase_angle": 23.264, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.813, "filter_rmsd": 0.105, "frame": { "rmsd": 0.007, "origin": [ -25.373, -1.847, -94.210 ], "x_axis": [ 0.756, 0.024, 0.654 ], "y_axis": [ -0.302, -0.874, 0.380 ], "z_axis": [ 0.581, -0.485, -0.653 ], "quaternion": [ 0.239, 0.906, -0.077, 0.341 ] } }, { "index": 245, "index_chain": 64, "chain_name": "G", "nt_resnum": 1106, "nt_name": "G", "nt_code": "G", "nt_id": "///G/1106", "linked_nts": [ "///G/1105", "///G/1107" ], "nt_type": "RNA", "dbn": ")", "summary": "k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -71.786, "beta": -178.227, "gamma": 54.325, "delta": 83.741, "epsilon": -140.293, "zeta": -79.520, "epsilon_zeta": -60.773, "bb_type": "BI", "chi": -164.454, "glyco_bond": "anti", "C5prime_xyz": [ -1.361, 8.664, 0.859 ], "P_xyz": [ 1.211, 8.996, 1.268 ], "form": "A", "ssZp": 4.610, "Dp": 4.671, "splay_angle": 23.163, "splay_distance": 3.645, "splay_ratio": 0.201, "d22": null, "d64": null, "eta": 171.900, "theta": -142.863, "eta_prime": 178.234, "theta_prime": -140.759, "eta_base": -151.049, "theta_base": -111.525, "v0": 2.669, "v1": -23.877, "v2": 34.662, "v3": -34.254, "v4": 19.942, "amplitude": 35.808, "phase_angle": 14.530, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.740, "filter_rmsd": 0.008, "frame": { "rmsd": 0.008, "origin": [ -23.158, -1.832, -97.044 ], "x_axis": [ 0.481, -0.388, 0.786 ], "y_axis": [ -0.629, -0.777, 0.001 ], "z_axis": [ 0.611, -0.495, -0.618 ], "quaternion": [ 0.146, 0.848, -0.300, 0.412 ] } }, { "index": 246, "index_chain": 65, "chain_name": "G", "nt_resnum": 1107, "nt_name": "G", "nt_code": "G", "nt_id": "///G/1107", "linked_nts": [ "///G/1106", "///G/1108" ], "nt_type": "RNA", "dbn": ")", "summary": "k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -70.221, "beta": 162.833, "gamma": 64.184, "delta": 84.196, "epsilon": -160.680, "zeta": -69.099, "epsilon_zeta": -91.581, "bb_type": "BI", "chi": -169.271, "glyco_bond": "anti", "C5prime_xyz": [ -1.587, 8.659, 1.058 ], "P_xyz": [ 1.001, 9.091, 0.981 ], "form": "A", "ssZp": 4.517, "Dp": 4.489, "splay_angle": 26.692, "splay_distance": 4.058, "splay_ratio": 0.231, "d22": null, "d64": null, "eta": 161.997, "theta": -145.776, "eta_prime": -179.564, "theta_prime": -146.930, "eta_base": -132.802, "theta_base": -118.084, "v0": 1.232, "v1": -22.484, "v2": 33.879, "v3": -34.339, "v4": 20.874, "amplitude": 35.391, "phase_angle": 16.808, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.736, "filter_rmsd": 0.009, "frame": { "rmsd": 0.009, "origin": [ -19.897, -3.118, -98.044 ], "x_axis": [ -0.085, -0.648, 0.757 ], "y_axis": [ -0.748, -0.460, -0.478 ], "z_axis": [ 0.658, -0.607, -0.446 ], "quaternion": [ 0.048, 0.675, -0.517, 0.524 ] } }, { "index": 247, "index_chain": 66, "chain_name": "G", "nt_resnum": 1108, "nt_name": "U", "nt_code": "U", "nt_id": "///G/1108", "linked_nts": [ "///G/1107", "///G/1109" ], "nt_type": "RNA", "dbn": ")", "summary": "k-turn,anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop", "alpha": -68.717, "beta": -167.666, "gamma": 47.806, "delta": 85.138, "epsilon": -126.780, "zeta": -87.489, "epsilon_zeta": -39.291, "bb_type": "--", "chi": -157.459, "glyco_bond": "anti", "C5prime_xyz": [ -1.046, 8.584, 0.439 ], "P_xyz": [ 1.471, 8.696, 1.198 ], "form": ".", "ssZp": 4.273, "Dp": 4.750, "splay_angle": 18.718, "splay_distance": 2.946, "splay_ratio": 0.167, "d22": 4.061, "d64": 3.271, "eta": 179.031, "theta": -136.731, "eta_prime": -173.596, "theta_prime": -129.242, "eta_base": -135.850, "theta_base": -65.433, "v0": 5.478, "v1": -26.503, "v2": 35.905, "v3": -33.787, "v4": 17.881, "amplitude": 36.470, "phase_angle": 10.101, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.750, "filter_rmsd": 0.105, "frame": { "rmsd": 0.002, "origin": [ -16.558, -5.380, -98.493 ], "x_axis": [ -0.606, -0.732, 0.311 ], "y_axis": [ -0.539, 0.089, -0.838 ], "z_axis": [ 0.586, -0.675, -0.449 ], "quaternion": [ 0.094, -0.434, 0.732, -0.517 ] } }, { "index": 248, "index_chain": 67, "chain_name": "G", "nt_resnum": 1109, "nt_name": "C", "nt_code": "C", "nt_id": "///G/1109", "linked_nts": [ "///G/1108", "///G/1110" ], "nt_type": "RNA", "dbn": ".", "summary": "k-turn,anti,~C3'-endo,non-pair-contact,internal-loop", "alpha": -54.863, "beta": 139.476, "gamma": 65.996, "delta": 90.252, "epsilon": -116.037, "zeta": -85.150, "epsilon_zeta": -30.887, "bb_type": "--", "chi": -142.210, "glyco_bond": "anti", "C5prime_xyz": [ -1.193, 8.700, -0.488 ], "P_xyz": [ 1.132, 8.282, -1.626 ], "form": ".", "ssZp": 3.292, "Dp": 4.555, "splay_angle": 28.822, "splay_distance": 4.808, "splay_ratio": 0.255, "d22": null, "d64": null, "eta": 174.606, "theta": -118.812, "eta_prime": -164.851, "theta_prime": -113.203, "eta_base": -90.661, "theta_base": -84.947, "v0": 3.891, "v1": -23.510, "v2": 32.922, "v3": -31.764, "v4": 17.665, "amplitude": 33.691, "phase_angle": 12.265, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.267, "filter_rmsd": 0.063, "frame": { "rmsd": 0.002, "origin": [ -17.350, -8.062, -99.419 ], "x_axis": [ -0.750, -0.572, -0.333 ], "y_axis": [ 0.279, 0.183, -0.943 ], "z_axis": [ 0.600, -0.800, 0.022 ], "quaternion": [ 0.337, -0.106, 0.691, -0.630 ] } }, { "index": 249, "index_chain": 68, "chain_name": "G", "nt_resnum": 1110, "nt_name": "G", "nt_code": "G", "nt_id": "///G/1110", "linked_nts": [ "///G/1109", "///G/1111" ], "nt_type": "RNA", "dbn": ".", "summary": "k-turn,anti,~C2'-endo,BII,non-canonical,non-pair-contact,helix,multiplet,internal-loop", "alpha": -45.102, "beta": 161.599, "gamma": 51.447, "delta": 145.211, "epsilon": -132.841, "zeta": -179.748, "epsilon_zeta": 46.907, "bb_type": "BII", "chi": -115.029, "glyco_bond": "anti", "C5prime_xyz": [ -1.902, 8.424, -1.432 ], "P_xyz": [ 0.674, 8.825, -1.140 ], "form": ".", "ssZp": 1.735, "Dp": 1.789, "splay_angle": 36.747, "splay_distance": 6.203, "splay_ratio": 0.317, "d22": null, "d64": null, "eta": 171.563, "theta": -179.700, "eta_prime": -147.577, "theta_prime": 169.758, "eta_base": -111.329, "theta_base": 172.107, "v0": -19.829, "v1": 31.948, "v2": -31.424, "v3": 20.970, "v4": -0.874, "amplitude": 32.895, "phase_angle": 162.803, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1b", "suiteness": 0.396, "filter_rmsd": 0.004, "frame": { "rmsd": 0.004, "origin": [ -17.511, -11.807, -102.430 ], "x_axis": [ -0.647, 0.449, -0.616 ], "y_axis": [ 0.760, 0.316, -0.568 ], "z_axis": [ -0.060, -0.836, -0.546 ], "quaternion": [ 0.176, 0.382, 0.792, -0.443 ] } }, { "index": 250, "index_chain": 69, "chain_name": "G", "nt_resnum": 1111, "nt_name": "A", "nt_code": "A", "nt_id": "///G/1111", "linked_nts": [ "///G/1110", "///G/1112" ], "nt_type": "RNA", "dbn": ".", "summary": "k-turn,anti,~C2'-endo,non-canonical,non-pair-contact,helix-end,internal-loop,phosphate", "alpha": -49.747, "beta": 154.699, "gamma": 34.836, "delta": 142.220, "epsilon": -154.067, "zeta": -156.889, "epsilon_zeta": 2.822, "bb_type": "--", "chi": -114.915, "glyco_bond": "anti", "C5prime_xyz": [ -1.936, 8.405, -1.836 ], "P_xyz": [ 0.370, 9.411, -1.111 ], "form": ".", "ssZp": 1.250, "Dp": 1.848, "splay_angle": 39.241, "splay_distance": 6.573, "splay_ratio": 0.336, "d22": null, "d64": null, "eta": -178.743, "theta": -178.191, "eta_prime": -170.336, "theta_prime": 156.040, "eta_base": -169.679, "theta_base": 172.672, "v0": -23.283, "v1": 35.586, "v2": -33.716, "v3": 21.271, "v4": 1.061, "amplitude": 35.980, "phase_angle": 159.568, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "4b", "suiteness": 0.474, "filter_rmsd": 0.044, "frame": { "rmsd": 0.023, "origin": [ -14.747, -16.373, -99.269 ], "x_axis": [ -0.640, 0.273, -0.718 ], "y_axis": [ 0.768, 0.231, -0.597 ], "z_axis": [ 0.003, -0.934, -0.358 ], "quaternion": [ 0.241, 0.349, 0.746, -0.513 ] } }, { "index": 251, "index_chain": 70, "chain_name": "G", "nt_resnum": 1112, "nt_name": "G", "nt_code": "G", "nt_id": "///G/1112", "linked_nts": [ "///G/1111", null ], "nt_type": "RNA", "dbn": ")", "summary": "k-turn,anti,~C3'-endo,non-stack,isolated-canonical,non-canonical,non-pair-contact,multiplet,internal-loop,A-minor,phosphate", "alpha": -54.809, "beta": 71.155, "gamma": 149.133, "delta": 85.808, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": -168.663, "glyco_bond": "anti", "C5prime_xyz": [ -0.969, 8.525, 1.067 ], "P_xyz": [ -1.071, 9.717, -1.281 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": 7.352, "v1": -26.185, "v2": 33.832, "v3": -30.753, "v4": 14.839, "amplitude": 34.058, "phase_angle": 6.604, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.006, "frame": { "rmsd": 0.006, "origin": [ -12.491, -19.943, -94.232 ], "x_axis": [ 0.279, -0.955, 0.102 ], "y_axis": [ 0.848, 0.195, -0.493 ], "z_axis": [ 0.451, 0.224, 0.864 ], "quaternion": [ 0.765, -0.234, 0.114, -0.590 ] } }, { "index": 252, "index_chain": 1, "chain_name": "I", "nt_resnum": 2646, "nt_name": "C", "nt_code": "C", "nt_id": "///I/2646", "linked_nts": [ null, "///I/2647" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end", "alpha": null, "beta": -160.155, "gamma": 63.654, "delta": 84.686, "epsilon": -131.600, "zeta": -76.154, "epsilon_zeta": -55.446, "bb_type": "BI", "chi": -169.502, "glyco_bond": "anti", "C5prime_xyz": [ -0.950, 8.494, 1.162 ], "P_xyz": [ 1.657, 8.412, 1.540 ], "form": ".", "ssZp": 4.801, "Dp": 4.801, "splay_angle": 26.719, "splay_distance": 4.161, "splay_ratio": 0.233, "d22": 3.816, "d64": 4.263, "eta": null, "theta": -128.514, "eta_prime": null, "theta_prime": -122.562, "eta_base": null, "theta_base": -86.084, "v0": 5.840, "v1": -27.155, "v2": 36.858, "v3": -34.459, "v4": 18.092, "amplitude": 37.402, "phase_angle": 9.782, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.064, "frame": { "rmsd": 0.010, "origin": [ 19.943, 24.545, -47.592 ], "x_axis": [ 0.656, 0.517, -0.550 ], "y_axis": [ 0.174, -0.813, -0.556 ], "z_axis": [ -0.735, 0.269, -0.623 ], "quaternion": [ -0.235, 0.879, 0.197, -0.365 ] } }, { "index": 253, "index_chain": 2, "chain_name": "I", "nt_resnum": 2647, "nt_name": "U", "nt_code": "U", "nt_id": "///I/2647", "linked_nts": [ "///I/2646", "///I/2648" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -51.190, "beta": 154.293, "gamma": 59.189, "delta": 83.964, "epsilon": -179.680, "zeta": -87.052, "epsilon_zeta": -92.628, "bb_type": "BI", "chi": -166.528, "glyco_bond": "anti", "C5prime_xyz": [ -1.630, 8.693, 0.959 ], "P_xyz": [ 0.941, 9.133, 0.684 ], "form": ".", "ssZp": 4.452, "Dp": 4.317, "splay_angle": 39.557, "splay_distance": 5.897, "splay_ratio": 0.339, "d22": null, "d64": null, "eta": 163.128, "theta": -174.029, "eta_prime": -165.696, "theta_prime": -178.270, "eta_base": -103.378, "theta_base": -171.186, "v0": -1.949, "v1": -20.188, "v2": 33.483, "v3": -35.512, "v4": 23.604, "amplitude": 36.021, "phase_angle": 21.637, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.635, "filter_rmsd": 0.103, "frame": { "rmsd": 0.007, "origin": [ 19.579, 27.300, -50.690 ], "x_axis": [ 0.624, -0.146, -0.768 ], "y_axis": [ -0.390, -0.909, -0.144 ], "z_axis": [ -0.677, 0.389, -0.624 ], "quaternion": [ -0.150, 0.888, -0.151, -0.407 ] } }, { "index": 254, "index_chain": 3, "chain_name": "I", "nt_resnum": 2648, "nt_name": "G", "nt_code": "G", "nt_id": "///I/2648", "linked_nts": [ "///I/2647", "///I/2649" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -64.582, "beta": -174.331, "gamma": 63.683, "delta": 84.904, "epsilon": -147.265, "zeta": -68.488, "epsilon_zeta": -78.777, "bb_type": "BI", "chi": -169.896, "glyco_bond": "anti", "C5prime_xyz": [ -1.262, 8.567, 1.144 ], "P_xyz": [ 1.314, 8.669, 1.653 ], "form": "A", "ssZp": 4.598, "Dp": 4.616, "splay_angle": 24.505, "splay_distance": 3.834, "splay_ratio": 0.214, "d22": null, "d64": null, "eta": -170.172, "theta": -132.851, "eta_prime": -171.847, "theta_prime": -130.371, "eta_base": -165.883, "theta_base": -90.014, "v0": 3.206, "v1": -24.045, "v2": 34.530, "v3": -33.741, "v4": 19.308, "amplitude": 35.533, "phase_angle": 13.645, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "&a", "suiteness": 0.690, "filter_rmsd": 0.003, "frame": { "rmsd": 0.003, "origin": [ 15.817, 31.805, -50.113 ], "x_axis": [ 0.519, -0.279, -0.808 ], "y_axis": [ -0.389, -0.919, 0.068 ], "z_axis": [ -0.761, 0.279, -0.586 ], "quaternion": [ -0.061, 0.869, -0.192, -0.451 ] } }, { "index": 255, "index_chain": 4, "chain_name": "I", "nt_resnum": 2649, "nt_name": "C", "nt_code": "C", "nt_id": "///I/2649", "linked_nts": [ "///I/2648", "///I/2650" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -53.549, "beta": 166.798, "gamma": 50.448, "delta": 85.223, "epsilon": -160.927, "zeta": -69.016, "epsilon_zeta": -91.910, "bb_type": "BI", "chi": -162.134, "glyco_bond": "anti", "C5prime_xyz": [ -1.349, 8.768, 0.694 ], "P_xyz": [ 1.243, 9.060, 0.997 ], "form": "A", "ssZp": 4.398, "Dp": 4.428, "splay_angle": 24.113, "splay_distance": 3.814, "splay_ratio": 0.209, "d22": 4.264, "d64": 4.397, "eta": 169.353, "theta": -145.614, "eta_prime": -167.715, "theta_prime": -147.567, "eta_base": -106.125, "theta_base": -124.173, "v0": -0.169, "v1": -21.433, "v2": 33.648, "v3": -34.724, "v4": 22.004, "amplitude": 35.567, "phase_angle": 18.904, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.833, "filter_rmsd": 0.062, "frame": { "rmsd": 0.004, "origin": [ 14.796, 32.638, -53.714 ], "x_axis": [ 0.071, -0.822, -0.565 ], "y_axis": [ -0.675, -0.457, 0.579 ], "z_axis": [ -0.734, 0.340, -0.587 ], "quaternion": [ 0.082, 0.727, -0.515, -0.447 ] } }, { "index": 256, "index_chain": 5, "chain_name": "I", "nt_resnum": 2650, "nt_name": "U", "nt_code": "U", "nt_id": "///I/2650", "linked_nts": [ "///I/2649", "///I/2651" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -74.029, "beta": 176.296, "gamma": 56.902, "delta": 82.120, "epsilon": -153.465, "zeta": -77.528, "epsilon_zeta": -75.937, "bb_type": "BI", "chi": -168.753, "glyco_bond": "anti", "C5prime_xyz": [ -1.471, 8.628, 1.079 ], "P_xyz": [ 1.095, 9.062, 1.402 ], "form": "A", "ssZp": 4.661, "Dp": 4.611, "splay_angle": 22.538, "splay_distance": 3.439, "splay_ratio": 0.197, "d22": 4.440, "d64": 4.341, "eta": 164.791, "theta": -151.289, "eta_prime": 178.307, "theta_prime": -150.271, "eta_base": -140.810, "theta_base": -122.394, "v0": 0.322, "v1": -23.060, "v2": 35.605, "v3": -36.399, "v4": 22.731, "amplitude": 37.452, "phase_angle": 18.067, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.830, "filter_rmsd": 0.104, "frame": { "rmsd": 0.005, "origin": [ 13.111, 34.184, -56.767 ], "x_axis": [ -0.235, -0.960, -0.153 ], "y_axis": [ -0.576, 0.011, 0.817 ], "z_axis": [ -0.783, 0.280, -0.555 ], "quaternion": [ -0.235, -0.572, 0.671, 0.409 ] } }, { "index": 257, "index_chain": 6, "chain_name": "I", "nt_resnum": 2651, "nt_name": "C", "nt_code": "C", "nt_id": "///I/2651", "linked_nts": [ "///I/2650", "///I/2652" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -67.300, "beta": 177.687, "gamma": 49.665, "delta": 82.241, "epsilon": -149.808, "zeta": -74.468, "epsilon_zeta": -75.340, "bb_type": "BI", "chi": -165.072, "glyco_bond": "anti", "C5prime_xyz": [ -1.109, 8.582, 0.942 ], "P_xyz": [ 1.499, 8.734, 1.159 ], "form": "A", "ssZp": 4.723, "Dp": 4.707, "splay_angle": 26.012, "splay_distance": 4.168, "splay_ratio": 0.233, "d22": 4.319, "d64": 4.970, "eta": 164.159, "theta": -144.363, "eta_prime": 173.989, "theta_prime": -142.767, "eta_base": -143.653, "theta_base": -126.283, "v0": 4.243, "v1": -26.449, "v2": 37.163, "v3": -35.740, "v4": 19.855, "amplitude": 38.034, "phase_angle": 12.283, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.938, "filter_rmsd": 0.063, "frame": { "rmsd": 0.010, "origin": [ 11.422, 34.379, -59.756 ], "x_axis": [ -0.477, -0.790, 0.385 ], "y_axis": [ -0.383, 0.581, 0.718 ], "z_axis": [ -0.791, 0.194, -0.580 ], "quaternion": [ -0.362, -0.361, 0.812, 0.281 ] } }, { "index": 258, "index_chain": 7, "chain_name": "I", "nt_resnum": 2652, "nt_name": "C", "nt_code": "C", "nt_id": "///I/2652", "linked_nts": [ "///I/2651", "///I/2653" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,internal-loop", "alpha": -51.928, "beta": 175.594, "gamma": 49.564, "delta": 81.279, "epsilon": -139.177, "zeta": -72.098, "epsilon_zeta": -67.080, "bb_type": "BI", "chi": -167.799, "glyco_bond": "anti", "C5prime_xyz": [ -1.587, 8.740, 1.022 ], "P_xyz": [ 0.899, 9.323, 1.594 ], "form": ".", "ssZp": 4.627, "Dp": 4.635, "splay_angle": 20.804, "splay_distance": 3.327, "splay_ratio": 0.182, "d22": 4.282, "d64": 3.845, "eta": 178.448, "theta": -135.667, "eta_prime": -170.903, "theta_prime": -130.047, "eta_base": -142.248, "theta_base": -77.697, "v0": -0.725, "v1": -21.889, "v2": 34.805, "v3": -36.278, "v4": 23.341, "amplitude": 36.980, "phase_angle": 19.748, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.830, "filter_rmsd": 0.062, "frame": { "rmsd": 0.005, "origin": [ 9.154, 32.990, -62.966 ], "x_axis": [ -0.439, -0.466, 0.769 ], "y_axis": [ -0.117, 0.878, 0.465 ], "z_axis": [ -0.891, 0.114, -0.440 ], "quaternion": [ -0.500, -0.176, 0.830, 0.174 ] } }, { "index": 259, "index_chain": 8, "chain_name": "I", "nt_resnum": 2653, "nt_name": "U", "nt_code": "U", "nt_id": "///I/2653", "linked_nts": [ "///I/2652", "///I/2654" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-canonical,non-pair-contact,helix,internal-loop,phosphate", "alpha": -54.005, "beta": 168.334, "gamma": 50.800, "delta": 86.180, "epsilon": -152.156, "zeta": 48.446, "epsilon_zeta": 159.398, "bb_type": "--", "chi": -134.909, "glyco_bond": "anti", "C5prime_xyz": [ -1.657, 8.711, -0.933 ], "P_xyz": [ 0.883, 9.218, -1.369 ], "form": ".", "ssZp": 3.411, "Dp": 4.399, "splay_angle": 21.514, "splay_distance": 3.555, "splay_ratio": 0.190, "d22": null, "d64": null, "eta": 170.260, "theta": -28.190, "eta_prime": -168.514, "theta_prime": -68.955, "eta_base": -103.439, "theta_base": -104.014, "v0": -2.340, "v1": -19.113, "v2": 32.101, "v3": -34.464, "v4": 23.207, "amplitude": 34.743, "phase_angle": 22.487, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.824, "filter_rmsd": 0.104, "frame": { "rmsd": 0.001, "origin": [ 6.174, 31.939, -61.926 ], "x_axis": [ -0.466, 0.268, 0.843 ], "y_axis": [ -0.152, 0.914, -0.375 ], "z_axis": [ -0.872, -0.303, -0.385 ], "quaternion": [ 0.515, -0.035, -0.832, 0.204 ] } }, { "index": 260, "index_chain": 9, "chain_name": "I", "nt_resnum": 2654, "nt_name": "A", "nt_code": "A", "nt_id": "///I/2654", "linked_nts": [ "///I/2653", "///I/2655" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C2'-endo,BII,non-canonical,non-pair-contact,helix,internal-loop", "alpha": 177.723, "beta": 136.685, "gamma": 45.653, "delta": 142.651, "epsilon": -110.621, "zeta": -177.999, "epsilon_zeta": 67.378, "bb_type": "BII", "chi": -144.123, "glyco_bond": "anti", "C5prime_xyz": [ -2.467, 8.694, 0.053 ], "P_xyz": [ -0.173, 8.949, 1.293 ], "form": ".", "ssZp": 1.094, "Dp": 1.206, "splay_angle": 47.049, "splay_distance": 7.855, "splay_ratio": 0.399, "d22": null, "d64": null, "eta": 47.278, "theta": 177.003, "eta_prime": 113.989, "theta_prime": 151.566, "eta_base": 115.236, "theta_base": 163.429, "v0": -23.498, "v1": 35.530, "v2": -33.103, "v3": 20.616, "v4": 1.529, "amplitude": 35.556, "phase_angle": 158.593, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "5z", "suiteness": 0.750, "filter_rmsd": 0.038, "frame": { "rmsd": 0.009, "origin": [ 2.643, 32.319, -61.769 ], "x_axis": [ 0.332, -0.736, -0.590 ], "y_axis": [ -0.085, 0.599, -0.796 ], "z_axis": [ 0.939, 0.315, 0.136 ], "quaternion": [ 0.719, -0.386, 0.532, -0.226 ] } }, { "index": 261, "index_chain": 10, "chain_name": "I", "nt_resnum": 2655, "nt_name": "G", "nt_code": "G", "nt_id": "///I/2655", "linked_nts": [ "///I/2654", "///I/2656" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,anti,~C2'-endo,non-canonical,non-pair-contact,multiplet,internal-loop", "alpha": -83.025, "beta": 71.516, "gamma": 179.459, "delta": 152.414, "epsilon": -169.022, "zeta": 156.357, "epsilon_zeta": 34.622, "bb_type": "--", "chi": -112.247, "glyco_bond": "anti", "C5prime_xyz": [ -2.107, 8.391, -1.518 ], "P_xyz": [ -2.902, 8.566, -4.014 ], "form": ".", "ssZp": 1.756, "Dp": 1.866, "splay_angle": 54.679, "splay_distance": 8.169, "splay_ratio": 0.461, "d22": null, "d64": null, "eta": -37.907, "theta": 21.405, "eta_prime": -82.346, "theta_prime": 63.200, "eta_base": -96.309, "theta_base": 92.896, "v0": -19.266, "v1": 35.479, "v2": -36.812, "v3": 26.824, "v4": -5.042, "amplitude": 37.555, "phase_angle": 168.583, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22t", "cluster": "4s", "suiteness": 0.750, "filter_rmsd": 0.003, "frame": { "rmsd": 0.003, "origin": [ -1.749, 35.616, -56.153 ], "x_axis": [ 0.166, 0.476, 0.864 ], "y_axis": [ -0.098, 0.880, -0.466 ], "z_axis": [ -0.981, -0.007, 0.192 ], "quaternion": [ 0.748, -0.153, -0.617, 0.192 ] } }, { "index": 262, "index_chain": 11, "chain_name": "I", "nt_resnum": 2656, "nt_name": "U", "nt_code": "U", "nt_id": "///I/2656", "linked_nts": [ "///I/2655", "///I/2657" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,internal-loop,phosphate", "alpha": -74.109, "beta": 154.277, "gamma": 41.407, "delta": 85.509, "epsilon": -141.459, "zeta": -79.282, "epsilon_zeta": -62.176, "bb_type": "BI", "chi": -179.623, "glyco_bond": "anti", "C5prime_xyz": [ -1.354, 8.262, 1.755 ], "P_xyz": [ 1.172, 8.008, 2.433 ], "form": "A", "ssZp": 4.701, "Dp": 4.651, "splay_angle": 30.070, "splay_distance": 4.547, "splay_ratio": 0.261, "d22": null, "d64": null, "eta": 166.081, "theta": -136.483, "eta_prime": 153.969, "theta_prime": -134.236, "eta_base": 155.930, "theta_base": -111.181, "v0": 4.819, "v1": -25.232, "v2": 34.765, "v3": -33.051, "v4": 17.832, "amplitude": 35.418, "phase_angle": 11.018, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "#a", "suiteness": 0.885, "filter_rmsd": 0.105, "frame": { "rmsd": 0.004, "origin": [ -0.879, 31.811, -63.329 ], "x_axis": [ -0.083, 0.210, 0.974 ], "y_axis": [ -0.222, 0.949, -0.224 ], "z_axis": [ -0.972, -0.234, -0.032 ], "quaternion": [ 0.677, 0.004, -0.718, 0.159 ] } }, { "index": 263, "index_chain": 12, "chain_name": "I", "nt_resnum": 2657, "nt_name": "A", "nt_code": "A", "nt_id": "///I/2657", "linked_nts": [ "///I/2656", "///I/2658" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop,cap-acceptor,phosphate", "alpha": -56.420, "beta": 174.924, "gamma": 48.905, "delta": 82.502, "epsilon": -132.179, "zeta": -54.006, "epsilon_zeta": -78.173, "bb_type": "BI", "chi": -172.448, "glyco_bond": "anti", "C5prime_xyz": [ -1.337, 8.484, 1.301 ], "P_xyz": [ 1.192, 8.644, 1.977 ], "form": ".", "ssZp": 4.700, "Dp": 4.732, "splay_angle": 37.865, "splay_distance": 5.853, "splay_ratio": 0.326, "d22": null, "d64": null, "eta": 175.527, "theta": -111.933, "eta_prime": -173.161, "theta_prime": -106.306, "eta_base": -135.843, "theta_base": -58.563, "v0": 3.363, "v1": -25.007, "v2": 35.768, "v3": -34.940, "v4": 19.919, "amplitude": 36.789, "phase_angle": 13.530, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.858, "filter_rmsd": 0.038, "frame": { "rmsd": 0.002, "origin": [ -4.557, 29.275, -62.487 ], "x_axis": [ -0.145, 0.736, 0.662 ], "y_axis": [ 0.021, 0.671, -0.741 ], "z_axis": [ -0.989, -0.094, -0.113 ], "quaternion": [ 0.594, -0.272, -0.694, 0.301 ] } }, { "index": 264, "index_chain": 13, "chain_name": "I", "nt_resnum": 2658, "nt_name": "C", "nt_code": "C", "nt_id": "///I/2658", "linked_nts": [ "///I/2657", "///I/2659" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,isolated-canonical,non-pair-contact,helix,hairpin-loop,internal-loop,cap-donor", "alpha": -64.243, "beta": 174.628, "gamma": 50.093, "delta": 81.863, "epsilon": -142.208, "zeta": -59.616, "epsilon_zeta": -82.592, "bb_type": "BI", "chi": -166.737, "glyco_bond": "anti", "C5prime_xyz": [ -1.390, 8.691, 1.023 ], "P_xyz": [ 1.173, 9.088, 1.399 ], "form": ".", "ssZp": 4.696, "Dp": 4.682, "splay_angle": 27.045, "splay_distance": 4.436, "splay_ratio": 0.240, "d22": null, "d64": null, "eta": 159.868, "theta": -125.882, "eta_prime": -171.180, "theta_prime": -122.722, "eta_base": -96.867, "theta_base": -81.406, "v0": -0.770, "v1": -22.375, "v2": 35.629, "v3": -37.039, "v4": 23.822, "amplitude": 37.843, "phase_angle": 19.697, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.705, "filter_rmsd": 0.062, "frame": { "rmsd": 0.007, "origin": [ -8.393, 33.417, -60.940 ], "x_axis": [ 0.076, 0.927, -0.366 ], "y_axis": [ 0.116, -0.373, -0.921 ], "z_axis": [ -0.990, 0.028, -0.136 ], "quaternion": [ -0.377, 0.629, 0.414, -0.539 ] } }, { "index": 265, "index_chain": 14, "chain_name": "I", "nt_resnum": 2659, "nt_name": "G", "nt_code": "G", "nt_id": "///I/2659", "linked_nts": [ "///I/2658", "///I/2660" ], "nt_type": "RNA", "dbn": ".", "summary": "u-turn,anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,hairpin-loop,phosphate", "alpha": -60.754, "beta": -177.771, "gamma": 46.526, "delta": 80.817, "epsilon": -142.921, "zeta": -60.100, "epsilon_zeta": -82.821, "bb_type": "BI", "chi": -152.124, "glyco_bond": "anti", "C5prime_xyz": [ -1.577, 8.892, 0.066 ], "P_xyz": [ 0.887, 9.704, 0.440 ], "form": ".", "ssZp": 4.163, "Dp": 4.582, "splay_angle": 80.058, "splay_distance": 11.531, "splay_ratio": 0.644, "d22": null, "d64": null, "eta": 168.452, "theta": -115.649, "eta_prime": -171.774, "theta_prime": -158.137, "eta_base": -113.474, "theta_base": 145.508, "v0": -1.649, "v1": -21.023, "v2": 34.166, "v3": -36.190, "v4": 23.886, "amplitude": 36.636, "phase_angle": 21.160, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.827, "filter_rmsd": 0.003, "frame": { "rmsd": 0.003, "origin": [ -10.831, 36.909, -62.177 ], "x_axis": [ 0.316, 0.337, -0.887 ], "y_axis": [ -0.153, -0.905, -0.398 ], "z_axis": [ -0.936, 0.262, -0.234 ], "quaternion": [ -0.210, 0.783, 0.058, -0.582 ] } }, { "index": 266, "index_chain": 15, "chain_name": "I", "nt_resnum": 2660, "nt_name": "A", "nt_code": "A", "nt_id": "///I/2660", "linked_nts": [ "///I/2659", "///I/2661" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,u-turn,anti,~C3'-endo,BI,non-pair-contact,hairpin-loop", "alpha": 167.107, "beta": 149.317, "gamma": 43.098, "delta": 84.516, "epsilon": -158.128, "zeta": -71.858, "epsilon_zeta": -86.270, "bb_type": "BI", "chi": 176.982, "glyco_bond": "anti", "C5prime_xyz": [ -1.608, 8.297, 1.820 ], "P_xyz": [ 0.893, 8.115, 2.617 ], "form": ".", "ssZp": 4.373, "Dp": 4.461, "splay_angle": 23.236, "splay_distance": 3.770, "splay_ratio": 0.210, "d22": null, "d64": null, "eta": 5.673, "theta": -110.290, "eta_prime": 34.881, "theta_prime": -117.223, "eta_base": 23.076, "theta_base": -74.215, "v0": 2.216, "v1": -22.436, "v2": 32.863, "v3": -32.769, "v4": 19.315, "amplitude": 34.050, "phase_angle": 15.175, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1g", "suiteness": 0.825, "filter_rmsd": 0.038, "frame": { "rmsd": 0.002, "origin": [ -18.830, 31.553, -55.830 ], "x_axis": [ 0.085, -0.991, 0.107 ], "y_axis": [ -0.076, -0.114, -0.991 ], "z_axis": [ 0.993, 0.076, -0.085 ], "quaternion": [ -0.471, 0.567, -0.471, 0.486 ] } }, { "index": 267, "index_chain": 16, "chain_name": "I", "nt_resnum": 2661, "nt_name": "G", "nt_code": "G", "nt_id": "///I/2661", "linked_nts": [ "///I/2660", "///I/2662" ], "nt_type": "RNA", "dbn": ".", "summary": "u-turn,anti,~C3'-endo,BI,non-pair-contact,hairpin-loop", "alpha": 173.981, "beta": -151.234, "gamma": 157.948, "delta": 87.858, "epsilon": -149.160, "zeta": -55.480, "epsilon_zeta": -93.680, "bb_type": "BI", "chi": -159.036, "glyco_bond": "anti", "C5prime_xyz": [ -1.290, 8.746, 0.442 ], "P_xyz": [ 0.780, 9.431, -1.022 ], "form": ".", "ssZp": 3.985, "Dp": 4.357, "splay_angle": 28.253, "splay_distance": 4.500, "splay_ratio": 0.247, "d22": null, "d64": null, "eta": 167.081, "theta": -138.165, "eta_prime": -165.681, "theta_prime": -138.747, "eta_base": -96.972, "theta_base": -75.790, "v0": 3.442, "v1": -21.810, "v2": 30.739, "v3": -29.946, "v4": 16.794, "amplitude": 31.522, "phase_angle": 12.796, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.237, "filter_rmsd": 0.008, "frame": { "rmsd": 0.008, "origin": [ -15.840, 29.380, -55.087 ], "x_axis": [ 0.351, -0.674, -0.650 ], "y_axis": [ 0.130, 0.723, -0.679 ], "z_axis": [ 0.927, 0.154, 0.341 ], "quaternion": [ 0.777, -0.268, 0.507, -0.259 ] } }, { "index": 268, "index_chain": 17, "chain_name": "I", "nt_resnum": 2662, "nt_name": "A", "nt_code": "A", "nt_id": "///I/2662", "linked_nts": [ "///I/2661", "///I/2663" ], "nt_type": "RNA", "dbn": ".", "summary": "u-turn,anti,~C3'-endo,non-canonical,non-pair-contact,helix-end,hairpin-loop,cap-acceptor,phosphate", "alpha": -70.410, "beta": 169.439, "gamma": 47.842, "delta": 84.948, "epsilon": -128.535, "zeta": -53.378, "epsilon_zeta": -75.157, "bb_type": "--", "chi": -148.858, "glyco_bond": "anti", "C5prime_xyz": [ -0.983, 8.615, -0.111 ], "P_xyz": [ 1.646, 8.599, -0.120 ], "form": ".", "ssZp": 3.870, "Dp": 4.729, "splay_angle": 38.114, "splay_distance": 6.194, "splay_ratio": 0.327, "d22": null, "d64": null, "eta": 159.986, "theta": -106.910, "eta_prime": -174.223, "theta_prime": -97.732, "eta_base": -93.215, "theta_base": -62.048, "v0": 4.908, "v1": -25.207, "v2": 34.901, "v3": -33.133, "v4": 17.831, "amplitude": 35.552, "phase_angle": 10.985, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.724, "filter_rmsd": 0.038, "frame": { "rmsd": 0.003, "origin": [ -11.972, 29.379, -57.386 ], "x_axis": [ 0.246, 0.288, -0.926 ], "y_axis": [ -0.088, 0.958, 0.274 ], "z_axis": [ 0.965, 0.014, 0.261 ], "quaternion": [ 0.785, 0.083, 0.602, 0.120 ] } }, { "index": 269, "index_chain": 18, "chain_name": "I", "nt_resnum": 2663, "nt_name": "G", "nt_code": "G", "nt_id": "///I/2663", "linked_nts": [ "///I/2662", "///I/2664" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,isolated-canonical,non-pair-contact,helix,hairpin-loop,internal-loop,cap-donor", "alpha": -59.233, "beta": 147.714, "gamma": 75.064, "delta": 81.891, "epsilon": -151.859, "zeta": -56.480, "epsilon_zeta": -95.379, "bb_type": "BI", "chi": -164.763, "glyco_bond": "anti", "C5prime_xyz": [ -1.785, 8.808, 0.879 ], "P_xyz": [ 0.510, 9.534, -0.145 ], "form": ".", "ssZp": 4.678, "Dp": 4.580, "splay_angle": 32.149, "splay_distance": 4.989, "splay_ratio": 0.278, "d22": null, "d64": null, "eta": 165.711, "theta": -129.262, "eta_prime": -152.182, "theta_prime": -133.180, "eta_base": -86.684, "theta_base": -83.404, "v0": -3.933, "v1": -20.141, "v2": 35.094, "v3": -38.276, "v4": 26.624, "amplitude": 38.495, "phase_angle": 24.267, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.196, "filter_rmsd": 0.012, "frame": { "rmsd": 0.012, "origin": [ -8.506, 33.042, -60.983 ], "x_axis": [ 0.045, 0.935, -0.351 ], "y_axis": [ -0.086, 0.353, 0.931 ], "z_axis": [ 0.995, -0.012, 0.096 ], "quaternion": [ 0.611, 0.386, 0.550, 0.418 ] } }, { "index": 270, "index_chain": 19, "chain_name": "I", "nt_resnum": 2664, "nt_name": "G", "nt_code": "G", "nt_id": "///I/2664", "linked_nts": [ "///I/2663", "///I/2665" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop", "alpha": -72.352, "beta": 177.057, "gamma": 53.670, "delta": 82.053, "epsilon": -157.028, "zeta": -78.000, "epsilon_zeta": -79.028, "bb_type": "BI", "chi": -166.027, "glyco_bond": "anti", "C5prime_xyz": [ -1.244, 8.683, 0.947 ], "P_xyz": [ 1.350, 9.015, 1.223 ], "form": ".", "ssZp": 4.665, "Dp": 4.600, "splay_angle": 69.855, "splay_distance": 11.085, "splay_ratio": 0.579, "d22": null, "d64": null, "eta": 160.652, "theta": 174.734, "eta_prime": -174.893, "theta_prime": 158.203, "eta_base": -97.948, "theta_base": 147.193, "v0": 1.797, "v1": -23.777, "v2": 35.497, "v3": -35.495, "v4": 21.259, "amplitude": 36.914, "phase_angle": 15.929, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.815, "filter_rmsd": 0.009, "frame": { "rmsd": 0.009, "origin": [ -5.489, 37.009, -61.205 ], "x_axis": [ -0.161, 0.776, 0.610 ], "y_axis": [ -0.008, -0.619, 0.786 ], "z_axis": [ 0.987, 0.122, 0.106 ], "quaternion": [ 0.285, 0.581, 0.330, 0.687 ] } }, { "index": 271, "index_chain": 20, "chain_name": "I", "nt_resnum": 2665, "nt_name": "A", "nt_code": "A", "nt_id": "///I/2665", "linked_nts": [ "///I/2664", "///I/2666" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,internal-loop,phosphate", "alpha": -119.655, "beta": 84.315, "gamma": 168.233, "delta": 85.777, "epsilon": -154.402, "zeta": -58.470, "epsilon_zeta": -95.932, "bb_type": "BI", "chi": 177.050, "glyco_bond": "anti", "C5prime_xyz": [ -1.176, 8.139, 1.902 ], "P_xyz": [ -1.461, 10.429, 0.654 ], "form": ".", "ssZp": 4.684, "Dp": 4.629, "splay_angle": 39.557, "splay_distance": 5.261, "splay_ratio": 0.381, "d22": null, "d64": null, "eta": -156.137, "theta": 159.730, "eta_prime": 174.618, "theta_prime": -174.499, "eta_base": 152.776, "theta_base": -77.639, "v0": 6.386, "v1": -26.785, "v2": 35.548, "v3": -33.038, "v4": 16.899, "amplitude": 35.962, "phase_angle": 8.713, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1e", "suiteness": 0.920, "filter_rmsd": 0.039, "frame": { "rmsd": 0.007, "origin": [ -0.950, 29.100, -67.508 ], "x_axis": [ -0.131, 0.934, -0.332 ], "y_axis": [ -0.035, 0.330, 0.943 ], "z_axis": [ 0.991, 0.135, -0.010 ], "quaternion": [ 0.545, 0.370, 0.607, 0.445 ] } }, { "index": 272, "index_chain": 21, "chain_name": "I", "nt_resnum": 2666, "nt_name": "C", "nt_code": "C", "nt_id": "///I/2666", "linked_nts": [ "///I/2665", "///I/2667" ], "nt_type": "RNA", "dbn": ".", "summary": "syn,~C3'-endo,non-canonical,non-pair-contact,helix,internal-loop,phosphate", "alpha": -62.594, "beta": -179.308, "gamma": 61.851, "delta": 85.575, "epsilon": -125.138, "zeta": -68.888, "epsilon_zeta": -56.251, "bb_type": "--", "chi": 4.228, "glyco_bond": "syn", "C5prime_xyz": [ -5.349, 3.800, -1.288 ], "P_xyz": [ -4.992, 1.365, -2.215 ], "form": ".", "ssZp": -4.310, "Dp": 4.468, "splay_angle": 31.277, "splay_distance": 4.885, "splay_ratio": 0.270, "d22": 3.650, "d64": 4.379, "eta": -170.655, "theta": -118.467, "eta_prime": -151.698, "theta_prime": -115.395, "eta_base": -60.547, "theta_base": -130.264, "v0": 0.942, "v1": -21.835, "v2": 32.999, "v3": -33.583, "v4": 20.606, "amplitude": 34.542, "phase_angle": 17.186, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.755, "filter_rmsd": 0.063, "frame": { "rmsd": 0.007, "origin": [ 2.359, 32.104, -64.733 ], "x_axis": [ 0.130, 0.541, -0.831 ], "y_axis": [ 0.047, -0.841, -0.540 ], "z_axis": [ -0.990, 0.031, -0.135 ], "quaternion": [ -0.197, 0.725, 0.202, -0.628 ] } }, { "index": 273, "index_chain": 22, "chain_name": "I", "nt_resnum": 2667, "nt_name": "C", "nt_code": "C", "nt_id": "///I/2667", "linked_nts": [ "///I/2666", "///I/2668" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop", "alpha": -62.899, "beta": 163.666, "gamma": 48.134, "delta": 84.380, "epsilon": -133.022, "zeta": -68.552, "epsilon_zeta": -64.470, "bb_type": "BI", "chi": -166.560, "glyco_bond": "anti", "C5prime_xyz": [ -1.382, 8.703, 0.916 ], "P_xyz": [ 1.192, 8.937, 1.355 ], "form": ".", "ssZp": 4.467, "Dp": 4.613, "splay_angle": 30.907, "splay_distance": 5.009, "splay_ratio": 0.267, "d22": null, "d64": null, "eta": 156.119, "theta": -124.027, "eta_prime": -178.720, "theta_prime": -121.237, "eta_base": -179.215, "theta_base": -86.659, "v0": 1.221, "v1": -22.373, "v2": 33.815, "v3": -34.207, "v4": 20.817, "amplitude": 35.323, "phase_angle": 16.804, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.650, "filter_rmsd": 0.063, "frame": { "rmsd": 0.001, "origin": [ 6.484, 32.503, -67.319 ], "x_axis": [ -0.372, 0.236, 0.898 ], "y_axis": [ -0.107, -0.972, 0.211 ], "z_axis": [ 0.922, -0.017, 0.387 ], "quaternion": [ 0.104, 0.551, 0.059, 0.826 ] } }, { "index": 274, "index_chain": 23, "chain_name": "I", "nt_resnum": 2668, "nt_name": "G", "nt_code": "G", "nt_id": "///I/2668", "linked_nts": [ "///I/2667", "///I/2669" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,internal-loop", "alpha": -61.583, "beta": 161.139, "gamma": 61.159, "delta": 82.364, "epsilon": -158.781, "zeta": -64.430, "epsilon_zeta": -94.351, "bb_type": "BI", "chi": -169.781, "glyco_bond": "anti", "C5prime_xyz": [ -1.900, 8.756, 1.078 ], "P_xyz": [ 0.607, 9.509, 1.078 ], "form": ".", "ssZp": 4.558, "Dp": 4.464, "splay_angle": 23.890, "splay_distance": 4.129, "splay_ratio": 0.220, "d22": null, "d64": null, "eta": 163.365, "theta": -142.420, "eta_prime": -169.623, "theta_prime": -147.254, "eta_base": -111.627, "theta_base": -130.254, "v0": -3.869, "v1": -19.392, "v2": 33.852, "v3": -37.058, "v4": 25.769, "amplitude": 37.178, "phase_angle": 24.420, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.767, "filter_rmsd": 0.009, "frame": { "rmsd": 0.009, "origin": [ 9.141, 33.203, -63.130 ], "x_axis": [ -0.449, -0.488, 0.748 ], "y_axis": [ 0.122, -0.863, -0.490 ], "z_axis": [ 0.885, -0.129, 0.448 ], "quaternion": [ -0.184, 0.492, -0.186, 0.831 ] } }, { "index": 275, "index_chain": 24, "chain_name": "I", "nt_resnum": 2669, "nt_name": "G", "nt_code": "G", "nt_id": "///I/2669", "linked_nts": [ "///I/2668", "///I/2670" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -68.660, "beta": -176.746, "gamma": 52.417, "delta": 79.045, "epsilon": -159.189, "zeta": -72.605, "epsilon_zeta": -86.584, "bb_type": "BI", "chi": -166.555, "glyco_bond": "anti", "C5prime_xyz": [ -2.074, 8.862, 0.794 ], "P_xyz": [ 0.198, 10.000, 1.426 ], "form": "A", "ssZp": 4.505, "Dp": 4.457, "splay_angle": 22.778, "splay_distance": 3.691, "splay_ratio": 0.202, "d22": null, "d64": null, "eta": 167.764, "theta": -157.146, "eta_prime": -179.009, "theta_prime": -154.915, "eta_base": -144.435, "theta_base": -124.753, "v0": -4.448, "v1": -19.467, "v2": 34.150, "v3": -37.813, "v4": 26.712, "amplitude": 37.748, "phase_angle": 25.222, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.882, "filter_rmsd": 0.009, "frame": { "rmsd": 0.009, "origin": [ 11.276, 34.618, -59.892 ], "x_axis": [ -0.397, -0.825, 0.402 ], "y_axis": [ 0.317, -0.535, -0.783 ], "z_axis": [ 0.861, -0.183, 0.474 ], "quaternion": [ -0.368, 0.408, -0.312, 0.775 ] } }, { "index": 276, "index_chain": 25, "chain_name": "I", "nt_resnum": 2670, "nt_name": "A", "nt_code": "A", "nt_id": "///I/2670", "linked_nts": [ "///I/2669", "///I/2671" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -68.659, "beta": -179.907, "gamma": 54.111, "delta": 83.500, "epsilon": -154.510, "zeta": -71.048, "epsilon_zeta": -83.462, "bb_type": "BI", "chi": -164.509, "glyco_bond": "anti", "C5prime_xyz": [ -1.628, 8.748, 0.726 ], "P_xyz": [ 0.850, 9.406, 1.296 ], "form": "A", "ssZp": 4.378, "Dp": 4.476, "splay_angle": 22.492, "splay_distance": 3.759, "splay_ratio": 0.200, "d22": null, "d64": null, "eta": 170.805, "theta": -146.520, "eta_prime": -178.104, "theta_prime": -146.007, "eta_base": -138.083, "theta_base": -123.830, "v0": 0.462, "v1": -22.089, "v2": 33.836, "v3": -34.709, "v4": 21.655, "amplitude": 35.575, "phase_angle": 17.989, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.894, "filter_rmsd": 0.037, "frame": { "rmsd": 0.003, "origin": [ 13.071, 34.286, -56.684 ], "x_axis": [ -0.253, -0.953, -0.167 ], "y_axis": [ 0.503, 0.018, -0.864 ], "z_axis": [ 0.826, -0.303, 0.475 ], "quaternion": [ 0.557, -0.252, 0.446, -0.654 ] } }, { "index": 277, "index_chain": 26, "chain_name": "I", "nt_resnum": 2671, "nt_name": "G", "nt_code": "G", "nt_id": "///I/2671", "linked_nts": [ "///I/2670", "///I/2672" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -61.047, "beta": 167.084, "gamma": 58.883, "delta": 80.862, "epsilon": -165.088, "zeta": -68.869, "epsilon_zeta": -96.219, "bb_type": "BI", "chi": -163.476, "glyco_bond": "anti", "C5prime_xyz": [ -1.883, 8.910, 0.567 ], "P_xyz": [ 0.588, 9.781, 0.680 ], "form": "A", "ssZp": 4.295, "Dp": 4.358, "splay_angle": 22.704, "splay_distance": 3.553, "splay_ratio": 0.197, "d22": null, "d64": null, "eta": 169.676, "theta": -153.256, "eta_prime": -172.049, "theta_prime": -153.989, "eta_base": -133.999, "theta_base": -117.225, "v0": -3.715, "v1": -19.671, "v2": 33.821, "v3": -36.979, "v4": 25.642, "amplitude": 37.064, "phase_angle": 24.148, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.914, "filter_rmsd": 0.004, "frame": { "rmsd": 0.004, "origin": [ 14.631, 32.720, -53.643 ], "x_axis": [ 0.060, -0.846, -0.529 ], "y_axis": [ 0.601, 0.454, -0.658 ], "z_axis": [ 0.797, -0.279, 0.536 ], "quaternion": [ 0.716, -0.132, 0.463, -0.506 ] } }, { "index": 278, "index_chain": 27, "chain_name": "I", "nt_resnum": 2672, "nt_name": "U", "nt_code": "U", "nt_id": "///I/2672", "linked_nts": [ "///I/2671", "///I/2673" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -71.828, "beta": -178.702, "gamma": 53.559, "delta": 84.929, "epsilon": -176.035, "zeta": -71.816, "epsilon_zeta": -104.219, "bb_type": "BI", "chi": -156.150, "glyco_bond": "anti", "C5prime_xyz": [ -1.213, 8.693, 0.341 ], "P_xyz": [ 1.393, 8.989, 0.535 ], "form": ".", "ssZp": 4.329, "Dp": 4.405, "splay_angle": 25.653, "splay_distance": 4.538, "splay_ratio": 0.237, "d22": null, "d64": null, "eta": 166.292, "theta": -133.726, "eta_prime": -177.891, "theta_prime": -146.314, "eta_base": -125.384, "theta_base": -145.310, "v0": 2.878, "v1": -24.765, "v2": 35.785, "v3": -35.144, "v4": 20.342, "amplitude": 36.910, "phase_angle": 14.188, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.778, "filter_rmsd": 0.105, "frame": { "rmsd": 0.003, "origin": [ 16.768, 30.607, -51.748 ], "x_axis": [ 0.483, -0.384, -0.787 ], "y_axis": [ 0.456, 0.878, -0.148 ], "z_axis": [ 0.747, -0.288, 0.599 ], "quaternion": [ 0.860, 0.041, 0.446, -0.244 ] } }, { "index": 279, "index_chain": 28, "chain_name": "I", "nt_resnum": 2673, "nt_name": "G", "nt_code": "G", "nt_id": "///I/2673", "linked_nts": [ "///I/2672", "///I/2674" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": 153.254, "beta": -169.716, "gamma": -175.509, "delta": 85.349, "epsilon": -150.800, "zeta": -69.090, "epsilon_zeta": -81.710, "bb_type": "BI", "chi": -178.312, "glyco_bond": "anti", "C5prime_xyz": [ -1.205, 8.317, 1.647 ], "P_xyz": [ 0.168, 10.366, 0.747 ], "form": "A", "ssZp": 4.720, "Dp": 4.649, "splay_angle": 25.634, "splay_distance": 3.922, "splay_ratio": 0.226, "d22": null, "d64": null, "eta": 173.271, "theta": -173.534, "eta_prime": -177.440, "theta_prime": -165.735, "eta_base": -155.991, "theta_base": -135.095, "v0": 6.822, "v1": -26.974, "v2": 35.607, "v3": -32.772, "v4": 16.394, "amplitude": 35.955, "phase_angle": 7.984, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.838, "filter_rmsd": 0.004, "frame": { "rmsd": 0.004, "origin": [ 17.709, 27.173, -48.935 ], "x_axis": [ 0.623, -0.157, -0.766 ], "y_axis": [ 0.329, 0.942, 0.074 ], "z_axis": [ 0.710, -0.298, 0.638 ], "quaternion": [ 0.895, 0.104, 0.412, -0.136 ] } }, { "index": 280, "index_chain": 29, "chain_name": "I", "nt_resnum": 2674, "nt_name": "G", "nt_code": "G", "nt_id": "///I/2674", "linked_nts": [ "///I/2673", null ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix-end,stem-end", "alpha": -69.831, "beta": -166.856, "gamma": 45.848, "delta": 83.664, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": -164.550, "glyco_bond": "anti", "C5prime_xyz": [ -1.071, 8.611, 0.877 ], "P_xyz": [ 1.401, 8.777, 1.746 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": 3.301, "v1": -24.888, "v2": 35.740, "v3": -34.882, "v4": 19.946, "amplitude": 36.773, "phase_angle": 13.614, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.756, "filter_rmsd": 0.007, "frame": { "rmsd": 0.007, "origin": [ 19.875, 24.220, -47.530 ], "x_axis": [ 0.594, 0.486, -0.641 ], "y_axis": [ -0.133, 0.845, 0.518 ], "z_axis": [ 0.793, -0.222, 0.567 ], "quaternion": [ 0.867, 0.213, 0.413, 0.179 ] } }, { "index": 281, "index_chain": 1, "chain_name": "J", "nt_resnum": 1944, "nt_name": "U", "nt_code": "U", "nt_id": "///J/1944", "linked_nts": [ null, "///J/1945" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C2'-endo,non-pair-contact,ss-non-loop,cap-donor,cap-acceptor,splayed-apart", "alpha": null, "beta": -164.875, "gamma": 42.695, "delta": 144.631, "epsilon": -103.325, "zeta": -104.818, "epsilon_zeta": 1.493, "bb_type": "--", "chi": -118.357, "glyco_bond": "anti", "C5prime_xyz": [ -2.300, 8.529, -1.384 ], "P_xyz": [ -0.473, 10.185, -0.496 ], "form": ".", "ssZp": 0.810, "Dp": 0.865, "splay_angle": 141.691, "splay_distance": 17.280, "splay_ratio": 0.945, "d22": null, "d64": null, "eta": null, "theta": -50.022, "eta_prime": null, "theta_prime": -96.743, "eta_base": null, "theta_base": 172.011, "v0": -23.496, "v1": 36.961, "v2": -35.177, "v3": 22.745, "v4": 0.202, "amplitude": 37.272, "phase_angle": 160.699, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.104, "frame": { "rmsd": 0.002, "origin": [ 0.254, 13.539, -21.592 ], "x_axis": [ 0.510, -0.514, -0.690 ], "y_axis": [ -0.122, -0.837, 0.533 ], "z_axis": [ -0.851, -0.188, -0.490 ], "quaternion": [ 0.214, 0.842, -0.189, -0.458 ] } }, { "index": 282, "index_chain": 2, "chain_name": "J", "nt_resnum": 1945, "nt_name": "G", "nt_code": "G", "nt_id": "///J/1945", "linked_nts": [ "///J/1944", "///J/1946" ], "nt_type": "RNA", "dbn": "(", "summary": "~C3'-endo,canonical,non-pair-contact,helix-end,stem-end,splayed-apart", "alpha": 79.090, "beta": 139.495, "gamma": 45.049, "delta": 85.557, "epsilon": -128.476, "zeta": -86.365, "epsilon_zeta": -42.111, "bb_type": "--", "chi": 178.431, "glyco_bond": "--", "C5prime_xyz": [ -1.567, 8.344, 1.762 ], "P_xyz": [ 0.940, 7.903, 2.415 ], "form": "A", "ssZp": 4.446, "Dp": 4.568, "splay_angle": 22.614, "splay_distance": 3.538, "splay_ratio": 0.196, "d22": null, "d64": null, "eta": -99.489, "theta": -128.465, "eta_prime": -41.909, "theta_prime": -128.829, "eta_base": 57.430, "theta_base": -102.778, "v0": 3.035, "v1": -23.190, "v2": 33.135, "v3": -32.564, "v4": 18.669, "amplitude": 34.117, "phase_angle": 13.778, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "8d", "suiteness": 0.324, "filter_rmsd": 0.006, "frame": { "rmsd": 0.006, "origin": [ -9.558, 12.404, -7.413 ], "x_axis": [ 0.852, 0.055, 0.521 ], "y_axis": [ 0.458, -0.561, -0.689 ], "z_axis": [ 0.254, 0.826, -0.504 ], "quaternion": [ -0.444, 0.854, 0.150, 0.227 ] } }, { "index": 283, "index_chain": 3, "chain_name": "J", "nt_resnum": 1946, "nt_name": "U", "nt_code": "U", "nt_id": "///J/1946", "linked_nts": [ "///J/1945", "///J/1947" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -52.299, "beta": 161.297, "gamma": 43.232, "delta": 82.339, "epsilon": -147.692, "zeta": -77.066, "epsilon_zeta": -70.626, "bb_type": "BI", "chi": -164.600, "glyco_bond": "anti", "C5prime_xyz": [ -1.493, 8.664, 0.844 ], "P_xyz": [ 1.056, 8.905, 1.390 ], "form": "A", "ssZp": 4.471, "Dp": 4.567, "splay_angle": 19.519, "splay_distance": 3.165, "splay_ratio": 0.172, "d22": 4.225, "d64": 4.172, "eta": 161.156, "theta": -143.503, "eta_prime": 176.969, "theta_prime": -144.232, "eta_base": -136.048, "theta_base": -123.982, "v0": 0.257, "v1": -21.906, "v2": 33.918, "v3": -34.862, "v4": 21.831, "amplitude": 35.726, "phase_angle": 18.304, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.543, "filter_rmsd": 0.106, "frame": { "rmsd": 0.002, "origin": [ -8.726, 15.785, -8.040 ], "x_axis": [ 0.929, -0.370, 0.019 ], "y_axis": [ -0.177, -0.490, -0.854 ], "z_axis": [ 0.325, 0.789, -0.521 ], "quaternion": [ -0.479, 0.857, -0.159, 0.100 ] } }, { "index": 284, "index_chain": 4, "chain_name": "J", "nt_resnum": 1947, "nt_name": "C", "nt_code": "C", "nt_id": "///J/1947", "linked_nts": [ "///J/1946", "///J/1948" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -60.081, "beta": 173.023, "gamma": 44.781, "delta": 81.812, "epsilon": -162.181, "zeta": -67.529, "epsilon_zeta": -94.653, "bb_type": "BI", "chi": -158.360, "glyco_bond": "anti", "C5prime_xyz": [ -1.470, 8.802, 0.538 ], "P_xyz": [ 1.056, 9.373, 0.877 ], "form": "A", "ssZp": 4.483, "Dp": 4.505, "splay_angle": 25.153, "splay_distance": 4.018, "splay_ratio": 0.220, "d22": null, "d64": null, "eta": 161.087, "theta": -149.906, "eta_prime": 173.461, "theta_prime": -149.162, "eta_base": -149.702, "theta_base": -126.005, "v0": 0.444, "v1": -22.392, "v2": 34.417, "v3": -35.380, "v4": 22.073, "amplitude": 36.209, "phase_angle": 18.098, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.840, "filter_rmsd": 0.062, "frame": { "rmsd": 0.007, "origin": [ -7.148, 18.528, -8.103 ], "x_axis": [ 0.646, -0.680, -0.345 ], "y_axis": [ -0.582, -0.146, -0.800 ], "z_axis": [ 0.494, 0.718, -0.490 ], "quaternion": [ 0.503, -0.755, 0.418, -0.049 ] } }, { "index": 285, "index_chain": 5, "chain_name": "J", "nt_resnum": 1948, "nt_name": "G", "nt_code": "G", "nt_id": "///J/1948", "linked_nts": [ "///J/1947", "///J/1949" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -67.720, "beta": -174.741, "gamma": 47.632, "delta": 80.938, "epsilon": -157.148, "zeta": -66.445, "epsilon_zeta": -90.704, "bb_type": "BI", "chi": -167.356, "glyco_bond": "anti", "C5prime_xyz": [ -1.556, 8.695, 0.962 ], "P_xyz": [ 0.869, 9.220, 1.793 ], "form": "A", "ssZp": 4.571, "Dp": 4.592, "splay_angle": 22.983, "splay_distance": 3.777, "splay_ratio": 0.208, "d22": null, "d64": null, "eta": 165.829, "theta": -146.641, "eta_prime": 176.532, "theta_prime": -143.282, "eta_base": -146.359, "theta_base": -117.299, "v0": 0.520, "v1": -23.719, "v2": 36.115, "v3": -36.892, "v4": 22.935, "amplitude": 37.921, "phase_angle": 17.754, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.812, "filter_rmsd": 0.005, "frame": { "rmsd": 0.005, "origin": [ -3.927, 20.822, -8.816 ], "x_axis": [ 0.121, -0.836, -0.536 ], "y_axis": [ -0.861, 0.180, -0.476 ], "z_axis": [ 0.494, 0.519, -0.698 ], "quaternion": [ 0.388, -0.640, 0.663, 0.016 ] } }, { "index": 286, "index_chain": 6, "chain_name": "J", "nt_resnum": 1949, "nt_name": "G", "nt_code": "G", "nt_id": "///J/1949", "linked_nts": [ "///J/1948", "///J/1950" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,hairpin-loop", "alpha": -59.579, "beta": -172.416, "gamma": 47.761, "delta": 82.482, "epsilon": -154.757, "zeta": -65.824, "epsilon_zeta": -88.933, "bb_type": "BI", "chi": -153.434, "glyco_bond": "anti", "C5prime_xyz": [ -1.469, 8.852, 0.096 ], "P_xyz": [ 0.977, 9.555, 0.738 ], "form": ".", "ssZp": 4.126, "Dp": 4.489, "splay_angle": 23.873, "splay_distance": 3.797, "splay_ratio": 0.207, "d22": null, "d64": null, "eta": 176.532, "theta": -143.164, "eta_prime": -171.843, "theta_prime": -138.125, "eta_base": -136.435, "theta_base": -92.651, "v0": 0.540, "v1": -22.437, "v2": 34.211, "v3": -34.996, "v4": 21.785, "amplitude": 35.931, "phase_angle": 17.800, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.841, "filter_rmsd": 0.006, "frame": { "rmsd": 0.006, "origin": [ -0.584, 21.053, -10.558 ], "x_axis": [ -0.413, -0.638, -0.650 ], "y_axis": [ -0.736, 0.654, -0.174 ], "z_axis": [ 0.536, 0.407, -0.739 ], "quaternion": [ 0.354, -0.410, 0.838, 0.069 ] } }, { "index": 287, "index_chain": 7, "chain_name": "J", "nt_resnum": 1950, "nt_name": "G", "nt_code": "G", "nt_id": "///J/1950", "linked_nts": [ "///J/1949", "///J/1951" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,hairpin-loop", "alpha": -68.180, "beta": 177.213, "gamma": 52.926, "delta": 84.482, "epsilon": -133.578, "zeta": -66.673, "epsilon_zeta": -66.905, "bb_type": "BI", "chi": -146.649, "glyco_bond": "anti", "C5prime_xyz": [ -1.221, 8.744, -0.219 ], "P_xyz": [ 1.392, 9.009, -0.213 ], "form": ".", "ssZp": 3.813, "Dp": 4.656, "splay_angle": 29.083, "splay_distance": 4.806, "splay_ratio": 0.251, "d22": null, "d64": null, "eta": 171.832, "theta": -123.107, "eta_prime": -172.700, "theta_prime": -120.535, "eta_base": -118.438, "theta_base": -95.590, "v0": 1.979, "v1": -23.264, "v2": 34.394, "v3": -34.327, "v4": 20.411, "amplitude": 35.704, "phase_angle": 15.570, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.932, "filter_rmsd": 0.001, "frame": { "rmsd": 0.001, "origin": [ 0.115, 21.140, -14.290 ], "x_axis": [ -0.867, -0.056, -0.496 ], "y_axis": [ -0.177, 0.963, 0.201 ], "z_axis": [ 0.467, 0.262, -0.845 ], "quaternion": [ 0.251, -0.061, 0.958, 0.121 ] } }, { "index": 288, "index_chain": 8, "chain_name": "J", "nt_resnum": 1951, "nt_name": "U", "nt_code": "U", "nt_id": "///J/1951", "linked_nts": [ "///J/1950", "///J/1952" ], "nt_type": "RNA", "dbn": ".", "summary": "u-turn,anti,~C3'-endo,BI,non-pair-contact,hairpin-loop,cap-acceptor", "alpha": -72.102, "beta": -171.500, "gamma": 44.023, "delta": 85.105, "epsilon": -153.255, "zeta": -56.039, "epsilon_zeta": -97.216, "bb_type": "BI", "chi": -142.811, "glyco_bond": "anti", "C5prime_xyz": [ -1.527, 8.766, -0.480 ], "P_xyz": [ 0.944, 9.560, -0.108 ], "form": ".", "ssZp": 3.780, "Dp": 4.462, "splay_angle": 81.300, "splay_distance": 12.228, "splay_ratio": 0.651, "d22": null, "d64": null, "eta": 159.284, "theta": -116.115, "eta_prime": 176.512, "theta_prime": -158.127, "eta_base": -146.758, "theta_base": 151.049, "v0": -0.782, "v1": -21.093, "v2": 33.565, "v3": -35.045, "v4": 22.632, "amplitude": 35.693, "phase_angle": 19.886, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.701, "filter_rmsd": 0.104, "frame": { "rmsd": 0.002, "origin": [ -0.763, 22.283, -18.875 ], "x_axis": [ -0.884, 0.240, 0.401 ], "y_axis": [ 0.400, 0.833, 0.383 ], "z_axis": [ -0.242, 0.499, -0.832 ], "quaternion": [ -0.171, 0.170, 0.942, 0.234 ] } }, { "index": 289, "index_chain": 9, "chain_name": "J", "nt_resnum": 1952, "nt_name": "A", "nt_code": "A", "nt_id": "///J/1952", "linked_nts": [ "///J/1951", "///J/1953" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,u-turn,anti,~C3'-endo,non-canonical,non-pair-contact,multiplet,hairpin-loop,A-minor,ribose-zipper", "alpha": 164.399, "beta": 152.105, "gamma": 51.223, "delta": 86.448, "epsilon": -126.774, "zeta": -73.900, "epsilon_zeta": -52.874, "bb_type": "--", "chi": -158.202, "glyco_bond": "anti", "C5prime_xyz": [ -1.739, 8.835, 0.321 ], "P_xyz": [ 0.848, 9.220, 0.585 ], "form": "B", "ssZp": 3.819, "Dp": 4.294, "splay_angle": 20.289, "splay_distance": 3.383, "splay_ratio": 0.178, "d22": null, "d64": null, "eta": 26.136, "theta": -122.132, "eta_prime": 47.367, "theta_prime": -123.199, "eta_base": 25.807, "theta_base": -75.886, "v0": -4.274, "v1": -16.860, "v2": 30.280, "v3": -33.778, "v4": 24.019, "amplitude": 33.655, "phase_angle": 25.879, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1g", "suiteness": 0.796, "filter_rmsd": 0.038, "frame": { "rmsd": 0.006, "origin": [ 8.551, 25.376, -26.170 ], "x_axis": [ 0.794, 0.160, 0.587 ], "y_axis": [ -0.554, 0.586, 0.591 ], "z_axis": [ -0.249, -0.794, 0.554 ], "quaternion": [ 0.856, 0.404, -0.244, 0.208 ] } }, { "index": 290, "index_chain": 10, "chain_name": "J", "nt_resnum": 1953, "nt_name": "A", "nt_code": "A", "nt_id": "///J/1953", "linked_nts": [ "///J/1952", "///J/1954" ], "nt_type": "RNA", "dbn": ".", "summary": "u-turn,anti,~C3'-endo,BI,non-canonical,non-pair-contact,multiplet,hairpin-loop,A-minor,ribose-zipper,cap-donor,cap-acceptor,phosphate", "alpha": -71.159, "beta": 161.054, "gamma": 54.730, "delta": 85.251, "epsilon": -135.623, "zeta": -55.522, "epsilon_zeta": -80.102, "bb_type": "BI", "chi": -132.307, "glyco_bond": "anti", "C5prime_xyz": [ -1.700, 8.653, -1.102 ], "P_xyz": [ 0.762, 8.960, -1.950 ], "form": ".", "ssZp": 3.053, "Dp": 4.508, "splay_angle": 58.422, "splay_distance": 9.667, "splay_ratio": 0.488, "d22": null, "d64": null, "eta": 155.852, "theta": -121.667, "eta_prime": 177.568, "theta_prime": -113.110, "eta_base": -121.255, "theta_base": -104.161, "v0": -0.340, "v1": -21.252, "v2": 33.265, "v3": -34.583, "v4": 22.111, "amplitude": 35.238, "phase_angle": 19.265, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.667, "filter_rmsd": 0.038, "frame": { "rmsd": 0.002, "origin": [ 8.903, 24.268, -22.993 ], "x_axis": [ 0.219, 0.668, 0.711 ], "y_axis": [ -0.964, 0.036, 0.262 ], "z_axis": [ 0.149, -0.743, 0.652 ], "quaternion": [ 0.691, 0.364, -0.203, 0.591 ] } }, { "index": 291, "index_chain": 11, "chain_name": "J", "nt_resnum": 1954, "nt_name": "G", "nt_code": "G", "nt_id": "///J/1954", "linked_nts": [ "///J/1953", "///J/1955" ], "nt_type": "RNA", "dbn": ".", "summary": "u-turn,anti,~C2'-endo,non-canonical,non-pair-contact,hairpin-loop,phosphate,splayed-apart", "alpha": -68.517, "beta": -127.259, "gamma": 43.936, "delta": 149.856, "epsilon": -153.816, "zeta": -178.580, "epsilon_zeta": 24.765, "bb_type": "--", "chi": -100.492, "glyco_bond": "anti", "C5prime_xyz": [ -2.225, 8.089, -2.066 ], "P_xyz": [ -0.571, 9.819, -0.991 ], "form": ".", "ssZp": 1.538, "Dp": 1.639, "splay_angle": 115.172, "splay_distance": 18.077, "splay_ratio": 0.845, "d22": null, "d64": null, "eta": -167.471, "theta": 145.624, "eta_prime": -143.358, "theta_prime": 129.800, "eta_base": -136.219, "theta_base": 121.085, "v0": -18.321, "v1": 32.768, "v2": -34.233, "v3": 24.690, "v4": -4.167, "amplitude": 34.987, "phase_angle": 168.085, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1[", "suiteness": 0.649, "filter_rmsd": 0.003, "frame": { "rmsd": 0.003, "origin": [ 7.307, 22.352, -13.653 ], "x_axis": [ -0.029, 0.994, -0.108 ], "y_axis": [ -0.803, -0.088, -0.589 ], "z_axis": [ -0.595, 0.069, 0.801 ], "quaternion": [ 0.649, -0.254, -0.188, 0.692 ] } }, { "index": 292, "index_chain": 12, "chain_name": "J", "nt_resnum": 1955, "nt_name": "U", "nt_code": "U", "nt_id": "///J/1955", "linked_nts": [ "///J/1954", "///J/1956" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,anti,~C2'-endo,non-canonical,non-pair-contact,multiplet,hairpin-loop,cap-donor,phosphate,splayed-apart", "alpha": -75.488, "beta": -146.962, "gamma": -73.267, "delta": 142.795, "epsilon": -120.554, "zeta": -39.822, "epsilon_zeta": -80.732, "bb_type": "--", "chi": -132.189, "glyco_bond": "anti", "C5prime_xyz": [ -2.232, 8.733, -0.747 ], "P_xyz": [ -2.629, 11.207, -1.541 ], "form": ".", "ssZp": 1.193, "Dp": 1.303, "splay_angle": 121.107, "splay_distance": 16.529, "splay_ratio": 0.871, "d22": 8.457, "d64": 10.863, "eta": 126.762, "theta": -91.572, "eta_prime": 97.230, "theta_prime": -81.298, "eta_base": 82.285, "theta_base": -49.221, "v0": -24.610, "v1": 36.226, "v2": -33.227, "v3": 20.110, "v4": 2.559, "amplitude": 36.081, "phase_angle": 157.058, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22m", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.104, "frame": { "rmsd": 0.003, "origin": [ 3.789, 5.571, -19.378 ], "x_axis": [ 0.469, 0.148, -0.871 ], "y_axis": [ -0.087, 0.989, 0.122 ], "z_axis": [ 0.879, 0.018, 0.477 ], "quaternion": [ 0.856, 0.030, 0.511, 0.069 ] } }, { "index": 293, "index_chain": 13, "chain_name": "J", "nt_resnum": 1956, "nt_name": "U", "nt_code": "U", "nt_id": "///J/1956", "linked_nts": [ "///J/1955", "///J/1957" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,hairpin-loop,splayed-apart", "alpha": -91.112, "beta": -161.126, "gamma": 63.591, "delta": 86.068, "epsilon": -152.236, "zeta": -48.352, "epsilon_zeta": -103.884, "bb_type": "BI", "chi": -167.809, "glyco_bond": "anti", "C5prime_xyz": [ -1.454, 8.641, 0.963 ], "P_xyz": [ 1.063, 8.935, 1.667 ], "form": ".", "ssZp": 4.530, "Dp": 4.544, "splay_angle": 35.991, "splay_distance": 5.672, "splay_ratio": 0.311, "d22": 3.650, "d64": 4.273, "eta": 157.778, "theta": -120.021, "eta_prime": -155.326, "theta_prime": -118.428, "eta_base": -127.626, "theta_base": -79.243, "v0": 1.610, "v1": -23.457, "v2": 34.887, "v3": -34.926, "v4": 21.001, "amplitude": 36.299, "phase_angle": 16.035, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "2a", "suiteness": 0.229, "filter_rmsd": 0.103, "frame": { "rmsd": 0.003, "origin": [ 4.829, 20.464, -12.284 ], "x_axis": [ -0.783, 0.217, -0.583 ], "y_axis": [ -0.198, -0.975, -0.098 ], "z_axis": [ -0.590, 0.039, 0.806 ], "quaternion": [ 0.110, -0.311, -0.016, 0.944 ] } }, { "index": 294, "index_chain": 14, "chain_name": "J", "nt_resnum": 1957, "nt_name": "C", "nt_code": "C", "nt_id": "///J/1957", "linked_nts": [ "///J/1956", "///J/1958" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,hairpin-loop", "alpha": -74.889, "beta": -172.502, "gamma": 51.569, "delta": 83.010, "epsilon": -142.691, "zeta": -79.497, "epsilon_zeta": -63.193, "bb_type": "BI", "chi": -172.804, "glyco_bond": "anti", "C5prime_xyz": [ -1.514, 8.671, 1.284 ], "P_xyz": [ 0.867, 9.130, 2.290 ], "form": "A", "ssZp": 4.608, "Dp": 4.553, "splay_angle": 24.921, "splay_distance": 3.945, "splay_ratio": 0.217, "d22": 4.461, "d64": 4.427, "eta": 168.468, "theta": -147.094, "eta_prime": -168.406, "theta_prime": -142.683, "eta_base": -107.639, "theta_base": -113.168, "v0": -0.010, "v1": -21.520, "v2": 33.608, "v3": -34.720, "v4": 21.925, "amplitude": 35.494, "phase_angle": 18.762, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.577, "filter_rmsd": 0.062, "frame": { "rmsd": 0.005, "origin": [ -0.622, 21.083, -10.841 ], "x_axis": [ -0.461, -0.638, -0.617 ], "y_axis": [ 0.647, -0.717, 0.259 ], "z_axis": [ -0.608, -0.279, 0.743 ], "quaternion": [ -0.376, -0.358, -0.006, 0.855 ] } }, { "index": 295, "index_chain": 15, "chain_name": "J", "nt_resnum": 1958, "nt_name": "C", "nt_code": "C", "nt_id": "///J/1958", "linked_nts": [ "///J/1957", "///J/1959" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -56.612, "beta": 174.172, "gamma": 38.913, "delta": 81.460, "epsilon": -159.730, "zeta": -65.463, "epsilon_zeta": -94.267, "bb_type": "BI", "chi": -165.109, "glyco_bond": "anti", "C5prime_xyz": [ -1.346, 8.695, 0.894 ], "P_xyz": [ 1.152, 9.083, 1.573 ], "form": "A", "ssZp": 4.604, "Dp": 4.580, "splay_angle": 23.949, "splay_distance": 3.827, "splay_ratio": 0.213, "d22": null, "d64": null, "eta": 160.810, "theta": -147.177, "eta_prime": 174.130, "theta_prime": -143.843, "eta_base": -143.057, "theta_base": -119.996, "v0": 1.660, "v1": -24.428, "v2": 36.210, "v3": -36.324, "v4": 21.817, "amplitude": 37.678, "phase_angle": 16.046, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.602, "filter_rmsd": 0.062, "frame": { "rmsd": 0.005, "origin": [ -4.066, 20.689, -8.959 ], "x_axis": [ 0.098, -0.876, -0.472 ], "y_axis": [ 0.817, -0.200, 0.541 ], "z_axis": [ -0.568, -0.438, 0.696 ], "quaternion": [ 0.631, 0.388, -0.038, -0.671 ] } }, { "index": 296, "index_chain": 16, "chain_name": "J", "nt_resnum": 1959, "nt_name": "G", "nt_code": "G", "nt_id": "///J/1959", "linked_nts": [ "///J/1958", "///J/1960" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -64.638, "beta": -171.854, "gamma": 49.038, "delta": 83.362, "epsilon": -164.740, "zeta": -72.831, "epsilon_zeta": -91.909, "bb_type": "BI", "chi": -161.743, "glyco_bond": "anti", "C5prime_xyz": [ -1.544, 8.755, 0.576 ], "P_xyz": [ 0.845, 9.267, 1.518 ], "form": "A", "ssZp": 4.234, "Dp": 4.425, "splay_angle": 20.056, "splay_distance": 3.569, "splay_ratio": 0.187, "d22": null, "d64": null, "eta": 172.806, "theta": -125.921, "eta_prime": -174.446, "theta_prime": -132.957, "eta_base": -138.910, "theta_base": -107.317, "v0": 0.919, "v1": -22.910, "v2": 34.567, "v3": -35.153, "v4": 21.569, "amplitude": 36.182, "phase_angle": 17.181, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.829, "filter_rmsd": 0.010, "frame": { "rmsd": 0.010, "origin": [ -7.331, 18.848, -8.185 ], "x_axis": [ 0.631, -0.726, -0.271 ], "y_axis": [ 0.636, 0.285, 0.717 ], "z_axis": [ -0.443, -0.625, 0.642 ], "quaternion": [ 0.800, 0.420, -0.054, -0.426 ] } }, { "index": 297, "index_chain": 17, "chain_name": "J", "nt_resnum": 1960, "nt_name": "A", "nt_code": "A", "nt_id": "///J/1960", "linked_nts": [ "///J/1959", "///J/1961" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": 154.771, "beta": -162.258, "gamma": 177.267, "delta": 86.492, "epsilon": -132.842, "zeta": -82.346, "epsilon_zeta": -50.496, "bb_type": "BI", "chi": -173.694, "glyco_bond": "anti", "C5prime_xyz": [ -1.621, 8.497, 1.271 ], "P_xyz": [ 0.123, 10.205, 0.324 ], "form": "A", "ssZp": 4.236, "Dp": 4.516, "splay_angle": 20.892, "splay_distance": 3.458, "splay_ratio": 0.184, "d22": null, "d64": null, "eta": 168.066, "theta": -162.047, "eta_prime": -176.444, "theta_prime": -156.174, "eta_base": -133.256, "theta_base": -127.753, "v0": 2.589, "v1": -22.302, "v2": 32.358, "v3": -32.090, "v4": 18.627, "amplitude": 33.428, "phase_angle": 14.538, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.948, "filter_rmsd": 0.039, "frame": { "rmsd": 0.012, "origin": [ -8.727, 15.564, -8.113 ], "x_axis": [ 0.916, -0.395, 0.074 ], "y_axis": [ 0.166, 0.540, 0.825 ], "z_axis": [ -0.366, -0.743, 0.560 ], "quaternion": [ 0.868, 0.452, -0.127, -0.161 ] } }, { "index": 298, "index_chain": 18, "chain_name": "J", "nt_resnum": 1961, "nt_name": "C", "nt_code": "C", "nt_id": "///J/1961", "linked_nts": [ "///J/1960", null ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix-end,stem-end", "alpha": -48.680, "beta": 165.043, "gamma": 47.483, "delta": 86.954, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": -147.315, "glyco_bond": "anti", "C5prime_xyz": [ -1.726, 8.925, -0.406 ], "P_xyz": [ 0.771, 9.666, -0.115 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": -4.808, "v1": -15.493, "v2": 28.748, "v3": -32.634, "v4": 23.598, "amplitude": 32.333, "phase_angle": 27.239, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.605, "filter_rmsd": 0.063, "frame": { "rmsd": 0.008, "origin": [ -9.457, 12.239, -7.499 ], "x_axis": [ 0.865, 0.015, 0.501 ], "y_axis": [ -0.422, 0.562, 0.711 ], "z_axis": [ -0.271, -0.827, 0.493 ], "quaternion": [ 0.854, 0.450, -0.226, 0.128 ] } }, { "index": 299, "index_chain": 1, "chain_name": "K", "nt_resnum": 2547, "nt_name": "A", "nt_code": "A", "nt_id": "///K/2547", "linked_nts": [ null, "///K/2548" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end", "alpha": null, "beta": 175.404, "gamma": 46.925, "delta": 75.049, "epsilon": -173.003, "zeta": -85.473, "epsilon_zeta": -87.530, "bb_type": "BI", "chi": -151.078, "glyco_bond": "anti", "C5prime_xyz": [ -2.625, 8.897, -0.203 ], "P_xyz": [ -0.642, 10.580, -0.285 ], "form": "A", "ssZp": 4.196, "Dp": 4.257, "splay_angle": 21.306, "splay_distance": 3.371, "splay_ratio": 0.185, "d22": null, "d64": null, "eta": null, "theta": 177.567, "eta_prime": null, "theta_prime": 179.982, "eta_base": null, "theta_base": -153.666, "v0": -11.599, "v1": -15.149, "v2": 33.974, "v3": -41.539, "v4": 33.604, "amplitude": 41.174, "phase_angle": 34.400, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.036, "frame": { "rmsd": 0.008, "origin": [ 7.202, 20.459, -32.962 ], "x_axis": [ -0.663, -0.748, -0.041 ], "y_axis": [ 0.677, -0.575, -0.459 ], "z_axis": [ 0.320, -0.332, 0.887 ], "quaternion": [ -0.403, 0.079, -0.224, 0.884 ] } }, { "index": 300, "index_chain": 2, "chain_name": "K", "nt_resnum": 2548, "nt_name": "U", "nt_code": "U", "nt_id": "///K/2548", "linked_nts": [ "///K/2547", "///K/2549" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,multiplet,A-minor", "alpha": -59.364, "beta": 170.475, "gamma": 54.731, "delta": 86.140, "epsilon": -165.133, "zeta": -70.596, "epsilon_zeta": -94.537, "bb_type": "BI", "chi": -155.492, "glyco_bond": "anti", "C5prime_xyz": [ -1.408, 8.753, 0.259 ], "P_xyz": [ 1.190, 9.111, 0.431 ], "form": ".", "ssZp": 4.140, "Dp": 4.358, "splay_angle": 20.954, "splay_distance": 3.770, "splay_ratio": 0.193, "d22": null, "d64": null, "eta": 174.013, "theta": -119.038, "eta_prime": -178.523, "theta_prime": -132.558, "eta_base": -147.454, "theta_base": -111.126, "v0": 1.185, "v1": -22.051, "v2": 33.258, "v3": -33.607, "v4": 20.490, "amplitude": 34.737, "phase_angle": 16.778, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.528, "filter_rmsd": 0.105, "frame": { "rmsd": 0.003, "origin": [ 7.411, 20.344, -29.599 ], "x_axis": [ -0.279, -0.906, -0.317 ], "y_axis": [ 0.934, -0.180, -0.309 ], "z_axis": [ 0.224, -0.382, 0.897 ], "quaternion": [ 0.600, 0.030, 0.225, -0.767 ] } }, { "index": 301, "index_chain": 3, "chain_name": "K", "nt_resnum": 2549, "nt_name": "G", "nt_code": "G", "nt_id": "///K/2549", "linked_nts": [ "///K/2548", "///K/2550" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,multiplet,A-minor", "alpha": 142.418, "beta": -162.283, "gamma": -177.903, "delta": 83.423, "epsilon": -156.813, "zeta": -66.660, "epsilon_zeta": -90.153, "bb_type": "BI", "chi": -178.867, "glyco_bond": "anti", "C5prime_xyz": [ -1.550, 8.444, 1.602 ], "P_xyz": [ -0.038, 10.388, 0.701 ], "form": "A", "ssZp": 4.453, "Dp": 4.540, "splay_angle": 23.527, "splay_distance": 3.704, "splay_ratio": 0.210, "d22": null, "d64": null, "eta": 157.975, "theta": -170.853, "eta_prime": 177.573, "theta_prime": -164.757, "eta_base": -134.875, "theta_base": -139.499, "v0": 2.799, "v1": -24.427, "v2": 35.302, "v3": -34.729, "v4": 20.125, "amplitude": 36.425, "phase_angle": 14.267, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.829, "filter_rmsd": 0.004, "frame": { "rmsd": 0.004, "origin": [ 6.073, 18.058, -26.916 ], "x_axis": [ 0.180, -0.803, -0.568 ], "y_axis": [ 0.960, 0.269, -0.075 ], "z_axis": [ 0.213, -0.532, 0.819 ], "quaternion": [ 0.753, 0.152, 0.259, -0.585 ] } }, { "index": 302, "index_chain": 4, "chain_name": "K", "nt_resnum": 2550, "nt_name": "G", "nt_code": "G", "nt_id": "///K/2550", "linked_nts": [ "///K/2549", "///K/2551" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,cap-donor", "alpha": -81.290, "beta": -152.715, "gamma": 46.640, "delta": 83.100, "epsilon": -149.079, "zeta": -63.684, "epsilon_zeta": -85.395, "bb_type": "BI", "chi": -153.782, "glyco_bond": "anti", "C5prime_xyz": [ -1.202, 8.731, 0.160 ], "P_xyz": [ 1.166, 9.118, 1.223 ], "form": "A", "ssZp": 4.181, "Dp": 4.616, "splay_angle": 21.742, "splay_distance": 3.631, "splay_ratio": 0.192, "d22": null, "d64": null, "eta": 169.414, "theta": -136.703, "eta_prime": 175.585, "theta_prime": -131.646, "eta_base": -154.984, "theta_base": -104.484, "v0": 2.688, "v1": -24.178, "v2": 35.254, "v3": -34.778, "v4": 20.199, "amplitude": 36.418, "phase_angle": 14.525, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1m", "suiteness": 0.604, "filter_rmsd": 0.006, "frame": { "rmsd": 0.006, "origin": [ 4.674, 15.615, -24.509 ], "x_axis": [ 0.673, -0.382, -0.633 ], "y_axis": [ 0.677, 0.664, 0.319 ], "z_axis": [ 0.298, -0.643, 0.706 ], "quaternion": [ 0.872, 0.276, 0.267, -0.304 ] } }, { "index": 303, "index_chain": 5, "chain_name": "K", "nt_resnum": 2551, "nt_name": "C", "nt_code": "C", "nt_id": "///K/2551", "linked_nts": [ "///K/2550", "///K/2552" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,hairpin-loop", "alpha": -60.738, "beta": -175.804, "gamma": 41.690, "delta": 82.751, "epsilon": -150.972, "zeta": -68.108, "epsilon_zeta": -82.865, "bb_type": "BI", "chi": -143.815, "glyco_bond": "anti", "C5prime_xyz": [ -1.555, 8.885, -0.381 ], "P_xyz": [ 0.889, 9.761, -0.037 ], "form": ".", "ssZp": 3.857, "Dp": 4.457, "splay_angle": 24.574, "splay_distance": 3.987, "splay_ratio": 0.214, "d22": 3.751, "d64": 3.254, "eta": 167.539, "theta": -142.717, "eta_prime": -178.028, "theta_prime": -137.817, "eta_base": -141.330, "theta_base": -92.737, "v0": -4.412, "v1": -17.966, "v2": 32.321, "v3": -35.901, "v4": 25.411, "amplitude": 35.853, "phase_angle": 25.646, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.717, "filter_rmsd": 0.061, "frame": { "rmsd": 0.003, "origin": [ 5.963, 12.304, -23.763 ], "x_axis": [ 0.797, 0.240, -0.554 ], "y_axis": [ 0.283, 0.662, 0.694 ], "z_axis": [ 0.534, -0.710, 0.459 ], "quaternion": [ 0.854, 0.411, 0.319, -0.013 ] } }, { "index": 304, "index_chain": 6, "chain_name": "K", "nt_resnum": 2552, "nt_name": "U", "nt_code": "U", "nt_id": "///K/2552", "linked_nts": [ "///K/2551", "///K/2553" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,multiplet,hairpin-loop,cap-acceptor", "alpha": -75.289, "beta": 172.494, "gamma": 59.959, "delta": 86.388, "epsilon": -133.143, "zeta": -57.541, "epsilon_zeta": -75.603, "bb_type": "BI", "chi": -149.569, "glyco_bond": "anti", "C5prime_xyz": [ -1.324, 8.728, -0.054 ], "P_xyz": [ 1.262, 9.022, -0.405 ], "form": ".", "ssZp": 4.010, "Dp": 4.641, "splay_angle": 74.732, "splay_distance": 11.268, "splay_ratio": 0.607, "d22": null, "d64": null, "eta": 167.423, "theta": -89.575, "eta_prime": -175.880, "theta_prime": -136.924, "eta_base": -121.748, "theta_base": 164.555, "v0": 2.530, "v1": -23.509, "v2": 34.180, "v3": -33.814, "v4": 19.785, "amplitude": 35.333, "phase_angle": 14.682, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.818, "filter_rmsd": 0.104, "frame": { "rmsd": 0.003, "origin": [ 9.764, 11.229, -23.228 ], "x_axis": [ 0.579, 0.812, -0.072 ], "y_axis": [ -0.196, 0.224, 0.955 ], "z_axis": [ 0.791, -0.539, 0.289 ], "quaternion": [ 0.723, 0.516, 0.298, 0.349 ] } }, { "index": 305, "index_chain": 7, "chain_name": "K", "nt_resnum": 2553, "nt_name": "G", "nt_code": "G", "nt_id": "///K/2553", "linked_nts": [ "///K/2552", "///K/2554" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,anti,~C3'-endo,non-pair-contact,hairpin-loop,cap-acceptor", "alpha": 153.224, "beta": 161.563, "gamma": 52.554, "delta": 81.500, "epsilon": -113.694, "zeta": -84.227, "epsilon_zeta": -29.467, "bb_type": "--", "chi": -154.104, "glyco_bond": "anti", "C5prime_xyz": [ -1.286, 8.789, 0.189 ], "P_xyz": [ 1.325, 9.015, 0.054 ], "form": ".", "ssZp": 4.000, "Dp": 4.724, "splay_angle": 24.700, "splay_distance": 4.569, "splay_ratio": 0.224, "d22": null, "d64": null, "eta": 11.033, "theta": -107.300, "eta_prime": 42.904, "theta_prime": -114.877, "eta_base": 24.092, "theta_base": -96.309, "v0": 2.096, "v1": -23.990, "v2": 35.052, "v3": -34.946, "v4": 20.798, "amplitude": 36.352, "phase_angle": 15.372, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1g", "suiteness": 0.718, "filter_rmsd": 0.002, "frame": { "rmsd": 0.002, "origin": [ 10.077, 1.033, -18.442 ], "x_axis": [ -0.941, -0.031, 0.336 ], "y_axis": [ 0.129, 0.887, 0.443 ], "z_axis": [ -0.312, 0.461, -0.831 ], "quaternion": [ -0.169, 0.025, 0.956, 0.236 ] } }, { "index": 306, "index_chain": 8, "chain_name": "K", "nt_resnum": 2554, "nt_name": "U", "nt_code": "U", "nt_id": "///K/2554", "linked_nts": [ "///K/2553", "///K/2555" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,hairpin-loop,cap-donor,phosphate", "alpha": 72.725, "beta": -111.037, "gamma": -93.118, "delta": 94.258, "epsilon": -143.277, "zeta": -69.617, "epsilon_zeta": -73.661, "bb_type": "BI", "chi": -133.829, "glyco_bond": "anti", "C5prime_xyz": [ -1.037, 8.403, -1.008 ], "P_xyz": [ -1.519, 10.497, -2.488 ], "form": ".", "ssZp": 3.087, "Dp": 4.470, "splay_angle": 20.596, "splay_distance": 3.516, "splay_ratio": 0.179, "d22": 4.201, "d64": 3.987, "eta": -148.622, "theta": 165.982, "eta_prime": -139.892, "theta_prime": 176.377, "eta_base": -104.613, "theta_base": 165.405, "v0": 8.700, "v1": -25.028, "v2": 30.824, "v3": -27.071, "v4": 11.707, "amplitude": 30.868, "phase_angle": 3.047, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33m", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.105, "frame": { "rmsd": 0.006, "origin": [ 5.985, 1.398, -20.443 ], "x_axis": [ -0.902, 0.430, 0.032 ], "y_axis": [ 0.427, 0.901, -0.077 ], "z_axis": [ -0.062, -0.055, -0.997 ], "quaternion": [ -0.024, 0.220, 0.975, -0.034 ] } }, { "index": 307, "index_chain": 9, "chain_name": "K", "nt_resnum": 2555, "nt_name": "U", "nt_code": "U", "nt_id": "///K/2555", "linked_nts": [ "///K/2554", "///K/2556" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-pair-contact,hairpin-loop", "alpha": -100.172, "beta": 168.459, "gamma": 67.216, "delta": 81.116, "epsilon": -133.790, "zeta": -37.775, "epsilon_zeta": -96.016, "bb_type": "--", "chi": -133.062, "glyco_bond": "anti", "C5prime_xyz": [ -2.133, 8.781, -1.050 ], "P_xyz": [ 0.056, 9.503, -2.292 ], "form": ".", "ssZp": 3.226, "Dp": 4.481, "splay_angle": 48.960, "splay_distance": 8.162, "splay_ratio": 0.414, "d22": 3.416, "d64": 4.687, "eta": 144.586, "theta": -101.375, "eta_prime": 158.543, "theta_prime": -97.031, "eta_base": 151.829, "theta_base": -55.475, "v0": -7.617, "v1": -16.746, "v2": 32.938, "v3": -38.197, "v4": 28.850, "amplitude": 37.935, "phase_angle": 29.741, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.100, "filter_rmsd": 0.104, "frame": { "rmsd": 0.007, "origin": [ 6.794, 0.030, -23.580 ], "x_axis": [ -0.738, 0.491, 0.463 ], "y_axis": [ 0.403, 0.871, -0.280 ], "z_axis": [ -0.541, -0.020, -0.841 ], "quaternion": [ -0.270, 0.241, 0.929, -0.081 ] } }, { "index": 308, "index_chain": 10, "chain_name": "K", "nt_resnum": 2556, "nt_name": "C", "nt_code": "C", "nt_id": "///K/2556", "linked_nts": [ "///K/2555", "///K/2557" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,multiplet,hairpin-loop", "alpha": -72.484, "beta": 174.308, "gamma": 56.378, "delta": 81.187, "epsilon": -155.334, "zeta": -56.278, "epsilon_zeta": -99.057, "bb_type": "BI", "chi": -152.364, "glyco_bond": "anti", "C5prime_xyz": [ -1.659, 8.948, -0.012 ], "P_xyz": [ 0.825, 9.773, -0.206 ], "form": ".", "ssZp": 4.232, "Dp": 4.487, "splay_angle": 32.919, "splay_distance": 5.197, "splay_ratio": 0.283, "d22": null, "d64": null, "eta": 154.434, "theta": -135.055, "eta_prime": -165.689, "theta_prime": -131.277, "eta_base": -102.233, "theta_base": -80.544, "v0": -2.662, "v1": -20.530, "v2": 34.293, "v3": -36.800, "v4": 24.916, "amplitude": 37.135, "phase_angle": 22.561, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.313, "filter_rmsd": 0.062, "frame": { "rmsd": 0.003, "origin": [ 4.447, 7.701, -22.077 ], "x_axis": [ 0.632, 0.719, 0.288 ], "y_axis": [ 0.538, -0.140, -0.831 ], "z_axis": [ -0.557, 0.681, -0.475 ], "quaternion": [ 0.504, -0.750, -0.419, 0.090 ] } }, { "index": 309, "index_chain": 11, "chain_name": "K", "nt_resnum": 2557, "nt_name": "G", "nt_code": "G", "nt_id": "///K/2557", "linked_nts": [ "///K/2556", "///K/2558" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,hairpin-loop", "alpha": -72.220, "beta": 167.636, "gamma": 64.229, "delta": 83.450, "epsilon": -143.291, "zeta": -83.700, "epsilon_zeta": -59.591, "bb_type": "BI", "chi": -163.001, "glyco_bond": "anti", "C5prime_xyz": [ -1.304, 8.738, 0.751 ], "P_xyz": [ 1.307, 9.033, 0.591 ], "form": "A", "ssZp": 4.514, "Dp": 4.618, "splay_angle": 21.205, "splay_distance": 3.339, "splay_ratio": 0.184, "d22": null, "d64": null, "eta": 167.883, "theta": -147.546, "eta_prime": -165.227, "theta_prime": -148.452, "eta_base": -94.276, "theta_base": -127.570, "v0": 1.551, "v1": -23.016, "v2": 34.527, "v3": -34.643, "v4": 20.892, "amplitude": 35.963, "phase_angle": 16.248, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.685, "filter_rmsd": 0.005, "frame": { "rmsd": 0.005, "origin": [ 5.857, 12.430, -23.707 ], "x_axis": [ 0.844, 0.232, -0.484 ], "y_axis": [ -0.249, -0.629, -0.736 ], "z_axis": [ -0.476, 0.741, -0.473 ], "quaternion": [ -0.430, 0.858, -0.005, -0.280 ] } }, { "index": 310, "index_chain": 12, "chain_name": "K", "nt_resnum": 2558, "nt_name": "C", "nt_code": "C", "nt_id": "///K/2558", "linked_nts": [ "///K/2557", "///K/2559" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -61.842, "beta": 170.853, "gamma": 44.553, "delta": 84.486, "epsilon": -153.282, "zeta": -66.758, "epsilon_zeta": -86.524, "bb_type": "BI", "chi": -160.279, "glyco_bond": "anti", "C5prime_xyz": [ -1.194, 8.708, 0.627 ], "P_xyz": [ 1.401, 8.959, 0.924 ], "form": "A", "ssZp": 4.529, "Dp": 4.593, "splay_angle": 23.350, "splay_distance": 3.764, "splay_ratio": 0.205, "d22": 3.867, "d64": 4.123, "eta": 161.633, "theta": -138.788, "eta_prime": 172.440, "theta_prime": -137.869, "eta_base": -151.991, "theta_base": -109.182, "v0": 2.066, "v1": -23.581, "v2": 34.842, "v3": -34.654, "v4": 20.568, "amplitude": 36.143, "phase_angle": 15.419, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.772, "filter_rmsd": 0.063, "frame": { "rmsd": 0.006, "origin": [ 5.008, 15.542, -24.569 ], "x_axis": [ 0.675, -0.338, -0.655 ], "y_axis": [ -0.697, -0.582, -0.418 ], "z_axis": [ -0.240, 0.739, -0.629 ], "quaternion": [ -0.340, 0.850, -0.305, -0.264 ] } }, { "index": 311, "index_chain": 13, "chain_name": "K", "nt_resnum": 2559, "nt_name": "C", "nt_code": "C", "nt_id": "///K/2559", "linked_nts": [ "///K/2558", "///K/2560" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,multiplet,A-minor,ribose-zipper", "alpha": -61.802, "beta": 173.675, "gamma": 52.117, "delta": 81.226, "epsilon": -158.871, "zeta": -71.121, "epsilon_zeta": -87.750, "bb_type": "BI", "chi": -164.600, "glyco_bond": "anti", "C5prime_xyz": [ -1.512, 8.810, 0.765 ], "P_xyz": [ 1.012, 9.355, 1.211 ], "form": "A", "ssZp": 4.463, "Dp": 4.514, "splay_angle": 23.514, "splay_distance": 3.781, "splay_ratio": 0.207, "d22": null, "d64": null, "eta": 166.407, "theta": -150.755, "eta_prime": -175.634, "theta_prime": -149.776, "eta_base": -128.227, "theta_base": -131.216, "v0": -1.119, "v1": -21.915, "v2": 35.043, "v3": -36.655, "v4": 23.787, "amplitude": 37.335, "phase_angle": 20.184, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.951, "filter_rmsd": 0.062, "frame": { "rmsd": 0.002, "origin": [ 6.185, 18.045, -27.122 ], "x_axis": [ 0.194, -0.734, -0.650 ], "y_axis": [ -0.966, -0.260, 0.005 ], "z_axis": [ -0.172, 0.627, -0.760 ], "quaternion": [ -0.209, 0.744, -0.571, -0.276 ] } }, { "index": 312, "index_chain": 14, "chain_name": "K", "nt_resnum": 2560, "nt_name": "A", "nt_code": "A", "nt_id": "///K/2560", "linked_nts": [ "///K/2559", "///K/2561" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,multiplet,A-minor,ribose-zipper", "alpha": -63.147, "beta": -170.800, "gamma": 44.478, "delta": 82.900, "epsilon": -156.097, "zeta": -63.626, "epsilon_zeta": -92.471, "bb_type": "BI", "chi": -157.028, "glyco_bond": "anti", "C5prime_xyz": [ -1.390, 8.747, 0.342 ], "P_xyz": [ 1.001, 9.337, 1.251 ], "form": "A", "ssZp": 4.237, "Dp": 4.489, "splay_angle": 21.448, "splay_distance": 3.458, "splay_ratio": 0.187, "d22": null, "d64": null, "eta": 171.918, "theta": -142.617, "eta_prime": -179.668, "theta_prime": -139.459, "eta_base": -151.632, "theta_base": -104.665, "v0": 2.263, "v1": -23.411, "v2": 34.003, "v3": -33.882, "v4": 20.003, "amplitude": 35.217, "phase_angle": 15.087, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.761, "filter_rmsd": 0.038, "frame": { "rmsd": 0.004, "origin": [ 7.521, 20.429, -29.734 ], "x_axis": [ -0.262, -0.890, -0.373 ], "y_axis": [ -0.941, 0.149, 0.305 ], "z_axis": [ -0.216, 0.431, -0.876 ], "quaternion": [ 0.052, -0.605, 0.756, 0.243 ] } }, { "index": 313, "index_chain": 15, "chain_name": "K", "nt_resnum": 2561, "nt_name": "U", "nt_code": "U", "nt_id": "///K/2561", "linked_nts": [ "///K/2560", null ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix-end,stem-end", "alpha": -74.293, "beta": 177.737, "gamma": 54.565, "delta": 83.757, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": -157.052, "glyco_bond": "anti", "C5prime_xyz": [ -1.580, 8.767, 0.399 ], "P_xyz": [ 0.966, 9.348, 0.568 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": -0.804, "v1": -21.784, "v2": 34.624, "v3": -36.086, "v4": 23.293, "amplitude": 36.804, "phase_angle": 19.816, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.871, "filter_rmsd": 0.105, "frame": { "rmsd": 0.005, "origin": [ 7.243, 20.431, -33.180 ], "x_axis": [ -0.729, -0.684, -0.004 ], "y_axis": [ -0.630, 0.669, 0.395 ], "z_axis": [ -0.268, 0.291, -0.919 ], "quaternion": [ -0.073, -0.361, 0.911, 0.188 ] } } ], "num_hbonds": 1189, "hbonds": [ { "index": 1, "atom1_serNum": 19, "atom2_serNum": 1566, "donAcc_type": "standard", "distance": 2.792, "atom1_id": "///A/1/O6", "atom2_id": "///A/72/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 2, "atom1_serNum": 20, "atom2_serNum": 1564, "donAcc_type": "standard", "distance": 3.023, "atom1_id": "///A/1/N1", "atom2_id": "///A/72/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 3, "atom1_serNum": 22, "atom2_serNum": 1563, "donAcc_type": "standard", "distance": 3.557, "atom1_id": "///A/1/N2", "atom2_id": "///A/72/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 4, "atom1_serNum": 35, "atom2_serNum": 51, "donAcc_type": "acceptable", "distance": 2.879, "atom1_id": "///A/2/O2'", "atom2_id": "///A/3/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 5, "atom1_serNum": 39, "atom2_serNum": 1546, "donAcc_type": "standard", "distance": 2.552, "atom1_id": "///A/2/O2", "atom2_id": "///A/71/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 6, "atom1_serNum": 40, "atom2_serNum": 1544, "donAcc_type": "standard", "distance": 2.758, "atom1_id": "///A/2/N3", "atom2_id": "///A/71/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 7, "atom1_serNum": 42, "atom2_serNum": 1543, "donAcc_type": "standard", "distance": 2.849, "atom1_id": "///A/2/N4", "atom2_id": "///A/71/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 8, "atom1_serNum": 62, "atom2_serNum": 1523, "donAcc_type": "standard", "distance": 2.887, "atom1_id": "///A/3/O6", "atom2_id": "///A/70/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 9, "atom1_serNum": 63, "atom2_serNum": 1521, "donAcc_type": "standard", "distance": 2.921, "atom1_id": "///A/3/N1", "atom2_id": "///A/70/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 10, "atom1_serNum": 65, "atom2_serNum": 1520, "donAcc_type": "standard", "distance": 2.897, "atom1_id": "///A/3/N2", "atom2_id": "///A/70/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 11, "atom1_serNum": 85, "atom2_serNum": 1501, "donAcc_type": "standard", "distance": 2.963, "atom1_id": "///A/4/O6", "atom2_id": "///A/69/N3", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 12, "atom1_serNum": 86, "atom2_serNum": 1500, "donAcc_type": "standard", "distance": 2.805, "atom1_id": "///A/4/N1", "atom2_id": "///A/69/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 13, "atom1_serNum": 108, "atom2_serNum": 1483, "donAcc_type": "standard", "distance": 2.977, "atom1_id": "///A/5/N6", "atom2_id": "///A/68/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 14, "atom1_serNum": 109, "atom2_serNum": 1481, "donAcc_type": "standard", "distance": 2.691, "atom1_id": "///A/5/N1", "atom2_id": "///A/68/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 15, "atom1_serNum": 128, "atom2_serNum": 1462, "donAcc_type": "standard", "distance": 2.617, "atom1_id": "///A/6/N3", "atom2_id": "///A/67/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 16, "atom1_serNum": 130, "atom2_serNum": 1461, "donAcc_type": "standard", "distance": 2.983, "atom1_id": "///A/6/O4", "atom2_id": "///A/67/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 17, "atom1_serNum": 143, "atom2_serNum": 1063, "donAcc_type": "acceptable", "distance": 2.544, "atom1_id": "///A/7/O2'", "atom2_id": "///A/49/OP2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 18, "atom1_serNum": 148, "atom2_serNum": 1440, "donAcc_type": "standard", "distance": 2.645, "atom1_id": "///A/7/N3", "atom2_id": "///A/66/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 19, "atom1_serNum": 150, "atom2_serNum": 1439, "donAcc_type": "standard", "distance": 2.781, "atom1_id": "///A/7/O4", "atom2_id": "///A/66/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 20, "atom1_serNum": 163, "atom2_serNum": 451, "donAcc_type": "acceptable", "distance": 2.614, "atom1_id": "///A/8/O2'", "atom2_id": "///A/21/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 21, "atom1_serNum": 163, "atom2_serNum": 1047, "donAcc_type": "acceptable", "distance": 3.526, "atom1_id": "///A/8/O2'", "atom2_id": "///A/48/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 22, "atom1_serNum": 167, "atom2_serNum": 296, "donAcc_type": "standard", "distance": 2.991, "atom1_id": "///A/8/O2", "atom2_id": "///A/14/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 23, "atom1_serNum": 168, "atom2_serNum": 293, "donAcc_type": "standard", "distance": 2.764, "atom1_id": "///A/8/N3", "atom2_id": "///A/14/N7", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 24, "atom1_serNum": 174, "atom2_serNum": 10892, "donAcc_type": "standard", "distance": 2.329, "atom1_id": "///A/9/OP1", "atom2_id": "///C/535/NE2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 25, "atom1_serNum": 175, "atom2_serNum": 276, "donAcc_type": "standard", "distance": 2.901, "atom1_id": "///A/9/OP2", "atom2_id": "///A/13/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 26, "atom1_serNum": 176, "atom2_serNum": 1017, "donAcc_type": "standard", "distance": 3.195, "atom1_id": "///A/9/O5'", "atom2_id": "///A/46/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 27, "atom1_serNum": 183, "atom2_serNum": 236, "donAcc_type": "acceptable", "distance": 2.962, "atom1_id": "///A/9/O2'", "atom2_id": "///A/11/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 28, "atom1_serNum": 187, "atom2_serNum": 495, "donAcc_type": "standard", "distance": 2.735, "atom1_id": "///A/9/N7", "atom2_id": "///A/23/N6", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 29, "atom1_serNum": 190, "atom2_serNum": 480, "donAcc_type": "standard", "distance": 3.187, "atom1_id": "///A/9/N6", "atom2_id": "///A/23/OP2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 30, "atom1_serNum": 190, "atom2_serNum": 492, "donAcc_type": "standard", "distance": 2.805, "atom1_id": "///A/9/N6", "atom2_id": "///A/23/N7", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 31, "atom1_serNum": 212, "atom2_serNum": 540, "donAcc_type": "standard", "distance": 2.767, "atom1_id": "///A/10/O6", "atom2_id": "///A/25/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 32, "atom1_serNum": 212, "atom2_serNum": 994, "donAcc_type": "standard", "distance": 2.951, "atom1_id": "///A/10/O6", "atom2_id": "///A/45/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 33, "atom1_serNum": 213, "atom2_serNum": 538, "donAcc_type": "standard", "distance": 2.713, "atom1_id": "///A/10/N1", "atom2_id": "///A/25/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 34, "atom1_serNum": 215, "atom2_serNum": 537, "donAcc_type": "standard", "distance": 2.561, "atom1_id": "///A/10/N2", "atom2_id": "///A/25/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 35, "atom1_serNum": 229, "atom2_serNum": 245, "donAcc_type": "acceptable", "distance": 3.186, "atom1_id": "///A/11/O2'", "atom2_id": "///A/12/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 36, "atom1_serNum": 233, "atom2_serNum": 520, "donAcc_type": "standard", "distance": 2.605, "atom1_id": "///A/11/O2", "atom2_id": "///A/24/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 37, "atom1_serNum": 234, "atom2_serNum": 518, "donAcc_type": "standard", "distance": 2.754, "atom1_id": "///A/11/N3", "atom2_id": "///A/24/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 38, "atom1_serNum": 236, "atom2_serNum": 517, "donAcc_type": "standard", "distance": 2.998, "atom1_id": "///A/11/N4", "atom2_id": "///A/24/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 39, "atom1_serNum": 254, "atom2_serNum": 496, "donAcc_type": "standard", "distance": 2.871, "atom1_id": "///A/12/N3", "atom2_id": "///A/23/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 40, "atom1_serNum": 256, "atom2_serNum": 495, "donAcc_type": "standard", "distance": 2.879, "atom1_id": "///A/12/O4", "atom2_id": "///A/23/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 41, "atom1_serNum": 273, "atom2_serNum": 475, "donAcc_type": "standard", "distance": 2.723, "atom1_id": "///A/13/O2", "atom2_id": "///A/22/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 42, "atom1_serNum": 274, "atom2_serNum": 473, "donAcc_type": "standard", "distance": 2.911, "atom1_id": "///A/13/N3", "atom2_id": "///A/22/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 43, "atom1_serNum": 276, "atom2_serNum": 472, "donAcc_type": "standard", "distance": 3.010, "atom1_id": "///A/13/N4", "atom2_id": "///A/22/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 44, "atom1_serNum": 319, "atom2_serNum": 1055, "donAcc_type": "standard", "distance": 2.690, "atom1_id": "///A/15/N1", "atom2_id": "///A/48/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 45, "atom1_serNum": 321, "atom2_serNum": 1056, "donAcc_type": "standard", "distance": 2.884, "atom1_id": "///A/15/N2", "atom2_id": "///A/48/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 46, "atom1_serNum": 335, "atom2_serNum": 346, "donAcc_type": "acceptable", "distance": 2.213, "atom1_id": "///A/16/O2'", "atom2_id": "///A/17/OP2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 47, "atom1_serNum": 338, "atom2_serNum": 366, "donAcc_type": "questionable", "distance": 2.517, "atom1_id": "///A/16/O2", "atom2_id": "///A/18/OP2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 48, "atom1_serNum": 355, "atom2_serNum": 389, "donAcc_type": "acceptable", "distance": 2.724, "atom1_id": "///A/17/O2'", "atom2_id": "///A/19/OP2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 49, "atom1_serNum": 372, "atom2_serNum": 1249, "donAcc_type": "standard", "distance": 3.212, "atom1_id": "///A/18/O3'", "atom2_id": "///A/57/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 50, "atom1_serNum": 374, "atom2_serNum": 1247, "donAcc_type": "acceptable", "distance": 2.892, "atom1_id": "///A/18/O2'", "atom2_id": "///A/57/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 51, "atom1_serNum": 374, "atom2_serNum": 1249, "donAcc_type": "acceptable", "distance": 2.839, "atom1_id": "///A/18/O2'", "atom2_id": "///A/57/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 52, "atom1_serNum": 382, "atom2_serNum": 1196, "donAcc_type": "standard", "distance": 2.803, "atom1_id": "///A/18/N1", "atom2_id": "///A/55/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 53, "atom1_serNum": 384, "atom2_serNum": 1196, "donAcc_type": "standard", "distance": 2.803, "atom1_id": "///A/18/N2", "atom2_id": "///A/55/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 54, "atom1_serNum": 384, "atom2_serNum": 1255, "donAcc_type": "standard", "distance": 3.352, "atom1_id": "///A/18/N2", "atom2_id": "///A/58/O5'", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 55, "atom1_serNum": 384, "atom2_serNum": 1258, "donAcc_type": "standard", "distance": 3.226, "atom1_id": "///A/18/N2", "atom2_id": "///A/58/O4'", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 56, "atom1_serNum": 388, "atom2_serNum": 1312, "donAcc_type": "standard", "distance": 3.291, "atom1_id": "///A/19/OP1", "atom2_id": "///A/60/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 57, "atom1_serNum": 393, "atom2_serNum": 1249, "donAcc_type": "standard", "distance": 3.057, "atom1_id": "///A/19/O4'", "atom2_id": "///A/57/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 58, "atom1_serNum": 404, "atom2_serNum": 1226, "donAcc_type": "standard", "distance": 3.117, "atom1_id": "///A/19/O6", "atom2_id": "///A/56/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 59, "atom1_serNum": 405, "atom2_serNum": 1224, "donAcc_type": "standard", "distance": 2.935, "atom1_id": "///A/19/N1", "atom2_id": "///A/56/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 60, "atom1_serNum": 407, "atom2_serNum": 1223, "donAcc_type": "standard", "distance": 2.713, "atom1_id": "///A/19/N2", "atom2_id": "///A/56/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 61, "atom1_serNum": 430, "atom2_serNum": 458, "donAcc_type": "standard", "distance": 3.144, "atom1_id": "///A/20/N2", "atom2_id": "///A/22/O5'", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 62, "atom1_serNum": 430, "atom2_serNum": 461, "donAcc_type": "standard", "distance": 3.235, "atom1_id": "///A/20/N2", "atom2_id": "///A/22/O4'", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 63, "atom1_serNum": 443, "atom2_serNum": 458, "donAcc_type": "acceptable", "distance": 2.780, "atom1_id": "///A/21/O2'", "atom2_id": "///A/22/O5'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 64, "atom1_serNum": 469, "atom2_serNum": 1015, "donAcc_type": "standard", "distance": 2.819, "atom1_id": "///A/22/N7", "atom2_id": "///A/46/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 65, "atom1_serNum": 472, "atom2_serNum": 1017, "donAcc_type": "standard", "distance": 2.826, "atom1_id": "///A/22/O6", "atom2_id": "///A/46/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 66, "atom1_serNum": 560, "atom2_serNum": 969, "donAcc_type": "standard", "distance": 2.909, "atom1_id": "///A/26/O6", "atom2_id": "///A/44/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 67, "atom1_serNum": 561, "atom2_serNum": 970, "donAcc_type": "standard", "distance": 2.840, "atom1_id": "///A/26/N1", "atom2_id": "///A/44/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 68, "atom1_serNum": 582, "atom2_serNum": 949, "donAcc_type": "standard", "distance": 2.755, "atom1_id": "///A/27/O2", "atom2_id": "///A/43/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 69, "atom1_serNum": 583, "atom2_serNum": 947, "donAcc_type": "standard", "distance": 2.741, "atom1_id": "///A/27/N3", "atom2_id": "///A/43/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 70, "atom1_serNum": 585, "atom2_serNum": 946, "donAcc_type": "standard", "distance": 2.746, "atom1_id": "///A/27/N4", "atom2_id": "///A/43/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 71, "atom1_serNum": 602, "atom2_serNum": 926, "donAcc_type": "standard", "distance": 2.634, "atom1_id": "///A/28/O2", "atom2_id": "///A/42/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 72, "atom1_serNum": 603, "atom2_serNum": 924, "donAcc_type": "standard", "distance": 2.710, "atom1_id": "///A/28/N3", "atom2_id": "///A/42/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 73, "atom1_serNum": 605, "atom2_serNum": 923, "donAcc_type": "standard", "distance": 2.686, "atom1_id": "///A/28/N4", "atom2_id": "///A/42/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 74, "atom1_serNum": 625, "atom2_serNum": 903, "donAcc_type": "standard", "distance": 3.446, "atom1_id": "///A/29/N6", "atom2_id": "///A/41/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 75, "atom1_serNum": 626, "atom2_serNum": 901, "donAcc_type": "standard", "distance": 2.884, "atom1_id": "///A/29/N1", "atom2_id": "///A/41/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 76, "atom1_serNum": 647, "atom2_serNum": 882, "donAcc_type": "standard", "distance": 2.770, "atom1_id": "///A/30/O6", "atom2_id": "///A/40/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 77, "atom1_serNum": 648, "atom2_serNum": 880, "donAcc_type": "standard", "distance": 2.816, "atom1_id": "///A/30/N1", "atom2_id": "///A/40/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 78, "atom1_serNum": 650, "atom2_serNum": 879, "donAcc_type": "standard", "distance": 2.789, "atom1_id": "///A/30/N2", "atom2_id": "///A/40/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 79, "atom1_serNum": 650, "atom2_serNum": 880, "donAcc_type": "standard", "distance": 2.948, "atom1_id": "///A/30/N2", "atom2_id": "///A/40/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 80, "atom1_serNum": 670, "atom2_serNum": 851, "donAcc_type": "standard", "distance": 3.393, "atom1_id": "///A/31/N6", "atom2_id": "///A/39/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 81, "atom1_serNum": 671, "atom2_serNum": 847, "donAcc_type": "standard", "distance": 3.216, "atom1_id": "///A/31/N1", "atom2_id": "///A/39/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 82, "atom1_serNum": 681, "atom2_serNum": 840, "donAcc_type": "standard", "distance": 2.812, "atom1_id": "///A/32/O2", "atom2_id": "///A/38/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 83, "atom1_serNum": 706, "atom2_serNum": 754, "donAcc_type": "acceptable", "distance": 2.359, "atom1_id": "///A/33/O2'", "atom2_id": "///A/35/N7", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 84, "atom1_serNum": 711, "atom2_serNum": 764, "donAcc_type": "standard", "distance": 3.767, "atom1_id": "///A/33/N3", "atom2_id": "///A/36/OP2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 85, "atom1_serNum": 1031, "atom2_serNum": 1069, "donAcc_type": "acceptable", "distance": 3.220, "atom1_id": "///A/47/O2'", "atom2_id": "///A/49/O3'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 86, "atom1_serNum": 1031, "atom2_serNum": 1083, "donAcc_type": "acceptable", "distance": 2.817, "atom1_id": "///A/47/O2'", "atom2_id": "///A/50/OP1", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 87, "atom1_serNum": 1038, "atom2_serNum": 10617, "donAcc_type": "standard", "distance": 3.497, "atom1_id": "///A/47/O4", "atom2_id": "///C/501/NE", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 88, "atom1_serNum": 1051, "atom2_serNum": 1281, "donAcc_type": "acceptable", "distance": 3.188, "atom1_id": "///A/48/O2'", "atom2_id": "///A/59/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 89, "atom1_serNum": 1051, "atom2_serNum": 1285, "donAcc_type": "acceptable", "distance": 3.109, "atom1_id": "///A/48/O2'", "atom2_id": "///A/59/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 90, "atom1_serNum": 1075, "atom2_serNum": 1419, "donAcc_type": "standard", "distance": 2.760, "atom1_id": "///A/49/O2", "atom2_id": "///A/65/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 91, "atom1_serNum": 1076, "atom2_serNum": 1417, "donAcc_type": "standard", "distance": 2.785, "atom1_id": "///A/49/N3", "atom2_id": "///A/65/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 92, "atom1_serNum": 1078, "atom2_serNum": 1416, "donAcc_type": "standard", "distance": 2.692, "atom1_id": "///A/49/N4", "atom2_id": "///A/65/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 93, "atom1_serNum": 1097, "atom2_serNum": 1395, "donAcc_type": "standard", "distance": 2.726, "atom1_id": "///A/50/N3", "atom2_id": "///A/64/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 94, "atom1_serNum": 1099, "atom2_serNum": 1394, "donAcc_type": "standard", "distance": 2.703, "atom1_id": "///A/50/O4", "atom2_id": "///A/64/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 95, "atom1_serNum": 1119, "atom2_serNum": 1374, "donAcc_type": "standard", "distance": 3.077, "atom1_id": "///A/51/O6", "atom2_id": "///A/63/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 96, "atom1_serNum": 1120, "atom2_serNum": 1372, "donAcc_type": "standard", "distance": 2.836, "atom1_id": "///A/51/N1", "atom2_id": "///A/63/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 97, "atom1_serNum": 1122, "atom2_serNum": 1371, "donAcc_type": "standard", "distance": 2.611, "atom1_id": "///A/51/N2", "atom2_id": "///A/63/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 98, "atom1_serNum": 1140, "atom2_serNum": 1353, "donAcc_type": "standard", "distance": 2.796, "atom1_id": "///A/52/N3", "atom2_id": "///A/62/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 99, "atom1_serNum": 1142, "atom2_serNum": 1352, "donAcc_type": "standard", "distance": 2.850, "atom1_id": "///A/52/O4", "atom2_id": "///A/62/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 100, "atom1_serNum": 1162, "atom2_serNum": 1332, "donAcc_type": "standard", "distance": 2.960, "atom1_id": "///A/53/O6", "atom2_id": "///A/61/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 101, "atom1_serNum": 1163, "atom2_serNum": 1330, "donAcc_type": "standard", "distance": 2.870, "atom1_id": "///A/53/N1", "atom2_id": "///A/61/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 102, "atom1_serNum": 1165, "atom2_serNum": 1329, "donAcc_type": "standard", "distance": 2.667, "atom1_id": "///A/53/N2", "atom2_id": "///A/61/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 103, "atom1_serNum": 1170, "atom2_serNum": 1266, "donAcc_type": "standard", "distance": 3.001, "atom1_id": "///A/54/N3", "atom2_id": "///A/58/N7", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 104, "atom1_serNum": 1175, "atom2_serNum": 1269, "donAcc_type": "standard", "distance": 2.888, "atom1_id": "///A/54/O2", "atom2_id": "///A/58/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 105, "atom1_serNum": 1191, "atom2_serNum": 1254, "donAcc_type": "standard", "distance": 2.783, "atom1_id": "///A/55/N3", "atom2_id": "///A/58/OP2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 106, "atom1_serNum": 1199, "atom2_serNum": 1243, "donAcc_type": "acceptable", "distance": 2.720, "atom1_id": "///A/55/O2'", "atom2_id": "///A/57/N7", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 107, "atom1_serNum": 1262, "atom2_serNum": 1297, "donAcc_type": "acceptable", "distance": 2.634, "atom1_id": "///A/58/O2'", "atom2_id": "///A/60/OP2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 108, "atom1_serNum": 1296, "atom2_serNum": 1332, "donAcc_type": "standard", "distance": 3.199, "atom1_id": "///A/60/OP1", "atom2_id": "///A/61/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 109, "atom1_serNum": 1432, "atom2_serNum": 10651, "donAcc_type": "acceptable", "distance": 2.821, "atom1_id": "///A/66/O2'", "atom2_id": "///C/505/NE2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 110, "atom1_serNum": 1452, "atom2_serNum": 10904, "donAcc_type": "questionable", "distance": 2.626, "atom1_id": "///A/67/O3'", "atom2_id": "///C/537/O", "atom_pair": "O:O", "residue_pair": "nt:aa" }, { "index": 111, "atom1_serNum": 1476, "atom2_serNum": 10921, "donAcc_type": "acceptable", "distance": 2.497, "atom1_id": "///A/68/O2'", "atom2_id": "///C/539/NE", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 112, "atom1_serNum": 1496, "atom2_serNum": 1512, "donAcc_type": "acceptable", "distance": 2.947, "atom1_id": "///A/69/O2'", "atom2_id": "///A/70/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 113, "atom1_serNum": 1508, "atom2_serNum": 10931, "donAcc_type": "standard", "distance": 2.894, "atom1_id": "///A/70/OP2", "atom2_id": "///C/541/N", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 114, "atom1_serNum": 1551, "atom2_serNum": 1571, "donAcc_type": "questionable", "distance": 2.187, "atom1_id": "///A/72/OP2", "atom2_id": "///A/73/OP2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 115, "atom1_serNum": 1579, "atom2_serNum": 1589, "donAcc_type": "acceptable", "distance": 2.698, "atom1_id": "///A/73/O2'", "atom2_id": "///A/73/N3", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 116, "atom1_serNum": 1579, "atom2_serNum": 1593, "donAcc_type": "acceptable", "distance": 2.649, "atom1_id": "///A/73/O2'", "atom2_id": "///A/74/OP2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 117, "atom1_serNum": 1592, "atom2_serNum": 10786, "donAcc_type": "standard", "distance": 3.913, "atom1_id": "///A/74/OP1", "atom2_id": "///C/521/NH2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 118, "atom1_serNum": 1601, "atom2_serNum": 1605, "donAcc_type": "acceptable", "distance": 2.851, "atom1_id": "///A/74/O2'", "atom2_id": "///A/74/O2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 119, "atom1_serNum": 1601, "atom2_serNum": 1612, "donAcc_type": "acceptable", "distance": 2.299, "atom1_id": "///A/74/O2'", "atom2_id": "///A/75/OP1", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 120, "atom1_serNum": 1601, "atom2_serNum": 1613, "donAcc_type": "acceptable", "distance": 2.301, "atom1_id": "///A/74/O2'", "atom2_id": "///A/75/OP2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 121, "atom1_serNum": 1606, "atom2_serNum": 6618, "donAcc_type": "questionable", "distance": 3.286, "atom1_id": "///A/74/N3", "atom2_id": "///K/2556/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 122, "atom1_serNum": 1608, "atom2_serNum": 6581, "donAcc_type": "standard", "distance": 3.676, "atom1_id": "///A/74/N4", "atom2_id": "///K/2554/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 123, "atom1_serNum": 1608, "atom2_serNum": 6601, "donAcc_type": "standard", "distance": 3.450, "atom1_id": "///A/74/N4", "atom2_id": "///K/2555/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 124, "atom1_serNum": 1621, "atom2_serNum": 1625, "donAcc_type": "acceptable", "distance": 2.300, "atom1_id": "///A/75/O2'", "atom2_id": "///A/75/O2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 125, "atom1_serNum": 1628, "atom2_serNum": 6281, "donAcc_type": "standard", "distance": 3.120, "atom1_id": "///A/75/N4", "atom2_id": "///J/1955/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 126, "atom1_serNum": 1632, "atom2_serNum": 1641, "donAcc_type": "acceptable", "distance": 2.698, "atom1_id": "///A/76/OP1", "atom2_id": "///A/76/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 127, "atom1_serNum": 1632, "atom2_serNum": 6634, "donAcc_type": "acceptable", "distance": 3.037, "atom1_id": "///A/76/OP1", "atom2_id": "///K/2557/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 128, "atom1_serNum": 1639, "atom2_serNum": 6644, "donAcc_type": "standard", "distance": 3.129, "atom1_id": "///A/76/O3'", "atom2_id": "///K/2557/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 129, "atom1_serNum": 1648, "atom2_serNum": 6268, "donAcc_type": "standard", "distance": 2.679, "atom1_id": "///A/76/N6", "atom2_id": "///J/1955/OP1", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 130, "atom1_serNum": 1672, "atom2_serNum": 3210, "donAcc_type": "questionable", "distance": 3.015, "atom1_id": "///B/1/N4", "atom2_id": "///B/72/N6", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 131, "atom1_serNum": 1672, "atom2_serNum": 3211, "donAcc_type": "standard", "distance": 3.459, "atom1_id": "///B/1/N4", "atom2_id": "///B/72/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 132, "atom1_serNum": 1692, "atom2_serNum": 3190, "donAcc_type": "standard", "distance": 3.039, "atom1_id": "///B/2/O6", "atom2_id": "///B/71/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 133, "atom1_serNum": 1693, "atom2_serNum": 3188, "donAcc_type": "standard", "distance": 3.012, "atom1_id": "///B/2/N1", "atom2_id": "///B/71/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 134, "atom1_serNum": 1695, "atom2_serNum": 3187, "donAcc_type": "standard", "distance": 2.901, "atom1_id": "///B/2/N2", "atom2_id": "///B/71/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 135, "atom1_serNum": 1712, "atom2_serNum": 3170, "donAcc_type": "standard", "distance": 3.215, "atom1_id": "///B/3/O2", "atom2_id": "///B/70/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 136, "atom1_serNum": 1713, "atom2_serNum": 3168, "donAcc_type": "standard", "distance": 2.957, "atom1_id": "///B/3/N3", "atom2_id": "///B/70/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 137, "atom1_serNum": 1715, "atom2_serNum": 3167, "donAcc_type": "standard", "distance": 2.770, "atom1_id": "///B/3/N4", "atom2_id": "///B/70/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 138, "atom1_serNum": 1728, "atom2_serNum": 1743, "donAcc_type": "acceptable", "distance": 2.318, "atom1_id": "///B/4/O2'", "atom2_id": "///B/5/OP2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 139, "atom1_serNum": 1728, "atom2_serNum": 1744, "donAcc_type": "acceptable", "distance": 2.720, "atom1_id": "///B/4/O2'", "atom2_id": "///B/5/O5'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 140, "atom1_serNum": 1728, "atom2_serNum": 1755, "donAcc_type": "acceptable", "distance": 2.896, "atom1_id": "///B/4/O2'", "atom2_id": "///B/5/N7", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 141, "atom1_serNum": 1735, "atom2_serNum": 3147, "donAcc_type": "standard", "distance": 2.962, "atom1_id": "///B/4/O6", "atom2_id": "///B/69/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 142, "atom1_serNum": 1736, "atom2_serNum": 3144, "donAcc_type": "standard", "distance": 2.853, "atom1_id": "///B/4/N1", "atom2_id": "///B/69/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 143, "atom1_serNum": 1736, "atom2_serNum": 3145, "donAcc_type": "standard", "distance": 2.889, "atom1_id": "///B/4/N1", "atom2_id": "///B/69/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 144, "atom1_serNum": 1738, "atom2_serNum": 3144, "donAcc_type": "standard", "distance": 2.761, "atom1_id": "///B/4/N2", "atom2_id": "///B/69/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 145, "atom1_serNum": 1759, "atom2_serNum": 3125, "donAcc_type": "standard", "distance": 3.088, "atom1_id": "///B/5/N1", "atom2_id": "///B/68/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 146, "atom1_serNum": 1761, "atom2_serNum": 3124, "donAcc_type": "standard", "distance": 2.530, "atom1_id": "///B/5/N2", "atom2_id": "///B/68/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 147, "atom1_serNum": 1761, "atom2_serNum": 3125, "donAcc_type": "standard", "distance": 2.964, "atom1_id": "///B/5/N2", "atom2_id": "///B/68/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 148, "atom1_serNum": 1782, "atom2_serNum": 3107, "donAcc_type": "questionable", "distance": 3.368, "atom1_id": "///B/6/N1", "atom2_id": "///B/67/N4", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 149, "atom1_serNum": 1784, "atom2_serNum": 3105, "donAcc_type": "standard", "distance": 3.458, "atom1_id": "///B/6/N2", "atom2_id": "///B/67/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 150, "atom1_serNum": 1788, "atom2_serNum": 2003, "donAcc_type": "standard", "distance": 3.700, "atom1_id": "///B/7/OP1", "atom2_id": "///B/16/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 151, "atom1_serNum": 1797, "atom2_serNum": 2714, "donAcc_type": "acceptable", "distance": 3.251, "atom1_id": "///B/7/O2'", "atom2_id": "///B/49/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 152, "atom1_serNum": 1804, "atom2_serNum": 3087, "donAcc_type": "standard", "distance": 2.633, "atom1_id": "///B/7/O6", "atom2_id": "///B/66/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 153, "atom1_serNum": 1805, "atom2_serNum": 3085, "donAcc_type": "standard", "distance": 3.087, "atom1_id": "///B/7/N1", "atom2_id": "///B/66/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 154, "atom1_serNum": 1807, "atom2_serNum": 3084, "donAcc_type": "standard", "distance": 3.447, "atom1_id": "///B/7/N2", "atom2_id": "///B/66/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 155, "atom1_serNum": 1816, "atom2_serNum": 2702, "donAcc_type": "questionable", "distance": 2.851, "atom1_id": "///B/8/O4'", "atom2_id": "///B/48/O2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 156, "atom1_serNum": 1820, "atom2_serNum": 2130, "donAcc_type": "acceptable", "distance": 2.962, "atom1_id": "///B/8/O2'", "atom2_id": "///B/21/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 157, "atom1_serNum": 1824, "atom2_serNum": 1958, "donAcc_type": "standard", "distance": 3.056, "atom1_id": "///B/8/O2", "atom2_id": "///B/14/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 158, "atom1_serNum": 1825, "atom2_serNum": 1955, "donAcc_type": "standard", "distance": 2.789, "atom1_id": "///B/8/N3", "atom2_id": "///B/14/N7", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 159, "atom1_serNum": 1836, "atom2_serNum": 2651, "donAcc_type": "questionable", "distance": 3.019, "atom1_id": "///B/9/O4'", "atom2_id": "///B/46/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 160, "atom1_serNum": 1840, "atom2_serNum": 1867, "donAcc_type": "acceptable", "distance": 2.845, "atom1_id": "///B/9/O2'", "atom2_id": "///B/10/N7", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 161, "atom1_serNum": 1840, "atom2_serNum": 2643, "donAcc_type": "acceptable", "distance": 3.768, "atom1_id": "///B/9/O2'", "atom2_id": "///B/45/N3", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 162, "atom1_serNum": 1870, "atom2_serNum": 2214, "donAcc_type": "standard", "distance": 2.996, "atom1_id": "///B/10/O6", "atom2_id": "///B/25/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 163, "atom1_serNum": 1870, "atom2_serNum": 2642, "donAcc_type": "standard", "distance": 3.241, "atom1_id": "///B/10/O6", "atom2_id": "///B/45/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 164, "atom1_serNum": 1871, "atom2_serNum": 2212, "donAcc_type": "standard", "distance": 2.842, "atom1_id": "///B/10/N1", "atom2_id": "///B/25/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 165, "atom1_serNum": 1873, "atom2_serNum": 2211, "donAcc_type": "standard", "distance": 2.641, "atom1_id": "///B/10/N2", "atom2_id": "///B/25/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 166, "atom1_serNum": 1893, "atom2_serNum": 2194, "donAcc_type": "standard", "distance": 3.211, "atom1_id": "///B/11/N6", "atom2_id": "///B/24/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 167, "atom1_serNum": 1894, "atom2_serNum": 2192, "donAcc_type": "standard", "distance": 2.904, "atom1_id": "///B/11/N1", "atom2_id": "///B/24/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 168, "atom1_serNum": 1915, "atom2_serNum": 2174, "donAcc_type": "standard", "distance": 3.193, "atom1_id": "///B/12/O6", "atom2_id": "///B/23/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 169, "atom1_serNum": 1916, "atom2_serNum": 2172, "donAcc_type": "standard", "distance": 3.024, "atom1_id": "///B/12/N1", "atom2_id": "///B/23/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 170, "atom1_serNum": 1918, "atom2_serNum": 2171, "donAcc_type": "standard", "distance": 2.775, "atom1_id": "///B/12/N2", "atom2_id": "///B/23/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 171, "atom1_serNum": 1935, "atom2_serNum": 2154, "donAcc_type": "standard", "distance": 2.969, "atom1_id": "///B/13/O2", "atom2_id": "///B/22/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 172, "atom1_serNum": 1936, "atom2_serNum": 2152, "donAcc_type": "standard", "distance": 3.075, "atom1_id": "///B/13/N3", "atom2_id": "///B/22/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 173, "atom1_serNum": 1938, "atom2_serNum": 2151, "donAcc_type": "standard", "distance": 3.073, "atom1_id": "///B/13/N4", "atom2_id": "///B/22/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 174, "atom1_serNum": 1958, "atom2_serNum": 2132, "donAcc_type": "standard", "distance": 2.973, "atom1_id": "///B/14/N6", "atom2_id": "///B/21/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 175, "atom1_serNum": 1959, "atom2_serNum": 2122, "donAcc_type": "acceptable", "distance": 2.716, "atom1_id": "///B/14/N1", "atom2_id": "///B/21/O2'", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 176, "atom1_serNum": 1980, "atom2_serNum": 2702, "donAcc_type": "questionable", "distance": 3.116, "atom1_id": "///B/15/O6", "atom2_id": "///B/48/O2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 177, "atom1_serNum": 1981, "atom2_serNum": 2703, "donAcc_type": "standard", "distance": 3.030, "atom1_id": "///B/15/N1", "atom2_id": "///B/48/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 178, "atom1_serNum": 1983, "atom2_serNum": 2703, "donAcc_type": "standard", "distance": 3.286, "atom1_id": "///B/15/N2", "atom2_id": "///B/48/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 179, "atom1_serNum": 1994, "atom2_serNum": 2952, "donAcc_type": "questionable", "distance": 2.891, "atom1_id": "///B/16/O3'", "atom2_id": "///B/60/O3'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 180, "atom1_serNum": 1996, "atom2_serNum": 2020, "donAcc_type": "acceptable", "distance": 3.392, "atom1_id": "///B/16/O2'", "atom2_id": "///B/17/O2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 181, "atom1_serNum": 1996, "atom2_serNum": 2965, "donAcc_type": "acceptable", "distance": 2.519, "atom1_id": "///B/16/O2'", "atom2_id": "///B/61/OP1", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 182, "atom1_serNum": 2007, "atom2_serNum": 2954, "donAcc_type": "acceptable", "distance": 2.696, "atom1_id": "///B/17/OP1", "atom2_id": "///B/60/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 183, "atom1_serNum": 2056, "atom2_serNum": 2072, "donAcc_type": "acceptable", "distance": 2.989, "atom1_id": "///B/18/O2'", "atom2_id": "///B/19/O5'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 184, "atom1_serNum": 2064, "atom2_serNum": 2852, "donAcc_type": "standard", "distance": 2.626, "atom1_id": "///B/18/N1", "atom2_id": "///B/55/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 185, "atom1_serNum": 2066, "atom2_serNum": 2906, "donAcc_type": "standard", "distance": 2.879, "atom1_id": "///B/18/N2", "atom2_id": "///B/58/O4'", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 186, "atom1_serNum": 2070, "atom2_serNum": 2959, "donAcc_type": "standard", "distance": 3.361, "atom1_id": "///B/19/OP1", "atom2_id": "///B/60/N3", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 187, "atom1_serNum": 2086, "atom2_serNum": 2875, "donAcc_type": "standard", "distance": 3.470, "atom1_id": "///B/19/O6", "atom2_id": "///B/56/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 188, "atom1_serNum": 2087, "atom2_serNum": 2873, "donAcc_type": "standard", "distance": 2.988, "atom1_id": "///B/19/N1", "atom2_id": "///B/56/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 189, "atom1_serNum": 2089, "atom2_serNum": 2872, "donAcc_type": "standard", "distance": 2.641, "atom1_id": "///B/19/N2", "atom2_id": "///B/56/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 190, "atom1_serNum": 2234, "atom2_serNum": 2617, "donAcc_type": "standard", "distance": 3.184, "atom1_id": "///B/26/O6", "atom2_id": "///B/44/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 191, "atom1_serNum": 2235, "atom2_serNum": 2618, "donAcc_type": "standard", "distance": 3.405, "atom1_id": "///B/26/N1", "atom2_id": "///B/44/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 192, "atom1_serNum": 2237, "atom2_serNum": 2618, "donAcc_type": "standard", "distance": 3.192, "atom1_id": "///B/26/N2", "atom2_id": "///B/44/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 193, "atom1_serNum": 2255, "atom2_serNum": 2596, "donAcc_type": "standard", "distance": 2.888, "atom1_id": "///B/27/N3", "atom2_id": "///B/43/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 194, "atom1_serNum": 2257, "atom2_serNum": 2595, "donAcc_type": "standard", "distance": 2.566, "atom1_id": "///B/27/O4", "atom2_id": "///B/43/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 195, "atom1_serNum": 2274, "atom2_serNum": 2575, "donAcc_type": "standard", "distance": 2.494, "atom1_id": "///B/28/O2", "atom2_id": "///B/42/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 196, "atom1_serNum": 2275, "atom2_serNum": 2573, "donAcc_type": "standard", "distance": 2.775, "atom1_id": "///B/28/N3", "atom2_id": "///B/42/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 197, "atom1_serNum": 2277, "atom2_serNum": 2572, "donAcc_type": "standard", "distance": 2.963, "atom1_id": "///B/28/N4", "atom2_id": "///B/42/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 198, "atom1_serNum": 2297, "atom2_serNum": 2552, "donAcc_type": "standard", "distance": 2.748, "atom1_id": "///B/29/O6", "atom2_id": "///B/41/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 199, "atom1_serNum": 2298, "atom2_serNum": 2550, "donAcc_type": "standard", "distance": 2.730, "atom1_id": "///B/29/N1", "atom2_id": "///B/41/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 200, "atom1_serNum": 2300, "atom2_serNum": 2549, "donAcc_type": "standard", "distance": 2.568, "atom1_id": "///B/29/N2", "atom2_id": "///B/41/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 201, "atom1_serNum": 2320, "atom2_serNum": 2532, "donAcc_type": "standard", "distance": 3.109, "atom1_id": "///B/30/O6", "atom2_id": "///B/40/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 202, "atom1_serNum": 2321, "atom2_serNum": 2529, "donAcc_type": "standard", "distance": 2.733, "atom1_id": "///B/30/N1", "atom2_id": "///B/40/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 203, "atom1_serNum": 2321, "atom2_serNum": 2530, "donAcc_type": "standard", "distance": 2.964, "atom1_id": "///B/30/N1", "atom2_id": "///B/40/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 204, "atom1_serNum": 2323, "atom2_serNum": 2529, "donAcc_type": "standard", "distance": 2.738, "atom1_id": "///B/30/N2", "atom2_id": "///B/40/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 205, "atom1_serNum": 2343, "atom2_serNum": 2512, "donAcc_type": "standard", "distance": 2.677, "atom1_id": "///B/31/O6", "atom2_id": "///B/39/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 206, "atom1_serNum": 2344, "atom2_serNum": 2510, "donAcc_type": "standard", "distance": 2.869, "atom1_id": "///B/31/N1", "atom2_id": "///B/39/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 207, "atom1_serNum": 2346, "atom2_serNum": 2509, "donAcc_type": "standard", "distance": 2.945, "atom1_id": "///B/31/N2", "atom2_id": "///B/39/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 208, "atom1_serNum": 2363, "atom2_serNum": 2490, "donAcc_type": "standard", "distance": 2.732, "atom1_id": "///B/32/O2", "atom2_id": "///B/38/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 209, "atom1_serNum": 2364, "atom2_serNum": 2490, "donAcc_type": "standard", "distance": 2.790, "atom1_id": "///B/32/N3", "atom2_id": "///B/38/N6", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 210, "atom1_serNum": 2379, "atom2_serNum": 2423, "donAcc_type": "acceptable", "distance": 2.722, "atom1_id": "///B/33/O2'", "atom2_id": "///B/35/N7", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 211, "atom1_serNum": 2384, "atom2_serNum": 2433, "donAcc_type": "standard", "distance": 2.673, "atom1_id": "///B/33/N3", "atom2_id": "///B/36/OP2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 212, "atom1_serNum": 2419, "atom2_serNum": 2437, "donAcc_type": "acceptable", "distance": 3.042, "atom1_id": "///B/35/O2'", "atom2_id": "///B/36/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 213, "atom1_serNum": 2525, "atom2_serNum": 2541, "donAcc_type": "acceptable", "distance": 3.001, "atom1_id": "///B/40/O2'", "atom2_id": "///B/41/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 214, "atom1_serNum": 2698, "atom2_serNum": 2710, "donAcc_type": "acceptable", "distance": 2.635, "atom1_id": "///B/48/O2'", "atom2_id": "///B/49/OP2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 215, "atom1_serNum": 2718, "atom2_serNum": 2734, "donAcc_type": "acceptable", "distance": 2.708, "atom1_id": "///B/49/O2'", "atom2_id": "///B/50/O5'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 216, "atom1_serNum": 2725, "atom2_serNum": 3067, "donAcc_type": "standard", "distance": 2.602, "atom1_id": "///B/49/O6", "atom2_id": "///B/65/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 217, "atom1_serNum": 2726, "atom2_serNum": 3065, "donAcc_type": "standard", "distance": 3.072, "atom1_id": "///B/49/N1", "atom2_id": "///B/65/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 218, "atom1_serNum": 2728, "atom2_serNum": 3065, "donAcc_type": "standard", "distance": 3.238, "atom1_id": "///B/49/N2", "atom2_id": "///B/65/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 219, "atom1_serNum": 2745, "atom2_serNum": 3045, "donAcc_type": "standard", "distance": 2.843, "atom1_id": "///B/50/O2", "atom2_id": "///B/64/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 220, "atom1_serNum": 2745, "atom2_serNum": 3047, "donAcc_type": "standard", "distance": 2.832, "atom1_id": "///B/50/O2", "atom2_id": "///B/64/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 221, "atom1_serNum": 2746, "atom2_serNum": 3044, "donAcc_type": "standard", "distance": 3.148, "atom1_id": "///B/50/N3", "atom2_id": "///B/64/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 222, "atom1_serNum": 2765, "atom2_serNum": 3024, "donAcc_type": "standard", "distance": 3.902, "atom1_id": "///B/51/O2", "atom2_id": "///B/63/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 223, "atom1_serNum": 2766, "atom2_serNum": 3022, "donAcc_type": "standard", "distance": 3.796, "atom1_id": "///B/51/N3", "atom2_id": "///B/63/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 224, "atom1_serNum": 2768, "atom2_serNum": 2788, "donAcc_type": "standard", "distance": 3.034, "atom1_id": "///B/51/N4", "atom2_id": "///B/52/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 225, "atom1_serNum": 2781, "atom2_serNum": 2796, "donAcc_type": "acceptable", "distance": 3.200, "atom1_id": "///B/52/O2'", "atom2_id": "///B/53/OP2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 226, "atom1_serNum": 2781, "atom2_serNum": 2797, "donAcc_type": "acceptable", "distance": 2.437, "atom1_id": "///B/52/O2'", "atom2_id": "///B/53/O5'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 227, "atom1_serNum": 2781, "atom2_serNum": 2800, "donAcc_type": "acceptable", "distance": 2.998, "atom1_id": "///B/52/O2'", "atom2_id": "///B/53/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 228, "atom1_serNum": 2789, "atom2_serNum": 3001, "donAcc_type": "questionable", "distance": 3.190, "atom1_id": "///B/52/N1", "atom2_id": "///B/62/N4", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 229, "atom1_serNum": 2791, "atom2_serNum": 2998, "donAcc_type": "standard", "distance": 3.106, "atom1_id": "///B/52/N2", "atom2_id": "///B/62/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 230, "atom1_serNum": 2791, "atom2_serNum": 2999, "donAcc_type": "standard", "distance": 2.810, "atom1_id": "///B/52/N2", "atom2_id": "///B/62/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 231, "atom1_serNum": 2811, "atom2_serNum": 2981, "donAcc_type": "standard", "distance": 2.960, "atom1_id": "///B/53/O6", "atom2_id": "///B/61/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 232, "atom1_serNum": 2812, "atom2_serNum": 2979, "donAcc_type": "standard", "distance": 2.990, "atom1_id": "///B/53/N1", "atom2_id": "///B/61/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 233, "atom1_serNum": 2814, "atom2_serNum": 2978, "donAcc_type": "standard", "distance": 2.874, "atom1_id": "///B/53/N2", "atom2_id": "///B/61/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 234, "atom1_serNum": 2819, "atom2_serNum": 2914, "donAcc_type": "standard", "distance": 2.911, "atom1_id": "///B/54/N3", "atom2_id": "///B/58/N7", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 235, "atom1_serNum": 2824, "atom2_serNum": 2917, "donAcc_type": "standard", "distance": 3.136, "atom1_id": "///B/54/O2", "atom2_id": "///B/58/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 236, "atom1_serNum": 2848, "atom2_serNum": 2892, "donAcc_type": "acceptable", "distance": 3.187, "atom1_id": "///B/55/O2'", "atom2_id": "///B/57/N7", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 237, "atom1_serNum": 2853, "atom2_serNum": 2902, "donAcc_type": "standard", "distance": 3.201, "atom1_id": "///B/55/N3", "atom2_id": "///B/58/OP2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 238, "atom1_serNum": 2910, "atom2_serNum": 2946, "donAcc_type": "acceptable", "distance": 2.554, "atom1_id": "///B/58/O2'", "atom2_id": "///B/60/OP2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 239, "atom1_serNum": 2910, "atom2_serNum": 2981, "donAcc_type": "acceptable", "distance": 3.383, "atom1_id": "///B/58/O2'", "atom2_id": "///B/61/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 240, "atom1_serNum": 3037, "atom2_serNum": 3056, "donAcc_type": "acceptable", "distance": 2.963, "atom1_id": "///B/64/O2'", "atom2_id": "///B/65/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 241, "atom1_serNum": 3140, "atom2_serNum": 3156, "donAcc_type": "acceptable", "distance": 2.845, "atom1_id": "///B/69/O2'", "atom2_id": "///B/70/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 242, "atom1_serNum": 3310, "atom2_serNum": 3326, "donAcc_type": "acceptable", "distance": 3.128, "atom1_id": "///E/153/O2'", "atom2_id": "///E/154/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 243, "atom1_serNum": 3314, "atom2_serNum": 3642, "donAcc_type": "standard", "distance": 2.872, "atom1_id": "///E/153/O2", "atom2_id": "///E/168/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 244, "atom1_serNum": 3315, "atom2_serNum": 3640, "donAcc_type": "standard", "distance": 2.944, "atom1_id": "///E/153/N3", "atom2_id": "///E/168/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 245, "atom1_serNum": 3317, "atom2_serNum": 3639, "donAcc_type": "standard", "distance": 2.886, "atom1_id": "///E/153/N4", "atom2_id": "///E/168/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 246, "atom1_serNum": 3330, "atom2_serNum": 3346, "donAcc_type": "acceptable", "distance": 2.893, "atom1_id": "///E/154/O2'", "atom2_id": "///E/155/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 247, "atom1_serNum": 3335, "atom2_serNum": 3618, "donAcc_type": "standard", "distance": 2.900, "atom1_id": "///E/154/N3", "atom2_id": "///E/167/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 248, "atom1_serNum": 3337, "atom2_serNum": 3617, "donAcc_type": "standard", "distance": 2.974, "atom1_id": "///E/154/O4", "atom2_id": "///E/167/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 249, "atom1_serNum": 3357, "atom2_serNum": 3597, "donAcc_type": "standard", "distance": 2.799, "atom1_id": "///E/155/N6", "atom2_id": "///E/166/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 250, "atom1_serNum": 3358, "atom2_serNum": 3595, "donAcc_type": "standard", "distance": 2.899, "atom1_id": "///E/155/N1", "atom2_id": "///E/166/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 251, "atom1_serNum": 3376, "atom2_serNum": 3577, "donAcc_type": "standard", "distance": 2.877, "atom1_id": "///E/156/O2", "atom2_id": "///E/165/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 252, "atom1_serNum": 3377, "atom2_serNum": 3575, "donAcc_type": "standard", "distance": 2.943, "atom1_id": "///E/156/N3", "atom2_id": "///E/165/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 253, "atom1_serNum": 3379, "atom2_serNum": 3574, "donAcc_type": "standard", "distance": 2.878, "atom1_id": "///E/156/N4", "atom2_id": "///E/165/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 254, "atom1_serNum": 3396, "atom2_serNum": 3552, "donAcc_type": "standard", "distance": 2.750, "atom1_id": "///E/157/O2", "atom2_id": "///E/164/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 255, "atom1_serNum": 3397, "atom2_serNum": 3551, "donAcc_type": "standard", "distance": 2.867, "atom1_id": "///E/157/N3", "atom2_id": "///E/164/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 256, "atom1_serNum": 3420, "atom2_serNum": 3528, "donAcc_type": "standard", "distance": 2.918, "atom1_id": "///E/158/N1", "atom2_id": "///E/163/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 257, "atom1_serNum": 3420, "atom2_serNum": 3529, "donAcc_type": "standard", "distance": 2.929, "atom1_id": "///E/158/N1", "atom2_id": "///E/163/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 258, "atom1_serNum": 3422, "atom2_serNum": 3509, "donAcc_type": "questionable", "distance": 2.838, "atom1_id": "///E/158/N2", "atom2_id": "///E/162/N6", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 259, "atom1_serNum": 3422, "atom2_serNum": 3528, "donAcc_type": "standard", "distance": 2.652, "atom1_id": "///E/158/N2", "atom2_id": "///E/163/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 260, "atom1_serNum": 3435, "atom2_serNum": 3484, "donAcc_type": "acceptable", "distance": 2.909, "atom1_id": "///E/159/O2'", "atom2_id": "///E/161/N7", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 261, "atom1_serNum": 3435, "atom2_serNum": 3487, "donAcc_type": "acceptable", "distance": 3.324, "atom1_id": "///E/159/O2'", "atom2_id": "///E/161/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 262, "atom1_serNum": 3442, "atom2_serNum": 3531, "donAcc_type": "standard", "distance": 3.322, "atom1_id": "///E/159/O6", "atom2_id": "///E/163/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 263, "atom1_serNum": 3445, "atom2_serNum": 3494, "donAcc_type": "standard", "distance": 3.092, "atom1_id": "///E/159/N2", "atom2_id": "///E/162/OP2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 264, "atom1_serNum": 3445, "atom2_serNum": 3506, "donAcc_type": "standard", "distance": 2.922, "atom1_id": "///E/159/N2", "atom2_id": "///E/162/N7", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 265, "atom1_serNum": 3446, "atom2_serNum": 3509, "donAcc_type": "standard", "distance": 3.927, "atom1_id": "///E/159/N3", "atom2_id": "///E/162/N6", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 266, "atom1_serNum": 3465, "atom2_serNum": 3832, "donAcc_type": "standard", "distance": 3.718, "atom1_id": "///E/160/N6", "atom2_id": "///F/347/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 267, "atom1_serNum": 3466, "atom2_serNum": 3831, "donAcc_type": "standard", "distance": 3.364, "atom1_id": "///E/160/N1", "atom2_id": "///F/347/N2", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 268, "atom1_serNum": 3488, "atom2_serNum": 3821, "donAcc_type": "acceptable", "distance": 2.977, "atom1_id": "///E/161/N1", "atom2_id": "///F/347/O2'", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 269, "atom1_serNum": 3502, "atom2_serNum": 3858, "donAcc_type": "acceptable", "distance": 3.630, "atom1_id": "///E/162/O2'", "atom2_id": "///F/349/OP1", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 270, "atom1_serNum": 3610, "atom2_serNum": 3628, "donAcc_type": "acceptable", "distance": 2.826, "atom1_id": "///E/167/O2'", "atom2_id": "///E/168/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 271, "atom1_serNum": 3660, "atom2_serNum": 3899, "donAcc_type": "standard", "distance": 2.835, "atom1_id": "///F/339/O2", "atom2_id": "///F/350/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 272, "atom1_serNum": 3661, "atom2_serNum": 3897, "donAcc_type": "standard", "distance": 2.901, "atom1_id": "///F/339/N3", "atom2_id": "///F/350/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 273, "atom1_serNum": 3663, "atom2_serNum": 3896, "donAcc_type": "standard", "distance": 2.848, "atom1_id": "///F/339/N4", "atom2_id": "///F/350/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 274, "atom1_serNum": 3676, "atom2_serNum": 3692, "donAcc_type": "acceptable", "distance": 3.181, "atom1_id": "///F/340/O2'", "atom2_id": "///F/341/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 275, "atom1_serNum": 3681, "atom2_serNum": 3875, "donAcc_type": "standard", "distance": 2.711, "atom1_id": "///F/340/N3", "atom2_id": "///F/349/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 276, "atom1_serNum": 3683, "atom2_serNum": 3874, "donAcc_type": "standard", "distance": 3.010, "atom1_id": "///F/340/O4", "atom2_id": "///F/349/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 277, "atom1_serNum": 3696, "atom2_serNum": 3712, "donAcc_type": "acceptable", "distance": 3.106, "atom1_id": "///F/341/O2'", "atom2_id": "///F/342/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 278, "atom1_serNum": 3700, "atom2_serNum": 3854, "donAcc_type": "standard", "distance": 2.788, "atom1_id": "///F/341/O2", "atom2_id": "///F/348/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 279, "atom1_serNum": 3701, "atom2_serNum": 3852, "donAcc_type": "standard", "distance": 2.931, "atom1_id": "///F/341/N3", "atom2_id": "///F/348/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 280, "atom1_serNum": 3703, "atom2_serNum": 3851, "donAcc_type": "standard", "distance": 2.958, "atom1_id": "///F/341/N4", "atom2_id": "///F/348/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 281, "atom1_serNum": 3720, "atom2_serNum": 3831, "donAcc_type": "standard", "distance": 2.760, "atom1_id": "///F/342/O2", "atom2_id": "///F/347/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 282, "atom1_serNum": 3721, "atom2_serNum": 3829, "donAcc_type": "standard", "distance": 2.858, "atom1_id": "///F/342/N3", "atom2_id": "///F/347/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 283, "atom1_serNum": 3723, "atom2_serNum": 3828, "donAcc_type": "standard", "distance": 2.837, "atom1_id": "///F/342/N4", "atom2_id": "///F/347/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 284, "atom1_serNum": 3736, "atom2_serNum": 3805, "donAcc_type": "acceptable", "distance": 2.719, "atom1_id": "///F/343/O2'", "atom2_id": "///F/346/O6", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 285, "atom1_serNum": 3740, "atom2_serNum": 3806, "donAcc_type": "standard", "distance": 3.144, "atom1_id": "///F/343/O2", "atom2_id": "///F/346/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 286, "atom1_serNum": 3748, "atom2_serNum": 3785, "donAcc_type": "standard", "distance": 3.288, "atom1_id": "///F/344/OP2", "atom2_id": "///F/345/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 287, "atom1_serNum": 3756, "atom2_serNum": 3805, "donAcc_type": "acceptable", "distance": 3.513, "atom1_id": "///F/344/O2'", "atom2_id": "///F/346/O6", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 288, "atom1_serNum": 3821, "atom2_serNum": 3837, "donAcc_type": "acceptable", "distance": 2.660, "atom1_id": "///F/347/O2'", "atom2_id": "///F/348/O5'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 289, "atom1_serNum": 3867, "atom2_serNum": 3885, "donAcc_type": "acceptable", "distance": 3.002, "atom1_id": "///F/349/O2'", "atom2_id": "///F/350/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 290, "atom1_serNum": 3917, "atom2_serNum": 4018, "donAcc_type": "acceptable", "distance": 3.306, "atom1_id": "///G/1043/O2", "atom2_id": "///G/1048/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 291, "atom1_serNum": 3917, "atom2_serNum": 5398, "donAcc_type": "standard", "distance": 2.907, "atom1_id": "///G/1043/O2", "atom2_id": "///G/1112/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 292, "atom1_serNum": 3918, "atom2_serNum": 5396, "donAcc_type": "standard", "distance": 2.931, "atom1_id": "///G/1043/N3", "atom2_id": "///G/1112/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 293, "atom1_serNum": 3920, "atom2_serNum": 5395, "donAcc_type": "standard", "distance": 2.822, "atom1_id": "///G/1043/N4", "atom2_id": "///G/1112/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 294, "atom1_serNum": 3933, "atom2_serNum": 4014, "donAcc_type": "acceptable", "distance": 2.854, "atom1_id": "///G/1044/O2'", "atom2_id": "///G/1048/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 295, "atom1_serNum": 3933, "atom2_serNum": 5374, "donAcc_type": "acceptable", "distance": 3.233, "atom1_id": "///G/1044/O2'", "atom2_id": "///G/1111/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 296, "atom1_serNum": 3946, "atom2_serNum": 3991, "donAcc_type": "questionable", "distance": 2.598, "atom1_id": "///G/1045/O5'", "atom2_id": "///G/1047/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 297, "atom1_serNum": 3995, "atom2_serNum": 4010, "donAcc_type": "acceptable", "distance": 2.722, "atom1_id": "///G/1047/O2'", "atom2_id": "///G/1048/OP2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 298, "atom1_serNum": 3995, "atom2_serNum": 5351, "donAcc_type": "acceptable", "distance": 2.427, "atom1_id": "///G/1047/O2'", "atom2_id": "///G/1110/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 299, "atom1_serNum": 3995, "atom2_serNum": 5353, "donAcc_type": "acceptable", "distance": 2.720, "atom1_id": "///G/1047/O2'", "atom2_id": "///G/1110/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 300, "atom1_serNum": 4005, "atom2_serNum": 5343, "donAcc_type": "acceptable", "distance": 3.132, "atom1_id": "///G/1047/N2", "atom2_id": "///G/1110/O2'", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 301, "atom1_serNum": 4005, "atom2_serNum": 5370, "donAcc_type": "standard", "distance": 2.686, "atom1_id": "///G/1047/N2", "atom2_id": "///G/1111/N7", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 302, "atom1_serNum": 4006, "atom2_serNum": 5373, "donAcc_type": "standard", "distance": 3.082, "atom1_id": "///G/1047/N3", "atom2_id": "///G/1111/N6", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 303, "atom1_serNum": 4022, "atom2_serNum": 5353, "donAcc_type": "standard", "distance": 2.615, "atom1_id": "///G/1048/N7", "atom2_id": "///G/1110/N2", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 304, "atom1_serNum": 4026, "atom2_serNum": 5388, "donAcc_type": "acceptable", "distance": 2.577, "atom1_id": "///G/1048/N1", "atom2_id": "///G/1112/O2'", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 305, "atom1_serNum": 4028, "atom2_serNum": 5398, "donAcc_type": "standard", "distance": 2.892, "atom1_id": "///G/1048/N3", "atom2_id": "///G/1112/N2", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 306, "atom1_serNum": 4040, "atom2_serNum": 4056, "donAcc_type": "acceptable", "distance": 3.151, "atom1_id": "///G/1049/O2'", "atom2_id": "///G/1050/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 307, "atom1_serNum": 4089, "atom2_serNum": 5308, "donAcc_type": "standard", "distance": 2.923, "atom1_id": "///G/1051/O6", "atom2_id": "///G/1108/N3", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 308, "atom1_serNum": 4090, "atom2_serNum": 5307, "donAcc_type": "standard", "distance": 2.944, "atom1_id": "///G/1051/N1", "atom2_id": "///G/1108/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 309, "atom1_serNum": 4109, "atom2_serNum": 5290, "donAcc_type": "standard", "distance": 2.749, "atom1_id": "///G/1052/O2", "atom2_id": "///G/1107/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 310, "atom1_serNum": 4110, "atom2_serNum": 5288, "donAcc_type": "standard", "distance": 2.883, "atom1_id": "///G/1052/N3", "atom2_id": "///G/1107/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 311, "atom1_serNum": 4112, "atom2_serNum": 5287, "donAcc_type": "standard", "distance": 2.937, "atom1_id": "///G/1052/N4", "atom2_id": "///G/1107/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 312, "atom1_serNum": 4125, "atom2_serNum": 4141, "donAcc_type": "acceptable", "distance": 3.161, "atom1_id": "///G/1053/O2'", "atom2_id": "///G/1054/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 313, "atom1_serNum": 4129, "atom2_serNum": 5267, "donAcc_type": "standard", "distance": 2.704, "atom1_id": "///G/1053/O2", "atom2_id": "///G/1106/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 314, "atom1_serNum": 4130, "atom2_serNum": 5265, "donAcc_type": "standard", "distance": 2.834, "atom1_id": "///G/1053/N3", "atom2_id": "///G/1106/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 315, "atom1_serNum": 4132, "atom2_serNum": 5264, "donAcc_type": "standard", "distance": 2.864, "atom1_id": "///G/1053/N4", "atom2_id": "///G/1106/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 316, "atom1_serNum": 4152, "atom2_serNum": 5244, "donAcc_type": "standard", "distance": 2.957, "atom1_id": "///G/1054/N6", "atom2_id": "///G/1105/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 317, "atom1_serNum": 4153, "atom2_serNum": 5242, "donAcc_type": "standard", "distance": 2.684, "atom1_id": "///G/1054/N1", "atom2_id": "///G/1105/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 318, "atom1_serNum": 4167, "atom2_serNum": 4815, "donAcc_type": "acceptable", "distance": 2.857, "atom1_id": "///G/1055/O2'", "atom2_id": "///G/1085/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 319, "atom1_serNum": 4174, "atom2_serNum": 5224, "donAcc_type": "standard", "distance": 2.991, "atom1_id": "///G/1055/O6", "atom2_id": "///G/1104/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 320, "atom1_serNum": 4175, "atom2_serNum": 5222, "donAcc_type": "standard", "distance": 2.970, "atom1_id": "///G/1055/N1", "atom2_id": "///G/1104/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 321, "atom1_serNum": 4177, "atom2_serNum": 4817, "donAcc_type": "standard", "distance": 3.226, "atom1_id": "///G/1055/N2", "atom2_id": "///G/1085/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 322, "atom1_serNum": 4177, "atom2_serNum": 5221, "donAcc_type": "standard", "distance": 2.862, "atom1_id": "///G/1055/N2", "atom2_id": "///G/1104/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 323, "atom1_serNum": 4190, "atom2_serNum": 4829, "donAcc_type": "acceptable", "distance": 3.491, "atom1_id": "///G/1056/O2'", "atom2_id": "///G/1086/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 324, "atom1_serNum": 4190, "atom2_serNum": 5202, "donAcc_type": "acceptable", "distance": 3.185, "atom1_id": "///G/1056/O2'", "atom2_id": "///G/1103/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 325, "atom1_serNum": 4200, "atom2_serNum": 5199, "donAcc_type": "standard", "distance": 2.749, "atom1_id": "///G/1056/N2", "atom2_id": "///G/1103/N7", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 326, "atom1_serNum": 4201, "atom2_serNum": 5202, "donAcc_type": "standard", "distance": 3.180, "atom1_id": "///G/1056/N3", "atom2_id": "///G/1103/N6", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 327, "atom1_serNum": 4220, "atom2_serNum": 4732, "donAcc_type": "standard", "distance": 2.937, "atom1_id": "///G/1057/N6", "atom2_id": "///G/1081/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 328, "atom1_serNum": 4220, "atom2_serNum": 4843, "donAcc_type": "standard", "distance": 3.346, "atom1_id": "///G/1057/N6", "atom2_id": "///G/1087/OP2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 329, "atom1_serNum": 4221, "atom2_serNum": 4730, "donAcc_type": "standard", "distance": 2.861, "atom1_id": "///G/1057/N1", "atom2_id": "///G/1081/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 330, "atom1_serNum": 4235, "atom2_serNum": 12768, "donAcc_type": "acceptable", "distance": 3.412, "atom1_id": "///G/1058/O2'", "atom2_id": "///H/115/O", "atom_pair": "O:O", "residue_pair": "nt:aa" }, { "index": 331, "atom1_serNum": 4240, "atom2_serNum": 4711, "donAcc_type": "standard", "distance": 2.802, "atom1_id": "///G/1058/N3", "atom2_id": "///G/1080/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 332, "atom1_serNum": 4242, "atom2_serNum": 4710, "donAcc_type": "standard", "distance": 2.982, "atom1_id": "///G/1058/O4", "atom2_id": "///G/1080/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 333, "atom1_serNum": 4259, "atom2_serNum": 4278, "donAcc_type": "acceptable", "distance": 3.271, "atom1_id": "///G/1059/N7", "atom2_id": "///G/1060/O2'", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 334, "atom1_serNum": 4262, "atom2_serNum": 4690, "donAcc_type": "standard", "distance": 2.854, "atom1_id": "///G/1059/O6", "atom2_id": "///G/1079/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 335, "atom1_serNum": 4263, "atom2_serNum": 4688, "donAcc_type": "standard", "distance": 2.951, "atom1_id": "///G/1059/N1", "atom2_id": "///G/1079/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 336, "atom1_serNum": 4265, "atom2_serNum": 4687, "donAcc_type": "standard", "distance": 2.908, "atom1_id": "///G/1059/N2", "atom2_id": "///G/1079/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 337, "atom1_serNum": 4265, "atom2_serNum": 12856, "donAcc_type": "standard", "distance": 2.818, "atom1_id": "///G/1059/N2", "atom2_id": "///H/127/O", "atom_pair": "N:O", "residue_pair": "nt:aa" }, { "index": 338, "atom1_serNum": 4270, "atom2_serNum": 12754, "donAcc_type": "standard", "distance": 2.952, "atom1_id": "///G/1060/OP2", "atom2_id": "///H/112/NZ", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 339, "atom1_serNum": 4282, "atom2_serNum": 4310, "donAcc_type": "questionable", "distance": 2.954, "atom1_id": "///G/1060/O2", "atom2_id": "///G/1062/OP2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 340, "atom1_serNum": 4283, "atom2_serNum": 4878, "donAcc_type": "standard", "distance": 2.201, "atom1_id": "///G/1060/N3", "atom2_id": "///G/1088/N7", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 341, "atom1_serNum": 4285, "atom2_serNum": 4881, "donAcc_type": "standard", "distance": 2.315, "atom1_id": "///G/1060/O4", "atom2_id": "///G/1088/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 342, "atom1_serNum": 4294, "atom2_serNum": 4487, "donAcc_type": "questionable", "distance": 2.960, "atom1_id": "///G/1061/O4'", "atom2_id": "///G/1070/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 343, "atom1_serNum": 4305, "atom2_serNum": 12016, "donAcc_type": "questionable", "distance": 2.680, "atom1_id": "///G/1061/O4", "atom2_id": "///H/11/OE1", "atom_pair": "O:O", "residue_pair": "nt:aa" }, { "index": 344, "atom1_serNum": 4325, "atom2_serNum": 4628, "donAcc_type": "standard", "distance": 2.851, "atom1_id": "///G/1062/O6", "atom2_id": "///G/1076/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 345, "atom1_serNum": 4326, "atom2_serNum": 4626, "donAcc_type": "standard", "distance": 2.920, "atom1_id": "///G/1062/N1", "atom2_id": "///G/1076/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 346, "atom1_serNum": 4328, "atom2_serNum": 4625, "donAcc_type": "standard", "distance": 2.857, "atom1_id": "///G/1062/N2", "atom2_id": "///G/1076/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 347, "atom1_serNum": 4328, "atom2_serNum": 12906, "donAcc_type": "standard", "distance": 2.996, "atom1_id": "///G/1062/N2", "atom2_id": "///H/134/O", "atom_pair": "N:O", "residue_pair": "nt:aa" }, { "index": 348, "atom1_serNum": 4339, "atom2_serNum": 12568, "donAcc_type": "standard", "distance": 3.298, "atom1_id": "///G/1063/O3'", "atom2_id": "///H/88/N", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 349, "atom1_serNum": 4341, "atom2_serNum": 12572, "donAcc_type": "acceptable", "distance": 3.083, "atom1_id": "///G/1063/O2'", "atom2_id": "///H/89/N", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 350, "atom1_serNum": 4348, "atom2_serNum": 4608, "donAcc_type": "standard", "distance": 2.856, "atom1_id": "///G/1063/O6", "atom2_id": "///G/1075/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 351, "atom1_serNum": 4349, "atom2_serNum": 4606, "donAcc_type": "standard", "distance": 2.913, "atom1_id": "///G/1063/N1", "atom2_id": "///G/1075/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 352, "atom1_serNum": 4351, "atom2_serNum": 4605, "donAcc_type": "standard", "distance": 2.840, "atom1_id": "///G/1063/N2", "atom2_id": "///G/1075/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 353, "atom1_serNum": 4351, "atom2_serNum": 12581, "donAcc_type": "standard", "distance": 2.879, "atom1_id": "///G/1063/N2", "atom2_id": "///H/90/O", "atom_pair": "N:O", "residue_pair": "nt:aa" }, { "index": 354, "atom1_serNum": 4355, "atom2_serNum": 12568, "donAcc_type": "standard", "distance": 2.908, "atom1_id": "///G/1064/OP1", "atom2_id": "///H/88/N", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 355, "atom1_serNum": 4368, "atom2_serNum": 4588, "donAcc_type": "standard", "distance": 2.828, "atom1_id": "///G/1064/O2", "atom2_id": "///G/1074/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 356, "atom1_serNum": 4369, "atom2_serNum": 4586, "donAcc_type": "standard", "distance": 2.940, "atom1_id": "///G/1064/N3", "atom2_id": "///G/1074/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 357, "atom1_serNum": 4371, "atom2_serNum": 4469, "donAcc_type": "acceptable", "distance": 3.572, "atom1_id": "///G/1064/N4", "atom2_id": "///G/1069/O2'", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 358, "atom1_serNum": 4371, "atom2_serNum": 4482, "donAcc_type": "standard", "distance": 3.568, "atom1_id": "///G/1064/N4", "atom2_id": "///G/1070/OP1", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 359, "atom1_serNum": 4371, "atom2_serNum": 4585, "donAcc_type": "standard", "distance": 2.924, "atom1_id": "///G/1064/N4", "atom2_id": "///G/1074/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 360, "atom1_serNum": 4388, "atom2_serNum": 4563, "donAcc_type": "standard", "distance": 2.831, "atom1_id": "///G/1065/O2", "atom2_id": "///G/1073/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 361, "atom1_serNum": 4389, "atom2_serNum": 4469, "donAcc_type": "acceptable", "distance": 3.745, "atom1_id": "///G/1065/N3", "atom2_id": "///G/1069/O2'", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 362, "atom1_serNum": 4404, "atom2_serNum": 4450, "donAcc_type": "acceptable", "distance": 2.558, "atom1_id": "///G/1066/O2'", "atom2_id": "///G/1068/N7", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 363, "atom1_serNum": 4409, "atom2_serNum": 4461, "donAcc_type": "standard", "distance": 2.725, "atom1_id": "///G/1066/N3", "atom2_id": "///G/1069/OP2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 364, "atom1_serNum": 4446, "atom2_serNum": 5048, "donAcc_type": "acceptable", "distance": 2.831, "atom1_id": "///G/1068/O2'", "atom2_id": "///G/1096/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 365, "atom1_serNum": 4453, "atom2_serNum": 4476, "donAcc_type": "standard", "distance": 2.763, "atom1_id": "///G/1068/O6", "atom2_id": "///G/1069/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 366, "atom1_serNum": 4456, "atom2_serNum": 5024, "donAcc_type": "standard", "distance": 3.213, "atom1_id": "///G/1068/N2", "atom2_id": "///G/1095/O3'", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 367, "atom1_serNum": 4456, "atom2_serNum": 5026, "donAcc_type": "acceptable", "distance": 2.711, "atom1_id": "///G/1068/N2", "atom2_id": "///G/1095/O2'", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 368, "atom1_serNum": 4469, "atom2_serNum": 4585, "donAcc_type": "acceptable", "distance": 3.013, "atom1_id": "///G/1069/O2'", "atom2_id": "///G/1074/O6", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 369, "atom1_serNum": 4483, "atom2_serNum": 4527, "donAcc_type": "questionable", "distance": 3.346, "atom1_id": "///G/1070/OP2", "atom2_id": "///G/1072/OP1", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 370, "atom1_serNum": 4491, "atom2_serNum": 4504, "donAcc_type": "acceptable", "distance": 2.626, "atom1_id": "///G/1070/O2'", "atom2_id": "///G/1071/OP1", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 371, "atom1_serNum": 4491, "atom2_serNum": 5068, "donAcc_type": "acceptable", "distance": 3.230, "atom1_id": "///G/1070/O2'", "atom2_id": "///G/1097/O3'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 372, "atom1_serNum": 4495, "atom2_serNum": 5048, "donAcc_type": "acceptable", "distance": 2.623, "atom1_id": "///G/1070/N7", "atom2_id": "///G/1096/O2'", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 373, "atom1_serNum": 4513, "atom2_serNum": 4888, "donAcc_type": "acceptable", "distance": 2.576, "atom1_id": "///G/1071/O2'", "atom2_id": "///G/1089/OP2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 374, "atom1_serNum": 4520, "atom2_serNum": 5142, "donAcc_type": "standard", "distance": 2.650, "atom1_id": "///G/1071/O6", "atom2_id": "///G/1100/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 375, "atom1_serNum": 4521, "atom2_serNum": 4947, "donAcc_type": "standard", "distance": 2.736, "atom1_id": "///G/1071/N1", "atom2_id": "///G/1091/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 376, "atom1_serNum": 4523, "atom2_serNum": 4896, "donAcc_type": "acceptable", "distance": 3.101, "atom1_id": "///G/1071/N2", "atom2_id": "///G/1089/O2'", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 377, "atom1_serNum": 4523, "atom2_serNum": 4944, "donAcc_type": "standard", "distance": 3.027, "atom1_id": "///G/1071/N2", "atom2_id": "///G/1091/N7", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 378, "atom1_serNum": 4524, "atom2_serNum": 4896, "donAcc_type": "acceptable", "distance": 2.997, "atom1_id": "///G/1071/N3", "atom2_id": "///G/1089/O2'", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 379, "atom1_serNum": 4540, "atom2_serNum": 4970, "donAcc_type": "standard", "distance": 2.901, "atom1_id": "///G/1072/O2", "atom2_id": "///G/1092/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 380, "atom1_serNum": 4541, "atom2_serNum": 4970, "donAcc_type": "standard", "distance": 2.645, "atom1_id": "///G/1072/N3", "atom2_id": "///G/1092/N4", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 381, "atom1_serNum": 4543, "atom2_serNum": 5119, "donAcc_type": "standard", "distance": 3.291, "atom1_id": "///G/1072/N4", "atom2_id": "///G/1099/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 382, "atom1_serNum": 4621, "atom2_serNum": 12594, "donAcc_type": "acceptable", "distance": 2.983, "atom1_id": "///G/1076/O2'", "atom2_id": "///H/92/O", "atom_pair": "O:O", "residue_pair": "nt:aa" }, { "index": 383, "atom1_serNum": 4639, "atom2_serNum": 12604, "donAcc_type": "questionable", "distance": 2.892, "atom1_id": "///G/1077/O3'", "atom2_id": "///H/93/OD1", "atom_pair": "O:O", "residue_pair": "nt:aa" }, { "index": 384, "atom1_serNum": 4648, "atom2_serNum": 4887, "donAcc_type": "standard", "distance": 3.153, "atom1_id": "///G/1077/N6", "atom2_id": "///G/1089/OP1", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 385, "atom1_serNum": 4649, "atom2_serNum": 4874, "donAcc_type": "acceptable", "distance": 3.023, "atom1_id": "///G/1077/N1", "atom2_id": "///G/1088/O2'", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 386, "atom1_serNum": 4663, "atom2_serNum": 4865, "donAcc_type": "acceptable", "distance": 2.605, "atom1_id": "///G/1078/O2'", "atom2_id": "///G/1088/OP1", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 387, "atom1_serNum": 4667, "atom2_serNum": 4887, "donAcc_type": "questionable", "distance": 3.071, "atom1_id": "///G/1078/O2", "atom2_id": "///G/1089/OP1", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 388, "atom1_serNum": 4683, "atom2_serNum": 12899, "donAcc_type": "acceptable", "distance": 2.936, "atom1_id": "///G/1079/O2'", "atom2_id": "///H/133/NE", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 389, "atom1_serNum": 4683, "atom2_serNum": 12902, "donAcc_type": "acceptable", "distance": 2.568, "atom1_id": "///G/1079/O2'", "atom2_id": "///H/133/NH2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 390, "atom1_serNum": 4690, "atom2_serNum": 4867, "donAcc_type": "standard", "distance": 3.192, "atom1_id": "///G/1079/N4", "atom2_id": "///G/1088/O5'", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 391, "atom1_serNum": 4699, "atom2_serNum": 12902, "donAcc_type": "standard", "distance": 3.703, "atom1_id": "///G/1080/O4'", "atom2_id": "///H/133/NH2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 392, "atom1_serNum": 4703, "atom2_serNum": 4721, "donAcc_type": "acceptable", "distance": 2.933, "atom1_id": "///G/1080/O2'", "atom2_id": "///G/1081/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 393, "atom1_serNum": 4703, "atom2_serNum": 12825, "donAcc_type": "acceptable", "distance": 3.841, "atom1_id": "///G/1080/O2'", "atom2_id": "///H/123/O", "atom_pair": "O:O", "residue_pair": "nt:aa" }, { "index": 394, "atom1_serNum": 4721, "atom2_serNum": 12858, "donAcc_type": "acceptable", "distance": 3.198, "atom1_id": "///G/1081/O4'", "atom2_id": "///H/127/OG", "atom_pair": "O:O", "residue_pair": "nt:aa" }, { "index": 395, "atom1_serNum": 4725, "atom2_serNum": 12786, "donAcc_type": "acceptable", "distance": 3.653, "atom1_id": "///G/1081/O2'", "atom2_id": "///H/117/OG1", "atom_pair": "O:O", "residue_pair": "nt:aa" }, { "index": 396, "atom1_serNum": 4736, "atom2_serNum": 12792, "donAcc_type": "standard", "distance": 3.818, "atom1_id": "///G/1082/OP1", "atom2_id": "///H/119/N", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 397, "atom1_serNum": 4765, "atom2_serNum": 4811, "donAcc_type": "acceptable", "distance": 2.799, "atom1_id": "///G/1083/O2'", "atom2_id": "///G/1085/N7", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 398, "atom1_serNum": 4770, "atom2_serNum": 4821, "donAcc_type": "standard", "distance": 3.215, "atom1_id": "///G/1083/N3", "atom2_id": "///G/1086/OP2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 399, "atom1_serNum": 4785, "atom2_serNum": 5237, "donAcc_type": "acceptable", "distance": 2.742, "atom1_id": "///G/1084/O2'", "atom2_id": "///G/1105/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 400, "atom1_serNum": 4803, "atom2_serNum": 5233, "donAcc_type": "questionable", "distance": 3.349, "atom1_id": "///G/1085/O4'", "atom2_id": "///G/1105/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 401, "atom1_serNum": 4807, "atom2_serNum": 5217, "donAcc_type": "acceptable", "distance": 2.754, "atom1_id": "///G/1085/O2'", "atom2_id": "///G/1104/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 402, "atom1_serNum": 4807, "atom2_serNum": 5221, "donAcc_type": "acceptable", "distance": 3.364, "atom1_id": "///G/1085/O2'", "atom2_id": "///G/1104/O2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 403, "atom1_serNum": 4858, "atom2_serNum": 5182, "donAcc_type": "standard", "distance": 2.916, "atom1_id": "///G/1087/O6", "atom2_id": "///G/1102/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 404, "atom1_serNum": 4859, "atom2_serNum": 5180, "donAcc_type": "standard", "distance": 2.952, "atom1_id": "///G/1087/N1", "atom2_id": "///G/1102/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 405, "atom1_serNum": 4861, "atom2_serNum": 5179, "donAcc_type": "standard", "distance": 2.853, "atom1_id": "///G/1087/N2", "atom2_id": "///G/1102/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 406, "atom1_serNum": 4881, "atom2_serNum": 12879, "donAcc_type": "standard", "distance": 3.416, "atom1_id": "///G/1088/N6", "atom2_id": "///H/130/O", "atom_pair": "N:O", "residue_pair": "nt:aa" }, { "index": 407, "atom1_serNum": 4881, "atom2_serNum": 12908, "donAcc_type": "acceptable", "distance": 3.222, "atom1_id": "///G/1088/N6", "atom2_id": "///H/134/OG", "atom_pair": "N:O", "residue_pair": "nt:aa" }, { "index": 408, "atom1_serNum": 4896, "atom2_serNum": 4922, "donAcc_type": "acceptable", "distance": 2.890, "atom1_id": "///G/1089/O2'", "atom2_id": "///G/1090/N7", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 409, "atom1_serNum": 4918, "atom2_serNum": 4936, "donAcc_type": "acceptable", "distance": 2.984, "atom1_id": "///G/1090/O2'", "atom2_id": "///G/1091/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 410, "atom1_serNum": 4925, "atom2_serNum": 5162, "donAcc_type": "standard", "distance": 3.050, "atom1_id": "///G/1090/N6", "atom2_id": "///G/1101/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 411, "atom1_serNum": 4926, "atom2_serNum": 5160, "donAcc_type": "standard", "distance": 2.715, "atom1_id": "///G/1090/N1", "atom2_id": "///G/1101/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 412, "atom1_serNum": 4940, "atom2_serNum": 4959, "donAcc_type": "acceptable", "distance": 3.235, "atom1_id": "///G/1091/O2'", "atom2_id": "///G/1092/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 413, "atom1_serNum": 4947, "atom2_serNum": 5142, "donAcc_type": "standard", "distance": 2.932, "atom1_id": "///G/1091/O6", "atom2_id": "///G/1100/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 414, "atom1_serNum": 4948, "atom2_serNum": 5140, "donAcc_type": "standard", "distance": 2.936, "atom1_id": "///G/1091/N1", "atom2_id": "///G/1100/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 415, "atom1_serNum": 4950, "atom2_serNum": 5139, "donAcc_type": "standard", "distance": 2.814, "atom1_id": "///G/1091/N2", "atom2_id": "///G/1100/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 416, "atom1_serNum": 4967, "atom2_serNum": 5122, "donAcc_type": "standard", "distance": 2.836, "atom1_id": "///G/1092/O2", "atom2_id": "///G/1099/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 417, "atom1_serNum": 4968, "atom2_serNum": 5120, "donAcc_type": "standard", "distance": 2.942, "atom1_id": "///G/1092/N3", "atom2_id": "///G/1099/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 418, "atom1_serNum": 4970, "atom2_serNum": 5119, "donAcc_type": "standard", "distance": 2.919, "atom1_id": "///G/1092/N4", "atom2_id": "///G/1099/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 419, "atom1_serNum": 4983, "atom2_serNum": 5097, "donAcc_type": "acceptable", "distance": 3.069, "atom1_id": "///G/1093/O2'", "atom2_id": "///G/1098/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 420, "atom1_serNum": 4993, "atom2_serNum": 5094, "donAcc_type": "standard", "distance": 2.909, "atom1_id": "///G/1093/N2", "atom2_id": "///G/1098/N7", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 421, "atom1_serNum": 4994, "atom2_serNum": 5097, "donAcc_type": "standard", "distance": 2.958, "atom1_id": "///G/1093/N3", "atom2_id": "///G/1098/N6", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 422, "atom1_serNum": 5006, "atom2_serNum": 5052, "donAcc_type": "acceptable", "distance": 2.718, "atom1_id": "///G/1094/O2'", "atom2_id": "///G/1096/N7", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 423, "atom1_serNum": 5011, "atom2_serNum": 5062, "donAcc_type": "standard", "distance": 3.102, "atom1_id": "///G/1094/N3", "atom2_id": "///G/1097/OP2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 424, "atom1_serNum": 5175, "atom2_serNum": 5191, "donAcc_type": "acceptable", "distance": 3.177, "atom1_id": "///G/1102/O2'", "atom2_id": "///G/1103/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 425, "atom1_serNum": 5187, "atom2_serNum": 5224, "donAcc_type": "standard", "distance": 3.620, "atom1_id": "///G/1103/OP2", "atom2_id": "///G/1104/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 426, "atom1_serNum": 5237, "atom2_serNum": 5253, "donAcc_type": "acceptable", "distance": 2.891, "atom1_id": "///G/1105/O2'", "atom2_id": "///G/1106/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 427, "atom1_serNum": 5343, "atom2_serNum": 5358, "donAcc_type": "acceptable", "distance": 3.103, "atom1_id": "///G/1110/O2'", "atom2_id": "///G/1111/OP2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 428, "atom1_serNum": 5366, "atom2_serNum": 5380, "donAcc_type": "acceptable", "distance": 2.558, "atom1_id": "///G/1111/O2'", "atom2_id": "///G/1112/OP2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 429, "atom1_serNum": 5416, "atom2_serNum": 6024, "donAcc_type": "standard", "distance": 2.879, "atom1_id": "///I/2646/O2", "atom2_id": "///I/2674/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 430, "atom1_serNum": 5417, "atom2_serNum": 6022, "donAcc_type": "standard", "distance": 2.865, "atom1_id": "///I/2646/N3", "atom2_id": "///I/2674/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 431, "atom1_serNum": 5419, "atom2_serNum": 6021, "donAcc_type": "standard", "distance": 2.739, "atom1_id": "///I/2646/N4", "atom2_id": "///I/2674/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 432, "atom1_serNum": 5432, "atom2_serNum": 5445, "donAcc_type": "acceptable", "distance": 2.765, "atom1_id": "///I/2647/O2'", "atom2_id": "///I/2648/O5'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 433, "atom1_serNum": 5432, "atom2_serNum": 5448, "donAcc_type": "acceptable", "distance": 2.951, "atom1_id": "///I/2647/O2'", "atom2_id": "///I/2648/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 434, "atom1_serNum": 5436, "atom2_serNum": 5999, "donAcc_type": "standard", "distance": 2.760, "atom1_id": "///I/2647/O2", "atom2_id": "///I/2673/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 435, "atom1_serNum": 5437, "atom2_serNum": 5998, "donAcc_type": "standard", "distance": 2.816, "atom1_id": "///I/2647/N3", "atom2_id": "///I/2673/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 436, "atom1_serNum": 5459, "atom2_serNum": 5976, "donAcc_type": "standard", "distance": 2.821, "atom1_id": "///I/2648/O6", "atom2_id": "///I/2672/N3", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 437, "atom1_serNum": 5460, "atom2_serNum": 5975, "donAcc_type": "standard", "distance": 2.950, "atom1_id": "///I/2648/N1", "atom2_id": "///I/2672/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 438, "atom1_serNum": 5475, "atom2_serNum": 5491, "donAcc_type": "acceptable", "distance": 2.975, "atom1_id": "///I/2649/O2'", "atom2_id": "///I/2650/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 439, "atom1_serNum": 5479, "atom2_serNum": 5958, "donAcc_type": "standard", "distance": 2.888, "atom1_id": "///I/2649/O2", "atom2_id": "///I/2671/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 440, "atom1_serNum": 5480, "atom2_serNum": 5956, "donAcc_type": "standard", "distance": 2.924, "atom1_id": "///I/2649/N3", "atom2_id": "///I/2671/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 441, "atom1_serNum": 5482, "atom2_serNum": 5955, "donAcc_type": "standard", "distance": 2.823, "atom1_id": "///I/2649/N4", "atom2_id": "///I/2671/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 442, "atom1_serNum": 5495, "atom2_serNum": 5511, "donAcc_type": "acceptable", "distance": 3.296, "atom1_id": "///I/2650/O2'", "atom2_id": "///I/2651/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 443, "atom1_serNum": 5500, "atom2_serNum": 5934, "donAcc_type": "standard", "distance": 2.874, "atom1_id": "///I/2650/N3", "atom2_id": "///I/2670/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 444, "atom1_serNum": 5502, "atom2_serNum": 5933, "donAcc_type": "standard", "distance": 2.927, "atom1_id": "///I/2650/O4", "atom2_id": "///I/2670/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 445, "atom1_serNum": 5519, "atom2_serNum": 5913, "donAcc_type": "standard", "distance": 2.780, "atom1_id": "///I/2651/O2", "atom2_id": "///I/2669/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 446, "atom1_serNum": 5520, "atom2_serNum": 5911, "donAcc_type": "standard", "distance": 2.926, "atom1_id": "///I/2651/N3", "atom2_id": "///I/2669/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 447, "atom1_serNum": 5522, "atom2_serNum": 5910, "donAcc_type": "standard", "distance": 2.968, "atom1_id": "///I/2651/N4", "atom2_id": "///I/2669/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 448, "atom1_serNum": 5539, "atom2_serNum": 5890, "donAcc_type": "standard", "distance": 2.754, "atom1_id": "///I/2652/O2", "atom2_id": "///I/2668/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 449, "atom1_serNum": 5540, "atom2_serNum": 5888, "donAcc_type": "standard", "distance": 2.907, "atom1_id": "///I/2652/N3", "atom2_id": "///I/2668/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 450, "atom1_serNum": 5542, "atom2_serNum": 5887, "donAcc_type": "standard", "distance": 2.936, "atom1_id": "///I/2652/N4", "atom2_id": "///I/2668/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 451, "atom1_serNum": 5547, "atom2_serNum": 5575, "donAcc_type": "acceptable", "distance": 2.857, "atom1_id": "///I/2653/OP2", "atom2_id": "///I/2654/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 452, "atom1_serNum": 5547, "atom2_serNum": 5589, "donAcc_type": "questionable", "distance": 3.022, "atom1_id": "///I/2653/OP2", "atom2_id": "///I/2655/OP2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 453, "atom1_serNum": 5559, "atom2_serNum": 5867, "donAcc_type": "standard", "distance": 3.010, "atom1_id": "///I/2653/O2", "atom2_id": "///I/2667/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 454, "atom1_serNum": 5571, "atom2_serNum": 5616, "donAcc_type": "questionable", "distance": 3.050, "atom1_id": "///I/2654/O4'", "atom2_id": "///I/2656/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 455, "atom1_serNum": 5579, "atom2_serNum": 5847, "donAcc_type": "standard", "distance": 3.253, "atom1_id": "///I/2654/N7", "atom2_id": "///I/2666/N4", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 456, "atom1_serNum": 5582, "atom2_serNum": 5832, "donAcc_type": "standard", "distance": 3.130, "atom1_id": "///I/2654/N6", "atom2_id": "///I/2666/OP2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 457, "atom1_serNum": 5582, "atom2_serNum": 5845, "donAcc_type": "standard", "distance": 2.949, "atom1_id": "///I/2654/N6", "atom2_id": "///I/2666/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 458, "atom1_serNum": 5582, "atom2_serNum": 5867, "donAcc_type": "questionable", "distance": 3.121, "atom1_id": "///I/2654/N6", "atom2_id": "///I/2667/N4", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 459, "atom1_serNum": 5597, "atom2_serNum": 5612, "donAcc_type": "acceptable", "distance": 2.501, "atom1_id": "///I/2655/O2'", "atom2_id": "///I/2656/OP2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 460, "atom1_serNum": 5597, "atom2_serNum": 5802, "donAcc_type": "acceptable", "distance": 2.451, "atom1_id": "///I/2655/O2'", "atom2_id": "///I/2664/O6", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 461, "atom1_serNum": 5597, "atom2_serNum": 5803, "donAcc_type": "acceptable", "distance": 3.308, "atom1_id": "///I/2655/O2'", "atom2_id": "///I/2664/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 462, "atom1_serNum": 5607, "atom2_serNum": 5627, "donAcc_type": "standard", "distance": 3.229, "atom1_id": "///I/2655/N2", "atom2_id": "///I/2656/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 463, "atom1_serNum": 5607, "atom2_serNum": 5810, "donAcc_type": "standard", "distance": 3.298, "atom1_id": "///I/2655/N2", "atom2_id": "///I/2665/OP2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 464, "atom1_serNum": 5612, "atom2_serNum": 5803, "donAcc_type": "standard", "distance": 2.926, "atom1_id": "///I/2656/OP2", "atom2_id": "///I/2664/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 465, "atom1_serNum": 5624, "atom2_serNum": 5825, "donAcc_type": "standard", "distance": 2.919, "atom1_id": "///I/2656/O2", "atom2_id": "///I/2665/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 466, "atom1_serNum": 5625, "atom2_serNum": 5822, "donAcc_type": "standard", "distance": 2.829, "atom1_id": "///I/2656/N3", "atom2_id": "///I/2665/N7", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 467, "atom1_serNum": 5631, "atom2_serNum": 7546, "donAcc_type": "standard", "distance": 3.117, "atom1_id": "///I/2657/OP1", "atom2_id": "///C/106/NE2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 468, "atom1_serNum": 5632, "atom2_serNum": 5669, "donAcc_type": "standard", "distance": 3.898, "atom1_id": "///I/2657/OP2", "atom2_id": "///I/2658/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 469, "atom1_serNum": 5644, "atom2_serNum": 5805, "donAcc_type": "standard", "distance": 2.873, "atom1_id": "///I/2657/N7", "atom2_id": "///I/2664/N2", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 470, "atom1_serNum": 5647, "atom2_serNum": 5795, "donAcc_type": "acceptable", "distance": 3.115, "atom1_id": "///I/2657/N6", "atom2_id": "///I/2664/O2'", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 471, "atom1_serNum": 5647, "atom2_serNum": 5806, "donAcc_type": "standard", "distance": 2.982, "atom1_id": "///I/2657/N6", "atom2_id": "///I/2664/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 472, "atom1_serNum": 5666, "atom2_serNum": 5782, "donAcc_type": "standard", "distance": 2.744, "atom1_id": "///I/2658/O2", "atom2_id": "///I/2663/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 473, "atom1_serNum": 5667, "atom2_serNum": 5780, "donAcc_type": "standard", "distance": 2.883, "atom1_id": "///I/2658/N3", "atom2_id": "///I/2663/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 474, "atom1_serNum": 5669, "atom2_serNum": 5779, "donAcc_type": "standard", "distance": 2.910, "atom1_id": "///I/2658/N4", "atom2_id": "///I/2663/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 475, "atom1_serNum": 5674, "atom2_serNum": 10313, "donAcc_type": "standard", "distance": 2.748, "atom1_id": "///I/2659/OP2", "atom2_id": "///C/463/NH1", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 476, "atom1_serNum": 5682, "atom2_serNum": 5731, "donAcc_type": "acceptable", "distance": 2.761, "atom1_id": "///I/2659/O2'", "atom2_id": "///I/2661/N7", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 477, "atom1_serNum": 5692, "atom2_serNum": 5742, "donAcc_type": "standard", "distance": 2.758, "atom1_id": "///I/2659/N2", "atom2_id": "///I/2662/OP2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 478, "atom1_serNum": 5692, "atom2_serNum": 5754, "donAcc_type": "standard", "distance": 3.489, "atom1_id": "///I/2659/N2", "atom2_id": "///I/2662/N7", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 479, "atom1_serNum": 5696, "atom2_serNum": 10288, "donAcc_type": "questionable", "distance": 2.991, "atom1_id": "///I/2660/OP1", "atom2_id": "///C/460/O", "atom_pair": "O:O", "residue_pair": "nt:aa" }, { "index": 480, "atom1_serNum": 5795, "atom2_serNum": 5814, "donAcc_type": "acceptable", "distance": 2.917, "atom1_id": "///I/2664/O2'", "atom2_id": "///I/2665/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 481, "atom1_serNum": 5903, "atom2_serNum": 5922, "donAcc_type": "acceptable", "distance": 3.258, "atom1_id": "///I/2669/O2'", "atom2_id": "///I/2670/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 482, "atom1_serNum": 5948, "atom2_serNum": 5967, "donAcc_type": "acceptable", "distance": 3.069, "atom1_id": "///I/2671/O2'", "atom2_id": "///I/2672/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 483, "atom1_serNum": 6034, "atom2_serNum": 6273, "donAcc_type": "questionable", "distance": 2.703, "atom1_id": "///J/1944/O4'", "atom2_id": "///J/1955/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 484, "atom1_serNum": 6045, "atom2_serNum": 6644, "donAcc_type": "standard", "distance": 2.567, "atom1_id": "///J/1944/O4", "atom2_id": "///K/2557/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 485, "atom1_serNum": 6065, "atom2_serNum": 6409, "donAcc_type": "standard", "distance": 2.740, "atom1_id": "///J/1945/O6", "atom2_id": "///J/1961/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 486, "atom1_serNum": 6066, "atom2_serNum": 6407, "donAcc_type": "standard", "distance": 2.833, "atom1_id": "///J/1945/N1", "atom2_id": "///J/1961/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 487, "atom1_serNum": 6068, "atom2_serNum": 6406, "donAcc_type": "standard", "distance": 2.792, "atom1_id": "///J/1945/N2", "atom2_id": "///J/1961/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 488, "atom1_serNum": 6081, "atom2_serNum": 6097, "donAcc_type": "acceptable", "distance": 3.223, "atom1_id": "///J/1946/O2'", "atom2_id": "///J/1947/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 489, "atom1_serNum": 6086, "atom2_serNum": 6388, "donAcc_type": "standard", "distance": 2.757, "atom1_id": "///J/1946/N3", "atom2_id": "///J/1960/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 490, "atom1_serNum": 6088, "atom2_serNum": 6387, "donAcc_type": "standard", "distance": 2.877, "atom1_id": "///J/1946/O4", "atom2_id": "///J/1960/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 491, "atom1_serNum": 6105, "atom2_serNum": 6367, "donAcc_type": "standard", "distance": 2.743, "atom1_id": "///J/1947/O2", "atom2_id": "///J/1959/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 492, "atom1_serNum": 6106, "atom2_serNum": 6365, "donAcc_type": "standard", "distance": 2.913, "atom1_id": "///J/1947/N3", "atom2_id": "///J/1959/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 493, "atom1_serNum": 6108, "atom2_serNum": 6364, "donAcc_type": "standard", "distance": 2.972, "atom1_id": "///J/1947/N4", "atom2_id": "///J/1959/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 494, "atom1_serNum": 6128, "atom2_serNum": 6344, "donAcc_type": "standard", "distance": 2.882, "atom1_id": "///J/1948/O6", "atom2_id": "///J/1958/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 495, "atom1_serNum": 6129, "atom2_serNum": 6342, "donAcc_type": "standard", "distance": 2.846, "atom1_id": "///J/1948/N1", "atom2_id": "///J/1958/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 496, "atom1_serNum": 6131, "atom2_serNum": 6341, "donAcc_type": "standard", "distance": 2.697, "atom1_id": "///J/1948/N2", "atom2_id": "///J/1958/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 497, "atom1_serNum": 6151, "atom2_serNum": 6324, "donAcc_type": "standard", "distance": 2.863, "atom1_id": "///J/1949/O6", "atom2_id": "///J/1957/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 498, "atom1_serNum": 6152, "atom2_serNum": 6322, "donAcc_type": "standard", "distance": 2.930, "atom1_id": "///J/1949/N1", "atom2_id": "///J/1957/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 499, "atom1_serNum": 6154, "atom2_serNum": 6321, "donAcc_type": "standard", "distance": 2.860, "atom1_id": "///J/1949/N2", "atom2_id": "///J/1957/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 500, "atom1_serNum": 6175, "atom2_serNum": 6254, "donAcc_type": "acceptable", "distance": 3.093, "atom1_id": "///J/1950/N1", "atom2_id": "///J/1954/O2'", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 501, "atom1_serNum": 6177, "atom2_serNum": 6304, "donAcc_type": "standard", "distance": 2.718, "atom1_id": "///J/1950/N2", "atom2_id": "///J/1956/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 502, "atom1_serNum": 6190, "atom2_serNum": 6236, "donAcc_type": "acceptable", "distance": 2.540, "atom1_id": "///J/1951/O2'", "atom2_id": "///J/1953/N7", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 503, "atom1_serNum": 6195, "atom2_serNum": 6246, "donAcc_type": "standard", "distance": 2.749, "atom1_id": "///J/1951/N3", "atom2_id": "///J/1954/OP2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 504, "atom1_serNum": 6210, "atom2_serNum": 6697, "donAcc_type": "acceptable", "distance": 2.938, "atom1_id": "///J/1952/O2'", "atom2_id": "///K/2560/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 505, "atom1_serNum": 6220, "atom2_serNum": 6697, "donAcc_type": "acceptable", "distance": 2.614, "atom1_id": "///J/1952/N3", "atom2_id": "///K/2560/O2'", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 506, "atom1_serNum": 6228, "atom2_serNum": 6693, "donAcc_type": "questionable", "distance": 2.848, "atom1_id": "///J/1953/O4'", "atom2_id": "///K/2560/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 507, "atom1_serNum": 6232, "atom2_serNum": 6681, "donAcc_type": "acceptable", "distance": 2.502, "atom1_id": "///J/1953/O2'", "atom2_id": "///K/2559/O2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 508, "atom1_serNum": 6240, "atom2_serNum": 6465, "donAcc_type": "acceptable", "distance": 2.586, "atom1_id": "///J/1953/N1", "atom2_id": "///K/2549/O2'", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 509, "atom1_serNum": 6242, "atom2_serNum": 6475, "donAcc_type": "standard", "distance": 2.686, "atom1_id": "///J/1953/N3", "atom2_id": "///K/2549/N2", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 510, "atom1_serNum": 6250, "atom2_serNum": 6488, "donAcc_type": "acceptable", "distance": 2.998, "atom1_id": "///J/1954/O4'", "atom2_id": "///K/2550/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 511, "atom1_serNum": 6250, "atom2_serNum": 6507, "donAcc_type": "questionable", "distance": 3.264, "atom1_id": "///J/1954/O4'", "atom2_id": "///K/2551/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 512, "atom1_serNum": 6254, "atom2_serNum": 6269, "donAcc_type": "acceptable", "distance": 2.524, "atom1_id": "///J/1954/O2'", "atom2_id": "///J/1955/OP2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 513, "atom1_serNum": 6254, "atom2_serNum": 6304, "donAcc_type": "acceptable", "distance": 2.599, "atom1_id": "///J/1954/O2'", "atom2_id": "///J/1956/O4", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 514, "atom1_serNum": 6264, "atom2_serNum": 6301, "donAcc_type": "standard", "distance": 3.269, "atom1_id": "///J/1954/N2", "atom2_id": "///J/1956/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 515, "atom1_serNum": 6284, "atom2_serNum": 6621, "donAcc_type": "standard", "distance": 3.382, "atom1_id": "///J/1955/O4", "atom2_id": "///K/2556/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 516, "atom1_serNum": 6423, "atom2_serNum": 6441, "donAcc_type": "acceptable", "distance": 2.547, "atom1_id": "///K/2547/O2'", "atom2_id": "///K/2548/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 517, "atom1_serNum": 6430, "atom2_serNum": 6726, "donAcc_type": "standard", "distance": 2.997, "atom1_id": "///K/2547/N6", "atom2_id": "///K/2561/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 518, "atom1_serNum": 6431, "atom2_serNum": 6724, "donAcc_type": "standard", "distance": 2.772, "atom1_id": "///K/2547/N1", "atom2_id": "///K/2561/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 519, "atom1_serNum": 6450, "atom2_serNum": 6705, "donAcc_type": "standard", "distance": 2.851, "atom1_id": "///K/2548/N3", "atom2_id": "///K/2560/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 520, "atom1_serNum": 6452, "atom2_serNum": 6704, "donAcc_type": "standard", "distance": 2.854, "atom1_id": "///K/2548/O4", "atom2_id": "///K/2560/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 521, "atom1_serNum": 6472, "atom2_serNum": 6684, "donAcc_type": "standard", "distance": 2.868, "atom1_id": "///K/2549/O6", "atom2_id": "///K/2559/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 522, "atom1_serNum": 6473, "atom2_serNum": 6682, "donAcc_type": "standard", "distance": 2.933, "atom1_id": "///K/2549/N1", "atom2_id": "///K/2559/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 523, "atom1_serNum": 6475, "atom2_serNum": 6681, "donAcc_type": "standard", "distance": 2.879, "atom1_id": "///K/2549/N2", "atom2_id": "///K/2559/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 524, "atom1_serNum": 6495, "atom2_serNum": 6664, "donAcc_type": "standard", "distance": 2.851, "atom1_id": "///K/2550/O6", "atom2_id": "///K/2558/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 525, "atom1_serNum": 6496, "atom2_serNum": 6662, "donAcc_type": "standard", "distance": 2.899, "atom1_id": "///K/2550/N1", "atom2_id": "///K/2558/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 526, "atom1_serNum": 6498, "atom2_serNum": 6661, "donAcc_type": "standard", "distance": 2.822, "atom1_id": "///K/2550/N2", "atom2_id": "///K/2558/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 527, "atom1_serNum": 6515, "atom2_serNum": 6644, "donAcc_type": "standard", "distance": 2.953, "atom1_id": "///K/2551/O2", "atom2_id": "///K/2557/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 528, "atom1_serNum": 6516, "atom2_serNum": 6642, "donAcc_type": "standard", "distance": 2.954, "atom1_id": "///K/2551/N3", "atom2_id": "///K/2557/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 529, "atom1_serNum": 6518, "atom2_serNum": 6641, "donAcc_type": "standard", "distance": 2.822, "atom1_id": "///K/2551/N4", "atom2_id": "///K/2557/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 530, "atom1_serNum": 6535, "atom2_serNum": 6621, "donAcc_type": "standard", "distance": 3.022, "atom1_id": "///K/2552/O2", "atom2_id": "///K/2556/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 531, "atom1_serNum": 6733, "atom2_serNum": 6755, "donAcc_type": "standard", "distance": 3.058, "atom1_id": "///C/1/O", "atom2_id": "///C/4/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 532, "atom1_serNum": 6741, "atom2_serNum": 6772, "donAcc_type": "standard", "distance": 2.985, "atom1_id": "///C/2/O", "atom2_id": "///C/5/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 533, "atom1_serNum": 6750, "atom2_serNum": 7286, "donAcc_type": "standard", "distance": 2.988, "atom1_id": "///C/3/O", "atom2_id": "///C/72/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 534, "atom1_serNum": 6754, "atom2_serNum": 7265, "donAcc_type": "standard", "distance": 3.625, "atom1_id": "///C/3/ND2", "atom2_id": "///C/69/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 535, "atom1_serNum": 6754, "atom2_serNum": 7270, "donAcc_type": "standard", "distance": 2.915, "atom1_id": "///C/3/ND2", "atom2_id": "///C/70/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 536, "atom1_serNum": 6758, "atom2_serNum": 6772, "donAcc_type": "standard", "distance": 2.951, "atom1_id": "///C/4/O", "atom2_id": "///C/5/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 537, "atom1_serNum": 6763, "atom2_serNum": 7289, "donAcc_type": "standard", "distance": 2.893, "atom1_id": "///C/5/N", "atom2_id": "///C/72/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 538, "atom1_serNum": 6766, "atom2_serNum": 7303, "donAcc_type": "standard", "distance": 3.056, "atom1_id": "///C/5/O", "atom2_id": "///C/74/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 539, "atom1_serNum": 6770, "atom2_serNum": 8069, "donAcc_type": "standard", "distance": 2.901, "atom1_id": "///C/5/NE", "atom2_id": "///C/177/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 540, "atom1_serNum": 6770, "atom2_serNum": 8095, "donAcc_type": "standard", "distance": 2.931, "atom1_id": "///C/5/NE", "atom2_id": "///C/180/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 541, "atom1_serNum": 6773, "atom2_serNum": 8069, "donAcc_type": "standard", "distance": 2.919, "atom1_id": "///C/5/NH2", "atom2_id": "///C/177/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 542, "atom1_serNum": 6777, "atom2_serNum": 7473, "donAcc_type": "standard", "distance": 3.163, "atom1_id": "///C/6/O", "atom2_id": "///C/96/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 543, "atom1_serNum": 6777, "atom2_serNum": 7482, "donAcc_type": "standard", "distance": 3.486, "atom1_id": "///C/6/O", "atom2_id": "///C/97/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 544, "atom1_serNum": 6780, "atom2_serNum": 7310, "donAcc_type": "standard", "distance": 3.630, "atom1_id": "///C/6/OD1", "atom2_id": "///C/74/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 545, "atom1_serNum": 6781, "atom2_serNum": 7480, "donAcc_type": "standard", "distance": 3.326, "atom1_id": "///C/6/ND2", "atom2_id": "///C/96/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 546, "atom1_serNum": 6781, "atom2_serNum": 8340, "donAcc_type": "questionable", "distance": 2.669, "atom1_id": "///C/6/ND2", "atom2_id": "///C/211/NH2", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 547, "atom1_serNum": 6782, "atom2_serNum": 7306, "donAcc_type": "standard", "distance": 3.160, "atom1_id": "///C/7/N", "atom2_id": "///C/74/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 548, "atom1_serNum": 6785, "atom2_serNum": 7322, "donAcc_type": "standard", "distance": 3.041, "atom1_id": "///C/7/O", "atom2_id": "///C/76/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 549, "atom1_serNum": 6793, "atom2_serNum": 7485, "donAcc_type": "standard", "distance": 3.490, "atom1_id": "///C/8/N", "atom2_id": "///C/97/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 550, "atom1_serNum": 6796, "atom2_serNum": 7491, "donAcc_type": "standard", "distance": 2.856, "atom1_id": "///C/8/O", "atom2_id": "///C/99/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 551, "atom1_serNum": 6799, "atom2_serNum": 7325, "donAcc_type": "standard", "distance": 3.550, "atom1_id": "///C/9/N", "atom2_id": "///C/76/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 552, "atom1_serNum": 6802, "atom2_serNum": 6868, "donAcc_type": "standard", "distance": 3.143, "atom1_id": "///C/9/O", "atom2_id": "///C/17/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 553, "atom1_serNum": 6807, "atom2_serNum": 7494, "donAcc_type": "standard", "distance": 2.935, "atom1_id": "///C/10/N", "atom2_id": "///C/99/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 554, "atom1_serNum": 6810, "atom2_serNum": 7507, "donAcc_type": "standard", "distance": 3.112, "atom1_id": "///C/10/O", "atom2_id": "///C/101/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 555, "atom1_serNum": 6820, "atom2_serNum": 6852, "donAcc_type": "acceptable", "distance": 2.713, "atom1_id": "///C/12/N", "atom2_id": "///C/15/ND1", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 556, "atom1_serNum": 6823, "atom2_serNum": 6845, "donAcc_type": "questionable", "distance": 3.150, "atom1_id": "///C/12/O", "atom2_id": "///C/14/OD2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 557, "atom1_serNum": 6830, "atom2_serNum": 6846, "donAcc_type": "questionable", "distance": 2.603, "atom1_id": "///C/13/N", "atom2_id": "///C/15/N", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 558, "atom1_serNum": 6844, "atom2_serNum": 7019, "donAcc_type": "questionable", "distance": 2.932, "atom1_id": "///C/14/OD1", "atom2_id": "///C/37/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 559, "atom1_serNum": 6849, "atom2_serNum": 7731, "donAcc_type": "questionable", "distance": 2.551, "atom1_id": "///C/15/O", "atom2_id": "///C/131/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 560, "atom1_serNum": 6855, "atom2_serNum": 7550, "donAcc_type": "standard", "distance": 3.501, "atom1_id": "///C/15/NE2", "atom2_id": "///C/107/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 561, "atom1_serNum": 6863, "atom2_serNum": 6890, "donAcc_type": "standard", "distance": 2.508, "atom1_id": "///C/17/O", "atom2_id": "///C/21/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 562, "atom1_serNum": 6868, "atom2_serNum": 7336, "donAcc_type": "standard", "distance": 2.922, "atom1_id": "///C/17/NZ", "atom2_id": "///C/77/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 563, "atom1_serNum": 6868, "atom2_serNum": 7341, "donAcc_type": "standard", "distance": 2.829, "atom1_id": "///C/17/NZ", "atom2_id": "///C/78/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 564, "atom1_serNum": 6872, "atom2_serNum": 6896, "donAcc_type": "standard", "distance": 2.552, "atom1_id": "///C/18/O", "atom2_id": "///C/22/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 565, "atom1_serNum": 6878, "atom2_serNum": 6904, "donAcc_type": "standard", "distance": 3.223, "atom1_id": "///C/19/O", "atom2_id": "///C/23/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 566, "atom1_serNum": 6885, "atom2_serNum": 6915, "donAcc_type": "standard", "distance": 2.994, "atom1_id": "///C/20/O", "atom2_id": "///C/24/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 567, "atom1_serNum": 6893, "atom2_serNum": 6923, "donAcc_type": "standard", "distance": 3.511, "atom1_id": "///C/21/O", "atom2_id": "///C/25/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 568, "atom1_serNum": 6899, "atom2_serNum": 6931, "donAcc_type": "standard", "distance": 3.229, "atom1_id": "///C/22/O", "atom2_id": "///C/26/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 569, "atom1_serNum": 6907, "atom2_serNum": 6940, "donAcc_type": "standard", "distance": 3.225, "atom1_id": "///C/23/O", "atom2_id": "///C/27/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 570, "atom1_serNum": 6913, "atom2_serNum": 7731, "donAcc_type": "standard", "distance": 3.374, "atom1_id": "///C/23/NH1", "atom2_id": "///C/131/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 571, "atom1_serNum": 6914, "atom2_serNum": 7732, "donAcc_type": "questionable", "distance": 2.606, "atom1_id": "///C/23/NH2", "atom2_id": "///C/131/ND2", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 572, "atom1_serNum": 6914, "atom2_serNum": 7960, "donAcc_type": "standard", "distance": 3.086, "atom1_id": "///C/23/NH2", "atom2_id": "///C/162/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 573, "atom1_serNum": 6918, "atom2_serNum": 6948, "donAcc_type": "standard", "distance": 3.201, "atom1_id": "///C/24/O", "atom2_id": "///C/28/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 574, "atom1_serNum": 6926, "atom2_serNum": 6948, "donAcc_type": "standard", "distance": 3.173, "atom1_id": "///C/25/O", "atom2_id": "///C/28/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 575, "atom1_serNum": 6926, "atom2_serNum": 6958, "donAcc_type": "standard", "distance": 2.707, "atom1_id": "///C/25/O", "atom2_id": "///C/30/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 576, "atom1_serNum": 6939, "atom2_serNum": 6993, "donAcc_type": "questionable", "distance": 2.449, "atom1_id": "///C/26/NE2", "atom2_id": "///C/34/NH1", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 577, "atom1_serNum": 6957, "atom2_serNum": 6965, "donAcc_type": "questionable", "distance": 2.989, "atom1_id": "///C/29/O", "atom2_id": "///C/31/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 578, "atom1_serNum": 6979, "atom2_serNum": 7003, "donAcc_type": "questionable", "distance": 2.830, "atom1_id": "///C/33/O", "atom2_id": "///C/35/OE2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 579, "atom1_serNum": 6994, "atom2_serNum": 7966, "donAcc_type": "standard", "distance": 3.747, "atom1_id": "///C/34/NH2", "atom2_id": "///C/163/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 580, "atom1_serNum": 6995, "atom2_serNum": 7002, "donAcc_type": "standard", "distance": 2.777, "atom1_id": "///C/35/N", "atom2_id": "///C/35/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 581, "atom1_serNum": 7007, "atom2_serNum": 7029, "donAcc_type": "questionable", "distance": 2.569, "atom1_id": "///C/36/O", "atom2_id": "///C/39/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 582, "atom1_serNum": 7029, "atom2_serNum": 7042, "donAcc_type": "standard", "distance": 2.738, "atom1_id": "///C/39/O", "atom2_id": "///C/41/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 583, "atom1_serNum": 7064, "atom2_serNum": 7096, "donAcc_type": "standard", "distance": 3.250, "atom1_id": "///C/44/N", "atom2_id": "///C/47/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 584, "atom1_serNum": 7067, "atom2_serNum": 7097, "donAcc_type": "standard", "distance": 3.037, "atom1_id": "///C/44/O", "atom2_id": "///C/48/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 585, "atom1_serNum": 7075, "atom2_serNum": 7108, "donAcc_type": "standard", "distance": 2.925, "atom1_id": "///C/45/O", "atom2_id": "///C/49/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 586, "atom1_serNum": 7078, "atom2_serNum": 7106, "donAcc_type": "standard", "distance": 2.856, "atom1_id": "///C/45/OD1", "atom2_id": "///C/48/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 587, "atom1_serNum": 7083, "atom2_serNum": 7117, "donAcc_type": "standard", "distance": 3.180, "atom1_id": "///C/46/O", "atom2_id": "///C/50/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 588, "atom1_serNum": 7088, "atom2_serNum": 7095, "donAcc_type": "standard", "distance": 2.619, "atom1_id": "///C/47/N", "atom2_id": "///C/47/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 589, "atom1_serNum": 7091, "atom2_serNum": 7128, "donAcc_type": "standard", "distance": 2.692, "atom1_id": "///C/47/O", "atom2_id": "///C/51/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 590, "atom1_serNum": 7091, "atom2_serNum": 7132, "donAcc_type": "standard", "distance": 3.183, "atom1_id": "///C/47/O", "atom2_id": "///C/52/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 591, "atom1_serNum": 7135, "atom2_serNum": 7147, "donAcc_type": "standard", "distance": 3.256, "atom1_id": "///C/52/O", "atom2_id": "///C/54/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 592, "atom1_serNum": 7145, "atom2_serNum": 7337, "donAcc_type": "acceptable", "distance": 3.220, "atom1_id": "///C/53/OG1", "atom2_id": "///C/77/OD2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 593, "atom1_serNum": 7172, "atom2_serNum": 7183, "donAcc_type": "acceptable", "distance": 3.040, "atom1_id": "///C/57/O", "atom2_id": "///C/58/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 594, "atom1_serNum": 7184, "atom2_serNum": 7314, "donAcc_type": "standard", "distance": 2.969, "atom1_id": "///C/59/N", "atom2_id": "///C/75/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 595, "atom1_serNum": 7187, "atom2_serNum": 7311, "donAcc_type": "standard", "distance": 2.922, "atom1_id": "///C/59/O", "atom2_id": "///C/75/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 596, "atom1_serNum": 7194, "atom2_serNum": 8557, "donAcc_type": "questionable", "distance": 2.626, "atom1_id": "///C/60/O", "atom2_id": "///C/240/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 597, "atom1_serNum": 7196, "atom2_serNum": 7309, "donAcc_type": "acceptable", "distance": 2.697, "atom1_id": "///C/60/OG1", "atom2_id": "///C/74/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 598, "atom1_serNum": 7198, "atom2_serNum": 7298, "donAcc_type": "standard", "distance": 2.736, "atom1_id": "///C/61/N", "atom2_id": "///C/73/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 599, "atom1_serNum": 7201, "atom2_serNum": 7295, "donAcc_type": "standard", "distance": 2.767, "atom1_id": "///C/61/O", "atom2_id": "///C/73/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 600, "atom1_serNum": 7214, "atom2_serNum": 7277, "donAcc_type": "standard", "distance": 2.852, "atom1_id": "///C/63/N", "atom2_id": "///C/71/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 601, "atom1_serNum": 7217, "atom2_serNum": 7274, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///C/63/O", "atom2_id": "///C/71/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 602, "atom1_serNum": 7225, "atom2_serNum": 8014, "donAcc_type": "acceptable", "distance": 3.386, "atom1_id": "///C/63/OH", "atom2_id": "///C/170/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 603, "atom1_serNum": 7225, "atom2_serNum": 8046, "donAcc_type": "acceptable", "distance": 2.704, "atom1_id": "///C/63/OH", "atom2_id": "///C/174/OE2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 604, "atom1_serNum": 7235, "atom2_serNum": 7261, "donAcc_type": "standard", "distance": 2.816, "atom1_id": "///C/65/N", "atom2_id": "///C/69/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 605, "atom1_serNum": 7238, "atom2_serNum": 7254, "donAcc_type": "standard", "distance": 2.909, "atom1_id": "///C/65/O", "atom2_id": "///C/68/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 606, "atom1_serNum": 7240, "atom2_serNum": 8046, "donAcc_type": "standard", "distance": 3.040, "atom1_id": "///C/66/N", "atom2_id": "///C/174/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 607, "atom1_serNum": 7245, "atom2_serNum": 8045, "donAcc_type": "acceptable", "distance": 2.727, "atom1_id": "///C/66/OG", "atom2_id": "///C/174/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 608, "atom1_serNum": 7252, "atom2_serNum": 7254, "donAcc_type": "standard", "distance": 2.850, "atom1_id": "///C/67/OD1", "atom2_id": "///C/68/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 609, "atom1_serNum": 7252, "atom2_serNum": 7258, "donAcc_type": "standard", "distance": 2.805, "atom1_id": "///C/67/OD1", "atom2_id": "///C/69/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 610, "atom1_serNum": 7253, "atom2_serNum": 7285, "donAcc_type": "acceptable", "distance": 2.768, "atom1_id": "///C/67/OD2", "atom2_id": "///C/71/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 611, "atom1_serNum": 7277, "atom2_serNum": 7295, "donAcc_type": "standard", "distance": 3.249, "atom1_id": "///C/71/O", "atom2_id": "///C/73/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 612, "atom1_serNum": 7293, "atom2_serNum": 7310, "donAcc_type": "standard", "distance": 3.032, "atom1_id": "///C/72/OE1", "atom2_id": "///C/74/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 613, "atom1_serNum": 7309, "atom2_serNum": 8678, "donAcc_type": "questionable", "distance": 3.278, "atom1_id": "///C/74/OD1", "atom2_id": "///C/255/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 614, "atom1_serNum": 7336, "atom2_serNum": 7338, "donAcc_type": "standard", "distance": 2.915, "atom1_id": "///C/77/OD1", "atom2_id": "///C/78/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 615, "atom1_serNum": 7348, "atom2_serNum": 7608, "donAcc_type": "standard", "distance": 3.009, "atom1_id": "///C/79/O", "atom2_id": "///C/115/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 616, "atom1_serNum": 7380, "atom2_serNum": 9370, "donAcc_type": "standard", "distance": 2.876, "atom1_id": "///C/83/OD2", "atom2_id": "///C/347/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 617, "atom1_serNum": 7384, "atom2_serNum": 7419, "donAcc_type": "standard", "distance": 2.924, "atom1_id": "///C/84/O", "atom2_id": "///C/88/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 618, "atom1_serNum": 7395, "atom2_serNum": 7426, "donAcc_type": "standard", "distance": 3.134, "atom1_id": "///C/85/O", "atom2_id": "///C/89/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 619, "atom1_serNum": 7401, "atom2_serNum": 7431, "donAcc_type": "acceptable", "distance": 2.824, "atom1_id": "///C/86/O", "atom2_id": "///C/89/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 620, "atom1_serNum": 7401, "atom2_serNum": 7432, "donAcc_type": "standard", "distance": 3.036, "atom1_id": "///C/86/O", "atom2_id": "///C/90/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 621, "atom1_serNum": 7409, "atom2_serNum": 8911, "donAcc_type": "acceptable", "distance": 2.409, "atom1_id": "///C/86/OH", "atom2_id": "///C/287/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 622, "atom1_serNum": 7413, "atom2_serNum": 7443, "donAcc_type": "standard", "distance": 3.172, "atom1_id": "///C/87/O", "atom2_id": "///C/91/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 623, "atom1_serNum": 7422, "atom2_serNum": 7443, "donAcc_type": "standard", "distance": 3.065, "atom1_id": "///C/88/O", "atom2_id": "///C/91/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 624, "atom1_serNum": 7422, "atom2_serNum": 7449, "donAcc_type": "standard", "distance": 3.051, "atom1_id": "///C/88/O", "atom2_id": "///C/92/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 625, "atom1_serNum": 7429, "atom2_serNum": 7457, "donAcc_type": "standard", "distance": 2.772, "atom1_id": "///C/89/O", "atom2_id": "///C/93/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 626, "atom1_serNum": 7431, "atom2_serNum": 7439, "donAcc_type": "acceptable", "distance": 3.079, "atom1_id": "///C/89/OG", "atom2_id": "///C/90/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 627, "atom1_serNum": 7446, "atom2_serNum": 7462, "donAcc_type": "standard", "distance": 3.044, "atom1_id": "///C/91/O", "atom2_id": "///C/94/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 628, "atom1_serNum": 7452, "atom2_serNum": 7467, "donAcc_type": "standard", "distance": 2.993, "atom1_id": "///C/92/O", "atom2_id": "///C/95/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 629, "atom1_serNum": 7460, "atom2_serNum": 8357, "donAcc_type": "standard", "distance": 2.847, "atom1_id": "///C/93/O", "atom2_id": "///C/213/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 630, "atom1_serNum": 7465, "atom2_serNum": 8337, "donAcc_type": "standard", "distance": 3.504, "atom1_id": "///C/94/O", "atom2_id": "///C/211/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 631, "atom1_serNum": 7476, "atom2_serNum": 7680, "donAcc_type": "standard", "distance": 3.115, "atom1_id": "///C/96/O", "atom2_id": "///C/125/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 632, "atom1_serNum": 7480, "atom2_serNum": 8340, "donAcc_type": "standard", "distance": 3.013, "atom1_id": "///C/96/OE1", "atom2_id": "///C/211/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 633, "atom1_serNum": 7481, "atom2_serNum": 8340, "donAcc_type": "standard", "distance": 3.040, "atom1_id": "///C/96/OE2", "atom2_id": "///C/211/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 634, "atom1_serNum": 7486, "atom2_serNum": 7683, "donAcc_type": "standard", "distance": 2.645, "atom1_id": "///C/98/N", "atom2_id": "///C/125/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 635, "atom1_serNum": 7489, "atom2_serNum": 7696, "donAcc_type": "standard", "distance": 2.739, "atom1_id": "///C/98/O", "atom2_id": "///C/127/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 636, "atom1_serNum": 7499, "atom2_serNum": 7699, "donAcc_type": "standard", "distance": 2.795, "atom1_id": "///C/100/N", "atom2_id": "///C/127/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 637, "atom1_serNum": 7502, "atom2_serNum": 7514, "donAcc_type": "standard", "distance": 3.303, "atom1_id": "///C/100/O", "atom2_id": "///C/102/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 638, "atom1_serNum": 7502, "atom2_serNum": 7710, "donAcc_type": "standard", "distance": 3.069, "atom1_id": "///C/100/O", "atom2_id": "///C/129/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 639, "atom1_serNum": 7514, "atom2_serNum": 7713, "donAcc_type": "standard", "distance": 2.803, "atom1_id": "///C/102/N", "atom2_id": "///C/129/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 640, "atom1_serNum": 7517, "atom2_serNum": 7725, "donAcc_type": "standard", "distance": 2.737, "atom1_id": "///C/102/O", "atom2_id": "///C/131/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 641, "atom1_serNum": 7524, "atom2_serNum": 7547, "donAcc_type": "standard", "distance": 3.127, "atom1_id": "///C/103/O", "atom2_id": "///C/107/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 642, "atom1_serNum": 7527, "atom2_serNum": 7529, "donAcc_type": "standard", "distance": 3.083, "atom1_id": "///C/103/OD1", "atom2_id": "///C/104/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 643, "atom1_serNum": 7527, "atom2_serNum": 7534, "donAcc_type": "standard", "distance": 3.078, "atom1_id": "///C/103/OD1", "atom2_id": "///C/105/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 644, "atom1_serNum": 7529, "atom2_serNum": 7728, "donAcc_type": "standard", "distance": 2.978, "atom1_id": "///C/104/N", "atom2_id": "///C/131/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 645, "atom1_serNum": 7532, "atom2_serNum": 7783, "donAcc_type": "standard", "distance": 2.708, "atom1_id": "///C/104/O", "atom2_id": "///C/139/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 646, "atom1_serNum": 7551, "atom2_serNum": 7846, "donAcc_type": "standard", "distance": 3.657, "atom1_id": "///C/108/N", "atom2_id": "///C/146/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 647, "atom1_serNum": 7554, "atom2_serNum": 10330, "donAcc_type": "acceptable", "distance": 3.674, "atom1_id": "///C/108/O", "atom2_id": "///C/465/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 648, "atom1_serNum": 7561, "atom2_serNum": 7581, "donAcc_type": "standard", "distance": 3.025, "atom1_id": "///C/109/O", "atom2_id": "///C/112/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 649, "atom1_serNum": 7561, "atom2_serNum": 7586, "donAcc_type": "acceptable", "distance": 2.741, "atom1_id": "///C/109/O", "atom2_id": "///C/112/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 650, "atom1_serNum": 7561, "atom2_serNum": 7588, "donAcc_type": "standard", "distance": 3.323, "atom1_id": "///C/109/O", "atom2_id": "///C/113/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 651, "atom1_serNum": 7570, "atom2_serNum": 7596, "donAcc_type": "standard", "distance": 3.525, "atom1_id": "///C/110/O", "atom2_id": "///C/114/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 652, "atom1_serNum": 7572, "atom2_serNum": 7579, "donAcc_type": "standard", "distance": 2.753, "atom1_id": "///C/111/N", "atom2_id": "///C/111/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 653, "atom1_serNum": 7591, "atom2_serNum": 7615, "donAcc_type": "standard", "distance": 2.580, "atom1_id": "///C/113/O", "atom2_id": "///C/117/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 654, "atom1_serNum": 7599, "atom2_serNum": 7627, "donAcc_type": "standard", "distance": 2.961, "atom1_id": "///C/114/O", "atom2_id": "///C/118/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 655, "atom1_serNum": 7599, "atom2_serNum": 7632, "donAcc_type": "acceptable", "distance": 2.913, "atom1_id": "///C/114/O", "atom2_id": "///C/118/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 656, "atom1_serNum": 7604, "atom2_serNum": 7634, "donAcc_type": "standard", "distance": 3.041, "atom1_id": "///C/115/O", "atom2_id": "///C/119/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 657, "atom1_serNum": 7612, "atom2_serNum": 7639, "donAcc_type": "standard", "distance": 3.216, "atom1_id": "///C/116/O", "atom2_id": "///C/120/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 658, "atom1_serNum": 7618, "atom2_serNum": 7639, "donAcc_type": "standard", "distance": 3.033, "atom1_id": "///C/117/O", "atom2_id": "///C/120/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 659, "atom1_serNum": 7618, "atom2_serNum": 7647, "donAcc_type": "standard", "distance": 2.885, "atom1_id": "///C/117/O", "atom2_id": "///C/121/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 660, "atom1_serNum": 7626, "atom2_serNum": 7876, "donAcc_type": "acceptable", "distance": 3.025, "atom1_id": "///C/117/OH", "atom2_id": "///C/150/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 661, "atom1_serNum": 7630, "atom2_serNum": 7656, "donAcc_type": "standard", "distance": 2.988, "atom1_id": "///C/118/O", "atom2_id": "///C/122/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 662, "atom1_serNum": 7659, "atom2_serNum": 7672, "donAcc_type": "standard", "distance": 2.666, "atom1_id": "///C/122/O", "atom2_id": "///C/124/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 663, "atom1_serNum": 7706, "atom2_serNum": 7933, "donAcc_type": "standard", "distance": 3.793, "atom1_id": "///C/128/O", "atom2_id": "///C/159/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 664, "atom1_serNum": 7717, "atom2_serNum": 7936, "donAcc_type": "standard", "distance": 2.880, "atom1_id": "///C/130/N", "atom2_id": "///C/159/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 665, "atom1_serNum": 7720, "atom2_serNum": 7951, "donAcc_type": "standard", "distance": 3.008, "atom1_id": "///C/130/O", "atom2_id": "///C/161/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 666, "atom1_serNum": 7733, "atom2_serNum": 7954, "donAcc_type": "standard", "distance": 2.918, "atom1_id": "///C/132/N", "atom2_id": "///C/161/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 667, "atom1_serNum": 7742, "atom2_serNum": 7954, "donAcc_type": "standard", "distance": 3.209, "atom1_id": "///C/133/N", "atom2_id": "///C/161/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 668, "atom1_serNum": 7761, "atom2_serNum": 7778, "donAcc_type": "standard", "distance": 3.133, "atom1_id": "///C/135/O", "atom2_id": "///C/138/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 669, "atom1_serNum": 7786, "atom2_serNum": 7818, "donAcc_type": "standard", "distance": 3.093, "atom1_id": "///C/139/O", "atom2_id": "///C/143/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 670, "atom1_serNum": 7794, "atom2_serNum": 7825, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///C/140/O", "atom2_id": "///C/144/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 671, "atom1_serNum": 7798, "atom2_serNum": 7805, "donAcc_type": "standard", "distance": 2.763, "atom1_id": "///C/141/N", "atom2_id": "///C/141/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 672, "atom1_serNum": 7801, "atom2_serNum": 7830, "donAcc_type": "standard", "distance": 3.381, "atom1_id": "///C/141/O", "atom2_id": "///C/145/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 673, "atom1_serNum": 7810, "atom2_serNum": 7839, "donAcc_type": "standard", "distance": 3.105, "atom1_id": "///C/142/O", "atom2_id": "///C/146/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 674, "atom1_serNum": 7821, "atom2_serNum": 7848, "donAcc_type": "standard", "distance": 2.986, "atom1_id": "///C/143/O", "atom2_id": "///C/147/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 675, "atom1_serNum": 7828, "atom2_serNum": 7856, "donAcc_type": "standard", "distance": 3.199, "atom1_id": "///C/144/O", "atom2_id": "///C/148/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 676, "atom1_serNum": 7833, "atom2_serNum": 7865, "donAcc_type": "standard", "distance": 2.821, "atom1_id": "///C/145/O", "atom2_id": "///C/149/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 677, "atom1_serNum": 7842, "atom2_serNum": 7873, "donAcc_type": "standard", "distance": 2.759, "atom1_id": "///C/146/O", "atom2_id": "///C/150/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 678, "atom1_serNum": 7851, "atom2_serNum": 7881, "donAcc_type": "standard", "distance": 3.116, "atom1_id": "///C/147/O", "atom2_id": "///C/151/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 679, "atom1_serNum": 7851, "atom2_serNum": 7888, "donAcc_type": "standard", "distance": 3.197, "atom1_id": "///C/147/O", "atom2_id": "///C/152/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 680, "atom1_serNum": 7851, "atom2_serNum": 7892, "donAcc_type": "standard", "distance": 3.577, "atom1_id": "///C/147/O", "atom2_id": "///C/153/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 681, "atom1_serNum": 7864, "atom2_serNum": 7908, "donAcc_type": "standard", "distance": 3.393, "atom1_id": "///C/148/OE2", "atom2_id": "///C/155/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 682, "atom1_serNum": 7895, "atom2_serNum": 7908, "donAcc_type": "standard", "distance": 3.264, "atom1_id": "///C/153/O", "atom2_id": "///C/155/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 683, "atom1_serNum": 7906, "atom2_serNum": 7918, "donAcc_type": "acceptable", "distance": 3.670, "atom1_id": "///C/154/OD1", "atom2_id": "///C/156/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 684, "atom1_serNum": 7923, "atom2_serNum": 8057, "donAcc_type": "standard", "distance": 2.624, "atom1_id": "///C/157/O", "atom2_id": "///C/175/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 685, "atom1_serNum": 7957, "atom2_serNum": 7991, "donAcc_type": "standard", "distance": 3.353, "atom1_id": "///C/162/N", "atom2_id": "///C/167/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 686, "atom1_serNum": 7962, "atom2_serNum": 7968, "donAcc_type": "acceptable", "distance": 2.956, "atom1_id": "///C/162/OG", "atom2_id": "///C/164/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 687, "atom1_serNum": 7962, "atom2_serNum": 7977, "donAcc_type": "acceptable", "distance": 3.255, "atom1_id": "///C/162/OG", "atom2_id": "///C/165/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 688, "atom1_serNum": 7982, "atom2_serNum": 7988, "donAcc_type": "acceptable", "distance": 3.152, "atom1_id": "///C/165/OG1", "atom2_id": "///C/167/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 689, "atom1_serNum": 7987, "atom2_serNum": 7999, "donAcc_type": "standard", "distance": 3.477, "atom1_id": "///C/166/O", "atom2_id": "///C/169/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 690, "atom1_serNum": 7998, "atom2_serNum": 8023, "donAcc_type": "standard", "distance": 2.966, "atom1_id": "///C/168/O", "atom2_id": "///C/172/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 691, "atom1_serNum": 8002, "atom2_serNum": 8030, "donAcc_type": "standard", "distance": 3.208, "atom1_id": "///C/169/O", "atom2_id": "///C/173/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 692, "atom1_serNum": 8009, "atom2_serNum": 8038, "donAcc_type": "standard", "distance": 2.845, "atom1_id": "///C/170/O", "atom2_id": "///C/174/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 693, "atom1_serNum": 8018, "atom2_serNum": 8047, "donAcc_type": "standard", "distance": 2.937, "atom1_id": "///C/171/O", "atom2_id": "///C/175/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 694, "atom1_serNum": 8026, "atom2_serNum": 8058, "donAcc_type": "standard", "distance": 2.960, "atom1_id": "///C/172/O", "atom2_id": "///C/176/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 695, "atom1_serNum": 8033, "atom2_serNum": 8066, "donAcc_type": "standard", "distance": 3.158, "atom1_id": "///C/173/O", "atom2_id": "///C/177/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 696, "atom1_serNum": 8041, "atom2_serNum": 8073, "donAcc_type": "standard", "distance": 3.139, "atom1_id": "///C/174/O", "atom2_id": "///C/178/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 697, "atom1_serNum": 8050, "atom2_serNum": 8084, "donAcc_type": "standard", "distance": 2.955, "atom1_id": "///C/175/O", "atom2_id": "///C/179/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 698, "atom1_serNum": 8061, "atom2_serNum": 8092, "donAcc_type": "standard", "distance": 2.890, "atom1_id": "///C/176/O", "atom2_id": "///C/180/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 699, "atom1_serNum": 8080, "atom2_serNum": 8090, "donAcc_type": "standard", "distance": 2.861, "atom1_id": "///C/178/NE", "atom2_id": "///C/179/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 700, "atom1_serNum": 8083, "atom2_serNum": 8091, "donAcc_type": "standard", "distance": 3.236, "atom1_id": "///C/178/NH2", "atom2_id": "///C/179/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 701, "atom1_serNum": 8124, "atom2_serNum": 8352, "donAcc_type": "questionable", "distance": 3.301, "atom1_id": "///C/184/O", "atom2_id": "///C/213/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 702, "atom1_serNum": 8134, "atom2_serNum": 8364, "donAcc_type": "standard", "distance": 3.102, "atom1_id": "///C/186/N", "atom2_id": "///C/214/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 703, "atom1_serNum": 8137, "atom2_serNum": 8158, "donAcc_type": "standard", "distance": 2.859, "atom1_id": "///C/186/O", "atom2_id": "///C/189/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 704, "atom1_serNum": 8137, "atom2_serNum": 8366, "donAcc_type": "standard", "distance": 2.819, "atom1_id": "///C/186/O", "atom2_id": "///C/215/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 705, "atom1_serNum": 8141, "atom2_serNum": 8149, "donAcc_type": "standard", "distance": 2.884, "atom1_id": "///C/186/OD2", "atom2_id": "///C/188/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 706, "atom1_serNum": 8145, "atom2_serNum": 8375, "donAcc_type": "acceptable", "distance": 2.783, "atom1_id": "///C/187/O", "atom2_id": "///C/216/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 707, "atom1_serNum": 8172, "atom2_serNum": 8824, "donAcc_type": "acceptable", "distance": 2.974, "atom1_id": "///C/191/O", "atom2_id": "///C/275/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 708, "atom1_serNum": 8177, "atom2_serNum": 8361, "donAcc_type": "standard", "distance": 2.799, "atom1_id": "///C/192/N", "atom2_id": "///C/214/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 709, "atom1_serNum": 8180, "atom2_serNum": 8349, "donAcc_type": "standard", "distance": 2.794, "atom1_id": "///C/192/O", "atom2_id": "///C/213/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 710, "atom1_serNum": 8180, "atom2_serNum": 8358, "donAcc_type": "standard", "distance": 3.187, "atom1_id": "///C/192/O", "atom2_id": "///C/214/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 711, "atom1_serNum": 8185, "atom2_serNum": 8882, "donAcc_type": "standard", "distance": 2.956, "atom1_id": "///C/192/NE2", "atom2_id": "///C/283/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 712, "atom1_serNum": 8186, "atom2_serNum": 8814, "donAcc_type": "standard", "distance": 2.930, "atom1_id": "///C/193/N", "atom2_id": "///C/274/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 713, "atom1_serNum": 8189, "atom2_serNum": 8811, "donAcc_type": "standard", "distance": 2.647, "atom1_id": "///C/193/O", "atom2_id": "///C/274/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 714, "atom1_serNum": 8191, "atom2_serNum": 8333, "donAcc_type": "standard", "distance": 2.844, "atom1_id": "///C/194/N", "atom2_id": "///C/211/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 715, "atom1_serNum": 8194, "atom2_serNum": 8207, "donAcc_type": "standard", "distance": 3.133, "atom1_id": "///C/194/O", "atom2_id": "///C/196/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 716, "atom1_serNum": 8194, "atom2_serNum": 8330, "donAcc_type": "standard", "distance": 3.123, "atom1_id": "///C/194/O", "atom2_id": "///C/211/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 717, "atom1_serNum": 8199, "atom2_serNum": 8799, "donAcc_type": "standard", "distance": 2.925, "atom1_id": "///C/195/N", "atom2_id": "///C/272/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 718, "atom1_serNum": 8202, "atom2_serNum": 8792, "donAcc_type": "standard", "distance": 2.857, "atom1_id": "///C/195/O", "atom2_id": "///C/271/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 719, "atom1_serNum": 8207, "atom2_serNum": 8317, "donAcc_type": "standard", "distance": 2.932, "atom1_id": "///C/196/N", "atom2_id": "///C/209/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 720, "atom1_serNum": 8218, "atom2_serNum": 8314, "donAcc_type": "standard", "distance": 2.795, "atom1_id": "///C/197/O", "atom2_id": "///C/209/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 721, "atom1_serNum": 8221, "atom2_serNum": 8223, "donAcc_type": "standard", "distance": 2.844, "atom1_id": "///C/197/OD1", "atom2_id": "///C/198/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 722, "atom1_serNum": 8226, "atom2_serNum": 9173, "donAcc_type": "standard", "distance": 3.152, "atom1_id": "///C/198/O", "atom2_id": "///C/320/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 723, "atom1_serNum": 8228, "atom2_serNum": 8313, "donAcc_type": "acceptable", "distance": 2.825, "atom1_id": "///C/198/OG", "atom2_id": "///C/208/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 724, "atom1_serNum": 8228, "atom2_serNum": 8776, "donAcc_type": "acceptable", "distance": 2.829, "atom1_id": "///C/198/OG", "atom2_id": "///C/268/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 725, "atom1_serNum": 8229, "atom2_serNum": 8304, "donAcc_type": "standard", "distance": 2.957, "atom1_id": "///C/199/N", "atom2_id": "///C/207/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 726, "atom1_serNum": 8232, "atom2_serNum": 8301, "donAcc_type": "standard", "distance": 2.930, "atom1_id": "///C/199/O", "atom2_id": "///C/207/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 727, "atom1_serNum": 8254, "atom2_serNum": 8293, "donAcc_type": "standard", "distance": 2.817, "atom1_id": "///C/201/N", "atom2_id": "///C/205/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 728, "atom1_serNum": 8257, "atom2_serNum": 8290, "donAcc_type": "standard", "distance": 2.816, "atom1_id": "///C/201/O", "atom2_id": "///C/205/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 729, "atom1_serNum": 8260, "atom2_serNum": 8270, "donAcc_type": "standard", "distance": 2.819, "atom1_id": "///C/201/OD1", "atom2_id": "///C/203/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 730, "atom1_serNum": 8260, "atom2_serNum": 8282, "donAcc_type": "standard", "distance": 2.813, "atom1_id": "///C/201/OD1", "atom2_id": "///C/204/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 731, "atom1_serNum": 8293, "atom2_serNum": 8301, "donAcc_type": "standard", "distance": 3.295, "atom1_id": "///C/205/O", "atom2_id": "///C/207/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 732, "atom1_serNum": 8308, "atom2_serNum": 8703, "donAcc_type": "standard", "distance": 3.182, "atom1_id": "///C/208/N", "atom2_id": "///C/258/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 733, "atom1_serNum": 8311, "atom2_serNum": 8700, "donAcc_type": "standard", "distance": 2.802, "atom1_id": "///C/208/O", "atom2_id": "///C/258/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 734, "atom1_serNum": 8322, "atom2_serNum": 8685, "donAcc_type": "standard", "distance": 2.605, "atom1_id": "///C/210/N", "atom2_id": "///C/256/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 735, "atom1_serNum": 8325, "atom2_serNum": 8682, "donAcc_type": "standard", "distance": 3.023, "atom1_id": "///C/210/O", "atom2_id": "///C/256/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 736, "atom1_serNum": 8339, "atom2_serNum": 8344, "donAcc_type": "standard", "distance": 2.753, "atom1_id": "///C/211/NH1", "atom2_id": "///C/212/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 737, "atom1_serNum": 8341, "atom2_serNum": 8669, "donAcc_type": "standard", "distance": 3.042, "atom1_id": "///C/212/N", "atom2_id": "///C/254/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 738, "atom1_serNum": 8344, "atom2_serNum": 8662, "donAcc_type": "standard", "distance": 2.943, "atom1_id": "///C/212/O", "atom2_id": "///C/253/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 739, "atom1_serNum": 8377, "atom2_serNum": 8642, "donAcc_type": "standard", "distance": 2.892, "atom1_id": "///C/217/N", "atom2_id": "///C/250/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 740, "atom1_serNum": 8380, "atom2_serNum": 8639, "donAcc_type": "standard", "distance": 2.743, "atom1_id": "///C/217/O", "atom2_id": "///C/250/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 741, "atom1_serNum": 8385, "atom2_serNum": 8416, "donAcc_type": "standard", "distance": 2.842, "atom1_id": "///C/218/N", "atom2_id": "///C/221/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 742, "atom1_serNum": 8394, "atom2_serNum": 8637, "donAcc_type": "standard", "distance": 3.557, "atom1_id": "///C/218/NH1", "atom2_id": "///C/249/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 743, "atom1_serNum": 8396, "atom2_serNum": 8626, "donAcc_type": "standard", "distance": 3.076, "atom1_id": "///C/219/N", "atom2_id": "///C/248/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 744, "atom1_serNum": 8399, "atom2_serNum": 8513, "donAcc_type": "questionable", "distance": 2.306, "atom1_id": "///C/219/O", "atom2_id": "///C/234/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 745, "atom1_serNum": 8408, "atom2_serNum": 8508, "donAcc_type": "questionable", "distance": 3.038, "atom1_id": "///C/220/O", "atom2_id": "///C/233/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 746, "atom1_serNum": 8409, "atom2_serNum": 8415, "donAcc_type": "standard", "distance": 2.682, "atom1_id": "///C/221/N", "atom2_id": "///C/221/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 747, "atom1_serNum": 8412, "atom2_serNum": 8510, "donAcc_type": "standard", "distance": 3.079, "atom1_id": "///C/221/O", "atom2_id": "///C/234/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 748, "atom1_serNum": 8420, "atom2_serNum": 8834, "donAcc_type": "standard", "distance": 3.026, "atom1_id": "///C/222/O", "atom2_id": "///C/277/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 749, "atom1_serNum": 8426, "atom2_serNum": 8493, "donAcc_type": "standard", "distance": 2.656, "atom1_id": "///C/223/N", "atom2_id": "///C/232/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 750, "atom1_serNum": 8429, "atom2_serNum": 8490, "donAcc_type": "standard", "distance": 2.810, "atom1_id": "///C/223/O", "atom2_id": "///C/232/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 751, "atom1_serNum": 8433, "atom2_serNum": 8822, "donAcc_type": "standard", "distance": 2.760, "atom1_id": "///C/224/N", "atom2_id": "///C/275/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 752, "atom1_serNum": 8436, "atom2_serNum": 8819, "donAcc_type": "standard", "distance": 3.062, "atom1_id": "///C/224/O", "atom2_id": "///C/275/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 753, "atom1_serNum": 8442, "atom2_serNum": 8477, "donAcc_type": "standard", "distance": 3.107, "atom1_id": "///C/225/N", "atom2_id": "///C/230/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 754, "atom1_serNum": 8445, "atom2_serNum": 8470, "donAcc_type": "standard", "distance": 2.699, "atom1_id": "///C/225/O", "atom2_id": "///C/229/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 755, "atom1_serNum": 8449, "atom2_serNum": 8807, "donAcc_type": "standard", "distance": 3.192, "atom1_id": "///C/226/N", "atom2_id": "///C/273/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 756, "atom1_serNum": 8457, "atom2_serNum": 8802, "donAcc_type": "standard", "distance": 3.239, "atom1_id": "///C/227/N", "atom2_id": "///C/272/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 757, "atom1_serNum": 8457, "atom2_serNum": 8803, "donAcc_type": "standard", "distance": 3.242, "atom1_id": "///C/227/N", "atom2_id": "///C/272/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 758, "atom1_serNum": 8505, "atom2_serNum": 8515, "donAcc_type": "standard", "distance": 2.766, "atom1_id": "///C/233/O", "atom2_id": "///C/235/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 759, "atom1_serNum": 8515, "atom2_serNum": 8711, "donAcc_type": "standard", "distance": 3.291, "atom1_id": "///C/235/N", "atom2_id": "///C/259/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 760, "atom1_serNum": 8523, "atom2_serNum": 8711, "donAcc_type": "standard", "distance": 3.115, "atom1_id": "///C/236/N", "atom2_id": "///C/259/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 761, "atom1_serNum": 8526, "atom2_serNum": 8708, "donAcc_type": "standard", "distance": 2.714, "atom1_id": "///C/236/O", "atom2_id": "///C/259/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 762, "atom1_serNum": 8530, "atom2_serNum": 8611, "donAcc_type": "standard", "distance": 2.935, "atom1_id": "///C/236/NE", "atom2_id": "///C/246/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 763, "atom1_serNum": 8533, "atom2_serNum": 8610, "donAcc_type": "standard", "distance": 2.732, "atom1_id": "///C/236/NH2", "atom2_id": "///C/246/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 764, "atom1_serNum": 8537, "atom2_serNum": 8612, "donAcc_type": "standard", "distance": 2.749, "atom1_id": "///C/237/O", "atom2_id": "///C/247/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 765, "atom1_serNum": 8542, "atom2_serNum": 8689, "donAcc_type": "standard", "distance": 3.072, "atom1_id": "///C/238/N", "atom2_id": "///C/257/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 766, "atom1_serNum": 8545, "atom2_serNum": 8686, "donAcc_type": "standard", "distance": 2.753, "atom1_id": "///C/238/O", "atom2_id": "///C/257/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 767, "atom1_serNum": 8546, "atom2_serNum": 8600, "donAcc_type": "standard", "distance": 2.961, "atom1_id": "///C/239/N", "atom2_id": "///C/245/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 768, "atom1_serNum": 8549, "atom2_serNum": 8597, "donAcc_type": "standard", "distance": 3.123, "atom1_id": "///C/239/O", "atom2_id": "///C/245/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 769, "atom1_serNum": 8549, "atom2_serNum": 8694, "donAcc_type": "standard", "distance": 3.079, "atom1_id": "///C/239/O", "atom2_id": "///C/257/NE1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 770, "atom1_serNum": 8565, "atom2_serNum": 8582, "donAcc_type": "standard", "distance": 2.825, "atom1_id": "///C/241/N", "atom2_id": "///C/243/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 771, "atom1_serNum": 8582, "atom2_serNum": 8597, "donAcc_type": "standard", "distance": 3.281, "atom1_id": "///C/243/O", "atom2_id": "///C/245/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 772, "atom1_serNum": 8607, "atom2_serNum": 8621, "donAcc_type": "standard", "distance": 3.040, "atom1_id": "///C/246/O", "atom2_id": "///C/247/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 773, "atom1_serNum": 8647, "atom2_serNum": 8674, "donAcc_type": "standard", "distance": 3.258, "atom1_id": "///C/251/N", "atom2_id": "///C/254/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 774, "atom1_serNum": 8650, "atom2_serNum": 8666, "donAcc_type": "standard", "distance": 3.101, "atom1_id": "///C/251/O", "atom2_id": "///C/254/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 775, "atom1_serNum": 8718, "atom2_serNum": 8726, "donAcc_type": "standard", "distance": 2.548, "atom1_id": "///C/260/O", "atom2_id": "///C/262/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 776, "atom1_serNum": 8746, "atom2_serNum": 8769, "donAcc_type": "standard", "distance": 2.902, "atom1_id": "///C/264/O", "atom2_id": "///C/267/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 777, "atom1_serNum": 8781, "atom2_serNum": 8796, "donAcc_type": "standard", "distance": 3.305, "atom1_id": "///C/269/O", "atom2_id": "///C/272/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 778, "atom1_serNum": 8802, "atom2_serNum": 8804, "donAcc_type": "standard", "distance": 2.754, "atom1_id": "///C/272/OD1", "atom2_id": "///C/273/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 779, "atom1_serNum": 8824, "atom2_serNum": 8853, "donAcc_type": "acceptable", "distance": 3.492, "atom1_id": "///C/275/OG1", "atom2_id": "///C/279/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 780, "atom1_serNum": 8824, "atom2_serNum": 8865, "donAcc_type": "acceptable", "distance": 2.721, "atom1_id": "///C/275/OG1", "atom2_id": "///C/281/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 781, "atom1_serNum": 8964, "atom2_serNum": 9334, "donAcc_type": "standard", "distance": 2.795, "atom1_id": "///C/294/N", "atom2_id": "///C/342/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 782, "atom1_serNum": 8973, "atom2_serNum": 9334, "donAcc_type": "standard", "distance": 2.873, "atom1_id": "///C/295/N", "atom2_id": "///C/342/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 783, "atom1_serNum": 8976, "atom2_serNum": 9331, "donAcc_type": "standard", "distance": 2.602, "atom1_id": "///C/295/O", "atom2_id": "///C/342/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 784, "atom1_serNum": 8992, "atom2_serNum": 9324, "donAcc_type": "standard", "distance": 2.826, "atom1_id": "///C/297/N", "atom2_id": "///C/340/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 785, "atom1_serNum": 8995, "atom2_serNum": 9321, "donAcc_type": "standard", "distance": 2.703, "atom1_id": "///C/297/O", "atom2_id": "///C/340/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 786, "atom1_serNum": 9000, "atom2_serNum": 9538, "donAcc_type": "standard", "distance": 3.029, "atom1_id": "///C/298/O", "atom2_id": "///C/366/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 787, "atom1_serNum": 9001, "atom2_serNum": 9302, "donAcc_type": "standard", "distance": 2.887, "atom1_id": "///C/299/N", "atom2_id": "///C/338/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 788, "atom1_serNum": 9004, "atom2_serNum": 9299, "donAcc_type": "standard", "distance": 2.923, "atom1_id": "///C/299/O", "atom2_id": "///C/338/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 789, "atom1_serNum": 9009, "atom2_serNum": 9526, "donAcc_type": "standard", "distance": 2.762, "atom1_id": "///C/300/N", "atom2_id": "///C/364/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 790, "atom1_serNum": 9012, "atom2_serNum": 9523, "donAcc_type": "standard", "distance": 2.736, "atom1_id": "///C/300/O", "atom2_id": "///C/364/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 791, "atom1_serNum": 9027, "atom2_serNum": 9510, "donAcc_type": "standard", "distance": 3.301, "atom1_id": "///C/302/N", "atom2_id": "///C/362/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 792, "atom1_serNum": 9037, "atom2_serNum": 9054, "donAcc_type": "standard", "distance": 2.954, "atom1_id": "///C/303/O", "atom2_id": "///C/306/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 793, "atom1_serNum": 9043, "atom2_serNum": 9062, "donAcc_type": "standard", "distance": 3.157, "atom1_id": "///C/304/O", "atom2_id": "///C/307/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 794, "atom1_serNum": 9057, "atom2_serNum": 9088, "donAcc_type": "standard", "distance": 2.847, "atom1_id": "///C/306/O", "atom2_id": "///C/310/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 795, "atom1_serNum": 9065, "atom2_serNum": 9099, "donAcc_type": "standard", "distance": 2.970, "atom1_id": "///C/307/O", "atom2_id": "///C/311/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 796, "atom1_serNum": 9073, "atom2_serNum": 11559, "donAcc_type": "acceptable", "distance": 3.322, "atom1_id": "///C/307/OH", "atom2_id": "///D/76/ND1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 797, "atom1_serNum": 9077, "atom2_serNum": 9110, "donAcc_type": "standard", "distance": 3.110, "atom1_id": "///C/308/O", "atom2_id": "///C/312/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 798, "atom1_serNum": 9086, "atom2_serNum": 9118, "donAcc_type": "standard", "distance": 2.877, "atom1_id": "///C/309/O", "atom2_id": "///C/313/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 799, "atom1_serNum": 9091, "atom2_serNum": 9123, "donAcc_type": "standard", "distance": 3.031, "atom1_id": "///C/310/O", "atom2_id": "///C/314/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 800, "atom1_serNum": 9102, "atom2_serNum": 9131, "donAcc_type": "standard", "distance": 3.189, "atom1_id": "///C/311/O", "atom2_id": "///C/315/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 801, "atom1_serNum": 9113, "atom2_serNum": 9135, "donAcc_type": "standard", "distance": 2.958, "atom1_id": "///C/312/O", "atom2_id": "///C/316/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 802, "atom1_serNum": 9121, "atom2_serNum": 9144, "donAcc_type": "standard", "distance": 2.977, "atom1_id": "///C/313/O", "atom2_id": "///C/317/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 803, "atom1_serNum": 9126, "atom2_serNum": 9152, "donAcc_type": "standard", "distance": 2.881, "atom1_id": "///C/314/O", "atom2_id": "///C/318/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 804, "atom1_serNum": 9134, "atom2_serNum": 9158, "donAcc_type": "standard", "distance": 3.353, "atom1_id": "///C/315/O", "atom2_id": "///C/319/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 805, "atom1_serNum": 9147, "atom2_serNum": 9166, "donAcc_type": "standard", "distance": 3.209, "atom1_id": "///C/317/O", "atom2_id": "///C/320/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 806, "atom1_serNum": 9147, "atom2_serNum": 9174, "donAcc_type": "standard", "distance": 2.853, "atom1_id": "///C/317/O", "atom2_id": "///C/321/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 807, "atom1_serNum": 9181, "atom2_serNum": 9187, "donAcc_type": "standard", "distance": 3.249, "atom1_id": "///C/321/OD2", "atom2_id": "///C/323/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 808, "atom1_serNum": 9201, "atom2_serNum": 9330, "donAcc_type": "standard", "distance": 3.275, "atom1_id": "///C/325/N", "atom2_id": "///C/341/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 809, "atom1_serNum": 9204, "atom2_serNum": 9327, "donAcc_type": "standard", "distance": 2.685, "atom1_id": "///C/325/O", "atom2_id": "///C/341/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 810, "atom1_serNum": 9224, "atom2_serNum": 9313, "donAcc_type": "standard", "distance": 2.956, "atom1_id": "///C/327/N", "atom2_id": "///C/339/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 811, "atom1_serNum": 9227, "atom2_serNum": 9310, "donAcc_type": "standard", "distance": 2.752, "atom1_id": "///C/327/O", "atom2_id": "///C/339/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 812, "atom1_serNum": 9232, "atom2_serNum": 9317, "donAcc_type": "standard", "distance": 3.094, "atom1_id": "///C/327/OE2", "atom2_id": "///C/339/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 813, "atom1_serNum": 9236, "atom2_serNum": 11543, "donAcc_type": "standard", "distance": 3.431, "atom1_id": "///C/328/O", "atom2_id": "///D/74/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 814, "atom1_serNum": 9240, "atom2_serNum": 9298, "donAcc_type": "standard", "distance": 3.015, "atom1_id": "///C/329/N", "atom2_id": "///C/337/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 815, "atom1_serNum": 9243, "atom2_serNum": 9295, "donAcc_type": "standard", "distance": 2.836, "atom1_id": "///C/329/O", "atom2_id": "///C/337/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 816, "atom1_serNum": 9255, "atom2_serNum": 9283, "donAcc_type": "standard", "distance": 2.970, "atom1_id": "///C/331/N", "atom2_id": "///C/335/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 817, "atom1_serNum": 9258, "atom2_serNum": 9280, "donAcc_type": "standard", "distance": 3.246, "atom1_id": "///C/331/O", "atom2_id": "///C/335/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 818, "atom1_serNum": 9266, "atom2_serNum": 10558, "donAcc_type": "acceptable", "distance": 3.903, "atom1_id": "///C/332/OG", "atom2_id": "///C/493/OD2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 819, "atom1_serNum": 9298, "atom2_serNum": 11562, "donAcc_type": "standard", "distance": 2.664, "atom1_id": "///C/337/O", "atom2_id": "///D/76/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 820, "atom1_serNum": 9353, "atom2_serNum": 9380, "donAcc_type": "standard", "distance": 3.210, "atom1_id": "///C/344/O", "atom2_id": "///C/348/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 821, "atom1_serNum": 9357, "atom2_serNum": 9388, "donAcc_type": "standard", "distance": 2.835, "atom1_id": "///C/345/O", "atom2_id": "///C/349/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 822, "atom1_serNum": 9365, "atom2_serNum": 9397, "donAcc_type": "standard", "distance": 2.779, "atom1_id": "///C/346/O", "atom2_id": "///C/350/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 823, "atom1_serNum": 9373, "atom2_serNum": 9405, "donAcc_type": "standard", "distance": 3.200, "atom1_id": "///C/347/O", "atom2_id": "///C/351/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 824, "atom1_serNum": 9383, "atom2_serNum": 9413, "donAcc_type": "standard", "distance": 2.923, "atom1_id": "///C/348/O", "atom2_id": "///C/352/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 825, "atom1_serNum": 9391, "atom2_serNum": 9422, "donAcc_type": "standard", "distance": 3.041, "atom1_id": "///C/349/O", "atom2_id": "///C/353/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 826, "atom1_serNum": 9400, "atom2_serNum": 9431, "donAcc_type": "standard", "distance": 2.871, "atom1_id": "///C/350/O", "atom2_id": "///C/354/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 827, "atom1_serNum": 9408, "atom2_serNum": 9442, "donAcc_type": "standard", "distance": 2.695, "atom1_id": "///C/351/O", "atom2_id": "///C/355/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 828, "atom1_serNum": 9416, "atom2_serNum": 9450, "donAcc_type": "standard", "distance": 2.886, "atom1_id": "///C/352/O", "atom2_id": "///C/356/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 829, "atom1_serNum": 9421, "atom2_serNum": 9536, "donAcc_type": "acceptable", "distance": 3.219, "atom1_id": "///C/352/NE2", "atom2_id": "///C/365/OG1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 830, "atom1_serNum": 9425, "atom2_serNum": 9459, "donAcc_type": "standard", "distance": 3.042, "atom1_id": "///C/353/O", "atom2_id": "///C/357/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 831, "atom1_serNum": 9429, "atom2_serNum": 9469, "donAcc_type": "standard", "distance": 3.311, "atom1_id": "///C/353/OE1", "atom2_id": "///C/357/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 832, "atom1_serNum": 9430, "atom2_serNum": 9466, "donAcc_type": "standard", "distance": 2.756, "atom1_id": "///C/353/OE2", "atom2_id": "///C/357/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 833, "atom1_serNum": 9430, "atom2_serNum": 9469, "donAcc_type": "standard", "distance": 3.116, "atom1_id": "///C/353/OE2", "atom2_id": "///C/357/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 834, "atom1_serNum": 9434, "atom2_serNum": 9470, "donAcc_type": "standard", "distance": 3.069, "atom1_id": "///C/354/O", "atom2_id": "///C/358/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 835, "atom1_serNum": 9434, "atom2_serNum": 9479, "donAcc_type": "standard", "distance": 3.451, "atom1_id": "///C/354/O", "atom2_id": "///C/359/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 836, "atom1_serNum": 9438, "atom2_serNum": 9478, "donAcc_type": "standard", "distance": 3.068, "atom1_id": "///C/354/NE", "atom2_id": "///C/358/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 837, "atom1_serNum": 9445, "atom2_serNum": 9499, "donAcc_type": "standard", "distance": 3.106, "atom1_id": "///C/355/O", "atom2_id": "///C/361/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 838, "atom1_serNum": 9502, "atom2_serNum": 9515, "donAcc_type": "standard", "distance": 3.297, "atom1_id": "///C/361/O", "atom2_id": "///C/363/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 839, "atom1_serNum": 9548, "atom2_serNum": 9562, "donAcc_type": "acceptable", "distance": 3.349, "atom1_id": "///C/367/O", "atom2_id": "///C/369/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 840, "atom1_serNum": 9553, "atom2_serNum": 9562, "donAcc_type": "acceptable", "distance": 2.633, "atom1_id": "///C/368/O", "atom2_id": "///C/369/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 841, "atom1_serNum": 9553, "atom2_serNum": 10186, "donAcc_type": "questionable", "distance": 2.710, "atom1_id": "///C/368/O", "atom2_id": "///C/448/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 842, "atom1_serNum": 9578, "atom2_serNum": 9685, "donAcc_type": "standard", "distance": 3.484, "atom1_id": "///C/372/N", "atom2_id": "///C/384/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 843, "atom1_serNum": 9581, "atom2_serNum": 9682, "donAcc_type": "standard", "distance": 3.471, "atom1_id": "///C/372/O", "atom2_id": "///C/384/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 844, "atom1_serNum": 9590, "atom2_serNum": 9808, "donAcc_type": "standard", "distance": 2.942, "atom1_id": "///C/373/N", "atom2_id": "///C/400/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 845, "atom1_serNum": 9593, "atom2_serNum": 9805, "donAcc_type": "standard", "distance": 2.821, "atom1_id": "///C/373/O", "atom2_id": "///C/400/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 846, "atom1_serNum": 9597, "atom2_serNum": 9814, "donAcc_type": "standard", "distance": 2.695, "atom1_id": "///C/373/OE1", "atom2_id": "///C/400/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 847, "atom1_serNum": 9598, "atom2_serNum": 9681, "donAcc_type": "acceptable", "distance": 2.514, "atom1_id": "///C/373/OE2", "atom2_id": "///C/383/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 848, "atom1_serNum": 9599, "atom2_serNum": 9665, "donAcc_type": "standard", "distance": 2.780, "atom1_id": "///C/374/N", "atom2_id": "///C/382/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 849, "atom1_serNum": 9602, "atom2_serNum": 9662, "donAcc_type": "standard", "distance": 2.829, "atom1_id": "///C/374/O", "atom2_id": "///C/382/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 850, "atom1_serNum": 9606, "atom2_serNum": 9791, "donAcc_type": "standard", "distance": 2.904, "atom1_id": "///C/375/N", "atom2_id": "///C/398/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 851, "atom1_serNum": 9609, "atom2_serNum": 9776, "donAcc_type": "standard", "distance": 2.870, "atom1_id": "///C/375/O", "atom2_id": "///C/397/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 852, "atom1_serNum": 9609, "atom2_serNum": 9788, "donAcc_type": "standard", "distance": 3.198, "atom1_id": "///C/375/O", "atom2_id": "///C/398/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 853, "atom1_serNum": 9613, "atom2_serNum": 9644, "donAcc_type": "standard", "distance": 2.797, "atom1_id": "///C/375/OE1", "atom2_id": "///C/379/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 854, "atom1_serNum": 9614, "atom2_serNum": 9815, "donAcc_type": "standard", "distance": 2.650, "atom1_id": "///C/375/OE2", "atom2_id": "///C/400/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 855, "atom1_serNum": 9615, "atom2_serNum": 9649, "donAcc_type": "standard", "distance": 3.097, "atom1_id": "///C/376/N", "atom2_id": "///C/380/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 856, "atom1_serNum": 9622, "atom2_serNum": 9763, "donAcc_type": "standard", "distance": 2.729, "atom1_id": "///C/377/N", "atom2_id": "///C/395/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 857, "atom1_serNum": 9625, "atom2_serNum": 9635, "donAcc_type": "standard", "distance": 3.090, "atom1_id": "///C/377/O", "atom2_id": "///C/379/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 858, "atom1_serNum": 9700, "atom2_serNum": 9716, "donAcc_type": "standard", "distance": 2.874, "atom1_id": "///C/386/O", "atom2_id": "///C/389/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 859, "atom1_serNum": 9702, "atom2_serNum": 9715, "donAcc_type": "acceptable", "distance": 3.337, "atom1_id": "///C/386/OG", "atom2_id": "///C/388/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 860, "atom1_serNum": 9706, "atom2_serNum": 9725, "donAcc_type": "standard", "distance": 3.191, "atom1_id": "///C/387/O", "atom2_id": "///C/390/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 861, "atom1_serNum": 9724, "atom2_serNum": 11552, "donAcc_type": "standard", "distance": 3.133, "atom1_id": "///C/389/NZ", "atom2_id": "///D/75/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 862, "atom1_serNum": 9743, "atom2_serNum": 9760, "donAcc_type": "standard", "distance": 2.705, "atom1_id": "///C/392/O", "atom2_id": "///C/395/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 863, "atom1_serNum": 9743, "atom2_serNum": 9768, "donAcc_type": "standard", "distance": 3.330, "atom1_id": "///C/392/O", "atom2_id": "///C/396/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 864, "atom1_serNum": 9748, "atom2_serNum": 9768, "donAcc_type": "standard", "distance": 3.286, "atom1_id": "///C/393/O", "atom2_id": "///C/396/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 865, "atom1_serNum": 9796, "atom2_serNum": 9812, "donAcc_type": "standard", "distance": 2.802, "atom1_id": "///C/398/OE2", "atom2_id": "///C/400/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 866, "atom1_serNum": 9800, "atom2_serNum": 10434, "donAcc_type": "standard", "distance": 3.232, "atom1_id": "///C/399/O", "atom2_id": "///C/478/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 867, "atom1_serNum": 9816, "atom2_serNum": 10423, "donAcc_type": "standard", "distance": 3.027, "atom1_id": "///C/401/N", "atom2_id": "///C/476/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 868, "atom1_serNum": 9819, "atom2_serNum": 10420, "donAcc_type": "standard", "distance": 2.909, "atom1_id": "///C/401/O", "atom2_id": "///C/476/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 869, "atom1_serNum": 9823, "atom2_serNum": 10017, "donAcc_type": "standard", "distance": 3.196, "atom1_id": "///C/401/OE1", "atom2_id": "///C/426/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 870, "atom1_serNum": 9823, "atom2_serNum": 10437, "donAcc_type": "questionable", "distance": 2.888, "atom1_id": "///C/401/OE1", "atom2_id": "///C/478/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 871, "atom1_serNum": 9824, "atom2_serNum": 10017, "donAcc_type": "standard", "distance": 3.067, "atom1_id": "///C/401/OE2", "atom2_id": "///C/426/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 872, "atom1_serNum": 9824, "atom2_serNum": 10018, "donAcc_type": "standard", "distance": 2.871, "atom1_id": "///C/401/OE2", "atom2_id": "///C/426/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 873, "atom1_serNum": 9828, "atom2_serNum": 10175, "donAcc_type": "standard", "distance": 2.803, "atom1_id": "///C/402/O", "atom2_id": "///C/447/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 874, "atom1_serNum": 9832, "atom2_serNum": 10401, "donAcc_type": "standard", "distance": 2.678, "atom1_id": "///C/403/N", "atom2_id": "///C/474/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 875, "atom1_serNum": 9835, "atom2_serNum": 10389, "donAcc_type": "standard", "distance": 2.953, "atom1_id": "///C/403/O", "atom2_id": "///C/473/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 876, "atom1_serNum": 9835, "atom2_serNum": 10398, "donAcc_type": "standard", "distance": 3.498, "atom1_id": "///C/403/O", "atom2_id": "///C/474/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 877, "atom1_serNum": 9840, "atom2_serNum": 10163, "donAcc_type": "standard", "distance": 2.706, "atom1_id": "///C/404/N", "atom2_id": "///C/445/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 878, "atom1_serNum": 9843, "atom2_serNum": 10160, "donAcc_type": "standard", "distance": 2.863, "atom1_id": "///C/404/O", "atom2_id": "///C/445/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 879, "atom1_serNum": 9845, "atom2_serNum": 10373, "donAcc_type": "standard", "distance": 2.894, "atom1_id": "///C/405/N", "atom2_id": "///C/471/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 880, "atom1_serNum": 9848, "atom2_serNum": 10370, "donAcc_type": "standard", "distance": 3.171, "atom1_id": "///C/405/O", "atom2_id": "///C/471/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 881, "atom1_serNum": 9852, "atom2_serNum": 9869, "donAcc_type": "standard", "distance": 2.813, "atom1_id": "///C/405/OE1", "atom2_id": "///C/407/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 882, "atom1_serNum": 9853, "atom2_serNum": 10397, "donAcc_type": "standard", "distance": 3.022, "atom1_id": "///C/405/OE2", "atom2_id": "///C/473/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 883, "atom1_serNum": 9854, "atom2_serNum": 10142, "donAcc_type": "standard", "distance": 2.718, "atom1_id": "///C/406/N", "atom2_id": "///C/443/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 884, "atom1_serNum": 9857, "atom2_serNum": 10139, "donAcc_type": "standard", "distance": 2.935, "atom1_id": "///C/406/O", "atom2_id": "///C/443/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 885, "atom1_serNum": 9860, "atom2_serNum": 10353, "donAcc_type": "standard", "distance": 2.778, "atom1_id": "///C/407/N", "atom2_id": "///C/469/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 886, "atom1_serNum": 9863, "atom2_serNum": 10339, "donAcc_type": "questionable", "distance": 3.361, "atom1_id": "///C/407/O", "atom2_id": "///C/467/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 887, "atom1_serNum": 9863, "atom2_serNum": 10350, "donAcc_type": "standard", "distance": 2.912, "atom1_id": "///C/407/O", "atom2_id": "///C/469/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 888, "atom1_serNum": 9870, "atom2_serNum": 10127, "donAcc_type": "standard", "distance": 2.652, "atom1_id": "///C/408/N", "atom2_id": "///C/441/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 889, "atom1_serNum": 9873, "atom2_serNum": 10124, "donAcc_type": "standard", "distance": 2.784, "atom1_id": "///C/408/O", "atom2_id": "///C/441/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 890, "atom1_serNum": 9878, "atom2_serNum": 10339, "donAcc_type": "standard", "distance": 3.257, "atom1_id": "///C/409/N", "atom2_id": "///C/467/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 891, "atom1_serNum": 9881, "atom2_serNum": 10322, "donAcc_type": "questionable", "distance": 3.186, "atom1_id": "///C/409/O", "atom2_id": "///C/465/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 892, "atom1_serNum": 9881, "atom2_serNum": 10336, "donAcc_type": "standard", "distance": 2.851, "atom1_id": "///C/409/O", "atom2_id": "///C/467/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 893, "atom1_serNum": 9886, "atom2_serNum": 10115, "donAcc_type": "standard", "distance": 3.150, "atom1_id": "///C/410/N", "atom2_id": "///C/439/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 894, "atom1_serNum": 9889, "atom2_serNum": 10112, "donAcc_type": "standard", "distance": 2.720, "atom1_id": "///C/410/O", "atom2_id": "///C/439/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 895, "atom1_serNum": 9897, "atom2_serNum": 9915, "donAcc_type": "standard", "distance": 3.092, "atom1_id": "///C/411/O", "atom2_id": "///C/414/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 896, "atom1_serNum": 9901, "atom2_serNum": 10098, "donAcc_type": "standard", "distance": 3.239, "atom1_id": "///C/412/N", "atom2_id": "///C/437/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 897, "atom1_serNum": 9909, "atom2_serNum": 10094, "donAcc_type": "standard", "distance": 2.846, "atom1_id": "///C/412/NE2", "atom2_id": "///C/436/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 898, "atom1_serNum": 9918, "atom2_serNum": 9939, "donAcc_type": "standard", "distance": 2.771, "atom1_id": "///C/414/O", "atom2_id": "///C/417/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 899, "atom1_serNum": 9918, "atom2_serNum": 9947, "donAcc_type": "standard", "distance": 3.179, "atom1_id": "///C/414/O", "atom2_id": "///C/418/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 900, "atom1_serNum": 9926, "atom2_serNum": 10311, "donAcc_type": "acceptable", "distance": 3.926, "atom1_id": "///C/414/OH", "atom2_id": "///C/463/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 901, "atom1_serNum": 9930, "atom2_serNum": 9954, "donAcc_type": "standard", "distance": 3.029, "atom1_id": "///C/415/O", "atom2_id": "///C/419/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 902, "atom1_serNum": 9939, "atom2_serNum": 9945, "donAcc_type": "standard", "distance": 2.863, "atom1_id": "///C/417/N", "atom2_id": "///C/417/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 903, "atom1_serNum": 9950, "atom2_serNum": 9969, "donAcc_type": "standard", "distance": 3.096, "atom1_id": "///C/418/O", "atom2_id": "///C/421/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 904, "atom1_serNum": 9950, "atom2_serNum": 9977, "donAcc_type": "standard", "distance": 2.999, "atom1_id": "///C/418/O", "atom2_id": "///C/422/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 905, "atom1_serNum": 9957, "atom2_serNum": 9983, "donAcc_type": "standard", "distance": 3.063, "atom1_id": "///C/419/O", "atom2_id": "///C/423/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 906, "atom1_serNum": 9965, "atom2_serNum": 9990, "donAcc_type": "standard", "distance": 3.165, "atom1_id": "///C/420/O", "atom2_id": "///C/424/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 907, "atom1_serNum": 9972, "atom2_serNum": 9990, "donAcc_type": "standard", "distance": 2.878, "atom1_id": "///C/421/O", "atom2_id": "///C/424/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 908, "atom1_serNum": 9972, "atom2_serNum": 9999, "donAcc_type": "standard", "distance": 2.836, "atom1_id": "///C/421/O", "atom2_id": "///C/425/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 909, "atom1_serNum": 9980, "atom2_serNum": 10008, "donAcc_type": "standard", "distance": 3.253, "atom1_id": "///C/422/O", "atom2_id": "///C/426/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 910, "atom1_serNum": 9980, "atom2_serNum": 10019, "donAcc_type": "standard", "distance": 2.778, "atom1_id": "///C/422/O", "atom2_id": "///C/427/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 911, "atom1_serNum": 9998, "atom2_serNum": 10267, "donAcc_type": "standard", "distance": 2.736, "atom1_id": "///C/424/OE2", "atom2_id": "///C/457/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 912, "atom1_serNum": 10007, "atom2_serNum": 10264, "donAcc_type": "questionable", "distance": 3.030, "atom1_id": "///C/425/NZ", "atom2_id": "///C/457/NE", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 913, "atom1_serNum": 10017, "atom2_serNum": 10437, "donAcc_type": "standard", "distance": 3.227, "atom1_id": "///C/426/NH1", "atom2_id": "///C/478/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 914, "atom1_serNum": 10023, "atom2_serNum": 10154, "donAcc_type": "standard", "distance": 2.806, "atom1_id": "///C/428/N", "atom2_id": "///C/444/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 915, "atom1_serNum": 10026, "atom2_serNum": 10151, "donAcc_type": "standard", "distance": 2.657, "atom1_id": "///C/428/O", "atom2_id": "///C/444/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 916, "atom1_serNum": 10037, "atom2_serNum": 10150, "donAcc_type": "acceptable", "distance": 3.336, "atom1_id": "///C/429/OE1", "atom2_id": "///C/443/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 917, "atom1_serNum": 10039, "atom2_serNum": 10135, "donAcc_type": "standard", "distance": 2.812, "atom1_id": "///C/430/N", "atom2_id": "///C/442/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 918, "atom1_serNum": 10046, "atom2_serNum": 10135, "donAcc_type": "standard", "distance": 3.182, "atom1_id": "///C/431/N", "atom2_id": "///C/442/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 919, "atom1_serNum": 10049, "atom2_serNum": 10132, "donAcc_type": "standard", "distance": 3.057, "atom1_id": "///C/431/O", "atom2_id": "///C/442/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 920, "atom1_serNum": 10052, "atom2_serNum": 12072, "donAcc_type": "acceptable", "distance": 3.191, "atom1_id": "///C/431/OD1", "atom2_id": "///H/20/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 921, "atom1_serNum": 10062, "atom2_serNum": 10122, "donAcc_type": "standard", "distance": 2.978, "atom1_id": "///C/433/N", "atom2_id": "///C/440/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 922, "atom1_serNum": 10065, "atom2_serNum": 10119, "donAcc_type": "standard", "distance": 2.699, "atom1_id": "///C/433/O", "atom2_id": "///C/440/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 923, "atom1_serNum": 10081, "atom2_serNum": 10106, "donAcc_type": "standard", "distance": 2.722, "atom1_id": "///C/435/N", "atom2_id": "///C/438/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 924, "atom1_serNum": 10084, "atom2_serNum": 10103, "donAcc_type": "standard", "distance": 2.946, "atom1_id": "///C/435/O", "atom2_id": "///C/438/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 925, "atom1_serNum": 10094, "atom2_serNum": 12130, "donAcc_type": "standard", "distance": 2.697, "atom1_id": "///C/436/O", "atom2_id": "///H/29/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 926, "atom1_serNum": 10098, "atom2_serNum": 10102, "donAcc_type": "standard", "distance": 2.830, "atom1_id": "///C/437/O", "atom2_id": "///C/437/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 927, "atom1_serNum": 10158, "atom2_serNum": 10408, "donAcc_type": "standard", "distance": 2.787, "atom1_id": "///C/444/OE1", "atom2_id": "///C/474/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 928, "atom1_serNum": 10171, "atom2_serNum": 10188, "donAcc_type": "standard", "distance": 2.983, "atom1_id": "///C/446/O", "atom2_id": "///C/449/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 929, "atom1_serNum": 10171, "atom2_serNum": 10197, "donAcc_type": "standard", "distance": 3.122, "atom1_id": "///C/446/O", "atom2_id": "///C/450/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 930, "atom1_serNum": 10178, "atom2_serNum": 10204, "donAcc_type": "standard", "distance": 2.994, "atom1_id": "///C/447/O", "atom2_id": "///C/451/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 931, "atom1_serNum": 10191, "atom2_serNum": 10214, "donAcc_type": "questionable", "distance": 2.837, "atom1_id": "///C/449/O", "atom2_id": "///C/452/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 932, "atom1_serNum": 10207, "atom2_serNum": 10219, "donAcc_type": "standard", "distance": 3.113, "atom1_id": "///C/451/O", "atom2_id": "///C/453/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 933, "atom1_serNum": 10226, "atom2_serNum": 10227, "donAcc_type": "standard", "distance": 3.388, "atom1_id": "///C/453/OD2", "atom2_id": "///C/454/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 934, "atom1_serNum": 10226, "atom2_serNum": 10249, "donAcc_type": "standard", "distance": 3.129, "atom1_id": "///C/453/OD2", "atom2_id": "///C/456/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 935, "atom1_serNum": 10230, "atom2_serNum": 10268, "donAcc_type": "standard", "distance": 2.864, "atom1_id": "///C/454/O", "atom2_id": "///C/458/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 936, "atom1_serNum": 10241, "atom2_serNum": 10276, "donAcc_type": "standard", "distance": 3.082, "atom1_id": "///C/455/O", "atom2_id": "///C/459/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 937, "atom1_serNum": 10252, "atom2_serNum": 10285, "donAcc_type": "standard", "distance": 2.784, "atom1_id": "///C/456/O", "atom2_id": "///C/460/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 938, "atom1_serNum": 10260, "atom2_serNum": 10290, "donAcc_type": "acceptable", "distance": 3.190, "atom1_id": "///C/457/O", "atom2_id": "///C/460/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 939, "atom1_serNum": 10260, "atom2_serNum": 10291, "donAcc_type": "standard", "distance": 3.112, "atom1_id": "///C/457/O", "atom2_id": "///C/461/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 940, "atom1_serNum": 10271, "atom2_serNum": 10298, "donAcc_type": "standard", "distance": 3.102, "atom1_id": "///C/458/O", "atom2_id": "///C/462/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 941, "atom1_serNum": 10271, "atom2_serNum": 10303, "donAcc_type": "acceptable", "distance": 2.827, "atom1_id": "///C/458/O", "atom2_id": "///C/462/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 942, "atom1_serNum": 10279, "atom2_serNum": 10315, "donAcc_type": "standard", "distance": 2.684, "atom1_id": "///C/459/O", "atom2_id": "///C/464/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 943, "atom1_serNum": 10284, "atom2_serNum": 10334, "donAcc_type": "standard", "distance": 2.680, "atom1_id": "///C/459/NZ", "atom2_id": "///C/466/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 944, "atom1_serNum": 10288, "atom2_serNum": 10304, "donAcc_type": "standard", "distance": 2.978, "atom1_id": "///C/460/O", "atom2_id": "///C/463/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 945, "atom1_serNum": 10294, "atom2_serNum": 10296, "donAcc_type": "acceptable", "distance": 3.117, "atom1_id": "///C/461/O", "atom2_id": "///C/461/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 946, "atom1_serNum": 10301, "atom2_serNum": 10319, "donAcc_type": "standard", "distance": 3.215, "atom1_id": "///C/462/O", "atom2_id": "///C/465/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 947, "atom1_serNum": 10303, "atom2_serNum": 10331, "donAcc_type": "acceptable", "distance": 3.203, "atom1_id": "///C/462/OG", "atom2_id": "///C/466/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 948, "atom1_serNum": 10339, "atom2_serNum": 10341, "donAcc_type": "acceptable", "distance": 3.109, "atom1_id": "///C/467/O", "atom2_id": "///C/467/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 949, "atom1_serNum": 10377, "atom2_serNum": 10381, "donAcc_type": "standard", "distance": 2.584, "atom1_id": "///C/471/ND2", "atom2_id": "///C/472/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 950, "atom1_serNum": 10407, "atom2_serNum": 10427, "donAcc_type": "standard", "distance": 2.586, "atom1_id": "///C/474/NH1", "atom2_id": "///C/476/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 951, "atom1_serNum": 10443, "atom2_serNum": 10606, "donAcc_type": "acceptable", "distance": 3.267, "atom1_id": "///C/479/O", "atom2_id": "///C/500/ND1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 952, "atom1_serNum": 10456, "atom2_serNum": 10596, "donAcc_type": "standard", "distance": 2.247, "atom1_id": "///C/481/N", "atom2_id": "///C/499/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 953, "atom1_serNum": 10459, "atom2_serNum": 10593, "donAcc_type": "standard", "distance": 2.869, "atom1_id": "///C/481/O", "atom2_id": "///C/499/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 954, "atom1_serNum": 10470, "atom2_serNum": 10487, "donAcc_type": "standard", "distance": 3.080, "atom1_id": "///C/482/NE", "atom2_id": "///C/484/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 955, "atom1_serNum": 10474, "atom2_serNum": 10580, "donAcc_type": "standard", "distance": 3.179, "atom1_id": "///C/483/N", "atom2_id": "///C/497/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 956, "atom1_serNum": 10477, "atom2_serNum": 10577, "donAcc_type": "standard", "distance": 3.360, "atom1_id": "///C/483/O", "atom2_id": "///C/497/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 957, "atom1_serNum": 10481, "atom2_serNum": 10862, "donAcc_type": "standard", "distance": 2.454, "atom1_id": "///C/484/N", "atom2_id": "///C/531/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 958, "atom1_serNum": 10484, "atom2_serNum": 10859, "donAcc_type": "standard", "distance": 2.734, "atom1_id": "///C/484/O", "atom2_id": "///C/531/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 959, "atom1_serNum": 10492, "atom2_serNum": 10544, "donAcc_type": "standard", "distance": 3.607, "atom1_id": "///C/485/O", "atom2_id": "///C/492/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 960, "atom1_serNum": 10496, "atom2_serNum": 10848, "donAcc_type": "standard", "distance": 2.661, "atom1_id": "///C/486/N", "atom2_id": "///C/529/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 961, "atom1_serNum": 10499, "atom2_serNum": 10845, "donAcc_type": "standard", "distance": 3.135, "atom1_id": "///C/486/O", "atom2_id": "///C/529/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 962, "atom1_serNum": 10504, "atom2_serNum": 10527, "donAcc_type": "standard", "distance": 3.202, "atom1_id": "///C/487/N", "atom2_id": "///C/490/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 963, "atom1_serNum": 10507, "atom2_serNum": 10524, "donAcc_type": "standard", "distance": 2.562, "atom1_id": "///C/487/O", "atom2_id": "///C/490/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 964, "atom1_serNum": 10507, "atom2_serNum": 10527, "donAcc_type": "questionable", "distance": 2.515, "atom1_id": "///C/487/O", "atom2_id": "///C/490/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 965, "atom1_serNum": 10512, "atom2_serNum": 10835, "donAcc_type": "standard", "distance": 3.382, "atom1_id": "///C/488/N", "atom2_id": "///C/527/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 966, "atom1_serNum": 10518, "atom2_serNum": 10832, "donAcc_type": "standard", "distance": 2.878, "atom1_id": "///C/488/OD1", "atom2_id": "///C/527/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 967, "atom1_serNum": 10547, "atom2_serNum": 10564, "donAcc_type": "standard", "distance": 3.217, "atom1_id": "///C/492/O", "atom2_id": "///C/495/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 968, "atom1_serNum": 10554, "atom2_serNum": 10572, "donAcc_type": "standard", "distance": 2.846, "atom1_id": "///C/493/O", "atom2_id": "///C/496/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 969, "atom1_serNum": 10603, "atom2_serNum": 10629, "donAcc_type": "standard", "distance": 3.464, "atom1_id": "///C/500/O", "atom2_id": "///C/503/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 970, "atom1_serNum": 10613, "atom2_serNum": 10637, "donAcc_type": "standard", "distance": 3.034, "atom1_id": "///C/501/O", "atom2_id": "///C/504/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 971, "atom1_serNum": 10613, "atom2_serNum": 10642, "donAcc_type": "acceptable", "distance": 2.603, "atom1_id": "///C/501/O", "atom2_id": "///C/504/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 972, "atom1_serNum": 10621, "atom2_serNum": 10627, "donAcc_type": "standard", "distance": 2.904, "atom1_id": "///C/502/N", "atom2_id": "///C/502/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 973, "atom1_serNum": 10632, "atom2_serNum": 10660, "donAcc_type": "standard", "distance": 2.712, "atom1_id": "///C/503/O", "atom2_id": "///C/507/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 974, "atom1_serNum": 10632, "atom2_serNum": 10667, "donAcc_type": "standard", "distance": 2.906, "atom1_id": "///C/503/O", "atom2_id": "///C/507/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 975, "atom1_serNum": 10636, "atom2_serNum": 10658, "donAcc_type": "standard", "distance": 3.836, "atom1_id": "///C/503/ND2", "atom2_id": "///C/506/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 976, "atom1_serNum": 10640, "atom2_serNum": 10671, "donAcc_type": "standard", "distance": 2.968, "atom1_id": "///C/504/O", "atom2_id": "///C/508/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 977, "atom1_serNum": 10646, "atom2_serNum": 10675, "donAcc_type": "standard", "distance": 3.151, "atom1_id": "///C/505/O", "atom2_id": "///C/509/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 978, "atom1_serNum": 10650, "atom2_serNum": 10904, "donAcc_type": "questionable", "distance": 2.766, "atom1_id": "///C/505/OE1", "atom2_id": "///C/537/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 979, "atom1_serNum": 10655, "atom2_serNum": 10686, "donAcc_type": "standard", "distance": 3.234, "atom1_id": "///C/506/O", "atom2_id": "///C/510/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 980, "atom1_serNum": 10659, "atom2_serNum": 10694, "donAcc_type": "standard", "distance": 2.849, "atom1_id": "///C/506/ND2", "atom2_id": "///C/510/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 981, "atom1_serNum": 10663, "atom2_serNum": 10695, "donAcc_type": "standard", "distance": 3.103, "atom1_id": "///C/507/O", "atom2_id": "///C/511/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 982, "atom1_serNum": 10674, "atom2_serNum": 10703, "donAcc_type": "standard", "distance": 3.154, "atom1_id": "///C/508/O", "atom2_id": "///C/512/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 983, "atom1_serNum": 10678, "atom2_serNum": 10710, "donAcc_type": "standard", "distance": 3.111, "atom1_id": "///C/509/O", "atom2_id": "///C/513/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 984, "atom1_serNum": 10689, "atom2_serNum": 10719, "donAcc_type": "standard", "distance": 2.966, "atom1_id": "///C/510/O", "atom2_id": "///C/514/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 985, "atom1_serNum": 10698, "atom2_serNum": 10728, "donAcc_type": "standard", "distance": 3.187, "atom1_id": "///C/511/O", "atom2_id": "///C/515/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 986, "atom1_serNum": 10706, "atom2_serNum": 10736, "donAcc_type": "standard", "distance": 2.896, "atom1_id": "///C/512/O", "atom2_id": "///C/516/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 987, "atom1_serNum": 10713, "atom2_serNum": 10745, "donAcc_type": "standard", "distance": 3.108, "atom1_id": "///C/513/O", "atom2_id": "///C/517/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 988, "atom1_serNum": 10718, "atom2_serNum": 10744, "donAcc_type": "standard", "distance": 3.090, "atom1_id": "///C/513/OE2", "atom2_id": "///C/516/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 989, "atom1_serNum": 10722, "atom2_serNum": 10753, "donAcc_type": "standard", "distance": 3.445, "atom1_id": "///C/514/O", "atom2_id": "///C/518/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 990, "atom1_serNum": 10731, "atom2_serNum": 10753, "donAcc_type": "standard", "distance": 2.772, "atom1_id": "///C/515/O", "atom2_id": "///C/518/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 991, "atom1_serNum": 10731, "atom2_serNum": 10761, "donAcc_type": "standard", "distance": 2.969, "atom1_id": "///C/515/O", "atom2_id": "///C/519/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 992, "atom1_serNum": 10772, "atom2_serNum": 10787, "donAcc_type": "standard", "distance": 3.230, "atom1_id": "///C/520/O", "atom2_id": "///C/522/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 993, "atom1_serNum": 10785, "atom2_serNum": 10957, "donAcc_type": "standard", "distance": 2.954, "atom1_id": "///C/521/NH1", "atom2_id": "///C/544/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 994, "atom1_serNum": 10790, "atom2_serNum": 10963, "donAcc_type": "standard", "distance": 2.741, "atom1_id": "///C/522/O", "atom2_id": "///C/545/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 995, "atom1_serNum": 10822, "atom2_serNum": 10954, "donAcc_type": "standard", "distance": 2.789, "atom1_id": "///C/525/OD1", "atom2_id": "///C/544/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 996, "atom1_serNum": 10824, "atom2_serNum": 10941, "donAcc_type": "standard", "distance": 3.081, "atom1_id": "///C/526/N", "atom2_id": "///C/542/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 997, "atom1_serNum": 10827, "atom2_serNum": 10938, "donAcc_type": "standard", "distance": 2.681, "atom1_id": "///C/526/O", "atom2_id": "///C/542/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 998, "atom1_serNum": 10837, "atom2_serNum": 10928, "donAcc_type": "standard", "distance": 2.745, "atom1_id": "///C/528/N", "atom2_id": "///C/540/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 999, "atom1_serNum": 10840, "atom2_serNum": 10925, "donAcc_type": "standard", "distance": 2.727, "atom1_id": "///C/528/O", "atom2_id": "///C/540/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1000, "atom1_serNum": 10853, "atom2_serNum": 10923, "donAcc_type": "questionable", "distance": 3.017, "atom1_id": "///C/529/NE2", "atom2_id": "///C/539/NH1", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 1001, "atom1_serNum": 10854, "atom2_serNum": 10912, "donAcc_type": "standard", "distance": 2.667, "atom1_id": "///C/530/N", "atom2_id": "///C/538/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1002, "atom1_serNum": 10857, "atom2_serNum": 10901, "donAcc_type": "standard", "distance": 2.972, "atom1_id": "///C/530/O", "atom2_id": "///C/537/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1003, "atom1_serNum": 10857, "atom2_serNum": 10909, "donAcc_type": "standard", "distance": 3.287, "atom1_id": "///C/530/O", "atom2_id": "///C/538/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1004, "atom1_serNum": 10864, "atom2_serNum": 10886, "donAcc_type": "standard", "distance": 2.891, "atom1_id": "///C/532/N", "atom2_id": "///C/535/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1005, "atom1_serNum": 10867, "atom2_serNum": 10883, "donAcc_type": "standard", "distance": 3.041, "atom1_id": "///C/532/O", "atom2_id": "///C/535/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1006, "atom1_serNum": 10934, "atom2_serNum": 10945, "donAcc_type": "standard", "distance": 2.985, "atom1_id": "///C/541/O", "atom2_id": "///C/543/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1007, "atom1_serNum": 10981, "atom2_serNum": 11000, "donAcc_type": "standard", "distance": 2.774, "atom1_id": "///D/2/O", "atom2_id": "///D/5/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1008, "atom1_serNum": 10981, "atom2_serNum": 11009, "donAcc_type": "standard", "distance": 3.047, "atom1_id": "///D/2/O", "atom2_id": "///D/6/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1009, "atom1_serNum": 10988, "atom2_serNum": 11009, "donAcc_type": "standard", "distance": 2.804, "atom1_id": "///D/3/O", "atom2_id": "///D/6/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1010, "atom1_serNum": 10988, "atom2_serNum": 11017, "donAcc_type": "standard", "distance": 3.015, "atom1_id": "///D/3/O", "atom2_id": "///D/7/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1011, "atom1_serNum": 10992, "atom2_serNum": 10998, "donAcc_type": "standard", "distance": 2.930, "atom1_id": "///D/4/N", "atom2_id": "///D/4/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1012, "atom1_serNum": 10995, "atom2_serNum": 11024, "donAcc_type": "standard", "distance": 3.317, "atom1_id": "///D/4/O", "atom2_id": "///D/8/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1013, "atom1_serNum": 11012, "atom2_serNum": 11035, "donAcc_type": "standard", "distance": 2.660, "atom1_id": "///D/6/O", "atom2_id": "///D/9/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1014, "atom1_serNum": 11012, "atom2_serNum": 11044, "donAcc_type": "standard", "distance": 2.771, "atom1_id": "///D/6/O", "atom2_id": "///D/10/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1015, "atom1_serNum": 11070, "atom2_serNum": 11087, "donAcc_type": "standard", "distance": 3.292, "atom1_id": "///D/13/O", "atom2_id": "///D/15/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1016, "atom1_serNum": 11081, "atom2_serNum": 11094, "donAcc_type": "standard", "distance": 2.812, "atom1_id": "///D/14/O", "atom2_id": "///D/16/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1017, "atom1_serNum": 11102, "atom2_serNum": 11114, "donAcc_type": "standard", "distance": 2.896, "atom1_id": "///D/17/O", "atom2_id": "///D/19/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1018, "atom1_serNum": 11117, "atom2_serNum": 11687, "donAcc_type": "standard", "distance": 3.295, "atom1_id": "///D/19/O", "atom2_id": "///D/93/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1019, "atom1_serNum": 11129, "atom2_serNum": 11702, "donAcc_type": "acceptable", "distance": 3.040, "atom1_id": "///D/21/N", "atom2_id": "///D/94/OH", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1020, "atom1_serNum": 11136, "atom2_serNum": 11702, "donAcc_type": "acceptable", "distance": 2.620, "atom1_id": "///D/22/N", "atom2_id": "///D/94/OH", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1021, "atom1_serNum": 11144, "atom2_serNum": 11163, "donAcc_type": "standard", "distance": 2.926, "atom1_id": "///D/23/O", "atom2_id": "///D/26/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1022, "atom1_serNum": 11157, "atom2_serNum": 11422, "donAcc_type": "questionable", "distance": 2.718, "atom1_id": "///D/24/OE2", "atom2_id": "///D/58/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1023, "atom1_serNum": 11161, "atom2_serNum": 11169, "donAcc_type": "standard", "distance": 3.261, "atom1_id": "///D/25/O", "atom2_id": "///D/27/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1024, "atom1_serNum": 11172, "atom2_serNum": 11603, "donAcc_type": "questionable", "distance": 3.321, "atom1_id": "///D/27/O", "atom2_id": "///D/82/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1025, "atom1_serNum": 11185, "atom2_serNum": 11595, "donAcc_type": "standard", "distance": 3.566, "atom1_id": "///D/29/N", "atom2_id": "///D/81/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1026, "atom1_serNum": 11188, "atom2_serNum": 11592, "donAcc_type": "standard", "distance": 2.686, "atom1_id": "///D/29/O", "atom2_id": "///D/81/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1027, "atom1_serNum": 11205, "atom2_serNum": 11579, "donAcc_type": "standard", "distance": 2.708, "atom1_id": "///D/31/N", "atom2_id": "///D/79/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1028, "atom1_serNum": 11209, "atom2_serNum": 11393, "donAcc_type": "standard", "distance": 2.958, "atom1_id": "///D/32/N", "atom2_id": "///D/55/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1029, "atom1_serNum": 11222, "atom2_serNum": 11375, "donAcc_type": "standard", "distance": 2.531, "atom1_id": "///D/34/N", "atom2_id": "///D/53/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1030, "atom1_serNum": 11225, "atom2_serNum": 11236, "donAcc_type": "standard", "distance": 2.619, "atom1_id": "///D/34/O", "atom2_id": "///D/35/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1031, "atom1_serNum": 11229, "atom2_serNum": 11375, "donAcc_type": "standard", "distance": 3.280, "atom1_id": "///D/35/N", "atom2_id": "///D/53/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1032, "atom1_serNum": 11232, "atom2_serNum": 11372, "donAcc_type": "standard", "distance": 2.740, "atom1_id": "///D/35/O", "atom2_id": "///D/53/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1033, "atom1_serNum": 11236, "atom2_serNum": 11551, "donAcc_type": "standard", "distance": 3.001, "atom1_id": "///D/35/NE", "atom2_id": "///D/75/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1034, "atom1_serNum": 11240, "atom2_serNum": 11551, "donAcc_type": "standard", "distance": 3.569, "atom1_id": "///D/36/N", "atom2_id": "///D/75/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1035, "atom1_serNum": 11247, "atom2_serNum": 11362, "donAcc_type": "standard", "distance": 3.118, "atom1_id": "///D/37/N", "atom2_id": "///D/51/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1036, "atom1_serNum": 11250, "atom2_serNum": 11359, "donAcc_type": "standard", "distance": 3.185, "atom1_id": "///D/37/O", "atom2_id": "///D/51/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1037, "atom1_serNum": 11250, "atom2_serNum": 11362, "donAcc_type": "questionable", "distance": 3.002, "atom1_id": "///D/37/O", "atom2_id": "///D/51/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1038, "atom1_serNum": 11266, "atom2_serNum": 11342, "donAcc_type": "standard", "distance": 3.218, "atom1_id": "///D/39/N", "atom2_id": "///D/49/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1039, "atom1_serNum": 11269, "atom2_serNum": 11339, "donAcc_type": "standard", "distance": 3.076, "atom1_id": "///D/39/O", "atom2_id": "///D/49/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1040, "atom1_serNum": 11287, "atom2_serNum": 11649, "donAcc_type": "standard", "distance": 3.057, "atom1_id": "///D/42/N", "atom2_id": "///D/88/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1041, "atom1_serNum": 11319, "atom2_serNum": 11653, "donAcc_type": "standard", "distance": 2.838, "atom1_id": "///D/45/ND2", "atom2_id": "///D/88/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1042, "atom1_serNum": 11329, "atom2_serNum": 11339, "donAcc_type": "standard", "distance": 3.329, "atom1_id": "///D/47/O", "atom2_id": "///D/49/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1043, "atom1_serNum": 11348, "atom2_serNum": 11652, "donAcc_type": "standard", "distance": 2.651, "atom1_id": "///D/49/NH1", "atom2_id": "///D/88/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1044, "atom1_serNum": 11349, "atom2_serNum": 11652, "donAcc_type": "standard", "distance": 2.529, "atom1_id": "///D/49/NH2", "atom2_id": "///D/88/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1045, "atom1_serNum": 11353, "atom2_serNum": 11480, "donAcc_type": "standard", "distance": 3.218, "atom1_id": "///D/50/O", "atom2_id": "///D/66/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1046, "atom1_serNum": 11366, "atom2_serNum": 11465, "donAcc_type": "standard", "distance": 2.743, "atom1_id": "///D/52/N", "atom2_id": "///D/64/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1047, "atom1_serNum": 11369, "atom2_serNum": 11462, "donAcc_type": "standard", "distance": 2.566, "atom1_id": "///D/52/O", "atom2_id": "///D/64/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1048, "atom1_serNum": 11379, "atom2_serNum": 11446, "donAcc_type": "standard", "distance": 3.103, "atom1_id": "///D/53/NE", "atom2_id": "///D/61/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1049, "atom1_serNum": 11383, "atom2_serNum": 11451, "donAcc_type": "standard", "distance": 2.853, "atom1_id": "///D/54/N", "atom2_id": "///D/62/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1050, "atom1_serNum": 11386, "atom2_serNum": 11448, "donAcc_type": "standard", "distance": 2.993, "atom1_id": "///D/54/O", "atom2_id": "///D/62/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1051, "atom1_serNum": 11386, "atom2_serNum": 11451, "donAcc_type": "questionable", "distance": 2.724, "atom1_id": "///D/54/O", "atom2_id": "///D/62/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1052, "atom1_serNum": 11397, "atom2_serNum": 11447, "donAcc_type": "standard", "distance": 3.046, "atom1_id": "///D/55/NE", "atom2_id": "///D/61/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1053, "atom1_serNum": 11399, "atom2_serNum": 11447, "donAcc_type": "standard", "distance": 2.919, "atom1_id": "///D/55/NH1", "atom2_id": "///D/61/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1054, "atom1_serNum": 11400, "atom2_serNum": 11427, "donAcc_type": "standard", "distance": 3.938, "atom1_id": "///D/55/NH2", "atom2_id": "///D/59/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1055, "atom1_serNum": 11404, "atom2_serNum": 11424, "donAcc_type": "standard", "distance": 3.047, "atom1_id": "///D/56/O", "atom2_id": "///D/59/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1056, "atom1_serNum": 11467, "atom2_serNum": 11471, "donAcc_type": "acceptable", "distance": 2.924, "atom1_id": "///D/64/OG", "atom2_id": "///D/65/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1057, "atom1_serNum": 11467, "atom2_serNum": 11713, "donAcc_type": "acceptable", "distance": 2.618, "atom1_id": "///D/64/OG", "atom2_id": "///D/96/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1058, "atom1_serNum": 11468, "atom2_serNum": 11694, "donAcc_type": "standard", "distance": 3.106, "atom1_id": "///D/65/N", "atom2_id": "///D/94/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1059, "atom1_serNum": 11471, "atom2_serNum": 11713, "donAcc_type": "standard", "distance": 3.054, "atom1_id": "///D/65/O", "atom2_id": "///D/96/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1060, "atom1_serNum": 11471, "atom2_serNum": 11718, "donAcc_type": "acceptable", "distance": 2.510, "atom1_id": "///D/65/O", "atom2_id": "///D/96/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1061, "atom1_serNum": 11488, "atom2_serNum": 11712, "donAcc_type": "questionable", "distance": 2.934, "atom1_id": "///D/67/N", "atom2_id": "///D/95/NE2", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 1062, "atom1_serNum": 11491, "atom2_serNum": 11736, "donAcc_type": "standard", "distance": 2.797, "atom1_id": "///D/67/O", "atom2_id": "///D/98/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1063, "atom1_serNum": 11499, "atom2_serNum": 11794, "donAcc_type": "standard", "distance": 3.629, "atom1_id": "///D/69/O", "atom2_id": "///D/107/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1064, "atom1_serNum": 11508, "atom2_serNum": 11736, "donAcc_type": "standard", "distance": 2.628, "atom1_id": "///D/70/O", "atom2_id": "///D/98/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1065, "atom1_serNum": 11508, "atom2_serNum": 11737, "donAcc_type": "standard", "distance": 2.748, "atom1_id": "///D/70/O", "atom2_id": "///D/98/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1066, "atom1_serNum": 11522, "atom2_serNum": 11526, "donAcc_type": "standard", "distance": 2.638, "atom1_id": "///D/72/O", "atom2_id": "///D/72/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1067, "atom1_serNum": 11522, "atom2_serNum": 11535, "donAcc_type": "standard", "distance": 2.863, "atom1_id": "///D/72/O", "atom2_id": "///D/74/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1068, "atom1_serNum": 11535, "atom2_serNum": 11568, "donAcc_type": "acceptable", "distance": 3.003, "atom1_id": "///D/74/N", "atom2_id": "///D/77/OG", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1069, "atom1_serNum": 11556, "atom2_serNum": 11569, "donAcc_type": "standard", "distance": 3.113, "atom1_id": "///D/76/O", "atom2_id": "///D/78/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1070, "atom1_serNum": 11587, "atom2_serNum": 11720, "donAcc_type": "standard", "distance": 3.204, "atom1_id": "///D/80/O", "atom2_id": "///D/97/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1071, "atom1_serNum": 11600, "atom2_serNum": 11706, "donAcc_type": "standard", "distance": 2.605, "atom1_id": "///D/82/N", "atom2_id": "///D/95/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1072, "atom1_serNum": 11614, "atom2_serNum": 11703, "donAcc_type": "standard", "distance": 2.671, "atom1_id": "///D/83/O", "atom2_id": "///D/95/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1073, "atom1_serNum": 11626, "atom2_serNum": 11633, "donAcc_type": "standard", "distance": 3.327, "atom1_id": "///D/85/NE", "atom2_id": "///D/86/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1074, "atom1_serNum": 11630, "atom2_serNum": 11676, "donAcc_type": "standard", "distance": 3.254, "atom1_id": "///D/86/N", "atom2_id": "///D/92/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1075, "atom1_serNum": 11646, "atom2_serNum": 11653, "donAcc_type": "standard", "distance": 2.617, "atom1_id": "///D/88/N", "atom2_id": "///D/88/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1076, "atom1_serNum": 11672, "atom2_serNum": 11680, "donAcc_type": "standard", "distance": 2.631, "atom1_id": "///D/91/O", "atom2_id": "///D/93/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1077, "atom1_serNum": 11709, "atom2_serNum": 11716, "donAcc_type": "acceptable", "distance": 2.736, "atom1_id": "///D/95/ND1", "atom2_id": "///D/96/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1078, "atom1_serNum": 11716, "atom2_serNum": 11718, "donAcc_type": "acceptable", "distance": 2.961, "atom1_id": "///D/96/O", "atom2_id": "///D/96/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1079, "atom1_serNum": 11716, "atom2_serNum": 11727, "donAcc_type": "standard", "distance": 3.184, "atom1_id": "///D/96/O", "atom2_id": "///D/98/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1080, "atom1_serNum": 11734, "atom2_serNum": 11772, "donAcc_type": "standard", "distance": 3.235, "atom1_id": "///D/98/NE", "atom2_id": "///D/104/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1081, "atom1_serNum": 11737, "atom2_serNum": 11772, "donAcc_type": "standard", "distance": 3.142, "atom1_id": "///D/98/NH2", "atom2_id": "///D/104/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1082, "atom1_serNum": 11742, "atom2_serNum": 11766, "donAcc_type": "standard", "distance": 3.024, "atom1_id": "///D/100/N", "atom2_id": "///D/103/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1083, "atom1_serNum": 11745, "atom2_serNum": 11755, "donAcc_type": "standard", "distance": 2.860, "atom1_id": "///D/100/O", "atom2_id": "///D/102/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1084, "atom1_serNum": 11745, "atom2_serNum": 11763, "donAcc_type": "standard", "distance": 3.321, "atom1_id": "///D/100/O", "atom2_id": "///D/103/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1085, "atom1_serNum": 11813, "atom2_serNum": 11826, "donAcc_type": "standard", "distance": 2.651, "atom1_id": "///D/109/NH2", "atom2_id": "///D/111/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1086, "atom1_serNum": 11835, "atom2_serNum": 11854, "donAcc_type": "standard", "distance": 3.284, "atom1_id": "///D/112/O", "atom2_id": "///D/115/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1087, "atom1_serNum": 11840, "atom2_serNum": 11879, "donAcc_type": "standard", "distance": 3.788, "atom1_id": "///D/113/O", "atom2_id": "///D/118/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1088, "atom1_serNum": 11844, "atom2_serNum": 11882, "donAcc_type": "standard", "distance": 2.865, "atom1_id": "///D/113/NE", "atom2_id": "///D/118/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1089, "atom1_serNum": 11847, "atom2_serNum": 11895, "donAcc_type": "questionable", "distance": 3.100, "atom1_id": "///D/113/NH2", "atom2_id": "///D/120/N", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 1090, "atom1_serNum": 11857, "atom2_serNum": 11875, "donAcc_type": "standard", "distance": 2.829, "atom1_id": "///D/115/O", "atom2_id": "///D/117/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1091, "atom1_serNum": 11882, "atom2_serNum": 11895, "donAcc_type": "standard", "distance": 3.136, "atom1_id": "///D/118/O", "atom2_id": "///D/120/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1092, "atom1_serNum": 11959, "atom2_serNum": 11984, "donAcc_type": "acceptable", "distance": 2.981, "atom1_id": "///H/5/N", "atom2_id": "///H/7/OH", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1093, "atom1_serNum": 11962, "atom2_serNum": 11973, "donAcc_type": "standard", "distance": 3.111, "atom1_id": "///H/5/O", "atom2_id": "///H/7/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1094, "atom1_serNum": 11971, "atom2_serNum": 12361, "donAcc_type": "questionable", "distance": 3.301, "atom1_id": "///H/6/O", "atom2_id": "///H/60/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1095, "atom1_serNum": 11985, "atom2_serNum": 12346, "donAcc_type": "standard", "distance": 2.824, "atom1_id": "///H/8/N", "atom2_id": "///H/58/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1096, "atom1_serNum": 11988, "atom2_serNum": 12343, "donAcc_type": "standard", "distance": 2.798, "atom1_id": "///H/8/O", "atom2_id": "///H/58/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1097, "atom1_serNum": 12001, "atom2_serNum": 12332, "donAcc_type": "standard", "distance": 3.097, "atom1_id": "///H/10/N", "atom2_id": "///H/56/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1098, "atom1_serNum": 12004, "atom2_serNum": 12329, "donAcc_type": "standard", "distance": 2.779, "atom1_id": "///H/10/O", "atom2_id": "///H/56/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1099, "atom1_serNum": 12021, "atom2_serNum": 12314, "donAcc_type": "standard", "distance": 3.166, "atom1_id": "///H/12/O", "atom2_id": "///H/54/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1100, "atom1_serNum": 12033, "atom2_serNum": 12232, "donAcc_type": "questionable", "distance": 3.144, "atom1_id": "///H/14/O", "atom2_id": "///H/42/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1101, "atom1_serNum": 12063, "atom2_serNum": 12087, "donAcc_type": "standard", "distance": 2.988, "atom1_id": "///H/19/O", "atom2_id": "///H/23/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1102, "atom1_serNum": 12090, "atom2_serNum": 12098, "donAcc_type": "standard", "distance": 2.872, "atom1_id": "///H/23/O", "atom2_id": "///H/25/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1103, "atom1_serNum": 12090, "atom2_serNum": 12105, "donAcc_type": "standard", "distance": 3.013, "atom1_id": "///H/23/O", "atom2_id": "///H/26/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1104, "atom1_serNum": 12097, "atom2_serNum": 12110, "donAcc_type": "standard", "distance": 3.199, "atom1_id": "///H/24/O", "atom2_id": "///H/27/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1105, "atom1_serNum": 12097, "atom2_serNum": 12118, "donAcc_type": "standard", "distance": 2.588, "atom1_id": "///H/24/O", "atom2_id": "///H/28/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1106, "atom1_serNum": 12113, "atom2_serNum": 12131, "donAcc_type": "standard", "distance": 3.059, "atom1_id": "///H/27/O", "atom2_id": "///H/30/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1107, "atom1_serNum": 12113, "atom2_serNum": 12144, "donAcc_type": "standard", "distance": 3.460, "atom1_id": "///H/27/O", "atom2_id": "///H/32/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1108, "atom1_serNum": 12121, "atom2_serNum": 12140, "donAcc_type": "standard", "distance": 2.971, "atom1_id": "///H/28/O", "atom2_id": "///H/31/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1109, "atom1_serNum": 12143, "atom2_serNum": 12393, "donAcc_type": "questionable", "distance": 3.350, "atom1_id": "///H/31/O", "atom2_id": "///H/64/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1110, "atom1_serNum": 12147, "atom2_serNum": 12159, "donAcc_type": "standard", "distance": 3.269, "atom1_id": "///H/32/O", "atom2_id": "///H/34/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1111, "atom1_serNum": 12154, "atom2_serNum": 12175, "donAcc_type": "standard", "distance": 2.977, "atom1_id": "///H/33/O", "atom2_id": "///H/36/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1112, "atom1_serNum": 12154, "atom2_serNum": 12184, "donAcc_type": "standard", "distance": 2.978, "atom1_id": "///H/33/O", "atom2_id": "///H/37/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1113, "atom1_serNum": 12158, "atom2_serNum": 12182, "donAcc_type": "standard", "distance": 3.914, "atom1_id": "///H/33/ND2", "atom2_id": "///H/36/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1114, "atom1_serNum": 12158, "atom2_serNum": 12399, "donAcc_type": "questionable", "distance": 2.755, "atom1_id": "///H/33/ND2", "atom2_id": "///H/64/NH1", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 1115, "atom1_serNum": 12162, "atom2_serNum": 12195, "donAcc_type": "standard", "distance": 2.852, "atom1_id": "///H/34/O", "atom2_id": "///H/38/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1116, "atom1_serNum": 12170, "atom2_serNum": 12201, "donAcc_type": "standard", "distance": 3.501, "atom1_id": "///H/35/O", "atom2_id": "///H/39/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1117, "atom1_serNum": 12178, "atom2_serNum": 12210, "donAcc_type": "standard", "distance": 2.805, "atom1_id": "///H/36/O", "atom2_id": "///H/40/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1118, "atom1_serNum": 12187, "atom2_serNum": 12215, "donAcc_type": "standard", "distance": 2.552, "atom1_id": "///H/37/O", "atom2_id": "///H/41/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1119, "atom1_serNum": 12198, "atom2_serNum": 12226, "donAcc_type": "standard", "distance": 3.312, "atom1_id": "///H/38/O", "atom2_id": "///H/42/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1120, "atom1_serNum": 12198, "atom2_serNum": 12233, "donAcc_type": "standard", "distance": 2.522, "atom1_id": "///H/38/O", "atom2_id": "///H/42/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1121, "atom1_serNum": 12204, "atom2_serNum": 12234, "donAcc_type": "standard", "distance": 3.267, "atom1_id": "///H/39/O", "atom2_id": "///H/43/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1122, "atom1_serNum": 12213, "atom2_serNum": 12239, "donAcc_type": "standard", "distance": 3.685, "atom1_id": "///H/40/O", "atom2_id": "///H/44/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1123, "atom1_serNum": 12218, "atom2_serNum": 12239, "donAcc_type": "standard", "distance": 3.124, "atom1_id": "///H/41/O", "atom2_id": "///H/44/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1124, "atom1_serNum": 12218, "atom2_serNum": 12248, "donAcc_type": "standard", "distance": 2.945, "atom1_id": "///H/41/O", "atom2_id": "///H/45/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1125, "atom1_serNum": 12229, "atom2_serNum": 12255, "donAcc_type": "standard", "distance": 3.145, "atom1_id": "///H/42/O", "atom2_id": "///H/46/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1126, "atom1_serNum": 12242, "atom2_serNum": 12269, "donAcc_type": "standard", "distance": 3.023, "atom1_id": "///H/44/O", "atom2_id": "///H/48/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1127, "atom1_serNum": 12251, "atom2_serNum": 12277, "donAcc_type": "standard", "distance": 2.851, "atom1_id": "///H/45/O", "atom2_id": "///H/49/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1128, "atom1_serNum": 12302, "atom2_serNum": 12314, "donAcc_type": "standard", "distance": 3.109, "atom1_id": "///H/52/O", "atom2_id": "///H/54/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1129, "atom1_serNum": 12325, "atom2_serNum": 12450, "donAcc_type": "standard", "distance": 3.683, "atom1_id": "///H/55/O", "atom2_id": "///H/71/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1130, "atom1_serNum": 12336, "atom2_serNum": 12439, "donAcc_type": "standard", "distance": 3.603, "atom1_id": "///H/57/N", "atom2_id": "///H/69/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1131, "atom1_serNum": 12339, "atom2_serNum": 12436, "donAcc_type": "standard", "distance": 3.599, "atom1_id": "///H/57/O", "atom2_id": "///H/69/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1132, "atom1_serNum": 12351, "atom2_serNum": 12421, "donAcc_type": "standard", "distance": 2.657, "atom1_id": "///H/59/N", "atom2_id": "///H/67/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1133, "atom1_serNum": 12354, "atom2_serNum": 12418, "donAcc_type": "standard", "distance": 2.899, "atom1_id": "///H/59/O", "atom2_id": "///H/67/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1134, "atom1_serNum": 12365, "atom2_serNum": 12404, "donAcc_type": "standard", "distance": 2.890, "atom1_id": "///H/61/N", "atom2_id": "///H/65/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1135, "atom1_serNum": 12385, "atom2_serNum": 12401, "donAcc_type": "standard", "distance": 2.512, "atom1_id": "///H/63/O", "atom2_id": "///H/65/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1136, "atom1_serNum": 12464, "atom2_serNum": 12771, "donAcc_type": "acceptable", "distance": 2.567, "atom1_id": "///H/72/OG1", "atom2_id": "///H/115/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1137, "atom1_serNum": 12469, "atom2_serNum": 12754, "donAcc_type": "standard", "distance": 3.522, "atom1_id": "///H/73/O", "atom2_id": "///H/112/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1138, "atom1_serNum": 12483, "atom2_serNum": 12497, "donAcc_type": "standard", "distance": 2.718, "atom1_id": "///H/75/O", "atom2_id": "///H/78/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1139, "atom1_serNum": 12483, "atom2_serNum": 12505, "donAcc_type": "standard", "distance": 3.253, "atom1_id": "///H/75/O", "atom2_id": "///H/79/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1140, "atom1_serNum": 12488, "atom2_serNum": 12513, "donAcc_type": "standard", "distance": 3.044, "atom1_id": "///H/76/O", "atom2_id": "///H/80/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1141, "atom1_serNum": 12493, "atom2_serNum": 12522, "donAcc_type": "standard", "distance": 3.168, "atom1_id": "///H/77/O", "atom2_id": "///H/81/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1142, "atom1_serNum": 12500, "atom2_serNum": 12531, "donAcc_type": "standard", "distance": 3.055, "atom1_id": "///H/78/O", "atom2_id": "///H/82/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1143, "atom1_serNum": 12508, "atom2_serNum": 12536, "donAcc_type": "standard", "distance": 2.770, "atom1_id": "///H/79/O", "atom2_id": "///H/83/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1144, "atom1_serNum": 12516, "atom2_serNum": 12541, "donAcc_type": "standard", "distance": 2.839, "atom1_id": "///H/80/O", "atom2_id": "///H/84/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1145, "atom1_serNum": 12516, "atom2_serNum": 12545, "donAcc_type": "standard", "distance": 2.872, "atom1_id": "///H/80/O", "atom2_id": "///H/85/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1146, "atom1_serNum": 12534, "atom2_serNum": 12690, "donAcc_type": "standard", "distance": 3.555, "atom1_id": "///H/82/O", "atom2_id": "///H/104/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1147, "atom1_serNum": 12577, "atom2_serNum": 12618, "donAcc_type": "acceptable", "distance": 2.554, "atom1_id": "///H/89/OG", "atom2_id": "///H/95/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1148, "atom1_serNum": 12585, "atom2_serNum": 12606, "donAcc_type": "standard", "distance": 3.027, "atom1_id": "///H/91/O", "atom2_id": "///H/94/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1149, "atom1_serNum": 12585, "atom2_serNum": 12615, "donAcc_type": "standard", "distance": 3.243, "atom1_id": "///H/91/O", "atom2_id": "///H/95/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1150, "atom1_serNum": 12594, "atom2_serNum": 12606, "donAcc_type": "standard", "distance": 2.604, "atom1_id": "///H/92/O", "atom2_id": "///H/94/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1151, "atom1_serNum": 12605, "atom2_serNum": 12895, "donAcc_type": "standard", "distance": 3.054, "atom1_id": "///H/93/ND2", "atom2_id": "///H/133/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1152, "atom1_serNum": 12632, "atom2_serNum": 12920, "donAcc_type": "standard", "distance": 3.304, "atom1_id": "///H/97/N", "atom2_id": "///H/136/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1153, "atom1_serNum": 12642, "atom2_serNum": 12929, "donAcc_type": "standard", "distance": 3.309, "atom1_id": "///H/98/O", "atom2_id": "///H/138/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1154, "atom1_serNum": 12652, "atom2_serNum": 12932, "donAcc_type": "standard", "distance": 2.746, "atom1_id": "///H/100/N", "atom2_id": "///H/138/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1155, "atom1_serNum": 12655, "atom2_serNum": 12943, "donAcc_type": "standard", "distance": 2.875, "atom1_id": "///H/100/O", "atom2_id": "///H/140/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1156, "atom1_serNum": 12660, "atom2_serNum": 12689, "donAcc_type": "standard", "distance": 3.552, "atom1_id": "///H/101/N", "atom2_id": "///H/104/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1157, "atom1_serNum": 12663, "atom2_serNum": 12682, "donAcc_type": "standard", "distance": 2.929, "atom1_id": "///H/101/O", "atom2_id": "///H/104/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1158, "atom1_serNum": 12663, "atom2_serNum": 12691, "donAcc_type": "standard", "distance": 3.195, "atom1_id": "///H/101/O", "atom2_id": "///H/105/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1159, "atom1_serNum": 12666, "atom2_serNum": 12946, "donAcc_type": "standard", "distance": 3.124, "atom1_id": "///H/102/N", "atom2_id": "///H/140/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1160, "atom1_serNum": 12669, "atom2_serNum": 12699, "donAcc_type": "standard", "distance": 3.156, "atom1_id": "///H/102/O", "atom2_id": "///H/106/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1161, "atom1_serNum": 12680, "atom2_serNum": 12708, "donAcc_type": "standard", "distance": 3.087, "atom1_id": "///H/103/O", "atom2_id": "///H/107/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1162, "atom1_serNum": 12685, "atom2_serNum": 12717, "donAcc_type": "standard", "distance": 2.814, "atom1_id": "///H/104/O", "atom2_id": "///H/108/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1163, "atom1_serNum": 12694, "atom2_serNum": 12725, "donAcc_type": "standard", "distance": 2.912, "atom1_id": "///H/105/O", "atom2_id": "///H/109/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1164, "atom1_serNum": 12702, "atom2_serNum": 12730, "donAcc_type": "standard", "distance": 2.790, "atom1_id": "///H/106/O", "atom2_id": "///H/110/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1165, "atom1_serNum": 12711, "atom2_serNum": 12730, "donAcc_type": "standard", "distance": 2.831, "atom1_id": "///H/107/O", "atom2_id": "///H/110/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1166, "atom1_serNum": 12711, "atom2_serNum": 12739, "donAcc_type": "standard", "distance": 2.988, "atom1_id": "///H/107/O", "atom2_id": "///H/111/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1167, "atom1_serNum": 12720, "atom2_serNum": 12746, "donAcc_type": "standard", "distance": 3.044, "atom1_id": "///H/108/O", "atom2_id": "///H/112/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1168, "atom1_serNum": 12728, "atom2_serNum": 12755, "donAcc_type": "standard", "distance": 2.898, "atom1_id": "///H/109/O", "atom2_id": "///H/113/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1169, "atom1_serNum": 12749, "atom2_serNum": 12765, "donAcc_type": "standard", "distance": 2.788, "atom1_id": "///H/112/O", "atom2_id": "///H/115/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1170, "atom1_serNum": 12749, "atom2_serNum": 12773, "donAcc_type": "standard", "distance": 2.782, "atom1_id": "///H/112/O", "atom2_id": "///H/116/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1171, "atom1_serNum": 12800, "atom2_serNum": 12827, "donAcc_type": "standard", "distance": 3.237, "atom1_id": "///H/120/O", "atom2_id": "///H/124/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1172, "atom1_serNum": 12808, "atom2_serNum": 12835, "donAcc_type": "standard", "distance": 3.123, "atom1_id": "///H/121/O", "atom2_id": "///H/125/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1173, "atom1_serNum": 12808, "atom2_serNum": 12840, "donAcc_type": "acceptable", "distance": 2.778, "atom1_id": "///H/121/O", "atom2_id": "///H/125/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1174, "atom1_serNum": 12816, "atom2_serNum": 12842, "donAcc_type": "standard", "distance": 3.029, "atom1_id": "///H/122/O", "atom2_id": "///H/126/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1175, "atom1_serNum": 12825, "atom2_serNum": 12842, "donAcc_type": "standard", "distance": 2.879, "atom1_id": "///H/123/O", "atom2_id": "///H/126/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1176, "atom1_serNum": 12825, "atom2_serNum": 12853, "donAcc_type": "standard", "distance": 3.070, "atom1_id": "///H/123/O", "atom2_id": "///H/127/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1177, "atom1_serNum": 12830, "atom2_serNum": 12859, "donAcc_type": "standard", "distance": 3.017, "atom1_id": "///H/124/O", "atom2_id": "///H/128/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1178, "atom1_serNum": 12838, "atom2_serNum": 12867, "donAcc_type": "standard", "distance": 3.007, "atom1_id": "///H/125/O", "atom2_id": "///H/129/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1179, "atom1_serNum": 12845, "atom2_serNum": 12876, "donAcc_type": "standard", "distance": 3.315, "atom1_id": "///H/126/O", "atom2_id": "///H/130/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1180, "atom1_serNum": 12856, "atom2_serNum": 12876, "donAcc_type": "standard", "distance": 3.008, "atom1_id": "///H/127/O", "atom2_id": "///H/130/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1181, "atom1_serNum": 12862, "atom2_serNum": 12885, "donAcc_type": "acceptable", "distance": 2.487, "atom1_id": "///H/128/O", "atom2_id": "///H/131/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1182, "atom1_serNum": 12862, "atom2_serNum": 12887, "donAcc_type": "standard", "distance": 3.259, "atom1_id": "///H/128/O", "atom2_id": "///H/132/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1183, "atom1_serNum": 12870, "atom2_serNum": 12892, "donAcc_type": "standard", "distance": 2.989, "atom1_id": "///H/129/O", "atom2_id": "///H/133/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1184, "atom1_serNum": 12879, "atom2_serNum": 12908, "donAcc_type": "acceptable", "distance": 3.037, "atom1_id": "///H/130/O", "atom2_id": "///H/134/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1185, "atom1_serNum": 12883, "atom2_serNum": 12909, "donAcc_type": "standard", "distance": 3.232, "atom1_id": "///H/131/O", "atom2_id": "///H/135/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1186, "atom1_serNum": 12890, "atom2_serNum": 12909, "donAcc_type": "standard", "distance": 2.983, "atom1_id": "///H/132/O", "atom2_id": "///H/135/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1187, "atom1_serNum": 12890, "atom2_serNum": 12917, "donAcc_type": "standard", "distance": 3.125, "atom1_id": "///H/132/O", "atom2_id": "///H/136/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1188, "atom1_serNum": 12890, "atom2_serNum": 12921, "donAcc_type": "standard", "distance": 2.937, "atom1_id": "///H/132/O", "atom2_id": "///H/137/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1189, "atom1_serNum": 12952, "atom2_serNum": 12959, "donAcc_type": "standard", "distance": 2.682, "atom1_id": "///H/141/N", "atom2_id": "///H/141/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" } ], "refCoords": { "purine": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 -0.5000 0.4000", " 3 N -2.2500 -0.5000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 1.2500 5.0000 0.4000", " 6 C 1.2500 -0.5000 0.4000", " 7 C 1.2500 -0.5000 -0.4000", " 8 C 1.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 -0.5000 0.4000", " 11 C -2.2500 -0.5000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ], "pyrimidine": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 1.0000 0.4000", " 3 N -2.2500 1.0000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 1.2500 5.0000 0.4000", " 6 C 1.2500 1.0000 0.4000", " 7 C 1.2500 1.0000 -0.4000", " 8 C 1.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 1.0000 0.4000", " 11 C -2.2500 1.0000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ], "wc_pair": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 -5.0000 0.4000", " 3 N -2.2500 -5.0000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 2.2500 5.0000 0.4000", " 6 C 2.2500 -5.0000 0.4000", " 7 C 2.2500 -5.0000 -0.4000", " 8 C 2.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 -5.0000 0.4000", " 11 C -2.2500 -5.0000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ] }, "metadata": { "license": "http://innovation.columbia.edu/technologies/CU20391", "url": "http://x3dna.org/", "url_alt": "http://home.x3dna.org/", "forum": "http://forum.x3dna.org/", "citation": "Lu et al. (2015). 'DSSR: an integrated software tool for dissecting the spatial structure of RNA.' Nucleic Acids Res., 43(21):e142 [doi:10.1093/nar/gkv716].", "str_id": "3deg", "num_aaChains": 3, "aaChains": "C=545,D=123,H=141", "num_naChains": 8, "naChains": "A=76,B=77,E=16,F=12,G=70,I=29,J=18,K=15", "num_atoms": 12950, "num_waters": 0, "num_notes": 52, "notes": [ { "Aminors": "A-minor interactions (including types I and II)" }, { "Cstem_index": "stem index of the 'Canonical' helix in k-turn" }, { "Cstem_pair": "Cstem bp delineating the k-turn internal loop" }, { "Dp": "perpendicular distance of the 3' P atom to the glycosidic bond" }, { "GA_pair": "sheared G-A pair in k-turn" }, { "HtypePknot": "H-type pseudoknot" }, { "Kturn": "kink-turn (k-turn)" }, { "LW": "Leontis-Westhof" }, { "NCstem_index": "stem index of the 'Non-Canonical' helix in k-turn" }, { "NCstem_pair": "NCstem bp delineating the k-turn internal loop" }, { "Uturn": "U-turn of the UNR- or GNRA-type" }, { "aa": "amino acid" }, { "atom_pair": "symbols of the two atoms involved in an H-bond" }, { "auxfiles": "auxiliary files" }, { "glyco_bond": "conformation of base related to sugar (syn or anti)" }, { "bb_type": "backbone conformation, BI or BII" }, { "bending_angle": "angle between two helical axes" }, { "bp": "base pair" }, { "bseq": "base sequence in one-letter code" }, { "bulge": "bulge loop" }, { "coaxStacks": "coaxial stacking of stems within a helix" }, { "dbn": "dot bracket notation" }, { "desc": "description" }, { "donAcc_type": "donor/acceptor type of the atom pair in an H-bond" }, { "epsilon_zeta": "difference between epsilon and zeta torsion angles" }, { "hairpin": "hairpin loop" }, { "hbond": "hydrogen bond (H-bond)" }, { "helix": "defined by base-stacking interactions, regardless of bp type and backbone connectivity" }, { "id": "identifier" }, { "iloop": "internal loop" }, { "index": "serial number" }, { "isoCanonPairs": "isolated canonical pairs" }, { "junction": "(multi-branched) junction loop" }, { "kissingLoop": "kissing loop" }, { "multiplet": "3+ bases in a coplanar geometry" }, { "na": "nucleic acid" }, { "nonPair": "two nts not forming a pair, but with H-bonding/stacking interactions" }, { "nonStack": "nucleotide not involved in stacking interactions" }, { "nt": "nucleotide" }, { "num": "number" }, { "oArea": "overlap areas between two bases, including exocyclic atoms" }, { "oArea_ring": "overlap areas between two bases, including only ring atoms" }, { "phosContacts": "H-bonding and atom-capping interactions involving a phosphate" }, { "residue_pair": "types of the two residues involved in an H-bond" }, { "rmsd": "root-mean-squares deviation" }, { "serNum": "serial number" }, { "ssSegments": "single-stranded segments not involved in loops" }, { "ssZp": "Z-coordinate of the 3' phosphorus atom with reference to the 5' base plane" }, { "sstr": "secondary structure in dbn" }, { "stem": "helix consisting of only canonical pairs, with a continuous backbone" }, { "str_id": "structure identifier, derived from inpfile with extension removed" }, { "vert_dist": "vertical distance from an atom to a base plane" } ], "num_auxfiles": 21, "auxfiles": [ { "index": 1, "name": "dssr-pairs.pdb", "desc": "an ensemble of base pairs" }, { "index": 2, "name": "dssr-multiplets.pdb", "desc": "an ensemble of multiplets" }, { "index": 3, "name": "dssr-stems.pdb", "desc": "an ensemble of stems" }, { "index": 4, "name": "dssr-helices.pdb", "desc": "an ensemble of helices (coaxial stacking)" }, { "index": 5, "name": "dssr-hairpins.pdb", "desc": "an ensemble of hairpin loops" }, { "index": 6, "name": "dssr-bulges.pdb", "desc": "an ensemble of bulges" }, { "index": 7, "name": "dssr-iloops.pdb", "desc": "an ensemble of internal loops" }, { "index": 8, "name": "dssr-junctions.pdb", "desc": "an ensemble of junctions (multi-branch)" }, { "index": 9, "name": "dssr-2ndstrs.bpseq", "desc": "secondary structure in bpseq format" }, { "index": 10, "name": "dssr-2ndstrs.ct", "desc": "secondary structure in connectivity table format" }, { "index": 11, "name": "dssr-2ndstrs.dbn", "desc": "secondary structure in dot-bracket notation" }, { "index": 12, "name": "dssr-torsions.txt", "desc": "backbone torsion angles and suite names" }, { "index": 13, "name": "dssr-splays.pdb", "desc": "an ensemble of splayed-apart units" }, { "index": 14, "name": "dssr-Aminors.pdb", "desc": "an ensemble of A minor motifs (types I and II)" }, { "index": 15, "name": "dssr-Kturns.pdb", "desc": "an ensemble of kink-turn motifs" }, { "index": 16, "name": "dssr-stacks.pdb", "desc": "an ensemble of base stacks" }, { "index": 17, "name": "dssr-atom2bases.pdb", "desc": "an ensemble of atom-base stacking interactions" }, { "index": 18, "name": "dssr-rotmat.txt", "desc": "position vector and rotation matrix" }, { "index": 19, "name": "dssr-viewV.pdb", "desc": "vertical view of the principal moment of inertia" }, { "index": 20, "name": "dssr-viewH.pdb", "desc": "horizontal view of the principal moment of inertia" }, { "index": 21, "name": "dssr-viewT.pdb", "desc": "top view of the principal moment of inertia" } ], "time_used": "999" } }