{ "num_pairs": 44, "pairs": [ { "index": 1, "nt1": "///D/1", "nt2": "///E/61", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -163.528, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 50.311, "chi2": -144.630, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 50.260, "C1C1_dist": 10.729, "N1N9_dist": 8.873, "C6C8_dist": 9.662, "CNNC_torsion": -23.725, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.76],N1(imino)-N3[2.68],N2(amino)-O2(carbonyl)[2.97]", "interBase_angle": 27.384, "planarity": 0.324, "simple_Shear": -0.228, "simple_Stretch": -0.322, "simple_Buckle": -9.094, "simple_Propeller": -25.830, "bp_simpleParams": [ -0.228, -0.322, 0.049, -9.094, -25.830, -3.599 ], "bp_params": [ -0.224, -0.325, 0.049, -8.618, -25.993, -3.684 ], "frame": { "rmsd": null, "origin": [ 22.721, 81.280, 19.821 ], "x_axis": [ 0.782, 0.587, 0.212 ], "y_axis": [ 0.580, -0.558, -0.594 ], "z_axis": [ -0.231, 0.587, -0.776 ], "quaternion": [ -0.335, 0.883, 0.330, -0.005 ] } }, { "index": 2, "nt1": "///D/2", "nt2": "///E/60", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -168.036, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 52.230, "chi2": -158.739, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 49.864, "C1C1_dist": 10.883, "N1N9_dist": 9.022, "C6C8_dist": 9.835, "CNNC_torsion": -18.428, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[3.02],N1(imino)-N3[2.89],N2(amino)-O2(carbonyl)[2.83]", "interBase_angle": 19.734, "planarity": 0.247, "simple_Shear": 0.103, "simple_Stretch": -0.140, "simple_Buckle": -3.890, "simple_Propeller": -19.347, "bp_simpleParams": [ 0.103, -0.140, 0.298, -3.890, -19.347, -2.973 ], "bp_params": [ 0.100, -0.141, 0.298, -4.205, -19.281, -3.013 ], "frame": { "rmsd": null, "origin": [ 21.855, 84.422, 18.199 ], "x_axis": [ 0.989, 0.142, -0.036 ], "y_axis": [ 0.093, -0.800, -0.593 ], "z_axis": [ -0.113, 0.583, -0.804 ], "quaternion": [ -0.310, 0.948, 0.062, -0.039 ] } }, { "index": 3, "nt1": "///D/3", "nt2": "///E/59", "bp": "U-G", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -156.861, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 63.457, "chi2": 173.118, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 41.050, "C1C1_dist": 10.791, "N1N9_dist": 9.017, "C6C8_dist": 9.801, "CNNC_torsion": -13.169, "hbonds_num": 2, "hbonds_desc": "O2(carbonyl)-N1(imino)[3.10],N3(imino)-O6(carbonyl)[2.89]", "interBase_angle": 7.824, "planarity": 0.122, "simple_Shear": 1.921, "simple_Stretch": -0.014, "simple_Buckle": 2.052, "simple_Propeller": -7.550, "bp_simpleParams": [ 1.921, -0.014, 0.306, 2.052, -7.550, -5.969 ], "bp_params": [ 1.884, -0.375, 0.306, 0.594, -7.801, -5.983 ], "frame": { "rmsd": null, "origin": [ 22.305, 87.473, 16.321 ], "x_axis": [ 0.814, -0.451, -0.367 ], "y_axis": [ -0.580, -0.678, -0.452 ], "z_axis": [ -0.045, 0.581, -0.813 ], "quaternion": [ -0.284, 0.909, -0.284, -0.113 ] } }, { "index": 4, "nt1": "///D/4", "nt2": "///E/58", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -161.485, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 51.920, "chi2": -155.258, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 45.010, "C1C1_dist": 11.000, "N1N9_dist": 9.084, "C6C8_dist": 9.869, "CNNC_torsion": -19.452, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.98],N1-N3(imino)[2.94]", "interBase_angle": 21.788, "planarity": 0.257, "simple_Shear": 0.429, "simple_Stretch": -0.011, "simple_Buckle": -3.780, "simple_Propeller": -21.457, "bp_simpleParams": [ 0.429, -0.011, 0.066, -3.780, -21.457, -6.088 ], "bp_params": [ 0.428, -0.032, 0.066, -4.773, -21.258, -6.188 ], "frame": { "rmsd": null, "origin": [ 23.633, 90.084, 14.472 ], "x_axis": [ 0.439, -0.800, -0.409 ], "y_axis": [ -0.875, -0.277, -0.397 ], "z_axis": [ 0.205, 0.532, -0.822 ], "quaternion": [ -0.292, 0.797, -0.526, -0.064 ] } }, { "index": 5, "nt1": "///D/5", "nt2": "///E/57", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -162.215, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 51.779, "chi2": -167.995, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 51.256, "C1C1_dist": 10.948, "N1N9_dist": 9.139, "C6C8_dist": 10.046, "CNNC_torsion": -17.658, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.16],N1-N3(imino)[3.07]", "interBase_angle": 15.996, "planarity": 0.215, "simple_Shear": 0.063, "simple_Stretch": 0.082, "simple_Buckle": 2.715, "simple_Propeller": -15.763, "bp_simpleParams": [ 0.063, 0.082, 0.468, 2.715, -15.763, -3.444 ], "bp_params": [ 0.063, 0.082, 0.468, 2.606, -15.782, -3.476 ], "frame": { "rmsd": null, "origin": [ 25.641, 91.460, 12.205 ], "x_axis": [ -0.111, -0.842, -0.527 ], "y_axis": [ -0.977, 0.190, -0.098 ], "z_axis": [ 0.182, 0.504, -0.844 ], "quaternion": [ 0.242, -0.621, 0.732, 0.139 ] } }, { "index": 6, "nt1": "///D/6", "nt2": "///E/56", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -162.724, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 47.778, "chi2": -155.560, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 56.140, "C1C1_dist": 10.655, "N1N9_dist": 8.860, "C6C8_dist": 9.685, "CNNC_torsion": -18.337, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.79],N1-N3(imino)[2.91]", "interBase_angle": 18.640, "planarity": 0.227, "simple_Shear": -0.733, "simple_Stretch": -0.245, "simple_Buckle": -0.138, "simple_Propeller": -18.639, "bp_simpleParams": [ -0.733, -0.245, -0.111, -0.138, -18.639, -5.337 ], "bp_params": [ -0.714, -0.296, -0.111, 1.177, -18.603, -5.408 ], "frame": { "rmsd": null, "origin": [ 27.960, 92.379, 9.286 ], "x_axis": [ -0.578, -0.652, -0.491 ], "y_axis": [ -0.773, 0.629, 0.075 ], "z_axis": [ 0.260, 0.423, -0.868 ], "quaternion": [ 0.214, -0.406, 0.877, 0.142 ] } }, { "index": 7, "nt1": "///D/7", "nt2": "///E/55", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -164.534, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 52.910, "chi2": -167.595, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 60.485, "C1C1_dist": 10.709, "N1N9_dist": 9.107, "C6C8_dist": 10.101, "CNNC_torsion": -13.621, "hbonds_num": 4, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.89],N3-N1(imino)[3.06],N3-N2(amino)[3.04],N4(amino)-O6(carbonyl)[3.16]", "interBase_angle": 19.482, "planarity": 0.232, "simple_Shear": -0.690, "simple_Stretch": 0.136, "simple_Buckle": 8.029, "simple_Propeller": -17.751, "bp_simpleParams": [ -0.690, 0.136, 0.198, 8.029, -17.751, 3.194 ], "bp_params": [ -0.699, 0.081, 0.198, 9.367, -17.082, 3.220 ], "frame": { "rmsd": null, "origin": [ 28.700, 92.175, 5.867 ], "x_axis": [ -0.904, -0.282, -0.322 ], "y_axis": [ -0.382, 0.872, 0.306 ], "z_axis": [ 0.195, 0.399, -0.896 ], "quaternion": [ 0.135, -0.173, 0.958, 0.184 ] } }, { "index": 8, "nt1": "///D/8", "nt2": "///E/54", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -167.061, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 54.426, "chi2": -169.840, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 53.638, "C1C1_dist": 10.833, "N1N9_dist": 9.082, "C6C8_dist": 10.026, "CNNC_torsion": -13.653, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.19],N1-N3(imino)[3.05]", "interBase_angle": 13.372, "planarity": 0.177, "simple_Shear": -0.093, "simple_Stretch": 0.101, "simple_Buckle": -4.818, "simple_Propeller": -12.474, "bp_simpleParams": [ -0.093, 0.101, 0.160, -4.818, -12.474, 0.811 ], "bp_params": [ -0.093, 0.101, 0.160, -4.761, -12.496, 0.815 ], "frame": { "rmsd": null, "origin": [ 29.369, 92.269, 2.184 ], "x_axis": [ -0.971, 0.220, 0.094 ], "y_axis": [ 0.240, 0.881, 0.408 ], "z_axis": [ 0.007, 0.419, -0.908 ], "quaternion": [ -0.022, 0.119, 0.970, 0.213 ] } }, { "index": 9, "nt1": "///D/9", "nt2": "///E/53", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -155.105, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 49.733, "chi2": -153.612, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 60.088, "C1C1_dist": 10.681, "N1N9_dist": 8.986, "C6C8_dist": 9.964, "CNNC_torsion": -14.796, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.97],O4(carbonyl)-N6(amino)[3.11]", "interBase_angle": 22.535, "planarity": 0.263, "simple_Shear": -0.919, "simple_Stretch": 0.065, "simple_Buckle": 4.777, "simple_Propeller": -22.023, "bp_simpleParams": [ -0.919, 0.065, -0.300, 4.777, -22.023, 2.259 ], "bp_params": [ -0.921, -0.029, -0.300, 6.945, -21.439, 2.295 ], "frame": { "rmsd": null, "origin": [ 29.168, 92.422, -0.978 ], "x_axis": [ -0.739, 0.589, 0.327 ], "y_axis": [ 0.670, 0.692, 0.268 ], "z_axis": [ -0.068, 0.417, -0.906 ], "quaternion": [ -0.108, 0.345, 0.913, 0.188 ] } }, { "index": 10, "nt1": "///D/10", "nt2": "///E/52", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -155.339, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 54.027, "chi2": -166.233, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 56.426, "C1C1_dist": 10.903, "N1N9_dist": 9.201, "C6C8_dist": 10.165, "CNNC_torsion": -13.715, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[3.06],N3-N1(imino)[3.08],N4(amino)-O6(carbonyl)[3.17]", "interBase_angle": 22.505, "planarity": 0.269, "simple_Shear": -0.117, "simple_Stretch": 0.138, "simple_Buckle": 8.343, "simple_Propeller": -20.902, "bp_simpleParams": [ -0.117, 0.138, -0.425, 8.343, -20.902, 3.574 ], "bp_params": [ -0.120, 0.136, -0.425, 8.757, -20.732, 3.623 ], "frame": { "rmsd": null, "origin": [ 27.744, 93.838, -3.825 ], "x_axis": [ -0.189, 0.808, 0.558 ], "y_axis": [ 0.970, 0.242, -0.023 ], "z_axis": [ -0.154, 0.537, -0.829 ], "quaternion": [ -0.237, 0.591, 0.752, 0.171 ] } }, { "index": 11, "nt1": "///D/11", "nt2": "///E/51", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -137.447, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 56.002, "chi2": 178.952, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 55.371, "C1C1_dist": 11.115, "N1N9_dist": 9.417, "C6C8_dist": 10.323, "CNNC_torsion": 2.317, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[3.20],N3-N1(imino)[3.40],N4(amino)-O6(carbonyl)[3.54]", "interBase_angle": 22.638, "planarity": 0.246, "simple_Shear": 0.196, "simple_Stretch": 0.455, "simple_Buckle": 21.301, "simple_Propeller": -7.666, "bp_simpleParams": [ 0.196, 0.455, -0.618, 21.301, -7.666, 2.232 ], "bp_params": [ 0.200, 0.454, -0.618, 21.267, -7.759, 2.199 ], "frame": { "rmsd": null, "origin": [ 26.217, 95.422, -6.234 ], "x_axis": [ 0.447, 0.688, 0.571 ], "y_axis": [ 0.881, -0.228, -0.415 ], "z_axis": [ -0.156, 0.689, -0.708 ], "quaternion": [ -0.358, 0.772, 0.508, 0.135 ] } }, { "index": 12, "nt1": "///D/14", "nt2": "///E/50", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": 162.297, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 40.676, "chi2": -170.119, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 43.826, "C1C1_dist": 11.744, "N1N9_dist": 9.545, "C6C8_dist": 10.054, "CNNC_torsion": -20.253, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.83],N1(imino)-N3[3.31],N2(amino)-O2(carbonyl)[3.89]", "interBase_angle": 25.798, "planarity": 0.304, "simple_Shear": -0.342, "simple_Stretch": 0.129, "simple_Buckle": -5.399, "simple_Propeller": -25.227, "bp_simpleParams": [ -0.342, 0.129, 0.043, -5.399, -25.227, -17.265 ], "bp_params": [ -0.345, 0.120, 0.043, -4.656, -25.375, -17.677 ], "frame": { "rmsd": null, "origin": [ 23.659, 98.745, -8.554 ], "x_axis": [ 0.825, 0.445, 0.350 ], "y_axis": [ 0.551, -0.491, -0.675 ], "z_axis": [ -0.129, 0.749, -0.650 ], "quaternion": [ -0.413, 0.861, 0.289, 0.064 ] } }, { "index": 13, "nt1": "///D/15", "nt2": "///E/49", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -149.679, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 58.706, "chi2": -142.074, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 60.308, "C1C1_dist": 10.103, "N1N9_dist": 8.608, "C6C8_dist": 9.731, "CNNC_torsion": -6.350, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.16],N1-N3(imino)[2.80]", "interBase_angle": 26.653, "planarity": 0.313, "simple_Shear": -0.336, "simple_Stretch": -0.130, "simple_Buckle": -17.973, "simple_Propeller": -19.682, "bp_simpleParams": [ -0.336, -0.130, -0.934, -17.973, -19.682, 11.463 ], "bp_params": [ -0.334, -0.135, -0.934, -17.654, -19.968, 11.505 ], "frame": { "rmsd": null, "origin": [ 22.877, 102.884, -8.821 ], "x_axis": [ 0.969, -0.143, 0.203 ], "y_axis": [ 0.098, -0.532, -0.841 ], "z_axis": [ 0.229, 0.835, -0.501 ], "quaternion": [ -0.484, 0.866, -0.013, 0.125 ] } }, { "index": 14, "nt1": "///D/16", "nt2": "///E/48", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -154.969, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 55.545, "chi2": -171.772, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 60.297, "C1C1_dist": 10.498, "N1N9_dist": 8.917, "C6C8_dist": 9.974, "CNNC_torsion": -11.197, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.65],N3-N1(imino)[2.93],N4(amino)-O6(carbonyl)[3.26]", "interBase_angle": 28.932, "planarity": 0.315, "simple_Shear": -0.107, "simple_Stretch": 0.090, "simple_Buckle": 19.351, "simple_Propeller": -21.508, "bp_simpleParams": [ -0.107, 0.090, -0.538, 19.351, -21.508, 9.362 ], "bp_params": [ -0.110, 0.087, -0.538, 20.016, -20.890, 9.380 ], "frame": { "rmsd": null, "origin": [ 23.821, 104.843, -9.668 ], "x_axis": [ 0.868, -0.472, -0.154 ], "y_axis": [ -0.371, -0.412, -0.832 ], "z_axis": [ 0.330, 0.779, -0.533 ], "quaternion": [ -0.480, 0.839, -0.252, 0.053 ] } }, { "index": 15, "nt1": "///D/17", "nt2": "///E/47", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -161.717, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 49.954, "chi2": -171.954, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 60.684, "C1C1_dist": 10.670, "N1N9_dist": 8.980, "C6C8_dist": 9.994, "CNNC_torsion": -11.566, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.98],O4(carbonyl)-N6(amino)[3.25]", "interBase_angle": 11.728, "planarity": 0.201, "simple_Shear": -0.838, "simple_Stretch": 0.085, "simple_Buckle": 6.442, "simple_Propeller": -9.800, "bp_simpleParams": [ -0.838, 0.085, 0.481, 6.442, -9.800, 3.076 ], "bp_params": [ -0.842, 0.008, 0.481, 7.306, -9.174, 3.080 ], "frame": { "rmsd": null, "origin": [ 25.560, 108.368, -10.751 ], "x_axis": [ 0.438, -0.780, -0.447 ], "y_axis": [ -0.839, -0.175, -0.515 ], "z_axis": [ 0.324, 0.601, -0.731 ], "quaternion": [ -0.365, 0.765, -0.529, -0.040 ] } }, { "index": 16, "nt1": "///D/18", "nt2": "///E/46", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -161.688, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 63.981, "chi2": -151.166, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 65.436, "C1C1_dist": 10.290, "N1N9_dist": 9.006, "C6C8_dist": 10.375, "CNNC_torsion": -14.055, "hbonds_num": 2, "hbonds_desc": "N1(imino)-N3[3.33],N2(amino)-O2(carbonyl)[2.71]", "interBase_angle": 21.853, "planarity": 0.358, "simple_Shear": -0.333, "simple_Stretch": 0.544, "simple_Buckle": 3.755, "simple_Propeller": -21.528, "bp_simpleParams": [ -0.333, 0.544, -0.490, 3.755, -21.528, 24.021 ], "bp_params": [ -0.349, 0.534, -0.490, 4.369, -21.412, 24.417 ], "frame": { "rmsd": null, "origin": [ 27.929, 108.862, -14.129 ], "x_axis": [ -0.118, -0.832, -0.542 ], "y_axis": [ -0.875, 0.345, -0.339 ], "z_axis": [ 0.469, 0.434, -0.769 ], "quaternion": [ 0.338, -0.571, 0.747, 0.032 ] } }, { "index": 17, "nt1": "///D/19", "nt2": "///E/45", "bp": "G-U", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": 166.349, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 52.858, "chi2": -168.000, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 61.096, "C1C1_dist": 10.695, "N1N9_dist": 9.075, "C6C8_dist": 10.112, "CNNC_torsion": 2.128, "hbonds_num": 2, "hbonds_desc": "N1(imino)*N3(imino)[3.34],N2(amino)-O2(carbonyl)[2.80]", "interBase_angle": 23.026, "planarity": 0.274, "simple_Shear": -0.738, "simple_Stretch": 0.327, "simple_Buckle": -23.023, "simple_Propeller": -0.353, "bp_simpleParams": [ -0.738, 0.327, -0.466, -23.023, -0.353, 6.607 ], "bp_params": [ -0.759, 0.277, -0.466, -22.947, -1.909, 6.476 ], "frame": { "rmsd": null, "origin": [ 30.996, 110.053, -16.689 ], "x_axis": [ -0.709, -0.634, -0.309 ], "y_axis": [ -0.688, 0.719, 0.101 ], "z_axis": [ 0.158, 0.284, -0.946 ], "quaternion": [ 0.127, -0.360, 0.918, 0.105 ] } }, { "index": 18, "nt1": "///D/20", "nt2": "///E/44", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -174.717, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 44.622, "chi2": -161.415, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 51.694, "C1C1_dist": 10.931, "N1N9_dist": 8.954, "C6C8_dist": 9.643, "CNNC_torsion": 14.097, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.80],N1-N3(imino)[3.03]", "interBase_angle": 20.079, "planarity": 0.248, "simple_Shear": -0.680, "simple_Stretch": -0.154, "simple_Buckle": -16.405, "simple_Propeller": 11.576, "bp_simpleParams": [ -0.680, -0.154, -0.597, -16.405, 11.576, -10.991 ], "bp_params": [ -0.667, -0.203, -0.597, -17.227, 10.315, -10.912 ], "frame": { "rmsd": null, "origin": [ 33.425, 109.069, -20.113 ], "x_axis": [ -0.984, -0.179, 0.009 ], "y_axis": [ -0.178, 0.981, 0.081 ], "z_axis": [ -0.024, 0.078, -0.997 ], "quaternion": [ -0.008, -0.090, 0.995, 0.040 ] } }, { "index": 19, "nt1": "///D/21", "nt2": "///E/43", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": 176.048, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 54.265, "chi2": -167.906, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 54.240, "C1C1_dist": 10.459, "N1N9_dist": 8.733, "C6C8_dist": 9.720, "CNNC_torsion": 6.976, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.96],N1-N3(imino)[2.80]", "interBase_angle": 11.391, "planarity": 0.221, "simple_Shear": -0.102, "simple_Stretch": -0.203, "simple_Buckle": 10.954, "simple_Propeller": 3.127, "bp_simpleParams": [ -0.102, -0.203, -0.509, 10.954, 3.127, 1.906 ], "bp_params": [ -0.101, -0.203, -0.509, 10.944, 3.161, 1.898 ], "frame": { "rmsd": null, "origin": [ 31.785, 108.375, -23.074 ], "x_axis": [ -0.942, 0.330, 0.062 ], "y_axis": [ 0.335, 0.935, 0.113 ], "z_axis": [ -0.021, 0.127, -0.992 ], "quaternion": [ -0.021, 0.169, 0.983, 0.061 ] } }, { "index": 20, "nt1": "///D/22", "nt2": "///E/42", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": 166.636, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 50.494, "chi2": 177.864, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 61.976, "C1C1_dist": 10.781, "N1N9_dist": 9.133, "C6C8_dist": 10.130, "CNNC_torsion": -11.733, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[3.62],N1(imino)-N3[3.35],N2(amino)-O2(carbonyl)[3.00]", "interBase_angle": 23.105, "planarity": 0.297, "simple_Shear": -0.986, "simple_Stretch": 0.329, "simple_Buckle": 20.276, "simple_Propeller": -11.078, "bp_simpleParams": [ -0.986, 0.329, 0.608, 20.276, -11.078, 5.660 ], "bp_params": [ -1.015, 0.227, 0.608, 21.329, -8.883, 5.580 ], "frame": { "rmsd": null, "origin": [ 30.956, 106.430, -26.695 ], "x_axis": [ -0.743, 0.652, 0.152 ], "y_axis": [ 0.657, 0.669, 0.348 ], "z_axis": [ 0.125, 0.358, -0.925 ], "quaternion": [ -0.007, 0.358, 0.913, 0.193 ] } }, { "index": 21, "nt1": "///D/23", "nt2": "///E/41", "bp": "C-G", "name": "~Wobble", "Saenger": "--", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -153.404, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 79.934, "chi2": -172.043, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 55.340, "C1C1_dist": 9.423, "N1N9_dist": 8.329, "C6C8_dist": 9.589, "CNNC_torsion": -8.323, "hbonds_num": 3, "hbonds_desc": "O2'(hydroxyl)-N2(amino)[3.32],O2(carbonyl)-N1(imino)[2.85],O2(carbonyl)-N2(amino)[3.04]", "interBase_angle": 38.052, "planarity": 0.431, "simple_Shear": 2.360, "simple_Stretch": 0.337, "simple_Buckle": 35.338, "simple_Propeller": -14.112, "bp_simpleParams": [ 2.360, 0.337, -1.507, 35.338, -14.112, 29.212 ], "bp_params": [ 2.376, -0.187, -1.507, 31.604, -21.193, 28.654 ], "frame": { "rmsd": null, "origin": [ 29.221, 108.102, -30.040 ], "x_axis": [ -0.107, 0.975, 0.196 ], "y_axis": [ 0.982, 0.135, -0.135 ], "z_axis": [ -0.158, 0.178, -0.971 ], "quaternion": [ -0.119, 0.657, 0.744, 0.015 ] } }, { "index": 22, "nt1": "///D/24", "nt2": "///E/40", "bp": "U-G", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -150.757, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 58.979, "chi2": 159.392, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 42.982, "C1C1_dist": 10.870, "N1N9_dist": 9.026, "C6C8_dist": 9.767, "CNNC_torsion": 2.836, "hbonds_num": 2, "hbonds_desc": "O2(carbonyl)-N1(imino)[3.27],N3(imino)-O6(carbonyl)[3.10]", "interBase_angle": 20.784, "planarity": 0.314, "simple_Shear": 1.607, "simple_Stretch": 0.086, "simple_Buckle": -20.165, "simple_Propeller": -5.034, "bp_simpleParams": [ 1.607, 0.086, -0.140, -20.165, -5.034, -7.729 ], "bp_params": [ 1.600, -0.174, -0.140, -20.716, -1.674, -7.604 ], "frame": { "rmsd": null, "origin": [ 26.900, 108.288, -34.868 ], "x_axis": [ 0.632, 0.702, 0.329 ], "y_axis": [ 0.774, -0.546, -0.321 ], "z_axis": [ -0.045, 0.457, -0.888 ], "quaternion": [ -0.222, 0.876, 0.421, 0.081 ] } }, { "index": 23, "nt1": "///I/1", "nt2": "///J/61", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -160.528, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 50.878, "chi2": -145.372, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 50.028, "C1C1_dist": 10.849, "N1N9_dist": 8.971, "C6C8_dist": 9.783, "CNNC_torsion": -20.729, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.78],N1(imino)-N3[2.77],N2(amino)-O2(carbonyl)[2.95]", "interBase_angle": 23.880, "planarity": 0.278, "simple_Shear": -0.247, "simple_Stretch": -0.237, "simple_Buckle": -11.686, "simple_Propeller": -20.825, "bp_simpleParams": [ -0.247, -0.237, -0.108, -11.686, -20.825, -4.269 ], "bp_params": [ -0.245, -0.239, -0.108, -11.424, -20.970, -4.321 ], "frame": { "rmsd": null, "origin": [ 33.161, 39.438, 40.796 ], "x_axis": [ 0.277, -0.537, -0.797 ], "y_axis": [ 0.867, 0.497, -0.033 ], "z_axis": [ 0.413, -0.682, 0.603 ], "quaternion": [ 0.771, 0.211, 0.392, -0.455 ] } }, { "index": 24, "nt1": "///I/2", "nt2": "///J/60", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -169.716, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 50.969, "chi2": -160.670, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 48.266, "C1C1_dist": 11.011, "N1N9_dist": 9.099, "C6C8_dist": 9.908, "CNNC_torsion": -17.269, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[3.04],N1(imino)-N3[2.92],N2(amino)-O2(carbonyl)[3.10]", "interBase_angle": 18.154, "planarity": 0.229, "simple_Shear": 0.076, "simple_Stretch": -0.100, "simple_Buckle": -3.746, "simple_Propeller": -17.763, "bp_simpleParams": [ 0.076, -0.100, 0.204, -3.746, -17.763, -5.142 ], "bp_params": [ 0.074, -0.101, 0.204, -3.990, -17.710, -5.201 ], "frame": { "rmsd": null, "origin": [ 33.453, 36.244, 42.349 ], "x_axis": [ 0.650, -0.131, -0.748 ], "y_axis": [ 0.562, 0.746, 0.358 ], "z_axis": [ 0.511, -0.653, 0.559 ], "quaternion": [ 0.860, 0.294, 0.366, -0.201 ] } }, { "index": 25, "nt1": "///I/3", "nt2": "///J/59", "bp": "U-G", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -161.576, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 61.564, "chi2": 167.891, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 40.127, "C1C1_dist": 10.948, "N1N9_dist": 9.122, "C6C8_dist": 9.895, "CNNC_torsion": -5.944, "hbonds_num": 2, "hbonds_desc": "O2(carbonyl)-N1(imino)[3.13],N3(imino)-O6(carbonyl)[2.95]", "interBase_angle": 8.687, "planarity": 0.110, "simple_Shear": 1.904, "simple_Stretch": 0.061, "simple_Buckle": 5.095, "simple_Propeller": -7.036, "bp_simpleParams": [ 1.904, 0.061, 0.140, 5.095, -7.036, -7.161 ], "bp_params": [ 1.882, -0.290, 0.140, 3.710, -7.855, -7.174 ], "frame": { "rmsd": null, "origin": [ 34.904, 32.975, 42.875 ], "x_axis": [ 0.866, 0.380, -0.325 ], "y_axis": [ 0.005, 0.644, 0.765 ], "z_axis": [ 0.500, -0.664, 0.556 ], "quaternion": [ 0.875, 0.408, 0.236, 0.107 ] } }, { "index": 26, "nt1": "///I/4", "nt2": "///J/58", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -166.372, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 53.061, "chi2": -157.982, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 44.136, "C1C1_dist": 11.153, "N1N9_dist": 9.204, "C6C8_dist": 9.976, "CNNC_torsion": -16.824, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.01],N1-N3(imino)[2.99]", "interBase_angle": 23.753, "planarity": 0.284, "simple_Shear": 0.536, "simple_Stretch": 0.065, "simple_Buckle": -5.518, "simple_Propeller": -23.103, "bp_simpleParams": [ 0.536, 0.065, 0.110, -5.518, -23.103, -7.754 ], "bp_params": [ 0.539, 0.031, 0.110, -6.908, -22.726, -7.894 ], "frame": { "rmsd": null, "origin": [ 37.099, 30.140, 42.909 ], "x_axis": [ 0.644, 0.765, -0.004 ], "y_axis": [ -0.288, 0.248, 0.925 ], "z_axis": [ 0.708, -0.595, 0.380 ], "quaternion": [ 0.754, 0.504, 0.236, 0.349 ] } }, { "index": 27, "nt1": "///I/5", "nt2": "///J/57", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -161.725, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 50.842, "chi2": -171.525, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 49.217, "C1C1_dist": 11.111, "N1N9_dist": 9.221, "C6C8_dist": 10.058, "CNNC_torsion": -16.478, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.18],N1-N3(imino)[3.10]", "interBase_angle": 16.649, "planarity": 0.230, "simple_Shear": 0.085, "simple_Stretch": 0.095, "simple_Buckle": 3.843, "simple_Propeller": -16.199, "bp_simpleParams": [ 0.085, 0.095, 0.577, 3.843, -16.199, -5.476 ], "bp_params": [ 0.086, 0.094, 0.577, 3.652, -16.243, -5.529 ], "frame": { "rmsd": null, "origin": [ 39.967, 28.588, 42.625 ], "x_axis": [ 0.391, 0.783, 0.483 ], "y_axis": [ -0.599, -0.182, 0.780 ], "z_axis": [ 0.699, -0.594, 0.398 ], "quaternion": [ 0.634, 0.542, 0.085, 0.545 ] } }, { "index": 28, "nt1": "///I/6", "nt2": "///J/56", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -168.915, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 46.146, "chi2": -161.961, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 54.518, "C1C1_dist": 10.808, "N1N9_dist": 8.942, "C6C8_dist": 9.760, "CNNC_torsion": -18.150, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.92],N1-N3(imino)[2.98]", "interBase_angle": 20.632, "planarity": 0.247, "simple_Shear": -0.816, "simple_Stretch": -0.173, "simple_Buckle": -0.294, "simple_Propeller": -20.630, "bp_simpleParams": [ -0.816, -0.173, 0.184, -0.294, -20.630, -6.573 ], "bp_params": [ -0.799, -0.237, 0.184, 1.359, -20.587, -6.679 ], "frame": { "rmsd": null, "origin": [ 43.666, 27.463, 42.703 ], "x_axis": [ 0.056, 0.590, 0.806 ], "y_axis": [ -0.645, -0.594, 0.480 ], "z_axis": [ 0.762, -0.547, 0.347 ], "quaternion": [ 0.450, 0.571, -0.024, 0.686 ] } }, { "index": 29, "nt1": "///I/7", "nt2": "///J/55", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -163.077, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 50.682, "chi2": -164.918, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 58.622, "C1C1_dist": 10.885, "N1N9_dist": 9.163, "C6C8_dist": 10.144, "CNNC_torsion": -9.522, "hbonds_num": 4, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.87],N3-N1(imino)[3.08],N3-N2(amino)[3.08],N4(amino)-O6(carbonyl)[3.13]", "interBase_angle": 17.931, "planarity": 0.201, "simple_Shear": -0.653, "simple_Stretch": 0.169, "simple_Buckle": 9.276, "simple_Propeller": -15.344, "bp_simpleParams": [ -0.653, 0.169, -0.093, 9.276, -15.344, 2.965 ], "bp_params": [ -0.664, 0.120, -0.093, 10.380, -14.621, 2.977 ], "frame": { "rmsd": null, "origin": [ 46.714, 27.336, 44.389 ], "x_axis": [ -0.307, 0.236, 0.922 ], "y_axis": [ -0.520, -0.853, 0.045 ], "z_axis": [ 0.797, -0.465, 0.384 ], "quaternion": [ 0.237, 0.539, -0.132, 0.798 ] } }, { "index": 30, "nt1": "///I/8", "nt2": "///J/54", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -168.116, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 54.421, "chi2": -171.982, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 53.520, "C1C1_dist": 10.816, "N1N9_dist": 9.062, "C6C8_dist": 10.020, "CNNC_torsion": -12.680, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.11],N1-N3(imino)[3.01]", "interBase_angle": 10.149, "planarity": 0.156, "simple_Shear": -0.064, "simple_Stretch": 0.057, "simple_Buckle": -3.887, "simple_Propeller": -9.376, "bp_simpleParams": [ -0.064, 0.057, 0.303, -3.887, -9.376, 0.364 ], "bp_params": [ -0.064, 0.057, 0.303, -3.875, -9.381, 0.365 ], "frame": { "rmsd": null, "origin": [ 49.949, 26.884, 46.206 ], "x_axis": [ -0.723, -0.215, 0.657 ], "y_axis": [ -0.224, -0.826, -0.517 ], "z_axis": [ 0.654, -0.521, 0.549 ], "quaternion": [ 0.003, 0.372, -0.295, 0.880 ] } }, { "index": 31, "nt1": "///I/9", "nt2": "///J/53", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -154.632, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 49.558, "chi2": -153.936, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 60.318, "C1C1_dist": 10.636, "N1N9_dist": 8.940, "C6C8_dist": 9.908, "CNNC_torsion": -16.630, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.90],O4(carbonyl)-N6(amino)[3.09]", "interBase_angle": 22.578, "planarity": 0.267, "simple_Shear": -0.976, "simple_Stretch": 0.024, "simple_Buckle": 4.320, "simple_Propeller": -22.161, "bp_simpleParams": [ -0.976, 0.024, -0.095, 4.320, -22.161, 1.954 ], "bp_params": [ -0.973, -0.082, -0.095, 6.634, -21.582, 1.986 ], "frame": { "rmsd": null, "origin": [ 52.223, 26.412, 48.425 ], "x_axis": [ -0.772, -0.557, 0.306 ], "y_axis": [ 0.169, -0.644, -0.746 ], "z_axis": [ 0.613, -0.524, 0.591 ], "quaternion": [ -0.210, 0.265, -0.366, 0.867 ] } }, { "index": 32, "nt1": "///I/10", "nt2": "///J/52", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -160.157, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 54.437, "chi2": -166.880, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 56.914, "C1C1_dist": 10.920, "N1N9_dist": 9.234, "C6C8_dist": 10.194, "CNNC_torsion": -14.813, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[3.02],N3-N1(imino)[3.14],N4(amino)-O6(carbonyl)[3.29]", "interBase_angle": 21.696, "planarity": 0.255, "simple_Shear": -0.048, "simple_Stretch": 0.197, "simple_Buckle": 8.140, "simple_Propeller": -20.111, "bp_simpleParams": [ -0.048, 0.197, -0.141, 8.140, -20.111, 3.141 ], "bp_params": [ -0.051, 0.196, -0.141, 8.403, -20.002, 3.181 ], "frame": { "rmsd": null, "origin": [ 53.273, 24.703, 51.192 ], "x_axis": [ -0.599, -0.747, -0.287 ], "y_axis": [ 0.620, -0.207, -0.757 ], "z_axis": [ 0.506, -0.632, 0.587 ], "quaternion": [ -0.442, 0.071, -0.449, 0.774 ] } }, { "index": 33, "nt1": "///I/11", "nt2": "///J/51", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -139.169, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 55.944, "chi2": -174.418, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 56.012, "C1C1_dist": 11.141, "N1N9_dist": 9.461, "C6C8_dist": 10.406, "CNNC_torsion": 0.602, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[3.21],N3-N1(imino)[3.45],N4(amino)-O6(carbonyl)[3.56]", "interBase_angle": 19.684, "planarity": 0.211, "simple_Shear": 0.197, "simple_Stretch": 0.482, "simple_Buckle": 17.980, "simple_Propeller": -8.011, "bp_simpleParams": [ 0.197, 0.482, -0.697, 17.980, -8.011, 3.012 ], "bp_params": [ 0.202, 0.480, -0.697, 17.927, -8.128, 2.983 ], "frame": { "rmsd": null, "origin": [ 54.049, 22.758, 53.894 ], "x_axis": [ -0.201, -0.613, -0.764 ], "y_axis": [ 0.915, 0.162, -0.371 ], "z_axis": [ 0.351, -0.774, 0.528 ], "quaternion": [ 0.610, 0.165, 0.457, -0.626 ] } }, { "index": 34, "nt1": "///I/14", "nt2": "///J/50", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": 164.070, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 40.938, "chi2": -172.247, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 43.205, "C1C1_dist": 11.816, "N1N9_dist": 9.623, "C6C8_dist": 10.128, "CNNC_torsion": -23.158, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.84],N1(imino)-N3[3.35],N2(amino)-O2(carbonyl)[3.97]", "interBase_angle": 25.442, "planarity": 0.306, "simple_Shear": -0.164, "simple_Stretch": 0.197, "simple_Buckle": -4.406, "simple_Propeller": -25.057, "bp_simpleParams": [ -0.164, 0.197, 0.137, -4.406, -25.057, -17.809 ], "bp_params": [ -0.166, 0.196, 0.137, -4.132, -25.104, -18.226 ], "frame": { "rmsd": null, "origin": [ 53.838, 19.308, 57.081 ], "x_axis": [ 0.256, -0.412, -0.874 ], "y_axis": [ 0.900, 0.432, 0.060 ], "z_axis": [ 0.353, -0.802, 0.481 ], "quaternion": [ 0.736, 0.293, 0.417, -0.445 ] } }, { "index": 35, "nt1": "///I/15", "nt2": "///J/49", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -147.927, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 58.073, "chi2": -144.184, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 61.227, "C1C1_dist": 10.070, "N1N9_dist": 8.578, "C6C8_dist": 9.731, "CNNC_torsion": -7.080, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.22],N1-N3(imino)[2.77]", "interBase_angle": 23.224, "planarity": 0.275, "simple_Shear": -0.341, "simple_Stretch": -0.138, "simple_Buckle": -14.895, "simple_Propeller": -17.818, "bp_simpleParams": [ -0.341, -0.138, -0.775, -14.895, -17.818, 12.123 ], "bp_params": [ -0.338, -0.145, -0.775, -14.539, -18.110, 12.180 ], "frame": { "rmsd": null, "origin": [ 53.202, 15.206, 57.489 ], "x_axis": [ 0.507, 0.136, -0.851 ], "y_axis": [ 0.730, 0.458, 0.508 ], "z_axis": [ 0.459, -0.879, 0.133 ], "quaternion": [ 0.724, 0.479, 0.452, -0.205 ] } }, { "index": 36, "nt1": "///I/16", "nt2": "///J/48", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -151.589, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 55.998, "chi2": -171.153, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 61.143, "C1C1_dist": 10.481, "N1N9_dist": 8.922, "C6C8_dist": 9.985, "CNNC_torsion": -12.614, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.74],N3-N1(imino)[2.99],N4(amino)-O6(carbonyl)[3.30]", "interBase_angle": 30.914, "planarity": 0.338, "simple_Shear": -0.005, "simple_Stretch": 0.124, "simple_Buckle": 20.407, "simple_Propeller": -23.221, "bp_simpleParams": [ -0.005, 0.124, -0.589, 20.407, -23.221, 9.832 ], "bp_params": [ -0.008, 0.124, -0.589, 20.917, -22.763, 9.869 ], "frame": { "rmsd": null, "origin": [ 54.363, 13.162, 57.191 ], "x_axis": [ 0.723, 0.460, -0.515 ], "y_axis": [ 0.421, 0.299, 0.857 ], "z_axis": [ 0.548, -0.836, 0.023 ], "quaternion": [ 0.715, 0.592, 0.372, 0.014 ] } }, { "index": 37, "nt1": "///I/17", "nt2": "///J/47", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -162.529, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 50.131, "chi2": -171.796, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 60.572, "C1C1_dist": 10.667, "N1N9_dist": 8.972, "C6C8_dist": 9.975, "CNNC_torsion": -11.457, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[3.01],O4(carbonyl)-N6(amino)[3.25]", "interBase_angle": 10.284, "planarity": 0.202, "simple_Shear": -0.774, "simple_Stretch": 0.072, "simple_Buckle": 5.892, "simple_Propeller": -8.429, "bp_simpleParams": [ -0.774, 0.072, 0.579, 5.892, -8.429, 2.963 ], "bp_params": [ -0.777, 0.007, 0.579, 6.579, -7.904, 2.965 ], "frame": { "rmsd": null, "origin": [ 56.040, 9.484, 56.341 ], "x_axis": [ 0.682, 0.731, 0.018 ], "y_axis": [ -0.153, 0.118, 0.981 ], "z_axis": [ 0.715, -0.672, 0.193 ], "quaternion": [ 0.706, 0.585, 0.247, 0.313 ] } }, { "index": 38, "nt1": "///I/18", "nt2": "///J/46", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -162.116, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 64.749, "chi2": -154.224, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 66.315, "C1C1_dist": 10.278, "N1N9_dist": 9.041, "C6C8_dist": 10.417, "CNNC_torsion": -13.377, "hbonds_num": 2, "hbonds_desc": "N1(imino)-N3[3.39],N2(amino)-O2(carbonyl)[2.76]", "interBase_angle": 21.514, "planarity": 0.361, "simple_Shear": -0.277, "simple_Stretch": 0.596, "simple_Buckle": 5.784, "simple_Propeller": -20.722, "bp_simpleParams": [ -0.277, 0.596, -0.479, 5.784, -20.722, 24.002 ], "bp_params": [ -0.292, 0.588, -0.479, 6.272, -20.580, 24.349 ], "frame": { "rmsd": null, "origin": [ 60.006, 8.732, 56.697 ], "x_axis": [ 0.385, 0.775, 0.502 ], "y_axis": [ -0.349, -0.382, 0.856 ], "z_axis": [ 0.855, -0.504, 0.123 ], "quaternion": [ 0.531, 0.641, 0.166, 0.529 ] } }, { "index": 39, "nt1": "///I/19", "nt2": "///J/45", "bp": "G-U", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": 168.227, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 52.013, "chi2": -167.383, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 61.748, "C1C1_dist": 10.712, "N1N9_dist": 9.091, "C6C8_dist": 10.147, "CNNC_torsion": 3.196, "hbonds_num": 2, "hbonds_desc": "N1(imino)*N3(imino)[3.37],N2(amino)-O2(carbonyl)[2.80]", "interBase_angle": 23.002, "planarity": 0.270, "simple_Shear": -0.822, "simple_Stretch": 0.360, "simple_Buckle": -23.002, "simple_Propeller": 0.170, "bp_simpleParams": [ -0.822, 0.360, -0.527, -23.002, 0.170, 7.328 ], "bp_params": [ -0.848, 0.295, -0.527, -22.946, -1.605, 7.182 ], "frame": { "rmsd": null, "origin": [ 63.962, 7.277, 55.899 ], "x_axis": [ -0.184, 0.599, 0.779 ], "y_axis": [ -0.576, -0.708, 0.409 ], "z_axis": [ 0.797, -0.373, 0.476 ], "quaternion": [ 0.382, 0.512, 0.012, 0.769 ] } }, { "index": 40, "nt1": "///I/20", "nt2": "///J/44", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -174.490, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 44.344, "chi2": -159.631, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 52.227, "C1C1_dist": 10.884, "N1N9_dist": 8.921, "C6C8_dist": 9.600, "CNNC_torsion": 13.444, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.78],N1-N3(imino)[3.04]", "interBase_angle": 21.104, "planarity": 0.257, "simple_Shear": -0.709, "simple_Stretch": -0.162, "simple_Buckle": -18.212, "simple_Propeller": 10.663, "bp_simpleParams": [ -0.709, -0.162, -0.640, -18.212, 10.663, -11.451 ], "bp_params": [ -0.694, -0.216, -0.640, -19.000, 9.186, -11.332 ], "frame": { "rmsd": null, "origin": [ 68.283, 7.909, 56.332 ], "x_axis": [ -0.641, 0.173, 0.747 ], "y_axis": [ -0.246, -0.969, 0.013 ], "z_axis": [ 0.727, -0.175, 0.664 ], "quaternion": [ 0.116, 0.407, -0.045, 0.905 ] } }, { "index": 41, "nt1": "///I/21", "nt2": "///J/43", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": 175.560, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 54.982, "chi2": -166.027, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 54.780, "C1C1_dist": 10.464, "N1N9_dist": 8.749, "C6C8_dist": 9.748, "CNNC_torsion": 6.103, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.03],N1-N3(imino)[2.83]", "interBase_angle": 10.205, "planarity": 0.213, "simple_Shear": -0.152, "simple_Stretch": -0.171, "simple_Buckle": 9.939, "simple_Propeller": 2.313, "bp_simpleParams": [ -0.152, -0.171, -0.534, 9.939, 2.313, 2.915 ], "bp_params": [ -0.150, -0.173, -0.534, 9.917, 2.408, 2.905 ], "frame": { "rmsd": null, "origin": [ 69.437, 8.255, 59.606 ], "x_axis": [ -0.679, -0.329, 0.656 ], "y_axis": [ 0.067, -0.918, -0.391 ], "z_axis": [ 0.731, -0.222, 0.645 ], "quaternion": [ -0.110, 0.385, -0.170, 0.900 ] } }, { "index": 42, "nt1": "///I/22", "nt2": "///J/42", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": 167.040, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 50.032, "chi2": 178.899, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 61.092, "C1C1_dist": 10.863, "N1N9_dist": 9.171, "C6C8_dist": 10.138, "CNNC_torsion": -12.879, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[3.56],N1(imino)-N3[3.35],N2(amino)-O2(carbonyl)[3.08]", "interBase_angle": 24.673, "planarity": 0.324, "simple_Shear": -0.919, "simple_Stretch": 0.334, "simple_Buckle": 20.803, "simple_Propeller": -13.266, "bp_simpleParams": [ -0.919, 0.334, 0.595, 20.803, -13.266, 4.687 ], "bp_params": [ -0.947, 0.243, 0.595, 22.028, -11.115, 4.624 ], "frame": { "rmsd": null, "origin": [ 71.774, 9.874, 62.617 ], "x_axis": [ -0.641, -0.644, 0.418 ], "y_axis": [ 0.126, -0.626, -0.770 ], "z_axis": [ 0.757, -0.440, 0.482 ], "quaternion": [ -0.232, 0.355, -0.365, 0.829 ] } }, { "index": 43, "nt1": "///I/23", "nt2": "///J/41", "bp": "C-G", "name": "~Wobble", "Saenger": "--", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -148.169, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 79.943, "chi2": -171.427, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 54.023, "C1C1_dist": 9.444, "N1N9_dist": 8.316, "C6C8_dist": 9.543, "CNNC_torsion": -6.466, "hbonds_num": 3, "hbonds_desc": "O2'(hydroxyl)-N2(amino)[3.28],O2(carbonyl)-N1(imino)[2.88],O2(carbonyl)-N2(amino)[3.01]", "interBase_angle": 39.763, "planarity": 0.449, "simple_Shear": 2.308, "simple_Stretch": 0.312, "simple_Buckle": 37.792, "simple_Propeller": -12.364, "bp_simpleParams": [ 2.308, 0.312, -1.711, 37.792, -12.364, 30.178 ], "bp_params": [ 2.321, -0.191, -1.711, 34.451, -19.854, 29.338 ], "frame": { "rmsd": null, "origin": [ 73.042, 7.809, 66.057 ], "x_axis": [ -0.290, -0.952, -0.095 ], "y_axis": [ 0.738, -0.159, -0.656 ], "z_axis": [ 0.609, -0.260, 0.749 ], "quaternion": [ 0.570, -0.173, 0.309, -0.741 ] } }, { "index": 44, "nt1": "///I/24", "nt2": "///J/40", "bp": "U-G", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -150.998, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 58.841, "chi2": 165.387, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 44.177, "C1C1_dist": 10.817, "N1N9_dist": 8.975, "C6C8_dist": 9.743, "CNNC_torsion": 2.011, "hbonds_num": 2, "hbonds_desc": "O2(carbonyl)-N1(imino)[3.19],N3(imino)-O6(carbonyl)[3.08]", "interBase_angle": 20.396, "planarity": 0.318, "simple_Shear": 1.494, "simple_Stretch": 0.013, "simple_Buckle": -19.825, "simple_Propeller": -4.792, "bp_simpleParams": [ 1.494, 0.013, -0.209, -19.825, -4.792, -6.305 ], "bp_params": [ 1.479, -0.208, -0.209, -20.321, -1.755, -6.207 ], "frame": { "rmsd": null, "origin": [ 75.174, 7.105, 70.920 ], "x_axis": [ 0.107, -0.671, -0.734 ], "y_axis": [ 0.792, 0.504, -0.345 ], "z_axis": [ 0.601, -0.545, 0.585 ], "quaternion": [ 0.741, 0.067, 0.451, -0.494 ] } } ], "num_helices": 2, "helices": [ { "index": 1, "num_stems": 2, "strand1": "GGUAAACAUCCGACUGGAAGCU", "strand2": "CCGUUUGUAGGCUGACUUUCGG", "bp_type": "||||||||||||||||||||.|", "helix_form": "A.AAAA.AA.x......A...", "helical_rise": 2.876, "helical_rise_std": 0.614, "helical_radius": 9.666, "helical_radius_std": 1.075, "helical_axis": [ 0.082, 0.525, -0.847 ], "point1": [ 23.852, 82.083, 21.366 ], "point2": [ 28.792, 113.768, -29.751 ], "num_pairs": 22, "pairs": [ { "index": 1, "nt1": "///D/1", "nt2": "///E/61", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.224, -0.325, 0.049, -8.618, -25.993, -3.684 ], "step_params": [ 0.272, -1.566, 3.275, -3.508, 5.989, 31.364 ], "heli_params": [ -3.857, -1.093, 2.887, 10.912, 6.392, 32.104 ], "bp2_params": [ 0.100, -0.141, 0.298, -4.205, -19.281, -3.013 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.275, "simple_Twist": 29.576, "simple_hRise": 2.859, "simple_hTwist": 30.362 }, { "index": 2, "nt1": "///D/2", "nt2": "///E/60", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.100, -0.141, 0.298, -4.205, -19.281, -3.013 ], "step_params": [ 0.327, -1.516, 3.261, 0.600, 3.894, 40.901 ], "heli_params": [ -2.573, -0.402, 3.114, 5.557, -0.857, 41.083 ], "bp2_params": [ 1.884, -0.375, 0.306, 0.594, -7.801, -5.983 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.261, "simple_Twist": 32.187, "simple_hRise": 3.067, "simple_hTwist": 32.421 }, { "index": 3, "nt1": "///D/3", "nt2": "///E/59", "bp": "U-G", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 1.884, -0.375, 0.306, 0.594, -7.801, -5.983 ], "step_params": [ -0.142, -1.550, 3.095, 9.220, 11.336, 27.654 ], "heli_params": [ -4.722, 1.762, 2.156, 21.887, -17.801, 31.210 ], "bp2_params": [ 0.428, -0.032, 0.066, -4.773, -21.258, -6.188 ], "groove_widths": [ 16.860, null, 15.181, null ], "simple_Rise": 3.095, "simple_Twist": 35.174, "simple_hRise": 2.391, "simple_hTwist": 38.000 }, { "index": 4, "nt1": "///D/4", "nt2": "///E/58", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.428, -0.032, 0.066, -4.773, -21.258, -6.188 ], "step_params": [ 0.284, -1.429, 2.990, -1.639, 1.771, 32.744 ], "heli_params": [ -2.802, -0.755, 2.894, 3.137, 2.902, 32.831 ], "bp2_params": [ 0.063, 0.082, 0.468, 2.606, -15.782, -3.476 ], "groove_widths": [ 16.508, 15.509, 15.738, 14.678 ], "simple_Rise": 2.990, "simple_Twist": 34.554, "simple_hRise": 2.899, "simple_hTwist": 34.635 }, { "index": 5, "nt1": "///D/5", "nt2": "///E/57", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.063, 0.082, 0.468, 2.606, -15.782, -3.476 ], "step_params": [ -0.044, -1.698, 3.444, 6.006, 2.699, 29.202 ], "heli_params": [ -3.863, 1.365, 3.205, 5.269, -11.724, 29.919 ], "bp2_params": [ -0.714, -0.296, -0.111, 1.177, -18.603, -5.408 ], "groove_widths": [ 16.551, 15.625, 16.139, 15.406 ], "simple_Rise": 3.444, "simple_Twist": 33.288, "simple_hRise": 3.243, "simple_hTwist": 33.915 }, { "index": 6, "nt1": "///D/6", "nt2": "///E/56", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.714, -0.296, -0.111, 1.177, -18.603, -5.408 ], "step_params": [ 0.978, -1.305, 3.102, -0.862, 4.220, 29.895 ], "heli_params": [ -3.292, -2.038, 2.866, 8.127, 1.660, 30.196 ], "bp2_params": [ -0.699, 0.081, 0.198, 9.367, -17.082, 3.220 ], "groove_widths": [ 16.423, 15.365, 16.545, 15.471 ], "simple_Rise": 3.102, "simple_Twist": 30.559, "simple_hRise": 2.872, "simple_hTwist": 30.854 }, { "index": 7, "nt1": "///D/7", "nt2": "///E/55", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.699, 0.081, 0.198, 9.367, -17.082, 3.220 ], "step_params": [ -0.206, -1.457, 3.443, -1.569, 10.741, 36.829 ], "heli_params": [ -3.555, 0.119, 2.927, 16.564, 2.420, 38.342 ], "bp2_params": [ -0.093, 0.101, 0.160, -4.761, -12.496, 0.815 ], "groove_widths": [ 16.469, 15.419, 16.425, 14.735 ], "simple_Rise": 3.443, "simple_Twist": 32.738, "simple_hRise": 2.845, "simple_hTwist": 34.444 }, { "index": 8, "nt1": "///D/8", "nt2": "///E/54", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.093, 0.101, 0.160, -4.761, -12.496, 0.815 ], "step_params": [ -0.457, -1.098, 2.941, 2.052, 3.785, 28.363 ], "heli_params": [ -2.960, 1.327, 2.735, 7.669, -4.157, 28.681 ], "bp2_params": [ -0.921, -0.029, -0.300, 6.945, -21.439, 2.295 ], "groove_widths": [ 16.749, null, 15.261, 13.071 ], "simple_Rise": 2.941, "simple_Twist": 33.755, "simple_hRise": 2.773, "simple_hTwist": 34.020 }, { "index": 9, "nt1": "///D/9", "nt2": "///E/53", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.921, -0.029, -0.300, 6.945, -21.439, 2.295 ], "step_params": [ 0.408, -0.989, 3.315, 0.295, 9.528, 35.857 ], "heli_params": [ -2.804, -0.603, 2.969, 15.148, -0.469, 37.062 ], "bp2_params": [ -0.120, 0.136, -0.425, 8.757, -20.732, 3.623 ], "groove_widths": [ null, null, 15.044, 12.521 ], "simple_Rise": 3.315, "simple_Twist": 31.281, "simple_hRise": 2.901, "simple_hTwist": 32.667 }, { "index": 10, "nt1": "///D/10", "nt2": "///E/52", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.120, 0.136, -0.425, 8.757, -20.732, 3.623 ], "step_params": [ -0.407, -1.016, 3.073, 1.658, 11.018, 36.160 ], "heli_params": [ -2.839, 0.819, 2.642, 17.254, -2.596, 37.783 ], "bp2_params": [ 0.200, 0.454, -0.618, 21.267, -7.759, 2.199 ], "groove_widths": [ null, null, 17.506, 15.821 ], "simple_Rise": 3.073, "simple_Twist": 34.422, "simple_hRise": 2.614, "simple_hTwist": 36.129 }, { "index": 11, "nt1": "///D/11", "nt2": "///E/51", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.200, 0.454, -0.618, 21.267, -7.759, 2.199 ], "step_params": [ -0.857, -1.862, 4.332, 2.003, 4.621, 28.656 ], "heli_params": [ -4.995, 2.264, 3.922, 9.246, -4.007, 29.086 ], "bp2_params": [ -0.345, 0.120, 0.043, -4.656, -25.375, -17.677 ], "groove_widths": [ 16.186, null, 18.565, 15.573 ], "simple_Rise": 4.332, "simple_Twist": 30.287, "simple_hRise": 3.948, "simple_hTwist": 30.694 }, { "index": 12, "nt1": "///D/14", "nt2": "///E/50", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.345, 0.120, 0.043, -4.656, -25.375, -17.677 ], "step_params": [ -0.173, -2.411, 3.460, 2.475, 22.721, 28.511 ], "heli_params": [ -6.434, 0.557, 1.243, 39.150, -4.265, 36.392 ], "bp2_params": [ -0.334, -0.135, -0.934, -17.654, -19.968, 11.505 ], "groove_widths": [ 17.218, 15.349, 18.371, null ], "simple_Rise": 3.460, "simple_Twist": 28.542, "simple_hRise": 1.245, "simple_hTwist": 36.416 }, { "index": 13, "nt1": "///D/15", "nt2": "///E/49", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.334, -0.135, -0.934, -17.654, -19.968, 11.505 ], "step_params": [ 0.262, -0.388, 2.287, -2.303, 6.461, 27.985 ], "heli_params": [ -1.768, -0.878, 2.118, 13.112, 4.675, 28.797 ], "bp2_params": [ -0.110, 0.087, -0.538, 20.016, -20.890, 9.380 ], "groove_widths": [ 17.914, 16.240, null, null ], "simple_Rise": 2.287, "simple_Twist": 28.382, "simple_hRise": 2.121, "simple_hTwist": 29.183 }, { "index": 14, "nt1": "///D/16", "nt2": "///E/48", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.110, 0.087, -0.538, 20.016, -20.890, 9.380 ], "step_params": [ -0.677, -1.529, 3.717, -11.475, 10.134, 33.944 ], "heli_params": [ -3.902, -0.638, 3.205, 16.364, 18.530, 37.144 ], "bp2_params": [ -0.842, 0.008, 0.481, 7.306, -9.174, 3.080 ], "groove_widths": [ 17.584, 15.747, 17.505, null ], "simple_Rise": 3.717, "simple_Twist": 37.194, "simple_hRise": 3.271, "simple_hTwist": 40.118 }, { "index": 15, "nt1": "///D/17", "nt2": "///E/47", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.842, 0.008, 0.481, 7.306, -9.174, 3.080 ], "step_params": [ 1.656, -0.668, 3.752, 7.368, 10.583, 31.248 ], "heli_params": [ -3.169, -1.448, 3.630, 18.681, -13.007, 33.743 ], "bp2_params": [ -0.349, 0.534, -0.490, 4.369, -21.412, 24.417 ], "groove_widths": [ 17.400, 14.771, 16.728, 13.738 ], "simple_Rise": 3.752, "simple_Twist": 28.388, "simple_hRise": 3.590, "simple_hTwist": 31.125 }, { "index": 16, "nt1": "///D/18", "nt2": "///E/46", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.349, 0.534, -0.490, 4.369, -21.412, 24.417 ], "step_params": [ -1.019, -1.729, 3.654, -11.354, 19.301, 34.077 ], "heli_params": [ -4.735, 0.150, 2.565, 29.341, 17.260, 40.593 ], "bp2_params": [ -0.759, 0.277, -0.466, -22.947, -1.909, 6.476 ], "groove_widths": [ 17.680, 14.661, 16.965, 14.381 ], "simple_Rise": 3.654, "simple_Twist": 36.055, "simple_hRise": 2.639, "simple_hTwist": 42.246 }, { "index": 17, "nt1": "///D/19", "nt2": "///E/45", "bp": "G-U", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.759, 0.277, -0.466, -22.947, -1.909, 6.476 ], "step_params": [ -1.246, -2.421, 3.343, 6.126, 14.837, 33.069 ], "heli_params": [ -5.561, 2.688, 1.870, 24.362, -10.058, 36.661 ], "bp2_params": [ -0.667, -0.203, -0.597, -17.227, 10.315, -10.912 ], "groove_widths": [ 18.037, 15.838, 19.856, 17.890 ], "simple_Rise": 3.343, "simple_Twist": 33.133, "simple_hRise": 1.873, "simple_hTwist": 36.718 }, { "index": 18, "nt1": "///D/20", "nt2": "///E/44", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.667, -0.203, -0.597, -17.227, 10.315, -10.912 ], "step_params": [ 1.489, -1.120, 2.909, -2.825, 0.056, 29.759 ], "heli_params": [ -2.181, -3.396, 2.757, 0.108, 5.484, 29.890 ], "bp2_params": [ -0.101, -0.203, -0.509, 10.944, 3.161, 1.898 ], "groove_widths": [ 17.492, 15.820, 20.267, 18.606 ], "simple_Rise": 2.909, "simple_Twist": 26.451, "simple_hRise": 2.736, "simple_hTwist": 26.599 }, { "index": 19, "nt1": "///D/21", "nt2": "///E/43", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.101, -0.203, -0.509, 10.944, 3.161, 1.898 ], "step_params": [ -0.573, -2.889, 2.985, -16.152, -0.119, 22.635 ], "heli_params": [ -5.997, -2.607, 2.785, -0.264, 35.867, 27.746 ], "bp2_params": [ -1.015, 0.227, 0.608, 21.329, -8.883, 5.580 ], "groove_widths": [ 16.485, null, 20.293, null ], "simple_Rise": 2.985, "simple_Twist": 27.640, "simple_hRise": 2.887, "simple_hTwist": 31.934 }, { "index": 20, "nt1": "///D/22", "nt2": "///E/42", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -1.015, 0.227, 0.608, 21.329, -8.883, 5.580 ], "step_params": [ 1.381, -1.173, 3.702, 19.375, -2.135, 42.451 ], "heli_params": [ -1.263, 0.270, 3.994, -2.781, -25.228, 46.524 ], "bp2_params": [ 2.376, -0.187, -1.507, 31.604, -21.193, 28.654 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.702, "simple_Twist": 23.279, "simple_hRise": 3.814, "simple_hTwist": 30.275 }, { "index": 21, "nt1": "///D/23", "nt2": "///E/41", "bp": "C-G", "name": "~Wobble", "Saenger": "--", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 2.376, -0.187, -1.507, 31.604, -21.193, 28.654 ], "step_params": [ -1.855, -1.356, 4.843, -1.444, 17.915, 43.735 ], "heli_params": [ -3.785, 2.153, 4.078, 22.931, 1.849, 47.116 ], "bp2_params": [ 1.600, -0.174, -0.140, -20.716, -1.674, -7.604 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 4.843, "simple_Twist": 49.040, "simple_hRise": 4.193, "simple_hTwist": 52.038 }, { "index": 22, "nt1": "///D/24", "nt2": "///E/40", "bp": "U-G", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 2, "num_stems": 2, "strand1": "GGUAAACAUCCGACUGGAAGCU", "strand2": "CCGUUUGUAGGCUGACUUUCGG", "bp_type": "||||||||||||||||||||.|", "helix_form": "AAAAAA.AA.x......A...", "helical_rise": 2.871, "helical_rise_std": 0.622, "helical_radius": 9.742, "helical_radius_std": 1.041, "helical_axis": [ 0.653, -0.608, 0.451 ], "point1": [ 32.755, 38.845, 38.702 ], "point2": [ 72.102, 2.206, 65.881 ], "num_pairs": 22, "pairs": [ { "index": 1, "nt1": "///I/1", "nt2": "///J/61", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.245, -0.239, -0.108, -11.424, -20.970, -4.321 ], "step_params": [ 0.039, -1.620, 3.174, -4.833, 4.198, 31.876 ], "heli_params": [ -3.585, -0.865, 2.905, 7.549, 8.691, 32.497 ], "bp2_params": [ 0.074, -0.101, 0.204, -3.990, -17.710, -5.201 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.174, "simple_Twist": 30.081, "simple_hRise": 2.885, "simple_hTwist": 30.739 }, { "index": 2, "nt1": "///I/2", "nt2": "///J/60", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.074, -0.101, 0.204, -3.990, -17.710, -5.201 ], "step_params": [ 0.430, -1.665, 3.180, 0.780, -0.507, 40.814 ], "heli_params": [ -2.333, -0.532, 3.207, -0.726, -1.119, 40.824 ], "bp2_params": [ 1.882, -0.290, 0.140, 3.710, -7.855, -7.174 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.180, "simple_Twist": 32.221, "simple_hRise": 3.214, "simple_hTwist": 32.234 }, { "index": 3, "nt1": "///I/3", "nt2": "///J/59", "bp": "U-G", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 1.882, -0.290, 0.140, 3.710, -7.855, -7.174 ], "step_params": [ -0.024, -1.698, 3.158, 8.795, 13.533, 28.947 ], "heli_params": [ -4.951, 1.319, 2.088, 24.790, -16.112, 33.058 ], "bp2_params": [ 0.539, 0.031, 0.110, -6.908, -22.726, -7.894 ], "groove_widths": [ 16.597, null, 15.148, null ], "simple_Rise": 3.158, "simple_Twist": 35.459, "simple_hRise": 2.314, "simple_hTwist": 38.851 }, { "index": 4, "nt1": "///I/4", "nt2": "///J/58", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.539, 0.031, 0.110, -6.908, -22.726, -7.894 ], "step_params": [ 0.232, -1.628, 2.829, -1.159, -0.018, 31.876 ], "heli_params": [ -2.960, -0.605, 2.820, -0.033, 2.109, 31.896 ], "bp2_params": [ 0.086, 0.094, 0.577, 3.652, -16.243, -5.529 ], "groove_widths": [ 16.240, 15.337, 15.917, 14.806 ], "simple_Rise": 2.829, "simple_Twist": 34.423, "simple_hRise": 2.821, "simple_hTwist": 34.442 }, { "index": 5, "nt1": "///I/5", "nt2": "///J/57", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.086, 0.094, 0.577, 3.652, -16.243, -5.529 ], "step_params": [ 0.068, -1.884, 3.376, 5.348, 0.821, 29.206 ], "heli_params": [ -3.854, 1.022, 3.283, 1.611, -10.493, 29.692 ], "bp2_params": [ -0.799, -0.237, 0.184, 1.359, -20.587, -6.679 ], "groove_widths": [ 16.303, 15.495, 16.299, 15.489 ], "simple_Rise": 3.376, "simple_Twist": 33.966, "simple_hRise": 3.303, "simple_hTwist": 34.382 }, { "index": 6, "nt1": "///I/6", "nt2": "///J/56", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.799, -0.237, 0.184, 1.359, -20.587, -6.679 ], "step_params": [ 1.030, -1.312, 3.061, 4.138, 3.643, 29.970 ], "heli_params": [ -3.175, -1.189, 2.997, 6.971, -7.917, 30.462 ], "bp2_params": [ -0.664, 0.120, -0.093, 10.380, -14.621, 2.977 ], "groove_widths": [ 16.295, 15.383, 16.815, 15.583 ], "simple_Rise": 3.061, "simple_Twist": 29.858, "simple_hRise": 2.996, "simple_hTwist": 30.351 }, { "index": 7, "nt1": "///I/7", "nt2": "///J/55", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.664, 0.120, -0.093, 10.380, -14.621, 2.977 ], "step_params": [ -0.214, -1.446, 3.440, -3.729, 12.391, 37.104 ], "heli_params": [ -3.618, -0.122, 2.840, 18.786, 5.653, 39.221 ], "bp2_params": [ -0.064, 0.057, 0.303, -3.875, -9.381, 0.365 ], "groove_widths": [ 16.470, 15.509, 16.641, 14.849 ], "simple_Rise": 3.440, "simple_Twist": 32.982, "simple_hRise": 2.744, "simple_hTwist": 35.364 }, { "index": 8, "nt1": "///I/8", "nt2": "///J/54", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.064, 0.057, 0.303, -3.875, -9.381, 0.365 ], "step_params": [ -0.471, -1.172, 2.953, 1.393, 3.066, 28.345 ], "heli_params": [ -2.991, 1.234, 2.788, 6.234, -2.832, 28.541 ], "bp2_params": [ -0.973, -0.082, -0.095, 6.634, -21.582, 1.986 ], "groove_widths": [ 16.785, null, 15.336, 13.037 ], "simple_Rise": 2.953, "simple_Twist": 34.030, "simple_hRise": 2.819, "simple_hTwist": 34.192 }, { "index": 9, "nt1": "///I/9", "nt2": "///J/53", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.973, -0.082, -0.095, 6.634, -21.582, 1.986 ], "step_params": [ 0.449, -1.068, 3.215, -0.391, 8.718, 36.725 ], "heli_params": [ -2.720, -0.742, 2.890, 13.602, 0.611, 37.713 ], "bp2_params": [ -0.051, 0.196, -0.141, 8.403, -20.002, 3.181 ], "groove_widths": [ null, null, 15.412, 12.730 ], "simple_Rise": 3.215, "simple_Twist": 31.513, "simple_hRise": 2.821, "simple_hTwist": 32.670 }, { "index": 10, "nt1": "///I/10", "nt2": "///J/52", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.051, 0.196, -0.141, 8.403, -20.002, 3.181 ], "step_params": [ -0.474, -1.031, 3.225, 4.987, 11.528, 35.351 ], "heli_params": [ -3.015, 1.348, 2.682, 18.286, -7.911, 37.449 ], "bp2_params": [ 0.202, 0.480, -0.697, 17.927, -8.128, 2.983 ], "groove_widths": [ null, null, 17.541, 15.818 ], "simple_Rise": 3.225, "simple_Twist": 34.289, "simple_hRise": 2.661, "simple_hTwist": 36.453 }, { "index": 11, "nt1": "///I/11", "nt2": "///J/51", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.202, 0.480, -0.697, 17.927, -8.128, 2.983 ], "step_params": [ -0.879, -1.799, 4.253, -0.053, 3.118, 29.452 ], "heli_params": [ -4.358, 1.705, 4.047, 6.111, 0.103, 29.613 ], "bp2_params": [ -0.166, 0.196, 0.137, -4.132, -25.104, -18.226 ], "groove_widths": [ 16.176, null, 18.476, 15.451 ], "simple_Rise": 4.253, "simple_Twist": 30.213, "simple_hRise": 4.053, "simple_hTwist": 30.370 }, { "index": 12, "nt1": "///I/14", "nt2": "///J/50", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.166, 0.196, 0.137, -4.132, -25.104, -18.226 ], "step_params": [ -0.046, -2.453, 3.373, 2.830, 21.277, 28.130 ], "heli_params": [ -6.557, 0.410, 1.253, 37.620, -5.004, 35.252 ], "bp2_params": [ -0.338, -0.145, -0.775, -14.539, -18.110, 12.180 ], "groove_widths": [ 17.264, 15.359, 18.582, null ], "simple_Rise": 3.373, "simple_Twist": 29.166, "simple_hRise": 1.324, "simple_hTwist": 36.075 }, { "index": 13, "nt1": "///I/15", "nt2": "///J/49", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.338, -0.145, -0.775, -14.539, -18.110, 12.180 ], "step_params": [ 0.316, -0.363, 2.320, 0.447, 8.457, 28.576 ], "heli_params": [ -1.934, -0.551, 2.132, 16.675, -0.882, 29.779 ], "bp2_params": [ -0.008, 0.124, -0.589, 20.917, -22.763, 9.869 ], "groove_widths": [ 17.937, 16.184, null, null ], "simple_Rise": 2.320, "simple_Twist": 28.501, "simple_hRise": 2.131, "simple_hTwist": 29.708 }, { "index": 14, "nt1": "///I/16", "nt2": "///J/48", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.008, 0.124, -0.589, 20.917, -22.763, 9.869 ], "step_params": [ -0.719, -1.500, 3.781, -12.925, 10.507, 33.582 ], "heli_params": [ -3.914, -0.812, 3.241, 16.952, 20.852, 37.379 ], "bp2_params": [ -0.777, 0.007, 0.579, 6.579, -7.904, 2.965 ], "groove_widths": [ 17.599, 15.700, 17.557, null ], "simple_Rise": 3.781, "simple_Twist": 36.831, "simple_hRise": 3.312, "simple_hTwist": 40.303 }, { "index": 15, "nt1": "///I/17", "nt2": "///J/47", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.777, 0.007, 0.579, 6.579, -7.904, 2.965 ], "step_params": [ 1.649, -0.695, 3.635, 7.266, 10.944, 31.349 ], "heli_params": [ -3.186, -1.502, 3.492, 19.230, -12.767, 33.926 ], "bp2_params": [ -0.292, 0.588, -0.479, 6.272, -20.580, 24.349 ], "groove_widths": [ 17.390, 14.711, 16.671, 13.741 ], "simple_Rise": 3.635, "simple_Twist": 28.668, "simple_hRise": 3.454, "simple_hTwist": 31.477 }, { "index": 16, "nt1": "///I/18", "nt2": "///J/46", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.292, 0.588, -0.479, 6.272, -20.580, 24.349 ], "step_params": [ -1.087, -1.812, 3.734, -10.922, 19.023, 33.612 ], "heli_params": [ -4.975, 0.256, 2.611, 29.340, 16.846, 39.963 ], "bp2_params": [ -0.848, 0.295, -0.527, -22.946, -1.605, 7.182 ], "groove_widths": [ 17.703, 14.642, 16.965, 14.457 ], "simple_Rise": 3.734, "simple_Twist": 36.172, "simple_hRise": 2.708, "simple_hTwist": 42.113 }, { "index": 17, "nt1": "///I/19", "nt2": "///J/45", "bp": "G-U", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.848, 0.295, -0.527, -22.946, -1.605, 7.182 ], "step_params": [ -1.317, -2.442, 3.399, 5.888, 15.110, 33.313 ], "heli_params": [ -5.598, 2.758, 1.900, 24.627, -9.596, 36.950 ], "bp2_params": [ -0.694, -0.216, -0.640, -19.000, 9.186, -11.332 ], "groove_widths": [ 18.088, 15.855, 19.914, 18.000 ], "simple_Rise": 3.399, "simple_Twist": 32.992, "simple_hRise": 1.884, "simple_hTwist": 36.663 }, { "index": 18, "nt1": "///I/20", "nt2": "///J/44", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.694, -0.216, -0.640, -19.000, 9.186, -11.332 ], "step_params": [ 1.580, -1.080, 2.917, -2.802, -0.751, 29.665 ], "heli_params": [ -1.964, -3.582, 2.785, -1.462, 5.457, 29.803 ], "bp2_params": [ -0.150, -0.173, -0.534, 9.917, 2.408, 2.905 ], "groove_widths": [ 17.516, 15.840, 20.509, 18.855 ], "simple_Rise": 2.917, "simple_Twist": 26.394, "simple_hRise": 2.766, "simple_hTwist": 26.550 }, { "index": 19, "nt1": "///I/21", "nt2": "///J/43", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.150, -0.173, -0.534, 9.917, 2.408, 2.905 ], "step_params": [ -0.645, -2.856, 2.928, -15.728, 0.081, 23.067 ], "heli_params": [ -5.952, -2.268, 2.783, 0.179, 34.637, 27.859 ], "bp2_params": [ -0.947, 0.243, 0.595, 22.028, -11.115, 4.624 ], "groove_widths": [ 16.529, null, 20.647, null ], "simple_Rise": 2.928, "simple_Twist": 27.530, "simple_hRise": 2.864, "simple_hTwist": 31.631 }, { "index": 20, "nt1": "///I/22", "nt2": "///J/42", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.947, 0.243, 0.595, 22.028, -11.115, 4.624 ], "step_params": [ 1.472, -1.159, 3.768, 20.315, -1.971, 41.259 ], "heli_params": [ -1.270, 0.352, 4.081, -2.614, -26.938, 45.833 ], "bp2_params": [ 2.321, -0.191, -1.711, 34.451, -19.854, 29.338 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.768, "simple_Twist": 22.922, "simple_hRise": 3.875, "simple_hTwist": 30.600 }, { "index": 21, "nt1": "///I/23", "nt2": "///J/41", "bp": "C-G", "name": "~Wobble", "Saenger": "--", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 2.321, -0.191, -1.711, 34.451, -19.854, 29.338 ], "step_params": [ -1.764, -1.316, 4.884, -1.695, 18.821, 43.655 ], "heli_params": [ -3.826, 1.997, 4.082, 24.015, 2.163, 47.386 ], "bp2_params": [ 1.479, -0.208, -0.209, -20.321, -1.755, -6.207 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 4.884, "simple_Twist": 49.033, "simple_hRise": 4.205, "simple_hTwist": 52.338 }, { "index": 22, "nt1": "///I/24", "nt2": "///J/40", "bp": "U-G", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W" } ] } ], "num_stems": 4, "stems": [ { "index": 1, "helix_index": 1, "strand1": "GGUAAACAUCC", "strand2": "CCGUUUGUAGG", "bp_type": "|||||||||||", "helix_form": "A.AAAA.AA.", "helical_rise": 3.154, "helical_rise_std": 0.348, "helical_radius": 9.183, "helical_radius_std": 0.412, "helical_axis": [ 0.084, 0.505, -0.859 ], "point1": [ 24.671, 82.488, 21.614 ], "point2": [ 27.345, 98.550, -5.706 ], "num_pairs": 11, "pairs": [ { "index": 1, "nt1": "///D/1", "nt2": "///E/61", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.224, -0.325, 0.049, -8.618, -25.993, -3.684 ], "step_params": [ 0.272, -1.566, 3.275, -3.508, 5.989, 31.364 ], "heli_params": [ -3.857, -1.093, 2.887, 10.912, 6.392, 32.104 ], "bp2_params": [ 0.100, -0.141, 0.298, -4.205, -19.281, -3.013 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.275, "simple_Twist": 29.576, "simple_hRise": 2.859, "simple_hTwist": 30.362 }, { "index": 2, "nt1": "///D/2", "nt2": "///E/60", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.100, -0.141, 0.298, -4.205, -19.281, -3.013 ], "step_params": [ 0.327, -1.516, 3.261, 0.600, 3.894, 40.901 ], "heli_params": [ -2.573, -0.402, 3.114, 5.557, -0.857, 41.083 ], "bp2_params": [ 1.884, -0.375, 0.306, 0.594, -7.801, -5.983 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.261, "simple_Twist": 32.187, "simple_hRise": 3.067, "simple_hTwist": 32.421 }, { "index": 3, "nt1": "///D/3", "nt2": "///E/59", "bp": "U-G", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 1.884, -0.375, 0.306, 0.594, -7.801, -5.983 ], "step_params": [ -0.142, -1.550, 3.095, 9.220, 11.336, 27.654 ], "heli_params": [ -4.722, 1.762, 2.156, 21.887, -17.801, 31.210 ], "bp2_params": [ 0.428, -0.032, 0.066, -4.773, -21.258, -6.188 ], "groove_widths": [ 16.860, null, 15.181, null ], "simple_Rise": 3.095, "simple_Twist": 35.174, "simple_hRise": 2.391, "simple_hTwist": 38.000 }, { "index": 4, "nt1": "///D/4", "nt2": "///E/58", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.428, -0.032, 0.066, -4.773, -21.258, -6.188 ], "step_params": [ 0.284, -1.429, 2.990, -1.639, 1.771, 32.744 ], "heli_params": [ -2.802, -0.755, 2.894, 3.137, 2.902, 32.831 ], "bp2_params": [ 0.063, 0.082, 0.468, 2.606, -15.782, -3.476 ], "groove_widths": [ 16.508, 15.509, 15.738, 14.678 ], "simple_Rise": 2.990, "simple_Twist": 34.554, "simple_hRise": 2.899, "simple_hTwist": 34.635 }, { "index": 5, "nt1": "///D/5", "nt2": "///E/57", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.063, 0.082, 0.468, 2.606, -15.782, -3.476 ], "step_params": [ -0.044, -1.698, 3.444, 6.006, 2.699, 29.202 ], "heli_params": [ -3.863, 1.365, 3.205, 5.269, -11.724, 29.919 ], "bp2_params": [ -0.714, -0.296, -0.111, 1.177, -18.603, -5.408 ], "groove_widths": [ 16.551, 15.625, 16.139, 15.406 ], "simple_Rise": 3.444, "simple_Twist": 33.288, "simple_hRise": 3.243, "simple_hTwist": 33.915 }, { "index": 6, "nt1": "///D/6", "nt2": "///E/56", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.714, -0.296, -0.111, 1.177, -18.603, -5.408 ], "step_params": [ 0.978, -1.305, 3.102, -0.862, 4.220, 29.895 ], "heli_params": [ -3.292, -2.038, 2.866, 8.127, 1.660, 30.196 ], "bp2_params": [ -0.699, 0.081, 0.198, 9.367, -17.082, 3.220 ], "groove_widths": [ 16.423, 15.365, 16.545, 15.471 ], "simple_Rise": 3.102, "simple_Twist": 30.559, "simple_hRise": 2.872, "simple_hTwist": 30.854 }, { "index": 7, "nt1": "///D/7", "nt2": "///E/55", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.699, 0.081, 0.198, 9.367, -17.082, 3.220 ], "step_params": [ -0.206, -1.457, 3.443, -1.569, 10.741, 36.829 ], "heli_params": [ -3.555, 0.119, 2.927, 16.564, 2.420, 38.342 ], "bp2_params": [ -0.093, 0.101, 0.160, -4.761, -12.496, 0.815 ], "groove_widths": [ 16.469, 15.419, 16.425, 14.735 ], "simple_Rise": 3.443, "simple_Twist": 32.738, "simple_hRise": 2.845, "simple_hTwist": 34.444 }, { "index": 8, "nt1": "///D/8", "nt2": "///E/54", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.093, 0.101, 0.160, -4.761, -12.496, 0.815 ], "step_params": [ -0.457, -1.098, 2.941, 2.052, 3.785, 28.363 ], "heli_params": [ -2.960, 1.327, 2.735, 7.669, -4.157, 28.681 ], "bp2_params": [ -0.921, -0.029, -0.300, 6.945, -21.439, 2.295 ], "groove_widths": [ 16.749, null, 15.261, null ], "simple_Rise": 2.941, "simple_Twist": 33.755, "simple_hRise": 2.773, "simple_hTwist": 34.020 }, { "index": 9, "nt1": "///D/9", "nt2": "///E/53", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.921, -0.029, -0.300, 6.945, -21.439, 2.295 ], "step_params": [ 0.408, -0.989, 3.315, 0.295, 9.528, 35.857 ], "heli_params": [ -2.804, -0.603, 2.969, 15.148, -0.469, 37.062 ], "bp2_params": [ -0.120, 0.136, -0.425, 8.757, -20.732, 3.623 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.315, "simple_Twist": 31.281, "simple_hRise": 2.901, "simple_hTwist": 32.667 }, { "index": 10, "nt1": "///D/10", "nt2": "///E/52", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.120, 0.136, -0.425, 8.757, -20.732, 3.623 ], "step_params": [ -0.407, -1.016, 3.073, 1.658, 11.018, 36.160 ], "heli_params": [ -2.839, 0.819, 2.642, 17.254, -2.596, 37.783 ], "bp2_params": [ 0.200, 0.454, -0.618, 21.267, -7.759, 2.199 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.073, "simple_Twist": 34.422, "simple_hRise": 2.614, "simple_hTwist": 36.129 }, { "index": 11, "nt1": "///D/11", "nt2": "///E/51", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 2, "helix_index": 1, "strand1": "GACUGGAAG", "strand2": "CUGACUUUC", "bp_type": "|||||||||", "helix_form": "......A.", "helical_rise": 2.563, "helical_rise_std": 0.740, "helical_radius": 9.838, "helical_radius_std": 1.008, "helical_axis": [ 0.050, 0.524, -0.850 ], "point1": [ 26.647, 100.482, -7.101 ], "point2": [ 27.675, 111.217, -24.515 ], "num_pairs": 9, "pairs": [ { "index": 1, "nt1": "///D/14", "nt2": "///E/50", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.345, 0.120, 0.043, -4.656, -25.375, -17.677 ], "step_params": [ -0.173, -2.411, 3.460, 2.475, 22.721, 28.511 ], "heli_params": [ -6.434, 0.557, 1.243, 39.150, -4.265, 36.392 ], "bp2_params": [ -0.334, -0.135, -0.934, -17.654, -19.968, 11.505 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.460, "simple_Twist": 28.542, "simple_hRise": 1.245, "simple_hTwist": 36.416 }, { "index": 2, "nt1": "///D/15", "nt2": "///E/49", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.334, -0.135, -0.934, -17.654, -19.968, 11.505 ], "step_params": [ 0.262, -0.388, 2.287, -2.303, 6.461, 27.985 ], "heli_params": [ -1.768, -0.878, 2.118, 13.112, 4.675, 28.797 ], "bp2_params": [ -0.110, 0.087, -0.538, 20.016, -20.890, 9.380 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.287, "simple_Twist": 28.382, "simple_hRise": 2.121, "simple_hTwist": 29.183 }, { "index": 3, "nt1": "///D/16", "nt2": "///E/48", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.110, 0.087, -0.538, 20.016, -20.890, 9.380 ], "step_params": [ -0.677, -1.529, 3.717, -11.475, 10.134, 33.944 ], "heli_params": [ -3.902, -0.638, 3.205, 16.364, 18.530, 37.144 ], "bp2_params": [ -0.842, 0.008, 0.481, 7.306, -9.174, 3.080 ], "groove_widths": [ 17.584, null, 17.505, null ], "simple_Rise": 3.717, "simple_Twist": 37.194, "simple_hRise": 3.271, "simple_hTwist": 40.118 }, { "index": 4, "nt1": "///D/17", "nt2": "///E/47", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.842, 0.008, 0.481, 7.306, -9.174, 3.080 ], "step_params": [ 1.656, -0.668, 3.752, 7.368, 10.583, 31.248 ], "heli_params": [ -3.169, -1.448, 3.630, 18.681, -13.007, 33.743 ], "bp2_params": [ -0.349, 0.534, -0.490, 4.369, -21.412, 24.417 ], "groove_widths": [ 17.400, 14.771, 16.728, 13.738 ], "simple_Rise": 3.752, "simple_Twist": 28.388, "simple_hRise": 3.590, "simple_hTwist": 31.125 }, { "index": 5, "nt1": "///D/18", "nt2": "///E/46", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.349, 0.534, -0.490, 4.369, -21.412, 24.417 ], "step_params": [ -1.019, -1.729, 3.654, -11.354, 19.301, 34.077 ], "heli_params": [ -4.735, 0.150, 2.565, 29.341, 17.260, 40.593 ], "bp2_params": [ -0.759, 0.277, -0.466, -22.947, -1.909, 6.476 ], "groove_widths": [ 17.680, 14.661, 16.965, 14.381 ], "simple_Rise": 3.654, "simple_Twist": 36.055, "simple_hRise": 2.639, "simple_hTwist": 42.246 }, { "index": 6, "nt1": "///D/19", "nt2": "///E/45", "bp": "G-U", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.759, 0.277, -0.466, -22.947, -1.909, 6.476 ], "step_params": [ -1.246, -2.421, 3.343, 6.126, 14.837, 33.069 ], "heli_params": [ -5.561, 2.688, 1.870, 24.362, -10.058, 36.661 ], "bp2_params": [ -0.667, -0.203, -0.597, -17.227, 10.315, -10.912 ], "groove_widths": [ 18.037, null, 19.856, null ], "simple_Rise": 3.343, "simple_Twist": 33.133, "simple_hRise": 1.873, "simple_hTwist": 36.718 }, { "index": 7, "nt1": "///D/20", "nt2": "///E/44", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.667, -0.203, -0.597, -17.227, 10.315, -10.912 ], "step_params": [ 1.489, -1.120, 2.909, -2.825, 0.056, 29.759 ], "heli_params": [ -2.181, -3.396, 2.757, 0.108, 5.484, 29.890 ], "bp2_params": [ -0.101, -0.203, -0.509, 10.944, 3.161, 1.898 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.909, "simple_Twist": 26.451, "simple_hRise": 2.736, "simple_hTwist": 26.599 }, { "index": 8, "nt1": "///D/21", "nt2": "///E/43", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.101, -0.203, -0.509, 10.944, 3.161, 1.898 ], "step_params": [ -0.573, -2.889, 2.985, -16.152, -0.119, 22.635 ], "heli_params": [ -5.997, -2.607, 2.785, -0.264, 35.867, 27.746 ], "bp2_params": [ -1.015, 0.227, 0.608, 21.329, -8.883, 5.580 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.985, "simple_Twist": 27.640, "simple_hRise": 2.887, "simple_hTwist": 31.934 }, { "index": 9, "nt1": "///D/22", "nt2": "///E/42", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 3, "helix_index": 2, "strand1": "GGUAAACAUCC", "strand2": "CCGUUUGUAGG", "bp_type": "|||||||||||", "helix_form": "AAAAAA.AA.", "helical_rise": 3.140, "helical_rise_std": 0.390, "helical_radius": 9.298, "helical_radius_std": 0.402, "helical_axis": [ 0.665, -0.587, 0.462 ], "point1": [ 33.049, 38.434, 37.923 ], "point2": [ 54.106, 19.840, 52.540 ], "num_pairs": 11, "pairs": [ { "index": 1, "nt1": "///I/1", "nt2": "///J/61", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.245, -0.239, -0.108, -11.424, -20.970, -4.321 ], "step_params": [ 0.039, -1.620, 3.174, -4.833, 4.198, 31.876 ], "heli_params": [ -3.585, -0.865, 2.905, 7.549, 8.691, 32.497 ], "bp2_params": [ 0.074, -0.101, 0.204, -3.990, -17.710, -5.201 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.174, "simple_Twist": 30.081, "simple_hRise": 2.885, "simple_hTwist": 30.739 }, { "index": 2, "nt1": "///I/2", "nt2": "///J/60", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.074, -0.101, 0.204, -3.990, -17.710, -5.201 ], "step_params": [ 0.430, -1.665, 3.180, 0.780, -0.507, 40.814 ], "heli_params": [ -2.333, -0.532, 3.207, -0.726, -1.119, 40.824 ], "bp2_params": [ 1.882, -0.290, 0.140, 3.710, -7.855, -7.174 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.180, "simple_Twist": 32.221, "simple_hRise": 3.214, "simple_hTwist": 32.234 }, { "index": 3, "nt1": "///I/3", "nt2": "///J/59", "bp": "U-G", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 1.882, -0.290, 0.140, 3.710, -7.855, -7.174 ], "step_params": [ -0.024, -1.698, 3.158, 8.795, 13.533, 28.947 ], "heli_params": [ -4.951, 1.319, 2.088, 24.790, -16.112, 33.058 ], "bp2_params": [ 0.539, 0.031, 0.110, -6.908, -22.726, -7.894 ], "groove_widths": [ 16.597, null, 15.148, null ], "simple_Rise": 3.158, "simple_Twist": 35.459, "simple_hRise": 2.314, "simple_hTwist": 38.851 }, { "index": 4, "nt1": "///I/4", "nt2": "///J/58", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.539, 0.031, 0.110, -6.908, -22.726, -7.894 ], "step_params": [ 0.232, -1.628, 2.829, -1.159, -0.018, 31.876 ], "heli_params": [ -2.960, -0.605, 2.820, -0.033, 2.109, 31.896 ], "bp2_params": [ 0.086, 0.094, 0.577, 3.652, -16.243, -5.529 ], "groove_widths": [ 16.240, 15.337, 15.917, 14.806 ], "simple_Rise": 2.829, "simple_Twist": 34.423, "simple_hRise": 2.821, "simple_hTwist": 34.442 }, { "index": 5, "nt1": "///I/5", "nt2": "///J/57", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.086, 0.094, 0.577, 3.652, -16.243, -5.529 ], "step_params": [ 0.068, -1.884, 3.376, 5.348, 0.821, 29.206 ], "heli_params": [ -3.854, 1.022, 3.283, 1.611, -10.493, 29.692 ], "bp2_params": [ -0.799, -0.237, 0.184, 1.359, -20.587, -6.679 ], "groove_widths": [ 16.303, 15.495, 16.299, 15.489 ], "simple_Rise": 3.376, "simple_Twist": 33.966, "simple_hRise": 3.303, "simple_hTwist": 34.382 }, { "index": 6, "nt1": "///I/6", "nt2": "///J/56", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.799, -0.237, 0.184, 1.359, -20.587, -6.679 ], "step_params": [ 1.030, -1.312, 3.061, 4.138, 3.643, 29.970 ], "heli_params": [ -3.175, -1.189, 2.997, 6.971, -7.917, 30.462 ], "bp2_params": [ -0.664, 0.120, -0.093, 10.380, -14.621, 2.977 ], "groove_widths": [ 16.295, 15.383, 16.815, 15.583 ], "simple_Rise": 3.061, "simple_Twist": 29.858, "simple_hRise": 2.996, "simple_hTwist": 30.351 }, { "index": 7, "nt1": "///I/7", "nt2": "///J/55", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.664, 0.120, -0.093, 10.380, -14.621, 2.977 ], "step_params": [ -0.214, -1.446, 3.440, -3.729, 12.391, 37.104 ], "heli_params": [ -3.618, -0.122, 2.840, 18.786, 5.653, 39.221 ], "bp2_params": [ -0.064, 0.057, 0.303, -3.875, -9.381, 0.365 ], "groove_widths": [ 16.470, 15.509, 16.641, 14.849 ], "simple_Rise": 3.440, "simple_Twist": 32.982, "simple_hRise": 2.744, "simple_hTwist": 35.364 }, { "index": 8, "nt1": "///I/8", "nt2": "///J/54", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.064, 0.057, 0.303, -3.875, -9.381, 0.365 ], "step_params": [ -0.471, -1.172, 2.953, 1.393, 3.066, 28.345 ], "heli_params": [ -2.991, 1.234, 2.788, 6.234, -2.832, 28.541 ], "bp2_params": [ -0.973, -0.082, -0.095, 6.634, -21.582, 1.986 ], "groove_widths": [ 16.785, null, 15.336, null ], "simple_Rise": 2.953, "simple_Twist": 34.030, "simple_hRise": 2.819, "simple_hTwist": 34.192 }, { "index": 9, "nt1": "///I/9", "nt2": "///J/53", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.973, -0.082, -0.095, 6.634, -21.582, 1.986 ], "step_params": [ 0.449, -1.068, 3.215, -0.391, 8.718, 36.725 ], "heli_params": [ -2.720, -0.742, 2.890, 13.602, 0.611, 37.713 ], "bp2_params": [ -0.051, 0.196, -0.141, 8.403, -20.002, 3.181 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.215, "simple_Twist": 31.513, "simple_hRise": 2.821, "simple_hTwist": 32.670 }, { "index": 10, "nt1": "///I/10", "nt2": "///J/52", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.051, 0.196, -0.141, 8.403, -20.002, 3.181 ], "step_params": [ -0.474, -1.031, 3.225, 4.987, 11.528, 35.351 ], "heli_params": [ -3.015, 1.348, 2.682, 18.286, -7.911, 37.449 ], "bp2_params": [ 0.202, 0.480, -0.697, 17.927, -8.128, 2.983 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.225, "simple_Twist": 34.289, "simple_hRise": 2.661, "simple_hTwist": 36.453 }, { "index": 11, "nt1": "///I/11", "nt2": "///J/51", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 4, "helix_index": 2, "strand1": "GACUGGAAG", "strand2": "CUGACUUUC", "bp_type": "|||||||||", "helix_form": "......A.", "helical_rise": 2.558, "helical_rise_std": 0.740, "helical_radius": 9.874, "helical_radius_std": 1.036, "helical_axis": [ 0.634, -0.610, 0.475 ], "point1": [ 54.619, 17.777, 53.696 ], "point2": [ 67.584, 5.305, 63.417 ], "num_pairs": 9, "pairs": [ { "index": 1, "nt1": "///I/14", "nt2": "///J/50", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.166, 0.196, 0.137, -4.132, -25.104, -18.226 ], "step_params": [ -0.046, -2.453, 3.373, 2.830, 21.277, 28.130 ], "heli_params": [ -6.557, 0.410, 1.253, 37.620, -5.004, 35.252 ], "bp2_params": [ -0.338, -0.145, -0.775, -14.539, -18.110, 12.180 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.373, "simple_Twist": 29.166, "simple_hRise": 1.324, "simple_hTwist": 36.075 }, { "index": 2, "nt1": "///I/15", "nt2": "///J/49", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.338, -0.145, -0.775, -14.539, -18.110, 12.180 ], "step_params": [ 0.316, -0.363, 2.320, 0.447, 8.457, 28.576 ], "heli_params": [ -1.934, -0.551, 2.132, 16.675, -0.882, 29.779 ], "bp2_params": [ -0.008, 0.124, -0.589, 20.917, -22.763, 9.869 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.320, "simple_Twist": 28.501, "simple_hRise": 2.131, "simple_hTwist": 29.708 }, { "index": 3, "nt1": "///I/16", "nt2": "///J/48", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.008, 0.124, -0.589, 20.917, -22.763, 9.869 ], "step_params": [ -0.719, -1.500, 3.781, -12.925, 10.507, 33.582 ], "heli_params": [ -3.914, -0.812, 3.241, 16.952, 20.852, 37.379 ], "bp2_params": [ -0.777, 0.007, 0.579, 6.579, -7.904, 2.965 ], "groove_widths": [ 17.599, null, 17.557, null ], "simple_Rise": 3.781, "simple_Twist": 36.831, "simple_hRise": 3.312, "simple_hTwist": 40.303 }, { "index": 4, "nt1": "///I/17", "nt2": "///J/47", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.777, 0.007, 0.579, 6.579, -7.904, 2.965 ], "step_params": [ 1.649, -0.695, 3.635, 7.266, 10.944, 31.349 ], "heli_params": [ -3.186, -1.502, 3.492, 19.230, -12.767, 33.926 ], "bp2_params": [ -0.292, 0.588, -0.479, 6.272, -20.580, 24.349 ], "groove_widths": [ 17.390, 14.711, 16.671, 13.741 ], "simple_Rise": 3.635, "simple_Twist": 28.668, "simple_hRise": 3.454, "simple_hTwist": 31.477 }, { "index": 5, "nt1": "///I/18", "nt2": "///J/46", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.292, 0.588, -0.479, 6.272, -20.580, 24.349 ], "step_params": [ -1.087, -1.812, 3.734, -10.922, 19.023, 33.612 ], "heli_params": [ -4.975, 0.256, 2.611, 29.340, 16.846, 39.963 ], "bp2_params": [ -0.848, 0.295, -0.527, -22.946, -1.605, 7.182 ], "groove_widths": [ 17.703, 14.642, 16.965, 14.457 ], "simple_Rise": 3.734, "simple_Twist": 36.172, "simple_hRise": 2.708, "simple_hTwist": 42.113 }, { "index": 6, "nt1": "///I/19", "nt2": "///J/45", "bp": "G-U", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.848, 0.295, -0.527, -22.946, -1.605, 7.182 ], "step_params": [ -1.317, -2.442, 3.399, 5.888, 15.110, 33.313 ], "heli_params": [ -5.598, 2.758, 1.900, 24.627, -9.596, 36.950 ], "bp2_params": [ -0.694, -0.216, -0.640, -19.000, 9.186, -11.332 ], "groove_widths": [ 18.088, null, 19.914, null ], "simple_Rise": 3.399, "simple_Twist": 32.992, "simple_hRise": 1.884, "simple_hTwist": 36.663 }, { "index": 7, "nt1": "///I/20", "nt2": "///J/44", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.694, -0.216, -0.640, -19.000, 9.186, -11.332 ], "step_params": [ 1.580, -1.080, 2.917, -2.802, -0.751, 29.665 ], "heli_params": [ -1.964, -3.582, 2.785, -1.462, 5.457, 29.803 ], "bp2_params": [ -0.150, -0.173, -0.534, 9.917, 2.408, 2.905 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.917, "simple_Twist": 26.394, "simple_hRise": 2.766, "simple_hTwist": 26.550 }, { "index": 8, "nt1": "///I/21", "nt2": "///J/43", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.150, -0.173, -0.534, 9.917, 2.408, 2.905 ], "step_params": [ -0.645, -2.856, 2.928, -15.728, 0.081, 23.067 ], "heli_params": [ -5.952, -2.268, 2.783, 0.179, 34.637, 27.859 ], "bp2_params": [ -0.947, 0.243, 0.595, 22.028, -11.115, 4.624 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.928, "simple_Twist": 27.530, "simple_hRise": 2.864, "simple_hTwist": 31.631 }, { "index": 9, "nt1": "///I/22", "nt2": "///J/42", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] } ], "num_isoCanonPairs": 2, "isoCanonPairs": [ { "index": -1, "helix_index": 1, "nt1": "///D/24", "nt2": "///E/40", "bp": "U-G", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W" }, { "index": -2, "helix_index": 2, "nt1": "///I/24", "nt2": "///J/40", "bp": "U-G", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W" } ], "num_coaxStacks": 2, "coaxStacks": [ { "index": 1, "helix_index": 1, "num_stems": 2, "stem_indices": [ 1, 2 ] }, { "index": 2, "helix_index": 2, "num_stems": 2, "stem_indices": [ 3, 4 ] } ], "num_stacks": 10, "stacks": [ { "index": 1, "num_nts": 2, "nts_short": "RC", "nts_long": "///A/602,///E/61" }, { "index": 2, "num_nts": 2, "nts_short": "RC", "nts_long": "///A/835,///E/63" }, { "index": 3, "num_nts": 2, "nts_short": "GG", "nts_long": "///D/14,///E/51" }, { "index": 4, "num_nts": 2, "nts_short": "GC", "nts_long": "///D/22,///D/23" }, { "index": 5, "num_nts": 2, "nts_short": "RC", "nts_long": "///F/602,///J/61" }, { "index": 6, "num_nts": 2, "nts_short": "RC", "nts_long": "///F/835,///J/63" }, { "index": 7, "num_nts": 2, "nts_short": "GG", "nts_long": "///I/14,///J/51" }, { "index": 8, "num_nts": 2, "nts_short": "GC", "nts_long": "///I/22,///I/23" }, { "index": 9, "num_nts": 3, "nts_short": "UGC", "nts_long": "///D/24,///E/41,///E/42" }, { "index": 10, "num_nts": 3, "nts_short": "UGC", "nts_long": "///I/24,///J/41,///J/42" } ], "nonStack": { "num_nts": 4, "nts_short": "GGgg", "nts_long": "///E/62,///J/62,///C/1177,///H/1177" }, "num_atom2bases": 2, "atom2bases": [ { "index": 1, "type": "other", "atom": "///A/606/OG", "nt": "///D/1", "vert_dist": 2.995 }, { "index": 2, "type": "other", "atom": "///F/606/OG", "nt": "///I/1", "vert_dist": 2.966 } ], "num_iloops": 2, "iloops": [ { "index": 1, "type": "symmetric internal loop", "bridging_nts": [ 1, 1 ], "stem_indices": [ 2, -1 ], "summary": "[2] 1 1 [D.22 E.42 D.24 E.40] 9 1", "num_nts": 6, "nts_short": "GCUGGC", "nts_long": "///D/22,///D/23,///D/24,///E/40,///E/41,///E/42", "num_stems": 2, "bridges": [ { "index": 1, "num_nts": 1, "nts_short": "C", "nts_long": "///D/23" }, { "index": 2, "num_nts": 1, "nts_short": "G", "nts_long": "///E/41" } ] }, { "index": 2, "type": "symmetric internal loop", "bridging_nts": [ 1, 1 ], "stem_indices": [ 4, -2 ], "summary": "[2] 1 1 [I.22 J.42 I.24 J.40] 9 1", "num_nts": 6, "nts_short": "GCUGGC", "nts_long": "///I/22,///I/23,///I/24,///J/40,///J/41,///J/42", "num_stems": 2, "bridges": [ { "index": 1, "num_nts": 1, "nts_short": "C", "nts_long": "///I/23" }, { "index": 2, "num_nts": 1, "nts_short": "G", "nts_long": "///J/41" } ] } ], "num_ssSegments": 4, "ssSegments": [ { "index": 1, "num_nts": 2, "nts_short": "GC", "nts_long": "///E/62,///E/63" }, { "index": 2, "num_nts": 2, "nts_short": "GC", "nts_long": "///J/62,///J/63" }, { "index": 3, "num_nts": 1, "nts_short": "g", "nts_long": "///C/1177" }, { "index": 4, "num_nts": 1, "nts_short": "g", "nts_long": "///H/1177" } ], "num_splayUnits": 2, "splayUnits": [ { "index": 1, "num_nts": 2, "nts_short": "CG", "nts_long": "///E/61,///E/62" }, { "index": 2, "num_nts": 2, "nts_short": "CG", "nts_long": "///J/61,///J/62" } ], "dbn": { "all_chains": { "num_nts": 94, "num_chars": 101, "bseq": "GGUAAACAUCC&GACUGGAAGCU&GGCUUUCAGUCGGAUGUUUGCCGC&GGUAAACAUCC&GACUGGAAGCU&GGCUUUCAGUCGGAUGUUUGCCGC&g&g", "bseqUP": "GGUAAACAUCC&GACUGGAAGCU&GGCUUUCAGUCGGAUGUUUGCCGC&GGUAAACAUCC&GACUGGAAGCU&GGCUUUCAGUCGGAUGUUUGCCGC&G&G", "sstr": "(((((((((((&(((((((((.(&).))))))))))))))))))))..&(((((((((((&(((((((((.(&).))))))))))))))))))))..&.&.", "form": "AAAAAAAAAA-&....A.A...-&....AA.A..AAAAAAAAAAA..-&AAAAAAAAA.-&...A..A...-&....AA.A..AAAAAAAAAAA..-&-&-" }, "chain_D": { "num_nts": 22, "num_chars": 23, "bseq": "GGUAAACAUCC&GACUGGAAGCU", "bseqUP": "GGUAAACAUCC&GACUGGAAGCU", "sstr": "(((((((((((&(((((((((.(", "form": "AAAAAAAAAA-&....A.A...-" }, "chain_E": { "num_nts": 24, "num_chars": 24, "bseq": "GGCUUUCAGUCGGAUGUUUGCCGC", "bseqUP": "GGCUUUCAGUCGGAUGUUUGCCGC", "sstr": ").))))))))))))))))))))..", "form": "....AA.A..AAAAAAAAAAA..-" }, "chain_I": { "num_nts": 22, "num_chars": 23, "bseq": "GGUAAACAUCC&GACUGGAAGCU", "bseqUP": "GGUAAACAUCC&GACUGGAAGCU", "sstr": "(((((((((((&(((((((((.(", "form": "AAAAAAAAA.-&...A..A...-" }, "chain_J": { "num_nts": 24, "num_chars": 24, "bseq": "GGCUUUCAGUCGGAUGUUUGCCGC", "bseqUP": "GGCUUUCAGUCGGAUGUUUGCCGC", "sstr": ").))))))))))))))))))))..", "form": "....AA.A..AAAAAAAAAAA..-" } }, "chains": { "chain_D": { "num_nts": 22, "bseq": "GGUAAACAUCC&GACUGGAAGCU", "sstr": "(((((((((((&(((((((((.(", "form": "AAAAAAAAAA-&....A.A...-", "helical_rise": 2.845, "helical_rise_std": 0.683, "helical_axis": [ 0.066, 0.522, -0.850 ], "point1": [ 24.444, 82.554, 20.644 ], "point2": [ 28.396, 113.733, -30.155 ], "num_chars": 64, "suite": "G1aG1aU1aA1aA!!A1aC1aA1aU1aC!!C..G!!A!!C1aU1aG!!G!!A!!A1LG1cC7aU" }, "chain_E": { "num_nts": 24, "bseq": "GGCUUUCAGUCGGAUGUUUGCCGC", "sstr": ").))))))))))))))))))))..", "form": "....AA.A..AAAAAAAAAAA..-", "helical_rise": 2.966, "helical_rise_std": 1.582, "helical_axis": [ -0.151, -0.644, 0.750 ], "point1": [ 28.612, 116.173, -25.393 ], "point2": [ 18.453, 72.819, 25.140 ], "num_chars": 70, "suite": "G!!G1aC1cU!!U1aU1aC!!A1cG1LU1eC1aG1aG1aA1cU1aG1aU1aU1aU1cG1aC1aC!!G5zC" }, "chain_I": { "num_nts": 22, "bseq": "GGUAAACAUCC&GACUGGAAGCU", "sstr": "(((((((((((&(((((((((.(", "form": "AAAAAAAAA.-&...A..A...-", "helical_rise": 2.841, "helical_rise_std": 0.694, "helical_axis": [ 0.644, -0.608, 0.464 ], "point1": [ 33.655, 38.430, 38.724 ], "point2": [ 72.045, 2.142, 66.407 ], "num_chars": 64, "suite": "G1aG1aU1aA1aA1cA1LC1aA1aU1aC!!C..G!!A!!C1aU1aG!!G!!A!!A1LG1cC7aU" }, "chain_J": { "num_nts": 24, "bseq": "GGCUUUCAGUCGGAUGUUUGCCGC", "sstr": ").))))))))))))))))))))..", "form": "....AA.A..AAAAAAAAAAA..-", "helical_rise": 2.972, "helical_rise_std": 1.610, "helical_axis": [ -0.617, 0.715, -0.329 ], "point1": [ 68.585, 0.291, 63.061 ], "point2": [ 26.920, 48.524, 40.875 ], "num_chars": 70, "suite": "G!!G1aC1cU1cU1aU1aC!!A1cG1LU1eC1aG1aG1aA1cU1aG1aU1aU1aU1cG1aC1aC!!G5zC" } }, "num_nts": 94, "nts": [ { "index": 1, "index_chain": 1, "chain_name": "D", "nt_resnum": 1, "nt_name": "G", "nt_code": "G", "nt_id": "///D/1", "linked_nts": [ null, "///D/2" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,cap-acceptor", "alpha": null, "beta": null, "gamma": 50.295, "delta": 98.597, "epsilon": -133.923, "zeta": -86.180, "epsilon_zeta": -47.743, "bb_type": "BI", "chi": -163.528, "glyco_bond": "anti", "C5prime_xyz": [ -1.076, 8.664, 0.508 ], "P_xyz": [ null, null, null ], "form": "A", "ssZp": 4.413, "Dp": 4.626, "splay_angle": 23.211, "splay_distance": 3.754, "splay_ratio": 0.206, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": 13.394, "v1": -36.022, "v2": 44.670, "v3": -37.543, "v4": 15.000, "amplitude": 44.681, "phase_angle": 1.302, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.044, "frame": { "rmsd": 0.044, "origin": [ 22.534, 81.320, 19.874 ], "x_axis": [ 0.695, 0.718, 0.044 ], "y_axis": [ 0.624, -0.572, -0.532 ], "z_axis": [ -0.357, 0.397, -0.846 ], "quaternion": [ -0.263, 0.882, 0.380, -0.089 ] } }, { "index": 2, "index_chain": 2, "chain_name": "D", "nt_resnum": 2, "nt_name": "G", "nt_code": "G", "nt_id": "///D/2", "linked_nts": [ "///D/1", "///D/3" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -61.877, "beta": 149.937, "gamma": 62.060, "delta": 71.973, "epsilon": -147.272, "zeta": -65.429, "epsilon_zeta": -81.844, "bb_type": "BI", "chi": -168.036, "glyco_bond": "anti", "C5prime_xyz": [ -1.675, 8.867, 0.929 ], "P_xyz": [ 0.807, 9.479, 0.428 ], "form": "A", "ssZp": 4.644, "Dp": 4.792, "splay_angle": 23.386, "splay_distance": 3.699, "splay_ratio": 0.205, "d22": null, "d64": null, "eta": 165.445, "theta": -144.034, "eta_prime": -178.069, "theta_prime": -143.728, "eta_base": -132.980, "theta_base": -105.740, "v0": -1.019, "v1": -27.758, "v2": 44.611, "v3": -46.435, "v4": 29.905, "amplitude": 47.433, "phase_angle": 19.863, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.201, "filter_rmsd": 0.029, "frame": { "rmsd": 0.029, "origin": [ 21.881, 84.573, 18.120 ], "x_axis": [ 0.954, 0.257, -0.157 ], "y_axis": [ 0.126, -0.813, -0.568 ], "z_axis": [ -0.274, 0.522, -0.808 ], "quaternion": [ -0.288, 0.945, 0.101, -0.114 ] } }, { "index": 3, "index_chain": 3, "chain_name": "D", "nt_resnum": 3, "nt_name": "U", "nt_code": "U", "nt_id": "///D/3", "linked_nts": [ "///D/2", "///D/4" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -69.472, "beta": 176.499, "gamma": 49.619, "delta": 83.541, "epsilon": -149.776, "zeta": -86.372, "epsilon_zeta": -63.403, "bb_type": "BI", "chi": -156.861, "glyco_bond": "anti", "C5prime_xyz": [ -1.574, 8.692, 0.340 ], "P_xyz": [ 0.973, 9.247, 0.365 ], "form": "A", "ssZp": 4.330, "Dp": 4.595, "splay_angle": 20.700, "splay_distance": 3.152, "splay_ratio": 0.181, "d22": null, "d64": null, "eta": 162.474, "theta": -159.393, "eta_prime": 179.346, "theta_prime": -158.373, "eta_base": -122.734, "theta_base": -140.581, "v0": 12.382, "v1": -38.399, "v2": 48.588, "v3": -42.760, "v4": 19.396, "amplitude": 48.728, "phase_angle": 4.350, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.725, "filter_rmsd": 0.089, "frame": { "rmsd": 0.021, "origin": [ 23.173, 87.264, 15.936 ], "x_axis": [ 0.838, -0.375, -0.397 ], "y_axis": [ -0.537, -0.695, -0.478 ], "z_axis": [ -0.097, 0.613, -0.784 ], "quaternion": [ -0.300, 0.911, -0.250, -0.136 ] } }, { "index": 4, "index_chain": 4, "chain_name": "D", "nt_resnum": 4, "nt_name": "A", "nt_code": "A", "nt_id": "///D/4", "linked_nts": [ "///D/3", "///D/5" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -63.078, "beta": 159.671, "gamma": 59.821, "delta": 89.817, "epsilon": -147.289, "zeta": -81.830, "epsilon_zeta": -65.459, "bb_type": "BI", "chi": -161.485, "glyco_bond": "anti", "C5prime_xyz": [ -1.218, 8.619, 0.549 ], "P_xyz": [ 1.276, 8.798, -0.047 ], "form": "A", "ssZp": 4.431, "Dp": 4.640, "splay_angle": 22.305, "splay_distance": 3.445, "splay_ratio": 0.195, "d22": null, "d64": null, "eta": 167.625, "theta": -142.195, "eta_prime": 177.581, "theta_prime": -147.207, "eta_base": -152.431, "theta_base": -123.128, "v0": 6.401, "v1": -30.685, "v2": 43.126, "v3": -40.112, "v4": 21.119, "amplitude": 43.834, "phase_angle": 10.310, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.646, "filter_rmsd": 0.047, "frame": { "rmsd": 0.021, "origin": [ 23.748, 89.935, 14.364 ], "x_axis": [ 0.513, -0.672, -0.534 ], "y_axis": [ -0.854, -0.339, -0.394 ], "z_axis": [ 0.084, 0.658, -0.748 ], "quaternion": [ -0.326, 0.806, -0.473, -0.140 ] } }, { "index": 5, "index_chain": 5, "chain_name": "D", "nt_resnum": 5, "nt_name": "A", "nt_code": "A", "nt_id": "///D/5", "linked_nts": [ "///D/4", "///D/6" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -60.219, "beta": 166.818, "gamma": 52.573, "delta": 78.786, "epsilon": -179.968, "zeta": -64.659, "epsilon_zeta": -115.309, "bb_type": "BI", "chi": -162.215, "glyco_bond": "anti", "C5prime_xyz": [ -1.149, 8.682, 0.487 ], "P_xyz": [ 1.464, 8.936, 0.255 ], "form": "A", "ssZp": 4.397, "Dp": 4.503, "splay_angle": 23.039, "splay_distance": 3.737, "splay_ratio": 0.208, "d22": null, "d64": null, "eta": 165.831, "theta": -138.197, "eta_prime": -177.783, "theta_prime": -144.547, "eta_base": -131.542, "theta_base": -130.157, "v0": 1.082, "v1": -30.050, "v2": 46.374, "v3": -46.659, "v4": 28.713, "amplitude": 48.551, "phase_angle": 17.222, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.754, "filter_rmsd": 0.039, "frame": { "rmsd": 0.013, "origin": [ 25.640, 91.559, 11.987 ], "x_axis": [ -0.054, -0.771, -0.634 ], "y_axis": [ -0.974, 0.179, -0.135 ], "z_axis": [ 0.218, 0.611, -0.761 ], "quaternion": [ 0.302, -0.618, 0.706, 0.168 ] } }, { "index": 6, "index_chain": 6, "chain_name": "D", "nt_resnum": 6, "nt_name": "A", "nt_code": "A", "nt_id": "///D/6", "linked_nts": [ "///D/5", "///D/7" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -175.074, "beta": -162.420, "gamma": 142.206, "delta": 81.368, "epsilon": -124.899, "zeta": -85.882, "epsilon_zeta": -39.017, "bb_type": "--", "chi": -162.724, "glyco_bond": "anti", "C5prime_xyz": [ -1.228, 8.556, 0.886 ], "P_xyz": [ 0.848, 9.481, -0.249 ], "form": "A", "ssZp": 4.388, "Dp": 4.744, "splay_angle": 23.096, "splay_distance": 3.676, "splay_ratio": 0.202, "d22": null, "d64": null, "eta": 167.636, "theta": -148.079, "eta_prime": -179.583, "theta_prime": -146.427, "eta_base": -148.569, "theta_base": -113.868, "v0": 14.952, "v1": -38.239, "v2": 46.206, "v3": -38.717, "v4": 15.064, "amplitude": 46.207, "phase_angle": 0.237, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.045, "frame": { "rmsd": 0.028, "origin": [ 28.267, 92.495, 9.498 ], "x_axis": [ -0.491, -0.604, -0.628 ], "y_axis": [ -0.794, 0.606, 0.037 ], "z_axis": [ 0.358, 0.517, -0.778 ], "quaternion": [ 0.291, -0.413, 0.848, 0.163 ] } }, { "index": 7, "index_chain": 7, "chain_name": "D", "nt_resnum": 7, "nt_name": "C", "nt_code": "C", "nt_id": "///D/7", "linked_nts": [ "///D/6", "///D/8" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -57.559, "beta": 143.192, "gamma": 70.207, "delta": 78.315, "epsilon": -149.691, "zeta": -80.871, "epsilon_zeta": -68.820, "bb_type": "BI", "chi": -164.534, "glyco_bond": "anti", "C5prime_xyz": [ -1.795, 8.853, 0.799 ], "P_xyz": [ 0.753, 9.317, -0.025 ], "form": "A", "ssZp": 4.572, "Dp": 4.660, "splay_angle": 24.354, "splay_distance": 3.798, "splay_ratio": 0.212, "d22": null, "d64": null, "eta": 163.141, "theta": -146.647, "eta_prime": -174.936, "theta_prime": -149.608, "eta_base": -124.046, "theta_base": -121.995, "v0": -0.993, "v1": -23.957, "v2": 38.033, "v3": -39.204, "v4": 25.530, "amplitude": 40.382, "phase_angle": 19.639, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.276, "filter_rmsd": 0.070, "frame": { "rmsd": 0.012, "origin": [ 29.020, 92.348, 5.903 ], "x_axis": [ -0.872, -0.200, -0.447 ], "y_axis": [ -0.335, 0.910, 0.247 ], "z_axis": [ 0.357, 0.365, -0.860 ], "quaternion": [ 0.211, -0.140, 0.954, 0.160 ] } }, { "index": 8, "index_chain": 8, "chain_name": "D", "nt_resnum": 8, "nt_name": "A", "nt_code": "A", "nt_id": "///D/8", "linked_nts": [ "///D/7", "///D/9" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -71.052, "beta": 169.718, "gamma": 61.515, "delta": 81.414, "epsilon": -151.301, "zeta": -81.647, "epsilon_zeta": -69.655, "bb_type": "BI", "chi": -167.061, "glyco_bond": "anti", "C5prime_xyz": [ -1.776, 8.705, 0.983 ], "P_xyz": [ 0.815, 9.018, 1.259 ], "form": "A", "ssZp": 4.420, "Dp": 4.514, "splay_angle": 19.978, "splay_distance": 3.136, "splay_ratio": 0.175, "d22": null, "d64": null, "eta": 168.325, "theta": -150.980, "eta_prime": -178.637, "theta_prime": -152.126, "eta_base": -134.319, "theta_base": -135.339, "v0": 3.191, "v1": -29.852, "v2": 43.573, "v3": -43.582, "v4": 25.122, "amplitude": 45.088, "phase_angle": 14.892, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.825, "filter_rmsd": 0.038, "frame": { "rmsd": 0.015, "origin": [ 29.427, 92.336, 2.127 ], "x_axis": [ -0.962, 0.273, -0.001 ], "y_axis": [ 0.244, 0.861, 0.446 ], "z_axis": [ 0.123, 0.428, -0.895 ], "quaternion": [ 0.032, 0.134, 0.964, 0.227 ] } }, { "index": 9, "index_chain": 9, "chain_name": "D", "nt_resnum": 9, "nt_name": "U", "nt_code": "U", "nt_id": "///D/9", "linked_nts": [ "///D/8", "///D/10" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -71.959, "beta": 173.676, "gamma": 55.652, "delta": 82.919, "epsilon": -146.109, "zeta": -77.690, "epsilon_zeta": -68.419, "bb_type": "BI", "chi": -155.105, "glyco_bond": "anti", "C5prime_xyz": [ -1.504, 8.725, 0.120 ], "P_xyz": [ 1.018, 9.104, -0.130 ], "form": "A", "ssZp": 4.212, "Dp": 4.640, "splay_angle": 22.680, "splay_distance": 3.545, "splay_ratio": 0.197, "d22": 4.041, "d64": 3.938, "eta": 165.104, "theta": -145.231, "eta_prime": 173.276, "theta_prime": -143.693, "eta_base": -156.424, "theta_base": -111.165, "v0": 3.252, "v1": -29.590, "v2": 42.939, "v3": -42.169, "v4": 24.771, "amplitude": 44.346, "phase_angle": 14.468, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.888, "filter_rmsd": 0.108, "frame": { "rmsd": 0.019, "origin": [ 29.508, 92.078, -0.997 ], "x_axis": [ -0.729, 0.667, 0.155 ], "y_axis": [ 0.684, 0.699, 0.208 ], "z_axis": [ 0.030, 0.258, -0.966 ], "quaternion": [ -0.034, 0.367, 0.921, 0.127 ] } }, { "index": 10, "index_chain": 10, "chain_name": "D", "nt_resnum": 10, "nt_name": "C", "nt_code": "C", "nt_id": "///D/10", "linked_nts": [ "///D/9", "///D/11" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -77.771, "beta": 173.167, "gamma": 75.097, "delta": 89.140, "epsilon": -165.513, "zeta": -87.753, "epsilon_zeta": -77.760, "bb_type": "BI", "chi": -155.339, "glyco_bond": "anti", "C5prime_xyz": [ -1.423, 8.800, 0.251 ], "P_xyz": [ 1.162, 9.038, -0.311 ], "form": "A", "ssZp": 4.275, "Dp": 4.418, "splay_angle": 19.909, "splay_distance": 3.125, "splay_ratio": 0.173, "d22": 4.716, "d64": 3.778, "eta": 168.233, "theta": -136.160, "eta_prime": -171.808, "theta_prime": -140.063, "eta_base": -123.053, "theta_base": -122.478, "v0": 4.620, "v1": -24.549, "v2": 33.794, "v3": -32.154, "v4": 17.537, "amplitude": 34.446, "phase_angle": 11.162, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.272, "filter_rmsd": 0.060, "frame": { "rmsd": 0.008, "origin": [ 27.854, 93.692, -3.684 ], "x_axis": [ -0.190, 0.898, 0.397 ], "y_axis": [ 0.963, 0.248, -0.102 ], "z_axis": [ -0.190, 0.363, -0.912 ], "quaternion": [ -0.192, 0.607, 0.767, 0.085 ] } }, { "index": 11, "index_chain": 11, "chain_name": "D", "nt_resnum": 11, "nt_name": "C", "nt_code": "C", "nt_id": "///D/11", "linked_nts": [ "///D/10", null ], "nt_type": "RNA", "dbn": "(", "is_broken": true, "summary": "break,anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack", "alpha": -146.123, "beta": -131.455, "gamma": 101.643, "delta": 82.580, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": -137.447, "glyco_bond": "anti", "C5prime_xyz": [ -1.776, 8.956, -0.711 ], "P_xyz": [ 0.924, 8.868, -1.245 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": -1.701, "v1": -18.143, "v2": 29.425, "v3": -31.249, "v4": 21.305, "amplitude": 31.678, "phase_angle": 21.740, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.071, "frame": { "rmsd": 0.015, "origin": [ 26.510, 95.226, -6.052 ], "x_axis": [ 0.446, 0.732, 0.514 ], "y_axis": [ 0.826, -0.115, -0.552 ], "z_axis": [ -0.345, 0.671, -0.656 ], "quaternion": [ -0.411, 0.745, 0.523, 0.057 ] } }, { "index": 12, "index_chain": 12, "chain_name": "D", "nt_resnum": 14, "nt_name": "G", "nt_code": "G", "nt_id": "///D/14", "linked_nts": [ null, "///D/15" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack", "alpha": null, "beta": null, "gamma": 176.406, "delta": 86.876, "epsilon": -151.411, "zeta": -72.467, "epsilon_zeta": -78.944, "bb_type": "BI", "chi": 162.297, "glyco_bond": "anti", "C5prime_xyz": [ -1.144, 7.724, 2.483 ], "P_xyz": [ null, null, null ], "form": ".", "ssZp": 4.553, "Dp": 4.824, "splay_angle": 24.569, "splay_distance": 4.013, "splay_ratio": 0.236, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": 16.432, "v1": -35.934, "v2": 41.113, "v3": -32.708, "v4": 10.496, "amplitude": 41.220, "phase_angle": 355.859, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.030, "frame": { "rmsd": 0.030, "origin": [ 23.547, 98.655, -8.669 ], "x_axis": [ 0.683, 0.669, 0.292 ], "y_axis": [ 0.672, -0.421, -0.609 ], "z_axis": [ -0.284, 0.613, -0.738 ], "quaternion": [ -0.362, 0.843, 0.398, 0.002 ] } }, { "index": 13, "index_chain": 13, "chain_name": "D", "nt_resnum": 15, "nt_name": "A", "nt_code": "A", "nt_id": "///D/15", "linked_nts": [ "///D/14", "///D/16" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -147.232, "beta": -105.242, "gamma": 75.463, "delta": 78.361, "epsilon": -178.007, "zeta": -105.908, "epsilon_zeta": -72.099, "bb_type": "BI", "chi": -149.679, "glyco_bond": "anti", "C5prime_xyz": [ -2.229, 8.982, -0.271 ], "P_xyz": [ 0.260, 9.374, 0.532 ], "form": ".", "ssZp": 4.130, "Dp": 4.335, "splay_angle": 15.712, "splay_distance": 2.545, "splay_ratio": 0.137, "d22": null, "d64": null, "eta": 142.926, "theta": -142.955, "eta_prime": 162.854, "theta_prime": -145.493, "eta_base": -158.099, "theta_base": -117.435, "v0": -14.501, "v1": -12.307, "v2": 32.661, "v3": -40.927, "v4": 35.262, "amplitude": 41.417, "phase_angle": 37.946, "puckering": "C4'-exo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.043, "frame": { "rmsd": 0.017, "origin": [ 22.602, 102.554, -8.564 ], "x_axis": [ 0.997, -0.070, 0.026 ], "y_axis": [ -0.025, -0.651, -0.758 ], "z_axis": [ 0.070, 0.756, -0.651 ], "quaternion": [ -0.417, 0.908, -0.026, 0.027 ] } }, { "index": 14, "index_chain": 14, "chain_name": "D", "nt_resnum": 16, "nt_name": "C", "nt_code": "C", "nt_id": "///D/16", "linked_nts": [ "///D/15", "///D/17" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": 167.571, "beta": -115.770, "gamma": 148.733, "delta": 72.900, "epsilon": -153.388, "zeta": -79.442, "epsilon_zeta": -73.946, "bb_type": "BI", "chi": -154.969, "glyco_bond": "anti", "C5prime_xyz": [ -2.107, 9.095, 0.038 ], "P_xyz": [ -0.180, 9.212, -1.703 ], "form": ".", "ssZp": 4.122, "Dp": 4.436, "splay_angle": 28.936, "splay_distance": 4.712, "splay_ratio": 0.250, "d22": 4.577, "d64": 4.325, "eta": 160.991, "theta": -156.692, "eta_prime": 178.456, "theta_prime": -167.417, "eta_base": -140.021, "theta_base": -146.508, "v0": -14.976, "v1": -13.495, "v2": 35.220, "v3": -44.697, "v4": 37.662, "amplitude": 44.526, "phase_angle": 37.720, "puckering": "C4'-exo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.060, "frame": { "rmsd": 0.008, "origin": [ 23.668, 104.642, -9.552 ], "x_axis": [ 0.889, -0.338, -0.308 ], "y_axis": [ -0.397, -0.237, -0.887 ], "z_axis": [ 0.227, 0.911, -0.345 ], "quaternion": [ 0.572, -0.786, 0.234, 0.026 ] } }, { "index": 15, "index_chain": 15, "chain_name": "D", "nt_resnum": 17, "nt_name": "U", "nt_code": "U", "nt_id": "///D/17", "linked_nts": [ "///D/16", "///D/18" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -70.716, "beta": 178.630, "gamma": 52.215, "delta": 78.502, "epsilon": -128.589, "zeta": -70.358, "epsilon_zeta": -58.231, "bb_type": "BI", "chi": -161.717, "glyco_bond": "anti", "C5prime_xyz": [ -1.274, 8.730, 0.660 ], "P_xyz": [ 1.323, 9.208, 1.052 ], "form": ".", "ssZp": 4.405, "Dp": 4.746, "splay_angle": 24.090, "splay_distance": 3.855, "splay_ratio": 0.209, "d22": null, "d64": null, "eta": 172.227, "theta": -134.862, "eta_prime": 175.823, "theta_prime": -130.695, "eta_base": -153.060, "theta_base": -87.893, "v0": 8.256, "v1": -30.695, "v2": 40.459, "v3": -37.017, "v4": 18.292, "amplitude": 40.807, "phase_angle": 7.484, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.755, "filter_rmsd": 0.105, "frame": { "rmsd": 0.010, "origin": [ 25.450, 108.840, -10.741 ], "x_axis": [ 0.442, -0.732, -0.518 ], "y_axis": [ -0.830, -0.115, -0.546 ], "z_axis": [ 0.340, 0.671, -0.659 ], "quaternion": [ -0.409, 0.744, -0.525, -0.060 ] } }, { "index": 16, "index_chain": 16, "chain_name": "D", "nt_resnum": 18, "nt_name": "G", "nt_code": "G", "nt_id": "///D/18", "linked_nts": [ "///D/17", "///D/19" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -76.853, "beta": 153.675, "gamma": 74.179, "delta": 78.741, "epsilon": -156.047, "zeta": -76.782, "epsilon_zeta": -79.266, "bb_type": "BI", "chi": -161.688, "glyco_bond": "anti", "C5prime_xyz": [ -1.396, 8.779, 0.632 ], "P_xyz": [ 1.050, 9.237, -0.395 ], "form": "A", "ssZp": 4.565, "Dp": 4.714, "splay_angle": 29.048, "splay_distance": 4.475, "splay_ratio": 0.252, "d22": null, "d64": null, "eta": 156.042, "theta": -151.117, "eta_prime": -177.843, "theta_prime": -159.274, "eta_base": -114.257, "theta_base": -143.554, "v0": 10.000, "v1": -34.030, "v2": 44.213, "v3": -39.368, "v4": 18.724, "amplitude": 44.449, "phase_angle": 5.900, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.271, "filter_rmsd": 0.011, "frame": { "rmsd": 0.011, "origin": [ 27.601, 108.993, -13.936 ], "x_axis": [ -0.206, -0.644, -0.736 ], "y_axis": [ -0.831, 0.512, -0.216 ], "z_axis": [ 0.516, 0.568, -0.641 ], "quaternion": [ 0.408, -0.480, 0.768, 0.115 ] } }, { "index": 17, "index_chain": 17, "chain_name": "D", "nt_resnum": 19, "nt_name": "G", "nt_code": "G", "nt_id": "///D/19", "linked_nts": [ "///D/18", "///D/20" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -120.252, "beta": -178.348, "gamma": 88.906, "delta": 72.681, "epsilon": -137.723, "zeta": -112.189, "epsilon_zeta": -25.534, "bb_type": "--", "chi": 166.349, "glyco_bond": "anti", "C5prime_xyz": [ -1.664, 8.052, 2.410 ], "P_xyz": [ 0.958, 8.632, 2.690 ], "form": ".", "ssZp": 4.729, "Dp": 4.837, "splay_angle": 28.532, "splay_distance": 4.574, "splay_ratio": 0.268, "d22": null, "d64": null, "eta": 153.884, "theta": -148.924, "eta_prime": 160.356, "theta_prime": -145.280, "eta_base": -164.406, "theta_base": -138.410, "v0": 13.583, "v1": -40.005, "v2": 50.285, "v3": -43.226, "v4": 18.902, "amplitude": 50.361, "phase_angle": 3.158, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.014, "frame": { "rmsd": 0.014, "origin": [ 31.133, 110.327, -16.337 ], "x_axis": [ -0.746, -0.591, -0.308 ], "y_axis": [ -0.665, 0.682, 0.305 ], "z_axis": [ 0.030, 0.432, -0.901 ], "quaternion": [ 0.092, -0.344, 0.912, 0.202 ] } }, { "index": 18, "index_chain": 18, "chain_name": "D", "nt_resnum": 20, "nt_name": "A", "nt_code": "A", "nt_id": "///D/20", "linked_nts": [ "///D/19", "///D/21" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -168.716, "beta": -143.156, "gamma": 140.778, "delta": 78.456, "epsilon": -130.705, "zeta": -115.498, "epsilon_zeta": -15.207, "bb_type": "--", "chi": -174.717, "glyco_bond": "anti", "C5prime_xyz": [ -1.565, 8.576, 1.409 ], "P_xyz": [ 0.789, 9.413, 0.550 ], "form": "A", "ssZp": 4.682, "Dp": 4.734, "splay_angle": 23.486, "splay_distance": 3.681, "splay_ratio": 0.206, "d22": null, "d64": null, "eta": 167.227, "theta": -136.702, "eta_prime": 170.133, "theta_prime": -144.241, "eta_base": -176.392, "theta_base": -108.970, "v0": 4.916, "v1": -30.907, "v2": 43.510, "v3": -41.934, "v4": 23.336, "amplitude": 44.549, "phase_angle": 12.402, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.042, "frame": { "rmsd": 0.013, "origin": [ 33.778, 109.006, -19.827 ], "x_axis": [ -0.956, -0.282, 0.076 ], "y_axis": [ -0.257, 0.937, 0.238 ], "z_axis": [ -0.138, 0.208, -0.968 ], "quaternion": [ -0.054, -0.137, 0.983, 0.113 ] } }, { "index": 19, "index_chain": 19, "chain_name": "D", "nt_resnum": 21, "nt_name": "A", "nt_code": "A", "nt_id": "///D/21", "linked_nts": [ "///D/20", "///D/22" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": 127.263, "beta": -120.553, "gamma": 178.236, "delta": 83.838, "epsilon": -125.555, "zeta": -96.855, "epsilon_zeta": -28.700, "bb_type": "--", "chi": 176.048, "glyco_bond": "anti", "C5prime_xyz": [ -1.141, 7.990, 1.968 ], "P_xyz": [ 0.562, 9.192, 0.394 ], "form": ".", "ssZp": 4.870, "Dp": 4.869, "splay_angle": 31.900, "splay_distance": 4.624, "splay_ratio": 0.275, "d22": null, "d64": null, "eta": 161.678, "theta": -168.896, "eta_prime": -178.301, "theta_prime": -170.509, "eta_base": -118.925, "theta_base": -152.381, "v0": 18.788, "v1": -38.734, "v2": 43.391, "v3": -33.470, "v4": 9.506, "amplitude": 43.648, "phase_angle": 353.783, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.039, "frame": { "rmsd": 0.009, "origin": [ 31.803, 108.231, -22.836 ], "x_axis": [ -0.935, 0.343, 0.090 ], "y_axis": [ 0.346, 0.938, 0.017 ], "z_axis": [ -0.078, 0.047, -0.996 ], "quaternion": [ -0.043, 0.175, 0.983, 0.016 ] } }, { "index": 20, "index_chain": 20, "chain_name": "D", "nt_resnum": 22, "nt_name": "G", "nt_code": "G", "nt_id": "///D/22", "linked_nts": [ "///D/21", "///D/23" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop", "alpha": -59.742, "beta": 140.390, "gamma": 74.819, "delta": 87.595, "epsilon": -119.718, "zeta": -81.302, "epsilon_zeta": -38.416, "bb_type": "--", "chi": 166.636, "glyco_bond": "anti", "C5prime_xyz": [ -1.491, 7.856, 2.439 ], "P_xyz": [ 1.176, 8.040, 2.326 ], "form": ".", "ssZp": 4.685, "Dp": 4.763, "splay_angle": 24.802, "splay_distance": 4.195, "splay_ratio": 0.227, "d22": null, "d64": null, "eta": -178.192, "theta": -87.536, "eta_prime": -166.317, "theta_prime": -101.427, "eta_base": -136.438, "theta_base": -60.628, "v0": 14.860, "v1": -32.464, "v2": 36.442, "v3": -28.638, "v4": 8.951, "amplitude": 36.579, "phase_angle": 355.039, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1L", "suiteness": 0.604, "filter_rmsd": 0.010, "frame": { "rmsd": 0.010, "origin": [ 31.445, 106.284, -27.014 ], "x_axis": [ -0.702, 0.707, 0.086 ], "y_axis": [ 0.710, 0.685, 0.165 ], "z_axis": [ 0.058, 0.177, -0.982 ], "quaternion": [ -0.008, 0.386, 0.918, 0.093 ] } }, { "index": 21, "index_chain": 21, "chain_name": "D", "nt_resnum": 23, "nt_name": "C", "nt_code": "C", "nt_id": "///D/23", "linked_nts": [ "///D/22", "///D/24" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-canonical,non-pair-contact,helix,internal-loop", "alpha": 154.253, "beta": -144.640, "gamma": 167.424, "delta": 84.942, "epsilon": -123.187, "zeta": -119.943, "epsilon_zeta": -3.244, "bb_type": "--", "chi": -153.404, "glyco_bond": "anti", "C5prime_xyz": [ -1.652, 8.954, 0.083 ], "P_xyz": [ -0.203, 9.740, -1.989 ], "form": ".", "ssZp": 4.009, "Dp": 4.557, "splay_angle": 35.620, "splay_distance": 5.742, "splay_ratio": 0.312, "d22": 5.190, "d64": 4.487, "eta": 151.521, "theta": 176.888, "eta_prime": -176.094, "theta_prime": -172.821, "eta_base": -103.565, "theta_base": -149.481, "v0": -0.854, "v1": -22.608, "v2": 35.694, "v3": -37.064, "v4": 24.205, "amplitude": 37.933, "phase_angle": 19.784, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.112, "filter_rmsd": 0.068, "frame": { "rmsd": 0.010, "origin": [ 29.121, 109.113, -29.062 ], "x_axis": [ 0.070, 0.994, -0.079 ], "y_axis": [ 0.916, -0.095, -0.390 ], "z_axis": [ -0.396, -0.045, -0.917 ], "quaternion": [ -0.120, 0.722, 0.662, -0.165 ] } }, { "index": 22, "index_chain": 22, "chain_name": "D", "nt_resnum": 24, "nt_name": "U", "nt_code": "U", "nt_id": "///D/24", "linked_nts": [ "///D/23", null ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,isolated-canonical,non-pair-contact,helix-end,internal-loop", "alpha": -44.767, "beta": 157.212, "gamma": 40.685, "delta": 98.988, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": -150.757, "glyco_bond": "anti", "C5prime_xyz": [ -1.263, 8.685, 0.164 ], "P_xyz": [ 1.347, 8.501, 0.634 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": 6.642, "v1": -19.959, "v2": 25.115, "v3": -21.978, "v4": 9.715, "amplitude": 25.170, "phase_angle": 3.769, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "7a", "suiteness": 0.241, "filter_rmsd": 0.113, "frame": { "rmsd": 0.014, "origin": [ 27.341, 108.865, -34.515 ], "x_axis": [ 0.580, 0.747, 0.326 ], "y_axis": [ 0.810, -0.570, -0.134 ], "z_axis": [ 0.086, 0.341, -0.936 ], "quaternion": [ -0.135, 0.878, 0.443, 0.117 ] } }, { "index": 23, "index_chain": 1, "chain_name": "E", "nt_resnum": 40, "nt_name": "G", "nt_code": "G", "nt_id": "///E/40", "linked_nts": [ null, "///E/41" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,isolated-canonical,non-pair-contact,helix-end,internal-loop", "alpha": null, "beta": null, "gamma": -165.847, "delta": 80.270, "epsilon": -144.674, "zeta": -63.040, "epsilon_zeta": -81.634, "bb_type": "BI", "chi": 159.392, "glyco_bond": "anti", "C5prime_xyz": [ -1.665, 7.700, 2.691 ], "P_xyz": [ null, null, null ], "form": ".", "ssZp": 4.530, "Dp": 4.775, "splay_angle": 36.164, "splay_distance": 5.124, "splay_ratio": 0.314, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": 9.953, "v1": -32.964, "v2": 42.396, "v3": -37.447, "v4": 17.645, "amplitude": 42.581, "phase_angle": 5.331, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.009, "frame": { "rmsd": 0.009, "origin": [ 26.458, 107.711, -35.222 ], "x_axis": [ 0.682, 0.663, 0.310 ], "y_axis": [ -0.710, 0.499, 0.496 ], "z_axis": [ 0.174, -0.558, 0.811 ], "quaternion": [ 0.865, 0.305, -0.039, 0.397 ] } }, { "index": 24, "index_chain": 2, "chain_name": "E", "nt_resnum": 41, "nt_name": "G", "nt_code": "G", "nt_id": "///E/41", "linked_nts": [ "///E/40", "///E/42" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop", "alpha": -126.759, "beta": -128.121, "gamma": 68.928, "delta": 79.273, "epsilon": -152.751, "zeta": -76.280, "epsilon_zeta": -76.471, "bb_type": "BI", "chi": -172.043, "glyco_bond": "anti", "C5prime_xyz": [ -1.483, 8.605, 1.180 ], "P_xyz": [ 0.947, 8.246, 2.152 ], "form": ".", "ssZp": 4.681, "Dp": 4.696, "splay_angle": 32.175, "splay_distance": 4.808, "splay_ratio": 0.279, "d22": null, "d64": null, "eta": 149.850, "theta": -145.484, "eta_prime": 168.314, "theta_prime": -142.172, "eta_base": -127.040, "theta_base": -118.985, "v0": 6.030, "v1": -30.998, "v2": 43.054, "v3": -40.803, "v4": 21.891, "amplitude": 43.854, "phase_angle": 10.963, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.011, "frame": { "rmsd": 0.011, "origin": [ 29.321, 107.091, -31.017 ], "x_axis": [ -0.343, 0.880, 0.329 ], "y_axis": [ -0.934, -0.284, -0.216 ], "z_axis": [ -0.097, -0.382, 0.919 ], "quaternion": [ 0.568, 0.073, -0.187, 0.798 ] } }, { "index": 25, "index_chain": 3, "chain_name": "E", "nt_resnum": 42, "nt_name": "C", "nt_code": "C", "nt_id": "///E/42", "linked_nts": [ "///E/41", "///E/43" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop", "alpha": -65.818, "beta": 167.071, "gamma": 70.724, "delta": 80.041, "epsilon": -150.640, "zeta": -54.527, "epsilon_zeta": -96.113, "bb_type": "BI", "chi": 177.864, "glyco_bond": "anti", "C5prime_xyz": [ -1.471, 8.373, 1.837 ], "P_xyz": [ 1.182, 8.619, 1.941 ], "form": ".", "ssZp": 4.721, "Dp": 4.753, "splay_angle": 17.393, "splay_distance": 3.855, "splay_ratio": 0.201, "d22": 5.092, "d64": 5.822, "eta": 179.429, "theta": -112.151, "eta_prime": -167.055, "theta_prime": -128.089, "eta_base": -127.072, "theta_base": -134.692, "v0": 12.927, "v1": -36.827, "v2": 45.142, "v3": -38.390, "v4": 16.447, "amplitude": 45.172, "phase_angle": 2.096, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.508, "filter_rmsd": 0.070, "frame": { "rmsd": 0.013, "origin": [ 30.466, 106.576, -26.376 ], "x_axis": [ -0.785, 0.588, 0.195 ], "y_axis": [ -0.591, -0.615, -0.522 ], "z_axis": [ -0.187, -0.525, 0.831 ], "quaternion": [ 0.328, 0.002, -0.291, 0.899 ] } }, { "index": 26, "index_chain": 4, "chain_name": "E", "nt_resnum": 43, "nt_name": "U", "nt_code": "U", "nt_id": "///E/43", "linked_nts": [ "///E/42", "///E/44" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": 173.669, "beta": 169.151, "gamma": 176.777, "delta": 88.417, "epsilon": -151.092, "zeta": -111.019, "epsilon_zeta": -40.072, "bb_type": "BI", "chi": -167.906, "glyco_bond": "anti", "C5prime_xyz": [ -1.707, 8.806, 0.786 ], "P_xyz": [ -0.744, 10.838, -0.616 ], "form": ".", "ssZp": 4.191, "Dp": 4.220, "splay_angle": 19.796, "splay_distance": 3.250, "splay_ratio": 0.172, "d22": 5.171, "d64": 4.676, "eta": 177.990, "theta": 179.115, "eta_prime": -171.458, "theta_prime": -178.243, "eta_base": -157.646, "theta_base": -165.652, "v0": -11.769, "v1": -9.718, "v2": 25.745, "v3": -33.507, "v4": 28.696, "amplitude": 33.146, "phase_angle": 39.039, "puckering": "C4'-exo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.453, "filter_rmsd": 0.103, "frame": { "rmsd": 0.008, "origin": [ 31.766, 108.519, -23.312 ], "x_axis": [ -0.947, 0.319, 0.031 ], "y_axis": [ -0.319, -0.925, -0.208 ], "z_axis": [ -0.037, -0.207, 0.978 ], "quaternion": [ 0.163, -0.002, -0.106, 0.981 ] } }, { "index": 27, "index_chain": 5, "chain_name": "E", "nt_resnum": 44, "nt_name": "U", "nt_code": "U", "nt_id": "///E/44", "linked_nts": [ "///E/43", "///E/45" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": 158.041, "beta": -140.265, "gamma": 148.555, "delta": 80.546, "epsilon": -147.951, "zeta": -69.317, "epsilon_zeta": -78.634, "bb_type": "BI", "chi": -161.415, "glyco_bond": "anti", "C5prime_xyz": [ -1.449, 8.845, 0.619 ], "P_xyz": [ 0.601, 9.455, -0.976 ], "form": "A", "ssZp": 4.325, "Dp": 4.525, "splay_angle": 25.671, "splay_distance": 4.073, "splay_ratio": 0.223, "d22": 3.898, "d64": 3.850, "eta": 142.866, "theta": -146.242, "eta_prime": 160.655, "theta_prime": -151.527, "eta_base": -176.660, "theta_base": -119.655, "v0": 0.645, "v1": -25.920, "v2": 40.442, "v3": -40.692, "v4": 25.356, "amplitude": 42.428, "phase_angle": 17.600, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.104, "frame": { "rmsd": 0.009, "origin": [ 33.071, 109.133, -20.399 ], "x_axis": [ -0.993, -0.084, -0.087 ], "y_axis": [ 0.078, -0.995, 0.061 ], "z_axis": [ -0.091, 0.054, 0.994 ], "quaternion": [ -0.041, -0.045, 0.029, 0.998 ] } }, { "index": 28, "index_chain": 6, "chain_name": "E", "nt_resnum": 45, "nt_name": "U", "nt_code": "U", "nt_id": "///E/45", "linked_nts": [ "///E/44", "///E/46" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -80.756, "beta": 172.475, "gamma": 66.339, "delta": 83.453, "epsilon": -149.877, "zeta": -73.933, "epsilon_zeta": -75.944, "bb_type": "BI", "chi": -168.000, "glyco_bond": "anti", "C5prime_xyz": [ -1.490, 8.732, 1.004 ], "P_xyz": [ 1.127, 9.161, 1.042 ], "form": "A", "ssZp": 4.575, "Dp": 4.605, "splay_angle": 25.028, "splay_distance": 3.907, "splay_ratio": 0.217, "d22": 4.464, "d64": 4.133, "eta": 164.762, "theta": -141.958, "eta_prime": -179.235, "theta_prime": -138.007, "eta_base": -129.363, "theta_base": -104.355, "v0": 0.734, "v1": -23.718, "v2": 36.443, "v3": -36.837, "v4": 22.911, "amplitude": 38.205, "phase_angle": 17.468, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.606, "filter_rmsd": 0.103, "frame": { "rmsd": 0.011, "origin": [ 30.859, 109.780, -17.040 ], "x_axis": [ -0.675, -0.680, -0.288 ], "y_axis": [ 0.683, -0.723, 0.106 ], "z_axis": [ -0.280, -0.125, 0.952 ], "quaternion": [ -0.372, -0.155, -0.005, 0.915 ] } }, { "index": 29, "index_chain": 7, "chain_name": "E", "nt_resnum": 46, "nt_name": "C", "nt_code": "C", "nt_id": "///E/46", "linked_nts": [ "///E/45", "///E/47" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -83.358, "beta": -176.579, "gamma": 65.794, "delta": 91.354, "epsilon": -143.615, "zeta": -69.849, "epsilon_zeta": -73.766, "bb_type": "BI", "chi": -151.166, "glyco_bond": "anti", "C5prime_xyz": [ -1.539, 8.877, 0.107 ], "P_xyz": [ 1.120, 9.054, 0.192 ], "form": ".", "ssZp": 4.006, "Dp": 4.372, "splay_angle": 26.961, "splay_distance": 4.479, "splay_ratio": 0.233, "d22": null, "d64": null, "eta": 174.259, "theta": -132.520, "eta_prime": -171.499, "theta_prime": -144.526, "eta_base": -127.819, "theta_base": -133.998, "v0": 1.643, "v1": -21.179, "v2": 31.848, "v3": -31.982, "v4": 19.078, "amplitude": 33.144, "phase_angle": 16.071, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.460, "filter_rmsd": 0.069, "frame": { "rmsd": 0.014, "origin": [ 28.257, 108.731, -14.321 ], "x_axis": [ -0.007, -0.949, -0.315 ], "y_axis": [ 0.914, -0.134, 0.383 ], "z_axis": [ -0.406, -0.285, 0.868 ], "quaternion": [ 0.657, 0.254, -0.035, -0.709 ] } }, { "index": 30, "index_chain": 8, "chain_name": "E", "nt_resnum": 47, "nt_name": "A", "nt_code": "A", "nt_id": "///E/47", "linked_nts": [ "///E/46", "///E/48" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -139.924, "beta": 142.289, "gamma": 121.883, "delta": 88.723, "epsilon": -158.788, "zeta": -77.822, "epsilon_zeta": -80.966, "bb_type": "BI", "chi": -171.954, "glyco_bond": "anti", "C5prime_xyz": [ -1.025, 8.315, 1.325 ], "P_xyz": [ 0.812, 9.502, -0.199 ], "form": "A", "ssZp": 4.626, "Dp": 4.622, "splay_angle": 21.677, "splay_distance": 3.458, "splay_ratio": 0.194, "d22": null, "d64": null, "eta": 149.905, "theta": -142.258, "eta_prime": 166.104, "theta_prime": -151.558, "eta_base": -162.987, "theta_base": -125.379, "v0": 16.230, "v1": -32.500, "v2": 35.804, "v3": -27.612, "v4": 7.361, "amplitude": 36.082, "phase_angle": 352.884, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.039, "frame": { "rmsd": 0.011, "origin": [ 25.669, 107.896, -10.762 ], "x_axis": [ 0.436, -0.819, -0.373 ], "y_axis": [ 0.847, 0.233, 0.477 ], "z_axis": [ -0.304, -0.524, 0.796 ], "quaternion": [ 0.785, 0.319, 0.022, -0.531 ] } }, { "index": 31, "index_chain": 9, "chain_name": "E", "nt_resnum": 48, "nt_name": "G", "nt_code": "G", "nt_id": "///E/48", "linked_nts": [ "///E/47", "///E/49" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": 177.821, "beta": -158.358, "gamma": 149.330, "delta": 89.064, "epsilon": -112.834, "zeta": -92.095, "epsilon_zeta": -20.739, "bb_type": "--", "chi": -171.772, "glyco_bond": "anti", "C5prime_xyz": [ -1.297, 8.419, 1.366 ], "P_xyz": [ 0.912, 9.300, 0.298 ], "form": ".", "ssZp": 4.514, "Dp": 4.692, "splay_angle": 13.076, "splay_distance": 2.127, "splay_ratio": 0.114, "d22": null, "d64": null, "eta": 168.848, "theta": -145.806, "eta_prime": -174.520, "theta_prime": -147.549, "eta_base": -130.908, "theta_base": -129.667, "v0": 13.063, "v1": -32.138, "v2": 37.684, "v3": -31.191, "v4": 11.742, "amplitude": 37.692, "phase_angle": 358.880, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.016, "filter_rmsd": 0.015, "frame": { "rmsd": 0.015, "origin": [ 23.974, 105.045, -9.784 ], "x_axis": [ 0.833, -0.553, 0.018 ], "y_axis": [ 0.370, 0.580, 0.726 ], "z_axis": [ -0.412, -0.598, 0.688 ], "quaternion": [ 0.880, 0.376, -0.122, -0.262 ] } }, { "index": 32, "index_chain": 10, "chain_name": "E", "nt_resnum": 49, "nt_name": "U", "nt_code": "U", "nt_id": "///E/49", "linked_nts": [ "///E/48", "///E/50" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -61.200, "beta": 144.065, "gamma": 53.203, "delta": 73.084, "epsilon": -137.009, "zeta": -34.167, "epsilon_zeta": -102.842, "bb_type": "--", "chi": -142.074, "glyco_bond": "anti", "C5prime_xyz": [ -1.810, 8.898, -0.537 ], "P_xyz": [ 0.565, 9.219, -1.665 ], "form": ".", "ssZp": 3.561, "Dp": 4.731, "splay_angle": 24.778, "splay_distance": 4.468, "splay_ratio": 0.222, "d22": 3.840, "d64": 4.987, "eta": 151.616, "theta": -122.598, "eta_prime": 168.126, "theta_prime": -138.506, "eta_base": -157.958, "theta_base": -134.937, "v0": -3.421, "v1": -24.290, "v2": 41.271, "v3": -44.099, "v4": 30.248, "amplitude": 44.779, "phase_angle": 22.832, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1L", "suiteness": 0.776, "filter_rmsd": 0.101, "frame": { "rmsd": 0.008, "origin": [ 23.152, 103.214, -9.078 ], "x_axis": [ 0.897, -0.251, 0.365 ], "y_axis": [ -0.235, 0.427, 0.873 ], "z_axis": [ -0.375, -0.869, 0.324 ], "quaternion": [ 0.814, 0.535, -0.227, -0.005 ] } }, { "index": 33, "index_chain": 11, "chain_name": "E", "nt_resnum": 50, "nt_name": "C", "nt_code": "C", "nt_id": "///E/50", "linked_nts": [ "///E/49", "///E/51" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,phosphate", "alpha": -130.931, "beta": 99.072, "gamma": 158.851, "delta": 91.032, "epsilon": -144.367, "zeta": -62.309, "epsilon_zeta": -82.057, "bb_type": "BI", "chi": -170.119, "glyco_bond": "anti", "C5prime_xyz": [ -1.134, 8.511, 1.232 ], "P_xyz": [ -1.116, 10.581, -0.409 ], "form": "A", "ssZp": 4.518, "Dp": 4.537, "splay_angle": 27.587, "splay_distance": 4.369, "splay_ratio": 0.241, "d22": null, "d64": null, "eta": -179.929, "theta": 175.753, "eta_prime": -178.019, "theta_prime": -170.295, "eta_base": -157.900, "theta_base": -129.051, "v0": 7.499, "v1": -25.664, "v2": 33.652, "v3": -30.144, "v4": 14.385, "amplitude": 33.854, "phase_angle": 6.263, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1e", "suiteness": 0.023, "filter_rmsd": 0.065, "frame": { "rmsd": 0.020, "origin": [ 23.771, 98.835, -8.440 ], "x_axis": [ 0.910, 0.194, 0.368 ], "y_axis": [ -0.414, 0.494, 0.764 ], "z_axis": [ -0.034, -0.847, 0.530 ], "quaternion": [ 0.856, 0.471, -0.117, 0.178 ] } }, { "index": 34, "index_chain": 12, "chain_name": "E", "nt_resnum": 51, "nt_name": "G", "nt_code": "G", "nt_id": "///E/51", "linked_nts": [ "///E/50", "///E/52" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack", "alpha": -81.868, "beta": -179.592, "gamma": 58.540, "delta": 81.776, "epsilon": -138.654, "zeta": -85.183, "epsilon_zeta": -53.470, "bb_type": "BI", "chi": 178.952, "glyco_bond": "anti", "C5prime_xyz": [ -1.704, 8.518, 1.584 ], "P_xyz": [ 0.804, 9.102, 2.123 ], "form": "A", "ssZp": 4.861, "Dp": 4.804, "splay_angle": 22.213, "splay_distance": 3.404, "splay_ratio": 0.195, "d22": null, "d64": null, "eta": 160.747, "theta": -151.676, "eta_prime": 178.320, "theta_prime": -146.385, "eta_base": -127.930, "theta_base": -111.823, "v0": -0.700, "v1": -26.051, "v2": 40.144, "v3": -42.193, "v4": 27.546, "amplitude": 42.656, "phase_angle": 19.762, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.592, "filter_rmsd": 0.022, "frame": { "rmsd": 0.022, "origin": [ 25.924, 95.618, -6.415 ], "x_axis": [ 0.434, 0.649, 0.626 ], "y_axis": [ -0.900, 0.343, 0.269 ], "z_axis": [ -0.040, -0.680, 0.732 ], "quaternion": [ 0.792, 0.299, -0.210, 0.489 ] } }, { "index": 35, "index_chain": 13, "chain_name": "E", "nt_resnum": 52, "nt_name": "G", "nt_code": "G", "nt_id": "///E/52", "linked_nts": [ "///E/51", "///E/53" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -69.138, "beta": 161.685, "gamma": 62.747, "delta": 84.203, "epsilon": -143.143, "zeta": -80.613, "epsilon_zeta": -62.531, "bb_type": "BI", "chi": -166.233, "glyco_bond": "anti", "C5prime_xyz": [ -1.408, 8.660, 0.939 ], "P_xyz": [ 1.142, 8.898, 0.700 ], "form": "A", "ssZp": 4.556, "Dp": 4.674, "splay_angle": 22.184, "splay_distance": 3.456, "splay_ratio": 0.193, "d22": null, "d64": null, "eta": 169.843, "theta": -142.535, "eta_prime": -176.209, "theta_prime": -143.618, "eta_base": -128.982, "theta_base": -118.224, "v0": 7.475, "v1": -32.155, "v2": 42.910, "v3": -40.164, "v4": 20.659, "amplitude": 43.459, "phase_angle": 9.117, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.717, "filter_rmsd": 0.019, "frame": { "rmsd": 0.019, "origin": [ 27.634, 93.984, -3.967 ], "x_axis": [ -0.196, 0.690, 0.697 ], "y_axis": [ -0.974, -0.217, -0.059 ], "z_axis": [ 0.111, -0.690, 0.715 ], "quaternion": [ 0.571, 0.277, -0.257, 0.729 ] } }, { "index": 36, "index_chain": 14, "chain_name": "E", "nt_resnum": 53, "nt_name": "A", "nt_code": "A", "nt_id": "///E/53", "linked_nts": [ "///E/52", "///E/54" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -62.603, "beta": 173.726, "gamma": 50.673, "delta": 81.947, "epsilon": -160.227, "zeta": -96.872, "epsilon_zeta": -63.355, "bb_type": "BI", "chi": -153.612, "glyco_bond": "anti", "C5prime_xyz": [ -1.287, 8.735, 0.141 ], "P_xyz": [ 1.334, 8.985, 0.145 ], "form": "A", "ssZp": 4.257, "Dp": 4.599, "splay_angle": 20.590, "splay_distance": 3.286, "splay_ratio": 0.179, "d22": null, "d64": null, "eta": 169.886, "theta": -139.567, "eta_prime": -177.639, "theta_prime": -145.014, "eta_base": -136.603, "theta_base": -122.080, "v0": 3.394, "v1": -27.979, "v2": 40.233, "v3": -39.564, "v4": 22.917, "amplitude": 41.484, "phase_angle": 14.102, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.911, "filter_rmsd": 0.034, "frame": { "rmsd": 0.006, "origin": [ 28.827, 92.766, -0.960 ], "x_axis": [ -0.731, 0.484, 0.481 ], "y_axis": [ -0.663, -0.672, -0.330 ], "z_axis": [ 0.164, -0.560, 0.812 ], "quaternion": [ 0.320, 0.180, -0.248, 0.896 ] } }, { "index": 37, "index_chain": 15, "chain_name": "E", "nt_resnum": 54, "nt_name": "U", "nt_code": "U", "nt_id": "///E/54", "linked_nts": [ "///E/53", "///E/55" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": 152.219, "beta": -141.631, "gamma": 166.378, "delta": 87.351, "epsilon": -125.755, "zeta": -80.035, "epsilon_zeta": -45.720, "bb_type": "--", "chi": -169.840, "glyco_bond": "anti", "C5prime_xyz": [ -1.162, 8.392, 1.299 ], "P_xyz": [ 0.797, 9.262, -0.186 ], "form": "A", "ssZp": 4.364, "Dp": 4.533, "splay_angle": 23.301, "splay_distance": 3.714, "splay_ratio": 0.203, "d22": null, "d64": null, "eta": 166.152, "theta": -145.961, "eta_prime": -179.194, "theta_prime": -147.844, "eta_base": -139.119, "theta_base": -117.343, "v0": 10.877, "v1": -30.045, "v2": 37.190, "v3": -32.601, "v4": 13.481, "amplitude": 37.227, "phase_angle": 2.581, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.333, "filter_rmsd": 0.109, "frame": { "rmsd": 0.013, "origin": [ 29.311, 92.201, 2.240 ], "x_axis": [ -0.967, 0.169, 0.191 ], "y_axis": [ -0.231, -0.899, -0.372 ], "z_axis": [ 0.108, -0.403, 0.909 ], "quaternion": [ 0.103, 0.077, -0.199, 0.971 ] } }, { "index": 38, "index_chain": 16, "chain_name": "E", "nt_resnum": 55, "nt_name": "G", "nt_code": "G", "nt_id": "///E/55", "linked_nts": [ "///E/54", "///E/56" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -56.618, "beta": 161.932, "gamma": 53.142, "delta": 79.227, "epsilon": -155.928, "zeta": -78.482, "epsilon_zeta": -77.445, "bb_type": "BI", "chi": -167.595, "glyco_bond": "anti", "C5prime_xyz": [ -1.451, 8.811, 0.890 ], "P_xyz": [ 1.255, 9.226, 0.932 ], "form": "A", "ssZp": 4.580, "Dp": 4.609, "splay_angle": 21.408, "splay_distance": 3.334, "splay_ratio": 0.187, "d22": null, "d64": null, "eta": 158.834, "theta": -156.506, "eta_prime": 179.287, "theta_prime": -154.468, "eta_base": -129.392, "theta_base": -138.793, "v0": -2.515, "v1": -21.881, "v2": 36.799, "v3": -38.069, "v4": 25.917, "amplitude": 39.552, "phase_angle": 21.503, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.628, "filter_rmsd": 0.033, "frame": { "rmsd": 0.033, "origin": [ 28.381, 92.001, 5.831 ], "x_axis": [ -0.909, -0.367, -0.198 ], "y_axis": [ 0.416, -0.829, -0.374 ], "z_axis": [ -0.027, -0.423, 0.906 ], "quaternion": [ -0.205, -0.059, -0.209, 0.954 ] } }, { "index": 39, "index_chain": 17, "chain_name": "E", "nt_resnum": 56, "nt_name": "U", "nt_code": "U", "nt_id": "///E/56", "linked_nts": [ "///E/55", "///E/57" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -66.163, "beta": 174.317, "gamma": 54.945, "delta": 88.494, "epsilon": -157.797, "zeta": -80.913, "epsilon_zeta": -76.884, "bb_type": "BI", "chi": -155.560, "glyco_bond": "anti", "C5prime_xyz": [ -1.559, 8.656, 0.237 ], "P_xyz": [ 1.046, 9.058, 0.224 ], "form": "A", "ssZp": 4.207, "Dp": 4.467, "splay_angle": 25.706, "splay_distance": 4.010, "splay_ratio": 0.223, "d22": 4.274, "d64": 4.480, "eta": 169.932, "theta": -147.351, "eta_prime": -177.554, "theta_prime": -149.150, "eta_base": -149.859, "theta_base": -125.896, "v0": 0.813, "v1": -24.971, "v2": 39.026, "v3": -39.705, "v4": 24.045, "amplitude": 40.929, "phase_angle": 17.542, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.806, "filter_rmsd": 0.104, "frame": { "rmsd": 0.015, "origin": [ 27.654, 92.263, 9.074 ], "x_axis": [ -0.648, -0.682, -0.340 ], "y_axis": [ 0.746, -0.658, -0.100 ], "z_axis": [ -0.156, -0.319, 0.935 ], "quaternion": [ -0.397, -0.138, -0.116, 0.900 ] } }, { "index": 40, "index_chain": 18, "chain_name": "E", "nt_resnum": 57, "nt_name": "U", "nt_code": "U", "nt_id": "///E/57", "linked_nts": [ "///E/56", "///E/58" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -71.665, "beta": 168.501, "gamma": 65.811, "delta": 81.543, "epsilon": -157.444, "zeta": -76.015, "epsilon_zeta": -81.429, "bb_type": "BI", "chi": -167.995, "glyco_bond": "anti", "C5prime_xyz": [ -1.532, 8.728, 1.006 ], "P_xyz": [ 1.068, 9.072, 0.778 ], "form": "A", "ssZp": 4.546, "Dp": 4.578, "splay_angle": 20.458, "splay_distance": 3.230, "splay_ratio": 0.181, "d22": 4.601, "d64": 4.530, "eta": 170.480, "theta": -149.573, "eta_prime": -176.789, "theta_prime": -151.414, "eta_base": -137.382, "theta_base": -131.094, "v0": -1.073, "v1": -23.643, "v2": 38.800, "v3": -39.293, "v4": 25.570, "amplitude": 41.162, "phase_angle": 19.503, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.631, "filter_rmsd": 0.108, "frame": { "rmsd": 0.031, "origin": [ 25.642, 91.361, 12.424 ], "x_axis": [ -0.163, -0.898, -0.408 ], "y_axis": [ 0.976, -0.207, 0.065 ], "z_axis": [ -0.143, -0.388, 0.911 ], "quaternion": [ 0.621, 0.183, 0.107, -0.755 ] } }, { "index": 41, "index_chain": 19, "chain_name": "E", "nt_resnum": 58, "nt_name": "U", "nt_code": "U", "nt_id": "///E/58", "linked_nts": [ "///E/57", "///E/59" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -65.274, "beta": 167.394, "gamma": 56.442, "delta": 81.011, "epsilon": -165.474, "zeta": -78.284, "epsilon_zeta": -87.191, "bb_type": "BI", "chi": -155.258, "glyco_bond": "anti", "C5prime_xyz": [ -1.289, 8.807, 0.280 ], "P_xyz": [ 1.284, 9.148, 0.198 ], "form": "A", "ssZp": 4.197, "Dp": 4.458, "splay_angle": 23.578, "splay_distance": 3.920, "splay_ratio": 0.208, "d22": null, "d64": null, "eta": 174.030, "theta": -132.802, "eta_prime": -173.724, "theta_prime": -144.723, "eta_base": -139.517, "theta_base": -123.407, "v0": -4.813, "v1": -21.015, "v2": 37.901, "v3": -41.709, "v4": 29.183, "amplitude": 41.859, "phase_angle": 25.119, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.918, "filter_rmsd": 0.099, "frame": { "rmsd": 0.018, "origin": [ 23.518, 90.234, 14.581 ], "x_axis": [ 0.343, -0.898, -0.275 ], "y_axis": [ 0.884, 0.210, 0.418 ], "z_axis": [ -0.318, -0.386, 0.866 ], "quaternion": [ 0.778, 0.259, -0.014, -0.573 ] } }, { "index": 42, "index_chain": 20, "chain_name": "E", "nt_resnum": 59, "nt_name": "G", "nt_code": "G", "nt_id": "///E/59", "linked_nts": [ "///E/58", "///E/60" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": 133.836, "beta": -169.711, "gamma": -171.208, "delta": 95.100, "epsilon": -115.205, "zeta": -81.034, "epsilon_zeta": -34.171, "bb_type": "--", "chi": 173.118, "glyco_bond": "anti", "C5prime_xyz": [ -1.137, 7.725, 2.112 ], "P_xyz": [ 0.632, 9.616, 1.772 ], "form": "A", "ssZp": 4.660, "Dp": 4.695, "splay_angle": 24.064, "splay_distance": 3.776, "splay_ratio": 0.212, "d22": null, "d64": null, "eta": 164.699, "theta": -153.309, "eta_prime": 174.105, "theta_prime": -144.847, "eta_base": -144.641, "theta_base": -107.052, "v0": 15.265, "v1": -30.548, "v2": 33.869, "v3": -26.668, "v4": 6.990, "amplitude": 34.098, "phase_angle": 353.349, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.447, "filter_rmsd": 0.020, "frame": { "rmsd": 0.020, "origin": [ 21.436, 87.682, 16.707 ], "x_axis": [ 0.783, -0.524, -0.334 ], "y_axis": [ 0.621, 0.654, 0.431 ], "z_axis": [ -0.008, -0.545, 0.838 ], "quaternion": [ 0.905, 0.270, 0.090, -0.316 ] } }, { "index": 43, "index_chain": 21, "chain_name": "E", "nt_resnum": 60, "nt_name": "C", "nt_code": "C", "nt_id": "///E/60", "linked_nts": [ "///E/59", "///E/61" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -61.969, "beta": 166.974, "gamma": 52.907, "delta": 77.997, "epsilon": -155.741, "zeta": -67.897, "epsilon_zeta": -87.844, "bb_type": "BI", "chi": -158.739, "glyco_bond": "anti", "C5prime_xyz": [ -1.469, 8.849, 0.547 ], "P_xyz": [ 1.166, 9.169, 0.512 ], "form": "A", "ssZp": 4.456, "Dp": 4.644, "splay_angle": 21.589, "splay_distance": 3.545, "splay_ratio": 0.191, "d22": 4.567, "d64": 4.608, "eta": 158.104, "theta": -143.883, "eta_prime": -179.778, "theta_prime": -142.683, "eta_base": -128.012, "theta_base": -121.827, "v0": 5.325, "v1": -29.135, "v2": 41.787, "v3": -39.597, "v4": 21.469, "amplitude": 42.672, "phase_angle": 11.688, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.264, "filter_rmsd": 0.073, "frame": { "rmsd": 0.022, "origin": [ 21.829, 84.272, 18.279 ], "x_axis": [ 0.997, 0.020, 0.081 ], "y_axis": [ -0.066, 0.778, 0.625 ], "z_axis": [ -0.051, -0.628, 0.777 ], "quaternion": [ 0.942, 0.332, -0.035, 0.023 ] } }, { "index": 44, "index_chain": 22, "chain_name": "E", "nt_resnum": 61, "nt_name": "C", "nt_code": "C", "nt_id": "///E/61", "linked_nts": [ "///E/60", "///E/62" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,splayed-apart", "alpha": -62.439, "beta": 164.330, "gamma": 70.749, "delta": 90.820, "epsilon": -172.992, "zeta": 144.524, "epsilon_zeta": 42.484, "bb_type": "--", "chi": -144.630, "glyco_bond": "anti", "C5prime_xyz": [ -1.634, 8.962, -0.262 ], "P_xyz": [ 0.957, 9.568, -0.572 ], "form": ".", "ssZp": 3.444, "Dp": 3.734, "splay_angle": 130.097, "splay_distance": 18.462, "splay_ratio": 0.907, "d22": null, "d64": null, "eta": -178.181, "theta": 25.345, "eta_prime": -157.895, "theta_prime": -52.834, "eta_base": -124.672, "theta_base": -83.184, "v0": -4.706, "v1": -12.419, "v2": 24.598, "v3": -27.523, "v4": 20.098, "amplitude": 27.806, "phase_angle": 27.797, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.418, "filter_rmsd": 0.059, "frame": { "rmsd": 0.028, "origin": [ 22.908, 81.241, 19.767 ], "x_axis": [ 0.836, 0.419, 0.354 ], "y_axis": [ -0.541, 0.521, 0.660 ], "z_axis": [ 0.092, -0.744, 0.662 ], "quaternion": [ 0.869, 0.404, -0.076, 0.276 ] } }, { "index": 45, "index_chain": 23, "chain_name": "E", "nt_resnum": 62, "nt_name": "G", "nt_code": "G", "nt_id": "///E/62", "linked_nts": [ "///E/61", "///E/63" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,anti,~C3'-endo,non-stack,non-pair-contact,ss-non-loop,phosphate,splayed-apart", "alpha": 166.083, "beta": 62.001, "gamma": -172.483, "delta": 77.346, "epsilon": -130.195, "zeta": 93.123, "epsilon_zeta": 136.682, "bb_type": "--", "chi": 176.342, "glyco_bond": "anti", "C5prime_xyz": [ -2.061, 8.739, 1.590 ], "P_xyz": [ -3.424, 10.374, 0.110 ], "form": ".", "ssZp": 4.653, "Dp": 4.576, "splay_angle": 65.721, "splay_distance": 10.113, "splay_ratio": 0.543, "d22": null, "d64": null, "eta": 165.948, "theta": -58.294, "eta_prime": -142.092, "theta_prime": -82.739, "eta_base": -108.308, "theta_base": -105.891, "v0": -11.210, "v1": -18.126, "v2": 38.182, "v3": -43.866, "v4": 37.213, "amplitude": 45.150, "phase_angle": 32.257, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.015, "frame": { "rmsd": 0.015, "origin": [ 15.588, 79.355, 36.611 ], "x_axis": [ -0.666, 0.621, 0.413 ], "y_axis": [ -0.202, 0.382, -0.902 ], "z_axis": [ -0.718, -0.684, -0.129 ], "quaternion": [ -0.383, 0.142, 0.738, -0.537 ] } }, { "index": 46, "index_chain": 24, "chain_name": "E", "nt_resnum": 63, "nt_name": "C", "nt_code": "C", "nt_id": "///E/63", "linked_nts": [ "///E/62", null ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C2'-endo,ss-non-loop,phosphate", "alpha": 172.701, "beta": 126.628, "gamma": 31.074, "delta": 134.096, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": -152.267, "glyco_bond": "anti", "C5prime_xyz": [ -2.008, 8.904, 0.186 ], "P_xyz": [ 0.234, 9.027, 1.490 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": -32.715, "v1": 38.537, "v2": -29.675, "v3": 11.622, "v4": 13.093, "amplitude": 37.934, "phase_angle": 141.471, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "5z", "suiteness": 0.016, "filter_rmsd": 0.066, "frame": { "rmsd": 0.010, "origin": [ 6.276, 78.951, 32.687 ], "x_axis": [ 0.394, -0.454, 0.799 ], "y_axis": [ 0.702, -0.412, -0.581 ], "z_axis": [ 0.593, 0.790, 0.157 ], "quaternion": [ 0.534, -0.642, -0.096, -0.542 ] } }, { "index": 47, "index_chain": 1, "chain_name": "I", "nt_resnum": 1, "nt_name": "G", "nt_code": "G", "nt_id": "///I/1", "linked_nts": [ null, "///I/2" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,cap-acceptor", "alpha": null, "beta": null, "gamma": 53.551, "delta": 94.750, "epsilon": -146.047, "zeta": -69.410, "epsilon_zeta": -76.637, "bb_type": "BI", "chi": -160.528, "glyco_bond": "anti", "C5prime_xyz": [ -1.007, 8.584, 0.646 ], "P_xyz": [ null, null, null ], "form": "A", "ssZp": 4.349, "Dp": 4.539, "splay_angle": 22.597, "splay_distance": 3.699, "splay_ratio": 0.202, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": 25.205, "v1": -38.374, "v2": 39.209, "v3": -26.198, "v4": 1.256, "amplitude": 40.928, "phase_angle": 343.334, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.043, "frame": { "rmsd": 0.043, "origin": [ 33.001, 39.482, 40.865 ], "x_axis": [ 0.324, -0.668, -0.670 ], "y_axis": [ 0.837, 0.532, -0.125 ], "z_axis": [ 0.440, -0.520, 0.732 ], "quaternion": [ 0.804, 0.123, 0.345, -0.468 ] } }, { "index": 48, "index_chain": 2, "chain_name": "I", "nt_resnum": 2, "nt_name": "G", "nt_code": "G", "nt_id": "///I/2", "linked_nts": [ "///I/1", "///I/3" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -65.573, "beta": 156.518, "gamma": 63.368, "delta": 72.625, "epsilon": -151.698, "zeta": -64.288, "epsilon_zeta": -87.410, "bb_type": "BI", "chi": -169.716, "glyco_bond": "anti", "C5prime_xyz": [ -1.693, 8.868, 0.844 ], "P_xyz": [ 0.844, 9.565, 0.529 ], "form": "A", "ssZp": 4.547, "Dp": 4.678, "splay_angle": 23.610, "splay_distance": 3.708, "splay_ratio": 0.208, "d22": null, "d64": null, "eta": 161.785, "theta": -144.406, "eta_prime": -179.335, "theta_prime": -143.815, "eta_base": -134.830, "theta_base": -104.640, "v0": -7.969, "v1": -22.384, "v2": 42.654, "v3": -47.922, "v4": 35.313, "amplitude": 48.159, "phase_angle": 27.665, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.414, "filter_rmsd": 0.022, "frame": { "rmsd": 0.022, "origin": [ 33.501, 36.135, 42.360 ], "x_axis": [ 0.697, -0.263, -0.667 ], "y_axis": [ 0.578, 0.757, 0.306 ], "z_axis": [ 0.424, -0.599, 0.679 ], "quaternion": [ 0.885, 0.256, 0.308, -0.237 ] } }, { "index": 49, "index_chain": 3, "chain_name": "I", "nt_resnum": 3, "nt_name": "U", "nt_code": "U", "nt_id": "///I/3", "linked_nts": [ "///I/2", "///I/4" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -76.216, "beta": 175.843, "gamma": 58.726, "delta": 79.117, "epsilon": -152.842, "zeta": -78.113, "epsilon_zeta": -74.729, "bb_type": "BI", "chi": -161.576, "glyco_bond": "anti", "C5prime_xyz": [ -1.585, 8.668, 0.483 ], "P_xyz": [ 0.924, 9.207, 0.223 ], "form": "A", "ssZp": 4.485, "Dp": 4.718, "splay_angle": 21.412, "splay_distance": 3.299, "splay_ratio": 0.187, "d22": null, "d64": null, "eta": 164.542, "theta": -156.752, "eta_prime": 179.950, "theta_prime": -158.463, "eta_base": -123.378, "theta_base": -138.917, "v0": 1.819, "v1": -32.432, "v2": 49.304, "v3": -49.591, "v4": 30.366, "amplitude": 51.492, "phase_angle": 16.762, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.705, "filter_rmsd": 0.102, "frame": { "rmsd": 0.012, "origin": [ 35.753, 33.193, 42.497 ], "x_axis": [ 0.895, 0.293, -0.336 ], "y_axis": [ 0.076, 0.641, 0.763 ], "z_axis": [ 0.439, -0.709, 0.552 ], "quaternion": [ 0.879, 0.419, 0.221, 0.062 ] } }, { "index": 50, "index_chain": 4, "chain_name": "I", "nt_resnum": 4, "nt_name": "A", "nt_code": "A", "nt_id": "///I/4", "linked_nts": [ "///I/3", "///I/5" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -73.329, "beta": 161.765, "gamma": 67.410, "delta": 82.019, "epsilon": -147.049, "zeta": -76.091, "epsilon_zeta": -70.957, "bb_type": "BI", "chi": -166.372, "glyco_bond": "anti", "C5prime_xyz": [ -1.197, 8.581, 0.922 ], "P_xyz": [ 1.386, 8.885, 0.352 ], "form": "A", "ssZp": 4.676, "Dp": 4.774, "splay_angle": 21.814, "splay_distance": 3.414, "splay_ratio": 0.192, "d22": null, "d64": null, "eta": 167.866, "theta": -144.209, "eta_prime": 177.492, "theta_prime": -146.351, "eta_base": -148.276, "theta_base": -123.786, "v0": 9.468, "v1": -32.937, "v2": 42.297, "v3": -37.968, "v4": 18.205, "amplitude": 42.533, "phase_angle": 6.037, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.621, "filter_rmsd": 0.038, "frame": { "rmsd": 0.018, "origin": [ 37.308, 30.317, 42.943 ], "x_axis": [ 0.790, 0.613, 0.014 ], "y_axis": [ -0.273, 0.331, 0.903 ], "z_axis": [ 0.549, -0.718, 0.428 ], "quaternion": [ 0.798, 0.508, 0.167, 0.277 ] } }, { "index": 51, "index_chain": 5, "chain_name": "I", "nt_resnum": 5, "nt_name": "A", "nt_code": "A", "nt_id": "///I/5", "linked_nts": [ "///I/4", "///I/6" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -64.868, "beta": 166.484, "gamma": 59.312, "delta": 79.962, "epsilon": -176.170, "zeta": -69.080, "epsilon_zeta": -107.090, "bb_type": "BI", "chi": -161.725, "glyco_bond": "anti", "C5prime_xyz": [ -1.260, 8.733, 0.594 ], "P_xyz": [ 1.374, 9.078, 0.331 ], "form": "A", "ssZp": 4.456, "Dp": 4.516, "splay_angle": 23.043, "splay_distance": 3.850, "splay_ratio": 0.209, "d22": null, "d64": null, "eta": 166.626, "theta": -133.309, "eta_prime": -175.390, "theta_prime": -143.530, "eta_base": -131.775, "theta_base": -129.061, "v0": 4.084, "v1": -28.904, "v2": 41.091, "v3": -39.993, "v4": 22.792, "amplitude": 42.216, "phase_angle": 13.258, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.917, "filter_rmsd": 0.040, "frame": { "rmsd": 0.019, "origin": [ 40.157, 28.442, 42.797 ], "x_axis": [ 0.515, 0.701, 0.494 ], "y_axis": [ -0.553, -0.169, 0.816 ], "z_axis": [ 0.655, -0.693, 0.301 ], "quaternion": [ 0.642, 0.588, 0.063, 0.489 ] } }, { "index": 52, "index_chain": 6, "chain_name": "I", "nt_resnum": 6, "nt_name": "A", "nt_code": "A", "nt_id": "///I/6", "linked_nts": [ "///I/5", "///I/7" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": 175.465, "beta": -159.986, "gamma": 151.806, "delta": 80.540, "epsilon": -119.982, "zeta": -92.354, "epsilon_zeta": -27.628, "bb_type": "--", "chi": -168.915, "glyco_bond": "anti", "C5prime_xyz": [ -1.182, 8.515, 1.162 ], "P_xyz": [ 0.776, 9.754, -0.096 ], "form": "A", "ssZp": 4.649, "Dp": 4.848, "splay_angle": 21.446, "splay_distance": 3.418, "splay_ratio": 0.189, "d22": null, "d64": null, "eta": 165.401, "theta": -153.648, "eta_prime": 177.855, "theta_prime": -148.276, "eta_base": -148.525, "theta_base": -112.390, "v0": 10.953, "v1": -34.411, "v2": 42.947, "v3": -38.040, "v4": 17.160, "amplitude": 43.066, "phase_angle": 4.256, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.069, "filter_rmsd": 0.043, "frame": { "rmsd": 0.011, "origin": [ 43.790, 27.248, 42.356 ], "x_axis": [ 0.229, 0.517, 0.825 ], "y_axis": [ -0.624, -0.572, 0.532 ], "z_axis": [ 0.747, -0.636, 0.192 ], "quaternion": [ 0.461, 0.634, -0.042, 0.619 ] } }, { "index": 53, "index_chain": 7, "chain_name": "I", "nt_resnum": 7, "nt_name": "C", "nt_code": "C", "nt_id": "///I/7", "linked_nts": [ "///I/6", "///I/8" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -57.455, "beta": 140.284, "gamma": 69.337, "delta": 82.404, "epsilon": -152.323, "zeta": -79.960, "epsilon_zeta": -72.363, "bb_type": "BI", "chi": -163.077, "glyco_bond": "anti", "C5prime_xyz": [ -1.912, 8.961, 0.638 ], "P_xyz": [ 0.609, 9.324, -0.221 ], "form": "A", "ssZp": 4.438, "Dp": 4.496, "splay_angle": 25.111, "splay_distance": 3.997, "splay_ratio": 0.218, "d22": null, "d64": null, "eta": 162.099, "theta": -142.030, "eta_prime": -173.143, "theta_prime": -148.311, "eta_base": -120.992, "theta_base": -121.791, "v0": -5.597, "v1": -20.381, "v2": 37.237, "v3": -41.357, "v4": 29.365, "amplitude": 41.436, "phase_angle": 26.017, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1L", "suiteness": 0.844, "filter_rmsd": 0.059, "frame": { "rmsd": 0.010, "origin": [ 46.748, 27.229, 44.068 ], "x_axis": [ -0.211, 0.156, 0.965 ], "y_axis": [ -0.438, -0.897, 0.049 ], "z_axis": [ 0.874, -0.413, 0.258 ], "quaternion": [ 0.193, 0.597, -0.118, 0.769 ] } }, { "index": 54, "index_chain": 8, "chain_name": "I", "nt_resnum": 8, "nt_name": "A", "nt_code": "A", "nt_id": "///I/8", "linked_nts": [ "///I/7", "///I/9" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -77.066, "beta": 170.163, "gamma": 64.502, "delta": 83.529, "epsilon": -152.308, "zeta": -84.294, "epsilon_zeta": -68.015, "bb_type": "BI", "chi": -168.116, "glyco_bond": "anti", "C5prime_xyz": [ -1.858, 8.774, 0.978 ], "P_xyz": [ 0.741, 9.212, 1.248 ], "form": "A", "ssZp": 4.260, "Dp": 4.334, "splay_angle": 20.482, "splay_distance": 3.215, "splay_ratio": 0.179, "d22": null, "d64": null, "eta": 165.576, "theta": -153.300, "eta_prime": 179.279, "theta_prime": -154.633, "eta_base": -135.559, "theta_base": -136.167, "v0": -3.016, "v1": -23.589, "v2": 40.627, "v3": -43.484, "v4": 28.446, "amplitude": 43.921, "phase_angle": 22.330, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.701, "filter_rmsd": 0.038, "frame": { "rmsd": 0.014, "origin": [ 50.065, 26.788, 46.254 ], "x_axis": [ -0.668, -0.261, 0.697 ], "y_axis": [ -0.245, -0.808, -0.537 ], "z_axis": [ 0.703, -0.529, 0.476 ], "quaternion": [ -0.005, 0.407, -0.310, 0.859 ] } }, { "index": 55, "index_chain": 9, "chain_name": "I", "nt_resnum": 9, "nt_name": "U", "nt_code": "U", "nt_id": "///I/9", "linked_nts": [ "///I/8", "///I/10" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -69.829, "beta": 171.523, "gamma": 52.685, "delta": 81.696, "epsilon": -147.676, "zeta": -76.975, "epsilon_zeta": -70.701, "bb_type": "BI", "chi": -154.632, "glyco_bond": "anti", "C5prime_xyz": [ -1.487, 8.734, 0.222 ], "P_xyz": [ 1.074, 9.114, -0.046 ], "form": "A", "ssZp": 4.307, "Dp": 4.685, "splay_angle": 22.919, "splay_distance": 3.519, "splay_ratio": 0.199, "d22": 3.914, "d64": 3.839, "eta": 163.833, "theta": -147.537, "eta_prime": 170.987, "theta_prime": -145.056, "eta_base": -157.558, "theta_base": -109.878, "v0": 6.916, "v1": -33.416, "v2": 45.736, "v3": -43.152, "v4": 22.719, "amplitude": 46.482, "phase_angle": 10.284, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.855, "filter_rmsd": 0.106, "frame": { "rmsd": 0.009, "origin": [ 52.562, 26.734, 48.279 ], "x_axis": [ -0.640, -0.654, 0.403 ], "y_axis": [ 0.219, -0.659, -0.720 ], "z_axis": [ 0.736, -0.372, 0.565 ], "quaternion": [ -0.258, 0.337, -0.323, 0.846 ] } }, { "index": 56, "index_chain": 10, "chain_name": "I", "nt_resnum": 10, "nt_name": "C", "nt_code": "C", "nt_id": "///I/10", "linked_nts": [ "///I/9", "///I/11" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -76.501, "beta": 165.996, "gamma": 75.481, "delta": 90.459, "epsilon": -161.940, "zeta": -89.478, "epsilon_zeta": -72.463, "bb_type": "BI", "chi": -160.157, "glyco_bond": "anti", "C5prime_xyz": [ -1.362, 8.710, 0.570 ], "P_xyz": [ 1.198, 8.869, 0.013 ], "form": ".", "ssZp": 4.443, "Dp": 4.510, "splay_angle": 19.796, "splay_distance": 3.122, "splay_ratio": 0.172, "d22": 4.870, "d64": 3.916, "eta": 170.575, "theta": -130.091, "eta_prime": -170.194, "theta_prime": -136.234, "eta_base": -119.386, "theta_base": -122.202, "v0": 5.557, "v1": -25.252, "v2": 33.794, "v3": -31.566, "v4": 16.659, "amplitude": 34.265, "phase_angle": 9.506, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.247, "filter_rmsd": 0.066, "frame": { "rmsd": 0.007, "origin": [ 53.314, 24.746, 51.083 ], "x_axis": [ -0.488, -0.851, -0.196 ], "y_axis": [ 0.673, -0.224, -0.705 ], "z_axis": [ 0.556, -0.476, 0.682 ], "quaternion": [ -0.492, 0.116, -0.381, 0.774 ] } }, { "index": 57, "index_chain": 11, "chain_name": "I", "nt_resnum": 11, "nt_name": "C", "nt_code": "C", "nt_id": "///I/11", "linked_nts": [ "///I/10", null ], "nt_type": "RNA", "dbn": "(", "is_broken": true, "summary": "break,anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack", "alpha": -155.158, "beta": -131.636, "gamma": 109.018, "delta": 86.991, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": -139.169, "glyco_bond": "anti", "C5prime_xyz": [ -1.817, 8.956, -0.687 ], "P_xyz": [ 0.776, 8.918, -1.371 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": -3.686, "v1": -16.574, "v2": 29.276, "v3": -31.975, "v4": 22.577, "amplitude": 32.254, "phase_angle": 24.816, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.071, "frame": { "rmsd": 0.013, "origin": [ 54.126, 23.004, 53.544 ], "x_axis": [ -0.156, -0.665, -0.730 ], "y_axis": [ 0.964, 0.060, -0.261 ], "z_axis": [ 0.217, -0.744, 0.631 ], "quaternion": [ 0.620, 0.195, 0.382, -0.657 ] } }, { "index": 58, "index_chain": 12, "chain_name": "I", "nt_resnum": 14, "nt_name": "G", "nt_code": "G", "nt_id": "///I/14", "linked_nts": [ null, "///I/15" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack", "alpha": null, "beta": null, "gamma": 177.890, "delta": 90.536, "epsilon": -152.691, "zeta": -73.236, "epsilon_zeta": -79.455, "bb_type": "BI", "chi": 164.070, "glyco_bond": "anti", "C5prime_xyz": [ -1.089, 7.706, 2.394 ], "P_xyz": [ null, null, null ], "form": ".", "ssZp": 4.445, "Dp": 4.733, "splay_angle": 24.274, "splay_distance": 3.995, "splay_ratio": 0.236, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": 19.133, "v1": -39.178, "v2": 43.518, "v3": -33.667, "v4": 9.342, "amplitude": 43.802, "phase_angle": 353.482, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.029, "frame": { "rmsd": 0.029, "origin": [ 53.929, 19.330, 57.192 ], "x_axis": [ 0.185, -0.640, -0.745 ], "y_axis": [ 0.929, 0.362, -0.080 ], "z_axis": [ 0.321, -0.678, 0.662 ], "quaternion": [ 0.743, 0.201, 0.359, -0.528 ] } }, { "index": 59, "index_chain": 13, "chain_name": "I", "nt_resnum": 15, "nt_name": "A", "nt_code": "A", "nt_id": "///I/15", "linked_nts": [ "///I/14", "///I/16" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -145.285, "beta": -104.527, "gamma": 75.312, "delta": 81.666, "epsilon": -176.360, "zeta": -107.991, "epsilon_zeta": -68.369, "bb_type": "BI", "chi": -147.927, "glyco_bond": "anti", "C5prime_xyz": [ -2.154, 8.980, -0.366 ], "P_xyz": [ 0.349, 9.372, 0.353 ], "form": ".", "ssZp": 4.129, "Dp": 4.339, "splay_angle": 15.401, "splay_distance": 2.480, "splay_ratio": 0.134, "d22": null, "d64": null, "eta": 142.154, "theta": -142.632, "eta_prime": 162.079, "theta_prime": -145.832, "eta_base": -159.193, "theta_base": -115.863, "v0": -13.130, "v1": -12.861, "v2": 31.963, "v3": -40.103, "v4": 33.612, "amplitude": 39.993, "phase_angle": 36.946, "puckering": "C4'-exo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.040, "frame": { "rmsd": 0.012, "origin": [ 52.886, 15.490, 57.545 ], "x_axis": [ 0.648, 0.061, -0.759 ], "y_axis": [ 0.606, 0.563, 0.562 ], "z_axis": [ 0.462, -0.824, 0.327 ], "quaternion": [ 0.797, 0.435, 0.383, -0.171 ] } }, { "index": 60, "index_chain": 14, "chain_name": "I", "nt_resnum": 16, "nt_name": "C", "nt_code": "C", "nt_id": "///I/16", "linked_nts": [ "///I/15", "///I/17" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": 168.003, "beta": -119.622, "gamma": 149.108, "delta": 77.333, "epsilon": -155.398, "zeta": -82.370, "epsilon_zeta": -73.028, "bb_type": "BI", "chi": -151.589, "glyco_bond": "anti", "C5prime_xyz": [ -1.972, 9.068, -0.060 ], "P_xyz": [ -0.155, 9.101, -1.894 ], "form": ".", "ssZp": 4.077, "Dp": 4.451, "splay_angle": 30.074, "splay_distance": 4.830, "splay_ratio": 0.260, "d22": 4.526, "d64": 4.252, "eta": 158.037, "theta": -157.640, "eta_prime": 177.035, "theta_prime": -167.721, "eta_base": -138.482, "theta_base": -147.305, "v0": -8.277, "v1": -19.740, "v2": 38.591, "v3": -44.457, "v4": 33.398, "amplitude": 44.211, "phase_angle": 29.205, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.066, "frame": { "rmsd": 0.012, "origin": [ 54.225, 13.425, 57.240 ], "x_axis": [ 0.849, 0.292, -0.441 ], "y_axis": [ 0.428, 0.110, 0.897 ], "z_axis": [ 0.311, -0.950, -0.031 ], "quaternion": [ 0.694, 0.665, 0.271, -0.049 ] } }, { "index": 61, "index_chain": 15, "chain_name": "I", "nt_resnum": 17, "nt_name": "U", "nt_code": "U", "nt_id": "///I/17", "linked_nts": [ "///I/16", "///I/18" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -71.296, "beta": -179.146, "gamma": 51.276, "delta": 83.137, "epsilon": -127.176, "zeta": -75.701, "epsilon_zeta": -51.475, "bb_type": "--", "chi": -162.529, "glyco_bond": "anti", "C5prime_xyz": [ -1.298, 8.694, 0.719 ], "P_xyz": [ 1.296, 9.015, 1.149 ], "form": "A", "ssZp": 4.424, "Dp": 4.698, "splay_angle": 23.537, "splay_distance": 3.708, "splay_ratio": 0.204, "d22": null, "d64": null, "eta": 172.462, "theta": -133.764, "eta_prime": 176.048, "theta_prime": -130.236, "eta_base": -153.731, "theta_base": -86.731, "v0": 9.842, "v1": -31.700, "v2": 40.610, "v3": -36.242, "v4": 16.560, "amplitude": 40.774, "phase_angle": 5.148, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.843, "filter_rmsd": 0.112, "frame": { "rmsd": 0.013, "origin": [ 55.982, 9.006, 56.393 ], "x_axis": [ 0.727, 0.685, 0.055 ], "y_axis": [ -0.132, 0.061, 0.989 ], "z_axis": [ 0.674, -0.726, 0.135 ], "quaternion": [ 0.693, 0.619, 0.223, 0.295 ] } }, { "index": 62, "index_chain": 16, "chain_name": "I", "nt_resnum": 18, "nt_name": "G", "nt_code": "G", "nt_id": "///I/18", "linked_nts": [ "///I/17", "///I/19" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -75.409, "beta": 150.040, "gamma": 77.017, "delta": 81.872, "epsilon": -151.588, "zeta": -80.232, "epsilon_zeta": -71.356, "bb_type": "BI", "chi": -162.116, "glyco_bond": "anti", "C5prime_xyz": [ -1.390, 8.715, 0.703 ], "P_xyz": [ 0.991, 9.090, -0.361 ], "form": ".", "ssZp": 4.536, "Dp": 4.673, "splay_angle": 29.734, "splay_distance": 4.608, "splay_ratio": 0.258, "d22": null, "d64": null, "eta": 158.133, "theta": -149.930, "eta_prime": -176.950, "theta_prime": -158.386, "eta_base": -112.791, "theta_base": -144.286, "v0": 10.396, "v1": -33.153, "v2": 41.922, "v3": -37.144, "v4": 17.064, "amplitude": 42.065, "phase_angle": 4.723, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.168, "filter_rmsd": 0.012, "frame": { "rmsd": 0.012, "origin": [ 59.642, 8.627, 56.846 ], "x_axis": [ 0.457, 0.572, 0.682 ], "y_axis": [ -0.409, -0.545, 0.732 ], "z_axis": [ 0.790, -0.613, -0.015 ], "quaternion": [ 0.473, 0.710, 0.057, 0.518 ] } }, { "index": 63, "index_chain": 17, "chain_name": "I", "nt_resnum": 19, "nt_name": "G", "nt_code": "G", "nt_id": "///I/19", "linked_nts": [ "///I/18", "///I/20" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -110.600, "beta": -178.413, "gamma": 81.768, "delta": 75.780, "epsilon": -143.282, "zeta": -108.849, "epsilon_zeta": -34.433, "bb_type": "BI", "chi": 168.227, "glyco_bond": "anti", "C5prime_xyz": [ -1.653, 8.215, 2.284 ], "P_xyz": [ 0.982, 8.705, 2.664 ], "form": ".", "ssZp": 4.656, "Dp": 4.763, "splay_angle": 28.731, "splay_distance": 4.674, "splay_ratio": 0.271, "d22": null, "d64": null, "eta": 153.333, "theta": -144.790, "eta_prime": 160.757, "theta_prime": -143.906, "eta_base": -164.680, "theta_base": -137.879, "v0": 10.887, "v1": -36.913, "v2": 47.829, "v3": -42.227, "v4": 19.805, "amplitude": 48.052, "phase_angle": 5.522, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.021, "frame": { "rmsd": 0.021, "origin": [ 63.746, 7.017, 55.503 ], "x_axis": [ -0.219, 0.553, 0.804 ], "y_axis": [ -0.710, -0.655, 0.257 ], "z_axis": [ 0.669, -0.515, 0.536 ], "quaternion": [ 0.407, 0.474, -0.083, 0.776 ] } }, { "index": 64, "index_chain": 18, "chain_name": "I", "nt_resnum": 20, "nt_name": "A", "nt_code": "A", "nt_id": "///I/20", "linked_nts": [ "///I/19", "///I/21" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -167.463, "beta": -145.827, "gamma": 141.839, "delta": 76.411, "epsilon": -131.046, "zeta": -113.326, "epsilon_zeta": -17.720, "bb_type": "--", "chi": -174.490, "glyco_bond": "anti", "C5prime_xyz": [ -1.545, 8.610, 1.378 ], "P_xyz": [ 0.764, 9.554, 0.547 ], "form": "A", "ssZp": 4.776, "Dp": 4.822, "splay_angle": 23.709, "splay_distance": 3.717, "splay_ratio": 0.207, "d22": null, "d64": null, "eta": 164.596, "theta": -138.296, "eta_prime": 168.350, "theta_prime": -145.455, "eta_base": -177.819, "theta_base": -108.930, "v0": 4.991, "v1": -29.177, "v2": 40.661, "v3": -38.874, "v4": 21.522, "amplitude": 41.544, "phase_angle": 11.837, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.039, "frame": { "rmsd": 0.009, "origin": [ 68.299, 8.009, 55.859 ], "x_axis": [ -0.657, 0.284, 0.699 ], "y_axis": [ -0.425, -0.904, -0.032 ], "z_axis": [ 0.623, -0.318, 0.715 ], "quaternion": [ 0.196, 0.365, -0.097, 0.905 ] } }, { "index": 65, "index_chain": 19, "chain_name": "I", "nt_resnum": 21, "nt_name": "A", "nt_code": "A", "nt_id": "///I/21", "linked_nts": [ "///I/20", "///I/22" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": 125.309, "beta": -121.740, "gamma": 179.424, "delta": 85.182, "epsilon": -124.553, "zeta": -99.797, "epsilon_zeta": -24.756, "bb_type": "--", "chi": 175.560, "glyco_bond": "anti", "C5prime_xyz": [ -1.066, 7.929, 1.976 ], "P_xyz": [ 0.635, 9.185, 0.422 ], "form": ".", "ssZp": 4.907, "Dp": 4.900, "splay_angle": 31.679, "splay_distance": 4.572, "splay_ratio": 0.273, "d22": null, "d64": null, "eta": 162.247, "theta": -170.635, "eta_prime": -178.004, "theta_prime": -170.548, "eta_base": -117.136, "theta_base": -152.700, "v0": 19.765, "v1": -39.439, "v2": 43.078, "v3": -32.486, "v4": 8.313, "amplitude": 43.491, "phase_angle": 352.097, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.037, "frame": { "rmsd": 0.009, "origin": [ 69.287, 8.418, 59.419 ], "x_axis": [ -0.691, -0.349, 0.633 ], "y_axis": [ 0.147, -0.925, -0.350 ], "z_axis": [ 0.708, -0.149, 0.690 ], "quaternion": [ -0.136, 0.369, -0.137, 0.909 ] } }, { "index": 66, "index_chain": 20, "chain_name": "I", "nt_resnum": 22, "nt_name": "G", "nt_code": "G", "nt_id": "///I/22", "linked_nts": [ "///I/21", "///I/23" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop", "alpha": -59.145, "beta": 138.592, "gamma": 74.247, "delta": 85.513, "epsilon": -118.812, "zeta": -82.200, "epsilon_zeta": -36.612, "bb_type": "--", "chi": 167.040, "glyco_bond": "anti", "C5prime_xyz": [ -1.456, 7.918, 2.419 ], "P_xyz": [ 1.181, 8.040, 2.217 ], "form": ".", "ssZp": 4.773, "Dp": 4.811, "splay_angle": 24.682, "splay_distance": 4.199, "splay_ratio": 0.225, "d22": null, "d64": null, "eta": -178.393, "theta": -87.260, "eta_prime": -166.200, "theta_prime": -100.882, "eta_base": -137.601, "theta_base": -60.803, "v0": 13.999, "v1": -31.927, "v2": 36.785, "v3": -29.117, "v4": 9.834, "amplitude": 36.855, "phase_angle": 356.475, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1L", "suiteness": 0.664, "filter_rmsd": 0.015, "frame": { "rmsd": 0.015, "origin": [ 72.318, 9.972, 62.468 ], "x_axis": [ -0.555, -0.705, 0.443 ], "y_axis": [ 0.297, -0.665, -0.686 ], "z_axis": [ 0.777, -0.249, 0.578 ], "quaternion": [ -0.299, 0.365, -0.279, 0.836 ] } }, { "index": 67, "index_chain": 21, "chain_name": "I", "nt_resnum": 23, "nt_name": "C", "nt_code": "C", "nt_id": "///I/23", "linked_nts": [ "///I/22", "///I/24" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-canonical,non-pair-contact,helix,internal-loop", "alpha": 155.266, "beta": -142.526, "gamma": 166.243, "delta": 85.696, "epsilon": -128.346, "zeta": -114.652, "epsilon_zeta": -13.694, "bb_type": "--", "chi": -148.169, "glyco_bond": "anti", "C5prime_xyz": [ -1.725, 9.019, -0.195 ], "P_xyz": [ -0.261, 9.724, -2.303 ], "form": ".", "ssZp": 3.796, "Dp": 4.445, "splay_angle": 36.201, "splay_distance": 5.824, "splay_ratio": 0.316, "d22": 5.148, "d64": 4.434, "eta": 150.613, "theta": 176.965, "eta_prime": -175.940, "theta_prime": -173.385, "eta_base": -103.764, "theta_base": -149.650, "v0": -0.874, "v1": -21.876, "v2": 35.206, "v3": -36.445, "v4": 23.422, "amplitude": 37.402, "phase_angle": 19.732, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.093, "filter_rmsd": 0.069, "frame": { "rmsd": 0.013, "origin": [ 72.114, 6.942, 65.368 ], "x_axis": [ 0.031, -0.998, -0.053 ], "y_axis": [ 0.914, 0.050, -0.403 ], "z_axis": [ 0.405, -0.036, 0.914 ], "quaternion": [ 0.706, -0.130, 0.162, -0.677 ] } }, { "index": 68, "index_chain": 22, "chain_name": "I", "nt_resnum": 24, "nt_name": "U", "nt_code": "U", "nt_id": "///I/24", "linked_nts": [ "///I/23", null ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,isolated-canonical,non-pair-contact,helix-end,internal-loop", "alpha": -57.436, "beta": 162.885, "gamma": 52.818, "delta": 99.390, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": -150.998, "glyco_bond": "anti", "C5prime_xyz": [ -1.243, 8.681, 0.221 ], "P_xyz": [ 1.422, 8.491, 0.537 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": 7.563, "v1": -19.558, "v2": 23.944, "v3": -20.244, "v4": 7.994, "amplitude": 23.946, "phase_angle": 0.869, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "7a", "suiteness": 0.233, "filter_rmsd": 0.109, "frame": { "rmsd": 0.010, "origin": [ 75.108, 6.614, 70.352 ], "x_axis": [ 0.080, -0.709, -0.700 ], "y_axis": [ 0.679, 0.553, -0.482 ], "z_axis": [ 0.730, -0.437, 0.526 ], "quaternion": [ 0.735, -0.015, 0.487, -0.472 ] } }, { "index": 69, "index_chain": 1, "chain_name": "J", "nt_resnum": 40, "nt_name": "G", "nt_code": "G", "nt_id": "///J/40", "linked_nts": [ null, "///J/41" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,isolated-canonical,non-pair-contact,helix-end,internal-loop", "alpha": null, "beta": null, "gamma": -158.521, "delta": 85.735, "epsilon": -150.545, "zeta": -62.144, "epsilon_zeta": -88.401, "bb_type": "BI", "chi": 165.387, "glyco_bond": "anti", "C5prime_xyz": [ -1.567, 7.840, 2.431 ], "P_xyz": [ null, null, null ], "form": ".", "ssZp": 4.486, "Dp": 4.768, "splay_angle": 34.897, "splay_distance": 5.027, "splay_ratio": 0.304, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": 14.584, "v1": -35.168, "v2": 40.457, "v3": -33.598, "v4": 12.206, "amplitude": 40.478, "phase_angle": 358.184, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.017, "frame": { "rmsd": 0.017, "origin": [ 75.241, 7.597, 71.488 ], "x_axis": [ 0.147, -0.639, -0.755 ], "y_axis": [ -0.879, -0.434, 0.197 ], "z_axis": [ -0.453, 0.635, -0.625 ], "quaternion": [ -0.148, 0.743, -0.511, -0.407 ] } }, { "index": 70, "index_chain": 2, "chain_name": "J", "nt_resnum": 41, "nt_name": "G", "nt_code": "G", "nt_id": "///J/41", "linked_nts": [ "///J/40", "///J/42" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop", "alpha": -133.663, "beta": -126.378, "gamma": 70.768, "delta": 80.064, "epsilon": -154.536, "zeta": -75.476, "epsilon_zeta": -79.060, "bb_type": "BI", "chi": -171.427, "glyco_bond": "anti", "C5prime_xyz": [ -1.434, 8.682, 1.207 ], "P_xyz": [ 0.975, 8.345, 2.224 ], "form": ".", "ssZp": 4.651, "Dp": 4.661, "splay_angle": 32.603, "splay_distance": 4.956, "splay_ratio": 0.283, "d22": null, "d64": null, "eta": 148.071, "theta": -145.473, "eta_prime": 167.247, "theta_prime": -141.861, "eta_base": -127.543, "theta_base": -120.162, "v0": 6.819, "v1": -31.656, "v2": 43.147, "v3": -40.346, "v4": 21.198, "amplitude": 43.793, "phase_angle": 9.855, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.018, "frame": { "rmsd": 0.018, "origin": [ 73.970, 8.677, 66.746 ], "x_axis": [ -0.530, -0.848, 0.016 ], "y_axis": [ -0.412, 0.275, 0.869 ], "z_axis": [ -0.741, 0.453, -0.495 ], "quaternion": [ -0.250, -0.416, 0.758, 0.436 ] } }, { "index": 71, "index_chain": 3, "chain_name": "J", "nt_resnum": 42, "nt_name": "C", "nt_code": "C", "nt_id": "///J/42", "linked_nts": [ "///J/41", "///J/43" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop", "alpha": -67.346, "beta": 167.727, "gamma": 71.490, "delta": 80.202, "epsilon": -150.740, "zeta": -54.790, "epsilon_zeta": -95.951, "bb_type": "BI", "chi": 178.899, "glyco_bond": "anti", "C5prime_xyz": [ -1.528, 8.467, 1.775 ], "P_xyz": [ 1.120, 8.817, 1.858 ], "form": ".", "ssZp": 4.693, "Dp": 4.728, "splay_angle": 16.729, "splay_distance": 3.790, "splay_ratio": 0.198, "d22": 5.032, "d64": 5.713, "eta": 177.953, "theta": -112.864, "eta_prime": -167.313, "theta_prime": -129.063, "eta_base": -128.353, "theta_base": -132.974, "v0": 13.800, "v1": -37.345, "v2": 45.381, "v3": -38.126, "v4": 15.590, "amplitude": 45.389, "phase_angle": 1.055, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.475, "filter_rmsd": 0.073, "frame": { "rmsd": 0.018, "origin": [ 71.230, 9.777, 62.765 ], "x_axis": [ -0.711, -0.571, 0.411 ], "y_axis": [ 0.043, 0.548, 0.835 ], "z_axis": [ -0.702, 0.612, -0.365 ], "quaternion": [ -0.344, -0.163, 0.810, 0.447 ] } }, { "index": 72, "index_chain": 4, "chain_name": "J", "nt_resnum": 43, "nt_name": "U", "nt_code": "U", "nt_id": "///J/43", "linked_nts": [ "///J/42", "///J/44" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": 176.282, "beta": 167.887, "gamma": 174.880, "delta": 86.083, "epsilon": -151.261, "zeta": -109.517, "epsilon_zeta": -41.743, "bb_type": "BI", "chi": -166.027, "glyco_bond": "anti", "C5prime_xyz": [ -1.727, 8.858, 0.730 ], "P_xyz": [ -0.746, 10.829, -0.739 ], "form": ".", "ssZp": 4.198, "Dp": 4.270, "splay_angle": 19.869, "splay_distance": 3.279, "splay_ratio": 0.173, "d22": 5.225, "d64": 4.716, "eta": 177.012, "theta": 179.442, "eta_prime": -172.043, "theta_prime": -178.844, "eta_base": -156.156, "theta_base": -167.903, "v0": -5.711, "v1": -15.805, "v2": 29.582, "v3": -33.600, "v4": 25.206, "amplitude": 33.550, "phase_angle": 28.148, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.395, "filter_rmsd": 0.106, "frame": { "rmsd": 0.010, "origin": [ 69.586, 8.092, 59.794 ], "x_axis": [ -0.663, -0.312, 0.680 ], "y_axis": [ 0.014, 0.904, 0.428 ], "z_axis": [ -0.748, 0.294, -0.595 ], "quaternion": [ -0.402, -0.084, 0.889, 0.203 ] } }, { "index": 73, "index_chain": 5, "chain_name": "J", "nt_resnum": 44, "nt_name": "U", "nt_code": "U", "nt_id": "///J/44", "linked_nts": [ "///J/43", "///J/45" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": 155.946, "beta": -140.637, "gamma": 151.303, "delta": 80.066, "epsilon": -144.838, "zeta": -69.834, "epsilon_zeta": -75.004, "bb_type": "BI", "chi": -159.631, "glyco_bond": "anti", "C5prime_xyz": [ -1.395, 8.829, 0.531 ], "P_xyz": [ 0.586, 9.471, -1.072 ], "form": "A", "ssZp": 4.281, "Dp": 4.564, "splay_angle": 26.064, "splay_distance": 4.128, "splay_ratio": 0.226, "d22": 3.843, "d64": 3.777, "eta": 143.929, "theta": -147.690, "eta_prime": 160.169, "theta_prime": -151.618, "eta_base": -178.801, "theta_base": -119.034, "v0": 2.519, "v1": -26.848, "v2": 40.347, "v3": -39.477, "v4": 23.376, "amplitude": 41.788, "phase_angle": 15.092, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.010, "filter_rmsd": 0.108, "frame": { "rmsd": 0.015, "origin": [ 68.266, 7.808, 56.806 ], "x_axis": [ -0.589, 0.067, 0.806 ], "y_axis": [ 0.061, 0.997, -0.039 ], "z_axis": [ -0.806, 0.026, -0.591 ], "quaternion": [ -0.452, 0.036, 0.891, -0.003 ] } }, { "index": 74, "index_chain": 6, "chain_name": "J", "nt_resnum": 45, "nt_name": "U", "nt_code": "U", "nt_id": "///J/45", "linked_nts": [ "///J/44", "///J/46" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -78.016, "beta": 172.692, "gamma": 66.155, "delta": 83.844, "epsilon": -147.406, "zeta": -72.642, "epsilon_zeta": -74.764, "bb_type": "BI", "chi": -167.383, "glyco_bond": "anti", "C5prime_xyz": [ -1.394, 8.715, 0.978 ], "P_xyz": [ 1.221, 9.118, 1.040 ], "form": "A", "ssZp": 4.613, "Dp": 4.644, "splay_angle": 25.596, "splay_distance": 4.033, "splay_ratio": 0.222, "d22": 4.477, "d64": 4.217, "eta": 166.344, "theta": -139.085, "eta_prime": -177.469, "theta_prime": -136.370, "eta_base": -127.921, "theta_base": -104.628, "v0": 1.912, "v1": -22.964, "v2": 33.873, "v3": -33.615, "v4": 20.169, "amplitude": 35.151, "phase_angle": 15.499, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.650, "filter_rmsd": 0.105, "frame": { "rmsd": 0.012, "origin": [ 64.179, 7.538, 56.294 ], "x_axis": [ -0.171, 0.650, 0.740 ], "y_axis": [ 0.417, 0.728, -0.544 ], "z_axis": [ -0.893, 0.216, -0.396 ], "quaternion": [ 0.539, -0.352, -0.757, 0.108 ] } }, { "index": 75, "index_chain": 7, "chain_name": "J", "nt_resnum": 46, "nt_name": "C", "nt_code": "C", "nt_id": "///J/46", "linked_nts": [ "///J/45", "///J/47" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -87.386, "beta": -174.713, "gamma": 69.086, "delta": 89.094, "epsilon": -137.376, "zeta": -73.174, "epsilon_zeta": -64.202, "bb_type": "BI", "chi": -154.224, "glyco_bond": "anti", "C5prime_xyz": [ -1.564, 8.884, 0.247 ], "P_xyz": [ 1.077, 9.150, 0.331 ], "form": ".", "ssZp": 4.185, "Dp": 4.486, "splay_angle": 26.685, "splay_distance": 4.424, "splay_ratio": 0.231, "d22": null, "d64": null, "eta": 172.239, "theta": -134.926, "eta_prime": -172.596, "theta_prime": -145.607, "eta_base": -129.401, "theta_base": -135.336, "v0": 1.225, "v1": -19.890, "v2": 29.806, "v3": -30.014, "v4": 18.166, "amplitude": 31.076, "phase_angle": 16.439, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.360, "filter_rmsd": 0.071, "frame": { "rmsd": 0.012, "origin": [ 60.369, 8.837, 56.548 ], "x_axis": [ 0.306, 0.910, 0.279 ], "y_axis": [ 0.340, 0.170, -0.925 ], "z_axis": [ -0.889, 0.378, -0.257 ], "quaternion": [ 0.552, -0.590, -0.529, 0.258 ] } }, { "index": 76, "index_chain": 8, "chain_name": "J", "nt_resnum": 47, "nt_name": "A", "nt_code": "A", "nt_id": "///J/47", "linked_nts": [ "///J/46", "///J/48" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -134.357, "beta": 140.156, "gamma": 118.483, "delta": 88.096, "epsilon": -158.686, "zeta": -78.317, "epsilon_zeta": -80.369, "bb_type": "BI", "chi": -171.796, "glyco_bond": "anti", "C5prime_xyz": [ -1.123, 8.351, 1.348 ], "P_xyz": [ 0.751, 9.493, -0.132 ], "form": "A", "ssZp": 4.552, "Dp": 4.559, "splay_angle": 21.531, "splay_distance": 3.451, "splay_ratio": 0.193, "d22": null, "d64": null, "eta": 149.464, "theta": -140.592, "eta_prime": 166.769, "theta_prime": -150.856, "eta_base": -163.232, "theta_base": -124.570, "v0": 14.081, "v1": -30.766, "v2": 35.419, "v3": -28.158, "v4": 8.983, "amplitude": 35.507, "phase_angle": 355.956, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.036, "frame": { "rmsd": 0.006, "origin": [ 56.099, 9.962, 56.290 ], "x_axis": [ 0.636, 0.771, -0.022 ], "y_axis": [ 0.179, -0.175, -0.968 ], "z_axis": [ -0.751, 0.612, -0.250 ], "quaternion": [ 0.550, -0.718, -0.331, 0.269 ] } }, { "index": 77, "index_chain": 9, "chain_name": "J", "nt_resnum": 48, "nt_name": "G", "nt_code": "G", "nt_id": "///J/48", "linked_nts": [ "///J/47", "///J/49" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": 179.357, "beta": -157.066, "gamma": 148.420, "delta": 88.047, "epsilon": -112.530, "zeta": -94.919, "epsilon_zeta": -17.612, "bb_type": "--", "chi": -171.153, "glyco_bond": "anti", "C5prime_xyz": [ -1.372, 8.449, 1.297 ], "P_xyz": [ 0.798, 9.349, 0.168 ], "form": ".", "ssZp": 4.541, "Dp": 4.721, "splay_angle": 13.990, "splay_distance": 2.267, "splay_ratio": 0.122, "d22": null, "d64": null, "eta": 167.867, "theta": -147.136, "eta_prime": -175.212, "theta_prime": -148.936, "eta_base": -131.196, "theta_base": -129.644, "v0": 11.342, "v1": -30.472, "v2": 36.616, "v3": -31.107, "v4": 12.729, "amplitude": 36.622, "phase_angle": 1.028, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.010, "filter_rmsd": 0.008, "frame": { "rmsd": 0.008, "origin": [ 54.500, 12.899, 57.143 ], "x_axis": [ 0.566, 0.570, -0.596 ], "y_axis": [ -0.352, -0.487, -0.799 ], "z_axis": [ -0.746, 0.662, -0.075 ], "quaternion": [ 0.501, -0.729, -0.075, 0.460 ] } }, { "index": 78, "index_chain": 10, "chain_name": "J", "nt_resnum": 49, "nt_name": "U", "nt_code": "U", "nt_id": "///J/49", "linked_nts": [ "///J/48", "///J/50" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -58.667, "beta": 144.314, "gamma": 49.891, "delta": 75.347, "epsilon": -132.451, "zeta": -38.065, "epsilon_zeta": -94.386, "bb_type": "--", "chi": -144.184, "glyco_bond": "anti", "C5prime_xyz": [ -1.797, 8.886, -0.426 ], "P_xyz": [ 0.629, 9.239, -1.325 ], "form": ".", "ssZp": 3.743, "Dp": 4.741, "splay_angle": 24.428, "splay_distance": 4.396, "splay_ratio": 0.220, "d22": 3.902, "d64": 5.080, "eta": 152.173, "theta": -122.520, "eta_prime": 168.104, "theta_prime": -138.494, "eta_base": -156.928, "theta_base": -136.223, "v0": -1.340, "v1": -25.870, "v2": 41.609, "v3": -43.573, "v4": 28.150, "amplitude": 44.345, "phase_angle": 20.230, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1L", "suiteness": 0.716, "filter_rmsd": 0.100, "frame": { "rmsd": 0.010, "origin": [ 53.518, 14.922, 57.433 ], "x_axis": [ 0.350, 0.239, -0.906 ], "y_axis": [ -0.829, -0.372, -0.418 ], "z_axis": [ -0.437, 0.897, 0.068 ], "quaternion": [ 0.511, -0.643, 0.229, 0.522 ] } }, { "index": 79, "index_chain": 11, "chain_name": "J", "nt_resnum": 50, "nt_name": "C", "nt_code": "C", "nt_id": "///J/50", "linked_nts": [ "///J/49", "///J/51" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,phosphate", "alpha": -128.725, "beta": 97.905, "gamma": 160.341, "delta": 91.681, "epsilon": -139.336, "zeta": -66.129, "epsilon_zeta": -73.206, "bb_type": "BI", "chi": -172.247, "glyco_bond": "anti", "C5prime_xyz": [ -1.215, 8.481, 1.318 ], "P_xyz": [ -1.212, 10.539, -0.254 ], "form": "A", "ssZp": 4.601, "Dp": 4.610, "splay_angle": 26.178, "splay_distance": 4.228, "splay_ratio": 0.229, "d22": null, "d64": null, "eta": -177.349, "theta": 176.976, "eta_prime": -176.190, "theta_prime": -168.279, "eta_base": -157.930, "theta_base": -126.308, "v0": 4.548, "v1": -22.856, "v2": 31.605, "v3": -29.821, "v4": 15.943, "amplitude": 32.163, "phase_angle": 10.689, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1e", "suiteness": 0.058, "filter_rmsd": 0.058, "frame": { "rmsd": 0.010, "origin": [ 53.748, 19.287, 56.970 ], "x_axis": [ 0.319, -0.160, -0.934 ], "y_axis": [ -0.873, -0.432, -0.224 ], "z_axis": [ -0.368, 0.888, -0.277 ], "quaternion": [ -0.390, 0.712, -0.363, -0.457 ] } }, { "index": 80, "index_chain": 12, "chain_name": "J", "nt_resnum": 51, "nt_name": "G", "nt_code": "G", "nt_id": "///J/51", "linked_nts": [ "///J/50", "///J/52" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack", "alpha": -75.495, "beta": 176.651, "gamma": 53.775, "delta": 78.177, "epsilon": -142.243, "zeta": -82.641, "epsilon_zeta": -59.602, "bb_type": "BI", "chi": -174.418, "glyco_bond": "anti", "C5prime_xyz": [ -1.749, 8.704, 1.257 ], "P_xyz": [ 0.719, 9.367, 1.776 ], "form": "A", "ssZp": 4.771, "Dp": 4.773, "splay_angle": 24.060, "splay_distance": 3.719, "splay_ratio": 0.210, "d22": null, "d64": null, "eta": 157.570, "theta": -153.230, "eta_prime": 176.884, "theta_prime": -148.194, "eta_base": -127.940, "theta_base": -113.515, "v0": -0.960, "v1": -25.249, "v2": 40.136, "v3": -41.960, "v4": 27.086, "amplitude": 42.689, "phase_angle": 19.917, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.661, "filter_rmsd": 0.013, "frame": { "rmsd": 0.013, "origin": [ 53.972, 22.511, 54.244 ], "x_axis": [ -0.253, -0.564, -0.786 ], "y_axis": [ -0.844, -0.269, 0.465 ], "z_axis": [ -0.474, 0.780, -0.408 ], "quaternion": [ -0.132, 0.597, -0.590, -0.528 ] } }, { "index": 81, "index_chain": 13, "chain_name": "J", "nt_resnum": 52, "nt_name": "G", "nt_code": "G", "nt_id": "///J/52", "linked_nts": [ "///J/51", "///J/53" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -66.836, "beta": 163.399, "gamma": 61.143, "delta": 81.060, "epsilon": -146.034, "zeta": -76.997, "epsilon_zeta": -69.038, "bb_type": "BI", "chi": -166.880, "glyco_bond": "anti", "C5prime_xyz": [ -1.545, 8.691, 0.993 ], "P_xyz": [ 1.031, 8.985, 0.886 ], "form": "A", "ssZp": 4.619, "Dp": 4.709, "splay_angle": 21.459, "splay_distance": 3.362, "splay_ratio": 0.187, "d22": null, "d64": null, "eta": 170.083, "theta": -143.726, "eta_prime": -176.260, "theta_prime": -144.597, "eta_base": -129.283, "theta_base": -117.977, "v0": 8.424, "v1": -31.863, "v2": 41.984, "v3": -38.278, "v4": 18.932, "amplitude": 42.342, "phase_angle": 7.461, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.802, "filter_rmsd": 0.015, "frame": { "rmsd": 0.015, "origin": [ 53.233, 24.660, 51.300 ], "x_axis": [ -0.698, -0.620, -0.358 ], "y_axis": [ -0.566, 0.173, 0.806 ], "z_axis": [ -0.438, 0.765, -0.472 ], "quaternion": [ -0.026, -0.388, 0.765, 0.513 ] } }, { "index": 82, "index_chain": 14, "chain_name": "J", "nt_resnum": 53, "nt_name": "A", "nt_code": "A", "nt_id": "///J/53", "linked_nts": [ "///J/52", "///J/54" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -61.472, "beta": 173.461, "gamma": 51.340, "delta": 82.039, "epsilon": -157.903, "zeta": -99.526, "epsilon_zeta": -58.377, "bb_type": "BI", "chi": -153.936, "glyco_bond": "anti", "C5prime_xyz": [ -1.302, 8.752, 0.210 ], "P_xyz": [ 1.335, 9.057, 0.269 ], "form": "A", "ssZp": 4.348, "Dp": 4.638, "splay_angle": 20.450, "splay_distance": 3.289, "splay_ratio": 0.178, "d22": null, "d64": null, "eta": 169.787, "theta": -138.318, "eta_prime": -177.494, "theta_prime": -143.669, "eta_base": -135.080, "theta_base": -121.415, "v0": 6.805, "v1": -28.803, "v2": 38.506, "v3": -35.775, "v4": 18.360, "amplitude": 38.973, "phase_angle": 8.886, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.963, "filter_rmsd": 0.036, "frame": { "rmsd": 0.009, "origin": [ 51.884, 26.089, 48.572 ], "x_axis": [ -0.876, -0.435, 0.208 ], "y_axis": [ -0.123, 0.618, 0.777 ], "z_axis": [ -0.467, 0.655, -0.594 ], "quaternion": [ -0.192, -0.159, 0.879, 0.407 ] } }, { "index": 83, "index_chain": 15, "chain_name": "J", "nt_resnum": 54, "nt_name": "U", "nt_code": "U", "nt_id": "///J/54", "linked_nts": [ "///J/53", "///J/55" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": 150.019, "beta": -137.756, "gamma": 168.731, "delta": 85.122, "epsilon": -125.711, "zeta": -77.773, "epsilon_zeta": -47.938, "bb_type": "--", "chi": -171.982, "glyco_bond": "anti", "C5prime_xyz": [ -1.309, 8.446, 1.341 ], "P_xyz": [ 0.642, 9.360, -0.077 ], "form": "A", "ssZp": 4.383, "Dp": 4.534, "splay_angle": 21.702, "splay_distance": 3.500, "splay_ratio": 0.190, "d22": null, "d64": null, "eta": 165.588, "theta": -146.605, "eta_prime": -179.272, "theta_prime": -148.994, "eta_base": -139.856, "theta_base": -117.150, "v0": 8.030, "v1": -28.826, "v2": 38.736, "v3": -35.618, "v4": 17.022, "amplitude": 39.074, "phase_angle": 7.542, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.282, "filter_rmsd": 0.109, "frame": { "rmsd": 0.014, "origin": [ 49.833, 26.980, 46.159 ], "x_axis": [ -0.773, -0.170, 0.611 ], "y_axis": [ 0.205, 0.844, 0.495 ], "z_axis": [ -0.600, 0.508, -0.618 ], "quaternion": [ -0.336, 0.010, 0.899, 0.279 ] } }, { "index": 84, "index_chain": 16, "chain_name": "J", "nt_resnum": 55, "nt_name": "G", "nt_code": "G", "nt_id": "///J/55", "linked_nts": [ "///J/54", "///J/56" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -56.500, "beta": 161.453, "gamma": 52.941, "delta": 78.549, "epsilon": -157.847, "zeta": -78.408, "epsilon_zeta": -79.439, "bb_type": "BI", "chi": -164.918, "glyco_bond": "anti", "C5prime_xyz": [ -1.474, 8.844, 0.764 ], "P_xyz": [ 1.182, 9.334, 0.925 ], "form": "A", "ssZp": 4.439, "Dp": 4.542, "splay_angle": 22.367, "splay_distance": 3.559, "splay_ratio": 0.195, "d22": null, "d64": null, "eta": 161.276, "theta": -154.997, "eta_prime": -179.466, "theta_prime": -154.279, "eta_base": -128.257, "theta_base": -136.560, "v0": -2.699, "v1": -21.634, "v2": 36.528, "v3": -38.811, "v4": 26.442, "amplitude": 39.507, "phase_angle": 22.392, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.652, "filter_rmsd": 0.017, "frame": { "rmsd": 0.017, "origin": [ 46.681, 27.444, 44.710 ], "x_axis": [ -0.387, 0.319, 0.865 ], "y_axis": [ 0.598, 0.801, -0.027 ], "z_axis": [ -0.702, 0.507, -0.501 ], "quaternion": [ -0.478, 0.279, 0.820, 0.146 ] } }, { "index": 85, "index_chain": 17, "chain_name": "J", "nt_resnum": 56, "nt_name": "U", "nt_code": "U", "nt_id": "///J/56", "linked_nts": [ "///J/55", "///J/57" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -62.386, "beta": 163.936, "gamma": 56.346, "delta": 79.159, "epsilon": -160.502, "zeta": -75.088, "epsilon_zeta": -85.414, "bb_type": "BI", "chi": -161.961, "glyco_bond": "anti", "C5prime_xyz": [ -1.597, 8.794, 0.614 ], "P_xyz": [ 1.059, 9.241, 0.525 ], "form": "A", "ssZp": 4.376, "Dp": 4.511, "splay_angle": 25.270, "splay_distance": 3.955, "splay_ratio": 0.221, "d22": 4.327, "d64": 4.586, "eta": 167.499, "theta": -150.763, "eta_prime": -179.471, "theta_prime": -152.160, "eta_base": -147.924, "theta_base": -128.460, "v0": -1.831, "v1": -24.845, "v2": 41.187, "v3": -43.044, "v4": 28.265, "amplitude": 44.075, "phase_angle": 20.857, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.875, "filter_rmsd": 0.090, "frame": { "rmsd": 0.021, "origin": [ 43.541, 27.679, 43.050 ], "x_axis": [ -0.118, 0.643, 0.757 ], "y_axis": [ 0.648, 0.627, -0.432 ], "z_axis": [ -0.752, 0.439, -0.491 ], "quaternion": [ 0.504, -0.432, -0.748, -0.003 ] } }, { "index": 86, "index_chain": 18, "chain_name": "J", "nt_resnum": 57, "nt_name": "U", "nt_code": "U", "nt_id": "///J/57", "linked_nts": [ "///J/56", "///J/58" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -70.019, "beta": 167.545, "gamma": 64.764, "delta": 81.521, "epsilon": -160.039, "zeta": -74.664, "epsilon_zeta": -85.375, "bb_type": "BI", "chi": -171.525, "glyco_bond": "anti", "C5prime_xyz": [ -1.458, 8.689, 1.164 ], "P_xyz": [ 1.217, 9.086, 1.040 ], "form": "A", "ssZp": 4.562, "Dp": 4.536, "splay_angle": 19.657, "splay_distance": 3.164, "splay_ratio": 0.177, "d22": 4.553, "d64": 4.617, "eta": 171.225, "theta": -149.185, "eta_prime": -176.604, "theta_prime": -150.002, "eta_base": -137.073, "theta_base": -130.198, "v0": -2.447, "v1": -21.408, "v2": 36.114, "v3": -37.925, "v4": 25.889, "amplitude": 38.944, "phase_angle": 21.976, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.718, "filter_rmsd": 0.119, "frame": { "rmsd": 0.026, "origin": [ 39.777, 28.735, 42.453 ], "x_axis": [ 0.260, 0.851, 0.456 ], "y_axis": [ 0.635, 0.206, -0.745 ], "z_axis": [ -0.728, 0.483, -0.487 ], "quaternion": [ -0.495, 0.621, 0.599, -0.109 ] } }, { "index": 87, "index_chain": 19, "chain_name": "J", "nt_resnum": 58, "nt_name": "U", "nt_code": "U", "nt_id": "///J/58", "linked_nts": [ "///J/57", "///J/59" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -68.676, "beta": 169.809, "gamma": 61.805, "delta": 83.063, "epsilon": -161.502, "zeta": -88.131, "epsilon_zeta": -73.371, "bb_type": "BI", "chi": -157.982, "glyco_bond": "anti", "C5prime_xyz": [ -1.367, 8.870, 0.436 ], "P_xyz": [ 1.297, 9.272, 0.239 ], "form": "A", "ssZp": 4.262, "Dp": 4.415, "splay_angle": 24.137, "splay_distance": 4.000, "splay_ratio": 0.214, "d22": null, "d64": null, "eta": 172.281, "theta": -132.555, "eta_prime": -173.886, "theta_prime": -144.459, "eta_base": -139.110, "theta_base": -122.508, "v0": -3.681, "v1": -19.344, "v2": 34.266, "v3": -37.201, "v4": 25.582, "amplitude": 37.531, "phase_angle": 24.075, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.814, "filter_rmsd": 0.101, "frame": { "rmsd": 0.013, "origin": [ 36.891, 29.963, 42.875 ], "x_axis": [ 0.473, 0.881, -0.008 ], "y_axis": [ 0.275, -0.156, -0.949 ], "z_axis": [ -0.837, 0.446, -0.316 ], "quaternion": [ 0.500, -0.697, -0.414, 0.303 ] } }, { "index": 88, "index_chain": 20, "chain_name": "J", "nt_resnum": 59, "nt_name": "G", "nt_code": "G", "nt_id": "///J/59", "linked_nts": [ "///J/58", "///J/60" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": 137.142, "beta": -157.239, "gamma": -173.738, "delta": 95.566, "epsilon": -122.199, "zeta": -78.310, "epsilon_zeta": -43.890, "bb_type": "--", "chi": 167.891, "glyco_bond": "anti", "C5prime_xyz": [ -1.277, 7.745, 2.428 ], "P_xyz": [ 0.644, 9.534, 2.085 ], "form": "A", "ssZp": 4.617, "Dp": 4.578, "splay_angle": 23.553, "splay_distance": 3.767, "splay_ratio": 0.210, "d22": null, "d64": null, "eta": 165.414, "theta": -149.897, "eta_prime": 175.081, "theta_prime": -143.673, "eta_base": -143.249, "theta_base": -107.774, "v0": 9.334, "v1": -22.294, "v2": 26.233, "v3": -21.864, "v4": 7.761, "amplitude": 26.241, "phase_angle": 358.579, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.424, "filter_rmsd": 0.018, "frame": { "rmsd": 0.018, "origin": [ 34.054, 32.757, 43.254 ], "x_axis": [ 0.827, 0.465, -0.316 ], "y_axis": [ 0.064, -0.637, -0.768 ], "z_axis": [ -0.558, 0.615, -0.557 ], "quaternion": [ -0.398, 0.869, 0.152, -0.252 ] } }, { "index": 89, "index_chain": 21, "chain_name": "J", "nt_resnum": 60, "nt_name": "C", "nt_code": "C", "nt_id": "///J/60", "linked_nts": [ "///J/59", "///J/61" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -70.779, "beta": 169.169, "gamma": 61.728, "delta": 79.810, "epsilon": -150.315, "zeta": -75.653, "epsilon_zeta": -74.662, "bb_type": "BI", "chi": -160.670, "glyco_bond": "anti", "C5prime_xyz": [ -1.494, 8.908, 0.619 ], "P_xyz": [ 1.122, 9.340, 0.525 ], "form": "A", "ssZp": 4.443, "Dp": 4.580, "splay_angle": 20.772, "splay_distance": 3.443, "splay_ratio": 0.185, "d22": 4.578, "d64": 4.588, "eta": 156.396, "theta": -143.857, "eta_prime": 179.892, "theta_prime": -142.542, "eta_base": -128.176, "theta_base": -119.097, "v0": 1.740, "v1": -25.054, "v2": 37.707, "v3": -38.029, "v4": 22.658, "amplitude": 39.283, "phase_angle": 16.280, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.339, "filter_rmsd": 0.061, "frame": { "rmsd": 0.007, "origin": [ 33.405, 36.353, 42.338 ], "x_axis": [ 0.591, 0.006, -0.807 ], "y_axis": [ -0.555, -0.723, -0.412 ], "z_axis": [ -0.586, 0.691, -0.424 ], "quaternion": [ -0.333, 0.827, -0.166, -0.421 ] } }, { "index": 90, "index_chain": 22, "chain_name": "J", "nt_resnum": 61, "nt_name": "C", "nt_code": "C", "nt_id": "///J/61", "linked_nts": [ "///J/60", "///J/62" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,phosphate,splayed-apart", "alpha": -63.885, "beta": 166.812, "gamma": 71.394, "delta": 86.167, "epsilon": -170.884, "zeta": 143.872, "epsilon_zeta": 45.244, "bb_type": "--", "chi": -145.372, "glyco_bond": "anti", "C5prime_xyz": [ -1.705, 9.053, -0.386 ], "P_xyz": [ 0.903, 9.622, -0.767 ], "form": ".", "ssZp": 3.480, "Dp": 3.833, "splay_angle": 132.622, "splay_distance": 18.687, "splay_ratio": 0.916, "d22": null, "d64": null, "eta": 176.739, "theta": 34.742, "eta_prime": -162.506, "theta_prime": -53.900, "eta_base": -126.052, "theta_base": -86.333, "v0": -4.839, "v1": -15.747, "v2": 30.302, "v3": -33.006, "v4": 23.348, "amplitude": 33.708, "phase_angle": 25.980, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.469, "filter_rmsd": 0.064, "frame": { "rmsd": 0.007, "origin": [ 33.321, 39.395, 40.727 ], "x_axis": [ 0.240, -0.383, -0.892 ], "y_axis": [ -0.898, -0.437, -0.054 ], "z_axis": [ -0.369, 0.814, -0.449 ], "quaternion": [ -0.298, 0.729, -0.439, -0.432 ] } }, { "index": 91, "index_chain": 23, "chain_name": "J", "nt_resnum": 62, "nt_name": "G", "nt_code": "G", "nt_id": "///J/62", "linked_nts": [ "///J/61", "///J/63" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,anti,~C3'-endo,non-stack,non-pair-contact,ss-non-loop,phosphate,splayed-apart", "alpha": 155.291, "beta": 68.096, "gamma": -173.148, "delta": 77.682, "epsilon": -128.886, "zeta": 95.175, "epsilon_zeta": 135.939, "bb_type": "--", "chi": -179.116, "glyco_bond": "anti", "C5prime_xyz": [ -2.080, 8.797, 1.441 ], "P_xyz": [ -3.451, 10.450, -0.101 ], "form": ".", "ssZp": 4.577, "Dp": 4.553, "splay_angle": 65.871, "splay_distance": 10.051, "splay_ratio": 0.544, "d22": null, "d64": null, "eta": 154.083, "theta": -56.981, "eta_prime": -144.506, "theta_prime": -84.451, "eta_base": -109.733, "theta_base": -108.643, "v0": -6.575, "v1": -20.972, "v2": 37.984, "v3": -42.061, "v4": 32.228, "amplitude": 42.679, "phase_angle": 27.127, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.030, "frame": { "rmsd": 0.030, "origin": [ 15.807, 43.088, 35.359 ], "x_axis": [ -0.788, -0.581, 0.205 ], "y_axis": [ 0.526, -0.462, 0.714 ], "z_axis": [ -0.320, 0.670, 0.670 ], "quaternion": [ -0.324, -0.033, 0.405, 0.854 ] } }, { "index": 92, "index_chain": 24, "chain_name": "J", "nt_resnum": 63, "nt_name": "C", "nt_code": "C", "nt_id": "///J/63", "linked_nts": [ "///J/62", null ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C2'-endo,ss-non-loop,phosphate", "alpha": 168.355, "beta": 123.685, "gamma": 30.632, "delta": 130.735, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": -153.292, "glyco_bond": "anti", "C5prime_xyz": [ -1.936, 8.928, 0.210 ], "P_xyz": [ 0.235, 8.918, 1.620 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": -34.204, "v1": 40.172, "v2": -30.151, "v3": 11.279, "v4": 14.376, "amplitude": 39.278, "phase_angle": 140.142, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "5z", "suiteness": 0.010, "filter_rmsd": 0.067, "frame": { "rmsd": 0.010, "origin": [ 12.741, 43.204, 44.930 ], "x_axis": [ -0.303, 0.548, -0.780 ], "y_axis": [ 0.930, 0.347, -0.117 ], "z_axis": [ 0.206, -0.761, -0.615 ], "quaternion": [ 0.328, 0.491, 0.753, -0.292 ] } }, { "index": 93, "index_chain": 1, "chain_name": "C", "nt_resnum": 1177, "nt_name": "GTP", "nt_code": "g", "is_modified": true, "nt_id": "///C/1177", "linked_nts": [ null, null ], "nt_type": "RNA", "dbn": ".", "summary": "modified,anti,~C2'-endo,non-stack,ss-non-loop", "alpha": null, "beta": null, "gamma": 73.065, "delta": 126.639, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": -123.434, "glyco_bond": "anti", "C5prime_xyz": [ -1.913, 8.774, -1.277 ], "P_xyz": [ null, null, null ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": -20.216, "v1": 25.845, "v2": -22.505, "v3": 11.150, "v4": 5.646, "amplitude": 26.079, "phase_angle": 149.649, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.074, "frame": { "rmsd": 0.074, "origin": [ 11.169, 119.559, 17.022 ], "x_axis": [ 0.882, 0.007, 0.470 ], "y_axis": [ 0.065, 0.989, -0.136 ], "z_axis": [ -0.466, 0.150, 0.872 ], "quaternion": [ 0.967, -0.074, -0.242, -0.015 ] } }, { "index": 94, "index_chain": 1, "chain_name": "H", "nt_resnum": 1177, "nt_name": "GTP", "nt_code": "g", "is_modified": true, "nt_id": "///H/1177", "linked_nts": [ null, null ], "nt_type": "RNA", "dbn": ".", "summary": "modified,anti,non-stack,ss-non-loop", "alpha": null, "beta": null, "gamma": -139.938, "delta": 143.072, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": -135.115, "glyco_bond": "anti", "C5prime_xyz": [ -0.902, 8.350, -0.203 ], "P_xyz": [ null, null, null ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": 9.019, "v1": 1.696, "v2": -10.890, "v3": 16.832, "v4": -16.231, "amplitude": 17.052, "phase_angle": 230.311, "puckering": "C4'-endo", "sugar_class": "--", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.066, "frame": { "rmsd": 0.066, "origin": [ 28.219, 2.740, 48.449 ], "x_axis": [ 0.111, 0.011, -0.994 ], "y_axis": [ 0.117, -0.993, 0.002 ], "z_axis": [ -0.987, -0.116, -0.112 ], "quaternion": [ 0.040, 0.744, 0.043, -0.665 ] } } ], "num_hbonds": 2649, "hbonds": [ { "index": 1, "atom1_serNum": 21, "atom2_serNum": 51, "donAcc_type": "standard", "distance": 3.037, "atom1_id": "///A/4/OD2", "atom2_id": "///A/9/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2, "atom1_serNum": 25, "atom2_serNum": 51, "donAcc_type": "standard", "distance": 3.372, "atom1_id": "///A/5/O", "atom2_id": "///A/9/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 3, "atom1_serNum": 34, "atom2_serNum": 59, "donAcc_type": "standard", "distance": 3.463, "atom1_id": "///A/6/O", "atom2_id": "///A/10/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 4, "atom1_serNum": 41, "atom2_serNum": 65, "donAcc_type": "standard", "distance": 3.651, "atom1_id": "///A/7/O", "atom2_id": "///A/11/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 5, "atom1_serNum": 44, "atom2_serNum": 408, "donAcc_type": "standard", "distance": 2.561, "atom1_id": "///A/7/OD1", "atom2_id": "///A/53/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 6, "atom1_serNum": 49, "atom2_serNum": 82, "donAcc_type": "standard", "distance": 2.983, "atom1_id": "///A/8/O", "atom2_id": "///A/12/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 7, "atom1_serNum": 54, "atom2_serNum": 74, "donAcc_type": "standard", "distance": 2.945, "atom1_id": "///A/9/O", "atom2_id": "///A/12/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 8, "atom1_serNum": 54, "atom2_serNum": 83, "donAcc_type": "standard", "distance": 2.852, "atom1_id": "///A/9/O", "atom2_id": "///A/13/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 9, "atom1_serNum": 62, "atom2_serNum": 91, "donAcc_type": "standard", "distance": 2.946, "atom1_id": "///A/10/O", "atom2_id": "///A/14/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 10, "atom1_serNum": 68, "atom2_serNum": 98, "donAcc_type": "standard", "distance": 3.274, "atom1_id": "///A/11/O", "atom2_id": "///A/15/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 11, "atom1_serNum": 77, "atom2_serNum": 107, "donAcc_type": "standard", "distance": 2.775, "atom1_id": "///A/12/O", "atom2_id": "///A/16/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 12, "atom1_serNum": 86, "atom2_serNum": 112, "donAcc_type": "standard", "distance": 2.981, "atom1_id": "///A/13/O", "atom2_id": "///A/17/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 13, "atom1_serNum": 94, "atom2_serNum": 119, "donAcc_type": "standard", "distance": 3.113, "atom1_id": "///A/14/O", "atom2_id": "///A/18/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 14, "atom1_serNum": 94, "atom2_serNum": 124, "donAcc_type": "acceptable", "distance": 2.574, "atom1_id": "///A/14/O", "atom2_id": "///A/18/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 15, "atom1_serNum": 101, "atom2_serNum": 126, "donAcc_type": "standard", "distance": 3.297, "atom1_id": "///A/15/O", "atom2_id": "///A/19/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 16, "atom1_serNum": 110, "atom2_serNum": 133, "donAcc_type": "standard", "distance": 3.193, "atom1_id": "///A/16/O", "atom2_id": "///A/20/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 17, "atom1_serNum": 115, "atom2_serNum": 141, "donAcc_type": "standard", "distance": 3.286, "atom1_id": "///A/17/O", "atom2_id": "///A/21/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 18, "atom1_serNum": 122, "atom2_serNum": 149, "donAcc_type": "standard", "distance": 3.077, "atom1_id": "///A/18/O", "atom2_id": "///A/22/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 19, "atom1_serNum": 129, "atom2_serNum": 177, "donAcc_type": "acceptable", "distance": 3.315, "atom1_id": "///A/19/O", "atom2_id": "///A/25/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 20, "atom1_serNum": 144, "atom2_serNum": 157, "donAcc_type": "standard", "distance": 3.163, "atom1_id": "///A/21/O", "atom2_id": "///A/23/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 21, "atom1_serNum": 152, "atom2_serNum": 227, "donAcc_type": "standard", "distance": 3.079, "atom1_id": "///A/22/O", "atom2_id": "///A/30/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 22, "atom1_serNum": 181, "atom2_serNum": 217, "donAcc_type": "standard", "distance": 3.214, "atom1_id": "///A/26/O", "atom2_id": "///A/30/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 23, "atom1_serNum": 188, "atom2_serNum": 228, "donAcc_type": "standard", "distance": 3.174, "atom1_id": "///A/27/O", "atom2_id": "///A/31/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 24, "atom1_serNum": 197, "atom2_serNum": 236, "donAcc_type": "standard", "distance": 3.257, "atom1_id": "///A/28/O", "atom2_id": "///A/32/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 25, "atom1_serNum": 197, "atom2_serNum": 243, "donAcc_type": "questionable", "distance": 3.056, "atom1_id": "///A/28/O", "atom2_id": "///A/32/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 26, "atom1_serNum": 208, "atom2_serNum": 245, "donAcc_type": "standard", "distance": 3.041, "atom1_id": "///A/29/O", "atom2_id": "///A/33/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 27, "atom1_serNum": 220, "atom2_serNum": 245, "donAcc_type": "standard", "distance": 2.936, "atom1_id": "///A/30/O", "atom2_id": "///A/33/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 28, "atom1_serNum": 220, "atom2_serNum": 250, "donAcc_type": "standard", "distance": 2.813, "atom1_id": "///A/30/O", "atom2_id": "///A/34/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 29, "atom1_serNum": 231, "atom2_serNum": 258, "donAcc_type": "standard", "distance": 2.755, "atom1_id": "///A/31/O", "atom2_id": "///A/35/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 30, "atom1_serNum": 239, "atom2_serNum": 267, "donAcc_type": "standard", "distance": 2.957, "atom1_id": "///A/32/O", "atom2_id": "///A/36/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 31, "atom1_serNum": 248, "atom2_serNum": 278, "donAcc_type": "standard", "distance": 3.173, "atom1_id": "///A/33/O", "atom2_id": "///A/37/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 32, "atom1_serNum": 253, "atom2_serNum": 284, "donAcc_type": "standard", "distance": 3.207, "atom1_id": "///A/34/O", "atom2_id": "///A/38/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 33, "atom1_serNum": 261, "atom2_serNum": 293, "donAcc_type": "standard", "distance": 3.284, "atom1_id": "///A/35/O", "atom2_id": "///A/39/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 34, "atom1_serNum": 270, "atom2_serNum": 302, "donAcc_type": "standard", "distance": 2.930, "atom1_id": "///A/36/O", "atom2_id": "///A/40/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 35, "atom1_serNum": 281, "atom2_serNum": 313, "donAcc_type": "standard", "distance": 2.807, "atom1_id": "///A/37/O", "atom2_id": "///A/41/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 36, "atom1_serNum": 287, "atom2_serNum": 322, "donAcc_type": "standard", "distance": 3.073, "atom1_id": "///A/38/O", "atom2_id": "///A/42/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 37, "atom1_serNum": 292, "atom2_serNum": 321, "donAcc_type": "standard", "distance": 3.085, "atom1_id": "///A/38/OE2", "atom2_id": "///A/41/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 38, "atom1_serNum": 296, "atom2_serNum": 322, "donAcc_type": "standard", "distance": 3.035, "atom1_id": "///A/39/O", "atom2_id": "///A/42/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 39, "atom1_serNum": 296, "atom2_serNum": 331, "donAcc_type": "standard", "distance": 2.857, "atom1_id": "///A/39/O", "atom2_id": "///A/43/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 40, "atom1_serNum": 305, "atom2_serNum": 340, "donAcc_type": "standard", "distance": 3.130, "atom1_id": "///A/40/O", "atom2_id": "///A/44/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 41, "atom1_serNum": 343, "atom2_serNum": 615, "donAcc_type": "standard", "distance": 2.754, "atom1_id": "///A/44/O", "atom2_id": "///A/78/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 42, "atom1_serNum": 343, "atom2_serNum": 616, "donAcc_type": "standard", "distance": 2.898, "atom1_id": "///A/44/O", "atom2_id": "///A/78/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 43, "atom1_serNum": 356, "atom2_serNum": 381, "donAcc_type": "standard", "distance": 3.372, "atom1_id": "///A/46/O", "atom2_id": "///A/50/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 44, "atom1_serNum": 364, "atom2_serNum": 387, "donAcc_type": "standard", "distance": 2.736, "atom1_id": "///A/47/O", "atom2_id": "///A/51/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 45, "atom1_serNum": 370, "atom2_serNum": 391, "donAcc_type": "standard", "distance": 2.915, "atom1_id": "///A/48/O", "atom2_id": "///A/52/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 46, "atom1_serNum": 377, "atom2_serNum": 399, "donAcc_type": "standard", "distance": 3.108, "atom1_id": "///A/49/O", "atom2_id": "///A/53/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 47, "atom1_serNum": 384, "atom2_serNum": 410, "donAcc_type": "standard", "distance": 3.114, "atom1_id": "///A/50/O", "atom2_id": "///A/54/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 48, "atom1_serNum": 390, "atom2_serNum": 418, "donAcc_type": "standard", "distance": 3.063, "atom1_id": "///A/51/O", "atom2_id": "///A/55/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 49, "atom1_serNum": 402, "atom2_serNum": 423, "donAcc_type": "standard", "distance": 3.249, "atom1_id": "///A/53/O", "atom2_id": "///A/56/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 50, "atom1_serNum": 426, "atom2_serNum": 441, "donAcc_type": "standard", "distance": 2.663, "atom1_id": "///A/56/O", "atom2_id": "///A/58/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 51, "atom1_serNum": 426, "atom2_serNum": 448, "donAcc_type": "standard", "distance": 3.067, "atom1_id": "///A/56/O", "atom2_id": "///A/59/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 52, "atom1_serNum": 448, "atom2_serNum": 455, "donAcc_type": "standard", "distance": 2.607, "atom1_id": "///A/59/N", "atom2_id": "///A/59/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 53, "atom1_serNum": 460, "atom2_serNum": 477, "donAcc_type": "standard", "distance": 2.697, "atom1_id": "///A/60/O", "atom2_id": "///A/63/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 54, "atom1_serNum": 460, "atom2_serNum": 484, "donAcc_type": "standard", "distance": 2.916, "atom1_id": "///A/60/O", "atom2_id": "///A/64/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 55, "atom1_serNum": 467, "atom2_serNum": 495, "donAcc_type": "standard", "distance": 2.865, "atom1_id": "///A/61/O", "atom2_id": "///A/65/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 56, "atom1_serNum": 472, "atom2_serNum": 505, "donAcc_type": "standard", "distance": 3.216, "atom1_id": "///A/62/O", "atom2_id": "///A/66/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 57, "atom1_serNum": 480, "atom2_serNum": 516, "donAcc_type": "standard", "distance": 2.933, "atom1_id": "///A/63/O", "atom2_id": "///A/67/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 58, "atom1_serNum": 487, "atom2_serNum": 516, "donAcc_type": "standard", "distance": 2.901, "atom1_id": "///A/64/O", "atom2_id": "///A/67/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 59, "atom1_serNum": 487, "atom2_serNum": 520, "donAcc_type": "standard", "distance": 2.937, "atom1_id": "///A/64/O", "atom2_id": "///A/68/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 60, "atom1_serNum": 493, "atom2_serNum": 856, "donAcc_type": "standard", "distance": 3.019, "atom1_id": "///A/64/NH1", "atom2_id": "///A/108/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 61, "atom1_serNum": 493, "atom2_serNum": 857, "donAcc_type": "standard", "distance": 2.859, "atom1_id": "///A/64/NH1", "atom2_id": "///A/108/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 62, "atom1_serNum": 494, "atom2_serNum": 800, "donAcc_type": "standard", "distance": 3.628, "atom1_id": "///A/64/NH2", "atom2_id": "///A/101/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 63, "atom1_serNum": 498, "atom2_serNum": 528, "donAcc_type": "standard", "distance": 2.905, "atom1_id": "///A/65/O", "atom2_id": "///A/69/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 64, "atom1_serNum": 501, "atom2_serNum": 535, "donAcc_type": "acceptable", "distance": 3.703, "atom1_id": "///A/65/ND1", "atom2_id": "///A/69/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 65, "atom1_serNum": 508, "atom2_serNum": 537, "donAcc_type": "standard", "distance": 3.182, "atom1_id": "///A/66/O", "atom2_id": "///A/70/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 66, "atom1_serNum": 519, "atom2_serNum": 545, "donAcc_type": "standard", "distance": 3.219, "atom1_id": "///A/67/O", "atom2_id": "///A/71/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 67, "atom1_serNum": 523, "atom2_serNum": 553, "donAcc_type": "standard", "distance": 2.914, "atom1_id": "///A/68/O", "atom2_id": "///A/72/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 68, "atom1_serNum": 531, "atom2_serNum": 562, "donAcc_type": "standard", "distance": 2.823, "atom1_id": "///A/69/O", "atom2_id": "///A/73/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 69, "atom1_serNum": 536, "atom2_serNum": 9171, "donAcc_type": "standard", "distance": 3.725, "atom1_id": "///A/69/NE2", "atom2_id": "///C/74/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 70, "atom1_serNum": 540, "atom2_serNum": 562, "donAcc_type": "standard", "distance": 2.739, "atom1_id": "///A/70/O", "atom2_id": "///A/73/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 71, "atom1_serNum": 540, "atom2_serNum": 572, "donAcc_type": "standard", "distance": 2.931, "atom1_id": "///A/70/O", "atom2_id": "///A/74/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 72, "atom1_serNum": 548, "atom2_serNum": 579, "donAcc_type": "standard", "distance": 3.198, "atom1_id": "///A/71/O", "atom2_id": "///A/75/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 73, "atom1_serNum": 556, "atom2_serNum": 586, "donAcc_type": "standard", "distance": 2.938, "atom1_id": "///A/72/O", "atom2_id": "///A/76/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 74, "atom1_serNum": 561, "atom2_serNum": 938, "donAcc_type": "standard", "distance": 3.201, "atom1_id": "///A/72/OE2", "atom2_id": "///A/118/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 75, "atom1_serNum": 565, "atom2_serNum": 595, "donAcc_type": "standard", "distance": 2.749, "atom1_id": "///A/73/O", "atom2_id": "///A/77/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 76, "atom1_serNum": 575, "atom2_serNum": 606, "donAcc_type": "standard", "distance": 2.878, "atom1_id": "///A/74/O", "atom2_id": "///A/78/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 77, "atom1_serNum": 575, "atom2_serNum": 617, "donAcc_type": "standard", "distance": 3.380, "atom1_id": "///A/74/O", "atom2_id": "///A/79/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 78, "atom1_serNum": 609, "atom2_serNum": 639, "donAcc_type": "standard", "distance": 3.196, "atom1_id": "///A/78/O", "atom2_id": "///A/81/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 79, "atom1_serNum": 625, "atom2_serNum": 1015, "donAcc_type": "standard", "distance": 2.729, "atom1_id": "///A/79/NE1", "atom2_id": "///A/127/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 80, "atom1_serNum": 651, "atom2_serNum": 683, "donAcc_type": "standard", "distance": 2.858, "atom1_id": "///A/83/N", "atom2_id": "///A/86/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 81, "atom1_serNum": 654, "atom2_serNum": 685, "donAcc_type": "standard", "distance": 3.140, "atom1_id": "///A/83/O", "atom2_id": "///A/87/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 82, "atom1_serNum": 656, "atom2_serNum": 676, "donAcc_type": "acceptable", "distance": 2.766, "atom1_id": "///A/83/OG", "atom2_id": "///A/86/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 83, "atom1_serNum": 660, "atom2_serNum": 694, "donAcc_type": "standard", "distance": 2.954, "atom1_id": "///A/84/O", "atom2_id": "///A/88/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 84, "atom1_serNum": 671, "atom2_serNum": 701, "donAcc_type": "standard", "distance": 3.059, "atom1_id": "///A/85/O", "atom2_id": "///A/89/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 85, "atom1_serNum": 679, "atom2_serNum": 713, "donAcc_type": "standard", "distance": 3.041, "atom1_id": "///A/86/O", "atom2_id": "///A/90/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 86, "atom1_serNum": 688, "atom2_serNum": 721, "donAcc_type": "standard", "distance": 2.879, "atom1_id": "///A/87/O", "atom2_id": "///A/91/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 87, "atom1_serNum": 697, "atom2_serNum": 730, "donAcc_type": "standard", "distance": 3.050, "atom1_id": "///A/88/O", "atom2_id": "///A/92/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 88, "atom1_serNum": 704, "atom2_serNum": 738, "donAcc_type": "standard", "distance": 2.932, "atom1_id": "///A/89/O", "atom2_id": "///A/93/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 89, "atom1_serNum": 704, "atom2_serNum": 743, "donAcc_type": "acceptable", "distance": 2.737, "atom1_id": "///A/89/O", "atom2_id": "///A/93/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 90, "atom1_serNum": 716, "atom2_serNum": 744, "donAcc_type": "standard", "distance": 3.077, "atom1_id": "///A/90/O", "atom2_id": "///A/94/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 91, "atom1_serNum": 724, "atom2_serNum": 751, "donAcc_type": "standard", "distance": 2.934, "atom1_id": "///A/91/O", "atom2_id": "///A/95/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 92, "atom1_serNum": 733, "atom2_serNum": 759, "donAcc_type": "standard", "distance": 2.740, "atom1_id": "///A/92/O", "atom2_id": "///A/96/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 93, "atom1_serNum": 741, "atom2_serNum": 768, "donAcc_type": "standard", "distance": 2.813, "atom1_id": "///A/93/O", "atom2_id": "///A/97/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 94, "atom1_serNum": 747, "atom2_serNum": 776, "donAcc_type": "standard", "distance": 3.277, "atom1_id": "///A/94/O", "atom2_id": "///A/98/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 95, "atom1_serNum": 754, "atom2_serNum": 784, "donAcc_type": "standard", "distance": 3.293, "atom1_id": "///A/95/O", "atom2_id": "///A/99/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 96, "atom1_serNum": 762, "atom2_serNum": 784, "donAcc_type": "standard", "distance": 2.885, "atom1_id": "///A/96/O", "atom2_id": "///A/99/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 97, "atom1_serNum": 762, "atom2_serNum": 789, "donAcc_type": "standard", "distance": 3.103, "atom1_id": "///A/96/O", "atom2_id": "///A/100/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 98, "atom1_serNum": 762, "atom2_serNum": 797, "donAcc_type": "standard", "distance": 3.587, "atom1_id": "///A/96/O", "atom2_id": "///A/101/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 99, "atom1_serNum": 771, "atom2_serNum": 797, "donAcc_type": "standard", "distance": 2.948, "atom1_id": "///A/97/O", "atom2_id": "///A/101/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 100, "atom1_serNum": 779, "atom2_serNum": 1200, "donAcc_type": "questionable", "distance": 3.232, "atom1_id": "///A/98/O", "atom2_id": "///A/149/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 101, "atom1_serNum": 808, "atom2_serNum": 856, "donAcc_type": "standard", "distance": 2.600, "atom1_id": "///A/103/N", "atom2_id": "///A/108/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 102, "atom1_serNum": 811, "atom2_serNum": 824, "donAcc_type": "standard", "distance": 3.017, "atom1_id": "///A/103/O", "atom2_id": "///A/105/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 103, "atom1_serNum": 819, "atom2_serNum": 832, "donAcc_type": "standard", "distance": 2.755, "atom1_id": "///A/104/O", "atom2_id": "///A/106/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 104, "atom1_serNum": 819, "atom2_serNum": 847, "donAcc_type": "questionable", "distance": 2.931, "atom1_id": "///A/104/O", "atom2_id": "///A/107/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 105, "atom1_serNum": 824, "atom2_serNum": 843, "donAcc_type": "standard", "distance": 3.259, "atom1_id": "///A/105/N", "atom2_id": "///A/107/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 106, "atom1_serNum": 827, "atom2_serNum": 901, "donAcc_type": "standard", "distance": 2.994, "atom1_id": "///A/105/O", "atom2_id": "///A/113/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 107, "atom1_serNum": 840, "atom2_serNum": 847, "donAcc_type": "standard", "distance": 3.159, "atom1_id": "///A/107/N", "atom2_id": "///A/107/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 108, "atom1_serNum": 852, "atom2_serNum": 901, "donAcc_type": "standard", "distance": 3.710, "atom1_id": "///A/108/O", "atom2_id": "///A/113/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 109, "atom1_serNum": 861, "atom2_serNum": 885, "donAcc_type": "standard", "distance": 2.977, "atom1_id": "///A/109/O", "atom2_id": "///A/112/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 110, "atom1_serNum": 870, "atom2_serNum": 902, "donAcc_type": "standard", "distance": 3.159, "atom1_id": "///A/110/O", "atom2_id": "///A/114/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 111, "atom1_serNum": 873, "atom2_serNum": 1805, "donAcc_type": "standard", "distance": 3.295, "atom1_id": "///A/110/OD1", "atom2_id": "///A/222/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 112, "atom1_serNum": 874, "atom2_serNum": 9469, "donAcc_type": "standard", "distance": 2.723, "atom1_id": "///A/110/ND2", "atom2_id": "///C/110/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 113, "atom1_serNum": 878, "atom2_serNum": 910, "donAcc_type": "standard", "distance": 3.093, "atom1_id": "///A/111/O", "atom2_id": "///A/115/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 114, "atom1_serNum": 888, "atom2_serNum": 915, "donAcc_type": "standard", "distance": 2.799, "atom1_id": "///A/112/O", "atom2_id": "///A/116/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 115, "atom1_serNum": 896, "atom2_serNum": 923, "donAcc_type": "standard", "distance": 2.979, "atom1_id": "///A/113/O", "atom2_id": "///A/117/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 116, "atom1_serNum": 901, "atom2_serNum": 1217, "donAcc_type": "standard", "distance": 2.469, "atom1_id": "///A/113/NZ", "atom2_id": "///A/151/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 117, "atom1_serNum": 905, "atom2_serNum": 929, "donAcc_type": "standard", "distance": 2.697, "atom1_id": "///A/114/O", "atom2_id": "///A/118/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 118, "atom1_serNum": 908, "atom2_serNum": 1285, "donAcc_type": "standard", "distance": 2.653, "atom1_id": "///A/114/OD1", "atom2_id": "///A/159/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 119, "atom1_serNum": 909, "atom2_serNum": 936, "donAcc_type": "standard", "distance": 3.250, "atom1_id": "///A/114/OD2", "atom2_id": "///A/118/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 120, "atom1_serNum": 913, "atom2_serNum": 940, "donAcc_type": "standard", "distance": 3.307, "atom1_id": "///A/115/O", "atom2_id": "///A/119/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 121, "atom1_serNum": 918, "atom2_serNum": 948, "donAcc_type": "standard", "distance": 3.258, "atom1_id": "///A/116/O", "atom2_id": "///A/120/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 122, "atom1_serNum": 926, "atom2_serNum": 955, "donAcc_type": "standard", "distance": 3.052, "atom1_id": "///A/117/O", "atom2_id": "///A/121/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 123, "atom1_serNum": 932, "atom2_serNum": 962, "donAcc_type": "standard", "distance": 2.996, "atom1_id": "///A/118/O", "atom2_id": "///A/122/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 124, "atom1_serNum": 939, "atom2_serNum": 9198, "donAcc_type": "standard", "distance": 2.740, "atom1_id": "///A/118/NH2", "atom2_id": "///C/77/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 125, "atom1_serNum": 939, "atom2_serNum": 9449, "donAcc_type": "standard", "distance": 2.978, "atom1_id": "///A/118/NH2", "atom2_id": "///C/107/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 126, "atom1_serNum": 943, "atom2_serNum": 971, "donAcc_type": "standard", "distance": 2.997, "atom1_id": "///A/119/O", "atom2_id": "///A/123/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 127, "atom1_serNum": 951, "atom2_serNum": 971, "donAcc_type": "standard", "distance": 2.872, "atom1_id": "///A/120/O", "atom2_id": "///A/123/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 128, "atom1_serNum": 951, "atom2_serNum": 979, "donAcc_type": "standard", "distance": 2.807, "atom1_id": "///A/120/O", "atom2_id": "///A/124/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 129, "atom1_serNum": 958, "atom2_serNum": 987, "donAcc_type": "standard", "distance": 2.922, "atom1_id": "///A/121/O", "atom2_id": "///A/125/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 130, "atom1_serNum": 965, "atom2_serNum": 996, "donAcc_type": "standard", "distance": 3.116, "atom1_id": "///A/122/O", "atom2_id": "///A/126/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 131, "atom1_serNum": 974, "atom2_serNum": 1007, "donAcc_type": "standard", "distance": 3.328, "atom1_id": "///A/123/O", "atom2_id": "///A/127/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 132, "atom1_serNum": 982, "atom2_serNum": 1016, "donAcc_type": "standard", "distance": 2.917, "atom1_id": "///A/124/O", "atom2_id": "///A/128/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 133, "atom1_serNum": 995, "atom2_serNum": 1316, "donAcc_type": "standard", "distance": 2.927, "atom1_id": "///A/125/NZ", "atom2_id": "///A/163/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 134, "atom1_serNum": 1010, "atom2_serNum": 1056, "donAcc_type": "standard", "distance": 3.181, "atom1_id": "///A/127/O", "atom2_id": "///A/132/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 135, "atom1_serNum": 1059, "atom2_serNum": 1085, "donAcc_type": "standard", "distance": 3.148, "atom1_id": "///A/132/O", "atom2_id": "///A/135/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 136, "atom1_serNum": 1077, "atom2_serNum": 1084, "donAcc_type": "standard", "distance": 2.597, "atom1_id": "///A/134/N", "atom2_id": "///A/134/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 137, "atom1_serNum": 1080, "atom2_serNum": 1101, "donAcc_type": "standard", "distance": 2.970, "atom1_id": "///A/134/O", "atom2_id": "///A/137/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 138, "atom1_serNum": 1080, "atom2_serNum": 1109, "donAcc_type": "standard", "distance": 2.738, "atom1_id": "///A/134/O", "atom2_id": "///A/138/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 139, "atom1_serNum": 1088, "atom2_serNum": 1118, "donAcc_type": "standard", "distance": 2.916, "atom1_id": "///A/135/O", "atom2_id": "///A/139/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 140, "atom1_serNum": 1096, "atom2_serNum": 1126, "donAcc_type": "standard", "distance": 3.238, "atom1_id": "///A/136/O", "atom2_id": "///A/140/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 141, "atom1_serNum": 1104, "atom2_serNum": 1134, "donAcc_type": "standard", "distance": 2.620, "atom1_id": "///A/137/O", "atom2_id": "///A/141/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 142, "atom1_serNum": 1104, "atom2_serNum": 1139, "donAcc_type": "acceptable", "distance": 2.713, "atom1_id": "///A/137/O", "atom2_id": "///A/141/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 143, "atom1_serNum": 1112, "atom2_serNum": 1141, "donAcc_type": "standard", "distance": 2.841, "atom1_id": "///A/138/O", "atom2_id": "///A/142/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 144, "atom1_serNum": 1121, "atom2_serNum": 1149, "donAcc_type": "standard", "distance": 2.869, "atom1_id": "///A/139/O", "atom2_id": "///A/143/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 145, "atom1_serNum": 1129, "atom2_serNum": 1155, "donAcc_type": "standard", "distance": 3.309, "atom1_id": "///A/140/O", "atom2_id": "///A/144/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 146, "atom1_serNum": 1132, "atom2_serNum": 1163, "donAcc_type": "standard", "distance": 3.276, "atom1_id": "///A/140/OD1", "atom2_id": "///A/144/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 147, "atom1_serNum": 1133, "atom2_serNum": 1163, "donAcc_type": "standard", "distance": 3.286, "atom1_id": "///A/140/OD2", "atom2_id": "///A/144/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 148, "atom1_serNum": 1137, "atom2_serNum": 1155, "donAcc_type": "standard", "distance": 3.203, "atom1_id": "///A/141/O", "atom2_id": "///A/144/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 149, "atom1_serNum": 1144, "atom2_serNum": 1164, "donAcc_type": "standard", "distance": 3.159, "atom1_id": "///A/142/O", "atom2_id": "///A/145/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 150, "atom1_serNum": 1152, "atom2_serNum": 1154, "donAcc_type": "acceptable", "distance": 2.782, "atom1_id": "///A/143/O", "atom2_id": "///A/143/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 151, "atom1_serNum": 1152, "atom2_serNum": 1207, "donAcc_type": "acceptable", "distance": 2.708, "atom1_id": "///A/143/O", "atom2_id": "///A/150/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 152, "atom1_serNum": 1154, "atom2_serNum": 1207, "donAcc_type": "acceptable", "distance": 2.859, "atom1_id": "///A/143/OG", "atom2_id": "///A/150/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 153, "atom1_serNum": 1176, "atom2_serNum": 1193, "donAcc_type": "standard", "distance": 3.246, "atom1_id": "///A/146/O", "atom2_id": "///A/149/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 154, "atom1_serNum": 1176, "atom2_serNum": 1201, "donAcc_type": "standard", "distance": 3.385, "atom1_id": "///A/146/O", "atom2_id": "///A/149/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 155, "atom1_serNum": 1176, "atom2_serNum": 1202, "donAcc_type": "standard", "distance": 3.093, "atom1_id": "///A/146/O", "atom2_id": "///A/150/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 156, "atom1_serNum": 1176, "atom2_serNum": 1207, "donAcc_type": "acceptable", "distance": 2.789, "atom1_id": "///A/146/O", "atom2_id": "///A/150/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 157, "atom1_serNum": 1180, "atom2_serNum": 1209, "donAcc_type": "standard", "distance": 3.003, "atom1_id": "///A/147/O", "atom2_id": "///A/151/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 158, "atom1_serNum": 1196, "atom2_serNum": 1226, "donAcc_type": "standard", "distance": 2.972, "atom1_id": "///A/149/O", "atom2_id": "///A/153/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 159, "atom1_serNum": 1205, "atom2_serNum": 1233, "donAcc_type": "standard", "distance": 3.140, "atom1_id": "///A/150/O", "atom2_id": "///A/154/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 160, "atom1_serNum": 1212, "atom2_serNum": 1241, "donAcc_type": "standard", "distance": 3.071, "atom1_id": "///A/151/O", "atom2_id": "///A/155/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 161, "atom1_serNum": 1221, "atom2_serNum": 1252, "donAcc_type": "standard", "distance": 3.180, "atom1_id": "///A/152/O", "atom2_id": "///A/156/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 162, "atom1_serNum": 1229, "atom2_serNum": 1260, "donAcc_type": "standard", "distance": 2.880, "atom1_id": "///A/153/O", "atom2_id": "///A/157/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 163, "atom1_serNum": 1236, "atom2_serNum": 1268, "donAcc_type": "standard", "distance": 3.254, "atom1_id": "///A/154/O", "atom2_id": "///A/158/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 164, "atom1_serNum": 1236, "atom2_serNum": 1855, "donAcc_type": "acceptable", "distance": 3.546, "atom1_id": "///A/154/O", "atom2_id": "///A/230/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 165, "atom1_serNum": 1244, "atom2_serNum": 1276, "donAcc_type": "standard", "distance": 3.163, "atom1_id": "///A/155/O", "atom2_id": "///A/159/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 166, "atom1_serNum": 1255, "atom2_serNum": 1287, "donAcc_type": "standard", "distance": 2.837, "atom1_id": "///A/156/O", "atom2_id": "///A/160/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 167, "atom1_serNum": 1263, "atom2_serNum": 1295, "donAcc_type": "standard", "distance": 3.010, "atom1_id": "///A/157/O", "atom2_id": "///A/161/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 168, "atom1_serNum": 1263, "atom2_serNum": 1885, "donAcc_type": "acceptable", "distance": 2.880, "atom1_id": "///A/157/O", "atom2_id": "///A/234/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 169, "atom1_serNum": 1271, "atom2_serNum": 1300, "donAcc_type": "standard", "distance": 2.903, "atom1_id": "///A/158/O", "atom2_id": "///A/162/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 170, "atom1_serNum": 1279, "atom2_serNum": 1309, "donAcc_type": "standard", "distance": 3.057, "atom1_id": "///A/159/O", "atom2_id": "///A/163/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 171, "atom1_serNum": 1279, "atom2_serNum": 9441, "donAcc_type": "standard", "distance": 3.933, "atom1_id": "///A/159/O", "atom2_id": "///C/106/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 172, "atom1_serNum": 1286, "atom2_serNum": 9449, "donAcc_type": "standard", "distance": 2.627, "atom1_id": "///A/159/NH2", "atom2_id": "///C/107/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 173, "atom1_serNum": 1290, "atom2_serNum": 1317, "donAcc_type": "standard", "distance": 3.202, "atom1_id": "///A/160/O", "atom2_id": "///A/164/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 174, "atom1_serNum": 1298, "atom2_serNum": 1331, "donAcc_type": "standard", "distance": 3.972, "atom1_id": "///A/161/O", "atom2_id": "///A/166/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 175, "atom1_serNum": 1303, "atom2_serNum": 1331, "donAcc_type": "standard", "distance": 3.025, "atom1_id": "///A/162/O", "atom2_id": "///A/166/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 176, "atom1_serNum": 1303, "atom2_serNum": 1338, "donAcc_type": "standard", "distance": 2.787, "atom1_id": "///A/162/O", "atom2_id": "///A/167/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 177, "atom1_serNum": 1307, "atom2_serNum": 9441, "donAcc_type": "standard", "distance": 2.911, "atom1_id": "///A/162/OE1", "atom2_id": "///C/106/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 178, "atom1_serNum": 1307, "atom2_serNum": 9476, "donAcc_type": "standard", "distance": 2.881, "atom1_id": "///A/162/OE1", "atom2_id": "///C/110/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 179, "atom1_serNum": 1308, "atom2_serNum": 9476, "donAcc_type": "standard", "distance": 2.890, "atom1_id": "///A/162/OE2", "atom2_id": "///C/110/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 180, "atom1_serNum": 1312, "atom2_serNum": 1358, "donAcc_type": "standard", "distance": 2.890, "atom1_id": "///A/163/O", "atom2_id": "///A/169/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 181, "atom1_serNum": 1312, "atom2_serNum": 1363, "donAcc_type": "acceptable", "distance": 3.098, "atom1_id": "///A/163/O", "atom2_id": "///A/169/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 182, "atom1_serNum": 1315, "atom2_serNum": 9441, "donAcc_type": "standard", "distance": 2.991, "atom1_id": "///A/163/OD1", "atom2_id": "///C/106/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 183, "atom1_serNum": 1315, "atom2_serNum": 9442, "donAcc_type": "standard", "distance": 2.829, "atom1_id": "///A/163/OD1", "atom2_id": "///C/106/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 184, "atom1_serNum": 1320, "atom2_serNum": 1453, "donAcc_type": "standard", "distance": 3.774, "atom1_id": "///A/164/O", "atom2_id": "///A/179/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 185, "atom1_serNum": 1376, "atom2_serNum": 1396, "donAcc_type": "standard", "distance": 2.952, "atom1_id": "///A/171/O", "atom2_id": "///A/174/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 186, "atom1_serNum": 1376, "atom2_serNum": 1407, "donAcc_type": "standard", "distance": 2.879, "atom1_id": "///A/171/O", "atom2_id": "///A/175/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 187, "atom1_serNum": 1383, "atom2_serNum": 1418, "donAcc_type": "standard", "distance": 3.051, "atom1_id": "///A/172/O", "atom2_id": "///A/176/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 188, "atom1_serNum": 1399, "atom2_serNum": 1437, "donAcc_type": "standard", "distance": 3.610, "atom1_id": "///A/174/O", "atom2_id": "///A/178/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 189, "atom1_serNum": 1410, "atom2_serNum": 1437, "donAcc_type": "standard", "distance": 3.191, "atom1_id": "///A/175/O", "atom2_id": "///A/178/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 190, "atom1_serNum": 1410, "atom2_serNum": 1445, "donAcc_type": "standard", "distance": 3.182, "atom1_id": "///A/175/O", "atom2_id": "///A/179/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 191, "atom1_serNum": 1416, "atom2_serNum": 1453, "donAcc_type": "questionable", "distance": 2.925, "atom1_id": "///A/175/NH1", "atom2_id": "///A/179/NE2", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 192, "atom1_serNum": 1421, "atom2_serNum": 1454, "donAcc_type": "standard", "distance": 3.068, "atom1_id": "///A/176/O", "atom2_id": "///A/180/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 193, "atom1_serNum": 1432, "atom2_serNum": 1463, "donAcc_type": "standard", "distance": 3.149, "atom1_id": "///A/177/O", "atom2_id": "///A/181/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 194, "atom1_serNum": 1432, "atom2_serNum": 1468, "donAcc_type": "acceptable", "distance": 2.248, "atom1_id": "///A/177/O", "atom2_id": "///A/181/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 195, "atom1_serNum": 1440, "atom2_serNum": 1470, "donAcc_type": "standard", "distance": 2.701, "atom1_id": "///A/178/O", "atom2_id": "///A/182/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 196, "atom1_serNum": 1448, "atom2_serNum": 1478, "donAcc_type": "standard", "distance": 3.012, "atom1_id": "///A/179/O", "atom2_id": "///A/183/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 197, "atom1_serNum": 1448, "atom2_serNum": 1483, "donAcc_type": "acceptable", "distance": 2.835, "atom1_id": "///A/179/O", "atom2_id": "///A/183/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 198, "atom1_serNum": 1457, "atom2_serNum": 1485, "donAcc_type": "standard", "distance": 2.852, "atom1_id": "///A/180/O", "atom2_id": "///A/184/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 199, "atom1_serNum": 1466, "atom2_serNum": 1494, "donAcc_type": "standard", "distance": 2.992, "atom1_id": "///A/181/O", "atom2_id": "///A/185/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 200, "atom1_serNum": 1466, "atom2_serNum": 1501, "donAcc_type": "standard", "distance": 2.634, "atom1_id": "///A/181/O", "atom2_id": "///A/185/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 201, "atom1_serNum": 1473, "atom2_serNum": 1502, "donAcc_type": "standard", "distance": 2.897, "atom1_id": "///A/182/O", "atom2_id": "///A/186/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 202, "atom1_serNum": 1481, "atom2_serNum": 1502, "donAcc_type": "standard", "distance": 2.910, "atom1_id": "///A/183/O", "atom2_id": "///A/186/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 203, "atom1_serNum": 1488, "atom2_serNum": 1529, "donAcc_type": "standard", "distance": 3.548, "atom1_id": "///A/184/O", "atom2_id": "///A/188/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 204, "atom1_serNum": 1497, "atom2_serNum": 1530, "donAcc_type": "standard", "distance": 2.812, "atom1_id": "///A/185/O", "atom2_id": "///A/189/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 205, "atom1_serNum": 1505, "atom2_serNum": 1538, "donAcc_type": "standard", "distance": 2.964, "atom1_id": "///A/186/O", "atom2_id": "///A/190/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 206, "atom1_serNum": 1513, "atom2_serNum": 1549, "donAcc_type": "standard", "distance": 2.791, "atom1_id": "///A/187/O", "atom2_id": "///A/191/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 207, "atom1_serNum": 1522, "atom2_serNum": 1555, "donAcc_type": "standard", "distance": 2.799, "atom1_id": "///A/188/O", "atom2_id": "///A/192/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 208, "atom1_serNum": 1533, "atom2_serNum": 1566, "donAcc_type": "standard", "distance": 3.022, "atom1_id": "///A/189/O", "atom2_id": "///A/193/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 209, "atom1_serNum": 1541, "atom2_serNum": 1574, "donAcc_type": "standard", "distance": 3.041, "atom1_id": "///A/190/O", "atom2_id": "///A/194/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 210, "atom1_serNum": 1552, "atom2_serNum": 1582, "donAcc_type": "standard", "distance": 2.957, "atom1_id": "///A/191/O", "atom2_id": "///A/195/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 211, "atom1_serNum": 1558, "atom2_serNum": 1590, "donAcc_type": "standard", "distance": 3.058, "atom1_id": "///A/192/O", "atom2_id": "///A/196/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 212, "atom1_serNum": 1558, "atom2_serNum": 1595, "donAcc_type": "acceptable", "distance": 2.603, "atom1_id": "///A/192/O", "atom2_id": "///A/196/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 213, "atom1_serNum": 1569, "atom2_serNum": 1597, "donAcc_type": "standard", "distance": 3.051, "atom1_id": "///A/193/O", "atom2_id": "///A/197/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 214, "atom1_serNum": 1577, "atom2_serNum": 1605, "donAcc_type": "standard", "distance": 2.912, "atom1_id": "///A/194/O", "atom2_id": "///A/198/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 215, "atom1_serNum": 1585, "atom2_serNum": 1614, "donAcc_type": "standard", "distance": 2.997, "atom1_id": "///A/195/O", "atom2_id": "///A/199/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 216, "atom1_serNum": 1593, "atom2_serNum": 1623, "donAcc_type": "standard", "distance": 2.903, "atom1_id": "///A/196/O", "atom2_id": "///A/200/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 217, "atom1_serNum": 1593, "atom2_serNum": 1630, "donAcc_type": "standard", "distance": 3.056, "atom1_id": "///A/196/O", "atom2_id": "///A/200/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 218, "atom1_serNum": 1600, "atom2_serNum": 1631, "donAcc_type": "standard", "distance": 2.915, "atom1_id": "///A/197/O", "atom2_id": "///A/201/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 219, "atom1_serNum": 1608, "atom2_serNum": 1638, "donAcc_type": "standard", "distance": 3.089, "atom1_id": "///A/198/O", "atom2_id": "///A/202/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 220, "atom1_serNum": 1617, "atom2_serNum": 1646, "donAcc_type": "standard", "distance": 3.008, "atom1_id": "///A/199/O", "atom2_id": "///A/203/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 221, "atom1_serNum": 1626, "atom2_serNum": 1655, "donAcc_type": "standard", "distance": 3.101, "atom1_id": "///A/200/O", "atom2_id": "///A/204/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 222, "atom1_serNum": 1634, "atom2_serNum": 1655, "donAcc_type": "standard", "distance": 2.827, "atom1_id": "///A/201/O", "atom2_id": "///A/204/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 223, "atom1_serNum": 1634, "atom2_serNum": 1667, "donAcc_type": "standard", "distance": 2.867, "atom1_id": "///A/201/O", "atom2_id": "///A/205/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 224, "atom1_serNum": 1641, "atom2_serNum": 1667, "donAcc_type": "standard", "distance": 2.605, "atom1_id": "///A/202/O", "atom2_id": "///A/205/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 225, "atom1_serNum": 1641, "atom2_serNum": 1676, "donAcc_type": "standard", "distance": 3.535, "atom1_id": "///A/202/O", "atom2_id": "///A/206/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 226, "atom1_serNum": 1649, "atom2_serNum": 1685, "donAcc_type": "standard", "distance": 3.554, "atom1_id": "///A/203/O", "atom2_id": "///A/207/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 227, "atom1_serNum": 1675, "atom2_serNum": 2091, "donAcc_type": "standard", "distance": 3.788, "atom1_id": "///A/205/NE2", "atom2_id": "///A/260/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 228, "atom1_serNum": 1695, "atom2_serNum": 1708, "donAcc_type": "standard", "distance": 3.261, "atom1_id": "///A/208/O", "atom2_id": "///A/210/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 229, "atom1_serNum": 1700, "atom2_serNum": 2092, "donAcc_type": "standard", "distance": 3.236, "atom1_id": "///A/208/NZ", "atom2_id": "///A/260/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 230, "atom1_serNum": 1711, "atom2_serNum": 1723, "donAcc_type": "standard", "distance": 2.589, "atom1_id": "///A/210/O", "atom2_id": "///A/212/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 231, "atom1_serNum": 1711, "atom2_serNum": 1729, "donAcc_type": "standard", "distance": 3.245, "atom1_id": "///A/210/O", "atom2_id": "///A/213/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 232, "atom1_serNum": 1732, "atom2_serNum": 1762, "donAcc_type": "standard", "distance": 3.360, "atom1_id": "///A/213/O", "atom2_id": "///A/217/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 233, "atom1_serNum": 1741, "atom2_serNum": 1767, "donAcc_type": "standard", "distance": 2.982, "atom1_id": "///A/214/O", "atom2_id": "///A/218/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 234, "atom1_serNum": 1750, "atom2_serNum": 1776, "donAcc_type": "standard", "distance": 3.195, "atom1_id": "///A/215/O", "atom2_id": "///A/219/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 235, "atom1_serNum": 1756, "atom2_serNum": 1781, "donAcc_type": "standard", "distance": 2.995, "atom1_id": "///A/216/O", "atom2_id": "///A/220/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 236, "atom1_serNum": 1756, "atom2_serNum": 1788, "donAcc_type": "standard", "distance": 2.735, "atom1_id": "///A/216/O", "atom2_id": "///A/220/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 237, "atom1_serNum": 1765, "atom2_serNum": 1789, "donAcc_type": "standard", "distance": 3.069, "atom1_id": "///A/217/O", "atom2_id": "///A/221/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 238, "atom1_serNum": 1779, "atom2_serNum": 1806, "donAcc_type": "standard", "distance": 3.261, "atom1_id": "///A/219/O", "atom2_id": "///A/223/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 239, "atom1_serNum": 1784, "atom2_serNum": 1813, "donAcc_type": "standard", "distance": 3.376, "atom1_id": "///A/220/O", "atom2_id": "///A/224/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 240, "atom1_serNum": 1792, "atom2_serNum": 1813, "donAcc_type": "standard", "distance": 2.729, "atom1_id": "///A/221/O", "atom2_id": "///A/224/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 241, "atom1_serNum": 1792, "atom2_serNum": 1817, "donAcc_type": "standard", "distance": 3.182, "atom1_id": "///A/221/O", "atom2_id": "///A/225/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 242, "atom1_serNum": 1798, "atom2_serNum": 1824, "donAcc_type": "standard", "distance": 3.070, "atom1_id": "///A/222/O", "atom2_id": "///A/226/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 243, "atom1_serNum": 1804, "atom2_serNum": 9497, "donAcc_type": "standard", "distance": 3.249, "atom1_id": "///A/222/NH1", "atom2_id": "///C/113/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 244, "atom1_serNum": 1809, "atom2_serNum": 1829, "donAcc_type": "standard", "distance": 2.769, "atom1_id": "///A/223/O", "atom2_id": "///A/227/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 245, "atom1_serNum": 1816, "atom2_serNum": 1829, "donAcc_type": "standard", "distance": 2.753, "atom1_id": "///A/224/O", "atom2_id": "///A/227/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 246, "atom1_serNum": 1816, "atom2_serNum": 1834, "donAcc_type": "standard", "distance": 2.772, "atom1_id": "///A/224/O", "atom2_id": "///A/228/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 247, "atom1_serNum": 1820, "atom2_serNum": 1842, "donAcc_type": "standard", "distance": 2.909, "atom1_id": "///A/225/O", "atom2_id": "///A/229/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 248, "atom1_serNum": 1827, "atom2_serNum": 1850, "donAcc_type": "standard", "distance": 2.764, "atom1_id": "///A/226/O", "atom2_id": "///A/230/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 249, "atom1_serNum": 1832, "atom2_serNum": 1857, "donAcc_type": "standard", "distance": 2.533, "atom1_id": "///A/227/O", "atom2_id": "///A/231/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 250, "atom1_serNum": 1837, "atom2_serNum": 1865, "donAcc_type": "standard", "distance": 3.108, "atom1_id": "///A/228/O", "atom2_id": "///A/232/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 251, "atom1_serNum": 1845, "atom2_serNum": 1870, "donAcc_type": "standard", "distance": 3.433, "atom1_id": "///A/229/O", "atom2_id": "///A/233/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 252, "atom1_serNum": 1860, "atom2_serNum": 1874, "donAcc_type": "standard", "distance": 2.911, "atom1_id": "///A/231/O", "atom2_id": "///A/234/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 253, "atom1_serNum": 1860, "atom2_serNum": 1886, "donAcc_type": "standard", "distance": 3.110, "atom1_id": "///A/231/O", "atom2_id": "///A/235/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 254, "atom1_serNum": 1873, "atom2_serNum": 1910, "donAcc_type": "standard", "distance": 2.721, "atom1_id": "///A/233/O", "atom2_id": "///A/237/NE1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 255, "atom1_serNum": 1877, "atom2_serNum": 1902, "donAcc_type": "standard", "distance": 3.001, "atom1_id": "///A/234/O", "atom2_id": "///A/237/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 256, "atom1_serNum": 1877, "atom2_serNum": 1916, "donAcc_type": "standard", "distance": 2.971, "atom1_id": "///A/234/O", "atom2_id": "///A/238/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 257, "atom1_serNum": 1889, "atom2_serNum": 2216, "donAcc_type": "standard", "distance": 3.127, "atom1_id": "///A/235/O", "atom2_id": "///A/277/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 258, "atom1_serNum": 1919, "atom2_serNum": 2216, "donAcc_type": "standard", "distance": 2.707, "atom1_id": "///A/238/O", "atom2_id": "///A/277/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 259, "atom1_serNum": 1926, "atom2_serNum": 1943, "donAcc_type": "standard", "distance": 3.061, "atom1_id": "///A/239/O", "atom2_id": "///A/242/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 260, "atom1_serNum": 1928, "atom2_serNum": 1942, "donAcc_type": "acceptable", "distance": 3.183, "atom1_id": "///A/239/OG", "atom2_id": "///A/241/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 261, "atom1_serNum": 1932, "atom2_serNum": 1953, "donAcc_type": "standard", "distance": 2.866, "atom1_id": "///A/240/O", "atom2_id": "///A/243/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 262, "atom1_serNum": 1932, "atom2_serNum": 1961, "donAcc_type": "standard", "distance": 2.988, "atom1_id": "///A/240/O", "atom2_id": "///A/244/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 263, "atom1_serNum": 1940, "atom2_serNum": 1968, "donAcc_type": "standard", "distance": 2.716, "atom1_id": "///A/241/O", "atom2_id": "///A/245/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 264, "atom1_serNum": 1964, "atom2_serNum": 1990, "donAcc_type": "standard", "distance": 2.770, "atom1_id": "///A/244/O", "atom2_id": "///A/248/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 265, "atom1_serNum": 1993, "atom2_serNum": 2021, "donAcc_type": "standard", "distance": 3.122, "atom1_id": "///A/248/O", "atom2_id": "///A/252/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 266, "atom1_serNum": 1999, "atom2_serNum": 2030, "donAcc_type": "standard", "distance": 2.912, "atom1_id": "///A/249/O", "atom2_id": "///A/253/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 267, "atom1_serNum": 2008, "atom2_serNum": 2038, "donAcc_type": "standard", "distance": 3.213, "atom1_id": "///A/250/O", "atom2_id": "///A/254/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 268, "atom1_serNum": 2024, "atom2_serNum": 2046, "donAcc_type": "standard", "distance": 2.924, "atom1_id": "///A/252/O", "atom2_id": "///A/255/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 269, "atom1_serNum": 2024, "atom2_serNum": 2052, "donAcc_type": "standard", "distance": 3.110, "atom1_id": "///A/252/O", "atom2_id": "///A/256/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 270, "atom1_serNum": 2029, "atom2_serNum": 2353, "donAcc_type": "standard", "distance": 3.265, "atom1_id": "///A/252/OE2", "atom2_id": "///A/295/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 271, "atom1_serNum": 2033, "atom2_serNum": 2060, "donAcc_type": "standard", "distance": 2.717, "atom1_id": "///A/253/O", "atom2_id": "///A/257/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 272, "atom1_serNum": 2049, "atom2_serNum": 2068, "donAcc_type": "standard", "distance": 2.951, "atom1_id": "///A/255/O", "atom2_id": "///A/258/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 273, "atom1_serNum": 2055, "atom2_serNum": 2076, "donAcc_type": "standard", "distance": 3.414, "atom1_id": "///A/256/O", "atom2_id": "///A/259/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 274, "atom1_serNum": 2063, "atom2_serNum": 2084, "donAcc_type": "standard", "distance": 3.294, "atom1_id": "///A/257/O", "atom2_id": "///A/260/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 275, "atom1_serNum": 2071, "atom2_serNum": 2126, "donAcc_type": "questionable", "distance": 3.228, "atom1_id": "///A/258/O", "atom2_id": "///A/264/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 276, "atom1_serNum": 2083, "atom2_serNum": 2379, "donAcc_type": "standard", "distance": 3.010, "atom1_id": "///A/259/ND2", "atom2_id": "///A/298/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 277, "atom1_serNum": 2087, "atom2_serNum": 2111, "donAcc_type": "standard", "distance": 2.786, "atom1_id": "///A/260/O", "atom2_id": "///A/263/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 278, "atom1_serNum": 2087, "atom2_serNum": 2119, "donAcc_type": "standard", "distance": 2.765, "atom1_id": "///A/260/O", "atom2_id": "///A/264/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 279, "atom1_serNum": 2093, "atom2_serNum": 2100, "donAcc_type": "standard", "distance": 2.928, "atom1_id": "///A/261/N", "atom2_id": "///A/261/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 280, "atom1_serNum": 2096, "atom2_serNum": 2127, "donAcc_type": "standard", "distance": 3.434, "atom1_id": "///A/261/O", "atom2_id": "///A/264/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 281, "atom1_serNum": 2114, "atom2_serNum": 2136, "donAcc_type": "standard", "distance": 3.071, "atom1_id": "///A/263/O", "atom2_id": "///A/266/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 282, "atom1_serNum": 2114, "atom2_serNum": 2140, "donAcc_type": "standard", "distance": 2.972, "atom1_id": "///A/263/O", "atom2_id": "///A/267/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 283, "atom1_serNum": 2122, "atom2_serNum": 2145, "donAcc_type": "standard", "distance": 2.627, "atom1_id": "///A/264/O", "atom2_id": "///A/268/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 284, "atom1_serNum": 2131, "atom2_serNum": 2150, "donAcc_type": "standard", "distance": 3.039, "atom1_id": "///A/265/O", "atom2_id": "///A/269/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 285, "atom1_serNum": 2139, "atom2_serNum": 2159, "donAcc_type": "standard", "distance": 2.985, "atom1_id": "///A/266/O", "atom2_id": "///A/270/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 286, "atom1_serNum": 2143, "atom2_serNum": 2165, "donAcc_type": "standard", "distance": 2.970, "atom1_id": "///A/267/O", "atom2_id": "///A/271/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 287, "atom1_serNum": 2148, "atom2_serNum": 2173, "donAcc_type": "standard", "distance": 2.912, "atom1_id": "///A/268/O", "atom2_id": "///A/272/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 288, "atom1_serNum": 2153, "atom2_serNum": 2181, "donAcc_type": "standard", "distance": 3.219, "atom1_id": "///A/269/O", "atom2_id": "///A/273/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 289, "atom1_serNum": 2162, "atom2_serNum": 2189, "donAcc_type": "standard", "distance": 3.123, "atom1_id": "///A/270/O", "atom2_id": "///A/274/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 290, "atom1_serNum": 2168, "atom2_serNum": 2194, "donAcc_type": "standard", "distance": 3.147, "atom1_id": "///A/271/O", "atom2_id": "///A/275/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 291, "atom1_serNum": 2176, "atom2_serNum": 2201, "donAcc_type": "standard", "distance": 3.153, "atom1_id": "///A/272/O", "atom2_id": "///A/276/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 292, "atom1_serNum": 2176, "atom2_serNum": 2206, "donAcc_type": "acceptable", "distance": 2.655, "atom1_id": "///A/272/O", "atom2_id": "///A/276/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 293, "atom1_serNum": 2192, "atom2_serNum": 2207, "donAcc_type": "standard", "distance": 3.280, "atom1_id": "///A/274/O", "atom2_id": "///A/277/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 294, "atom1_serNum": 2197, "atom2_serNum": 2639, "donAcc_type": "standard", "distance": 3.163, "atom1_id": "///A/275/O", "atom2_id": "///A/332/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 295, "atom1_serNum": 2230, "atom2_serNum": 2274, "donAcc_type": "standard", "distance": 2.875, "atom1_id": "///A/279/O", "atom2_id": "///A/284/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 296, "atom1_serNum": 2234, "atom2_serNum": 2257, "donAcc_type": "standard", "distance": 3.054, "atom1_id": "///A/280/O", "atom2_id": "///A/283/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 297, "atom1_serNum": 2243, "atom2_serNum": 2265, "donAcc_type": "standard", "distance": 3.218, "atom1_id": "///A/281/O", "atom2_id": "///A/284/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 298, "atom1_serNum": 2243, "atom2_serNum": 2276, "donAcc_type": "standard", "distance": 3.439, "atom1_id": "///A/281/O", "atom2_id": "///A/285/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 299, "atom1_serNum": 2268, "atom2_serNum": 2292, "donAcc_type": "standard", "distance": 2.616, "atom1_id": "///A/284/O", "atom2_id": "///A/287/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 300, "atom1_serNum": 2272, "atom2_serNum": 2638, "donAcc_type": "standard", "distance": 2.988, "atom1_id": "///A/284/NE", "atom2_id": "///A/332/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 301, "atom1_serNum": 2279, "atom2_serNum": 2300, "donAcc_type": "standard", "distance": 3.101, "atom1_id": "///A/285/O", "atom2_id": "///A/288/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 302, "atom1_serNum": 2288, "atom2_serNum": 2308, "donAcc_type": "standard", "distance": 3.256, "atom1_id": "///A/286/O", "atom2_id": "///A/289/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 303, "atom1_serNum": 2295, "atom2_serNum": 2315, "donAcc_type": "standard", "distance": 3.256, "atom1_id": "///A/287/O", "atom2_id": "///A/290/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 304, "atom1_serNum": 2303, "atom2_serNum": 2323, "donAcc_type": "standard", "distance": 2.996, "atom1_id": "///A/288/O", "atom2_id": "///A/291/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 305, "atom1_serNum": 2311, "atom2_serNum": 2334, "donAcc_type": "standard", "distance": 2.858, "atom1_id": "///A/289/O", "atom2_id": "///A/292/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 306, "atom1_serNum": 2326, "atom2_serNum": 2748, "donAcc_type": "questionable", "distance": 3.330, "atom1_id": "///A/291/O", "atom2_id": "///A/348/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 307, "atom1_serNum": 2337, "atom2_serNum": 2358, "donAcc_type": "standard", "distance": 2.862, "atom1_id": "///A/292/O", "atom2_id": "///A/296/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 308, "atom1_serNum": 2338, "atom2_serNum": 2748, "donAcc_type": "standard", "distance": 3.090, "atom1_id": "///A/293/N", "atom2_id": "///A/348/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 309, "atom1_serNum": 2349, "atom2_serNum": 2366, "donAcc_type": "standard", "distance": 3.203, "atom1_id": "///A/294/O", "atom2_id": "///A/297/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 310, "atom1_serNum": 2356, "atom2_serNum": 2376, "donAcc_type": "standard", "distance": 2.957, "atom1_id": "///A/295/O", "atom2_id": "///A/298/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 311, "atom1_serNum": 2356, "atom2_serNum": 2388, "donAcc_type": "standard", "distance": 2.985, "atom1_id": "///A/295/O", "atom2_id": "///A/299/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 312, "atom1_serNum": 2361, "atom2_serNum": 2396, "donAcc_type": "standard", "distance": 2.799, "atom1_id": "///A/296/O", "atom2_id": "///A/300/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 313, "atom1_serNum": 2369, "atom2_serNum": 2404, "donAcc_type": "standard", "distance": 3.161, "atom1_id": "///A/297/O", "atom2_id": "///A/301/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 314, "atom1_serNum": 2379, "atom2_serNum": 2410, "donAcc_type": "standard", "distance": 3.208, "atom1_id": "///A/298/O", "atom2_id": "///A/302/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 315, "atom1_serNum": 2391, "atom2_serNum": 2415, "donAcc_type": "standard", "distance": 3.055, "atom1_id": "///A/299/O", "atom2_id": "///A/303/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 316, "atom1_serNum": 2399, "atom2_serNum": 2420, "donAcc_type": "standard", "distance": 2.804, "atom1_id": "///A/300/O", "atom2_id": "///A/304/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 317, "atom1_serNum": 2413, "atom2_serNum": 2434, "donAcc_type": "acceptable", "distance": 2.506, "atom1_id": "///A/302/O", "atom2_id": "///A/305/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 318, "atom1_serNum": 2418, "atom2_serNum": 2436, "donAcc_type": "standard", "distance": 3.337, "atom1_id": "///A/303/O", "atom2_id": "///A/306/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 319, "atom1_serNum": 2428, "atom2_serNum": 2802, "donAcc_type": "standard", "distance": 3.773, "atom1_id": "///A/304/NE2", "atom2_id": "///A/354/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 320, "atom1_serNum": 2432, "atom2_serNum": 2503, "donAcc_type": "standard", "distance": 2.854, "atom1_id": "///A/305/O", "atom2_id": "///A/315/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 321, "atom1_serNum": 2452, "atom2_serNum": 2457, "donAcc_type": "standard", "distance": 2.693, "atom1_id": "///A/308/O", "atom2_id": "///A/310/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 322, "atom1_serNum": 2452, "atom2_serNum": 3338, "donAcc_type": "acceptable", "distance": 3.029, "atom1_id": "///A/308/O", "atom2_id": "///A/421/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 323, "atom1_serNum": 2460, "atom2_serNum": 2469, "donAcc_type": "standard", "distance": 3.372, "atom1_id": "///A/310/O", "atom2_id": "///A/312/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 324, "atom1_serNum": 2472, "atom2_serNum": 2494, "donAcc_type": "standard", "distance": 2.834, "atom1_id": "///A/312/O", "atom2_id": "///A/315/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 325, "atom1_serNum": 2472, "atom2_serNum": 2504, "donAcc_type": "standard", "distance": 2.959, "atom1_id": "///A/312/O", "atom2_id": "///A/316/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 326, "atom1_serNum": 2479, "atom2_serNum": 2516, "donAcc_type": "standard", "distance": 3.174, "atom1_id": "///A/313/O", "atom2_id": "///A/317/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 327, "atom1_serNum": 2484, "atom2_serNum": 9953, "donAcc_type": "standard", "distance": 2.539, "atom1_id": "///A/313/OE2", "atom2_id": "///C/167/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 328, "atom1_serNum": 2488, "atom2_serNum": 2523, "donAcc_type": "standard", "distance": 3.278, "atom1_id": "///A/314/O", "atom2_id": "///A/318/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 329, "atom1_serNum": 2497, "atom2_serNum": 2534, "donAcc_type": "standard", "distance": 2.964, "atom1_id": "///A/315/O", "atom2_id": "///A/319/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 330, "atom1_serNum": 2507, "atom2_serNum": 2542, "donAcc_type": "standard", "distance": 2.886, "atom1_id": "///A/316/O", "atom2_id": "///A/320/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 331, "atom1_serNum": 2515, "atom2_serNum": 2880, "donAcc_type": "acceptable", "distance": 3.005, "atom1_id": "///A/316/OH", "atom2_id": "///A/364/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 332, "atom1_serNum": 2515, "atom2_serNum": 3374, "donAcc_type": "acceptable", "distance": 2.477, "atom1_id": "///A/316/OH", "atom2_id": "///A/425/OD2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 333, "atom1_serNum": 2526, "atom2_serNum": 2551, "donAcc_type": "standard", "distance": 2.856, "atom1_id": "///A/318/O", "atom2_id": "///A/321/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 334, "atom1_serNum": 2526, "atom2_serNum": 2562, "donAcc_type": "standard", "distance": 2.782, "atom1_id": "///A/318/O", "atom2_id": "///A/322/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 335, "atom1_serNum": 2537, "atom2_serNum": 2570, "donAcc_type": "standard", "distance": 2.986, "atom1_id": "///A/319/O", "atom2_id": "///A/323/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 336, "atom1_serNum": 2545, "atom2_serNum": 2584, "donAcc_type": "standard", "distance": 2.866, "atom1_id": "///A/320/O", "atom2_id": "///A/324/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 337, "atom1_serNum": 2550, "atom2_serNum": 3373, "donAcc_type": "standard", "distance": 3.174, "atom1_id": "///A/320/NZ", "atom2_id": "///A/425/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 338, "atom1_serNum": 2554, "atom2_serNum": 2576, "donAcc_type": "standard", "distance": 2.857, "atom1_id": "///A/321/O", "atom2_id": "///A/324/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 339, "atom1_serNum": 2554, "atom2_serNum": 2585, "donAcc_type": "standard", "distance": 3.069, "atom1_id": "///A/321/O", "atom2_id": "///A/325/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 340, "atom1_serNum": 2565, "atom2_serNum": 2592, "donAcc_type": "standard", "distance": 2.986, "atom1_id": "///A/322/O", "atom2_id": "///A/326/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 341, "atom1_serNum": 2573, "atom2_serNum": 2600, "donAcc_type": "standard", "distance": 2.914, "atom1_id": "///A/323/O", "atom2_id": "///A/327/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 342, "atom1_serNum": 2579, "atom2_serNum": 2606, "donAcc_type": "standard", "distance": 3.006, "atom1_id": "///A/324/O", "atom2_id": "///A/328/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 343, "atom1_serNum": 2588, "atom2_serNum": 2611, "donAcc_type": "standard", "distance": 2.991, "atom1_id": "///A/325/O", "atom2_id": "///A/329/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 344, "atom1_serNum": 2595, "atom2_serNum": 2619, "donAcc_type": "standard", "distance": 3.096, "atom1_id": "///A/326/O", "atom2_id": "///A/330/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 345, "atom1_serNum": 2595, "atom2_serNum": 2785, "donAcc_type": "acceptable", "distance": 2.531, "atom1_id": "///A/326/O", "atom2_id": "///A/352/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 346, "atom1_serNum": 2603, "atom2_serNum": 2623, "donAcc_type": "standard", "distance": 3.069, "atom1_id": "///A/327/O", "atom2_id": "///A/331/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 347, "atom1_serNum": 2603, "atom2_serNum": 2629, "donAcc_type": "questionable", "distance": 2.547, "atom1_id": "///A/327/O", "atom2_id": "///A/331/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 348, "atom1_serNum": 2609, "atom2_serNum": 2631, "donAcc_type": "standard", "distance": 2.757, "atom1_id": "///A/328/O", "atom2_id": "///A/332/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 349, "atom1_serNum": 2614, "atom2_serNum": 2640, "donAcc_type": "standard", "distance": 2.987, "atom1_id": "///A/329/O", "atom2_id": "///A/333/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 350, "atom1_serNum": 2622, "atom2_serNum": 2648, "donAcc_type": "standard", "distance": 2.811, "atom1_id": "///A/330/O", "atom2_id": "///A/334/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 351, "atom1_serNum": 2626, "atom2_serNum": 2654, "donAcc_type": "standard", "distance": 2.926, "atom1_id": "///A/331/O", "atom2_id": "///A/335/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 352, "atom1_serNum": 2629, "atom2_serNum": 2961, "donAcc_type": "acceptable", "distance": 2.925, "atom1_id": "///A/331/OD1", "atom2_id": "///A/374/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 353, "atom1_serNum": 2634, "atom2_serNum": 2654, "donAcc_type": "standard", "distance": 2.982, "atom1_id": "///A/332/O", "atom2_id": "///A/335/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 354, "atom1_serNum": 2634, "atom2_serNum": 2659, "donAcc_type": "standard", "distance": 2.840, "atom1_id": "///A/332/O", "atom2_id": "///A/336/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 355, "atom1_serNum": 2643, "atom2_serNum": 2667, "donAcc_type": "standard", "distance": 3.067, "atom1_id": "///A/333/O", "atom2_id": "///A/337/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 356, "atom1_serNum": 2670, "atom2_serNum": 2684, "donAcc_type": "standard", "distance": 2.741, "atom1_id": "///A/337/O", "atom2_id": "///A/340/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 357, "atom1_serNum": 2682, "atom2_serNum": 2692, "donAcc_type": "standard", "distance": 2.337, "atom1_id": "///A/339/O", "atom2_id": "///A/341/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 358, "atom1_serNum": 2687, "atom2_serNum": 2698, "donAcc_type": "standard", "distance": 2.830, "atom1_id": "///A/340/O", "atom2_id": "///A/342/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 359, "atom1_serNum": 2695, "atom2_serNum": 2706, "donAcc_type": "standard", "distance": 2.895, "atom1_id": "///A/341/O", "atom2_id": "///A/343/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 360, "atom1_serNum": 2732, "atom2_serNum": 2750, "donAcc_type": "standard", "distance": 3.267, "atom1_id": "///A/346/O", "atom2_id": "///A/349/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 361, "atom1_serNum": 2739, "atom2_serNum": 2750, "donAcc_type": "standard", "distance": 2.978, "atom1_id": "///A/347/O", "atom2_id": "///A/349/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 362, "atom1_serNum": 2745, "atom2_serNum": 2765, "donAcc_type": "standard", "distance": 2.962, "atom1_id": "///A/348/O", "atom2_id": "///A/351/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 363, "atom1_serNum": 2745, "atom2_serNum": 2774, "donAcc_type": "standard", "distance": 3.273, "atom1_id": "///A/348/O", "atom2_id": "///A/352/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 364, "atom1_serNum": 2753, "atom2_serNum": 2786, "donAcc_type": "standard", "distance": 3.057, "atom1_id": "///A/349/O", "atom2_id": "///A/353/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 365, "atom1_serNum": 2764, "atom2_serNum": 2794, "donAcc_type": "standard", "distance": 2.880, "atom1_id": "///A/350/O", "atom2_id": "///A/354/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 366, "atom1_serNum": 2768, "atom2_serNum": 2803, "donAcc_type": "standard", "distance": 2.888, "atom1_id": "///A/351/O", "atom2_id": "///A/355/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 367, "atom1_serNum": 2777, "atom2_serNum": 2809, "donAcc_type": "standard", "distance": 2.620, "atom1_id": "///A/352/O", "atom2_id": "///A/356/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 368, "atom1_serNum": 2789, "atom2_serNum": 2820, "donAcc_type": "standard", "distance": 2.826, "atom1_id": "///A/353/O", "atom2_id": "///A/357/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 369, "atom1_serNum": 2797, "atom2_serNum": 2828, "donAcc_type": "standard", "distance": 3.314, "atom1_id": "///A/354/O", "atom2_id": "///A/358/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 370, "atom1_serNum": 2806, "atom2_serNum": 2828, "donAcc_type": "standard", "distance": 3.031, "atom1_id": "///A/355/O", "atom2_id": "///A/358/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 371, "atom1_serNum": 2812, "atom2_serNum": 2844, "donAcc_type": "standard", "distance": 3.133, "atom1_id": "///A/356/O", "atom2_id": "///A/360/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 372, "atom1_serNum": 2812, "atom2_serNum": 2849, "donAcc_type": "acceptable", "distance": 2.872, "atom1_id": "///A/356/O", "atom2_id": "///A/360/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 373, "atom1_serNum": 2823, "atom2_serNum": 2844, "donAcc_type": "standard", "distance": 2.731, "atom1_id": "///A/357/O", "atom2_id": "///A/360/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 374, "atom1_serNum": 2823, "atom2_serNum": 2851, "donAcc_type": "standard", "distance": 3.067, "atom1_id": "///A/357/O", "atom2_id": "///A/361/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 375, "atom1_serNum": 2849, "atom2_serNum": 2971, "donAcc_type": "acceptable", "distance": 3.065, "atom1_id": "///A/360/OG1", "atom2_id": "///A/375/NE1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 376, "atom1_serNum": 2871, "atom2_serNum": 3311, "donAcc_type": "acceptable", "distance": 2.769, "atom1_id": "///A/363/O", "atom2_id": "///A/418/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 377, "atom1_serNum": 2878, "atom2_serNum": 2909, "donAcc_type": "standard", "distance": 3.053, "atom1_id": "///A/364/O", "atom2_id": "///A/368/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 378, "atom1_serNum": 2884, "atom2_serNum": 2920, "donAcc_type": "standard", "distance": 2.950, "atom1_id": "///A/365/O", "atom2_id": "///A/369/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 379, "atom1_serNum": 2884, "atom2_serNum": 2925, "donAcc_type": "acceptable", "distance": 3.026, "atom1_id": "///A/365/O", "atom2_id": "///A/369/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 380, "atom1_serNum": 2893, "atom2_serNum": 2926, "donAcc_type": "standard", "distance": 3.095, "atom1_id": "///A/366/O", "atom2_id": "///A/370/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 381, "atom1_serNum": 2893, "atom2_serNum": 2931, "donAcc_type": "acceptable", "distance": 2.888, "atom1_id": "///A/366/O", "atom2_id": "///A/370/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 382, "atom1_serNum": 2904, "atom2_serNum": 2932, "donAcc_type": "standard", "distance": 3.621, "atom1_id": "///A/367/O", "atom2_id": "///A/371/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 383, "atom1_serNum": 2912, "atom2_serNum": 2932, "donAcc_type": "standard", "distance": 3.090, "atom1_id": "///A/368/O", "atom2_id": "///A/371/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 384, "atom1_serNum": 2912, "atom2_serNum": 2937, "donAcc_type": "acceptable", "distance": 2.773, "atom1_id": "///A/368/O", "atom2_id": "///A/371/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 385, "atom1_serNum": 2912, "atom2_serNum": 2947, "donAcc_type": "standard", "distance": 3.248, "atom1_id": "///A/368/O", "atom2_id": "///A/372/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 386, "atom1_serNum": 2925, "atom2_serNum": 3490, "donAcc_type": "acceptable", "distance": 2.978, "atom1_id": "///A/369/OG", "atom2_id": "///A/439/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 387, "atom1_serNum": 2935, "atom2_serNum": 2956, "donAcc_type": "standard", "distance": 3.040, "atom1_id": "///A/371/O", "atom2_id": "///A/374/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 388, "atom1_serNum": 2935, "atom2_serNum": 2963, "donAcc_type": "standard", "distance": 3.087, "atom1_id": "///A/371/O", "atom2_id": "///A/375/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 389, "atom1_serNum": 2942, "atom2_serNum": 2977, "donAcc_type": "standard", "distance": 2.703, "atom1_id": "///A/372/O", "atom2_id": "///A/376/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 390, "atom1_serNum": 2946, "atom2_serNum": 3155, "donAcc_type": "acceptable", "distance": 3.026, "atom1_id": "///A/372/OE1", "atom2_id": "///A/397/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 391, "atom1_serNum": 2951, "atom2_serNum": 2981, "donAcc_type": "standard", "distance": 2.951, "atom1_id": "///A/373/O", "atom2_id": "///A/377/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 392, "atom1_serNum": 2959, "atom2_serNum": 2986, "donAcc_type": "standard", "distance": 2.815, "atom1_id": "///A/374/O", "atom2_id": "///A/378/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 393, "atom1_serNum": 2966, "atom2_serNum": 2986, "donAcc_type": "standard", "distance": 2.827, "atom1_id": "///A/375/O", "atom2_id": "///A/378/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 394, "atom1_serNum": 2966, "atom2_serNum": 2994, "donAcc_type": "standard", "distance": 2.933, "atom1_id": "///A/375/O", "atom2_id": "///A/379/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 395, "atom1_serNum": 3019, "atom2_serNum": 3051, "donAcc_type": "standard", "distance": 3.330, "atom1_id": "///A/381/O", "atom2_id": "///A/385/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 396, "atom1_serNum": 3019, "atom2_serNum": 3056, "donAcc_type": "acceptable", "distance": 2.708, "atom1_id": "///A/381/O", "atom2_id": "///A/385/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 397, "atom1_serNum": 3038, "atom2_serNum": 3057, "donAcc_type": "standard", "distance": 3.073, "atom1_id": "///A/383/O", "atom2_id": "///A/386/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 398, "atom1_serNum": 3038, "atom2_serNum": 3068, "donAcc_type": "standard", "distance": 3.151, "atom1_id": "///A/383/O", "atom2_id": "///A/387/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 399, "atom1_serNum": 3071, "atom2_serNum": 3099, "donAcc_type": "standard", "distance": 3.049, "atom1_id": "///A/387/O", "atom2_id": "///A/391/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 400, "atom1_serNum": 3075, "atom2_serNum": 3083, "donAcc_type": "standard", "distance": 3.010, "atom1_id": "///A/387/OD2", "atom2_id": "///A/389/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 401, "atom1_serNum": 3079, "atom2_serNum": 3107, "donAcc_type": "standard", "distance": 2.731, "atom1_id": "///A/388/O", "atom2_id": "///A/392/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 402, "atom1_serNum": 3094, "atom2_serNum": 3112, "donAcc_type": "standard", "distance": 3.010, "atom1_id": "///A/390/O", "atom2_id": "///A/393/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 403, "atom1_serNum": 3102, "atom2_serNum": 3120, "donAcc_type": "standard", "distance": 3.191, "atom1_id": "///A/391/O", "atom2_id": "///A/394/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 404, "atom1_serNum": 3115, "atom2_serNum": 3144, "donAcc_type": "standard", "distance": 2.937, "atom1_id": "///A/393/O", "atom2_id": "///A/397/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 405, "atom1_serNum": 3123, "atom2_serNum": 3156, "donAcc_type": "standard", "distance": 2.804, "atom1_id": "///A/394/O", "atom2_id": "///A/398/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 406, "atom1_serNum": 3131, "atom2_serNum": 3164, "donAcc_type": "standard", "distance": 3.042, "atom1_id": "///A/395/O", "atom2_id": "///A/399/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 407, "atom1_serNum": 3138, "atom2_serNum": 3175, "donAcc_type": "standard", "distance": 3.282, "atom1_id": "///A/396/O", "atom2_id": "///A/400/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 408, "atom1_serNum": 3147, "atom2_serNum": 3180, "donAcc_type": "standard", "distance": 2.988, "atom1_id": "///A/397/O", "atom2_id": "///A/401/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 409, "atom1_serNum": 3159, "atom2_serNum": 3186, "donAcc_type": "standard", "distance": 3.001, "atom1_id": "///A/398/O", "atom2_id": "///A/402/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 410, "atom1_serNum": 3167, "atom2_serNum": 3199, "donAcc_type": "acceptable", "distance": 3.510, "atom1_id": "///A/399/O", "atom2_id": "///A/403/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 411, "atom1_serNum": 3178, "atom2_serNum": 3201, "donAcc_type": "standard", "distance": 2.968, "atom1_id": "///A/400/O", "atom2_id": "///A/404/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 412, "atom1_serNum": 3183, "atom2_serNum": 3209, "donAcc_type": "standard", "distance": 2.941, "atom1_id": "///A/401/O", "atom2_id": "///A/405/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 413, "atom1_serNum": 3185, "atom2_serNum": 3524, "donAcc_type": "acceptable", "distance": 3.844, "atom1_id": "///A/401/OG", "atom2_id": "///A/443/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 414, "atom1_serNum": 3189, "atom2_serNum": 3209, "donAcc_type": "standard", "distance": 2.946, "atom1_id": "///A/402/O", "atom2_id": "///A/405/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 415, "atom1_serNum": 3197, "atom2_serNum": 3217, "donAcc_type": "standard", "distance": 3.018, "atom1_id": "///A/403/O", "atom2_id": "///A/406/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 416, "atom1_serNum": 3212, "atom2_serNum": 3224, "donAcc_type": "standard", "distance": 3.220, "atom1_id": "///A/405/O", "atom2_id": "///A/407/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 417, "atom1_serNum": 3212, "atom2_serNum": 3498, "donAcc_type": "standard", "distance": 3.442, "atom1_id": "///A/405/O", "atom2_id": "///A/440/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 418, "atom1_serNum": 3220, "atom2_serNum": 3233, "donAcc_type": "standard", "distance": 2.629, "atom1_id": "///A/406/O", "atom2_id": "///A/408/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 419, "atom1_serNum": 3232, "atom2_serNum": 3442, "donAcc_type": "standard", "distance": 3.013, "atom1_id": "///A/407/NZ", "atom2_id": "///A/433/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 420, "atom1_serNum": 3232, "atom2_serNum": 3477, "donAcc_type": "standard", "distance": 3.969, "atom1_id": "///A/407/NZ", "atom2_id": "///A/437/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 421, "atom1_serNum": 3241, "atom2_serNum": 3291, "donAcc_type": "standard", "distance": 3.901, "atom1_id": "///A/409/N", "atom2_id": "///A/415/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 422, "atom1_serNum": 3244, "atom2_serNum": 3344, "donAcc_type": "acceptable", "distance": 2.972, "atom1_id": "///A/409/O", "atom2_id": "///A/422/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 423, "atom1_serNum": 3259, "atom2_serNum": 3354, "donAcc_type": "standard", "distance": 2.860, "atom1_id": "///A/411/O", "atom2_id": "///A/423/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 424, "atom1_serNum": 3263, "atom2_serNum": 3407, "donAcc_type": "standard", "distance": 3.448, "atom1_id": "///A/412/N", "atom2_id": "///A/429/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 425, "atom1_serNum": 3268, "atom2_serNum": 3406, "donAcc_type": "acceptable", "distance": 2.919, "atom1_id": "///A/412/OG", "atom2_id": "///A/429/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 426, "atom1_serNum": 3272, "atom2_serNum": 3354, "donAcc_type": "standard", "distance": 3.434, "atom1_id": "///A/413/O", "atom2_id": "///A/423/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 427, "atom1_serNum": 3281, "atom2_serNum": 3283, "donAcc_type": "acceptable", "distance": 2.638, "atom1_id": "///A/414/O", "atom2_id": "///A/414/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 428, "atom1_serNum": 3296, "atom2_serNum": 3312, "donAcc_type": "standard", "distance": 3.002, "atom1_id": "///A/416/O", "atom2_id": "///A/419/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 429, "atom1_serNum": 3309, "atom2_serNum": 3339, "donAcc_type": "standard", "distance": 3.088, "atom1_id": "///A/418/O", "atom2_id": "///A/422/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 430, "atom1_serNum": 3309, "atom2_serNum": 3344, "donAcc_type": "acceptable", "distance": 2.999, "atom1_id": "///A/418/O", "atom2_id": "///A/422/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 431, "atom1_serNum": 3315, "atom2_serNum": 3345, "donAcc_type": "standard", "distance": 3.384, "atom1_id": "///A/419/O", "atom2_id": "///A/423/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 432, "atom1_serNum": 3321, "atom2_serNum": 3345, "donAcc_type": "standard", "distance": 3.115, "atom1_id": "///A/420/O", "atom2_id": "///A/423/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 433, "atom1_serNum": 3321, "atom2_serNum": 3356, "donAcc_type": "standard", "distance": 3.584, "atom1_id": "///A/420/O", "atom2_id": "///A/424/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 434, "atom1_serNum": 3325, "atom2_serNum": 3355, "donAcc_type": "standard", "distance": 3.376, "atom1_id": "///A/420/OE1", "atom2_id": "///A/423/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 435, "atom1_serNum": 3330, "atom2_serNum": 3367, "donAcc_type": "standard", "distance": 3.258, "atom1_id": "///A/421/O", "atom2_id": "///A/425/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 436, "atom1_serNum": 3342, "atom2_serNum": 3375, "donAcc_type": "standard", "distance": 2.978, "atom1_id": "///A/422/O", "atom2_id": "///A/426/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 437, "atom1_serNum": 3392, "atom2_serNum": 9781, "donAcc_type": "acceptable", "distance": 2.897, "atom1_id": "///A/427/OD1", "atom2_id": "///C/147/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 438, "atom1_serNum": 3393, "atom2_serNum": 9781, "donAcc_type": "acceptable", "distance": 2.697, "atom1_id": "///A/427/OD2", "atom2_id": "///C/147/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 439, "atom1_serNum": 3393, "atom2_serNum": 9880, "donAcc_type": "standard", "distance": 2.731, "atom1_id": "///A/427/OD2", "atom2_id": "///C/159/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 440, "atom1_serNum": 3397, "atom2_serNum": 3425, "donAcc_type": "standard", "distance": 3.177, "atom1_id": "///A/428/O", "atom2_id": "///A/432/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 441, "atom1_serNum": 3400, "atom2_serNum": 3407, "donAcc_type": "standard", "distance": 2.490, "atom1_id": "///A/429/N", "atom2_id": "///A/429/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 442, "atom1_serNum": 3403, "atom2_serNum": 3436, "donAcc_type": "standard", "distance": 2.600, "atom1_id": "///A/429/O", "atom2_id": "///A/433/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 443, "atom1_serNum": 3408, "atom2_serNum": 3415, "donAcc_type": "standard", "distance": 2.504, "atom1_id": "///A/430/N", "atom2_id": "///A/430/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 444, "atom1_serNum": 3411, "atom2_serNum": 3444, "donAcc_type": "standard", "distance": 3.057, "atom1_id": "///A/430/O", "atom2_id": "///A/434/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 445, "atom1_serNum": 3420, "atom2_serNum": 3449, "donAcc_type": "standard", "distance": 3.208, "atom1_id": "///A/431/O", "atom2_id": "///A/435/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 446, "atom1_serNum": 3428, "atom2_serNum": 3460, "donAcc_type": "standard", "distance": 2.765, "atom1_id": "///A/432/O", "atom2_id": "///A/436/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 447, "atom1_serNum": 3439, "atom2_serNum": 3471, "donAcc_type": "standard", "distance": 2.740, "atom1_id": "///A/433/O", "atom2_id": "///A/437/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 448, "atom1_serNum": 3447, "atom2_serNum": 3479, "donAcc_type": "standard", "distance": 3.323, "atom1_id": "///A/434/O", "atom2_id": "///A/438/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 449, "atom1_serNum": 3447, "atom2_serNum": 3484, "donAcc_type": "acceptable", "distance": 2.860, "atom1_id": "///A/434/O", "atom2_id": "///A/438/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 450, "atom1_serNum": 3452, "atom2_serNum": 3484, "donAcc_type": "acceptable", "distance": 3.084, "atom1_id": "///A/435/O", "atom2_id": "///A/438/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 451, "atom1_serNum": 3452, "atom2_serNum": 3485, "donAcc_type": "standard", "distance": 2.800, "atom1_id": "///A/435/O", "atom2_id": "///A/439/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 452, "atom1_serNum": 3463, "atom2_serNum": 3491, "donAcc_type": "standard", "distance": 2.930, "atom1_id": "///A/436/O", "atom2_id": "///A/440/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 453, "atom1_serNum": 3474, "atom2_serNum": 3502, "donAcc_type": "standard", "distance": 3.177, "atom1_id": "///A/437/O", "atom2_id": "///A/441/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 454, "atom1_serNum": 3482, "atom2_serNum": 3507, "donAcc_type": "standard", "distance": 3.476, "atom1_id": "///A/438/O", "atom2_id": "///A/442/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 455, "atom1_serNum": 3488, "atom2_serNum": 3516, "donAcc_type": "standard", "distance": 2.865, "atom1_id": "///A/439/O", "atom2_id": "///A/443/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 456, "atom1_serNum": 3494, "atom2_serNum": 3525, "donAcc_type": "standard", "distance": 2.732, "atom1_id": "///A/440/O", "atom2_id": "///A/444/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 457, "atom1_serNum": 3500, "atom2_serNum": 10873, "donAcc_type": "standard", "distance": 3.474, "atom1_id": "///A/440/NH1", "atom2_id": "///E/58/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 458, "atom1_serNum": 3505, "atom2_serNum": 3529, "donAcc_type": "standard", "distance": 3.710, "atom1_id": "///A/441/O", "atom2_id": "///A/445/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 459, "atom1_serNum": 3505, "atom2_serNum": 10842, "donAcc_type": "acceptable", "distance": 2.603, "atom1_id": "///A/441/O", "atom2_id": "///E/56/O2'", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 460, "atom1_serNum": 3510, "atom2_serNum": 3538, "donAcc_type": "standard", "distance": 3.470, "atom1_id": "///A/442/O", "atom2_id": "///A/446/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 461, "atom1_serNum": 3519, "atom2_serNum": 3545, "donAcc_type": "standard", "distance": 3.029, "atom1_id": "///A/443/O", "atom2_id": "///A/447/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 462, "atom1_serNum": 3528, "atom2_serNum": 3553, "donAcc_type": "standard", "distance": 3.413, "atom1_id": "///A/444/O", "atom2_id": "///A/448/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 463, "atom1_serNum": 3532, "atom2_serNum": 3564, "donAcc_type": "standard", "distance": 3.459, "atom1_id": "///A/445/O", "atom2_id": "///A/449/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 464, "atom1_serNum": 3536, "atom2_serNum": 10829, "donAcc_type": "standard", "distance": 3.537, "atom1_id": "///A/445/OE1", "atom2_id": "///E/55/N2", "atom_pair": "O:N", "residue_pair": "aa:nt" }, { "index": 465, "atom1_serNum": 3537, "atom2_serNum": 10830, "donAcc_type": "questionable", "distance": 3.104, "atom1_id": "///A/445/OE2", "atom2_id": "///E/55/N3", "atom_pair": "O:N", "residue_pair": "aa:nt" }, { "index": 466, "atom1_serNum": 3548, "atom2_serNum": 3572, "donAcc_type": "standard", "distance": 2.998, "atom1_id": "///A/447/O", "atom2_id": "///A/450/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 467, "atom1_serNum": 3548, "atom2_serNum": 3577, "donAcc_type": "standard", "distance": 2.920, "atom1_id": "///A/447/O", "atom2_id": "///A/451/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 468, "atom1_serNum": 3556, "atom2_serNum": 3583, "donAcc_type": "standard", "distance": 2.778, "atom1_id": "///A/448/O", "atom2_id": "///A/452/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 469, "atom1_serNum": 3563, "atom2_serNum": 10840, "donAcc_type": "standard", "distance": 2.694, "atom1_id": "///A/448/NH2", "atom2_id": "///E/56/O3'", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 470, "atom1_serNum": 3563, "atom2_serNum": 10853, "donAcc_type": "standard", "distance": 2.839, "atom1_id": "///A/448/NH2", "atom2_id": "///E/57/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 471, "atom1_serNum": 3575, "atom2_serNum": 3594, "donAcc_type": "standard", "distance": 3.106, "atom1_id": "///A/450/O", "atom2_id": "///A/453/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 472, "atom1_serNum": 3575, "atom2_serNum": 3602, "donAcc_type": "standard", "distance": 3.263, "atom1_id": "///A/450/O", "atom2_id": "///A/454/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 473, "atom1_serNum": 3580, "atom2_serNum": 3602, "donAcc_type": "standard", "distance": 3.075, "atom1_id": "///A/451/O", "atom2_id": "///A/454/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 474, "atom1_serNum": 3605, "atom2_serNum": 3633, "donAcc_type": "standard", "distance": 3.321, "atom1_id": "///A/454/O", "atom2_id": "///A/458/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 475, "atom1_serNum": 3605, "atom2_serNum": 3638, "donAcc_type": "acceptable", "distance": 2.917, "atom1_id": "///A/454/O", "atom2_id": "///A/458/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 476, "atom1_serNum": 3608, "atom2_serNum": 3631, "donAcc_type": "acceptable", "distance": 3.098, "atom1_id": "///A/454/OD1", "atom2_id": "///A/457/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 477, "atom1_serNum": 3609, "atom2_serNum": 3631, "donAcc_type": "acceptable", "distance": 2.642, "atom1_id": "///A/454/OD2", "atom2_id": "///A/457/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 478, "atom1_serNum": 3613, "atom2_serNum": 3638, "donAcc_type": "acceptable", "distance": 2.671, "atom1_id": "///A/455/O", "atom2_id": "///A/458/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 479, "atom1_serNum": 3613, "atom2_serNum": 3639, "donAcc_type": "standard", "distance": 3.151, "atom1_id": "///A/455/O", "atom2_id": "///A/459/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 480, "atom1_serNum": 3620, "atom2_serNum": 3650, "donAcc_type": "standard", "distance": 2.901, "atom1_id": "///A/456/O", "atom2_id": "///A/460/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 481, "atom1_serNum": 3629, "atom2_serNum": 3659, "donAcc_type": "standard", "distance": 2.971, "atom1_id": "///A/457/O", "atom2_id": "///A/461/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 482, "atom1_serNum": 3636, "atom2_serNum": 3667, "donAcc_type": "standard", "distance": 2.886, "atom1_id": "///A/458/O", "atom2_id": "///A/462/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 483, "atom1_serNum": 3642, "atom2_serNum": 3672, "donAcc_type": "standard", "distance": 2.637, "atom1_id": "///A/459/O", "atom2_id": "///A/463/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 484, "atom1_serNum": 3653, "atom2_serNum": 3676, "donAcc_type": "standard", "distance": 2.811, "atom1_id": "///A/460/O", "atom2_id": "///A/464/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 485, "atom1_serNum": 3662, "atom2_serNum": 3685, "donAcc_type": "standard", "distance": 3.141, "atom1_id": "///A/461/O", "atom2_id": "///A/465/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 486, "atom1_serNum": 3670, "atom2_serNum": 3699, "donAcc_type": "standard", "distance": 3.066, "atom1_id": "///A/462/O", "atom2_id": "///A/466/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 487, "atom1_serNum": 3675, "atom2_serNum": 3699, "donAcc_type": "standard", "distance": 3.000, "atom1_id": "///A/463/O", "atom2_id": "///A/466/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 488, "atom1_serNum": 3675, "atom2_serNum": 3707, "donAcc_type": "standard", "distance": 3.052, "atom1_id": "///A/463/O", "atom2_id": "///A/467/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 489, "atom1_serNum": 3679, "atom2_serNum": 3716, "donAcc_type": "standard", "distance": 3.018, "atom1_id": "///A/464/O", "atom2_id": "///A/468/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 490, "atom1_serNum": 3688, "atom2_serNum": 3728, "donAcc_type": "standard", "distance": 2.967, "atom1_id": "///A/465/O", "atom2_id": "///A/469/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 491, "atom1_serNum": 3693, "atom2_serNum": 3736, "donAcc_type": "questionable", "distance": 3.399, "atom1_id": "///A/465/NE1", "atom2_id": "///A/469/NE2", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 492, "atom1_serNum": 3702, "atom2_serNum": 3737, "donAcc_type": "standard", "distance": 3.075, "atom1_id": "///A/466/O", "atom2_id": "///A/470/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 493, "atom1_serNum": 3710, "atom2_serNum": 3750, "donAcc_type": "acceptable", "distance": 3.489, "atom1_id": "///A/467/O", "atom2_id": "///A/471/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 494, "atom1_serNum": 3719, "atom2_serNum": 3745, "donAcc_type": "standard", "distance": 3.254, "atom1_id": "///A/468/O", "atom2_id": "///A/471/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 495, "atom1_serNum": 3719, "atom2_serNum": 3756, "donAcc_type": "acceptable", "distance": 3.023, "atom1_id": "///A/468/O", "atom2_id": "///A/472/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 496, "atom1_serNum": 3772, "atom2_serNum": 3774, "donAcc_type": "acceptable", "distance": 2.628, "atom1_id": "///A/491/O", "atom2_id": "///A/491/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 497, "atom1_serNum": 3774, "atom2_serNum": 6408, "donAcc_type": "acceptable", "distance": 3.740, "atom1_id": "///A/491/OG", "atom2_id": "///A/824/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 498, "atom1_serNum": 3792, "atom2_serNum": 6408, "donAcc_type": "standard", "distance": 2.644, "atom1_id": "///A/494/O", "atom2_id": "///A/824/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 499, "atom1_serNum": 3816, "atom2_serNum": 3843, "donAcc_type": "standard", "distance": 3.392, "atom1_id": "///A/497/O", "atom2_id": "///A/501/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 500, "atom1_serNum": 3822, "atom2_serNum": 3850, "donAcc_type": "standard", "distance": 3.008, "atom1_id": "///A/498/O", "atom2_id": "///A/502/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 501, "atom1_serNum": 3829, "atom2_serNum": 3859, "donAcc_type": "standard", "distance": 2.750, "atom1_id": "///A/499/O", "atom2_id": "///A/503/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 502, "atom1_serNum": 3835, "atom2_serNum": 3873, "donAcc_type": "standard", "distance": 2.848, "atom1_id": "///A/500/O", "atom2_id": "///A/504/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 503, "atom1_serNum": 3846, "atom2_serNum": 3882, "donAcc_type": "standard", "distance": 3.377, "atom1_id": "///A/501/O", "atom2_id": "///A/505/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 504, "atom1_serNum": 3853, "atom2_serNum": 3887, "donAcc_type": "standard", "distance": 3.039, "atom1_id": "///A/502/O", "atom2_id": "///A/506/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 505, "atom1_serNum": 3862, "atom2_serNum": 3895, "donAcc_type": "standard", "distance": 2.824, "atom1_id": "///A/503/O", "atom2_id": "///A/507/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 506, "atom1_serNum": 3862, "atom2_serNum": 3900, "donAcc_type": "acceptable", "distance": 2.751, "atom1_id": "///A/503/O", "atom2_id": "///A/507/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 507, "atom1_serNum": 3876, "atom2_serNum": 3902, "donAcc_type": "standard", "distance": 3.262, "atom1_id": "///A/504/O", "atom2_id": "///A/508/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 508, "atom1_serNum": 3885, "atom2_serNum": 3910, "donAcc_type": "standard", "distance": 3.061, "atom1_id": "///A/505/O", "atom2_id": "///A/509/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 509, "atom1_serNum": 3890, "atom2_serNum": 3921, "donAcc_type": "standard", "distance": 2.908, "atom1_id": "///A/506/O", "atom2_id": "///A/510/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 510, "atom1_serNum": 3898, "atom2_serNum": 3929, "donAcc_type": "standard", "distance": 2.845, "atom1_id": "///A/507/O", "atom2_id": "///A/511/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 511, "atom1_serNum": 3900, "atom2_serNum": 4287, "donAcc_type": "acceptable", "distance": 3.449, "atom1_id": "///A/507/OG1", "atom2_id": "///A/555/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 512, "atom1_serNum": 3905, "atom2_serNum": 3938, "donAcc_type": "standard", "distance": 3.265, "atom1_id": "///A/508/O", "atom2_id": "///A/512/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 513, "atom1_serNum": 3913, "atom2_serNum": 3944, "donAcc_type": "standard", "distance": 2.699, "atom1_id": "///A/509/O", "atom2_id": "///A/513/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 514, "atom1_serNum": 3924, "atom2_serNum": 3944, "donAcc_type": "standard", "distance": 2.586, "atom1_id": "///A/510/O", "atom2_id": "///A/513/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 515, "atom1_serNum": 3924, "atom2_serNum": 3951, "donAcc_type": "standard", "distance": 2.714, "atom1_id": "///A/510/O", "atom2_id": "///A/514/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 516, "atom1_serNum": 3932, "atom2_serNum": 3959, "donAcc_type": "standard", "distance": 3.284, "atom1_id": "///A/511/O", "atom2_id": "///A/515/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 517, "atom1_serNum": 3932, "atom2_serNum": 3964, "donAcc_type": "acceptable", "distance": 2.709, "atom1_id": "///A/511/O", "atom2_id": "///A/515/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 518, "atom1_serNum": 3941, "atom2_serNum": 3966, "donAcc_type": "standard", "distance": 3.361, "atom1_id": "///A/512/O", "atom2_id": "///A/516/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 519, "atom1_serNum": 3947, "atom2_serNum": 3975, "donAcc_type": "standard", "distance": 2.970, "atom1_id": "///A/513/O", "atom2_id": "///A/517/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 520, "atom1_serNum": 3954, "atom2_serNum": 3983, "donAcc_type": "standard", "distance": 2.942, "atom1_id": "///A/514/O", "atom2_id": "///A/518/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 521, "atom1_serNum": 3969, "atom2_serNum": 4010, "donAcc_type": "acceptable", "distance": 2.956, "atom1_id": "///A/516/O", "atom2_id": "///A/520/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 522, "atom1_serNum": 3978, "atom2_serNum": 4012, "donAcc_type": "standard", "distance": 3.120, "atom1_id": "///A/517/O", "atom2_id": "///A/521/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 523, "atom1_serNum": 4023, "atom2_serNum": 4048, "donAcc_type": "standard", "distance": 3.145, "atom1_id": "///A/522/O", "atom2_id": "///A/525/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 524, "atom1_serNum": 4027, "atom2_serNum": 4056, "donAcc_type": "standard", "distance": 2.467, "atom1_id": "///A/522/ND2", "atom2_id": "///A/525/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 525, "atom1_serNum": 4031, "atom2_serNum": 4037, "donAcc_type": "standard", "distance": 3.009, "atom1_id": "///A/523/O", "atom2_id": "///A/523/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 526, "atom1_serNum": 4031, "atom2_serNum": 4368, "donAcc_type": "acceptable", "distance": 3.036, "atom1_id": "///A/523/O", "atom2_id": "///A/565/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 527, "atom1_serNum": 4038, "atom2_serNum": 4368, "donAcc_type": "acceptable", "distance": 3.078, "atom1_id": "///A/523/NH2", "atom2_id": "///A/565/OH", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 528, "atom1_serNum": 4048, "atom2_serNum": 4055, "donAcc_type": "standard", "distance": 2.456, "atom1_id": "///A/525/N", "atom2_id": "///A/525/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 529, "atom1_serNum": 4060, "atom2_serNum": 4072, "donAcc_type": "standard", "distance": 2.504, "atom1_id": "///A/526/O", "atom2_id": "///A/528/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 530, "atom1_serNum": 4068, "atom2_serNum": 4095, "donAcc_type": "standard", "distance": 2.767, "atom1_id": "///A/527/O", "atom2_id": "///A/531/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 531, "atom1_serNum": 4075, "atom2_serNum": 4099, "donAcc_type": "standard", "distance": 2.819, "atom1_id": "///A/528/O", "atom2_id": "///A/532/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 532, "atom1_serNum": 4079, "atom2_serNum": 4085, "donAcc_type": "standard", "distance": 2.815, "atom1_id": "///A/529/N", "atom2_id": "///A/529/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 533, "atom1_serNum": 4082, "atom2_serNum": 4107, "donAcc_type": "standard", "distance": 3.030, "atom1_id": "///A/529/O", "atom2_id": "///A/533/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 534, "atom1_serNum": 4090, "atom2_serNum": 4116, "donAcc_type": "standard", "distance": 3.074, "atom1_id": "///A/530/O", "atom2_id": "///A/534/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 535, "atom1_serNum": 4098, "atom2_serNum": 4124, "donAcc_type": "standard", "distance": 2.942, "atom1_id": "///A/531/O", "atom2_id": "///A/535/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 536, "atom1_serNum": 4102, "atom2_serNum": 4132, "donAcc_type": "standard", "distance": 2.702, "atom1_id": "///A/532/O", "atom2_id": "///A/536/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 537, "atom1_serNum": 4110, "atom2_serNum": 4141, "donAcc_type": "standard", "distance": 3.175, "atom1_id": "///A/533/O", "atom2_id": "///A/537/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 538, "atom1_serNum": 4119, "atom2_serNum": 4149, "donAcc_type": "standard", "distance": 2.821, "atom1_id": "///A/534/O", "atom2_id": "///A/538/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 539, "atom1_serNum": 4127, "atom2_serNum": 4156, "donAcc_type": "standard", "distance": 2.893, "atom1_id": "///A/535/O", "atom2_id": "///A/539/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 540, "atom1_serNum": 4135, "atom2_serNum": 4164, "donAcc_type": "standard", "distance": 2.764, "atom1_id": "///A/536/O", "atom2_id": "///A/540/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 541, "atom1_serNum": 4144, "atom2_serNum": 4172, "donAcc_type": "standard", "distance": 3.006, "atom1_id": "///A/537/O", "atom2_id": "///A/541/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 542, "atom1_serNum": 4159, "atom2_serNum": 4463, "donAcc_type": "standard", "distance": 3.585, "atom1_id": "///A/539/O", "atom2_id": "///A/576/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 543, "atom1_serNum": 4175, "atom2_serNum": 4463, "donAcc_type": "standard", "distance": 3.456, "atom1_id": "///A/541/O", "atom2_id": "///A/576/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 544, "atom1_serNum": 4201, "atom2_serNum": 4528, "donAcc_type": "questionable", "distance": 3.352, "atom1_id": "///A/544/O", "atom2_id": "///A/584/OE2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 545, "atom1_serNum": 4210, "atom2_serNum": 4230, "donAcc_type": "standard", "distance": 2.916, "atom1_id": "///A/545/O", "atom2_id": "///A/548/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 546, "atom1_serNum": 4210, "atom2_serNum": 4238, "donAcc_type": "standard", "distance": 2.939, "atom1_id": "///A/545/O", "atom2_id": "///A/549/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 547, "atom1_serNum": 4214, "atom2_serNum": 4230, "donAcc_type": "standard", "distance": 2.817, "atom1_id": "///A/545/OD2", "atom2_id": "///A/548/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 548, "atom1_serNum": 4218, "atom2_serNum": 4246, "donAcc_type": "standard", "distance": 3.029, "atom1_id": "///A/546/O", "atom2_id": "///A/550/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 549, "atom1_serNum": 4233, "atom2_serNum": 4252, "donAcc_type": "standard", "distance": 2.909, "atom1_id": "///A/548/O", "atom2_id": "///A/551/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 550, "atom1_serNum": 4233, "atom2_serNum": 4258, "donAcc_type": "standard", "distance": 2.929, "atom1_id": "///A/548/O", "atom2_id": "///A/552/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 551, "atom1_serNum": 4241, "atom2_serNum": 4265, "donAcc_type": "standard", "distance": 2.696, "atom1_id": "///A/549/O", "atom2_id": "///A/553/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 552, "atom1_serNum": 4249, "atom2_serNum": 4278, "donAcc_type": "acceptable", "distance": 2.958, "atom1_id": "///A/550/O", "atom2_id": "///A/554/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 553, "atom1_serNum": 4249, "atom2_serNum": 4686, "donAcc_type": "standard", "distance": 3.239, "atom1_id": "///A/550/O", "atom2_id": "///A/603/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 554, "atom1_serNum": 4255, "atom2_serNum": 4280, "donAcc_type": "standard", "distance": 2.874, "atom1_id": "///A/551/O", "atom2_id": "///A/555/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 555, "atom1_serNum": 4255, "atom2_serNum": 4287, "donAcc_type": "standard", "distance": 2.566, "atom1_id": "///A/551/O", "atom2_id": "///A/555/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 556, "atom1_serNum": 4261, "atom2_serNum": 4280, "donAcc_type": "standard", "distance": 2.839, "atom1_id": "///A/552/O", "atom2_id": "///A/555/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 557, "atom1_serNum": 4261, "atom2_serNum": 4288, "donAcc_type": "standard", "distance": 2.790, "atom1_id": "///A/552/O", "atom2_id": "///A/556/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 558, "atom1_serNum": 4268, "atom2_serNum": 4295, "donAcc_type": "standard", "distance": 3.124, "atom1_id": "///A/553/O", "atom2_id": "///A/557/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 559, "atom1_serNum": 4268, "atom2_serNum": 4300, "donAcc_type": "acceptable", "distance": 2.926, "atom1_id": "///A/553/O", "atom2_id": "///A/557/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 560, "atom1_serNum": 4276, "atom2_serNum": 4301, "donAcc_type": "standard", "distance": 2.830, "atom1_id": "///A/554/O", "atom2_id": "///A/558/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 561, "atom1_serNum": 4278, "atom2_serNum": 4686, "donAcc_type": "acceptable", "distance": 2.838, "atom1_id": "///A/554/OG1", "atom2_id": "///A/603/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 562, "atom1_serNum": 4283, "atom2_serNum": 4306, "donAcc_type": "standard", "distance": 3.019, "atom1_id": "///A/555/O", "atom2_id": "///A/559/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 563, "atom1_serNum": 4291, "atom2_serNum": 4314, "donAcc_type": "standard", "distance": 2.725, "atom1_id": "///A/556/O", "atom2_id": "///A/560/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 564, "atom1_serNum": 4300, "atom2_serNum": 4709, "donAcc_type": "acceptable", "distance": 3.443, "atom1_id": "///A/557/OG", "atom2_id": "///A/607/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 565, "atom1_serNum": 4309, "atom2_serNum": 4332, "donAcc_type": "standard", "distance": 3.085, "atom1_id": "///A/559/O", "atom2_id": "///A/562/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 566, "atom1_serNum": 4317, "atom2_serNum": 4343, "donAcc_type": "standard", "distance": 3.032, "atom1_id": "///A/560/O", "atom2_id": "///A/563/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 567, "atom1_serNum": 4328, "atom2_serNum": 4350, "donAcc_type": "standard", "distance": 3.208, "atom1_id": "///A/561/O", "atom2_id": "///A/564/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 568, "atom1_serNum": 4335, "atom2_serNum": 4357, "donAcc_type": "standard", "distance": 2.886, "atom1_id": "///A/562/O", "atom2_id": "///A/565/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 569, "atom1_serNum": 4335, "atom2_serNum": 4369, "donAcc_type": "standard", "distance": 3.321, "atom1_id": "///A/562/O", "atom2_id": "///A/566/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 570, "atom1_serNum": 4372, "atom2_serNum": 4396, "donAcc_type": "standard", "distance": 3.032, "atom1_id": "///A/566/O", "atom2_id": "///A/569/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 571, "atom1_serNum": 4376, "atom2_serNum": 4395, "donAcc_type": "standard", "distance": 2.723, "atom1_id": "///A/566/NE", "atom2_id": "///A/568/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 572, "atom1_serNum": 4379, "atom2_serNum": 15392, "donAcc_type": "standard", "distance": 2.912, "atom1_id": "///A/566/NH2", "atom2_id": "///F/568/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 573, "atom1_serNum": 4383, "atom2_serNum": 4407, "donAcc_type": "standard", "distance": 3.183, "atom1_id": "///A/567/O", "atom2_id": "///A/570/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 574, "atom1_serNum": 4394, "atom2_serNum": 15392, "donAcc_type": "questionable", "distance": 3.303, "atom1_id": "///A/568/OE1", "atom2_id": "///F/568/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 575, "atom1_serNum": 4395, "atom2_serNum": 15377, "donAcc_type": "standard", "distance": 3.753, "atom1_id": "///A/568/OE2", "atom2_id": "///F/566/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 576, "atom1_serNum": 4399, "atom2_serNum": 4422, "donAcc_type": "standard", "distance": 3.001, "atom1_id": "///A/569/O", "atom2_id": "///A/572/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 577, "atom1_serNum": 4399, "atom2_serNum": 4431, "donAcc_type": "standard", "distance": 3.062, "atom1_id": "///A/569/O", "atom2_id": "///A/573/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 578, "atom1_serNum": 4410, "atom2_serNum": 4438, "donAcc_type": "standard", "distance": 2.733, "atom1_id": "///A/570/O", "atom2_id": "///A/574/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 579, "atom1_serNum": 4418, "atom2_serNum": 4449, "donAcc_type": "standard", "distance": 2.806, "atom1_id": "///A/571/O", "atom2_id": "///A/575/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 580, "atom1_serNum": 4418, "atom2_serNum": 4454, "donAcc_type": "acceptable", "distance": 2.981, "atom1_id": "///A/571/O", "atom2_id": "///A/575/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 581, "atom1_serNum": 4425, "atom2_serNum": 4455, "donAcc_type": "standard", "distance": 2.856, "atom1_id": "///A/572/O", "atom2_id": "///A/576/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 582, "atom1_serNum": 4434, "atom2_serNum": 4464, "donAcc_type": "standard", "distance": 3.196, "atom1_id": "///A/573/O", "atom2_id": "///A/577/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 583, "atom1_serNum": 4441, "atom2_serNum": 4472, "donAcc_type": "standard", "distance": 2.894, "atom1_id": "///A/574/O", "atom2_id": "///A/578/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 584, "atom1_serNum": 4452, "atom2_serNum": 4483, "donAcc_type": "standard", "distance": 3.039, "atom1_id": "///A/575/O", "atom2_id": "///A/579/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 585, "atom1_serNum": 4452, "atom2_serNum": 4488, "donAcc_type": "acceptable", "distance": 2.521, "atom1_id": "///A/575/O", "atom2_id": "///A/579/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 586, "atom1_serNum": 4458, "atom2_serNum": 4494, "donAcc_type": "acceptable", "distance": 2.896, "atom1_id": "///A/576/O", "atom2_id": "///A/580/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 587, "atom1_serNum": 4467, "atom2_serNum": 4495, "donAcc_type": "standard", "distance": 3.114, "atom1_id": "///A/577/O", "atom2_id": "///A/581/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 588, "atom1_serNum": 4475, "atom2_serNum": 4495, "donAcc_type": "standard", "distance": 2.914, "atom1_id": "///A/578/O", "atom2_id": "///A/581/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 589, "atom1_serNum": 4475, "atom2_serNum": 4507, "donAcc_type": "acceptable", "distance": 3.258, "atom1_id": "///A/578/O", "atom2_id": "///A/582/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 590, "atom1_serNum": 4486, "atom2_serNum": 4502, "donAcc_type": "standard", "distance": 3.069, "atom1_id": "///A/579/O", "atom2_id": "///A/582/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 591, "atom1_serNum": 4498, "atom2_serNum": 4662, "donAcc_type": "standard", "distance": 2.828, "atom1_id": "///A/581/O", "atom2_id": "///A/601/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 592, "atom1_serNum": 4498, "atom2_serNum": 4665, "donAcc_type": "standard", "distance": 3.327, "atom1_id": "///A/581/O", "atom2_id": "///A/601/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 593, "atom1_serNum": 4523, "atom2_serNum": 4536, "donAcc_type": "standard", "distance": 2.540, "atom1_id": "///A/584/O", "atom2_id": "///A/586/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 594, "atom1_serNum": 4523, "atom2_serNum": 4543, "donAcc_type": "standard", "distance": 3.457, "atom1_id": "///A/584/O", "atom2_id": "///A/587/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 595, "atom1_serNum": 4555, "atom2_serNum": 4567, "donAcc_type": "standard", "distance": 2.862, "atom1_id": "///A/588/O", "atom2_id": "///A/590/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 596, "atom1_serNum": 4584, "atom2_serNum": 4599, "donAcc_type": "standard", "distance": 3.174, "atom1_id": "///A/592/O", "atom2_id": "///A/594/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 597, "atom1_serNum": 4602, "atom2_serNum": 4622, "donAcc_type": "standard", "distance": 3.224, "atom1_id": "///A/594/O", "atom2_id": "///A/597/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 598, "atom1_serNum": 4602, "atom2_serNum": 4629, "donAcc_type": "standard", "distance": 3.259, "atom1_id": "///A/594/O", "atom2_id": "///A/598/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 599, "atom1_serNum": 4606, "atom2_serNum": 6412, "donAcc_type": "standard", "distance": 3.950, "atom1_id": "///A/595/N", "atom2_id": "///A/825/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 600, "atom1_serNum": 4609, "atom2_serNum": 4640, "donAcc_type": "standard", "distance": 2.643, "atom1_id": "///A/595/O", "atom2_id": "///A/599/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 601, "atom1_serNum": 4617, "atom2_serNum": 6396, "donAcc_type": "standard", "distance": 3.009, "atom1_id": "///A/596/N", "atom2_id": "///A/823/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 602, "atom1_serNum": 4620, "atom2_serNum": 4648, "donAcc_type": "standard", "distance": 3.090, "atom1_id": "///A/596/O", "atom2_id": "///A/600/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 603, "atom1_serNum": 4625, "atom2_serNum": 4655, "donAcc_type": "standard", "distance": 3.140, "atom1_id": "///A/597/O", "atom2_id": "///A/601/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 604, "atom1_serNum": 4632, "atom2_serNum": 4666, "donAcc_type": "standard", "distance": 3.265, "atom1_id": "///A/598/O", "atom2_id": "///A/602/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 605, "atom1_serNum": 4638, "atom2_serNum": 10961, "donAcc_type": "standard", "distance": 3.684, "atom1_id": "///A/598/NH1", "atom2_id": "///E/62/O4'", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 606, "atom1_serNum": 4643, "atom2_serNum": 4677, "donAcc_type": "standard", "distance": 2.815, "atom1_id": "///A/599/O", "atom2_id": "///A/603/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 607, "atom1_serNum": 4646, "atom2_serNum": 4675, "donAcc_type": "standard", "distance": 3.479, "atom1_id": "///A/599/OD1", "atom2_id": "///A/602/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 608, "atom1_serNum": 4651, "atom2_serNum": 4687, "donAcc_type": "standard", "distance": 2.713, "atom1_id": "///A/600/O", "atom2_id": "///A/604/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 609, "atom1_serNum": 4658, "atom2_serNum": 4687, "donAcc_type": "standard", "distance": 2.786, "atom1_id": "///A/601/O", "atom2_id": "///A/604/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 610, "atom1_serNum": 4658, "atom2_serNum": 4692, "donAcc_type": "standard", "distance": 2.939, "atom1_id": "///A/601/O", "atom2_id": "///A/605/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 611, "atom1_serNum": 4669, "atom2_serNum": 4698, "donAcc_type": "standard", "distance": 2.869, "atom1_id": "///A/602/O", "atom2_id": "///A/606/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 612, "atom1_serNum": 4676, "atom2_serNum": 10956, "donAcc_type": "standard", "distance": 3.166, "atom1_id": "///A/602/NH2", "atom2_id": "///E/62/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 613, "atom1_serNum": 4680, "atom2_serNum": 4704, "donAcc_type": "standard", "distance": 2.987, "atom1_id": "///A/603/O", "atom2_id": "///A/607/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 614, "atom1_serNum": 4680, "atom2_serNum": 4709, "donAcc_type": "acceptable", "distance": 2.977, "atom1_id": "///A/603/O", "atom2_id": "///A/607/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 615, "atom1_serNum": 4690, "atom2_serNum": 4710, "donAcc_type": "standard", "distance": 2.882, "atom1_id": "///A/604/O", "atom2_id": "///A/608/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 616, "atom1_serNum": 4695, "atom2_serNum": 4710, "donAcc_type": "standard", "distance": 3.153, "atom1_id": "///A/605/O", "atom2_id": "///A/608/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 617, "atom1_serNum": 4695, "atom2_serNum": 4718, "donAcc_type": "standard", "distance": 3.381, "atom1_id": "///A/605/O", "atom2_id": "///A/609/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 618, "atom1_serNum": 4701, "atom2_serNum": 4726, "donAcc_type": "standard", "distance": 3.013, "atom1_id": "///A/606/O", "atom2_id": "///A/610/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 619, "atom1_serNum": 4707, "atom2_serNum": 4735, "donAcc_type": "standard", "distance": 2.945, "atom1_id": "///A/607/O", "atom2_id": "///A/611/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 620, "atom1_serNum": 4713, "atom2_serNum": 4743, "donAcc_type": "standard", "distance": 3.071, "atom1_id": "///A/608/O", "atom2_id": "///A/612/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 621, "atom1_serNum": 4721, "atom2_serNum": 4749, "donAcc_type": "standard", "distance": 2.737, "atom1_id": "///A/609/O", "atom2_id": "///A/613/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 622, "atom1_serNum": 4729, "atom2_serNum": 4760, "donAcc_type": "standard", "distance": 2.922, "atom1_id": "///A/610/O", "atom2_id": "///A/614/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 623, "atom1_serNum": 4738, "atom2_serNum": 4768, "donAcc_type": "standard", "distance": 2.885, "atom1_id": "///A/611/O", "atom2_id": "///A/615/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 624, "atom1_serNum": 4756, "atom2_serNum": 4767, "donAcc_type": "standard", "distance": 2.848, "atom1_id": "///A/613/NE", "atom2_id": "///A/614/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 625, "atom1_serNum": 4758, "atom2_serNum": 10047, "donAcc_type": "standard", "distance": 3.650, "atom1_id": "///A/613/NH1", "atom2_id": "///D/2/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 626, "atom1_serNum": 4759, "atom2_serNum": 4766, "donAcc_type": "standard", "distance": 3.326, "atom1_id": "///A/613/NH2", "atom2_id": "///A/614/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 627, "atom1_serNum": 4771, "atom2_serNum": 4804, "donAcc_type": "standard", "distance": 3.423, "atom1_id": "///A/615/O", "atom2_id": "///A/619/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 628, "atom1_serNum": 4783, "atom2_serNum": 4811, "donAcc_type": "standard", "distance": 2.662, "atom1_id": "///A/616/O", "atom2_id": "///A/620/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 629, "atom1_serNum": 4807, "atom2_serNum": 4826, "donAcc_type": "standard", "distance": 3.027, "atom1_id": "///A/619/O", "atom2_id": "///A/622/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 630, "atom1_serNum": 4814, "atom2_serNum": 4834, "donAcc_type": "standard", "distance": 3.065, "atom1_id": "///A/620/O", "atom2_id": "///A/623/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 631, "atom1_serNum": 4829, "atom2_serNum": 4861, "donAcc_type": "standard", "distance": 3.309, "atom1_id": "///A/622/O", "atom2_id": "///A/626/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 632, "atom1_serNum": 4837, "atom2_serNum": 4869, "donAcc_type": "standard", "distance": 2.955, "atom1_id": "///A/623/O", "atom2_id": "///A/627/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 633, "atom1_serNum": 4845, "atom2_serNum": 4851, "donAcc_type": "standard", "distance": 2.355, "atom1_id": "///A/624/N", "atom2_id": "///A/624/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 634, "atom1_serNum": 4848, "atom2_serNum": 4881, "donAcc_type": "standard", "distance": 2.951, "atom1_id": "///A/624/O", "atom2_id": "///A/628/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 635, "atom1_serNum": 4856, "atom2_serNum": 4889, "donAcc_type": "standard", "distance": 2.782, "atom1_id": "///A/625/O", "atom2_id": "///A/629/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 636, "atom1_serNum": 4864, "atom2_serNum": 4899, "donAcc_type": "standard", "distance": 2.979, "atom1_id": "///A/626/O", "atom2_id": "///A/630/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 637, "atom1_serNum": 4872, "atom2_serNum": 4906, "donAcc_type": "standard", "distance": 2.895, "atom1_id": "///A/627/O", "atom2_id": "///A/631/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 638, "atom1_serNum": 4880, "atom2_serNum": 5245, "donAcc_type": "acceptable", "distance": 3.256, "atom1_id": "///A/627/OH", "atom2_id": "///A/671/OE2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 639, "atom1_serNum": 4884, "atom2_serNum": 4915, "donAcc_type": "standard", "distance": 3.019, "atom1_id": "///A/628/O", "atom2_id": "///A/632/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 640, "atom1_serNum": 4892, "atom2_serNum": 4924, "donAcc_type": "standard", "distance": 2.995, "atom1_id": "///A/629/O", "atom2_id": "///A/633/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 641, "atom1_serNum": 4902, "atom2_serNum": 4932, "donAcc_type": "standard", "distance": 2.898, "atom1_id": "///A/630/O", "atom2_id": "///A/634/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 642, "atom1_serNum": 4909, "atom2_serNum": 4940, "donAcc_type": "standard", "distance": 2.915, "atom1_id": "///A/631/O", "atom2_id": "///A/635/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 643, "atom1_serNum": 4909, "atom2_serNum": 4945, "donAcc_type": "acceptable", "distance": 2.555, "atom1_id": "///A/631/O", "atom2_id": "///A/635/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 644, "atom1_serNum": 4918, "atom2_serNum": 4945, "donAcc_type": "acceptable", "distance": 2.866, "atom1_id": "///A/632/O", "atom2_id": "///A/635/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 645, "atom1_serNum": 4949, "atom2_serNum": 4971, "donAcc_type": "standard", "distance": 3.092, "atom1_id": "///A/636/O", "atom2_id": "///A/639/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 646, "atom1_serNum": 4957, "atom2_serNum": 5028, "donAcc_type": "standard", "distance": 2.723, "atom1_id": "///A/637/O", "atom2_id": "///A/645/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 647, "atom1_serNum": 4987, "atom2_serNum": 5019, "donAcc_type": "standard", "distance": 2.608, "atom1_id": "///A/641/N", "atom2_id": "///A/644/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 648, "atom1_serNum": 4990, "atom2_serNum": 5020, "donAcc_type": "standard", "distance": 2.681, "atom1_id": "///A/641/O", "atom2_id": "///A/645/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 649, "atom1_serNum": 4992, "atom2_serNum": 10965, "donAcc_type": "acceptable", "distance": 2.818, "atom1_id": "///A/641/OG1", "atom2_id": "///E/62/O2'", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 650, "atom1_serNum": 4994, "atom2_serNum": 10980, "donAcc_type": "standard", "distance": 2.729, "atom1_id": "///A/642/N", "atom2_id": "///E/63/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 651, "atom1_serNum": 4997, "atom2_serNum": 5029, "donAcc_type": "standard", "distance": 2.949, "atom1_id": "///A/642/O", "atom2_id": "///A/646/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 652, "atom1_serNum": 5003, "atom2_serNum": 10980, "donAcc_type": "standard", "distance": 3.580, "atom1_id": "///A/643/N", "atom2_id": "///E/63/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 653, "atom1_serNum": 5006, "atom2_serNum": 5035, "donAcc_type": "standard", "distance": 3.152, "atom1_id": "///A/643/O", "atom2_id": "///A/647/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 654, "atom1_serNum": 5014, "atom2_serNum": 5040, "donAcc_type": "standard", "distance": 3.333, "atom1_id": "///A/644/O", "atom2_id": "///A/648/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 655, "atom1_serNum": 5023, "atom2_serNum": 5040, "donAcc_type": "standard", "distance": 3.133, "atom1_id": "///A/645/O", "atom2_id": "///A/648/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 656, "atom1_serNum": 5023, "atom2_serNum": 5048, "donAcc_type": "standard", "distance": 3.274, "atom1_id": "///A/645/O", "atom2_id": "///A/649/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 657, "atom1_serNum": 5032, "atom2_serNum": 5056, "donAcc_type": "standard", "distance": 2.794, "atom1_id": "///A/646/O", "atom2_id": "///A/650/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 658, "atom1_serNum": 5038, "atom2_serNum": 5065, "donAcc_type": "standard", "distance": 3.065, "atom1_id": "///A/647/O", "atom2_id": "///A/651/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 659, "atom1_serNum": 5043, "atom2_serNum": 5070, "donAcc_type": "standard", "distance": 2.974, "atom1_id": "///A/648/O", "atom2_id": "///A/652/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 660, "atom1_serNum": 5051, "atom2_serNum": 5078, "donAcc_type": "standard", "distance": 2.754, "atom1_id": "///A/649/O", "atom2_id": "///A/653/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 661, "atom1_serNum": 5059, "atom2_serNum": 5085, "donAcc_type": "standard", "distance": 3.066, "atom1_id": "///A/650/O", "atom2_id": "///A/654/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 662, "atom1_serNum": 5063, "atom2_serNum": 5713, "donAcc_type": "standard", "distance": 2.950, "atom1_id": "///A/650/OE1", "atom2_id": "///A/734/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 663, "atom1_serNum": 5063, "atom2_serNum": 5716, "donAcc_type": "standard", "distance": 3.112, "atom1_id": "///A/650/OE1", "atom2_id": "///A/734/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 664, "atom1_serNum": 5068, "atom2_serNum": 5093, "donAcc_type": "standard", "distance": 3.150, "atom1_id": "///A/651/O", "atom2_id": "///A/655/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 665, "atom1_serNum": 5073, "atom2_serNum": 5093, "donAcc_type": "standard", "distance": 3.115, "atom1_id": "///A/652/O", "atom2_id": "///A/655/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 666, "atom1_serNum": 5073, "atom2_serNum": 5101, "donAcc_type": "standard", "distance": 3.095, "atom1_id": "///A/652/O", "atom2_id": "///A/656/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 667, "atom1_serNum": 5081, "atom2_serNum": 5106, "donAcc_type": "acceptable", "distance": 2.618, "atom1_id": "///A/653/O", "atom2_id": "///A/656/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 668, "atom1_serNum": 5081, "atom2_serNum": 5107, "donAcc_type": "standard", "distance": 3.193, "atom1_id": "///A/653/O", "atom2_id": "///A/657/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 669, "atom1_serNum": 5096, "atom2_serNum": 5115, "donAcc_type": "standard", "distance": 2.898, "atom1_id": "///A/655/O", "atom2_id": "///A/658/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 670, "atom1_serNum": 5104, "atom2_serNum": 5124, "donAcc_type": "standard", "distance": 2.911, "atom1_id": "///A/656/O", "atom2_id": "///A/659/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 671, "atom1_serNum": 5110, "atom2_serNum": 5135, "donAcc_type": "standard", "distance": 3.447, "atom1_id": "///A/657/O", "atom2_id": "///A/660/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 672, "atom1_serNum": 5113, "atom2_serNum": 5709, "donAcc_type": "questionable", "distance": 2.696, "atom1_id": "///A/657/OD1", "atom2_id": "///A/734/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 673, "atom1_serNum": 5114, "atom2_serNum": 5191, "donAcc_type": "standard", "distance": 3.980, "atom1_id": "///A/657/ND2", "atom2_id": "///A/665/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 674, "atom1_serNum": 5143, "atom2_serNum": 5790, "donAcc_type": "standard", "distance": 2.705, "atom1_id": "///A/660/NZ", "atom2_id": "///A/743/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 675, "atom1_serNum": 5144, "atom2_serNum": 5192, "donAcc_type": "questionable", "distance": 2.580, "atom1_id": "///A/661/N", "atom2_id": "///A/665/NE2", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 676, "atom1_serNum": 5147, "atom2_serNum": 5184, "donAcc_type": "standard", "distance": 3.001, "atom1_id": "///A/661/O", "atom2_id": "///A/665/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 677, "atom1_serNum": 5150, "atom2_serNum": 5173, "donAcc_type": "standard", "distance": 3.109, "atom1_id": "///A/661/OD1", "atom2_id": "///A/664/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 678, "atom1_serNum": 5152, "atom2_serNum": 5814, "donAcc_type": "standard", "distance": 2.744, "atom1_id": "///A/662/N", "atom2_id": "///A/747/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 679, "atom1_serNum": 5155, "atom2_serNum": 5193, "donAcc_type": "standard", "distance": 2.761, "atom1_id": "///A/662/O", "atom2_id": "///A/666/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 680, "atom1_serNum": 5167, "atom2_serNum": 5202, "donAcc_type": "standard", "distance": 2.857, "atom1_id": "///A/663/O", "atom2_id": "///A/667/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 681, "atom1_serNum": 5176, "atom2_serNum": 5209, "donAcc_type": "standard", "distance": 3.216, "atom1_id": "///A/664/O", "atom2_id": "///A/668/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 682, "atom1_serNum": 5187, "atom2_serNum": 5220, "donAcc_type": "standard", "distance": 3.081, "atom1_id": "///A/665/O", "atom2_id": "///A/669/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 683, "atom1_serNum": 5196, "atom2_serNum": 5228, "donAcc_type": "standard", "distance": 3.153, "atom1_id": "///A/666/O", "atom2_id": "///A/670/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 684, "atom1_serNum": 5205, "atom2_serNum": 5237, "donAcc_type": "standard", "distance": 3.044, "atom1_id": "///A/667/O", "atom2_id": "///A/671/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 685, "atom1_serNum": 5212, "atom2_serNum": 5246, "donAcc_type": "standard", "distance": 2.659, "atom1_id": "///A/668/O", "atom2_id": "///A/672/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 686, "atom1_serNum": 5223, "atom2_serNum": 5254, "donAcc_type": "standard", "distance": 2.815, "atom1_id": "///A/669/O", "atom2_id": "///A/673/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 687, "atom1_serNum": 5231, "atom2_serNum": 5262, "donAcc_type": "standard", "distance": 2.902, "atom1_id": "///A/670/O", "atom2_id": "///A/674/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 688, "atom1_serNum": 5236, "atom2_serNum": 5964, "donAcc_type": "questionable", "distance": 2.869, "atom1_id": "///A/670/OE2", "atom2_id": "///A/767/OE2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 689, "atom1_serNum": 5257, "atom2_serNum": 5274, "donAcc_type": "standard", "distance": 2.782, "atom1_id": "///A/673/O", "atom2_id": "///A/676/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 690, "atom1_serNum": 5257, "atom2_serNum": 5281, "donAcc_type": "standard", "distance": 2.985, "atom1_id": "///A/673/O", "atom2_id": "///A/677/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 691, "atom1_serNum": 5265, "atom2_serNum": 5286, "donAcc_type": "standard", "distance": 3.373, "atom1_id": "///A/674/O", "atom2_id": "///A/678/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 692, "atom1_serNum": 5265, "atom2_serNum": 5291, "donAcc_type": "acceptable", "distance": 2.787, "atom1_id": "///A/674/O", "atom2_id": "///A/678/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 693, "atom1_serNum": 5270, "atom2_serNum": 5292, "donAcc_type": "standard", "distance": 3.298, "atom1_id": "///A/675/O", "atom2_id": "///A/679/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 694, "atom1_serNum": 5277, "atom2_serNum": 5300, "donAcc_type": "standard", "distance": 3.025, "atom1_id": "///A/676/O", "atom2_id": "///A/680/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 695, "atom1_serNum": 5284, "atom2_serNum": 5314, "donAcc_type": "standard", "distance": 3.021, "atom1_id": "///A/677/O", "atom2_id": "///A/681/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 696, "atom1_serNum": 5295, "atom2_serNum": 5327, "donAcc_type": "acceptable", "distance": 2.697, "atom1_id": "///A/679/O", "atom2_id": "///A/682/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 697, "atom1_serNum": 5308, "atom2_serNum": 6002, "donAcc_type": "standard", "distance": 3.142, "atom1_id": "///A/680/NE1", "atom2_id": "///A/772/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 698, "atom1_serNum": 5325, "atom2_serNum": 5353, "donAcc_type": "standard", "distance": 3.023, "atom1_id": "///A/682/O", "atom2_id": "///A/686/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 699, "atom1_serNum": 5327, "atom2_serNum": 5344, "donAcc_type": "acceptable", "distance": 3.266, "atom1_id": "///A/682/OG", "atom2_id": "///A/684/OD2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 700, "atom1_serNum": 5331, "atom2_serNum": 5363, "donAcc_type": "standard", "distance": 3.442, "atom1_id": "///A/683/O", "atom2_id": "///A/687/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 701, "atom1_serNum": 5340, "atom2_serNum": 5374, "donAcc_type": "standard", "distance": 3.103, "atom1_id": "///A/684/O", "atom2_id": "///A/688/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 702, "atom1_serNum": 5344, "atom2_serNum": 5345, "donAcc_type": "standard", "distance": 2.703, "atom1_id": "///A/684/OD2", "atom2_id": "///A/685/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 703, "atom1_serNum": 5348, "atom2_serNum": 5374, "donAcc_type": "standard", "distance": 2.797, "atom1_id": "///A/685/O", "atom2_id": "///A/688/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 704, "atom1_serNum": 5348, "atom2_serNum": 5381, "donAcc_type": "standard", "distance": 2.759, "atom1_id": "///A/685/O", "atom2_id": "///A/689/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 705, "atom1_serNum": 5356, "atom2_serNum": 5389, "donAcc_type": "standard", "distance": 2.973, "atom1_id": "///A/686/O", "atom2_id": "///A/690/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 706, "atom1_serNum": 5356, "atom2_serNum": 5394, "donAcc_type": "acceptable", "distance": 2.847, "atom1_id": "///A/686/O", "atom2_id": "///A/690/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 707, "atom1_serNum": 5359, "atom2_serNum": 5394, "donAcc_type": "acceptable", "distance": 2.864, "atom1_id": "///A/686/ND1", "atom2_id": "///A/690/OG", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 708, "atom1_serNum": 5366, "atom2_serNum": 5395, "donAcc_type": "standard", "distance": 2.820, "atom1_id": "///A/687/O", "atom2_id": "///A/691/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 709, "atom1_serNum": 5384, "atom2_serNum": 6084, "donAcc_type": "acceptable", "distance": 2.303, "atom1_id": "///A/689/O", "atom2_id": "///A/782/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 710, "atom1_serNum": 5398, "atom2_serNum": 5423, "donAcc_type": "standard", "distance": 2.993, "atom1_id": "///A/691/O", "atom2_id": "///A/695/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 711, "atom1_serNum": 5401, "atom2_serNum": 5410, "donAcc_type": "standard", "distance": 2.751, "atom1_id": "///A/691/OD1", "atom2_id": "///A/693/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 712, "atom1_serNum": 5401, "atom2_serNum": 5418, "donAcc_type": "standard", "distance": 3.361, "atom1_id": "///A/691/OD1", "atom2_id": "///A/694/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 713, "atom1_serNum": 5406, "atom2_serNum": 5434, "donAcc_type": "standard", "distance": 2.740, "atom1_id": "///A/692/O", "atom2_id": "///A/696/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 714, "atom1_serNum": 5413, "atom2_serNum": 5442, "donAcc_type": "standard", "distance": 3.138, "atom1_id": "///A/693/O", "atom2_id": "///A/697/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 715, "atom1_serNum": 5416, "atom2_serNum": 6181, "donAcc_type": "standard", "distance": 3.127, "atom1_id": "///A/693/OD1", "atom2_id": "///A/794/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 716, "atom1_serNum": 5417, "atom2_serNum": 6181, "donAcc_type": "standard", "distance": 2.809, "atom1_id": "///A/693/OD2", "atom2_id": "///A/794/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 717, "atom1_serNum": 5421, "atom2_serNum": 5447, "donAcc_type": "standard", "distance": 2.861, "atom1_id": "///A/694/O", "atom2_id": "///A/698/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 718, "atom1_serNum": 5426, "atom2_serNum": 5459, "donAcc_type": "standard", "distance": 3.152, "atom1_id": "///A/695/O", "atom2_id": "///A/699/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 719, "atom1_serNum": 5437, "atom2_serNum": 5466, "donAcc_type": "standard", "distance": 2.891, "atom1_id": "///A/696/O", "atom2_id": "///A/700/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 720, "atom1_serNum": 5437, "atom2_serNum": 5470, "donAcc_type": "standard", "distance": 3.424, "atom1_id": "///A/696/O", "atom2_id": "///A/701/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 721, "atom1_serNum": 5450, "atom2_serNum": 5579, "donAcc_type": "standard", "distance": 3.096, "atom1_id": "///A/698/O", "atom2_id": "///A/717/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 722, "atom1_serNum": 5458, "atom2_serNum": 5575, "donAcc_type": "acceptable", "distance": 3.873, "atom1_id": "///A/698/OH", "atom2_id": "///A/717/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 723, "atom1_serNum": 5462, "atom2_serNum": 5590, "donAcc_type": "standard", "distance": 3.091, "atom1_id": "///A/699/O", "atom2_id": "///A/718/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 724, "atom1_serNum": 5473, "atom2_serNum": 6190, "donAcc_type": "standard", "distance": 2.597, "atom1_id": "///A/701/O", "atom2_id": "///A/796/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 725, "atom1_serNum": 5503, "atom2_serNum": 5510, "donAcc_type": "standard", "distance": 2.770, "atom1_id": "///A/707/N", "atom2_id": "///A/707/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 726, "atom1_serNum": 5533, "atom2_serNum": 5547, "donAcc_type": "standard", "distance": 2.762, "atom1_id": "///A/711/O", "atom2_id": "///A/713/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 727, "atom1_serNum": 5533, "atom2_serNum": 5554, "donAcc_type": "standard", "distance": 2.711, "atom1_id": "///A/711/O", "atom2_id": "///A/714/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 728, "atom1_serNum": 5537, "atom2_serNum": 5539, "donAcc_type": "standard", "distance": 2.862, "atom1_id": "///A/711/OE1", "atom2_id": "///A/712/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 729, "atom1_serNum": 5538, "atom2_serNum": 5589, "donAcc_type": "standard", "distance": 3.451, "atom1_id": "///A/711/OE2", "atom2_id": "///A/718/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 730, "atom1_serNum": 5538, "atom2_serNum": 10995, "donAcc_type": "standard", "distance": 3.394, "atom1_id": "///A/711/OE2", "atom2_id": "///E/63/N4", "atom_pair": "O:N", "residue_pair": "aa:nt" }, { "index": 731, "atom1_serNum": 5539, "atom2_serNum": 5546, "donAcc_type": "standard", "distance": 2.960, "atom1_id": "///A/712/N", "atom2_id": "///A/712/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 732, "atom1_serNum": 5542, "atom2_serNum": 5564, "donAcc_type": "standard", "distance": 3.772, "atom1_id": "///A/712/O", "atom2_id": "///A/716/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 733, "atom1_serNum": 5550, "atom2_serNum": 5572, "donAcc_type": "standard", "distance": 3.366, "atom1_id": "///A/713/O", "atom2_id": "///A/717/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 734, "atom1_serNum": 5557, "atom2_serNum": 5580, "donAcc_type": "standard", "distance": 3.135, "atom1_id": "///A/714/O", "atom2_id": "///A/718/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 735, "atom1_serNum": 5563, "atom2_serNum": 5591, "donAcc_type": "standard", "distance": 3.175, "atom1_id": "///A/715/O", "atom2_id": "///A/719/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 736, "atom1_serNum": 5567, "atom2_serNum": 5591, "donAcc_type": "standard", "distance": 3.166, "atom1_id": "///A/716/O", "atom2_id": "///A/719/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 737, "atom1_serNum": 5567, "atom2_serNum": 5596, "donAcc_type": "standard", "distance": 3.018, "atom1_id": "///A/716/O", "atom2_id": "///A/720/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 738, "atom1_serNum": 5575, "atom2_serNum": 5596, "donAcc_type": "standard", "distance": 3.014, "atom1_id": "///A/717/O", "atom2_id": "///A/720/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 739, "atom1_serNum": 5575, "atom2_serNum": 5607, "donAcc_type": "standard", "distance": 3.008, "atom1_id": "///A/717/O", "atom2_id": "///A/721/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 740, "atom1_serNum": 5578, "atom2_serNum": 5606, "donAcc_type": "standard", "distance": 3.426, "atom1_id": "///A/717/OD1", "atom2_id": "///A/720/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 741, "atom1_serNum": 5583, "atom2_serNum": 5620, "donAcc_type": "acceptable", "distance": 2.738, "atom1_id": "///A/718/O", "atom2_id": "///A/722/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 742, "atom1_serNum": 5589, "atom2_serNum": 10992, "donAcc_type": "standard", "distance": 2.845, "atom1_id": "///A/718/NH1", "atom2_id": "///E/63/O2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 743, "atom1_serNum": 5589, "atom2_serNum": 10993, "donAcc_type": "standard", "distance": 3.147, "atom1_id": "///A/718/NH1", "atom2_id": "///E/63/N3", "atom_pair": "N:N", "residue_pair": "aa:nt" }, { "index": 744, "atom1_serNum": 5594, "atom2_serNum": 5621, "donAcc_type": "standard", "distance": 2.897, "atom1_id": "///A/719/O", "atom2_id": "///A/723/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 745, "atom1_serNum": 5599, "atom2_serNum": 5632, "donAcc_type": "standard", "distance": 3.272, "atom1_id": "///A/720/O", "atom2_id": "///A/724/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 746, "atom1_serNum": 5610, "atom2_serNum": 5638, "donAcc_type": "standard", "distance": 3.340, "atom1_id": "///A/721/O", "atom2_id": "///A/725/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 747, "atom1_serNum": 5618, "atom2_serNum": 5645, "donAcc_type": "standard", "distance": 2.852, "atom1_id": "///A/722/O", "atom2_id": "///A/726/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 748, "atom1_serNum": 5624, "atom2_serNum": 5657, "donAcc_type": "standard", "distance": 3.057, "atom1_id": "///A/723/O", "atom2_id": "///A/727/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 749, "atom1_serNum": 5624, "atom2_serNum": 5662, "donAcc_type": "acceptable", "distance": 2.505, "atom1_id": "///A/723/O", "atom2_id": "///A/727/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 750, "atom1_serNum": 5635, "atom2_serNum": 5663, "donAcc_type": "standard", "distance": 2.954, "atom1_id": "///A/724/O", "atom2_id": "///A/728/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 751, "atom1_serNum": 5641, "atom2_serNum": 5671, "donAcc_type": "standard", "distance": 3.061, "atom1_id": "///A/725/O", "atom2_id": "///A/729/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 752, "atom1_serNum": 5648, "atom2_serNum": 5679, "donAcc_type": "standard", "distance": 2.987, "atom1_id": "///A/726/O", "atom2_id": "///A/730/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 753, "atom1_serNum": 5660, "atom2_serNum": 5683, "donAcc_type": "standard", "distance": 2.917, "atom1_id": "///A/727/O", "atom2_id": "///A/731/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 754, "atom1_serNum": 5666, "atom2_serNum": 5690, "donAcc_type": "standard", "distance": 3.073, "atom1_id": "///A/728/O", "atom2_id": "///A/732/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 755, "atom1_serNum": 5674, "atom2_serNum": 5697, "donAcc_type": "standard", "distance": 2.993, "atom1_id": "///A/729/O", "atom2_id": "///A/733/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 756, "atom1_serNum": 5682, "atom2_serNum": 5706, "donAcc_type": "standard", "distance": 3.203, "atom1_id": "///A/730/O", "atom2_id": "///A/734/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 757, "atom1_serNum": 5686, "atom2_serNum": 5717, "donAcc_type": "standard", "distance": 2.976, "atom1_id": "///A/731/O", "atom2_id": "///A/735/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 758, "atom1_serNum": 5686, "atom2_serNum": 5722, "donAcc_type": "acceptable", "distance": 2.635, "atom1_id": "///A/731/O", "atom2_id": "///A/735/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 759, "atom1_serNum": 5693, "atom2_serNum": 6676, "donAcc_type": "acceptable", "distance": 3.226, "atom1_id": "///A/732/O", "atom2_id": "///A/857/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 760, "atom1_serNum": 5716, "atom2_serNum": 10031, "donAcc_type": "standard", "distance": 3.182, "atom1_id": "///A/734/NH2", "atom2_id": "///D/1/O3'", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 761, "atom1_serNum": 5716, "atom2_serNum": 10033, "donAcc_type": "acceptable", "distance": 3.100, "atom1_id": "///A/734/NH2", "atom2_id": "///D/1/O2'", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 762, "atom1_serNum": 5761, "atom2_serNum": 5783, "donAcc_type": "standard", "distance": 2.944, "atom1_id": "///A/740/O", "atom2_id": "///A/743/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 763, "atom1_serNum": 5761, "atom2_serNum": 5792, "donAcc_type": "standard", "distance": 2.917, "atom1_id": "///A/740/O", "atom2_id": "///A/744/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 764, "atom1_serNum": 5765, "atom2_serNum": 5783, "donAcc_type": "standard", "distance": 2.865, "atom1_id": "///A/740/OD2", "atom2_id": "///A/743/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 765, "atom1_serNum": 5769, "atom2_serNum": 5792, "donAcc_type": "standard", "distance": 2.718, "atom1_id": "///A/741/O", "atom2_id": "///A/744/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 766, "atom1_serNum": 5769, "atom2_serNum": 5797, "donAcc_type": "standard", "distance": 3.031, "atom1_id": "///A/741/O", "atom2_id": "///A/745/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 767, "atom1_serNum": 5782, "atom2_serNum": 5805, "donAcc_type": "standard", "distance": 3.575, "atom1_id": "///A/742/OE2", "atom2_id": "///A/745/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 768, "atom1_serNum": 5786, "atom2_serNum": 5811, "donAcc_type": "standard", "distance": 3.444, "atom1_id": "///A/743/O", "atom2_id": "///A/747/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 769, "atom1_serNum": 5795, "atom2_serNum": 5819, "donAcc_type": "standard", "distance": 3.148, "atom1_id": "///A/744/O", "atom2_id": "///A/749/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 770, "atom1_serNum": 5800, "atom2_serNum": 5815, "donAcc_type": "standard", "distance": 3.029, "atom1_id": "///A/745/O", "atom2_id": "///A/748/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 771, "atom1_serNum": 5818, "atom2_serNum": 5924, "donAcc_type": "standard", "distance": 2.928, "atom1_id": "///A/748/O", "atom2_id": "///A/762/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 772, "atom1_serNum": 5822, "atom2_serNum": 5917, "donAcc_type": "standard", "distance": 2.849, "atom1_id": "///A/749/O", "atom2_id": "///A/762/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 773, "atom1_serNum": 5837, "atom2_serNum": 5901, "donAcc_type": "standard", "distance": 2.659, "atom1_id": "///A/751/N", "atom2_id": "///A/760/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 774, "atom1_serNum": 5847, "atom2_serNum": 5898, "donAcc_type": "standard", "distance": 2.831, "atom1_id": "///A/752/O", "atom2_id": "///A/760/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 775, "atom1_serNum": 5860, "atom2_serNum": 5886, "donAcc_type": "standard", "distance": 2.792, "atom1_id": "///A/754/N", "atom2_id": "///A/758/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 776, "atom1_serNum": 5863, "atom2_serNum": 5879, "donAcc_type": "standard", "distance": 2.742, "atom1_id": "///A/754/O", "atom2_id": "///A/757/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 777, "atom1_serNum": 5876, "atom2_serNum": 5878, "donAcc_type": "acceptable", "distance": 3.134, "atom1_id": "///A/756/O", "atom2_id": "///A/756/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 778, "atom1_serNum": 5931, "atom2_serNum": 5949, "donAcc_type": "standard", "distance": 3.186, "atom1_id": "///A/763/O", "atom2_id": "///A/766/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 779, "atom1_serNum": 5931, "atom2_serNum": 5954, "donAcc_type": "acceptable", "distance": 2.787, "atom1_id": "///A/763/O", "atom2_id": "///A/766/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 780, "atom1_serNum": 5934, "atom2_serNum": 5943, "donAcc_type": "standard", "distance": 2.908, "atom1_id": "///A/763/OD1", "atom2_id": "///A/765/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 781, "atom1_serNum": 5946, "atom2_serNum": 5974, "donAcc_type": "standard", "distance": 2.796, "atom1_id": "///A/765/O", "atom2_id": "///A/769/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 782, "atom1_serNum": 5952, "atom2_serNum": 5982, "donAcc_type": "standard", "distance": 2.902, "atom1_id": "///A/766/O", "atom2_id": "///A/770/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 783, "atom1_serNum": 5968, "atom2_serNum": 5973, "donAcc_type": "standard", "distance": 2.780, "atom1_id": "///A/768/O", "atom2_id": "///A/768/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 784, "atom1_serNum": 5977, "atom2_serNum": 5999, "donAcc_type": "standard", "distance": 2.558, "atom1_id": "///A/769/O", "atom2_id": "///A/772/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 785, "atom1_serNum": 5977, "atom2_serNum": 6007, "donAcc_type": "standard", "distance": 3.312, "atom1_id": "///A/769/O", "atom2_id": "///A/773/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 786, "atom1_serNum": 5985, "atom2_serNum": 6007, "donAcc_type": "standard", "distance": 3.149, "atom1_id": "///A/770/O", "atom2_id": "///A/773/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 787, "atom1_serNum": 5993, "atom2_serNum": 6030, "donAcc_type": "standard", "distance": 3.978, "atom1_id": "///A/771/O", "atom2_id": "///A/775/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 788, "atom1_serNum": 6002, "atom2_serNum": 6031, "donAcc_type": "standard", "distance": 3.234, "atom1_id": "///A/772/O", "atom2_id": "///A/776/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 789, "atom1_serNum": 6010, "atom2_serNum": 6031, "donAcc_type": "standard", "distance": 2.938, "atom1_id": "///A/773/O", "atom2_id": "///A/776/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 790, "atom1_serNum": 6010, "atom2_serNum": 6039, "donAcc_type": "standard", "distance": 3.006, "atom1_id": "///A/773/O", "atom2_id": "///A/777/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 791, "atom1_serNum": 6018, "atom2_serNum": 6047, "donAcc_type": "standard", "distance": 2.956, "atom1_id": "///A/774/O", "atom2_id": "///A/778/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 792, "atom1_serNum": 6026, "atom2_serNum": 6052, "donAcc_type": "standard", "distance": 2.786, "atom1_id": "///A/775/O", "atom2_id": "///A/779/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 793, "atom1_serNum": 6034, "atom2_serNum": 6060, "donAcc_type": "standard", "distance": 2.661, "atom1_id": "///A/776/O", "atom2_id": "///A/780/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 794, "atom1_serNum": 6042, "atom2_serNum": 6068, "donAcc_type": "standard", "distance": 2.894, "atom1_id": "///A/777/O", "atom2_id": "///A/781/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 795, "atom1_serNum": 6050, "atom2_serNum": 6079, "donAcc_type": "standard", "distance": 3.017, "atom1_id": "///A/778/O", "atom2_id": "///A/782/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 796, "atom1_serNum": 6050, "atom2_serNum": 6084, "donAcc_type": "acceptable", "distance": 2.720, "atom1_id": "///A/778/O", "atom2_id": "///A/782/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 797, "atom1_serNum": 6055, "atom2_serNum": 6086, "donAcc_type": "standard", "distance": 2.699, "atom1_id": "///A/779/O", "atom2_id": "///A/783/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 798, "atom1_serNum": 6063, "atom2_serNum": 6096, "donAcc_type": "standard", "distance": 2.968, "atom1_id": "///A/780/O", "atom2_id": "///A/784/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 799, "atom1_serNum": 6071, "atom2_serNum": 6104, "donAcc_type": "standard", "distance": 3.031, "atom1_id": "///A/781/O", "atom2_id": "///A/785/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 800, "atom1_serNum": 6071, "atom2_serNum": 6109, "donAcc_type": "acceptable", "distance": 2.829, "atom1_id": "///A/781/O", "atom2_id": "///A/785/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 801, "atom1_serNum": 6077, "atom2_serNum": 6821, "donAcc_type": "acceptable", "distance": 3.075, "atom1_id": "///A/781/NH1", "atom2_id": "///A/875/OG", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 802, "atom1_serNum": 6082, "atom2_serNum": 6111, "donAcc_type": "standard", "distance": 3.038, "atom1_id": "///A/782/O", "atom2_id": "///A/786/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 803, "atom1_serNum": 6089, "atom2_serNum": 6111, "donAcc_type": "standard", "distance": 3.027, "atom1_id": "///A/783/O", "atom2_id": "///A/786/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 804, "atom1_serNum": 6095, "atom2_serNum": 6130, "donAcc_type": "acceptable", "distance": 3.838, "atom1_id": "///A/783/NE2", "atom2_id": "///A/787/OH", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 805, "atom1_serNum": 6099, "atom2_serNum": 6119, "donAcc_type": "standard", "distance": 3.304, "atom1_id": "///A/784/O", "atom2_id": "///A/787/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 806, "atom1_serNum": 6099, "atom2_serNum": 6852, "donAcc_type": "standard", "distance": 2.674, "atom1_id": "///A/784/O", "atom2_id": "///A/879/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 807, "atom1_serNum": 6103, "atom2_serNum": 6581, "donAcc_type": "acceptable", "distance": 3.893, "atom1_id": "///A/784/ND2", "atom2_id": "///A/844/OH", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 808, "atom1_serNum": 6107, "atom2_serNum": 6131, "donAcc_type": "standard", "distance": 3.067, "atom1_id": "///A/785/O", "atom2_id": "///A/788/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 809, "atom1_serNum": 6130, "atom2_serNum": 6919, "donAcc_type": "acceptable", "distance": 2.564, "atom1_id": "///A/787/OH", "atom2_id": "///A/887/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 810, "atom1_serNum": 6134, "atom2_serNum": 6152, "donAcc_type": "standard", "distance": 2.901, "atom1_id": "///A/788/O", "atom2_id": "///A/791/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 811, "atom1_serNum": 6134, "atom2_serNum": 6160, "donAcc_type": "standard", "distance": 2.872, "atom1_id": "///A/788/O", "atom2_id": "///A/792/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 812, "atom1_serNum": 6139, "atom2_serNum": 6168, "donAcc_type": "standard", "distance": 3.000, "atom1_id": "///A/789/O", "atom2_id": "///A/793/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 813, "atom1_serNum": 6143, "atom2_serNum": 6151, "donAcc_type": "standard", "distance": 3.139, "atom1_id": "///A/790/N", "atom2_id": "///A/790/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 814, "atom1_serNum": 6155, "atom2_serNum": 6173, "donAcc_type": "standard", "distance": 2.868, "atom1_id": "///A/791/O", "atom2_id": "///A/794/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 815, "atom1_serNum": 6163, "atom2_serNum": 6182, "donAcc_type": "standard", "distance": 3.133, "atom1_id": "///A/792/O", "atom2_id": "///A/795/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 816, "atom1_serNum": 6193, "atom2_serNum": 6211, "donAcc_type": "standard", "distance": 2.715, "atom1_id": "///A/796/O", "atom2_id": "///A/799/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 817, "atom1_serNum": 6225, "atom2_serNum": 6227, "donAcc_type": "acceptable", "distance": 3.060, "atom1_id": "///A/800/O", "atom2_id": "///A/800/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 818, "atom1_serNum": 6246, "atom2_serNum": 6911, "donAcc_type": "acceptable", "distance": 2.935, "atom1_id": "///A/803/O", "atom2_id": "///A/886/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 819, "atom1_serNum": 6257, "atom2_serNum": 6911, "donAcc_type": "acceptable", "distance": 3.303, "atom1_id": "///A/804/OD1", "atom2_id": "///A/886/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 820, "atom1_serNum": 6267, "atom2_serNum": 6295, "donAcc_type": "standard", "distance": 3.717, "atom1_id": "///A/806/N", "atom2_id": "///A/809/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 821, "atom1_serNum": 6270, "atom2_serNum": 6288, "donAcc_type": "standard", "distance": 2.599, "atom1_id": "///A/806/O", "atom2_id": "///A/809/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 822, "atom1_serNum": 6270, "atom2_serNum": 6297, "donAcc_type": "standard", "distance": 3.228, "atom1_id": "///A/806/O", "atom2_id": "///A/810/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 823, "atom1_serNum": 6275, "atom2_serNum": 6281, "donAcc_type": "standard", "distance": 2.699, "atom1_id": "///A/807/N", "atom2_id": "///A/807/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 824, "atom1_serNum": 6278, "atom2_serNum": 6311, "donAcc_type": "acceptable", "distance": 3.393, "atom1_id": "///A/807/O", "atom2_id": "///A/811/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 825, "atom1_serNum": 6281, "atom2_serNum": 6515, "donAcc_type": "standard", "distance": 3.938, "atom1_id": "///A/807/OD1", "atom2_id": "///A/837/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 826, "atom1_serNum": 6286, "atom2_serNum": 6312, "donAcc_type": "standard", "distance": 3.247, "atom1_id": "///A/808/O", "atom2_id": "///A/812/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 827, "atom1_serNum": 6295, "atom2_serNum": 6554, "donAcc_type": "acceptable", "distance": 3.778, "atom1_id": "///A/809/OE1", "atom2_id": "///A/841/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 828, "atom1_serNum": 6300, "atom2_serNum": 6325, "donAcc_type": "standard", "distance": 3.200, "atom1_id": "///A/810/O", "atom2_id": "///A/814/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 829, "atom1_serNum": 6309, "atom2_serNum": 6337, "donAcc_type": "standard", "distance": 3.244, "atom1_id": "///A/811/O", "atom2_id": "///A/816/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 830, "atom1_serNum": 6315, "atom2_serNum": 6333, "donAcc_type": "standard", "distance": 3.228, "atom1_id": "///A/812/O", "atom2_id": "///A/815/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 831, "atom1_serNum": 6336, "atom2_serNum": 6345, "donAcc_type": "standard", "distance": 3.082, "atom1_id": "///A/815/O", "atom2_id": "///A/817/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 832, "atom1_serNum": 6387, "atom2_serNum": 6409, "donAcc_type": "standard", "distance": 3.156, "atom1_id": "///A/822/O", "atom2_id": "///A/825/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 833, "atom1_serNum": 6401, "atom2_serNum": 6407, "donAcc_type": "standard", "distance": 2.792, "atom1_id": "///A/824/N", "atom2_id": "///A/824/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 834, "atom1_serNum": 6426, "atom2_serNum": 6437, "donAcc_type": "standard", "distance": 2.882, "atom1_id": "///A/827/O", "atom2_id": "///A/829/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 835, "atom1_serNum": 6440, "atom2_serNum": 6457, "donAcc_type": "standard", "distance": 2.808, "atom1_id": "///A/829/O", "atom2_id": "///A/831/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 836, "atom1_serNum": 6460, "atom2_serNum": 6488, "donAcc_type": "standard", "distance": 2.689, "atom1_id": "///A/831/O", "atom2_id": "///A/835/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 837, "atom1_serNum": 6474, "atom2_serNum": 6507, "donAcc_type": "standard", "distance": 2.903, "atom1_id": "///A/833/O", "atom2_id": "///A/837/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 838, "atom1_serNum": 6482, "atom2_serNum": 6516, "donAcc_type": "standard", "distance": 3.118, "atom1_id": "///A/834/O", "atom2_id": "///A/838/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 839, "atom1_serNum": 6491, "atom2_serNum": 6527, "donAcc_type": "standard", "distance": 3.341, "atom1_id": "///A/835/O", "atom2_id": "///A/839/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 840, "atom1_serNum": 6491, "atom2_serNum": 10988, "donAcc_type": "acceptable", "distance": 3.094, "atom1_id": "///A/835/O", "atom2_id": "///E/63/O2'", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 841, "atom1_serNum": 6497, "atom2_serNum": 10961, "donAcc_type": "standard", "distance": 3.533, "atom1_id": "///A/835/NH1", "atom2_id": "///E/62/O4'", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 842, "atom1_serNum": 6502, "atom2_serNum": 6538, "donAcc_type": "standard", "distance": 2.924, "atom1_id": "///A/836/O", "atom2_id": "///A/840/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 843, "atom1_serNum": 6510, "atom2_serNum": 6554, "donAcc_type": "acceptable", "distance": 3.004, "atom1_id": "///A/837/O", "atom2_id": "///A/841/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 844, "atom1_serNum": 6519, "atom2_serNum": 6555, "donAcc_type": "standard", "distance": 3.231, "atom1_id": "///A/838/O", "atom2_id": "///A/842/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 845, "atom1_serNum": 6519, "atom2_serNum": 6560, "donAcc_type": "acceptable", "distance": 2.708, "atom1_id": "///A/838/O", "atom2_id": "///A/842/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 846, "atom1_serNum": 6525, "atom2_serNum": 10925, "donAcc_type": "acceptable", "distance": 3.896, "atom1_id": "///A/838/NH1", "atom2_id": "///E/60/O2'", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 847, "atom1_serNum": 6530, "atom2_serNum": 6562, "donAcc_type": "standard", "distance": 2.774, "atom1_id": "///A/839/O", "atom2_id": "///A/843/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 848, "atom1_serNum": 6541, "atom2_serNum": 6570, "donAcc_type": "standard", "distance": 2.830, "atom1_id": "///A/840/O", "atom2_id": "///A/844/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 849, "atom1_serNum": 6552, "atom2_serNum": 6582, "donAcc_type": "standard", "distance": 3.105, "atom1_id": "///A/841/O", "atom2_id": "///A/845/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 850, "atom1_serNum": 6554, "atom2_serNum": 6922, "donAcc_type": "acceptable", "distance": 3.715, "atom1_id": "///A/841/OG", "atom2_id": "///A/887/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 851, "atom1_serNum": 6558, "atom2_serNum": 6591, "donAcc_type": "standard", "distance": 2.715, "atom1_id": "///A/842/O", "atom2_id": "///A/846/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 852, "atom1_serNum": 6565, "atom2_serNum": 6599, "donAcc_type": "standard", "distance": 2.920, "atom1_id": "///A/843/O", "atom2_id": "///A/847/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 853, "atom1_serNum": 6573, "atom2_serNum": 6605, "donAcc_type": "standard", "distance": 3.427, "atom1_id": "///A/844/O", "atom2_id": "///A/848/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 854, "atom1_serNum": 6585, "atom2_serNum": 6616, "donAcc_type": "standard", "distance": 2.873, "atom1_id": "///A/845/O", "atom2_id": "///A/849/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 855, "atom1_serNum": 6594, "atom2_serNum": 6626, "donAcc_type": "standard", "distance": 3.133, "atom1_id": "///A/846/O", "atom2_id": "///A/850/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 856, "atom1_serNum": 6602, "atom2_serNum": 6634, "donAcc_type": "standard", "distance": 3.325, "atom1_id": "///A/847/O", "atom2_id": "///A/851/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 857, "atom1_serNum": 6608, "atom2_serNum": 6642, "donAcc_type": "standard", "distance": 2.770, "atom1_id": "///A/848/O", "atom2_id": "///A/852/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 858, "atom1_serNum": 6619, "atom2_serNum": 6646, "donAcc_type": "standard", "distance": 2.897, "atom1_id": "///A/849/O", "atom2_id": "///A/853/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 859, "atom1_serNum": 6629, "atom2_serNum": 6655, "donAcc_type": "standard", "distance": 2.862, "atom1_id": "///A/850/O", "atom2_id": "///A/854/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 860, "atom1_serNum": 6637, "atom2_serNum": 6660, "donAcc_type": "standard", "distance": 3.970, "atom1_id": "///A/851/O", "atom2_id": "///A/855/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 861, "atom1_serNum": 6649, "atom2_serNum": 6671, "donAcc_type": "standard", "distance": 3.093, "atom1_id": "///A/853/O", "atom2_id": "///A/857/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 862, "atom1_serNum": 6658, "atom2_serNum": 6677, "donAcc_type": "standard", "distance": 2.885, "atom1_id": "///A/854/O", "atom2_id": "///A/858/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 863, "atom1_serNum": 6663, "atom2_serNum": 6685, "donAcc_type": "standard", "distance": 2.913, "atom1_id": "///A/855/O", "atom2_id": "///A/859/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 864, "atom1_serNum": 6688, "atom2_serNum": 6711, "donAcc_type": "standard", "distance": 3.153, "atom1_id": "///A/859/O", "atom2_id": "///A/862/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 865, "atom1_serNum": 6688, "atom2_serNum": 6722, "donAcc_type": "standard", "distance": 3.360, "atom1_id": "///A/859/O", "atom2_id": "///A/863/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 866, "atom1_serNum": 6697, "atom2_serNum": 6739, "donAcc_type": "acceptable", "distance": 3.099, "atom1_id": "///A/860/O", "atom2_id": "///A/864/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 867, "atom1_serNum": 6703, "atom2_serNum": 6709, "donAcc_type": "standard", "distance": 2.800, "atom1_id": "///A/861/N", "atom2_id": "///A/861/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 868, "atom1_serNum": 6714, "atom2_serNum": 6741, "donAcc_type": "standard", "distance": 3.057, "atom1_id": "///A/862/O", "atom2_id": "///A/865/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 869, "atom1_serNum": 6733, "atom2_serNum": 7020, "donAcc_type": "acceptable", "distance": 2.765, "atom1_id": "///A/863/OH", "atom2_id": "///A/899/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 870, "atom1_serNum": 6744, "atom2_serNum": 6765, "donAcc_type": "standard", "distance": 3.190, "atom1_id": "///A/865/O", "atom2_id": "///A/868/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 871, "atom1_serNum": 6751, "atom2_serNum": 6793, "donAcc_type": "standard", "distance": 3.549, "atom1_id": "///A/866/O", "atom2_id": "///A/871/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 872, "atom1_serNum": 6760, "atom2_serNum": 6778, "donAcc_type": "standard", "distance": 3.002, "atom1_id": "///A/867/O", "atom2_id": "///A/870/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 873, "atom1_serNum": 6760, "atom2_serNum": 6785, "donAcc_type": "standard", "distance": 2.920, "atom1_id": "///A/867/O", "atom2_id": "///A/871/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 874, "atom1_serNum": 6768, "atom2_serNum": 6794, "donAcc_type": "standard", "distance": 2.665, "atom1_id": "///A/868/O", "atom2_id": "///A/872/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 875, "atom1_serNum": 6776, "atom2_serNum": 6802, "donAcc_type": "standard", "distance": 2.895, "atom1_id": "///A/869/O", "atom2_id": "///A/873/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 876, "atom1_serNum": 6781, "atom2_serNum": 6810, "donAcc_type": "standard", "distance": 2.855, "atom1_id": "///A/870/O", "atom2_id": "///A/874/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 877, "atom1_serNum": 6781, "atom2_serNum": 6815, "donAcc_type": "acceptable", "distance": 2.612, "atom1_id": "///A/870/O", "atom2_id": "///A/874/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 878, "atom1_serNum": 6788, "atom2_serNum": 6815, "donAcc_type": "acceptable", "distance": 3.153, "atom1_id": "///A/871/O", "atom2_id": "///A/874/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 879, "atom1_serNum": 6788, "atom2_serNum": 6816, "donAcc_type": "standard", "distance": 3.149, "atom1_id": "///A/871/O", "atom2_id": "///A/875/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 880, "atom1_serNum": 6788, "atom2_serNum": 6821, "donAcc_type": "acceptable", "distance": 2.776, "atom1_id": "///A/871/O", "atom2_id": "///A/875/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 881, "atom1_serNum": 6797, "atom2_serNum": 6816, "donAcc_type": "standard", "distance": 3.164, "atom1_id": "///A/872/O", "atom2_id": "///A/875/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 882, "atom1_serNum": 6797, "atom2_serNum": 6822, "donAcc_type": "standard", "distance": 2.840, "atom1_id": "///A/872/O", "atom2_id": "///A/876/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 883, "atom1_serNum": 6797, "atom2_serNum": 6827, "donAcc_type": "standard", "distance": 3.228, "atom1_id": "///A/872/O", "atom2_id": "///A/877/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 884, "atom1_serNum": 6848, "atom2_serNum": 6869, "donAcc_type": "standard", "distance": 2.908, "atom1_id": "///A/879/O", "atom2_id": "///A/882/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 885, "atom1_serNum": 6848, "atom2_serNum": 6877, "donAcc_type": "standard", "distance": 3.173, "atom1_id": "///A/879/O", "atom2_id": "///A/883/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 886, "atom1_serNum": 6851, "atom2_serNum": 6876, "donAcc_type": "standard", "distance": 2.525, "atom1_id": "///A/879/OD1", "atom2_id": "///A/882/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 887, "atom1_serNum": 6856, "atom2_serNum": 7244, "donAcc_type": "standard", "distance": 2.934, "atom1_id": "///A/880/O", "atom2_id": "///A/926/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 888, "atom1_serNum": 6880, "atom2_serNum": 7244, "donAcc_type": "standard", "distance": 3.164, "atom1_id": "///A/883/O", "atom2_id": "///A/926/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 889, "atom1_serNum": 6880, "atom2_serNum": 7245, "donAcc_type": "standard", "distance": 2.734, "atom1_id": "///A/883/O", "atom2_id": "///A/926/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 890, "atom1_serNum": 6888, "atom2_serNum": 6912, "donAcc_type": "standard", "distance": 3.168, "atom1_id": "///A/884/O", "atom2_id": "///A/887/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 891, "atom1_serNum": 6888, "atom2_serNum": 6923, "donAcc_type": "standard", "distance": 3.195, "atom1_id": "///A/884/O", "atom2_id": "///A/888/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 892, "atom1_serNum": 6895, "atom2_serNum": 6931, "donAcc_type": "standard", "distance": 3.052, "atom1_id": "///A/885/O", "atom2_id": "///A/889/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 893, "atom1_serNum": 6898, "atom2_serNum": 7277, "donAcc_type": "standard", "distance": 2.944, "atom1_id": "///A/885/OD1", "atom2_id": "///A/930/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 894, "atom1_serNum": 6899, "atom2_serNum": 7277, "donAcc_type": "standard", "distance": 2.954, "atom1_id": "///A/885/OD2", "atom2_id": "///A/930/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 895, "atom1_serNum": 6915, "atom2_serNum": 6949, "donAcc_type": "standard", "distance": 3.066, "atom1_id": "///A/887/O", "atom2_id": "///A/891/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 896, "atom1_serNum": 6926, "atom2_serNum": 6957, "donAcc_type": "standard", "distance": 2.990, "atom1_id": "///A/888/O", "atom2_id": "///A/892/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 897, "atom1_serNum": 6934, "atom2_serNum": 6965, "donAcc_type": "standard", "distance": 3.162, "atom1_id": "///A/889/O", "atom2_id": "///A/893/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 898, "atom1_serNum": 6940, "atom2_serNum": 6975, "donAcc_type": "questionable", "distance": 3.243, "atom1_id": "///A/889/NH1", "atom2_id": "///A/893/NH2", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 899, "atom1_serNum": 6945, "atom2_serNum": 6976, "donAcc_type": "standard", "distance": 3.110, "atom1_id": "///A/890/O", "atom2_id": "///A/894/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 900, "atom1_serNum": 6952, "atom2_serNum": 6983, "donAcc_type": "standard", "distance": 2.783, "atom1_id": "///A/891/O", "atom2_id": "///A/895/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 901, "atom1_serNum": 6952, "atom2_serNum": 6994, "donAcc_type": "standard", "distance": 3.312, "atom1_id": "///A/891/O", "atom2_id": "///A/896/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 902, "atom1_serNum": 6960, "atom2_serNum": 7001, "donAcc_type": "standard", "distance": 2.859, "atom1_id": "///A/892/O", "atom2_id": "///A/897/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 903, "atom1_serNum": 6986, "atom2_serNum": 7017, "donAcc_type": "standard", "distance": 3.132, "atom1_id": "///A/895/O", "atom2_id": "///A/899/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 904, "atom1_serNum": 6997, "atom2_serNum": 7025, "donAcc_type": "standard", "distance": 3.037, "atom1_id": "///A/896/O", "atom2_id": "///A/900/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 905, "atom1_serNum": 7004, "atom2_serNum": 7032, "donAcc_type": "standard", "distance": 3.061, "atom1_id": "///A/897/O", "atom2_id": "///A/901/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 906, "atom1_serNum": 7009, "atom2_serNum": 7511, "donAcc_type": "standard", "distance": 3.143, "atom1_id": "///A/897/NZ", "atom2_id": "///A/971/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 907, "atom1_serNum": 7013, "atom2_serNum": 7040, "donAcc_type": "standard", "distance": 3.084, "atom1_id": "///A/898/O", "atom2_id": "///A/902/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 908, "atom1_serNum": 7028, "atom2_serNum": 7051, "donAcc_type": "standard", "distance": 2.829, "atom1_id": "///A/900/O", "atom2_id": "///A/903/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 909, "atom1_serNum": 7054, "atom2_serNum": 7101, "donAcc_type": "acceptable", "distance": 3.044, "atom1_id": "///A/903/O", "atom2_id": "///A/908/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 910, "atom1_serNum": 7060, "atom2_serNum": 7080, "donAcc_type": "standard", "distance": 2.865, "atom1_id": "///A/904/O", "atom2_id": "///A/907/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 911, "atom1_serNum": 7067, "atom2_serNum": 7090, "donAcc_type": "standard", "distance": 2.986, "atom1_id": "///A/905/O", "atom2_id": "///A/908/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 912, "atom1_serNum": 7071, "atom2_serNum": 7078, "donAcc_type": "standard", "distance": 2.309, "atom1_id": "///A/906/N", "atom2_id": "///A/906/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 913, "atom1_serNum": 7083, "atom2_serNum": 7116, "donAcc_type": "standard", "distance": 3.196, "atom1_id": "///A/907/O", "atom2_id": "///A/911/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 914, "atom1_serNum": 7083, "atom2_serNum": 7124, "donAcc_type": "standard", "distance": 3.340, "atom1_id": "///A/907/O", "atom2_id": "///A/912/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 915, "atom1_serNum": 7093, "atom2_serNum": 7131, "donAcc_type": "standard", "distance": 2.824, "atom1_id": "///A/908/O", "atom2_id": "///A/913/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 916, "atom1_serNum": 7109, "atom2_serNum": 7660, "donAcc_type": "standard", "distance": 3.395, "atom1_id": "///A/909/OE1", "atom2_id": "///A/1021/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 917, "atom1_serNum": 7127, "atom2_serNum": 7152, "donAcc_type": "standard", "distance": 2.913, "atom1_id": "///A/912/O", "atom2_id": "///A/916/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 918, "atom1_serNum": 7134, "atom2_serNum": 7160, "donAcc_type": "standard", "distance": 3.269, "atom1_id": "///A/913/O", "atom2_id": "///A/917/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 919, "atom1_serNum": 7147, "atom2_serNum": 7171, "donAcc_type": "standard", "distance": 3.219, "atom1_id": "///A/915/O", "atom2_id": "///A/919/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 920, "atom1_serNum": 7155, "atom2_serNum": 7179, "donAcc_type": "standard", "distance": 2.753, "atom1_id": "///A/916/O", "atom2_id": "///A/920/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 921, "atom1_serNum": 7163, "atom2_serNum": 7190, "donAcc_type": "standard", "distance": 3.157, "atom1_id": "///A/917/O", "atom2_id": "///A/921/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 922, "atom1_serNum": 7163, "atom2_serNum": 7195, "donAcc_type": "acceptable", "distance": 2.953, "atom1_id": "///A/917/O", "atom2_id": "///A/921/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 923, "atom1_serNum": 7167, "atom2_serNum": 7197, "donAcc_type": "standard", "distance": 2.954, "atom1_id": "///A/918/O", "atom2_id": "///A/922/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 924, "atom1_serNum": 7174, "atom2_serNum": 7209, "donAcc_type": "standard", "distance": 2.727, "atom1_id": "///A/919/O", "atom2_id": "///A/923/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 925, "atom1_serNum": 7182, "atom2_serNum": 7217, "donAcc_type": "standard", "distance": 2.997, "atom1_id": "///A/920/O", "atom2_id": "///A/924/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 926, "atom1_serNum": 7193, "atom2_serNum": 7227, "donAcc_type": "standard", "distance": 3.099, "atom1_id": "///A/921/O", "atom2_id": "///A/925/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 927, "atom1_serNum": 7200, "atom2_serNum": 7227, "donAcc_type": "standard", "distance": 2.885, "atom1_id": "///A/922/O", "atom2_id": "///A/925/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 928, "atom1_serNum": 7200, "atom2_serNum": 7235, "donAcc_type": "standard", "distance": 2.806, "atom1_id": "///A/922/O", "atom2_id": "///A/926/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 929, "atom1_serNum": 7208, "atom2_serNum": 7244, "donAcc_type": "acceptable", "distance": 2.738, "atom1_id": "///A/922/OH", "atom2_id": "///A/926/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 930, "atom1_serNum": 7212, "atom2_serNum": 7246, "donAcc_type": "standard", "distance": 2.789, "atom1_id": "///A/923/O", "atom2_id": "///A/927/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 931, "atom1_serNum": 7220, "atom2_serNum": 7254, "donAcc_type": "standard", "distance": 3.013, "atom1_id": "///A/924/O", "atom2_id": "///A/928/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 932, "atom1_serNum": 7220, "atom2_serNum": 7259, "donAcc_type": "acceptable", "distance": 2.847, "atom1_id": "///A/924/O", "atom2_id": "///A/928/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 933, "atom1_serNum": 7230, "atom2_serNum": 7260, "donAcc_type": "standard", "distance": 3.273, "atom1_id": "///A/925/O", "atom2_id": "///A/929/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 934, "atom1_serNum": 7238, "atom2_serNum": 7269, "donAcc_type": "standard", "distance": 3.001, "atom1_id": "///A/926/O", "atom2_id": "///A/930/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 935, "atom1_serNum": 7249, "atom2_serNum": 7278, "donAcc_type": "standard", "distance": 2.736, "atom1_id": "///A/927/O", "atom2_id": "///A/931/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 936, "atom1_serNum": 7257, "atom2_serNum": 7292, "donAcc_type": "standard", "distance": 3.062, "atom1_id": "///A/928/O", "atom2_id": "///A/932/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 937, "atom1_serNum": 7259, "atom2_serNum": 7757, "donAcc_type": "acceptable", "distance": 3.560, "atom1_id": "///A/928/OG", "atom2_id": "///A/1034/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 938, "atom1_serNum": 7263, "atom2_serNum": 7301, "donAcc_type": "standard", "distance": 3.356, "atom1_id": "///A/929/O", "atom2_id": "///A/933/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 939, "atom1_serNum": 7272, "atom2_serNum": 7308, "donAcc_type": "standard", "distance": 3.437, "atom1_id": "///A/930/O", "atom2_id": "///A/934/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 940, "atom1_serNum": 7281, "atom2_serNum": 7316, "donAcc_type": "standard", "distance": 2.767, "atom1_id": "///A/931/O", "atom2_id": "///A/935/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 941, "atom1_serNum": 7286, "atom2_serNum": 7467, "donAcc_type": "acceptable", "distance": 3.360, "atom1_id": "///A/931/NE1", "atom2_id": "///A/966/OG1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 942, "atom1_serNum": 7295, "atom2_serNum": 7324, "donAcc_type": "standard", "distance": 3.158, "atom1_id": "///A/932/O", "atom2_id": "///A/936/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 943, "atom1_serNum": 7311, "atom2_serNum": 7333, "donAcc_type": "standard", "distance": 3.080, "atom1_id": "///A/934/O", "atom2_id": "///A/937/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 944, "atom1_serNum": 7343, "atom2_serNum": 7410, "donAcc_type": "standard", "distance": 3.741, "atom1_id": "///A/937/NH2", "atom2_id": "///A/959/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 945, "atom1_serNum": 7347, "atom2_serNum": 7377, "donAcc_type": "standard", "distance": 3.241, "atom1_id": "///A/952/O", "atom2_id": "///A/956/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 946, "atom1_serNum": 7356, "atom2_serNum": 7385, "donAcc_type": "standard", "distance": 2.832, "atom1_id": "///A/953/O", "atom2_id": "///A/957/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 947, "atom1_serNum": 7371, "atom2_serNum": 7402, "donAcc_type": "standard", "distance": 3.232, "atom1_id": "///A/955/O", "atom2_id": "///A/959/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 948, "atom1_serNum": 7380, "atom2_serNum": 7411, "donAcc_type": "standard", "distance": 3.506, "atom1_id": "///A/956/O", "atom2_id": "///A/960/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 949, "atom1_serNum": 7388, "atom2_serNum": 7420, "donAcc_type": "standard", "distance": 3.457, "atom1_id": "///A/957/O", "atom2_id": "///A/961/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 950, "atom1_serNum": 7396, "atom2_serNum": 7428, "donAcc_type": "standard", "distance": 3.313, "atom1_id": "///A/958/O", "atom2_id": "///A/962/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 951, "atom1_serNum": 7405, "atom2_serNum": 7428, "donAcc_type": "standard", "distance": 3.091, "atom1_id": "///A/959/O", "atom2_id": "///A/962/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 952, "atom1_serNum": 7405, "atom2_serNum": 7435, "donAcc_type": "standard", "distance": 3.249, "atom1_id": "///A/959/O", "atom2_id": "///A/963/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 953, "atom1_serNum": 7414, "atom2_serNum": 7446, "donAcc_type": "standard", "distance": 3.048, "atom1_id": "///A/960/O", "atom2_id": "///A/964/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 954, "atom1_serNum": 7423, "atom2_serNum": 7454, "donAcc_type": "standard", "distance": 3.018, "atom1_id": "///A/961/O", "atom2_id": "///A/965/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 955, "atom1_serNum": 7431, "atom2_serNum": 7462, "donAcc_type": "standard", "distance": 2.859, "atom1_id": "///A/962/O", "atom2_id": "///A/966/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 956, "atom1_serNum": 7431, "atom2_serNum": 7467, "donAcc_type": "acceptable", "distance": 2.339, "atom1_id": "///A/962/O", "atom2_id": "///A/966/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 957, "atom1_serNum": 7438, "atom2_serNum": 7469, "donAcc_type": "standard", "distance": 3.132, "atom1_id": "///A/963/O", "atom2_id": "///A/967/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 958, "atom1_serNum": 7444, "atom2_serNum": 7807, "donAcc_type": "standard", "distance": 2.883, "atom1_id": "///A/963/NH1", "atom2_id": "///A/1040/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 959, "atom1_serNum": 7449, "atom2_serNum": 7480, "donAcc_type": "standard", "distance": 2.938, "atom1_id": "///A/964/O", "atom2_id": "///A/968/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 960, "atom1_serNum": 7457, "atom2_serNum": 7489, "donAcc_type": "standard", "distance": 2.825, "atom1_id": "///A/965/O", "atom2_id": "///A/969/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 961, "atom1_serNum": 7465, "atom2_serNum": 7496, "donAcc_type": "standard", "distance": 2.837, "atom1_id": "///A/966/O", "atom2_id": "///A/970/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 962, "atom1_serNum": 7472, "atom2_serNum": 7504, "donAcc_type": "standard", "distance": 2.759, "atom1_id": "///A/967/O", "atom2_id": "///A/971/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 963, "atom1_serNum": 7479, "atom2_serNum": 7807, "donAcc_type": "standard", "distance": 3.553, "atom1_id": "///A/967/NH2", "atom2_id": "///A/1040/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 964, "atom1_serNum": 7483, "atom2_serNum": 7512, "donAcc_type": "standard", "distance": 2.922, "atom1_id": "///A/968/O", "atom2_id": "///A/972/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 965, "atom1_serNum": 7492, "atom2_serNum": 7520, "donAcc_type": "standard", "distance": 2.993, "atom1_id": "///A/969/O", "atom2_id": "///A/973/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 966, "atom1_serNum": 7499, "atom2_serNum": 7528, "donAcc_type": "standard", "distance": 2.912, "atom1_id": "///A/970/O", "atom2_id": "///A/974/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 967, "atom1_serNum": 7499, "atom2_serNum": 7533, "donAcc_type": "acceptable", "distance": 2.802, "atom1_id": "///A/970/O", "atom2_id": "///A/974/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 968, "atom1_serNum": 7507, "atom2_serNum": 7535, "donAcc_type": "standard", "distance": 2.852, "atom1_id": "///A/971/O", "atom2_id": "///A/975/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 969, "atom1_serNum": 7510, "atom2_serNum": 7854, "donAcc_type": "standard", "distance": 3.528, "atom1_id": "///A/971/OD1", "atom2_id": "///A/1046/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 970, "atom1_serNum": 7515, "atom2_serNum": 7542, "donAcc_type": "standard", "distance": 3.208, "atom1_id": "///A/972/O", "atom2_id": "///A/976/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 971, "atom1_serNum": 7523, "atom2_serNum": 7548, "donAcc_type": "standard", "distance": 3.429, "atom1_id": "///A/973/O", "atom2_id": "///A/977/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 972, "atom1_serNum": 7531, "atom2_serNum": 7554, "donAcc_type": "standard", "distance": 2.877, "atom1_id": "///A/974/O", "atom2_id": "///A/978/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 973, "atom1_serNum": 7545, "atom2_serNum": 7589, "donAcc_type": "acceptable", "distance": 2.968, "atom1_id": "///A/976/O", "atom2_id": "///A/1012/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 974, "atom1_serNum": 7551, "atom2_serNum": 7584, "donAcc_type": "standard", "distance": 2.679, "atom1_id": "///A/977/O", "atom2_id": "///A/1012/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 975, "atom1_serNum": 7561, "atom2_serNum": 7570, "donAcc_type": "standard", "distance": 3.197, "atom1_id": "///A/979/N", "atom2_id": "///A/1010/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 976, "atom1_serNum": 7587, "atom2_serNum": 7607, "donAcc_type": "standard", "distance": 2.749, "atom1_id": "///A/1012/O", "atom2_id": "///A/1015/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 977, "atom1_serNum": 7587, "atom2_serNum": 7611, "donAcc_type": "standard", "distance": 2.859, "atom1_id": "///A/1012/O", "atom2_id": "///A/1016/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 978, "atom1_serNum": 7594, "atom2_serNum": 7620, "donAcc_type": "standard", "distance": 2.537, "atom1_id": "///A/1013/O", "atom2_id": "///A/1017/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 979, "atom1_serNum": 7602, "atom2_serNum": 7626, "donAcc_type": "standard", "distance": 3.255, "atom1_id": "///A/1014/O", "atom2_id": "///A/1018/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 980, "atom1_serNum": 7610, "atom2_serNum": 7634, "donAcc_type": "standard", "distance": 3.226, "atom1_id": "///A/1015/O", "atom2_id": "///A/1019/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 981, "atom1_serNum": 7614, "atom2_serNum": 7634, "donAcc_type": "standard", "distance": 3.013, "atom1_id": "///A/1016/O", "atom2_id": "///A/1019/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 982, "atom1_serNum": 7614, "atom2_serNum": 7642, "donAcc_type": "standard", "distance": 3.143, "atom1_id": "///A/1016/O", "atom2_id": "///A/1020/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 983, "atom1_serNum": 7654, "atom2_serNum": 7685, "donAcc_type": "standard", "distance": 3.369, "atom1_id": "///A/1021/O", "atom2_id": "///A/1025/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 984, "atom1_serNum": 7664, "atom2_serNum": 7691, "donAcc_type": "standard", "distance": 3.270, "atom1_id": "///A/1022/O", "atom2_id": "///A/1026/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 985, "atom1_serNum": 7664, "atom2_serNum": 7696, "donAcc_type": "acceptable", "distance": 2.966, "atom1_id": "///A/1022/O", "atom2_id": "///A/1026/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 986, "atom1_serNum": 7673, "atom2_serNum": 7698, "donAcc_type": "standard", "distance": 3.060, "atom1_id": "///A/1023/O", "atom2_id": "///A/1027/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 987, "atom1_serNum": 7681, "atom2_serNum": 7703, "donAcc_type": "standard", "distance": 2.867, "atom1_id": "///A/1024/O", "atom2_id": "///A/1028/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 988, "atom1_serNum": 7688, "atom2_serNum": 7711, "donAcc_type": "standard", "distance": 3.058, "atom1_id": "///A/1025/O", "atom2_id": "///A/1029/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 989, "atom1_serNum": 7694, "atom2_serNum": 7719, "donAcc_type": "standard", "distance": 2.966, "atom1_id": "///A/1026/O", "atom2_id": "///A/1030/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 990, "atom1_serNum": 7701, "atom2_serNum": 7727, "donAcc_type": "standard", "distance": 3.151, "atom1_id": "///A/1027/O", "atom2_id": "///A/1031/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 991, "atom1_serNum": 7701, "atom2_serNum": 7732, "donAcc_type": "acceptable", "distance": 2.490, "atom1_id": "///A/1027/O", "atom2_id": "///A/1031/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 992, "atom1_serNum": 7706, "atom2_serNum": 7734, "donAcc_type": "standard", "distance": 3.254, "atom1_id": "///A/1028/O", "atom2_id": "///A/1032/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 993, "atom1_serNum": 7714, "atom2_serNum": 7739, "donAcc_type": "standard", "distance": 3.125, "atom1_id": "///A/1029/O", "atom2_id": "///A/1033/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 994, "atom1_serNum": 7722, "atom2_serNum": 7750, "donAcc_type": "standard", "distance": 2.849, "atom1_id": "///A/1030/O", "atom2_id": "///A/1034/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 995, "atom1_serNum": 7730, "atom2_serNum": 7758, "donAcc_type": "standard", "distance": 3.038, "atom1_id": "///A/1031/O", "atom2_id": "///A/1035/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 996, "atom1_serNum": 7730, "atom2_serNum": 7763, "donAcc_type": "acceptable", "distance": 2.504, "atom1_id": "///A/1031/O", "atom2_id": "///A/1035/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 997, "atom1_serNum": 7737, "atom2_serNum": 7763, "donAcc_type": "acceptable", "distance": 2.779, "atom1_id": "///A/1032/O", "atom2_id": "///A/1035/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 998, "atom1_serNum": 7753, "atom2_serNum": 7772, "donAcc_type": "standard", "distance": 2.948, "atom1_id": "///A/1034/O", "atom2_id": "///A/1037/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 999, "atom1_serNum": 7753, "atom2_serNum": 7777, "donAcc_type": "standard", "distance": 3.628, "atom1_id": "///A/1034/O", "atom2_id": "///A/1038/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1000, "atom1_serNum": 7761, "atom2_serNum": 7777, "donAcc_type": "standard", "distance": 3.101, "atom1_id": "///A/1035/O", "atom2_id": "///A/1038/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1001, "atom1_serNum": 7794, "atom2_serNum": 7808, "donAcc_type": "standard", "distance": 3.390, "atom1_id": "///A/1039/O", "atom2_id": "///A/1041/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1002, "atom1_serNum": 7803, "atom2_serNum": 7829, "donAcc_type": "standard", "distance": 3.904, "atom1_id": "///A/1040/O", "atom2_id": "///A/1044/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1003, "atom1_serNum": 7806, "atom2_serNum": 7823, "donAcc_type": "standard", "distance": 2.970, "atom1_id": "///A/1040/OD1", "atom2_id": "///A/1043/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1004, "atom1_serNum": 7811, "atom2_serNum": 7843, "donAcc_type": "standard", "distance": 3.074, "atom1_id": "///A/1041/O", "atom2_id": "///A/1045/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1005, "atom1_serNum": 7818, "atom2_serNum": 7843, "donAcc_type": "standard", "distance": 3.491, "atom1_id": "///A/1042/O", "atom2_id": "///A/1045/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1006, "atom1_serNum": 7826, "atom2_serNum": 7855, "donAcc_type": "standard", "distance": 2.903, "atom1_id": "///A/1043/O", "atom2_id": "///A/1047/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1007, "atom1_serNum": 7826, "atom2_serNum": 7860, "donAcc_type": "acceptable", "distance": 2.692, "atom1_id": "///A/1043/O", "atom2_id": "///A/1047/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1008, "atom1_serNum": 7828, "atom2_serNum": 7860, "donAcc_type": "acceptable", "distance": 2.824, "atom1_id": "///A/1043/OG", "atom2_id": "///A/1047/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1009, "atom1_serNum": 7832, "atom2_serNum": 7862, "donAcc_type": "standard", "distance": 3.057, "atom1_id": "///A/1044/O", "atom2_id": "///A/1048/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1010, "atom1_serNum": 7832, "atom2_serNum": 7867, "donAcc_type": "acceptable", "distance": 2.470, "atom1_id": "///A/1044/O", "atom2_id": "///A/1048/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1011, "atom1_serNum": 7838, "atom2_serNum": 7869, "donAcc_type": "standard", "distance": 3.065, "atom1_id": "///A/1045/O", "atom2_id": "///A/1049/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1012, "atom1_serNum": 7838, "atom2_serNum": 7874, "donAcc_type": "acceptable", "distance": 2.587, "atom1_id": "///A/1045/O", "atom2_id": "///A/1049/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1013, "atom1_serNum": 7842, "atom2_serNum": 8164, "donAcc_type": "standard", "distance": 3.483, "atom1_id": "///A/1045/OE1", "atom2_id": "///A/1086/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1014, "atom1_serNum": 7847, "atom2_serNum": 7875, "donAcc_type": "standard", "distance": 3.217, "atom1_id": "///A/1046/O", "atom2_id": "///A/1050/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1015, "atom1_serNum": 7858, "atom2_serNum": 7884, "donAcc_type": "standard", "distance": 2.850, "atom1_id": "///A/1047/O", "atom2_id": "///A/1051/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1016, "atom1_serNum": 7858, "atom2_serNum": 7892, "donAcc_type": "standard", "distance": 2.759, "atom1_id": "///A/1047/O", "atom2_id": "///A/1052/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1017, "atom1_serNum": 7865, "atom2_serNum": 7898, "donAcc_type": "standard", "distance": 3.892, "atom1_id": "///A/1048/O", "atom2_id": "///A/1053/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1018, "atom1_serNum": 7887, "atom2_serNum": 7919, "donAcc_type": "standard", "distance": 3.359, "atom1_id": "///A/1051/O", "atom2_id": "///A/1055/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1019, "atom1_serNum": 7895, "atom2_serNum": 7927, "donAcc_type": "standard", "distance": 3.505, "atom1_id": "///A/1052/O", "atom2_id": "///A/1056/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1020, "atom1_serNum": 7901, "atom2_serNum": 7927, "donAcc_type": "standard", "distance": 2.860, "atom1_id": "///A/1053/O", "atom2_id": "///A/1056/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1021, "atom1_serNum": 7901, "atom2_serNum": 7935, "donAcc_type": "standard", "distance": 2.899, "atom1_id": "///A/1053/O", "atom2_id": "///A/1057/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1022, "atom1_serNum": 7922, "atom2_serNum": 7944, "donAcc_type": "standard", "distance": 3.113, "atom1_id": "///A/1055/O", "atom2_id": "///A/1058/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1023, "atom1_serNum": 7922, "atom2_serNum": 7953, "donAcc_type": "standard", "distance": 3.582, "atom1_id": "///A/1055/O", "atom2_id": "///A/1059/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1024, "atom1_serNum": 7930, "atom2_serNum": 7953, "donAcc_type": "standard", "distance": 2.921, "atom1_id": "///A/1056/O", "atom2_id": "///A/1059/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1025, "atom1_serNum": 7930, "atom2_serNum": 7960, "donAcc_type": "standard", "distance": 3.284, "atom1_id": "///A/1056/O", "atom2_id": "///A/1060/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1026, "atom1_serNum": 7971, "atom2_serNum": 7973, "donAcc_type": "acceptable", "distance": 3.074, "atom1_id": "///A/1061/O", "atom2_id": "///A/1061/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1027, "atom1_serNum": 7977, "atom2_serNum": 7985, "donAcc_type": "standard", "distance": 3.171, "atom1_id": "///A/1062/O", "atom2_id": "///A/1064/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1028, "atom1_serNum": 7977, "atom2_serNum": 8342, "donAcc_type": "acceptable", "distance": 3.812, "atom1_id": "///A/1062/O", "atom2_id": "///A/1108/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1029, "atom1_serNum": 7996, "atom2_serNum": 8014, "donAcc_type": "standard", "distance": 2.841, "atom1_id": "///A/1065/O", "atom2_id": "///A/1068/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1030, "atom1_serNum": 7996, "atom2_serNum": 8019, "donAcc_type": "standard", "distance": 3.201, "atom1_id": "///A/1065/O", "atom2_id": "///A/1069/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1031, "atom1_serNum": 8004, "atom2_serNum": 8026, "donAcc_type": "standard", "distance": 3.338, "atom1_id": "///A/1066/O", "atom2_id": "///A/1070/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1032, "atom1_serNum": 8009, "atom2_serNum": 8031, "donAcc_type": "acceptable", "distance": 2.733, "atom1_id": "///A/1067/O", "atom2_id": "///A/1070/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1033, "atom1_serNum": 8009, "atom2_serNum": 8033, "donAcc_type": "standard", "distance": 3.309, "atom1_id": "///A/1067/O", "atom2_id": "///A/1071/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1034, "atom1_serNum": 8017, "atom2_serNum": 8047, "donAcc_type": "standard", "distance": 2.995, "atom1_id": "///A/1068/O", "atom2_id": "///A/1072/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1035, "atom1_serNum": 8022, "atom2_serNum": 8055, "donAcc_type": "standard", "distance": 3.525, "atom1_id": "///A/1069/O", "atom2_id": "///A/1073/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1036, "atom1_serNum": 8029, "atom2_serNum": 8066, "donAcc_type": "standard", "distance": 3.266, "atom1_id": "///A/1070/O", "atom2_id": "///A/1074/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1037, "atom1_serNum": 8029, "atom2_serNum": 8071, "donAcc_type": "acceptable", "distance": 2.519, "atom1_id": "///A/1070/O", "atom2_id": "///A/1074/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1038, "atom1_serNum": 8036, "atom2_serNum": 8073, "donAcc_type": "standard", "distance": 2.957, "atom1_id": "///A/1071/O", "atom2_id": "///A/1075/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1039, "atom1_serNum": 8036, "atom2_serNum": 8078, "donAcc_type": "acceptable", "distance": 2.898, "atom1_id": "///A/1071/O", "atom2_id": "///A/1075/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1040, "atom1_serNum": 8050, "atom2_serNum": 8079, "donAcc_type": "standard", "distance": 3.172, "atom1_id": "///A/1072/O", "atom2_id": "///A/1076/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1041, "atom1_serNum": 8058, "atom2_serNum": 8086, "donAcc_type": "standard", "distance": 2.985, "atom1_id": "///A/1073/O", "atom2_id": "///A/1077/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1042, "atom1_serNum": 8069, "atom2_serNum": 8094, "donAcc_type": "standard", "distance": 2.941, "atom1_id": "///A/1074/O", "atom2_id": "///A/1078/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1043, "atom1_serNum": 8076, "atom2_serNum": 8103, "donAcc_type": "standard", "distance": 3.166, "atom1_id": "///A/1075/O", "atom2_id": "///A/1079/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1044, "atom1_serNum": 8082, "atom2_serNum": 8107, "donAcc_type": "standard", "distance": 3.114, "atom1_id": "///A/1076/O", "atom2_id": "///A/1080/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1045, "atom1_serNum": 8089, "atom2_serNum": 8115, "donAcc_type": "standard", "distance": 2.711, "atom1_id": "///A/1077/O", "atom2_id": "///A/1081/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1046, "atom1_serNum": 8097, "atom2_serNum": 8124, "donAcc_type": "standard", "distance": 2.613, "atom1_id": "///A/1078/O", "atom2_id": "///A/1082/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1047, "atom1_serNum": 8106, "atom2_serNum": 8132, "donAcc_type": "standard", "distance": 3.093, "atom1_id": "///A/1079/O", "atom2_id": "///A/1083/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1048, "atom1_serNum": 8135, "atom2_serNum": 8146, "donAcc_type": "standard", "distance": 2.885, "atom1_id": "///A/1083/O", "atom2_id": "///A/1085/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1049, "atom1_serNum": 8149, "atom2_serNum": 8165, "donAcc_type": "standard", "distance": 3.380, "atom1_id": "///A/1085/O", "atom2_id": "///A/1087/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1050, "atom1_serNum": 8158, "atom2_serNum": 8183, "donAcc_type": "standard", "distance": 3.135, "atom1_id": "///A/1086/O", "atom2_id": "///A/1090/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1051, "atom1_serNum": 8164, "atom2_serNum": 10689, "donAcc_type": "standard", "distance": 3.904, "atom1_id": "///A/1086/NE2", "atom2_id": "///E/49/O3'", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 1052, "atom1_serNum": 8168, "atom2_serNum": 8191, "donAcc_type": "standard", "distance": 3.345, "atom1_id": "///A/1087/O", "atom2_id": "///A/1091/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1053, "atom1_serNum": 8171, "atom2_serNum": 10329, "donAcc_type": "acceptable", "distance": 3.379, "atom1_id": "///A/1087/OD1", "atom2_id": "///D/17/O2'", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 1054, "atom1_serNum": 8176, "atom2_serNum": 8196, "donAcc_type": "standard", "distance": 3.392, "atom1_id": "///A/1088/O", "atom2_id": "///A/1092/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1055, "atom1_serNum": 8180, "atom2_serNum": 8196, "donAcc_type": "standard", "distance": 2.884, "atom1_id": "///A/1089/O", "atom2_id": "///A/1092/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1056, "atom1_serNum": 8180, "atom2_serNum": 8202, "donAcc_type": "standard", "distance": 2.652, "atom1_id": "///A/1089/O", "atom2_id": "///A/1093/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1057, "atom1_serNum": 8186, "atom2_serNum": 8210, "donAcc_type": "standard", "distance": 2.800, "atom1_id": "///A/1090/O", "atom2_id": "///A/1094/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1058, "atom1_serNum": 8194, "atom2_serNum": 8217, "donAcc_type": "standard", "distance": 3.115, "atom1_id": "///A/1091/O", "atom2_id": "///A/1095/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1059, "atom1_serNum": 8199, "atom2_serNum": 8227, "donAcc_type": "standard", "distance": 3.266, "atom1_id": "///A/1092/O", "atom2_id": "///A/1096/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1060, "atom1_serNum": 8205, "atom2_serNum": 8235, "donAcc_type": "standard", "distance": 2.707, "atom1_id": "///A/1093/O", "atom2_id": "///A/1097/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1061, "atom1_serNum": 8213, "atom2_serNum": 8240, "donAcc_type": "standard", "distance": 2.805, "atom1_id": "///A/1094/O", "atom2_id": "///A/1098/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1062, "atom1_serNum": 8220, "atom2_serNum": 8251, "donAcc_type": "standard", "distance": 2.998, "atom1_id": "///A/1095/O", "atom2_id": "///A/1099/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1063, "atom1_serNum": 8230, "atom2_serNum": 8260, "donAcc_type": "standard", "distance": 3.302, "atom1_id": "///A/1096/O", "atom2_id": "///A/1100/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1064, "atom1_serNum": 8238, "atom2_serNum": 8268, "donAcc_type": "standard", "distance": 3.118, "atom1_id": "///A/1097/O", "atom2_id": "///A/1101/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1065, "atom1_serNum": 8243, "atom2_serNum": 8280, "donAcc_type": "standard", "distance": 3.230, "atom1_id": "///A/1098/O", "atom2_id": "///A/1102/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1066, "atom1_serNum": 8254, "atom2_serNum": 8289, "donAcc_type": "standard", "distance": 3.178, "atom1_id": "///A/1099/O", "atom2_id": "///A/1103/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1067, "atom1_serNum": 8263, "atom2_serNum": 8294, "donAcc_type": "standard", "distance": 3.205, "atom1_id": "///A/1100/O", "atom2_id": "///A/1104/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1068, "atom1_serNum": 8297, "atom2_serNum": 8331, "donAcc_type": "standard", "distance": 3.063, "atom1_id": "///A/1104/O", "atom2_id": "///A/1108/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1069, "atom1_serNum": 8305, "atom2_serNum": 8309, "donAcc_type": "standard", "distance": 3.056, "atom1_id": "///A/1105/O", "atom2_id": "///A/1105/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1070, "atom1_serNum": 8309, "atom2_serNum": 8334, "donAcc_type": "standard", "distance": 3.017, "atom1_id": "///A/1105/NE", "atom2_id": "///A/1108/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1071, "atom1_serNum": 8311, "atom2_serNum": 8523, "donAcc_type": "standard", "distance": 3.094, "atom1_id": "///A/1105/NH1", "atom2_id": "///A/1130/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1072, "atom1_serNum": 8311, "atom2_serNum": 8524, "donAcc_type": "standard", "distance": 2.995, "atom1_id": "///A/1105/NH1", "atom2_id": "///A/1130/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1073, "atom1_serNum": 8354, "atom2_serNum": 8384, "donAcc_type": "standard", "distance": 3.689, "atom1_id": "///A/1110/O", "atom2_id": "///A/1114/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1074, "atom1_serNum": 8363, "atom2_serNum": 8391, "donAcc_type": "standard", "distance": 3.436, "atom1_id": "///A/1111/O", "atom2_id": "///A/1115/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1075, "atom1_serNum": 8371, "atom2_serNum": 8399, "donAcc_type": "standard", "distance": 3.244, "atom1_id": "///A/1112/O", "atom2_id": "///A/1116/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1076, "atom1_serNum": 8377, "atom2_serNum": 8524, "donAcc_type": "standard", "distance": 2.886, "atom1_id": "///A/1112/NH1", "atom2_id": "///A/1130/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1077, "atom1_serNum": 8378, "atom2_serNum": 8496, "donAcc_type": "standard", "distance": 2.665, "atom1_id": "///A/1112/NH2", "atom2_id": "///A/1127/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1078, "atom1_serNum": 8387, "atom2_serNum": 8408, "donAcc_type": "standard", "distance": 3.147, "atom1_id": "///A/1114/O", "atom2_id": "///A/1117/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1079, "atom1_serNum": 8394, "atom2_serNum": 8417, "donAcc_type": "standard", "distance": 3.135, "atom1_id": "///A/1115/O", "atom2_id": "///A/1118/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1080, "atom1_serNum": 8406, "atom2_serNum": 8466, "donAcc_type": "standard", "distance": 3.551, "atom1_id": "///A/1116/OE1", "atom2_id": "///A/1123/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1081, "atom1_serNum": 8444, "atom2_serNum": 8458, "donAcc_type": "standard", "distance": 3.208, "atom1_id": "///A/1121/O", "atom2_id": "///A/1123/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1082, "atom1_serNum": 8452, "atom2_serNum": 8480, "donAcc_type": "acceptable", "distance": 2.511, "atom1_id": "///A/1122/O", "atom2_id": "///A/1125/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1083, "atom1_serNum": 8452, "atom2_serNum": 8481, "donAcc_type": "standard", "distance": 3.044, "atom1_id": "///A/1122/O", "atom2_id": "///A/1126/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1084, "atom1_serNum": 8461, "atom2_serNum": 8489, "donAcc_type": "standard", "distance": 2.862, "atom1_id": "///A/1123/O", "atom2_id": "///A/1127/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1085, "atom1_serNum": 8470, "atom2_serNum": 8497, "donAcc_type": "standard", "distance": 3.304, "atom1_id": "///A/1124/O", "atom2_id": "///A/1128/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1086, "atom1_serNum": 8478, "atom2_serNum": 8506, "donAcc_type": "standard", "distance": 3.476, "atom1_id": "///A/1125/O", "atom2_id": "///A/1129/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1087, "atom1_serNum": 8484, "atom2_serNum": 8517, "donAcc_type": "standard", "distance": 2.811, "atom1_id": "///A/1126/O", "atom2_id": "///A/1130/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1088, "atom1_serNum": 8492, "atom2_serNum": 8525, "donAcc_type": "standard", "distance": 3.130, "atom1_id": "///A/1127/O", "atom2_id": "///A/1131/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1089, "atom1_serNum": 8528, "atom2_serNum": 8563, "donAcc_type": "standard", "distance": 2.661, "atom1_id": "///A/1131/O", "atom2_id": "///A/1135/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1090, "atom1_serNum": 8580, "atom2_serNum": 8597, "donAcc_type": "standard", "distance": 3.015, "atom1_id": "///B/1306/O", "atom2_id": "///B/1310/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1091, "atom1_serNum": 8585, "atom2_serNum": 8602, "donAcc_type": "standard", "distance": 2.998, "atom1_id": "///B/1307/O", "atom2_id": "///B/1311/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1092, "atom1_serNum": 8590, "atom2_serNum": 8607, "donAcc_type": "standard", "distance": 3.331, "atom1_id": "///B/1308/O", "atom2_id": "///B/1312/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1093, "atom1_serNum": 8595, "atom2_serNum": 8612, "donAcc_type": "standard", "distance": 2.988, "atom1_id": "///B/1309/O", "atom2_id": "///B/1313/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1094, "atom1_serNum": 8600, "atom2_serNum": 8617, "donAcc_type": "standard", "distance": 3.288, "atom1_id": "///B/1310/O", "atom2_id": "///B/1314/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1095, "atom1_serNum": 8605, "atom2_serNum": 8622, "donAcc_type": "standard", "distance": 3.199, "atom1_id": "///B/1311/O", "atom2_id": "///B/1315/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1096, "atom1_serNum": 8610, "atom2_serNum": 8627, "donAcc_type": "standard", "distance": 2.764, "atom1_id": "///B/1312/O", "atom2_id": "///B/1316/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1097, "atom1_serNum": 8653, "atom2_serNum": 9041, "donAcc_type": "questionable", "distance": 3.065, "atom1_id": "///C/8/OE1", "atom2_id": "///C/58/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1098, "atom1_serNum": 8671, "atom2_serNum": 9056, "donAcc_type": "standard", "distance": 3.006, "atom1_id": "///C/11/N", "atom2_id": "///C/60/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1099, "atom1_serNum": 8674, "atom2_serNum": 9073, "donAcc_type": "standard", "distance": 2.760, "atom1_id": "///C/11/O", "atom2_id": "///C/62/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1100, "atom1_serNum": 8682, "atom2_serNum": 9256, "donAcc_type": "standard", "distance": 2.673, "atom1_id": "///C/12/N", "atom2_id": "///C/84/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1101, "atom1_serNum": 8685, "atom2_serNum": 9249, "donAcc_type": "standard", "distance": 3.102, "atom1_id": "///C/12/O", "atom2_id": "///C/84/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1102, "atom1_serNum": 8685, "atom2_serNum": 9258, "donAcc_type": "standard", "distance": 3.302, "atom1_id": "///C/12/O", "atom2_id": "///C/85/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1103, "atom1_serNum": 8690, "atom2_serNum": 9206, "donAcc_type": "standard", "distance": 2.984, "atom1_id": "///C/12/NZ", "atom2_id": "///C/79/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1104, "atom1_serNum": 8691, "atom2_serNum": 9076, "donAcc_type": "standard", "distance": 2.629, "atom1_id": "///C/13/N", "atom2_id": "///C/62/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1105, "atom1_serNum": 8694, "atom2_serNum": 9088, "donAcc_type": "standard", "distance": 2.643, "atom1_id": "///C/13/O", "atom2_id": "///C/64/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1106, "atom1_serNum": 8699, "atom2_serNum": 9261, "donAcc_type": "standard", "distance": 2.917, "atom1_id": "///C/14/N", "atom2_id": "///C/85/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1107, "atom1_serNum": 8702, "atom2_serNum": 9269, "donAcc_type": "standard", "distance": 2.733, "atom1_id": "///C/14/O", "atom2_id": "///C/87/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1108, "atom1_serNum": 8706, "atom2_serNum": 9091, "donAcc_type": "standard", "distance": 3.073, "atom1_id": "///C/15/N", "atom2_id": "///C/64/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1109, "atom1_serNum": 8709, "atom2_serNum": 9110, "donAcc_type": "standard", "distance": 3.320, "atom1_id": "///C/15/O", "atom2_id": "///C/66/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1110, "atom1_serNum": 8709, "atom2_serNum": 9115, "donAcc_type": "acceptable", "distance": 2.634, "atom1_id": "///C/15/O", "atom2_id": "///C/66/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1111, "atom1_serNum": 8714, "atom2_serNum": 9272, "donAcc_type": "standard", "distance": 3.049, "atom1_id": "///C/16/N", "atom2_id": "///C/87/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1112, "atom1_serNum": 8717, "atom2_serNum": 9285, "donAcc_type": "standard", "distance": 2.854, "atom1_id": "///C/16/O", "atom2_id": "///C/89/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1113, "atom1_serNum": 8728, "atom2_serNum": 8737, "donAcc_type": "standard", "distance": 3.300, "atom1_id": "///C/18/O", "atom2_id": "///C/20/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1114, "atom1_serNum": 8728, "atom2_serNum": 8746, "donAcc_type": "acceptable", "distance": 2.802, "atom1_id": "///C/18/O", "atom2_id": "///C/21/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1115, "atom1_serNum": 8731, "atom2_serNum": 9416, "donAcc_type": "standard", "distance": 2.794, "atom1_id": "///C/18/OD1", "atom2_id": "///C/104/NE1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1116, "atom1_serNum": 8732, "atom2_serNum": 9385, "donAcc_type": "standard", "distance": 2.537, "atom1_id": "///C/18/OD2", "atom2_id": "///C/100/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1117, "atom1_serNum": 8737, "atom2_serNum": 22001, "donAcc_type": "standard", "distance": 2.950, "atom1_id": "///C/20/N", "atom2_id": "///C/1177/O3B", "atom_pair": "N:O", "residue_pair": "aa:ligand" }, { "index": 1118, "atom1_serNum": 8740, "atom2_serNum": 9571, "donAcc_type": "standard", "distance": 2.903, "atom1_id": "///C/20/O", "atom2_id": "///C/123/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1119, "atom1_serNum": 8744, "atom2_serNum": 9562, "donAcc_type": "standard", "distance": 3.070, "atom1_id": "///C/21/O", "atom2_id": "///C/122/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1120, "atom1_serNum": 8748, "atom2_serNum": 22005, "donAcc_type": "standard", "distance": 3.277, "atom1_id": "///C/22/N", "atom2_id": "///C/1177/O3A", "atom_pair": "N:O", "residue_pair": "aa:ligand" }, { "index": 1121, "atom1_serNum": 8752, "atom2_serNum": 22003, "donAcc_type": "acceptable", "distance": 2.671, "atom1_id": "///C/23/N", "atom2_id": "///C/1177/O1B", "atom_pair": "N:O", "residue_pair": "aa:ligand" }, { "index": 1122, "atom1_serNum": 8755, "atom2_serNum": 8786, "donAcc_type": "standard", "distance": 3.354, "atom1_id": "///C/23/O", "atom2_id": "///C/27/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1123, "atom1_serNum": 8760, "atom2_serNum": 21999, "donAcc_type": "acceptable", "distance": 2.437, "atom1_id": "///C/23/NZ", "atom2_id": "///C/1177/O2G", "atom_pair": "N:O", "residue_pair": "aa:ligand" }, { "index": 1124, "atom1_serNum": 8760, "atom2_serNum": 22003, "donAcc_type": "acceptable", "distance": 2.995, "atom1_id": "///C/23/NZ", "atom2_id": "///C/1177/O1B", "atom_pair": "N:O", "residue_pair": "aa:ligand" }, { "index": 1125, "atom1_serNum": 8761, "atom2_serNum": 22004, "donAcc_type": "standard", "distance": 3.227, "atom1_id": "///C/24/N", "atom2_id": "///C/1177/O2B", "atom_pair": "N:O", "residue_pair": "aa:ligand" }, { "index": 1126, "atom1_serNum": 8761, "atom2_serNum": 22007, "donAcc_type": "acceptable", "distance": 3.026, "atom1_id": "///C/24/N", "atom2_id": "///C/1177/O1A", "atom_pair": "N:O", "residue_pair": "aa:ligand" }, { "index": 1127, "atom1_serNum": 8764, "atom2_serNum": 8793, "donAcc_type": "standard", "distance": 2.985, "atom1_id": "///C/24/O", "atom2_id": "///C/28/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1128, "atom1_serNum": 8766, "atom2_serNum": 8918, "donAcc_type": "acceptable", "distance": 2.547, "atom1_id": "///C/24/OG1", "atom2_id": "///C/42/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1129, "atom1_serNum": 8766, "atom2_serNum": 9109, "donAcc_type": "acceptable", "distance": 2.939, "atom1_id": "///C/24/OG1", "atom2_id": "///C/65/OD2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1130, "atom1_serNum": 8768, "atom2_serNum": 22007, "donAcc_type": "acceptable", "distance": 3.102, "atom1_id": "///C/25/N", "atom2_id": "///C/1177/O1A", "atom_pair": "N:O", "residue_pair": "aa:ligand" }, { "index": 1131, "atom1_serNum": 8771, "atom2_serNum": 8802, "donAcc_type": "standard", "distance": 3.124, "atom1_id": "///C/25/O", "atom2_id": "///C/29/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1132, "atom1_serNum": 8778, "atom2_serNum": 8819, "donAcc_type": "acceptable", "distance": 3.348, "atom1_id": "///C/26/O", "atom2_id": "///C/30/ND1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1133, "atom1_serNum": 8789, "atom2_serNum": 8823, "donAcc_type": "standard", "distance": 2.879, "atom1_id": "///C/27/O", "atom2_id": "///C/31/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1134, "atom1_serNum": 8796, "atom2_serNum": 8831, "donAcc_type": "standard", "distance": 2.980, "atom1_id": "///C/28/O", "atom2_id": "///C/32/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1135, "atom1_serNum": 8796, "atom2_serNum": 8836, "donAcc_type": "acceptable", "distance": 2.722, "atom1_id": "///C/28/O", "atom2_id": "///C/32/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1136, "atom1_serNum": 8796, "atom2_serNum": 8838, "donAcc_type": "standard", "distance": 3.526, "atom1_id": "///C/28/O", "atom2_id": "///C/33/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1137, "atom1_serNum": 8805, "atom2_serNum": 8838, "donAcc_type": "standard", "distance": 2.474, "atom1_id": "///C/29/O", "atom2_id": "///C/33/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1138, "atom1_serNum": 8809, "atom2_serNum": 9830, "donAcc_type": "standard", "distance": 2.696, "atom1_id": "///C/29/NE", "atom2_id": "///C/154/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1139, "atom1_serNum": 8836, "atom2_serNum": 8842, "donAcc_type": "acceptable", "distance": 3.312, "atom1_id": "///C/32/OG1", "atom2_id": "///C/34/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1140, "atom1_serNum": 8865, "atom2_serNum": 22016, "donAcc_type": "acceptable", "distance": 3.427, "atom1_id": "///C/36/O", "atom2_id": "///C/1177/O2'", "atom_pair": "O:O", "residue_pair": "aa:ligand" }, { "index": 1141, "atom1_serNum": 8869, "atom2_serNum": 8880, "donAcc_type": "standard", "distance": 3.056, "atom1_id": "///C/36/OE1", "atom2_id": "///C/38/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1142, "atom1_serNum": 8874, "atom2_serNum": 22016, "donAcc_type": "acceptable", "distance": 2.495, "atom1_id": "///C/37/O", "atom2_id": "///C/1177/O2'", "atom_pair": "O:O", "residue_pair": "aa:ligand" }, { "index": 1143, "atom1_serNum": 8883, "atom2_serNum": 8901, "donAcc_type": "standard", "distance": 3.175, "atom1_id": "///C/38/O", "atom2_id": "///C/40/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1144, "atom1_serNum": 8900, "atom2_serNum": 22000, "donAcc_type": "acceptable", "distance": 2.721, "atom1_id": "///C/39/OH", "atom2_id": "///C/1177/O3G", "atom_pair": "O:O", "residue_pair": "aa:ligand" }, { "index": 1145, "atom1_serNum": 8913, "atom2_serNum": 22000, "donAcc_type": "acceptable", "distance": 3.814, "atom1_id": "///C/42/N", "atom2_id": "///C/1177/O3G", "atom_pair": "N:O", "residue_pair": "aa:ligand" }, { "index": 1146, "atom1_serNum": 8923, "atom2_serNum": 8932, "donAcc_type": "standard", "distance": 3.174, "atom1_id": "///C/43/O", "atom2_id": "///C/45/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1147, "atom1_serNum": 8928, "atom2_serNum": 9156, "donAcc_type": "standard", "distance": 2.703, "atom1_id": "///C/44/N", "atom2_id": "///C/72/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1148, "atom1_serNum": 8931, "atom2_serNum": 9117, "donAcc_type": "standard", "distance": 2.994, "atom1_id": "///C/44/O", "atom2_id": "///C/67/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1149, "atom1_serNum": 8939, "atom2_serNum": 9105, "donAcc_type": "standard", "distance": 3.140, "atom1_id": "///C/46/N", "atom2_id": "///C/65/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1150, "atom1_serNum": 8942, "atom2_serNum": 9102, "donAcc_type": "standard", "distance": 3.331, "atom1_id": "///C/46/O", "atom2_id": "///C/65/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1151, "atom1_serNum": 8955, "atom2_serNum": 9084, "donAcc_type": "standard", "distance": 2.718, "atom1_id": "///C/48/N", "atom2_id": "///C/63/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1152, "atom1_serNum": 8958, "atom2_serNum": 9065, "donAcc_type": "questionable", "distance": 2.840, "atom1_id": "///C/48/O", "atom2_id": "///C/61/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1153, "atom1_serNum": 8958, "atom2_serNum": 9081, "donAcc_type": "standard", "distance": 2.818, "atom1_id": "///C/48/O", "atom2_id": "///C/63/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1154, "atom1_serNum": 8972, "atom2_serNum": 9065, "donAcc_type": "standard", "distance": 2.775, "atom1_id": "///C/50/N", "atom2_id": "///C/61/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1155, "atom1_serNum": 8975, "atom2_serNum": 9062, "donAcc_type": "standard", "distance": 2.646, "atom1_id": "///C/50/O", "atom2_id": "///C/61/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1156, "atom1_serNum": 8987, "atom2_serNum": 9048, "donAcc_type": "standard", "distance": 2.697, "atom1_id": "///C/52/N", "atom2_id": "///C/59/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1157, "atom1_serNum": 8990, "atom2_serNum": 9008, "donAcc_type": "standard", "distance": 2.920, "atom1_id": "///C/52/O", "atom2_id": "///C/54/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1158, "atom1_serNum": 8990, "atom2_serNum": 9045, "donAcc_type": "standard", "distance": 3.144, "atom1_id": "///C/52/O", "atom2_id": "///C/59/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1159, "atom1_serNum": 9001, "atom2_serNum": 10017, "donAcc_type": "questionable", "distance": 3.265, "atom1_id": "///C/53/O", "atom2_id": "///C/176/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1160, "atom1_serNum": 9008, "atom2_serNum": 9037, "donAcc_type": "standard", "distance": 2.734, "atom1_id": "///C/54/N", "atom2_id": "///C/57/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1161, "atom1_serNum": 9011, "atom2_serNum": 9034, "donAcc_type": "standard", "distance": 3.216, "atom1_id": "///C/54/O", "atom2_id": "///C/57/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1162, "atom1_serNum": 9013, "atom2_serNum": 9023, "donAcc_type": "acceptable", "distance": 2.676, "atom1_id": "///C/54/OG1", "atom2_id": "///C/56/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1163, "atom1_serNum": 9013, "atom2_serNum": 9037, "donAcc_type": "acceptable", "distance": 2.928, "atom1_id": "///C/54/OG1", "atom2_id": "///C/57/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1164, "atom1_serNum": 9015, "atom2_serNum": 9021, "donAcc_type": "standard", "distance": 2.814, "atom1_id": "///C/55/N", "atom2_id": "///C/55/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1165, "atom1_serNum": 9015, "atom2_serNum": 10008, "donAcc_type": "standard", "distance": 3.275, "atom1_id": "///C/55/N", "atom2_id": "///C/175/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1166, "atom1_serNum": 9021, "atom2_serNum": 10005, "donAcc_type": "standard", "distance": 2.630, "atom1_id": "///C/55/OD1", "atom2_id": "///C/175/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1167, "atom1_serNum": 9032, "atom2_serNum": 9981, "donAcc_type": "standard", "distance": 2.992, "atom1_id": "///C/56/NH1", "atom2_id": "///C/171/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1168, "atom1_serNum": 9091, "atom2_serNum": 9110, "donAcc_type": "standard", "distance": 2.979, "atom1_id": "///C/64/O", "atom2_id": "///C/66/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1169, "atom1_serNum": 9113, "atom2_serNum": 9115, "donAcc_type": "acceptable", "distance": 2.849, "atom1_id": "///C/66/O", "atom2_id": "///C/66/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1170, "atom1_serNum": 9122, "atom2_serNum": 21999, "donAcc_type": "acceptable", "distance": 3.322, "atom1_id": "///C/68/N", "atom2_id": "///C/1177/O2G", "atom_pair": "N:O", "residue_pair": "aa:ligand" }, { "index": 1171, "atom1_serNum": 9129, "atom2_serNum": 9153, "donAcc_type": "standard", "distance": 3.106, "atom1_id": "///C/69/O", "atom2_id": "///C/72/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1172, "atom1_serNum": 9129, "atom2_serNum": 9164, "donAcc_type": "standard", "distance": 3.505, "atom1_id": "///C/69/O", "atom2_id": "///C/73/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1173, "atom1_serNum": 9175, "atom2_serNum": 9191, "donAcc_type": "standard", "distance": 2.816, "atom1_id": "///C/75/O", "atom2_id": "///C/77/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1174, "atom1_serNum": 9175, "atom2_serNum": 9199, "donAcc_type": "standard", "distance": 2.998, "atom1_id": "///C/75/O", "atom2_id": "///C/78/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1175, "atom1_serNum": 9183, "atom2_serNum": 9203, "donAcc_type": "standard", "distance": 2.922, "atom1_id": "///C/76/O", "atom2_id": "///C/79/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1176, "atom1_serNum": 9194, "atom2_serNum": 9215, "donAcc_type": "standard", "distance": 3.129, "atom1_id": "///C/77/O", "atom2_id": "///C/80/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1177, "atom1_serNum": 9202, "atom2_serNum": 9227, "donAcc_type": "standard", "distance": 3.249, "atom1_id": "///C/78/O", "atom2_id": "///C/81/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1178, "atom1_serNum": 9218, "atom2_serNum": 9244, "donAcc_type": "standard", "distance": 3.180, "atom1_id": "///C/80/O", "atom2_id": "///C/83/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1179, "atom1_serNum": 9264, "atom2_serNum": 9518, "donAcc_type": "standard", "distance": 3.140, "atom1_id": "///C/86/N", "atom2_id": "///C/116/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1180, "atom1_serNum": 9267, "atom2_serNum": 9530, "donAcc_type": "standard", "distance": 2.897, "atom1_id": "///C/86/O", "atom2_id": "///C/118/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1181, "atom1_serNum": 9277, "atom2_serNum": 9533, "donAcc_type": "standard", "distance": 2.938, "atom1_id": "///C/88/N", "atom2_id": "///C/118/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1182, "atom1_serNum": 9280, "atom2_serNum": 9545, "donAcc_type": "standard", "distance": 3.017, "atom1_id": "///C/88/O", "atom2_id": "///C/120/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1183, "atom1_serNum": 9293, "atom2_serNum": 9548, "donAcc_type": "standard", "distance": 2.904, "atom1_id": "///C/90/N", "atom2_id": "///C/120/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1184, "atom1_serNum": 9296, "atom2_serNum": 9555, "donAcc_type": "standard", "distance": 2.766, "atom1_id": "///C/90/O", "atom2_id": "///C/122/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1185, "atom1_serNum": 9304, "atom2_serNum": 9355, "donAcc_type": "acceptable", "distance": 3.139, "atom1_id": "///C/91/N", "atom2_id": "///C/97/OG1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1186, "atom1_serNum": 9307, "atom2_serNum": 9329, "donAcc_type": "questionable", "distance": 2.880, "atom1_id": "///C/91/O", "atom2_id": "///C/94/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1187, "atom1_serNum": 9307, "atom2_serNum": 9355, "donAcc_type": "acceptable", "distance": 2.740, "atom1_id": "///C/91/O", "atom2_id": "///C/97/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1188, "atom1_serNum": 9310, "atom2_serNum": 9312, "donAcc_type": "standard", "distance": 2.788, "atom1_id": "///C/91/OD1", "atom2_id": "///C/92/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1189, "atom1_serNum": 9310, "atom2_serNum": 9319, "donAcc_type": "standard", "distance": 2.978, "atom1_id": "///C/91/OD1", "atom2_id": "///C/93/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1190, "atom1_serNum": 9310, "atom2_serNum": 9324, "donAcc_type": "acceptable", "distance": 3.195, "atom1_id": "///C/91/OD1", "atom2_id": "///C/93/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1191, "atom1_serNum": 9312, "atom2_serNum": 9558, "donAcc_type": "standard", "distance": 3.314, "atom1_id": "///C/92/N", "atom2_id": "///C/122/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1192, "atom1_serNum": 9315, "atom2_serNum": 9623, "donAcc_type": "standard", "distance": 2.993, "atom1_id": "///C/92/O", "atom2_id": "///C/130/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1193, "atom1_serNum": 9315, "atom2_serNum": 9632, "donAcc_type": "standard", "distance": 2.974, "atom1_id": "///C/92/O", "atom2_id": "///C/131/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1194, "atom1_serNum": 9322, "atom2_serNum": 9631, "donAcc_type": "standard", "distance": 3.693, "atom1_id": "///C/93/O", "atom2_id": "///C/130/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1195, "atom1_serNum": 9329, "atom2_serNum": 9355, "donAcc_type": "acceptable", "distance": 2.616, "atom1_id": "///C/94/O", "atom2_id": "///C/97/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1196, "atom1_serNum": 9335, "atom2_serNum": 9357, "donAcc_type": "standard", "distance": 3.165, "atom1_id": "///C/95/O", "atom2_id": "///C/98/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1197, "atom1_serNum": 9335, "atom2_serNum": 9369, "donAcc_type": "standard", "distance": 3.348, "atom1_id": "///C/95/O", "atom2_id": "///C/99/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1198, "atom1_serNum": 9346, "atom2_serNum": 9378, "donAcc_type": "standard", "distance": 3.112, "atom1_id": "///C/96/O", "atom2_id": "///C/100/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1199, "atom1_serNum": 9368, "atom2_serNum": 9676, "donAcc_type": "acceptable", "distance": 2.750, "atom1_id": "///C/98/OH", "atom2_id": "///C/137/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1200, "atom1_serNum": 9368, "atom2_serNum": 9683, "donAcc_type": "acceptable", "distance": 2.927, "atom1_id": "///C/98/OH", "atom2_id": "///C/138/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1201, "atom1_serNum": 9381, "atom2_serNum": 9408, "donAcc_type": "standard", "distance": 3.233, "atom1_id": "///C/100/O", "atom2_id": "///C/104/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1202, "atom1_serNum": 9389, "atom2_serNum": 9422, "donAcc_type": "standard", "distance": 2.774, "atom1_id": "///C/101/O", "atom2_id": "///C/105/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1203, "atom1_serNum": 9396, "atom2_serNum": 9432, "donAcc_type": "standard", "distance": 2.953, "atom1_id": "///C/102/O", "atom2_id": "///C/106/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1204, "atom1_serNum": 9403, "atom2_serNum": 9443, "donAcc_type": "standard", "distance": 3.193, "atom1_id": "///C/103/O", "atom2_id": "///C/107/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1205, "atom1_serNum": 9411, "atom2_serNum": 9451, "donAcc_type": "standard", "distance": 3.383, "atom1_id": "///C/104/O", "atom2_id": "///C/108/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1206, "atom1_serNum": 9425, "atom2_serNum": 9459, "donAcc_type": "standard", "distance": 3.121, "atom1_id": "///C/105/O", "atom2_id": "///C/109/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1207, "atom1_serNum": 9435, "atom2_serNum": 9466, "donAcc_type": "standard", "distance": 3.265, "atom1_id": "///C/106/O", "atom2_id": "///C/110/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1208, "atom1_serNum": 9439, "atom2_serNum": 9449, "donAcc_type": "standard", "distance": 3.454, "atom1_id": "///C/106/NE", "atom2_id": "///C/107/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1209, "atom1_serNum": 9446, "atom2_serNum": 9477, "donAcc_type": "standard", "distance": 3.537, "atom1_id": "///C/107/O", "atom2_id": "///C/111/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1210, "atom1_serNum": 9454, "atom2_serNum": 9484, "donAcc_type": "standard", "distance": 2.928, "atom1_id": "///C/108/O", "atom2_id": "///C/112/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1211, "atom1_serNum": 9525, "atom2_serNum": 9749, "donAcc_type": "standard", "distance": 3.685, "atom1_id": "///C/117/O", "atom2_id": "///C/145/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1212, "atom1_serNum": 9537, "atom2_serNum": 9752, "donAcc_type": "standard", "distance": 2.825, "atom1_id": "///C/119/N", "atom2_id": "///C/145/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1213, "atom1_serNum": 9540, "atom2_serNum": 9770, "donAcc_type": "standard", "distance": 3.270, "atom1_id": "///C/119/O", "atom2_id": "///C/147/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1214, "atom1_serNum": 9551, "atom2_serNum": 9773, "donAcc_type": "standard", "distance": 3.543, "atom1_id": "///C/121/N", "atom2_id": "///C/147/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1215, "atom1_serNum": 9554, "atom2_serNum": 9790, "donAcc_type": "standard", "distance": 2.790, "atom1_id": "///C/121/O", "atom2_id": "///C/149/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1216, "atom1_serNum": 9561, "atom2_serNum": 9804, "donAcc_type": "standard", "distance": 3.301, "atom1_id": "///C/122/OD1", "atom2_id": "///C/151/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1217, "atom1_serNum": 9562, "atom2_serNum": 22020, "donAcc_type": "standard", "distance": 3.124, "atom1_id": "///C/122/ND2", "atom2_id": "///C/1177/N7", "atom_pair": "N:N", "residue_pair": "aa:ligand" }, { "index": 1218, "atom1_serNum": 9563, "atom2_serNum": 9793, "donAcc_type": "standard", "distance": 2.974, "atom1_id": "///C/123/N", "atom2_id": "///C/149/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1219, "atom1_serNum": 9566, "atom2_serNum": 9587, "donAcc_type": "standard", "distance": 3.505, "atom1_id": "///C/123/O", "atom2_id": "///C/126/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1220, "atom1_serNum": 9571, "atom2_serNum": 22012, "donAcc_type": "standard", "distance": 3.033, "atom1_id": "///C/123/NZ", "atom2_id": "///C/1177/O4'", "atom_pair": "N:O", "residue_pair": "aa:ligand" }, { "index": 1221, "atom1_serNum": 9572, "atom2_serNum": 9793, "donAcc_type": "standard", "distance": 3.364, "atom1_id": "///C/124/N", "atom2_id": "///C/149/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1222, "atom1_serNum": 9579, "atom2_serNum": 9586, "donAcc_type": "standard", "distance": 2.651, "atom1_id": "///C/125/N", "atom2_id": "///C/125/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1223, "atom1_serNum": 9585, "atom2_serNum": 22026, "donAcc_type": "standard", "distance": 3.381, "atom1_id": "///C/125/OD1", "atom2_id": "///C/1177/N2", "atom_pair": "O:N", "residue_pair": "aa:ligand" }, { "index": 1224, "atom1_serNum": 9586, "atom2_serNum": 22024, "donAcc_type": "standard", "distance": 3.031, "atom1_id": "///C/125/OD2", "atom2_id": "///C/1177/N1", "atom_pair": "O:N", "residue_pair": "aa:ligand" }, { "index": 1225, "atom1_serNum": 9604, "atom2_serNum": 9610, "donAcc_type": "standard", "distance": 2.827, "atom1_id": "///C/128/N", "atom2_id": "///C/128/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1226, "atom1_serNum": 9607, "atom2_serNum": 9623, "donAcc_type": "standard", "distance": 3.381, "atom1_id": "///C/128/O", "atom2_id": "///C/130/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1227, "atom1_serNum": 9619, "atom2_serNum": 9635, "donAcc_type": "standard", "distance": 3.208, "atom1_id": "///C/129/NE", "atom2_id": "///C/131/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1228, "atom1_serNum": 9622, "atom2_serNum": 9635, "donAcc_type": "standard", "distance": 3.298, "atom1_id": "///C/129/NH2", "atom2_id": "///C/131/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1229, "atom1_serNum": 9642, "atom2_serNum": 9662, "donAcc_type": "standard", "distance": 2.964, "atom1_id": "///C/132/O", "atom2_id": "///C/135/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1230, "atom1_serNum": 9642, "atom2_serNum": 9667, "donAcc_type": "acceptable", "distance": 2.642, "atom1_id": "///C/132/O", "atom2_id": "///C/135/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1231, "atom1_serNum": 9647, "atom2_serNum": 10682, "donAcc_type": "standard", "distance": 3.249, "atom1_id": "///C/132/NZ", "atom2_id": "///E/49/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 1232, "atom1_serNum": 9647, "atom2_serNum": 10703, "donAcc_type": "standard", "distance": 3.517, "atom1_id": "///C/132/NZ", "atom2_id": "///E/50/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 1233, "atom1_serNum": 9665, "atom2_serNum": 9676, "donAcc_type": "standard", "distance": 3.175, "atom1_id": "///C/135/O", "atom2_id": "///C/137/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1234, "atom1_serNum": 9679, "atom2_serNum": 9704, "donAcc_type": "standard", "distance": 2.996, "atom1_id": "///C/137/O", "atom2_id": "///C/140/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1235, "atom1_serNum": 9679, "atom2_serNum": 9715, "donAcc_type": "standard", "distance": 3.341, "atom1_id": "///C/137/O", "atom2_id": "///C/141/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1236, "atom1_serNum": 9686, "atom2_serNum": 9715, "donAcc_type": "standard", "distance": 2.923, "atom1_id": "///C/138/O", "atom2_id": "///C/141/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1237, "atom1_serNum": 9686, "atom2_serNum": 9724, "donAcc_type": "standard", "distance": 3.031, "atom1_id": "///C/138/O", "atom2_id": "///C/142/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1238, "atom1_serNum": 9694, "atom2_serNum": 9700, "donAcc_type": "acceptable", "distance": 3.036, "atom1_id": "///C/139/N", "atom2_id": "///C/139/ND1", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 1239, "atom1_serNum": 9697, "atom2_serNum": 9741, "donAcc_type": "standard", "distance": 2.804, "atom1_id": "///C/139/O", "atom2_id": "///C/144/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1240, "atom1_serNum": 9757, "atom2_serNum": 9761, "donAcc_type": "standard", "distance": 3.528, "atom1_id": "///C/145/NE2", "atom2_id": "///C/146/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1241, "atom1_serNum": 9785, "atom2_serNum": 9850, "donAcc_type": "questionable", "distance": 3.089, "atom1_id": "///C/148/O", "atom2_id": "///C/156/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1242, "atom1_serNum": 9798, "atom2_serNum": 9835, "donAcc_type": "standard", "distance": 3.385, "atom1_id": "///C/150/N", "atom2_id": "///C/155/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1243, "atom1_serNum": 9801, "atom2_serNum": 9824, "donAcc_type": "standard", "distance": 2.630, "atom1_id": "///C/150/O", "atom2_id": "///C/154/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1244, "atom1_serNum": 9803, "atom2_serNum": 9809, "donAcc_type": "acceptable", "distance": 3.237, "atom1_id": "///C/150/OG", "atom2_id": "///C/152/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1245, "atom1_serNum": 9803, "atom2_serNum": 9818, "donAcc_type": "acceptable", "distance": 2.889, "atom1_id": "///C/150/OG", "atom2_id": "///C/153/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1246, "atom1_serNum": 9803, "atom2_serNum": 22023, "donAcc_type": "acceptable", "distance": 3.208, "atom1_id": "///C/150/OG", "atom2_id": "///C/1177/O6", "atom_pair": "O:O", "residue_pair": "aa:ligand" }, { "index": 1247, "atom1_serNum": 9804, "atom2_serNum": 22023, "donAcc_type": "standard", "distance": 2.858, "atom1_id": "///C/151/N", "atom2_id": "///C/1177/O6", "atom_pair": "N:O", "residue_pair": "aa:ligand" }, { "index": 1248, "atom1_serNum": 9821, "atom2_serNum": 9823, "donAcc_type": "acceptable", "distance": 2.896, "atom1_id": "///C/153/O", "atom2_id": "///C/153/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1249, "atom1_serNum": 9824, "atom2_serNum": 9830, "donAcc_type": "standard", "distance": 2.819, "atom1_id": "///C/154/N", "atom2_id": "///C/154/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1250, "atom1_serNum": 9827, "atom2_serNum": 9844, "donAcc_type": "standard", "distance": 3.246, "atom1_id": "///C/154/O", "atom2_id": "///C/156/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1251, "atom1_serNum": 9827, "atom2_serNum": 9852, "donAcc_type": "standard", "distance": 3.122, "atom1_id": "///C/154/O", "atom2_id": "///C/157/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1252, "atom1_serNum": 9847, "atom2_serNum": 9872, "donAcc_type": "standard", "distance": 2.903, "atom1_id": "///C/156/O", "atom2_id": "///C/159/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1253, "atom1_serNum": 9866, "atom2_serNum": 9899, "donAcc_type": "standard", "distance": 2.943, "atom1_id": "///C/158/O", "atom2_id": "///C/162/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1254, "atom1_serNum": 9875, "atom2_serNum": 9907, "donAcc_type": "standard", "distance": 3.081, "atom1_id": "///C/159/O", "atom2_id": "///C/163/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1255, "atom1_serNum": 9884, "atom2_serNum": 9921, "donAcc_type": "standard", "distance": 3.079, "atom1_id": "///C/160/O", "atom2_id": "///C/164/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1256, "atom1_serNum": 9891, "atom2_serNum": 9929, "donAcc_type": "standard", "distance": 2.891, "atom1_id": "///C/161/O", "atom2_id": "///C/165/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1257, "atom1_serNum": 9902, "atom2_serNum": 9934, "donAcc_type": "standard", "distance": 2.755, "atom1_id": "///C/162/O", "atom2_id": "///C/166/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1258, "atom1_serNum": 9910, "atom2_serNum": 9945, "donAcc_type": "standard", "distance": 2.988, "atom1_id": "///C/163/O", "atom2_id": "///C/167/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1259, "atom1_serNum": 9924, "atom2_serNum": 9945, "donAcc_type": "standard", "distance": 2.611, "atom1_id": "///C/164/O", "atom2_id": "///C/167/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1260, "atom1_serNum": 9924, "atom2_serNum": 9954, "donAcc_type": "standard", "distance": 2.806, "atom1_id": "///C/164/O", "atom2_id": "///C/168/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1261, "atom1_serNum": 9932, "atom2_serNum": 9962, "donAcc_type": "standard", "distance": 3.303, "atom1_id": "///C/165/O", "atom2_id": "///C/169/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1262, "atom1_serNum": 9937, "atom2_serNum": 9974, "donAcc_type": "standard", "distance": 3.314, "atom1_id": "///C/166/O", "atom2_id": "///C/171/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1263, "atom1_serNum": 9941, "atom2_serNum": 10000, "donAcc_type": "standard", "distance": 2.525, "atom1_id": "///C/166/NE", "atom2_id": "///C/174/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1264, "atom1_serNum": 9944, "atom2_serNum": 10000, "donAcc_type": "standard", "distance": 3.357, "atom1_id": "///C/166/NH2", "atom2_id": "///C/174/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1265, "atom1_serNum": 9977, "atom2_serNum": 9997, "donAcc_type": "standard", "distance": 3.052, "atom1_id": "///C/171/O", "atom2_id": "///C/174/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1266, "atom1_serNum": 10040, "atom2_serNum": 10952, "donAcc_type": "standard", "distance": 2.764, "atom1_id": "///D/1/O6", "atom2_id": "///E/61/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1267, "atom1_serNum": 10041, "atom2_serNum": 10950, "donAcc_type": "standard", "distance": 2.680, "atom1_id": "///D/1/N1", "atom2_id": "///E/61/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1268, "atom1_serNum": 10043, "atom2_serNum": 10949, "donAcc_type": "standard", "distance": 2.969, "atom1_id": "///D/1/N2", "atom2_id": "///E/61/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1269, "atom1_serNum": 10063, "atom2_serNum": 10932, "donAcc_type": "standard", "distance": 3.025, "atom1_id": "///D/2/O6", "atom2_id": "///E/60/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1270, "atom1_serNum": 10064, "atom2_serNum": 10930, "donAcc_type": "standard", "distance": 2.886, "atom1_id": "///D/2/N1", "atom2_id": "///E/60/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1271, "atom1_serNum": 10066, "atom2_serNum": 10929, "donAcc_type": "standard", "distance": 2.834, "atom1_id": "///D/2/N2", "atom2_id": "///E/60/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1272, "atom1_serNum": 10083, "atom2_serNum": 10910, "donAcc_type": "standard", "distance": 3.102, "atom1_id": "///D/3/O2", "atom2_id": "///E/59/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1273, "atom1_serNum": 10084, "atom2_serNum": 10909, "donAcc_type": "standard", "distance": 2.889, "atom1_id": "///D/3/N3", "atom2_id": "///E/59/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1274, "atom1_serNum": 10106, "atom2_serNum": 10869, "donAcc_type": "standard", "distance": 3.944, "atom1_id": "///D/4/N6", "atom2_id": "///E/57/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1275, "atom1_serNum": 10106, "atom2_serNum": 10889, "donAcc_type": "standard", "distance": 2.977, "atom1_id": "///D/4/N6", "atom2_id": "///E/58/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1276, "atom1_serNum": 10107, "atom2_serNum": 10887, "donAcc_type": "standard", "distance": 2.944, "atom1_id": "///D/4/N1", "atom2_id": "///E/58/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1277, "atom1_serNum": 10128, "atom2_serNum": 10869, "donAcc_type": "standard", "distance": 3.157, "atom1_id": "///D/5/N6", "atom2_id": "///E/57/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1278, "atom1_serNum": 10129, "atom2_serNum": 10867, "donAcc_type": "standard", "distance": 3.069, "atom1_id": "///D/5/N1", "atom2_id": "///E/57/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1279, "atom1_serNum": 10150, "atom2_serNum": 10849, "donAcc_type": "standard", "distance": 2.792, "atom1_id": "///D/6/N6", "atom2_id": "///E/56/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1280, "atom1_serNum": 10151, "atom2_serNum": 10847, "donAcc_type": "standard", "distance": 2.913, "atom1_id": "///D/6/N1", "atom2_id": "///E/56/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1281, "atom1_serNum": 10169, "atom2_serNum": 10829, "donAcc_type": "standard", "distance": 2.886, "atom1_id": "///D/7/O2", "atom2_id": "///E/55/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1282, "atom1_serNum": 10170, "atom2_serNum": 10827, "donAcc_type": "standard", "distance": 3.062, "atom1_id": "///D/7/N3", "atom2_id": "///E/55/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1283, "atom1_serNum": 10170, "atom2_serNum": 10829, "donAcc_type": "standard", "distance": 3.036, "atom1_id": "///D/7/N3", "atom2_id": "///E/55/N2", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1284, "atom1_serNum": 10172, "atom2_serNum": 10826, "donAcc_type": "standard", "distance": 3.156, "atom1_id": "///D/7/N4", "atom2_id": "///E/55/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1285, "atom1_serNum": 10192, "atom2_serNum": 10806, "donAcc_type": "standard", "distance": 3.186, "atom1_id": "///D/8/N6", "atom2_id": "///E/54/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1286, "atom1_serNum": 10193, "atom2_serNum": 10804, "donAcc_type": "standard", "distance": 3.055, "atom1_id": "///D/8/N1", "atom2_id": "///E/54/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1287, "atom1_serNum": 10212, "atom2_serNum": 10785, "donAcc_type": "standard", "distance": 2.968, "atom1_id": "///D/9/N3", "atom2_id": "///E/53/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1288, "atom1_serNum": 10214, "atom2_serNum": 10784, "donAcc_type": "standard", "distance": 3.108, "atom1_id": "///D/9/O4", "atom2_id": "///E/53/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1289, "atom1_serNum": 10231, "atom2_serNum": 10764, "donAcc_type": "standard", "distance": 3.059, "atom1_id": "///D/10/O2", "atom2_id": "///E/52/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1290, "atom1_serNum": 10232, "atom2_serNum": 10762, "donAcc_type": "standard", "distance": 3.081, "atom1_id": "///D/10/N3", "atom2_id": "///E/52/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1291, "atom1_serNum": 10234, "atom2_serNum": 10761, "donAcc_type": "standard", "distance": 3.175, "atom1_id": "///D/10/N4", "atom2_id": "///E/52/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1292, "atom1_serNum": 10247, "atom2_serNum": 10260, "donAcc_type": "acceptable", "distance": 3.251, "atom1_id": "///D/11/O2'", "atom2_id": "///D/14/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 1293, "atom1_serNum": 10251, "atom2_serNum": 10741, "donAcc_type": "standard", "distance": 3.204, "atom1_id": "///D/11/O2", "atom2_id": "///E/51/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1294, "atom1_serNum": 10252, "atom2_serNum": 10739, "donAcc_type": "standard", "distance": 3.403, "atom1_id": "///D/11/N3", "atom2_id": "///E/51/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1295, "atom1_serNum": 10254, "atom2_serNum": 10738, "donAcc_type": "standard", "distance": 3.539, "atom1_id": "///D/11/N4", "atom2_id": "///E/51/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1296, "atom1_serNum": 10271, "atom2_serNum": 10718, "donAcc_type": "standard", "distance": 2.828, "atom1_id": "///D/14/O6", "atom2_id": "///E/50/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1297, "atom1_serNum": 10272, "atom2_serNum": 10716, "donAcc_type": "standard", "distance": 3.311, "atom1_id": "///D/14/N1", "atom2_id": "///E/50/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1298, "atom1_serNum": 10274, "atom2_serNum": 10715, "donAcc_type": "standard", "distance": 3.895, "atom1_id": "///D/14/N2", "atom2_id": "///E/50/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1299, "atom1_serNum": 10287, "atom2_serNum": 10302, "donAcc_type": "acceptable", "distance": 3.168, "atom1_id": "///D/15/O2'", "atom2_id": "///D/16/O5'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 1300, "atom1_serNum": 10287, "atom2_serNum": 10305, "donAcc_type": "acceptable", "distance": 2.891, "atom1_id": "///D/15/O2'", "atom2_id": "///D/16/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 1301, "atom1_serNum": 10294, "atom2_serNum": 10675, "donAcc_type": "standard", "distance": 3.205, "atom1_id": "///D/15/N6", "atom2_id": "///E/48/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1302, "atom1_serNum": 10294, "atom2_serNum": 10698, "donAcc_type": "standard", "distance": 3.162, "atom1_id": "///D/15/N6", "atom2_id": "///E/49/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1303, "atom1_serNum": 10295, "atom2_serNum": 10696, "donAcc_type": "standard", "distance": 2.795, "atom1_id": "///D/15/N1", "atom2_id": "///E/49/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1304, "atom1_serNum": 10309, "atom2_serNum": 10325, "donAcc_type": "acceptable", "distance": 3.288, "atom1_id": "///D/16/O2'", "atom2_id": "///D/17/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 1305, "atom1_serNum": 10313, "atom2_serNum": 10678, "donAcc_type": "standard", "distance": 2.651, "atom1_id": "///D/16/O2", "atom2_id": "///E/48/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1306, "atom1_serNum": 10313, "atom2_serNum": 10695, "donAcc_type": "questionable", "distance": 3.367, "atom1_id": "///D/16/O2", "atom2_id": "///E/49/O2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 1307, "atom1_serNum": 10314, "atom2_serNum": 10676, "donAcc_type": "standard", "distance": 2.931, "atom1_id": "///D/16/N3", "atom2_id": "///E/48/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1308, "atom1_serNum": 10316, "atom2_serNum": 10675, "donAcc_type": "standard", "distance": 3.261, "atom1_id": "///D/16/N4", "atom2_id": "///E/48/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1309, "atom1_serNum": 10334, "atom2_serNum": 10654, "donAcc_type": "standard", "distance": 2.981, "atom1_id": "///D/17/N3", "atom2_id": "///E/47/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1310, "atom1_serNum": 10336, "atom2_serNum": 10653, "donAcc_type": "standard", "distance": 3.247, "atom1_id": "///D/17/O4", "atom2_id": "///E/47/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1311, "atom1_serNum": 10357, "atom2_serNum": 10631, "donAcc_type": "standard", "distance": 3.330, "atom1_id": "///D/18/N1", "atom2_id": "///E/46/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1312, "atom1_serNum": 10359, "atom2_serNum": 10630, "donAcc_type": "standard", "distance": 2.706, "atom1_id": "///D/18/N2", "atom2_id": "///E/46/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1313, "atom1_serNum": 10380, "atom2_serNum": 10611, "donAcc_type": "questionable", "distance": 3.336, "atom1_id": "///D/19/N1", "atom2_id": "///E/45/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1314, "atom1_serNum": 10382, "atom2_serNum": 10610, "donAcc_type": "standard", "distance": 2.797, "atom1_id": "///D/19/N2", "atom2_id": "///E/45/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1315, "atom1_serNum": 10402, "atom2_serNum": 10593, "donAcc_type": "standard", "distance": 2.796, "atom1_id": "///D/20/N6", "atom2_id": "///E/44/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1316, "atom1_serNum": 10403, "atom2_serNum": 10591, "donAcc_type": "standard", "distance": 3.033, "atom1_id": "///D/20/N1", "atom2_id": "///E/44/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1317, "atom1_serNum": 10424, "atom2_serNum": 10573, "donAcc_type": "standard", "distance": 2.957, "atom1_id": "///D/21/N6", "atom2_id": "///E/43/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1318, "atom1_serNum": 10425, "atom2_serNum": 10571, "donAcc_type": "standard", "distance": 2.802, "atom1_id": "///D/21/N1", "atom2_id": "///E/43/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1319, "atom1_serNum": 10446, "atom2_serNum": 10553, "donAcc_type": "standard", "distance": 3.622, "atom1_id": "///D/22/O6", "atom2_id": "///E/42/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1320, "atom1_serNum": 10447, "atom2_serNum": 10551, "donAcc_type": "standard", "distance": 3.349, "atom1_id": "///D/22/N1", "atom2_id": "///E/42/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1321, "atom1_serNum": 10449, "atom2_serNum": 10550, "donAcc_type": "standard", "distance": 3.004, "atom1_id": "///D/22/N2", "atom2_id": "///E/42/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1322, "atom1_serNum": 10462, "atom2_serNum": 10533, "donAcc_type": "acceptable", "distance": 3.321, "atom1_id": "///D/23/O2'", "atom2_id": "///E/41/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1323, "atom1_serNum": 10466, "atom2_serNum": 10531, "donAcc_type": "standard", "distance": 2.851, "atom1_id": "///D/23/O2", "atom2_id": "///E/41/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1324, "atom1_serNum": 10466, "atom2_serNum": 10533, "donAcc_type": "standard", "distance": 3.038, "atom1_id": "///D/23/O2", "atom2_id": "///E/41/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1325, "atom1_serNum": 10486, "atom2_serNum": 10508, "donAcc_type": "standard", "distance": 3.272, "atom1_id": "///D/24/O2", "atom2_id": "///E/40/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1326, "atom1_serNum": 10487, "atom2_serNum": 10507, "donAcc_type": "standard", "distance": 3.105, "atom1_id": "///D/24/N3", "atom2_id": "///E/40/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1327, "atom1_serNum": 10566, "atom2_serNum": 10582, "donAcc_type": "acceptable", "distance": 3.553, "atom1_id": "///E/43/O2'", "atom2_id": "///E/44/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 1328, "atom1_serNum": 10626, "atom2_serNum": 10642, "donAcc_type": "acceptable", "distance": 3.557, "atom1_id": "///E/46/O2'", "atom2_id": "///E/47/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 1329, "atom1_serNum": 10819, "atom2_serNum": 10838, "donAcc_type": "acceptable", "distance": 2.946, "atom1_id": "///E/55/O2'", "atom2_id": "///E/56/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 1330, "atom1_serNum": 10842, "atom2_serNum": 10858, "donAcc_type": "acceptable", "distance": 3.083, "atom1_id": "///E/56/O2'", "atom2_id": "///E/57/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 1331, "atom1_serNum": 10862, "atom2_serNum": 10878, "donAcc_type": "acceptable", "distance": 3.120, "atom1_id": "///E/57/O2'", "atom2_id": "///E/58/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 1332, "atom1_serNum": 10945, "atom2_serNum": 10957, "donAcc_type": "acceptable", "distance": 3.121, "atom1_id": "///E/61/O2'", "atom2_id": "///E/62/OP2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 1333, "atom1_serNum": 10988, "atom2_serNum": 10992, "donAcc_type": "acceptable", "distance": 3.096, "atom1_id": "///E/63/O2'", "atom2_id": "///E/63/O2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 1334, "atom1_serNum": 11019, "atom2_serNum": 11049, "donAcc_type": "standard", "distance": 3.187, "atom1_id": "///F/4/OD2", "atom2_id": "///F/9/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1335, "atom1_serNum": 11023, "atom2_serNum": 11044, "donAcc_type": "standard", "distance": 2.874, "atom1_id": "///F/5/O", "atom2_id": "///F/8/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1336, "atom1_serNum": 11023, "atom2_serNum": 11049, "donAcc_type": "standard", "distance": 3.372, "atom1_id": "///F/5/O", "atom2_id": "///F/9/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1337, "atom1_serNum": 11032, "atom2_serNum": 11057, "donAcc_type": "standard", "distance": 3.439, "atom1_id": "///F/6/O", "atom2_id": "///F/10/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1338, "atom1_serNum": 11042, "atom2_serNum": 11406, "donAcc_type": "standard", "distance": 2.648, "atom1_id": "///F/7/OD1", "atom2_id": "///F/53/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1339, "atom1_serNum": 11047, "atom2_serNum": 11080, "donAcc_type": "standard", "distance": 2.805, "atom1_id": "///F/8/O", "atom2_id": "///F/12/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1340, "atom1_serNum": 11052, "atom2_serNum": 11072, "donAcc_type": "standard", "distance": 2.796, "atom1_id": "///F/9/O", "atom2_id": "///F/12/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1341, "atom1_serNum": 11052, "atom2_serNum": 11081, "donAcc_type": "standard", "distance": 2.933, "atom1_id": "///F/9/O", "atom2_id": "///F/13/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1342, "atom1_serNum": 11060, "atom2_serNum": 11089, "donAcc_type": "standard", "distance": 3.310, "atom1_id": "///F/10/O", "atom2_id": "///F/14/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1343, "atom1_serNum": 11066, "atom2_serNum": 11096, "donAcc_type": "standard", "distance": 3.355, "atom1_id": "///F/11/O", "atom2_id": "///F/15/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1344, "atom1_serNum": 11075, "atom2_serNum": 11105, "donAcc_type": "standard", "distance": 2.739, "atom1_id": "///F/12/O", "atom2_id": "///F/16/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1345, "atom1_serNum": 11084, "atom2_serNum": 11110, "donAcc_type": "standard", "distance": 2.835, "atom1_id": "///F/13/O", "atom2_id": "///F/17/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1346, "atom1_serNum": 11092, "atom2_serNum": 11117, "donAcc_type": "standard", "distance": 3.206, "atom1_id": "///F/14/O", "atom2_id": "///F/18/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1347, "atom1_serNum": 11092, "atom2_serNum": 11122, "donAcc_type": "acceptable", "distance": 2.494, "atom1_id": "///F/14/O", "atom2_id": "///F/18/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1348, "atom1_serNum": 11099, "atom2_serNum": 11124, "donAcc_type": "standard", "distance": 3.291, "atom1_id": "///F/15/O", "atom2_id": "///F/19/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1349, "atom1_serNum": 11108, "atom2_serNum": 11131, "donAcc_type": "standard", "distance": 3.090, "atom1_id": "///F/16/O", "atom2_id": "///F/20/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1350, "atom1_serNum": 11113, "atom2_serNum": 11139, "donAcc_type": "standard", "distance": 3.207, "atom1_id": "///F/17/O", "atom2_id": "///F/21/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1351, "atom1_serNum": 11120, "atom2_serNum": 11139, "donAcc_type": "standard", "distance": 3.098, "atom1_id": "///F/18/O", "atom2_id": "///F/21/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1352, "atom1_serNum": 11120, "atom2_serNum": 11147, "donAcc_type": "standard", "distance": 2.898, "atom1_id": "///F/18/O", "atom2_id": "///F/22/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1353, "atom1_serNum": 11127, "atom2_serNum": 11147, "donAcc_type": "standard", "distance": 3.130, "atom1_id": "///F/19/O", "atom2_id": "///F/22/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1354, "atom1_serNum": 11134, "atom2_serNum": 11224, "donAcc_type": "standard", "distance": 3.259, "atom1_id": "///F/20/O", "atom2_id": "///F/30/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1355, "atom1_serNum": 11142, "atom2_serNum": 11155, "donAcc_type": "standard", "distance": 3.268, "atom1_id": "///F/21/O", "atom2_id": "///F/23/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1356, "atom1_serNum": 11150, "atom2_serNum": 11225, "donAcc_type": "standard", "distance": 2.817, "atom1_id": "///F/22/O", "atom2_id": "///F/30/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1357, "atom1_serNum": 11154, "atom2_serNum": 11155, "donAcc_type": "standard", "distance": 3.041, "atom1_id": "///F/22/OD2", "atom2_id": "///F/23/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1358, "atom1_serNum": 11158, "atom2_serNum": 11170, "donAcc_type": "standard", "distance": 3.101, "atom1_id": "///F/23/O", "atom2_id": "///F/25/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1359, "atom1_serNum": 11162, "atom2_serNum": 11168, "donAcc_type": "standard", "distance": 2.530, "atom1_id": "///F/24/N", "atom2_id": "///F/24/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1360, "atom1_serNum": 11179, "atom2_serNum": 11203, "donAcc_type": "standard", "distance": 2.804, "atom1_id": "///F/26/O", "atom2_id": "///F/29/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1361, "atom1_serNum": 11179, "atom2_serNum": 11215, "donAcc_type": "standard", "distance": 3.042, "atom1_id": "///F/26/O", "atom2_id": "///F/30/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1362, "atom1_serNum": 11186, "atom2_serNum": 11226, "donAcc_type": "standard", "distance": 3.383, "atom1_id": "///F/27/O", "atom2_id": "///F/31/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1363, "atom1_serNum": 11190, "atom2_serNum": 19945, "donAcc_type": "questionable", "distance": 3.135, "atom1_id": "///F/27/OE1", "atom2_id": "///H/46/OE2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1364, "atom1_serNum": 11191, "atom2_serNum": 19944, "donAcc_type": "standard", "distance": 3.283, "atom1_id": "///F/27/NE2", "atom2_id": "///H/46/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1365, "atom1_serNum": 11195, "atom2_serNum": 11234, "donAcc_type": "standard", "distance": 3.216, "atom1_id": "///F/28/O", "atom2_id": "///F/32/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1366, "atom1_serNum": 11195, "atom2_serNum": 11241, "donAcc_type": "questionable", "distance": 2.972, "atom1_id": "///F/28/O", "atom2_id": "///F/32/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1367, "atom1_serNum": 11206, "atom2_serNum": 11243, "donAcc_type": "standard", "distance": 2.980, "atom1_id": "///F/29/O", "atom2_id": "///F/33/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1368, "atom1_serNum": 11218, "atom2_serNum": 11243, "donAcc_type": "standard", "distance": 2.936, "atom1_id": "///F/30/O", "atom2_id": "///F/33/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1369, "atom1_serNum": 11218, "atom2_serNum": 11248, "donAcc_type": "standard", "distance": 2.738, "atom1_id": "///F/30/O", "atom2_id": "///F/34/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1370, "atom1_serNum": 11229, "atom2_serNum": 11256, "donAcc_type": "standard", "distance": 2.794, "atom1_id": "///F/31/O", "atom2_id": "///F/35/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1371, "atom1_serNum": 11237, "atom2_serNum": 11265, "donAcc_type": "standard", "distance": 3.072, "atom1_id": "///F/32/O", "atom2_id": "///F/36/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1372, "atom1_serNum": 11246, "atom2_serNum": 11276, "donAcc_type": "standard", "distance": 3.316, "atom1_id": "///F/33/O", "atom2_id": "///F/37/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1373, "atom1_serNum": 11251, "atom2_serNum": 11282, "donAcc_type": "standard", "distance": 3.259, "atom1_id": "///F/34/O", "atom2_id": "///F/38/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1374, "atom1_serNum": 11251, "atom2_serNum": 11289, "donAcc_type": "questionable", "distance": 3.042, "atom1_id": "///F/34/O", "atom2_id": "///F/38/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1375, "atom1_serNum": 11259, "atom2_serNum": 11291, "donAcc_type": "standard", "distance": 3.269, "atom1_id": "///F/35/O", "atom2_id": "///F/39/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1376, "atom1_serNum": 11268, "atom2_serNum": 11300, "donAcc_type": "standard", "distance": 2.910, "atom1_id": "///F/36/O", "atom2_id": "///F/40/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1377, "atom1_serNum": 11279, "atom2_serNum": 11311, "donAcc_type": "standard", "distance": 2.761, "atom1_id": "///F/37/O", "atom2_id": "///F/41/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1378, "atom1_serNum": 11285, "atom2_serNum": 11320, "donAcc_type": "standard", "distance": 3.092, "atom1_id": "///F/38/O", "atom2_id": "///F/42/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1379, "atom1_serNum": 11290, "atom2_serNum": 11319, "donAcc_type": "standard", "distance": 3.169, "atom1_id": "///F/38/OE2", "atom2_id": "///F/41/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1380, "atom1_serNum": 11294, "atom2_serNum": 11320, "donAcc_type": "standard", "distance": 3.103, "atom1_id": "///F/39/O", "atom2_id": "///F/42/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1381, "atom1_serNum": 11294, "atom2_serNum": 11329, "donAcc_type": "standard", "distance": 2.840, "atom1_id": "///F/39/O", "atom2_id": "///F/43/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1382, "atom1_serNum": 11314, "atom2_serNum": 11569, "donAcc_type": "standard", "distance": 3.062, "atom1_id": "///F/41/O", "atom2_id": "///F/73/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1383, "atom1_serNum": 11323, "atom2_serNum": 11613, "donAcc_type": "standard", "distance": 3.088, "atom1_id": "///F/42/O", "atom2_id": "///F/78/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1384, "atom1_serNum": 11332, "atom2_serNum": 11613, "donAcc_type": "standard", "distance": 2.805, "atom1_id": "///F/43/O", "atom2_id": "///F/78/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1385, "atom1_serNum": 11341, "atom2_serNum": 11613, "donAcc_type": "standard", "distance": 2.889, "atom1_id": "///F/44/O", "atom2_id": "///F/78/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1386, "atom1_serNum": 11341, "atom2_serNum": 11614, "donAcc_type": "standard", "distance": 2.970, "atom1_id": "///F/44/O", "atom2_id": "///F/78/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1387, "atom1_serNum": 11347, "atom2_serNum": 11359, "donAcc_type": "standard", "distance": 2.893, "atom1_id": "///F/45/O", "atom2_id": "///F/47/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1388, "atom1_serNum": 11347, "atom2_serNum": 11614, "donAcc_type": "standard", "distance": 3.081, "atom1_id": "///F/45/O", "atom2_id": "///F/78/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1389, "atom1_serNum": 11354, "atom2_serNum": 11379, "donAcc_type": "standard", "distance": 3.397, "atom1_id": "///F/46/O", "atom2_id": "///F/50/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1390, "atom1_serNum": 11362, "atom2_serNum": 11385, "donAcc_type": "standard", "distance": 2.956, "atom1_id": "///F/47/O", "atom2_id": "///F/51/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1391, "atom1_serNum": 11368, "atom2_serNum": 11389, "donAcc_type": "standard", "distance": 2.903, "atom1_id": "///F/48/O", "atom2_id": "///F/52/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1392, "atom1_serNum": 11375, "atom2_serNum": 11397, "donAcc_type": "standard", "distance": 3.216, "atom1_id": "///F/49/O", "atom2_id": "///F/53/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1393, "atom1_serNum": 11382, "atom2_serNum": 11408, "donAcc_type": "standard", "distance": 3.092, "atom1_id": "///F/50/O", "atom2_id": "///F/54/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1394, "atom1_serNum": 11388, "atom2_serNum": 11416, "donAcc_type": "standard", "distance": 3.044, "atom1_id": "///F/51/O", "atom2_id": "///F/55/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1395, "atom1_serNum": 11392, "atom2_serNum": 11429, "donAcc_type": "questionable", "distance": 2.552, "atom1_id": "///F/52/O", "atom2_id": "///F/56/OE2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1396, "atom1_serNum": 11400, "atom2_serNum": 11421, "donAcc_type": "standard", "distance": 3.010, "atom1_id": "///F/53/O", "atom2_id": "///F/56/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1397, "atom1_serNum": 11424, "atom2_serNum": 11446, "donAcc_type": "standard", "distance": 3.055, "atom1_id": "///F/56/O", "atom2_id": "///F/59/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1398, "atom1_serNum": 11438, "atom2_serNum": 11790, "donAcc_type": "standard", "distance": 3.776, "atom1_id": "///F/57/NZ", "atom2_id": "///F/100/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1399, "atom1_serNum": 11458, "atom2_serNum": 11475, "donAcc_type": "standard", "distance": 2.995, "atom1_id": "///F/60/O", "atom2_id": "///F/63/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1400, "atom1_serNum": 11458, "atom2_serNum": 11482, "donAcc_type": "standard", "distance": 2.828, "atom1_id": "///F/60/O", "atom2_id": "///F/64/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1401, "atom1_serNum": 11465, "atom2_serNum": 11493, "donAcc_type": "standard", "distance": 2.829, "atom1_id": "///F/61/O", "atom2_id": "///F/65/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1402, "atom1_serNum": 11470, "atom2_serNum": 11503, "donAcc_type": "standard", "distance": 3.192, "atom1_id": "///F/62/O", "atom2_id": "///F/66/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1403, "atom1_serNum": 11478, "atom2_serNum": 11514, "donAcc_type": "standard", "distance": 2.932, "atom1_id": "///F/63/O", "atom2_id": "///F/67/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1404, "atom1_serNum": 11485, "atom2_serNum": 11518, "donAcc_type": "standard", "distance": 3.023, "atom1_id": "///F/64/O", "atom2_id": "///F/68/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1405, "atom1_serNum": 11491, "atom2_serNum": 11854, "donAcc_type": "standard", "distance": 2.994, "atom1_id": "///F/64/NH1", "atom2_id": "///F/108/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1406, "atom1_serNum": 11496, "atom2_serNum": 11526, "donAcc_type": "standard", "distance": 2.923, "atom1_id": "///F/65/O", "atom2_id": "///F/69/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1407, "atom1_serNum": 11499, "atom2_serNum": 11533, "donAcc_type": "acceptable", "distance": 3.916, "atom1_id": "///F/65/ND1", "atom2_id": "///F/69/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1408, "atom1_serNum": 11506, "atom2_serNum": 11535, "donAcc_type": "standard", "distance": 3.157, "atom1_id": "///F/66/O", "atom2_id": "///F/70/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1409, "atom1_serNum": 11517, "atom2_serNum": 11543, "donAcc_type": "standard", "distance": 3.306, "atom1_id": "///F/67/O", "atom2_id": "///F/71/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1410, "atom1_serNum": 11521, "atom2_serNum": 11551, "donAcc_type": "standard", "distance": 3.014, "atom1_id": "///F/68/O", "atom2_id": "///F/72/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1411, "atom1_serNum": 11529, "atom2_serNum": 11560, "donAcc_type": "standard", "distance": 2.933, "atom1_id": "///F/69/O", "atom2_id": "///F/73/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1412, "atom1_serNum": 11538, "atom2_serNum": 11570, "donAcc_type": "standard", "distance": 2.971, "atom1_id": "///F/70/O", "atom2_id": "///F/74/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1413, "atom1_serNum": 11546, "atom2_serNum": 11577, "donAcc_type": "standard", "distance": 3.393, "atom1_id": "///F/71/O", "atom2_id": "///F/75/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1414, "atom1_serNum": 11554, "atom2_serNum": 11584, "donAcc_type": "standard", "distance": 2.919, "atom1_id": "///F/72/O", "atom2_id": "///F/76/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1415, "atom1_serNum": 11559, "atom2_serNum": 11936, "donAcc_type": "standard", "distance": 3.026, "atom1_id": "///F/72/OE2", "atom2_id": "///F/118/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1416, "atom1_serNum": 11563, "atom2_serNum": 11593, "donAcc_type": "standard", "distance": 2.939, "atom1_id": "///F/73/O", "atom2_id": "///F/77/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1417, "atom1_serNum": 11563, "atom2_serNum": 11604, "donAcc_type": "standard", "distance": 3.595, "atom1_id": "///F/73/O", "atom2_id": "///F/78/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1418, "atom1_serNum": 11573, "atom2_serNum": 11615, "donAcc_type": "standard", "distance": 2.642, "atom1_id": "///F/74/O", "atom2_id": "///F/79/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1419, "atom1_serNum": 11580, "atom2_serNum": 12001, "donAcc_type": "standard", "distance": 2.724, "atom1_id": "///F/75/O", "atom2_id": "///F/126/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1420, "atom1_serNum": 11580, "atom2_serNum": 12004, "donAcc_type": "standard", "distance": 3.155, "atom1_id": "///F/75/O", "atom2_id": "///F/126/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1421, "atom1_serNum": 11587, "atom2_serNum": 12004, "donAcc_type": "standard", "distance": 2.811, "atom1_id": "///F/76/O", "atom2_id": "///F/126/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1422, "atom1_serNum": 11623, "atom2_serNum": 12012, "donAcc_type": "standard", "distance": 2.654, "atom1_id": "///F/79/NE1", "atom2_id": "///F/127/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1423, "atom1_serNum": 11649, "atom2_serNum": 11681, "donAcc_type": "standard", "distance": 2.996, "atom1_id": "///F/83/N", "atom2_id": "///F/86/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1424, "atom1_serNum": 11652, "atom2_serNum": 11683, "donAcc_type": "standard", "distance": 3.159, "atom1_id": "///F/83/O", "atom2_id": "///F/87/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1425, "atom1_serNum": 11654, "atom2_serNum": 11681, "donAcc_type": "acceptable", "distance": 2.945, "atom1_id": "///F/83/OG", "atom2_id": "///F/86/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1426, "atom1_serNum": 11658, "atom2_serNum": 11692, "donAcc_type": "standard", "distance": 2.861, "atom1_id": "///F/84/O", "atom2_id": "///F/88/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1427, "atom1_serNum": 11669, "atom2_serNum": 11699, "donAcc_type": "standard", "distance": 2.961, "atom1_id": "///F/85/O", "atom2_id": "///F/89/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1428, "atom1_serNum": 11677, "atom2_serNum": 11711, "donAcc_type": "standard", "distance": 3.164, "atom1_id": "///F/86/O", "atom2_id": "///F/90/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1429, "atom1_serNum": 11686, "atom2_serNum": 11719, "donAcc_type": "standard", "distance": 2.995, "atom1_id": "///F/87/O", "atom2_id": "///F/91/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1430, "atom1_serNum": 11695, "atom2_serNum": 11728, "donAcc_type": "standard", "distance": 3.117, "atom1_id": "///F/88/O", "atom2_id": "///F/92/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1431, "atom1_serNum": 11702, "atom2_serNum": 11736, "donAcc_type": "standard", "distance": 3.054, "atom1_id": "///F/89/O", "atom2_id": "///F/93/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1432, "atom1_serNum": 11702, "atom2_serNum": 11741, "donAcc_type": "acceptable", "distance": 2.941, "atom1_id": "///F/89/O", "atom2_id": "///F/93/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1433, "atom1_serNum": 11714, "atom2_serNum": 11742, "donAcc_type": "standard", "distance": 3.234, "atom1_id": "///F/90/O", "atom2_id": "///F/94/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1434, "atom1_serNum": 11722, "atom2_serNum": 11749, "donAcc_type": "standard", "distance": 2.957, "atom1_id": "///F/91/O", "atom2_id": "///F/95/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1435, "atom1_serNum": 11731, "atom2_serNum": 11757, "donAcc_type": "standard", "distance": 2.807, "atom1_id": "///F/92/O", "atom2_id": "///F/96/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1436, "atom1_serNum": 11739, "atom2_serNum": 11766, "donAcc_type": "standard", "distance": 2.900, "atom1_id": "///F/93/O", "atom2_id": "///F/97/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1437, "atom1_serNum": 11745, "atom2_serNum": 11774, "donAcc_type": "standard", "distance": 3.403, "atom1_id": "///F/94/O", "atom2_id": "///F/98/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1438, "atom1_serNum": 11752, "atom2_serNum": 11774, "donAcc_type": "standard", "distance": 3.228, "atom1_id": "///F/95/O", "atom2_id": "///F/98/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1439, "atom1_serNum": 11752, "atom2_serNum": 11782, "donAcc_type": "standard", "distance": 3.291, "atom1_id": "///F/95/O", "atom2_id": "///F/99/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1440, "atom1_serNum": 11760, "atom2_serNum": 11782, "donAcc_type": "standard", "distance": 2.683, "atom1_id": "///F/96/O", "atom2_id": "///F/99/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1441, "atom1_serNum": 11760, "atom2_serNum": 11787, "donAcc_type": "standard", "distance": 2.959, "atom1_id": "///F/96/O", "atom2_id": "///F/100/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1442, "atom1_serNum": 11769, "atom2_serNum": 11795, "donAcc_type": "standard", "distance": 2.859, "atom1_id": "///F/97/O", "atom2_id": "///F/101/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1443, "atom1_serNum": 11769, "atom2_serNum": 11799, "donAcc_type": "standard", "distance": 3.406, "atom1_id": "///F/97/O", "atom2_id": "///F/102/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1444, "atom1_serNum": 11785, "atom2_serNum": 12198, "donAcc_type": "questionable", "distance": 2.943, "atom1_id": "///F/99/O", "atom2_id": "///F/149/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1445, "atom1_serNum": 11817, "atom2_serNum": 11838, "donAcc_type": "standard", "distance": 2.617, "atom1_id": "///F/104/O", "atom2_id": "///F/107/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1446, "atom1_serNum": 11817, "atom2_serNum": 11847, "donAcc_type": "standard", "distance": 2.579, "atom1_id": "///F/104/O", "atom2_id": "///F/108/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1447, "atom1_serNum": 11822, "atom2_serNum": 12189, "donAcc_type": "acceptable", "distance": 3.351, "atom1_id": "///F/105/N", "atom2_id": "///F/148/OG1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1448, "atom1_serNum": 11825, "atom2_serNum": 11899, "donAcc_type": "standard", "distance": 3.153, "atom1_id": "///F/105/O", "atom2_id": "///F/113/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1449, "atom1_serNum": 11855, "atom2_serNum": 11856, "donAcc_type": "standard", "distance": 2.624, "atom1_id": "///F/108/OE2", "atom2_id": "///F/109/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1450, "atom1_serNum": 11868, "atom2_serNum": 11900, "donAcc_type": "standard", "distance": 3.262, "atom1_id": "///F/110/O", "atom2_id": "///F/114/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1451, "atom1_serNum": 11871, "atom2_serNum": 12803, "donAcc_type": "standard", "distance": 3.780, "atom1_id": "///F/110/OD1", "atom2_id": "///F/222/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1452, "atom1_serNum": 11872, "atom2_serNum": 20467, "donAcc_type": "standard", "distance": 2.929, "atom1_id": "///F/110/ND2", "atom2_id": "///H/110/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1453, "atom1_serNum": 11876, "atom2_serNum": 11908, "donAcc_type": "standard", "distance": 2.983, "atom1_id": "///F/111/O", "atom2_id": "///F/115/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1454, "atom1_serNum": 11886, "atom2_serNum": 11913, "donAcc_type": "standard", "distance": 3.043, "atom1_id": "///F/112/O", "atom2_id": "///F/116/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1455, "atom1_serNum": 11894, "atom2_serNum": 11921, "donAcc_type": "standard", "distance": 2.944, "atom1_id": "///F/113/O", "atom2_id": "///F/117/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1456, "atom1_serNum": 11899, "atom2_serNum": 12215, "donAcc_type": "standard", "distance": 2.545, "atom1_id": "///F/113/NZ", "atom2_id": "///F/151/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1457, "atom1_serNum": 11903, "atom2_serNum": 11921, "donAcc_type": "standard", "distance": 2.717, "atom1_id": "///F/114/O", "atom2_id": "///F/117/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1458, "atom1_serNum": 11903, "atom2_serNum": 11927, "donAcc_type": "standard", "distance": 2.734, "atom1_id": "///F/114/O", "atom2_id": "///F/118/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1459, "atom1_serNum": 11906, "atom2_serNum": 12283, "donAcc_type": "standard", "distance": 2.530, "atom1_id": "///F/114/OD1", "atom2_id": "///F/159/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1460, "atom1_serNum": 11911, "atom2_serNum": 11938, "donAcc_type": "standard", "distance": 3.355, "atom1_id": "///F/115/O", "atom2_id": "///F/119/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1461, "atom1_serNum": 11916, "atom2_serNum": 11946, "donAcc_type": "standard", "distance": 3.420, "atom1_id": "///F/116/O", "atom2_id": "///F/120/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1462, "atom1_serNum": 11924, "atom2_serNum": 11953, "donAcc_type": "standard", "distance": 3.040, "atom1_id": "///F/117/O", "atom2_id": "///F/121/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1463, "atom1_serNum": 11930, "atom2_serNum": 11960, "donAcc_type": "standard", "distance": 3.037, "atom1_id": "///F/118/O", "atom2_id": "///F/122/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1464, "atom1_serNum": 11937, "atom2_serNum": 20196, "donAcc_type": "standard", "distance": 2.691, "atom1_id": "///F/118/NH2", "atom2_id": "///H/77/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1465, "atom1_serNum": 11941, "atom2_serNum": 11969, "donAcc_type": "standard", "distance": 3.070, "atom1_id": "///F/119/O", "atom2_id": "///F/123/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1466, "atom1_serNum": 11949, "atom2_serNum": 11977, "donAcc_type": "standard", "distance": 2.833, "atom1_id": "///F/120/O", "atom2_id": "///F/124/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1467, "atom1_serNum": 11956, "atom2_serNum": 11977, "donAcc_type": "standard", "distance": 2.547, "atom1_id": "///F/121/O", "atom2_id": "///F/124/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1468, "atom1_serNum": 11956, "atom2_serNum": 11985, "donAcc_type": "standard", "distance": 2.795, "atom1_id": "///F/121/O", "atom2_id": "///F/125/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1469, "atom1_serNum": 11963, "atom2_serNum": 11994, "donAcc_type": "standard", "distance": 3.052, "atom1_id": "///F/122/O", "atom2_id": "///F/126/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1470, "atom1_serNum": 11972, "atom2_serNum": 12005, "donAcc_type": "standard", "distance": 3.179, "atom1_id": "///F/123/O", "atom2_id": "///F/127/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1471, "atom1_serNum": 11980, "atom2_serNum": 12014, "donAcc_type": "standard", "distance": 2.710, "atom1_id": "///F/124/O", "atom2_id": "///F/128/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1472, "atom1_serNum": 12017, "atom2_serNum": 12035, "donAcc_type": "standard", "distance": 2.547, "atom1_id": "///F/128/O", "atom2_id": "///F/130/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1473, "atom1_serNum": 12017, "atom2_serNum": 12044, "donAcc_type": "standard", "distance": 2.861, "atom1_id": "///F/128/O", "atom2_id": "///F/131/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1474, "atom1_serNum": 12035, "atom2_serNum": 12042, "donAcc_type": "standard", "distance": 2.981, "atom1_id": "///F/130/N", "atom2_id": "///F/130/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1475, "atom1_serNum": 12057, "atom2_serNum": 12083, "donAcc_type": "standard", "distance": 2.827, "atom1_id": "///F/132/O", "atom2_id": "///F/135/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1476, "atom1_serNum": 12075, "atom2_serNum": 12082, "donAcc_type": "standard", "distance": 2.653, "atom1_id": "///F/134/N", "atom2_id": "///F/134/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1477, "atom1_serNum": 12078, "atom2_serNum": 12107, "donAcc_type": "standard", "distance": 2.763, "atom1_id": "///F/134/O", "atom2_id": "///F/138/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1478, "atom1_serNum": 12086, "atom2_serNum": 12116, "donAcc_type": "standard", "distance": 3.133, "atom1_id": "///F/135/O", "atom2_id": "///F/139/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1479, "atom1_serNum": 12094, "atom2_serNum": 12124, "donAcc_type": "standard", "distance": 2.997, "atom1_id": "///F/136/O", "atom2_id": "///F/140/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1480, "atom1_serNum": 12102, "atom2_serNum": 12132, "donAcc_type": "standard", "distance": 2.876, "atom1_id": "///F/137/O", "atom2_id": "///F/141/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1481, "atom1_serNum": 12102, "atom2_serNum": 12137, "donAcc_type": "acceptable", "distance": 2.668, "atom1_id": "///F/137/O", "atom2_id": "///F/141/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1482, "atom1_serNum": 12110, "atom2_serNum": 12139, "donAcc_type": "standard", "distance": 2.945, "atom1_id": "///F/138/O", "atom2_id": "///F/142/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1483, "atom1_serNum": 12119, "atom2_serNum": 12147, "donAcc_type": "standard", "distance": 2.862, "atom1_id": "///F/139/O", "atom2_id": "///F/143/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1484, "atom1_serNum": 12127, "atom2_serNum": 12153, "donAcc_type": "standard", "distance": 3.282, "atom1_id": "///F/140/O", "atom2_id": "///F/144/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1485, "atom1_serNum": 12130, "atom2_serNum": 12161, "donAcc_type": "standard", "distance": 3.250, "atom1_id": "///F/140/OD1", "atom2_id": "///F/144/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1486, "atom1_serNum": 12131, "atom2_serNum": 12161, "donAcc_type": "standard", "distance": 3.300, "atom1_id": "///F/140/OD2", "atom2_id": "///F/144/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1487, "atom1_serNum": 12135, "atom2_serNum": 12153, "donAcc_type": "standard", "distance": 3.025, "atom1_id": "///F/141/O", "atom2_id": "///F/144/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1488, "atom1_serNum": 12142, "atom2_serNum": 12162, "donAcc_type": "standard", "distance": 3.243, "atom1_id": "///F/142/O", "atom2_id": "///F/145/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1489, "atom1_serNum": 12150, "atom2_serNum": 12205, "donAcc_type": "acceptable", "distance": 2.580, "atom1_id": "///F/143/O", "atom2_id": "///F/150/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1490, "atom1_serNum": 12152, "atom2_serNum": 12205, "donAcc_type": "acceptable", "distance": 2.905, "atom1_id": "///F/143/OG", "atom2_id": "///F/150/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1491, "atom1_serNum": 12174, "atom2_serNum": 12191, "donAcc_type": "standard", "distance": 3.070, "atom1_id": "///F/146/O", "atom2_id": "///F/149/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1492, "atom1_serNum": 12174, "atom2_serNum": 12199, "donAcc_type": "standard", "distance": 3.213, "atom1_id": "///F/146/O", "atom2_id": "///F/149/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1493, "atom1_serNum": 12174, "atom2_serNum": 12200, "donAcc_type": "standard", "distance": 2.893, "atom1_id": "///F/146/O", "atom2_id": "///F/150/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1494, "atom1_serNum": 12174, "atom2_serNum": 12205, "donAcc_type": "acceptable", "distance": 2.977, "atom1_id": "///F/146/O", "atom2_id": "///F/150/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1495, "atom1_serNum": 12178, "atom2_serNum": 12207, "donAcc_type": "standard", "distance": 2.839, "atom1_id": "///F/147/O", "atom2_id": "///F/151/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1496, "atom1_serNum": 12194, "atom2_serNum": 12224, "donAcc_type": "standard", "distance": 3.016, "atom1_id": "///F/149/O", "atom2_id": "///F/153/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1497, "atom1_serNum": 12203, "atom2_serNum": 12231, "donAcc_type": "standard", "distance": 3.082, "atom1_id": "///F/150/O", "atom2_id": "///F/154/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1498, "atom1_serNum": 12210, "atom2_serNum": 12239, "donAcc_type": "standard", "distance": 2.999, "atom1_id": "///F/151/O", "atom2_id": "///F/155/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1499, "atom1_serNum": 12219, "atom2_serNum": 12250, "donAcc_type": "standard", "distance": 3.172, "atom1_id": "///F/152/O", "atom2_id": "///F/156/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1500, "atom1_serNum": 12227, "atom2_serNum": 12258, "donAcc_type": "standard", "distance": 2.811, "atom1_id": "///F/153/O", "atom2_id": "///F/157/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1501, "atom1_serNum": 12234, "atom2_serNum": 12266, "donAcc_type": "standard", "distance": 3.181, "atom1_id": "///F/154/O", "atom2_id": "///F/158/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1502, "atom1_serNum": 12234, "atom2_serNum": 12853, "donAcc_type": "acceptable", "distance": 2.815, "atom1_id": "///F/154/O", "atom2_id": "///F/230/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1503, "atom1_serNum": 12253, "atom2_serNum": 12274, "donAcc_type": "standard", "distance": 2.979, "atom1_id": "///F/156/O", "atom2_id": "///F/159/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1504, "atom1_serNum": 12253, "atom2_serNum": 12285, "donAcc_type": "standard", "distance": 2.895, "atom1_id": "///F/156/O", "atom2_id": "///F/160/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1505, "atom1_serNum": 12261, "atom2_serNum": 12293, "donAcc_type": "standard", "distance": 3.137, "atom1_id": "///F/157/O", "atom2_id": "///F/161/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1506, "atom1_serNum": 12261, "atom2_serNum": 12883, "donAcc_type": "acceptable", "distance": 2.674, "atom1_id": "///F/157/O", "atom2_id": "///F/234/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1507, "atom1_serNum": 12269, "atom2_serNum": 12298, "donAcc_type": "standard", "distance": 3.162, "atom1_id": "///F/158/O", "atom2_id": "///F/162/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1508, "atom1_serNum": 12277, "atom2_serNum": 12307, "donAcc_type": "standard", "distance": 2.994, "atom1_id": "///F/159/O", "atom2_id": "///F/163/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1509, "atom1_serNum": 12284, "atom2_serNum": 20447, "donAcc_type": "standard", "distance": 2.948, "atom1_id": "///F/159/NH2", "atom2_id": "///H/107/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1510, "atom1_serNum": 12288, "atom2_serNum": 12315, "donAcc_type": "standard", "distance": 3.282, "atom1_id": "///F/160/O", "atom2_id": "///F/164/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1511, "atom1_serNum": 12296, "atom2_serNum": 12322, "donAcc_type": "standard", "distance": 3.207, "atom1_id": "///F/161/O", "atom2_id": "///F/165/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1512, "atom1_serNum": 12301, "atom2_serNum": 12329, "donAcc_type": "standard", "distance": 2.976, "atom1_id": "///F/162/O", "atom2_id": "///F/166/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1513, "atom1_serNum": 12301, "atom2_serNum": 12336, "donAcc_type": "standard", "distance": 2.839, "atom1_id": "///F/162/O", "atom2_id": "///F/167/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1514, "atom1_serNum": 12305, "atom2_serNum": 20439, "donAcc_type": "standard", "distance": 3.459, "atom1_id": "///F/162/OE1", "atom2_id": "///H/106/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1515, "atom1_serNum": 12305, "atom2_serNum": 20474, "donAcc_type": "standard", "distance": 3.053, "atom1_id": "///F/162/OE1", "atom2_id": "///H/110/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1516, "atom1_serNum": 12306, "atom2_serNum": 20474, "donAcc_type": "standard", "distance": 3.198, "atom1_id": "///F/162/OE2", "atom2_id": "///H/110/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1517, "atom1_serNum": 12310, "atom2_serNum": 12356, "donAcc_type": "standard", "distance": 2.609, "atom1_id": "///F/163/O", "atom2_id": "///F/169/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1518, "atom1_serNum": 12310, "atom2_serNum": 12361, "donAcc_type": "acceptable", "distance": 2.748, "atom1_id": "///F/163/O", "atom2_id": "///F/169/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1519, "atom1_serNum": 12313, "atom2_serNum": 20439, "donAcc_type": "standard", "distance": 2.473, "atom1_id": "///F/163/OD1", "atom2_id": "///H/106/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1520, "atom1_serNum": 12313, "atom2_serNum": 20440, "donAcc_type": "standard", "distance": 2.975, "atom1_id": "///F/163/OD1", "atom2_id": "///H/106/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1521, "atom1_serNum": 12318, "atom2_serNum": 12414, "donAcc_type": "standard", "distance": 3.861, "atom1_id": "///F/164/O", "atom2_id": "///F/175/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1522, "atom1_serNum": 12374, "atom2_serNum": 12394, "donAcc_type": "standard", "distance": 2.852, "atom1_id": "///F/171/O", "atom2_id": "///F/174/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1523, "atom1_serNum": 12374, "atom2_serNum": 12405, "donAcc_type": "standard", "distance": 2.766, "atom1_id": "///F/171/O", "atom2_id": "///F/175/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1524, "atom1_serNum": 12381, "atom2_serNum": 12416, "donAcc_type": "standard", "distance": 2.965, "atom1_id": "///F/172/O", "atom2_id": "///F/176/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1525, "atom1_serNum": 12397, "atom2_serNum": 12435, "donAcc_type": "standard", "distance": 3.473, "atom1_id": "///F/174/O", "atom2_id": "///F/178/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1526, "atom1_serNum": 12408, "atom2_serNum": 12443, "donAcc_type": "standard", "distance": 3.392, "atom1_id": "///F/175/O", "atom2_id": "///F/179/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1527, "atom1_serNum": 12414, "atom2_serNum": 12451, "donAcc_type": "questionable", "distance": 3.097, "atom1_id": "///F/175/NH1", "atom2_id": "///F/179/NE2", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 1528, "atom1_serNum": 12419, "atom2_serNum": 12452, "donAcc_type": "standard", "distance": 3.135, "atom1_id": "///F/176/O", "atom2_id": "///F/180/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1529, "atom1_serNum": 12430, "atom2_serNum": 12461, "donAcc_type": "standard", "distance": 3.067, "atom1_id": "///F/177/O", "atom2_id": "///F/181/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1530, "atom1_serNum": 12430, "atom2_serNum": 12466, "donAcc_type": "acceptable", "distance": 2.402, "atom1_id": "///F/177/O", "atom2_id": "///F/181/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1531, "atom1_serNum": 12438, "atom2_serNum": 12468, "donAcc_type": "standard", "distance": 2.751, "atom1_id": "///F/178/O", "atom2_id": "///F/182/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1532, "atom1_serNum": 12446, "atom2_serNum": 12476, "donAcc_type": "standard", "distance": 2.998, "atom1_id": "///F/179/O", "atom2_id": "///F/183/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1533, "atom1_serNum": 12446, "atom2_serNum": 12481, "donAcc_type": "acceptable", "distance": 2.678, "atom1_id": "///F/179/O", "atom2_id": "///F/183/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1534, "atom1_serNum": 12455, "atom2_serNum": 12483, "donAcc_type": "standard", "distance": 2.894, "atom1_id": "///F/180/O", "atom2_id": "///F/184/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1535, "atom1_serNum": 12464, "atom2_serNum": 12492, "donAcc_type": "standard", "distance": 2.919, "atom1_id": "///F/181/O", "atom2_id": "///F/185/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1536, "atom1_serNum": 12464, "atom2_serNum": 12499, "donAcc_type": "standard", "distance": 2.816, "atom1_id": "///F/181/O", "atom2_id": "///F/185/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1537, "atom1_serNum": 12471, "atom2_serNum": 12500, "donAcc_type": "standard", "distance": 3.004, "atom1_id": "///F/182/O", "atom2_id": "///F/186/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1538, "atom1_serNum": 12479, "atom2_serNum": 12500, "donAcc_type": "standard", "distance": 2.971, "atom1_id": "///F/183/O", "atom2_id": "///F/186/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1539, "atom1_serNum": 12486, "atom2_serNum": 12527, "donAcc_type": "standard", "distance": 3.429, "atom1_id": "///F/184/O", "atom2_id": "///F/188/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1540, "atom1_serNum": 12495, "atom2_serNum": 12517, "donAcc_type": "standard", "distance": 2.854, "atom1_id": "///F/185/O", "atom2_id": "///F/188/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1541, "atom1_serNum": 12495, "atom2_serNum": 12528, "donAcc_type": "standard", "distance": 2.823, "atom1_id": "///F/185/O", "atom2_id": "///F/189/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1542, "atom1_serNum": 12503, "atom2_serNum": 12536, "donAcc_type": "standard", "distance": 2.937, "atom1_id": "///F/186/O", "atom2_id": "///F/190/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1543, "atom1_serNum": 12511, "atom2_serNum": 12547, "donAcc_type": "standard", "distance": 3.051, "atom1_id": "///F/187/O", "atom2_id": "///F/191/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1544, "atom1_serNum": 12520, "atom2_serNum": 12553, "donAcc_type": "standard", "distance": 2.918, "atom1_id": "///F/188/O", "atom2_id": "///F/192/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1545, "atom1_serNum": 12531, "atom2_serNum": 12564, "donAcc_type": "standard", "distance": 3.020, "atom1_id": "///F/189/O", "atom2_id": "///F/193/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1546, "atom1_serNum": 12539, "atom2_serNum": 12572, "donAcc_type": "standard", "distance": 2.975, "atom1_id": "///F/190/O", "atom2_id": "///F/194/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1547, "atom1_serNum": 12550, "atom2_serNum": 12580, "donAcc_type": "standard", "distance": 2.957, "atom1_id": "///F/191/O", "atom2_id": "///F/195/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1548, "atom1_serNum": 12556, "atom2_serNum": 12588, "donAcc_type": "standard", "distance": 3.085, "atom1_id": "///F/192/O", "atom2_id": "///F/196/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1549, "atom1_serNum": 12556, "atom2_serNum": 12593, "donAcc_type": "acceptable", "distance": 2.626, "atom1_id": "///F/192/O", "atom2_id": "///F/196/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1550, "atom1_serNum": 12567, "atom2_serNum": 12595, "donAcc_type": "standard", "distance": 3.008, "atom1_id": "///F/193/O", "atom2_id": "///F/197/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1551, "atom1_serNum": 12575, "atom2_serNum": 12603, "donAcc_type": "standard", "distance": 2.958, "atom1_id": "///F/194/O", "atom2_id": "///F/198/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1552, "atom1_serNum": 12583, "atom2_serNum": 12612, "donAcc_type": "standard", "distance": 2.975, "atom1_id": "///F/195/O", "atom2_id": "///F/199/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1553, "atom1_serNum": 12591, "atom2_serNum": 12621, "donAcc_type": "standard", "distance": 3.086, "atom1_id": "///F/196/O", "atom2_id": "///F/200/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1554, "atom1_serNum": 12591, "atom2_serNum": 12628, "donAcc_type": "standard", "distance": 2.968, "atom1_id": "///F/196/O", "atom2_id": "///F/200/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1555, "atom1_serNum": 12598, "atom2_serNum": 12629, "donAcc_type": "standard", "distance": 2.989, "atom1_id": "///F/197/O", "atom2_id": "///F/201/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1556, "atom1_serNum": 12606, "atom2_serNum": 12636, "donAcc_type": "standard", "distance": 3.263, "atom1_id": "///F/198/O", "atom2_id": "///F/202/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1557, "atom1_serNum": 12615, "atom2_serNum": 12644, "donAcc_type": "standard", "distance": 3.016, "atom1_id": "///F/199/O", "atom2_id": "///F/203/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1558, "atom1_serNum": 12624, "atom2_serNum": 12653, "donAcc_type": "standard", "distance": 3.103, "atom1_id": "///F/200/O", "atom2_id": "///F/204/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1559, "atom1_serNum": 12632, "atom2_serNum": 12653, "donAcc_type": "standard", "distance": 2.868, "atom1_id": "///F/201/O", "atom2_id": "///F/204/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1560, "atom1_serNum": 12632, "atom2_serNum": 12665, "donAcc_type": "standard", "distance": 2.649, "atom1_id": "///F/201/O", "atom2_id": "///F/205/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1561, "atom1_serNum": 12639, "atom2_serNum": 12674, "donAcc_type": "standard", "distance": 3.104, "atom1_id": "///F/202/O", "atom2_id": "///F/206/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1562, "atom1_serNum": 12647, "atom2_serNum": 12683, "donAcc_type": "standard", "distance": 3.134, "atom1_id": "///F/203/O", "atom2_id": "///F/207/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1563, "atom1_serNum": 12656, "atom2_serNum": 12690, "donAcc_type": "standard", "distance": 2.948, "atom1_id": "///F/204/O", "atom2_id": "///F/208/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1564, "atom1_serNum": 12673, "atom2_serNum": 13089, "donAcc_type": "standard", "distance": 2.812, "atom1_id": "///F/205/NE2", "atom2_id": "///F/260/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1565, "atom1_serNum": 12702, "atom2_serNum": 12714, "donAcc_type": "standard", "distance": 2.941, "atom1_id": "///F/209/O", "atom2_id": "///F/211/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1566, "atom1_serNum": 12709, "atom2_serNum": 12727, "donAcc_type": "standard", "distance": 3.181, "atom1_id": "///F/210/O", "atom2_id": "///F/213/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1567, "atom1_serNum": 12712, "atom2_serNum": 12726, "donAcc_type": "acceptable", "distance": 3.154, "atom1_id": "///F/210/OD1", "atom2_id": "///F/212/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1568, "atom1_serNum": 12717, "atom2_serNum": 12719, "donAcc_type": "acceptable", "distance": 3.135, "atom1_id": "///F/211/O", "atom2_id": "///F/211/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1569, "atom1_serNum": 12717, "atom2_serNum": 12744, "donAcc_type": "questionable", "distance": 2.995, "atom1_id": "///F/211/O", "atom2_id": "///F/214/OE2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1570, "atom1_serNum": 12730, "atom2_serNum": 12760, "donAcc_type": "standard", "distance": 3.139, "atom1_id": "///F/213/O", "atom2_id": "///F/217/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1571, "atom1_serNum": 12739, "atom2_serNum": 12765, "donAcc_type": "standard", "distance": 2.942, "atom1_id": "///F/214/O", "atom2_id": "///F/218/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1572, "atom1_serNum": 12748, "atom2_serNum": 12774, "donAcc_type": "standard", "distance": 3.230, "atom1_id": "///F/215/O", "atom2_id": "///F/219/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1573, "atom1_serNum": 12754, "atom2_serNum": 12779, "donAcc_type": "standard", "distance": 3.033, "atom1_id": "///F/216/O", "atom2_id": "///F/220/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1574, "atom1_serNum": 12754, "atom2_serNum": 12786, "donAcc_type": "standard", "distance": 2.896, "atom1_id": "///F/216/O", "atom2_id": "///F/220/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1575, "atom1_serNum": 12763, "atom2_serNum": 12787, "donAcc_type": "standard", "distance": 3.136, "atom1_id": "///F/217/O", "atom2_id": "///F/221/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1576, "atom1_serNum": 12768, "atom2_serNum": 12793, "donAcc_type": "standard", "distance": 3.300, "atom1_id": "///F/218/O", "atom2_id": "///F/222/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1577, "atom1_serNum": 12777, "atom2_serNum": 12804, "donAcc_type": "standard", "distance": 3.253, "atom1_id": "///F/219/O", "atom2_id": "///F/223/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1578, "atom1_serNum": 12790, "atom2_serNum": 12815, "donAcc_type": "standard", "distance": 3.126, "atom1_id": "///F/221/O", "atom2_id": "///F/225/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1579, "atom1_serNum": 12796, "atom2_serNum": 12822, "donAcc_type": "standard", "distance": 3.119, "atom1_id": "///F/222/O", "atom2_id": "///F/226/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1580, "atom1_serNum": 12802, "atom2_serNum": 20495, "donAcc_type": "standard", "distance": 3.560, "atom1_id": "///F/222/NH1", "atom2_id": "///H/113/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1581, "atom1_serNum": 12807, "atom2_serNum": 12827, "donAcc_type": "standard", "distance": 2.844, "atom1_id": "///F/223/O", "atom2_id": "///F/227/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1582, "atom1_serNum": 12814, "atom2_serNum": 12832, "donAcc_type": "standard", "distance": 3.053, "atom1_id": "///F/224/O", "atom2_id": "///F/228/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1583, "atom1_serNum": 12818, "atom2_serNum": 12832, "donAcc_type": "standard", "distance": 2.926, "atom1_id": "///F/225/O", "atom2_id": "///F/228/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1584, "atom1_serNum": 12818, "atom2_serNum": 12840, "donAcc_type": "standard", "distance": 3.039, "atom1_id": "///F/225/O", "atom2_id": "///F/229/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1585, "atom1_serNum": 12825, "atom2_serNum": 12848, "donAcc_type": "standard", "distance": 2.968, "atom1_id": "///F/226/O", "atom2_id": "///F/230/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1586, "atom1_serNum": 12825, "atom2_serNum": 12853, "donAcc_type": "acceptable", "distance": 3.157, "atom1_id": "///F/226/O", "atom2_id": "///F/230/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1587, "atom1_serNum": 12830, "atom2_serNum": 12855, "donAcc_type": "standard", "distance": 2.649, "atom1_id": "///F/227/O", "atom2_id": "///F/231/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1588, "atom1_serNum": 12835, "atom2_serNum": 12855, "donAcc_type": "standard", "distance": 2.608, "atom1_id": "///F/228/O", "atom2_id": "///F/231/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1589, "atom1_serNum": 12835, "atom2_serNum": 12863, "donAcc_type": "standard", "distance": 2.795, "atom1_id": "///F/228/O", "atom2_id": "///F/232/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1590, "atom1_serNum": 12843, "atom2_serNum": 12868, "donAcc_type": "standard", "distance": 3.457, "atom1_id": "///F/229/O", "atom2_id": "///F/233/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1591, "atom1_serNum": 12858, "atom2_serNum": 12872, "donAcc_type": "standard", "distance": 2.953, "atom1_id": "///F/231/O", "atom2_id": "///F/234/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1592, "atom1_serNum": 12858, "atom2_serNum": 12884, "donAcc_type": "standard", "distance": 2.843, "atom1_id": "///F/231/O", "atom2_id": "///F/235/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1593, "atom1_serNum": 12871, "atom2_serNum": 12908, "donAcc_type": "standard", "distance": 3.118, "atom1_id": "///F/233/O", "atom2_id": "///F/237/NE1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1594, "atom1_serNum": 12875, "atom2_serNum": 12914, "donAcc_type": "standard", "distance": 3.365, "atom1_id": "///F/234/O", "atom2_id": "///F/238/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1595, "atom1_serNum": 12887, "atom2_serNum": 13214, "donAcc_type": "standard", "distance": 3.127, "atom1_id": "///F/235/O", "atom2_id": "///F/277/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1596, "atom1_serNum": 12892, "atom2_serNum": 12898, "donAcc_type": "standard", "distance": 2.523, "atom1_id": "///F/236/N", "atom2_id": "///F/236/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1597, "atom1_serNum": 12895, "atom2_serNum": 13212, "donAcc_type": "standard", "distance": 3.034, "atom1_id": "///F/236/O", "atom2_id": "///F/277/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1598, "atom1_serNum": 12917, "atom2_serNum": 13214, "donAcc_type": "standard", "distance": 2.607, "atom1_id": "///F/238/O", "atom2_id": "///F/277/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1599, "atom1_serNum": 12924, "atom2_serNum": 12941, "donAcc_type": "standard", "distance": 3.234, "atom1_id": "///F/239/O", "atom2_id": "///F/242/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1600, "atom1_serNum": 12926, "atom2_serNum": 12940, "donAcc_type": "acceptable", "distance": 2.755, "atom1_id": "///F/239/OG", "atom2_id": "///F/241/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1601, "atom1_serNum": 12930, "atom2_serNum": 12951, "donAcc_type": "standard", "distance": 2.928, "atom1_id": "///F/240/O", "atom2_id": "///F/243/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1602, "atom1_serNum": 12930, "atom2_serNum": 12959, "donAcc_type": "standard", "distance": 2.986, "atom1_id": "///F/240/O", "atom2_id": "///F/244/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1603, "atom1_serNum": 12930, "atom2_serNum": 12964, "donAcc_type": "acceptable", "distance": 3.137, "atom1_id": "///F/240/O", "atom2_id": "///F/244/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1604, "atom1_serNum": 12969, "atom2_serNum": 12980, "donAcc_type": "standard", "distance": 3.090, "atom1_id": "///F/245/O", "atom2_id": "///F/247/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1605, "atom1_serNum": 12979, "atom2_serNum": 13002, "donAcc_type": "standard", "distance": 3.500, "atom1_id": "///F/246/OE2", "atom2_id": "///F/249/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1606, "atom1_serNum": 12991, "atom2_serNum": 13019, "donAcc_type": "standard", "distance": 3.136, "atom1_id": "///F/248/O", "atom2_id": "///F/252/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1607, "atom1_serNum": 12997, "atom2_serNum": 13028, "donAcc_type": "standard", "distance": 2.929, "atom1_id": "///F/249/O", "atom2_id": "///F/253/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1608, "atom1_serNum": 13006, "atom2_serNum": 13036, "donAcc_type": "standard", "distance": 3.134, "atom1_id": "///F/250/O", "atom2_id": "///F/254/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1609, "atom1_serNum": 13014, "atom2_serNum": 13044, "donAcc_type": "standard", "distance": 3.071, "atom1_id": "///F/251/O", "atom2_id": "///F/255/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1610, "atom1_serNum": 13022, "atom2_serNum": 13044, "donAcc_type": "standard", "distance": 3.107, "atom1_id": "///F/252/O", "atom2_id": "///F/255/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1611, "atom1_serNum": 13022, "atom2_serNum": 13050, "donAcc_type": "standard", "distance": 3.136, "atom1_id": "///F/252/O", "atom2_id": "///F/256/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1612, "atom1_serNum": 13031, "atom2_serNum": 13058, "donAcc_type": "standard", "distance": 2.809, "atom1_id": "///F/253/O", "atom2_id": "///F/257/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1613, "atom1_serNum": 13047, "atom2_serNum": 13066, "donAcc_type": "standard", "distance": 2.706, "atom1_id": "///F/255/O", "atom2_id": "///F/258/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1614, "atom1_serNum": 13053, "atom2_serNum": 13074, "donAcc_type": "standard", "distance": 3.482, "atom1_id": "///F/256/O", "atom2_id": "///F/259/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1615, "atom1_serNum": 13061, "atom2_serNum": 13082, "donAcc_type": "standard", "distance": 3.159, "atom1_id": "///F/257/O", "atom2_id": "///F/260/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1616, "atom1_serNum": 13080, "atom2_serNum": 13407, "donAcc_type": "acceptable", "distance": 3.101, "atom1_id": "///F/259/OD1", "atom2_id": "///F/301/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1617, "atom1_serNum": 13081, "atom2_serNum": 13377, "donAcc_type": "standard", "distance": 3.482, "atom1_id": "///F/259/ND2", "atom2_id": "///F/298/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1618, "atom1_serNum": 13085, "atom2_serNum": 13109, "donAcc_type": "standard", "distance": 2.582, "atom1_id": "///F/260/O", "atom2_id": "///F/263/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1619, "atom1_serNum": 13085, "atom2_serNum": 13117, "donAcc_type": "standard", "distance": 3.015, "atom1_id": "///F/260/O", "atom2_id": "///F/264/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1620, "atom1_serNum": 13091, "atom2_serNum": 13098, "donAcc_type": "standard", "distance": 3.245, "atom1_id": "///F/261/N", "atom2_id": "///F/261/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1621, "atom1_serNum": 13108, "atom2_serNum": 13491, "donAcc_type": "standard", "distance": 3.264, "atom1_id": "///F/262/OE2", "atom2_id": "///F/314/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1622, "atom1_serNum": 13112, "atom2_serNum": 13138, "donAcc_type": "standard", "distance": 3.237, "atom1_id": "///F/263/O", "atom2_id": "///F/267/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1623, "atom1_serNum": 13120, "atom2_serNum": 13143, "donAcc_type": "standard", "distance": 2.603, "atom1_id": "///F/264/O", "atom2_id": "///F/268/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1624, "atom1_serNum": 13129, "atom2_serNum": 13148, "donAcc_type": "standard", "distance": 3.044, "atom1_id": "///F/265/O", "atom2_id": "///F/269/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1625, "atom1_serNum": 13137, "atom2_serNum": 13157, "donAcc_type": "standard", "distance": 2.889, "atom1_id": "///F/266/O", "atom2_id": "///F/270/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1626, "atom1_serNum": 13141, "atom2_serNum": 13163, "donAcc_type": "standard", "distance": 2.863, "atom1_id": "///F/267/O", "atom2_id": "///F/271/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1627, "atom1_serNum": 13146, "atom2_serNum": 13171, "donAcc_type": "standard", "distance": 2.881, "atom1_id": "///F/268/O", "atom2_id": "///F/272/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1628, "atom1_serNum": 13151, "atom2_serNum": 13179, "donAcc_type": "standard", "distance": 3.354, "atom1_id": "///F/269/O", "atom2_id": "///F/273/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1629, "atom1_serNum": 13160, "atom2_serNum": 13187, "donAcc_type": "standard", "distance": 3.130, "atom1_id": "///F/270/O", "atom2_id": "///F/274/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1630, "atom1_serNum": 13166, "atom2_serNum": 13192, "donAcc_type": "standard", "distance": 3.120, "atom1_id": "///F/271/O", "atom2_id": "///F/275/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1631, "atom1_serNum": 13174, "atom2_serNum": 13199, "donAcc_type": "standard", "distance": 2.898, "atom1_id": "///F/272/O", "atom2_id": "///F/276/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1632, "atom1_serNum": 13174, "atom2_serNum": 13204, "donAcc_type": "acceptable", "distance": 2.505, "atom1_id": "///F/272/O", "atom2_id": "///F/276/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1633, "atom1_serNum": 13208, "atom2_serNum": 13637, "donAcc_type": "standard", "distance": 3.097, "atom1_id": "///F/277/O", "atom2_id": "///F/332/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1634, "atom1_serNum": 13228, "atom2_serNum": 13272, "donAcc_type": "standard", "distance": 2.894, "atom1_id": "///F/279/O", "atom2_id": "///F/284/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1635, "atom1_serNum": 13232, "atom2_serNum": 13262, "donAcc_type": "questionable", "distance": 2.559, "atom1_id": "///F/280/O", "atom2_id": "///F/283/OD2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1636, "atom1_serNum": 13241, "atom2_serNum": 13263, "donAcc_type": "standard", "distance": 2.879, "atom1_id": "///F/281/O", "atom2_id": "///F/284/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1637, "atom1_serNum": 13266, "atom2_serNum": 13290, "donAcc_type": "standard", "distance": 2.554, "atom1_id": "///F/284/O", "atom2_id": "///F/287/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1638, "atom1_serNum": 13270, "atom2_serNum": 13636, "donAcc_type": "standard", "distance": 3.228, "atom1_id": "///F/284/NE", "atom2_id": "///F/332/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1639, "atom1_serNum": 13273, "atom2_serNum": 13636, "donAcc_type": "standard", "distance": 2.742, "atom1_id": "///F/284/NH2", "atom2_id": "///F/332/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1640, "atom1_serNum": 13277, "atom2_serNum": 13298, "donAcc_type": "standard", "distance": 3.219, "atom1_id": "///F/285/O", "atom2_id": "///F/288/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1641, "atom1_serNum": 13286, "atom2_serNum": 13306, "donAcc_type": "standard", "distance": 3.477, "atom1_id": "///F/286/O", "atom2_id": "///F/289/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1642, "atom1_serNum": 13293, "atom2_serNum": 13313, "donAcc_type": "standard", "distance": 3.377, "atom1_id": "///F/287/O", "atom2_id": "///F/290/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1643, "atom1_serNum": 13301, "atom2_serNum": 13321, "donAcc_type": "standard", "distance": 2.949, "atom1_id": "///F/288/O", "atom2_id": "///F/291/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1644, "atom1_serNum": 13309, "atom2_serNum": 13332, "donAcc_type": "standard", "distance": 2.651, "atom1_id": "///F/289/O", "atom2_id": "///F/292/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1645, "atom1_serNum": 13335, "atom2_serNum": 13356, "donAcc_type": "standard", "distance": 2.915, "atom1_id": "///F/292/O", "atom2_id": "///F/296/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1646, "atom1_serNum": 13347, "atom2_serNum": 13364, "donAcc_type": "standard", "distance": 3.201, "atom1_id": "///F/294/O", "atom2_id": "///F/297/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1647, "atom1_serNum": 13347, "atom2_serNum": 13374, "donAcc_type": "standard", "distance": 3.591, "atom1_id": "///F/294/O", "atom2_id": "///F/298/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1648, "atom1_serNum": 13354, "atom2_serNum": 13374, "donAcc_type": "standard", "distance": 2.947, "atom1_id": "///F/295/O", "atom2_id": "///F/298/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1649, "atom1_serNum": 13354, "atom2_serNum": 13386, "donAcc_type": "standard", "distance": 2.990, "atom1_id": "///F/295/O", "atom2_id": "///F/299/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1650, "atom1_serNum": 13359, "atom2_serNum": 13394, "donAcc_type": "standard", "distance": 2.925, "atom1_id": "///F/296/O", "atom2_id": "///F/300/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1651, "atom1_serNum": 13367, "atom2_serNum": 13402, "donAcc_type": "standard", "distance": 3.197, "atom1_id": "///F/297/O", "atom2_id": "///F/301/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1652, "atom1_serNum": 13377, "atom2_serNum": 13408, "donAcc_type": "standard", "distance": 3.202, "atom1_id": "///F/298/O", "atom2_id": "///F/302/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1653, "atom1_serNum": 13389, "atom2_serNum": 13413, "donAcc_type": "standard", "distance": 3.150, "atom1_id": "///F/299/O", "atom2_id": "///F/303/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1654, "atom1_serNum": 13397, "atom2_serNum": 13418, "donAcc_type": "standard", "distance": 2.819, "atom1_id": "///F/300/O", "atom2_id": "///F/304/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1655, "atom1_serNum": 13411, "atom2_serNum": 13432, "donAcc_type": "acceptable", "distance": 2.382, "atom1_id": "///F/302/O", "atom2_id": "///F/305/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1656, "atom1_serNum": 13430, "atom2_serNum": 13439, "donAcc_type": "standard", "distance": 2.473, "atom1_id": "///F/305/O", "atom2_id": "///F/307/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1657, "atom1_serNum": 13430, "atom2_serNum": 13501, "donAcc_type": "standard", "distance": 2.155, "atom1_id": "///F/305/O", "atom2_id": "///F/315/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1658, "atom1_serNum": 13450, "atom2_serNum": 13455, "donAcc_type": "standard", "distance": 2.851, "atom1_id": "///F/308/O", "atom2_id": "///F/310/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1659, "atom1_serNum": 13458, "atom2_serNum": 13467, "donAcc_type": "standard", "distance": 3.044, "atom1_id": "///F/310/O", "atom2_id": "///F/312/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1660, "atom1_serNum": 13470, "atom2_serNum": 13492, "donAcc_type": "standard", "distance": 2.757, "atom1_id": "///F/312/O", "atom2_id": "///F/315/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1661, "atom1_serNum": 13470, "atom2_serNum": 13502, "donAcc_type": "standard", "distance": 2.900, "atom1_id": "///F/312/O", "atom2_id": "///F/316/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1662, "atom1_serNum": 13477, "atom2_serNum": 13514, "donAcc_type": "standard", "distance": 3.188, "atom1_id": "///F/313/O", "atom2_id": "///F/317/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1663, "atom1_serNum": 13482, "atom2_serNum": 20951, "donAcc_type": "standard", "distance": 3.102, "atom1_id": "///F/313/OE2", "atom2_id": "///H/167/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1664, "atom1_serNum": 13486, "atom2_serNum": 13521, "donAcc_type": "standard", "distance": 3.178, "atom1_id": "///F/314/O", "atom2_id": "///F/318/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1665, "atom1_serNum": 13495, "atom2_serNum": 13532, "donAcc_type": "standard", "distance": 2.909, "atom1_id": "///F/315/O", "atom2_id": "///F/319/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1666, "atom1_serNum": 13505, "atom2_serNum": 13540, "donAcc_type": "standard", "distance": 2.879, "atom1_id": "///F/316/O", "atom2_id": "///F/320/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1667, "atom1_serNum": 13513, "atom2_serNum": 13878, "donAcc_type": "acceptable", "distance": 2.741, "atom1_id": "///F/316/OH", "atom2_id": "///F/364/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1668, "atom1_serNum": 13513, "atom2_serNum": 14371, "donAcc_type": "acceptable", "distance": 3.108, "atom1_id": "///F/316/OH", "atom2_id": "///F/425/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1669, "atom1_serNum": 13513, "atom2_serNum": 14372, "donAcc_type": "acceptable", "distance": 2.340, "atom1_id": "///F/316/OH", "atom2_id": "///F/425/OD2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1670, "atom1_serNum": 13524, "atom2_serNum": 13549, "donAcc_type": "standard", "distance": 2.751, "atom1_id": "///F/318/O", "atom2_id": "///F/321/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1671, "atom1_serNum": 13524, "atom2_serNum": 13560, "donAcc_type": "standard", "distance": 2.885, "atom1_id": "///F/318/O", "atom2_id": "///F/322/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1672, "atom1_serNum": 13535, "atom2_serNum": 13568, "donAcc_type": "standard", "distance": 2.914, "atom1_id": "///F/319/O", "atom2_id": "///F/323/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1673, "atom1_serNum": 13543, "atom2_serNum": 13582, "donAcc_type": "standard", "distance": 2.781, "atom1_id": "///F/320/O", "atom2_id": "///F/324/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1674, "atom1_serNum": 13552, "atom2_serNum": 13583, "donAcc_type": "standard", "distance": 3.153, "atom1_id": "///F/321/O", "atom2_id": "///F/325/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1675, "atom1_serNum": 13563, "atom2_serNum": 13590, "donAcc_type": "standard", "distance": 3.142, "atom1_id": "///F/322/O", "atom2_id": "///F/326/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1676, "atom1_serNum": 13571, "atom2_serNum": 13590, "donAcc_type": "standard", "distance": 2.809, "atom1_id": "///F/323/O", "atom2_id": "///F/326/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1677, "atom1_serNum": 13571, "atom2_serNum": 13598, "donAcc_type": "standard", "distance": 2.853, "atom1_id": "///F/323/O", "atom2_id": "///F/327/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1678, "atom1_serNum": 13577, "atom2_serNum": 13604, "donAcc_type": "standard", "distance": 2.917, "atom1_id": "///F/324/O", "atom2_id": "///F/328/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1679, "atom1_serNum": 13586, "atom2_serNum": 13609, "donAcc_type": "standard", "distance": 2.948, "atom1_id": "///F/325/O", "atom2_id": "///F/329/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1680, "atom1_serNum": 13593, "atom2_serNum": 13617, "donAcc_type": "standard", "distance": 3.023, "atom1_id": "///F/326/O", "atom2_id": "///F/330/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1681, "atom1_serNum": 13593, "atom2_serNum": 13783, "donAcc_type": "acceptable", "distance": 2.529, "atom1_id": "///F/326/O", "atom2_id": "///F/352/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1682, "atom1_serNum": 13601, "atom2_serNum": 13621, "donAcc_type": "standard", "distance": 3.000, "atom1_id": "///F/327/O", "atom2_id": "///F/331/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1683, "atom1_serNum": 13601, "atom2_serNum": 13627, "donAcc_type": "questionable", "distance": 2.668, "atom1_id": "///F/327/O", "atom2_id": "///F/331/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1684, "atom1_serNum": 13601, "atom2_serNum": 13959, "donAcc_type": "acceptable", "distance": 3.202, "atom1_id": "///F/327/O", "atom2_id": "///F/374/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1685, "atom1_serNum": 13607, "atom2_serNum": 13629, "donAcc_type": "standard", "distance": 3.010, "atom1_id": "///F/328/O", "atom2_id": "///F/332/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1686, "atom1_serNum": 13612, "atom2_serNum": 13638, "donAcc_type": "standard", "distance": 3.276, "atom1_id": "///F/329/O", "atom2_id": "///F/333/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1687, "atom1_serNum": 13620, "atom2_serNum": 13646, "donAcc_type": "standard", "distance": 3.054, "atom1_id": "///F/330/O", "atom2_id": "///F/334/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1688, "atom1_serNum": 13624, "atom2_serNum": 13652, "donAcc_type": "standard", "distance": 3.150, "atom1_id": "///F/331/O", "atom2_id": "///F/335/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1689, "atom1_serNum": 13627, "atom2_serNum": 13959, "donAcc_type": "acceptable", "distance": 2.838, "atom1_id": "///F/331/OD1", "atom2_id": "///F/374/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1690, "atom1_serNum": 13632, "atom2_serNum": 13657, "donAcc_type": "standard", "distance": 3.111, "atom1_id": "///F/332/O", "atom2_id": "///F/336/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1691, "atom1_serNum": 13641, "atom2_serNum": 13657, "donAcc_type": "standard", "distance": 2.750, "atom1_id": "///F/333/O", "atom2_id": "///F/336/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1692, "atom1_serNum": 13641, "atom2_serNum": 13665, "donAcc_type": "standard", "distance": 2.738, "atom1_id": "///F/333/O", "atom2_id": "///F/337/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1693, "atom1_serNum": 13649, "atom2_serNum": 14023, "donAcc_type": "standard", "distance": 2.982, "atom1_id": "///F/334/O", "atom2_id": "///F/381/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1694, "atom1_serNum": 13660, "atom2_serNum": 13690, "donAcc_type": "standard", "distance": 3.854, "atom1_id": "///F/336/O", "atom2_id": "///F/341/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1695, "atom1_serNum": 13668, "atom2_serNum": 13682, "donAcc_type": "standard", "distance": 2.933, "atom1_id": "///F/337/O", "atom2_id": "///F/340/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1696, "atom1_serNum": 13673, "atom2_serNum": 14023, "donAcc_type": "questionable", "distance": 3.060, "atom1_id": "///F/338/N", "atom2_id": "///F/381/NE2", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 1697, "atom1_serNum": 13680, "atom2_serNum": 13690, "donAcc_type": "standard", "distance": 2.682, "atom1_id": "///F/339/O", "atom2_id": "///F/341/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1698, "atom1_serNum": 13685, "atom2_serNum": 13696, "donAcc_type": "standard", "distance": 2.770, "atom1_id": "///F/340/O", "atom2_id": "///F/342/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1699, "atom1_serNum": 13693, "atom2_serNum": 13704, "donAcc_type": "standard", "distance": 2.948, "atom1_id": "///F/341/O", "atom2_id": "///F/343/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1700, "atom1_serNum": 13699, "atom2_serNum": 13711, "donAcc_type": "standard", "distance": 3.033, "atom1_id": "///F/342/O", "atom2_id": "///F/344/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1701, "atom1_serNum": 13740, "atom2_serNum": 13746, "donAcc_type": "standard", "distance": 2.607, "atom1_id": "///F/348/N", "atom2_id": "///F/348/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1702, "atom1_serNum": 13743, "atom2_serNum": 13763, "donAcc_type": "standard", "distance": 2.841, "atom1_id": "///F/348/O", "atom2_id": "///F/351/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1703, "atom1_serNum": 13743, "atom2_serNum": 13772, "donAcc_type": "standard", "distance": 2.848, "atom1_id": "///F/348/O", "atom2_id": "///F/352/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1704, "atom1_serNum": 13751, "atom2_serNum": 13784, "donAcc_type": "standard", "distance": 3.036, "atom1_id": "///F/349/O", "atom2_id": "///F/353/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1705, "atom1_serNum": 13762, "atom2_serNum": 13792, "donAcc_type": "standard", "distance": 3.012, "atom1_id": "///F/350/O", "atom2_id": "///F/354/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1706, "atom1_serNum": 13766, "atom2_serNum": 13801, "donAcc_type": "standard", "distance": 3.088, "atom1_id": "///F/351/O", "atom2_id": "///F/355/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1707, "atom1_serNum": 13775, "atom2_serNum": 13807, "donAcc_type": "standard", "distance": 2.612, "atom1_id": "///F/352/O", "atom2_id": "///F/356/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1708, "atom1_serNum": 13787, "atom2_serNum": 13818, "donAcc_type": "standard", "distance": 2.785, "atom1_id": "///F/353/O", "atom2_id": "///F/357/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1709, "atom1_serNum": 13804, "atom2_serNum": 13831, "donAcc_type": "standard", "distance": 3.769, "atom1_id": "///F/355/O", "atom2_id": "///F/359/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1710, "atom1_serNum": 13810, "atom2_serNum": 13831, "donAcc_type": "standard", "distance": 3.143, "atom1_id": "///F/356/O", "atom2_id": "///F/359/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1711, "atom1_serNum": 13810, "atom2_serNum": 13842, "donAcc_type": "standard", "distance": 3.391, "atom1_id": "///F/356/O", "atom2_id": "///F/360/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1712, "atom1_serNum": 13810, "atom2_serNum": 13847, "donAcc_type": "acceptable", "distance": 3.160, "atom1_id": "///F/356/O", "atom2_id": "///F/360/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1713, "atom1_serNum": 13821, "atom2_serNum": 13842, "donAcc_type": "standard", "distance": 2.842, "atom1_id": "///F/357/O", "atom2_id": "///F/360/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1714, "atom1_serNum": 13821, "atom2_serNum": 13849, "donAcc_type": "standard", "distance": 3.167, "atom1_id": "///F/357/O", "atom2_id": "///F/361/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1715, "atom1_serNum": 13829, "atom2_serNum": 13854, "donAcc_type": "acceptable", "distance": 2.943, "atom1_id": "///F/358/O", "atom2_id": "///F/361/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1716, "atom1_serNum": 13845, "atom2_serNum": 14206, "donAcc_type": "standard", "distance": 3.656, "atom1_id": "///F/360/O", "atom2_id": "///F/404/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1717, "atom1_serNum": 13847, "atom2_serNum": 13969, "donAcc_type": "acceptable", "distance": 3.004, "atom1_id": "///F/360/OG1", "atom2_id": "///F/375/NE1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1718, "atom1_serNum": 13869, "atom2_serNum": 13879, "donAcc_type": "standard", "distance": 3.255, "atom1_id": "///F/363/O", "atom2_id": "///F/365/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1719, "atom1_serNum": 13869, "atom2_serNum": 14309, "donAcc_type": "acceptable", "distance": 2.670, "atom1_id": "///F/363/O", "atom2_id": "///F/418/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1720, "atom1_serNum": 13876, "atom2_serNum": 13907, "donAcc_type": "standard", "distance": 3.161, "atom1_id": "///F/364/O", "atom2_id": "///F/368/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1721, "atom1_serNum": 13878, "atom2_serNum": 13899, "donAcc_type": "acceptable", "distance": 2.960, "atom1_id": "///F/364/OG", "atom2_id": "///F/367/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1722, "atom1_serNum": 13882, "atom2_serNum": 13918, "donAcc_type": "standard", "distance": 2.998, "atom1_id": "///F/365/O", "atom2_id": "///F/369/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1723, "atom1_serNum": 13882, "atom2_serNum": 13923, "donAcc_type": "acceptable", "distance": 2.782, "atom1_id": "///F/365/O", "atom2_id": "///F/369/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1724, "atom1_serNum": 13891, "atom2_serNum": 13924, "donAcc_type": "standard", "distance": 3.087, "atom1_id": "///F/366/O", "atom2_id": "///F/370/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1725, "atom1_serNum": 13891, "atom2_serNum": 13929, "donAcc_type": "acceptable", "distance": 2.954, "atom1_id": "///F/366/O", "atom2_id": "///F/370/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1726, "atom1_serNum": 13902, "atom2_serNum": 13930, "donAcc_type": "standard", "distance": 3.574, "atom1_id": "///F/367/O", "atom2_id": "///F/371/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1727, "atom1_serNum": 13910, "atom2_serNum": 13930, "donAcc_type": "standard", "distance": 2.904, "atom1_id": "///F/368/O", "atom2_id": "///F/371/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1728, "atom1_serNum": 13910, "atom2_serNum": 13935, "donAcc_type": "acceptable", "distance": 2.512, "atom1_id": "///F/368/O", "atom2_id": "///F/371/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1729, "atom1_serNum": 13910, "atom2_serNum": 13945, "donAcc_type": "standard", "distance": 3.488, "atom1_id": "///F/368/O", "atom2_id": "///F/372/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1730, "atom1_serNum": 13917, "atom2_serNum": 14309, "donAcc_type": "acceptable", "distance": 3.151, "atom1_id": "///F/368/NH2", "atom2_id": "///F/418/OG", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1731, "atom1_serNum": 13923, "atom2_serNum": 14488, "donAcc_type": "acceptable", "distance": 3.004, "atom1_id": "///F/369/OG", "atom2_id": "///F/439/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1732, "atom1_serNum": 13933, "atom2_serNum": 13954, "donAcc_type": "standard", "distance": 3.139, "atom1_id": "///F/371/O", "atom2_id": "///F/374/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1733, "atom1_serNum": 13933, "atom2_serNum": 13961, "donAcc_type": "standard", "distance": 3.180, "atom1_id": "///F/371/O", "atom2_id": "///F/375/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1734, "atom1_serNum": 13940, "atom2_serNum": 13975, "donAcc_type": "standard", "distance": 2.858, "atom1_id": "///F/372/O", "atom2_id": "///F/376/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1735, "atom1_serNum": 13944, "atom2_serNum": 14153, "donAcc_type": "acceptable", "distance": 3.121, "atom1_id": "///F/372/OE1", "atom2_id": "///F/397/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1736, "atom1_serNum": 13949, "atom2_serNum": 13979, "donAcc_type": "standard", "distance": 3.026, "atom1_id": "///F/373/O", "atom2_id": "///F/377/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1737, "atom1_serNum": 13957, "atom2_serNum": 13984, "donAcc_type": "standard", "distance": 2.757, "atom1_id": "///F/374/O", "atom2_id": "///F/378/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1738, "atom1_serNum": 13964, "atom2_serNum": 13992, "donAcc_type": "standard", "distance": 2.826, "atom1_id": "///F/375/O", "atom2_id": "///F/379/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1739, "atom1_serNum": 13978, "atom2_serNum": 14003, "donAcc_type": "standard", "distance": 3.341, "atom1_id": "///F/376/O", "atom2_id": "///F/380/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1740, "atom1_serNum": 14017, "atom2_serNum": 14041, "donAcc_type": "standard", "distance": 3.001, "atom1_id": "///F/381/O", "atom2_id": "///F/384/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1741, "atom1_serNum": 14017, "atom2_serNum": 14049, "donAcc_type": "standard", "distance": 2.582, "atom1_id": "///F/381/O", "atom2_id": "///F/385/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1742, "atom1_serNum": 14017, "atom2_serNum": 14054, "donAcc_type": "acceptable", "distance": 2.445, "atom1_id": "///F/381/O", "atom2_id": "///F/385/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1743, "atom1_serNum": 14027, "atom2_serNum": 14062, "donAcc_type": "standard", "distance": 3.697, "atom1_id": "///F/382/O", "atom2_id": "///F/386/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1744, "atom1_serNum": 14044, "atom2_serNum": 14066, "donAcc_type": "standard", "distance": 2.712, "atom1_id": "///F/384/O", "atom2_id": "///F/387/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1745, "atom1_serNum": 14058, "atom2_serNum": 14074, "donAcc_type": "standard", "distance": 3.129, "atom1_id": "///F/386/O", "atom2_id": "///F/388/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1746, "atom1_serNum": 14069, "atom2_serNum": 14089, "donAcc_type": "standard", "distance": 2.690, "atom1_id": "///F/387/O", "atom2_id": "///F/390/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1747, "atom1_serNum": 14069, "atom2_serNum": 14097, "donAcc_type": "standard", "distance": 3.142, "atom1_id": "///F/387/O", "atom2_id": "///F/391/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1748, "atom1_serNum": 14077, "atom2_serNum": 14105, "donAcc_type": "standard", "distance": 2.923, "atom1_id": "///F/388/O", "atom2_id": "///F/392/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1749, "atom1_serNum": 14092, "atom2_serNum": 14110, "donAcc_type": "standard", "distance": 2.975, "atom1_id": "///F/390/O", "atom2_id": "///F/393/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1750, "atom1_serNum": 14113, "atom2_serNum": 14142, "donAcc_type": "standard", "distance": 2.897, "atom1_id": "///F/393/O", "atom2_id": "///F/397/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1751, "atom1_serNum": 14121, "atom2_serNum": 14154, "donAcc_type": "standard", "distance": 2.732, "atom1_id": "///F/394/O", "atom2_id": "///F/398/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1752, "atom1_serNum": 14129, "atom2_serNum": 14162, "donAcc_type": "standard", "distance": 3.046, "atom1_id": "///F/395/O", "atom2_id": "///F/399/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1753, "atom1_serNum": 14136, "atom2_serNum": 14173, "donAcc_type": "standard", "distance": 3.355, "atom1_id": "///F/396/O", "atom2_id": "///F/400/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1754, "atom1_serNum": 14145, "atom2_serNum": 14178, "donAcc_type": "standard", "distance": 3.154, "atom1_id": "///F/397/O", "atom2_id": "///F/401/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1755, "atom1_serNum": 14145, "atom2_serNum": 14183, "donAcc_type": "acceptable", "distance": 3.019, "atom1_id": "///F/397/O", "atom2_id": "///F/401/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1756, "atom1_serNum": 14157, "atom2_serNum": 14184, "donAcc_type": "standard", "distance": 3.117, "atom1_id": "///F/398/O", "atom2_id": "///F/402/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1757, "atom1_serNum": 14165, "atom2_serNum": 14197, "donAcc_type": "acceptable", "distance": 3.632, "atom1_id": "///F/399/O", "atom2_id": "///F/403/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1758, "atom1_serNum": 14176, "atom2_serNum": 14199, "donAcc_type": "standard", "distance": 2.959, "atom1_id": "///F/400/O", "atom2_id": "///F/404/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1759, "atom1_serNum": 14181, "atom2_serNum": 14207, "donAcc_type": "standard", "distance": 2.981, "atom1_id": "///F/401/O", "atom2_id": "///F/405/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1760, "atom1_serNum": 14181, "atom2_serNum": 14522, "donAcc_type": "standard", "distance": 3.753, "atom1_id": "///F/401/O", "atom2_id": "///F/443/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1761, "atom1_serNum": 14187, "atom2_serNum": 14207, "donAcc_type": "standard", "distance": 3.138, "atom1_id": "///F/402/O", "atom2_id": "///F/405/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1762, "atom1_serNum": 14210, "atom2_serNum": 14496, "donAcc_type": "standard", "distance": 3.141, "atom1_id": "///F/405/O", "atom2_id": "///F/440/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1763, "atom1_serNum": 14218, "atom2_serNum": 14231, "donAcc_type": "standard", "distance": 2.858, "atom1_id": "///F/406/O", "atom2_id": "///F/408/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1764, "atom1_serNum": 14230, "atom2_serNum": 14475, "donAcc_type": "standard", "distance": 3.118, "atom1_id": "///F/407/NZ", "atom2_id": "///F/437/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1765, "atom1_serNum": 14239, "atom2_serNum": 14289, "donAcc_type": "standard", "distance": 3.851, "atom1_id": "///F/409/N", "atom2_id": "///F/415/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1766, "atom1_serNum": 14242, "atom2_serNum": 14342, "donAcc_type": "acceptable", "distance": 3.119, "atom1_id": "///F/409/O", "atom2_id": "///F/422/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1767, "atom1_serNum": 14246, "atom2_serNum": 14267, "donAcc_type": "standard", "distance": 3.013, "atom1_id": "///F/410/O", "atom2_id": "///F/413/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1768, "atom1_serNum": 14257, "atom2_serNum": 14267, "donAcc_type": "standard", "distance": 2.822, "atom1_id": "///F/411/O", "atom2_id": "///F/413/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1769, "atom1_serNum": 14257, "atom2_serNum": 14352, "donAcc_type": "standard", "distance": 2.863, "atom1_id": "///F/411/O", "atom2_id": "///F/423/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1770, "atom1_serNum": 14261, "atom2_serNum": 14405, "donAcc_type": "standard", "distance": 2.979, "atom1_id": "///F/412/N", "atom2_id": "///F/429/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1771, "atom1_serNum": 14266, "atom2_serNum": 14404, "donAcc_type": "acceptable", "distance": 2.660, "atom1_id": "///F/412/OG", "atom2_id": "///F/429/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1772, "atom1_serNum": 14279, "atom2_serNum": 14281, "donAcc_type": "acceptable", "distance": 2.643, "atom1_id": "///F/414/O", "atom2_id": "///F/414/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1773, "atom1_serNum": 14289, "atom2_serNum": 14291, "donAcc_type": "standard", "distance": 3.059, "atom1_id": "///F/415/OD1", "atom2_id": "///F/416/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1774, "atom1_serNum": 14294, "atom2_serNum": 14310, "donAcc_type": "standard", "distance": 2.823, "atom1_id": "///F/416/O", "atom2_id": "///F/419/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1775, "atom1_serNum": 14296, "atom2_serNum": 14304, "donAcc_type": "acceptable", "distance": 3.070, "atom1_id": "///F/416/OG", "atom2_id": "///F/418/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1776, "atom1_serNum": 14307, "atom2_serNum": 14337, "donAcc_type": "standard", "distance": 3.263, "atom1_id": "///F/418/O", "atom2_id": "///F/422/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1777, "atom1_serNum": 14307, "atom2_serNum": 14342, "donAcc_type": "acceptable", "distance": 2.542, "atom1_id": "///F/418/O", "atom2_id": "///F/422/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1778, "atom1_serNum": 14313, "atom2_serNum": 14343, "donAcc_type": "standard", "distance": 3.075, "atom1_id": "///F/419/O", "atom2_id": "///F/423/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1779, "atom1_serNum": 14319, "atom2_serNum": 14354, "donAcc_type": "standard", "distance": 3.200, "atom1_id": "///F/420/O", "atom2_id": "///F/424/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1780, "atom1_serNum": 14323, "atom2_serNum": 14350, "donAcc_type": "standard", "distance": 3.277, "atom1_id": "///F/420/OE1", "atom2_id": "///F/423/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1781, "atom1_serNum": 14323, "atom2_serNum": 14353, "donAcc_type": "standard", "distance": 2.987, "atom1_id": "///F/420/OE1", "atom2_id": "///F/423/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1782, "atom1_serNum": 14328, "atom2_serNum": 14365, "donAcc_type": "standard", "distance": 3.147, "atom1_id": "///F/421/O", "atom2_id": "///F/425/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1783, "atom1_serNum": 14384, "atom2_serNum": 14390, "donAcc_type": "standard", "distance": 2.658, "atom1_id": "///F/427/N", "atom2_id": "///F/427/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1784, "atom1_serNum": 14390, "atom2_serNum": 20755, "donAcc_type": "standard", "distance": 3.255, "atom1_id": "///F/427/OD1", "atom2_id": "///H/145/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1785, "atom1_serNum": 14391, "atom2_serNum": 20878, "donAcc_type": "standard", "distance": 2.889, "atom1_id": "///F/427/OD2", "atom2_id": "///H/159/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1786, "atom1_serNum": 14395, "atom2_serNum": 14423, "donAcc_type": "standard", "distance": 3.265, "atom1_id": "///F/428/O", "atom2_id": "///F/432/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1787, "atom1_serNum": 14397, "atom2_serNum": 14406, "donAcc_type": "acceptable", "distance": 3.332, "atom1_id": "///F/428/OG", "atom2_id": "///F/430/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1788, "atom1_serNum": 14397, "atom2_serNum": 14422, "donAcc_type": "acceptable", "distance": 3.169, "atom1_id": "///F/428/OG", "atom2_id": "///F/431/OD2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1789, "atom1_serNum": 14398, "atom2_serNum": 14405, "donAcc_type": "standard", "distance": 2.715, "atom1_id": "///F/429/N", "atom2_id": "///F/429/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1790, "atom1_serNum": 14401, "atom2_serNum": 14434, "donAcc_type": "standard", "distance": 2.760, "atom1_id": "///F/429/O", "atom2_id": "///F/433/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1791, "atom1_serNum": 14401, "atom2_serNum": 14441, "donAcc_type": "standard", "distance": 3.274, "atom1_id": "///F/429/O", "atom2_id": "///F/433/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1792, "atom1_serNum": 14406, "atom2_serNum": 14413, "donAcc_type": "standard", "distance": 2.505, "atom1_id": "///F/430/N", "atom2_id": "///F/430/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1793, "atom1_serNum": 14409, "atom2_serNum": 14442, "donAcc_type": "standard", "distance": 3.044, "atom1_id": "///F/430/O", "atom2_id": "///F/434/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1794, "atom1_serNum": 14418, "atom2_serNum": 14447, "donAcc_type": "standard", "distance": 3.151, "atom1_id": "///F/431/O", "atom2_id": "///F/435/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1795, "atom1_serNum": 14426, "atom2_serNum": 14458, "donAcc_type": "standard", "distance": 2.777, "atom1_id": "///F/432/O", "atom2_id": "///F/436/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1796, "atom1_serNum": 14437, "atom2_serNum": 14469, "donAcc_type": "standard", "distance": 2.665, "atom1_id": "///F/433/O", "atom2_id": "///F/437/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1797, "atom1_serNum": 14440, "atom2_serNum": 14476, "donAcc_type": "standard", "distance": 3.686, "atom1_id": "///F/433/OD1", "atom2_id": "///F/437/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1798, "atom1_serNum": 14445, "atom2_serNum": 14477, "donAcc_type": "standard", "distance": 3.252, "atom1_id": "///F/434/O", "atom2_id": "///F/438/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1799, "atom1_serNum": 14445, "atom2_serNum": 14482, "donAcc_type": "acceptable", "distance": 3.044, "atom1_id": "///F/434/O", "atom2_id": "///F/438/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1800, "atom1_serNum": 14450, "atom2_serNum": 14482, "donAcc_type": "acceptable", "distance": 3.104, "atom1_id": "///F/435/O", "atom2_id": "///F/438/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1801, "atom1_serNum": 14450, "atom2_serNum": 14483, "donAcc_type": "standard", "distance": 2.809, "atom1_id": "///F/435/O", "atom2_id": "///F/439/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1802, "atom1_serNum": 14461, "atom2_serNum": 14489, "donAcc_type": "standard", "distance": 2.969, "atom1_id": "///F/436/O", "atom2_id": "///F/440/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1803, "atom1_serNum": 14472, "atom2_serNum": 14500, "donAcc_type": "standard", "distance": 3.197, "atom1_id": "///F/437/O", "atom2_id": "///F/441/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1804, "atom1_serNum": 14480, "atom2_serNum": 14505, "donAcc_type": "standard", "distance": 3.483, "atom1_id": "///F/438/O", "atom2_id": "///F/442/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1805, "atom1_serNum": 14486, "atom2_serNum": 14514, "donAcc_type": "standard", "distance": 2.813, "atom1_id": "///F/439/O", "atom2_id": "///F/443/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1806, "atom1_serNum": 14492, "atom2_serNum": 14523, "donAcc_type": "standard", "distance": 2.540, "atom1_id": "///F/440/O", "atom2_id": "///F/444/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1807, "atom1_serNum": 14503, "atom2_serNum": 14527, "donAcc_type": "standard", "distance": 3.630, "atom1_id": "///F/441/O", "atom2_id": "///F/445/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1808, "atom1_serNum": 14508, "atom2_serNum": 14536, "donAcc_type": "standard", "distance": 3.452, "atom1_id": "///F/442/O", "atom2_id": "///F/446/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1809, "atom1_serNum": 14517, "atom2_serNum": 14543, "donAcc_type": "standard", "distance": 3.035, "atom1_id": "///F/443/O", "atom2_id": "///F/447/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1810, "atom1_serNum": 14526, "atom2_serNum": 14543, "donAcc_type": "standard", "distance": 3.201, "atom1_id": "///F/444/O", "atom2_id": "///F/447/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1811, "atom1_serNum": 14530, "atom2_serNum": 14562, "donAcc_type": "standard", "distance": 3.661, "atom1_id": "///F/445/O", "atom2_id": "///F/449/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1812, "atom1_serNum": 14539, "atom2_serNum": 14570, "donAcc_type": "standard", "distance": 3.405, "atom1_id": "///F/446/O", "atom2_id": "///F/450/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1813, "atom1_serNum": 14546, "atom2_serNum": 14575, "donAcc_type": "standard", "distance": 3.058, "atom1_id": "///F/447/O", "atom2_id": "///F/451/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1814, "atom1_serNum": 14554, "atom2_serNum": 14581, "donAcc_type": "standard", "distance": 2.838, "atom1_id": "///F/448/O", "atom2_id": "///F/452/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1815, "atom1_serNum": 14565, "atom2_serNum": 14592, "donAcc_type": "standard", "distance": 3.290, "atom1_id": "///F/449/O", "atom2_id": "///F/453/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1816, "atom1_serNum": 14573, "atom2_serNum": 14592, "donAcc_type": "standard", "distance": 2.930, "atom1_id": "///F/450/O", "atom2_id": "///F/453/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1817, "atom1_serNum": 14573, "atom2_serNum": 14600, "donAcc_type": "standard", "distance": 3.065, "atom1_id": "///F/450/O", "atom2_id": "///F/454/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1818, "atom1_serNum": 14603, "atom2_serNum": 14636, "donAcc_type": "acceptable", "distance": 3.046, "atom1_id": "///F/454/O", "atom2_id": "///F/458/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1819, "atom1_serNum": 14606, "atom2_serNum": 14615, "donAcc_type": "standard", "distance": 3.507, "atom1_id": "///F/454/OD1", "atom2_id": "///F/456/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1820, "atom1_serNum": 14606, "atom2_serNum": 14624, "donAcc_type": "standard", "distance": 3.054, "atom1_id": "///F/454/OD1", "atom2_id": "///F/457/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1821, "atom1_serNum": 14606, "atom2_serNum": 14629, "donAcc_type": "acceptable", "distance": 2.636, "atom1_id": "///F/454/OD1", "atom2_id": "///F/457/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1822, "atom1_serNum": 14607, "atom2_serNum": 14629, "donAcc_type": "acceptable", "distance": 3.017, "atom1_id": "///F/454/OD2", "atom2_id": "///F/457/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1823, "atom1_serNum": 14618, "atom2_serNum": 14648, "donAcc_type": "standard", "distance": 3.185, "atom1_id": "///F/456/O", "atom2_id": "///F/460/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1824, "atom1_serNum": 14627, "atom2_serNum": 14657, "donAcc_type": "standard", "distance": 3.032, "atom1_id": "///F/457/O", "atom2_id": "///F/461/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1825, "atom1_serNum": 14634, "atom2_serNum": 14665, "donAcc_type": "standard", "distance": 3.006, "atom1_id": "///F/458/O", "atom2_id": "///F/462/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1826, "atom1_serNum": 14640, "atom2_serNum": 14670, "donAcc_type": "standard", "distance": 2.683, "atom1_id": "///F/459/O", "atom2_id": "///F/463/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1827, "atom1_serNum": 14651, "atom2_serNum": 14674, "donAcc_type": "standard", "distance": 2.849, "atom1_id": "///F/460/O", "atom2_id": "///F/464/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1828, "atom1_serNum": 14660, "atom2_serNum": 14683, "donAcc_type": "standard", "distance": 2.996, "atom1_id": "///F/461/O", "atom2_id": "///F/465/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1829, "atom1_serNum": 14668, "atom2_serNum": 14697, "donAcc_type": "standard", "distance": 3.273, "atom1_id": "///F/462/O", "atom2_id": "///F/466/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1830, "atom1_serNum": 14673, "atom2_serNum": 14705, "donAcc_type": "standard", "distance": 3.138, "atom1_id": "///F/463/O", "atom2_id": "///F/467/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1831, "atom1_serNum": 14677, "atom2_serNum": 14714, "donAcc_type": "standard", "distance": 3.162, "atom1_id": "///F/464/O", "atom2_id": "///F/468/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1832, "atom1_serNum": 14682, "atom2_serNum": 14713, "donAcc_type": "standard", "distance": 3.395, "atom1_id": "///F/464/OE2", "atom2_id": "///F/467/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1833, "atom1_serNum": 14686, "atom2_serNum": 14726, "donAcc_type": "standard", "distance": 2.840, "atom1_id": "///F/465/O", "atom2_id": "///F/469/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1834, "atom1_serNum": 14700, "atom2_serNum": 14735, "donAcc_type": "standard", "distance": 3.021, "atom1_id": "///F/466/O", "atom2_id": "///F/470/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1835, "atom1_serNum": 14708, "atom2_serNum": 14748, "donAcc_type": "acceptable", "distance": 3.712, "atom1_id": "///F/467/O", "atom2_id": "///F/471/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1836, "atom1_serNum": 14717, "atom2_serNum": 14743, "donAcc_type": "standard", "distance": 3.285, "atom1_id": "///F/468/O", "atom2_id": "///F/471/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1837, "atom1_serNum": 14717, "atom2_serNum": 14754, "donAcc_type": "acceptable", "distance": 2.994, "atom1_id": "///F/468/O", "atom2_id": "///F/472/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1838, "atom1_serNum": 14772, "atom2_serNum": 17406, "donAcc_type": "acceptable", "distance": 2.735, "atom1_id": "///F/491/OG", "atom2_id": "///F/824/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1839, "atom1_serNum": 14790, "atom2_serNum": 17406, "donAcc_type": "standard", "distance": 3.245, "atom1_id": "///F/494/O", "atom2_id": "///F/824/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1840, "atom1_serNum": 14814, "atom2_serNum": 14830, "donAcc_type": "standard", "distance": 2.946, "atom1_id": "///F/497/O", "atom2_id": "///F/500/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1841, "atom1_serNum": 14814, "atom2_serNum": 14841, "donAcc_type": "standard", "distance": 3.288, "atom1_id": "///F/497/O", "atom2_id": "///F/501/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1842, "atom1_serNum": 14816, "atom2_serNum": 14829, "donAcc_type": "acceptable", "distance": 3.495, "atom1_id": "///F/497/OG", "atom2_id": "///F/499/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1843, "atom1_serNum": 14820, "atom2_serNum": 14848, "donAcc_type": "standard", "distance": 3.284, "atom1_id": "///F/498/O", "atom2_id": "///F/502/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1844, "atom1_serNum": 14827, "atom2_serNum": 14857, "donAcc_type": "standard", "distance": 2.726, "atom1_id": "///F/499/O", "atom2_id": "///F/503/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1845, "atom1_serNum": 14833, "atom2_serNum": 14871, "donAcc_type": "standard", "distance": 2.962, "atom1_id": "///F/500/O", "atom2_id": "///F/504/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1846, "atom1_serNum": 14844, "atom2_serNum": 14880, "donAcc_type": "standard", "distance": 3.209, "atom1_id": "///F/501/O", "atom2_id": "///F/505/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1847, "atom1_serNum": 14851, "atom2_serNum": 14885, "donAcc_type": "standard", "distance": 3.186, "atom1_id": "///F/502/O", "atom2_id": "///F/506/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1848, "atom1_serNum": 14860, "atom2_serNum": 14893, "donAcc_type": "standard", "distance": 2.798, "atom1_id": "///F/503/O", "atom2_id": "///F/507/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1849, "atom1_serNum": 14860, "atom2_serNum": 14898, "donAcc_type": "acceptable", "distance": 2.702, "atom1_id": "///F/503/O", "atom2_id": "///F/507/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1850, "atom1_serNum": 14874, "atom2_serNum": 14900, "donAcc_type": "standard", "distance": 3.082, "atom1_id": "///F/504/O", "atom2_id": "///F/508/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1851, "atom1_serNum": 14883, "atom2_serNum": 14908, "donAcc_type": "standard", "distance": 3.100, "atom1_id": "///F/505/O", "atom2_id": "///F/509/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1852, "atom1_serNum": 14888, "atom2_serNum": 14919, "donAcc_type": "standard", "distance": 3.012, "atom1_id": "///F/506/O", "atom2_id": "///F/510/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1853, "atom1_serNum": 14896, "atom2_serNum": 14927, "donAcc_type": "standard", "distance": 2.881, "atom1_id": "///F/507/O", "atom2_id": "///F/511/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1854, "atom1_serNum": 14898, "atom2_serNum": 15285, "donAcc_type": "acceptable", "distance": 3.478, "atom1_id": "///F/507/OG1", "atom2_id": "///F/555/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1855, "atom1_serNum": 14903, "atom2_serNum": 14936, "donAcc_type": "standard", "distance": 3.202, "atom1_id": "///F/508/O", "atom2_id": "///F/512/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1856, "atom1_serNum": 14911, "atom2_serNum": 14942, "donAcc_type": "standard", "distance": 2.840, "atom1_id": "///F/509/O", "atom2_id": "///F/513/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1857, "atom1_serNum": 14922, "atom2_serNum": 14942, "donAcc_type": "standard", "distance": 2.739, "atom1_id": "///F/510/O", "atom2_id": "///F/513/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1858, "atom1_serNum": 14922, "atom2_serNum": 14949, "donAcc_type": "standard", "distance": 2.836, "atom1_id": "///F/510/O", "atom2_id": "///F/514/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1859, "atom1_serNum": 14930, "atom2_serNum": 14962, "donAcc_type": "acceptable", "distance": 2.638, "atom1_id": "///F/511/O", "atom2_id": "///F/515/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1860, "atom1_serNum": 14939, "atom2_serNum": 14964, "donAcc_type": "standard", "distance": 3.291, "atom1_id": "///F/512/O", "atom2_id": "///F/516/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1861, "atom1_serNum": 14945, "atom2_serNum": 14973, "donAcc_type": "standard", "distance": 2.953, "atom1_id": "///F/513/O", "atom2_id": "///F/517/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1862, "atom1_serNum": 14952, "atom2_serNum": 14981, "donAcc_type": "standard", "distance": 3.075, "atom1_id": "///F/514/O", "atom2_id": "///F/518/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1863, "atom1_serNum": 14967, "atom2_serNum": 15003, "donAcc_type": "standard", "distance": 3.357, "atom1_id": "///F/516/O", "atom2_id": "///F/520/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1864, "atom1_serNum": 14967, "atom2_serNum": 15008, "donAcc_type": "acceptable", "distance": 3.233, "atom1_id": "///F/516/O", "atom2_id": "///F/520/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1865, "atom1_serNum": 14976, "atom2_serNum": 15010, "donAcc_type": "standard", "distance": 3.267, "atom1_id": "///F/517/O", "atom2_id": "///F/521/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1866, "atom1_serNum": 15021, "atom2_serNum": 15046, "donAcc_type": "standard", "distance": 2.596, "atom1_id": "///F/522/O", "atom2_id": "///F/525/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1867, "atom1_serNum": 15021, "atom2_serNum": 15055, "donAcc_type": "standard", "distance": 3.390, "atom1_id": "///F/522/O", "atom2_id": "///F/526/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1868, "atom1_serNum": 15025, "atom2_serNum": 15053, "donAcc_type": "standard", "distance": 2.607, "atom1_id": "///F/522/ND2", "atom2_id": "///F/525/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1869, "atom1_serNum": 15036, "atom2_serNum": 15366, "donAcc_type": "acceptable", "distance": 2.745, "atom1_id": "///F/523/NH2", "atom2_id": "///F/565/OH", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1870, "atom1_serNum": 15046, "atom2_serNum": 15053, "donAcc_type": "standard", "distance": 2.711, "atom1_id": "///F/525/N", "atom2_id": "///F/525/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1871, "atom1_serNum": 15066, "atom2_serNum": 15093, "donAcc_type": "standard", "distance": 3.152, "atom1_id": "///F/527/O", "atom2_id": "///F/531/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1872, "atom1_serNum": 15073, "atom2_serNum": 15097, "donAcc_type": "standard", "distance": 3.187, "atom1_id": "///F/528/O", "atom2_id": "///F/532/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1873, "atom1_serNum": 15077, "atom2_serNum": 15083, "donAcc_type": "standard", "distance": 2.814, "atom1_id": "///F/529/N", "atom2_id": "///F/529/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1874, "atom1_serNum": 15080, "atom2_serNum": 15105, "donAcc_type": "standard", "distance": 2.832, "atom1_id": "///F/529/O", "atom2_id": "///F/533/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1875, "atom1_serNum": 15088, "atom2_serNum": 15114, "donAcc_type": "standard", "distance": 3.210, "atom1_id": "///F/530/O", "atom2_id": "///F/534/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1876, "atom1_serNum": 15096, "atom2_serNum": 15122, "donAcc_type": "standard", "distance": 3.073, "atom1_id": "///F/531/O", "atom2_id": "///F/535/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1877, "atom1_serNum": 15100, "atom2_serNum": 15130, "donAcc_type": "standard", "distance": 2.864, "atom1_id": "///F/532/O", "atom2_id": "///F/536/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1878, "atom1_serNum": 15108, "atom2_serNum": 15139, "donAcc_type": "standard", "distance": 3.288, "atom1_id": "///F/533/O", "atom2_id": "///F/537/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1879, "atom1_serNum": 15117, "atom2_serNum": 15147, "donAcc_type": "standard", "distance": 2.964, "atom1_id": "///F/534/O", "atom2_id": "///F/538/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1880, "atom1_serNum": 15125, "atom2_serNum": 15154, "donAcc_type": "standard", "distance": 2.972, "atom1_id": "///F/535/O", "atom2_id": "///F/539/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1881, "atom1_serNum": 15133, "atom2_serNum": 15154, "donAcc_type": "standard", "distance": 2.822, "atom1_id": "///F/536/O", "atom2_id": "///F/539/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1882, "atom1_serNum": 15133, "atom2_serNum": 15162, "donAcc_type": "standard", "distance": 2.759, "atom1_id": "///F/536/O", "atom2_id": "///F/540/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1883, "atom1_serNum": 15150, "atom2_serNum": 15170, "donAcc_type": "standard", "distance": 3.333, "atom1_id": "///F/538/O", "atom2_id": "///F/541/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1884, "atom1_serNum": 15157, "atom2_serNum": 15461, "donAcc_type": "standard", "distance": 2.758, "atom1_id": "///F/539/O", "atom2_id": "///F/576/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1885, "atom1_serNum": 15169, "atom2_serNum": 15428, "donAcc_type": "questionable", "distance": 3.260, "atom1_id": "///F/540/ND2", "atom2_id": "///F/572/NE2", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 1886, "atom1_serNum": 15173, "atom2_serNum": 15461, "donAcc_type": "standard", "distance": 2.990, "atom1_id": "///F/541/O", "atom2_id": "///F/576/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1887, "atom1_serNum": 15187, "atom2_serNum": 15189, "donAcc_type": "standard", "distance": 2.939, "atom1_id": "///F/542/OD1", "atom2_id": "///F/543/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1888, "atom1_serNum": 15199, "atom2_serNum": 15526, "donAcc_type": "questionable", "distance": 3.356, "atom1_id": "///F/544/O", "atom2_id": "///F/584/OE2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1889, "atom1_serNum": 15208, "atom2_serNum": 15236, "donAcc_type": "standard", "distance": 2.775, "atom1_id": "///F/545/O", "atom2_id": "///F/549/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1890, "atom1_serNum": 15211, "atom2_serNum": 15220, "donAcc_type": "standard", "distance": 3.127, "atom1_id": "///F/545/OD1", "atom2_id": "///F/547/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1891, "atom1_serNum": 15216, "atom2_serNum": 15244, "donAcc_type": "standard", "distance": 2.953, "atom1_id": "///F/546/O", "atom2_id": "///F/550/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1892, "atom1_serNum": 15231, "atom2_serNum": 15256, "donAcc_type": "standard", "distance": 3.121, "atom1_id": "///F/548/O", "atom2_id": "///F/552/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1893, "atom1_serNum": 15239, "atom2_serNum": 15263, "donAcc_type": "standard", "distance": 2.798, "atom1_id": "///F/549/O", "atom2_id": "///F/553/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1894, "atom1_serNum": 15247, "atom2_serNum": 15276, "donAcc_type": "acceptable", "distance": 2.846, "atom1_id": "///F/550/O", "atom2_id": "///F/554/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1895, "atom1_serNum": 15247, "atom2_serNum": 15684, "donAcc_type": "standard", "distance": 3.355, "atom1_id": "///F/550/O", "atom2_id": "///F/603/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1896, "atom1_serNum": 15253, "atom2_serNum": 15278, "donAcc_type": "standard", "distance": 2.817, "atom1_id": "///F/551/O", "atom2_id": "///F/555/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1897, "atom1_serNum": 15259, "atom2_serNum": 15278, "donAcc_type": "standard", "distance": 2.848, "atom1_id": "///F/552/O", "atom2_id": "///F/555/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1898, "atom1_serNum": 15259, "atom2_serNum": 15286, "donAcc_type": "standard", "distance": 2.842, "atom1_id": "///F/552/O", "atom2_id": "///F/556/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1899, "atom1_serNum": 15266, "atom2_serNum": 15293, "donAcc_type": "standard", "distance": 3.068, "atom1_id": "///F/553/O", "atom2_id": "///F/557/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1900, "atom1_serNum": 15274, "atom2_serNum": 15299, "donAcc_type": "standard", "distance": 2.954, "atom1_id": "///F/554/O", "atom2_id": "///F/558/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1901, "atom1_serNum": 15276, "atom2_serNum": 15684, "donAcc_type": "acceptable", "distance": 2.913, "atom1_id": "///F/554/OG1", "atom2_id": "///F/603/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1902, "atom1_serNum": 15281, "atom2_serNum": 15304, "donAcc_type": "standard", "distance": 3.037, "atom1_id": "///F/555/O", "atom2_id": "///F/559/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1903, "atom1_serNum": 15289, "atom2_serNum": 15312, "donAcc_type": "standard", "distance": 2.857, "atom1_id": "///F/556/O", "atom2_id": "///F/560/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1904, "atom1_serNum": 15298, "atom2_serNum": 15707, "donAcc_type": "acceptable", "distance": 3.567, "atom1_id": "///F/557/OG", "atom2_id": "///F/607/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1905, "atom1_serNum": 15307, "atom2_serNum": 15330, "donAcc_type": "standard", "distance": 2.964, "atom1_id": "///F/559/O", "atom2_id": "///F/562/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1906, "atom1_serNum": 15315, "atom2_serNum": 15341, "donAcc_type": "standard", "distance": 2.953, "atom1_id": "///F/560/O", "atom2_id": "///F/563/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1907, "atom1_serNum": 15326, "atom2_serNum": 15353, "donAcc_type": "acceptable", "distance": 3.090, "atom1_id": "///F/561/O", "atom2_id": "///F/564/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1908, "atom1_serNum": 15333, "atom2_serNum": 15355, "donAcc_type": "standard", "distance": 3.280, "atom1_id": "///F/562/O", "atom2_id": "///F/565/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1909, "atom1_serNum": 15344, "atom2_serNum": 15378, "donAcc_type": "standard", "distance": 2.969, "atom1_id": "///F/563/O", "atom2_id": "///F/567/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1910, "atom1_serNum": 15370, "atom2_serNum": 15394, "donAcc_type": "standard", "distance": 3.212, "atom1_id": "///F/566/O", "atom2_id": "///F/569/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1911, "atom1_serNum": 15374, "atom2_serNum": 15393, "donAcc_type": "standard", "distance": 2.778, "atom1_id": "///F/566/NE", "atom2_id": "///F/568/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1912, "atom1_serNum": 15381, "atom2_serNum": 15405, "donAcc_type": "standard", "distance": 3.323, "atom1_id": "///F/567/O", "atom2_id": "///F/570/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1913, "atom1_serNum": 15397, "atom2_serNum": 15429, "donAcc_type": "standard", "distance": 3.093, "atom1_id": "///F/569/O", "atom2_id": "///F/573/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1914, "atom1_serNum": 15408, "atom2_serNum": 15436, "donAcc_type": "standard", "distance": 2.863, "atom1_id": "///F/570/O", "atom2_id": "///F/574/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1915, "atom1_serNum": 15416, "atom2_serNum": 15447, "donAcc_type": "standard", "distance": 2.823, "atom1_id": "///F/571/O", "atom2_id": "///F/575/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1916, "atom1_serNum": 15423, "atom2_serNum": 15453, "donAcc_type": "standard", "distance": 2.905, "atom1_id": "///F/572/O", "atom2_id": "///F/576/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1917, "atom1_serNum": 15432, "atom2_serNum": 15462, "donAcc_type": "standard", "distance": 3.164, "atom1_id": "///F/573/O", "atom2_id": "///F/577/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1918, "atom1_serNum": 15439, "atom2_serNum": 15470, "donAcc_type": "standard", "distance": 2.898, "atom1_id": "///F/574/O", "atom2_id": "///F/578/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1919, "atom1_serNum": 15450, "atom2_serNum": 15481, "donAcc_type": "standard", "distance": 2.897, "atom1_id": "///F/575/O", "atom2_id": "///F/579/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1920, "atom1_serNum": 15450, "atom2_serNum": 15486, "donAcc_type": "acceptable", "distance": 2.886, "atom1_id": "///F/575/O", "atom2_id": "///F/579/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1921, "atom1_serNum": 15456, "atom2_serNum": 15492, "donAcc_type": "acceptable", "distance": 3.547, "atom1_id": "///F/576/O", "atom2_id": "///F/580/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1922, "atom1_serNum": 15465, "atom2_serNum": 15493, "donAcc_type": "standard", "distance": 3.213, "atom1_id": "///F/577/O", "atom2_id": "///F/581/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1923, "atom1_serNum": 15473, "atom2_serNum": 15505, "donAcc_type": "acceptable", "distance": 2.962, "atom1_id": "///F/578/O", "atom2_id": "///F/582/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1924, "atom1_serNum": 15484, "atom2_serNum": 15500, "donAcc_type": "standard", "distance": 3.110, "atom1_id": "///F/579/O", "atom2_id": "///F/582/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1925, "atom1_serNum": 15496, "atom2_serNum": 15660, "donAcc_type": "standard", "distance": 2.793, "atom1_id": "///F/581/O", "atom2_id": "///F/601/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1926, "atom1_serNum": 15496, "atom2_serNum": 15663, "donAcc_type": "standard", "distance": 3.280, "atom1_id": "///F/581/O", "atom2_id": "///F/601/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1927, "atom1_serNum": 15521, "atom2_serNum": 15534, "donAcc_type": "standard", "distance": 2.162, "atom1_id": "///F/584/O", "atom2_id": "///F/586/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1928, "atom1_serNum": 15548, "atom2_serNum": 15574, "donAcc_type": "standard", "distance": 3.007, "atom1_id": "///F/587/OE1", "atom2_id": "///F/591/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1929, "atom1_serNum": 15589, "atom2_serNum": 17420, "donAcc_type": "acceptable", "distance": 2.554, "atom1_id": "///F/593/O", "atom2_id": "///F/826/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1930, "atom1_serNum": 15595, "atom2_serNum": 21973, "donAcc_type": "questionable", "distance": 3.175, "atom1_id": "///F/593/NH1", "atom2_id": "///J/62/N2", "atom_pair": "N:N", "residue_pair": "aa:nt" }, { "index": 1931, "atom1_serNum": 15602, "atom2_serNum": 15620, "donAcc_type": "acceptable", "distance": 3.265, "atom1_id": "///F/594/OG1", "atom2_id": "///F/597/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1932, "atom1_serNum": 15607, "atom2_serNum": 15638, "donAcc_type": "standard", "distance": 2.685, "atom1_id": "///F/595/O", "atom2_id": "///F/599/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1933, "atom1_serNum": 15613, "atom2_serNum": 21935, "donAcc_type": "standard", "distance": 2.803, "atom1_id": "///F/595/NH1", "atom2_id": "///J/61/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 1934, "atom1_serNum": 15615, "atom2_serNum": 17394, "donAcc_type": "standard", "distance": 3.081, "atom1_id": "///F/596/N", "atom2_id": "///F/823/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1935, "atom1_serNum": 15618, "atom2_serNum": 15646, "donAcc_type": "standard", "distance": 3.241, "atom1_id": "///F/596/O", "atom2_id": "///F/600/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1936, "atom1_serNum": 15623, "atom2_serNum": 15653, "donAcc_type": "standard", "distance": 3.197, "atom1_id": "///F/597/O", "atom2_id": "///F/601/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1937, "atom1_serNum": 15630, "atom2_serNum": 15664, "donAcc_type": "standard", "distance": 3.436, "atom1_id": "///F/598/O", "atom2_id": "///F/602/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1938, "atom1_serNum": 15641, "atom2_serNum": 15675, "donAcc_type": "standard", "distance": 2.806, "atom1_id": "///F/599/O", "atom2_id": "///F/603/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1939, "atom1_serNum": 15644, "atom2_serNum": 15673, "donAcc_type": "standard", "distance": 3.445, "atom1_id": "///F/599/OD1", "atom2_id": "///F/602/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1940, "atom1_serNum": 15649, "atom2_serNum": 15685, "donAcc_type": "standard", "distance": 2.945, "atom1_id": "///F/600/O", "atom2_id": "///F/604/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1941, "atom1_serNum": 15656, "atom2_serNum": 15685, "donAcc_type": "standard", "distance": 2.969, "atom1_id": "///F/601/O", "atom2_id": "///F/604/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1942, "atom1_serNum": 15656, "atom2_serNum": 15690, "donAcc_type": "standard", "distance": 2.962, "atom1_id": "///F/601/O", "atom2_id": "///F/605/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1943, "atom1_serNum": 15662, "atom2_serNum": 16016, "donAcc_type": "standard", "distance": 3.311, "atom1_id": "///F/601/NH1", "atom2_id": "///F/644/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1944, "atom1_serNum": 15667, "atom2_serNum": 15696, "donAcc_type": "standard", "distance": 2.806, "atom1_id": "///F/602/O", "atom2_id": "///F/606/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1945, "atom1_serNum": 15667, "atom2_serNum": 15701, "donAcc_type": "acceptable", "distance": 3.167, "atom1_id": "///F/602/O", "atom2_id": "///F/606/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1946, "atom1_serNum": 15674, "atom2_serNum": 21954, "donAcc_type": "standard", "distance": 3.815, "atom1_id": "///F/602/NH2", "atom2_id": "///J/62/OP1", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 1947, "atom1_serNum": 15678, "atom2_serNum": 15702, "donAcc_type": "standard", "distance": 2.869, "atom1_id": "///F/603/O", "atom2_id": "///F/607/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1948, "atom1_serNum": 15678, "atom2_serNum": 15707, "donAcc_type": "acceptable", "distance": 2.948, "atom1_id": "///F/603/O", "atom2_id": "///F/607/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1949, "atom1_serNum": 15688, "atom2_serNum": 15708, "donAcc_type": "standard", "distance": 2.940, "atom1_id": "///F/604/O", "atom2_id": "///F/608/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1950, "atom1_serNum": 15693, "atom2_serNum": 15716, "donAcc_type": "standard", "distance": 3.402, "atom1_id": "///F/605/O", "atom2_id": "///F/609/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1951, "atom1_serNum": 15699, "atom2_serNum": 15724, "donAcc_type": "standard", "distance": 3.061, "atom1_id": "///F/606/O", "atom2_id": "///F/610/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1952, "atom1_serNum": 15705, "atom2_serNum": 15733, "donAcc_type": "standard", "distance": 2.969, "atom1_id": "///F/607/O", "atom2_id": "///F/611/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1953, "atom1_serNum": 15711, "atom2_serNum": 15741, "donAcc_type": "standard", "distance": 3.111, "atom1_id": "///F/608/O", "atom2_id": "///F/612/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1954, "atom1_serNum": 15719, "atom2_serNum": 15747, "donAcc_type": "standard", "distance": 2.686, "atom1_id": "///F/609/O", "atom2_id": "///F/613/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1955, "atom1_serNum": 15727, "atom2_serNum": 15758, "donAcc_type": "standard", "distance": 3.054, "atom1_id": "///F/610/O", "atom2_id": "///F/614/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1956, "atom1_serNum": 15736, "atom2_serNum": 15766, "donAcc_type": "standard", "distance": 2.825, "atom1_id": "///F/611/O", "atom2_id": "///F/615/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1957, "atom1_serNum": 15754, "atom2_serNum": 15765, "donAcc_type": "standard", "distance": 2.762, "atom1_id": "///F/613/NE", "atom2_id": "///F/614/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1958, "atom1_serNum": 15757, "atom2_serNum": 15764, "donAcc_type": "standard", "distance": 3.421, "atom1_id": "///F/613/NH2", "atom2_id": "///F/614/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1959, "atom1_serNum": 15769, "atom2_serNum": 15794, "donAcc_type": "standard", "distance": 3.206, "atom1_id": "///F/615/O", "atom2_id": "///F/618/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1960, "atom1_serNum": 15769, "atom2_serNum": 15802, "donAcc_type": "standard", "distance": 3.524, "atom1_id": "///F/615/O", "atom2_id": "///F/619/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1961, "atom1_serNum": 15781, "atom2_serNum": 15809, "donAcc_type": "standard", "distance": 3.092, "atom1_id": "///F/616/O", "atom2_id": "///F/620/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1962, "atom1_serNum": 15797, "atom2_serNum": 15831, "donAcc_type": "standard", "distance": 3.299, "atom1_id": "///F/618/O", "atom2_id": "///F/622/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1963, "atom1_serNum": 15805, "atom2_serNum": 15824, "donAcc_type": "standard", "distance": 2.971, "atom1_id": "///F/619/O", "atom2_id": "///F/622/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1964, "atom1_serNum": 15812, "atom2_serNum": 15832, "donAcc_type": "standard", "distance": 3.213, "atom1_id": "///F/620/O", "atom2_id": "///F/623/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1965, "atom1_serNum": 15827, "atom2_serNum": 15859, "donAcc_type": "standard", "distance": 3.245, "atom1_id": "///F/622/O", "atom2_id": "///F/626/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1966, "atom1_serNum": 15835, "atom2_serNum": 15867, "donAcc_type": "standard", "distance": 2.888, "atom1_id": "///F/623/O", "atom2_id": "///F/627/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1967, "atom1_serNum": 15843, "atom2_serNum": 15849, "donAcc_type": "standard", "distance": 2.582, "atom1_id": "///F/624/N", "atom2_id": "///F/624/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1968, "atom1_serNum": 15846, "atom2_serNum": 15879, "donAcc_type": "standard", "distance": 2.912, "atom1_id": "///F/624/O", "atom2_id": "///F/628/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1969, "atom1_serNum": 15854, "atom2_serNum": 15887, "donAcc_type": "standard", "distance": 2.921, "atom1_id": "///F/625/O", "atom2_id": "///F/629/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1970, "atom1_serNum": 15862, "atom2_serNum": 15897, "donAcc_type": "standard", "distance": 2.998, "atom1_id": "///F/626/O", "atom2_id": "///F/630/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1971, "atom1_serNum": 15870, "atom2_serNum": 15904, "donAcc_type": "standard", "distance": 2.920, "atom1_id": "///F/627/O", "atom2_id": "///F/631/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1972, "atom1_serNum": 15878, "atom2_serNum": 16243, "donAcc_type": "acceptable", "distance": 3.741, "atom1_id": "///F/627/OH", "atom2_id": "///F/671/OE2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1973, "atom1_serNum": 15882, "atom2_serNum": 15913, "donAcc_type": "standard", "distance": 3.043, "atom1_id": "///F/628/O", "atom2_id": "///F/632/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1974, "atom1_serNum": 15890, "atom2_serNum": 15922, "donAcc_type": "standard", "distance": 2.991, "atom1_id": "///F/629/O", "atom2_id": "///F/633/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1975, "atom1_serNum": 15900, "atom2_serNum": 15930, "donAcc_type": "standard", "distance": 3.052, "atom1_id": "///F/630/O", "atom2_id": "///F/634/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1976, "atom1_serNum": 15907, "atom2_serNum": 15938, "donAcc_type": "standard", "distance": 3.072, "atom1_id": "///F/631/O", "atom2_id": "///F/635/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1977, "atom1_serNum": 15907, "atom2_serNum": 15943, "donAcc_type": "acceptable", "distance": 2.948, "atom1_id": "///F/631/O", "atom2_id": "///F/635/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1978, "atom1_serNum": 15916, "atom2_serNum": 15938, "donAcc_type": "standard", "distance": 2.909, "atom1_id": "///F/632/O", "atom2_id": "///F/635/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1979, "atom1_serNum": 15916, "atom2_serNum": 15943, "donAcc_type": "acceptable", "distance": 2.906, "atom1_id": "///F/632/O", "atom2_id": "///F/635/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1980, "atom1_serNum": 15947, "atom2_serNum": 15969, "donAcc_type": "standard", "distance": 3.155, "atom1_id": "///F/636/O", "atom2_id": "///F/639/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1981, "atom1_serNum": 15955, "atom2_serNum": 16026, "donAcc_type": "standard", "distance": 3.037, "atom1_id": "///F/637/O", "atom2_id": "///F/645/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1982, "atom1_serNum": 15985, "atom2_serNum": 16017, "donAcc_type": "standard", "distance": 2.934, "atom1_id": "///F/641/N", "atom2_id": "///F/644/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1983, "atom1_serNum": 15988, "atom2_serNum": 16018, "donAcc_type": "standard", "distance": 2.753, "atom1_id": "///F/641/O", "atom2_id": "///F/645/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1984, "atom1_serNum": 15990, "atom2_serNum": 21963, "donAcc_type": "acceptable", "distance": 3.057, "atom1_id": "///F/641/OG1", "atom2_id": "///J/62/O2'", "atom_pair": "O:O", "residue_pair": "aa:nt" }, { "index": 1985, "atom1_serNum": 15992, "atom2_serNum": 21978, "donAcc_type": "standard", "distance": 2.684, "atom1_id": "///F/642/N", "atom2_id": "///J/63/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 1986, "atom1_serNum": 15995, "atom2_serNum": 16027, "donAcc_type": "standard", "distance": 3.057, "atom1_id": "///F/642/O", "atom2_id": "///F/646/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1987, "atom1_serNum": 16004, "atom2_serNum": 16033, "donAcc_type": "standard", "distance": 3.030, "atom1_id": "///F/643/O", "atom2_id": "///F/647/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1988, "atom1_serNum": 16012, "atom2_serNum": 16038, "donAcc_type": "standard", "distance": 3.373, "atom1_id": "///F/644/O", "atom2_id": "///F/648/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1989, "atom1_serNum": 16021, "atom2_serNum": 16046, "donAcc_type": "standard", "distance": 3.154, "atom1_id": "///F/645/O", "atom2_id": "///F/649/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1990, "atom1_serNum": 16030, "atom2_serNum": 16054, "donAcc_type": "standard", "distance": 2.977, "atom1_id": "///F/646/O", "atom2_id": "///F/650/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1991, "atom1_serNum": 16036, "atom2_serNum": 16063, "donAcc_type": "standard", "distance": 3.040, "atom1_id": "///F/647/O", "atom2_id": "///F/651/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1992, "atom1_serNum": 16041, "atom2_serNum": 16068, "donAcc_type": "standard", "distance": 2.951, "atom1_id": "///F/648/O", "atom2_id": "///F/652/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1993, "atom1_serNum": 16049, "atom2_serNum": 16076, "donAcc_type": "standard", "distance": 2.927, "atom1_id": "///F/649/O", "atom2_id": "///F/653/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1994, "atom1_serNum": 16057, "atom2_serNum": 16083, "donAcc_type": "standard", "distance": 3.100, "atom1_id": "///F/650/O", "atom2_id": "///F/654/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1995, "atom1_serNum": 16061, "atom2_serNum": 16713, "donAcc_type": "standard", "distance": 2.273, "atom1_id": "///F/650/OE1", "atom2_id": "///F/734/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1996, "atom1_serNum": 16071, "atom2_serNum": 16099, "donAcc_type": "standard", "distance": 3.336, "atom1_id": "///F/652/O", "atom2_id": "///F/656/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1997, "atom1_serNum": 16079, "atom2_serNum": 16099, "donAcc_type": "standard", "distance": 2.932, "atom1_id": "///F/653/O", "atom2_id": "///F/656/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1998, "atom1_serNum": 16079, "atom2_serNum": 16104, "donAcc_type": "acceptable", "distance": 2.641, "atom1_id": "///F/653/O", "atom2_id": "///F/656/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1999, "atom1_serNum": 16079, "atom2_serNum": 16105, "donAcc_type": "standard", "distance": 3.227, "atom1_id": "///F/653/O", "atom2_id": "///F/657/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2000, "atom1_serNum": 16094, "atom2_serNum": 16113, "donAcc_type": "standard", "distance": 3.027, "atom1_id": "///F/655/O", "atom2_id": "///F/658/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2001, "atom1_serNum": 16102, "atom2_serNum": 16122, "donAcc_type": "standard", "distance": 2.880, "atom1_id": "///F/656/O", "atom2_id": "///F/659/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2002, "atom1_serNum": 16108, "atom2_serNum": 16133, "donAcc_type": "standard", "distance": 3.153, "atom1_id": "///F/657/O", "atom2_id": "///F/660/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2003, "atom1_serNum": 16111, "atom2_serNum": 16707, "donAcc_type": "questionable", "distance": 2.821, "atom1_id": "///F/657/OD1", "atom2_id": "///F/734/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 2004, "atom1_serNum": 16142, "atom2_serNum": 16190, "donAcc_type": "questionable", "distance": 2.892, "atom1_id": "///F/661/N", "atom2_id": "///F/665/NE2", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 2005, "atom1_serNum": 16145, "atom2_serNum": 16171, "donAcc_type": "standard", "distance": 3.038, "atom1_id": "///F/661/O", "atom2_id": "///F/664/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2006, "atom1_serNum": 16145, "atom2_serNum": 16182, "donAcc_type": "standard", "distance": 3.098, "atom1_id": "///F/661/O", "atom2_id": "///F/665/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2007, "atom1_serNum": 16148, "atom2_serNum": 16162, "donAcc_type": "standard", "distance": 3.274, "atom1_id": "///F/661/OD1", "atom2_id": "///F/663/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2008, "atom1_serNum": 16148, "atom2_serNum": 16171, "donAcc_type": "standard", "distance": 3.106, "atom1_id": "///F/661/OD1", "atom2_id": "///F/664/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2009, "atom1_serNum": 16150, "atom2_serNum": 16812, "donAcc_type": "standard", "distance": 2.960, "atom1_id": "///F/662/N", "atom2_id": "///F/747/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2010, "atom1_serNum": 16153, "atom2_serNum": 16191, "donAcc_type": "standard", "distance": 2.841, "atom1_id": "///F/662/O", "atom2_id": "///F/666/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2011, "atom1_serNum": 16165, "atom2_serNum": 16200, "donAcc_type": "standard", "distance": 2.820, "atom1_id": "///F/663/O", "atom2_id": "///F/667/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2012, "atom1_serNum": 16174, "atom2_serNum": 16207, "donAcc_type": "standard", "distance": 3.106, "atom1_id": "///F/664/O", "atom2_id": "///F/668/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2013, "atom1_serNum": 16185, "atom2_serNum": 16218, "donAcc_type": "standard", "distance": 3.201, "atom1_id": "///F/665/O", "atom2_id": "///F/669/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2014, "atom1_serNum": 16194, "atom2_serNum": 16226, "donAcc_type": "standard", "distance": 3.308, "atom1_id": "///F/666/O", "atom2_id": "///F/670/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2015, "atom1_serNum": 16203, "atom2_serNum": 16235, "donAcc_type": "standard", "distance": 3.138, "atom1_id": "///F/667/O", "atom2_id": "///F/671/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2016, "atom1_serNum": 16210, "atom2_serNum": 16244, "donAcc_type": "standard", "distance": 2.692, "atom1_id": "///F/668/O", "atom2_id": "///F/672/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2017, "atom1_serNum": 16221, "atom2_serNum": 16252, "donAcc_type": "standard", "distance": 2.879, "atom1_id": "///F/669/O", "atom2_id": "///F/673/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2018, "atom1_serNum": 16234, "atom2_serNum": 16962, "donAcc_type": "questionable", "distance": 2.955, "atom1_id": "///F/670/OE2", "atom2_id": "///F/767/OE2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 2019, "atom1_serNum": 16238, "atom2_serNum": 16260, "donAcc_type": "standard", "distance": 3.154, "atom1_id": "///F/671/O", "atom2_id": "///F/674/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2020, "atom1_serNum": 16255, "atom2_serNum": 16279, "donAcc_type": "standard", "distance": 2.947, "atom1_id": "///F/673/O", "atom2_id": "///F/677/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2021, "atom1_serNum": 16263, "atom2_serNum": 16284, "donAcc_type": "standard", "distance": 3.228, "atom1_id": "///F/674/O", "atom2_id": "///F/678/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2022, "atom1_serNum": 16263, "atom2_serNum": 16289, "donAcc_type": "acceptable", "distance": 2.906, "atom1_id": "///F/674/O", "atom2_id": "///F/678/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 2023, "atom1_serNum": 16268, "atom2_serNum": 16284, "donAcc_type": "standard", "distance": 2.879, "atom1_id": "///F/675/O", "atom2_id": "///F/678/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2024, "atom1_serNum": 16268, "atom2_serNum": 16290, "donAcc_type": "standard", "distance": 3.043, "atom1_id": "///F/675/O", "atom2_id": "///F/679/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2025, "atom1_serNum": 16275, "atom2_serNum": 16298, "donAcc_type": "standard", "distance": 3.114, "atom1_id": "///F/676/O", "atom2_id": "///F/680/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2026, "atom1_serNum": 16282, "atom2_serNum": 16312, "donAcc_type": "standard", "distance": 3.024, "atom1_id": "///F/677/O", "atom2_id": "///F/681/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2027, "atom1_serNum": 16293, "atom2_serNum": 16325, "donAcc_type": "acceptable", "distance": 2.636, "atom1_id": "///F/679/O", "atom2_id": "///F/682/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 2028, "atom1_serNum": 16306, "atom2_serNum": 17000, "donAcc_type": "standard", "distance": 3.249, "atom1_id": "///F/680/NE1", "atom2_id": "///F/772/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2029, "atom1_serNum": 16323, "atom2_serNum": 16343, "donAcc_type": "standard", "distance": 2.978, "atom1_id": "///F/682/O", "atom2_id": "///F/685/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2030, "atom1_serNum": 16323, "atom2_serNum": 16351, "donAcc_type": "standard", "distance": 3.041, "atom1_id": "///F/682/O", "atom2_id": "///F/686/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2031, "atom1_serNum": 16325, "atom2_serNum": 16342, "donAcc_type": "acceptable", "distance": 3.362, "atom1_id": "///F/682/OG", "atom2_id": "///F/684/OD2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 2032, "atom1_serNum": 16329, "atom2_serNum": 16361, "donAcc_type": "standard", "distance": 3.499, "atom1_id": "///F/683/O", "atom2_id": "///F/687/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2033, "atom1_serNum": 16338, "atom2_serNum": 16372, "donAcc_type": "standard", "distance": 3.047, "atom1_id": "///F/684/O", "atom2_id": "///F/688/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2034, "atom1_serNum": 16342, "atom2_serNum": 16343, "donAcc_type": "standard", "distance": 2.648, "atom1_id": "///F/684/OD2", "atom2_id": "///F/685/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2035, "atom1_serNum": 16346, "atom2_serNum": 16372, "donAcc_type": "standard", "distance": 2.849, "atom1_id": "///F/685/O", "atom2_id": "///F/688/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2036, "atom1_serNum": 16346, "atom2_serNum": 16379, "donAcc_type": "standard", "distance": 2.878, "atom1_id": "///F/685/O", "atom2_id": "///F/689/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2037, "atom1_serNum": 16354, "atom2_serNum": 16387, "donAcc_type": "standard", "distance": 2.965, "atom1_id": "///F/686/O", "atom2_id": "///F/690/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2038, "atom1_serNum": 16354, "atom2_serNum": 16392, "donAcc_type": "acceptable", "distance": 2.754, "atom1_id": "///F/686/O", "atom2_id": "///F/690/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 2039, "atom1_serNum": 16357, "atom2_serNum": 16392, "donAcc_type": "acceptable", "distance": 2.927, "atom1_id": "///F/686/ND1", "atom2_id": "///F/690/OG", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2040, "atom1_serNum": 16364, "atom2_serNum": 16393, "donAcc_type": "standard", "distance": 2.959, "atom1_id": "///F/687/O", "atom2_id": "///F/691/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2041, "atom1_serNum": 16382, "atom2_serNum": 17082, "donAcc_type": "acceptable", "distance": 2.304, "atom1_id": "///F/689/O", "atom2_id": "///F/782/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 2042, "atom1_serNum": 16399, "atom2_serNum": 16401, "donAcc_type": "standard", "distance": 2.780, "atom1_id": "///F/691/OD1", "atom2_id": "///F/692/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2043, "atom1_serNum": 16399, "atom2_serNum": 16408, "donAcc_type": "standard", "distance": 2.608, "atom1_id": "///F/691/OD1", "atom2_id": "///F/693/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2044, "atom1_serNum": 16399, "atom2_serNum": 16416, "donAcc_type": "standard", "distance": 3.643, "atom1_id": "///F/691/OD1", "atom2_id": "///F/694/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2045, "atom1_serNum": 16411, "atom2_serNum": 16432, "donAcc_type": "standard", "distance": 2.708, "atom1_id": "///F/693/O", "atom2_id": "///F/696/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2046, "atom1_serNum": 16411, "atom2_serNum": 16440, "donAcc_type": "standard", "distance": 2.959, "atom1_id": "///F/693/O", "atom2_id": "///F/697/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2047, "atom1_serNum": 16419, "atom2_serNum": 16445, "donAcc_type": "standard", "distance": 2.876, "atom1_id": "///F/694/O", "atom2_id": "///F/698/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2048, "atom1_serNum": 16424, "atom2_serNum": 16457, "donAcc_type": "standard", "distance": 3.045, "atom1_id": "///F/695/O", "atom2_id": "///F/699/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2049, "atom1_serNum": 16435, "atom2_serNum": 16464, "donAcc_type": "standard", "distance": 2.671, "atom1_id": "///F/696/O", "atom2_id": "///F/700/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2050, "atom1_serNum": 16435, "atom2_serNum": 16468, "donAcc_type": "standard", "distance": 3.657, "atom1_id": "///F/696/O", "atom2_id": "///F/701/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2051, "atom1_serNum": 16448, "atom2_serNum": 16577, "donAcc_type": "standard", "distance": 3.236, "atom1_id": "///F/698/O", "atom2_id": "///F/717/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2052, "atom1_serNum": 16456, "atom2_serNum": 16573, "donAcc_type": "acceptable", "distance": 2.727, "atom1_id": "///F/698/OH", "atom2_id": "///F/717/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 2053, "atom1_serNum": 16460, "atom2_serNum": 16588, "donAcc_type": "standard", "distance": 3.415, "atom1_id": "///F/699/O", "atom2_id": "///F/718/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2054, "atom1_serNum": 16468, "atom2_serNum": 16481, "donAcc_type": "standard", "distance": 3.118, "atom1_id": "///F/701/N", "atom2_id": "///F/702/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2055, "atom1_serNum": 16471, "atom2_serNum": 16483, "donAcc_type": "standard", "distance": 3.318, "atom1_id": "///F/701/O", "atom2_id": "///F/703/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2056, "atom1_serNum": 16495, "atom2_serNum": 16501, "donAcc_type": "standard", "distance": 3.228, "atom1_id": "///F/704/O", "atom2_id": "///F/707/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2057, "atom1_serNum": 16519, "atom2_serNum": 16528, "donAcc_type": "standard", "distance": 2.972, "atom1_id": "///F/709/O", "atom2_id": "///F/711/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2058, "atom1_serNum": 16531, "atom2_serNum": 16545, "donAcc_type": "standard", "distance": 3.207, "atom1_id": "///F/711/O", "atom2_id": "///F/713/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2059, "atom1_serNum": 16536, "atom2_serNum": 16552, "donAcc_type": "standard", "distance": 3.070, "atom1_id": "///F/711/OE2", "atom2_id": "///F/714/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2060, "atom1_serNum": 16536, "atom2_serNum": 16558, "donAcc_type": "standard", "distance": 2.764, "atom1_id": "///F/711/OE2", "atom2_id": "///F/715/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2061, "atom1_serNum": 16540, "atom2_serNum": 16558, "donAcc_type": "standard", "distance": 3.210, "atom1_id": "///F/712/O", "atom2_id": "///F/715/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2062, "atom1_serNum": 16555, "atom2_serNum": 16578, "donAcc_type": "standard", "distance": 3.344, "atom1_id": "///F/714/O", "atom2_id": "///F/718/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2063, "atom1_serNum": 16565, "atom2_serNum": 16589, "donAcc_type": "standard", "distance": 3.122, "atom1_id": "///F/716/O", "atom2_id": "///F/719/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2064, "atom1_serNum": 16565, "atom2_serNum": 16594, "donAcc_type": "standard", "distance": 3.044, "atom1_id": "///F/716/O", "atom2_id": "///F/720/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2065, "atom1_serNum": 16573, "atom2_serNum": 16605, "donAcc_type": "standard", "distance": 3.099, "atom1_id": "///F/717/O", "atom2_id": "///F/721/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2066, "atom1_serNum": 16576, "atom2_serNum": 16604, "donAcc_type": "standard", "distance": 3.387, "atom1_id": "///F/717/OD1", "atom2_id": "///F/720/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2067, "atom1_serNum": 16581, "atom2_serNum": 16618, "donAcc_type": "acceptable", "distance": 2.917, "atom1_id": "///F/718/O", "atom2_id": "///F/722/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 2068, "atom1_serNum": 16587, "atom2_serNum": 21990, "donAcc_type": "standard", "distance": 3.054, "atom1_id": "///F/718/NH1", "atom2_id": "///J/63/O2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 2069, "atom1_serNum": 16587, "atom2_serNum": 21991, "donAcc_type": "standard", "distance": 2.851, "atom1_id": "///F/718/NH1", "atom2_id": "///J/63/N3", "atom_pair": "N:N", "residue_pair": "aa:nt" }, { "index": 2070, "atom1_serNum": 16592, "atom2_serNum": 16619, "donAcc_type": "standard", "distance": 3.045, "atom1_id": "///F/719/O", "atom2_id": "///F/723/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2071, "atom1_serNum": 16597, "atom2_serNum": 16630, "donAcc_type": "standard", "distance": 3.173, "atom1_id": "///F/720/O", "atom2_id": "///F/724/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2072, "atom1_serNum": 16608, "atom2_serNum": 16636, "donAcc_type": "standard", "distance": 3.340, "atom1_id": "///F/721/O", "atom2_id": "///F/725/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2073, "atom1_serNum": 16616, "atom2_serNum": 16643, "donAcc_type": "standard", "distance": 2.903, "atom1_id": "///F/722/O", "atom2_id": "///F/726/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2074, "atom1_serNum": 16622, "atom2_serNum": 16655, "donAcc_type": "standard", "distance": 3.108, "atom1_id": "///F/723/O", "atom2_id": "///F/727/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2075, "atom1_serNum": 16622, "atom2_serNum": 16660, "donAcc_type": "acceptable", "distance": 3.085, "atom1_id": "///F/723/O", "atom2_id": "///F/727/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 2076, "atom1_serNum": 16633, "atom2_serNum": 16655, "donAcc_type": "standard", "distance": 2.931, "atom1_id": "///F/724/O", "atom2_id": "///F/727/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2077, "atom1_serNum": 16633, "atom2_serNum": 16661, "donAcc_type": "standard", "distance": 2.867, "atom1_id": "///F/724/O", "atom2_id": "///F/728/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2078, "atom1_serNum": 16639, "atom2_serNum": 16669, "donAcc_type": "standard", "distance": 3.073, "atom1_id": "///F/725/O", "atom2_id": "///F/729/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2079, "atom1_serNum": 16646, "atom2_serNum": 16677, "donAcc_type": "standard", "distance": 3.035, "atom1_id": "///F/726/O", "atom2_id": "///F/730/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2080, "atom1_serNum": 16658, "atom2_serNum": 16681, "donAcc_type": "standard", "distance": 3.036, "atom1_id": "///F/727/O", "atom2_id": "///F/731/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2081, "atom1_serNum": 16664, "atom2_serNum": 16688, "donAcc_type": "standard", "distance": 3.132, "atom1_id": "///F/728/O", "atom2_id": "///F/732/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2082, "atom1_serNum": 16672, "atom2_serNum": 16695, "donAcc_type": "standard", "distance": 2.995, "atom1_id": "///F/729/O", "atom2_id": "///F/733/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2083, "atom1_serNum": 16680, "atom2_serNum": 16704, "donAcc_type": "standard", "distance": 3.276, "atom1_id": "///F/730/O", "atom2_id": "///F/734/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2084, "atom1_serNum": 16684, "atom2_serNum": 16704, "donAcc_type": "standard", "distance": 3.050, "atom1_id": "///F/731/O", "atom2_id": "///F/734/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2085, "atom1_serNum": 16684, "atom2_serNum": 16715, "donAcc_type": "standard", "distance": 2.806, "atom1_id": "///F/731/O", "atom2_id": "///F/735/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2086, "atom1_serNum": 16684, "atom2_serNum": 16720, "donAcc_type": "acceptable", "distance": 2.428, "atom1_id": "///F/731/O", "atom2_id": "///F/735/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 2087, "atom1_serNum": 16691, "atom2_serNum": 17674, "donAcc_type": "acceptable", "distance": 2.811, "atom1_id": "///F/732/O", "atom2_id": "///F/857/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 2088, "atom1_serNum": 16713, "atom2_serNum": 21031, "donAcc_type": "acceptable", "distance": 3.517, "atom1_id": "///F/734/NH1", "atom2_id": "///I/1/O2'", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 2089, "atom1_serNum": 16714, "atom2_serNum": 21029, "donAcc_type": "standard", "distance": 3.670, "atom1_id": "///F/734/NH2", "atom2_id": "///I/1/O3'", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 2090, "atom1_serNum": 16759, "atom2_serNum": 16790, "donAcc_type": "standard", "distance": 2.869, "atom1_id": "///F/740/O", "atom2_id": "///F/744/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2091, "atom1_serNum": 16767, "atom2_serNum": 16795, "donAcc_type": "standard", "distance": 2.990, "atom1_id": "///F/741/O", "atom2_id": "///F/745/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2092, "atom1_serNum": 16775, "atom2_serNum": 16804, "donAcc_type": "standard", "distance": 2.745, "atom1_id": "///F/742/O", "atom2_id": "///F/746/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2093, "atom1_serNum": 16780, "atom2_serNum": 16803, "donAcc_type": "standard", "distance": 2.875, "atom1_id": "///F/742/OE2", "atom2_id": "///F/745/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2094, "atom1_serNum": 16784, "atom2_serNum": 16809, "donAcc_type": "standard", "distance": 2.727, "atom1_id": "///F/743/O", "atom2_id": "///F/747/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2095, "atom1_serNum": 16793, "atom2_serNum": 16813, "donAcc_type": "standard", "distance": 3.267, "atom1_id": "///F/744/O", "atom2_id": "///F/748/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2096, "atom1_serNum": 16793, "atom2_serNum": 16817, "donAcc_type": "standard", "distance": 2.912, "atom1_id": "///F/744/O", "atom2_id": "///F/749/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2097, "atom1_serNum": 16798, "atom2_serNum": 16813, "donAcc_type": "standard", "distance": 2.805, "atom1_id": "///F/745/O", "atom2_id": "///F/748/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2098, "atom1_serNum": 16816, "atom2_serNum": 16922, "donAcc_type": "standard", "distance": 2.684, "atom1_id": "///F/748/O", "atom2_id": "///F/762/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2099, "atom1_serNum": 16816, "atom2_serNum": 16925, "donAcc_type": "standard", "distance": 2.700, "atom1_id": "///F/748/O", "atom2_id": "///F/762/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2100, "atom1_serNum": 16820, "atom2_serNum": 16915, "donAcc_type": "standard", "distance": 2.891, "atom1_id": "///F/749/O", "atom2_id": "///F/762/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2101, "atom1_serNum": 16835, "atom2_serNum": 16899, "donAcc_type": "standard", "distance": 2.701, "atom1_id": "///F/751/N", "atom2_id": "///F/760/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2102, "atom1_serNum": 16842, "atom2_serNum": 16899, "donAcc_type": "standard", "distance": 3.316, "atom1_id": "///F/752/N", "atom2_id": "///F/760/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2103, "atom1_serNum": 16845, "atom2_serNum": 16896, "donAcc_type": "standard", "distance": 2.837, "atom1_id": "///F/752/O", "atom2_id": "///F/760/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2104, "atom1_serNum": 16858, "atom2_serNum": 16884, "donAcc_type": "standard", "distance": 3.136, "atom1_id": "///F/754/N", "atom2_id": "///F/758/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2105, "atom1_serNum": 16861, "atom2_serNum": 16877, "donAcc_type": "standard", "distance": 2.290, "atom1_id": "///F/754/O", "atom2_id": "///F/757/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2106, "atom1_serNum": 16863, "atom2_serNum": 16881, "donAcc_type": "acceptable", "distance": 2.859, "atom1_id": "///F/754/OG1", "atom2_id": "///F/758/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2107, "atom1_serNum": 16863, "atom2_serNum": 16884, "donAcc_type": "acceptable", "distance": 2.738, "atom1_id": "///F/754/OG1", "atom2_id": "///F/758/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 2108, "atom1_serNum": 16907, "atom2_serNum": 17700, "donAcc_type": "standard", "distance": 3.760, "atom1_id": "///F/761/O", "atom2_id": "///F/860/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2109, "atom1_serNum": 16929, "atom2_serNum": 16947, "donAcc_type": "standard", "distance": 3.219, "atom1_id": "///F/763/O", "atom2_id": "///F/766/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2110, "atom1_serNum": 16929, "atom2_serNum": 16952, "donAcc_type": "acceptable", "distance": 3.071, "atom1_id": "///F/763/O", "atom2_id": "///F/766/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 2111, "atom1_serNum": 16933, "atom2_serNum": 17672, "donAcc_type": "standard", "distance": 2.567, "atom1_id": "///F/763/ND2", "atom2_id": "///F/857/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2112, "atom1_serNum": 16944, "atom2_serNum": 16972, "donAcc_type": "standard", "distance": 2.768, "atom1_id": "///F/765/O", "atom2_id": "///F/769/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2113, "atom1_serNum": 16950, "atom2_serNum": 16980, "donAcc_type": "standard", "distance": 2.793, "atom1_id": "///F/766/O", "atom2_id": "///F/770/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2114, "atom1_serNum": 16952, "atom2_serNum": 17708, "donAcc_type": "acceptable", "distance": 3.797, "atom1_id": "///F/766/OG1", "atom2_id": "///F/861/OD2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 2115, "atom1_serNum": 16957, "atom2_serNum": 16988, "donAcc_type": "standard", "distance": 3.363, "atom1_id": "///F/767/O", "atom2_id": "///F/771/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2116, "atom1_serNum": 16966, "atom2_serNum": 16971, "donAcc_type": "standard", "distance": 2.951, "atom1_id": "///F/768/O", "atom2_id": "///F/768/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2117, "atom1_serNum": 16966, "atom2_serNum": 16997, "donAcc_type": "standard", "distance": 3.751, "atom1_id": "///F/768/O", "atom2_id": "///F/772/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2118, "atom1_serNum": 16975, "atom2_serNum": 16997, "donAcc_type": "standard", "distance": 2.984, "atom1_id": "///F/769/O", "atom2_id": "///F/772/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2119, "atom1_serNum": 16975, "atom2_serNum": 17005, "donAcc_type": "standard", "distance": 3.356, "atom1_id": "///F/769/O", "atom2_id": "///F/773/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2120, "atom1_serNum": 16983, "atom2_serNum": 17005, "donAcc_type": "standard", "distance": 3.018, "atom1_id": "///F/770/O", "atom2_id": "///F/773/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2121, "atom1_serNum": 17000, "atom2_serNum": 17029, "donAcc_type": "standard", "distance": 3.426, "atom1_id": "///F/772/O", "atom2_id": "///F/776/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2122, "atom1_serNum": 17008, "atom2_serNum": 17029, "donAcc_type": "standard", "distance": 2.974, "atom1_id": "///F/773/O", "atom2_id": "///F/776/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2123, "atom1_serNum": 17008, "atom2_serNum": 17037, "donAcc_type": "standard", "distance": 3.010, "atom1_id": "///F/773/O", "atom2_id": "///F/777/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2124, "atom1_serNum": 17016, "atom2_serNum": 17045, "donAcc_type": "standard", "distance": 3.055, "atom1_id": "///F/774/O", "atom2_id": "///F/778/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2125, "atom1_serNum": 17024, "atom2_serNum": 17050, "donAcc_type": "standard", "distance": 2.972, "atom1_id": "///F/775/O", "atom2_id": "///F/779/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2126, "atom1_serNum": 17032, "atom2_serNum": 17058, "donAcc_type": "standard", "distance": 2.775, "atom1_id": "///F/776/O", "atom2_id": "///F/780/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2127, "atom1_serNum": 17040, "atom2_serNum": 17066, "donAcc_type": "standard", "distance": 2.644, "atom1_id": "///F/777/O", "atom2_id": "///F/781/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2128, "atom1_serNum": 17048, "atom2_serNum": 17077, "donAcc_type": "standard", "distance": 3.006, "atom1_id": "///F/778/O", "atom2_id": "///F/782/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2129, "atom1_serNum": 17048, "atom2_serNum": 17082, "donAcc_type": "acceptable", "distance": 2.814, "atom1_id": "///F/778/O", "atom2_id": "///F/782/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 2130, "atom1_serNum": 17053, "atom2_serNum": 17084, "donAcc_type": "standard", "distance": 2.804, "atom1_id": "///F/779/O", "atom2_id": "///F/783/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2131, "atom1_serNum": 17061, "atom2_serNum": 17094, "donAcc_type": "standard", "distance": 2.942, "atom1_id": "///F/780/O", "atom2_id": "///F/784/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2132, "atom1_serNum": 17069, "atom2_serNum": 17102, "donAcc_type": "standard", "distance": 3.001, "atom1_id": "///F/781/O", "atom2_id": "///F/785/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2133, "atom1_serNum": 17069, "atom2_serNum": 17107, "donAcc_type": "acceptable", "distance": 2.928, "atom1_id": "///F/781/O", "atom2_id": "///F/785/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 2134, "atom1_serNum": 17075, "atom2_serNum": 17819, "donAcc_type": "acceptable", "distance": 2.980, "atom1_id": "///F/781/NH1", "atom2_id": "///F/875/OG", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2135, "atom1_serNum": 17080, "atom2_serNum": 17109, "donAcc_type": "standard", "distance": 3.075, "atom1_id": "///F/782/O", "atom2_id": "///F/786/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2136, "atom1_serNum": 17093, "atom2_serNum": 17128, "donAcc_type": "acceptable", "distance": 3.815, "atom1_id": "///F/783/NE2", "atom2_id": "///F/787/OH", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2137, "atom1_serNum": 17097, "atom2_serNum": 17117, "donAcc_type": "standard", "distance": 3.146, "atom1_id": "///F/784/O", "atom2_id": "///F/787/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2138, "atom1_serNum": 17100, "atom2_serNum": 17823, "donAcc_type": "questionable", "distance": 2.686, "atom1_id": "///F/784/OD1", "atom2_id": "///F/876/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 2139, "atom1_serNum": 17101, "atom2_serNum": 17579, "donAcc_type": "acceptable", "distance": 3.885, "atom1_id": "///F/784/ND2", "atom2_id": "///F/844/OH", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2140, "atom1_serNum": 17105, "atom2_serNum": 17129, "donAcc_type": "standard", "distance": 3.031, "atom1_id": "///F/785/O", "atom2_id": "///F/788/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2141, "atom1_serNum": 17128, "atom2_serNum": 17917, "donAcc_type": "acceptable", "distance": 2.622, "atom1_id": "///F/787/OH", "atom2_id": "///F/887/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2142, "atom1_serNum": 17132, "atom2_serNum": 17158, "donAcc_type": "standard", "distance": 2.691, "atom1_id": "///F/788/O", "atom2_id": "///F/792/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2143, "atom1_serNum": 17141, "atom2_serNum": 17149, "donAcc_type": "standard", "distance": 2.545, "atom1_id": "///F/790/N", "atom2_id": "///F/790/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2144, "atom1_serNum": 17144, "atom2_serNum": 17166, "donAcc_type": "standard", "distance": 3.235, "atom1_id": "///F/790/O", "atom2_id": "///F/793/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2145, "atom1_serNum": 17153, "atom2_serNum": 17171, "donAcc_type": "standard", "distance": 3.186, "atom1_id": "///F/791/O", "atom2_id": "///F/794/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2146, "atom1_serNum": 17191, "atom2_serNum": 17209, "donAcc_type": "standard", "distance": 2.841, "atom1_id": "///F/796/O", "atom2_id": "///F/799/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2147, "atom1_serNum": 17212, "atom2_serNum": 17227, "donAcc_type": "standard", "distance": 2.699, "atom1_id": "///F/799/O", "atom2_id": "///F/801/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2148, "atom1_serNum": 17212, "atom2_serNum": 17236, "donAcc_type": "standard", "distance": 2.917, "atom1_id": "///F/799/O", "atom2_id": "///F/802/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2149, "atom1_serNum": 17230, "atom2_serNum": 17249, "donAcc_type": "standard", "distance": 2.885, "atom1_id": "///F/801/O", "atom2_id": "///F/804/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2150, "atom1_serNum": 17244, "atom2_serNum": 17909, "donAcc_type": "acceptable", "distance": 2.886, "atom1_id": "///F/803/O", "atom2_id": "///F/886/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 2151, "atom1_serNum": 17260, "atom2_serNum": 17513, "donAcc_type": "standard", "distance": 2.590, "atom1_id": "///F/805/O", "atom2_id": "///F/837/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2152, "atom1_serNum": 17265, "atom2_serNum": 17294, "donAcc_type": "standard", "distance": 3.705, "atom1_id": "///F/806/N", "atom2_id": "///F/809/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2153, "atom1_serNum": 17268, "atom2_serNum": 17286, "donAcc_type": "standard", "distance": 2.729, "atom1_id": "///F/806/O", "atom2_id": "///F/809/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2154, "atom1_serNum": 17268, "atom2_serNum": 17295, "donAcc_type": "standard", "distance": 2.688, "atom1_id": "///F/806/O", "atom2_id": "///F/810/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2155, "atom1_serNum": 17276, "atom2_serNum": 17304, "donAcc_type": "standard", "distance": 2.839, "atom1_id": "///F/807/O", "atom2_id": "///F/811/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2156, "atom1_serNum": 17279, "atom2_serNum": 17281, "donAcc_type": "standard", "distance": 2.733, "atom1_id": "///F/807/OD1", "atom2_id": "///F/808/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2157, "atom1_serNum": 17284, "atom2_serNum": 17310, "donAcc_type": "standard", "distance": 2.988, "atom1_id": "///F/808/O", "atom2_id": "///F/812/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2158, "atom1_serNum": 17289, "atom2_serNum": 17315, "donAcc_type": "standard", "distance": 3.156, "atom1_id": "///F/809/O", "atom2_id": "///F/813/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2159, "atom1_serNum": 17294, "atom2_serNum": 17552, "donAcc_type": "acceptable", "distance": 3.626, "atom1_id": "///F/809/OE2", "atom2_id": "///F/841/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 2160, "atom1_serNum": 17298, "atom2_serNum": 17323, "donAcc_type": "standard", "distance": 3.073, "atom1_id": "///F/810/O", "atom2_id": "///F/814/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2161, "atom1_serNum": 17307, "atom2_serNum": 17323, "donAcc_type": "standard", "distance": 2.742, "atom1_id": "///F/811/O", "atom2_id": "///F/814/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2162, "atom1_serNum": 17307, "atom2_serNum": 17331, "donAcc_type": "standard", "distance": 3.212, "atom1_id": "///F/811/O", "atom2_id": "///F/815/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2163, "atom1_serNum": 17353, "atom2_serNum": 17366, "donAcc_type": "standard", "distance": 3.059, "atom1_id": "///F/818/O", "atom2_id": "///F/820/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2164, "atom1_serNum": 17424, "atom2_serNum": 17435, "donAcc_type": "standard", "distance": 2.818, "atom1_id": "///F/827/O", "atom2_id": "///F/829/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2165, "atom1_serNum": 17431, "atom2_serNum": 17454, "donAcc_type": "standard", "distance": 2.479, "atom1_id": "///F/828/O", "atom2_id": "///F/830/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2166, "atom1_serNum": 17458, "atom2_serNum": 17486, "donAcc_type": "standard", "distance": 2.705, "atom1_id": "///F/831/O", "atom2_id": "///F/835/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2167, "atom1_serNum": 17465, "atom2_serNum": 17497, "donAcc_type": "standard", "distance": 3.194, "atom1_id": "///F/832/O", "atom2_id": "///F/836/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2168, "atom1_serNum": 17472, "atom2_serNum": 17505, "donAcc_type": "standard", "distance": 2.845, "atom1_id": "///F/833/O", "atom2_id": "///F/837/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2169, "atom1_serNum": 17480, "atom2_serNum": 17514, "donAcc_type": "standard", "distance": 3.055, "atom1_id": "///F/834/O", "atom2_id": "///F/838/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2170, "atom1_serNum": 17489, "atom2_serNum": 17525, "donAcc_type": "standard", "distance": 3.412, "atom1_id": "///F/835/O", "atom2_id": "///F/839/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2171, "atom1_serNum": 17500, "atom2_serNum": 17536, "donAcc_type": "standard", "distance": 3.047, "atom1_id": "///F/836/O", "atom2_id": "///F/840/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2172, "atom1_serNum": 17508, "atom2_serNum": 17552, "donAcc_type": "acceptable", "distance": 3.377, "atom1_id": "///F/837/O", "atom2_id": "///F/841/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 2173, "atom1_serNum": 17517, "atom2_serNum": 17553, "donAcc_type": "standard", "distance": 3.246, "atom1_id": "///F/838/O", "atom2_id": "///F/842/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2174, "atom1_serNum": 17517, "atom2_serNum": 17558, "donAcc_type": "acceptable", "distance": 2.985, "atom1_id": "///F/838/O", "atom2_id": "///F/842/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 2175, "atom1_serNum": 17528, "atom2_serNum": 17560, "donAcc_type": "standard", "distance": 2.813, "atom1_id": "///F/839/O", "atom2_id": "///F/843/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2176, "atom1_serNum": 17539, "atom2_serNum": 17568, "donAcc_type": "standard", "distance": 2.768, "atom1_id": "///F/840/O", "atom2_id": "///F/844/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2177, "atom1_serNum": 17550, "atom2_serNum": 17580, "donAcc_type": "standard", "distance": 3.084, "atom1_id": "///F/841/O", "atom2_id": "///F/845/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2178, "atom1_serNum": 17552, "atom2_serNum": 17919, "donAcc_type": "acceptable", "distance": 3.482, "atom1_id": "///F/841/OG", "atom2_id": "///F/887/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2179, "atom1_serNum": 17556, "atom2_serNum": 17589, "donAcc_type": "standard", "distance": 2.792, "atom1_id": "///F/842/O", "atom2_id": "///F/846/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2180, "atom1_serNum": 17563, "atom2_serNum": 17597, "donAcc_type": "standard", "distance": 2.988, "atom1_id": "///F/843/O", "atom2_id": "///F/847/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2181, "atom1_serNum": 17571, "atom2_serNum": 17603, "donAcc_type": "standard", "distance": 3.379, "atom1_id": "///F/844/O", "atom2_id": "///F/848/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2182, "atom1_serNum": 17583, "atom2_serNum": 17614, "donAcc_type": "standard", "distance": 2.891, "atom1_id": "///F/845/O", "atom2_id": "///F/849/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2183, "atom1_serNum": 17592, "atom2_serNum": 17624, "donAcc_type": "standard", "distance": 2.996, "atom1_id": "///F/846/O", "atom2_id": "///F/850/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2184, "atom1_serNum": 17600, "atom2_serNum": 17632, "donAcc_type": "standard", "distance": 3.305, "atom1_id": "///F/847/O", "atom2_id": "///F/851/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2185, "atom1_serNum": 17606, "atom2_serNum": 17640, "donAcc_type": "standard", "distance": 2.717, "atom1_id": "///F/848/O", "atom2_id": "///F/852/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2186, "atom1_serNum": 17617, "atom2_serNum": 17644, "donAcc_type": "standard", "distance": 2.901, "atom1_id": "///F/849/O", "atom2_id": "///F/853/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2187, "atom1_serNum": 17627, "atom2_serNum": 17653, "donAcc_type": "standard", "distance": 2.886, "atom1_id": "///F/850/O", "atom2_id": "///F/854/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2188, "atom1_serNum": 17647, "atom2_serNum": 17669, "donAcc_type": "standard", "distance": 2.969, "atom1_id": "///F/853/O", "atom2_id": "///F/857/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2189, "atom1_serNum": 17656, "atom2_serNum": 17675, "donAcc_type": "standard", "distance": 2.981, "atom1_id": "///F/854/O", "atom2_id": "///F/858/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2190, "atom1_serNum": 17661, "atom2_serNum": 17683, "donAcc_type": "standard", "distance": 2.547, "atom1_id": "///F/855/O", "atom2_id": "///F/859/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2191, "atom1_serNum": 17678, "atom2_serNum": 17701, "donAcc_type": "standard", "distance": 3.071, "atom1_id": "///F/858/O", "atom2_id": "///F/861/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2192, "atom1_serNum": 17686, "atom2_serNum": 17709, "donAcc_type": "standard", "distance": 2.823, "atom1_id": "///F/859/O", "atom2_id": "///F/862/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2193, "atom1_serNum": 17686, "atom2_serNum": 17720, "donAcc_type": "standard", "distance": 2.934, "atom1_id": "///F/859/O", "atom2_id": "///F/863/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2194, "atom1_serNum": 17695, "atom2_serNum": 17732, "donAcc_type": "standard", "distance": 3.034, "atom1_id": "///F/860/O", "atom2_id": "///F/864/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2195, "atom1_serNum": 17695, "atom2_serNum": 17737, "donAcc_type": "acceptable", "distance": 2.744, "atom1_id": "///F/860/O", "atom2_id": "///F/864/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 2196, "atom1_serNum": 17712, "atom2_serNum": 17739, "donAcc_type": "standard", "distance": 3.410, "atom1_id": "///F/862/O", "atom2_id": "///F/865/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2197, "atom1_serNum": 17731, "atom2_serNum": 18018, "donAcc_type": "acceptable", "distance": 2.693, "atom1_id": "///F/863/OH", "atom2_id": "///F/899/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 2198, "atom1_serNum": 17742, "atom2_serNum": 17763, "donAcc_type": "standard", "distance": 2.761, "atom1_id": "///F/865/O", "atom2_id": "///F/868/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2199, "atom1_serNum": 17749, "atom2_serNum": 17791, "donAcc_type": "standard", "distance": 3.212, "atom1_id": "///F/866/O", "atom2_id": "///F/871/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2200, "atom1_serNum": 17758, "atom2_serNum": 17783, "donAcc_type": "standard", "distance": 2.998, "atom1_id": "///F/867/O", "atom2_id": "///F/871/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2201, "atom1_serNum": 17766, "atom2_serNum": 17783, "donAcc_type": "standard", "distance": 2.858, "atom1_id": "///F/868/O", "atom2_id": "///F/871/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2202, "atom1_serNum": 17766, "atom2_serNum": 17792, "donAcc_type": "standard", "distance": 2.738, "atom1_id": "///F/868/O", "atom2_id": "///F/872/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2203, "atom1_serNum": 17774, "atom2_serNum": 17800, "donAcc_type": "standard", "distance": 2.838, "atom1_id": "///F/869/O", "atom2_id": "///F/873/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2204, "atom1_serNum": 17779, "atom2_serNum": 17808, "donAcc_type": "standard", "distance": 2.968, "atom1_id": "///F/870/O", "atom2_id": "///F/874/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2205, "atom1_serNum": 17779, "atom2_serNum": 17813, "donAcc_type": "acceptable", "distance": 2.672, "atom1_id": "///F/870/O", "atom2_id": "///F/874/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 2206, "atom1_serNum": 17786, "atom2_serNum": 17814, "donAcc_type": "standard", "distance": 3.293, "atom1_id": "///F/871/O", "atom2_id": "///F/875/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2207, "atom1_serNum": 17786, "atom2_serNum": 17819, "donAcc_type": "acceptable", "distance": 2.596, "atom1_id": "///F/871/O", "atom2_id": "///F/875/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 2208, "atom1_serNum": 17795, "atom2_serNum": 17814, "donAcc_type": "standard", "distance": 3.083, "atom1_id": "///F/872/O", "atom2_id": "///F/875/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2209, "atom1_serNum": 17795, "atom2_serNum": 17820, "donAcc_type": "standard", "distance": 2.815, "atom1_id": "///F/872/O", "atom2_id": "///F/876/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2210, "atom1_serNum": 17795, "atom2_serNum": 17825, "donAcc_type": "standard", "distance": 3.303, "atom1_id": "///F/872/O", "atom2_id": "///F/877/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2211, "atom1_serNum": 17846, "atom2_serNum": 17850, "donAcc_type": "standard", "distance": 2.642, "atom1_id": "///F/879/O", "atom2_id": "///F/879/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2212, "atom1_serNum": 17846, "atom2_serNum": 17867, "donAcc_type": "standard", "distance": 2.658, "atom1_id": "///F/879/O", "atom2_id": "///F/882/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2213, "atom1_serNum": 17846, "atom2_serNum": 17875, "donAcc_type": "standard", "distance": 3.491, "atom1_id": "///F/879/O", "atom2_id": "///F/883/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2214, "atom1_serNum": 17850, "atom2_serNum": 17873, "donAcc_type": "standard", "distance": 3.322, "atom1_id": "///F/879/ND2", "atom2_id": "///F/882/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2215, "atom1_serNum": 17854, "atom2_serNum": 17875, "donAcc_type": "standard", "distance": 3.261, "atom1_id": "///F/880/O", "atom2_id": "///F/883/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2216, "atom1_serNum": 17878, "atom2_serNum": 18242, "donAcc_type": "standard", "distance": 3.244, "atom1_id": "///F/883/O", "atom2_id": "///F/926/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2217, "atom1_serNum": 17878, "atom2_serNum": 18243, "donAcc_type": "standard", "distance": 2.924, "atom1_id": "///F/883/O", "atom2_id": "///F/926/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2218, "atom1_serNum": 17886, "atom2_serNum": 17910, "donAcc_type": "standard", "distance": 3.298, "atom1_id": "///F/884/O", "atom2_id": "///F/887/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2219, "atom1_serNum": 17886, "atom2_serNum": 17921, "donAcc_type": "standard", "distance": 3.287, "atom1_id": "///F/884/O", "atom2_id": "///F/888/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2220, "atom1_serNum": 17893, "atom2_serNum": 17929, "donAcc_type": "standard", "distance": 2.986, "atom1_id": "///F/885/O", "atom2_id": "///F/889/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2221, "atom1_serNum": 17896, "atom2_serNum": 18243, "donAcc_type": "standard", "distance": 2.907, "atom1_id": "///F/885/OD1", "atom2_id": "///F/926/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2222, "atom1_serNum": 17896, "atom2_serNum": 18275, "donAcc_type": "standard", "distance": 3.238, "atom1_id": "///F/885/OD1", "atom2_id": "///F/930/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2223, "atom1_serNum": 17897, "atom2_serNum": 18275, "donAcc_type": "standard", "distance": 3.333, "atom1_id": "///F/885/OD2", "atom2_id": "///F/930/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2224, "atom1_serNum": 17913, "atom2_serNum": 17947, "donAcc_type": "standard", "distance": 3.014, "atom1_id": "///F/887/O", "atom2_id": "///F/891/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2225, "atom1_serNum": 17924, "atom2_serNum": 17955, "donAcc_type": "standard", "distance": 2.862, "atom1_id": "///F/888/O", "atom2_id": "///F/892/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2226, "atom1_serNum": 17932, "atom2_serNum": 17963, "donAcc_type": "standard", "distance": 3.227, "atom1_id": "///F/889/O", "atom2_id": "///F/893/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2227, "atom1_serNum": 17943, "atom2_serNum": 17974, "donAcc_type": "standard", "distance": 3.004, "atom1_id": "///F/890/O", "atom2_id": "///F/894/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2228, "atom1_serNum": 17950, "atom2_serNum": 17981, "donAcc_type": "standard", "distance": 3.066, "atom1_id": "///F/891/O", "atom2_id": "///F/895/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2229, "atom1_serNum": 17950, "atom2_serNum": 17992, "donAcc_type": "standard", "distance": 3.480, "atom1_id": "///F/891/O", "atom2_id": "///F/896/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2230, "atom1_serNum": 17958, "atom2_serNum": 17999, "donAcc_type": "standard", "distance": 2.807, "atom1_id": "///F/892/O", "atom2_id": "///F/897/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2231, "atom1_serNum": 17984, "atom2_serNum": 18015, "donAcc_type": "standard", "distance": 2.893, "atom1_id": "///F/895/O", "atom2_id": "///F/899/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2232, "atom1_serNum": 17995, "atom2_serNum": 18023, "donAcc_type": "standard", "distance": 2.979, "atom1_id": "///F/896/O", "atom2_id": "///F/900/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2233, "atom1_serNum": 18002, "atom2_serNum": 18030, "donAcc_type": "standard", "distance": 2.946, "atom1_id": "///F/897/O", "atom2_id": "///F/901/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2234, "atom1_serNum": 18007, "atom2_serNum": 18509, "donAcc_type": "standard", "distance": 3.099, "atom1_id": "///F/897/NZ", "atom2_id": "///F/971/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2235, "atom1_serNum": 18011, "atom2_serNum": 18038, "donAcc_type": "standard", "distance": 3.052, "atom1_id": "///F/898/O", "atom2_id": "///F/902/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2236, "atom1_serNum": 18026, "atom2_serNum": 18049, "donAcc_type": "standard", "distance": 2.890, "atom1_id": "///F/900/O", "atom2_id": "///F/903/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2237, "atom1_serNum": 18058, "atom2_serNum": 18078, "donAcc_type": "standard", "distance": 2.813, "atom1_id": "///F/904/O", "atom2_id": "///F/907/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2238, "atom1_serNum": 18065, "atom2_serNum": 18088, "donAcc_type": "standard", "distance": 2.929, "atom1_id": "///F/905/O", "atom2_id": "///F/908/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2239, "atom1_serNum": 18069, "atom2_serNum": 18076, "donAcc_type": "standard", "distance": 2.679, "atom1_id": "///F/906/N", "atom2_id": "///F/906/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2240, "atom1_serNum": 18081, "atom2_serNum": 18114, "donAcc_type": "standard", "distance": 3.044, "atom1_id": "///F/907/O", "atom2_id": "///F/911/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2241, "atom1_serNum": 18081, "atom2_serNum": 18122, "donAcc_type": "standard", "distance": 3.491, "atom1_id": "///F/907/O", "atom2_id": "///F/912/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2242, "atom1_serNum": 18091, "atom2_serNum": 18129, "donAcc_type": "standard", "distance": 2.912, "atom1_id": "///F/908/O", "atom2_id": "///F/913/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2243, "atom1_serNum": 18108, "atom2_serNum": 18658, "donAcc_type": "standard", "distance": 3.024, "atom1_id": "///F/909/OE2", "atom2_id": "///F/1021/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2244, "atom1_serNum": 18125, "atom2_serNum": 18150, "donAcc_type": "standard", "distance": 2.943, "atom1_id": "///F/912/O", "atom2_id": "///F/916/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2245, "atom1_serNum": 18132, "atom2_serNum": 18158, "donAcc_type": "standard", "distance": 3.160, "atom1_id": "///F/913/O", "atom2_id": "///F/917/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2246, "atom1_serNum": 18145, "atom2_serNum": 18169, "donAcc_type": "standard", "distance": 3.161, "atom1_id": "///F/915/O", "atom2_id": "///F/919/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2247, "atom1_serNum": 18153, "atom2_serNum": 18177, "donAcc_type": "standard", "distance": 2.786, "atom1_id": "///F/916/O", "atom2_id": "///F/920/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2248, "atom1_serNum": 18161, "atom2_serNum": 18188, "donAcc_type": "standard", "distance": 3.170, "atom1_id": "///F/917/O", "atom2_id": "///F/921/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2249, "atom1_serNum": 18161, "atom2_serNum": 18193, "donAcc_type": "acceptable", "distance": 2.928, "atom1_id": "///F/917/O", "atom2_id": "///F/921/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 2250, "atom1_serNum": 18165, "atom2_serNum": 18195, "donAcc_type": "standard", "distance": 2.998, "atom1_id": "///F/918/O", "atom2_id": "///F/922/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2251, "atom1_serNum": 18172, "atom2_serNum": 18207, "donAcc_type": "standard", "distance": 2.889, "atom1_id": "///F/919/O", "atom2_id": "///F/923/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2252, "atom1_serNum": 18180, "atom2_serNum": 18215, "donAcc_type": "standard", "distance": 2.981, "atom1_id": "///F/920/O", "atom2_id": "///F/924/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2253, "atom1_serNum": 18191, "atom2_serNum": 18225, "donAcc_type": "standard", "distance": 3.219, "atom1_id": "///F/921/O", "atom2_id": "///F/925/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2254, "atom1_serNum": 18198, "atom2_serNum": 18233, "donAcc_type": "standard", "distance": 2.755, "atom1_id": "///F/922/O", "atom2_id": "///F/926/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2255, "atom1_serNum": 18206, "atom2_serNum": 18242, "donAcc_type": "acceptable", "distance": 2.736, "atom1_id": "///F/922/OH", "atom2_id": "///F/926/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2256, "atom1_serNum": 18210, "atom2_serNum": 18244, "donAcc_type": "standard", "distance": 2.728, "atom1_id": "///F/923/O", "atom2_id": "///F/927/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2257, "atom1_serNum": 18218, "atom2_serNum": 18252, "donAcc_type": "standard", "distance": 2.845, "atom1_id": "///F/924/O", "atom2_id": "///F/928/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2258, "atom1_serNum": 18218, "atom2_serNum": 18257, "donAcc_type": "acceptable", "distance": 2.804, "atom1_id": "///F/924/O", "atom2_id": "///F/928/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 2259, "atom1_serNum": 18228, "atom2_serNum": 18258, "donAcc_type": "standard", "distance": 3.151, "atom1_id": "///F/925/O", "atom2_id": "///F/929/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2260, "atom1_serNum": 18236, "atom2_serNum": 18267, "donAcc_type": "standard", "distance": 3.096, "atom1_id": "///F/926/O", "atom2_id": "///F/930/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2261, "atom1_serNum": 18247, "atom2_serNum": 18276, "donAcc_type": "standard", "distance": 2.834, "atom1_id": "///F/927/O", "atom2_id": "///F/931/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2262, "atom1_serNum": 18255, "atom2_serNum": 18290, "donAcc_type": "standard", "distance": 2.997, "atom1_id": "///F/928/O", "atom2_id": "///F/932/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2263, "atom1_serNum": 18270, "atom2_serNum": 18306, "donAcc_type": "standard", "distance": 3.302, "atom1_id": "///F/930/O", "atom2_id": "///F/934/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2264, "atom1_serNum": 18279, "atom2_serNum": 18314, "donAcc_type": "standard", "distance": 2.724, "atom1_id": "///F/931/O", "atom2_id": "///F/935/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2265, "atom1_serNum": 18309, "atom2_serNum": 18331, "donAcc_type": "standard", "distance": 2.937, "atom1_id": "///F/934/O", "atom2_id": "///F/937/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2266, "atom1_serNum": 18341, "atom2_serNum": 18408, "donAcc_type": "standard", "distance": 3.088, "atom1_id": "///F/937/NH2", "atom2_id": "///F/959/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2267, "atom1_serNum": 18345, "atom2_serNum": 18375, "donAcc_type": "standard", "distance": 3.240, "atom1_id": "///F/952/O", "atom2_id": "///F/956/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2268, "atom1_serNum": 18354, "atom2_serNum": 18383, "donAcc_type": "standard", "distance": 2.783, "atom1_id": "///F/953/O", "atom2_id": "///F/957/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2269, "atom1_serNum": 18369, "atom2_serNum": 18400, "donAcc_type": "standard", "distance": 3.352, "atom1_id": "///F/955/O", "atom2_id": "///F/959/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2270, "atom1_serNum": 18378, "atom2_serNum": 18409, "donAcc_type": "standard", "distance": 3.710, "atom1_id": "///F/956/O", "atom2_id": "///F/960/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2271, "atom1_serNum": 18386, "atom2_serNum": 18409, "donAcc_type": "standard", "distance": 2.746, "atom1_id": "///F/957/O", "atom2_id": "///F/960/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2272, "atom1_serNum": 18386, "atom2_serNum": 18418, "donAcc_type": "standard", "distance": 3.392, "atom1_id": "///F/957/O", "atom2_id": "///F/961/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2273, "atom1_serNum": 18394, "atom2_serNum": 18426, "donAcc_type": "standard", "distance": 3.305, "atom1_id": "///F/958/O", "atom2_id": "///F/962/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2274, "atom1_serNum": 18403, "atom2_serNum": 18433, "donAcc_type": "standard", "distance": 3.266, "atom1_id": "///F/959/O", "atom2_id": "///F/963/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2275, "atom1_serNum": 18412, "atom2_serNum": 18433, "donAcc_type": "standard", "distance": 2.883, "atom1_id": "///F/960/O", "atom2_id": "///F/963/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2276, "atom1_serNum": 18412, "atom2_serNum": 18444, "donAcc_type": "standard", "distance": 3.108, "atom1_id": "///F/960/O", "atom2_id": "///F/964/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2277, "atom1_serNum": 18421, "atom2_serNum": 18452, "donAcc_type": "standard", "distance": 2.883, "atom1_id": "///F/961/O", "atom2_id": "///F/965/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2278, "atom1_serNum": 18429, "atom2_serNum": 18460, "donAcc_type": "standard", "distance": 3.026, "atom1_id": "///F/962/O", "atom2_id": "///F/966/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2279, "atom1_serNum": 18429, "atom2_serNum": 18465, "donAcc_type": "acceptable", "distance": 2.337, "atom1_id": "///F/962/O", "atom2_id": "///F/966/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 2280, "atom1_serNum": 18436, "atom2_serNum": 18467, "donAcc_type": "standard", "distance": 3.053, "atom1_id": "///F/963/O", "atom2_id": "///F/967/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2281, "atom1_serNum": 18442, "atom2_serNum": 18804, "donAcc_type": "standard", "distance": 2.744, "atom1_id": "///F/963/NH1", "atom2_id": "///F/1040/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2282, "atom1_serNum": 18443, "atom2_serNum": 18797, "donAcc_type": "questionable", "distance": 3.107, "atom1_id": "///F/963/NH2", "atom2_id": "///F/1039/NZ", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 2283, "atom1_serNum": 18447, "atom2_serNum": 18478, "donAcc_type": "standard", "distance": 2.938, "atom1_id": "///F/964/O", "atom2_id": "///F/968/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2284, "atom1_serNum": 18455, "atom2_serNum": 18487, "donAcc_type": "standard", "distance": 2.917, "atom1_id": "///F/965/O", "atom2_id": "///F/969/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2285, "atom1_serNum": 18463, "atom2_serNum": 18494, "donAcc_type": "standard", "distance": 2.874, "atom1_id": "///F/966/O", "atom2_id": "///F/970/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2286, "atom1_serNum": 18470, "atom2_serNum": 18502, "donAcc_type": "standard", "distance": 2.802, "atom1_id": "///F/967/O", "atom2_id": "///F/971/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2287, "atom1_serNum": 18477, "atom2_serNum": 18804, "donAcc_type": "standard", "distance": 3.026, "atom1_id": "///F/967/NH2", "atom2_id": "///F/1040/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2288, "atom1_serNum": 18481, "atom2_serNum": 18510, "donAcc_type": "standard", "distance": 2.704, "atom1_id": "///F/968/O", "atom2_id": "///F/972/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2289, "atom1_serNum": 18490, "atom2_serNum": 18518, "donAcc_type": "standard", "distance": 2.916, "atom1_id": "///F/969/O", "atom2_id": "///F/973/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2290, "atom1_serNum": 18497, "atom2_serNum": 18526, "donAcc_type": "standard", "distance": 2.971, "atom1_id": "///F/970/O", "atom2_id": "///F/974/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2291, "atom1_serNum": 18497, "atom2_serNum": 18531, "donAcc_type": "acceptable", "distance": 2.582, "atom1_id": "///F/970/O", "atom2_id": "///F/974/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 2292, "atom1_serNum": 18505, "atom2_serNum": 18533, "donAcc_type": "standard", "distance": 2.884, "atom1_id": "///F/971/O", "atom2_id": "///F/975/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2293, "atom1_serNum": 18508, "atom2_serNum": 18852, "donAcc_type": "standard", "distance": 3.056, "atom1_id": "///F/971/OD1", "atom2_id": "///F/1046/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2294, "atom1_serNum": 18513, "atom2_serNum": 18540, "donAcc_type": "standard", "distance": 3.211, "atom1_id": "///F/972/O", "atom2_id": "///F/976/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2295, "atom1_serNum": 18521, "atom2_serNum": 18546, "donAcc_type": "standard", "distance": 3.474, "atom1_id": "///F/973/O", "atom2_id": "///F/977/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2296, "atom1_serNum": 18529, "atom2_serNum": 18552, "donAcc_type": "standard", "distance": 2.865, "atom1_id": "///F/974/O", "atom2_id": "///F/978/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2297, "atom1_serNum": 18543, "atom2_serNum": 18587, "donAcc_type": "acceptable", "distance": 2.740, "atom1_id": "///F/976/O", "atom2_id": "///F/1012/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 2298, "atom1_serNum": 18549, "atom2_serNum": 18582, "donAcc_type": "standard", "distance": 2.499, "atom1_id": "///F/977/O", "atom2_id": "///F/1012/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2299, "atom1_serNum": 18549, "atom2_serNum": 18587, "donAcc_type": "acceptable", "distance": 3.050, "atom1_id": "///F/977/O", "atom2_id": "///F/1012/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 2300, "atom1_serNum": 18577, "atom2_serNum": 18617, "donAcc_type": "standard", "distance": 3.865, "atom1_id": "///F/1011/O", "atom2_id": "///F/1016/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2301, "atom1_serNum": 18585, "atom2_serNum": 18605, "donAcc_type": "standard", "distance": 2.538, "atom1_id": "///F/1012/O", "atom2_id": "///F/1015/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2302, "atom1_serNum": 18585, "atom2_serNum": 18609, "donAcc_type": "standard", "distance": 2.753, "atom1_id": "///F/1012/O", "atom2_id": "///F/1016/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2303, "atom1_serNum": 18587, "atom2_serNum": 18605, "donAcc_type": "acceptable", "distance": 2.786, "atom1_id": "///F/1012/OG1", "atom2_id": "///F/1015/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2304, "atom1_serNum": 18589, "atom2_serNum": 18596, "donAcc_type": "standard", "distance": 2.615, "atom1_id": "///F/1013/N", "atom2_id": "///F/1013/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2305, "atom1_serNum": 18592, "atom2_serNum": 18618, "donAcc_type": "standard", "distance": 3.256, "atom1_id": "///F/1013/O", "atom2_id": "///F/1017/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2306, "atom1_serNum": 18608, "atom2_serNum": 18632, "donAcc_type": "standard", "distance": 3.325, "atom1_id": "///F/1015/O", "atom2_id": "///F/1019/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2307, "atom1_serNum": 18612, "atom2_serNum": 18640, "donAcc_type": "standard", "distance": 3.473, "atom1_id": "///F/1016/O", "atom2_id": "///F/1020/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2308, "atom1_serNum": 18621, "atom2_serNum": 18640, "donAcc_type": "standard", "distance": 2.755, "atom1_id": "///F/1017/O", "atom2_id": "///F/1020/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2309, "atom1_serNum": 18652, "atom2_serNum": 18683, "donAcc_type": "standard", "distance": 3.222, "atom1_id": "///F/1021/O", "atom2_id": "///F/1025/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2310, "atom1_serNum": 18662, "atom2_serNum": 18689, "donAcc_type": "standard", "distance": 3.260, "atom1_id": "///F/1022/O", "atom2_id": "///F/1026/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2311, "atom1_serNum": 18662, "atom2_serNum": 18694, "donAcc_type": "acceptable", "distance": 2.913, "atom1_id": "///F/1022/O", "atom2_id": "///F/1026/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 2312, "atom1_serNum": 18671, "atom2_serNum": 18696, "donAcc_type": "standard", "distance": 2.972, "atom1_id": "///F/1023/O", "atom2_id": "///F/1027/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2313, "atom1_serNum": 18679, "atom2_serNum": 18701, "donAcc_type": "standard", "distance": 2.834, "atom1_id": "///F/1024/O", "atom2_id": "///F/1028/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2314, "atom1_serNum": 18686, "atom2_serNum": 18709, "donAcc_type": "standard", "distance": 3.022, "atom1_id": "///F/1025/O", "atom2_id": "///F/1029/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2315, "atom1_serNum": 18692, "atom2_serNum": 18717, "donAcc_type": "standard", "distance": 3.033, "atom1_id": "///F/1026/O", "atom2_id": "///F/1030/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2316, "atom1_serNum": 18699, "atom2_serNum": 18725, "donAcc_type": "standard", "distance": 3.207, "atom1_id": "///F/1027/O", "atom2_id": "///F/1031/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2317, "atom1_serNum": 18699, "atom2_serNum": 18730, "donAcc_type": "acceptable", "distance": 2.397, "atom1_id": "///F/1027/O", "atom2_id": "///F/1031/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 2318, "atom1_serNum": 18704, "atom2_serNum": 18732, "donAcc_type": "standard", "distance": 3.151, "atom1_id": "///F/1028/O", "atom2_id": "///F/1032/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2319, "atom1_serNum": 18712, "atom2_serNum": 18737, "donAcc_type": "standard", "distance": 3.197, "atom1_id": "///F/1029/O", "atom2_id": "///F/1033/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2320, "atom1_serNum": 18720, "atom2_serNum": 18748, "donAcc_type": "standard", "distance": 2.929, "atom1_id": "///F/1030/O", "atom2_id": "///F/1034/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2321, "atom1_serNum": 18728, "atom2_serNum": 18756, "donAcc_type": "standard", "distance": 3.107, "atom1_id": "///F/1031/O", "atom2_id": "///F/1035/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2322, "atom1_serNum": 18728, "atom2_serNum": 18761, "donAcc_type": "acceptable", "distance": 2.420, "atom1_id": "///F/1031/O", "atom2_id": "///F/1035/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 2323, "atom1_serNum": 18735, "atom2_serNum": 18761, "donAcc_type": "acceptable", "distance": 2.803, "atom1_id": "///F/1032/O", "atom2_id": "///F/1035/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 2324, "atom1_serNum": 18759, "atom2_serNum": 18775, "donAcc_type": "standard", "distance": 2.807, "atom1_id": "///F/1035/O", "atom2_id": "///F/1038/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2325, "atom1_serNum": 18765, "atom2_serNum": 18778, "donAcc_type": "questionable", "distance": 3.161, "atom1_id": "///F/1036/O", "atom2_id": "///F/1038/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 2326, "atom1_serNum": 18765, "atom2_serNum": 19139, "donAcc_type": "standard", "distance": 2.516, "atom1_id": "///F/1036/O", "atom2_id": "///F/1083/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2327, "atom1_serNum": 18797, "atom2_serNum": 20601, "donAcc_type": "questionable", "distance": 3.304, "atom1_id": "///F/1039/NZ", "atom2_id": "///H/127/NZ", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 2328, "atom1_serNum": 18801, "atom2_serNum": 18827, "donAcc_type": "standard", "distance": 3.906, "atom1_id": "///F/1040/O", "atom2_id": "///F/1044/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2329, "atom1_serNum": 18805, "atom2_serNum": 18821, "donAcc_type": "standard", "distance": 2.987, "atom1_id": "///F/1040/OD2", "atom2_id": "///F/1043/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2330, "atom1_serNum": 18809, "atom2_serNum": 18841, "donAcc_type": "standard", "distance": 3.006, "atom1_id": "///F/1041/O", "atom2_id": "///F/1045/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2331, "atom1_serNum": 18816, "atom2_serNum": 18841, "donAcc_type": "standard", "distance": 3.484, "atom1_id": "///F/1042/O", "atom2_id": "///F/1045/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2332, "atom1_serNum": 18824, "atom2_serNum": 18853, "donAcc_type": "standard", "distance": 2.901, "atom1_id": "///F/1043/O", "atom2_id": "///F/1047/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2333, "atom1_serNum": 18824, "atom2_serNum": 18858, "donAcc_type": "acceptable", "distance": 2.707, "atom1_id": "///F/1043/O", "atom2_id": "///F/1047/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 2334, "atom1_serNum": 18826, "atom2_serNum": 18858, "donAcc_type": "acceptable", "distance": 2.868, "atom1_id": "///F/1043/OG", "atom2_id": "///F/1047/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 2335, "atom1_serNum": 18830, "atom2_serNum": 18860, "donAcc_type": "standard", "distance": 3.107, "atom1_id": "///F/1044/O", "atom2_id": "///F/1048/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2336, "atom1_serNum": 18830, "atom2_serNum": 18865, "donAcc_type": "acceptable", "distance": 2.367, "atom1_id": "///F/1044/O", "atom2_id": "///F/1048/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 2337, "atom1_serNum": 18836, "atom2_serNum": 18867, "donAcc_type": "standard", "distance": 3.067, "atom1_id": "///F/1045/O", "atom2_id": "///F/1049/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2338, "atom1_serNum": 18836, "atom2_serNum": 18872, "donAcc_type": "acceptable", "distance": 2.730, "atom1_id": "///F/1045/O", "atom2_id": "///F/1049/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 2339, "atom1_serNum": 18845, "atom2_serNum": 18873, "donAcc_type": "standard", "distance": 3.203, "atom1_id": "///F/1046/O", "atom2_id": "///F/1050/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2340, "atom1_serNum": 18856, "atom2_serNum": 18882, "donAcc_type": "standard", "distance": 2.884, "atom1_id": "///F/1047/O", "atom2_id": "///F/1051/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2341, "atom1_serNum": 18856, "atom2_serNum": 18890, "donAcc_type": "standard", "distance": 2.741, "atom1_id": "///F/1047/O", "atom2_id": "///F/1052/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2342, "atom1_serNum": 18863, "atom2_serNum": 18896, "donAcc_type": "standard", "distance": 3.889, "atom1_id": "///F/1048/O", "atom2_id": "///F/1053/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2343, "atom1_serNum": 18885, "atom2_serNum": 18917, "donAcc_type": "standard", "distance": 3.317, "atom1_id": "///F/1051/O", "atom2_id": "///F/1055/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2344, "atom1_serNum": 18893, "atom2_serNum": 18925, "donAcc_type": "standard", "distance": 3.462, "atom1_id": "///F/1052/O", "atom2_id": "///F/1056/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2345, "atom1_serNum": 18899, "atom2_serNum": 18933, "donAcc_type": "standard", "distance": 2.783, "atom1_id": "///F/1053/O", "atom2_id": "///F/1057/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2346, "atom1_serNum": 18920, "atom2_serNum": 18942, "donAcc_type": "standard", "distance": 3.054, "atom1_id": "///F/1055/O", "atom2_id": "///F/1058/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2347, "atom1_serNum": 18928, "atom2_serNum": 18958, "donAcc_type": "standard", "distance": 3.169, "atom1_id": "///F/1056/O", "atom2_id": "///F/1060/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2348, "atom1_serNum": 18975, "atom2_serNum": 18983, "donAcc_type": "standard", "distance": 2.755, "atom1_id": "///F/1062/O", "atom2_id": "///F/1064/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2349, "atom1_serNum": 18975, "atom2_serNum": 19340, "donAcc_type": "acceptable", "distance": 3.436, "atom1_id": "///F/1062/O", "atom2_id": "///F/1108/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 2350, "atom1_serNum": 18994, "atom2_serNum": 19012, "donAcc_type": "standard", "distance": 2.822, "atom1_id": "///F/1065/O", "atom2_id": "///F/1068/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2351, "atom1_serNum": 18994, "atom2_serNum": 19017, "donAcc_type": "standard", "distance": 3.237, "atom1_id": "///F/1065/O", "atom2_id": "///F/1069/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2352, "atom1_serNum": 19002, "atom2_serNum": 19024, "donAcc_type": "standard", "distance": 3.291, "atom1_id": "///F/1066/O", "atom2_id": "///F/1070/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2353, "atom1_serNum": 19007, "atom2_serNum": 19029, "donAcc_type": "acceptable", "distance": 2.800, "atom1_id": "///F/1067/O", "atom2_id": "///F/1070/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 2354, "atom1_serNum": 19007, "atom2_serNum": 19031, "donAcc_type": "standard", "distance": 3.253, "atom1_id": "///F/1067/O", "atom2_id": "///F/1071/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2355, "atom1_serNum": 19015, "atom2_serNum": 19031, "donAcc_type": "standard", "distance": 2.952, "atom1_id": "///F/1068/O", "atom2_id": "///F/1071/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2356, "atom1_serNum": 19015, "atom2_serNum": 19045, "donAcc_type": "standard", "distance": 2.941, "atom1_id": "///F/1068/O", "atom2_id": "///F/1072/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2357, "atom1_serNum": 19020, "atom2_serNum": 19053, "donAcc_type": "standard", "distance": 3.565, "atom1_id": "///F/1069/O", "atom2_id": "///F/1073/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2358, "atom1_serNum": 19027, "atom2_serNum": 19064, "donAcc_type": "standard", "distance": 3.327, "atom1_id": "///F/1070/O", "atom2_id": "///F/1074/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2359, "atom1_serNum": 19027, "atom2_serNum": 19069, "donAcc_type": "acceptable", "distance": 2.338, "atom1_id": "///F/1070/O", "atom2_id": "///F/1074/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 2360, "atom1_serNum": 19034, "atom2_serNum": 19071, "donAcc_type": "standard", "distance": 3.084, "atom1_id": "///F/1071/O", "atom2_id": "///F/1075/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2361, "atom1_serNum": 19034, "atom2_serNum": 19076, "donAcc_type": "acceptable", "distance": 2.670, "atom1_id": "///F/1071/O", "atom2_id": "///F/1075/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 2362, "atom1_serNum": 19048, "atom2_serNum": 19071, "donAcc_type": "standard", "distance": 3.157, "atom1_id": "///F/1072/O", "atom2_id": "///F/1075/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2363, "atom1_serNum": 19048, "atom2_serNum": 19077, "donAcc_type": "standard", "distance": 3.183, "atom1_id": "///F/1072/O", "atom2_id": "///F/1076/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2364, "atom1_serNum": 19056, "atom2_serNum": 19084, "donAcc_type": "standard", "distance": 3.085, "atom1_id": "///F/1073/O", "atom2_id": "///F/1077/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2365, "atom1_serNum": 19067, "atom2_serNum": 19092, "donAcc_type": "standard", "distance": 2.944, "atom1_id": "///F/1074/O", "atom2_id": "///F/1078/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2366, "atom1_serNum": 19074, "atom2_serNum": 19101, "donAcc_type": "standard", "distance": 3.146, "atom1_id": "///F/1075/O", "atom2_id": "///F/1079/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2367, "atom1_serNum": 19080, "atom2_serNum": 19105, "donAcc_type": "standard", "distance": 3.119, "atom1_id": "///F/1076/O", "atom2_id": "///F/1080/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2368, "atom1_serNum": 19087, "atom2_serNum": 19113, "donAcc_type": "standard", "distance": 2.709, "atom1_id": "///F/1077/O", "atom2_id": "///F/1081/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2369, "atom1_serNum": 19095, "atom2_serNum": 19122, "donAcc_type": "standard", "distance": 2.582, "atom1_id": "///F/1078/O", "atom2_id": "///F/1082/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2370, "atom1_serNum": 19104, "atom2_serNum": 19130, "donAcc_type": "standard", "distance": 2.656, "atom1_id": "///F/1079/O", "atom2_id": "///F/1083/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2371, "atom1_serNum": 19133, "atom2_serNum": 19144, "donAcc_type": "standard", "distance": 2.742, "atom1_id": "///F/1083/O", "atom2_id": "///F/1085/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2372, "atom1_serNum": 19151, "atom2_serNum": 20629, "donAcc_type": "standard", "distance": 3.369, "atom1_id": "///F/1085/OE1", "atom2_id": "///H/130/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2373, "atom1_serNum": 19156, "atom2_serNum": 19181, "donAcc_type": "standard", "distance": 3.292, "atom1_id": "///F/1086/O", "atom2_id": "///F/1090/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2374, "atom1_serNum": 19162, "atom2_serNum": 21687, "donAcc_type": "standard", "distance": 3.590, "atom1_id": "///F/1086/NE2", "atom2_id": "///J/49/O3'", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 2375, "atom1_serNum": 19166, "atom2_serNum": 19189, "donAcc_type": "standard", "distance": 3.635, "atom1_id": "///F/1087/O", "atom2_id": "///F/1091/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2376, "atom1_serNum": 19174, "atom2_serNum": 19194, "donAcc_type": "standard", "distance": 3.522, "atom1_id": "///F/1088/O", "atom2_id": "///F/1092/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2377, "atom1_serNum": 19178, "atom2_serNum": 19200, "donAcc_type": "standard", "distance": 2.746, "atom1_id": "///F/1089/O", "atom2_id": "///F/1093/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2378, "atom1_serNum": 19184, "atom2_serNum": 19208, "donAcc_type": "standard", "distance": 2.867, "atom1_id": "///F/1090/O", "atom2_id": "///F/1094/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2379, "atom1_serNum": 19192, "atom2_serNum": 19215, "donAcc_type": "standard", "distance": 3.203, "atom1_id": "///F/1091/O", "atom2_id": "///F/1095/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2380, "atom1_serNum": 19197, "atom2_serNum": 19225, "donAcc_type": "standard", "distance": 3.064, "atom1_id": "///F/1092/O", "atom2_id": "///F/1096/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2381, "atom1_serNum": 19203, "atom2_serNum": 19233, "donAcc_type": "standard", "distance": 2.710, "atom1_id": "///F/1093/O", "atom2_id": "///F/1097/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2382, "atom1_serNum": 19211, "atom2_serNum": 19238, "donAcc_type": "standard", "distance": 2.781, "atom1_id": "///F/1094/O", "atom2_id": "///F/1098/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2383, "atom1_serNum": 19218, "atom2_serNum": 19249, "donAcc_type": "standard", "distance": 3.091, "atom1_id": "///F/1095/O", "atom2_id": "///F/1099/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2384, "atom1_serNum": 19228, "atom2_serNum": 19258, "donAcc_type": "standard", "distance": 3.224, "atom1_id": "///F/1096/O", "atom2_id": "///F/1100/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2385, "atom1_serNum": 19236, "atom2_serNum": 19266, "donAcc_type": "standard", "distance": 3.109, "atom1_id": "///F/1097/O", "atom2_id": "///F/1101/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2386, "atom1_serNum": 19252, "atom2_serNum": 19287, "donAcc_type": "standard", "distance": 3.297, "atom1_id": "///F/1099/O", "atom2_id": "///F/1103/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2387, "atom1_serNum": 19261, "atom2_serNum": 19292, "donAcc_type": "standard", "distance": 3.334, "atom1_id": "///F/1100/O", "atom2_id": "///F/1104/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2388, "atom1_serNum": 19295, "atom2_serNum": 19329, "donAcc_type": "standard", "distance": 3.044, "atom1_id": "///F/1104/O", "atom2_id": "///F/1108/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2389, "atom1_serNum": 19309, "atom2_serNum": 19521, "donAcc_type": "standard", "distance": 2.909, "atom1_id": "///F/1105/NH1", "atom2_id": "///F/1130/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2390, "atom1_serNum": 19310, "atom2_serNum": 19344, "donAcc_type": "standard", "distance": 3.522, "atom1_id": "///F/1105/NH2", "atom2_id": "///F/1109/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2391, "atom1_serNum": 19352, "atom2_serNum": 19382, "donAcc_type": "standard", "distance": 3.816, "atom1_id": "///F/1110/O", "atom2_id": "///F/1114/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2392, "atom1_serNum": 19361, "atom2_serNum": 19389, "donAcc_type": "standard", "distance": 3.596, "atom1_id": "///F/1111/O", "atom2_id": "///F/1115/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2393, "atom1_serNum": 19375, "atom2_serNum": 19494, "donAcc_type": "standard", "distance": 2.798, "atom1_id": "///F/1112/NH1", "atom2_id": "///F/1127/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2394, "atom1_serNum": 19375, "atom2_serNum": 19522, "donAcc_type": "standard", "distance": 3.230, "atom1_id": "///F/1112/NH1", "atom2_id": "///F/1130/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2395, "atom1_serNum": 19376, "atom2_serNum": 19494, "donAcc_type": "standard", "distance": 2.704, "atom1_id": "///F/1112/NH2", "atom2_id": "///F/1127/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2396, "atom1_serNum": 19385, "atom2_serNum": 19406, "donAcc_type": "standard", "distance": 3.062, "atom1_id": "///F/1114/O", "atom2_id": "///F/1117/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2397, "atom1_serNum": 19392, "atom2_serNum": 19415, "donAcc_type": "standard", "distance": 2.989, "atom1_id": "///F/1115/O", "atom2_id": "///F/1118/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2398, "atom1_serNum": 19404, "atom2_serNum": 19464, "donAcc_type": "standard", "distance": 3.901, "atom1_id": "///F/1116/OE1", "atom2_id": "///F/1123/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2399, "atom1_serNum": 19442, "atom2_serNum": 19456, "donAcc_type": "standard", "distance": 3.293, "atom1_id": "///F/1121/O", "atom2_id": "///F/1123/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2400, "atom1_serNum": 19450, "atom2_serNum": 19478, "donAcc_type": "acceptable", "distance": 2.484, "atom1_id": "///F/1122/O", "atom2_id": "///F/1125/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 2401, "atom1_serNum": 19450, "atom2_serNum": 19479, "donAcc_type": "standard", "distance": 3.099, "atom1_id": "///F/1122/O", "atom2_id": "///F/1126/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2402, "atom1_serNum": 19459, "atom2_serNum": 19487, "donAcc_type": "standard", "distance": 2.835, "atom1_id": "///F/1123/O", "atom2_id": "///F/1127/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2403, "atom1_serNum": 19468, "atom2_serNum": 19495, "donAcc_type": "standard", "distance": 3.389, "atom1_id": "///F/1124/O", "atom2_id": "///F/1128/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2404, "atom1_serNum": 19476, "atom2_serNum": 19504, "donAcc_type": "standard", "distance": 3.303, "atom1_id": "///F/1125/O", "atom2_id": "///F/1129/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2405, "atom1_serNum": 19482, "atom2_serNum": 19515, "donAcc_type": "standard", "distance": 2.749, "atom1_id": "///F/1126/O", "atom2_id": "///F/1130/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2406, "atom1_serNum": 19490, "atom2_serNum": 19523, "donAcc_type": "standard", "distance": 3.176, "atom1_id": "///F/1127/O", "atom2_id": "///F/1131/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2407, "atom1_serNum": 19526, "atom2_serNum": 19561, "donAcc_type": "standard", "distance": 2.671, "atom1_id": "///F/1131/O", "atom2_id": "///F/1135/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2408, "atom1_serNum": 19578, "atom2_serNum": 19595, "donAcc_type": "standard", "distance": 2.813, "atom1_id": "///G/1306/O", "atom2_id": "///G/1310/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2409, "atom1_serNum": 19583, "atom2_serNum": 19600, "donAcc_type": "standard", "distance": 2.991, "atom1_id": "///G/1307/O", "atom2_id": "///G/1311/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2410, "atom1_serNum": 19588, "atom2_serNum": 19605, "donAcc_type": "standard", "distance": 3.302, "atom1_id": "///G/1308/O", "atom2_id": "///G/1312/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2411, "atom1_serNum": 19593, "atom2_serNum": 19610, "donAcc_type": "standard", "distance": 2.991, "atom1_id": "///G/1309/O", "atom2_id": "///G/1313/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2412, "atom1_serNum": 19598, "atom2_serNum": 19615, "donAcc_type": "standard", "distance": 3.214, "atom1_id": "///G/1310/O", "atom2_id": "///G/1314/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2413, "atom1_serNum": 19603, "atom2_serNum": 19620, "donAcc_type": "standard", "distance": 3.101, "atom1_id": "///G/1311/O", "atom2_id": "///G/1315/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2414, "atom1_serNum": 19608, "atom2_serNum": 19625, "donAcc_type": "standard", "distance": 2.801, "atom1_id": "///G/1312/O", "atom2_id": "///G/1316/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2415, "atom1_serNum": 19651, "atom2_serNum": 20039, "donAcc_type": "questionable", "distance": 3.180, "atom1_id": "///H/8/OE1", "atom2_id": "///H/58/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 2416, "atom1_serNum": 19669, "atom2_serNum": 20054, "donAcc_type": "standard", "distance": 2.710, "atom1_id": "///H/11/N", "atom2_id": "///H/60/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2417, "atom1_serNum": 19672, "atom2_serNum": 20071, "donAcc_type": "standard", "distance": 2.770, "atom1_id": "///H/11/O", "atom2_id": "///H/62/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2418, "atom1_serNum": 19680, "atom2_serNum": 20254, "donAcc_type": "standard", "distance": 2.927, "atom1_id": "///H/12/N", "atom2_id": "///H/84/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2419, "atom1_serNum": 19683, "atom2_serNum": 20247, "donAcc_type": "standard", "distance": 3.253, "atom1_id": "///H/12/O", "atom2_id": "///H/84/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2420, "atom1_serNum": 19688, "atom2_serNum": 20204, "donAcc_type": "standard", "distance": 2.846, "atom1_id": "///H/12/NZ", "atom2_id": "///H/79/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2421, "atom1_serNum": 19689, "atom2_serNum": 20074, "donAcc_type": "standard", "distance": 2.653, "atom1_id": "///H/13/N", "atom2_id": "///H/62/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2422, "atom1_serNum": 19692, "atom2_serNum": 20086, "donAcc_type": "standard", "distance": 2.647, "atom1_id": "///H/13/O", "atom2_id": "///H/64/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2423, "atom1_serNum": 19697, "atom2_serNum": 20259, "donAcc_type": "standard", "distance": 3.065, "atom1_id": "///H/14/N", "atom2_id": "///H/85/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2424, "atom1_serNum": 19700, "atom2_serNum": 20267, "donAcc_type": "standard", "distance": 2.857, "atom1_id": "///H/14/O", "atom2_id": "///H/87/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2425, "atom1_serNum": 19704, "atom2_serNum": 20089, "donAcc_type": "standard", "distance": 3.150, "atom1_id": "///H/15/N", "atom2_id": "///H/64/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2426, "atom1_serNum": 19707, "atom2_serNum": 20108, "donAcc_type": "standard", "distance": 3.295, "atom1_id": "///H/15/O", "atom2_id": "///H/66/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2427, "atom1_serNum": 19707, "atom2_serNum": 20113, "donAcc_type": "acceptable", "distance": 2.908, "atom1_id": "///H/15/O", "atom2_id": "///H/66/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 2428, "atom1_serNum": 19712, "atom2_serNum": 20270, "donAcc_type": "standard", "distance": 3.065, "atom1_id": "///H/16/N", "atom2_id": "///H/87/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2429, "atom1_serNum": 19715, "atom2_serNum": 20283, "donAcc_type": "standard", "distance": 2.788, "atom1_id": "///H/16/O", "atom2_id": "///H/89/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2430, "atom1_serNum": 19723, "atom2_serNum": 20286, "donAcc_type": "standard", "distance": 3.985, "atom1_id": "///H/18/N", "atom2_id": "///H/89/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2431, "atom1_serNum": 19726, "atom2_serNum": 19744, "donAcc_type": "acceptable", "distance": 3.013, "atom1_id": "///H/18/O", "atom2_id": "///H/21/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 2432, "atom1_serNum": 19726, "atom2_serNum": 22031, "donAcc_type": "acceptable", "distance": 3.076, "atom1_id": "///H/18/O", "atom2_id": "///H/1177/O1G", "atom_pair": "O:O", "residue_pair": "aa:ligand" }, { "index": 2433, "atom1_serNum": 19729, "atom2_serNum": 20414, "donAcc_type": "standard", "distance": 2.943, "atom1_id": "///H/18/OD1", "atom2_id": "///H/104/NE1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2434, "atom1_serNum": 19730, "atom2_serNum": 20383, "donAcc_type": "standard", "distance": 2.484, "atom1_id": "///H/18/OD2", "atom2_id": "///H/100/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2435, "atom1_serNum": 19735, "atom2_serNum": 22034, "donAcc_type": "standard", "distance": 3.122, "atom1_id": "///H/20/N", "atom2_id": "///H/1177/O3B", "atom_pair": "N:O", "residue_pair": "aa:ligand" }, { "index": 2436, "atom1_serNum": 19738, "atom2_serNum": 20569, "donAcc_type": "standard", "distance": 2.682, "atom1_id": "///H/20/O", "atom2_id": "///H/123/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2437, "atom1_serNum": 19742, "atom2_serNum": 20560, "donAcc_type": "standard", "distance": 3.042, "atom1_id": "///H/21/O", "atom2_id": "///H/122/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2438, "atom1_serNum": 19744, "atom2_serNum": 19758, "donAcc_type": "acceptable", "distance": 3.604, "atom1_id": "///H/21/OG1", "atom2_id": "///H/23/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2439, "atom1_serNum": 19744, "atom2_serNum": 22036, "donAcc_type": "acceptable", "distance": 3.273, "atom1_id": "///H/21/OG1", "atom2_id": "///H/1177/O1B", "atom_pair": "O:O", "residue_pair": "aa:ligand" }, { "index": 2440, "atom1_serNum": 19746, "atom2_serNum": 22036, "donAcc_type": "acceptable", "distance": 2.859, "atom1_id": "///H/22/N", "atom2_id": "///H/1177/O1B", "atom_pair": "N:O", "residue_pair": "aa:ligand" }, { "index": 2441, "atom1_serNum": 19749, "atom2_serNum": 19773, "donAcc_type": "standard", "distance": 3.061, "atom1_id": "///H/22/O", "atom2_id": "///H/26/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2442, "atom1_serNum": 19750, "atom2_serNum": 22036, "donAcc_type": "acceptable", "distance": 2.973, "atom1_id": "///H/23/N", "atom2_id": "///H/1177/O1B", "atom_pair": "N:O", "residue_pair": "aa:ligand" }, { "index": 2443, "atom1_serNum": 19753, "atom2_serNum": 19784, "donAcc_type": "standard", "distance": 3.268, "atom1_id": "///H/23/O", "atom2_id": "///H/27/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2444, "atom1_serNum": 19758, "atom2_serNum": 22031, "donAcc_type": "acceptable", "distance": 2.554, "atom1_id": "///H/23/NZ", "atom2_id": "///H/1177/O1G", "atom_pair": "N:O", "residue_pair": "aa:ligand" }, { "index": 2445, "atom1_serNum": 19759, "atom2_serNum": 22037, "donAcc_type": "standard", "distance": 2.962, "atom1_id": "///H/24/N", "atom2_id": "///H/1177/O2B", "atom_pair": "N:O", "residue_pair": "aa:ligand" }, { "index": 2446, "atom1_serNum": 19759, "atom2_serNum": 22040, "donAcc_type": "acceptable", "distance": 2.516, "atom1_id": "///H/24/N", "atom2_id": "///H/1177/O1A", "atom_pair": "N:O", "residue_pair": "aa:ligand" }, { "index": 2447, "atom1_serNum": 19762, "atom2_serNum": 19791, "donAcc_type": "standard", "distance": 2.903, "atom1_id": "///H/24/O", "atom2_id": "///H/28/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2448, "atom1_serNum": 19764, "atom2_serNum": 19916, "donAcc_type": "acceptable", "distance": 2.501, "atom1_id": "///H/24/OG1", "atom2_id": "///H/42/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 2449, "atom1_serNum": 19764, "atom2_serNum": 20107, "donAcc_type": "acceptable", "distance": 2.724, "atom1_id": "///H/24/OG1", "atom2_id": "///H/65/OD2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 2450, "atom1_serNum": 19766, "atom2_serNum": 22040, "donAcc_type": "acceptable", "distance": 2.839, "atom1_id": "///H/25/N", "atom2_id": "///H/1177/O1A", "atom_pair": "N:O", "residue_pair": "aa:ligand" }, { "index": 2451, "atom1_serNum": 19769, "atom2_serNum": 19800, "donAcc_type": "standard", "distance": 3.055, "atom1_id": "///H/25/O", "atom2_id": "///H/29/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2452, "atom1_serNum": 19771, "atom2_serNum": 19863, "donAcc_type": "acceptable", "distance": 3.681, "atom1_id": "///H/25/OG1", "atom2_id": "///H/36/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 2453, "atom1_serNum": 19776, "atom2_serNum": 19811, "donAcc_type": "standard", "distance": 3.379, "atom1_id": "///H/26/O", "atom2_id": "///H/30/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2454, "atom1_serNum": 19787, "atom2_serNum": 19821, "donAcc_type": "standard", "distance": 2.910, "atom1_id": "///H/27/O", "atom2_id": "///H/31/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2455, "atom1_serNum": 19794, "atom2_serNum": 19829, "donAcc_type": "standard", "distance": 3.023, "atom1_id": "///H/28/O", "atom2_id": "///H/32/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2456, "atom1_serNum": 19794, "atom2_serNum": 19834, "donAcc_type": "acceptable", "distance": 2.835, "atom1_id": "///H/28/O", "atom2_id": "///H/32/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 2457, "atom1_serNum": 19803, "atom2_serNum": 19836, "donAcc_type": "standard", "distance": 2.668, "atom1_id": "///H/29/O", "atom2_id": "///H/33/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2458, "atom1_serNum": 19807, "atom2_serNum": 20828, "donAcc_type": "standard", "distance": 2.814, "atom1_id": "///H/29/NE", "atom2_id": "///H/154/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2459, "atom1_serNum": 19809, "atom2_serNum": 19849, "donAcc_type": "questionable", "distance": 3.017, "atom1_id": "///H/29/NH1", "atom2_id": "///H/35/N", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 2460, "atom1_serNum": 19820, "atom2_serNum": 20853, "donAcc_type": "standard", "distance": 3.160, "atom1_id": "///H/30/NE2", "atom2_id": "///H/157/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2461, "atom1_serNum": 19834, "atom2_serNum": 19840, "donAcc_type": "acceptable", "distance": 3.231, "atom1_id": "///H/32/OG1", "atom2_id": "///H/34/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2462, "atom1_serNum": 19863, "atom2_serNum": 22049, "donAcc_type": "acceptable", "distance": 3.357, "atom1_id": "///H/36/O", "atom2_id": "///H/1177/O2'", "atom_pair": "O:O", "residue_pair": "aa:ligand" }, { "index": 2463, "atom1_serNum": 19867, "atom2_serNum": 19878, "donAcc_type": "standard", "distance": 2.929, "atom1_id": "///H/36/OE1", "atom2_id": "///H/38/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2464, "atom1_serNum": 19872, "atom2_serNum": 22049, "donAcc_type": "acceptable", "distance": 2.946, "atom1_id": "///H/37/O", "atom2_id": "///H/1177/O2'", "atom_pair": "O:O", "residue_pair": "aa:ligand" }, { "index": 2465, "atom1_serNum": 19881, "atom2_serNum": 19899, "donAcc_type": "standard", "distance": 2.876, "atom1_id": "///H/38/O", "atom2_id": "///H/40/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2466, "atom1_serNum": 19890, "atom2_serNum": 19906, "donAcc_type": "standard", "distance": 3.297, "atom1_id": "///H/39/O", "atom2_id": "///H/41/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2467, "atom1_serNum": 19898, "atom2_serNum": 22032, "donAcc_type": "acceptable", "distance": 3.607, "atom1_id": "///H/39/OH", "atom2_id": "///H/1177/O2G", "atom_pair": "O:O", "residue_pair": "aa:ligand" }, { "index": 2468, "atom1_serNum": 19921, "atom2_serNum": 19930, "donAcc_type": "standard", "distance": 3.095, "atom1_id": "///H/43/O", "atom2_id": "///H/45/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2469, "atom1_serNum": 19926, "atom2_serNum": 20154, "donAcc_type": "standard", "distance": 2.595, "atom1_id": "///H/44/N", "atom2_id": "///H/72/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2470, "atom1_serNum": 19929, "atom2_serNum": 20115, "donAcc_type": "standard", "distance": 3.079, "atom1_id": "///H/44/O", "atom2_id": "///H/67/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2471, "atom1_serNum": 19937, "atom2_serNum": 20103, "donAcc_type": "standard", "distance": 3.381, "atom1_id": "///H/46/N", "atom2_id": "///H/65/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2472, "atom1_serNum": 19940, "atom2_serNum": 20082, "donAcc_type": "questionable", "distance": 3.172, "atom1_id": "///H/46/O", "atom2_id": "///H/63/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 2473, "atom1_serNum": 19940, "atom2_serNum": 20100, "donAcc_type": "standard", "distance": 3.220, "atom1_id": "///H/46/O", "atom2_id": "///H/65/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2474, "atom1_serNum": 19953, "atom2_serNum": 20082, "donAcc_type": "standard", "distance": 2.821, "atom1_id": "///H/48/N", "atom2_id": "///H/63/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2475, "atom1_serNum": 19956, "atom2_serNum": 20063, "donAcc_type": "questionable", "distance": 3.013, "atom1_id": "///H/48/O", "atom2_id": "///H/61/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 2476, "atom1_serNum": 19956, "atom2_serNum": 20079, "donAcc_type": "standard", "distance": 2.713, "atom1_id": "///H/48/O", "atom2_id": "///H/63/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2477, "atom1_serNum": 19970, "atom2_serNum": 20063, "donAcc_type": "standard", "distance": 2.631, "atom1_id": "///H/50/N", "atom2_id": "///H/61/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2478, "atom1_serNum": 19973, "atom2_serNum": 20060, "donAcc_type": "standard", "distance": 2.677, "atom1_id": "///H/50/O", "atom2_id": "///H/61/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2479, "atom1_serNum": 19985, "atom2_serNum": 20046, "donAcc_type": "standard", "distance": 2.669, "atom1_id": "///H/52/N", "atom2_id": "///H/59/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2480, "atom1_serNum": 19988, "atom2_serNum": 20006, "donAcc_type": "standard", "distance": 3.172, "atom1_id": "///H/52/O", "atom2_id": "///H/54/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2481, "atom1_serNum": 19988, "atom2_serNum": 20043, "donAcc_type": "standard", "distance": 2.954, "atom1_id": "///H/52/O", "atom2_id": "///H/59/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2482, "atom1_serNum": 19996, "atom2_serNum": 20002, "donAcc_type": "acceptable", "distance": 2.999, "atom1_id": "///H/53/N", "atom2_id": "///H/53/ND1", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 2483, "atom1_serNum": 20006, "atom2_serNum": 20035, "donAcc_type": "standard", "distance": 2.956, "atom1_id": "///H/54/N", "atom2_id": "///H/57/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2484, "atom1_serNum": 20011, "atom2_serNum": 20021, "donAcc_type": "acceptable", "distance": 2.789, "atom1_id": "///H/54/OG1", "atom2_id": "///H/56/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2485, "atom1_serNum": 20011, "atom2_serNum": 20035, "donAcc_type": "acceptable", "distance": 2.722, "atom1_id": "///H/54/OG1", "atom2_id": "///H/57/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 2486, "atom1_serNum": 20013, "atom2_serNum": 20019, "donAcc_type": "standard", "distance": 2.821, "atom1_id": "///H/55/N", "atom2_id": "///H/55/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2487, "atom1_serNum": 20013, "atom2_serNum": 21006, "donAcc_type": "standard", "distance": 3.130, "atom1_id": "///H/55/N", "atom2_id": "///H/175/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2488, "atom1_serNum": 20019, "atom2_serNum": 21003, "donAcc_type": "standard", "distance": 2.639, "atom1_id": "///H/55/OD1", "atom2_id": "///H/175/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2489, "atom1_serNum": 20030, "atom2_serNum": 20979, "donAcc_type": "standard", "distance": 3.134, "atom1_id": "///H/56/NH1", "atom2_id": "///H/171/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2490, "atom1_serNum": 20089, "atom2_serNum": 20108, "donAcc_type": "standard", "distance": 2.894, "atom1_id": "///H/64/O", "atom2_id": "///H/66/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2491, "atom1_serNum": 20120, "atom2_serNum": 22031, "donAcc_type": "acceptable", "distance": 3.262, "atom1_id": "///H/68/N", "atom2_id": "///H/1177/O1G", "atom_pair": "N:O", "residue_pair": "aa:ligand" }, { "index": 2492, "atom1_serNum": 20123, "atom2_serNum": 20133, "donAcc_type": "standard", "distance": 3.431, "atom1_id": "///H/68/O", "atom2_id": "///H/70/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2493, "atom1_serNum": 20127, "atom2_serNum": 20151, "donAcc_type": "standard", "distance": 2.850, "atom1_id": "///H/69/O", "atom2_id": "///H/72/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2494, "atom1_serNum": 20173, "atom2_serNum": 20189, "donAcc_type": "standard", "distance": 2.905, "atom1_id": "///H/75/O", "atom2_id": "///H/77/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2495, "atom1_serNum": 20173, "atom2_serNum": 20197, "donAcc_type": "standard", "distance": 3.147, "atom1_id": "///H/75/O", "atom2_id": "///H/78/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2496, "atom1_serNum": 20181, "atom2_serNum": 20201, "donAcc_type": "standard", "distance": 2.808, "atom1_id": "///H/76/O", "atom2_id": "///H/79/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2497, "atom1_serNum": 20189, "atom2_serNum": 20195, "donAcc_type": "standard", "distance": 2.708, "atom1_id": "///H/77/N", "atom2_id": "///H/77/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2498, "atom1_serNum": 20192, "atom2_serNum": 20213, "donAcc_type": "standard", "distance": 3.220, "atom1_id": "///H/77/O", "atom2_id": "///H/80/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2499, "atom1_serNum": 20262, "atom2_serNum": 20516, "donAcc_type": "standard", "distance": 3.117, "atom1_id": "///H/86/N", "atom2_id": "///H/116/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2500, "atom1_serNum": 20265, "atom2_serNum": 20528, "donAcc_type": "standard", "distance": 2.985, "atom1_id": "///H/86/O", "atom2_id": "///H/118/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2501, "atom1_serNum": 20275, "atom2_serNum": 20531, "donAcc_type": "standard", "distance": 2.968, "atom1_id": "///H/88/N", "atom2_id": "///H/118/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2502, "atom1_serNum": 20278, "atom2_serNum": 20543, "donAcc_type": "standard", "distance": 2.917, "atom1_id": "///H/88/O", "atom2_id": "///H/120/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2503, "atom1_serNum": 20291, "atom2_serNum": 20546, "donAcc_type": "standard", "distance": 2.850, "atom1_id": "///H/90/N", "atom2_id": "///H/120/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2504, "atom1_serNum": 20294, "atom2_serNum": 20553, "donAcc_type": "standard", "distance": 2.787, "atom1_id": "///H/90/O", "atom2_id": "///H/122/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2505, "atom1_serNum": 20302, "atom2_serNum": 20353, "donAcc_type": "acceptable", "distance": 3.081, "atom1_id": "///H/91/N", "atom2_id": "///H/97/OG1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2506, "atom1_serNum": 20305, "atom2_serNum": 20327, "donAcc_type": "questionable", "distance": 2.805, "atom1_id": "///H/91/O", "atom2_id": "///H/94/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 2507, "atom1_serNum": 20305, "atom2_serNum": 20353, "donAcc_type": "acceptable", "distance": 2.708, "atom1_id": "///H/91/O", "atom2_id": "///H/97/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 2508, "atom1_serNum": 20308, "atom2_serNum": 20310, "donAcc_type": "standard", "distance": 3.060, "atom1_id": "///H/91/OD1", "atom2_id": "///H/92/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2509, "atom1_serNum": 20308, "atom2_serNum": 20556, "donAcc_type": "questionable", "distance": 3.157, "atom1_id": "///H/91/OD1", "atom2_id": "///H/122/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 2510, "atom1_serNum": 20310, "atom2_serNum": 20556, "donAcc_type": "standard", "distance": 3.307, "atom1_id": "///H/92/N", "atom2_id": "///H/122/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2511, "atom1_serNum": 20313, "atom2_serNum": 20621, "donAcc_type": "standard", "distance": 3.074, "atom1_id": "///H/92/O", "atom2_id": "///H/130/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2512, "atom1_serNum": 20313, "atom2_serNum": 20630, "donAcc_type": "standard", "distance": 3.053, "atom1_id": "///H/92/O", "atom2_id": "///H/131/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2513, "atom1_serNum": 20320, "atom2_serNum": 20629, "donAcc_type": "standard", "distance": 3.806, "atom1_id": "///H/93/O", "atom2_id": "///H/130/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2514, "atom1_serNum": 20327, "atom2_serNum": 20353, "donAcc_type": "acceptable", "distance": 2.575, "atom1_id": "///H/94/O", "atom2_id": "///H/97/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 2515, "atom1_serNum": 20327, "atom2_serNum": 20355, "donAcc_type": "standard", "distance": 3.993, "atom1_id": "///H/94/O", "atom2_id": "///H/98/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2516, "atom1_serNum": 20333, "atom2_serNum": 20367, "donAcc_type": "standard", "distance": 3.369, "atom1_id": "///H/95/O", "atom2_id": "///H/99/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2517, "atom1_serNum": 20344, "atom2_serNum": 20367, "donAcc_type": "standard", "distance": 2.900, "atom1_id": "///H/96/O", "atom2_id": "///H/99/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2518, "atom1_serNum": 20344, "atom2_serNum": 20376, "donAcc_type": "standard", "distance": 3.087, "atom1_id": "///H/96/O", "atom2_id": "///H/100/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2519, "atom1_serNum": 20366, "atom2_serNum": 20674, "donAcc_type": "acceptable", "distance": 2.921, "atom1_id": "///H/98/OH", "atom2_id": "///H/137/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2520, "atom1_serNum": 20366, "atom2_serNum": 20681, "donAcc_type": "acceptable", "distance": 2.965, "atom1_id": "///H/98/OH", "atom2_id": "///H/138/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2521, "atom1_serNum": 20379, "atom2_serNum": 20398, "donAcc_type": "standard", "distance": 3.130, "atom1_id": "///H/100/O", "atom2_id": "///H/103/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2522, "atom1_serNum": 20379, "atom2_serNum": 20406, "donAcc_type": "standard", "distance": 3.177, "atom1_id": "///H/100/O", "atom2_id": "///H/104/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2523, "atom1_serNum": 20387, "atom2_serNum": 20420, "donAcc_type": "standard", "distance": 2.989, "atom1_id": "///H/101/O", "atom2_id": "///H/105/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2524, "atom1_serNum": 20394, "atom2_serNum": 20430, "donAcc_type": "standard", "distance": 3.173, "atom1_id": "///H/102/O", "atom2_id": "///H/106/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2525, "atom1_serNum": 20401, "atom2_serNum": 20441, "donAcc_type": "standard", "distance": 3.308, "atom1_id": "///H/103/O", "atom2_id": "///H/107/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2526, "atom1_serNum": 20423, "atom2_serNum": 20449, "donAcc_type": "standard", "distance": 2.676, "atom1_id": "///H/105/O", "atom2_id": "///H/108/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2527, "atom1_serNum": 20423, "atom2_serNum": 20457, "donAcc_type": "standard", "distance": 3.065, "atom1_id": "///H/105/O", "atom2_id": "///H/109/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2528, "atom1_serNum": 20433, "atom2_serNum": 20464, "donAcc_type": "standard", "distance": 3.201, "atom1_id": "///H/106/O", "atom2_id": "///H/110/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2529, "atom1_serNum": 20437, "atom2_serNum": 20447, "donAcc_type": "standard", "distance": 3.395, "atom1_id": "///H/106/NE", "atom2_id": "///H/107/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2530, "atom1_serNum": 20444, "atom2_serNum": 20475, "donAcc_type": "standard", "distance": 3.471, "atom1_id": "///H/107/O", "atom2_id": "///H/111/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2531, "atom1_serNum": 20452, "atom2_serNum": 20482, "donAcc_type": "standard", "distance": 2.923, "atom1_id": "///H/108/O", "atom2_id": "///H/112/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2532, "atom1_serNum": 20508, "atom2_serNum": 20520, "donAcc_type": "standard", "distance": 3.286, "atom1_id": "///H/115/O", "atom2_id": "///H/117/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2533, "atom1_serNum": 20523, "atom2_serNum": 20747, "donAcc_type": "standard", "distance": 3.646, "atom1_id": "///H/117/O", "atom2_id": "///H/145/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2534, "atom1_serNum": 20535, "atom2_serNum": 20750, "donAcc_type": "standard", "distance": 2.859, "atom1_id": "///H/119/N", "atom2_id": "///H/145/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2535, "atom1_serNum": 20538, "atom2_serNum": 20768, "donAcc_type": "standard", "distance": 3.244, "atom1_id": "///H/119/O", "atom2_id": "///H/147/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2536, "atom1_serNum": 20549, "atom2_serNum": 20771, "donAcc_type": "standard", "distance": 3.508, "atom1_id": "///H/121/N", "atom2_id": "///H/147/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2537, "atom1_serNum": 20552, "atom2_serNum": 20788, "donAcc_type": "standard", "distance": 2.768, "atom1_id": "///H/121/O", "atom2_id": "///H/149/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2538, "atom1_serNum": 20559, "atom2_serNum": 20802, "donAcc_type": "standard", "distance": 3.173, "atom1_id": "///H/122/OD1", "atom2_id": "///H/151/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2539, "atom1_serNum": 20560, "atom2_serNum": 22053, "donAcc_type": "standard", "distance": 3.244, "atom1_id": "///H/122/ND2", "atom2_id": "///H/1177/N7", "atom_pair": "N:N", "residue_pair": "aa:ligand" }, { "index": 2540, "atom1_serNum": 20561, "atom2_serNum": 20791, "donAcc_type": "standard", "distance": 3.026, "atom1_id": "///H/123/N", "atom2_id": "///H/149/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2541, "atom1_serNum": 20564, "atom2_serNum": 20585, "donAcc_type": "standard", "distance": 3.565, "atom1_id": "///H/123/O", "atom2_id": "///H/126/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2542, "atom1_serNum": 20577, "atom2_serNum": 20584, "donAcc_type": "standard", "distance": 2.637, "atom1_id": "///H/125/N", "atom2_id": "///H/125/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2543, "atom1_serNum": 20583, "atom2_serNum": 22059, "donAcc_type": "standard", "distance": 3.145, "atom1_id": "///H/125/OD1", "atom2_id": "///H/1177/N2", "atom_pair": "O:N", "residue_pair": "aa:ligand" }, { "index": 2544, "atom1_serNum": 20584, "atom2_serNum": 22057, "donAcc_type": "standard", "distance": 2.712, "atom1_id": "///H/125/OD2", "atom2_id": "///H/1177/N1", "atom_pair": "O:N", "residue_pair": "aa:ligand" }, { "index": 2545, "atom1_serNum": 20602, "atom2_serNum": 20608, "donAcc_type": "standard", "distance": 2.779, "atom1_id": "///H/128/N", "atom2_id": "///H/128/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2546, "atom1_serNum": 20605, "atom2_serNum": 20621, "donAcc_type": "standard", "distance": 3.310, "atom1_id": "///H/128/O", "atom2_id": "///H/130/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2547, "atom1_serNum": 20617, "atom2_serNum": 20633, "donAcc_type": "standard", "distance": 3.180, "atom1_id": "///H/129/NE", "atom2_id": "///H/131/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2548, "atom1_serNum": 20620, "atom2_serNum": 20633, "donAcc_type": "standard", "distance": 3.307, "atom1_id": "///H/129/NH2", "atom2_id": "///H/131/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2549, "atom1_serNum": 20640, "atom2_serNum": 20660, "donAcc_type": "standard", "distance": 2.870, "atom1_id": "///H/132/O", "atom2_id": "///H/135/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2550, "atom1_serNum": 20640, "atom2_serNum": 20665, "donAcc_type": "acceptable", "distance": 2.522, "atom1_id": "///H/132/O", "atom2_id": "///H/135/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 2551, "atom1_serNum": 20645, "atom2_serNum": 21681, "donAcc_type": "standard", "distance": 2.741, "atom1_id": "///H/132/NZ", "atom2_id": "///J/49/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 2552, "atom1_serNum": 20645, "atom2_serNum": 21701, "donAcc_type": "standard", "distance": 3.413, "atom1_id": "///H/132/NZ", "atom2_id": "///J/50/OP2", "atom_pair": "N:O", "residue_pair": "aa:nt" }, { "index": 2553, "atom1_serNum": 20663, "atom2_serNum": 20674, "donAcc_type": "standard", "distance": 3.163, "atom1_id": "///H/135/O", "atom2_id": "///H/137/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2554, "atom1_serNum": 20677, "atom2_serNum": 20702, "donAcc_type": "standard", "distance": 3.201, "atom1_id": "///H/137/O", "atom2_id": "///H/140/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2555, "atom1_serNum": 20677, "atom2_serNum": 20713, "donAcc_type": "standard", "distance": 3.366, "atom1_id": "///H/137/O", "atom2_id": "///H/141/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2556, "atom1_serNum": 20684, "atom2_serNum": 20722, "donAcc_type": "standard", "distance": 3.074, "atom1_id": "///H/138/O", "atom2_id": "///H/142/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2557, "atom1_serNum": 20692, "atom2_serNum": 20698, "donAcc_type": "acceptable", "distance": 3.004, "atom1_id": "///H/139/N", "atom2_id": "///H/139/ND1", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 2558, "atom1_serNum": 20695, "atom2_serNum": 20739, "donAcc_type": "standard", "distance": 2.675, "atom1_id": "///H/139/O", "atom2_id": "///H/144/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2559, "atom1_serNum": 20783, "atom2_serNum": 20848, "donAcc_type": "questionable", "distance": 2.913, "atom1_id": "///H/148/O", "atom2_id": "///H/156/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 2560, "atom1_serNum": 20796, "atom2_serNum": 20833, "donAcc_type": "standard", "distance": 3.287, "atom1_id": "///H/150/N", "atom2_id": "///H/155/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2561, "atom1_serNum": 20799, "atom2_serNum": 20822, "donAcc_type": "standard", "distance": 2.579, "atom1_id": "///H/150/O", "atom2_id": "///H/154/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2562, "atom1_serNum": 20801, "atom2_serNum": 20816, "donAcc_type": "acceptable", "distance": 2.762, "atom1_id": "///H/150/OG", "atom2_id": "///H/153/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2563, "atom1_serNum": 20801, "atom2_serNum": 22056, "donAcc_type": "acceptable", "distance": 2.872, "atom1_id": "///H/150/OG", "atom2_id": "///H/1177/O6", "atom_pair": "O:O", "residue_pair": "aa:ligand" }, { "index": 2564, "atom1_serNum": 20802, "atom2_serNum": 22056, "donAcc_type": "standard", "distance": 2.628, "atom1_id": "///H/151/N", "atom2_id": "///H/1177/O6", "atom_pair": "N:O", "residue_pair": "aa:ligand" }, { "index": 2565, "atom1_serNum": 20819, "atom2_serNum": 20821, "donAcc_type": "acceptable", "distance": 2.895, "atom1_id": "///H/153/O", "atom2_id": "///H/153/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 2566, "atom1_serNum": 20822, "atom2_serNum": 20828, "donAcc_type": "standard", "distance": 2.772, "atom1_id": "///H/154/N", "atom2_id": "///H/154/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2567, "atom1_serNum": 20825, "atom2_serNum": 20842, "donAcc_type": "standard", "distance": 3.186, "atom1_id": "///H/154/O", "atom2_id": "///H/156/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2568, "atom1_serNum": 20864, "atom2_serNum": 20886, "donAcc_type": "standard", "distance": 2.915, "atom1_id": "///H/158/O", "atom2_id": "///H/161/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2569, "atom1_serNum": 20864, "atom2_serNum": 20897, "donAcc_type": "standard", "distance": 2.913, "atom1_id": "///H/158/O", "atom2_id": "///H/162/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2570, "atom1_serNum": 20873, "atom2_serNum": 20905, "donAcc_type": "standard", "distance": 3.097, "atom1_id": "///H/159/O", "atom2_id": "///H/163/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2571, "atom1_serNum": 20882, "atom2_serNum": 20919, "donAcc_type": "standard", "distance": 3.240, "atom1_id": "///H/160/O", "atom2_id": "///H/164/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2572, "atom1_serNum": 20889, "atom2_serNum": 20927, "donAcc_type": "standard", "distance": 2.949, "atom1_id": "///H/161/O", "atom2_id": "///H/165/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2573, "atom1_serNum": 20900, "atom2_serNum": 20932, "donAcc_type": "standard", "distance": 2.933, "atom1_id": "///H/162/O", "atom2_id": "///H/166/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2574, "atom1_serNum": 20908, "atom2_serNum": 20943, "donAcc_type": "standard", "distance": 3.088, "atom1_id": "///H/163/O", "atom2_id": "///H/167/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2575, "atom1_serNum": 20922, "atom2_serNum": 20943, "donAcc_type": "standard", "distance": 2.793, "atom1_id": "///H/164/O", "atom2_id": "///H/167/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2576, "atom1_serNum": 20922, "atom2_serNum": 20952, "donAcc_type": "standard", "distance": 2.837, "atom1_id": "///H/164/O", "atom2_id": "///H/168/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2577, "atom1_serNum": 20930, "atom2_serNum": 20960, "donAcc_type": "standard", "distance": 3.078, "atom1_id": "///H/165/O", "atom2_id": "///H/169/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2578, "atom1_serNum": 20935, "atom2_serNum": 20972, "donAcc_type": "standard", "distance": 3.197, "atom1_id": "///H/166/O", "atom2_id": "///H/171/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2579, "atom1_serNum": 20939, "atom2_serNum": 20998, "donAcc_type": "standard", "distance": 2.419, "atom1_id": "///H/166/NE", "atom2_id": "///H/174/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2580, "atom1_serNum": 20942, "atom2_serNum": 20998, "donAcc_type": "standard", "distance": 3.226, "atom1_id": "///H/166/NH2", "atom2_id": "///H/174/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 2581, "atom1_serNum": 20975, "atom2_serNum": 20995, "donAcc_type": "standard", "distance": 2.804, "atom1_id": "///H/171/O", "atom2_id": "///H/174/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 2582, "atom1_serNum": 21038, "atom2_serNum": 21950, "donAcc_type": "standard", "distance": 2.777, "atom1_id": "///I/1/O6", "atom2_id": "///J/61/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 2583, "atom1_serNum": 21039, "atom2_serNum": 21948, "donAcc_type": "standard", "distance": 2.772, "atom1_id": "///I/1/N1", "atom2_id": "///J/61/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 2584, "atom1_serNum": 21041, "atom2_serNum": 21947, "donAcc_type": "standard", "distance": 2.951, "atom1_id": "///I/1/N2", "atom2_id": "///J/61/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 2585, "atom1_serNum": 21061, "atom2_serNum": 21930, "donAcc_type": "standard", "distance": 3.039, "atom1_id": "///I/2/O6", "atom2_id": "///J/60/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 2586, "atom1_serNum": 21062, "atom2_serNum": 21928, "donAcc_type": "standard", "distance": 2.919, "atom1_id": "///I/2/N1", "atom2_id": "///J/60/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 2587, "atom1_serNum": 21064, "atom2_serNum": 21927, "donAcc_type": "standard", "distance": 3.100, "atom1_id": "///I/2/N2", "atom2_id": "///J/60/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 2588, "atom1_serNum": 21081, "atom2_serNum": 21908, "donAcc_type": "standard", "distance": 3.133, "atom1_id": "///I/3/O2", "atom2_id": "///J/59/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 2589, "atom1_serNum": 21082, "atom2_serNum": 21907, "donAcc_type": "standard", "distance": 2.954, "atom1_id": "///I/3/N3", "atom2_id": "///J/59/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 2590, "atom1_serNum": 21104, "atom2_serNum": 21867, "donAcc_type": "standard", "distance": 3.977, "atom1_id": "///I/4/N6", "atom2_id": "///J/57/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 2591, "atom1_serNum": 21104, "atom2_serNum": 21887, "donAcc_type": "standard", "distance": 3.014, "atom1_id": "///I/4/N6", "atom2_id": "///J/58/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 2592, "atom1_serNum": 21105, "atom2_serNum": 21885, "donAcc_type": "standard", "distance": 2.986, "atom1_id": "///I/4/N1", "atom2_id": "///J/58/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 2593, "atom1_serNum": 21126, "atom2_serNum": 21867, "donAcc_type": "standard", "distance": 3.175, "atom1_id": "///I/5/N6", "atom2_id": "///J/57/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 2594, "atom1_serNum": 21127, "atom2_serNum": 21865, "donAcc_type": "standard", "distance": 3.098, "atom1_id": "///I/5/N1", "atom2_id": "///J/57/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 2595, "atom1_serNum": 21148, "atom2_serNum": 21847, "donAcc_type": "standard", "distance": 2.919, "atom1_id": "///I/6/N6", "atom2_id": "///J/56/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 2596, "atom1_serNum": 21149, "atom2_serNum": 21845, "donAcc_type": "standard", "distance": 2.984, "atom1_id": "///I/6/N1", "atom2_id": "///J/56/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 2597, "atom1_serNum": 21167, "atom2_serNum": 21827, "donAcc_type": "standard", "distance": 2.869, "atom1_id": "///I/7/O2", "atom2_id": "///J/55/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 2598, "atom1_serNum": 21168, "atom2_serNum": 21825, "donAcc_type": "standard", "distance": 3.076, "atom1_id": "///I/7/N3", "atom2_id": "///J/55/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 2599, "atom1_serNum": 21168, "atom2_serNum": 21827, "donAcc_type": "standard", "distance": 3.081, "atom1_id": "///I/7/N3", "atom2_id": "///J/55/N2", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 2600, "atom1_serNum": 21170, "atom2_serNum": 21824, "donAcc_type": "standard", "distance": 3.128, "atom1_id": "///I/7/N4", "atom2_id": "///J/55/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 2601, "atom1_serNum": 21183, "atom2_serNum": 21201, "donAcc_type": "acceptable", "distance": 3.181, "atom1_id": "///I/8/O2'", "atom2_id": "///I/9/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 2602, "atom1_serNum": 21190, "atom2_serNum": 21804, "donAcc_type": "standard", "distance": 3.112, "atom1_id": "///I/8/N6", "atom2_id": "///J/54/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 2603, "atom1_serNum": 21191, "atom2_serNum": 21802, "donAcc_type": "standard", "distance": 3.013, "atom1_id": "///I/8/N1", "atom2_id": "///J/54/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 2604, "atom1_serNum": 21210, "atom2_serNum": 21783, "donAcc_type": "standard", "distance": 2.905, "atom1_id": "///I/9/N3", "atom2_id": "///J/53/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 2605, "atom1_serNum": 21212, "atom2_serNum": 21782, "donAcc_type": "standard", "distance": 3.088, "atom1_id": "///I/9/O4", "atom2_id": "///J/53/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 2606, "atom1_serNum": 21229, "atom2_serNum": 21762, "donAcc_type": "standard", "distance": 3.017, "atom1_id": "///I/10/O2", "atom2_id": "///J/52/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 2607, "atom1_serNum": 21230, "atom2_serNum": 21760, "donAcc_type": "standard", "distance": 3.141, "atom1_id": "///I/10/N3", "atom2_id": "///J/52/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 2608, "atom1_serNum": 21232, "atom2_serNum": 21759, "donAcc_type": "standard", "distance": 3.295, "atom1_id": "///I/10/N4", "atom2_id": "///J/52/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 2609, "atom1_serNum": 21245, "atom2_serNum": 21258, "donAcc_type": "acceptable", "distance": 3.161, "atom1_id": "///I/11/O2'", "atom2_id": "///I/14/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 2610, "atom1_serNum": 21249, "atom2_serNum": 21739, "donAcc_type": "standard", "distance": 3.214, "atom1_id": "///I/11/O2", "atom2_id": "///J/51/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 2611, "atom1_serNum": 21250, "atom2_serNum": 21737, "donAcc_type": "standard", "distance": 3.453, "atom1_id": "///I/11/N3", "atom2_id": "///J/51/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 2612, "atom1_serNum": 21252, "atom2_serNum": 21736, "donAcc_type": "standard", "distance": 3.556, "atom1_id": "///I/11/N4", "atom2_id": "///J/51/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 2613, "atom1_serNum": 21269, "atom2_serNum": 21716, "donAcc_type": "standard", "distance": 2.838, "atom1_id": "///I/14/O6", "atom2_id": "///J/50/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 2614, "atom1_serNum": 21270, "atom2_serNum": 21714, "donAcc_type": "standard", "distance": 3.352, "atom1_id": "///I/14/N1", "atom2_id": "///J/50/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 2615, "atom1_serNum": 21272, "atom2_serNum": 21713, "donAcc_type": "standard", "distance": 3.969, "atom1_id": "///I/14/N2", "atom2_id": "///J/50/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 2616, "atom1_serNum": 21285, "atom2_serNum": 21300, "donAcc_type": "acceptable", "distance": 3.094, "atom1_id": "///I/15/O2'", "atom2_id": "///I/16/O5'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 2617, "atom1_serNum": 21285, "atom2_serNum": 21303, "donAcc_type": "acceptable", "distance": 2.864, "atom1_id": "///I/15/O2'", "atom2_id": "///I/16/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 2618, "atom1_serNum": 21292, "atom2_serNum": 21673, "donAcc_type": "standard", "distance": 3.138, "atom1_id": "///I/15/N6", "atom2_id": "///J/48/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 2619, "atom1_serNum": 21292, "atom2_serNum": 21696, "donAcc_type": "standard", "distance": 3.220, "atom1_id": "///I/15/N6", "atom2_id": "///J/49/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 2620, "atom1_serNum": 21293, "atom2_serNum": 21694, "donAcc_type": "standard", "distance": 2.767, "atom1_id": "///I/15/N1", "atom2_id": "///J/49/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 2621, "atom1_serNum": 21307, "atom2_serNum": 21323, "donAcc_type": "acceptable", "distance": 3.405, "atom1_id": "///I/16/O2'", "atom2_id": "///I/17/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 2622, "atom1_serNum": 21311, "atom2_serNum": 21676, "donAcc_type": "standard", "distance": 2.735, "atom1_id": "///I/16/O2", "atom2_id": "///J/48/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 2623, "atom1_serNum": 21312, "atom2_serNum": 21674, "donAcc_type": "standard", "distance": 2.988, "atom1_id": "///I/16/N3", "atom2_id": "///J/48/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 2624, "atom1_serNum": 21314, "atom2_serNum": 21673, "donAcc_type": "standard", "distance": 3.300, "atom1_id": "///I/16/N4", "atom2_id": "///J/48/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 2625, "atom1_serNum": 21332, "atom2_serNum": 21652, "donAcc_type": "standard", "distance": 3.009, "atom1_id": "///I/17/N3", "atom2_id": "///J/47/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 2626, "atom1_serNum": 21334, "atom2_serNum": 21651, "donAcc_type": "standard", "distance": 3.254, "atom1_id": "///I/17/O4", "atom2_id": "///J/47/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 2627, "atom1_serNum": 21355, "atom2_serNum": 21629, "donAcc_type": "standard", "distance": 3.385, "atom1_id": "///I/18/N1", "atom2_id": "///J/46/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 2628, "atom1_serNum": 21357, "atom2_serNum": 21628, "donAcc_type": "standard", "distance": 2.762, "atom1_id": "///I/18/N2", "atom2_id": "///J/46/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 2629, "atom1_serNum": 21378, "atom2_serNum": 21609, "donAcc_type": "questionable", "distance": 3.369, "atom1_id": "///I/19/N1", "atom2_id": "///J/45/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 2630, "atom1_serNum": 21380, "atom2_serNum": 21608, "donAcc_type": "standard", "distance": 2.798, "atom1_id": "///I/19/N2", "atom2_id": "///J/45/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 2631, "atom1_serNum": 21400, "atom2_serNum": 21591, "donAcc_type": "standard", "distance": 2.783, "atom1_id": "///I/20/N6", "atom2_id": "///J/44/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 2632, "atom1_serNum": 21401, "atom2_serNum": 21589, "donAcc_type": "standard", "distance": 3.036, "atom1_id": "///I/20/N1", "atom2_id": "///J/44/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 2633, "atom1_serNum": 21422, "atom2_serNum": 21571, "donAcc_type": "standard", "distance": 3.032, "atom1_id": "///I/21/N6", "atom2_id": "///J/43/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 2634, "atom1_serNum": 21423, "atom2_serNum": 21569, "donAcc_type": "standard", "distance": 2.834, "atom1_id": "///I/21/N1", "atom2_id": "///J/43/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 2635, "atom1_serNum": 21444, "atom2_serNum": 21551, "donAcc_type": "standard", "distance": 3.562, "atom1_id": "///I/22/O6", "atom2_id": "///J/42/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 2636, "atom1_serNum": 21445, "atom2_serNum": 21549, "donAcc_type": "standard", "distance": 3.348, "atom1_id": "///I/22/N1", "atom2_id": "///J/42/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 2637, "atom1_serNum": 21447, "atom2_serNum": 21548, "donAcc_type": "standard", "distance": 3.083, "atom1_id": "///I/22/N2", "atom2_id": "///J/42/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 2638, "atom1_serNum": 21460, "atom2_serNum": 21531, "donAcc_type": "acceptable", "distance": 3.275, "atom1_id": "///I/23/O2'", "atom2_id": "///J/41/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 2639, "atom1_serNum": 21464, "atom2_serNum": 21529, "donAcc_type": "standard", "distance": 2.884, "atom1_id": "///I/23/O2", "atom2_id": "///J/41/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 2640, "atom1_serNum": 21464, "atom2_serNum": 21531, "donAcc_type": "standard", "distance": 3.014, "atom1_id": "///I/23/O2", "atom2_id": "///J/41/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 2641, "atom1_serNum": 21484, "atom2_serNum": 21506, "donAcc_type": "standard", "distance": 3.193, "atom1_id": "///I/24/O2", "atom2_id": "///J/40/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 2642, "atom1_serNum": 21485, "atom2_serNum": 21505, "donAcc_type": "standard", "distance": 3.079, "atom1_id": "///I/24/N3", "atom2_id": "///J/40/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 2643, "atom1_serNum": 21624, "atom2_serNum": 21640, "donAcc_type": "acceptable", "distance": 3.611, "atom1_id": "///J/46/O2'", "atom2_id": "///J/47/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 2644, "atom1_serNum": 21817, "atom2_serNum": 21836, "donAcc_type": "acceptable", "distance": 2.811, "atom1_id": "///J/55/O2'", "atom2_id": "///J/56/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 2645, "atom1_serNum": 21840, "atom2_serNum": 21856, "donAcc_type": "acceptable", "distance": 3.070, "atom1_id": "///J/56/O2'", "atom2_id": "///J/57/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 2646, "atom1_serNum": 21860, "atom2_serNum": 21876, "donAcc_type": "acceptable", "distance": 2.918, "atom1_id": "///J/57/O2'", "atom2_id": "///J/58/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 2647, "atom1_serNum": 21943, "atom2_serNum": 21955, "donAcc_type": "acceptable", "distance": 2.977, "atom1_id": "///J/61/O2'", "atom2_id": "///J/62/OP2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 2648, "atom1_serNum": 21986, "atom2_serNum": 21990, "donAcc_type": "acceptable", "distance": 3.199, "atom1_id": "///J/63/O2'", "atom2_id": "///J/63/O2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 2649, "atom1_serNum": 21999, "atom2_serNum": 22003, "donAcc_type": "acceptable", "distance": 3.176, "atom1_id": "///C/1177/O2G", "atom2_id": "///C/1177/O1B", "atom_pair": "O:O", "residue_pair": "ligand:ligand" } ], "refCoords": { "purine": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 -0.5000 0.4000", " 3 N -2.2500 -0.5000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 1.2500 5.0000 0.4000", " 6 C 1.2500 -0.5000 0.4000", " 7 C 1.2500 -0.5000 -0.4000", " 8 C 1.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 -0.5000 0.4000", " 11 C -2.2500 -0.5000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ], "pyrimidine": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 1.0000 0.4000", " 3 N -2.2500 1.0000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 1.2500 5.0000 0.4000", " 6 C 1.2500 1.0000 0.4000", " 7 C 1.2500 1.0000 -0.4000", " 8 C 1.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 1.0000 0.4000", " 11 C -2.2500 1.0000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ], "wc_pair": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 -5.0000 0.4000", " 3 N -2.2500 -5.0000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 2.2500 5.0000 0.4000", " 6 C 2.2500 -5.0000 0.4000", " 7 C 2.2500 -5.0000 -0.4000", " 8 C 2.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 -5.0000 0.4000", " 11 C -2.2500 -5.0000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ] }, "metadata": { "license": "http://innovation.columbia.edu/technologies/CU20391", "url": "http://x3dna.org/", "url_alt": "http://home.x3dna.org/", "forum": "http://forum.x3dna.org/", "citation": "Lu et al. (2015). 'DSSR: an integrated software tool for dissecting the spatial structure of RNA.' Nucleic Acids Res., 43(21):e142 [doi:10.1093/nar/gkv716].", "str_id": "3a6p", "num_aaChains": 6, "aaChains": "A=1072,B=13,C=171,F=1072,G=13,H=171", "num_naChains": 4, "naChains": "D=22,E=24,I=22,J=24", "num_atoms": 22052, "num_waters": 0, "num_metals": 2, "metals_desc": "Mg=2", "num_notes": 52, "notes": [ { "Aminors": "A-minor interactions (including types I and II)" }, { "Cstem_index": "stem index of the 'Canonical' helix in k-turn" }, { "Cstem_pair": "Cstem bp delineating the k-turn internal loop" }, { "Dp": "perpendicular distance of the 3' P atom to the glycosidic bond" }, { "GA_pair": "sheared G-A pair in k-turn" }, { "HtypePknot": "H-type pseudoknot" }, { "Kturn": "kink-turn (k-turn)" }, { "LW": "Leontis-Westhof" }, { "NCstem_index": "stem index of the 'Non-Canonical' helix in k-turn" }, { "NCstem_pair": "NCstem bp delineating the k-turn internal loop" }, { "Uturn": "U-turn of the UNR- or GNRA-type" }, { "aa": "amino acid" }, { "atom_pair": "symbols of the two atoms involved in an H-bond" }, { "auxfiles": "auxiliary files" }, { "glyco_bond": "conformation of base related to sugar (syn or anti)" }, { "bb_type": "backbone conformation, BI or BII" }, { "bending_angle": "angle between two helical axes" }, { "bp": "base pair" }, { "bseq": "base sequence in one-letter code" }, { "bulge": "bulge loop" }, { "coaxStacks": "coaxial stacking of stems within a helix" }, { "dbn": "dot bracket notation" }, { "desc": "description" }, { "donAcc_type": "donor/acceptor type of the atom pair in an H-bond" }, { "epsilon_zeta": "difference between epsilon and zeta torsion angles" }, { "hairpin": "hairpin loop" }, { "hbond": "hydrogen bond (H-bond)" }, { "helix": "defined by base-stacking interactions, regardless of bp type and backbone connectivity" }, { "id": "identifier" }, { "iloop": "internal loop" }, { "index": "serial number" }, { "isoCanonPairs": "isolated canonical pairs" }, { "junction": "(multi-branched) junction loop" }, { "kissingLoop": "kissing loop" }, { "multiplet": "3+ bases in a coplanar geometry" }, { "na": "nucleic acid" }, { "nonPair": "two nts not forming a pair, but with H-bonding/stacking interactions" }, { "nonStack": "nucleotide not involved in stacking interactions" }, { "nt": "nucleotide" }, { "num": "number" }, { "oArea": "overlap areas between two bases, including exocyclic atoms" }, { "oArea_ring": "overlap areas between two bases, including only ring atoms" }, { "phosContacts": "H-bonding and atom-capping interactions involving a phosphate" }, { "residue_pair": "types of the two residues involved in an H-bond" }, { "rmsd": "root-mean-squares deviation" }, { "serNum": "serial number" }, { "ssSegments": "single-stranded segments not involved in loops" }, { "ssZp": "Z-coordinate of the 3' phosphorus atom with reference to the 5' base plane" }, { "sstr": "secondary structure in dbn" }, { "stem": "helix consisting of only canonical pairs, with a continuous backbone" }, { "str_id": "structure identifier, derived from inpfile with extension removed" }, { "vert_dist": "vertical distance from an atom to a base plane" } ], "num_auxfiles": 15, "auxfiles": [ { "index": 1, "name": "dssr-pairs.pdb", "desc": "an ensemble of base pairs" }, { "index": 2, "name": "dssr-stems.pdb", "desc": "an ensemble of stems" }, { "index": 3, "name": "dssr-helices.pdb", "desc": "an ensemble of helices (coaxial stacking)" }, { "index": 4, "name": "dssr-iloops.pdb", "desc": "an ensemble of internal loops" }, { "index": 5, "name": "dssr-2ndstrs.bpseq", "desc": "secondary structure in bpseq format" }, { "index": 6, "name": "dssr-2ndstrs.ct", "desc": "secondary structure in connectivity table format" }, { "index": 7, "name": "dssr-2ndstrs.dbn", "desc": "secondary structure in dot-bracket notation" }, { "index": 8, "name": "dssr-torsions.txt", "desc": "backbone torsion angles and suite names" }, { "index": 9, "name": "dssr-splays.pdb", "desc": "an ensemble of splayed-apart units" }, { "index": 10, "name": "dssr-stacks.pdb", "desc": "an ensemble of base stacks" }, { "index": 11, "name": "dssr-atom2bases.pdb", "desc": "an ensemble of atom-base stacking interactions" }, { "index": 12, "name": "dssr-rotmat.txt", "desc": "position vector and rotation matrix" }, { "index": 13, "name": "dssr-viewV.pdb", "desc": "vertical view of the principal moment of inertia" }, { "index": 14, "name": "dssr-viewH.pdb", "desc": "horizontal view of the principal moment of inertia" }, { "index": 15, "name": "dssr-viewT.pdb", "desc": "top view of the principal moment of inertia" } ], "time_used": "999" } }