{ "num_pairs": 18, "pairs": [ { "index": 1, "nt1": "///A/2", "nt2": "///B/44", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -155.050, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 55.489, "chi2": -154.878, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 53.457, "C1C1_dist": 10.652, "N1N9_dist": 8.949, "C6C8_dist": 9.899, "CNNC_torsion": -1.723, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.88],N1(imino)-N3[2.86],N2(amino)-O2(carbonyl)[2.71]", "interBase_angle": 3.659, "planarity": 0.042, "simple_Shear": 0.114, "simple_Stretch": -0.127, "simple_Buckle": -2.475, "simple_Propeller": -2.695, "bp_simpleParams": [ 0.114, -0.127, -0.110, -2.475, -2.695, 0.658 ], "bp_params": [ 0.112, -0.129, -0.110, -2.518, -2.655, 0.658 ], "frame": { "rmsd": null, "origin": [ 20.786, -3.473, 12.529 ], "x_axis": [ 0.584, 0.466, -0.665 ], "y_axis": [ -0.579, -0.334, -0.743 ], "z_axis": [ -0.569, 0.819, 0.075 ], "quaternion": [ 0.575, -0.679, 0.042, 0.454 ] } }, { "index": 2, "nt1": "///A/3", "nt2": "///B/43", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -176.402, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 51.182, "chi2": -163.328, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 52.603, "C1C1_dist": 10.729, "N1N9_dist": 8.921, "C6C8_dist": 9.778, "CNNC_torsion": -7.789, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.82],N3-N1(imino)[2.80],N4(amino)-O6(carbonyl)[2.67]", "interBase_angle": 8.449, "planarity": 0.098, "simple_Shear": 0.031, "simple_Stretch": -0.242, "simple_Buckle": 3.257, "simple_Propeller": -7.796, "bp_simpleParams": [ 0.031, -0.242, -0.055, 3.257, -7.796, -3.310 ], "bp_params": [ 0.031, -0.242, -0.055, 3.269, -7.791, -3.317 ], "frame": { "rmsd": null, "origin": [ 19.831, -0.236, 13.699 ], "x_axis": [ 0.243, 0.198, -0.950 ], "y_axis": [ -0.782, -0.539, -0.313 ], "z_axis": [ -0.573, 0.819, 0.024 ], "quaternion": [ -0.427, 0.663, -0.220, -0.574 ] } }, { "index": 3, "nt1": "///A/4", "nt2": "///B/42", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -169.747, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 55.308, "chi2": -162.555, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 53.781, "C1C1_dist": 10.551, "N1N9_dist": 8.854, "C6C8_dist": 9.789, "CNNC_torsion": -3.256, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.81],N1(imino)-N3[2.79],N2(amino)-O2(carbonyl)[2.68]", "interBase_angle": 13.458, "planarity": 0.138, "simple_Shear": -0.060, "simple_Stretch": -0.213, "simple_Buckle": -9.086, "simple_Propeller": -9.928, "bp_simpleParams": [ -0.060, -0.213, -0.265, -9.086, -9.928, 0.435 ], "bp_params": [ -0.060, -0.212, -0.265, -9.105, -9.911, 0.435 ], "frame": { "rmsd": null, "origin": [ 19.505, 3.743, 13.076 ], "x_axis": [ -0.143, -0.257, -0.956 ], "y_axis": [ -0.839, -0.481, 0.254 ], "z_axis": [ -0.525, 0.838, -0.147 ], "quaternion": [ -0.240, 0.609, -0.450, -0.607 ] } }, { "index": 4, "nt1": "///A/5", "nt2": "///B/41", "bp": "U-U", "name": "--", "Saenger": "16-XVI", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -174.167, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 68.479, "chi2": -166.983, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 48.760, "C1C1_dist": 9.031, "N1N9_dist": 7.528, "C6C8_dist": 8.769, "CNNC_torsion": -7.630, "hbonds_num": 2, "hbonds_desc": "O2(carbonyl)-N3(imino)[3.37],N3(imino)-O4(carbonyl)[3.16]", "interBase_angle": 7.665, "planarity": 0.105, "simple_Shear": 1.944, "simple_Stretch": -1.125, "simple_Buckle": 3.049, "simple_Propeller": -7.033, "bp_simpleParams": [ 1.944, -1.125, 0.179, 3.049, -7.033, 7.525 ], "bp_params": [ 1.691, -1.478, 0.179, 1.636, -7.489, 7.540 ], "frame": { "rmsd": null, "origin": [ 18.960, 6.595, 10.792 ], "x_axis": [ -0.611, -0.496, -0.618 ], "y_axis": [ -0.590, -0.236, 0.772 ], "z_axis": [ -0.529, 0.836, -0.148 ], "quaternion": [ 0.036, -0.440, 0.617, 0.652 ] } }, { "index": 5, "nt1": "///A/6", "nt2": "///B/40", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -159.543, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 57.005, "chi2": 167.716, "conf2": "--", "pucker2": "~C3'-endo", "lambda2": 52.818, "C1C1_dist": 10.505, "N1N9_dist": 8.822, "C6C8_dist": 9.790, "CNNC_torsion": 5.598, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.67],N3-N1(imino)[2.83],N4(amino)-O6(carbonyl)[2.88]", "interBase_angle": 3.993, "planarity": 0.100, "simple_Shear": 0.427, "simple_Stretch": -0.237, "simple_Buckle": 1.551, "simple_Propeller": -3.679, "bp_simpleParams": [ 0.427, -0.237, -0.350, 1.551, -3.679, 1.737 ], "bp_params": [ 0.418, -0.253, -0.350, 1.412, -3.735, 1.738 ], "frame": { "rmsd": null, "origin": [ 18.800, 9.763, 7.948 ], "x_axis": [ -0.841, -0.518, -0.157 ], "y_axis": [ -0.246, 0.107, 0.963 ], "z_axis": [ -0.483, 0.849, -0.217 ], "quaternion": [ -0.111, -0.260, 0.736, 0.616 ] } }, { "index": 6, "nt1": "///A/8", "nt2": "///B/37", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -159.242, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 56.870, "chi2": -154.419, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 54.593, "C1C1_dist": 10.626, "N1N9_dist": 8.982, "C6C8_dist": 10.004, "CNNC_torsion": -17.617, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.83],N3-N1(imino)[3.00],N4(amino)-O6(carbonyl)[3.24]", "interBase_angle": 23.013, "planarity": 0.268, "simple_Shear": 0.409, "simple_Stretch": 0.009, "simple_Buckle": 8.087, "simple_Propeller": -21.545, "bp_simpleParams": [ 0.409, 0.009, 0.002, 8.087, -21.545, 4.595 ], "bp_params": [ 0.409, -0.003, 0.002, 7.359, -21.805, 4.671 ], "frame": { "rmsd": null, "origin": [ 12.272, 12.443, 5.536 ], "x_axis": [ -0.110, -0.413, 0.904 ], "y_axis": [ 0.673, 0.638, 0.373 ], "z_axis": [ -0.731, 0.649, 0.208 ], "quaternion": [ 0.659, -0.105, -0.620, -0.412 ] } }, { "index": 7, "nt1": "///A/9", "nt2": "///B/36", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -157.408, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 57.704, "chi2": -163.030, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 57.397, "C1C1_dist": 10.307, "N1N9_dist": 8.740, "C6C8_dist": 9.808, "CNNC_torsion": -17.793, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.06],N1-N3(imino)[2.76]", "interBase_angle": 14.165, "planarity": 0.175, "simple_Shear": 0.096, "simple_Stretch": -0.130, "simple_Buckle": 2.725, "simple_Propeller": -13.900, "bp_simpleParams": [ 0.096, -0.130, 0.284, 2.725, -13.900, 5.033 ], "bp_params": [ 0.095, -0.132, 0.284, 2.516, -13.939, 5.069 ], "frame": { "rmsd": null, "origin": [ 9.126, 13.335, 6.604 ], "x_axis": [ 0.429, -0.114, 0.896 ], "y_axis": [ 0.590, 0.787, -0.182 ], "z_axis": [ -0.684, 0.607, 0.404 ], "quaternion": [ 0.809, -0.244, -0.488, -0.217 ] } }, { "index": 8, "nt1": "///A/10", "nt2": "///B/35", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -159.988, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 57.117, "chi2": -166.589, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 54.815, "C1C1_dist": 10.463, "N1N9_dist": 8.830, "C6C8_dist": 9.857, "CNNC_torsion": -17.612, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.66],N3-N1(imino)[2.84],N4(amino)-O6(carbonyl)[3.06]", "interBase_angle": 20.805, "planarity": 0.245, "simple_Shear": 0.304, "simple_Stretch": -0.132, "simple_Buckle": 8.759, "simple_Propeller": -18.871, "bp_simpleParams": [ 0.304, -0.132, -0.027, 8.759, -18.871, 4.686 ], "bp_params": [ 0.301, -0.138, -0.027, 8.344, -19.058, 4.740 ], "frame": { "rmsd": null, "origin": [ 6.708, 14.331, 8.572 ], "x_axis": [ 0.696, 0.297, 0.654 ], "y_axis": [ 0.231, 0.769, -0.595 ], "z_axis": [ -0.680, 0.566, 0.467 ], "quaternion": [ 0.856, -0.339, -0.389, 0.019 ] } }, { "index": 9, "nt1": "///A/11", "nt2": "///B/34", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -159.495, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 53.097, "chi2": -173.381, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 53.790, "C1C1_dist": 10.651, "N1N9_dist": 8.907, "C6C8_dist": 9.813, "CNNC_torsion": -11.489, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.77],N3-N1(imino)[2.81],N4(amino)-O6(carbonyl)[2.77]", "interBase_angle": 9.564, "planarity": 0.122, "simple_Shear": 0.038, "simple_Stretch": -0.216, "simple_Buckle": -1.043, "simple_Propeller": -9.507, "bp_simpleParams": [ 0.038, -0.216, 0.142, -1.043, -9.507, -1.584 ], "bp_params": [ 0.038, -0.216, 0.142, -1.037, -9.508, -1.589 ], "frame": { "rmsd": null, "origin": [ 4.107, 15.066, 11.338 ], "x_axis": [ 0.788, 0.600, 0.139 ], "y_axis": [ -0.203, 0.467, -0.861 ], "z_axis": [ -0.581, 0.650, 0.490 ], "quaternion": [ 0.828, -0.456, -0.217, 0.242 ] } }, { "index": 10, "nt1": "///A/12", "nt2": "///B/33", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -162.622, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 53.481, "chi2": -155.552, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 54.698, "C1C1_dist": 10.679, "N1N9_dist": 8.965, "C6C8_dist": 9.892, "CNNC_torsion": -14.591, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.91],N1(imino)-N3[2.92],N2(amino)-O2(carbonyl)[2.81]", "interBase_angle": 10.198, "planarity": 0.143, "simple_Shear": -0.244, "simple_Stretch": -0.131, "simple_Buckle": 6.563, "simple_Propeller": -7.806, "bp_simpleParams": [ -0.244, -0.131, 0.451, 6.563, -7.806, -0.903 ], "bp_params": [ -0.242, -0.137, 0.451, 6.733, -7.660, -0.903 ], "frame": { "rmsd": null, "origin": [ 2.716, 16.160, 14.274 ], "x_axis": [ 0.716, 0.638, -0.285 ], "y_axis": [ -0.489, 0.166, -0.856 ], "z_axis": [ -0.499, 0.752, 0.431 ], "quaternion": [ 0.760, -0.529, -0.070, 0.370 ] } }, { "index": 11, "nt1": "///A/13", "nt2": "///B/32", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -165.168, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 52.205, "chi2": -161.678, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 55.090, "C1C1_dist": 10.709, "N1N9_dist": 8.981, "C6C8_dist": 9.907, "CNNC_torsion": -19.664, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.97],N1(imino)-N3[2.94],N2(amino)-O2(carbonyl)[2.91]", "interBase_angle": 18.207, "planarity": 0.226, "simple_Shear": -0.373, "simple_Stretch": -0.121, "simple_Buckle": -1.443, "simple_Propeller": -18.150, "bp_simpleParams": [ -0.373, -0.121, 0.174, -1.443, -18.150, -0.697 ], "bp_params": [ -0.369, -0.133, 0.174, -0.848, -18.188, -0.706 ], "frame": { "rmsd": null, "origin": [ 2.264, 18.950, 16.641 ], "x_axis": [ 0.366, 0.541, -0.758 ], "y_axis": [ -0.827, -0.185, -0.531 ], "z_axis": [ -0.427, 0.821, 0.379 ], "quaternion": [ 0.624, -0.541, 0.132, 0.547 ] } }, { "index": 12, "nt1": "///A/14", "nt2": "///B/31", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -163.498, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 58.430, "chi2": -161.889, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 55.565, "C1C1_dist": 10.356, "N1N9_dist": 8.766, "C6C8_dist": 9.806, "CNNC_torsion": -17.127, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.80],O4(carbonyl)-N6(amino)[3.05]", "interBase_angle": 14.392, "planarity": 0.180, "simple_Shear": 0.247, "simple_Stretch": -0.142, "simple_Buckle": -1.612, "simple_Propeller": -14.301, "bp_simpleParams": [ 0.247, -0.142, 0.266, -1.612, -14.301, 3.613 ], "bp_params": [ 0.244, -0.147, 0.266, -1.902, -14.265, 3.640 ], "frame": { "rmsd": null, "origin": [ 2.031, 22.218, 17.753 ], "x_axis": [ -0.164, 0.298, -0.941 ], "y_axis": [ -0.892, -0.452, 0.012 ], "z_axis": [ -0.422, 0.841, 0.339 ], "quaternion": [ 0.425, -0.487, 0.305, 0.699 ] } }, { "index": 13, "nt1": "///A/15", "nt2": "///B/30", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -159.698, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 54.140, "chi2": -158.612, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 53.909, "C1C1_dist": 10.646, "N1N9_dist": 8.932, "C6C8_dist": 9.853, "CNNC_torsion": -17.295, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.92],N1(imino)-N3[2.88],N2(amino)-O2(carbonyl)[2.87]", "interBase_angle": 24.154, "planarity": 0.274, "simple_Shear": -0.163, "simple_Stretch": -0.129, "simple_Buckle": -11.579, "simple_Propeller": -21.198, "bp_simpleParams": [ -0.163, -0.129, -0.057, -11.579, -21.198, -0.228 ], "bp_params": [ -0.163, -0.130, -0.057, -11.454, -21.266, -0.231 ], "frame": { "rmsd": null, "origin": [ 2.004, 25.769, 18.425 ], "x_axis": [ -0.541, -0.167, -0.825 ], "y_axis": [ -0.704, -0.448, 0.552 ], "z_axis": [ -0.461, 0.878, 0.124 ], "quaternion": [ 0.184, -0.442, 0.492, 0.727 ] } }, { "index": 14, "nt1": "///A/18", "nt2": "///B/28", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": 173.799, "conf1": "--", "pucker1": "~C3'-endo", "lambda1": 52.996, "chi2": 178.878, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 52.702, "C1C1_dist": 10.744, "N1N9_dist": 8.976, "C6C8_dist": 9.870, "CNNC_torsion": 4.228, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.83],N1(imino)-N3[2.88],N2(amino)-O2(carbonyl)[2.81]", "interBase_angle": 6.039, "planarity": 0.064, "simple_Shear": -0.083, "simple_Stretch": -0.150, "simple_Buckle": -5.101, "simple_Propeller": -3.233, "bp_simpleParams": [ -0.083, -0.150, -0.150, -5.101, -3.233, -1.816 ], "bp_params": [ -0.082, -0.150, -0.150, -5.092, -3.247, -1.815 ], "frame": { "rmsd": null, "origin": [ 0.493, 32.289, 14.779 ], "x_axis": [ -0.699, -0.603, 0.385 ], "y_axis": [ 0.185, 0.367, 0.912 ], "z_axis": [ -0.691, 0.708, -0.145 ], "quaternion": [ -0.362, -0.141, 0.743, 0.545 ] } }, { "index": 15, "nt1": "///A/19", "nt2": "///B/27", "bp": "U-U", "name": "--", "Saenger": "16-XVI", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -168.186, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 54.818, "chi2": -172.076, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 24.566, "C1C1_dist": 10.765, "N1N9_dist": 8.603, "C6C8_dist": 8.952, "CNNC_torsion": 10.372, "hbonds_num": 1, "hbonds_desc": "N3(imino)-O4(carbonyl)[2.75]", "interBase_angle": 8.708, "planarity": 0.122, "simple_Shear": 3.066, "simple_Stretch": -0.287, "simple_Buckle": -3.543, "simple_Propeller": -7.955, "bp_simpleParams": [ 3.066, -0.287, -0.512, -3.543, -7.955, -31.647 ], "bp_params": [ 2.818, -1.242, -0.512, -5.874, -6.429, -31.655 ], "frame": { "rmsd": null, "origin": [ -1.542, 34.088, 10.804 ], "x_axis": [ -0.379, -0.160, 0.911 ], "y_axis": [ 0.600, 0.707, 0.374 ], "z_axis": [ -0.705, 0.688, -0.172 ], "quaternion": [ 0.538, -0.146, -0.751, -0.353 ] } }, { "index": 16, "nt1": "///A/20", "nt2": "///B/26", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -160.280, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 53.245, "chi2": -157.030, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 52.823, "C1C1_dist": 10.787, "N1N9_dist": 9.025, "C6C8_dist": 9.903, "CNNC_torsion": -0.525, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.89],N3-N1(imino)[2.91],N4(amino)-O6(carbonyl)[2.82]", "interBase_angle": 7.902, "planarity": 0.087, "simple_Shear": 0.097, "simple_Stretch": -0.126, "simple_Buckle": 3.780, "simple_Propeller": -6.939, "bp_simpleParams": [ 0.097, -0.126, -0.156, 3.780, -6.939, -2.315 ], "bp_params": [ 0.097, -0.126, -0.156, 3.749, -6.956, -2.318 ], "frame": { "rmsd": null, "origin": [ -5.505, 34.296, 10.705 ], "x_axis": [ -0.131, 0.022, 0.991 ], "y_axis": [ 0.699, 0.711, 0.077 ], "z_axis": [ -0.703, 0.703, -0.108 ], "quaternion": [ 0.607, -0.258, -0.698, -0.279 ] } }, { "index": 17, "nt1": "///A/21", "nt2": "///B/25", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -167.286, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 55.127, "chi2": -161.235, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 55.283, "C1C1_dist": 10.517, "N1N9_dist": 8.845, "C6C8_dist": 9.822, "CNNC_torsion": -0.619, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.84],N1(imino)-N3[2.79],N2(amino)-O2(carbonyl)[2.61]", "interBase_angle": 6.056, "planarity": 0.090, "simple_Shear": -0.064, "simple_Stretch": -0.210, "simple_Buckle": 0.059, "simple_Propeller": -6.056, "bp_simpleParams": [ -0.064, -0.210, -0.166, 0.059, -6.056, 1.885 ], "bp_params": [ -0.064, -0.210, -0.166, 0.068, -6.056, 1.888 ], "frame": { "rmsd": null, "origin": [ -9.173, 35.527, 11.369 ], "x_axis": [ 0.344, 0.233, 0.910 ], "y_axis": [ 0.676, 0.611, -0.412 ], "z_axis": [ -0.652, 0.757, 0.053 ], "quaternion": [ 0.709, -0.412, -0.551, -0.156 ] } }, { "index": 18, "nt1": "///A/22", "nt2": "///B/24", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -158.528, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 55.685, "chi2": -176.164, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 54.713, "C1C1_dist": 10.491, "N1N9_dist": 8.818, "C6C8_dist": 9.795, "CNNC_torsion": 0.291, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.57],N3-N1(imino)[2.77],N4(amino)-O6(carbonyl)[2.83]", "interBase_angle": 3.711, "planarity": 0.041, "simple_Shear": 0.160, "simple_Stretch": -0.234, "simple_Buckle": 2.991, "simple_Propeller": -2.197, "bp_simpleParams": [ 0.160, -0.234, -0.155, 2.991, -2.197, 1.776 ], "bp_params": [ 0.158, -0.236, -0.155, 2.967, -2.230, 1.776 ], "frame": { "rmsd": null, "origin": [ -12.348, 37.009, 13.388 ], "x_axis": [ 0.644, 0.527, 0.555 ], "y_axis": [ 0.382, 0.407, -0.830 ], "z_axis": [ -0.663, 0.746, 0.061 ], "quaternion": [ 0.727, -0.542, -0.419, 0.050 ] } } ], "num_helices": 1, "helices": [ { "index": 1, "num_stems": 3, "strand1": "GCGUCCACCGGUGGUCGC", "strand2": "CGCUGGUGGCCACCUGCG", "bp_type": "|||.||||||||||.|||", "helix_form": "AA..xAAAAAAAx..AA", "helical_rise": 2.948, "helical_rise_std": 1.334, "helical_radius": 9.572, "helical_radius_std": 1.972, "helical_axis": [ -0.559, 0.786, 0.266 ], "point1": [ 19.619, -1.707, 5.652 ], "point2": [ -8.284, 37.526, 18.924 ], "num_pairs": 18, "pairs": [ { "index": 1, "nt1": "///A/2", "nt2": "///B/44", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.112, -0.129, -0.110, -2.518, -2.655, 0.658 ], "step_params": [ -0.260, -1.447, 3.256, -1.790, 2.290, 29.974 ], "heli_params": [ -3.244, 0.142, 3.149, 4.415, 3.451, 30.112 ], "bp2_params": [ 0.031, -0.242, -0.055, 3.269, -7.791, -3.317 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.256, "simple_Twist": 30.306, "simple_hRise": 3.150, "simple_hTwist": 30.442 }, { "index": 2, "nt1": "///A/3", "nt2": "///B/43", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.031, -0.242, -0.055, 3.269, -7.791, -3.317 ], "step_params": [ 0.459, -1.915, 3.528, 2.673, 9.923, 33.311 ], "heli_params": [ -4.716, -0.359, 2.884, 16.819, -4.530, 34.817 ], "bp2_params": [ -0.060, -0.212, -0.265, -9.105, -9.911, 0.435 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.528, "simple_Twist": 33.813, "simple_hRise": 2.896, "simple_hTwist": 35.296 }, { "index": 3, "nt1": "///A/4", "nt2": "///B/42", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.060, -0.212, -0.265, -9.105, -9.911, 0.435 ], "step_params": [ 0.979, -1.901, 3.012, -0.182, 0.194, 36.414 ], "heli_params": [ -3.067, -1.590, 2.998, 0.310, 0.292, 36.415 ], "bp2_params": [ 1.691, -1.478, 0.179, 1.636, -7.489, 7.540 ], "groove_widths": [ 17.669, null, 15.788, null ], "simple_Rise": 3.012, "simple_Twist": 25.140, "simple_hRise": 2.991, "simple_hTwist": 25.141 }, { "index": 4, "nt1": "///A/5", "nt2": "///B/41", "bp": "U-U", "name": "--", "Saenger": "16-XVI", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 1.691, -1.478, 0.179, 1.636, -7.489, 7.540 ], "step_params": [ -0.439, -2.695, 3.271, 4.721, -0.778, 29.882 ], "heli_params": [ -5.006, 1.796, 3.232, -1.497, -9.082, 30.254 ], "bp2_params": [ 0.418, -0.253, -0.350, 1.412, -3.735, 1.738 ], "groove_widths": [ 19.549, 13.409, 14.618, 14.490 ], "simple_Rise": 3.271, "simple_Twist": 38.617, "simple_hRise": 3.248, "simple_hTwist": 38.901 }, { "index": 5, "nt1": "///A/6", "nt2": "///B/40", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.418, -0.253, -0.350, 1.412, -3.735, 1.738 ], "step_params": [ 1.728, -3.761, 6.204, -12.029, 28.360, 76.719 ], "heli_params": [ -4.110, -1.845, 4.565, 22.038, 9.347, 81.780 ], "bp2_params": [ 0.409, -0.003, 0.002, 7.359, -21.805, 4.671 ], "groove_widths": [ 20.868, 15.183, 11.999, 9.737 ], "simple_Rise": 6.204, "simple_Twist": 77.087, "simple_hRise": 4.577, "simple_hTwist": 82.117 }, { "index": 6, "nt1": "///A/8", "nt2": "///B/37", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.409, -0.003, 0.002, 7.359, -21.805, 4.671 ], "step_params": [ 0.244, -1.404, 3.131, -1.099, 11.784, 33.952 ], "heli_params": [ -3.775, -0.536, 2.512, 19.461, 1.815, 35.898 ], "bp2_params": [ 0.095, -0.132, 0.284, 2.516, -13.939, 5.069 ], "groove_widths": [ 22.645, 16.921, 10.614, 8.051 ], "simple_Rise": 3.131, "simple_Twist": 35.345, "simple_hRise": 2.541, "simple_hTwist": 37.214 }, { "index": 7, "nt1": "///A/9", "nt2": "///B/36", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.095, -0.132, 0.284, 2.516, -13.939, 5.069 ], "step_params": [ 0.241, -1.044, 3.093, 3.243, 2.830, 31.610 ], "heli_params": [ -2.382, 0.112, 2.999, 5.166, -5.918, 31.894 ], "bp2_params": [ 0.301, -0.138, -0.027, 8.344, -19.058, 4.740 ], "groove_widths": [ 19.807, 15.667, 17.301, 13.643 ], "simple_Rise": 3.093, "simple_Twist": 30.920, "simple_hRise": 2.997, "simple_hTwist": 31.211 }, { "index": 8, "nt1": "///A/10", "nt2": "///B/35", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.301, -0.138, -0.027, 8.344, -19.058, 4.740 ], "step_params": [ -0.509, -1.738, 3.417, -2.224, 7.197, 34.463 ], "heli_params": [ -3.935, 0.511, 3.030, 11.971, 3.699, 35.252 ], "bp2_params": [ 0.038, -0.216, 0.142, -1.037, -9.508, -1.589 ], "groove_widths": [ 16.312, 14.866, 17.435, 14.372 ], "simple_Rise": 3.417, "simple_Twist": 35.324, "simple_hRise": 3.041, "simple_hTwist": 36.093 }, { "index": 9, "nt1": "///A/11", "nt2": "///B/34", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.038, -0.216, 0.142, -1.037, -9.508, -1.589 ], "step_params": [ -0.583, -1.772, 2.877, -3.196, 7.618, 23.782 ], "heli_params": [ -5.879, 0.579, 2.266, 17.810, 7.471, 25.157 ], "bp2_params": [ -0.242, -0.137, 0.451, 6.733, -7.660, -0.903 ], "groove_widths": [ 16.797, 15.846, 16.239, 13.844 ], "simple_Rise": 2.877, "simple_Twist": 25.669, "simple_hRise": 2.318, "simple_hTwist": 26.944 }, { "index": 10, "nt1": "///A/12", "nt2": "///B/33", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.242, -0.137, 0.451, 6.733, -7.660, -0.903 ], "step_params": [ 0.167, -1.492, 3.367, 0.729, 6.352, 34.117 ], "heli_params": [ -3.466, -0.169, 3.051, 10.710, -1.229, 34.694 ], "bp2_params": [ -0.369, -0.133, 0.174, -0.848, -18.188, -0.706 ], "groove_widths": [ 16.659, 15.422, 15.481, 12.145 ], "simple_Rise": 3.367, "simple_Twist": 34.505, "simple_hRise": 3.055, "simple_hTwist": 35.075 }, { "index": 11, "nt1": "///A/13", "nt2": "///B/32", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.369, -0.133, 0.174, -0.848, -18.188, -0.706 ], "step_params": [ 0.422, -1.209, 3.214, 0.034, 2.574, 35.440 ], "heli_params": [ -2.346, -0.687, 3.122, 4.221, -0.056, 35.530 ], "bp2_params": [ 0.244, -0.147, 0.266, -1.902, -14.265, 3.640 ], "groove_widths": [ 19.145, 15.031, 15.105, 10.119 ], "simple_Rise": 3.214, "simple_Twist": 32.138, "simple_hRise": 3.111, "simple_hTwist": 32.239 }, { "index": 12, "nt1": "///A/14", "nt2": "///B/31", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.244, -0.147, 0.266, -1.902, -14.265, 3.640 ], "step_params": [ -0.392, -1.553, 3.241, 2.780, 12.439, 33.319 ], "heli_params": [ -4.178, 1.007, 2.482, 20.772, -4.643, 35.609 ], "bp2_params": [ -0.163, -0.130, -0.057, -11.454, -21.266, -0.231 ], "groove_widths": [ 21.688, 15.474, 10.410, 7.807 ], "simple_Rise": 3.241, "simple_Twist": 34.977, "simple_hRise": 2.525, "simple_hTwist": 37.159 }, { "index": 13, "nt1": "///A/15", "nt2": "///B/30", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.163, -0.130, -0.057, -11.454, -21.266, -0.231 ], "step_params": [ -1.432, -4.194, 6.200, 9.924, 20.347, 78.908 ], "heli_params": [ -4.117, 1.538, 5.011, 15.715, -7.665, 81.579 ], "bp2_params": [ -0.082, -0.150, -0.150, -5.092, -3.247, -1.815 ], "groove_widths": [ 20.582, 14.629, 11.857, 10.372 ], "simple_Rise": 6.200, "simple_Twist": 79.067, "simple_hRise": 5.015, "simple_hTwist": 81.731 }, { "index": 14, "nt1": "///A/18", "nt2": "///B/28", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.082, -0.150, -0.150, -5.092, -3.247, -1.815 ], "step_params": [ -2.366, -2.580, 3.306, 2.082, -0.198, 44.587 ], "heli_params": [ -3.378, 3.306, 3.209, -0.260, -2.742, 44.634 ], "bp2_params": [ 2.818, -1.242, -0.512, -5.874, -6.429, -31.655 ], "groove_widths": [ 19.433, 13.804, 14.473, 14.414 ], "simple_Rise": 3.306, "simple_Twist": 28.892, "simple_hRise": 3.149, "simple_hTwist": 28.966 }, { "index": 15, "nt1": "///A/19", "nt2": "///B/27", "bp": "U-U", "name": "--", "Saenger": "16-XVI", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 2.818, -1.242, -0.512, -5.874, -6.429, -31.655 ], "step_params": [ 0.920, -2.492, 2.949, -1.499, 3.459, 17.993 ], "heli_params": [ -9.367, -3.557, 2.348, 10.905, 4.727, 18.380 ], "bp2_params": [ 0.097, -0.126, -0.156, 3.749, -6.956, -2.318 ], "groove_widths": [ 18.045, null, 16.100, null ], "simple_Rise": 2.949, "simple_Twist": 32.767, "simple_hRise": 2.636, "simple_hTwist": 32.977 }, { "index": 16, "nt1": "///A/20", "nt2": "///B/26", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.097, -0.126, -0.156, 3.749, -6.956, -2.318 ], "step_params": [ 0.428, -1.954, 3.378, -2.589, 9.852, 28.905 ], "heli_params": [ -5.516, -1.287, 2.544, 19.007, 4.994, 30.612 ], "bp2_params": [ -0.064, -0.210, -0.166, 0.068, -6.056, 1.888 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.378, "simple_Twist": 29.736, "simple_hRise": 2.570, "simple_hTwist": 31.395 }, { "index": 17, "nt1": "///A/21", "nt2": "///B/25", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.064, -0.210, -0.166, 0.068, -6.056, 1.888 ], "step_params": [ 0.483, -2.263, 3.317, 0.963, -0.219, 31.920 ], "heli_params": [ -4.072, -0.701, 3.344, -0.398, -1.750, 31.935 ], "bp2_params": [ 0.158, -0.236, -0.155, 2.967, -2.230, 1.776 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.317, "simple_Twist": 30.690, "simple_hRise": 3.346, "simple_hTwist": 30.706 }, { "index": 18, "nt1": "///A/22", "nt2": "///B/24", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] } ], "num_stems": 3, "stems": [ { "index": 1, "helix_index": 1, "strand1": "GCG", "strand2": "CGC", "bp_type": "|||", "helix_form": "AA", "helical_rise": 2.527, "helical_rise_std": 0.239, "helical_radius": 9.012, "helical_radius_std": 0.287, "helical_axis": [ -0.763, 0.638, -0.103 ], "point1": [ 22.932, -1.248, 9.751 ], "point2": [ 19.133, 1.930, 9.238 ], "num_pairs": 3, "pairs": [ { "index": 1, "nt1": "///A/2", "nt2": "///B/44", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.112, -0.129, -0.110, -2.518, -2.655, 0.658 ], "step_params": [ -0.260, -1.447, 3.256, -1.790, 2.290, 29.974 ], "heli_params": [ -3.244, 0.142, 3.149, 4.415, 3.451, 30.112 ], "bp2_params": [ 0.031, -0.242, -0.055, 3.269, -7.791, -3.317 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.256, "simple_Twist": 30.306, "simple_hRise": 3.150, "simple_hTwist": 30.442 }, { "index": 2, "nt1": "///A/3", "nt2": "///B/43", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.031, -0.242, -0.055, 3.269, -7.791, -3.317 ], "step_params": [ 0.459, -1.915, 3.528, 2.673, 9.923, 33.311 ], "heli_params": [ -4.716, -0.359, 2.884, 16.819, -4.530, 34.817 ], "bp2_params": [ -0.060, -0.212, -0.265, -9.105, -9.911, 0.435 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.528, "simple_Twist": 33.813, "simple_hRise": 2.896, "simple_hTwist": 35.296 }, { "index": 3, "nt1": "///A/4", "nt2": "///B/42", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 2, "helix_index": 1, "strand1": "CACCGGUG", "strand2": "GUGGCCAC", "bp_type": "||||||||", "helix_form": "AAAAAAA", "helical_rise": 2.778, "helical_rise_std": 0.194, "helical_radius": 9.293, "helical_radius_std": 0.533, "helical_axis": [ -0.582, 0.749, 0.317 ], "point1": [ 11.835, 10.813, 9.352 ], "point2": [ 0.519, 25.358, 15.506 ], "num_pairs": 8, "pairs": [ { "index": 1, "nt1": "///A/8", "nt2": "///B/37", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.409, -0.003, 0.002, 7.359, -21.805, 4.671 ], "step_params": [ 0.244, -1.404, 3.131, -1.099, 11.784, 33.952 ], "heli_params": [ -3.775, -0.536, 2.512, 19.461, 1.815, 35.898 ], "bp2_params": [ 0.095, -0.132, 0.284, 2.516, -13.939, 5.069 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.131, "simple_Twist": 35.345, "simple_hRise": 2.541, "simple_hTwist": 37.214 }, { "index": 2, "nt1": "///A/9", "nt2": "///B/36", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.095, -0.132, 0.284, 2.516, -13.939, 5.069 ], "step_params": [ 0.241, -1.044, 3.093, 3.243, 2.830, 31.610 ], "heli_params": [ -2.382, 0.112, 2.999, 5.166, -5.918, 31.894 ], "bp2_params": [ 0.301, -0.138, -0.027, 8.344, -19.058, 4.740 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.093, "simple_Twist": 30.920, "simple_hRise": 2.997, "simple_hTwist": 31.211 }, { "index": 3, "nt1": "///A/10", "nt2": "///B/35", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.301, -0.138, -0.027, 8.344, -19.058, 4.740 ], "step_params": [ -0.509, -1.738, 3.417, -2.224, 7.197, 34.463 ], "heli_params": [ -3.935, 0.511, 3.030, 11.971, 3.699, 35.252 ], "bp2_params": [ 0.038, -0.216, 0.142, -1.037, -9.508, -1.589 ], "groove_widths": [ 16.312, null, 17.435, null ], "simple_Rise": 3.417, "simple_Twist": 35.324, "simple_hRise": 3.041, "simple_hTwist": 36.093 }, { "index": 4, "nt1": "///A/11", "nt2": "///B/34", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.038, -0.216, 0.142, -1.037, -9.508, -1.589 ], "step_params": [ -0.583, -1.772, 2.877, -3.196, 7.618, 23.782 ], "heli_params": [ -5.879, 0.579, 2.266, 17.810, 7.471, 25.157 ], "bp2_params": [ -0.242, -0.137, 0.451, 6.733, -7.660, -0.903 ], "groove_widths": [ 16.797, 15.846, 16.239, 13.844 ], "simple_Rise": 2.877, "simple_Twist": 25.669, "simple_hRise": 2.318, "simple_hTwist": 26.944 }, { "index": 5, "nt1": "///A/12", "nt2": "///B/33", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.242, -0.137, 0.451, 6.733, -7.660, -0.903 ], "step_params": [ 0.167, -1.492, 3.367, 0.729, 6.352, 34.117 ], "heli_params": [ -3.466, -0.169, 3.051, 10.710, -1.229, 34.694 ], "bp2_params": [ -0.369, -0.133, 0.174, -0.848, -18.188, -0.706 ], "groove_widths": [ 16.659, null, 15.481, null ], "simple_Rise": 3.367, "simple_Twist": 34.505, "simple_hRise": 3.055, "simple_hTwist": 35.075 }, { "index": 6, "nt1": "///A/13", "nt2": "///B/32", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.369, -0.133, 0.174, -0.848, -18.188, -0.706 ], "step_params": [ 0.422, -1.209, 3.214, 0.034, 2.574, 35.440 ], "heli_params": [ -2.346, -0.687, 3.122, 4.221, -0.056, 35.530 ], "bp2_params": [ 0.244, -0.147, 0.266, -1.902, -14.265, 3.640 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.214, "simple_Twist": 32.138, "simple_hRise": 3.111, "simple_hTwist": 32.239 }, { "index": 7, "nt1": "///A/14", "nt2": "///B/31", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.244, -0.147, 0.266, -1.902, -14.265, 3.640 ], "step_params": [ -0.392, -1.553, 3.241, 2.780, 12.439, 33.319 ], "heli_params": [ -4.178, 1.007, 2.482, 20.772, -4.643, 35.609 ], "bp2_params": [ -0.163, -0.130, -0.057, -11.454, -21.266, -0.231 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.241, "simple_Twist": 34.977, "simple_hRise": 2.525, "simple_hTwist": 37.159 }, { "index": 8, "nt1": "///A/15", "nt2": "///B/30", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 3, "helix_index": 1, "strand1": "CGC", "strand2": "GCG", "bp_type": "|||", "helix_form": "AA", "helical_rise": 2.144, "helical_rise_std": 0.201, "helical_radius": 9.487, "helical_radius_std": 0.578, "helical_axis": [ -0.383, 0.913, -0.139 ], "point1": [ -5.962, 35.292, 16.499 ], "point2": [ -7.557, 39.094, 15.922 ], "num_pairs": 3, "pairs": [ { "index": 1, "nt1": "///A/20", "nt2": "///B/26", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.097, -0.126, -0.156, 3.749, -6.956, -2.318 ], "step_params": [ 0.428, -1.954, 3.378, -2.589, 9.852, 28.905 ], "heli_params": [ -5.516, -1.287, 2.544, 19.007, 4.994, 30.612 ], "bp2_params": [ -0.064, -0.210, -0.166, 0.068, -6.056, 1.888 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.378, "simple_Twist": 29.736, "simple_hRise": 2.570, "simple_hTwist": 31.395 }, { "index": 2, "nt1": "///A/21", "nt2": "///B/25", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.064, -0.210, -0.166, 0.068, -6.056, 1.888 ], "step_params": [ 0.483, -2.263, 3.317, 0.963, -0.219, 31.920 ], "heli_params": [ -4.072, -0.701, 3.344, -0.398, -1.750, 31.935 ], "bp2_params": [ 0.158, -0.236, -0.155, 2.967, -2.230, 1.776 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.317, "simple_Twist": 30.690, "simple_hRise": 3.346, "simple_hTwist": 30.706 }, { "index": 3, "nt1": "///A/22", "nt2": "///B/24", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] } ], "num_isoCanonPairs": 2, "isoCanonPairs": [ { "index": -1, "helix_index": 1, "nt1": "///A/6", "nt2": "///B/40", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" }, { "index": -2, "helix_index": 1, "nt1": "///A/18", "nt2": "///B/28", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ], "num_coaxStacks": 1, "coaxStacks": [ { "index": 1, "helix_index": 1, "num_stems": 3, "stem_indices": [ 1, 2, 3 ] } ], "num_stacks": 6, "stacks": [ { "index": 1, "num_nts": 2, "nts_short": "GU", "nts_long": "///A/4,///A/5" }, { "index": 2, "num_nts": 2, "nts_short": "AA", "nts_long": "///A/16,///A/17" }, { "index": 3, "num_nts": 2, "nts_short": "AA", "nts_long": "///B/38,///B/39" }, { "index": 4, "num_nts": 3, "nts_short": "GUC", "nts_long": "///B/26,///B/27,///B/28" }, { "index": 5, "num_nts": 4, "nts_short": "UGAC", "nts_long": "///A/19,///A/18,///B/29,///B/30" }, { "index": 6, "num_nts": 5, "nts_short": "CAGUC", "nts_long": "///A/8,///A/7,///B/40,///B/41,///B/42" } ], "nonStack": { "num_nts": 2, "nts_short": "CC", "nts_long": "///A/6,///A/20" }, "num_atom2bases": 2, "atom2bases": [ { "index": 1, "type": "other", "atom": "///A/51/O31", "nt": "///A/15", "vert_dist": 3.374 }, { "index": 2, "type": "other", "atom": "///B/50/O31", "nt": "///B/37", "vert_dist": 3.268 } ], "num_iloops": 4, "iloops": [ { "index": 1, "type": "symmetric internal loop", "bridging_nts": [ 1, 1 ], "stem_indices": [ 1, -1 ], "summary": "[2] 1 1 [A.4 B.42 A.6 B.40] 3 1", "num_nts": 6, "nts_short": "GUCGUC", "nts_long": "///A/4,///A/5,///A/6,///B/40,///B/41,///B/42", "num_stems": 2, "bridges": [ { "index": 1, "num_nts": 1, "nts_short": "U", "nts_long": "///A/5" }, { "index": 2, "num_nts": 1, "nts_short": "U", "nts_long": "///B/41" } ] }, { "index": 2, "type": "symmetric internal loop", "bridging_nts": [ 1, 1 ], "stem_indices": [ -2, 3 ], "summary": "[2] 1 1 [A.18 B.28 A.20 B.26] 1 3", "num_nts": 6, "nts_short": "GUCGUC", "nts_long": "///A/18,///A/19,///A/20,///B/26,///B/27,///B/28", "num_stems": 2, "bridges": [ { "index": 1, "num_nts": 1, "nts_short": "U", "nts_long": "///A/19" }, { "index": 2, "num_nts": 1, "nts_short": "U", "nts_long": "///B/27" } ] }, { "index": 3, "type": "asymmetric internal loop", "bridging_nts": [ 1, 2 ], "stem_indices": [ -1, 2 ], "summary": "[2] 1 2 [A.6 B.40 A.8 B.37] 1 8", "num_nts": 7, "nts_short": "CACGAAG", "nts_long": "///A/6,///A/7,///A/8,///B/37,///B/38,///B/39,///B/40", "num_stems": 2, "bridges": [ { "index": 1, "num_nts": 1, "nts_short": "A", "nts_long": "///A/7" }, { "index": 2, "num_nts": 2, "nts_short": "AA", "nts_long": "///B/38,///B/39" } ] }, { "index": 4, "type": "asymmetric internal loop", "bridging_nts": [ 2, 1 ], "stem_indices": [ 2, -2 ], "summary": "[2] 2 1 [A.15 B.30 A.18 B.28] 8 1", "num_nts": 7, "nts_short": "GAAGCAC", "nts_long": "///A/15,///A/16,///A/17,///A/18,///B/28,///B/29,///B/30", "num_stems": 2, "bridges": [ { "index": 1, "num_nts": 2, "nts_short": "AA", "nts_long": "///A/16,///A/17" }, { "index": 2, "num_nts": 1, "nts_short": "A", "nts_long": "///B/29" } ] } ], "num_splayUnits": 4, "splayUnits": [ { "index": 1, "num_nts": 2, "nts_short": "GA", "nts_long": "///A/15,///A/16" }, { "index": 2, "num_nts": 2, "nts_short": "AG", "nts_long": "///A/17,///A/18" }, { "index": 3, "num_nts": 2, "nts_short": "GA", "nts_long": "///B/37,///B/38" }, { "index": 4, "num_nts": 2, "nts_short": "AG", "nts_long": "///B/39,///B/40" } ], "dbn": { "all_chains": { "num_nts": 42, "num_chars": 43, "bseq": "GCGUCACACCGGUGAAGUCGC&GCGUCACACCGGUGAAGUCGC", "sstr": "(((.(.((((((((..(.(((&))).).))))))))..).)))", "form": "AA.AAAAAAAAAA.A.AAAA-&AA..AAAAA.AAA.B..AAA-" }, "chain_A": { "num_nts": 21, "num_chars": 21, "bseq": "GCGUCACACCGGUGAAGUCGC", "sstr": "(((.(.((((((((..(.(((", "form": "AA.AAAAAAAAAA.A.AAAA-" }, "chain_B": { "num_nts": 21, "num_chars": 21, "bseq": "GCGUCACACCGGUGAAGUCGC", "sstr": "))).).))))))))..).)))", "form": "AA..AAAAA.AAA.B..AAA-" } }, "chains": { "chain_A": { "num_nts": 21, "bseq": "GCGUCACACCGGUGAAGUCGC", "sstr": "(((.(.((((((((..(.(((", "form": "AA.AAAAAAAAAA.A.AAAA-", "helical_rise": 2.604, "helical_rise_std": 1.392, "helical_axis": [ -0.601, 0.782, -0.164 ], "point1": [ 22.356, 0.514, 22.378 ], "point2": [ -9.038, 41.373, 13.800 ], "num_chars": 61, "suite": "G1cC1aG1cU1aC1aA1aC1aA1aC1aC1aG1aG1aU1aG!!A1aA3dG1aU1aC1aG1aC" }, "chain_B": { "num_nts": 21, "bseq": "GCGUCACACCGGUGAAGUCGC", "sstr": "))).).))))))))..).)))", "form": "AA..AAAAA.AAA.B..AAA-", "helical_rise": 2.641, "helical_rise_std": 1.148, "helical_axis": [ 0.655, -0.752, 0.073 ], "point1": [ -10.222, 37.846, 5.597 ], "point2": [ 24.434, -1.958, 9.457 ], "num_chars": 61, "suite": "G1aC1aG1cU1cC1aA1aC1aA1aC1aC1cG1aG1aU1aG!!A1aA1aG1aU1aC1aG1aC" } }, "num_nts": 42, "nts": [ { "index": 1, "index_chain": 1, "chain_name": "A", "nt_resnum": 2, "nt_name": "G", "nt_code": "G", "nt_id": "///A/2", "linked_nts": [ null, "///A/3" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack", "alpha": null, "beta": -137.305, "gamma": 52.866, "delta": 84.687, "epsilon": -176.110, "zeta": -82.478, "epsilon_zeta": -93.632, "bb_type": "BI", "chi": -155.050, "glyco_bond": "anti", "C5prime_xyz": [ -1.265, 8.741, 0.233 ], "P_xyz": [ 1.084, 8.982, 1.480 ], "form": "A", "ssZp": 4.174, "Dp": 4.360, "splay_angle": 22.415, "splay_distance": 3.614, "splay_ratio": 0.196, "d22": null, "d64": null, "eta": null, "theta": -140.385, "eta_prime": null, "theta_prime": -144.698, "eta_base": null, "theta_base": -122.448, "v0": 4.226, "v1": -26.230, "v2": 37.070, "v3": -35.724, "v4": 19.901, "amplitude": 37.961, "phase_angle": 12.440, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.003, "frame": { "rmsd": 0.003, "origin": [ 20.887, -3.471, 12.536 ], "x_axis": [ 0.567, 0.483, -0.667 ], "y_axis": [ -0.570, -0.355, -0.741 ], "z_axis": [ -0.595, 0.801, 0.074 ], "quaternion": [ 0.567, -0.680, 0.032, 0.464 ] } }, { "index": 2, "index_chain": 2, "chain_name": "A", "nt_resnum": 3, "nt_name": "C", "nt_code": "C", "nt_id": "///A/3", "linked_nts": [ "///A/2", "///A/4" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": 162.426, "beta": -153.954, "gamma": 161.780, "delta": 84.085, "epsilon": -125.099, "zeta": -76.833, "epsilon_zeta": -48.267, "bb_type": "--", "chi": -176.402, "glyco_bond": "anti", "C5prime_xyz": [ -1.055, 8.270, 1.593 ], "P_xyz": [ 1.039, 9.388, 0.517 ], "form": "A", "ssZp": 4.695, "Dp": 4.773, "splay_angle": 24.523, "splay_distance": 3.940, "splay_ratio": 0.217, "d22": null, "d64": null, "eta": 165.008, "theta": -144.428, "eta_prime": 177.083, "theta_prime": -144.820, "eta_base": -144.908, "theta_base": -118.289, "v0": 9.872, "v1": -30.309, "v2": 38.339, "v3": -33.745, "v4": 14.998, "amplitude": 38.440, "phase_angle": 4.150, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.431, "filter_rmsd": 0.063, "frame": { "rmsd": 0.002, "origin": [ 19.945, -0.190, 13.721 ], "x_axis": [ 0.227, 0.269, -0.936 ], "y_axis": [ -0.792, -0.508, -0.338 ], "z_axis": [ -0.566, 0.819, 0.097 ], "quaternion": [ -0.452, 0.640, -0.205, -0.587 ] } }, { "index": 3, "index_chain": 3, "chain_name": "A", "nt_resnum": 4, "nt_name": "G", "nt_code": "G", "nt_id": "///A/4", "linked_nts": [ "///A/3", "///A/5" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop", "alpha": -57.895, "beta": 165.376, "gamma": 46.971, "delta": 77.207, "epsilon": -166.247, "zeta": -63.021, "epsilon_zeta": -103.225, "bb_type": "BI", "chi": -169.747, "glyco_bond": "anti", "C5prime_xyz": [ -1.612, 8.730, 1.103 ], "P_xyz": [ 0.908, 9.361, 1.288 ], "form": ".", "ssZp": 4.668, "Dp": 4.583, "splay_angle": 26.277, "splay_distance": 4.451, "splay_ratio": 0.245, "d22": null, "d64": null, "eta": 154.832, "theta": -128.304, "eta_prime": 174.896, "theta_prime": -133.527, "eta_base": -136.375, "theta_base": -100.704, "v0": -2.364, "v1": -24.702, "v2": 40.999, "v3": -43.252, "v4": 28.667, "amplitude": 44.051, "phase_angle": 21.451, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.637, "filter_rmsd": 0.006, "frame": { "rmsd": 0.006, "origin": [ 19.668, 3.691, 13.097 ], "x_axis": [ -0.193, -0.187, -0.963 ], "y_axis": [ -0.795, -0.546, 0.266 ], "z_axis": [ -0.575, 0.817, -0.044 ], "quaternion": [ 0.233, -0.591, 0.416, 0.651 ] } }, { "index": 4, "index_chain": 4, "chain_name": "A", "nt_resnum": 5, "nt_name": "U", "nt_code": "U", "nt_id": "///A/5", "linked_nts": [ "///A/4", "///A/6" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop", "alpha": 173.923, "beta": -173.133, "gamma": 168.930, "delta": 86.019, "epsilon": -141.251, "zeta": -78.952, "epsilon_zeta": -62.300, "bb_type": "BI", "chi": -174.167, "glyco_bond": "anti", "C5prime_xyz": [ -1.128, 8.279, 1.476 ], "P_xyz": [ 0.682, 9.897, 0.547 ], "form": "A", "ssZp": 4.611, "Dp": 4.668, "splay_angle": 22.528, "splay_distance": 3.586, "splay_ratio": 0.198, "d22": 4.819, "d64": 4.907, "eta": 175.176, "theta": -168.312, "eta_prime": -168.131, "theta_prime": -164.491, "eta_base": -114.426, "theta_base": -147.471, "v0": 9.250, "v1": -28.774, "v2": 36.469, "v3": -32.202, "v4": 14.556, "amplitude": 36.579, "phase_angle": 4.449, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.553, "filter_rmsd": 0.104, "frame": { "rmsd": 0.003, "origin": [ 18.832, 6.425, 9.686 ], "x_axis": [ -0.681, -0.454, -0.574 ], "y_axis": [ -0.553, -0.194, 0.810 ], "z_axis": [ -0.479, 0.870, -0.119 ], "quaternion": [ 0.038, -0.397, 0.634, 0.663 ] } }, { "index": 5, "index_chain": 5, "chain_name": "A", "nt_resnum": 6, "nt_name": "C", "nt_code": "C", "nt_id": "///A/6", "linked_nts": [ "///A/5", "///A/7" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,non-stack,isolated-canonical,helix,internal-loop,phosphate", "alpha": -58.316, "beta": 170.895, "gamma": 44.801, "delta": 77.669, "epsilon": -151.799, "zeta": -71.030, "epsilon_zeta": -80.770, "bb_type": "BI", "chi": -159.543, "glyco_bond": "anti", "C5prime_xyz": [ -1.377, 8.796, 0.465 ], "P_xyz": [ 1.171, 9.257, 0.676 ], "form": "A", "ssZp": 4.408, "Dp": 4.670, "splay_angle": 24.303, "splay_distance": 3.912, "splay_ratio": 0.214, "d22": null, "d64": null, "eta": 164.199, "theta": -146.623, "eta_prime": 175.899, "theta_prime": -144.531, "eta_base": -156.886, "theta_base": -119.819, "v0": 0.378, "v1": -26.477, "v2": 41.260, "v3": -42.001, "v4": 26.186, "amplitude": 43.390, "phase_angle": 18.030, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.788, "filter_rmsd": 0.062, "frame": { "rmsd": 0.002, "origin": [ 18.740, 9.492, 7.831 ], "x_axis": [ -0.860, -0.489, -0.150 ], "y_axis": [ -0.238, 0.125, 0.963 ], "z_axis": [ -0.452, 0.864, -0.224 ], "quaternion": [ -0.102, -0.245, 0.743, 0.615 ] } }, { "index": 6, "index_chain": 6, "chain_name": "A", "nt_resnum": 7, "nt_name": "A", "nt_code": "A", "nt_id": "///A/7", "linked_nts": [ "///A/6", "///A/8" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-pair-contact,internal-loop", "alpha": -52.320, "beta": 171.337, "gamma": 46.411, "delta": 78.610, "epsilon": -144.581, "zeta": -67.951, "epsilon_zeta": -76.630, "bb_type": "BI", "chi": -164.480, "glyco_bond": "anti", "C5prime_xyz": [ -1.593, 8.762, 0.790 ], "P_xyz": [ 0.908, 9.383, 1.182 ], "form": "A", "ssZp": 4.527, "Dp": 4.660, "splay_angle": 26.650, "splay_distance": 4.224, "splay_ratio": 0.233, "d22": null, "d64": null, "eta": 172.574, "theta": -138.714, "eta_prime": -175.072, "theta_prime": -134.707, "eta_base": -137.269, "theta_base": -91.886, "v0": -1.721, "v1": -24.552, "v2": 40.204, "v3": -42.111, "v4": 27.544, "amplitude": 42.986, "phase_angle": 20.728, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.787, "filter_rmsd": 0.037, "frame": { "rmsd": 0.004, "origin": [ 16.385, 11.543, 5.475 ], "x_axis": [ -0.763, -0.515, 0.390 ], "y_axis": [ 0.222, 0.358, 0.907 ], "z_axis": [ -0.607, 0.779, -0.159 ], "quaternion": [ -0.330, -0.097, 0.755, 0.558 ] } }, { "index": 7, "index_chain": 7, "chain_name": "A", "nt_resnum": 8, "nt_name": "C", "nt_code": "C", "nt_id": "///A/8", "linked_nts": [ "///A/7", "///A/9" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop", "alpha": -61.192, "beta": 176.602, "gamma": 46.554, "delta": 79.596, "epsilon": -148.023, "zeta": -72.335, "epsilon_zeta": -75.688, "bb_type": "BI", "chi": -159.242, "glyco_bond": "anti", "C5prime_xyz": [ -1.295, 8.803, 0.470 ], "P_xyz": [ 1.264, 9.254, 0.797 ], "form": "A", "ssZp": 4.391, "Dp": 4.659, "splay_angle": 22.291, "splay_distance": 3.533, "splay_ratio": 0.194, "d22": null, "d64": null, "eta": 165.697, "theta": -145.763, "eta_prime": -178.023, "theta_prime": -142.542, "eta_base": -120.313, "theta_base": -113.447, "v0": 2.341, "v1": -27.195, "v2": 40.553, "v3": -40.139, "v4": 23.752, "amplitude": 42.061, "phase_angle": 15.390, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.889, "filter_rmsd": 0.062, "frame": { "rmsd": 0.003, "origin": [ 12.247, 12.358, 5.721 ], "x_axis": [ -0.224, -0.259, 0.939 ], "y_axis": [ 0.635, 0.692, 0.342 ], "z_axis": [ -0.739, 0.674, 0.009 ], "quaternion": [ 0.608, -0.136, -0.690, -0.368 ] } }, { "index": 8, "index_chain": 8, "chain_name": "A", "nt_resnum": 9, "nt_name": "A", "nt_code": "A", "nt_id": "///A/9", "linked_nts": [ "///A/8", "///A/10" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -64.650, "beta": 176.763, "gamma": 49.973, "delta": 80.752, "epsilon": -147.437, "zeta": -78.904, "epsilon_zeta": -68.533, "bb_type": "BI", "chi": -157.408, "glyco_bond": "anti", "C5prime_xyz": [ -1.363, 8.729, 0.281 ], "P_xyz": [ 1.204, 9.188, 0.507 ], "form": "A", "ssZp": 4.271, "Dp": 4.681, "splay_angle": 19.778, "splay_distance": 3.118, "splay_ratio": 0.172, "d22": null, "d64": null, "eta": 166.908, "theta": -149.491, "eta_prime": 179.404, "theta_prime": -147.631, "eta_base": -139.767, "theta_base": -117.622, "v0": 3.753, "v1": -28.492, "v2": 41.014, "v3": -39.831, "v4": 22.771, "amplitude": 42.183, "phase_angle": 13.523, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.969, "filter_rmsd": 0.038, "frame": { "rmsd": 0.009, "origin": [ 9.010, 13.364, 6.716 ], "x_axis": [ 0.367, -0.005, 0.930 ], "y_axis": [ 0.559, 0.801, -0.216 ], "z_axis": [ -0.744, 0.599, 0.297 ], "quaternion": [ 0.785, -0.260, -0.533, -0.179 ] } }, { "index": 9, "index_chain": 9, "chain_name": "A", "nt_resnum": 10, "nt_name": "C", "nt_code": "C", "nt_id": "///A/10", "linked_nts": [ "///A/9", "///A/11" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -62.508, "beta": 155.441, "gamma": 63.342, "delta": 82.667, "epsilon": -157.437, "zeta": -73.852, "epsilon_zeta": -83.585, "bb_type": "BI", "chi": -159.988, "glyco_bond": "anti", "C5prime_xyz": [ -1.399, 8.802, 0.441 ], "P_xyz": [ 1.122, 9.100, -0.225 ], "form": "A", "ssZp": 4.428, "Dp": 4.598, "splay_angle": 24.988, "splay_distance": 3.939, "splay_ratio": 0.218, "d22": 4.436, "d64": 4.415, "eta": 164.592, "theta": -147.704, "eta_prime": -176.885, "theta_prime": -152.013, "eta_base": -130.393, "theta_base": -132.803, "v0": 0.632, "v1": -25.474, "v2": 39.232, "v3": -39.793, "v4": 24.694, "amplitude": 41.166, "phase_angle": 17.634, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.724, "filter_rmsd": 0.063, "frame": { "rmsd": 0.005, "origin": [ 6.806, 14.315, 8.705 ], "x_axis": [ 0.580, 0.414, 0.702 ], "y_axis": [ 0.153, 0.790, -0.593 ], "z_axis": [ -0.800, 0.452, 0.394 ], "quaternion": [ 0.831, -0.314, -0.452, 0.078 ] } }, { "index": 10, "index_chain": 10, "chain_name": "A", "nt_resnum": 11, "nt_name": "C", "nt_code": "C", "nt_id": "///A/11", "linked_nts": [ "///A/10", "///A/12" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -62.493, "beta": -178.702, "gamma": 46.436, "delta": 80.757, "epsilon": -153.447, "zeta": -71.420, "epsilon_zeta": -82.027, "bb_type": "BI", "chi": -159.495, "glyco_bond": "anti", "C5prime_xyz": [ -1.210, 8.750, 0.439 ], "P_xyz": [ 1.331, 9.127, 0.955 ], "form": "A", "ssZp": 4.324, "Dp": 4.644, "splay_angle": 22.003, "splay_distance": 3.571, "splay_ratio": 0.194, "d22": null, "d64": null, "eta": 171.003, "theta": -149.685, "eta_prime": -179.802, "theta_prime": -148.259, "eta_base": -146.159, "theta_base": -132.547, "v0": 4.745, "v1": -28.992, "v2": 41.012, "v3": -39.176, "v4": 21.711, "amplitude": 41.950, "phase_angle": 12.139, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.863, "filter_rmsd": 0.063, "frame": { "rmsd": 0.007, "origin": [ 4.103, 15.073, 11.468 ], "x_axis": [ 0.740, 0.645, 0.191 ], "y_axis": [ -0.187, 0.470, -0.863 ], "z_axis": [ -0.646, 0.602, 0.469 ], "quaternion": [ 0.818, -0.448, -0.256, 0.254 ] } }, { "index": 11, "index_chain": 11, "chain_name": "A", "nt_resnum": 12, "nt_name": "G", "nt_code": "G", "nt_id": "///A/12", "linked_nts": [ "///A/11", "///A/13" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -65.229, "beta": 173.109, "gamma": 53.582, "delta": 77.661, "epsilon": -158.056, "zeta": -71.252, "epsilon_zeta": -86.804, "bb_type": "BI", "chi": -162.622, "glyco_bond": "anti", "C5prime_xyz": [ -1.563, 8.801, 0.533 ], "P_xyz": [ 0.951, 9.458, 0.688 ], "form": "A", "ssZp": 4.408, "Dp": 4.635, "splay_angle": 23.246, "splay_distance": 3.613, "splay_ratio": 0.203, "d22": null, "d64": null, "eta": 165.570, "theta": -153.101, "eta_prime": 178.201, "theta_prime": -151.877, "eta_base": -152.426, "theta_base": -121.179, "v0": 1.460, "v1": -27.368, "v2": 41.271, "v3": -41.542, "v4": 25.364, "amplitude": 43.086, "phase_angle": 16.687, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.954, "filter_rmsd": 0.011, "frame": { "rmsd": 0.011, "origin": [ 2.550, 16.241, 14.464 ], "x_axis": [ 0.686, 0.684, -0.247 ], "y_axis": [ -0.514, 0.214, -0.831 ], "z_axis": [ -0.516, 0.697, 0.498 ], "quaternion": [ 0.774, -0.493, -0.087, 0.387 ] } }, { "index": 12, "index_chain": 12, "chain_name": "A", "nt_resnum": 13, "nt_name": "G", "nt_code": "G", "nt_id": "///A/13", "linked_nts": [ "///A/12", "///A/14" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -60.857, "beta": 171.007, "gamma": 55.206, "delta": 83.576, "epsilon": -144.710, "zeta": -72.005, "epsilon_zeta": -72.705, "bb_type": "BI", "chi": -165.168, "glyco_bond": "anti", "C5prime_xyz": [ -1.355, 8.674, 0.777 ], "P_xyz": [ 1.238, 8.981, 0.981 ], "form": "A", "ssZp": 4.450, "Dp": 4.670, "splay_angle": 22.520, "splay_distance": 3.569, "splay_ratio": 0.197, "d22": null, "d64": null, "eta": 173.553, "theta": -137.870, "eta_prime": -173.351, "theta_prime": -137.689, "eta_base": -129.370, "theta_base": -104.345, "v0": 4.772, "v1": -28.310, "v2": 39.753, "v3": -38.113, "v4": 21.040, "amplitude": 40.645, "phase_angle": 12.029, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.896, "filter_rmsd": 0.009, "frame": { "rmsd": 0.009, "origin": [ 2.215, 18.934, 16.849 ], "x_axis": [ 0.298, 0.664, -0.685 ], "y_axis": [ -0.822, -0.187, -0.538 ], "z_axis": [ -0.486, 0.724, 0.490 ], "quaternion": [ 0.633, -0.499, 0.079, 0.587 ] } }, { "index": 13, "index_chain": 13, "chain_name": "A", "nt_resnum": 14, "nt_name": "U", "nt_code": "U", "nt_id": "///A/14", "linked_nts": [ "///A/13", "///A/15" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -62.742, "beta": 166.738, "gamma": 54.310, "delta": 81.069, "epsilon": -160.214, "zeta": -71.825, "epsilon_zeta": -88.389, "bb_type": "BI", "chi": -163.498, "glyco_bond": "anti", "C5prime_xyz": [ -1.482, 8.728, 0.635 ], "P_xyz": [ 1.087, 9.220, 0.596 ], "form": "A", "ssZp": 4.460, "Dp": 4.597, "splay_angle": 22.078, "splay_distance": 3.475, "splay_ratio": 0.195, "d22": null, "d64": null, "eta": 162.598, "theta": -150.919, "eta_prime": -177.979, "theta_prime": -151.740, "eta_base": -123.721, "theta_base": -129.973, "v0": 2.301, "v1": -27.729, "v2": 41.115, "v3": -40.772, "v4": 24.261, "amplitude": 42.659, "phase_angle": 15.462, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.964, "filter_rmsd": 0.104, "frame": { "rmsd": 0.005, "origin": [ 2.021, 22.399, 17.682 ], "x_axis": [ -0.244, 0.384, -0.890 ], "y_axis": [ -0.878, -0.478, 0.034 ], "z_axis": [ -0.413, 0.790, 0.454 ], "quaternion": [ 0.428, -0.442, 0.279, 0.738 ] } }, { "index": 14, "index_chain": 14, "chain_name": "A", "nt_resnum": 15, "nt_name": "G", "nt_code": "G", "nt_id": "///A/15", "linked_nts": [ "///A/14", "///A/16" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop,cap-acceptor,splayed-apart", "alpha": -65.988, "beta": -179.472, "gamma": 49.258, "delta": 84.007, "epsilon": -123.940, "zeta": -139.120, "epsilon_zeta": 15.180, "bb_type": "--", "chi": -159.698, "glyco_bond": "anti", "C5prime_xyz": [ -1.324, 8.739, 0.449 ], "P_xyz": [ 1.251, 9.127, 0.782 ], "form": ".", "ssZp": 4.241, "Dp": 4.762, "splay_angle": 97.704, "splay_distance": 15.387, "splay_ratio": 0.756, "d22": null, "d64": null, "eta": 176.278, "theta": -148.202, "eta_prime": -176.397, "theta_prime": -166.814, "eta_base": -145.307, "theta_base": 174.156, "v0": 2.283, "v1": -26.727, "v2": 39.653, "v3": -39.361, "v4": 23.360, "amplitude": 41.138, "phase_angle": 15.442, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.871, "filter_rmsd": 0.008, "frame": { "rmsd": 0.008, "origin": [ 2.107, 25.786, 18.453 ], "x_axis": [ -0.621, -0.006, -0.783 ], "y_axis": [ -0.660, -0.534, 0.528 ], "z_axis": [ -0.421, 0.845, 0.328 ], "quaternion": [ 0.208, -0.382, 0.436, 0.788 ] } }, { "index": 15, "index_chain": 15, "chain_name": "A", "nt_resnum": 16, "nt_name": "A", "nt_code": "A", "nt_id": "///A/16", "linked_nts": [ "///A/15", "///A/17" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-pair-contact,internal-loop,phosphate,splayed-apart", "alpha": 74.795, "beta": 131.252, "gamma": -169.827, "delta": 85.585, "epsilon": -156.462, "zeta": -74.484, "epsilon_zeta": -81.977, "bb_type": "BI", "chi": -158.965, "glyco_bond": "anti", "C5prime_xyz": [ -1.361, 8.673, 0.451 ], "P_xyz": [ -1.589, 11.061, -0.574 ], "form": "A", "ssZp": 4.321, "Dp": 4.536, "splay_angle": 20.750, "splay_distance": 3.319, "splay_ratio": 0.181, "d22": null, "d64": null, "eta": 68.577, "theta": 152.003, "eta_prime": 60.832, "theta_prime": 168.870, "eta_base": 43.672, "theta_base": -170.176, "v0": 4.035, "v1": -27.072, "v2": 38.374, "v3": -37.216, "v4": 21.025, "amplitude": 39.373, "phase_angle": 12.939, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.003, "origin": [ 1.928, 32.701, 32.198 ], "x_axis": [ 0.830, -0.529, 0.177 ], "y_axis": [ -0.337, -0.729, -0.595 ], "z_axis": [ 0.444, 0.434, -0.784 ], "quaternion": [ -0.282, 0.914, -0.237, 0.170 ] } }, { "index": 16, "index_chain": 16, "chain_name": "A", "nt_resnum": 17, "nt_name": "A", "nt_code": "A", "nt_id": "///A/17", "linked_nts": [ "///A/16", "///A/18" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-pair-contact,internal-loop,phosphate,splayed-apart", "alpha": -77.615, "beta": 179.295, "gamma": 54.413, "delta": 83.807, "epsilon": -99.546, "zeta": -139.022, "epsilon_zeta": 39.477, "bb_type": "--", "chi": -149.183, "glyco_bond": "anti", "C5prime_xyz": [ -1.394, 8.752, -0.139 ], "P_xyz": [ 1.165, 9.254, -0.412 ], "form": ".", "ssZp": 3.520, "Dp": 4.708, "splay_angle": 143.111, "splay_distance": 16.599, "splay_ratio": 0.949, "d22": null, "d64": null, "eta": 177.105, "theta": -120.745, "eta_prime": -178.409, "theta_prime": -103.233, "eta_base": -162.742, "theta_base": -68.495, "v0": 0.850, "v1": -25.162, "v2": 38.428, "v3": -38.939, "v4": 24.047, "amplitude": 40.263, "phase_angle": 17.360, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.810, "filter_rmsd": 0.038, "frame": { "rmsd": 0.005, "origin": [ 3.436, 35.288, 30.766 ], "x_axis": [ 0.581, -0.813, -0.035 ], "y_axis": [ -0.541, -0.354, -0.763 ], "z_axis": [ 0.608, 0.462, -0.646 ], "quaternion": [ -0.381, 0.803, -0.422, 0.178 ] } }, { "index": 17, "index_chain": 17, "chain_name": "A", "nt_resnum": 18, "nt_name": "G", "nt_code": "G", "nt_id": "///A/18", "linked_nts": [ "///A/17", "///A/19" ], "nt_type": "RNA", "dbn": "(", "summary": "~C3'-endo,BI,isolated-canonical,non-pair-contact,helix,internal-loop,phosphate,splayed-apart", "alpha": 68.940, "beta": 128.437, "gamma": 39.080, "delta": 84.594, "epsilon": -146.453, "zeta": -76.260, "epsilon_zeta": -70.192, "bb_type": "BI", "chi": 173.799, "glyco_bond": "--", "C5prime_xyz": [ -1.144, 8.032, 2.137 ], "P_xyz": [ 1.405, 7.408, 2.023 ], "form": "A", "ssZp": 4.904, "Dp": 4.744, "splay_angle": 26.680, "splay_distance": 4.111, "splay_ratio": 0.241, "d22": null, "d64": null, "eta": -120.286, "theta": -131.615, "eta_prime": -115.725, "theta_prime": -133.548, "eta_base": -120.060, "theta_base": -126.503, "v0": 9.028, "v1": -30.874, "v2": 39.747, "v3": -35.607, "v4": 16.830, "amplitude": 39.956, "phase_angle": 5.851, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "3d", "suiteness": 0.072, "filter_rmsd": 0.014, "frame": { "rmsd": 0.014, "origin": [ 0.560, 32.233, 14.706 ], "x_axis": [ -0.721, -0.588, 0.366 ], "y_axis": [ 0.204, 0.325, 0.923 ], "z_axis": [ -0.662, 0.740, -0.115 ], "quaternion": [ -0.350, -0.131, 0.735, 0.566 ] } }, { "index": 18, "index_chain": 18, "chain_name": "A", "nt_resnum": 19, "nt_name": "U", "nt_code": "U", "nt_id": "///A/19", "linked_nts": [ "///A/18", "///A/20" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop", "alpha": -58.400, "beta": 177.218, "gamma": 55.704, "delta": 84.094, "epsilon": -149.865, "zeta": -73.285, "epsilon_zeta": -76.580, "bb_type": "BI", "chi": -168.186, "glyco_bond": "anti", "C5prime_xyz": [ -1.509, 8.623, 0.923 ], "P_xyz": [ 1.043, 8.970, 1.402 ], "form": "A", "ssZp": 4.466, "Dp": 4.609, "splay_angle": 21.965, "splay_distance": 3.558, "splay_ratio": 0.195, "d22": 4.466, "d64": 4.540, "eta": -179.891, "theta": -142.956, "eta_prime": -166.517, "theta_prime": -143.553, "eta_base": -138.462, "theta_base": -120.591, "v0": 3.196, "v1": -26.754, "v2": 38.789, "v3": -37.981, "v4": 21.957, "amplitude": 39.994, "phase_angle": 14.101, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.920, "filter_rmsd": 0.104, "frame": { "rmsd": 0.007, "origin": [ -2.269, 33.246, 11.899 ], "x_axis": [ -0.575, -0.299, 0.762 ], "y_axis": [ 0.497, 0.613, 0.615 ], "z_axis": [ -0.651, 0.732, -0.204 ], "quaternion": [ -0.457, 0.064, 0.773, 0.435 ] } }, { "index": 19, "index_chain": 19, "chain_name": "A", "nt_resnum": 20, "nt_name": "C", "nt_code": "C", "nt_id": "///A/20", "linked_nts": [ "///A/19", "///A/21" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,non-stack,canonical,helix,stem-end,coaxial-stack,internal-loop", "alpha": -62.643, "beta": 174.173, "gamma": 48.118, "delta": 79.684, "epsilon": -151.137, "zeta": -70.290, "epsilon_zeta": -80.847, "bb_type": "BI", "chi": -160.280, "glyco_bond": "anti", "C5prime_xyz": [ -1.422, 8.838, 0.486 ], "P_xyz": [ 1.128, 9.416, 0.718 ], "form": "A", "ssZp": 4.417, "Dp": 4.637, "splay_angle": 24.074, "splay_distance": 3.938, "splay_ratio": 0.213, "d22": null, "d64": null, "eta": 165.157, "theta": -145.833, "eta_prime": 177.495, "theta_prime": -144.859, "eta_base": -143.635, "theta_base": -119.480, "v0": 0.024, "v1": -25.144, "v2": 39.435, "v3": -40.381, "v4": 25.388, "amplitude": 41.583, "phase_angle": 18.496, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.931, "filter_rmsd": 0.062, "frame": { "rmsd": 0.003, "origin": [ -5.501, 34.198, 10.757 ], "x_axis": [ -0.187, 0.049, 0.981 ], "y_axis": [ 0.672, 0.735, 0.092 ], "z_axis": [ -0.716, 0.677, -0.170 ], "quaternion": [ 0.587, -0.249, -0.723, -0.266 ] } }, { "index": 20, "index_chain": 20, "chain_name": "A", "nt_resnum": 21, "nt_name": "G", "nt_code": "G", "nt_id": "///A/21", "linked_nts": [ "///A/20", "///A/22" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -60.560, "beta": 172.254, "gamma": 52.042, "delta": 78.409, "epsilon": -159.629, "zeta": -62.210, "epsilon_zeta": -97.419, "bb_type": "BI", "chi": -167.286, "glyco_bond": "anti", "C5prime_xyz": [ -1.583, 8.817, 0.921 ], "P_xyz": [ 0.919, 9.532, 1.229 ], "form": "A", "ssZp": 4.598, "Dp": 4.572, "splay_angle": 24.381, "splay_distance": 4.070, "splay_ratio": 0.221, "d22": null, "d64": null, "eta": 167.045, "theta": -146.024, "eta_prime": -178.305, "theta_prime": -144.258, "eta_base": -137.034, "theta_base": -119.171, "v0": -1.163, "v1": -24.037, "v2": 38.665, "v3": -40.305, "v4": 26.188, "amplitude": 41.180, "phase_angle": 20.130, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.960, "filter_rmsd": 0.004, "frame": { "rmsd": 0.004, "origin": [ -9.201, 35.393, 11.379 ], "x_axis": [ 0.320, 0.282, 0.904 ], "y_axis": [ 0.670, 0.607, -0.427 ], "z_axis": [ -0.669, 0.743, 0.005 ], "quaternion": [ 0.695, -0.421, -0.566, -0.140 ] } }, { "index": 21, "index_chain": 21, "chain_name": "A", "nt_resnum": 22, "nt_name": "C", "nt_code": "C", "nt_id": "///A/22", "linked_nts": [ "///A/21", null ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack", "alpha": -65.403, "beta": -176.431, "gamma": 54.694, "delta": 74.637, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": -158.528, "glyco_bond": "anti", "C5prime_xyz": [ -1.711, 8.940, 0.317 ], "P_xyz": [ 0.754, 9.771, 0.708 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": -6.011, "v1": -19.627, "v2": 36.349, "v3": -40.743, "v4": 29.384, "amplitude": 40.723, "phase_angle": 26.801, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.789, "filter_rmsd": 0.062, "frame": { "rmsd": 0.003, "origin": [ -12.291, 36.945, 13.525 ], "x_axis": [ 0.637, 0.548, 0.543 ], "y_axis": [ 0.354, 0.418, -0.837 ], "z_axis": [ -0.685, 0.725, 0.072 ], "quaternion": [ 0.729, -0.535, -0.421, 0.066 ] } }, { "index": 22, "index_chain": 1, "chain_name": "B", "nt_resnum": 24, "nt_name": "G", "nt_code": "G", "nt_id": "///B/24", "linked_nts": [ null, "///B/25" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack", "alpha": null, "beta": 168.847, "gamma": 50.213, "delta": 84.275, "epsilon": -156.536, "zeta": -68.988, "epsilon_zeta": -87.548, "bb_type": "BI", "chi": -176.164, "glyco_bond": "anti", "C5prime_xyz": [ -1.324, 8.445, 1.483 ], "P_xyz": [ 1.306, 8.551, 1.977 ], "form": "A", "ssZp": 4.647, "Dp": 4.614, "splay_angle": 25.816, "splay_distance": 4.025, "splay_ratio": 0.229, "d22": null, "d64": null, "eta": null, "theta": -143.560, "eta_prime": null, "theta_prime": -142.894, "eta_base": null, "theta_base": -124.255, "v0": 5.298, "v1": -27.657, "v2": 38.313, "v3": -36.308, "v4": 19.546, "amplitude": 39.029, "phase_angle": 10.990, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.002, "frame": { "rmsd": 0.002, "origin": [ -12.405, 37.073, 13.251 ], "x_axis": [ 0.650, 0.506, 0.566 ], "y_axis": [ -0.409, -0.396, 0.823 ], "z_axis": [ 0.640, -0.766, -0.051 ], "quaternion": [ 0.549, 0.724, 0.034, 0.417 ] } }, { "index": 23, "index_chain": 2, "chain_name": "B", "nt_resnum": 25, "nt_name": "C", "nt_code": "C", "nt_id": "///B/25", "linked_nts": [ "///B/24", "///B/26" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -64.870, "beta": -171.658, "gamma": 48.306, "delta": 81.989, "epsilon": -155.955, "zeta": -69.795, "epsilon_zeta": -86.159, "bb_type": "BI", "chi": -161.235, "glyco_bond": "anti", "C5prime_xyz": [ -1.224, 8.711, 0.635 ], "P_xyz": [ 1.312, 9.071, 1.195 ], "form": "A", "ssZp": 4.511, "Dp": 4.628, "splay_angle": 24.243, "splay_distance": 3.914, "splay_ratio": 0.215, "d22": null, "d64": null, "eta": 173.574, "theta": -148.711, "eta_prime": -175.743, "theta_prime": -146.523, "eta_base": -143.093, "theta_base": -129.464, "v0": 3.823, "v1": -27.328, "v2": 39.184, "v3": -37.962, "v4": 21.519, "amplitude": 40.250, "phase_angle": 13.220, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.850, "filter_rmsd": 0.062, "frame": { "rmsd": 0.002, "origin": [ -9.145, 35.661, 11.359 ], "x_axis": [ 0.367, 0.182, 0.912 ], "y_axis": [ -0.682, -0.614, 0.397 ], "z_axis": [ 0.632, -0.768, -0.101 ], "quaternion": [ 0.404, 0.721, -0.173, 0.535 ] } }, { "index": 24, "index_chain": 3, "chain_name": "B", "nt_resnum": 26, "nt_name": "G", "nt_code": "G", "nt_id": "///B/26", "linked_nts": [ "///B/25", "///B/27" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop", "alpha": -67.762, "beta": -174.233, "gamma": 46.791, "delta": 76.632, "epsilon": -172.926, "zeta": -72.879, "epsilon_zeta": -100.048, "bb_type": "BI", "chi": -157.030, "glyco_bond": "anti", "C5prime_xyz": [ -1.347, 8.827, 0.401 ], "P_xyz": [ 1.186, 9.439, 0.619 ], "form": ".", "ssZp": 4.497, "Dp": 4.556, "splay_angle": 25.586, "splay_distance": 4.817, "splay_ratio": 0.248, "d22": null, "d64": null, "eta": 164.900, "theta": -142.522, "eta_prime": 175.839, "theta_prime": -153.640, "eta_base": -154.101, "theta_base": -164.938, "v0": 0.927, "v1": -26.652, "v2": 41.028, "v3": -41.356, "v4": 25.516, "amplitude": 42.969, "phase_angle": 17.285, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.837, "filter_rmsd": 0.009, "frame": { "rmsd": 0.009, "origin": [ -5.509, 34.395, 10.654 ], "x_axis": [ -0.074, -0.008, 0.997 ], "y_axis": [ -0.723, -0.688, -0.059 ], "z_axis": [ 0.686, -0.726, 0.045 ], "quaternion": [ 0.266, 0.626, -0.292, 0.672 ] } }, { "index": 25, "index_chain": 4, "chain_name": "B", "nt_resnum": 27, "nt_name": "U", "nt_code": "U", "nt_id": "///B/27", "linked_nts": [ "///B/26", "///B/28" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop", "alpha": 148.279, "beta": -172.378, "gamma": -166.327, "delta": 79.558, "epsilon": -148.141, "zeta": -59.911, "epsilon_zeta": -88.230, "bb_type": "BI", "chi": -172.076, "glyco_bond": "anti", "C5prime_xyz": [ -1.381, 8.516, 1.333 ], "P_xyz": [ -0.534, 10.794, 0.396 ], "form": ".", "ssZp": 4.723, "Dp": 4.685, "splay_angle": 37.135, "splay_distance": 5.890, "splay_ratio": 0.325, "d22": 3.584, "d64": 4.484, "eta": 174.911, "theta": -143.925, "eta_prime": 177.613, "theta_prime": -140.159, "eta_base": 178.530, "theta_base": -90.588, "v0": 2.497, "v1": -26.794, "v2": 40.011, "v3": -39.535, "v4": 23.301, "amplitude": 41.469, "phase_angle": 15.238, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.596, "filter_rmsd": 0.104, "frame": { "rmsd": 0.006, "origin": [ -0.816, 34.929, 9.708 ], "x_axis": [ -0.172, 0.012, 0.985 ], "y_axis": [ -0.633, -0.767, -0.101 ], "z_axis": [ 0.755, -0.641, 0.140 ], "quaternion": [ 0.224, 0.603, -0.257, 0.721 ] } }, { "index": 26, "index_chain": 5, "chain_name": "B", "nt_resnum": 28, "nt_name": "C", "nt_code": "C", "nt_id": "///B/28", "linked_nts": [ "///B/27", "///B/29" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,isolated-canonical,non-pair-contact,helix,internal-loop,phosphate", "alpha": 151.688, "beta": -169.250, "gamma": 179.186, "delta": 85.627, "epsilon": -123.134, "zeta": -74.239, "epsilon_zeta": -48.895, "bb_type": "--", "chi": 178.878, "glyco_bond": "anti", "C5prime_xyz": [ -0.908, 7.871, 1.916 ], "P_xyz": [ 0.987, 9.531, 1.360 ], "form": "A", "ssZp": 4.803, "Dp": 4.814, "splay_angle": 27.021, "splay_distance": 4.332, "splay_ratio": 0.241, "d22": null, "d64": null, "eta": 162.639, "theta": -150.961, "eta_prime": -171.885, "theta_prime": -144.183, "eta_base": -99.591, "theta_base": -117.638, "v0": 14.674, "v1": -32.750, "v2": 37.891, "v3": -30.565, "v4": 9.941, "amplitude": 37.957, "phase_angle": 356.605, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.823, "filter_rmsd": 0.063, "frame": { "rmsd": 0.003, "origin": [ 0.426, 32.345, 14.853 ], "x_axis": [ -0.676, -0.617, 0.404 ], "y_axis": [ -0.165, -0.407, -0.898 ], "z_axis": [ 0.718, -0.674, 0.174 ], "quaternion": [ -0.150, 0.373, -0.523, 0.751 ] } }, { "index": 27, "index_chain": 6, "chain_name": "B", "nt_resnum": 29, "nt_name": "A", "nt_code": "A", "nt_id": "///B/29", "linked_nts": [ "///B/28", "///B/30" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-pair-contact,internal-loop", "alpha": -43.562, "beta": 170.196, "gamma": 40.576, "delta": 79.006, "epsilon": -145.685, "zeta": -66.107, "epsilon_zeta": -79.578, "bb_type": "BI", "chi": -166.563, "glyco_bond": "anti", "C5prime_xyz": [ -1.750, 8.713, 0.875 ], "P_xyz": [ 0.676, 9.386, 1.535 ], "form": "A", "ssZp": 4.525, "Dp": 4.635, "splay_angle": 25.252, "splay_distance": 4.064, "splay_ratio": 0.222, "d22": null, "d64": null, "eta": 169.452, "theta": -138.135, "eta_prime": -172.878, "theta_prime": -134.101, "eta_base": -134.110, "theta_base": -91.277, "v0": -1.924, "v1": -23.427, "v2": 38.504, "v3": -40.693, "v4": 26.801, "amplitude": 41.302, "phase_angle": 21.211, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.364, "filter_rmsd": 0.037, "frame": { "rmsd": 0.003, "origin": [ 2.145, 29.776, 17.888 ], "x_axis": [ -0.746, -0.640, -0.182 ], "y_axis": [ 0.228, 0.011, -0.974 ], "z_axis": [ 0.625, -0.768, 0.138 ], "quaternion": [ -0.317, 0.162, -0.636, 0.684 ] } }, { "index": 28, "index_chain": 7, "chain_name": "B", "nt_resnum": 30, "nt_name": "C", "nt_code": "C", "nt_id": "///B/30", "linked_nts": [ "///B/29", "///B/31" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop", "alpha": -64.812, "beta": 176.407, "gamma": 49.183, "delta": 79.582, "epsilon": -150.695, "zeta": -73.064, "epsilon_zeta": -77.630, "bb_type": "BI", "chi": -158.612, "glyco_bond": "anti", "C5prime_xyz": [ -1.514, 8.839, 0.377 ], "P_xyz": [ 1.015, 9.447, 0.573 ], "form": "A", "ssZp": 4.383, "Dp": 4.646, "splay_angle": 23.717, "splay_distance": 3.762, "splay_ratio": 0.207, "d22": null, "d64": null, "eta": 163.624, "theta": -147.533, "eta_prime": -179.289, "theta_prime": -144.393, "eta_base": -121.121, "theta_base": -113.117, "v0": -1.176, "v1": -24.943, "v2": 40.076, "v3": -41.714, "v4": 27.027, "amplitude": 42.657, "phase_angle": 20.033, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.943, "filter_rmsd": 0.062, "frame": { "rmsd": 0.003, "origin": [ 1.901, 25.752, 18.397 ], "x_axis": [ -0.454, -0.331, -0.827 ], "y_axis": [ 0.750, 0.359, -0.556 ], "z_axis": [ 0.481, -0.873, 0.085 ], "quaternion": [ 0.497, 0.159, 0.657, -0.543 ] } }, { "index": 29, "index_chain": 8, "chain_name": "B", "nt_resnum": 31, "nt_name": "A", "nt_code": "A", "nt_id": "///B/31", "linked_nts": [ "///B/30", "///B/32" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -61.919, "beta": 173.131, "gamma": 51.883, "delta": 82.464, "epsilon": -152.422, "zeta": -76.941, "epsilon_zeta": -75.481, "bb_type": "BI", "chi": -161.889, "glyco_bond": "anti", "C5prime_xyz": [ -1.554, 8.725, 0.538 ], "P_xyz": [ 0.983, 9.204, 0.927 ], "form": "A", "ssZp": 4.298, "Dp": 4.572, "splay_angle": 21.396, "splay_distance": 3.382, "splay_ratio": 0.186, "d22": null, "d64": null, "eta": 169.639, "theta": -149.169, "eta_prime": -176.600, "theta_prime": -148.673, "eta_base": -133.088, "theta_base": -119.623, "v0": 1.165, "v1": -25.441, "v2": 38.720, "v3": -39.099, "v4": 23.938, "amplitude": 40.489, "phase_angle": 16.999, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.976, "filter_rmsd": 0.039, "frame": { "rmsd": 0.009, "origin": [ 2.042, 22.036, 17.823 ], "x_axis": [ -0.082, 0.204, -0.975 ], "y_axis": [ 0.902, 0.432, 0.014 ], "z_axis": [ 0.424, -0.879, -0.220 ], "quaternion": [ 0.531, 0.420, 0.658, -0.328 ] } }, { "index": 30, "index_chain": 9, "chain_name": "B", "nt_resnum": 32, "nt_name": "C", "nt_code": "C", "nt_id": "///B/32", "linked_nts": [ "///B/31", "///B/33" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -61.824, "beta": 163.829, "gamma": 55.474, "delta": 81.624, "epsilon": -157.455, "zeta": -68.973, "epsilon_zeta": -88.482, "bb_type": "BI", "chi": -161.678, "glyco_bond": "anti", "C5prime_xyz": [ -1.394, 8.782, 0.543 ], "P_xyz": [ 1.194, 9.128, 0.456 ], "form": "A", "ssZp": 4.396, "Dp": 4.586, "splay_angle": 23.811, "splay_distance": 3.765, "splay_ratio": 0.208, "d22": 4.314, "d64": 4.237, "eta": 165.985, "theta": -145.459, "eta_prime": -178.870, "theta_prime": -146.312, "eta_base": -134.064, "theta_base": -121.350, "v0": 2.229, "v1": -26.624, "v2": 39.553, "v3": -39.204, "v4": 23.356, "amplitude": 41.041, "phase_angle": 15.478, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.928, "filter_rmsd": 0.062, "frame": { "rmsd": 0.006, "origin": [ 2.314, 18.965, 16.433 ], "x_axis": [ 0.423, 0.403, -0.812 ], "y_axis": [ 0.833, 0.181, 0.524 ], "z_axis": [ 0.358, -0.897, -0.259 ], "quaternion": [ 0.580, 0.612, 0.504, -0.185 ] } }, { "index": 31, "index_chain": 10, "chain_name": "B", "nt_resnum": 33, "nt_name": "C", "nt_code": "C", "nt_id": "///B/33", "linked_nts": [ "///B/32", "///B/34" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -60.322, "beta": -176.830, "gamma": 45.525, "delta": 81.834, "epsilon": -159.186, "zeta": -70.933, "epsilon_zeta": -88.253, "bb_type": "BI", "chi": -155.552, "glyco_bond": "anti", "C5prime_xyz": [ -1.202, 8.761, 0.233 ], "P_xyz": [ 1.313, 9.156, 0.841 ], "form": ".", "ssZp": 4.184, "Dp": 4.538, "splay_angle": 17.795, "splay_distance": 3.291, "splay_ratio": 0.168, "d22": null, "d64": null, "eta": 173.917, "theta": -121.759, "eta_prime": -174.637, "theta_prime": -132.279, "eta_base": -136.963, "theta_base": -114.414, "v0": 3.322, "v1": -26.164, "v2": 37.777, "v3": -36.995, "v4": 21.314, "amplitude": 38.920, "phase_angle": 13.923, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.832, "filter_rmsd": 0.063, "frame": { "rmsd": 0.006, "origin": [ 2.881, 16.078, 14.084 ], "x_axis": [ 0.745, 0.587, -0.318 ], "y_axis": [ 0.466, -0.116, 0.877 ], "z_axis": [ 0.478, -0.802, -0.360 ], "quaternion": [ 0.563, 0.745, 0.353, 0.053 ] } }, { "index": 32, "index_chain": 11, "chain_name": "B", "nt_resnum": 34, "nt_name": "G", "nt_code": "G", "nt_id": "///B/34", "linked_nts": [ "///B/33", "///B/35" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": 135.013, "beta": -160.141, "gamma": -174.466, "delta": 81.999, "epsilon": -146.956, "zeta": -71.857, "epsilon_zeta": -75.099, "bb_type": "BI", "chi": -173.381, "glyco_bond": "anti", "C5prime_xyz": [ -1.282, 8.495, 1.284 ], "P_xyz": [ -0.106, 10.447, -0.034 ], "form": "A", "ssZp": 4.690, "Dp": 4.733, "splay_angle": 24.607, "splay_distance": 3.796, "splay_ratio": 0.217, "d22": null, "d64": null, "eta": 157.934, "theta": -173.604, "eta_prime": 174.712, "theta_prime": -166.535, "eta_base": -144.571, "theta_base": -130.774, "v0": 7.493, "v1": -30.973, "v2": 41.547, "v3": -38.144, "v4": 19.395, "amplitude": 42.007, "phase_angle": 8.484, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.685, "filter_rmsd": 0.005, "frame": { "rmsd": 0.005, "origin": [ 4.111, 15.059, 11.207 ], "x_axis": [ 0.830, 0.551, 0.086 ], "y_axis": [ 0.220, -0.465, 0.858 ], "z_axis": [ 0.512, -0.693, -0.507 ], "quaternion": [ 0.463, 0.837, 0.230, 0.179 ] } }, { "index": 33, "index_chain": 12, "chain_name": "B", "nt_resnum": 35, "nt_name": "G", "nt_code": "G", "nt_id": "///B/35", "linked_nts": [ "///B/34", "///B/36" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -58.481, "beta": 170.912, "gamma": 54.678, "delta": 82.537, "epsilon": -143.050, "zeta": -78.529, "epsilon_zeta": -64.521, "bb_type": "BI", "chi": -166.589, "glyco_bond": "anti", "C5prime_xyz": [ -1.318, 8.671, 0.838 ], "P_xyz": [ 1.265, 8.948, 1.162 ], "form": "A", "ssZp": 4.424, "Dp": 4.673, "splay_angle": 21.772, "splay_distance": 3.435, "splay_ratio": 0.190, "d22": null, "d64": null, "eta": 175.348, "theta": -144.293, "eta_prime": -169.375, "theta_prime": -143.342, "eta_base": -123.853, "theta_base": -117.849, "v0": 5.167, "v1": -29.043, "v2": 40.515, "v3": -38.532, "v4": 21.091, "amplitude": 41.348, "phase_angle": 11.520, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.955, "filter_rmsd": 0.008, "frame": { "rmsd": 0.008, "origin": [ 6.609, 14.347, 8.438 ], "x_axis": [ 0.786, 0.164, 0.597 ], "y_axis": [ -0.309, -0.732, 0.607 ], "z_axis": [ 0.536, -0.661, -0.524 ], "quaternion": [ 0.364, 0.872, -0.041, 0.325 ] } }, { "index": 34, "index_chain": 13, "chain_name": "B", "nt_resnum": 36, "nt_name": "U", "nt_code": "U", "nt_id": "///B/36", "linked_nts": [ "///B/35", "///B/37" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -60.107, "beta": 163.450, "gamma": 54.324, "delta": 81.366, "epsilon": -159.348, "zeta": -69.253, "epsilon_zeta": -90.095, "bb_type": "BI", "chi": -163.030, "glyco_bond": "anti", "C5prime_xyz": [ -1.469, 8.722, 0.580 ], "P_xyz": [ 1.122, 9.137, 0.544 ], "form": "A", "ssZp": 4.389, "Dp": 4.586, "splay_angle": 21.266, "splay_distance": 3.352, "splay_ratio": 0.187, "d22": null, "d64": null, "eta": 163.737, "theta": -147.642, "eta_prime": -179.204, "theta_prime": -149.677, "eta_base": -135.950, "theta_base": -126.204, "v0": 4.973, "v1": -29.870, "v2": 41.878, "v3": -39.877, "v4": 22.082, "amplitude": 42.794, "phase_angle": 11.881, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.910, "filter_rmsd": 0.105, "frame": { "rmsd": 0.008, "origin": [ 9.242, 13.306, 6.492 ], "x_axis": [ 0.481, -0.222, 0.848 ], "y_axis": [ -0.626, -0.764, 0.155 ], "z_axis": [ 0.614, -0.606, -0.506 ], "quaternion": [ 0.229, 0.829, -0.256, 0.441 ] } }, { "index": 35, "index_chain": 14, "chain_name": "B", "nt_resnum": 37, "nt_name": "G", "nt_code": "G", "nt_id": "///B/37", "linked_nts": [ "///B/36", "///B/38" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop,cap-acceptor,splayed-apart", "alpha": -63.625, "beta": -176.015, "gamma": 45.409, "delta": 82.365, "epsilon": -157.077, "zeta": -100.830, "epsilon_zeta": -56.247, "bb_type": "BI", "chi": -154.419, "glyco_bond": "anti", "C5prime_xyz": [ -1.186, 8.723, 0.210 ], "P_xyz": [ 1.371, 9.114, 0.646 ], "form": ".", "ssZp": 4.251, "Dp": 4.606, "splay_angle": 98.270, "splay_distance": 15.164, "splay_ratio": 0.759, "d22": null, "d64": null, "eta": 171.029, "theta": -140.379, "eta_prime": -178.573, "theta_prime": -166.686, "eta_base": -141.506, "theta_base": 173.678, "v0": 6.610, "v1": -28.450, "v2": 38.352, "v3": -35.659, "v4": 18.402, "amplitude": 38.845, "phase_angle": 9.145, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.814, "filter_rmsd": 0.008, "frame": { "rmsd": 0.008, "origin": [ 12.296, 12.528, 5.351 ], "x_axis": [ -0.003, -0.556, 0.831 ], "y_axis": [ -0.719, -0.576, -0.388 ], "z_axis": [ 0.694, -0.599, -0.399 ], "quaternion": [ 0.075, 0.702, -0.454, 0.543 ] } }, { "index": 36, "index_chain": 15, "chain_name": "B", "nt_resnum": 38, "nt_name": "A", "nt_code": "A", "nt_id": "///B/38", "linked_nts": [ "///B/37", "///B/39" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-pair-contact,internal-loop,phosphate,splayed-apart", "alpha": 121.624, "beta": 104.800, "gamma": 178.861, "delta": 82.705, "epsilon": -135.070, "zeta": -87.662, "epsilon_zeta": -47.408, "bb_type": "BI", "chi": -150.882, "glyco_bond": "anti", "C5prime_xyz": [ -1.516, 8.774, -0.120 ], "P_xyz": [ -2.304, 10.560, -1.852 ], "form": "B", "ssZp": 3.747, "Dp": 4.557, "splay_angle": 18.855, "splay_distance": 3.127, "splay_ratio": 0.172, "d22": null, "d64": null, "eta": 77.244, "theta": 149.856, "eta_prime": 72.252, "theta_prime": 174.084, "eta_base": 50.037, "theta_base": -136.991, "v0": 0.396, "v1": -23.601, "v2": 36.608, "v3": -37.547, "v4": 23.497, "amplitude": 38.536, "phase_angle": 18.202, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.009, "origin": [ 16.877, 10.731, -8.992 ], "x_axis": [ -0.173, 0.985, 0.009 ], "y_axis": [ -0.562, -0.106, 0.821 ], "z_axis": [ 0.809, 0.137, 0.571 ], "quaternion": [ 0.568, 0.301, 0.352, 0.680 ] } }, { "index": 37, "index_chain": 16, "chain_name": "B", "nt_resnum": 39, "nt_name": "A", "nt_code": "A", "nt_id": "///B/39", "linked_nts": [ "///B/38", "///B/40" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-pair-contact,internal-loop,phosphate,splayed-apart", "alpha": -57.889, "beta": 159.256, "gamma": 56.808, "delta": 93.599, "epsilon": -106.205, "zeta": -74.048, "epsilon_zeta": -32.157, "bb_type": "--", "chi": -117.996, "glyco_bond": "anti", "C5prime_xyz": [ -1.846, 8.256, -1.825 ], "P_xyz": [ 0.543, 8.055, -2.886 ], "form": ".", "ssZp": 1.560, "Dp": 4.438, "splay_angle": 107.798, "splay_distance": 14.950, "splay_ratio": 0.812, "d22": null, "d64": null, "eta": -175.144, "theta": -97.325, "eta_prime": -162.958, "theta_prime": -92.432, "eta_base": -121.155, "theta_base": -65.237, "v0": 1.241, "v1": -22.231, "v2": 33.341, "v3": -33.728, "v4": 20.616, "amplitude": 34.817, "phase_angle": 16.745, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.470, "filter_rmsd": 0.037, "frame": { "rmsd": 0.007, "origin": [ 18.404, 12.237, -6.716 ], "x_axis": [ -0.431, 0.781, 0.453 ], "y_axis": [ 0.019, -0.494, 0.869 ], "z_axis": [ 0.902, 0.383, 0.198 ], "quaternion": [ 0.261, 0.465, 0.430, 0.728 ] } }, { "index": 38, "index_chain": 17, "chain_name": "B", "nt_resnum": 40, "nt_name": "G", "nt_code": "G", "nt_id": "///B/40", "linked_nts": [ "///B/39", "///B/41" ], "nt_type": "RNA", "dbn": ")", "summary": "~C3'-endo,BI,isolated-canonical,non-pair-contact,helix,internal-loop,phosphate,splayed-apart", "alpha": -53.259, "beta": -167.278, "gamma": 62.476, "delta": 87.863, "epsilon": -147.859, "zeta": -64.921, "epsilon_zeta": -82.938, "bb_type": "BI", "chi": 167.716, "glyco_bond": "--", "C5prime_xyz": [ -1.041, 7.764, 2.386 ], "P_xyz": [ 1.512, 7.333, 2.867 ], "form": ".", "ssZp": 4.857, "Dp": 4.768, "splay_angle": 32.960, "splay_distance": 5.043, "splay_ratio": 0.300, "d22": null, "d64": null, "eta": -168.525, "theta": -130.294, "eta_prime": -143.879, "theta_prime": -127.451, "eta_base": -119.401, "theta_base": -114.478, "v0": 13.159, "v1": -34.433, "v2": 41.639, "v3": -34.794, "v4": 13.715, "amplitude": 41.640, "phase_angle": 0.410, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.114, "filter_rmsd": 0.018, "frame": { "rmsd": 0.018, "origin": [ 18.860, 10.033, 8.064 ], "x_axis": [ -0.821, -0.547, -0.165 ], "y_axis": [ 0.252, -0.088, -0.964 ], "z_axis": [ 0.513, -0.832, 0.210 ], "quaternion": [ -0.274, 0.120, -0.617, 0.728 ] } }, { "index": 39, "index_chain": 18, "chain_name": "B", "nt_resnum": 41, "nt_name": "U", "nt_code": "U", "nt_id": "///B/41", "linked_nts": [ "///B/40", "///B/42" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop", "alpha": -68.835, "beta": -160.575, "gamma": 53.010, "delta": 80.479, "epsilon": -154.734, "zeta": -74.287, "epsilon_zeta": -80.447, "bb_type": "BI", "chi": -166.983, "glyco_bond": "anti", "C5prime_xyz": [ -1.506, 8.646, 0.939 ], "P_xyz": [ 0.939, 9.027, 1.847 ], "form": "A", "ssZp": 4.587, "Dp": 4.638, "splay_angle": 20.392, "splay_distance": 3.197, "splay_ratio": 0.180, "d22": 4.385, "d64": 4.385, "eta": -178.461, "theta": -151.833, "eta_prime": -166.445, "theta_prime": -148.413, "eta_base": -138.392, "theta_base": -119.584, "v0": 4.074, "v1": -28.230, "v2": 40.292, "v3": -38.878, "v4": 21.992, "amplitude": 41.347, "phase_angle": 12.972, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.662, "filter_rmsd": 0.104, "frame": { "rmsd": 0.005, "origin": [ 19.087, 6.765, 11.898 ], "x_axis": [ -0.535, -0.532, -0.657 ], "y_axis": [ 0.618, 0.283, -0.733 ], "z_axis": [ 0.576, -0.798, 0.177 ], "quaternion": [ 0.481, 0.034, 0.640, -0.598 ] } }, { "index": 40, "index_chain": 19, "chain_name": "B", "nt_resnum": 42, "nt_name": "C", "nt_code": "C", "nt_id": "///B/42", "linked_nts": [ "///B/41", "///B/43" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop", "alpha": -62.201, "beta": 168.453, "gamma": 54.838, "delta": 82.102, "epsilon": -158.792, "zeta": -70.222, "epsilon_zeta": -88.570, "bb_type": "BI", "chi": -162.555, "glyco_bond": "anti", "C5prime_xyz": [ -1.289, 8.757, 0.607 ], "P_xyz": [ 1.313, 9.060, 0.610 ], "form": "A", "ssZp": 4.440, "Dp": 4.589, "splay_angle": 26.488, "splay_distance": 4.141, "splay_ratio": 0.231, "d22": null, "d64": null, "eta": 167.981, "theta": -147.388, "eta_prime": -177.728, "theta_prime": -147.062, "eta_base": -135.183, "theta_base": -125.379, "v0": 3.465, "v1": -28.289, "v2": 41.003, "v3": -39.909, "v4": 22.970, "amplitude": 42.232, "phase_angle": 13.855, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.954, "filter_rmsd": 0.063, "frame": { "rmsd": 0.003, "origin": [ 19.342, 3.795, 13.054 ], "x_axis": [ -0.096, -0.328, -0.940 ], "y_axis": [ 0.879, 0.415, -0.235 ], "z_axis": [ 0.467, -0.849, 0.249 ], "quaternion": [ 0.626, 0.245, 0.562, -0.482 ] } }, { "index": 41, "index_chain": 20, "chain_name": "B", "nt_resnum": 43, "nt_name": "G", "nt_code": "G", "nt_id": "///B/43", "linked_nts": [ "///B/42", "///B/44" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -65.951, "beta": -175.797, "gamma": 51.458, "delta": 84.391, "epsilon": -147.347, "zeta": -74.201, "epsilon_zeta": -73.146, "bb_type": "BI", "chi": -163.328, "glyco_bond": "anti", "C5prime_xyz": [ -1.376, 8.721, 0.691 ], "P_xyz": [ 1.141, 9.045, 1.378 ], "form": "A", "ssZp": 4.382, "Dp": 4.597, "splay_angle": 21.617, "splay_distance": 3.531, "splay_ratio": 0.190, "d22": null, "d64": null, "eta": 175.346, "theta": -141.373, "eta_prime": -174.340, "theta_prime": -139.541, "eta_base": -141.232, "theta_base": -114.227, "v0": 2.404, "v1": -24.973, "v2": 36.911, "v3": -36.526, "v4": 21.483, "amplitude": 38.229, "phase_angle": 15.090, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.881, "filter_rmsd": 0.006, "frame": { "rmsd": 0.006, "origin": [ 19.716, -0.282, 13.676 ], "x_axis": [ 0.260, 0.126, -0.957 ], "y_axis": [ 0.774, 0.566, 0.285 ], "z_axis": [ 0.578, -0.815, 0.049 ], "quaternion": [ 0.685, 0.401, 0.560, -0.236 ] } }, { "index": 42, "index_chain": 21, "chain_name": "B", "nt_resnum": 44, "nt_name": "C", "nt_code": "C", "nt_id": "///B/44", "linked_nts": [ "///B/43", null ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack", "alpha": -59.539, "beta": 170.564, "gamma": 50.619, "delta": 75.267, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": -154.878, "glyco_bond": "anti", "C5prime_xyz": [ -1.521, 8.906, 0.154 ], "P_xyz": [ 1.033, 9.525, 0.179 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": -2.627, "v1": -22.414, "v2": 37.534, "v3": -40.054, "v4": 26.824, "amplitude": 40.533, "phase_angle": 22.179, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.876, "filter_rmsd": 0.062, "frame": { "rmsd": 0.001, "origin": [ 20.685, -3.476, 12.523 ], "x_axis": [ 0.600, 0.448, -0.662 ], "y_axis": [ 0.588, 0.314, 0.745 ], "z_axis": [ 0.542, -0.837, -0.075 ], "quaternion": [ 0.678, 0.584, 0.444, -0.052 ] } } ], "num_hbonds": 92, "hbonds": [ { "index": 1, "atom1_serNum": 12, "atom2_serNum": 28, "donAcc_type": "acceptable", "distance": 2.892, "atom1_id": "///A/2/O2'", "atom2_id": "///A/3/O5'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 2, "atom1_serNum": 12, "atom2_serNum": 31, "donAcc_type": "acceptable", "distance": 3.115, "atom1_id": "///A/2/O2'", "atom2_id": "///A/3/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 3, "atom1_serNum": 19, "atom2_serNum": 899, "donAcc_type": "standard", "distance": 2.879, "atom1_id": "///A/2/O6", "atom2_id": "///B/44/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 4, "atom1_serNum": 20, "atom2_serNum": 897, "donAcc_type": "standard", "distance": 2.857, "atom1_id": "///A/2/N1", "atom2_id": "///B/44/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 5, "atom1_serNum": 22, "atom2_serNum": 896, "donAcc_type": "standard", "distance": 2.706, "atom1_id": "///A/2/N2", "atom2_id": "///B/44/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 6, "atom1_serNum": 39, "atom2_serNum": 879, "donAcc_type": "standard", "distance": 2.816, "atom1_id": "///A/3/O2", "atom2_id": "///B/43/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 7, "atom1_serNum": 40, "atom2_serNum": 877, "donAcc_type": "standard", "distance": 2.800, "atom1_id": "///A/3/N3", "atom2_id": "///B/43/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 8, "atom1_serNum": 42, "atom2_serNum": 876, "donAcc_type": "standard", "distance": 2.674, "atom1_id": "///A/3/N4", "atom2_id": "///B/43/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 9, "atom1_serNum": 62, "atom2_serNum": 856, "donAcc_type": "standard", "distance": 2.805, "atom1_id": "///A/4/O6", "atom2_id": "///B/42/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 10, "atom1_serNum": 63, "atom2_serNum": 854, "donAcc_type": "standard", "distance": 2.792, "atom1_id": "///A/4/N1", "atom2_id": "///B/42/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 11, "atom1_serNum": 65, "atom2_serNum": 853, "donAcc_type": "standard", "distance": 2.677, "atom1_id": "///A/4/N2", "atom2_id": "///B/42/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 12, "atom1_serNum": 82, "atom2_serNum": 834, "donAcc_type": "standard", "distance": 3.366, "atom1_id": "///A/5/O2", "atom2_id": "///B/41/N3", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 13, "atom1_serNum": 83, "atom2_serNum": 836, "donAcc_type": "standard", "distance": 3.162, "atom1_id": "///A/5/N3", "atom2_id": "///B/41/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 14, "atom1_serNum": 85, "atom2_serNum": 984, "donAcc_type": "acceptable", "distance": 2.613, "atom1_id": "///A/5/O4", "atom2_id": "///B/50/O62", "atom_pair": "O:O", "residue_pair": "nt:ligand" }, { "index": 15, "atom1_serNum": 90, "atom2_serNum": 998, "donAcc_type": "acceptable", "distance": 2.687, "atom1_id": "///A/6/OP2", "atom2_id": "///B/50/O34", "atom_pair": "O:O", "residue_pair": "nt:ligand" }, { "index": 16, "atom1_serNum": 102, "atom2_serNum": 816, "donAcc_type": "standard", "distance": 2.670, "atom1_id": "///A/6/O2", "atom2_id": "///B/40/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 17, "atom1_serNum": 103, "atom2_serNum": 814, "donAcc_type": "standard", "distance": 2.827, "atom1_id": "///A/6/N3", "atom2_id": "///B/40/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 18, "atom1_serNum": 105, "atom2_serNum": 813, "donAcc_type": "standard", "distance": 2.877, "atom1_id": "///A/6/N4", "atom2_id": "///B/40/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 19, "atom1_serNum": 125, "atom2_serNum": 972, "donAcc_type": "standard", "distance": 3.095, "atom1_id": "///A/7/N6", "atom2_id": "///B/50/O51", "atom_pair": "N:O", "residue_pair": "nt:ligand" }, { "index": 20, "atom1_serNum": 126, "atom2_serNum": 974, "donAcc_type": "questionable", "distance": 2.548, "atom1_id": "///A/7/N1", "atom2_id": "///B/50/O61", "atom_pair": "N:O", "residue_pair": "nt:ligand" }, { "index": 21, "atom1_serNum": 144, "atom2_serNum": 749, "donAcc_type": "standard", "distance": 2.832, "atom1_id": "///A/8/O2", "atom2_id": "///B/37/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 22, "atom1_serNum": 145, "atom2_serNum": 747, "donAcc_type": "standard", "distance": 2.995, "atom1_id": "///A/8/N3", "atom2_id": "///B/37/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 23, "atom1_serNum": 147, "atom2_serNum": 746, "donAcc_type": "standard", "distance": 3.240, "atom1_id": "///A/8/N4", "atom2_id": "///B/37/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 24, "atom1_serNum": 167, "atom2_serNum": 703, "donAcc_type": "standard", "distance": 3.258, "atom1_id": "///A/9/N6", "atom2_id": "///B/35/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 25, "atom1_serNum": 167, "atom2_serNum": 726, "donAcc_type": "standard", "distance": 3.057, "atom1_id": "///A/9/N6", "atom2_id": "///B/36/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 26, "atom1_serNum": 168, "atom2_serNum": 724, "donAcc_type": "standard", "distance": 2.764, "atom1_id": "///A/9/N1", "atom2_id": "///B/36/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 27, "atom1_serNum": 186, "atom2_serNum": 706, "donAcc_type": "standard", "distance": 2.662, "atom1_id": "///A/10/O2", "atom2_id": "///B/35/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 28, "atom1_serNum": 187, "atom2_serNum": 704, "donAcc_type": "standard", "distance": 2.842, "atom1_id": "///A/10/N3", "atom2_id": "///B/35/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 29, "atom1_serNum": 189, "atom2_serNum": 703, "donAcc_type": "standard", "distance": 3.056, "atom1_id": "///A/10/N4", "atom2_id": "///B/35/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 30, "atom1_serNum": 206, "atom2_serNum": 683, "donAcc_type": "standard", "distance": 2.769, "atom1_id": "///A/11/O2", "atom2_id": "///B/34/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 31, "atom1_serNum": 207, "atom2_serNum": 681, "donAcc_type": "standard", "distance": 2.811, "atom1_id": "///A/11/N3", "atom2_id": "///B/34/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 32, "atom1_serNum": 209, "atom2_serNum": 680, "donAcc_type": "standard", "distance": 2.768, "atom1_id": "///A/11/N4", "atom2_id": "///B/34/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 33, "atom1_serNum": 229, "atom2_serNum": 660, "donAcc_type": "standard", "distance": 2.907, "atom1_id": "///A/12/O6", "atom2_id": "///B/33/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 34, "atom1_serNum": 230, "atom2_serNum": 658, "donAcc_type": "standard", "distance": 2.921, "atom1_id": "///A/12/N1", "atom2_id": "///B/33/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 35, "atom1_serNum": 232, "atom2_serNum": 657, "donAcc_type": "standard", "distance": 2.815, "atom1_id": "///A/12/N2", "atom2_id": "///B/33/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 36, "atom1_serNum": 237, "atom2_serNum": 940, "donAcc_type": "acceptable", "distance": 3.530, "atom1_id": "///A/13/OP2", "atom2_id": "///A/51/O44", "atom_pair": "O:O", "residue_pair": "nt:ligand" }, { "index": 37, "atom1_serNum": 252, "atom2_serNum": 618, "donAcc_type": "standard", "distance": 3.297, "atom1_id": "///A/13/O6", "atom2_id": "///B/31/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 38, "atom1_serNum": 252, "atom2_serNum": 640, "donAcc_type": "standard", "distance": 2.967, "atom1_id": "///A/13/O6", "atom2_id": "///B/32/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 39, "atom1_serNum": 253, "atom2_serNum": 638, "donAcc_type": "standard", "distance": 2.941, "atom1_id": "///A/13/N1", "atom2_id": "///B/32/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 40, "atom1_serNum": 255, "atom2_serNum": 637, "donAcc_type": "standard", "distance": 2.911, "atom1_id": "///A/13/N2", "atom2_id": "///B/32/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 41, "atom1_serNum": 273, "atom2_serNum": 619, "donAcc_type": "standard", "distance": 2.804, "atom1_id": "///A/14/N3", "atom2_id": "///B/31/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 42, "atom1_serNum": 275, "atom2_serNum": 618, "donAcc_type": "standard", "distance": 3.050, "atom1_id": "///A/14/O4", "atom2_id": "///B/31/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 43, "atom1_serNum": 275, "atom2_serNum": 944, "donAcc_type": "standard", "distance": 2.694, "atom1_id": "///A/14/O4", "atom2_id": "///A/51/N64", "atom_pair": "O:N", "residue_pair": "nt:ligand" }, { "index": 44, "atom1_serNum": 295, "atom2_serNum": 598, "donAcc_type": "standard", "distance": 2.920, "atom1_id": "///A/15/O6", "atom2_id": "///B/30/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 45, "atom1_serNum": 295, "atom2_serNum": 933, "donAcc_type": "acceptable", "distance": 2.701, "atom1_id": "///A/15/O6", "atom2_id": "///A/51/O53", "atom_pair": "O:O", "residue_pair": "nt:ligand" }, { "index": 46, "atom1_serNum": 296, "atom2_serNum": 596, "donAcc_type": "standard", "distance": 2.876, "atom1_id": "///A/15/N1", "atom2_id": "///B/30/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 47, "atom1_serNum": 298, "atom2_serNum": 595, "donAcc_type": "standard", "distance": 2.871, "atom1_id": "///A/15/N2", "atom2_id": "///B/30/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 48, "atom1_serNum": 303, "atom2_serNum": 908, "donAcc_type": "acceptable", "distance": 2.648, "atom1_id": "///A/16/OP2", "atom2_id": "///A/51/O31", "atom_pair": "O:O", "residue_pair": "nt:ligand" }, { "index": 49, "atom1_serNum": 324, "atom2_serNum": 919, "donAcc_type": "standard", "distance": 2.657, "atom1_id": "///A/17/OP1", "atom2_id": "///A/51/N32", "atom_pair": "O:N", "residue_pair": "nt:ligand" }, { "index": 50, "atom1_serNum": 325, "atom2_serNum": 910, "donAcc_type": "acceptable", "distance": 2.690, "atom1_id": "///A/17/OP2", "atom2_id": "///A/51/O41", "atom_pair": "O:O", "residue_pair": "nt:ligand" }, { "index": 51, "atom1_serNum": 346, "atom2_serNum": 919, "donAcc_type": "standard", "distance": 2.852, "atom1_id": "///A/18/OP1", "atom2_id": "///A/51/N32", "atom_pair": "O:N", "residue_pair": "nt:ligand" }, { "index": 52, "atom1_serNum": 359, "atom2_serNum": 919, "donAcc_type": "standard", "distance": 2.757, "atom1_id": "///A/18/N7", "atom2_id": "///A/51/N32", "atom_pair": "N:N", "residue_pair": "nt:ligand" }, { "index": 53, "atom1_serNum": 362, "atom2_serNum": 556, "donAcc_type": "standard", "distance": 2.825, "atom1_id": "///A/18/O6", "atom2_id": "///B/28/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 54, "atom1_serNum": 363, "atom2_serNum": 554, "donAcc_type": "standard", "distance": 2.881, "atom1_id": "///A/18/N1", "atom2_id": "///B/28/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 55, "atom1_serNum": 365, "atom2_serNum": 553, "donAcc_type": "standard", "distance": 2.815, "atom1_id": "///A/18/N2", "atom2_id": "///B/28/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 56, "atom1_serNum": 383, "atom2_serNum": 536, "donAcc_type": "standard", "distance": 2.748, "atom1_id": "///A/19/N3", "atom2_id": "///B/27/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 57, "atom1_serNum": 385, "atom2_serNum": 916, "donAcc_type": "unknown", "distance": 2.890, "atom1_id": "///A/19/O4", "atom2_id": "///A/51/N12", "atom_pair": "O:N", "residue_pair": "nt:ligand" }, { "index": 58, "atom1_serNum": 402, "atom2_serNum": 516, "donAcc_type": "standard", "distance": 2.887, "atom1_id": "///A/20/O2", "atom2_id": "///B/26/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 59, "atom1_serNum": 403, "atom2_serNum": 514, "donAcc_type": "standard", "distance": 2.910, "atom1_id": "///A/20/N3", "atom2_id": "///B/26/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 60, "atom1_serNum": 405, "atom2_serNum": 513, "donAcc_type": "standard", "distance": 2.816, "atom1_id": "///A/20/N4", "atom2_id": "///B/26/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 61, "atom1_serNum": 405, "atom2_serNum": 959, "donAcc_type": "standard", "distance": 2.901, "atom1_id": "///A/20/N4", "atom2_id": "///A/51/O27", "atom_pair": "N:O", "residue_pair": "nt:ligand" }, { "index": 62, "atom1_serNum": 425, "atom2_serNum": 493, "donAcc_type": "standard", "distance": 2.844, "atom1_id": "///A/21/O6", "atom2_id": "///B/25/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 63, "atom1_serNum": 425, "atom2_serNum": 962, "donAcc_type": "standard", "distance": 2.762, "atom1_id": "///A/21/O6", "atom2_id": "///A/51/N47", "atom_pair": "O:N", "residue_pair": "nt:ligand" }, { "index": 64, "atom1_serNum": 426, "atom2_serNum": 491, "donAcc_type": "standard", "distance": 2.788, "atom1_id": "///A/21/N1", "atom2_id": "///B/25/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 65, "atom1_serNum": 428, "atom2_serNum": 490, "donAcc_type": "standard", "distance": 2.609, "atom1_id": "///A/21/N2", "atom2_id": "///B/25/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 66, "atom1_serNum": 445, "atom2_serNum": 473, "donAcc_type": "standard", "distance": 2.570, "atom1_id": "///A/22/O2", "atom2_id": "///B/24/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 67, "atom1_serNum": 446, "atom2_serNum": 471, "donAcc_type": "standard", "distance": 2.768, "atom1_id": "///A/22/N3", "atom2_id": "///B/24/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 68, "atom1_serNum": 448, "atom2_serNum": 470, "donAcc_type": "standard", "distance": 2.833, "atom1_id": "///A/22/N4", "atom2_id": "///B/24/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 69, "atom1_serNum": 541, "atom2_serNum": 938, "donAcc_type": "acceptable", "distance": 2.778, "atom1_id": "///B/28/OP2", "atom2_id": "///A/51/O34", "atom_pair": "O:O", "residue_pair": "nt:ligand" }, { "index": 70, "atom1_serNum": 576, "atom2_serNum": 912, "donAcc_type": "standard", "distance": 3.017, "atom1_id": "///B/29/N6", "atom2_id": "///A/51/O51", "atom_pair": "N:O", "residue_pair": "nt:ligand" }, { "index": 71, "atom1_serNum": 577, "atom2_serNum": 914, "donAcc_type": "questionable", "distance": 2.636, "atom1_id": "///B/29/N1", "atom2_id": "///A/51/O61", "atom_pair": "N:O", "residue_pair": "nt:ligand" }, { "index": 72, "atom1_serNum": 666, "atom2_serNum": 1058, "donAcc_type": "acceptable", "distance": 3.468, "atom1_id": "///B/34/O5'", "atom2_id": "///B/55/O34", "atom_pair": "O:O", "residue_pair": "nt:ligand" }, { "index": 73, "atom1_serNum": 687, "atom2_serNum": 1056, "donAcc_type": "standard", "distance": 2.872, "atom1_id": "///B/35/OP1", "atom2_id": "///B/55/N24", "atom_pair": "O:N", "residue_pair": "nt:ligand" }, { "index": 74, "atom1_serNum": 688, "atom2_serNum": 1000, "donAcc_type": "acceptable", "distance": 3.510, "atom1_id": "///B/35/OP2", "atom2_id": "///B/50/O44", "atom_pair": "O:O", "residue_pair": "nt:ligand" }, { "index": 75, "atom1_serNum": 726, "atom2_serNum": 1004, "donAcc_type": "standard", "distance": 2.758, "atom1_id": "///B/36/O4", "atom2_id": "///B/50/N64", "atom_pair": "O:N", "residue_pair": "nt:ligand" }, { "index": 76, "atom1_serNum": 746, "atom2_serNum": 993, "donAcc_type": "acceptable", "distance": 2.689, "atom1_id": "///B/37/O6", "atom2_id": "///B/50/O53", "atom_pair": "O:O", "residue_pair": "nt:ligand" }, { "index": 77, "atom1_serNum": 754, "atom2_serNum": 968, "donAcc_type": "acceptable", "distance": 2.630, "atom1_id": "///B/38/OP2", "atom2_id": "///B/50/O31", "atom_pair": "O:O", "residue_pair": "nt:ligand" }, { "index": 78, "atom1_serNum": 775, "atom2_serNum": 979, "donAcc_type": "standard", "distance": 2.728, "atom1_id": "///B/39/OP1", "atom2_id": "///B/50/N32", "atom_pair": "O:N", "residue_pair": "nt:ligand" }, { "index": 79, "atom1_serNum": 776, "atom2_serNum": 970, "donAcc_type": "acceptable", "distance": 2.621, "atom1_id": "///B/39/OP2", "atom2_id": "///B/50/O41", "atom_pair": "O:O", "residue_pair": "nt:ligand" }, { "index": 80, "atom1_serNum": 798, "atom2_serNum": 979, "donAcc_type": "standard", "distance": 2.710, "atom1_id": "///B/40/OP2", "atom2_id": "///B/50/N32", "atom_pair": "O:N", "residue_pair": "nt:ligand" }, { "index": 81, "atom1_serNum": 810, "atom2_serNum": 979, "donAcc_type": "standard", "distance": 2.760, "atom1_id": "///B/40/N7", "atom2_id": "///B/50/N32", "atom_pair": "N:N", "residue_pair": "nt:ligand" }, { "index": 82, "atom1_serNum": 836, "atom2_serNum": 976, "donAcc_type": "unknown", "distance": 3.092, "atom1_id": "///B/41/O4", "atom2_id": "///B/50/N12", "atom_pair": "O:N", "residue_pair": "nt:ligand" }, { "index": 83, "atom1_serNum": 856, "atom2_serNum": 1019, "donAcc_type": "standard", "distance": 2.955, "atom1_id": "///B/42/N4", "atom2_id": "///B/50/O27", "atom_pair": "N:O", "residue_pair": "nt:ligand" }, { "index": 84, "atom1_serNum": 876, "atom2_serNum": 1022, "donAcc_type": "standard", "distance": 2.637, "atom1_id": "///B/43/O6", "atom2_id": "///B/50/N47", "atom_pair": "O:N", "residue_pair": "nt:ligand" }, { "index": 85, "atom1_serNum": 906, "atom2_serNum": 926, "donAcc_type": "standard", "distance": 2.836, "atom1_id": "///A/51/N21", "atom2_id": "///A/51/O13", "atom_pair": "N:O", "residue_pair": "ligand:ligand" }, { "index": 86, "atom1_serNum": 966, "atom2_serNum": 986, "donAcc_type": "standard", "distance": 2.830, "atom1_id": "///B/50/N21", "atom2_id": "///B/50/O13", "atom_pair": "N:O", "residue_pair": "ligand:ligand" }, { "index": 87, "atom1_serNum": 1000, "atom2_serNum": 1004, "donAcc_type": "acceptable", "distance": 2.937, "atom1_id": "///B/50/O44", "atom2_id": "///B/50/N64", "atom_pair": "O:N", "residue_pair": "ligand:ligand" }, { "index": 88, "atom1_serNum": 1026, "atom2_serNum": 1046, "donAcc_type": "standard", "distance": 3.216, "atom1_id": "///B/55/N21", "atom2_id": "///B/55/O13", "atom_pair": "N:O", "residue_pair": "ligand:ligand" }, { "index": 89, "atom1_serNum": 1026, "atom2_serNum": 1053, "donAcc_type": "acceptable", "distance": 2.934, "atom1_id": "///B/55/N21", "atom2_id": "///B/55/O53", "atom_pair": "N:O", "residue_pair": "ligand:ligand" }, { "index": 90, "atom1_serNum": 1032, "atom2_serNum": 1039, "donAcc_type": "standard", "distance": 2.699, "atom1_id": "///B/55/O51", "atom2_id": "///B/55/N32", "atom_pair": "O:N", "residue_pair": "ligand:ligand" }, { "index": 91, "atom1_serNum": 1044, "atom2_serNum": 1048, "donAcc_type": "acceptable", "distance": 3.156, "atom1_id": "///B/55/O62", "atom2_id": "///B/55/O23", "atom_pair": "O:O", "residue_pair": "ligand:ligand" }, { "index": 92, "atom1_serNum": 1044, "atom2_serNum": 1067, "donAcc_type": "acceptable", "distance": 2.824, "atom1_id": "///B/55/O62", "atom2_id": "///B/55/N25", "atom_pair": "O:N", "residue_pair": "ligand:ligand" } ], "refCoords": { "purine": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 -0.5000 0.4000", " 3 N -2.2500 -0.5000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 1.2500 5.0000 0.4000", " 6 C 1.2500 -0.5000 0.4000", " 7 C 1.2500 -0.5000 -0.4000", " 8 C 1.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 -0.5000 0.4000", " 11 C -2.2500 -0.5000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ], "pyrimidine": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 1.0000 0.4000", " 3 N -2.2500 1.0000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 1.2500 5.0000 0.4000", " 6 C 1.2500 1.0000 0.4000", " 7 C 1.2500 1.0000 -0.4000", " 8 C 1.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 1.0000 0.4000", " 11 C -2.2500 1.0000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ], "wc_pair": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 -5.0000 0.4000", " 3 N -2.2500 -5.0000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 2.2500 5.0000 0.4000", " 6 C 2.2500 -5.0000 0.4000", " 7 C 2.2500 -5.0000 -0.4000", " 8 C 2.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 -5.0000 0.4000", " 11 C -2.2500 -5.0000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ] }, "metadata": { "license": "http://innovation.columbia.edu/technologies/CU20391", "url": "http://x3dna.org/", "url_alt": "http://home.x3dna.org/", "forum": "http://forum.x3dna.org/", "citation": "Lu et al. (2015). 'DSSR: an integrated software tool for dissecting the spatial structure of RNA.' Nucleic Acids Res., 43(21):e142 [doi:10.1093/nar/gkv716].", "str_id": "2pwt", "num_naChains": 2, "naChains": "A=21,B=21", "num_atoms": 1286, "num_waters": 206, "num_notes": 52, "notes": [ { "Aminors": "A-minor interactions (including types I and II)" }, { "Cstem_index": "stem index of the 'Canonical' helix in k-turn" }, { "Cstem_pair": "Cstem bp delineating the k-turn internal loop" }, { "Dp": "perpendicular distance of the 3' P atom to the glycosidic bond" }, { "GA_pair": "sheared G-A pair in k-turn" }, { "HtypePknot": "H-type pseudoknot" }, { "Kturn": "kink-turn (k-turn)" }, { "LW": "Leontis-Westhof" }, { "NCstem_index": "stem index of the 'Non-Canonical' helix in k-turn" }, { "NCstem_pair": "NCstem bp delineating the k-turn internal loop" }, { "Uturn": "U-turn of the UNR- or GNRA-type" }, { "aa": "amino acid" }, { "atom_pair": "symbols of the two atoms involved in an H-bond" }, { "auxfiles": "auxiliary files" }, { "glyco_bond": "conformation of base related to sugar (syn or anti)" }, { "bb_type": "backbone conformation, BI or BII" }, { "bending_angle": "angle between two helical axes" }, { "bp": "base pair" }, { "bseq": "base sequence in one-letter code" }, { "bulge": "bulge loop" }, { "coaxStacks": "coaxial stacking of stems within a helix" }, { "dbn": "dot bracket notation" }, { "desc": "description" }, { "donAcc_type": "donor/acceptor type of the atom pair in an H-bond" }, { "epsilon_zeta": "difference between epsilon and zeta torsion angles" }, { "hairpin": "hairpin loop" }, { "hbond": "hydrogen bond (H-bond)" }, { "helix": "defined by base-stacking interactions, regardless of bp type and backbone connectivity" }, { "id": "identifier" }, { "iloop": "internal loop" }, { "index": "serial number" }, { "isoCanonPairs": "isolated canonical pairs" }, { "junction": "(multi-branched) junction loop" }, { "kissingLoop": "kissing loop" }, { "multiplet": "3+ bases in a coplanar geometry" }, { "na": "nucleic acid" }, { "nonPair": "two nts not forming a pair, but with H-bonding/stacking interactions" }, { "nonStack": "nucleotide not involved in stacking interactions" }, { "nt": "nucleotide" }, { "num": "number" }, { "oArea": "overlap areas between two bases, including exocyclic atoms" }, { "oArea_ring": "overlap areas between two bases, including only ring atoms" }, { "phosContacts": "H-bonding and atom-capping interactions involving a phosphate" }, { "residue_pair": "types of the two residues involved in an H-bond" }, { "rmsd": "root-mean-squares deviation" }, { "serNum": "serial number" }, { "ssSegments": "single-stranded segments not involved in loops" }, { "ssZp": "Z-coordinate of the 3' phosphorus atom with reference to the 5' base plane" }, { "sstr": "secondary structure in dbn" }, { "stem": "helix consisting of only canonical pairs, with a continuous backbone" }, { "str_id": "structure identifier, derived from inpfile with extension removed" }, { "vert_dist": "vertical distance from an atom to a base plane" } ], "num_auxfiles": 15, "auxfiles": [ { "index": 1, "name": "dssr-pairs.pdb", "desc": "an ensemble of base pairs" }, { "index": 2, "name": "dssr-stems.pdb", "desc": "an ensemble of stems" }, { "index": 3, "name": "dssr-helices.pdb", "desc": "an ensemble of helices (coaxial stacking)" }, { "index": 4, "name": "dssr-iloops.pdb", "desc": "an ensemble of internal loops" }, { "index": 5, "name": "dssr-2ndstrs.bpseq", "desc": "secondary structure in bpseq format" }, { "index": 6, "name": "dssr-2ndstrs.ct", "desc": "secondary structure in connectivity table format" }, { "index": 7, "name": "dssr-2ndstrs.dbn", "desc": "secondary structure in dot-bracket notation" }, { "index": 8, "name": "dssr-torsions.txt", "desc": "backbone torsion angles and suite names" }, { "index": 9, "name": "dssr-splays.pdb", "desc": "an ensemble of splayed-apart units" }, { "index": 10, "name": "dssr-stacks.pdb", "desc": "an ensemble of base stacks" }, { "index": 11, "name": "dssr-atom2bases.pdb", "desc": "an ensemble of atom-base stacking interactions" }, { "index": 12, "name": "dssr-rotmat.txt", "desc": "position vector and rotation matrix" }, { "index": 13, "name": "dssr-viewV.pdb", "desc": "vertical view of the principal moment of inertia" }, { "index": 14, "name": "dssr-viewH.pdb", "desc": "horizontal view of the principal moment of inertia" }, { "index": 15, "name": "dssr-viewT.pdb", "desc": "top view of the principal moment of inertia" } ], "time_used": "999" } }